changeset 0:4c8f32256fa8 draft

planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/canu commit b7904bf39167833b3d3648e250726615f75f7525
author bgruening
date Fri, 08 Jun 2018 04:43:41 -0400
parents
children 58346ef3116b
files canu.xml test-data/bowtie2-fq1.fq test-data/canu_contigs_result1.fa test-data/canu_contigs_result2.fa test-data/canu_corrected_reads.fa.gz test-data/canu_unassembled_result1.fa test-data/canu_unassembled_result2.fa test-data/canu_unitigs_result1.fa test-data/canu_unitigs_result2.fa test-data/ecoli-reads.fasta test-data/ecoli_canu_contigs.fa test-data/ecoli_canu_unitigs.fa test-data/ecoli_unassembled.fa
diffstat 13 files changed, 3469 insertions(+), 0 deletions(-) [+]
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/canu.xml	Fri Jun 08 04:43:41 2018 -0400
@@ -0,0 +1,172 @@
+<tool id="canu" name="Canu assembler" version="1.7">
+    <description>Assembler optimized for long error-prone reads such as PacBio, Oxford Nanopore </description>
+    <requirements>
+        <requirement type="package" version="1.7">canu</requirement>
+    </requirements>
+    <version_command>canu --version</version_command>
+    <command detect_errors="exit_code">
+    <![CDATA[
+
+    #for $counter, $input in enumerate($inputs):
+        #if $input.ext in ['fastq.gz', 'fasta.gz']
+            ## linking does not work
+            cp '$input' ./input_${counter}.gz &&
+        #end if
+    #end for
+
+    canu
+        $stage
+        -p canu
+        -d out_dir
+        #if $s:
+            -s '$s'
+        #end if
+        genomeSize=$genomeSize
+        #if $rawErrorRate:
+            rawErrorRate=$rawErrorRate
+        #end if
+        #if $correctedErrorRate:
+            correctedErrorRate=$correctedErrorRate
+        #end if
+        minReadLength=$minReadLength
+        minOverlapLength=$minOverlapLength
+        corOutCoverage=$corOutCoverage
+        contigFilter='
+            ${contigFilter.minReads}
+            ${contigFilter.minLength}
+            ${contigFilter.singleReadSpan}
+            ${contigFilter.lowCovSpan}
+            ${contigFilter.lowCovDepth}
+        '
+        genomeSize=$genomeSize
+        stopOnReadQuality=false
+        minThreads=\${GALAXY_SLOTS:-4}
+        maxThreads=\${GALAXY_SLOTS:-4}
+        obtovlThreads=\${GALAXY_SLOTS:-4}
+        utgovlThreads=\${GALAXY_SLOTS:-4}
+        batThreads=\${GALAXY_SLOTS:-4}
+        batMemory=\${GALAXY_MEMORY_MB:-7}
+        cormhapMemory=\${GALAXY_MEMORY_MB:-7}
+        obtovlMemory=\${GALAXY_MEMORY_MB:-7}
+        utgovlMemory=\${GALAXY_MEMORY_MB:-7}
+        gfaThreads=\${GALAXY_SLOTS:-4}
+        corThreads=\${GALAXY_SLOTS:-4}
+        cnsThreads=\${GALAXY_SLOTS:-4}
+        gnuplotTested=true
+        useGrid=false
+        $mode
+        #for $counter, $input in enumerate($inputs):
+            #if $input.ext in ['fastq.gz', 'fasta.gz']
+                ./input_${counter}.gz
+            #else:
+                '$input'
+            #end if
+        #end for
+        2>&1
+    ]]>
+    </command>
+    <inputs>
+        <param name="inputs" type="data" format="fasta,fasta.gz,fastq,fastq.gz" multiple="true" label="Input reads" />
+        <param name="mode" type="select" label="Mode">
+            <option value="-nanopore-raw" selected="true">Nanopore raw</option>
+            <option value="-nanopore-corrected">Nanopore corrected</option>
+            <option value="-pacbio-raw">PacBio raw</option>
+            <option value="-pacbio-corrected">PacBio corrected</option>
+        </param>
+        <param name="stage" type="select" label="To restrict canu to only a specific stage, use">
+            <option value="" selected="true">all</option>
+            <option value="-correct">generate corrected reads</option>
+            <option value="-trim">generate trimmed reads</option>
+            <option value="-assemble">generate an assembly</option>
+            <option value="-trim-assemble">generate trimmed reads and then assemble them</option>
+        </param>
+        <param argument="genomeSize" type="text" label="Estimated genome size (e.g. 80m, 15k, 2g)" />
+        <param argument="rawErrorRate" type="float" value="" optional="true" min="0" max="1"
+            label="Maximum raw overlap mismatch" help="The defaults are 0.300 for PacBio reads and 0.500 for Nanopore reads." />
+        <param argument="correctedErrorRate" type="float" value="" optional="true" min="0" max="1"
+            label="Maximum corrected overlap mismatch" help="The allowed difference in an overlap between two corrected reads.  Assemblies of
+                low coverage or data with biological differences will benefit from a slight increase
+                in this.  Defaults are 0.045 for PacBio reads and 0.144 for Nanopore reads." />
+        <param argument="minReadLength" type="integer" value="1000" min="1" label="Minimum read length" />
+        <param argument="minOverlapLength" type="integer" value="500" min="1" label="Minimum overlap" />
+        <param argument="corOutCoverage" type="integer" value="40" min="1" label="Target coverage for corrected reads" />
+        <param argument="-s" type="data" format="txt" optional="true" label="Additonal options" help="Additional specifications provided in a canu spec file." />
+
+        <section name="contigFilter" title="Contig Filters">
+            <param argument="minReads" type="integer" value="2" min="0" label="Minimum reads" />
+            <param argument="minLength" type="integer" value="0" min="0" label="Minimum length" />
+            <param argument="singleReadSpan" type="float" value="1.0" min="0.0" max="1.0" label="Maximum single read span (fraction)" />
+            <param argument="lowCovSpan" type="float" value="0.5" min="0.0" max="1.0" label="Low coverage span (fraction)" />
+            <param argument="lowCovDepth" type="integer" value="5" min="0" label="Low coverage depth" />
+        </section>
+    </inputs>
+    <outputs>
+        <data name="contigs" format="fasta" from_work_dir="out_dir/canu.contigs.fasta" label="${tool.name} on ${on_string} (contigs)">
+        </data>
+        <data name="unassembled" format="fasta" from_work_dir="out_dir/canu.unassembled.fasta" label="${tool.name} on ${on_string} (contigs)">
+        </data>
+        <data name="unitigs" format="fasta" from_work_dir="out_dir/canu.unitigs.fasta" label="${tool.name} on ${on_string} (unitigs)">
+        </data>
+        <data name="corrected_reads" format="fasta.gz" from_work_dir="out_dir/canu.correctedReads.fasta.gz" label="${tool.name} on ${on_string} (unitigs)">
+        </data>
+    </outputs>
+    <tests>
+        <test>
+            <!-- test multiple input -->
+            <param name="inputs" ftype="fasta" value="ecoli-reads.fasta"/>
+            <param name="genomeSize" value="4.6m" />
+            <param name="minReadLength" value="2000" />            
+            <output name="contigs" ftype="fasta" file="ecoli_canu_contigs.fa"/>
+            <output name="unitigs" ftype="fasta" file="ecoli_canu_unitigs.fa"/>
+            <output name="unassembled" ftype="fasta" file="ecoli_unassembled.fa"/>
+        </test>
+
+        <test >
+            <!-- test multiple input -->
+            <param name="inputs" ftype="fasta" value="ecoli-reads.fasta"/>
+            <param name="genomeSize" value="4.6m" />
+            <param name="minReadLength" value="2000" />
+            <param name="minOverlapLength" value="800" />
+            <param name="rawErrorRate" value="0.2" />
+            <param name="correctedErrorRate" value="0.05" />
+            <param name="corOutCoverage" value="2" />
+            <output name="contigs" ftype="fasta" file="canu_contigs_result1.fa"/>
+            <output name="unitigs" ftype="fasta" file="canu_unitigs_result1.fa"/>
+            <output name="unassembled" ftype="fasta" file="canu_unassembled_result1.fa"/>
+        </test>
+        <test>
+            <!-- test multiple input -->
+            <param name="inputs" ftype="fasta" value="ecoli-reads.fasta"/>
+            <param name="minReadLength" value="2000" />
+            <param name="stage" value="-correct"/>
+            <param name="genomeSize" value="4.6m" />
+            <section name="contigFilter">
+                <param name="minReads" value="10" />
+            </section>
+            <output name="corrected_reads" ftype="fasta.gz" decompress="True" file="canu_corrected_reads.fa.gz"/>
+        </test>
+    </tests>
+    <help>
+    <![CDATA[
+
+        Canu specializes in assembling PacBio or Oxford Nanopore sequences. Canu operates in three phases: correction, trimming and assembly.
+        The correction phase will improve the accuracy of bases in reads. The trimming phase will trim reads to the portion that appears to
+        be high-quality sequence, removing suspicious regions such as remaining SMRTbell adapter. The assembly phase will order the reads
+        into contigs, generate consensus sequences and create graphs of alternate paths.
+
+        For eukaryotic genomes, coverage more than 20x is enough to outperform current hybrid methods, however, between 30x and 60x
+        coverage is the recommended minimum. More coverage will let Canu use longer reads for assembly, which will result in better assemblies.
+
+        http://canu.readthedocs.io
+
+    ]]>
+    </help>
+    <citations>
+        <citation type="doi">10.1101/gr.215087.116</citation>
+        <citation type="doi">10.1093/bioinformatics/btw753</citation>
+        <citation type="doi">10.1038/nbt.3238</citation>
+        <citation type="doi">10.1126/science.287.5461.2196</citation>
+        <citation type="doi">10.1038/nmeth.4035</citation>
+        <citation type="doi">10.1038/nmeth.2474</citation>
+    </citations>
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/bowtie2-fq1.fq	Fri Jun 08 04:43:41 2018 -0400
@@ -0,0 +1,400 @@
+@M01368:8:000000000-A3GHV:1:1101:6911:8255/1
+ATCTGGTTCCTACTTCAGGGCCATAAAACCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATCCTATTATTTATCGCACCTACGTTCAATATT
++
+BCCCCFFFFFFFGGGGGGGGGGGHHHHGHGHHHHHHHHHGGGGGGHHHHGHHHHHHHHHHGHHHHHHGGHGGHHHGHHHHFHHGHHHHHHHHHGHEHEFFGHHEGGCEFGGFHHHBGHHGHHHHGHFHHHGHGHGHGGCDFDDACGGGGGGGAAFFFFFFFFFBAFFFFFB;FFFFFFADDFFFFFFFFFFEFFFFFFFFFFBFFFFFFFFFFFFFFEFFFFFFFFBFEFFFFEFE;DFFFDFBFF/9BFB
+@M01368:8:000000000-A3GHV:1:1101:14518:9998/1
+GTTATTATTATGTCCTACAAGCATTAATTAATTAACACACTTTAGTAAGTATGTTCGCCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGGGATAGACCTGTGATCCATCGTGAT
++
+AAAAAFFFFFFFGGGGGGGGGGHGGHHHHGHHHHHHHGCGHHHHHHHHHHHHHHHGGGGGHHHHHHHHHGHHGFHFE5BGEEHFGGGHHHHHHHHFBHHGGGGFHGHHFGHHHHGHHHHHHGEGGGGFHFHGEGHHGGCDGDGHGGGDGGHGGCGGGHGHHH/ACDG?.1FGCDCCGCA.CC@CDCHFHGFFGGGEBFGAB//CEFBFGG.:;D;;A0AFFFFFB..:@ABFF//;BFFFFFBF/9D:A//
+@M01368:8:000000000-A3GHV:1:1101:18422:19051/1
+GTATCCGACATCTGGTTCCTACTTCAGGGTCATAAAACCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATCCTATTATTTATCGCACCTACG
++
+CCCCCFDDDDDFGGGGGGGGGGHHHHHHHHHHHHHHHHGHHHHHHFHHHHGGGGHHHHHHHHHGHHHHHHHHHHHHGGHGGHHHHHHHHHHHHHHHHHHHHHHHHHHHGHHHHHGCGGGHHHHHHHHHHHHHHHHHHHHHHGFDHGFHCFGGGGFGGFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF;FFFFFFFFFFFFFFFFFFFFFFFFFFFFEFBFFFFFFFFFF:FFF.
+@M01368:8:000000000-A3GHV:1:1101:25545:21098/1
+ATTAATTAACACACTTTAGTAAGTATGTTCGCCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATAAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGGCTTATTTAAGGGGAACGGGTGGGG
++
+33AA?DFD5BDFGGGFEBDGEGHEGHGEGHCEGGHHCHGHHFFHHGFGAGE53FF2FAFFGDE5FFFE5GFBFGAEE1GHHHGHHHEHE3FGHF@GEGEGGHHGG3FAGFFDE?EEE3GFEGFGFGGCG?GHHHFHGGGC@DHFFHD/A<C@EGFDCGGGHFHHHEGFGHBFHG0:CEHFCHGGED.;0CEF.F99B0CFFEEFGGG0FBFBBF0F/FFBDE?/9//9B.FFBFFFFFFBF..A..;@B--
+@M01368:8:000000000-A3GHV:1:1101:5446:12248/1
+AATTAACACACTTTAGTAAGTATGTTCGCCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGGGGAACGTGTGGGCTAT
++
+CCCCDFFFFCCFGGGGGGGGFGHHHHHGGGGHHHHHHHHHHHHHHHHGBGHGGHGGHHHHHHHHHHGHGHGGGGGHHHHHHHHGHHHHHHHHHGGGGGHHHHFFGHHHGGGGGGHHHGFGGHHGGGGHHHHHHGGGGGGHGHHGGGGGGGHGGGGGGHHHHHHHHHHHHHFHGGGHHHHGGGGGG:FE;EGEGGGGG/;?FGGGGGGGFFFFGGFFFFFFFFFBFFFFFFFFFFBFFFFFFEFFFFFEFFF
+@M01368:8:000000000-A3GHV:1:1101:5861:6452/1
+ATTATGTCCTACAAGCATTAATTAATTAACACACTTTAGTAAGTATGTTCGCCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTT
++
+ABCCCFFFFFFFGGGGGGGGGGHHHHHHHHHHHGHHHHGHHHHHHHHHHHGGGGHHHHHHHHFHHHHHHGGHGHGGHGGHHHHHHHGGHFHHHGGGGGHHHHHHHHHHHHHHHHHHGGGGGHHHHHEGGHHGGGGGGHHHGGGGHGGGGGHHHHHHGGGDCGHHHHGGGGGGGHEFGGGGHGHHHGHGGGFGGGGGGGEGGGGGGG?E0CEFGGGGGFEE9EEFFFFFBFFFFFFFBFFBD.AFFFFFFF0
+@M01368:8:000000000-A3GHV:1:1102:10403:6021/1
+CGCTCCGGGCCCATAACACTTGGGGGTAGCTAAAGTGAACTGTATCCGACATCTGGTTCCTACTTCAGGGTCATAAAACCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTG
++
+>A@AAAAD2ADDFFGGGGGFGGHA?EAEFBEAGHFABFGG5FDF5DB1EEGAFDFB53FF5FH@G5FFEHGHEFHFFHBE333GF43GCGGGGE@0?BFGGB0B?FHGFDGGHHHBFFDEGGHGFFFDFE@<1>@FFFGHHHHFHEFGDABFFGG/@DCE<CG1<GF0/DD000=<DHGBDFDCECE/:AC?-;-;9B/ABBB-AD9BFB99AB?BDFBAD-.9..@;=;;..9..9/9;BEF;A:9/BFF
+@M01368:8:000000000-A3GHV:1:1102:10677:23253/1
+CCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATCCTATTATTTATCGCACCTACGTTCAATATTACAGGCGAACATACTTACTAAAGTGTGTTAATTCTGTCTCTTATACACA
++
+ABBBBFFFFFFFGGGGGGGCGGGHHHHHGHHHHHHHHHGHHHHHHHHHHHGHHHHHGGGGGHGHHHHHHHHHHHHHBGFHHHHGHGHGGHGGGCGGGHHHGGGGGGGHHHGHGGGGGGGGGGGGGGGGGGGGFFFFFFFFFFFFFFDFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFBFFFFFFFFFEDBDFFFFFFFEFFFE0F0FBFFFF0FFFFFFFFFFFFFFFFF:
+@M01368:8:000000000-A3GHV:1:1102:13809:1733/1
+ATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGGGGAACGTGAGGGCTATTTAGGTTTTATGCTGTCTCTTATACACATCTCCG
++
+BCCBCFFFFFBFGGGGGGGGGGHHHHHHHHHHHGHHGGGGGH3EHHHGHGHHHHHHHHHGGCEGGGHHHGGGFHGGGGGGHHGEAEFHHGGGGHHHHHHGGGGGGHHHHGGGGGGGHGGCFFGHHFGHHHGHHHHHHCHGFHHHHGGHGGG00EHGHHHGFHHGEHGHFFFHHGGFHHHGGGGGGGGGB;;CFFGGFGFFBFFDFED;E.:A?DFFFFFFFF:FFFFF0BFFBBBFFFFFBFF0BFBF9F.
+@M01368:8:000000000-A3GHV:1:1102:17584:10050/1
+ATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGTTTTATGACCTGTCTCTTATACACATCTCCGAGCCCACGAGACTAAGGCGAATCTCGTATGCCGTCTTCT
++
+CCCCCFFFFFFFGGGGGGGGGGGHHHHHGGHHHGGGGGGHHHGFGDHHGGGGHHHHHHGGGGGGHHHHGGGGGGGHGGGEGGHHHHHHHGHGHHGHHHHGHHHHGGGGFDGHFHGEHHHHHHGFFHHHHHHHHHHHHHHHHHGGHHHHHHHHHHFHHHHHHGGGGGHHHHGGGHHGHHHGGGGGGGGGGGFGFFGGGGGGGCFGGGFGGGGGGGFFFFFFFFFFFFFFFFFFF;.BF9ADF/9;A;DFFF0
+@M01368:8:000000000-A3GHV:1:1102:18842:24844/1
+CACTTGGGGGTAGCTAAAGTGAACTGTATCCGACATCTGGTTCCTACTTCAGGGTCATAAAACCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCT
++
+BBBCBFF@CCBBGGGGGGGGGGHHGHGGHHHGGGGGHHHHHHHHHHHHHHHHHHHHHHHHHHHGHHHHHHFHHHHGGGGGHHHHHHHHHHHHHHHHHHHHGGGHGGHHHHHHGHBFGHHHHHHHHBGHHHHHHGHGGGHFGCGGFHHFHFFHHBHHHHFFHFHHHHGGDHGGBC?;@DFBFFFFFFFFFBFFFFFFFFFFFFFF.B?FB.@;;DFFFFFFFFFFFEE-A./BBBFBFBFFF//BFB/BFF/
+@M01368:8:000000000-A3GHV:1:1102:21788:11027/1
+GCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATCCTATTATTTATCGCACCTACGTTCAATATTACAGGCGAACATACTTACTAAAGTGTGTTAATTCTG
++
+ABCCBCCBBFFFGGGGGGGGGGGHGHHHHHHGGHGGHHHHHHHHGHHHHHHHHHHHHHHHHHHGHHHHHFGGGGHHHHHHHHHHHHHHHHHHHHHHGHGHGGFCGGCGGGHHHGGGGGGGGGGGGGGGGGGGGGGGGGFFFFFFFFFFFFFFFFFFFFFDFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFEF9EFFFFFFFFFFFBFF0FFBBBBFBFBFFFF0
+@M01368:8:000000000-A3GHV:1:1102:5728:8777/1
+ATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGTTTTATGACCCTGAAGTAGGAACCAGATG
++
+BBBBBFFFFFAFGG5GGGGGGGHHHGHHHHHHHHHHGGGGGHHHHHHGHHHHHHFGHHHGGGGGFHGHGGGHHHGGGCEGHHGG?F1BGGGGGHHHHHGGGGEGGHHHHGGGGGCGHGGGGCGHHHHHHHHHHHHHHHHGGHHHHGGCEEDFDEGGHHHHHHHCEHHFHHHHGHGFHHHFFGGGFFFGGFGBGFFFFFFFFGFDGGD9EFA.DAFA/;FEFF9FB?/BBF/FFFFBBFFFFF/FFEFFFBB
+@M01368:8:000000000-A3GHV:1:1102:5983:21093/1
+GTATCCGACATCTGGTTCCTACTTCAGGGTCATAAAACCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATCCTATTATTTATCGCACCTACG
++
+AAABCFCABBCFGGGGGGGGGGHHHHHHGFHHHHHHHHGGHHHGHGHHHGGGGFHHHHHHHHGHHHHHHHHHHHHHGGHGGHHHHHHFHGGHHHHFHGHHEHHHHHHHGHHHHHD@FGGHHHHHFFFHHGGHGH?DHHHHHGHGHEGG/@?ADGFGGFFFFAFFFFFFFFFFFFFFFFFFFFFFFAAFFFFFFDFFFFFFFF;D9BFFFFFFFFFFFFFFFFFEFFFBBFFF0BFFFBBFF0EFFFFFFFA
+@M01368:8:000000000-A3GHV:1:1102:7765:18353/1
+CTCCGGGCCCATAACACTTGGGGGTAGCTAAAGTGAACTGTATCCGACATCTGGTTCCTACTTCAGGGTCATAAAACCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTC
++
+CCDCCCCCCBCFGGGGGGGGGGGGGGGHHHHHHDHHHHHHHHHHHGGGGGHHGHGHHHGHHHHHHFHHHHGHHHHHHGHGHHHGHHHHHGGGGHHHHHHHHHHHHHHHHHHHHHHGGHGGHHHHHHHGFFHHHHHGHHHHHHHHHHHGHHHHHGCFGGHGHFHHGHGHGHHHHGGFHHHHGGGHGBFGCC=BFFFFFFFF-@DFFFFFFFFFFFFFFFFFFFFFFAFFAEF.::FBFBFFE-A9:BFFFF0
+@M01368:8:000000000-A3GHV:1:1103:10405:17879/1
+GTATCCGACATCTGGTTCCTACTTCAGGGTCATAAAACCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATCCTATTATTTATCGCACCTACG
++
+CBCCCFCCCCCFGGGGGGGGGGHHHHHHHHHHHHGHHHGHHHHHHHHHHHGGGGGGHHHHHHHHHHHHHHHHHHHHGGHGGHHHGHHGHHGHHHHHHHHHCGGFHHHHGHHHHHGCFGGHHGHHHHHHGFHHHGHHHHHHHGHGHGFF/CC?ADAFGFFFFFFFFFFFFFFDFFFFFFFFAFFFFFFFFFFFEDFFFFFFFFFFAFFFFFFFFFFFFFFFFFFFFFFBBFBFBFFFFFFFFFFFFFFFFF?
+@M01368:8:000000000-A3GHV:1:1103:13493:8205/1
+GTAGCTAAAGTGAACTGTATCCGACATCTGGTTCCTACTTCAGGGTCATAAAACCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATCCTATT
++
+CCCCCFFFFFFFGGGGGGGGGGGGGGGHFHHHHHHHHHHHHHHHHGHHHHHHHHGHHHIHHHHHHHGGGGFHHHHHHHHHHHHHHHHHHHGHGGHGGHHHHHHHHHGHHHHHHHHHHHHHHHHHGHHHH/FGGGGHHHHHHHGGEHHHHHGHHHHHHGHGHEFEFGGFFFFFFFFFFFFFFFFFFFFFAFDFFFFFAFFFF;;@FFEFFFFFFFFFFE=?AFFFFFFFFFFFFFFFFFFBFBBBFFFFEFF
+@M01368:8:000000000-A3GHV:1:1103:14060:21273/1
+GTATCCGACATCTGGTTCCTACTTCAGGGTCATAAAACCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATCCTATTACTGTCTCTTATACAC
++
+AAABAFCCCCCFGGGGGGGGGGHHHHHHHHHHHHHHHHGHHHHHHGHHHHGGGGGFHHHHHHHHHHHHHHHGHHHHGGHGGHHHHHHHHHHHHHHHHHH?GGHHHHHHGHHHHHFEGGGHHHHHHHHHHHHHHHGFHHHFHGHGHGFGCGG@@BCFGFFFFFFF?FFFFFFFFAFFFAD?@FFEEFFFFFFFFFFFFFFFFFFD9BFF/B/FFF/:/9FB9/BFA//;BFB:FFFBB/BFFFFFBFFFFB/
+@M01368:8:000000000-A3GHV:1:1103:14528:12993/1
+GCCCATAACACTTGGGGGTAGCTAAAGTGAACTGTATCCGACATCTGGTTCCTACTTCAGGGTCATAAAACCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGAT
++
+BBBBBFFFBDFFGFBCG2EGFFGHHCF5AFHHHFHFHHHGG?CEHBHHDGFHHGHHGHBGHABFFBGHGDGGGFHGHHGGHHHGGG@E1GEHHHGHHFHH3FEDHHHHGFGHGFHHGHFBGA?FGHHHHHGHHFFGHFDFGGHHH2??<ECFHHGHHHHHHHHHGHH<1DFGHGC<.FCB/<=@DCFFFFFEDA=-AAB9B/9B9B-@?.-;A-AFF.=-=BFEFEDEFFFBFEA-A.B//9F9F//;BBB
+@M01368:8:000000000-A3GHV:1:1103:17657:20856/1
+AAAGCGAACTGTATCCGACATCTGGTTCCTACTTCAGGGTCATAAAACCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATCCTATTATTTAT
++
+ABB?AABBBBFFGGGGGGGGGGHHHHHHHHGHHHHHHHHHHHHHHHHHGHHHHHHGHHHHGGGGGHHHHHHHGHHFHHHHHHHHHHGGGGGHHHHHHHH3BGGHHHHHHHEHHHHHHHGHHHHGEEGGGHHHHHHHHGHHFHGHGHGHGHHCHGGECCDFGB@AFFFFFFFFFFFFFFFFFDAFFFFFFFFFFFFFCAF;AFFFFEFFBBEFFF9FBBFFFFFFFFFFEFFFFFFFFFFFFF/FFFFBFF9
+@M01368:8:000000000-A3GHV:1:1103:23099:3794/1
+AAGACAGATACTGCGACATAGGGTGTTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCTCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGTTTTATGACCCTGAAGCTGTCTCTTATACACATCTCCGAGCCCACGAGACTAAGGCGAATCTCGGATGCCGTCT
++
+BBBBBFFFFFFFGGEEGGFGGGGCFGEHCGGGGGGFHFFEDEHFGGDEHHHHHHGGFECGHHHHGFEFGCGHGGFGGGHBGFH3/BF3GGGHHEEEHHG22???BCFFFFFFHHFHFF@FGHH11GHHHHFGFHHHHGGHHHHEFFGFGHFG1DGFGGGGEDCCCAEGGFFHHFHHHHHHCFBBFGBFFF/0;B0B00;B0BBFGBB9BFGEFGGGFFDEEAB;BDDBFBFFFFF@;.9BF..;-./-A=F
+@M01368:8:000000000-A3GHV:1:1103:25465:20010/1
+GACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATCGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGTTCTGTCTCTTATACACATCTCCGAGCCCACGAGACTAAGGCGAATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAAAAACAACAGAC
++
+ABBBBFFFFBAAGGGFEFGGGGHHFEFFHFGGGGGHHHGHFGGGGGHHHGGGGGGGGHGEEEGGHHHGFHEHFHDGHGHEHGF?FGG?GGGGHHGHF4F?2?DDCDHGHHHHHFG2@FGHHHGH?CFGGHFHFHHHHGDDGGHGGGGGHGFH.<AFAGHHHFHGHHFCGFHHHHHGHHHHBGHHGGDGAGF.CEGCFDGGGGGEFFF=B.FFFEFFFFFFADF?/9//BFF.B/;:>---;--..;.../9
+@M01368:8:000000000-A3GHV:1:1103:25519:6301/1
+AAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGCATCTGTCTTTGATTCCTGCCTCATCCTATTATTTATCGCACCTACGTTCAATATTACAGCTGTCTCTTATACACATCTCCGAGCCCACGAGACTAAGGCGAATTTCGT
++
+3A3AAFFFFBFFGGG2CF?4FGHGHHCHGGHHBHGFFAGGHHFFHHCGHFEGCECEGHFFFHGHHGFGHFGDAFDGFFEEFEGGBECC/<A@DFBBEGC--:;GHHHGBECG@:9-9.-9C/ABB?B@?.EDAFFFFBAFBFBFBFFFFF//;BBFFFF/;/9BBF/BBFBFFFFFFFFFEFF??BF/.AF./;B/9FFFFFFBFBFFFBFFFBFFFFF/BF/A---9.9A-B?DFFF/B/B?---.//;.
+@M01368:8:000000000-A3GHV:1:1103:6074:6549/1
+TAACACTTGGGGGTAGCTAAAGTGAACTGTATCCGACATCTGGTTCCTACTTCAGGGTCATAAAACCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTG
++
+CCCBCFFFFFCCGGGGGGGGGG5GFHHHHHGHHHGGGGGHHHGHHHHHHHHHHHHGHHHHHHHHHGGHHHHGHHHHHHGGGGHHHHHHHHHHHHHHGHHHHHHHGGHGGHHHHHHHFGHHGHGHHHHHHHHHHHHHGHHHHHGGGGCHHHHEHGHHHEGHHHFGGHHHHGHGHGHF@CCBDFAFFFFFF-CDFFFFFFFFFFFFFAFFFFFEFF;BFF?FEDFFFFFFFF-A./FFFFFFFFFFFF/BFF/
+@M01368:8:000000000-A3GHV:1:1104:11572:8264/1
+GTATCCGACATCTGGTTCCTACTTCAGGGTCATAAAACCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATCCTATTATTTATCGCACCTACG
++
+BABCBFBACCCFGGGGGGGGGGGHHGHHGHHHHGFGCHGHHGFFHEHHHHGGGGFGHHHHHHHHHHHHGHHHHHHHGGGGGHHHFFHHGHHHHHHHHHHHEHHHHHHHGHHGHGGEGEGHHHFHHHHGHHHHHHGGHHHHHGHGEGEHCGG-BGDFGFFFFAFFDFFFFEFFCFFDDFFFFFFFEC>;>=EF?AEFFFF;9;=DAFFFFBBFFFBFFF//;BFB.:FBFFBB/BFFFF/BFFE?EFAFEF9
+@M01368:8:000000000-A3GHV:1:1104:11928:24197/1
+ACGTAGGTGCGATAAATAATGGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGTTTTATGACCCTGAAGTAGGAACCAGATGTCGGATA
++
+CDDCCFCFFFBCGGGGGGGGGGHHHGHHHGGGGGHHHHHHHHHHHHHHHHHHGGGGGHHHHGGGHHHGGGGGGHHHGGGGHHGGGGHHHHHHGGGGGGHHHHGGGGGGGHGGGGGGHHHHHHHHHGHHHHGHHGHHHHGGHGEEGGGGFHHFHHHGHGEHHHHHHHHHHHHHHHHHGGGGGGFGGGGGGGGFFGGGFGFGAEFEFGFEAFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF@D9
+@M01368:8:000000000-A3GHV:1:1104:12288:20635/1
+CACTTGGGGGTAGCTAAAGTGAACTGTATCCGACATCTGGTTCCTACTTCAGGGTCATAAAACCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGCCGCAGCATCTGTCTTTGATTCCTGCCT
++
+ABA?AFBAB2>AFGGGGFFGD5GGHGFFHGHEGGGGHHHHFFHH5FHGHHHFFHEFHHHHHHGGHHHHHGFHGGHGGGGFHGGGFBHHHFGEGHHHHGHGGGGECEHHFHHGHHFFHFGGGHHHEGHDGHHGHGHFHHHECGCBCHHGFHHFHD1GFHEFHEF?GDCFFEFE0A@;@>BD/9BFBBBBFDFFFF99D=?>DDBFF-AFFEBB9BBEFEFAFFF//-@---;;FBBFBFB///;99999BA9
+@M01368:8:000000000-A3GHV:1:1104:13832:4398/1
+CACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCCTGTCTCTTATACACATCTCCGAGCCCACGAGACTAAGGCGAATCTCGTATGCCGTCTTCTGCTTGACAAAAAAAAACACACAACAACCAACACCCAGTAGACTAGTGCGTC
++
+AAABABCAFFFFGGGGGGGGGGHFHHHHHHHHHGFFHHGGHGGGGGHHHHHHHHHHFHHHHGHHHHHGGHGHGGHGGGGGGGHGFFGGGGDGGHHHHGGGGFGGGGGCFGGEGCDGGGGGGGGGGGGEGF?;BFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFF/FFFFFFC.;BFEAFFFFF;@FFBFFFFEF?/FFFFE----:...:...9....9.9...:.9//9////;/9-.-
+@M01368:8:000000000-A3GHV:1:1104:23670:4161/1
+ATTCAATTGTTATTATTATGTCCTACAAGCATTAATTAATTAACACACTTTAGTAAGTATGTTCGCCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCC
++
+AAAABFFFFFFFGGGGGGGCGBBGGHHHHHHHHHGHHHHHHHHHHFGGHHHHHHGGFHHHHHHHGGGGGFHHHGHHHHHGHHHHGHHGGGHGGGGHHHHHGHHHHHHEGGGFHHHGFFDGEGHGHFHGHHGEGGGHHBGHGGHGHGGGGG/@FCDFDGFHGGGDFFHFGFFGGGGGHHHHGGGGGGGEGCDG?GGBFFFEE00BFFGABBBAFGGGEGEA.9FFF/./;BFBF./AAF/BFFBBF/F/BFB
+@M01368:8:000000000-A3GHV:1:1104:24927:22253/1
+AGCTAAAGTGAACTGTATCCGACATCTGGTTCCTACTTCAGGGTCATAAAACCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATCCTATTAT
++
+AAA?AFFF3DFFFGGBGFF3EAEEEHFHHFHHHGHHHHDGHHGAEFGHHHGFCHHGHHHBGHHHAEGGHGGFHFBFHHHHHHHHHHFHH1EEHEEHH1FFDEEFCGHBGHHFHEHHHHHH1FCGHHHHEEFGEEGFFCHHH11>GHHF/FG2DGGCGAGGHGGGG@@@BEFFF?@@@FFEFFFFFF?@@FB@BB@FFFE=;==---A9EFBBB/;E;A9B/B/FFFEF/B///;/;9/A/;/9BFFFBFBB
+@M01368:8:000000000-A3GHV:1:1104:4705:7727/1
+CTACAAGCATTAATTAATTAACACACTTTAGTAAGTATGTTCGCCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGGG
++
+BBBBBFFBFFFFGGGGGGGGGGHHHGHHHGHHHHH6GHHHHFFGGGHHHHHHHHHHHHHHHGGFGGGEGGGHHHHHHHHHHGHE3FGGGGHHHHHFHHHHHHHHHHHHGGGGGHHFHFCGFHHGGGGGGGHHGGGGHHGGGGGGHHHHGGGADCHHHHGDGGGGGGGGC@DGFHEHHHHHHGHHHHGFGDEGFGFFGGGGCFGBEGFGGGFG;C.BFFFFFFFBFBFFFF/F?.AFFF/BFFEFFFFFEFF
+@M01368:8:000000000-A3GHV:1:1104:7756:4776/1
+GGCCCATAACACTTGGGGGTAGCTAAAGTGAACTGTATCCGACATCTGGTTCCTACTTCAGGGTCATAAAACCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGA
++
+CCCCCCFFFFFFGGGGGGGEEFHHHHGHGHHHHHHGGHHHGGGGGGHHGHHHHHGHHGHHHGGFHHHHHHHHGHHHFHHGHHGFGGGGHHHHHHHHGHGHFFHFHHHHHHGGHGFGFHHHGHG?FGHHHHHHHHHHHHHHGHGHHGHGGCDGFFHHHHGHHHHHGHHHGFHGHFHGHGHGH/@CABFFFFFFFACAFF?BBFFBFD-@-.D>FFAF.F.:9---;AADFFFFFBEFFF:9FFFFBBFFFF/
+@M01368:8:000000000-A3GHV:1:1105:11310:21761/1
+ATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGTTTTATGACCCTGAAGTAGGAACCAGATGTCGGATACAGTTCACTTT
++
+CCCCBFFFFFFFGGGGGGGGGGGHHHHHHHHHHHHGHHHHHGGGGGHHHHHGGHHHGGGGGGHHHGGGGHHGGGGHHHHHHGGGGGGHHHHGGGGGGGHGGGGGGHHHHGHHHGHHHGHGHHGHHHHGGHGGG=FFGEHHHHHGHFGGHHGHHHHHFHHHHHHHGGHHHHHHHGHEHHGHHHHHGGGGF9AGE?DEGFFGGGGGGGGGGGGGGFFFF/9FFBFFFFFFFEFFFBFFFFFFFFFFFFEFFF0
+@M01368:8:000000000-A3GHV:1:1105:11578:14676/1
+ATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGTTTTATGACCCTGAAGTAGGAACCAGATGTC
++
+CDDDDFFFBFFCGGGGGGGGGGHHHHHHHHHHHHGGGGGHHHHHHHHHHHHHHHHHHGGGGGHHHHFGGHHHGGGGGGHHHGGGGHHGGGGHHHHHHGGGGGGHHHHGGGGGGGHGGGGGGHHHHHHHHHHHHHHHHHGHHHHGGGGGGHGGHGHHHHHHH;CHHHHHHHHHHHHHHHGHGGGGFGGGFGGGGGGGGGGGGFGGGEGGFFFFFFFFFFFFFFFFFFFFFFFFF/FFFFFFFFFFFFFFFF0
+@M01368:8:000000000-A3GHV:1:1105:13575:19255/1
+TTAGTAAGTATGTTCGCCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGTTCCCGTGAGTGGTTAATAGGGTGATAGGCCTGTGATCCATCGTGATGTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGTTTTATG
++
+AA1A1DFFFFFBGG3A111FFAEGDDBGFDHF00F01BBA00BFGEHFBFFA1FABB0FAE?CFHF1BGFHFB0011F121E//>>1F10>B?EFHGCC/?/BFG/EEGFFEE//BCFDE0?E@@B/?11</?//<@?/F<<<A-<FBGH0.00=G0<<C//./0;;GC....<C.=.00;;BB./:.900////.C000;0090;..//000;C/;;/B/9BA9A9-AEEFF?B---;B99//9/;A//9
+@M01368:8:000000000-A3GHV:1:1105:15502:11453/1
+GTCCTACAAGCATTAATTAATTAACACACTTTAGTAAGTATGTTCGCCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCTGTCTCTTATACACATCTC
++
+A3AAAFFFFFCFGGGGGGGGGGHHGHHHGHHHHHHHHHFGHHHHHGGGGHGHHHHHGFHHHHGHGGGHHGGHGGHHHHHHHHHHHHHHGGGGGFHGHHHGHHHHHGHHHHGGGGGGHGEGFECHEHGGGGGGHHHGADFHHGGGGHHHHH<ECGGGGHHHHGGGGGGGHGGGGGGHHHGHGHHGEHBFFFGFGEGGGGGEDEGF0C;;BFFFGGGBEFFE/FFFFFFFFFFFFFFEFFFFFFFFBFFFBFF
+@M01368:8:000000000-A3GHV:1:1105:16787:9771/1
+GTTATTATTATGTCCTACAAGCATTAATTAATTAACACACTTTAGTAAGTATGTTCGCCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGAT
++
+AABCCFFFFFFFGGGGGGGGGGHHHHHHHHHHHHHHHHHGHHHHHHHHHHHHHGHHGGGGHIIHHHHHDHHHHHHHGHHHGGHGGHHHHHHHHHHHHHHGGGGGHHHHHHHHHHHHHHHHHHGGGGGHHHHGGGHHHGGGGGGHHHGGGGHHGGGGGHHHHHGGGGGGHHGHGGGGGGGEEGEGFGHHHGGGGFFGGGGGGGGGGGGGGGEG?G;:EFFFFFFFFF:AEFFFFFFFFBFFFFFFFFFEFF/
+@M01368:8:000000000-A3GHV:1:1105:17564:15723/1
+TATGCTCGCCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGTTTTATGACCCTGAA
++
+EDCCDFFCEEDCGGGGGGGGGGHHHHHGFGHGGHGGHHHHHHHHGHHEHHGGGGGHHHHHHHHHGHHHGHHHHGGGGGHHHHFFGHHHGGGGGGHHHGGGGGHGGGGHHHHHHGGGGGGHHHHGGGGGGGHGGGGGGHHHHHFEHHHHHHHHHHGHHGHGGHGGGCGGGGHHH1FGGGFGGFGGGGGGGGGGEFGGGGGGGGGGGGGGGGGFFFFFFFFFFAEFFFFFFFFFFBBFBBFFFFFE1:BFFB0
+@M01368:8:000000000-A3GHV:1:1105:18108:12091/1
+TAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGTTTTATGACCCTGAAGTAGGAACCAGATGTCGGATACCTGTCTCTTATACAC
++
+CCCCCFBFFFFFGGGGGGGGGGHHHHHHHHHHHHHGGGGGGFHHHBFGHHHGGGGGGHHGGGGGHHGFGGHHHHHHGGGGGGHGHFGGGGGGDGEGEFGCHHHHHHHHHHGHHHHGEDHHHGGGCDGGGGFHFHGHHHGHHGHFGHHHFHHGFHHHFHHGGHFHFHHGB0CGHGFHCBGGGGEDEE9ADFEFFFGFBFGFFGGFFFFFGGFGFFFFFFFF/A?FEFFFFFEF-A.B//;BFFEF//BB///
+@M01368:8:000000000-A3GHV:1:1105:18331:16683/1
+TCTGGTTCCTACTTCAGGGTCATAAAACCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATCCTATTATTTATCGCACCTACGTTCAATATTA
++
+BABA?DFFFFFFGGGGGGGGGGHHHHHHGHGHHGGGHHGHGGGGFFHHGHHHGHHHHHHH3FGHHGGGHGGHHHHFHHHFHGHHHGHHHHHHHHHHHHGHHHHGGCGGGHHGHHHHHHHHHHHHHFHHGHHGHGHEFGGGGABFFFGBEGGAFFFFFFFFFFFFFDDFF?DFFFFFFFFAEFFFFFFFFFFFFB;9FFFFFEFFFFFFFFFFFF?FFFFFFF/BFFFFFFFB.DABFFFFFFB.//:FB//
+@M01368:8:000000000-A3GHV:1:1105:20577:18421/1
+GGGGGTAGCTAAAGTGAACTGTATCCGACATCTGGTTCCTACTTCAGGGTCATAAAACCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATCC
++
+ABB@3>AAFFFFFEAGGGFGGAA6FHDGGCGFHFFHFHFHHHHHGDDDFFFHGFFHGBEGEGHHHFFFHGEEAEGHHHHHFHHHFHGHFEDGGEGBEAGEFHHFFHHHHHHGGHHHGHHGBGHHFHHFGHHHHG?CG?AFHH1FHHHGHFHHHF?DGHFFHCGAGEFHGCBBBB?BFFF?B-B.9/BFFFFFB=-AD?..@FFFF@@-@@?AFD.FFFBBEEBD9/:FFFFFBB/:FF9BF/BF.BBFF/:
+@M01368:8:000000000-A3GHV:1:1105:21099:2895/1
+TAGCTAAAGTGAACTGTATCCGACATCTGGTTCCTACTTCAGGGTCATAAAACCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATCCTATTT
++
+CBCBBFFFFFFFGGGGGGGGGGGGGFHHHHFHGHHHHHHFHHHHFGFHHHHHHGHHHHHHGHHEHGGGGHHHHHHHHHHHHHHHHHHHHHHGGHGGHHHHHHHHFHHHHGHGHHHGGHHHHHGGHFFGHGCGGGHGHHGHHHFGHHFHH/FGGGHFGFEGGCFCCD;B@DFFFFFFFFFFFFFFFFFFFFFFFFF;F.BEFADFFFF.AEFFFFFFE;D.;:B00099:09BFBFFBFF.0:000BFFBF0
+@M01368:8:000000000-A3GHV:1:1105:26469:19245/1
+TTATGATTATGTCCTACAAGCATTAATTAATTAACACACTTTAGTAAGTATGTTCGCCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCAAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATG
++
+BAAAAFFFBFFFGGGGGGFFGGHHHHHHHHHHHHGGHHGHHHGGHHHHHHHHHHHDEGGHGHHHHHGEDHFHGFHGGHHGGHGGEHHHGHHGHHGHHHGGEGGGHGHGHHHHHHGHHHHGHGGGGGHFHGGGGHHGGGGCDGHHHGD<EHHGGGGGHHGHH?EDCCDHHHHDGFFGGGHGGFCGGHHHHFG.CFGGGGGGGGGGGBFGDEG.AFFG;AFFFFEB?/A9BBBFFFFFFF/9FFFFBDEFFFF
+@M01368:8:000000000-A3GHV:1:1105:7169:17145/1
+AACCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATCCTATTATTTATCGCACCTACGTTCAATATTACAGGCGAACATACTTACTAAAGTGT
++
+CCCCCFFFFFFFGGGGGGGGGGHHHHHHHHHHHBHHHHHHHGGHGGHHHHHHFHHHHHHHHHHHHHHHHHHHHGHHHHHGGGGCHHHHHHHHGHHHHHHHFHHHHHGHGHGHHGGGGGFGGHHGGGGGGGGGGGGEGGFGGGFFFFFFFFFFFFFFFFFFFFFFFFFFFDFFFFFFFFFEFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFEFFFFFFFFFFFFF-9@DDBFFFFFFFFBBFFF0
+@M01368:8:000000000-A3GHV:1:1106:15481:16176/1
+CTTTAGTAAGTATGTTCGCCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGTTTTT
++
+ABBBBFFFFFFFGGGGGGGGGGHHGHGHHHGHHHFGHGFGHFEHGGHGGHHHGHHHHFGHGGFGFFHHFHHHHEGHFHHHHHFGGGGGHGGGHGFHGHGGGGGGHHHGGGGHHGGGGHHHGGHGGGGGGHHHHGGGGGCFHGGGCDGHGHHHFHEHHHHHHHHHEEFHHGG:C:?0<EFGBFGGGGGFE.BFGEFFFGFFGGGGGGFDEF/FFGFFFFFFF;BBFA;.:EFFE:AAFEF.BFFFFF;9FF.
+@M01368:8:000000000-A3GHV:1:1106:17389:18671/1
+CCATAACACTTGGGGGTAGCTAAAGTGAACTGTATCCGACATCTGGTTCCTACTTCAGGGTCATAAAACCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGGCTTTGATTC
++
+3>>A@FFFFFFFGGGFEECFGGFFB5GBHH5DFH5GBEEAEFHFHHF3F3GHFHHHEF3GAEHBGFHFFEFFHHHHFFB31FGGEGFHGEHHHHHHHHHHHHHHHHHEEEEGHHHFFF3GF3FGF44BBGEHHHHGG2B/BGGHE</ECDFHHBF1DGBFBFGFH<1GHGDGGFDFE0/<--;-9./BBED;BFBD/BF9BFFFDBFDADD;FFF?->;B=.9.;.BBFFF..;A;/B/;B//;;//BBF/
+@M01368:8:000000000-A3GHV:1:1106:22927:3863/1
+GTATCCGACATCTGGTTCCTACTTCAGGGTCATAAAACCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGACTTCTGTCTCTTATACACATCTCCGAGCCCACGAGACTAA
++
+A>ABAFA?D@AFGGGGFGGGFGFHHHFFH4BCBGHHHHGFFF3G5BF3322EEAFHHHHHHAB5GHFHEHFHHH3BEEHFGF5@13FDF3GDGFHHFGHHHGHHHGFGGHHFCG//?/EGHHHG3F4BFFGHHHEDGFHHB/B/?FBF<@-9?BDEFFF?B--?DFFFB9FA>B;A.BFDB?AB.--@;-.FFAEFFFF9AE;DDFFFFB/9BFFFFFFFB:BF/BB/BFF//FFF-=--.99=--.9///
+@M01368:8:000000000-A3GHV:1:1106:23625:4236/1
+TAGCTAAAGTGAACTGTATCCGACATCTGGTTCCTACTTCAGGGTCATAAAACCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATCCTATTA
++
+@?AAAFFBFBFFFGGFGFGGGEFCGGHHHHFGHGHFHGHHHHGGFGGFGHHGHGHHHHGHGFFHHGGGGGHHHHHHHHHBFHHEFHHHHHHGF?FAGHGFHHHGDGFHHGGGHGHFHHHGHHHGHHFHHGFFGFHHHGHHHHFFHHHHH/FGHHHHGHGHG<C???B=@ABBFEF@=-AFFFFFFBFAFFDFFFFA?AFFCFFABEFFFFFFFFF?FFFDFFBFF;FFEFFEFFFFFFFAF///9FF/BB/
+@M01368:8:000000000-A3GHV:1:1106:26031:14826/1
+GATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATCCTATTATTTATCGCACCTACGTTCAATATTACAGCTGTCTCTTATACACATCTCCGAGCCCACGAGACTAAGGCGAATATCGTATGCCGTCTTCTGCTTGA
++
+ABBAAFFF@FFFGGGGGGGGGGHHHHHHGHHHHHGGGGGHHHHHHHHGHGHHHHHHHHHHHGHGHFHFGE?CGDGGHHGGGGGGGHHHHGHGGGGGGFGGGHGHGGGGGGGGGGGGGGGGGGDGAFFGFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFEFFB/9FFBFFFFFFFFFFFFFD@D=BEFFF;FDDB////B=CF-.;BAFFFFFF;;BFE/BFFFFB:
+@M01368:8:000000000-A3GHV:1:1106:27607:15990/1
+GACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGGGGCTGTCTCTTATACACATCTCCGAGCCCACGAGACTAAGGCGAATCTCGTATGCCGACTTCTGCTTGAAAAAAAAAAACTACAACCCACGGACGCA
++
+BBBBBFFFFFFFGGGGGGGGGGGGHHHGGGGGGHHHGGGGGFCEGGHHHGHHGGGEGGHHHAFGGGGGGAFG//EGHHHHCGEHHHHEEHHFHGHFHHGGEF/FGGC?FDFH2DHHFFGGFGHHHHGGHHFGHHGHGHHGFHDHBGBBGHHFHHGGCCDC<=D<DGHHC;CGFCCFBECDG?FGGA-;EB9FBGFFBBF>DFFFE?FFF/--;;9/:BFFFBA///9----;B.//////;...---9---
+@M01368:8:000000000-A3GHV:1:1106:6455:17124/1
+GTATCCGACATCTGGTTCCTACTTCAGGGTCATAAAACCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATCCTATTATTTATCGCACCTACG
++
+BBBAAFABDBBFGGGGGGGGGGHHHGHHGHHHHHHHHHGHHGHHGHHHGHGGGEGHHHHHHHHHHHHHGHHHGHHHGGHGGHHHHHHHHHHHHHHHHHHGHHHHHHHHGHHHHHGGCFEHHHGFHHHHGHHFFH?GGHHHHGHGHGHHCFGGGGGGGFFFFFFFFFFFFFFFFFFFFADFA?.FEFAFFFEFFFFFFFFFFFFDABFBBFFFFFFFFEFFBFFFFFFFFFFF/FFBFFFFFFADE>BFFF9
+@M01368:8:000000000-A3GHV:1:1107:14451:26748/1
+GTATGTTCGCCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGTTTTATGACCCTGA
++
+BABBBFFDABBBGGGGGGGGGGHGHHHHGAGHGGGGGHHHHHHHHGHHHHHGGGGGGFFHHHHHHHHHFHHHHHGGGGCHFHH3FEHHGCGGGDGHHHGFGGHHGGGGHHHHHHG/DGGGHHHHGGGGGCCHGG?CGG1GHHGHHHHBGHHHFHHGHHHHGGADAD00ECEGHEFHHFFAEFFFFFGGFBFBFFFGFFG.;B/99;BCFGGGGEFFFFFFEDA./:ADEB?FBFFFF;FFEBFBFFB./9.
+@M01368:8:000000000-A3GHV:1:1107:18714:24788/1
+GTATGTTCGCCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGTTTTATGACCCTGA
++
+BBBCCFFFDEDEGGGGGGGGGGHHHHHHGGHHGGHGGHHHHHHHHHHHHHHGGGGGHHHHHHHHHHHHHHHHHHGGGGGHHHHCFGHHHGGGGGGHHHGGGGHHGGGGHHHHHHGGGGGGHHHHGGGGGGGHGGGGGGHHHHHGHHHHHHHHHHHGHHHHGGEGEGCCEGGHHHHHHG:CAFFGGGGGGBFEFGGGGHGAFFGGFGGGGGGGEFFFFFFFFFEF/EDDFFFFFFFFFBFFFFFBBFFBBF/
+@M01368:8:000000000-A3GHV:1:1107:21355:8333/1
+ATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGTTTTATGACCCTGAAGTAGGAACCAGATG
++
+ABCBBFFFFFAFGGGGGGGGGGHHHHHHHHFHHHHHGGGGGHHHHHHFHHHGHHHHHHHGGGGGHHHHFFGHGHGGGGGGGHGGEGGGHGGGGHHHHHHGGGGGGHHHHGGGGGGGHGGGGGGHGHHHFHHHHHHHHGHFFHHHHGGHGEGHHGHGFHHFHGHCEFHEGHGHHHGHHHGGGGGGCFFFFBFGGFGGGGFBG?FDGGGEGFFFFEFFFFFFFFFFFFFFFFFFFFFFFFFFFFFBFF.AA/9
+@M01368:8:000000000-A3GHV:1:1107:22864:15712/1
+AATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATCCTATTATTTATCGCACCTACGTTCAATATTACCTGTCTCTTATACACATCTCCGAGCCCACGAGACTAAGGCGAATCTCGTATG
++
+BBBBBFBBFFFFGGGGCEGGGGHGHHDGFHHHHHHHHHHHHHCHHGHFGBGDFGE?GHHGHFBHHFHHHHHHHHHGHFGFGHGHHGGC@DCFGHHGGGGGGGHHHHHHGGGGGFGGGGFFGGGGFADGFEFFFFFFFFFFF9;FFFF/BFFFFFFFFFFFFFFFFFFFFFFFEFFFFFFEAECDFFFFFFFFFBFFFFFFFFFFFFFFEFBFBFFF/FFFDF-;-9;E@>-9DFFF/FFBF;-.:;.9A//
+@M01368:8:000000000-A3GHV:1:1107:24817:14233/1
+CTTCAGGGTCATAAAACCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATCCTATTATTTATCGCACCTACGTTCAATATTACAGGCGAACAT
++
+3AABABFFBFFFGCFGGGGGGGHHHFGCFGGGFFGHHCGHHHGHGHGHBFFHHHEDGGFGFGHHFFFHGGEGHFHHGHFHGFFHHHFGHHHFHACECEHHHBGFHGFHHHFHHF4GFHFHFHEHGGE/EG:A-CFGGFGADGGGGFGGGGDAAAADFA.-AFFECFDAAFFFFEFFFFBFF;D;BFFFB/;BFFFFFFFFFFFFFFBFFBF/;//;BFFFF?FFFFFFEDAFFFFFBF//:BFBACF--9/
+@M01368:8:000000000-A3GHV:1:1107:24830:14440/1
+AACTGTATCCGACATCTGGTTCCTACTTCAGGGTCATAAAACCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATCCTATTATTTATCGCACC
++
+ABBBA@FFFFBBGGGGGGGGGGHGHHGHHGHHHGGHHHHHGHGHHGDHHHHHHAGGGGFHHGHHHHHHGHHHHHHHHHHHEGAFGFHFHHHHGEGHHHHHHHHHHHHHHHHHGGHHHGEFEGGHHGHHHHHGGHGFHH/?GHHHHGFGHGFHCGGBBDAFFFEFFFFFFFFFFFFFF=CDDADDFFFFEF=BFFFEFFFBFFFFEEBF./:FFFFFFFFFFFFFFFFFFFEFFFFFFFFFFF/BFBEFFC-
+@M01368:8:000000000-A3GHV:1:1107:26478:23602/1
+GCTAAAGTGAACTGTATCCGACATCTGGTTCCTACTTCAGGGTCATAAAACCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATCTGTCTCTTATACACCTCTC
++
+1AAAAF1B13BBBEGGGFGGGGGGHHDB1BGFHHHFGFGGG0F00BGBGFGGF1GBGB1BGCGAEE/FGFHGHFHHHHHBFF1B0FGGF//F//FGFGFFF/1@B1DFHHHGGEFEDHFDFAFF0B//</ECCC>1FDD1GFFHHDF?1BD>GF/GCAC0C@?@-;99BBB->@--;-B//99B--9-BF=A--A-:A----9AA9AFBFBBB?E@BBFFFFFFFBFFFFFBFFFBBFFF//B/////-;9
+@M01368:8:000000000-A3GHV:1:1108:11059:23181/1
+GTTATTATTATGTCCTACAAGCATTAATTAATTAACACACTTTAGTAAGTATGTTCGCCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGAT
++
+CCCCCFFFFFFFGGGGGGGGGGGHHHHHHHHHHHHHHHHGHHHHHHHHHHHHHGHHGGGGHIIIHHHHHHHGHHHHGHHHGGHGGHHHHHHHHHHHHHHGGGGGHHGHHHHHHHHHHHHHHHGGGGGHHHHHFGHHHGGGGGGHHHGGGGGHGGGGHHHHHHGGGGGGHGGHEFGGGGGHGGG-ECHHHGGGGGGGGGFGFFGGGGFGGGCF?EFGG0;BFFFFB?9AAFFFFFFBF;BBFFBFFFFE?F/
+@M01368:8:000000000-A3GHV:1:1108:12233:13498/1
+TAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGTTTTATGACCCTGAAGTAGGAACCCTGTCTCTTATACAC
++
+BCCBAFFBCCCCGGGGGGGGGGHHHHGGGGGHHHHHHGHGHBGFHHHHHGGGGGHHGGBFGHHGGGGGGGHHHGGGGHHGGGFHHHHHHGGGGGGHGHHGGGGGGGGGGGGGGHHHHFHHHGHGHHHHHHGHGHHGGFGGGDFFGGHHHGHGH/<GHHFGBGFHFBGHHHGHHGEFHFHFGBF0BFGGGFGGGGGEFFF;A?EEG?CFFFFF0:BEFFFFFBFFFFFF0FFEFF?EFFFF0BFFFFBBB00
+@M01368:8:000000000-A3GHV:1:1108:14328:14751/1
+ATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGTTTTATGACCCTGAAGTAGGAACCAGATGTCGGATACCTGTCTCTTATACA
++
+BCCCBFFFFFFFGGGGGGGGGGHHHHHHHGHGHHHHHGGGGGFHHHFFDGHHGGGGGGHHHGGGGHHGGGGHHHHHHGGGGGGHHGHGGGGGGGGGGGCFGHHHHHHHHHHHHHHHHHGHHHHGGGDGGFGGFGGHHHHHH>FHHHFHGHGHHGHHHGHHBA<CGFHHHHHHHHHHGFHHGDDEGCEGGGGEEFBFGGGGFGGGB0CFF:FFFFFBBFFFFBFEFA.BFFFEFFFBF/BF/FFEFFBFFF/
+@M01368:8:000000000-A3GHV:1:1108:16350:22621/1
+TTAGTAAGTATGTTCGCCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGTTTTATG
++
+AAAACFFFFFFFGGGFGGGGGGHHHHHHGBGGGFGGGHFGGGGGHHHHHGGHHHHFHGGGGGGHHGFHHHHHGEFHHFFHHGFCEFHHHGFF?GHHEE@ECFHHEGGGGBFFEGGGHFDHHGFG/BFEHHFCDGGGCDEGGGCGFFFHHHFEGHFHHHHGHHDGHHHGGHDED0CE;CFFFFBFF/;CBFFFGG0/FFF0B0:BB?.;BFF0FGFBFFFFFEFE;ADED.;BE.99FAFFFFFFF/;EFF/
+@M01368:8:000000000-A3GHV:1:1108:21791:23272/1
+CTTTAGTAAGTATGTTCGCCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGTTTTA
++
+3ABBBFFFFF@FGGGGGGGCGGGHHHHHHHHGHHACGDAGFEEHGGHHGHHHHHHHHHHHGGGGGGHHHHGFHFGHGFDDGFFFGGFGHHFF?FEGHHGGGGGGHHHGFFDHHFGG?HEFGHHGGGDDCGFFC?ECCFGDEFGGGGGGFHHHHHHHEFHFCGHHGEGGGGD.:.A;CECAFFFFBFF/;EFFBFFBFB;;BFFFFBBAA./BFFEBB//BFFFFFFFDFFFEEFEFFFBFBFBBFFFFF./
+@M01368:8:000000000-A3GHV:1:1108:23314:26089/1
+ATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGTTTTATGACCCTGAAGTAGGAACCAGATGTG
++
+BBBBBFFF?FFAGFBFGGEGGGGHGHHFHHHGHHGFGGFHHHHHHHHFHHFHHGHHHGGGGGHHHHFFEHHHGGGGGGHFHGEEGF3FEFGHHHHHFFDEEEEHHHGEEGGGGGHFGGDADGFFFFFHHFGHHHFGBHGHHGBCEHDEDDGADCFFHHHGG/:GCCCGHFGHFFGG0CGFGF.FB/9;BFBB0FFBFG0A-..;C:E/.A9.FFFFFFFF9BFFFFFFBFBBB./:BFFF/F;AA?F////
+@M01368:8:000000000-A3GHV:1:1108:25084:18127/1
+TTATTATGTCCTACAAGCATTAATTAATTAACACACTTTAGTAAGTATGTTCGCCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGAGATAGACCTGTGATCCATCGTGATGTCT
++
+CCBBCFFFFFFFGGGGGGGGGGHHHHHGHHHHGFGGFHHHHGHHGGFHEHHHCGGGHBHHHHHHFHHGHHHHGGHHGGHGGGHHHEFHHHHEHGHGGGCFHFHHHHHHHHHHHGHEFGDEGGGHFHHCGGHHGGGGGFGHHGGEGDFHEGG/?GFHGHDGGGGGHHHHADFGGGGGEGCGGGEFGHHFEBFFGGG?GGGGEGGFEFAA?.0:A0;BFFFBFF/;9BFFFFEFF9FBFFB/F/.;FFFF/BB
+@M01368:8:000000000-A3GHV:1:1108:7626:10048/1
+ATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGTTCTGTCTCTTATACACATCTCCGAGCCCACGAGACTAAGGCGAATCTCGTATGCCGTCTTCTGCTTGAA
++
+CCCCCFFFFFFFGGGGGGGGGGGHHHHEFEFHHGGGGGGHHHGEF?GGGGGGHHHHHHGGGEGEHHHHGGGGGGGGGGGGGGHHHHHHHHHHHHFFCGHGHHHHGG/BFGDGG2FFHFHGHH0FHFGFHHHHFFHHHHHHHGG<FHHHFGHHGGGGFHHHGGGGGGHGGHGGGHHHHHHFGGGGGGGFFFGGFGGBFGGGGGGGGGGGFGFFFCFFDFFFFFFFFF;./;AAAFFFFFFAFABBFFFB/;;
+@M01368:8:000000000-A3GHV:1:1109:11270:12255/1
+AATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGTTTTATGACCCTGAGGTAGCTGTCTCTTATACACATCTCCGAGCCCACGAGACTAAGGCGAATCTCGTT
++
+CCCCCFFFFFFFGGGGGGGGGGGGHHHHFFFHHHGGGFGGFFHGEGCHHGGGGHHHHHHGGGGGGHHGHGGGGGGGGGCEGFCHHHHHGFHFHHHHGFHHGGFHGGGFD/EFGEFFDGFHHGEFCEHFFGHHHGHHHHHHHHHGCGHHHGGFGHHHHGHEHHCFFADGHHHD?CG.CGHBCBFBFFGGFFFGFFFFF.CFBFBCFFFFGFFFFFGGGFFFFFDFAFFFFFF-@DBFFFFBFD---.;BAA.
+@M01368:8:000000000-A3GHV:1:1109:19224:11655/1
+AAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGCATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATCCTATTATTTATCGCACCTACGTTCAATATTACAGGCTGTCTCTTATACACATCTCCGAGCC
++
+BBB@A4FFFBBBGGGGGGGGGGHHHHHHHHFHHHHGFGHGGGFFAGFHHHFHHHGHHHHHHHHHHHFHGGHGHHGCFFGHHHGHHHGHHFHGGH3BFFGHHGHGEFFH/EG@-CFGGCC@-;BD?FGGGGGG??FGDAGDFFFFEFF@BAAFEFFBFFFFF?FD9BBFFFF/FFFFBFFFFFFF?FFBFFFF/FBBFFBFFFE?F;@B//AFFFFFFFFF//;BFFEF.BFFFB/;F/99/FBFFBDCF;B
+@M01368:8:000000000-A3GHV:1:1109:21978:9490/1
+GGGTCATAAAACCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGTCTCTTATACACATCTCCGAGCCCACGAGACTAAGGCGAATCTCGTATGCAGTT
++
+?A3AA?DFFFFFGGGGGGGFFGHFGCEGGFHHHHHHHHHGHCBGFEGGHHDEGAFGHGHFGDGBCGHHHHHFHHGHHHHHHHGHHHH1E?EGGGHHHHFGFHFHHHHHEDHHGHH@GGHGHHCGG?CFGFGGGGGFGB.BFGGFFGGFFFBDDBFFFFFF9-;DEFFDFBFFBB.EFF;BFBFFFFFFFFFFFFFFFFFFFFFFFFF/B9/FFFFFFFAFFFF--99AFFFFFFFA;;;FF..9//;/;;/
+@M01368:8:000000000-A3GHV:1:1109:22910:4079/1
+TAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGTTTTATGACCCTGAAGTAGGAACCAGATGTCGGATACAGTCCACTTTAGCTA
++
+CCCCCFFFFFFFGGGGGGGGGGHHHHHHHHHHHHHHGGGGGHHHHGGEHHHGGGGGGHHHGGGGHHGGGGHHHHHHGGGGGGFHHHGGGGGGGHGGGGGGHHHHHHHHHHHHHHHHHGGHHHGGHGGGHHGHGHHHHHHHGFHHHHHHHHHHHHHHHHHHGGHHHHHHHHHHGHHHHHHGGGGGGGGGGGGGGGGGGGGFFGGGGGGGGGGGFFFFFFFFFFFFFFFFFFFCCDFFFFFFF0BFFFFFFF0
+@M01368:8:000000000-A3GHV:1:1109:24217:19077/1
+AAAGTGAACTGTATCCGACATCTGGTTCCTACTTCAGGGTCATAAAACCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGCCTTTGATTCCTGCCTCATCCTATTACTGTC
++
+>AAA3BDFFFFDGBFFEEGGGGHHGHFHHCFHGHGHHHGF3BFGFHGFEFHFHGH3EGFC1EEGBFGBHFGGFFHHHGHFHGHHGHGGHCEHEBCFF3ED3@GH4FDEG12FFHFFHG/G3FGA/@EFEFCG33FFGBBGHFHH/?BFBGFGFAGC2C/@-;@-;BFFEFADF?DFFFFFF?;AFFA;AD;..FEFFA--;9;D.9BFFBE?;.;///://///99//BB/9;F./B//BBFB9////99/
+@M01368:8:000000000-A3GHV:1:1109:25237:11722/1
+CCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGCTGTCTCTTATACACATCTCCGAGCCCACGAGACTAAGGCGAATATCGTATGCCGT
++
+AABBBFFFFFBBF5BGGFGABGHGGAEFGFHHHHFHCHFHHBFGGGEHBGGHFFFFGFAEF5FHH?EGGF5AEG3?EBFHD?C/EFHFFEGEE?CFGGGHHFHB3EEFG?EEGHCFGGGGGGGEC<CDFHHHHHE.FD11FFAGBGD.DGHEA<.<<0<EHAHCFHHF./;CC0GFH0::0CFGG0FBFD;9/90BFF0CBBFGB09;B:0;CFF0.-;@AFEEF--;AFFBF/99D-;.//.../9;B-.
+@M01368:8:000000000-A3GHV:1:1109:27103:7153/1
+GTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGTTTTATGACCCTGAAGTAGCTGTCTC
++
+33>A?FFFDFBFGCG4EGFG??GACFGGHFHCFHCHBECDEFCEGHHHHHFFGGF3AFFHHFGEGCGHHGEHGFGHHEGG?EFHHH?EGGHHGGGGHHHHHHEGGGGGHFHHGFDDGGACFCC@?/FDDGHHHGHEFFHHH0FDHHFFEDCD.<GGEHGF0CHHHF/CAGC000CCGFHFGFGFFG?:CB990;F09;FB0BBGGGGGG?;A9EBDEFA///;FF/:F?BFBBFFBFFFF///;/9B;///
+@M01368:8:000000000-A3GHV:1:1109:8763:7859/1
+TAGTAAGTATGTTCGCCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGCTTTATGC
++
+BABAADFFFFFFGGGGGGGGFBGFGHHFBHHHHGGHHGGEHGDHHHFGHEHHHHGHHGGGGAGHHFBHHGHFHHHHHHHHGGGCEFGFFFFEHHH?FFG1FFHHFEGGGHGFEEHHHHHGGGFGGGHHHHGGGGG/C/FG-<A<GFHHFFCGHHFHGE0<<CGHHHGCHG.CCCCCE00BBFGFFG.BB0FFBFBCF0;CBFFFEEGBBBFFBF/FFF9BF/9BAFFD9AFEDAA.A/BFFFFFFFFFEB/
+@M01368:8:000000000-A3GHV:1:1110:12808:18367/1
+AATTAACACACTTTAGTAAGTATGTTCGCCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGGGGAACGTGTGGGCCTG
++
+BBBBBFFFFBBFGGGGGGGGFGFGHHGGGGGHHHHHHHHGFHHGEGGGHHGFGHEEGGHHHHGHHGFFHHGGGGGHHHHGHGHGHHHFGGFHHGGGGGHHFFFGGHHHE?@EGGHFHEGGGHHGGGGHGEFHHGD?/>CFHHGDFGGGGGEFGC?EGHHHB0CGHHGCGHHHHBEHGHH.::ACA;FECFGGGGGFFFEFGGGGGGGFFBBBFGBFFFEFFFFBFFFFFFBBFBFFB9..AF?FFFFFFF9
+@M01368:8:000000000-A3GHV:1:1110:14751:26540/1
+TAACACTTGGGGGTAGCTAAAGTGAACTGTATCCGACATCTGGTTCCTACTTCAGGGTCATAAAACCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACTGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGTTGTGCACGCGATAGCATTGCGCGACGCTGGCGCCGGCGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTG
++
+AAA?1CFFFFADGEEGFGB1112DGDGHGFGHHCG/ECEBGGHDFGHHFHGHEB1BCGFFE2EGHHGHFFFHHBFFHEFCGGHHFHHHHH111BFFHGHEHBEHGGECEFHGFHFGGDBBGHHBHHHH0GH22FGHGFFFH1BFCG0F@FGG11@GDHFG1D/1FGFHH/FCG.>0><-<@CCFFG.CC-@C?C9FFF0C---;------;9----9-9@-AAFF9B9---9-/;B9BF/9BB//B/;///
+@M01368:8:000000000-A3GHV:1:1110:15519:10008/1
+CTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGTTTTATGACCCTGAAGTAGGAACC
++
+BBBBBFFFFFFFGGGGGGCBGGE?GGGHHHHHGHHBEGGHHGGGGGHHHHHHHHHHHGGHHHHGFGGGGHGHGCFGHHHGGGCGGHGHGGGGGHFGGGHHHHHHGCEFGGHHHHGGGGGGGHGG/CEGHHHHGFHHHGFHHGFFHGHGHFGGEGFDDGGBCGHHGFHH/CHHHHGHGHF0CFGGGGGGGFFFFFBFFFFFFGFFGGF?DGEDEEFEFFFF?FFFFFFFFFFFFFFFBFFF.BFFFBFBBA;
+@M01368:8:000000000-A3GHV:1:1110:16559:7507/1
+CATTCAATTGTTATTATTATGTCCTACAAGCATTAATTAATTAACACACTTTAGTAAGTATGTTCGCCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAACTGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATC
++
+ABBBAFFFFFFFFGGGGGGGFGGGGAGHHGCHHGHHHHHHHHHHHGHHGHHHHHHHHHHHHHHHHFGGGHHHHHHHHBDHHHHHGGHFEEGHGGHHHHHHHGHHHEHFGGGGGGHHHF33FGHHG3GDDGH//EEGHHFFBF?GHHFCC@DGFCGGB?DGHAFGGHHGFH0E??<@DGHGGCFGGF?DGGGFFGGGGGGGG.C/0BBF?FBBEGG0FFF.AA9;B9/E////99;;:.//:FFFFBBF//9
+@M01368:8:000000000-A3GHV:1:1110:16700:6843/1
+AAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGTTTTATGACCCTGAAGTAGGAACCTGTCTCTTATACACATCTCCGAGCC
++
+BBBBBFFFFFFFGGGGGGGGGGHHHHGHHHHHHHHHHHHGGGGGHHHHHGGHGHGGGGGGHHHGFFGHHGGGGHHHHHHCGG@FGHFHFEGGGGGGHGGGGDGHHHHHHHHHHHHHHGHHGHGHHGGGGGCGHEHGHHHFHHHFF.DGHHHHHHGHHHHHHGFGHGCGHGHHHHHHHHGHHHCD?:A::FCDGEGFGFFBFGBFGGGF00CBFFFF/BFBFFFFAE.FBBFBFFFFB/BFFBFFF/ADCAD
+@M01368:8:000000000-A3GHV:1:1110:18014:7856/1
+ATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGGGATAGACCTGTGATCCATCGTGATGCTGTCTCTTATACACATCTCCGAGCCCACGAGACTAAGGCGAATCTCGTATGCCGTCTTCTGCTTGCAAAAAAAAAATAG
++
+AABBBFFFFFFFCGGGCGGGGGGHHHHHGFHHHHHHGHHHGGGGGFHHGHFGGHHHGGFGGGHHGGGGGHHGGGGHGGHHHGGGGGGHHGHGDGGGGGGGGB/A<GFHFHHHGHBBGFEGGGGHFFFEF/EEGGHGGFEHFHHBA.<ADFFHFHB/CCGHFEFHHGHGEFFGGGGGFFFGGFGFFBFFGGBFGG??DGG?@9-ADFFFFB/@BD;./BFE?BFE/>99FE//BBFFF.9/FF?DA=@9./9
+@M01368:8:000000000-A3GHV:1:1110:23303:11846/1
+ACTTGGGGGTAGCTAAAGTGAACTGTATCCGACATCTGGTTCCTACTTCAGGGTCATAAAACCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGTGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTC
++
+3ABB?FAB?DAAGGGFBGGBB5AFFFGFHHGGGEGHHHFHHF3EGFHHHHEFHHGGHHHGH3EFHHHHHBDGHHE?ECHGHGHHHHHHFHHHGHHHHHHHGGHGGFHHHFHHGFFHHFEGFHHHHHHEHHFDAGHHHH/BDDFGGH1FDBGHHHHHHHCGHHHFH?0CGCF>CC=@--AFBFFB?=BFDFFF//FDB;-9A-AD-.A.A=?-9-:B/AEB/BFF.A;DDFFFBBFFFF/BBFFFFBFF9B;
+@M01368:8:000000000-A3GHV:1:1111:13195:14562/1
+ATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGTTTTATGACCCTGAAGTAGGAACCAGATGTCGGATACCTGTCTCTTATACACATCTCCGAGCCCACGAGA
++
+ABAAAFFFFFFFGGGGGGGGGGGHHGG4FDFGFGGCGGGHGHG?EGHEGFFDHFHHHHGGFE@EHHGEEEGFCCEFFGFG/EHHHHHBFBGGHFHFHEHGHEFGGGED/EFDEFFEHHBGHHCFFFDFGGHHGFFFHHHHGFG>0<0DGGFHBGHFBDFGHGFFGGAGHHGCGBHFFHHHFFFBFGGGGF/:FFFCB9F9FF0FEFE?FF0BED-D.//BF9//BBFF/BFFFEFFFFED-DCFF?.:BFA
+@M01368:8:000000000-A3GHV:1:1111:14287:20817/1
+GCCAACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATCCTATTATTCATCGCACCTACGTTCACTATTACAGGCGAACATACTTATTAAAGTGTGTTAATTAAT
++
+>>A3>AAAACFFFGFGFGGGGGHGHHHHHHHGGGGGHGHFFCGHHGBGHFHHHHAGHHHHEHHAGFFEHEAE?GHHHHEGFFFDGHGHBFFHFHHHGHGHGHBECG@@@EHGGEGCGGGGFFGGGG?BGGGGGG.-C.FEDCFFFEFFFAF/99BEFA.:9BFB/9FFFEFFFFFFEFFF/FBBFFFFFFFFFFFB//;.@@//;DFFFF//BBFFFBF;A;DF=>B//;9B//B/;/;9//9//;B/:B9
+@M01368:8:000000000-A3GHV:1:1111:23624:14516/1
+GTCCTACAAGCATTAATTAATTAACACACTTTAGTAAGTATGTTCGCCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGGGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAG
++
+3>3AAFFFFFAFGGGGGGGGBGHHHHHHGGHGGHEHGHADFHHHHEGGGHBGHFFHHEHHGHFHGG5FBEEGEGHHHGHHHEFDGHHFFGFGGHHGHHHGHBHGHFHFHHGGGGFCFBGFGE?GFBECEGDGHEHGDGCGHGC/DF@GHGFFCGGGGFFFFDD?@C@GFEC?-ADHFFHBGHFBHFG0CC//.;B0/CA.;AA.;@.AB/9BB/A/.AFFFE/BFFF///9B/FBDE9/;99/B/BFFEF/
+@M01368:8:000000000-A3GHV:1:1111:7437:24508/1
+ACACACTTTAGTAAGTATGTTCGCCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTGTCTCTTATACACATCTCCGAGCCCACGAG
++
+CBCCDCFFFFFFGGGGGGGGGGGGGGHHHHHHHHHHHHHHHHGGGFFEHGGHHHHHHHHHHHGHHGGGGGHHHHHHFHHHHGHHHHGHGGGGGHHHHHGGHHHGGGGGGHHHGGGGHHGGGGHHHHHHGGGGGGHGHHGGGGGGGHGGGGGCGHHHHGHHGHHHHHHHEDHHGHGGGGGD;BEGGGFFGGGGC:CFGGGGGGGGGFGGGFFFGFFFFF;FFF;BFFFFFFFFFFFB:FFFFD=CAEEEF>-
+@M01368:8:000000000-A3GHV:1:1111:8665:25542/1
+TCCTACTTCAGGGTCATAAAACCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTGTCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATCCTATTATTTATCGCACCTACGTTCAATATTACAGGCG
++
+AA3AAFFFFFFFGGGFGFFGGGGHGH4AGGGFHHCGEE2FGHHHHHHHHHHGFHGF53FHEGGFAF5CFHHGGFGHFHHGGHHHCHHHHHHHFHHGH?EEEG1FFFEHHFHFGGHHGG?F4FBGHGHCHEF0//-9--;0CFGG?@BGDGFFFFEFBBBDA?FFBFFFF=B;-9.AA9EFFFF/;9BD.//;9/9/B:/:BFBFFBFFF/B:BFF//;/B/FFFBFF.A-BFFFBA/F//BFFFBF/;/A-
+@M01368:8:000000000-A3GHV:1:1111:9655:13916/1
+GGCCCATAACACTTGGGGGTAGCTAAAGTGAACTGTATCCGACATCTGGTTCCTACTTCAGGGTCATAAAACCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGCGGTGTCCACGCAATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGA
++
+1>>1AAFFFFFBGGFE1EEEEGGHGHHH2FGHHHFGFGHGCFGGGEFHGGEGGHHHHGHEFBFEGHHHGHHBEHHHHGHGFHHHGGGGHHEGGGGHHHGFHGHHHH1FHHG?G/AGF1GBFGEFFHF2FDD0FG<GDHBFDGFFCGH//B//?0GFFGFGGHHHFHFB.=1FDFB?FGH.C/.-:::CH0;CAB@-.;0CGFFFGG--9.A@GB>--99@=---AAABA-BF/B?A@F-9BBFF//BB/9/
+@M01368:8:000000000-A3GHV:1:1112:10272:7828/1
+GTATCCGACATCTGGTTCCTACTTCAGGGTCATAAAACCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCTGTCTCTTATACACATCTCCGAGCCCACGAGACTAAGGCGAATCTCGTATGCCGTCTT
++
+AAABABBBBBBFGGGGGGGGGGHGHHGHGHHHHHHHHHGHHHGGHDGHHHGGGGHHHHHHHHHHHHHHHFHGHHHHGGHGGHHHFHHHHHCGHFFHHHHHHHHHHHHHGHGEFGAEEEEHHGHHGHGHHHHHHHGHHHHHHGHGHFFBC/BA?BGGGFFFFFFFFFFFFFFFC-@DDFFFFFFFEFAFFFFFFBFBFFFFFFFFFFFFFFFFBFF->@FFFFFFFFFFBFBFAD--.99;A?////:.9A.
+@M01368:8:000000000-A3GHV:1:1112:9832:16531/1
+CTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGGGCTGTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGTTTTATGACCTTGAAGTAGGAACC
++
+AABABFFFFFFFF4GGGGEBGEFGHGGHGHGHHHGGHFBGFGGGGGHHEFHGEHFHFHEHHHHHGCGGGHFHHCFGHE@1EEEFFGB?EEEEHBGGGCHHGHHBEE@>EAHHFAEBDGGGCEFF?CEGFFHHHHHFHHHFHGHCGCAHHF<..C.D=0CD.GFHHHG.CAGHC:CHB0GGGFFB0:CFA.A-;9.;000CBBFFBFGA.9AA;A;EDDE.ABBFFFF9;BEFFF/BF//9/B//9:B//..
+@M01368:8:000000000-A3GHV:1:1112:9832:6701/1
+CGCCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGTTTTATGACCCTGAAGTAGGA
++
+AABBBBFFFFFFGGGFGGGGGGHHHGGHGGHHHHHHHHHHHGHHGGGGGHHHHHHHHHHHHHHHHHHGGCGDHHHHFGGHHHGGGGGFGGHGGGGHHGGGGHHHHHHGGGGGGHHGGGGDGGFGHGGFCDCHHHHGHHHHGHHFAGFGGEHFGEG.C<EGCECEFCFFHBGHE:GHHGFF0FFFB0CFGGGGAGFFF0;;FFGGGFFGFFCDD.DEFBEDD?9FFFFFFFFFFFFFFF/B./FB///;BF/
+@M01368:8:000000000-A3GHV:1:1113:13532:8618/1
+GGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGTTTTATGACCCTGAAGTAGGAACCAGATGTCGGCTACAGTTCACTTTAGCTACCTCCAAGTGTTATG
++
+AA?AAFFFFFFFGGGGGFBFGGGGGGH5GHFEDHHGGGGCGFBGH?AEEHFFEEGHGHHHHGGG?0EHGHHGGGGGC?GEE/EE?GHHHGBHFHHHHHHGHHGHHHGGGCG/A@<FGGHHHHHHHFF/GFDGHHHHHHGFFFGHGGHABGHFHHHHHFHEGDGHGDDEEHHBEDDEGFGHGBFFBFFEGGGEFGFGFB000;F0F;FGGEGGEFFF;-.9//B///B9FFFFF/BFFB/:.BB//;FBFFF
+@M01368:8:000000000-A3GHV:1:1113:21679:18011/1
+GATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGAGGGTGTGCACGCGATAGCATTGCGAGACGCTTGAGCCGGAGCACCCTATGTCGCAGTATATGTCTTTGATTCCTGCCTCTTCCTATTATTTATCGCACCTACGTTCAATATTACAGGCGAACATACTTACTAACTGTCTCTTATACACATATCCACGCCCACGAGACTAAGGCGAAGTTCATT
++
+AA>1>11F1D1DDFFFFGGG1FH3GHGHGHGHFHEC?EC0B1FBGFB1GHHH21AF2HH2FEGEHAE10AAE/>/FFHE?/E/?E1@EFFH?E@/EGGG//B11B//<@@C0F/<0<FFDGGCC?FF221<BDD11@<11@DDCGEF1<111F1<F1FBGHGHCF-CHHFA./</0CGHF<0CC/;C-:-;;09;FFBFBBFFBC0FFFGGFC0009C00090/-:--9--;-;AFFE;/99-9--/;///
+@M01368:8:000000000-A3GHV:1:1113:25528:14016/1
+CCTACAAGCATTAATTAATTAACACACTTTAGTAAGTATGTTCGCCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGG
++
+>AAAAFFFBFFFGGGGGGGGGGHHFHGHHHHGHHHHHHHHHHHGGGGHHHHFHHHHFHGHHHHGAFFEFHEGHHHHHHHHGHEHHGGFGGGHHHHHHFHHHHHGGHHHHGGGGGHFHHFF?HHGGFECEFFGHFFGFHGECDGHGBGFHGDF@@?CGFHCEGGGFD.CCC?EGHBHHHFHHFBCFFGEB/CEGGGGDAA.90C9CEBFGGBBF/9.9FBFFFBBFF//99FFFFEABF//99FFEFFFBFF
+@M01368:8:000000000-A3GHV:1:1113:5741:16959/1
+TAGTAAGTATGTTCGCCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGTTTTATGA
++
+ABBBBFFFFFFFGGGFGGGGGGHHHGHHGGHBGHGAGFFCAFGHGFFGHHGFHHHHHGGGGGHGHHHHHHHHE3BFFHHHGG0EDF@GHFFGGGHGGGGGGGGGGGGGHHGGEEFHGFHHDDG@DGGGHHGDGGGGGHGG?CF?HHGHHHGHGHHHFFHGGGHHHHGGCD.;0<C;CGGGGEFF/.;0;FFFBF/0;0CFGFFB..9B/;0CBFFBBFFFFBAC?DED9;B9AD;.FFFB/B/;FBA/B//
+@M01368:8:000000000-A3GHV:1:1114:10130:11959/1
+CGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTCTGATCTGTCTCTTATACACATCTCCGAGCCCACGAGACTAAGGCGAATCTCGTATGCCGTCTTCTGCTTGCAACAAACACACATCCAGA
++
+>A33>FFFFFF@FFFGGGGFGGD4EGGGGGHHGFFGHFGGHHHFEFHECFHHHEHGAGBCCGCCEGGHGHEGFBFHFHHHHGGGHFHGHEGGGFEGEGG??@DBGHGGC-@FFGHFHFHB-??DA-DD@9:BEBG@B?E?A.ABBFBFA??F.FF/BFFB/B9B/9;BF9FF9FFFFFFFFFFFFFF?BB?;9EE;-;DDB9//;B-B@;ABFFEFFFF/-.9A.;//9/BF./B/..9.9:...//////
+@M01368:8:000000000-A3GHV:1:1114:14540:5315/1
+CTTTAGTAAGTATGTTCGCCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGGGGAACGTGGGGGCTATTTAGGTTTTT
++
+AABCCFFFFFFFGGGGGGGGGGHHHHHHHFHHHHGHHGHHGGGHGGHHHHHHHGHHHHHHGGGGGHHFHHHFGHHGGFHHHHHGGGGGHHHGHGGHHHGGGGGGHGHGGGGHHGGGGHHHHHEGDDFGFFFHHGGGGGCDAFCFGFDHHHHGGHGHHHHHHBCGEHHHHGGHG.ACGEHGG0CBFFF:A;BB0;09CGF00CFFFE0AA?//CFFFFFFFFFFFFFFFBEF;A.-=A--:BBFB90;;FE.
+@M01368:8:000000000-A3GHV:1:1114:15066:16302/1
+TAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATCCTATTATTTATCGCACCTACGTTCAATATTACAGGCGAACATACTTACTAACGGTTGTTAATTAATTATTGCTTGTAGGACA
++
+BBBBAFFBDFBFBGGGGGFGGGBGFFFHGFHHGFFFHGHHHGHHHHFFHHHGHGC?AEFFHEFBFFFGHHHHH1FDGFFHGHGHFEGCGC-<<AHHHGGGGGGGFHH0GHFCCCADGGG?.9/A-???DGGFFF.9F9/EE-;;BBBFFBFFFFFFFFFEFFFFBFFBBFFFFF/BFFBFFFFF-DBFFF;/BFF//BB//9/BEA---9:BFFFFFF/F/.;.:@9.BBFF/;BFF/;/////9/////.
+@M01368:8:000000000-A3GHV:1:1114:16639:15258/1
+CCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGCGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATCCTATTATTTATCGCACCTACGTCCAATATTACAGGCGAACATACTTACTAAATTGTGT
++
+11>>ABFFFFFFGGCGC1BBF1GHHHBHHHHGFHGH1A100AA/GGEHGFBAA1FFD2FHHHHECG2F1BB/E0FC/A>EE/FGGFGEF1EGBBEHHCGGGHBGEHFHE0B?E--;C?CCGGG@A@GBFBBBB09?@??A-AB--ABE@=-=-9AE9A;FFFFFE=9-//;//;9FF/////;;///9B///;/B////9FFBB;--A@-;/9;9-:-/;;FFFE9BF?@;-9-99/B9F/://///99/;
+@M01368:8:000000000-A3GHV:1:1114:2404:13066/1
+TCCTACAAGCATTAATTAATTAACACACTTTAGTAAGTATGTTCGCCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCTGTCTATTATACACATC
++
+CCCCCFFFFCFFGGGGGGGGGGHHHHHGHHHHHHHHHFFHHHHHGGGGHHHHHHHHFHHHHHHFGGHHGGHGGHHHHHHGHHFHHHHGGGGGGHHHHHHGHHHHHHHHHHGGGGGGGHH?FGHHHGGGGGGHHGGFGGHHGGGGHHHHHFGGGGFGHGHHGGGGGGGHGGGEGGHHGHHHHHHHHHGFBFFDA0FGGGFFGG0:EFGGGGGGGG;AEBF0B0BFFBFFFFFFFFFFFFFFFFFFFFFEFF0
+@M01368:8:000000000-A3GHV:1:1114:9184:6959/1
+GGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGTTTTATGACCCTGAAGTAGGAACCAGATGTCGGATACAGTTCACTTTCTGTCTCTTA
++
+AABBBFFFCCCBFGGGGGGGGGHHHHHHHHGGGGGGHHHG3FFHHHFGFGGGHHHGGGEHHGGGGHHHHHHGGGGGGHGHGGGGGGGDEGGGGEGGFHHHHHHHHHHHHGGGFGEHHGGFDGGGDFFGFHHHHGFCFHHHHHEFHFHGGFFGHHGGGHHHHDGHHHFHHHFFFFGFGGG.EFGGGGFGEBFGGGFGFGGGGFFBFGGBBFFFFFB/FEFF?///;A::AABBFFFBFFFFFFFFFBFFFF/
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/canu_contigs_result1.fa	Fri Jun 08 04:43:41 2018 -0400
@@ -0,0 +1,155 @@
+>tig00000001 len=15307 reads=47 covStat=-31.76 gappedBases=no class=contig suggestRepeat=no suggestCircular=no
+AAAATAGTCAATAGTAGGATGCCTGACAATTTATGCTCTACTTTCCAGGCTTATCTGTAATCGGGAATAATAGAAATATGTTCCATCAATTTTTAAGTTC
+CATTTGTTCACCTTATTTATGTAAGGAGTATTTGATCATGTATAAGCTATGAAAAACAGCTTTAGGTAATAAGAATATCTCAATTTTTAAACATAAAATG
+CGAATTATTTAGTACAAAAAGGCGTTACGTGATCTTTCCTGGGATACAACTCTGGCAATGGTATCGTGAACAGGAATACCATTTTCAAAATCACCATATT
+GCTTCAAAAAATCGAGATGTGTTTCCCCGAAATCCTCTATATCTTCCCAACCTTCTGCACCAGAAATAACGGCACAAATAGTCAAACAGTAGAATATCTG
+ACAATTTATGCACCACTTTCAGGCTTGTCTGTAATCGGGTGTAATAGAAATATGTTCCATCAATTTTTTAAGTTCCATTTGTTCACCTTATTTATGTAAG
+GGTATTTGATCATGTATAAGCTATGAAAAAACAGCTTTAGACAATAAGTAGTATCTCAATTGTTGAACTTAAATTCGAATTATTTAGTACAAAAAGTAGC
+GTTACGTGATCTTTCCTGCAAATGGAACGCAAAATAAACACCTATTCCATGAGTTATATAATTTTTCACAATGATTAATTTGTTTTCTCAGGAAGAGATT
+TTATTTCTCTTCACTACGAATTAGTTCATGCTGTATCTTTATTAAACATTCGTAAGACTCATTTTTGTTCGGGAGATGTGCTGTCATTCGAGCATAAGTT
+GGTTTCTCATCTTTAAAATATTTTACCATGATTGAATTATCAAGGACTGCCAACAACTGAACTGGATCACTGCTCTTTTGATAGATACCCGCTCTTATAT
+AACTTCTAAACCGATCGCCGAGAAACGCCGTTTTTCTGCTGTATTTATCAACTCCTGCAACGTTCCTTTGATGGCATGATTTTCATTAAGGCGTAGTGAC
+CCGACGCGAATTAAGAGTCTCGCCCCGCTTGGTGTGAATTTATTATTTTTACATGTACCCAGTTCTGTTTGCCAATAATACTCACCGATGTCCTCATTCT
+GATACCATCTCACATGGCTTTATTATTTAAGACAGGAAACGCGGAAAAATAGTACCCTTAGCGAAAATAGTAAAACAATCATGATCTTTAGCTTGTATTT
+CGCAATCAGCTATAACACCAAAACTAACAAATATCATCAGCAAAAAGAACAAAACTCTTTTCATTTTCTTATTCCTCTCGATGTTCTCTGTTTCATCTTA
+GCTAAAATTTCACCCAAATCATCTATCCCTGCTGTTGCTGGCCCATCGGGTTTATTAATGTCTGGGAATAAATAGGGTTCTGCACAAGTATATCCTGGTG
+GTAATTGAGTTGTTGGCCAATTTGTCTGTGGCAGGTAATCACTTGCTGTCTTTGTATCCATCCCTGGATACTGGGAATCATCCTGTGGCGTACAAGTCAG
+ATTTGGTTTTACCCACTTCCTGCAATACAGTGTGTAGTCGTAGGGCTTAATGCTCTGAAGAATGTTTTGAAAACATTAGGCGCACTACTGGCCTGGTCAA
+TAGGATATGGCAGTCTTAATTGTTTCGCTATGTCCGGCAATTTACTTGGATCGGGCGTAGGCGGTTTGTTGGTCTCGCTCCATATCCGCCATTATTTAAG
+TGTCCATATTTTGATGCCAGTCCCATTGAATCTATATACTGAACCGGATTCAGCGGATACTGATAAAATTCCATCCCCCTTCAGCCCAATCGGATCCTGA
+GTGATATACCTCCCTGCAGCGGGTCATAATAGCGGTGGCGGTTGTAATACAGGCCGGACTCCTCATCATACTGCTGCCCCGGCAGGCGGATAAGCTGCTG
+CAGCTGATGCGGGTTCTCTTCATTCAGCAGGTTGCCCCATTCATCGTATTCTGCGCACCATTCTGTTGCCCCTTCCGTGCTGACAAGCGCCAGCGGCAGG
+CCGCGATGGTCGCAGTGGTACAGGTGGATTTTCGCGCCGGCGTGTACACCGGGTCCATCTGGTTTTGCATCTGCTCCACCGTCAGGCCGCACGATGCCAG
+CCAGCGGCGGCTTTCCTCACTCACCCGGTCAGCCAGGATTTCACTTTCCAGCCGGTCGAGCATCTGCACCAGCACCGGCGGAACACCACACTGCCACCGT
+CTTCGCCGCCGGACTGCTGAAGGGTATCCGCCAGGCTGCGGCGCTGCGTTCGCCAGCTCACCGGTGGCGGTTTCAACCTGATGAGTGGCGTGAAGCTCCC
+CGGCTGATAAATCGTCTGGATGCGGGTTCTGTCGTTCTGTATCGTGGTCAGGCGGTCGCCGTCCCAGCCGTACCAGGTCACTTGCGGTTTCCGTGACAGC
+GACATCCAGCCCGTCAGGTCCCGTTCACGTCGCCACACCCGTTTTGCCACCCTGCGGCCCAGCGGGTCGTAAAGATAGCGGCTTTCGACCAGCGGCTCTG
+CATATTGTGTCCGCGTGTAGTGCACCAGCCGGTGCTGACTGTCGTAATGGTACCGGTGGGTGCGCTCATCATCCGTGCGGATAACCCTTCCGGGATGAGG
+TCGGTTTTCTCCGTCAGCCTGCCGTGACGGTCATACCGGTAAAGATAGTGCGCGTCACGGGCGATACGGTTATCCGGCCACATGCTGAGGGTGCTGTCCG
+GTGCAGCTCCGGTCGGGCAGGCGGTTACCTGCCGGGTCTGTGGCATACGGGATATCAATGCCCAGGTTACATATAATAATAAGAGCAATTAACTTAATTT
+ATTTGTTTATAATGCGCTTACTTAATACAAACCATTGAATATACCCTCCTGACAGAAAATAAAGCCATATTATTATCGCCATAATATACTTACTATCAAT
+CCTTACGCCAATAATGTCTGATACAGTCCCTATAAATATTAGAGCAATAAAGAATACTATGCCTGTTGGAAAACATATTACCATCATTCCATAAGACATG
+AGACTAATTAACTCGCTCACATCACGAGTGGAGTCTAATAGTGAAAGTCTATGCATGGAAAAGAATAGTATTAAAAGCGATAAAGCCAGCCATATAGCTC
+TGAATAAAAAATAATATATTTCATTACATCACTCCGGTGAATACAAATCTAATAAAACGTCCAATGTTATTTCCGGAGCACTTCATCTTACATGTTTCTA
+AAGAATCATTAGACCAGTCTTGGCAGTTTTAAATAGCCCTAAATTTATAGGTGTGAATATATCAGGCAATACAGAATAACGCGGCCTTACCTCTTTAAAC
+TTCCTTTTAAACAGTTCTCCACACAACTATTATCGGTTTCAACGAGGTCACAACGGCCAGCAGCTTCTTTGTATCATTACTTGCTTTACCTGGCCCCCAT
+AGACCATCTCCTTTGATTCTCCCCGTTGGTCTTGGCCACCACAAGTATAGTCCCTTTACCATCTGGGACACAAAGATATTGATGATAGAACGGATTCCCC
+ATATATCTGGACCGCTTCTTTCACCAGTTCCGCCCATTGAATGCAGTGGCTTAATGCATTTTAGTGTTTCTAATCCTAATGGATCTATATTTGAGATCGG
+ATTCAACGGATACTGATAAAATTCCATCCCCTTTCAGCCCAATCGGATCCTGAGTGATATATCGCCCCTGCAGCGGGTCATAATAGCGGTGGCGGTTGTA
+ATACAGGCCGGACTCCTCATCATACTGCTGCCCCGGCAGGCGGATAAGCTGCTGCAGCTGATGCGGGTTCTCTTCATTCAGCAGGTTACCCCATTCATCG
+TATTCTGCGTACCACGCTGTTGTCCCTTCCGTGCTGATATGGGCCAGCGGCAGGCCGCGATGGTCGCAGTGGTACAGGTGAATTTTTCGCGCCGGCGTGT
+ATACCGGGTCCATCTGGCTTTGCATCTGCGCCACCGTCAGGCCGCACGATGCCAGCCAGCGGCGGCTTTCCTCACTCACCCGGTCAGCCAGGATTTCACT
+TTCCAGCCGGTCGAGCATCTGCACCAGCACCGGCGGGAACACCACACTGCCACCGTCTTCGCCACCGGACTGCTGAAGGGTATCCGCCAGGCTGCGGCGC
+TGCGTTTTCGCCAGCTCACCGGTGGCGGTTTCAACCCTGATGAGTGGCGTGAAGCTCCCCGGCTGATAAATCGTCTGGATGCGGGTTCTGTCGTTCTGTA
+TCGTGGTCAGGCGGTCGCCGTCCCAGCCGTACCAGGTCACTTGCGGTTTCCGTGACAGCGACATCCAGCCCGTCAGGTCCCGTTCACGCCGCCATACCCG
+TTTTGCCACCCTGCGGCCCAGCGGGTCGTAAAGATAGCGACTTTCGACCAGCGGCTCTGCATATTGTGTCCGCGTGTAGTGCACCAGCCGGTGCTGACTG
+TCGTAATGGTACCGGTGGGTGCGCTCATCATCCGTGCGGATAACCCTTCCGGGATGAGGTCGGTTTTCTGTCAGCCTGCCGTGACGGTCATACCGGTAAA
+GATAGTGCGCGTCACGGGCGATACGGTTATCCGGCCACATGCTGAGGGCGCTGTCCGGGTGCAGCTCCGGTCGGGCAGGCGGTTACCTGCCGGGTCTGTG
+GTATACGGGATGCGGATATCCAGATTCGCTGCGGTGGTGTGAACGCCGGTCAGCCTGCCGGTGGTGCTGTAGCTGTAACTCCGGGTCTGGCGCGGGCTGC
+TGATGCGGATGAGTTCGCCGTTGTCGTTCCAGGTGTAATCGCGGTCAGACAGCAGGCTGTTCAGGTGCTGGCTCTGTAACTGCCCGGCAGGGGTATAAGC
+GGTGGTGAGTTCATAACGGCCGAAGCTGCGCAGCGTTTCCCGGTGCAGGCGGTCGCGGGTGTACTCCACCAGCGGTGTGTCGCCGAGTTTCATGCCTGAC
+AGCCAGCCGCTGCCGTAGGTCAGCCATTCCACGGCGGGCAGGCTGTCCGGTATACAGCGGTTCGCCAGTCCCTGTGCGTTGTACGCATGTCTGGTCTCAT
+GCTGCCAGAGCAGTTCATTCGTCTGCGGATGATGCACCGTCAGGTGTTCACTGGCGAGGCGGCCTTTACTGTCATAACCATAGTGCACCGTCACCCGGTG
+CCCTTCGCTGATATGGCTGATGTCTGTCAGCCAGCCGCGTTCGTCATACTGCCACCGCTCTGCGGTTTCGCCATTCACGGTGCGGTGCGTGAGGCGGTCT
+GCTTCGTCATAGTGCCAGTGGGTGACCAGCCCTCATCCTCGCTGCGGATAAGTTTGCCGGTCAGGTCGTGGTGATAACGCTGTGTGCGGCCGTCAAAGCC
+GGTTTCCTGTATCAGCCGGTCGAGTACATCGTAACGGAAGGTGGTGTGGCTGCCGTTTTCACTGGTCAGGCGGATGACCCGTCCGGCAGCATCGTATTCC
+ATACTGCGCGTCAGACCGCCCTGCGTGGTACAGATGGCTTTTCCCCACGCATCGTACTGTGTCCCGTTTCTGCTGCCGTCCGGGGCAATGACGGTGGTCA
+GGTCACCGGCGGCGTTGTATTCATACCGCGTTTCATGGCCCTGCGTGTCTTTCACGGCAATTAACTGTCCACGGCTGTCGTATGCGCGGTACTGACTCAG
+CCCTTCCTCGCGGTGCACCGCCGTCACCTGACCAAAACGGTCATGGTCATAGCGGGTTACATAACCGGAACAGTCAGTGAAGCTCAGCAACTGACCGTAA
+CGGCTCCACGTCATGGTTTTCCGGCTGCCGGTGGCATCTTCCGTTGCGCAGGGTAAGTCACTGTGTGGATTATCATAACGGTAGCGGGTGATATCGCCGT
+CAGGGGCAGTTTCCTGAATCAGACGGCCCCATTCATCATATTCCCGGCGTATTTCCAGCCCGTCAGGCCCGGTGGCTGACGTTAACTGGCTGTGGTGGTT
+ATAGTAAAACGCCGATGCCCTGCCATCCGGCGTGGTGATGCGCGTGATGAGGCCCGTCACCACATCCGGACTGTATTCTGTTGTCCTGCCTGCGGCATCC
+GTCTGTGCCCTGAGCCTGCCCACCGCGTCAAACTGACTCTGCGTGACGCTGCCGTCCGCGTGTTCCTTTTCACCACCCGCTTCAGCCCGCCTTCACCCTG
+CGTGTGCAGGACTTCACGGCGGTTCAGGCTGTCGGTGATGGTGATGCGGTCCTTCTCATACTGATACGTGTAACTTAAGCCTGCCGGGTTTAGCTGTTCT
+GTCACCCGCCCGTCGCTGTCGTAACGGTAACAGATTTCCGGTCGGCCCGTGTGACGGTGCGCCACCATCCGGCCCCGGTATTTATCATCGTAAGTAAAGC
+TGCGCACCTGTGTATTGCTGCGGTCATACACCGCCGCCAGTTCGCCGCGGGCGTCCAGCCATAGCGCACCAGCGGCGCGGCAGGTAAATTCTCCGGGTAT
+TCCGGGTCGTGCGTCAGCCACACGGCAGACAGACGGATGCCGTTGTCCCGGCCATATTCGGTGTAACCCGGCAGGGTATCAGGAAAAGCGGACGGTTCCG
+TCCCGCCGGAAATGGCCTGCTGCCGGGCTTCTTCTGCCCGCTGCGCCTGCGTGGTCAGTACCAGCCGGAAGTGACGCCCGGCACCATCCGTCACGCCGGT
+GATTTCGCCGCTGAATTCACCGGCGGCTTCGCGGTGGAACGTCTGTGTGCGCCCGAAGCGGTCCACCAGCCCGGTCAGTACCCGGTACGGCGGCAGCGGC
+GCAGGCAGCACCTCATCCGCTTCCGGCACCCGCTCACACCAGCCGAGCAGCCACCACGGCCCCTGCGGACTGTTTGTCGCCAGATAACGATGCGGACTTA
+AGCGGAGTTCTTCCGGCAGCGCCTGCCAGAGTGCGGCCAGCCGGTGACCTTCATCCAGTTTCGCCACGCCGCCGCGCACCAGCCACAGTGACTCGCTGCG
+GCTGTAACCGTCCTCACCGGGAAACAGGTGCTCAAAATACAGGCTTCTGCCGCCGTTATCACTGAGTATCAGTGTGTTATCGCGCAGCTGTAAGCGGATA
+TCCGCAGGCATTTTCCAGCCGGGGCCGAGGCTCCCCACCGGCGCGGGCGTTTTGTCCGGTAACTGCTGTAGGTGCGGGAGAGAATGAACGGCAGCGGGCC
+GGGCAGGGCGATGTCGGTTTCACCGGGAAGGACCTTTGCACCGAGCAGCGGATTGACCGGATGGCCGGACGTCACCCGCCGGGGCACACCGAACAGGCCA
+CGCCGGTGGGGCACCGATGCGTACCCCGGCTGAACCCTGGACAATGCTACCGCCATACTGCGTCATGTCGCCCTGACGCGCCGCCGGTTTTCCGCTCATC
+TGCTCATCCTTGTTTTATCGGGTTATTTGTCTGCTGACAGGCGAAACCCTACAGATTTATAAGAAAGCCTTAAGTGAGATATCTGTCAGATAAGAACAAT
+TAGGAAAATATTTATATATATTTCATGAATATATGTTTCGATTGGTATAACGATGTCTAAATATTCCTCTGAACATCTTCCTGATACAAAAACCGCCAGC
+GTTTCCGCTGGCGGTTTTCAATGTATTCAAAACTCAGCAATCAATAAAATCACCAGTTGCCTTTTCGGCCTGATCCATCCACACCGGTTTATCGCTGGTT
+TTCGACCAGACGCGATGCAGGTAGCTGTAAAAGCGGGCGCGGTCTTTCCAGAAAAGCATGAAAGGCAGCGCCAGAACGCCCGCTGCAACCGCATAAGTAC
+GGCGTAAAAAGATAAGCCATGCAGGATATTCTCTGTAGAGTTCCATACTTTTCTCCCCTTTTGTATCTACCCGGTGAATGGCACCGGAAAAATGAATTTG
+TTTATCTGATGAAAATAGTACCGCCTTTGTGTAATTTTACTACTCATCCGACCACTTATTTTTGCTTATTGATGGTTTATTTACATTCATCCTGTAATTA
+AGTTACACAAAAGTTAAATTAATACTAAACATTAGTTAAATCATGGCTTTTGCCATTTTTATACTTTTACACCCCGCCCGCAGATTTTTGCGAAATCTTT
+GCAGCCAGAATTCTACCCTTCCGGTATCACTTTTAGGCCACTGGAGGTGCACTGTGAGTGCAGGCGTGATAACCGGCGTATTGCTGGTGTTTTATTACTG
+GGTTATCTGGTTTATGCCCTGATCAATGCGGAGGCGTTCTGATGGCTGCGCAAGGGTTCTTACTGATCGCCACGTTTTTACTGGTGTTAATGGTGCTGGC
+GCGTCCTTTAGGCAGCGGGCTGGCGCGGCTGATTAATGACATTCCTCTTCCCGGTACAACGGGCGTTGAGCGCGTACTTTTCGCGCACTTGGCGTCTCTG
+ACCGTGAGATGAACTGGAAGCAATATCTTTGTGCCATTCTCGGCCTGAACATGCTGGGGCTGGCGGTGCTGTTTTTATGTTGCTCGGTCAGCACTATCTG
+CCGCTTAATCCACAGCAGTTGCCAGGGCTGTCGTGGGATCTGGCGCTGAATACCGCCGTCAGCTTTGTCACCAATACCAACTGGCAATCTTATAGCGGTG
+AAACCACGTTGAGCTATTTCAGCCAGATGGCGGGCTTAACGGTGCAAAACTTTCTTTCTGCCGCCAGCGGGATTGCGGTGATTTTGCCCTCATCCGTGCG
+TTTACCCGCCAGAGCATGAGCACGCTCGGGAATGCCTGGGTCGATCTGCTACGCATCACGTTATGGGTGCTAGTCCCTGTGGCGTTGTTGATTGCACTGT
+TTTTATTCAACAAGGTGCGCTGCAAAACTTTCTGCCTTATCAGGCTGTGAATACCGTTGAAGGAGCGCAACAGCTGTTACCCATGGGGCCTGTAGCTTCT
+CAGGAAGCGATCAAGATGCTCGGTACTAACGGCGGTGGCTTCTTTAATGCCAACTCGTCGCATCCGTTTGAAAACCCAACCGCACTGACCAACTTCGTGC
+AGATGCTGGCGATCTTCTTGATCCCAACGGCGCTGTGCTTTGCCTTTGGTGAAGTGATGGGCGATCGCCGCCAGGGGCGCATGTTGCTGTGGGCGATGTC
+AGTGATTTTGTCATCTGCGTAGGCGTGGTGATGTGGGCAGAAGTTCAGGGTAATCCTCATCTGCTGGCACTGGGCACGGACAGCAGCATCAATATGGAAG
+GTAAAGAGAGCCGTTTCGGCGTGCTGGTCAGTAGCCTGTTTGCGGTCGTGACGACGGCGGCTTCCTGTGGCGCGGTGATTGCGATGCATGATTCGTTTAC
+CGCTCTCGGTGGCATGGTGCCGATGTGGCTGATGCAAATTGGTGAAGTGGTGTTCGGCGGTGTCGGTTCTGGTCTTTACGGCATGATGCTGTTTGTCCTG
+CTGGCGGTGTTTATTGCCGGGCTGATGATTGGTCGTACACCGGAATATCTGGGTAAAAATCGACGTACGCGAGATGAAACTGACTGCACTGGCAATTCTG
+GTTACCCCGACGCTGGTGCTGATGGGCGCGGCGTTGGCGATGATGACCGACGCCGGACGTAGCGCCATGCTCAACCCTGGCCCGCATGGTTTTAGCGAAG
+TGCTGTACGCCGTGTCATCCGCCGCTAACAACAACGGCAGCGCCTTTGCCGGATTAAGCGCCAACTCTCCGTTCTGGAACTGTTTACTGGCGTTCTGCAT
+GTTTGTCGGTCGCTTCGGGGTGATTATCCCGGTGATGGCAATTGCCGGTTCGCTGGTGAGTAAAAGAGCCAAGCCGCCAGCTCCGGCACGCTGCCAACGC
+ACGGCCCGCTGTTTGTTGGCCTGTTAATCGGCACCGTGTTGCTGGTTGGCGCACTGACCTTTATCCCTGCCCTGGCGCTTGGTCCGGTGGCGGAATATCT
+CTCCTGATGATATTGAGTGAGCACTGAATATGAGTCGTAAACAACTGGCGCTATTCGAACCAACACTTGTCGTTCAGGCGCTGAAAGAAGCGGTGAAAAA
+ATTAAACCCGCAGGCGCAATGGCGCAATCCGGTGATGTTTATCGTCTGGATCGGCAGTCTGCTGACCACCTGTATTAGCATCGCGATGGCAAGCGGTGCG
+ATGCCCGGCAATGCGCTGTTTAGCGCGGCCATTAGCGGTTGGCTGTGGATCACCGTACTGTTCGCTAATTTCGCCGAGGCGCTGGCAGAAGGCCGCAGTA
+AAGCGCAGGCCAACAGTCTGAAAGGGTGAAAAACTGCCTTTGCCCGCAAGCTGCGTGAGCCGAAATATGGCGCTGCGGCGGACAAAGTTCCTGCCGACCA
+ACTTCGTAAAGGCGATATCGTACTGGTAGAAGCTGGCGATATTATCCCCTGCGATGGTGAAGTTATTGAAGGGGTGCATCGGTCGATGAAAGCGCCATCA
+CCGGGGAATCGGCACCGGTGATCCGTGAATCCGGCGGCGATTTTGCCTCCGTCACCGGCGGCACGCGTATTCTTTCTGACTGGCTGGTGATTGAGTGTAG
+CGTTAACCCCGGCGAGACATTTCTGGATCGGATGATCGCGATGGTGGAAGGCGCACAGCGACGCAAAACGCCGAACGAAATTGCCCTGACCATTCTGCTG
+ATTGCCCTGACTATCGTCTTTTACTGGCAACCGCCACGCTGTGGCCGTTTTCCGCGTGGGGCGGTAATGCAGTCAGCGTAACGGTACTGGTGGCGCTGCT
+GGTCTGTCTGATCCCAACCACTATTGGCGGCCTGTTGTCAGCGATCGGCGTCGCCGGGATGAGCCGGATGCTAGGCGCGAATGTGATTGCCACCAGCGGA
+CGTGCAGTTGAAGCGGCAGGTGACGTTGACGTTCTGCTACTGGATAAAACCGGCACCATCACACTCGGTAACCGTCAGGCGTCGGAGTTTATCCCCGCGC
+AGGGCGTGGATGAAAAACGCTGGCTGACGCCGCACAACTGGCTTCGCTGGCTGATGAAACGCCGGAAGGCCGCAGTATTGTGATCCTCGCCAAGCAGCGT
+TTTAACCTGCGCGAGCGCGATGTGCAGTCGCTCCATGCCACCTTTGTACCGTTTACTGCGCAAAGCCGGATGAGCGGGATCAACATCGACAACCGCATGA
+TCCGTAAAGGTTCTGTCGATGCCATTCGTCGCCATGTTGAGGCTAACGGTGGTCACTTCCCTACCGATGTTGATCAAAAGTCGATCAGGTTGCGCGTCAG
+GGAGCCACGCCGCTGGTGGTGGTGGAAGGTTCTCGTGTGCTGGGCGTTATTGCGCTGAAAGATATCGTCAAAGGCGGTATTAAAGAGCGCTTCGCCCAGC
+TGCGCAAAATGGGCATTAAAACGGTGATGATTACCGGCGATAACCGTCTGACTGCCGCCGCGATTGCTGCGGAAGCGGGTGTCGATGATTTTCTCGCCGA
+AGCGACACCGGAGGCCAAGCTGGCATTGATCCGTCAGTATCAGGCGGAAGGTCGTTTGGTAGCGATGACCGGCGACGGCACCAACGATGCTCCGGCGCTG
+GCGCAGGCAGATGTCGCGGTGGCGATGAACTCCGGCACCCAGGCGGCGAAAGAGGCGGGCAATATGGTCGATCTCGACTCTAACCCGACCAAGTTGATCG
+AGGTGGTGCACATTGGCAAACAGATGCTGATGACCCGTGGCTCGCTGACCACCTTCAGCATTGCCAACGATGTGGCGAAATACTTCGCCATTATTCCGGC
+GGCATTCGCGGCAACGTATCCGCAGTTAAATGCGCTGAACATCATGTGCCTGCATTCGCCCGACTCCGCAATCCTCAGTGCGGTGATTTTCAACGCCTTG
+ATTATCGTCTTTGATTCCCCTGGCGTTAAAGGCGTGAGTTATAAACCGCTTACCGCTTCTGCCATGTTGCGCCGTAACTTATGGATTTACGGTCTGGGTG
+GGCTGCTGGTGCCGTTTATCGGTATCAAAGTCATTGATTTACTGCTGACCGTTTGCGGTCTGGTGAGGTTTACCATGAGTGGATTACGTCCGGCATTATC
+AACATTTATCTTTCTGTTATTGATTACTGGCGGCGTTTACCCGCTGCTGACCACCGTACTGGGGCAATGGTGGTTTCCTGGCAGGCCAATGGTTCGTTGA
+TTCGTGAAGGTGATACGGTGCGCGGTTCGGCATTAATCGGGCAGAATTTTACCGGCAACGGCTATTTTCATGGTCGCCCGTCGGCAACGGCAGAAATGCC
+CTATAATCCACAGGCTTCTGGCGGGAGCAATCTGGCGGTCAGTAACCCTGAGCTGGATAAACTAATAGCCGCACGCGTTGCTGCATTACGGGCCGCTAAC
+CCGGATGCCAGCGCGAGCGTTCCGGTTGAACTGGTGACGGCATCGGCAAGCGGGCTGGACAATAATATCACCCGCAAGCGGCGGCCTGGCAAATCCCACG
+CGTGGCGAAAGCGCGTAATCTCAGCGTTGAACAGCTCACGCAACTGATCGCAAAATACAGCCAACAACCGCTGGTGAAATATATCGGCCAGCCGGTTGTC
+AACATTGTTGAACTCAATCTGGCGCTGGATAAACTTGATGAATAACGAACCCTTACGTCCCGACCCCGATCGTCTGCTGGAACAAACTGCCGCGCCGCAT
+CGGGGAAGCTGAAAGTTTTCGGTGCCTGTGCAGGCGTCGGGAAGACCTGGGCGATGCTGGCAGAAGCCCAGCGACTGCGGGCGCAAGGGCTGGATATTGT
+GGTTGGCGTGGTAGAAACCCACGGGCGAAAGATACCGCCGCCATGCTGGAAGGGCTGGCTGTTCTGCCGTTAAAACGCCAGGCGTACCGTGGGCGGCATA
+TCAGCGAGTTTGATCTCGATGCCGCCCTCGCCCGCCGCCCGGCGCTGATCTTAATGGACGAACTGGCGCACAGTAATGCGCCAGGTTCCCGTCATCCCAA
+ACGCTGGCAGGATATCGAAGAACTGCTGGAAGCTGGCATTGATGTTTTCACTACCGTCAACGTTCAGCATCTGGAAAGTCTGAATGATGTGGTCAGCGGC
+GTCACCGGAATTCAGGTACGGGAAACCGTGCCCGATCCTTTTCGATGCCGCCGACGACGTGGTGCTGGTGGACTTGCCCCGGACGATCTGCGCCAGCGGC
+TGAAAGAAGGCAAAGTCTATATTGCCGGGCAGGCGGAGCGCGCCATTGAACATTTTTCCGCAAAGGTAATCTGATCGCCCTGCGCGAACTGGCACTGCGC
+CGTACTGCCGATCGCGTTGATGAGCAAATGCGCGCCTGGCGGGGCATCCTGGCGAAGAGAAAGTGGCACACGCGCGACGCGATCCTTTTATGCATCGGCC
+ATAACACCGGCAGCGAAAACTGGTCCGCGCAGCGGCGCGGCTGGCGTCACGGCTGGGTAGCGTCTGGCACGCGGTGTATGTTGAAACCCCTGCCCTGCAC
+CGCTTACCGGAAAAACGTCGGGCAATTCTCAGCGCCTTACGTCTGGCGCAGGAACTGGGCGCGAGACGGCAACACTTTCTGATCCAGCGGAAGAGAAAGC
+GGTAGTGCGTTATGCCCGTGAACATAATCTCGGCAAGATTATTCTCGGTCGCCCGGCCTCGCGCCGCTGGTGGCGTCGGGAAACGTTTGCTGACCGACTG
+GCGCGCATCGCCCCGATCTCGATCAGGTGCTGGTCGCGCTTGATGAACCACCCGCCCGCACGATTAACAACGCGCCGGATAACCGCTCTTTTAAAGACAA
+GTGGCGTGTACAAATTCAGGGATGCGTGGTTGCCGCCGCGTTATGCGCCGTTATCACCTTAATTGCCATGCAGTGGCTGATGGCGTTTGATGCCGCCAAC
+CTGGTGATGCTGTATCTGCTTGGCGTGGTGGTGGTGGCGCTATTTTATGGACGCTGGCCTTCAGTGGTTGCCACCGTCATTAATGTAGTGAGTTTCGATC
+TCTTTTTATCGCCCCACGCGGCACGCTCGCCGTCTCTGATGTGCAATATCTGCTGACCTTCGCGGTGATGTTAACCGTCGGGCTGGTGATCGGGAACCTT
+ACTGCTGGCGTGCGTTATCAGGCGCGGGTAGCCCGTTACCGCGAGCAACGCACACACGGCACTTATATGAAATGTCGAAAGCTCTGGCGGTGGGCCGCAG
+TCCGCAGGATATCGCTGCCACCAGCGAACAATTTATTGCCTCCACGTTTCATGCCCGCAGTCAGGTGTTGTTGCCCGATGACAACGGTAAATTGCAGCCG
+TTAACACATCCGCAAGGAATGACGCCGTGGGACGATGCCATCGCGCAGTGGAGTTTTGATAAAGGCCTGCCTGCGGGCGCGGCACCGACACGTTACCCGG
+TGTACCGTACCAGATTTTGCCGCTAAAAAGCGGCGAGAAACCTACGGGCTGGTGGTGGTGGAGCTGGGAATCTGCGCCAGTTGATGATCCCGGAACAGCA
+GCGCCTGCTGGAGACGTTACGCTGTTAGTCGCCAATGCCCTGAGCGGCTGACGCTAACCGCCAGCGAAGAACAGGCGCGGATGGCAAGCGAACGTGAACA
+GATCCGCAACGCCTGCTGCTGGCGGCGCTTTCGCATGATTTACGCACGCCGCTTACGGTGCTGTTTGGTCAGGCAGAAATCTTAACGCTCGATCTGCAAG
+CGAAGATCACCACGCCCGCCAGGCCAGCGAGATCCGTCAGCATGTGCTGAACACTACCCGACTGGTGAATAATCTACTGGATATGGCGCGAATTCAGTCC
+GGCGGCTTTAATTTGAAGAAAGAGTGGTTAACGCTGGAAGAAGTAGTCGGCAGCGCGCTGCAAATGCTGGAACCGGGTTTATCGTCGCCCATCAATCTTT
+CTCTGCCAGAACCGCTGACCTTAATCCACGTTGACGGGCCACTTTTGAACGGGTGCTGATTAATCTGCTGGAGAACGCGGTGAAATATGCGGGTGCGCAG
+GCCGAAATTGGTATCGATGCCCACGTTGAGGGCGAAAATCTACAACTGGATGTCTGGGATAACGGCCCCGGTCTTCCGCCAGGCCAGGAGCAGACGATAT
+TTGATAAGTTTGTTCGCGGAATAAAAGAGCAGTACCGGGGGTAGGGCTTGGACTGGCAATTTGTCGGGCGATAGTGGATGGTACGGGGGCACTATTACCG
+CGTTCAACCGACCGGAAGGTGGTGCCTGTTTTCGTGTTACACTTCCCCAGCAAACTGCCCCTGAACTTGAAGAATTTCATGAGGATATGTGACAAACGTT
+CTGATTGTTGAAGATGAACAGGCTATTCGTCGCTTTCTGCGCACGGCGCTGGAGGGGCGATGCGCGTCTTTGAGGCCGAAACGCTGCAACGCGGCTTGCT
+GGAAGCGGCAACCCGTAAGCCAGATTTGATTATTCTCGATCTCGGCCTGCCCGATGGTGATGGGATTGAGTTTATCCGCGACCTGCGCCAGTGGAGCGCG
+GTGCCGG
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/canu_contigs_result2.fa	Fri Jun 08 04:43:41 2018 -0400
@@ -0,0 +1,10 @@
+>tig00000001 len=370 reads=77 covStat=-52.68 gappedBases=no class=contig suggestRepeat=no suggestCircular=no
+GTTATTATTATGTCCTACAAGCATTAATTAATTAACACACTTTAGTAAGTATGTTCGCCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGC
+AGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGG
+AGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGTTTTATGACCCTGAA
+GTAGGAACCAGATGTCGGATACAGTTCACTTTAGCTACCCCCAAGTGTTATGGGCTAAGGCGAATCTCGT
+>tig00000007 len=305 reads=6 covStat=-3.47 gappedBases=no class=contig suggestRepeat=no suggestCircular=no
+AACACACTTTAGTAAGTATGTTCGCCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTG
+CTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGA
+CCTGTGATCCATCGTGATGTCTTATTTAAGTCTCTTATACACATCTCCGAGCCCACGAGACTAAGGCGAATCTCGTATGCCGTCTTCTGCTTGAAAAAAA
+AAAAC
Binary file test-data/canu_corrected_reads.fa.gz has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/canu_unassembled_result1.fa	Fri Jun 08 04:43:41 2018 -0400
@@ -0,0 +1,758 @@
+>tig00000005 len=6788 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
+CAATACCAACTGGCAATCTTATAGCGGTGAAACCACGTTGAGCTATTTCAGCCAGATGGCGGGCAACAGTGCAAAACTTTCTTTCTGCCGCCAGCGAATT
+GCAGTGATTTTGCCCTCATCCGTGCGTTTTACCCGCCAGAGCATGAGCACGCTCAGGAATGCCTGGGTCGATCTGCTACGCATCACGTTATGGGTGCTAG
+TCCCTGTGGCGTTGTTGATTGCACTGTTTTTTATTCAACAAGGTGCGCTGCAAAACTTTCTGCCTTATCGGGCTGTGAATACCGTTGAAGGGCGCAACAG
+CTGATACCATGGGGCCTGTAGCTTCTCAGGAAGCGATCAAGATGCTCAGTACTAACGGCGGCTTCTTTAATGCCAACTCTGTCGCATCCGTTTGAAAACC
+CAACCGCACTGACCAACTTCGTGCAGATGCTGGCGTCTTCTTGATCCCAACGGCGCTGTGCTTTGCCTTTGGTGAAGTGATGGGCGATCGCCGCCAGGGG
+CGCATGTTGCTGTGGGCGATGTCAGTGATTTTTGTCATCTGCGTAGGCGTGGTGATGTGGGCAGAAGTTCAGGGTAATCCTCATCTGCTGGCACTGGGCA
+CGGACAAGCAGCATCAATATGGAAGGTAAAGAGAGCCGTTTCGGCGTGCTGGTCAGTAGCCTGTTTGCGGTCGTGACGACGGCGGCTTCTGTGGCGCGGT
+GATTGCGATGCATGATTCGTTTACCGCTCTCGGTGGCATGGTGCCGATGTGGCTGATGCAAATTGGTGAAGTGGTGTTCGGCGGTGTCGGTTCTGGTCTT
+TACGGCATGATGCTGTTTGTCCTGCTGGCGGTGTTTATTGCCGGGCTGATGATTGGTCGTACACCGGAATATCTGGGTAAAAAATCGACGTACGCGAGAT
+GAAACTGACTGCACTGGCAATTCTGGTTACCCCGACGCTGGTGCTGATGGGCGCGGCGTTGGCGATGACCGACGCCGGACGTAGCGCCATGCTCAACCCT
+GGCCCGCATGGTTTTGGCGAAGTGCTGTACGCCGTGTCATCCGCCGCTAACAACAGCAGCAGCGCCTTTGCCGGATTAAGCGCCAACTCTCCGTTCTGGA
+ACTGTTTACTGGCGTTCTGCATGTTTGTCGGTCGCTTCCGGGGTGATTATCCCGGTGATGGCAGTGCCGGTTCGCTGGTGAGTAAAGCCAAGCCGCCAGC
+TCCGGCACGCTGCAACGCACGGCCCGCTGTTTGTTGGCCTGTTAATCGGCACCGTGTTGCTGGATTGGCGCACTGACCTTTATCCTGCCCTGGCGCTTGG
+TCCGTGGCGGAATATCTCTCCTGATGATATTGGTGAGCACTGAATATGAGTCGTAAACAACTGGCGCTATTCAGACCAACACTTGTCGTTCAGGCGCTGA
+AAGAAGAAGCGTTGAAAAATTAAACCCGCAGGCGCAATGGCGCAATCCGGTGATGTTTATCGTCTGGATCGGCAGTCTGCTGACCACCTGTAATAGCATC
+GCGATGGCAGGCGGTGCGATGCCCGGCAATGCGCTGTTTAGCGCGGCCATTAGCGGTTGGCTGTGGATCACCGTACTGTTCGCTAATTTCGCCGGGCGCT
+GGCAGAAGGCCGCAGTAAAGCGCAGGCCAACAGTCTGAAAGGGTGAAACTGCCTTTGCCCGCAAGCTGCGTGAGCCGAAATATGGCGCTGCGGCGGACAA
+AGTTCCTGCCGACCAACTTCGTAAAGGCGATATCGTACTGGTAAAGCCTGATATTATCCCCTGCGATGGTGAAGTTATTGAAGAGGGTGCATCGGTCGAT
+GAAAGCGCCATCACCGGGAATCGGCACCGGTGATCCGTGAATCAGCGGCGATTTTGCCTCCGTCACCGGCGGCACGCGTATTCTTTCTGACTGGCTGGTG
+ATTAGTGTAGCGTTAACCCGGCGAGACATTTCTGGATCGGATGATCGCGATGGTGGAAGGCGCACAGCGACGCAAAACGCCGAACGAGAACGCCTGACCA
+TTCTGCTGATTGCCCTGACTATCGTCTTTTACTGGCAACCGCCACGTAGCCGTTTTCCGCGTGGGGCGGTAATGCAGTCAGCGTAACGGTACTGGTGGCG
+CTGCTGGTCTGTCTGATCAACCACTATTGGCGGCCTGTTGTCAGCGATCGGCGTCGCCGGGATGAGCCGGATGCTAGGCGCGAATGTGATTGCCACCAGC
+GGACGTGCAGTTGAAGCGGCAGGTGACGTTGACGTTCTGCTACTGGATAAAACCGGCACCATCACACTCGGTAACCGTCAGGCGTCGGGTTTATCCCCGC
+GCAGGGCGTGGATGAAAAACGCTGGCTGACGCCGCACAACTGGCTTCGCTGGCTGATGAAACGCCGGAAGGCCGCAGTATTGTGATCCTCATAAGCAGCG
+TTTTAACCTGCGCGAGCGCGATGTGCAGTCGCTCCATGCCACCTTTGTACCGTTTACTGCGCAAAGCCGGATAGCAGGATCAACATCGACAACCGCATGA
+TCCGTAAAGGTTCTGTCGATGCCATTCGTCGCCATGTTGAGGCTAACGGTGGTCACTTCCCTACCGATGTTGATCAAAAGTCGATCAGGTTGCGCGTCAG
+GGGAGCCACGCCGCTGGTGGTGGTGGAAGGTTCTCGTGTGCTGGGCGTTATTGCGCTGAAGATATCGTCAAAGGCGGTATTAAAGAGCGCTTCGCCCAGC
+TGCGCAAAATGGGCATTAAAACGGTGATGATTACCGGCGATAACCGTCTGACTGCCGCCGCGATTGCTGCGGAAGCGGGTGTCGATGATTTTCTCGCCGA
+AGCGACACCAGGTAAGCTGGCATTGATCCGTCAGTATCAGGCGGAAGGTCGTTTGGTAGCGATGACCGGCGACGGCATAACGATGCTCCGGCTGGCGCAG
+GCAGATGTCGCAGTGGCGATGACTCCAGCGCAGGCGGCGAAAGGCGGGCAATATGGTCGATCTCGACTCTAACCCGACCAAGTTGATCGAGGTGGTGCAC
+ATTGGCAAACAGATGCTGATGACCCGTGTCGCTGACCACCTTCAGCGTACCAACGATGTGGCGAAATACTTCGCCATTATTCCGGCGGCATTCGCGGCAA
+CGTATCCGCAGTTAAATGCGCTGAACATCATGTGCCTGCATTCGCCCGACTCCGCAATCCTCAGTGCGGTGATTTTCAACATGATTATCGTCTTTGATTC
+CCTGGCGTTAAAAGGCGTGAGTTATAAACCGCTTACCGCTTCTGCCATGTTGCGCCGTAACTTATGGATTTACGGTCTGGGTGGGCTGCTGGTGCCGTTT
+ATCGGTATCAAAGTCATTGATTTACTGCTGACCGTTTGCGGTCTGGTGTAGGTTTACCATGAGTGGATTACGTCCGGCATTATCAACATTTATCTTTCCG
+TTATTGATTACTGGCGTTTACCCGCTGCTGACCACCGTACTGGGGCAATGGTGGTTTCCTGGCAGGCCAATGGTTCGTTGATTCGTGAAGGTGATACGGT
+GCGCGGTTCGGCATTAATCAGGCAGAATTTACCGGCAGCAGCTGTTTTCATGGTCGCCCGTCAGCAGCAGCAGAAATGCCCTATAATCCACAGGCTTCTG
+GCAGGAGCAATCTGGCGGTCAGTAACCCTGAGCTGGATAAACTAATAGCCGCGCGTTGCTGCATTACGGGCCGCTAACCCGGATGCCAGCGCAGGCGTTC
+CAGTTGAACTGGTGACGGCATCGGCAAGCGGGCTGGACAATAATATCACCCATAAGCGGCGGCCTGGCAAATCCCACGCGTGGCGAAAGCGCGTAATCTC
+AGCGTTGACAGCTCACGCAACTGATCGCAAAATACAGCCAACAACCGCTGGTGAAATATATCGGCCAGCCGGTTGTCAACATTATTGAACTCAATCTGGC
+GCTGGATAAACTTGATGAATAACGAACCCTTACGTCCCCACCCCGATCGTCTGCTGGAACAAACTGCCGCGCCGCATCGGGAAGCTGGATTTTCTTCGGT
+GCCTGTGCAGGCGTCGGGAAGACCTGGGCGATGCTGGCAGAAGCCCAGCGACTGCGGAGCGCAAAGGGCTGGATATTGTGGTTGGCGTGGTAGAAACCCA
+CGGGCGAAAGATACCGCCGCCATGCTGGAAGGGCTGGCTGTTCTGCCGTTAAAACGCCAGGCGTACCGTGGGCGGCATATCAGCGAGTTTGATCTCGATG
+CCGCCCTCGCCCGCCGCCCGGCGCTGATCTTAATGGACGAACTGGCGCACAGTAATGCGCCAGGTTCCCGTCATCCCAAACGCTGGCAGGATATCGAAGA
+ACTGCTGGAAGCTGGCATTGATGTTTTCACTACCGTCAACGTTCAGCATCTGGAAAGTCACGATGATGTGGTCAGCGGCGTCACCGGAATTCAGGTACGG
+AAACCGTGCCCGATCCTTTCGATGCCGCCGACGACGTGGTGCTGGTGGACTTGCCCCGGACGATCTGCGCCAGCGGCTGAAAGAAGGCAAAGTCTATATT
+GCCGGGCAGGCGGGCGCGCGCCATTGAACATTTTTCCGCAAAGGTAATCTGATCGCCCTGCGCGAACTGGCACTGCGCCGTACTGCCGATCGCGTTGATG
+AGCAAATGCGCGCCTGGCGGGGGCGTCCTGGCGAAGAGAAAGTGTGGCACACGCGCGACGCGATCCTTTTATGCATCGGCCATAACACCGGCAGCGAAAA
+ACTGGTCCGCGCAGCAGCGCGCAGCGTCACGGCTGGGTGGCGTCTGGCACGCGGTGTATGTTGAAACCCCTGCCCTGCACGCTTACCGGAAAAAACGTCG
+GGCAATTCTCAGCGCCTTACGTCTGGCGCAGGAACTGGGCGCGGGGACGGCAACACTTTCTGATCAGCGGAAGAGAAAGCGGTAGTGCGTTATGCCCGTG
+AACATAATCTCGGCAAGATTATTCTCCGGTCGCCCGCCTCGCGCCGCTGGTGGCGTCGGGGATTTGCTGACCGACTGGCGCGCATCGCCCCGATCTCGAT
+CAGGTGCTGGTCGCGCTTGATGAACCACCCGCCCGCACGATTAACAACGCGCCGGATAACCGCTCTTTTAAAGACAAGTGGCGTGTACAAATTCAGGGGA
+TGCGTGGTTGCCGCCGCGTTATGCGCCGTTATCACCTTAATTGCCATGCAGTGGCTGATGGCGTTGATGCCGCCAACCTGGTGATGCTGTATCTGCTTGG
+CGTGGTGGTGGTGGCGCTATTTATGGACGCTGGCCTTCAGTGGTTGCCACCGTCATTAATGTAGTGAGTTTCGATCTCTTTTATCGCCCGCGGCACGCTC
+GCCGTCTCTGATGTGCAATATCTGCTGACCTTCGCGGTGATGTTAACCGTCGGGCTGGTGATCAGGAACCTTACTGCTGGCGTGCGTTATCAGGCGCGGG
+TAGCCCGTTACCGCGAGCAACGCACACGGCACTTATATGAAATGTCGAAAGCTCTGGCGGTGGGCCGCAGTCCGCAGGATATCTGCCACCAGCAGACAAT
+TTATTGCCTCCACGTTTCATGCCCGCAGTCAGGTGTTGTTGCCCGATGACAACGGTAAATTGCAGCCGTTAACACATCCGCAAGGGAATGACGCCGTGGG
+ACGATGCCATCGCGCAGTGGAGTTTTGATAAAGGCCTGCCTGCGGGCGCGGGCACCGACGTTACCCGGTGTACCGTACCAGATTTTGCCGCTAAAAAGCG
+GCGAGAAAACCTACGGGCTGGTGGTGGTGGAGCCGGGGAATCTGCGCCAGTTGATGATCCCGGAACAGCAGCGCCTGCTGGAACGTTACGCTGTTAGTCG
+CCAATGCCCTTGAGCGGCTGACGCTAACCGCCAGCGAAGAACAGGCGCGGATGGCAAGCGAACGTGAACAGATCCGCAACGCCCTGCTGGCGGCGCTTTC
+GCATGATTTACGCACGCCGCTTACGGTGCTGTTTGGTCAGGCAGAAATCTTAACGCTCGATCTGGCGAAGCGAGGATCACCCCACGCCCGCCAGGCCAGC
+GAGATCCGTCAGCATATTAACTTCACTACCCGACTGGTGAATAATCTACTGGATATGGCGCGAATTCAGTCCGGCGGCTTTAATTTGGAAGAAAGAGTGG
+TTAACGCTGGAAAGAAGTAGTCGGCAGCGCGCTGCAAATGCTGGAACCGGGTTTATCGTCGCCCATCAATCTTTCTCTGCCAGAACCGCTGACCTTAATC
+CACGTTGACGGGCCTCTTTGAACGGGTGCTGATTAATCTGCTGGAGAACGCGGTGAAATATGCGGGTGCGCAGGCCGAAATTGGTATCGATGCCCACGTT
+GAGGGCGAAAATCTACAACTGGATGTCTGGGATAACGGCCCCGGTCTTCCGCCAGGCCAGGAGCAGACGATATTTGATAAGTTTGCTCGCGGGAATAAAG
+AGTCGGCAGTACCGGGGTAGGGCTTGGACTGGCAATTTGTCGGGCGATAGTGGATGTACACGGGGGCACTATTACCGCGTTCAACCGACCGGAAGGTGGT
+GCCTGTTTTTCGTGTTACACTTCCCCAGCCAAACTGCCCTGAACTGAAGAATTTCAGCGGGATATGTGACAAACGTTCTGATTGTTGAAGATGAACAGGC
+TATTCGTCGCTTTCTGCGCACGGCGCTGGAGGGCGACGGATGCGATCTTTGAGGCCGAAACGCTGCAACGCGGCTTGCTGGAAGCGGCAACCCGTAAGCC
+AGATTTGATTATTCTCGATCTCGGCCTGCCCGATGGTGATGGGATTGAGTTTATCCGCGACCTGCGCCAGTGGAGCGCGGTGCCGGTG
+>tig00000006 len=6499 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
+CGTCATCTGGCCGAAGCGGTCGTATTCATAACGGGTCTGGTAGCCCGAGCAGTCGGTGAACGCCAGCAACTGCCCGTAGCGGCTCCAGGTCATCTGTTGG
+AGTGCTGCCCGTCGCATCCGTTGTCGTCGCCGGTAACTCACTGTGCGCGTCATCGTAGCGGTAGCGTACTGTCTCCCCGCTGCGCGATGTCTCCGATACC
+AGCCTGCCCGGTTCATCATATTCGGCGGCTCTCCAGCCCGTCCGGGGACACCACCGCCGTCAGCTGGTTCACGTCGTTATAGTAAAATTTCGTCTCCCGC
+CCGTCCGGTGTGGTGATGTCCGTGATATCGCCGGACACCACATTCAGACCGCACTCTGTCCTCCGTCCCCGCGTCCGTCTGCGCCGTGAGCCTTCCTGCC
+GCGTCATACCCGCTGCGCGTGACGCTGCCGTCCGCCAGTTCTTTTTCACCACCCGTTTCCAGCCCGGCCCCGCCTTCTGTATGCAGCACCTCACGCCGGT
+TCAGGCTGTCGGTGACGGTGATGCGGTCCTGCTCATAAAGATAGCGGTAGCTTAACCCTGCCGGGTTCAGTTGCTCCACCACCCGCCCCGTATCGTCGTA
+GCGGTAGCGCATCTCCGGCCTTCCCGCGTAACGGTGCGCCACCATCCGGCCCGGGTGCTGCGTCATACGTGAAAGCGCGCACCTGCGTATTGCTGCGGTC
+ATATACCGCCAGCAGTTCACCGGCTTCCGTATGCGTGTACCGCACCAGTGGCGCAGCGGGCAGGCTCTCCGGGTATGCCGGGTCGTGCATCAGCCACACC
+GCCGAAAGGCGGATACCCTGTCGGGGCCGTATTCGGTACCGGGCAGTGTGTCGAGGAACGCTGAGGCTGAGAGAGGGCGGGAACTGTCAGAAGAAGATAG
+CGAAGAGGTGGGCCTCTTCCGCACGCTGCGCCTGCGTGGTCAGCACCAGACGGAACTCCGCCCGGCACCGTCCGTCACGCCGGTGATTTCCCCGGCCAGG
+TCACCGGCGGCCTCACGCCGGTACGTCAGCGTCCGCCCGAAGCGGTCCGCCATCCCGGTAAGCACCCGGTACGGCGGCAGCGGCGCTGGCAGTACGTCCT
+CAGCACCCGGCACCCGCTCAGACCACCCCAGTATCCACCACGGCCTGTGCGCTGTTGGTCGCCAGGTAAAGATGCGGGCAACCGGATATCCGGCGGCAGC
+GCCCCCACAGCCGCGCCAGCGTATGGCCGTCCGGCTGTGCTGCCTTACCACCGCGCACCAGCCACATTGACTCACTGCGGCTGTACACCGCCTCCCGGCA
+GCAGCGGCTCAAAGTGAATGCTCCGCCCGCCGTTGTCGTTGAGTATCAGTCCGTCATCACGTAGCTGTAAGCGGATATCAGAAGGCGCTTTCAGCCGGGG
+CCGAAAACGCCCACCGGTGCAGGCGTCTTCGTCCGGTAGCTGCTGTAGGTGCGGGAGAGAATGAACGGCAGCGGGCCGGCAGCGCAAGGTCCGTCTCGCC
+GGGCAGCACCTTCGCCCCCAGCAGCGGATTTACCGGGTTGCCCGAAGTCATCCCGCCGGACACACCGAGCACGCCACGCCGGTGGGCGCGCCAATTTACA
+CCTGCCGAACCCTGGACAATGGGACCGCCATACTGAGTCATATCTCCTGACGCGCCGCTGGTTTTCCGCTCATATAAAGTGCCCTTTTAGTTATTGTTCA
+TATCCCTGTGTTAGCAACAAAAAATAAAATGACACACAAGACCAGCTAATGTATTTATATATTTTTCACATAAACTTATTTTGTTCTCAATCAACAACAA
+CTGTTATTACAGGTCACTTTCAATATTTTATTAAACTAACATTTTGCACAGATGAATTCATCATCAGCAAATTCACTATATGGATAATATCCATTCAACG
+CATATGATTTATGATTTTATTAGTCTGAGTTATTTTGTAGGGCTATATTTAAAATCAATAAACTCCACCGATTCAGATTAATATCAGCAATAGAAGATAG
+AAATCACCAATTCAATAACATCATCAATGCGGAAACATATTGTAGAATTAATTTAAACAAGGCGTTCCATTCAACCAGAACGCCCTTATTTACTCTCATC
+ACCCCGCAAACTGCCTGAACAGCGCCTTACCCTTTAACCAGTCGCGCACCCAGCCAGCCGCCGAAAAGCGACAGCAGCAGCGCTCCGCTGCACGGCAGAA
+CAATCCACAATCGCCAGTCTGGCTCCCACGGAAAATCAAACACTCGCCTGCAACACTGCCAGCGCCGTTTCCGCACCAATTGCGGCCACCAGGCCGGAAA
+CAAACCCAAGCATGGCGAACTCACACCACAACGTGGTACGCAGCAGTTTTTCCCGCACCGAGTGTGCGCCACACCACCAGCTCCTGATGACGCTGACGCA
+TTCCCACCTGCACCTGTGCCAGCAACAGCAACATACCGCAGGCGGTGACCAGTACCACCATCACTTCCAGCGCCCGACTTACCTGCTCCAGCACCTGACC
+GACCTGTTTTAAAATCGCGCCAATATCTAACAGGCTAATGGTCGGGAACTGGCGGTTGAGTTGTGTCAACATGCCGTTGCCATTCTCCCAGCGGAAACTG
+GTAAGCCAGTTCTGCGGTTGCCCGTCTAATGCCCCTTCAGGGAAAATAAAATAGAAATTAGGCCGCAGACTTTCCCAGTCCACTTTGCGCAGGCTGGTCA
+CTTTAGCGCGGAACTCTGGGTATCGCCCATAAAAGTCACGGTATCACCGAGGGCAACGTTTAAGCGTTTCGCCAGCCCCTCTTCCATCGACACTTCATCG
+GCTTTTGGCGGCCAGTTACCGGCGACAATCGGATTATGATCGGGCGCGTATTTTGCCAGGTAAGATTGAGTTCGCGGTTAAGCGCCTCATCTTCATTACC
+TTCTGTCGGCTTATCGTTAATCGCCGTCAGCCGCGCCCACCACCGGATAAAACGATTCCGGACTATCTGATGTTCCGCGAGGAACGCTTTAGCGGTGCTA
+CCTGTTCTGTGGCGATGTTAATTAAAAGTAGTTCGGGCTTTCTGGAGGTAGCTGCTGCTGCCAGCGGTCGAGCAGATCGCCACGCAACACCAGCAGCAGT
+GCCAGCAGCATAAAGAGAGCGAAAATGCCGAAAGCTGACTTAACGTTGACCACGGCTGACGTAACAGGCGGCTAACCGCCAGGCGCAGAGGCAGCGATTT
+CAGCGTCATGCGGCGAAGTACATTCAGCAGCATCCAGCCCAGCACACCGCACAGCAAAGCCAGTACTACCGCGCCCGCCAGCACCGCCCAAAGCAGCATG
+CTGCCACCCATTAATCCGGCGAGCAGCAGCACAACCACCACACTGACAATCGGCAGATAAAACTTCAGCGGCCAGACGTTCGCTACCACATCATTACGTA
+ATACGCGTAAAGGCTGCGTTGCCAGCAACAAGCGATATGGTCGTAGCCCCACCAGCAGCGAGATGACCGTCATGGTGCCAAGCGCCCACAGCCACGGCCA
+GAGGCTGGCTGGCGGTAGTGCAGCAGGCAGAACGGGCTTGAGCAGCACCATCAACACGTTTCGAACAACAGGCCTATGGCCCCACCGGTAACGGCTGAAA
+GCGTCAGCACCATCAACCACTGACCGACGATTAGCTTACGCAGTTGCGCTCGCCCTGCCCCCAGCGTTTTGAGGATCGCCACCAGATCGTAGCGACTGCG
+ACAGTAATGATTCATCGCTACCGCCACCGCTGCCACTGCCAGCAGCAGGTCAGAAGCGCCAGCAGCAGGAACTGTTACGAGCGTTCCATCGATCGCCCCA
+GCGCGCCTTCGTCCTGTTCCAGACCGTACCAGCGTTGTTCGGGTTTAAGCTGGTAACAACCATTTCATAGCCGTCGAGCTGGTTCTCGTTGCCCGCCGAA
+TTTATAACGCCAGGTGACCCGACTCCCCGGCTGCACGGCTCCGGTTTTATCGACATCCGCCAGATTCATCATCAGACGCGGAGCCATCTGGAAGGGTTAA
+AACCGGAATCCGGTTCCTGAATCACTTCTCCGGCAATCCGCAAGGTGGCATCGCCCACGCCAATGGTGTCGCCCGTTTTCAGGTTAAGCAGTGCCATCAG
+GCGTGGGGCCAGCAATACGCTGCCCGCCTGCGGTTTCAGGCCAGGGTTAGTTGCAGATCGCCATACATCGGGTAGATATCATCCACCGCTTTGACGTTCG
+CCAGCTGCGGTGTGTCGCCTGCAAAGGTCATTGTGCGAAAGTCAGCTTGCCGACTTTCAGGCCGCGCTTTGCGCTTCCTCCAGCCACGCTTGCGGCACTT
+CGCGTGAACTGCGCAACGCCCGATCGCCCGCCATAAACTCACGGCTTTGCTGGCTTAAGCCCTTCTCCATGCGATCGCTGATATTGCCCAGCGCCAGCAC
+GCAGGCCACCGCCAGGCTTAGCGCCAGCCAGACAATTAATAGCGACGGCGAACGCCATTCGCGCCAGAACCAACGTGCAATCATGCTTCCTCCTGCAACT
+GCCCGTTCACCAGCCGTAAGCAGCGGTCGCAGCGCCGCCAGTTGCAGGTCGTGGGTCACCATAATCAACGTGGTGCCATGTTTACGGTTGAGGAAAACAG
+CAGGTCGGCAATTTTATCGCCCGTCTGGCGGTCAAGGTTGCCGTGTTCGTCGGCAAACAGCATCAGGTCGACCATTAAAGGCTCGTGCCAGCGCTTCCTC
+GTTGCTGTTCACCGCCGGAAAGCTGTGCCGGAAGATGATCAGACGTTTACCCAGCCCTAACTGTTCGAGCAACGCTTTCGCCCCGTTACGACTTTCCGCT
+ACTCTCCACCGCGCAGCAGGCCGGAAGCTCGACGTTTTCCAGCGCGTTAAGGGTAGGAATTAACATAAATGACTGAAAAACAAAGCCGACGTGCTTCGCG
+CGCAACTTTGCCCGCGCTTCTTCGTCCATATTATGTGGCGGTTGTCCCTGGAGCTCACTTCGCCACTGCTGCCGTCATCAAGCCCGGCGAGGATCGCCAG
+CAAGGTTGACTTACCGATCCCGACTCGCCCACCAGTGCGATGGTCTCGCGCGTTTGACAACCAGCTCAACTCCGGTGAGGATGGAGAGTTCATGCTCCCT
+GACCGACGGACTTCTTAAGATGATGAACTTCAACAATGTTTTCCGCTGGCATTTGCCCTTCCTGTTCCTGGTCCCATTAACCTTCCGTGCCGCCGCAGCC
+GTTATTGATTCTGGGTGATAGCCTGAGCGCCGGGTATCGAATGTCTGCCAGCGCGGCCTGGCCTGCCTTGTTGAATGATAAGTGGCAGAGTAAACGTCGG
+TAGTTAATGCCAGCATCAGCGGCGACACCTCGCAACAAGGACTGGCGCCTTCCGGCTCTGCTGAAACAGCATCAGCCGCGTTGGGTGCTGGTTGAACTAT
+GGGCAATGACGGTTTGCGTGGTTTTCAGCCACAGCAAACCGAGCAAACGCTGCGCCAGATTTTGCAGGATGTCAAAGCGCCAACGCTGAACCATTGTTAA
+TGCAAATACGTCTGCCTGCAAACTATGGTCGCCGTTATAATGAAGCCTTTAGCGCCATTTACCCCAAACTCGCCAAAGAGTTTGATGTTCCGCTGCTGCC
+CTTTTTTATGGAAGAGGTCTGCCTCAAGCCACAATGGATGCAGGATGACGGTATTCATCCCAACCGCGACGCCCAGCCGTTTATTGCCGACTGGATGGCG
+AAGCAGTTGCAGCCTTTAGTAAATCATGACTCATAAAGCAACGGAGATCCTGACAGGTAAAGTTATGCAAAAATCGGTCTTAATTACCGGATGTTCCAGT
+GGAATTGGCCTGGAAAGCGCGCTCGAATTAAAACGCCAGGGTTTTCATGCTGGCAGGTTGCCGGAAACCGGATGATGTTGAGCGCACGAACAGCATGGGA
+TTTACCGGCGTGTTGATCGATCTGGATTCACCAGAAAGTGTTGATCGCGCAGCCGACGAGGTGATCGCCTGACCGATAATTGTCTGTATGGGATCTTTAA
+CAATGCCGGATTCGGCATGTATGGCCCCTTTCCTGCATCAGCCGTGCGCAGATGGAACAGCAGTTTCCGCCAACTTTTCGGCGCACACCAGCTCACCATG
+CGCCTGTTACCCGCGATGTTACCGCACGGTGAAGGGCGTATTGTGATGACATCATCGGTGATGGGATTAATCTCCACGCCGGGTCGTGGCGCTTACGCGG
+CCAGTAAATATGCGCTGGAGGCGTGGTCAGATGCACTGCGCATGGAGCTGCGCCACAGCGGAATTAAAGTCAGCCTGATCGAACCCGGTCCCATTCGTAC
+TCGCTTCACCGACAACGTCAACCAGACGCAAAGTGATAAACCAGTCGAAAATCCGGCATCGCCGCCCGCTACGTTGGGACCGGAAGCGGTGGTGGACAAA
+GTACGCCATGCTTTTATTAGCGAAGCCGAAGATGCGCTATCCGGTGACGCTGGTGACCTGGGCGGTAATGGTGCTTAAGCGCCTGCTGCCGGGGCGCGT
+>tig00000007 len=3672 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
+CGGCTCCAGGTCATCTGCCGGTGCTGCCCGTCGCATCCGTTGTCGTCGCCGGTAACTCACTGTGCGCGTCATCGTAGCGGTAGCGTACTGTCTCCCCATG
+CGCGATGTCTCCGATACCAGCCTGCCCGGTTCATCATATTCCGGCGGCTCTCCAGCTGATCCGGGGACACCACCGCCGTCAGCTGGTTCCGTCGTTATAG
+TAAAATTTCGTCTCCCGCCTGTCCGGTGTGGTGATGTCCGTGATATCGCCGGACACCACATTCAGACGCACTCTGTCCTCCGTCCCGCCGCGTCCGTCTG
+CGCCGTGAGCCTTCCTGCCGCGTCATACCGCTGCGCGTGACGCTGCCGTCCGCCAGTTCTTTTTTCACCGTTTCAGCCCGGCCCCGCCTTCTGTATGCAG
+CACCTCACGCCGGTTCAGGCTGTCGGTGACGGTGATGCGGTCCTGCTCATAAAGATAGCGGTAGCTTAACCCTGCCGGGTTCAGTTGCTCCACCACCCGC
+CCCGTATCGTCGTAGCGGTAGCGCATCTCCGGCCTTCCCGCGTAACGGTGCGCCACCATCCGGCCGGGTGCTGCGCGTCATACGTGACGCGCACCTGCGT
+ATTGCTGCGGTCATATACCGCCAGCAGTTCACCGGCTTCCGTATACGTGTACCGCACCAGTGGCGCAGCGGGCAGGCTCTCCGGGTATGCCGGGTCGTGC
+ATCAGCCACACCGCCGAAAGGCGGATACCCTGTCGGGGCCGTATTCGGTACCGGGCGGTGTCGGGGAACGCTGAGGCTGAGAGGGGGGAACTGTCAGAAG
+AAGATAGCGAAGAGGTGTGGCCTCTTCCGCGCTGCGCCTGCGTGGTCAGCACCAGACGGAACTCCCGCCCGGCACCGTCCGTCGCCGGTGATTTCCCGGC
+CAGGTCACCGGCGGCCTCACGCCGGTACGTCAGCGTCAAGCGGTCCGCCATCCCGGTAAGCACCCGGTACGGCAGCAGCGGCGCTGGCAGTACGTCCTCA
+GCACCCGGCACCCGCTCAGACCACCCCAGTATCCACCACGGCCCTGTGCGCTGTTGGTCGCCAGGTAAAGATGCGGGCTTAACCGGATATCCGGCGGCAG
+CGCCCCCCACAGCCGCGCCAGCGTATGGCCGTCCGGCTGTGCTTGCCTTACCACCGCGCACCAGCCACATTGACTCACTGCGGCTGTACACCGCCTCCCC
+AGCAGCGGCGGCTCAAAGTGAATGCTCCGCCCGCCGTTGTCGTTGAGTATCAGTCCGTCATCACGTAGCTGTAAGCGGATATCAGAAGGCGCTTCAGCCG
+GGGCCGAAAACGCCCACCGGTGCAGGCGTCTTCGTCCGGTAGCTGCTGTAGGTGCGGGAGAGAATGAACGGCAGCGGGCCGGGCAGCGCAAGGTCCGTCT
+CGCCGGGCAGCACCTTCGCCCCAGCAGCGGATTTACCGGGTTGCCAGAAGTCATCCCGCCCGGACACACCGAGCACGCACGCCGGTGGGCGCGCCAATTT
+TACACCTGCCGAACCCTGGACAATGGGACCGCCATACTGAGTCATATCTCTGACGCGCCGCTGGTTTTCCGCTCATAAAGTGCCCTTTAGTTATTGTTCA
+TATCCCTGTGTTAGCAACAAAAAATAAAATGACACACAAGACCAGCTAATGTATTTATATATTTTTCACATAAACTTATTTGTTCTCAATCAACAACAAC
+TGTTATTACAGGTCACTTTCAATATTTTATTAAACTAACATTTTAGCACAGATGAATTCATCATCAACAAATTCACTATATGGATAATATCCATTCAACG
+CATATGATTTATGATTTTATTAGTCTGAGTTATTTTTGTAGGGCTATATTTAAAATCAATAAACTCACCGATTCAGATTAATATCAGCAATAGAAAGATA
+GGAAATCACCAATTCAATAACATCATCAATGAAACATATTGTAGAATTAATTTAAACAAGGCGTTCCATTCAACCAGAACGCCCTTATTTACTCATCACC
+CCGCAAACTGCCTGAACAGCGCCTTGCCTTTAACCAGTCGCGCACCCAGCCAGCCGCCGAAAAGCGACAGCAGCAGCGCTCCGCTGCACGGCAGAACAAT
+CCACAATCGCCAGTCTGGCTCCCACGGAAAATCAAACACCTTTCGCCTGCAACTGCCAGCGCCGTTTCCGCGCAATTGCGGCCACCAGGCCGGAAACAAA
+CCCAAGCATGGCGAACTCACACCACAACGTGGTACGCAGCAGTTTTTCCCGCACCGAGTGTGCGCCACACCACCAGCTCCTGATGACGCTGACGCATTCC
+CACCTGCACCTGTGCCAGCAGCAGCAACATACCGCAGGCGGTGACCAGTACCACCATCACTTCCAGCGCCCGACTTACCTGCTCCAGCACCTGACCGACC
+TGTTTTAAAATCGCGCCAATATCTAACAGGCTAATGGTCGGGAACTGGCGGTTGAGTTGTGTCAACATGCCGTTGCCATTCTCCCAGCGGAAACTGGTAA
+GCCAGTTCTGCGGTTGCCCGTCTAATGCCCTTCAGGGAAAATAAAATAGAAATTAGGCCGCAGACTTTCCCAGTCCACTTTGCGCAGGCTGGTCACTTTA
+GCGCGGAACTCCTGGGTATCGCCCATAAAAGTCACGGTATCACCGAGGGCAACGTTTGCGTTTCGCCAGCCCCTCTTCATCGACACTTCATCGGCTTTTG
+GCGGCCAGTTACCGGCGACAATCGGATTATGATCGGGCCGCGTATTTTGCCAGGTAAGATTGAGTTCGCGGTTAAGCGCCTCATCTTCATTACCTTCTGT
+CGGCTTATCGTTAATCGCCGTCAGCCGCGCCCGCACCACCGGATAAAACGATTCCGGGACTATCTGATGTTCCGCGAGGAACGCTTTAGCGGTGCTACCT
+GTTCTGTGGCGATGTTAATTAAAAAGTAGTTCGGGCTTTCTGGAGGTAGCTGCTGCTGCCAGCGGTCGAGCAGATCGCCACGCAACACCAGCAGCAGTGC
+CAGCAGCATAAAGGAGCGAAAATGCCGAGCTGACTTAACGTTGACCACGGCTGACGTAACAGGCGGCTAACCGCCAGGCGCAGAGGCAGCGATTTCAGCG
+TCATGCGGCGAAGTACATTCAGCAGCATCCAGCCCAGCACACCGCACAGCAAAGCCAGTACTACCGCGCCCGCCAGCACCGCCCAAAGCAGCATGCGCCA
+CCCATTAATCCGGCGAGCAGCAGCACAACCACCACACTGACAATCGGCAGATAAAACTTCAGCGGCCAGACGTTCGCTACCACATCATTACGTAATACGC
+GTAAAGGCTGCGTTGCCAGCAACAAGCGATATGGTCGTAGCCCCACCAGCAGCGAGATGACCGTCATGGTGCCAAGCGCCCAGCCGGCCAGAGGCTGGCT
+GGCGGTAGTGCAGCAGGCAGAACGGGCTTGAGCAGCACCATCAACACGTTTCGAACAACAGGCCTATGGCCCCACCGGTAACGGCTGAAAGCGTCAGCAC
+CATCAACCACTGACCGACGATTAGCTTACGCGGTTGCGCCTGCCCTGCCCCCAGCGTTTTGAGGATCGCCACCAGATCGTAGCGACTGCGACAGTAATGA
+TTTCATCGCTACCGCCACCGCTGCCACTGCCAGCAGCAAGGTCAGAAGCGCCGAAAGCAGCAGGAACTGTTA
+>tig00000008 len=7086 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
+ACGCGCCCCGGCAGCAGGCGCTTAAGCACATTACCGCCCAGGTCACCAGCGTCACCGGATAGCGCATCTTCGGCTTCGCTAATAAAAGCATGGCGTACTT
+TGTCCACCACCGCTTCCGGTCCCAACGTAGCGGGCGGCGATGCCGGATTTTCGACTGGTTTATCACTTTGCGTCTGGTTGACGTTGTCGGTGAAGCGAGT
+ACGAATGGGACCGGGTTCGATCAGGCTGACTTTAATTCCGCTGTGGCGCAGCTCCATGCGCAGTGCATCTGACCACGCCTCCAGCGCATATTTACTGGCC
+GCGTAAGCGCCACGACCCGGCGTTGAGATTAATCCCATCACCGATGATGTCATCACAATACGCCCTTCACCGTGCGGTAACATCGCGGGTAACAGGCGCA
+TGGTGAGCTGGTGTGCGCCGAAAAGTTGGCGGAAACTGCTGTTCCATCTGCGCACGGCTGATGTTGGAAAGGGCCATACATGCCGAATCCGGCATTGTTA
+AAGATCCCATACAGACCACTATCGGTCAGGGCGATCACCTCGTCGGCTGCGCGATCAACACTTTCTGGTGAATCCAGATCGATCAACCGCGCCGGTAAAT
+CCCATGCTGTTCGCGCGCTCAACATCATCCGGTTTCCGGCAACCTGCCAGCACACTTGAAAACCCTGGCGTTTTAATTCGAGCGCGCGCTTTCCAGGCCA
+ATTCCACTGGAACATCCGGTAATTAAGACCGATTTTTGCATAACTTTACCTGTCAGGATCTCCGTTGCTTTATGAGTCATGATTTACTAAAGGCTGCAAC
+TGCTTCGCCATCCAGTCGGCAATAAACGGCTGGGCGTCGCGGTTGGGATGAATACCGTCATCCTGCATCCATTGTGGCTTGAGGAGACCTCTTCCATAAA
+AAGGGCAGCAGCGGAACATCAAACTCTTTGGCGAGTTTGGGGTAAATGGCGCTAAAGGCTTCATTATAACGGCGACCATAGTTTGCAGGCAGACGTATTT
+GCATTAACAATGGTTCAGCGTTGGCGGCTTTGACATCCTGCAAAATCTGGCGCAGCGTTTGCTCGGTTTGCTGTGGCTGAAAACCACGCAAACCGTCATT
+GCCGCCAGTTCAACCAGCACCCAACGCGGCTGATGCTGTTTCAGCAGAGCCGGAAGGCGCGCCAGTCCTTGTTGCGAGGTGTCGCCGCTGATGCTGGCAT
+TAACTACCGACGTTTTTACTCTGCCACTTATCATTCAACAAGGCAGGCCAGGCCGCGCTGGCAGACATTCGATACCCGGCGCTCAGGCTATCACCCAGAA
+TCAATAACGTGTCCTGCGGCGGCACGGAAGGTGCTGGGACCAGGAACAGGAAGGGCAAATGCCAGCGGAAAACATTGTTGAAGTTCATCATCTTAAGAAG
+TCCGTCGGTCAGGGAGCATGAACTCTCCATCCTCACCGGAGTTGAGCTGGTTGTCAAACGGCGAGACCATCGCACTGGTGGGCGAGTCGGGATCGGTAAG
+TCAACCTTGCTGGCGATCCTCGCCGGGCTTGATGACGGCAGCAGTGGCGAAGTGAGTCTGGTGGACAACCGCTACATAATATGGACGAAGCGCGGGCAAA
+GTTGCGCGCGAAGCACGTCGGCTTTGTTTTCAGTCATTTATGTTAATTCCTACCCTTAACGCGCTGGAAAACGTCGAGCTTCCGGCCTGCTGCGCGGTGA
+GTAGCGCGGAAAGTCGTAACGGGGCGAAAGCGTTGCTCGAACAGTTAGGGCTGGGTAAACGTCTGGATCATCTTCCGGCACAGCTTTCCGGCGGTGAACA
+GCAACGAGGAAGCGCTGGCACGAGCCTTTAATGGTCGACCTGATGCTGTTTGCCGACGAACCCACGGCAACCTTGACCGCCAGACGGGCGATAAAATTGC
+CGACCTGCTGTTTTCCTCAACCGTGAACATGGCACCACGTTGATTATGGTGACCCACGACCTGCAACTGGCGGCACGCTGCGACCGCTGCTTACGGCTGG
+TGAACGGGCAGTTGCAGGAGGAAGCATGATTGCACGTTGGTTCTGGCGCGAATGGCGTTCGCCGTCGCTATTAATTGTCTGGCTGGCGCTAAGCCTGGCG
+GTGGCCTGCGTGCTGGCGCTGGGCAATATCAGCGATCGCATGGAGAAGGGCTTAAGCCAGCAAAAGCCGTGAGTTTATGGCGGGCGATCGGGCGTTGCGC
+AGTTCACGCGAAGTGCCGCAAGCGTGGCTGGAGGAAGCGCAAAAGCGCGGCCTGAAAGTCGGCAAAGCTGACTTTCGCCACAATGACCTTGCAGGCGACA
+CACCGCAGCTGGCGAACGTCAAAGCGGTGGATGATATCTACCCGATGTATGGCGATCTGCAAACTAATCCCCTGGCCTGAAACCGCAGGCGGGCAGCGTA
+TTGCTGGCCCCACGCCTGATGGCACTGCTTAACCTGAAAACGGGCGACACCATTGACGTGGGCGATGCCACCTTGCGGATTGCCGGAGAAGTGATTCAGG
+AACCGGATTCCGGTTTTAACCCTTCCAGATGGCTCCGCGTCTGATGATGAATCTGGCGGATGTCGATAAAACCGGAGCCATGCAGCCGGGGAGTCGGGTC
+ACCTGGCGTTATAAATTCGGCGGCAACGAGAACCAGCTCGACGGCTATGAGAAATGGTTGTTACCCCTCAGCTTAAACCCGAACAACGCTGGTACGGTCT
+GGAACAGGACGAAGGCGCGCTGGGGCGATCGATGGAACGCTCGCAACAGTTCCTGCTGCTGGCGCTTCTGACCTTGCTGCTGGCAGTGGCAGCGGTGGCG
+GTAGCGATGAATCATTACTGTCGCAGTCGCTACGATCTGGTGGCGATCCTCAAAACGCTGGGGGCAGGGCAGGCGCAACTGCGTAAGCTAATCGTCGGTC
+AGTGGTTGATGGTGCTGACGCTTTCAGCCGTTACCGGTGGGGCCATAGGCCTGTTGTTCGAAAACGTGTTGATGGTGCTGCTTCAAGCCCGTTCTGCCTG
+CTGCACTACCGCCAGCCAGCCTCTGGCCGTGGCGTGGGCGCTTGGCACCATGACGGTCATCTCGCTGCTGGTGGGGCTACGACCATATCGCTTGTTGCTG
+GCAACGCAGCCTTTACGCGTATTACGTAATGATGTGGTAGCGAACGTCTGGCCGCTGAAGTTTTATCTGCCGATTGTCAGTGTGGTGGTTGTGCTGCTGC
+TCGCCGGATTAATGGGTGGCAGCATGCTGCTTTAGGCGGTGCTGGCGGGCGCGGTAGTACTGGCTTTGCTGTGCGGTGTGCTGGGCTGGATGCTGCTGAA
+TGTACTTCGCCGCATGACGCTGAAATCGCTGCCTCTCTGCGCCTGGCGGTTAGCCGCCTGTTACGTCAGCCGTGGTCAACGTTAAGTCAGCTTTCGGCAT
+TTTCGCTCTCCTTTATGCTGCTGGCACTGCTGCTGGTGTTGCGTGGCGATCTGCTCGACCGCTGGCAGCAGCAGCTACCTCAAGAAAGCCCGAACTACTT
+TTTAATTAACATCGCCACAGAACAGGTAGCACCGCTAAAGCGTTCCTCGCGGAACATCAGATAGTCCCGGAATCGTTTTATCCGGTGGTGCGGGCGCGGC
+TGACGGCGATTAACGATAAGCCGACAGAAGGTAATGAAGATGAGGCGCTTAACCGCGAACTCAATCTTACCTGGCAAAATACGCGGCCCGATCATAATCC
+GATTGTCGCCGGTAACTGGCCGCCAAAAGCCGATGAAGTGTCGATGGAAGAGGGGCTGGCGAAACGCAAACGTTGCCCTCGGTGATACCGTGACTTTATG
+GGCGATACCCAGGAGTTCCGCGCTAAAGTGACCAGCCTGCGCAAAGTGGACTGGGAAAGTCTGCGGCCTAATTTCTATTTTATTTTCCCTGAAGGGGCAT
+TAGACGGGCAACCGCAGAGCTGGCTTACCAGTTTCCGCTGGGAGAATGGCAACGGCATGTTGACACAACTCAACCGCCAGTTCCCGACCATTAGCCTGTT
+AGATATTGGCGCGATTTTTAAAACAGGTCGGTCAGGTGCTGGAGCAGGTAAGTCGGGCGCTGGAAGTGATGGTGGTACTGGTCACCGCCTGCGGTATGTT
+GCTGTTGCTGGCACAGGTGCAGGTGGGAATGCGTCAGCGTCATCAGGAGCTGGTGGTGTGGCGCACACTCGGTGCGGGAAAAACTGCTGCGTACCACGTT
+GTGGTGTGAGTTCGCCATGCTTGGGTTTGTTTCCGGCCTGGTGGCCGCAATTGGTGCGGAAACGGCGCTGGCAGTGTGTTGCAGGCGAAAGTGTTTGATT
+TTCCGTGGGAGCCAGACTGGCGATTGTGGATTGTTCTGCCGTGCAGCAGGCGCTGCTGCTGTCGCTTTCGGCGGCTGGCTGGGTGCGCGACTGGTTAAAG
+GGTAAGGCGCTGTTCAGGCAGTTTGCGGGGTGATGAGAGTAAATAAGGGGCGTTCTGGTTGAATGGAACGCCTTGTTTAAATTAATTCTACAATATGTTT
+CGTTGATGATGTTATTGAATTGGTGATTTCTATCTTCTATTGCTGATATTAATCTGAATCGGTGGAGTTTATTGATTTTAAATATAGCCCTACAAAAATA
+ACTCAGACTAATAAAATCATAAATCATATGCGTTGAATGGATATTATCCATATAGTGAATTTGTTGATGATGAATTCATCTGTGCTAAAAATGTTAGTTT
+AATAAAATATTGAAAGTGACCTGTAATAACAGTTGTTGTTGATTGAGAACAAATAAGTTTATGTGAAAAATATATAAATACATTAGCTGGTCTTGTGTGT
+CATTTTATTTTTTGTTGCTAACACAGGGATATGAACAATAACTAAAAGGGCACTTTATATGAGCGGAAAACCAGCGGCGCGTCAGGAGATATGACTCAGT
+ATGGCGGTCCCATTGTCCAGGGTTCGGCAGGTGTAAATTGGCGCGCCCACCGGCGTGGCGTGCTCGGTGTGTCCGGGCGGGATGACTTCGGGCAACCCGG
+TAAATCCGCTGCTGGGGGCGAAGGTGCTGCCCGGCGAGACGGACCTTGCGCTGCCCGGCCCGCTGCCGTTCATTCTCTCCCGCACCTACAGCAGCTACCG
+GACGAAGACGCCTGCACCGGTGGGCGTTTTCGGCCCCGGCTGAAGCGCCTTCTGATATCCGCTTACAGCTACGTGATGACGGACTGATACTCAACGACAA
+CGGCGGGCGGAGCATTCACTTTGAGCCGCTGCTGCCGGGGCGGTGTACAGCCGCAGTGAGTCAATGTGGCTGGTGCGCGGTGGTAAGGCAGCACAGCCGG
+ACGGCCATACGCTGGCGCGGCTGTGGGGGCGCTGCCGCCGGATATCCGGTTAAGCCCGCATCTTTACCTGGCGACCAACAGCGCACAGGGGCCGTGGTGG
+ATACTGGGGTGGTCTGAGCGGGTGCCGGGTGCTGAGGACGTACTGCCAGCGCCGCTGCCGCCGTACCGGGTGCTTACCGGGATGGCGGACCGCTTCGGGC
+GGACGCTGACGTACCGGCGTGAGGCCGCCGGTGACCTGCCGGGGAAATCACCGGCGTGACGGACGGTGCCGGGCGGGAGTTCCGTCTGGTGCTGACCACG
+CAGGCGCAGCGTGCGGAAGAGGCCCACCTCTTCGCTATCTTCTTCTGACAGTTCCCGCCCTCTCTCAGCCTCAGCGTTCCCCGACACTGCCCGGTACCGA
+ATACGGCCCCGACAGGGTATCCGCCTTTCGGCGGTGTGGCGATGCACGACCCGGCATACCCGGAGAGCCTGCCCGCTGCGCCACTGGTGCGGTACACGTA
+TACGGAAGCCGGTGAACTGCTGGCGGTATATGACCGCAGCAATACGCAGGTGCGCGCTTTCGTATGACGCGCAGCACGGGCCGGATGGTGGCGCACCGTT
+ACGCGGGAAGGCCGGAGATGCGCTACCGCTACGACGATACGGGGCGGTGGTGGAGCAACTGAACCCGGCAGGGTTAAGCTACCGCTATCTTTATGAGCAG
+GACCGCATCACCGTCACCGACAGCCTGAACCGGCGTGAGGTGCTGCATACAGAAGGCGGGGCCGGGCTGAAACGGTGGTGAAAAAGAACTGGCGGACGGC
+AGCGTCACGCGCAGCGGGTATGACGCGGCAGGAAGGCTCACGGCGCAGACGGACGCGGCGGGACGGAGGACAGAGTGCGGTCTGAATGTGGTGTCCGGCG
+ATATCACGGACATCACCACACCGGACGGGCGGGAGACGAAATTTTACTATAACGACGAACCAGCTGACGGTGAATTGTCCCCGGACGGGCTGGAGAGCCG
+CCGGGAATATGATGAACCGGGCAGGCTGGTATCGGAGACATCGCGCAGCGGGGAGACAGTACGCTACCGCTACGATGACGCGCACAGTGAGTTACCGGCG
+ACGACAACGGATGCGACGGGCAGCACCAACAGATGACCTGGAGCCGCTACGGGCAGTGCTGGCGTTCACCGACTGCTCAGGCTACCAGACCCGTTATGAA
+TACGACCCTTCGGCCAGATGACGGCGGTCCACCGCGAGGCATCAGCCTTTACCGCCGCTATGACAACCGTGGCCGGTTAACCTCGGTGAAGACGCACAGG
+GCCGTGAAACGCGGTATGAATACCTTGCCGCAGGCGACCTGACTGCCGTTATCACCCCGGACGGCAACCGGGCGAGACACAGTACGATGCGTGGGGAAAG
+GCGGTCAGCACCACGCAGGGCGGGCTGACGCGCAGTATGGAATTACGATGCTGCCGGACGTGTCATCAGCTGACCAACGAGAACGGCAGCCACAGCGTCT
+TCAGTTACGATGCGCTGGACCGGCTGGTACAGCAGGGCGGCTTTGACGGGCGGACGCAACGTTATCATTATGACCTGACCGGAAAACTCACACCAGAGTG
+AGGATGAGGACTTGTCATCCTCTGGTACTACGATGAATCGGACCGTATCACTCACCGCACGGTGAACGGCGAACCGGCAGAGCAGTGGCAGTATGATGGC
+ACAGCTGGCTGACAGACATCAGCCACCTGAGCGAAGGCCACCGTGTTGCCGTCCACTATGGCTATGACGATAAGGCCGCCTGACCG
+>tig00000009 len=2712 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
+TACCAGGTCACTTGCGGTTTCCGTGACAGCGACATCCAGCCCGTCAGGTCCCGTTCACGCCGCCATACCCGTTTTGCCACCCTGCGGCCAGCGGGTCGTA
+AAGATAGCGACTTTCGACCAGCGGCTGCATATTGTGTCCGCGTGGCGAATTGCCAGCCGGTGCTGACTGTCGTAATGGTACCGGTGGGTGCGCTCATCAT
+CCGTGCGGATAAAACGCTTCCGGGATAAGGGTCAGTTTTCTCTGTCAGCCACCGTGACGGTCATACCGGTAAAGATAGTGCGCGTCACGGGTGATACGGT
+TATCCGGCCACATGCTGAGGGCGCTGTCAGGTCACCTTCCGGGTCGAACGACGGTTACCTGCCGGGTCTGTAGTATACGGGATGCGGATATCAGATTCGC
+TGCGGTGGTGTGAGCGCCGGTCAGCCTGCCGGAGTAGTGCTGTAGCTGTAACTCGGGTCTGGCGCGGGCTGCTGATTACGGATGAGTTCGCCGTTGTCGT
+TCCAGTGTAATCGCGGTCAGACAGCAGGCTGTTCAGGTGCTGGCTCTGTAACTGCCCGGCAGGGTATAAGCGGTGGTGAGTTCATAACGGCCGAAGCTGC
+GCAGCGTTTCCCGTGCAGGCGGTCGCGGGTGTACTCCACCAGCGGTGTGTCGCCGAGTTTCATGCCTGACAGCCAGCCGCTGCCGTAGGTCAGCCATTCC
+ACGGCAGGCAGGCTGTCCGGTATACAGCAGTTCGCCAGTCCTGTGCGTTGTACGCATGTCTGGTCTCATGCTGCCAGAGCAGTTCATTCGTCTGCGGATG
+ATGCACCGTCAGGTGTTCACTGGCAGAGGCAGCCTTTACTGTCATAACCATAGTGCACCGTCACCCGGTGCCCTTCGCTGATATGGCTGATGTCTGTCAG
+CCAGCCGCGTTCGTCATGCTGCCACCGCTCTGCGGTTTCGCCATTCACGGTGCGGTGCGTGAGGCGGTCTGCTTCGTCATAGTGCCAGTGGGTGACCAGC
+CCTCATCCTCGCTGCGGATAAGTTTGCCGGTCGGGTCATTAGTGATAACGCGCTGTGTGCGGCCGTCAAAGCCGGTTTCCTGTATCAGCCGGTCGAATTA
+CATCGTAACGGAAGGTGGTGTGGCCTTGTTTTCACTGGTCAGGCGGATGACCCGTCAGCAGCATCGTATTCCATACTGCGCGTCAGACCGCCCTGCGTGG
+TACAGATGGCTTTCCCCGCATCGTACTGTGTCCCGTTTCTGCTGCCGTCCGGGAGGGCAATGACGGTGGTCAGGTCACCGGCGGCGTTGTATTCATACCG
+CGTTTCATGGCCCTGCGTGTCTTCACGGCAATTAACTGTCCACGGCTGTCGTATGCGCGGTACTGACTCAGCCCTTCCTCGCGGTGCACCGCCGTCACCT
+GACAAAACGGTCATGGTCATAGCGGGTTACATAACCGGAACAGTCAGTGAAGCTCAGCAACTGACCGTAACGGCTCCACGTCATGGTTTTCCGGCTGCCG
+GTGGCATCTTCCGTTGCGCAGGGTAAGTCACTGTGTGGATTATCATAACGGTAGCGGGTGATATCGCCGTCAGGGGCAGTTTCCTGAATCAGACGGCCCC
+ATTCATCATATTCCCGGCGTATTTCCAGCCCGTCAGGCCGGTGGCTGACGTTAACTGGCTGTGGTGGTTATAGTAAAACGCCGATGCCCTGCCATCCGGC
+GTGGTGATGCGCGTGATGGGCCCGTCACCATCCGGACTGTATTCTGTTGTCCTGCCTGCGGCATCCGTCGCAATGCCCTGAGCCTGCCCACCGCGTCAAA
+CTGACTCTGCGTGACGCTGCCGTCCGCGTGTTCCTTTTCACCACCCGCTGCCCGCCTTCACCCTGCGTGTGCGGGACTTCACGGCAGTTCAGGCTGTCGG
+TGATGGTGATGCGGTCCTTCTCATACTGATACGTGTAACTTTAAGCTGCCGGGTTTAGCTGTTCTGTCACCCGCCCGTCGCTGTCGTAACGGTAACAGAT
+TTCCGGTCGGCCCGTGTGACGGTGCGCCACCATCCGGCCCCGGTATTTATCATCGTAAGTAAAGCTGCGCACCTGTATTGCTGCGGTCTACACCGCCGCT
+TCGCCGCGGGGCGTCAGCCATAGCGCACCAGCGGCGCGGCAGGTAAATTCTCCGGTATTCCGGGTCGTGCGTCAGCCACACGGCAGACAGACGGATGCCG
+TTGTCCCGGCCATATTCGGTGTAACCCGGCAGGGTATCAGGAAAAGCGGACGGTTCCGTCCGCCGGAAATGGCCTGCTGCCGGGCTTCTTCTGCCCGCTG
+CGCCTGCGTGGTCAGCCGAGTGACGCCCGGCACCATCCGTCGCGCCGGTGATTTCGCCGCTGAATTCACCGGCGGCTTCGCGGTGGAACGTCTGTGTGCG
+CCGAAGCGGTCCACCAGCCCGGTCAGTACCCGGTACGGCGGCGGCGGCGCAGGCAGCACCTCATCCGCTTCCGGCACCCGCTCACCAGCCGAGCAGCCAC
+CACGGCTGCGGACTGTTTGTCGCCAGATAACGATGCGGACTTAAGCGGGTTCTTCCGGCAGCGCCTGCCGGAGTGCGGCCGGTGACCTTCATCCAGTTCG
+CCACGCCGCCGCGCACCATACAGTGACTCGCTGCGGCAACCGTCCTCACCGGGAAACAGGTGCTCAAAATACAGGCTTCTGCCGCCGTTATCACTGGTAT
+CAGTGTGTTATC
+>tig00000010 len=4686 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
+CAATGACCTTTGCAGGCGACACACCGCAGCTGGCGAACGTCAAAGCGGTGGATGATATCTACCCGATGTATGGCGATCTGCAAACTAATCCCCTGGCCTG
+AAACCGCAGGCGGGCAGCGTATTGCTGGCCCCACGCCTGATGGCACTGCTTAACCTGAAAACGGGCGACACCATTGGCGTGGGCGATGCCACCTTGCGGA
+TTGCCGGAGAAGTGATTCAGGAACCGGATTCCGGTTTTAACCCCTTCCAGATGGCTCCGCGTCTGATGATGAATCTGGCGGATGTCGATAAAACCGGAGC
+CGTGCAGCCGAGGAGTCGGGTCACCTGGCGTTATAAATTCGGCGGCAACGAGAACCAGCTCGACGGCGAGAATGGTTGTTACCTCAGCTTAAACCCGAAC
+AACGCTGGTACGGTCTGGAACAGGACGAAGAGGCGCGCTGGGGCGATCGATGGAACGCTCGCAACAGTTCCTGCTGCTTTCGGCGCTTCTGACCTTGCTG
+CTGTGGCAGTGGCGGTGGCGGTAGCGATGAATCATTACTGTCGCAGTCGCTACGATCTGGTGGCGATCCTCAAAACGCTGGGGGCAGGGCGAGCGCAACT
+GCGTAAGCTAATCGTCGGTCAGTGGTTGATGGTGCTGACGCTTTCAGCCGTTACCGGTGGGGCCATAGGCCTGTTGTTCGAAACGTGTTGATGGTGCTGC
+TCAAGCCCGTTCTGCCTGCTGCACTACCGCCAGCCAGCCTCTGGCCGTGGCTGTGGGCGCTTGGCACCATGACGGTCATCTCGCTGCTGGTGGGGCTACG
+ACCATATCGCTTGTTGCTGGCAACGCAGCCTTTACGCGTATTACGTAATGATGTGGTAGCGAACGTCTGGCCGCTGAAGTTTTATCTGCCGATTGTCAGT
+GTGGTGGTTGTGCTGCTGCTCGCCGGATTAATGGGTGGCAGCATGCTGCTTTGGGCGGTGCTGGCGGGCGCGGTAGTACTGGCTTTGCTGTGCGGTGTGC
+TGGGCTGGATGCTGCTGAATGTACTTCGCCGCATGACGCTGAAATCGCTGCCTCTGCGCCTGGCGGTTAGCCGCCTGTTACGTCAGCCGTGGTCAACGTT
+AAGTCAGCTTTCGGCATTTTCGCTCTCCTTTATGCTGCTGGCACTGCTGCTGGTGTTGCGTGGCGATCTGCTCGACCGCTGGCAGCAGCAGCTACCTCCA
+GCCCGAACTACTTTTTAATTAACATCGCCAGGAACAGGTAGCACCGCTAAAGGGCGTTCCTCGCGGAACATCAGATAGTCGGAATCGTTTTATCCGGTGG
+TGCGGGCGCGGCTGACGGCGATTAACGATAAGCCGACAGAAGGTAATGAATGAGGCGCTTAACCGCGAACTCAATCTTACCTGGCAAAATACGCGGCCCG
+ATCATAATCCGATTGTCGCCGGTAACTGGCCGCCAAAAGCCGATGAAGTGTCGATGGAAGAGGGGCTGGCGAAACGCAAACGTTGCCCTCGGTGATACCG
+TGACTTTTATGGGCGATACCCAGAGTTCCGCGCTAAAGTGACCAGCCTGCGCAAAGTGGACTGGGAAAGTCTGCGGCCTAATTTCTATTTTATTTTCCCT
+GAAGGGGAGATTAGACGGGCAACCGCAGAACTGGCTTACCAGTTTCCGCTGGGAGAATGGCAACGGCATGTTGACACAACTCAACCGCCAGTTCCCGACC
+ATTAGCCTGTTAGATATTGGCGCGATTTTAAAACAGGTCGGTCAGGTGCTGGAGCAGGTAAGTCGGGCGCTGGAAGTGATGGTGGTACTGGTCACCGCCT
+GCGGTATGTTGCTGTTGCTGGCACAGGTGCAGGTGGGAATGCGTCAGCGTCATCAGGCTGGTGGTGGTGGCGCACACTCGGTGCGGGAAAAACTGCTGCG
+TACCACGTTGTGGTGTGAGTTCGCCATGCTTGGGTTTGTTTCCGGCCTGGTGGCCGCAATTGGTGCGGAAACGGCGCTGGCAGTGTGTTGCAGGCGAAAG
+TGTTTGATTTTCCGTGGGAGCCAGACTGGCGATTGTGGATTGTTCTGCCGTGCAGCGGAGCGCTGCTGCTGTCGCTTTTCGGCGGCTGGCTGGGTGCGCG
+ACTGGTTAAAGGGTAAGGCGCTGTTCAGGCGGTTTGCGGGGGTGATGAGAGTAAATAAGGGCGTTCTGGTTGAATGGAACGCCTTGTTTAAATTAATTCT
+ACAATATGTTTCGTGATGATGTTATTGAATTGGTGATTTCTATCTTTCTATTGCTGATATTAATCTGAATCGGTGGAGTTTATTGATTTTAAATATAGCC
+CTACAAAATAACTCAGACTAATAAAATCATAAATCATATGCGTTGAATGGATATTATCCATATAGTGAATTTGTTGATGAATTCATCTGTGTAAAAATGT
+TAGTTTAATAAAATATTGAAAGTGACCTGTAATAACAGTTGTTGTTGATTGAGAACAAATAAGTTTGTGTGAAAAATATATAAATACATTAGCTGGTCTT
+GTGTGTCATTTTATTTTTGTTGCTAACACAGGGATATGAACAATAACTAAAAAGGCACTTTATGAGCGGAAAACCAGCGGCGCGTCGGGAGATATGACTC
+AGTATGGCGGTCCCATTGTCCAGGGTTCGGCAGGTGTAAATTGGCGCGCCCACCGGCGTGGCGTGCTCGGTGTGTCCGGGCGGGATGACTTCCGGGCAAC
+CCGGTAAATCCGCTGCTGGGAGCGAAGGTGCTGCCCGGCGAGACGGACCTTGCGCTGCCCGGCCCGCTGCCGTTCATTCTCTCCCGCACCTACAGCAGCT
+ACCGGACGAAGACGCCTGCACCGGTGGGCGTTTTCGGCCCCGGCTGAAAGCGCCTTCTGATATCCGCTTACAGCTACGTGATGACGGACTGATACTCAAC
+GACAACGGCGGGCAGACATTCACTTTGAGCCGCTGCTGCCGGGAGGCGGTGTACAGCCGCAGTGAGTCAATGTGGCTGGTGCGCGGTGGTAAGGCAGCAC
+AGCCGGACGGCCCATACGCTGGCGCGGCGTGGGGGCGCTGCCGCCGGATATCCCGGTAAGCCCGCATCTTTACCTGGCGACCAACAGCGCACAGGCCGTG
+GTGAATACTGGGGTGGTCTGAGGCAGCGGTGCCGGGTGCTGAGGACGTACTGCCAGCGCCGCTGCCGCCGTACCGGTGCTTACCGGGATGGCGGACCGCT
+TCGGGCGGACGCTGACGTACCGGCGTGAGGCCGCCGGTGACCTGGCCGGGAAATCACCGGCGTGACGGACGGTGCCGGGCGGGAGTTCCGTCTGGTGCTG
+ACCACGCAGGCGCAGCGTGCGGAAGAGGCCCACACTCTTCGCTATCTTCTTCTGACAGTTCGCCCTCTCTCAGCCTCAGCGTTCCCCGACACACTGCCCG
+GTACCGAATACGGCCCCGACAGGGTATCCGCCTTTCGGCGGTGTGGCTGATGCACGACCCGGCATACCCGGAGAACCTGCCCGCTGCCGCCACTGGTGCG
+GTACACGTATACGGAAGCCGGTGAACTGCTGGCGGTATATGACCGCAGCAATACGCAGGTGCGCGCTTTCACGTATGACGCGCAGCACCCGGGCCGGATG
+GTGGCGCACCGTTACGCGGGAAGGCCGGAGATGCGCTACCGCTACGACGATACGGGGCGGTGGGTGGAGCAACTGAACCCGGCAGGGTTAAGCTACCGCT
+ATCTTTATGAGCAGGACCGCATCACCGTCACCGACAGCCTGAACCGGCGTGAGGTGCTGCATACAGAAAGGCGGGGCCGGGCTGAAACGGGTGGTGAAAA
+AGAACTGGCGGACGGCAGCGTCACGCGCAGCAGGTATGACGCGGCAGGAAGGCTCACGGCGCAGACGGACGCGGCGGACGGAGGACAGAGTAGGTCTGAA
+TGTGGTGTCCGGCGATATCACGGACATCACCACACCGGACGGGCGGGAGACGAAATTTTACTATAACGACGGGAACCAGCTGACGGCGGTGGTGTCCCCG
+GACGAAGCTGGAGAGCCGCCGGGAATATGATGAACCGGGCAGGCTGGTATCGGAGACATCGCGCAGCGGGGAGACAATACGCTACCGCTACGATGACGCG
+CACAGTGAGTTACCGGCGACGACAACGGATGCGACGGGCGCACAACAGATGACCTGGAGCCGCTACGGGCGGTTGCTGGCGTTCACCGACTGCTCGGCTA
+CCAGACCCGTTATGAATACGACCCTTCGGCCAGGATGACGGCGGTCCACCGCGAAGGCATCAGCCTTTACCGCCGCTATGACAACCGTGGCCGGTTAACC
+TCGGTGAAGACGCACAGGGCCGTGAACGCGGTATGAATATAACCGCAGGCGACCTGACTACCGTTATCACCCCGGACGGCAACCGGGCGAGACACAGTAC
+GATGCGTGGGGAAAGGCGGTCAGCACCACGCAGGGCGGGCTGACGCGCAGTATAGGAGTACGATGCTGCCGGACGTGTCATCAGCCTGACCAACGAGAAC
+GGCAGCCACAGCGTCTTCAGTTACGATGCGCTGGACCGGCTGGTACTGCGGGGCGGCTTTGACGGGCGGACCTGGCGTTATCATTATGACCTGAGCCGGA
+AAACTCACACCAGAGTGAGGATGAGGACTTGTCATCCTCTGGTACTACGATGAATCGGACCGTATCACTCACCGCACGGTGAACGG
+>tig00000011 len=5118 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
+TTTGCAGGCAGACGTATTTGCATTAACAATGGTTCAGCGTTGGCGGCTTTGACATCCTGCAAAATCTGGCGCAGCGTTTGCTCGGTTTGCTGTGGCTGAA
+AACCACGCAAACCGTCATTGCCGCCAGTTCAACCAGCACCCAACGCGGCTGATGCTGTTTCAGCAGAGCCGGAAGGCGCGCCAGTCCTTGTTGCGAGGTG
+TCGCCGCTGATGCTGGCATTAACTACCGACGTTTTACTCTGCCACTTATCATTCAACAAGGCAGGCCAGGCCGCGCTGGCAGACATTCGATACCCGGCGC
+TCAGGCTATCACCCAGAATCAATAACGTGTCCGCTGCGGCGCTACGGAAAGTTAACTGGGACCAGGAACAGGAAGGGCAAATGCCAGCGGAAAACATTGT
+TGAAGTTCATCATCTTAAGAAGTCCGTCGGTCAGGGGCATGAACTCTCCATCCTCACCGGAGTTGAGCTGGTTGTCAAACGGCGAGACCATCGCACTGGT
+GGGCGAGTCGGGATCGGTAAGTCAACCTTGCTGGCGATCCTCGCCGGGCTTGATGACGGCAGCAGTGGCGAAGTGAGTCTGGTGGGACAACCGCCACATA
+ATATGGACGAAGCGCGGGCAAAGTTGCGCGCGAAGCACGTCGGCTTTGTTTTCAGTCATTTATGTTAATTCCTACCCTTAACGCGCTGGAAAACGTCGAG
+CTTCCGCCCTGCTGCGCGGTGAGTAGCGCGGAAAGTCGTAACGGGGCGAAAGCGTTGCTCGAACAGTTAGGGCTGGGTAAACGTCTGGATCATCTTCCGG
+CACAGCTTTCCGGCGGTGAACAGCAACGAGGAAGCGCTGGCACGAGCCTTTAATGGTCGACCTGATGCTGTTTGCCGACGAACCCACGGCAACCTTGACC
+GCCAGACGGGCGATAAAATTGCCGACCTGCTGTTTTCCCTCAACCGTGAACATGGCACCACGTTGATTATGGTGACCCACGACCTGCAACTGGCGGCACG
+CTGCGACCGCTGCTTACGGCTGGTGAACGGGCAGTTGCAGGAGGAAGCATGATTGCACGTTGGTTCTGGCGCGAATGGCGTTCGCCGTCGCTATTAATTG
+TCTGGCTGGCGCTAAGCCTGGCGGTGGCCTGCGTGCTGGCGCTGGGCAATCAGCGATCGCATGGAGAAGGGCTTAGCCAGCAAAGCCGTGAGTTTATGGC
+GGGCGATCGGGCGTTGCGCAGTTCACGCGAAGTGCCGCAAGCGTGGCTGGAGGAAGCGCAAAAGCGCGGCCTGAAAGTCGGCAAAGCTGACTTTCGCCAC
+AATGACCTTGCAGGCGACACACCGCAGCTGGCGAACGTCAAAGCGGTGGATGATATCTACCCGATGTATGGCGATCTGCAACCAATCCCTGGCCTGAAAC
+CGCAGGCGGGCAGCGTATTGCTGGCCCCACGCCTGATGGCACTGCTTAACCTGAAAACGGGCGACACCATTGACGTGGGCGATGCCACCTTGCGGATTGC
+CGGAGAAGTGATTCAGGAACCGGATTCCGGTTTTAACCCCTTCCAGATGGCTCCGCGTCTGATGATGAATCTGGCGGATGTCGATAAAACCGGAGCCATT
+ACAGCCGGGGAGTCGGGTCACCTGGCGTTATAAATTCGGCGGCAACGAGAACCAGCTCGACGGCTATGAGAAATGGTTGTTACCTCAGCTTAAACCCGAA
+CAACGCTGGTACGGTCTGGAACAGGACGAAGGCGCGCTGGGGCGATCGATGGAACGCTCGCAACAGTTCCTGCTGCTGGCGCTTCTGACCTTGCTGCTGG
+CAGTGGCAGCGGTGGCGGTAGCGATGAATCATTACTGTCGCAGTCGCTACGATCTGGTGGCGATCCTCAAAACGCTGGGGGCAGGGCAGGCGCAACTGCG
+TAAGCTAATCGTCGGTCAGTGGTTGATGGTGCTGACGCTTTCAGCCGTTACCGGTGGGGCCATAGGCCTGTTGTTCGAAAACGTGTTGATGGTGCTGCTC
+AAGCCCGTTCTGCCTGCTGCACTACCGCCAGCCAGCCTCTGGCCGTGGCGTGGGCGCTTGGCACCATGACGGTCATCTCGCTGCTGGTGGGGCTACGACC
+ATATCGCTTGCTGCTGGCAACGCAGCCTTTACGCGTATTACGTAATGATGTGGTAGCGAACGTCTGGCCGCTGAAGTTTTATCTGCCGATTGTCAGTGTG
+GTGGTTGTGCTGCTGCTCGCCGGATTAATGGGTGGCAGCATGCTGCTTTAGGCAGTGTGCTGGCGGGCGCGGTAGTACTGGCTTTGCTGTGCGGTGTGCT
+GGGCTGGATGCTGCTGAATGTACTTCGCCGCATGACGCTGAAATCGCTGCCTCTGCGCGCCTGGCGGTTAGCCGCCTGTTACGTCAGCCGTGGTCAACGT
+TAAGTCAGCTTTCGGCATTTTCGCTCTCCTTATGCTGCTGGCACTGCTGCTGGTGTTGCGTGGCGATCTGCTCGACCGCTGGCAGCAGCAGCGCTACCTC
+AAGCCCGAACTACTTTTTAATTAACATCGCCACAGAACAGGTAGCACCGCTAAAGCGTTCCTCGCGGAACATCAGATAGTCCCGGAATCGTTTTATCCGG
+TGGTGCGGGCGCGGCTGACGGCGATTAACGATAAGCCGACAGAAGGTAATGAAGATGAGGCGCTTAACCGCGAACTCAATCTTACCTGGCAAAATACGCT
+GGCCCGATCATAATCCGATTGTCGCCGGTAACTGGCCGCCAAAAGCCGATGAAGTGTCGATGGAAGAGGGCTGGCGAAACGCAAACGTTGCCCTCGGTGA
+TACCGTGACTTTATGGGCGATACCCAGGAGTTCCGCGCTAAAGTGACCAGCCTGCGCAAAGTGGACTGGGAAAGTCTGGCCCTAATTTCTATTTTTATTT
+TCCCTGAAGGGGCATTAGACGGGCAACCGCAGACTGGCTTACCAGTTTCCGCTGAGAATGGCAACGGCATGTTGACACAACTCAACCGCCAGTTCCCGAC
+CATTAGCCTGTTAGATATTGGCGCGATTTTTAAAACAGGTCGGTCAGGTGCTGGAGCAGGTAAGTCGGGCGCTGGAAGTGATGGTGGTACTGGTCACCGC
+CTGCGGTATGTTGCTGTTGCTGGCACAGGTGCAGGTGGGAATGCGTCAGCGTCATCAGGAGCTGGTGGTGTGGCGCACACTCGGTGCGGGAAAAACTGCT
+GCGTACCACGTTGGTGTGAGTTCGCCATGCTTGGGTTTGTTTCCGGCCTGGTGGCCGCAATTGGTGCGGAAACGGCGCTGGCAGTGTTGCAGGCGAGTGT
+TTGATTTTCCGTGGAGCCAGACTGGCGATTGTGGATTGTTCTGCCGTGCAGCGGAGGCGCTGCTGCTGTCGCTTTCGGCGGCTGGCTGGGTGCGCGACTG
+GTTAAAGGGTAAGGCGCTGTTCAGGCAGTTTGCGGGGGTGATGAGTAAATAAGGGGCGTTCTGGTTGAATGGAACGCCTTGTTTAAATTAATTCTACAAT
+ATGTTTCATTGATGATGTTATTGAATTGGTGATTTCCTATCTTCTATTGCTGATATTAATCTGAATCGGTGGAGTTTATTGATTTTAAATATAGCCCTAC
+AAAAATAACTCAGACTAATAAAATCATAAATCATATGCGTTGAATGGATATTATCCATATAGTGAATTTGTTGATGAATTCATCTGTGCTAAAATGTTAG
+TTTAATAAAATATTGAAAGTGACCTGTAATAACAGTTGTTGTTGATTGAGAACAAATAAGTTTATGTGAAAAATATATAAATACATTAGCTGGTCTTGTG
+TGTCATTTTATTTTTTGTTGCTAACACAGGATATGAACAATAACTAAAGGGCACTTTATATGAGCGGAAAACCAGCGGCGCGTCAGGGAGATATGACTCA
+GTATGGCGGTCCCATTGTCCAGGTTCGGCAGGTGTAAGACTTAGCGCGCCCACCGGCGTGGCGTGCTCAGTGTGTCCGGCGGGATGACTTCGGGCAACCC
+GGTAAATCCGCTGCTGGGGGCGAAGGTGCTGCCCGGCGAGACGGACCTTGCGCTGCCCGGCCCGCTGCCGTTCATTCTCTCCCGCACCTACAGCAGCTAC
+CGGACGAAGACGCCTGCACCGGTGGGCGTTTTCGGCCCCGGCTGAAAACGCCTTCTGATATCCGCTTACAGCTACGTGATGACGGACTGATACTCAACGA
+CAACGGCGGGCGGAGCATTCACTTTGAGCCGCTGCTGCCGGGGAGGCGGTGTACAGCCGCAGTGAGTCAATGTGGCTGGTGCGCGGTGGTAAGGCAGCAC
+AGCCGGACGGCCATACGCTGGCGCGGCTGTGGGGGCGCACCGCCGGATATCCAGTTAAGCCCGCATCTTTACCTGGCGACCAACAGCGCACAGGGGCCGT
+GGTGACTGGGGTGGTCTGGCGGGTGCCGGGTGCTGAGGACGTACTGCCAGCGCCGCTGCCGCCGTACCGGGTGCTTACCGGGATGGCGGACCGCTTCGGG
+CGGACGCTGACGTACCGGCGTGAGGCCGCCGGTGACCTGGCCGGGGAAATCACCGGCGTGACGGACGGTGCCGGGCGGGAGTTCCGTCTGGTGCTGACCA
+CGCAGGCGCAGCGTGCGGAAGAGGCCCACCCTCTTCGCTATCTCCTTCTGACAGTTCCCGCCCTCTCTCAGCCTCAGCGTTCCCCGACACTGCCCGGTAC
+CGAATACGGCCCCGACAGGGTATCCGCCTTTCGGCGGTGTGAAGCTGATGCACGACCCGGCATACCCGGAGAGCCTGCCCGCTGCGCCACTGGTGCGGTA
+CACGTATACGGAAGCCGGTGAACTGCTGGCGGTATATGACCGCAGCAATACGCAGGTGCGCGCTTTCACGTATGACGCGCAGCACCCGGGCCGGATGGTG
+GCGCACCGTTACGCGGGAAGGCCGGAGATGCGCTACCGCTACGACGATACGGGGCGGGTGGTGGAGCAACTGAACCCGGCGGGTTAAGCTACCGCTATCT
+TTATGAGCAGGACCGCATCACCGTCACCGACAGCCTGAACCGGCGTGAGGTGCTGCATACAGAAGGCGGGGCCGGGCTGAAACGAGGTGGTGAAAAAGAA
+CTGGCGGACGGCAGCGTC
+>tig00000012 len=2176 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
+AACATAAAAACAGCACCGCCAGCCCCAGCATGTTCAGGCCGAGAATGGCACAAAGATATTGCTTCCAGTTCATCTCACGGTCAGAGACGCCAAGTGCGCG
+AAAAAGTACGCGCTCAACGCCCGTTGTACCGGAAGAGGAATGTCATTAATCAACCGCGCCAGCCCGCTGCCTAAAGGACGCGCCAGCACACCATTAACAC
+CAGTAAAAACGTGGCGATCAGTAAGAACCCTTGCGCAGCCATCAGAACGCCTCCGCATTGATCAGGGCATAAACCAGATAACCCAGTAATAAAAGCACCA
+GCAATACGCCGGTTATCACGCCTGCACTCACAGTGCACCTCCAGTGGCCTAAAAGTGATACCGGAAGGTAGAATTCTGGCTGCAAAGATTTCGCAAAATC
+TGCGGGCGGGGTGTAAAAGTATAAAAATGGCAAAAAGCCATGATTTAACTAATGTTTAGTATTAATTTAACTTTGTGTAACTTAATTGCAGGATGAATGT
+AAATAAACCATCAATAAGCAAAAATAAGTGGTCGGATGAGTAGTAAAATGCACAAAGGCGGTACTATTTCTGCATCAGATAAACAAATTCATTTTTCCGG
+TGCCATTCACCGGGTAGATACAAAGGGGGAGAAAAGTATGGAACTCTGCAGAGAATATCTGCATGGCTTATCTTTACGCCATTACTTATGCGGTTGCAGC
+GGGCGTTCTGGCGCTGCCCTTTCATGCTTTTCTGGAAAGACCGCGCCCGCTTTACAGCTACCTGCATCGCGTCTGGCAGAAACCAGCGATAAACCGGTGT
+GGATGGATCAGGCCGAAAAGGCGGCTGGTGATTTTATTGATTGCTGAGTTTGAATGCATTGAAACCGCCAGCGGAAACGCTGGCGGTTTTTTATCAGGAA
+GATGTTCAGAGGAATATTTAGACATCGTTATACCAATCGAAACATATATTCATGGAAATATATATAAATATTTTCCTAATTGTTCTTATCGACAGATATC
+TCGCCAGGCTTTCTTATAAATCTGTAGGGTTTCGCCCTGTCGGCATAAAATAACCCGATAAAACAAGGATGAGCAGATGAGCGGAAAACCGGCGGCGCGT
+CAGGGCGACATGACGCAGTATGGCGGTAGCATTGTCCCAGGGTTCAGCCAGGGTACGCATCGGTGCCCCACCGGCGTGGCCTGTTCGGTGTGCCCGGCGG
+GTGACGTCCGGCCATCCGGTCAATCCGCTGCTCGGTGCAAAGGTCCTTCCGGTGAAACCGACATCGCCCTGCCCGGCCGCTGCCGTTCATTTCTCTCCAC
+TAGCAGTTACCGGACAAAACGCCCGCGCCGGTGGGGAGCCTCGGCCCCGGCTGGAAAATGCCTGCGGATATCCGCTTACAGCTGCAAGATAACACACTGA
+TACTCAGTGATAACGGCGGCAGAAGCCTGTATTTTGAGCACCTGTTTCCCGGTGAGGACGGTTACAGCCGCAGCGAGTCACTGTGGCTGGTGCGCGGCGG
+CGTGGCGAAACTGGATGAAGGTCACCGGCTGGCCGCACTCTGGCAGGCGCTGCCGGAAGAACTCGCTTAAGTCCGCATCGTTATCTGGCGACAAACAGTC
+CGCAGGGCCGTGGTGGCTGCTCGGCTGGTGTGAGCGGGTGCCGGAAGCTGATGGGGTGCTGCCTGCGCCGCTGCCGCCGTACCGGGTACTGACCGGGCTG
+GTGGACCGCTTCGGCGCATTACAGACGTTCCACCGCGAAGCCGCGGTGAATTCAGCGGCGAAATCACCGGCCCGTGACGGATGGTGCCGGGCGTCACTTC
+CGGCTGGTACTGACCGCAGGCGCAGCGGGCAGAAGAAGCCCGGCAGCAGCCATTTCCGGCGGACGGAACCGTCCGCTTTTCCCGATACCCTGCGGGTTAC
+ACCGGAATATGGCCGGGACAACGGCATCCGTCTGTCTGCCGTGGGCTGACCCCGCACGACCCGGAATACCCGGAGAATTTACCCCTGCCGCGCCGCTGGT
+GCGCTATGGCTGGACGCCCGCGAACTGGCGGCAGTGTATGACCGCAGCAATACACAGGTGCGCAGCTTTACTGATGATAAAATACCGGGGCCGGATGGTG
+GCGTACCGTCACACGGGCCGACCGGAAATCTGTTACCGTTACGACAGCGACGGGCGGGTGACAGAACAGCTAAACC
+>tig00000013 len=6987 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
+AATTCTACCCTTCCGGTATCACTTTTAGGCCACTGGAGGTGCACTGTGAGTGAGGCGTGATAACCGGCGTATTGCTGGTGTTTTATTGCTGGGTTATCTG
+GTTTTATGCCTGATCAATGCGGAGGCGTTCTGATGGCTGCGCAAGGTTCTTACTGATCGCCACGTTTTTACTGGTGTTGGTGCTGGCGCGTCCTTTGGGC
+AGCGGGCTGGCGCGGCTGATTAATGACATTCCTCTTCCCGGTACAGCGGGCGTTGAGCGCGTACTTTTTCGCGCACTTGGCGTCTCTCTGACCGTGAGAT
+GAACTGGAAGCAATATCTTTGTGCCATTCTCGGCCTGAACATGCTGGGGCTGGCGGTGCTGTTTTATGTTGCTCGGTCAGCACTGGCATCACCCTTCCAT
+AATCCACAGCAGTTGCCAGGGCTGTCGTGGGATCTGGCGCTGAATACCGCCGTCAGCTTTGTCACCAATACCAACTGGCAATCTTATAGCGGTGAAACCA
+CGTTGAGCTATTTCAGCCAGATGGCGGGCTTAACGGTGCAAAACTTTCTTTCTGCCGCCAGCGGGATTGCGGTGATTTTTGCCCTCATCCGTGCGTTTTA
+CCCGCCAGAGCATGAGCACGCTCAGGAATGCCTGGGTCGATCTGCTACGCATCACGTTATGGGTGCTAGTCCCTGTGGCGTTGTTGATTGCACTGTTTTT
+ATTCAACAAGGTGCGCTGCAAAACTTTCTGCCTTATCGAACTGTGAATACCGTTGAAGGAGCGCAACAGCTGTTACCCATGGGGCCTGTAGCTTCTCAGG
+AAGCGATCAAGATGCTCGGTACTAACGGCGGTGGCTTCTTTAATGCCAACTCGTCGCATCCGTTTGAAAACCAACCGCACTGACCAACTTCGTGCAGATG
+CTGGCGATCTTCTTGATCCCAACGGCGCTGTGCTTTGCCTTTGGTGAAGTGATGGGCGATCGCCGCCAGGGGCGCATGTTGCTAATGGGCGATGTCAGTG
+ATTTTGTCATCTGCGTAGGCGTGGTGATGTGGGCAGAAGTTCAGGGTAATCCTCATCTGCTGGCACTGGGCACGGACAGCAGCATCAATATGGAAGGTAA
+AGAGAGCCGTTTCGGCGTGCTGGTCAGTAGCCTGTTTGCGGTCGTGACGACGGCGGCTTCCTGTGGCGCGGTGATTGCGATGCATGATTCGTTTACCGCT
+CTCGGTGGCATGGTGCCGATGTGGCTGATGCAAATTGGTGAAGTGGTGTTCGGCGGTGTCGGTTCTGGTCTTTACGGCATGATGCTGTTTGTCCTGCTGG
+CGGTGTTGTGCCGGGCTGATGATTGGTCGTACACCGGAATATCTGGGTAAAAAATCGACGTACGCGAGATGAAACTGACTGCACTGGCAATTCTGGTTAC
+CCCGACGCTGGTGCTGATGGGCGCGGCGTTGGCGATGATGACCGACGCCGGACGTAGCGCCATGCTCAACCCTGGCCCGCATGGTTTTGCGAAGTGCTGT
+ACGCCGTGTCATCCGCCGCTAACAACAACGGCAGCGCCTTTGCCGGATTAAGCGCCAACTCTCCGTTCTGGAACTGTTTACTGGCGTTCTGCATGTTTGT
+CGGTCGCTTCGGGTGATTATCCCGGTGATGGCAGTGCCGGTTCGCTGGTGAGTAAAAGAGCCAAGCCGCCAGCTCCGGCACGCTGCCAACGCACGGCCCG
+CTGTTTGTTGGCCTGTTAATCGGCACCGTGTTGCTGGTTGGCGCACTGACCTTTATCCCTGCCCTGGCGCTTGGTCGGTGTGGAATATCTCTCCTGATGA
+TATTGGTGAGCACTGAATATGAGTCGTAAACAACTGGCGCTATTCGAGGCCAACACTTGTCGTTCAGGCGCTGAAAGAAGCGGTGAAAAAATTAAACCCG
+CAGGCGCAATGGCGCAATCCGGTGATGTTTATCGTCTGGATCGGCAGTCTGCTGACCACCTGTATTAGCATCGCGATGGCAAGCGGTGCGATGCCCGACA
+ATGCGCTGTTTAGCGCGGCCATTAGCGGTTGGCTGTGGATCACCGTACTGTTCGCTAATTTCGCCGAGGCGCTGGCGAAGGCCGCAGTAAAGCGCAGGCC
+AACAGTCTGAAGGGGTGAAAAACTGCCTTTGCCCGCAAGCTGCGTGAGCCGAAATATGGCGCTGCGGCGGACAAAGTTCCTGCCGACCAACTTCGTAAAG
+GCGATATCGTACTGGTAGAAGCTGGCGATATTATCCCCTGCGATGGTGAAGTTATTGAAGGGTGCATCGGTCGATGAAAGCGCCATCACCGGGAATCGGC
+ACCGGTGATCCGTGAATCCGGCGATTTTGCCTCCGTCACCGGCGGCACGCGTATTCTTTCTGACTGGCTGGTGATTGAGTGTAGCGTTAACCCCGGCGAG
+ACATTTCTGGATCGGATGATCGCGATGGTGGAAGGCGCACAGCGACGCAAAACGCCGAACAAAATTGCCTGACCATTCTGCTGATTGCCCTGACTATCGT
+CTTTTACTGGCAACCGCCACGCTGGGCCGTTTTCCGCGTGGGGCGGTAATGCAGTCAGCGTAACGGTACTGGTGGCGCTGCTGGTCTGTCTGATCCCAAC
+CACTATTGGCGGCCTGTTGTCAGCGATCGGCGTCGCCGGGATGAGCCGGATGCTAGGCGCGAATGTGATTGCCACCAGCGGACGTGCAGTTGAAGCGGCA
+GGTGACGTTGACGTTCTGCTACTGGATAAAACCGGCACCATCACACTCGGTAACCGTCGGGCGTCGAGTTTATCCCCGCGCAGGGGCGTGGATGAAAAAC
+GCTGGCTGACGCCGCACAACTGGCTTCGCTGGCTGATGAAACGCCGGAAGGCCGCAGTATTGTGATCCTCGTAAAGCAGCGTTTTAACCTGCGCGAGCGC
+GATGTACGAGTATCCATGCCACCTTTGTACCGTTTACTGCGCAAAGCCGGATGAGCGGGATCAACATCGACAACCGCATGATCCGTAAAGGTTCTGTCGA
+TGCCATTCGTCGCCATGTTGAGGCTAACGGTGGTCACTTCCTACCGATGTTGATCAAAAGTCGATCAGGTTGCGCGTCAGGAGCCACGCCGCTGGTGGTG
+GTGGAAGGTTCTCGTGTGCTGGGCGTTATTGCGCTGAAGATATCGTCAAAGGCGGTATTAAAGAGCGCTTCGCCCAGCTGCGCAAAATGGGCATTAAAAC
+GGTGATGATTACCGGCGATAACCGTCTGACTGCCGCCGCGATTGCTGCGGAAGCGGGTGTCGATGATTTTCTCGCCGAAGCGACACCGGGGCCAAGCTGG
+CATTGATCCGTCAGTATCAGGCGGAAGGTCGTTTGGTAGCGATGACCGGCGACGGCACCAACGATGCTCGGCGCTGGCGCAGGCGAATGTCGCGGTGGCG
+ATGAACTCCGGCGCAGGCGGCGAAAGGCGGGCAATATGGTCGATCTCGACTCTAACCCGACCAAGTTGATCGAGGTGGTGCACATTGGCAAACAGATGCT
+GATGACCCGTGGCTCGCTGACCACCTTCAGCGTACCAACGATGTGGCGAAATACTTCGCCATTATTCCGGCGGCATTCGCGGCAACGTATCCGCAGTTAA
+ATGCGCTGAACATCATGTGCTGCATTCGCCCGACTCCGCAATCCTCGGTGCGGTGATTTTCAACGCCTTGATTATCGTCTTTTTGATTCCCCTGGCGTTA
+AAGGCGTGAGTTATAAACCGCTTACCGCTTCTGCCATGTTGCGCCGTAACTTATGGATTTACGGTCTGGGTGGGCTGCTGGTGCCGTTTATCGGTATCAA
+AGTCATTGATTTACTGCTGACCGTTTGCGGTCTGGTGTGAGGTTTACCATGAGTGGATTACGTCCGGCATTATCAACATTTATCTTTCTGTTATTGATTA
+CTGGCGGCGTTTACCGCTGCTGACCACCGTACTGGGGCAATGGTGGTTTCCCTGGCAGGCCAATGGTTCGTTGATTCGTGAAGGTGATACGGTGCGCGGT
+TCGGCATTAATCGGGCAGAATTTTACCGGCAGCTGTTTTCATGGTCGCCCGTCAGCAACAGCAGAAATGCCTATAATCCACAGGCTTCTGGCGGGAGCAA
+TCTGGCAGTCAGTAACCTGAGCTGGATAAACTAATAGCCGCACGCGTTGCTGCATTACGGGCCGCTAACCCGGATGCCAGCGCAGGCGTTCCAGTTGAAC
+TGGTGACGGCATCGGCAAGCGGGCTGGACAATAATATCACCCGCAAGCGGCGGCCTGGCAAATCCACGCGTGGCGAAAGCGCGTAATCTCAGCGTTAGAA
+CAGCTCACGCAACTGATCGCAAAATACAGCCAACAACCGCTGGTGAAATATATCGGCCAGCCGGTTGTCAACATTGTTGACTCAATCTGGCGCTGGATAA
+ACTTGATGAATAACGAACCCTTACGTCCCGACCCCGATCGTCTGCTGGAACAAACTGCCGCGCCGCATCGGGAAGCTGAAAAGTTTCTTCGGTGCCTGTG
+CAGGCGTCAGGAAGACCTGGGCGATGCTGGCAGAAGCCCAGCGACTGCAAAGGGCTGGATATTGTGGTTGGCGTGGTAGAAACCCACGGGCGAAAGATAC
+CGCCGCCATGCTGGAAGGGCTGGCTGTTCTGCCGTTAAAACGCCAGGCGTACCGTGGGCGGCATATCAGCGAGTTTGATCTCGATGCCGCCCTCGCCCGC
+CGCCCGGCGCTGATCTTAATGGACGAACTGGCGCACAATGTGCGCCAGGTTCCCGTCATCCCAAACGCTGGCAGGATATCGAAGAACTGCTGGAAGCTGG
+CATTGATGTTTTCACTACCGTCAGCGTTCAGCATCTGGAAAGTCTGAATGATGTGGTCAGCGGCGTCACCGGAATTCAGGTACGGGAAACCGTGCCCGAT
+CCTTTTCGATGCCGCCGACGACGTGGTGCTGGTGGACTTGCCCCGGACGATCTGCGCCAGCGGCTGAAGAAGGCAAAGTCTATATTGCCGGGCAGGCGGA
+GCGCGCCATTGAACATTTTTCCGCAAAGGTAATCTGATCGCCCTGCGCGAGCTGGCACTGCGCCGTACTGCCGATCGCGTTGATGAGCAAATGCGCGCCT
+GGCGGGGCATCCTGGCGAAGAGAAGTGTAGCACGCGCGACGCGATCCTTTTATGCATCGGCCATAACACCGGCAGCGAAAACTGGTCCGCGCAGCTGCGG
+CTGGCGTCACGGCTGGGTAGCGTCTGGCACGCGGTGTATGTTGAAACCCCTGCCCTGCACCGCTTACCGGAAAAAACGTCGGGCAATTCTCAGCGCCTTA
+CGTCTGGCGCAGGAACTGGGCGCGGGGCGGCAACACTTTCTGATCCAGCGGAAGAGCGGTAGTGCGTTATGCCCGTGAACATAATCTCGGCAAGATTATT
+CTCGGTCGCCCGGCCTCGCGCCGCTGGTGGCGATCGGGAAACGTTTGCTGACCGACTGGCGCGCATCGCCCCGATCTCGATCAGGTGCTGGTCGCGCTTG
+ATGATCACCACGCCCGCACGATTAACAACGCGCCGGATAACCGCTCTTTTAAAGACAAGTGGCGTGTACAAATTCAGGGATGCGTGGTTGCCGCCGCGTT
+ATGCGCCGTTATCACCTTAATTGCCATGCAGTGGCTGATGGCGTTTGATGCCGCCAACCTGGTGATGCTGTATCTGCTTGGCGTGGTGGTGGTGGCGCTA
+TTTATGGACGCTGGCCTTCGGTGGTTGCCACCGTCATTAATGTAGTGAGTTTCGATCTCTTTTTTATCGCCCACGCGGCACGCTCGCCGTCTCTGATGTG
+CAATATCTGCTGACCTTCGCGGTGATGTTAACCGTCGGGCTGGTGATCAGGAACCTTACTGCTGGCGTGCGTTATCAGGCGCGGGTAGCCCGTTACCGCG
+AGCAACGCACGGCACTTATATGAAATGTCGAGCTCTGGCGGTGGGCCGCAGTCCGCAGGATATCGCTGCCACCAGCGAACAATTTATTGCCTCCACGTTT
+CATGCCCGCAGTCAGGTGTTGTTGCCCGATGACAACGGTAAATTGCAGCCGTTAACACATCCGCAAGGAATGACGCCGTGGGACGATGCCATCGCGCAGT
+GGAGTTTGATAAAGGCCTGCCTGCGGGCGCGGGCACCGACACGTTACCCGGTGTACCGTACCAGATTTTGCCGTAAAAGCGGCGAAAACCACGGGCTGGT
+GGTGGTGGAGCCGGGAATCTGCGCCAGTTGATGATCCCGGAACAGCAGCGCCTGCTGGAACGTTACGCTGTTAGTCGCCAATGCCCTTGAGCGGCTGACG
+CTAACCGCCACGAAAAAGAACAGGCGCGGATGGCAAGCGAACGTGAACAGATCCGCAACGCCTGCTGGCGGCGCTTTCGCATAATTTACGCACGCCGCTT
+ACGGTGCTGTTTGGTCAGGCAGAAATCTTAACGCTCGATCTGGCAAGCGAGGATCACCCCGCCCGCCAGGCCAGCGAGATCCGTCAGCATGTGCTGAACA
+CTACCCGACTGGTGAATAATCTACTGGATATGGCGCGAATTCAGTCCGGCGGCTTTAATTTGAAGAAAGAGTGGTTAACGCTGGAAGAAGTAGTCGGCAG
+CGCGCTGCAAATCTGGAACCGGGTTTATCGTCGCCCATCAATCTTTCTCTGCCAGAACCGCTGACCTTAATCCACGTTGACGGGCCTCTTTGAACGGGTG
+CTGATTAATCTGCTGGAGAACGCGGTGAAATATGCGGGTGCGCAGGCCGAAATTGGTATCGATGCCCACGTTGAGGCGAAAATCTACAACTGGATGTCTG
+GGATAGCGGCCCCGGTCTTCCGCCAGGCCAGGAGCAGACGATATTTGATAAGTTTGCTCGCGGGAATAAAGAGTCGGCAGTACCGGGGGTAGGGCTTGGA
+CTGGCAATTTGTCGGGCGATAGTGGATGTACACGGGGCACTATTACGCGTTCAACCGACCGGAAGGTGGTGCCTGTTTTCGTGTTAC
+>tig00000014 len=6644 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
+GAATGCCTGGGTCGATCTGCTACGCATCACGTTATGGGTGCTAGTCCCTGTGGCGTTGTTGATTGCACTGTTTTTTATTCAACAAGGTGCGCTGCAAAAC
+TTTCTGCCTTATCAGGCTGTGAATACCGTTGAAAGGCGCAACAGCTGTTATTACCATGGGGCCTGTAGCTTCTCAGGGAAGCGATCAAGATGCTCGTACT
+AACGGCGGTGCTTCTTTAATGCCAACTCGTCGCATCCGTTTGAAAACCCAACCGCACTGACCAACTTCGTGCAGATGCTGGCGATCTTCTTGATCCCAAC
+GGCGCTGTGCTTTGCCTTTGGTGAAGTGATGGGCGATCGCCGCCAGGGGCACTTGTTGCTGTGGGCGATGTCAGTGATTTTTGTCATCTGCGTAGGCGTG
+GTGATGTGGGCAGAAGTTCAGGTGTCCTCATCTGCTGGCACTGGGCACGGACAGCAGCATCAATATGGAAGGTAAAGAGAGCCGTTTCGGCGTGCTGGTC
+AGTAGCCTGTTTGCGGTCGTGACGACGGCGGCTTCTGTGGCGCGGTGATTGCGATGCATGATTCGTTTACCGCTCTCGGTGGCATGGTGCCGATGTGGCT
+GATGCAAATTGGTGAAGTGGTGTTCGGCGGTGTCGGTTCTGGTCTTTACGGCATGATGCTGTTTGTCCTGCTGGCGGTGTTTATTGCCGGGCTGATGATT
+GGTCGTACACCGGAATATCTGGGTAAAAAATCGACGTACGCGAGATGAAACTGACTGCACTGGCAATTCTGGTTACCCCGACGCTGGTGCTGATGGGCGC
+GGCGTTGGCGATGACCGACGCCGGACGTAGCGCCATGCTCAACCCTGGCCCGCATGGTTTTGGCGAAGTGCTGTACGCCGTGTCATCCGCCGCTAACAAC
+AGCAGCAGCGCCTTTGCCGGATTAAGCATATCTCCGTTCTGGAACTGTTTACTGGCGTTCTGCATGTTTGTCGGTCGCTTCAGGGTGATTATCCCGGTGA
+TGGCAGTGCCGGTTCGCTGGTGAGTAAAAGCCAAGCCGCCAGCTCCGGCGCTGCCAACGCACGGCCCGCTGTTTGTTGGCCTGTTAATCGGCACCGTGTT
+GCTGGTTGGCGCACTGACCTTTATCCCTGCCCTGGCGCTTGGTCGGTGGCGGAATATCTCTCCTGATGATATTGAGTGAGCACTGAATATGAGTCGTAAA
+CAACTGGCGCTATTCGAACCAACACTTGTCGTTCAGGCGCTGAAAAGAAGCGGTGAAAAATTAAACCCGCAGGCGCAATGGCGCAATCCGGTGATGTTTA
+TCGTCTGGATCGGCAGTCTGCTGACCACCTGTATTAGCATCGCGATGGCAAGCGGTGCGATGCCCGGCAATGCGCTGTTTAGCGCGGCCATTAGCGGTTG
+GCTGCGGATCACCGTACTGTTCGCTAATTTCGCCGAGGCGCTGGCAGAAGGCCGCAGTAAAGCGCAGGCCAACAGTCTGAAGGGGTGAAAACTGCCTTTG
+CCCGCAAGCTGCGTGAGCCGAAATATGGCGCTGCGGCGGACATTCCTGCCGACCAATACGTAAAAGGCGATATCGTACTGGTAAAGCTGGCGATATTATC
+CCCTGCGATGGTGAAGTTATTGAAGGGGTGCATCGGTCGATGAAAGCGCCATCACCGGAATCGGCACCGGTGATCCGTGAATCCGGCGGCGATTTTGCCT
+CCGTCACCGGCGGCACGCGTATTCTTTCTGACTGGCTGGTGATTGAGTGTAGCGTTAACCCGGCGAGGCATTTCTGGATCGGATGATCGCGATGGTGGAA
+GGCGCACAGCGACGCAAAACGCCGAACAGAAATTGCCTGACCATTCTGCTGATTGCCCTGACTATCGTCTTTTACTGGCAACCGCCACGTAGCCGTTTTC
+GCGTGGGGCGGTAATGCAGTCAGCGTAACGGTACTGGTGGCGCTGCTGGTCTGTCTGATCCCAACCACTATTGGCGGCCTGTTGTCAGCGATCGGCGTCG
+CCGGGATGAACCGGATGCTGAGCGCGCGAATGTGATTGCCACCAGCGGACGTGCAGTTGAAGCGGCAGGTGACGTTGACGTTCTGCTACTGGATAAAACC
+GTACCATCACACTCGGTAACCGTCAGGCGTCAGGTTTATCCCCGCGCAGGGCGTGGATGAAAAACGCTGGCTGACGCCGCACAACTGGCTTCGCTGGCTG
+ATGAAACGCCGGAAGGCCGCAGTATTGTGATCCTCGCCAAGCAGCGTTTAACCTGCGCGAGCGCGATGTGCAGTCGCTCCATGCCACCTTTGTACCGTTG
+CGCAAAGCCGGATAGGCGGGATCAACATCGACAACCGCATGATCCGTAAAGGTTCTGTCGATGCCATTCGTCGCCATGTTGAGAGGCTAACGGTGGTCAC
+TTCCCTACCGATGTTGATCAAAAGTCGATCAGGTTGCGCGTCAAAGGAGCCACGCCGCTGGTGGTGGTGGAAGGTTCTCGTGTGCTGGGCGTTATTGCGC
+TGAAGATATCGTCAAAGGCGGTATTAAAGAGAGCGCTTCATAGCTGCGCAAAATGGGCATTAAAACGGTGATGATTACCGGCGATAACCGTCTGACTGCC
+GCCGCGATTGCTGCGGAAGCGGGTGTCGATGATTTTCTCGCCGAAGAAGCGACACCGAGTAAGCTGGCATTGATCCGTCAGTATCAGGCGGAAGGTCGTT
+TGGTAGCGATGACCGGCGACGGCACCAACGATGCTCCGGCACTGGCGCAGGCAGATGTCGCAGTGGCGATGAACTCCGGCGCAGGCGGCGAAAGGCGGGC
+AATATGGTCGATCTCGACTCTAACCCGACCAAGTTGATCGAGGTGGTGCACATTGGCAAACAGATGCTGATGACCCGTGGCTCATGACCACCTTCAGCGT
+ACTGTGGCGAAATACTTCGCCATTATTCCGGCGGCATTCGCGGCAACGTATCCGCAGTTAATGCGCAGACATCATGTGCCTGCATTCGCCCGACTCCGCA
+ATCCTCGGGTGCGGTGATTTTCAAGCTTTGATTATCGTCTTTGATTCCCTGGCGTTAAAAGGCGTGAGTTATAAACCGCTTACCGCTTCTGCCATATTTG
+CGCCGTAACTTACGGATTACGGTCTGGGTGGGCTGCTGGTGCCGTTTATCGTATCAAAGTCATTGATTTACTGCTGACCGTTTGCGGTCTGGTGTGAGGA
+CTTTACCATAGTGGATTACGTCCGGCATTATCAACATTTATCTTTCTGTTATTGATTACTGGCGTTTACCCGCTTGCTGACCACCGTACTGGGGCAATGG
+TGGTTTCCTGGCAGGCCAATGGTTCGTTGATTCGTGAAGGTGATACGGTGCGCGGTTCGGCATTAATCAGGCAGAATTTACCGGCAACGGCTGTATTTTT
+CATGGTCGCCCGTCAGCAGCAGCAGAAATGCCCTATAATCCACAGGCTTCTGGCAGGAGCAATCTGGCGGTCAGTAACCCTGAGCTGGATAAATTAATAG
+CCGCACGCGTTGCTGCATTACGGGCCGCTAACCCGGATGCCAGCGCAGGCGTTCGGTTGAACTGGTGACGGCATCGGCAAGCGGGCTGACAATAATATCA
+CCCGCAAGCGGCGGCCTGGCAAATCCCACGCGTGGCGAGCGCCATAATCTCAGCGTTGAACAGCTCACGCAACTGATCGCAAAATACAGCCAACAACCGC
+TGGTGAAATATATCGGCCAGCCGGTTGTCAACATGTTGAAACTCAATCTGGCGCTGGATAAACTCGATGAATAACGAACCCTTACGTCCGACCCCGATCG
+TCTGCTGGAACAAACTGCCGCGCCGCATCGGGAAGCTGATTTTCTTCGGTGCCTGTGCAGGCGTCAGGGAAGACCTGGGCGATGCTGGCAGAAGCCCAGC
+GACTGCGAGCGCAAGGGCTGGATATTGTGGTTGGCGTGGTAGAAACCCACGGGCGAAAGATACCGCCGCCATGCTGGAAGGGCTGGCTGTTCTGCCGTTA
+AAACGCCAGGCGTACCGTGGGCGGCATATCAGCGAGTTTGATCTCGATGCCGCCACTCGCCCGCCGCCCGGCGCTGATCTTAATGGACGAACTGGCGCAC
+AGTAATGCGCGGAGTTCCCGTCATCCCAAACGCTGGCAGGATATCGAAGAACTGCTGGAAGCTGGCATTGATGTTTTCACTACCGTCAACGTTCAGCATC
+TGGAAAGTCTGAATGATGTGGTCAGCGGCGTCACCGGAATTCAGGTACGGAAACCGTGCCCGATCCTTTTCGATGCCGCGACGACGTGGTGCTGGTGGAC
+TTGCCCCGGACGATCTGCGCCAGCGGCTGAAAGAAGGCAAAGTCTATATTGCCGGGCAGGCGGAGCGCGCCATTGAACATTTTTCCGCAAAGGTAATCTG
+GTCGCCCTGCATGAACTGGCACTGCGCCGTACTGCCGATCGCGTTGATGAGCAAATGCGCGCCTGGCGGGGGCGTCCTGGCGAAGAGAAAGTGTGCACAC
+GCGACGCGATCCTTTTATGCATCGGCCATAACACCGGCAGCGAAAAACTGGTCCGCGCAGCTGCGCGCTGGCGTCACGGCTGGGTGGCGTCTGGCACGCG
+GTGTTATGTTGAAACCCCTGCCCTGCACCGCTTACCGGAAAAAACGTCGGGCAATTCTCAGCGCCTTACGTCTGGCGCAGGAACTGGGCTGGAGACGGCA
+ACACTTTCTGATCCAGCGGAAGAGAAAGCGGTAGTGCGTTATGCCCGTGAACATAATCTCGGCAAGATTATTCTCAGTCGCGGCCTCGCGCCGCTGGTGG
+CGTCGGGAGACGTTTGCTGACCGACTGGCGCGCATCGCCCCGATCTCGATCAGGTGCTGGTCGCGCTTGATGAACCACCCGCCCGCACGATTAACAACGC
+GCCGGATAACCGCTCTTTTAAAGACAAGTGGCGTGTACAAATTCAGGGATGCGTGGTTGCCGCCGCGTTATGCGCCGTTATCACTTTAATTGCCATGCAG
+TGGCTGATGGCGTTGATGCCGCCAACCTGGTGATGCTGCTGTATCTGCTTGGCGTGGTGGTGGTGGCGCTATTTATGGACGCTGGCCTTCAGTGGTTGCC
+ACCGTCATTAATGTAGTGAGTTTCGATCTCTTTTTATCGCCCCACGCAGCACGCTCGCCGTCTCTGATGTGCAATATCTGCTGACCTTCGCGGTGATGTT
+AACCGTCGGGCTGGTGATCAGGAACCTTACTGCTGGCGTGCGTTATCAGGCGCGGGTAGCCCGTTACCGCGAGCACGCACACGGCACTTATATGAAATGT
+CGAAAGCTCTGGCGGTGGGCCGCAGTCCGCAGGATATCGCTGCCACCAGCAGACAATTTATTGCCTCCACGTTTCATGCCCGCAGTCAGGTGTTGTTGCC
+CGATGACAACGGTAAATTGCAGCCGTTAACACATCCGCAAGGAATGACGCCGTGGGACGATGCCATCGCCGCAGTGGAGTTTTGATAAAGGCCTGCCTGC
+GGGCGCGGGCACCGACACGTTACCCGGTGTACCGTACCAGATTTTGCCATAAAAAGCGGCGAGAAAACCTACGGGCTGGTGGTGGTGGAGCCGGGAATCT
+GCGCCAGTTGATGATCCCGGAACAGCAGCGCCTGCTGGAAGACGTTACGCTGTTAGTCGCCAATGCCCTTGAGCGGCGGCGCTAACCGCCAGCGAAGAAC
+AGGCGCGGATGGCAAGCGAACGTTGAACAGATCCGCAACGCCCTGCTGGCGGCGCTTTCGCATGATTTACGCACGCCGCTTACGGTGCTGTTTGGTCAGG
+CAGAAATCTTAACGCTCGGTCTGGCAAGCGAAGGATCACCCCGCCCGCCAGGCCAGCGGATCCGTCAGCATGTGCTGAACACTACCCGACTGGTGAATAA
+TCTACTGGATATGGCGCGAATTCAGTCCGGCGGCTTTAATTTGAAGAAAGAGTGGTTAACGCTGGAAGAAGTAGTCGGCAGCGCGCTGCAAATGCTGGAA
+CCGGGTTTATCGTCGCCCATCAATCTTTCTCTGCCAGAACCGCTGACCTTAATCCACGTTGACGGGCCCTCTTTGAACGGGTGCTGATTAATCTGCTGGA
+GAACGCGGTGAAATATGCGGGTGCGCAGGCCGAAATTGGTATCGATGCCCACGTTGAGGGCGAAAATCTACAACTGGATGTCTGGGATAACGGCCCCGGT
+CTTCCGCCAGGCCAGGAGCAGACGATATTTGATAAGTTTGCTCGCGGGAATAAAGAGTCGGCAGTACCGGGGTAGGGCTTGGACTGGCAATTTGTCGGGC
+GATAGTGGATGTACACGGGGGCACTATTACCGCGTTCAACCGACCGGAAGGTGGTGCCTGTTTTCGTGTTACACTTCCCCAGCAAACTGCCCCTGAACTG
+AAGAATTTCAGCGAGGATATGTGACAAACGTTCTGATTGTTGAAGATGAACAGGCTATTCGTCGCTTTCTGCGCACGGCGCTGGAGGGCGACGGATGCGC
+GTCTTTGAGGCCGAAACGCTGCAACGCGGCTTGCTGGAAGCGGCAACCCGTAAGCCAGATTTGATTATTCTCGATCTCGGCCTGCCCGATGGTGATGGGA
+TTGAGTTTATCCGCGACCTGCGCCAGTGGAGCGCGGTGCCGGTG
+>tig00000015 len=3097 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
+GACAGCCTGGCAACTGCTGTGGATTAAGCGGCAGATGGTGCTGACCGAGCAACGCAAAAACAGCACCGCCAGCCCCAGCATGTTCAGGCCGAGAATGGCA
+CAGATATTGCTTCAGTTCATCTCACGGTCAGAGACGCCAAGTGCGCGAAAAAGTACGCGCTCAACGCCCGTTGTACCGGGAAGAGAATATCATTAATCAA
+CCGCCAGCCCGCTGCCTAAAGGACGCGCCAGCACCATTAACACCAGTAAAACGTGGCGATCAGTAAGAACCCTTGCGCAGCCATCAGAACGCCTCCGCAT
+TGATCAGGGCATAAACCAGATAACCCAGTAATAAAACACCAGCAATACGCCGGTTATCACGCCTGCACTCACAGTGCACCTCCAGTGGCCTAAAGTGATA
+CCGGAAGGGGTAGAATTCTGGCTGCCAAGATTTCGCAAAATCTGCGGGCGGGGTGTAAAAATATAAAATGTGAAAAGCCATGGTTAACTAATGTTTAGTG
+AATTGCTTTTGTAACTTAATTACAGGATGAATGTAAATAAAACCATCAATAAGCAAAATAAGTGGTCGGATGGGTAGTAAAATTACACAAAAGGCATTTA
+TTTTCATCAGATAAACCAAATTCATTTTTCAGTGCCATTCACCGGTAGATACAAAGGGAGAAAAGTATGGAACTCTACAGAATATCACCATGGCTTATCT
+TTTTACGCCGTACTTATGCGGTTTGCGGCGGGCGTTCTGGCGCTGCCTTTCATGCTTTTCTGGAAAGGCCGCGCCCGCTTTACAGCTACCTGCATCGCGT
+CTGGTCGAAAACCAGCGATAAACCGGTGTGGATGGATCAGGCCGAAAAGGCAACTGGTGATTTTATTGATTGCTGGAGTTTGAATACATTGAAAACCGCC
+AGCGGAAACGCTGGCGGTTTTTATCAGGAAGATGTTCAGAGGAATATTTGAACATCGTTATACCAATCCGAAACATATATTCATGAAATATGCCATAAAT
+ATTTTCCTAATTGTTCTTATCTGACCAGATATCTCACTTAAAACAAAGCTTTCATAAATCTGTAGGGTTTCGCCTGGCATCAGCAGATAAATAACCCGAT
+AAAACAAGGATGAGCAGATGAGCGGAAAACCGGCGGCGCGTCAGGGCGACATGACGCGATATGGCTGATAGCATTGTCCAGGTTCAGCCGGGGTACGCAT
+CAGTGCCCCCACCGGCGTGGCCTGTTCGGTGTGCCCGGCGGGGGGTGACGTCGGCCATCGGTCAATCCGCTGCTCGGTGCAAGGTCCTTCCAGTGAAACC
+GACATCGCCCTGCCCGGCCCGCTGCCGTTCATTCTCTCCCGCACCTACAGCAGTTACCGGACAAAAACGCCGCGCCGGTGGGGAGCCTCGGCCCCGGCTG
+GAAAATGCCTGCGGATATCCGCTTACAGCTGCGCGATAACACACTGATACTCAATGATAACGGCGGCAAGCCTGTATTTTGACACCTGTTTCCCGGTAAG
+GACAGTGATTACAGCCACGGCGAGTCACTGTGGCTGGTGCGCGGCGGCGTGGCGAAACTGGATGAAAGGTCACCGGCTGGCCGCACTCTGGCAGCGCTGC
+CGGAAGAACTCCGCTTAAGTCCGCATCGTTATCTGGCGACAAACAGTCCGCAGGGCCGTGGTAGCTGCTCGGCTGGTGTGAGCGGGTGCCGGAAGCGGAT
+GAGGTGCTGCCTGCGCCGCTGCCGCCGTACCGGGTACTGACCGGGCTGGTGGACCGCTTCGGGCGCACACAGACGTTCCACCGAAGCCGCCGGTGAATTC
+AGCGGCGAAATCACCGGCGTGACGGATGGTGCCGGGCGTCACTTCCGGCTGGTACTGACCACGCAGGCGCAGCGGTAGAAGAAGCCCGGCAGCAGGCCAT
+TTCCGGCGGGACGGAACCGTCCGCTTTCCTGATACCTGCCGGGTTACACCGAATATGGCCGGGACAACGGCATCCGTCTGTCTGCCGTGTGGCTGACGCA
+CGACCGGAATACCCGGAGGAATTTACCTGCCGCGCCGCTGGTGCGCTATGGCTGGACGCCCGCGGCGAACTGGCGGCGGTGTATGACCGCAACCAATACA
+CAGGTGCGCAGCTTTACTTACGATGATAAATACCGGGGGCCGGATGGTGGCGCACCGTCACACGGGCCGACCGGAAATCTGTTACCGTTACGACAGCGAC
+GGGCGGGTGACAGAACAGCTAAACCGGCAGGCTTAAGTTACACGTATCAGTATGAGAAGGACCGCATCACCATCACCGACAGCCTGAACCGCCGTGAAGT
+CCTGCACACGCAAATTGAAGGCGGGCTGAAGCGAGTGGTGAAAAGGAACACGCGGACGGCAGCGTCACGCAGAGTCAGTTTGACGCGGTGGGCAGGCTCG
+GGCACTGAACGGATGCCGCAGGCAGGACAACGAATACAGTCCGGATGTGGTGACGGGCCTCATCACGCGCATCACCACGCCGGATGGCGGGGCATCGGCG
+TTTACTATAACCACCACAGCCAGTTAACGTCAGCCACCGGGCCTGACGGGCTGGAAATACGCCAGGAATATAGTGATACGATTGCGTCTGATTCAGGAAA
+CTGCCCCTGACGGCGATATCACCCGCTACCGTTATGATAATCCACACGGTGACTTACCCTGCGCAACGGAAGATGCCACCGGCGGCGGAAAACCATGACG
+TGGAGCCGTTACGGTCAGTTGCTGGGCTTCACTGACTGTTCCGGTTATGTAACCCGCTATGACCATGACCGTTTTGGTCAGGTGACGGCGGTCACCGCGA
+GGAAAGGGCTGAGTCAGTACCGCGCATACACGGCCGTGGACGGTTAATTGCCGTGAAAAGCACGCAGGGCCATAAAGACGCGGTATGAATACAACGCCGC
+CGGTGACCTGACCACCGTCATTGCCCCGGACGGCAGCGAAACGGGACACAGTACGATGCGTGGGGAGAAAACCATCATACCACGCAGGGCGGTCTGACGC
+GCAGTATATGGAATACGATGCGCCGGACGGGTCATCCGCCTGACCAGTGAAAACGGCAGCCACACCACCTTCCGTTACGATGTACTCGACCGGCTGA
+>tig00000016 len=5147 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
+CATGGCACCACGTTGATTATGGTGACCCACGACCTGCAACTGGCGGCGCTGCGACCGCTGCTTACGGCTGGTGAACGGGCAGTTGCAGGAGGAAGCATGA
+TTGCACGTTGGTTCTGGCGCGAATGGCGTTCGCCGTCGCTATTAATTGTCTGGCTGGCGCTAAGCCTGGCGGTGGCCTGCGTGCTGGCGCTGGGCAATAT
+CAGCGATCGCATGGAGAAGGGGCTTAAGCCAGCATTAAGCCGTGAGTTTATGGCGGGCGATCGGGCGTTGCGCAGTTCACGCGAAGTGCCGCAAGCGTGG
+CTGGAAGCGCAAGAGCGCGGCCTGAGAATCAGCAAGCGGCTGACTTTCGCCACAATGACCTTGCAGGCGACACACCGCAGCTGGCGAACGTCAAAGCGGT
+GGATGATATCTACCCGATGTATGGCGATCTGCAAACTAATCCCCTGGCCTGAAACCGCAGGCGGGCAGCGTATTACTGGCCCCACGCCTGATGGCACTGC
+TTAACCTGAAAACGGGCGACACCATTGGCGTGGGCGATGCCACCTTGCGGATTGCCGGAGAAGTGATTCAGGAACCGGTTCCGGTTTAACCCTTCCAGAT
+GGCTCCGCGTCTGATGATGAATCGGATGTCGATAAAACCGGAGCCGTGCAGCCGAGGGAGTCAGGTCACCTGGCGTTATAAATTCGGCGGCAACGAGAAC
+CAGCTCGACGGCTATGAAATGGTTGTTACCCTCAGCTTAAACCCGAACAACGCTGGTACGGTCTGGAACAGGACGAAGAGGCGCTGGGGCGATCGATGGA
+ACGCTCGTAACAGTTCCTGCTGCTTTCGGCGCTTCTGACCTGCTGCTGGCAGTGGCAGCGGTGGCGGTAGCGATGAATCATTACTGTCGCAGTCGCTACG
+ATCTGGTGGCGATCCTCAAAACGCTGGGGGCAGGGCGAGCGCAACTGCGTAAGCTAATCGTCGGTCAGTGGTTGATGGTGCTGACGCTTTCAGCCGTTAC
+CGGTGGGGCCATAGGCCTGTTGTTCGAAACGTGTTGATGGTGCTGCTTCAAGCCCGTTCTGCCTGCTGCACCGCCAGCCAGCCTCTGGCCGTGGCTGTGG
+GCGCTTGGCACCATGACGGTCATCTCGCTGCTGGTGGGGCTACGACCATATCGCTTGTTGCTGGCAACGCAGCCTTTACGCGTATTACGTAATGATGTGG
+TAGCGAACGTCTGGCCGCTGAAGTTTTATCTGCCGATTGTCAGTGTGGTGGTTGTGCTGCTGCTCGCCGGATTAATGGGTGGCAGCATGCTGCTTTAGCG
+GTGCTGGCGGGCGCGGTAGTACTGGCTTTGCTGTGCGGTGTGCTGGGCTGGATGCTGCTGAATGTACTACTTCGCCGCATGACGCTGAAATCGCTGCCCT
+CTGCGCCTGGCGGTTAGCCGCCTGTTACGTCAGCCGTGGTCAACGTTAAGTCAGCTTTCGGCATTTTCGCTCTCCTTTATGCTGCTGGCACTGCTGCTGG
+TGTTGCGTGGCGATCTGCTCGACCGCTGGCAGCAGCAGCTACCTCCAGAGAAGCCCGAACTACTTTTAATTAACATCGCCACAGAACAGGTAGCACCGCT
+AAAGCGTTCCTCGCGGAACCATCAGATAGTCGGAATCGTTTTATCCGGTGGTGCGCGGGCGCGTGACGGCGATTAACGATAAGCCGACAGAAGGTAATGA
+AGATGGGCGCTTAACCGCGAACTCAATCTTACCTGGCAAAATACGCGGCCCGATCATAATCCGATTGTCGCCGGTAACTGGCCGCCAAAAGCCGATGAAG
+TGTCGATGGAAGAGGGGCTGGCGAAACGCAAACGTTGCCCTCGGTGATACCGTGACTTTATGGGCGATACCCAGAGAGTTCCGCGCTAAAGTGACCAGCC
+TGCGCAAAGTGGACTGGGAAAGTCTGCGGCCTAATTTCTATTTTATTTTCCCTGAAGGGCATTAGACGGGCAACCGCAGAACTGGCTTACCAGTTTCCGC
+TGGGAGAATGGCAACGGCATGTTGACACAACTCAACCGCCAGTTCCCGACCATTAGCCTGTTAGATATTGGCGCGATTTTAAAAACAGGTCGGTCAGGTG
+CTGGAGCAGGTAAGTCGGGCGCTGGAAGTGATGGTGGTACTGGTCACCGCCTGCGGTATGTTGCTGTTGCTGGCACAGGTGCAGGTGGGAATGCGTCAGC
+GTCATCAGGAGCTGGTGGTGTGGCGCACACTCGGTGCGGGAAAAACTGCTGCGTACCACGTTGTGGTGTGAGTTCGCCATGCTTGGGTTTGTTTCCGGCC
+TGGTGGCCGCAATTGCGGAAACGGCGCTGGCAGTGTTGCAGGCGAAAGTGTTTGATTTTCCGTGGGAGCCAGACTGGCGATTGTGGATTGTTCTGCCGTG
+CAGCGGAGCGCTGCTGCTGTCGCTTTTCGGCGGCTGGCTGGGTGCGCGACTGGTTAAAGAGTAAAGGCGCTGTTCAGCAGGTTTGCGGGGTGATGAGAGT
+AAATAAGGGCGTTCTGGTTGAATGGAACGCCTTGTTTAAATTAATTCTACAATATGTTTCGTGATGATGATGTTATTGAATTGGTGATTTCTATCTTTCT
+ATTGCTGATATTAATCTGAATCGGTGGAGTTTATTGATTTTAAATATAGCCCTACAAAAATAACTCAGACTAATAAAATCATAAATCATATGCGTTGAAT
+GGATATTATCCATATAATGAATTTGTTGATGATGAATTCATCTGTGTGCTAAATGTTAGTTTAATAAAATATTGAAAGTGACCTGTAATAACAGTTGTTG
+TTGATTGAGAACAAATAAGTTTATGTGAAAAATATATAAATACATTAGCTGGTCTTGTGTGTCATTTTATTTTTTGTTGCTAACAGGGATATGAACAATA
+ACTAAAAGGGCACTTTATGAGCGGAAAACCAGCGGCGCGTCAGGAGATATGACTCAGTATGGCGGTCCCATTGTCCAGGGTTCGGCAGGTGTAAATTGGC
+GCGCCCACCGGCGTGGCGTGCTCGGTGTGTCCGGGCGGGATGACTTCCGGGCAACCCGGTAAATCGCTGCTGAGGGCGAAGGTGCTGCCCGGCGAGACGG
+ACCTTGCGCTGCCGGCCCGCTGCCGTTCATTCTCTCCCGCACCTACAGCAGCTACCGGACGAAGACGCCTGCACCGGTGGGCGTTTTCGGCCCCGGCTGA
+AAGCGCCTTCTGATATCCGCTTACAGCTACGTGATGACGGACTGATACTCAACGACAACGGCGGGCGGAGCATTCACTTTGAGCCGCTGCTGCCGGGAGG
+CGGTGTACAGCCGCAGTGAGTCAATGTGGCTGGTGCGCGGTGGTAAAGCAGCACACAGCCGGACGGCCCATACGCTGGCGCGGCTGTGGGGGCGCTGCCG
+CCGGATATCCCGGTTAAGCCCGCATCTTTACCTGGCGACCAACAGCGCACAGGGGCCGTGGTGGATACTGGGGTGGTCTGAGCGGGTGCCGGGTGCTGAG
+GACGTACTGCCAGCGCCGCTGCCGCCGTACCGGGTGCTTACCGGGATGGCGGACCGCTTCGGACGCTGACGTACCGGCGTGAGGCCGCCGGTGACCTGGC
+GAAATCACCGGCGTGACGGACGGTGCCGGGCGGGAGTTCCGTCTGGTGCTGACCACGCAGGCGCAGCGTGCGGAAGAGGCCACACCTCTTCGCTATCTTC
+TTCTGACAGTTCCGCCCTCTCTCAGCCTCAGCGTTCCCCGACACACTGCCCGGTACCGAATACGGCCCCGACAGGTATCCGCCTTTCGGCGGTGTGGCTG
+ATGCACGACCCGGCATACCCGGAGGCCTGCCCGCTGCGCCACTGGTGCGGTACACGTATACGGAAGCCGGTGAACTGCTGGCGGTATATGACCGCAGCAA
+TACGCAGGTGCGCGCTTTCACGTATGACGCGCAGCACCCGGCCGGATGGTGGCGCACCGTTACGCGGGAAGGCCGGAGATGCGCTACCGCTACGACGATA
+CGGGGCGGGTGGTGGAACAACTGAACCCGGCAGGGTTAAGCTACCGCTATCTTTATGAGCAGGACCGCATCACCGTCACCGACAGCCTGAACCGGCGTGA
+GGTGCTGCATACAGAAAGGCGGGGCCGGGCTGGAAACGGGTGGTGAAAAAGAACTGGCGGACGGCAGCGTCACGCGCAGCAGGTATGACGCGGCAGGAAG
+GCTCACGGCGCAGACGGACGCGGCGGGACGGAGGACAGAGCGGTCTGAATGTGGTGTCCGGCGATATCACGGACATCACCACACCGACGGGCAGGAGACG
+AAATTTTACTATAACGACGAGAACCAGCTGACGGCGGTGGTGTCCCCGGACGGGCTGGAGAGCCGCCGGGAATATGATGAACCGGCAGGCTGGTATCGGA
+GACATCGCGCAGCGGGGAGACAGTACGCTACCGCTACGATGACGCGCACAGTGAGTTACCGGCGACGACAACGGATGCGACGGGCAGCACCGGCAACAGA
+TGACCTGGAGCCGCTACGGGCAGTTGCTGGCGTTCACCGACTGCTCAGGCTACCAGACCCGTTATGAATACGACCGCTTCGGCCAGATGACGGCGGTCCA
+CCGCGAGAGAGCATCAGCCTTTACCGCCGCTATGACAACCGTGGCCGGTTAACCTCGGTGAAGACGCACAGGGCCGTGAAACGCGGTATGAATACAACGC
+CGCAGGCGACCTGACTGCCGTTATCACCCCGGACGGCAACCGGGCGAGACACAGTACGATGCGTGGGGAAAGGCGGTCAGCACCACGCAGGGCGGGCTGA
+CGCGCAGTATGGATTACGATGCTGCCGGACGTGTCATCAGCCTGACCAACGAGAACGGCAGCCACAGCGTCTTCAGTTACGATGCGCTGGACCGGCTGGT
+ACAGCAGGGCGGCTTTGACGGGCGGACGCAACGTTATCATTATGACCTGAGCCGGAAAACTCACACCAGAGTGAGGATGAGGACTTGTCATCCTCTGGTA
+CTACGATGAATCGGACCGTATCACTCACCGCACGGTGAACGGCGAACCGGCAGAGCAGTGGCAGTATGATGGCCACGGCTGGCTGACAGACATCAGCCAC
+CTGAGCGAAGGCCACCGTGTTGCCGTCCACTATGGCTATGACGATAA
+>tig00000017 len=6305 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
+CTGTCTCCCCGCTGCGCGATGTCTCCGATACCAGCCTGCCCGGTTCATCATATTCCGGCGGCTCTCCAGCCCGTCCGGGGACACCACCGCCGTCAGCTGG
+TTCGTCGTTATAGTAAAATTTCGTCTCCCGCCCGTCCGGTGTGGTGATGTCCGTGATATCGCCGGACACCACATTCAGACCATTACTCTGTCCTCCGTCC
+GCCGCGTCCGTCTGCGCCGTGAGCCTTCCTGCCGCGTCATACCCGCTGCGCGTGACGCTGCCGTCCGCCAGTTCTTTTTCACCACCCGTTTCAGCCCGGC
+CCCGCCTTCTGTATGCAGCACCTCACGCCGGTTCAGGCTGTCGGTGACGGTGATGCGGTCCTGCTCATAAAGATAGCGGTAGCTAACCCTGCCGGGTTCA
+GTTGCTCCACCACCGCCCCGTATCGTCGTAGCGGTAGCGCATCTCCGGCCTTCCCGCGTAACGGTGCGCCACCATCCGGCCCGGGTGCTGCGCGTCATAC
+GTGAAAGCGCGCACCTGCGTATTGCTGCGGTCATATACCGCCAGCAGTTCACCGGCTTCCGTATACGTGTACCGCACCAGTGGCGCAGCGGGCAGGCTCT
+CCGGGTATGCCGGGTCGTGCATCAGCCACACCGCCGAAAGGCGGATACCCTGTCGGGGCCGTATTCGGTACCGGGCAGTGTGTCGAGGGAACGCTGAGGC
+TGAGAGAGGGCGGGAACTGTCAGAAGAAGATAGCGAAGAGGTCGGGCCTCTTCCGCACGCTGCGCCTGCGTGGTCAGCACCAGACGGAACTCCGCCCGGC
+ACCGTCCGTCACGCCGGTGATTTCCCCGGCCAGGTCACCGGCGGCCTCACGCCGGTACGTCAGCGTCCGCCCGAAGCGGTCCGCCATCCCGAAAGCACCC
+GGTACGGCGGCAGCGGCGGCGCTGGCAGTACGTCCTCAGCACCCGGCACCCGCTCAGACCACCCCAGTATCCACCACGGCCTGTGCGCTGTTGGTCGCCA
+GGTAAAGATGCGGGCTTAACCGGATATCCGGCGGCAGCGCCCCCACAGCCGCGCCAGCGTATGGCCGTCCGGCTGTGCTGCCTTACCACCGCGCACCAGC
+CACGTGACTCACTGCGGCTGTACACCGCCTCCCCGGCAGCAGCGGCTCAAAGTGAATGCTCCGCCCGCCGTTGTCGTTGAGTATCAGTCCGTCATCACGT
+AGCTGTAAGCGGATATCAGAAGGCGCTTTCCAGCCGGGGCCGAAAACGCCCACCGGTGCAGGCGTCTTCGTCCGGTAGCTGCTGTAGGTGCGGGAGAGAA
+TGAACGGCAGCGGGCCGGGCAGCGCAAGGTCCGTCTCGCCGGGCAGCACCTTCGCCCCCAGCAGCGGATTTACCGGGTTGCCCGAAGTCATCCCGCCCGG
+ACACACCGAGCACGCCACGCCGGTGGGCGCGCCAATTCTTACACCTGCCGAACCCTGGACAATGGGACCGCCATACTGAGTCATATCTCCTGACGCGCCG
+CTGGTTTTCCGCTCATATAAAGTGCCCTTTTAGTTATTGTTCATATCCTGTGTTAGCAACAAAAAATAAAATGACACACAAGACCAGCTAATGTATTTAT
+ATCTTTTCATAAACTTATTTGTTCTCAATCAACAACAACTGTTATTACAGGTCACTTTCAATATTTTATTAAACTAACATTTTTAGCACAGATGAATTCA
+TCATCAGCAAATTCACTATATGGATAATATCCATTCAACGCATATGATTTATGATTTTATTAGTCTGAGTTATTTTTGTAGGGCTATATTTAAAATCAAT
+AAACTCCACCGATTCAGATTAATATCAGCAATAGAAGATAGAAATCACCAATTCAATAACATCATCAATGAAGACATATTGTAGAATTAATTTAAACAAG
+GCGTTCCATTCAACCAGAACGCCCCTTATTTACTCTCATCACCCGCAAACTGCCTGAACAGCGCCTTACCCTTAACCAGTCGCGCACCCAGCCAGCCGCC
+GAAAGCGACAGCAGCAGCGCCTCCGCTGCACGGCAGAACAATCCACAATCGCCAGTCTGGCTCCACGGAAAATCAAACACTTTCGCCTGCAACACTGCCA
+GCGCCGTTTCCGCACCAATTGCGGCCACCAGGCCGGAAACAAACCCAAGCATGGCGAACTCACACCACAACGTGGTACGCAGCAGTTTTTCCCGCACCGA
+GTGTGCGCCACACCACCAGCTCCTGATGACGCTGACGCATTCCCACCTGCACCTGTGCCAGCAACAGCAACATACCGCAGGCGGTGACCAGTACCACCAT
+CACTTCCAGCGCCCGACTTACCTGCTCCAGCACCTGACCGACCTGTTTTAAAAATCGCGCCAATATCTAACAGGCTAATGGTCGGGAACTGGCGGTTGAG
+TTGTGTCAACATGCCGTTGCCATTCTCAGCGGAAACTGGTAAGCCAGCTCTGCGGTTGCCCGTCTAATGCCCCTTCAGGGAAAATAAAATAGAAATTAGG
+CCGCAGACTTTCCCAGTCCACTTTGCGCAGGCTGGTCACTTTAGCGCGGAACTCCTGGGTATCGCCCATAAAAGTCACGGTATCACCGAGGGCAACGTTT
+GCGTTTCGCCAGCCCTCTTCCATCGACACTTCATCGGCTTTTGGCGGCCAGTTACCGGCGACAATCGGATTATGATCGGGCCGCGTATTTTGCCAGGTAA
+GATTGAGTTCGCGGTTAAGCGCCTCATCTTCATTACCTTCTGTCGGCTTATCGTTAATCGCCGTCAGCCGCGCCGCACCACCGGATAAAACGATTCCGGG
+ACTATCTGATGTTCCGCGAGGAACGCTTTAGCGGTGCTACCTGTTCTGTGGCGATGTTAATTAAAAAGTAGTTCGGGCTTTCTGGAGGTAGCTGCTGCTG
+CCGCAGCGGTCGAGCAGATCGCCACGCAACACCAGCAGCAGTGCCAGCAGCATAAAGGAGAGCGAAAATGCCGAAAGCTGACTTAACGTTGACCACGGCT
+GACGTAACAGGCGGCTAACCGCCAGGCGCAGAGGCAGCGATTTCAGCGTCATGCGGCGAAGTACATTCAGCAGCATCCAGCCCAGCACACCGCACAGCAA
+AGCCAGTACTACCGCGCCCGCCAGCACCGCCCAAAGCAGCATGCTGCCACCCATTAATCCGGCGAGCAGCAGCACAACCACCACACTGACAATCGGCAGA
+TAAAACTTCAGCGGCCAGACGTTCGCTACCACATCATTACGTAATACGCGTAAGGCTGCGTTGCCAGCAAGCAAGCGATATGGTCGTAGCCCCACCAGCA
+GCGAGATGACCGTCATGGTGCCAAGCGCCCACGCCACGGCCAGAGGCTGGCTGGCGGTAGTGCAACAGGCAGAACGGGCTTGAGCAGCACCATCAACACG
+TTTTCGAACAACAGGCCTATGGCCCCACCGGTAACGGCTGAAAGCGTCAGCACCATCAACCACTGACCGACGATTAGCTTACGCAGTTGCGCTCGCCCTG
+CCCCCAGCGTTTTGAGGATCGCCACCAGATCGTAGCGACTGCGACAGTAATGATTCATCGCTACCGCCACCGCTGCCACTGCCAGCAGCAAGGTCAGAAG
+CGCCAGCAGCAGGAACTGTTGCGAGCGTTCCATCGATCGCCCCAGCGCGCCTTCGTCCTGTTCCAGACCGTACCAGCGTTGTTCGGGTTTAAGCTGGGGT
+AACAACCATTTCTCATAGCCGTCGAGCTGGTTCTCGTTGCCGCCGAATTTATAACGCCAGGTGACCCGACTCCCCGGCTGCTGGCTCCGGTTTTATCGAC
+ATCCGCCAGATTCATCATCAGACGCGGAGCCATCTGGAAGGGTTAAAACCGGAATCCGGTTCCTGAATCACTTCTCCGGCAATCCGCAAGGTGGCATCGC
+CCACGTCAATGGTGTCGCCCGTTTTCAGGTTAAGCAGTGCCATCAGGCGTGGGGCCAGCAATACGCTGCCCGCCTGCGGTTTCAGGCCAGGGGATTAGTT
+TGCAGATCGCCATACATCGGGTAGATATCATCCACCGCTTTGACGTTCGCCAGCTGCGGTGTGTCGCCTGCAAAGGTCATTGTGGCGAAAGTCAGCTGCT
+GCCGACTTTCAGGCCGCGCTTTGCGCTTCCTCCAGCCACGCTTGCGGCACTTCGCGTGAACTGCGCAACGCCCGATCGCCCGCCATAAACTCACGGCTTT
+GCTGGCTTAAGCCCTTCTCCATGCGATCGCTGATATTGCCCAGCGCCAGCACGCAGGCCACCGCCAGGCTTAGCGCCAGCCAGACAATTAATAGCGACGG
+CGAACGCCATTCGCGCCAGAACCAACGTGCAATCATGCTTCCTCCTGCAACTGCCCGTTCACCAGCCGTAAAGCAGCGGTCGCAGCGTGCCGCCAGTTGC
+AGGGTCGTGGGTCACCATAATCAACGTGGTGCCATGTTCACGGTTGAGGAAAACAGCAGGTCGGCAATTTTATCGCCCGTCTGGCGGTCAAGGTTGCCGT
+GGGTTCGTCGGCAAACAGCATCAGGTCGACCATTAAAGGCTCGTGCCAGCGCTTCCTCGTTGCTGTTCACCGCCGGAAAGCTGTGCCGGAAGATGATCAG
+ACGTTTACCCAGCCCTAACTGTTCGAGCAACGCTTTCGCCCCGTTACGACTTTCCGCGCTTTCTCACCGCGCAGCAGGGCGGAAGCTCGACGTTTTCCAG
+CGCGTTAAGGTAGGAATTAACATAAATGACTGAAAAACAAAGCCGACGTGCTTCGCGCGCAACTTTGCCCGCGCTTCGTCCATATTATGTGGCGGTTGTC
+CCACCAGACTCACTTCGCCACTGCTGCCGTCATCAAGCCCGGCGAGGATCGCCAGCAAGGTTGACTTACCCGATCCCGACTCGCCCACCAGTGCGATGGT
+CTCGCCGTTTGACAACCAGCTCAACTCCGGTGAGGATGGAGAGTTCATGCTCCCTGACCGACGGACTTCTTAAGATGATGAACCAACAATGTTTTCCGCT
+GGCATTTGCCCTTCCTGTTCCTGGTCCCATTAACCTTCCGTGCCGCCGCAGCGGCACGTTATTGATTCTGGGTGATAGCCTGAGCGCCGGGTATCGAATG
+TCTGCCAGCGCGGCCTGGCCTGCCTTGTTGAATGATAAGTGGCAGAGTAAAGACGTCGGTAGTTAATGCCAGCATCAGCGGCGACACCTCGCAACAAGGA
+CTGGCGCGCCTTCCGGCTCTGCTGAAACAGCATCAGCCGCGTTGGGTGCTGGTTGAACTAATGGGCAATGACGGTTTGCGTGGTTTTCAGCCACAGCAAA
+CCGAGCAAACGCTGCGCCAGATTTTGCAGGATGTCAAAGCCGCCAACGCTGAACCATTGTTAATGCAAATACGTCTGCCTGCAAACTATGGTCGCCGTTA
+TAATGAAGCCTTTAGCGCCATTTACCCCAAACTCGCCAAAGAGTTTGATGTTCCGCTGCTGCCCATTTTTATGGAAGAGGTCTACCTCAAGCCACAATGG
+ATGCAGGATGACGGTATTCATCCCAACCGCGACGCCCAGCCGTTTATTGCCGACTGGATGGCGAAGCAGTTGCAGCCTTTAGTAAATCATGACTCATAAA
+GCAACGGAGATCCTGACAGGTAAAGTTATGCAAAAATCGGTCTTAATTACCGGATGTTCCAGTGGAATTGGCCTGGAAAGCGCGCTCGAATTAAAACGCC
+AGGGTTTTCATGTGTGCTGGCAGGTTGCCGGAAACCGGATGATGTTGAGCGCGCGAACAGCATGGGATTTACCGGCGTGATCGATCTGGATTCACCAGAA
+AGTGTTGATCGCGCAGCCGACGAGGTGATCGCCCTGACCGATAGTGTCTGTATGGGATCTTTAACAATGCCGGATTCGGCATGTATGGCCCTTTCCACCA
+TCAGCCGTGCGCAGATGGAACAGCAGTTTCCGCCAACTTTTCGGCGCACACCAGCTCACCATGCGCCTGTTACCCGCGATGTTACCGCACGGTGAAGGGC
+GTATTGTGATGACATCATCGGTGATGGGATTAATCTCCCGCCGGGTCGTGGCGCTTACGCGGCCAGTAAATATGCGCTGGAGGCGTGGTCAGATGCACTG
+CGCATGGAGCTGCGCCACAGCGGAATTAAAGTCAGCCTGATCGAACCCGGTCCCATTCGTACTCGCTTCACCGACAACGTCAACCAGACGCAAAGTGATA
+AACCAGTCGAAAATCCAGCATCGCCGCCCGCTACGTTGGGACCGGAAGCGGTGGTGGACAAAGTACGCCATGCTTTTATTAGCGAAGCCGAAGATGCGCT
+ATCCG
+>tig00000018 len=4534 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
+ACGTCGTTATAGTAAAATTTCGTCTCCCGCCCGTCCGGTGTGGTGATGTCCGTGATATCGCCGGACACCACATTCAGACCATTACTCTGTCCTCCGTCCG
+CCGCGTCCGTCTGCGCCGTGAGCCTTCCTGCCGCGTCATACCCGCTGCGCGTGACGCTGCCGTCCGCCAGTTCTTTTTCACCACCCGTTTCAGCCCGGCC
+CCGCCTTCTGTATGCAGCACCTCACGCCGGTTCAGGCTGTCGGTGACGGTGATGCGGTCCTGCTCATAAAGATAGCGGTAGCTAACCCTGCCGGGTTCAG
+TTGCTCCACCACCCGCCCCGTATCGTCGTAGCGGTAGCGCATCTCCGGCCTTCCCGCGTAACGGTGCGCCACCATCCGGCCCGGGTGCTGCGTCATACGT
+GAAAGCGCGCACCTGCGTATTGCTGCGGTCATATACCGCCAGCAGTTCACCGGCTTCCGTATACGTGTACCGCACCAGTGGCGCAGCGGGCAGGCTCTCC
+GGGTATGCCGGGTCGTGCATCAGCCACACCGCCGAAAGGCGGATACCCTGTCGGGGCCGTATTCGGTACCGGGCAGTGTGTCGGGGAACGCTGAGGCTGA
+GAGAGGGCGGGAACTGTCAGAAGAAGATAGCGAAGTCGGGCCTCTTCCGCGCTGCGCCTGCGTGGTCAGCACCAGACGGAACTCCCGCCCGGCACCGTCC
+GTCACGCCGGTGATTTCCCCGCCAGGTCACCGGCGGCCTCACGCCGGTACGTCAGCGTCCGCCCGAAGCGGTCCGCCATCCCGGTAAGCACCCGGTACAG
+CGGCAGCGGCGCTGGCAGTACGTCCTCAGCACCCGGCACCCACTCAGACCACCCCAGTATCACCACGGCCTGTGCGCTGTTGGTCGCCAGGTAAAGATGC
+GGGCAACCGGATATCCGGCGGCAGCGCCCCCACAGCCGCGCCAGCGTATGGCCGTCCGGCTGTGCTGCCTTACCACCGCGCACCAGCCATTGACTCACTG
+CGGCTGTACCGCCTCCCCGGCAGCAGCGGCTCAAAGTGAATGCTCCGCCCGCCGTTGTCGTTGAGTATCAGTCCGTCATCACGTAGCTGTAAGCGGATAT
+CAGAAGGCGCTTTCAGCCGGGGCCGAAAACGCCCACCGGTGCAGGCGTCTTCGTCCGGTAGCTGCTGTAGGTGCGGGAGAGAATGAACGGCAGCGGGCCG
+GGCAGCGCAAGGTCCGTCTCGCCGGGCAGCACCTTCGCCCCCAGCAGCGGATTTACCGGGTTGCCCGAAGTCATCCCGCCCGGACACACCGAGCACGCCA
+CGCCGGTGGGCGCGCCAATTCTTACACCTGCCGAACCCTGGACAATGGGACCGCCATACTGAGTCATATCTCCCTGACGCGCCGCTGGTTTTCCGCTCAT
+ATAAAGTGCCCTTTTTGGTTATTGTTCATATCCCTGTGTTAGCAACAAAAAATAAAATGACACACAAGACCAGCTAATGTATTTATATATTTTTCACATA
+AGCTTATTTGTTCTCAATCAACAACAACTGTTATTACAGGTCACTTTCAATATTTTATTAAACTAACATTTTTGGCACAGATGAATTCATCATCAGCAAA
+TTCACTATATGGATAATATCCATTCAACGCATATGATTTATGATTTTATTAGTCTGAGTTATTTTTGTAGGGCTATATTTAAAATCAATAAACTCCACCG
+ATTCAGATTAATATCAATAGAAAGATAGAAATCACCAATTCAATAACATCATCAATAAGAACATTGTAGAATTAATTTAAACAAGGCGTTCCATTCAACC
+AGAACGCCCCTATTCTCTCATCACCCCCAAACTGCCTGAACAGCGCCTTACCCTCCAACCAGTCGCGCACCCAGCCAGCCGCCGAAAGCGACAGCAGCAG
+CGCTCCGCTGCACGGCAGAACAATCCACAATCGCCAGTCTGGCTCCCACGGAAAATCAAACACTTTCGCCTGCAACACTGCCAGCGCCGTTTCCGCACCA
+ATTGCGGCCACCAGGCCGGAAACAAACCCAAGCATGGCGAACTCACACCACAACGTGGTACGCAGCAGTTTTTCCCGCACCGAGTGTGCGCCACACCACC
+AGCTCCTGATGACGCTGACGCATTCCCACCTGCACCTGTGCCAGCAACAGCAACATACCGCAGGCGGTGACCAGTACCACCATCACTTCCAGCGCCCGAC
+TTACCTGCTCCAGCACCTGACCGACCTGTTTTAAAATCGCGCCAATATCTAACAGGCTAATGGTCGGGAACTGGCGGTTGAGTTGTGTCAACATGCCGTT
+GCCATTCTCCCAGCGGAAACTGGTAAGCCAGCTCTGCGGTTGCCCGTCTAATGCCCCTTCAGGGAAAATAAAATAGAAATTAGGCCGCAGACTTTCCCAG
+TCCACTTTGCGCAGGCTGGTCACTTTAGCGCGGAACTCCTGGGTATCGCCCATAAAAGTCACGGTATCACCGAGGGCAACGTTTGGCGTTTCGCCAGCCC
+TCTTCCATCGACACTTCATCGGCTTTTGGCGGCCAGTTACCGGCGACAATCGGATTATGATCGGGCCGCGTATTTTGCCAGGTAAGATTGAGTTCGCGGT
+TAAGCGCCTCATCTTCATTACCTTCTGTCGGCTTATCGTTAATCGCCGTCAGCCGCGCCGCACCACCGGATAAAACGATTCCGGGACTATCTGATGTTCC
+GCGAGGAACGCTTTTAGCGGTGCTACCTGTTCTGTGGCGATGTTAATTAAAAAGTAGTTCGGGCTTTCTGGAGGTAGCTGCTGCTGCCAGCGGTCGAGCA
+GATCGCCACGCAACACCAGCAGCAGTGCCAGCAGCATAAAGGAGCGAAAATGCCGAAAGCTGACTTAACGTTGACCACGGCTGACGTAACAGGCGGCTAA
+CCGCCAGGCGCAGAGGCAGCGATTTCAGCGTCATGCGGCGAAGTACATTCAGCAGCATCCAGCCCAGCACACCGCACAGCAAAGCCAGTACTACCGCGCC
+CAGCACCGCCCAAAGCAGCATGCTGCCACCCATTAATCCGGCGAGCAGCAGCACAACCACCACACTGACAATCGGCAGATAAAACTTCAGCGGCCAGACG
+TTCGCTACCACATCATTACGTAATACGCGTAAGGCTGCGTTGCCAGCAACAAGCGATATGGTCGTAGCCCCACCAGCAGCGAGATGACCGTCATGGTGCC
+AAGCGCCCAGCCACGGCCAGAGGCTGGCTGGCGGTAGTGCAACAGGCAGAACGGGCTTGAGCAGCACCATCAACACGTTTTCGAACAACAGGCCTATGGC
+CCCACCGGTAACGGCTGAAAGCGTCAGCACCATCAACCACTGACCGACGATTAGCTTACGCAGTTGCGCCGCCCTGCCCCAGCGTTTTGAGGATCGCCAC
+CAGATCGTAGCGACTGCGACAGTAATGATTCATCGCTACCGCCACCGCTGCCACTGCCAGCAGCAAGGTCAGAAGCGCCAGCAGCAGGAACTGTTGCGAG
+CGTTCCATCGATCGCCCCAGCGCGCCTTCGTCCTGTTCCAGACCGTACCAGCGTTGTTCGGGTTTAAGCTGGGGTAACAACCATTTCTCATAGCCGTCGA
+GCTGGTTCTCGTTGCCCCGAATTTATAACGCCAGGTGACCCGACTCCCCGGCTGCGGCTCCGGTTTTATCGACATCCGCCAGATTCATCATCAGACGCGG
+AGCCATCTGGAAGGGTTAAAACCGGAATCCGGTTCCTGAATCACTTCTCCGGCAATCCGCAAGGTGGCATCGCCCACGTCAATGGTGTCGCCCGTTTTCA
+GGTTAAGCAGTGCCATCAGGCGTGGGGCCAGCAATACGCTGCCCGCCTGCGGTTTCAGGCCAGGGGATTAGTTTGCAGATCGCCATACATCGGGTAGATA
+TCATCCACCGCTTTGACGTTCGCCAGCTGCGGTGTGTCGCCTGCAAAGGTCATTGTGGCGAAAGTCAGCTGCTTGCCGACTTTCAGGCCGCGCTTTGCGC
+TTCCTCCAGCCACGCTTGCGGCACTTCGCGTGAACTGCGCAACGCCCGATCGCCCGCCATAAACTCACGGCTTTGCTGGCTTAAGCCCTTCTCCATGCGA
+TCGCTGATATTGCCCAGCGCCAGCACGCAGGCCACCGCCAGGCTTAGCGCCAGCCAGACAATTAATAGCGACGGCGAACGCCATTCGCGCCAGAACCAAC
+GTGCAATCATGCTTCCTCCTGCAACTGCCCGTTCACCAGCCGTAAAGCAGCGGTCGCAGCGTGCCGCCAGTTGCAGGTCGTGGGTCACCATAATCAACGT
+GGTGCCATGTTCACGGTTGAGGGAAACAGCAGGTCGGCAATTTTATCGCCCGTCTGGCGGTCAAGGTTGCCGGTGGGTTCGTCGGCAAACAGCACATCAG
+GTCGACCATTAAAGGCTCGTGCCAGCGCCTACTCGTTGCTGTTCACCGCCGGAAAGCTGTGCCGGAAGATGATCAGACGTTTACCCAGCCCTAACTGTTC
+GAGCAACGCTTTCGCCCCGTTACGACTTTCCGCT
+>tig00000019 len=2223 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
+CGGTCAGGCGGCCTTATCGTCATAGCCATAGTGGACGGCAACACGGTGGCCTTCGCTCAATTGGCTGATGTCTGTCAGCCAGCCGTAGCCATCATACTGC
+CACTGCTCTGCCGGTTCGCCGTTCACCGTGCGGTGAGTGATACGGTCCGATTCATCGTAGTACCAGAGGATGACAAGTCCTCATCCTCACTCTGTGTGAG
+TTTTCCGGTCAGGTCATAATGATAACGTTGCGTCCGCCCGTCAAAGCCGCCCTGCTGTACCAGCCGGTCCAGCGCATCGTAACTGAAGACGCTGTGGCTG
+CCGTTCTCGTTGGTCAGTTGATGACGTCCGGCAGCATCGTAATCCATACTGCGCGTCAGCCCGCCCTGCGTGGTGCTGACCGCCTTTCCTACGCATCGTA
+CTGTGTCTCGCTCGGTTGCCGTCCGGGGTGATAACGGCAGTCAGGTCGCCTGCGGCGTTGTATTCATACCGCGTTTCACGGCCCTGTGCGTCTTTCACCG
+AGTTAACCGGCCACGGTTGTCATAGCGGCGGTAAAGGCTGATGCCTTCCTCGCGGTGGACCGCCGTCCTCATCTGGCCGAAGCGGTCGTATTCATAACGG
+GTCTGGTAGCCCGAGCAGTCGGTGAACGCCAGCAACGCTGCCGTAGCGGCTCCAGGTCATCTGCCGGTGCTGCCGTCGCATCCGTTGTCGTCGCCGGTAA
+CTCACTGTGCGCGTCATCGTAGCGGTAGCGTACTGTCTCCCCGCTGCGCGATGTCTCCGATACCAGCCTGCCCGGTTCATCATATTCCGGCGGCTCTCCA
+GCCGTCCGGGGACACCACCGCCGTCAGCTGGTTCCGTCGTTATAGTAAAATTTCGTCTCCCGCCCGTCCGGTGTGGTGATGTCCGTGATATCGCCGGACA
+CCACATTCAGACCGTACTCTGTCCTCCGTCCCGCCGCGTCCGTCTGCGCCGTGAGCCTTCCTGCCGCGTCATACCGCTGCGCGTGACGCTGCCGTCCGCC
+AGTTCTTTTCACCACCCGTTTCAGCCCGGCCCGCCTTCTGTATGCAGCACCTCACGCCGGTTCAGGCTGTCGGTGACGGTGATGCGGTCCTGCTCATAAA
+GATAGCGGTAAGCTAACCCTGCCGGGTTCAGTTGCTCCACCACCCGCCCCGTATCGTCGTAGCGGTAGCGCATCTCCGGCCTTCCCGCGTAACGGTGCGC
+CACCATCCGGCCCGGGTGCTGCGCGTCATACGTGAAAGCGCGCACCTGCGTATTGCTGCGGTCATATACCGCCAGCAGTTCACCGGCTTCCGTATACGTG
+TACCGCACCAGTGGCGCAGCGGGCAGGCTCTCCGGGTATGCCGGGTCGTGCATCAGCCACACCGCCGAAAGGCGGATACCCTGTCGGGGCCGTATTCGGT
+ACCGGGCGGTGTCGGGGAACGCTGAGGCTGAGAGGGCGGGAACTGTCAGAAGAAGATAGCGAAGAGGTGCGGGCCTCTTCCGCACGCTGCGCCTGCGTGG
+TCAGCACCAGACGGAACTCCCGCCCGGCACCGTCCGTCACGCCGGTGATTTCCCGGCCAGGTCACCGGCGGCCTCACGCCGGTACGTCAGCGTCCGCCGA
+AGCGGTCCGCCATCCCGGTAAGCACCCGAATGCGGCAGCAGCGGCGCTGGCAGTACGTCCTCAGCACCCGGCACCCGCTCAGACCACCCCGGTATCACCA
+CGGCCCTGTGCGCTGTTGGTCGCCAGGTAAAGATGCGGGCTTAACCGGATATCCGGCGGCAGCGCCCCACAGCCGCGCCATATGGCCGTCCGGCTGTGCT
+GCCTTACCACCGCGCACCAGCCACATTGACTCACTGCGGCTGTACACCGCCTCCCGGCAGCAGCGGCTCAAGTGAATGCTCCGCCCGCCGTTGTCGTTGA
+GTATCAGTCCGTCATCACGTAGCTGTGGCGGATATCAGAAGGCGCTTCCAGCCGGGGCCGAAAACGCCCACCGGTGCAGGCGTCTTCGTCCGGTAGCTGC
+TGTAGGTGCGCGGGAGAATGAACGGCAGCGGGCCGGGCAGCGCAAAGTCCGTCTCGCCGGGCAGCACCTTCGCCCCCAGCAGCGGATTTACCGGGTTGCC
+CGAAGTCATCCCGCCCGGACACACCGAGCACGCCACGCCGGTGGGCGCGCCAATTTTACACCTGCCGAACCCTGGACAATGGGACCGCCATACTGAGTCA
+TATCTCTGACGCGCCGCTGGTTT
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/canu_unassembled_result2.fa	Fri Jun 08 04:43:41 2018 -0400
@@ -0,0 +1,48 @@
+>tig00000005 len=254 reads=3 covStat=-1.39 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
+AAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTT
+CGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTCTGATCCTGCCTCATTATATTTATCGA
+GCCCACGAGACTAAGGCGAATCTCGTATGCCGTCTTCTGCTTGCAAAAAAAAAC
+>tig00000006 len=268 reads=3 covStat=-1.39 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
+AAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGA
+TAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATCCTATTATTTATCGCACCTACGTTCAATATTAC
+AGCTGTCTCTTATACACATCTCCGAGCCCACGAGACTAAGGCGAATCTCGTATGCCGTCTTCTGCTTG
+>tig00000008 len=248 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
+CTCCGGGCCCATAACACTTGGGGGTAGCTAAAGTGAACTGTATCCGACATCTGGTTCCTACTTCAGGGTCATAAAACCTAAATAGCCCACACGTTCCCCT
+TAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCG
+ATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCT
+>tig00000009 len=252 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
+AATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGA
+GCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGTTTTATGACCCTGTCTCT
+TATACACATCTCCGAGCCCACGAGACTAAGGCGAATCTCGTATGCCGTCTTC
+>tig00000010 len=250 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
+CTCCGGGCCCATAACACTTGGGGGTAGCTAAAGTGAACTGTATCCGACATCTGGTTCCTACTTCAGGGTCATAAAACCTAAATAGCCCACACGTTCCCCT
+TAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCG
+ATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGT
+>tig00000011 len=251 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
+AAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTC
+CCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGTTTTATGACCCTGAAGCTGTCT
+CTTATACACATCTCCGAGCCCACGAGACTAAGGCGAATCTCGGATGCCGTC
+>tig00000012 len=251 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
+ATTCAATTGTTATTATTATGTCCTACAAGCATTAATTAATTAACACACTTTAGTAAGTATGTTCGCCTGTAATATTGAACGTAGGTGCGATAAATAATAG
+GATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAA
+ATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCC
+>tig00000013 len=251 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
+GTATCCGACATCTGGTTCCTACTTCAGGGTCATAAAACCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCT
+ATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTC
+GCAGTATCTGTCTTCTGTCTCTTATACACATCTCCGAGCCCACGAGACTAA
+>tig00000014 len=254 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
+AATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGA
+GCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGTTTTATGACCCTGATACA
+CATCTCCGAGCCCACGAGACTAAGGCGAATCTCGTATGCCGTCTTCTGCTTGAA
+>tig00000015 len=247 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
+GGGTCATAAAACCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCAT
+GCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGTCT
+CTTATACACATCTCCGAGCCCACGAGACTAAGGCGAATCTCGTATGC
+>tig00000016 len=249 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
+ATTCAATTGTTATTATTATGTCCTACAAGCATTAATTAATTAACACACTTTAGTAAGTATGTTCGCCTGTAATATTGAACGTAGGTGCGATAAATAATAG
+GATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAA
+ATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGAT
+>tig00000017 len=261 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
+GTATCCGACATCTGGTTCCTACTTCAGGGTCATAAAACCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCT
+ATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTC
+GCAGTATCTGTATACACATCTCCGAGCCCACGAGACTAAGGCGAATCTCGTATGCCGTCTT
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/canu_unitigs_result1.fa	Fri Jun 08 04:43:41 2018 -0400
@@ -0,0 +1,155 @@
+>tig00000001 len=15307 reads=47 covStat=1.00 gappedBases=no class=contig suggestRepeat=no suggestCircular=no
+AAAATAGTCAATAGTAGGATGCCTGACAATTTATGCTCTACTTTCCAGGCTTATCTGTAATCGGGAATAATAGAAATATGTTCCATCAATTTTTAAGTTC
+CATTTGTTCACCTTATTTATGTAAGGAGTATTTGATCATGTATAAGCTATGAAAAACAGCTTTAGGTAATAAGAATATCTCAATTTTTAAACATAAAATG
+CGAATTATTTAGTACAAAAAGGCGTTACGTGATCTTTCCTGGGATACAACTCTGGCAATGGTATCGTGAACAGGAATACCATTTTCAAAATCACCATATT
+GCTTCAAAAAATCGAGATGTGTTTCCCCGAAATCCTCTATATCTTCCCAACCTTCTGCACCAGAAATAACGGCACAAATAGTCAAACAGTAGAATATCTG
+ACAATTTATGCACCACTTTCAGGCTTGTCTGTAATCGGGTGTAATAGAAATATGTTCCATCAATTTTTTAAGTTCCATTTGTTCACCTTATTTATGTAAG
+GGTATTTGATCATGTATAAGCTATGAAAAAACAGCTTTAGACAATAAGTAGTATCTCAATTGTTGAACTTAAATTCGAATTATTTAGTACAAAAAGTAGC
+GTTACGTGATCTTTCCTGCAAATGGAACGCAAAATAAACACCTATTCCATGAGTTATATAATTTTTCACAATGATTAATTTGTTTTCTCAGGAAGAGATT
+TTATTTCTCTTCACTACGAATTAGTTCATGCTGTATCTTTATTAAACATTCGTAAGACTCATTTTTGTTCGGGAGATGTGCTGTCATTCGAGCATAAGTT
+GGTTTCTCATCTTTAAAATATTTTACCATGATTGAATTATCAAGGACTGCCAACAACTGAACTGGATCACTGCTCTTTTGATAGATACCCGCTCTTATAT
+AACTTCTAAACCGATCGCCGAGAAACGCCGTTTTTCTGCTGTATTTATCAACTCCTGCAACGTTCCTTTGATGGCATGATTTTCATTAAGGCGTAGTGAC
+CCGACGCGAATTAAGAGTCTCGCCCCGCTTGGTGTGAATTTATTATTTTTACATGTACCCAGTTCTGTTTGCCAATAATACTCACCGATGTCCTCATTCT
+GATACCATCTCACATGGCTTTATTATTTAAGACAGGAAACGCGGAAAAATAGTACCCTTAGCGAAAATAGTAAAACAATCATGATCTTTAGCTTGTATTT
+CGCAATCAGCTATAACACCAAAACTAACAAATATCATCAGCAAAAAGAACAAAACTCTTTTCATTTTCTTATTCCTCTCGATGTTCTCTGTTTCATCTTA
+GCTAAAATTTCACCCAAATCATCTATCCCTGCTGTTGCTGGCCCATCGGGTTTATTAATGTCTGGGAATAAATAGGGTTCTGCACAAGTATATCCTGGTG
+GTAATTGAGTTGTTGGCCAATTTGTCTGTGGCAGGTAATCACTTGCTGTCTTTGTATCCATCCCTGGATACTGGGAATCATCCTGTGGCGTACAAGTCAG
+ATTTGGTTTTACCCACTTCCTGCAATACAGTGTGTAGTCGTAGGGCTTAATGCTCTGAAGAATGTTTTGAAAACATTAGGCGCACTACTGGCCTGGTCAA
+TAGGATATGGCAGTCTTAATTGTTTCGCTATGTCCGGCAATTTACTTGGATCGGGCGTAGGCGGTTTGTTGGTCTCGCTCCATATCCGCCATTATTTAAG
+TGTCCATATTTTGATGCCAGTCCCATTGAATCTATATACTGAACCGGATTCAGCGGATACTGATAAAATTCCATCCCCCTTCAGCCCAATCGGATCCTGA
+GTGATATACCTCCCTGCAGCGGGTCATAATAGCGGTGGCGGTTGTAATACAGGCCGGACTCCTCATCATACTGCTGCCCCGGCAGGCGGATAAGCTGCTG
+CAGCTGATGCGGGTTCTCTTCATTCAGCAGGTTGCCCCATTCATCGTATTCTGCGCACCATTCTGTTGCCCCTTCCGTGCTGACAAGCGCCAGCGGCAGG
+CCGCGATGGTCGCAGTGGTACAGGTGGATTTTCGCGCCGGCGTGTACACCGGGTCCATCTGGTTTTGCATCTGCTCCACCGTCAGGCCGCACGATGCCAG
+CCAGCGGCGGCTTTCCTCACTCACCCGGTCAGCCAGGATTTCACTTTCCAGCCGGTCGAGCATCTGCACCAGCACCGGCGGAACACCACACTGCCACCGT
+CTTCGCCGCCGGACTGCTGAAGGGTATCCGCCAGGCTGCGGCGCTGCGTTCGCCAGCTCACCGGTGGCGGTTTCAACCTGATGAGTGGCGTGAAGCTCCC
+CGGCTGATAAATCGTCTGGATGCGGGTTCTGTCGTTCTGTATCGTGGTCAGGCGGTCGCCGTCCCAGCCGTACCAGGTCACTTGCGGTTTCCGTGACAGC
+GACATCCAGCCCGTCAGGTCCCGTTCACGTCGCCACACCCGTTTTGCCACCCTGCGGCCCAGCGGGTCGTAAAGATAGCGGCTTTCGACCAGCGGCTCTG
+CATATTGTGTCCGCGTGTAGTGCACCAGCCGGTGCTGACTGTCGTAATGGTACCGGTGGGTGCGCTCATCATCCGTGCGGATAACCCTTCCGGGATGAGG
+TCGGTTTTCTCCGTCAGCCTGCCGTGACGGTCATACCGGTAAAGATAGTGCGCGTCACGGGCGATACGGTTATCCGGCCACATGCTGAGGGTGCTGTCCG
+GTGCAGCTCCGGTCGGGCAGGCGGTTACCTGCCGGGTCTGTGGCATACGGGATATCAATGCCCAGGTTACATATAATAATAAGAGCAATTAACTTAATTT
+ATTTGTTTATAATGCGCTTACTTAATACAAACCATTGAATATACCCTCCTGACAGAAAATAAAGCCATATTATTATCGCCATAATATACTTACTATCAAT
+CCTTACGCCAATAATGTCTGATACAGTCCCTATAAATATTAGAGCAATAAAGAATACTATGCCTGTTGGAAAACATATTACCATCATTCCATAAGACATG
+AGACTAATTAACTCGCTCACATCACGAGTGGAGTCTAATAGTGAAAGTCTATGCATGGAAAAGAATAGTATTAAAAGCGATAAAGCCAGCCATATAGCTC
+TGAATAAAAAATAATATATTTCATTACATCACTCCGGTGAATACAAATCTAATAAAACGTCCAATGTTATTTCCGGAGCACTTCATCTTACATGTTTCTA
+AAGAATCATTAGACCAGTCTTGGCAGTTTTAAATAGCCCTAAATTTATAGGTGTGAATATATCAGGCAATACAGAATAACGCGGCCTTACCTCTTTAAAC
+TTCCTTTTAAACAGTTCTCCACACAACTATTATCGGTTTCAACGAGGTCACAACGGCCAGCAGCTTCTTTGTATCATTACTTGCTTTACCTGGCCCCCAT
+AGACCATCTCCTTTGATTCTCCCCGTTGGTCTTGGCCACCACAAGTATAGTCCCTTTACCATCTGGGACACAAAGATATTGATGATAGAACGGATTCCCC
+ATATATCTGGACCGCTTCTTTCACCAGTTCCGCCCATTGAATGCAGTGGCTTAATGCATTTTAGTGTTTCTAATCCTAATGGATCTATATTTGAGATCGG
+ATTCAACGGATACTGATAAAATTCCATCCCCTTTCAGCCCAATCGGATCCTGAGTGATATATCGCCCCTGCAGCGGGTCATAATAGCGGTGGCGGTTGTA
+ATACAGGCCGGACTCCTCATCATACTGCTGCCCCGGCAGGCGGATAAGCTGCTGCAGCTGATGCGGGTTCTCTTCATTCAGCAGGTTACCCCATTCATCG
+TATTCTGCGTACCACGCTGTTGTCCCTTCCGTGCTGATATGGGCCAGCGGCAGGCCGCGATGGTCGCAGTGGTACAGGTGAATTTTTCGCGCCGGCGTGT
+ATACCGGGTCCATCTGGCTTTGCATCTGCGCCACCGTCAGGCCGCACGATGCCAGCCAGCGGCGGCTTTCCTCACTCACCCGGTCAGCCAGGATTTCACT
+TTCCAGCCGGTCGAGCATCTGCACCAGCACCGGCGGGAACACCACACTGCCACCGTCTTCGCCACCGGACTGCTGAAGGGTATCCGCCAGGCTGCGGCGC
+TGCGTTTTCGCCAGCTCACCGGTGGCGGTTTCAACCCTGATGAGTGGCGTGAAGCTCCCCGGCTGATAAATCGTCTGGATGCGGGTTCTGTCGTTCTGTA
+TCGTGGTCAGGCGGTCGCCGTCCCAGCCGTACCAGGTCACTTGCGGTTTCCGTGACAGCGACATCCAGCCCGTCAGGTCCCGTTCACGCCGCCATACCCG
+TTTTGCCACCCTGCGGCCCAGCGGGTCGTAAAGATAGCGACTTTCGACCAGCGGCTCTGCATATTGTGTCCGCGTGTAGTGCACCAGCCGGTGCTGACTG
+TCGTAATGGTACCGGTGGGTGCGCTCATCATCCGTGCGGATAACCCTTCCGGGATGAGGTCGGTTTTCTGTCAGCCTGCCGTGACGGTCATACCGGTAAA
+GATAGTGCGCGTCACGGGCGATACGGTTATCCGGCCACATGCTGAGGGCGCTGTCCGGGTGCAGCTCCGGTCGGGCAGGCGGTTACCTGCCGGGTCTGTG
+GTATACGGGATGCGGATATCCAGATTCGCTGCGGTGGTGTGAACGCCGGTCAGCCTGCCGGTGGTGCTGTAGCTGTAACTCCGGGTCTGGCGCGGGCTGC
+TGATGCGGATGAGTTCGCCGTTGTCGTTCCAGGTGTAATCGCGGTCAGACAGCAGGCTGTTCAGGTGCTGGCTCTGTAACTGCCCGGCAGGGGTATAAGC
+GGTGGTGAGTTCATAACGGCCGAAGCTGCGCAGCGTTTCCCGGTGCAGGCGGTCGCGGGTGTACTCCACCAGCGGTGTGTCGCCGAGTTTCATGCCTGAC
+AGCCAGCCGCTGCCGTAGGTCAGCCATTCCACGGCGGGCAGGCTGTCCGGTATACAGCGGTTCGCCAGTCCCTGTGCGTTGTACGCATGTCTGGTCTCAT
+GCTGCCAGAGCAGTTCATTCGTCTGCGGATGATGCACCGTCAGGTGTTCACTGGCGAGGCGGCCTTTACTGTCATAACCATAGTGCACCGTCACCCGGTG
+CCCTTCGCTGATATGGCTGATGTCTGTCAGCCAGCCGCGTTCGTCATACTGCCACCGCTCTGCGGTTTCGCCATTCACGGTGCGGTGCGTGAGGCGGTCT
+GCTTCGTCATAGTGCCAGTGGGTGACCAGCCCTCATCCTCGCTGCGGATAAGTTTGCCGGTCAGGTCGTGGTGATAACGCTGTGTGCGGCCGTCAAAGCC
+GGTTTCCTGTATCAGCCGGTCGAGTACATCGTAACGGAAGGTGGTGTGGCTGCCGTTTTCACTGGTCAGGCGGATGACCCGTCCGGCAGCATCGTATTCC
+ATACTGCGCGTCAGACCGCCCTGCGTGGTACAGATGGCTTTTCCCCACGCATCGTACTGTGTCCCGTTTCTGCTGCCGTCCGGGGCAATGACGGTGGTCA
+GGTCACCGGCGGCGTTGTATTCATACCGCGTTTCATGGCCCTGCGTGTCTTTCACGGCAATTAACTGTCCACGGCTGTCGTATGCGCGGTACTGACTCAG
+CCCTTCCTCGCGGTGCACCGCCGTCACCTGACCAAAACGGTCATGGTCATAGCGGGTTACATAACCGGAACAGTCAGTGAAGCTCAGCAACTGACCGTAA
+CGGCTCCACGTCATGGTTTTCCGGCTGCCGGTGGCATCTTCCGTTGCGCAGGGTAAGTCACTGTGTGGATTATCATAACGGTAGCGGGTGATATCGCCGT
+CAGGGGCAGTTTCCTGAATCAGACGGCCCCATTCATCATATTCCCGGCGTATTTCCAGCCCGTCAGGCCCGGTGGCTGACGTTAACTGGCTGTGGTGGTT
+ATAGTAAAACGCCGATGCCCTGCCATCCGGCGTGGTGATGCGCGTGATGAGGCCCGTCACCACATCCGGACTGTATTCTGTTGTCCTGCCTGCGGCATCC
+GTCTGTGCCCTGAGCCTGCCCACCGCGTCAAACTGACTCTGCGTGACGCTGCCGTCCGCGTGTTCCTTTTCACCACCCGCTTCAGCCCGCCTTCACCCTG
+CGTGTGCAGGACTTCACGGCGGTTCAGGCTGTCGGTGATGGTGATGCGGTCCTTCTCATACTGATACGTGTAACTTAAGCCTGCCGGGTTTAGCTGTTCT
+GTCACCCGCCCGTCGCTGTCGTAACGGTAACAGATTTCCGGTCGGCCCGTGTGACGGTGCGCCACCATCCGGCCCCGGTATTTATCATCGTAAGTAAAGC
+TGCGCACCTGTGTATTGCTGCGGTCATACACCGCCGCCAGTTCGCCGCGGGCGTCCAGCCATAGCGCACCAGCGGCGCGGCAGGTAAATTCTCCGGGTAT
+TCCGGGTCGTGCGTCAGCCACACGGCAGACAGACGGATGCCGTTGTCCCGGCCATATTCGGTGTAACCCGGCAGGGTATCAGGAAAAGCGGACGGTTCCG
+TCCCGCCGGAAATGGCCTGCTGCCGGGCTTCTTCTGCCCGCTGCGCCTGCGTGGTCAGTACCAGCCGGAAGTGACGCCCGGCACCATCCGTCACGCCGGT
+GATTTCGCCGCTGAATTCACCGGCGGCTTCGCGGTGGAACGTCTGTGTGCGCCCGAAGCGGTCCACCAGCCCGGTCAGTACCCGGTACGGCGGCAGCGGC
+GCAGGCAGCACCTCATCCGCTTCCGGCACCCGCTCACACCAGCCGAGCAGCCACCACGGCCCCTGCGGACTGTTTGTCGCCAGATAACGATGCGGACTTA
+AGCGGAGTTCTTCCGGCAGCGCCTGCCAGAGTGCGGCCAGCCGGTGACCTTCATCCAGTTTCGCCACGCCGCCGCGCACCAGCCACAGTGACTCGCTGCG
+GCTGTAACCGTCCTCACCGGGAAACAGGTGCTCAAAATACAGGCTTCTGCCGCCGTTATCACTGAGTATCAGTGTGTTATCGCGCAGCTGTAAGCGGATA
+TCCGCAGGCATTTTCCAGCCGGGGCCGAGGCTCCCCACCGGCGCGGGCGTTTTGTCCGGTAACTGCTGTAGGTGCGGGAGAGAATGAACGGCAGCGGGCC
+GGGCAGGGCGATGTCGGTTTCACCGGGAAGGACCTTTGCACCGAGCAGCGGATTGACCGGATGGCCGGACGTCACCCGCCGGGGCACACCGAACAGGCCA
+CGCCGGTGGGGCACCGATGCGTACCCCGGCTGAACCCTGGACAATGCTACCGCCATACTGCGTCATGTCGCCCTGACGCGCCGCCGGTTTTCCGCTCATC
+TGCTCATCCTTGTTTTATCGGGTTATTTGTCTGCTGACAGGCGAAACCCTACAGATTTATAAGAAAGCCTTAAGTGAGATATCTGTCAGATAAGAACAAT
+TAGGAAAATATTTATATATATTTCATGAATATATGTTTCGATTGGTATAACGATGTCTAAATATTCCTCTGAACATCTTCCTGATACAAAAACCGCCAGC
+GTTTCCGCTGGCGGTTTTCAATGTATTCAAAACTCAGCAATCAATAAAATCACCAGTTGCCTTTTCGGCCTGATCCATCCACACCGGTTTATCGCTGGTT
+TTCGACCAGACGCGATGCAGGTAGCTGTAAAAGCGGGCGCGGTCTTTCCAGAAAAGCATGAAAGGCAGCGCCAGAACGCCCGCTGCAACCGCATAAGTAC
+GGCGTAAAAAGATAAGCCATGCAGGATATTCTCTGTAGAGTTCCATACTTTTCTCCCCTTTTGTATCTACCCGGTGAATGGCACCGGAAAAATGAATTTG
+TTTATCTGATGAAAATAGTACCGCCTTTGTGTAATTTTACTACTCATCCGACCACTTATTTTTGCTTATTGATGGTTTATTTACATTCATCCTGTAATTA
+AGTTACACAAAAGTTAAATTAATACTAAACATTAGTTAAATCATGGCTTTTGCCATTTTTATACTTTTACACCCCGCCCGCAGATTTTTGCGAAATCTTT
+GCAGCCAGAATTCTACCCTTCCGGTATCACTTTTAGGCCACTGGAGGTGCACTGTGAGTGCAGGCGTGATAACCGGCGTATTGCTGGTGTTTTATTACTG
+GGTTATCTGGTTTATGCCCTGATCAATGCGGAGGCGTTCTGATGGCTGCGCAAGGGTTCTTACTGATCGCCACGTTTTTACTGGTGTTAATGGTGCTGGC
+GCGTCCTTTAGGCAGCGGGCTGGCGCGGCTGATTAATGACATTCCTCTTCCCGGTACAACGGGCGTTGAGCGCGTACTTTTCGCGCACTTGGCGTCTCTG
+ACCGTGAGATGAACTGGAAGCAATATCTTTGTGCCATTCTCGGCCTGAACATGCTGGGGCTGGCGGTGCTGTTTTTATGTTGCTCGGTCAGCACTATCTG
+CCGCTTAATCCACAGCAGTTGCCAGGGCTGTCGTGGGATCTGGCGCTGAATACCGCCGTCAGCTTTGTCACCAATACCAACTGGCAATCTTATAGCGGTG
+AAACCACGTTGAGCTATTTCAGCCAGATGGCGGGCTTAACGGTGCAAAACTTTCTTTCTGCCGCCAGCGGGATTGCGGTGATTTTGCCCTCATCCGTGCG
+TTTACCCGCCAGAGCATGAGCACGCTCGGGAATGCCTGGGTCGATCTGCTACGCATCACGTTATGGGTGCTAGTCCCTGTGGCGTTGTTGATTGCACTGT
+TTTTATTCAACAAGGTGCGCTGCAAAACTTTCTGCCTTATCAGGCTGTGAATACCGTTGAAGGAGCGCAACAGCTGTTACCCATGGGGCCTGTAGCTTCT
+CAGGAAGCGATCAAGATGCTCGGTACTAACGGCGGTGGCTTCTTTAATGCCAACTCGTCGCATCCGTTTGAAAACCCAACCGCACTGACCAACTTCGTGC
+AGATGCTGGCGATCTTCTTGATCCCAACGGCGCTGTGCTTTGCCTTTGGTGAAGTGATGGGCGATCGCCGCCAGGGGCGCATGTTGCTGTGGGCGATGTC
+AGTGATTTTGTCATCTGCGTAGGCGTGGTGATGTGGGCAGAAGTTCAGGGTAATCCTCATCTGCTGGCACTGGGCACGGACAGCAGCATCAATATGGAAG
+GTAAAGAGAGCCGTTTCGGCGTGCTGGTCAGTAGCCTGTTTGCGGTCGTGACGACGGCGGCTTCCTGTGGCGCGGTGATTGCGATGCATGATTCGTTTAC
+CGCTCTCGGTGGCATGGTGCCGATGTGGCTGATGCAAATTGGTGAAGTGGTGTTCGGCGGTGTCGGTTCTGGTCTTTACGGCATGATGCTGTTTGTCCTG
+CTGGCGGTGTTTATTGCCGGGCTGATGATTGGTCGTACACCGGAATATCTGGGTAAAAATCGACGTACGCGAGATGAAACTGACTGCACTGGCAATTCTG
+GTTACCCCGACGCTGGTGCTGATGGGCGCGGCGTTGGCGATGATGACCGACGCCGGACGTAGCGCCATGCTCAACCCTGGCCCGCATGGTTTTAGCGAAG
+TGCTGTACGCCGTGTCATCCGCCGCTAACAACAACGGCAGCGCCTTTGCCGGATTAAGCGCCAACTCTCCGTTCTGGAACTGTTTACTGGCGTTCTGCAT
+GTTTGTCGGTCGCTTCGGGGTGATTATCCCGGTGATGGCAATTGCCGGTTCGCTGGTGAGTAAAAGAGCCAAGCCGCCAGCTCCGGCACGCTGCCAACGC
+ACGGCCCGCTGTTTGTTGGCCTGTTAATCGGCACCGTGTTGCTGGTTGGCGCACTGACCTTTATCCCTGCCCTGGCGCTTGGTCCGGTGGCGGAATATCT
+CTCCTGATGATATTGAGTGAGCACTGAATATGAGTCGTAAACAACTGGCGCTATTCGAACCAACACTTGTCGTTCAGGCGCTGAAAGAAGCGGTGAAAAA
+ATTAAACCCGCAGGCGCAATGGCGCAATCCGGTGATGTTTATCGTCTGGATCGGCAGTCTGCTGACCACCTGTATTAGCATCGCGATGGCAAGCGGTGCG
+ATGCCCGGCAATGCGCTGTTTAGCGCGGCCATTAGCGGTTGGCTGTGGATCACCGTACTGTTCGCTAATTTCGCCGAGGCGCTGGCAGAAGGCCGCAGTA
+AAGCGCAGGCCAACAGTCTGAAAGGGTGAAAAACTGCCTTTGCCCGCAAGCTGCGTGAGCCGAAATATGGCGCTGCGGCGGACAAAGTTCCTGCCGACCA
+ACTTCGTAAAGGCGATATCGTACTGGTAGAAGCTGGCGATATTATCCCCTGCGATGGTGAAGTTATTGAAGGGGTGCATCGGTCGATGAAAGCGCCATCA
+CCGGGGAATCGGCACCGGTGATCCGTGAATCCGGCGGCGATTTTGCCTCCGTCACCGGCGGCACGCGTATTCTTTCTGACTGGCTGGTGATTGAGTGTAG
+CGTTAACCCCGGCGAGACATTTCTGGATCGGATGATCGCGATGGTGGAAGGCGCACAGCGACGCAAAACGCCGAACGAAATTGCCCTGACCATTCTGCTG
+ATTGCCCTGACTATCGTCTTTTACTGGCAACCGCCACGCTGTGGCCGTTTTCCGCGTGGGGCGGTAATGCAGTCAGCGTAACGGTACTGGTGGCGCTGCT
+GGTCTGTCTGATCCCAACCACTATTGGCGGCCTGTTGTCAGCGATCGGCGTCGCCGGGATGAGCCGGATGCTAGGCGCGAATGTGATTGCCACCAGCGGA
+CGTGCAGTTGAAGCGGCAGGTGACGTTGACGTTCTGCTACTGGATAAAACCGGCACCATCACACTCGGTAACCGTCAGGCGTCGGAGTTTATCCCCGCGC
+AGGGCGTGGATGAAAAACGCTGGCTGACGCCGCACAACTGGCTTCGCTGGCTGATGAAACGCCGGAAGGCCGCAGTATTGTGATCCTCGCCAAGCAGCGT
+TTTAACCTGCGCGAGCGCGATGTGCAGTCGCTCCATGCCACCTTTGTACCGTTTACTGCGCAAAGCCGGATGAGCGGGATCAACATCGACAACCGCATGA
+TCCGTAAAGGTTCTGTCGATGCCATTCGTCGCCATGTTGAGGCTAACGGTGGTCACTTCCCTACCGATGTTGATCAAAAGTCGATCAGGTTGCGCGTCAG
+GGAGCCACGCCGCTGGTGGTGGTGGAAGGTTCTCGTGTGCTGGGCGTTATTGCGCTGAAAGATATCGTCAAAGGCGGTATTAAAGAGCGCTTCGCCCAGC
+TGCGCAAAATGGGCATTAAAACGGTGATGATTACCGGCGATAACCGTCTGACTGCCGCCGCGATTGCTGCGGAAGCGGGTGTCGATGATTTTCTCGCCGA
+AGCGACACCGGAGGCCAAGCTGGCATTGATCCGTCAGTATCAGGCGGAAGGTCGTTTGGTAGCGATGACCGGCGACGGCACCAACGATGCTCCGGCGCTG
+GCGCAGGCAGATGTCGCGGTGGCGATGAACTCCGGCACCCAGGCGGCGAAAGAGGCGGGCAATATGGTCGATCTCGACTCTAACCCGACCAAGTTGATCG
+AGGTGGTGCACATTGGCAAACAGATGCTGATGACCCGTGGCTCGCTGACCACCTTCAGCATTGCCAACGATGTGGCGAAATACTTCGCCATTATTCCGGC
+GGCATTCGCGGCAACGTATCCGCAGTTAAATGCGCTGAACATCATGTGCCTGCATTCGCCCGACTCCGCAATCCTCAGTGCGGTGATTTTCAACGCCTTG
+ATTATCGTCTTTGATTCCCCTGGCGTTAAAGGCGTGAGTTATAAACCGCTTACCGCTTCTGCCATGTTGCGCCGTAACTTATGGATTTACGGTCTGGGTG
+GGCTGCTGGTGCCGTTTATCGGTATCAAAGTCATTGATTTACTGCTGACCGTTTGCGGTCTGGTGAGGTTTACCATGAGTGGATTACGTCCGGCATTATC
+AACATTTATCTTTCTGTTATTGATTACTGGCGGCGTTTACCCGCTGCTGACCACCGTACTGGGGCAATGGTGGTTTCCTGGCAGGCCAATGGTTCGTTGA
+TTCGTGAAGGTGATACGGTGCGCGGTTCGGCATTAATCGGGCAGAATTTTACCGGCAACGGCTATTTTCATGGTCGCCCGTCGGCAACGGCAGAAATGCC
+CTATAATCCACAGGCTTCTGGCGGGAGCAATCTGGCGGTCAGTAACCCTGAGCTGGATAAACTAATAGCCGCACGCGTTGCTGCATTACGGGCCGCTAAC
+CCGGATGCCAGCGCGAGCGTTCCGGTTGAACTGGTGACGGCATCGGCAAGCGGGCTGGACAATAATATCACCCGCAAGCGGCGGCCTGGCAAATCCCACG
+CGTGGCGAAAGCGCGTAATCTCAGCGTTGAACAGCTCACGCAACTGATCGCAAAATACAGCCAACAACCGCTGGTGAAATATATCGGCCAGCCGGTTGTC
+AACATTGTTGAACTCAATCTGGCGCTGGATAAACTTGATGAATAACGAACCCTTACGTCCCGACCCCGATCGTCTGCTGGAACAAACTGCCGCGCCGCAT
+CGGGGAAGCTGAAAGTTTTCGGTGCCTGTGCAGGCGTCGGGAAGACCTGGGCGATGCTGGCAGAAGCCCAGCGACTGCGGGCGCAAGGGCTGGATATTGT
+GGTTGGCGTGGTAGAAACCCACGGGCGAAAGATACCGCCGCCATGCTGGAAGGGCTGGCTGTTCTGCCGTTAAAACGCCAGGCGTACCGTGGGCGGCATA
+TCAGCGAGTTTGATCTCGATGCCGCCCTCGCCCGCCGCCCGGCGCTGATCTTAATGGACGAACTGGCGCACAGTAATGCGCCAGGTTCCCGTCATCCCAA
+ACGCTGGCAGGATATCGAAGAACTGCTGGAAGCTGGCATTGATGTTTTCACTACCGTCAACGTTCAGCATCTGGAAAGTCTGAATGATGTGGTCAGCGGC
+GTCACCGGAATTCAGGTACGGGAAACCGTGCCCGATCCTTTTCGATGCCGCCGACGACGTGGTGCTGGTGGACTTGCCCCGGACGATCTGCGCCAGCGGC
+TGAAAGAAGGCAAAGTCTATATTGCCGGGCAGGCGGAGCGCGCCATTGAACATTTTTCCGCAAAGGTAATCTGATCGCCCTGCGCGAACTGGCACTGCGC
+CGTACTGCCGATCGCGTTGATGAGCAAATGCGCGCCTGGCGGGGCATCCTGGCGAAGAGAAAGTGGCACACGCGCGACGCGATCCTTTTATGCATCGGCC
+ATAACACCGGCAGCGAAAACTGGTCCGCGCAGCGGCGCGGCTGGCGTCACGGCTGGGTAGCGTCTGGCACGCGGTGTATGTTGAAACCCCTGCCCTGCAC
+CGCTTACCGGAAAAACGTCGGGCAATTCTCAGCGCCTTACGTCTGGCGCAGGAACTGGGCGCGAGACGGCAACACTTTCTGATCCAGCGGAAGAGAAAGC
+GGTAGTGCGTTATGCCCGTGAACATAATCTCGGCAAGATTATTCTCGGTCGCCCGGCCTCGCGCCGCTGGTGGCGTCGGGAAACGTTTGCTGACCGACTG
+GCGCGCATCGCCCCGATCTCGATCAGGTGCTGGTCGCGCTTGATGAACCACCCGCCCGCACGATTAACAACGCGCCGGATAACCGCTCTTTTAAAGACAA
+GTGGCGTGTACAAATTCAGGGATGCGTGGTTGCCGCCGCGTTATGCGCCGTTATCACCTTAATTGCCATGCAGTGGCTGATGGCGTTTGATGCCGCCAAC
+CTGGTGATGCTGTATCTGCTTGGCGTGGTGGTGGTGGCGCTATTTTATGGACGCTGGCCTTCAGTGGTTGCCACCGTCATTAATGTAGTGAGTTTCGATC
+TCTTTTTATCGCCCCACGCGGCACGCTCGCCGTCTCTGATGTGCAATATCTGCTGACCTTCGCGGTGATGTTAACCGTCGGGCTGGTGATCGGGAACCTT
+ACTGCTGGCGTGCGTTATCAGGCGCGGGTAGCCCGTTACCGCGAGCAACGCACACACGGCACTTATATGAAATGTCGAAAGCTCTGGCGGTGGGCCGCAG
+TCCGCAGGATATCGCTGCCACCAGCGAACAATTTATTGCCTCCACGTTTCATGCCCGCAGTCAGGTGTTGTTGCCCGATGACAACGGTAAATTGCAGCCG
+TTAACACATCCGCAAGGAATGACGCCGTGGGACGATGCCATCGCGCAGTGGAGTTTTGATAAAGGCCTGCCTGCGGGCGCGGCACCGACACGTTACCCGG
+TGTACCGTACCAGATTTTGCCGCTAAAAAGCGGCGAGAAACCTACGGGCTGGTGGTGGTGGAGCTGGGAATCTGCGCCAGTTGATGATCCCGGAACAGCA
+GCGCCTGCTGGAGACGTTACGCTGTTAGTCGCCAATGCCCTGAGCGGCTGACGCTAACCGCCAGCGAAGAACAGGCGCGGATGGCAAGCGAACGTGAACA
+GATCCGCAACGCCTGCTGCTGGCGGCGCTTTCGCATGATTTACGCACGCCGCTTACGGTGCTGTTTGGTCAGGCAGAAATCTTAACGCTCGATCTGCAAG
+CGAAGATCACCACGCCCGCCAGGCCAGCGAGATCCGTCAGCATGTGCTGAACACTACCCGACTGGTGAATAATCTACTGGATATGGCGCGAATTCAGTCC
+GGCGGCTTTAATTTGAAGAAAGAGTGGTTAACGCTGGAAGAAGTAGTCGGCAGCGCGCTGCAAATGCTGGAACCGGGTTTATCGTCGCCCATCAATCTTT
+CTCTGCCAGAACCGCTGACCTTAATCCACGTTGACGGGCCACTTTTGAACGGGTGCTGATTAATCTGCTGGAGAACGCGGTGAAATATGCGGGTGCGCAG
+GCCGAAATTGGTATCGATGCCCACGTTGAGGGCGAAAATCTACAACTGGATGTCTGGGATAACGGCCCCGGTCTTCCGCCAGGCCAGGAGCAGACGATAT
+TTGATAAGTTTGTTCGCGGAATAAAAGAGCAGTACCGGGGGTAGGGCTTGGACTGGCAATTTGTCGGGCGATAGTGGATGGTACGGGGGCACTATTACCG
+CGTTCAACCGACCGGAAGGTGGTGCCTGTTTTCGTGTTACACTTCCCCAGCAAACTGCCCCTGAACTTGAAGAATTTCATGAGGATATGTGACAAACGTT
+CTGATTGTTGAAGATGAACAGGCTATTCGTCGCTTTCTGCGCACGGCGCTGGAGGGGCGATGCGCGTCTTTGAGGCCGAAACGCTGCAACGCGGCTTGCT
+GGAAGCGGCAACCCGTAAGCCAGATTTGATTATTCTCGATCTCGGCCTGCCCGATGGTGATGGGATTGAGTTTATCCGCGACCTGCGCCAGTGGAGCGCG
+GTGCCGG
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/canu_unitigs_result2.fa	Fri Jun 08 04:43:41 2018 -0400
@@ -0,0 +1,61 @@
+>tig00000001 len=287 reads=18 covStat=1.00 gappedBases=no class=contig suggestRepeat=no suggestCircular=no
+GTTATTATTATGTCCTACAAGCATTAATTAATTAACACACTTTAGTAAGTATGTTCGCCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGC
+AGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGG
+AGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGTT
+>tig00000002 len=251 reads=3 covStat=1.00 gappedBases=no class=contig suggestRepeat=no suggestCircular=no
+CTTTAGTAAGTATGTTCGCCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGG
+CTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTG
+ATCCATCGTGATGTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGTTTTT
+>tig00000003 len=252 reads=3 covStat=1.00 gappedBases=no class=contig suggestRepeat=no suggestCircular=no
+TTTAGTAAGTATGTTCGCCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGC
+TCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGA
+TCCATCGTGATGTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGTTTTATT
+>tig00000004 len=252 reads=1 covStat=1.00 gappedBases=no class=contig suggestRepeat=no suggestCircular=no
+TTAGTAAGTATGTTCGCCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCT
+CCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGAT
+CCATCGTGATGTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGTTTTATGG
+>tig00000005 len=251 reads=1 covStat=1.00 gappedBases=no class=contig suggestRepeat=no suggestCircular=no
+GTATGTTCGCCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGT
+CTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGT
+GATGTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGTTTTATGACCCTGG
+>tig00000006 len=250 reads=2 covStat=1.00 gappedBases=no class=contig suggestRepeat=no suggestCircular=no
+TGTTCGCCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTC
+GCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGAT
+GTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGTTTTATGACCCTGAAG
+>tig00000007 len=250 reads=1 covStat=1.00 gappedBases=no class=contig suggestRepeat=no suggestCircular=no
+CGCCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAA
+TGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCT
+TATTTAAGGGGAACGTGTGGGCTATTTAGGTTTTATGACCCTGAAGTAGG
+>tig00000008 len=250 reads=1 covStat=1.00 gappedBases=no class=contig suggestRepeat=no suggestCircular=no
+GCCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAAT
+GCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTT
+ATTTAAGGGGAACGTGTGGGCTATTTAGGTTTTATGACCCTGAAGTAGGA
+>tig00000009 len=252 reads=1 covStat=1.00 gappedBases=no class=contig suggestRepeat=no suggestCircular=no
+CCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATG
+CTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTA
+TTTAAGGGGAACGTGTGGGCTATTTAGGTTTTATGACCCTGAAGTAGGAACC
+>tig00000010 len=308 reads=40 covStat=1.00 gappedBases=no class=contig suggestRepeat=no suggestCircular=no
+AATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATC
+GCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAA
+GGGGAACGTGTGGGCTATTTAGGTTTTATGACCCTGAAGTAGGAACCAGATGTCGGATACAGTTCACTTTAGCTACCCCCAAGTGTTATGGGCTAAGGCG
+AATCTCGT
+>tig00000011 len=244 reads=1 covStat=1.00 gappedBases=no class=contig suggestRepeat=no suggestCircular=no
+GTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTA
+TCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTT
+AAGGGGAACGTGTGGGCTATTTAGGTTTTATGACCCTGAAGTAG
+>tig00000012 len=246 reads=1 covStat=1.00 gappedBases=no class=contig suggestRepeat=no suggestCircular=no
+AATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATC
+GCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAA
+GGGGAACGTGTGGGCTATTTAGGTTTTATGACCCTGTCTCTTATAC
+>tig00000013 len=251 reads=2 covStat=1.00 gappedBases=no class=contig suggestRepeat=no suggestCircular=no
+AACACACTTTAGTAAGTATGTTCGCCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTG
+CTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGA
+CCTGTGATCCATCGTGATGTCTGTCTCTTATACACATCTCCGAGCCCACGA
+>tig00000014 len=251 reads=1 covStat=1.00 gappedBases=no class=contig suggestRepeat=no suggestCircular=no
+CCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATG
+CTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTGT
+CTCTTATACACATCTCCGAGCCCACGAGACTAAGGCGAATATCGTATGCCG
+>tig00000015 len=258 reads=2 covStat=1.00 gappedBases=no class=contig suggestRepeat=no suggestCircular=no
+ATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGAC
+GAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGTCTCTTATACACATCTCC
+GAGCCCACGAGACTAAGGCGAATCTCGTATGCCGTCTTCTGCTTGCAAAAAAAAAAAC
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/ecoli-reads.fasta	Fri Jun 08 04:43:41 2018 -0400
@@ -0,0 +1,224 @@
+>fa9ad683-35c5-4dad-a3af-de7a86b1ffa8
+TTGGTATGCTTCGTTCCAGTTACGTATTACTTTCTGTTGGTGCTGATGTTGCGTCTGCTGATTGTTTAACCTGGCTGGATCGCTGCTGAATAACTTCGCCGCATGGCCGCTGAAATCTTTCACCCTCTGCGCCTGGCGGTTAGCCGCCTGTTACGTCAGCCGTGGTCAACGTTAAGTCAGCTTTTCGGCATTTCGCTCCGCTATGCTGGCACTGCTGCGGTGTGCATAGCGATCTGCTCGACCGCTGGCAGCAGCATCTCAAGCGAACTACTTGCATTCATCGCCACAGAACAGGTAACCATCGAGGCGTTCCTCGGAACATCAGATAGTCAGAATCGTTTTGTATCCGAGTGGGTACAGGCGCGGCTGACGGCGATTAACGATAAGCAACAAAAGGTAAATAGAAGATGCGGCGCTTAACCGCGAGCTCAATCTTACCTGGCAAAATACGCGGCTTGATCATGATCGATTGTAATGCCCGGTAACTGGCCGCCAAAGCCGATGAAGTGTCGATGGAAGGGGCTGGCCGAAACGCTTAAACGATTGCCCTCGGTGATACCGTGGCTTTGCGGGGCGATGCGCAGGAGTTTCCGCGCTAAAGTAGCCAGCCTGCGCAAGTGGACTGGAAAGTCACGGCCTAATTTCTATTTTATTTTTCCCTGAAGGGCATTCGTTAAGGCAACCGCAGAGCAACCACCCAGTTTCCGCTGGGAGAATGGCAACGGCATGATGACACCGGCTCTTCGCCAGTTCCCGACCATCAGCCTGATAGATATTGGCGCGATTTTTAAAACCGTCGGTCAGGTGCTGGAGCAGATGGGGTCGGGCGCTGGAAGTGATAAATTGGTACTGGTCACCGCCTGCGGTATATTTGCTGTTGCTAGCACAGGGGTACGGGCGAGACATCCAGCGTCATCAAGGCTAATTGGGTGTGGCGCACTCGGTGCGGAAAAAGGCTTTGCTGCGTACCACGTTGGCAAGTGTAGAGTTCGCCATACTTGGGTTTTGTTTTGTACCAAGTGGCCGCAAAATTAGTGCACAGAAACAGCGCTGGCGGCGGTGTGCAGGCGAAAGTGAACGATTTTCAAAGTAGGAGCCAAGACTGGCGATTGTGGATTATTCTACCGTGCAGCGGGCGGCTGCTGCTGTCGCTTTCCGGCGGCTGGCTGGGTGCGGTTGGGTAGGCGCTGTTCGAGGCAGTTTGCAGAAATGCGCAAGGTAAATAGGGGGCGTTCTGGTTTAGAATGAACGCGCCCAGCAATTTCGATGAATTCTACAATATGTTTCATTGATGATGTTATTGAATTGGTGATTTTATCTTTCTGTTGCTGTCGCTAATCACAAGATCGAGGTGGGTTTGTTGATTTTTAAATGTAGCCTACAATACTCCGTTCGTGAAATCATAAAAAGCCATATGCGTTGAATGGATGTCATCCTATGGTAATTTGTTGATGATGAATTCATCCTGTGTAAAAATGTTAGTTTAATAAAATATTAGTGACCTGTAACTAACGGTTTGTTTGTTGATTGAGAACCGTGGTTATATTGAAAAATATATAAATACATTGGCTGGTCTTGTATGTCGGTTTTATTTTTTGTTGCCTAAACACAGGGATATCGAACTAATAACTAAAGGGCACTTTATAGGCAGAAAAACCAACGCGTCGGGAGATATGAGCTCAAGTATGGCGGATCCCATTGTCCGGGGCTCGGCAGGTGTAAAATTGGCGCGCCCACCAGCGTGGCATGCTCGTTGTCGGGCGGGATGACTTCGGGCAACCCGGTAAATCCGCTGCTGGGGGCAGGTACGCTTGGCCGAGACGGACTTGCCGCTGCCCGTACGCTGCGTTCATTCTCTCCCGCACCTAAAAAGCCTTCTGGACGAAGACGCCTGCCGGTGGGCGTTTTCGGCCCCGGCACAAACGCTGATATCCGCTTACAACTGCGTGATGACGGACTGATACTCCAGCAACAACGGCAGACGAACATTCCGCTGAGCCGCTGCTGCCACATGAGGAGAGCGAAATTAATACAACCGCAGGGTACGAGTCAATGTGGCTGGTGCGGTAAGGCAGCGCAACTGGACGGCCATACTGCTAGCGCGCGGCTGTGGGGGCTATACCGCCGGATATCAGTTAAGCCCGCATCTTTACCTGGCGACCAACGCGCACAGGGGCCGTGGTGGATGCTGGGTGGTCTGAGCGGGTGCCGGGTGCTGAGGACGCTTGCTGCCAGCGCCGCTGCCGTACCAGGTGCCACCAGGATAGCGGACCGCTTCAGGCGGACGCTGACGCCTGCGGCGTAGAACATGGTGACCCTGGCCAGAAATCACCAGCGTGACGGACGGTGCCGGGCGGGGTTATTCTGATTTTGTCACGCAGGCGCGAGCGTTGCGGAAAAGGCCACTTACCTCTTCGCTATCTTAATACGACGTTCCCCGCCCTATATAGCCTCAGCGTTCCCCAACCTACCCAGTACCGAATACGGCCCCGTGGTGGCTGATCACGACCGGCATGCCAGAGAAACCCTGCCGCTGCGCCACTAGATTGCGGTACGTCTCTGGAAACCGAGTGAACTGCGGCGGTATATGAGCCGCAGCAATACGCAGGTGCGCTTTCATTATGACGCGCTTACCCGGGCAGATGTGGCGCACCGTTACACTTAGGAAAGGCCGGAGATGCGCTACCACTTCGACGATACAGGGCGGGTGGTGGAGCAACGACCAGCAGGGGTTAAGCTACACTATCTTTATAGGCAAGGACCATATCGTCACCGACGGCCTGAACCGGCGTGGGAGTGCTGCATACAGAAGGCAGGGCCGGGCTAAAACAAATTGGTGAAAAAGAACGAGCGGACGGCACAGAAGCGTTCCGCGCTGAAATTGCATCGACCGCGAAGCAGGAAGGCTCACGGCATGAACGGACGCGGCAGGGCAGGAGGATAAGTACGGTCTGAATGTGGTGTCCAGCGATATCGAATACCACCGGACGGGCGGGAGACGAAATTCCTATAACGACGGGAGCCAGCTGACGGCGGTGGTAATGCCGGACGAACTGGAGAAACCGCCAGGAATATGATGAACCGGGCAGGCTGGTGTCAGAACATCGCGCAGCGGGGACAGTACGCTACCGCTACGTGGCCGCCTGATAGTTACCGGCGACGACAACGGATGCGACGGGCGCTTACCAACAGATAATATAGACACGCTACGGGCGTTGCTGGCGTTCTGGCTTTTCGACACGGAGCCATTATGAATACGACCGCTTCGGCCAGATGACGGCGAAGTCCACCGCGAAGGCATCAAACGCTACCGCTATAATAACGTGGCGGTTAACCTCGATGAAAACCGCACAGGGCGATGAAACGCGACATGAGCCACAACGCCGCAGAGCAACCTATTTCGCCAATTATCTGCCCCGGACGCGGCCGGAGCGGAAGACACGAGGTACGATGCGTGGGGAAAGGCGGGTCAGCACCACACCAGGGCGGCTGACGCGCAGTATCATTACGGTGCTGCCGGATGTCATCGCCCTGACCAACGAGAACACGGCAGCCACGGCGTCTTCTGGTTACGATGCGCTGGACCGGCTGGTGGGACAAACACCAAGCAGACGCCGAAGATGAGAACGATGAGCAGTATACCCGTAATGACGCTTCCTC
+>a403a23e-20e7-43f7-a5fa-dae8ebc59a01
+TTGACTGTGCTTCGTTCGGTTACGTATTGCTTTTTCTGTTGGTGCTGATATTGCGGCGTCTGTAGGTGTTTAACCTGCCAGCATCACACGAGATTGGTCAAGTGCGGTTGGGTTTTTCAAACGGATGCGACAGCAGTTGGCATTAAAGAAGCCACCGCCGTTAGGCGCCGAGCATCTTGATGCTTCCACGAAGCTACGATACCGCCGGGTAACAGCTGTTGCGCTCCTTCAACGGTATTCCTACGGCCTGTTGAGCGAAAGTTTTAGCGCGCAGCGAATAAAAACAATTACGAAATCAACAACGCCACGGGACTAGCACCCGCGTGGTACGTAGCAGATCGACCCAGGCATTCGAGGCGTGCTCATGCTCTGGCAGATAAACACACGGATGGGGCAAAATCACCCTGTCCCGCTGGCGGCAGAAGAAAGTTTTGCACCGTTAGCCCGCCATCTGGCTGAAATAAACTCAACGTGGTTTCACCGCTATAAGATTGCCAGTTGGTATTGGTGACAAACGACTGGCGGTATTCAGCTCATTTCAGCCACAGCTGCTGTGGATTAGCGGCGAATGGTGCTGACCGAGCAACATAAAAAACAGCACCGCCAGCCCCAGCGTATTTCGGGCCGGGAATGGCACAAAGATATTGCTTCCAGTTCATCTCACGGTCAGAGACGCCAGGTGCGAAAAGTACGCGCTCAACGCCCACCGTTGTACCGGGAAGAGGAATCATTAAATCTGGCCGCGCCAGCCCGCTGCTAAAGGACGCCAGCACCATTAACACCAATATAAAAACGTGGCGATCAGTAAGAACCCTTGCGCAGCCATCAGACACCTCCGCATTGATCGGGGCATAAACCGAATGCGGTAATAAAAGCACCAACAATGCGCCGGGTGTCGCCTGCACTCACGGTGCACCTCCGGTGGCCTAAAAGTGATACCGGAAGGGTGAATTCTGTGGCTGCAAAGATTTCGCAAAATCTGCGGGCGGGTGTAAAAAGTGATATAAAAATGGCAAAAGCCTTGATTTAACTAATGTTTAATATTAATTTAACTTTATTGTAACTTAATTACAGGATGGGTAAATAAATATAATAAGCAAAAATAGAGCCGGTCGGATGAGTAGTAAAATTACACAAAAAGGCGGTGCTATTTTCATCAGATAAACAAATTCATTTTTCCGGTGCCATTCACCGAATTGGGCAAAGGAAAGTATGGAACTCTACAGAGAATATCCTGCATGACATCTTTTACGCCATGCCTGCACGGTTGCAGCGGGCGTTCTGGCGCTGCCTTTCATGCTTTCTGGAAAGACGCGCCCGCTTTTTGCAATACCATCGCGTCTGATTCGAAAACCAGCGATAAACCAGGTGTGGATGGATCGGGCGAAAAGGCAACTGGTGATTTTATGATTGCTGAGTTTGAATATACATTGAAAACCGCCAGCGGAAACGCTGGCGGTTTTGTATCAGGAAGATGTTCAGAGGAATATTTGAACATCGTTATACCAATCGAAACGTATATTCTGCCAAATATATATAAATATTTTCTAATTGTTCTTATCTGACAGATATCTCTTAAGGCTTTCTTATAAATCTGTAGGGTTTCGCCTGTCCAGCGAACAAATAACCCGATAAACAAAGGATGAGCAGTGAGCGGAAAACCGGCGGCGCGTCGGGGTGACATGACGCAGTATGGCGTGGTAATCCAGGAGTTCAGCCGGGGTACGCATCGGTGCCCCCACCGTGGCCTGTTCGGTGTGCCCCGGCGAGTGACGTCCGGCCATCCGGTCAATCCGCTGCTCGGTGCAAAGGTCCTTCCAGTGAAACCGACATCGCCCTGCCCGGCCCGCTGCCGTTCATTCTCTCCCGCACCTACAGCAGTTACCCGGACAAAAACGCCCGCGCCGGTAGAGGCCTCGGCCCCGGCTGGAAAATGCCTGCGGATATCCGCTTACAGCTGCGCGATAACACACTGATACCAGTGATAGCGGCGGCAGAAGCCCTGTATTACGAGCACCTGTTTCCCGGTGAGGGACGGTTACAGCCGCAGCGAGTCACTGTGGCTGGTGCGCGACGGCGTGAAAGCGAAACTGGATGAAGCAAGGTCTGGCTGGCCGCCTCTGGCAGGCGCTGCCGGAGAAGAACTCGCTTAAGTCCGCATCGTTATCTGGCGACAAACAGTCCACAGGGGCCGTGGTGGCTGCTCGGCTGGTGTGAGCGGGTGCCGGAAGCGGATGAGTGCTGCCTGCGCCTTTGCCGCGCCGTACCGGGTACTGACCGGGCTGGTGGACCGCTTCGGGCGCACACAGACGTTCGCCGGTGAATTCAGCGGCGAAATCACCGGCGTGACGGATGGTGCGGGCAG
+>ae3ab29f-07ae-4476-85eb-b212d69ce732
+TTGGTATGCCTTCCGTTCAGTTACGTATTGCTACTTGCCTGTCGCTCTATCTTCGGCGTTCTGCTTGGGTGGGTACAACCTCACCCTGCGTGTGCAGGACTTCACGGCGATTCGAGCTGTCAAGTGATAGTGATGCGGTCCTTCTCATACTGATACGTGTAACTTGGCCTGCCGGGTTTAGCTGTTCTGTCACCGCCCGTCGCTGTCGTAACGGTAACAGATTCCGGTCAGCCCGTGTGACGGTGCGCCACCATCGGCCCCGGTATTTATCATCGTAAGTAAAGCTGCACCTGTATTGCTGCGGTCATACACCGCCGCCAGTTCGCCGCGGGGCGTCCAGCCATAGCGCACACCAGCGGCGCGGCAGGTAAATTCTCAGGTATTCCGGGTCGTGCGTCAGCCACACGGCAGACAGACGGATGCCGTTGTCCCGGCCATATTCAGTGTAACCGGCGGGTATCAGGAAAAAGCGGACGGTTCCGTCCCGCCGGGAAATATTACCTACTGCGGCTTCTTCTGCCCGCTGCGCCTGCGTGGTCCAGTACCAGCCGGAAGTGACGCCCGGCACCATCCATCACGCCGGTGATTTCGCCGCTGAATTCACCGGCGGCTTCGCGGTGGAACGTCTGTGTGCGCCCGAAGCGGTCACCAGCCAGTCAGTACCCGGTACGGCGGCAGCGGCGCGGTAGCACCTCATCCGCTTCCGGCACCGCTCACACCAGCCGAGCAGCCACCACGGCCCTGCGGACTGTTTGTCGCCAGATAACGATACGGACTTAAGCGAGTTCTTCCGGCGCTGCAGGATGCGGCCAGCGGTGACCTTCATCAGTTTCGCCGCGCCGCCGCGCAGCCACGGTAGCTCGCTGCGGCTGTAACCGTCCTCACCGAAACAGGTGCTCAAAATACAGAGCTTCTGCCGCCGTTGTCACTGGTATCAGTGTGTTTATCAGCGCAGCTGTAAGCGGATATCCGCAGGCATTTTCCAGCCGGGGCCGAGGCTCCCACCGGCGCAGGCGTTTTGTCCGGTAACTGCACTGTAGGTGCGGGAGAAGAATGAACGGCCTTGGGCCGGGCAGGGCGGTCATCGGTTTTCACCGGGAAGGACCTTTACCAAACAGCGGATTGACCAGACCGGACGTCACCCGCAGGGGCACACCGAACAGGCCACGCCGGTGGGGCACCGATGGAAGTACCCCGGCTGAACCCTGGACGTACTGCCGCCATACTGCGTCATGTCCGCCCTGACGCCGCCGGGTTTCCGCTCATCTGCTCATCCTTGTTTTATCGGGTTATTTGTCTGCTGACGGGCAGAACCTACAGTTATAAAGAAAGCAGCCAAGTGCCGAATATCTGTCAGATAAGAACCAATTGGAAAATATTTATATATTTCGCGTAGATATATGTTTCGATTGGTATAACGATGTCTAAATATTCCTCTGAACATCTTTCTGATAAAAACCGCCAGCGTTTCGCTGGCGGTTTCAATATTCAAACTCAGCAGAAATCAATAAAATCACCAGTTGCCTTTTCGGCCTGATCATCCACACCGGTTTTATCGCTGGTTTTCGACCCAGACGCGATGCAGAGTAAGCTGTAAAAGCGGGCGCGGTCTTTCCAGAAAAGCATGAAGAGCGCCAGAACGCCCGCTGCAGCCGCATAAGTGCGGCGTAAAAGATAAGCCATGCAGGATATTCTCTGTAGAGTTCCATACTTTCTCCCCTTTTGTATCTACCCGGTGAATGGCACCGGAAAATGAATTGTTTATCTGATGAAAATAGTACCGCCTTTGTGTAATTTTACTACTCATCCGACCACTTATTTTTTGCTTATTGATGGTTTATTTGCATTCATCCTGTAATTAGAAGTTACACAAAAGTTAGTGTACTAAACGTGGATTAAATCATGGCTTTTGCCATTTTTATACTTTACACCCGCCCGCAGATTTTTGCGAAATCTTTGCAGCCAAATTCTACCCTTCGGTATCACTTTTAGGCCACTGGAGGTGCACTGTGAGTGGGCGTGATAACCGGCGTATTGCTGGTGTTTTTATTACTGGGTTATCTGGTTTGTACCTGATCATGCGGAGGCGTTCTGATGATGGCTGCGCAGGGTTCTTACTGATCGCCACGTTTTACTGGTGTTAATGGTGCTGGCGCGTCCTTTAGGCAGCGGGCTGGCGCGGCTGATTAATGACATTCCTCTTCCCGGTACAACGGGCGTTGAGCGCGTGCTTTTCGCGCACTTGGCGTCTCTGACCGTGAAAGGATGAATGACTTAATATGCTGTGCCATTCTCGGCCTGAACATGCTGGGGCTGGCGGTGCTGTTTTATGTTGCTCGGTCAGCGCTGTATCTGCCGCTTAATCCACAGCAGCGGTGCCAGGGCTGTCGTGGGATCTGGCGCTGAATACCGCCGTCAGCTTTAATCACCAATACCAACTGGCAATCTTATAGCGGTGAAACCACGTTGAGCTATTTCAGCCAGATGGCGGGCTTAACGGTGCAAAACTTTCTTTCTGCCGCCAGCGGGGATTGCGGTGATTTTTGCCCTCATCCGTGCGTTTTACCCGCCAGGCATGACACGCTCGGGAATGCCTGGGTCGATCTGCTACGCATCACGTTATAGGTGCTGAGTCCTGTGGCGTTGTTGATTGCACTGTTTTTATTCAACAAGGTGCGCTACGCAAAACTTTCTGCCTTATCAGGCTGTAGATACCGTTAGAAGGAGCGCAACGGCTATTCACCCATGGGGCCTGTAGCTTCTCAGGAAGCGATCAAGATGCTCGGTACTAACGGCGGTGGCTTCTTTAATGCCAGCTCGTCGCATCAGTTTGAAGGAAAACCAACCGCACTGACCAACTTCGTGCGGATGCTGGCGTCTTCTTGATCCCAACGGCGCTGTGCTTTGCCTTTGGTGAAGTGATGGGCGATCGCCGCCAGGGCGCATGTTGCTGTGGGCGATGTCAGTGATTTTGTCATCTGCGTAGGCGTGGTGATGTGGGCAGAAGTTCAGGGTAATCCTCGTCTGCTGGCACTGGGCACGGACAGCAGCATCAATATGGAAGGGGTAAAGAGAGCCGTTTCGGCGTGCTGGTCAGTAGCCTGTTTGCGGTCGTGACGACGGCGGCTTCCATATGGCGCATTGATTGCGATGCATGATTCGTTTACACCGCTCTCGGTGGCATGGTGCCGATGTGGCTGGTCATGGTGGTGTTCGGCGGTGTCGGTTCTGGTCTTTTACGGCATGATGCTGTTTGTCCTGCTGGCGGTGTTTATTGCCGGGCGTGATGATTGGTCATTACACCGGAATATCTGGGTAAAAATCGACGTACGCGAGATGAGAACTGACTGCACTGGCAATTCTGGTTACCCCGACGCTGGTAGCACGATGGGCGCGGCGTTGGCGATGATGACCGACGCCGGACGTGCGCCATGCTTTCAACCCTGGCCCGCATGGTTTTTAGCGAAGTGCTGTACGCCCGTGTCATCCGCCGCTAACTAACAACAGCTGGCAGCGCCTTTGCCGGATTAGCGCCAACTCTCCGTTCTGGAACTGTTTACTGGCGTTCTGCATGTTTGTCCGGTCGCTTCGGGTGATTATCCCGGTGATGGCGATTGCCGGTTCGCTGGTGAGTAAAGGAGCCAAGCCGCCAGCTCCGGCACGCTTCGCAACGCACGGCCCGCTGTTTGTTGGCCTGTTAATCGCACCGTGTTGCTGGTTGGCGCATGACCTTTATCCTGCCCTGGCGCTTGGTCCGGTGGCGGAATATCTCTCCTGATGATATTGAGTGAGCACTGAATGTGAGTCGTAAACAGCTGGCGCTATTCGAACCAACACTTGTCGTTCAGGCGCTGAAGCGGGAAGTGAAAAAATTAAACCCGCAGGCGCAATGGCGCAATCCGGTGATGTTTATCGTCTGGATCGGCAGTCTGCTGACCACCTGTATTAGCATCGCGATGGCAAAGCGGTGCGATGCCCGGCAATGCGCTGTTTAAGCGCGGCCATTAGCGGTGGCTGTGGATCACCATTACTGTTCATAATTTCGCCGAGGCGCGCTGGCAGAAGGCCGCAGTAAAGCGCAGGCCAACAGTCTGAAAGGTGTAAACTTTACCTTTGCCCTGGCTGCGTAGACCGAAATATGGCGCTGCGGCGGACAAAGTTCCTGCCGACCAACTTCGTAAAGGGCGATACATTGCTGGTAGAAGCTGGCGATATTATCCCTACGATGGTGAAGTTATTGAAGGGGTGCATCGGTCGATGAAAGCGCCATCACCGGGAATCGGCACCGGTGATCCGTGAATCCGGCGGCATTTTGCCTCCGTCACCGGCGGCACGCGTATTCTTTCTGACTGGCTGGTGATTGGTGTGGCGTGCCCCGGCGAGACATTTCTGGATCGGATGATCGCGATGGTGGAAGGCACAGCGACGCAAAGACGCCGAACGAAATTGCCTGACCATTCTGCTGATTGCCCTGACTATCGTCTTTTTACTGGCAACCGCCACGCTTTGTGTGTTTTCCGCGTGGGCGGTAATGCAGTCAGCGTAACGGTACTGGTGGCGCTGCTGGTCTGTCTGATCAACCACTATTGGCGGCCTGTTGTCGGCGATCGGCGTCGCCGGGATGAGCGGATGCTAGGCGCGAATGTGATTGCCACCGGCGGACGATGCAGTTGGAAGCGGCAGGTGACGTTGACGTTCTGCTACTGGATAAAACCGGCACCATCACACTCGGTAACCGTCAGGCGTCGGAGTTTATCCCCGCGCAAGGGCGTGGATGAAAAACGCTGGCTGACGCCGCACAACTGGCTTCGCTGGCTGATGAAACGCCGGAAGGCCGCAGTATTGTGATCTCCTCTCGCCAAAACGGCGTTTTAACCTGCGCGAGCGCGATGTGCAGTCGCTCCATGGTTAAACACCCAAGCAGACGCGCAATATCCGGCA
+>88b1797f-3a41-442f-bab4-cdfedf7ec597
+TTGTTATTGCTTCGTTCAGTTACGTATTGCTACTTGCCTGTCGCTCTATCTTCGGCGTCTGCTTGGTGTTTAACCTCCGCCTCTTTCGCCGCCTGGTGCCGGAGTTCATCGCCACCGCGACATCTGCCTGCGCCAGCGCCGGGCAATCGTTGGTGCCGTCGCCGGTCATCGCTGCCAAACGACCTTCCGCCTGATACTGACGGATCAATGCCAGCTTGGCCTCGGTGTCGCTTCGGCGAGAAAATCGATGAAACACCCGCTTCCGCAACAATCGCGGCGGCAGTCGGAACGGTTATCGCTGGTAATCATCACCGTTTTAATGCCCATTTTGCGCAGCTGGGCGGCTCTTTAATACCGCGACGATATCTTTCAGCGCAATAACGCCCAGCACGAGAATACCACCACCAGCGGCGTGGCTCCTGACGCGCAACTGATCGACTTTTGATCAACATCGGTAGAGTGACCACCGTTAGCCCTCAACATGGCGACGATATCGACAGAACCTTTACGGATCATGCGGTTGTCGATGTTGATCCCGCTCATCCGGCTTTGCGCAGTAAACGGTACAAAGGTGGCATGGAGCGACTGCACATCGCGCTCATGCAGGTTAAAACGCTGCTTGGCGAGGATCACAATACTGCGGCCTTCCGGCGTTTCATCAGCCAGCGAAGCCAGTTGTGCGGCGTCAGCCAGCGTTTTCATCCACGCCCTGCGCGGATAAACTCGCGCCTGACGGTTACCGAGTGTGATGGTGCCGGTTTTATCCAGTAGCCGAGCGTCAGCGTCACCTGCCGCTTCAACTGCACGTCCGCTGGTGGCAATCACATTCGCCTGGCATCCGGCTCATCCCGGCGACGCCGATCGCTGACAACAGGCCGCCAATAGTGGTTGGGATCAGACAGACCAGCAGCGCCACGGTACCGTTACGCTGACTGCATTACCCGCCCACGCGGAAACGGCCGCAGCGTGGCGGTTGCCAGTAAAAGGTGATAGTCCAGGGCAATCAGCAGAATGGTCAGGGCAATTTTCGTTCGGCGTTTTGCGTCATGTGCGCCCTTCCACCATCGCGTCATCCGGTCAGAAATGTCTCGCCGGGGTTAACGCTACACTCAATCACCGTGATCAGAAAGAATACGCGTGCCGCCGGTGACTGGAGGCAAAATCGCCACTCGGATTCACGGATCACCGATGCCGATTCCCCGGTGATAGCGCGCTTTCATCGACCGATGCACCTTCAATAACTTCACCATCGCAGGATAATATCGCCAGCTTCTACCAATTTTTGATATCGCCTTTACGAAGTTGGTCGGCAGGAACTTTGTCCGCCGCAGCGCCATATTTCGGCTCACGCAGCTTGCGGGCAAAGGCAGTTTTTCACCCCTTTCAGACTGTTGGCCTGCGCTTTACTGCGACCTTCTGCCAGCCTCGGCGAAATTAGCGAACAGTACGGTGATCAGCCAACCGCTAATGGCCGCGCTTCGGCAACGCATTGCCGGGCACATCGCCGCTTTGCCATCGCGATGCTAATACAGGTGGTCAACGAGCTGCCGATCCAGACGATAAACATCACCGGATTGCGCCATTGCGCCTGCGGGTTAATTTTTCACCGCTTCTTTCAGCGCCTGAACGACAAGTGTTGGTTCAGAATAAGCGCCAGTTGTTTGACTCATATTCAGTGCTCACTCAATATCATCAGGAGATATTCCGCCACCGGACCAAGCGCCAGGGCAGGGGATAAAGGTCAGTCGCCAACCAGCAACACGGTGCCGATTAACAGGCCAACAAACAGCGGGCCGTGCGTTGGCAGCGTGCCGGAGCTGGCGGCGGCTCTTTTGCTCACCAGCGAACCGGCTGGTGCCATCACCGGGATAATCGCGAAGCGACCGACAAACGCTGCAGAACGCCGGTAAACAGTTCCAGAACGGAAGGTTGGCGCTTAATCCGGCAAAGGCGCTGCCGTTGTTGTTAGCGGCGGATGACACGGCGTACAGCACTTCGCTAAAACCATGCGGGCCAGGTTGAGCATGGCGCTACGTCCGGCGTCGGTCATCATCGCCAACGCCGCCCATCAACACCAGCGTCGGGGTAACCAAATTGGTGCAGTCGGATTTCATCTCGCGGCCCGTCGATTTTTTACCCAGATATTCCGGTGTACGACCAATCATCAGCGGCTTAATAAACACCTGCGCCAACGGGACAAGCAGCATCATGCCGTAAGACCAGACGGCACCGCCGAACACCACTTCGCAATTTGCATCAGCCACATCGGCACCATGCCACCGGAAGCGGTAAACGAATCATGCATCGCAATCACCGCGCCTGAAGCCGCCGTCGTCACGACCGCAAACAGGCTACTGACCAGCACGCCGAGCAGCTCTCTTTACCTTCCATATTGATGCTGCTGTCCGTGCCCAGTGCCAGCGAGATGAGGATTACCCTGAACTTCTGCCCACATCACCACGCCTACGCGGAATGGCAAAATCACTGACATCATACAGCAACATGCGCCCTGGCGTGATCGCCCCATCACTTCACCAAAGGCAAAGCACAGCGCCGTTGGGATCAGAAGAATCATAGCATCTGCACGAAGTTGGTCAATGCGGTTGGGTTTTCAAACGGATGCGACGAGTTGGCATTAAAGCCACCGCGTTAATTGCCGAGCATCTTGATCGCTTCCTGAGAAGCTTCTGGGCCCCATGGGTAACAGCTGTTGCGCTCCTTCAACGGTATTCTGGCCTGATAAAAGGCGAAAGTTTTAGCGCACCTTGTTGAATAAAAACAGTGCAATCAACAACGCCACAGGGACCTTTACCCATAACGTGATGCGTAGCGATCGGTAGGCATTCCCGAGCGTGCTCATGCTCTGGCGGGTAAACGCACGGATAGGGGCAAAATCACCGCGATCCCGCTGGCGGCAGAAAGAAAGTTTTGCACCGTTAAGCCCGCCATCTGGCTGAAATAGCTCAACGTGGTTTTCACCGCTAAGATTGCCAGTTGGTATTGGTGACAAAGCTGACGGCGGTATTCAGCGCCAGATCCACGACAGCCCTGGCAACTGCTGTGGATTAAGCGGCGAATGGTGCTGACGACAACGCAAAAACAGCACCGCCAGCCCCAGCATGTTCCGGGCCGAGAATGGCACAAAGATATTGCTTCCAGTTCATCTCACGGTCCAGAGACGCCAAGTGCGCGAAAAGTACGCGCTCAACGCCCGTTGTGCCGGGAAGAGATGTCATTAATCAACCGCGCCAGCCCGCTGCCTAAGGACGCGCCAGCACCATTAACACCAGTAAAACGTGGCGATCAGTGGGAGAACCGCTTGCGCAGCCATCAGAACCTCCGCATTGATCAGGGCATAAACCCAGATAACCCAGTAATAAAACACCGGCAATACGTGGTTATCACGCCTGCACTCACAGTGCACCTCCAGTGAAAGCCTCAAGAGAGTGATACCGGAAGGGTAATTCTGGCTGCAAAGATTTCCTGCAAAATCTGCGGGCAGGAATTAATAAAAAAGTATAAAAATGGCAAAAGCCATGGTTTAACTAATGTTTAGTATTAATTTAACTTTGTGTAACCCAATTACAGGATGAATGTAAATAAACCATCAATAAGCAAAAATAAGTGGTCGGATGGTAGTAAAATTACACAAAAGGCGGTTACTATTTTCATCAGATAAAACAAATTCATTTTCGGTGCCATTCACCGGGTAGATACAAAGGGAGAAAGGTATGAACTCTACAGAATATCCTGCATGGCTTATCTTTTTTACGCCGTACTTGTGCGGTTGCAGCGGGCGTTCTGGCGCTGCCAGCTCGTACTTTCTGGAAAGACCGCGCCCGCTTTACAGCTTCTGCATCGCGTCTGGTCGAAAACCAGCGATAAACCGGTGTGGATGGATCCAGGCCGAAAGGCAACTGATTTTTATTGATTGCTGAGTTTTGAATACATTGAAAACCGCCAGCGGAAACGCTGGCGGTTTTTAATATCGAAGATGTTCAGAGAATTTAGACATCGTTATACCAATCAGAAACATATATTGCATGAAATATATAAATATTTTCCTAATTGTTCTTATCGTAGATATCTCGCCAAGGCTTTCTTATAAATCTGTAGGGTTTCGCCTGTCCAGCAGACAAATAACCCGATAAAACAAGGATGAGCAGATGAGCGGAAAACCGGCGGCGCGTCGGGCGACATGACGCAGTATGGCGATAACGGTAATCCAGGGTTCAGCCGGTACGCATCCGGTGCCCCCACCGGCGTAGCCTGTTCGTGTGCCCCGGCGAAGTGACGTCCAGCCATCCGGTCAATCCGCTGCTCGGTGCAAAGGTCGCTTCCCGGTGAAACCGACATCGCCCTGCCCGGCCGCTGCCGTTCGTCTCTCCCGCACCTACCAGCGGTTACCGGACAAACGCCCGCGCGCCGGTGTAAGGAGCCACCTCGGCGGCGCGCTGGAAATGCCTGCGGATATCCGCTGGCTACGCGATAACACGCGATACTCGAGTGATAACGGCAGCAGAAGCCTGTATTTTGGGCTCTGTTTCCCGGTGAGGACGGTTTACACAGCCGCAGCAGTCACTGTGGCTGGTGCGCGGCGGCGTGGCGAAACTGGATGAAAGGTCACCGGCTGGCCGCACTCTGGCAGGCATGCCGGAAGAACTCCGCTTAAGTCCGCATCGTTATCTGGCGACAAACAGTCCACAGGGGCCGGCTGCTCGGCTGGTGTGAGCGGAGTGCCGGAAGCGGATGAGGTGCTGCCTGCGCCGCGCCGCCGTACCGGGTACTGACCGGGCTGGTGGACCGCTTCGGGCGCACAGACGTTCCGCCGCGAAGCCGCCGGTGAATTCAGCGGCAATCACCGGCGTGACGGATGGTGCCGAGGCGTCACTTCCGGCTGTACTAATACCGCACCAGGCGCAACGGGCAGAAAGCCCGGCAGCAGGCCATTTCAGCGGGACGGAACCGTCCGCTTTCCTGATACCCTGCCGGGTTACACCGAATATGGCCGGGACAACGGCATCCGTCTGTCTGCCGTGTGGCTGACGCAGCCCGGAATACCCGGAGAATTTACCTGCCGCGCCGCTGGTGCGCTATGGCTGAACGCCCGCGGCGAACTGGCAGCGGTGTATGACCGCAGCAATACACAGGTGCCTGCAACTTTACTTACGATGATAAATACCGGGGCCGGATGGTGGCGCACCGTCACACGGGCCGACCGAAATCTGTTACCGTTACGACAGCGACGGGCGGTGACAGAACAGCTAAACCGGCAGGCTTGAGTTACGCATATCGATATGAGAAGGACCGCATCACCATCACCGACAGCCTGAACCGCCGTGAAGTCCTGCACACGCAGGGTGAAGGCGGGCTGAAGCGGGTGGTGAAAAGGCTACGCGGACAGCAGCGTCACGCAGAGTCAGTTTGACGCGGTGATTGGGCAGGCTCAGGGCGCTGAACGGATACCGCAGGCAGGACAACAGAATACAGTCCGGATGTGGTGACGGGCCTCATCACGCGCATCACCACGCCGGATGGCAGGGCATCGGCGTTTACTATAACCACCACAGCCAGTTAACACGTCAGCCACCGGGCCTGACGGGCTGGAAATACTGAGGCCATGATGAATGGGGCCGTCTGATTCGGGAAACTGCCCTGACGGCGATATCACCCATACCGTTATGATAATCCCGCACAGTGACACCCTGCGCAGCGGAGATGCCGGCAGCGGAAAACCGTGACGTGGGCCGTTGCACGGTCAGTTGCTGACTTCACTGACTGTTCCGGTTATGCAACCCGCTATGACCATGACCGTTTTGGTCAGGCTGACGGCAGTGCACCGCGGAAGGGCTGAGTCAATTACCGCGCATACGACAGCCGTGGACAGTTAATTGCCGTAAAGAAAGACACGCAGGGCCATGAAACGCGGTATGAATACAACGCCGCCGGTGACCTGACCGCAAATCTATACCCCGGACGGCAGCGAAACGGGACACAGTACGATGCGTGGGGAAAAGCCATCTGTACCACGCAGGGCGGTCTGACGCGCAGTATAGACCGATGCTGCTGGACGGGTCATCCGCCTGACCAGTGAAAAGCAGCAGCCACACCACCTTCCGTTACGATGTACTCGACCGGCTGATACAGAAACCGGCTTTGACGGCCGCACGCAGCGTTATCTGCCACGACCTGACCGGCAAACTTATCCGCAGCGGGATGAGGGCTGGTCACCCACTAACACTATGACGAAGCAGACCGCCTCGCACCGCACCGTGAATGGCAAACCGCAAACGGTAGCGAGTATGACGAACGCGGCTGGCTGACAGACATCAGCCATATCAGCGAAAGGGCACCGGGTGACGGTGCACTATGGTTATGACAGTAAGGGCCGCCTCGCCCAGTGAACACCTGACGGTGCATCATCCGCAGACAGATGAACTGCTCTGGCAGCATGAGACCAGACATGCATACAACGCACGGGACTGGCGAACCGCTGTATGCCGGACCTGCCGCCGTGGAATGGCTGACCTACGGCAGCAGCTGGCTGTCAGGCATGAAACTCGGCGACACACCGCTGGTGAGTACACCCGCGACCGCCTGCACCGGGGAAACGCTGCGCAGCTTCGTGATTATGGGCTTCCACACCGCTTATACCCTGCCGGGCAGTTACAGAGCCAGCACCTGAACAGCCTGCTGTCTGACCGCGATTACACCTGGAACGACAACGGCGAACTCATCGCATCAGCAGCCCGCGCCAGACCCGGAGTTACAGCGCTACAGCACCACCGGCAGTGACCGGCGTTCACACCACCGCAGCGGATCTGGATATCCGCATCGTATACCTGAACCCGGCGGGTAACCGCCTGCCCGACCGGAGCTACCCGGACTGGCGCCCTCAATGTAACCGGATAACCGTATCGCCCGTGACGCGCACTATCTTTACCGGTATGACCGTCACGGCAGGCTGACAGAAAACCGACCTCATCGGAAGGTTATCCGCACAGATGATGATGATGAGCGCACCACCGGTACCGATACGACCAGTCAGCACCGGCTGGTGCACTACACGCGGACACAATATGCAGAGCCGCTGGTCGAAAGTCGCTATCTTTACGACCCGCTGGGCCGCAGGGTGGCAAACGGGTATGGCAGCGTGAACGGGACCTGACGGGCTGATGTCGCTGTCACAAACCGCAAGTGACTGGTACGGCTGGGACGGCGACCATGACCACGATACAGAACGACAGAACCCGCATCCAGACGATTTATCAATACGGGGCTTCGCCACTCATCAGGGTTGAAACCGCCACCGGTGAGCTGGCAGCGCCGCAGCTGGATACCCTTCAGCAGTCCGGTGGCGGGCAATTGGCAGTGTGGTGTTCCGCCGGTGCTGGTGCAGATGCTCGACCGGCTGAAAGTAATCCTGGCTGACCGGGTGAGTGAGGAAAGCCGCCGCTGGCTGGCATCCTCGTGCGGTGACCTGACGGTGGCGCAGATGCAAAAGCCAGATGGACCCGGTATACACGCCGGCGCGAAAAATTCACCTGTACCACTGCGACCATCGCTGACCTGCCGCTGGCCATATCAGCACGGAAGGGACAACAGCGTGGTACAGAATACGATGAATGCGGAACCTGCTGAATGAAGAGAGCCCGCATCAGCTGCAGCAGCTTATCCGCCTGCCGGGGCAGCAATTATGATGAGAGTCCGGCCTGTATTACAACCGCCACCGCTATTATGACCCGCTGCAGGGGCGATATATCACTCAGGGATCCGATTGGGCTGAAAGGGATGGAATTTTTATCAGTATCCGTTGAATCCGATCTCAAATATAGATCATTAGGATTAGAAACACTAAAATGCATTAAGCACTGCATTCAATGGGCGGAACTGGTGAAAAGCGGTCAGATATATGGGGGGAATCGTTCTATCATCAATATCTTTGTGTCCCCAGATGTTAAGGGGACTATACCTGTAGTGGCCAGACCAGCGGGGAGAATCAAGGAGATGGTCTATGGGGCCAGGTAAAGCAAGTAATGATACAAAAGAAGCTGCTGGCCGTTGTGACCTCGTTGAAACCGATAATAGTTGTGTGGAGAACTGTTTAAAGGGAAGTTTAAAGAGAGGTAAGACGCGTTATTCTGTATTGCCTGATATATTCGCACCTATAAATTTAGGGCTATTTAAACTGCCAAGACTGGTCTAATGATTCTTTAGAAACATGTAGATGGTCTCCGGAAATAACATTGGACGTTTTATTAGATTTGTATTCACCGGGTGATGTAATGAAATATATTATTTTTATTCCAGGCTATATGGCTGGCTTTATCGCTTTTTTAATACTATTCTTTTCAATGCATAGACTTTCACTATTAGACTCACTCATTGATGTGACGAGTTAATTAGTCTTATGGAATGATGGTAATATGTTTTCCAACAGGCATTAAGGAGTTAAACACCCAAGCAGACGCCGAAGATAGAGCACC
+>c2cfeb47-1930-4486-ba44-fb1f43519806
+TTGTTATTGCTTCCGGTCAGTTACGTATTGCTTTCTGTTGGTGCTGATGTGCGGCGTCTGTTGGGGTGTTTTAACTACCCTTGCGCCAGCCATCAGAACGCCCTCCGCGATGATCAGGGCGCCAAACCAGATAACCCAGTAATAAAAACGCAAACATGCGCCGGTTATCACGCCTGCACTCACAGTGCACCTCGATGTCTTCATTGATACCGGAAGGGTAGAATTCTGGCCCAAAGATTTCCATAAAATCTGCGGGCGAGATTAATAAAAGTATAAAGCCAGCTAAAAGCCGTGGTTAACTAATGTTTGAAGTAATTCGCTTTTGTATGGCAATTACGGGATGAATGTAAATAAACCATCAATAGCAAAAATAAATTGGTCGGATGAGTAGTAAAATTACACAAAAGGCGGTACTATTTTCATCAGATAAACAATTCATTTTTTCGGTGCCATTCACCGGGTAGATACAAAGGGGAGAAAGAAGTATGGAACTCTACCAGAATATCCTGCATGGCTTATCATTTTTACGCCGTACTTTATGCGGTTACAGCGGGCGTTCTGGCGCTGCCTTTCAATAGCTTTTCTGGAAAGGCCGCGCCCGCTTTGCAGCTACCTGCATGCGCGTCTGGTCGAAAACCAGCGATAAACCGGTGTGATGGATCAGGCCGAAAAGCAACTGGTGATTTTTGAAATTGATTTACCCAGGTTTTGATACATTGAAAACCGCCAGCGGAAACGCTGGCGGTTTTTATCATCAGGAAGATGTTCAGAGAATATTTAGACATCAATTTATACCAATCGAAACATATATTCATAAAGTATATATAAATATTTTCCTAATTGTTCTTATCTGACAGATATCTCGCCAAAGCTCTTATAAATCGCCGGGTTTCGCCTGTCAGCGAACAACTCAACGATAAAACGGATGAGCAGATGAGCGGAAAACCGGCGGCGCGTCAGGGCGACTTATGACGCAGTATGGCGAGTAGCATTGTCAGAGGAGTTCAGCCGGGGTACGCATCAGTGCCCCACCGGCGTGGTAACCTGTTCGGGGTATTAACCCCGGCGAAGTGACGTCCGACCATCCGAGTCGATCCGCTGCTCGGTGCAAAGGTCAGCTTCCCGGTGAAACCACCGACATCGCCCTGCCGGCCCGCTGCCGTTCATTCTCGCACCTGCGGCAGTTACCGGACAAAAACGCCCGCGCCGGTAAGGAGCCTCGGCCCCCGGCACAGAAAATACCTGCGGATATCCGCTTACAGCTGCGCGATAACACACTGATACTCAGTGATAACGGCGGCAAGCCTGTATTTTGAGCACCTGTTTTGGCGAGGACGGTTACAGCCCGCAGCGAGTCACTGTGGCTGAAGATGCGGCGTGGCGAAAACTGGATGAAGGTCACCGGCTGGCCGCCTCTGGCAGGCGCTGCCGGAAGAACTCCATGCGTCGCATCGTTATCTGGCGACAAACAGTCCACCCGGGGCCGTGGTGGCTGCTCGGCTGGTGTGAGCAGATTGGAAGCGGATGAAGAGGTGCTGCCGCCGCTGCCGCCATTACCAGGTACTGACCGGGCCTGGTGGACCGCCGGGCGCACACAGACGTTCCACCGCAGAAGCCGCCGGTGAATTCGGCGGCGAAATCACCGGCGTGACGGATGGTGCCGGGCATCACTTCCGGCTAGTACTGACCACGCAGGCGCTGGCGGGCAGAAGCCCGGCAGGCCATTCCGGCAGGACGGAACGTCCGCTTTCTGATACCCTGCCGGGTTACCAGATATGGCCGGGACAACGGCATCCGATCTGTCTGCCGTGTGGCTGACGCACGGCCGGAATACCCGGAGGAATTACCTGCCGCGCGCCGCTGGTGCGCTATGGCTGGGAACGCCCGCGGCGAACTGGCGGCGGTGTATGACCACCGTAATACACAGATTTGCAACTGCCCGTGATAAATACCGGGGCGGATGGTGGCGCACCGCCACACGGAGCCGACCGGAAATGTTACCGTTACGACGACGGGTTAAACGCAAGCAGACGCCGAAGATACCG
+>1c935ec4-4503-44ea-be57-7201fc03eeb6
+CTATCGGTAATACTTCGTTCCAGTTACGTATTGCTTTCTGTTGGTGCTGATATTGCGGCGTCTGCTTGGGTGTTTAACCTGACAACAGGCCGCCAATAGTCAGTTTAGGATCAGACGGACCAGCAGCGCCACCAGTACCGTTACGCTGACGCATTACCGCCCACGCGGAAAACGGCCACAGCGTGGCGGTTGCCAATATAAAGACGATAGTCAGGGCAATCAACCAGAATGGTCAGGAGCAATTTCGTTCGGCGTTTTGCGTCGCTGTGCGCCTTCACCATCGCGATCATCCGATCCAGAAATGTCGCCGGGGTTAACGCCACTCAATCCGCAGCCAGTCAGAAGAATACGCGTGCCGCCGGTGACGGAGGCAAAATCGCCACGCCGGATTCACGGATCACCGGTGCCGATTCACGGTGATGGCGCTTTCATCGACCGATGCACCCCTTCAATGCTTCACCATCGCAGGGGATAATATCGCCAGCTTCTACCAGTACGATATCGCCTTTACGAAGTTGGTCGGCGGAACTTTGTCCGCCGCAGCATATTTCGGCTCACGCAGCTTGCGGGCAAAGGCGATTTTCACCTTTCAGACTGTTGGCCTGCGCTTTACTGCGGCCTTCTGCCAGCGCCTCGCTGAAATTAGCGAACAATTACGGTGATCCACAGCCAACCGCTAATGGCCGCTTTAAACAGCCGCATTGCCGGGCATCGCACGCTGCCATCGCGATGCTAATACAGGTGGTCAACAGACTGCCGATCAGACGATAAACATCACCGGATTGCGCCATTGCGCCTGCGGGTTTAATTTTTTCACCGCTTCTTTCAGCGCCTGAACGACAAGTGTTGGTTCGAATAGCGCCAGTTGTTTTACGACTCATATTCAGTGCTCACTCAATATCATCAGGAGAGATATTCCGCCACCGGACCAAGCGCCAGGGCGGGGATAAAGGTCGAGTGCGCCAACCAACAACACGGTGCCGATTAACAGGCCAACAAACAGCGGGCCGTGCGTTGGCAGCGTGCCGGAGCTGGCGGCAGCTCTTTTACTCACCAGCAGACGGCGTTGCCATCACCGGGATAAATCGCCCCGGCGACCGACAAACATGCAGAACATACGTGAAACAGTTCCAGAACGGAGTTGGCGCTTAATCCGGCAGGCGCTGCCGTTGTTGTTAGCGGCGGATAGCCCACGGCGGTAGCACTTCGCTAAAACCATGCGGGCCAGGGTTGAGCAGCAGCGCTACGTCCGGCGTCGTCATCATCATGGCACCTGCCGCGCCCCATCAGCACCAGCGTCAGGTAGCCAAATTGCCAGTGCAGTCAGTTTCATCTCGCGTACGTCGATTTTTTACCCAGATATTCCGGTGTACGACCAATCATCAGCCCGGCAATAAACACCCGCCAGCAGGACAAAACAACATCATGCCGTAGGAGCCAGAACCGACACCGCCGGAACACCACTTCACCGAATTTGCATCAGCCACATCGGCACCATGCCGCAGGCAGTAAACAGATCATGCATCGCAATCACCCGCGCCACAGGAAGCCGCCGTCGTCGACCACCGACAGGCTACTGACCAGCACGCCAGAAACGGCTCTCTTTACCTTCCATATTGATGCTGCTGTCCGTGCCCAGTGCCAGCAGATGAGGATTACCCTGAACTTCTGCCCACATCACCACGCCTACGCGGATGACAAAATCACTGACATCGCCCACAGCAACATACGCCCCTGGCGGCGATCGCCCATCCCGCTTCACCAAAGGCAAAGCACAGCGCCGTTGGGATCGAAGATCGCCAGCATCTGCACGAAGTTGGTCCAGTGCGGTTGGGTTTTCGACGGATGCGACCGGTTGGCATTAAAGAAGCCCACCGCCGTTAGTACCGAGCATCTTGATCGCTGCTTCCTGAGCTACAGGCCCCATGGGTAACAGCTGTTGCGCTCCTTCAGCGGTATTCACAACCTGCGATAAAGGCAGAAAGTTTTGCACCCGCGAATAAACAGTGCAATCAACAACGCCGGGGACTAGCACCCATAACGTGATGCGTAGCAGATCGACCCAGGCATTCAGGCGTGCTCATGCTCTGGCGGGTAAGCGCACGGATGAGGGCCAAAATCACCGCAATCCGCTGGCGGCAGAAAGTTTGCACGTTAAAGCCGCCATCTGGCTGGCAAATAGCTCAACGTGGTTTCACCGCTATAAGATTGCCAGTTGGTATTGGTGACAAACTGACGGCGGTGTTCAACGCCAGATCCCGACAGCCCTGGCAGCTGCTGTGGATTAAGCGGCGAATGGTGCTGACCGAGCAACATAAAAACAGCACCGCCAGCCCCAGCATATTTCCAGGCCGAGAATGGCACAAGATGTGCTTCAGTTCATCTCACGGTCAGAGACGCCAAGTGCGCGAAAAGTACGCGCTCGCGCCCGTTGTACCGGGAAGAGGAATGTGGTAATCAGCGCATGGCCGCTGCCTAAAGGACGCGCCAGCACCATTAACACCAGTAAAAGCAGTGGCGATCCAGTAGAACCCTTGCGCAGCCATCAGAACGCCTCCGCATTGATCAGGGCATAAACCAGATAACCCGATGGCAAAACACCAGCAATACGCCGGTTATCGCGCCTGCACTCACAATTGCACCCCAGTGAAAGCCCTGAAGTGATACCGGAAGGGTAGAATTCTGGCTGCAAAGATTTCGCAAAAATCTGCGGGCGGGGTGTAAAAAGTATAAAAATGGCCAAAGCCATGATTTTAACTAATGTTTAGTATTAATTTAACTTTTGTGTAACTTAATTACAGGATGAATGTAAATAAAGCCATCAATAAAGCAAAATAAGTGGTCGGATGAGTAGGTAAAATTACACAAAGGCGGTACTGTTTCATCAGATAAGCAAATTCCGTTTTTCCGGTGCCATTCACCCGGGTAGATTAAAAAGGGGGAGAAAGTATGGAGACTCTACAGAGAATATCTGCATGGCTTATCTTTTTACGCCGTGTGCTTAATACGGTTGCAGCGGGGCGTTCTGGCGCTACGCTTTCATGCTTTTTCTGGAAGGCCGCGCCCGCTTTTACGGCTTCTGCCTGCATCGCGTCTGGTCGAAAACCAGCGATAAACCGGTGTGGATGGATCAGGCGAAAAGGCAACTGGTGATTTTATTGATTGCTGAGTTTTGAATACATTTGAAAACCGCCAGCGGAAACTTGTAGCGGTTTTTTGTATCAGGAAGATGTTCAGAGGAATATTTAAAACGTAGTTATACCAATCAGAAACATATATTCATGAAATATATATAAATATTTTTTCTAATTGTTCTTATCGGCAGGATGTATCTCCGCACTTAAGACTTTCTTATAAATCTGGGTTTCGCCTGTCCTTGAACTAAAATAACCCGATAAAACAAGGATAGACGGATGAGCGGAAAACCGGCGGCGCGTCGGAGCGACCATGACGCAGTATGGCAATAACGTGTCAGGAGTTCAGCCGGGGAACGCATCGTGCTCCCACCGGCGTGGCCTGTTGTTATTGCCCCGGCGGTGATCCAGCCATCCAGTCAATCCGCTGCTCAGTGCAAAATTCCTTCCCGGTGAAACCGACATCGCCTACCCGGCCCGCTGCCGTTCATTCTCTCCCGCACCTACAGCAGTTACCGGACAAACGCCCGCGCGCCGGTGGGAGCCTCGGCCAGCTGGAAATGCCTGCGGATATCCGCTTACAGCTGCGCGATAACACTGATATCGAGTGATAACGGCGGCAGAAGCCTGTATTTTGAGCACCTGTTTCCGGTGAGGACGGTTGCAGCCACCAACTGATCACTGTGGCTGGTACTTTGCGGCGGCGTGGCGAGCGGATGAAGGTCACCGGCTGGCCGCGCTCGGCAGGCTGCCGGAAGGAACTCCGCTTAAATTCCCGCATCGTTATCTGGCGACAAACCGGTCCGCAGGGGCCGTGGTGGCTGCTCGGCTGGTGTAGGCAGGTACCCGGAAGCGGATAAGTGCTGCCTGCGCCGCTGCCGCCGTACCGGGTACTGACCGGGCTGGTGGACCGCTTCGGAGACGCACACCAGACGTTCCACCATGAAGCGCCAATTGATTCGCGGCGAAATCACCGGCGTGACGGATGGTGCCGAGCGTCACTTCCGGCTGGGTACTGACCACGCGACGCAGCGAACAGAGAAGCCCGGCAAACGGGCCATTTCCGGCGGGACGGAACCGTCCGCTTTTCTGATGCCCTGCAGGTTACACCGAATATGGCCGGAACAACGGCATCCGTCAATGCCGTGTGGCTGACGCGACCAGAATACCGGAGAATTTACCGCGCGCCGCTGGTATATGGCTCGAGACGCCCGCGGCGAACTGGCGGCGATTATGACCGCAGCAATACGGGTGCGCAAAAGCTTCCCGCGCGATGATAAATGCCGGGGCGGATGGTGGCACCGTCACACGGGCCGACGGAAATCATTACCGTTACGACAGCGACGGGCGGGTGATGACAGAACAGCTAAACCCGGCAGGCTTAGTTACACGTATCGGTATGAGAAGGACCGCATCATCACCGACGGCTGAACCGCCGTGAAGTCCGCAGGGTGAAGGCAGGCTGAAACGGGTGAACGAAAAAGGAACTGCCGGACAGCATCGTCGCAGGAATCGGTTGACGCGGTGGGCAGGCTCAGGGCACAGACGGATGCCACCAGGCAGGATATGAAGATACGATCCGGATGTGGTGACGGGCCTCATCGCGCATCCACCACGCCGGATGGCAGGGCATCGACGTTTTACTATAACCACAGCGGATTAGCGTCAGCCACCGGGCCTGACGGGCTGGAAATACGCCAGGGAATATGATGAATGGGGCCGTCTGATTCGAGCACTGGCGGCGATATATCACCCATACCGTTATGATAATCCACAGTGACTTGCCCTGCGCAACGGAAGATGCCGCAGCGGCTGGAAAACCATGATGGAGCCGTTACGGTCAGTTGCTGGAAGCTTTACTGACTGTTCCGGTTGCTGACCCGCTATGATATGACCGTTTGGTCAGGTGACGGCGATGCACCGCGAAAGGAAGGGCTGAGTCGGTACCGCGCATACGACAGCCGTGGACAGTTAATTGCCGTAAAGACACGCGGGCCATATGACGCAGGTATGAATACAACGCCGCCGGTGACCTGACCACCGTCATTGCCCCGGACGGCAGAAACGGGACACAGTACGATGCTGGGAAAAGCCATCTGTACCACGCAGGGCGATCGACGCGCAGTATGGAATACGATGCTGCCGGACGGGTCATCCATGACCAATTGAAAACGGCAACCACACCACCTTCCGTTACGATGTACTCTGACCGGCTGATGCAGAAGCCCGGCGCGACTGGCCGCACACAGCGTTATCACCACGACACGATGGCGACAAATATCCGCAGCGAGGATGAGGGCTGGTCACCCTGGCATATGACGAAACAGACCGCCTCACGCACCGCACCGTGGATGGCGAAACCTGAAACGGTGGCGAGTATGACGAACGCGGCTGGCTGACGGGCATCAGCCATATCAGCGAAGAACAGGTGACGGTGCACTATGGATTATGACAGTAAAGGCCGCCTCGCCAGTGAACACCTGACGGTGCATCATCACCGAACCAGTGAACTGCTCTGGCATGAGGACCAGACATGCGTACAACGCACGGGACCTGGCGAACCGCTGTATACCGGACAGCCTGCCCGCCCGTGGAATGGCTGACCTACGGCAGCGGCTTCATGTCAGGCATGAAACTCGGCGACACACCGCTGGTGGAGTACACCGCGACCGCCTGCACCGGGAGAGCAGCTGCGCAGCTTTCGGCCGTTATGAACTCACCACCGTATACCCTGCCGGGCAGTTACAGAACCGCGCCTGAACAGCCTGCTGTCTGACCCGCGATTACACCTGGAACGACAACGGCGAACTCCTTCGCATCAGCAGCCCGCCAGACCCGGAGTTACAGCTACAGCACCGCCAGCGACTGACCGGCGTTCACTACCGCAGCAGATCTGGATATCCGCATCCGCCATACCACAGACCCGACGGGTAACCGCCTGCCCGGCGGAGGCTTCACCCGGACAGCGCCCTCAGCATGTGGCCCGGATAACCACATATCGCCGTGACGCTACTATCTTTACCGGTATGACCGTCCGGCAGGTGACAGAAAACCGACCTCATCGGAAGGGGTTATCACGCACGGATGATGAGCGCACCACCGGTACCATTACGGCAGTCAGCACGTAGTGCACCACGCGGACTGTGTATGCAGAGCGCGCTGGTCGAAGTCCTTTATCTTTACGACCCGCTGCTGGGCCGCAGGGTGGCGAAGCAGGTATGGCGGCGTGAGCAGGACCCTACCGACGGGCTGGATGTCGCTGTCACGGAAACCGCAAGTGACCTGGTAACACGGCTGGGACGGCAGCCGCCTGACCACGATACAGAACGACAGAACCCGCATCCAGACGATTTATCAGCCGGGAGCTTCACGCCACTCATCAGGGTTGAAACCGCCACCCGGTGAGCTGGCGAAAACGCAGCGCCGCAGCCTGGCGGATACCCTTCAGCAGTCCGGTGGCGAAGACGGTGGCGGTGTGGTGTTCCCGCCGGTGCTGGATGCAGATGCTCGACCGGCTGGAAAGTGAAATCCTGGCTGACCGGGTGAGTGAGAAAGCCGCCGCTGGCTGGCATCGATGCGGCCTGACGGTGGCGCAGATGCAAAATGAAGATGGACCCAGTATACCGCCGGCTTTGAAAAGTCACCTGTACCCTGCGACCATCGCGGCCTGCCGCTGGCCATATCAGCACGGAAGGGACAACAGCGTGGTACGCAGGAGAAATGCGATGAATGGGGGTAACCTGCTGAATGAAGAACCCGCATCAGCTGCGGCAACATCCGCCTGCCGGGGCAGCAGTATGATGGGGAATCCGGCCTGTATTACAACCGCCACCGCTATTATGACCCGCTGCAGGGCGATATATCACTCAGGATCGATTGGGCTGAAGGGGATGGAATTTTATCCGGTATCAAGTTGAATCGATCTCAAATATATAAGATCCGTGGGATTAGAAACGCTAAAATGCATTAAGCCACTGCATTCAATGGGCGGAACTGGTGAAAGAAGCGGTCCAGATATATGGGGGAATCCGTTCTATCATCAATATCTTTGTGTTAGATGTTAGGGACTATACTTGTGGTAGCCAAGACCAGCAGGAGAATCAAGGAGATGGTCTATGGGGGCCAGGTAAACAAGTAATGATACAAAGAAGCTGCTGGCCGTTTGTGACCTCGTTGAAACCGATAATAGTTGTGTGGAGAACTGTTTAAAGGAAGTTTAAAGAGGTAAGGCCGCGTTATTCTGTATTGCTGATATATTCACACCTATAGATTTAGGGCTGTTAAAAGGAAACTGCCAAGACTGGTCTAATGATTCTTTTTAGAAACATGTAAGATGAAGTGCTCGGAAATAACGTTGGACGTTTTATTAGATTTGTATTCACCGGGTGATGTAATGAAATATATTATTTTTTATTCAGAGCTATATGGCTGGCTTTATCGCTTTTAATACTATTCTTTTTCCATGCATAGACTTTCACTATTAGACTCCACTCGTGATGTGAGCGAGTTAATTAGTCTCATATCTTATGGGATGGTGGTAATATGTTTTCCAACAGGCATAGTATTCTTTCATTGCTCCTAATATTTTATGGGACTGTATCAGACATTATTGGCGTAAGAGTTGATAGTAAGTATATTATGGCGATAATAATATGTTTTATTTTTCTGTCAGGAGGGGTATATTCAATGGGGTTTGTATTAAAGTAAGCGCATTATAAACAAATAAATTAAGTTAATTGCTCTTATTGATATAATAATAACCTGGGCATTGATATCCCGTATGCCACAGACCCGGCAGGTAACCGCCTGCCCGGCCGGAGCTGCACCGGACGGCACCCTCAGCATGTGGCCGGATAACCGTATCGCCCGTGACGCGCACTATCTTTACCGGTATGACCGTCACGGCGGGCTGACGGAGAAAACCGACCTCATCGGAAGGGTCATCCGCACCGGATGATAGGCGCGCCCACCGGTACCATTACGACAGTCGGCACCGGCTGGTGCACTACACGCGGACACATGCTGCAGAGCCGCTGGTCGAAAGCCGCTATCTTTACGACCCGCTGGAGCCGCAGGAGTGGCAAAACGGGTGTGGCGACGTGAACGGAGACCTGACGGGCTGGATGTCGCTGTCACGAAACCACCAAGTGACCTGGTACGGCTGGGACGGCGACCGCCTGACCACGATACAGAACGACTTAAGAACCCGCATCCAGACGATTTATCAGCCGAGAACTTCACGCCACTCATCAGGGTTGGAAACCGCCACCGGTGAGCTGGCAACAACGCCGCAACCTGGCGAGATACCCTTCCAGCAGTCCGGCAGCGAACGGTGGCAGTGTGGTGTTCCGCCGGTGCTGGTGCAGATGCTCGACCGGCTGGAAAGTGAAATCCTGGCTGACCGGGTGGTACAAGGAAAGCCGCCGCTGGCTGGCATCGATGCGGCCTGACGGTGGAGCAGATGCAAAACAGATGGACCGGTGATTGTACACGCCGGCGCGAAAATCACCTGTACCCACTGCGACCATCGCGGCCTGCCGCTGGCGCTTAATCAGCTGGAAGAACAACAGAATGGTGCGCAGAATACGATGAATGGGGCAACCTGCTGGGCGAAGAGAACCCGCATCAGCTGCGGCAGCTTATCCGCCTGCGGGGCGACAGTATGATAGAGTCCGGCCTGTATTACAACCGCCACCGCTATTATGACCCGCTGCAGGGAGGTATCACTCAGGATCCCGATTGGGCTGAAGGGGGATGGAATTTTATCGGTATCCGCTGAATCCGGTTCAGTATATAGATTCAATGGGACTGGCATCAAAATATGGACATAAATAATGGCGGATATGGGCAGAGACCAACAAACCGCCTACGCCCGATCAAATGAAAATTACCCGAAGGACCGCTGCTTAAAACAAATTAGACTGCCATATCCTATTGACCAGGCCAGTAGTGCGCCTAATGTTTTCAAAACATTCTTCAGAGCATTAAGCCTTACGACTACACACTGTATTGCAGGGAAGTGGGTAAAACCAAATCTGACTTGTACGCCACAGGATGATTCCCAGTATCAGGGATGGATACAAAGACAGCAAGTGGTTACCTGCGCCACGAAGACAAATTGGCCAACAGCTCAATTACCAGGATATCTTGTGCCAGAGACCCTATTTATTCCCAGACGTTAATAAACCCGATGGGCCAGCAACGGCAGGGGATAGATGATTTGGGTGAAATTTTGGCTAAGATGGAAAGAGAACATCGAGAGGGAATAAGAAAATGAAAGAGTTTTGTTCTTTTTGCTGATGATATTTGTTAGTTTTTGGTGTTATAGCTGATTGCGAAATACAAGCTAAAGATCATGATTGTTTTACTATTTTCATAAAGGGTACTATTTTTCCGCGTTTCCTGTCTTAAATAATAAAGCCATGTGGAATGGTATCAGAATGGGGACATCGGTGGTATTATTGGCAAACAGAACTGGGTACATGTAAAAATAATAAATTCACCAAAGCGGGGCGAGACTCTTAATTCGCGTCGGGTCACTACGCCTTAATGAAAATCATGCCATCAAAGGAACGTTGCAGAAGGTTGATAAATGCAGCAGAAAAACGGCGTTTCTCGGCGATCGGTTTTAGAAGTTATATAGAGCGGGTATCTATCAAAAGAGCAGTGATCCAGTTCGGTTGTTGGCAGTCGCCCGATAATTCAATCGTAGTAAAATATTTTTAAAGATGAGAAACCAGCTTATGCTCCGAATGACGCATCTCCCGAACAAAATGGAGTCTTACGAATGTTTTAATAAAATACAGCATGAACTAATTCGTAGTGAAGAGAAATAAATCTCTTCCTGAAGAAAACAAATTAATCATTGTGAAAAATTATATAACTCATGGAATAGGTGTTTATTTTGATTCCATTTGCAGGAAAGATCGTAACGCTACTTTTTGTACTAAATAATTCGAATTTAAGTTCAACAATTGAGATACTACTTATTGTCTAAAGCTGTTTTTTCATAAACTATACATGATCAAAATACTCCTTACATAAATAGGTGAACAAAACTGGAGCTTAAAAAATTGATGGAACATATTTCTATTACACCCGATTACAGACAAGCCTGGAAAGTGGTGCATAAAATTGTCAGATATTCTACTGTTATTGACTATTTGTGCCGTTATTTCTGGTGCAGAGGTTGGGAAGATATAAGAGGATTTCGGGGAAGCATCTCGATTTTTGAAGCAATATGGTGATTTTTGAAAATGGTATTCGTTAAATACCATTGCAGAGTTGTATCAGGGAAGATCGTAACGCTTCTTTTTAATGCTAAAATAATTCGCATTTTATGTTTAAAAATTGAGATATTCATATTACCTAAAGCTGTTTTTCATAGCTTACCCTTGATCCAAATACTCCTTACATAAATAAGGTGAACAAATGGAACTTAAAAATTGATGGAACATATTTCTGTATTCCCGATTACAGATAAGCCTGGAAAAGTAGAGCATAAATTGTCAGGCATCTCCTACTATTGACTATTTTGCCGTTATTTCTGGTGCGAAAGTTGGGAAGATATAGAGGATTTCGGGAAACACATCTCGATTTCTTGAAGCAATATGGTGATTTTTGAAAATGGTATTCCTGTTCACGATACTATTGCCAGAGTTGTATCCTGTATCAGTCCTAGGTTAAACACCCAACAGACGCCGAAGATAGAGCGACAGGCAAAGAGCAATGCAATGAAAAAAAGA
+>756abc44-d69f-46e2-8464-2f309b147a27
+TTGTTGGCATACTTCGTTCAGTTACGTATTGCTACGCCTGTCGCTCTATCTTCGTCTGCTTGGTGGTTTAACCTTCAGCTTTATGCCAATACCAACTGGCAATCTTATGAGTGAAACCACGTTGGCTATTTCAGCCAGATGTGGGCTTAACGGTACAAACTTTTCTTTCTGCCGCCAGCGGGGTGCGGCGATTTTGCCCTCATCGTGCGTTTTACCCGCCCAGAGCATGGCACGCTCGGGAATGCCTGGGTCCGATCTGCTACGCATCACGTTATGGAGTGCTAGTCCCTGCGTTGTTGATTGCACCGTTTTATTCAACAAGATTGCGCTGCAAAACTTTCTGCCTTATCAGGCTGGAATACCGTTGAAGAGGCCTGTAGCTGTTGCCCATAGGGCCTGTGGCTTCTCGGGAAGCGATCAAGATGCTCAGTACTAACGGCGGTGGCTTCTTTAATGCCAACTCGTCGCATCCGTTTAACCCAACCACGCTGACCAGCTTCGTGCAGATGCTGGCGATCTTCTTGATCCCAACGGCGCTGTGCTTTGCCTTTGGTGAAGTGATGGGCGATCGCCGCCAGGGGCGCATGTTGCTGTGGGCGATGTCAGTGATTTTGTCATCTGCGCGTAGGCGTGGTGATGTGGGCAAGTTCAGGGTAAATCCTCATCTGCTGGCACTGGGCACGGACAGCAGCATCAATATGGAAGGTAAAGAGAGCCGTTTCGGCGCTGGTCAGTAACCTGTTTGCGGTCGTGACGACGGCGGCTTCCTGTGGCGCGGTGATTGCGATGCGCCAGTTCGTTTACCGCTCTCGGTGGCATAGTGCCGATGGCTGATGCAAATTGGTGAAGTGGTGTTCGGCGGTGTCGGTTCTGGTCTTTACGGCATGATGCTGTTTGTCCTGCTGGCGGTGTTTATTGCCGGGCTGATGATTGGTCGTACACCGGAATATCTGGGTAAAAATCGACGTACGCGGATGAAACTGACTGCACTGGCAATTCTGGTTACCCCGACGCTGAATTGCTGATGGGCGCGGCGTTGGCGATGATGACCGACGCCCGGACGTAACGCCATGTCCAGCCCTGGCCCGCATGGTTTTAGCGAAGTGCTGTACGCCGTGTCATCCGCCGCTAACAACAACGGCAGCGCCTTTGCCGGATTAAGCGCCAACTCCGTTCTGGAACTGTTTACTGGCGTTCTGCATGTTTGTCGGTCGCTTCCGGGGTATTATCCCGGTGATGGCAATTGCCGGTTCGCTGGTGAATTAAAAGAGCCAAGCCGCCAGCTCCGGCACGCGCTGCAACGCACGGCCCGCTGTTTGTTGGCCTGTTAATCGGCACCGTGTTGCTGGTTGGCGCACTGACCTTTATCCTGCCCTGGCGCTTGGTCGGTGGCGGAATATCTCCCTGATGATATTGGTGAGCGCACAGATATGAGTCGTAAACAGCTGTATGGCGCTTCTTCAGACCAACGCTTGTCGCTCAGGCGCTGAAAGAAGCGGTAGAAAAATTAAACCCGCAGGCGCAATAATAATCCGGTGATGTTTATCGTCTGGATCGGCAGTCTGCTGACCACCTGTATTAGCATCTCGCGATGGCAAGCGGTGCGATGCCCGGCAATGCGCTGTTTAGCGCGAAGCCATTAGCGGTTGTGGATCACCATGCTGTTCGCTAATTTCGCCGAGGCGCTGGCCAGAAACGGTAAAGCGCAGGCAACAGTCTGAAAGGGTGAAAAAACTGCCTTTGCCCGCAAGCTGCGTGAGCCGAAATATGGCGCTGCGGCGGACAAAGTTCACCGACCAACTTCGTAAAGGCGATGGCGTACTGGTAGAAGCTGGCGATATTATCCCCTGCGATGGTGAGGTTATTGAAGGGGTGCATCGGTCGATGAAAGCGCCATCACCGAGAATCGGCACCGGTGATCCGTGAATCCGGCGGCGATTTTGCCTCCGTCACCGGCGGCACGCTATTCTTTCTGACTGGCTGGTGATTGAGTGTAGCGTTAGCGGCAGGACATTTCTGGATCGGATGATCGCGATGGTGGAAGGCGCACAGCGACGCAAAACGCCGAACAATTACCCTGACCATTCTGCTGATTGCCCTGACTATCGTCTTTTTACTGGCAACCGCCGCGCTGTGGCCGTTTTCCGCGTGGGGCGGTAATGCAGTCAGCGTAACGGTACTGGTGGCGCTGCTGGTCTGTCTGATCCCAACCACTATTGGCGGCCTGTTGTCGGCGATCGGCGTCGCCGGGATGAGCCGGATGCTAGGCGCGAATGTGATTGCCACCAGCGGACGTGCGGTTGAAGCGGCAGGTGACGTTGACGTTCTGCTACTGGATAAAACCGGCACCATCACACTCGGTAACCGTCAGGCGTCGGAGTTTATCCCCGCGCAGGGCGTGGATGAAAAACGTAGCTGACGCGCCGCACAACTGGCTTCGCTGGCTGATGAAACGCCGGAAGGCCGCGGTATTATTGATCCTCGCCAAGCAGCGTTTAACCTGCCCAGGCGCGATGCAGTCGCTCATTCACCTGCTTTGTACCGTTTACTGCGCAAAGCCGGATGAGCGGGATCAACATCGACAACCGCATGATCCGTAAAGGTTCTGTCGATGCCATTCGTCGCCATGTTGAGGCTAACGGTGGTCACTTCCTACCGATGTTGATCAAAAAGTCGATCAGGTTGCGCGTCGGGGAGCCGCGCCGCTGGTGGTGGTGGAAAGGTTCTCGTGTGCTGGGCGTTATTGCTGAAGATATCGTCAAAGGCGGTATTAAAGAGCGCTTCGCCCAGCTGCGCAAATGGGCATTAAACGGTGATGATTACCGGCGATAACCGTCTGACTGCCGCCGCGATTGCTGGAAGCGGGTGTCGATGATTTTCTCGCCGAAGCGACACCGGAGGCCAAGCTGGCGTGATCCGTCAGTATCAGGCGGAAGAGGTCGTTTGGTAGCGATGACGGCGACGGCACCAACGATGCTCCGGCGCTGGCGCAGGCAAGATGTCGCAGTGGCGATGAACTCCGGCACCCAGGCGGCGAAAGGGCGGGCAATATGGTCGATCTCGACTCTAACCCGACCAAAGTTGATCGAGGTGGTGCACATTGGCAAACAGATGCTGATGACCCGTGGCTCATGACCACCTTCAGCGTGCCAACGATGTGGCGAAATACTTCGCCATTATTCCGGCGGCATTCGCGGCAACGTATCCGCAGTTAAATGCGCTGTTTATCATGTGCGCCATTCGCCCGACTCACATTCCTCGGTGCGGTGATTTTCAACGCCTTGATTATCGTCTTTTTGATTCCCCTGGCGTTAAAGGCGTGAGTTATAAACCGCTTACCGCTTCTGCCATGTTGCGCCGTAACTTATGGATTTACGGATGGGTGGGCTGCTGGTGCCGTTTATCGGTATCAAAGTCATTGATTTACCGACCGTTTGCGGTCTGGTGTGAGTTTACCATGAGTGGATTACGTCGGCATTATCAACATTTATCTTTCTGTTGTGATTACTGGCGGCGTTTACCGCTGCTGACCCACCGTACTGGGAGCAATGGTGGTTTCCTGGCGGGTAATGGTTCGTTGATTCGTGAAGGTGATACGGTGCGCGGTTCGGCATTAATCCGGGCAGAATTTTACCGGCAACGGCTATTTCATGGTCGCCCGTCGGCAGCGGCAGAAATGCCCTATAATCCACAGGCTTCTGGCGGGAGCAATCTGGCGGTCAGTAACCCTGAGCTGGATAAACTAATAGCCGCACGCGTTGCTGCATTACGGGCCATGCCGGATGCCAGCGCGAGCGTTCCAGTTGAACTGGTGACGGCATCCGGCAAGCGGGCTGGACAATAATATCACCCGCAAGCGGCGGCCTGTAAATCCCGCGTGGCGAAAGCGCGTAATCTCAGCGTTGAACAGCTCACGCAACTGATCATAAAATACAGCCAACAACCGCTGGTGAGATATATCAGCCAACCGGTTATCCAACATTGTTAGACTCAATCTGGCGCTGGATAAACATTGAATAACGAACCCTTACGTCCCGACCCCGATCGTCTGCTGGAACAAACTGCCGCGCCGCATCGGGGGAAAGCTGGATTTTCTTCGGTGCCGCAATGCAGGCGTCGGGAAGACCTGGGCGATGCTGGCAGAAGCCCAGCGACTGCAGACGCAAAGAGGCTGGATCTTGGCAGTTGGCGTAAGTAGAAACCGGGCGAAAAGATACCGCCGCCATGCTGGAAGGGCTGGCTGTTCTGCCGTTAAAACGCCAGGAGGTTAAACACCCAAGCAGACGCCGAAGATAGAACGCCG
+>6ffbbdea-7881-4ec3-b14a-e5a0c37c056d
+TCGTACTTCGTTCGTTAAATATTGCTGCCCTGTCGCTCCATCTTCGGCGTCGCGGGTGTTTAACTTCACCCCCGCACTCGGGCGGCTGGCTGCGCTTTACAGCCTTTACCCAGCGCCTCGGCGAAACCAGCGAACAGTACCGATCCACCGTAACGCTTCGCCGTACTTCAGCTGCTTTAATTGCCAGGCATCACGCACCGCTTACCATCACTGATATAATACCGGTGATCGCTTGACTGCCGACCAGACGATATCGCCCATCACCCGGATTGCGCCATTGCGCCTGCGGTTAATTTTCACCGCTTCGGCGCCTGAACGGCGTCATCTCGGTTCGAATAAGCGCGCGGCCTCATATTCATTTGCTCCTCAATATCATCGGGAGAGATATTCGCCACGGACCGACGCCAGAACGGGGATGATTGATCACCCAACCAGCAACACGGTGCCGATGCAAACCCGCCAACAACGGCAGGCCGTGCGTTGCTTGCGCTGTCGCGGAAGTGGCTTGATGCTCACCAGCGAACCGGCAATTTATCCGGATAATCACCTGAAGCGACTGACAAACATGCAGAGCGCCAGTAAACAGTTTCGAGCAGGTTAACCAGCGGTAATCAAGCAAAGGCACTGCCGTTATTTCGCGGCCGGATGTTGCGGCGTACAGCGCCCTTCAAAACTTCATGCGGGCAGGTTGAGCGTAGCGCTACGTCAGCGTCGGTCATTAATCATAACGCCGCGCGCCCATCTTTCAGCGTCAGGGGTAACCAGAATTGCCGGTACAGTCAGTTTCATCTCAAAGCGTCGGTTGCAGATGATATTCCGGTGTGCGACCGATCATCGGCGGCAATAAACTGCCGCCCAGGACAAACAGCATCGCGCATAAAGACCAGAACCGACACCGCCGAACACCGCTACGATTTGCATCAGAAGCCGAAATATTTCGCGTATGCGAGGCAGTAAAGCAGATGTCAGAAATAACAATCACCGCGCACCACGAGGGGTAACTTACCGTGGTCAGCCCGCAAAAGCGGCTGCTGACCAGCTTGCGCCGAAGGCGGCTCTCTTTACGCTTCCATATTGATGCGCTGTCGCATTTGTGCCCAGCGGGTGATTACCCTGAACTTCTGCCCACATCACCCTTACGCAGATGACAAAATCACCCCGGCATCGCCCACAGCAGCATGCCGCTGGCGGCAAGTCGCCATCACTTCCGCAAAGGCAAAGCACGAAGCGCCGTTGGGGATCGATCGCCAGCATCTGCACGCAATTGGTCGGAAATTTGCGGTTGGGTTTTCAAACCGGATGCGACGGTTGGCGTAAAGAAACCACCACCGTCGTGCAAGGCATCGCCCGGTCGCTACTGAAGAAGCTACAGGCCCCATCGTGCGCGCCAACTGTTGCGCTCCTTCGCGGTATTCCCGCAGCCTGATGAAAGGCCAGAAAGTTTATGCTGTTGAGACCAAAAACGTGATTGCAATCTAACCACCGCGCCAGGGGATAACTTCCGCCAACGTGATGCGAATCGACCCGGAGGCATTACGAGCGTCTTTCGTAACTTCTGGCGGGTAAACGCACGGATGAATAAAATCACCACAATCCCTTTGGCAGAAAGTTTTGCACCGACCGACCCGCATCTGGCGAAACTAACCTCAACGTGAACTACCTTCTGCGAGATTACCAGTTGACGGTGACAAAGCTGACGGCGGTATTCCGGCGCCGCCAGATCCCGGTGGCCTATGCTTGGCTACTGTGGATTAAGCGGCGAACAATTAACTGACCGACAACATAAAAACGCTGCCAGCCCAGCATCATTTCCAGGCCGAAGAATGGTGGCACCGAACTGTTGCCTTCCCGTTCATCTCCGGTCAGAGACTGGAGTGCGAAAAGAATTACGCGCTCAGCGAACAGCCGGGAGATGTCATGAAATCAGCCGCCAGCCCGCTGCCTAAAGGACGCGCCAGCACCATTAAGCACCAAACAAAAACGTGGCGATCAATTAAAAGTACCCACCCGACCATCGAACCTCCGCATTGATCAGGGGCGCATAAGCCAGATGTGATAATAAAACACCAGCAATACGCCGGGTTGTCGCGCTGCACTCAGTGCACCTCAAATCAGCTCAGGAAATTGATACCGGGAAGGTGAATTCTGGCTGCAAAGATTTCACCAAAATCTGCGGGTGTAAAAAGAAGTATAAAATGGCAAAAGCTTCGCGGATTTAGCCTAATGTTTAATGTTAATTTAACTTTGTACGTAACTTAATTACCGTGGAATGTAAATCTCGACATCAATGCGGCAAAAAGAATAAATTTGGTCGTGGGATGGGTAATGGAATGCACAAAGGCGGTACTATTTTCATCAGACGTAAACAAATTCATTTTCGGTGCCATTCACCGAATTGGGCTACAAAGGAGAAAGTATGGAACTCTGCAGAGAATATCCTGCATGAAGAGCTTTATCTTTTTACGCCGTGCCCACATGCGGTTGCAGCGGGCGTTCTGGCTGCGCTTTCATCGCTTTCTGGAAAGAGACCGCGCCCTTTTACCGGCTACCTGCATCGCGTCTGGTCGAAAACGAAATGGCTTCAGTCGTAATGGATAAGGATCGATGAAAAGGCAACTGGTGATTTTGATTGCTGGTTTTGAACCATTTAGAAAACCGCCGGAAGTAGCGGTTTTTTCTCGGAAGATGTTCAGAGAATATTTGCGTTATCGTATACGAAATCAAACATATATTCATGAAATATAAATGTTTTCCCTAATTGTTCTTTATCGGCAGATATCTCACCCAGGCTTTCTTGGGTTTCATATATCGAAAGCAGACAAATAACCCGATAAACCGGGATGGAAGATGAGCGGAAAACCGGCGGCGTCAGGCGACTTATGACGCAGTATGGTATTAACATTGTCCAGGGTTTCTTAAATTGCGTCGGTGCCCCCACCGGCGTGAAGCTGTTCCGGTGGCTTTTTGACGCGACGTCGGCCATCCGGTCAATCCGCTGCTCGGTGAAAGGTCCTTCCCGGTAGAGCATCGCCCTGCCCGGCCCGCGCGTTCATTCTCCGCACCCTACAGCGAGTTACCGGACAAAAACGCTTACGCCACGGTGGGGGCCTCGGCAACTGGTGGAAAATGCCTGCCGGATATCCGCTTACAGCTGCTGCTGAACAACACGCTGATACTCGGTGACGCGGCGGCAGAAGCCCACATATTTCCCGAGCACCTGTTTCCCTGAGGGACGGTTGTACAGCGAGTCACTTTGTGGCCAGTGCGGCGGCGTGGCGAAGGAAACTGGATCCCCGAAGGTCTTCGGCTGGCCCACTGCTCCTGGCAACGCTTCGCCGGGAAGAACTCCCTTAAATGCGCATCTACCGTTATCTGGCGACAGGAAAAAGACGATTAAGGGGCCGGCCAAATTGGCTGCTCGGCCAGTGTGAGCGAACGCGGTGCCGGAAGCGGATGAGGTGCTGCCTGCGCCGCTGCCGCCGTACCGGAGTACTGACCAGTGGTTAACTTCGGGCGCACACAGGAACGTTCCACCATGAAAATACGCCAGGTGAATTCAGCGGCGAAATCACCGGCATGACGGATGGTGCCGAACTCACTTCAAACAGTGCACTGATGACCACCAGGCGCAGCGGGCAGAAGAAGCCGGCAACGAACCCATTCGGCGGGACGGAACCGTCCGCTTTTCTGAAATTACCTGGGTTACCGAATATGGCCAGGACAGCAGCGTCGTCTATTACCGATAACGGCTGGCGCACGAATACCCGGAGAGATTTACCTGCCGCGCTTCGGTGCGCTATGGCTGGACTGCCCGCAGCGAACTGGCGGCCAGGGTGTATGACCGCAGCAATACCTGAAGATGCCGCGGCTTTGCTTACGATGATAAATACCGGGGCCGGATGGTGGCGCGCAATCACCACGAATACGACCGAATCTGTTACCGCCGTTACGGCAAGCGACAGCGGGCGGGTGATGGAACAGCTAAACCCGACGGGCTTAAGTTCACGTATCAATTATAGAGGAAGGACGCAATACCATCACCGACAGCCCTGAACCATACAAATGAGAGTCTACCTGCACAGAGCCAGAGAGCGGGCTGACGGAAGGTGTTGAAAAAGGAACACGCGGACGGCGGCGAAAATCTGCATAAGTCGTTTGACGCGATTGGGCAGGCTCAAGAGCTGGAACTGGTCACCGCAGGCGGGACCGGCACAGAATACAGTCCGGATTAAACTGGTGACGGGCCTCATCACTGCTGCTTTCCGGATGGCAGGGCAGCGTCGGCGTTTTACTATAACACTGCAATGATTAACGTCGGTACCCAGGCCTGACGGGCTACGCCAGAAGGAATATGATGGATACGGGGCCGTCGATTCAGGAAACTGGCTGACGGCGATATCACCGCTACCGTTGATAATCACACAGTGGCTTACCCTGCACCGGCGGAAAGATACCACCCGGCGCTGGAAAACCATACGGCGATAAGAACCGTTACGGTCGGTGCTGAAACTACTGACTGTTTCGGTTAATAAACCCTTCTGAAAGCCGCGACCGTTTTGGCGGTGGAGTGACGGCGGGTGCACCACCGAAAGACTGGTCAGTACCGCATCACGACAACCGTGGATAGATTTTACCGTGGAACGGATGGGTAGCGAGGCGGCTTCGATACTACCA
+>adeedf44-dbc5-401b-8b3c-07c944e12deb
+TTGATGTGCTACGTTCGGTTACGTATTGCTCCGCCTGTCCTGTCTATCTTCGGCGTCATAGCGGGTGTTTAACCTCCCTTTCAGCCCAAATCGGTCCTGGTGATATATCGCCCTGCGGCGGGTCTTAATGGCGGTGGCGATTTGTAATACAGGCCGGACTCCTCATCTTACTGCTGCCCCAGCGGTGGATAGCTTCACTGCAGCTGAAGTCGCAGGTTCTCTTCATTCAGCAGGTGCCATTCTGTCGTATTCTGCGTACACCCACGCTGTTGTCCTTCCGTGCTGATAAGGGCCAGCGGCAGACGCGATGGTCGCAGTGGTACAGGTGAATTTTCGCGCCGTGGCCATACAGGTCCATCTGGCTGCATCCTGCGCCACCGTCAATTTTACTGATGCCAGCCAACTGGCAGCTTCCTCACCCTCACCGTCAGCCAGAGTTCACTTTTCCGCCGGTCGAGCATCTGCCAGCACCGGCAGGGAGCACCACCTGCCACCGTCTTCGCCACCGGACTACTGGAAGGGTATCCGCCAGGCTGCGGCGCTGCGTTTTCGCCAGCTCACCGGTATTTGGCGGTTTCAAACCCTGATGAGTGGCGTAGAAGCTCTCTCCCCGACTGATAAATCACGTCTGGATGCGGGTTCATCGTTCTGTTATCGTGGTCAGGCGGTCGCCGTCCCAGCCATTACCAGGTCACTTGCGGTTTCCCGTGACAGCGACATCCAGCCCGTCAGGTCCCGTTCACGCCGCCATACCCGTTTGCCACCCTGCGGCCAGCAGGTCGTAAAAAATAACGACTTTCGACCAGCGGCTCTGCATATTGTGTCACGATGTAGTGCACCAGCCGGTGCTGACTGTCGTAATGAACCGGTGGTGCGCTCAATCATCATGCGGATAACCCTTCCGGGATGAGGTCAGTTTTCTCTGTCAGCCTGCCGTGACGGTCATACCGGTAAAGATAGTGCGCGTCACGGGCGATACGGTTATCCGGCCACATGCCAGGGAGCGCTGTCCGTTACAGCTCCAGGTCAGGCAGGCGGTTACCTGCCGGGTCTGTGGTATACGGGATGCGGATATCCAGATTCGCTGCGGAGGTGGTAGAACGCCGCCGGTCAGCCTGCCGGTGAACGTTATGTAGCTGTAGCTCCGGGTCCTGGCGCGGGCTGCTGATGCCAGTGAGTTCGCCGTTATCGTTCCAGGTGTAATCGCGGTCAGACAGCAGGCTGTTATTCAGGTCGCTGGCTCATAACTGCCCGGCAGGGTATAAGCAGTGAGTGGTTATAACGGCCGAAGCTGCGCAGCGTTTTCCAGTGCAGGCGGTCGCGAATTAATACTCCACCAGCGAACAATAATCGCCGAGTTCATCCTGACAGCCAGCCGCTGCCGTAGGTCAGCCATTCCACGGCAGGCAGGCTGTCGATGCTCAGCCAGTTTCGCCAGTCCCTGTGCGTTGTACGCATCATCACCAGTCTCATGCTGCCAAGGCAGTTTCATTCGTCTGCGGATGATGCACCGTCAGGTGTTCACTGGCAGGCAACGCTTTACTGTCATAACCGCAGTGCCGTCACCGGTGCCCTTCGCTGATATGGCTGATGTCATGTCGGCCAGCGCGTTCGATCATGCTGCCACCACCGCTCTGCGGTTTCGCCATTCACGGTGCGGTGCGTGGGGGCGGTCTGCTTCATCATGGTGCCAGTGGTGTGGCCCTCATCCTCGCTGCCGGATAAGTTTGCCGGTCAGGTCGTGGTGATAACATGTGCAGCCGTCAAAGCCGGTTTCCTGTATCCAGCCGGTCAATTACATCGTAACGGAAGGTGGTGTGGCTGCCGTTTTTCACTGGTCAGGCAGGGATGACCCGTCCGGCAGCATCGTATTCCATACTGCGCGTCAGACGCCCTGCGTGGTACAGATATTTTCCCCACGCATCGTGCTGTGTCCCGTTTCTGCTGCGTCGGGGGCAATGACGGTGGTCAGGTCACCGGCAGCGTTGTATTCATACCGCGTTTCATGGCCCTGCGTGTCTTTCACGGCAATTAACTGTCCACGGCTGTCGGCATGCGCGGTACAGCTCAACCCTTCTCGCGGTGCACCGCCGATCACCTGACCAAACGGTCATGGTCGCCAGCGGTTATAACCGGAACAGTCGGCAGTGAAGCTCAACTGACCGTAACGGCTCACGTCATATTTTTCGGCTGCCGGTGGCATCTTCGTTGCGCAGGGTAAGTCGCGTGTGGATTATATCATAACGGTAGCGGGTGATATCGCGCCGTCAGGGGCAGTTTCCTGAATCAGACGGCTGATAAAATCATATTCAGCGTATTTCCAGCCCGTCAGGCCCGGTGGCTGACGTTAACTGGCTGGTTATAGTAAAACGCCGTGCCCCTGCCATCCGGCGTGGTGATGCCGCGTGATGGGCCGTCACCCGCATCCGGACTGTATTCTGTTGGTCACCGCCGGCGTCGCGTCTGTGCCCTGAGCCTGCCCACCGCGATCTGACTCCTGCGTGACGCTGCCGTCCGCGTGTTCCTTTTTCACCACCCACAGCCCACTTCACCCTGCGTGTGCAGGACTTCACAGCGGTTCGACATCGGTGATGGTGATGCGGTCCTTCTCATACTGATCGTGTAACTTAAGCCTGCCGGGTTTGCTGTTCTGTCACCCGCCGTCGCTGTCGTAACGGTAACAGTTTCCGGTCGGCCCGTGTGACGGTGCGTTGCGCCACCCATCCGGCGGTATTTATCGTCGTAAGTAAAGCTGCGCACCTGTGTATTGCTGCGGTCATACACCGCCGCCAGTTCGCCGCGGGGCGTCCGGCCATAGCGCACCAGCGGCGCGAGCAGGTAAATTCTCCGAACATTTCAGATTCGTGCGTCAACCACACGGCAGACAGACGGATGCCGTTGTCCGGCCATGTTGGTGTAACCCGGCAGGGAATTATCGGAAAAGCGGACGGTTCCGTCCGCCGGAAATGACCTGCTGCCGGGCTTCTTCTGCCCACTGCGCCTGCGTGGTCAGTACCGGTAGACGACGCCCGGCGCCATCAAATCGCCGGTGATTTCGCCATGAATTCACCGGCGGCTTCGCGGTGGGACGTCTGTGTGCGCCCGAAGCGGTCCACCAGCCCGGTCGGTACCGGTACGGCAGCGGCAGCGCGGGGCAACACCTCGTCGCCCGGCCCGCTCGCACCAGCCGAGCAGCCACCACGGCCCCTGCGGACTGTTTGTCGCCAGATAACGATGCGGACTTAAGCGGGTTCTTCCGGCAGCGCCTGCCAGAGTGCGGCCAGCCGGTGACCTTCATCCAGTTTCGCCACGCCGCCGCGCGCCAGCCACAGTGACTCGCTGCGGCTGTAGCCGTCCTCACCAGGAAACAGGTGCTCAAAATGCAGGCTTCTGCCGCCGTTATCACTGATCGGTGTGTTATCGCGCCGCAGCTGTAAGCGGATATCCGCAGGCATTTTCAGCGGGGCCGGGCTCCCCACCGGCGCGGGCGTTTTGTCCGGTAACTGCTGTGGGTGGGGAGAGAGGGAATGAACGGCAGCGGGCCGGGCAGACGATGTCGGTTTCACCGGGAAGGACCTTTGCGCGAGCAGCGGATTGACCGGATGGCCCGACACCCGCCGGAGCTGCCGAACAGGCCACGCCGGTGGGGCACCGATGCGTACCCGGCTGGAACCCTGGACAATGCCACCGCCGCTGCGTCATGTCGCCCTGACGCGCCGCCGGTTTCCAGCTCATCTGCTCATCAACTTGTTTTATCGGGTTGTTGTCTGCTGACGGGCGAAACCCTGGATTTATAAGAAAGCCTTAAGTGGATATCTGTCAGATAAGAACAATTGGAAAATATTTATATATATTTCATGAATGGCATATGTTTCGATTGGTATAACGATCTAAATGTTCACTCTACGAACATCTTTACAGATACAAAACCGCCAGCGTTTCCGCTGGCGGTTTCAATCCAAAACTCAATCAATAAAAATCACCAGTTGCCCTTTTCGGTCCTGATCCATCACACCAGTTTTTATCGCGGTTTCGACCAGACTGCGATGCAGGTAGCACAACAAAAGCGGGCGCAGTCTTTCAGAAAAAGCATGAGCAGCGCCAGGGCCTTACTACAGCCGCATAATTACGGCGTAAGACAAAGCCATGCAGGATATTCTCTGTGAGTTCCATACTTTTCTCCCCTTTTTCTTATCTGCCAGTGCAGATGGCACCGGAAAATGAATTTGTTTATCGATGAAAATAGTACCCGCCTTTTGTGTAATTTTACTACTCATCCGACCATATTTTTGCTTATTGATGGTTTATTTACATTCATCATAAATTAAAGTTACAAAAGTTAAATTAATGCTAAACGTAAGTTAAATCATGGCTTTTTGCCGTTTATACTTACACCGCCCGCAATTTTGCGAAATCTTTGCAGCGTAGAATTCTCCACCTTCGGTATCACTTTTAGGCCGCGCTGGAGGTGCACTGTGAAATTGGCGTGATAACCGGCGTGGTGCTGATGTTTTATTGCTGGGTTATCCTGGTTTATGCCTGATCAATGCGGAGGCGTTCTGATGGCTGCGCAAGGGTTCGCCTGTTCGCCACGTTTTTTACTGGTGGTGTTAATGGTGCTGGCGCGTCCTTTAGGCAGCGGGCGGCGCGGCTGATTAATGACGCATTCCTCTTCCCGGTACAACGGGCGTTGTGAGCGCCGTACTTTTTTTCGCGCTTGGCGTCTCTGACCGTGAGATGAACTGGAAGCAATATCTTTACAGTGCCATTCTCTGGCCTGAACGTGCTGGGGCTGGCGGTGCTGTTTTTGCTCTTTATCGGTCAGCACTATCTTGCCAGCAATCCACAGCAGTTGCCAGGGCTGTGTCGTGGGATCTGGCGCTGAATACCGCCGTCAGCTTTTGTCGCAATACCAACTGGCAATCTTATGGCGGTGAAACCACGTTGAGCTATTTCAGCCAGATGGCGGGCTTAACCGGTGCAAAACTTTCTTTCGCCAGCGGATTGCGGTGATTTTTGCCCTCATCCGTGCGTTTACCCGCAGAGCATGACGCGCTCGAGGAATGCACTGGGTCGATCTGCTACGCATCCGCGTTATGGGTATGGTCCTGTGGCGTTGTTGATTGCGCTGTTTTTATTCAACAAGGTGCGCTGCAAAACTTTCTGCCTTATCCAGGCTGTGATGCGTTGAAGGAGGCGGCTGTTACCCATAAAGGGCCTGGCTTCTCGGAAGCGATCAAGATGCTCTCCGGTACTAACGGCGGTGGCTTCTTTAATGCCAACTCGTCGCATCCGTTTGAAACCCAACCGCACTGACCAACTTCGTTACGCAGATGCTGGCGATCTTGATCCAACGGCGCTATTGCTTTTGCCTTTGGTGAAGTGGGCGATCGCCGCCAGGGGCGCAGCATGTTGCTGTGGGCGATGTCGGTGATTTTTGTCATCTGCGTAGGCGTGGTGATGTGGGCGAAGTTCAGGGTAATCCTCATCTCTTGGCACTGGGCACGGACGGCAACATCAATATCGGAAGGTAAAGAGCCGTTTCGGCGTGCTGGTCAGTAACCTGTTTGCGGTCGTGACGACGGCGGCTTCCTGTAAGCGCCCGGTGATTGCGATGCATGATTCGTTTACCGCTCTCGGTGGCATGGTGCCGATGTGGCTGATGCAAATTGGTGATGAATTATTCGGCGGTGTCGGTTCTGGTCTTTACGGCGCTTGATGCTGTTTGTCCTGCTGGCGGTGTTTATTACCCGGCGGGCTGATGATTGGTCGTACGCCGGAATATCTGGGTAAAAAATCTGACGTACGCCGAGATGGCTTGACTGCACTGGCGATTCAGTTTACCCCGACGCTGGTGCTGATGGGCGCGGCGTTGGCGATGATGACCGACGCCGGACAGCGCCATGCTCAACCCCTGGCCCGCATGGTTTAGCGAAGTGCTGTACGCCGTCATCCGCCATAACAACAACGGCAGCACTTTGCCGGATTAAGCGCCAACTCTCCGTTCTGGAACTGTTTACTGGCGTTCTGCATGTTTGTCGGTCGCTTCGGGGTGATTGTCCGGTGATAGCAATGCCAGTTCGCTGAGTGAAAAGACCGAAGCCGCCAGCTCCGGCACGCTGCCAGCTTGCCACGGCCCGCTGTTTGTTGGCCTGTTAATCGGCACCGATGTTGCTGGATTTGGCGCCCACTGACCTTTATCCCTGCCCTGGCGCTTGGTCAGTGGCGAATATCTCTCCTGATGATATTGAGTGAGCACTGAATATGAGTCGTAAACAGCTGGCGCTATTCGAACCAACACTTGTCGTAGGTTAAACGCAAGCAGACGCCGCAATATCGAAAAGA
+>c75c8f96-eb4b-4465-9d43-024209a6a35a
+TTGCTCATTTGTACTTCGTTCAGCTACGTATTGCTACTTGCTGTCGCTCTATCTTCGGCGTCCTGCTTGGGTGTTTTAACCTCTGCTGTAGGTGCGGGAGAATAGACGGCAGCGGGCCGAACGGCCTAAGGTCCATCTCGCCAGACAACACCGCCTTCGCCCCCAGCAGCCGGATTCTCAGTTGCCCGAAGTCATCCCGCCAGACACACCAGGCACGCCACGCCAGTCGTGCCCTTGGTGCCCACCTGCCGAACCACGGGCAATGGGACCCGCCATACTGAGTCATGTATCCTCCCTGACGCGCGCTGGTTTCCGCTCATATAAGTGCCACTTTTAGTTGTGTTCATATCCTGTGTTTAGCAACAAAAAAAATGAAATGACACACAAGACCAGCTAATGTATTTATGGCCCTTTCTAAGCTTATTTGTTCTCAATCAACAACAACTGGTAATACCAGGTCACTTTCAATATTTTATTAAACTAACATTTTTAGCACAGATGAATTCATCATCAACAAATTCACTATGGATAATATCCATGCTTACTGCATATGGTTTTATGATTTTATTAATTGAGTTATTTTTGTAGAGACTATATTTAAAATCAATAAACTCCACCGGTCAGATTAATATCAGCAATAGAAGATGAAATCACCAGTTCAATAACATCATCAATGAAACATATTGTAGAATTAATTTTAAACCAAGGCGTTCATTCCAGAACGCCCTTATTTACTCTCATGCCCGCAAACTGCCTGAACAGCGCCTTACCCGCCAACCAGTCGCTTCGCACCCAGCCAGCCGCCAGCGACAGCAACGGCGGCGCTCCGCTGCACGGCAGAACAATCACAATCGCCGGTCTGGCTCACGGAAAATCAAAGCACTTTCGCGCAACACTGCCAGCGCCGTTTCCGCACCAATTGCGGCCACCAGGCCGAAACAAATAAACGCTGGCGAACTCACACCTAACGTGGTACCGGCAATTTTCCCGCACCGAGTGCCGCCACCACCAGCTCCTGATGACGCTGTTGCATTTCCACTGCACTATTGCCAGCAACGCTTTGCGCCTGCACCAGGCGGTGACCAGTACCACCATCACTTCAGCGCCCGACTTACCTGCTCCCAGCACCTGACCGACCTGTTTTAAATCGCGCCAATATCTAACGGGCTAATGGTCGAGGAACTGGCGGATGAGTTGTGTCGGGTTAAACCACCAGCAGACGCAATATCCAGCGTAG
+>40aac17d-56a6-44db-934d-c0dbb853e2cd
+TTGTTATTGCTTCGTTCAGTTACGTGTGCTTTTCTGTTGGTGCTGATATTGCGGCGTCTGGCGGGTGTTTAACCTCAGGTGCTGGCTCTGTAACTGCCGGCAGGGGAGATAAGCGATGATGAGTTCATAACGGCCGAAGCTGCAGCGTTACCACGGTACGGCGGTCGCGATTAACATGCTCCACCAGCGGGTGTGCCGCCGAGTTTCATGCCTGACGGCCAGCCGCTGCCGTGGGTCAGCCATTCCCGGCGGGCAGGCTGTCCGATATGGCCGTTCGCCGATCCCTGTGCGTTGTACGCATGTCTGGTCTCATGCTGCCAGAGCAGTTCGATCGTCTGCGGATGATGCGAATCAGGTGTTCACTGGCGAGCGGCCTTTACTATCATAACCATGGTGCACCGTCACCCGGTGCCCTTCGCTGTTATGGCTGATGTCGTCAATGGCCGCGTTCGTCATACTGCCACCGCTCTGCGGTTTTCGCCGTCACGGTGCGGTGCGTGGGCAGGGTCTGCTGCTTCGATCATGAATTGCCGGTGGTGACCAGCCCCTCATCCCTCGCTGCGGATAAGTTTGCCGGACCAGGTCGTGGTGATAACGCTGTGTGCAGCCCGTCAAAAGCCGGTTTCCTGTATCATGCGGTCAGTACATCGTAACGGAAGGTGGTGTGGCTGCCGTTTTCACTGGTCAGGCGGATGACCGTCCGGCAACATCGTATTCCATACTGCGGCGTCAGACCGCCCTGCGTGGCCTGAATGGCCACGCATCATCTGTACGTTTCTGCTGCCGTCGGGGGCAATGACGGTGGTCAGGTCACCGGCGGCGTTGTAATCATACCGCGTTTCGCCTTTCATTGTCTTTCACGACGTTAACTGTCCACGGCTTGTCGTATGCGCCGGTACTTGTCAGCCCTTCCTCGCGGTGCACCGCCGTGCCACAACCAAAACGGTCATGGTCGCAGCGGGTTACATAACCGGAACAGTCAGTGAAGCTCAACGCTGACCGTAACGGCTCCACGTCATGGTTTTCCGGCTGCCGGTGGCATCTTCCGTTGCGCAGGTAAGTCACTGTGGATTATCACCGCTTGGTAGCGGGTGATATCGCCCGTCAGGGGCAGTTCCTGAATCAGACGGCCCCTTCATCATATTCCCGTATTTCCAGCCGTCAGGCCCGGTGGCTGGCGTTAACTGGCTATTGGTGGTTATAGTAAAACGCCGATGCCCATCCGGCGTGGTGATGCGCGTGATGAGGCCCGTCACCCACATCCGGACTGGCTATTCTGTTGTCCTGCATGCGGCATCCGTCGCGTGCTGAGCCTGCCCACCATCGGCTGACTCTGCGTGACGCTGCCGTCCGCGTGTTCGCGCACCCGCTTCCAGCCGCCTTCACCTGCGTGTGCGGGACTTCACGGCAGTTCCGGGCTGTCGGTGATAATTTGATGCGGTCCTTCTCATACTGATACGGTAACTTAAGCCTGCCGGGTTTAGCTGTTCTGTCACCCGCCCGTCGCTGTCGCTAAACGGTAACAGATTTCCGGTCGGCCCGTGTGACTGATGCGCCTGTCCGGCCCGGTATTTATCATGTGGTAAAGCTGCGCACCTGTGTATTGCTGCGGTCATACACCTGCATGATTCGCCGCGGGGCATTCAGCCATAGCGCACCAGCGCGGCGGTAAATTCTCCGAATGACCGGATTAATTGCGTCAGCCACGGCGAACGAACGGATGCCCGGTTCCGGCCATTCGACGTGTTGATGGTTCCGTCCGGTTGATCCGTGTCGGTGACATCAACAATCCATCAGATGAACGTCTCCGGTATGTTGATGCCATGTCGAACGGATGCCATCGACGTAAAGTCGTCAGTTTATCCGATCTCTTCCGGGTGAAACCGGTAATCAATCGTCATCATTTTCAATCAGTGGATATATGAGCAGCGGATTGACCGGATGGCCGGACGTCACCCGCCGGGGCACAGGTGACCACGCCGATTAGGGCACCGATGCGTACTTGGCTGAACCCTGGACGATGCTACGCCATGCCGTCGTGTCGCTGACGCGCCGGTTTTCCGCTCATCTGGCTCATCTTGTTTTGTCGGGTTGTTGTCTGCTTTGACGAGCTGAAACCCTACAGTTTATAAGAAGCCTTAAGTGGATATCTGTCCGAATAAGAACAATTGGAAAATGTTTATATATGTTTCATGAATATATGTTTCGATTGGTATAACGATGTCACAAATATTCTGAACATCTTTGATGATAAAAACCGCCAGCGTTTCGCTGGCGGTTTTAATATTATTCAAACTCGGCAATCAATAAAATCACCAGTTGCCTTTTTCGGCCTGATCCATCACACCGGTTTTATCGCTGGTTTTCGACCAGACGCGATGCGAGGTAGCTGTAAAAGCGGGCGCGGTCTTTCCAGAAAAGCATGAAAGGCAGCGCCAGACGCTACTTAACTTTCACAACCGCATAGGTACGGCGTAAAAAGATAAAATGCATGCGGGATATTCTCTGTGAGTTCATACTTTCTCCCCTTTTGTATCTACCCGGTGAATGGCACCGGAAAAATGAATTGTTTATCTGATGAAAATAGTACCGCCTTTTTTGGTAACAATTTTACTACTCGTCGACCACTTATTTTTGCTTGTTATTGTTGGTTTGTTGCTTCATCCTGTAATTAAGTTACACAAAAGTTAAATTAATACTAAACGTGGTTAAATCATGGCTTTTGCCATTTTTATACTTTTTACGCACCGCCCGCGTTTTTGCGAAATCTTTGCAGCCAGAATTCTACCCTTCGGTATCACTTTTTAGGCCACTGGAGTTGCACTGTGAGTGCGGGCGTGATAACCGGCGTGTTATGGTGTTTTATTACTGGGTTATCTGGTTTATGCCTGATCAATGCGGAAGCGTTCGATGGCTGCGCAAGTTCTCTGATCGCCACGTTTTTACTGATTGTTAATGGTGCTGGCGCGTCCGCTGAGCGGGCTGGCGCGGCTGATCAATATTCCTCTTCCCGGTACAGCGAGCGTTGAGCGCGTACTTTTCGCGCAAATTATGACCGTGAGATGAACTGGAAGCAATATCTTTGTGCCATTCTCGGCCTGAACAATGCAGGACTGGCGGTGCTGTTTTTATGTTTATAGGTCAGCATATCTGCCGCTTAATCACAACGTTGCTGCTGTCATTGGGATCTGGCTGAATGCCGCCGTCAGCTTTGTCACCAATACTAACTGGCAATCTCTGGTGAAACCGTTGACTATTTCAGCCAGATGGCGGGCTTAACGGTGCAAAACTTTCTTTCTGCCGCCAGCGGATTGCGGTGATTTTGCCCTCATCCGTCACGTTTACCCACCCAGGCATGAACGCAGCTTTCGAGATGCCTGGGTCGATCTGCTACGCATCGCGTTATGGGTGCTAGTCCTGGCGTTGTTGATTGCACTGTTTTTATTCAACAAGGTGCGCTGCAAACTTTCTGCCTTATCAGGCTGTGAATACCGTTGAAGGGCGCAACAGCTATTCACCATGGGGCCTGTGGCTTCTCGAAGCGATCAGATACTCGGTACTAACGGCGGTGGCTTCTTCAATGCCAACTTTCTGTCGCATCCGTTTGAAAACCAACCACTGACCAACTTCGATGCAGATGCTGGCGATCTTCTTGATCCAACGGCGCTTTCATGCTTTGCCTTTGAATTGAAGTGATGGGCGGAAATCGCCGCCAGGCGCATGTTGCTGTGGGCGATGGTCAGTGATTTTTGTCATCTGCGTAGGCGTGGTGATGTGGGCGAAGTTCAGGGTAATCCTCATCTGCTGGCACTGGGCACGGACGGCAGCATCAATATGGAAGGTAGAAACCGTTTCGGCGTGCTGGTCAGTAACCTGTTTGCGGTCGTGACGTGGCGGCTTCCTGTGGCGCAGTGAGTTGCGATGCATAGTTCGTTTACCGCTCACTCGGTGGCATGGTGCCGATGTGGCTGATACAGTGGTGAAGTGGTGTTCCGGCGGTGTCGGTTCCTGGTCTTTACGGCATGATGCCAGTTTGTCCTGCTGGCGGTGTTTATTTGCCGGGCTGATGATTGGGTCATGCCGGAATATCTGGGTAAAAAATCGACGTACGCGAGATGAAACTGACTGCACTGGCGAACTAAGTTTACCCCGACGCTGGGTGCTGATGGGCGCGTTGGCGGTATTGTCGACGCCGGACAGCCAGCGCCATGCTCAACCCTGGCCCGCATGGTTTTGCAGCGAAGTGCTGTACGCCGTAATCATCCGCCGCTTCTTTCTTTCTTGGCTTAGCACCTTTGCCGGTTCGCGCCAACTCTCCGTTCTGGAACTGTTTACTGGCGTTCTGCATGTTTTGTCGGTCGCTTCCGGGGTATTATCCCGGTGATGGCGTTGCCGGTTCGCTGGTGAGTAAAGAGCCAAACCGCCAGCTCCGGCACGCTGCCAACACGGCCCGCTGTTTGTGGCTATTCAATCGGCACCGTCATTGCTGGTTGGCGCACTGACCTTTATCCCTGCCCTGGCGCTTGGTCCGGTGGCGGAATATCTCTCCTGATATTGAGTGAGCACTGAATATGAGTCGTAAACGGCTGGCGCTTCTGTTCGAACCAGCACTTGTCGTTCAGGCGCTGAAAAACGGTGAAAAATTAAACCCACCGGGCACAATGGCGCAATCGGTGATGTTTATCGTCTGGATCGGCAGTCTGCTGACCACCTGTATTAACATCGCGATGGCAAGCGGGTACGTGCCGGCGCAATGCGCTGTTTAGCGCGGCCATTAATGATTGGCTGTGGATCACCCGTACTGTTCGCTAATTTCGCCGGGCGCTGGCGAAGAAGGTGTGACCTGATGAAAACAGGCCAACAGTCTGAAAGGGGTGAAAAAAAACTGCTGCCCTGAAAGCTGCGTGACCGAAATATGGCGCTGCGGCGGACAAAGTTCTGCCGACCAACTTCGTAAAGGCGATATCGTACTGGTGAAGAAGCTGGCGGAGTTAAACACCCAGACGCCGAGATGGGGCACGGG
+>1d5ccec9-296a-4afd-ad74-010ebd3732ec
+CCGGTATGCTTCGTTCGGTTACGTAATGCTCTTGCCTGTCGCTCTATCTTCGGCGTCTGCTTGGGTGTTTTAACCCTCAATACCAACTGGCAATCTTATAGCGGTGAAACCACGTTGAGCTATTTCAGCCAGATGGCGGGCAACAGTGCAAAACTTTCTTTCTGCCGCCAGCGAAGTTGCAGTGATTTTGCCCTCATCCGTGCGTTTTACCGCCAGAGTATGCGCTCAGGAATGCCTGGGTCGATCTGCCTACGCATCACGTTATAGATTGCTAGTCCCTGTGGCGTTGTTGATTGCACTGTTTTTTTATTCCAACAAGGTGCGCTGCAAAACTTTCTGCCTTATCGGGCTGGCGGAATACCGTTGAAGGAGCGCAACAGCTGATACCATGGGGCCTGTAAGCTTCTCAGGAAGCGATCAAGATGCTCAGTACTAACGGTGGCTTCTTTAATGCCAACTCTGTCGCATCCGTTTGAAAACCCAACCGCACTGACAACTTCGTGCAGATGCTGGCGTCTTCTTGATCCCCAACGGCGCTGTGCTTTGCCTTTAGTGAAGTGATAGGCGATCGCCGCCAGGGGCGCATGTTGCTGTGGGCGATGTCAGTGATTTTTGTCATCTGCGTAAGGCGTGGTGATGGGCAGAAGTTCAGGGTAATCCCTCATCTGCTGGCACTGGGCACGGACCTTGGCATCAATATGGAAGGTAAAGAGAGCCGTTTCGGCGTGCTGGTCAGTAGCCTGTTGCGGTCGTAACGTGGCGGCTTCCTGTGGCGCGGTGATTGCGATGCATGATTCGTTTACCGCTCTCGGTGGCATGGTGGTGCCGATGTGGCTGATGCAAATTGGTGAAGTGGTGTTCGGCGGTGTCGGTTCTGGTCTTTACGGCATGATGCTGTTTGTCCTGCTGGCGGTATTTATTGCCGGGCTGATGATTGGTCGTACACCGGAGATATCTGGGTAAAAATCGGCGTACGCAGATGAAACTGACTGCACTGGCAATTCTGGTTACCCCGACGCTGGTGCTGATGGGCGCAGCGTTAGCGATGACCGACGCGGACGTAGCGCCATGCTCAACCTGGCCCGCATGGTTTTGGCAAGTGCTGTACGCCGTGTCATCCGCCGCTAACAACAGCAGCAGCGCCTTTGCCGATTAAGCGCCAACTCTCCGTTCTGGAACTGTTTACTGGCGTTCTGCATGTTTGTCAGTCGCTTCCGGGGTGATTATCGGTGATGGCAGTGCCGGTTCGCTGAGTGAGTAAAGCCAAGCCGCCAGCTCCGGCACGCTGCAACGCACGGCCCGCTGTTTTGTTGGCCCTGCCAATCAGCACCGTGTTGCTGGATTTGGCGCACGGCTTTATCCTGCCCTGGCGCTTGGTCAGTGTGGAATATCTCTCCTGATGATATTGGTGAGCACTGAATACGAGTCGTAAACAACTGGCGCTAATTCAGACCAACACTTGTCGTTCAGGCGCTGAAAGAAGAAGCGTTGAAAAAATTAAACCCGCAGGCGCAAACTAATCCGGTGATGTTTATCGTCTGGATCGGCAGTCTGCTGACCACCTGTAATAGCATCGCGATGGCAGAAGCGGTGCGATGCCCGTAATGCGCTGTTTAGCGCGGCCATTAGCGGTTGGCTGCAACGGATCACCCGTACTGTTCGCTAATTTCGCCGGGCCTTGCAACTGAAAGCCGCAGTAAAGCGCAGGCGACTGGTCTGAAAGGGTGAAACTGCCTTTGCCCGCAAACCGTAGGCGAAATATGGCGCTGCGGCGGACAAAGTTCCTGCCGACCAACTTCGTAAAGGCGATATCGTACTGGTAAAGCCTTTGATATTATCCCCTGCGATGGTGAAGTTATTGAAGAGGGTGCATCGGTCGATGAAAAGCGCCATCACCGGGAATCGGCACCCGGTGATCCGTGAATCAGCGGCGATTTGCCTCCGTCACCGGCGGCACGCGTATTCTTTCTGACTGGCTGGTGATTAGTGTAGCGATTAACCCGGCAGAGACATTTCTAGGATCGGATGATCGCGATGGTGGAAGGCGCACAGCGACGCAAAGGCGCCGAACGAGAACGCCTGACCATTCTGCTGATTGCCCTGACTATCGTCTTTTACTGTAGCCGCCGCGTAATACGTTTTCCGCGTGGGGCGGTAATGCAGTCAGCGTAACGGTACTGGTGGCGCTGCTGGTCTATCTGATCAACCACTATTGGCGGCCTGTTGTCAGCGATCGGCGGCGTCGCCGGGATGAACGCCGGATGCTAGGCGCGAATCATGATTGCCACCAGCGGACGTGCAGTTGAAGCAGCAGGTGACGTTGACGTTCTGCTACTGGATAAAACCGGCACCCATCACACTCGGTAACCGTCAGGCGTCAGGTTTGTCCCCGCGCCGGGGCGTGGATGAAAAACGCTGGCTGACACACCGCACAACTGGCTTCAGCTGGCTGATGAAACGCCGGAAGGCCGCGAGTATTGTGATCCTCATAAGCAGCGTTTTAACCTGCGCGAGGCGCGATGTGCAGTCATCATGCCACCTTTATTGCCGTTTACTGCGCAAAGCCGGATAGGCAGGATCAACATCGACAACCGCATGATCCGTAAAAGGTTCTGTCGATGCCATTCATGCCATGTTAGGCTAACCGGTGGTCACTTCCCTACCGATGTTGATCAAAAGTCGATCAGAGTTGCGCGTCAGGGGAGCCACGCCGCTGGTGGTGGTGGAAGGTTCTCGTGTGCTGGGCGTTATTGCGCTGAAGATATCGTCAAAGGCGGTATTAAAGAGCGCTTCGCCCAGCTGCGCAAAATGGGCATTAAAACGGTGATGATTACCGGCGATAACCGTCTGACTGCCGCCGCGGTGCTGCGGAAGCGGGTGTCGATGATTTTCTCGCCGAAGCGACACCAGGTAAGCTGGCATTGATCCGTCAATATCAGGCGGAAGGTCGTTTAGTAGCGATGACCGGCGACGGCATAACGATGTCCGCTGGCGCAGGCAGATGTCGCAGTGGCGATGACTCCAGCGCAGGCGGCGAAAGGCGGGGCAATATGGTCGATCTCGACTCCGCCCGACCAAGTTGATCGAGGTGAGTGCATTGGCAAACAGATGCTGATGACCCGTGTCGCTGATACGCTTCAGCGTACCAACGATGTGGCGAAATACTTCGCCATTATTCCGGCGGCATTCGCGGCAACGTATCCGCAGTTAGATGCGCTGAACATCATGTACCTGCATTCACCCGACTCCGCAATCCTCCAGTGCGGTGATTTTCAACATGATTATCGTCACTGATTCCCTGGCGTTAAAAGGCGTGAGTTATAAACCATACCGCTTCTGCCATATGTTGCGCCGTAACTTATGGATTTGGTCTGGGTGGGCTGCTGGTGCCGTTTATCGAGTATCGAAGCCATTGATTTACTGCTGACCGTTTGCGGTCTGGTGTAAGGAGTTTACCATGAGTGGATTACGTCGGCATTATCAACATTTATCTTTCCGTTATTGATTACTGGCGTTTACCCGCACTGACCACCGTACTGGGGCAATGGTGGTTTCCTGGCAGGCCAATGGTTCGTTGATTCGTGAAGGTGATACGGGTGCGCGGTTCGGCATTAATCAGGCAGAATTTACCAGCAGCAGCTGTTTTCATGGTCGCCCGTCAGCAGCAGCGAGAAATGCCCTATAATCACAGGCTTCTGGCAGGAGCAATCAGCAGTCAGTAACCCTGAGCTGGATAAACTAATAGCCGCGCGTTGCTGCATTACGGGCCGCTAACCCGGATGCCAGCGCAGGCGATTCCAGTTGAACTGGTGACGGCATCGGCGGCAAGCGGGCTGGACAATAATATCACCCATAAGCGGCGGCCTGGCACAAATCCCACGCGTAGCGAGAAAGCGCGTAATCTCAGCGTTAGACAGCTCACGCAACTGATCATAAAATACAGCCAACAACCGCTGGTGAAATATATCGGCCAGCCGGTTGTCAGCATTATTGAACTCAATCTGGCGCTGGATAAACGATGAATAACGAACCCTTACGTCCCCATCCCCGATCGTCTGCTGGAACAAACTGCCGCGCCGCATCGAAGGAAGCTGGATTTTCTTCGGTGCGCAATGCAGGCGTCAGGAAGACCTGGGCGTGCTGGCAGAAGCCCAGCGACTGCTGAGCGCAGGGCTGGATATTGTGGTTGGCGTGGTACCCACGGGCGAAAGATACCGCCGCCATGCTGGAAGGGCTGGCTGTTCTGCCGTTAAAACGCCAGGCGTACCGTGGGCGGCATATCAGCGAGTTTGATCTCGATGCCGCCCTCGCCCGCCGCCCGGCGCTGATCTTAATGGACGAACTGGCGCGCACAGTAATGCGCCAGGTTCCCGTCATCCCAAACGCTGGCAGGATATCGAAGAACTGCTGGGAAGCTGGCGTGATGTTTTCACTACCGTCAACGTTCAGCATCTGGAAAGTCACAGATGATGTGGTCAGCGGCGTCACACCGGAATTCAGGTGCGGAAACCGTGCCCGATCCTTTCGATGCCGCCGACGACGTGGGTGGGTGGACTTGCCCCGGACGTCTGCGCCAGCGGCTTGAAAGAAGGCAAAGTCTATATTGCCGGGCAGGCGGGCAGCGCGCCATTGAACATTTTTCCGCAAAGGTAATCCCCAGTCGCCCTGCACCCAGTGGCACTGCGCCGTACTGCCGATCGCGTTGATGAGCAAATATGCGCGCCTGGCAGGGGCGTCCTGGCGAAGAGAAGTGTAGCACACGCGCGGCCGCGATCCTTTTAATACATCGGCCCATAACACCGGCAGCGAAAAACTGGTCCGCGCGGCAGCGCGAAACAGCGTCACGGCTGGGTGGCGTCTGGCACGCGGTGGTAATGTTGAAACCCTGCCCTGCCGCTTACCGGAAAAAACGTCGAACTTCTCAGCGCCTTACGTCTGGCGCAGGAACTTTGGGCGCCCCGGGGCAACAACACTTTCCGATCAGCGGAAGAGAAAGCGGTAGTCGTTATGCCCGTGAACATAATCTCGGCAAGATTATTCTCCGGTCGCCCAGCCTCGCGCCGCTGGTGGCGATCAGTGATTTGCTGACCGACTGGCGCGCATCGCCCCCAGTCTCGATCAGGTGCTGGTCGCGCTTGATGAACCACCGCCCGCACGATTAACAACGCGCCCGGATAGCCGCTCTTTTAAAGACCGTGGCATTGTACAAATTCCGGGGATACGTAGTTGCCGCCGCGTCATGCGCCGTTATCACCTTAATTGCTGCCATTACGGTGGCTGATGGCGTTGATGCCGCCAACCTGGTGATGCTGTATCTGCTTGGCGTGGTGGTGGTGGCGCTATTTATGGACGCTGGCCTTCAGTGGTTGCCACCGTCATTAATGTAGTGAGTTTCGATCTCTTTTTATCGCCCGCGGCACGCTCATACGTCTCTGATATGCAATATCTGCTGACCTTCGCGGTGATGTTAACCGTCGGGCTGGTGATCGGGAACCTTACTGCTTTGGCGTACGTTATCAGGCGCGGGTAGCCCGTTACCGCGAGCAACGCACGGCGCCACATATGAAATGTCGAAAGCTCTGGCGGTGGGCCGCAGTCCGCAGGATATCTGCCACCAGCAGACAATTTGTGCCTCCACGTTTCATGCCCGCAGTCAGGTGTTGTTGCCCGATGGCAGCGGTAAATTGCAGCCGTTAACACATCCGCAAGGGAATGACGCCGTGGGACGATGCCATCCTTGCAGTGGAGTTTTGATAAAGGCCTGCCTGCGGGCGCGGGCACCGACGTTACCCGGTGTACCGTACCAGATTTTGCGTAAAGCGGCGAGAAAACCTACGGGCTGGTGGTGGTGGAGCCGGGGAATCTGCGCCAGTTGATGATCCCGGAACAGCAGCGCCTGCTGGAACCGTTACGCTGTTAGTCATATCACCCTTGAGCGTGACGCTAACCGCCAGCGAAGAACAGGCGCGGATGGCAAGCGAACGTGAACCAGATCCGCAATGCCCTGCTGGCGGCGCTTTCGCATGATTTACGCACGCCGCTTACGGTGCTGCGAGGTCAGGCAGAAATCTTAACCTCGATCCTACCGGCGAAGCGAGGATCACCCGCCCGCCAGGCCAGCGAGATCAGGTAGCGTATTAACTTCTTACTACCCGACTGGTGAATAATCTACTGGATATGGCGCGAATTCAGTCCGGCGGCTTTAATTTGGGGAAGAAAGAGTGGTTAACGCTGGAAAGAAGTAGTCAGCAGCGCGCTGCCGTCTGGAACCGGGTTTATCGTCGCCCATCAATCTTTCTCTGCCAGAACCGCTGACCTTAATCCACGTTGACGGGCCTCTTTGAACGGGTGCTGATTAATCTGCTGGAGAACGCGGTGAAATATGCGGGTGCGCAGGCCGAAATTAATTATCGATGCCCACGTTGAGGCGAAAATCTACAACTGGATGTCTGGGATAGCGGCGGTCTTCCGCCAGGCCAAGACAGACGATATTTGATAAGTTTGCTCGCGGGAATAAAGAGTCGGCGGCAGTACCGGGGGTAGGGCTTGGACTGGCAATTTGTCGGGCGATAGTGGATGTACACGGGGGCACTATTACCGCGTTCAACCGACCGGAAGGTGGTGCCTGTTTTTCGTGTTACACTTCCCCAACCAAACTGCCCTGAACGGAAAGATTTCAGCGGGATATGCTTGACAAACGTTCTGATTCTTGAAGATGAACAGGCTATTCGTCCTTTCTGCGCACGGCGCTGGAGGAGGCGACGGATGCGATCTTTGAGGCCGAAACGCTGCAACGCGGCTTGCTGGAAGCGGCAACCCGTAAGCCAGATTTGATTATTCTCGATCTCGGCCTGCCCGATGGTGATGGGATTGAGTTTATCACGCGACCTGCGCCAGTGGGGCGCGGTGCCGGTGATTGACTTTCCGCACGCAGCAGAAGAGCGACAAAATCGCCGCGCGCTGGATGCCAGGCGGATGATTAGCTATCTGAGTAAAGCCGTTTTGGCGTGGCAGATGCCAGGCCCGTCTGCGCGTCGCATTACGCCGCCACTCTGCCACCACCGCGCCCGATCCGCTGGTAAAATTTTTCCGATGTTACCGTCGATTTAGCCGCCCGCGTGATTCACCGGGGTGAGGAAGGTGCATCTCCACACCAATTGAGTTCCGCCTGCTGGCGGTGCTGCTCCAACAATGCCGGAAAAATTACTCACCCAGCGCCAGCTCCTTAGCAGGTGCAGGGTTAAACCCAAGCAGACGCCGAATGGGAGCGACCAGGCAAGTAGCAATACGTAACGCA
+>690186f5-a384-40a4-8aae-9a99ad2322f5
+ACAGTACTTCGTTCCAGTTACGTATTGCTTTTCTGTTGGTGCTGATATTGGCGTCTGCTTGGGTGTTAACCTGGCGGCAGGCGTTTTGTCCGGTAACTGCTGTAGGTGCGGAGAGAATGAACGGCAGCGGGCCGGGCAGGGCGATGTCGGTTCACCGGGAAGGACCTTTGCACCGAGCAGCGGATTGACCGGATGGCCCGGACGTCGCCGCCGGGCTACCGAACAGGCCACGCCGGTGGGGGCACCGATGCGTACCCCCGGCTGAACCTGGACGAAATGCTACCGCCATACTGCGCGTCATGTCGCCCTGACGCGCCGCCGGTTTCGCTCATCTGCTCATCCTTGTTTTATCGGGTTATTTGTCTGCTGACAGGCAGAAACCCTACCGTTATAAGCCTTAAGTGAATATCTGTCGAATAAGAACAATTAGGAAAATATTTATATATATTTCATGAATATAACTCGCTTTCGATTGGTATAACGATATCTAAATATTCCTCTAGACATCTTCCTGATACAAAAACCGCCAGCGTTTCCGCTGGCGGTTTCAATATTCAAAACTCGGCAATCAATAAAATGCGCGGTTGCCTTTTCGGCTGATCATCCACCGGTTTTATCGCTGGTTTTCGACCAGACGCGATGCAGGTAGCTGTAAAGCGGGCGCGGTCTTTCCAGAAAAGCATGAAGGCAGCGCCAAGACGCCCGCTGCAACCGCATAAGTACGGCGTAAAGATAAGCCATGCAGGATATTCTCTGTAGAGTTCCATACTTTTCTCCCCTTTGTATCTACCCGGTGAATGGCACCGGAAAAATGGAATTGTTTATCTGATGAAAATAGTACCGCCTTTTGTGTAATTTTACTGCTCATCGACCACTTATTTTTGCTTATTGATGGTTTTATTTACATTCATCCTGTAATTAAGTTACACAAAAGTTAAATTAATACTAAACATTAGTTAAATCATGGCTTTTGCCATTTTATACTTTTACACATATACAGATTTTGCGAAATCTTTGCAGCCAGAATTCTACCCTTCCGGTATCACTTGCAGGCCACTGGAGGTGCACTGTGAGTGCAGGCGTGATAACCGATTATTATTGCTGGTGTTTTTATTGCTGGTTATCTGGTTTATGCCCTGATCAATGCGGAGGCGTTCTGATGGCTGCGCAAAGGGTTCGCTACTGATCGCCACGTTTTTACTGGTGTTAATGGTGCTGGCGCGTCCTTTAGGCAGCGGGCTGGCGCGGCTGATTAATGACATTCCTCTTCCGGTACAACGGGCGTTGAGCGCATGCTTTCGCACTTAGCGTCTCTGACCGTGGATGAACTGGAAGCAATATCTTTGTGCCATTCTCGGCCTGAACATGCTGGGGCTGGCGGTGCTGTTTTATGTTGCTCGGTCAGCACTATCTGCCGCTTAATCCACAGCAGTTGCCAGGGCTGTCGTGGGATCTGGCGCTGAATGCCGCCGTCAGCTTTGTCGCAATACCAACTGGCAATCTTATAGCGGTGAAACCACGTTGAGCTATTTCAGCCAGATGGCGGGCTTAACGGTGCAAAACTTTCTTTCTGCCGCCAGCGAAGTTGCGGTGATTTTTGCCCTCATCGTGCGTTTACCCGCCAGAGCATGAGCACGCTCAGGAATGCCTGGGTCGATCTGCTACGCATCACGTTATGGAGTGCTAGTCCCTGTAGCGTTTGTTGATTGCACTGTTTTTTTTATTCAACAAGGTGCGCTGCAAAACTTTCTGCCTTATCGGGCTGTATGAATACCGTTGAAGGAGCGCAACTGCTGTTCTACATGGGCCTGCTGGCTTCTCAGAGCGATCAAGATGCTCAGTACTAACGGCGGTGGCTTCTTTAATGCCAACTCGTCGCATCGTTTAGAAAACCCAACCGCACTGACCAACTTCGTGCAGATGCTGGCGATCTTCTTGATCCCAACATTAGCGCTTTGCCTTTGGTGATGATGGGCGATCGCCGCCAGGGAGGCGCATGTTGCTATGGGCGATATTGATTTTGTCATCTGCGTAGGCGTGGTGATGTGGGCAGAAGTTCAGGGTAATCCTCATCTGCTGGCACTGGGCACGGACAGCAGCATCAATATGGAAGGTAAAGAGCCGTTTCGGCGTGCTGGTCAGTAGCCTGTTTGCGGTCGTGACGACGGCGGCTTCCTGTGTACTTATTGATTGCGATGCGTTCGTTTACCGCTCTCCGTGGCATGGTGCCGTCTGGCTGATACAGAATTAGGTGATGGTGTTCGGCGGTGTCGGTTCTGGTCTTTACGGCATGATGCTGTTTGTCCTGCTGGCGGGTGTTTATTGCCGGGCTGATGATTGGTCGTACACCGGAATATCTGGGTAAAAAAAATCGACGTACGCGAGATGAAACTGACTGCACTGGCGATTCTGGTTACCCCGACGCTGGTGCTGATGGGCGCGGCGTTGGCGATGATGACCGACGCCGGACGTAGCGCCATGCTCAGCCTGGCCCGCATGGTTTTAGCGAAGTGCTGTACGCGTCATCCGCCGCTAACAACAACGGCAGCGCGCCTTTGCCGGGTCGCCAACTCTCCATTCTGGAACTGTTTACTGGCGTTCTGCATGTTTGTCGGTCGCTTCGGGGGTGATTATCCCCGTATTGATGGCAGTGCCGGTTCGCTGGTGAGTAAAAAGAAGCCAGCCGCCAGCTCCGGCACCGCTGCCAACGCACGGCCCGCTGTTTGTTGGCCTGTTAATCGGCACCGTGTTTGCTGGTTGGCGCACTGACCTTTATCCCTGCCCTGGCGCTTGGTCGGTGGCAGATATCTCTCTGATGATATTAGTGGGCACTGAATATGAGTCGTAAACAACTGGCGCTTCTTCGAACCAACACTTGTCGTTCGGGCGCTGAAAGAAGCTGAAGTGAAAAAATTAAACCCGCAGGCGCAATGCGGCACCAATCCGGTGATGTTTATCGTCTGGATCGGCGGTCTGCTGACCACCTGTATTAGCATCGCGATGGCAAACGGCGCGATGCCCGGCAAATCTGCTGTTTAGCGCGGCCATTAACGGTTGGCTGTGGATCACCGTACTGTTCGCTAATTTCGCCGAGGAAGGCGCTGGCGAAAGGCCGCAGTAAAAGCGCAGGCCAACAGTCTGAAAGAGGTGAAAAAACTGCCTTTGCCCGCAAACTGCGTGAGCCGAAATATGGCGCTGCGGCGGACAAAGTTCACCATAAACCAACTTCGTAAAGGCGATATCGTACTGGTAAGAAGCTGGCGATATTACCCCCTGCGATGGTGAAGTTATTGAAGGGTCATCGGTCGATAAGCGCCATCACCGGGAATTGGCACAGGTGATCCGTGAATCCGGCGGCGATTTTGCCTCCGTCACCGGCGGCACGCGTATTCTTTCTGACTGGCTGGCGGGTGATTGGAATTGTGGCGTTAACCCCCGGCGAGACATTTCTGGATCGGATGATCGCGATGGTGGAAGGCGCACAGCGACGCAAAACGCCGAACGAAATTGCCCTGACCATTCTGCAGATTGCCCTGACTATCATCTTTTACTGGCAGCCGCCACGCTTTGGTAGCCGTTTTTCCGCGATGGGGCGGTAATACAGTCAGCGTAACGGTACTGGTGGCGCTGCTGGTCATCTGATCCCAGCCACTGGTGGCGGCCTGTTGTCGGCGATCGGCGTCGCCGGGATGAGCCGGATGCTAGGCGCGAGATGTGATTGCCACCAGCGGACGTGCGGTTAGCGGAAGCGGCAGGTGACGTTGAGAGCGTTAGGTTAAACGCAGAAAAACAGACGCCGAAGATAGAAGCGCG
+>c7937d7b-d85f-433b-9327-7eb293974905
+CGCATTCTCGTTAGTCGATCGTATCGCTATCGTCAATCATCGCGTCGATCGATATCACGGTTGTCGCCAGCGGCGATGAGGCTGATGCCTTCCTCGCGGTGGACGCGATCATCTGGCCGAAGCGGTCGTATTCATAACGGGTCTGGTAGCCCGAGCAGTCGGTGGTACGCCAGCAACTGCCGTAGCGGCTCCAGGTCATCTGCCGGAGTGCTGCCGTCGCATCCGTTGTCGTCGCCGGTAACTCACTGTGCGCGTCATCATTGGCGGTAGCGTACTGTCTCCCCGCTGCGCGGTGTCTCCGATACCAGCCTGCGGTTCATCATATTCGGCGGCTCTCCAGCCCGTCCGGGACACCACCGCCGTCAGCTGGTTCACGTCGTTATAGTAAAATTTCGTCTCCCGCCCGTCCCGGTGTGGTGATGTCCGTGATGATATCGCCGGACACCGCATTCAGACCGTACTCTGTCCTCCGTCACGCGTCGTCTGCGCCGTGAGCCTTCCTGCCGCGTCATACCCGCTGCGCGTGACGCTGCCGTCCGCCAGTTCTTTTTCACCACCGTTTCCAGCCCGGCCCGCCTTCTGCAATATGCAGCACCTCACGCCGGTTCAGGCTGTATCGGTGACGGTGATGCTGATCCTGCTCATAAAGATAGCGGTAGCTTAACCCTGCCGGGTTCAGTTGCTCCACCACCCGCCCCGTATCGTCGTAGCGGTAGCGCATCTCGGCCTTCCACGCGTAACGGTGCGCCACCATCCGGCCCGGGTGCTGCGTCATCACGTGAAAGCGCGCACCTGCGTATTGCTGCGGTCTATACCGCCAACGGTTCACCGGCTTCCGTATGCGTGTACCCGCACCAGTGGCGCAGCGGGCAGGCTCTCGGGTATGCTGGGTCGTGCATCAGCCACCGCCGAAAGGCGGATACCCCTAATCGGGGCCGTATTCGGTACCGGGCGGTGTGTCGAGGAACGCTGAAAGGGCTGAGAGAGGGCGGGAACGCTGTCAGGAAGAAGATAGCGAAGAGGTGGGCCTCTTCCGCACGCTGCGCCTGCGTGGTCAGCACCAGGTGGAACTCCGCCCGGCACCGTCCGTCACGCCGGTGATTTCCCCAGCCAGGTCACCGGCGGCCTCACGCCGGTACGTCAACAATCCGCCCGAAGCGGTCCGCCATCCCAGTAACACCCGGTACACGGCGGCAGCGGCGCTGGCAGTACGTCCTCGGCACCCGGCACCGCTCCAGACCACCCCGAAAGTATCACCACGGCCTGTGCGCTGTTGGTCGCCAGGTAAAGATGCGGAAGCAACCGGATATCCGGCGGCAGCGCCCCCACAACCGCGCCAGCGCCATGGCCATCCGGCTGTGCTGCCTTACCACCGCGCACCAGCCACGATGACTCACTGCGGCTGTACACCGCCTCCCCGGCAGCAGCGGCTCGAAGTAGATACTCCGCCCGCCGTTGTCGTTGAGTATCAGTCCGTCATCACGTAGCTGTAAGCCCGGATATCAGAAAGGCGCTTTCAGCCGGGGCCGAAAACGCCCACCGGTGCAGGCGTCTTCGTCCGGTAGCTGCTGTAGGTGCGGGAGAGAATGAACGGCAACGGGCCAAGACAGCGCAAGGTCAAATCTCGCCGGGCAGCACCTTCGCCCCCAGCAGCGGATTTACCGGGTTGCCCGAAGTCATCGCCGGACACACCGAGCACGCCACGCCGGTGGGCGCCATGGTCTTACCTGCCGAACCCTGGACAATGGGACCGCCATGCTAGTCATATCTCCTGACGCGCCCGCTGGTTTCCGCTCATATAAAGTGCCCTTTTAGTTATTGTTCATATCCGCAATGTTAGCAACAAAAATAAGGAAGCACACAAGACCATTAATGTATTTATATGTCTTTTCACGCCGACTTTATTTTGTTCTCAATCAGCAACAACTGTTATTACGGTCGCTTTCAGTATTTTATTAAACTAACATTTTGCTTTAGATGGAATTCATCATCAGCAAATTCACTATATGGATAATATCCATTCAACGCATATGATTTATGATTTTATTAGTCTGAGTTATTTTTGTAGGGCTATATTTAAATCAATAAACTCCACCGATTCAGATTAATATGTAATAGAAGATAGAAATCGCAATTCAATAACATCATCAATGCGGAAACATATTGTAGAATTAATTTAAACAAGGCGTTCCATTCAACCAGAACGCCCTTATTTACTCTCATCACCGCAAACTGCACAGACAGCGCCTTACCCACCTTAACCAGTCGCGCACCCAGCCAGCCGCCAGCGACAGCGGCAGCGCTCCGCTGCACATGGGGAACAATCCAATCGCAGTCTGGCTCCACGGAAAATCAAACGCTCGCCACCCAGCACTGCCAGCGCCGTTTCCGCACCAATTGCGGCCACCAGGCCGGAAACAAGCCAAGCATGGCGAATCACACCACAACGTGGTACGCAGCAGTTTTTCCCGCACCGGTGTGCGCCACCACCAGCTCCTGATGACGCTGACGCATTTCCCACCTGCACCTGTGCCAGCAACAGCAACATACCGCAGGCGGTGACCAGTACCACCATCACTTCCAGCGCCCGACACCTGCTCCAGCGCACTGACCGACCTGTTTCAAAATCCAGCGCCAATATCTAACGGGCTAATGGTCGGGAACTGGCGGTTGGTGTGTCAACATGCCGTTGCCATTCTCAGCGGAAGCGGTAAGCCAGCTCTGCGGTTGCCGTCTAATGCCCCTTCAGGAAAATAAAATAGAAATTAGGCCTGGAACTTTCCCAGTCCACTTTGCTGGGCTGGCCACTTTAGCGCGGAACTCTGGGTATCGCCCATAAAGTCACGGTATCACCGAGGGCAACGTTTAAGCGTTTCGCCAGCCCTCTTCCATCGACACTTCATCGGCTTTTGGCGGCCAGTTACCGGCGACAATCGGATTATGATCAGACGCGTATTTTGCCAGGTAGATTGAGTTCGCGGTTAAGCGCTATCATCTTCATTACCTTCTGTCGGCTTATCGTTAATCGCCGTCAGCCGCGCCCACTACCGGATAAAACGATTCCAGGACTATCTGATGTTTTCGCGAGGAACCTTTTAGCAGTGCTACCTGTTCTGTGGCGATGTTGAATTAAAAGTAGTTCGGGCTTTCTGGAGGTAGCTGCTGCCGGCGGTCGAGCAGATCGCCACCAACACCAACAGCAGTGCCAGCAGCATAAAGAGCGAAAATGCCAGCTGACTTAACGTTGACCACGGCTGACGTAACGGGCGGCTAACGCCGAGCGCAAGAGCGGCAATTTCAGCGTCATGCGGCAGAAGTACATTCCAGCAGCATCCAGCCCAGCACACCGCTGCTTTCGTAGTACTACCGCGCCCGCCAGCACCGCTAAAGCAGCATGCTGCCACCCATTAATCCGGCGAGCAACAGCACAGCCACCACACTGACAATCGGCAGATAAAACTTCCAGCAGCCAGACGTTCGCTACCACATCATTACGTAATACGCGTAAAGGCTGCGTTGCCAGCAGCAAGCGATATGGTCGTAGCCCACCAGCAGCGAGATGACCGTCATGGTGCCAAGCGCCCACAGCCACGGCGAGGCTGGCTGGCGGTAGTGCAGCAGGCAGAACGGGCTTGAGCAGCACCATCAACACGTTTTCGAACAACAGGCCTATGGCCCGGCCCCACCGGTAACGGCTGACGTCAGCACCATCAACCACTGACCGACGATTAGCTTACGCAGTTAGCTCGCCCTGCCCCCAGCGTTTTGAGGATCGCCACCAGATCGTAGCGACTGCGACGGTAATGATTCATCGCTACCGCCACCGCTGCCACTGCCAGCAGCAGGTCAGAAGCGCCAGCAGCAGGAACTGTTACGGCGTTCCATCGATCGCCCAGCGCGCCTTCGTCCTGTTCCAGACCGTACCAGCGTTGTTCGGGTTTTAAGCTGGTAACAACCATTTCATAGCCGTCGAGCTGGTTCTCGTTACCCGCCCAGTTTATAACGCCAGGTGACCCGACTCCCCGGCTGCTGGCTCCGGTTTTATCGACATCCGCCAGTTCATCACATCAGACCTTGGAGCCATCTGGAAGGGTTAAAACCGGAATCCGGTTCCTGAATCACCTTCTCCGGCAATCCGCAAAGGTATCGCCCACGTCAATGGTGTCGCCCGTTTTCAGGTTAAGCAGTGCCATCAGGCGTAGGGGCCCAGCAATACGCTGCCCGCCTGCGGTTTCAGGCCAGAGTTGGTTGCAGATCGCCATACATCGGGTGAATGTCATCCACCCGCTTTGACGTTCGCCAGCTGCGGTGTGTCGCCTGCAAAGGTCATTGGCGAAAGTCAGCTTGCCGGCTTTCCAGGCCGCGCTTTGCTTCCTCCAGCCACGCTTGCGGCACTTCGCGTGAACTGCGCAACGCCCGATCGCCCGCCATAAACTCACGGCTTTGCTGGCTTATTCTCCATGCGATCGCTGATGTTGCCCAGCGCCAGCACAGGCCACCGCCAGGCTTAAGCGCCAGCCAGACAATTAATAGCGACGGCGAACGCCATTCGCGCTGGGAACCAACGTGCAATCATGCTTCCTCCTGCAACTGCCCCGTTCACCAGCCCAATGGCAGCGGTCGCAGCGCCGCCAGTTGCAGGTCGTGGGTCACCATAATCAACGTGGTGCCATGTTTACGGTTGAGGAAAACAGCAGGTCGGCAATTTTATCGCCCGTCTGGCGGTCAAAGGTTGCCGGTTCGTCGGCAAACAGCATCAGGTCGACCATTAAAGGCTCGTGCCAGCATATCTTCCTCGTTGCTGTTCACCGCTGGAAAGCTGTGCCGGAAGATGATCAGACGTTTACCCAGCCCTAACTGTTTCGAGCAACGCTTTCGCCCCGTTACGACTTTCCGCTACTCTCCACCGCGCAGCAGGCCAGGAAGCTCGACGTTTTCCAGCGCGTTAAGGGTAGGAATTAACATAAATGACTGAAAAACAAAGCCGACGTGCTTCGCGCTTAACTTTGCCCGCGCTTCTTCGTCCATATTATGTGGCGGTTGTCCCTGGAGCTCACTTCGCCACTGCTGCCGTCATCAAGCCCGGCGAGGATCGCCAACAAGGTTGACTTACGATCCCGACTCGCCCACCAGTGCGATGGTCTCGCGCGTTTGACAACCAGCTCAACTCGGTGAGGATGGAGAGTTCATACTCCCTGACCGACGGACTTCTTAAGATGATGAACTTCAACAATGTTTTCGGCATTTGCCCTTCCTGTTCCTGGTCCTGTTAACCTTCCGTGCCGCCGCAGCCGTTATTGATTCTGGGTGATAGCCTGAGCCGGGTATCCAGATGTCTGCCAGCGCTGGCCTGGCCTGCCTGTTGAATGATAAGTGGCAGAGTAAACGTCGGTAATTAATGCCAGCATCAGCACGGCGACACCTCGCAACAAGGACTGGCGCCTTCCGGCTCTGCTGAAACAGCATCAGCCGCGTTGGGTGCTGGTTGAACTGGGCGGCAATGACGGTTTGCGTGGTTTTCGGCCGCAGCAAACCGGTGGCTGCGCCAGATTTTGCGGATGTCAAAGCGCCAACGCTGGACATTGTTAATGCAAAATACGTCTGCCTGCTGACGCTATGGTCGCCGTTATAATGAAGCCTTTAGCGCGCCATTTACCCCAAACTCGCCAAAGAGTTTGATGTTCCGCTGCTGCCCTTTTTTATGGAAAGGTCTGCCTCAAGCCACAATGGATGCGGGATGACCCAGGTATTCATCCCAACCGCGACGCCCAGCCGTTTATTGCCGACTGGATGGCGAAGCAGTTGCAGCCTTTAGTAAATCATGACTCATAAAGCAACGGAGATCCTGACAGGTAAAGTTATGCAAAATCATTAATTACCGGATGTTCCAGTGGAATTGACACCAGAGCGCTCGAATTAAAACGCCAGGGTTTTCATGCTGGCAGGTTGCCGGAAACCGGATGATGTTGAGCGCATGAACGGCATGGGATTTACCGGCGTGTTGATCGATCTGGATTCACCAGAAAGTGTTGATCGCGCAGCAACGAGGTGATCGCCTGACCGATAATTGTCTGTATGGGATCTTTAACAATGCCGGATTCAGCATGTATGGCCCCTTTCCTGCATCCAGCCCGTGCGCAGATGGAACAGCAGTTTCCGCCAACTTTTCGGCGCACCAGCTCTGTGCGCCTGTTACCCGCGATGTTACCGCACGGTGAGGGCGTATTGTGATGACATCATCGGTGATGGGATTAATCTCCACGCCAGGTCGTGGCGCTTACGCCGGCCAGTAAATATGCGCTGGAGGCGTGGTCAGATGCACTGCGCATGGGCTGCGCCACAGCGGAATTAAAGTCAGCCTGATCGAACCCGGTCCCATTCGTACTCGCTTCACCGACAACGTCAGCCAGACGCAAAGTGATAAACCAGTCGAAAATCCGGCAGCCGCCCGCTACGTTGTTGGGACCGGAAGCGGTGGTGGACAAAGTACGCCATGCTTTTATTAGCGAAGCCGAAGATGCGCTATCCGGTGACGCTGGTGACCTGGGCGGTAATGGTGCTTAAGCGCCTGCTGCCGGGGCGCGTAGTGGAGGTTAAACGCAAGCAGACGCCGAAGATAGAAACGT
+>c65d1bb9-c11b-4d4e-bba5-c821e0eb7758
+TTGGTGTGCTTCGTTCTGATTACGTATTGCTTTTCTGTTGGTCGCTGATATTGCGGCGTCTGTGGAGGTGTTTTAACCTGATGGCCGGACGTCACCCGCCAGGGCACACCGAACAGGCCACGCCAGTGGGGGCACTGATGCGTACCCAGCTGAACCTGAACAATGCTACCGCCATGCCGTCATCGCCTGACGCGCCGCCAGTTTCCGCTCGTCTGCTCATCCTTGTTTTATCGGGTTATTTGTCTGCTGTAGGCGAAGCCTAGTTATAAAGAAAGCCTTACGGTGAGATATCTGTCAGATAAAGAACAATGGGAAAATATTTATACCTGTTTCGCTTAGATATATGTTTCGATTGGTATAACGATAATACAAATGTTCCTCTGACATCTTCACCGGTACAAAACCGCCAGCGTTTCCGCTGGCGGACAATATTCAAAACTCGGCAATAATAAATCACGGATTGCCTTTTCGGCCTGATCCATCCCTGGTTTATCGCTGGTTCAATAGACGCGATACGGAAATGCCTGTAAAGCGGGCGCGGTCTTTCCAGAAAAGCATGAAAGGCACAGGGTATGCACAACCGCATAAGTGCGGCGTAAAGATAAATACAGGAATCTTCTCTGCAGAGTTCCGCCTTTCTCCCCCTTGCATCCTGCGGTGGAATGGCTGGAAAAATGAATTGTTTAATCTGATAGAAAACCAGTACCGCCTTTTGTGTAATTTATACTCATCGACCACTTATTTTGCCATTAGAGTAGTTTATTTACATTCTCATCCCGTAAACAAGACACAAAGTTAAATTAATACTAAACATTAGTTGAAATCATGGCTTTGCCATTTTTGTACTTTTACACCCCGCCCGCAGACTTTTTGCAAATCTTTACGTAATTCCTTCAGTATACTTTTAGGCCACTGGAATTTTTTCGGGGTACAGGCGTGATATTGACATGTGCTGATGTTTTTTATTACTGCGGGTTATCTGGTTTATGCCTGATGATCAATCAGAAGCGTTCAGTGTGGCTGCGCAAAGGTTCTTCACTGATCGCCACGTTTGATTTTTTACTGGTAATTGGCGGTGCTGGCGCGTCCTTTAGGCAGCGGGCTTTGGCGCAGCAATTATATTCCTATCTTCCCGGTACAACGACGTTGACGCGTACTTTTCGCGCACTTGGCGTCTCTGACGTGAGAGATGAACTGGAAACAATATCTTTGTGCGCCATTTTCTCGGCTGAGCAACACCGGGCTGGCGATTCTTTTTATGCAACGGTCGGCACTATCTGCCGCTTAATCCCCAGCAGTTGCCAGGGCTGTCCGTAGGATCTGGCGCTGGAATACCGCCATCCAGCTTTGTATTCACCCTTCTTCGGCAATCTTATGGCGGTGAAACCACGTTGAGCTATTTCAGCGAAACCAGATGGCGGGCTTAACGGTGCAAAACTTTCTTTCTGCCGCCAGCCAGTTGCGATTTACCGCCCTCTGTCGTTTACCCGCCAGAGCATGAAACCACTCGAATGCCTGGGTCGATCTACGCATCACGTTGGTGCTGGTCTGGCATTGTTGGTCAGGTTCAGCTTACCCGAAGCAGACGTCGAGAAGATATGACCGCA
+>0d624d4b-671f-40b8-9798-84f2ccc4d7fc
+CTCTTCAGTATTACTTCGTTTCAGTACGTATTGCTTCTTGCCTGTCGCTCCTATCTTCGGCGTCTGCTTGGGTGTTTTAACCTCGGCTCCAGGTCATCTGCCGGGTGCTGCCGTCGCATCCGTTGTCGTCGCCGGTAACTCACTGTGCGCGTCATCATGCTTGATGGCGATACTAATCTCCCCATGCGCGATGTCTCCGATACCAATACTGCCCGGTTCATCATATTCCGGCAGCTCTCCAGCTGATCCAGGACACCACCGCCGTCAGCTGGTTCCGTCGATTATAGTAAAATTTCGTCTCCCGCCCGTCCGGTGTGGTGATGTCCGTGATATCGCCGGACACCACATTCAGACGTACTCTGTCCTCCCGTCCCGCCGCGTCCGTCTGCGCCGTGAGCCTTCCTGCCGCGTCATACCGCTGCGCGTGAGCGCGCATCCGCCAGTTCTTTTTTCACCGTTTCAGCCCAGTACACGCCTTCTGTATGCAGCACCTCACGCCGGTTCAGGCTGTCGGTGACGGTGATGGTCCTGCTCATAAAGATAGCGGTAAGCAACCCTGCAAGGTTCAGTTGCTCCACCACCCGCCCCGTATCGTCGCGGTGGCATCTCCGGCTTCCCGCGTAACGGTGCGCCACCATCCGGCCGGGTGCTGCGCGTCATACGTGACGCGCACCTGCGTAATGCTGCGGTCATATACCGCCAGCAGTTCACCGGCTTCCGTATGCGTGTACCGCACCAGTGGCGCAGCGGGCAGGCTCTCCAGGTATCAGGTCGATTGCATCAGCCACACCGCCGAAAGGCGGATACCCTGTCAGGGCCGTATTCAGTACCGGGCGGTGTCGGGGTGCTGAGGCTGAAGGTGGGAACTGTCAGAAGAAGATAGCGAAAGAGGTGGGCCTCTTCCGCGCTGCGCCTGCGTGGTCTTCAGACGGAACTCCCGCCCGGCACCGTCCGTCGCCGGTGATTCCCCGGCCAGGTCTGGCGGCCTCACGCCGGTACGTCAGCGTCAAGCGGTCGCCATCGGTAAGCACCGAGGTACGGCAGCAGCGGCGCTGGCAGTACGTCCTCAGCACCGGCACCCGCTCAGACCACCCCAGTATCTGGCCCTGTGCGCTGTTGGTCGCCAGGTAAAGATGCGGGCTTAACCGGATATCCGGCAGCAGCGCCCCTGGCACCGCGCCAGCCTGTAGCCGTCCGGCTGGCTTGCCTTACCACCGCGCACCAGCCACATTGACTCCTGCGGCTGTACCGCGCCTCCCCAGCAGCGGCGGCTCAGAGTGAATGCTCCGCCCGCCGTTGTCGTTGAGTATCAGTCCGTCATCACGTAGCTGTAGCGGATATCAGAAGGCGCTTCCAGCCGGGGCCGAAAGCGCCCACCGGTACAAGGCGTCTTCGTCCGGTAACTGCTGTAGGTGCGGGAAGATGAACGGCGGCAGCGGGCCGGGCAACGCAAGATCCCGTCTCGCCGGGCAGCACCTTCGCCCCAACAGCGGATTTACCGGGTTGCCAGAAGTCATCCCGCCCGGACGCACCGAGCACGCGCCACGCCAGTGGGCGCCTCAGTCACCACCTGCCGAACCCTGGACAATGGGACCGCCATGCTGAGTCATATCTCTGACGCGCCGCTGGTTTTCCGCTCATAAAGTGCCTTTTGGTTATTGTTCATATCCCTGTGTTGGCAACAAAAAAAATAAAATGACACACAAGACCAGCTAATGTATTTATATATTTTTTCACATAAACTTATTTGTTCTCAATCAACAACAACTGTTATTACAGGTCACTTTCAATATTTTATTAAGCTAACATTTTAGCACAGATGAATTCATCATCAACAAATTCACTATATGGATAATATCATTCAGCATATGATTTATGATTTTATTAGTCTGAGTTATTTTTGTAGGGCTATATTTAAAATCAATAAACTCACCGATTCAGATTAATATCAACTTAATAGAAAGATAGGAAATCACCAATTCAATAACATCATCAATGAAACATATTGTAGAATTAATTTAAACAAGGCGTTCCATTCAGCCAGAACGCCCTTATTTACTCATCACCGCAAACTGCCTGAACGGCGCCTTGCCTTAACCAGTCGCGCAGCCAGCCGCCGAAAAGCGACAGCAGCAGCGCTCCGCTGCACGGCCGTTTTCAATCCACAATCGCCAGTCTGAAAACCACGGAAAATCAAAACCTTTCGCCTGCAACTGCCAGCGCCGTTTCCGCGCAATTGCGGCCACCAGACCGAACAAAGCCAAGCGTGAACTCACACCCTGGCGTGAGCACGCAGCAGTTTTTCCCGCACCGAGTGTGCGCCACACCACCAGCTCCTGATGACGCTGACGCATTTCCCACCTGCGCAATGCCCTTAGCAATAACATACCGCAGGCGGTGACCAGTACCACCATCACTTCAGCGCCCGACTTACCCTGCTCAGCACCTGACCGACCTGTTTTAAAATCAGCGCCAGTATCTAACAGGCTAATGGTCGGGAACTGGCAGTTGAGTTAATGTCAACATGCCGTTGCCATTCTCCCAGCGGAAACTGAGTAAGCCAGCTCTGCGGTTGCCCGTCTAATGCCCTTCAGGGAAAATAAAATAGAAATTAAAATACCGCAGACTTTCCCAGTCCACTTTGCGCAGGCTGGTCACTTTAGCGCGGAACTCCTGGGTATCGCCCATAAAAGTCACGGTATCACCGAGGCAACGTTTAAGCGTTTTCGCCAGCCCCTCTTCATCGATACTTCATCGGCTTTTGGCGTGAAGTTACCGGCGACAATCGGATTATAGATCGGGCCGCGTATTTTGCCAAATTAAGATTGAGTTCGCGGTTAAGCGCCTCATCTTCATTACCTTCTGTCGGCTTATCGTTAATCGCCCGTCAGCCGCGCCGCACCACCGGATAAAACGATTCCGGGACTATCTGATGTTCCGCGAACGCACAGCGGTGCTACCTGTTCTGTGGCGATGTTAATTAAAAATGGTTCGGGCTTTCTGGAAGTAGCTGCTGCTGCCGGCAGTCGAGCAGATCATACACGCAACACCAGCAGCAGTGCCAGCAGCATAAAGGAGCGAAAATGCCAGCTGACTTAACGTTGACCACGGCTGACGTAACAGGCAGTAACCGCCAGGCGCAGAGGCAGCGATTTCAGCGTCATGCGGCGAAGTACATTCAGCAGCATCCAGCCCAGCACACCACAGCAAAGCCAGTACTACCGCGCCCGCCAGCACCGCCCAAAACGGCGTAACGCCGCCCATTAATCCGGCGAGCAGCAGCACAAACCTACGCGGCGTCGGCAGATAAAACTTCCAGCGGCCAGACGTTCGCTGCCATCATTACGTAATACGCGTAAAGGCTGCGTTGCCAGCAACAAACGATATGGTCGTAGCCCGCAGCGAGATGACCGTCATGGTGCCAAAGCGCCCAGCCGGTAGAGGCTGAAACTGGCGGTAGTGCAGCAGGCAGAGCGGGCTTGAGCAGCACCATCAACACGTTTCGAACAACGGGCCTATGGCCTGGTAACGGCTGAAGCGTCAACTGCATCAGCCACTGACCGACGATTGGCTTACGCGGTTCATCGCCCTGCCCCCAGCGTTTGAGGATCATACCAGATCGTAGCGGCTGCGACAGTAATGATGATTCATCGCTACCGCCACCGCTGCCACTGCCAACCCAGCAAGGTCAGAAGCGCCGAAAGCAGCGGGGTTAAACGCAAGCAGACGCTTACCCAATATCCGGCAG
+>d4402dd6-1f80-4d82-9ce1-f4e7326e5054
+TTGGTACTTCGTTCAGTTATTGCTACTTGCCTGTATCGCTCTTCGGCGTCTGCGCGCGGGTGTTTAACCTCACCGCTTCTTTCAGCGCCTGAACGACCGACTGTTGAATTCGGAATAGCGCCAGTTGTTGTTTACGGCGGCTCATATTCGGTGCTCACTTCAATATCATCGGGAGAGAATGTCTTCGCCGGTGCCGAACGGGGATAAGGTCACGGTGCGCCAACCAACGCAGGTGCCCGGTCGCCAGGCTTAATGGCTGTAGGCCGTCCGTTGTGATGCCGGAATGGCAGCAGCTCTTTTGCACCACCAGCAGATGCGGCAGACGTTGCCATCACCGGGATAATCACCCGAAGCGACCATTCATAAACATGCAGAACGCCAAACGGTTCCAGAACGGAGAGTTGGCGCTTAATCCGGCAAAGGCGCTGCATTGTTGTTAGCGGCGGATGACACGGCGATACCGCCGCCCTTCGGCTCATGCGGGCCAGGGTTGACATGGCGCGTCGGCGTCGGTCATCATCGCCAACGCCGCGCCCATCCAGCACAGCGTCGGGGTAACCAGAATTGCCAGTGCAGTCGGTTTCATCTCGCGTGCGTCGATTTTTTTTACCCAGATATTCAGTGCGACCAATCATCCAGCCCGACAATAAGCTTACACCGCCAGCAGGACAAAACTGGCATCATGCCGTAGGGCGAACCGATACCGCCGAACACCACTTCGCAATTTGCATCGCCACATCGGCACCATGCCACCGAGAGCGGTAAACGAATCTGCATCCTGTCACCGCGCCACGAGCCGCAAATCGTCACGACCTGAAGCAGGCTACTGACCAGCACGCCAGGCAGCTCTCTTTACCTTCCATAAACGATGCTGTCCGTGCCCCGATGCCAACGAATGAGGATTACCCTGAACTTCTGCCCACATCACCACGCCTACGCAGATGACAAAATCGTGACATCGCCCACAACATGCGCCTGGCGGCAGCGATCGCCCTCACTTCACCAAGGCAAAACTGGCGCCGTTGGGATCAGAAGATCGCCAGCATCCTGCACCCGAAGTTGAAGTCAGGTGCGGTTGGGTTTTCAAACGGATGCGACGAGTTGGCGTTAAAGAAATACCGCCGTTAGTACCGAGCTTATCTTGATCTCGCTTCCTGAGAAGCTGCCAGGCCCCCAGGTAACAGCTGTTGCGCTCCTTCAACGGTATTACAGCCTGACGGGCAGAAAGTTTTACGCGCAGCGGTGAATAAAAACAGTGCAATCAACAACGCCACAGGGACTAACGCACCCATAACGTGATGCGTAGCAATGCTGGCGATGTCGCTGCACGGATGAGGGCAAAATCACCGCAATCCGCTGGCGGCAGAAGAAGTTTGCACCGTAAATGGCCCGCCGCTCCTGGCTGAAGCAAGCTCAACGTGGTTTCACCGCTATGGATTGCCAGTTAATTATTGGTAATAATGACGGTATTCAGCTTCAGATCCCACGACAACCTGGCAACTGCTGTGGATTAAGCGGCGAATAGTGCTGACCGACAACATAAAAACAGCACCGCCAGCCCCAGCATGTTGGGCCGAGAATGGCACAAAGATGTTAACCAGTTCATCTCACGGTGGGAACCAGAACGAAAAGTACGCGCTCAACGCCCGGCCAATACCGGGAAGAATGTCATTAATCAACCGCGTGCTGCTAAAAGGACGCCAGCACCATTAACACCAGTAAAACGTGGCGATCCAGTAGAACCCTTGCGCAGCCATCAGAACGCCTCCATTGATCGGGGGCGCCAACCAGATAACGAAAACCACCATAATACGCCGGTTAGCGCCTGCGCCACCGTGCCTCCAGTGGCCTAAAGTGATACCGGAAGGGTAGAATTCTGGCTGCAAAGATTTCACTGCAAAAATCTGCGGGCGGTGTAAAAAGTATATAAAATGGCAACCATGATTTAACAATGTTTAGGTATTAATTTGCTTTTGTGTAGCAATTACAGGATGAATATGAATATCAATAAGCATAAAGTGGTCGGATGGTAGTAAATTACTGCAAAAGGCGGTACTTATTTCATCAGATAAAACAAATTCATTTTTCGGTGCTTCGCAGGTAGATACAAGGAGAAAATTGTGGAACTCTACACAGAGAATATCCTGCATGGCTTATCTTTACGCCGTACTTATACGGTGCAGCGAGCGTTCTGGCGCTGCCTTTCATCGCTTTCTGGAAAGACCGCGCCCGCTTTTACCTTCTGCCTGCATCGCGTCTGGTCGAAAACCAGCGATAAACCGGTGTGGATGCTGGATCGAACGAAAAAGGCAACTGATTTTATTGATTGCTGGATTTTGAATACGTGTTGAAAACCGCCGAAACGCTGGCGGTTTTCAAAGATGTTCAAGAGGAATGGCCCGAACATCGATTATACCAATCGAAACATATATTCATGAAATATATAAATATTTTCCTAATTGTTCTTATCTGACAGATAATACTCGCTTAAGGCTTTCTTATAAATCTCGCGGGTTTCGCTAAGACAAATAACCGTCGAAAACAAGGATGAGCAGATGAGCGGAAAAACCAGCGGCGCGTCGAACATGACGCAATGCGCCAGCGTGTAATCCGAAGAGTTCAGCCGGGGTATCGGTGCCCCGGCGTGGCCTGTTCGGTGTGCCCGGCAGTGACGTCAGCCATCGGTCAATCCGCTGCTCGATTACCAGGTCCTTCCCGGTGAAACCGGCATCTTCTACCCGGCCGCTGCCGTTCATTCTCTCCGCACCTACAGCGGTTACGGACAAAAACGCCGCGCCGGTGAAGAGCCTCGGCCCCGGCTGGAAAATACTGCAGACAATCGCTTGGCTGCGCGATAACACGCTGATATCCGGCGGTGATTAACGGCGGCAGAAAGCCTGTATTTTGAACCTGTTTCCGGTGAGGGCGGTTGGCCGCAGCGGGTCGCGCTGTGGCTGGTGCGCGGCGGCGTGGCGAAACTGGATGCTGAAGGTCACCTGGCCACTCTGGCGAACCGGAAGAACTCCGCTTAAGTCCGCATCGTTATCTGGCGACCGCCAGTCCGCAGGGGGCCGTGGTGGCTATCGGCACCAGGTAATGAGCGAGTGCCGGAAAGCGGATGCTGCCTGCGCCGCTGCCGCCGTACCGGGTACTGATAGCCGGGCTGGTGGACCGCTTCGGGCGCACAGACGTTTACGCCGCAAGCCGCCATTCAGCGGCGAAATCACCGGCGTGACGGATGGTGCCGGGGCAATGCGGCTGGTACTGCCTGATACACCAGGCGCAGCGGGCAGAAGAAGCCCAGCAGCAGACCATTTCCGGCAGGACGGAATATAACTTTTCACAATGCCTGCCGGGTTACACCGAATATGTGGCAGGACAAGCGGCATCCGTCTATGCCGTGTGGCTGTGCGACCCGGAATACCGGAGAATTTGCCATACCGCGCCGCTTTGGTGCATATCGGCTGGACGCCCGCAGCGAACTGGCGGCGGTGTATGACCGCAACAATACACAGGTGCGCAACTTTACTTACGATGATAAATACCGGGGCCGGATGGTGGCGTACCTGCCGTCCACGGGCCGACCGGAAATCATTACCGTTACGACGGCGACAGCGGGCGGGTGACCGAACAGCTAACCGGCAGGCTTAAGTTACGTATCAGTATGGATAACCGCATCCGCATCACCGACAGCCTGAACCGCCGTGAAGTCCTGCGCACGCAGGGTGAAGGCGGAACAATGGTGAAAAAGGAACTGCGGACGGCAGCGTCACGCAGAGTCAGTTTGACGCGGTGGGCGAACTCTCGGGGCACAGACGGATGCGCAGGCAGGATAACAGAATACAATGATCCGGATGTGGTGACGGGCCTCATCGCATCACCGCACACTCCGGATAAGCGGGGCATCAGCGTTTATATCTTTAATAGCCAGTTAACGTCGGCCACCGGGCCTGACGGGCTGGAAATACGCCGGGAATATGATGAATGGGGCCGTCTGATTCAGGAAACTGCCCTGACGGCGATATCACCCGCTACCGTTAGATAATCCACACAGTGACTTACCTGCGCAACGGAAGATGCCACCGGCAGCGGAAAACCATGACGTGGAGCCGTTACGGGTGCTGAGTACTGACTGTTCAGTTGTAACCGCTGACCATGACCGTTTTGGTGGAAGTGACGGCGGTGCACCGCGAGGAAAGGCTGATCAGTATTACCGCGCCACGACTAGCCGTGGACGGTTAATTTGCGTGAAAGACGCAGGGCCGCGAAACGCGGTATGAATACAGCATACCGCCGGTGACTGACCACCGTCATTGCCCGGACGGCAGCAAAGCGGGACACAGTACGATGCGTGGGGAGAAAACCATCTGTACCACGCAGGGCGGTCTGACGCGCAGTGTATGGAATACGATGCTGCGGACGATCACCCTGACCAGCGTGAAAACAGCAGCCACACCGCCTTCGTTACGATGTACTCGACCGGCTGTTGGAAACCGGCGACGGCCGCACACAACGTTATACCACGACTGACCGGCAAACTTATCCGCAGCGAGGATGGGGGCTGATCACCCTAACATATGACGAAGAGCAGACCGCCTCACGCACCGCACCGTGAATAGCGAAACCGGTAAACGCGTATGACGAACGCGGCTGGCTGATGAACATGTCAGCCGCCATCGGCGAAGGAACACCGGGTGACGGTCTATGGTTATGACGAAGTAAAGGCCGCCTCGCCGGTGAACACCTGACGGTTGCATCCGCAAGACGATGAACTGTACTCACGGCGGCGGACCTTGAACATGCGTACAACGCACGGGACTGACGAACCGCTGTATACCGGACAGCCGCCGTGGAATGGCTACGACCTACGGCAGCGGCTGGCTGTCGACGCTCAAACGTACACCGCTGGTGGAGTACACCCGCGACCGCCTGCACCGAAACGCTGCGCTTCGGCCGTTATGAACTCACCACCGCTTATACCCTGCCGAGCGGTTACAGAACCAGCACCTGAACAGCCTGCTGTCTGATACGATTACACCTGGAACGATGACGCTCATCCCTCAGCAGCCGCGCCAGACCGGGTTACAGCTTCTGGCACCACCAAACAGGCAGGCCGGCGTTCTACACCACAGCGAATCTGGATATCCGCATCCCGTATGCCACAACCCGGCAGGTAACCTGCCGAGCCAGAACTGCGCGGACGGCGCCCTCAGCGACAATGACCGGATAACCGTATCTCGCCCGTGACGCGCACTATCTTTACCGGTAGCATGACCGTCACGGCAGGCTGACGGAAAACCGACCTCATCCCGGAAGGTTATCCACGCACGGATGATGACGCACCCACCGGTACCATTATTACGACAGTCAGCGCTTCGGCCGGTGCACCGCAGACCTAATGCCGACCGCTGGTCGAAAGTCGTATCTTTACGTCCGCTGGGCGCAGGGTGGCAAAACGGGTATAATGGCGAGGTTAAACGCCGCAAACGGACATATGCCGAAGATAGGCGG
+>723b3ed8-ede7-42bd-89c3-d269619eea3d
+TTGTTGTACTTCGTTCAGTTACGTATTGCTACTTGCCTGTCGCTCTCTATCTTCGGCGCGTCTGCTTGGGTGTTTAACCTTGCCGATCAGCGGAATATCAATACAACAATGCATACAGCTGGCGGCGATACTTCGACGCCAGTGCATCACCCGTACCCAGCGCAGGGATCTCCTGGAACGTTTTACGCGTCTGACCGTCTGCGGCGGTAGAGATCTTTACGCAGATGCCGAACAACAACTCCAGCGCCTCTTCATTGCGCCCAACCTGATGCAGTTGCAGCGCCCGGTTTGCGTCGCCAGTGCGGCATCTTCTGGATCTCCGCCACCTGCTGTTACAGCTGTTGAGATTTCCGGCGTATCAGCCGCCTGCTGGCACCAGTTCGGTTTGCGCCACCAGCCCCTGGCTGTAGGTGTCCTGATCCTGCAACGGAATGGTTTTCCAGCACCGCTTCCGCATCTTCAGAACGGTTCAGCGCAATCCAGCGTTTCTGCCAGCAGCAGGCCGATCTCCCCGTTCTGATTCGACAACTGCCGGGCGTCTTTCAGCAATAGCGGGGCATCGGTGTAATTGCTTTCCTGCATCAGTTGCATCGCCTGCTGCGCTTTCATTCTTCTTCGCGCAGCAGCACTTTATCCAACAGGGCGCGGATCGCCTCTTCCGGTTGCGGGCCTGGAAGCCATCCACCGGTTGCCGTTCTGGAACCGAATGCACGAGGTCGGAATCGCGCAGACCAAACTGCGCGGCAATCATCTGCTCCGTCGCAGTCAACTTCGCCAGAATAAATTGCCCGTTGTACTGCGCCGCGAGGCACCAGGAGTAGGTTAACTTTACCGTAGTGCTGGCTACGTTCAGACCAAAATAGAACAGCACCGGAGTGGTCATCGACTGTTCAGAACCTGTTGCAGGTTAGATTCGTTAATGTTGACAATATTTTCTACGGACATGGAGTCGCTCTCTGTTGTCGATATTTTCTTTGACATGGGGGCTTAAGCGCGCGCTTCAACTCACCTGCAATATTTTGTCCATCACGCGCCCCGGCAGCAGGCGCTGCGCTTTCATTACCGCCCAGGTCACCAGCGTCACCGGATAGCGCATCTTCGGCTTCTCGCTAATAAAAGCATGGCGTACTTTGTCCTACCGCTACCGGTCCCAACGTAAAGCGGGCGGCGATGCCGGGATTTTCGACTGGTTTATCACTTTTGCGTCTGGTTGACGTTGTCGGTGAAACGAGTACGAATGGGACCGGGTTCGATCAGAGCTGACTTTAATTCCGCTGTGGCGCAGCTCCATGCGCAGTGCATCTGACCACGCCTCCAGCGCATATTTACTGGCCGCGTAAGCGCCACGACCCGGCATTGAAGTTAATCCCATCACCATTGATGTCATCACAATACGCCCTTCACCGTGCGGTAACATCGCGGGTAACAGGCGCATGGTGACGCTGGTGTGCGCCGAAAAGTTGGCGGAGAACTGCTGTTCCATCTGCGCACGGCTGATGTTAATTGGAAAGGGCCATACATACCCGAATCCGGCATTGTTAAAGATCCCATACAGGAACCAGGTATCGGTCGGGGCGATCACCTCGTCGGCTGCGCGATCCAGCACTTTCTGGTGAATCCAGATCGATCCAACCGCGCCGAGGCTGGAATCCCATGCTGTTCGTACGCTCAACATCATCCGGTTTCCAGCAACCTGCCAGCTTTACTTAAGAAAACCCTGGCGTTTTAATTCGAGCGCGCGCTTTCCAGGCCAATTCCACTGGAACATCCGGTAATTAAGACCGATTTTTGCATAACTTTACCTGTCGCGGGATCTCCGTTGCTTTATGAGTCATGATTTACTAAGGCTGCAACTTTCTTCGCCATCAGTCGGCAATAAACGGCTGGGCGTCGCCAGTTGGGATGAATACCGTATCCTGCATCCCGGTAATGGCAAAGTGGAGCCTCTTCCATAAAAAGGGCAGCAGCGGAACATCAAACTCTTTGGCGAGTTTGGGGTAAATGGCGCTAAAAGGCTTCATTATAACGGCGACCATAGTTTGCAGGCAGACGTATTTGCATTAACAATGGTTCAGCGTTGGCGGCTTTGACATCCTGCAAAATCTGGCGCAGCGTTTGCTCGGTTGCTGTGGCTGAAAACCACGCAAACCGTCGTACCATAGTTCAGCCAACAACGCGGCTGATGCTGTTTCAGCAGAGCCGGAAGGCGCATGATCCTTGTTGCAGGTGTCGCCGCTGGTACTGGCATTAACTACCGACGTTTTTACTCTGCCGCCCATCATTCAACAAGGCCAGGCCAGGCCGCGCTGGCAGACATTCGATACCCGGCGCTCAGGCTATCACCAGATCAATAACGTGTCCTGCGGCGTACGGGAAGGTGCTGGGACCGAAGACAGGAAGGGCAAATGCCAGCGGAAAACATTGTTGAAGTTCGTCATCTTAAAGAAGTCCGTCGGTCGGGAGCATGAACTCTCATCCTCACCGGAGTTGAGCTGGTTGTCAAACGTGGCGAGACCATCGCACTGGTGGGCGAGTGGGATCGGAAATAAATCAACCTTGCTGGCGATCCTCTCGCCGGGCTTGATGACGGCAGCAGTGGCGAAGTGAGTCTGGTGGACAACCGCTACATAATATGGATTGAAAGCGCGGGCAAAGTTGCGCGCGCGAAGCCGTCGGCTTTGTTTTCAGTCATTTATGTTAATTCCTACCCTTAACGCGCTGGAAAACGTCGAGCTTCCGGCTCTGCTGCGCGATGAGTAGCGCGGAAAGTCGTAACGGGGCGAAAGCGTTGCTCGAACAGTTAGGGCTGGATAAACGTCTGGATCATCTTCCGGCTTTAGCTTTCCGGCGGTGAACAGCAGCGGTAGCGCTGGCACGAGCCTTTAATAGTCATTCCTGATGTTATTGCTGTTTGCCGACAGACCCACGGCAACCTTGACCGCCAGACGGGCGATAAAATTGCCGACCTGCTGTTTCCCTCAACCGTGAACATGGCACCACGTTGATTATGGTGACCCACGACCTGCAACTGGCGGCACGCTGCGACCACGCTGCTTACGGCTGGTGAACGGGCAGTTGCAGGAGGAAAGCATGATTGCACGTTGGTTCTATGGCGCGAATGGCGTTCGCCGTCGCTATTAATTGTCTGGCTGGCGCTAAGCCTGGCGGTGGCCTGCGTGCTGGCGCTGGGCAATATCGGCGATCGCATGGAGAAGGGCTTAAGCCAGCAAGAAGCCGTGAAGTTTACTGGCGGGCGATCGGGCGTTGCGCAGTTCACGCGAAGTGCCGCAAGCGTGGCTGGGAGGAAGCGCAAAAGCGCGGCCTGAAAGTCGGCAAAGCTGACTTTATACAATGAACCTTGCAGGCGACACACCGCGGCTGGCGAACTTGTCAAAGCGGTGGATGATATCTACCCGATGTATGGCGATCTGCAAATAATCCCTGGCCTGAAACCGCAGGCGGGCAGCGTATTACTGGCCCCACGCCTGTCGCTTTCTTAACCTGAAAACGGGCGACACCATTGGCGTGGGCGATGCCACCTTGCGGATTGCGGAGAAGTGATTTAGGAACCGGATTCCCGGTTTTAACCCCTTCCAGATGGCTCCGCGTCTGATGATGAATCTGGCGGATGTCGATAAAACCGAACCATACGGCCGGAGTCGGGTCACCTGGCGTTATAAATTCGGCAACAGCGAGGCCAGCTCGACGGCTATGAGGAAATGGATTTGTTACCCCTCAGCAAAGCCCGAACAACGCTGGTACGGTCTGGAACAGGACGAAGAGAAGGCGCGCTGGGGCGATCGATGGAACGCTCACCAACAGTTCCTGCTGCTGGCGCTTCTGACCCAGCACTGCTGGCAGTGGCAGCGGTGGCGGTAGCGATGAATCATTACTGTCGCAGTCGCTGATCTGGTGGCGATCCTCAAAACGCTGGGGGGCAGGGCAGGCGCAACTGCGCGTAAGCTAATCGTCGGTCAGTGGTTGATAGTGCTGACGCTTTCCAGCCGTTACCGGTGGGGCCATAGGCCTGTTGTTCGAAACGTGTTGATGGTGCTGCTTCCGGCCGTTCTGCCTGCTTTACTACCGCCAGCCAGCTCTGTGGCCGTGGCGCTGGGCGCCAGCACCATGACGGTCATCTCGCTGCTGGTGGGGCTACGACCATAATCGCTTGTTGCTGGCAGCGCAGCCTTTACGCGTATTACGTAATGATGTGGTAGCAGAACGTCTGACCCGCTGAAGTTTTATCTGCCGATTGTCAGTGTGGTGGTTGTGCTGCTGCTCGCCAGTTAATGGGTGGCGGCATGCTGCTTTGGGCAGTGCGCTGGCGGGCGCGGTAGTACTGGCTTTGCTGTGCGGTGTGCTGGGGCTGGATGCTGCTGAATGTATACTTCGCCGCATGACGCTGAAATCGCTGCCTCTCTGCGCCTGGCGGTTAGCCGCCTGTTACGTCAGCCGTGGTCAACGTTAAATTGACTTTCGGCATTTTCGCTCTCCTTTATGCTGCTGGCACTGCTGCTGGTGTTGCGTGGCGATCTGCTCGACCGCTGGCAGCAGCAGCTACCTCAAGAAGCGAACTACTTTTTAATTAACATCGCCACCAGAACAGGTAGCACCATAAAGCGTTCCTCGCGGAACATCAGATAGTCCCGGAATCGTTTTATCCGGTGGTGCGGGCGCGGCTGACGGCGATTAACGATAAACCGACAGAAGGTAATGAGATGAGGCGCTTAACCGCGAACTCAATCTTACCTGGCAAAATACGCAGCCCGATCATAATCCGATTGTCGCCGGTAACTGGCCGCCAAAAGCCGATGAAGTGTCGATGGAAGAGGGGCTGGCGAAACGCAAACGTTGCCCTCGATGATACCGTGACTTTATGGGCGATACCAGGAGTTCCGCGCTAAAGTGACCAGCCTGCGCAAAGTGGACTGGGAAAGTCTGCGGCCTAATTTCTATTTTTATTTTCCCTGAAGGGGGCATTAGACGGGCAACCGCAGAACTGGCTTACCAGTTTCCGCTGGGAGAATGGCAACGGCATGTTGACACAACTCAACCGCCAGTTCCCGACCATTAGCCTGTTAGATATTGGCGCGATTTTGCAAACAGGTCGGTCAGGTGCTGGAGCAGGTAAGTCGGGCGCTGGAAGTGATGGGTGGTACTGGTCACCGCCTGCGGTATGTTGCTGTTGCTGGCACAGGTGCAGGTGGGAATGCGTCGGCGTCATCAGGAGCTGGTGGTGTGGCGCACACTCGGTGCGGAAAAACTGCTGCATTACCACGTTGTGGTGTGAGTTCGCCATGCTTGGGTTTGTTTCCGGCCTGGTGGCCGCAATTGAATGCGGAAACGGCGCTGGCAGTGTGTTACAGGCGAAAGTGTTTGATTTTCCGTGGGAGCCAGACTGGCGATTGTGGATTGTTCTGCCGTGCAGCAGGCGCTACTGCTGTCGCTTTCGGCGGCTGGCTGGGTGCGCGACTGGTTAAAGAGAGTAAAGGCGCTGTTCAGGCAGTTTGCGGGGTGATGAAGTAAATAAGGGCGTTCTGGTTGAATGGAACGCCTTGTTTAAATTAATTCTACAATATGTTTCGTGATGATGTTATTGAATTGGTGATTTCCTATCTTTCTATTGCTGATATTATCTGAATCGGTGGAGTTTATTGATTTTAAATATAGCCCTACAAAAATAACTCAGACTAATAAATCATAAATCATATGCGTTGAATGGATATTATCCATATGGTGAATTTGTTGATGATGAATTCATCTGTGCTAAAAATGTTAGTTTAATAAAATATTGAAAGTGACCTGTAATAACCGGTTGTTGATTGAGAACAAATGGTTATTAATGAGAAAAATATATAAATACATTAGCTGGTCTTGTATTGTCATTTTATTTTTTGTTGCTAACACAGGGATATGAACAATAACTAAAGGGCACTTTATAGAGCGGAAAACCAGCGGCGCGTCGGGAGATATGACTCAGTATGGCGGTCCCCATTGTCCAGGTTCAGCAGGTGTAAATTGGCGCGCCCACCGGCGTGGCGTACTCGAAGTGTGTCCGGGCGGGATGACTTCAGGCAACCCGGTAAATCCACTGCTGAGGCAGAAGGTGCTGCCGGCAGGACGGACCTTACGCTGCCAGCCGCTGCCGTTCATTCTCTCCCGCACCTACAGCAGCTACCGGACGAAGACATGCACCGGTAGGCGTTTTCGGCCCCAGCCTGAAGCGCCTTCTGATATCCGCTTTACAGCTACGTGATGACGGACTGATACTCAACGACAACGGCGGGCAGACATTCACTTTGAGCCGCTGCTGCCGCGGTGTACAGCCGCAGTGAGTCAATGTGGCTGGTGCGCGGTGGTAGGCAGCACAGCCGGACGGCCCATACGCTGGCGCGGCTGTGGGGGCGCTACCGCCGGATATCCAGTTAAGCCCGCATCTTTACCTGGCGACCAACAGCGCACAGGGGCCGTGGTGGATACTGGGGTGGTCTGAGCGGGTGCCGGGTGCCGAGGACGTACACCAGCGCCGCTGCCGCCGTACCGGGTGCTTACCGGGATGGCGGACCGCTTCAGGCGGACGCTGACGTACCGGCATTGAGGCCGCCGGTGACCACAGCCGAGAAATCACCGGCGGCGACGGACAGTGCCGGGCGGGAGTTCCGTCTGGTGCTGACCACGCAGGCGCAGCGTGGAAGAATTTTACCTCTTCGCTATCTTCTTCTGACAGTTCCCGCCCTCTCAGCCTCAGCGTTCCCCGACACTGCCCGGTACGGAATACGGCCCCCGACAGGGTATCGCCTTTCGGCGGTGTGAAGCGATGCACGACCCGGCATACCCGGAAACCACGCTGCGCCACTGGTGCGGTACACGTATACGGAAGCCGGTGAACTGCTGGCGGTATATGACCCGCAGCAATACGCAGGTGCGCGCTTTCGTATGACGCGCAGCACGGGCCGGATGGTGGCGCACCGTTACGCGGGAAGGCCGGAGTCTGCGCTACCGCTACGACGATACGGGGCAGGTGGTGGAGCAACTGAACCCGGCGGGGTTAGCTACCGCTATCTTTATGAGCAGGACCGCATCACCGTCACCGACAGCCTGAACCGGCGTGAGTGCTGCATACAGAAACGAGGCCGGGCTACAGAACAGGTGGTGAAAAAGAACTGGCGGACGGCAGCGTCACGGCACCTTGGTATGACGCGGCAGGAGAGCTCGGCTTTCTGAAAACGGACGCGGCAGGACGGAGGACGGAAATTGCGGTGAATGTGGTGTCCGGCGATATCACGGACATCACCACCGGACAGGCGGGAGACGAAATTTTACTATAACGACAGGGAACCAGCTGACGGTGAATTGTCCCCGGACGAATACGGAGAAACCGCCGGGAATATGATGAACCGGGCAGGCTGGTATCGGAGACGCATCGCGCAGCGGGGAGACAATACGCTACCGCTACGATGACGCGCACAGTGAGTTACCGGCGACGACAACGGATGCGACGGGCAGCACCAACAGATGACCTGGAGCCGCTACGGGCAGTTGCTGGCGTTCACCGACTGCTCAGGCTACCAGACCCGTTAGATACGACCCTTCGGCGGATGACGGCGGTCCACCGCGAGGCATCAGCCTTTACCGCCGCTATGACAACCGTAGCCGGTTAACCTCGGTGAAGACGCACAGGGCCGTGAAACGCGGTATGAATACCTTGCCGCAGGCGACCCTGACTACCGTTATCACCCCGGACGGCAACCGGGCGAGACACAGTACGATGCGTGGGGAAAGGCGGTCAGCACCACGCAGGGAGCGGGCTTTGACGCGCAGTATGGAATTACGATGCTGCCGGACGTGTCATCAACTGACCAACGAAGACAGCAGCCACAGCGTCTTCAGTTACGATGCGCTGGACCGGCAATTTTACAGCAGGGCGGCTTTGACGCGGGCGGACGCAACGTTATCATTATGACCTGACCGGAAAACTCACACCAGAGTGAGGATGAGGACTTGTCATCCTCTGGTACTACGATGAATCGGACCGTATCACTCACCGCACGGTGAACGGCGAACCGGCAGAGCAGTGGCAGTATGATGGCCACAGCTGGCTGACCAGACATCAGCCACCTGAGCGAAGACCACCGTGTTGCCGTCCACTATGCTATGACGATAAGGCCGCCTGACCGTAGATGCCAGACGAGTGGAGAACCGGAGACGGGGAACTGCTGTGGCAGCATGAGACGAAAACACGCATACAACGAGCTGGGCTGGCAAACCGCGTCACGCCGGACAGCCTGCCGCCGGTGGAGTGGCTGACGTATGGCAGCGGTTACCTGGCAGAGATGAGCTGGGCAGGACGCGCTGGTCAGTATACGCGGGACAGGCTGCACCGTGAGACGGTGCGCAGCTTCGGCAGCATGGCAGGCAGTAATGCGCATACGAGCAAACCAGCACATACACCCCGCAGGCCAGTTACAGAGCCAGCACCTGAACAGCCTGGTATATGACCGTGACTACGGGTGGGTGACAACGGCGACCTGGTGCGCATCAGCTGGCCCGCGACAGACGCGGGAATACGGCCACCACAGCGCCACAGCGGGCAGGCTGGAAATTATGCGCACCCTCGCACCAGACCTGGACATCCGCATCCCGTATGCCCACGGACCCGGCAGACAGCCGGCTGCGGACCCGGAGCTACGCGGACGGAAGCCCCGCCTCTGATGTGGCCGGATAACCGCATCGCGGAGGATTACTATGTCTACCGCCACGATGAATACAGCAGGCTGACGGAAGAAGACGGACCATCCCGGCGGGTGTGATACGGACGGACGACGAGCGGACCCACCACTACCACTACGACAGCCAGCACCGCCTGGTGTTCTACGCGGATACAGCGCTGGCGAGCCACTGATTAGAGAGCCGCTACCTCTACGACCCGCTGGAGTTGGCGAATTGGCAAAAACAGGTCTGGCGGCGGAGCGTGACCTGGCAAGGGGTGGATGTCGCTGTCACGTAAACCGGAGTGATGGTATGAAACAGGACGGAGACAGGCTGACGACGGTGCAGACTGACACCACGCATATCCAGACGGTATACGAGCCGGGAAGCTTCACGCCGCTCATCAGGTCGAGACAGAGAACGGCGAGCGGAAAAAGCGCGCAACGGCGCAGCCTGGCAAGAGACGCTCCAGCAGGAAGGAGTGAGAACGGCCACGGCGTGGTGGTTTCCCAGCTGAACTGGTGCAGCTGCTGGGCAGGCTGGAGGAAGAAATCCGGAGCGAACCGCGTGAGCAGTAGAAAGCCGGGCGTGGCTGCACAGTGCGGGCTGACGGTGGAGCAACTGGCCAGACAGGTGGAGCGGAATACACACCGGCGCGAAAAGCTCATCTTTATCACTGCGACCACCGGGGACTGCCGCTGGCGCTTATCGCGAAGACGGCAATACGGCGTGCTGCGCGGAATATGATGAAATTAGGGCAACCAACTTAATGAAAGGAGAACCCGCATCATGTGTATCCCAGCGTACCGTCTGCCAGGGCAGCAGCATGATGAGAATCAGGGCTATTATATAACCGTCACCGGTACTACGATCCGTTGCAGGGGCGGTATATTACTCAGGACCCGATGGGGTTGAAGGGGATGGAATTTATATCAGTATCTTTAAATCAGGTTAAACACCCAAAGCAGACGCCGAAGATAAGAGGCGACAGGCAAGTAGCAATACGTAACCCACCACC
+>98eef8ef-3499-4c27-9191-9420b864869c
+TTGTTATTACTTCGTTCCAGTTACGTATTGCTTTTCTGTTGGTGCTGATATTGCGGCGTCTGTTGGGTGTTAACCTTTTTCGCCCCAGCTCACGGTGGCGGTTTCAACCTGATGAGTGGCGTGAAGCTCCCCGGCTGATGGAAATCGTCTGGATTCTGCGGGTTCTGTCGTTCTGTATCGTGGTCAGGCGATTCGCCGTCCCAGCCATACCAGGTCACTTGCGGTTTCCGTGACAGCGACATCCAGCCCGTCAGGTCCCGTTCACGCCGCCATACCCGTTTTGCCACCCTGCGGCCAGCGGGTCGTAAAGATAGCGACTTTCGACCAGCGGCTGCATATTGTGTCCGCGTGGCGAATTGCCAGCCGGTGCTGACTGTCGTAATGGTACCGGTGGGTGCGCTCATCATCCGTGCGGATAAAACGCTTCCGGGATAAGGGTCAGTTTTCTCTGTCAGCCACCGTGACGGTCATACCGGTAAAGATAGTGCGCGTCACGGGTGATACGGTTATCCGGCCACATGCTGAGGGCGCTGTCAGGTCACCTTCCGGGTCGAACGACGGTTACCTGCCGGGTCTGTAGTATACGGGATGCGGATATCAGATTCGCTGCGGTGGTGTGAGCGCCGGTCAGCCTGCCGGAGTAGTGCTGTAGCTGTAACTCGGGTCTGGCGCGGGCTGCTGATTAACGGATGAGTTCGCCGTTGTCGTTCCAGTGTAATCGCGGTCAGACAGCAGGCTGTTCAGGTGCTGGCTCTGTAACTGCCCGGCAGGGAACATAAGCAGTGGTGAGTTCATAACGGCCGAAGCTGCGCAGCGTTTCCCGGCTGTCTGGCGGTCGCGGGTGTACTCCACCAGCGGTGGTGTCGCCGAGTTTCATGCCTGACAGCCAGCCGCTGCCGTAGATCAGCCATTCCACGGCGGGCAGGCTGTCATTATACAGCGGTTCGCCAGTCTGTGCGTTGTACGCATGTCTGGTCTCATGCTGCCAGAGCAGTTCATTCGTCTGCGGATGATGCACCGTCAGGTGTTCACTGGCAGGAGGCAGCCTTTACTGTCATAACCATAGTGCGATCACCCGGTGCTTCCCTTCGCTGATATGGCTGATGTCCGTCAGCCAGCCGCGTTCGTCATGCTGCCACCGCCTGCGGTTTCGCCATTCACGGTGCGGTGCGTGAGGCGGTCTGCTTCGTCATAGTGCCAGTGGGTGACCAGCCCTCATCCTCGCTGCGGATAAGTTTGCCGGTCAGGTCATTAGTGATAACGCGCTGTGTGCGGCCGTCAAAGCCGGTCCTGTATCAGCCGGTCGAAATTACATCGTAACGGAAGGTGGTGTGGCCTTGTTTTCACTGGTCAGGCGGATGAACCCGTCAGCAGCATCGCATTCCCACTACTAACGCGTCAGGCCGCCCTGCGTGGTACAGATGGCTTTCCCCACGCATCGTACTGTATTCCCGTTTCTGCTGCCGTCCGGGAGGGCAATGACGGTGGTCAGGTCACCGGCGGCGTTGTATTCATACCACTGCATGGCCTGCGTGTCTTTCACGGCAATTAACTGTCCACGGCTGGCCGTATGCGCGGTACTGACTCAACCCTTCCTCGCGGTGCACCGCCGTCCACCTGACAAAACGGTCATGGTCATAGCGTTACATAACCGGAACAGTCAGTGAAGCTCAGCAACTGACCGTAACGGCTCCACGTCATGGTTTTCCGGCTGCCGGTGGCATCTTCCGTTGCGCGCAGGGTAAGTCACTGCGTGGATTATCATAGCACCGGTAGCGGGTGATATCGCCCGTCAGGGCAGTTCCTGAATCAGACGGCCCCATTCATCGCATATTCCCGGCGTATTTCCAATACGTCAGGCCCAGTGTGGCGTTAACTGGCTGTGGTGGTTATAGTAAAACGCCGATGCCCCTGCACCATCCGGCGTGGTGATGCTGCGTGATGGGCCCGTCGCATCCGGACTGTATTCTGTTGTCCTGCTGCGGCATCCGTCGCAATGCCCTGAGCCTGCCCACCGCGTCAAACTGACTCTGCGTGACGCTGCCGTCCGCGTGTTCCTTTTCACCACCCGCTTCAGCCCGCCTTCACCCTGCGTGTGCGGGACTTCACGGCGGTTCGGGCTGTCGGTGATGGTGATGCGGTCATCTCATACTGATACGTGTAACTTTAAGCCCTGCCGGGTTTTAGCTGTTCTGTCACCCGCCGTCGCTGTCGTAACGGTAACAGATTTCCGGTCGGCCCGTGTGACGGTGCGCCACCATCGGCCCCGGTATTTATCATCGTAAGTAAAGCTGCCTGTGTATTGCTGCGGTCTACACCGCCGCTTCGCCGCGGGGCGTCAGCCATAGCGCGCCAGCGGCGCAACAGGAGTAAATTCTCCGGTATTCCGGGTCGTGCGTCAGCCACACGGCAGACAGACGGATGCCATTGTCCCGGCCATATTCGGTGTAACCCGGCGGGGTATCAGGAAAAGCGGACGGTTCGATCCGCGGAAATGGCCTGCTGCCGGGCTTCTTCTGCCCTTTCGCCTGCGTGGTCAGCCGAGTGACGCCCGGCACCATCGATCACGCCGGTGATTTCGCCGCTGATTCACCGGCGGCTTCGCGGTGGAGCGATCTGTGTGCGCCGAAGCGGTCCACCAGCCCGGTCAGTACCCGGTACGGCGGCGGCGGCGCAGGCAGCACCTCATCCGCTTCCGGCACCCGCTCACCAGCCGAGCAGCCACCACGGCCTGCGGGCTGTTTGTCGCCAGATAACGATGCGGACTTAAGCGGGTTCTTCCGGCAGCAGCGCCTGCCGGAGTGCGTGGCCGGTGACCAGCCTTCATCCGGTTCGCCACGCCGCCGCGCCAATACAGTGACTCGCTGCGGCAACCGTCCTCACCGAGAAACCGTGCTCAAAATACAGGCTTCGCCGCCGTTATCACTGGTATCAGTGTGTTATCGCGCAGCTGTAAGCGGATATCCGCAGGCATTTTCCAGCCGGGGCCGGGCTCCCCACCGGCGCGGGCGTTTTGTCCAGTAACTGCTGTAGGTGCGGGGAAGTGAACGGCAGCGGGCCGGGCAGGGCGATGTCGGTTTCACCAGGAAGGACCTTTACCGAGCAGCCGGACGACCGGATGGCGGACGTCACCCGCCGGGGCACACCAGACTGGAAGCCACGCCGGTGGGGCACCGATGCGTACCCCGGCTGGACCCCTGGACGAATGCTACCGCCGGCATACTGCGTCATCGCCCTGACGCGCCGCCGGTTTTCCGCTCATCTGCTCATCCTTGTTTTTATCGGGTTATTTGTCTGCTGACAGGCGAAACCCTACAGATTTATAAGAAAGCCTTAAGTGAGATATCTGTCCAGATAGAACAATTAGGAAAATATTTTATATATTTCATGAATATATGTTTCGATTGGTATAACGATGTCTAAATATTCCTCTGAACATCTTCCTGATACAAAAACCGCCGGCGTTCCGTGGCCGGTTTTCAATATTCAAAACTCAGCAATCAATAAAAATCACCGGATTGCCTTTTCGGCCTGATCCATCACCGGTTTATCGCTGGTTTTGACCCAGACGCGCGATGCAGGTAGCTGTAAGCGGGCGCGGTCTTTCCAGAGAAAACGCCGAAGGCAGCGCCAGAACGCCCGCTGCAACCGCATAAGTGCGGCGTAAAGATAAGCCATGCAGGATATTCTCTGGAGTTCATACTTTCTCCCCTTTTATCTCCACCCGGTGAATGGCACCGGAAAAATGAATTCGTTTTATCTGATGAAGAAAATGGTACCGCCTTTTGTGTAATTTTACTACTCATCCGACCCACTTATTTTTGCTTATTGACCGTTTATTTACATTCATCCTGTAATTAAATTTACACAAAGTTAAATTAATACTAAACATTAGTTAAATCATGGCTTTTGCCATTTTGCCACTTTTACACCCCGCCCGCAGATTTTGCGAAATCTTTGCAGCCAGAATTCTACCTTCCGGTATCACTTTAGGCCACTGGGTGCACTGTAGTGGGCGTGATAACCGGCGTATTACTGGTGTTTTATTACTGCGGGTTATCTGGTTTATGCCCTGATCAATGCGGGCGTTCTGATGTGCGCAAGGGTTCTTACTGATCGCCACGTTTTTACTGTAATGAAGATTGGCCGTGAACTGGCGCGTCCTTTAGGTCAAACACCGGCAGACGCCGAGATGGAGCACACGCA
+>0a238451-b9ed-446d-a152-badd074006c4
+TTAAAAACTCGGTATGCTTCGTTCGGTTACGTATTACTACTTGCCTGTCGGCTCTATCTTCGGCGTCTGCTTGGGTGTTTAGCTCAATGACCTTTGCAGGCGACACGCAACTGGCGAACGTCAAAGCGGTGGATGATATCTACCCGATGCTGGCGATCCTGCCAAGCTAATCCCCTGGCCTGAAACCGCAGGCGGGCAGCGTATTGCTGGCCCCACGCCTGATGGCACTGCTTAACCTGAAAACGGGCGACACCATTGGCGTGGGCGATGCCACCTTGCGGATTGCCGGAGAAATTGATTAGGAACGAGTTCGGTTTAACCCCTTCCAGATAAGCTCCGCATCCTGATGATGGAATCTGGCGGATGTCGTCAAAACCGGAGCCGTGCAGCCGAGAGTCAGGGTCACCTGGCGTTATAGATTCGGCAGCAACGAAATTAGCTCGACGGCGAAATGGTTGTTACCTCGGCTTAAGCCGGGCACAACGCTGGTACGGTCTGGAACAGGACGAGAAGGCGCGCTGGGGCGATCAATGGAACGCTCTGTAGCAGTTCCTGCTCGCTTTCGGCGCTCTGACCTTGCTGCTGTGGCGGTGGCGGTGGCGGTAGCGATGAATCATTACTGTCGCGGTCGCGCTTTACGATCGTCACGAGTGCGGCGATCCTCAAAACGCTGTGGGGGGCAGGGCGAGCGCAACTGCGTGGCTAATCGTCGGTCAGTGGTTGATGGTGCTGACGCTTTCAACCGTTACCGGTGGGGCCATAGGCCTGTTGTTCAGCTTGTCTGTTGATGGGTGCTGCTCGAACCCGTTCTGCCTGCTGCACTACCGTAATGGCCTCTGGCCGTGGCTGTGGGCGCTTGGCACCATGACGGTCATCTCGCTGCTGGTGGGGCTACGACCATATCGCTTGTTGCTGGCAGCACCCAGCCTTTACGTATTATGATGTGGTAGCGAACGTCTGGCCGCTGAAGTTTTATCTGCCGATTGTCAAATTGGCTGGTGGTTGTGCTGCTGCTCGCCGGATTAATGGGTGGCAGCATGCTGCTTTGGGCAGTGCTTGCGGGCGCGGTAGTACTGGCTGCTGTGTGCGGTGTGCTGGAGGCTGGATGCTGCTGAATGTACTTCGCCGCGCGCGGTAGCTGAAATCGCTGCCTCTGCGCCTGGCGGTTAGCCGCCTGTTACGTCAGCCGTGGTCAACGTTAAGTCAGCTTTCGGCATTTCGCTCTCTTTATGCTGCTGGCACTGCTGCTGGTGTTGCGTGGCGATCTGCTCGACCGCTGGCAGCAGCAGCTACCTCCAGCCCGGGCTTTACTTTTTAATTAACATCGCCTGGAACAGGTAGCACCGCTAAAGAAGGCGTTCCTCGCGGAACCAGATAGTCGGAATCGTTTTATCCGGTGGTACGGGCTGCCGCGGCGAGCGGCGATTAACGATAAGCCGACAGAGGTAAATGAATGAGGCGCTTAACCGCGAACTCAATCTTACCTGGCAAAATACGCGGCCCGATCATGAAATCCGGTGTCGCCGGTAACTGGCCTTAAAAAGCCGATGAAGTGTCGATGGAAGAGGGGCTGGCGAAACGCTAAACGTTGCCCTCGGTGATACCGTGACTTTTATGGGCGATACCCAGAGTTCCGCGCTAAAGTGACCAGCCTGCGCAGAGTGGACTGGGGAAAGTCACGCCCTAATTTCTATTTTATTTTCCCTGAAGGGGAGATGATAAGACGAACAGCAACCGCAGAACTAGAAACTGCACCAGTTTCCGCTGGGAGAATGGCAACGGCATGTTGACACCGCTCAACCAGTTCCCGACCATTGGCCGCAGGTATTAGATATTGGCGCGATTTTAAAACCATAGTCGGTCGGGTGCTGGGAACGCGGGTAAGTCGGGCGCTGCGGTGATGGTGGTGCTGGTCACCCGCCTGCGGTATGTTGCTATTTGCTGGCACAGGTGCAGATGCAGAGAGATGCGTCAGCATCATCAAGGCGGTGGTGTGGCGCACCTCGGATGCGGGAAAAACTGCTGCGCGCCACGTTGTGGTGTGATTTCGCCATGCTTGGGTTTGTTTCCGGCCTGGTGGCATAATTGGTGCGGAAACGGCGCTGGCAGTGTGTTGCAGGCGAAAGTGTTTGCGATTTTTCCGTGGGAGCCAGACGGCGATTATTACGGATTGTTCTGCCGTGCAGCGGAGCGCTGCTGCTGTCGCTTTTCGGCGGCTGGCTGGGTGCGCGACTGGTTAAAGGGTAGGCGCTGTTCAGGCGGTTGCGGGGGTGATGAAATTAAATAAGGGCGTTCTGGTTGAATGGAACGCCTTGTTTCGTAATTCTACAATATGTTTCACGGCTGATGATATTTATTGAATTGGTGATTTCTATCGCTCTATTGCTGATAATAATCTGCGTCGGTGGAGTTTATTGATTTTAAATATAACCCTACAAAATAACTCGGACTAATAAAAATCATAATCGCCTTCGTTTGAATGGATATTATCCATATAATTGAACTGTTGATGAATTCATCTGTGTAAAAATGTTAGTTTAATAAAATATTGAAAGTGACCTGTAATAACGAGTTGTTGTTGATTTGAGAACAAAATAGAGTTTGTAACGAAAAATATATAAAATACATTAGCTGGTCTTGTGTGTCATTTTATTTTTGTTGCTAACACAGGGATATGAACAATAATAACTAAAGGCACTTTATGGCAGGAAAACCAGCGGCGCGTCGGGAGGCCATGACTCGATACTGGCGGTCAGCTGTCCAGGTTCGGCAGGTGTAAATTGGCGCGCCCACCGGCGTGGCGTTAATAAATATGTCGGGCGGGATGACTTCCGGGCGGCCCGAAGGTAAATCCGCTGCTGGGAGCAAGGTGCTGCCCGGCAGAACGGACCTTGCGCTGCTGCCGGCCCGCCGCCGTTTCATTCTCTCCCGCACCTACAGCAGCTACCGGACGAAGACGCTTGCCGGTGGGCGTTTTCACGGCCCCCGGCTGGAAAAGCGCCTTCTGATAATCCGCTTACAGCTACGTGATGACGGACTGATGCTCAACGACCAACGGCGGGCAGACATTCACTTTGAACCGCTGCTGCCGGGAGGCGATTGTACAGCCGCAGTAGATCAATGTGGCTGGTGCGCGGTGAAGTAAAGGCAGCTTACAACCGGACAGCGGCCATACGCTGGCGCGGCGCAACGCTACCGCCGGATATCCCGGTAAGCCCGCATCGCACCTGGCGATAACAGCGCACCGGGGGCCGTGGTGAATGCTGGGGTGTGGTCTGAAGGCAGCAGGAGTGCAGGTGCTGAGGACGTACTGCCAGCGCCGCTGCCGCCGTACCGGTGCTTTACCGGGATGGCGGACCACTCGGGCGGACGCTGTTATTTCGGCGTGAGGCCGCCGGTGACCACAGCCAGGGAAATCACCGGCGTGACGGACGGTGCCGGAGCGGGAGTTCCGCCTGAAGTGCTGACACGCAAGAGCTTGGCGAACTGCGGAAGAGGCCCACACCTCTTCGCTATCTTCAACTTCTGACGGTTCGCCCTCTCTCAGCCTCAGCGTTCCCCGACACACTGCCCGGTACCGGAAATACGGCTACGACAGGTAATCCGCCGCCTCGGCAGTATTGGCTGATATACGACCCGGCATACCCGGAGAACCTGCCGCTACCGCAATTCGGTACACGTATGCAAACCGGTGAACTGCTGGCGGTATATGACCGCAACAATACGCAGGTGCGCTTTCACGTAAGCGCGCAGCACCCGGGCCGGATGGTGGCTGGGCCGCAGGAAGCGGAGATGCGCTACCATGACGATACGGGGCGTTGAAGGTGGAACAACTGAACCCGGCAGGGTTAAGCTACCGCTATCTTTATGAGCAGGACCGCATCACCGTCACCGACAGCCTGAACCGGCGTGAGGTGCTGCTACAGAAAGGCGGGGCCAGGCTGAAACGGGTGGTGAAAAAGAACTGGCGGTTAACTTGGCGTCGCGCAGCAGGTGACGCGGCAGGGAAGGCTCACGGCACAGGAAACGGACGCGGCGGACGGAGGACAGAGTAGGTCTGAATGGTGGTGTCCGGCGATATCACGGAATCACCACACCGGACGGAGCAGGGCAATTTTACACTATAACGGCGGGAACCAGCTGACGGCGGTGGTGTCCCCGGACGGAGCTGGAGAGCACCGGGAATGGAAGACCGGGCAGGCGGTGTCGACATCGCGCAGCGGGGGGCAATTACGCTACCGCTACGATGACGCACAGTGAGTTACCGGCAACGACAACGGATGCGACGAACGCGCAACTTAGATGACCTGGAGCCACTACGGGCGGTTGCTGGCGTTCACCATTGCTCGACTACCGGGCGCCCGTTCATGAATACGACCCTTTCGGCCCGGATGACGGCGGTCCACCGAGAAGGCATCAGCTTACCGCCGCTATGATAACCGTGGCGGGTCAACCTCGTGAAAGACGCACAGGGCGTAACGCAATTATGAATATAACCGCGGTACAGCTACCGTTATCACCCCGGACGGCAGCGAACTGAACTTTAAGAGTACGATGCGTGGGGAAAGGCGGTCAACTTTCCGCAGGGCGAGCTGACGCGCGGTATCAGGAGTACGATGCTGCCGGACGTGTCATCAGCCTGACCAGCGAGAACGGCAGCCCACAGCGTCTTCAGTTACGATACGCTGGACCGGCTGGTACTGTGGGGCGGCTTTGACGGGCGGGCCTGGCGATATCATTATGACTGAGCCGGAAAACTCACTGGAGAGTGAGGATGAGGGACTTGTCATCCTCTGGTACTGATGAATCGGACGGCCAGCTATCACTCTGCACGGTGAACGTGGAAACCAACGACAGTGATGGCGATATGATGGCCACGGCTGGCTGAAGCGACATCATGCACAGGCGAAGATACCGTGTTGCCGTCCACTATAACTGCATGACGATAAAGGCCACTGACCGGCGATACGGGGGCGGTGAAACCGGAACAGGGGAACTGCTGTGTAAGCATGGGAGACGAAAGAAACGCGCATACAGCGAGCAGAGGCTGGCAAAACCATCACGCCGACAGCCTGCCGCCGGTGGAATGGCTGACAATAACGGCGTTACCTGGCAAAGGAATCAGAAGCTGGAGCGGACGCCGCTGAATTAAATGCGGGTTCAGGCTGCACCGACGGACGCGGTGCGCAACTTCAAGCATGGCAGGCAGTAAATGCCTACGAACTGACCAGCTGCTGTACACACCCCCGCAAACCAGTGCGAACCGCACCTGAACTGCGACTGTTGCCAGCGTATTCACGGGTGGGGTGACAACGGCGACCTGGTGCGCATCAGCGGCCACGACGAAGACGCGGGAATACGGCTACAGCGCCACAGGCAGGCTGGAGAGTGTGCGCACCCTCCACACCAGACCTGGACATCGCATCATCATGCACGGACCCGGCGGGCAACCAGCTGCCGGACGGGGCTGCACACCCGGACAGTACACTCACAGTGTGGCCGGATAACCGCATCGCGGAGGATGCGCCTATTTCACCGCCACGATGAATACGGCAGGCTGACAGCGGAGAAGACGGACCGCATCCCGGCGAGGTGTGATACGGACGGACGACGAGCGAGACCCACCACTACCACTACGACAGCCAACTTTCGCCTGGTGTTCTACACCGCGGATACAGCATGGCGAGCCGCTGGTCGAAACCGCTACCTCTACGACCGCTGGGACGGCATGAATGGCAAAACAGGTCTGGCGGCGGGGCGTGACTGGCCAGGGTGGATATCGCTGTCGCGCGCGTAAACCGGAGAGTGACGTGGTATGGCTGGGACGGGGAGACAGGCTTTGGCGGCAGTGCAGACTGACACCACGATATCAGACGAAGTATATACGAGGCAGAACTTCCGCCCATCATCGGGTCGAGCAAGAGAACTGACGAGCGGGAAAAGCGCGGCGGCAGCCTGGCTGAGAGACGCTCAGCAGGAAGGAGTGAGAACGGCTTACGGCGTGGTGTTCCCGGCTGAACTGGTGCGGCTGCTGGACAGGCTGGAGGAGAAGAAATCCGGGCAGACCGCGTGGGCAGTGAAAGCCGGGCGTGGCTGCGCAGTGCGGGCTGACGGTGGAACGTTGGAGCCGGAATACACACCGGCGCGAAAAGCTCATCTTTCACTGCATGCAGGGGACTGCCGCTGGCGCTTATCAGCGAAGACGTACGGCGTGGAGCGCGGAATATGATGGAATGGGGCAACCAGCAATGAGGAGAACCCGCATCGTAATGTATCAGCCGTACCGTCTGCCAGGGCAGCAACGCGGTGAGGAATCGGGGCTGTACTATAAGCAAATACCGGTACTACGATCGGTGCAGAGGCGGTATATTACTCCAGGACCGATGGGGTTGAAGAGGGATGGGGCGCTGTCGGTATCCTTTAAATCCACTACAACAAATTGACCTATGGGATTATTGCCGAACTTGGGATGATGCCAGATCTGGAGCATCGCAGAGGAAGTTTGTAGGTATTCTTTTCCCATCTCATCGGACCAATGCGAGGTGAAATGAAATGCACGGAGTCTGCATTCGTCTTTAGAAAACGCAGAATAGATCTCTGTCGTAAAAATGATATGGAATCTCTGTTGTCTGTAAAGATACTAATGGAAAATATTTTTGCATCTAAAGGCAACCTGATAATTTAAGAAGGAGTCATATCCTCTGAAAGAAAATGTCCCACAGGTACAGATGAGTTGCTGCTTATCATACTCACGGTACGAATAGATCATGGCAATTATGTTGATGAATTTTTCAAAATGGCGATAAAACTCTTGTAAAGTAAAGATAATAATCTTGAAGCATTTTATCTCACCAGCACCTGATGGACGGGTGGGAGGCACTTAATAATAAAGGAGAATATATTTTTATCAGAAATAGTGTCCCAGGATTAGGTCAGTATGCATACCGTATCATGATTAATTTTAGTGCTTTTAATTGGGGCCTATGGAGATTCAATGAAATATAGTTCAATATTTTCGATGCTTTCATTTTTATACTATTTGCCTGTAAATGAGACAGCTGTTTGCGGTTCTGATGGCAATTATTTTATGAGGTATGTGGAAAATTACATTTAGATAAACCTCTGGCCAAAAATACGGCAAAAGCGAAACAATGAAACAATTAGCTTCGAAATATATGTTAGGCAATTGCATCATATGGCGAACGGATTGCAGAAAAGAAGAAAACCACCATTTAATTGGAACTTACAGATAGTTGGGTTGTTGAGAGCAAAGTTACCTTATGAAGTTGCGGGTGGTGTATTTGATATATAGAAATTAATAAGAAAAATGGATGTTTTGAATTTCCTACATGGTAAATAATAATGCAGCGCTGATGGATGCGGATGGAGACATTGCGTGGAGCGGGGATATGATGAGTGGGGCAACCAGCTGAATGAAGAGAACGCATCACCTGCACCAGCCATTACACCGGCTGCAGGGCAGCAGTATATGATGAGAGTCGGGGCTGTACTACAGCCGGAACCGGTACTACCCGATCCGTTGCAGGGCAGTACTATCACTCAGGGCCGATAGGCTGGAGAGGATGGAGTCCTGTATGTGCGTATCCGCTGAATCCAGGTGAATGGTATTGATCCATTAAAGTTTAAATTCCCGCAGATGTAGCGCTAATATAAGAAGAAAAGATCAACTAAACCATCAAAGAGCATGGGATATGTTATCTGATACTTATGAAGATATGAAGAGACTAAATTTAGGTGGGACTGATCAATTTTCCATTGTATGGCATTTTTGTCGAGTGTCTAAAATTAAATGATGACGCTGGTCAATTAGCCGATCGGCGAAAGAGGGCTGGGTTATGAAAAGAGATTAGAGATTACGGAGTTAAATCTGTTCGAATTGTACGGCAGAAAAGTAAAAGCTATCCCATTCTGAAATGATTGAAGATAATAAAAAAGACTTGGCTGTAAATGACCATGGGTTGACATGTCCATCAACAACAATTGCTCCAGATAGATCTTAGTGATTATGATAATCCAGAGCATAAAAAACGATAAAGGCTTTACAGATGCTGAAGCTATCTCAAGTAATCTATCAAAGATGATAATATTTATTTTTGCTATTATAAGTATTCTTGACATGCGTAATTGCCTTATTTATAAAAGATGGTCTCTTGTAAATATAAACATTACACTTAAGCTATGTAGCAATACCAGAAAATGATGGAGTTTTACGCCAGCTCCCAGATTTTTCCTTTTGTAGCGGTGGATATATCAATATATACCTAAATCTGAAAGACGAAGTGCTTTTCTTATTTTCCCCTAACTTCGTGATGATGGGGTGAGTTTGAAAACATTGACCAGTGAGACCCAGGAACAGATGGCGAAATCAACCATCAAAGAATGATCGATACAAAAATTATTGGTGTAAATATGAGTAGATGCCAGGGCAAGGGGACAATTGGCAAACCTTTTTTTGTTGTTGGTGAAACAATGTTACGCATTATTTTATAACAAATATTGGAGCTGGATTGCCTGATGGTACTTTATACTGCGATAATTCGCTTGAATTAAGAGTCTATCCCATATCGAAGTCCGTCAGCCGTAGTGGGAAAAGTAAAATTCTGAAGCTGAGAAAAGAACATGTCGGCTATTGTGTAAAAGCCATATAGCTCGAGCGATGAATATCCTCGTGATAGTTGTTTTGTGAGGGTGAGTTCCGACCCTCGGCAACAAAATAAAATGAACAGTCAGAGAGTTTACGCCGATTGCACTAATCTCAATGATATCTTCGCCATATTCCAGCCGAAACAAATGAAAATGTTACGTGTTTAATGCGGAGTCTATCTGAAATAAATAATCCTTCGGATTAGAAATAAATTCTTGCCGGGAAAGAAAAGGAAATAAACCATTAGCGGAAAACCAGCGGCACGCCGGTGACATGCCCCAGTACGGCGGCGATAATTAGGAAATTTCAGCGGGGAACACTGATAGTCGCGCCGACTGCATCGAGAACTCCTTACAACTTTTTACAGAACGTCACTGTCGTTGTTCGATATCGTCTTTTTGAATTCTCCAGGTTATGGAGCTGGCAACCCGACGAACGGACACCACTGTCGATAAAAACCCTGTTTACGCAGCTCGTTGCTGGCCCGGTGCTGACCATGTCGGGAAAGCGACGTATTAACAACAGCCTGTTCAGTTGCCTCATCGGTTTTGGTTCTTAAGGTTAGGAGCGCGGCGACTACTGATTAATCTGCGCATCCACCGCCTTCAGCGACCAGTTCGCGGTAACGATAAAACGTATCACATGGCTTTCAGTTACAGGCTTTTGATACGTTGCTGAGTTCTTCCAGCCAGATTGAACAAACCGGCTTTGTGTTTGATGACGGGATTGGCAGTATGAAGCATGAGGTTACCTCTTGTTTTGGATAAAGTTCGACACTCATATCAAAACCGGTAACTCTCAACCTTTCAGAGGTTAAACACCCAAGCAGACGCCGAAGATGAGCACC
+>ac1527fd-d73e-4721-95f5-b7d270cae783
+TTCGGTATTGCTTCGTTCAGTTACGTATTGCTGCCTGTCGCTCCTATCTTCGGCGTCTGGCGGGTAACCTATCGCGGTCAGACAGCAGGCTGTTCAGGTGTAATATGTAACTGCCGGCAGGGTATAAGCGGTGGTGAGTTCATAACGGCCGAAGCTGCGCAGCGTTTCCGGTACAGGCGGTCGCGGGTGTACTCCACCAGCGGTGTGTCGCCGAGTTTCATGCTGACAGCCAGCCGCTGCCGTAAGTCAGCCATTCCACGGCAGGCAGGCTGTCCATTATAAACGTTTCGCCAGTCCTGTGCGTTGTACGCATGTCTGGTCTCATGCTGCCAGAGCAGTTCGACCGTCTGCGGATGATGCACCGTCAGGTGTTCACTGTGAGGCGGCCTTTACTGTCATAACCATAGTGCACGTCACCCGGTGCCCTTCGCTGATATGGCTGATGTCTGTCAAGCCAGCTGGCGTCGTCTGCCACCGCTCTTACGGTTCGCCATTCACGATTGCGGTGCGTAGGGCGGTCTGCTTCGTCCATGAGTGCCAGTGGGTGAGCCCTCATCCTCGCTGCGGATAAAGTTTGCGGTCGGGTCATTGGTGATAACGCTGTGTGCGGCCGCCAAAACCGGTTTCCTGTATCAGCCGGTCCGGGTACATCGTAACGGGTAGATTGTGGCTGCGGTTTTTCACTGGTCAGGCGGATGGCCAGAATCCGGCGGCATCATGGTATTCCATACTGCGCGTCAGACCGCCTGCGTGAACGCAGATGGCTTTTCCCCGCGCATCGTACTGTGTCGTTTCTGCTGCCGTCCGGGGCAATGGCCGGTGGTCAGGTCACAGCGGCGTTGTATTCACCGCGTTTCATGGCCCTGCATTAGTATGCGGCAATTAACTGTCCACGGCGCTGTCGGCATCGCGGTACTGACTCAGCCAGCTTCCTCGCGGTGCACCGCTTCACCCTGACAAAACGGTGTATAGTTTAGCAGGTTATAACCGGAACAGTCAGTGAAGCTCAGCAACTGACCGTAACGGCTCCACGTCATGGTTTCCGGCTGCCGGTGTCTTCCGTTGCGCAGGAGTAAGTCACTGTGTGGATTATCATAACGGTAGCGGGTGATATCGCCGTCAGGCAGTTTCCTGAATCGGAACGGCCCCATTCATCTCTTCGGCGTATTTCCAGCCCGTCAGGCCGGTGGCTGACGTTAGCGGCTTTAATGGTGGTTATAGTAAAACGCCGATGCCCTGCCATCGGCGTGGTGATGCGCGTAGATGGGGGTAATCACCATCCGGACTAATATTCTGTTGTCCTGCCTGCGGCATCGTCACAATGCCCTGGAGCCTGCCCACCGTCAAACTGTTCTGCGTGACGCTGCCGTCCGCGTGTTCCTTTTTCACCACCCGCTGTACGCCTTCACTTATGCGTGCAGGACTTCGGCAGTTCAGGCTGTCGGTGATGGTGATGCGGTCCTTCTCATACTGATACATTCATGGCAAGCCTGCCAGGTTTAGCTGTTCCTGTCACCGCCCGTCGCTGTCGTAACGGTAACAGATTTCCGGTCGGCCCGGTAACGACCCGTGCCACCATCCGGCGGTATTTTATCATCGTAAGTAAGAAGCTGCGCACCTGTGTGTATTGCTGCGGTCATACACCGCCAGCAGTTCGCCGCGGGGCGTCAGCCATAATAGCGCACCAGCGGCGCGAGCAGGTAAATTCTCGATTATTCCGGGTCGTGCGTCAGCCACACGGCGAACAGACGGATGCCGTTGTCGACCCTTCGGTGTATTGGCAGAGATATCAGGAAAAGCGGACGGTTCCGTCCGCCGGAAATAGCCTGCTGCCGGGCTTCTTCTGCCCGCTGCGCCTGCGTGGTCAGTACCAGCCAGAGTGACGCCCAGCACCATCCGTCGCGCCGGTGATTTCGCGCCGCTGGAATTCACCGGCGGCTTCGCGGTCGGAACGTCTGTGTGCGCCGAAGCGGTCCACCAGCAGTCAGTACCGGTACCGGCAGCGGCAGCGCAGGCAGCACCTCATCACTTCCCGGCACCCGCTCACCAGCCGAGCAGCCACCACGGCCCCTGCGGACTGTTTGTCGCCAGATAACGATGCGGACTTAGTGAGTTCTTCCGGCAGCGCCTGCCGAGTGCGGCCAGCCGGTGACCTTCATCAGTTTCGCCACGCCGCCCGCGCAGCCACATGATGACTCGCTGCGGCTGTATTACCGTCCTCACCGGGAAACAGGTGCTCAAAATACCAGGCTTCTGCCGCGGTATCACTGAGTATCAGTGTGTTATCCTTGCAGCTGTAAGCGGATATCGCAGGCGATTTTCCAGCCGGGCCGAGGCTCCCCCATAGCGCGGGCGTTTCATCGGTAACTGCTGGCGGTGCAGAGAATGAACGGCAGCAGGCCGGGCGGGGGCGATGTCGGTTTCACCGGGAAGGACCTTTGCACCGAGCAGCCGGATTGACCGGATCGGCGGACGTCTGCCCGCGGGGCGCGAACAGGCCACGCCGTGGGGCTTTTTCGATGCGTACCCGGCTGAACCCTGGACAATGCTACCGCCATACTGCGTCATGTGCTGACGCGCCGCCGGTTTTTCCGCTCATCTGTAATCGCTTGTTTATCGGGTTGTTTGTCTGCTGACAGGCAGAAACCCTACAGATTTATAAGAGAAAGCCTTGAGAGTGAGATATCTGTCAGATAAGAACAATTGGAGGAAATATTTTATATATGTTCGCTGAATATATGTTTCGATTGGTATAACGATGCGTAAAATGTTCCATCTGAACATCTTCCTGATGCAAAACCGCCAGCGTTTCCGCTGGCGGTTTTCAATATTATTCAAACTCAGCAATCAATAAAGTCGCAGTTGCCTTTTCGGCCTGATCCGTCCACCGGTTTATCGCTGGTTTTCGAAGCCAGACGCGATGCAGAGTAGCGCAACGAAAGCGGGCGCAGTCTTTCAGAAAAGCATGAAAGGCAGCGCCGGAACGCCGCTGCAACCGCGAAGTGCGGCGTAAAGATAAATATGCAGGATATTCTCTGTAGAGTTCATACTTTTCTCCCCTTTGTATCTACCCGGTGAATGGCACCGGAAAAATGGATTATTTATCTGGTAAATAATGCCGCCCTTTTGTGTAATTTTACTACTCAGCCAGTACTTATTTTGCTTATTGATGTTGTTTTGTTACATTCATCCTGTAATTAAGTTACGAAGTTAAATTAATACTAAACATTAGTTAAATCACTTGGCTTTGCCATTTTTACTTTTACCCGCAGATTTTGCGAAAATCTTTGCAGCAAAAATTCTACCCTTCCGGTATCACTTTTGGAAATACTGGAGGTGCACTGTGGTACGGCGTGATAACCGGCATATTGCTGGTGGTACTATTACTGGGTTATCTGGTTTTATGCCTGATCAAATGCGGAGGCGTTCTGATGGCTGCGCAAGGTTCTACTGATCGCCACGTTTTTACTGGTGTTAATGGTGCTGGCGCGTCCTTTAGGCAGCAGGCTGGCACGCGGCGCTGATTAATGACATTCCTCTTCCCGGTACAACGGGCGTTGAGCGCGTACTTTTCGCTTCGCGCTGGCGTCTGACCATTGAATGAACTGGAAGCAATATCTTTGTTGCCATTCTCGGCTGAGCGCAATGCTGGGGCTGGCGGTGCTGTTTTATGTTGCTCGGTCAGCACTATCTGCCGCCAATCAGCAGTTACCGGGCTGTCGTGGGATCGCTGAATACCGCCGTCGGCTTTGTCACCAACACCAACTGGCAATCCCATGGCGGTGGAAACCATTGAGCCTATTTCAGCCAGATGGCGGGCTTAACGTTGCAAACTTTCTTTCTCTGCGCCAGCGGGATTTTGCGGTGATTTTGCCTCATCCGTGCGGTGCACCGCGAGCATAAGGCACGCTCAGGATGCCTGGGTCGATCTGCTGCGCATCGCGTTATGGAGTGTAGTCCCGCAATGGCGTTGTTGATTGCACTGTTTTTATTCAACAAGGTGCGCTGCAAAAACTTTCGCATATCGGGCTGTGAATACCGTGAAGACGCAGCACAATTGCCATGGATTTATAGCAACTTCTCAGGAAGCGATCAGATCTTTCGATTACTAACGGCGGTAAATATTTAATGCCAATAATTAGCATCCGTTTAACCAACCATATGACCAACTTCTGGTACAGATGCTGGCGATCTTCGCCAGTCCCAACGGCGCTGGCGCTTTGCGCTGGTGAAGTGATGGGCGATCGCGCCACCAGGGCGCAATGTTGCTGTGGAGCGATGTCGGTGATTTTGTCATCTGCATGCGGCGGCGTGGTGATGTAGGCAGAGATTCAGGGTAATCCTCATGCTGGCACTGGGCACGGACAGCAGCATCAATGGAAGGTAAAGAGAGCCGTTTCGGCGTGCTGGTCAGCTCGCCTGTTTGCGGTCGTGACGACGGCGGCTTCCTGTGGCGCATTGATTGCGATGCATGGTTAGTTTACCGCTCTCGGTGGCATGAATGCGCCGATGTGGCTGGTAAATTGGTGAAGTGGTATTCGTGGTGTCGGTTCTGTTAGGATTCAAACACCCAAGCAGACGCCGCAATATCAGCACCAACAGAAAGCAATGCGTAACGCAG
+>2a021335-d1c5-4881-93fc-a673d8960075
+TGCTTCGGTATTGCTTCGTTCCAGTTACGTATTGCTTTTTCTGTTGGTGCTGATGTTGCGGCGTCTGCTTGGGTGTTTAACCTTGGCGCTGGGCAATATCAGCGATCTGGAAGGGCTTAAGCCAGCAAAGCCGTGAAGTTTATGGCGGGCGATCGGGCGTTGCGCGAGTTCACGCGAAGTGCCGCAAGCGTGAAGCTGGAGGAAGCGCAAAGCGCGGCCTGATCGGCAAACAGCTGACTTTCATACAATGACCTTTGCAGGCGACACACCGCAGCTGGCGAACGTCAGCGGTGGATGATATCTACCCGATGTATGGCGATCTGCAAACCTTTAATCCCCTGGCCTGAAGCCGCAGGCGGGCGGCGTATTGCTGGCCCCACGCCTGATGGCACTGCCAACCTGAAAACGGGCGACACACCATTGACGTGGGCGATACCACCTTGCGGATTGCCGGAGAGTGATTCAGGAACCGGATTCCGGTTTAGCTTCAGATGGCTCGCGTCTGATGATGAATCGGATGTCGATAAAACCAGGTCGATTACGGCCGAAGTCAGGTCACCTGGCGTTATAAATTCGGCGGCAGCAGAGACCAGCTCGACGGCTATGAGAAATGGATTTGTTACCTCCGGCTTAGAAACCCGAACAACACTGGTACGGTCTGGAACAGGACGAAGGCGCGCTGCAGGGCGATCAGTGGAACGCTCGCAGCGAAGTTCACTGCTGCTTTCGGCGCTTCCTGACCTTGCTGCTGCTGGCAGTGGCGAAGCGGTGGCGGTAGCGATGAATCGGTATTACTGTCGCAGTCGCTACGATCTGGTGGCGATCCTCAAAACCTTTAAGGGGCAGGGCGAGCGCAACTGCGTAAAGAGCCCAATCGTCAGTCAGTGGTTGATGGTGCTGACGCTTTCAGCCGTTACCGGTGTATAGGCCTGTTGTTGTTCGAAAACGTGTTGATGAATTGCTGCTCAAGAAGCCGTTCTGCCTGCTGCACTACCGCCAGCCAGCCTGGCCGTGGCTGTGGGCGCTTAACCATGACGGTCATCTCGCTGCTGGTGGGGCTACGACCATATCGCTTGTTGCTGGCAACGCAGCGCTACGCGTATTACGTAATGATGTGGTAGCGAACGTCCTGGCCGCTGAAGTTTTATCTGCCGATTGTCAGTGTGGTGGTTGTGCTGCTGCTCGCCGGATTAATGGGTGGCAGCATGCTGCTTTTGGGCGTGCTGGCGGGCGCGGTAATTACTGGCTTTGCTGTGCGGTGTGTGCTGGGCTGGATGCTGCTGAATGTACTTCGCCGCATGACACTGAAATCAGCTGCCCCTCTGCGCCTGGCAGTTATACCGCCTGTTACGTCAGCCGTGGTCAACGTTAAGTCAGCTTTCGGCATTTTTCGCTCTCTCCTATGCTGCTGGCTGCTGCTGGTGTTGCGTGGCGATCTGCTCGACCGCTGGCGGCAGCGACTACCACATCAAGCCGAACTACTTTTTTAATTAACATCGCCACAGAACGGAATTGCTAGCACCGCTAAAGCGTTCCTCGCGCGGAACATCAGATAGTCCGGAATCGTTTTATCCGGTGGTGCGGGCGCGGCTGACGGCGATTAACGATAAACCGACAGAAGGTAATGAAGATGGGCGCTTAACCGCCGAACTCAATCTTACCTGGCAAAATGCGCGGCCCGATCATAATAATCCGATTGTCTCGCCGGTAACTGGCCGCCAAAGCCGATGAAGTGTCGATGGAAGAGGGGGCTGGCAAAGAAACGCTTAAACGTTGCCCTCGGTGATACCGTGACTTTTATGGGCGATACCCAGGGTTTCCGCGCTAAAGTGACCAGCCTGCACAAAGTGGACTGGGAAAGTCTGCGGCCTAATTTCTATTATTTTCCCTGAAGGGGGCATTAGACGGGCAACCACAGAACTGGCTTACCGGTTTCCGCTGGGAGATAGCAGCGGCATGTTGACACAACTCAACCATAGTTCCCGACCATTAGCCTGGTATTGAATATTGGCGCGATTTTTAAAACAGGTCAGTCCGGGTGCTGGAGCAGGTAAAGTCGGGCGCTGGAAGTGATGGTGTAGTACTGGTCACCGCCTGCGGTATGTTGCTGTTGCTGGCACAGGTGCAGGTGGGAATGCGTCAGCGTCATCAGGGAGCTGGTGGTGTGGCGCACGCGCGGTGCGGAAAAACTGCTGCGTACCACGTTGTGTGGTGTGAGTTCGCCATGCTTGGGTTTGTTTCCGGCCTGGTGGCCTGGTGGTGCGGAAACGGCGCTGGCGGTGTTGCGAGCGAAGTGTTTGATTTTCCGTGGGGAGCCAGACTGGCGATTGTGGATTATTCTGCCACCGTGCAGCAGGCGCTTTCTGCTGTCGCTTTTCGGCGGCTGGCTGGGTGCGCGACTGGTTAAGGGTAAGGCGCTGTTCAGGCGGTTGCGGGGTGATGAGAGTAAATAAGGGGGCGTTCTGGTTGAATGGAACGCTGAACAAATTAATTCCACCACAATATGTTTCATTGATGATGTTATTGAATTGGTGATTTCCTATCTTTTTCTATTGCTGATATTAATCTGAATCGGTGGAGTTTATTGATTTTAATATAAAGCCCCTACAAAAATAACTCAGACTAATAAAATCATAAATCATATACGTTGAATGGATATTATCCATATAGTGGGCCCCGATTGATGATGAATTCATCTGTGCTAAAAATGTTAGTTTAATAAAATATTGAAAGTGACCTGTAATAACAGTTGTTGTTGATTGAGAACAAATAAGTTTATAATGAAAATATATAAATACATTAGCTGGTCTTGTGTGTCATTTTATTTTTTGTTGCTAACACAGGGATATGAACAATAATAACTAAAAGGAGCACTTTATGAGCGGAAAACCAGCGGCGCGTCAGGGAGATATGACTCAGTATGGCGGTCCCATTGTCCAGGGGTTCGGCAGGTGTAAATTAGCGCGCCCACCGGCGTGGCGTGCTCGGTGATGTCCGGGCGGAAGGATGACTTCAGGCAGCCCGGTAAATCCACAGGGGCGAGGTGCTGCCCGGCGAAGGGCTTGGACCTTGCGCTGCCGGCCCGCTGCCGTTCATTCTCTCCCGCACCTACAGCAGCTACCGGACGAAGACGCCTGCACCGGTGGGCGTTTTCGGCCCGGTAGCTGCTGTAGGTGCAGGAGAGAATGAACGGCAGCGGGCCGGGCAGCGCAGGTCATCTCGCCGGGCAGCACCTTCGCCCCAGCAGCGGATTTACCGGGCTGCCCAGTCATCCGCCCGGACGCACCGAGCACGCCACGCCGATTGGGCGCGCCACCTGCCGAACCCTGGACAATGGGACCGCCATACTGAGTCATATCTCCCTGACGCGCCGCTGGTTTTCCGCTCATATAAAGTGCCCTTTTAGTTATTGTTCCTTATCCCGCAATGTTAGCAACAAAAAAATGGAAAGCACACAAGACCAGCTAATGTATTTATATATTTTTCACATAAACTGTTCTCAGTAACCCAACAACTGTTATTACCAGGTCCTCTCAATATTTTTTATTAAACTAACATTTTACTTAGCACAAGATGGTCATCATCAACAAATTCACTATATGGATAATATCCATTCAACGCATATGATTTATGATTTTGGCTTTAGTCTGAGTTATTTTTTGTAGGGCTATATTTAAAATCAATAAACTCCACCGATTCAGATTAATATCAGCAATAGAAAGATAGGAAATCCCACCAATTCAATAACATCATCAATGAAACATATTATAGAATTAATTTAAACAAGGCGTTCCATTCAACCAGAACGCCCATTTACTCTCATCACCCCGCAAACTGCCTGAACAGCGCCTTACCCGCTTAACCAGTCGCGCACCCAGCCAGCCGCCGAAAGCGACAGCAGCAGCGCTCCGCTGCACGGCGCAATCCACAATCGCCGGTCTGGCTCCCGCGATCAAACACTTTCGCCTGCAACACTGCCAGCGCCGTTTCCGCACCAATTGCGGCCACCAGGCCGGAAACAAACAAGCATGGCAGAGACTCACACCACAACGTGGTACGCAGCAGTTTTTTTCCCCGCACCGAGTGTGCGCACACCACCAGCTCCCTGTGTGACGCATTCCCACCTGCACCTGTGCCAGCAACAGCAACATACCGCAGGCGGTGACCAGTACCACCATCACTTCCAGCATACCTGCTCAACACCTGACCGACCTGTTTTAAATCCCGCGCCAATATCTAACAGGCTAATGGTCGAGAACTGGCCCGGTTGAGTTGTCAGCATGCCGTTGCCATTCTCCCCGGCGGAAGCTGGTAAGCCAGCTCTGCGATTTGCCCGATCTAATGGGGGAAAATAAAATAGAAATTAGGCCAGACTTTTTCCCAGTCCACTTTGGTACAGGCTGGTCACTTTAGCGCGGAACTCCACCAGGTATCGCCCATAAAGTACATTGTATCACCCATCAATCGATTATGATGTTAATTATCAATCGTTCGGATGATGTTCCTGTTCTGTGGCGATGTTAATTAAAGAAGTAGTTCGGGCTTTCTGGGGAGTAGCTGCTGCTTGCTGCCAGCGGTCGAGCAGATCGCCGCGCAACACCAGCAGCAGTGCCAGCAGCATAAAGGAGGCGAAATGCCGAAAGCTGACAACGTTGACCACGGCTGACGTAACGGGCGGTAACCGCCAGGCGCAGAGGCGATTTCCGGTCATGCGGCGAAGTACGTTCAGCAGCATCAGCCCAGCACACCGCACAGCCAGTACAGTACTACCGCGCCCGCCAGCACCGCCCAAAACGGCATTAATCGGCGAGCAGCGGCACAGCCACCACACACTGACAATCCGGCAGATAAAACTTCCTTGACCAGACGTTCGCTACCACATCATTACGTAATACGCGTAAAGAGGCGTTGCCAGCAACAAGCGATATGGTCGTAGCCCACCAGCAGCGAGATGACCGTCATGGTGCCAAGCGCCCACAGCCACGGCCAGAGGCTGGCTGGCGGTAGTGCAGCAGGTAAGAACCGGGCGAGCAGCACCATCAACACGTTTCGAACAACAGGCCTATGGCCCCACCGGTAACGGCGGCGTCAGCACCATCAACCACTGGCCGACGATTGGCTTACGCGGTAGCTCGCCCTGCTAGCGTTTGAGGGATCGCCACCAGATCGTAGCGACTGCGACAGTAATGATTCATCATTTACCGCCACCGCTGCCACTGCCAGCGAAAGCAAGGTCAGAAGCTGCCGAAAGCAGCGGGAACTGTTGCGAGCGTTCCATCGATCGCCCCAGCGCGCCTTCGTCTGTTCCAGACCGTATTTACCAGCGTTGTTCGGGTTTAAGCTGAGGTAACAACCATTTCTCATAGCCGTCGAGCTGGTTCTCGTTGCCGCCGAATTTATAACGCCAGGTGACCCGACTCCCCGGCTGCACGACTCGGTTTTATCGACATCCGCCAGATTCATCATCAGACGCGGAGCCATCTGGAAGGGTTAAAACCGGAATCGGTTCCTGAATCACTTCTCCGGCAATCCGCAGGTGGCATCGCCCACGTCAATGGTGTCGCCCGCCGGGTAAAGCAGTGCCATCAGGCGGGGCCAACAATACTGCGCTGCCCGCCTGCGGTTTTCAGGCCAGGGGATTAGTTTGCAGATCGCCATACATCGGGTAGATATATCATCCACCGCTTTGACGTTCGCCAGCTGCGGTGTGTCGCCTCACAAAGGTCATTTGTGGCGAAATTGGCTGCTTGCCGACTTTTTCAGGCCGCGCTTTTGCGCTTCCTCCAGCCACGCTTGCGGCACTTCGCGTGAACTGCGCAACGCCCGATCGCCCGCCATAAACTCACGGCTTTGCTGGCTTAAGCCCTTCTCCGTACGATCGCTGATATTGCCAGCACCAGGTTAAACGCAAGCAGACGCCGCAATATCAGCACCAACAGAAAAAGCAATGCGTAATGACACGGG
+>8b55f8dd-3fcb-478c-8384-6df32ed6400b
+CCCCATCGGTATGCTTCGTTCCGGTTACGTATTGCTACTTGCCTGCTCGCTCTATCTTCGGCGTCTGCCCGGGTGTTTAACCTTTGCAGGCAGACGTATTGCATTAACAATGGTTCAGCGTTGGCGGCTTTGACATCCTGCAAAATCTGGCGCAGCGTTTGCTCGGTTTGCTGTGGCTGAAAACCACGCAAACCGTCATTACCGCCAGTTCAACCAGCGCAACTTGCCGCGGCTGATGCTGTTCAGCAGAGCCGGAAGGCGCGCCAGTCCTTGATACGAGTGTCGCCGCTGATGCTGGCATTAACTACCGACGTTTTACTCTGCCACTTATCATTCAACAAGGCAGGCCAGGCCGCGCTGAACATTCGATACCCGGCGCTCAGGCTATCACCCAGAATCAATAACGTGTCCGCTGCGGGCGCTACGGAAAGTTAACTGGGACCAGGAACGGAAGGGCAAATGCCAGCGGAAAGTATTGGGATTCACCATCTTAAGAAGTCCGTCGGTCAGGGGCATGAACTCTCCATCCTCACCGGAGTTGGTGGTTGTCAAACGGCGAGACCATCGCACTGGTGGGCGAGTCGGAATCAGGTAAGTCAACCTTGCTGGCGATCCTCGCCGGGCTTGATGACAGCAGCAGTGGCGAAGTGAGTCTGGTGGGACAACCGCTTCACATAATATGGACGAAGCGCGGGCAAGATTGCGCGCGAAGCACGTCGGCTTTGTTTTCAGTCATTTATGTTAATTCCTACCGCCAACGCGCTGGAAAACGTCGAGCTTCCAATGCTGCTGCGCGGTGAGTAGCGCGGAAAGTCGCTAACGGGGCGAAAGCGTTGCTCGAACAGTTAGGGCAGGGGCAAACGTCTGGATCATCTTCCGGCACAGCTTTCCGGCGGTGAACAGCAACGAGTGGCGCTGGCACGAGCCTTTAATGGTCGACCTGATGTGTGCTGTTTGCCGACGAACCCACCGGCAACCTTGACCGCCAGACGGGCGATAAAATTGCCGACCTGCTGTTTTCCCTCAACCGTGAACATGGCACCACGTTGATTATGGTGACCCGACCTGCAACTGGCAGCACGCTGCGACCGCTGCTTACGGCTGGTGAACAGGCAGTTGCAGGAGGAAGCATGATTGCACGTTGGTTCTGGCGCGAATGGCGTTCGCCGTCATATTAATTGTCTGGCTGGCGCTAAGCCTGGCGGTGGCCTGCGATGCTGGCGCTGGGCAATCAGCGATCGCATGGAGAAGGGCCAGCCAGCAAAACCGTGAAAGTTTATGGCGGGCGATCGGGCGTTGCGCAGTTCACGCGAAGTGCCGCAAGCGTGGCTGGAGGAAGCGCAAAAGCGCGGCCTGAAAGTCGGCAAGCAGCTGACTTTCGCCACAATGACCTTGCAGGCGACACACCGCAGCTGGCGAACGTCAAAGCGGTGGATGATATCTACCCGATGTATGGCGATCTGCAAACTAATCCCCCTGGCCTGAAACCGCAGGCGGGCAGCGTATTGCTGGCCCCACGCCTGATGGCACTGCTTAACCTGAAAACGGGCGACACACCATTGACGTGGGCGATGCCACCTTGCGGATTGCCGGAGAAGTGATTCAGGAACGGATTCCGGTTTTAACCCCTTCAGATGGCTCCGCGTCTGATGATGAATCCTGGCGGATGTCGATAAAACCGGAGCCATTACAGCCGAAGTCAGGTCACCTGGCGTTATAAATTCCGGCGGCAACGAGAACCAGCTCGACGGCTATGAGAAATAGTTGTTACCTCGGCTTAAACCCGAACAACGCTGGTACGGTCTGGAACAGGACGAAGGCGCGCTGGGGCGATCGATGGAACGCTCGCAACAGTTCCTGCTGCTTTCGGCGCTTCTGACCTTGCTGCTGGCAGTGGCAGCGGTGGCGGTAGCGATGAATCGTACTGTCGCAGTCGCTACGATCTGGTGGCGATCCTCAAAACGCTGGGGGCAGGGCAGGCGCAACTGCGTAAGCTAATCGTCGGTCAGTGGTTGATGGTGCTGACGCTTTCAGCCGTTACCGGTGAGACCCATAGGCCTGTTGTTCGAAAACGTGTTGATGGTGCTGCTCAAGCCCGTTTCGCCTGCTGCACTACCGCCAGCCAGCCTCTGGCCATTAACGTGGGCGCTTGGCACCATGGCGGTCATCTCGCTGCTGGTGGGGCTACGACCATATCGCTTATTTGCTGGCCTTGCCAGCTTTACGCGTATTACGTAATGATGTGGTAGCGAACGTCTGGCCGCTGAAGTTTTATCTGCCGATTGTCAGTGTGGTGGTTGTGCTGCTGCTCGCTTGGCGGATTAATGGGTGGCAGCATGCTGCTTTAGGCAGTGGTGCTGGCTTGGGCGCGGTAGTACTGGCTGCTGTGCGGTGTGCTGGGCTGGATGCTGCTGAATATTGCTTCGCCGCATGACTGAAATCGCTGCCTCTGCGCGCCTGGCGGTTAGCCGCCTGTTACGTCAGCCGTGGTCAACGTTAAGTCAGCTTTCGGCATTTTTCGCTCTCAGCATGCTGCTGGCACTGCTGCTGGTGTTGCGTGGCGATCTGCTCGACCGCTGGCAGCAGCAGCGCTACCTCAAGCCCAGACTACTTTTTAATTAACATCGCCACAGAACAGGTAGCACCGCTAAAGCGTTCCTCGCGGAACATCAGATAGTCCCGGAGATCGTTTTATCCGGTGGTGCGGGCGCGGCTGACGGCGATTAACGATAAGCCGACAGAAGGTAATGAAGATGAGGCGCTTAACCGCGAAACTCAATCTTACCTGGCAAAATACGCTGGCCCGATCATAATCCGGTGTCGCCGGTAACTGGCCGCCAAAGCCGATGAAGTGTCGATGGAAGAGGGCTGGCAAGCAGCAAACGTTGCCCTCGGTGATACCGTGACTTTTATGGGCGATACCCAGGAGTTCCGCGCTAAAGTGACCAGCCTGCGCAAAGTGGACTGGGAGAAGGTCTGGCCCTAATTTCTATTTTTATTTTCCCTGAAGGGCATTGAACGGGCAACCGCAGGACTGGCTTACCAGTTTCCGCTGGAGAATGGCAACGGCATGTTGACGCAACTCAACCGCAAGTTCCCGACCATTAGCCTGTTAGGTATTGGCGCGATTTTTAAAACAGGTCGGTCAGGTGCTGGAGCAAAGATGCGTCGGGCGCTGGAAGTGATGAATGGTACTGGTCACCGCCTGCGGTATGTTGCTGTTGCTGGCACAGGTGCAGGTGAGAATGCGTCAGCGTCATCAGGAGCTGGTGGTGTGGCGCACACTCGGTGCGGGAAAAACTGCTGCGTGTACCACGTTGGTGTGAGTTCGCCATGCTTGGGTTTGTTTCCGGCCTGGTGGCCGCAATTGGTGCGGAAACGGCGCTGGCGGTCTTGCAGGCGAGTGTTTGATTTTCCGTAGGAGCCAGACGGCGATTGTGGATTGTTCTGCCGTGCACGGCAGGCGCTGCTGCTGTCGCTTTCGGCGGCTGGCTGGGTGCGCGACTGGTTAAAGGGTAAGGCGCTGTTCAGGCGAAGTTTGCGGGGGTGATGAGTAAAATAAGGGGCGTTCTGGTTGGATATGGAACGCCTTGTTTAAATTAATTCTACAATATGTTTCATTGATGATGTTATTGAATTGGTGATTTCCTATCTTTTCTATTGCTGATATTGTAATCTGAATCGGTGGGTTTATTGATTTTAAATATAGCCCTACAAAAATAACTCAGACTAATAAAATCATAAAATCATATGCGTTGAATGGATATTATCCATATAGTGAATTTGTTGATGAATTCATCGTGCTAAAATGTTAGTTTAATAAAATATTGAAAGTATTACTGTAATAACAGTTTAATTTGTTGATTGAGAACAAATAAGTTTATGTGAAAAATATGTAAATCACATTATGGTCTTGTGTGTCATTTTATTTTTTGTTGCTAACACAGGATATGAACAATAACCTAAAGGGCACTTTATGAGCGGAAAACCAGCGGCGCGTCAGGGAGATATGACTCAGTATAGCGGTCCCATTGTCCGAGGTTCGGCAGGTGTAAGAATTAGCGCGCCCACCGGCGTGCGTGCTCAGTATTGTCGGGCAGGGATGACTTCGGAACGGCCGGTAAATCCGCTGCTGGGGGCGAAGGTGCTGCCCGGCTTTGAGACGGACCTTGCGCTGCCCGGCCCGCTGCCGTTCATTCTCTCCCGCACCTACAGCAGCTACCGGACGAACGCCTGCACCGGTAAGGCGTTTTCGGCCCCGGCTGAAAACGCCTTCTGATATCCGCTTACAGCTACGTGATGACGGACTGATACTTTCAACGCGACAACGGCGGGCGGAGCATTCACTTTGAGCCGCTGCTGCCGGGGAGGCGGTGTACAGCCGCAATGAGTCAATGTGGCTGGTGCGCGGTGGTAAGGCAACACAGCCGGACGGCCATACGCTGGCACGCGGCTGTGGGGGGCGCACCGCCGGATATCCAGTTAAGCCCGCATCTTTACCTGGCGACCAACAGCGCACAGGGGCCGTGGTGACTGGGGTGGTCTGGTGGGTGCCGGGTGCTGAGGACGTACTGCCAGCGCCGCTGCCGCCATTACCGGAGTGCTTACCGGGATGGCGGACCGCTTCGGGCGGACGCTGACGTACCGGCGTGAGGCCGCTGGTGACTGACCGGGGAAATCACCGGCGTGACGGACGGTGCCGGGCGGGAGTTCCGTCTGGTGCTGACCACGCAGGCGCAGCGATGCGCGGAAAAGGCCCACACCTCTTCGCTATCTCCTTCTGACAGTTCCCGCCCTCTCTCAGCCTCAGCGTTCCCCGACACACTGCGGTACCGAATACGGCCTTCGACAGAGTATCCGCCTTTCGGCGGTGTGAAGCTGTCACGACCCGGCATACCGGAGAGCCTGCCGCTGCGCCACTGGTGCAGTACACGTATACGGAAGCCGGTGAACTGCTGGCGGTATATGACCACCAATACGCAGGTACGCCTTTCCACGTATGACGCGCAGCACCCGGGCCGGATGGTGGCGCACCGTTACGCGGGAAGGCCGGAGATGCCGCTACCGCTACGATGATACGGGGCGGGTGGTGGAACAACTGAACTTCCAGCGGGTTAAGCTACCGCTATCTTTATGAAACGGGACCGCATCACCGTCACCGTGGCCTGAACCGGCGTGAGGGTGCTGCATACAGAAGGCGGGGCCGGGCTGAAACGAATTGGTGAAAAAGAACTGGCGGACGGCAGCGTCGCGCAGCGGGAGTTAAGCTGCAAGCAGACGCCGAAGATAGAGCGGC
+>f163818d-019b-4937-b07d-023528a6cbea
+TTGTTGTACTTCGTTCAGTTCGTATTGCTTTTCTGTTGGTGCTGATATTGCGGCGTCTGCTTGGGTGTTTAACCTAACACCGCCAGCAAGGACAAACAGCATCATGCCATTAAGACCAGAACCGACACCGCCGAACACCACTTCACCAATTTGCATCAACCACATCGGCACCATGCCACCGAGAGCGGTAAACCGGATCATGCATCCGCAATCACCGCGCCACAGAAGCCGCCGTCGTCGACCGCAAACAGGCTGCGAAACCAGCGCCGAAACGGCTCTCTTTACCTTCCATATTGATGCTGCTGTCGTGCCCAGTGCCAGCAGATGAGGATTACCCTGAACTTCTGCCCACATCACCACGCCTACGCAGATGACAAAATCACTGACATCGCCCACAGCGACATGCGCCCCTGGCGGCGATCGCCCATCACTTCACCAAAGGCAAAGCACAGTGCCGTTGGGATCAAAGAAGATCGCCAGCATCTGCACGAAGTTGGTCAATTACGGTTAGGTTTTCAAACGGATGCGACGAGTTGGCATTAAAGAAATACCGCCGTTAGTACCGAGCATCTTGATCGCTTTCCTGAAGCTACAGGCCCCATGGGTAGCTGTTGCGCTCCTTCAACAGTATTCACAGCCTGATAAGGCAGAAAGTTTACAGCGCACCTTGTTGAATAAAAACAGTGCAATCAACAACGCCACGGGGACTAGCACCCGCCAACGTGATGCGTAGCAGATCGACCCAGGCATTCCCGAGCGTGCTCATGCTCTGGCGGAGTAAACGCACGGATGAGGGGCAAAAATCACCGCAATCCCGCTGGCGGCAGAAGAAAGTTTTACACCGTTAAGCCCGCCATCTGGCTGGAAATAGCTCAACGTGGTTTCACCGCTATGGTGCCAGTTGGTATTGGTATTGACCAGCTGACGGCGGTATTCAGCGCCAGATCCACGACAGCCCTGGCAACTGCTGTGGATTAAGCGGCAGAATAATTTTGACCGAGCAACATAAAACAGCACCGCCAGCCCCAGCATGTTCAGGCCGAGAATGGCACAAAGATATTTGCTTCAGTTCATCTCCACGGTCAGAGACGCCAAATTAGCGAAAAGTACGCTCAACGCCCGTTGTACCGGGAAGAGGAATGTCATTAATCAACCGCGCCAGCCCGCTGCCTAAAGGACGCGCCAACTTCATTAACACCAGTAAACGTGGCGATCAGTAGAACCCTTGCGCAGCCATCAGAACGCCTCCGCATTGATCAGGGCATAAACCAGATAACCCAGTAATAAAACACCAGCAATACGCCGGTTATCGCGCCTGCACTTCTACAGTGCACCTCCAGTGGCCTAAAAGTGATACCGGAAGGTAGAATTCTGGCTGCAAAGATTTCGCAAAATCTGCGGGCGGGGTGTAAAAAGAATATAAAAATGGCAAAGCCATGGTTGCTAATGTTTAGTATTAATTTAACTTTATTGTAACTTAATTACAGGATGAATGTAAATAAACCATCAATAAGCAAAAATAAGTGGTCCGGATGGTGATAAAATTACACAAAAGGCGGTACTATTTTCATCAGATAAACAAATTCATTTTCAGTGCCATTCACCGGTAGATACAAAAGGGGAAAAGTATGGAACTCTACAGAGAATATCCTGCATGAGTTAAAACACCCAAGCAGACGCCGAAGATGAAACGT
+>fb405411-031d-4447-8096-b603693b1fe7
+TTGTTATTGCTTCGTTCCAGTTGCATTGCTTTTCTGTTGGTGCTGATATTGCAGCGTCTGGCGGGTGTTTAACCTCGAAAGTCCACAATACTGCGGCCTTCCGGCGTTTCATCAGCCAGCGAAGCCAGTTGTGCGGCGTCAGCCAGCGTTTTTCATCCACGCCCTGCGCGGATAAACTCAAACGCCTGACGGTTACCGAGGTGATGGTGCCGGTTTTATCCAGTAGCAAACGTCAACGTCACCCTGCCGCGCTTCTGCGTCCGCTACAGGTGGCAATCACATTTCGCGCCTAGCATCGGCTCCTCCCGACGCCGATCGCTGACAACAGGCCGCCAATAGTGGTTGGGATCAGACGAGCCAGCAGCGCCACCAGTACCGTTGTGACTGCATTACCGCCCCCACGCGGAAAACGGCCACAGCGTGGCGGTTGCCAATAAAGACGATAGTCAGGGCAATCAGCAGAATGGTCAGGAACGGAGAATTTCGTTTCGGCGTTTTGCGCCTGTGCGCCTTAACTTCCACCATCGCGATCATCCGATCCAGAAATGTCTCGCCGGGGTTAACGCTACACTCAATCACCAGCCAGTCAGAAAGAATACGCGTGCCGCCGGTGACGGAGGCAAAATCGCCGCCGGATTCACGGATCACCGGTGCCGATTCCCCGGTGATGGCGCTTTCATCGACCGGTACCCCTTCAATAACTTCACCATCGCAGGATAATATCGCCAGCTTCTACCGGTGATATCGCGCTTTACGAAGTTGGTCGGCAGGGCTTTGTCGCCGCAGCGCCATCATTTCGGCTCGCGCGGCTTGCGGGCAAAGGCAGTTTTTCACCCCCCTTTCAGACTGTTGGCCTGCGCTTTGCGGCCTTCTGCCAACGCCTCGGCGAAATTGTAGCGAACAGTACGGTGATCCACAGCCAACCGCTAATGGCCGCGCTAAACAGCGCATTGCCGGGCATCGCACCGCTTGCCATCGCGATGCTAATGCAATTGGTCGGCAGACTGCCGATCCAGACGATAAACATCACCGGATTGCGCCATTGCGCCTGCGGGTTTAATTTTCACCGCTTCTTTCAGCGCCTGAACGACAAGTGTTGGTTCGAATAGCGCCAGTTGTTTACGACTCATATTCGAGTGCTCCTCAATATCATCGGAGATATTCCGCCACCGGACCAAGCGCCAGGGCAGGGGATAAAGGTCCAGTGCGCCAACCAGCACAGTGCCGATTAACGGGCCAACAAACAGCCGGGCCGTGCGTTCGGCAGCGTGCCGGAGCTGGCGGCTTGGCTCTTTTACTCACCAACGAACCGGCAATTGCCATCCACCAGGGGATAATCACCCCAGAGCGACCGACAAACATGCAGAACGCCAGTAAACAGTTCCAGAACGGAGGTTGGCGCTTAATCCGGCAAAGGCGCTGCCGTTGTTAGCGGCGGATGACACGGCGTACAGCACTTCCTTCGCCATGCGGGCCAGGGTTGAGCATGGCGCTACGTCGGCGTCGGTCATCATCGTAACGCCGCGCCCATCAACACCAGCGTCAGGGGTAACCAGAATTGCCAGTGCAGTCAGTTTCATCGCGTACGTCGATTTTTTTACCCAGATATTCCGGTGTACACGACCAATCTCAGCCCGGCAATAAACACCGCCAGCAGGACAAACTGGCATCATGCCGTAAGACCAGAACCATTACCGCCGAACACCCACTTCGCAATTTGCATCAGCCACATCGGCACCATGCCGCGAGGCGATGAAGCAGATCATGCATCGCAATCACCGCGCCACAGGAAGCCGCCGTCGTCACGACCGCAAACTGGGCTACTGACCAGCGCGAAACGGCTCTCTTTACCTTCATATTGATGCTGCTGTCCGTGCCCGGTGCCAGCAGATGAGGATTACCCTGAACTTCTGCCCACATCACCACGCCTACGCAGTTGTTAAAAATCACTGACATCGCCCACGGCAACATGTGCGCCCCTGGCGTGATCGCCCATCACTTCACCAAAGGCAAGCGCAGCGTCGTTGGGATCAAGAAGATCGCCAGCATCTGCACAGGGTGGTCAGTGCGGTTGGGTTTTCAAACGGATGCGACGAGTTGGCATTAAAAGCCACCGCCGTTAGTACCGAGCATCTTGATCGCTTCCTGAAGCTACAGGCCCCATGGGTAACAGCTGTTGCGCTCTCCTTCAACGGTATTCACAGCCTGATAAGGCAGAAAGTTTTGCAGCGCACCTTGTTGAATAAAAACAGTGCAATCAACAACGCCACAGGGACTATATAACGTGATGCGTAACAGATCGACCCAGGCATTCGAGCGTGCTCATGCTCTGGCGGGTAAACGCACGGATGAGGGCAAAAATCACCACAATCCCGCTGGCGGCAGAAGTTTTACCGTTAAGCCCGCCATCTGGCTGAAATAGCTCAACGTGGTTTCACCGCTATAAGATTGCCAGTTAATTATTGGTGACAAAGCTGACGGCGGTAATTCAGCGCCAGATCCCACGACAGCTGGCAGCTGCTGTGGATTAAGCGGCAGATGAATTGCTGACCGAGCAACATAAAAACAGCACCGCCAGCCCCAACGTGTTCAGGCCGAGAATGGCACAAGATATTGCTTCCAGTTCATCTCACGGTCAGAGACGCCAAGTGCGCGAAAAAGTACGCGCTCAACGCCCCGTTGTACCGGGAAGAGGAATGTCATTAATCAGCCGCGCCGGCCCGCTGCCTAAAGGACGCGCCGGCACCATTAACACCAGTAAAGCAATGGCGTCAGTACAGAACCCTTGCGCAGCCATCAGAACGCCTCCGCATTGATCAGGGGCATAAACCAGATAACCCAGTAATAAAAGCACCAGCAATACGCCGGTTATCGCCTCACCGGTGCACCTCAGTGGCCTAAAAAGTGATACCGGGTAGAATTCTGGCTGCGCAAGATTTCGCAAAAATCTGCGGGCGGGGTGTAAAAGAATATAAAATGTAAAAAGCCATGATTTAACTAATGTTTAGTATTAATTTAACTTTTTGTGTAACTTAATTACAGGATGAATGTAAATAAACCATCAATAAGCAAAAATGGTGGTCGGATGGTAGTAAAATTACACAAAAGGCGGTACTATTTTCATCAGATAAAACAAATTCATTTTCGGTGCCATTCACCGGAATTACAGATACAAAAGAGGGAGAAAAGTATGGAACTCTACAAGAGATATCCTGCATGGCTTATCTTTTTACGCCATTACTTATGCAGTTTGCAGCGGGCGTTCTGGCGCTGCGCTCATACTTTTCTGGAAAGACCGCGCCCGCTTTTGGCTACCTGCATCGCGTCTGGTCGAAAACCAGCGATAAACCGGTGTGGATGGATCAGGCCGAAAAGGCAACTGGTGATTTTTATTGATTGCTGAGTTTGAATGCATTTATGAAAACCGCCAGCGGAAACGCTGGCGGTTTTATCGAGGAAGATGTTCAGAGGAATATTTGAACTTGTCGTTATATACCAGTCGAAACGCTATATTCATGAAATATATATAAATATTTTCCTAATTGTTCTTATCTGACAGATATCTCACTACAGGCTTTCTTATAAATCACCAGCGGGGTTTCACCTGTCCAGACAAATAACCCGATAAAACAAGGATGAGCAGATGGAGCGGAAACCGGCGGCGGCGCGTCGGGGCGACATGACGCAGTATGGCCGGTAGCATTGTCAGGAGGTTCAGCCGGGGTACGCATCCGGTGCCCACCGGCGTGGCCTGTTCGGTGCCCGGCGAGTTGACGTCCGGCAATCCGGTCAATCCGCTGCTCTCGGTGCAAAGGTCCTTCCAGTGGAAACCGACATCGCCTACCCGGCCCGCTGCCGTTCATTCTCTCCCGCACCTACAGCAGTTACCGGACAAAAACGCCCGCGCCGGTGTTGGGAGCCTCGGCTGGCTGGAAAATGCCTGCGGATATCCGCTTACAGCTGCGCGATAACACACTGATACTCAGTGATAACGGCGGCAGAAACCTGTATTTTTGAGCACCTGTTTCCCGAGTGAGGACGGTTTACAGCCGCAGCGAGTCACATGGCTGGTGCGCGGCGGCGTGGCGAAACTGGATGAAGGTCACCGGCTGGCAGCCGCCTCTGGCGAGCGCTGCCGGAAGAACTCGCTTAAGTCCGCATCGTTATCTGGCGACAAACAGTCCGCAGGGGCGAGTGGTGGCTGCTCGGCTGGTGTGAGCGGGTGCCGGAAGCGGATGAGGTGCACCTGCGCCGCTGCCGCCGTACCGGGTACTGACCGGGCTGGTGGACCGCTTCGGGCGCACCAGACGTTCCACCGCGAAGCCGCCGGTGGTCAGCGGCGAAATCGCAACGTGACGGATGGTGCCGGGCGTCACTTCCGGCTGGTACTGACCACGCACCAGGCGCAGCGGGCAGAAGAAGCCCGGCAGCCAGGCCATTTCCGGCGGACGGAACCGTCCGCTTTTCCTGATACCCTGCTGCGGGTTACACCGAATATGGCCGGAACAGCGGCATCCATCTGTCTGCCCGTGTGGCTGACGCACGACCCGGAATACCCGGAGAATTTACCTGCCGCGCCTTTGGTGCGCTGCTGGCTGGAACGCCCGCGAACTGGCGGCGGTGTATGACCACCCAGCAACACAGGTGCGCAACTTTACTTACGGTGATGATAAATACCGGGGCCGGATGGGCGCACCGTCACACGGGCCGACCGAAATCTGTTACCGTTACGACAGCGACGGGCGGGTGACAGAACAGCTAAACCCGGCGGGCTTAAGTTACGTATCAGTATGAGAAGGACCGCATCACCATCTGCCGACAGCCTGAACCGCCGTGAAGTCTGCTGCACACACGCAGGGTGAAGGCGGGCTGAAGCGGGTGGTGAAAAGGAACGCGCGCGGACGGCAGCGTCACGCAGAGTCAGTTTGCTGACGCGGTGGAGGCAGGCTCAGAGGCGCAGACGGATGCCGCAGGCGGGACAACGAATACAGTCCGGATGTGGTGACGGGCCTGTCACGCGCATCACCACGCCGGATGGCAGGGGCATCGGCGTTTTATAACCACCACAGCCAGTTAACGTCAGCCACCGGGCTGACTGGGCTGGAAATACGCCGGGAATACTGATGAATGGGGCCGTCTGATTAGGAAGGCTGCCCCTGACGGCGATATCACCCACTACCGTTATGATGTCCACGGTGAGCTTACCTGCGCAACGGAAGATGCCACCGGCGGCGGAAAACCATGACGTGACCGTACGGTCAGTTGCTGGCTTCACTATTGTTCCGGTTATGTAACCCGCTATGACCATGACCGTTTTGGTCAGGTGACGGCGGTGCACCGCGAGGAAGGGCTGAGTCAGTACCGCGCATACGACAGCCGTGGACAGTTAATTGCCGTGGAGCACGCAGGGCCATGAGCGCGGTATGAATACAACGCCGCCGGTGACCTGACCACCGTCATTACCCCGGACGGCAGCAGAAACAGGACACAGTACGGTACGTGGGGAAAAGCCATCTGTACCACACCCAGGGCGGTCTGACGCGCAGTATGGAATACGATGCTTACCGGATTTGGGTCATCCCGCCTGACCAGTGAAACAGCAGCCACCACCTTCCGTTACGATGTACTCTCGACCGGCTGATACAGAAACCGGCGGCACGACGGCCGCGCACAGCGTTATCACCCACGACCTGACGGCAAACTTATCCGCAGCAGCGAGGATGAGGGCTGAACCACCCACTGGCACTATGACGAGCAGACCGCCTCGCACCGCACCGTGAATGGCGAAACCGCAGAGCAGTTGGCAGTATGACGAACGCGGCTGGCTGACGGACATCAGCCATATCTGGCAGAAGGGCACCGGGCGGTGCACTATGGATTATGACAGTAAGGAGCCGCCTCGCCAGTGAACACCTGACGGTGCATCATCCGCAGACAGATAGACTGCTCTGGCAGCGTAAAGAGACCAGACATGCGTACAGCGCACGGGGACTGGCGAACCGCTGTATACCGGACAGCCTGCCCGCCGTGGAATGGCGTGACCTACGGCAGCGGCTGGCTGTCGGGCATGAAACTCAGCGACTACACCGCTGGTGGAGTACGCGACCGCCTGCACCGGGAAACGCTGCACCCAGCTTCGGCCGTTATGAACTCACCACCCGCTTATACCCCTGCCGGGCAGTTACAGAGCCAGCACCTGAACAGCCTGCTGTCTGACCCGCGATTACACCTGGAACGACAACGGCGAACTCATCCGCATCAGCAGCCCGCGCCAGACCGGAGTTACAGCTACGGCACCACCGGCAGGCTGACCATTTCACCACCGCAGCAGATCTGGATATCCGCATCCCGTATACCACAGACCGGCAGGTAACCGCCTGCCCGACCCGGAACTGCACCCGGACAGCACCCTCAGCGTAATGGCCGGATAACCGTATCGCCCGTGACGCACTATCTTTACCGGTATGACCGTCGGCAGGCTGACAGAAAACCGACCTCATCAGGAGGGTTATCCGCGGATGATGAGCGCACCCACCGGTACCATTACGACAGTCAGCACCGGCTGGTGCACTACGCGCGGACACAATATGCAGAGCCGCTGGTCGAAAGTCGCTATCTTTACGACCCGCTGGGCCGCAGGGTAGCAAAACGGGTATGGCGGCGTGAACGGGACCTGACGAGCTGGATGTCGCTGTCACGGAAACCGCCGTGACCTGGTACGGCTGGGACGGCGACCGCCGAGCCACGATACAGAACGACAGAACCGCATCCAGACGATTTATCAGCCGGGGAGCCACGCCACTCATCAGGGTTGAAACCGCCACCGGTGGACTGGCGAAAACGCAGCGCCACCTTCGGCGGATACCCTTCCAGCAGTCCGGTGGCGAAGACGGTGGCAGTGTGGTGTTCCGCCGGTGCTGGTGCGAATCTTTCGACCGGCTGGAAGAAGTGAAATCTGGCTGACCGGGTGAGTGAGGAAAGCCGCCGCTGGCTGGCATCGTGCGGCCTGACGGTGGCGCAGATGCAAAGCCAGATGGACCCGGTATACACGCCGGCGCGAAAAATTCACCCGCAGCGCCACTGCGACCATCGCGGCCTGCCGCTGGCTGGCCCGCTATCAGCACGGAAGGGACAACAGCGTGAGTACGCAGAATACGATGAATGGGGTAACCTGCTGAATGAAGAGAACCCGCATCAGCTGCGGCAACATCCGCCTGCCGGGGCAGCAAGTATGATGAGGAGTCCGGCCTGTATTACAACCGCCACCGCTATTATGACCGCTGCGGGGGCGATATATCACTCAGGATCCGATTGGGCTGAAGGGGATGAATTTTATCAGTATCCGTTGAATCGATCTCAAATATAGATCCATTACTGGGATTAGAAACGCTAAAACCGTTAAGCCACTGCATTCAATGGGCGGAACTGGTGAAAAGCGGTCCAGATATATGGGGAATCCGTTCTATCAATATCTTTGTGTCCCAGATGGTAAAGGGGACTATACTGTGGTGGCCAAGACCAACGGGGAGAATCAAAAGGAGAGATGGTCTATAGAGGGGCCAGGTAGAAACCAAGTAATGATACAAAAGCTGCTGGCCGTTGTGACCTCGTTGAAACCGATAATAGTTGTGTGGAGAACTGTTTAAAGGAAGTTTAAAGAGGTAAGGCCGCGTTATTCTGTATTGCCTGATATTCACACCGATTTAGGGCTATTTAAAACTGCCAAGACTGGTCTAATGATTCTTTAGAAATAGCAAGATGAAGTGCTCGGAAATAACATTGGACGTTTTATTAGATTTGTATTCACCGGAGTGATGTAATGAAATATATTATTTTTTATTCAGAGCTATATGGCTGGCTTTATCGCTTTTAATACTATTCTTTTCCATGCATAGACTTTCACTATTAGACTCCACTCGTGATGTGAGCGAGTTAATTAGTCTCATGTCTTATGGAATGATGATGGTAATATGTTTTCCAACAGGCGCAGGTATTCTTTATTGCTCTAATATTTATAGGGACTGTATCAATTTATTATTGGCGTAAGTTGATGAAATAAGTATATATTATGGCGATAATAATATGGCTTTATTTTCTGTCAGGGAGGGTATATTCAATGGTTTGTATTAAGTGGCGCATTATAAACAAATAAATTAAAGTTAATTGCTCTTATTATGGGTTAAACTTGCAAGCAGACGCCGAAGATAGAGCGACAGGCAAAGAGCAATACGTAACTGG
+>5e348aa0-252a-4ba2-b659-f460207d0f86
+TTGGTATGCTTCGTTCAGTTGCGTATTGCTACTTGCTGTCGCTCTATCTTCGGCGTCTGCTTGGGTGTTAACTAGATGGCTTTCCCGCATCGTACTGTGTCCCGTTTCTGCTGCGTCGGGAGCAGCCAGCCGACGGTGGTCAGGTCACCGGCAGCTGTATTCATCACCGCGTTTCATGGCCCTGCGTGTCTTTCTGACAATTAACTGTCCACGGCTGTCGTATGCGCCGGTACTGACTCAGCCCAGCGCTTCCTCGCGCGGTGCACCGCCGTCCACCTGACCGAAACGGTCATGGTCGCGGGTTACATAACCGGAACAGTCGTGAAGCTCAACCTTTGACCGTAACGGCTCCACGTCATGGTTTTCCGGCTGCCGGTGGCATCTTCCGTTGCGCAGGGTAGAGTCGCAATGTGGATTATCATAACTGGTATGGGTGATATCGCCGTCAGGGCAGTTTCCCTGAATCAGACGGCCCCATTCATCATATTCCGGCGTATTTCCAGCCCGTCAGGTGGTGGCTGGCGATTAGCTTCGCTGGTGGTTATGGTAAAACGCCGATGCCCTGCCATCGGCGTGGTGATGCACGTGATAGAGGCCCGTCACACCACATCGGACTGTATTATTGTCCTGCCTGCGGCATCCGTCTGTGCCTGGAGCCTGCCCACCGCGTCAAACTGACTCTGCGTGACGCTGCCGTCACTGTTCCTTTTTCACCGCTTCAGCCCGCCTTCACCCTGTACGTGCAGGACTTCACGGCGGTTCAGGCTGTCAGTGATGGTGATGGTCCTTCTCATACTGATACGTGTAACTTAAGCCTGCCAGGTTTGGCTGTTCTGTCACCGCCCGTCGCTGTCGTAACGGTAACAGATTTCCGGTCAGCCCGTGTGACAGTGCGCCACCATATCCGGCGGTATTTATCATCGTAAGTAAAGCTGCGCACCTGTGTGCTGCGGTCATACCACCGCCTGCCAGTTCGCCGCGGGGCGATCAGCCATAGCGCACCAGCGGCGCAGCGGTAAATTCTCAGGTATTCCGGGTCGTGTCCAGCCACGGCAGACCAGACGGATGCCGTTGTCAGCCATATTCGGTGTAACCCGGCAAATTATCAGGCGGACGGTTCCGTCCCGCCGGAAATAACTTCTTTGCCGGGCTTCTTCTGCCCGCTGCGCCTGCGTGGTCGGTACCAGCCGATGACGCCCGGCACCATCCGTCACGCCGGTGATTTCGCCGCTTCGTTACAGCGGCTTCGCGATGGAACGTCTGTTATTGCGCCCGAAGCGGTCCATAGCCCGATCAGTACCCGGTACGGCGGCAGCGGCACCAGGCAGCACCTCATCCGCTTCCGGCACCCGCTCACACCAGCGAGCAGCCACCGGCCTACGGACTGTTTGTCGCCAGATAACGATGCGGACTTAAGCGGGTTCTTCCGGCAGCGCCTGCCAGAGTGCGGCCAGCCGGTGACCTTCATCAGTTCGCCACGCCGCCGCGCGCCAGCCGCAGTGACTCCTTTAAGCAAACAATCTCTCACCGGAATTGCAAAAGCCAGTAGACTGCCGCCATTATCACTGGTATCAGTGTGTTATCGCCTGGCTATGTAAGCTGGATATCCATAGGCATTTTCCAGCCAGGGCCGAGGCTCCCCACCGGCGCAGGCGTTTTTGATCCGGTAACTGCTGTAGGTGCGGGAAGAATGAACGGCAGCGGGCCAGGCAGGGCGATGTCGGTTTTCACCGGGAAGGACCTTTGCACCGAGCAGCCGGTTGACCCGGATGGCGGACATCACCCCGCCGGGGCACACCGAACCAGGCCACGCCGGTGGGGGCGCGATGCGTACCCAGCTGAAGACCCTGGACAATGCTACCGCCATACTGCGTCATTGTCGCCCTGACGCGCCGCCGGTTTTCGCTCATCTGCTCATCATCCTTGTTTTATCGGGTTGTTTGTCTGTGACAGGCCAGAACCCTACAGATTTATAAAGAAAGCCCAGCAGAATTGCAGGATATCTGTCAGATAGAACAATTAGGAAAATATTTATATATGTTTCGCTTGAATATATATGTTTCGATTGGTATGACGATGTCTAAATATTCCTCTAGACATCTTCCTGATGCAAAAAACCATAAGCGTTTCCGCTGGCGGTTTTCAATAATATTCAAAACTCAATAGTAAATAAAAATCACCAGTTGCCTTTTCGTACAGATCCATCCACACCGGTTTATCGCTGGTTTTCGACCAGACGCGATGCAGGTAATAAAGCGGGCGCGGTCTTTCAGAAAAGCATGAAAGGCAAGCGCCAGAGACGCCCATGCAAGCCGCATGAAATTGACATCAAAAGATAAAGCCATGCAGGATATTCTCTGTAGAGTTCCATACTTTTCTCCCCTTTTGCTGTCTGCCCGGTGATGGCACCGGAAAAATGAATTGTTTATCTGATGAAAATAGTACCGCCTTTTGTGTAATTTTACTACTCGTCGATACTTATTTTTTGCTTATTGATGGTTTGTTTACATTCATCACCGCCAGTGCAAGTTACACAAAGTTAAATTAATACTAAGCATTAGTTAAATCTGGCTTTTGCCATTTTATGTCTTTTACCCCGCCCGCAATTTTTGCCGAAATCTTTTGCAGCAAAATTCTACCCTTCCGGTATCACTTTTGGCCGCCAGGTGCATGAGTGCAGGCATGATAACCGGCGTATTGCTGGTGTTTTTATTACTGGGTTATCTGGTTTTATGCCCTGGCGTCAATGCGGAGGCGTTCTGATGGCTTTGCCAAAGGGTTAATACTGATCGCCACGTTTTACTGGTGTTGAATTTTGGCGTCCTTTAGGCAGCGGGCTGGCGCGGCGCTGATTAATGACATTCCACTCTTCCGGTACAACGGGCGTTGAGCGCGTACTTTCGCCTTGGCGTACTCTGACCGTGAGGATGAACTGGAAGCAATATCTTTTGTGCCGTTCTCGGCCTGGTTTATGCTGGGGCTGGCGGTGCTGTTTTATGATGTTGCTCAGTCCAGCACTATCTTGCCAGCAATCACAGCTTGCGGTTGCCAGGGCTGTCGTGCGGATCTGGCGCTGAATACCGCCGTCGGCTTTGTCACCAATACCAGCGAAAGCAGTCTTATGGTGAAACCACGTTGAGCTATTTCAGCCAGATGGGCTTAACGTTATGGCTTTCTTTCTGCCGCCAGCAGAGTTGCGGTGATTTTTGCCCTCATCGTGCGTTTACCCGCCAGGCATGAGCACGCTCGGGAATGCACCAGATCGATCTGCTACGCATCACGTTATGGGTTACTGGTCCTGTGGCGTTATTGGTTGCTGTTTTTTATTCAACAAAGAATTTGCGCTGCAAAACTTTCTGCCTTATCGGGCTGGCGAATACCGTTGAAGAGGCGCAACAGCTGTTGCACCATGGGGCCTGTAGCTTCTCAAGGAAGCGTCAGATCTCGGTACTAACAGCGTTGGCTTCTTTAATGCCAACTCGTCGCATCCGTTTTGAAAACCAACCACGCGAAGCCAGCCGTGCGGATGCTGGCGTCTTCGCCAGTCAACGGCGCTGTACTTTGCTTTGGTGAAGTGAGGTTAAACACCCAAACAGACGCCGCAATATCCAGCACC
+>f3bfcfc6-b5f3-4573-a280-2718d104f8d4
+TTGGTATGCTTCGTTCAGTTGCATTGCTGCTTGCACCGCTCTATCTTGGCGTCTGGCGGAATTGTTTAACTATCTGGCACCAGCGTCAGAGGTAACCAAATTACCAGTGCAGTCAGTTTCATCGCGTACATCGATTTTTACCCAGATATTCGGTGTACGACCAATCATCCAGCCCGGCAAATGAAAACACATAACCGGACAAACAGCATCATGCCGTAAAGACCAGAACCGACACCGCCGAACACCCGCTTCACCAATTTGCATCAGCCCACATCGGCACCATGCCAGAGCGATAAACGAATCATGCATCGCAATCACCGCGCCACAGGAAGCCGCCGTCGTCACGACCGCAAACAGGCTACTGACCATGCGCCGAAACGGCTCTTTGCACCTTCCATATTGATGCTGCTGTCCATTACTTGGTGCCAGCAGATAGGGATTACCCTGAACTTCTGCCCACATCACCACGCCTACGCAGATGACAAAATCACTGACATCGCCCACAGCAACATGCGCCCTGGCGGCGATCGTATCACTTCACCAAAGGCAAAGCACGGCGCCGTTGGGATGAAGATCGCCAGCATCTGCACGAAGTTGGTCAATGCGGTTGGGTTTCAACGGATGTGAGTTGGCATTAAAAAGCCACCGCCATTTGGTACCGAGCATCTTTGATCGCTTCCTGAAGCTACGGGCCCATAATTGCAGCTGTTGCGCTCCTTCAACGGTATTCACAGCCTGATAAAGACAGAAAGTTTACAGCGCAGCTTGTTGAATAAAAACAGTGCAATCAACAACGCCACAGGGATACGCACCCATATAGCGTGATGCGTAACCTTAGATCGACCCAGGCATTCCGAGCGTGCTCGTACTCTGGCGGGTAAACGCCGCACGGATGAGGGGCAAAATCACCGCAATCCGCTGGCGAAAGTTTGCACCGTTAAAGCCCGCCGTCTGGCTGAAATAGCTCAACGTGGTTTCACCGCTAAGATTGCCAGTTGGTATTGAGTACAGACCAGCTGACGGCGGTATTCAGCGCCAGATCCCGACAGCCCTGGCAACTGCTGTGGATTAAGCGGCAGATAGTGCTGACCGAGCAACGCCAAAACAGCACCGCCAGCCCCAGCATGTTCAGGCCGAGGAATGGCACAAAGACGTATTGCTTCCAGTTCATCCCACGGTCAGAGACGCCAAGTGCGCGAAAAGTACGCGCTCAACGCCCGTTGTACCGGGAAGAGGAGATGTCGTAATCAGCCGCGCCAGCCCGCTGCCTAAAAAGGACGCGCCAGCACCATTAACACCAGTAAAAACGTGGCGATGTTAGAACCCTTGCGCAGCCATCAGAACGCCTCCGCATTGATCAGGGCATAAACCAGATAGCCAGTAATAAACACAGCAATACGCCGGTTATCACGCCTGCACTCACAGTGCACCTCCAGTGGCCTAAAAGTGATACCGGAAGGGTAGAATTCTGGCTGCAGATTTGCAAAAATCTGCGGGCGAGGGTGTAAAAAGTATAAAATGGCAAAGCCATGATTTAACTTCATCGCAGTAACAATTTAACTTTTGTGTAACCCAATTACAGGATGAATGTAAATAGAAGCATCAATAGCAAAAATAAATTGGTCGGATGGTGATAAGAGCCACCGAAGGCGGTACTATTTTTCTGGATAAACAAATTCATTTTCGGTGCCATTCACCGGGTAGATACAAAGGGGAGAAAAGTATGCTACAGAATATCTGCCATGGCATCTTTTACGCCGTACTTATGCGGTTGCAGCGGGCGTTCTGGCGCTGCCTTTCATCTTTCTGGAAAGACCGCGCCCGCTTACGGCTACCTGCATCGCGTCTGGTCGAAAACCAGCGATAAACCGGTGTGGATGGATCGAGCCGAAAAGGCTGGTGATTTTATTGATTGCTGAGTTTGAACCGTGAAAACCGCCAGCGGAAACGCTGGCGGTTTTGTATCAGGAAGATGTTCAGAGGAATATTTAGACATCAGTTACCAATCGAAACATATATTCGCTGATATATATAAATATTTTCCTAATTGTTTCTTATCGGAATATCTCACTTAAGGCTTTCTTATATAAATCTGTGAGGGTTTCGCCTGTCAGCAGACAAATAACCCGATAAAACAAGGGATGAGCAGATGAGCGGAAAACCGGCGGCGCGTCAGGCGACATGACGCAGCGGTAAGCATTGTCAGGGTTCAGCCGGTACGCATCCGGTGCCCCCCACCGGCGTGGCCTGTTCCGGTATTAACCCCGGCGGGGCGACGTCCGGCCATCCGGTCAATCCGCTGCTCGTTACCAGGTCAGCTTCCCGGTGAAACCGACATCGCCCTGCTGACCGCTGCCGTTCGTTCTCTCCGCACCTACGGCAGTTACCGGACAAAACGCCCGCGCCGGTGAGGAGCCTCATTTGGCTGGAAAATGCCTGCGGATATCCGCTTACAGCTGCGCGATAACACACCTGATACTCGGTGATAACGGCGGCCAGAAGCCTGTATTTTGAGCACCTGCCGGTGAGGTTGATTTAGCCACAGCGAGTCATGGCTGATGCGCGGCGGCGTGGCGAAACTGGATAAAGGTCACCGGCTGGCCGCCTCTGGCAGGCGCTGCGGAAGAACTCCAGCAGAAGTCCGCATCGTTATCCACGGCGACAAACATAGTCCTGGGGGCCGTAGGTGGCTGCTCGGCTGGAATTGAGCAGGTGCCAGGAAGCGGATGAGGTGCCACCTGCGCCGCTGCCGCCGTACCGGGTACTGAAACCGGGGCTGGTGGACCGCTTCGGGCGCACACAGACGTTCCACCGCGAAGCCGCCGGTGAATTCAGCGGCGAAATCACCGGCGGCGTGACGGATGGTGCCGGGCGTCACTTCCGGCTGGTACCCCGATACGCAGGCACCAGCGGGCAGAAGAAGCCCGGCAACGGGCCATTTCAGCCAGGACGGAACCGTCCGCTTTTCCTGATACCCTGCCGGGTTACACCGAATATGGCGGGACGAAAGCGGCATCCGTCTGTCTGCCATTGTGGCTGACTGGAAACCCGGAATACCCGGAGGGAATTTACCGCCGCCGCTGGTGCGCGCTATGGCTGGAACGCCCGCAGCGAACTGGCGGTGTATGACCGCAACCATACACGACCTGCCGCACCCAGCTTTACTTACGATGATAAATACCGGTGGATGGTGGCGCACCGTCACACGGGCCGACCGGAAATCTGTTACCGTTACGGCGAAAGCGCGACGGGCCGACAGAACAGCTAAACCCGGCGACTGGTTACGTATCACGACATGGAAGGACCGCATCTGCATACCGACCAGCCTGAACCGCCGTGAAGTCCTGCACGCAGGGGTGAAGGCAGGCTTCGGCGCTGGTGGTGAAAAGATACCTGCGGGCAGCGTCACGCGAAGTCAGTTTGACGCGTGCAGGCAGGCTCAGGGCTGGAGCGGATGCGCAGGCAGGACAACGAATACAGTCCGGATGTGACGGAGCTCATCACGCGCATCACCACGCCAGTGGCAGGGCATCAGCGTTTTACTATAACCACCACAGCCAGTTAACGTCGTACCGGCCTGACGGGCTGGAAACTCTGCCGAATATGATGATGGATGGGGTGCGTCTGATTCGAAACTGCCCTGACGGCGATATCACCCTTACCGTATGATAATCCCACACGGCTTACTGCGCAACGGAAGATGCACGGCGGCGGAAAACCATGACGTGGAGCCGTTACGGTCAGTTGCTGAGCTACTGATTTTCGGTTGTATGGCAACCCGCTTCATGACCGCCTGACCGTTTTGGTCAGGTGACGGCGAGATTGCACCGCGAGGAAGAGGGCGCGGTCAGTACCGCGCCACGGCGTGGACAGTTAATTGCCGTGAAGACACGCAGGGCCGCCGAAACGCGGCCTGAATACAGCGCCGCCGGTGACCTGACCACCGTCGTGCCCGGACGGCAGCAGAAACGGGACACAGTACGATGCGTGGGGAAAGCCATCCTGTACCGCAGAGCGGTCTGGCGCGCAGTATGGAATACGATGCTGCCGGACATATCCGCGCCTGACCAGTGAAAACAGCAGCCACCACCTTCCGTTACGATGTACTCTGACCCGACCCGATACGGAAACCGGCTGACGGCCGCACACAGCGTTATCACCACGACCTGACCGGCAAACTTATCCGCAGCGCGGGATGGGGGCTGGTCACCACTGACACTACTGGCCAGAAGCAGACCGCCTCGCACCCACTGCGTGAATGGCGAAACTGCAGAAGCGGTGGCAGTATGACGAACGCGGCTGGCTGACAGACATCAGCCATATCAGCGAAGGGCACCGGGTGACGGTGCATAGTTATGACGACAAAGCCGCCTCGCCAGTGAACACTGACGGTGCATCATCACCAGACGAATGAACTGCTCTGGCAGCATAGAGACCAGACATGCGTACAACACCAAAGGGACGAACCGCTGTATATGCGGACAATACCGCACCAGCGAATGGCTGACCTACAGCAGCGGCTGGCTGTGTCAGGCATAATCTGGCGACACCGCTGGTGGGTACACGACCGCCGCCGCAGGAAACGCTGCGCAGCTTCGGCCGTTATGAACTCACCTTATACCCTGCCGGGGCGGTTACAGAGCCAGCACCCTGGAGCAGCCTGCTGTCTGACCGCAGTGCACCTGGAACGACAACGGCGAACTCATCCGCATCAGCTTATTGCGCCAGACCCAGGTTACAGCTACCGCTGCACCGGCAGGCTTTGACCGGCGTTCACACCACCACGGCGAATCTGGATATCCGTCCGTATACCACAGACCCGGCAGGTAACCGCCTGCCGACCGGAACTTCACCCGGACAGCGCCCTCAGCATGTCGGCGGATAACCGTATCTGCGTGACGCGCACTATCTTTACCGGTATGACCGTCACGGCAGGCTGACAGAGAAAACCGACCTCGTCCAGAAGGGAGTTATCGCACGGATGATGTTTTTACCGGTACCGTCAGCACCGGCTGGTGCACTACGCCGGTTTGTATGCAGAGCCGCTGGACGAATAATATCTTTACGACCCACGCGGAGCGCAAGGTGGCAAAACGGGTATGGCGGCGTGAACGGGGACCTGACGGGCTGGATGTCGCTGTCACGGAAACCGCAAGTGACCTGGTACGGCTGGGACGGCGACCTGACCACGATACGGAACGACGAACCGCATCCAGACGATTTATCAGCCGGGGAGCTTCACGCCACTCATCAGGGGTTGAAACCGCCACCGGTGAGCTGGCGAAAACAGCGCCGCGGCTGGCGGATACCCTTCAACCGCTGGTCCGGTGGCGAAGACGGTGGCAGTGTGGTGTTCCCGCCGGTGCTGGTGCGATGCTCGACCGGCTGGAAGAATGAAATCCTGGCTGACCGGGTGAGTGAGGAAAGCCGCCGCTGGCTGGCATCGTGCGGCCTGACGGTGTACGGATGCAAAGCCAGATGGACCCGGTACTGCACGCCGGCGCGAAAAGTTCACCTGTACTACGCTGCGACCATCTTTGGCCTGCCGCTAGCCCATATCAGCACGGAAGACAACAGCGTGGTACGCAGGGTAATACGATGAATGGGGTAACCTGCTGAATGGAAGAACCCGCATCAAGCTGCCCGGCAAAGCTTATCCGCCTGCCGGGGGCAGCAATGCATGATGATGGAGGTCCGGCCTGTATTACAACCGCCACCGCTATTGACCGCTGCAGGGGCGATATATCACTCAGGATCCGATTGAACGAAGGGGATGGAGATTTTATCAGTATCCGTTGAATCCGATCTCAAATATATAGATCCATTAGGATTGAAACACTAAAATGCATTAAGCCACTGCGTTCAATGGAATAGGTTGGTGAAAGAAGCGGTCCAGATGTAGCTGGGGGAATCGTTCTATCATCAATATCTTTGTGTCCCAGATGGTAAAGGGACTATGCTTGTGGTGGCCAAGACCAACGGGGAGAATCAAAGGAGATGGTCTATGGGGGCCAGGTAAAGCAAGTAATGATACAAAAGAAGCTGCTGGCCGTTGTGACCTCGTTGAAACCGATAATAGTTGTGTGGAGAACTGTTTAGGGAAGTTTAAAGAGGTAAAGGCCGCGTTATTCTGTATTGCCTGATATATTCCACACCTATAAATTTAGAATTATTTAAAAACTGCCAAGACTGGTCTAATGATTCTTTAGAAACATGTAAGATGAAGTGCTCCGGAAATAACATTGGACGTTTTATTAGTTTGTATTCGCCGGGTGATGTAATGAAATATATTGAGTTAAACACCCAAACGCCGAAGATGAGGCATA
+>3221ccdb-0395-4983-8a44-e5558664096f
+TGGTAACACTTCGTTCAGTTACGTATTGCTACTTGCCTGTCGCTCTATCTTCGGCGTCTGCCCGGGTGTTTAACCTGGCGACCATAAAATTCTCGTGCAGATTCGCAATTCTCAAAGACACCCGAAATACAGGGCAAATACTCTGCGAATTACACACGTTCTGATTTTCGGTAGCAATAAATGCCGGGATGCCATAACCCGTGGCATCGATTTCATCGGGGATTTCCGCCATAACATCGTTGAACTGATAAAACTATTGCCGCCACATCGATATTACGACTTTCATTAATGTAGATACATTCTCGCTGCGTGGTAAAACGGTCCGGGCAAGAATCTAACTAACCGCAATTTTTAATTTTGGCATTTTCATCTCTTTATTTTAGGTAATAGCAGGTCCTCAATTTCTCGAATGAGAAATCGATCGTGCTGAAAAAGCAAAATTACCCCGCTGATAAATAAATCAGGTGATTGCTTTTTCTGAGAATCTGAGAGCCTGGTCAGGTGGCTGATAATGGGGTTAACAGAGAATGAGCACTGCGGAGCTAAGGCATATACCTGTAGCCTGAAAGTCAGGAAGACTGTACGCTGAAGTGCCTGAGTCGGTAGACTAACGGGCATTGAAAGTGAAGATCGAAGCTATTGCGATGAGCAAACTTCATAATATGGAGTTGTCCGCCTTATATGGGAGCATAAACGGCTGTTATTTTCCATTTAATTTACCTTTCCTGATGATGTGGAATGAAGGTGAAGATATTATCAGGAAATACCTGGTTGAATGTGAAATTGATCAATAAAAATGATCAAATCTTAATTTATTTAATGGTAAGGCTTTTTACTCAAGTAATACTAAAATATTGAATTGTTATTTTGTGTGTTGTTTTAAGATAAAGCCGGCAATGTTATTAATACGGCACAATTAATAAAAAGGCAGGCTGTATTAAAATTAATATTCAAAGCATAAACCGATAGCCAATACCCGGTTTCAGTAATGAAATGGCGTGGGCGGGCGGGATCCTGTTCAGTTTTTGTCGCAGATGTCCCATATAAATACGCAAATGGTGACTGTGTTTCGACCGCGTTTATTTACCTGGTTAAGGCTGGCGCTGGGTGAGTACTTTCCGGCGTATTGAGCAGCACCGCCGGCGGGCGGAACTCAATTGGTGTGAGATGCACCTCTTCTCCACCCATTCTGAGATCACGCGGGCGGCTAAATCGACGGTAACATCGGAAAATTTACCAGCGGATCGGGCGCGGTGGTGGCAGAGTGTAGCGGCATGTCACGACCGCGCAGACCGGGCCTGCAATTCGCCAATGCCAAACGGCCTCGATAATCATCCGCTCCGGCATCCAGCGCGGCGATTTTGTCGCTCTCTTGCTGCGCACGTGCGGGAAAGCGCAATCACCGGCACCGCGCTCCACTGGCACTGGGTCGCGGATAAACTCAATCCCATCACCATCGGGCAGGCCGAGGATCGGGGAATAATCAAATCTGGCTTACGGGTTGCCGCTTCCAGCAAGCCGCGTTGCAGCGTTTCGGCCTCAAAGACGCGCATCCGTCGCCCTCCAGCGCCGTGCGCGAAAGCGACGAATAGCCTGTTCATCTTCAACAATCAGAACGTTTGTCACATATCCTCATGAAATTCTTCAAGTTCAGGGGCAGTTTGCTGGGAAGTGTAACACGAAAACAGGCACCACCTTCCGGTCGGTTGAACGCGGTAATAGTGCCCCCGTGTGTACATCCACTATCGCCCGACAAATTGCCAGTCAAGCCCCTACCCCAGTACTGCCGACTCTTTTATTCCGCGAACAAACATCGATATCGTCTGCTCCTGGCCTGGCGGAAGACGGGGCCGTTATCCCAGACATCCAGTTGTAGATTTTCACCGCCCTCCAGCATTAGTGCTCGATGCCAATTTCGGCCTGCGCACCGCATATTTCACCGCGTTCTCCAGCAGATTAATCAGCGCACCCGTTCAAGAGTGGCCCGTCAACGTGGATTAAGGTCAGCGGTTCTGGCAGAGAAAGATTGATGGGCGACGATAAGAGCGTTCCAGCATTTGCAGCGCTGCCGACTACTTCAGCGTTAACTTCCTCTTTCTAACGAATTAAAGCCGCCGGACTGAATTCGCGCCATATCCAGAGTAAGATTATTCACCGGTCGGGTAGTGTTCGGCATGCTGACGGATCTCGCGCTGGCCTGGCGGGCGTGGGGTGGTGATCGCTTAAACGCAGATCCGAGGCGTTAAGATTTCTGCCTGATAAAACTGGCACCGTAAGCGGCGTGCGTAAATCATGCGAAAGCGCCGCCAGCAGGGCGTTGCGGATCTGTTCCACGTTCGCTTGCCATCGCGCCTGTTCTTCGCTGGCGGTTAGCGTCCAGCCGCTCAGAGCATTGGCGACTAACCCAGCGTAAACGTCTCCAGCAGGCGCTGCTGTTCAGGATCATCAACTGGCGCAGTCCCCAGCTCCACCACCACCAGCCCGTAGGTTTTTCTCGCCGCTTTTTAGCGGCAAAATCTGTGCAATTTACACCCGGGTAACGTGTCGGTGCCGCGCCCGCAAGGCAGGCCTTTATCAAAACTCCGCACTGCGCGATGGCATCGTCCCACGGCGTCATTCCTTGCGGATGTGTTAACGGCTGCAGTTACCGTTGTCATCGGGCAAACAACACCTGACTGCGGGCGAAACGTGGAGGCAATAAATTGTTCGCTGGTGGCAGCGATATCCTGGACTGCGGCCCACCGCCAGAGCTTTCGACATTTCATATAAGTGCCGTGTGCGTGCTCGCGGTAACGGAGCTGCCACCCTGATAACGCCGGCAGTAAGGTTCCCCTCACCAGCCCGACGGTTAACATCACCGCGAAAGGTCAGCAGATATTGCACATCAGAGACGGCGAGCGTGCCGCGTGGGGCGATAAAAGAGATCGAAACTCACTGCATTAATGACGGTGGCAACCACTGAGGCCAGCGTCCATAAAATGGCGCCACCACCACCATAAGCCGGTACAGCATCACCAGGTTGGCGGCATCAAACGCCATCAGCCACTGCATGGCAATTAAAGGTGATAACGGCGCATAACGCGGCGGCAACCGCATCCTGAATTGTACACGCCATGTCTTTAAAAACGGTTATCCGGCGCGTTGTTAATCGTGCGGGCGGGTGGTTCATCAAGCGCGACCAGCACCTGATCGAGATCAGGGCGATGCGCGCCAGTCGGTCAGCAAACGTTTCCCCGACGCGCCACCAGCGGCGCGAGGCCGGGCGACCGAGAATAATCTTGCCGAGATTATGTTCACGGGCATAACGCACTACCGCTTTCTCTTCCGCTGGATCGAAGTATTGCGTCTCGCGCCCGGTTCACGCCAGACGTAAGGCGCTGAGAATTGCCCGACGTTTTTCCGGTAAGCGGTGCAGGGCAGGGGTTTCAACATACACCGCGTGCCAGACGCTACCAACCGTGACGCCAGCCGCGCCGCTGCGCAGCCAGTTTTCGCTGCCGGTGTTATGGCCGATGCATAAAAAGGATCGCGTCGCGCGTGTGCCACACTTTCTCTTCGCCAGGATGCCCCGCCAGGCGCGCATTTGCTCATCAACGCGATCAAGCGGTACGGCGCAGTGCCAGTTCGCGCAGGGCGATCAGATTACCCAGCTACGGAAAAATGTTTGTCGCGCGCTCCGCCTGCCCGGCAATATGAGCTTTGCCTTCTTTCAGCCGCTGGCGCAGATCGTCCGGGGCAAAGTCACCAGCACCACGTCGTCAGCGGCATCGAAAAGGATCGGGCACGGTTTCCGTGCCTGAATTCCGGTGACGCCGCTGACCACATCATTCGAACTTTCCAGATGCTGAACGTTGACGGTAGTGAAAACATCAATGCCAGCTTCAGCAGTTCTTCGATATCTGCCAGCGTTTGGATGACGGGAACACCAACATTACTGTGCGCCAGTTCGTCCATTAAAGATCAGCGCCGGGCGGCGGGCGAGGGGCAGCATCGAGATCAAACTCGCTGATATGCCGCCCACGGTACGCCTGGCGTTTAAACGGCACAGAACAGCCAGCCCTTCCAGCGTAGCGGCGGTATCTTTCGCCCGTGGGTTTCACCACGCCAACCACAATATCAGCCCTTGCGCCCGCCGGTCGCTGAACTTCTGCCAGCATCGCCCAGGTCTTCCCGACGCCTGCTGGGCACCGAAACTTTCAGCTTCCCCGATGCGGCGCGGCAGTTTGTTCAGCAGACGATCAGGGTCGGGACGTAAAGGGTTCGTTATTCATCAAGTTTATCAGCGCCAGGTGGGTTCAACAATGTTGACGCCGGCTGGCCGATATATTTCACCGAAAGCAGTTTATTTGGCTGTATTTTGCGATCAGTTGCGTAGGCTGTTCCAGCGCGCTGAGATTACGCTTTCGCCACGCGTGGGATTTGCCAGGCCGCCGCTTGCGGTGATATTATTGTCAACCCTTGCCGATGCGTCACCAGTTCAACCGGAACGCTCGCGCTGGCATCCGGGTTAGCGGCCAATAAATGCAGCTTAACGCGTGCAGCTGTGGTTATCCAGCTCAGGGTTACTGACCGCCAGATTGCTCCCGCCAGAAGCCTGTGGATTATAGGGCATTTCTGCCGTTGCCGACGGGCGACCATGAAGATAGCCGTTGCCGAGTGCATTCTGCCCGATTAATGCCGAACCGCGCACCGTATCACCTTCACGAATCAACGAACCCACATTGGCCTGCCAGAAGCCACCTATTGCTGATACGGTGGTCAGCAGCGGGTAAACGCCGCCAGTAATCAATAAGAAAGATAAATGTTGATAATGCCGGACGCCAATCCTCGCGGTAAACCTCCACCAGACGCAAAACGGTCAGCGGTAAATCAATGACTTTGATACCGATAAACAGCGCCAGCGGCCCACGGAACCGTAAATCCGCCAAGTTACGGCGCAACATGGCAAAGAAGCGGTAAGCGGTTTATAACTCACGCCTTTAACGCCAGAATCAAAGACGATAATCAAGGCGTTGAAAATCACCGCACTGAGGATTGCGGTCGGGCGAATGCAGGCACATGATGTTCCAGCGCATTTAACTGCGGATACGTTACGCGAATGCCGCCGGAATAATGGCGAGTATTTCGCCACATCTGGTCAACAATGCTGAAGGTGGTCAACGAGCCACGGGTCATCAGCATCTGTTTGCCAATGTGCACCACCTCGATCAACTTGGTCGGGTTAGAATTCGGATCGACCATATTGCCCGCCTCTTTCGCCGCCACAGATTGCCGGAGTTCATCGCACCGCGACATCTGCCTGCGCCAGCTTCCAGGCATCGGTGGTGCCGTCGCCGGTCATCGCTACCAAACGACCTTCCGCCCACAGTACTGACGGATCAATGCCAACGGCCTCGGTGTCGCTCCGGCGAGAAAAATCATCGACACCACCCGCGCAACGATAGCGGCGGCAGTCAGACGGTTATCGCCATTAATCATCACCGTTTTAATACCCATTTTGCGCAGCTGGGCGAGCGCTCTTTAGCCACCGCCTTTGACGATATCTTTAGCGCAATAACGCCTTTACGAGCCTTTACACCACCACCAGCGGCGTGGCTCCTGACGCGCAACCTGACGTCGACTTTTTGATCAGCGCATCGGTAGGGAAGTGACCACCGTTAACTCAACATGGCGACGAATGGCATCGACAGAACCTTTACGGATCATGCGGTTGTCGATGTTGATCCCGCTCATCGGCTTTGCGCAGTAACCGGTACAAAGGTGGCGCTTCAGGCGACTGCACATCGCGCTCGCGCAGGATTCCGCTTAACTTCGCCCGGCGGGATCACAATGCTGCGGCCCTTTCCGGCGTTTCATCAGCCAGCAGAAGCCAGTTATTGCGGCGTCAGCCAGCGTTTTCATCCGCCCTGCGCGGATAAACTCCGACGCTGACGGTTACCGAGTGTGATGGTGCGGTTTTATCCAGTAGCAGAACGTCAACGTCACCTGCCGCTTCAACTGCGTCCGCTGGTAATCCACATTCGCGCCAGCATCCGGCTCATCCCGGCGACGCCGTCGCTGACAACAGGCCGCCAATAGTGGTTGGGATCAGACAGACCAACGCACCACCAGTACCGTTACGCTGACTGCGTACCTTGCGCAGCGAAACGGCCACAGCGTGGCGGTTGCCAGTAAAAGACGATAGTCAGGGCAAATCAGCAGAATGGTCAGAACGAATTTCGTTTCAGCGTTTGCGTCAGCATTGCGCCTTCCACCATCGCGATCATCCGATCAAACTCGCCGGGGTTAACGCTGCACTCAATCACCAGCCAGTCAGAAAGAATACGCGTGCCGCCGACGGAGGCAAAATCGCCGCCAGTTCACGGTCCCGCCGGTGCCGATTCTGATGATGGCGCTTTCATCGACCGATCACCCCTTCAATACTTCACCATCACCAGGGGATAATATCGCCGCTTCTACAATTACGATATCGCCTTTGAAGTTGGTCGGCGAACTTTGTCCGCCGCGGCGCTATATTTCAGCTCACGCAGCTTGCGGGCAAAGGCAAGTTTTCACCCCTTTCAGACTGTTGGCCTGCGCTTTACCGGCCTTCTGCCAGCGCCTCGGCGAAATTAGCGAACAGTGCGGTGATCCGCAGCCAACCGCTAATGGCCGCTAAACAGCGCATTGCCGGGCATCAGCACCGCTGCCATCGCGATGCTCGCTAGCCACAGGTGGTCAGCAGACTGCCGATCCGAACCCGATAAACATCGCCGGATTGCGCCACATTGCGCCTGCGGGTTTAATTTTCACCGCTTCTTTCAGCGCCTGAACGACAAGTGTTGGTTTCCGAATAGCGCCAGTTGTTTGACTCATGTTCAGTGCTCACTCAATATCATCAGGAGAGATATTCCGCCACCGGACCAAGCGCCAGGGCAAGGATAAAGGTCAGTGCGCCAACCAACAACACGGTGCCGGTCAACAGGCCAACAAACAGCGGGCCATGCGTTTAGCGCTTCGATGCCGGAACGGCGGCAGCTCTTACTCACCAGCGAACCTACGGCAATTGCCATCACCGGGATAATCACCCCGGCGACCAGAGCAAACATGCAGAACGCCAGTAAACGGTTCCAGAACGGAGTTGGCGCTAATCCGGCAAAGGCGCTGCCGTTGTTTGTTAGCGACGGATGACACGGCGTACAACACTTCAGCACTAAAACCATGCGGGCCAGGGTTGAGCATGGCGCTACGTCCGGCGTCGGTCATCATCGCCAACGCCGCGCCCATCAGCACCAGCGTCAGGGAGTAACCAGAATTGCCAGTGCGAGTCAGTTTCATCTCGCGTACGTCGATTTTTTACCCAGATATTCGGTGTACGACCAATCATCAACCGGCAATAAACACCGCCAGCAGGATAGACAGCATCATGCCGTAAAGACCAGGGCCATTACCGCCGAACACCACTTCACCAATTTGCATCAATACATCGGCACCATGCCACCGAGGCGATAGAAGCAGATCATGCATCGCAATCCACCGCGCCACAGAAGCCCGCCGTCGTCACGACCAAACAGGCTACTGACCAGCGCGCCGAAACGGCTCTCTTTACCTTCCATATTGATGCTGCTGGCTTCCGTGCCCAGTCTCAACAGATGAAGTTACCCTGAACCTGCCCACATCACCACGCCTACGCAGATGACAAAATCATGACATCGCCCACAGCAACATGCGCCCTGGCGACGATCGCCCATCACTTCACCAAAGGCAAGCACAGCGCCGTTGGGATCAAGATCGTATCTCTGCACGAAGTTGGTCAGTGCTGTTGGGTTTTCAAACGGATGCGACGAGTTGGCATTAAAGAAGCCGCCGCCGTTAGTACCGAGCATCTTGATCGCTTCACGCAAAGCTGGGCCCCATGGTGACAGCTGTTGCGCTCTTCAGCAGTATTCACAGCCTGATAAGGCAGAAAGTTTGCAGCGCACCTTGTTGAATAAAACGGTGCAATCCAACAACGCCACAGGGACTAGCACCCGCCAACGTGATGCGTAGCAGATCGGTAAGGCATTCCCGAGCGTGCTCATGCTCTGGCGGGTAAACCGCACGGATGAGGGCAAAAATCACCACCAATCCCGCTGGCGGCAGAAGAAAGTTTTGCCGTTAAGCCCGCCATCTGGCTGAAATGACTCAACGTGGTTTCACCGCTATAAGATTGCCAGTTGGTGTTGTTGACAAACTGACGGCGGTATTCAGCGCCAGATCCACGACAGCCTGGCAGCTGCGCAATGGATTAAGCGGCAGATAGTGCTGACCAGGCAACGCAAAACGGCACCATAGCCCCAGCATGTTCGGGCCGAGAATGGCACAAAGATATTGCTTCCAGTTCATCTCACGGTCAGAGACGCCAGTGCGCGAAAAGAGTACGCGCTCAACGCCCGTTGTACCGGGAAGGAATGTCATTAATCAACCGCCAGCCGCTGCCTAAGGACGCGCCAGCACCATTAACACAGTAAAACGGCGATCAGTAAGAACCTTGCGCAGCCATCAAGAGAACCTCCGCATTGATCAGGGCATAAACCAGATAACCCAGTAATAAAGCACCAGCAATACGCCGGTTATCACGCCCGCACCTCACAGTGCGCCTCCATTGGCCTAAAGTGATACCGGAAGGGTAGAATTCTGGCTGCCAAAGATTTCGCAAAATCTGCGGGCGGGGTGTAAAAAAGTATCAAAATGCCAAAAGCCATGAGTTAGCTTAATGTTTAATGTTAGAATTTAACTTTTATGGCAAATTACAGGATGAATGTAAATATAAACCATCAATATAAGCAAAAATAAAGTGGTCGGATGAGTAGTAAAATTACACAAAAAGGCGTTACTATTTCATCAGATAAAGCAAATTCATTTTTCCGGTGCCATTCACCGGTGGAGTACAAAGGGGAAAAGTATGGAACTCTACCAGAGAATATCACCATGGCTTATCTTTTTTACGCCGTACTTATGCGGTTTGCAGCGGGCGTTCTGGCGCTGCCTTTCATCTTTTCTGGAAAGACCGCGCCCTTTTTACAGCTACCTGCATCGCGTCTGGTCGAAAACAGCGATAAACCGGTGTGGATGGATCAGGCCGAAAAGGCAACTGGTGATTTTATTGATTGCTGATTTTGAATACATTGAAAACCGCCAGCGGAAACGCTGGCGGTTTTTTGTATCAGGAAGATGTTCAGAGGAATATTTAGACATCGTTATGTCGAAACGCCATAATTCCTGAAATATGCCATAAATATTTTTCCTAATTGTTCTTATCTGGCCAGATATCTCGCAAAGGCTTTCATAAATCTGTAGGGTTTCGCCTGTCGGAACAAATAACCCGATAAAACAAGGATGAGCAGATGAGCGGAAAACCGGCGGCGCGTCAGGGCGACATGACGCGATATGGCGGTAGCATTGTCAAGGTTCAGCCGGGTGCGCATCAGTGCCCCCACCGGCGGTAGCCTGTTCGGTGTGCCCCGGCGGAAGTTGACGTCCGGCCATCCGGTCAATCCGCTGCTCGGTGCAAAGGTCCTTCCCGGTGAAACCACGACATCGCCCTGCCCGGCCCGCTGCCGTTCATTCTCTCCCGCACCTACAGTTACCGGACAAAACGCCCGCGCCGGTGGGGAGCCTCGGCCCCGGCTGGAAAATGCCTGCGGATAACCGCTTACAGCTGCGCGATAACACACTGATACTCGAAGTGATAACGGCGGCAAGCCTGTATTTTGACACCTGTTTCCCGGTGAGGACAGTTTACAGCCGCAGCGGAGAGTCGCAATGGCACAAATTGCGCGCAGCGGCGTGGCGAAACTGGATGAAAGGTCACCGGCTGGCCGCACTCTGGCAGGCGCTGCCGGAAGAACTCCTTAAGTCCGCATCGTTATCTGGCGACAAACAGTCCGCAGGGCCGTGGTACGCTGCTCGGCTGGTGTGAGCGGGTGCCGGAAAGCGGATGAGGTGCTGCCTGCGCCGCTGCCGCCATTACCGGGTACTGACCGGGCTGGTGGACCGCTTCGGGCGCACACAGACGTTCCACCGCGAAACCGCCAGTGAATTCAGCGGCGAAATCACCGGCGTGACGGATGGTGCCGGGCGTCACTTCCGGCTGGTACGCACTGACCGCAGGCGCAGCGGTAGAAGAAGCCCGGCAGCAGGCCATTTCGGCGGGACGGAACCGTCCGCTTTCCTGATACCCTGCGGGTTACACCGAATATGGCCGGGACAACGGCATCCGTCACCATCTGCCGTGTGGCTGACGCACGACCCGAATACCCGGAGAATTTACCTGCCGCGCCGCTGGTGCGCTATGGCTGGACGCCCGCGGCGAACTGGCGGCGATTAATATGACCGCAACCAATACACAGGTGCGCAGCTTTACTTACGATGATAAATACGGGGGCCGGATGGTGGCACTTACCGTCACACACGGGCCGACCGAATCATTACCCATTACGACAGCGACGGGCGGGTGACAGAACAGCTAAACCGGCAGGCTTAAGTTACGTATCAGTATGAGAAGGACCGCATCACCATCACCGACAGCCTGAACCTGCGTGAAGTCCTGCACACTTGGTGAAGGCAGGCTGAAGCGAGTGGTGAAAAGGAACACGCGGACGGCAGCGTCACGCAGAGTCGAAGTTTGACGCGGTGGGCAGGCTCGGGCACAGACGGATGCCGCAGGCAGGACAACAAAATTACAGTCCGGATATTGGTACGGGCCTCATCGCGCATCACCACGCCGGATGGCGGGGCATCGGCGTTTTACTATAACACCACAGCCAGTTAACGTCGGCCACCGGGCCTGACGGCGGGTACGGAAATACGCCGGGAATATGATGAATGGGGCCGTCACAGTTCAGGAAACTGCCCTGACGGCGATATCACCCGCTACCGTTATGATAATCCACAGTGACTTACCCACCTGCGCAACGGAAGATGCCACCGGCAACGGAAAACCATGACGTGGAGCCGTTACCCGCGGTCAGTTGCTGAGCTTCACTGACTGTTCGGTTATGTAACCCGCTATGACCATGACCGTTTTGGTCAGGTGACGGCGGTACACCGCAGGAAAGAGGCTGGAGTCAGTACCGCGCATACGACAATACGTGGACAGTTAATTGCCGTGAAAGACACGCAGGGCCATGAAACGCGGTATAGAATACAACGCCGCCGGTAGCCCTGACCACCGTCATTGCCCCGGACGGCAGCGAAACGGGACACAGTACGATGCGTGAGGAAAAGCCATCCTGTACCACGCAGGGCGGTCTGACGCGCAGTATGGAATACGATGCTGCCGGACGGGTCATCCGCCTGACCGTGAAACGGCAGCACACCACCTTCCGTTACGATGTACTCGACCGGCTGATACAGGAAACCGGCTTTGACGGCCGCACACAGCGTTATCACCACGACCTGACCGGCAAACTTATCCGCAGCGGGGATGAGGGGCTGATCACCCACTAACACTATGGCGAAGCAGACCGCCTCACGCACCGCACGTGAATGGCGGAAACCGCAGAGCAATTGTAGCAACGAACGCGGCTGGTTGACAGACATCAATACATATCAGCAGAGGCACCGGGTGACGGTGCACTGGTTATGACAGTAAAGGCCGCCTCGCCAGTGAACACCTGACGATTGCATCATCGCAGACAAGATGAACTGCTCACAGCGGCATGAGACGAACATGCATGCAACGCACAGGGACTGGCGAACCGCTTTGTATACCAGGCAGCCTGCCGCCGTGGAATGGCTGACCTACGGCAGCGGCTGGCTGTCAGGTATGAAGCTCGGCGACACACCGCTGGTGGAGTACACCGCGACCGCCTGCACCGGAAACGCTGCACGCTTCGGCCGTTATGAACTCACCGCTTATGCCCCTGCCGGGCAGTTACGGAGAGCCAAGCACACCTGAACAGCCTGCTGTCTGACGCGATTACACTGGAACGACAACGGCGAACTCATCCCGCATCAGCAGCCCGCGCCAGACCCGGAGTTACAGCTACAGCACCGGCAGGCTGACCGGCACGTTCACACCACCGCAGCGAATCTGGATATCACGTCCGTATGCCACGAGACCCGGCGGGTAACCGCCTGCTTGACCGAGCTTCACCCGGACAGCGCCCACTCAGCATGTGGCCGGATAACCGTATCGCCCGTGACGCGCACTATCTTTACCGGTATGACCGTCACGGCGGGCTGACGGAAAACCGACCTCATCCCGGAAGGGTTATCACACAGATGATAGAGCGCACCACCGGTACCATTACGACGATCAGCACCGGCTGGTGCACTACACGCCGGACACAATATGCAGAGCCGCTGGTCGAAAGTCGCTATCTTTACGACCCGCTGGGCCGCAGGGTGGCAAAAACGGGTATGCTTGGCATGAACTTGGACCTGACGGGCTGGATGTCGCTGTCACGGGAAACCGCAAGTGACCTGGTACAGCTGGGACAGCGACCGCCTGACCACGATACAGAACGACAGAACCCGCATCCAGACGGTTTATCAACCGGGGAGCTTCGCCACTCCCATCGGGGTTGAAACCGCCACCGGTGAGCTGGCGCTTAAAGGTTAAACGCAAACGGACGCGCCGAAGATGAAGGCACC
+>71408c92-f605-49e0-9230-1809837ae8c8
+TTGGTATGCTTCGTTCAGTTACGTATTGCTCTTGCCTGTCGCTCTATCTTCGGCGTCTGGCAGGTGTTTAACCTCCAGTACACGGCGAACGATAGAATTTTGGTCGCGCTCGTTTACCGCCAGATGGTGTCAACGCTATCGATGGAGTATCAACAATAACGCGGTGACGATCAGCCCGCGCACGCCCCAGCAGCAGTCATCTTGTGGAACAGCAAATTGTTCGATATACCGCTGGAATAACATCGCCAGTAGCAGGGCAGAAAGTTGGCAAAAATAAAGTGACGTAACTGAATGTGACGTCGGAAAACATAGGAAAAGCGGCGAAAGCGCAAAAACAACGGCAACCAGCGGCACTAATGAGAGAGCAACGACACATAGGCAAGGTTACCTGCCAGGGTTGTCATGTTGTCCTCGTAATGCGTTAAGTGAACACCAGCCAGGCCCTTAGTGGACCGGAGTACGGTGCCTGGCTTTGTCCTGAATGGTTTTAGCATAACACCTTCGCGAAATAGTCCGGGATGGTGGTTTTATCTTTCACCAGAATACTGGTAATGCTGCCCAGCTGATTGGCTCCTTCTATATTATCGGCGTTATCGTCGAAAAAGACCATATCGCTGGGTGAAAAACCAGCTCCGCCTGCAAAACATGCTGGTAAATTCGTGCTTCAGGTTTACGCATCCCCAGATCTTGCGACAGATAGATGGTCAGCAGCATCACGAATTTCCGAATTCTTCCGGCCGAAGGTGGTATGCAGGCGGTTGGTAAGAAAACACCACCACGCGATGCCCCTGCTCACGCAGTTTATGCATGATGGCGATCACTTCGGGCGCAGCGCAACAAACACCGCCTGCCAGCCATTGAAGGCTGCTCGTAGCAGCGAGTGAGAGCCATCTCATAACCACAGCGCCTGCGACGCTTCGTCGCCTAATTTCCCGCTCATGCTGGTGAAACGCCTCCCCATGAAAACTCTTCTTAAGCGATGCCAGCCGGAATACGCGTTAAATCGCTCCAGGCTCCCAGCACACGGTTAAAGTCGATATCGACAATCACATTACCTAAATCAAAGATATAGAGCATTTTTTACCTCCTTTCGCGCCACAAAGAAGTGCTATGCGGCGGGAAAGGATGGGTTTAACTGTATGTGGCCAATTATGAAGCCAGGTTAACGGTCACAAAATCTACGCGTCTTCCTGGGAAGAATGATTTCAAGTGGCTGTCTTGTAAGCGTGATTTTTAGCGCAGCGAGCGGCAGCTCGTCGGTAAAGAGCGCAGTGACCTGTGCCACGTTACCAATTTCAACCGCGCCGAAGCATGATACTTAGATGTGATCGGCGACCGGCAAATATTTCTCGCGTGCGCCATCATCGTTTTCACCACGTTAGCCGTTTACATCAAACTCCATCAACGCGCCATCATCTCCAATCGCCTGACGCTTGTACAGATAATCAGCACGAAAATCAGCCACAAAGGACGCCGCTGGGGCCAATGATCCCGCGCTATTGTAGAGAGCGCAACGTACCGCCGAACCATCACTTCAAAGCGCGGGTTGTGGTAAAGAATATGCGCCACGCAGGCTGTTGGTGATTATCCGCAAATGATTATGGTTAAAGTAACGCCCGGGCAACATGCTCAACAGTCGTACCAATGGTGATAAATATTGTTGAACCATCAGGAATATATCAGTCTGCCACCGCTACGGCAATCGCTTTTTCCTCGGTTTGCGAAACCTCGCTGCTCGAACGCCGTATTAACGACGCTTCATTGACCCGCGCCACCGTGATGGCATCATCGAACCTGCTCAGCAATTTACGAATAACCGGCGGACCGTCTGCGTGAGACATCCAACAGATTTGCCAGGCTCATCAATATTCATATACCCACGCTCGGCGATCAGCATGAGTTAGTCGTGCCGCGGGACACCGGTTAGTTCGGTAAGGCTCACGAAAATTCCTCGAAAACCACCATCACCCGGCATTTTATACAAAAGTGACAAAAGATCGGGTTTGATCACAGTCAGGATCTGGCTCCGTCCGCAGGACGTGTGCATTTTAACGCCGCCGCTACACCGCTGGCGAAGCGGACTGACTCCATAAATCCCCACTTGTTTAGCGCCACCGCCAAAGCGCCGTGAAAAACATCACACCCGCACCTGTGGTATCTACCACATCAACTTTGAGGCAGAGTTGATGCTGACGCCCACCATTTTCCAGCCAGTCGCGGCCTGCGCTTACCCTGGTCACGCAGACGCTGACCATTTTGTGACGTTTGTGCCTGTTTTTAGCGCTGGCATCTCTTTCACGCCGTTAAGCGCACCAGACCCGGTTCTGAAAGGCCGCGTGATCCGGCAATGCCACCACCAGCTCACTGATATCCTGCGGCGTAATGTCCCCAGTCCAGAACGGTCATCACCCGCCCTGACGGGCCAGGAGTGAAGGCTTTTTCGCGCCGTCATTACCAGCGTACATCTGCCAGCACAACATCCCACTGAGAGAAATCAATTTCCTCCAACCACTCTGCGTCAGGCAGCAGATCCGACTGGGGTAATGGTTAATGATTAATCAACTCGCCTTTGGCAGGTATCCGCCATGATGGCGGATGCGAAGATTTCGCCTGGTTATACCGTTTGGTGTAACGGGTGTTAACGCCCCAGGATTCCAGCTCTGCCAGCAGGCTGTTGCCATCGTCATCACCTACGCGATAATAAAATCGACCTGCGCCCCCAGCCTTGCCGCCGCAACCTCTGCCATCGCCACTGGCCGCCACCAACTTCGTATAATTTCATACGTATTTACCGCTCTCCGTCGGTAACCTTCCACATGTCGATGCGATCCATCACGGTTATACCTACACAAACACTTACAAGATCATGGTCATTCCTTAAACATTTTTGGGATGCGTTCATTTTAATTCACCAATTGTTTAAAAAGCGGCAGCTGTCAATTTTGACGATAAATTACAAATACGATCAAAACGAACAAACAAAGCGTATCATAAATGACAAAAGTGACATAACTGTATTCAGGAGAGGTTATGGCAGCAATCGCGTTTATCGGTTAGGACAAATGGGTTCGCCAATGGCGGCAATTTATTACCCAGCAAGGGCATCAACTTCGCGTCTTTGATGCTTGAACGCCGAAGCTGTGCGGCATCTGGTAGACAAGGTGCGGCTCCGCCGCCAACCAGCGCAGACGCTAAAAGATGCCGAATTTATCATTACCATGTTGCCGAATGGCGATCTGGTGCGCAACGTGTTGTTCGGTGAAAACGGCGTTTGCGAAGGCTTATCTACCGATGCGCTGGTCATTGATATATCCACCATCCATCCGCTGCAAACCGATAAGTGATTGCCGATAATATACTAAACAAGGCTTCAGCATGATGGATGTTCGGTAAGGCCGTACTTCTGCAAATGCCATTACCGGTACTCTGTTACTGCTGGCTGGCGCTGCTGAACAAGTTGAATGCCACCGATCCTGATGGCGATGGGCAGTGAGTTGATCAACGCAGCGGTCCGGGCATGGGGATCCGCGTTAAGCTCATCAACAGCTTCGCCAGGCATCGCGCGCTCAATGCGCTTTCGGCAGAAGCCGCCGTTTTATTGCGAAGCCTGAATCTTCCTTCGATGTTGCCGTCAAAGTGATGGCGACGGTACCGCCGCCGGTAAAGGTCACTTCACCACTTCCTGTGAAACAAAGTCCTCAGCGGAGATCTTTCTCCCGCCTTCATGATCGTTGCCCATAGGATCTTGGCATCGCCCTTGATGTCGCCAACCAGCTTCCGTATGAAATGCCGCTGGGGCATCTGAGGTTTTATAGCCAGGCGCGCGCAACTTGGCGGTCGCGGTCGCCAGATGGTCCGCCATTCTGGGACAGGTCCGTGTCGAATGCCGGGATGACTGCCAAAGTAAAAATGTAACGACTGGATAAAGGAATAAATGAATGGGCAAACACATCCTTTGACATTACGCGCGCATCCGGGCGGTTTTGCCATGCTGGCGGTCGATCAGCGCGAAACCATGCGCGCCGATGTTTTGCCGCGGCTGGGCACCCGCTCGGTAGCCGATAGCGTTTTAACTGATTTCAAAGTTAACGCTGCAAAGGCCCTCTCGCCCCTTATGCCTCCGGCGATTCTGGTGATCAACAATTCTGCTACCGCCAGGTGGTTGAGCAAAACGCGATTGCCAAAAGTTGCGCCATGATTGTCGCCGCCGGTAGGTTCATTCCTGGCAACGGTATTCGGTCGATAGCGTGGTTATTGACCGCAAAATCAATCGCTAAGATCAAACAAGACGGTGCTGAAGCCAAAACTGCTGGTGCTGTGGCGTAGTGATGAAGATGCGCAGCAACGTCTGGATATGGTGAAAGAGTTCAACGAACTGTGCCACTCACGCGGTCTGGTAAAGCATCATTGAGCCGGTGATGCGCCCACCGCGTCGTGGCGATAAATTCGATCGCGAACAAGCGATCATCGATGCCATAAAGAGCTGGGCGACAATTGGCGCTATCTAAGTTGAAATGCCGCTTTTGGCAAAGGTCCGCAACAAGAGCTTCTCGTAGCTTCTGGCATCTGAATGACCATATCAATATGCCATGGGTGATCCTCTCTTCCGGTGTCGACGAAAAACTGTTTCCCGCGTGCCCGTACGCGTGGCTTGTGACAGCGGGCGCATCAAGTTCCTGGCAGGCCGTGCAGTCTGGGCATCGGTCGTCGGTTTACCGAACCGCAGGCTGATGTAGCGGCGTTTGCGCACCGAAATTACAGCAACGGCGTATTGTCCTGACGAAATGATGTAAAAGCACCGCTAAGATGAGGATAAAAGGAATGAAATGGTTTACTAAGCCACAACCGTGGCTGGAACGAAATCAAATGCATCTTTGATTTTGGTAAAAAATTTCCGTAGTGCCGACTGGTTTTGGCTGGTTTAGGTAATAAAGGGCAAATCAAAGAAGAGATGGGCACCCATCTGCATGGATCTGCTAAATATATTGCGTTTATTCCGTTGCTGCGGCGATGGGTCGACCTGGCGCTTACTCGTTGGTTGATCACGGTATCAAAGCCATATTTAAGCGCACGTGATAAAATATGGCGGTTGGTATGCCTGCGTGAATGGCGAGGGCGTGGTGGATGCCTCCAAACAGGGCTATCAACACTTCTTTGCTCTGCTGGTGCCATGGCATACGTCTGCTGCAGATCACCAGGAAGCGCGCAAATAACTCGGTGCCGCCGTGGAAATTATCGAGAAATGTTCTGGGCGAAGAGCAGATGTGCCTGGAATCCTCAGGACGAAGCCTTCCAGCAAAACCGAAAGTACCGCGGCGGCAATGCCAATATGCGCGGTGGAAGCCTCTTGATTGTTTATGACGTCACTCACGACAAAAATGGGCTGGATCGCGCATTCGCGTGGCTTCCGTGATTATCGACGTCGCCGAAATAATCATTATCGCGTTAACGAACACTTCGTACCAGTGGAATCCGCTGCGGATTTATACAAAGATATTGACGCATCCTTCCGCGCGTTCGGAAGTACCTGAGCCACTGGATCAGATGGGGCCGTTTAATGCTGCTTTTATCCATGCTGCCCTGGAAGCCCGTTGCGAACAACCACCAGCATGGCTGCTAGAAGATGCAAAGGTCTGTTTAACGCCACCGTGCGCGCGATGCCTGGGCACCACGATGGCGCGGACGGGATTGTTTATACCGTTGACTGGGAAGGAAAACCGGTGGTCCGCGAACGTGTACGTTGGCCTATCGTCGAAGCAATGGGCTGGCCTACGCGCTCTACACCGTCACTGGCGTCGCCAGTAAACCTGATCAAACATGGTGGGAGTACTGCATTAAGTACTGATGGACTATGAAAATGGGTTTCTGGTGGCAGGAGCTGGATGCGGACAATAAGATTTCACAAAGTCTGGGACGGCAAACAGGATATTCACCTGCTGCATTGCCTGGTGATCACGCGTATCTACGTTAGCGCCCGGCATGGCTCCAGCGGTTGCGGCGGGTCTGCTGGATGTGCAGAAATAACTGATCTGAAAATAGGGTGCGGGTTTCCCCTCTCCTAACCCCTCTCCCAAAGGGGTGAGGACCGTCAGTGCAGTTTTTGGGTTTGACATCAGCTCACGGGAGGCTGTATGTCAGATGATGCGTGCAATGCAGAAATCACCAGCTGCCGTGCAGTGGACAGACCGTTTCGCGCCGCGGGGATTATCCGCGACCATTAGCGACCGTCGGTGCTGTCACCGTGAATTAACCTTCCAGGGTTATCATTTAGTCATCGCACAAACCCGAAGAGATGCCGCTGGCGCATCTGGTAAAGTGCTTATTCCGGTATGAACCGGATCGCCAACTGGCCCAGTTCATCTCACGGTCAGAGACGCCAAAGTGCGCCGAAAAATTACGCGCTCAACGCCCGTTGTACCGGGAAAGAATTCGTCATTAATCCCGGCCGCAACCCGCTGCCTAAAGGACGCGCCAGCACCAGTAACACAGTAAAACGTGGCGATCGAGTAAGAACCCTTGCGCGGCCATCAGGAACGCCTCCCGTGATCAGGGCATAAACCAGATAACCCAGTAATAAAAACAGGTTAAACACCCGAAGCAGACGCCAAGATAGAACGCCG
+>67ee25a0-86c1-44be-9b64-5a0db853eaf2
+TCGGTACTTCGTTCCAGTTACGTATTGCTGCCCCTTGCAATCGCTCTATCTTCGGCGTCTGCTTGGGTGTTTAACCTCGGCGTTTCCATCAGCCAGCAGAAGCCAGTTGTGCGGCGTCAGCCAGCGTTTTTCATCCACGCCCTGCGCGTGGATAAACTCGACGCCTGACGGTTACCGAGGTGTGATGGTGCCGGTTTTATCCAGTAGCAGAACGTCGTCACCCGCCGCCTCAACTGCGTCCGCTGGTAGCAATCACATTCGCGCCTAGCATCAGCTCATCCGGCGACACTGTCGCTGACAACAGGCCGCCAATGGTGGTTGGGATCAGACAGACCAGCAGCACCACCAGTACCGTTACGCTGACTGCGTACCGCCCCACGCGGAAAACGGCCACAACGTGGCGATTTGCCAGTAAAAGACGATAGTCGGGGCAAATCAGCAGAATGGTCAGGGCAATTTCGTTCGGCGTTTGCGTCGCTTGTGCGCGCTACCATCGCGATCATCCGATCCAGAAGTATCTCGCCAGGGTTAACACCACATAAATCACCAGCCAGTCAGAAAGAATACGCGTGCCGCCGGTGACGGAAGTAGAAATCGCCGCCAGTTCACGGATCACCGGTGCCGATTCCCCGGTGATGGCGCTTTCATCGACCGATGCACCCCTTCATTAACTTCACCATCGCGGGATAATATCGCCAGCTTCTACCAGTACGATATCGCTTTGCGAAGGACGGTCGGCAGGAGCTTTGTCCGCCGCAGCGCCATATTTCGGCTCACGCAGCTTGCGGGCAAACCAGTTTTCACCTTTACAGACTGTTGGCCTGCGCTGCTGCGGCCTTCTGCCAGCGCCTCGGCGAAGGCTGGCGAACAGTACGGTGATCCACAGCCAACCGCTAATGGCCGCGCTAAACGGCGCATTGCCGGGCATCGCACCGCTTGCCATCGCGGTACTAATACCAGACGGTCAGCAGACTGCCGATCCAGACGATAAATCACCCGGATTGCGCCATTGCGCCTGCGGGTTTAATTTTCACCGCTTCTTTCAGCGCCTGAACGACAAGTGTTGGTTCGAATAGCGCCAGTTTGTTTACGGCTCATATTCAGTGCTCACTCAATATCATCAGGAGATATTCCGCCACCGGATAAAGCGCCAGGGCAGGGGATAAAGGTCAATTCGCCAACCAACGGCTTACGGTGTGCCCGATTAACAGGCCAACAAACAGCGGGCCGTGCGTTGGCAGCGTGCCGGAGCTGGCGGCTTGGCTCTTTTACTCACCAGCGAACCGGCAATTTACCCATCACCGGGATAATCACCCCGAAGCGACCGACAAACATGCGAACGCAATGGTTGAACGGAAGTGGCGCTTAAATCGGCGAAACGCTACCGTTGTTAGCGGCGGATGACGGCGTACAGCGCTTCGCTAAAACCATGCGGGCAGGGTTGGTATGGCGCTACGTCCGGCGTCGGTCATCATCGCCAACGCCGCGCCCATCAGCACCAGCGTCGGGGTAACCAAATTGCCAGTGCAGTCGGTTTCATCTATTGCGATTTTTTTACCCCAGATAATGTTCCGGTGTACGACCAATCATCAGCCCGGCAATAAACACACCGCCAGCAGGACAAACGGCATCATGCCGTAAAGACCAAGAACCGACACCGCCGAACGCCGCCACCAATTTGCATCAGCCACATCGGCACCATGCCACCGAGGCGATGAAGCAGATCATGCATCGCAATCACCCGCGCCACAGGAAACCGCCGTCGTCACGACCAAGGCAGGCTACTGACCAGCACGCCGAAACGGCTCTCTTTACCTTCCATATTGATGCTGCTGTCCGTGCCCGGTACAGCAGATGAGTTCCCTGAACTTCTGCCCACATCACCACGCCTACGCGGATGACAAAATCACTGACATCGCCCACAGCAACGCTGCGCCCCTGGCGGCGATCGCCCATCACTTCACCAAAGGCAAAGCACAGCGCCGTTGGGATCAAAGAAGATCCGCCAGCATCTGCACGGGGATTGGTCAGTGCGGTTGGGTTTTCAAACGGATGCGACGAGTTGGCATTAAAGCCACCGCAAATTAGTACCGAGCGAAGCGATTCGCTTCCTGAAAGGAAGCTACAGGCCCCATGGGTAACAGCTGTTGCGCTCCTTCAACGGTATTCACAACCTGATAAAGGCAGAAAGGTTTTACAGCGCACCTTTGTTGAATAAAAACAGTGCAATCAACAACGCCACGGGGATAGCACCCTGCGGCGATGCGTAGCAGATCGACCCAGGCATTCCCAGGCGTGCTCATGCTCTGGCGGGTAAACGCACGGATGAGGCCAAAAAATCACCGCAATCCCGCTGGCGGCAGAAGAAAGTTTTGCACCGTTAAGCCCGCCATCTGGCTGAAATAAAAACCAACGTGGTTTCACCGCTATAAGATTGCCGAGTTGGTATTGGTGACCGAAGCTGACGGCGGTGATTCAGCGCCAGATCCTGACAGCCCTGGCAACTGCTGTGGATTAAGCGGCGGATAGTTAGCGACCGAGCAATAAAAAACAGCACCGCCAGCCCCAGCGTATTCGGGCCGAGAATGGCACAAGATATTGCTTCCAGTTCATCACGGTCCAGAGACGCAGGGTGCGCGAAAAGAGTACGCTATCTAACGCCCGTTGTACCGGGAAGAGTGTCATTAATCAACCGCGCCAGCCCGCTGCCTAAAAAGGACGCGCCAGCACCATTAGCACCAATTAAAAACGTGGCGATCAGTAAGAACCCTTGCGCAGCCATCAGAACGCCTCCGCATTGATCAGGGCATAAACCAGATAACCCGGTAATAAAGCACCAGCAATACGCCGGTTATCACGCCTGCACTCACAGTGCACCTCGAGTAGCCTAAAGGCGATACCACCGGAAGGGTAGAATTCTGGCTGCAAAGATTTCGCAAAAATCTGCAGGCGGTGTAAAAAAGTATAAAAATGGCAAAGCCGTGGTTGTAACTAATGTTTTGTCATTAAATTTAACTTTTGTGTAACTTAATTACGGATGAATGTAAATAAACCGTAATGGCAAAAATAAGTGGTCGGATGGTAGTAAAATTGCACAAAAAGGCGGTACACTATTTTCATCAGATAAACAAATTCGTCCGGTGCATTCACCGGGTAGATACAAAAAGGGGAGAAAGTATGAACTCTACAGAGAATATCCTGCATGGCTTATCTTTTTACGCCGTGCCCATGCGGATTGCAGCGGGCGTTCTGGCGCTGCCTTTCATGCTTCTGGAAGACCGCGCCCGCTTTTACACAGCTACCATCGCGTCTGGTGAAACCGGCGATAAACCGGTGTGGATGGATCAGGCCGAAAGGCAACTGGTGATTTTATTGATTGCTGAGTTTAGTCACATTAGAAACCGCCAGCGGAAACGCTGGCGGTTTTTTATATATCAAGGAAGATCTTCAGAGGAATATTTAGACATCGTTATACCAATCGAAATATATATTCATGAAATATATATAAATATTTTTCTAATTGTTCTTATCTGACAGATATCTCACTTAAGGCCTTCTTATAAATCTGTAGGGTTTCGCCTGTCAGCAACAAAATAACCCGATAAAACAAGGATGAGCAGATGAGCGGAAAACCGGCGGCGCGTCAGGGCGACTATGACCGCAGTATGGCGGTAACGTGTCCAGGAGTTCAGCCGGGGTACGCATCGGTGCCCCACCGGCGTGGCCTGTTCGGTGTGCCCCGGCGGTGTTGACGTCCGGCCATCGGTCAATCCGCTGCTCAGTGCAAAGGTCCCGGTGAAACCGACATCGCCCTGCACCCGGCCCTTTGCCGTTCATTTCTCTCCCGCACCTACAGCAGTTACCGGACAAAAACGCCCCGCGCCGGTAGAGGCCTCGGCCAGCACAAAATGCCTACGGATATCCGCTTACAGCTGCGCGATAACACTGATACTCCGAGTGATAACGGCGGCAGAAGCCTGTATTTTGAAGGTTAAACTTACCCAAGCAGACGCCGCAATATCAGCACAACTTGCCTGTCGCTCATCTTCGGCGTCTGCTTGGGTGGTGCAACCTGCGGCTCCAAAGTAGATGCTCCGCCCGCCGTTGTCGTTGGTATCAGTCCGTCATCACGTAGCTGTAAGCGGATATCAGAAGGCACTTTCCAGCCGGGCCGAAACGCCCACCGGTGCAGGCGTCTTCGTCCGGTAGCTGCTGTAGGTGCAGAGAATGAACGGCAGCCAGGCGGGCAGCGCAAAGATCCATCTCGCCGGGCAGCACCTTCGCCCCCAGCAGCGGATTTACCGGGTTGCCCGAGATATCATCCCGCCGGACACACCGAGCACGCGCCACGCCGGTAGGCGCGCCAATTCTTACACCTGCCGAACCCTGGACAATGGGACCACACGCCATACTGAGTCATATCTCCCTGACGCGCCGCTGGTTTTCCGCTCATATAAAGTGCCCTTTTAGTTATTGTTCATATTATCCCTGTGTTGAAAAGCAAAAAAAATAAAATGACACAAGACCAGCTAATGTATTTATATATTTTCACATAAACTTGTTGTTCTCAATCAACAACGCTGTTATTACAGGTCACTTTCAATATTTTATTAAAGCTAACATTTTAGCACAGATGGTCATCATCCAACGAATTCACTATATGGATAATATCCATTCAACGCATATGATTTATGATTTTATTAGTCTGAGTTATTTTTTGTAGGGCTATATTTAGAAATCAATAAACTCCACCGATTCAGATTAATATCAGCAATAGAAAGATAGGAAATCACCGATTCAATAACATCATCAATGAAACATATTGTAGAATTAATTTAAACAAGGCGTTCAATTTCAACCGAACTGCCCTTATTTACTCTCATCACCCGCAAACTGCCTGAACAGCGCCTTACCCTTAACCAGTCGCGCACCCAGCCAGCCGCCGAAAGCGACGGCAGCGGCGCTCCGCGCACGGCAGAACAATCCACAATCACCAGTCTGGCTCCACGGAAAATCAAACACTTTCGCCTGCAACACTGCTGGCGCAGTTTCCGCACCAATTGCGGCCACCGGGCCGGAAACAAATTAAGCATGGCGAACTCACACCCACAACGTGGTACGCAGCAGTTTTTCCCCGCACCGGGTGTGCGCCACACCACCAGCTCCTGGTGACGCTTTGGCGCATTCCACCTGCACCTGCCGTAACAACAACATACCGCAGGCGGTGACCAGTACCATCACTTCCAGCGCCCGACCTGCCAGCACCTGACCGACCTGTTTCAAAATCGCGCCAATATCTAACGATAATGGTCAAAGGAACTGGCGGTTGAGTTAAATGATAATGCCGTTGCCATTCTCCCAGCGAAACTGGTAAAGCCAGCTCTGCGGTTCCGTCTAATACACTAGGGGAAAATAAAATAAGTGGTATAGACTTTCCCAGTCCGCTTTGCGCAAGGCTGGTCACTTTAGCGCGGAGAACTCACCGGTATCGCCATAAAAGTCAGGTATCACCGAGGGCAACGTTTAAGCGTTTTGCTTAAGCCTCTTCCATCCCGACACTTCCATCGGCTTTTGGCGGCCAGTTACCGGCGACAATCGGATTATGATCGGGTACGTATTTTGCCAGGAGTAAGATTGAGTTCGCGGTTAAGCGCCTCATCTTCATTTCTGTCGGCTTATCATTAATCGCCATCAGCCGCGCCCACCACCGGATAAAACGATTCCGGGACTATCTGATGTTCCGCGAGGAACGCGCACCTTGGTGCTACCTGTTCTGCAATGGCGATGTTGAATTAAAAAGTAGTTGGGCTTTCTGGAGTAGCTGCTGCTGGCGGTCGGTGATCGCCCACACCAAACGCAAACAGTACAGCTTGGCATAAAGGAGCGAAAATGCCAGCTGACTTAAACGTTGACCACGGCTGGCGTAACAGGCGGCTAACCGCCAGGCACCGAGGCAGCGATTTCAGCGTCATGCGGCGAAATGCGTTCAGCAACATCAAGCCCAGCACACCGCACAGCAAACCGATACTACCGCGCCCATGGCACCACCCGCCCAAAGCAGCATGCACCACCCATTAATCCGGCGAGCAGCGGCACAACTACCACACTGACAATCGGCAGATAAAACTTCCAGCAGCCAGGGCGTTCTTCCACCACATCATTACGTAATACGCGTAAAGAGGCTGCGTTGCCAGCAACAACGATATGGTCGTAGCCCACCAGCAGCAGAGATGACCGTCATGGTGCTAAGCGCCCACAGCCGGCCAGAGGCTGGCTGGCGGTAGTGCAACGGAGCAGAACAGGCGAGCAGCACCATCAACGTTTTCGAACAACGGGCCTATGGCCCCACCGGTAACGGCTGGCATCGGCACCATCAACCGCTGACCGACGATTGGCTTACGCGAAGTTGCGCTCGCCTGCCCCCAGCATTTTGAGGATCATACCGGATCGTAGCGGCTGCACGACGGTAATGATTCATCGCTACCGCCACGCACCACTGCCAGCAGCGGTCAAGCGCCGAAAGCAGCGGAACTGTTTGACGTTCCATCGATCGCCCAAACGCGCCTTCGTCCTGTTCAGGCCGTACCAGCGTTGTTCGGGTTTAAGCTGAGGTAACAACCATTTCTCGCCTTAGGTAAGAGCTGGTTCTCGTTGCGCCAATTTATAACGCCAGGTGACCCGACTCCCGGCTGCGGCTCGGGTTTATCGACATCCGCAGATTCGTCATCAGACGCGGGCCATCTGGAAGGTTAAAGGCAAGATCCGGTTCCTGAATCATACTCCGGCAATCGCCCGGAGCAGACGCCGCAATATCAGCACCAACAGAAAAGCAATACGTAACCCGCA
+>ce4d48fa-9112-4aa8-b655-10c5064129db
+TTGGTATGCTTCGTTCAGTTACGTATTGCTCTTGCCTGTCGCTCTATCTTCGGCGTCTGCTTGGGTGTTTAACCTGAAACAGTGCAATCAACAGCATACGGGGACTAGCACCCATAACGTGATGCATGTAGATCGACCCAGAGCATTCCAGGCGTGCTCATGCTCTGGCGGAGTAAACGCGCACGGATGAGGGCAAAATCACCGCAATCCGCTGGCGGCAGAAGAAAGTTTTGCACCGTTAAGCCCCGCCATCTGGCTGAAATAAGCTCAACGTGGTTTCACCGCTATAAGATTGCCAGTTGGTATTGGTGACAAAGCTGACGGCGGTATTCAGCGCCAGATCCCGGCAGCCCTGGCAGCTGCTGTGGATTAAGCGGCAGATAGTGCTGACCGAGCAACATAAAAACAGCACCGCCAGCCCCAGCATGTTCAGGCCGAGAATGGCACAAGATATTGCTTCCAGTTCATCTGCGGTCAGAGACATAAGTGCGCGCCCAATGCGCTCAACGCCCGTTGTACCGGGAAGAGATGTCATTAATCAGCCGCGCCAACCCGCTGCCTAAAGGACGCGCCAGCACCATTAGCACCAGTAAAAACGTGGCGATCAGTAGAACCCTTGCGCAGCCATCAGAACGCCTCCGCATTGATCAGGGCATAAGCCAGATAACCCAGTAATAAAACACCAGCAATACGCCGGTTATCACGCCTGCACTCTAGTGCACCTCCAGTGGCCTAAAAGTGATACCGGAAGGGTAGAATTCTGGCTGCAGATTTCAAAAATCTGCGGGCGGGGTGTAAAAAGAAATATAAAAAATGGCAAAAGCCATGATTTAAACTAATGTTTAGTAATTTAACTTTTGTGTAACCCAATTGCAGGATGGATAAAATAAACCACCATCAATAAGCAAAAATAAGTGGTCGGATGAGTAGTAAAAATTACACAAAGGCGGTACACTATTTCATCAGATAAACAAATTCATTTTCAGTGCCATTCACCGGGTAGATACAAAGGGGAGAAAGTATGGAACTCTACAGAATAATATCCTGCATGAAAACATCTTTTTTACGCCGTACTTATGCGGTTGCAGCGGGCGTTCTGGCATGCCTTTCATGCTTTCTGGAAAGACCGCGCCCGCTTACCTTCTGCATCGCGTCTGGTCGAAAACCAGCGATAAACCGGTGTGGATGGATCAGGCCGAAAAGGCAACTGGTGATTTTTATTGATTGCTGAGTTTTGAATACATTTGAAAACCGCCAGCGGAAACGCTGGCGGTTTTAATATCAGGAAAATCATTTCAGAGGAATATTTTGGAGCATCGTTATACCAATCAAAACATATATTCATAGAGAAATATATATAAAATATTTCCTAATTGTTCTTATCTGACAGATATCTCATAAGGCTTTCTTATAAATCTGTAGGGTTTCGCCTGTCAGCAGACAAATAACCCGATAAACAAGGATGAGCAGATGAGCGGAAAACCGGCGGCGCGTCGGGGCGACATGTTGCCAGTATGGCATTAGCATTGTCAGGAGTTCAGCCAGGGTACGCATCAGTGCCCCCACCGGCATGGCCTGTTCGGTGTGCCCCCGGCAGGGTGACGTCCGACCATCCGGATCAATCCTTGCTCCGGTGCAAAGGTCCTTCCCGGTGAAACCGACATCGCCCTACCCGGCCCGCTGCCGTTGTTCTCTCCGCACCTACGGCAGTTACCGGACAAAACGCCCGCGCCGGTAGAGCCTCGGCCCCGGCGCTGGAAATGCCTGCGGATATCCGCTTACAGCTGCGCGATAACACACTGATACTCGAGTGATAACGGCGGCAAGCCTGTATTTTGAGCACCTGTTTCCGGTGAGGACGGTTACAGCCGCAGCGAGTCACTGTGGCTGGTGCGCGGCAACGTGGCAGAAACTGGATGAAGGTCACCGGCTGGCCACCTCTGGCAGGCGCTGCCGGAAGAACTCCGCTTAAGTCCGCATCGTTATCTGGCGACAAACAGTCCGCAGGGGCCGTGGTGGCTGCTCGGCTGGTGTGAAGGCGGGTGCCGGAAAGCGGATGAGGTGCTACCGCCGCTGCCGCCGTACCGGGTACTGACCGGACTGGTGGACCGCTTCGGGCGCACACAGACGTTCACCGCGAAGCCGCCGGTGAATTCAGCGGCAGAAATCACCGGCGGCGTGACGGATGGTGCCGGGCGTCACTTCCGGCTGGTACTGACCACGCAGGCGCAGCGGGCAGAAGAAGCCCGGCAGCAGGCCATTTCCGGCGGGACAAGACCGTCCGCTTTCCTGATACCCTGCCGGGTTACACCGAATATGGCCGGGACAACGGCATCCGATCTGTCTGCCGTGTGGCTGACGCACGACGGAATACCCGGAGGAATTTACCTGCCGCGCCGCTGGTGCGCTATGGCTGGACGCCCCGCGGCAGCGAACTGGCGGCGGTGTATGACCGCAACAATACACCAGAGTGCGCAGCTTTACGATGATAAATACCGGGGCCGGATGGTGGCGCACCGTCACACGGAGCCCGACCGGAAATCTGTTACCGTTACGACAGCGACGGGCGGGTGACAGAACAGCTAAACCGGCGGGCTTAAGTTACACGTATCAGTATGAGAAGGACCGCATCACCATCACCGACAGCCTGAACCGCCGTGAGTCCTGCACACGCAAGTGAAGGCGGGCTGAAGCGGGTGGTGAAAAGGAACGCGGACGGCAGCGTCACGCAGAGTCAGTTTGACGCGGTGGGCGGGCTCAGGGCACAGACGGATGCCGCAGGCGGGACAATGGTCACAGTCCGGATGTGGTGACGGGCCTCATCCCGCGCGCATCACCACGCCGGATGGCAGGGCATCGGCGTTTTACTATAACCACCACAGCCAGTTAACGTCAGCCACCGGGCCTGACGAGGCTGGAAATACGCCGGGAATATGATGAATGGGGCCGTCTGATTCAGAGGAAACTGCCTGACGGCATTATCACCCGCTACCGTTATGATAATCCACACAGTGACTTACCCTGCGCAACGGAAGATGCCGGCGGCGGAAAACCATGACGATGGAGCCGTTACGGTCAGTTGCTGAGCTTCACTGATAACTGTTCCGGTTATGTAACCCGCTATGACCATGACCGTTTTGGTCAGGTGACGGCGGTGCACCGCGAAGGCTGAGTCAGTACCGCGCATACGACCGTGGACAGTTAATTGCCGTGAAAGACACGCAGGGCCATGAAACGCGGTATAGATACAACGCCGCCGGTGACCTGACCACCGTCATTGCCCGGACGGCTTGTAGAAACGGGACACAGTACGATGCGTGGGGAAAAGCCATCTGTACCACGCAGAAGGGCGGTCTGACGCGCAGTATGAATACGATGCTGCCGGACGGGTCATCCGCCTGACCAGTGAAAGCAGCAGCCACACCACCTTCCGTTACGATGTACTCGACCGGCTGATACGAAACCGGCACGACGGCCGCACACAGCGATTATCACCACGACCTGACCGGCAAACTTATCCGCAGCGAGGATGGGGGGCTGGTCACCCACTGTACTATGACAGAAGCAAGACCGCCTCACGCACCGCACCGTGAATGGCGAAACCGCAGAGCGGTGGCAGTATGACGAACGCGGCTGGCTGACAGACATCAGCCATATCAGCGAAGGGCACCGGGTGACGGTGCGCTATGGTTATGACAGTAAGGCGCCTCGCCAGTAAGACACCTGACGGTGCATCATCGCAGACGAATGAACTGCTCTGGCAGCATGAGACCAGACATGCGTACAACGCACAGGGACTGGCGAACCGCTGTATACCGGACAACCTGCCCGCCGTGGAATGGCTGACCTACGGCAGCAATGGCTGTCGGAGCATGAAATCAGCGACACACCGCTGGTGGAGTACACCCGCGACCGCCTGCACCGGGAAACGCTGCGCAGCTTCGGCCGTTAATAGACCACCACCGCTTATACCCCTGCCGGGCGGTTTAAGAGCCAGCACCTGAACAGCCTGCTGTCTGACCGCGATTACACCTGGAACGACAACGGCGAACTCATCGCATCAGCAGCCCGCGCAGACCCGGAGTTGCTTCACAGCACCACCGGCAGGCTGACGGCGTTCACACCACCGCAGCGAATCTGGATATCCGCATCCGTATACCACAGACCCGGCGGTAACCGCCTGCCCGACCGGAGCTGCACCGGACAGCGCCCTCAGCGTAATGGCCGGATAACCGTATCGCCCGTGACGCGCACTATCTTTACCGGTATGACCGTCACGGCAGGCTGACAGAGAAAACCGACCTCATCCGGAAGGGGTTATCCCGCGGATGATGAGCGCACCCACCGGTACCATTACGACAGTCAGCACCGGCTGGTGCACTACACGCAGACACAATATGCCAGAGCCGCTGGTCGAAAGTCGCTATCTTTACGACCCGCTGGGCCGCAGGGTGGCAAAACGGGTATGGCGGCGTGAACGGGACCTGACGGGCTGGATGTCGCTGTCACGGAAACCGCAAGTGACCTGGTACGGCTGGACGGCGACCGCCTGACCACGATACAGAACGACAGAACCGCATCCAGACGATTTATCAGCCGGGGAGCTTCACGCCACTCATCAGGGTTTAAGAACCGCCACCGGTGAGCTGGCGAAACGCAGCGCCGCAGCCTGGCGGATACCCTTCAGCAGTCCGATGGCGAGGCCGGTGGCAGTGTAGATTATTCCCGCCGGTGCTGGTGCAGATGCTCGACCGGCTGGAAAGGTGAAATCCTGGCTGACCGGGTGAGTAGGGAAAGCGCCGCCGCTGGCTGGCATCGTGCGGCCTGACGGTGGCGCAGATGCAAAGCCAGATGGACCGGTATACCACGCCGGCGCGAAAAATTCACCTGTACCACTGCGACCATCGCGGCCTGCCGCTGGCCATATCAGCACGGAAGGGACAACAGCGTGGTACGCACCAGAATACGATGAATGGGGTAACCTGCTGAATGAAGAGAACCCGCATCAGCTGCAGCAGCTTATCCGCCTGCCGGGGCAGCAGTATGATGAAGAGTCCGGCCTGTGTACAACCGCCACCGCTTCATATGACCCGCTGCAGGGGGCGATATCACTCAGGATCCGATTGGTGGGCTGAAAGGGGGATGGAATTTTATCGGTATCCGTTGAATCCGATCTCAAATATAGATCCATTAGGATTAAGAAACGCACTAAAATGCATTAAGCCACTGCGATCAATGGGCGGAACTGGTGAAAGAAGCGGTCCAGATATATGGGGAATCCGTTCTATCATCAATATCTTTGTCCCAGATGGTAAAGGGGACTATACTTGTGGTAGCCAAGACCAACGGGGAGAATCAAAAAGGGAGATGGTCTATGGGGGCCAGACAAAGCAAGTAAATGATACAAAGAAGCTGCTGGCCGTTGTGACCTCGTTGAAACTTCGATAATGGTTGTGTGGAGAACTGTTTTAAAGGGAAGTTTAAAGAGGTAAGGCCGCGTTATTGTATTGCCTGATATATTCCGCACCTATAAATTTAGGGCTATTTAAAAACTGCAAGACTGGTCTAATGATTCTTTAAAAGAAACATGTAAGATGAAGTGCTCCGGAAATAACATTGGACGTTTTATTGATTTGTATTCACGGAGTGATGTAATGAAATATATTATTTTTATTCAGAGCTATATGGCTGGCTTTATCGCTTTAATACTATTCTTTTCCATGCATAGACTTTCACTAAGGTTAAACGCAAGCAGACGCCGAAGATAGAGCGACAGGCAAGTAGCAATACGTAACCCCGCA
+>3048e786-5b3d-4587-b5d0-714b40192268
+CTGTTGTACTTCGTTCAGTTACGTATTGCTCTTGCCTGTCGCTCTATCTTCGGCGTCTGCTTGGTGTTTAACCTCCGGCTGGCCGATATATTTCCTAGCGGTTGTTGGCTGTATTTTGCGATGGTGCGCTGGGCTGTTCAACGCTGAGATTACGCCCTTTCGCCACGCGTGGGATTTGCCAGGCCGCCGCGCGCGTGATATTGTCCAGCCCGCTTGCCGATGCCGTCACCAGTTCAACCGGAACGCTCGCGCTTCAGCATCCGGGTTAGCGGCCCATCCGTACAGCAACGCGTGCGGCTATTAGTTTATCCAGCTCAGGGTTACTGGCCGCCAGATTGCTCGCAAAGCTGTGGATTATAGGGCGACTTCTGCCGATTTGCCGACAGGCGACCGAAAATAGCCGTTGCCGGTAAATTCTGCCCGATTAATGCAGACGCGCACCGTATCACCTTCACGAATCGGCAGACCATTGGCCTGCCAGAAACCACCATTGCCCCCAGTACGGTGAGATTAAGCGGCGGGTAAACGCCGCCAGTAATCAATAACAGAAGATAAATGTTGATAATGCCGGACGTAATCCACTCATGGTAAGCCTCACACCGGACCTGACGGTCAGCGGTAAAATCAATGACTTTGATACCGATGGCAGCAGCAATACAGACCGTAAATCCGCCAGTTACGGCGCAACATAGCAGAAGCGGTAGCGGTTTATAACTCACGCCTTTTTAAACGCCAGAGGAATCAGGGCAAATAATCAAGGCGTTGAAATCTTACTGGTTGGAGTCGGGCAGATACGGGCGCATGATGTTCAGCGCATTTAACTGCGGATACGTTGCCGCGAATGCCGCCGGAATAATGGCGAAGTATTTCATACATCGTTAGCAATGCTGAAGGTGGTCAGCGAGCCACGGGTCATCAGCGTCTGTTGCCAATATTGCCCACCTCGATCAACTTGGTCGGGTTGAGTCGAGATCGACCATATTGCCTCTTTCGCCGCCTGGGTGCCGGAGTTCATCGCCACCGCGGCATCTGCCTGCGCCAGCGCCAGGAGCATCGTTGAATTGCCGTCGCCGGTCATCGCTACCAAACGACCTTCCGCCTGATACCTGACGGATCAATGCCAGCGGCACTCCGGTATCGCTTCGGCGAGAAAATCATCGACACCCGCTTCCGCAGCAATCGCGCTTAAAGTCAGACCAGTTATCGCCGGTAATCATCACCGTTTTAATGCCCATTTTGCGCAGCTGGGCGACGCTCTTTAATACCGCCTTTGACGATATCTTAAGCGCAATAACGCCCAGCACACGAAATTTCCACCACCACCAGCGGCGTGGCTCCTGACGCACACGCAACCTGATCGACTTTTGATCCAACATCATTTGGGAAGTGACCACCGTTAGCCTCAACACGCCAGCGACAGAATGGCATCGACAGAACCTTTACGGATCATGCGGTTGTCGATGTTGATCCCGCTCATCCAGCTTTGCGCAGTAAACGGTACAAAGGTGGCATGGGCGACGCTGCATCCTTGCTCGCGCAGGTTAAAAACGCTGCTTGGCGAGGATCACAATATATTCCGGCGTTTCATCGGCCAGCAAAGCCAGTTGTGCGGCGTCAGTAGCATTTTTCATCCACGCCTGCGCAGCGATAAACTCCGACGCCCTGACGGTTACCGAGTGTGATAGAGTGCTGGTTTTATCCAGTAGCAGAACGTCAACGTCACCTGCCGCTTCAACTGCGCGTCCGCTGGTGCAGCAATCACATTCGCGCCTAGCATCCGGCTCATCCAGCGACGCCGATCGCTGACAACAGGCCGCCAATAGTGGGTTGGGATCAGACAGACCAGCAGCCATAGTACGTTACGCTGACTGCATTACCGCGCCCACGCGGAAAACGGCCACAGCGTGGCGGTTGCCGTAAAGACGATAACGTCGGGGCAATCAACCCAGAATGGTCAGGAGCCATTTCGCGTTCGGCGTTTTGCGTCGCTGTGCGCCTTCACCATCGCGATCATCCGATCCGAAATGTCTCGCCGGGGTTAACGCTACACTCCAATGCCAGCCAGTCAGAAGAATGCGCGTGCCGCCGGTGACGGAGGCAAAATCGCCGCGGATTACGGATCACCGGTGCCGATTCCCCGGTGATGGCGCTTTTCATCGACCGATGCCGCTTCAATAACTACACCATCGCGGGGATAATATCGCCAGCTTCTGCCAGTACGATATCCGCCTTTGCAGAAGTTGGTCAGCAGGAACTGTCCGCCGCAGCGCCATATTTCAGCTCCGCAGCTTGCGGGCAAAGGCAGTTTTCGCCCCTTCCAGACTGTTGGCCTGCGCTTTACCGGCCTTCTGCTAGCCTCGGCGAAATTAGCGAACAGTACGGTGATCACAGCCAACCGCTAATGTACGCTAAACAGCGCATCGCCGGGCATCACCGCCGCTTGCCATCGCGATGCTAATACAGGTGGTCAACAGACTGCCGATCGAATAAACATCACCGGATTGCCATTGCGCCTGCGGGTTTTAATTTTTCACTTCTGGCGCCTGAACGACAAATATTTGGTTCGAATAAGCGCCGGTGTTTACGACTCATATTCAGTTGCTCATATTATCACATCCAGGAGAGATGTTCCGCCACCCGGACCAGCGCCAGGGCGGGGACAAAGGTCAGTGCGCCAACCAGCAACACGAATTGCCGATTAACAGGCCAACAAACAGCGGGCCGTGCGTTGGCAGCGATGCCGGAGCTGGCGGCTTGGCTCTTTACTCACCAGCAGACCGGCAATTGCATCACCGGGATAATCACCCCGAAGCGACCGACAAACATGCGAACATGATAAACGGTTCCAGAACGGAAGTTGGCGCTTAATCCGGCAAAGCGCTGCCGTTGACTGTGCTTACAGCACTTCCTTCAAACCATGCGGGCCAGGGTTGAGCATGGCGCTACGATCGGCGTCGGTCATCATCGCGCCGCGCCCATCAACACCAGCGTCGGGAAGTAACCAAATTGCCAGTGCAGTCAGTTTCATCGCGTACGTCGATTTTTTACCCCAGAATGTTCCGGTCTTACGACAATCATCAGCCCGGCAATAAAGCACCGCCAGCAGGACAAACCAGCATCATGCCAGCAAGACCAGAACCGACACCGCCAACACCACTTCACCAATTTGCATCAGCCACATCGGCACCATGCCGCGAGCGGTAAACAGATCATGCATCGCAATGCCGCTTTCACAGGAAGCCGCCGTCGTCGACCGCCGACAGGCTACTGACCAGCGCGCCGAAACGGCTCTCTTTACCTTCCATATTGATGCTGCTGTCCGTGCCCAGTGCCAGCCAGATGAAGTTACCTGAACTACCCACATCACCACGCCTACGCAGATGACCAAAATCACTGACATCGCCCACAGCAACATGCGCCAAACCGATCGCCCATCCGCCACAGGCAAAGCACAGCGCCGTTAAGGATCAAGAAGATCGCCAGCATCTGCACGAAGTTGGTCAGTGCGGTTGGGTTTCAAACGGATGCGACGAGTTGGCATTAAAGAAGCCCGCCACCGTTAGTACCGAGCATCTTGATCGCTTCTGAGAAGCTACAGGCCCCATGGGTAACAGCCGTTGCCGCTCCTTCAACGGTATTCACAGCCTGATAAGGCGAAAAGATTTTACAGCACGCTGTTGAATAAAAACAGTGCAATCAACAACGCCACAGGGATTTTACCCATAACGTGATGCATGTAGATCGATGACATTCCAGGCGTGCTCGTATCTGGCGGGTAAACGCACGGATGAGGGCAAAAAATCACCCGCAATCCCGCTGGCGGCAGAGAAAGAAAAGTTTGCGCAGTGGCCGCCATCTGGCTGAAATAGCTCAACGTGGTTTCACCGCTATAAGATTGCCAGTTGGTATTGGTGACAAAGCCCCGAGCTGGCGGTATTAGCGCCAGATCCCGTAGCCACTGGCAACTGCTGTGGATTAAAGCGGCAGATGAACTGACCGGTAACATAAAAACATACCGCCAGCCCCAGCATGTTCAGGCCGAGAATGGCACAAAGATATTGCTTCCAGTTCATCTCACGGTCAAGACGCCAAGTGCGCGAAAAAGTACGCGCTCAACGCCCGTTGTACCGGAAGAGGAATGTCATTAATCAACCGCGCCAGCCCGCTGCCTAAAGGACGCGCCAGCACACCATTAACACCAGTAAAAGCGTGGCGATCAGTGATAGAACCCTTGCGCAGCCATCAGAACGCCTCCGCATTGATCAGGGCATAAACCAAGAATGGCAATAATAAAAGCACCAGCAATACGCCGGTTATCACGCCTGCTACTCACAGTGCACCTCCAATTGGCCTAAAGTGATACCGGAAGGGTAGAATTCTGGCTGCAAAGATTTCGCAAAAATCTGCGGGCGGGGTGTAAAAAAAGTATAAAATGCGCCCAAAAAGCCATGATTTAACTAATGTTTATTATTAATTTAACTTTTGTGTAACTTAATTGCAGGATGGATGTAAAATAAACCATCAATAAGCAAAAATAAAGTGGTCGGATGAGTATTAAAATGCACAAAGGCGGTACTGTTTACTGCATCAGATAAACAAATTCATTTTCCAGTGCCATTCACCGGGTAGATACAAAGGGGGAGAAAAGTGCATGGAACTCTGCAGAATATCTGCATGGCTTATCTTTTACGCCATTACTTATGCTGCGGTTACGCGGGCGTTCTGGCGCTGCCCTTTCATGCTTTTCTGGAAAGACCGCGCCCGCTTTTGCAATACCTGCATCGCGTCTGGCAGAAAACCGGCGATAAACCGGTGTGGATGGATCAGGCCGAAAAAGCGGCTGGTGATTTTATTGATTGCTGAGTTTGAATGCATTGAAAACCGCCAGCCCAGCTGGCGGTTTTCATCAGGAAGATGTTCAGAGGAATATTTAGACATCGTTATACCAATCGAAACATATCATTCATGAAATATATATAAATATTTTCCTAATTGTTCTTATCGACAGATATCTCGCCAGGCTTTCTTATAAATCTGTAGGGTTTCGCCCTGTCGGATAAAATAACCCGATAAAGTAAGGATGAGCAGATGAGCGGAAAACCGGCGGCGCGTCAGGGCGACATGGCCGCAGTATGGCGGTAGCATTGTCCCAGGGTTCAGCCAGGGTACGCATCAGTGCCCCACCGGCGTGGCCTGTTCGGTGTGCCCGGCGGGGTGACGTCGGCCATCCGGTCAATCCGCTGTACTCGGTGCAAAGGTCCTTCCGGTGAAACCGACATCGCCCTGCCCGGCCGCTGCCGTTCATTTCTCTCCACTAGCGGTTACCGGACAAAACGCCCGCGCCGGTGGGGAGCCTCGGCCCCGGCTGGAAAATGCCTGCGGATATCGCTTACAGCTGCGCGATAACACACTGATACTCAGTGATAACGGCGGCAGAAGCCTGTATTTTGAGCACCTGTTTCCCGGTGAGGACGGTTACAGCCGCAGCGAGTCACTGTGGCTGGTGCGCGGCGGCGTGGCGAAGCTGGATAGAAGGTCACCGGCTGGCCCGCACTCTGGCAGGCGCTGCCGGAAGAACTCGCTTAAGTCCGCATCGTTATCTGGCGACAAACAGTCCGCAGGGGCCGTGGTGGCTTTCGCTCGGCTGGTGTGAGCGGGTGCCGGAAGCTGATGGGGTGCTGCCTGCGCCGCTGCCTTAAATACCGGGTACTGACCGGGCTGGTGGACGCTTCGGGCGCACACGAGACGTTCCACCGCGAAGCCGCGGTGAATTCAGCGGCGAAATCACCAGCCCGTGACGGATGGTGCCAGGCGTCACTTCGGCTGGTACTGACCGCAGGCGCAGCGGGCAGAAGAAGCCCGGCAGGCCATTTCCGGCAGGGACGGAACCGTCCGCTTTCCTGATACCTGCGGGTTACACCCGGAATATGGCCGGGACAGCGGCATCCGTCTGTCTGCCGTGTGGCTGACCCCGCACGACCCGGAATACCCGGAGAATTTACCCCTGCCGCACCGCTGGTGCGCTATGGCTGGACGCCCGCGAACTGGCGGCAGTGTATGACCGCAGCAATACACAGGTGCACCGCCTGATGATAAATGCCGGGGCCGGATGGTGGCGCACCGTCACACGGGCCGACCGGAAATCCTGTTACCGTACGACAGCGACGGGCGGGTGACAGAACAGCTAAACCAGCGGAGAAGCAAGTTACACGTATCCAGTATGAAGGACCGCATCACCATCACCGGCAACCCTGAACCGCCGTGAAGTCCTGCACGCAGGGTGAAGGCAAGGCTGGTGGTGGTGAAAAGAACACGCGGACGGCGTCACGCGGAGTCAGTTTGGCGCGGTGTTGGGCAGGCTCAGGCACCAGACGGATGCCGCAGGCAGGACAACAGAATACAGTCGGATGTGGTGACGAGCCTCATCACGCGCATCCACCACGCCGGATGGCGGGGCATCGGCGTTTTACTATAACCACACAGCTGATTAACGTCAGCCACCCGGGCCTGACGAACGGAAATACGCCGGAATATGATGAATGGGGCCGTCTGAGTTGAAACTGCCCCTGGCGGCGATATCACCGCTAGGTTAAACGCAGAAAACGGAGCCGCCGAAGATGAAACCGTA
+>d7bbdb5c-225f-4910-a264-6444e1ace544
+TTGTTGTACTTCGTTTCAGTTACGTATTGCTACTTGCCTGTCATCATCTTCGGCGTCATAGCGATTTTAACCTATCAGCATCTGTTTGCCAATGTGCACCACCTCGATCAACTTGGTCGGGTTAGAGTCGAGATCGACCATATTGCCCACCTCTTTCGCCGCCTGGGTGCCGGGAGTTCATCACCACCGCGACATCTGCCTGCGCCAGCTGGAGCATCGCTGGTGCCGTCGCCGGTCATCACCAAAACGACCTTCCGCCTGATACTGACGGATCAATGCCAGCTTGGCCTCCGGTGTCGCTTCGGCGAAAATCATCGACACCCGCTTCCCGCAGCAATCGCGGCGGCAATCGAACGGTTATCGTCAGTAATCATCACCGTTTTAATGCCCATTTTGCGCAGCTGGGCGAAGCAACTCTTTAATACCGCCTTTGACGATATCTTTCAGCGCAATAACGCCCAGCACGAACCACCACCAGCGGCGTGAAAACCCTGACGCGCAACCTGATCAACTTTTGATCAACATCGGTGAGGAAGTGACCACCGTTAGCCTCAACATGGCGACGAATGGCATCGACAGAACCTTTACGGATCATGCGGTTGTCGATGTTGATCCCGCTCATCGGCTTTGCGCAGTAAAACGGTACAAAAGGTGGCATGGAGCGACTGCACATCGCGCTCGCGCGGGTTAAAACGCTGCTTAGCGGGGATCACAATACTGCGGCCTTCCGGCGTTTCATCAGCCAGCGAAGCCAGTTGTGCGGCGTCAGCCAGCGTTTTTTCATCCACGCCCTGCGCGGATAAACTCCGACGCACCTGACGGTTTACCGGGTGTGATGGTGCCGGTTTTATCCAGTAACCAGGGCAATCAACGTCACCTGCCGCTTCAACTGCACGTCCGCTGGTGGCAATCACATTCGCGCCTAGCATCCGGCTCATCCCGGCGACGCCGATCGCTGACAACAGGCCGCCAATAGTGGTTGGGATCAGACAGTTCCAGCAGCGCCACCACCAGTACCGTTACGCTGACTGCATTACCGCCCACGCGGGGAAAACGGCCACAGCAGTAGCGATTTGCCAGTAAAAGACGATAGTCAGGGCAATCAGCAGAATGGTCAGGGCAATTTCGTTCGGCGTTTAGCGTCGCTGTGCGCCTTCCACCATCGCGATCATCCGATCCAGAAATGTCTCGCCGGGTTAACGCTACACTCAATCACCAGCCAGTCCAGAAGAAAGAATACGCGTGCCGCCGGTGACCTTTGAGCAAAATCGCCCGCCAGTTCACGGATCACCGGTGCCGATTCCCCGGTGATGGCGCTTTCATCGACCGATGCACCCCTTCCAATAACTTCACCATCGCAGGGGATAATATCGCCAGCTACCAGTACGATATCCAGCCTTTACGAAGTTGGTCGGCAGGAACTTTGTCCGCCGCAGCGCCATATTTCGGCTCACGCAGCTTGCGGAGCAAAGGCAGTTTTCACCCCTTTCAGACTGTTGGCCTGCGCTTTACTGCGGCCTTCTGCCCAACGCCTCAGCGAAATTAGCGAACAGTACGGTGATCCACAGCCAACCGCTAATGGCCGCGCTAAACAGCGCATTTACCGGGCATCGCACCGCTTGCCATCGCGATGCTAATACAGACGGTCAGCAGACTGCCGATCCAGACGATAAGCTTATCACGGATTGCGCCATTGCGCCTGCGGAGTTTAATTTTCACCGCTTCTTTCAGCGCCTGAGCGACAGAGTGTTGGTTCGAATAGCGCCAGTTGTTTCGACTCATATTCAGTGCTCGTATCATCGGAGAATGTTCCGCCACCGGACCAAGCGCCAGGGCGGATAAAGGTCAGTGCGCCAACCAGCAACACGGTGCCGATTAACAGGCCAATAAAACAGCGGGCCGTGCGTTGGCAGCGTGCCGGAGCTGGCGGCTTGGCTCTTTACTCACCAGCGAATAACCGGCAATTGCCATCACCGGGATAAATCACCCCAGAAGCGACCGACAAACATGCAAGAACGCCAGTAAACAGTTCCAGAACGGAGAGTTGGCGCTTAATCCGGCAAAGGCGCTGCCGTTGTTGTTAGCGGCGGATGACACCGGCTGCAGCACTTCGCTAAAACCATGCGGAGCCAGGGTTGAGCATGGCGCTACTCCGGCGTCGGTCATCATCGCCAACGCCGCGCCGCTCAACACCAGCACGTCAGGGTAACCAAATTGCCAGTGCAGTCAGTTTCATCTCGCGCGTACGTCGTTTTTACCCAGATATTCCGGTGTACGACCAATCATCAGCCCGGCAATAAACACCGCCAGCAGGACCAAACAGCATCATGCCGTAAAGACCAGAACCGGCACCGCCGAACACCACTTCACCAATTTGCATCAGCCATCGGCACCATGCCACCGAGCGATAAACGAATCATGCATCGCAATCACCGCCACAGGAAGCCGCCGTCGTCACGATACAAACAGGCTACTGACCAGCACGCCGAAACAGCTCTCTTTACCTTCCATATTGATGCTGCTGTCATTGCCCGGTGCCAGCGGATGAGGATTACCCTGAACTTCTGCCCACATCACCACGCCTACGCAGATGACAAAAATCACTGACATCGCCCACAGCAACATGCGCCCTGGCGGCCGATCGCCCATCACTTCACCAAAGGCAAAGCACAGCGCCGTTGGGATCAAGAAGATCGCCAGCATCTGCACGAAGTTGGTCAGTGCGGTTGGGTTTTCAAACGGATGCATTGAGTTGGCATTAAAGCCACCGCCATTTAGTACCGAAACATCTTGATCGCTTCCTGAGAAGCTACAGGCCCCATGGGTAACAGCTGTTGCGCTCCTTCAACAGTATTCTCACAGCCTGATAAGGCAGAAAGTTTTACCCAGCGCAGCGTTGTGAATAAAAACGGTGGCTTAACAACGCCACAGGGACTAGCACCCATAACGTGATGCGTAGCAGATCGACCCAGGCATTCCAGAGCGTGCTCATGCTCTGGCGGAGTAAACAGGTTAAACGCGAAGCAGACGCCGCAATATCCAGCACC
+>c39789a3-7c1c-4b1e-bc6d-dc0df49e969c
+TTGCGCATTGTGCTTCGTTCAGTTACGTATTGCTGCCTGTCGCTCTATCTTCGGCGTCTGCTTGGAGTGTTTAACCTGATGCCCCCGCCAGGCACGCATTTGCTCATCAACGCGATCGGCAGTACGGCGCAGTGCCAGTTCGCGCAGGGCGATCAGATTACCTTTGCGGAAAAATGTTCAATGGCGCGCTCTCGCCTGCCCGGCTAATAGGCTTTGCCTTCTTTCAGCCGCTGGCGCAGATCGTCGGGGCAAGTCCACCAGCACCACGTCGTCGGCATCGAAAAAGGATCAGGCACGGTTTCCCGTACCTGAATTCCGGTGACGCCATGACCACATCATTCAGACTTCCAGATGCTGAACGTTGACGGTGGTAAACATCAATGCCAGCTTCAGCAGTTCTTCGATATCCTGCCAGCGTTTGGGATGACGGAACCTGGCGCATTACTGTGCGCGCCAGTTCGTCAATAAGATCAGCGCCGGGCGGCCCGGCGAGGGCGGCATCGAGATCAAACTCGCTGATACCGCCCGCGGTACGCCTGGCGTTTTAACGGCAGAACAGCCAGCCGCTTCAGCATGGCGTGAGCGTCTTTTCGCCCGTGGGTTTCTGCCACGCCAACCACAATGTCAGCCTTGCGCCCGCGGTCAGCTGGGCTTTCTGCCAGCATCGCCCAGGTCTTCCCGACGCCTGCACAGGCACCGAAGAAAAACTTTCAGCTTCCCCGATGCGGCGCGGCAGTTTGTTCAGCTGAACTGATCGGGGGTCGGGACTAATGAGGTTCGTTATTCATCAAGTTTATCCAGCGCCAGATTAGGTTCAACAATGGTGAAGGCAAGCCGGCTGGCCGATATATTTCACCGGTTGTTGGCTTGTATTTTGCGATCGGTTGCGTGAGCTGTTCAACGCTGAATTACGCGCTTTCGCCATTAGAGTTTGCCGAGCCGCCGCTTGCGGGTGATATTATTGTGTCAGCCAGCTTGCCGATGCCGTCACCAGTTAACCGGAACGCTCGCGCTGGCATCCGGGTTAGCGGCCCGTAATGCAGCAACGCGTGCGGCTATTAGTTTATCCAGCTCAGGTTACTGACCTTGATTGCTCCGCCAGAAGCCTGTGGATTATAGGGCATTTCTGCCGTTGCCGACGGGCGACCATGAAAATAGCCGTTGCCGGTAAAATTCTGCCCGGTGTACCGAACCGCGCGCCGTATCACCTTCACGAATCAACGAACCATTGGCCTGCCAGGAAACCACCATTGCCCCAGTACGTTGGTCAGCAGCGGGTAAACGCCGCCAGTAATCAATAACAGAAGAAGATAAATGTTGATAATGCCGGACGTAAATCCACTCATGTAGTAAACCTCACCAGACCGCAAACGGTCAGCAGTAAATCAATGACTTTGATACCAGATAAACGGCACAACATTACAGACCGTAAATCCATAGAAGTTACGGGCGCAACATGGCCAGAAGCAGTGGCGGTTTATAACTCACGCCTTTACAACGCCAGGAATCAAAGACGATAATCAAGGCGTTGAAAATCACCCGCACTGAGGATTGCGGAGTCGGGCGAATGCAGGCACATGATGTTCAGCGCGTTTAACTGCGGATACGTTGCCGCGAATGCCGCCGGAATAATGGCGAAGTATTTCGCCACATCGTTAGCAATGCTGAAGGTGGTCGAGCCACGGGTCATCAGCATCTGTTTGCCAATGTGCACCACCTCGATCCAGCGGTCGGGTTAGGTCGAGATCGACCATGTTATGCCCATACTCTTTCGCCGCCTGGGTGCCGGGTTCATCATACCGCGACATCTGCCTGCGCCAGCGCTGCCAGACATCGTTGGATTGCCGTCGCCGGTCATCGCACCAAACGACCTTCCGCCTGATACTGACGGATCAATGCCAGCTTGGCCTCGGTGTCGCTTCGGCGAGAAAATCATCGACACCCGCTTCCGCAGCAATCGCGGCGGCAGTCAGACGGTTATCGCCGGTAATCATCACCGTTTAATGCCCATTTTGCGCAGCTGGGCGAAGCGCTCTTTAATACCGCCTTTGACGATATCTTTCAGCGCAATAACGCCCAGCGAGAACCTTCCACCACCACCAGCGGCGTGGCTCCCTGACGCGCAACCTGATCGACTTTTGATCAACATCGGTAGAGAGTGACCACCGTTAGCCTCAGCATGGCGACGAATGGCATCGACAGAACCTTTACGGATCATGCGGTTGTCGATGTTGATCCCACATCATCCGGCTTTTGCGCAGTAAACGGTACAAAGGTGGCGTAAGGCGACTGCACATCGCGCTCGCGCAGGTTAAACGCTGCTTGGCGAGGATCACAATACTGCGGCCTTCCGGCGTTTCATCAGCCAGCGAAGCCAGTTGTGCGGCGTCAGCCAGCGTTTTCATCCACGCCTGCGCGGATAAACTCCGACGCCTGACGGTTACCGAGTGTAGTAAGTGCCGGTTTTATCCAGTAGCAGAACGTTAACGTCACCTGCCGCTTCAACTGCACGTCCGCTGGTGGCAATCACATTCGCGCCTAGCATCCGGCTCATCCGGCGACGCCGATCGCTGACAACAGGCGCCAATGGTGGTTGGGATCGAGACAGACCAGCAGCGCAGCGCCACCGGTATTGCCGTTACGCTGACTGCATTACCGCTTACGCGGAAAACGGCCACAGCGTGGCGGTTGCCGAAATAAAAAGACGATAGTCAGGGCAATCAGCAGAATGGTCAGAACCAATTTCGTTCGGCGTTTCGTCGCTGTGCGCCTTCCACCATCGCGATCATCCGATCCGAAATGTCTCGCCGGGTTAACGCCACTCAATCACCAGCCAGTCAGAAAGAATACGCGTGCCGCCGGTGACGAAACCGCAAATCGCCCGCCGGATTCACACGGATCACCGGTGCCGATTCCCCGGTGATGGCGCTTTCATCGACCGATGCACCTTCAATAACCTTCACCATCACGGGGATAATATCGCCAGCTTCTACCAGTACCGATATCGCCTTTACAGAAGTTGGTCGGCAGGAACTGTCCGCCGCAGCGCCATGTTCGAAGCTCACGCGGCTTGCGGGCAAAGGCAGTTTTTCACCCTTTCAGACTGTTGGCCTGCGCTTTACTGCGGCCTTCTGCCAGCGCCTCGGCGAAATTGGCGAACAGTACGGTGATCACAGCCAACCGCTAATGGCCGCTAAACAGCGCATTGCCGGGCATCGCACCGCTTGCCATCCGCGATGCTAATACCGCGGGTAGTCAACAGACTGCCGATCAGACGGAAAGTAAACATCACCGGATTGCGCCATTGCGCCTGCGGGTTTAATTTTTTCACCTTTGCTTCTTTCAGCGCCTGAACGACAAGTGTTGGTTCGAATAGCGCCAGTTGTTTGACTCATATTCAGTACTCCTCAATATCATCAGGAGATATTCCGCCACCGGACCAGAAAGCGCCAGAACAGGGATAAAGGTCCAGTGCGCCAACCAGCAACACGATTGCCGATTAACAGGCCAACAAACAGCGGGCCGTGCGTTGTGGCGTGCCGGAGCTGGCGGCTTGGCTCTTTTACTCACCAGCGAACCGGCAATTCGCCATCACCGGATAATCACCCCGAAGCGACCGACAAACGCACGGAACGCCGGTAAACGGTCCAGAACGGAGAGTTGGCGCTTAATCCGGCAAAGGCGCTGCCGTTATTTGTTAGCGGCGGATGACACGGCTGCAGCACTTCGCTAAAACCATACGGGCCAGAATTTGAGCATGGCGCTACGTCCGGCGTCGGTCATCATCGCCAACGCCGCGCCCATCGCTTTCCAGCGTCAGGGTAACCAGAATTGCCAGTGCAGTCCATTTCATCTCGCGTACGTCGATTTTTACCCAGATATTCGGTGTACGACCAATCATCAGCCGGCAATAAACACCGCCAGCGGGACAAGCAGCATCATGCCGTAAAGACCAGAACCGACACCGCCGGAACACCCGCTTCACCAGTTTGCATCAGCCACATCGGCACCATGCCACCGAGAGCGGTAAACGAATCATGCATCGCAATCACCGCGCCACAGGAAGCCGCCGTCGTCACGACCGCAAACAGGCTACTGACCAGCACGCCGAAACGGCTCTCTTTACCTTCCATATTGATGCTGCTGTCCGTGCCCAGTGCCAGCCGTGAGGATTACCCTGAACTTCTGCCCACATCACCACGCCTACGCGAGATGACAAAATCACTGACATCGCCCACACAGCAGCATGCGCCCCTGGCGTGATCGCCCATCACTTCACCAAAGGCAAAGCACAGCGCCGTTGGGATCAGAAGATCGCGCCAGCATCTGCACAGCGAAGTTGGTCAGTGCGGTTGGGTTTTCAAACGGATGCGACGAGTTGGCATTAAAGCCACCGCCGTTAGTACCGAGCATCTTGATCCTTCCTGAGAAGCTACAGGCCCCATGGTGGCTGGCTGTTGCGCTCCTTCAGCAGTATTCACAGCCTGATAAGGCCAGTTTTACAGCGCACCTTGTTGAATAAAAACGGTGCAATCAACAACGCCACAGGGATAGCACCCATAACGTGATGCGTAACCAGATCCGGCCAGGCATTCCCGAGCGTGCTCATGCTCTGGCGGGTAAACTACTTACGGATAGGGGCAAAATGCCGCAATCCGCTGGCGGCGAAAGTTTTGCCGTTAAGCCCGCCATCTGGCTGAAATAGCTCAACGTGGTTTCGCCCTATAAGATTGCCAGTTGGTATTGGTGACAAAGCGACGGCATTATTCAGCGCCAGATCCCACGACAGCCAGCAACTGCTGTGGATTAAGCGGCGAATGTAGTGCTGACGAGCAACGCAAAAACAGCACCGCCAGCCCCAGCATGTTCAGGCGGGGAATGGCACAAAGATATTGCTTCCAGTTCATCTCGGTCAGAGACGCCAAGTGCGCGAAAAGTACGCGCTCAACGCCCGTTTATTACCGGGAAGAGGAATGTCATTAATCAGCCGCGCCGGCCGCTGCCTAAAGGACGCGCCAGCACCATTAACACCAGTAAAGCGTGGCGATCAGTAGAACCGCTGCGCAGCCATCAAGAACGCCTCCGCATTGATCAGGGCATAAACCAGATAACCCAGTAATAAAAACACCAGCAATGCACGCCGGTTATCACGCCTGCGCTCACAGTGCGCCTCCAGTGGCCTAAAAGTGATACCGGAAGGGTGAATTCTGGCTGCAAAGATTTCGCAAAAATCTGCGGGCGGGGTGTAAAAAGTATAAAAATGGCAAAAGCCATGATTTGCTAATGTTTAGTATTAGTTGGCACGGTAGCTTAATTACAGGATGAATGTAAATAAACCATCAATAGCAAAAATAAGTGGTCGGATGAGTAGTAAATTACACAAAGGCGGTACTATTTTCATCAGATAAACAAATTCATTTTTCGGTGCCATTCACCGGGTAGATACAAAAGGGGGAGAAAAGTATGGAACTCTACAGAATATCCTGCGCGAAGCATCTTTTTACGCCGTACTTATGCGGTTGCAGCGGGCGTTCTGGCGCTGCCTTTCATGCTTTCTGGAAAGACCGCGCCCGCTTTTACAGCTACCCAACGTCTGGTCGAAAACCAGCGATAAACCGATTGTGGATGGATCGGGCCGAAAAGGCAACTGGTGATTTTATTGATTGCTGAGTTTTGAATACATTGAAAACCGCCAGCGGAAACGCTGGCCGGTTTTACGTATCAGGAAGATGTTCAGAGGAATATTTAGACATCGTTATACCAATCAAAGAGCATATATTCATGAAATATATATAAATATTTTTCCTAATTGTTCTTATCTGACAGATATCTCCACTTAAGGCTTTCTTATAAATCTGTAGGGTTTCTACGCCTGTCAGCAGACAAATAACCCGATAAAACAAGGATGAGCAGATGAGCGAAGCGGCGGCGCGTCAGGCGACATGAAGGCGCAGTATGGCGGTAGCATTGTCAGGGTTCAGCCGGGGTACATCCAGTGCCCCCACCGGCGTGGCCCTGTTCGGTGTGCCCCGGCGAAGTGACGTCCGGCCATCGGTCAATCCGCTGCTCGGTGCAAAGGTCCTTCCCAGGTGAGCCGACATCGCCCTACTTGGCCGCTGCCGTTCATTCTCTCCGCACCTACGGCAGTTACCGGACAAAACGCCCGCGCCGGTGAGGCCTCGGCCCCGGCTGGAAAATGCCTGCGGATACCCGCTTACAGCTGCGCGATAACGCACTGATACTCGAGTGATAGCGGCGGCAGAAGCCTGTATTTTGAGCACCTGTTTCCCGGTGAGGACGGTTACAGCCGCAGCGGAAAGTCACTGTGGCTGGTGCGCGGCGGCGTGGCGAAACTGGATGAAGATCACCGGCTGGCGCACTCTGGCGAAACGCTGCGGAAGAACTCCACGCTTAAGTCCCGCATCGTTATCTGGCGACAAACAGTCCGCAGGGGCCGTGGTGGCGGCTGCTCGGCTGGTGTGAGCGGGTGCCGGAAGCGGATGAGGTGCTTCTGCGCCGCTGCCGCCATTACCGGGTACTGACCGGGCTGGTGGACCGCTTCGGGCGCACACAGACGTTCCCCACCCGCGAAACCGCCGGTGAATTCAGCGGCAATCACCGGCGTGACGGATGGTGCCGGGCGTCACTTCCGGCTGGAGCTGCGACCGCGCAGCAGGCGCAACGGTAGAAAGCCCGGCAGCAGGCCATTTCCGGCAGGACAGGAACCGTCGCTTTCCTGATACCCTGCCGGGTTACACCGAATATGGCCGGGACAGCGGCATCCGTCTGCCGTGTGGCTGACGCACGACCCGGAATACCCTGAGATTTTACTGCCGCGCCGCTGGTGCACTGTAACTGGACGCTAGGTTTAAACACCCAAACGAACGCCGAAGATAGAGCGACAGGCAGAAGTAGCAATGCGTATTGGCCCGCA
+>9388888e-4344-4e51-a44c-54c3b3c62b8b
+CGGTATACTTCGTTTGCCAGTTGCGTGATGGCTGCCTGTCGCTCTATCTTCGGCGTCTGCGGGTGTTTAACCTACTTGTCTTTAAAGAGCGTATCGGCGCGTTGGTAATCGGCGTGCGGGCGGGTGGTTCATCAAGCGCGACCAGCACCTGATCGAGATCGGGGCGATGCGCGCCAGTCGGTCAACAAACGTTTCCCGACGCCACCAGCGGCGCGGGCCGAACGACCGAGAATAATCTTGCCGGTTATGTTCACGGGCATAACGCACTACCGCTTTCTCTTCCGCTGGATCAAAGATGTTGCCAAATATCGCGCCCAGTTCACCGCCAGACGTAAGGCGCTGAAATTGCCCGACGTTTTTCCGGTAAGCGGGTGCAGGGCAGGGGTTTCAACACACCGCGTGCCAGACGCTACCAGCCAATGACGCCAGCCGCGCCGCTGCGCAGCGACGTAGTTTTCGCTGCCGGTGTTATGGCCGATGCCATAAAGAGATCGCGTCGCGCGTGGCCACACTTTTCTCTTCGCCAGGATGCCCCGCCAGGCTGCGCATTTGCTCATCAGCGCGATCGGCAGTACGGCGCAGTGCCAGTTCAGCGCAGGGCGATCAGATTACCTTTGCGGAAAAATGTTCAATGGCGCGCTCCGCCTGCCCGGCAATATAGACTTTGCCTTCTTTCAGCCGCTGGCGCAGAATCGTCCGAGGACAAGTCCACCCAGCACCACGTCGTCGGCGGCATCGAAAAAGGATGAGCACAGTTCCCCGTACCTGAATTCCGGTGACGCCGCTGACCACATCATTCCAGCAGGCTTTCCAGATGCTGAACGTTGACGGTAGTGAAAACATCAATGCCAGCTTCAGTTCTTCGATATCCTGCCAGCGTTTGGGATGACGGGAACCTGGCGCATTACTGTGCGCCAGTTCGTCAAATAGATCAGCGCCGGAGCGGCGGGCAGGGGGCAGCATCGAGATCAAATAAGCGTGTAACGCCCACGGTACGCCTGGCGTTTTAACAACGGCAGAACAGCCAGCCCTTCCAGCATGGCGGCGGTATCTTTTCGCCCGTGGGTTTCTACCATAACCACAATATCCAGCCTTGCGCCCGCAGTCGCTGGGCTTCTGCCAGCATCGCCAGGTCTTCCCGACGCCTGCTGAGCACCGAAAGAAAACTTTCCAGCTTCCCCGATGCGGCGCGGCAGTTTGTTCCAACCAGACGATCAGGGGTCAGGTTATCAGGGTTCGTTATTCATCAAAGTTTATCAGCGCCAGATTGGTCAACAATGTTGACAACCGACTGGCCGATATATTTCACCAGCAGGTTGTTGGCTGTATTTTGCGATCAGTTGCGTGAGCTGTTCAACGCTGGTGCCTTTCGCCACGCACGTAAGGATTTGCCAGGCCCGCCGCGCGGGGTGATATTATTGTCCAGCCCGCTTGCGTGCCGTCACCAGTTCAGCCGGAACGCTCGCGCTGGCATCCGGGTTGGCGGCCCGTAATGCAGCAACGCGTGCGGCTATTAGTTTATCCAGCTCAGGGTTACTGACCGCCAGATTGCTCCCGCCAGAAGCCGCAACTGGATTATAGGGCATTTCTACCGTTGCCGACAGGTGATACCAAAATAGCCGTTGCCGGTAAAGAATTTCTGCCCGATTAATGCCGAACCGCTTGCCGTATCACGCCGCGAATCAACGAACCATTGGCCCAGAAACCACCATTGCTAAGTACGGTGGTCAGCGGCGGGTAAACGCCCTTGATAATCAATAACAGAAGATAAATGTTGATAATACGGACGTAATCACTCATGGTAAACCTCACCGGATACTGAAGCGGTCAGCCCAGTAAATCCATTTGTAAACTTTGATGATACCGATAAACGGCACCAACAGCCCACCCAGACCGTAAATCCATAAGTTACGGCGCAACATGGCAGAAAAACGGTAAGCGGTTTATAACTCACGCCTTTAACGCCAGAGGAATCAAAGACGATAATCAGGCGGTTGAAATCCACCGCTACTGAGAGTTGCGGAGTCGGGCGAATGCGGGCACATGATGTTCCAGCGCATTTAACTGCGGATGCGTTGCCACCGCCGGAATAATGCGTGGCTTCGCCACATCGCAACAATGCTGAAGGTGAATTCAGCGAGCCACGGTCATCAGCATCTGTTTGCCAATGTGCACCACCTCGATCAACCCGGTCGGGTTAAGTCGAGATCGACCATATGCCCCTTACTCTTTCGCCGCCTGGGTGCCGGAGTTCATCGCCACCGCGACATCTGCCTGCGCCAGCGCCGGGCCTCGTTGCCGTCTACTTCGGTCATCGCTACCAGGCGACCTTCCGCCTGATACTGACCGGATCAATGCCGAAACGGCCTCGGTGTCGCTTCGGCGAGAAAATCATCGACACCCGCTTCGCAACATTGCAGCGGCAGTCAGACGGTTATCGCCGGTAATCATCTCACCGTTTTAATGCCCATTTGCGCAGCTGGGCGAAGCGCTCTTTAATACCGCCTTTGACGGTGATATCTTTCAGCGCAATAACGCCTTTGCAGAACCTTCCACCACCAGCGTGGCTCCTGACGCGCAACCTGATCAAACTTTTTTGATCCAGCATCGGTAGGGAAGTGACCACCGTTAGCCTCTTGCCAGCGACAGATGGCATCGACAGAACGCTTTACGGATCCTTACAGTTTGTCGATGTTGATCCCATCATCGGCTTTGCGCAGTAAACGGTACAAAGGTAGCGTAGACGACTGCACATCGCTCGCGCAGGTTAAAACGCTGCTTAGCGAGGATCACAATACTGCGGCCTTCCGGCGTTTCATCAGCCAGCGAAGCCAGTTGTGCGGCGTCAGCCAGCGTTTCATCACACGCCCTGCGCGGATAAGCTCCGACGCCCTGACGGTTACCGAGTGTGATGCCGGTTTTAATCAGTAGCCAGAACGTCAGCAGCGTCTATACCGCTTCAACTGCACGTCCGCTGGCGTGTAATCACATTCGCGCCTAGCACATCCGGCTCATCCGGCGGCATGATCGCTGACAACAGGCCGCCAATATGTGGTTGGGATCAGACAGACCAGCAGCGCCACCAGTACCGTTACGCTGACTGCATTACCGCCCCGCGCGGAAAACGGCCACAGCGTGGCGGTTATAATCAAAAAGACGATGATAATTCAGGGGCAATCAGCAGAATAGTCAGGGCAATTTCGTTCGGCGTTTGCGTCGCTGTGCGCCCTTCCACCATCGCGATCATCCGATCCAGAAATGCTCGCCGGTAACGCTACACTCACCAGCCAGTCAGAAAGAATACGCGTGCCGCCGGTGACGGAGGCAAAATCGCCGCCAGTTCACGGATCACCGGTGCCGATTCCCGGTGATGGCGCTTTCATCGACTTCACCCCTTCAATAACTTCACCATCGCAGGGATAATATCGCCAGCTTCTACCAGTACGATATCGCCTTTACGAGTTGGTCGGCAGGAACTGTCCGCCGCAGCCTTCGGCCCACGCAGCTTGCGGGCAAGGCAGTTTTCACCCCTTTCAGACTTTGTTGGCCTGCGCTTTACTGCGGCCTTCTGCCAGCCGCCTCGGCAGCGAGTGGCGAACAGTGCGGTGATCCACAGCCAACGCTAATGGCGCGCTAAACAGCGCATTGCCGGGCATGTACCGCTTGCCATCGCGATGCTAATACAGGTGGTCAGCAGACTGCCGATCCAGACGATAAACATCACCGGATTGCGCCAATTGCGCCTGCGGGTTTTAATTTTTTCACCGCTTCTTTCAGCGCCTGAGCGACAAGTGTTGGTTCCGAATAAGCGCCAGTTGTTTGCGACTCGCATATTCGGTGCTCCTCAATATCATCGGGAGATGTTCCGCCACCGGACCAAGCGCCAGAACTGAGATAAAGGTCAGTGCGCCAACCAACGCAGTTGCCTAACGCAGGCCAACAAACAGCGGGCCGTGCGTTGGCCAGCGATGCCGGGCTGGCGGCTGGCTCTTTACTCACCAGCGAACCGGCAGTGCCATCACCGGGATAATCCTTGAAGCGACCGACAGAGCATGCAGAACGCCGGTAAACGAGTTCCCAGAGACGGAGTTGGCGCCCAATCCGGCTGAGCACTTTGCCGTTGTTGTTAGCGGATGACGGCAGTACAGCACTTCGCTTCGCCATGCCGTTGGCAGGGTTGAGCGTAGCGCCGATCCGGCGTCGGTCATCATCGCCAACGCCGCGCCCATCAACACCAGCGTCAGGGTAACCAGAATTGCCAGTGCAGTCAGTTTCATCTCGCGTACGTCATTTTTTGCAGATATTCCGGTGTACGACCAATCATCAACCGGCAATAAGCTTACCGCCAGCGGGACAAACATCGCCGTAAAGACCAGAACCGACACCGCCGAACACCACTTCACCAATTTGCATCAGCCCACATCGGCACCATGCCACCGAGCGATGACGAATCATCGCAATCACCGCGCCACGAAGAGCCGCCGTCGACCGCGACCGCAAACAGGCTGCAGCAGCACGCCGAAACGGCTCTCTTTACCTTCCGCCATTGATGCTGCTGTCGTGCCCAGTGCCAGCAGATGAGGATTACCTGAACTTCTACCCACATCACCACGCCTACGCAGATGACAAAAATCGCGGCATCGCCCACAGCAACGTATGCGCCCCTGGCAGCGATCGCCCATCACTTCACCAAAGGTAAAGCGCAGCGCCGTTGGGATCAAAGAAGATCGCCAGCATCTGCTGAAGTTGGTCGAATGCGGTTGGGTTTTCAAACGGATGCGACGGTTGGCATTAAAGCCACCGCCGTTAGTACCGGTATCTTGATCGCTTCTGAAGCTACAGGCCCCATGGGTAACAGCTGTTGCGCTCTTCAGCGGTATTCACAGCCTGATAAGGCGAAAGTTTTGCAGCGCAGCGTTTAGATCCAAAAACAGTGCAATCGTAACAACGCCACAGGGACTAGCACCATAACGCGTGATGCGTAGCAGATCGGCCCAGGCATTCGAGCGTGCTCATGCTCCTGGCGGAGTAAACGCACGGATGAGGGCAAAAGGAAAAATCACCGCAATCCCGCTGGCGGCAGAAGAAAGTTTTGCGCGTTAAGCCCGCCATCCTGGCTGAAATAGCTCAACGTGGTTCTGCCGCTATAAGATTGCCAGTTGGTATTGGTGATAAAGCTGACGGCGGTATTCAGCGCCAGATCCCTGACAGCCCACAGCAACTGCTGTGGATTAAGCAGATGGTGCTGACTGAGCAACATAAAACAGCACCGCCAGCCCCAGCATGTTCAGGCCGAGAATGGCACAAAGATATTGCTTCCGGTTCATCTCACGGTCAGAGGCCTTAAGTGCCCGAAAAAGTACGCTCAACGCCCGTGCCAGGAGAGATGTCGTTAATCAGCCGCCAGCCCGCTGCCTAAAGGACGCGCCAGCACCATTAACACCAGTAAAAACGTGGCGATCAGTAAGAACCCTTGCAGCCATCAGAACTGCCTCCCGCGTGATCAGGGGCATAACCAGATAACAGTAATAAAACACCAGCAATACGCCGGTTATCCGCCTGCACTCATTGCACTCAGTGGCTAAAAGGTGATACCGGAAGGGTAAATTCTGGCTGCAAGATTTCGCAAAATCTGCGGGCGGGGAGTCTAAAGAAATATAAAAATGCGCCCAGAAGCCGTAATTTTAACTAATATTTGAAGTATTAATTTAACTTTGTGTGGCAATTACAGGATGAATGTAAATAAACCATCAATAGCAAAATAAGTGGTCGGATGGTAGTAAAATTACACAAAGGCGGTACTAAACTCATCAGATAAACCGATTCATTTTCAGTGCCATTCACCGGGTGGAGGTAAAGGGAGAAAAGTATGGAACTCTGCAAGAATATCCTGCATGGCTTATCTTTTTACGCCGTACTTATGCGGTTTGCAGCGGGCGTTCTGGCGCTGCCTTTCATGCTTTTCTGGAAAGACCGCGCCCTTTTACGCTACCTGCATCGCGTCTGGTCGAAAACCAGCGATAAACCGGGTGTGGATGGATCAGGCCGAAGAGCGGCTGGTGATTTTTGTTGATTGCTGAGTTTTGAATACATTGAAAACGCCAGCGGAAACGCTGGCGGTTTTTGCTATCAGGAAGATGTTCAGAGGAATGTTTGAACATCGTTATGCCGTCGAAACATATTCATGAAATATATATAAATATTTTTCCTAATTGTTCTTATATGAATATCTCGCCAGGCTTTCTTATAAATCTGTAGGGTTTCGCCTGTCCTTGAACAAATATTGATAAAACAAGGATGAACAGATGACGGAAAACCGGCGGCGCGTCAGGGCGACATGACGCAGTATGGCGGTAACGTATCAGGGTTCAGCCGGTACATCCGGTGCCCCCACCGGCGTGGCCTGTTCGGTATTATGCCCCGGCAGGTGACGTCAATCGGTCAATCACTGCTCGGTGCAAAAGGTCCTTCCCGGTGAAACCGACATCGCCCTGCCGGCCCGCGCCGTTCATTCTCCTCCGCACTGACGATTACCGGACAAAACGCGCGCACGCCGGTGGGAGCCTCGGCTTCAGCTGGAAAATGCCTGCGGATATCGCTTACAATTTCGCGATAACACACTGATACTCAGTGATAACGGCGAAAAGCAGAAAGCTATTTTGAGCACCTGTTTCCCGGTAGAGACGGTTACAGCCGCAACGAGTCACTGTGGCTGGTGCGCATGCGAAGCGTGGCGAAAAGCTGGATGAACAGCTGGCACGCACTCAGCGACGCTGCCGGAACTTTCGCCAAAGTCCGCATCGTTATCTGGCGACAAACAGTCCGCAGGGGCGTGGTGGCTGCTCGTACCGTGTGAGCGGTGCCGGAAGCGGAGTGGTGCTGCTGCTACGCCGCTGCCGCGCCAATACCGAATTGCTGACCGGCTGGTGGACCCTTCGAGCATACGGGCCGTTCCACCGAAGCCGCCGGGTAAATTCAGCGGCGAAATCGCCGGCGTGACGGATGATGCCGGGCGCCACTTCCGGCTGGTGCGACCACGCAGGCGCAGCGGGCAGAAGAAGCCCGGCAGCAATTGCGACTTCCGACGGGACGGAACCGTCGCTTTCTGATACCCTGCCGGAACGCACCGAATATGGCCAGGACAACGCCAATCTATCTGCCGTGTGAAAGCTGACGCACATTCCAGGAATACCGGAGAATTTACCTGCCGCGCCGCTGGTGCATATGGCTATGGACGCCCGCGGCGAACTGGCAGCGGTGTATATTGACCGCAGCAATGCGATTAACGCAACTGCCCGATATTAATCGCATGCAGGGGCCGGATGGTGGCGCACGTCGCACGGTGACCGGAAATCTATTACCGTTACAATGGCGACGGGCGGGTGAACAACAAACCAGCGGAAGCAAGTTACACGTATCAGTATAGAAGGACCGCATGCCATCACCGACAGCCTGAACCGCCGTGAGAGTGCAGGGTGAAGACTGGGCTGAAATAGTGGTGAAAAAGGTACGCGGACGGCAGCGTCACGCCAGAGTCAGTTTGACGCGTGGGCGAATGAGGCACAGACGGATTCACCGCGAAGGACAACATGAAATACAGTCCGGATGTGGTGACGGGCCTCATCACGCGCATCACCACGCCGGATGGCAGGGCATCGGCGTTTACTACAACCACCACAGCCAGTTGACGTCAGCCACCGGGCCTGACAGCGGGCTGGAATACGCCGGGAATATGATGAATGGGGCCGTCGTTCGAAACTGCTGACGGCGGTATCACCGCTACCGTTGAATTAATCCACTGTTGACTTTACCTGCGCAGCGGAAGATGCACCGGCAACGGAAAACATGACGTGGGCCGTTACGGTCAGTTGCTGAGCTTCACTGACTGTTCCGGTTATGTAACCCGCTACTGACCATGACCGTTTTGGTCAGGTGACGGCGGTGCACCGCGAGGAAGGAGCTGAGTCAATTACCGCGCATACGACCGTGGACGGATTAATTACCGATATGAAAGACACGCAGGGCCGCGCCAGAAGCGCGGTAGATACAGAAACGCCGCCAGTGACCTGACCACCGTCATTGCCCCGGACGGCAGCAGAAACGGGACGCAGTACATTCGTGGGGAAAAAGCCATCTGTACCGTA
+>c30b48fc-11eb-4d3d-9c89-58ad29b2631d
+TTGGTATGCTTCGTTCAGTTACGTATTGCTCTTGCCTGTCGCTCTCTATCTTCGGCGTCTGCTTGGGTGTTTAACCTACCCTTGCGCAGCCATCGAACGCCTCCGCATTGATCAGGGCGCAAACCAGATAACCCAGTAATAAGAACACCAGCAATACACTTGGGTTATCACGCCTGCACTCTGGTGCACCTCAAATTGGCCTAAAAGTGATACCGGAAGGGTAGAATTCTGGCTGCAAAGATTTCGCAAAATCTGCGGGCGGGTGTAAAAAGTATAAAATGCTTAAAAGCCATGGTTAACTAATATTTATCAGTAATTTAACTTTGTGTAACAATACAGGATGAATGTAAAATAAACCATCAATAAGCAAAATGGTGATCGGATGAGTAGTAAAATTACACAAAAGGCGGTACTATTTTCATCAGATCAAGCTCATTCATTTTTCAGTGCCATTCACCGGGTAGATACAAGGGGAGAAAGTATGGAACTCTACAGAGAATATCCTGCATGGCTTATCTTTTTACGCCGTACTTATGCGGTTGCGGCAGGCGTTCTGGCGCTGCCTTTCATGCTTTCTGGAAAGAAGACCGCGCCCGCTTTTACAGCTACTGCATCGCGTCTGGTCGAAAACCAGCGATAAACCGGTGTGGATGGATCAGGCCGAAAAAGGCAACTGGTGATTTTATTGATTGCTGAGTTTTGAATACATTGAAAACCGCCAGCGGAAACGCTGGCGGTTTTTATATCAGGAAGATGTTCAGAGAATATTTAGACATCGTTATACCAATCGAAACCTTATATTCATGAAATATATATAAATATTTTCCTAATTGTTCTTATCTGACAGATATCTCACTTAAAACTTTCTTACAAATCGCCAGGGTTCGCCTGTCAGCAGACAAATAACCCGATAAAACAGGATGAGCAGATGAGCGGAAAACCGGCGGCGCGTCGGGCGACACTGACGCGGTATGGCGGTAGCATTGTCCAGGGTTCAGCCGGGTGCATCAGTGCCCCCACCGGCGTGGCCTGTTCGGTGTGTGCCCCGGCAGGTGACGTCGGCCATCCGAGTCAATCCGCTGCTCAGTGCAAAGGTCTTCCCGGTGAAACCGACATCGCCCTGCCGGCCGCTGCCGTTCATTCTCTCCGCACCTACAACCACCGGACAAAAACGCGCCCGCGCCGGTAGAGCCTCGGCCCCGGCTGGAAAAGTGCCTGCGGATATCCGCTTACAGCTGCGCGATAACGCACTGATACTCAGTGATAACGGCGGCGAAGCCTGTATTTTGAGCACCTGTTTCCCGGTGAGGACGGTTACAGCCGCAGCGATCACTGTGGCTGGTGCGCGGCGGCGTGTGAAGCTTTGGATGAAGGTCACCGGCTGGCCGCCTCTGGCGACGCTGCGAAGAACTCAACAAGTCCGCGTCGTTATCTGGCAGCAAACAGTCACAGGAGGCCGTGGTGGCTGCTCTGGCTGGTGTGAGCGGGTGAAGCGGATGAGGTGCTGCCTGCGCCGCTGCCGCCGTACCCGGGTACTGACCAGACTGGTGGACCGCTTCCGGAGAAACCTGAACGTTCCACAGCAAGCCGCCATTTAATTCAGCGGCAAAATCTGGCATGACAGACGGGCGTCGCTTCCGGCTGGTACTGACCACACCAGGCGCAACGGGCAGAAGAAGCCCGGCAACTGAGCCATTTCCGGCGGGACGGAACCGTCCGCTTTTCTGATACCTGCCGGGTTACACCGAATATAGCGGGACAACGGCATCCGTCTGTCTACCGTGTGGCTGACGCGACGGAATACCCGGAGGAATTTACCTGCCGCGCGCCGCTGGTGCATATGGCTGGACGCCCCGCGGCGAACTGGCGGCGGTGTATGTGACCGCAGCAATACACAGGTGCGCAGCTTTACTTACGATGATATGCAGGGCCGGATGGTGGCGCACCGTCCACACGGGCCGACCAATCTGTTACCGTTACGACAGCGACGGGCGGGTGACAGAACAGCTAAACCCGGCAGGCTTAAGTTACGTATCAGTATGAGAAGAATTTGCATCACTGTCACCGACAGCCTGGGCCGCTGTGAAGTCCTGCACGCAGGGTGAAGGCGGGCTGAAACTGGCGGGTGGTGAAAAGGAACACGCGGACAGCGGCGTCACGCCAAGTCAGTTTGGCACGGTGGGCGGAAACAAATTTTGAACGGATGCTGCAGGCAAGAGACAACAGGAATACAGTCCGGATCTGGTGACGGGCCTCATCACGCGCATCACCACGCCGGATAACGAAGAACATCGGCGTTTTACTATAACCACCACAGCCAGTTAACGTCAGCCACCGGGCCTGACGGGCTGGAATACGCCGGAATATGATGAATGGGGCCGTCTGATTCAGGAAACTGCCCCTGACGGCGATATCACCGCTACCGTTATGATGTCCACACAGTGACTTACCCTGCGCAACGGAAGATGCCGGCAACGGGAAAACCATGACGCGTGGAGCCATTACGGTCAGTTGCTGAGCTTCACTGACTGTTCAGTTATGTAACCCGCTATGAAACCATGACCGTTTTGGTCAGGTGACGGCGGTGCACCGCGAGGAAGGGCTGAGTCAGTACCGCGCATACGACAGCCGTGGTTGATTAATTGCCGTGAAAGACACGCGGGCCATGAAGCACGGTATGTATAGATACAACGCCGCCGGTGACCCTGACCACCGTCATTGCCCCGGACGGCAGCAGGAAACGGGACACAGTACGATGCGTGGGAAAAGCCATCTGTACCACGCAGGGCGGTCTGACGCAGTATGGAATACGATGCTGCCGGACGGGTCATCCGCCTGACCAGTGAAAACGGCAATACCACCTTCCGTTACGATAACATCTCGACCGGCTGATACGGAAACCGGCACGGCGGCCCGCACACAGCGATTATCACCACGACCCTGACCGGCAAACATCCGCAGCGAGGATGAGGAATGGTCACCCACTGGCACTATGACGAAGCAGACCGCCTCACGCACCGCACCGTGAATGGCGAAACCGCAGAGCGGTGGCGATATGACAAAGACATGGCTGGCTGACAGACATCAGCCACCATATCAGCGAAAGGGACACCGAATTTGACGGTACTATGGTTATGAACAGTAAAACCGCCTCGCCAGTGAACACCTGACGGTGCTGCATCATCCACTGAACGAATGAACTGCTCTGGCAGCATGAGACCAGACATGCGTACAACGCACAGGGACTGGCGAACCATGTATGCCGGACAGCCTGCCCACGCCGTGGTCGCGATACGGCAGCGGCGGCCGTCGACATCGAACTCGGCGAGCACACCGCTGGTGGAGTACACCCGCGACCACCTGCACGGGAAACGCTGCGCGGCTTTCGGTCGTTATGAACTCACCTGCCATACTTGCCGGGCAGTTACAAGAGCCAACTACGAACAGCCTGCTGTCTGATACGATTACACACCGGAACGACAACGGCGAACTCATCCGCATCAGCAGCCCGCGCCAGACCCGGAGTTACAGCTGGCACCACCGGCAGGCTGACCGGCGTTCACACCACCGCAGCGAATCACGGATATCCGCATCCATTACCACAGACCCGGCAGGTAACCGCCTGCCCGACCCGGAAACACCCGGACGGCGCCCTCAGCATGTGGCCGGATAACCGTATCGCCGTGAGCGCACTATCTTTACCGGTATGACCGTGCGGCAGGCTGACAGAAAACCGGCCTCATCCCGGAAGGGGTTATCACACGGATGATGAGCGCACCCACCAGTACCATTACGACGGTGGCACCGGCGGTGCACCACACGCGGACACAATATGCAGAGCCGCTGGTCGAAAGTCGCTATCTTTACGACCCTTTGGGCCGCAGGGTAATGAAACGGGTATGACGGCGTGAACGGGACTGACGGGCTGGATATCGCTGTCACGGAAACCGCAAGTGACCTGGTACGGCTGGGACGGCGACCGCCTGACCACGATACAGAACGACAGAACCCGCATCAGACGGTTTATCAGCCGGGAGCTTCCGCCGCTCATCAGGGTTGAAACCGCCACCGGTTAAACGCAGAAGCAGACGCCGAAGATAGGAGCCGCA
+>237f1f8e-b267-437b-b8d0-464a8f838fc0
+TTCGTGTATGCGCTGGTTTCAGTTACGTATTTGCTACGCCTGTCGCTCTATCTTCGGCGTCTGCCCGGGTGTTTAACCTGTTATCGCATGAGCCATCAGTGCCATTTATCGCGCCAACTCGCCACCAGGCATTTTCCAGCCAGGGCCAGGCTCCCCACGGCGCAGGCGTTTTGTCCGGTAACTGCTGCGCCGGTGCAGGAGAGAATGTATGAACGGCAGCCCAGGTAGGCAGGAGCGATATCGGATTTCACCAGGAAGGACCTTTACCACCGAGCAGCGGATTCGACCGGATGGCGGAAATCACCCCGCCGGGAGCACCGATAGGCCACGCCGGTGAATTTTCGACCGTACCCCGGCTGAACCCTGGAACAATGCTACCGCCATACTGCGTCATGTCGCCCTGACGCGCCGCCAGAACTTCTAATCACCATCGCATCCTTGTTGTTTATCGGGTTATTTGTCGCCTTTGTGGGCAAAAGCCCTACAGATTACTCGAAAGCCGCCAAAGGTGAATATCTGTCGATTAAGAACGAATTGGGAAAATATTTATATATGTTCGCCGGGCTCCATGTTTCGGTGGTATAACGATGTCTAAATATTCCTCCTGAACATCTTCCACCGATGCAAAAACGCCAGCGTTTTCCGCTGGCGGACTCAATATTAAAACTCAGCAATCAATAAAATCACCAGTTACTTTTTCAGTACAGATCCATCCCACCCGGTTTTATCCGCTGGTTTCGACAGACGCGATGCGGAAGTAGCTGTAAAAGCGGGCGCGGTCTTTCCAGAAAAACGCTGAAGGCAGCGCCGGAACATGCTACAACCGCATAATTACGGCGTAATAAGCCATGCGAGATATTCTCTAGCAGAGTTCATACTTTTCTCCTCCTTTTGCTTATCTACCCGATGAATGGCACCGGAAAATGGAATTACTGTTTATCTATTGATGAAAATAAGTACGCCCTTTTGTGTAATTTTACTGCTCATCCAAACCGCTTATTTTTGCTTTATTGATGGTTTTATTTACATTCATCCGCCATATTCAAGTTACAAAGGTTAAATTAATACTAAACGTGGATTAAATCATAAAAACTTTTGCCATTTTTATACTTGCCCGCGATTTTTGCGAAATCTTTGCAACCAGGTCTACCTTCCGGTATCACTTTTAGGCCGCAAAATTGCACTGTAGTACAGGCGTGATAACCGGCAACCTTCGTGTTTTTATTATTACTGGGTTATCTGGTTTATGCCTGATCAAATGCGGAGGCGTTCTGATGGCTGCACTGGGGATATACTGATCGCCACGTTTTTGCAGGTGTTAATGGTGCTGGCGATCGCTTTGAGCGGCGGGCTGGCGCAGCTGATTGACATTTCACTCTTCCCCGGTACAACGGGCGTTAGGCGCGTACTTTTTTCGCGCATGGCGTCTGACGTGAGATGAACTGGAAGCAGTATGCTGTGCCATTCTCATTTTCGTTATGCTGGGGCTGGCGGTGCTGTTTTCATGTTGCTCGGTCGGCATATCGCCGCTTAATCCACAGCAGTTGCCAGAATTTCAATGGTAGGATCTGGCGCTGAATACCGCCGTCAGCTTTATGCAATACCAGCTAACGTCTTATGGCAGTGGCTTGGGTAGGCTATTTCAACAGCCAGATGGCAGCGGGCTTAACGGTGCAAACTTTCTTTCTGCCGCTAAGCAGGATTGCGTGATTTTGCTCATCCGACCGTTTACCGCCAGAACATGAGCACGCTCAGGAATGCCGCAATTCGATCTGCTACGCGTCACGTTAGCAGGTGCTTCAGTCCTGTGGCATTGTTGATTGCACTGTTTTTATTCAACAAAGGTGCGCTGCAAACTTTCGCCTTATCAGGCTGTGAATACCGTTGGAAGGCACGCAACAAGCTGTACCCATGGGGCCTATGGCTTCTTTCAGGAAGCGATCAAGATACTCAGTACTAACGGCGGTGGCTTCGCTGTACCAACTCATCGCATCGTTTGAAAACTAGCCACTGACCAACTTCGTGCAGATGCTGGCGATCTTCTTGATCCCAACGGCACAATAACTTTGCACTGGGTGAAGTGATGGGCGATCGCGCCAGGGGCGCATGTTGCTATTAAGGCAACCAAAGTGATTTTTACGTAATCTGTGAGCGTGATGTGGGCAGAAGTTCAGGGTAATCCACTCATCTGCCAGCACTGGGCACGGACAGCAGCATCAATATGGAAGACAAAGAGGCCGTTTCGCTGTCTTTGGTCAATGTATGTTTGCGGTCGTGACGACGGCGGCTATAATGGCGCGGTGATTGCGATATATGATTTCGTTTACCCAAAGCTCTCGGTATCAGTTACGTCGTATTTGATAAAATTGGTACGAGTGAATTGTTCGGCGGTGTCGGTTCTGTGCTTTTACGGCATGATGCTGTTTGTCCTGCTGGCGGTGTTTGTTGCCAGCGGGGCTGATGGTTGATTCATTACACCGGAATTTCTGGGTAAAAATCGACGTACGCGAGATGAAACCCGACTGCACAGCGAATTACCGTTTACCCCCGACGCTATGGTGCTGATGAACGCGGCGGTGGCGATGATGACCGACGCCCGGCGGACGTAGCGCCATGCTCAGCCCTGGCCCGCATAAGGTTTTAGCAGTGCTGTACGCTTAAAATGTCATCCGCCGCGCTAACAACAACGACGGCGCCTTTGCCCGGATTAAGCGCAACTCTCCGTTCTGGAATATTTTACTGGCGTTCTGCATGTTTCATCGGTCACTTCGGGGTGATTATCCCGGCCGATGGCAATTACGCCGGTTCTTCGGTGTAAAGAGGCCAGAAGCCGCCAGCAGCTTCCGGCACGCTGCCAACACTTTACGGCCCGCTGTTTTGTTGGCTGTTAATCGGCACCGTTGCTGGATTTGGCGCACTGACCTTTATCCTGCCTGGCACTGGTCGGTGGAATATCTCTCCTGATGATATTGGTGAGCGCACAGATATGAGTCGTAAAGCAACTGGCGCTATTGAATTAACGCATCGTTCGGCGCTGAAAAACTGGTGAAATTAAACCCGCAAGGCACCAGTAAGCAATCCGGTGATGTTTATCCGATACCGGATCGGCAGTCTGCTGATATTATAACATTAACATCGCGATGGCAAACGGTTACGTCGCGGCAATGCGTGTTAACGACCATTAGCAGTTGGCACAATATGGATCACCCAGCACTGTTCGCTAATAATAATTTCGCCGGGCGCTGGCAGAAGGCCGCGGTAAGCGCAGGCCAACAGTCTGAAAAGGATAAACTGCCTTTGCCCGCGAGCGCGTGAGCCAATATATGGCGCTGCGGCCAGACCAAAATACCGACCAACAATAAAAGGCGATATATCGTACTTTTGTTAGAAGCTGGCGTCAGTATCCCTGCGATGGTGAGTTATTGGAAGGGTCATCGGTCGGTAAGCGCCATCACCGGGAATCGGCACGGTGATCCGTGAATCAGCGGCGATTTGCCTTGTCACCGGCGGCGCGTATTCTTTCTGACTGGCTGGTGATTGAATTGGCGTTAACCCCGGCGGAACATTTCTGGATCGGATGATCGCGATGGTGGAAGCGCACAGCAGCGCAAAACGCCGAACAAAAGTACCCTGACCGTTCTACCGTTGCCTGACTATCGTCTTTTTACTGGCAACCCGCACGCTGTACATTTCCGCGTGGGGCGGTAATGCCGTCAGCGGCAACGGTACTGTCGGTGGCACTGCTGGTCTATTCTGATCCCAACCACTATTGGCGGCCTGTTTGTCAGCGATCGGCATCGCCGGGATGAGCGGATGCTGCGACGCGAATGTGATTGCCACCAGCGGACGTGCGGATTTGAAGCGACGCGGCGTTGACGTTCTGCTGCTGGTCAAAACCGGCACCATCACACTCGGCAACCGTCAGGCGTCGGAGTTTATCCCCGCGCGGGGCGTGGATAAAACGCTGGCTGACGCCGCTTTATGGCTTCGCTGGCTGATATGAAACGCCGGAAGGCCGCAGTATTGTGATCTCCACCAAGCAGCGTTTTAACCTGCGCGAGCGCGTCAATGCAGTCGCTCCATACACCTTTGCTGCGTTTACTGCGCAAAACCGGATGAGCGGGATCAACATCGACAACCGCATGATCCGTAAAGTTCTGTCGTGCCATTGTTCGATACGCCATCATTTAGCAGAGGCTAACGGTGGTCGCCCCTACCCGATGTTGATCAAAGTCGATCAGGTTGCGCGATCGGGGTACGCCGCTGGTGGTGGTGGAAGGTTCTCGTGTTACTGGGCGTTATTGCGCTGAAAGATATCGTCGAGGCGGTGTAAAGGCGCTTCGCCCGAGCTGCGCAAAATGGGCATTAAAACATTGATGATTACAGCGATAAGCTTTGCCTGCCGTCTGACTGCCACCGCGATTACCGCGGAAGCAGGTGTCGATGATTTTCTCATGAAAGCGACACACGCAGGCCAAGCTGGCATTGATCCGTCGAGTATTATCAGGCGCGGAAGGTCGTTTGTGACTGGCGATATTAGGCCCGGCGACAACAACCAACGTGCTCCGGCGCTGGCGCAAACGGATCATAGTGAGCGATGAACTCCGGCACCAGGCGGCGAAAGGCAGGCAATATGAAGGTCGATCTCGACTCTATTGACAAGTTGATCGAGGTGGTGCACATTGGCAAACAGATGCTGCGATGACCCGTGGCTCATGACCACCTTCAGCATTGCCGCAAACGATGTGGCGAAATGCTTCGCCTATTCCAGCGGCATTCGCGGCAACGTATCCGCAGTTAAATGCGCTGAACATCATGTGCCTGCATTCGCGCTCCGCAATCCTCAGTGCGGTGATTTTTAACGCCTTGATTATCGTCTTTTGATTCCCCTGGCGTTAAAAATGAGTTATAAACCATACCGCTTCTGCCATGTTGCGCCCGTAACTTATGGATTTACGGTGCGTTGGGCTACGGTGCCGTTTATCGGTATCAAAGTCATTGATTTGATTTACTGCTTGTTTGCGGTCTGGTGTAAGGAGTTTTACCATGATGGGATTACGTCCATCAACATTTATCTTTCTGTTGACAGGTGCGATTTAAACGCACCCAAGCAGACGCCGCAATATCAACCGCG
+>463d6152-c15a-4ad9-b4b6-a85be09d62c3
+TTGTTGTACTTCGTTCAGTTGTGCTTTTCTGTTGGTGCTGATATTGCGGCGTCTGCTTGGGTGTTTTAACCTATCGTTATACCAATCGAAACATATATTCATGGTATATAAATATTTTCCTAATTGTTCTTATCTGACAGATATCTCACTTAGGCTTTCCATATAAATCTGCTTAAGGGTTCGCCTGTCAGCAGACAAATAACCCGATAAAACAAGGATGAGCAGATGAGCGGAAAACCAGCGGCGTCAGGGCGACGCCGACGCAATGGCAGTAGCAGCATTGTCCAGAGGTTCAGCCGGGGTACGCATCAGTTGCCCCACCGGCGTGGCCTGTTCGGTGTGCCCCGGCGGTGATCCGGCCATCCGGTCAATCCGCTGCTCGGTGCAAAGTCCTTCCCGGTGAAACCGACATCGCCCTACCCGGCCCGCTGCCGTTCATTTCTCTCCCGCACCTGGCAGTTACCGGACAAAAACGCCCGCGCCGGTGGGAGCCTCGAAGCCCCGGCTGGAAAATGCCTGCGGATATCCCGCTTACAGCTGCGCGATAACACACTGATACTCGATAACGGCGGCAAGCCTGTATTTTGACACCTGTTTCCCGGTGAGGACGGTTTACCCAGCCGCAGCGAGTCACTGTGGCTGGTGCGCGGCGGCGTGGCGAAACTGGATGAAGGTCACCGGCTGGCCGCACTCTGGCAGGCGCTGCGGAAGAACTCCACTTAAGTCCGCATCGTTATCTGGCGACAAACAGCAGTCCGCAGGGGCCGTGGTGGCTGCTCGGCTGGTGTGACAGGTGCCGGAAAGCGGATGAGGTGCTACCCTGCGCCGCTGCCGCCGTACCGGGTACTGACCGGGCACAATTGGACCGCTTCGGGCGCACACAGACGTTCCACCACTGAAGCCGCCAGTGAATTCAACCAGCGAAATCACCAGCGTGACGGATGGTGCCGAATCACTTCCGGCTGGTACTGACCGCAGGCGCAGCGACTGAAAGCCCGGCAGCAGGCCATTTCGGCGGAACGATTCGTCCACTTTTCACGATACCCTGCCGGGTTACACGAATATAGCCGGGACAACGGCATCGATCTGTATCTGCCATGTGGCTGACGCACGACCCGGAATACCCGGAGAATTTACCTGCCGCGCCGCTGGTGCATATGGCTGGACGCCCGCGGCGAACTGGCGGTATATGACCGCAGCAATACCTGGAATGCGCAGCTTTACTTACGATGATAAATACCGGGGCCGGATGGTGGCGCGCAAATCACACGGGCCGACCGGAAATCTGTTACCGTTACACGACAGCGACGGGCGGGTGACAGAACAGCTAAACCGGCAGGCTTAAAGTTACGTATCCAGTATGAAGGACCGCATCACCATCACCGACAGCCTGAACCGCCGTGAAGTCCTGCACACGCAGGGTGAAGGCAGGTGAGCGAGTGGTGAAAAAGAACTACGCGGACGGCAGCGTCACGCAGAGTCAGTTTGACGCGGTGGGCAGGCTCAGGCACAGACGGATGCCACCAGGCAGGACAGCAGAATACAGTCCGGATGTGACGGGCCTCATCACGCGCATCACCACGCCGGATGGCGGGAGCATCGGCGTTTACTATAACCACCACAGCCAGTTAACGTCAGCCACCGGGCCTGACGGGCTGAAATACGCCAGGAATATGCTGATGAATGGGGCCGTCTGATTCAGGAAACTGCCCCTGGCGATATGCTGCCGCTACCGTTATGATAATAATCCACACAGTGACTTACCCTGCGCAACGGAAGATGCCACCGGCAGCGGAAAAACCATGACGTGGAGCCGTTACGGTCAGTTGCTGAGCTTCACTGACTGTTTCCGGTTATGTAACCCGCTATGACCATGACCGTTTTGGTCAGGTGACGGCGGTGCACCGCGAGGAAGGGGCTGAGTCAGTACCGCGCATGCGACAGCCGTGGACAGTTAATTGCCGTGAAGGAACGCAGGGGCCGTAGAGCGGTATGAATACAACGCCGCCGGTGACCTGACCACCGTCATTGCCCGGACGGCAGAAGCCAGGACACAGTACGATGCGTGGGAAAAGCCATCTGTACCGCAGGGCGGTCTGACGCAGTATGGAATGCGATGCTGCCGGACGGGTCATCCGCCTGACCAGTGAAAACGGCGAAAGCCACACCACCTTCCGTTACGATGTACTCGACCGGCTGATGCAGGGAAACCGGCACGGCGGCCGCACGCAACGTTATCACCACGACCTGACCGGCAAACTTAGCCGCAGCGAGGATGAGGGCTGGTCACCCACTATTTTACTATGGCAAAACAGACCGCCTCACGCACCGCACCGTGAATGGCGAAACCGCGAAACGGTGGCAGTATGACGAACGCGGCTGGCTGACAGACATCAGCCATATCAGCGAAGGGCACCGGTGACGGTGCACTATGGTTATGACAGTAAAGGCCACCTCGCCAGTGAACACCTGACGGGTGCATCATCCTGAACCGATGAACTGCTCTGGCGGCATGAGACCAGACATGCGTACAACGCACGGGGACTGGCGAACCGCTGTATACCGGACAACCTGCCCGCCGTGGAATGGCTGACCTACGGCAGCGGCTGGCTGTCAGGCATGAAACTCGGCGACACCGCTGGTGCGTGCACCCGCGACCGCCTGCACCGAGGAAACGCTGCGCAACTCGGCCCGTTATGAACTCACCACCGCTTATACCCCTGCCGGGCAGTTACGGAAACCGGCACACCTGAACAGCCTGCTGTCTGACCGCGATTACACCTGCGAACGTGGCAGACTCATCCCGCATCAATGACCGCGCCAGGCCAGATTTTAGCTACAGCACCGCCGGCGAGCTGACCGGCGTTCACACCACCGCAGCAGATCTGGATATCCACGTCCGTATACCACAGACCCGGCAGGTAACCGCCTGCCCGACCCGAAACTGCACCCGGACAGCACCCTCAGCGTAATGGCCGGATAACCGTATCGCCCGTGACGCGCACTGGGTTAAACACCCAAGCAGACGCCGAAGATAAGAACGCGGCA
+>be16c798-0278-462a-b65b-6e77e03c7432
+TTGGTAGCCCTTGCTTCGTTTCAGTTGCATTGCTGCTTGCCTGTCATCTATCTTCGGCGTCTGCTTGGGTGTTAACTGGGTCGGTATCGCACCAGCACCGGCGGGAACGCCACACTGCCACCGTCGCTTCGCCGCCGGACTGCTGAAGGGTATCCGCCAGGCTGCGGCGCTGCGTTTTCGCCAGCTCACCGGTGGCAGTTTCAACCTGATGAGTGGCGTGGCTCCCGGCTGATAAATCATCTGGATGCGGGTTCTGTCGTTCTGTATCGTGGTCAGGCGGTCGCCGTCCCAGCCGTACCGGGTCACTTGTGGTTCCGACAGCGACATCAGCCCGTCAGGTCCCCGTTCACGTCGCCACACCCGTTTGCCGCACGGTAGCGGGTCATTAAGATAGCGGCTTTCGACCAGCGGCTCTGCATATTGTGTCCGTAGTAGTGCACCAGCCCGGTGCTGACTGTCATGTGGTACCGGTGGGTGCGCTCATCATCCGTGCGGATAACCCCTTCCGGGATGGTCGGTTTTCTCCGTCAGCCTGCCGTGACGGTCATGCCGGTAAAGATAATTCGCGTCACGGGCGATACGGTTATCCGGCCACATGCTGAGGGTGCTGTCGGGTGCAGCTCGGGTCGGGTGACAGTTACCTGCAGGTCTGTAGGCATACGGGATATCAATGCAGGTTACATATAATAATAAGGCAATTAACTTAATTTATTTGTTTATAATGCGCTCGCACTTAATACAAACCATTGAATATACCACTCCTGACGGAAAATAAAGCCATATTATTATCGCCATAATATACTTACTATCGAAATCCTTACGCCAATAATGTCGTCTGAGTCCCTATAAATATTAGAGCAATAAGAGAATGCTATGTTGGAAAACATATTACCATCATTCCATAAGACATGAGACGAATTAACTCGCTCACATCACGGAGTGGAGTCTAATAGTGAAAGTCTATGCATGGAAAAGAATAGTGATAAAAGCGATAAAATGACCATGGCTCTGAACAAAAATAATATATTTCATTCACATCCTCCGGTGAATACAAATCTAATAAAACGATCAATGTATTTTCCGGAGCACTTCATCTTACATGTTTCCTGAGAATCCACATTAGACCAGTCTTGGCAGTTTTAAATAGCCCTAAATTTATAGGTGTGTGAATATATCCAGGCAATACCAGAATAACATGACCTTACCTCTTTAAACTTCCTTTTAAACAGTTCTCCACACAACTATTATCTGGTTTCAACGAGGGTCACAACGGCCAGCAGCTTCTTTTGTATCATTACTTCCTTTACCTGGCTACATAGACCATCTCCTTTTGATTCTCCCCGTTGGTCTTGGCACACAAGTATAGTCCCTTTACCATCTGGGACACAAAGATATTGATGATGAACCGGATTCCCCATATATCTGGACCGCTTCTTTCACCAGTTCGCCCATTGAATGCAGTGGCTTAATGCATTTTAGTGTTTTCTAATCTAATGGATCTATATTTGAGATCGGATTCAGCGGATACTGATAAAATTCCATCCCCCTTTCAGCCCAATCGGATCTGAGTGATATATCGCCCCTGCAGCGGGTCATAGCGGTGGCGGTTGTAATACCAGGCCGGACTCCTCATCATGCTGCTGCCCCGGCAGGTATCGGATAAGCTGCTGCAGCTGATGCGGGTTCTCTTCATTCAACAGGTTACCCCATTCATCGTATTCTGCGTACCACGCTGTTATTCCTTCCGTGCTGATAAGGGCCAGCGGCGGGCCGCGATAGTCGCCAGTGGTACGGGTGAATTTTTCGCGCCGGCGTGTATACCGGGTCCATCTGGCTTTGCATCTGCGCCACCGTCAGGCCGCACGATGCCAGCCAACGGCAACTCCTCACTCACCCGGTCAGCCAGGATTTCACTTTCCAGCCGGTCGAGCATCTGCACCAGCACCGGCAGAACACCACTGCCACCGTCTTCGCCACCGGACTGCTGAAGGGTATCCGCCAGGCTGCGGCGCTGGGTTTTCGCCAGCTCACCGGTGGCGGTTTTTAACCCTGATGAGTGGCGTGGCTCCCCGGCTGATAAATCGTCTGGATGGTTCTGTCGTTCTGTATCGTGGTCAGGCGATTCGCCGTCCCAGCCATGCCAGGTCTTGCGGTTTCCGTGACAGCGACATCCAGCCCGTCAGGTCCCGTTCACGCCGCCATGCCCGTTTTGCCACCCTGCGGCCCAGCCCAGGTCGTAAAGATAGCGACTTTCGACCAGCGGCTCTGCATATTGTGTCCGCGTGTAGTGCACCAGCCGGTGCTGACTGTCATCAATGGTACCGGTGGGTGCGCTCATCATCCGTGCGGATAACCCTTCCCGGGATGAGGTCGGTTTTTCTCATCAGCCGTGACGGTCATACCAGTAAAGATAGTGCGCGTCACGGGCGATACGGTTATCCGGCCACATGCTGAGGCGCTGTCCGGGTGCAGCTCCGGGTCAGACGAGCGGTTACCTGCCGGGTCTGTGGTATACGGGATGCGGATATCCAGATTCGCTGCGGTGGTGTGAACGCCGGTCAGCCTGCCAGTGGTGCTGTAGCTGTAACTCCGGGTCTGGCGCGGGCTGCTGATGCGGATGGTTCGCGTTATTGTCGTTCCAGGTGTAATCGCGGTCAGACAGCAGGCTGTTCAGGTGCTGGCTCTGTAACTGCCGGCAGGTATAAGCGGTGGTGAGTTCACCAACGGCCGAAGCTGCGCAGCGCTTCCCCGGTGCAGGCGGTCGCGGGTGTACTCCACCAGCGGGTGTGTCACCAGTTTCATGCCTGACGGCCAGCCGCTGCCGTAGGTCAGCCACGGCGGGCAGGCTGTCCGGTGCTCACAGCGGTTCGCCAGTCCTGTGCGTTGTACGCATGTCTGGTCTCATGCTGCCAAGAGCAGTTCATTCGTCTGCGGATGATGCACCGTCAGGTGTTCTACTGGCAGGCGGCCTTTACTGTCATAACCATAGTGCACCGTCACCCGGTGCCCTTCGCTGATATGGCTGCGATGCTTGTCAGCCAGCCGCGTTCGTCATACTGCCCACCGCTCTGCGGTTTCGCCATTCACGGTGCGGTGCGTGAGGCGGTCACCAGCTGAAGTCGCCAGTGCCAGTGGGTGACCAGCCCCTCATCCTCGCTGCCGGATAAAGTTTGCCGGTCAGGTCGTGGTGATAACGCTGTGTGCGGCCGTCAAAAGCCGGTTCCTGTATCAGCCGGTCCAGAAATTACATCGGCGTAACAGCGGAAGGTGGTGTGGCTGCTTGCCGTTTTCACTGGTCAGGCGGATGACCGTCCGGCATCGTAATTCCATACTGCGTCAGACCGCCCTGCGTGAGCGCAGATGGCTTTCCCCACGCATCGTACTGTGTCCGTTTCTGCTGCCGTCCGGGAGGCAATGACGGTGGTCAGGTCACCGGCAGCGTTGGCGTATTCATACCGCGTTTCATGGCCTGCGTGTCTTTCACGGCAATTAACATCCCACGGCTGTCGTATGCGCAGTACTGACTCAGCCCTTCCTCGCGGTGCACCGCCGTCACCTGACCAAAGCGGTCATGGTCATAGCGGGTTACATAACCGGAACAGTCAGTGAAGCTCAGCAACTGACCGTAACGGCTCCACGTCATGGTTTTCCGGCTGCCGGTGGCATCTTCCGTTGCGCAGGGTAAGTCACTGTGTGGATTATCATAACGGTAGCGGGTGATATCGCCGTCAGGGGCAGTTTCTGAATCAGACGGCCCCATTCATCATATTCCGGCGTATTTCCAGCCGTCAGGCCGGTGGCTGACGTTAACTGGCTATTGGTGGTTATAGTAAAACGCCGATGCCCTGCCATCCGGCGTGGTGATGCGCGTGAGGCCCGTCACCACATCGGGCTGTATTCTGTTGTCCTGCCTGCGGCGTCGTCTGTGCCCTGGGCCTGCCCACCGCGTCAAACTGACTCTGCGTGACGCTGCCGTCCGCGTGTTCCTTTTCACCACCCGCTTCAGCCCGCCTTCACCCTGCGTGTGCAGGACTTCACGGCAGTTCAGGCTGTCGGTGATGCGGTCCTTCTCATACTGATACGTGTAACCCAAGCCTGCCGGGTTTTGGCTGTTCTGTCACCCGCCCGTCGCTGTCGTAACGGTAACAGATTTCGGTCGTACGTGTGACGGTCGCCACCATCCGGCCCCGGTATTTATCATCGTAAGTAAAGCTGCGCTGTGTGTGCTGCGGTCATACCGCCGCCAGTTCGCCGCAGAGGGCGTCCAGCCATAGCGCACCAGCGGCGCGGCAGGTAAATTCTCCGGGTATTCCGGGTCGTGCGTCAGCCCGCGGCGAACAGACGGATGCCGTTGTCCGGCCATATTCGGTATGTAACCCGGCAGGGTAATCAGGAAAAGCGGACGGCTCCGTCCCGCCGGAAATGGCCTGCTGCCGGGCTTCTTCTGCCCGCTGCGCCTGCGTGGTCAGTACCAGCCAGGATGACGCCCGGCACCATCCATCGCCGGTGATTTCGCCGCTGAATTCACCGGCGGCTTCGCAGTGGAACGTCTGTGCGCCCGAAGCGGTCCACCAACCCGGTCGTACCCGGTACGGCGGCGGCGGCATGAGCGGCACCTCATCCGCTTCCGGCACCCGCTCACACCAGCCGAGCAGCCACCACGGCCCTGCGGACTGTTTGTCGCCAGATAACGATGCGGACAGCGGAGTTCTTCCGGCAGCGCCTGCCAGAGTGCGGCCAGCCGGTGACTGGCTTCATCCGGTTCGCCACGCCGCCGCGCCAGCCACAGTGAAGCTCACTGCGGCTGTAACCGTCCTCACCGGGAAACAGGTGCTCAAAATGCAGGCTTCTGCCGCCGTTATCACTGAGTATCGGTGTTATCGCGCAGCTGTAAGCGGATATCACCAGGCATTTTTCCAGCCGGGGCCGAGCTCCCCACCGGCGCGGGCGTTTTGTCCGGTAACTGCTGTAGGTGCGGAAGATAAAGACAGCAGCGGGCCGGGCAGGGCGATGTCGGTTTCACCGGGACCTTTACCGAGCAGCCCGGATAGTTGACCGGATGGCCGGACGTCACCCCGCCGGGGCACACCAGACAGGCCGCCGATTGGGGCACCGATGCGTACCCCGGCTGAACCTGGACAATGCTACCGCCATACTTCCGTCATGTCGCCCTGACGCGCCCGCCGGTTTCCGCTCATCTGCTCATCCTTGTTTTATCGGGTTATTTGTCTGCTGACAGGCGGAAACCCTACAGATTTATAAGAAAGCCTTAAGTGAGATATCTGTCAGATAAGAACAATTAGGAAAATATTTATATATATTTCCTTGAATATATGTTTCGATTGGTATAACGATGTCTAAAATATTCCTCTGAACATCTTCCTGATACAAAAACCGCCAGCGTTTCCGCTGGCGGTTTCATCTATCAAAACTCGGCAATCAATAAAAATCACCAGTTGCCTTCCGGCCCTGATCCATCCACACCGGTTTATCGCTGGTTTTCGACCAGACGCGATGCGAATGCTTCTGTAAAGCGGGCGCGGTCTTTCCAGAAAAGCATGAAGGCAGCGCCAGAGCGCCCGCTGCAACCGCATAAATTACGGCGTAAAAGATAAGCCATGCAGGATATTCTCCTGTAGAGGGGACATACTTTTCTCCCCTTTTATCCTACCCGGTGAATGGCACCGGAAAAATGAATTTGTTTATCTGATGAAAATAGTACCGCCTTTTTTGTGTAATTTTACTACTCATCCGACCCATATTTTTGCTTATTGATGGTTTATTTACATTCATCCCATGTAATTAAGTTACACAAAAGTTAAATTAATACTAAACATTAGTTAAATCATGGCTTTGCCATTTTTATACTTTTACACCCCGCCCGCAGATTTTTGCGAAATCTTTGCAGCCAGGAATTCTACCCTTCCGGTATCACTTTGGGCCACTGGAAGTGCTGTGAGTGCAGGCGTGATAACCGGCGTATTGCTGGTGTTTTTATTACTGGGTTATCTGGTTTATGCCCTGACCAATGCGGAGGCGTTCTGATGGCTGCGCAAGGGTTCTTACTGATCGCCACGTTTTTACTGGTGTTAATGGTGCTGGCGCGTCCTTTAGGCGGCGGGCTGGCGCGGCTGATTAATGACATTCCTCTTCCCGGTACAGCAGGCGTTGAGCGCATACTTTTCGCGCACTTGGCGTCTCTGACCGTGAGATGAATGGAAGCAATATCTTTGTGCCATTCGGCCTGAACATGCTGGGGCTGGCGGTGCTTTCTGTTTTTATGTTGCTCGGTCAGCACTATCTGCCGCCCAATCACAGCAGTTGCCAGGGCTGTCGTGGGATCTGGCGCTGAATACCGCCGTCAGCTTTGTCACCAATACCAACTGGCAATCTTATGGCGGTGAAACCACGTTGAGCTATTTCAGCCAGATGGCGGAGAAACTTAACGGTGCAAAACTTTCTTTCTGCCGCCAGCGGGTGCGGTGATTTTGCCCTCATCCGTGCGTTTACCCGCCAGAGCATGAGCACGCTCGGGAATGCCTGGGTCGATCTGCTGCACGCATCACGTTATGGGTACTTAGTCCCTGTGGCGTTGTTGATTGCACTGTTTTTATTCAACAAGGTGCGCTGCAAAACTTTCTGCCTTATCGGGCTGTGAATACCGTTGAAGGAGCGCAACGGCTGTTACCATAGGTTAAACCCCACCCAAGCAGACGCCGAAGATAGAGCGACAGGCAAGTAGCAATACGTAACTGG
+>8d9d3bb4-cec7-4960-a3c6-9c3e59aab4a7
+TTGGTATTGCTTCGTTCAGTTACGTATTGCTTTTCTGTTGGTGCTGATATTGCGGCGTCTGTAGGGTGTTTAACCTAGACATCAGTTATGCAATCAGAAACATATATTCATAAATATATATAAATATTTTCCTAATTGTTCTTATCTGACAGATATCTCCTTAAGGCTTTCTTATAAATCTGTACAGGGTTTTCGCCTGTCAGCAGACAAATAACCCGATAAAAACAAGGATAAAGCAGATGGAGGCGGAAAAACCAGCGGCGCGTCAGGGCGACATGACGCAGTATGGCGATAGCGGTAATCCAAAGTTCCAGCCGGGTACGCATCAGTGCCCCCACCGGCGTGGCCTGTTGGTGATACCCCGGCGAAAGTGACGATCCGGCCATCAGTCAATCCGCTTTCTTCAGTGCAAAGATGCCAGGTGAAATAAACTTATCGCCCCTACCGGCCCGCTGCGATTAAATTATCCCACCTACAGCAGTTACCGGACAACGCCCGCGCCGGTGAGCCTCAGCGGCTGAAAATGCCTGCGGATATCGCTTACAGCTGCGCGATAACACACTGATACTCAGTGATAACGGCGGCAGAAGCCTGTATTTTGAGCACCTGTTTCCCGGTAAGGGACCAGTTTAGCCGCAGCGAGTCACTGTGGCTGGTGCGCGGCGGCGTGGCGAAACTGGATGAAGATACCCGGCTGGCCCGCGCACTCTGGCAGGCGCGCCGGAAGAACTCCGCTTAAGTCCGCATCGTTATCTGGCGACAAACGAAGTCCACCTGGGGGCCGTGGTGGCTGCTCGGCTGGTGTGAGCGGGTGCCGGAAGCGGATGAGGGTACTTTCTGCGCCGCTGCCGCCGTACCGGGTACTGACCGGGCTGGTGGACCGCTTCGGGCGCACACAGACGTTCACCGCGCGTAACCGGTGAATTCAGCGGCGAGAATCACCATGACGGATGGTGCCGAGGCATCACTTCCCGGCTGTTTGACCACGCAGGCGCAGCGGGCAGAAAGAAGCCAAGCAGCAGGCCATTTTCCGGCGGGACGAGACCGTCACTTTTACCGATACCCTGCCGGGTTACCGAATATGGCCAGGACAACGGCATCCATCTGTCTGCCGTAGCTGGTACGACTGCACGACCGAATACCCGGAATTTACCTGCCGCCGCTGGTACTTATGGCTCTGAACCGCCCGCGGCGAACTGGCGGTAATATGACCGCAGCAATACACAGGTGCACAGCTTTACACCTGATATTAAATACGGGGCCGGATGGCGCACCGTCACACGGGCCGACCGATATTTACCGTTGACAGCGACGGGCGGTGACAGAACAGCTAAACAGCAGGCTTAAAGTACGTATCGGTAGCCGAAGGACCGCATCACCATGCCGACAGCTGAACCGCCGTGAAGTCCTGCACACGCAGGGTGAAGGCGGGCTGAAGCAGGTGGTGAAAAATTCCGCGGACAACGGCGTCACGCCAGAGTCAGTTTGAAGCGCGTGGGCAGGCTCAGGGCACAGACGATTCTGCCAGGCAAGTTAGAATCTGGTCGGGATGTGGTGACGGAGCTCATCACGCGCATCACCACGCCGGATAACAGAGAACATCGAAAGCGTTTTACTATAACCACCCTGGCCAGTTAACGTCAGCCACCGGGCTGACGGGCTGGAAATACGCCAGGAATATGATGATGAATGGGGCCGTCTGATTCAGGAAACTGCCCCTGACGGCGATATCACCGCTTCTGTGCCGATAATCCACACGGTGACTTACCCTGCGCAACGGAAGATGCCACCGGCGGCAGAGAAAACCATGACGATAGACCGTACGGTCAGTTGCTTCCAGGCTTCACTGAAGCTGTTCCGGTTATGTAACCGCTATGACCATGACCGTTTGGTCAGGTGACGGCGGTGCACCGCGAGGAAGGGCTGAGTCGGTACCGCGCGCCACGACAGCCGTGGATTAATTGCCGTGAAAGACACGCGGGGCCATGAAACGCCGTATGGATACCAGCGCCGCGGTGGCCTGACCACCGTCATTCACGGGCGGCAGCAGAAACGGGACACAGTACGATGCGTGGGGAAAAGCCATCTGTACCACGCAGGGCGGTCTGACGCGCAGTATGGAATACGATGCTGCCGGACGGGTCATCCGCCTGACCAGTGGCGGCAGCCACACACCTTCCGTTACGATGTACTCGACCGGCTGATACAGGAAACCGGCGACGGCCGCACAGCATTCATCACGACCTGACCGGCTTGACTTATCCGCAGCGAGGATGAGGGCTGGTCACCCACTATGACGAAGCAGACCGCCTCACGCGTCGCACCGTGAATGGCGAAACCGCAGAGCGGTGGCAGTATGACGAACGCGTGGCTGTTAAGACGTAAGCCATATCAGCGAGGGCACCGGGTGACGGTGCACTATGGTTATGACAGTAAAGGCCGCCCCTCGCCAGTAGACACCTGACTGGTGCATCATCCGCAGACAGATCGACTGCTCTGGCAGCATGAGACCAGACATGCGTACGCTTGCGGGGACTGGCGAACCGCTGTATACCGGACCAGCCTGCCCGCCGTGGAATGGCTGACCTACGGCGACTGGCTGTCGGAAGGAAAACTCGGCAACACACCGCTGGTGGAATTTTACCGCGACCGCCTGCACCGGGGAAACGCTGCGCAACTTTCGGCCGTTATGAACTCACCACCCGCTTATACCCCTGCCGGGCAGTTACAGAGCCAGCACCTGAACAGCCTGCTGTCTGACCCGCGATTACACCTGGAACGACAACGGCGAACTCATCGCATCAGCAGCCGCGCCAGACCGGAGTTACAGCTACAGCACCACCAGCAGGCTGACCGGCGTTCACACCACCACCGAATCTGGATATCCGCATCCCGTATACCACAGACCCGGCAAGGTAACCGCCTGCCCGACCGGAGCGCTGCGCGGACAGCGCCCTCAGCATGTGGCCGGATAACCGTATCGCCCGTGACGCGCACTATCTTTACCGGTATGACCGTCACGGCAGGCTGACAGAGAAAACCGACCTCATCCCGGAAGGGGTTGGCATCCGCACGGATGATGGGCGCACCACCGGTACCATTACGACAGTCAGCACCGGCGAGTGCACTACGCGGACACAATGGCAGAGCCGCTGGTCGAAAGTCGCTTCTTTACGACCGCTGGAACGCAGGGTGGCAAAACGGGTATGGCAGCGTAGACGGGACCTGACGGGCTGGATAATCGCTGTCACGGAAACCGCAAGTGACCTGGGTACGGCTGGGACGGCGACCGCCTGACCACGATACAGAACGACAGAACCCGCATCAGACGATTTATCAGCCGGGGCTTCACGCCCTCATCAGGTTGAAACCGCCACCGGTGAGCTGGCGAAAACGCAGCGCCACCCAGCTAACTGGATACCCTTCAACAGTCCGGTGGCGAAGACGGTGGCGGTGTGGTGTTTGCCGGTGCTGGTGCAGATGCTCGACCGGCTGGAAAGTGAAATCTGGCTGACCGGGTGATGGGGAAAGCCGCCGCTGGCTGGCATCGTGCGGCCTGACGGTGGCGCAGATGCAAGCCAGATGGACCCGGTATACCGCCGGCGCGAAATTCACCTGTACCACTGCGACCATCGCGGCCTGCCGCTGGCCATATCAGCACGGAAGGGGACAACAGCGTGGTACGCAGAATACGATGAATGGGGTAACCTGCTGGATAAGAGAACCCGCATCAGCTGCAGCAGCTTATCCGCCTGCCGGGGCAGCAATTATGATGAGGAGTCCGGCGTATTACAGCCACCACCATAATATGACGCTGCAGGGGCGATATATCCTCAGGATCCGATTGGGCTGAAGGGGATGGAATTTTATCGAGTATCCGTTGAATCCGATCTCAAATATAGAATCCATTAGAGTTAGAAACGCTAAAATGCATTGTTCAGCCACTGCATTCAATGGGCGGAACTGGTGAAAAGCGGTCCAGATATATGGGGGAATCCGTTCTATCATCAATATCTTTGTGTCCCCAGATGGTAAAGGGGACTATACTTGTGGTGGCCAAGACCAGCAGGAGAATCAAAGGAGATGGTCTATGGGGGCCAGGTAAAGCAAGTAATGATACAAAGAAGCTGCTGAAAGCCGTTGTGACCTCGTTGAAACCGATAATAGTTGTGTGGAGAACTGTTTAAAAGGGAAGTTTAAAGAGATAAGGCCGCGTTATTCTGTATTGCCTGATATTCCGCACCTATAAATTTAGGGCTGTTAAAACTGCCAAGACTAGGTTAAACGCAAGCAGACGCGCCGAAGATAGAGCGACAGGCAAGAGCAATACACGTAACACGA
+>a724164e-c45d-4870-8cc1-b5973253fe9c
+ATCGGTAGCCTTCGTTCAGTTACGTATTGCTCTTGCCTGTCGCTCTATCTTCGGCGTCTGCTTGGGTGTTTAACCTCTGCACGTCGCTGGTGGCAATCCACGGTCGCGCCACAAGATCCGGCTCATCCGGCGACGCCGATCGCTGACAACAGGCCATAATAGTGGTTGGGATCCAGGCAGACCAGCAGCGCCACCAGTACTCGTTACGCTGACATTACCGCCCCCACGCGGAAAGCAGCCACAGCGTGGCGGTTGTAATAAAAGACGATAGTCAGGGCAATCAACCAGAATGGTCAGGGCAAGATTTCGTTCGGCGTTTTGCGTCTTGTGCTTATTCCACCATCGCGATCATCCGATCGAAATGTCTCATGGTTAACGCTACACTCAATCACCAGCCAGTCAGAAAGAATGCGCGTGCCGCCGGTGACGAGCAAAATCGCCGCCAGTTCACGGATCTGCCAGTGCCGATTCCCGGTGATGGCGCTTTCATCGACCGATACACCCCTTCAATGCTTCACCATCGCGGGGATAATATCGCCAGCTTCTACCGGTACGATATCGCCTTTACAGGGGATTGGTCGGCAGGAACTTTGTCCGCCGCAGCGCCATCACAAACTCACGCAGCTTGCGGGCAAAGGCAGTTTTCACCTTTCAGCGGACTGCTGGCCTGCGCTTTACTGCGGCCTTCTGCCAGCGCCTCGGCGAGTGGCGAACAGTACGGTGATCTGGCCAACCGCTAATGGCCGCTAAACAGCGCATTGCCGGGCATCACCGCTTGCCATCGCGATGCTAATACAGGTGTCAGCAGACTGCCGATCAGACGATAAACATCACCGGTTGCGCCATTGCGCCTGCGGGTTTAATTTTTTCACCGCTTCTTTCAGCGCCCTGAACGGCAAGTGTTGGTTCGAATAGCGCCAGTTATTTACGACTCATATTCAGTGCTCCTCAATATCATCAGGAGATATTCCGCCACCGGACCAAGCGCCAGGGCAGGGATAAAGGTCAGTGCGCCAACCAGCAGCTTACGGTGCCGATTAACAGGCCAACAAACAGCGGGCCGTGCGTTGGCAGCGACCCGGAGCTGGCAGCGGCTCTTTTACTCACCAGCGAACCCGGCAATTGCCATCACCGGATAATCACCCCAGCGACCGACAAACATGCAGAACGCCGGTAAACGGTTTCCAGAACGGAGAGTTGGCGCTTAATCGGCAAAAGGCGCTGCGCCGTTGTTGTTAGCGGCGGATGTTACGGCGTACAACACTTCGCTTCTAAAACCATGCGGGTGGGGTTGAGCATGGCGCTTTACGTCCGGCGTCGGTCATCATCGCCAACGCCGCGCCCATCCAGCACCAGCGTCAGGGGTAACCAGAGATTGCCAGTGCAGTCAGTTTCATCGCGTACGTCGATTTTTTACCCAGATATTCCGGTGTACGACCAATCATCAGCCCGGCAATAAACACCGCCAGCGGGACCGACAGCATCATGCCGTAAAGGCCAGAACCGACACCGCGAACACCGCTTCACCAGATTTGCATCAGCCCACATCGGCACCGTACCGCAGGCGAGTAAACGAATCATGCATCGCAATCACCGCGCCACAGGAAGCCGCCGTCGTCACGACCGCAGAGCAGACTGCTGACCAGCACGCCCGAGCAGCTCTCTTTGCCTTCCATATTGATGCTGCTGTCATTCGCGGCGCAGCGAATGAGGATTCCTGAACTTCTGCCCATCGCCACGCCTGCGGATGACAAAAATGCTGACATCGCCCACAGCAACGCCTGCGCCTGGCGGCTCGATCGCCCATCACTTCACCAAAGGCAAGCGCCACAGCGCCGTTGGGATCAAAGAAGATCGCCAGCATCTCTGCACGAAGTTGGTCGAGTGCGGTTGGGTTTCAAACGGATGCGACGGGGTTGGCATTAAAGAAGCCACCGCCGTTAGTGCCGAGCATCTTGATCGCTTCTGAAGCTACAGGCCCATGGGTAACAGCTGTTGCGCTCCTTCAGCAGTATTCACAGCACAATCAGGCAGAAAGGTTTTGCAGCGCACCTTGTTGAATAAAAAACAGTGCAATCAGCAGCAACGCCACCAGGGACCTAGCACCCATGGCGTGATGCGTAGCAGATCGACCCAGGCATTCCGGCATAACCATGCTCTGGCGGAGTAAACGCACGGATGAGGCAAAATCACCCGCAATCCCGCTGGCGGCAGAAAGAAAGTTTTACCTGTACCGTTAAGCCGCCATCACGGCTGAAATGACTCAGCGTGGTTTCACCGCTATAAGATTGCCAGTTGGTATTGGTGACAAAGCTGTTGGCGGTATTCAGCGCCAGATCCCCACGACAGCCCTGGCAACTGCTGTGGATAAGCGGCAGATGGTGGCGACCGAGCAACATAAAAACAGCACCGCCAGCCCCAGCATGTTCCGGGCGTGGCACAAAGATATTGCGCTTCCAGTTCATCTCACGTTCAGAGACGCCCAGTGCGCGAAAAGTGATGCGCTCAGCGCCCGTTATTGCCGGGAAGGAATATCTCGATAATCAATACGCGCCAGCCCGCTGCCTAAAGGACGCCGCCAGCACCATTAACACCGAATAAAAAGCAATGGCGATCAGTAAGAACCCATGCGCAGCCATCAGAACCTCCCGCATTGATCAGGGCATAAACCAGATAACCCAGTAATAAAAACACCAGCCAATACGCCGGTTATCGCCTGCTCACGGTACACCTCCAGGCCTAAAAGTGATACCGGAAGGGTAGAATTCTGGCGCAAGATTTCGCAAAAATCTGCGGGCGGGGACAAAAAAGTAAAATGGCAAAGCCGCCGTTTAACTAATGTTTGAGTAATTTAACTTTTGTGTAACCAATTACAGGATGAATAATAAATAAACCATCAATAACTTAAAATAAGTGGTCGGATGGTGGTAAAATTACACAAAGGCGGTACTATTTTCATCAGATAAACAATTCATTTTCGGTACATTCACCGGGTGAATACAAAGGGAGAAAAGTATGGAACTCTACAGAGAATATCCTGCATGGCTTATCTTTTACGCCGTACTTATGCGGTTACGCCCGGGGCGTTCTGGCGCTGCCTTTCATGCTTTTCTGGAAAGACCGCGCCCTTTTGCAATACCTGCATCGCGTCTGGTCGAAAACCAGCGATAAACGGTGACCGGATGGATCAGGCCGAGGCAACCTGGTGATTTTTATTGATGGGTTAAACTACCCAAGCAGACGCCGCAATATCACGGG
+>cdf5b34b-6170-45bb-9691-6fcdaadb4713
+TTGATGTACTTCGTTCAGTTACGTATTGCTACTTGCCTGTCGCTCTATCTTCGGCGTCTGCTTGGGTGTTTAACCTACCATGATTAGTTATCAGGACGCAACAACTGAACTGGATCACTGCTCTTTTTTTGATAGATACCCGCTCTTATATAACTTCTAAACCGATCGCCGAGAAACGCCGTTTTTTCTGCTGTTTATCAACTCCTGCAACGTTCCTTTGATGGCATGATTTCATTGAGCGTAGTGACTGACGCGAATTAAGAGTCTCGCCCGCTTGGTGAATTTATTATTTTTTACATGTGCAGTTCTGTTTGCGCCAATAGCTTCTCACCGATGTCCTCATTCTGATACCATCTCCATGGCTTTATTGGCTAAGACCAGGAAACGCGGAAAAATGGTACCCTTAGCGAAAATAGTAAAACAATCATGATCTTTTAGCTTGTATTTCGCAATCAGCTATAACACCAAAACTAACAAATATCATCGGCAAAAGAGAACAAAACTCTTTTCATTTTTCTTATTCCTCTCGATGTTCTCTGTTTCATCTTAGCTAAAACTTCACCCCAAATCATCTATCCCTGCTGTTGCTGGCCCATCAGGTTTATTAATGTCTAAAGGAATAAATGGGGTTCTGCACAAGTATATCCTGGTGGTAATTGAGTTGTTGGCCAGTTGTCTGTGGCGGGTAATCACTTGCTGTCTTTGCATCCATCCCTGGATACTGGGAATCATCCTGTGGCGTACAAAGTCAGATTTGGTTTTACCCACTTCCTGCAATACAGTGTGTAGTCGTAGGGCTTAATGCTCTGAAGAATGTTTTGAAAACATTAGGCGCACTACTGGCCTGGTCAATAGGATGGCAGTCTTAATTGTTTCGCCTTGTCCCGGCAATTTACACTTGGATCGGGCGTAGGCGGTTTTGTTGGGTCTCGCTCCATATCGCCATTATTTAGAGATGTCCATGACTTACGATGCAGTCCCATTGAATCTATATACTGAACCGGATTCAGCGGATGCTGATAAAATTCCATCCCCCCTTCCAGCCCAATCGGATCCTGGTGATATACACTCCCTGCAGCGGGTCATAATAGCGGTGGCGGTTGTAATACAGGCCGGACTCCTCATCCTGCTGCTGCCCCGGCAGGCGGATAAGCTGCTGCAGCTGATGCGGGTTCTCTTCATTTCAGCAGGTTGCCCCATTCATCGTATTCTGCGCACCATTCTGTTGCCCCTTCCGTGCTGACAAGCGCCAGCGGCAGGCCGCGATGGTCGCAGTGGTACAGGTGGATTTTTCGCGCCGGCGTGTACACCGGGTCCATCTGTGGTTTTGCATCTGCTCCACCGTCCAGGCCGCACGATGCCAGCCAGCGGCAGCTTTCCTCACTCACCCGGTCAGCCAGTTTCGCTTTCCAGCCGGTCGAGCATCTGCACCAGCACCGGCGGGAACACCACCTACCACCATCTTCGCCGCCGGACTGCTGAAGAATTTATCCGCCAGGCTGCGGCGCTGCGTTTCGCCAGCTCACCGGTGGCGGTTTCAGCCCTGATGAGTGGCGTGGCTCCCCGGCTGATAAATCGTCTGGATGCGGGTTCTGTCGTTCTGTATCGTGGTCAGGCGGTCGCCGTCTAGCCGTACCGGGTCACTTGCGGTTTCCGTGACAGCGACATCCAGCCCGTGGGTCCGTTCACGTCGCCACACCCGTTTTTGCCTGCGGCCCAGCGGTCGTAAAGATAGCGGCTTTCGACCAGCGGCTCTGCATATTGTGTCCGCGTGTGAGTGCACCAGCCGGTGCTGACTGTCGTAATGGGTACTGGTGGGTGCGCTCATCATCCGATGCGGATAACCCCTTCCGGGATGAGGTCGGTTTTCTCGTCAGCCTGCCGACGGTCATACCGGTAAAGATAGTGCGCGTCACGGGCGATACGGTTATCCGGCCACACATGCTGAGATTGCTGTCCGGGTGCAGCTCCAGGTCGGGCCAGGCGGGGATTTACCTGCCGGGTCTGTGGCATACGGGATATCAATGCCCAGGTTACATATAATAATAAGAGCAATTAGCAATTTGTTTGTTTATAGTAAACACTTAATACAAACCATTGAATATACCCTCCTGACAGAAAATAAAGCCATATTATTATCGCCATAATATGCTTACTATCCAATCCTTACGCCAATAATGTCTGATACAGTCCCTATAAATATTAGAGCAATAAAAGGAATACTATGCCTGTTGGAAGCATATTACCATCATTCCATAAGACATGGAGCTAATTAACTCAGCTCCACATCCCACGAGTGGAGGTCTAATGGTGAAAGTCTATGCATGGAAAGAATAGTATTAAAGCGATCGAGAAACCAGCCATATAGCTCTGAATAAAAAATAATATATTTCATTACATCACTCCGGTGAATACAAATCCCTAATAAAGAGCGATCAATGTTATTTCCGGAGCACTTCATCTTACATGTTTCTAAAGAATCATTAGACCAGTCTTGGCAGTTTTAAATAGCCCTAAGTTTATAGGTAATGAATATCAGGCAATACAGAATAACGCGTATACCTCTTTAAGCTTCCTTTTAAAACGGTTCTCACACAGCTATTATCGGTTTCAACGAGGTCTGGCAACCCATGGCTTCTTTTGTATCATTACTTGCTTTACCTGGCCCCATAGACCATCTCCTTTTGATTCTCCCCGTTGGTCTTGGCCACCACAAGTATAGTCCCTTTACCATCTGGGACTTCAAGATATTGATGATGAAACCCGGATTCCCCATATATCTGGACCGCTTCTTTCACCAGTTCCGCCCATTGAATGCAGTGGCAATGCATTTTGAGTGTTTCTATCTAATGGATCTATATTTGGATCGGATTCAACGGATACTGTTAAAAATTCCATCCCCTTTCAGCCCAATCAGTCCTGGTGATATATCGCCCCTGCAGCGGGTCATAATAGCGGTGGCGGTTGGCCACAGGCCGGACTCCTCATCATACTGCTGCCCCGGCAGTGGATAAGCTGCTGCAGCTGATGCAGGTTCTCTTCATTCAACAGGTTACCCCATTCATCATATTCTGCGTACCACGCTGTTGTCCCTTCCGTGCTGATAAGGGCCAGCGGCAGAGCCGCGATGGTCGCGGTGGTACGAATTGAATTTTTCGCGCCGGCGTGTATACCCGGGTCCATCTGGCTTTGCATCTGCGCCACCGTCAGGCCGCACGATGCCAGCCAGCTAACGGCTTTCCTCACTCACCCGGTCAGCCAGAGTTTCACTTTCAGCCGGTCGAACTCTGCACCAGCACCGGCGGGAACACCACCTACCACCGTCTTCGCCACCGGACTGCTGAAGGGTATCCGCCAGGCTGCGGCGCTGCGTTTTCGCCAGCTCACCCGGTGGCGGTTCAACTGATAGTGGCGTGAAGCTCCCGGCTGATAAATCGTCTGGATGCGGAGTTCTGTCGTTCTGTGTCGTGGTCAGGCGGTCGCCGTCCCCAGCCGTACCAGGTCACTTGCGGTTTCCGTGACAGCGACATCCGGCCCGTCAGGTCCCGTTCACGCCACCATACCCGTTTTGCCACCCTGCGGCCCAGCGGGTCGTAAAGATAGCGACTTTCGACCAGCGGCTCTGCATATTGTGTGTCCGCGTGTGGTGCACCAGCCGGTGCTGACTGTCGTAATGGTGCCGGTGGGTGCGCTCATCATCCGTGCGGATAGCCCCTTCGGGATGAGGTCAGTTTCTCTGTCAGCCTGCCGTGACGGTCATACCGGTAAAGATAGTGCGCGTCACGGGCGATACGGTTATCGGCCACATGCTGGGGCGCTGTCCGGGTGCAGCTCCGGGTCCGGGCAGGCGGTTACCTGCCGGGTCTGGCAATTATACGGGATGCGGATATCCAGATTCGCTGCGGTGGTGTTGTGAACGCCGGTCAGCCTGCCGGTGGTGCTGTGGCGCTGTAACTCCGGGTCTGGCGCGGGCTGCTGATGCGGATGAGTTCGCCGTTGTCGTTCCAGGTGTAATCGCGGGGTCAGACAGCAGGCTGTTCAGGTGCTAGCTCTGTAACTGCCAGCGAGGGGTATAAGCGGTGGTGAGTTCATAACGGCTGACTGCCTGGCGTTTCCCGAGTGCAGAGCGGTCGCGGGTGTACTCCTGGCGGTGTGTCGCCAGTTTCATGCCCTGACAGCCAGCCGCTGCCGTAGGTCAGCCATTCTTACAGCAGGCAGGCTGTCGGTATCACAACCGGTTCGCCAGTCCTGTGCGTTGTACGCATGTCTCTGGTCTCATGCTGCCAGGCAGTTCGTTCGTCTGCGGATGATGCCGTCAGGTGTTCACTGGCAGGCGGCCTTTACTGTCATAACCATAGTGCACCGTCACGGTGCTCCTTCGCTGATATGGCTGATGTCTGTCCAGCCAATACGCGTTCGTCATACTGCCACCGCTCTGCGGTTTTCGCCATTCGGTGCGGTGCGTGAGGCGGTCTGCTTCGTCATAGTGCCAGTGGGTGACCAGCCCCTCATCCTCGCTGCCGGATAAGTTTGCCGGTCAGGTCGTGTGTTGATAACGCTGTGTGCGGCCGTCAAGCCGGTTTCCTGTATCCAGCCGGTCGAGTACATCGTAACGGAAGGTGGTGTGGCTGCCGATTTTCACTGGTCAGGCGGATGACCCGTCCGGCAGCATCGTATTCCATACACCGCGCGTCAGACCGCCCTGCATTAGTTACAGATGGCTTTTCCCCGCATCGTACTGTGTCCCGTTTCTGCTGCCGTCCGGGGCAATGACGGTGGTCAAAGGTCACCGGCGGCGTGTGTCATACCGCGTTTCATGGCCCTGCGTATGCTTTCACGGCAATTAACTGTCACGGCTGTCGTATGCGCGGTGCAGCTCAGCCCTTCCTCGCGGTGCACCGCCGTCACCTGACCAAAACGGTCATGGTCGCGGGTTATAACCGGAACAGTCAGTGAAGCTCAGCAACTGACCGTAACAGCTCCACGTCCATGGTTTTCCGGCTGCCGGTGGCATCTTCCGTTGCGCAGGGTAAGTCACTGTGTGGATTATCATAACGGTAGCGGGTGATATCGCCGTCAGGGGCAATTTCCTGATCAGACGGCCCCATTCATCATATTCCCGGCGTATTTCCAGCCCGTCGACCCGGTGGCTGACGTTAACGGCTGGTGGTTATAGTAAAACGCCGATGCCCTGCCATCCGGCGTGGTGATGCGCGTGATGGGGCCGTCGCACATCGGACTGTATTCTGTTGTCCTGCCTGCGGCATCCGTCTGTGCCCTGAGCCTGCCCACCGCGTCAAACTGACTCTGCGTGACGCTGCCCGTCCGCGTGTTCCTTTTTTTTCACCACCCTGCTTCAGCCCGCCTTCACCCTGCGTGTGCAGGACTTCACAGCAGTTCAGGCTGTCGGTGATGGTGATGCGGTCCTTCTCATACTGATACGTGTAACTTAAGCCTGCCGGGTTTTAGCTGTTCTGTCGCCCGCCCGTCGCTGTCGTAACGGTAACAGATTTCCGGTCGGCCCGTGTGACGGTGCGCCACCATCCGGCCCCGGTATTTATCATCGTAAGTAAAGAAGCTGCGCACCTGTGTATTGCTGCGGTCATGCACACCGCCATGGTCGCCACCAGGGCGTCCAGCCATAGCGCACCAGCGGCGCGGCAGGTGGTCTCCGGTATTCCGGGTCGTGCGTCAGCCACACGGCAGAACAGACGGATGCCAATTTGTCCCCGGCCATATTCGGTGCTTGGCAACCCGGCAGGGTATCAGGAAAAACGGACGGTTCCGTCCCGCCGGGAAATGGCCTGCTGCCGGGCTTCTTCTGCCCGCTGCGCCTGCGTGGTCGAGTACCAGCGGAAGTGACGCCCAGCTGCCATCCGTCCGCAGTGATTTCGCCGCTGAATTACCGGCGGCTTCGCGGTGGAACGTCTGTGTGCGCCCGAAGCGGTCCACCAACCAGTCAGTACCCGGTACGGCGGCGGCAGCGGCACGAACGGCACCTCATCCGCTTCCGGCACCCGCTCACCAGCCGAGCAGCCACCACGGCCCCTGCGGACTGTTTGTCGCCAGATAACGATGCGGACTTAAGCGGGATTCTTCCGGCAGCGCCTGCCAGAGTGCGGCCAGCCGGTGACCTTCATCCAGTTTCGCCACGCCGCCGCGCAGCCACAGTGACTCGCTGCGGCAGCAACCGTCCTCACCGAAACAGGTGCTCAAAGAAATACAGGCTTCTGCCCGCCGTTATCACTGAGCATCAGTGTGTTATCGCTGGCTAATAAGCGGATATCCGCAGGCATTTTCCAGCCAGGGGCCGAGGGCTCCCCACCGGCGCAGGCGTTTTGTCAGTAACTGCTGTAGGTGCGGGAGAATGAACAGCAGCAGGCCGGGCAGGGCGATGTCGGTTTTCACCGGGAAGGACCTTTACCGAGCAGCGGATTGACCGGATGGCCGGACGTCACCCCGCCGGGGCACCGAACAGGCCACGCCGGTGGGGGCACCGATAAGTACCCCGGCTGAACCCTGGACAATGCTACCGCCATGCTGCGTCATGTCGCCCTGACGCGCCGCCAGTTTTCCGCTCATCTGCTCATCCTTGTTTTGTATCCGGGGTTGTTGTCTGCTGACAGGCGGAACCCTACAGATTTATAAAGAAACTGTAATTGAGATATCTGTCAGATAGAACAATTAGGAAAAATATTTATATATATTTCATGGATATATGTTTCGATTGAGGTATAACGATGTCTAAATATTCCTCTGAACATCTTCCTGATACAAAACCGCCAGCGTTTCCGCTGGCGGTTTCAATATTCAAAACTCAGCAATCAATAAAATCACCGGTGCCTTTTTCGGCTGATCCATCCACACCGGTTTATCGCTGGTTTCGACCAGACGCGATGCAGGTAGCTGTAAAAGCAGGCGCGGTCTTTCCAGAAAAGCATGAAAGGCAACCAGAACGCCGCTACGAAAAGCCGCACATAGAATTACGGCGTAAAAGATAAGCCATGCAGGATATTCTCTGTGAGAGTTCCATCACACTTTCTCCCCCTTTTGTATCTACCCGGTGAATGGCACGGAAAAATGGTATTGTTTATCTGATGAAAATAGTACCGCCTTTTTGTGTAATTTTACTACTCATCCGACCACTTATTTTTTGCTTATTGATGGGTTTATTTACATTCATCCTGTAATTAAGTTACTGAAAGAGTTAAATTAATACTAAACATTGGATTAAATCATGGCTTTTTGCCATTTTATACTTTTACACCGCCCGCAGATTTTGCGAATCTTTGCAGCCAGAATTCTACCCTTCCGGTATCACTTTTAGGCCACTGGAGTTACCACTGTAGTGCAGGCGTGATAACCGGCGTATTGCTGAGTGTTTTATTACTGGGTTATCTGGTTTATGCCCTGATCAATGCGGGAGGCGTTCTGATGGCTGCGCAAAGGGTTCATACTGATCGCCACGTTTTTACTGGTGTTAATGGTGCTGGCGCGTCCTTTAGGCGGCAGGCTGGCGCGGCTGATTAATGACATTCCTCTTCCCGGTACAACGGGCGTTGAGCGCGTACTTTTTCGCGCACTTGGCGTCTCGACCGTGAGATGAACTGGAAGCAATATCTTTGTGCCATTCTCGGCCTGAACATGCTGGGGCTGGCGGTGCTGTTTTATGTTGCTCGGTCGGCACTATCTGCCCGTAATCCACAGCAGTTGCCAGGGCTGTCATTGGGATCTGGCGCTGAATACCGCCATCGGCTTTGTCACCAATACCAACTGGCAATCTTATGGTGAAACCACGTTGAGCTATTTCAGCAGATGGCGGGCTTAACGATTACCGGCTTTCTTTCTGCCGCCAGCGGATTGCGGTGATTTTGCCCTCATCCGTGCGTTTACCCGCCAGAGCATGAGCACGCTCGGGAATACCTGGGGCGATCTGCTGCGCATCACGTTATGGGTGCTAGTCCTGTGGCGTTGATTGCACTGTTTTTTATTCAACAAGGTCGCTGCAAAACTTTCTGCCTTATCAGGCTGAATACCGTTGAAGGAGCGCAGCTTGGCTGTTACCCATGGGGCCTGTAGCTTCTCAGGGAAGCGATCAGATGCTCACGGTACTAACGGCGGTGGCTTCTTTAATGCCAACTCGTCGCATCGTTTGAAGAAACCCAACCGCACTGACCAACTTCGTGCAGATGCTGGCGATCTTCTTGATCCCAACGGCGCTGTGCTGCCTTTGGTGAAGTGATGGGCGATCGCCGCCAGGGGCGCATGTTGCTGTGGGCGATGTCAGTGATTTTTGTCATCTGCGTAGGCGTGGTGATGTGGGCAGAAGTTCAGGGTAATCCTCATCTGCTGGCACTGGGCACGGACAGCAGCATCAATATGGAAGGTAAAGAGAGCCGTTTCGGCGTGCTGGTCAGTAGCCTGTTTGCGGTCGTGACGACAGCGGCTTCCACCAATGGCGCAGTGATTACGATGCATGATTCGTTTACCGCTCTCGGTGGCATGGTGCCGATGTGGCTGATGCAAATTGGTGAAGTGGTGGTGTTCGGCGGGTGTCGGTTCTGGTCTTTACGGCATGATGCTGTTTGTCCTGCTGGCGGTGTTTATTGCCGGGCTGATGATTGGTCGTACACCGGAATATCTGGGTAAAAAATCGGCGTACGCGAGATGAAACTGACTGCACTGGCAATTCTGGTAGGTTAAACACCCAAGCAGACGCCGAAGATGGAGCGACAGGCGAAATTGCGCAATGGCTCTATCGGCGTCTGAAATGTTCTTCCGCAATGTGTTATGCGGGGGCCGCATCGTTACCCGGCACTAAGCCCTGGCTGAAACGGGTGGTGCCGTCAGCGCCTTAACCCCGCGTGAGCACCTTGTGTTATGTCAACCAACTGTAACGTTTCTCCTTGAGATACCGCGTGCACGGCAAGCTGGCAACAGGCAGCGGAAAGGTACGTCAACTGGCAGTGCTCCTGAACCACAGGGGACGCGTATGAACCTGGTGGATATCGCCGTTCTTGTCTCAAACCCATTGTTTGCAGCGCCGCGGCTTCCTTGATGCTGTTCTGGAAATACCTGAAGTAATTCAGATTCAAGTCGCACCAAGGGGCAAACCGCTCCTTTTATATTAGCGATGCGGGTTGGTGTCGGATGCGATGCTGACGCGTCTTATCCGCCCTACCATCTCCAGCAGCATTTATTGCCGCTTTTGTTTTATATTCTGCCCGCTAAACAATTCCCCATTTCACCAGCGTATACCTGGCTAACATTCATCAATGTGATAGATTCCTCTCCCGCATTTATGAGATGCGTAGTGACTTATTCTAATTATTTTTATAAAGCATCCGTGATAATGAAAAAGGCAAAGAAACGTCAATTTGTTATTGATGTTGGTATTACTCGTGGCCGTCGGTCAGATGGCGCAAACCGATTTATATTCCAGCTATTGCCGATATGGCGCGCGATCTCAACGTCCGTGAAGGGCGGTGCAGGGCGTAATGGGCGCTTATCTGCTGACTTACGATTCTCACAGCTGTTTTATGGCCCGATTTCCGACCGCGTGGGCCGCCGACCGGTGATCCTCGTCGGAATGTCCATTTTATGCTGTAACGCTGGTCGCGGTCACGACCTCCAGTTTGACGGTGTTGATTGCCGCCAGCGCGATGCGGGGATGGGCACCGGCGTTGGCAGCATAATGGCGCGTAATGCTTTACCGCGAGATTTATATGAACGGACACAGTTGCGCCATGCTAACAGCCTGTTAAACATATGGGGATTCTCGTCAGTCGTTGCTCGCACCGCTAATCGGCGGTCTGCTGGATGCGATGTGGAACTGGCGCGCCTGTTATCTCTTTTTGTTGGTTCTTTGTGCTGGTGTGACTGTATGGCCCGCTGGATGCCGGAAACGCGTCCGGTCGATGCACCGCGCACGCGCGCCTGCTTACCAGTTATAAAACGCTTTTCGGTAACAGCGGTTTTAACTGTTATTTGCTGATGCTGATTGGCGGGTCTGGCCGGGATTGCCGCCTTTGAAGCCCTGCTCGGCGCGTGCTGATGGGCGCGGTGTTAGGGCTGAGCAGTATGACGGTCAGTATTTTGTTGTTTATTCTGCCGATTCCGGCAGCGTTTTTGGCGCATGGTTTGCCGGACGTCCCCAATAAACGCTTCTCCCACGTTAATGTGGCAGTCGGTTATCTGCTGCCTGCTGGCTGGCTTGCTGATGTGGATCCCCGACTGGTTTGGCGTGATGAATGTCTGGACGCTGCTCGTTCCCGCCGCGCTGTTCTTTTCCGGTGCCGGGATGCTGCTGTTTCCGCTGGCGGCCAACGGCGCGATGAACCGTTCCCCTTCCTGGCGGGCACGGCTGGCGCGCGCTGGTCGGCGGTCCGCAAAACATTGGTTCCGGCGTGCTGGCGTCGCTCTCTGCGATGTTACCGCAAACCGGTCAGGGCAGCCTGGGGTTGTTGATGACCTTAATGGGATTGTTGATCGTGCTGTGCTGGCTGCCGCTGGCGGCGCGGATGTCGCGTAGGGGCAGCCCGTTTTAAGCGCACGTCACCACCCAGCATCATCAGCTCCGTGGGAGAACGATGCTGCTTTATCAGATCACATCACCCGCATATGCGGTGCCCGGAGTAAGAATAAAACGCCTGATAGCCGCACAAAGCACTGTCTGGCGTCTCCTGCCGAGCGATGCGGGCACAGGCGATGCCAGTCGCACGCCTGGCAGTCACAACGCGGTTGCGGGTTTTTCGCTGCCACACCATTTTTTGTAAGGTGGCGTCAAAAGCTCAATCGAGATACGACTGATATCTGCCCGCACCCAACACTCGAACAGGGCAGTGCAAAATTTCCCCACGAAGCTCTGCTGTCACGAAGCGGCCGTCCAGATCGCCCGGTCGTAAATTCAAGATAGGGGAATGGGCTGTACGGGCGGATGCCCGCTGTTTGAAATTATTGATAAAATCGGCGGGTTGCAGAGCATCCTTGTACTCTACAACCAGTTTATGCCCCGCAATCTCTTCAGCATCAATGACCTGACTTCCTGCCATGCGACTCTCAATAAATACGATAAGAAGTTGATGTATGCGTTACGGCAAACGTATTGCGAGATAACACCGCGAGGAGATCAAAAATTTGTCACGGACTACGTGAAATTGGGAAAATCGCTATTCATTGACATCCATTAGAAGTGCGATTACGTTAGCGAATCGCGGAAGGATCAGCGCCACGATGGCGAAATGCCAATCGAAATCAGAATAACATGCCCGCCTGGTACCCAGTTGTGTTTGATAGCCAACGCCATCAACGCCGTAGCCAGCGTGGTACGAAACCACGCCGGTGATATTGCGCTCCGGCTGCAGTCCTGGGTCGGCAATGCGTCTGGCTTTGCGGCTATCCGGCATACAACGCCAGTCCATAACGATCACCGCCACGACCATCAATATTAAGCTAATGATTAATGGCTGTTGGTGTAGGAGCGGATCCTCTTTCAGACGCATCGCTTTTTCATTGCGCGCCAGCGCAAGTAGCCATACATCGCTAACCGCCGGAAAACAGACACAACAACAACGCCAGCAGTTCGCGAATGACGGGCGTGGCGAAATCCTGGCGCAAGTTGATTGAAGCCCAACCCCGCCGCCAGAAATCCTGGTGCAGTACGGATCCACGCCAGAAAAGTACGCTCATTAGCCAGCGAGAAGCGGTAATCAGGCGCTTCTCCGGGCGGGAAAATTTTCATTGTTGCTCCTTTGCAATTTCACTAACGCGCTCTACCTTTAGCGGTTTTTAAAATTTCCGTCCGCCCGTTTCCTGATATGCTTTTGCCATCCGCTACAAAGGGAGGTCAGATGGGTATCATGGCTCAAAATAAAATCCAGTTCATTGGGCATGCTGTTCGGTGCCATCGCTTTAATGATGGGGATTATCCACTTTTCATTCGGCGCTTTCTCCGCACCATAACGTTTGAAAGCATCGTGGCGAGACCGAAACGGCGAAATTAAAGGGTCTTCTCGCCGGAATAAAAGGCAGAAAAAATTACCACCGTGGAGAAAAAAGAGGACGTAGATGTCGATAAAATCCTCAATCAAAGCGGTATCGCACTGGCCATTGCTGCGCTACTGCGCATTTATTGGCGGTATGCGTAAGGAGAAAATCCTTCTGGGGCATTCGCGGCTGCGCTGGTTTTGGCGGCGGGACGCTGGCTTTCCATACCTTGCTTTTGGTATCGGCATCGTGTGCGGCGATTTTGCTGATATTCCTTATCTTTTTCCTTCCTGACCGGCGGTTCACTGGTTTAAACAGCCTGAATAATTGCCCGCCGGGTGATCATCAGCGGGCATTATCGTCAGAACTTCTGTTTTTCTCCTCACCTTCACCCTTGTGTCCGGTAGGCCGGTGTCATAGTCGCGTACAGCTGGCGAATAGCGGGTTAAACGCCTAGCAGACGCCGCAATATCAGCACCGCA
+>84c0329b-2fe2-4fd8-ae10-f17ed9b2e0f9
+TTCGTGCTGCTGCGTTTAGTTACGTATTGCTACTTGCCTGTCGCTCTATCGCTACGTCTGCTTGGGTGTTTAACCTACACCGCCGCCAGTTCGCCGCGGGCGTCAGCCGCCAGCGCACCAGCGGCGCGGCGAATTAAATTCTCCGGGTATTCCGGGTCGTGCGTCAACCACGGCGAACATGGGCAGATGCCGTTATCAGCCATATTCGGTATAACCGGCAGGGTATCAGAGCGGACGGTTCGACCCGTCAGGAAATAATACTGCCCGGGCTTCTTCTGCCCACTGCGCCTGCCGTAATTCCAGTACCAGCGGAAGTGACGCCCGGCACCATCCATCCACGCCGGTAGTTTCGCCGCTAGATTACCAGCGGCCGTGGGAACGTCTGGCCATGCGCAAAGCGGTGGTCCACCAGCCCGGTCAGTACCCGGTACATGGCGGCAGCGGCGCGAGCAGCACCTCATCCGCTTCGGCACCCGCTCACACCAGCCGAGCCACCGGCCTACGTTGTTTGTCGCCGATAGCGATGCCGGACTTTAAGCGGGTTCTTCCGGCAGCGCCTGCAAGTCGACCAGCCGGTGACCTTCATCCAGTTCGCCACGCCGCCGCGCATAATACAGTGACTCATGCGGCGCCAGCAAATCTCACCAGGCTGGGTGCTCAAATAAACGGGCTTCTGCCACTGGTCAGTGTGTTATAACGCTACGTATGGCCGGATATCACCGAGCATTTTTCAGCCGGGGCCGAGGCTCCCCACCGGCGCGGGCGTTTCATCCCGGTAACTGCTGGCAGGTGCGGGAGAAGAATGAGCGGCAACCCGGGCGAACGGGGCGATCGGTTTCACCGGGAAGGACCTTTGCACCGAGTGGCGGATTGACCGGATAAGCCCGGACGATCACCCCGCCGGGGCACACGAACAAACCCCGCGCCGGTGAGGCACCGATGCGTACTGGCTGAACTTCCCTGGACAATGCCGCCGCCATGCGTCATATCGCCTGACGCGCCGCCGGTTTTCCGCTCATCTCGCTCCATCAACATCAGGTTATTTGTCTGCTGACGGAAACCGAATTTATAAAGAAAGCTGAGGCGAGATATCTGTCAGATAGAACAATTGGAATATTTACTATGTTCATGAATATATGTTTCGATTAATTATAACGATGTCTAAATATTCCTCTGAACATCTTCCTGATGCAAAAACCGCCAGCGTTTCCGCTGGCGGTTTCATATTCAAACTCGGCAATCAATAAAATCACCAGTTGCCTTTTTCGGCCTGATCAAATTCCACACCGGGTTTATCGCTGGTTTTCTGACCAGACGCGATGCAGGTAGCTGCAAAAAGCGGGCGCAGTCTTTCCAGAAAAAGCGCCAGAAGAGCTGGCGCCAGAACGCCGCTGCAACGCATGAGAATGCCTGACGTAAAAGATAAACCGTGGGATATTCTCTGTAGAGTTCCATACTTTCTCCCCTTTTGTATCTACCCGGTGAATGGCACCGGAAAAATGAATTTGTTTGCTCTGATGAAAAATGGTACCGCCTTTTTGTGTAATTTTCTCATCCGACCACTTATTTTGCAACGTGATGGTTTATTTACATTCATCCTGCCTTAATTAAATTTACAAAGTTAAATTAATATAAACGATGGATTAAATCATGTTTTGCCATTTTATACTTTTACACCCCGCCCTGATTTTTGCGAAATCTTTGCCGTAATTCTACTTCGGTATCGCGCAGGCCGGAGATTTTCTTGAGTGAGCGTGATAACGGCATTGCTGGTGTTTTTATTACTGCGGGTTATCTGGTTTATACCCTGGTACGTCAATGCGGAGGCGTTCTGGTGGCTGCGCAAGGGTTCTTCTGATCGCGCCGATTTTACTGGTGTTAATGGTGCTGGCGCGTCCTTTAGGCGGCGGGCTGGCGCGGCTTTGATTAATGACATTCCTCTTCCCGGTACAACGGGCGTTGAGCGCGTACTTTTTCGCGCCTTGGCGTCCTCTGACCGTGGATGAACTGGAAGCAATATCTTTATTGCCATTCTCCTTCGACATGCTGGGGCTGGCAGTTACTGTTTTATGTTGCTCGGTCAGCACTATCTGCCGCTTAATCCCCAGCGGATTTACTAGGGCTGTCGTGGGATCTGGCGCGCTGAATACCGCCGTCTTTGTCACCAATACCAGCTGGCAATCTTATAGCAGGTGAAACCACGTTGGGCTATTTCCGTAAGATGGCGAAGGCTAACGGTGCAAAGCTTTCTTTCTACCGCCAGCGAGTTGCGGTGATTTTTGCCTCATCCGTGCGTTTACCCGGAAACGCCGAGCACGCTCGAGATGCCTGGTCGATCTGCTACGCATCGTTATGGTGCTAAGTCCTGTGGCGTTGTTGGTGCACTGTTTTTATTCAGCAAAGGTGCGCTGCAAAACTTTCTGCCTTATCGGGCTGTGAATACCGGGTGGAAGGAGCGCAACGGCTGATACCATGGACCTGCTGGCTTCTCAGGAAACGATCAAGATGCTCGGTACTAACGGCGGTGGCTGTATTTTAATGCCAACTCGTCGCATCAGTTTTGAAAACCCAACCGCTGACCAACTTCGTGCAGATGCTGGCGATCTTCTTGATCCCAACGTATGCTGCCTTTGGTGAAGTGATGGGCGATCGCCAGGGCGCATGTTGCTATGGGCGATGCTCGGTGATTTTGTCATCTGCGTAGGCGTGTTGATGTAGGCGGTTCGAATTAATCCTCATCTACTGGCACTGGGCACGGACAGCGCATCAATATGGAAGGTAAAGCCGTTCGGCGTGCTGGTCAATGCGCCTGTTTGCGGTCGCGGCGGCTTCCTGCTGGCGCGGTGATTGCGATGCATGATTCGTTTACCGCTCGGTGGCATATAGTGCAAATGCATGGCTGTCACAAAATTGGTGATGGTGTTCGGCGATTGACTGGTTCTGGTCTTTACGGCATGATGCTGTTTGTCCTGCTGGCGTGTTTATTACCGGGCTGATGATTGGTCGTACACCGAATATCGGGTAAAAAATCGACGTACACAGATGAAACTGGCGGCTGCACTGGCAATTCTGGTTACCCTGACGCTGGTGCTGATGGGCGCAACGTTAAGCGATATTAATGAAACGCCGGACGTAGCGCCATGCTCGCTATGGCCCACATGGCGGTTTTAACAGTGCTGTACGCCGTGTCTCCGCCGCTAACAACAACGGCAGCGCCGCGCCGCGGCGGATCAGCGCCAACTCTCGTTCTGGAACTGTTTACTGGCGTTCTGCATGTTTGTCGATCCTTCGAATTTGATTATCCCGGTGATAGCAGTGCGGTTCGCTGGTGATAAAAGGCAAACCGCCAGCTCCGGCGCGCTGCCAACGCACGTAACTGTTTGTTGGCCTGTTAAATCCGGCACCGTATTTGCGGGGTTAAACACCCAACGAACGCCGCAATATCGGCGGG
+>2c469631-125c-4046-b1c0-677322b0f3a3
+TTGAGCGCGCTGACCAGTTGCATATTGCTTTTCTGTTTGGTGCTGATATTGCGGCGTCTGGCAGGTGTTGTAGCCTGGGGGCGCTGCCGCCGGATATCCGGTTAAGCGCATCTTTACCTGGCGACCAGCAGCGCACAGGGGCCGTGTTGCCACGGATACTGGGGTGGTCTGAGCGGAGGTGTGCCGGGTCACGAGACGTACTGCCAGCGCCGCTGCCGCCGTACCGGGTGCTTACCGGGATGGCGGACCGCTTCGGACGCTGACGTACCGGCGTGGGCGCCAGTGACCACAAGCCGGGGAAATCACCGGCGTGACGGACAGTGCCGGGCAGGAGTTCCGTCAATTGCCGAGCCACACCGGGCGCGTGATGCAGAAGGGCCGCACCTCTTCGCTATCTTCTTCTGACGGTTTACGCCCTCTCAGCCCTCAAGCGTTTCCCCGACACACCGGTGCCGATACGGCCCCGGCAGGTAATCGCCTTCTGGCGGTGTAAGCTACGGCCGGCATACCCGGAAGCCACCCGCTGCCCACTGGTGCGGTACCCGCGGG
+>c0789440-f511-4522-8231-d4d179a7a487
+TTGTTGTACTTCGTTCAGTTACGTATTGCTCTTGCCTGTCGCTCTATCTTCGGCGTCTGCTTAGGTGTTTAACCTATCTCACGGTCAGAGACGCCAAGTGCGCGAAAAAGTACGCTCAACGCCCGTTGTACCAGGAGGAATGTCATTAATCAGCCGCGCCAGCCCGCTGCCTAAGAGACAGCGCCAGCGCACCATTAACACCAGTAAAACGTGGCGATCAGTAGAACCTTGCGCAGCCATCAGAACGCCTCCGCATTGATCAGGGCATAAACCAGATAGCAGTAATAAAGCACCAACCAATACGCCGGTTATCACGCCTGCACTCTAGTGCACCTCCAGTGGCCTAAAAGTATTCCGGAAGGGTAGAATTCTGGCTGCAAGATTTCGCAAAAATCTGCGGGCGGGGTGTAAAAAAGTATAAAATGGCAACCATGGTTAACTAATGTTGAGTATTAATTTAACTTTTATTAGCAATTACAGGATGAATGTAAATAAACCATCCAATAAAGCAAAATAAGTGGTCGGATGGTAGTAAAATTACACAAAGGCGGTGTACTATTTTCATCAAGATAAACAAATTCATTTTCGGTGCCATTCACCGGGTAGATACAAAGGGGGAGAAAGTATGGAACTCTACAGAGAATATCCTGCATGGCTTATCTTTTACGCCTTAGCCGTACTTATGCGGTTGCAGCGGGCGTTCTGGCGCTGCCTTTCATGCTTTTCTGGAAAGACCGCGCCCGCTTTTACCTTCTACCATCGCGTCTGGTCGAAAACCAGCGATAAACCGGTGTGGATGGATCAGTAGAAAAGACAGCTGGTGATTTTTGACTGATTGCTGAGTTTGAAGATACATTGAAATACGCCAGCGAAACGCTGGCGGTTTTATATCAAGGAAGATGTTCAGAGGAATATTTAGACATCGTTATGCAATCGAAACTATATATTCTGAAATATATATAAATATTTTCCTAATTGTTCTTATCGATAGATATCTCACTTAAGGCTTTCTTATAAATCTGTAGGGTTTCGCCTGTCAGCGAATAAATAACCCGATAAAACAAGGATAGGCAGATGAGCGGAAAACCGGCGGCGCGTCAGGGCGACATGACGCAGTATGGCGTATCATTGTCCAGAGTTCAGCCGGGGTACGCATCAGTGCCCCCACCGGCGTATTGGCCTGTTGGGGTAATGCCCGGCAGGGTGACGTCCAGCCATCCGGTCAATCCGCTGCTCGGTGCAAAGGTCCTTCAGTGAAACCGACATCGCCCTGCCCGGCCCGCTGCGTTCATTCTCTCCCGCACCTACAGCGGTTACCGGACAAAAACGCCCGCGCCGGTGAATTATCAGCCCGGCTGAAAATGCTGCGGATATCCGCTTACAGCTGCGCGATAACACACTGATACTCAGTAACGGCAGCAGAAGCCTGTATTTTGAGCACCCTGTTTCCCGGTGAGGACGGTTACAGCCGCAGCGAGTCACTGCATGGCTGGTGCGCGGCGGCGTGGCGAAACTGGATGGTCACCGGCTGGCCGCCTCTGGCAAACGCTAACCGGAAGAAATCGCTTAAGTCCGCATCGTTATCTGGCGACAAACAGTCCGCAGGGGCCGTGGTGGCTGCTCGGCTGGTGTGAGCAGGTGCCGGAAGCGGATGAGTGCTGCCTGCCACCGCTGCCGCCGTACCGATTGACCGGGCTGGTGGACCGCTTCAGGCGCACACAGACGTTCCACCGCAACGAAGCCGCCGGTGATTGGCAATCACCGGCGTGACGGATGGTGCGGGCGTCACTTCCGGCTGGTACTGACCACGCAGGCGCAGCGGGCGAAGAAAGCCCGGCAGCAGGCCATTTCCGGCAGGACGGAACAAATCCGCTTTTCCTGTTCACCCTGCTGGGTTACACCGAATATGGCCAGGACAGCGGCATCCATCTGTCTGCCATGTGGCTGACACGACCCAGAATACCCGGAGAATTTTACCTGCCGCGCCGCTGGGTACGCTATGGCCTGAACGCCCGCGGCGAACTGGCGGCGGTGTGAAGCCGCAGCAATACACAGGTGCGCAGCTTTTACTTACGATGGTAAATGCCGGGGCGGATGGTGGCGCACCAATCACAGATGACCGAAATCTAAATTGCCGTTACGACAGCGACGGGCGGGTGACAGAACAGCTAAACCAGCAGGCTTAATTTACGTATCAGTGAAGGACCATCATATCACCGACAGCTGGGCCATGGTCCTGCACACGCAGGTGAAGGCGGGCTGAAACAGGTGGTGAAAGAACTACGCGGACGGCAGCGTCACGCAGGAATCAGTTTGACACGGTGGGCAGGCTCAGGCTGAACTGGATGCCGCAGGCAGGACAACAGAGCCACAGTCCGGATGTGGTGGCCGGGCTCATGCGCGCATCACCCGCCGGATGGCAGGGCATCCGGCGTTTACTGCATAACCACACAGCCAGTTAACGTCAGCCACCGGGCCTGAAGCTGAACAAATACGCCGGGAATATGATGAATGGGGCCGTCTGATTCAAAACTGCCCCTGACGGCGATATCACCCGCTACCGTTATGATAATCACAGTGACTTCCCTGCGCAACGGAAGATGCCGGCGGCGGAAAATACGACGTGGAGCCGTTACGGTCGGTTGCTGAGCTTCACTGACTGTTCGGTTATGTATTACGCTATGACCATGACCGTTTTGGTGGTGACGGCAGTGCACCGCGAAGAACTGTATTACGCGCATGCGACGGCCGTGGACAGTTAATTGCCGTAGAAAGACACGCAGACCGCCAAACGCGAATATGAATACAACGCCGCCGGTGACCTGACCGCAATCATTTACCCCGGACGGCAGCAGAAACAGGACCTGATACGATGCGTGGGAAAAATCTGTACCACGCAGGGCGGTCTGACGCGCAGTATGGAATACGATGCTGCCGGACGGGTCATCCGCTGACCAGTGAAAACGGCAGCCACACCACCTTTGTTACGAATAGCACTCGACCGGCTGATACGGAAACCGGCTTTGACGGCGCACGGCGTTATCACCACGACTTACAGCCGTAAACTCCGCAGCGAGGATGGTTAAACACCAGCAGACGCCCGCAATATCGGCA
+>7caaf6c8-af5c-484f-ad5f-981112218eb0
+CTGTTATGCTTCGTTCCGGTTACGTATTGCTGCTACTTGCCTGTCGCTCTATCTTCGGCGTCTGCTTAGGTGTTTAACCTGCATGGCTTATCTTTTTACGCCGTACTTATGCGGTTGCAGCGGGCGTTCTGGCGCTGCCTTTCATGCTTTCTGGAAAGACCGCGCCCGCTTTTACAGCTACCATCGCGTCTGGTCGAAAACCAGCGATAAGCCGGTGTGGATGGATCAGGCCGAAAAGGCAACTGGTGATGATTTTTATTGATTGCTGAGTTTGAATACGGTGAAAACCGCCAGCGGAAACGCTGGCGGTTTTAATATCAGGAAGATGTTCAGAGGAATATTTAGACATCGTTATACCAGAAATCGAAACATATATGAAATATATATAAATATTTTCTAATTGTTCTTATCGACAGATATCTCACTTAAGGCTTTCTTATAAATGGGTTTCGCCTGTCCAGCAGACAAATAACCCGATAAAACAAGGATGAGCAGATGAGCGGAAAAACCGGCAACGCGTCAGGCGACATGACGCAGTATGGCGGTAACGTTAATCCAGGAGTTCAGCCGGGGTACGCATCGGTGCCCCCACCGGCGGCGTGGCCTGTTCGGTGTGCCCCGGCGAGTGTGACGTCCAGCCATCCGGTCAATCCGCTGCTCGGTGCAAGGTCCTTCCCATTGAAACCGACATCGCCCTGCCGGCCGCGCGTTCATTCTCTCCCGCACCTACAGCAGTTGCGGACAAAAACGCCCGCGCCGGTGGGAGCCTCGGCCCCGGCAGAAAATGCCTGCGGATATCCGCTTACAGCTGCGCGATAACACGCACTGATACTCAGTGATAACGGCGGCAAAGCCTGTATTTTGAGCACCTGTTTCCCGGTGAGGACGGTTACAGCCGCAGCGAGTCACTGTGGCTGGTGCGCGGCGGCGTGAAAACTGGATGAAGGTCACCGGCTGGCCGCCTCTGGCAGGCGCTGCCGGAAGAACTCCCTTAAGTCCGCATCGTTATCTGGCGTCACAAACAGTCCACAGGGGCCGTGGTGGCTGCTCGGCTGGTGTGAGCGGAGTGCCGGAAGCGGATGAGGTGCTGCTGCGCCGCTGCCGCCGTACCGAATTACTGACCGGGCTGGTGGACCGCTTCAGGCGCACACAGACGTTCCACCGCGAAGCCGCCGGTAGATTCAGCGGCGAAATCACCAGCGTGACCGGATGGTGCCAGGCGTCACTTCCGGCTGGTACTGACCACGCGAGCGCAGCGGGCAGAAAAGAAGCCCGGCAACAGGCCATTTCCAGCAGGACGGAACCGTCCGCTTTCTGATACCTGCCGGGTTACACCGAATATGGCCAGGACAACGGCATCCGTCTGTCTGCCGTGTGGCTGACACGACCGGAATACCCGGAGGAATTTACCTGCCGCGCCGCTGGTGCGCTATGGCTGGACGCCCGCGGCGAACTGGCGGCGGTGTATGACCGCAGCAATACACAGGTGCAGCTTTACTTACGATGATAAATGCCGGGGCCGGATGGTGACGCACCGTCCGCACGGGCCGACCGGAAATCTGTTACCGTTACGACCTTGGCGACGGGCGGGTGACGAACAGCTAAACCCGGCGGGCTTAAGTTACGTATCAGTATGAAGGACCGCATCACCATCACCGACAGCCTGAACCGCCGTGAAGTCCTGCACACGCAGGAGTGAAGGCAGGCTGAAGCGGAGTGGTGAAAAAGGAACTACGCGGACGGCAGCGTCACGCAGAGTCAGTTTGACGCGGTGGGCAGGCTCAGGGCACAGACGGATGCCGCAGGCGGGACAACAGAATACCAGTCCGGATGTGGTGACGGGCCTCATCGCGCATCACCACGCCGGATGGCAGGGCATCGGCGTTTACTATAACCACCACAGCCAGTTAACGTCAGCCACCGGGCCTGACGAAGATGGAAATACGCCAGGAATATGATGAATGGGGCCGTCTGATTCGAAACTGCTGACGGCGATATCACCCGCTACCACCGTTATGATAATCCGCACAGTGACTTACCCTGCCAACGGAAGATGCACCGGCGGCGCGGAAAACCATGACGTGGAGCCGTTACGGTCAGTTGCTGAGCTTCACTGACTGTTCCGGTTATGTAACCCGCTATATGACCATGACCGTTTTGGTCGAGTGACGGCAGTGCACCGCGAGGAAGGGCTGAGTCAGTACCGCATGCGACAGCCGTGGACAGTTAATTGCCGTAGAGAAAGACACGCAGGGCCATGAAACGCGGTATGAATACAACGCCGCCGGTGACCTGACCACCGTCATTGCCCCGGACGGCGGCAAACGGGACTGCAGTACGTGCGTGGGGAAAAGCCATCTGTACCACGCAGGGCGGTCTGACGCGCAGTATGGAATCTGATGCTGCCGGACAGATGCATCCGCTGACCAGTGAAACGGCAGCCACCACCTTCCGTTACGGTACTCGACCGTGATACGAAACCGGCACGACGGCCGCACACAGCGTTATCACCACGACCTGACCGGCAAACATCCGCAGCGGGATGAGGCTGGTCACCCACTGGCACTATGACGAAGCAGACCGCCTCACGCACCGCACCGTGAATGGCGAAACCATGAGCGGTGGCAGTATGACGAACGCGGCTGGCTGACAGACATCAGCCATATCAGCAGAAAGGGCACCGGGTGACGGTGCACTATGGATATGACAGTAAGAGCCGCCTCGCCGAAGTGAACACCTGACGGTGCATCATCCGCAGACGAATGAACTGCTCTGGCAGCATGAGACCAGACATGCGTACAACGCACGGGGACTGGCAGACCGCTGTATACCGGACAACCTGCCCGCCGTGGAATGGCTGACCTACGGCAGCGGCTGGCTGGGCATGAAACTCGGCGACACACCGCTGGTGAGTGATACACCCGCGACCGCCTGCACCGGGAAACGCTGCGCAGCTTTCGGCCATTATGAACTCACCACCGCTTATACCCCTGCCGGGCGGTTACGAACCAGCACCTGAACAGCCTGCGTCTGACCGCGATTACCTGGAACGACAACGGCGAATAAATCGCATCAGCAGCCGCCAGACCCGGAGTTACAGCTACAGCACCACCAGCGGGCTGATAAGCGTTCCACACCACCGCAGCGAATCTGGATATCACATCCCGTATACCACAGACCCGGCAGGTAACCGCCTGCCCGACCCGGAGCTGCACCCGGACAGCGCCCTCAGCATAGCGGATAACCGTATCGCCGTGACGCGCACTATCTTTACCGGTATGACCGTCACGGCAGGTGACAGAAAACCGACCTCATCCCGGAAGGGGTTATCCGCACAGGATGATGAGCGCACCCACCGGTACCATTACGACAGTCAGCACCGGCTGGTGCCTTTCTGCGGACACAATATGCAGAGCCGCTGGTCGAAAGTCGCTATCTTTACGACCCGCTGGATACCAGGGTGGCAAAACAGGTATGGCGGCGTGAACGGGACCTGACGAACGGATGTCGCTGTCACGGAAACCGCAAGTGACCTGGTACGGCTGGGATGGCGACCGCCTGACCACGATACAGAACGACAGAACCCGCATCCAGACGATTTATCAGCGGGGCTTCACGCCACTCATCAGGGTTGAAACCGCCACCGGTGAGCTGGCGAAAACGCAGCGCCGCAGCCTGGCGGATGCCATCTAACAGTCAGTGGCGAAGACGTTGGCGGTGTGGTGTTCCCGCCGGTGCGGTGCAGATGTCGACCGGCGGAAAGTGAAATCCTGGCTGACCGGGTGAGTAGAGCTTCCGCCGCTGGCTGGCATCGATGCGGCCTGACGGTGGCGCAATTAAAGCCAGATGGACCCGGTATACCACGCCGACTTGAAAATTCACTGTACCACTGCATTCGCGCGGCCTGCCGCTGGCCCATATCAGCACGGAAGGGACAACAGCGTGGTACGCAGGAATACGATGAATGGGGTAACCTGCTGAATGGAAAGGAGCCGCATCAGCTGCAACATCCGCCTGCCGGGGGCAGCAGTATGATGAGGAGTCCGGCCTGGCCAGCCACCACCGCTGTATGACCCGCTGCGGGGGCGATATATCCTCAAGGATCCATTGGGCTGAAAGGGGATGGAATTTTATCAGTATCCATTGAATCGATCTCAAATATAGATCCATTAGGATTAGAAACACTAAAATGCGCATTAAGCACCATTCAATGGGCGGAACTGGTGAAAAGCGGTCCAGTATGTGGGGAATCCGTTCTATCATCAATATCTTTGTGTCCCCAGATGGTAAAGGGACTATACTTGTGGTGGCCAAGACCAACGGGAGAATCAAAGGGAATGGTCTATGGGGGCCAGGTAAAGCAAGTAATGATACAAAGAAACTGCTGGCCGTTGTGACCTCGTTGAAACCGATAATAGTTGTGTGGAGAACTGTTTAAAGGGAAGTTTAAAGTGAAAGCCGCGTTATTCTGTATTGCCTGATATATTCACCTATAAATTTAGGGCCTATTTAAAACTGCCAAGACTGGTCTAATGATTCTTTAGAAACATGTAGATGAAGTGCTCCGGAAATAACATTGGACGTTTTATTAGATTTGTATTCACCGGAGTGATGTAATGAAATATATTATTTTTATTCAGGGGCTATATGGCTGGCTATCGCTTTTAATACTATTCTTTTCCATGCATAGACTTTCACTATTGGGCTCCCTCGTGATGTGAGCGAGTTAATTAGTCATCTATGGAATGATGGTAATATGTTTTCCAACAGGCATAAATATTCTTTGTGCTCCTAATATTTATGAGGACTGTATCAGACATTATTGGCGTAAGTTGATGGTAAGTATATTATGGCGATAATAATGGCTTTATTTTCTGTCGGGTATATTCAATGGTTTGTATTAAGTAAGCGCATTATAAACAAATAAATTAAAGTTAATTGCTCTTATTGTGCCTGTCGCAACCTGGGCATTGATATCCCGTATGCCTGAACCCGGCAGATAACCGCCTGCCCGACCGGAACTGCCGGACAGCACCCTCGGCATGACCCGATTAACCGTATCGCCCGTGACGCGCACTATCTTTACCGGTATGACCGTCACGGCAGGCTGAGCGGAGATAACCGACCTCTCATCCCGGAAGGGTTATCCGCACGGATGATGAGCGCACCACGGTACCGCTACGACAGTCAGCACCGGCTGGTGCACTACCGCAGGGCCTTTAATATGCAGAGCCGCTGGTCGAAAGCCGCTATCTTTACGACCCGCTGGGCCGCAGGTGGCAAAACGAAGATTGTGGCGACGTGAACGGGACCTGACGAGGCTGGATGTCGCTGTCACGAAACCGCAAGTGACCTGGTACGGCTGGGACGGCGACCGCCTGACCACGATACAGAACGGCGAACCCGCATCAGACGGTTATCGGCCGAGGCTTCACGCCCTCATCAGGGTTGAAACCGCCACCGGTGAGCTATGGCGAAAACACAGCGCCATGACCTGGCGGATACCCTTCAACAGTCCAGCGGCAGACGGTGACAGTGTAAAGTGTTCCCGCCGGTACTGGTGCAGATGCTCGACCGGCTGGAAAGTGAAATCCTGGCTGACCGGGTAGTGAGAAGCCGCCGCTGGCTGGCATCGTGCGGCCTGACGGTGGAGCAGATGCAAAACCAGATGGACCCGGTGTACACGCCGGCGCGAAAAATCCACCTGTACCACTGCGACCATCGCGGCCTGCCGCTGGCGCTTGTCAGCACAGAAGGGGCAACAGAATGGTGCTGGAAATACGATGAATGGGAACAACCTGCTGAATGAAGAACCCGCATCAGCTGCAGCAGCTTATCCCGCCTGCCGGGGCAGCTGGTATGATGAGTCCGGCCTGTATTACAACCGCCACCCGCTATTATGACCCGCTGCAGGAGGTATATCACTCCAGGATCGATTGGGCGAAGGGGATGGAATTTTTATCAGTATCCGCTGAATCGGTTCCGTATATGCAGATTCAATGGGACTGGCATCAAAATATGGACGCCAAATAATAGGCGAGATGGGCGAGACCCAACAAACCGCCGCCCGATCCAAGTAGAATTGCCGGACGCAGCGAAACAATTAAGACTGCCATATCCTATTGACCAGGCCAGTAGTGCGCCTAATGTTTCAAAGAAAGAAACGTTCTTCCAGAGCATTAAGCCCACTTGACTACACACTGTATTGCAGGAAGTGGGTAAAACCAAATCTGACTTGTACGCCACAGGATGATTCCCTGATATCCAGGGATGGATACAAAGACAGCAAAAGAAGTGATTACACTGCCACAGACAAATTGGCCCAACAAACTCAATTACCACCAGGATATGCGTACAGAACCCTACTTATTCCAGACATTTAATAAACCCGATGGGCTGGCAACGGGGATAAGATGATTTGGGTGAAATTTTAGTAAGATGGAAGCAGAACATCGAGAGGAATAAAGAAAATGAAAAGAAATTTTGTTCTTTTTGCTGATGATATTTGTAGTTTTGGTAATTGCATATTGATTGCGAGAATACAAGCTAAAGATCATACGTTGTTTTACTATTTTCCTTCGGGTACTATTTTTCCGCGTTCCTGTCTTAAATAATAAAGCCATGTGGAGATGGTATCAGAATGAGGACATCGGTGAGTATTGATAGCGAAACAGAACTGGGTACATGTAAAATATTAAAATTCACACCAAGCGGGGCGAGACTCTTAATTCGCGTCGGGTCACTACCGCCTTAATGAAAAATCATGCCATCAAAGGAACGTTGCAGGAGTTGATAAATACAACCAGAAAAAACGGCGTTTCTCGGCGATCGGTTTTAGGGATTATAAGAGCGGGTATCTATCAAAAGAGCAGTAGTCAAGTTCAGTTGTTGCAGCAGTCCTTGATAATTCAATCATGGTAAAATATTTAAAGATGAGAAACCAACCCTTCTCGAATGACAGCATCTCCCGAACAAAATATGAGTCTTACGAATGTTTAATAAAGATACAGCATGAACTAATTCGTAGTGAAGAGAAATAAATCTCTTCCTGAAAACAAATTAATCATTGTGAAAATTGTAACTCATGGAATAGAGGTGTTTGTTTTGCGTTCCATTTGCAGGAAAGATCACGTAACGCTACTTTTTGTACTAAATAATTCAATTTTAAAGTTCAACAATTGAGATACTTGTTGTCTAAAGCTGTTTTCCTTAAACATACGCTGATCAAATACTCCTTACATAAATAAGGTGAACAAATGGAACTTAAAAATTGATGGAACATATTTCACAATTACACCCGATTACAGACAAGCCTGGAAAGTGGTGCATAAATTGTCAGATATTCTACTGTTGACTATTTGTGCCATTGGCTATAGTGCAGAAGGTTGGGAAGATATAAGAGGATTTCGAAACACATCTCGATTTTTTTGAGCAATATGGTGATTTTGAAAATGGTATTCCTGTTCACGATACCATTGCCAGAGTTGTATCAGGGAAAAGATCACGTAACGCTACTTTTTGTACTAAATAATTCGCATTTTATGTTTTAAAAATTGATATTCCTTATTACCTAAAGCTGTTTTCATAAGCATACATGATCAAATACTCCTTACATAAATAAGGTGAACAAATGGAACTTAAAAATTGATGGAACATATTTCTATTATTCCCGGTCTAGATAAGCCTGGAAAGTAGAGCATAAATTGTCCAGGCATCCTACTATTGACTATTTTGCCGTTATTTCTAATTACCCAGTTAAGGAAAGATATAGAGGATTTCGAAACATCTCGTTCTTGAGCAATATGGTGATTTTGAAATGGTATTCCTGTTCACGATACTGTGCCAGGTTGTATCCTGTATCAGTCCTGCAAAATTTCACGAGTGCTTTATTAACTGGATGCGTGATTGCCATTCATCAAATGATAAAAGACGTCATTGCAATTGATGGAAAAAACGCTCCGGCACTCTTATGACAAGAGTCGCCACGGGAGCGGTCATGTCATTAGTGCGTTCTCAACAATGCACAGTCTGGTCATCGGGCAGATCAAGACGGATAAGAAATCAATGAGATCACAGCTATCCTGAACTTCTTAACATGCTGGATATTAAAGGAAAAATCATCACAACTGATGCGATGGGTTGCCAGAAAGATATTGCAGAGAAGATGCAAAAACAGGGAGGTGATTGGTTAAACTTACCAAGCAGACGCGCCGCAATATCAGCACCGCA
+>b098b785-7ccd-41af-8980-f2894d700284
+TCGCTGGCATCGGTATGCGCTACGTTCCAGTTACGTATTGCTCTGGCGGGTGTTTAATACCAAGCTCAGCGCCTGGGCGACAAGTGTTAGTTCGGGCAGCGCCGGTTGTTTACGACTCATATTCAGTGCTCCTCAATATCAAATGGGAGAGATATTCCGCCACGCCGGACTGACGCCAGGGCAGGGATAAAGGTCAGTTACATAGCCAGCAGCACGTTGCCGATTAACGGGCCAACCGACAACGGGCCGTACGTTGGCAGCGTGCCGGAGCTGGCGGCTTGGCTCTTTTTACTCACCAGCGGGCCGGCCAATTGCCATCGCAGGATAATCACTTTGAAGCGACCGGCAAACATGCAGAGCCTTGATAAACAGTTCCAGAACGGAGAGTTTGGCGCTTAATCGGCAAAGCGCTGCCGTTGTTGTTAGCAGCCGGATGACGGCGGCGTTTAGCCGCCCTTTAAAACCATGCGGGCAGGGTTGTAGACATGGCGCTACGTCCGGCGTCAGGTCATCATCGCCAACGCCGCGCCCATCAACACCAGCGTCAGGGTAACCAGAATTGCCAGTACGGTCAGTTTCATCTCGCGTACGTCGATTTTTTACCCAGATATTTGATGCACGACCAATCATCCAGCCCGGCAATAAACACCGCCAGCGGGACAAACAGCATCATGCCGTAGAGACCAGAACCATTGCCGCCGAACACCGCTTCTGGTGCATCAATACATCGGCACCATGCCACCGAGCATTAGAGCAGATCATGCGTAAATCCACCGCGCACAGGAAGCCGCCGTCGTCACGACCGCAAAACAGGCTGCGACCAGCACGCCAGAGCAATGTCTTTACCTTCCATATTGATGCTGCTGTCCGTGCCCAGTGCCAGCAGATGGGGATTACCCTGAACTTCTGCCCATCACCACGCCTACGCAGATTGACAAAATCCTGACATCGCCCACAGCAACATGCGCCCTGGCGGCGATCGCCCATCACTTCACCAAGGTAAAGCACAGCGCCGTTGGGATCAAGAAGATCGCCAGCATCTGCACAGAAGTTGGTCAGTGCGGTTGGTTTTCAAACGGATCGACGAGTTGGCATTAAAGAAGCCACCGCCGTTAGTACCGAGCATCTTGATCGCTTCCTGAAGCTACAGGCCCCATGGTGGCAGCTGTTGCGCTCCTTCAACGGTATTCACAGCCTGAAGGTTGTACCCAAACGGGCATACCAATATCGCGCG
+>cc70a582-d0ee-47f5-890d-9d097df3619a
+CTGTTGCCCCGTTTCCAGTTGTGTTGCTACTTGCCTGTCGCTCTATCTTCGGCGTCTGCTTGGGTTTAACCTCGGATATCCGCAGGCATTTTCCAGCCAGGGCCAGAAGCTCCCCACCAGCGCAGGCGTTTTGTCAATAACTGCTGTAGGTGCAGGAGAGAATGAACGGCAACGGGCCGGGCAGGGCGATATCAGTTTCACCGGGAAAGGACCTTTGCACCGAGCAGCCCAGTTGACCAGACGGTGATCACCCGCCAGGGCACCGAACAGGCCACGCCGGTAGAGGCACCGGTACGTACCCCAGCTGAACCCTGGACAATGCTACCACCGCCATACTGCGTCATGTCGCCTGACGCGCCGCCCGGTTTCGCTCATCTATACTCATCCCTTGTTTTTATCCGGGTTGTTGTCTGCTGACCAGGCGAAACCCTACAGATTTATAAGAAGCCTTCGTGAGATATCTGTCCAAAGATAAGAACAATTAGGAAAAGAAATATTTATATATATATTTCATGAATATATCGATGTTTCGATTGGTATAACGATGTCGTATTCCTCTGAACATCTTCCTGATACAAAAACCGCCAGCGTTTCGCTGGCGGTTTTCTAATATTCAAGCTCAGCAATCAATAAAAATCACCAGTTGCCTTTTCAGGCCTGATCCATCCACCGGTTTATCGCTGGTTTCGACCAGACGCGATGCAGGTAGCTGTAAAAGCGGCGCGGTCTTTCCAGAAAAGCATGAAAGGCAGCGCCAAGACGCCCGCTGCAACCGCATGAAATTACGGCGGCAGATAAAGCCATGCGGATATTCTCTGTAGGTTCCCACTTTTCTCCCCTTTTGTATCTACCCGGTGAATGGCGCCGGAAAAATGAATTGTTTATCTGATGAAAATAGTACCGCCTTTTTGTGTAATTTTACTACTCATCCGACCACTTATTTTTGCTTATTGATGGTTTTATCTACAATCATCCGTAATTAAGTTACACAAAGTTAAATTAATACTAAACGTGGATTCATCATGGCTTTTGCCATTTTATGCACACCCGCCCACCAGATTTTTGCGAAATCTTTACGTAGAATTCTACCCTTCGGTATCACTTTTAGGCCACTGGAGTGCACTGTGAGTGCAGGCGTGATAAACCGGCGTATTGCTGAGAATATTTTATTACTGGGTTATCTGGTTTATGCCTGATCAATGCAGGTGGCGTTCTGATGGCTGCGCAAAGGGTTCTTACTGATCGCCACGTTTTACTGAATTGTTAATGGTGCTGGCGCGTCCTTTAAGGGCAGGCTGGCGCGGCTGATTAATGACATTCCTCTTCCCGGTACAACGGGCGTTGAGCGCTGCGTGCTTTTCGCGCACTTGGCGTCTCTGACCGTGAGATGAACTTCGGAAGCTTATCTTTGTGCCATTCTCTGGCCTGAACATGCTGGGGCTGGCGGTGCTGTTTTATGTTGCTCGGTCCAGCACTATCTGCCGCTTAATCCCACAGCAGCAGTTGCCAAGCTGTCGTGGGATCTGGCGCTGAATACCGCCGTCAGCTTGTCACCAATACCAGCTGGCAATCTTATAGCGGGTGGGGAAACCACGTTGAGCTTCTTTCAGCCAGATGGCGGGCTTAACAGTGCAAAACTTTCTTTCTGCCGCCAGCGGGATTGGGAGATTTTGCCCTCATCCGTGCGTTTACCCGCCAGAGCATGAGCACGCTCAGGAATGCCTGGGTCGATCTGCTACGCATCACGTTATGGGTGCTAGTCCACCAATGGCGTTGTTGATTACTGTTTTTATTCAACAAAGGTGCGCTGCAAAACTTTCTGCCTTATCAGGCTGTGAATACCGTTGAAGGAGCGCAACAGCTGCCACCCGTGGGGCCTGTGGCTTCTCAGGAAGCGATCAAGATGCTCGGTACTAACGGCGGTGGCTTCTTTAATGCCAACTCGTCGCATCCGTTTGAAAACCCAACCGCACTGACCAACTTCGTGCGATGCCAGCGTCTTCTTGATCCCAACGGCGCTGTGCTGCCTTTAATTTAGAAGTGATGGGCGACCGCCGCCAGGGCATGTTGCTGTGGGCGATGTCAGTGATTTTTGTCATCTGCGTAAGCGTGTTGATGTGGGCAGAAGTTCAGGGGTAATCCTCAATCTGCTGCTGGCACTGGGCACGGACAGCAGCATCAATATGGAAGGTAAAGAGAGCCGTTTCGGCGTGCTGGTCCAGTAAGCCTGTTTGCGGTCGTGACGACGGCGGCTTCCTGTGGCGCGGTGATTACGATGCATGATTCGTTTACACCGCTCTCGGTATGGTGCCGAATGTGGCTGATGCAAATTGGTGAAGTGGTGAATTCGGCGGTGTCGGTTCTGGTCTTTACGGCATGATGCTGTTTGTCCTGCTGGCGGTGATTTTAATGCCAGGCGGCTGAAGTAGTTAAGGTCCGTACCACCAGAATGTCTGGGTAAAAAATCGAGCCCGTACGCGAGATGCAACTGACTGCACTGGCAATTCTGGTTACCCCGACGCTGTGCTGATGGAAGCGCAAGCGCTAGCGTGATGACCGACGCCGGACCCGAAATCAGCGCCATGCTCAACCCTGGCCCGCATGGTTTTAGCGAAGTGCTGTACGCCGTATCATCCGCCGCTAACAACAACGGCAAGGTTAAACGCAGAAGCAGACGCCGTATCAGCACCAACAGAAGCAATACGTAACG
+>eaa48d4e-1945-4011-8bae-ded748af1fca
+TTGTTATGCTTCGTTCAGTTACGTATTGCTACTTGCCTGTCGTATCTTCGGCGTCTGCTTGGGAACTGTTTAACCTAGTCGGTCGCCAAGCGTTTCCCAGCGCCACCAACTGGCGGCGAACCGGGCGACCGAGAATAATCACCGAGGTGTATTCCGGGCATAACGCACTACACTTTTCTCTTCACTGGGATCAGAAAGTGTTGCCGTCTCGCGCCCAGTTCCTGCGCAAGACGCTAAGGCGCTGAGAATTACTTCGTTTTTCCGGTGGCGGTACAGGGCAGGGTTTAAGCATACACGTTGCAGGGCCTTTACCCAGCCGTGACGCAAACCGCGCCGCTGCGCGGACCAGTTTTTCATACCGGTGTTATAAGCGATGCATAAAGGGATCGCGTCGCGCGCGTGTACCACACTTTCTCTTCGCCAGGATGCCCCGCCAGTACGCATTTGCTCACCAACGCGATCGGCAGTACGGCGCAGTGCCAGTTCAGCGCAGGGCGATCAGATTACCTTTGGAAAAAAATGTTCAATGGCGCGCGCTCCGCCTGCCCGGCAATATAGACTTTGCCTTCTTTCGGCGCTGGCGCCGTCCATTCAGGCCGATCCGCCGGCACCACGTCGTCGGCGGCATCGAAAAAGGATCGGGCGGTTTTACGTACCTGAATTCCAGTGACGCCGCTGGGCCATCGTTAGACTCCAGATGCTGGAGCAGTTGACGGTAGTGAAAACATCAATGCCAGCTTCCAGCAGTTCTTCGATATCTGCCAGCGTTTGGGATGACGGGAACCTGGCGCATTACTGTGCGCCAGTTCGTCCCATTAAGATCAGCGCCGGAGCGGCGGCGAGGACGGCATCGAGATCAAACTCGCTGATATACGCCACGTTACGCCCAGCGTTTTAACGATAAGAACAGCCAACCCTTCCAGCATGGCGGCGGTATCTTTTTCGCCCGTGGTTTCTACCGCCAACCACAATATCCAGCCTTGCGCCCGCAGTCGCTGGGCTTCTGCCAGCATCGCCCAGGTCTTCCCGGCATACACCCACTTTTGTTTCAAGCTTTCAGCTTCCCCGATGCGGCGCGGCGGTTTGTTCCAGCAGACGAATCGGGGTCGGGACGTAAGGGTTCGTTATTCATCAGGTTGTCGCGCCGAATTGGGTTCAACAATGGCTGACCAACCGGCTGGCCGATATATTCCTGGCGGTTGTTGGCTGTATTTTGCGATCAGTTGCGTGAGCTGTTCAACTTCCGCTGAAGTTACGCGCTTTCACCACGCGTGGGATTTATAAGGCCGCCGCGCGGTGATATTATTCAGCCGCTTACTGCCGTGCGTCACCAGTTCAACCGGAACGCTCGCGCTGGCATCCGGGTTAGCGGCCCGTAATGCAGCAACGTACGGCTATTAGTTATCCAGCTCAGGATTTCGCCGCCAGATTGCTCCCGCCAAGCCTGTGGATTGCCGGGGCGTGCCGTTGCCGACGGGCGACCATGAAAATAGCCGTTGTAAATTCTGCAATTAATGCCGGAACACGCACCGTATCGCCTTCACGAATCAACGAACCATTGGCCTGGAAACCACCATTGCCCCAGTACGGTGGTCAGCAGCGAAATTAAGCGCGCCAGTAATCAAATAACAGAAGAAAGATAAATGTTGATAATACCGGACGTAATCCACTCATGGTGAAACCACTCACACCAGACCGCAAACGGTCAGCGGTAAAATCAATGACTTTGTTACCAAATAAACGGCACCAACGGCCCCACCCAGACCGTAAATCCGCCAGTTACGGCGCAACGCCAGCGAAGCGGTAAGCGGTTTCCTGCTTCCACGCCTTTTAACGCCAGAGAATCAAAGACGATATCCAAGGCGATTGAAAATCTACCGCTGAGGATTGCGGAGTCGGGCGGAATGCAGGCACGATGTTCAGCGCATTTAACTGCCGGATACGTTGCCGCGATGCCGCCGGAATAATGGCGAAGTATTTCCATACATCGTTGGCAATGCTGAAGGTCAGCGAGCCGGTCATCAGCATCTGTTTGCCAATGTGCACCACCTCGATCAGCTTGGTCCGGGTTAAGAGTCGAGATCGACCATAACGCCCTTACTCTTTCGCCGCCTGGGTGCGCCAGGTTCATCGCCACCGCGACATCTGCTACGCCAGCTGGGTATCGATTGGGGTGCCGTCGCCGGTCATCGCTACCAAACGACCTTCCGCCTGATACTTGACGGATCGAAATTGCCAGCGGCCTCCGGTGTCGCTTCGGCGAGAAAGTCATCGACACCGCTTCCGCAGCAATGCGCAGCGGCAGTCGAACGGTTATCGCCGGTAATCATCACTGTTTTAATGCCATTTTGCGCAGCTGGGCAGAAGCGCTCTTTAATACCGCCTTTGACGATATCTTTCCAGCGCAATAACGCCCAGCACGAGAACCTTCCACCACCACCAGCGAAAGTAAAACCACGACCGCGCAACCTGATCGACTTTTTTGATCAACATCGGTAGGGAAGTGACCACCGTTAGCCTCAACATGGCGACGAATGGCATCGACAGAACCTTTACGGATCATGCGATTTGTCGATGTGATCCCGCTCATCCGGCTTTGCGCAGTAAACGGTTACAAAGTGGCATGGAGCGACGCTGCACATCGCGCTCGCGCCTGGGTTAAACCTTTGTAGCGAGGATCACAATACAAAGCCTTCGGCGTTTCATCAGCCAGCAGAAGCCGGTTAGTACGGCGTCAATAACGTTTTCATCCACGCCTGCGCGTGATAAACTCCGACGCCTGACGGTTACCGGGTGTGATGGGCGCGGTTTATCCAGTGGCAGGGCAGTCAGCAAATCACCTGCCTTCAACTGCACGTCGCTGGTGGCAAATCCGCATTCGCCCTGGCATCCGGCTCATCCCGGCGACGCCGATCGCTGACAATGACCGCTTCAATGAGTGGTTCGGGATCAGACAGACCAGCGCCACCGAGTACCGTTACGCTGACTGCATTACCGCCCCACGCGGAAAACGGCCACAACGTGGCGGTTGCCAGTAAAAGACGATGATCAGGGCAATCAGCAGAATGGTCAGGGCAATTTCGTTCGGCGTTTTGCGTCGCTGTGCGCCTTCCACCATCGCGATCATCCGATCCAGAGGAAATGTCTCGCTTGGGGTTAACGCTACACTCAATCACCAGCCAGTCAGAAGAATGCGCGTACCGCCGGTGACGAGCAAAATCGCCAGATTCACGGATCCACCAGTGCCGATTCCCCGGTGATGGCGCTTTCATCGACCGATACCCCCTTCAATAACTTCACCATCGCGGGGATAATATCGCCAGCTTCTACCAGTACGATATCCTTGCCCACGAAGTTGGTCAGCAGGAACTTTGTCGCCGCAGCGCCATATTTCAAAGCACGCAGCTGCGGGCAAAGGCAGTTTTTCACCCCCTTTCAGACTGTTGGCCTGCGCTTTGCCTGCGGCCTTCTGCCAGCCTTATCGGCGAAATTAGCGAACAGTGCACGGTGATCACAGCCAACCGCTGTGGCCGCGCTAAACAGCATTGCCGGGCATCGCGCCACCGCTTGCCATCGCGATGATGCTAATACAGGTGATCAGCCAGACTGCCCGATCAGACGATAAACATCACCGGATTGCGCCATTGCGCCTGCGGGTTTAATTTTTCACCGCTTCTTCAGCGCCTGAACGATAAAGTGTTGGTTCGAATAAGCGCCAGTTGTTTACGGCTTCATATTCAGTGCTCACTCAATATCATCAGGAGATGTTCCGCCACCAGGACTGAAGCGCCAGGGCAGGATAAGGTCAGTGCGCCAACCAGCAACACGGTGCCGATTAACAGGCCAACAAACGGCGGGCCGTGCGTTGGCAGCGATGCCGGAGCTGGCGGCGGCTTGCTCTCACCAGCGGACCGGCAATTTACTTATCACCGGGATAATCACTTGAAGCGACCGACAAACATGCAGAACGCCGGTAAACGGTTCCAGAACGGAGAGTTGGCGCTTAATCCGGCAAGGCGCTGCCGTTGTTGTGCTTATTGATGACACGGCGTACAGCACTTCGCCAAAACCATGCGGGCCAGGGTTGAGCAGCGCTACGTCCGGCGTCGGTCATCATCTGTAACGCCGCGCCCATCAACTTCCAGCGTCAGGGGTAACCAGAATTGCCAGTGCAGTCAGTTTCATCTCGCGTACGTCCCGATTTTTTGCAGATATTCCGGTGTACGACCAATCATCAACGACGAAATAAATTTACCGCCAACCAGGACAAACAGCATCATGCCGTAAAGACCAGAACCGACACCGCCGAACACCACTTCACCAATTTGCATCAGCCACATCCGGCACCATGCCACCAGGCGGTAAAGCAGATCATGCATCGCAATCACCGCACCACAGAGGAAACGCCGTCGTCACGACCGCAAACAGGCTACTGACCAGCACCAAAACGGCTCTTTACCTTCCATATTGATGCTGCTGTCCGTGCCCAGTGCCAGCAGATGAGGATTACCCTGAACTTCTGCCCACATCACCACGCCTACGCAGATGACAAAATCGCTGACATCGCCCACAGCAACATGCGCCCCTGGCGCCGATCATATCCACTTCACCCAAAGGCAAAGCAGCGCCGTTGGGATCAAAGAAGATCGCCAGCATCTGCAGAAATTGGTCAGTGCCGTTGGGTTTTCAAACGGATGCGACGAGTTGGCATTAAAAGCCACCGCCGTTGTACCGAACATCTGATCGCTTCCTGAGAAGCTACAGGCCCCCATGGGTAACAGCTGTTGCGCTCCTTCAGCAGTATTCACAGCCTGATGGGCAGAAAGTTTTGCAGCGCACACCTTGTTGAATAAAAAACGGTGCAATCAACAACGCCGCAGGGACTAGCACCCATAACGTGATGCGTAGCAGATCGACCCAGGCATTCCAGGCGATGCTCATGCTCTGGCGGGTAAACGCACGGATGAGAGGCAAAATCACCGCAATCCGCTGGCGGCAGAAAGAAGGTTTGCACCGTTAAGCCCGCTTCATCTGGCTGAAATAGCTCAACGTGGTTTCACCGCTAAGATTGCAGTTGGTAGGTGACAAAGCTGACGGCGGTATTCAGCGCCAGATCCCACGACAGCCACAACTGACTGCTGTGGATTAAGCGGCGAATGGTGCTGACCGAGCAACATAAAACAGCACCGCCAGCTAGCATGTTCAGGCCGAGAATGGCACAAAGTGTTAGCTTCCAGTTCATCTCACGGTCAAGAGCGCCAAAGTGCGCGAAAAGTACGCGCTCAACGCCCGTTGTACCGGGAAGAGGAATGTCATTAATCAACCGCGCCAGCCCGCTGCCTAAAAGGACGCGCCAGCACCATTAACACCAGTAAAACGGCGTCGGTAAGAACCCTTGCGCAGCCATCAGAACGCCTCACGGTAGTCAGGGCATAAACCAGATAACCCGGTAATAAAACACCAGCAATACGCCGGTTATCACGCCTGCGCTCACAGTGCACCTCTAAATTCAAATCTGCGGGCGGGGTGTAAAAAGTATAAAAATGGCAAAAGCCATGATTTAACTAATGTTTGAAATATGATTTAACTTTGTGTAGCAATTACAGGATGAATGTAAATAAACCATCAATAAGCAAAATAAGTGGTCGGATGAGTAGTAAAATTACACAAAGGCGGTACTATTTTCATCAGATAAACAAATTCATTTTCGGTGCCATTCACCGGGTAGATACAAAAAGGGGGAAAAGTATGGAACTCTACAGAATATCCTGCATGGCTTATCTTTTACGCCGTACTTATGCGGTTTGCAGCGGGCGTTCTGGCGCTGCCTTTCATGCTTTTACTGGAAAGACCGCGCCCGCTTTGCAGCTACCTGCATCGCGTCTGGTCGAAAACCAGCGATAAACCGGTGGCAGATGGATCAGGCCGAAAAGGCAACTGGTGAATTTTTATTGATTGCTGATTTTGAATACATTGAAAGCCGCCAGCAAAACGCTGGCGGTTTTCTATCAGGAAGATGTTCAGAGGAATATTTAGACATCGTTATACCAATCGAAACATATATTCATGATATGTATAAATATTTTCCTAATTGTTCTTATCTGACGGTCATCTCACTTAAGGCTTTCTTATAAATCTGTAGGGTTTCACCGCCTGTCAGCAGACAAACTAACCCGATAAAACAAGGATGAGCAGATGAGCGGAAAACCGGCGGCGCGTCGGGGCGACATGACGCAGTATGGCGGTAACGTACCAGTTCCAGCCGGGGTACGCATCGGTACTTTACCGGCGTGGCCTGTTCGGTGTGCCCCGGCGAGTGTTGACGTCCGGCCATCGGTCAATCCGCTATGGTGCAAAGGTCCTTCCCGGTGAAACCGACATCGCCCTACGGCCCGCTGCCATTTCATTCTCTCCGCACCTACAGCGGTTACCGGACCAAAAACGCCCGCGCCGGTGGGAGCCTCGGCCCCGGCTGAAAATGCCTGCGGATATCCGCTTACAGCTGCGCGATAACACTGATACTCGAGTGATAACGGCGGCAGAAGCCTGTATTTTGAGCACTGTTTCCCGGTGAGGACAGTTGCAACCGCGGCGAGTCCACTGTGGCTGGTGCGCGGCAGCGTGGCGAGCGGATGAAGGTCACCCGGCTGGCCGCACTCTGGCAGGCGCTGCCGGAAGAACTCACGCTTAAGTCCGCATCGTTATCTGGCGACAAACAGTCCGCAGGGGCCGTGGTGGCTGCTCGGCTGTTGTGAGCAGGTGCCGGAAGCGGATGGTGCTGCCTGCGCCGCTGCCCGCCGTACCGGGTACTGACCGGGCTGGTGGACCGCTTCAGGCGCACACAGACGTTCCACCGCGAAGCCGCCAATTGAATTCAGCGAATCACCGGCATGACGGATGGTGCCGGGCGTCACTTCCGGCTGGTACTGACCACGCACCAGGCGCAGCGGGCAGAAGAAGCCCGGCAGCAGGCCATTTCGGCAGGACGGAACCGTCCACTTTCCTGATACCCTGCCGGTTACACCGAATATGGCCGGGACAACGGCATCCCGTCTGTCTGCCGTATTGGCTGACGCACGACCGGAATACCGGAGAATTTACCTGCCGCGCCGCGCTGGTGCGCTATGGCTGGACGCCCGCGGCGAACTGGCGGCGGTGTATGACGCAGCAATACACAGGTACGCAGCTTTACTTACGATGATAAATACGGGGCCGGATGGTGGCGCACCGTCACGGGCCGACCAATCTGTTACCATTACGGCAGCGACGGGCGGGTGACAGAACAAGCTAAACCCGGCAGGCTTAAGTTACGTATCGGTATGAGAAGGACCGCATCACCATCACCGACAGCCTGAACCGCCGTGAAGTCCTGCACACGCAGGGTGAAGGCGGGCTGAAGCGGGTGGTGAAAAGGAACACGCGGACGGCATCACGCAGAGTCAGTTTGTTGACGCGGTGGGCAGGCTCAGGAGGCACAGACGGATGCCGCAGGCAGGACCAACAGAATACAGTCCGGATGTGAGTGACGGGCCTCATCACGCGCATCACCACGCCGGATGGCAGGGCATCGGCGTTTTACTATAACCACCACAGCTTCAGTTAACGTCAGCCACCACCGGGCCTGACGGGCTGGAAATACGCCAGGAATATGATGAATGGGGCCGTCTGGTTCAGGGAAACTGCCCCTGACGGCGATATCGCCGCTACCGTTATGATAATCACACAGTGACTACCCTGCGCAACGGAAGATGCCACCGGCAACGAAAACCATGACGATGGAGCCGTTACGGTCGTTGCTGAGCTTCATACGGCTGTTCCGGGTTATCATGACCCGCTATGACCATGACCGTTTTGGTCAGGCAGTTACCACGAGGAAGGGCTGAATTAATTACCGCGTAGCCGTGGACGGATTAATTGCCGTGAAAGACACGCAGGGCCATGAAACGCGGTATGAATACAACGCCATGATGACCTGACCACCGTCATTGCCCCGGACGGCTTGGCAAAACGGGACACAGTACGTGCGTGGGGAAAAACCGTATACCCGCAAGGGCGGTCTGACGCGCAGTATGGAATACGATGATGCTGCCGGACGGTCCATCCGCCTGACCAGTGAAAACGGCAGCCACACCTTCCGTTACGATGTACTCGACCGGCTGATACAGGAAACCGGCACGGCGGCCGCACACAGCGATTATCCGCCCACGACCTGACCGGCAAACTTATCGCAGCGAGGATGAGGGGCTGGTCACCACTAACACTATGACGAAGCAGACCGCCTCACGCACCGCACACGTGAATGGCGAAACCGCAGAGCGGTGGCAGTATGACGAAGACGCGGCTGGCTGACAGACATCAGCCATATCAGCGAAAGGCACCGGTGACGGTGCACTATGGTTATGACAGTAAAGGCCGCCTCGCCAGTGGAAACACCTGACGGGTGCATCATCCCGCAGACGAATGGAACTGCTTAAGCGGCGCTGAGACCGAACTGTGCGTACAACGCAGGGACTGGCGAACCGCTGTATACGGACAACCTGCCCGCCGTGGAATGGCTGACCTACGGCAGCGGCTAGAAACATCAGGCATGAAACTCGGCGACACACCGCTGGTGGAGTACACGCGACCGCCTGCAGGAAACTGCGCAGCTTCGGCCGTTATGAACTCACCACCGCTTATACCCCCTGCCGGGCGGGTTACAGAGTAGCACCTGAACGGCCTGCTGTCTGACCGCGATTACACCTGGAACGACAACGGCGAACTCATCCCGCATCAGCGGCCGCGCCAGACCGGAGTTACAGCTTCACAGCACCACACCGGCAGGCTGACCGGCGTTCACACCACCGCAGCGAATCTGGATATCCATCCCGTATACCACAGACCCGGCAAGATGCCCTGCCGAAGCCAGAACTGCGCCCGGACAGCGCCCTCCATGTGGCCGGATAACCACCGTATCACCCGTGACGCGCACTATCTTTACCGGTATGATACCGTCACGGCGGGCTGACAGAAAACCGACCCTCATCCGGAAGGGTTATCCGCACGGATGTTGGCGCACCCACCGGTACCATTACGACAGTCAGCACCGGCTGGTACGCCACAGACACAATATGCAGAGCCGCTGGTCGAAGTCGCTATCTTTACGACCGCTGGGCCGCAGGGTAGCAAAACGAACATCGGCGGCGTAGACGGGACCTGACGGGCTGGATAATGCTGTCACGGAAACCGCAAAGTGACCTGGTACGGCTGGGACGGCGACGCCTGACCTGATACAGAACGACGGACCCGCATCAGACGATTTATCAGCCGGGGGAGCTTCACGCCACTCATCAGGGTTTGAAGCCGCCACCGGTGAGCTGGCGAAAACGCAGCGCCGCAACCTGGCGGATACCTTCCAGCAGTCCGGTGGTGAAGGCGGTGGCGGTATGTCGGTGTTCCCGCCGGTGCTGGTACCAGATGTCGCTCGACCGGCTGGAAGGAACGAAATCCTGGCTGACCAGATTGAGTGAGGGAAAGCCGCCGCTGGCTGGCATCGATGCGACTGACGGTGGCGCAGATGCAAAACCAGATGGACCGGTATACGCCGGCGCGAAAAATTCACCTGTACCACTGCGACCGCCGCGGCCTGCCGCACAAAGCCATATCAACTGGAAGGGACAACAACAGCGTGGTACGCAGAATACGATGAATGGGGTATTGCTGAATGAAGAGAACCCGCATCAGCTGCAGCAGCTATCCGCCTGCCGGGGCAGCAATTATGATGAGGAGTCCGGCATATTACCAGCCGCCACCGCTATTATAGGCCACTGCAGGGGGCGATATATCACTCAGGATCCGATTGGGCTGAAAGGGGATGGAATTTTTTATCAGTATCGACGAATCCGATCTCAAATATAGATCAATGGGATTAAATTCTAAAATGCATTAAGCCACCATTCCGTGGGCGGAACTGGTGAAAAGCGGTCCAGATATATGGGGGAATCCGTTCTATCGTCAATATCTTTGTGTCCCAGATGGTAAAGGGGACTATACTTGTAGGTGGCCGAAAGACCAACGGAAGGAGATGGTCTATAGGGGCCAGGTAAAGCAAGTAATGATACAAAGAAGCTAGGTTAAACACCCAAGCAGACGCCGCAATATCAAAAAAGA
+>95ff70e7-2b87-42d1-a957-21f9f276595c
+TTGGTAGCGCTACGTTTCAGTTACGTATTGCTACTTGCCTGTCGCTCTATCTTCGGCGTCTGCTTGGGTGTTTTAACCTGAGTGCCGGGCGTTTTCCATCAATTGCAATGACGTCTTTATCATTTGATGAATGGCAATCACGCATCCAGTTAATAAAGCACTCGTGAAATTTTGCAGGACTGATACAGGATACAACTCTGGCAATAATTATCGTGAACAGAATACCATTTTCAAAATCACCATATTGCTTCAGAAAATCGAGATGTGTTTCCCCGTCCTCTATATCTTCCCAACTTTCTGCACCAGAAATAACGGCAAAATAGTCAATAGTAGGATGCCTGACAATTTTGTCTCCTACCAGGCTTATCTGTAATCGGGAATAATAGAAATATGTTCCATCAATTTTTTAAGTTCATTTGTTCACCTTATTTATGTAAGGAGTATTTGATCATGTATAAGCTATGAAAAACAGCTTTAGGTAATAAGATATCTCAATTTTTAAACATAAAATGCGAATTATTTAGTACAAAATGGCGTTGCGTGATCTTTCCTGGGATACAACTCTGGCAATGGTATCGTGAACAGGGCCATTTTCAAAATCACCATATTGTACAAAATCGAGATGTGTTTCCCCGAAATCCTCTATATCTTCCAACCCTTCTGCAGAAATAGCAGCACAAATGATCCAACAGTAGAGATATCTGACCGTTTATGCACCGCACAGGCTTGTCTGTAATCAGATTAATAATGAAATATGTTCCATCAATTTTTTAAGTTCCATTTGTTCACCTTATTTATGTAAAGGGTATTTGATCATGTATAAGCTATGAAAAAACAGCTTTAGACAATAGTAATGTCTCAATTGTTGAACTTAAATTCGAATTATTTAGTACAAAAGTAGCGTTACGTGATCTTTCCTGCAAATGGAACGCAAAATAAACACCTATTCCATAGGTTATATAATTTTCACAATGATTAATTTGTTTTTCTCAGGAAGAGATTTTATTTCTCTTCACGAATTAGTTCTTGTATCTTTATTAAACATTCGTAAAGGCTCATTTTTGTTCGGGAGATGTGCTTGTCATTCGAGCATAAGTTGGTTTCTCATCTTTAAAATATTTTACCATGATTGGATTATCAAGGACTGCTTAACAACTGAACTGGATCACTGCTCTTTTGATAGATACCCGCTCTTATACTTCTAAACCGATCGCCGAGAAACGCCGTTTTTCTGCTGTATTTATCAACTCCTGCAACGTTCCTTTGATGGCATATTTCATTAAGGCGTAGTGACCCGACGCAGATTGAGTCTCGCCCCGCTTGGTGTGAATTTAGTATTTTACATGTGCAGTTCTGTTTGCCAATAATACTCACCGATGTCCTCATTCTGATACCATCTCATGGCTTTATTATTTAAGACAGAAACCTTGGAAAAAATAGTACCCATAGCGAAAATAGTAAAACAATCCATGATCTTTAAAGCTTGTATTTCGCAATCAGCTATAACACCAAAACTAACAAATATCATCAGCAAAAAGAACAAAGCTCTTTTTCATTTTCTTATTCCTCTCGATGTTCTCTCTGTTTCATCTTAGCTAAAATTTCACCCAAATCATCTATCCTGCCGTTGCTGGCCCATCGGGTTTATTAATGTCCTGGGGAATAAATAGGGTTCTGCACAAGTATATCCTGGTGAGCCAATTGAGTTGTTGGCCAATTTGTCTGTGGCAGGTATTGCCCTTGCTGTCTTTGTATCCATCCCTGGATACCAGGAATCATCCTGTGGCGTACAAGTCCAGATTTGGTTTTACCCACTTCCTGCAATACAGTGTGTGGTCATGGGGCTTAATGCTCTGAAGAATGTTTTGAAAACATTAGGCGCACTACTGGCCTGGTCAATAGGATGTAAGCGGTCTTAATTGTTTCGCTATGTCCGGCAATTTTACTTGGATCGAAGTAGGCGGTTTGTTTTGAGTCTCGCTCCGCCCATCCGCCATTATTTAAGTGTCCATATTTTGATGCCAGTCCCATTGAATCTATATACTGAACCGGATTCAGCGGATGCTGATAAATTCCATCCCCCTTCAGCCCAATCGGATCTGAGTGATATACCACCTCCCCTGCAGCGGGTCATAATGGCGGTGGCGGTTGCTATTACGGGCCGGACTCCTCGTCATGCTGCTGCCCCGGCGAATGGATAAGCTGCTGCAGCTGATGCGGTTCTCTTCATTCAGCAGGTTGCCCCATTCATCGTATTCCTGCGCACCATTCTGTTGCCCCTTCCGCTGACAAGCGCCAGCGGCTGAGCCGCGATGGTCGCAATTAGTACAGGTGGATTTTTCGCGCCGGCATTGTACACCGGGGTCCATCTGGTTTGCATCTCTCCACCGTCAGGCCGCACGATGCCAGCCAGCGGCAACTTTTCCTCCTCACCCGGTCAGCCAGGATTTCACTTTCCAGCCGGTCGAGCATCTGCACCAGCACCGGCAGACACCACGCCACCGCCTTCGCCGCCGGACTGCTGAAGGGTATCCGCCAGGCTGCGGCGCTGCGTTCGCCAGCTCACCGGTGGCGGTTTCAACCTGATAGTGGCGTGAAGCTCCCCGGCTGATAAATCGTCTGGATGCAGGTTCTGTCGTTCTGTATCGTGGTCAGGCGGTCGCCGTCCCAGCCGTACCAGGTCACTTGCGGTTTCGTGACAGCGACATCCAGCCCGTCAGGTCCCGTTCACGTCGCGCCACACCCGTTTGCCACCCTGCGGCCCAGCGGGTCGTAAAGATATCTTGGCTTTCGACCAGCGGCTCTGCATATTGTGTCCGCGTGTAATTACCAGCCGGTGCTGATGTCGTAATGTTACCGGTGGGTGCGCTCATCATCGAATGCGGATAACTGGCGGGATGAGTCGGTTTTCTCCGTCAGCCTGCCCAGTGACGGTCATACCGGTAAAGATAGTGCGCGTCACGGGCGATACGGTTATCCGGCCACATGCTGGGGTGCTGTCAGGTCTGGCTTCCGGGTCGGGCGAGCGGTTACCTGCCGGGTCTGTGGCATACGGGATATCCAATGCCCAGGTTACATATAATAATAAGAGCAATTAACCCAATTTATTTGTTTATAATGCGCTTATAGCCACAAACCACAGATATATACCCTCCTGACGAAGAAATAAAGCCATATTATTATCGCCATAATATACTTCTATCAATCCCTTGCATAATAATGTCTGATGCAGTCCTATAAATATTAGAGCAATAAAGAATACTTGTGCCTGTTGGAAAACGTACCATCATTCCATAAGACATGAGACCTAGTTAACTCATCACATCACGAGTGGAGTCTAATGGTGAAAGTCTATGCATGGAAAAGAATAGTATTAAAAGCGATAAAAGCCAATATAGCTCTGAATAAAAAAATAATATGTTCGTACATCCTCCGGTGAATACAAATCCTAATAAAACGATCCGATGTTATTTCCGGAGCACTTCATCTTACATGTTTCTAAAGAATCCCAAAGACCAGTCTTGGCAGTTTTAAATAGCCCTAAATTTATGGGTGTGAATATATCAGGCAATACAGAATAACGCGGCCTTACCTCTTTTAAACTTCCCTTTTAAACAGTTCTTACACAACTATTATCGGTTTCAACGAGGTCTGGCGGCCAGCAGCTTCTTTTGTATCATTACTTGCTACCTGGCCCCATAGACCATCTCCTTTTAGGTCTCCCCGTTGGTCTTGGCCACCACAGGTATAGTCCCTTTACCATCTGGGACACAAGATATTGATGATAGAACGGATTCCCCATATATCTGGACCGCTTCTTTCACCAGTTCCGCCCATTGAATGCAGTGGCTTAATGCATTTAGTGTTTCCTAATCTAATGGATCATATTTGAGATCGGATTCAACGGATACTGATAAAATTCCATCCCCCTTTCAGCCCAATCGGATCCTACCAGGTGATATATCGCCCCTGCAGCGGAGTCATAATAGCGGTGGCGGTTGTGACACAGGCCGGACTCCTCATCATACTGCTGCTGACGAATGGATAAGCTGCTGCAGCTGATGCGGGTTCTCTTCATTCAGCAGGTTACCCCATTCATCGTATTCTGCATACCACGCTGTTGTCCCTTCCGGTATGATAAGGGCCGGCGGCAGGCGCGATGGTCACGTGGTACAGGTAAGATTTTCAGCGCCAACGTGTATACCCGGGTCCATCTGGCTTTGCATCTGCGCCACCGTCGGGCCGCGTGCCAGCCAGCGGCAGCTTTCCTCACTCACCCGGTCAGCCAGGATTTCGCACCAGCCGGTCGAGCATCTGCACCAGCACCGGCGGAACACCCACACTGCCACCGTCTTCGCCCACCCCGGACTGCTGAAGGGGTATCCGCCGGGCTGCGGCGCTGCGTTTTTCGCCAGCTCACCGGTGAAAGCGGTTTCAACCCTGATGAGTGGCGTGAAGGCTCCCCGGCTGATAAATCCGTCTGGATGCGGGTTCTGTCGTTCTGTATCGTGGTCAGGCGGTCGCCGTCCCCAGCCGTACCAGGTCGCGGTTTCCGTGACAGCGGTATCCAGCCCGTCAGGTCCGTTCACGCCGCCATACCCGTTTGCCACCCTGCGGCCCGGCAGATCGTACCAAAGATAGCGACTTTCGACCAGCGGCTCTGCATATTGTGTCCGCGTGTAGTGCACCAGCCGGTGCTGACTATCGTAATGGTACCGGTGGGTGCGCTCATCATCCGTGCGGATAGCAGCGCTTCCGGGATAAGTCGGTTTCTCTGTCAACCTGCCGTGACGGTCATACCGGTAAAAGATAGTGCGCGTCACGGGCGATACACGGTTATCCGGCCACATGCTGAGGGCGCTGTCCGGTACAGCTCAGGTCGGAGCAGGCGGGTTACCTGCCGGGTCTGTGGCTTATACGGGATGCGGATATCAGATTCGCTGCGGTGGTGTGAACGCCGGTCAGCCTACCGGTAGTGCTGTAGCTGTAACTCCGGGTCTGGCGCGGGCTGCTGATGCGGATGAGTTCGCCGTTGTCGTTCAGGTGTAATCGCGGTCAGACAGCAGGCTGTTCGGGTGCTGGCTCTGTAACTGCCCGGCAGGGGGAGCATAAGCGGTGGTGAGTTCATAACGGCCGAAGCTGCGCAGCGTTTCAGTGCAGGCGGTCAGGTGTACTCCACCAGCGGTGTGTCGCCGAAGTTTCATGCCTGACAGCCAGCCGCTGCCGTAGGTCAGCCATTCCACGGCGGAGCAGGCTGTCCGGCCTCTGGCGGTTCGCCAGTCCCTGTGCGTTGTACGCATGTCTGGTCTCATGCTGCCAGAGCAGTTCATTCGTCTGCGGATGATGCACCGTCAGGTGTTCACTGGCAGGCGGCCTTTACTGTCATAACCATAGTGCACCGTCACCCGGTGCCCTTCAGCTGATATGGCTGATGTCTGTCAGCCAGCCGCGTTCGTCATACCGCCACCGCTCTGCGGTTTCGCCATTCACGGTGCGGTGCGTGAGGCGGTCTGCTTCGTCATAGTGCCGGTGGTGACCAGCCCCTCATCCTCACCGCTGCGGATAAGTTTGCCGGTCGGGTCGTGGTGTTGATAACGCTGTGTGCGGCCGTCAAAGCCGGTTTCCTGTATCAGCCGGTCAGGTACATCGTAACGGAAGGTGGTGTGGCTGCCGTTTTCACTGGTCAGGCAATTGGCCGTCCGGCAGCATCGTATTCCATACTGCGTCAGACCGCCCTGCGTGGTACCGAATGGCTTTCCCCGCATCGTACTGTGTCCCGTTTCTGCTGCCGTCCGGGGCAATGACGGTGGTCAGGTCACCGGCGGCGTTGTCATATACCGCGTTTCATGGCCCTGCGTGTCTTTCACGGCAATTAACTGTCCACGGCTGTCGTATGCGCGGTACTGACTCAGCCTTCCTCGCGAGGGTGCACCGCCGTCACCTGACAAAACGGTCATGGTCGCGGGTTATAACCGGAACAGTCAGGTAAAGCTCAGCAGCGGCGTAACGGCTCCACGTCATGGTTTTCCGGCTGCCGGTGGCATCTTCCGTTGCGCGGTGGGAGTCACTGTGTGGATTATCATAACTTGTTGGCAGGTGATATCGCCGTCAGGGGGCAGTTTCCTGAATCAGACGGCCCCATTCATCATGTTACGGCGTATTTCCAGCCCGTCCAGGCCGGTGGCTGACGTTAACTGGCTGTGGTGGTTATGAAGCAAAACGCCGATGCCTGCCATCCGGCGTGGTGATGCGCGTGATGGGCCGTCACCACATCGGACTGTATTGTTATGTCCTGCCTGCGGCATCCGTCATGCCCTATGAGCCTGCCCACCGCGTCAAACTGACTCTGCGTGACGCTGCCGTCCGCGTGTTCACTTTTCACCACCCGCTTCAGCCCGCCTTCACCCTGCGTGTGCAGGACTACACGGCGGTTCCAGGCTGTCGGTGATGGTGATGCGGTCCTTCTCATACTGATACACGTGTAACCGTACCGGGTTTAGCTGTTCTGTCACCCGCCCGTCGCTGTCGTAACGATGATTTCCGGTCGGCCCGATGTGACGGTGCGCCACCATCAGCCCCGGTATTTATCATCGTAAGTAAAGCTGCGCACCTGTGTATTGCTGCGGTCATACACCGCCGCCAGTTCATGCGGGGCGTCCAGCCATAGCGCACCAGCGGCGCGGCGATCAAATTCTCCGAACATTCCGGGTCGTGCGTCAGCCACGGCAGACAGACGGATGCCGTTGTCAGCCATATTCGGTGTAACCCGGCAGGGTATCAGGAAAAGCGGACGGTTCCGTCCCGCCGGAAATGGCCTGCTGCCGGGCTTCTTCTGCCCGCTGCGCCTGCGTGGTCAGTACCAGCCGGAAGTGACGCCCGGCACCATCCGTCACGCCGGTGATTTCGCCGCTGAATTCACCCGGCGGCTTCGCGGTGGAACGTCTGTATTGTGCGCCCGAAGCGGTCCACCAACCCGGTCAGTACCGGTACGGCGGCAGCGGCGCAGGGCAGCACCTCATCCGCTTCCGGCACCCGCTCACGCAGCCGAGCAGCCACCCACGGCTACGGACTGTTTGTCGCCAGATAACGATGCGGATAGCGGAGTTCTTCCGGCAGCGCCTGCCAGTGCGGCCAGCCGGTGACCTTCATCCAGTTCGCCACGCCGCGCGCACCAGCCACAGTGACTCGCTGCGGCTGTAACCGTCACCGGGAAACAGGTGCTCAAAATACGGGCTTCTGCCGCCGTTATCACCTGGTATCCGGTGTGTTATCGCGCAGCTGTAAGCGGATATCCGCAGGCATTTTCAGCCGGGGCCGAGGCTCCCCCACCGGCGCAGGCGTTTTGTCGGTAACTTCTGCTGTAGGTGCGGAGAGGAATGGTGGCAGCGGGCCGGGCAGGGCGATGTCGGTTTCACCGGGAGGACCTTTGCACCGAGCAGCGGATTGACCGGATGGCCGGACGTCACCCGCCGGGGGCACCGAACAGGCCACGCCGGTGCGGGGCACCGATGCGTACCCCGGCAGACCCTGGACAATGCTACCGCCATGCTGCGTCATGTCGCCCTGACGCGCCGCCGGTTTCGCTCATCTGCTCATCCTTGTTTTATCGGGTTATTTACGATGCCTTTGACGGGCGAGAACCCTGGATTTATAAGAAACTGGCAAATTGAGATATCTGTCAGATAAGAACAATTAGGAAAATATTTATATATATTTCCTTGAATATATGTTTCGATTGGTATAACGATGTCTAAATATTCCTCTGAACATCTTCCTGATACAAAAACCGCCAGCGTTTCCGCTGGCGGTTTTCAACTATTCAAACTCAGCAATCAATAAAAATCACCAGTTGCCTTTTCGTACGATCCATCCACACCGGTTTATCGCTGGTTTTCGACCAGACGCTGATGCAGGTAACAAAAGCGAACGCGGTCTTTCCGAAAGCATGAAAGGCAGCGCCAGAACGCCCGCTTTCGCCCGCATAATTACGGCGTAAAAAGATAAGCCATACAGGATATTCTCTGTAGAGTTCATATTTTCTCCCCTTTTTGTATCTACCCGGTGAATGGCACCGGAAAAATGGGTGTTTATCTGATGAAAATGGTACCGCCTTTTGTGAATTTTACTACTCATCCGACCACTTATTTTTTGCTTATTGATGGTTTGTTACATTCATCCTGTAATTAAGTTACACAAAAGTTAAATTAATACTAAACGTGGTTAAATCATGGCTTTTGCCATTTTTATACTTTTACACCCGCCCGCAGATTTTGCGAAATCTTTGCAGCAGAATTCTACCCTTCCGGTATCACTTTTAGGCCACTGGAGGTGCACTGTGAGTGCAGGCGTGATAACCGGCGTATTGCTGGTGTTTTATTACTGGGTTATCTGGTTTATGCCTGATCAATGCGGGCGTTCTGATGGCTGCGCAAGGGTTCTTTACTGATCGCCACGTTTTTACTGGTGTTAATGGTGCTGGCGCGTCCTTTGGGCAGCGGGCTGGCGCGGCTGATTAATGACATTCCTCTTCGGTACAACGGGCGTTGAGCGCGTACTTTTCGCGCATGGCGTCTCTGACCGTGAGATGAACTGGAAGCAATATCTTTATTGCCATTCTCAGCCTGAACATGCTGGGGCTGGCGGTGCTGTTTTATGTTGCTCGGTCGGCACTATCTGCCGCCAATCCACAGCAGTTGCCAGGGCTGTCGTGGGATCTGGCGCTGAATACCGCCAGCATCGGCTTTGTCACCAATACCAACTGGCAATCTTATAGCGGTGAAACCACGTTGAAGGCTATTTCCAGCCAGATGGCGGGCTTAACGGTGCAAAACTTTCTTTCTGCCGCCAGCAGGATTGCGGTGATTTTTGCCCTCATCCGTGCGTTTACCCGCCAGAGCATGAGCACGCTCGGGAATGCCTGGGTCGTCTGCTACGCATCGTTATGGGTGCTGGTCCCACGTGGCGTTGTTGATTGCACTGTTTTTATTCAACAAGGTGCGCTGCAAAACTTTCTGCCTTATCAGGCTGTGAATACCGTTGAAGGAGCGCAACGGCGCTGTGCCCATGGGGCCTGTGGCTTCTCAGGAAGCGATCAAGATGCTCGGTACTAACGGCGGTGAAGCTAGCTAATGCCAACTCGTCGCATCCGTTTGAAAACCAACCGCACTGACCAACTTCATTGCAGATGCTGGCGATCTTCTTGATCCCAACGGCGCTGTGCTTTGCCTTTGGTGAAGTGATGGGCGATCGCCGCAGGGGCACATCATTGCTTTAATGGGCGATGTCAGTGATTTTTGTCATCTGCGTAGGCGTGGTGATGTGGGCAGAAGTTCAGGGTAATCCTCATCTGCTGGCACTGGGCACGGACAACAGCATCAATATGGAAGGTAAAAGGCCGTTTCAGCGTGCTGGTCAATGCTTGTTTGCGGTCGTGACGACGGCGGCTTCCTGTGGCGCGGTGATTGCGATGCAGTTCGTTTACCGCTCTCAGTGGCATGTATGGTGCCGATGTGGCTGATGCAAATTGGTGAAGTGGTGTTCGCGGGGTATGGTTCTGGTCTTTGGCATGATGCTGTTTGTCCCTGCTGGCGGTGTTTATTGCCGGGCTGATGATTGGTCGTACCGGAATATCTGGGTAAAAATCGACGTACGAGATGAAACTGACTGCACTGGCAATTCTGGTTACCCGACGCTGGTGCTGATGGAAGGCGCGGCGTTAGCGATGATGACCGACGCCGGACGTAGCGCCATGCTCAACCCTAGCCCGCATGGTTTTGTGAAGTGCTGTACGCCGTGTCATCCGCCGCTAACAATAACGGCAGCGCGCTTTGCCGGATAAGCGCCAACTCTCCGTTCTGGAACTGTTTACTGGCGTTCTGCACATGTTTTGTCCGGTCGCTTCAGGGTGATTATCCCGGTGATGGCAATTGCCGGTTCGCTGATTGAGTAAAAAGAGCCAAGCCGCCAGCCGGCACGCTGCTGCTGCACGGCCCGCTGTTTTGTGGCCTGTTAATCGGCACCGTGTTGCTGGTTGGCGCATGACCTTTATCCCTGCCCTGGCGGTCCGGTGGCGGAATATCTCTCCTGATGATGACAGGTGAGCACTGAATATGAGTCGTAAAACAACTGGCGCTATTCGAAGACCAACACTTGTCGTTCAGGCGCTGAAGAAGCGGTAGAAAAATTAAACCCGCAGGCGCAGTAACAATCCGGTGATGTTTATCGTCTGGATCGGCAGTCTGCTGACCACCTGTATTAACATCGCGATGGCAAGCGGTGCGATGCCCGGCAATGCACGCTTTGTTTAGCGCGGCCATTATGGTTGGCTGTGGATCACCGTACTGTTCACGCTAATTTCGCCGAGGCGCTGGCAAGTTAAACACCCAAGCAGACGCCGAAGATAGGTAG
+>3ecfda3a-811b-4250-b282-811bffe581d5
+TTGTTGTACTTCGTTCAGTTGCGTATTGCTCTTGCCTGTCGCTCTATCTTCGGCGTCTGGCGGGTGTTTAGCCTTATTTCATACCGCGTTTCATGGCCCTGCGTGTCTTTCGGCAATTAGCTGTCCACGGCTGTCGTATGCGCGGTACTGAGCTCAGCCCTTCCTCGCGGTGCACCGCCGATCACCTGACCAAAACGGTCATGGTCATAGCGGAGTTACATAACCGGAACAGTCAGTGAAGCTCAGCAACTGGCCGTAACGGCTCCACGTCATGGTTTTTCCGGCTGCCGGTGGCATCTTCCGTTGCGCAGGGTAAGTCACTGTGGATTATCATAACGGTAGCGGGTGATATCGCCGTCAGGGGTGGTTTCCTGAATCAGACGGCCCCATTCATCATATTCCCGGCGTATTTCCAGCCCGTCAGGCCCGGTAAAGCTGACGTTAACTGGCTTCAATGGTGGTTATAGTAAACGCCGATGCCCTGCCATCCGGCGTGGTGATGCGCGTGATGAGGCCCGTCACCACATCCGGACTGTATTCTGTTGTCCTGCCTGCGGCATCCGTCTGTGCCCTGGGCCTGCCCACCCCGTCAAACTGACTCTGCGTGACGCTGCCGTCCGCGTGTTCCTTTTCACCACCCGCTGGCCCGCCTTCACCCTGCGTGTGCAGGACTTCACGGCAGTTCAGGCTGTCGGTGATGGTGATGCAGTCCTTCTCATACTGATACGTAATAACTTAAGCCTGCCGGGTTTTAGCTGTTCTGTCACCCCGCCCGTCGCTGTCGTAACGGTAACAGATTTCCGGTCGGCCCGTGTAATGATGCGCCACCATCCGGCCCCGGTATTTATCATCGTAAGTAAAGCTGCGCACCTTGTGTATTGCTGCGGTCATACACCGCTAACCAGTTCGCCATGAGGGCGTCCAGCCATAGCGCACCAGCGGCACGCGGCAGGTAGAAATTCTCCAGGTATTCCGGGTCGTTAGGCGTCAGCCACACGGCAGACAGACGGATGCCGTTGTCCCGGCCATATTCCGGTGCCAACCCGGCGGTATCAGGAAAAGCGGACAGTTCCGTCCCGCCGATAAGCCTGCTGCCGGGCTTCTTCTGCCCACTGCGCCTGCGTAGTCGAAGTACCAGCCGGAAGTGACGCGGCACCATCCAAATCACGCCGGTGGTTTCGCCGCTGAATTCACCGGCGGCGCGGTGGAACGTCTGTGTGCTTGAAGCGGTCACCAACCCGGTCAGTACCCGGTACGGCGGCAGCGGCGCAGGCAGCACCTCATCCGCTTCCCGTACCGCTCACACCAGCCGAGCAGCCTACGGCCCCTGCGCGGACTGTTTGTCGCCAGACGCGATGCGGACTTAAGCGGGTTCTTCCGGCAGCGCCTGCCAGAGTGCGCGGCCAGCCGGTGACGCTTCATCCAGTTTCTAGCCGCCGCGCGCAGCCACAGTGACTCGCTGCGGCTGTAACCGTCCTCACCGGAAACAGGTGCTCAAATACAGGCTTCCTGCCGCCGTTATAAGGTTAAACACCGGCAGACGCCGCAATAATGGCA
+>f58173f7-dbfb-4c47-92c1-0124626bf4c2
+TTGGTAGCACTTCGTTCAGTTACGTATTGCTACTTGCCTGTCGCTCTATCTTCGGCGTCTGCTTGGGTGTTTAACCTGAAAAATGATTTGTTTATCTGATGAAAATAGTGCCGCCTTTTGTGTAATTTTACTACTCATCCGACCCTTATTTTTGCTTATTGATGGTTTATTTACATTCATCCACCTTAATTAAGTTACACAAAAGTTAAATTAATACTAAACATTAGTTAAATCATGGCTTTTGCCATTTTTATACTTTTACACCCCGCCCGCAGATTTTGCAGAAATCTTTGCAGCCAGAATTCTACCCTTCCGGTATCCTTTTTAGGCCACTGGAGGTGCACTGTGGTGAGCGTGATAACCGGCGTATTGCTGGTGTTTTATTGCTGGGTTATCTGGTTTTATGCCCTGATCAATGCGGAGGCGTTCTGATGGCTGCGCAAGGTTCTTACTGATCGCCACGTTTTTACTGGTGTTAGTGCTGGCGCGTCCTTTGGGCAGCGGGCTGGCGCGGCTGATTAATGACATTCCTCTTCCCGGTACAACGGGCGTTGAGCGCGTACTTTTTCGCGCACTTGGCGTCTCTCTGACCGTGAGATGAACTGGAAGCAATATCTTTGTGCCATTCTCGGCCTAACATGCTGGGGCTGGCGGTGCTGTTTTTATGTTGCTCGGTCAGCACTGGCATCACCCTTCCATAATCCACAGCAGTTGCCAGGGCTGTCGTGGGATCTGGCGCTGAATACCGCCGTCAGCTTTGTCACCATACCAACTGGCAATCTTATAGCGGTGAAACCACGTTGAGCTATTTCAGCCAGATGGCGGGCTTAGCGGTGCAAAACTTTCTTTCTGCCGCCAGCGGGATTGCGGTGATTTTTGCCCTCATCCGTGCGATTTTACCCGCCAGAGCATGAGCACGCTCAGGAATGCCTGGAGTCGATCTGCTACGCATCACGTTATGGGTGTTGCTAGTCCCTGTGGCGTTGTTGATTGCACTGTTTTTATTCAACAAGGTGCGCTGCAAAACTTTCTGCCTTATCGAACCTTGAATACCGTTGAAGGAGCGCAGCAGCTGTTACCCATGGAACCTGTGGCTTCTCAGGAAACGATCAAGATGTCGGTACTAACGGCGGTGGCTTCTTTAATGCCAGCTCGTCGCATCCGTTTGAAAACCCAACCGCGCGGTAACTTGTTGCAGATGCTGGCGATCTTCTTGATCCCAACGGCGCTGTGCTTTACCGCTGGTGAAGTGATGGGCGATCGCCGCCAGGGGCGCATGTTGCACAATGGGCGATGTCAGTGATTTTGTCTCTGCGTAGGCGCGTGGTGATGTGGGCGAAGTTCAGGGTAATCCTCATCTGCTGGCACTGGGCACGGACAGCAGCATCAATATGGAAGAATTAAAGAGAGCCGTTTCGGCGTGTGCTGGTCAGTAACCTGTTTGCGGTCGTGACGACGGCGGCTTCCTGTGGCACCCGGTGATTGCGATGCATGATTCGTTTACCGCTCTCGAGTGGCATGGTGCCGATAATGGCTGATGCAAATTGGTGAAGTGGTGTTCGGCGGTGTCGGTTCTGAAGTCTTTACGGCATGATGCTGTTTGTCCTGCTGGCGGTGTTGTGCCGGGCTGATGATTGGTCGTACCGGAATATCGGGTAAAAATCCGACGTACGCGAGATGAAACTGACTGCGCTGGCAATTCTGGTTACCCCGACGCTGGTGCTGATGGGCGCGGCGTTGGCGATGATGACCGACGCCGGACTGGCGCCATGCTCAACCCTGGCCCACATGGTTTAGCGAAGTGCTGTACGCCGTGTCATCCGCCGCTAACAACAACGGCAGCGCCTTTGCCGGATTAAGCGCCAACTCTCCGTTCTGGAACTGTTTACTGGCGTTCACCATGTTTGTCGGTCGCTTCGGGGTGATTATCCCGGTGATGGCAGTGCCGGTTCTGGTGAGTAAAAGAGCCAAGCCGCCAGCTCCGGCGCTGCTGTACGGCCCGCTGTTTGTTGGCCTGTTAATCGGCACCGTGTTGCTGGTTGGCGCACTGACCTTTATCCCTGCCCTGGCGCTTGGTCGGTGTGGAATATCTCTCCTGATGATATTGGTGAGCACTGAATGTAGTCGTAAACAACTGGCGCTATTCCAGGCCAACACTTGTCGTTCGGGCGCTGAAAGAAGCTGATGAAAAAATTAAACCCGCAGGCGCAATGGCGCGATCCGGTGATGTTTATCGTCTGGGATCGGCAGTCTGCTGACCACCTGTATTAGCAGCATCGCGATGGCAAGCGGTGCGATGCCCGACAATGCGCTGTTTTAGCGCGGCCATTAACGGTTGGCTGTGGATCACCATTGCTGTTCGCTAATTTCGCCGAGGCGCTAAGCCAGAAGGCCGCAGTAAAGCGCAGGCCAACAGTCTGAAGGGGTAAAAACTGCGCTTGCCCGCAAGCTGCGTGAGCCGAAATATGGCGCTGCGGCGGACAAAGTTCCTGCCGACTCCAACTTCGTAAAGGCGATATCGTACTGGTAGAAGCTGGCGATATTATCCCCTGCGATGGTGAAGTTATTGAAGGGTGCATCGGTCGATGAAAGCGCCATCACCGGGGAATCGGCACCGATGATCCGTGATCCGGCGATTTTGCCTCGTCACCGGCGGCACGCGTATTCTTTCTGACTGGCTGGTGATTGAGTGTAGCGTTAACCCCGGCGAGACATTTCTGGATCGGATGATCGCGATGGTGGAAGGCGCACAGCGACGCAAAACGCCGAGCAAAATTGCCCTGACCATTCCTGCTGATTGCCCTGACTATCGTCTTTTTACTGGCAACCGCCACGCTGGCAGCCGTTTTCGCGTGGGGCGGTAATGCAGTCAGCGTAACGGTACTGGTGGCATGTTGGTCTGTCTGATCCCAACCACTATTGGCGGCCTGTTGTCGGCGATCGGCGTCGCCGGGATGAGCCGGATGCTGAGCGCGAATGTGATTGCCACCAGCGGACGTGCGAAGTTGAAGCGGCAGGTGACGTTGACGTTCTGCTACTGGATAAAACCGTACCATCACACTCGGTAACCCGTCGGGCGTCGAGTTTATCCCCGCGCAGGGGCGTGGATGAAAAACGCTGGCTGACGCCGCACAACTGGCTTCGCTGGCTGATGAAACGCCGGAAGATACGGTATTGTGATCCTCGTAAACGGCGTTTAACCTGCGCGAGCGCGATGTACGATATCCATGCCACCTTTGTACCGTTTACTGCGCAAAGCCGGATGAGCGGGATCAGCATCGACAACCGCATGATCCGTAAAGGTTCTGTCGATGCCATTCGTCGCCATGTTGAGGCTAACGGTGGTCACTTCCTACCGATGTTGATCAAAAGTCGATCCCGGGTTGCGCGTCAGGAGCCGCCGCTGGTGGTGGTGAGTTCTCGTGTTAGCTGGGCGTTATTGCGCTGAAGATGTCGTCAAGGCGGTATTAAAGAGCGCTTCGCCCAGCTGCAAAATAGGCATTAAAACAGTGATGATTACCGGCGATAACCGTCTGACTTGCCGCCGCGATTGCTGCGGAAGCGGGTGTCGATGATTTTCTCGCCGAAGCGACACCGGGGCCAAGCTGGCATTGATCCATCCCAGTATCAGGCGGAAGGTCGTTTTGGTAGCGATGACCGGCGACGGCACCAACGATGCTCGGCGCTGGCGCAGGCGAATGTCGCGGTGGCGATGGGCGCTCCGGCGCGCAGGCGGCGAAGAAGGCGGGCAATATGGTCGATCTCGACTCTAGCCCGACCAAGTTGATCGAGGTGGTGCACATTGGCAAACAGATGCTGATGACCCGTGGCTCGCTGACCACCTTCAGCGTACCAACTTGATGTGGCAGGAAATACTTCGCCGGTATTCCGGCGGCATTCGCGGCAACGCTGTCCGCAGTTAAATGCGCTGAACATCATGTTATTGCTGCATTCGCCCGACTCCCGCAATCCTCGGTGCGGTGATTTTCAACGCCTTGATTATCGTCTTTTGACCAGTTCCCCTGGCGTTAAAGGCGTGAGTTATAAACCGCTTACCGCTTCTGCCATGTTGCGCCATGTATGGATTTACGGTCTGGGTGGGCTGCTGGTGCGTTTATCGGTATCAAAGTCATTGATTTACTGCTGACCGTTTGCGGTCTGGTGTGAGTTTACCATGAGTGGATTACGTCCGGCATTATCAGCATTTATCTTTCTGTTATTGATTACTGGCGGCGTTTGCCGCTGCTGACCACCGTACTGGAGCAATGGTGGTTTCCCTGGCAGGCCAATGGTTCGTTGATTCGTAGAAGGTGATACGGTGCGCGGTTCGGCGTAATCGGGCGGAATTTTACCGGCAGCTGTTTTCATGGTCGCCCGTCGGCAACAGCAGAAATACCTATAATCCACAGGCTTCTGGCGGGGAGCAATCTGGCAGTCAGTAACCTGAGCTGGATAAACTAATAGCCGCACGCATTGCTGCATTACGGGCCGCTTCGCCCGGATGCCAGCGTGAGCGTTCAGTTGAACTGGTGACGGCATCGGCAAGCGGGCTGGACAATAATATCACCCGCAAGCGGCGGCCTGGCAAATCCACGCGTGGCGAAAGCGCGTAATCTCAGCGTTAGACAGCTCACGCAACTGATCATAAATACAGCCAACAACCGCCGGTGAAATATATCGGCCAGCCGGTTTGTCAACATTGTTAGTCAATCTGGCGCTGGATAAACTTGATGAATAACGAACCCTTACGTCCCCGACCCGATCTGCTGGAACAAACCGCCACCGCGCCCGCATCGGGAAGCTGAAAAGTTTCTTCGGTGCCTGTGCAGGCGTCAGGAAGACCTGGGCGATGCTGGCAGAAGCCCAGCGACTGCAAAGGGCTGAATATTGTGGTTGGCGTGGTAGAAACCCACGGGCGAAAGATACCGCCGCCATGGAAGGGCTGGCTGTTCTGCCGTTGAAACGCCAGGCGTACCGTGGGCGGCATATCAGCGAGTTTGATCTCGATGCCGCCCTCGCCCACTCGCCAGCGCTGATCTTAATGGGCGAACTGGCGCACAATGTACGCCAGGTTGCATCCCAAACGCTGGCAGGATATCGAAGAACTGCTGGAAGCTGGCATTGATGTTTCACTACCGTCAACGTTCCCGGCAGCATCTGGAAGATCACGAATGATGTGGTCAGCGGCGTCACCGGAATTCAGGTACGAGGAAACCGTGCCCGATCCTTTTCGATGCCGCCGACGACGTGGTGCTGGTGGACTTGCCCCGGACGATCTGCGCCAGCGGCTGAAGAAGGCAAAGTCTATATTGCCGGGCAGGCGGAGCGCGCCATTAGACATTTTTCCGCAAAGGTAATCTGATCGCCCTGCGCGAGCTGGCACTGCGCCGTACTGCCGATCGCGTTGATGAGCAAATGCGCGCCTGGCGGGGCATCCTGGCGAAGAAAGTGTAGCACGCGCGACGCGATCGCTTTATGCATCGGCCATAACACCGGCAGCGAAAACTGGTCCGCGCAGCTTCGCGGCCTGGCGTCGGCTGGGTAGCGTCTGGCACGCGGTGTATGTTGAAAACCCTGCCCTGCACCGCTTACCGGAAAAAACGTCCGGGCAATTCTCAGCGCCTTACGTCTGGCGCAGGAACTGGGCGCGGGGCAGCAGCACTTTCTGATCCAGCGGAAAGCGGTAGTGCGTTATGCCCGTAGACATAATCTCGGCAAGATTATTCTCGGTCGCCCGGCCTCGCGCCGCTGGTGGCGTCGGGAAACGTTTGCTGACCGACTGGCGCGCATCGCCTGATCTCGATCAGGTGCTGGTAAGCGCTTGATGGATCACCACGCCCGCACGTTAACAACGCGCCGGATAACCGCTCTTTTAAAGACAAGTGGCGTGTACTAATTCAGGGATGCGTGGTTGCCGCCGCGTTATGCGCCGTTATCACCTTAATTGCCATGCAGTGGCTGATGGCGTTTGATGCCGCCAACCTGGTGATGCTGTATCTGCTTGGCGTGGTGGTGGTGGCGCTATTTTATGAACTGGCCTTCGGTGGTTGCCACCGTCATTAATGTGAAGTGAGTTTCGATCTCTTTTTTATCGCCCACGCGGCACGCTCGCCGTCTCGATGTGCAATATCCTGCTGACCTTCGCGGTGATGTTAACCGTCGGGCTGGTGATCAGAACCTTACTGCTGGCGTGATTATCAGGCGCGGGTAGCCCGTTACCGCGAGCAACGCACGGCACTTATATGAAATGTCAGCTCTGGCGGTGGGCCCGCAGTCCGCGAGATATCGCTGCCACCAGCGAACAATTTATTGCCTCCACGTTTCATACCCGCAGTCAGGTGTTGTTGCCGATGACAACGGTAAATTGCAGCCGTTAACACATCCGCAAGGAATGAGCGCGTGGGACGGTACCATCGCGCAGTGGGTTTGATAAAGGCCTGCCTGCGGGCGCGAACTTTCGACACGTTACGGTGTGCCATGCAGATTTTGCCGTAAAAGCGGCGGAAAACCACGGGCTGGTGGTGGTGGAGCCGGGAATCTGCGCCAGTTGATGATCGGAACAGCAGCGCCTGCTGGAGACGTTACGCTGTTAGTCGCCAATGCCCATGAGCGGCTGACGCTAACCGCAACGAAAAAGAACAGGCGCGGATGGCAAAGCGAACGTGAACAGATCCCGCAACGCCTGCTAGCGGCGCTTTCGCATAATTTACGCACGCCGCTTACGGTGCTGTTTTGGTCAGGCAGAAATCTTAACGCTCGATCTGGCAAGCGAGGATCACCCCGCCCGCCAGGCCAGCGAGATCCGTCAGCATGTGCTGAACACTACCCGACTGGTGAATAATCTACTGGATATGGCGCGCGAATTCAGTCCGGCGGCTTTAATTTGAAGAAAGTGGTTAACGCTGGAAGAAGTAGTCGGCAGCGCTGCAAATCTGGAACCGGGTTTATCGTCGCCTCAATCTTTCTCTGCCAGAACCGCTGACCTTAATCCCGTTGACGGGCCTCTTTGAACGGGTGCTGATTAATCTGCTGGAACGCGGTGAAATATGCGGGTGCGCGGGCCGAAATTGGTATCGATGCCCACGTTGAGGCGAAAATCTACAACTGGATGTCTGGGATAGCAGGCCCCGGTCTTCCGCCAGGCCAGGAGCGAACGATATTTGATAAGTTTGCTCTCGCGAAGTAAAAGAGTCGGCAGTACCGGGGGTAGAGGGCTTGGACTGGCAATTTGTCGGGCGATAGTGGATGTACACGGGGCACTATTACGCGTTCGACCGACCGGAAGGTGGTGCCTGTTTTCGTGTTACTTCCCCAGCAAACTGCCCCTGAACGGAAGAATTTCATGAGGATATGTGACAAACGTTCTGATTGTTGAAGATGAACAGGCTATTCGTCGCTTTCTGCGCACAGGTTAAACACCCAAGCAGACGCCGAAGATAGAGCGACGAGCAGAGCAATGCTT
+>745b1774-6cd3-42d6-b574-a26fb2065d9c
+TTGGTAATGCTTCGTTCCAGTTACGTATTGCTCTTGCCTGTCGCTCTATCTTCAGCGTCTGGCAGGTGTTTAACCTCTGCGCGGGGTAAACTCCGACGCCTGATTTACCGAGTGTGATGGTGCCGGTTTTATCCAGTAGCAGAATCAGCGTCACCTGCCGCTTCAACTGCACGTCCGCTGGTGGCAATCACATTCGCGCGCCTGGCATCTGGCTCTCCGGCGACGCCGATCGCTGGCAACAGGCCGCCAATAGTGGTTGAAGTCAGACAGACCAGCAACGCCACCAGTACCGTTACGCTGACTGCATTACCTTACGCGGAAAACGGCCACAGCGTGGCGGTTATAATCAAAAGGCGATAGTCAGGGCAATCAGCAAATGGTCAGGGCAATTTCGTTTCGAAGCGTTTTGCGTCGCTAATTGCGCCTTCCACCATCGCGATCATCCGATCAGAAATGCTCGCCGGGGTTAACGCTACACTCAATCACCAGCCAGTCAAGAAAGAATACGCGTGCCCGCCGGTTACGGCGGAAGTAAAATCGCCGCCGGATTCACGGTTCTACCGGTGCCGATTCCCCGGTGATGGCGCTCATCGACCGATGCACCTTTAATAACTTCACCATCGCGGGATAATATCGCCAGCTTCTACCAGTACAATCACCTTTACGAAGTTGGTCGGCAGGAACTTTGTCCGCCGCAGCATATTTCGGCTCCACGCAGCTTGCGGGCAAAGGCAGTTTTTCACCCTTTCAGACTGTTGGCCTGCGCTTTACTGCGGCCTTCTGCCAGCGCCTCGGCGAAATTAGCGAACAGTACGGTGATCACAGCCAATACGCTAATGGCCGCGCTAAACCAGCGCATTACCGGGCATCGCACCCGCTTGCCATCGCGATGCTAATACAGGTGGTCAGCAGACTGCCGATCAGACGATAAACATCACCCGGATTGCGCCATTTGCGCCTGCGGGTTTAATTTTTCACCGCTTCTTTCTCGGCGCCTGAACGACAAGTGTTGGTTCGAATAGCGCCAGTTGTTTACGGCTCATATTCGAGTGCTCCTCCAATATCATCAGGAGATATTCCGCCGCTGCCGGACCAAAGCGCCAGAACGAGGATAAAGGTCAGTGCGCCAACCAGCAACACGGTGCCGATTAACAGGCCAACAAACAGCGGGCCGTGCGTTGGCGGCAGCGTGCCGGAACTGGCGGCTTGGCTCTTTTACTCACCAGCGAACCGGCAATTACCATCACCGGGATAATAATAATCACCCCGAAGCGACCGACGACAAACATGCAGAACGCCAGTAAACAGTTCCAGAACGGAGAGTTGGCGCTTAATCCGGCAGAGCGCTGCCGTTGTTAGCGGCGGATGACGGCGTACAGCACTTCGCTAAAACCATACGGTGGGGTTGAGCATGGCGCTACGGCGTCGGTCATCATCGCCAACGCCGCGCCATCAGCACCAGCGTCAGGGTAACCAAGTGCCAGTTGGTCAGTTTCATCTCTCGCGTACGTCGATTTTTACAGATATTCCGGTGTACGACCAATCATCAGCCCGGCAATAGAAAAACACCGCCAGCAGGACAAACAGCATCATGCCGTAAAGACCAGAACCGACACCGCCGAACACCACTTCGCCAATTTGCATCAGCCACATCGGCACCATGCCACCGAGGCGATAAAGCAGATCCATGCATCGCAATCACCGCGCCACAGGAAATACCGTCGTCACGACCGCAAACAGGCTACTGACCAGCACGCCGAAACGGCTCTCTTTACCTTCCATATTATTGATGCTGCTGTCCGTGCTAGTGCCAGCAGATGAGGATTACCTGAACTTCTGCTTACATCACCACGCCTACGCAGATGACAAAAATCACTGACATCGCCCACAGCAACATGCGCCCTGGCGTGATCGCCCACATCACTTCACCAAAGGCAAAGCGCAGCGCCGTTGCCCGGATCAAGAAGATCGCATCTCTGCACGAAGTTGGTCAGTGCGGTTGGGTTTTTCAAACGGATTCACGACGAGTTGGCGATAAAAAGAAGCCACCGCCGTTAGTACCGAGCATCTTGATTTGCTTCTGAGGCTTCTGAGCCCCATGGGTAACGGCTGTTGCGCTCCTTCAGCGGTATTCACAGCCCGATAAGGCAGAAGTTTGCAGCGCACTGTGTTGAATAAAACAGTGCAATCAACAACGCCACAGGGATAGCACCCATAATAACGTGATGCGTAACCTTGCCGATCGACCCAGGCATTCCCGAGCGTGCTCATGCTCTGGCGGGTAAACGCACGGATGGGGCAAAAATCACCGCAATCCCGCTGGCGGCAGAAGAAAGTTTTGCACCGTTAAGCCCGCCATCTGGCTGGAAATGGCTCAACGTGGTTTCACCGCTATAAGATTGCCGGATTAATTGTGGTGACAAAGCTGACGGCGGTATTCGCGCCAGATCCCACGACAGCCCTGGCAACTGCTGTGTGGATTAAGCGGCAGATGGTGCTGACCGAGCAACGCAAAACAGCACCGCCAGCCCCAGCATGTTTCGAATACATGTGGCACAAGATATTTAGCTTCCAGTTCATCTCACGGTCAGAGACGCCAGAGTGCGCGAAAAGTACGCGCTCAACGCCCGTGTACCGGGAAGAGGAATGTCATTAATCAATGCGCCAGCCCGCTGCCCTAAAAGGACGCGCCAGCACCATTAACGGGTTAAACACCCAAGCAGACGCCGCAATCAACGTAG
+>6a470b8f-d316-4d8c-b93f-ea7bd154775d
+ATGTTGTACTTCGTTCAGTTACGTATTGCTACTTGCCTGTCGCTCTATCTTCGGCGTCTGCTTGGGTGTTTAACCTCCGCCAAGAACATGAGCACGCTCCGCGCGAGAATGCCTGGGTCGATCTGCTACGCATCACGTTATGGGTGCTAGTCCCACCAGCGTTGATTGATTACTGTTTTTTATTCAACAAGGTGCGCGCAAAACTTTCTGCCTTATCAGGCTGTGAATACCGTTGAAAGGCGCAACAGCTGTTATTACCCATGGGGCCTGTAGCTTCTCAGGGAAGCGATCAAGATGCTCGTACTAACGGCGGTGCTTCTTTAATGCCAACTCGTCGCATCCGTTTGAAAACCAACCGCACTGACCAACTTCGTGCCAGATGCTGGCGATCTTCTTGATCCCAACGGCGCTGTGCTTTGCCTTTGGTGAAGTGATGGGCGATCACCGCCAGGGGCACTTGTATTTGCTAATGGGCGATGTCAGTGATTTTTGTCATCTGCGTAGGCGTGGTGATGTGGGCAGAAGTTCGGTGTCCTCATCTGCTGGCACTGGGCACGGACAGCAGCATCAATATAGGTAAAGGCCGTTTCGGCGTGCTGGTCAGTAGCCTGTTTGCGGTCGTGACGACGGCGGCTTCTGTGGCGCGGTGATTGCGATGCATGATTCGTTTACCGCTCTCAGGTGGCATGGTGCCGATGTGGCTGATGCAAATTGGTGATTGATGGTGTTCCGGCGGTGTCGGTTCTGGTCTTTGGCATGATGCTGTTTGTCCTGCTGGCGGTGTTTGTGCCGGGCTGATGATTGGTCGTACACCGGAATATCTGGGTAAAAAATCGACGTACGCGAGATGAAACTGACTGCACTGGCAGTTCTGGTTACCCCGACGCTGGTGCTGATGGGCGCGGCGTTGGCGATGACCGACGCCGGACGTGGCACTCATGTCAACCCTGGCCGCATGGTTTTGGCGAAGTGCTGTACGCCGTGTCATCCGCCATAACAACAGCAGCAGCGCCTTTGCCGGATTAAGCATATCTCCGTTCTAAGGAACTGTTTACTGGCGTTCTGCATGTTTGTCGGTCGCTTCAGGTGATTATCCCGGTGATGGCAGTGCCGGTTCGCTGGTGAGTAAAAGGCCAAGCCGCCAGCTCCGGCGCTGCCAACGCACGGCCGCTGTTTGTTGGCCTGTTAATCGGCACCGTGTTGCTGGTTGGCGCACTGACCTTTATCCCTGCCCTGGCGCTTGGTCGGTGGCGGAATATTTATCTCTCCTGATGATATTGAGTGAGCACTGGATATGAGTCGTAAACAACTGGCTATTCGAACCAACACTTGTCGTTCAGGCGCTGAAAAGAAGCGGTGAAAAATTAAACCCGCAGGCGCAATGGCGCAATCCGGTGATGTTTATCGTCTGGATCGGCAGTCTGCTGACCACCTGTATTAGCATCGCGATGGCAAGCGGTGCGATGCCCGGCACAATGCGCTGTTTAGCGCGGCCATTAGCGGTTGGCTGTGGATCACCGTACTGGCCGCTAATAATTTCGCCGAGGCGCTGGCGAAGGCCGCAGTAAAAGCGCAGGCCAACAGTCTGAAGGGGTGAAAAACTGCCTTTGCCCGCAAGCTGCGTGAGCCCGATATGGCGCTGCGGCGGACATTCCTGCCGACCAATACGTAAAAAGGCGATATCGTACTGGTAAGCTGGCGATATTATCCCCTGCGATGGTGGTTAGTGAAGGGGTGCATCGGTCGATGAAAGCGCCATCACCGGAATCGGCACCGGTGATCCGTGAATCCGGCGGCGATTTTGCCTCCGTCACCGGCGGCACGCGTATTCTTTCTGACTGGCTGTTGATTGAGTGTAGCGTTATTGGCGGCGAGGCATTTCTGGATCGGATGATCGCGATGGTGGAAGGCGCACAGCGACGCAAAACGCCGAACAGAAATTGCCTGACCATTCTGCTGATTGCCCTGACTATCGTCTTTTACTGGCAACCGCCACGTAGCCGTTTTCGCGTGGGGCGGTAATGCAGTCAGCGTAACGGTACTAGTGGCGCTGCTGGTCTGTCTGATCCCAACCACACTATTGGCGGCCTGTTGTCGGCGATCGGCGTCGCCGGGATGAACCGGATGCTGAGCGCGCGAATGTGATTGCCACCAGCGGACGTGCAGTTGAAGCGGCAGGTGACGTTGTTCTGCTACTGGATAAAACCGTACCATCACACTCCGGTAACCGTCAGGCGTCAATTTATCCCCGCGCAGGGCGTGGATGAAAAACGCTGGCTGACGCCGCACAACTGGCTTCGCTGGCTGATGAAACACCGGAAGGCCGCAGTATTGGCGATCCTCGCCAAGCAGCGTTTAACCTGCATAGCGCGATGTGCAGTCGCTCCATGCCACCTTTGTACCGTTGCGCAAAGCCGGATAAACGGGATCAACATCGGCAACCGCATGATCCGTAAAGGTTCTGTCGATGCCATTCGTCGCCATGTTGAGAGGCTAACGGTGGTCACTTCCTACCGATGTTGATCAAAAGCCGATCAGGTTGCGCATTAAAGGAGCCACGCCGCTGGTGGTGGTGGAAGGTTCTCGTGTGCTGGGCGTTATTGCGCTGAAGATATCGTCAAAGGCGGTATTAAAGAGAGCGCTTCATAGCTGCGCAAAATGGGCATTAAACGGTGATGATTACCGGCGATAGCCGTCTGACTGCCGCCGCGATTGCTGCGGAAGCGGGTGTCGATGATTTTCTCGCCGAAGAAGCGACACGGAGTAAGCTGGCGATGATCCGTCAGTATCAGGCGGAAGGTCGTTTGGTAGCGATGACCGGCGACGGCACCAACGATGCTCCGGCACTGGCGCAGGCGAATCGCAGTGGCGATGAACTCCGGCGCAGGCGGCGAAAGGCGGGCAATATGGTCGATCTCGACTCTAACCCGACCAAGTTGATCGGTGGTGCACATTGGCAAACAGATGCTGATGACCGTGGCTCATGACCACCTTCAGCGTACTGTGGCAGAAATACTTCGCCATTATTCGGCGGCATTCGCGGCAACGTATCCGCAGTTAATGCATACAGACATCATGTGCCTGCATTCGCCCGACTCCGCAAATCACTCGGGTGCGGTGATTTTCCAGCTTTGTGATTATCGTCTTTTTGATTCCCTGGCGTTAAAAGGCGTGAGTTATAAACCGCTTACCGCTTCTGCCATATTTGCGCCGTAACCTTACGGTTACGGTCTGGGTGGGCTGCTGGTGCCGTTTATCGTATCAAAGTCATTGATTTACTGCGGCCGTTTGCGGTCTGGTGTGAGGGACTTTACCATAGTGGATTACGTCCGGCATTATCGCATTTATGCTTTCTGTTATTGATTACTGGCGTTTACCGCTTGCTGACCACCGTACTGGGGCAATGGTGGTTTCCTGGCGAACCAATGGTTCGTTGATTCGTGAAGGTGATACGGTGCGCGGTTCGGCATTAATCAGGCAGAATTTTACCGGCAACGGCTGTATTTTTCATGGTGCCCGTCAGCAGCAGCAGAAATGCCCTATAATCCACAGGCTTCTGGCAGAACAATCTGGCGGTCAGTAACCCTGAGCTGGATAAATTAATAGCCGCACGCGTTGCTGCATTACGGGCCGCTAACCCGGATGCCAGCGCAGGCGTTCGGATGAACTGGTGGCGGCATCGGCAAGCGGGCTGAATAATATCGCCCGCAAGCGGCGGCCTGGCAAATCCCACGCGTGGCAGCGCCATAATCTCAGCGTTGAACAGCTCACTGCCAACTGATCGCAAAATATTTGTAACAACCGCTGGTGAAATATATCGGCCAGCCGGTTGTCAACGTGTGAAACTCAATCTGGCGCTGGATAAACTCGATGAATGTAACGAACCCTTACGTCCGACCCCGATCGTCTGCTGGAACAAACTGCGCGCCGCATCGGGAAGCTGATTTTCTTCGGTGCCTGTGCAGGCGTCAAAGGGAAGACCTGGAGCGATGCTGGCAGAAGCCCAGCGACTGCGAGCGCAAAGGGCTGGATATTGTGGTTGGCGTGGTAGAAACCCACGGGCGAAAGATACCGCCGCCATGCTGGAAGGTGGCTGTTCTGCCGTTAAAACCAGGCGTACCGTGGGCGGCATATCAGCGAGTTTGATCTCGATGCCGCCACTCGCCCGCCGCCCGGCGCTGATCTTAATGGACGAACTGGCGCACAGTAATGCGCGGAGTTCCCGTCATCCCAAACGCTGGCAGGATATCGAAGAGGCGCTGCTGGAAGCTGGCATTGATGTTTTCACTACCGTCAGCGTTCAGCATCTGGAAAGTCTGAATGATGGTCAGCGGCGTCACCGGAATTCAGGTACGGGGAAACCGTGCCCGATCCTTTTCGATGCCGCGACGACGTGGTGCTGGTGGACTTGCCCCGGACGATCTGCGCCAGCGGCTGAGAGAAGGCAAAGTCTATATTGCCGGGCAGGCGGAGCGCGCCATTGAACATTTTTTCCGCAAAGGTAATCTGGTCGCCCTGCATGAACTGGCACTACGCCGTACTGCCGATCGCGTTGATGAGCAAATGCGCGCCTGGCGGGGGCGTCTGGCAGAAGAGAAAGTGGCACACGCGACGCGATCCTTTATGCATCGGCCATAACACCGGCGGCGAAAAACTGGTCCGCGCAGCTGCGGCTGGCGTCACGGCTGGGTGGCGTCTGGCGCGGTGTTATGTTGAAACCCCTGCCCTGCACCGCTTACCGGAAAAAACGTCGGGCAATTCTCAGCGCGCCCGTCTGGCGCAGGAACTGGGCTGGAGACGGCAACACTTTCTGTTGATCCAGCGGAAGAGAGAAAGCGGTAGTGCGTTATGCCCGTGAACATAATCTCGTAAGATTATTCTCAGTCGCGGCCTCGCGCCGCTGGTGGCGTCGGGAGACGTTTGCTGACCGACTGGCGCGCATCGCCCCGATCTCGATCAGGTGCTGGTCGCGCCCGATGACCACCCGCCCGCACGATTAACAACGCGCCGGATAACCGCTCTTTTAAAGACAAGTGGCGTGTACAAATTCAGGGATGCGTGGTTGCCGCCGCGTTATGCGCCGTTATCTCTTGTAATTGCCATGCAGTGGCTGATGGCGTTGATGCGCCAACCTGGTGATGCTGCTGTATCTGCTTGGCGTGGTGGTGGTGGCGCTATTTATGGACGCTGGCCTTCAGTGGTTGCCACCGTCATTAATGTAGTGAGTTCGATCTCTTTTTTATCGCCCCACGCAGCACGCTCGCCGTCTCTGATGTGCAATATCTGCTGACCTTCGCGGTGATGTTAACCGTCGGGCTGGTGATCAGGAACCTTACTGCTGGCGTGCGTTATCAGGCGCGGGTAGCCCGTTACCGCGAACGCGCACACGGCACTTATATGAAATGTCGAAAGCTCTGGCGGTGGTGCAGTCCGCAGGATATCGCTGCCACCAGCAGACAATTTATTGCCTCCGTTTCATGCCCGCAGTCGGGTGTTGTTGCCCGATGACAACGGTAAATTGCAGCCGTTAACATCCGCAGGAATGACGCCGTGGGACGATGCCATCGCCGCGAGTGGAGTTTGATAAAGGCCTGCCTGCGGGCGCGGGCACCGACACGTTACCCGGTGTACCGTACCAGATTTTGCCATAAAAAGCGGCGAAAACTACCCTGGGCTGGTGGTGGTGGAGCCGGGAATCTGCGCCAGTTGATGATCCCGGAACAGCAGCGCCTGCTGGAAGACGTTACGCTGTTGGTCGCCAATGCCCTTGAGCGGCGGCGCGTAACCACCGCCAGCGAAGAACAGGCGCGGATGGCAAGCGGGCATTGAACAGATCCGCAACGCCTGCTGGCAGCGCTTTTCGCGGTTACGCGCCGCTTACGGTGCTGTTTGGTCAGGCAGAAATCTTAACGCTCGGTCTGGCAAGCGAAGGATCACCCCGCCCGCCAGGCCAGCGGATCCGTCAGCATGTGCTGAACACTACCGACTGAATTGAATAATCTACTGGAGTATGGCGCGAATTCCAGTCCGGCGGCTTTTAATTTGAAGAAAGAGTGGTTAACGCTGGAAGAAGTAGTCGGCAGCGCGCTGCAAATGCTGGAACCGGGTTTATCGTCGCCCATCAATCTTTCTCTGCCAGAACCATGACCTTAATCCACGTTGACGGGCCCTCTTTGAACGGGTGCTGATTAATCTGCTGGAGAACGCGGTGAAATATGCGGGTGCGCAGGCCGAAATTGGTATCGATGCCCACGTTGAGGGCGAAAATCTACAACTGGATGTCTGGGATAACGGCCCCGGTCTTCCGCCAGGCCAGGAGCAGACGATATTTGATAAGTTTGCTCGCGGGAATAAAGAGTCGGCAGTACCGGGGTAGGGCTTGGACTGGCAGTTTGTCGGGCGATAAGTGGATGTACACGGGGCACTATTACCCACGTTCAACCGACCGGAAGGTGGTGCCTGTTTTCGTGTTACCGCTTCCCCAGCAAACTGCCCCTGAACTGAAGAATTTCAGCGAGGATATGTGACAAACGTTCTGATTGTTGAAGAAGATGAACAGGCTATTCGTCGCTTTCTGCGCACGGCGCTGGAGGGCGACAGGATGCGCGTCTTTGAGCCGAAACGCTGCAACGCGGCTTGCTGGAAGCAGCGGCAACCCGTAAGCCAGATTTGGTTATTCTCGATCTCCGAAGCCTGCCCGATGGTGATGGGATTGAGTTTATCCGCGACCTGCGCCAGTGGAGCGCGGTGCCGGTGTTAATGCTTTCCGCGCAGCGAAAACGACAAAATCGCCGCGCTGGATGCCGGAAACGGATGATTATCTGGAAGTAAGCCGTTTGGCATTGGCGGAATTGAGCCCGTCTGCGCGTCGCATTACGCCGCCACTCTGCACCACCGCGCCCGATCGCTGGTAAAATTTTCCGATGTTACCGTCGATTTAGCCGCCCGCGTGATTCACCGGGGTGAGGAAGGTTAAACACCCAAGCAGACGCCGAAGATAGAGCACGCA
+>1896c369-b7d0-4e98-aa23-830f7a9f001f
+ATTGCATCGGTATTGCTTCCCGTTCGAAGTTACGTATTGCTCTTCGGCGTCTGGCGGGTGTTTAACCTTCCGACTCGCTGATATACCGCCACGGTACGCCAGCGTTTTAACGGCAGAACGACCAGCCCTTCCAGCATGGCGGCGTATCTTTTCGCCCGATAGGTTTCTACCACGCCAACCACAATATCAGCCCTTGCGCCCGCCGTCCGCTGGAGCTGCCAGCATCGCCCAGGTCTTCCCGACGCCTGCGCGAACAAGAAAACTTTCGGCTTCCCCGATGCAGCGCGGCGGTTTGTTCCAGGCAGCAGACGATCAGGGTCCGGGACGTAAAGGTTCGTTATTCATCAAGTTTATCCAGCAGATTAGGTTCAGCAAGTAACGACAACCAGCTGGCCGATATATTCACCAACGGTTGTTGGCTGTATTTTGCGATCAGTTGCGTGAGCTGTTCAACGCTGAGATTGCCCTTTCGCCACGCATTAAGTTTACCAGGCCGCCGCGCGGGTGATATTATTGTCCAGCCCGCTTGCCGATGCCGTCGCAGTTCAACCAGGAACGCTCGCGCTGGCATCCGGGTAGCGGCGTAATGCAATAACGCGTGCGGCTATTAGTTTATCAGCTCAGGGTTACTGACCGCCAAGATTGCTCCCGCCAAGCCTGTGGATTATAGAGGGCATTTCTGCCGTTGCCGACGGGCGACCATGAAAATAGCGGTGCCGGTAAATTCTGCCCGAAGAGATTAATGCCGAACCGCGCACCGTATCACCTTCACGAATCAACGAACCATTGGCCTGCCAGAAACCACCATTGCCCCAGTACGGTGGTCAGCGGCGGGGTAAACGCCGCAGTAATATTAACAGAAGATAAATGTTGATAATGCCGGACGTAATCCACTCATGGTAAACCTCACTGGAACCGCAAACGGTCAGCAGTAAATCAATGACTTTGTCACGATAAACGGCACCAGCAGCCCACCCAGACCATGAAATCACTAAGTTACGGCGCAACCTCGCGGCAGAAGCGGTAAGCGGTTTATAGCTCACGCCTTTTTAACGCCGGGAGATCAAAGACGATAATCCAAGGCGTTGAAAATGCCGCACTGAGGATTGCCGGAGTCCGGGCGAATGCAGGCACATGATGTTCAGCGCATTTAACTGCCGATACGTTGCAGGTTGCCGGAATAATGGCGAAACCATTTCGCCACATCGTTAACAATGCTGAAGGTGGTCAGAGCCACGGGTCATCCAGCATCTGTTTGCCAATGTACCACCTCGATCAACTTGGTCGGGTTAGAGTCGAGATCGACCATATTGCCCGCCTCTTTCCGCCGCCTGGGTGCCGGAGTTCATCGCCACCGCGACATCACCTGCGCCAGCGCTGGGCATCGTTGGTGCCGTCGCCGGTCATCATACCAAACGACCTTCCGCGCCTGATACTGACGGATCAATGCCAGCTTGGCGGTGTCGCTTCGGCGAAAAATCATCGACACCCGCTTCCCGCAGCTGATGCTAACGCGGCAGCAGTCAGACTGGTTATCGCCGGTAATCATCACCGTTTTAATGCCCATTTTGCGCAGCTGGGCGGGAAATAGCTCTTTAATGCACCGCCGCTGACGATATCTTTCAGCGCAATAACGCCCAGCACGAGAACCTTCCACCACCACCAGCGGCGTATACGACGCGCAACCTGATCGACTTTTTGATCAACATCGGTAGAGTGACCACCGTAGCCTCAACATGGCGACAGATGGCATCGAATAGAACCTTTACGGATCATGCGGTTGTCGATGTTGATCCCGCTCATCCGGCTTTGCGCAGTAAACGGTACAAAGGTGGCACCGGGCGACTTCTGCATCCGCGCTCGCTAAAACGCTGCTTGGCGAGGATCACAATACAAGCCTTCCGGCGTTTCATCAATAGCAAATGGCGCCAGTTGTTGGCGTCAATGGCAGTTTTCATCCACGCCGCGGCGGATAAACTCCGACGCCACGAAGCGGTTGCCGAAGTGTGATGTTGCCGGTTTTATCAAAGTAGCGAGCGTCAATCCTGCCGCTTCAACTGCACGTCACTGATTGGCAATCACGTTCTTTACTTCGCATCCGGCTCATCCGGCGACGCCGATCGCTGACAACAGGCCGCCAATAGTGGTTGGGATCGTGGGGCATAGACCAGCAGCGCCACAATTGCCGTTACGCTGACTGCATTACCGCCCGCGGAAACGGCCTGGCGTGGCGGTTGCCAATCAAAAGACGATAGTCAGGGCAATCAGCCAGAATGGTCAGGAACCAGTTTCGTTCCAGCGTTTTGCGTCGCTGTGCCTTCCACCATCCTTGATCATCGGTCCAGAAATGTCTCGCCAGGGTTAATACCTCCGTCACCAGCCAGTCAGAAGAATGCGCATTACCGCGGTGACGGAGAACCCAAAATCGCCGCCGGATTCACGGATCACCGGTGCCGGTTGTTCGGTGATGGCGCTTTCATCGACCAAAGTGCCCCGCTTCAATAGCACTTCACCATCGCAGGATAATATCGCCAGCTTTACAGTACGATATCGCTGCTTTACGAGGATTCAGTCGGCGCAGGAACTTTGTCCGCCGCAGCGCCATATTCGGCTCACGCGGCTTGCGGGCAAAGGCAGTTTTTCACCTTTCAGACTGTTGGCCTGCGCTGCTGCGGCATTGCTTATCGGCGAAATTAGCGGAATTAGTGGTGATCCAGCCAACCTTCGTGGCTGCGCTAAACCAGCGCATTACCGGGCATCGCACCACTTGCATCACTGATGTACTAATACAGGTGGTCAGCGAACTGCCGCCGATCCAGACGATAAGCTTATCACCCGGATTGCGCCATTGCGCCTGCGGTTTAATTTTTTCACGCTTCTTTCAAACGATATGAAGTGTTGGTTTCGAATAGCACCGGTTGTTTGACTCATATTCGGTGCCTCACTCAATATCATGGGAGAGAGATATTCCGCCACCGGACCGAAGGCGCCAGGGGCAGGATAAAGGTCGAACGCCAACCAACGCTTACGGTGCCGATTAACCGACCCAACAAACAGCGGGCCGTACGTTTGGCGGCGATGCCGTTACTACCAGCGAACGGCAATTTATCGCCGGTGTCACCCGGCGACCGATAAACGTGAACATGGTAACAGTTCCAGAACGGAGTTACGGCGCTTAATCCGGCAGGCGCTGCCATTGTTAGCGGCGGATGACGCGGCGTACGCGCTATTATTAATGCAGGCCAGGTTGGTACTGGCGCTACGTCAGCACGATGGTCATCATCGCCAACGCCACTTCATCCAGCGCCAGCGATCGGGTAACCCGGAACACCCGTTAAAGGTCGGTTTTCATCTCGCGTACGATAATTTTTACCCAGATATTCCGGTGCACGATAATCCTCAAGCCAGCAATAAGCACGCCAGCAGGATGACAGCATCATGCCGTAGGAATTAGGGAGCCGTTACCGCCGAACACCGCCCACCAATTTATGTCAATACATCCGGCACCACTTACACCCAGGAAGCTGACCAGCAGATCCATGCATCATAATCACCGCCACAGAAGCCGCCGTCGTCACGACCGCAAACAGGCTGCAACCAGCACGCCAGTGGCTCTCTTTACCCAACCATATTGGTGCTGCTGCTGTCCATTGCCGGTACTGCCAGCAGATGAGGATTACCCTGAACTTCTGCCCACATCACCACGCCTACGCAGATGACAAAGTCGCTGACCTCGCCCGCAGCAACGCGCCCCTGGCGTGATGCTTATCCGCTTCACCAAAAGGCAAAGCACACAGCGCCGTTACAGGATCAAAGAAGGTCGCCAGCATCTGCACGAAGTTAGTCAGGTGCGGTTGGGTTTTCAAACGGATGCGACAGGGTTGGCATTAAAGAAGCCACCGCGGTGGTACCCGGCTATCTTGATCGCTTCCTGGCTTTATTCCACGCTGGGTAACAGCTGTTGCGCTCCTTCAGCATTATTCACAGCTGAAATGGGGCAGAAGTTTACTGGCACCTTGTTGAATAAAAACAGTGCAATCAACAACGCCACGGGGATAGCACCATAACGTGAGTAAAGTCGACCCGAAGACATTCAGGCGTGCTCATGCTCTGGCATTAAACGCACGGATGAGGGCAAAAATCACCTGGAAATCCCGCTGGCGGCAGAAAAGTTTGCTAAGCCCGCCATCTGGCTGAAATAGCTCAACGTGGTTTCACTGCTTCTCAGATTACCCGGTTGTGGTGACAAAGCTGACGCGGTATTCGAAAGCATAGATCCGGTGAAGCTGGCAACTGCTGGCGATTAGCGGCAGATGGCTGACCGGCTGGCATAAAAAGAGCATACCGCCAGCCCCAGCATATTCCAGGCCGAGAATGGCACGAAGATTGCTTCCAGTTTCATCTACGATTCAGAGGGCGCCGTGCGCGAAAGTACGCTTCAACGCCGTTCGCCAGGAGAACCATCATTAATCAATAACGCCAGCCGCTGCCTAAAGGACGCGCGCCAGCGCACCATTAACCACCATTAAACGTAGCGATCAGGTAGAACCCTTGCGCAGCCATCAGAACGCCTCCGCATTGATCAGGGCATAAACCAGATAGCAGTAATAAAGCACCAGCATTACGCCGGTTATCACGCCTGCTCTGATGCACCTCCAGTGGCTAAAGAAATTGACCGGGTGGGAATTCGGCTGCGGAATTCCATAAAAATCTGCGGGCGAATTAAAAAAGTATAAAATGGCAAAAGCCATGATTTAACTAATGCGTTTAAGTATTAATTTAACTTTTGTTGTAACCCAATTACCGGGATGGATATAAATAAACCATCAATAAGCAAAATAAGTGGTCGGATGGTAGTAAGAATTACACAAAAGGCGGGAATTTCAAACAAATCAGATAAACAAAATTCATTTTTCCGGGGTGCCATTCACCGGGTAGATAAAAGGGGAAAAGAATGGAACTCTACAGAGATATCCTGCATGGCTTATCTTTTTACGCCGTGCTTATGCAGTTACGGGCGTTCTGGCGCTGCACCTTTCATGCTTTCTGGAAGGACCGCGCCCGCTTTTGGCTACCATCGCGTCTGAATGAAAACCAGCGATATCCGGTGTGGATGGATCGGAATGAAAAGGCAACTGAGTTTTTATTGATTGCTGGAGTTTTGAATACGGCTGAGAGCCGCCAGCGGGTTAAACGCAAACGGACCGCTATCAGCACCAACAGAAAAGCAGTAAATGAAAAAAGAAAAAGA
+>c1709263-8322-4cbd-86de-5f40eb0457c1
+TGCTGTACTTCGTTCGGTACGTATTACTGCCTGCCTGTCGCTCTATCGCCGGCGGCGTCTGCGGGTGTTAACCTTGCCAGGCCGCCGCTTGCCGAGGTGATATTGTTGGTAAGCCCGCTTGCCGATGCCATGCCAGTTCAACCGGAACGCTCGCGCTGGCATCGGGTTAGCGGCCCGTAATGCAGCAACGCGTGCGGCTATTAGTTTATCAGCTCAGGGTTACTGACCCGTAGTTACTCCCGCCAGAAGCTGTGGATTATAGGCATTTCTGCCGTTGCCGACGAGCGACCATGAAATAGCCGTTGCCGGTAAATTCTGCCCGATTAATGCCGAAACCGCGCACCGTATCACCTTCACGAATCAACAGACCATTGGCCTGCCAGAAACCACCATTGCCCAGTACGGTGGTCAGCAGCGGGTAAACGCCGCCAGTAATCAATAACAGAAAGATAAATGTTGATATTACCGGACATGTCACTCGCTAATTAAACCTCACCAGACCGCAAACGGTCAGCAGTAAATCAATGACTTTGTCCTACCGATAAAGCAGCACCAGCAGCCCCAGACCGTAAATCCATAAGTTACGGCTGTATGGCAGAAGCGGTAGGTTTATAACTCACGCTTTTTAACGCCAGAGGATCAAAAGGCGATAATCAAGAACGTTGAAAATCACCGCGCACTGAGGATTGCGAGTCGGGTGAAATGCAGGCATGATGTTCAGTACAACTGCCGGATACGTTGCCGCGAATGCCGCCGGAATAATGGCGAAGTATTTCGCCATCGTTGGCAATGCTGAAGGTGGTCAGCCGTGCGGTCATCAGCATCTGTTTGCCAATGTGCACCACCTCCGTCAGCAGGTCGGGTTAGAGTCGAGATGACCATATTGCCCGCCTCTTTCGCCGCCTGGGTGCGGGTTTCATCGCCACCGCGACGTCTGCCTGCGCCAGCTGGAGCATCGTTGGTGCCGTCGCCAGTCGTCGCTACCGGCGACCCTTCCGCCTGATACTGACGGATCCAATGCCAGCGGCCTCCGGTGTCGCTTCGGCGAGAAAATCATCGACACCCGCTTCCACCAGCAATCTGCTGGCAGCAGTCGAACGGTTATCGCCAGTAATCATCACCGTTTTAATCGCCCATTTGCGCGAAAACTGGGCAAGCGCTCTTTAATACCGCCTTTGACGATATCTTTCAACAATAACGCCCAGCACGAGACCTTCCTACCACCAGCGGCGCGGCTCCCCTGACGCGCAACCCTGATCGACTTTTTGATCAACATCGGTAGAGATGACACCGTTAGCCTCAACATGGCGACGAATGGCATCAAACAGAACGCTTGCGGATCATGCGGTTGTCGATGTTGATCCCGCTCATCGGCTTTGCGCGATAAGCAGTACAAAGGTAGCCGACGACCGCATCGCGCTCGCACAGGTTAAAAAACGCTGCTTGGCGGGATCACAATGCACGGCCTTCGGCGTTTCATCAGCCAGCGAAGCCAGTTGTGCGGCGTCAATAGCGTTTTCATCCACGCCCTGCGCGGCGTTAAACTCCGACGCCTGACGGTTACGCGAGGTGTGATGGTGCGGTTTATCCGGCGGCAGAACGTCAACGTCACCTGCCACGCTTCGCTGCGTCGCTGGTGGCAATCACATTCGCGCCTGGCATCCGGCTCATCCGGCGACGCCGATACGCTGACAACAGGCGCCAATGATGGTTGGGATCAGACAGACCAGCAGCGCCACCAGTACCGATTACGCTGACTGCATTGCCGCCCACTGCCGGAAACGGCCTGGCGTGGCGGTTGCCAGTAAAAAGACGATAGTCAAGGCCAATCCAGCAGAATGGTCAGGGCAATTTCGTTCCGGCGTTTGCGTCGCTGTGCGCCTTCACCATCGCGATCATCGATCCAGAAATGTCTCCGCCGGGGTTAACGCTACACTCAATCACCAGCCAGTCGAAGAATGCGCGTGCCGCCGGTGACGGAGGCAAAATCATACCGGATTCACGGATCGCCGATTACCGATTCCCCGGTGATGGCGCTGCATCGACCGATGCACCTTCAATGCTTCACCATCGCGGGATAATATCGCCAGCTTCACCGGTACGATATCGCCTTTACGAAGTTGGTCGGCAGGAACGTCGCCGCAGCGTATATTTCGGCTCACGCAACGCGGGCAAGGCAGTTTTCACTTGCCTTTTCAGACTGTTGGCCTGCGCTTTACTGCGGCGCTTGCAGCGCTATCAGCGAAATTGGCGAACAGTACGGTGATCACATCAGCCGCTAATGGCCGCTAAACAGCGCATTGCCGGGCATCGCACACTTGCCATCGCGATGCTAATTACAGGTGGTCAACCGGACTGCCGATCCAGACGATAAACATCACCGGATTGCGCCATTGCGCCTGCGGGTTAATTTTTTCACCGCTTCTTTCGCGCCTGAACGACAAGTGTTGTTCGAATAGCATGATTGTTTGACTCATATTCGGTGCTCACTCCAGCCGTATCATCGGAGAGATATTCCGCCACCGGACCAGGGCAGGGATAAAGGTCAGTGCGCCAACCCCAACGCACGATTGCCGATTAACAGGCCAACAAACAGCGGGCCGTGCGTTGGCAGCGATGCCGGAAACTGGCAGCAGCTCTTTTACTCACCAACCAGACCGGCAATTGCCATCACCGGGATAATCGCGAAGCAATACCGACAAACGCTGCAGAACGCCAGTAAACGGTTCAAGACGGAGGTTGGCGCCATCCGTAAAGCGCTACCGTTGTTGTTATGACGGATGACACGGCGTACAGCACTTCGCTAAAACCATGCAGACGGGGTTGAGCATGGCGCTACGTCCGGCGTCGGTCATCATCGCCAACTTGCCGCGCCCATCAGCACCAGCGTCGGGGGTAAACCAGAATTGCCAGTACGGTCAGTTCCATCTCGCATGCGTCGATTTTTTACCCAGATATTCCGGTGTACGATAATCATCAGCTACGGCAATAAGCACCGCCAGCGGGACAAACAGCATCATGCCGTAAGAATGAACCGGTACGCGAACACCGCTTCATAATTTGCATCAGCGTGGCACCATGCCACCGAGGCAGTAACCGATCATGCATCGCAATCACCGCGCCAGAAACCCGCCGTCGTCACGACCGCAAACGAGCTACTGACCCAGCACACGCCAGGAACGGCTCTCTTTACCTTCCATATTGATGCTGCTGTCGTGCCCGGTGCCAGCAGATGGGGATTCACCCTGAACTTCTGCCCACATCACCACGCCTACGCGGATGACCAAAATCGCTGACGCTCCCTTACAACGTATGCGCCCCTGGCGTAGTCGCCCATCATACCAAAGGCAAAGCACAGCGCCGTTGGGATCAAAGAAGATCGCCAGCATCTGCACGAAGTTAGTCCAGTGCGGTTTGGTTTTCAAACCGGATGCGACGAGTTGGCGACAAGAAGCCACCGCCAAAGGTGGTACCGAGCATCTTGATCGCTTCCTGAAACTGGGCCCCCATGGGGTAACAGCTGTTGCGCTCCTTCAGCAGTATTCACGGCCTGATAAGGCGAAAGTTTTACAGCGCACCATTGTTGAATAAAACGGTGCAATCAAGCAACGCCACGGACTAGCACCCATAACGTGATGCGTAGCAGATCGACCCGAGCATTCCCGAGCGTGCTCATGCTCTGGCGGGTAAACGCACGGATGAGGGCAAAATCACCGCAATCCCGCTGGCGGCAGAAGAAAGTTTTGCACCGTTAAGCCGCCATCTGGCTGAAATAGCTCAGCGTGGTTTCACCGCTATAAGATTGCCAGTTAATTGGTGATGACAAAGCTGACGGCGGTATTCAGCGCCAGATCCGGCAGCCCTGGCAACTGCTGTGGATTAAACTGCGGCGAATAGTGCTGACCGAGCAACGCAAAAACAGCACCGCCAGCTGGCATATTCCGGGCCGAGAATGGCACAAGATATTTACTTCCAGTTCATCTCACGGTCAGAGCGCCAAGTGCGCGCGAAAAGTACGCGCTCAACATACGTTGCCGGGAAGAGGAATGTCGTTAATCAGCCGCGCCAGCCCGCTGCCTAAAGGACGCCAGCACCATTAACCTACCAGTAAAAGCGTGGCGATCAGTAGAACCCTTGCGCAGCCATCAGAACGCCTCCCGCATTGATCCGGGCATAAACTGAATAACCCGGTAATAAAAGCACCAGCAATACGCCGGTTATCACGCCTGCACTCTGAGTGCACCTCAGTATTCAAAGTGATACCGGAAGGGTAGAATTCTGGCTGCAAAGATTTCGCAAAATCTGCGGGCGGGGTGTAAAAGGTATAAAAATGGCAAAGCCATGATTTAACTAATGTTTGAGTATTAATTTAACTTTTTGTGTAGCTTAATTACAGGATGAATGTAAATAAACCATCAATAAGCAAAATAAGTGGTCGGATGGTGGTAAAAATTACACAAAGGCGGTACTATTTTCATCAGATAAAACAAATTCATTTTCGGTGCCATTCACGGTGAAGATACAAAGGGGAGAAAGTGTATGGAACTCTACGGAGAATATCCTGCGTGGCTTATCTTTTACGCCGTGCTTGCGGTTGCAGCGGGCGTTCTGGCGCGCCTTTCGTACTTTTCTGGAAAGACCGCGCCCGCTTTTTACGGCTACCTGCATCGCGTCTGGTCGAAAACCAGCGATAAAACCGGTGTGGATGGATCAGGCCGAAGGCAACTGGTGATTTTTATTGATTGCTTGAGTTTTGGATACATTGAAAACCGCCAGCGGAAACGCTGGCGGTTTTAATCGGAAGATGTTCAGAGGAATATTTGACATCGTTATACCAATCCGAAACATATATTCATGAAATATATAAATATTTTCCTGGTGTTCTTATCTGACGGATATCTCATAAAGGCTTTCTTATAAATCCTTGTAGGGTTTCGCCTGTCGGCGGACAAATAACCCGATAAAACAAGGATGAGCAGATGGGCGGGAAAACCGGCGGCGCGTCGGGGCGACATGACGCAGTATGTGACCAACGCATTGTCAGAGTTCAGCCGGGGTACGCATCAATTGCCCCACCGGCGTAGCCTGTTCGGTGTGCCCCGGCAGTGCGACGTCGGCCATCGGTCAATCCGCTGCTCAATTGCAAAGGTCCTTCAGTGAAACCGACATCGCCCTGCCGGCCGCTACCGTTCATTGTCTCCGCACCTACAGCGATTACCGGACAAAACGCCCGCGCCGGTAGAGACCTCAGCCCCCGGCTGGAAAATGCCTGCGGAATATCCCGCTTACAATACGCGATAACACACTGATACTCAGTGATAACGGCAAGCCTGTATTTTGACACCTGTTTCCCGGTGAGGACCAGTTTGGCCGCAGCGAGTCACTGGCTGGTGCGCAGCGGCGTGGCGAAACTGGATGAAGGTCACCGGCTGGCCGCACTCTGGCGAGCGCTGCCGGAAGAACTCCGCTTAAGTCCGCATCGTTATCTGGCGATGGAAACAGTCCGCAGGGCCGTGGTGGCTGCTCGGCTGGTGTGAGCAGTTGCCGGAAGCGGATGAAGTGCTGCCTGCGCGCCGCTGCCGTACCGGAGTACTGACCGGGCTGGTGGACCGCTTCAGGCGCACACAGACGTTCCACCGCAAGCCACCGGTAGATTGGCGGCGAAATCACCGGCGTGACGGATGGTGCGGAGGCGTCCGCCAGCTGGTACTGACCACGCGGAAGCAGCGGGCGAAGAAGCGGCAGCGAGCCGGCATTTCCGAAGCGGGACGGAACGTCAACTTTTCCTGATACCGGGTTACGAATATGGCGGGACAACGGCATCCGTCTGTCTGCCGATAGCCGGCTGACGCACGACCGGAATACCCGGAGGATTTGCCTGCCGCGCCTTTGGTGCGCTATGGCTGGAACGCCCGCGGCGAACAGCAGCGGTGTATGACCACCAGCAATACACGGGTGCGCAGCTTTGCTGATGATAAATACCGGGGCCGGATGGTGGCGCACCGTGCACAGGCCGACGGAAATCTGTTACCGTTACGACGGCGACGGGCGGGTGACAAGAACAGCTAAGCCAGCGGGCTTAAGTTACGTATCAGTAGAGGACGCATCACCATCACCGACAGCCTGAACCGCCGTGAAGTCCTGCACACGCAGGGTGAAGGCGGGCTGAAGCGGGTGGTGAAAAAGGGCGCGGACGACAGCGTCACGCAGAGTCCAGTTTATTGCGGTGGGCAGGCTCAGGGCACAGACGGATGCCACCAGGCAGGACAAGCAGAACCTGATCCGGATGTGGTGAGCGGGCCTCATCGCGCATCACCGCCGGATGGCAGGGCATCGGCGTTTACTAACCACCACAGCCAGTTAACGTCAGCCACCGGGCCTGACGGGCTGAAGCTCGCCAGAGATATGATGAATGGGGCCGTCTGATTCAGGAAACTGCCCTGACGGCGATAATACCCGCTACCGTTATGTCGTCACAGTGACTTACCCTGCGCAGCGGAAGATGCCACCGGCGGCGGAAAACCATGACGTGGAGCCGTTGCGGTCAGTTGCTGGGCTTCTGACTGTTCCGGTTATGTAACCCGCTGAAGCCATGACCGTTTGGTCAGGTGGCGGCAGTGCACCGCGAGGAAGGGCTGAGTCAGTACCGCGCATACGACAGCCAGTGGACGGTTAATTGCCGTGAAAGACCGCAGGGCCGTAGAAACGCGGTATGAATACAACGCCGCCGGTGACCTGACCACCGTCATTGCCCGGACGGCAGCAGAAACGGGACACAGTACGTGCGTGGGGAAAAGCCATCTGTACCACGCAGGGGCGTCTGACGCGATATGGGGCTCACGATGCTGCCGGACGGGTCATCCGCCTGACCAGTAGCAGCAGCCACACCACGCTTCCACGTTACCGTGTACTCGACCGGCTGATGGAAACCACGGCTGACGGCCGCCTGGCGATTATCACCACGACCACAGCCAGCAAACTTATCCGCAGCGAGGATGAGGCTGGTCACCCTGGCACTATGACCAAACGAATACGCCTCACGCATTAATGGCGAAACCGCAAACGGTGGCAGTGACGAACGCGGCTGGCTGACGAACATCAGCCATATCAGCGAAAGGCACCGGAGTACGGCGGTGCACTATGGTTATGACAGTAAAGCCGCCTCGCCAGTGAACACCGAGCGGTGCATCATCCGCAGACAGATGAACTGCTCTGGCAGCGCAGGATGAACATGCGTACAACGCACAGGAACTGGCAATTGCTGTACCGGACAGCCTGCCCGCCGTGGAATGAGCTGACACGGCAGCGGCTGGCTGTCAGGCATGAAGCTCAACACCGCTGGTGGAGTACACCGCGACCGCCTGCAGGAAACGCTGCGCTGGCCGTTATGAACTCACCGCCGCTTATGCCCCCTGCCGGGCGGTTACCGTTAACTGAACAGCCTGCTGTCTGACCCGCGATTACACGCCTGGGCAACCAACGTGAACTCATCCGCATCAGCAGCCCACGCGCCGGGCAGGGCCTGGCTACAGCACCACCGGCAGGCCTGACCGGCGTTCCACACCACGCAGCGAATCTGGATATCGCATCCGTATACCACGGGCGGCAGGTAACCGCCTGCCGAGCTGAGCTGCGCGGACGCCCTCAGCACTGTGGCCCGGATAGCCGTATCGCCCGTGACGCACTATCTTTATGGTATGACCGTCACGGCAGGCTGACAGAGAAAATGACCTCATCGGAAGGGTTAATCACACCGGATGATGCGACGCACCACCGGTTACCATTACGACAGTCAGCACCGGCTGGTGCACTACCGCAGACACAATATATGCAGAGCCGCTGGTCGAAGTCGCTATCTTTACGACCCGCTGGGCCGCAGAGATTGGCAAACGGGTATGGCGGCGTGAACGGGACCTGACGGGCTGGATGTCGCTGTCTGCGGAAGCCGCAAGTGACCTGGTACGGCTGGGACGGCGACCGCTGACCGATAGAACGGCAGAACCCGCATCAGACGATTTATCAGCCGGGGAGCTTCACGCCACTCATCATGGGGGTTGAAACCGCCACCGGTGAGCCGGCGAAAACCGCAGCGCGCCGCAGCCTGGCGGATACCCTTCAGCAGTCCGGTGGCGAAGACGGTGGGCAGTGTGAATTGACCCGCCGGTACTGGTGCGGATGCTCGACCGGCTGGAAAATTGAAATCCTGGCTGACCGGGTGGTGAGGAAAGCCGCCGCTGGCTGGCGTCGTGCAGCTGACGGTGGCGCAGGTCGCCAGATGGACCCAGTATACACGCCGGCGGAAGAAAAATTCACCTGTACCGCCGAAGGAAGACCGTCGCGACCTGCCGCTGGCCCTTATCAACGCACCGGAAGGGACAACGGCGTGGTACACCAGAATACGATGAATGGGGTAACCTGCCGAATGAAGAGAGCCGCATCAGCTGCAGCAGCTTATCCGCCTGCCGGGCAGTATGATGAGGAGTCCGGCCTGTATTACAGCCGCCACCGCTATTGACCCGCTGCGGGGCGTATATGCTCAGGATCGGTTGGGCTGAAAGGGGATGGAATTTTTATCAATCCGTTGAATCCGTCTCAAATGGATCCATTAGGATTGAAAACACTAAAATGCATTAAGCCACTGCATTCAATGGGCGGAACTGGTGAAAGAAGCGGTCCAGATATGGAGAATCGTTCTATCATCAATATCTTTGTGTCCCAGATGGTAAAGGGACTATGCTTGTGGTGGCCAGACCAGCAGGGGAGAATCAAAGGAGATGGTCTATGGGGGCGGAGTAAAGGCAAATGATACAAAGAAGCTGGCCGTTTGTGACCTCGTTGAAACCGATAATGGTTGTGTGGAGCTGTTTAAAGGAAGTTTAAAGAGGTAAGGCCGCGTTATTCTGGCTGTTGCCTGATATATTCACCTATAAATTTAGGGCTATTTAAAACTGCAAGACTGGTCTAATGATTCTTTAGAAACATAACAGATGAGTGCTCCGGGAAATAACATTGGACGTTTTATTAGATTTGTGATACCGGGTGATGTAATGAAATATATTATTTTTTTTATTCAGGCTATATGAAAAAGGCTTTATCGCTTTTAATGCTATTCTTTTCCGGCCATAGACTTTCATATTAGACTCCACTCGTGATGTAGGCGGAGTTAATTGATCTCATGTCTTGGCAGATGATGGTAATATGTTTCCAACAGGCATAGTATTCTTTATTGCTCTAATATTTATGAGTTTGTATCGAACATTATTGGCGTAAGGATTGATAAATAAAGTATATTATAGCGATAATAATATGGCTTTATTTTCTGTCAGGAGGGTATATTCAATGGTTTGTATTAAAGTAAGCGCATATAAACAAATAAATTAAGTTAATTGCTCTTATTATTATATGTAACCTGGGCATTTGATATCCCGTATACCTGGGGCCAACGAGTAACCATACTGACCAGAGCTGCACCCGGGCCAGCACCCTCAGCATATGGCCGGATAAACCACGTAATATCGCCCGTGACGCGCGCACTATCTTCCACCGGTATGACCGTCACGGCAGGCTGACAGATGACCTCATCCCGGAAGAGTTATCCGCGGATGATGAGCGCACCCACGGTACCAATACGACGGTCCAGCACCGGCACCAGATTGCACTACGCAGACCACAATATGCAGAGCCGCTGGTCGAAAGCCGCTATCTTTACGACCCGCTGGGCCGCAGGGTGGCGGCAAAACAGGTGTGGCGTTATTGGAGCAGGACCTGACCCGGGCTGGATGTCGCTGTCACGGAAACCACCGGTGACCTGGGCACGGCTGGGACCGGCGACCGCCTGACCACGATAGAACGACAGAACCATCCAGACGATTTGTCGGCTACGGGGCTTCCACGCCACTCATCAGGTTAAAGAGCCGCCACCGGTCGACTGGCGAAAACGCAACGCCGCAGCCTGGCGGATACCTTCAGCGGTCCGGCGGCGAGACGGTGGCAGTGTGGTGTTCCGCCGGTGCTGATGCAGATGCTCGACCGGCTGGAAAGTGAAATCCTGGCTGACCGGGTGAATGAGGAAAACCGCCGCTAGCTGGCATCGTGCAGCTGACGGTGGAGCAGATACAAAACCGATGGACTGCGGTGTACACGCCGGCGCATCCACCTGGCCGCCACGACCATCGCGAGCTGCCGCTGGCGCTTATCAGCACGGAAGGGGCAACAGAATGGTGCGCAGACTCACGATGAATGGAACAGCCTGCTGGATAGAAGACCCGCATCAGCTACAGCAGCTTATCCGCCGCCGGGGCAGCAATTATGATAGAGAGTCCGGCCTATTACAACCGCCACCGCTATTATGACCCGCTTTGCAGGGGTATATCACTCAGGATCCGATTGGGCTGAAGGGGATGGAGATTTTATCGGTATCCGCTGAATCGGTTCGTATATAGATTCAATGGGACTGGCATCAAAATATGGACGCCAAATAATGGCGGATATGGGCGAGGACAACAAACCGCTACGCCCGATCCGTAGTGCCGGACATGGCGACAATTAAGACTGCCATATCCTAATGACCGGGCCAGTGGTGCCTAATGTTTCAAAACATTCTTCCAGGCATTAAGCCCTTACGACTGCACTGTATTGCAGAGTGGGTAAAACCAAATCTGACTTGTACGCCACAGGATGATTCCCCGGTATCAGGAGTGGATACCAAAGGGCTGTGATGATTACCTGCCGCGGAACCAAATTGGCCAACAACTCAATTACCACCAGGATATACTTGTACGGGGAACCCTACTTTGTTAGACATTAATAAACCCGATGGGCCAGCAACGAAAGCAGGGATGGTGATTTAGATTGAAATTTTATGGAATGGAACAGAGAACATCAGGGTAGAAAAATGAAAAGAGGTTTTGTTCTGCTGATGATATTTGTTAGTTTGGTGTCATAGCTGATTGCGAAATACCAGCTAAAGATCATGATTGTTTTACTATTTTCGCTAAAGGGCTGCTATTTTTTCGCGTTTCTATATTTAAATAATAAAGCCATGTGGAGATGGTATTATCAGAATGGGGACATCGGTGAGTATTATTGGCAAACAGGAACTGGGTACATGTAAAATAATAAATTCCACAAGCGGGGCGAGACTCTTAATTCGCGTCGGGTCACATACGCCTTAATGAAAAGTCATGCCATCAAAGACGTTGCAGGAGTTGATAAATGCAGCGAAAAAACGGCGTTTCTCGGCGATCGGTTTAGAGTTATATATAAAGGCGATTGTCTATCAAAAGAGCGGTGATCCAGTTCCAGTTGTTGGCAGTCCTTGATAATTCAATCATGGTAAAATATTTTAAAGATGAGAAACCAACTTATGCTCGAATGACGGCACATCTCCCGAACAAAATGAGTCTTACAGATGTTTAATAAAGATACAGCATGAAGACTAATTCATAGTGAAGAGAAATAAAAAGGTTAAACACCCAAGCAGACGCGAAGATAAAGGA
+>f20007a8-a22e-47c3-87d7-7c0f9744f792
+TTCGTGCTTACAGGTTTACGTATTGCTTTTCTGTTGGTGCTGATATTGCGGCGTCTGGCGGGTGACAACCGCGTTGGTGTTCGCTGGCAGTGGGCAGGCGCGGCTGTCATGGGCAGGTGCGCAGATGCCCGGTGCCCTTCGCTGAATGGCGATAATCACTGTCAGCCAGCGCGTTCGTCAGCCACCACCCGCTCTGCGGTTTCGCCGCATTCGATTGCGTTGCGTGGCAGGGCGGTCGCAATAAAATCGCAGTACTGGTGGGCGTGACCTCATCCTCGCTGCCGGATAAGTTTGCGCGGTCAGGTGCTGGTGATAACGCTGTGTGCAGCCGTCAAAGCCGGGTTTCAATGATTGAAATTTTGTCGTAACGGAAGATGGTGGCTGCCGTTTTCACTGGTCAGCGGATGGGCCGTCATTTGGCACATCGTATTCCATACTGCGCGTCAGACCGCCTGCGTGGTACAGATGGGCTTTCCCGTAATGTTCTGTCCATTTCTGCGCTGCCGTCCGGGGCAATGACGGTGGTCGGTCACCGGCGGCGTTGTCGCCGCGTTTCATGGCGCCCTGCCGTGTCTTTCGACGATTAACTGTCCGCGGCTTTATCGTATGCCAGTACTGACTCAGCCCTTCCGCAGGTGCACCGTTACCTATTAAAGCAGTAGCGGACAACATGGAGTTATAACGGAACAGTCGAATGGGCCAGCGCAACTGCCGTAACGAACCACGTCATATGGTTTTCCGGCTGCGGTGGCATCTTCCGTTGCGCAAATTGAGAATCTTTCCCGTGGATTCTCTTTCGGTAGCAGGGTGTTCGCCGTCAAGGGCAGTTCCTGAATCAGGCGACCCCATTCGTATCAATTCCAGCGTATTTCCAGCCCGTCAGGCCCGGTAGCCCGACGTTAACTGGCTGGTGGTTATAGTAAAACGCCGATGCCCCTGCCATCCGTGGGCCGGTGTGAATGCGCGTGATGGGCCGATACATCCGGAATAGCCTTCTGTTGTCACGCCTGCGGCATCGTCTATGCCCTGGCCTACTGCAAAACAAACTGACTCTGCATTGACGCCCATCCCGCGTGTTCCTTTTCTGCACCGCTTCAGCCCGCCTTCGCGTGCGCAGGAACTGGCGGTTCAGGCTGTCGGTGATGGTGATGCAGGTCAGCTCTCATGCGGCCGATATTAACCGGCACTGCCGGGTTTTAGCTGTTCTGCCGCCATTCGCTGTCATTAACGGTAACAGATTTCCGGTCGGCCCGTGTGACGGTGCGCCACCGCTCCGGCCGGTATTTATCATCGTAAGTAAAACTGCGCTGTATTGCTGCGGTCATACACGCCGCAGTTCGCCGCGGGGCGTCCAGCCATAGCGCACCAACTGGCGTGACGGGTAGAATTCTCCGGATATTCCGGGTCATGCGTCAGCCACGGCAGCGAACCGGGCTGGATGCCGTTAACGACCATATTCGGTGTAACCAGCAGGGTATCAGGGCGCCGGACGGTTCCGTCCGCCGGAAATGGCCTGCTGCCGGCTTCTTCTGCCCGCTGTGCCTGCGTGGTCCAGTACCAGCCGTGACGCGGCATATCCGTCACCAGTGTTTAGCCGCTGAATTCTGCGTTCGCGGTCGGAACGATATTGTGCTTTGCGAAGCGGTCCACCAACCGATTCAGTATTCCCGTGCGACGGCGCAGGCAGCACCTCATCAACCGACACCCGCTCACGCCAGCCGAGCAGCCACCACGGCCCTGCGGACTGTCGCCAGATAACGATGCGGACTTAAGCAGGTTCTTCCGGCAGCGCCTGGCAGAGTGCACGCGGCCAGCCGGTGACCGCTATCCAGTTTCGCCGCCGCCGCGCAGCCACAGTGACTCGCTGCGGCGCAACCGTCGCCGAAACAGATTGCGCTAATAAAGGCTTCTGCCGCCGCGTTGTCACTGAGTATCAGTGTGTTATCATACTGGCTGTAAGCGGATATCCGCAGGCATTTTCCAGCCGGGGCCAGGCCAGCGCGGGCGTTTTGTGCGGCACTGTAGTGCGGGAAGAATGTTGACAGCGGTAAGGGCAGGCGATGTCAGGTTTCACCGGAGGACCTTTGCACCGAGCGGCAGATTGACCGGATGGCCGGACGTCTTTGGCTGCGGGCACACCGAACCGAGCGCCGGTGGGGCACCGATGCATTACCCGGCTGAACCCTGTGGACAAATGCTACCCGCCATACTGCGATATGTCGCCTGTGCGCGCCGCCGGTTTTCCGCTCATCTGCTCATCCTTGTTTATTCGGGTTGTTTGTCGCTTTGACGGTGAAACCCTGGGTTGTAAAGCAACAAGATGAGATATCTGTCAGATAGAACAATTGGAAAATGTTTACTGTATTTCATGAATATATGTTTCCGATTGGTATAACGATAAAATGTTCCTGCAGACATCTTCACAATGCACAAAAACCATGACGGCGTTTTCCGCTGGCGGTTTTCAATATTCAAAATCAACAATCAATAAAATCACCAGTTGCTGCTTTTCGGCCTGATCCATCCGCAGTTTATCGCTGGTTTTCGACCAGACGCGGAATGCCGTGGCACAAAGAAAGCGGGACGCAGTCTTTCCCAGAAAAGCATGAAAGGCAACCGGAACGCCCGCGCTGCGGGTTTATTTAAACAGACGCCGAAGACGAAGAAGAGGGGT
+>c2ba4328-d217-4343-a959-874cf5addce4
+TCGGTAATACTTCGTTCAGTTACGTATTGCTTTTCTGTTGGTGCTGATATTGCGGCGTCTGCTTGGGTGTTTAACCTTGAGTGACGCCCGGCACCATCCGTCACGCCAGTGATTTCGCCGCTGAATTCACCAGCGGCTTCGCCATTCAGAACGTCTGGCATGCGCCCGAAGCGGTCCACCAACCAGTCAATTACCCGGTACGGCAGCGGCGGCGCAGGCAGCACCTCATCCTTCCGGCGCCCGCTCACCAGCCGAGCAGCCTGCAGCCCTGCGGACTGTTTGTCGCCAGATAACGATGCGGACTTAAGCAGAAGTTCTTCCGGCAGCGCCTGCCAGAGTGCGGCCAGCCGGTGACCTTCATCCGTTTCGCCACGCCGCCGCGCACCAGCCACAGTGACTCGCTGCGGCAACCGTCCTCACCGGGGAAACAGGTGCTCAAAATGCAGGCTTCTGCCGCCGTTATCACTGAGTATCAGTGTGTTATCCCTTGCAACTGGCGGATATCCACCAGGCATTTCCAGCCAGGCCAGGAGGCTCCCCACCGGCGCGGGCGTTTTGTCCGGTAACTGCTGTAGGTGCGGGAAGAGATGAACGGCAACGGGCCGGAGCAGGGAACTGATGTCGGTTTCACCAGGAAGGACCTTTGCACCGAGCAGCGGATTGACCGGATGTGGGCGTCACCCCCGCCAGGCACACCGAACAGGCCACGCCAGTGGGGCTTCGATGCGTACCCCGGCTGAACCCTGGACAATGCCGCACCGCCATACCGCGTCATGTCGCTGACGCACCGGTTTCCGCTCATCTGCTCATCCTTGTTTATCAGGTTGTTGTCTGCTGACAGGCGAAGGCCTACAAGATTTATAAAGAAAGCCTTAAGTGCCAGAGATATCTGTCAGATAAGAACAATTAGGAAAAGAAATATTTATGCTATATTTCATGAATATGTTTCGATTGGTATAACGATGTCTAATGTTCTCAGACATCTTCCTGATACGAAAACCGCCAGCGTTTCCGCGGCGGAACTGTATTCAAACTCGCTTAATCAATAAAATCGCAGTTGCCTTTTCGGCTGATCCATCCACACCGGTTTTATCTTTGGTTTTCGACCAGACGCAGTACGGAAGTGAAAGCTGTAAAGCGGGCGCGGTCTTTCCAGAAAAGCATGAAAGGCGGCGCGCCAGGTGCCCGCTACCAACCGCATAAGTACGGCGTAAAAAGTAAGCCATGCAGGATATTCTCTGTAGAGTTCCATACTTTTCCCCTTTTGTATCTACCCGGTGGATGGCACCGGAAAAAATGGGATTTGTTTATCTGGTGAAAATAGTGCCTTTTGTGTATTTTACTACTCATCCGACCACTTATTTTGCTTATTGATGGTTTATTTATTCATCCTGTAATTAAGTTACACAAGGTTAAATTAATGCCGCAAACATTAGTTAAATCATGGCTTTTTGCCATTTTTATACTTTTTACACCCCGCCCGCAGATTTTGCCGAAATCTTGCAGCCAGAATTCTACCCTTCCGGTATCACTTTTTAGGCCGCTGGAGGTGCTGTATGAGTGCAGGCGTGATAACCGGCATATTGCTGGTGTTTTTATTGCTGGGTTATCTGGTTTATGCCTGATCAATGCGGAGGCGTTCTGATGGCTGCGCAGGGTTCTTACTGATCGCCACGTTTTTTACTGGTGTTAATGGTGCTGGCGCGTCCTTTAGGCAGCGGGCTGGCGCGGCTGATTAACCGATACCACTCTTCCCGGTACAACGGGCGTTGAGCGCGTACTTTCGCGCGCCGGCGTCTCTGACCGTAAGAGATGAACTGGAAACAATATCTTTATTCTCGGCACAGAACGACCAGGGCTGGCGGTGCTGTTTTATCGGCATTGCTCGGTCAGCACTATCTGCCGCTTAATCCACAGCAGTTGCCAGGGCTGTCGTAGGATCTGGCGCTGAATACCGCCGTCAGCTTGTCACCAATACCAACTGGCAATCTTTATAGCGGTGAAACCACGTTGAGCTATTTCAGCCAGATGGCGAACTTAACGGTGCAAAACCAACCTGCCGCCAGCGGGATTGCGGTGATTTTGCCTCATCATTGCGTTTACCCGCCAGAGCATGAGCACGGCTTCAGGGTCACCTGGGTCGATCTGCTCGCATCACGTTATGGGTGCTGGTCCTGTGGCGTTGTTGATTGCACTGTTTTTATTCAACAAAGGTGCGCTGCAAAACTTGTATCAGGCTGTGAATACCGTTGAAGGGCGCAGCAGCTGTTACCATGGGGCCTGCTTCTCGGGAAGCGGTCAAGATGCTCGGTACTTAACGGCGGTGGCTTCTTTAGTAACTCGTCGCATCCGTTTGAAAACCCAACCGCACTGAAGCCAACTTCGTGCGATGCTGGCGATCTTCATGATCCCCAACGGCGCTGTGCTTTGCCTTTGGTGAAGTGATGGGCGATCGCCGCCAGGGGCGCCATGTTGCTGTATGGGCGATGTCGGTGATTTTGTCATCTCTGCGTAGGCGTGGTGATGTGGGCCAGAAGTTCAGGGTAATCCTCATCTGTTGGCACTGGGCACGGACAGCAGCATCAATATGGAAGGTAAAGAAACCGTTTTCGGCGTGCTGGTCAGTAACCTGTTTGCGGTCGTAGCGACGGCGGCTTCCGCAATGGCGCGGTGATTGCGATGCATGTTCGTTTACCGCTCCTCGGTGGCATATTAGTGCCGATGCGGCTGATGCAGTGGTGAAGTGGTGTTCAGCGGTGTCGGTTCTGGTCTTTGGCATGATGCTGTTTTGTCCTGCGGCGGTGTTGTGCCGGGCTGATGATTGGTCGTACACCGGAATATCTGGGTAAAATCGACGTACGCGAAGACGAAACTGACTGCTGGCAATTCAGTTTGCCCCGACGCTGGTACTGATGGGCGCGACGTTGGCGATGATGACCGACGCCGGACGTAGCGCCATGCTCAACCCTGGCCCGCATGGTTTTAGCGAAGTGCTGTACGCCGTGTCATCCGCCGCTAACAGCAGCGGCGCCTTTGCCGGATTAAGCGCCAACTCTCCGTTCTGGGCATTTTACTGGCGTTCTGCATGTTTGTCCAGTCGCTTCGGGGTGATTATCCCGGTGATAGCAATTGCCGATCGCTAAGGTGAGTAAAAAGGCAAACCGCCAGCTCCGGCACGCTGCTTAACCACGGCCCGCTGTTTGTTGGCCTGTTAATCAACCGTGTTGCTGGTTGGCGCACTGACCTTTATCCTGCCCTGGCGCTTGGTCCGGTGGCGGTCTCTCTCTGATGATATTGAGTGAGCGCTGAATATGAGTCGTAGCAACTGGCGCTATTCGAACCAACACTTGTCGTTTCAGGCGCTGAAAGAAGCGGTGAAAAAATTGAAGCCCACCAGGCGCAATGGCACCAATCCGGTGATGTTTATCGTCTGGATCGGCAGTCTGCTGACCACCTGTATTAGCATCGCGATGGCAAACGGTGCGATGCCCGGCTGTCGCTGTTTAGCGCGGCCATTAGCGGTTGGCTGTGGATCACCCGTACTGTTCGCTAATTTCTAGCCAGAGGCGCTGGCGAAGGCCGCGGTAAAGCGCAGGCCAACAGTCTGAAAGGGTGAAAAAAACTGCTTTGCCCGCAAGCTGCGTGAGCGAAATATGGCGCTGCGGCAGACCAAAGTTCTGCCGACCAACTTCGTAAAGGCGATATCGTACTGGTAGAAGCTGGCGATATTATCCCCTGCGATGGTGAAGTTATTGAAGGGTGCATCGGTCGATGCCAGCGCCATCACCGAGAATCAGCACCGGTGATCCGTGAATCGGCGGCGATTTTGCCTCCCGTCACCCGGCGGCACGCGTATTCTTTCTGACTGGCTGGTGATTGGGTGTAGCGTTAACCCCGGCGAGACATTTCTGGATCGGATGAGTCTGCTGATGGTGGAAGGCGCACAGCGACGCAAACGCGAACAAAATTGCCCCGGCCATTCTGCTGATTGCCCCTGACTATCGCGTCTTTTTTACTGGCAGCCGCCACGCGCTGTATGCGTTTTCGCGTGGGGCGGTAATGCAGTCAGCGTAACGGTACTGGTAGCTGCTGGTCTATGTCTGATCCCAACCACTATTGGCGGCCTGTTGTCAGCGATCAGCGTCGCCGGGATGAGAGCCGGATGCTAGCAGGCGCGAAGTGTGGTGCCACCAGCGGACGATGCGGTTGAAGCGGCGAGTGGCGTTGACGTTCTGCTGCTGGATAAAACCAGCACCATCACACTCCGGTAACCGTCAGGCGTCGGGTTTATCCCCGCGCAGGGCGTGGATGAAAAAACGCTGGCTGACCTTACTGTAGCTGGCTTCGCTGGCTGATGAAACGCCGGAAGGCCGCGGTATTGTGATCCTCGCCAAACGGCGTTTTAACCTGCGCAGGCGCGATATTGCAGTCGCTCCATGCCACCTTTGTACCGTTTACTGCGCAAAGCCGGATGAGCGGGATCAGCATCGACAACCGCATGATCCGTAAAAGGTTCTGTCGTGCCATTCGTCGCCATGTTAGGGCTAACGGTGGTCACTTCCCTACCGTGTTGATCAAAAAGTCGATCAGGTTGCGCGTCAGGGAGCCGCTTGCCGCTGGTGGTGGTGGAAGGTTCTCGTGTGCTGGGCGTTATTGCGCTGAAAGATATCGTCAAAGGCGGCGGTAAGAGCGCTTCGCCTTTACTTAAAATGGGCATTAAAACGGTGATGATTACCGGCGATAACCGTCTGACTGCCGCCGCGATTGCTGCGGAAGCGGGTGTCGATGATTTTCTCATGAAAGCGACACCGGAGGCCAAACTGGCATTGATCCGTCAGTATCAGGCGGAAGGTCGTTTGGTGGCGATGACCGGCGACGGCACCAACGATGCTCCGGCGCTGGCGCAGGCAGATGTCGCGGTAGCGATGAACTCCGGCACCCGGGCGGCGAAAGGCGGGCAATATGGTCGATCTCGACTCTAGCGACAAGTTGATCGAAAAGGTGGTGCACATTGGCAAACAGTGCTGATGACCCGGTGGCTCGCTGACCACCGGCATTGCCAACTTGATGTGGCGAAATACTTCGCCATTATTCCGGCGGCATTCGCGGCAACGCGTATCCACGCAGTTAAATGCGCTGAACATCATGTGCCTGCATTTCGCCCGACTCCGCAATCCTCAGTGCGGTGATTTTCAACGCCTTGATTATCGTCTTTTTGATTCCCCTGGCGTTAAAAGGCGTGGAGTTACAACCGCTTACCGCTTCTGCCATGTTGCCATGTATGGATTTACGGTCTGGGTGGAGCTGCTGGTGCCGTTTATCGGTATCAAAGTCATTGATTTACTGCTGACCGTTTGCGGTCTGGTGTGAGTTTACCATGGTGGATTACGTCCGGCATTATCAGCATTTGTCTTTCTGTTATTGATTGCTGGCGGCGTTTACCCGCTACTGACCACCGTACTGGGGCAATGGTGGTTTCCTGGCAGGCCAATGGTTCGTTGATTCGTGAAGGTGATACGGTGCGCGGTTCGGCATTAATCAGGCAGAATTTTACCGGCAGCAGCTATTTTCATGGTCGCCCGTCGGCAACGCCGAAATGCCTATAATCCACAGGCTTCTGGCGGGAGCAATCTGGCGGTCAGTAACCACCAGGCTGGATAAACTAATAGCCGCACGCGTTGCTGCATTACGGGCCGCTGGCGGATGCCGGCGCAGGCGTTCGGGTTGAACTGGTGACGGCATCGGCAAGCGGGCTGGACAATAATATCACCCCGCAAGCGGCGGCACAGCAAAATCCCACGCGTGGCGAAAGCGCATGTATCTCAGCGTTGAACAGCTCACACAACTGATCGCAAAATACAGCCAACAACCGCTGGTGAAATATATCAGCCAGCCAGTTTGTCAACATTGATGAACTCAATCTGGCGCTGGATAAACTTGATGAATAGCGAACCCTTACGTCCGGCCCCGATCGTCTGCTGGAGACAAACTGCACCGCGCCGCATCGGGAAGCTGAAAGTTTCTTCGGTGCCTGTGCAGGCGTCAGGAAGACCTGGGCGATGCTGGCAGAAGCCCAGCGACTGCTGACTGGGAAGACTGGATATTGTGGTTGGCGTGGTAAAGGAAACCCACGGGCGAAAGATACCGCCGCCATGCTGGAAGGGCTGGCTGTTCTGCCGTTAAAACGCCAGAGCGTACCGTGGGCACGGCATATCAGCGAGTTGATCTCGATGCCGCCCTCGCCGCCGCCCGGCGCTGATCTTAATGGACGAACTGGCGCACGGTAATAGCGCCCGGGTTCCCCGTCATCCCAAACGCTGGCAGGATATCGAAGAACTGCTGGAAGCTGGCATTGATGTTTTCACTACCGTCAACGTTTAGCGTCTGGAAAGTCTGAATGATGTGGTCAGCGGCGTCACCGGAATTCAGGTACGGGAAACCGTGCCCGATCCTTTTCGATGCCGCCGACGACGTGGTGCTGGTGGACTTGCCCCGGACGATCTGCGCCAGCGGCTGAAGAAGGCAAAGTCTATATTGCCGGAGCAGGCGGGCGCGCCATGAACATTTTTCATAAAGGTGAAATCCCAGTCGCCCCGCGCGAGTGGCACTGCGCCGTACTGCCGATCGCGTTGATGACAAATGCGCGCCTGGCGGGGGGCATCTGGCGAAGAGAAAGTGTAGCACACGCGACGCGATCGCTTTTATGCATCGGCCGCACCGGCGGCGAAAAACTGGTCGCGCGGGAGGCGCTATTAGCGTCACAGCTGGGTGGCGTCTGGCACGCGGTGTATGTTGAAACCCCTGCCCTGCACCGCTACCGGAAAAAAACGTCAGACGTTCTCAGCGCCCGTCCTGGCGCAGGAACTGGGCGCGGAGACAGCAACACTTTCTGATCCAGCGGGAAGAGAAAGCGGTAAGTGCGTTATGCCCGTGAACATAAATCCTCAGCAAGATTATTCTCCGGTCGCCCGGCCTCGCGCCGCTGGTGGCGTCGAAACGTTTGCTGACCGACTGAAAAGCTTGCATCACTGATCTCGATCAAAGTGCTGGTCGCGCTTGATGAACCGCCCGCCCGCACGATTAATAACGCGCCGGATAACCGCTCTTTTAAAGACAAATTGGCGTGTACAAATTCAGGGATGCGTAGTTTGCCGCCGCGTTATGCGCCGTTATCACCTTACGTGCCATGCAGTGGCTGATGGCGTTGATGCCGCCAACCTGGTGATGCTGTATCTGCTTGGCGTGGTGGTGGTGGCGCTATTTTATGGACAGGTTAAACACCGGCAGACGCCGAAGATAGGCGACAGGCAAGTAGCAATACGTAACCG
+>bbe44e2d-c0b1-4a30-997b-7a077a66c189
+CCCCTCGGTATTGCTTCGTTCAGTTACGTATTGCGCTGCGCGCATAAACTCTATCTTCGGCGTCTGCTTGGGTGACAACCTCCGACGCCCAGCCCGGTTACCGAAGTGTGATGGTGCCGGTTTATCCAGTAGCAGAACGTCAACGTCTGCCGCTTCAGCTGCGTCCGCTGGTAGCGAATCACATTCGCGCCTAACATCCGGCTCCATCCGGCGACGCCGATCGCTGACAACAGGCCGCCAATAGTGGTTGGGGATCAGACAGACCAGCAACGCCACCAGTACCGTTACGCTGACTGCATTACCGCCCACGCGGAAAACGGCCACAGCGTGGCGGTTGCCGATAAAAAGACGATAGTCAGGGCAATCCAGCCCAGAATGGTCAGGGCAATTTCGTTCGGCGTTTTGCGTCGCTGTTAGCCTTCCACCATCGCGATCATCCGATCCAGAAATGTCTCGCCGGGGTTAACGCTACACTCAATCACCAGCCAGTCAGAAAGAATACGCGTGCCGCCGGTGACGGAGGCAAAATCGCCGCCGGATTCACGGATCACCGGAGTGCCGGTTCCCCGGTGATGGCGCTTTCATCGACCGATGCACCCTTCAATAACTTCACCATCGCGGGGGATAATATCGCCAGCTTCTACCAGTACGATATCGCCTTTGGTTGGTCGGCGGAACTTTGTCCGCCGCAGCGCCATATTTCGGCTCACGGCTTGCGGGCAAAAGGCGGTTTTACCTTTCCGGAACTGTTGGCCTGCGCTTGCGCCGCGGCACTTCTGCCAACGCCTCCACGGCGAAATTAGCAAGAACAGTACGGTGATCCACAGCCAACCGCTGTGGCCGCGCCTTAAACAGCGCATTGCCGGAGCATCGCACCTTTATCGCGATGCTAATACAGGTGGTCAACGGGCTGCCGATCAGACGATAAACATCACCGGATTGCGCCATTGCGCCTGCGCAGTTCATTTTCACCGCTTCTTTCAGCGCCTGAACGACAAGTGTTGGTTTCGAATAGCGCCAGTTGTTTACGACTCATATTCAGTGCTCACTCAATATCATCAGGAGAGATATTTCGCCACCGGACCAAGCGCCAGGGCAGGGATAAAGGTCAGTGCGCCAATAACTTTGATTGCCGATTAACGGCCAACAAACAGCGGGCCGTGCGTTTGGCATGATACGAACTGGCGGCAATGCACCAGCAGACGGTTACCATCCGCAGGATAATCACCCAGAAGCGACCGACAAACATGCAGAACGCCAGTAAACGGTTCCAGAACGGAGGTGGCGCTTAATCCGGCAAAGCGCTGCCGTTGTTGTTAACCCGGCGGATGACACGGCGTACAACACCTCGCTAAAACCATGCAGGGCCAGGGTTGAGCATGGCGCTACGTCCGGCGTCGGTCATCATCACCAACGCCGCGCCCATCAGCACCAGCGTCGGGGCCTTAGAATTGCCAGTGCAGTCAGTTTCATCTCGCGTACGTCGATTTTTGCAGATGTTCGAATTGTACGACCAATCAGCCCGGCAATAAACACCGCCAGCAGGACAAACAGCATCATGCCGGCAAGACCAAGGGCCGACACCGCCGAACACCACTTCACCCAATTTGCATCAGCCACATCGGCACCATGCACCGAGAGCAGTAAAACGAATCATGCATCACCCAATCACCGCGCCACAGGAAGCCGCCGTCATCACGACCGCAAACTGGGCTACTGACCAGCACGCTTGAAACAGCTCTCTTTACCTTCCATATTGATGCTGCTGTCCGTGCCCAGTGCCAGCAGATGAGGATTACCTGAACTTCTGCCCACATCACCACGCCTACGCAGATGACAAAAATCACTGATGACATCGCTACAGCAACATGCGCCCCTGGCGTGATCGTATCACTTCTGCAAAGGCAAAGCACAGCGCCGTTGGGATCAAAGAAGATCGCCAGCATCTGCACGAAGTTGGTCAGTGCGGTTGGGTTTTCAAACGGATGCGACGAGTTGGCATTAAAGCCGCCGTTAATTGCAGGCATCTTGATCGCTTCTGAAGCTACAGGCCCCATGGGTAACAGCTGTTGCGCTCCTTCAACGGTATTCACAGCCTGATAAGGCGAAAGAAGTTTTGCAGCGCACATTGTTGAATAAAAACAGTGCAATCAACAACGCCACGGGGACTAGCACCCATAACGTGATGCGTAGCCAGATCGACCAGGCATTCCCGAAGCGTGCTCATGCTCTGGCGGGTAAACGCACGGATGAGGGGCAAAAATCACCGCAATCCCGCTGGCGGCAGAAGAAAGTTTTGCACCGTTAAGCCGCCATCTGGCTGGAAATGGCTCAACGTGAACTTTCACCGCTATAAGATTGCCAGTTGGTATTGGTGGTAAAGCTGACGGCGGTATTCAGCGCCAGATCACGACAGCTGGCAGCTGCTGGATTAAGCGGCGGATAGTGCTGACCGAGCAACGCAAAAAAACAGCACCGCCAGCCCCAGCATGTTCAGGCCGGGGAATAGCACAAAAGATATTGCTTCCAGTTCATCTTACGGTCAGAGACGCCAAGTGCGCGAAAAGTACGCGCTCAACGCCCGTTATTGCCGGGAAGAGAATGTCATTAATCAACCGCGCCAACCCGCTGCCTAAGGACGCGCCAGCACCATTAACACCAGTAAAGCAATGGCGATCAGTAAGAACCCTTGCGCAGCCATCAGGAACGCCTCCGCATTGATCAGGGGCATAAACCAGATAACCCAGTAATAAAAAACACCAGCAATACGCCGGTTATCACGCCTGCACTCACAGTGCACCTCAGTGGCCTAAAAGAAGTGATACCGGAAGGGGTAAATTCTGGCTGCAAAGATTTCGCAAAATCTGCGGGCGGGGTGTAAAAGTATAAAATGGCAAAGCCATGATTTAACTAATGTTTGAAGTATTAATTTAACTTTTGTGTAGCAATTACAGGATGAATGTAAATAAACCATCAATAAGCAAAATAGAGTGGTCGGATGAGTAGTAAAATTACACAAAAGGCGGTACTATTTTCATCAGATAAACAAATTCATTTTTCGGTGCCATTCACCGGGTAGATACAAGGGAGAAAAGTATGGAACTCTACAGAGGAATATCGCCAAGCAAACTATCTTTTACGCCGTACTTATGCGGTTGCAGCGGGCGTTCTGGCGCTGCCTTTCATGCTTTTCTGGAAAGACCGCGCCCGCTTTTGCAGCTACCTGCATCGCGTCTGGTCGAAAACCAGCGATAAACCGGTGTGGATGGATCAGGCCGAAAAAGGCGACTGGTGATTTTTATTGATTGCTGAGTTTTGAATACATTGAAAACCGCCAGCGGAAACGCTGGCGGTTTTTTCTCAGGAAGATGTTCAGAGGAATATTTAGACATCGTTATACCAATCGCGAAACGCCATGAAATATATAAATATTTTCCTAATTGATTTCTTATCTGACGGAATATCTCACTTAAGGCTTTCTTATAAATCTGTAGGGTTTCGCCTGTCAGCAGACAAATAACTCGATAAAACAAGGATGAGCAGATGAGCGGAAACCGGCGGCGCGTCAGGGCGACATGACGCAGTATGGCGGTAGCGTCAGGGTTCAGCCGGGGTACGCATCGGTGCCCCCACCGGCGTGGCCTGATCGGTGTGCCCCGGCGGGGTGACGTCAGCCATCCGTCAATCAACTCAGTGCAAAGGGTCCTTCCCGAGTGAAACCGACATCGCCCTGCCCGGCCCGCTGCCATTCATTCTCCGCACCTACAGCAGTTACCGGACAAAAACGCCCGCGCCGGTGGGGCCTCGGCTTCGGCTGAAAATGCCTGCGAGATATCGCTTACAGCTGCGCGATAACACACTGATACTCAGTGATAACGGCGGCAAAGCCTGTACTGACACCTAACGTGAGGACGGTTACGGCCGCAGCGAGTCACTGTGGCTGGTGCGCGGCGCGTGGCGAAGAACTGGATGAAAGGTCACCAGCTGGCCGCGCTCTGAGCGCTGCCGGAAAAGAACTCCGCTTAAGTCCGCATCGTTATCTGGCGACAAACAGTCCGCAGGGGCCGTGGTGGCTGCTCGGCTGTGGTGTGAGCGGGTGCCGGAAGCGGATGAAGTGCTGCCTGCGCCGCTGCCGCCGTACCGGGTACTGACCGGGCTGGTGGACCGCTTCCGGGCGCACACAGACGTTCAAAGAAACGCCGGGTGAATTCAGCGGCGAAATCACCGGCGTGACGGATGGTGCCGGGGCGTCACTCCGGCTGGTACTGACCACGCAGGCGCAGCGGCAGAAGCCCGGCAACAGGCCATTTCCGGCGGGACGGAACCGTCCGCTTTTCTGTTCTACCGGGTTACACCGAATATGGCCGGAACAACGGCATCCGTCTGTCTGCCGTGTGGCTGACGCACGACCCGGAATACCGGAGAATTTACCTGCCGCGCCGCTGGTGCGCTATGGCTGGACGCCCGCGGCGAACTGGCAGCGGTGTATGATACAGCAATACACAGGTGCGCAGCTTTACTTACGATGATAAATACCGGGGCCGGATGGTGGCGCACCGTCACACGGGCCGACCGGAAATCACCGTTACGACAGCGACGGGCGGGTGACGAACAACTAAACCGGCAGGCTTAGTTACGCGTATCAGTATGAGAAGGACCGCATCACCATCACCGACAGCCTGAACCGCCGTGAAGTCCATACTTACGCAAGGGTAGAAGGCAGGCTGAAGCGGGTGATGAAAGGAACACGCGGACGGCAGCGTCACGCAGAGGAATCAGTTTGACGCGGTGGGCAGGCTCAGGGCACAGACGGATGCGCAGGCAGGGACAACAGAATACAGTCCGGATGTGGTGACGGGCCTCATCGCGCGCATCCGCCGCCGGATGGCAGGGCATCGGCGTTTTACTATAACCACCACAGCCAGTTAACGTCAGCCACCGGGCCTGACGGGAACCAGGCTCGCCGGGAATATGATGAATGGGGCCGTCTGATTCGAAACTGCCCCTGACGGCGATATCACCCGCTACCGTTATGATAATCCACACAGTGACTTACCCTGCGCAACGGAAGATGCCGGCAGCGGAAAACCATGACGTGGAGCCGTTACGGTCAGTTGCTGAGCTTCATGACTGTTCCGGTTATGTAACCCGCTATGGCCGTAACCGTTTTGGTCAGGTGACGGCGGTGCACCGCGAGGCTGAGTCAGTACCGCGCCACGACAGCCGTGGACAGTTAATTGCCGTGAGAAAGACACGCAGGGCCATGAAACGCGGTATGAATACAACAGGTTAAACACCGGCAGACTCCGCAATATCAGCGTAG
+>b070b35d-1771-4ec6-9fde-9d52b973d2d5
+TTGTTGGCACTTCGTTTCAGTTACGTATTGCTCTTGCCTGTCGCTCTATCTTCGGCGTCTGCTGGGTGTTAACCTAACCAGGCTGCAAGCCAGCACGCCGACAGCTCTTACCTTCCATATTGATGCTGCTGTCATTGCCCAGTGCCAGCAGATGAGGATTCACCCTGAACTTCGCATCACCACGCCTACGCAGATGACAAATCACTGACATCGCCCACAGCAACGCGTACGCCCCTGGCGTGATCGCCCATCTACTTCACCAAAATGCGAAGCACAGCGCCGTTGGGATCAAGAAGATCGCCAGCATCTGCACGGAAGTTGGTCAGTGCGGTTGGGTTTTCAAACGGATGCGACGAGTTGGCATCAAAGAAGCCACCGCCGTTAGTACCAAGCATCTTGATCGCTTCCTGGCTACAGGCCCCACATAGGTACTTTAGCTATTTGCGCTCCTTCAACGGTATTCACAGCCTGATAAAGGCCAGAAAAGTTTCGCAGCCGCACGCTTGTTGAATAAAAAACGGTGTGCAATCAACAACGCCACAGGACTAGCACCCTTAACGTGATGCGTAGCAGATCATTGAGCATTCCAGGCGTGCTCTGGCGGGTAAACTGCCACGGATGAGGCAAAATGCCGCAATCCCGCTGGCGGCAGAAGAAAGGATTTTACCGTTAAGCCCGCCATCTGGCAAATAGCTCAACGTGGTTTCACCGCTATAAGGTGCCAGTTGGTATTGGTATTAAGCTGACGGCGGTATTCAGCGCCAGATCCCACGACAGCCTGGCAGCTGCTGTGGATGGCGGCGAATGGTGCTGACCGAGCAACGTAAAAAGCAGCACCGCCAGCTGGCATGTTCGGGCAGAATGGCACAGATATTGCTTCCAGTTCATCTCACGGTCAGGACGCCAGTGCGCGAAGAAATTGCGCGCTCAACGCCCGTTGTACCGGGAAGGAGGAATGTCGGTAATCAGCGCATAGCCCGCTGCCTAAAGGACGCGCCAGCACCATTAACACCAGTAAAAACGTGGCGATCAATGCAGGCCTTGCGCAGCCATCAGAACCGCCTCCCGCATTGATCAGGGCATAAGCCAGATATTGATAATAAAAACACCAGCAATACGCCGGTTATCACGCCTGCCTCTGAGTGCACTCAATTAGCCTAAAAGTGATACCGGAAGGGTAGAATTCAAACACCAAGATTTCGCAAAAATCTGCGGGCGAAGTGTAAAAAGTATAAAATGGCAAAGCCGCGGTTTAACTAATGTTTGGTATTAATTTAACTTTTGTGTAACTTAATTACAGGATGAATGTAAAATAAACCATCAATAAGCAAAAATAAGTGGTCCGGATGAGTAGTAAAATTACACAAAAAGGCGGTGGCTTTTTCATCAGATAAACAAATTCGTTGCCGGTGCCATTCACCGGTAGATAAAGGGGAGAAAATATGGAACTCTACAGAGAATATCTGCACCGACATCTTTTTCGCCGTACTTATGCAGTTGCAGCGGGCGTTCTGGCGCTGCGCTTTCATGCTTTTCTGGAAAGACCGCCCGCTTTACAGCTACCCATCGCGCGTCACGAATAAAAGAAAACCGCTGATAAACCGGTGACGGATGGATCAGGCCGAAGGCAACTGGTGATTTTATTGATTGCTGAGTTTTGGGCCGGGCGAAAGCCGCCAGCGGAAACGCTGGCGGTTTTTGTATCAGGAAGATGTTCAGAGGAATATTTGTTGCTCCCGTTATGCCAATCGAAACATATATTCATGAAATGTATATAAATGTTACCTAATTGTTCTTATCTGACAGATATCTCACTTAAGGCTTTCTTATAAATCCATGGGGTTTCGCCTGTCGGCAGACAAATAACCCGATAAAACAAGGATGAGCAGATGAGCGGAAAACCGGCGGCGCGTCAGGGCGACGCGCGGCGCCTCAGTATGGCGATAGCATTATTCAGGGTTCAGCCGGGGTACGCATCAGTGCCCCCACCAGCCGTGGCCTGTTCGAATTGACCGCTGGCAAGTGTGACATCCGGCCATCCGGTCAAATCCGCTGCTTTCGGTGCAAAGGTCCTTCGGTGAAATACGGCATCGCCCTGCCCGGCCCGCTGCGTTCATTCTCTCCGCACCTGGCAGTTACACCGGACAAAAACGCGCGCCGGTGGGGAGCCTCGGCTCCAGCTGGAAAAATGCACGGATATCCGCTTACAGCTGCGCGATAACACACTGATACTCAGTGATAACAGCGGCAAACGCAATATTTTGAGCACCCTGTTTCCGGTGAGGACGGTTACAGCCAGCGCGTCCTGCTGTGGCTGGTGCGCGGCGTGGCGAAACTGGATGAGTCTGGCTTTATTTTATCGGCAGGCGCTGCCGGAAGAACTCCACTTAAGTCGCATCGTTATCTGGCGACCGACAGTCCGCAGGGGCTGGTGGCTGCTCCGGCTGGTGTGAGCAGATTGCCGGAAGCGGATGGTGCTGCCTGCGCCCACTGCCGTACCAGGTACTGACCGGGCTGGTGGACGCTTCAGGCTGGGCGTTTGTTCCACCATAAAGCCACCGGTGAATTCAGCGGCGAAATCACCGGCGTGACGGATGGTGCAGAGCGTCTTTTCAGCTGGTACCCCACGACCCGCGCAGGCGCAGCGGGCGAAGAAGCCCGGCAGCAGGCCATTTCCGGCGGGGACGGAACCGTCCGCTTTCCTGATACCCTGCGGGTTACCGAATATGGCCGGGACAACGGCATCCGTCTGTCTGCCGTGTGGCTGACGCGCACGACCGGAATACGGAAATTTACCTGCCGCGCCGCTGGTGCGCTATGGCTGGACGCCCGCGGCGAACTGGCGGCGGTGTATGACCGCAACAATACACAGGTGCGCAGCTTTACTTACGATGATAATGCCGGGCCGGATGGTGGCGCACCGTCACGGGCCGACCGGAAATCTGTTACCGTTACGACAGCGACGGGCGGGTGACAGAACAGCTAAACCCGGCAGGCAGTTACGCATCGGTATGGAAAGGACCGCATCACCATCACCGACAGCCTGAGCCGCCGTGAGAGTCCTGCACGCAGGGTGAAGGCGGGCTGAAGCGGGTGGTGAAAAAGGAACACGCGGACGGCAGCGTAAACGAAGTCAGTTTGACGCGGTGGGCGGGCTCGGGGCACAGACGGATGCCGCAGGCAGGACAACAGAATACAGTCGGATAATGGTGACGGGCCTCATCACGCGCATCACCACGCCGGATGGCAGGGCATTGGCATTTTATATAACCACCACAGCCAGTTAACGTCGGCCACCGGGCCTGACGGCGGGCTGGAAATACGCCGGGAATATGATGAATGGGGCCGTCTGATTCAAACTGCCCTGACGGCGATATCACCCGCTACCGTTATGATATCCACACGGTAACACCCTGCGCAACGGAAGTGCCACCGGCGGCGGGAAAACCATGACGTGGAACCGTTACGGTCAATTCTGAGCTTCACCGACTGTTCCGGTTGTAAACCCGCTATGACCATGATACGTTTTGGTCAGGTGACGGTGCACCGCGAGGAAGGGGCTGGTCAGTACCGCGCATACGACAGCCGTGGACGGTTAATTGCCGCTGAAGAAAGACACGCAGGGGGCCATGAGCATGGTATGAATACAACGCCGCCGGTGACCTGACCACCGTCATTGCCCGGACAGCCCTTGAAACGGGACAATTACGATGCGTGGGGAAAAGCCATCTGTACCACGCAGGGCGGTCTGACGCGCAGTATGGAATGCGATGATGCTGCCGGACGGGTCATCCGCCTGACCAGTGAAACGGCAGCCACCACCTTCCGTTACGATGTACTCGACCGGCTGATGCAAGAGTCGGCTTTGACGGCGCACACAGCGTTATCACCGACCTGACCGGCAAACTTATCCGCAGCGGGGATGAGGGCTGGTCACCCACTAACTATGACGAAGCAGACCGCCTCACGCACCGCTGCATGAATGGCGAAACCGCAGAGCGGTGGCAGAGTATGACGAACGCGGCGCTGGCTGACGGACATCAGCCATATCAGCGAAGGGCACCGGGTGACGGTGCGCTATGGTATGACAGTAAAGGCGCCTCGCCCGGTGAGCACCTGACCGGTGCATCATCACCAGGCAGAATGAACTGCTCTGGCAGCGCCAAAGGGACCAGACATGCGTACAACGCACAGGGACTGGCGAACCGCTGTATACCGGACAACCTGCCCGCCGTGGAATGGCTGACCTACGGCGGCTGGCTCAGGCATGAAACTCGGCGACACACCGCTGGTGGGTACACCCGCGACCGCCTGCACCGAAACGCTGCGCAGCTTTCGGCCGTTATGAACTCACCACCGCTTATACCCCTGCGGGTGATTTACAGAACCAGCACCTGAACAGCTGCTGTCTGACCACCCGATTACACCTGGAACGGTAACGGCGAACTCATCGCATCAGCAGCCCGCGCCAGACCCGGAGTTACAGCTACAGCACCACCGGCAGGCTGACCGGCGTTCACACCACCGCAGCGAATCTGGATATCATCCGTATACACAGACCAGCAGGTAACCGCCTGCCCGACCGGAGCACACCCGGACAGCGCCCTCAGCGTAATGGCCGGATAACCATTATCGCCGTGACGCGCACTATCTTTACCGGTATGACCGTCGGCAGGCTAATGAGAAAACCGACCTCATCCCGGAAGGGGTTATCCGCACGGATGATGGGCGCACCACCGGTACCATTACGACAGTCAGCACCGGCTGGTACCACGCGGACACAATATGCAGAGCCGCTGGTCGAAGTCGCTATCTTTACGACCCGCTGGGCCTGGTGGCAAAACAGGTATGGCGGCGTGAACGGGACCACAAACCGGGCTGGATGTCGCTGTCTGAAACCGCAAGTGACCTGGTACGGCTGGGACGGCGACCGCTGACCACGATACCAGAACGACAGAACCCGCATCAGACCCGATTTATCAGCGGGGGCTTCACGCCACTCATCAGGGTTGAAACCGCCACCGGTGAGCTGGCGAAAACGCAGCGCCGCAACCTGGATACCTTCAGCAGTCCGGTGGCGAAGACGGGGTGGCGGTGTGGTGTTCCGCCGGTGCTGGTTGCAGATGTCGACCGGCTGGAAGTGAAATCCTGGCTGACCGGGTGGTAAGGAAAGCCGCCGCTGGCTGGCATCGTGCGGCCTGACGGTGGCGCGAGATCACCAAAGCCAGATGGACCCGGTATACACGCCGGCGCGAAAAATTCACCTGGCACTGCGACCATCGCGGCCTGCCGCTGGCCATATCAACACGGAAGGGGACAACAGCGTGGTACGCAGAATACGATGAAGGTTAAACACCCAAGCAGACGCCGCAATATCACGGCA
+>29fcf315-e502-472c-8e1f-80e65e5b4972
+GGTATACGCCGTTCAGTTACGTATTGCTCTTGCCTGTCGCTCTATCTTCGGCGTCTGCTTGGGTGTTTAACCTAGCTGCGCAGCGTTTTCCCAGTGCAGGCGGTCGCGGGTGTACTCCACCAGCGGTGTGTCGCCGAGTTTCATGCCTGACGGCCAGCCGCTGCCGTAGGTCAGCCATTCCGGCAGGCAGGCTGTCCGGTATACAGCGGTTCGCCAGTCCTGTGCGTTGTACGCATGTCTGGTCTCATGCTGCCAGAGCAGTTCATTCGTCTGCGGATGATGCACCGTCAGGTATTCACTGGCAGGCGGCCTTTACTGTCACCAACCATGGTGCACCGTCACCCGGTGCCCTTCGCTGATATGGCTGATGTCTGTCCAGCCAGCCGCGTTCGATCATACTGCCACCGCTCTGCGGTTTCGCCGACTCACGGTGCGGTGCGTGAGGGCGGTCTGCTTCGTCGCCAGTGCCCGGTGGTGATGGCCTCATCCTCGCTGCGGATAAAGTTTGCCCGGGTCAGGTCGTGGTGATAACGCTGTATTGTGCGGCCGTCAAAGAAGCCGGTTTCCTGTATCAGCCGGTCAGGTACATCGTAACGGAGGTGGTGTGGCTGCCGTTTTCTGGTCAGGCGGATGACCCGTCCGGCATCATTATTCCATACTGCGCATCAGACCGCCTGCGTGGTACAGATCAGCTTTCCCCGCATCGTACTGTGTCCCGTTTCTGCTGCCGTCCGGGGCAATGACGGTGCTGATCAGGTCACCGGCGGCGTTGTATTCATACCGCGTTTCATGGCCCTGCGTGTCTTTCTGGCAATTAACTGTCCACGGCTGTCATATGCGCGGTACTGACTCAGCCCTTCCTCGCGGTGCACCGCCGTCACCTGACCAAAACGGTCATGGTCATGGCAGGTTACATAACCGGGAACAGTCAGTGGCTCAGCAGCTATTGTAACGATACACGTCATGGTTTTCCGGCTGCCGGTGGCATCTTCCGTTGCGCAGGGTAAGTCACTGTGTGGATTATCATAACGGTAGCGGGTGATAACATCGCCGTCAGGGGCGGTTTCCTGAATCAGACGGCCCCATTCATCATATTCCGGCGTATTTCCAGCCCGTCAGGCCCGGTGGCTGACGTTAACTGGCATGGTGGTTACTGTAAAACGCCGATGCCCTGCCATCCGGCGTGGTGATGCGCGTGATGAGGCCCGTCACCACATCCGGACTGTATCTGTTGTCCTGCCTGCGGCATCCGTCTGTGCCCTGAGCCTGCCCACCGCGTCAAACTGACTCTGCGTGACGCTGCCGTCCGCGTGTTCCTTTTCACCACCCGCTTCAGCCGCCTTCACCCTGCGTGCGCAGGACTTTACGGCGGTTCAGGCTGTCGGTGGTGGTGATGCAGTCCTTCTCATACTGATACGTTAACCAAGCCTGCCGGGTTTTAGCTGTTCTGTCACCCGCCCGTCGCTGTCGTAACGGTAACAGATTTCGGTCGGCCGTGTGACAGTGCGCCACCATCAGCCCGGTATTTATCATCGTAAGTAAAGCTGCGCACCTGTGTATTGCTGCGATTCATACACCGCCGCCAGTTCGCCGCGGGCGTCCAGCCATAGCGCACCAGCGGCGCGGCAGGTAAATTCTCCGGGTATTCCGGGTCGTGCGTTAATACACGGCAGACAGACGGATGCCGTCGGCCGTATTCGGTGTAACCCGGCGGGGTATCAGGAAGCGGACGGTTCCGTCCCGCCGGAAATGGCCTGCTGCCGGGCTTCTTCTGCCCGCTGCGCCTGCGTGGTCGATTACCAGCCAGGTGACGCCCGGCACCATCCGTCACGCCGGTGATTTCGCCGCTGAATTCACCGGCGGCTTCGCGGTGGGACGATCTGTGTGCGCCAGGCGGTCCACCAACCCGGTCAGTACCCGGTACGGCGGCAGCGGCGCAGGCAGCACCTCATCCGCTTCCGGCACCCGCTCACACCAGCCGAGCAGCCACCACGGCCCCTGCGGACTGTTTGTCACCAGATAACGATGCGGACAAGCGGAGTTCTTCCGGCAGCGCCTGCCAGAGTGCGGCCAGCCGGTGACCTTCATCGGATTTCGCCACGCCGCCGCGCGCCAGCCACAGTGACTCGCTGCGGCTGTAACCGTCCTCACCGGGGAAACGGAATTGCTCAAAATGCAGGCTTCTGCCGCCGTTATCACTGGTATCAGTGTGTTATCGCGCAGCTGTAAGCCGGATATCCGCAGGCATTTTCAGCCGGGGCCGAGGCTCCCCACCGGCGCAGGCGTTTTTGTCGGTAACTGCTGTGGGTGCGGGAGAATGAACGGCAGCGGGCCGAACGCGGGGCGATCGGTTTTCACCAGGAAGGACCCTTTACCGAGCAGCGGATTGACCCGGATGGCCCGGACGTCACCCGCCGGGGCACACCGAACAGGCCGCCGGTGGGGCACCGATGCGTACGGCTGAACCCTGGACAATGCTACCGCCATGCTGCGTCATGTCGCCTGACGCGCCGCCGGTTTTCCGCTCATCTGCTCATCCTTGTTTTATCGGGTTATTTGTCTGCTGACAGGCGAAACCCTACAGATTTATAAAGAAGCCTTAAGTGAGATATCTGTCAGATAAGAACAATTATAGAATATTTATATATTTCATGAATATATGTTTTCCGATTAGTATAACGATGTCTAAAATATTCTCTGTGAACATCTTCCTGATACAAAAACCGCCAGCGTTTCCGCTGGCGGTTTCATTCAAAATCAGCAATCAATAAAATCACCAGTTGCCTTTTCGGCCTTTGATCATACACACCGGTTTTATCGCTGGTTTTCGACCAGACGCGATGCAGGTAGCTGTAAAAGCGGGCGCGGTCTTTCCAGAAAAGCATGAAGGCAGCGCCAGAACGCCCGCTGCAACCGCATGAAGTGCGGCGTAAAAGATAAGCCATGCAGGATATTCTCTGTAGAGTTCCATGCTTTTCTCCCCTTTTGTATCTGCGATTATGAATGGCACCGGAAAAATGAATTGTTTATCTGATGAAAATGAGCACCGCCTTTTATTGTAATTTTACTGCTCATCCGACCATATTTTTTTGCTTATTGATGGTTTATTTACATTCATCCTGTATGAATTAAGTTACACAAAAAGTTAAATTAGTACTAAACATTAGTTAAATCGGCTTTTGCCATTTTTATACTTTTACACACCCCGCCCGCAGATTTTGCGAAATCTTTGCAGCCAAATTCTACCCTTCGGTATCGCGCAGGCCACTGGAGGTGCCACTGTGGAGTGCAGGCGTAACAACCGGCATATTGCTGGTGTTTTATTACTGGGTTATCTGGTTTATGCCTGATCAATGCGGAGGCATTCTGATGGCTGCGCAAAGGGTTCTTACTGATCGCCACGTTTTTACTGTGGTGTTAATGTGGTGCTGGCGTCCTTTAGGCAGCGGGCTGGCGCGGCTGATTAATGACATTCCTCTTCCCGGTACAACGGGCGTTGAGCGCATGCTTTTTCGCGCACTTGGCGTCGTCTCTGACCGTGGGATGAACTGGAAACCCAATATCTTTGTGCCATTCTCGGCCTGAACATGCTGGGGCTGGCGGTGCTGTTTTTATATTTGCTCGGTCTTTATCTGCCGCTTAATCCACAGCAGTTACCAGGGCTGTCGTGGGATCTGGCGCTGAATACCGCCGTCTTTGTCACCAATACCAACTGGCAATCTTATAGCGGTGAAACCACGTTAATTTCTTTCAGCCAGATGGCGGGCTTAACGGTGCAAAACTTTCTTTCTGCCGCCAGCGGGATTGCGGTGATTTTGCCCTCATCCGTGCGTTTACCCGCCAGAGCATGAGCACGCTCGGGAATGCCTGGGTCGATCTGCTACACTGTCACGTTATGGGTGCTAGTCCTGTGGCGTTGTTGATTGCACTGTTTTTTTATTCAACAAGGTGCGCTGCAAAACTTTCTGCCTTATCGGGCTGTGAATACCGTTGAAGGAGCGCAACGGCTGTTATTACCCGCGTGGGGCCTGTAGCTTCTCAGGAAGCGGTCAAGATGCTCGTACTAACGGCGGTGGCTTCTTTAATGCCAACTCGTCGCATCCGTTTGAAAACCCAACCACGCTATTAACTTCGTGCAGATGCTGGCGATCTTCTTGATCCAACGGCGCTGTGCTTTGCCTTTGGTGAAGTGATGATGGGCGATCGCCGCCAGGGGCACCATGTTGCTGTGGGCGATGTCAGTGATTTTTGTCATCTGCGTAGGCGTGGTGGGCAGAAGTTCAGGGTAATCCTCATCTGCTGGCACTGGGCACGGACAGCAGCATCAATATGAATTAAAGAGCCGTTTCGGCGTGCTGGTCAGTAGCCTGTTTGCGGTCGTGACGACGGCGGCTTCCTGTGGCCATGATTGATTGCGATGCATGATTCGTTTACCGCTCTCAGTGGCATGGTGCCGATGTGGCTGATGCAAGTGGTGAAGTGGTGTTCGGCAGTGTCGGTTCTGGTCTTTACGGCGCGTGCTGTTTGTCCTGCTGGCGGTGTTATTGCCGGGCTGATGATTGGTCGTACACCGGAATATCTGGGTAAAAAAAATCGACGTACGCGGATGAAACTGACTGCGCAGCAATTCTGGATTACCCCGACGCTGGTGCTGATGGGCGCGGCGTTGGCGATGATGACCGACGCCGGACGTAGCGCCATGTGCTCAACCTAGCCCGCATGGTTTTAGCGAAGTGCTGTACGCCACCGTATTAATCCGCCATGCTGCTTAACGGCAGCGCCTTTGCCGGATTAAGCGCCAACTCTCCGTTCTGGAACATTTTACTGGCGTTCTGCATGTTTGTCGGTCGCTTCGGGGTGATTATCCCGGTGATGGCAATTGCCGGTTCGCTGGTGAGTAAAAGAGCCAAGCCGCCAGCTCCGGCACCCCGCTTTCTGCCAACACGGCCCGCGCTGTTTGTTGGCCTGTTAATCGGCACCGTGTTGCTGGTTGGCGCACTGACTATCCCTGCCCTGGCGCTTGGTCGGTGGCGGAATATCTCTCCTGATGATATTGAGTGAGCACTGAATATGAGTCGTAAAGAAGCAACTGGCGCTATTCGAACCAGCACTTGTCGTTCAGGCGCTGAAAGAAGCGGTGAAAAATTAAACCCGCAGGCGCAATGGCGCAATCCGGTGATGTTTATCGTCTGGATCGGCAGTCTGCTGACCACCTGTATTAGCATCGCGATGGCAAACGGTGCGATGCCCGGCACAATGCGCTGTTTAAGCGCGGCCATTATGATTGTGGATCACCGTACTGTTCGCTAATTTCGCCGAGGCGCTGGCAGAAGGCCGCAGTAAAGCGCAGACCCAACAGTCTGAAGGGGTGAAAAAACTGCCTTTGCCCGCAAGCTGCGTGAGCCGAAATATGGCGCTGCGGCGGAACAAAGTTCCGCAACGACCAACTTCGTAAAGGCGATATCGTACTGGTAAACTGGCGATATTATCCCCTGCGATGGTGAAGTTATTGGAAGGGGTGCATCGGTCGATAAGCGCCATCACCGGGGAATCGGCACCGGTGATCAAGTGAATCCGGCGGCGTTTGCCTCCGTCACCGGCGGCACGCGTATTCTTTCTGACTGGCTGGTGATTGGTGTGGCGTTAACTGGCGAGACATTTCTGGATCGGATGATCGCGATGGTGGAAGGAAGCACAGCGACGCAAAACGCCGAGCAAATTGCCCTGATAATTCTGCTGATTGCCCTGACTATCGTCTTTTTACTGGCAACCGCCACGCTGTATGCGTTTTCGCGTGGGGCGGTAATGCAGTCAACGTAACGGTACTGGTGGCGCTGCTGGTCTGTCTGATCCCAACCACTATTGGCGGCCTGTTGTCAGCGATCGGCGTCGCCGGGATAGACCGGATGCTAGGCGCGATGTGATTGCCACCAGCGGACGTGCAGTTGAAGCGGCAGGTGACGTTGACGTTCTGCTACTGGATAAAACCGGCACCATCACGCTCGGTAACCGTCAGGCGTCGGAGTTTATCCCGCGCAGGGCGTGGATGAAAAAAACGCTGGCTGACGCCGCACAACTGGCAACTGGCTGATGAAACGCCGGAAGGCCGCAGTATTGTGATCCTCTCGCCAGCAGCGTTTTAACCTGCGCGAGCGCGATGTTACCGTCGCTCCATACGCTTTGTACCGTTTACTGCGCAAAGCCGGATAAGGCAGGATCAACATCGACAACCGCATGATCCGTAAAGGTTCTGTCGATGCCATTCGTCCCTTAATGTTGAGACTGGTGGTCACTTCCCCGTGTTGATCAAAAGTCGATCAGGTTGCGCGTCAGGGAGCCACGCCGCTGGTGGTGGTGGAAGGTTCTCGTGTGCTGGGCGTTATTGCGCTGAAAGATATCGTCAAAGGCGGTATTAGAGAGCGCTTCGCCCAGCTGCGCAAAGGTTAAACACCCAAGCGAACGCCGAAGATAAAGAAGTG
+>baeacbab-db71-4be4-a4ac-c2fe5e26570d
+TTGTTATTGCTTCGTTCCAGTTACGTATTGCTGCCTGTCGCTCTATCTTCGGCGTCTGCTTAACGTTATTTAACCTCAGGTGTAATCGCAGAGTCGAACAGGCACAGGCCGGGTGCTGGCTCTGCTTTGCCCGGCAGGGAGTATGGCGGTGATGAGTTCATAACGGCCGAAGCTGCGCAGCGTTTCCCGTGCAGGCGGTCATGGTGTCCTCCACCAGCGGGCATATCGCCGAGTTTCATGCCTGACAGCCAGCCGCTGCCGTAGGTCAGCCGCCATTCACAGCAGGCAGAGGCTGTCCGGTATACGGCAGTTCTCCAGTCCCTGTGCTGCGTTATGCGCATGTCTGGTCTCATGCTGCCAGAGCAGTTCGTTCGTCTGCAGGATGATGATGCCACCGTCAGCAGGTGTTCACTGTAGAAACGGCCTTTGCATGTCATAACCATAGTGCACCGTCACCCGGTGCCCTTCGCTGATATGGCTGATGTCTGTCAGCCAGCCGCGTTCGTCATACTGCCACCCTTCTGCAGTTTCGCCATTCACGTTGCGTTTTGAGGCGGTCTGCTTCGTCATAGTGGAGCGACCCGGCCCTCATCCTCTGCGGGTTAAGTTTGCCGGTCGGGTCGTGGTGATAACGGCCGTCAAAGCCGGTTTCACCAACATCAGCCGGTCGAATTACGCTCGTAACGGAAGGTGGTGGCTGCCATTTTTCACTGGTCAGGCGGATGACCAAATCCGGCAGCATCATTCCATACTGCGCGTCAGACCGCCCTGCCGTGATACGAATGGCTTTCCCCGCATCGTACTGTGTCCGTTTGCTGCCGTCGGGGAATGGCGTGACGGTGGTCAGGTCCTGGCGGCGTTGTATTCATACCGCGTTTTTCATGGCCCTGCGTTATCTTCCGGCAGTGCTGTCCACGGCTGTCGTATGCGCGGTACTGACTCAGCCCTTCCTCGCGGTGCTGCCGTCACCTGACAAACGGTCATGGTCATAGCGGGTTACATAAGCAGGAACGATCGGTGAAGCTCGGCAACTGACCGTAACGGCTCCGATCGCGGTTTTCGGCTGCCGGTGGCATCTTCCGTTGCGCAGGGTAAGTCACTGTGTGGATTATCATAACGGTAGCGGGGTGATATCGCCGGTATCGGGGGCAATTTCCGTCAGACGGCCCCATTCATCATATTCCCGGCGTATTTTCCAGCCGTCAGGCCCGGTGGCTGACGTTAACTGGCTGTGGTGGTTATAGTAAAACGCCGATACTGCCATCCGGCGTGGTGATGCGCGTAGTGGGCCGTCACCACATCCGGACTGTATTCTGTTGTCATACCTGCGGCATCCGTCTGTGCCCTAGAGCCTTACCGCGTCAACTGACTCTGCGTGGCTGCCCGTCCGCGTGTTCCTTTTTCACCACCTGGCCCGCCTTCACCCTGCCGTGTTGTGCAGGCTTCACGGCAGTTCAGGCTGCATCGGTGATGGTGATGCAGTTCCTTCTCATACTGATACGTGTAACCGTACTGCCGGGTTTAGCTGTTTCTGTCACCCGCCCGTCTTTGTCGTAACGGTAACAGATTTCCGGTCGGCCCATGTGACGGTTACGCCACCATCCGGCTTGGTATTTGTATCTATCGTAAGTAAAGCTGCGCACCTGTATTGCTGGTCGCCACCGCCGCCAGTTCCGCGCGGGCGTCCAGCCATAGCGCACCAGCGGCGCGGCGGGTAAATTCTCCGGTATTCCGGGTCGTGCGTCGGCCACGCCTGAACCAGACGGATGCCGTTGTCCCGGCATATTCCGGTGTAACCGGCAGGGTATCTGGGAAAAGCGGACGGTTTCCGTCCGCCGGAAATATTACTGCTGCCGGGCTTCTTCCTGCCCGCTGCCGTGGTCAGTACCAGCCGGAAGTGACGCCCGGCACCATCCGTCGCATGCCGGTGTTCGCCGCTGAATTCACCGGCGGCTTCGCGGTGGAACGTCTGTATTGCGCCGAAGCGGTTCCAGCCGATCCCTGAGTACCAGGGTACGGCGGCAGCGGCGCAGGCAGCACCTCGTATCCGCTTCCGGCACCCGCTCACACCAGCCGAGCAGCCACCACGACTACGGACTGTTTGTCGCCAGATAACGATGCGGACTTAAGCGGAGTTCTGCGGCAGCGCCAGAGTGCGGCCAGCCGGTGACCTTCATCCAGTTTCGCCACGCCGCCCGCGCACCAGCCACAGTGACTCATGCGTGTAACCGTCCTCACCGGGAAACAGGTGCTCAAAATACAGGCTTCTGCCGCCGTTATCACTGGTATCAATTAATGGTATCATGCAGCTGTAAGCCCGGATATCCCGCAGGCATTTTCCAGCCGGGGCCGTCCCCACCGGCGCGGGCGTTTTGTCCGATGGCACTGCTGTGGTGCGGGAGATGAACGGCAACCGGGCCGGGCGGGGCGATGTCGGTTTCACCGGGAAGGACCTTTGCACTGAGCAGCAGTTGACCCGGATGGCCGGACGTCACCCGCCGGGGCACCACCGAACAATTACGCCGGTAGCAGGGAATACCGATGCGTACCCCGGGCTGAACCCTGTGGACAATGCTACCGCCATACTGCGTCATGTCGCCCTGGCGCGCCGCCGGTTTTCCGCTCATCTGCTCATCCTTGTTTTATCGGGTTTATTTGATGCCTTTGACGGGCGAGCCTGGATTTATAGAGAAATAGCCAGGGTGGCGGGATATCTGTCGGATAAGAACAATTAGGAAAATATTTATATATATTTCCATGAATATATGTTTCGGTGGTATAACGATACAAATATTCCTCTGAACATCTTCCTGATACAAAAACCGCCAGCGTTTCCACTGGCGGTTTCAATGTAAAAACTCAGCAATCAATAAAAATCCCCGCCGGTTACCTTTTCGGCCTGATCAAATACACCGGTTTATCGCTGGTTTCGACCAGACGCGATGCAGGTAGCTGTAAAGCGGGCGCGAGTCTTTCCAGAAAAGCATGAAACTGGCGCCAGAACGCCGCTGCAACCGCATAAGTGCAGCGTAAAGATAAGCCAGCTGGGGATATTCTCTGTAAGGTTCATACTTTTCCCCTTTTTTATCTGCCGGTGAATGGCACCGGAAAAATGAATTTGTTTATCTGATGAAGAAATGGTACTTACTTTTGTGTGATTTTTACTACTCGGCTCGACCACTTATTTTTGCTTATTGATGGTTTATTTGCATTCATCCTGTAATTAAGTTACACAAAGTTAAATTAATACTAAACATTAAGTTAAATCATGGCTTTTTTGCCATTTTTATACTTTTACCGCCCGCAGATTTTGCGAAATCTTTACGTAGAATTCTACCTTCCGGTATCACTTTTAGGCCACTGGAGGTGCACTGTGAGTGCAAGGCGGCGATAACCGGCGTATTGCTGGTGTTTTTTAATACTGGGTTATCTGGTTTATGCCTGATCAATGCGGAGGCGTTCTGATGAAACGCAAGGGTTCTTACTGATCGCCACGTTTTTACTGGTGTTAATGGTGCTGAAAGCGCGTCCTTTAGGCGGCAGGCTGGCGCAGTTAATGACATTCCTCTTCCGGTACAGCGGGCGTTGAGCGCGTACTTTTTCGCGCACTTGGCGTCTCTGACCGTGAGATGAACTGCGTTAATCTTTGTGCCATTCTCGGCCTGAACATGCTGGGGCTGGCGGTGCTGTTTTATCATGTTGCTCGGTCGGCACTATCACAGCAGCAATCCACAGCCAGTTGCCAGAATTTTGTCGTGGGATCTGGCGCTGAATGCCGTCAGCTTTGTCGCAATACCAACTGGCAATCTCCTGGCGGTGAAACCACGTTGACTATTTCAGCCAGATGGCGGGCTTAACGGTACAAAACTTTCTTTCTGCCGCCAGCGGGGTTGCGGTGATTTTTGCCCTCATCCGTGCGTTTTACCCGCCAGAGCATGACGCGCTCGAGGAATCTCTCAGGTCGATCTGCTACGCGTTATGGGTGCTAGTCCCTGTGGCGTTGTTGATTGCACTGTTTTTATTCCAACAGGTGCGCTGCAAACTTTCTGCCCATCGGGCTGTGAATTGCCGTTGAAGAGCGCAACAGCTGTTACCATAGAGACTATTCTCAGGAAGCGATCAAGATCTTTCAGTACTAACGGCGGTGGCTTCTTTAATGCCAACTCGTCGCATCCGTTTGAAAACCTTAACCGCACTGACCAACTTCAAAATTACGGGTACTGGCGATCTTCTTGATCCCAACGGCGCTGCGCTTTGCCTTCTTGGTGAAGTGATGGGCGATCCGCCGCCAGGGCGCATGTTAATGTGGGCGATGTCGGTGATTTTGTGTCATCTACGTAGGCGTGGTGATGTGGGCGAAGTTCGGTAATCCTCATCTACTGGCACTGGGCTGGACAGCAGCATCAATATGAAGGTAAAGAGAGCCGTTTCGGCGTGCTGGTCAGTAACCTGTTTGCGGTCGTGACGGCGGCTTCCTGTGGCAGTGATTGCGTGCATGATTCGTTACCTCGGTGGCATGGTGCCGATGTGGCTGATCACAAATTGGTGAAGTGGTGTTCGGCGGTGTCGGTTCACGGTCTTTACGGCATGATGTTTGTCCGCTGGCGGTGTTTAATGCCGGGCGATGGTGGTCCGTACACCGGAATATCTGGGTAAAAATCGACGTACGCGAGATAAAACTGACTGCACTGGCGAATTTCTGGTTACCCCGACGCTGGTGCTGATGGGCGCGGCGTTGGCGACTGATGACGCCGGACGTAGCGCCATCTCGCCTAGCCCACATGGTTTAGCGAAGTGCTGTAGCCGCCGTGTCATCCGCCCGCTAACAACAACGGCAGCGCCTTTGCCGGATTAAGCGCCAACTCTCCGTTCTGGAACTGTTTACTGGCGTTCTGCATGTTTGTCGGTCGCTGGGTGATTATCCCGGTGATGGCGGTGCCGGTTCGCTGGTGAAATAAAAAGAGCCAAACCGCCAGCTCCGGCACGCCAGCAACGCACGGCCCGCTGTTTGGCCTGTTAATCGGCACCGTGTTGCTGGTTTGGCGCACTGACTATCCCTGCCCTGGCGCTTGGTCGGTGGCGGAATATCTCTGATGATATTGGTGAGCACTGAATATAGTCATAAACAGCGCTATTCGAACCAACACTTGTCGTTCAGGCGCTGAAAGAAGCGGTGAAAAATTAAACCCGCAGGCGCAATGGCGCAATCCGGTGATGTTTATCGTCTGGATCGGCAGTCTGCTGACCACCTGTATTAGCATCGCGATGGCAAAGCGGTGCGATGCGGCAATGCCCCAGCGCGAGCCATTGTAGTTGGCTGTGGATCACCGTACTGTTCGCTAATTTCGCCGAGCTGGCCAGAAGGCCGCAGTAAAGCGCAGGCCAACGATGCAAAGGGTGAAAAAACTGCGCTTTGCCCGCAAGCTGCGTGAGCCGAAATATGGCGCTGCGGCGGATGAAGTCCTGCCGACCAACTTCGTAAAGGCGATATCGTACTGGTGTTAGAAGCTGGCGATATTATCCCTGCGATGGTGCGAAGTTATTGAAGGTTAAACACCCAGCAGACGCCGAAGATAGAGCGACAGGCAAGTAGCAATACGTAACGCGGG
+>7f343574-f2bc-4388-91b9-84b99e39256a
+TTGGTATGCGCTTCGTTCCAGTTACGTATTGCTACTTGCCTGTCGCTCTATCTTCGGCGTCTGCTTGGGTGTTTAACCTTCTGTCAGATGAACAATTAGGAAAATATTTATATATATATTTCACATGAATATATGTTTCGTTGGTATAACGATGTCTAAATATTCCTCTGAACATCTTCACGATACAAAAAACCGCCAGCGTTTCCTTTAGCTGGTTTTCAATCAAAACTCAGCAATCAATAAAAATCACCAGTTGCCTTTTCGGCCTGATCCATCCACACCGGTTTATCGCTGGTTTTCGACCAGACGCGATACTGCGAATAATATGCGTCAGTATCTATGATTATTATCGATAAAATAGATACCATATCGCTTTTGTGTAATTTTACTACTCATCGACCACTTATTTTTGCTTATTGATGGTTTATTTACATTCATCCCTGTAATTAAGTTACACAAAAAGTTAAATTAATACTAAACGTGGATTAAATCATGGCTTTTGCCATTTTATACTTTTACACCGCCCGCAGATTTTTGCGAAATCTTTGCAGCAGAATTCTACCTTCCGGTATCACTTTTAGGCCTGGAAGTTACACTGTGAGTAGGCGCTGAAGTAACCGACGTATTGCTGGTGTTTTTATTACTGGGGTTATCTGGTTTATGCCTGATCAATGCGGAGGCGTTCTGATGGCTGCGCAAAGGGTTCTTACTGATCGCCACGTTTTTACTGGTAATGGTGCTGGCGCGTCGCTTTGGGCAGCGGGCTGGCGCTGACTGATTAATGACATTCTCTTCCCGGTACAGCGGGCGTTGAAGGCGCGTACTTTTCGCGCACTTGGCGTCTTCTGACCGTGAGATGAAACTGGAAGCAATATCTTTGCCATTTCTCGGCCTGAACATACTGGGGCTGGCGGTGCTGTTTTATGTTGCTCGGTCAGCACTATCTGCCGCTTAATCCACAGCAGTTGCCAGGGGCTGTCGTGGGATCTGGCGCTGAATACCGCCGTCAGCTTTGTCACCAATACCAACTGGCAATCTTATGGCGGTGAAACCACGTTGAGCTATTTCAGCCAGATGGCGGGCTTAACGATTGCAAAACTTTTCTTCCTGCCGCCAGCGGGATTGCGGTGATTTTTGCCCTCATCCGTGCGTTTACCCGCCAGAGCATGAGCACGCTCGGGAATATGGGTCGATCTGCTACGCATCACGTTATGGGTGCTAGTCCCTGTGGCGTTGTTGATTGCACTGTTTTTATTCAACAGGTGCGCTGCAAAACTTTCTGCCTTATCGAACTGTGAATGCCGTTGGAAGGGCGCAACAGCTTTCAGTACCCATGGGGCCTGTAGCTTCTCGGGAAGCGATCAAGATGCTCGGTACTAACGGCGGTGGCTTCTTTAATGCCAACTCGTCGCATCCGTTTGAAAACCAACCGCACTGACCAACTTCGTGCGGATGCTGGCGATCTTCTTGATCCCAACGGCGCTGTGCTTTGCCTTTGGTGAAGTGATGGGCGATCGCCGCCAGGGCGCATGTTGCTATTAGGCGATGTCAGTGATTTTGTCATCTGCGTAGGCGTGGTGATGTGGGGCAGAAGTTCAGGGTAATCCTCATCTGCTGGCACTGGGCACGGACGGCAACATCAATATGGAAGGTAAAGGCCGTTTCGGCGTGCTGGTCAGTAGCCTGTTTGCGGTCATGACGACGGCGGCTTCCTGTGGCGCGGTGATTGCGATGCATGATTCGTTTACCGCTCTCGGTGGCATGGTGCCGATATGGCTGATGCAAATTGGTGAAGTAATGGTGTTCGGCGAAGTCGGTTCTGGTCTTTACGGCATGATGCTGTTTGTCCTGCTGGCGGTGTTATTGCCGGAGCTGATGATTGGTCATTTTACCGGAATATCTGGGTAAAAAATCGACGTACGCGAGATGAAACTGACTGCACTGGCAACAATTCTGATTTACCCCGACGCTGGTGCTGATGGGCGCGGCGTTGGCGATGATGACCGACGCCCGGACGTAGCGCCATGCTCAACCCTGGCCCGCATGGTTTTGCAGCGAAGTGCTGTACGCCGTGTCGCCGCTGCTAACAACGGCAGCGCCTTTGCCGGATTAACGCCAACTCTCCGTTCTGGAACTGTTTACTGGCGTTCTGCATGTTTGTCGGTCGCTTCGGGTGATTATCCCGGTGATGTAATTGCCGGTTCGCTGGTGAGTATTAAAAGAGCAAACCGCCAGCTCCGGCACGCTGCCAACGCACGGCCCGCTGTTTGTTGGCCTGGTAATCGGCACCGTGTTGCTGGATTTGGCGCACTGACCTTTATCCTGCCCTGGCGCGGTCGGTGGCGGAATATCTCCCTGATGATATTGGTGAGCACTGAATATGAGTCGTAAACAACTGGCGCTATTCGAGGCAGCACTTGTCGTTCAGGCGCTGAAAGAAGCGGTGAAAAAATTAAACCCGCAGGCGCAATGGCGCAATCCGGTGATGTTTATCGTCTGGATCGGCAGTCTGCTGACCACCTGTATTAGCATCGCGATGGCAAGCGGTGCGATGCCCGGCAATGCGCTGTTTAGCGCGGCCATTAGCAGTTGGCTGTGGATCACCGTACTGTTCGCTAATTTCTGTGAGGCGCTGGCGAAAGGCCGCAGTAAAGCGCAGGCCAACAGTCTGAAAGGGGTGAAAACCGCCTTTGCCCGCAAGCTGCGTGAGCCGAAATATGGCATGCGGCGGACAAAGTTCCTGCCAAACCAACTTCGTAAAAGCGATATCGTACTGGTAGAAGCTGGCGATATTATCCCCTGCGATGGTGAAGTTGATGAAGTTGCATCGGTCGATAAGCGCCATCACCACCGGGGAATCGGCACCGGTGATCCGTGAATCCGGCAGCGATTTTGCCTCCGTCACCGGCAGCGCGTATTCTTTCTGACTGGCTGGTGATTGGTGTAGCGTTAACCCGGGCTTGAACCCATTTCTGGATCGGATGATCGCGATGGTGGAAGGCGCACAGCGACGCAAAACGCCGAACAATTGCCCTGACCATTCTGCTGATTGCCCTGACTATCGTCTTTTTACTGGCAACCGCCACGCTGTGGCCGTTTTCCGCGATGAGGCGATATTGCAGTCAGCAGCTAACGGTACTGGTGGCGCTGCTGGTCTGTCTGATCCCAACCACTATTGGCGGCCTGTTGTCAGCGATAAGCGTCGCCGGAATGGAACCGGATGCTAGGCGCGAATGTGATTGCCACCAACGGACGTGCAGTTGAAGCGGCAGGTGACGTTGACGTTGCTACTGGATAAAACCGGCACCATCACACTCGGTAACCGTCGGGCGTCGGAGTTTATCCCCGCGCGGGGCGTGGATGAAAAACGCTGGCTGACGCCACAACTGGCTTCGCTGGCTGATGAAACGCCGGAAGGCCGCAGTATTATGATCCTCTGAAGCAGCGTTTTAACCTGCGCGGCGCGATGCAGTCGCTCCATGCCACCTTTACCGTTTACTGCGCAAAGCCGGATGAGCGGGATCAACATCGACAACCATGATCCGTAAAAGGTTCGCCGATGCCATTCGTCGCCATGTTAGAGGCTAACGGTGGTCACTTCCCTACCGATGTTGATCAAAAGTCCAGTCAGGTTGCGCGTCGAGGCCACGCCGCTGGTAATTGGTGGAAGGTTCTCGTGTGCTGGGCGTTGTTATTGCGCTGAAGATATCGTCAAAGGCGGTATTAAGAGCGCTTCGCCCAGCTGCGCAAAATGGGCATTAAAACGGTGATGATTACCGGCGATAACCGTCTGACTGCCACCGCGATTGCTGCGGAAGCGGGTGTCGATGATTTTTCTCGCCGAGCGACACCGGAGGCCAAGCTGGCATTGATCCGTCAGTATCAGGCGGAAGGTCGTTTGGTAGCGATGACCGGCGACGGCACCAACGATGCTCCGGCGCTGGCGCAGGCAAGATCGCGGTGGCGATGAACTCCGGCACCCAGGCGGCGAAAGGCGGGCAATATGGTCGATCTCGACTCTAACCCGACCAAGTTGATCGAGGTGGTGCACATTGGCAAACGGATGCTGATGACCCGTGGCTCGCTGACCACCTTCAACGTACCAACGATGTGGCGAAATACTTCGCCATTATTCCGGCAGCATTCGCGGCAACGTATCCGCAGTTAAATGCGCTGAACATCATGTGCCTGCATTCGCCCGACTCCGCAATCCTCAGTGCGGTGATTTTCAACGCGCTTGATTATCGTCTTTGATTCCCCTGGCGTTAAAGGCGTGGGTTATGAGAACCGCTTACCGCTTCTGCCATGTTGCGCCGTAACTTATGGATTTACGGTCTGGGTGGGCTCAACGGTGCCGTTTATCGGTATCAAAGTCATTGATTTACTGCTGACCGTTTGCGGTCTGGTGTGAGGTTTACCATGAGTGGATTACGTCCGGCATTATCAACATTTATCTTTCTATTTATTGATTACTGGCGGCGTTTACCCGCTGCTGACCACCGTACTGGGGCAATGGTGGTTTCCCTGGCAGGCCAATGGTTCGTTGATTCGTGAAGGTGATACGGTGCGCGGTTCGGCATTAATCGGGCAGAATTTTACCGGCAGCTATTTTCATAGTCGCCCGTCGGCAACGGCAAAATGCCTATAATCCACAGGCTTCTGGCGGGAGCAATCCTGGCAGTCCAGTAACCTGAGCTGGATAAACTAATAGCCGCACGCGTTGCTGCATTACGGGCCGCTAACCCGGATGCCAGCGCAGGCATTCCAGATTCAAGACTGTTGGCATCGGCAAGCGGGCTGGACAATAATATCACCCCGCAAGCGGCGGCCTGGCAAATCCACGCGTGGCGAAAGCGCGTAATCTCAGCGTTGAACAGCTCCGCAACTGATCGCAAAATACAGCCAACAACCGCTGGTGAAATATATCAGCCAGCCGGTTGTCAGTGATGAACTCAATCTGGCGCTGGATAAACGATGAATAGCAGACCGCCCGTCCCGACCCCGATCGTCTGCTGGAACAAACTGCCGCGCCGCATCGGGGAAGCTGAAAAGTTTTCTTCGGTGCCTGTGCAGGCGTCAGGGAAGACCTGGGCGATGCTGGCAGAAGCCCAGCGACTGCAGGCGCAAGGGCTGGATATTGTGGTTGGCGTGGTAGAAACCCACGGGCGAAAAGATACCGCCGCCATGCTGGAAGGGCTGGCTGTTCTGCCGTTAAAACGCCAGGCGTACCGTGGGCGGCATATCAGCGGGGTTTGATCGATGCCGCCCTCGCCCGCCGCCGGCGCTGATCTTAATGGACGAACTGGCGCACAGTAATGCGCCAGGTTCCCGTCATCCCAAACGCTGGCAGGATATCGAAGAACGCTGGAAGCTGGCATTGATGTTTCACTACCGTTAGCGTTCAGCATCTGGAAAGTCTGAATGATGTGGTCAGCGGCGTCACCGGAATTCAGGTACGGGAAACCGTGCCCGATCCTTTTTCGATACCGCCGACGCGACGTGGTGCTGGTGGACTTGCCCCCGGACGATCTGCGCCAGCGGCTGGAAAAGAAGGCAAAGTCTATATTGCCGGGCGGGCGGGTGCGCCATTGAACATTTTCCGCAAAGGCTGTCAGTCGCCCTGCGCAGACGCTGGCACTGCGCCATACTGCCGATCGCGTTGATGAGCAAATGCGCCTGGCGGGGCATCCTGGCGAAGAGAAAGTGGCACACGACGCGATCGCTTTTATGCATCGGCCATAACACCGGCAGCGAAAACTGGTCGCGCAGCTGGCTAGCGTCACGGCTGGGTAGCGTCTCTCACAGCACGCAGTGTATGTTAGAAACTGCCCTGCACCTTTACCGGAAAAAAACGTCGGGCAATTCTGGCGCCTTACCATTCTGGCGCAGGAACTGGAAGCGCGGAGACGGCAACACTTTTCTGATCCAGCGGAAGAGAAAGCGGTAGTGCGTTATGCCCGTGGAGCATAATCTCGGCAGATTATTCTCCCGAGTCGCCCGGCCTCGCGCCGCTGGTGGCGATCGGGAAACGTTTGCTGACCGACTGGCGCGCGCATCACGCCCCCGATCTCGATCAGGTGCTGGTCGCATGATGAACCACCCTTACACGATTAACAACGCGCCGGATAACCGCTCTTTTAAAGACAAATTGGCGTGTACAAATTCAGGGATGCGTGGTTGCCGCCGCGTTGTGCGCCGTTATCACCTTAATCGCCATGCAGTGGCTGATGGCGTTTTGATGCCGCCAACCTGGTGATGCTGTATCTGCTTGGCGTGGTGGTGGTGGCGCTATTTTATGGACAGCGCTGGCCTTCGGTGGTTGCCACCGTCATTAATGTAGTGAGTTTCGATCTCTTTTTTATCGCCCCACGCGGCACGCTCGCCGTCTCTGATGTGCAATATCTGCTGACCTTCGCGGTGATGTTAACCGTCGGGCTGGTGATCGGGAACCTTACTGCTGGCGTGCGTTATCAGGCGCGGGTAGCCCGTTACCGCGAGCAACGCACGGCACTTATGAAATGTCAGCTCAGGCGGTGGGCCGCAGTCCGCAGGATATCGCTGCCACCAGCGAACATTTATTGCCTCCACGTTTTCATGCCCGCAGTCAGGGTGTTGTTGCCCGATGACGGCGGTAAGTGCAGCCGTTAACACATCGCAAGGAATGACGCCGTGGGACGATGCCATCGCGCGGTGGAGTTTTGATAAAGGCCTGCTGCGGGCGCGGGGGCACCGACACGTTACCCGTTATTGCCGTACCGAGATTTTGCCGCTAAAAGCGTGAAGAACTCGGGCTGGTGGTGGTGGGCAAGGGGGAATCCTGCGCCAGTTGATGATCCCGGAACAGCAGCGCCTGCTGGAACGTTACGCTGTTAGTAGGTTAAACACCCAAACAAGACGCCGAAGATAGAGCACCG
+>e109fef1-6ea0-4bf1-b293-2d5d5a6ed906
+TCAGTACTTCGTTCCGGGAATTTACATATTGCTACTTGCCTGTCGCTCTATCTTCGGCGTCTGCTTGGGTGTTTAACCTGAAAAGTATGGAACTCTACAGAATATCCTGCATGAAACATCTTTTTACGCCGTACTTATGCGGTTGCAGCGGAGCGTTCTGGCGCTGCCTTTCGTGCTTTTCTGGAAAAGACCGCGCCCGCTTTACCTTCTGCATCGCGTCTGTGAGTCGAAAACCAGCGATAAACCGGTGTGGATGGATCAGGCCGAAAGGCAACTGGTGATTTTTATTGATTGCTGAGTTTTGAATACATTGAAAACCGCCAGCGGAAACGCTGGCGGTTTTTCTTATCGAGGCTTCAGAGGAATATTTGAACATCGTTATACCAATCGAAACATATATTCGCCAAAATATATATAAAATTTTCCTAATTGTTCTTATCTGACAGATATCTCACTTAAGGCTTTCTTATAAATCTGGCAGGGTTTCCTTGTCAGCGACAAATAACGATAAAACAAGGATGACAGATGAGCGGAAAACCGGCGGCGCGTCAGTGGCGACATGACGCAGTATGGCGTAGCATTGTCCAGGAGTCCAGCCGGGGTACGTGGTGCCCCACCGGCGTAATGTTCCGGGTGTGCCCGGCGGTGACGTCAACCATCCGGTGAAATCCGCTGCTCGGTGCAAAGGTCCTTCCGGAGTGAAACCGACATCGCCCTGCCCGGCCCGCTGCCATTCATTCTCCACCTGGCAGTTACCGGACAAAAACGCCCGCGCCGGTAGAGCCTCGGCCCCGGCGGCAAATGCCTGCGGATATCCGCTTACAGCTGCGCAATGTACTGATACTCAGTGATAACGGCGGCAGAAGCTGTATTTTGAGCACCTGTTTCCTGTGAGGACGGTTACAGCCGCAGCAGTCACTGTGGCTGGTGCGCGCGGCAACGTGGCGAAACTGGATGAAAGGTCACCGGCTGGCCGCACTCTGGCAGGCGCTGCCGGAAGAATCCATAGAGTCCGCATCGTTATCTGGCGACAAACAGTCCGCAGGGGCCGTGGTGGCTGCTCGGCTGGTGTGAGCGGAATTGCCGGAAGCGGATGAGTGCTGCCTGCGCCGCTGCCGCCGTACCGGGTACTGAAGCCAGGCACAATTGGACCGCTTCAGGGCGCACAGACGTTCCACCGCCGAAACCGCCGGTGAATTCAGCGAAAATCACCAGCGTGACGGATGAGGGTGCCGGGCGTCACTTCCGGCTGGTACTGACCGCACCAGGCGCAGCCCAGGCAGAAGAAACCCGGCAGCAGGCCATTTCCGGCAGGACGGAACCGTCCTTTCCTGAAACCACCCTGCCGAGTTACACCGAATATGGCCGGGACAACGGCATCCGTCTGTCTGCCGATATTGGCTGACGCACGACGGAGATACGGAGAATTTACCTGCCGCGCCGCTGGTGCGCTATGGCTGAACGCCCCGCGGCGCGAACTGGCAGCGGTGTATGGCCACTGGCAATACGAGTGCGCAACTTTAACACGATGATAAATACCGGGGCCGGATGGTGGCGCTTGCACCGTCACGCGCGGGCCGACCGGAAATCTGTTACCGTTACGACAGCGACGGGCGGGTGACAGAACAGCTAAACCCGGCAGGCTTAAGTTACACGTATCAGTATGAAGGACCGCATCACCATCACCGACAGCCTGAACCGCCGTGAAGTCCTGCACACGCAGGGTGAAGGCGGGCTGAAGCGGAGTGGTGGCGGAACGCGGACAGGTTAAACGCAGAAGCAGACGCCGCACC
+>d69c6ac9-3c79-4ee4-a3d2-92762f8b7433
+TTGGTATGCTTCGTTCAGTTACGTATTGCTTTCCTGTTGGTACGATATTGCGGCGGCGTCTGCTGATTGTTTAACCTAGCTCAGCAACTGGCCATGTGGCTCCACGTCATGGTTTCCGGCTGCCGCTCTTCCATTGCGCAGGGTAAGTCACTGTGTGGATTATCGCCAACGGTAGCAGGTGATAACATCGCCGTCAGGGGCGGATTTCCTGAATCAGACGGCCCACATTCATCATATTCAGCGTATTTCCGGCCCGTCAGGCCCGGTGGCTGACGTTAACTGGCTGTCGGTGGTTATGTTAAAACGCCGATAACACCGCCATCCGGCGTGGTACATTCGCGCGTGATGGGAGCCCGTCACCACATCGGGCTGTATTCTGCTGTCACCTGCGGCATCGTGTATGCCCTAGGCCTGCCACCGCGTCAGGCTCTGCGTGGCCTTGCCCGTCCCGCGTGTTCGCCTTTTCACCACCGCTGCGGCCCACCGTGGCGGGGCTTCACGGCAGTTCAGGCTGTCGGTGATGAACGATCTGGTCCTTCATACTGATACGTATAGCTTAAGCCTGCCGGGTTTTGGCTGTTCTCACCGCCCGTCGCTGTCAGCCAACGGTAACAGATTTCCGGTCGGCCCGTGTGACGGTGCGCCACCATCCAGCCAGTGTATCATCGCCTGATAAGCTGCGCACCTGCTCATTGCGGTCATGCCTGCGCCAGTTCGCCGCAGGGCGCGATCCAATATAGCGCACCAGCAGCGCGGCAGGTAAATTCTCCGTTATTCCGGGTCGTGCGTCGCCACGCGGCGAATGAAGACAGATGCCGTTATCCAGCCATATTCGGTGTAACCCGGCGGGGTATCTGGGAAAAGCTGGCGGGTTCCGTCCCTTGATAAGCCCTGCCAGGCTTCTTCTGCCTTTGCATACGCCGTGGTCAGTACCAGCCGGAAGTGACGCAGCACCCATCAAATCCGCCGGTGAGATTTCGCCGCTTTCAATTCACCGGCGGCTTCGCGGTGGAACGTCTGTTATGCGCCAGAAGCGGTCCACCAGCTGATCAGTACCGGTACGGCGGCACAGCGGCATGGCGTACCTCATCCCGCTTCCGGCACCGCTTCCCGCCCAATGCGGCAGCCTGCCACGGCCCCTGCGGACTGTTTGTCGCCAGATAACGATGCGGACTTAGCGGAGTTCTTCCGGCAGCGCCTGCCGATGCGGCCAATACCGGTATTATTCATCCAGTTTCGCGCCACGCCGCCGCGCACCAGCCACAGTGACTCGCTGCGGCTTATGCCGTCACCGAACAGGGTGCTCAAATGCAATTCTGCCGCCGTTATCACTGAGTATCCGGTGTATCCAGCAGCTGTAGCGGATCGCAGGCATTTTCCAGCCGGGGCCAGAAACCACCGGCGCGGGCGTTTTGTCAGTAACTGCTGTAGGTGCAGGAAGATAGACGGCAGCGGGCCGGGCAGGGCGATATCGGTTTCACCGGGAAGGACCTTTGCGCGAGCAGCGGATTGACCGGATGGCCGGACGATACCCCGCCGGGGCACCAGACAGGCCACGCCGGTGGGAGCTCGATACGTACTGGCTGAACCCTGGACAATCTACCGCCATACTGCGTCCGTATCGCCCTGACGCGCCGCCGGTTTCCGCTCATCCTCATCCTTGTTTTATCGGGTTGTATTTTGTCTTAACGACAGGCGAAACCCTACAGATTTATAAAGCCAGTGAGATATCTGTCAGATAAGAACAATTAGAAAATGTTTATATATATTTCGCGGATAGCAATGTTTCGATTGGTATAACGATGTCTAAATATTCCTCTAGACATCTTCCTGGTGCAAAAACCGCCAGCGTTTCGCTGTCAGTTTCATCATTCAAAACTCAGCAAATCAATAAAAATCACTGGTTGCCCTTTTCAGCCACATGATCCATCCACACCGGTTTTGTCATTGGTTTTCGACCAGACGCGATGCAGGTAAGCTGTAAAAGCGGGCGCGGTCTTTTCCAGAAAAGCAACAGAAGGCAGCCTTAGAACGCCCGCTGCAACCGCGCCAAGTGCGGCGTAAAAAGATAAGCCATGGGATATTCTCTGTAGAGTTCCATACTTTTCTCCCCTTTTGTATCTGCCCGGTGAATGGCACCGGAAAATGAATTGTTTATCTGATGAAAATAGTACCGCCCTTTGTGCTAATTTTACTGCTCATCGACCACTTATTTTTGAACTTATTGATGGTTTGTACATTAATCCTGTGATTAAGTTACACAAAAAGTTAAATTAATACTAAACATTAGATTTAAATCATGGCTTTTGCCATTTTTATCTTTTTTGCACCCCGCCCGCAGATTTTTGCGAAATCTTTGCAGCTTCGAAATTCTACCTTCGGTATCACTTTTAGGCCACTGGAGGTGCACTGTGAGTGCAGGCGTGATAAGCAAAGCGTATTGCTCAGTGTTTTATTACTGGGTTATCTGGTTTATGCCTGATCAATGCGGAGGCGTTCTGAGTGGCTGCGCAAAGGGTTCTTACCCAGTCGCCACGTTTTTACTGGTGTTAATGGTGCTGGCGCGCGTCCTTTGGGCAGCGGGCTGGCGCCCGGCTGATTAATGACATTCCTCTTCCCGGTACAGCGGGCGTTGAGCGCGTGCGCCATACGCGCCAGCGTCTCTGACCGTGGATGAACTGGAAGCAATATCTTTGTGCCATTCTCGGCCTGAACATGCTGGGGCTGGCGGTGCTGTTTTTGCATATTTGCTCGGTCTTTATCTGCCGCTTAAATCACAGCGGTGCCAGGGCTGTCATAGGATCTGGCGCTGGAGCCGCCGTCAGCTTTGTCGCAATACCAACTGGCAGCAATCTTATAGCGGGTGAAACCACGTTAGACTCTTCAACCAGATGGCAGGCTTAACGGTGCAAACTTTCTTTCTGCCTTGCGCTAAACTAAGATTTGCGGTGATTTTTGCCCTCGTCATTGCGTTTACCCGCCGGAGCATAGGCACGCTCGAGATATAGATTAGTCTGCTACGCATCACGTTATGATTACTTTAGTCCTGTGGCGTTGTTAGATTGCACTGTTTTTATTAACAAAGGTGCGCTGCAAACTTTCTGCTGCCATCAGGCTGTGAATGCCGTTGAAGGGCACGCAACTGGCTATTTTATGGGGCCTGTAGCTTCTCAGGAAGCGATCAAGATGCTCAGTACTAACAGCGGTGGCTTCTTCGCTTCGACTCTTCGCATCCGTTTAACCCAACCGCGACCAACTGTGCAGATGCTGGCGATCTTCTTGATCCCAGCGGCGCTGTCTTTGGTGAAGTGATGGGCGATCGCCGCCAGAGGGCGCATGTTCACCATGGGCGATGTCGATGATTTTGTCATCTGCGTAGGCGTGGTGGTATGGGTTAAACACTGAAGCAGACGCCGGGCTGAGCGACGGAACGTAATGCGTAACTGGG
+>fa215e11-ce27-464d-9a53-f0186fea1dc9
+TGTGTACTTCGTTTCAGTTACGTATTGCTCTTGCCTGTCGCTCTATCTTCCGGCGTCTGCTTGGGTGTTTTAACCTGTATTTCCAGCCCGTGGGCCCGGTGGCTGACGTTAACTGGCTGTGGTGGTTATAGTAAAACGCCGATGCCCACACCATCCAGCGTGGTGATGCGCGTGATGAGGCCCACGTCACCACATCGGACTGTATTCTGTTGTCCTGCCCTGCGGCATCCGTCTGTGCCCTGGGCCTGCCCACGCGTCAAACTGACTCCTGCGTGACGCTGCCGTCGCGTGTTCCTTCACCACCACTTCAGCCCGCCGCCTGCGTGCAGGACTTCGGCGGTTGAGCTGTATCGGTGATGGTGATGCGGTCCTTCTCATACTGATACGTGTAACTGGCCTGCCAGGTTTAGCAGCTGTTCTGTCACCCGCCCGTCGCTGTCGTAACCAGAACAGATTTCCGGTCGGCCCGTGTGACGGTGCGCCACCATCCGGCCCGATATTTTATCATCGTAAAGCTGCGCACCTGTATTATTGCTGCGGTCATACACCGCCGCCAGTTCGCCACGGAAGTAATGCGCAGCGCACCAGCGGCGCGGCGAATTAATTCTCCGGGTATTCCGGGTCGTGCGTCCAGCCACACGGCAGACAGACGGATGCCGTTGTCCAGCCATATTCGGTGTAACCCGGCAGGGTATCAGAAAAGCGGACGGTTCCGTCCCGCCGGAAATAACCTGCTGCCGGGCTTCTTCTGCCCGCTGCGCCTGCTGCGTGGTCGTACCAGCCGGAAGTGACGCGCCCGGCATAACCGTCACGCCGGTGATTTCTGCCGCTGAATTCACCAGCGGCTTCGCGGTGGAACGTCTGTCATTGCGCTTGAAGCGGTCCACCAGCCGGTCATTACCGGTACGGCGACGGCGGCGCAGGCAGCGCTTTACCTCATCCGCTTCGGCACCCGCCACCAGCCGAGCAGCCACCGGCCCCTGCGGACTGTTTGTCGCCAGATAACGATACGGACTTTAGCGGAGTTCTTCCGGCAGCGCCTGCCAGAGTGCGGCCAGCCGGTGACCTTCATCCGGATTTCGCCACGCCGCCGCTTTTGCCAGCACGGTGACTCCGCTGCGGCTGTAGCCGTCCTCACCGGGAAACAGGTGCTCAAATACAGGCTTCTGCCGCCGTTCATCACTGAGTATCGTGTTTATCGCCGTATGGCGGATATCCGCAGGCATTTTCAGCGGGGCCAGAGGCTCCTGGCGCGGGCGTTTTGTCCGGTAACTGCTGTAGGTGCGGGAGAGAATGAACGGCAGCGGGCCGGGCGGGGCGATCGGTTTCACCGGGAAGGACCTTTACTGAGCAGCGGATTGACCCGGATGGCCGGACGTCACCCCGCCGGGAGCTTACACCAGACAGGCCACGCCGGTGGGGCACCGATGCATTACTGACTGAACCTGTGGACAATGCTACCGCCATACTAAATCCCTTAACATCGCTTCAGCGCGCCGCCGGTTTCCGCTCATCTGCTCGCCATCCTTGTTTTATCGGGTTATTTGTCTGCTGACTGGGCAAAGCCCTGATTTATAAAGAAAGCCTTAGAGGTGAGGATATCTCTGTCGGATAAGAACAATTAGGAAAATATTTATATATACCGCGGATATAACAGTTGGTATAATAACGATGTCTAAATGTTCCTCTGAACATCTTCACCATTGAAACCGCCAGCGTTTTGCGCTGTCGGTTTTCAATCGTATTCAAAACTCAGCCAATCAATAAAATCTTAGTTGCCTTTTCGACACAGTCCATCCACACCGGTTTGTCATACGGAACCACCGATGAGACGCGATGCAGGTAGCTGTAAAAGCAGGCGCGGTCTTTCCAGAAAAGCATGAAGGCGGCATGGAACGCCCGCTGCAACCGCATAAGTACGGCGTAAAAGATAAATACATGCCGGGATATTCTCTGTAGAGGTTCCATGCTTTTCTCCCCGCTTTAGCCTCTGCGACGAATGGCACCGGAAAAATGAATTGTTTATCTGATGAAATAGTACTGTAGCCTTGCTGGCTTTACTCGTAAATCCTTATTTTTTGTGATGGTTTATTTTACATTTCATCTGTAGTAAGTTACACAGTTAATTAATACTAAACATTGATTAAATCATGGCTGTTTTATACTTTTACACCCGCCCACGGATTTTGCGAAAATCTTTGCAGCGAATTCTACCTTCAGGTATCGCTTTTGGGCTGCAGGTGCCACTGTGAGTGCAGGCGTGATGAACTGGCGTATATGCTACTCGCGATGCTTTTTTTTTTTATTACTGGGTTATCTGGTTTTGCATGCCCTGATCAGCAGGCGTTCTGATGTAGCTGCACATAAGGTTCTTCTGAAATCGCCATTTTTACCAAGTTATTGGCAATGGGTGCTGCGCGTCCTTTAGGCAGCAGGCTGGCAGCTGATTAATATGACATTCCTCTTTGGTACAGCAGGCGTGAGCGCGTACTTTTCGCACTTGGCGTCTCAGCCGTGAAATTGAACCGACTTCAATATCTTTTGTACCATTCTCGGCCTGAACATACTGGGTGGCGGTGCTGTTTTTATGTTGCTCGGTCTGGCACTATCTGCTGCTGTCCACGCAGCGGTTGCTGGGGCTGTCATTGGGATCTGGCGCTGAATACCGCCGTGTTTGTCACCTGCTGGCAATCCCATGGCGGTGAAACCACGTTGGCTATTTCAATGATGGAAACCAACGGTACCGAAACTTTCTTTCTGCCGCCAACGAGACACGTTGATTTTTGCCCTCTCCGTGCGTTACCCGCCAGAACGCTGAGCACGCTGGAGATGCTGGGTCGATCTGCTACCGCATCGTTAACCAGATTACTTCTAGTCCTATTGGCGTTGACAGTTACACTGGCTTTTTATTCAACAAGGTGCTTTGAAACTCACTATCAAGGTGAATACCGTTGAAGGAGCGCAGCGGCTGCTACCGGAACTGTAAGCTTCTCAGGAAGCGATCAAGATGCTCGGTACTAACGGCGGTGGCTTCTTTAAACACCAACTCTGGTCGCATCAGTTTTGGCTTCGCTACTGACCAACTTCGTGCGGATGCTGGCGATCTTCTTGATCCCAACGGCGCTGTGCTGCGCTGGCGGTGATGATGGGCGATCGCCGCCAGGGGCGCATGTTGCTGTGGGCGATGTCGGTGATTTTGTATAAATCTGCGTAGGCGTGGTGATGCTGGGCAGAAGTTCAAAGTCCTCATCTGCTGGCACTGGGCACGGACAGCAGCATCAATATGGAAGGTAAAAGAGAGCCGTTTCGGCGTGCTGGTCAGTAGCCTGTTTGCGGTCGTGACGACGGCGGCGGCTTCCTGTGGCGCGGTGATTGCGATGCATGATTCGTTTACCGCTCGTGGCATGGTGCTGATGTGGCTGATTAAATTGGTGAAGTGGTGTTCGGCGGTGTCGGTTCTGGTCTTTACGGCATGATGCTGTTTGTCCTGCTGGCGGCGGTGTTTATTGCCGGGCGATTCGACCGTACACCGGAATATCGTTAAAAAAAATCGACGTACGCGAGACAAACTGACTGCACTGGCAATTCTGGTTACCCCATTGCTGGTGCTTTGATGGGCGGCGTGGCGATATTGACGCCAGATAGCGCCATGCTCAACCCTGGCCCGCATGGTTTAGCGGAAGTACTACGCACACGTGTCATCCGCCGCTAACAACAACGGCAGCGCCTTTGCCGGATTAAGCGCCAACTCTCCGTTCCTGGAACTGTTTACTGGCGTTCTGCATGTTTTGTCGGTCGCTTCGGGAATTCCGGTATCGGTGGTAATTGGTTCGCTTCAATTAATTAAAAAGAGCCAAAGCCGCCGAAACGGCACGCTGCCAACGCACGGCGGCCCGCTGTTTGTTGGCTGTTAATCGGCACCGTGTTGCTGGTTGGCGCACTGACCCTATCTGCCTGGCGCCTTGGTCGGTCCGGTGGCAGGAATATCTCCTGATGATATTGGTGAGCACTGGATATGAGTCGTAAACAACTGGCGCTATTGAACCAACACTTGTCGTTCAGGCGCTGAAAGAAGCCGGTGAAAAGAATTAAACCCGCAGGCGCAATGGCGCAATCCGGTGATGTTTATCGATCTGGATCGGCGGTCTGCTGACCACCTGTATTAGCATCGCGATGGCAAAAACCCGATTGCGATGCCCGGCTTTAATGCGCTGTTTAGCGCGGCCATTAGCGGTTGGCTGTGGATCACCGTACTGTTCGCTAATTTCGCCGAGGCGCTGGCAGAAAGGCGCAGTAAAGCGCAGGCCAACAGAGATATTGAAAGGGGTGGGGTTAAACACCCAAACAGACGCCGCCAGATGGGGCAG
+>4148f43d-5b21-441b-a6cf-d4044e318987
+TCGTGCTTTGAACCGAAGTTGCACGCTGTCGGCTCTATCTTCGGCGTCTGCTTGGGTGTTGTATCGCGAGTGTCGATCGAAATGTCTCTGCCGGGAGTTAACGCTTCCTCAATCCTAGCCAGTCAGAAAGAATACGCGTGCCGCCGGTGACAGGCAAATCATACTGGATTCACGGATCACCGAGTGCCGATTCCCCGGTGATAGCGCTTTCGTCAGCCGATGCACCCTTCAATAACTTCATATCGCGGGATAATGTCGCCAGCTACCAGTACGATATCGCCTTTACGGGGATTTGGTCGGCACAAGACTTTGTCACCATAGCGCCTATTTCGGCTCACGCAGCTTGCGGGCAAAGGCAGTTTTTCCCCTTTTCAGACTGTTGGTACCACGCTTTGCGGCCTTCTGCCAGCACCTCGGCAAAGTGGCAAGAACAATTTGTTGATCCACAGCCAACCGCTAATGGCCGCGCTGACAGCGCATTGCCGGGCATCACCGCTTGCCTCGCGATACTAACCACAGGTGGTCAGCGACTGCCGATCGGACAGTAAACATGCGGATTGCGCCATTGCGCCTGCGGGGTTTAATTTTTTCACCCGCTTCTTTCAGCGCCTGAACGACAAGTGTTGGTTTCGAATAGCGCCAGTTGTTTGACTCATATTAGTGCTCTCAATATCAATGGGAAGTGTTCGCCACCGGACCAAGCGCCAGGGCGGGGATGATAAGGTCAGTGTAACCAACAACACGGTGCCGATTAACAGGCCAACAAACAGCAGGCCGTGCGTTGGCAGCGATGCCGGAGCTGGCGGCGGCTCTTTTTACTCACCAGCGGGCAAGCGAAAATTGCCATCCGGGATAATCACCCCGTGACCGACAAACCTGCAGAACGCCATTAAACCAGTTCCAGAACAGAGTTGGCGCTTAATCCGGCAAAGGCGCTGCCGTTGTTTGTTAGCGGCGGATGACGGCGTACGGCACTTCGCTAAAACCATGCGGGCCAGGGTTGAGCATGGCGCTTCGTCCGGCGTCGGTCATCATCGCCAACGCCGCCCATCAGCACCAGCGTCAGGGTATTAGAATTGCCAGTGCAGTCAGTTTCATCTCGCGTACGTCGATTTTTTACCCAGATATTCCGGTGTACGACCAATCATCAGCCCGGCTGTCGCTTCACCGCCAGCAGGACAAACAGCATCATGCCGTAAGACCAGAGACCGACACCGCCGAACACCACTTCACCAATTTGCATCAGCCACGTCGGCACCATGCCACAGGCGGTAAACGGATATGCATCGCAATCCACCGCGCCACGGAAGCCGCCCGTCGTCACGACCGCAAACAGGCTATTATGCGCCAGGTGGCTCTCTTTACCTTCCATATTGATGCTGCTGCTGTCAGGTACTGGTGCCGGCAGATGATTACCCTGAACTGCTACACATCCACCACGCCTACGCCAGATGACAAAATCTGACATCGCCCACAGCAACATGCGCCCCGGCGTGATCGCCCATCACTTCACCAAAGGCAAGCACAGCGCCGTTGGGATCAGAAGATCGCCAGCATCTGCGCGAAGTTGGTCAGTGCGGTTTGGGTTTCATGGATGCGACGGTTGGCGGTAAAGAAGCCACCGCCGTTAATTTTCCGAACATCTTGATCGCTTCCTGAGAAGCTACAGGCTATGGTAACAGCTGTTGCGCTCCTTCAGCGGTATTCACAGCCTGATAAGGCAGAAAGTTTTGCAGCGCACCTTGTTGAATAAAAACGGTGCAATCAGCAACGCCACAGGGACTAGCACCCATAACGTGATGTAACGAATCGACCCAGAGCATTCCCGAGCGATGCTCATGCTCTGGCGGAGTAAACGCGCGGATGCGGTAAAAATCACCGCAATCGCTGGCGGCAGAAAGAAAAGGATTTTGCACCAATTAAAGCCCATACCATCTGGCTGAAATAGCTCAATGGTTTCACCGCTATAAGATTGCCAGTTGGTATTGGTGGTAATGACGGCGGTGGCGCCAGATCCCACGACAGCCTGGCAACTGCTGTGGATTAAGCGGCAGATGGTGCTGACCGGAGCAACGCAAAAACAGCACCGCCAGCCCCAGCATGTTCAGGCCGGAATGGCACCAAAGATGTAGCCAGTTCATCACGGTCAGGGCGCCAAGTGCGCGAAAAATGCGCTCAACGCCCGTTGTACCGGGAAGAGGAATATCATTAAATCAACCGCGCCAGCCCGCTGCCTAAAGGGTAGCGCCAGCACCGAAGCTAACACCAGTAAAAACGTGGCGATCGAAGTAAGAACCGCCCGCGCAGCCATCAGAACGCCTCCCGCATTGATCGGGAACAAGCAGATATAACCCAGTAATAAAACGCAACAATACGCCGGTTATCGCGCCTGCGCTCACAGTGCTGCACCTCAGTGGCCCTAAAAGTGATGCCGGAAGGGGTAGAATTCTGGCTGCAAAGATTTCGCAAAATCTGCGGCGGTGTAAAAAGTATAAAAATGGCAAAAGCCGCCGTTTAACTAATGTTTAGTATTAATTTGGCTTTTATTGTGTAACCCAATTTACGGATGAATGTAAATAAAACCATCAATAAGCAAAATAAGTGGTCGGATGGGTAGTAAAATTACACAAAAGGCAATTTCTTTCCATCAGATAAACAAATTCATTTTCCGGTGCCATTCACCGGAGTAGATACGGGGAGAGAAAGTATGGAACTCTACAGAATATCACCGCTGGCCTATCTTTTTACGCTGCGTACTTATGCGGTTTAGCGGGCGTTGGCGCTGCCTTTCATCCTTTTCTGGAAGGAACCGCGCCCGCTTTTGGCTACCTGCATCGCGTCTGGTGAAAACCAGCGATAAATAAACCTTGGATGGATCCAGGCCGAAAAAGCCAACTGGTGATTTTTATTGGTTGCTGGTTTGAGATACGTTGAAACCATAAGCGGAAACGCTGGCGGTTTTTATCGGAAGATCTTCAGAGGAATATTTGAACATCGTTATACCAATCAGGAAGCATATATTTGTAGAATATGCTCATAAATATTTTCCTAATTGTTCTTATCTGACCAGATATCTCACTTAAGGCTTTCTTATAAATCTGTAGGGTTTCGCCTGTATCATGGGGCAAATAACCCGATAAAACAGGATGAGCAGATGAGCGACCAGCGGCGCGTCAGGCGACATGACGCAATTATGGCGATAGCATTGTCCAGGTTCAGCCGGGGGTACGCATCGGTGCCCCACCGGCGTGGCCTGTTCGGTGTTCTTGGCCCGGGGGTGACGTCGGCCATCAGGGTCAATCCCGCTGCTCGGTGCAAGGTCCTTCCGTGACCGACATCGCCCTGCCCGACCCGCTGCCGTTCATTCTCTCCCGCACCTACGGCAGTTACCGGTAAAAACGCCGCGCCGGTGGGGAGCCTCGGCCCCGGCTGAAAATGCCTGCGGATATCCGCTTACAGCTGCCGCGATAACACACTGATACTCAATGATAACGGCGGCAGAAGCCTGTATTTTGACACCTGTTTCCCGGTGGACGGTTACACAGCCTGGCGAGTCACTGTGGCTGGTGCGCGGCGGCGTGGCGAAACTGGATAGAGGTCACCCACCGGCTGGCCGCCTTTCTGGCGACGCTGCCGGAAGAACTCCGCTTAAAGATCCGCATCGTTATCTGGCGACAAACAGTCCGCAGGGGCCGTGGTGGCTGCTCAGTTGGTGTGAGCCGGGTGCCAGGAAACGGATGAGGTGCTGCCTGCGCCGCTGCCCGCCGTACCAGGTACTGACCGGGCTGGTGGACCGCTTCGGGCGCACAGACGTTCCACCGCCGAAGCCGCCGGTGAATTCAGCGGAAATCACCGGCGTGACGGATGGTGCCGGGCGTCACTTCCGTACAATTACTGACCGCAGGCGCAGCGGTGAAGAAGCCCGGCAGCAGGCCATTTCCGGCGGGACGGAACCGTCCGCTTTCCTGTCCCTGCCGGGTTACACCGAATATGGCCGGGACAGCGGCATCCGTCTATCTGCCGTGTGGCTGGCACGACCCGGAATACCCGGAGGAATTTACCTGCCGCGCCGCTGGTGCGCTATGGCTGGACGCCTTGCGCGGCAAGACTGGCGGCGGTGTGACCGCAGCAATACACGAATTTTGCAGCTTTACTTACGATGATAAATACCGGGGCCGGATGGTGGCGCTTTTGCCGTCACACGGGCCGACCGGAAATCTCAATTACCGTTACACGACAGCGACGGGCGGGTGACAGAACAGCTAAAGCCAGCTGGGCTTAAGTTACACGTATCAGTGAAGGACACCTCCACCCATCACCGACAGCCTGAACCGCCGTGAAGTCCTGCCGCAGGGTGAAGGCGGGCTATGGAGTGGTGAAAAGGAACACCTGGCGTTGGCAGCGTCACGCGAGTCAGTTTGACGCGGTGGGCAGGCTCGGGCTGAACGGATGCCGCAGGCAGGACAACAGAATACAGTCCGGATGGTGACGGGCCTCATCACGCATCACCACGCCGGATGGCAGGGCATCGGCGTTTACTATAACCACCACAGCCAGTTAACGTCAGCCGGGCCTGACGGGCTGGAAATACGCCAGGGAATATGATGGATAGGACGTCTGATTCAGGAAACTGCCCCTGACGGCGATATCGCCGCTACCGTTGCTGATAAATCCACACGGTGACTTACCCTGCGCAACGGAAGATGCAGCGGAAAACCAGGCGTGGAGCCGTTACGGTCCAGTTGCTGGGCTTCACTGGCTGTTTCCGGTTATGTAACCGCTATGACCATGACCGTTTTTGGTCAGGTGACGGCGGTGCACCGCGAAGGGCTGAATCAGTACCGCGCATACACGACAGCCGTGGACGGTTAATTGCCGTGAAAGACCTACGCAGGGCCATAGAGCGGGTATGATACAACACCGCCAGTGACCTGCCGTCATTGCCCCGGACGGCAGCGAAACGGGACACAAGGTTAAACACGAAGCAGACGCCGAAGATGGGCACC
+>8f548fb1-92c4-43a0-a032-74593f3988d4
+ATCATTGTACTTCGTTCAGTTACGTATTGCTACTTGCCTGTCGCTCTAGCTTCGGCGTCTGCTTGGGTGTTTAACCTATAACGGCAAAAATAGTCAATAGTAGGATGCCTGACAATTTATGCTCTACTTTCCAGGCTTATCTGTAATCAGGAATAATAGAAATATGTTCATCAATTTTTAAGTTCCATTTGTTCACCTTATTTATGCAAGGAGTGTTGATCATGTATAAGCTATGAAAAACAGCTTTAGGTAATAAAGGAATATCTCAATTTTTAAACATAAAATGCAGGTATTTGGTACAAAAAGTAGCGTTACGTGATGATCTTTCCTGGGATACAACTCTGGCAATGGTATCGTGAACAGGAATACCATTTTCAAAATCATATATTGCTTCAAAAAATCGAGATGCGTTTCCCGAAATCCTCTATATCTTCCCAACCTTCTGCACCAGAAATAACGGCACAAATAGTCAACAGTAGAATAATATCTGACAATTTATGCCACTTTCCAGGCTTGTCTCTGTAATCGGTGTAATAGAAATATGTTCCATCAATTTTTTTTTTAGTTTCCATTTGTTCACCTTATTTATGTAAGGGTATTTGATCATGTATAAGCTATAGAAAAACAGCTTTAGACAATAAATGTATCTCAATTGTTGAACTTAAAATTCGAAGATTATTTAGTACAAAAAGTAGCGTTACGTGATCTTTCCTGCAAAGTAGACGCAAAATAAACACCTATTCATGAGTTTATATAATTTTTTCACAATGATTAATTTGTTTTCTCCAGGAAGAGATTTTTATTTCTCTTTCACTACGAATTAGTTCATGCTGTATCTTTATTAAACATTCGTAAGACTCATTTTTGTTCGGAAGATGTGCTTGTCATTCGAGCATAAAGTTGGTTTTCTCATCTTTAAAATATTTTACCATGATTGGATTATCAGGACTGTAACAACTGAACTGGATCACTGCTCTTTTTTGATAGATGCATGTATATAGCTTCCTAAACCGATCGCCGAGAAACGCCGTTTTCTGCCTGTATTTATCAACTCCTGCAACGTTCCTTTGATGGCATGATTTTCATTAAAAGGCGTAGTGACCCGACGCGAATTAAGAGTCTCGCCCGCTTGGTGTGAATTTATTATTTTTACATGTACGCAGTTCTGTTTGCCAATAATGCTCACCGATGTCCTCATTCACAATGCCATCCCACATGGCTTTTATTGTTAAGACGGGAAACGCGGAAAAAATAGTACCCTTAGCGAAATAGTAAAACAATCATGATCTTTGGCAATATTTCGCAATCAATATAACACAAAAACTAACAAATATCATCAGCAAAAGAACAAAACTCTTTTCATTTTTTTCTTATTCCTCTCGATGTTCTCTGTTTTTCATCTTAGCTAAAATTTCACCCAAATCATCTATCCTGCTGTTGCTGCCCATCGGGTTTATTAATGTCTGGGAATAAATGAGGTTCTGCACAGAGTATATCCTGGTGGTGGTGAGGTTGTTGGCCAATTTGTCTGTAGCGGGTAATCCACTTGCTGTCTTTGTATCCATCCCTGGATGCTGGGAATCCTGTGGCGTACAAGTCAGATTTGGTTTTACCCACTTCCTGCAATACAGTGTATTAATAGTCGTAGGGCTTAATGCTCTGAAGAATGTTTTGAAAACATTAGGCGCACTACTGGCCCTGTGGTCAATAGGATGGCGGTAATTGTTCATATGTCCGGCAATTTACTTGGATCGGGCGTAGGCGGTTTTGTTAGGTCTCGCTCCACTTATCCGCCATTATTTAAGTGTCCATATTTTGATGCCAGTCCCCATTGAATCTATATACTGAACCGGATTCAGCGGATACTGATAAAATTCCATCCCCCTTCAGCCCAATCGGATCCTGAGTGATATACCTCCTGCAGCCCGGGTCATAATAATAGCGGTGGCGGTTGTAATACAGGCCGGACTCCTCATCATACTGCTGCCCCGGCAGTGGATAGCTGCTGCAGCTGATGCGGGTTCTCTTCATTCAGCAGGTTGCCCCATTCATCGTATTCTGCGCACCATTCTGTTGCCCCTTCCATTACTGACCAGCGCCAGCGTGCGTGAGCCGCGATGGTCGCAGTGGTACAGGTGGATTTTCGCGCCGGCGTGTGTACACCGGGTCCCATCTGGTTTTACATCTGCTCCACCGTCAGGCCGCACGGTACCAGCCAGCGGCAGCTTTCCTCACTCACCCGGTCAGCCAAGTTTCACTTTCCAACCGGTCGGCATCTGCACCAGCACCGGCAGGAACACCACTGCCACCGTCTTCGCCGCCGGACTGCTTGAAGGTATCCGCCAGGCTGCGGCGCTGCGTTCGCCAATCGCGGTGGCGGTTTCAACCCTGATGGGTGGTGGCTCCCCGGCTGATAAATCGTCTGGATGCGGGTTCTGTCGTTCTGTATCATTGGGTCAGGCGGTCGCCGTCCCAGCCGTACCAGGTCACTTGCGGTTTCCGTGACAGCGACATCAGCCCGTCAGGTCCCGTTCACGTCGCCACACCCGTTTTGCCACCCTGCGGCCCAGCGGTCGTAAAGATAACTGGCTTTCATTAGCGGCTCTGCATGGTAATGTCCATCTGGTGCACCCGCCGGTGCTGACTGTCATGGCGTGATACCGGTGGGTGCGCTCATCATCGTGCGGATAACCCCTTCAGGATGAGTCGGTTTTTCTCCGTCAGCCTGCCGTGACAGTCATACCAGTAAAAGATAGTGCGCGTCACCGGGCGATACGGTTATCAGCCCACATGCTGAGGTGCTGTCAGGTGCAGCTCCGGGTCGGGCAGGCGGTTACCTGCCGGGTCGGCATACGGGATGTAATGCCCAGGTTACATATAATAATAAGAGCAATTAACTGTTGTTGTTTAGCAATGTGCGCTTACTTAATACAAACCATTGAATATACCCTCCTGACAGAAAGTAAAGCCATATTATTATCGCCATAATATACTTACTATCAACCCTTACGCCAATAATATCTGATGCAGATCCCTATAAATATTAGAGCAATAAGAATACTATGCCTGTTGGAAAACATATTACCATCATTCCAAGACATGCAGGACTAATTAACTCGCTCACATCACGAGTGGAGTCTAATAGTGAAGATCTATGCATGGAAAAAGAATAGTATTAAAAGCGATAAAGCCAGCCATATAGCTCACGGAATAAAAAAAATAATATATTTCATTACATCACTCCGGTGAATACAAATCTAATAAAACGTCAATGTTATTTCCGGAGCACTTCATCTTACATGTTTCACAAGGTATTAGACCAGTCTTGGCAGTTTTAAATAGCCCTAAATTTATAGGGGTGCGACTATATCCAGGCAATACCGAATAACGCGGCTGCCCACTCTTTAAACTTCCTTTTAAACGTTCTCCACACAACTATTATCCCCGGTTTCAAGCAGTGCACTAACGGCCAACAGCTTCTTTATTATCATTACTTGCTACCTGGCCCCTAGACCATCTCCTTTTGATTCTCCCCGTTGGTCTTGGCCACCACAAATATAGTCCCCTTTACCATCTGGGACACAAAGATATTGATGATAGAACGGATTCCCCATATATCTGGACCGCTTCTTTCACCAGTTCCGCCCATTGAATGCAGTGGCTTAATGCATTTTAGTGTTTCTAATCCTAATGGATCTATATTTGAGATCGGATTCAACGGATACTGATAAAATTCCATCCCCCTTTCAAGCCCAATCGGATCCTGAGTATATCGCCCCTGCAGCGGTCATAATAGCGGTGGCGGTTGTAATACAGGCGGGCTCTCATCATACTGCTGCCCGGCAGGTATGGATAAGCTGCTGCAACTGATGCGGAGTTCTCTTCATTCAGCAGGTTACCCCATTCATCGTATTCTGCGTACCACGCTGTTGGCTCCTTCCGTGCTGATAAAGGGCCAGCGGCAGGCCGCGATGGTCGCGGTGGTACAGGTGAATTTTTCGCGCCGGCGTATTATACCGGGTCAATCGGCTTTGCATCTGCGCCACCACCGTCAGGCCGCACGATGCCAGCCAGCGGCTCCTCACCTCACCCGGTCAGCCAGGATTTCGCACCAGCCGGTCGAGCATCTGCACCAGCACCGGCAGAACACTACTGCCACCGTCTTCGCCACCGGACTGCTGAAGGGTATCCATGAGCTGCGGCGCTGCGTTTTCGCCAGCTCACCGGTGGCGGTTTCAACTGATGTGGCGTGGCGGCTCGGCTGATAAATCGTCTGGATGCGGGTTCTGTCGTTGTATCGTGGTCAGGCGGTCGCCGTCCCAACCGTACCAGGTCACTTGCGGTTCCGTGACAGCGACATCAGCCCGTCAGGTCCGTTCACGCCGCCATACCCGTTTTGCCACCCTGCATTGTAGGTCGTAAAGATAGCGACTTTCGACCAGCGGCTCTGCATGTTCAATGTCGCGTAAGTGCACCAACCGGTGCTGACTGTCGTAATGGTACCGGTGGGTGCGCTCATCATCCGTGCGGATAACCCCTTCGGGATGAGGTCGGCTTTCTCTGTCAGCCTGCCGTGACGGTCATACCGGTAAGATAATTGCGCGTCACGGGCGATACGGTTATCCGGCCACATGCTGAGGGCGCTGTCCGGGTGCAGCTCCAGGTCGGGCAAGGCGGTTACCTGCCGGGTCTGTGGTATGCAGGATGCGGATATCCAGATTCGCTGCGGTGGTGTGAACGCCGGTCAGCCTGCCGGTGGTGCTGTAGCTGTAACTCCGGGTCTGGCGCGGGCTGCTGATGCAGATTGAGTTCGCGGTGTTGTCGTTCCAGGTGTAATCGCGGTCAGACCAGCAGGCTGTTCAGGTGCTGGCTCGTAACTGCCCGGCAGAATATAAGCATTGGTGAGGATTCATAACGGCCAGAAACTGCTGGCGTTTCCAGTGCAGGCGGTCGCGGGTGTACTCCACCAGCGGTGTGTCGCGAGTTTCATACCTGACAGCCAGCCGCTACCCGGTAATACATTCCACGGCAGACAGGCTGTCCGGTATACAGCGGTTCGCCAGTCACAATGCCGTTGTACGCATGTCCTGGTCTCATGCCAGAGCAGTTCATTCGTCTGCGGATGATGCACCGTCAGGTGTTCACGCTGGCGAAGGCGCTACTGTCATAACCGCGGAGTGCACCGTCACCCGGTGCCCTTCGCTATTATGGCTGATGTCACTTCAAGCCAGCCGCGTTCGTCATACTGCCACGCTCTGCAGTTTCGCGTCACGGTGCGGTGCGTGGGCGGTCTGCTTCGTCATAGTGCCAGTGGGTGACCAGCCCCTCATCCTCGCTGCGGATAAGTTTGCCGGTCAGGTCGTGGTGATAACGCTGTGTGCGGCCGTCAAAGCCAGTTTCCTGTATCAACCGGTCAGTACATCGGCGCGGAAGGTGAATTGTGGCTGCCGTTTTTTCACTGGTCAGGCGGATGACCCGTCCGGCAATCAGTATTCCATACTGCGCGTCAGACCGCCCTGCGTGGTACAGATGGCTTTTCCCCACGCATCGTACTGTGTCCCGTTTCTGCTGCCGTGGGGCAATGACGGTGGGTAAGTCACCGGCGGCGTTGTCATACCGCGTTTCATGGCCTGCGTGTCTTTCACGGCAATTAACTGTCCACGGCTGTCGTATGCGCGGTACTTGTCAGCCCTTCCTCGCCTTACGGTGCACCGCCGTCACCTGACCAAACGGTCATGGTCATAGCGGAGTTATATTAGACAGTCAATTAAAGAAGCTCAACAACGCTGACCGTAACGGCTCCACGTCATGGTTTTCCGGCTGCCATTGGCATCTTCCGTTGCGCAGGAATTAGCAGTCACTGTGTGGATTTATGTAACGGTAGCGGGTGATATCGCCGTCAGGGGCGGTTTCCTGAATCAGGGCGGCCCATTCATCATATTGTCCCGGCGTATTTCCAGCCCGAGTAGGCCCGGTATTTGACGTTGGCTTTAGCTGTGGTGGTTATAGTAAAACGCCGATGCCCTGCCATCCGGCGTGGTGATGCGCGTGATGAGGCCCGTCACCACATCCGGACTGTATTCTGTTGTCCTGCGGCATCCGTCTGTGCTTCGGTTGCCCACCGCGTCCGACTGACTCTGCGTGACGCTGCCGTCCGCGTGTTCCTTTTTCACCACCCGCCTCAGCCGCCTTCACCCTGCGTATTGCAGGACTTCACGGCGGTTCCAGGCTGTCGGTGATGGTGATGCAGTCCTTCTCATACTGATACGTGTAACTTAAGCCTGCCAGGTTTGTTTCTACTTGCCATCCTTCCATCATGTAACAGTAGTAGATTTCCGGTCGGCCCGATGGTGCCCACCATCCGGCCCCCGGTGTTTATCATCAGCTAAATGGCTGCACCTGTGTATTGCTGCGGTCGCTTTACACGCCTGCCAGGTTCGCCGCAGGGCGTCCAGCCAGCGCACCAGCGGCGCGGCAGGTAAATTCTCCGGTGTTCACAATTGCGTCAACCACGGCAAGACAGACGGATTACGTTTGTCCCAGCCATATTCAGTGTAACCCGGCAGGAGTATCGGAAAAGCGGACGGTTGCGTCGCGATAAGCCTGCTGCCGGGCTTCTTCTGCCCGCTGCGCCTGCGTGGTCAGTACCAGCCGGAAGTGACGCCCGGCACCGTAAATCACGCCGGTGATTTCATACTTCGAATTCACCGGCGGCCTTCGCGGTGGAACGTCTGTGCCCGAAGCGGTCCACCAGCCCGGTCAGTACCCGGTACGCGGCAGCGGCTGGGGCAGCACCTCATCCCGCTTCGGCACCCGCTCCTTTCCAGCCGAGCAGCCACCACGGCCCCTACGGACTGTTTGTCGCCAGATAACGATGCGGACTTAAGCGGAGTTGTTCGGCAGCGCCTGCGAAGTGCGGCAGCCGGTGACCTTCATCCAGTTTCGCCACGCCGCGCACCAGCCACAGTGACTCGCTGCGGCAACCGTCCTCACGGGAAACCGATTACTCAAAATGAGCTTCTGCCATACGTTATCACTGATATCAGTGTGTTATCGCTGCCAAAGCGGATATCACCCAGGCGGTACCAGCCGGGCCAGAGCTCCCCACCGGCGCAGGCGTTTTTGTCCGGTAGCTTTGCTGTAGGTGCGGGGAGAATGGGCGGCAACCCGGGCCGGGGCTAAGGGCGTCATCAGTTTCGCAGGACCTTTACTTCGAGCAGCGGTTGACCGGATGGCCCGGACGTCACCCGCCGGGGCACCAGAACAAAGGCCACGCCGGTGGGGGCACCGATGCATTACCCCGGCTGAACCCTGGACAATGCTACCGCCATGCCGTCATGTCGCCCACAGAGCGCGCCGCCAGTTTTTCCGGCTCATCTGCTCATCTTGATGTTTTATCGGGTTATTTGTCTGCTGACAGGCGAAGAACCCTGATTTATAAGCCTTAAGTGAGATATCTGTCAGATAAAGAACAATTAGGAAAATATTTATATATATTTCGCTGAATATATGTTTCGATTGGTATAACGATGTCCCCGCAATATTCCTCCTGAACATCTTCCTGATACAAAAACCGCCAGCGTTCGCTGGCGGTTTTTCAATAATATTCAAAACTCAGCAATCAATAAAATCACCAGTTGCCTTTTTCGGCCCACAAGTCCATCACACCGGTTTATCGCTGGTTTCGACCAGACGCGATGCAGGTAGCTGTAAAAGCGGGCGCAGTCTTTCCAGAAAACGAAGGCAGCTTAGAACGCCCACTGCAACCGCATAAGTACGGCGTAAAGATGGCCATGCAGGATATTCTCTGTGAGTTCCATGCTTTTCTCGCGCATCTACCCGGTGAATGGCACGGAAAAATGAATTGTTTGCATCTGATGAAAATAGTACCGCGCCTTTTGTGTAATTTACTACTCATCCGACCACTTATTTTTTGCTTATTGTTCGGTTTTATTTGTTCATCCTGTAATTGAGGTTACACAAAGTTAAATTAATACTAAACGTGGATTAAATTATGGCTGCCATTTTATACTTTTACACCCCGCCCGCAGATTTTTGCGAAATCTTTGCAGCCAGAATTCTACCCTTCGGTATCACTTTAGGCCACTGGAGGTGCACTTTGTGAGTGCAGGCGTGATAACCGGCGTATTGCTGGTGTTTTATTACTGGGTTATGGTTTATGCCCTGATCAATGCGGAGGCGTTCTGATGGCTGAAGTTCTTACTGATCGCACGTTTTTTGCTGGTGTTGGTGCTGGCGCGTCCTTTAGGCAGCGGGCTGGCGCGGCTGATTAATGACATTCCTCTTCCGGTACAACGGGCGTTGAGCGCGTACTTTCGCGCACTTGGCGTCTCTGACCGTGAGATGAACTGGAAGCAATATCTTTGTGCCATTCTCGGCCTGAACATGCTGGGGCTGGCGGTGCTGTTTTATGTTGCTCGGTCAGCACTATCTGCCGCTTAATCCACAGCAGTTGCAGGGCTGTCGTGGGATCTGGCGCTGAATATATACCGTCAGCTTTGTCACCAATACTAACAGCAATCTTATAACGGGTGAAACCACGTTGAGCTTCTTTCAGCCAGATGGCGGGTAACGGTGAAACTTTCTTTCTGCCGCCAGCGGATTTGCGGTGATTTTGCCCTCTGTCGATGCGTTTACCCGCCAGAGCATGAGCACGCTCAGGGAATGCCTGGGTCGATCTGCTACGCATCACGTTGCCGGGGTACACTTTGGTCCTGTGGCGTTGTTGATTGCATATTTTTTATTCAACAAGGTATAGCTGCAAAACTTTCTGCCTTATCAGGCTGTGAATACCGTTGAAGGAGCGCAACAGCTATTACCCATGGGGCCTGTAGCTTCTCGAAGCGATCAAGGATGCTCGTACTAACGGCGGTGGCTTCTTTAATGCCAACTCGTCGCATCCGTTTGAAAGCCAACCACTGAAAAGGCAGCTTCGTTGCAGATGCTGGCGTCTTCGCCCGATCCCAACGGCGCTGTGCTTTGCCTTTGGTGAAGTGATGGGCGATCGCCGCCAGGCGCATGTTGCTGTGGGCGATGTCGGTGATTTTGTCATCTGCGTAGGCGTGGTGATGTGGGCAGAAGTTCAGGGTAATCCTCATCTGCTGGCACTGGGCACGGACAGCAGCATCAATATGGAAGGTAAAGGCCGTTTCGGCGTGCTGGTCAATGCTGTTTGCGGTCATTGACGACGGCAACCATAATGGCGCGGTGATTGCGGTGCCATGATTCAGTTTACCGCTCTCAGGTGGCATGGTGCCGTGTGGCTGATGCAAATTGGTGAAGTGGTGTTCGGCGGCGGTGTGTCGGTTCTGGTCTTTACGGCGCTGATGCTACGACATCCCTGCTGGCGGTGTGTTTGTGCCGGGCTGATGATTGGTCGTACACCGGAATATCTGGGTAAAAAATCGACGTACGCGAGGATGAAACTGACTGCACTGGCGTTCTGGTTACCCCGACGCTGGTGCTGATGGGCGCGGCGTTGGCGATGATGACCGACGCCGGACAGCCGGCGCCATGCTCAATACAGCCCGCGGACAGCGAAGTGCTGTACGCCGTGTCGTCGCCGCTAACAACAACGGCAGCGCCTTTGCCGGATTAAGCGCGCCAACTCTCGTTCTGGAAGACTGTTTGCGGCGTTAGGTTAAACGCAAGCAGACGCCGAAGGCTCACCGCA
+>280af896-8e53-4427-89d3-a554c87269fd
+TTGTTGTACTTCGTTCGGTTACGTGTGCTACTTGCCTGTCGCTCTATCTTCGGCGTCTGCTTGGGTTATTTAACCTGTCGGGAACGCTACGCAGGAGCTGAGAGGGGCAGGGAACTATCGAAGAGGTAGCGAAGAGGTGCGGGCCTCTTCCGCCACGCTGCGCCTGCGTGGTCAGCACCAGACGGACTCCGCCCGGCACCGCGTCCGTCCGCGGTGATTTCCCCGGCGGTCACCGGCGGCCTCACGCCAGTACGTCAGCGTCCGCCCGAAGCGATCCGCCATCCCGGTAAGCACCCGGTACGGCAGCGGCGGCGCTGGCAGTACGTCCTCAACACCAGCTTATAGACCGCAGTATCCACCGGCCCTGGCGCTGTTGGTCGCCAGGTAAGATGCGGGCTTAACCGGATATCCGGCGGCAGCGCCCAGCCGCGCCAGCGTATGGCCCGATCCGGCTGTGCTGCCTTACCACCGCGCACCAACCACATTGACTCCCCACTGCGTGCACACCGCCTCCCCGGCAGCAGAGGCTCAAAGTGGAATACTCCGCCCGCCGTTGTCGTTGAGTATCAATTCCGTCATCACGTAGCTGTAGGCGCGGATATCAGAAGGCGCTTTCCAGCCGGGCGGCACCCACCGGTGCAGGCGTCTTCGTCCGGTAGCTGCTGTAGGTGCGGGAAGATGAACGGCAACGGGCCGGGCAGCCTGAGTCCGTCTCGCCGGGCAGCACCTTCGCCCCCAGCGGCGGATTTACCAGGTTGCTGAAGTCATCCCGCCCGGACGCACCGAGCACGCCACGCCGGTGGGCGCGCCAGGTCTTACACCTGCCAGACCCTGGACAATGGGACCGCCATACTGAATTCATATCTCCTGACGCGCCGCTGGTTTCCGCTATGCGCCAAGGTACCTTTTGAGTTATTGTTCATCCTGTGGTAGCAGCAAAAAAAAATCAAAATGACACACAAGAGACCGGCTAATGTGTTTATATATTTTCACATAAACTTATTTGTTCTCAATCAACGTAACTGTTATTACAGGTCGCTTTCAATATTTTATTAAACTGCTGTTTTTAGCACAGATGAATTCATCATCAACAAATTCACTATATGGATAATCCATTCAGCATATGATTTATGATTTTATTAGTCTGAGTTATTTTTTGTGGGCTATATTTAAAATCAATAAACTCCACCGATTCCAGATTAATATCAGCAATAGAGAAGATGGAAATCACCAATTCAATAACATCATCAATGAAACATATTGTAAATTAATTTAAAACAAGGCGTTCCATTCAACCAGAACGCCCTTATTCCTCTCATCACCCACCAAACTGCACCTGGAACAGCGCCCACCCGCAACCAGTCGCGCACCCAGCCAGCCGCCGAAAGCGACAGCAGCAGCTCCCGCTGCACGGCAGGTTTTCAATCCACAATCGCCGGTCGGCTCCACGGAAAAATCGAAACACTTTTCGCCTGCAACACTGCCAGCGCCGTTTCCGCACCAATTGCGGCCACCAGGCCGAAACAAACCAAAGCATGGCGAATTTCACACCAACGTGGTACGCAGCAGTTTTTCCCCGCACCGAGTGTGCGCCACACCACCAGCTCCTGATGAGCGCTGACGCATTTCCCACCTGCACCTGTGCCCTTAAGCAGCAACATACCGCAGGCGGTGACCAGTACCACCATCACTGGTTAAACACCCAGCAGACGCCGCAATATCGGCAG
+>4205dba9-c9b2-4574-a9e3-25b8f7bfc601
+ATCGGTATTACTTCGTTCAGTTACGGCGTATTGCTTTTCTGTGTTGGTGCTGATATTGCGGCGTCTGCTTGGGTGTTTAACCTGTACAGCGTGGCGGTTGCCAGTGAACTGATGGTCAGGACCAATCAGCAGAATGGATCAGGGCAATTTCACCGTTCGGCGTTTTGCGTCGCTGTGCGCCTTCCACCATCGCGTCATCCGATCCGAAATGTCTCGCCGGGGTTAACGCTACACTGTCACCAGCCAGTCCAGAAAGAATACGCGTGCCGCCGGTGACGGAGAGCCCAAAATCGCTTCGCCAGTTCACGGATCTGTGCCGATTCCCCGGTGATGGCGCTTTCATCGACCGATGCACCCCCTTCAATAACTTCACCATCGCAGGGGATAATGTCGCCCTTCTACCAGTACGATATCGCCTTTACGAGTTGGTCGGCAGGAACTTTGTCGCCGCAGCGCCATATTTCGGCTCACGCGGCTTGCCGGGCAAGGCGGTTTTTCACCCCTTTCAGACTGTTGGCCTGCGCTTTACTGCGGCCTTCTGCCAGCGCCTCGGCAAAATTAGCGAACAATTACGGTGATCCACAGCCAACCGCTAATGGCCACCGCATAAACAGCGCATTGCCGGAGCATCGCACCGCTTGCCATCTTGATGCTAATGGAGTAGTCAACAGACTGCCAATCAGACGATAAACATCACCCGGATTGCGCCATTGCGCCTGCGGGTTTATTTTTCACCGCCTTTCAGCGCCTGAACGACAAGTGTTGGTTCGAGAATAAGCGCCAGTTGTTTGACTCATGATGGTGCTCGCTCAATATCATCAGGAGAGATATTCCGCCCACCGGACCAAGCGCCAGGGCAGGGATAAGGTCAGTGCGCCAGCCAGCAACACGGTGCCGATTAACAGGCCAACAAACGGCGGGCCATTCGTTGGCAGCGTGCCAGAGCTGGCGAAAGCGGCTCTTTTACTCACCAACGAACCGGCAATTGCCATCACCGGGATAATCACCCCGAAGCGACCGACAAACATACCCAGAACGCCGGTAAACGGTTCAGAACGGAGTTGGCACTTAATCCAGCAAGGGCGCTGCCGTTGTTGGTAGCGGCGGATGACACGGCATACAGCACTTCCGCTAAAACCATGCAGGCCAGGGTTGAGCATGGCGCCACGTCCGGCGTCGGTCATCATCGCCAACGCCGCCCATCAGCACCAGCGTCGGGGTATAGGTGCCAGTGCAGTCGGTTTCATCTCGCGTACGTCGATTTTTTACCCAGATATTCCGGTGTACGACCAATCATCAGCCCGGCAATAAACACCGCCAGCGGGACAAACAGCATCATGCCGCAAGACCAGAACCGACACCGCCGAACACCGCTTCGCAATTTGCATCAGCCACATCGGCACCGTACTGCCGAGAGCGATAAACGAATCATGCATCATAATCACCGCTTACGGGAAGCCGCCGTCGTCACGACCGCAAACAGGCTACTGACCAGCACGCCGAAACGGCTCTCTTTACCTTCCATATTGATGCTGCTGTCCGTTGCCCGGTGCCAGCAGATGAGGATTACCCTGAACTTCTGCCCACATCACCGCCTACGCAGATGACCCAAATGCTGACATCGCCCACGGCAGCATGCGCCCTGGCGTGATCGCCCATCCCACTTCACCAAAGGCAAAGCACAGCGCCGTTGGGATCAAAGAAGATCGCCAGCATCTGCACGAAGTTGGTCAGTGCGGTTGGGTTTTCAAACGGATGCGACGAGTTGGTAAAGAAGCCACCGCCGTTGGTACGAGCATCTTGTTCGCTCACAAAGCTACGGGCTACGCGGGTAACAGCTGTTGCGCTCCTTCCAGCAGCAGTATTCACAGCCTGATAAGGCAGAAAGTTTTACATGCCTGTATTTGAATAAAAAAACAGTGCAATCAACAACGCCACAGGGACTAACACCCATAACGTGATGCGTAGCAGATCGACAGGCATTCCAGAGCGTGCTCATGCTCCTGGCGGGTAAACGCACGGATGAGGGCAAAATCACCGCAATCCCGCTGGCGGCAGAAAGAAAGTTTTGCACCGTTAAGCCCGCCATCTGGCTGAAATAGCTCAACGTGGTTTCACCGCTATAAGATTGCCAGTTGGTATTGGTATGCAAAGCTGACGGCGGTATTCAGCGCCAGATCCACGACAGCCCTGGCAGCTGCTGTGGATTAAGCGGCAGATAGTGCTGACCGAGCAACATAAAAACAGCACCGCCAGCCCCAGCATGTTCGAAGCAGGCCGAGAATGGCACAAAGATATTGCTTCCAAGGTTAAACGCGAAGCAGACGCCGAAGATAGAGCGACAGGCAAAGAGCAATACGTAACTACCA
+>fb54982a-a9ad-4aeb-82e8-a4eea0e527a1
+TTGGTAACACTTCGTTCAGTTACGTAACCTTTTCTGTTGGTGCTGATATTGCGGCGTCTGGCGGGTGTTTTAGCCTGCCAGCTCACCGGTGGCGGTTTCAGCCTGATAGTGGCGTAGAAGCTCTCCCCGGCTGATAAATCGTCTGGATGCGGGTTCTGTCGTTCTGTATCGTGGTCGGGCCACGGTCGCCGTCCCAGCCGTACCAGGTCACTTGCGGTTCCGTGACGACATCAGCCCGTCAGGTCCCGTTCACGCCGCCATACCCGTTTTGCCACCCTGCGGCCCAGCCAGGTCGTAAAGATAGCGACTTTCGACCAGCGGCTCTGCATATTAATGTCCGCGTGTAGTGCACCAGCCGGTGCGGTATCATGGTACCGGTGGGTGCGCTCATCATCCGTGCGGATAACCCCTTCAGGATGAGGTCGGTTTCTCTGTCAAGCCTGCCGTGACGGTCATACCGGTAAAGATGAACCGCGTCACGGGCGATACGGTTATCCGGCCACATGCTGAGGGCGCTGTCGGAGATGCAGCTCCGGGTCGGGCGAGCGAGTTACCCTGCCGGGTCTGTGAGCTATACGGGATGCGGATATCCAGATTCGCTGCGGTGGTATGAACGCCGGTCAGCCTGCCGGTGTGCTGGCAGCTGTAACTCCGGGTCTGGCGCGGGCTGCTGATGCGGATGAGTTCGCCGTTGATTCCAGGTGTAATCGCGGTCAGACAGCAGGCTGTTCAGGTGCTGTCTGTAACTGCCCGGCAGGGAATTATAAAGCGGTGGTGAGTTCGCAACGGCCGAAACTGCGCAGCGTTTCCAGTGCAGGCGGTCACGGGTGTACTCCACCAGCGGTGTGTCGCCGAGTTTCATGCCCTGACAGCCAGCCGCTGCCGTAGGTCAGCCATTCCACGGCGGGCAGGCTGTCGGTATACAGCAGTTCGCCAGTCCTGTGCGTTGTACGCATGTCTGGTCTCATGCTGCCAGAAGAGCAGTTCATTCGTCTGCGGATGATGCACCGTCAGGTGTTCACTGGCAGGCGGCCTTTACTGTGCATAACCATAGTGCAAATCGCCGGTGCCGCTTCGCTGATATGGCTGATGTCTGTCAGCCAGCCGTTCGTCGCCGCTGCCACCGCTCTGCGGTTTCGCCATTCACGGTGCGGTGCGTGAGGCGGTCTGCTTCGTCATGGAAGTGCCAGTGGGTGACCAGCCCTCATCCTCGCTGCGGATAAGTTTGCCGGTCAGGTCGTGGTGATAACGCTGTGTGCGGCCGTCAAAGCCGGTTTCCTGTATCCAGCCGGTCGAGTACATCATGTAACGGAAGGTGGTGTGGCTGCCGTTTCACTGGTCGGGCGGATGACCCGTCCGGCAGCATCGTATTCCATACTGCGCGTCAGACCGCCCTGCGTGTACAGATGAAAGCACTTTCCCCACGCATCGTACTGTGTCCCGTTTCTGCTGCCGTCGGGAACGTGACGGTGGTCAGGTCACCGGCGGCGTTGTATTCATACCGCGTTTCATGGCCCTGCGTGTCTTTCACGGCAATTAACTTTAATCACGGCTGTCGTATGCGCGGTACTGACTCAGCCCCTCCCTCGCGGTACACCGCCGTCACTGAAACCAAAACGGTCATGGTCATAGCGGGTTACATAACCGGAACAGTCCAGTGGCTCAGCAACTGACCGTAACGGCTCCACGTCATGGTTTTCCGGCTGCCGGTGGCATCTTCCGTTGCGCAGGGTAAGTCACTGTGGATTATCATAACGGTAGCGGGTGATATCGCCGTCAGGGGGCAGTTTCCTGAATCAGACGGCCCCATTCATCATATTCCGGCGTATTTCCAGCCCGTCAGGCGGTGGCTGACGTTAACTGGCTATGGTGGTTATAGTAAAACGCCGATGCCCTGCCATCCGGCGTGGTGATGCGTGATGAGGCCCGTCACCACATCCGGACTGTATTCTGTTGTCCTGCCTGCGGCATCCGTCTGTGCCCTGAGCCTGCCCACCGTCAAACTGACTCTGCGTAGCGCTGCCGTCCGCGTGTTCCTTTCACCACCCGCTTCAGCCCGCCTTCACCCTGCGTGTGTGCGCAGGACTTCACGGCAGTTCCGGGCTGTCGGTGATGGTGATGCGGTCCTTCTCATACTGATACGTGTAACTTAAGCCTGCCGGGTTTTTAGCTGTTCTGTCACCGCCCGTCGCTGTCGTAACGACAGATTTCCGGTCGGCCCGATGTGACGGTGCGCCACCATCCGGCCCCGGTATTTATCATCGTAAGTAAAGCTGCGCACCTGTGTATTACTGCGGTCATACACCGCCGCCAGTTCGCCGCGGGGCGTCCAGCCATCAGCGCACCAGCGGCGCGGCGGGTAAATTCTCCGGGTATTCCGGGTCGTGCGTCAACCACGGCAGACGAGCGGATGCCATTGTCCCGGCGCCATATTCGGTGTAACCCGGCAGGGTATCAACGGAAAAGCGGACGGTTCCGTCCCGCCGGAAATAATGCTGCCGGGCTTCTTCCTGCCCGCTGCGCCTGCGTGGTCGGTACCAGCCGGAAGTGACGCCCGGCACCATCCGTCACGCCGGTGATTTCGCCGCTGAATTCACCGGCGGCTTCGCGGTGGAGCGTCTGTGTGCGCCCGAAGCGGTCCACCAACCCGGTCAATTTACCCGGTACGGCGGCTTGGCAGCGCAGGCAGCACCTCATCCGCTTCCGGCACCCGCTCACACCAGCCGAGCAGCCACCACGGCCCCCTGCGGACTGTTTGTCGCCAGATAACGATGCGGACTTAAGCGGAGTTCTTCCGGCGCGCCTGCCAGTGCGGCCAGCCGGTGACCTTCATCAGTTTCGCCACGCCGCCGCGCACCAGCCACAGTGACTCGCTGCGGCTGTAACCGTCCTCACCGAAACAGGTGCTCAAAATGCAGGCTTCTGCCGCCGTTATCACTGAGTATCAGTGTGTTATCGCGCAGCTGTAAGCCGGATATCCGCAGGCATTTTCGAAACCGGGGCCGGGCTCCCCACCGGCGCGGGCGTTTTGTCCGGTAACTGCTGTAGGTGCGGGAGAGAGAATGAACAGCAGCGGGCCGGGCAGGGCGATGTCCGGTTTCACCGGGAAGGACCTTTGCACCGAGCGGCCAGTTGACCGGATGGCCGGACTGTCACCGCCGGGGCACACCCGGAACAGGCCACGCCGGTGGGGCACCGATGCGTACCGGCTGAACCCTGGACAATGCTGCCGCCACATGCTGCGTCATGTCGCCCTGACGCGCCGCCGGTTTTCGCTCATCTGCTCATCCTTGTTTTTGTGGGTTGTTGTCTGCTGGTTAAACGCGAAGCAGACGCCGAAGATAGAGCGACAGGCAAGTGGCAATACGTAACGGCA
+>a6ec2107-dc02-44f1-96cc-704dfe885902
+TTGGTATGCTTCGTTCAGTTACGTATTGCTGCCTGTCGCTCTATCTTCGGCGTCTGCTTGGGTGCCTTCCATCCCCTTTTCAGCCCAATCGGATCTGGTGATATATCGCGCCCCTGCGGCGGGTCATAATAGCGGTGGCGGTTGTAATGCAGGCCGGACTCCTCATCCTTACTGCTGCTGGCAGTGGACAAAGCTGCTTTGGCTGATGCGGGTTCTCTTCATTCAGCAGGTTACCCATTCATCGTATTCTGCGTACCCGCGCTGTTGTCCCTTCCGTGCTGATAGGGCCAGCGGCGGCGCGATGGTCTGCCAGTGGTACAGGTGATTTTCGCCGGCATATTATGCCGGGTCCATCTGGCTTTGCATCTGCGCCACCGTCAGGCCGCACGATGCCAGCCAGCGGCGGCTTCCTCACTCACCCGGTCAGCCAGGATTTCACTTTCCAGCCAGGTCGAGCATCTGCACCAGCACCGGCGAACGCCACACTACCACCGTCTTCGCCACCGGACTGCTGGAGATTATCCGCCAGGCTGCGGCGCTGCGTTTTCTCGCCAGCTCACCGGTGGCAGTTTCAATGATGAGTGGCGTATGACTCCCAGCTGATAAATCGTCTGGATGCGGGTTCTGTCGTTCTGTATCGTGGTCAGGCGGTCGCCGTCCAGCCGTACCAGATCCCTTGCGGTTCCGTGACAGCGACATCCAGCCCGTCGTCCCGTTCACGCCGCCATACCGTTTGCCACCTGCGGCCAGCAGATAAGTAAAGATAGCGACTTTTCGACCAGCGGCTCTGCATATTGTGTCGCGTGGTGCACCAGCCGGTGCTGATGTCGGCAATGGTACCGGTGATTTGCGCTCATCATCCCGTGCGGATAACCCTTCGGGATGAGGTCGGTTTTCTCTGTCAGCCTGCCGTGACGGTCATACCGGTAAAGATGAATGCGCGTCACGGGCGATACGGTTATCCGGCCACATGCTGAGGCGCTAATCCAGGTGCAGCTCCGGGTCAGACGAGCGGTTACCTGCCGGGTCTGTGGTATACGGGATGCGGATATCCAGATTCGCTGCAGTGTAAGTGAACGCCGGTCAGCCTGCCGGTGGTGCTGTGGCGCTGTAACTCCGGGTCTGGCGGGCTGCTGATGCGGATGAGTTCGCCGTTGTCGTTCAGGTGTAATCGCGGCCAGACCTTAGGCTGTTCGGTGCTGAAACATAACTGCCAGCAGAGTATAAGCGGTGGTGAGTTCATAACGGCGAAGCTGCGCAGCGTTTCCCGGTGCAGGCGGTCGCCGGGTATGCTCACCAGCGGTATCTTTCAGTTTCATGCCTGACAACCAGCCGCTGCCGTAGGTCAGCCATTCCACGGCGGGCAGGCTGTCCGGTATACTGTAGTTCATAGCCAGTCCCTGTGCGTTGTACATGTCTGGTCTCATGCTGCCCGGCAGTTCATTCGTCTGCGGATGATACCGTCAGGTGTTCACTGGCAGGCGGCCTTTACTGTCACATAACCATGGTGCACCGTCGCGGTGCCTTCGCTGATATGGCTGATGTCTGTCAGCCAGCCGCGTTCGTCATACTGCCACCGCTCTGCCGGTTTCGCCATTCACGATTGCGGTGCGTGAGGCGAGGTCTGCTTCGATCATAGTGCCAGTGGGTATTAGCCCTCATCCTCGCTGCGGATAAGTTTGCCGGTCAGGTCGTAGGTGATAACGCTGTGTGCGTAGATCAAAAGCCGGTTTCCTGTATCAGCCGGTCCGGTACATCATGTCAACGGAAGGTGGTGTGGCTGCCGTTTTCACTGGTCAGGCCAGTGGCCCGTCCGGCAGCATCGTATTCCATACTGCGCGTCCAGACCGCCCTGCGTGGTACAGATGGCTTTCCCCGCATCGTACTGTGTCCGTTTCTGCTGCCGTCCGGGAGGCAATGACGGTGGTCAGGTCACCGGCGGCGTTGTATTCATACCGCGTTTCATGGCCCTGCGTGTCTTTCACGGCAATTAACTGTCACGGCTGTCGTATGCGCGGTACTGACTCGGCCCTTCCTCAGGGGTACCGCCGTCACCTGACCAATGGTCATGGTCATGGCAGGTTACATAACCGGAACAGTCAGTGAAGCTCGGCAACTGACCGTAACGGCTCCGTCATGGTTTTCCGGCTGCCGGTGGCATCTTCCGTTGCGCAGGGTAAGTCACTGTGTGGATTATCATAACGGTAGCGGGGTGATATCGCCATTGGGGGCAGTTTCCTGAATCAGACGGCCCATTCATCACATTCGGCGTATTTCCAGCCCGTCAGGCCGGTGGCTGACGTTAACTGGCTGTGGTGGTTATAGTAAAACGCCGTGCCCTGCTACCATCGGCGTGGTGATGCGCGTGATGAGGCCCGTCACCACATCCGGACTGTATTCTGTTGTCCTGCCTGCGGCATCCGTCTGTGCCCTGAGCCTGCCCACCGCGTCAAACTGACTCGCGTGACGCTGCCGTCCGTGTTCATTTTTCACCACCCGCTTCAATGCCTTCACCCTGCGCGTGCAGGACTTCACGGCGGTTCAGGCTGTCGGTGATGGTGATGCGGTCCTTCTCATACTGATACGTGTAACTTAAGCCTGCCGGGTTTGGCTGTTCTGTCACCCGCCCGTCGCTGTCGTAACGGTAACAGATTTCCGGTCGGCCCGTGTGACGGTGCGCCACCATCAGCCCCGGTATTTATCATCGTAAGTAAAGCTGCGCACCGCAGCTATTATTGCGGTCATACACCGCCGCCAGTTCGCCGCGGGGTCCAGCCATAGCGCACCAGCGGCGCGGCAGGTAAATTCTCCGGGTATTCGGGTCGTGCGTCAGCCACACGGCGAACAGACGGATGCCGTTGTCAGCCATATTCGGTGTAACCGGCGAATTATCAGGGAAAAAGCAGACGGTTCCGTCCGCCGGAAATAACCTGCTGCCGGGCTTCTTCATTACGCTTCGCCTGCGTGGTCAGTACCAGCCGGAAGTGACGCCCGGCACCATCCGTCACGCCGGTGATTTCGCCGCTGAATTCACCAGCGGCTTCGCGGTGGAACGTCTGTGTGCGCCCGAAGCGGTCACCAACCCGGTCAATTACCCGGTACGGCGGCAGCGGCGCAGGCAGCACCTCATCGCCCGGCACCCGCTCACACCAGCCGAGCAGCCACCGGCCCCTGCGGACTGTTTGTCGCCAGATAACGATGCGGACTTAAGCGGAGTTCTTCCGGCAGCGCCTGCCAGAGTGCGGCCAATGGTGACCTTCATCCGGTTTCATACGCCGCCGCGCCAGCCAGTGACTCGCTGCGGCAACAGCCGTCCTCACCGGGAAACAGGTGCTCAAAATACAGGCTTCTGCCGCCGTTATCACTGAGTATCGGTGTGTTATCGCGCAACTGTAAGCGGATATCCGCAGGCATTTCCAACCGGGGCCGGGCTCCCCACCGGCGCGGAGCGTTTTGTCCGGTAACTGCTGTAGGTGCGGGAAGAATGAACAGCAGCGGGCCGGGCAGAGACGATCAGGATTTCACCGGGAAAAGGACCTTTGCGCCGAGCAGCGGATTGGCCGGATGGCCGGACATCACCCGCCGGGGCACCGAACAGGCCACGCCGGTGGGGAGGCACCGATGCGTACCCCGGCTGAACCCTGGACAATGCTACCGCCATGCCGTCATGTCGCCCTGACGCGCCCGCCGGTTTTCGCTCATCTGCTCATCCTTGTTTTATCGGGTTATTTGTCTGCTGACCCAAGGCGAAACCCTGAATTTATAAGAAAGCCAGAAATTAGAGATATCTGTCAGATAAGAACAATTAGGAAAATATTTATATATATTTCATGAATATATGTTTCGATTGGTATAACGATGTCTAAATATTCCTCCTGAACATCTTCACGGTAAAAACCATAGCGTTTCCGCTGGCGGTTTTCTAATATTCAAAACTCAGCAATCAATAAAAATCACCAGTTGCCTTTTCGGCCTGATCCATCCACCGGTTTATCGCTGGTTTTTCGACCAGACGCGATGCAGGTAGCTGTAAAAGCAGGCGCGGTCTTTCCAGAAAAGCATGAAGACAGCCAGAACGCCCGCTGCAACCGCATGGTAAAGCGTAAAGATAAACCATGCAGGATATTCTCTGTAGGAGTTCGCACTTTTTCTCCCCCTTTTTGTATCTACCCGGTGAATGGCACCGGAAAAATGGAATTGTTTATCTGATGAAAATAGTACCGCCTTTTATGAATTTTACTGCTCATCCGACCCACTTATTTTTGTATTGATGGTTTATTTACATTCATCCATGTAATTAAGTTACACAAAAGTTAAATTAATACTACATTAATAGTTAAATCATGGCTAGGTTAAACGCAAGCAGACGCAATATCAGCACCAACAGAAAAGCAATACGTAACTGG
+>38f657d9-0701-44bb-8c13-d9446f8fe441
+TCTCGGTGGCTGCTTCGTTTCAGTTACGTATTGCTACTTGCCCTGTCGCTCTCTATCTTCGGCGTCTGCTTGGTCATTTAACCTCACTTTCTCTTCGTCAGGATGCCCCCGCCAGGCGCGCGCATTTTGCTCATCAACGCGATCAGCAGTACGGCGCAGTGCCAGTTCGCGCAGGGCGATCAGATTACCTTTGCGGAAAAAATGTTCAATGGCGCTCGCCGGCAATATAGACTTTGCCTTCTTTCAGCCGCTGGCGCAGATCGTCCGAGGGCAGTCCATAACACCACGTCGTCGGCGGCATCGAAAAAGGATCGGGCACGGTTTCCCGTACCTGAATTCCATTGACGCCCGCTGATACATCATTCAGACTCCAGATGCTGAGCGATTGACGGTAGTGAAAACATCAATGCAACTTCCAGCAGTTCTTCGATATCCTGCCAGCGTTTGGATGGCTGGGAACCTGGCACATTACAATGCCAGTTCGTCATTAAGATCAGCGCCGGGCGGCGAGCGAGGGCGGCATCGAGATCAAACTCGCTGATATACCGCCCACGGTACGCCTAATTTTAACGGCAGAACAGCCAGCCCTTCAGCATGGCGACGGTATCTTTTCGCCGTGGGTTTCTACCACGCCAACCCACAATATCCAGCCGCCGCCCGCAGTCGCTGGGCTTCTGCCAACATCGCCCAGGTCTTCCCGGCCTGCACAGGCTGAAAAACTTTCAAAGCTTCCCCGATGCGGCGCGGCAGTTTGTTCCAGCAGACGATCGGGGTCCGGGACGTAGGGTTCGTTATTCATCAAAGTTTATCCAGCGCCAGATTGAGTTCAACAATGTTGGCAATGACTGTACGATATATTTCGCAAGCGGTTGTTGGCTGTATTTTGCGATCAGTTGCGTAGGCTGTTCCAACGCTGAATTACGCACTTTCGCCACGCGTGGATTTGCTGAGGCCGCCGCTTGCGAGGTAGTATTATTAACCAGCCGCTTGCCGATGCCGTGCCAGATTCAGCGGAACGCTCGCGCTGGCATCCGGGTTCAGCGGCCCGTAATGCAACGCGTGCGGCTATTAGTTTATCAGCTCAGGGTTGCCGACCGCCAGATTGCTCCCGCCAGAAGCCACCAATGGATTATAGGGCATTTCTCACCGTTGCCGACGGGCGACCATGAAAATAGCGTTGCCGGTAGATTGCCCGGTAATGCTGGAACGCGCACCGGCGTATCACCTTCTGAATCAACGAACCATTGGCCTGCCAGAGGAAACCACCATTGCCCCAGTACGGTGAATTCAGCGGCGGGTAAACGCCGCCAGTAATCAATAACAGAAAGATAAATGTTTGATAATGCCGGACTCAAATCCTCATGGTAAACCTCCACACCAGACCGCAAACGGTCAGCGGTAAATCAATGGCTTTGATACCGATAAACTGGCACCAGCAGCCCACAGACCGTAAATCCATAAGTTACGGCGCAACATAGCCAGAAGCGGTAAAGCGGTTTATAACTCCGCCTTTTAACGCCAGAGTCAAAGACGATAATCAAGGCGTTTGAAAATCACCACACTGAGGATTGCGGAGTCGGGCAGATGCAGGCACATAGTGTTCAGCGCATTTAACTGCGGATACGTTGCCGCGAATGCCGCCGGAATAATATGGCGAAATGTTCACTTCACATCGTTAACAATGCTGAAGGTGGTCAGCGAGCCACAGGTCATCAACATCTGTTTGCCAATGTACCCTCGATCAACTTGGTCAGGGTTAAGTCGAGATCGACCATATTGCCGCCTCTTTCACCGCCTGGGGTGCCGGAGTTCATCATACTGCGACATCTGCCTGCGCCAGCGCCAAGACATCGTTGGTGCCGTCGCCGGTCATCGCTACCAAACGACCTTCCGCCTGATACTGACAGGATCAATGCCAACGGCCTCCGGTGTCCTTCGGCGAGAAAATCATCGGAAAGACACCCGCTTCCGCAGCAATCGCGGCAGCAGTCAGACGGTTATCGCCGGTAATCATCACCGTTTTAATGCCCATTTTGCGCAACTGGGCGAAACGCTCTTCAATACCGCCTTTGACAAATATCATTTCAGCGCAATGCGCCCAGCACGAGGAACCTTCCACCACCACCAGCGGCGTAAAACTCCTGACGCTTTAGCCTGATCGACTTTTTGATCAACATCGGTGCGAGTGACCACCGTTAGCCTCAGCATGGCGACAGATGGCATCCGACTAGAACCTTTACGAATCATGCGGTTGTCGATGTTGATCCATCATCCGGCTTTGCGCAGTAAACGGTACAAAGGTGGCATGGAGCGATTTCACGCTCCGCGCTCGCGCAGGTTTAAAACGCTGGCGGGGATCCGCAATACTGCGCCTTCCGGCGTTTAAACAATAGCGAAGCCAGTTGTGCGGCGTCAATAGCATTTTTCATCACGCCCTGCGCAGATAAACTCCGACGCTGACGGTTACCGGTGTGATGGTGCCGGTTTTATCCAGTAGCAGAACGTCAGCACGTCACCTGCCGCTTCAACTGCGTCCGCTGGTGCGAAATCACATTCAGCACCTAGCATCCGGCTCATCCGGCGACGCCGATCGCTGACTTTCAGGCCGCCAATAGTGGTTGGGATCAGACCAGACCAGCAGCGCCACCAGTACCGTTACGCTGACTGCATTACCGCCCCACGCGGGAAAAACGGCCTGGCAGTAGCGGTTGCCAGTAAAAGACGATAGTCAGGGCAATCAACAAGAATGGTCAGGGAACCGTTTCGTTCCGGCGTTTTGCGTCGCTGTACGCCTTCCACCATCGCGATCATCCGATCCAGAAATGTCTCGCCGGGTTAACGCTGCACTCAATCACCAGCCAGTCAGAAAGAATACGCGTGCCGCCGGTGACGGAAGCAAAATCGCCGCCGGATTCACGGATCGCCGGTACCGATTCCCCGGTGATGGCGCTTTCATCGACGATACACCCAGCTAATAACTTCACCATCGCGGGGATAATATCGCCAGCTTCTACCAGTACGATATCGCCTTTACGAAGTTGGTCGGCGGAACTTTGTCCGCCGCAGCGCCATATTCGGCTCCACGCAGCTTGCGGGCAAAGGCAGTTTTCACCCTTTCAGACTGTTGGCCCCTGCGCTTTACTGCACGGCCTTCTGCAGCCTCGGCGAAATTAGCTGGCGAACGAGTACGGTGATCCACAGCCAACCTTTAATGTACGCGCTAAACAGCATTGCCGGGCATCCTTACCGCTGCCATCGCGATGCTAATACAGAATTCAGTCCAACAGACTGCCGATCAGACGATAAACATCACCCGGATTGCGCCATTGCGCCTGCGGAACGTTAAATTTTTTCACCGCTTCTTTCAGCGCCTATTGAACGACAAATGTTTGGTTCGAATAGCGCCAGTTGTTTACGACTCTTCAGTGCTCACTCCAATATCATCAGGAGATAGGTATTCCGCCACCGGACCAAGCCAGGGCAGGGATATTAAAGGTCGATGCGCCAACCAGCAACTGGTGCCGATTAACAGGCCAACAAACAGCAGGCCGTGCATTCTGGCTTGGCGTGCCGGAGCTGGCGTGGCTCTTTTACTCACCTTGAACCGTAGTACCCATCTGGGATAATCACCCAAACGACCGACAAACATGCAGAACGCCAGTAAACAGTTCCAGAACGGAGTTGGCGCTTAATCCGGCAAAGGCGCTGCCGTTGTTGTTAGCGGCGAGGATGACGGCGTAACACTTCGCTAAAACCATGAACGGGTTGAACGCCGGCGCTACATCCAGCGTCGAAGTCATCATCGCCAACGCCGCGCCCATCAGCACCAGCGTCGGGGTAGCAGATTGCCAGTGCAGTCAGTTTCATCTCTGCGTACGTCGTTTTTTTGCAGATATTTCGGTGTACGACCAATCAATCAGCCGGCAATAAACGCCAGCAGGACAAACAGCATCATGCCGTAAAGACCAGAACCGACACCGCTGAACACCACTTCACCAATTTGCATCAGCCATCAACCATGCCAGGCGGTAAACAGATCATGCATCGCAATCTGCCGCGCCCACGGGAAGCCGCCCGTCGTCACGACATAAACTGGGCTACTGACCAGCACGCCAGTATCTTTACGCCTTCCATATTGGTCGCTGCTGTCCGCCCGGAGTGCCAGCAGATGAGGATTACCCTGAACTTCTGCCCACATCTTACGCCTACGCGAGATGACAAAAATCTGGCATCGCCCACAGCAACATGCGCCTGACGATCGCCCATCCACTTCACCAAAGGCAAAGCACAGCGCCGTTGGGATCCGAAGATCGCCAGCATCTGCACGAGACAGTCCAGAGTACGGTTGGGTTTTTCAAACGGATGCGACGAGTTGGCATTAAAGAAGCCACCGCCGTTTAATTACCGAGCATCTTGATCGCTTCCTGGCTACAGGCCCCATGGAGCAACAGCTGTTGCAGCTCCTTCAACGAGTATTCACAGCCTGATAAGGCAGAAAGTTTCAGCACCTTGTTGAATAAAAACAGTGCAATCAACAACGCCACAGGGATAGCACCCATAACGTGATGCATGCCGAATCGGCCCAGGCATTCCCGAGCGTGCTTTCATGCTCTGGCAGATAAACTTGCACGGATGAGGGGCAAAATCACCCGCAATCCGCTGGCGGCAGAAGAAGTTTTGCACCGTTATTACGCCATCTGGCTGAAATAGCTCAACGTGGTTTCACCGCTATAAGATTGCTGGATTGTTGTGGTGACAAAGCTGACGGCGGTATTCAGCGCCAGATCCGGCAGCCCTGGCAACTGCTGTGGATTAAGCGGCAGATGGTGCTGACCGAGCAACACAAAAACAGCACCGCCAGCCCAGCATGTTCAGGCCGAGAATGGCACAGATATTGCTTCAGTTCATCTCACGGTCAGAGACGCCAAGTGCGCGAAAAAGTACGCGCTCAACGCCGTTGTACCGAAGAGATATCATTAATCAGCCGCCAGCCCGCTGCCTAAAGGACGCGCCAGCACCATTAACACCGAGTAAAACGTGGCGATCAGTAAGAACCCTTGCGCAGCCATCAGAACGCCTCCGCATTGATCAGGGCATAAACCAGATGGCAGTAATAAAAACACCAGCAATACGCCGGTTATCACGCCTACACTCACAGTGCACCTCCAGTGGCTAAAGTGATACCGGAAGGGGTAGAATTCTGGCTGGGTTACCATAAAAATCTGCGGGCGGGGTGTAAAAATATAAAATGTGAAAGCCATGGTTAACTAATGTTTAGTGAATTGCTTTTGTAACTTAATTACAGGATGAATGTAAATAAACCATCAATAAGCAAAATAAGTGGTCGGATGGGTAATTAAAATTACACAAAAGGCATTTATTTTCATCAGATAAACCAAATTCATTTTTCAGTGCCATTCATGGTAGATACAAAGGGAGAAAATTATGGAACTCCTGCAGAATATCTGCATGGCTTATCTTTTTACGCCGTACTTATGCGGTTCGCGGCGGGCGTTCTGTGGCGCTGCCTTTCATGCTTTTCTGGAAAGGCCGCGCCCGCTTTACAGCTACCTGCATCGCGTCTGGTCGAAAACCAGCGATAAACCGGTGTGGATGGATCAGGCCGAAAAGGCAACTGGTGATTTTATTGATTGCTGGAGTTTGAATACATTGAAAACCGCCAGCGGAAACTGGCGGTTTTTATCAGGAAGATGTTCAGAGGAATATTTGAACTATCGTTATACCAATCCGAAACATATATTCATGAAATATATATAAATATTTTCCTAATTATTATCGACAGATATCTCACTTAAAACAAAGCCCCATAAATCTGTAGGGTTTCGCCTGGCATCAGCAGATAAATAACCCGATAAAACAAGGATGAGCAGATGGGCGGAAAACCGGCGGCGCGTCGGGGCGACATGACGCGGTATGGCTGACCAGCATTAATCCAGGGTTCAGCCGGGGTACGCATCAGTGCCCCCACCGGCGTGGCCTGTTCGGTGTGCCCGGCGGGGCGGCGCGATGGCCATCGGTCAATCCGCTGCTCAGTGCAAGATCCTTCCAGTGAAACCGACATCGCCCTGCCCGGCCCGCTGCCGTTCATTTCTCTCCCGCACCTACAGCAGTTACCGGACAAAAACGCCGCGCCGGTGAGGGAGCCTCGGCCCCGGCTGGAAAATGCCTGCGGATATCCGCTTACAGCTGCGCGATAACACACTGTTCTCAATGATAGCAGCGGCAAGCCTGTATTTTGAGCACCTGTTTCCCGGTAAGGGACAATGATTACAGCCACGGCGAGTCACTGTGGCTGGTGCGCGGCAACGTGGCAGGAAACTGGATGAAAGGTCACCGGCTGGCGCACTCTGTAGCGCTGCCGGAAAACTCCCGCTTAAGTCCGCATCGTTATCTGGCGGCAAACGGTCCGCCAGGGCCAATGGTAGCTGCTCGGCTGGTGTGAGCGGGTGGAAGCGGATGAGGGTGCTGCCTGCGCCGCTGCCGCCGTACCGGGTACTGACCGGGCTGGTGGGGACCGCTTCGGGCGCACACAGACGTTCCACGAAGCCGCCGGTGAATTCAGCGGCGAAATCACTAACGTGACGGATGGTGCCGGGCGTCACTTCCGGCTGGTACTGACCACGCAGGCGCAGCGGGCGAAGAAGCCCGGCAGCAGGCCATTTCCGGCAGGACAGAACCGTCCCGCTTTCTGATACCTGCCGGGTTACACCGAATATGGCCGGGACAACGGCATCCGTCTGTCTGCCGTGTGGCTGACGCACGACCGGAATACCGGAGGAATTTACACCTGCCACGCCGCTGGTGCACTATGGCTGGACGCCCGCGGCGAACTGGCGGCGGTGTATGACGCAACCAAAATACAGGTGCGAAGCTTTACTTACGATGATAAATACCGGAAGGGCCGGATGGTGGCGCACCGTCACACGGGCCGACCGGAAATCTGTTACCGTTACGACAGCGACGGGCGGGTGACAGAACAGCTAAACCGGCAGGCTTAAGTTACACGTATCAGTATGAGAAGGACCGCATCACCATCACCGACAGCCTGAACCGCCGTGAAGCCCTGCACACGCAAATTGAAGGCGGGCTGAAGCTGAGTGGTGAAAAAGAGAACTACGCGGACGGCAGCGTCACGCCAGAGTCAGTTTGACGCGGTGGAGCAGGCTCAGAACTGAACGGATGCCGCAGGCAGGACAACGAATACAGTCCGGATGTGGTGACGGGCCTCATCACGCGCATCACCACATGGATGGCGGGGCATCGGCGTTTACTATAACCACCACAGCCGGTTAACGTCAGCCACCGGGCCTGACGGGCTGGAAATACTCCAGGAATATAGTGATACGATTGCGTCTGATTCGAAACCGCCCCTGACAGCGATATCACCCGCTACCGTTATGATAATCCACACGGTGGCTTACCCTGCGCAACGGAAGATGCCACCGGCGGCGGAGAAAACCATGACGATGGAGCCGTTACGGTCAGTTGCTGGGCTTCACTGACTGTTCCGGTATGTAACCCGCTATGACCATGACCGTTTTGAGTCGGGTGACGGCGGTCACCGCGAGGAAAGGGCTGAGTCAGTACCGCGCATACATTGGCCGTGGACGGATAGTGCCGTGAAAAGCACGCCAGAGACCGTAAAGAACGCGGTATGAATACAACGCCGCCGGTGACCTGACCACCGTCATTGCCCCGGACGGCAGCAGAAACGGGACACAGTACGATGCGTGGGGAGAAAACCATCATACCACGCAGGGCGGTCTGACGCGCAGTATATGGAATACGATGCGCCGGACGGGTCATCCGCCTGACCAGTGAAAACGGCAGCCACACCACCTTCCGTTACGATGTACTCGACCGGCTGACCACAGGAAACCGGCTTTGACGGCCGCACACCGCGTTATCACCACGACCTGACCGACAAACTTATCGCAACCCGAGGGATGAGGGCAGTCACCCACTAACATATGACCAAACAGACCGCCTCGCACCGCACCGTGAATGGCGAAACCACGCAGAGCAGTGGCGATGCGCAACCGAACGCGGCTGGCTGACAGACATCAGCCATATCGGCGAAGGGCACCGGGTGACGGTGCACTATGGAATTATGACAGTAAAGGCCGCCTCGCCAGTGAGCACCTGACGATTGCATCATCCGCAGACGAATGAACTGCTCTGGCGGCATGAGACCAGACATGCGTACAACGCACAGGGACTGGCGAACCGCTGTATGCCGGACAGCCTGCCCGCCGTGGGATGAATGGCTGACCTACGGCAGCGGCTGGCTGTCGGCATGAGCTCGGCGACTTACACCGCTGGTGGAGTACACCCGCGACCGCCTGCACCAGGGAAACGCTGCGCAGCTTTCGGCCGTTATGGACGCTCACCACCGCTTATACCCCCTGCGGAGCAGTTACAGAGCCAGCACCTGAACAGCCTGCTGTCTGACCGCGGAACCACACCTGGAACGACAACGGCGAACTCATCCGCATCAGCAGCCCGCGCGCCAGACGGAGTTACGGCTACAGCACCACCGGCAGGCTGACCGGCGTTCACCACCGCAGCGAATCTGGATATCCGCATCCCGTATACCACAAAGGTTAAACGCAGCAGACGCCGAAGATGGGGAGCGACAGGCAAGAGTAGCAATACGTGAAAAAGA
+>ff281c20-4a4b-4775-9b8a-552530cf0b30
+TTGTTGTACTTCGTTTCAGTTACGTATTGCTACTTGCCTGTCGCTCTATCTTCAGCGTCTGCTTGGGTGTTTAACCTACCAGCCACAGTGACTCGCTGCGGCTGTAACCGTCCTCACCGGGAAACAGGTGCTCAAAATACAGGCTTCTGCCGCCGTTATCACTGAGTATCGGCAGTGTTATCGCGCAGCTGGCGGATATCCGCAGGCATTTTCAATAGAGCCGAGGCTCCCCACCGGCGCGGAGCGTTTTTGTCAGCTCGCTGCTGTAGGTGCGGGAGAGAATGAACGGCAGCGGGCCGGGCAGAACGTCATCGGTTTTCACCGGGGAGGACAGCTTTGCACCGAGCAGCGGATTGACCGGATGGCCGGACGTCACCCCGCCGGGGCACGGTGGAAGGCCACGCCGGTGGGGCACCGATGCATTACCCCGGCTGAACCCTGGACAATGCTACCGCCATACTGCGTCATGTCGCCCTGACGCGCCGCCGGTTTTCCGCTCATCTGCTCATCGCTTGTTTTATCGGGTTATTTGTCTGCTGACAGGCGAAACCTACAGATTTATAAGAAAGCCTTAAGTGAGATATCTGTCAAGATAAGAACAATTAGAAAATACTTATATATATTTCCTTGAAGGAATATATGTTTCGATTGGTATAACGATGTCTAAATATTCCTCGAACATCTTCCTGTTAAAACGCCCAGCGTTTCCGCTGGCGGTTTTCAATATTCAAAACTCAGCAATCAATAAAAATCACCAGTTGCCTTTTCGGCCTGATCATCCACACCGGTTTATCGCTGGTTTTCGACCAGACGCGATGCAGGTAGCTGTAAAAGCGGGCGCGGTCTTTCCAGAAAAGCATGAAAGGCAGCGCCAGAACATCCACTGCAACCGCATAAATACGGCGTAAAGATAAGCCATGCAGGATATTCTCTGTAGAGTTCGCACTTTTCTCCCCTTTTGTATCTACCCGGTGAATGGCGCGGAAAAATGGAATTTGTTTATCTGATGAAAATAGTACCGCCTTTGTGTGAATTTTTACTACTCATCGACCACTTATTTTTGCTTATTGATGGTTTATTTACATTCATCCTGTAATTAAGTTACACAAAAGTTAAATTAATACTAAACGTGGTTAAATCATGGCTTTTGCCATTTTTATACTTTTACACCCCGCCCGCAGATTACGCGAAATCTTTGCGTAGATTCTACCGGTATCGCGCAGGCCACTGGAGTTGCACTGTAGTGCAGGCGTGATAACCGGCGGCCATTGCTGGTGTTTTATTACTGGGTTATCTGGTTTTATGCCCTGATCAATGCGGGCGTTCTGATGGCTGCGCAAGGGTTCTTACTGATCGCCACGTTTTTACTGGTGTTAATGGTACTGGCGCGTCCGCTTTAGGCAGCAGGCTGGCGCGGCTGATTAATGACATTCCTCTTCCCGGTACAACGGGCGTTGAGCGCGTACTTTTTCGCGCACTTGGCGTCTCTGACCGTGAGATGAACTGGAAGCAATATCTTTGTGCCATTCTCGGCCTGAACATGCTGGGGCTGGCGGTGCTGTTTTTATGTTGCTCGGTCAGCACTATCTGCCGCTTAATCCCACAGCAGTTGCCAGGGCACGATAAATCCGGATCTGGCGCTGAATACCGCCGTAAGCTTGTCACCAATACCAATAGCAATCTTATAGCGGTGAAACCACGTTGAACTATTTCAGCCAGATGGCGGGCAACGGTGCAACTTTCTTTCCTACCATAGCGGATTGCGGTGATTTTGCCCATCGTGCGTTTACCCGCCAGGTATGGTACGCTCGGGAATGCCTGAGTCGATCTGCTCGCATCACGTTATGGAGTGCTAGTCCTGTGGCGTTATTGATTGCACTGTTTTTATTCAACAAGGTGCGCTGCAAAACTTTCTGCCTTATCGGGCTGTGAATACCGTTGAAGGAGCGCAGCAGCTGTGCCATAGATTTCTTCTCAGGAAGCGATCAAGATGCTCGGTACTTAACGGCGGTGGCCTCTTTAATGGGTTAAACGCGAAGCGAACGCCGCAATATCAGCACC
+>912e1555-f5ff-4eee-8431-e133aad618c5
+TTGTTATGCTTCGTTCAGTTACGTATTGCTCTTGCCTGTCGCTCTATCTTCCGGCGTCTGCCCGGGTGTTTTAACCTCGGATGCCGTTGTCCCGGCACCATATTCGGTGTAACCCGGCAGGGTATCAGGAAAAAGCAGTTTCCGTCCCGCCGGAAATGGCCTGCTGCCGGAGCTTCTTCTGCCCGCGCTGCGCCTGCGTGGTCAGTACCAGCCGGAAGTGACGCCCAGCACCATCCGTCACGCCGGTGATTTCGCCGCTGAATTCACCGGCGGCTTCGCGGTGGAACGTCTGTATTGCGCCCAGAAGCGGTCCACCAGCCAGTCAGTACCCGGTACGGCGGCAGCGGCACAGAGCAGCACCTCATCCGCTTCCGGCACCCGCTCACACACCAGCCGAGCAGCCACCACGGCCTACCCGGACTGTTTGTCGCCAGATAACGATGCGGACTTAAGCGGAGTTCTTCCGGCAGCGCCTGCCAGAGTGCGGCCAGCCGGTGACCTTCTTCCAGTTTCGCCACGCGGCCGCTATCTGCCAGCCACGAGCTCGCTGCGGCTGTAACCGTCCTCACCGGGGAAACAGGTGCTCAAAATACAGGCTTCTGCCGCCGTTATCGCACTGAGTATCAGTGTGTTATCGCGCAGCTGTAAGCGGATATCCGCAGGCATTTTCCAGCCGAGGCCGAGGCTCCCCACCGGCGCGGGCGTTTCCCGTCCGGTAACTGCTGTAGGTGCAGAATGAACGGCAGCGGGCCGGGCAGGGGCGATGTCAGTTTCACCGGGAAGGACCTTTGCGCAGGCAGCCTGGTTGACCAGGGTGGCCGGACGTCACCCCGCCGGGAGCACCGAACAGCAGGCCACGCCGGTGGGGCACCGATGCTGCGTACCCGGCTGAACCCTGGACAATGCCGCCATGCTGCGTCATGTCGCCCTGACGCGCCGCCGGTTTCCGCTCATCTGCTCATCCTTGTTTTATCGGGTTGTTGTCTGCTGGCAGGCGAAACCCTACCAGGTTATGAAAGCCTTAAGAAGTGAGATATCTGTCAGATAAAATTGAATTGGAAAATGTTGCTCATATATTTCCTTGAATATATGTTTCGATTGGTATAACGATGTCTAAATGTTCACCACAGACATCTTCCTGATACAAAAAAACCTGCCAGCGTTTCCGCTGGCCAGTTTCAATAATATTCAAACTCGGCAATCAATAAAAAAATCACCAGTTGCCTTTTCGGCTGATCCATCCACACCGGTTTATCGCTGGTTTTCGACCAGACGCGCGATGCAGGTAGCTGTAAAAGCGGGCGGTCTTTCCAGAAAACGCCGAAAGGCAGCACATAGAGACGCCCGCTGCAGCCGCATAATTGCAGCGTAAAAGATAAGCCATGCGGGATATTCTCTGTAGAGTTCCATGCTTCTCCCCCGCCTTTGTATCTACCCGGTGAATGGCACCGGAAAATGAATTTGTTTATCTGATGAAAATAGTACCGCCTTTTGTGTAATTTTACTGCTCATCCGACCATATTTTTGCTTATTGATGGTTTATTTACATTCATCCGCGAATTGGTTACACAAAAGTTAAATTAATACTAAACATTAGTTAAATCCTTGGCTTTTTTGCCATTTTATACTTACACACCCGCCCGCAGATTTTGCGAAATCTTTGCAGCCAAATTCTACCCTTCGGTATCGCGCAGGCCGCAGATTGCACTGTAGTGCAGGCGTGATAACCGGCGTATTGCTGGTGTTTTTAGGTTAAACGCACCGGCGAACGCCGCAATATCAGCACGCA
+>d1ecaa6c-a911-4cd4-86ab-f16ed29ddfde
+TTGGTATGCTTCGTTCCGTTACGTATTGCTACTTGCCTGTCGCTCTATCTTCGGCGTCTCTGCTTGGGTGTTTAACCTGACGATAAACATCACCGGATTGCGCCATTGCGCCTGCAGGTTAATTTTTCACCGCTTCTTTCAGCGCCTGAACGACAAGTCGTTGGTTCAGATAAGCGCCAGTTGTTTACGACCTCATATTCAGTGCTCACTCAATATCATCGGAGAGATATTCCGCCACCGGATGGCGCCAGGGCGAGGATAAAAGTCAGTGCGCCAACCAGCAACGCACGGTGCCGTTAACAGGGGCAACAAACAGCGGGCCGTGCGTTGGCAGCGATGCCGAACTGGCAGCGGCTCTTTTTGCTCACCAGCGAACCGGCAATTGCCATCACCGGGATAATCACCCGAAGCGACCGACAAACATGCAGAACGCCAGTAAACAGTTCCAGAACGGAGAGTTGGCGCTAATCCGGCAAAGGCGCTGCCGTTATTTGTTAGCGGCAGATGGCGGCGTACAGCACTTCGCTTCGCCATGCGGGCCAGGGTTGAGCATATGTACTACGTCTGGCGTCGGTCATCATCGCCAACGCCGCGCCCATCAACACGTCAGGTATAACCAGAATTGCCAGTGCAGTCAGTTTCATCTCCGCGTACGTCGATTTTTGCAAGATATTCCGGTGTACGACCAATCATCAGCCGTAATAAACACCGCCAGCAGGACAAACGGCATCATGCCGTAAAGACCAGAACCGACACCGCCGAACACCGCTTCGCAATTTGCATCAGCCCATCGGCACCACATGCCACCGAGGCGGTAAACGAATCATGCATCGCAATCACCGCGCCACAGGAAGCCGCCGTCGTCACGACCGCAAACGAATACTGACCAGCACGCCGAGCAATACTCTTTACCTTCCATATTGATGCTGCTGGTCGTGCCCAGTGCCAGCAGATGAGTTATGAACTGCCCACATCACCACGCGCCTGCGCAGATGACAAAATCGCTGACATCGCCCACAGCAACGCGCCCCTGGCGGCGATCGCTATCACTTCACCAAAGGCAAAGCACAGCGCCGTGGGATCAAGAAGATCGCCAGCATCATGCACGAAGTTGGTCGTGCGGTTGGGTTTTCAAACGGATGCGACGAGAGTTGGCATTAAAGAAGCCACCGCCGTTAGTACCGAGCATCTTGATCGCTTCTGAGAAGCTACAATTTATAAGGTAACAGCTGTTGCGCTCCTTCAGCGAGTATTCACAGCCTGATAAGGCAGAAGTTTTACAGCAGCGCACCTTGTTGAATAAAACAGTGCAATCAACAACGCCACGGGGACTACTTACCCATAACGTGATGCGTAGCAGATCGACCCAGGCATTCCCGAGCGTGCTCATGCTCTGGCGGGTAAACCTTTACGGATGAGGCAAAATCACCACCAATCCGCTGGCGGCAAGAGAAAGTTTTACCGTTAAACCCGCCATCTGGCTGAAATAGCTCAACGTGGTTTCACCGCTATAAGATTGCCAGTTGGTATTGGTGACAAAGCTGACGGCGGTATTTAACCAGATCCCACGACAGCCTGGCGGCTGCTGTGGATTCAGCGGCAGATGGTGCTGACCGAGCAACGCAAAAACAGCACCAACTGGCATGTTCAGGCCGAGAATGGCACAAAGATGTTACTTCCAGTTCATCACTCACGGTCAGAACCTTGAAGTGCGCGAAAAGTACGCGCTCAACGCGCCCGTTATTGCCGGGAAGAGGAATGTCATTAATCAACCGCATATTACGCTGCCTAAAGGACGCGCCAGCACCATTAACACCAGCGTAGTAAAGCCGTGGCGATCAGTAGAACCCTTGCGCAGCCATCAGAACGCCTCCCGCATTGATCAGGGCATAAACCAGATAGCCAGTAATAAAACGCCAGCAATACGCCAGTTTATCGCCTGCACTCTGGTGCGCCTCCGGTGGCCTAAAAAGTGATACCGGAAGGGTAGAATTCTGGCTGCAAAGATTTCGCAAAAATCTGCGGGCGGGGTGTAAAAGTATAAAAATGGCAAAGCCATGATTTAAACTAATGTTTAGTATTAATTTTAACTTTGTGTAACTTAAATTGCAGGATGAATGTAAAATAAACCATCAATGGCAAAAAATAAGTGGTCGGATGGGTAGTAAAATTACACAGACTGGTACTATTTTCATCAGATAAACAAATTCATTTTTTTCGGTGCCATTCTACCCGGGTGAACACAAAAGAGGGGAGAAAAGTATGGAACTCTACGAGAGATATCCTGCATGGCTTATCTTTTTACGCCGTACTTATGCGGTTGACGTTCTGGCGCTGCCCTTTCATGTACTGGAAAGACCGCGCTTTGCTTTTTACGGCTACCTGCGCGCGTCTGGTCGAAAACCGGCGATAAACCGGTGTGTGGATGGATCAGGCCGAAAGGCAACTGGTGATTTTTGATTGCTGGAGTTTTGAATACGCATTTGAAAACCGCCAGCGGAAAACGCTGGCGGTTTTAATATCAGGAAGATGTTCGGAGATATTTAGACATCGTGCCAATCCGAAACATATATTCATGAAATATATATAAACATTTTCCCTAATTGTTCTTATCTGACAGATATCTCACTTAAGGCTTTCTTATAAATCTGTGGGTTTCTACGCCTGTCAATGAACAAATAACCCGATAAAACAAGGATGAGCGGATGAGCGGAAAACCGGCGGCGCGTCGGGGCGACATATGACGCGTCATGGCGGTAACGTTAATCAGGTTCAACCGGGGTACGCATCGAAGGGTGCCCCACCGGCGTGAAAGCCTGTTCGATTGATACCCCGGCGGTGACGTCAGCCATCCGGTCAATCCACTACTCGGTACAGGTCCTTCGGTGAAACCGACATCCCGCTTCTGCCCGGCCGCTGCCGTTCATTCTCTCCCGCACCTACAGCAGTTACCGGACAAAACGCCCGCGCGCCGGTGGGGCCCTCGGCCAGCTGGAAAATGCCTGCGGATATCCGCTTACGGCTGCGCGATAACGCACTGATCTCAGTGATAAACGGCGGCAGAAGCCTGTATTTTGAGCACCTGTTTTGGTGAGGACGGTTACACAGCCGCAGCGAGTCACGCAATGGCCGTTGCGCGGCGGCATAGCGAAACTGGATGAAAGGTCAGCTGGCCCGCGCTCTGGCGGAAGCTGGAAGAACTCAGCAAGTCGCATCGTTATCTGGCGACAAACAGTCCGCAGGGCCGTGGTGGCTGCTCCGGCTGGTGTGAGCGAATTGCCGAAGCGGATGAGGTGCTGCCTGCGCTGCTGCCGTACCGAGGTACTGACCGGGCTGGTGGACCGCTTCCGGGCGCACACAGACGTTCCACCGCGAAGCCGCCGGTGAATTCAGCGGCGAAATCACCGGCGTGACGGATGGTGCCGGGCGTCACTTCGGCTGGTACTGACCACGCAGGCGGGCGGAAGCCGGCAGCAGGCCATTTCAGCGGCGGGACGGAACCGTCCGCTTTTCTGATACCCTGCCGGATTACACCGAATATGGCCGGGACAACGGCATCCGTCTGTCTGCCGTGTGGCTGACGCACGACCGGAATATGCCGGAGGAATTTACCGCGCCGCTGGTGCGCTATGGCTGGACGCCCGCGGCAGACGGCGGCGGTGTATGACCGCAGCAATACACAGGTGCGCAGCTTTACTTACGATATTGATAAATACGGGGCCGGATGGTACGGCGCACCGTCACACGGGCCGACCGGAAATCTGTTACCGTTACGACAACGACGGGCGGGTGACAGAACAACAAACCCGGCAGAAGCAAGTTACGCGTATCCAGTATGAGAAGGACCGCATCACCATCACCGACAGCCTGAACCGCCGTGAAGTCCTGCACGCAGGGTGAAGGCAATTTCAAACCGGAGTGTAGTGAAGGAACACGCCGGACGGCAGCGTCACGCAAGTCAGTTTGACGCGGTGGGCAGGCTCAGGGCACAGACAGTTCACGCCAGGTGGGACAGCAGAATACAGTCCGGATGTGGTGACTATCACGCATCACCACGCGCCGGATGGCAGGACGTCGGCGTTTTACTATAACCACCACAGCCAGTTAACGTCAGCCACCGGGCCTGACGGGCTGGAAATACGCGGGAATATGATGGAATGAAGTTGCGTCTGATTCGGAAACTGCCTGACGGCGATCACCCGCTACCGTTATGATATCCACACAGTGACTTACCTGCGCAGCGGAAGATGCCACTGCGGCGGCAGGAGAAGAAACCATGACGTGCAGGCCGTTACGGTCAGTTGCTGAGCTTCACTGACTGTTCCGGTTATGTAGCCCGCTTCATGACCGACCGTTTTGGTCAGGTGACGGCGGTGCACCGCGGAAAGGGCTGAGTCGGTACCGCGCGCTTCGACAGCAAAACGGACAGTTAATTGCCGTGAAAGACGCAGGGCCATGAAACGCGGTATGAATGCTTGCCGCCGAGCCTGACCGCCGTCATTTGCCCCGGACGGCGGCGAAACGGACACAGTATTGCCTGATGCATTAAGAAGGGAAAAGCCATCTCTGTACCCACGCAGGGCGGTCTGACGCGCAGTATGGAATACGGTGATGCTGCCGGACGGGTCATCCGCCTGACCAGTGAAAACGGCAGCCACACACCGCAGCCCGTTACGATGTACTCGACCGGCTGATACAGGAAACCGGCTTTGACGGCCGCACACAGCGTTATCACGACCTGACCGGCAAACTTGTCCGCAGCGAGGATGGGGGCTGGTCACCCACTGGCTATGACGAAGCAGACCGCCTCCACCACCGCACCGTAATGGCGAAAACCGCAAACGGTGGCAGTATGACGAACGCGGCTGGCTGACAGACATCAGCCATATCAGCGAAAGGGCACCGGGTGGCAGTGCATATGGTTATGACAGTAAGGCCGCCTCGCCAGTGAACACCTGACGGTGCATCATCCGCAGACGAATGAACTGCTCTGGCGGCATGAGACCAGACATGCGTACAACGCACGGGGACTGGCAGACCGCTGTATACCGGACAGCCTGCCCGCCGTGGAATGGCTGACCACTACGGCAGCGGCTGGCTGTCGAGCATGAAACTCGGCGACACACCGCTGGTGGAGTACACCCGCGACCGCCTGCTGCAGGAAACGCTGCGCAGCTTCGGCCGATTATGAACTCACCACTTATGCCTGCCGGGCGTTACAGAGCCAGCACCTGAACAGCCTGCTGTCTGACCACCCGATTACACCTGGAACGTGGCAGACTCATCCGCATCAGCGGCCCGCCGAACCGGAGTTACAGCTACAGCACCACCGGCGACTGACCGTTCACCACCGCAGCGAATCTGGATATCCCGCGTCGCGCATACCTGGGCCAGCGGGTAACCGCCTGCCCGACCGGGCACTGCCGGACAGCGCCCTCAGCGTAACGGCCGGATAACCGTATCGCCCGTGACACTATCTTTACCGGTATGACCGTCACGGCAGGCTGACAGAAAAACCGACCTCATCGGGAAGGGGTTATCACGCACCGGATGATGAGCGCACCCACCGAACCATTGACAGTCGGCACCGGCTGATTGCACCTGGACAATATGCAGAGCCCGCTGGTCGAAAGTCTTCTCTTTACGACCCGCTGGGCCGCAGGGTGTAAAACGGGTATGGCGGCGTGAACAGGACCTGACGGGCTGGGTAACCGCTGTCACGGAAACCGCAAGTGACCTGGTACAGCTGGGACGGCGACCGCTGATATTCACAGAACGACGGAACCCGCATCCAGACGATTTAATATTCCGAGGCTTCACGCCATCATCAGGGTTGAAACCGCCACCGGTGAGCTGGCGAAAACACAGCGCGCCACCAGCCTGGCGGATGCCCAGCTGGCGATCCGGTGGCGAAGACGGTGGCAGGTGTGGTGTTCCCGCCGGTGCTGGTGCAGATCATCGACCGGCTGGAAAGTGAAATCCTGGCTGACCGGGTGCGGTGAGAAAGCCGCCGCTGGCTGGCATCGATGCGGCTGACGGTGGCGCAGATCGCAAACCAGATGGACCAGGCGATACACGCCCGGCGCGAAAAATTCACCTGTACCACCGACCATGCGGCTGCCGCTGGCCATATCAGCACGGAAGGGACAACGGCGTGAGCGCAGAATGCGATGAATGGGTAACCTGCTGGATAGAAGAACCCGCATCTGGCTGCAGCGGCTTATCCGCCTGCCAGGGCAACCAATTATGATGAGGAGTCCGGCCTGTAATACAACCTGCCGCTATTATGACTACCGGGGTGATATATCCTCGGGGATCCGTTGGGCTGAAAGGGGATGGGAATTTTATCGGTAATCCCGGATCGATCTCAAATATAGATCCATTGGATTGAAACACTACAAAATGCATTAAGCCACTACATTCAATGGTGGAACTGGTGAAGAAGCGGTCCAGATATGTGGGGGATCGTTCCTATCATCCAATATCGCTGTGTCCCCAGATGGTAAAGGACTATACTTGTGGTGGCCAAGACCAACGGGGAGAATCAAGGGAATGGTCTATGGGGGCCAGGTAAAACAGTAATGATACAAAGAAACACTGGCCGTTGTGACCTCGTTGAAACCGATAATAGTTGTGGAACTGTTTAAAAGGGAAGTTTAAAGGTAGAGGTAGCGTTATTCTCATGCTGCCTGATATATTCCGCACCTATAAAGTTTAGGGCTATTTAAAAACTGCAAGACTGGTCTAATGATTCTTTAGAAACATGTAGATGAAGTGCTCCGGAAATAACATTGGACGTTTTATTAGATTTGTATTCACCGGAGTGATGTAATAGAATATATTATTTTTTATTCAGGAGCTATATGGCTGGCTTATCAGCTTTTTTAATACTATTCTTTCCGTGCATAGACTTTCACTGTGGAGCTCCTCGTGATGTAGGCGAGTTAATTAGTCTCATGTCTTATGAATGATGGTAATATATTTTTCCAACAGGCATAGTATTCTTTATTGCTCCTATTTATAGGGACTGTATCAGACATTATTGGCGTAAAGTTGATAGTAAGTATATTATGGCGATAATATGGCTGTTTTTCTGTCGGGGGTATATTCAATGGTTTGTATTAAGTAACATTATAAACAAATAAATTAAAGTTAATTTATGTATTATTATATGTGCCTGGGCATTGATATCCCGTATGCCTGAAACCAAACGCGGGTAACCACCTGCCCGACCGGAAACTGGACGGCACCCCTCAGCATGTGGCGGATAACCGTATCGCCCGTGACGCGCTATCTTTGCCGGTATGACCGTCGGCAGACTGGTGGAAAACCGACCTCCATCCCGGAGGGTTATCACTGGATGATGAGCGCACCACCGGCCTGCATTACGACAGTCAGCACCGGCTGGTGCACTACTTACGCGGACACAATAAAGGCCGCTGGTCGAAGCCGCTATCTTTACGACCCGCTGGAGCGCAGGGTGGCAAAACGGGTGTGGCGGCGTGAACGGGATGACGGGCTGGATGTCGCTGTCACGGAAACCGCAAGTGACTGGTACGGCTGGGACGGCGCGACCGCCTGACCGCGATACAGAACGGCAGAACCCGCATCGAACGATTTATCAGCCAGGGGAGCTTCGCCACTCATCAGGGTTGAAACCGCCACCGGTAGGCTGGCGAAAACGCAGCGCCGCAGCCTGGCGGATACCCTGGTTAAACCTTGCAAGCAGACGCCGAAGATGAGGCGGCAGGCGGGACAATGCACGCGGCA
+>4dbe677b-04b0-4738-8777-a15ee6cd652b
+TCGGTACTTCGTTCCGGTTACGTATGCCTGTCGCTCTATCTTCGGCGTCTGCTTGGGTGTTTAACCTGCCACAGCGTGGCGGTTTGCCAGTAAAGACGTCGTCCAGGGCAATCCAGCAGAATGGTCAGAACTTAATTTCGTTCGGCGTTTTGCGTCGCTGTGCGCCCACCATCGCGATCATCCGATCAGAAATGTCTCGCCGGTTAACGCTACCTCAATCACCAGCCAGTCAGAAGAATACGCGTGCCGCCGGTGACGGAGGCAAAATCGCCGCCAGTTCACGGATCACCGATTACTTGATTCCCCGGTGATGGCGCTGCATCGACCGATGCACCCCCTTCAATAACTTCACATCGCAGGGGATAATATCGCCAGCTTCTACCAGTACGATATCTGCTGCAGTTGGTCGGCAGGAACTTGTCGCCGCAGCGCCATATTTCGGCTCTTGCGGGCAAGAGAGCAGCGGTTTTTCACCTTCAGACTGGTGGCCTGCGCTGCTGCGGCACTTCTGCCAGCGCCTCCGGCGAAATTAACCCGAACAGTACGGTGATCCACAGCCAACCGCTAATGGCCGCGCTTCAAACAGCGTGCCAGGCGCATCACCGCTTGCCATCGCGATGCTAATACGGGTGGTCAACCGGACTGCCGATCCGGACGATAAACATCGCGGATTGCGCCATTGCGCCTGCGACAATTTTTCACCGCTTCTTTCAGCGCCTGAACGACAAGTGTTGGTTCGAATAGCGCCATTGTTTGACTCATATTCAGTGCTCACTCAATATCATCAGGAGAGGTATTCCGCCACCGGACCAAGCGCCGGGCAGGGATAAAGGTCAGTGCGCCAACCAACAGCACGGTGCCGATTAACAGGCCAACAAACAGCGGGCCGTGCGTTGGCAGCGATGCCGGAGCTGGCAACGGCTCTTTTTTACTCCACCAGCAGACCGGCAATTGCCATCACCGGGATAATCACCCCAGAAGCGACCGACAAACGCTGGGAGACGCCGGTAAACAGTTCCAGAACGGAGAGTTGGCGCTTAATCCGCAAAGGCGCTGCCGTTGTTGTTAGCGGCGGATGACACGGCATTACAGCACTTCGCTAAAACCATGCGGGCTGGGGTTGAGCATGGCGCTACGTCCGGCGTCAGTCATCATCGTAACGCCGCGCCCATCCAGCGCCAACGTCAGGGGGTAACCAGGATTGCCAGTGCAGTCGGGTTTCATCTCGCGCGTCGATTTTTGCCAGATATTCCGGTGTACGACCAATCCATCAGCCGGCAATAAACACCGCCAGCGGGACAAACAGCATCATGCCGTAGGAGCCAGAACCGACACCGCCGAACACCACTTCACCAATTTGCATCAGCCACATCGGCACCATGCCGCAAAGGCGGTAAACGAATCATGCATCGCAATCACCCACCGCGCCACAGGGAAGCCGCCGTCGTCACGACGCAAACAGGCTACTGACCAGCGCCGAAACGGCTCTACCTTCCATATTGTGATGCTGCTGTCCGTGCCCGAGATGCCAGCCAGATGAGTTACCCTGAACTTCTGCCCACATCACCACGCCTACGCAGATGACCAAATCGCGACATCGCCCACAGCAACATGCGCCCCTGGCGGCTTAGATCGCCCATCCACTTCACCAGAGCCAAAGCACAGCGCCGTTGGGATCAGAAGATCGCCAGCATCTGCACGAAGTTGGTCAGTGCGGTTGGGTTTTCAAACGGATGCGACGAGTTGGCATTAAAGAAGCCACCGCCGTTAGTACCGAGCATCTTGATCGCTTCCTGAAGCTACAGGCCCCATGGGTAACAGCTGTTGCTCCTTCAGCAGTATTCTGGCCTGATAAAGGCCAGAAAGTTTTACCCAGCGCACCATTGTTGAATAAAAACAGTGAAATCAACAACGCCACAGGGACTAGCACCCATAACGTGATGCGTAGCAGATCGACAGGCATTCCCGAGCGTGCTCATGCTCTGGCGGGTAAACACGCGGATGAGGGCAAAAATCACCGCAATCCCGCTGAGGTTAAACACCCAAGCGAACATGCCAATATCCCGGCACC
+>3fa4862f-bf61-4f3d-a13e-18b24be3b2a2
+TTGATATGCTTCGTTTCAGTTACGTATTGCTACTTGCCTGTCGCTCTATCTTCGGCGTCTGCTTGGGTGTTTAACCTCGTGCGTTGGCAGCATGCCGGAGCTGGCGGCTTGGCTCTTTACTCACCAGCGAACCGGCAATTGCCATCACCGGGATAATCACCCCGAAGCGACATAAACAAACATGCAGAACGCCAGTAAACAGTTCCAGAACGGAAGTTGGCGCTTAATCCGGCAAAGGCGCTGCCGTTGTTGTAAACAATATGGCAACCCGAGATGACACGGCGTACAGCACTTCGCTAAAACCATGCGGGCCAGGGTTGAGCGTAGCGCCCCGATCCGGCGTCGGTCATCATCGCCAACGCCGCGCCCATCCAGCACCAGCGTCAGGAGTAACCAGAATTGCCAGTGCAGTCAGTTTCATCTCGCGTACGTCGATTTTTTTACCCAGATGTTCCGGTGTACGACCAATCATCAGCCCGGCAATAAACACCGCCAGCAGGACAAACAGCATCATGCCGTAAAGACCAGAACCGACACCGCCGAACACCCTTCACCAATTTGCATCAGCCACATCGGCACCATGCCACCGAGAGCGATAAACAGATCATGCATCGCAATCACCGCGCCACAGGAAGCCGCCGTCAATCACGACCGCAAACAGGCTACTGACCAGCACGCGAAACGGCTCTCTTTACCTTCATATTGATGCTGCTGTCCGTGCCCAGTGCCGGCAGATGAGGATTACCCTGAACTTCTGCCCACATCACCACGCCTACGCGGATGACAAAAATCACTGACATCGCCCACAGCAACATGCGCCTGGCGGCATCGCCCATCACTTCACCAAAGGCAAAAGCACAGCGCCGTTGGGATCAAAGAAGATCGCCAGCATCTGCACGAAGTTGGTCAGTGCGGTTGGGTTTCAAACGGATGCGACGAGTTGGCATTAAAGCCACCGCCGTTAGTACCGAGCATCTTGATCGCTTCCTGAGAAGCTACAGGCCCCATGGGTAACAGCTGTTGCGCTCCTTCAACGGTATTCACAGCTGATAAGGCAGAAAGTTTCACAGCGCACCTTGTTGAATAAAAAAACAGTGCAATCAACAACGCCACAGGGATAGCACCCATAACGTGATGCGTAGCAGATCGACCCAGGCATTCGAGCGTGCTCATGCTCTGGCGGAGTAAACCTTGCACGGATAGGGGCAAAATCACCACCAATCCGCTTTGGCGGCAGAGAAAGTTTTGCCGTTAAGCCCGCCATCTGGCTGAAATAAGCTCAACGTGGTTTCACCGCTATAAGATTGCCAGTTGGTATTGGTGACAAGCTGACGGCGGTATTCAGCGCCAGATCCCACGACAGCCTGGCAACTGCTGTGGATTAAGCGGCAGATAGTGCTGACCGAGCAACATAAAAACAGCACCGCCAGCCCAGCATGTTCAGGCCGAGAATGGCACAAGATATTGCTTCAGTTCATCTCACGGTCAGAGACATGAAGTGCGCGAAAAATTACGCGCTCAACGCCCGTTATTACCGGGAAGATAATCATTAATCCAGCCGCGCCAGCCCGCTGCCACAAAAGGACGCGCCAGCACCATTAACACCAGTAAAAACGTGGCGATCGAGTAAGAACCCTTGCGCAGCCATCAGAACGCCTCCGCATTGATCAGGGCGCCAAACCAGATAACCCAGTAATAAAACACCAGCAATACGCCGGTTATCACGCCTGCACTCACAGTGCACCTCAGTGGCCTAAAGGTGATACCGGAATTAGAATTCTGGCTGCAAAGATTTCGCAAAAATCTGCGGGCGGGGTGTAAAGGTTAAACGCAAGCAGACGCCATGGCGCGAAGCGGG
+>9b070b44-f197-4952-8863-7e27e04ff558
+ATTGCATCGGTAGCCGCTTCGTTCAGTTACGTATTGCTCTTGCCTGTCGCTCTATCTTCGGCGTCTGGCAGGTGTTTAACCTCATGGCACCACGTTGATTATGTGAAAGGTGACCCACGACCTGCCACAACTGGCGGCGCTGCGACCGCTGCTTACGGCTGGTGAACGGGCAGTTGCAGGAGGAAGCATGATTACACGGTGGTTCTGGCGCGAATGGCGTTCACCGTCGCTATTCAATTATCTGGCTGGCGCTAAGCCTGGCGGTGGCCTGCGTGCTGGCGCTGGGCAATATCAGCGATCGCATGGAGAAGGGGCTTAAGCCAGCATTAAAGCCGTGAGTTTATGGCGGGCGATCGGGCGTTGCGCAGTTCACGCGAAGTGCCGCAAGCGTGGCTGGAAGCGCAAGAGCGCGGCCTGAGAATCAGCAAGCGGCTTGACTTTCGCCACAATGACCTTGCAGGCGACACACCGCAGCTGGCGAGCGTCAAGCGGTGGATGATATCTACCGATGTAGCGGCGATCTGCAAACTAATCCCCTGGCCTGAAACCGCAGGCAGGCAGCGTATTACTGGCCCACCTGATGGCACTGCTTAACCTGAAAACGGGCGACACCATTGGCGGTAGACGATGCCACCTTGCGGATTGCCGGAGAAGTGATTCAGGAACCAGTTCCGGTTTAACCCTTCAGATGGCTTTCCGCGTCTGATGATGAATCGGATGTCGATAAAACCGGAGCCGTGCAGCCGAGGGAGTCAGGTCACCTGGCGTTATAAATTCAGCGGCAACGAGAACCAGCTCGACGGCCTATGAGAATGGTTGTTACTGCCTCAGCTTAAACCCGAACAACGCTGGTACGGTCTGGAACAGGACGAAGAGGCGCTGGGGCGATCGATGGAACGCTCGCAACAGTTCCTGCTGCTTTCGGCGCTTCTGACCGCTGCTGCTGGCAGTGGCGAAAGCGGTGGCAGTAGCGATGAACTCATTACTGTCATGATCGCTACGATCTGGTGGCGATCCTCAAAACGCTGGGGGCAGAACTGAGCGCAACTTCCGTAAGCTAATCGTCGGTCAGTGGTTGATGGTGCTGACGCTTTCAGCCGTTACCGGTGGGGCCATAGGCCTGTTGTTCGAAACGTGTTGATGTTGCTTTCTTCAAGCCCAGTTCTGCCCTGCTGCACCGCCAAAGCCAGCCTCTGGCCGTGGCTGTGGGCGCTTGGCACCATGACGGTCATCGCTGCTGGTGGGGCTACGGCCCATATCGCTTGTTGCTGGCAACGCAGCGCTTTACGCGTATTACGTAATGATGTGGTAGCGAACGTCTGGCCGCTGAGGTTTTAATCTGCCGATTGTCAGTGTGGTGGTTGTGCTGCTGCTCGCCGGATTAATGGGTGGCAGCATGCTGCTGTAGACGGTGCTGGCGGGCGCGGTAGTACTGGCTTTGCTGTGCGGTGTGCTGGGCTGGATGCTGCTGAATGGCCTGCTTCGCCGCATGACGCTGAAATCGCTTCCACCTCTGCGCCTGGCGGTTATGCGCGCCTGTTGCGTCGTAAACGGGTCAACGTTAAGTCGGCTTTTCGGCATTTTCGCTCTCCTTTATGCTGCTGGCGCTGCTGCTGGTGTTGCGTAAGCGTCTGCTCGACCGCTGGCAGCAGCAACTACCTCCAGAGAAAGCCCGAACTACTTTTAATTAACATCGCCACAGGAACAGGTAGCACCGCTAAAGCGTTCCTCGCGGAACGCATCAAGATGGTCGGAATCGTTTATCCGGTGGTGCGCGGGCGCGTGACGGCAGTTAACGATAAGCCGACAGAGGTAATGAAGATGGGCGGCAACCGCGAACTCAATCTTACCTGGCAAAATACGCGGCCGATCATAATCCGATTGTCGCCAGTAACTGGCCATAAAAAGCCGATGAAGTGTCGATGGAGAGGGGCTGTGAAACAGCAAACGTTGCCCTCGGTGATACCGTGACTTTTATGGGCGATACCCAAGGTTCCGCGCTAAGTGACCAGCCTGCGCAAAGTGGACTGGGAAAGTCTGCGGCCTAATTCTATTTTATTTTCCCTGAAGGGCATTGAACGGAGCAACCGCAAACTGGCTTACCGGTTCCGCTGGGAGAATGGCAACGGCATGTTGACACAACTCAACCGCCAGTTCCCGACCATAGCCTGTTAGATATTGGCGCGATTTTAAAAACAGGTCGGTCAGGTGCTGGAGCAGGTAAGTCGGAGCGCTGGAAGTGATGGGTAATTACTAGTCACCGCCGGTATGTTGCTGTTGCTGGCACGGAAGGTGCAGGTGGGAATGCGTCAGCGTCATCAGGAGCTGGTGGTGGTGTGGCGCACACTCGGTGCGGGGAAAAAACTGCTGCGTACCACGTTGTGGTGTAGAGTTCGCCATGCTTGGGTTTGTTTCCGGCCTGGTGGCCTGGTGAAGTGCCCAAGGAAACGGCGCTGGCGATGTTGCAGGCGAAGGTGTTTGATTTTCCGTGGGAGCCAGACTGGCGATTGTGGATTGTTCTGCCGTGCAACTGAGCGCTGCTGCTGTCGCTTTTCGGCGGCTGGCTGGGTGCGCGACTGGTTAAAGAGCAAAGGCGCTGTTCGAGCCGGTTTACTTGCGGGGTGATGAGAGTAAATAAGGGGCGTTCTGGTTGAATGGAACGCCTTGTTTAGAAATAATTCTACAATATATGTTTCGTGATGAAGTGTTATTGAATTGGTGATTTCTATCTTTCTATTGCTGATATTAATCTGAATCGGTGGAGTTTATTGATTTTAAATATAGCCCTACAAAATAACTCAGACTAATAAAATCATAAATCATATGCGTTGAATGGATATTATCCATATAATTAATTTGTTGATGATGAATTCATCTGTGTGCTAAAGTAGTTTAATAAAATATTAGAAAGAAATTGACCACCAACAATAACAGTTGTTGTTGATTGAGAACAAATAAGTTTATGTGAAAAATATATAAATACATTAGCTGGTCTTGTGTGTCATTTTATTTTTTGTGCTAACAGGGATATGAACAATAACTAAAAGGGCACTATGAGCGGAAAACCAGCGGCGCGTCAGGAGATATGACTCAGTATGGCGTCCCATTGTCCAGGGTTCGGCAGGTGTAAAATTGGCGCGCCCACCGGCGGTAGCGTGCTCGGTGTCCGGGCGGGATGACTTCCGGGCAACCCGGTAAATCGCTGCTGAGGGCGAAGGTGCTGCCCGGCGAGACGGACCTTTACTGCCGGCCCGCTGCCACCATTCTCTCCCGCACCTACAGCAGCTACCGGACGAAGGGCGCCTGCACCGGTGGGCGTTTTCGGCTGGCTGAAGCGCCTTCTGATATCCGCTTACAGCTACGTGATGACGGACTGATACTCAACGACAACGGCGGGCGGAGCATTCACTTTGAGCCGCTGCTGCCGGGAGGCGGTGTGCAGCCGCAGTGAGTCAATGTGGCGGTGCGCGGTGAAATAAAGAACAGCACACAGCCGGACGGCCCTCTGCTAACGCGGCTATTAGAGCGCTGCCGCCGGATATCCCGGTTAAGCCCGCATCTTTACCTGGCGACCAACAGCGCACAGGGCCGTGGTGGATACTGGGTGGTCTGAGCGGGTGCGCACCGGAGTGCTGAGGACATTACTGCCAGCGCCGCGCGCTGCTGCCATTACCAGGTGCTTACCGGGATGGCGGACCGCCGGACGCTGACGTACCGGCGTAAGGCCGCCGGTGACTGGCGAAATCACCGGCGTGACGGACGGTGCCGGGTGAGTTCCGTCTGGTGCTGACCACGCAGGCGCAGCGTGCGGAAGAAGGCCACACCTCTTCGCTATCTTCTTCTGACAGTTCCGCCCTCTCTCGGCCTCAGCGTTTCCCGACACACTGCCCGGTACCGAATGCGGCGGCCCGACAGAATATCCGCCTTTCGGCGGTGTGGCTGTCACGACCCGGCATACCCGGAGGCCTGCCCGCTGCGCGCCACTGGTGCGGTACACGTATGAAGCCGGTGAACTGCTGTGTATGACCGCAGCAATACGCAGGTGCGCGCTTTCACGTATGACGCGCAGCACCAGGCCGGATAATTGGCGCACCGTTACGCGGGAAGGCCGGAGATGCGCTACCGCTACGACGATACGGGAGCCCGGGTGGTGGAACAACTGAACCCGGCAGGGTTAAGCTACCGCTATCTTTATGAGCAGGACCGCATCACCGTCACCGACAGCCCTGAACCGGCGTGAGGTGCTGCAGCCTGAAAGGCGGGGCCGGGCTGGAAACGGGTGGTGAAAAAAGCGGCGGACGGCAGCGTCACGCGCAGCAGGTATGACGCGGCAGGAAGGCTCACAGCGCAGACGGACGCGGCGGGACGGAGGACGTGCGGTCTGAATGTGGTGTCCGGCGATATCACGGACATCACCACACCAACAGGCAGGAGACGAAATTTTACTATAACGTGAGACCAGCTGACGGCGGTGAATTGTCCCCGGACGAATGGAGAGCCGCCGAGAATATGATGAACCAGGCGGGCTGGTATCGGAGACATCGCGCAGCAGGAGCAGTACGCTACCGCTACGATGACGCGCACAGTGAGTTACCGGCGACGACAACGGATGCGACGGGCGGCACCGGCAACAGATGACCTGGAGCCGCTACGGAGCGGTGCTGGCGTTCACCGACTTGCTCAGGCTACCAGACCCGTTATGAATACGACCGCTTCGGCCAGATGACGGCGGTCCGCCGCGAGAGAGCATCAGCCTTTACCGCCACTATGACAACCGTGGCCGGTTAACCTCGGTGAAGACGCACAGGGCCGTGAAGCGCGGTATGAATACAACGCCGCAGAGCGACCTGACTGCCGTTATCACCCGGACGGCAACCGGGCGAGACACAGTACGATGCGCATTGGGAAAGGCGGTCAGCACCACGCAGGGCGGGCTGACGCGCAGTATAGATTACGATGCTGCCGGACGTGTCATCAGCCTGACCAACGAGAACGGCAACCACAACGTCTTCAGTTACGATGCGCTGGACCGGCTGGTACGGCGGGGCGGCTTTGACGGGCGGACACCCAACGTTATCATTGTAACCTGAGCCGGAAGAACTCACACAGAGTGGGGATGAGGACTTGTCATCCTCTGGTACGCTACGATGAATCGGACCGTATCACTCACCGCACGGTGAACGGCAACCGGCAGAGCGGTGGCAGTATGATAATACGGCTGGCTGACAGACATCAGCCACCTGAGCGAAAGGCCACCGTGTTGCCGTCCACTATGGCTATGACGATAAAAGGCCGCTGACCGGCGAATGCCGAACCCGGTGGAGAACCCGGAGACAGGGGAACTGCTGTGGCGGCATGGGGCGAAACACGCATACAACGAGCAGGGGCTGGCAAACCGCGCGTCGCCGGACAGCCTGCCGCCGGTGGAGTGGCTGACGTATGGCGTTACCTGGCGGGAATGAAGCTGGGCGGGACGCCGCTGGTCGATATACTTGGAACAGGCTACCGTGAGACGGTACGCAGCTTCGGCAGCATGGCGAGGCAGTATGCCGCATACGAACTGACCCTTTGCCACCCCGCAGGCCAGTTACAGAGCCAGCACCTGAACAGCCTGGTATGACCGTGACTACGGGTGGAGTGACAACCGGCGACTGGTGCGCATCAGCGGCCGCGACAGACGCGGGGCCGGCTACAGCGCCACGGGCGGGCTGGAGGTGTGCGCGCCTCGCACCAGACCTGGACATCCGCATCCCGTATGCCACGGACCCGGCGGGCAACCGGCTGCGGGCCAGAGCTGCACCCGGACGGTACACTCACAGTGTGGCCGGATAACCGCATCTGGAGGATGCGCACTATGTCTACCGCCACGATGAATACGGCAGGCTGACGGAGAAGAAGACGGACCGCATCCGGCGGGTGTGATACGGACGAGGGACGACGACGGACCCACCACCACTACGACAGCCAGCACCGCCTGGTGTTACTGCACGCGGATACAGCATGGCGAGCCACTGGTCGAGAGCCGCTACCTCTACGACCCGCTGCAGGACGGCGAATGGCAAAACGGGTCTGGCGGCAGGGCGTGACCTGGCAAGTGGATGTCGCTGTCGCGTAAACCGGAGGTGACGTGGTATGGCTGGGACGGGAGACGGGCTGACGACAGTGCAGACTGACACCACACGTATCAGACGGTATACGAGCCGGGAAGCTTCACGCCGCTCATCCGGGTCGAGACGAACGGAAGGCGGGAAAAACGGGTTAAAGCAAGCAGACGCCGAATGAAACGT
+>70a6e1ac-2b52-46e4-83ac-0a49cdc637d4
+ATCGGTATGCTTTGGTTTCAGTTACGTATTACTGCTGCCGCAATCGCTCTATATTCCGGCTCTCTTTAAGATTGTTTAACCTGGGTCATCAGCATCATTTTGCAATATTACCCTCGTCGCCAGGTCAGAGATTTAGGGTCAGGTCGGCCATAATGCCTCTTTCGCCGCTGGGTGCCAGGTTCATCGCCACCGGCATCTGCCTCGCGCCTTTCCGAATCGTTGGTGCCGTCGCCAGAATATGCAAACGACCTTCCGCCTATTGGCCGGATCGAAGTAAAACCCGGCCTCCGGCGGTGTCGCTTCGGCGAAAATCATCGACACCCACTTCCCGCAGCAATCGCGGCAACGGTCGAACAGACGCTTCGCCGATAATCATCACCATTTTAATGCCCATTTTGCCGCTGGGCGGAAATACTATTTTGCTGTGACGATATCTTTCAGCACAATAACGCCCAGCACACGGGGCAGCTTCACCACCACCAGCGGCGTGAAACCACGACGCGCAACCTGATCGAACTTTTGATCAACATTCGGCGGGAAGTGACCACCGTTAGCCTCGCTGCCGGCGTGAAATGGCATCGACAGACGCTTTACGGATCGTGCGATTTGCCGATGTTGATCCCATCATCCGGCTTTGCACGTATTGCCAGGTTCGGGAGTGGCATGGAGCGACTGCACATCGCGCTCGCTGAGTTAAAACGCTTTGCTTGGCGAGATCACAATACTGCGGGCTTATTCCGGCGCTTCATCAGCCAGCAAAGCCAAGTTATTATCAGCCAGCGTTTTCATCCACGCCCTGCGCAGCGGATAAGCTCCGGAGAAACGCCCTGACGGTTACCAGAGTGTGATGTTGCGGTTTATCCGAGTAGCAGAACGTCAACGTCACACTACCGCTTCAACTGCACGTCCGCTGGTAGCAATCATTTAACGCCTAACGCATCCGGCCATCCAGCGACGCCGATCACTGACAACAGACTTGCGCCAATAGTGGTTGGGATAGACAGACCGTAAGCGCCACAATTACCGTTGCTGACTGCATTACCGCCCCACGCGGGAAAACAGCTGGCGAAATGGCGGTTTATAAATCAAAAGACGGCTCTAGTCATGGCGCAATCAGCGTCGTCAGGGCAATTTCGTTCGGCGTTTTGCGTGCGCTGTGCGCCTTCCACCATCGCGATCATCCGATCCAGAAATCTTCTCGCCGGGGTTAACGCCACTCAATCACCAGCCAGTCCAGAAAGACCGCGTGCCGCCGACGGCGGAAACAAAATCGCACCGGATTCACGGATCCACCGTACCGATTCCGGTGATGGCGCTTTCATCGTCGTCACCCCGCTCTTCACCGCTCGCAGGATAGCCTCGCCAGCTTCTACCAGTACCGATATCGCGCTTTTACAGGACAGGTGGCCAGGAACTTTGTCCGCCTGCAGCGCCATCATTCGGCTCACGCAGCTTGCGAACAAAGGCAGTTTCACCCTTTCAGACTTCGGCCTGCGCTTTGCACGGCCTTCTGCCTTTCAACGAAATTAGCGAATTAAGTACGGTGATCCCCTGGCCAACCGCTAATGGCCGCACTAAAGCAGCATTGCTGACATCGCACCGCTTACCATCGCGATGCTAATACAGGTGAATCAACGACTTCACCGATCCAGACGATGGCATCACCGGATTGCGCATTGCGCTTCACGGTTTAATTTTCTGCCGCTAAGCACCAGCGCCTGAACGGCAAGGGTATGTTGTTCGAATAGCGCCGGTTATTTGACTCATATTCAGTGCTCCTCAATATCATCAGGAGAGATATTTCACTTCCGGGACCAAGCGCCAGGCGGGGCAAAAGAGGTCGGTCGCCAACCAGCAACACGGACACCGATTAGCAACAGGCCAACAAACAGCGAGGCGACGGGTGAAAGCGGCATCACCGGTGTTATCGACCGACCAAACATGCGAGCGCCGACAAACGGTTCCAGGGCTGCAGGAGGTTGGCGCCAATCGGCAAAAGCGCTTTACCCGTTGTTGTGCAACGGCGGATGGAAACTTGCGGCATTACCGGCACTTCATCAAAACCATGCGGGCCAGAGGTTGAGGCATGGCGCCCATTCCGGCGTCGATTTCTGCGTATCATAACGCCGCGCCCATCAACACCAGCGTCGGTAACCGATTACGCCGAGTGCGGTCGGTTTCATCTCGCGTGCGTCGATTTTTTGCAGATCATTCCGGTCCGCTGCACGACCAATCATCAATACCCGGCGCAATAAACACCGCCAGCAGGGACCGACAGCGTCATGCCGTAAAGACCAGAACCGACACCGCCGAACTTACCACTTCACCAATTTGCATCAGCCACATCGGCACCATGCAAAGGCGATAAACAGATCATGCATCGCAATCCACTTACGCCACAGAGGAAGCCGCCAAATCGTCTGGGCGCAAAACCGGAGCTGCACTGAAGCCAAAGCACGCCGAAACGGCTTATAACTTTACAGCCTTCCATAACAGGTGCGCTTATTCGACACTTTGAACGCCCGGCAGATGAGGATTACACGAACTTCTGCCCACATCACCACTTCGCAGATGACCAAAATCACTGACATCACCCACAACAGCATGCGCCTGGCGTGATCGCCCATCACTTCACCAAAGGCAAAACTTGCACAGCGCCGTTGGGATCAGAAGATCGCCAGCGGCATCGAAGTTAGTCGATGCGGTTGGGTTTTCAAGCGGATCACGGCAGGATGGCGATTAAAGAAGCCACCGCCATTGAGCACCGAGAACATCTTGATCAGCTCACCAGAAACTGAAGCCCCGCCGAACAGCATTCTTCACTTCCTTCAGCGGTATTCACAACCACCGATGCGGTAGAAGTTTCTGGCAGCGCACCTTGTTGAATAAAAACAAACCGCAATCAACTTAACGCCACGGGGACTAGCACCATAACGGCGATGCGGCAGCAGATCGGCCAAAGGCATTCAGGCGGTGCTCATGCTCTGGCGGGTAAACTGCCGCACGGATGGGGGGCAAAATCACCGCAATCCGCTGGCGGCAGAAAGAAGGTTTTGCACCGTTAAATGCCATCTGGCTGGAAATAAACTCAGCGATGGTTTACCGCTATAAGTTGCCGTTGGTATTGGTGACCGAAGCTTGACGATTGGTATTCGGCGCGCCAGATCCCGCGGCGCCTGGCAATATGGATTAAACGGCAGATGGTGCTGACCGAGCAACGCAAAAAACAACTTCGCCAGCCCCAGCATGTTCCGGGGCTTACGAGAATGGCACAAAGAATTCAACTGCTTCCAGTTCATCACGGTCCAAAGAGACTTTGCCAAATTGCGAAAAAGAATACGCTCAGCACTTATTATGCCGGGAAGAATATCGTTAATCAGCCGCGCCAACCCGCTAAAAAGGACGCGCCAGCACCATTAACTTCCAGTAAAGCATGGCGACCGACAGAACCCTTGCGCAGCGTCAGAACCTTCCCGCATTGATCAGGCATAAAGCCAATCTTAAGCAATAAAGCACAGCACAATACGCCGGTTATCCGCGCACCACTCCCGATGCACCTCCAGTGGCTTCAAAGTGATACCGGAAGGGTAGGTCTGGCTGCAAGATTTCACCAAAATCTGCGGGCAGGTGCCAAAAAATGCAAAATGGCAAAAGCCAGCGGTTTAACTAATATTTAATTGATAATTTAACTTTTGGCACAATTACAGGATGGTCTTCAAATATAAACCGTCAATAATAAAAATGAGTGGTCGGATCGAACAAAATTACACAAAAGGCGGTACCATCAGATAAACAAATTCATTTTCCCGGTGCCATTCACCGGGTGGAGTAAAGGGGAAAAGTATGGAACTCTACAGAGGAATATCCTGCATGAGCTTATCTTTTGCCGTACTTATGCGGTTTACTGCCGGAACAGTTTCTGGCGCTGCCTTTCATGCTTTCTGGAAAGGCCGCGCCCGCTTTACAACTACCTGCATCATCTGGTCGAAAGCAACGATAAGAAGCCATTGATGGATGGATCAGGCGAAAAGGCAACTGGTGATTTTTATTGATTGCTTTGGTTTTGAATACATTGAAAACCGCCAGCCCGGAACGCTGGCGGTTTTTCTATCAGGAAGATGTTCAGAGGAATGTTGGGCATCGTTATACCAGTAGAAACATATGTTCGCCAAATATATACTCGCTATTTCCCTGAGCCGGCTGTGACAGATATCTTCGCCAAAGGCTTTCTTTATAAATCTTTAGGGTTTCGCCTGTCAGCGCAGGCAAATAACCCGATAAAGCTGGATGAGCAGATGAGCGGAAAACCGGCGGCGCGTCAGAGTGTGACAGCATGACTTAGACATGGCGTGGCATTGTCCAGGGTTCAGCAGCCGGAGGTACGCATCAGTGCCCCACCGGCGTGGCCTGTTCGGTGTGCCCGGCGGGTGGGCGATCCGGCCATCCGGTCAATCCACGCTCCGGTGCAAAAGGTCTTCGGGTAGGCTTCGACATCGCCTTTCTCTTGACGCTACCGTTCATTCTCTGCTCCACACCTACAGCGGTTACCGGACCCCCGCGCCAGGTGGGAACTCGGCAGCTGAAAATGCCACGGAATATCCACTTTCTGGCTGCGCGTGATAACACACTTTGTTCTCGATGATAGCGGCGGCAGCTTACTATTTTGAGCACCTGTTTCCGGGCAGGGGACGGTTACAGCCCGCAGCGAGTCACTGGCTGGTGTCCGCGGCAGCATGGCAAAACTGGATGAGTCACCAGCTGGCCGCACTCCGGCGGGCGCTGCCGAGAGAACTCCGCTTCAGATCCGCTCGGCCCATCTGGCGACCAGCAGTCCGCAGGAGCAAAGCGGTGGCTACGCTCAGCTGGTGGCAGGCGGGTGCAGAAGCGGATGAAGATTTTCACCACCGCCGCTGCCGCCGTACCGAATTTTCTTCCAGAGCTGGTGGACGCCGCTTCAGGCGCACACAGAACGTTCCACCGCGAAGCCGCCGGTGAATTCAGCGGCGAAATCTTCCAGCAGCGACCAGGATGGTGCCGGGCGTCTTCCGGCTGAATTTTGACCACGCAGGCGCAACCGGGCAGAAAAGCCCGGCAACGAGCCATTTCAGCGGGACGAAGACCACTTTCCTGATACCCTGCCGGGTTACCGAATATAGCCGGGACAACAGCGCTCCGTCATGCAAAAGTCGCGGCGACGCACGACCCGAATACCCGGAGGGCTACCCGCCGCTGGGGCGTATGGCTGGACACCCGCAGCGAGCTGGCGGCGATTCATATTGCTTCACAAAGCCACACGAGTACAGCTTTTGCCCGATATTTCGTACGGGCCGGATGGTGGCGCACGATCACGGGCCGACCGGAAATCTGTTACCGTACGGCAACGTGGGCGGTGAACCAGAACAAATAAACCAACGGGCTTAGATTTTTGCGTGTCAGTACCGAGAAGACCCGCATCCACTCACCGACAACCTGAACCGCTGGTATTGAAGTCCACGCACGCAGAATTGAGCCGGTAAAAATGGTGAAGAAAAGATACACGGACAGCAACGTCACGCAAAGTCAGGTTCTGACGCGGTGGAGCGAAACAAGGCACAGACTGGATGCACCAGGCAGGACAATGGGAAATACAGTCGGGTAACGGTGACGGGCCTCATCACGCGCATCACCACGCCGGACGCGGGGCATCGGCGTTTTACTATAACCACCACAGCCAGTTAACGTCAGCCACCGAGCACAGCACGGCGGGCTGGAAAGCTCACCGGGAATGCTGATGAATGGGGCCGTCAGTTCGAAACTACTGACGGCGCGATATCACCCGCTACCGTTATGATAATCCACACAGTGACTTACCTGCGCAACTGGAAAGCCACCGGCAGCCGGAAAAACCGCGGCGTAGATTTTTGATTCCGTTGCTGGAAGCTACGCCTAAATATTTCCGGTTATGTAACCCGCTATGATGCCGACCGTTTGAACCAGGTGACGGCAGGTGCACCGCGAGGAAGACTGTGAGTCAATTACCGCGCATACGACAGCCGTCGGACAAGTTAATTGCCGTGAAAGACACGCAGAGCCGCCAAAACGCGGTATGAATACAACGCCGCCGGTGACTACGACCACCGTCATTTTTGGACGGCAGCAGAAACGGGACCCAGAAGTACGATCAGTAACGGAAAAACCATCAACGCACCACAGGGCGGTCTGACGCGCAGTATGAATAGGTATGCCGGATTATCCACTGACCGAGCGAAAAGCAGCAGCCACCACCTTCCGTTACGATGTACCGACCGGCTGATACAGGAAACGGCACGGCGGCACGCGTTATCACCGACCTGACCGGCGAACTTATCCGCAGCGAGGATGAGGGGCTGGTCACCCACTGCTTGACGAAGCAGACCGCCTCCGCACCACTGCGTGAATGGCGAAACCCGTTCCGGCAATTGAAACATGACCGAACACGCGGCTGGCTGACAGACGCTCAGCCATATCCTGGCGAAAGGCGCAGAGGTGACGGTGCACTATCGATTGAGCAGTAAAGGCGCCTCGCCAGTGAACACCGACGGTGCATCATCAAGACGAATGGACTTCTCCGGCGGCATGAGACCAGAGGCATGCGATACACAACGCACAGGGACTGGCGAACCGCTTAATAACTCCTGGACAACAACCTGCCGCCGATGAATGGCTGACTTCAGCGGCAAGCTTTGGCCTCGGGCATGAAACTTCGGCGACACCGCTGGTGCGTTACACCCGCGATGCCTGCACCGGAAGCACGCTGCGCAGCTTCGGCCGTTATGGAACTCTACCGCTTATACCCCTGCCGGGCGGTTACAAAGGCCAGCACCGGGCTTCGGCCCTGCTGTTCCGATGCGGTGTTCACCTGGAGCGACAACACGGCGAAACTCATCCGCATCGTAGCCCGCATAGACCAGGGTTAGCTGCAGCACCACCGGCAGGTGACCGGCGTTACACCACCATAACAGATCTGCGGATATCCGCATCCCGTATACACAGACCGGCAGGTAACCACCCGACCAGGCACCGCACCCGGACAGCGCCCACATCAGCATGTGGCTTGGATAACCGTATCGCCCGTAACGCGCACTATCTTTACCGGTATGACCGTCACGGCGAACGAGCCCAGAAAACGGAAACCTCATCCGGAAGGTTATCCACTTTGGATGATAGGCACACCGCCGGTACCGTACGACGGTCAACCGGCTGGTACTACCCACGCCGGACCTAATATGCCGTGCCGCTGAACCGAAAGTCGCTATCACGACCCGCTGGGCCTCGAATTAGCTTCGCTGGAACATGGCGGCGTGACGGGACCCTGACAGGCTGGCGGATAATGCTGTCACGACTTCGCAAGTGATACGGTACGGCTGGGACGGCGACCGCCCACAATACGATACAGAACGACAGAACCCGCCAAGACCGATTTATCAACCGGGGCTTCACGCCGCTCTCAGGGTTGAAACCGCCACCGGGTGAGCTGGCGAAACAGCGCTGCAGCCTGGCGGATACTATTTAGTCCGGTGGCGAGGCCGGTGGCGGTGTGATGTTCCCGCCGGTGCTGGTGCAGATGCTCGACCAAACTGGAAAATTAAAATCCTGGCTGACCGGTGGTCGAGGAAAGCCGCGCTGGCTGGCATCATGCGGCGCCTGACGGTGGCGCAGATGCGAAAGCCAGATGGATGACATACGCGGCGCGAAAAGAGTCACCTTTTTACCTTGCCGCACGCACACACACACACACACGGGACGACCATGCGGCCTGCAACTGGCCCGCTATCAGCACAGGAAGGGACAACTGGCGTGACACTGGAAGGCGATAAAATGTTAACCTGCGGATAGAGAGAACCCGCATCGGCACGTAAAGCTTTATCCGCCTGCCGGGGCAACCAGTGATGAGGTCCGGCCTGTATTACAGCTCCGCCACCGCTATTATGACCCGCTGCCGGGGGCATTATGCGCATCACTCAAAAGGATGATTCCGGGCTGAAGGGAACAGTTTTATCAGTATCCGTTGAATCCGATCTGAAATATAGATCCGACTAGGACAAGAAACACTAAAATGCATTAAATACTGCATTCAATGGGCGGGCGGTGAAGGAAGCGGTCCAGATATGTAAGGGGAATCCGTTCTATCGTAATATCTTTGTCCCAGGATGGTAAAGGGGATTATATGGTGGCCAAAGTGTGGGAGAATCAAAGGAGATGTTCCTGGGGGCCGAATTAAAAGCAAGTAATGACCCTACAAAAGAGCTGCTTGTGGTGACATCGTTGAAACCGATAATGGTGTGGAGAACTGTTTGAAGGGAAGTTTAAAGAAGTGCAAGGCAAAGATTATTCTATATTACCTGATATATTAGGTTAACCACCCAGCAGACTTCGAATGAAGAACAG
+>7baacba0-bf17-4cee-98b8-2d382f7eb308
+TTGGTAACACTTCGTTGCTGCGTATTGCTACTTGCCTGTCGCTCTATCTTCGGCGTCTGCTTGGGTGTTTAACCTGGGTTTCGCCTGTCAGCAGACAAATAGCCCGATAAACGGGATGAGCAGATGAGCGGAAAACCGGCGGCGCGTCAGGGCGACATGACGCCAGTATGGCGTGGCATTGTCAGGGTTCAGCCGGGGTACGCATCGGTGCCCCACCGGCGTGTGGCCTGTTCGGTGTGCCCCGGCGGTGACGTCCGGCCATCCGGTCAATCCGCTGCTCGGTGCAAAGGTCCTTCCGGGTAAACCGACATCGCCCTGCCCGGCCCGCTGCCGTCCATTCTCTCCGCACCTACAGCAGTTACGGGGACAAAGCGCGCCCGCGCCGGTAAAGGGCCTCGGCCCCGGCTGGAAATGCCTGCGTTATCCGCTTACAGCTGCGCGATAACACACTGATACTCAGTGATAACGGCATGAAAGCCTGTATTTTGAGCACCTGTTTCCCGGTGAGGACGGTTACAGCCACCAGCGAGTCACTGTGGCTGGTGCGCGGCGGCGTGGCAAGCTGGATGAAGATCTCGGCTGGCCGCACTCTGGCGAGCGCTGCCGGGAGAAGAACTCCCTTAAGTCCCGCATCGTTATCTGGCGAGCAAACCTGGTCCGCAGAGACCGTGGTGGCTGCTCGCTGGGTGTGAGCGGGTGCCGGAAGCGGATGAGTGCTGCCTGCGCCGCTGCCGCCGTACCGGGTACTGACCGGGCTGGTGGACCGCTTCGGGCGCACACAGACGTTCCACCATAGCAGAAGCCGCCGGTAATTCAGCGGCGAAATCACCGGCGTGACGGATGGTGCCAGCGTCACTTCCGGCTGGTACGCTGACCACGCAGGCGCAGCGGGCAAGCAGCCCGGCAGCAGGCCATTTCCGGCAGGACGGAACCGTCCGCTTTTCCTGATACCCTGCCGGGTTACACCGAATATGGCCGGGACAACGGCATCCGTTTGTCTGCCGTGTGGCTGACGCACGGCCAGATACCCGGAGAATTTTCCTGCCGCGCCGCTGGTGCACTATGGCCTGAACGCCCCGCAGCAAACTGGCGGCAGTGTATGACCACCAGCAATACACAGTGCGCAGCTTTACTTACGATGATGATAAATGCCAGGGGCCGGATGGTGGCTTTACCGTCACACGGGCCGACCGGAAATCTGTTGCAGGCCACGACGGCGACGGGCGGGTGACAGAACAGCTAAACCGGCGAGCCAAGTTACACGTATCGGTATGAGAAGGACCGCATCCACCATCACCGACAGCACGAACCGCCGTGAAGTCCTGCACGCAGGGGTGAAGGCGGGCTGAAGCGGGTGGTGAAAAGGAACACGCGGACGGCAGCGTCACAGAGTCAGTTTGACGCGATTATGAGCCGGGCTCAGGGCACAGACGGATACGCAGGCAGGACAACAGAATACAGTCCGGATGTGGTGACGGGCCTCATCACGCGCATCACCGCCGGATGGCAGGGGCATCGGCGTTTTATAACCACCACAGCCAGTTAACGTCCGGCCACCGGGCTGGCAGACTGGGCGCCAGGAATATGATGAATGGGGCCCGTCCTGATTCAGGAAACTGCCCCTGACGGCGATATCACCGCTACCGTTATGATAATCCACGGTGACTTACCCTGCGCAACGGAAGATGCCACCAGCGGCGGAAAACCATGACGTGGAGCCGTTGCGGTCAGTTGCTGAGCTTCACTGACTGTTCCGGTTATGTAACCCGCTATGACCATGACCGTTTGGTCGGGTGACGGCGGTGCACCGCGAGGAAGGGCTGGTCAGTACCGCGCATGCGACAGCCGTGGACAGTTAATTGCCGTGAAAGACCTTACGCAGGGCCATGAAACGCAGTATGGACCACAACGCCGCCGGTGACCTGACCACCGTCATTGCCCCGGACGGCAGCAGAAACGGGACACAGTACGATGCGTGGGAAAAGCCATCTGTGCCACGCAGGGCGAATCCCAGACGCACCGGTATGGAATACGATGCTGCCGGACGGGTCATCCGCCTGATGACCAGTGAAAACGGCAGCCACACCACCTTCCGTTACGATGTACTCTGACCGGCGATACAGGGAAACCGGCTGACGGCCGCACACAGCGTTATCACCACGACCCGGCCATGAAGCTTATCCGCAGCGAGGATGAGGGGCTGGTCACCCACTAACTATGACAGAAGCAGACCGCCCCACGCACCGCACCGTGAATGGCGAAACCGCGGAGAGCGGTGGCGAATTATGACGAACGCGGCTGGCTGACGGAACGCATCAATACCGCGCATATCGGCGAAGGGCACCGGGTGACGGTGCACTATGGTTATGACAGTAAAGGTTAAATACCCAGAAGCGGGCATACCAATATCGCGTAG
+>bc5615d7-dc94-4315-9cf1-5112555c19d5
+TCGGTATTACTTCGTTCAGTTACGTATTGCTGCTTGCCTGTCGCTCTATCTTCGGCGTGGGTGTTTAACCTGTCTGTGGCATACGGGATATCAATCTTGGAATTTACATATAATAATGAAACAATTAACTTAATTTTATTTGTTTATAATGCGCTTACTTAATACAAACCGTGAATATACCTCCTGACAGAAAATAAAGCCATATTATCGCCATAATATACTTACTATCAATCTACGCCAATAATGTCTGATACAGTCCCTATAAATATTAGGCAATAAAAGGAATATATGCCTGTTGGAAAACATATTACCATCATTCATAAGACATGAGACTAATTAGCTCGCTCATCACGAGTGGAGTCTAATGATGAAAAGTCTATGCATGGAAAAGAATAGTATTAAAGCGATAAAGCCAGCCATATAGCTCTGAATAAAAAAATAATATATTTCATTACATCCTCCGGTGAATACAAATCTAATAAAACGTCAATGTTATTTCCGAACACTTCATCTTACATGTGTTTCTAAAGAATCATTAGACCAGTCTTGGCAGTTTTTAATGGCCCTAAATTTATAGGTGTGAATATATCAGGCAATACAGAATAACACTTGGCCTTACCTCTTTAAACTTCCCTTTTAAACGATTCTCCACACAACTATTAATCGGTTTCAACGGGGTCACAACGGCCAGCAGCTTCTTTTGTATCGTGCCTTTACCTGGCTATAGACCATCTCCTTTTTGATTCTCCCCGTTGGTCTTGTTACCACAAGGCATAGTCCTTTACCATCTGGGACACAAAGATATTGATGATAGAACGGATTCCCCATATATCTGGACCGCTTCTTTCACCAGTTCCGCCCATTGAATGCAGTGGCTTAATGCATTTTAGTGTTTCTAATCCTAATGGATCTATATTTGAGATCGGATTCAACGGATACTGATAAGAAATTCATCCCCTTTCAGCCCAATCGGATCTGGTGATATATCGCCCTGCAGCGGGTCATAATAGCGGTGGCGGTTGTAATACCAGGCCGGACTCCTCATCATACTGCTGCCCCGGCAGTGGATAAGCTGCTGCAGCTGATGCAGGTTCTCTTCATTCAGCAGGTTACCCCATTCATCGTATTCTGCGTACCACGCTGTTGTCCCTTCCGTGCTGATAAAGGGCCAGCGGCAGGCCGCGGTGATAGTCACTGATGGTACAGGTGATTTTTCGCGCCGGCGATAATACCGGGTCCATCTGGCTTTGCATCTGCGCCACCGTCAGGCCGCACGATGCCAGCCAGCAGCGGCTTTTCATCACTCACGGTCAGCCAGAGTTTTCACTTTCCATGGTCGAGCATCTGCACCAGCACCGGCGGGAACACCACACTGCCACCGTCTTCGCCACCGGACTGCTGAAGGGTATCCGCCAGGCTGCGGCGCACAACGTTTTCGCCAGCTCACCGGTGGCGGTTTCAGCCTGATGAGTGGCGTGAAGCTCCCCGGCTGATAAATCGATCTGGATGCAGGTTCTGTCGTTCTGTATCGTGGTCAGGCGGTCATGTCCCAGCCGTACCAGTCCTTGCGGTTTCCCGTGACAGCGACATCCAGCCGTCAGGTCCCGTTCACGCCGCCATGCCCGTTTGCCACCCTGCGGCCCAGCGGGTCGTAAAGATAACGACTTCCGACCAGCGGCTCTGCATATTGTGTCGCGTGTAGTGCACCAGCCGGTGCTGACTGTCATGTCGTACCGGTAGATTGCGCTCATCATCCGTGCGGATGCCCTTCCGGGATGAGGTCGGTTTCTCTGTCAGCCTGCCGTGACGGTCGCTACCGGTAAAGATAGTGCGCGTCACGGGCGATACGGTTATCCGGCCACATGCTGAGGCGCTGTCGATTACTGCAGCTCCGGGTCGGGCAGGCGGTTACCTGCCGGAGTCTGTGGTATACGGGATGCGGATATCCAGATTCGCTGCGGTGGTGTGAACGCCGGTCAGCCTGCCGATGGTGCTGCTGTAGCTCCAGGTCTGGCGCGGGCTGCTGATGCGGATGAGTTCGCCGTTGTCGTTCCAGGTGTAATCGCGGTCAGACAGCAGGCTGTTCAGGTGCTGGCTCTGTAACTTTGCCCGGCAGGGTATAAGCGGTGGTGAGTTCATAACGGCCGAAGCTGCGCAGCAGCGTTCCCAGTGCAGGCGGTCGCGGGTGTACTCCACCAGCGGTGTGTCACTCCGAGTTTCATGCCTGACAGCCAGCCGCTGCCGTAGGTCAGCCATTCCACGGCGGGCAGGCTGTGTCGGTATACAGCGATTTCGCCAGTCCATTGCGTTGTACGCATGTCTGGTCTCATGCTGCCAGAGCAGTTCATTCGTCTGCGGATGATGCACCGTCAGGTGTTCACTGGCAGGCGGCCTTTACTGTCATAACCATAATTGCACCGTCACCCGGTGCCAGCTTCGCTGATATGGCTGATGTCTGTCAGCCAGCCGCGTTCGTCATACTGCCACCGCTCCTGCGAGTTTCGCCATTCACGGTGCGGTGCGTGAGGCGGTCTGCTTCTCATAGTGCCAGTGGGCGATGGCCCCTCATCCTCGCTGCGGATAAGTTTGCCGGTCGGAGTCATTGGTGATAACGCTGTGTGCGGCCGTCAAAACCGGTTTCCTGTATCAGCCGGTCGAGTACATCGTAACGGAAGTGGGTGTAGCCGCCGTTTTCACTGAATCAGGCGGATGACCCGATCAGCAGCATCGTATTCCATACTGCGCGTCAGACCGCCCGCCGTGGTACAGATGGCTTTTCCCCACGCATCGTACTGTGTCCGTTTCTGCTGCCGTCCGGGAGCGTGACGGTGGTCAGGTCACCGGCGGCGTTGTATTCATACCGCGCGTTTCATGGCCCTGCGTGTCTTTCACGGCAGTGCTGTCACGGCTGTCGTATGCGCGGTACTGACTCAGCGCTTCATCGCGGTGCCGCCATCACCTGACCGAAACGGTCATGGTCATAGCGGGTTACATAACCGGAACAGTCCAGAGTGAAGCTCAGCAGCTGACCATCAACGGCTCCACGTCATAATGGTTTCCGGCTGCGGTGGCATCTTCCGTTGCGCAGGGTAAGTCATAATGTGGATTATCATAACGGTAGCGGGTGATATCGCCGTCAGGGGCGATTTCCTGAATCAGACGGCCCCATTCATCATATTCCGGCGTATTTCCAGCCCGTCAGGCCCGGTGGCTGACGTTAACTGGCTGTGGTGGTTATGGTAAAACGCCGATGCCCTGCCATCCGGCGTGGTGATGCGCGTGATGAGGCCGTCACCACATCCGGACTGTATTCTGTTGTCCTGCCTGCGGCATCCGTCTGTGCCCTGAGCCTGCCCACCGCGTCAAACTGACTCTGCGTGACGCTGCCGTCCGCGTGTTCCTTTTCACCACCCGCTTCAGCCCGCCTTCACCCTGCGTGTGCAGGACTTCACGGCAGTTCCAGGCTGTCGGTGATGATGATGCAGTCCTTCATACTGACCATGTAACCAAGCCTGCCGGGTTTTAGCTGTTCTGTCACCCGCCCGTCGCTGTCGCCAACGACAACAGATTTCGGTCGGCCCGTGTGACGGTGCGCCACCATCCGGCCCCGGTATTTATCATCGTAAGTAAAGCTGCGCACCTGTATTATTGCTGCGGTCGTTTTACCGCCGCCAGTTCGCCGCAGGGCGGTAATATAGCGCACCAGCGGCGCGGCAGGTAAATTCTCCGGGTATTCCGGGTCGTGCGTCAACCACGGCAGACAGACGGATGCCGTTGTCAGCCATATTCAGGTGTAACCCGGCAGGGTATCAGGAAAAGCGGACGGTTCCGTCCGCCGGAAATGGCCTGCTGCCGGGCTTCTTCTGCCCGCTGCGCCTGCGTGGTCAGTACCAGCCGGAAGTGACGCCCGGCACCATCCGTCACGCCGGTGATTTCGCCGCTGAATTCACCGGCGCTTCACTGATGGAACGTCTGTGTGCGCCCGAAGCGGTCCGCAACCCGGTCAATTGCCAGTACGGCGGCAGCGGCGCAGGCAGCACCTCATCCGCTTCCGGCACCCGCTCACACCAGCCGAGCAACCACCACGGCCTGCGGACTGTTTGTCGCCAGATAACGATGCGGACTTAAGCGGAGTTCTTCCGGCAGCGCCTGCCCGGAGTGCGGCCAGCCGGTGACCTTCATCCAGTTTCGCCACGCCGCCGCGCGCAGCCACAGTGACTCGCTGCGGCTGTAACCGTCCTCACCGGAAACAGGTGCTCAAAATGCAGGCTTCTGCCGCCGTTATCACTGAGTATCGGTGTGTTATCGCGCAGCTGGCGGATATCCGCAGGCATTTTCAGCCGGGGCCGAGAGCTCCCCACCGGCGCGGGCGTTTTTGTCGGTAACTGCTGTAGGTGCGGGAAGAATGAGCGGCAGCGGGCCGGGCAGGGCGATGTCGGTTTCACCGAGGACCTTTGCACCGAGCAGTTGACCGGATGGCCGGACGTCACCCCGCCGGGGCACCAGAACGAGCCACGCCGGTAGGGCACCGATGCGTACCCCGGCTGAACCCTGGACAATGCTACCGCCATGCTGCGTCGCTGTCGCCCTGACGCGCCGCCGGTTTTCCGCTCATCCTGCTCATCCTTGTTTTATCGGGTTTATTTGTCTGCTTTGACAGGCGAAACCCTACAGATTTATAAAGAAAGCCTTAAGTGAGATATCTGTCAGATGAACAATTAGGAAAATGTTATATATATTTCATGAATATATGTTTCGATTGGTATAACGATGTCTAAATATTCCTCTGAACATCTTCTGGTCTAAAAACCGCCCAGCGTTTCGCTGGCGGTTTTTTCAATATTCAAAACTCAGCAAATCGTAAAAATCCCGCAGTTGCCTTTCATTTTCGATCCATCCACCGGTTTATCGCTGGTTTCGACCAGACGCGATGCAGGTAGCTGTAAAAGCGGGCGCGAGTCTTTTCCGAAAAGCATGAAGGCAGCGCCAGAACGCCCGCTGCAACCGCATAAATTGCACGGCGTAAAAAGATAAGCCATGCGGGATATTCTGGGGTTCATACTTTTCTCCCCTTTTGTATCTACCCGGTGAATGGCACCGGAAAATGAATTGTTTATCTGATGAAAATAGTAGTACCGCCTTTGTGTAGTTTTACTACTCATCCGACCACTTATTTTGCTTATTGATGGTTTTATTTACATTTCATCCATAAATTAAAGTTACACAAAGTTAAATTAATACTAAGCATTAGTTAAATCATGGCTTTTGCCATTTTTATACTTTTACACCGCCCGCAGATTTTTGCGAAATCTTTGCAGCCAGAATTCTACCCTTCGGTATCACTTTTTAGGCCACTGGGTGCTGTGAGTGCAGGCGGCGATAACCGGCGTATTGCTGGTGTTTTATTACTGGGTTATCTGGTTTATGCCTGATCAATGCGGGAGGCGTTCTGATGGCTGCGCAAGGGTTCTTACTGATCGCCACGTTTTTTACTGGTGTTAATGGTGCTGGCGCGTCCTTTAGGCAGCGGGCTGGCGCGGCTGATTAATGACATTTCCCTCTTCCGGGTACAGCGGGCGTTGAGCGCGTACTTTTCGCGCGCTTGGCGTCTGACCGTGGATGAACTGGAAGCAATATCTTTGTGCCATTCTCGGCTTCTGAACATGCTGGGGCTGGCGGTGCTGTTTTTATGTTGCTCGGTCAGCACTATCTGCCGCTTAATCACAGCAGTTGCCAGGGCTGTCGTGGGATCTGGCGCTGAATACCGCCGTCAGCTTTGTCGCAATACCAACTGGCAATCTTATGGCGTTGAAACCACGTTGAGCTATTTCAGCCAGATGGCGGGCTTAACGGTGCAAAACTTTCTTTCTGCCGCCAGCGGGGTGCGGTGATTTTGCCCTCATCCGTGCGTTTACCCGCCAGAGCATGAGCACGCTCGGGAATGCCTGGGTCGATCTGCTACGCATCACGTTATGGGTGCTGGTCCTGTGGCGTTGTTGATTGCACTGTTTTTATTCAACAAGATTATAGCTGCAAAACTTTCTGCCTTATCAGGCTGTGAATACCGTTGAAGGAGCGCAACAGCTGTTACCCATGGGGCCTGTGGCTTCTCAGGAAGCGATCAAGATGCTCGGTACTAACGGCGGTGGCTTCTTTAATGCCAACTCGTCGCATCCGTTTAATAGCCGCACTGATAGCCGTGCAGATGCTGGCGATCTTCTTGATCAACGGCGCTGTGCTTTGCCTTTGGTGAAGTGATGGGCGATCGCCGCCAGGGGCGCATGTTGCTGTGGGCGATGTCAGTGATTTTGTCATCTGCGTAGGCGTGGTGATGTGAGCCGAAGTTCAGGGTAATCCTCATCTGCTGGCACTGGGCACGGACAGCAGCATCAATATGGAAGGTAAAAGAGGCCGTTTCGGCGTGCTGGTCAGTAGCCTGTTTGCGGTCGTGACGACGGCGGCTTCCTGTGGCGCAGTGATTGCGACATGATTCGTTTACCGCTCTCGGTGGCCATGGTGCCGATGTGGCTGATGCAAATTGGTGAAGTGGTGTTCGGCGGTGTCGGTTCTGGTCTTTACGGCGCGTGATGCTGTTTTGTCCTGCTGGCGGTGTTTGTGCCGGGCTGATGATTGGTCGTACACCCAGATATCTGGAGTCAAAAAATCGACGTACGCGAGATGAAACTGACTGCTGGCGAATTCTGGATTTACCCGACGCTGGTGCTGATGGGCGCAGCGTTGGCGATGATGACCGACGCCGGACGTAGCGCCATGCTCAACCCTGGCCCGCATGGTTTTAGCGAAATTGCTGTACGCGTGTCATCCGCCGCTAACAACAACAGCGCCTTTGCCGGATTAAGCGCCAACTCTCCGTTCTGGAACTGTTTACTGGCGTTCTGCATGTTTGTCGGTCGCTTCGGGGTGATTATCCCGGTGATGGCAATTGCCGGTTCGCTGGAGTGAGTAAAGAGCCAAGCCGCCAGCTCCGGCACGCTGCCAACGCACGGCCCGCTGTTTGTTGGCCTGTTAATCAGCACCGTGTTGCTGGTTGGCGCTGACGCTATCCTGCCCTGGCGCTTGGTCCGGTGGCGGAATATCTCTCCTGATGATATTGAGTGAGCACTGAATATGAGTAGGTTAAACACCCAAGCAGACGCCGAAGATGAAGAACGCG
+>5c46f248-1989-4a1e-bdf7-265af033510b
+TTGGTATGCTTCGTTCCGGTTACGTATTGCTCTGTGGTATACGGGATGCGGATATCCAGATTCGCTGCAGTGGTGTGAACGCCAGTCAGCCTACCGGTGGTGCTGTAGCTGTAACCCGGGTCTGGCGCGGAGCTGCTGATGCCGTGGAGTTCGCCGTTGTCGTTCCCGGGTGTAATCGCGGTCAGACAGCAGCAGGCTGTTCAGGTGCTGGCTCTGTAACTGCCGGCAGGGGTATAAGCGGTGGTGAGTTCATAACGGCCGAAGCTGCTGGCGTTTCCCCTGTGCAGGCGGTCGCGGGTGTACTCCACCAGCGGTGTGTCATCGAGTTTCATGCCTGACAGCCAGCCGCTGCCGTAGGTCAGCCTTCCACGGCAGGCAGGCTGTCCGGTATACCCAGCGGTTCGCCAGTCCCTGTGCGTTGTACGCATGTCTGGTCTCATGCTGCCGACGGATTCGTTCGTCTGCGGATGATGCACCGTCAGGTGTTCACTGGCGAGCGGCCTTTACTGTCATAACCATAGTGCACCGTCACCCCGGGTGCCCCTTCGCTGATATGGCTGATGTCTGTCAGCCAGCCGCGTTCGTCATACTGCCACCGCTCTGCGGTTTCGCCATTCACGGTGCAGTTGCGTGAGGGCGGTCTGCTTCGTCATAGTGCCCGGTGGGTGACCAGCCCCTCATCCTCGCTGCGGATAAGTTTGCCGGTCAGGTCGGTGATAACGCTGTGTGCGGCCGTCAAAGCCGGTTTCCTGTATCCAGCCGGTCAGGTACATCGTAACGGAAGGTGGTGTGGCTGCCGTTTTCACTGGTCAGGCGGATGACCCGTCCGGCAACATCGTATTCCATACTGCGCGTCAGACCGCCCTGCGCATTAGTACAGATGGCTTTTCCCCACGCATCGTACTGTGTCCGTTTCTGCTGCCGTCGGGGCAATGACGGTGTGGTCAGGTCACCGGCGGCGTTGTGATCGCCACCGCGTTTCATGGCCCTGCGTATCTTTCACGGCAATTAACTGTCCACGGCTGTCGTATGCGCGGTACTGACTCCAGCCCTTCCTCGCGGTGCACCGCCGTCACCTGACCAAAACGGTCATGGTCATAGCGAATTTACATAACCGGAGACAGTCAGTGAAGCTCAACAAAACCGTAACAGCTTATCCACGTCATGGTTTTCCGGCTGCCGGTGGCATCTTCCGTTGCGCAGGAGTAAAGTCACTGTGTAGTTATCATAACGGTAGCGGGTGATATCGCCGTCAGAGCAGTTTCCTGAATCAGACGGCCCCATTCATCATATTCGGCGTATTTCCAGCCCGTCAGGCCCGGTGGCTGACGTTAACTGGCTATGGTGGATTGAAGTAAAACGCCGATGCCTGCATCCGGCGTGGTGATGCGCGTGGTAGGCCGTCACCACATCCGGACTGTATTCTGTTGTCTGCCTGCGGCATCCGTCTGTGCCCTGAGCCTGCCCACCGCGTCAAACTGACTCTGCGTGACGCGCTGCCGTCGCGTGTTCCTTTTTGCCACCCGCTGGCCCGCCTTCACCCTGCGTGTGCAGGACTTCACAGCGGTTCAGGCTGTCGGTGATGGTGATGGATCCATTCTCATACTGATACATTAACTTCAGCCTGCCGGGGTTTAGCTGTTCTGTCACCCGCCCGTCGCTGTCGTAACGGTAACAGATTTCCGGTCGGCCCGTGTGACAGTGCGCCACCATCCGGCCCCGGTATTTATCATCGTAAGTAAAGCTGCGCACCTGTGTATTGCGGTCATACACGCCGCCAGTTCCGCCGCAGGGCGTCCAGCCATAGCGCACCAGCGGCGCGGCAGGTAAATTCTCCGGGTATTCCGGGTCGTGCGTCAGCCACGGCAGACAGACCGAGGATGCCGTTATCCCGGCACCATATTCGGTGTAACCGGCAGGGAGTATCAGGAAAACGGACGGTTCCGTCCCGCCGGAAATAATGGCCTGCTGCCGGGAGCTATGCCGCTGCGCCTGCGTGGTCAGTGACAGCCGGAAGTGACGCCCGGCACCATCCATCCGCCGATGATTTCATACGCTAATTCACCGGCGGCGGCTTCCGCGGTGGAACGTCTGTGTGCGCCGAAGCTGATTCACCAGCCCGGTCAGTACCCGGTACGGCGGCAGCGGCGCAGGCAGCACCTCATCCGCTTCCGGCACCCGCTTCCACACCAATGAGCAGCACCACGGCCCCTGCGGACTGCTGACCATGATAACGATGCGGACTTAAGCGGGTTCTTCCGGCAGCGCCTGCCAGTGCGTATGGTGACCTTCATCGATTTCGCCACGCCGCCGCCAGCCACAGTGACTCGCTGCGGCTGTAACCGTCCTCACCGGGAAACAGGTGCTCCAAGTACAGGCTTCTGCCGCCGATTTATCACTGATATCCGTGTGTTATCAGCGCAGCTGTAAGCGGATATCCGCAGGCAGCATTTTCCAGCCGGGGCCGAATCCCCCACCGGCACCGGGCGTTTTGTCAGTAACTGCTGTACCGTGGGCGGTGCCAAACACCGGCAGACCGCCGCAATATCGGCACCAACAGAAAAGCAATACGTAACTGGG
+>b1594985-30ce-4f59-9230-dff6ec966710
+TTGTTATTGCTTCGTTCAGTTACGTATTGCTGCTTGCGCAATAACTCTATCTTCGGCGTCTGCTTGGGTGTTTAAGCCTGTAGCGGTATGCTGTCTCCCCGCTTTGCGCGATGTCTCGATACCAGCCTGCCCGGTTCATCATATTCCCCGGCGGCTCTCAGCCCGTCAGGGGACACCACCGCAAATCAGCTGGTTCGTCGTTATAGTAAAATTTCGTCTCCGCCCGTCCGGTGTGGTGATGTCCGTGATATCGCGGACACCACATTCAGACCATTACTCTGTCCTCCGTCGCCGCGTCCGTCTGCGCCGTGAGCCTTCCTGCCGCGTCATACCCGCTGCGCGTGACGCTGCCAAATCCGCCATTCTTTTTCACCACCCACGTTTCAGCCCGGCCCCGCCTTCTGTATGCAGCACCTCACGCCGGTTCAGGCTGTCGGTGACGGTGATACGGTCCTGCTCATAAAGATAGCGGTAACCCAACCTACCGGGTTCAGTTGCTCCACCACCGCCCCGTATCCACGTCGTGGCAGCGCATCTCCGGCCTTCCCGTAACGGTGCGCCACCATCCGGCCAGGTGCTGCACGTCATGCAGTGAAAGCGCGCACCTGCGTATTGCTGCGGTCATATACCTTCAGTTCACCGGCTTCCCGACATGCGTGTACCGCACCAGTGGCGCAGCGGGCAGGCTCTCCGGGTATGCGGGTCGTGCATCAGCCACACCGCCGAAGGCGGATACCCTGTCGGGGCCGTATTCGGTACCGGGCAGTGTCGAGGGAACGCTGAGGCTGAGAGAGGGCGGGAACTGTCAGAAGAGGAATGGCGAAGAGGTCGGGCCTCTTCCGCACGCTACGCCTGCGTGGTCAGCACCAGACGGAACTCCGCCCGGCACCGTCCGTCACGCCGGTGATTTCCCCGGCCAAGGTCACCGGCGGCCTCACGCCGGTACGTCAGCGATCCGCCAAGCGGTCCGCCATCCCGAACAGCACCCGGTACGGCGAGCAGCGGCGGCGCTGGCAGTGCGATATCAGCACCCGGCACCCGCTCAGACCACCCCAGTATCCACCACATTTTGTGCGCTGTTGGTCGCCAGGTAAGATGCGGATAACCGGATATCCGGCGGCAGCGCCCCACAGCCGCGCCAGCGTATGGCCGTCCGGCTGTGCTGCCTTACCACCGCGCACCAGCCACGTGTTTCCTGCGTGGTACACCGCCTCTGGCAGCAGCGGCTCAGTGAATGCTCCGCCCGCCGTTGTCGATTTGAGTATCAGTCCGTCATCACGTAGCTGTAAGCCTTGGATATCAGAAGGCGCTTTCTCCAGCCGGGCCAGCAGCCCACCGGTGCAGAGCGTCTTCGTCCGGTAGCTGCTGTAGGTGCGGGAGAGAATGAACGGCAGCGGGCCGGGCGGCTATGAGTCCGTCTCGCCGGGCAACACCTTCGCCCCCAGCAGCGGATTTACCGGGTTGCCCGAAGTCATCCCGCCGGACACACCAGGCACGCCACGCCGGTGGGCGCGCCAGTCTTACACCTGCCGAACCCTGGACAATGGGACCGCCATACTGGGTCATATCTCCTGACGCGCCGCTGGTTTTCCGCTCATATAAAGTGCTGCCCGCTTTTAGTTATTGTTCATATCCTGTGTTGGCAACAAAAAATAAAATGACACACAAGACCAGCTAATGTATTGCTCTCTTTTCATAAACTTATTTTGTTCTCCAATCAACAACAACTGTTATTACAGGTCACTTTCAATATTTTATTAAGCTAACATTTTTTAGCACAGATGAATTCATCATCCAGCAAATTCACTATATGGATAATATCCATTCAGCACATTATGATTTATGATTTTATTAGTCTGAGTTATTTTGTAGGGCTATATTTAAATCAATAAAACTCCACCGATTCAGATTAATATCAGCAATAGAAGATGAAATCACCAATTCAATAACATCATCAATGAAGAACATATTGTAGAATTAATTTAAACAAGGCGTTCCATTCAACCAAGAACGCCCCTTATTTACTCTCATCACCCGCAAACTGCCTGAACAGCGCCTTACCCTTAACCAGTCGCGCACCCAATAAGCCGCCAGCGACAGCAGCAGCGCGCTCCGCTGCACGGCAGAACAATCCACAATCGCCAGTCTGGCTTCACGGAAAATCGACACTTTCGCCTGCAACACTGCCAGCGCCGTTTCCGCACCAATTGCGGCCACCAGGCCAAAACAAACGAAGCATGGCGAACTCACACCTGGCGTGGTACGCAGCAGTTTTTTCCCGCACCGAGTGTGCGCCACACCACCAGCTCCTGATGACGCTGACGCATTCCCACCTGCACCTGTGCCAGCAACAGCAACATACCGCAGGCGGTGACCAGTACCACCATCACTTCCAGCGCCCGACTTACCTGCTCCAGCACCTGACCGACCTGTTTTAAAAATCGCGCCAATATCTAACAGGCTAATGGTCGGGAACTGGCGGTTGGTTAATGTCAGCTTATACCGTTGCCATTCTCAGCGGAAACTGGTAAGCCAGCTCTGCGGTTGTTGCCCGTCTAATGCCCCTTCGGGAAAATAAAATAGAAATTGGGCCGCAGACTTTTCCCAGTCCACTTTGCGCAGGCTGGTCACTTTAGCGCGGAACTTCCCTGGGTATCGCCCATACAAAGTCACGGTATCACCGAGGGCAACGTTTAAGCGTTTCGCCAGCCCCTCTTCCATCGACACTTCATCGGCTTTTGGCGGCCAGTTACCGGCGACAATCGGATTATGATCCGGGCCGCGCGTATTTTGCCAGGTAAGATTGAGTTCGCGGTTAAGCGCCTCATCTTCATTACACCTTCTGTCGGCTTGTCGTTAATCGCCGTCAGCCGCCCGCACCACCGGATAAAACGATTCGGGACTATCTGATGTTCCGCGAGGAACGCTTTAGCGGTGCTACCTGTTCTGTGGCGATGTTAATTAAAAGTAGTTCGGGAACTTTCTGGGGTAGCTGCTGCTGCCTGCAGCGGTCGAACAGATCGCCACGCAACACCAACAGCAGTGCCAGCAGCATAAGGAAACGAAAATGCCGAAAGCTGACTTAACGTTGACCACGGCTGACGTAACAGACGGCTAACCGCCAGACGCAGAGGCAGCGATTTCAGCGTCATGCGGCGAAGTACATTCAGCGGCATCCAGCCCAGCACACCGCACAGCAAAGCCAGTACTACCGCGCCCGCCAGCACCGCCCAAAGCGGCATGCTGCTGATAATCCGGCAGGCAGCAGCACCAACCACCACACTGACAATCGGCAGATAAAACTTCAGCGGCCAGACGTTTCGCTACCACATCATTACGTAATACGCGTAAGGCTGCGTTGCCGAAGCCAGCAAGCGATATGGTCGTAGCCCCCACCAGCAGCAGGATGACCGTCGTAGTTGCCAAGCGCCCTGGCCACGGCCAGAGGCTGGCTGGCGGTAGTGCAACAGGCAGAACGGAGAAAGGAGGCGGGCAGCACCATCAACACGTTTTTCGAACAACGGGCCTATGGCCCCACCGGTAACGGCTGAAAGCGTCAGCACCATCAACCACTGACCGACGATTGGCTTACGCAGTTGCGCTCGCCCTGCCCCAGCGTTTGAGGATCGCCACAGATCGTAGCGACTGCGACAGTAATGATTCATCGCTACCGCCACCGCTGCCACTGCCAGCAGCAAGGTCAGAAGCGCCAGCAGCAGGAACTGTGCGACGTTCCATCGATCGCCCAGCGCGCCTTCGTCCTGTTCAGACCGTACCAGCGTTGATTTCGGGTTTAAGCTGGGGTAACGTAACCATTTCTCATAGCCGTCGAGCTGGTTCTCATTTGCCGCCGAATTTATAACGCCAGGTGACCCGACTCCCCGGCTGCACGGCTCCGGTTTTTTATCGACATCCGCCAGATTCATCATCAGACGCGGAGCCATCTGGAAGGGTTAAAACCGGAATCCGGTTCCTGAATCACTTCTCCGGCAATCCGCAGGTGGCGTCGCCCGTCAATGAGGAATTGTCGCCCGTTTTTTCCGGGTTAAAAAAGCAGAAGTGCCATCAGGCGTGGGCCAGCAATACGCTGCCCGCCTGCGGTTTCAGGCCAGGGGATGGTTGCAGATCGCCATACATCGGGTAGATATCATCCACCGCTGACGTTCGCCAGCTGCGGTGTGTCGCCTGCAAAGGTCATTGTGGCGAAAGTCCGGCTGCTGCCGACTTTCAGGCCGCGCTTTGCGCTTCCTCCAGCCACGCTGCGGCACTTCACGCGTGAACCGCAACGCCCGATCGCCCGCCATAAACTCACGGCTTTGCTGGCTTAAGCCCTTCTCCATGCGATCGCTGATATTGCCCCAGCGCCAGCACGCAGGCCACCGCCGGAAGCTTAGCGCCAGCCAGACAATTAATAGCGACGGCGAACGCCATTCGCGCCAGAACCAACGATGCAATCATGCTTCCTCTGCAACTGCCCGTTCACCAGCCATGAAAGCAGCGGTCGCAGCGTGCCGCCAGTTGATTGCGGTGTGGAGTCACCATAATCAACGTGGTGCCATGTTCACGGTTGAGGAAAACAGCAGGTCCGGCAATTTTATCGCCCGTCTGGCGGTCAAGGTTGCCAGTGGGTTCAAATCGGCAAACAGCATCAGGTCGACCATTAAAGGCTCGTGCCAGCTCTTCCTCGTTGCTGTTCTGCGCCGGAAAGCTGTGCCGGAAGATGATCAGACGTTTACCCAGCCCTAACTGTTCGAGCAACGCTTTCGCCCCGTTACGACTTTCCGCACTTTCTCACCGCGCAGCAGGGCGGAAGCTCGACGCGTTTTCAACGCGTTAAGGTGGGAATTAACATAAATGACTGAAAAACAAAGCCGACGTGCTTCGCGCGCAACTTTGCCCGCTTCTTCGTCCATATTAATGGCGGTTGTCCCACCAGACTCACTTCGCCACTGCTGCCGTCATCAAGCCCGGCGAGGATCGCCAGCAGCAGGTTGACTTACCCGATCCCGACTCGCCCACCAGTGCGATGGTCTCGCCGTTTGATAACCAGCTCAACTCCGGTGAGGATGGAGAGTTCATGCTCCCCTGACCGACGGACCTTAAGATGATGAACCAGCAATGTTTTCCCGCTGGCATTTGCCCTTCCTGTTCCTGGTCACCATTAACCTTCCGTGCCGCCGCAGCGGCCGTTATTGATTCTGGGTGATAGCCTGAGCGCCGGGTATCGAATGTCTGCCAGCGCGGCTGGCCTGCCTTGTTGAATGATAAGTGGCAGAGTAAAGAGCATCGGTAGTTAATGCCAGCATCAGCGGCGACACCTCGCAACAAGGACTGGCGCGCCTTCCGGCTCTGCTGAAACAGCATCAGCCACGTTGGGTGCTGGTTGAACTAATGGGCAATGACGGTTTGCGTGGTTTCAGCCACAGCAAACCGAGCAAACGCTGCGCCCGGATTTTGCAGGATGTCAAAGCCGTAACGCTGAACCATTGTTAATGCAAATACGTCTGCCTGCAAACTATGGTCGCCGTTATAATGGAAGCCTTTAGCGCCATTTACCCCAAACTCGCCAAAAGAGTTTGATGTTCCGCTGCTGCCCATTTTTATGGAAGAGGTCTACCTCAAGCCACAATGGATGCAGGATGACGGTATTCATCCCAACCGCGACGCCCAGCCGTTTATTGCCGACTGGATGGCAGAAGCAGTTGCAGCCTTTAGTAAATCATGACTCATAAAGCAACGGAGATCCTGACAGGTAAAGTTATGCAAAAATCGGTCTTAATTACCGGATGTTCCAGTGGAATTGGCCTGGAAAGCGCGCTCGAATTAAAACGCCAGGGTTTCATGTGTGCTGGCAGGTTGCCGGAAACCGGATGATGTTGAGCGCGCGCAGACAGCATGGGATTTACCGGCGTGATCGATCTGGATTCACCAGAAAGTGTTGATCGCGCAGCCGACAGGAGGTGATCGCCCTGACCGATAGTGTCTGTATCGGGATCTTTAACAATGCCGGATTCGGCATGTATGGCTACTTTCCACCATCAGCCGTGCGCAGATGGAACAGCAGTTTCCGCCAACTTTTTCGGCGCACACCAGCTCACCATGCGCTGTTACCCGCGATATTACCGCACGGTGAAGGGCGTATTGTGATGACATCATCGGTGATGGGATTAATCTCCCGCCGGGTCGTGGCGCTTACGCGGCAATAAATATGCGCTGGGCGTGGTCAGATGCACGCATGGAGCTGCGCCACAGCGGAATTAAAGTCAACCTGATCAGACGGTCCCATTCATTGCTCGCTTCACCGACAACGTCAACCAGACGCAAAGTGATAAACCAGTCGAAAATCCAGCATCGCCGCCGCTACGTTGGGACCGGAAGCGGTGGTGGACAAAGTACGCCATGCTTTTATTAGCGAAGCCGAAGATGCGCTATCCGAGGCGGCGCTGTTGACCTGGGCGGTAATGTGCTTAAGCGCCTGCTGCAGGGCGCGTGATGGACAAAATATTGCAGGGGTGAAGGTTGGAAGCGCGCTTAAAGCCCCATGTCAAAGAAAATATCGACAACAGAGAGCGACTCCATGTCCGTAGAAAATATTGTCAACATTAACGAATCTAACCTGCAGCAGGTTTCTTGAACAGTCGATGACCACTCCGGTGCTGTTTCTGTTTTGTAGTCGAACATGTAGCACTGTTTGCAGTTAACCCAATTCTGGAAAGCCTCGGCGCGAACCGCAACGAACCAGCTATTCTGGCGAAGCTGGACTGCGACGCGGAGCAGATGATTGCCGCGCAGTTTGGTCTGCGTGCGATTCCGACCGTGTCTGTTCCCAGAACGGGCAACCGGTAGATGGCTTCCAGGGGCCGCAACCGGTTGCCCGTTCTGGAACAGATACGGTGGAATCGCACGCAGACCAAACTGCGCGGCAATCATCTGCTCCGCGTCGCAGTCCAGCTTCGCCAGAATAAATTGCCCGTTGTACTGCCGCGAGGCACCAGAATTGGGGTTAACTGCAAACGGTGCTGGCGTTCAGACCAAAAACAGAACAGCACCGGGTGGTCATCATTGTTCAGAACCTGTTGCGGGTTAGATTCGTTAATGTTGACAATATTTTCTGCGGACGTAGGTCGCTCTCTGTTGTCGTGTTGCCTAACGACATGAGAGAAACTAACGCTCACCCTACCCGGCTGAGCGCTCATACCGCGCCAGGCTGGCGTACATCACCAGATAACACCATCGCTTCTCACAATAAACATGGCGTCGTAATCACCACCGATTCTGGCGCAACGGCGGCTGTCTCGAACTGGTTATCACTTGCGTCTGTTGATTGTCGGTAAGTACAGGCAGAGACCGAATTCGATCGAGCTGACTTTATTCGCCAATGACTTTATCCTGTTTACGCCTCCATATTACTGACCGCGTAACATACACGACTTAACGATGAAGATATCCATCACCGACTGATAAATGCAATACGCCCTTTCATAAATTATCGCGGTAATGGCACGTAATTAACTGTTATGCGCCGAACCGGCGGCTGCGCACGGCCGAATCCACGTACATTGATCCCATACAGGCACGTCGGGAACGATAACTGCGCGATCAACTACTCTGTGAATCGAATCGTCGGCACCGGTAAATCATTCATGCGGCACAACATCATCCGATTTCCGGCTGCTCTACCAACATGGCGTTCGTCGAACGCTTCCTGGTGATAATTGAACCGTTACCATATTTACCTGTCGAGATAACTCCGTTGCTGTAATTACTAAAGGCTGCAACTTTCGCCATCGATCAAACCGTGGCTGGGCATTCTCCGGTGATTGAATGAATACCGTCTTCCGGCTCCGACCCGGCGAAGGCTCTTTCCAGCAAAAAGAACGGCAACGAACATCCAGTTTGAAATGGCAGCTAAAATTTCATTATAACGGCGACATATTTCAACAATGGTTCGGCGTTGGCGGCGCTGACGTCTGCAAAATCTGGCGCGGCGTTTGCTTTCGGTTTTAGCGTGGCTGGCTCGCGCAAACGCCCGGTCAACGGCACCCAACGCGGCTGATGCTGTTTCAGCTTGAGTCGCATTAACAACACTGGGCGTTTTTCACTCTGCCGCCCATCATTCACTGAGCATTTCCTTACGCGACGAGACGTCGACACCCGCGTATCTCGCGATAACTCAACGTGTCGCTGCTGTTGTCTGAAGGTGCTTTGGACCGAAGGCGAAGAGGCGAAATGCCAGCGAACCGCTGTTGAAGTTCGTCGTCTTGAAGTCGTCGGTCGAGAATGAACTCCGTCACCGGAGACGCGTAACGAACATCGACCAGATCATGCTGGCGTCTCACCGGGCTTGACTGTTTGGCGGCGTGGCGAGAAATCTGGTGGTTTCTTCGCTACGCCAATGGACGGCGCGAACTGGCGGCTTACGTCGACTTTGTTTTCGTCATTTATGTTAATTCTACCCATGCACGCTGAGCGTCAAGGCGGCTGCTGCGCGCGGAAGGAATAAACGACGGGCAGCCTTAACTCGGCACGGTGAAACTGGTGGATATCTTCGGCAGTGACGCTGGCTGGCTGATATTAACTGTTGCCGACGAAGACCACCGGCGGCCTTGACCGAACGGCATTAAACCACCGACTACTTCATTTTCCCTCGACAGAAATAACCGCGTTATCGACGACCCACGACACGGCTTCGGCACCTTTTGACGACATGTACACGTTAAGCCGTCATCAACAGTGAAACGGCGCTAACCTGACGCGTTGACGGCGCTGGTATCATCTGCGAGGGCAAGCATGAAAACCGTGGCGGGCGTCGGCGTTGCTACGCGAGAGACGCGCAACGTGGCTGGAGAAAGCGACCTGAAACGAAGCAGCGATTTCGCCGTTTCTGGCTGCTTTGCGGCGACACGTTCCGGTGAATATTGATAACGACGTCTGCAAACTAATCCCCTGACCTGGCGTGCGCGCTGATGGCATAACCTGAGCGAACGTGCGTGAGCGTGCTACACGCTGCCGTTGCCGGGCTGTTCGAACAGCCGGTGCCCTTCCGGATGGCTCCGCGTCTGACGACCGTACGGCCAGTCGTCTGGCGTCGGCGACGGCGAATTTCAGCTCGACGACAAATGATTTGTTACCTCGGCAAACCGGTATCTGTGCGATGCTGGAATTGGACGAAGAAATGCCTTTGGCGATCGATGGAACATTCTGTTGCTGGCAGTGTTTAACGATGACGGCAACAGTCATTACTGTCGCGGTCTGCGTCCTGAAAACGCTGAGAACGAAGTTTGCTGCCTGGTAATCGATATTAACGACGCTTTCGGCGTTGCCGTGAGACCGCCAGGCCTGACGATTGAAAACTTTCGTTGATGTTCAAGCCTGCTACCTGCTGCACTACCGCTCGGCCTGGCCGTGATGGCATGACGTGCTGATGAATTACGACCGCTATCTTCGTTGTAACGGCAACACTTTATTACATGACCGATATTGATGACGAACGTCTGGCACTGAGGCTGTCTGCCGATTATTGATGATTATGCTACGCTCGCCGAACAATGGTGACGGCTCTTTAACTTTGAACAGTAACTTTGCTGTTAGCGTGTGCTGGTGGTGCTGCTGGTACTTCGCCGCATGTCGCTGAAATCGCTCGCCTGGCGGTTAACCGCCTGTTCCGTCGTGATCCCGTCGGCTTTCGACACTACTTCTCGCTTATTAACGGCACTTTAACTGCTGATGATCTCAACTCGACGCTGACGGCGGCTTACCTCCAGAAAACCGAACTGCACCAGGTGGCGGCTCATGCGGAACGGTAACGCCGCCGCGTATCGCGGAGACATCGAATGATCGGGATCGTTATCCGATGATGCTGGCGCGACTTTGACGTCAGCAGCTTCGACAGGCGCGCTTATTCCTGTCTTACCGGCGAAAATACGCGATACGATCATAAATGTCGGTGTCATGGCCGCCGCCGATAATGTCGATGAAGGGCTGACGGCTGCAAACGTTAACCTCATTGATACTGCGTGACTTTCGATGCCGGAGTTCGCGCTAAAGCCGGCCTTATGGCGCATTCTTCCTTTTGTACAGTGAACGGGCAACCACTGACTTTGACTGCAGTTTCCGCTGGGCGGCGGCATGTTGACTGGCTGCTGCCGGTTCGACCGTTAACCTGGGCCAGATATTGGCGCGATTTCGCGCAGGTCGGTCGATCTTCATGAAGTGATGATACTATTCTGCCGCGATATGTTGTTGGCGAAAACCGTCATCGAAACTGTTGTTGTGGCACGCGAACTGCTGCGCTTGATGATTCGTGGCGAATTTTGTTCCGACACAGTGTGGTGGGCTGGCGCTGGCGTGTTACGAAGACATCGATTTCCGTGGAGCCGGGCTTGGCGACGGCTGGTGCTGGGCAACGGAGCGCGCTGCTCTTGGTATATTCGGTGGTGGGCGCTGTTCAGTTTGCGAAGACGATGAAATGAGGGCGTTACCGGTTGATGGGGCGCTGTTTGAGTAATTCTGCAATATGTTTCATTGATGATGATTGTTGCTGATGTAATCTGAATATTCCGACCGATTTTAAATACAAAAATAACTTTCGAACTATTAATCTCCGTCGACAGACGGATGATATTATCCTATAGTAATTGATTGTTCATCGCATTATTAAAATCGGTTTATCGTGTTAATGGCGGTTGATTGCCCGATTGGTAAACTGGTTTATGTGAAAAATATATAAATACGTGTGATGTGATGATGTCGTTGTACACTGTTCACGGATATGAACGGCGTAACTAAAAGGGGCATATGAGCGGAAAACCGGCGGCGCGTCGGTATGACTTCGGTAATAAACGGTCCCCGTTGTCGAAGTCATTGAATACCGGCGCGCCCGCCGGTGGCGTTATTCGACGACGATAAATCTAACGAGCGAAATTTCGGTTGCTTATCTCCCGCATACAGCGCAACTTACCGTTGGCACCGATGAACGTTGCCCGGCTGGAAAGCGCCTTCTGATATCGCTTACGGCTTACGTGATGAACGGACTGATACTCGACTGACTTCGCTACCGAGGCGATTATTACGGCCGCGATGATGCTTCGATATTAACGACTTCCTTCGCTGGCGCATTTTGCTGCGGTCGTTAACTTCCGCATCTTCCTGACCAACAGCTTTACGAAGGCCGTGGTATTCACTGATTGATCTCGATTAACGTTACTGGTGCCGGCACGCCGCCGCCGTACCGACCAGCCGGATGACGGTCGCCGACGTTTGCTGCGTTACGAACCTCGGCGAATCGGCGAACGGTGCCGAGCGAATCACCGGTGCTACGAGCTTTTGGCGAGCCGCACCCTCTTCGTATCTTCTGACGGTTCCGCCTCTCTCTCGACGCATCGTTCCCCGGTACTAACCCGATACGCCGAATACGACTTACGACAGCGGCCTTTCGACGGGAGGTATTCGGCTGATGCACGACCCGGCATTACCGAAACCTGCCCGCTGTATATGCGAAACCGATGAACTGCTGGCGACATATGTTACCGGCAACTCACGGATACGCTTTCGTATGACGCGTACGCAGACCGGCACCGTTACATGAACGATCCATACCGCTACGACGCAATACGGGCGAACAGTAAACTACCTTCTCTTCGGTTGAGTTCGTCGCCGACAGCCTGAACCGGCGTCGATGCTGCTACGAAGGCGGTAAACTGAAGCGCAATTGATGAACTTCGGCGGACGGCAACTCGCGCGGCGCTGACATGTTTGATACTGATCTGATGGGGGTGATCGACGTTATCACGGACATCTACGCCGAATTACTATGGCGGAACCAATGACGACGTGTTTAATCGGCGGGCTGGAAGCTTGCGCCGAGATATATTGAACCGGGCGAGCTTATTATCGGCGGCAATACATGCCGCTACGAGTTTAAACACCCAGAGCGACGACAATGGCAATACGTAACACGGCA
+>d5943c57-7a5d-4b70-9db0-78c47b331a56
+TTGGTATTGCTTCGTTCAGTTACGTATTGCTGCGCCTGTCGCTCATCTTCGGCGTCTGCTTGGGTGTTTAACCTCAGGAAGAGATGTCATTAATCAGCGCGCCAGCCCGCTGCCTAAAGGACGCGCCAGCACCATTAACACCAGTAAAAACGTGGCGATCAGTAAGAACCACGCGCAGCCATCAGAACCTCCGCATTGATCAGGGCATAAACCAGATAACCCAGTAATAAAACACCAGCAATACGCCGGTTATCACGCCTGCACTCCTGATGCACCTCCGTGGCCTAAAAGTGATACCGGAAGGTAGAATTCTGGCTGCAAGATTTCGCAAAATCACCCGGGCAGGGTGTAAAAAGTATAAAAATAGCCAAAGCCATGATTTAACTAATGTTTGAAGTATTAATTTAGCTTTGTGTAACTTAATTACAGGATGAATGTAAATAAACCATCAATAAGCAAAAATAAGTGGTCGGATGGTAGTAAAATTACAAAAGGCGGGTACTATTTTCATCAGATAAACAAATTCATTTTCCGGTGCCATTCACCGGGTAGATACAAAAGGGGAGAAAGTATGGAACTCTACAGAGAATATCCTGCATGAAAAACTATCTTTTTACGCCGTACTTATGCAGTTTAAGCGGGCGTTCTGGCGCTGCCTTTCATGCTTTCTGGAAGAATTCGCGCCCGCTTTTGCAGCTTCTGCATCGCGTCTGATTCGAAAACCAGCGATAAACCCGGTGTGGATGGATCAGGCCGAAAAAAGGCAACTGGTGATTTTATTGATTGCTGAGTTTGAATACGTGAAAACCGCCAGCGAAACGCTGGCGGTTTTATCAGGAAGATGTTCAGAGAATATTTGAACATCGTTATACCAATCAGAAACATATATTCATGAAATATATATAAATATTTTTCCTAATTGTTCTTATCTGACAGATATCTCACTTAAGAGAAACTCTTATAAATCTGTAGGTTCGCCTGTCCAGCAGACAAATAACCCGATAAAACAAGGATGAGCAGATGAGCGGAAAACCGGCGGCGCGTCAGGGCGACATGACGCAATATGGCTATTAGCATTGTCCAGGAGGTTCAGCCGGGGTACATCAGTGCCCCACCGGCGTGTAGCCTGTTCGGTGTGCCCCGGCGGTGACGTCCAGCCATCCGGTCAATCCGCTATACTCGATTGCAGGTCCTTCCCGGTGAAACCGACATCGCCCTGCCAGCCGCTGCCGTTCATTTCTCTCCGCACTACAGCAGTTACCGGACGAAAACGCCCACGCGCCGGTGGGAGCCTCGGCCCCGGCTGCCCGTGAAATGCCTGCGGATATCCGCTTACAGCTGCGCGATAACACGCTGATACTCAGTGATAACGGCGGCAGAAGCGCAATTTTATCGTGGATATCACCGGCTGGCCGCACTCTGGCAGGCGCTGCCGGAAGAACTCGCTTAAGTCCGCATCGTTATCTGGCGACAAACAGTCCGCAGGGGCCGTGGTAAACTGCTCGGCTGGGTGTGAGCGGAGTGCCGGGAAGCGGATGAGGTGCTGCCTGCGCCGCTGCCGCCGTACCGGGTACTGACCGGGCTGGTGGACCGCTTCGGGCGCACACAGACGTTCCACCGCAGAGCCGCCGGTGAATTCAGCGGCGAAATCACCGGCGTGACGGTTGGGCGTCACTTCCGGCTGGTACTGACCACGCAATTTTGGCGAACTGAAGAAGCCGGCAGCAGGCCATTTTCCGGCGGGACGGAACCGTCCGCTTTCCTGATACCTGCCGGGTTACACCGAATATGGCCGGGACAGCGGCGTCCGTCTGTCTCTGCCGTGTAGTGACGCACGACCGGAATACCGGAGAGATTTACCTGCCACGCGCCGCTGGTGCGCTATGAAGCTGGACGCCCGCGGCGAACTGGCGGCGGTGTATGACCGCAGCAATACACAGGTGCGCAACTGCGATGATAAATACCGGGGCCGGATGGTGGCGCACCGTCACACGGGCCGACCGAAATCTGTTACCGTTACGACAGCGACGGGCGAATTTGACAGAACAGCTAAACCCGGCAGGCTTAAGTTACGCGTATCGGTATGAAGGTTGCATCACCATCACCGACAGCCTGAGCCGCCATTGAAGTCCTGCACGCAGGAGTAAGAAGGCCCGGGCTGGGCGCCAGGTGGTGAAAAGGCTACCTGGACGGCAGCGCGTCCGCAGAGTCAGTTTGACGCGGTGGGCAGGCTCAGGGCACAGACGGATGCCGCCAGGCAGGGCAACAGAATACCGTCCGGATGTGGTGACGGGCGCTCATCACGCGCATCACCACGCCGGATGGCAGGGCATCGGCGTTTTACTATAACCACCACAGCCAGTTCTTGTCAGCCACCGGGCCTGACGAACGAATACGCCGAATATGATGAATGGGGCCGTCTGATTCAGGAAACTGCCCCTGACGGCGATATCGCGCTACCCGTTATGATAATCCACACAGTGACTTGCCACGCACGCAACGGAGATGCCACCGGCAGCGGAAAACCATGACGTGGAGCCGTTACGGTGGATTGCTGAGCTTCTGACTGTTCCGGTTATGTAACCCGCTATGACCACTTGACCGTTTTGGTCAGGTGACGGCAATTGCACACCGCGAGGAAAGGCTGAGTCAGTACCGCGCATGCGACAGCCGTGGACGGTTAATTGCCGTGAAAGACACGCAGGGCCATGAAACGCGGTATGAATACAACGCCGCCGGTGACCTGACCACCGTCGTACGCGGACGGCAACGAAACAGGACACAGTACGATGCGCGGTGGGGAAAAGCCATCTGTACCACGCAGGGCGGTCTGACGCGCAGTATGAGATACGATGCTGCCGGACGGTCATCCGCCTGACCAGTGAAAACGGCAGCCACACCACCTTCCGTTACGATGTACTCGACCGGCTGATACAGGAAACCGGCACGACGGCCGCACACAGCGTTATCACCACGACCTGACCGACAAACATCCACCCGGCGAGGATGAGGGGCTGGTCACCCACTAACACTATGACGAAACTGACCGCCTCACGCACCGCACCGTGAATGGCGAAACCGCAGAGCGGTGGCAGTATGACGAACGGCTGGCTATTGAACATCAGCCATATCAGCGAAGGAACACCGGGTGACGTTTTATGGTTATGACAAGTAAAGGCCGCCTCGCCAGTGAACACCTGACGGTGCATCATCCGCAGACGAATGAACTGCTCTGGCAGCATGAGACCAGACATGCGGCTACCGCGGGGACTGGCGAACCGCTGTATACCGGACAGCCACCGCCCGCCGTGGAATGGCTGACCTACGGCAGCGGCGGCTATCAGGCATGGAAACTCGGCGACACCGCTGGTGGAGTACCTGACCGCCTGCACCGAGGAAACGCTGCGCAGCTTCGGCCGTGCCGAACTCACCACCGCTTATGCCCCTGCCGGGCGGTTACAGAGCCAGCACCTGAACAGCCTGCTGACCGCATTACACCTGGAGACGACAACGGCGAACTCATCCGCATCAGCAGCCCGCGCCAGACCCGGAGTTACAGCTACAGCACCACCGGCAGGCTGACCGGCGTTCACACCACCGCAGCGAATCTGGATATCCGCATCCCGTATACCACCAGACCCGGCAGGTAACCGCCTGCCCGACCCGGAGCTGCGCGGACAGCGCCCTCAGCGTAATGGCGGATAATATGTCGCCCCGTGACGCGCACTATCTTTACCGGTATGACCGTCACGGCAGGCTGACAGAAAGCCGACCTCATCCCGGAAGAGTTATCCGCACGGATGATGGCGCCACCGAGCCTGCGCTGACAGTCAGCACCGGCTGGTGCACTACGCAGACACAATATGCAAGGCCCGCTTTGGTCGAAAGTCGCTATCTTTACGACCCGCTTCTGGCAGGTACCAGAATTGTAAAACGGGTATGGCGGCGTAGAACGGGACCTGACCCAGGCTGGATGTCGCTGTCACGGAAACCACCGTGACACAGGTACGGCTGGGACGGCGACCGCCACAGCCACGATAAGAACGACAGAACCCGCATCAGACGATTTATCAGCCGGGAGCTTCGCCACTCATCAGGGTTGAAACCGCCACCGGTGAGCTGGCAAACACAGCGCCGCAGCTGGCGGGCCACCCTTCAGCAGTCCGGTGGCGAAGACGGTGGCATTGGTCGCTCCCGCCGGTGCTGGTGCAGATGCTCGACCGGCTGGAAAGAGTGAAATCCTGGCTGACCGGGTGAGTGGGGAAAGCCGCCGCTGGCTGGCATCGTGCGGCCTGACGGTGGCGCAGATGCAAAGCAGATGGACCCGGTATACACGCCGGCGCGAAAAATTCACCTGTACCGCGACCATCGCGGCCGCTGGCCTTATCGGCACGGAAGGGACAACTTGGCGTGGTACGCAGAATACGATGGTCGGGTAACCTGCTGGATAAGAGAGACGCATCGGCTGCAGCAGCTTATCCGCCTGCCGGGCAACGGTATGATGAGAGTCCGGCCTGTATTACGAAAACCGCCACCGCTATTATGACCGCTGCGAGGGGCGATATATCACTCAGGATCCGATTGGGCTGAAAGGGGGATGGAATTTTATCGAAATCCGTTTGAATCCGATCTCAAATATAAGATCCATTAGGATTAGAAACACTAAAATGCGGTAAGCCACTGCATTCAATGGGCGGAACTGGTGAAAACGGTCCAGATATATGGGGGAATCCGTTCTATCATCAATATCTTTGTGTCCCCAGATGGTAGGGACTATGCTTGTAGTGGCCAGACCAGCAGGAGAATCAAAGGAGATGGTCTATGGGGGCCAGGTAAAGCAAGTAATGATACAAAAGCTGCTGGCCGTTTGTGACCTCGTTGAAACCGATAATGGTTATGTGGAGAACTGTTTTAAAGGAAGTTTAAGAGGTAAGGCCGCGTTATTCTGTATTGCTGATATATTCCACCTATAAATTTGAGGCCTGTTAAAACTGCAAGACTGGTCTAATGATTCTTTAGAAACATGTAAGATGAAGTGCTCGGAAATAACATTGGACGTTTTATTAGATTTATTCACCGGGTGATGTAATAAAATATATTATTTTTTATTCAGAGGCTATATGGCTGGCTTTATCGCTTTTAGCCACTATTCTTTTCCATGCATAGACTTTCACTATTAGACTCTCCACTCGTGATGTGAGCGAGTTAATTAGTCTCATGTCTATGGAATGATGGTAATATGTTTTCCAACAGGCATAGTATTCTTTATTGCTCTAATATTTATAGGGGACTGTATCAGACATTATTGGCGGCGTAAGGGATTGATAGCAAGTATATTATAGCGATAATAATATGGCTTTATTTTCTGTCAGGAGGGTATATATTCAATGGTTTGTGATGGTAGCGCATTATAAACAAATAAATTAAGTTAATTGCTCTTATTATTATATGTAACCTGGGCATTGATATCCCGTATACCGCAGACCCGGCGAGGTAACCGCCTACCCGACCCGGAGGCTGCACCCGGACAGCACCCTCAGCGTGGCCCGGATAACCATTATCGCCGTGACGCACTATCTTTACCGGTATGACCGTCACGGCAGGCTGACGGAAAAACCAGGCCTCGTCCGGAGGGTTATCCGCACGGATGATGAGCGCACCACCGGTACCATTACGACAGTCCAGCACCGGCTGGTGCACTACACGCCGGACACAATATGCAGGCCGCTTCTGGTCGAAAAGCCGCTATCTTTGACCCGCTGGGCCGCAGGGTGGCAAAACGGGTGTGGCGACGTGAACAGGACCTGACGGGCTGGATGTCGCTGTCACGGAAACCGCAAACGACCTGGTACGGCTGGGACGGCGACCGCCTGGCCACGATACCAGAACGACAGAACCCGCATCCAGACGATTTATCAGCCGGGGAGCTTCACGCCACTCATCAGGGTTGAAACCGCCACCGGTGAGCTGGCAACAGCGCCGCAGCCTGGCGGATACCTTCAGCAGTCCGGCGGCGAAGACGGTGGCGGTGTGTGTTCCCGCCGGGGTGCTGGTCAGATGCTCGACCGGCTGGAAAGTGAAATCCTGGCTGACCGGGTGAGTGAGGGAAAGCCGCCGCTGGCTTCGGCATCGTGCGGCCTGACGGTGGAGCAGATGCTGAAACCAGATGGACCCGGTGCACGCCGGCGCGAAAAATCCACCTGTACCACTGCGACCATCGCGGCCTGCCGCTGGCAACGTCAGCCTGGAAGGGGCAACAGAGATGGTGCGCAGAATACGATGAATGGGCAACCTGAATGAAGAGAACCCGCATCAGCTGCAGCAGCTTATCCGCCTGCCGGGGCAGCAGTATGATGAGGAGTTGGCCTGTATTACAACCGCCACCGCTATTATATGACCCGCTGCAGGAGGTATATCACTCCAGGGGATCCGGTGGGCTGAAGGGGATGGAATTTTTATCGGTATCCGCGCTGAATCCGGTTCAGTATAGATTCAATGGGACTGGCATCAAATATGGACACTTAAATAATGGCGGATATGGGCGGACCCAACAAACCGCCTACGCCCGATCCAAAGTAAATTGCCGGACATAGCAGAAACAATTAAGACTGCCATATCTATTGACCAGGCCAGTAGTGCGCTAATGTTTTAAAACATTCTTCCAGAGCAGTAAGCCCGACTTCACACACTGTATTGCAGAATTAAGGTAAAACCAAATCTGACGTACGCCACAGGATGATTCCCGGTATCGAGGATGGTTAAGACAGCAAGTGATTACCTGCCACAGTGGAATTGGCCAACAACTCAATTACCACCAGGGATACTTGGCCAGAACCTATTTATTCCCAGACATTAATAAACCCGATGGGCCAGCAACTAGCAGGGATAAGATGATTTGGGTGAAATTTTGGCTAAAGATGAAACAGAAAGGTTAAACGCAAGCAGACGCCGAAGATGAAACGT
+>8a553dac-a603-4a38-ab2b-4c9cc41bd7ac
+TCGTGTACTTCGTTCGGTTACGTATTGCTAGTAAAATTTCGTCTCCCGCCCGTCTGGTGTGGTGATGTCCGTGATATCGCCGGGCCACCACATTCCAGACCATTACTCTGTCCTCCGTCCGCCGCGTCCGTCTGCGCCGTAGGCCTTCCTGCCGCGTCATACCCGCTGCGCGTGACGCTGCCGTCCGCCAGTTCTTTTTTCACCACCCGTTTCAGCCCGGCCCCGCCTTCTGTATGCAGCACCTCACGCCGGTTCGGGCGCAGCCGGTGACGGTGATGCGGTCCTGCCATAAAGATAGCGGTAAAACTAACCCTGCCGGGTTCAGTTGCTCCACCCGCCCGTATCGTCATTAGCGGTAGCGCATCTCCAGCCTTCCCGCGTAACGGTGCGCCACCATCAGCCGGGTGCTGCGTCATACGTGAAAGCGCGCACCTGCGTATTACTGCGGTCATATATACCGCCAGCAGTTCACCGGCTTCCGTATACGTGTACCGCACCGGTGGCGCAAGCGGGCAGGCTCTCCGGGTATGCCGGGTCGTGCATCAAGCCACACCGCCGAGGCAGATACCCTAATCGGGGCCGTATTCGGTACCGGGCGGTGTGTCGGGGAACGCTGAAGGCTGAGGGCGGGAACTGTCGAAGAAGATAGCGAAGTCGGGCCTCTTCCGCGCTGCGCCTGCGTGGTCAGCACCAGACGGAACTCCCGCCCGGCACCGTCCGTCACGCCGGTGATTTCCCAGCCAGGTCACCGGCGGCCTCACGCCGGTACGTCAGCGTCCGCCCGAAGCGGTCCACCATCAATGCGCTTACCCAATTGCAGCGGCAGCGGCGCTGGCAGTACGATCCTCAACACCCAGCACCCACTCAGACCACGGTATCACCACGGCCTGTGCGCTGTTGGTCGCCAGGTAAAAGATGCGGGCAACCGGATCCGGCGGCAGCGCCCCCACAATACCGCGCCAGCGTATGGCCGTCCGGCTGTGCTGCCTTACCACGCGCACCAGCCATTGGCTCACTGCGGCTGTACCGCCTCCCCGGCAGCAGCGGCTCAAAGTGAATGCTCGCCCGCCGTTGTCGTTGAGTATCAGTCCGCGTCATCACGTGGCTGTAAGCGGATATCAGAAGGCGCTTTCCAGCCGGGCCGAAAACGCCCACCGGTGCAGGCGTCTTCGTCCGGTAGCTGCTGTAGGTGCAGGAGAGAATGAACGGCTTGGCCGGGCAGCGCAGATCCCGTCTCGCCGGGCGGCACCTTCGCTGGCAGCGGATTTACCAGGTTGCCCGAAGTCATCCCGCCCGGACACACCGAGCACGCGCCGATTGGGCGCCGCATAATTCTTACGCCTGCCGAACCCTGGACAATGGGACCGCCATACTGAGTCATATCTCCCTGGCGCGCCGCTGGTTTTCCCGCTCATATAAAGTGCTCTTTTTGGTTATTGTTCATATCCCTGTGTTAGCAGCAAAAAAATAAAATGACACAAAGACCAGCTAATGTATTTATATTTTTTTCACATAAGCTTATTTGTTCTCAATCAACAACTTCATTATTACAGGTCACTTTCAATATTTTATTAAACTAACATTTTTGGCCTTGATGAATTCATCATCAGCAAATTCACTATATGGATAATATCCATTCAACGCATATGATTTATGATTTTGTAAGGTCTGAGTTATTTTGTAGAGATATATTTAAAATCAATAAGCTCCACCGATTCGGATTAATGTCAATAATGAAGATCACCAATTCCAATAACATCATCAAGTAAGAGCATGGCTAAATTAATTTAAACAAGGCGTTCCCATTCAACCAGAACGCCCCTGTTCTCTCATCACCCCCACCATTTACTGAACAGCGCCTTGCCCGCCAACCAGTCGCGCGCAGCCAGCCGCCGAAAGCGACAGCAGCAGCGCTCGCTGCACGTAGAACAATCCACAATCGCCAGTCTGGCTCCCACGGAAAATCCAAACCTTTCGCCTGCAACACTGCCAGCGCCGTTTCCGCACCAGCGTTGCGGCCTGGAATGAAACAAATTAAGCATAGCGGAACTCACACCACAACGTGGTACGCAGCGGTTTTTCCCCGCGCACCGGTGTGCGCCACCACCAGCTCCTGATGGCTGACGCATTCCCACCTGCACCTGTGCCAGCAACAGCAACATACCGCAGGCGGTGACCAGTACCACCATCGCCAGCGCCCGACTTACCTGCTCCAGCTGACCGACCTGTTTAAAATCGCGCCAATATCTAACAGGCTAATGGTCGGGAACTGGCGGTTGAGTTGTGTCAACATGCCGTTTGCCATTCTCCCAGCGGAAACTGGTAAGCCAGCTCTGCAGTTGCCCGTCCTAATGCCTTCAGGGGAAAATAAAATGAAATTAGGCCGCAGACTTTCCAAGATCCACTTTGCGCAGGCTGGTCGCTTTAGCGCGGAACTCCTGGGTATCGCCCATAAAAGTCACGGTATCACCGAGGGCAACGTTTGGCGTTTCGCCAGCCCTCTTCCATCGACTTCATCGGCTTTTGTGGCGGCCAGTTACCGGCGACAATCAGCGGATTATGATCGGGCCGCGTATTTTGCGGGTAAGATTAGGGTTCGCGGTTAAGCGCCTCATCTTCATTACACCTTCTGTCGGCTTATCGATTTAATCGCCGTCAGCCGCGCCGCCACCGGATAAAACGATTCCGGGACTATCTGATGTTCCGCGAGGAACCTTTTAGCAATGCTACCTGTTTCTGGCGATGTTAATTAAAAAGTAGTTCCGGGCTCTGGAGGTAGCTGCTGCCCGGCGGTCGAGCAGATCGCCACGCAACACCAGCAGCAGTGCCAGCAGCATAAAGGAGGCGAAAATGCCGAAAGCTGACTAACGTTGACCACGGCTGACGTAACAGGCGGCTAACCACCGCCAGGCGCAGAGGCAGCGATTTCAGCGTCATGCGGCGAAGTACATTCAGCATCCAGCCAGCACACCGCACAGCAAAGCCAGTATTACTACCGCGCCCAGCTTCCGCCCAAAGCAGCATGCTGCCATTAATCCGGCGAGCAGCAGCACAAGCCACCACACTGACAATCCCGGCAGATAAAACTTCAGCGGCCAGACGTTCGCTACCATCATTACGTAATACGCGTAAGGCTGCGTTGCCAGCAACAAAGCGATATGGTCAGCCCCACCAGCAGCGAGATGACCGTCATGGTGCCGGCGCCTAGCCACGGCCAGAGGCTGGCTGGCGGTAGCAGATGCAACAGGCAGAACGGGCTTGAGCAGCACCATCAACGTACGTTTCGAACAACAGGCCTATGGCCCCACCGGTAACGGCTGAAAGCGTCAGCGCCATCAGCCACACTGACCGACGATTAAACGCAGTTGCATCGCCCTGCCCCAGCGCGTTTTGAGGATCGCCACAGATCGTAGCGACTGCGACCCAGTGGCAGTTCATCACTACCACCGCTGCCACTGCCAGCAGCAAGGTCAGAAGCGCCGAAAGCAGCAGGAACTGTTTGCGAGCGTTCCATCGATCGCCCCAGCGCGCCTTCGTCCTGTTCAAATACGTACCAGCATTGCCGGGTTTAAGCTGGGGGTAACAACCATTTCTCGCCGTCTGAGCTGGTTCTCGTTGCCCTTGAATTTATAACGCCAGGTGACCCGGCTCCCCGGCTGCGGCTCCGGTTTTATCGACATCCGCCAGATTCATCATCAGACGGAATGGCCATCTGGAAGAGGTTAAAACCGGAATCCGGTTCCTGAATCACTTCTCCGGCAATCCACCGCAATTAGCATCGCCCGCATCAATGGTGTCGCCGTTTTTCCCGGGTTAAACAGTGCCATCAGGCGTGGGGCCAGCAACTCGCGCTGCCCCGCCTTACTGCGGTTTCAGGCCAGGGGATTAGTTTGCGGATCGCCATACATCAGGCAGATATCAATCCACCGCTTTGACGTTCGCCAGCTGCGGTGTGTGTCGCTATACAAAGGTCTATTTGTGGCGAGAAAGTCAGCTGCTTGCCGACTTTCAGGCCGCGCTTTGCGCTTGCCAACCGCTTGCGGCACTTCGCGTGGTTGCGCAACGCCCGATCGCCCCGCCATAAACTCACGGCTTTGTGGCCAGCCCTTCTCCATGCGATCAGCAATTATTGCCCAGCGCCAGCACGCAGGCCACCACCAGGCTTAGCGCCAATGAACAATTAATAGCGACGGCGAACGCCATTCGCGCCAGAACCAACGTGCAATCATGCTTCCTCCTGCAGCTGCCCGTTCGCAGCCGTAAAGCGGCGGTTTGTAGCGTGCCGCCAGTTGCGGGTCGTGGAATCACCATAATCAACGTGGTGCCATGTTCACGGTTGAAGGGAGAGACAGCAGGTCGGCAATTTTATCGCCGTCTGGCGGTCAAAGGGTTGCCGGTGGGTTCGTCGGCAAACAGCACATCAGGTCGACCATTAAAGTCGTGCCCGGCCTCACTCGTTGCTGTTCACCGCCGGAAAGCTAATGCCGGAAGATGATCAGACGTTTACCCAGCCCTGCTTTATTCGAACAACGCTTTCGCCCCGTTACGACTTTCCGCTTCTCTCACCGCGCAGCCAGAAGGTTAAACACGAAGCAGACGCCGCAATATCCAGCGGG
+>0e56d03e-268c-42cc-a0f3-90d688115d07
+TTGTTGCTTCGTTCAGTTACGTATTGCTACTTGCCTGTCGCTCTATCTTCGGCGTCTGCTTGGGTGTTTAACCTTCCATTTGTTCACCTTATTTATGTAAGGAGTATTTGATCATGTATAAGCTATGAAAACGGCTTTGGTAATAGGAATATCTCAATTTTAAACATAAAATGCGGTGTTGGTACAAAAGTAGCGTTACGTGATCTTTCCTGGGACTAGCTCTGGCAGTAATCGTGAACAGGGAATACCATTTCAAAATCACCATATTGCTTCAAAATCGAGGTGTTTCCCCGAAATCCTCTATCTTCCCAACCTTCTGCACCAGAAATGGCACAAATAGCCAACAGTAGAATATCTGACAATTTATGCACCACTTTCCAGGCTTGTCTGTAATCCCGGGTGTAATAGAAATATGTTCATCAATTTTAAAGTTCCATTTGTTCACCTTATTTATGTAAGAGTATTTGATCATGTATAAGCTATGAAAAACAGCTTTAGACAATAAGTAGTATCTCAATTGTTGAACAGAAATTCGAATTATTTAGTACAAAAGAAGTAGCGTTACGTGATCTTTCCTGCAAATGGAACGCAAAATAAACACCTATTCCATGAGTTATATAATTTTCACAATGATTAATTTGTTTTCTCCAGGAAGAGATTTTATTTCTCTTCACTACGGAGAATTTAGTTCATGCTGTATCTTTATTAAGCATTCGTAAGACTCATTTTGTTTCGAGGAGATGTGCTGTCATTTCAGGCATAAGTTGGTTTCTCATCTTTTAAAATATTTTACCATGATTGAATTATCAGGACTGCCAACAACTGAACTGGATCACTGCTCTTTTTGATAGATGATACCCGCTCTTATATAACTTCTAAACCGATCGCCGAGAAACGCCGTTTTCTGCTGTATTTATCCAACTCCTGCAACGTTCCTTTGATGGCATGATTTTCATTAAGGCGTAGTGACCGGCACCAGATAAGAGTCTCGCCCGCTTGGTGTGAATTTATTATTTTACATGTACCCAGTTCTGTTTGCCAATAATGCTCACCGATGTCCTCATTCTGATACCATCTCCACATGGCTTTACATTATTTAAGACAGGAAACGCGGAAAAATAGTACCCATAGCGAAAATAGTAAAACAATCATGATCTTTAAGCTTGTATTTCGCAATCAGCTATAACACCAAAACTAACAAATGTCATCAGCAAAGAACAAAACTCTTTTTCATTTTCTTATTCCTCTCGATGTTCTCTGTTTGCATCACCAGCTAAATTTCACCCAAATCATCTATCCCTGCTGTTGCTGGCCCATCAGGTTTATTAATGTCTGAGAATAAATAGGGGTTCTGCACAAGTATATCTGGTAGTAATTGAGTTGTTAGCCCAATTTGTCTGGCGAATTAATCACTTGCTTCTTTGTATCCATCCTGGATACTGGGAATCATCCTGTGGCGTACAAGTCAGATTTGGTTTTACCCGCTTCCTGCAATACGGTGTGTAGTCGTGGGGCTTAATGTGCTCTGAAGAATGTTTTGTGAAAACATTAGGCACTACTGGCTGGTCAATAGGATATGGCGGTCTTAATTGTTTCGCTATGTCGGCAATTTACTTACTTGGATCGGGTAGGCGGTTTATTTGAGTCTCGCTCCATATCCGCCATTATTTAAATTGTCCATATTTTGATGCCAGTCCCATTGAATCTATATACTGAACCGGATTCAGCGGATGCTGATAAAAATTTCCATCCCCCTTCAGCCCAATCGGATCCTGGTGATATACCTCCCCTGCAGCGGGTCATAGTAGCGTGGCAGTTGTAATACAGGCGGACTCCTCATCATACTGCCCCGGCAGTGGATAAGCTGCTGCGGCTGATGCGGGTTCTCTTCATTCAGCAGGTTGCCCCATTCATCGTATTCTGCGCACCATTCTGTTGCCTTCCGTGCTGACAAGCGCCAACTTTGAGCCGCGATGGTCGCAGTGAGGTACAGGTGGATTTTCCGCGCCGGCGTGTACACCGGGTCCATCTGGTTTTGCATCTGCTCCACCGTCAGGCCGCACGATGCCAGCCAGCGGCAGCTCTCTCACTCACCCGGTCAGCCAGGATTTCACTTTCCAGCCGGTCAGGCATCTGCCAGCACCGGCGGGAACACCACTACTACCACCGTCTTCGCCGCCCGGACTGCTGAAGGGTATCCGCCAGGCTGCGGCGCTGCGTTTCGCCAGCTCACCGGTGGCGGTTTCAACTTCTGATGAGTGGCGTGAAGCTCCCCGGCTGATAAAATCGTCTGGATGCGGGTTCTGTCGTTCTGTATCGTGGTCAGGCGGTCGCCGTCCCAGCCGTACCAGGTCACTTGCGGTTTCGTGACAGCGACATCCAGCCCGTCAGGTCCGTTCACGTCGCCACACCCGTTTTGCCACCCGCGGCCCAACGGGTCGTGAATAGCGGCTTTCGACCAGCGGCTCTGCATATTGTGTCCGCGTGTAGTGCACCAGCCGGTGCTGAAGCTGGCTGTCGTAATGGTACACCGGTGGGTGCGCTCATCATCCGATGCGGATAACCCCTTCCGGGATGAGGTCAGTTTCTCCGTCAACCTGCCGTGACGGTCATACCGACAAGATGAATGCGCGTCACGGGCGACCACGGTTATCCGGCCACATGCTGGGGAGGTGCTGTCCGGAGTGCAGCTCAGGTCGGGCAGGCGGTTTACCTACTGGCGGGTCTGCTGGCATACGGGATATCAAATGCGGAGTTACATATAATAATAAAACAGTGGCAATTTGTTTGTTTATATTGCGCTTGCTTAATACAAACCATTGAATATACCTCCTGACGAAAATAAAAACCATATTATTATCGCCATAATATATGCTTATATCCAATCCTTACGCCAATAATGTCTGATACAGTCCCTATAAATATTAGAGCAATAAAAGATGCATGCCTGTTGGAAAACATATTACCATCATTCCATGGACAGCCGGAGACTGATTAACTCGCTCACATCACGAGTGGAGTCTAATAGTGAGAAAGTCTATGCATGGAAAAGAATGGTAAAACAAAAGCGATAAAGCCAGCCATATGGCTGAATAAAAATAATATATTTCATTACATCCTCCGGTGAATACAAATCTAATAAGAGCGATCCAATGTTATTATTTCCGGAGCACTTCATCTTACATGTTCCTAAAGAATCATTAGACCAGTCTTGGCGGTTTAAATAGCCCTAAATTTATGAATTATTGAATATATCAGGCAACTACAGAATAACTATGACCTTACCTCTTTAAACTTCCCTTTTACCAAACAGTTCTCCACACAACTATTATCGGTTTCAACGAGGTCACAACGACCAGCAGCTTCTTTTCTTTATCATTGCTTGCTTTACCTGGCCCCATAGACCATCTCCTTTGGATTCTCCCCGTTGGTCTTGGCCACCACAAGTATAGTCCTTTACCATCTGGGACACAAAGATATTGATGATGAACGGATTCCCCATATGCTCTGGACCGCTTCTTTCGCAGTTCCGCCCATTGAATGCAGTAACCCAATGCATTTTAGTGTTTCTAATCCTAATGGATCTATATTTGGATCCGGATTCAACGGATACTGATAAAATTCCCATCCCCTTTCAGCCCAATCGGATCCTGAGTGATATATCGCTTCTGGCAGGTCATAATAGCGGTGGCGGAGGTTGTAATACAGGCCGGACTCCTCATACATACTGCTGCCCCGGCGAATGGATAGCTTCTGCTGATGCGGGTTCTCTTCATTCAGCAGGTTACCCCATTTCATCGTATTCTGCGTACCACGCTGTTGTCCTTCCGCTGATAAGAAGGGCCAGCGGCGGGCGCGACGGTCACCAGTGGTACAGGTGAATTTTCGCGCCGGCGTGTATACCGGGTCCCTCCCGGCACATCTGCGCCACCGTCAGGCCGCACGATGCCAGCCAGCAACGGCTTTCCTCACTTTCACCCGATCAGCCGAGTTTCGCTTTCCAGCCGGTCGGGCATCTGCACCAGCACCAGCGGAACACCGCTACCGTCTTCGCCACCGGACTGCTGGAAGGAGGTATCGCCAGGCTGCGGCGCTGCGTTTTCACCAGCTCACCGAGCAGTTTCAACCGATGGTGGCGTGAAGCTCCCCGGCTGATAAATCGTCTGGATGCGGGTTCTGTCGTTCTGTATCGTGGTCGGGCGGTCGCCGTCCCAGCCGTACCAGGTCTTGCGGTTTCCGTGACAGCGACATCCAGCCCGTCAGGTCGTTCACGCCGCCATACCCGTTTTATACCCTGCGGCCCAGCGGAATCGTAAAATTAGCGACTTTCAGCCAGCGGCTCTGCATATTGTATCGCGTGGCATGAGTACCAGCCGGTGCTGACTGTAATAATAAGTACCGGTGGGTGCGCTCATCATCCGATACCCGGATAACCCTTCCGGGATGAGGTCGGTTTCTCTGTCAGCCTGCGTGACGGTCGCCACCGGTAAAAGAGATAGTGCGCGTCACGGGCGATACGGTTATCCCGGCCGCTGCTGGGCGCGCTAATCAGGTGCAGCTCAGATCGAACTGAGCGGTTACCTGCCGGGTCTGTGGTATACGGGATGCGGATATCCAGATTCGCTGCGGTGGTGTGAACGCCGTCAGCCTGCCGGTGGTGCTGTAGCTGTAACTCCGGGTCTGGCGCGGGCTGCTGATGCGGATGGTTCGCCGTTGTCGTTCCAGGTAATCCGCGGTCAGACAGCAGAGCTGTTCGGTCTTTGGCTCTGTAACTGCAGCAGGGAAGTATAAGCGGTAGTGAGTTCATAACGGCCGAAGCTGCGCAGCGTTTCCAGTGCAGGCGGTCGCGGGTGTACTCCACCAGCGGTGTGTCGCCGAGTTTCATGCCCTGACAGCCAGCCGCTGCCGTAGGTCAGCCATTCCACGGCAGGCTGTCGACCTGACGGTTCGCCAGTCCCTGTGCGTTGTACATGTCTGGTCTGCATGCTGCCAGAGCAGTTCATTCGTCTGCGGATGATGCACCGTCAAAGGTGTTCACTGGCAGGCCTTTACTGTCCATAACCATGATGCACCGTCACCCGGTGCCCTTCGCTATTCTGGCTGATATGTCAGCCAGCCGCATTCGTCATACTGCCACCGCTCTGCGGTTTCGCCATTCACGGTACGCGGTGCGTGAGGGCGGTCTGCTTCGTCATAAGTGCGCCGGTGGGTGACCAGCCCTCATCCTCGCTGCGGATAAGTTTGCCACGGTCAGGTCGTGTTGATAACGCTGTGTGCGGCCGTCAAAAGCCGGTTTCCTGTATCCAGCCAGTCAGTACATCAACGGAAGGTGGTGTGGCTGCCGTTTCACTGGTCAGGCGGATGACCGTCCGGCGGCAGCATCATTCCATACTGCGCGTCAGACCGCCCTGCGTGGTACAGATTGGCTTTCCCCGCATCGTACTGTGTCCGTTTCTCTGCTGCCGTCAGGGCAATGACGGTGGTCAGGTCACCGGCGGCGTTGTATTCATACCACCGCGTTTCATGGCCCGCGTGTCTTTCACGGCAATTAGCTGTCCACGGCTGTCGTATGCGCAGTACTGATAGCCCTTCCTCGCGGTGCACCGCCGTCCGCACCTGACCAAAACGGTCATGGTCATGGCGGGTTATGGCGCCGGAACAGTCAGTGAAGCTCAGCAGCTGGCTTGACCGTAACGGCTCCACGTCATGGTTTCGGCTGCCGGTGGCATCGCTGTTGCGCAGGGTAAGTCACTGTGGATATCGCATAACGTGTGGTGATATCGCCGTCGGGGCAGTTTCTGAATCAGACGGCCCCATTCATCCCATATTCCCGGCGTATTTCCAGCCCGTCAGGCCGGTGGCTGACGTTAACTGGCTGTGGTGGTTATAGTAAAACGCCGATGCCCTGCCATCCGGCGTGGTGATGCGCGTGATGAGGCCCGTCACACATCGGACTGTATTCTGTTGTCCTGCCTGCGGCATCCGTCTGTGCCCTGAACCCTGCCCACCGCGTCAAACTGACTCTGCGTGAGCGCTGCGCAATCCGCGTGTTCCTTTCACCACCCGCTTCAATCCGCCTTCCTGCCCCTACGTGTGCAGGGCTTCACGGCGGTTCAAGCTGTCGGTGATGGTGATGCGGTCATATCTCGCTTTGTTACGTGTAACTTAAGCCTGCCGGGTTTAGCTGTTGTTCTGTCACCCGCCCGTCGCTGTCGTAACGGTGGCTCAGATTTCCGGTCGGCCCGTGTGACGGTGCGCCTCATCCGGCCCCGGTATTTATCATCGTAAGTAAAGCTGCGCCTGTGTATTGCTGCGGTCATACACCGCCGCCAGTTCGCCGCAGGGCGTCAGCCATAGCGCACCAGCGGCGCGACGGGTAATTCTCCGAAGGTATTCCGGGTCGTGCGTCCAGCCGAGCGAACGGGCGGATGCCGTATACGGCATATTCGGTGTAACCGGCAGGGTATCAGGAGAAAACGGACGGTTCCGTCCCGCCGGAAATGGCCTGCCGGGCTTCTTCTGCCTTTGCGCCTGCGTGGTCAGTACCAGCCAGGAAGTGACGCCAGCACCATCCGTCACGCCGGTGATTTCGCCGCTGGATTACCGGCGGCCTTCGCCAGTGGAACGTCTGTGTGTGCGCCTTGAAGCGGTCCACCAACCCAGTCAGTACGGTACGGCGGCAGCGACGCAGGCAGCACCTCATCCGCTTCCGGCACCGCTCACACCAGCCGAGCATTACCACGGCCCCTGCGGACTGTTTGTCGCCAGATAACGATGCGGACAAGCGGAGTTCTTCGAAGCAGCGCCTGCCGGGATGCGGCCAACTGGTGACCTTCATCCAGTTTCGCCACTTCGCCGCGCAGCCACAGTGACTCATGCGGCTGTAACAAATCACCGGGAAACAGGTGCTCAAAATGCGACTTCTGCCGCCGTTATCACTGGTATCGGTGTGTTGTTGTTATCGCGCAGCTGTAAAGCCCGGATATCGCAGGCATTTCCCAGCCGGGGCCGAGGCTCCCCCCACCGGCGCGGGCGTTTTGTCCGGTAACTGCTGCAGCAGGTGCGGGGAGAGAATGAACGGCAGCGGGCCGGGCGGGGCGATGTCGGTTTCACCGGGAGGACCTTTGCACCGAGCAGCGGATTGACCGGATGGCCGGACGTCTGCGCAGGGCACCGAACAGGCCACGCCGGTGGAGGCACAATCCATTTTTAGCTGAACCCTGAGCAATGCTACCGCCGCTACTGCGTCATGTCGCCCTGACGCGCCGCCGGTTTTCTCACTCCATCTGCTATCGCTTGTTTTTATCCGGGTTGGTTGTTGTCTGCTGACAGCAGGCAGAAACCCACAGATTTATAAAGAAAGCCTTAAGTGAGATATCTGTCAGATAAAGAACAGTTAGGAAAATATTTATATATATTTCATGAATATATGTTTTCGATTGGTATAACGATGTCTAGAAATATTCCTCTGAACATCTTCCTGATACAAAAACCGCCAGCGTTTTCGCTGGCTGATTTTCAATCTTCATTCAAACTCAGCAATCAATAAAATCACCAGTTGCCTTTTCGGCCTGATCCATCCACACCGGTTTGTATCGCTGGTTTTCGACCAGACGCGATGCGGAGTAGCTGTAAAAGCGGGCGCGGTCTTTCAGAAAGCATGAAGGCAGCGCCAGAACGCCCGCTGCAACCTGGGGTACGCGGCGTAAAAAGATAAGCCATGCAGGATGTTCTCTGTAGAGTTCCATACTTTTCTCCCCTTTTGTATCTACCCGGTGAATGGCACCGGAAAAATGGATTGTTTATAAGACGGCTTTAAACGAACGCCGCAATATCGGCA
+>bdfab7a9-1792-4c9a-9428-261e109cdfae
+TTGATAGCCGTCGGTTACGTATTGCTGCTGCGCAATGTCTATCTTCGGCGTCTTGGGTGTTTAACCTGCGGCTGATTAATGACATTCCTCACCCCGGTACAGCGTTAGGCCGCGTACTTTTTCGCGCATAGCGTCTCTGACCGTGGGGATGAACTGGAAGCAATATCTTTGCCATTCTCGGCCTGAACATGCTGGGCTGGCGGTGCTGTTTTTATGTTGCTCGGTCAGCACTATCGCCTGTAATCCACAGCGGTTGCCAGGGCTGTCGTGGGATCTGGCGCTGAATACCACCGTCGCTTTGTCACAATACCAACTGGCAATCACCCTGTGGTGAAACCACGTTGACTATTTCTGCAGCCAGATGGCGAACAACGATTTAAACTTTCTTTCTGCCCGCCAGCAGATTTAAATTGATTTTGCCCTCATCCGTGCGTTTACCCGCCAGAGCATGAGCACGCTCAGGAATCACCTGGGTCGATCTGCTGCAATATCACGTATGGGTGCTGGTCCTGTGGCGTTGTTGATTGCACTGTTTTTATTCAACAAGATTGCGCGCTGCAAAACTTTCTGCCTTATCGGGCTGTGAATACCGTTGAAGGGCGCAACTGGCTGTTACCATGGGGCTTTCATAGCTTCTGGAAGCGATCACGAATCATCAGTACTAACGGCGGTGGCTTCTTTAATGCCAACTCTGTCGCATCCGTTTGAAAACCCAACCGCACTGACCAACTTCGGTGCAGATGCGTCTTCTTGATCCCAGCGCTGTCGCTTTTGCGCTGGTGATGATGGGCGATCTCGCCGCCAGAAGTGTTGCTGTGGGCGATGTCCGGTGGTGTTTTGTCGCCCGTGGAAAGCGTGGTGATGTGGGCGAAGTTCAAATTAATCCTCATCTCTGCTGGCACTGGGCACGGACAAGCAGCATCAATATGGAAGATGCAAAGAAACCCGTTTCGGCGTGCTGGTCAATTAACGCCTGTTTGCGGTCGTGACGACGGCGACTTCCGCAATAGGCGCAGTGATTACGATGCATGATTCGTTTACCGCTCTCAGTGGCATGGTGCCGATGCGCTGATGCAAATTAGTGAAGTGTTCGGCGGTGTCGATTCTGCCGTCTTCTTTGACATGATGCTGTTTGTCCTGCTGGCGGTGTTTGTGCCGGGCTGATGATTGGTCATACACCGGAATATCTGAGTAAAATCGACGTACGCGGATGAAACTGACTGCACTGGCAGATTCTGGATTTACCCCGGCCTTTGGTGCTGATGGGCGCGGCGTTGGCGATGATGACCGACATGAACAGCGCCATGCTTTCAACCCTGGCCCGCATGGTTTGGCGAAGTGCTGTACGCCGTAATCATCCATAACAACAACGGCAGCGCGCTGCCGGATTAAGCGCCAACTCTCCGTTCTGGAACTGTTTACTGGCGTTCTGCATGTTTGTCGTCGGTCGCGCTTTCGGGGTGATTATCCGGTGATGGCAATTGCCGGTTCGCTGGGCGAGTAAAGGCCAAACCCATAGCTCCGGCACTGCAACGCACGGCCTGTTTATTGGCCTGTTAATCTCGGCACCATGTTGCTGGATTTAGCGCTGACCTTTATCCTGCCCTGGCGCTTGGTCCGGTGGCGGAATATCTCTCTGATGATATTGGTGAGCACTGAATACCAGGTCGTAAACGCTGGCGCTATTCAGACCAACGCCTTGTCGTTCAGGCGCTGAAGCGGGTAGAATTAAACCGCAGGCGCAATGGCGCAATCGGTGATGTTTATCGTCTGGATCGGCACGGTCTGCTGATACTGTAACGCGATGTGGCATTGCGATGCCCGGCAATGCGCTTTCATTGCTTTTGGCCGTATGATTGGCTGTGGATCACCGTACTGTTCGCGCTAATTTCACGCCGGGCGCTGGCAGAAGAGCCGCAGTAAGCAGAGGCCAACAGTCTGAAGGTGAAAAACACGCTGCCCTGCGGCTGCGTGAGCCGAAATATGGCGCTGCGGTAACGAGTTCTGCCGACTAACTTCGTAAAGGCGATACGTACTGGTAAAGGCCTGACGTCATGTCACGATGGTAGAGTTCGCCCAGAGGGGTACATCGGTCGATAAGCGCCATCCACCGGGAATCGGCACCGGTGATCCATGAATCGGCGGCGATTTTTGCCTCCGTCACCGGCGGCACGCGTATTCTTTCGGCTGGCTGGTGATTAGATTGCTTGGCGTTAACCCCGGCGAGACATTTCTGGATCGAATGATCGCGATGGTGGAAGGCGCACAGCGACGCAAAACGCCAGGCGAAATTGCGCTGACCAAATTCTGCTGATTGCCTGACTATCGTCTTTTACTGGCAACCGCCACGCTGTAGTCGTTTTCCGCATTGGGGAGCGGTAATGCAGTCAGCGTAACGGTACTGGTATGGCGCTGCTGGTCTGCATCTGATCAACTCACTATTCAGCGGCTATTCAGCGATCGGCGTCGCCGGGATGAGCCGGATGCTAGGCGCGAATGTGATTGCCACCAGCGGACCGTGCAGTTGAAGCGGCAGGTGACGTTGACGTTCTGCACTACTGGATAAAACCGGCACCATCACACTCGGCCATCAGGCGTCGGGTTTATCCCGCGCAGGGCGTGGATGGCGCTGGCTGACGCCGCACAACTATTCGCTGGCTGATGAAACGCCGGAAGGCCGCAGTATTGTGATCTCATAAGCAGCGTTTTAACCTGCGCGAGCACGATCTTCTGATCGCTCCATGCCGCCGCTGCCGTTTACTGCGCAAAAGCCGGATGAGCAGGATCCAACATCGACAACCCATGATCCATAAAGGTTCTGTCGGTACCATTCGTCGCCATGTTGGGCTAACGGTGGTCACTTCCCTACCGATGTTGATCCGTCGATCAGGTTGCGCGTCAGGGGCTTCACCGCTGGTGGTGGTGGAAGGTTCTCGTATTGCGCAGGCGTTATTGCGCTGAAAGATATCGTCAAAGGCGTTATTAAAGAGCGCTTCGCCCAGCCACCAAAATAGACATTAAAACGGTGATGATTACCGGCGATAACCATCTGACTGCCTGCCGCGATTGCTGCGGAAGCAGGTGTCGACGAATTTTCTCGCCGAAGCGACGCAGGAGCCAAACTGGCATGATCCGTCAGTATCAGGCGGAAGGTCGTTTATTTAGCGATGACCGGCGACGCTTTAACGATGCTCCGGCACTGGCGCGAGCAGATATCGCGGTGACACGATAGACTCCAGCACCCAGGCGGCGAAAAGGAGGCCAGACAATATATGGTCGATCTCGACTCTAACCCGACCAAGTTGATCGAGGGTGGTGCACGTTGGCAAACAGATACTGATGGCCGTGTGGCTCATGACCACCTTCAGCGTACTAACGTCGGCGAAATGCGCCGCCGGTATTCCGGCAGCATTCAGCAACGTATCCACCGGATAAAAATGCGCTGAACATCTGTGCCTACATTCGCTTGACTCCGCAATCCTCAGTGCGGTGATTTTCAACCTTATGATTATCGTCTTTTGATTCCCCTGGCGTTAAAAGGCGTGAGTTATAAACCGCTTACCGCTGCCATGTGCGCCGTAACTTATGGATTTACGGTCTACGGTGGGCTGCCGGGTGCGCGACATATCGGTATCAAAGTCGTTGATTTACTGTGACGTTTACGGTCTGGTAGTTTACATGAGTGGATTACGTCCGGCATTATCAACATTTATCTTTTCTGACAATTGATTACTGGCGGCGTTTGCCGCTGCTGACCGTACTTCAGAACGTGGTGGTTTCCCTGGCAGGCCAATGGTTCGTTGATTCGTAAGGTGATACGGTAGCGGTTCGGCATTAATCGGGCAGGTATTTACCGTAGCAGCTGTTTTCATGATAAGCGCCCGTCGGCGGCGGCTGTGCCTATAATCCACAGGCTTCTGGCGAAGGAGCAATCCTGGCGGTCAGTAACCCTGGCTGGATAAACTAATATGCACGCGTTGCTGCATTACGGGCCGCTAACCCGGATGCCAGCGCGAGCATTCGAACTGGTGACGGCATCGGCAAGCGGGCTGGACAATAATATCACTTACGCAAGCAGCGGCCTGGCAAATCCCACGCGTGGCGAAAGCGCGTAATCTCGGCGTTGACAGCTCGCAACTGATCCACAAAATACGGCCAACAACCGCTGGTGAAATATATCAGCCAGCGGTTGTCAACATTATTGAACTCAATCTGGCGCTGGATAAACTTGATGAATAACGGGCGCCACGTCGGCCCGATCGTCTGCTGGAACAAACTGCCGCTGCCACGTCGGAAGCTGAGTTTTTCTTCGGTGCCTGTGCAGGCGTCGGGAAGACCTGGGCGATGCTGGCGAAGCCCAACGACTGCGGGCGCAAAGGGCTGGTGATCATTATGGTTGGCGTGGTAGAAACCCACGGGCGAAAAGATACCGCCGCCATGCTGGAAGGCTGGCTGTTTCTGCCGTTAAACGCGCCAGGCGTACCGTGGGCGGCATATCGGCGAGTTTGATCTCGATGCCGCCCTCGCCCGCCGCCAGCGCTGATCTTAATGGACGAACTGGCGCACGGTAAATGCGCCAGGTTCCCGTCATCCCAAACGCTGGCGGGATATCGAGAACTGCTGGAAGCTGGCATTGATGTTTTCACTACCGTCAACGTTCAGCATCTGGGGAAAGTGGATGATGTGGTCGGCGGCGTCACCGGAATTCAGGTAAGGGGAAACCGTGCCCGATCCTTTCGATGCCGCCGACGACGTGGTGCTGGTGGACGCTGGTTGATCTGCGCCAGCGGCTGAAGAGAGCAAGGTCTGTATTGCCGGGCAGGCGGGCGCCTTTCATTGAACATTTTCCGCAAGGTAATTGATCGCCTGCGCGAACTGGCACTGCTTAATGCTGCCGATCGCGTTGATGAGCAAATACGCGCCTGGCGGGGGCATCCTGGCGAAGAGGTGGCTGGCACGCGCGACGCGATCCTTTTATGCATCGGCCATAACACCGGCGCGGCGAAAAACTGGTCCGCAGCTACTTGACCAGCGTCACGGCGCTGGGTAGCGTCTGGCGCGGTGTAAATGTTGAAACCTGCCCTGCACGCTTACGGAAAAAAACGTCGGGCGTTCTCGGCGCCTTACGTCTGGCGGAACTGGGCACGGGAGACGGCAACACTTTCTGATCAGCGGAAAGCGGTAGTGCGTTATGCCGTGAACATAATAAACGCGATTGGCTGCTGATCGCCCGTACTCCGCGCCGCTGGTGGCGTCGGGAAACTTGCTGACCGACTGGCGCGCGCATCGCCTGATCTCGATCAGGTGCTGGTCGCGCTTGATGGAACCACCCGCCCGCACGATTAACAACGCGCCGGATAACTATCTTTAAAGACAAGTGGCGTGTACAAATTCAGGGGATGCGTGGTTGCCGCCGCGTTATGCGCCGTTATCACCTTAATTGCCATGCGTGGCTGATGGCGTTGATGCCGCCAACCTGGTAACAGCAATATCTGCTTGGCGTGGTGTGTGGTGGCGCTATTTTATGGACTGCTGGCCTTCAGTGGTTGCCGCCGTCGTGTGTAGTGAGTTTCGATCTCTTTTATCGCCCACACGGCACGCTCGCCGTCTCTGATGTGCAATATCTGCTGACGCTTCGCGGTGTTAACCGTCAGGCTGATCAGAACCTTACTGCTGGCGTGCGTTATCAGGCGCGGAGGTAGCCCGTTACCGCAGGCAACGCACGCGGCACCATATGAAATCATCAGCTCTGGCGGTGGGCCGCAGTCCGCAGGGATATCTTCACCAGCGAACAATTTACGCCTCCACGTTTCATGCCCGCAGTCGGGTGTTGTTGCCCGATGACAACGGTAGAAATTGCAGCCGTTAACATCCTGGGAATGACGCCAGTGGGGACAAAGTACCATCGCGCAGTGGAGGTTTGCGGTAAAGGCCTGCCTGCGGGCGCGGGCACTGACGCGTTACCCGGTGTACCGTGCCAGATTTTCGCCGCTAAAAGCGGCGAAAGCTCTACGGGCTGTTGGTGTGGTGGAGCCGGGGAGTCTGCGCCAGTTGATGATCCGGAACCAGCAGCGCTGCTGGAACGTTCGCTGTTGGTCTCTTATCATGGGCGGCTGACGCTAACCGCCAGCAGCGAAGAACAGGCGGATGGCAAACGAACGTGAACAGATCGCAACGCCCACTGGCAGCGCTGCACATGATTTACGCACGCCGCTTACGGTGCTGTTTGGTCAGGCCAATCGCCCAGCTTGTCGATCTGGCAAACGCAGAGGATCACCCCACGCCCGCCAAGGCCGGCGAGATCCGTCCAGCATAGTAGCGAACACTACCGACTGGTGAATAATCTACTGGAGTATGGCGCGAATTCAGTCCGGCGGCTTTAATTTGGAAAAGTGGTTAACGCTACGGAAAGAAGTAGTCGGCAGCGCTGCAAATGCTGGAACCGGGTTTTATCGTCTACCCATCAATCTTTCTCTGCCGAACCATGACCTCGATCCACGTTGACAGGCCGCACTCTTTTGAACGAGGTGCTGATTAATCTACAGAGAACGCCCGGGTGAAATATGCGGATTGCGCAGGCCGAATTGGTATCGTGCCCACGTTGAGGGCGAAAATCTGCAACTGGATGTCTGGGATAATACTTGGCCCCGGTCTTCCGCCAGGCCAGGAGCGGACTTTGATATTTGATAAGTTTGCTCGCGGGAATAAAGAGTCGAAGCGGAAGTACCAGAGTGGGGCGGACTGGCAATTTGTCAGGCGATAGTGGATGTACACGAAGGGCACTATTACCTGCGTTCAACCATTGGAAGGTGGTGCCTGTTTTTCATTATTACGCTTCACAGCCAAACTGCCCTGAACTGAAGAATTTCGCGGGATATATGACAAACGTTCTGGTTATTCGAATGAACAGGCGTATTCGTCGCTTTCTGCGCGCACGCGCTGGAGAACGACGGGATGCACGATCTTTGAGGCCGAAACGCTGCAACGCGGCTTATGGAAGCAGCAACCCGTAAGCCAGATTTGATTATTCTCGATCTCGGCGGCCTGCCCGATGGTGATGAGATTGGTTTATCCGCGACCTGCGCCAGTGGAGCGCAGTGCCGCAGTTGTGCTTTCCGCACGCAGCGAAGAGCGACCAAAATCGCCGCTGGATGCCGGAGCGGATGATTCTCTGAGTAAACCGTTTGGCGTGGCGAATTACGGGCCCGTCTGCGCGTCGCATTACACCTATACTCTGCCACCACCGCGCCCGATCCGCTGCTGTAAAATTTTCCGATGTTACCGTCCGGTTAACCGCCGCGTGATTGCCAGGGTGAGGAAGAGGTGCATCTCACACCAATTGAGTTCCGCCTGCTGGCGGTGCTGTAACAATGCCGGAAGAAGTACTCACCCAGCGCCAGCTTTCCTTAACCAGGTGTGGGGGCCAAACGCGGTCGAACACAGTCACTATTTGCGTATTTATATGGGACATCTGCGACAAAAACTGGAACAGGATCCCGCCCGCCCGCCATTTCATTACTGGGAAACCGTATTGAAAACATCGGTTTATGCTTTTGAATATTAATTTTAATACAGCTGCCTTTATTAATTAAAGCCGTAATAATAAAGCGGCTTTTATCTTCACAAAACAACACACAAAAGCTAACAATTCAATATTTTTATATTACTGAGTAAAAAGCTCATCATTAAATAAATTAAAAGATTGATCATTTTTATTGATCACCTTCACGGTTCAACCGCTATTTCTGGATAGAATATCTTCACCTTCATGGACAAACACCCAAGCAGACGCCGAAGATAGGCGACAGGCAAGTAGCAATACGTAACCGCG
+>480b21b8-8901-4db2-939d-ed2eb1fb0a64
+TTGTTCTTCGTTCAGTTACGTATTGTCTCACCTGTCTAGCTCTATCTTCGCGTCAGCGGGTGTTGTATGACCCGCTCGCCCACTCAAAACTTGCCTGTCGCTCTATCCTTCGGCGCGTCTGGCGGGTGTTTTAACCTATCCCCGCTGGCGGCAGAAAGAAAGTTTTGCCGTTAAAGCCCGCCATCAAACGAAATAAGCTCAACATTATGGTTTCACCGCTACCAAATTTGCCAGTTGGTATTGGTGATAAAGCTGGGCGGTATTCAGCATGAATCCCACGACAACCCTTAACGCTGCTGTGGATTAGGCGGCAGATGGTGCTGTCGAGCAGCATAAAAACAGCACCTTCCAGCCCAGCAATATTCGGGCCGAGAATGGCGCTGCGCAAAGATGTTAGCCAGTTCATCTCGGTCAGAACGCCAAGTGCGCGAAAGTACGCTCAGCGCCCGTTATTGCCGGGAAGGTCATCGTTAATCAGCCGCGCCAGCCCGCTGCCTAGAGGACGCGCCAGCGCAATAACACCAGCAGTAAAAAGCGTGGCGTCAGTAGAACCCTCGCGCAGCCATCAGAACGCCTCCCATTGATCAGGAGCGCAAACCCAGATAACTGATGAAAACACCAATAATACGCCGAGTTATCACGCCTGCACTCTGGTCCGCACCTCCAGTGGCCTAAAGAAATTGATACCGGAAGGGTAGAATTTCTGGCTGCAAGATTTCGCAAAATCTGCGGGCAGGGGTGTAAAAAAGTATCTTAAAAGCCATGATTTAACTAATGTTTGAAGTATTAATTTGCTTTTGTTAACTTAATTTACAGGATGAATAAATAAAACCGTAATAAAGCAAAAATAAGTGGTCGGATGGTAGTAAAATTACTGCAAAAGGCGGTACTATTTTCATCAGATAAACAAATTCTACATTTTTTCGATTGCCATTCACCGGGTGGAAATACAAAAGGAGAAAAGTATGGAACTCTACAGAGAATATCTGCGCCGAAACTTGTCTTTTTACGCCGTACTTATGCCACCGGTTGCAGCGGGCGTTCTGGCGCTGCCTTTCATCACTTTCTGGAAAGATAACGCCCGCTTTTACAGCTTCTGCATCGCGCGTCTGGTCAGAAAACCGGCGATAAACCGGTGTGGATGGATCAGGCCGAAAAAAGGCAACTGGTGATTTTATTGAGTTGCTGAGTTTTGAATACATTGAAAACCGCCAGCGGAAACGCTGGCGGTTTTTATATCAGAAGATGTTCCAGAGGAATATTTAGACATCGTTATGCAATCCGACATACATTCATGAAATATATATATAAATATTTTCCTAATTGTTTCTTATCGACAGATATCTCACTTAAAGACTTTCTTATAAATCTGTAGGGTTTCTTCTGTCAGACAAATAACCCGTCGCATCGGGATGAACGATGGGCGGAAAACCGGCGGCGCGTCTGAAGCGACATGACGCAGTATGGCGGTAGCGATAATCAGGGTTCAGCCGGGGTACGCATCAGTTGCCCCACCGGCATTAACCTGTTCGGGTGTGCCCCGGCGGTGACGTCAGCCATCGGTCAATCCGCTGCTCGGTGCAAGGTCCTTCCCGGTGAAACCGACGTCGCCCTGCCCGGCCCGCTGCCGTTCTTCTCCCGCACCTACAGCAGTTACCGGTTAAAACGCCCGCGCCGGTGGGGCCTCGGCCCCGGCTGAAAATGCTACGGATATCCGCTTACAGCTGCGCGATAACACACTGATACTCAGTGATAACGGCGGCAGAAGCTGTATTTTGAGCACCTGTTTCCCGGTGAGGCGGTTACAGCCGCAGCGAGTCACTGTGGCTGGTGCGCGGCGGCGTGGCGGGAAACTGGATGAAGGTCACCGGCTGGCCACACTCTGTGAGCGCTGTGAACTCGCTTAAGAATCCGCATAAGTTATCAGCGGCGACAAACAGTCCGCAGGGGCCGTGGTGGCTGCTCGGCTGGTGTGAGCGGGTGCCGGAAGCGGATGAGGTGCTGCCTGCGCCGCGCCGTACCGGGTACTGACCGGGCTGGTGGACCGCTTCGGGCGCACACAAGACGTTCACCGCAAGCCGCCGGTGAATTCAGCGGCGAAATCGCCAGCATTGACGGATGGTGCCAGGCGTCACTTCCGACTGGTACTGACCACGCAGGCGCAGCGGAAGAAGCCCGGCAACAGGCCATTTCCGGCGGGACAGAACCATCCGCTTTTCTGATACCCTGCCGGGTTACACCGAATATGGCCGGGACAACGGCATCCGTCTGTCTGCCGTGTGGCTGACTGCCTGACGGAATACCCGGAGAGGAATTTACCTGCCGCGCCGCTGGTGCATATGGCTGGACGCCGCGAGCGAACTGGCAGCGGTGTATGACCGCAGCAATACACAGGTGCGCAGCTTTACTTACGATGATAAATACCGGGCCGGATGGTGGCGCACCGTCACGGGCCGACCGGAAATGTTGCCGTTACGACAGCGACGGGCGAGGGTGACAGAACAAGCTAAACCAGCAGGCTTAAGTTACGTATCGGTATGAAAGGACCGCATCACCATCACCGGTAGCCTGAACCGCCATGTTACCGCACACTGCGGTGAGCGGGCTGAAGCCAGGTGGTGAAAAAGAACACGCGGACGGCAGCGTCACATGAGTCAGTTTGACGCCGGTGGGCAGGCTCGGGGCACAGACGGATGCCACCAGGCAGGACTGGCAGAATACAGTCGGATGTGACGGGCCTCATCACGCGCATCACACCGCCGGATGGCGAAATCGGCGTTTCACTATAACCACAGCCAGTTAACGTCAGCCACCGGGCCTGACGAACATGGAAATACGCCGGGAGATATGATGTATGAATGGGGCCGTCTGATTCGGGAAACTGCCCTGACGGCGATATCACCCGCTGGTGCGATAATCCACGATGACTTACCCTGCAACGGAAGATGCACACCGGCAACGGAAAAACCATGACGCGTGGAGCCGTTACGGTCAGTTGCTGACTTCCTTGACTGTTCCGGTTATACTTAACCCGCTATGACCATGACCGTTTGGTCGGAAGTGACGGCGGTGCACCGCGAGGAAGAGGGCTGAGTCAGTACCGCATACGACGGCCGTGGACAGTTAATTGCCGTGAAAAGACACAGGGCCATGGAAACGCGGTATGAATACAACGCCGCCGGTGACCTGACCACCACCGTCATTGCCCCGGACGGCAACGAAACGGGACGCTGATGCGTGGGGAAAAGCCATCTGTACCACGCAGGGCGGATCCTGACGCACCAGTATGGAATACGATGCTGCCGGACAGGTCATCCACCCTGACCAGTGAGCAGCGGCCACCACCTTCCGTTACGATGTACTCGACCGGCTGATACAGAAACCGGCTTTGGCGGCCGCACACATACCTATCACCGACCTGACCAGCGAAACTTATCGCAGCGAGGATGAGGGGCTGGTCACCCGCAGCTTTACTATGACAAACAGACCGCCTCACGCACCGCACCGTGAATGGCGAAACCGCAGAGCGAGTGGCAGTATGACGAACGCGGCTGGCTGACAGACATCCAGCCATAACTTCAGCGAAGGGCACCGGGTGACGTGCACTATAGTTCTATGACAGTAAAGGCCGCCTCGCCGAGTGAACACCTGACGGTGCATCATCCGCAGACCGATGAACTGCTCTGGCAGCGCCGAGACCAGACCATGCGTACAACGCACAGGGACTGGCGAACCGCTGTATACCCGGACAACCTGCCGCCGTGGAATGGTGACCGCCGGCAGCGGCTGGCTGTCAGGCGCCAGAACTCGGCGACGACACACCGCTGGTAGATGCACGCGACCTGCACCGCGCGGAAACGCTGCGCAGCTTCGGCCGTTAGACTCACCGCAACATACCCTGCCGGGCAGTTTACAGAGCCAGCACCCTGAACAGCCCTGCTGTCTGACCGCGATTACCTGGAACGACAACGGCGAACTCATCCCGCATCAAACGGCCCGCGCCAGACGGAGTTACAGCTACAGCACCACCAGCAGGCTGACCAGCGTTCACACCACCGCAGCGAATCTGGATATCCGCATCCCGTACCACAGACCCGGCGGGTAACCATACCGACCCGGGACTGCTGCCGGACAGCGCCCTCAGCATGGCCCGGATAACCATGTCATACGTGACGCACTATCTTTGCCGGTATGACCGTCGGCAGGCTGACAGAAAACCGACCTCATCCCGGAAGGGTTATCCACACGGATAGAGTAAGGCGCGCACCACCGGTACCATTACGACAGTCAGCACCGGCTGGTGCACTACCGCGGACACAATAACATGCAGAGCCGCTGGTCGAAGATCGCTATCTTTACGACCCGCTGGGCCGCAGGGTGGCAAAACAGGTATGGCGGCGTAGACGGGACCTGACGGGCTGGATGTCGCTGTCACGGAAACCACAAGTGACCTGGTACGGCTGGGATGGCGACCGCCTGACCTGATACAGAACGACAAGAACCCGCATCCAGACGGGATTTATCTATTCACGCGCAAACCGGGGAGCTTCACGCCACTCATCAGGGTTGAAACCGCCACCGGTGGAGCTGGCGAAAAACGCAGCGCCGCAGCCTGGCGGATACCCTTCAGCAGTCCAGTGGCGGCGAAGACGGTGGCAGTGTGTTCCCGCCGGTGCTGGTTGCAGATGCTCGAACCGGCTGGAAGGTGAAATCCTGGCTGACCGGGTGGTGAAAACTCGCCGCTGGCTGACATCGATGCGGCCCTGACTGGTGGCACCGGATAAACCAGATGGACCGGTATACACGCCGGCGCGAAAATTCACCTGTACCGCCACGACCATCGCGACCGCCACTGGCCCTTATCGGCACGGAAGGACAACGGCGTGGTACGCAGAATACGATGGTTAATTGTGCTGGATAGAGAACCCGCATCAGCTACCCCGGCGAAACATCGCCTGCCGGAGACGTAATGCGCATGATGAGAGGTCCGGCCTGTATTACAACCCGCCACCGCTATTATATGACCCGCTGCAGGGCGTGCTATCGCCTCAACGGGATCGATTAGGCTGAAAGGGGATGGAATTTTATCAGTATCCGTTGAATCGATCTCGCAAATAGCACTGAATCCATTAGGACAGAAACGCCAAATGCATTAAGCCACTGCATTCAATGGGCGGAACTGGTGAAAAGCGGTCCAGATATGGAATCCGTTTATCATCAATATCTTTGTGTCCCCAGATGTTAAAGGGGACTATACTTGTGGTGGCAAGACCAACGGGGAGAATCAAAGGAGATGGTCTATGGGGGCCAGGTAAAACAAGTAATGATACAAAAGAAACGCGGCCCGTTGTGACCCCATCGTTGAAACCGATAATAGTTGTAGGTTAAATTACACCCAAACGGAACGCCGAAGATAGAGAGCGACAGGCAGAGCAATACGTAAAAAAAGA
+>44b26523-eaf0-4f28-87ad-4cca044fabc8
+ATGTTGCCTCGATGATGCTTCGTTCCGGTTACGTATTACTGCTTGCCTGTCGCTCTATCTTCGGCGTCTGCTTGGGTGTTTAACCTCGACATTTCATATAAGTGCCGTGTGCGTTGCTCGCGGTAACATTTCCCGCGCCTGATAACGCGCACGCCAGCAGTAAGGTTCCCGATCACCAGCCCGACGGTTAACATCACCGCGAAGAAGGTCAGCAGATGTGCACATCAGAGACGGCAGGCGTGCCGCGTGGGGCGATAAAAAGAATCGAAACTGCTACGTGTAATGACGGTGGCAACCACTGAAGGCCAGCGTCCGCAAAATCGCGCCACCACCACCACGCCAAGCAGATACAGCATCACCAGGTTGGCGGCATCAAACGCCATCCCAGCCACTGCATGGCAATTAAGGTGATAACGGCGCATAACGCGGCGGCAACCACGCATCCTGAATTTGTACACCACTTGTCTTTTAAAAGAGCGGTTATCCGGCGCGTTGTTAATCGTGCGGGCGGGTGGTTCATCCAGCGCGACCAGCACCTGATCGAGATCGGGGGCGATGCGCGCCAGTCGGTCAACGACGTTTCCCGACGCGCCACCAGCGGCGCGAGGCCAGGCGACCGAATAATCTGCCGAGATTATGTTCACGGGCATAACACTACCGCTTTCTCTTCCGCTGGATCAGAAAGTGTTGCCGTCTCGCGCCCAGTTCCTGCGCCAGACGTAAGGCGCTGAAAATTGCCGACATTTTTTTTCCGACCAGACGGTGCAGGGCAGGGGTTTCAACATACACCGCGTGCCGGAACTTTACCAGCCGTGACGCCAGCCCGCGCCGCTGCGCAGACCAGTTTTTCGCTGCCGGCCATGGCCGATGCATAAAGAATCGCGTCGCGCGGTATTGCCACACTTTCTCTTCGCCAGGATGCCCCGCCAGGCGCATTTGCTCATCAACGCGATCGGCAGTACGGCGCAGTGCCAGTTCGCGCAGGGCGATCAGATTACCTTTGCGGAAAAATGTTCAATGGCGCGCTCCGCCTGCCCGGCAATATAGACTTTGCCTTCTTTCAGCCGCTGGCGCAGATCGTCCGGGGCAAGTCCACCAGCACCACGTCGTCAGCGGCATCGAGAAAAGGATCGGGCACGGTTTCCCGTACCTGGCAAGATTCCGGTGACGCCGCTGACCACATCATTCAGACTTTCCAGATGCTGAACGTTGACGGTAGTGAAACATCAATGCAGCTTCAGCAGTTCTTCGATATCCTGCCAGCGGGATGACGGGAACCTGGCGCATTACTGTGCGCCAGTTCGTCCGATAAGATCAGCACGCCGGGCGGCGGGCGAGGGGCGGCATCGAGATCAAACTCGCTGATATGCCGCCCACGGTACGCCTGGCGTTTTAACGGCTTAGAACAGCCAGCCCTTCCAGCATGGCGGCGGTATCTTTAAGCCCGTGGGTTTCTACCACGCCAACCACAATATCCAGCCCTTGCGCCCGCAGTCGCTGGGCTTCTGCCATCGCCAGGTCTTCCCGACGCCTGCACAGGCTTCGAAAACTTTCAGCTTCCCCGATGCGGCGCGGCAGTTTGTTCCAGCAGACGATCGGGGTCGGGACGTAAGGGTTCGTTATTCATCAAGTTTATCCAGCGCCAGATTGAGTTCAGCAATGTTGACAACCGGCTGTGATATATTCACCGGCGGTTGTTGGCTGTATTTTGCGATCCAGTTGCGTGCCAACGCTGAGATTACGCGCTTTCGCCACGCGTGAGTTTATGAGCCGCCGCTTGCGGGTGATATTATTGTCCAGCCGCTTGCCGCGATGCCGTCACCAGTTCAACCGGAACGCTCGCGCTGTCCGGGTTAGCGGCCCGTAATGCAATAACGCGTGCGGCTATTAGTTTATCAGCTCAGGTTACTGACCGCCGTTGCTCCCGCCAGAAGCCTGTATGGATTATAGGGCATTTCCTGCCGTTGCCGACAGGCGACCATGAAAATAGCCGTTGCCGGTAAATTCTGCCCGATTAATGCGAACCGCGCACCGTATCACCTTCACGAATCAACGAACCATTGGCCTGCCAGGAAACCACCATTGCCCCAGTACGGTGTTGGTCAGCGGCGGGTAGAAACGCCGCCAGTAATCAATAACAGAAGATAAATGTTACGATGAAATGCGCGGACGTAATCCACTCATGGTAAACCTCGCAGACCGCAAACGGTCAGCCGGTAATCAATGACTTTGATACCGATAAACGGCACCAGCAGCCCACCCAGACCGTAAATCCATAAGTTACGGCGCAACATGGCAGAAGCGGTAAGCGGTTTATAACTCCACGCCTTTTTAACGCCAGAGATCAAAGACGGAATAATCAAGGCGTTGAAAATCACCGCACTGAGGATTGCGGAGTCGGGCGAATGCGGGCACATGATGTTCAGCGCATTTAACTGCGGATACGTTGCCGCGAATGCCATGGAATAATGGCGAAATATTTCGCCACATCGTTGGCAATGCTGAAGGTGGTCAGCGAGCCACGGGTCATCAGCATCTGTTTGCCAATGTGCACCACCTCGATCAGCTTGGTCGGGTTAGAGTCGAGATCGACCATATTGCCCGCCTCTTTCGCCGCCTGGGTGCCGGGTTCATCGCCACGCGACATCTGCCTGCGCCAGCGCCGAACATCGGTGCCGTCGCCGGTCATCGCTGCAAACGACCTTCCGCCTGATACTGACGGATCAATGCCAGCTTGGCCTCCGGTGTCGCTTCGGCGAAAATCATCGACACCCGCTTCCGCAGCAATCCCGCGGCGGCAGTCAGACGGTTATCGCCGGTAATCATCACCGTTTTAATGCCATTTTTGCGCAGCTGGGCGAAGCGCTCTTTAATACCGCCTTTGACGATATCTTTCAGCGCAATAACGCCCAGCACACGAGAACCTTCCACCACCACCAGCGGCGTGGCTCCCTGACGCGCAACCTGATCGACTTTTGATCCAGCATCGGTAGGGAAGTGACCACCGTTAGCCTAAACATGGCGACGAATGGCATCGACAGAACCTTTACGGATCATGCGGTTGTCGATGTTGATCCCGCTCATCGGCTTTGCGCAGTAAACGGTACAAAGGTGGCATGGAGCGACTGCACATCGCGCTCGCGCAGAGTTAAAACGCTGCTTGGCGGGATCACAATACTGCGGCCTTCCGGCGTTTCATCAGCCAGCAAAGCCAGTTGGCTGCGGCGTCAGCCAGCGTTTTCATCCACGCCCTGCGCGTCGCTTCCGACGCCTGACGGTTACCGAGTGTGATGGTGCCGGTTTTATCCAGTAGCAGAGCGTCAACGTCACCTGCCGCTTCAACTGCACGTCCGCTGGTGGCAATCTACGCTCGCGCCTAACATCCGGCTCATCCCGGCGACGCCCGTCGCTGACAACAGGCCGCCAATAGTGGTTGGGATCAGACAGACCAGCAGCGCCACCGAGTACCGTTACGCTGACTTTGCATTACCGCCCACGCGGAAAACGGCCACAGCGTGGCGGTTGCCAATAAAGACGATAGTCAGGGCAATCAGCAGAATGGTCCAGGGCAATTTCGTTCGGCGTTTTGCGATCATGTGCGCCTTCCACCATCGCGATCATCCGATCCAGAAATGTCTCGCCGGGTTAACGCCACCCTCAATCACCAGCCAGTCAGAAGAATACGCGTGCCGCCGGTGACGGAGGCAAAATCGCCGCCAGTTCTGCGGATCACACCGGTGCCGATTCCCCGGTGATGGCGCTTTCATCGACCAGTACACCTTCAATAACTTCACCATCGCAGGATAGCTATCGCCAGCTTCTACCAGTACGATATCGCCTTTACGAAGTTGGTCAGCGGGAACTTTGTCCGCCGCAGCGCCATGTTCGGCTCACGCAGCTTGCGAGGCAAAGGCAGTTTTTTCACCTTTCAGACTGTTGGCCTGCGCTTTACTGCGGCCTTCTGCCGCCTCGGCAGAATTAAGCAGAACAATTGCGGTGATCCACAGCCAACCATATTGGCCGCGCTAAACAGCACATTGCCGGGCATCACTTGCCGCTTGCCATCGCGATGCTAATACAGGTGGTCAGCAGACTGCCGATCCCAGACTGATAAACATCACCGGATTGCGCCATTGCGCCTGCGGGAGTTTTAATTTTTTCACCGCTTCTTTCAGCGCCTGAACGACAAGTGTTGGTTCGAATAGCGCCAGTTGTTTACACGACTCGCCAGTGCTCCTCAATATCATCAGGAGATATTCCGCCACCGGACCAAGCGCCAGAACGGGGATAAAGGTCAGTGCGCCAACCAACCCAACACGGTGCCGATTAACAGGCCAACAAACAGCGGGCCGTGCGTTGGCAGCGTGCCGGAGCTGGCGGCTTGGCTCTTTTACTCACCAGCGAACCGGCGATTGCCAGCACCGGGATAATCACCCCGAAGCGACCGACAAACATGCAGAACGCCAGTAAACGGTTCCAGAACGGAGAGTTGGCGTAATCCGGCAAGGCGCTGCCGTTGTTGTTAACCCGGCGGATGACACGGCGTACAGCACTTCGCTAAAACCATGCGGAGCCAGGGACGGAGCATGGCGCTACGATCCGGCGACCGGTCATCATCGCCAACGCCGCGCCCATCAGCACCAGCGTCGGGGTAACCAAATTGCCAGTGCAGTCAGTTTCATCTCGCGTACGTCGATTTTTTTGCAGATGTTCCGGTGTACGACCAATCATCAGCCCGGCAATAAACACCGCCAGCAGGACAAACATCATGCCGTGAGACCAGAACCGACACCGCCGAACACCACTTCACCGATTTGCATCAGCCACATCGGCACCATGCCACCGAGCGGTAAACCGTCATGCATCGCAATCACCGCGCCACGGAAGCCGCCATCGTCGACCGCAAACGGGCTACTGACCAGCACGCCGAAACAGCTCTCTTTACCTTATATTGATGCTGCTGTCGTGCCAGTGCCAGCAGATGAGGATACCCTGAACTTCTGCCCACATCACCACGCGCCTGCACGGATGACCAAATCACTGACATCGCCCACAGCAACATGCGCCCTGGCGGCGATCGCCCATCCCACTTCGCAAAGGCGAAGCACAGCGCCGTTGGGATCAAAGAGATCGCCAGCATCTGCGAAGTTGGTCGAGGTGCGGTTGGGTTTTCAAACGGATGCGACGAGTTGGCATTAAAGAAGCCACCGCCGTTAGTACCGAGCATCTTGATCGCTTCCTGAGAAGCTACAGGCTATGGGTAACATGTTGCGCTCCTTCAGCGAATTCACAGCCTGATGGGCGAAAGTTTTACAGCGCACCTTGTTGAATAAAAACAGTGCAATCAACAACGCCACAGGGACTAGCACCCATAACGTGATGCGTAGCAGATCGGCCCAGGCATTCCCAGGCGTGCTCATTATCTGGCGGGTAAACGCAGTTAAAGGGGTAAAAATCACCGCAATAATCCCGCTGGCGGCGAAGAAAAGTTTTGCACCGTTAAGCCCGCCATCTGGCTGAAATAGCTCAACGTGGTTTCCACCGCTATAAGATTGCCAGTTGGTATTGGTGACAAAGCTGTTGGCGGTATTCAAGCGCCAGATCCCACGACAGCCCTGGCAACTGCTGTGGATTAAACGGCAGATAGTGCTGACCGAGCAACGCAAAACAGCACCGCCAGCCCAGCATGTTCCGGGCCGAGAATGGCACGAATGTTGCTTCCAGTTCATCTCACGGTCAGAGACGCCAAGTGCGCGCGAAAAATGCGCGCTCAACGCCCGTTGTACCGGGAAGAGGAATGTCGTTAATCAGCCGCGCCAGCCCGCTGCCACAAAGGACGCGCCAGCACCATTAACACCAGTAAAAGCGTGGCGATCAGTGGAGAACCACTTGCGCAGCCATCAGAACCTCCGCATTGATCGGGCATAAACCCAGATAACCCAAAGGTTAAACGCAAGCAGACGCCGAAGATAAGAGCGACGGGCAAGTGGCAATACGTAATA
+>380cc868-0f9e-478b-b1df-70cbe6602339
+CGGTATTGCTTCGTTCGGGTTACGTGCCGCAGTTGCTGATACTTTGGCGTCTGGCGGGTGTTTAACCTGCGGATGCCGTTGTCCGGCCATATTCGGTGTTCGACGACGGGAATTATCAGAGCGAAGACGGTTCCGTCCGCCGAAATGGCCTGCTGCCGGGCTATTCTGCCCGCTGCCTGCGTGGTCAGTATAGCCGGAAGTGACGCCCGGCATATCCATCACGCCGGTGATTTCGCCGCTGAATTCACCGGCAGCGCTGGCGGAACGATACCAGCAATGCGCGAAGCGGTCCACCAGCCAGTCGAGTACCCGGTACGGCAGCAGCGGCGCAGGCAGCACCTCATCCGCTTCCGGCACGCTCACACCAGCCAGAGCAGCCACCGGCTACGGACTGTTTGTCGCCAGATAACGATGCGGGCTTAAGGTTCTTCCGGCAAGCGCCTGCCAGAATTTGACCAGCGGTGACCTTCATCCAGTTTCGCCACCACCGCGCAGCCACCGGCCCAGCTCGCTGCAACCGTCCTCACCGGGAAACGGGTGACCAAATCTGGGCTTCTGCCGCCGTTATCCACTGAGTATCAGTGTGTTATCCTTACTGCTGTAAGCCGGATATCCGCAGGCATTTTCCAGCCAGGGCCAGAGCTCCCCACCGGCGCGACGTTTCGTCGGTAACTATAGCCGGTGCGGGAAGATGAACGGCAACGGGCCGGGCAAGGGCGATATCGGTTTCACCGGGAAGGACCTTTACCGAGCAGCGGATTGACCGTTGGCGGACGTCACCCGCCAGGCTACCGAACAAGGCCACGCCGGTCAGGGGCACCGATGCGTACCCCAGCTGAACCCTGGACAATGCGCTACCGCCATACTGCGTCATGTCGCCCTGACGCGCCGCCGATTTTCCATCATCATAACAAATGTGTTTATCGGGTTATTTGTCTGCTGACAGGCGAAACCCTACAGATTTATAAAGAGAGCCTTGGTGAGATATCTGTCCAAGATAGAACAATTGGAAAATATTTATATCTCTTTCGCGCCAGATATATGTTTCGATTGGTACTAAAACGATGTCTAAATATTCCTCGAACATCTTCCTGATACAAAAACCATGGCGTTTCCGCACGGCTGATTTCCAATATTCAACTCAAAATCAATAAAATGCTGGTTGCCTTTTCGGCCTGATCCATCCACCCGGTTTATCGCTGGTTTTCGATGAACACGATGCAGTAGCTGTAAAAGCGAACTTGGTCTTTCCAGAAAAGCATGAAGGGCAGCGCCGAGCGCCACTGCAACCCGCAAAGAGTACGGCGTAAAGATAAAATATGCAGGATATTCTCTGTAAAGAGTTCCATGCTTTCTATACCTTTTGTATCACCGGTGAATGGCACCGGAAAAATGGAGGAATTGTTTATCTGATGAAAAGTAGTACCGCCTTTTGTATAATTTTACTACTCGATATTCACTTATTTTTTGGCAGTGATGGACTGTTACATTTCATCCTGTAATTAAAGTTACACAAAGTTAAATTAATACTAAACATTCGTTTAAATCATGGCTTTTACCATTTTATACTTTTTACACCCCGCCGCGTTTTTGCAGAAATCTTTTACGTAATTCTACCCTTCGGTATCACTTTTGGCCACTGGGGTGCACTGTGAGTGCAGGCGTGATAACCAGCGTAACTGGTGTTTTATTGCCGGTTATCGGTTTTATGCCTGATCGAAATGCGGAGCGTTCTGATGGCTGCGCAGGGTTCTTACAATCGCCACGTTTTGCTGCAGGTGTTGGCGGTGCTGGCGCGTCCTTTGGGCAGCGGGCTGGCGCCCCGGCTGATTAATATTGTCCCCTCTTCCCGGTACAGCGGGCGTTGGTACGTGCTTTTTTCTGCCCGGCGTCTCTGACCGTGGGAGATGAACTGGAAGCCAATATCTTTGTGCCATTCTCGGCCTGAACATATGCGGGGCTGGCGGTGCTGTTTTATGTTGCTCGATTAAAGCTTTACTATCCACCTTCAGCAAATCCACAGCAGTTGCCAGGGCTGCCGTGGGATCTGGCGCTGAATACCGCCGTCAGCTTTGTCACCAATACCAACTGGCAATCTTATGGCGGTGAAACCACGTTGAGCTTCTTTCAGCCAGATGGCGGGCTTAACGGTGCAAAACCTTTCTGCCGCCAGCGGGATTGCGGTGATTTTGCCCTCATCCGTGCGTTTTACCCGCCAGAGCATGCGAGCACGCTCAGGGAATGCCTGGGTCGATCTGCTACGCATCACGTTATGGGTGCTAGTCCTGTGGCGTTGTTGATTGCACTGTTTTATTCAACAAGGTGCGCTGCAAAACTTTCTGCCTTATCGGGCTGTGAATACCGTTGAAGGAGCGCAGCAGCTGTTACCCATGGGGCCTGTGGCTTCTCAGGAAGCGATCAAGATGCTCGGTACTAACGGTGGCTTCTTTAATGCCAACTCGTCATCCGTTTGAAAACAACCGCACTGACCAACTTCGATTGCGGAATGCAGCGATCTTCTTGATCCCAACGGCGCTGTGCTTTGCCTTTGGTGAAGTGATGGGCGATCGCCGCCGAGGCATCATTGCTGGGCGATGTCCGGTGATTTTTATTATCTACGTAGGCGTGGTGATGTGGGCGAAGTTCAGGGTAATCCTCCGTCTGCAACGGGCGCGGACAGCAGCATCAATATGGAAGGTAAAGAGGCGTTTCGGCGTGCTGGTCAGTAACCTGTTTGCGGTCGTGACGGCCCGGCGGCTTCCTGTGGCGCGGTGATTTGCGATGCATGGTTGTTTACGCTCTCCGGTGGCATCGTTGCCGAATGTGGCTGATGCAAATTGGTGAAGTGGTGTTCGGCGATTATTGTCGGTTCTGGTCTTTACAGCATGATGCTGTGTTTTATTCTGCTGGCGGTGGTTTTATTGCCGGGCTGATGATTGGTCGTACACCGGAATATCTGGGTAAAAAATCGACGTACGCGAGATAGAAACTGACTGCACTGGCAATTCTGGTTACCCATTGCTTCGTGCTGATGGGCGCGGCGTTGGCGATGATGACCGACGCCGGACGTAGCGCCATGCTCAGCCACAGCCCGCATGGTTTTAATGAAGTGCTGTACGCCGTGTCATCCGCCGCTAACAACAACGGCAGCAGCGCCTTTGCCCGGATTAAGCGCCAACTCTCCGTTCTGGGCTGTTTACTGGCGTTCTGCCATGTTTGTCGGTCGCTTCGGTGATTATCCAGTGATGGCAATTGCCGGTTCGCTGATGATAAAGAGCCAAAGCCGCCAGCTCCGGCACGCTGCCAACGCACGGCCCGCTGTTTGTTGTCGATAAGCACCGTGTTGCTGGTTGGCGCACTGGCCTTTATCCCTGCCCTGGCGCGGGTCCGGTGGCTTGGGGCCATCTCCTGATGATATTGGTAGGCACTGAATATGAGTCGTAAACAACTGGCGCTATTCAGCCAACACTAGTCATCCAGGCGCTAGAAAGAAGCCAATTGAAAAATTAAACCCGCAGGCGCAATGGCGCAATCAGGTGATGTTTATCGATGCGGATCGGCAGTCCTGCTGACCACCTGTATTATCGCGATGGCGGCAGAGATTGCGATGCGTAATGCGCTGTTTAACGGCCATTAGCGGTTGGCTGTGGATCACCCATGCTGTTCCTTCATTTCGCCGAGATGACGAAGGCCGCAGTAAAGCGCAGGCCAACCAGTCTGAAAGGGGTGAAAAAACTGCCTTTGCCGCAAGCTGCGTGAGCGAAATATGGCGCTGCGGCGGACAAAATTCCTGCCGACAGCGTAAAGGGCGATATCGTACTGGTAGAAGCTGGCGATATTATCCCCCTGCGATGAACAGCGAAGTTATTGAAGAAGTTGCATCGGTCGATAAGCGCCATCACCGGGAATCGGCACCATTGATCCATTGATCCGGCGGCGGTGCCTCGTCACCGGCGGCGCGTATTCTTTCTGACTGGCTGGTGGATTGAGTGTAGCATTAACCCCGGCGAGACATTTTCTGGATCGGATAGTCGCGATGGTGGAAGGCGCACAGCGACACCGAACGCCGAACAGAAATTGCCTGACCGTTCTGCTGATTGCTGGCTATCCGTCTTTTACTGGCAACCGCCACGCTGTGCGTTTTCCGCGTGGGGCGGTAATGCAGTCAGCCAACGGTACTGGTGGCGCTGCTGGTCTATCCTGATCCCAACCACTGTGGCGGCCTGTTGTCAGCGATCGGCGTCGCCGGGGATGGAGCCGGATGCTAGGCGCGATAGTTGCCATAACCGGACGTGCAGTTGAAGCGGCAGGTGACGTTGACTGTTCTACTTCACTGGATAAAACCGGCACCATCACACTCCGGTAACCGTCAGGGCGTCGGGTTTATCCCCGCGCAGGGCGAATTGAAACGCTGGCTGACGCCGCACAACTGGCTTCGCTGGCTGATGAAACGCCGGAAGGCCGCAGTATTGTGATCCTCGCCAAAAGCAGCGTTTTAACCTGCGCGAGCGCGGTACGGTCCGCTCATGCCGCAGCTTTGTACCGTTTACTGCCGAAGCCGGATGAGCGGGATCAGCATCGACAACCGCATGATCCGTAAAGGTTCTGTCGATGCCATTCATTCGCCATCATTGAGGCTAACGTTGCGGTCACTTCCTACCGATGTTGATCAAAAAGTCCCGATCAGGTTGCGTCAGGGAGCCACGCGCCGCTGGTGGTGGTAGGAAGAGGTTCTCGTGTGCTGGGCGTGTGCGCTGAAAGATATCGTCAAAGGCGGTATTAAAGGAAGCGCTTCGCCCAGCTGCGCAAATAGACATTAAACGGTGATGATTGCCAGCGATAACCGTCTGACTGCCGCCACGGTGCTGCGGAAGCGGGTGTCGATGATTTTCTCGCCGGCGACACCGGAGGCTTAAGCTGGCATTGATCCGTCCAGTATTATCAGGCGGAAGGTCGTTTGGTAGCGATGACCGGCGACGGCTTTTAAGCGATGCTCGGCGCTGGCGCAGGCAGATGTCGCGGTGGCGATGAACTCCGGCGCAGGCGGCGAAAGAGGCGGGCAGCCATGGTCGATCGCCGACTCTAACCTGACCAGAAGTTGATGATCGAGGTGATTGCACATTGGCAAACAGATGCTGATGACCGTGGCTCATGACCCACCTTCAGCATTGCCAACGATGTGGCGAAATACTTCGCCATTCCGGCGGCATTCGCGGCAACGTACATCCGCAAAGTTAAATGCGCTGAACATCATGTGCCTGCGAATTCTTGACTCCGCAAATCCTCAGTGCGGTGATTTTCAACGCCTTGATTATCGTCTTTTTGATTCCCCTGGCGTTAAAGGCGTGAGTTTATAAACGCTTACCGCTTCTGCCATGTTGCGCCATGTATGGGTTACGGTCTGGGTGGGGCTGCTGGTGCCGTTTATCGGTATCAAGGAATATCATTGGTTACTGCGACCGTTTGCGGTCTGGTGTAGAAGGTTTACCATAGGTGGATTACGTCCGGCATTATCAATATTTATCTTTCTGTTATTGATTACTGGCGGCGTTTACCACTATGACCACCGCCATACTGGGGCAATGGTGGTTTCCCTGGCAGGCCAATGGTTTCGTTGATTCGTAGAAGGGTGATACGGTGCGCAGTTCGGCATTAATCGGGCAGAAATTTTACCGGCAACGGCTATTTTCATGGTCGCCCGTCAGCAACGTAGAAATACCTATAATCCACAGGCTTCTGGCGGGAGCAAATCGGCGGTCAGTAACTGAGCTGGTTCGGCTTTAATAGCCGCACGCGTTGCTGCATTACGGGCCGCTAACCCGGATGCCAGCGCGAGCGTTCCAGTTGAACTGGTGACTGGCATCGACGGCGGGCTGGACAATAGCATATCACCCGCAAGCGGCGGCCTGTAGCAAATCCACGCGTGGCGAAGCGCGTAAATCTCAGCGTTAGAACGGCTCACGCAACTGATCGCAAATACAGCCAACAACCACGCTGAGGTGAAATATATCGGCCAGCCGGTTGTCAACGTGTTGAATCAATCTGGCGCTGGATAAACTTGATGAATAACGAACCCTTACGTCCCGACCCCGATCGTCCTGCTGGAACAAACTGCCGCGCCGCATCGGGGAAGCTGGTTTTCTTCGGTGCCTGTGCAGGCGTCAGGAAGACCTGGGCGATGCTGGCGGAAGCCAGCGACTGCGGGCGCAAAGGCTGGATATTGTGGTTGGCGTGGTAAAACCACGGGCGAAAAGATACCGCCGCCATGCTGGAAGGGCTGGCTGTTCTGCCGTTAAAACGCCAGGCATTACCGTGGTGGCATATCAGCGAGTTTGATCTCGATGCCGCCCTCGCCCGCCACCCGGCGCTGATCTTAATGGACAGGAACTGGCGCACGGTAATGCGCCAGGTTTCCGTCATCCCAAACGCTGGCGGGATATCAGAAGAACTGCTGGAGCTGGCATTGATGTTTTCACTACCGTCAGCATTCAGCATCTGGAAAGTCTGGAATGATGTGGTCAGCAGCGTCACCGGAATTCCAGGTACGGGAGACCGTGCCCGATCCTTTTCGATACCGCCGACACGACGTGGTGCGGGTGGACTTGCCCCGGACGATCTGCGCCAGCGGCTGAGAAAAGAAGGCAAAGTCTATATTGCCGGGCAGGCGGAGCGCGCCATTGAACATTTTCCCGCAAAGGTAATCTGATCGCCCTGCGCGAACTGGCACTCGCCGTACTGCCGATCGCGTTGATGAGCAAATGCGCGCCTGGCGGGGGCATCCTGGCGAGAAAATTGTGGCACACGCGCGACGCGATCCTTTTATGCATCAGCCATAACACCGGCAGCGAAAACTGGTCCGCGCAGCGCGGCTGGCGTCACGGCTGGGTAGCGTCTGGCACGCGGTGTATGTTGAAACCCCTGCCCTGCACCGCTTACCGGAAAAAAACGTCCGGGCAATTCTCAGCGCCTTGCCCACGTCTGGCGCAGGAACTGGGCGCCGGAGACGCTTAACCACTTTCTGATCCAGCGGAAGAAAGCGGTAGTGCGTTATGCTTCGTGAACTATAATCTCAGCCAAGATTATTCTCGGTCCTTGACCTCGCGCCACTGGTGGCGATCGGGAAACGTTGCTGACCGACTGGCGCGCATCGCCCCGATCTCCGATCGAGTGCTGGTCGCGCTTGATGAATCACCCGCCCGCACGATTAACAACTGGCACCGGATAACCGCTCTTTAAAGACAAGTGGCGTGTACAAATTCAGGGATGCGTGGTTGCCGCCGCGTTATGCGCCGTTATCACCTTAATTGCCATGCAGTGGCTGATGGCGTTTGATGCCGCCAGCGGTGATGCTGTATCTGCTTGGCGTGGTGGTGAATGGCGCGCTATTTATGGACGCTGGCCTTCGGTGGTTGCCACCGTCATTAATGTAGTGAGTTTCGATCTCTTTTTATCGCCCACGCGGCACGCTCGCCGTCTCTGATGTGCAATATCTGCTGACCTTCGCGGTGATGTTAACCGTCGGGCTGTTGGGGAACCTTACTGCTGGCGTGCGTTATCAGGCGCGGGTAGCCCGTTACCGCGAGCAACGCACGGCACTTATGAAATGTCGAAAGCTAGGTTAAACACCCGAAGCAGACGCCGAAGATAGAGCGACAGGCAAATGCTGTACGTGAAAAGCGTC
+>60664444-cccc-41e7-b7a6-5c4c14343658
+TTGTGTACTTCGTTCCAGTTACGTATTGTTTTCTGTTGGTGCTGATGTTGCAGCGTCTGGCGGGTGTTTAACCTCTCATCATCCGTGCGGATAACCCCTTCCGGGATGAGGTCGGTTTTCTCTGTCAGCCTGCCGTTGACGGTCATACCGGTAAAGATAGTGCGCGTCACGGGCGATACGGTTATCGACACATGCTGAGGGCGCTGTCCGGGATACGCTCCGGGTCGGGCAGGCGGTTACCTGCCGGGTCTGTGGTATACGGGATGCGGATATCCAGATTCGCTGCAGTGGTGTGAACGCCGGTCAGCCTGCCAGTGGTGCTATGGCTGTCAGGTCTGGCGCGGGCTGCTGATGCGGATGAGTTCGCCGTTGTCGTTCCGGAATTGTAATCGCGGTCAGACAGCAGGCTGTTCAGGCGGTGCTGGCTCTGTAACTGCCCGGCAGGGTATAAGCGATTGGTAGTTCGCAACGGCCAGCTGCGCAGCGTTTCCAGTGCGGGCGGTCGCGGGTGGCTCCACCAGCGGTGTGTCGCCAGTTTCATGCCTGACAGCCAGCCGCTGCCGTAGGTCAGCCATTCCACGGCGAACTGACTGTCCGGTATACAGCAGTTCGCCAGTCCTGTGCGTTGTACGTGTCTGGTCTCATGCTGCCAGAGCAGTTCATTCGTCTGCCGGATGATACCGTCAGGTGTTCACTGGCAGAGGCAGCCTTTACTGTCATAACCATAGTGCACCGTCACCCGGTGCCCTTCATGATATGGCTGATGTCTGTCAGCCAGCCGCGTTCGTCATGCTGCCACCGCTCTGCAGTTTCGCCATTCACGGTGCGGTGCGTAGAGGCGGTCTGCTTCATCATAGTGCCAGTGGTGGCCAGCCCCTCATCCTCGCTGCGGATAAGTTTGCCGGTCGGGTCGAGGTGATAACGCTGTATTTTGCGGCCGTCAAAGCCGGTTTCCTGTATCAGCCGATTAATTACGCGCATCGTAACGGAAGGTGGTGTAATACCGTTTTCACTGGTCAGGCGGATGACCCGTCCAGCGGCATCGTATTCCATACTGCGCGTCAGACCGCCCTGCGTGGTACAGATGGCTTTTCCCGCATCGTACTGTGTCCCGTTTCTGCTGCTGCCGTCCGGGGCAATGACGGTGGTCAGGTCACCGGCGGCGTTGTATTCATACCGCGTTTCATGGCCCTGCGTGCTTCACGACGATTAAACTGTCGGCTGTCATGCACGGTACTGACTCAGCCTTCCTCGCGGTGCACCGCCGTCACCCTGACCAAAACGGTCGCATGGTCGCAGCGGGTTACATAACCGAACAGTCGGTGAAGCTCAGCCAACTGACCGTAACGGCTCCACGTCGTTTTCCGGCTGCCGGTGCTTCCGTTGCGCAGGGTAAGTCCTGTGGATTGTCATAACGGTAGCGGGTGATATCGCCGTCAGGGGCAGTTTCCTGAATCAGACGGCCCCATTCATCATATTCGGCGTATTTCCAGCCCGTGGAGCCGGTGGCTGACGTTAACTGGCTGTGGTGGTTATAGTAAAACGCCGTGCCCACCGCATCCGGCGTGGTGATGCGCGCGTATTAAGGGCCCGTCACCCACATCGGACTGTATTCTGTTGTCCTGCACCTGCGGCATCCAGATGCAACCTTTCAGGAGCCTGCCCACCGCGTCAAACTGACTCACTGACGCTGCCGTCGCGTGTTCCTTTTCACCACCCGCTGTGCCTACCCTGCGTGTGCGGACTTCACGGCAAAGTTCAGGCTGTCAGTGATGGTATTGCGGTCCTTCTCATACTGATTAACTTAAACTGCCGGGTTTAGCTGTTTGTCGCCCGCCCGTCATGTCGTAACGGTAACTGAATTTCCGGTCGGCCCGGTGTGACGGTGCACTTACCATCCGGCCCCGGTATTTATCATCGTAAGTAAAGCTGCGCACCTGTATTGCTGCGGTCGCCCGCCACTATCCAGTTCGCCGCGGGGCGTCCAGCTTCGCGCACCAGCGGCGCGGCAGGTAAATTCTCCGGGTATTCCGGGTCGTGCGTCAGCCACGGCAGACAGACGGATGCCGTTGTCGACCATATTCGGTGTAACCCGGCAGGGTATCAGGAACGGACGGTTCCCGTCCCGCCGGAAATGGCCTGCTGCCGGGCTTCTTCTGCCCGCTGCGCCTGCGTGTTCAGTACCAGCCGGTGACGCCCGGCACCATCCTCTGCCGGTGAGAGGATTTCGCTGAATTCACCGGCGGCTTCGCAGTGGAACGTCTGTGTGCGCCCGGCGGTCCACCAACGGTCAATTACCCGGTACGGCAGCTGGCAGCGGCTGGGCAGCACCTCATCCGCTTCCGGCGCCGCTCACACCAGCCAGAGCAGCCACCACGGCTGCGGACTGTTTGTCGCCAGATAACGATGCCGGACTTAAGCCGGGTTCTTCCGGCAGCGCCTGCCAGAACTGCGGCCGGCAGTGACCTTCATCCAGTTTCATACGCCGCCGCGCACCGGCCAGTGGCTCGCTGCGGCCAACCCGTCCTCACGGAAACGGAACTCAAATACAGGCTTCTGCCGCCGTTATCACTGGTATCGGTGTGTTATCCGCTGGCTGTAAGCGGATAATCGCAGGCATTTTCCAGCCGGGGCCAGGGCTCCCCCACCACCGGCGCGGGCGTTTTTGTCCGGTAACTGCTGTAGGTGCGGGAGAAGGATGAACGGCAGCAGGCAGACGGGAGACGTCTCGGTTTCACCAGGAAGGACCCTTTGCACCGAGCAGCGTTGACCGGATGGCGGATCACCCGCCGGGGCACACCGGAACAATTACGCCGGTGGGGGCACCGATGCGCCCCGGCTGAACCCTGGACAATGCTACGCCATACTGCGTCATAATCGCCCTGACGCGCCGCCGGTTTTTCCGCTCATCTGCTCATCCTTGTTTTATCGGGTTGTTGTCTGCTGACAGGCCCGAAATTCCCTACAGATTTATAAAAGCCTTAAGTGAGATATCTGTCAGATAAGAACAGTGGAAAATATTTATATATATTTCATGAATATATGTTTCGATTGGTATAACGATGTCTAAATGTTCCTCACAGACATCTTCCTGATACAAAAAACCGCCAGCGTTTCCTTTAGCCGGTTTCAATAATATTCAAAACTCAGCAATCAATAAAAATCACCAGTTGCCTTTCGGCCTGATCCATCCACACCGGTTTTATCGCTGGTTTTCGACCAGACGCGATGCAGGTAGCTGTAAAAGCAGGCGCGGTCACCAGAAGAAGAAAAACGCAGAAAGGCAGCGCCAGAACGCCCGCTGCAGCCGCATAAATTGCAGCGTAAAAGATAAACCATGCAGGATATATTCTCTGTAGGTTCCATACTTTTTCTCCCCTTTTGTATCTACCGGTGAATGGCACCGGAAAAATGAATTGTTTATCTGATGAAAATAGTACCGCCTTTGTGTAATTTTGCACTCGCCGACCACTTATTTTGCTTGGCTGATGGTTTTATTTACATTCATCCTGTAATTAAGTTACACACAAAAGTTAAAATTAATACTAAGCATTAGTTAATCATGAAACTTTTGCCATTTTATACGCACACCCCGCCCGCAATTTTTTTTGAAATCTTTGTAAATTCTACCCTTCCGAGTATCACTTTTAGGCCACTGGAGGTGCACTGTGAGTGCAGGCGTGATAGCGGCGTATTGCTGGTGTTTTATTGCTGGGTTATCCTGGTTTATGCCCTGATCAATGCGGAGGCGTTCTGATGGCTGCGCAAGGGTTCTTACTGATCGCCACGTTTTTACTGAATTGTTAATGGTGCTGGCGCGTCAGCGCTTTAGGCAGCGGGCTGGCGCGGCTGATTAATGACATTCCTCTTCCCGGTACAGCGGGCGTTGAAGGCGCGTACTTTTCGCGCACTTGGCGTCTCTGACCGTGAGATGAACTGGAAGCAATATCTTTTGTGCCATTCGGCCTGAACATGCTGGGGCTGGCGGTGCTGTTTTTATGTTGCTCGGTCAGCACTATCTGCCGCTTAATCCCCAGCAGTTACCCGGGGCTGTCGTGGGATCTGTGGCGCTGAATACCGCCGTCAGCTTTGTCGCAATACCAGCTGGCAATCTTATAGCGGGTGAAACCACGTTGAGCTATTTCAGCCAGATGGCGGGCTTAACAGTGCAAAACTCTTTCTGCCGCCAGCAGGATTGCGGTGATTTTGCCCTCATCCGTGCGTTTACCCGCCAGAGCATGAGCACGCTCGGGAATGCCTGGGTCGATCTGCTACGCATCATTATGGGTGCTGATCCTGGCGTTGTTGATTGCACTGTTTTTATTCAACAAAGGGTGCGCTGCAAAACTTTCCTGCCTTATCAGGCTGTGAATGCCGTTGAAGGAGCGCAACAGCTGTTACCCATGGGGCCTGTAGCTTCTCAGGAAGCGATCAAGATGCTCGGTACTAACGGCGGTGAAGCTTCTTTAATGCCAACTCGTCGCATCGTTTGAAAACCCAACCGCACTGACCAACTTCGTGCAGATGCTGGCGATCTTCTTGATCCCAACGGCGCTGCTTTGCCTTTGGTGAAGTGATGAGCGATCGCCGCCAGGGGCGCATGTTACTGTGGGCGATGTCAGTGATTTTTTGTCATCTGCGTAGGCGTGGTGATGTGGGCAGAAGTTCAGGGTAATCCTCATCTACTGCTGGCACTGGGCACGGACAGCAGCATCAATGGAAGGTAAAGAGAGCCGTTTCGGCGTGCTGGTCAGTAGCCTGTTTGCGGTCGGCGACTGGCGGCTCCTGTGGCGCGGTGATTGCGATGCATGATTCGTTTACCGCTCTCGGTGGCATGGTGCCGATGTGGCTGATGCAAATTGGTGAAGTGGTGTTCGGCGGTGTCGGTTCGTCTTTACGGCGCATGATGCTGTTTGTCCTGCTGGCGGTGTTTATTGCCGGGCTGATGATTGGTCGATACCGGAATATCTGGGTAAAAAATCGACGTACGCGAGATGAAACTGGCTGCACTGGCAATTCTGGTTACCCGACGCTGTGATTGCTGATGGGCGCGGCGTTGGCGATGACCGACGCCGGACGTAGCGCCATGCTCAACCCTGGCCCGCATGGTTTGGCAGTGCTGTACGCCGTGTCATCCGCCGCTAACAACAACGGCAGCGCCTTTGCCGGATTAAGCGCCAACTCTCCGTTCTGAACTGTTTACTGGCGTTCTGCATGTTTGTCGGTCGCTTCGGGGTGATTATCCCGGTGATAGCAGTGCCGGTTCGCTGAGTGAGTAAAAGAGCCAAGCCGCCAGCTCCGGCACGCTGCCAACGCCACGGCCCGCTGTTTGTTACAGCCTGTTAATCGGCACCGTGTTGCTGGATTTGGCGCACTGACCTTTATCCCTGCCCTGGCGCTTGGTCAGTGGCGGAATATCTTCTCCTGATATTGGTGAGCACTGAATATGAGTCGTAAACAACTGGCGCTATTCGAACCAACACTTGTCGTTCAGGCGCTGAAAGAAGCGGTGAAAATTAAACCCACCAGGCGCAATGAAAGCAATCCGGTGATGTTTATCGTCTGGATCGGCAGTCTGCTGACCACCTGCGCTTATTAGCATCGCGATGGCAAGCGGTACGATGCCCGGCTTAATGCGCGCTGTTTGGCGCGGCCATTAGCAGTTGGCTGTGGATCACCATTACTGTTCGCTAATTTCGCCGAGGCGCTAATGAAGCCGCGAAGAAGTAAAGCGCAGGCCAACAGTCTGAAGGGTGAAAAACTGCCTTTGCCCGCAAGCTGCGTGACCGAAATATGGCGCTGCGGCGGACAAAGTTCGCCGACCAACTTCGTAAAAGGCGATATCATTTTGGTAAGAAGCTGGCGATATTATCCCTGCGATGGTGAAGTTATTGAAGGTGCATCGGTCGATGAAAGCGCCATCGCAGGGAATCGGCACCGGTGATCCGTGAATCAAGTTAAGCAAGCAGACGCCGAAGATGGAGCGACAGACGAAGTAGCAATGCAATGAAAAAAAAAGA
+>e744ac28-518e-4933-b2a9-e59adecd6512
+TTGGTATTACTTCGTTCAGTTGCGTATTGCTACTTGCGCAACCGGCTCTATCTTCGGCGTCTGGCAGGTGTTTAACCTTGCTTTTCCTGGAAAGACCGCGCCCGCTTTTACAGCTACCTGCATCGCGTCTGGTCGAAACCAGCGATAAACCGGTGTGGATCGGATCAGGCCGAAAGGCAACTGGTGATTTTATTGATTGCTGGGTTTGAATACATTGAAAACCGCCAGCGGAAACGGCAGTTTCTCATCAGGAAGATGTTCAGAGAATGGCCCAGACATCGTTATACCAATCGAAACATATATTCATGAAATATATATAAATATTTCCTAATTGTTCTTATCTGACAGATATCTCACTTAGAAACTCTTATAAATCAGGGTTTCGCCTGTCAGCAGACAAACCAACCCGATAAAACAAGGATGAGCAGATGAGCAGAAACCGGCGGCGCGTCAGGCGACATGACGCCGTATGGCGATAACATTGTCCAGGGTTCAGCCGGGGTACGCATCGGTGCCCCACCGGCGTCAGCATTCCGTTAATGCCCGGCGGGTATTGACGTCCGACCATCCGGTCAATCCGCTGCTCAGTGCAAAGGTCCTTCCCGGTGAAACCGACATCGCCCTGCCGGCCCGCGCGTTCATTCTCTCCGCACCTACAGCGGTTACACGGACAAAACGCCCGCGCCGGTGAGGAGTCTCGGCCCCGGCTGGAAAATGCCTGCGGATATCCGCTTACAGCTGCGCGATAACACACTGATACTCGAGTGATAGCGGCGAAGCTGTATTTTGAAACCTGTTTCCCGGTGAGGGACGGTTACAGCCGCAACGAAGTCACTATTTCGGCTGGTGCGCGGCGGCGTGGCAGAAAACTGGATGAAGATCACCGGCTGGCCGCGCACTCTGGCAGAGCGCTACCGGAAAAGAACTCTCCGCTTAAGTCCGCATCGTTATCTGGCGACAAACGGTGCACCGAAGTGGTGGCTGCTCGGCTGGTGTGAGCGAATTCCGGAAGCGGATGAGGGTGCTACCTGCGCCGCTGCCGCCGTACCGAATTTTGACCGGGCTGGTGGACCGCTTCGGGCGCCACACAGACCGTTCCACCGCAAAGCCGCCGGTGAATTCAGCGGCAATCACCGGCGTGACGGATGGTGCCAGGCGTCACTCCGGCTGGTACTGACCGCAGGCGCAGCGGGCAGAAGAAGCCCGGCAACCACAGGCCATTTCCGGCGGGACTGGAACCGTCCGCTTTCCTGATACCCTGCCGGGTTACACCGAATATGGCGGGGTTGGCAGCTCATCTGTCTGCCGTCATGGCTGACGCACGACCCGGAATACCCGGAGAATTTACCTGCCGCCGCTGGTGCGCGCGCTTATTTCAGACGCCCCGCGGCGGGAGCTGGCGGCGGTGTATGACCGCAGCAGCTGGAGTGCGCAGCTTTACTTACGATGTTAAATACCGGGGCCGGATGGTGGCGCACCGTCACGCACGGAGCCGGCAAATCTGTTACCGTTGACGGCGACCGGGCGGGTGACCAGAACAGCTAAACCCGGCAGGCTTAAGTTACACGTATCAGTATGAAGGACCGCATCACCATCACCGACAGCCTGAACCGCGGCTGAAGTCCTGCACACGCAGGGTGAAGGCAGGCTGAAGCAGGTGGTGAAAAAGGAACTACGCCGGACAGCGTCGCATGAGTCAGTTTGACGCGGTGGGCGAGGCTCAGAGCACAGACGGATGCCGCAGGCAGGACAACAGAATACAGTCCGGATGTGGTGACGGGCCTCATCCCGCGCATCACCACGCCGGATAGCAGGGCATCGACGTTTCACCTATCGCCACCACAGCCAATTAACGTCAGCCCACCGGGCCTGACGGGCTGGAAATACGCCGAATATATGATGAATGGGGCCCGTCTGATTCAGGAAACTGCCCCTGACGGCGATATCACCGCTACCGTTATGATAATCCACGGTATGACTTACCCTGCGCAGCGGAAGATGCCACCGGCGGCCGGAAAACCATGATAGACGTACGGTCGTTGCTGGTGAAACTTCACTGATGTTTCGAGTTTATGGCCCGCTATGACGCGACCGTTTTGGTCAGGTGACGGCAGCCGTGCACCGCGAGGAAGGGCTGAGTCGGTACCGCGCGCATCAGCGGCCGCTGGACAGTTAATTGCTGCGTGAATACGCAGGGCCATGAAACGCGGTATGAATACACAACACCGCCGGTGACCTGACCACCCGTCATTTGCCCCGGACGGCAGCGAGCACGGGGACACGGTACGTGCGTGGGGAAAAGCCATCTGCTTTACGCAGAGGCGGTCTGACGCGCAATTAGCCGGAATACGGACAGGTCATCCGCCTGTGGTGAAAACGGCAGCCACACCACCTTCCGTTACGATGGCGCTCGACCGGCTGATACGGAAACCACCGGCTTTGACGGCCGCACCGTTATCACCACGACCTGACCGACTGAAACTTATCCGCAGCGAGGATGAGGGGCTGGTCACCCACTAACACTATGACGAAACAGACGCCTCCGCGCACCGTAGATGGCGAAACCGCAGAGCGGTAGCGAGTATGACGAACGCGGCTGGCTGACGGACATCAGCCATATCGGCAGGGAGCACGGGTGACGGTGCACTATGGTTACTCGACAGTAAAGGCCACTTCTCGCCCACCGACACCTGACGGTGCATCCGCAGACGAATGAACTGCTCTGGCGGCATGAGACCAGGCAATGCGTACCTTGCCCACGGGGACTAACGAACCGCTGTATACCGGTAGCTGCCGCCATTCAGAATGGCTGACCACAGCGGCGGCGTATCAGGCGCTGGAAACTCGGCGACACACCGCTGGTGGAGTACCCGCGACCGCCTGCACCGAAGTACTGCGCAGCTTCTGATAATTATGAACTCTGCCACCGCTATGCCTGCCGGGCGATTACAGAATAAACACCTGAACAGCCTGCTGTCGATACGGTACACCTGGAACGACCAACGGCGAACTCATCCGCATCCGGCAGCCCGCGCCAGACCCGGAGTTACAGCTACAGCACCACCGACGGAAGCTGACCGGCGTTCCACACCACCGCAGCAGATGGGATATCGCATCCATATACCCACAGACCCGGCAGGTAACGCCACCCGACCGGAAACTGCACGGCGGACAGCGCCTGGCGTAATGGATAACCATATCGCCCGTGACGCGCACTTCTCTTTACCGGTATGATATCACGGCAGGCTGACTGAGAAAACCGACCTCATCCCGGAAGGTATCGCACGGATGATGGGCACCACCGGTACCGGTACGACGATCAAGCGCAAGCGTTCGCACTACATGGACACAATATGCAGAGCCGCTGGTCGAAAGTCGCTATCTTTACGACCCGCTGCGCGGGCCGCAAATTCAACAAAAACGCCAGGGTATGGCGGCGTGAACGGACCACGGCGAATGGTGTCTTCGCTGTCGAAACCGCAAGTGACCTGGTACGGCTGGGACGGCGACCGCTGAAACCACGATACGAACGACAGGGCCCGCATCCGGATTGATTTATCAGCCGGGGAGCTTCACGCCCATCATCAGGGTTGAAACCGCCACCGGTGAAGCTGGCGAAACCACCAGCGCCGCAGCCTGGCGGATACCCTTCAACGGTCGTCGGTGGCGAGAACCTTGATGCGGCGGTGTGGTGTTCCCGCCGGTGTAGTGCAGATGCTCGACCGGCTGGAAGTGAAATCCCTGGCTGACGGGTGGTGAGGAAAGCCGCCGCTGGCTACGCATCGATGCGGCCTGACGTTGGCGCAGATGCAAAGCCAAGATGGACCGGTATACACGCCAGGCGCGAAAAATTCACCTGTACCACTGCGACCATCGCGCGTACCGCTGGCCCGCTATCGGCACCGGAAGGACCAACAGCATTAGTGCGCAGATATCACGATGAATGGTACGCCTCTTACGATGAAGAACCGCATCCGGCGAGCTGCAGCAGCCCTCCGCCGGGGCAGCAGGTATGATGGGGAGTCGGCCTGTATTACAACCGCCACCGCTATTATGACCCGCTGCAGGGGCGATATCCTCAGGATCCGGTGGAACGAAGGGGATGGAATTTTTATCGGTATCCGTTGAATCGATCTCAAATATAGATCCGTGGGATTAGAAACACTAAAATGCATTCACTGCATTCAATGGGCGGAACGCTGGTGAAGAAGCGGTCCAGATATGGAATCCGTTCTATCATCAATATCTTTGTGTCCCAGATGGTAAAGGGACTATACTTGTGGTAGCCAAGACCAAGCGGGGAGAATCAAAGGAGATGGTCTGGGGGCCGATTAAAGCAAGTAATGATACAAAGGCTGCTGGCCGTTGTGACCTCGTTAAAACCGATAATGGTTATTGGCGGAGAACTGTTTAAAGGGAAGTTTAAAGAGGTAAGACCGCGTTGATAATGTTCCCTGATGCTCATTCCACACCTACCTCGATTTGGAACTGTTAAAAACTGCAGACTGGTCTAATGATTCTTTAGAAACATGTAAGATGAAGTGCTCCGGAAATAACATTGGACGTTTTATTAGATTTGTATTCACCGGAGTGATCTAAATGAAATATATTATTTTTTATTCAGAGCTACCTGGCTGGCTTTATCGCTTTTAATACTATTCTTTTCCATGCATAGACTTTGCTAATTAGGGCTCCACTCGTGATGGGCAGTTAAATTAGTGTCTTTATGAATGATGGTAATATCTGTTTCCAACGGGCATAGTATTCTTTATTGCTCTAATATTTATAGAGGTTATCAGACGTGCAATGAAGTTGATGGTAAGTATATTATGGCGATAATAATGTAAACTTATTTTCTGTCAGGGTATATTCAATGGTTTGTATTAAATGGCGCATTATAAGCTCGATAAATTAAGTTATTGCTCTTATTGGTATATGCAAACACCTGGCGTTGATATCCGTATACCACAGACCAACGATGTAACCGCCTACCACTTGACCCGGAGCTACGCGGACAACCCTCAAAGCATGGCGGATAACCGTATCGCCCGTGACGCGCACTATCTTTACCGGTAGCAATAAATAATGCAGCGGGTGACGGAAAACCGAGCCTCATCCGGGAGTTATCGCACGGATGATGACACCACCACCGGTACCGTACGACAGTCAGCACCGGCTGGTACGCACGCGGACACAATATGCGGGGCCAGCCGCTGGTCGAAGCCGCTATCTTTACGACCCGCTGGGCCGCCAGTTGTAAAGGTTAAAACACCCAGACGCCGCAATATCAGCACCAACAAGTAATACGTAAAAAAGA
+>2c468ad4-194a-4af0-93d4-3fcbe17a9be7
+TTGTTGTGCTTCGTTCCAGTTACGTATTGCTCTTGCCTGTCGCTCTATCTTCGGCGTCTGCTTGGGTGTTTAACCTCACTTGTCTTTAAAGAGCGGTTATCCGGCGCGTTGTTAATCGTGCGGGCGGGTGGTTCATCAAGCGCGACCAGCACCTGGAAATCGAGATCGGGGGGCGATGCGCGCCAGTCGGTCAGCAAACGTTTCCCGACGCCACCAGCGGCGGCGCGAGGCCAGGCGACCGAGAATATCTTGCCGAGATTAGCATGTTCACGGGCATAACGCACTACCGCTTTCTCTTCCGCTGGATCAGAAAGTGTTGCCGTCTCCGCGCCCAGTTCCTGCGCCAGACGGCAGGCGCTGAAAATTGCCCGACGTTTTTCCGGTAAGCGGTGCAGGGCGGGGGTTTCAACGCCACCGCGTGCCAGACGCTACCCAGCCGTGACGCCAGCCGCGCCGCTGCGCGGACAGTTTTCGCTGCCGGTGTATGGCCGATGCATAAAAGGATCGCGTCGCGCGTGCCACACTTTCTCTTCGCCAGGATGCCCCGCCGAACGCGCATTTGCTCATCAACGCGATCGGCGAGTACGGCGCAGTGCCAGTTCGCGCAGAACTGATCGGATTACCTTGCGGAAAAAATGTTCAATGGCGCGCTCCGCCTGCCCCGGCAATATAGGCTTGCCTTCTTTCAGCCGCTGGCACCAGATCGTCCAGGGCAAGTCCACCAGCACCACGTCGTCGGCGGCATCGAAAAGGATCGAGGCACGGTTTCCCGTACCTGAATTCCGGTGACGCCGCTGACCACATCATTCAGACTTTCCAGATGCTGAACGTTGACGGTAGTGGCTTTATCAATGCCAGCTTCAGCAGTTCTTCCGATATCCTGCCAGCGTTTGGGATGACGGGAACCTGGCGCATTACTGCAATGCGCCAGTTCGTCCATTAAGATCAGCGCCGGGCGGCGGGCGAGGCGGCATCGAGATCCAACTCGCTGATATGCCGCCCACGGTACGCCCTGGCGTTTAACGGCAGAACAACCAGCCCTTGGCATGGCGGCGGCGGTATCTTTCGCCCGTGAACTCTGCCACGCCAACCACAATATCCAGCCCTTGCGCCCGCAGTCCTTTGGGCTTCTGCCAACATCGCCCAGGTCTTCCCGACGCCTGCACAGGCACCGGCTTTCGGCTTCCCCGATGCGGCGCGGCGGTTTGTTCCAGCAGACGATCGGGGTCGGGACGTAAGGGTTCGTTATTCATCAAGTTTATCCAGCGCCAGATTGAGTTCAACAATGTTGACAACCGGCTGGCCGATATATTTCACCAACGGTTGTTGGCTGTATTTTGCGATCAGTTGCGTGAGCGCTGTTCAACGCTGAGATTACGCGCTTTCGCCACGCATTAAGTTTGCCAGGCCGCCGCTTGCGAGGTGATATTGTCCAGCCCGCTTGCCGATGCCGTCACCAGTTCAACCGGAACCTCCGCGCTGGCATCGGGTTAGCGGCCCGTAATGCAACAACGCGTGCGGCTATTAGTTTATCCAGCTCAGGGTTACTGACCGCCGATTGCTCCGCCAAGCCTGTGGATTATAGGGCATTTCTGCCGTTGCCGACGGGCGACATGAAAATAGCCGTTGCCGGTAAAATTCTGCCCGATTAATGCCGAACCGCGCGCACCGTATCACCTTCACGAATCAACGAACCATTGGCCTGCCAGAACCACCATTGCCCCAGTACGGTGGTCGGCAGCGGGTAAACGCCGCCAGTAATCAATAACAGAAGATAAATGTTGATAATGCCGGACGTAATCCACTCATGGTAAACCTCACGCAGACCGCAAACGGTCAGCAGTAAATCAATGACTTTGATGCGATAAACGGCGCAACGGCCCACCCAGACCGTAAATCCATAAGTTGCAGCAACATGTGAAGCGGTAAGCGGTTTATAACTCACGCCTTTTAACGCCAGGAGATCAAAGACGATAATCAAGGCGTTGAAAATCACCGCACTGAGGATTGCGGAGTCGGGCGAATACGGCACATGATGTTCAGCGCATTTAACTGCGGATACGTTGCCGCGAATGCCGCCGGAATAATGGCGAAGTATTTCGCCACATCGTTCAATAATGCTGAAGGTGGTCCAGCGAGCCACGGGTCATCAACATCTGTTTGCCAAATGTGCCACCTCGATCAGCTTGGTCCGGGTTAGAGTCGAGATCGACCATATTGCCCGCCTCTTTCGCCGCCTGGGTGCCGGGTTCATCGCCACCGCGACGTCTGCCTGCGCCAGCTTCGAATCGTTGGTGCCGTCGCCGGTCATCGCTACCGTGACCTTCCGCCTGATGCGACGGATCAATGCCAGCTTGGCCTCCGGTGTCGCTTCGGCGAAAATCATCGACACCCGCTTCGCAACAATCGCGGCGGCAGTCGAACCCGGTTATCGCCGGTAATCATCACCACCGTTTTAATGCCCATTTTTGCGCAGCTGGGCGAAGCGCTCGCTAATACCGCCTCTGACTTGATATCTTTCAGCGCAATAACGCCCTTTTGCGAGAACCTTCCACCACCACCAGCGGCGTGAAACCACCGACGCGCAACCCTGATCGACTTTTTGATCAACATCTGGTAGGGAAGTGACCACCGTTAGCCTCAACATGGCGACGAATGGCATCGACAGAACCTTTACGGATCATGCGGTTGTCGATGTTGATCCCGCTCATCCGGCTTTGCGCAGTAAACGGTACAAAGGTGGCATGGAGCGACTGCATCGCGCTCGCGCAGGTAAAAACGCTGCTTGGCGAGGATCACAATACTGCGGCCTTCCGGCGTTTCATCAACCAGCAAGAAGCTGGTTGCGGCGTCAATAACGTTTTTCATCCACGCCCTGCGCAGCGGATAAACTCCGACGCCTGACGGTTACCGAGTGTGATGAGTGCCGGTTTATCCGGTAGCAGAACGTCAACGTCACCTGCCGCTTCAGCTGCGTCCGCTGGTGGCAATCGCATTCGCGCCTAGCATCCGGCTCATCCGGCGACGCCGATCGCTGACAACAGGCCGCCAATGGTGGTTGGGATCAGACAGACCAGCAGCGCCACCAGTACCGTTACGCTGACTGCATTACCGCCCACGCGGAAGCGGCCTGGCAGCGTGGCGGTTGCTTGATAAAAGACGATAGTCAGGGCAATCCAGCAGAATGGTCAGGGCAATTTCGTTCGGCGTTTTGCGTCGCTGTGCGCCTTCCACCATCGCGATCATCCGGTCAGAAATGTCTCGCCGGGGTTAACGCTACACTCAATCACCAGCCAGTCAGAGAATACGCGTACCGCCGGTGACGGGCAAAATCGCCGCCGGATTCACGGATCACCGGTGCCGATTCCCCGGTGATAGCGCTTTCATCACGACCGATGCACCTTCAATACTTCACCATCGCGGGGGATAATATCGCCAGCTTCTACCAATACGATATCGCCTTTACAGAAGTTGGTCGGCCAGGAACTTTGTCCGCCGCAGCGCCATATTTCGGCTCACGCAGCTTGCGGGCAAAGGCGGATTTTTCACCTTTCAGACTGTTGGCCTGCGCTTTACTGCGGCCTTCTGCCAACGCCTCGGCGAAATTAGCGAACAGTACGGTGATCCACAGCCAACCTACCGCTAATGGCCGCGCTAAACAGCAGCGCATTGCCGGGCATCGCACCGCTTTGCCATCACCCGATGCTAATACAGGTGGTCAGCAGACTGCCGATCCGGACGATAAAACATCACCGGATTGCGCCATTGCGCCCTGCGGAGTTTTAATTTTTCACCGCTTCTTTCAGCGCCTGAACGACAAGTGTTGGTTCGAATGGCGCCAGTTGTTTACGGCTCATATTCAGTGCTCACTCAATATCATCAGGAGAGATATTCCGCCACCGGACCAAGCGCCAGGGCAGGGGATAAGGTCAGTGCGCCAACCAGCAACACGGTGCCGATTAACAGGCCAACAAACAGCGGGCCGTGCGTTGGCAGCGATGCCGGAGCTGGCGGCTTGGCTCTTTTACTCGCAGCGAACCGGCAATTGCCATCACCGGGATAATCACCCCGAAGCGACCGACAAACTGCAGAACGCCAGTAAACAGTTCCAGAACGGAGGTTGGCGCTTAATCCGACTTTAAAAGCGCTGCCGTTGTTGTTGACAGCGGCGGATGACGGCGTACAACACTTCGCCAGAAACCATACGGGCCAGGGTTGAGCATGGCGCTACATCCGGCGTCGGTCTTTCATCATCGCCAACGCCGCTGCATCAGCACCAGCGTCAGGGTAACCAGAATTGCCAGTGCAGTCGGTTTCATCTCGCGTGCGTCGATTTTTACCCGGATATTCGATTATTCGCGACCAATCATCCAGCCCGGCAATAAACACCGCCAGCAGGACAAACGGCATCATGCCGTAAGGGCCAGAACCGACACCGCCAGACACCACTTCACCAATTTGCATCAGCCACATCGGCACCATGCCACCGAGCGGTAAACGAATCATGCATCGCAATCACCGCGCCACAGGAAGCCGCCGTCGTCACGACCGCAAAACAGGCCTGACCAGCACGCCGAAACGGCTCTCTTTACCTTCCATGGTGATTAACGCTGTCCGTGCCCAGTGCCAGCAGATGGGGATTACCTGAACTTCTGCCCACATCACCACGCCTACGCGAATGACAAAATCACTGACATCGCCCACGGCAACATGCGCCCCTGGCGTGATCGCCATCCACTTCACCAAAGGCAAAGCACAGCGCCGTTGGGATCAAGAAGATCGCCAGCATCTCTGCTGAAGTTGGTCAGTGCGGTTGGGTTTTCAAACGGATGCGACGAGTTGGCATTAAAGAAGCCACCACCGCCGTTAGTACCGAGCATCTGATCGCTTCCTGAGAAATACAGGCCCCGCATGGGTAACAGCTGTTGCGCTCAGCTAACGGTATTCCACAGCCTGATAAAGGCAGAAAGTTTTGGCACGCAGCGGTGAATAAAAAACAGTGCAATCAACAACCACGGGGACTAGCACCCATAACGTGATGCGTAGCAGATCGACCCAGACATTCCAGGCGTGCTCATGCTCTGGCGGAGTAAACGCACGGATGAGGGCAAAAATCACCACCAATCCCGCTGGCGGCAGAAGAAAGTTTTGCACCGGCCCGCCATCTGGCTGAAATAGCTCAACGTGGTTTCACCGCTATAGGTTAAATACCCAAGCAGACGCCGCAATATCAGCACCAACAGAAAGCAATACGTAACGCACC
+>ead9981c-1001-491b-8db1-e0c05553899a
+TTGGTAGCCTTCGTTCGATTTACATGTTGCTTCTTGCCTGTCATCTATCTTCCGGCGTCTTTAGCGGGTGTTTAACCTAGAGGAATATTTGGGTATCATTATACCAATCGAAACATATATTCGCTGAAATATATATAAATATTTTCCTAATTGTTCTTATCGGCGAATATCTCACTTAAGGCTTTCTTATAAATCTGTAGAGTTTCGCCTGTCAGCAGACAATAACCCAAATAAAACAAAAGTTGAGCAGATGAGCGGAAAACCGGCGGCGGCGCGTCAGGGCGACATGACCTGATATGGCGTGTCAGGAGTTCAGCCGGGGTACGCATCAGTTGCCCCACCGGCGTGGCCTGTTCGGTGTGCCCGGCGGTGAGCGATCGGCAATCGGTCAATCCGCTGCTCGGTGCAAAGGTCCTTCCCGGTGACCGACATCGCTTCACCCGGCCCGCTTGCCGTTGTTCTCTCCACACCTGGCAGTTACCGGACAAAACGCGCCCGCGCGCCGGTGGGAGCCTCGGCCCCGGCTGGAAAATGCCTGCGGATATCCGCTTACAGCTGCGCGATAACACACTGATACTCAGTGATAGCGGCGGCAGAAGCCCTGTATTTTGACACCTGTTTTCCCGGTGAGGACAGTTTACAGCCACCCAGCGAGTCACTGTGGCTGGTGCGCGGCAACGTGGCAGAAACTGGATGAAGGTCACCGACTGGCGCACTCCTGGCAGGCATGCCGGAAGAACTCCGCTTAAGTCACGTAATTTATCTGGCGACAAACAGTCACAGGGCCGTGGTGGCTGCTCGGCTGGTGTGAGCAGATTGCCGAGAAAGCGGATGAGGTGCTGCCTGCGCCGCTGCCGCCGTACCAGTGCTGACCGGGCTGGTGGACCGCTTCGAGGCGCACACAGACGTTCCACCGCAGAAGCCGCCGGTGAATTCAGCGGCGGAAATCACCAACGTGACGGATGGTGCCAGGCGTCACCCGGCTGGTACCCCAGCCACGCAGGCGCAGCGGGCCAGAGGCCCGGCAGCGGAATATGCATTTCCGGCGGGATGGAACCGTCCGCTTTTCGATACCCTGCCGGGTTACACCGGAATATGGCGGGACAGCGGCATCCGTCTGTCTGCCGTGTGGCTGACGCACGGCCAGAATACCCGGAGGAATTTACCTGCCGCGCCGCTGGTTGCGCTAATGGCCTGGACGCCCCGCGGCGAACTGGCGGCGGTGTATGACCGCAGCAATACACAGGTGCGCTTTACTTACGATGATAAATACCGGGGCCGGATGGTGGCGCACCGTCACACGGGCCGACCGAATCTGTTACCGTTACGACAGCGACGGGCGGTACGACAGAACAGCTAAACCCGGCAGGCTTAAGTTACACATATCAGTATGAAGGGACCGCATCACCATCACCGACAGCCCTGAACCGCCGTGAAGTCCTGCACGCAGGGTGAAGGCGGGCTGAGCAGGTGTGAAAGGAGGTACGCGGACGGCAGCGTCACGCAGAGTCAGTTTGACGCGGTGGGCGGGCTCAGGGCACAGGGCGGATGCCGCAGGCAGGACAACAAGGCCTGATCGGATGTGGTGACGGGCCTCATCCGCGCATCACCACGCCGGATGGCAGGGCATCAGCGTTTTACTATAACCACCACAGCCAGTTAACGTCAGCCACCGGGCCTGACGGGCTGGAAATACATGGGGAATATGATGAATGGGGCCGTCTGATTCGAAACCGCCCCTGACGGCGATATCACCGCTACCGTTATGATGAAATCCACGGTGACACCCTGCGCAACGGAAAGTACCGGCAGCGAAAACCATGACGATGGAGCCAAATTTACGGTCAGTTGCTGACTTCACCCTGACTGTTTCGGTTATGTAACCCGCTAAAGATATGACCGTTTTGGTCAGGTGACCGGTGCACCGCGAGGAAGGGCTGAGTCAGTACCGCGCATACGACCTTGGCCGTGGACAGTTAATTGCCGTAGAAGACACGCAGGGCCATGAAACGCGGTATAGATACAACGCCAGGTGACCTGACCACCGTCATTTGCCCCGGACGGCAGCAGAAACCGGGACACAGTACGATGCGTGGGAAGCCATCTGTACCGCGGGGCGGTCTGACGCGCAGTATGGAATACGATGCTACCGGACGGGTCATCCGCCTGACCAATTCAGAAACGGCAGCCACACCACCTCCGTTACGATGTACTCGACCGGCTGATACAGAAACCGACTTTGACGGCCGCACACAGCGTTATCACGGCCGGCCGGCAAACTTATCCGCAGCGAGGATGGGGGAACAGTCACCCGCTAACACTATGGCCAAACAGATACGCCTCACGCACCGCACCGTGAATGGCGAAACCGCAGAGCAACGGTGGCAGTATGACGAACGCGGCTGGCTGACAGACATCAGCCATATCAGCGAAAGGGCACCGGGTGACGGTGCGCACTATGGTTATGACAGTAAAGGCCGCCTCGCCAGTGAACACCTGACGGTGCATCATCCGCAGACAGATGAACTGCTCTGGCAGCATGAGACCAGACATGCATTAAACGCACAGGAGGACTGGCGAACCGCTGTATGCCGGACAGCCTGCCCATGCGTGGATGGCTGACCTACGGCAGCGGCTGGCTGTCAGGCATGAAACCGGCGACACACCGCTGGTGGAATTACTGCGAGCCGCCTGCACCGGGAAACGCTGCGGCATGGCCCGATTATGAACTCACCACCGCTTATACCCTGCCGGGCAGTTACAGAGCCAGCACCTGGATGGCCTGCTTTGTCTGACCGCGATTACACCTGGAACGACAGCGAACTCCATCGCATCAGCAGCCCGCGCCAGACCCGGTTACAATACGGCACCACCAACCGCTGACCGGCGTTCACACCACCACCAGCGAATCTGGATAACTCGCATCCCGTATACCACAGACCCGGCGGGTAACCGCCTGCCGACCCAGGCACCCGGACAGCGCCCTCAGCACTGTGGCCCGGATAACCGTATCGCCGTGACGCGCATATCTTCACCACGGTATGACCGTCACGGCAGGCTGACAAACCGACCTCATCCGGAAGAGGTTATCCGCACGGATGATGAGCGCGCCCACCGGTACCATGCGACAGTCAGCACCGGCTGGTGCACTCGCGGACACAATATGCAGAGCCGCTGGTCGAGAGTCGCTATCTTTGACCCGCTGGGCCGCAGGGTGGCAAAACGGGTATGGCGGCGTGAACGGGACCTGACGGGCTGGATGTCGCTGTCACGGAAACCACCAAGTGACCTGGTACGGCTGGGACGGCGACCGCCTGACCGATACGGGCAACAGAACCCGCATCAGACGATTTATCAGCCGGGGGCTTGCGCACTCATCAGGGTTGAAACGCCACCGGTGAGCTGGCCGCAGCGCCGCTGGATACCCTTCAGCAGTCGTGGCGAAGACGGTGGCAGTGTGGTGTTCCGCCGGTGCTGGTGCAGATGCTCGACCGGCTGGAAAGTGAAATCCTGGCTGACCGGGGTGAGTGAGGAAAAGCCGCCGCTGGCTGGCATCGTGCGGCCTGACGGTGGCGCAGATACAACCAGATGGACCCAGTATACACGCTGGCACTGAAAAATTCACCTGCCCTGCGACCATCGCGGCCTGCCGCTGGCCCGCTATCAGCACGGAAGGACAACAGCGCCGGTACGCGAATGATGAATGGGGTAACCTGCTGAATAGAGAACCCGCATCAGCTGCAGCAGCTTAATCCATACCGGGGCAGCAGTATGATGAGGAGTCCGGCCCGCATGTTAACCGCCACCCGCTATGACCCGCTGCAGGGCGATATATCATCAGGATCCGGTGGGCTGAAAGGGGATGGAATTTTATCAGTATCGTTGAATCCGATCTCAAATAGATCCATTGGGATTAGAAACACTAAAATGCATTAAAGCACTGCATTCAATGCAGGGCGGAACTGGAGTGAAAAGCGGTCCAGATATATGGGGGAATCGTTCTATGTCAATATCTTTGTGTCCCAGATGAGCAAGGGACTATACTTGTAGTAGCCAAGACCAGCAGGGGAGAATCAGGAGATGGTCTATGGGGGCCAGGTAAAGCAAAATGTCATGATACAAAGCTGCTGGCCGTTGTGACCTCGTTGAAACCGATAATAGTTGTGGAGAACTGTTTAAAGAATTTAAAGAGGTGGGCGATTATTCTGTATTGCCGATATATTCACACCTATAAATTTGGGGCTATTTAAAACTGCCAAGACTGGTCTAATGATTCTTTAGAAACATGTAAGATGAAGTGCTCCCGGAAAATAACATTGGACGTTTTATTAGATTTGTATTCACCGGGTGATGTAGTAATGAAATATATTATTTTTTATTCAGGTATATGGCTGGCTTTATCGCTTTTAATACTATTCTTTTCCATGCATAGACTTTCACTGTGGAGCTCCACTCGTGATGTGAGCAGAGTTAATTAGTCTCATGTCTTATGGAATGATGATAATATGTTTTCCAACAGGCATAGTATTCTTTATTGCTCTAATATTTATGGGGACTGTATCCAGACATTATTAATGGGATTGATAGTAAGTATATTATGGCGATAATAATATGGCTTTATTTTCTGTCAGGAGGGTATATTCAATGGTTTTGTGATAAGTAAGCGCGTATAAACAGAGCAAATAAATTAAGTTAATTGCTCTTATTATTATGTAACCTGGGCATTGTTATCCCGTATGCCACAGACCCAGCAGGTAACCGCCCGACCAGGCTACACCTGGACAGCACCCTCGGCGTAATGGCCGGATAATACATATCGCCGTGACGCGCACTATCTTTACCGGTATGACGATGCGGCAGGCTGACGGAAAACCGACCACCATCGGAAGGGTTATCCCGCACGGATGATGAGCGCACCACCGGTACCATTACGACAGTCCCAGCGCAGACTGGTGCACTACACGCGGACACAATATGCCGACCACCGCTGGTCGAAAGCCGCTATCTTTACGACCCGCTGAAGCGCAGGAGTGGCAAACGGAATTGGCGACGTGAACGGGACCCTGACGGGCTGGATGTCGCTGTCACGGGAAACCACCAAGTGACCTGGTACGGCTGGGACGGCGATAAAAAACTGACCACGATACCAGAACGACAGAACCCGCATCCAGACGATTTATCAGCCGGGAGCTTCGCCCTCATCGAGGTTGAAACCGCCACCGGTGAGCTGGCGAAAACGCAGCGCCGCAGCCTGGCGGATACCCTTCAGCTTGATCCGGCGGCGAGACGCGGTGGCAGTGTGGTGTTCCGCCGGTGCTGGTGCAGATGCTCGACCGGCTGGAAAGTGAAATCTGGCTGACCGGGTGAGTGAGGAAAGCCGCCGCTGGCTGGCATCGTGCGGCCTGACGGTGAGCAGATGCAAAACCAAAGATGGACCGGTGTACACGCCGGCGCGAAAAATCCACCTGTACCACTGCGACCATCGCGGCCTGCCGCTGGCGCTTGTCAGCACAGGAAGGGGCAACAGAATGGTGCGCAGAATACGATGAATGGGGCAACCTGCTGAATGAAGAAGAACCCGCATCAGCTGCAGCGAAACATCCGCCTGCCGGGGCAGCTTATGGTATGATGAGAGTCGTACCAATATTACAACCGCCACCGCTATTATGACCCGCTGCAGGGAATTATGTCACTCAGGATCGATTGGGCTGAAGGGGATGGAATTTTATCAGTATCCGCTGGTCCGGTTCAGTATATAGATTCAATGGGACTGGCATCAAAATATGGGCATAAATAATGGCGGATATGGAGCGAGGACCCAACAAACCTACGCCCGATCCAAGTAATTGCGGACATAGCGAAACAATTAAGACTGCCATATCCTATTGACCAGGCCAGTAGTGCGCCTAATGTTTTCAAAACATTCTTCCAGAGCATTAAGCCCTTACGACTACACACTGTATTTGCAGGAAGTGGGTAAACCAAATCTGACTTACTTGTACGCCACAGGATGATTCCCAGTATCAGGATGGATACAAGACAGCAAGTGATTACCTGCCACAGACAAATTGGTATATCAATTACCACCGGATATGCTTGTGCAGAACCTATTTGTTCCCAGACATTAATAAACCCGATGGGCCAGCAACGCTTGGGGACCGATGATTTGGGTGAAATTTTAGCTAAGATGAAACAGAGAGAACATCGGAGGAATAAGAAAATGAAAAGAGTTTTGTTCTTTTTGCTGATGATATTTGTTAGTTTTGGTGTTATGGCTGATTGCGAAATAAGGTTAAACACCCAAGCAGACGCCGAAGATAGAGCGGG
+>bd76fe67-db4b-4d72-95df-e23f07aea51a
+CTGATGTGCTTCGGACAGTTGCGTATTGCTACTTGCCTGTCGCTCTATCTTCGGCGTCTGCCCGTTGTTTAACCTGTTCCACCCCAGCGGGCGGCGAGCGGCCGTCAGGATGTAAACATGCCACCACTCCAACCCAGCCAGCCGAACCCCACCAGGCCGGTAATCTGCCGCTGCCGCCGCTCCACAACAAACTATACTTCACTTCCAGCATCTCGGCGCAGCGGCAAACCGCCGAGACTGAGCCCAGAAAATATGTGGATGAACGACCATTAACGCCATCGCTGGCTGAGGTCCGTTTAATTTGGCTTCCATCTTTCCGCCAGCTCGGCAATCCGGCAATCGACCCATCAGGCTGCTGGCCTCAGCCATCATCACTACTTTGCTGTTACTGGAGGAACCGATCTGCTGTAACGCTTCGGTTATTTCTGCGCTACAGAGAAGTTCACCGCCTGAATATCACGGGGCGATAGCTCGAACACACACCATTTGGTGGCGCGGGCTTCTCGCCAGGCGGAACGTTCACGCGCTTCAGCCTGTAAAAACGCCGACTGACGTTTTCGCCTTCCTTTCAGGATTTGACTGTTTTCACCTTCGGCACGAAGTTTCCGCCTGACGGATCCCTTCCGCTTCCGATATAGCCTTGACGGTACCGTTCAACTTTCATCTGCGCGTTCATTGAAGAGATAAGCTCTGCCGGTGGGCGCACGTCGCGAATTTCAATACGAGCTTTAATCCCCACGGGTTGGTGAAAGCTACCATCAAGGCAATACACCCCAGCGGGCGGAGTTGATGCTGTCGCGCTGAAACATTTTGTCAAAGTTCCATTAGACCCAGCACGGTACGGATGTTAATTAACGGTCAGGTTGATGATGCCAGCTCAGGTTGCTGGCCATAGCCGCGCGTCGATCACCTGAATAAAGCACAGCGTCGATGGTAACGTTGGCGTTTATCTTCGGATAACTTCTCTGGGAAGGGATATCGACGCGCTCCATCATATTGATCTTGCGGCAATGCGATCCATAAGCGGCACCACCAGACTGGGCCCCGTACCAACGTTTGGTATAGCGACCGGCGTTCTACTGTCCACTGATGGCCTGCGAGTACGATTTGACACCCGCGCCGGCAATGACCAGCGCGGCAAAATGAATCGGGATAAAGGTAAGCATGGAAAAACCTCATTACCGTCAATCCAGCAGGCCTGCTTGATTAAATAAATTATACCTGATTACTGAAGAGGTTCCCCTTATTCCTGCGAAGGATGAAGCTGTTTTAGTAAATCAGAAAGGGAACAGCGATGGGGAAAATGAAGATCGCTTTAGCTTCAGCCGCTTGTGGATATCTGGCGTTGATGCGAAGTGCTGGCAACATCAATTTTTCATACGTGCTGGCGAATTTAAGTTCATTACTGTTCCTTCTGGTTTGGCAAAGTACGCTGCTAAAAATAGTTGCTTCATTGATAAGCTATGCTTCCGGAACATTCTGTTGAAAATTGAGGATGTCAGCGCAAAGCCGAAATCACCGCCAATGAAGTCTCTTTTTTCGCCCGGGCACCGACGCTGTTGGCGATACGGTATCCACGATATCTGAGTCTTTCACCGGCAGATCCGTAGCGGCATTGACCAGCCATTTTTTCTCGGTTATATCAGACGCTTTAGCGCGGACAGCATTTTGACGAAGAATATCGCCGAGCTATCTGGTGGTGAAAAACAACGCATCTCATTGATTCGTAACCTGCAATTTATGCCAGAAAGGTTTTATTACCGGATGAAATAACCAGTCGCTGGATGAAAGTAATAAACATAACGTCAATGAGATGATCCATCGTTATTGCGCACGGCAAAATATTGCCGATGCTGTGGGTGATACGATAAAGACAGGAAATTAATCATGGATAAAATTGATTACACTGCAACCACGCCGGGCATCAGGAAGCACGCTAGCAGACTCGCATAATATTGCTAACGATCGACCGCACTGGCATTAATCTTAGTGGTGAGGTGGCAATCAATTAGCCATAAAGAAAAACTGGCGCTGGAAAAGATGTCTCTGAATCCGGGGCAGCGATAATTCAGCTGATTATTGTCGGCTATGCTGAAGTATATTTTCAGCGTGATACCAGCCTGGTATTCTGTAAGTGGGTGTTATTTATCGCTTTATTTTGGCGTGGAACGCATAAAAAGCAATCATCTCATTGCGCTAAGCACTATCTCCATCGTTTAACACCATTGCGGTCAGGCTGAAATTACCCTGGCGTGCTGATTCTCTCAGGGTCGATTGATTTATCGATGCGATGATCCCTATCGCCGGATAAATTACGCCGGTAACGCCATGGTAGCGGTGGGGATTATGTTGCAACAAAATTTGCAGGGGCAACGGGTCAGCCGAACAACAACAGATTCAGAAACTGAGTCGCCCGGTGCGACGCCGGCAAACTTCAGCGATATTGATTCACTGGCGCAGTAATTGTACGCGGCGCAATTCCGACGAATTGAATTCGTAAAAACGGATTTGGCCAGTGAGTTTACCAGAGATGATGTCCAGGGCTAAGTATTTGCAGGATGGTCGGTGAAGGCGATTATCTCAAGATTATGGTGACCTTTAATGTGCGCCAACCGCCAGCTTATGGGCAACAACGCACTGCTATTTAACTTCATCAACAGTTTATAATTCCGCTTACCAGTTGGTGGTGACTAAATTCAGAAAGAAATGATGCGATGCCGGGTGCCAGCATCATCGGTAGCGGTTATGTGCCGATCAGCAGATATCCGTAAATGCATACAGCTGGCGGCGATACTTCGACGCCAATTATCATGCCAACGGCGAGGATCTTCTGGAACATTTTGCGCGTCTGAAGCTGTCCGGCGGTGAGATCCTGCAGATGCCCGAACGGCAACTCAGCGCTTCTTCGTTGCGCCCAACCTGATGCAGGTGCAGCGCAGTTTGCATCGCCGGTGAAGCATCTTTGATTCTCACCTGCCATTTGCAACTGTTGAATTTCAGCATCAGCGCCTACGCTTCCAACAGTTCATTGCCACCAGCCCTGGTAGCGCGGAACGTCCTGATCACCAACGGAATGGTTTTCAGCACCGCTGCATCGCCAAGACGGTTCAGCGCGTCAATACGTTTCTGCTGGCAACAATTTAGATCTCCCCGTTCTGTTCGACGCTGCCAGAGCGTCGCTCCAGCAGCCAACGAGGGCATCCTGGTATGTGCTTTTTCCTGCATCGATTTATCGCTGCGCGCTTTCAGCTCTTCTTTAGCGGCAACGCACATCAGCACGGGGCGCGGATCACCTCTTCCGGTTGCGGCCTGACCTACATCCGGTTGCCGATTCTGGAACGAATACGCGGTCGGAATCACCAGACCAAACTGCGCGGCAAATCATCACTCCGCGTCGCAGTCAGCTTCACTTAGAATCAGTACCCGTTAATGCCGCCGCAGGGCTTTTCAAGTGGGTTGCTGCGACAGTGCTGGCTGCGTTCAGACCAAATAAGAACAGCGCGAATTGGTAGCCGACTGTTCAGAACCTACGCACGGATAATTCGTTAAATATTGACAATATTTTACCACCACGGACATGGAATGCGCTCTCTGCATCGATATTTTCTTTGACATACAGAAGATAGCGCACTTCAGCTCACCTAAATATTTTGTCATCACGCGCCCCAGCAGCAGGCGCTTAAAGCACCAATACCAAGGTCACCGGCATCACCGGACCAACGCATCTTCGGCTTCTCGCTAATAAAAAGCTGTAATACTTTATTCCACCACCGCTTCCGGTCCCAGCGTAAAGCGGGCGGCGATGCCAGGATTTTCATTTGGTTATCACTTTGCGTCTGAGTTGACGTTGTCGGTGGGCAAATTACAGATGGGTTCCAGGTTCGTCAGGCTGGCTTTATTCCGCTTGTGGCACCGCTCCGTACGCAGGCCATCGACCACCTATCAGCGCATATTTACTGGCCGCATCGCCTCCATTCCAACATTGGGGAGATTAATCCACTCTCGTGATATCCTCCGCAATACGCCCTTCTGCGTGTTTATCGCTGATGCTGAGCGCATATGATGAGCTGGTGTGCGCCAAAAAAAGTTGGCGAGCTTTGCTGTTATTTCATCTGCGGCTGATGGTTGGAAAGTCGCCATGCCGGTCGGCGTTGTTAAAATCCATACAAAGATGGTATCGGTCAGGCGATCGTCAGCTGCGATCAACACTGGTGATCCAGATCGATCAACACGCCAGGTAATCCAGCCGTGGCCGCTTCAACATATCATCCGGTTTCAGCAGCCGCAACGCGAAAACCGAGTTTCAATTCAGGCGCTTTCCGGTAATTCTTTGGGTATCCGGTAATTAATTCCGGTGCGCCAACTTTACCATCCAGGATCTCCGTTGCTTTCATGATTTTCAAAGGCTGCCATTGCTTCACCATCGATCGGCAACAATAACGGCTGGGCATGCGTTAAGGATGATCTGTCATCCTACATCCATTCAATGGCAGGGTGGGCCTCTTCCACCATAAAGGGCAGCGGCGGAACATCGGCGTTTGCGATTAGAAATAAGCGCAAAACTTCCATTATAACGGCGACCATAGTTTAGAACCAGACCTATTTGCGGCTAACAATGGGTTTGGACGGCGGCTGCGGTATCTGCAAAATCTAGCGCAGCGTTGCCCGGTTGCTGTAAAACCACATAAACCGTCGTGCCTGAGTTCAGCCTTTTAACGCGGCGATGCTGTTTTCAATAGAGCCGGAAGCCTTTGCCTCAGTCACTTGTGCAGAGATTATTCGCCGCTGATGTCTGCCAGCATTAACACCGTTTACACTCGCTTATCATTTAATAAAGGCAGGCCGGTACTTCAGCGGGCATTTAAATGCCAGCATCAGGCGCTATCCTTGAATCAACATGTCGCTGCGTTGCTGGAAGGTTAATGGGGTTAGGGAAGGGCAAAATGCCGGCGGAAAACGTTGTTTGAGTTTATCATCTTAGAAGTCGCGAAAATCGGTCAGGGGGTATAGACTCATCATCCCTCACCAGGTTGACTGGTTGTATCCAAACGTGAGACCATCGCCTGGTGGGCAGTCAGGATCAGGTAAGAATCGACTGCAACGATCACCTGTCGGCGATGGCGTAATTGGCGAAGTGAGTCCGTTGGGACAACCGCCATAATATGGGATGGCGCGAGCCATTGCGCGAAACGCTGCCGTCGCTTTGTTTTTCAGTCATTTATTGTTCCTGCCTTAACGCCGCTGGAAACGTCAGGCTTCCAGCTTCACTGCGCGATGAAGTAACAGCGCGCGGAAAAGTCGTAACAGGGCAGCGTTGCTCGAACAGTTAGGGCTGGGTGGCGTCTGGATCATCTTCCACGGCACAGCTTTCAGCGGTGAACGCTTGAAACTGGCACGACGCTTCAATATGATCTGACTTGAGTATTGCTGTTTGCGACAGGCCACCGGCAACCTTGAAGCGCCAGACGGAACGTCCGTGCCGACCTGCTGTTTTCCTCGACCGTGAACGCGCTTACGGTCATGGTGACCCTGACCCTGCAACTGGCGGCACTGCGACCCGCTGCTTACGGCTGGTGAACAGGCGATTGGAGGAAGCATGGTACACGATTGGTTCTGGCGCGAATAATATTAATTATCTCTGGCTGGCGCTAAGCCTGTGGCCTGCGTGCTGGCGCTGAATATCAGCGATCGCATGGAGAAGAGGGCTTAAGCCAGCGAAAACTACGTAGGTTATGGCGATCAGGCGTTGCGCAATTCCACGCAATGCCATAGCGTATGTGGAAGGAAGCGCAAAAGCGCGGCTGAAAGTCAAGCAAAGCAGCTGACTTTCGCCACAATATTGCCAGGCGACCGCAGCTGGCGAGCGATCAAGCGGTGGATGATATCTACCGATGCATACGATCTGAAACTAATCTGGCGCAAACCGCAGGCGGGCGGCGTGTCGCCGCTGGCCCCGCCTGTGCTTTTCATAGCACAAAGCAGGCCTGTTGGCGTGGGCGATGCCACCTTGCGGATTACCCGGAGAATTGATTCAGAATCGGATTCCGGTTTTGCCCAGCAGATGGCTCCGCGTCTGATGATGAATCTGGCGGATGTCGATGAGCCAGGCCGTGCAGCCAGAAGTCCAGGTCACCTACAATTTTATAAATTCCAGCAACCGCCGAGAGACCCATCGCGCTGCTGAAATGGTTATACCTCGGCAAACCCGAACAACTGCCGATACGGTCTGGGCCGGGACGAAGAAGGCGCGCTGGGCGATCGATGGAACGCTCGCAACAGTTCCTGCACCTTTCAGCGCACTTCTGACCCTTGCTGCTGGCGTTAAGCAGCGGTGGCGGCGCGCGATGAATCATTATCGCAGTCGCTACGATCTGGTGGCGATCCTCAAACGCTGGGGGCAGGGCGAGCCTGCTTTGCGTAAGCTAATCGTCGGTCGATGTGGTTGATGGTGCTGTTGCTTTCAACCGTTACCGTGCAGACTGACCTGTTGTTCGAAAACGTGTTGATGGTACGCTCCGGCCCGTTCGCCTGCTGCCACTACCGCCAGCCAGCCTCTGGCGTGGCTGTAACCTGGCACCATGACGGTCATCTCGCTGCGGGGGCTACGACCATAATCGCTTATTGCTGGCAGCACTGGCGCTTCTGCGTACCAATGATGGCTAGCGAACGTCTGGCCGCTGAAGTTTTATCTGCCGATTGTCGATATGGTGGTTGTGCTGCCACTCGCCGGATTAATGCGGGTGACGCGCATGCTGCTTTGGGCGGTGCTGGCGGGCGCGGTAGTACTGGCACATGCGGTGTGCTGGGCTGGATGCTTATGGATAACCTTCGCCGCATGACGCTTCAATCGCTGCCTCTGCTGGCGGCGGTTAACCGCCTGCATCAGCCATGGTCAGCGATTAAATCCCAGCTTTTCGGCATTTTCGCTCTCCTTTATCTGCTGGCTGCTGCTGGTGTTGCGTGGCGATCTGCTGATGCCACTGGCAACCTTCTCTCAGCCGACTACTTTTTATTCGCATCGCCACAGAACAGGTACTTCGCGCTTAAAAGCGTTCTCAGACATCAGATAGTCCCGGAATCGTTTATCCGATTGGTGCGGGCGCGGCTGACGGCGATTAACGATAAGCCAAGCAGAGGAAGTAATGAAGATGGGCGCTTAAACGCAGTCAATCTTACAACGCAAATGCGCGGCCCAGTCATCCGGTGTGCGGTAACTGGCCGCCAAAGCCTGATATGATGTCGATGGGAAGAGGGCTGGCGGAAGCAGCGCTTAAACGTTACCTCGGTGATACCGTGACTTTATGGGCGTCACCCAGGAGTTCCACTTCAAAGTGACCCGTATACCACTGAAAATTGGACTGGGAAAGTCTGGCTAATTTCTACTATTTCCTGAAGGAACCAGACGGGCAACCCGCGGAGCTGACACCAGTTTTCCGCTGGGGGAGAATGGCAGCGGCATTGTTGACACAACTCGCCGCCAGTTCCACGACCAATTAACCTGTTAGATATTGGCATGATTTTAAAAACGGATCGGTTGGGTGCTGGAGCAGGTAGTCCGGGCTTCTGGAAGTGATGGTGTACTGGTCACTTATACCACGTTATCTTTATATTGCTAGCGCCAAGTGCAGGTGGGAATGCGTCAGCGATCATCAGGAGCTACCCAATTGGGGTGTTAGCTTTTTACTCAGTGCGGAAAAACTGCTGCATTACCACGTTTGTGTTGTGGTTCATATGGCAGGTTTGTTTCCAGCCTGGGTGACCACCATTGGTGCGGAAAACGCTGGCAGTGTTGCAGGCGAAGTGATTTTCCGTGGGGCCAGACTGGCGATTGTGGATTGTTCTGCCGTACGCTGGAGCGCTTTCTGCAATGGCACTGGCGGCTGGCTGGGTGCGCGACTGGTTGAGGGTAAAGGGCGCTATTCTTCGAACAGTTTGCGGGAGATTGGTAAGAGGAGTAATGAGGCATTGTTGGAATGGAACGCCTTGTTGAAGTAATTCTGTATGTTTTGATGATATTTGGTGAATTGGATTTCCCTGTCTTTCTATTTACTGATGTGTCTGAATCGGTGGAGGTTATTGATTTTAAATATAGCCCCATCATGAACTAATAAATCCATAAAATCTGCTGGTTGAATGAATCATATCTGCTGTGAATTTGTTGATGATGAATTCGTCATTATACAAAATATTAGTTTAATAAAATATTGAAGGCGTGACCTGTAATAACGGTTATTTGTTGATTGAACCATCAGTTTATATGAAAATATGTAAATCACATTGGCTGGTCGCGTATTGTCATTTTGTTTTTGTTTGCTTCAACACGGGATAGAACAATAACTAAAGGGCACACTTTATGAGCGGAAAACCAGCGGCGCGTCAGGAATATATGGCTCAGTGGCGGTCATTTGGTCGGGGTTTAAACATGGTGTAAAATTGGCGCGCCCACCAGCGTGGCGTGCTCGGTGTTCCGGGCGGATGATGACTTCAGACGGCCAGGCAAATCACTGCTGAAGCTGGTGCTGCCCGGCGAGACGGACTTAGCTGCCCGGCCCACGCTGCCGTTCGTTCTCTCCCCGCACCTACCTTCTGGACGAAGACGCCTGCACCGGTGGGCGTTTCGGCTGGCTGAAAGCGCCACTTCTGATATCCGCCACAGCTACGTGATGACGAGGACTGATACTCAGCGACATAGCAGCGAACATTCACTTTGAGCCGCTGCTGCCAGGAGGCGGTGTACAACCACCAGTGTTAGATCAGTAATATGGCTGGTGCGCGGTGACGAAACCTTTACAACCGGAACGCTTATACCGCTGGCGCGGCTGGCGGGGCGCTGCCGCGGATATCCGGTTAAATACTTATCGCTACCCTGGCGACCAGCAGCGCACAGGGGCCGTATGCTGGATGTCTGGGGTGGTCTGCAGGCTGGATTATACCAGTTGCTGAGGGACGTACCACCAGCGCCATACTTACCGCCATTTTCCGGGTGCTTTACCGGGATGGCGGACCACTTCGATGGACGCGCTATGACGATATGGCGATGAAACGCCGAACCGAAATCCGGCGTATTGGACGGTGCCAGGCGGGAAGTTCAATCACGGTGCTGATACAGGCGCAGCGTTGGAAGGGCCTGTATCATTCTGACAGTTCCCGCCCTCTCAGCCTCGCGTTCCACAGCGACCTGCGGTACCAGGCCGCAGGCCCCGACAAATTATCCTGCTGGCGGCTGATACTGACCCATGCCGACCTGCCGCTGCGCCACTGGTGCGTTTGCATGTACCGGAAGCCGTTGACTGCTGGCGATATGTACGTAATACGCTGATTACTTTCTACGTATGACACCAGACCCGGATGGTGGCGCACCGTGCGGAAGAACAGAATGCGCTACCGCTTCTACGACGACCAGGGCGGTGGTGGCGGGCAACTGAACCGGCGGGGTTCGTACCTATCTGCCGGGCCGGACCGCATCACCGTCACCGACCAGCTACCGAACCGGCGTGAAGTTTCGCTGAAGGCGGTAGGCGAAGCAGATGGTGAAAAAGAGCTGGCGGACGCGGCGTGCGCAGCCAGTATGTTGCGGCGGAGAACTCTGACATGGATGAACGCGGCAACGGACAGAGGACTTGATACGGTCTGAATGTGGGTATCCGGCGATGTCACTGGACATCACCACCAGTTCGACGGAGACGAAATTCTCAACGTGAGAGACCGGCAGGCGGCGGTGAACATCTGGACGGTGGAAACCTACCGGTCGATGAACCGGGCAGGCTGACATCCAGCGTAACGTGGGGAGATGAAACCACTTCGACGACGGTTCGCTGCCGAAGCGGGCGCCGCAATTAACCGGCA
+>f1b306de-8038-46af-b38f-7cf0d4c292ad
+ATCAGTATGCTTCGTTCAGTTACGTATTGCTTTTCTGTTGGTGCTGATATTGCGGCGTCTGCTTGGGTGTTTAACCTAATAAAAACACCAGCAATACGCCGATTTATCCGCCTGCACTCGGGTACACCTCAGTGGCCTAAAAGTGATACCGGAAGGGTAGAATTCTGGCTGCAAAGATTTGCAAAATCTGCGGGCGGGGTGTAAAAGTATAAAATATGGCAAAAGCCATGATTTAACTAATGTTTAGTAATTTAACTTTGTGTAACTTAATTACAGGATGAATAATAAATAAACCATCAATAAGCAAAAATAAGTGGTCGGATGAGTAGTAAAATTACACAAAGGCGGTACTATTTTTCATCAGATAAACAAATTCATTTTTCCGGTGCCATTCACCGGGTAGATATAAAGGGGAAAAGTATGGAACTCTACAGAGAATATCCTGCATGGCTTATCTTTTTACGCCGTACTTATGCAGTTGCAGCGGGCGTTCTACTGGCGCTGCCTTTTCATGCCTGGAAAGACCGCGCCCGCTTTACAGCTACCTGCATCGCGTCTGGTCGAAACCGGCGATAAACCGGTGTGGATGGATCAGGCCGAAAAGGCAACTGGTGATTTTATTGATTGCTGAGTTTTGAATACATTGAAAACCGCCAGCGAAACGCTGGCGGTTTTAATATCAGGAAAGTCATTCAGAGGAATATTTAGACATCGTTGCCACCAATCGAAACATATGTTATTCATGAAATATATATAAATATTTTCCTAATTGTTCTTATCTGGCCAGATATCTCACTTAAAGGCTTTCTTATAAATCTGTAGGGTTTCGCCTGTCGGCAGACAAATAACCCGATAAACAAGGATGAAGCAGATGAGCGGAAAACCGGCGGCGCGTCAGGGCGACGCGATGACGCAATTATGGCGGTAGCATTGTCCAGGGTTCAGCCGGGGTACGCATCGGTGCCCCACCGGCGTGGCCTGTTCGGTGTCTTGACGTGACGTCAACCATCCGGTCGATCCGCTGCTCGGTGCAAAGGTCCTTCCGGTGAAACCGACATCACCTACGGCCCGCTGCCGTTCATTCTCTCCCACTTTTCTGGCAGTTACCGGACAAAAACGCCCGCGCCGGTGGGGAGCCTCGGCCCCAGCTGGAAAATGCCTGCGGATATCCGCTTACAGCTGCGCGATAACACTGATACTCAGTGATAACGGCGGCAAGCCTGTATTTTGAGCACCTGTTTCCGGTGAGGACGGTTACAGCCGCAACGAGTCTACTGTGGCTGGTGCGCGGCGGCGTGGCCGAAACTGGATGAAGGTCACCCGGCTGGCCGCCTCATGGCAGGCGCTGCCAGGAAGAACTCCCTTAAGTCCGCATCGTTATCCGGCGACAAACAGTCCCGCAGGGCCGTGGTGGCTGCTCGGCTGGTGTGAGCGGGTGCCGGAAGCGGATGAGAGTGCTGCCTGCGCCGCTGCCGCCATGCCAGGTACTGACCGGGCTGGTGGACCGCTTCGGGCGCACAAGACGTTCCACCGCGAAGCCGCCGGTGAATTCAGCGGCGAAATCACCGGCGTGACGGATGGTGCCGGGCATCACTTCCGGCTGTTACTTACTGACCACGCAGGCGCAGCGGGCAAGCCCGGCAACAGGCCATTTCCGGCAGGACGGAACCATCGCTTTTCCTGATACCCTGCCGGGTTACACCGAATATGGCCGGGACAACGGCATCCGTCTGTCTGCCGTGTGGCTGACGCACGACCAGATACCCGGAGGAATTTACCTGCCGCGCCCGCTGGTGCGCTATGGCTGGACGCCCGCGGCGAACTGGCGGCGGTGTATGACCGCAGCAATACACAGGTGCGCAGCTTTACTTACGATGATAAATACCGGGGGCCGGATGGTGGCGCACCGTCACACGGGCCGACCGGAAATCTGTTACCGTTACGACGGCGACGGGCGGGTGACAGAACAGCTAAACCCGGCAGGCTTAAGTTACACGTATCGGTATGAAGGGCCGCATCACCATCACCGACAGCCTGAACCGCCGTGAAGTCCTGCACACGCAGGGTGAAGGCGGGCTGAAGCGAGTGGTGAAAAGGCTACGCGGACGGCAGCGTCACGCCAGGTCAGTTTGACGCGGTGGGCGGGCTCAGGGCACAAGACGGATGCCGCGAGCAGGACAACAGGGCTGATCCGGATGTGTGGTGACGGGCCTCATCACGCGCGCATCACCGCACGCCGGATGGCGGGGCATCTGGCGTTTTACTACCTTCACCACAGCCAGTTAACGTCATACCGGGCTGACGGGCTGGAAATACGCCGGGAATATGATGAATGGGGCCGTCTGATTCAGAAACTACCCTGACGGCGATATCGCACCCATACCGTTATGATAATCCACACGGTAGTACCCTGCGCAGCGGAGATGCCACCGGCAGCGGAAAACCATGACGTGGAGCCGTTACGGTCAGTTGCTGAAGCTTCACTGACTGTTCCGGTTTATGTAACCCGTATGACCATGACCGTTTGGTCAGGTGACGGCGATTGCGCACCGCGAGGAAGGGCTGAGTCAGTACCGCGCATACGACGGCAAACTGGACGGATTAATTGCCGTGAAGACACAGGGCCATGAAACGCGGTATGAATACAACGCCGCCGGTGACCTGACCACCAAATCCATTTGCCCCGGACAGCAGAAACGGGACACAGTACGATGCGTGAGGGAAAAGCCATCTGTACCGCAGGGCGGTCGACGCGCAGTATGGAATACGATGCTGCCGGACGGGTCATCCGCCTGACCAGTGAAAACGGCAGCCACACCACCTTCCGTTACGATGTACTCGACCGGCTGATACAGGAAACCGAAGCTTTGACGGCCGCACACAGCGTTATCACCACGACCTGACCGGCAAACTTATCACCAGCGGATGAGGGGCTGGTCACCCACTAACACTTATGACAGAAGCAGACCGCCTCACGCACCACCGTGAATGGCGAAACCGCAGAGCGGTGGCGAATATGACGAACGCGGCTGGCTGACGAGATTTATCCAGCCATATCAGCGAAAGGGCACCGGGTGACGGTGCACTATGGTTATGACAGTAAGGCCGCCTCGCCAGTGAACACCTGACGGTGCATCATCCGCAGACAGATAGACTGCTCTGGCAGCATGAGACCAGACGCGTACAACGCACAGGGACTGGCGAACCGCTGTATCTCGGACAGCCTGCCCGCCGTGGAATGGCTGACCTACGGCAGCAGCTGGCTGTCAGGCATGAAACTCGGCGACACACCGCTTTGGTGGAATTACACCCGCGACCGCCTGCACCGGGAAACGCTGCGCAGCTTCGGCCGTTATGAACTCACCACCGCTTATACCTGCCGGGCAGTTACAGAGCCAGCACCTGAACGGCCTGCTGTCTGACCGCGATTACACCTGGAACGAAGCAGCGGCGAACTCATCCGCATCAACTGGCCACGCCAGACCGGGTTACAGCTACAGCACCACCGCCGGCAGGCTGACCGGCGTTCACACCACCGCAGCGAATCTGGATCATCCGCATCCGTATACCACAGACCCGGCAGGTAACCGCCTGCCCGACGAACTGCACCCGGACAGCGCCCTCAGCATGTGGCCGGATAACCGTATCGCCCGTGACGCGCACTATCGCTACCGGTATGACCGTCGGCAGGCTGACAGAAAACCAAGGCCTCATCCGGAAGGGTTATCCGCACGGATGATGAGCGCACCACCATTACCATTACGACCCAGTCAGCACCACAAACGGTGCACTACGCGGACACAATAATGCCGGGCGCTGGTCGAAAGTCGCTATCTTTACGACCGCTGGGCCGCAGGGTGGCAAAACGGGTATGGCGGCGTGAACGGGACCTGACGGAAACGGAATGTCGCTGTCACGGAAACCGCAAAGTGACCTGGGTACGGCTGGGACGGCGACCGCCTGACCACGATACAGAACGACAGAACCCGCATCCGGACGATTTATCAGCCGGGGAGCTTCACGCCACTCATCGGGGTTGAAACCGCCACCGAGTGAGCTGGCGAAAACGCAGCGCCGCAGCCTGGCGGACCCTTCAGCAGTCCGGTGGCGAAGACGGTGGCAGTGTAGTGTTCCCGCCGGTGCTGGTGCAGATGCTCGACCGGCTGGAAAGGTAGAAATCCACCAAGCTGACCGGGTGAGTGAGGAAAGCCGCCGCTGGCTGGCATCGTGCGGCCTGACGGTGGCGCAGATGCAAAGCCAGATGGACCGTATACACGCCGGCGCGAAAATTCACCTGTACCACTGCGACCATCGCGGCCTGCCGCTGGCCATATCAGCACGGAAGGGACAACAGCGTGGTACGCAGAATACGATGAATGGGGTAACCTGCTGAATGAAGAACCCGCATCAGCTGCAGCAGCTTATCCGCCTGCAGGGCAGCAGTATGATGAGGAGTCCGGCCTGTATTTACAACCGCCACCGCTATTATGACCCGCTGCAGGGGCGATGTATCACTCAGGATCGATTGGGCTGAAAGGGGATGGGTACATCGGTATCCGTTGAATCGATCTCAAATATAGATCAGTAGGATTAGAAACACTAAAATGCATTCAAGCCCACTGCATTCAATGGGCGGAACTGGTGAAAAGCGGTCCAGATATGGGAATCCGTTCTATCATCAATATCTTTGTGTCCCAGATGGTAAAGGGACTATACTTGTGGTGGCCAAGACCAGCAGGGAGAATCAAAGGAGATGGTCTATGGGGGCCAGGTAAAGCAAGTAATGATACAAAGAAGCTGCTGGCCGTTTGTGATATCGTTGAAACCGATAATAGTTGTGTGGAGAACTGTTTAAAGGAAGTTTAAAGAGGTAAAGCCGCGTTATTCTGTATTGCCTGATATATTCACACCTATAAGTTGGGCTATTTAAAACTGCCAAGACTGGTCTAATGATTCTTCCCAGAAACATGTAAGATGAAGTGCTCGGAAATAACATTGGACGTTTTATTAGATTTTATTCACCGGGTGAATAGCAATGAAATATATTATTTTTTATTCAGGGGCTATGGCTGGCTTTGTCGCTTTTAATGCTACTCTTTTTCCATGCATGAACTCACTATTAAGGACTCCACTCGTGATGTGGGCAGGTTAATTAGTCTCATGTCTTATGGAATGATGGTAATATGTTTTCCAACAGGCATAGTATTCTTTATTGCTCTAATATTTATAGGGACTGTATCAGGGCATTTATTAGCGTAAAGTTGATAGTAAGTATAATTATGGCGATAATAATATGGCTTTATTTTCTGTCAGGAGGGCATATTCAATGGTTTGTATTAAGTAAGCGCATTATAAACAAATAAATTAAGTTAATTGCTCTTATTATTATATGTAACCTGGGCATTGATATCCGTATGCCACAGACCCGGCAGGTAACCGCCTGCCCCGACCGGAAACTGCACCGGACAGCACCCTCAGCATGTGGCCAGGATAACCGTATCGCCCGTGACGCGCACTATCTTTACCGGTATGACCGTCACGGCAGGCTGACCGGAAAACCGACCTCGCTCCGGAAGGGGTTATCCGCAGGATGATGAGCACCCACCGGTACCATTACGACAGTCAGCACCGGCTGGTGCTACACGCGGACACAACTATGCAGAGCCGCTGGTCGAAAGCCGCTATCTTTACGACCCGCTGGGCCGCAGGGTGGCAAAACGGGTGTGGCAGCGTGAACAGGACCTGACCCGGGCTGGATGTCGCTGTCACGGAAACCACCGAAGTGACCTGGTACGGCTGGGACGGCGACCATGACCACGATAGAACGGCAGAACCCGCATCCAGACGATTTATCAGCCGGGGGCTTCACGCCACTCATCAGGTTGAAACCGCCACCGGTGAGCTGGCGAAAACAGCGCCGCAGCCTGGCGGATACTTCAGCAGTCCGGCGGCGAAGACGGTGGCAGTGTAGTGTTCCGCCGGTGCTGGTGCAGATCTCGACCGGCTGGAAAATTGAAATTTCAATGACCGGGTGAGTGAGGAAAGCCGCCGCTGGCTGGCATCGTGCGGCCTGACGGGTGGAGCAGATGCAAAACCAGATGGACCCGGTGTACGCCGGCGCGAAAATCCACCTGTACCACTGCGACCGTCGCGGCCTGCCGCTGGCGCTTGTCAGCACAGGAAGGGGCAACAGAGATGGTGCGCAGATACGATGAATGGGGCAACCTGCTGAATGAAGAGAAGAACCGCATCAGCTGCGGCAGCTTATCCGCCTGCCGGGGGGCAGCAATTATGATGAGGAGTCGGCCTGTATTACAACCGCCACCGCTAACGAAGGCCCGCTGCGGGGAGGTATATCACTCAGGATCGATTGGGCTGGAAAGGGGATGGAATTTTATCATTATCCGCTAGTCCGGTTCAGTATAGATTCAATGGACTGGCATCAAAATATGGACACTTAAATATGGCGGATATGGGCGAGACCCAACAAACCGCCGCCCGATCCAAATGAATTGCGGACCATGGCGAAACAATTAAGACTGCGCCGTATCCTGTGAGCCAGGCTGATGGTGCGCTAATGTTTTCAAGCATTCTTCAGAGCATTAAGCCCTTACGACTACACACTGTATTGCGAGATGGGTAAAACCAAATCTGACTTGTACGCCACGGGATGATTCCCAGTATCAGGGATGGATACAAAAGACAGCAAATTACCTGCCATGAACAAAATTGGCCAACAACTCAATTACCACCAGGATATGCTTGTGCGGAACCTATTTATTCCCAGACATTAATAAACCCGATGGGCCAGCAACAGCAGGGATGAATGATTTGGAATTGAAGTACAGCTAAGATCGACAGAGAACATCGAGGAGAATAGAAAATGAAAAGAGTTTTGTTCTATTTTTGCTGATGATGTTGTTGGTTTGGTGTTATAGCTGATTGCGAAATACAAGCTAAAGATCATGATTGTTTTACTATTTTCGCTAAAGGGTACTATTTTTCCGTTTCTGTGTAAATAATAAAGCCATGTGGAGATGGTATCCAGAATGAGGACATCGGTGAGTATTATTAGCAAACAGAACTGGGTACATGTAAAAATAATAAATTCACCAAGCGAGGCGAGACTCTTAATTCGCGTCGGTCACTACGCTAATGAAAATCCTTATCAAAGGAACGTTGCAGGGTGTCATCACAGCAGAAAAACGGCGTTCTCGTGATCGGTTTAGAAGTTATATAAGAGCGGGTATCTATCAAAAGAGCAGTGATCCAGTTCAGTTGTTGGCAGTCCTTGATAAATTCAATCATGGTGAAATATTTTTTAAGATGAAAGCAACATGCTCGAATGACAGCACATCCCGAACAAAAGAATGAGTCTTACGAATGTTTAATAAAGATACAGCATGAACTAATTCGTAGTGAGAAATAAAATCTCTTCCTGAGAAAACAAATTAATCATTGTGAAAAATTAACATAACTCATGGAATAGGTGTTTATTTTGCGTTCCATTTGCGGGAAAAGATCACGTAACGCTACTTTTTTTGTACTAAATAATTCAGATTTTAAGTTCAACAATTGAGATACTACTTATTGTCCTAAAGCTGTTTCATAGCTTATACATGATCAAATACTCCTTATAAATAGGAGTGAACAAATGGAACTTAAAAATTGATGGAACGTATTTCTATTACACCCGATTACAGACAAGCCTGGAAAGTGAATTGCATAAATTGTCAGATATTCTACCATTTGACTATTTGTGCCGTTATTTCTGGTGCAGAAGGTTGGGAAGATATAAGAGGATTTCGGAAACACATCTCGATTTTTTGAAGCAATATGGTGATTTTGAAAATGGTATTCCTGTTCACGATACCATTTAGGTTATCAAGGAAAGATCACGTAACATACTTTTGTACTAAATAATTCGCATTTTATGTTTAAAATTGAGATATTCCTTATTACCTAAACTGTTTTCATAAAGCATACCTTGATCAAATACTCCTTACATAAATCCGGGTGAACAAATGGAACTAAAAATTGATGGAACATATTTCTATTATTCCCGATTACAGATAAGCCTGGAGAGTAGAGCATAAATTGTCCAGGCATCAGGTTAAACACCAAGCAGCAGACGCCGAAGATAGAGCATA
+>f432cb50-8c47-4c54-825f-ab04a38b5225
+TCGGTACTTCGTTCGGTTACGTATTGCTTGCCTGTCGCTCTATCTTCGGCGTCTGCTTGGGTGTTTTAACCTCTGGCATTCGCCGGTCAGGCGGCAACATCGTCATAGCCATAGTGGACGGCAACACGGTGGCCTTCGCTCAATTGGCTGATGTCTGTCAGCCAGCCGTAGCCATCATACTGCCACTAACTCTGCCGGTTCGCCGTTCACCGTGCGGTGATGATGCAGTCCGATTCATCGTAGTACCCAGGATGACAAGTCCTCATCCTCACTCTGTGTCGGTTTCCGGTCAGGTCATAATGATAACGTTGCGTCCGCCCGTCAAAGCCACCGCCCTGCTGTACCAGCCGGTCCAGCGCGCATCGTAACCTTCAGAAGACGCTGTGGCTGCCGTTCTCGTTGGTCGAATTTGATGACGTCCGGCAGCATCGTACTCCATACTGCGCGTCAGCCTGCTGGTGCTGACCGCCTTTCCTACGCATCGTACTGTGTCTCGCTCGGTTGCCGTCCGGGGTGATAACGGCAGTCAGGTCGCCTGCGGCGTTGTATTCATACCGCGTTTCACGGCCCTGTGCGTCTTTCACCGAGTTAACCGGCCACGGTTGTCATAGCGGCGGTAAAGGCGATGCCTTCCTCGCGGTGGATTACGCCGTCCTCATCTGGCCGAAGCGGTCGTATTCATAGCGGGTCTGGTAGCCCGAGCAGTCGGTGAACGCCAGCAACGCTGCCGTAGCGGCTCGGGTCATCTGCCGGGTGCTGCCGTCGCATCCGTTATCGTCGCCAGTAACTCACTGTGCGCGTCATCGTAACCCGGTAGCATACTGTCTCCCCGCTGCGCGATGTCTCCGATACCAGCCTGCCCGGTTCATCCTGTTCCGGCGGCTCTCCAGCCCGTCCGGGGACACCACCGCCGTCAGCTGGTTCCGTCGTTATAGTAAAATTTCGTCTCCGCCCGTCCGGTGTGGTGATGTCCGTGATATCGCCGGACACCACATTCAGACCGTACTCTGTCCTCCCGTCCCGCCGCATTCCATTCTGCGCCGTGGGCCTTCCTGCCGCGTCATACCGCTGCGTGACGCTGCCGTCCGCCAGTTCTTTTCACCACCCGTTTCAGTGGCCCGCCTTCTGTATGCAGCACCTCGCCGGTTCAGGCTGTCGGTGACGGTGATGCGGTCCTGCTCATAAAGATAGCGGTAAGTAACCCTGCCGGAGTTCAGTTGCTCCACCACCGCCCCGTATCGTCGTAGCGGTAGCGCGCATCTCCAGCCTTCCCGCGTAACGGTGCGCCTACCATCCGGCCCGGGTGCTGCGCGTCATACGTGAAAGCGCGCACCTGCATATTGCTGCGGTCATATACCGCCAGCAGTTCACCGGCTTCCGTATACGTGTACCGCACCGGTATGGCGCAGCAGGCAGGCTCTCCGGGTATGCCGGTCGTTATCAACCACACCACCGAAGGCGGATACCCCTGTCGAGGGCCGTATTCGGTACCGGGCGGTGTGTCGAGGAACAGGCTGAGAGGGCGGGAACTTCTCAGAAAGAAGATAGCGAAGAGGTGCGGGCCTCTTCCGCACGCTGCGCCGTGGTCAACACCAGACGGAACTCCGCCCGGCACCGTCCGTCACGCCGGTGTTCCCCGGCCAGGTCACCGGCGGCCTCACGCCGGTACGTCAGCGATCGCCGAAGCGGTCCATAACCGGTAAAGCACCCGAATTTGCGGCAGCAGCGGCGCTGGCAGTACGTCCTCAGCACCGGCACCCGCTCAGACCACCCCGGTATCACCGGCCCTGTGCTGTTGGTCGCCAGATGCGGGCTTAACCGGATATCCGGCGGCAGCGCCCCACAGCCGCGTAATATGGCCGTCCGGCTGTGCTGCCTTACCCACCGCGCACCAGCCACGATTGACTCTGCGGCTGTACACCGCCTCCCCGGCAACGGCGGCTCGAGTGAATGCTCCGCCCGCCCGTTGTCGTTGAGTATCAGTCCGTCATCACGTAGCTGTGGCCCGGATATCAGAAGGCGCTTTCCAGCCGGGGCCGAAAACGCCCACCGGTGCGGGCGTCTTCGTCCGATAGCTGCTGTAGATTTTCGCGGGAGAATGAACGGCAGCGGGCCGGGCAGCGCAAAGTCCGTCTCGCCGGGCAGCACCTTCGCCCCCAGCAGCGGATTTACCGGGTTGCCCGAAGTCATCCCGCCCGGACACACCGAGCACGCCACGCCGGTGAAGCGCGCTTAATTCTTACACCTGCCGAACCCTGGTTAATGGACCGCCATACTGAGTCATATCCTGACGCGCCGCTGGTTTAGGTTAAACACCCAAGACGCCGTATCGCCGCG
+>d57afb7d-903e-46cf-a43d-0e17fb0949d8
+TTGGTATGCTTCGTTCAGTTGCATGCCTGCTGCTTGCCTGTCGCTCTATCTTCGAGCGATCTCAGCGGGTGTTTAGCCTGCGTTAATGCCATTTACACACAATCCATCCACACATATTACGACCGCTGACACCTTCATGCCATTTTGGCGTTGATGTTCGGTGCGGCAAACAGCAGATCAGAACGGGCTGGTGGAAGCGTACATCCATAAAGGCGTGTTCATGCGTTTGTGCGGTATAACTGTTGCCTTCCAGTGTGGCTGTCTTTTATGAATTTGCCGAAGTCTGAAAGAAAACAGCTGTTGTTTGCTCACCAATTGCGCCAAGCAGAATACCGGATCGTTCTCTCATTAAAGATCCCAGCAACAGCAGCGAACAGTCCCGCCATCATCGAATAAACTGTTCATAGCCGACCCATGCTGAGTCAAACAGGATCGCCAGTCACACCGGATGACCCATTTTATCCACCATGGCGGGCGTTGCAAATCGTGCGTCGGCCAGGTTTAACTGAATCACCATGACGGAAGGACGAGCCTCACGCCCGCTGCGGTGCGACTTCCGCGATCGCTCACGCAAAGCCAGCTTTCTTTAAAACGGTGCGCATCCAGTACCACCGATAAAGCCATACGGGTTACATTACGTTTCCAGATAAACCCAAATTATTTTCAGCCTGGCAACACGCTCCGTGGTGGATTTACGTTGTGGTTGTGCGATCAAACAGCACCAGATCACGGTATTGGCAGGGCGTTAAAACCACTTTGTTTAGAAGATGAGTGCCATTTAAACGAAGTAGGTTTTATCGGCATTAAACACACCGCAGCTGTTGCTGTGCAATGCACGGCGCACCTTCGTGAATCAGCAGATCGCCCATCGCTACGTCGGCGTTGCTGGAATCGGCACGGAACAACTGCCTCACCAAAAGTATTCCCAAACTGATTCCCCACCACCGGATGGCGCTGGAAAATTCGCCCTGATGACCAGGGCAATCAAATGCCGCTGTTACCTTGGTTGACATAATCGATATGATGCGCCGGAAGAAAAGGTGGGCGCAGTTGGTTTCATAATGGCTGGCGGCGGTTTCCAGCTGGCGACCGCAAAATTCTCGATGCGTTCACCAGTTCTCAAAGACCCCGAAATAAGGGCAAATACTCTCACGGTGCGATTCTTGATTTTCAGTAGCAATAAATACGAAAGGATTACGCAACCGTGGCATCGATTTCATGTCGATTTTCGCATGCCAACATCGTTGGCGATAAAACTATTGCGCCATGCGATATTACGACTTTTTCGTAATGTAGATGCAATTCTCGCTGCGTGGTAAAACAGTCCGGGCCGCAAGAATCACTAACCTGCTTTTAATTTGTTGTTTTTCATCTCTTTAGTACAGGAGTAACGGTCATAATTTCTCAGATAGAAATCAGTCGATGCCGGAAAAAAGCAAATTCTTTCCCCGCTGATAAATAAATCAGAGTGGAGTGCTTTTTCAGAATGCGAGCCCTTACCAGTCAGGTGGCTGATAAATGCAAGGTTAACAGAGAGAATGAGCACCACGGAATACAGGCCTCACCTGCTAATACAGAGAGAGTCAGAAGGAAGACCTGTACGCTGAAGTGCCCTTAGTCCGGTGACTAACGGGCGATGAAGAAATGCTGAAGATCAAGCCCTATGCGTTAGGCAAACTTCATAATATGATTGTCACTTTGCTTATATGGGGCGCCAAATTGGCTGGTATTTTCCATTTAATTGCTTTCCTGAGTCTCTTGAATGAAGGTGAGAATATTCTATCCGGGAAGCTGAGTTTGAACCATGAAGGTGATCAATAAAAAAATGATCAATCTTAATTTATTTAATGATGAGCTTTTTACTCAGTAATATAAAATATTGAATTGTTATTTTGTGTGTTATTGCAAGATAAAAAAGCCGTATTTTATTCTATTGGCTTTAATTAATAAAAGAGCGGGCTGTATTAAAATTATCTTCAGCATAGCGCAAGCCGTGGCAATACCGGTTTCAATGCAATGTGAAATGGCGACTGGGCGGGCGGGATCCTGTTCCAGTTTTGTCGCAGATGTCCATATAAATACGCAAATGGCATTGACGACTGTTCAGGCCGCGTTTGGCCCCCACACCTGGTTAAAGGAGCTGGCGCTGGGTGAAATTACTTGCACAGCATTGTTGAGCGGCACCGCCCCAGCAGAGCCCGGAACTCAATGGTGGCGGGTGCACCTCTTCTCCCCAGTACTGAATCACGCGGGCGGCTAAATCGACGGTAACATCGGGAAGATTGCCCCACCGCTGGATCAGGCGCAGTGGTGGCAGAGTAGCGGCTTGTGTCGACGCGAACCGGGCCTGTTGTAATGCCGACGGCTTATCGGATAATCATCCGCTCCGGCATCCAGCGCGGCGATTTTTATCAGCTCATAACTGCTGCGTGCGGAAAGCAATCACCCGGCACCGCGCTCCACTGGCGCAGGTCGCGAGATAAACTCAATCCATCACCATCAGACGATGAGATCGAAATAATCAATCCCGACACGGGTTGCCCTTCCGGCAAACCCGGTTCGCGTTTCGGCCTCAAAGACGTAAATCGCCCTCCAGCGCCGTGCGCAGAAAGCGACAACGAATAGCCTGTTCATCTTCAGCAATCCGAACGTTTTGTCACGCCATCCTCATGAAATTCTTCAAGTTCGGGGCGGTTTGCTGAAATTAAACACGAAGCAAATACCCACCTTCGGTCGGTTGAACGCGGTAATAGATGCTTTAGTAGCCATCCACTATCACCCGACAAATTGCCAGTCCAAAGCCCTACCCCCGGTACAGCTCTTTTATTCCGCGAACAAACATCCGATATCGTCTTTCCTGGCCTGGCGGAAGAGACCGGAGGCCGTTATCCCAGACATCCGGTTGTAGATTTTCGCCCTCAACGTGGGCATCGATACCAATTTCGGCCTGCGCACCGCATATTTCACCGCCGTTCCTCAGCAGATTAATCAGCACCCGTTCAAAAGTGGCCCGTCAACGTGGATTAAGGTCAACCCGGTTCTGGCAGAGAAAGATTAGTGACGACGATAAACCCGGTTCCAGCATTTGCAGCGCGCTGCCGACTACTTCTTCCAGCGTTAACCACTCTTTCTTCAAATTAAAATACCGCCGGACTGAATTCGCGCCATATCAGTAGATTATTCACCAGTCAGGTGAGTGTTCCTTTATGCTGACGGATCTCGCTGGCCTGGCGGGCGTGGAAATTTGATCTTCGCTTGCAGATCGAGCGTTAAGATTTCTGCTGACCAAACAGCACCGTAAGCGGCGTGCGCGTAAATCAATGCAGAAAGCGCCGCCAATAAGAAGGCGTTGCGGATCTGTTCACGTTCGCTTGCCATCCGCGCCTGTTCTTCGCTGGCGGTTGGCGTCAGCCGCTCAGAACATTGGCGATAACAGCGTAAACGTCTCCAGCGAGCGCTGCTGTTTCGGGATCATCAACTGGCGCAGATTCCCAGCTCCACCCACCAGCCCGTAGGTTTCTCGCCGCTTTTTAGCGGCAAAATCCTGGTACGTTACTGCCGGGTAACGTGTCGAACCGCGCCGCGAACGGGCAGCTATCAAAGCTCCACTGCGCGATGGCATCGTCCCACGGCGTCATTCCTCGCGGATGTGTTAAACGGCTGCAATTTACCGTTGTCATCGAACGCAACACCTGACTGCGGGCATGAAGCGTGGGCAATAGAATTTGTTCGCTGGTGGCAGCGATATCCTGCGGACTGCGGCCCACCGCCAGAGCTTTCGACATTTCGCCTAAGTGCCGTGTGTGCGTTGCTCGCGCGGTAACGGGCTTTACGCGCGCCTGATAACGCACACGCCAGCGAGTAAGGTTCCCCGATCACCAGCCCGACGGTTAACATCACCGCGAGGTCAGCAGATATTGCATCAGAGACGGCAGGCGTGCCGCGTGGGGCGATAAAAAGAGATCGAAACTCACCATTAATGACGGTGGCCACTGAAGGCCAGCGTCCATAAAATAGCGCCACCACCCACCCGCCAAAGCAGATACAGCATCACCAGGTTGGCGGCATCAAAGCCTCATCAGCCACTGCGCGGCAATCAAAAGGTGATGGCAGCGCATAACGCGGCAGCAACCACGCATCCCTGAATTTACCGCCGCTTGTCTTTTAAAAGAGCGGATTTATCCGGCGCGTTGTTAATCGTGCGGGCGGGTGGTTTCATCAAAGCGCGACCAGCACCCTGATCGAGATCGGGGCGATGCGCGCCAGTCGGACAACAAACGTTTCCCGACGCCACCAGCGGCGCGAGGCCGAACGACCGAGAATAATCTTGCCAAGATTATGTTCACGGGCATAACGCACTACCGCTTTCTCTTCCGCTGGATCAGAAAGTGTTGCCGTCTCCACGCCGCCCAGTTCCTGCGCCAGACGTAAGGGCGCTGAGTACTTGACGTTTTCCGGTAAGCGGTGCGGAACGGGGGTTTCAAACATACACCCGCGTGCCAGGCCTTCTGGCCATGACGCCAGCCGCGCCGCTGCGCAGACCGGTTACCGCTGCCGGTGTTATGGCCGATTACATAAAAGGATCGCGCGTCGCGCGTGTGCCACTTCCCTTCGCGGATGCCCCGCCAGGCGCGCATTTAACTATCAGCGCGATCAACCCGGGTACGAGCGCCGAGTGCCAGTTCGCGCAGGGCGATCAGATTACCTTTGCGGAAAAAATGTTCAATGGCGCGCTCCGCCTGCCCGGCAATATAGACTTTGCCTTCTTTTCAGCCATAGCGCCGTCGTCCAGGGGCAGAGTCCACCAACACCACGTCGTCGGCGGCATCGAAAAAGGATCGGGCACGGTTTCCGTACCTGAATTCCGGTGACGCCGCCAGCCACATCATTCAGACTTTCCAGATGCTGAACGTTGACGGTAGTGAAAACATCAATGCCGGCTTCCAGCAGTTCTTCGATATCCTGCCAGCGTTTGGGGTGGCGGGGAACCTGGCGCATTACTGTGCGCCAGTTCGTCCATTAAGATCAGCGCCGGGCGGCGGGCGAGGGTAAACATCGAGATCAAACTCGCTGATATACCGCCCACGGTACGCCTGGCGTTTTAACGGCAGAACAACCAGCCCTTCCAGCATGGCGGCGGTATCTTTTCGCCGTGGGTTTCTGCCACGCCAACCACAATATCCAGCCCTTGCGCCCGCAGTCGCTGGGCTTCTGCCAGCATCGCCCAGGTCTTTGGCGCGCTGCACAGGCACCAGAAAACTTTCAGCTTCCCCCGATGCGGCGCGCGGCAGTTTGTTCCAGCAGTTGATCGGGGTCGGGACGTAAGGGTTCGTTTATTCATCAAGTTTATCCAGCGCCAGATTGGGTTCAACAATGTTGACAACCGGCTGGCCGATATATTTCACCAGTTTGTTGGCGGCTGTATTTTACGCGATCCGGTGCGTGAGCTGTTCAACGCTGGAATTACGCGCTTTCGCCACGCGTGGGTTTGCCAGGCCGCCGCTTGCGGGTGATATTATTGTCCAGCCCGCTTGCCGATCTGCCCGTCCACCAGTTCAACCGGAACGCTCGCGCTGGCATCCGGGTTAGCGGCCCGTAATGCAGCTTAACGCGTGCGGCTATTAGTTTATCCAGCTCAGGGTTACTGACCGCCAGATTACTCCCGCCAAGCCTGTAGTTATAGGGCATTTTCTGCCGTTGCCGACGGGCGACCATGAAAATAGCCGTTGCCGGTAAAATTCTGCCCGATTAATGCCGAACCATGCCGTATCACCTTCACAGATCAACGAACCATTGGCCTGCCGGGAAACCACCATTTGCCCCAGTACGGTGGTCAGCGGCGAATAAACGCCGCCAGTAATCAATAACAGAAAGATAAATGTTGAGTAATGCCGGACGTAATCCACTCATGGTAAACCTCACCAGACCGCAAACGGTCAGCGGTGATAATGGCTTTGACGCGATAAACGGCACCAGCAGCCTGACCGTAAATCCGCAAGTTACGGCTTTTAACATGCGCCAGAAGCGGTAAGCGGTTTATAGCTCGCCTTTAACGCCAGGGGAATCAAAGATGATAATCAGGCGTTAGAAAATCCACCGCACTGAGGATTGCGGAGTCGGGCGAATGCAGGCACATGATGTTCAGCGCATTCGCTGCGGATACGTTGCCGCGAATGCGCCGGAATAATGGCGAAATGGCTTCGCCACATCGTTCTTAATGCTGGAAGATTGGTCAGCGGCCACGGGTCGTAGCATCTGTTTGCCAATGTTACTACCTCAGTCAACTTGGTCGAGTTTAGAGGTCGAATCGACCATATTGCCCGCCTCTTTCGCCGCCTAGGTGCCGGGTTCATCGCCACCACCGGCATCTGCACCTGCATAGCGCCAGACATCCGTTGGTGCAAATCGCCGGTCTTCGCTTTAAAACGACCTTCCGCCTGATACTGACGGATCAATGCCATGGCCTCGGTGTCGCTTCGGCGAGAAAATCATCTGACACCCGCTTCCGCAGCAATCGCGGCAGCGAGTCAGACCAGTTATCGCCGGTAATGCAAGTTTTAATGCCCATTTTGCGCAGCTGGGCGGCAACTACTAATACCGCCAGCGGCGTCATCTTTCAGCACTAATAACCCAGCTACGAACCTTCCACCACCACCAGCGGCGTGGCTCCCTGACGCGCAACCTGATCGACTTTTTTGATCCAACATCGGTGAGAGTGACCACCGTTAGCCTCAACATGGCGACGAATGGCATCGACAGAACCTTTGGATCGGCACGGTTTATTGATGTTGATCCCTTCATCCGGCTTTGTCAAACGGTACAAGGTGGCATGGGCGACTGCGTCGCGCTCGCGCGCAGGTTAAAGCAACTGCTTGGCGGGGATACAATGCTGCGGCCTTCCGGCGTTTCATCAGCCAGCAGAAGCCAGTTGTGCAGCGTCAGCCAGCGTTTTCATCCACGCCCTGCGCGGGATAAACTCTGACGCCTGACGGTTACCGGGTGTGATGGTGCCGGTTTATCCAGTAGCCAGGGCAATCCGGCGTCACCTGCCGCTTCAACTGCGTCCGCTAGTGGCAATCACATTCGCGCCTAGCTGCCCGGCTCATCGGCGGCGCCGTCGCGACAACGGGCCGCCAATAGTGGTTGGGATCGAACAGACCAGCGCCAGCGCCACCAGTACCGTTACGCTGACTGCATTACCCTTTGCGGAAAACGGCCACAGCGTGGCGGTTGCCAATCAAAAACGATAGTCAGAACCGAAATCAACAGAATGGATCAGGGCAATTTCGTTCGGCGTTTGCGTCGCTGTGCGCCTTCCACCATCGCGATCATCCGATCCAGAAATGTCCGCCGGGTTACAACGCTACACTCAATCACCAGCCGAAGTCAGAAGAATACGTGCCGCCGGTGACGGAAGCAAAATCGCCCCGCCGGATCCACGGATCACCGGTGCCGATTCCCCGGTGATGGCGCTTTAAATCGACCACGATCGCCCCGCTTTCAACTAACTTCCACCCATCGCAGGGATATCGCCAGCTTCTACCGAGCACGATATCGCCTTTACGAAGTTGGCGGAATTCGGCAGGAACTTTGTCGCCGCAGCGCCATATTAGCTCACGCAACGCGGGCAAGGCGGATTTTCACCCTTTCGGACTGTTGGCCTGCGCTTTGCGGCCTTCTGCCAGCGCCTCGGCGAAATTGGCGAACAGTACGGTGATCCACAGCCGCCACTAATGGCCGCGCTAAACAGCGCATTGCGGGCATCACTGCTTGCCATCGCGATGCTAACAGGTGGTCAGCAGACTGCCGATCAGACGATAAACATCACCCGGATTGATTGCGCCATTGCGCCTACGGGTTAAATTTTTTCACCGCTGCTCAGCGCCCTGAACGACAAGTGTTGGTTCGAATGGCGCTGAGTTGTTTACGACTCATATTCGGTGCTCACTCAATATCGCTCAGGAGATATTCCGCCACCGGACCAAGCGCCAGGGCAGGGGATAAAGGTCAGTGCGCCAACCAGCAACACGGTGCCGATTAACAGGCCAACAAACAGCGGGCCATGCGTTGGCAGCGATGCCGGAGCTGGCGGCAGCTCTTTTGCTCTGCTTGAACCGGCAATTGCCATCACCGGGATAATCACCCCGAAGCGACCGACAAACATGCGGAACGCCAGTAAACGGTTCCAGAAGAGACGGGGTTGGCGCTTAATCCGGCAAAACGCTGCCGTTGTTGTTATGGCGGATGACACGGCGTACGCCTTCGCTAAAACCATGCGGGCCAGGGTGAGCATAGCGCCTACGATCAGCGTCAGTCTGTCATCGCCAACGCCGCGCCCTCAGCACCAGCGTCAGGGGTAACCAGAATTGCCGAACAGTCAGTTTCATCTCGCGTACGTCTGATTTTTTTTACCGATATTCCGATTGTACGACAATCATCGGCCCGGCAGCGTAAGCACCGCCAGCAGGACAAACAGCATCATGCCGTAGGGCCAGGGCCGACACCGCCAGAACACCGCTTCACCAATTTGCATCAGCCACATCGGCACCATGCCACCGAGGCATTAAAGCAGATCATACATCGCAATCACCGCCACAGGAAGCCGCCGTCGTCACGACCGCAAACCGGGCTACTGACCAGCGCCGAAACGGCTCTTTACCTTCCATATTGATGCTGCTGTCCGTGCCCAGTCACCCGGCAGATGAGGATTACCCTGAACTTCTGCCCACATCACCACGCCTACGCGGATGACCAAAAATCACTGACATCGCCCACAGCAACGCGCCGCCCTGGCGTGATCATATCACTTCACCAAAGGCAAAGCACAGCGCCGTTGGGATCAAGAAGATCGCCAGCATCTCTGCACGAAGTTGGTCGAAAGTGTGGTTGGGTTTCAAACCGGATGCACGACGAATTGGCATTAAAGCCACCACCGTTAGTACCGGTATCATGATCGCTTCCTGAGAAGCTACAGGCCCCTATGATGCTTCATTGCATCGCTAATTATCCACAGCCACAAATCAGGCGAAAGAGTTTTGCAGCGCACCTTGTTGAATAAAAAGCAGGTACGTCAACAACGCCACGGGGACTAGCACCCATAACGTGATGCGTGGCAGATCGACCCGAAGCCGTTCCAGAGCGTGCTCGTATGCTCTGGCGGGTAAACGCCTTGCGGATAGGGCAAAATCACCACAATCCGCTGGCGGCAGAGAAAGTTTTGCGCCGGTGCGGCCCGCCATCGGCTGAAATAGCTCAACGGTTTCACCGCTATAAGATTGCCAGTTGGGTATTGGTGACCGAAGCTGACGGCGTGTTCGGCGCCAGATCCCACGACAACCCTGGCAACTGCTTCCATTGGACCAGCGGCAGATAGTGCTGACCGAGCAACATAAAAACAGCACCGCCAGCCCCAGCGCATGTTCAGGCCGAGAATGTACAAGATATTGCTTCCAGTTCATCACGGTCGAGACGCCAAGTGCGCGAAAAAGTACGCGCTCAACGCCCATTGCCGGGAAGAGGAATGTCATTAATCAGCGCGCCAGCCGCTGCCTAAAGGACGCACCAGCACCGGCTAACACCAGTAAAAACGTGGCGATCAGTAGAACCCTTGCGCAGCCATCAAGACGCCTCCGCATTGATCAGGGGGCATAAACCAGATAACCCGAGTAATAAAACACCAGCAATACGCCGGTTATCACGCCTGCCTCACAGTGCACCTCCAGTGGCCTAAAAGTGATACCGGAAGGGTAGGAATTCTGGCTGCAGATTTCGCAAAATCTGCGGGCGGGGTGTAAAAAGTATAAAAATGGCAAAAGCCATGATTTGGCTAATGTTTGAGTAATGAATTTAAGGTTCGCTTACCCAAGCAGACGCCAGAAGATGGAGCACCGCA
+>f51c19c0-2613-48a7-a9a1-ec59658cbd2d
+TTGTTATACTTCGTTCAGTTACGTATTTAGCCGCTCATCTTCGGCGTCTGGCAGGTGTTTTTAACCTATGCGTACTGGCTGAACCCTGGACAATGCTACCGCCATACTGCGTCATGTCGCCCTGACGCGCCGCCGGTTTCGCTCATCTGCTCATCCTTGTTTATCGGGTTATTTGTCTGCTGACAGGCGAAACCCTACAGATTTATAAGAAAGCCTTAAGTGAGATATCTGTCAGATAAGAACAATTAGGAAAATATTTATATATGTTCGCTTGAATATATGTTTCGATTGGTATAACGATGTCTAAAATATTCCTCTGAACATCTTCCTGATACAAAAACCGCCAGCGTTTCCGCTGGCGGTTTTCAATATTCAAAACTCAAGCAATCAATAAAAATCACCAGTTGCCTTTTCGGCCTGATCCATCCACACCGGTTTTATCGCTGGTTTTCGATAGACGCGATGCAGGTAACTCATAAAAGCAGGCGCGGTCTTTCCAGAAAAGCATGAAAGGCAGCGCCAGAACGCCCGCTGCAGCCGCATGAAGTACGGCGTAAGATAAGCCATGCAGGATATTCTCTGTAGAGTTCCATACTTTTCTCCCCTTTTGTATCACCCGGTGAATGGCACCGGAAAAATGAATTGTTTATCACAGTGAAAATAGTACCGCCTTTTGTGTAATTTTACTACTCATCCGACCACTTATTTTTGCTTATTGATGGTTTATTTACATTCATCCTGTAATTAAGTTACACAAAGTTAAATTAATACTAAACATTAGTTAAATCATGGCTTTTGCCATTTTTATACTTTTACACCCCGCCCGCAGATTTTTGCGAAATCTTTGCAATAGGAATTCTACCCTTCCGGTATCACTTTTAGGCCACTGGGGTGCACTGTGAGTGCAGGCGTGATAACCGGCGTATTGCTGGTGTTTTACTATTGCTGGGTTATCTGGTTTATGCTGATCAATGCGGAGGCGTTCTGATGGCTGCGCAAAGGGTTCTTACTGATCGCCGTTTTACTGGTGTTAATGGTGCTGGCGCGTCTTTAGGCGGCGGGCTGGCGCAGCTGATTAATATTGTTCCTCTTCCCGGTACAACGGGCGTTGAGCGCGTACTTTTTCGCGCCAGCGTCTCTGACCGTGAGATGAACTGGAAGCAATATCTTTGTGCCATTCTCGGCCTGAACATGCTGGGGCTGGTGCTGTTTTTTATGTTGCTCGGTCGGCACTATCCTGCCGCTTAATCCGCCCGTTGCCAGGGCTGTCGTGGGATCTGGCATGAATACCGCCGTCAGCTTTATCACCAATACCAACGCTAGCGATCTTATAGCGGTGAAACCGTTGAGCTATTTCAGCCAGATGGCGGGCTTAACGGTGCAAAACTTTCTTTCTGCCAGCGGGATTGCGATGATTTTGCCTCATCCGTGCGTTTACCCGCCAGGCATGAGCACGCTCGGGAATGCAGGTCGATCTGCTACGCATCACGTTATGGGTGCTGGTCCTGTGGCGTTGTTGATTGCACTGTTTTTATTCAACAAAGATTGCGCTGCGACTTTCTGCCTTATCAGGCTGTGAATACCGTTGAAGGAGCGCAACAGCTGTTACCCTGGACCTGTAGCTTCTCAGGAAGCGATCAAGATGCTCGGTACTAACGGCGGTGGCTTCTTTAATGCCAACTCGTCGCATCGTTGAAAAACTAACCACGCGAAATAGCTTCGTGCAGATGCGGCGATCTTCTTGATCCCAACGGCGCTGTGCTTTGCCTTTAATTGAAGTGATGAGGCGGTCGCCGCCAGGGGCGCATGTTGCTATGGGCGATGTCAGTGATTTTGTCATCTGCGTAGGCGTGGTGATGTGGGCAGAAGTTCAGGGTAATCCTCATCTGCTGGCACTGGGCACGGACCTTCAGCATCAATATATGGAAGAGTAAAGAGAGCCATTTCGGCGTGCTGGTCAGTAACCTGTTTGCGGTCGTGACGACGGCGGCTTCCTGTAACGCAGTGGTTGCGATGCATAGTTCGTTTACCGCTCTCGGTGGCATGGTGCCGATGTGGCTGATACAAATTAGGTGAAGTGGTGTTCGGCGGTGTCGGTTCTGGTCTTTACGGCATGATGCTGTTTGTCCTGCTGGCGGTGTTTATTGCCGGGCGCTGATGATTGGTCGTACACCGGAATATCTGGTAAAAATCGACGTACGCGAGATGAAACTGGCTGCACTGGCAATTCTGGTTACCCCCGACGCTGAATTACTGATGGGCGCAGCGTTGGCGATGATGACCGACACCGGACGCGCTTGCCATGCTCAACCCTGGCCCGCATGGTTTAGCGAAGTGCTGTACGCCGTGTCATCCGCCGCTAACAACAACGGCGCCTTTGCCGGATTAAGCGCCAACTCTCCGTTCTGGAACTGTTTACTGGCGTTCTGCATGTTTGTCCATTCGCTTCGGGGTGATTATCCCGGTGATGGCAGTGCCGGTTCGCTGGTGAGTAAAAAGAGCCAAGCCGCCAGCTCCGGCACGCTGCCAACCTCACGGCCGCTGTTTGTTGGCCTGCAATCGGCACCCGTGTTGCTGGTTGGCGCACTGAAGCCTTTATCTGCCCTGGCGCTGAGATACGGTGGCGGAATATCTCTGATGATATTGAGTGAGCACTACAGATATGAGTCGTAAACAACTGGCGCTGTCCAGACCAACACTTGTCGTTCAGGCGCTGAAAGAAGCGGTGAAAAATTAAGCCCGCAGGCGCAATGGCGCAATCGGTGATGTTTATCGTCTGGATCAGCAGCAGTCTACTGACCACCTGTCGTAGCATCTGATGGCAAAAGCCGTGCGATGCCCGACAATGCGCTGTTTAGCGCAGCCATTAACGGTGGCTGTGGATCACCATACTGTTGTTCGCTAATTTCGCCGAGGCGCTGGCAGAAAGGCGCAGTAAACACCAGGCCAACAGTCTGAAAGGGGTGAAAAAAACTGCCTTTGCCCGCAAACTGCGAGCCGAAATATGGCGCTGCGGCGGACAAAGTTCCTGCCGACCAACTTCGTAAAAGGCGATATCGTACTGGTAGAAGCTGGCGATATTATCCCTGCGATGGTGAAGTTATTGAAGGGGTGCATCGGTCGATAAGCCGTACCATCACCGGGGAATCGGCACCGGTGATCCGTGAATCCGGCGATTTGCCTCCGTCACCAAACGGCGCATATTCTTTCTATTGGCTGGTGATTGAGTGTAGCGTTAACCCCAGCGAGACATTTCTGGATCGGATGATCGCGATGGTGGAAGGCGCACAGCGACGCAAAACACCAGGCGAAATTGCCCTGACCATTCTGCTGGCGTTGCCCTGACTATCGTCCTTTTACTGGCAACCGCCACGCTGGCCGTTTTCGCGATGGGGCAATGTACAGTCAGCGTAACGGTACTGGTGGCGCTGCTGGTCTGTCCTGATTAGCCACTATTGGCGGCCTGTTGTCAGCGATCGGCGTCGCCGGGATGAAACCGGATGCTAGGCGCGAATGTGATTGAGGTTAAACACCAAGCAGACGCCGAAGATGGGGAGCGGG
+>fea3d3b3-af6c-451a-b862-6043d17ec775
+TTGTTGTGCTTCGTTCGGTTACGTATTGCTACCCTGTCGCTCTATCTTCGGCGTCTGCTTGGGTGAACAACCTCAGCTGATGCAGGTTCTCTTCATTCAGCAGGTTGCCCCATTCATCGTATTCTGCGCACCATTCTGTTGCCCCTTCCGTGCTGACCAAGCGCCAGCGTAGGCCGCGATGGTCGCAGTGGTACAGGTGGATTTTTCGCGCCGGCGTGTACACCGGGTCCATCTGGTTTCTCTGCTCCACCGTCAGGCCGCACGATGCCAGCCAGCGGCGGCGCCTCCTCACCCGGTCCGGCCAGGGATTTCGCCAATAGCCGGTCGAGGCATCACCAGCACCGGCTTACCACACACTGCCACCGTCTTCGCCGCCGGACTGCTGAAGGGTATCCCGCCAGGCTGCGCGGCGCTGCGTTTTCGCCAGCTCACCGGTGGCGGTTTCAACCTGATGAGTGGCATTGAAGCTCCCCGGCTGATAAATCGTCTGGATGCGGGTTCTGTCGTTCTGTATCGTGGTCAGGCGGTCGCCGTCCCAGCCGTACCAGATCCTTGCGGTTTCCGTGACAGCGACATCCAGCCCGTCAGGTCCGTTCACGTCTTACACCCGTTTTGCCACCCTGCGGCCCAGCGGGTCGTAAAGATAGCGGCTTTCGACCAGCGGCTCTGCATATTGTGTCCGCGTGTAGTGCACCAGCCGGTACTTTGACTGTCAATAATGGTACCGGTGGGTGCGCTCATCATCCGTGCGGATAACCCCTTCCGGGATGGTCGGTTTTCTCCGTCAGCCTGCCGTGACGGTCATACCGGTAAAGATAGTGCGCGTCACGGGCGATACGGTTATCCGGCCACATGCTGAGGGTGCTGTCCGGGTGCAGCTCAGGTCGAGCGGGTGGTTACCTGCAGGTCTGTGGCATGCAGGATATCAATGCCAGGTTACATATAATAAGAGCAATTAACTTAATTTATTTGTTTATAATGCGCTACTTAGCCACAAACCATTGAATATACCCTCTGACAGAAAATAAGAAAGCCATGTTATTATCGCTATAATATACTTACTATCAATCCTTACGCCAATAATGTCTGTTGATCCCTATAAATATTAGAGCAATAAAGAATACTATGCCTGTTGGAAAACATATTACCATCATTCCGCCAAGACTGTGAGACTAATTAACTCGCTCACATCACGAGTGGAATCTAATAGTGAAGAGAATCTATGCATGAAAGAATAGTATTAAAGCGATAAAGCCAGCCATATAGCTCTGAATAAAAAATAATATATTTCGTTACATCACTCCGGTGAATACAAAATCCTAATAAAACGTCCAATGTTATTTCCGGAGCACTTCATCTTACATGTTTCTAAAGAATCGATAGACCAGTCTTGGCGGTTTAAATAGCCCTAAATTTATGATTGTGAATATATCAGGCAATACAGAATAGCAGTATACCTCACTTTAGCTTCCTTTTAAACAGTTCTCCACACAACTATTATCGGTTCCAGCGAGGTCACAACGGCCAGCAGCTTCTTTGTATCATTACTTGCTTTACCCTATTTTATAAGACCATCTCAGCAGTTCTCCCGTTGGTCTTGGCCACCACAAGTATAGTCCCCTTACCATCTGGGACACAAAGATATTGATGATAGAACGGATTCCCCATATATCTGGACCGCTTCTTTCACCAGTTCCGCCCATTGAATGCAGTGGCTTAATGCATTTTAGTGTTTCTAATCCTAATGGATCTATATTTGAGATCGGATTCAGCAGATGCTGATAAAATTCCATCCCCTTTCAGCCCAATCGGATCTGAGTGATATATCGCCCCTGCAGCGGGTCATAATAGCGGTGGCGGTTGTAATACAGGCCGGACTCTCATCATACTGCTGCCCCGGCGAACGGATAAGCTGCTGCAGCCTGATGCGGGTTCTCTTCCGTTCAGCAGGTTGCCCCCCATTCATCGTATTCTGCGTACCACGCTGTTGTCCCTTCCGTGCTGATGAGGCCAGCGGCGGGCGCGATGGTCGCAGTGGTACAGGTGAATTTTCGCGCCGGCGTGTATACCGGGTCCATCTGGCTTTGCATCTGCGCCACCGTCAGGCCGCACGATGCCAGCCAGCGGCGGCTTCCTCACTCACCCGGTCAGCCAGGATTTCACTTTCCAGCCGGTCCGAGCATCTGCACCAGCACCGGCAGAACACCTGCCACCGTCTTCGCCACCGGACTGCTGGGGTGATATCCGCCAGGCTGCGGCGCTGCGTTTCGCCAGCTCACCGGTGGTTTCAGCCCTGATGAGTGGCATTAGCTCCCCGGCGCTGATAAATCATCTGGATGCGGGTTTCTGTCGTTCTGTATCGTGGTCAGGCGGTCGCCGTCCCAGCCGTACCAGGTCACTTGCGGTTTCCGTGACAGCGACATCCAGCCGTCAGATTCCACGTTCACGCCGCCATACCCGTTTTGCCACCCTGCGGCCCAGCGGGTCGTAAAGATAGCGACTTTCGACCAGCGGCTCTGCATATTGTGTCCGCGTATGAGTGCACCAGCCGGTGCTGACTGTCGTAATGGTACCGGTGGGTGCGCTCATCATCCGTGCAGGATAACCCTTCCCGGGATGAGTCGGTTTTCTCTGTCAGCCTGCCGTGACGGTCACCACCGGTAAAGATAGTGCGCGTCACGGGCGATACGGTTATCCCGGCCACATGCTGAGGGCGCTGTCGGGTGCAGCTCAGGTCGGGCAGGCGGTTACCTGCCGGGTCTGGCGGTATACGGGATGCGGATATCCAGATTCGCTGCGGTGGTGTGAACGCCGGTCAGCCTGCCGGTGGTGCTGTAGCTGTAACTCGGGTCTGGCGCGGGCTGCTGATGCGGATGAGTTCGCCGTTGTCGTTCCAGGTGTAATCGCGGTCAGACAGCAGGCTGTTTCAGGTCTGGCTCTAACTTTGCCCGGCAGAGGTATAAGCGGTGACAGGTCATAACGGCCCGAAGCTGCGCAGCGTTTCCCGATGCAGGCGGTCGCGGGTGTACTCCACCAGCGGTGTCGCCGAGTTTCATGCCTGACAGCCAGCCGCTGCCGTAGGTCAGCCATTCCCACGGCGGGCAGGCTGTCGAAGCTATACAGCGGTTCGCCAGTCCACAATGCGTTGTACGCATGTCGGTCTCCATGCTGCCAGAGCAGTTCATTCATCTGCGGATGATGATGATGCACCGTCAGGTGTTCACTGGCAGGCGGCCTTCTGTCATAACCATAGTGCACCATCACCCGGTGCCCTTCGCTGATATGGCTGATGTCTGTCCAGCCAGCCGCGCGTTCGATCATACTGCCACCGCTCTGCGGTTTCGCCATTCACGGTGCCGGTGCGTGAGGCGGTCTGCTTCGTCATAGTTGGTAAGATTTGACCGGCCCCTCATCCTCGCTGCGGATAAGTTTGCCGGTCGGAGTCGTGGTGATAACTGTTGTGTGCGGCCGTCAAAGCCGGTTTTCCTGTATCAGCCGGTCGAGTACATCGTAACGGAAGGTGGTGTGGCTGCCGTTTTCACTGGTCAGGCGGATGACCCGTCCGGCAGCATCGTATTCCATACTGCGCGTCAGACCGCCTGCGTGTACAGATGGCTTTTTCCCCACGCATCGTACTGTGTCCACGTTTCTGCCGTCCGGGGCAATGAGCGGTGGTCAGGTCACCGGCGACGTTGTATTCATACCGCGTTTCATGGCCCTGCGTGTCTTTCACGGCAATTAACTGTCCACGGCTGTCGCGCCGCGGTACTGACTCAGCCTTCCTCGCGGTGCACCGCCGTCCCGCACGAAACCAAAACGGTCATGGTCATGGCAGGTTACATAGCCGGAACAGTCAGTGAAGCTCAACAGCCCCGGTGCGTAACGGCTCCCGTCATGTGGTTTTTCCGGCTGCCGGTGGCATCTTCCATTGCGCAGGGTAAGTCACTGTGTGGATTATCATAACGGTAGCGGGTGATGATATCGCCGTCAGGGGCAGTTCCACAATCAGACGGCCCCATTCATCATATTCCCGGCGTATTTCCAGCCCATCCAGGCCCGGTGGCTGGCGTTAACTGGCGCTGTGGTGGTTATAGTAAAAACGCCGATGCCCTGCCATCCGGCTATTGGTGATGCGCGTGATGGGCCCGTCACCACATCGGACTGTATTCTGTTGTCCTGCCTGCGGCATCCGTCTGTGCCCTGAGCCTGCCCACCGCGTCCAAACTGGCTCTGCGTGACGCTGCCGTCCGCGTGTTCCTTTTTCACCACCCGCTGTGCCTTCACCCTGCGTGTGCAGGACTTCACGGCAGTTCAGGCTATCGGTAGTGGTGATGCGAAGTCCTTCTCATGCTGATACGTGTAACCCAAGCCTGCCGGGTTTAGCTGTTCTGTCACCCGCCCGTCGCTGTCGTAACGGTAACAGATTTCCGGGTCGGCCCGATAATGACAGTGCGCCACCATCGGCGGTATTTATCATCGTAAGTAAAGCTGCGCACCTGTTGCTGCGGTCATACACCGCCGCCAGTTCGCCGCCAGGGCGAGTCAGCCATAGCGCACCAGCGGCGCGGCAGGTAAATTCTCCGGGTATTCCGGGTCGTGCGTCAATACACGGCAGACAGACGGATGCCGTTGATAACCACATATTCGGTGTAACCCGGCAGGGTGTCAGGAAAACGGACGGTTCCGTCCACCGATGGCCCTGCTGCCGAGGCTTCTTCTGCCCGCTGCGCCTGCGTGGTCAGTACCAGCGGAAGTGACGCCCGGCACCATCCGTCGCCGGTGATTTCGCCGCTGGTCACCGGCGGCTTCGCGGTGGAACGTCTGTGTGCGCCCGAAGCGGTCCACCAGCCCGGTCAGTACCCGGTACGGCGGCGGCGGCGCGGGCAGCACCTCATCATCACTTCCCGGCTTATCACACCAGCCGAGCAGCCACCGGCCCCTGCGGATTTGTTTGTCCGCCAGATAACGATGCGGACTTAAGCGGAGTTCTTCCGGCAGCGCCTGCCGAGTGCAGCCAGCCGGTGACCTTCGTCCAGTTTCGCCACGCCGCCGCGCAGCCACAGTGACTCGCTGCGGCTGTAACCAAATCCTCACCGGGAAACAGATTACTCAAATACCAGGCTTCTGCCGCCGTTATCACTGGTATCAGTGTGTTATCCCAGCGCAGCTGTAAGCGGATATCACCAGGCATTTTCCAGCCGGGGCCGAGGCTCCCCACCACCGGCGCGGGCGTTTTGTCCGGTAACTGCTGTAGGTGCGGGAGAGAATGAACGGCAGCGGGCCGGGCAGGGCGATGTCGGGTTTCACCGGGAAGGACCTTTGCCGAGCGGCGGATTGACCGGATGGCCGGACGTCACCCCGCCGGGCACACCGAACAGGCCACGCCGATGGGGCACCGATACATTGCCCCGGCTGAACCCTGGCGATACTACGCCATACTGCGTCATGTCGCCCTGACGCGCCGCCGGTTTTCCGCTCATCTGCTCATCCTTGTTTTATCCCGGGTTATTTGTCTGCTGACGGGCGAAACCCTACAGATTTACCGAAAGCCTTAAATTGAGATATCATCAGATAAGAACAATTGGGAAAATATTTATATATATTTCGCCAGATATATGTTTCGATTGGTATAACGATGTCTAAAATATTCCTCTGAACATCTTCCTGATACAAAACCGCCAGCGTTTCCGCTGGCGGTTTTCAATCTGTTAAACTCCCAGCAATCAATAAAATCACCAGTTGCCTTTCGGCCTGATCCATCCCACCGGTTTATCGCTGGTTTTCGACCAGACGAGGTTAAACTTGCCAAAGCAGACGCCGAAGATTAGAGCACGCA
+>dbe28df8-d40f-4a1a-9666-9e8bc64c6204
+CTGGTACTTCGTTCAGTTACGTATTGCTACTTGCCTGTCGCTCATCTTCGGCGTCTGCTTGGGTGTTTAACCTGCGCAGCTGGAGCGCGAAGCGCTCACTAATACCGCCTTTGACGAATATCTTTCAGCGCAATAACGCCTTTACGAGAACCTTCCACCACCACCAGCGGCGTGGCTCCTGACGCAGCCTGATCGACTTTTTGATCCAGCATCGGTAGAAGTGACCGTTAGCCTCAACATGACGGCGACGAATGGCATCGACAGAACCTTTTACGGATCATGCGGTTGTCGATGTTGATCCCGCTCATCCGGCTTTGCGCAGTCGCAAACGGTACAAAGGTGGCGGGCAGTGACTGCACAATCGCCGCTCGCGCAGGTTAAAACGCTGCTGGCGGGATCACAATACTGCGGCCTTCCGGCGTTTCATCGGCAGCAGAAGCCAGTTGTGCGGCGTCAGCCAACGTTTTCATCCACGCCCTGCGCGGATAAACTCCGACGCCTGACGGTTACCGGTGTGATGGTGCCGGTTTATCCAGTAGCAGAACGTCAGCGTCACCGCTTCAACTGCGTCCGCTGGTGGCAATCACATTCGCGCCCTAGCATCCGGCTCCATCCCGGCGACGCCGATCGCTGACAACAGGCCGCCAGGTGGTTTGGGATCAGACAGACCAACAACGCCATAGTACCGTTACGCTGACCATTACCGCCCGCGGAAAACGGCCACAGCGTGGCGGTTTAATAAAAAGACGATAGTCGGGCAATCAACAGAATGGTCCAGGGCAATTTCGTTCGGCGTTTTGCGTCGCTGTGCGCCTTCCACCATCGATCATCCGATCGAAATCGCCGGGGTTAACGCTACACTCAATCACCAGCCAGTCGAAGAATACGCGTGCCGCCGGTGACGGAGCAAAATCGCCGCCAGTTCACGGATCACCGGTGCCGATTCCCCGGTGATGGCGCTTTCCATCGACCGATGCACCCCTTCAATAACTTCCTGCATCGCGGGGATAATATCGCCAGCTTCACCAGTACGATATCGCCTTTACAGAAGTTGGTCGGCAGGAACTTTGTCCGCCGCAGCGCCATCTATTTCGGCTCACGCGGCTTGCGGGCAAAGGCGGTTTTTTTCACCCTTTCAGACTGTTGGCCTGCGCTTTACTGCGGCCTTCTGCCAGCGCCTCGGCAATTAGCCGGAACAGTACGGTGATCCACAGCCAGCCGCTAATGGCCGCTAAACCGGCATTGCCGGGCATGCTGCCTGCCATCGCGATGCTATTACGAATTCGGTCAAGCGATTGCCGATCCAGACGATAAACACCTCCTGCCGGATTGCCATTGCGCCTGCCGGAATTAATTTTTTCACCGCTTCAACACCGGCGCCTGAACGACAAGTGTTGGTTCCGAATAGCGCCAGTTGTTTACGACTCATATTCCGATAACAAAACCAATATCATCAGGAGAGATATTCACCACCGGACCAAGCGCCGGGCAGGGATAAAGGTCAGTCACGCCAACCAGCAACACGGTGCCGATTAACAGGCCAACAAACAGCGGGCCGTGCGTTGGCGACGTGCAGGAGCTGGCGGCTGGCTCTTTACTCACCAGCGAACCGGCAATTGCCATCACCGGGATAATAATCGCGAAGCGACCGACAAACGCAGAACGCCGGTAAACGGTTCCAGACGGAGTTGGCGCTTAATCCGGCAAAGGCGCTGCCGTTGTTGTTAGCGGCGGATGACACGGCGTACAACCTTCGCTAAAACCATGCGGGCCAGGGACGAGCATGGCGCTACGATCCGGCGTCGTCCATCATCGCCAACGCCATGCCTCCAGCACCAGCGTCGGTAAATTGCCAGTGCAGTCAGTTTCATCTCGCGTACGTCGATTTTTTTACCCAGATATTCCGGTGTACGACCAATCATCAGCCCGGCAATAAACACCTGTGGGATAAACAGCATCATGCCGCGAAGACAGAGACCGACACCGCCGAACACCACTTCACCAATTTGCATCAGCCACATCGGCACCATGCCACCGAGCCGGTAAACGAATCGTACATCGCCGTCACGCGCCACGAGAGCCGCCGTCGTCACGACCGCAAACGAGGCTACTGACCAGCACGCGCCAAACGGCTCTCTTTACCTTCCATATTGATGCTGCTGCAATGTCCGTGCCCAGTGCAGCAGATGCGGATTACCCTGAACTTCTGCCCACATCACCACGCCTACGCAGATGACAAAAATCACTGACATCGCCAGCAACATGCGCCCTGGCGACGATCGCCCATCCTTCACCAAAGGCAAAGCGCACAGCGCCGTTGGGATCAGAAGATCATCAGCATCTGCACGAAGTTGGTCGGTGCGGTTGGGTTTTCAAACGGATGACGAGTTGTGGCATTAAAGAAGCCACCGCCGTTAGTACCGAGCATCTTGATCGCTTCCTGAAGCTACAGGCCCCATGGGTAACAGCTGTTGCGCTCCTTCAGCGAGTATTCACAGCCTGATAAAGGCCGAAAGTTTGCAGCGCACCTTGTTGAATAAAAGCAGTGCAATCGAAAAGCAGCGCCACGGGGACTAGCACCCATAACGTGATGCGTAACCAGATCGACCCAGGCATTCGAGCGTGCTCATGCTCTGTGGCAGTGCTTGCGCACGGATGAGGGCAAAATCACCGCAATCCCGCTGGCGGCAGAAGAAAGTTTTGCACCGTTAAGCCCGCCATCTGGCTGAAATAATCAACGTGGTTTCACCGCTATAAGATTGCCAGTTGGTATTGGTGACAAAGCTGTTGTATTGTTCAGCGCGCCAGATCCACGACAGCCTGGCAACTGCTGTGGATTAAGCGGCGAATGAGTGCTGACCGAACAACACTAAAAACAGCACCGCCAGCCCCAGCATGTTCCGGGCCGAGAATGGCACAAGATATTGCTTCCAGTTCATCTCACGGTCAGAGACGCCAAGTGCGCGAAAAGTACGCGCTCAACGCCCGTTAATACCGGGAAGAGGAATGTCATTAAAAATCAGCCGCGCCAGCCCGCTGCCTAAAGGACGCGCCAGCACCGGCTAACACCAGTAAAAACGTGGCGATCAGTAAGAACCCTTGCGCAATACAGAACCTCCCGCATTGATCGGGGCATAAACCAGATATTAACCCAGTAATAAAAACGCAACCAATGCACGCCGGTTATCACGCCTGCACTCACAGTGCACCTCCAGTGGCCTAAAAGAAGTGATACCCGGAAGGGTAAAATTCTGGCTGCAAGATTTATAAAAATCTGCGGGCGGGGTGTAAAAAGTAAAATAGCCAAAAGCCATGATTTAACTAATCATTTTAAATATTAATTTAACTTTTGTGTAACTTAATTACAGGATGGATAAAATAAACCATCAATAAGCAAAATAAGTGGTCCGGATGAGTGGTAAATTACGCAAAAAGGCGACTGTACCATCAGATAAACAAATTCCATTTTTTCGGTGCCATTCACCGGGTAGATACAAAAGGGGAAAAGTATGGAACTCTACAGAATATCCTGCATGAAAGGCATCTTTTTACGCCGTGCCCATGCGGTTGCAGCGGGCGTTCTGGCGCTGCCTTTGTCTTTTCTGGGGAAAGACCACGCCCCGCCCGCTTTACGGCTACCTGGGTTAAACGAAACAGACGCCGAAGATAGAGCGACAGGCAAGTGGCAATACGTAACCCC
+>458e15d1-ec66-4e53-a4c8-97593504bf11
+TTGTTGTGCTTCGTTCGGTTACGTATTGCTGCGCCTGTCGCTCTATCTTCGGCGTCTGGCAGGTGTTTAACCTTCACGACCGCAAGCAGGCTACGACCAGCACGCCGAAACGGCTCTCTTTACCTTCATATTGATGCTGCTGTCATTGCCCGGTGCCAGCGGATGAGGATTACCCTGAACTTCTGCCCACATCACCACGCCTACGCAGATGACAAAATCACTGACATCGCCCACAGCAGCATGCGCCCTGGCGTGATCATACATCACTTCACCAAGGCAAAGCACAGCGCCATTGGGATCAAAGAAGATCGCCAGCATCGCACGAAGTTGGTCAGTGCGTTTGGGTTGGTTTTCAAACGGATGCGGCAGGTTGGCATTAAAGCCTACCGCCGTTGGTACCCAATCATGATCGCTTCTGAAGCTACAGGCCCCATGGGTAACAGCGCAAACTCCTTCAGCGGTATTCACAGCCTGATAAAGACAGAAAGTTTTGCAGCGCATTGTTGAATAAAAACAGTGCAATCAGCAACGCGCCACAGGGACCTAGCACCCATAACAACGTGATGTGCGTAACCAGATCATTAGGCATTCCCGAGCGTGCTCATGCTCTGGCGGGTAAACGCACGGATGAGGGCAAAAAATCTACCCGCAATCCCGCTGGCGGCGAAGTTTTGCACCGTTAAGCCCGCCATCTGGCTGAAATAGCTCAACGTGGTTCACCGCTATAAGATTATGGTGGTATTGGTGACCAAAGCTGACGGCGGTAATTCAGCGCCAGATCCACGACAGCCACAGCGGCTGCTGTGGATGGCGGCAGATAGTGCTGACCGAGCAACATAAAAACAACACCGCCAGCCCCAGCATGTTCCGGGCGAGAATGGCACAAAGATGTTACTTCAGTTCATCTACGGTCAGAGACGCCAGTGCGAAAAAGTGGCGCTCAACCGTTGTACCGGGAAGGAGAATGTCGTGGCTGCCAGCCCGCTGCCTAAAGGACAGCGCCAGCACCATTAACACCAGTAAAAACGTGGCGATCAGTAAGAACCCTTGCGCAGCCATCAGAACGCGCCTCCACATTGATCGGGGCGCTCGCCAGTAATGTAAAACACCAGCAATACGCCGGTATCCGCCTGCATCACAGTGCACCTTCAATTAACTAAAAGTGATACCGGAAGGGTAAAATTCTGGCTGCAAAGATTTCCATAAAAAATCTGCGGGCGCGGGGAATTGTAAAAAGTATAAAATGGCAAAAGCCATGTGATTTAACTATCATTTAGTGTTAATTTAGCTTTTGTGCCAACTTAATTACAAGATGAATGTAAATAAACATCAATAAGCAAAAATAGAGTGGTCGGATAGTGGTAAAGAATTACACAAAGGCGGTACATTTCCATCAGATAAACAAATTCATTTTCGGTGCCATTCACCGGTGAATCTCAAGGGGGAGAAAAGTATGAATCTACAGAGAATATCCTGCATGGCTTATCTTTTGCCGCCGTATGCCAATGCGGTTGCAGCGGGCGTTCTGGCGCTGCCTTTCTTTCCTTGAGCGCTTACCCTGCAGTGAAAGCCAGCTTGTTGATAAGCCGGTAATGGATGGATCGGTAAAGGCAACTGGTGATTTTATTGGTGCTGAGTTTGAATACATTGCTGAAAACCGCCAGCGGCTTTGGCGGTTTTTATGGAGAGATGTTCAGAGATATTTGAACATCGTTATACCAATCCAGAAACGCTTATATTCATGAAATATATAAATATTTTCCTAATTGTTCTTATCGACAGATATATCTTTCGCCAAGGCTTTCTTATATAAAATAGCGGGTTTCGCCTGTCGAATAATAACCGATAAAACAAGGATGAGCAGATGAGCGGAAAACCAGCGGCGCGTCAGGGCATGAACGCATGACGCAGTATGTGACTGTAGCATTGTCCAGAGGTTCAGCCGGGTACGCATCAGTGCCCCACCGGCGTGGCCTGTTCGGTGTGCCCGGCGGTGTCAACCATCAGTCAATCCGCTGCTCGGTGCAGGCCTTCCCGGTGAAACCGACATCGCCCTGCCAGCCCGCTGCCCGTTCATTCTGGCAGTTACCGGACAAAAACGCCCGCGCCGGAGGTTAAGCGCACCCAAGCGGACGCCGCAATACCGGCA
+>77635ef8-3824-401c-8442-7fdec33235a8
+TCGTGCTTCGTTCAGTTACATTGCTGCCGCGCAATATTATCACCGGCGTCTCTCTGGCGGTGTTCGCCTGGCGGTGCAGTGCGTAGAGCGGGTGCTTCACATCATAATTGGTGTTGACCAGCCCTCATCCTCGCTGCGGATAAGTTGCCGGTCAGGTCGTGGTATGCCCGCTGTGTGCCGGCCGTCAAAGCCGGTTCTCATATCAACCGGTCGAGAGTACATCGCCAACGGAAGGTGGTGTGGCTGCCGTTTTCACTTTTGGTCAGGCGGATGACCCGTCAGCAGCATCTATTCCGCCTGCGCGTCAGACCGCCCCTGCGTGGTACAGATGGCTTTTCCCCGCATCGTGCTGTAATCCCGTTTCTGCTGCTGCCGTCCGGGCAGCGGTGGTCGGTCACCACAGCGGCGTTATCATACCGCACTGCGCGAAACACCGTGTCTTTCCGCTTGATAACTGTCAGCTGTAATATGCCAATTTTGTCGCCCTTCACCAGGTGCACCGCCGGCACCTGACCAAAACGGTCATGGTCAGCGGAGTTACATAACCGGAGCGATCGGTGGCTAAGCAACAACTGACCGTAACGGCTCCCGATGTGGTTTTCGGCTGCCGGTGGCACTCTTCCGTGCGCGAGGAGTAGAATCACTGTGTGCCGGATATCAACAGTGGCAGGGTGGCGTCGCCGTCGGGGCAGTTCTGAATCAGACGGCCCATTCATCCTTCGGCATATTTCAAGCCCGTCAGGCCCGGTGGCTGACGCGTTAACCGGCATGGTGGTTGCCGTGTAAACGCCGATGCCCTGCCATCCGGCGTGGTGATGCGCGCGTGATGGGGCCCAATGCCATCAGGACGTATTCTATTGTCACCACCGGCATAAGTGCCAGCAGGCATACGCGCGTCAAACTGACTCTGCATGTTGCTGCAATGCACTGTGTTGCACCACCCGCACCGCTTCAGCCCGCCTTCACCTGCATATTGCAGGACTTCACGGCAATTCAGGCTGTCGGCGGTGATGATGGATCCTTCTCCGCCACTGATACGTGTAACTTAAGCCGCCGCCGGGTTTAGCTGTTCATGTCACCGCCCATGCTTTCATAATAACGGTAACGAATTTCCGGTAGTCAGCGTGTGACGGTGCGCCACCATCAACTGATGAAATTTATCATCGCAAAGTAAAGGCTGCGCACCTGCATATTATGCGATCTTACACCGCCGCCAGTTCCGCCGCAGGGCGTCAGCCATAGCTTTTCGCGGCACGGCAAGACCAGATATCGATATTCCGGGGTCGTGCGTCAGCCACGGCGAACAAGGCGGATGCCGTTATGCAACCATATTCGGTGATTGTAACCCGGCAGGTACTCAGGAAACGGACGGTTGTCCGCCGGAAATAACCTGCTGCGGGCTTCTTCTGCCGCTGCTTATGCGTGGTCAGTACCAAGCCAGGAAGTGACGCCCGGCACCATCCATTCACGCCGGTGATTTCGCCGCTGGTCCTGCCGGCGGCTTCGCGTTCGGGAACGATCTAATGTGCGCCAGGCGGTCCACCAGCCAGTCAGTACCCGTACGGCGGCAGCGGCGCAGGCAGCTTCATCACTTCCGGCACCTCACACCAGCCGAGCAGCCACCGCAGCCCCTGGGGCTGTTTTGTCGCCAGATCGCGATGATGTGCGGATAAGCGGAGTTCTTCCGGCGCTTTCCTGCCGGTGCAGCCAGCCGGTGACCTTATCCAGTTTCGCCGCCGCGCACCAGCCAGTAATCTGCTGCGGCGCAACCGTCTCACAACAGGTATAAAATGCAGGCTTCGCCGGGGTGTCACTGATATCGATGTTTATCGCGCAGCCAATAAGCGGATCCGCGAGCATTTTCCAACAGGGCGAACTCCCCACCAACGGTTTTTCGTCATTAACGCTGCTGCCGGGTGCGGGAAGACGAACGGCAGCCGGGCCGGGCAGGGCGACGTCGGTTTCACAGGAAGGATAGCCTTTGCACCGAGCAGCGGCGTTGACCAGATGGCCGGACGTCACCCGCAGGGCACCGCCGAACAGGCCACGCCGGTGAGCTGTACGTGCCCCGGCTGAACCTGGACAATGCTACCGCCATACTTCCGTCATGTGCCTGACGCGCCGCCGGTTTTCCGCTCATCTCCGTCCTTGTTTTATCAAGGGTTGTTTACCATCTGCTGACAGGCAACCCTGGATTTATAAGAAAGCGCCGTGAGATATCTGTCAGATAAGAACAATTCGGAAAATATTTTCTCCATATTTCGCGAATCCTGTTTCGATTGGTGCGATAAATATCTTCCTGGAACATCTTCTGATACAAAACCGCCAGCGTTTCCGCTGGCGGTTTTCAATATTCAAAACTCGGCAATCAATAAAGATGCCAGGATTGCCTTTCGGCCTGATCATCCACCGGTTTATGCTTCGGTTTTCGACCGGGCACGCGATGCAAGTGGCTGTAAAGCAGGCGCGGTCTTTCAGAAAACATGAAAGGCAGCGCTTAAAACGCAGCCGCATAGTACGGCGTAAAAAAGATCGAAGCCATGCGGATATTCTCTGGCTAAGGGTCATGCTTTTCTCCCCTTTGTATCTGCCAGGTAGATGGCACCGGAAAATGAAATTTGTTTATCTGATGAAAATAGTACCGCCTTTTGTGTGAATTTTCCTCGTCGACCCGCCTTTTGCTTTATTGATGGTTTATTTACACGTTCATCACCGCCAATTCGATTTACACAAAAGTTAAATTAATACTAAACATTAGTTAAATCCGCTGGCACGCCGTTTATCACGCACCTGCCGCCACGCAGATTTTGCGAAAATCTTTTAAGCCATCGATATCCGCTTTTTAGGCCACTGGAGGTGCACTGTGGTACAGGCGTATTAACCGGCGTGCTGGTGTTTTATTACTTTCGGTTATCTGGTTTATGCCTGTTGATCGGTGAGCGTTCTGATGGCTGCGCAAAGGGGTTTCTTACGATCCGCCGTTTTTACTGGTATTGGTGCTGGCGCGTCGCTTTGAGCAGCAGGCTGGCGCATGGATAATGACATTCCTCTTCCCCGGTACAACACGGCGTTGAGCGCGTATGCCTGCCGCGGCGTCTCGACCGTGAGATGAACTGGAAGCAATATCTTTGTATTTTATTCTCGACCTGAACAATGCTTTAGGCTGGCGGTGCTGGTATTTTTATGTTGCTCGGTCAGCACTATCTGCGCCAATCCACAGCAAGTTGCCAGGGCTGTCGTAGGATCGCGCGAATACCGCCGTCAGCTGTCGCAACACCAACTGGCAATCTTATAGCCAGTGTAGAAACCGTTGAGCTATTTCGGCGACCAGATGGCGGGCTTAACGATTTCCGCTTTCATCGCTTTCTGCCATAGCGAGATTGCGGTGATTTTGCCTCATCCGTGCGGTTTACCCGCAGAGCATATGAGCACGCTCAAGGTACTGGGTCGATCTGCTACGCACCGATAGCGGTGCTAGTCCCGCAATGGCGTTGTTGTTGTTGATTGCACTGTTTTTTATTCAACAAGGTGCATACCAAAGGCTTTCTGCCTTATCGGGCTGTGAATACCGTTGAAGGAGCGCAACGTATTCCCCATGGGGCCTGTGGCTTCTCGGGAAGCGATCAAGTGCTCGACACCTAACGACGGTGGCTTCTTTTTAATGCAACTCGTGCATCCGTTTGAAAACCCAACCGCACTATTAACTTCGTGCAGATGCTGGCGATCTTCTTGATCCCAACGGCGCTGTGCTTTTGCGAGTGAAGTGATGGGCGATCGCCGCCAGGGGCGCATGTTAACAATGGGCGATGTCGCGTGATTTTATGTCTGCGTAGGCGTGGCCGATGTGGGCGAAGTTCGGGTAATCACCTCATCTGCTTTGCTGGGCACGGACAGCAACATCAATAGATCAAAGGCCGTTTCGGCGTGCTGGTCAGTAACTGTTTGCGGTCGTGACGACGGCGGCTTCCTGTGGCGCGGTGATTGCGGTATGATCGTTTACCGCTCTCTCCTGGCATGGTGCCGATGTGGCTGATGGAATTGGTGAAGTGGTGTTCGGCGGTGTCGGGTTCTGGTCTTTACGGCGGCGCGATGCTGTTTGTCTGCTGGCGGTGTTTGTGCGGGCTGATGATTGGAATATCTGAATTAAAAAATCGACGCGTACGCGAGATGGAAACTGACTGCACTGGCAATTCTGGTTACCCCGACGCTGGTGCTGATGGGCGCAGCGTTGGCGATGACCGACGCCGGACGCGCCATGCTCGCCCTGGCCCGCCGGTTTTTAGCGAAGTGCTGTACGCAAAATGTCATCGCCGCTACTTAACGGCAGCGCCTTGCCGGATTAAGCGCCAGCTCTCCGTTCTGGAACTGTTTACTGGCGTTCTGCATGTTTGTCGGTCGCTTCCGGGTGATTATCCGGTGATGGCAGTGCCGGTTCGCTGGTGAGTAAAAGAGCCAAGCCGCCAGCTCGCTTTGCTACCCAACGCACGGCCCCGCTGTTTGTTGGCCTGTTAATCGGCACCGTCATTGCTGGTTGGCGCACTGATGACCTTTATCCTACCCTGGCGCCCGGGTCCGGTGGCGGAATATCTCTGATGATATTGGTGAGCTTTTGAAGATATGAGTCGTAAACGAAGCTGGCGCTATTCGAAGACCAGCTTGCGGCATCGTTCAGGCGCTGAAAGAAGCGGTGAAAAATTCAGCCACCAGGCGCAGTAACAATCCGGTGATGTTTATCGTCTGGATCGGCAGTCTGCTGACCACCTGTATTAGCATCGCGATGGCAAACGGTGCATTCTGTCACGCTGTTTGCTTTTTGCTGGCCATTAGCGGTTGGCTGGATCACCGTACTGTTCCTTCAATTTCGCCAGGAGGCGCTGGCAGAAGGCCGCAATCGCGCGAATGATCAAAGGTGAAAAAACTGCGCTTTGCCCTGGCTGCGTGAGCCAGAAATAGCGCTGCGGCGTTCGATTCACCGACCAACTTCGTAAAGCGATATCAGTACTACAGGTAAAATGGCGATATCCCTGCGATGGTGAAGTTATTGAAGGGGCATCGGTCGATAGCCGCCATCACCGGGAATCCCGGCACAGGCGATCGTGAATCAGCGGCGATTTTGCCTCCGTCACCGGCAGCGCACGCGTATTTCTTTCGGCAAGCTGGTGATTGATTAGCAGCGTTAACTGACGAGACATTTCTGGATCAAGGATGATCGCGCATTGGTGGAAGGCGCACGCGGCCGCAAAACATGAAATTGCCCTGTTAATGCTGGAATTGCTGGCTATCGTCTTTTCGCCGCCGCCGTTTTCCGCGTGGGCGGTAACCGATCAGCAACAACGGTACTGGTGGCGCCTGGTCTGTCTGATCCCAACCTGGCGGCGGCCTGTTATGGCGATCTAATCGCCCGGGATGGAGCCGGATGCCAAACGATATTGGTGCCACCTGGACGTCAGTTGAAGCGACGGTGACGTTGGCGTTCTGCTACTGGACAAAACCAGCACCATACCTCCGGTAACCGTCGAATCGATTTCATCCGCGCAGGCGCGGATGGCGCTAAAGCGGCGCCACAACCAGCCCCCGCTGGCTGGTAAACCGAGTACGGTATTCCATGATCCTCGCCAAGCGTTTTAACCTGCGCGACGCGATACTGATCATCATGCCATTGCTGCACTTAAAGCCGGATGACGGATCCGCATCGACCCATGATCCGTAAAGGTTCTGTCGTGCATTCGTCGCCATGTTGACTAACGGTGATGCGCTTCCCTACCGATGTTGATCCGCGTCGATCAGGTTGCGCGATCAGGCCGCACCGCTGGTAGGTGGAAGTTCCTCGGTAATGCTGGGCGTTATTGCTTCGAAAGAATATCGTCAAGAGCGGTATTCAGAGCGCTTCACTTAGCTATAAAATGGGCATTAAAACGGTGATGATTACCGGCGATAGCAAAATCTGACTGCCGCCACCCGATTGCGGAAGCGATCATCGATGATTTTCGCCGAAACTGGCACCGGAAGTGCAATGGCGATGATCGATGATATCAGGAAGGTCATTTGATGGCTGACTTGGCGACGCTTTAACGATGCTCCGGCGCTGGCGCGAGCAGATGTCGCGTGGCGATGAACTCCAACACCGGAGCGGCGAAAAGAGGCGAGGCAATATGGTCGATCATCTCAACCCGACCAAGTTGATCAGGGTGGTTTGTTAAGCAAACCACGATGCTGATGACCCGTGGCTCCGCCTGGCCCACCTTTCAGCATTGCCGAAGCGATGTGGCGGCTTCTTTAAAATTCCGGCGGCATTCGCGGCATCCTCCATGATTAAATGCGCTGAACATCAATGCCTCCGACTAGCCCGGCTCCGCAAATCTCGATGCGGTGATTTCAACGCTAACGACTTCTCAATCTTTGATTCCCCACGAACCGATTATAAACCGCTTACCGCTGCCATGTTGCGCCATCAACAACCTTCAGTTTACGGTCTGGGTGGGCCTGCTGGTGCCGTTTATCGGTATCAGAGTGTCATTGATTTACCGCTGACCCATTTGCGGTCAGTTGTAGTTTACCATGGTGGATACGTCGCGCTATCTTTCGTATTGATTACTGGCGTTTACCCGCTAACGACCACCGTACTTCGGGCAATGGTGAAGTTTCCTGGCAGGCCAATACGTTCAGTTCGTAGAGGTGAAACCACGGTGCGGTTACAAAGCGGTGTTAATCGGGCGAATTTTGCCGTAGCAGCTGTTTCATCTTCATGGTCGCGTCGTAGCGGCAACCTAAATCCTGACTTCCGGCAGGAGCAATCAGCGGTCAACAACCTGGGCTGGATAAACTAATAGCGCACGTTGCCGTACGGGCCGCCGGATGCCAGCGCAGTTCGTTAATTTAATTTGGCGGCGAAAGCGTAAACCGGCAGAACGGTTTCAAATAATATCACCCTGCAGCGGCGGCCTGGCAAATCCCGCGTGGCGGCGTAATCTCAGCGATTGAACAGCTCCCGCACAGCGAGTGCCAAAATACGTAGCAGCCGCTGGTGAAATATCAAAGCTGTGGTTGTCAACGTCGATGAACTCAATCTGGCGCTGGTCTTTTGGTGAACCAACGAAGACCCTTGCGTCCCCGACGATCATCACTGGAACAAACTGCCGCCGCATCGAGAGCTGAAAGGATTTTCGCCGGTGCTGTAAGGCGTCGGGAAGAGACCTGGGCGATGAAAGCCGCTGACTACGAACTGGATATTCAATGGTTGGCGGTAGAAACCCACGGCGAAAAGATACCGCCGCCATACCGAAGGCTGCTGTTCTGCCGTTAAAACGCCAGGCGTACCGTGGGCGGCATATCAGCGGGTTGATCTGTTTACGCCACCGCCCGCTCGATAATGGACCGCTGGTAATAGCAGGTTCCGTCATCCCCAAACGCTGGCGGATATCAGAGCGCTGCGAGCTGGCGTGATCTTTCGTCAACGTTCAGCATCTGGAAAGTCTGAATGATGCTGATTCGGCGGCGTCACGGAATTCAGGTACGGTATGCCCGATCCTTTTCGATGCATAAACGACGTGGTACTTCGGTGGACTTGCCCCGACTGATCCGCCAGCAGCGAAGAAAGGCAAAGTCCTCATTGCTGGGCGAGCGAACTTTACCGTCACGCCGCAAAGGTAATCTGATCGCGGCGCCCTGCGCGAACTGGCTGCACCGTACTGCCGATCGCATTGATGGAACAAATGCACGCCTGGCGAGCATCTGGCGAAGAAGAGTCATGCAGCACACGCGCGGCGCGATCGCTTTTAACCATCGATATACCGGCGGCGAAAAACTGGTCCGCGCAGCGTATTAAACGTCACGGCTGGTGGCGTCTGGCACGGTGTCATGTTGAAACCCTGCCCTGCACCGCTTACCGGAAAAAACGTCAGGGCAATTCTCGGCGCCTTACGTCTGGCACGCAGGAACTGGGCGGGGCGACAACACTTTCTGGTCAGCCGGAAGAAAGCGTGGTACGTTATGCCCGTGAACATAATCCTCGGCAAAGGATTATTTCTCGGTCGCGGCCTCCGCACTGGTGGCGTCGGGAAGCGATTTGCCGTGAGCTGGCGCGCATCGCCCGATCGTCAGAGTGCTGGTCGCGCTTGATGAATACCGCCCGCACGATTAAGCAACGCGCCGGATCGCCGCTCTTTTAGAATAGTGGCGTGTGTGGTTAAACAACACAAACCAGACGCCGAAGATACGAAAGCGGG
+>0eb7ac67-e215-4aa1-958a-7cd320d229a4
+TTAGTACTTCCGTTCAGTTACGTATTGCTACTTGCCTGTCGCTCTATCTTCGGCGTCTGCTCGAATTTAACCTAGGCTGTCCGGCGTGACGCGGTTGCCAGCCCCTGCTCGTTGTATGCGTGTTTCGTCTCATGCCCACCTTAGTTCCCCGTCTCGGGTTCTCCACCGTCTGGCATTCGCCAGTCGGGCGGCAGCTTTATCGTCATATGCGCAGTGGACGGCAACACGGTGGCCTTCGCTCGGAGTGGCTGATGTCTGTCCAGTAGCCGTGGCGTATCATACTGCCACTGCTCTGCCGGTTCGCCGTTCACCGTGCGGTGAGTACGGTCCGATTCATCGTAGTACCAGAAGGGATGACAAGTCCTCATCCTCACTCTGTGTCGATTTTCCGGTCAGGTCATAATGATAACGTTGCGTCCGCCCGTCAAACCGCCCTGCTGTACCAGCCGGTCAGCGCATCGTAACTGAAGACGCTGGCTGCCGTTCTCGTTAGTCAGGCTGATGACACGTCCGGCAGCATCGTACTCCATACTGCGCGTCAGCCGCCCTGCGTGAGTGCTGACCGCCCTTTCTACGCATCATTATATGTCTCATCGGTTGCCGTCAGGGGTGATAACGGCAATCCAGGTCGCCCTGCGGCGTTGTATTCATGCCGCGTTTCACGGCCCTGTACGTCTTTCACCGGGAGTTAACCAGCCACGGTTGTCATAGCGGCGGTAAAGGCTGATGCCTTCCTCGCGGTGGACCGCCGATCATCCTGGCCGAAGCGGTCGTATTCATAACGGGTCCTGGTAGCCCGAGCAGTCGATGAACGCCAGCAACTGCCGTAGCGGCTCCAGGTCATCTGCCAGGTGCTGCCCGTCGCATCCGTTGTCGTCGCCATTATCCTGTGCGCGTCATCGTAGCGGTAGCGTACTGTCTCCCGCTGCGCGATGTCTCCGATACCAGCCTGCGGTTCATCATATTCCCGGCGGCTCTCCAGCCCGTCGAGGACCGCCGTCAGCTGGTTCCCGTCGTTATAGTAAAATTTCGTCTCCCGCCCGTCCGGTGTGGTGATGTCCGTGATATCGCCGAACACCACGTCAGACCGTACTCTTGTCTCCGTCGCCGCGTCCGTCTGCGCCAATGAGCCTTCCATAACGCGTCATACCCATGCGCGTGACGCTGCCGTCCATATTCTTTTTCACCACCACGTTTCAGCCAGCCACCTTCTGGCCAGCCAGCACCTCACGCCGGTTCAGGCTGTCATTGACGGTGATGCAGTCCTGCTCATAAAGATAGCGGTAGCTTAACCCTGCCGGGTTCGGATTTATCCACCACCGCCCGGTATCGTCGTAGCGGTAGCGCATCTCACCATCAACCCGGGTGCTGCGCGTCGTACGTGAAAGCGCACCTACGTATTGCTGCGGTCATATACCGCCAGCGTTCACCGGCTTCCGTATTCGTGTACCGCACCAGTGGCGCAGCGGGCAGGCTCGGGTATGCCGGGTCGTGCGTAATACACCGCCGGCGGGAATTACCTGTCAGGGGCCGTATTCGGTACCGGAGCGTGTGATCGAGAACGCTGAGGCTGAGAGAGGGCGGGAACTATCAGAAGAAGATAGCGAAGGTGCGGGCCTCTTCCGCACGCTGCGCCTGCGTGGTCAGCACCAGACGGAACTCCCGCCCGGCACGTCGTCCGCCGGTGATTTCCCCGGCCAGGTCACCCAACGACACCTCGCCGGTACGTCAGCAATCCGCCCAGAAGCGGTCCGCCATCCGGTAGCTTCCGGTACGGCGGCAGCAGCGCTGGCAATTACGTCCTCAGCACCCGGCACCGCTCGGAACCACCCCAATTATCCACCACGGCCTGTGCGCTGTTGGTCATGAGTAAAGATGGGCTTAACCGGATATCCGGCAGCGCGCCCACAACCGCGCCAGCTATGGGTTAAACACCCGAAGCAGACGCCGCAATATCAGCAACGCCG
+>10df3a9d-60a4-4cb5-ab3d-46483be7bb59
+TTGCTCGGTACTTCGTTCAGTTACGTATTGCTACTTGCCTGTCGCTCTATCTTCGGCGTCTGCTTGGGTGTTTAACCTGCAATCAGCAGAATGGTCAGGGCAATTTCGTTCGGCGTTTTGCGTCGCTGTGCGCCTTCCACCATCGCGATCATCGATCCAGAAATGTCTCTCGCCGGTTAACGCTACGCTCAATCACCAGCCAGTCAGAAAGAATACGCGTGCCGCCGGTGACGGAAGGCAAAATCGCCACCGGATTCACGGATCACCGGTGCCGATTCCCCAGTGATGCTTTCATCGACCGATACCCCCTTCCAATAACTTCACCATCGCGGGGATAATATCGCCAGCTTCTACCAGTACGATATCGCCTTTACGAAGTTGGTCGGCAGGAACTTTGTCCGCCGCAGCGCCATATTTCGGCCCGCACGGCTTGCGGGCAAAGGCAGTTTTTCACCCCTTTCAGACTGTTGGTACCTTGCGCTTTACCTGCGGCCTTCTGCCAACGCCTCGGCGAAATTAGCGAACAGTACGGTGATCCACAGCCAACCGCTTAATGGCCGCGCTAAACAGCGCATTGCCGGGCATCGCACCGCTTGCCATCGCGATGCTAATACAGGTGGTCAATAGCTGCCGATCCAGACGATAAACATCACCGGATTGCGCCATTGCGCCTGCGGGTTTAATTTTTTTCACCGCTTCTTTCAGCGCCTGAACGACAAGTGTTGGTTCGAATAGCGCCAGTTGTTTTACGACTCATATTCAGTGCTCACTCAATATCATCAGGAGAATATTCCGCCACCGGACCAAGCGCAGGGCAGGGATAAAGGTCAGTGCGCCAACCAACAACACGGTGCCGATTAACAGGCCAACAAACAGCCCGGGCCGTGCGTTCCCGGCAGCGTGCCGGAGCTGGCGGCAGCTCTTTACTCACCAACGAACCGGCAATTGCCATCACCGGGATAATCACTGAAGCGACCGACAAACATGCAGAACGCCAGTAAACAGTTCCAGAACGGAGAGTTGGCCTTAATCCGGCAAAAGGCGCTGCCGTTGTTGTTAGCGGCGGATGACACGGCGTACAACACTTCGCTAAAACCATGCGGGCCAGGGTTGAGCATGGCGCTACGTCCGGCGTCGGTCATCATCGCCAACGCCGCGCCCATCAGCACCAGCGTCGGGTAACCAGAATTGCCAGTGCAGTCCGATTTCATCTCGCGTACGTCGATTTTTACCCAGATATTCCGGTGTACGATAATTTCATCAGCCCGGCAATAAACACCGCCAGCAGGACAAACAGCATCATGCCGTAAAGATAAGAACCGACACCGCCGAACCACCGCTTCCGCAATTTGCATCCAGCCACACTCGAGCACCATGCCACCGAGGCGGTAAACGAATCATGCATCGCAATCACCGCGCCACAGGAAGCCGCCGTCGTCACGACCGCAAACGGGCTACTGACCAGCACGCCGAAACGGCTCTCTTTACCTTCCATATTGATGCTGCTGTCCGTGCCCAGTGCCAGCAGATGAAAGTTACCCTGAACTTCTGCCCACATCACCCGCCTACGCAGATGACAAAATCACTGACATCGCCACAACGCTTATGCGCCCCCTGGCGGCGATCATATCCTTCACCAAAAGTAAAGCACAGCGCCGTTGGGATCAAGAAGATCATAACGTATCTACGAAGTTGGTCAGTGCGGTTGGGTTTTCAAACGGATGCGACAGTTGGTAAAGCCACCGCCGTTGAGTACCGAGCATCTTGATCGCTTCCTGAGAAGCTTCTGGGCCCCATGGGTAACAACATTTGCGCTCCTTCAACGGTATTCTGGCCTGATAAGGCAGAAAGTGCTACAGCGCACGCTTGAGATAAAAAACAGTGCAATCAACAACGCCACAGGGACTAGCACCCATAACGTGATGCGTAGCAAGATCCGGCCAGGCATTCCCGAGCGTGCTCATGCTCTGGCGGGTAAACGCACGGATGAGGGCAAAATCACCGCAATCCCGCTGGCGGCAGAAGAAAGTTTTGCACCGTTAAAGCCCGCCATCTGGCTGGAAATAAGCTCAACGTGGTTTCACCGCTATAAGATTGCCAGTTAGTATTGGTGACAAAGCTGACGGCGGTATTCAGCGCCAGATCCCGGTAGCCCTGGCAACTGCTGTGGATTAACGGCAGATAGTGCTGAGCCGAGCAACGCAAAAACAGCACCGCCAGCCCAGCATGTTCCGGGCCGAGAATGGCACAAAGATATTTCTTCCAGTTCATCTCACGGTCAGAGACGCCAAGTGCGCGAAAAAAAGTACGCTCAACGCCCGTTGTACCGGGAAGAGGAATGTCATTAATCAGCCGCCAGCCCGCTGCTAAAGGACGCGCCAGCACCATTAACACCAGTAAAAACGTGGCGATCAGTAAGAACCGCTTGCGCAGCCATCAGAACGCCTCCCGCATTGATCAGGGCATAAACCAGATAACCCAGTAATAAAACACCAGCAATACGCCGGTTATCACGCCTGCACTCTGATGCACCTCCAGTGGCCTAAAAGTGATACCGGAAGGGTGCAGATTCACAACACCGGAATTTCGCAAAATCTGCGGGCAGGGTGTAAAGTATAAAAATGGCAAAAGCCATGATTTAACTAATGTTTAGTATTAATTTAGCTTTTGGTGTGAGCAATTACAGGATGAATGTAAATAAACCATCAATAAGCAAAAATAAGTGGTCGGATGAGTAGTAAATTACACAAAGGCGGTACTATTTTCATCAGATAAACAAATTCATTTTCCGGTGCCATTCACCGGGTAGATACAAAGGGGGAGAAAGTATGGAACTCTACAGAGAATATCCTGCATGGCTTATCTTTTTACGCCGTACTTATGCGGTTGCGGCGGGCGTTCTGGCGCTGCCTTTCGTACTTTTCTGGAAAGACCGCGCCCGCTTTTACAGCTACCATCGCGTCTGGTCGAAAACCAGCGATAAACCGGTGTGGATGGATCAGGCCGAAAAAGGCAACTGGTGATTTTTATTGATTGCTGAGTTTGAATACGGCTGAAAACCGCCAGCGGAAACGCTGGCGGTTTACTATCAAAGAAGCTGTTTCAGAGGAATATTTAGACATCGTTATACCAATCCGAAACATATATTCATGAAATATATATAAATATTTTCTAATTGTTCTTATCTGACAGATATCTCCACTTAAGGCTTTCTTATAAATCTGTGGGTTTCGCCTGTCAGCAGACAAATAACCCGATAAAACAAGGATGAGCAGATGAGCGGAAAACCGGCGGCGCGTCAGGGGCGACATGACGCAGTATGGCCCCTGATAGCATTGTCAAGGGTTCAGCCGGGGTACGCATCGGTGCCCCCACCGGCGTGGCTTACTGTTCGGTGTGCCCCGGCGGAAATTGGGCGTCCGGCCATCCGGTCAATCCGCTGCTCGGTGCAAAGGTCGCTTCAATTGAAACCGACATCGCCCTGCCCAGCCCGCTTTGCCGTTCATTCTCTCCCGCACCTACAGCCAGCAGTTACCGGACAAAACGCCCGCGCCGGTAGAACCTCGGCCCCAGCTGGAAAATTGCTATACCGGATATCCGCTTACAATAACGCGATAACACACTGATACTCGGTAGTAACGGCGGCAAGCCTGTATTTTGAGCACCTGTTTCCCGGTGAGGACGGTTACAGCCGCAGCGAGGAATCACTGGCTGGTGCGCGGCGGCGTGGCGAAACTGGATGAAGGTCACCGGCTGGCCGCACTCTGGCAGGCGCGCGGAAGAACTCCGCTTAAGTCCGCATCGTTATCTGGCGACCATAAACAGTCCACCAGGGGCCGTGGTGGCTGCTCGGCTGTGGTGTGAGCGAATTGCCGGAAGCGAATTGAGGTGCTACTGCGCCGCTGCCGCCGTACCGGGTACTGACCGGGCTAATTGGACCGCTTCGAGCACTTACACACAGACGTTCCACCGCGAAGCCGCCGGTGGTCAGCAGCGAAATCACCGCGTGACGGATGGTGCCGAGTCGCTTCCGGCTGGTACTGACCACGCAGGCGCAGCGGGCAGAAGAAAACCCGGCAGCAGGCCATTTCGGCAGGACCCGGAACCGTCCGCTTTTCCTGATACCCTGCCGGGTTACACCGAATATGGCCGGGACAACGGCACCCGTCTGTCTGCCGTGTGTGACGCACGACGGAATACCGGAGAATTTACCTGCCGCGCCGCTGGTGCGCGCTATGGCTGGACGCCCGCGGCGAACTGGCGGCGGTGTATGACCGCAGCAATACACAGCAGGTGCTGGCTACTTACGATGATAAATACCGGGGCCGGATGGTGGCGCACCGTCACCGGGCCGACCGAAATCTGTTACCGTTACGACAGCGACGGGCGGGTGACAGAACAGCTAAACCCGGCAGGCTTAAGTTACACGTATCAGTATGAAGGACCGCATCACCATCACCGACAGCCTGAACCGCCGTGAAGTCCTGCACCGCAGGGTGAAGGCAGGCTGAAGCATGAGTGGTGAAAAGGAATTTTACGCGGACGGCGGCGTCACGCCAGAGTCAGTTTAGCGCGGTGGGCAGGCTCTCAGGGCACAGACGGATGCCGCAGGCAGGACAACCAAATTACAGTCGGATTGTGGTGACGGGCCTCATCACGCGCATCACCACGCCGGATGGCAGGGGCGTACGGCGTTTTACTATAACCACCACAATAGTTAACGTCAGCCACCGGGCCTGACGGGCTGGAAATACGCCAGGAATATGATGGAATGGGGCCGTCTGATTCAGGAAACTGCCCTGACGGTATCACCCGCTACCGTTATGATAATCCACACAGTGACTTACCCTGCGCAACGGAAGATGCCACCAGCGGCGGAAAACCATGACGTGGAGCCGTTACGGTCAGTTGCTGAGCTTCACTGACTGTTGTTCCGGTTATGTAACCCGCTATGACCATGACCGTTTTGGTCAGGTGACGGCGGTGCACCGCGAGGAAGGGCTGAGTCAGTACCGCGCATACGACAGCCGTGGACAGTTAATTGCCGTGAAAGACGCACCCAGGGGCCGTAGAGCTTTGCGCGGTATGGATACAATGGCTTGCGCCACGGTGACCTGACCACCGTCATTGCCCCGGACGGCAGCAGAGGTTAAACGCAAGCAGACGCCGAAGATAGAGCATAG
+>a46ed4fe-5181-4a9d-ad1a-9e7ac83a0f95
+TTGGTATACGTTCAGTTACATTATTGCTGCGCCTGTCGCTCTATCTTCGGCGTCTGCTTGGGTGTTTAACCTCTGTGCTGCCTTACCACGCGCACCAGCCACATTGACTCACTGCGGCTGTACACCGCCTCCCCGGCATCGAAGTGAATCTCCGCCCGCCGTTGTCGTTGATGCTCAGTCGTCATCACGCGCTGTAAAGCGGATATCGAAGGCGCTTTCCAGCCGGGGCAAAAGAAAACGCCCACCAGTGCAGGCATCTTCGTCAGTAGCTGCTGCTGGGTGCAGGAGAATGAACAGCAGGCCGGGCAGCGCAAGGTCCGTCTCGCCGGGCAGCACCTTCATAACAGCGGATTACCGTTGCCGAAGTCATCCCGCCGGACACACCGAGCACGCCGCCAGTACGGCGCTGGTCTTACACCTGCCGGGCCTGGACAATGGACCACGCCATGCAGATCGCCATCTTCTGTACGCCGCTGGTTTTAGCTCATGTAAAGTGCCCTTTAGTTATTGTTCACTATCCTGTGTTAGCAGCAAAAAAATAAAATGACCTGAAGACCAGCCTAATGTATTTGCTATCTTTTCTCATGACTTATTTGTTCTCAATCAGCAACAGCGGCTTCGTTATTACAGGTCACTTTCAATATTTTATTTAGCAACATTTTAGCACAGATGAATTCATCATCAACAAATTCACTATGTGGATATCATTAACATATATGATTTGCCAGGTTGCGGCATTAGTCACCGAGTTATTTTTGTAGGGCTATATTTAAAATCAATAAACTCCTGTTAAGATTAATATCAACCAGCAATAGAAGATGGAAATCACCAATTAATAACATCATCAAATGAAACATATTGTAGAATTAATTTAAACAAGGCGTTCCATTCAACCAGAACGCCCTTATTTACTCATCACCCGCAAACTGCCTGAACAGCGCCGCTACCCTTAACCAGTCGCGCACCCAGCCAGCCGCCAGCGGCAACAGCAGCGCTCCGCTGCTGACAGAACAATCACAATCGCCAGTCTGTCCACGGAAAAATCAAACACTTTCGCCTGCAACACTGCCAGCGCCGTTTCCCGCGCAATTGCGGCCTGGGCGAAACAAGCCTGGCGACTCGCACCACAACATGGTACGCAGCAATTTTTCCCGCACCGAGGTGTGCGCGCCACACCACCAGCTCCTGATGACGCTGGCGCCTCCACCTGCACCTGTGCCAGCAACAGCAACATACCGCAGGCGGTGACCAATACCATCACTTCGCGCCCGGCTCCAGCACCTGACGACCTGTTTAAAATCAGCGCCAATATCTAACAACGGCTGTGGTCAGGGAACTGGCGGTTGAGTTAATGTCCAGCGATGCCGTTGCCATTCTCCCAGCGAAACTGGTGCATTCAGCTCTGCGGTTGCCGTCTAATGCCCTTCAGGAAAATAGGCATGAAATCGGCCGCAGACTTTCCCGTCCGCTTTGCGCAGGCTGGTCACTTTAGCGCGGAACTCTGGGTATCGCCATAAAAGTCACGCATCACCGAGGCAACGTGCCAGCGTTTCGCCAGCCCCTCTTCCATCGACACTTCATCGGCTTTTGGCGGCCAGTTACCGGCGACCGTCAGTTATGATCGACGCAATATTTTGCCAGTGGGTGAGTTCGCGGTTAAGCCTTCATTACCTTCTGTCGGCTTATCGTTGTCGCCGTCAGCCGCGCCCACACCACCAGATAAAACGATTCCGGGACTATCTGATGTTCCGCAGGAACGCTTTTAGCAGTGCTACCTGTTCTGTGGCGTGCAATTAAAAAGTGATTTCGGGCTTTCTGGGTAGCTGCTGCTGCCTTGGCGGTCGGTAGATCGCCACGCAACACCAGCAACAGTGCCAGCAGCATAAAGGAGAGCGAAAATGCCGAAAGCTGAAGCAACGTTGACCACGGCTGACGTAATGGGCGGCTAACCGCCAGGCACAGAGGCAACTGATTTAAGCGTCATGCGGCTGAAGTACATTCAGCAGCATCCAGCCGTACCGCACATAAAGCCAGTACTGCCGCCATAGCACCATGAAACGGCATACTTAATCACGGCGAACGGCCTGCAACCACCACACTGGCAATCGGCAGGTAAAACTTCAGCGGCCAGACGTTCGCTACCACATCGTGCGTAATGCGGCGTAAAGAAGGCTGCGTTGCCAGCAACCAGCGGTATGGTCATAGCCCACCAGCAGCAGGATGACCGTCGCGTTGCCCAAGCGCTTACAGCCACGGCCAGAGGCTGGCTGTGGCGGTAGTGCAGCAGGCAGAACGAGGCTTGTGCTTTATCAACGTTTTTCGAACAACAGGCCTATGTTACCGGTAACAGCTGAAGCGTCAGCACCGTCAACCACTGATAAGAGCGTTAAACGCGCAGTTAAATAAACCTGCCCCCAACGTTTACGGATCGCCCTGCAGATCGTGCTTGACTGCGACAGTAATGATTCATCTTTACGCCACCGCTGCCTACCAGCAGCAAAGGTCAAAGCGCGAAAACGCCAGGAACTGTTGCGAGCGTTCCATCGATCGCGCATATCGTCCTGTTCCAGACCATTGCCAGCGTTGTTCGGGTTTAAGTAGAGGTAACAACATTTCTCACAGCCGTCAGAGCTGGTTCTCGTTGCCGCCAATTTATAACGTAAGGTGACCCGACTCTGGCTGCGGCTCCGTGGTTTTTATCAACATCATAGTTCATCATCAGACGGAGCCGTATCTGGAAGGGTTCGACTTCGAGGTCGGTTTCTCGAATCACTTCAGCGATCCGCAAGGTGGCATCGCCCACGTTAATGGTGTCGCCGTTTTTCCGGGTTATGAGTGCCATCAGGCGTGGAAGGATAACTTCATCACGCTGCCGCCTGAAGGTTTCAGGCCGAGGATTGGATTTGCAGATCGCCATACATCAGGTAGATATCATTACCGCTTTGACGTTCGCCAGCGTACGGTGTGTCGCTTCTCTAAAAGGTCATTGTGGCGAAAGTCAAGCTGCGCAAACTTTTCGACCGCGCTTTGCGCTTCCCTCCAGCCACGCTTGCGGCGGCACTTCGCGTGACTGCGCAACGCCGATCGCTGCCGCAAACTCCTGCGGCTTTGCTGGCTTAAAGCGCTTCAATGCACGATCGCTGATGGCGTACTTTAGCGCCAGCGCAGGCCACCGCGCCAAAACCCAGCGCCAATATTAATGACAACGACGGCGACCCAGAGACAACGATAATGCTTCTCCACTGCAACTGCCCGTTCACCAGCGCTTAGCCATGGCAGCGATTCGCAGCGATGCGCCAGTTGCAGGTCGTGGTCACCACTGAAATCAGCGTGGTGCCATCGTGTTCGTTGAGAGCCATGGTCAGCAGCCTGCTCTCGCCCGATCTGGCGGGTCAAAGTTTGCCGATGGGACTCAATCTAAAACTTGACAGCACATCAGGTCGACTATTAAAGAATCGTGCCAGCGCCACTCGATTGCTGTTCACCGCCGGAAGCTGTGCCGGAAGATGATCAGACGTTTACCCAGCCTAACTGTTTCGAGCAACGCTTTCGCTTTATTCCGACATATGCTTCTCTCACCGCGCAGCAGGGCAGCCAGAGCTCGACGTTTTCCAGCACGCGTGGGGTAGGAATTAACATAATGACTGAAAAACAAAATGAGCGCTTTGCGCGCGCAACTGCCCTTCTTCGTCATATGTAGCAGTTGTCCCCGCGATTCTTCCTTTTCTGCTGCGTCATCAAACCCGGCGAGGATCGCAACAAAGGTTGACTGCGATCCGACTCGCCCGCCAATTGGTGATATCGCCACGTTTTATTAGCTCTCCAGCTCCGATGAGGATGGAGTTCATGCTCCCCTGGTGGAAACGGACTTCTTAAGATGATGAACTTCAACAAATGTTTTTCAGGTTTAACCCCAAGCAGACGCCGAAGATGGGCACGCGGG
+>9a1776fd-9328-408e-9d54-e16535cbe064
+TTGTTGCTTCCTGGTTTCGGGACGGTTGCTGCTGTCATCTCTCGTCTGCTTGGGTGTTTAACCTCATGCACTGAAATAACGGCACAAATAATTCAACAGTAGAATATCGACCAATTTATGCCACCACTTTCCCAAACTTTTGTCTGTAATCAGATTAATAATAAAATATGTTCCATGGTTTTCCAGTTCCATTTGTTCACCTGTATGTAAAGATGCTGATCATCCATAGCTATGAAAACAACTTTATGAACAATATTAGTATGTTGAACACAAATTCGAATTCTATTGGTACACAAAAAGTAAGCGTTTAAATGATCTTTCCTGTGGAACTGCCAAATAACTATTCCATGTGAGTTATCTCAATTTTTCACCACAGTAGATTAATTTGTTTTCTCAGGAGGAGATTTTATTTCTCTTCACTTTCTGACAATTCTAGTTCATTCTGTATCTTTGTTCAAAACATTCTTAGACTCATTTTTTGTTCAGGAGATGGTGGCATCATTCGAGGCATAGTTGGTTTTCTCATCTTCGTATCACCTGCATGATTGGATTATCAAGGACTGCCAACAGCTAGACTGGATCACTGCTCTTTTGATAGATACTTGCTCTCCCATATAACTTCTAAACTGATCATGAGAAACGCCGTTTTCTGCTGTATTTATCAGCTCCTGCAACGTTCCTTTGATGATAATGATTTTCATTAAGGCATGTGACCCGACGCAAGATTAGAGTCTCTTGCCAGCAGGTGTGAATTTATTATTTTTACGTGTACCGGTTCTGTTTGCCATGTACTCATGATGTCCTCATTCTGATACCATCTCCCGCTGGCTTTATTATTTGAACTGAAGGCTTTTGGAAAAAATAATTTTGCTCTTGAAATAGTAAAATGAAATCATAGATCATCTTTAACATGTTCGCAATCATCTATAACACCGAAAACAACAAATATATCAGCAAAAAGAACAGCTCTCTGTTTTCTTATTCTCGTGTTCTCTTCATCTTGGCTAAATTTCACCCAATCGTATCCCTGTTGGCCATCAGGTTTAGCAATGTCTCTGGGAATAATGGGAGTTCTGCAAGTATATCCTGGTGGTAATTGGTTGTTGTCCCGATTTGTCTGTGGCAGGTAATCACTTATATCTTTGTATCCATCCCACGGATACAGAATCATTCCTGGCATTACCTGAATCCAGATTTGGTTTTACCTTCCTGCAATACGGTGTGTAGCGTCGGCAATGCTCTGAAGAATGTTTGGCATTAAATGAAACACTGGCGCTAAATCGGTATGGATATGGCGGTCTTAATTGTTTAACTGCTGTCCAGCAATTTGCTTGGATCGGGCGTGGCGGTTTGTTGGTCTCTAACTCCATATCTCTGTTATTTAAGTGTCCATATTTTGATACCAGTCCCATTGAATCTATATATGAACCAGTTCAGCGGATGCACCGTGTAAATTCATCCCCTTCAGCCCAATCGGATCCTGTAGTGATATACCTCCCTGCAGCGGGTCATAATAGCGTTGTGGCGGTTGTAATACCAGGCCAGACTCCTCTTCCGCCTGCCCCGGCGGCGCGATGGATAAACTGCCGCAGCTGATGCGGGTTCTCTTCATTCAGCAGGTTGCCCCCATTAAATGTTCGCACTTTTCATTCTGTTGCCTTCCGTGCCGTAGAAAGCATAGCGGCTGAACTGAGCCGCGATGGTCATAAGTGGCTGGAGTGGATTTTCGCCGGCGACGCACCACCAGGTCCATCTGGTTTTGCATCACCTGCTCCCACCGTCAGGCCGCATTACCAGCCAGCGGCGGCTTTCCTCCTCACCCGGTCAGCAAAGTTTCCTTTCAATATGGTCAGGCATCTGCACCCAGCACCGGCGAGACACCACTACCACCGTCTTCGCCGCCGGACGCTGAGGGTATCCGCCAGGCTGCAGCGCTGCGTTTTCGCCAGCTCTGGTGGCGGTTTCAATGATGAGTGGCGTGAAGCTCCCCGGCTGATAAATCGTCTGATTGCCGGGTTCTGTCGTTTCCTGTATCGTGGTCGGGCGGTGTTGCCACGTCCCAATACCAGGTCGCGCGGTTCTTTCCGTGACAGCGACATCGTCGGGTCCGTTCACGTCATTCATACACCCATTTTACCCACCCTATAAACAGCAGCGGGTCATTGAATAGCAGCTTTCGACTGGCAGCTCTTGCATATTGTCGCGTCGTAATTACTTTATAATACAGTGCGACTGGCGTAATAATTTCGGTGGACGCTCATCATATCATCGATGGATAACGCTTCAGGATGAATGGTTTCTCCGTCAGCCGCGTGACGGTCATACCGGTAAAGATGAATGCGCGTCACGAGGCGATGGATTTATCTGGCCACATGCTGAAGTGCTGTCCGGGTGCAGCTCGGGTCAGACAGGCAGGTTACCTGCCGGCGGGATACAGCAGCATGCGGGATATCAGTAATGCCCGGGTTATAATAATAAGGCAATTAACCAATTGCGCGTATTTGTTTATAATGCGCCCGCCTGGCCTGCGACCTTGAGATATGCCCTCACAATGAAATAAAGCCATGTTATTATCGCCGTATACTTACTATCGAAATCACTTACGCCAATAATGTCACCGATACAGTCCCTATAAATATTACCAGAGCAATGAGAATACTGCTACTGTTTGGAAAACCTGTTACCATCATTCCATAAGACAGGACGTAACTCCTCACATCACGGTGGAGGGTCTAATAATGATGAAAGTCGCCATGGAAAAAGATAAGCAATGCAAAGCGATAAAGCCAATAGCATATCCCTGAATCTAAAAATAATATGTTTCATTACATCCGCCGGTGAATACAAATCCTAATATAAACGTCAATATTGTACCGGAACGCTTCATCTTACATGTTCTACAAAAGATCATTATAGACCAGTCTTGGCAGTTTTGAAATAGCCTGAATTTATATGAATGGCCGAATATATCAGGCAATGCTTCAGAATAACGCGCGGCCTTACCTCTTTTCGCTTCCTTTTAAACGGTTCTCCACACAGCTATTATCTGGTTCAGCGAGTCACAGCGATAGCAGCTTCTTTTGTATCATTGCGCTTGCCTGTATTTATAGACCATCTCCTTTTTGAATTCTCCCCGTTGGTGCAACACCACTACAATTATAGTCCCTTTACCACCATCTGGTTCTAGATATTGATGAGCCGTTCCCCATATCTGGACCACTTCTTTCACCCAGTTCCGCCATTGAATGCAGTGGCTTAAGCCATTTTTCTTAAGTGTTTCATCTAATGATCTATATTGAGATCGGATTCAACGGACCAATCAAAATTCATCCCCTTTCGAACCCAATCAGTCCTGGTGATATATGGCCCTGCCGGCGGGTCATAATAGCGGTGGTTGCCAATACAGGCCGGACTCCTCATCGCCTGCTTACGGCGATGGATATAAGCTACTGCAGCGCCGTGCGGGTTCTCTTCATTCAGCAGGTTTATTCGTAAGTATTCTGCCGTACCACGCTGTTGTCCCTTCCGTGCTGATAGGGGCCAGCGGCAGGCTGATAGTCGCAGTGGTACGGGTGAATTTTTCGCGCCACCGGCGGTATGCAGGTCCATCTGGCTTTGCATCTCGCCACCGTCAGGTGCGATGCCAGCCAGCAACGGCTTCCTCCACTCTACTGAGTCAGCCGAGTTTCGCGCCAGCCGGTCGAGCATCTGCCAGCGCTGCGGCGAGAACACCACTACCACCGTCTTTATACCCGGTTTCTGGAAGAGGGTGGCCTTCCGCCAGGCTCCGCGGCGCTGCGTGCCGCCAGCGCTCACCGATGGCGGTTTCAGCCTGATAGTGGCGTGAAGGCTCCCCCAGCTGGTAAATCGTCTGGATACGGGTTCATGTTCTTCTTCGTGGTCAGGCGGTCGCTTCGTCTAACCATGCCAGGTCACTTACGGTTTCCGTGACAGCGACATCCAGCCCGTCGTCCCGTTCACGCCATATACCGTTTGCCACCACCTGCGGCCTTAGTAAGTAAAGATAACGACTTTCGGCCAGCGGCTCTGCCTGGTAATGTCATGCGTGTAGTGGTACCAGCCAGTGCTGGCTATCATAATGGTACGTTGCCAGTGGTGCGCTCATCGTGCGGATAACCCCCCTTCCGGATGGTCGGTTTCTCTGTCAGCCTGCGTGACGGTCGCGCCCGGTAAAGATAGTGCGCGTCACGGGCGATACGATTTGCTCCGGCCACATGCGCTGAGGCGCTGTCAGGTGCAGCTCCGGGTCGGGCAGGCGTTTACCTGCCGGGTCGCAATGGGCATACGGAAGGATGGATATCCAGATTCGCTGCAGAATTGACGAACGCCGGTCCAGCCTGCCGGTGGTGCTGTAGCTGTAACTCCGGGTCGCCTTTGCAGGCTGCTGTTCTGCGGATGAGTTCTGCATTGCGTATTCTTCCAGGTGTAATCGCGGTCAGACAGCAGGCTGTTCGATGCTGGCTCTGTAACTGCCCGGCAGGGAGTCGCGGTGTGGTGAGTTCATAACGTGACGCCGCAGCGTTTCCCGGTGCGGGCGGTCGCGGGTGTACTCAGCGGTGTGTCTGAAGTTCGTACGACAGCCAGCCGCTGCGTAGATCAAGCCTGATGCAGCGAACTGGCTGTCCGTCTTCTAGCGGTTCGCCAGTCCTGTGCGTTTATGTGCCGCATGTCTGGTCTCATGCTGCAGAGCAGTTTGTTGTCGTCACGGATGATGCACCGTCAGGTGTTCGCACCAGCGAGCGGCCTGTCATAATGCTCCGTTACCGTCACCCGGCGGTGCCCTTCGCTGATACAAGCTGTGTCTCTGTCAGCCAGCCGCGTTCGTCATACTGCCACCTGCTCTGCGATTCGCGCATCACGGTGCGGCCGTGAGGCGGCGGTCTTCGTCACTGGTGATGGGTATTGGCCCTCATGCTCGCTGCGGATAAGTTTTGCGGTGAGTCGTGGTGATAACGCTGTGCGTACGTCCGTGGTTCCTCATCAGCCGGTCATTATCGTAACGGAAGGTGGTGTACCGTTTTCCTGTTCGGCGGATGACCCCGTCCGGCAGCATCGTATTCCATGCTACCGTCGTGCGCCCTGCGTGGTACAGATGGCTTTTCCCGCATCGCTGTATTCACGTTTATACGCCGTCAGGGCAGCCGGCGGTGAATTAAAGGTCACCACGGCGGCGTTGTATTCCCTATACCGCGTTCCATGGCCCTGCGTGTCTTTCCACGGCAATTAACATCACGGCGCTCGTATGCGCGGTACTGACTCAGCCCTTCCTCGCGGTGCACCGCCGTCTTCCCTGTTAAAACATTGCTTCAATTCTTAGCGGATTACATAACTTCTTGGAACAGTCGAAGGTGGCTCAACAGCTGACCGTAACGGCTCCGTCATGGTTTCCGGCTGCCGGTGGCATCTTCCGTTGCGCAGAATTGCGTACTATTGTGTGGATTAACATAACGGTAGCGGGTGATATCGCTGCCATCAGGGGCAGTTCCTGAATCAGACATTTATTCATCACTGTTTCCCGGCGGCGTATTTTTACCAGCCCGTGGAGCCCCGGTGGCTGGCAATTAAGCGCAATGATGTGGTTATGGTAAAACGCCGATGCTAAACCGGCGTGGTGATGCGCGTGATGATTGCAATCGCACATCCCGGACGCAATATTCTGTTGTCAACCTGCCCGCCACGGCATCCGTCTGCCCTGACCTGCCACCGCGTCAGCCTGTCTGCGTGACGCTGCGTCCGCGTGTTCTTTTCACCACCTTCGCTTCAGCCCCTTTCACCCACCGATGGCCGCGCGGGGACTACGCAGCGGTTCGAACATTCTCATTTGATGGTGATGCGGTCCTTCTCATGCTGATACGTGCCTTATTAAGCCACCGCCGGGTTTAGCGCTGTTCTGTCACCCGCCGTCTTTCTCAATAACGGTAACAGATTCCGGTCAGCCCAACCGCTGACGAGTGCGCCACCATCCGGCCCTATGATGGTATTTATCATCGTAATGTTAAGCTGCGCACCTATGTAATGTGCTGCGGTCACCGCCAGTTCGCCATAGGGCGTCAGCTCGCTTTTCAGCGGCGCGGCAGGTAAATTCTCCCAGATATTGTTGTTCCGGTGTCGTGCGTCAGCCACCTGAACAGACGGATGCGTTGTCGGCCATATTCAATTTGTAACCCGGCGAGTATCAGGAAAAACTGGACCGGTTCGATCCCGCCACAAAATAAGCTGCTGCCGGGCTTCTTCTGCCGCCCACTCACGCCTGCGTGGTCAGGCTGGCAACCGGAAGCGCCCGGCACCATCCGTCGCCGGTGATTTCGCCACAACTGAATTCACCAGCGGCTTTGCTGATGGAACGTCTGTGCGCCCGAAAGCGGTCCGCAGCCAGTCCATGTACTGTGCAGCGGCAGCAGCACGCAGGCGGCTTTACTCATCGCTTCGGCACCACTTTCCACCAATGAGCAATACGCATTTCGGGACTGTTTATTCTCTTTCAGATGTGATGGACTTAAGCGGAGGTTTCTTAAAACCTGCAGAGTACGGCAACCGGTGACGCCTCCATCGTTCGCCCGCCGCCGCGCACGTACGGTGATAACGGCTGCCATCACGGGAAGCGATTCGCTCGAAATACCGACTGCCGCTGATGCGCGCTGAGTGTGTGTGTTTATCGCTGCTATGGCCGGATATCCGCAGAAGCATTTTCCAGCCCGAAGGCCGAGGCTCCCCGGCGCGGCGTTTTATCGTAACTGCTGTAGGTGCGGAGAAAGTGAACAGCAGCTGGGCCGGAGCAGAACGTCTCGGTTTCGCAGGACCTTGCCGGCGCGGATTCGCCCGGATGTTGGTTCACCGCAGGCACCTAAATTGACCCCACGCCAGGCAGGGGCTGATGTACCCGGCGAACCCCACCGGACCGTGCTATACTGCGTGCTTCTTTGGCGCGCGCCCGCCGGTTTTCACTTCATCCGCCATCGCCGAACATCTCGTTTCTGCTGTGGGCGAAGCCGGAATTTTAAGAAAGCGCAAAGGTAGAGATATCTGTCGAATAGAACAATAATTGGG
+>44442ba9-9951-4bac-90ab-2acc8d1c4015
+CTGGTAACCGCCCGTTTCAGATTTACGTGTTGCTGCTTGCCTGTCCGCTCTGTCGCTGACGTCTCGCCGGTGTTTAACAACTTCTTCCGTTTGCGCAAGGTAAGTCACTGCAATGGATTATCATAACGGTAGCGGGTGATAATATCGCCGTCAGGGGCGGTTCCTGGTCAGACGGCCCCATTCATCCCATAATTCCCCAGCGTATTTCCAGCCCGTCGGGCCCGGTGGCTGACGTTAACTGGCCTATGGTGAACATAGTAAAAACGCCAGTGCCCTGCCATCCGGCGTGGTGATGCGCGTGAGCAGGGCCAAATCACCACATCGGTTCTTCATTCTGTTGTCCTGCCTGCGGACATCAAGTCATAATGCCCTAAAACCCTGCCCACCGCGTCAAGCTGACTCTGCGTGACACTGCCGTCCGCGATGTTGCTTTTTCACCACCCGCTTGTACCTTTACCTGCGTGTGCGGACTTCACAGCAGTTCGATATCATTGATGGTGATCTGGTCCTTCTCATACTACGTCCCCGTGTAACTTAACCTGCCGGGTTTAGCTTCTTCTGTCGCCGCCGTCGCTGTCGTAACTATTTAACCGTTTCCGGTCGGCCCGTGTGACGGTGCGCCACCATCCATCCCCGGTATTTATCTCATCGTAAAGTAAAGCTGCACTGTGTATTGCTGGAAGTCATACCGCCGCCAGTTCGCCGCGGACGTCAGCCAAAAGCGCAGCGGCGCGGCAAATTATTCTCCGGGTGTTGGGTCGTGCGTCAACCACACGGCGAACAGACGGATGCGGTATTCGGCCGCCTATTTCGGGCAGCAACCCGGCGGTATAGAAACGGACAGTTCAAATCCCGCCAGAAATAAGCCTGCTGCCGGGCTTCTTTCTGCTTGCTGCCTCGTGGTCAGTACCAGCGGAAGTGACGCCCGGCACCGCATCCGTCACCGGTGATTTCGCCGCTGAATTCACCGGCGGCTTCGCCTGATGGAACGTCTGTGTGCGCCCGAAGCGGAAGTCCGCCAGCCCAGGTCAATTACCCGGGTACGCGGCAGCGGCGCAGGCGACATATCATCCGCTTCCGGCACCCGCTCACCAGCCGAGCGGCCACCACGGCCCCTGCGGACTGTTTTGTCGCCAGATAACGTGCGGACTTAGCGGGTTCTTCCGGCAGCGCCTGCCGGAGTGCGGCCAGCCAGTGACCTTCATCAGATTTCGCCCACGCCGCCGCGCAGCCAGTGACTCGCTGCGGCTGTAACCCAGGTATCACCGGGAAACAGGTGCTCCAAATACAGAGCTTCCTGCCGCCGCATTTATCACTGGTATCAGTGTGTTATCTGCAAGCTGTAGCGGATATCCGCAGGCATTTCCAGCCGGGGCCAGAAGGCTCCCCACCAGCGCAGGCGTTTATCCAGTAACTGCTGCTTAGGTTGCAGGAGAAGAATAGACAGCAGCGGGCCGGGCAGGGCGATGTCGGTTTCACCGGGACCTTGCCGAGCGGCGGATTGACCAGATGGCCGGACGCGTCACTTGCCAGGGGCACCGAACAGGCCACGCCACGGTGGGGCTTCCGTGCAGTACCCCGGCTGAACCCTGGACAATGCTACCGCCATACTGCGTCATGCTCGCCCTGACGCGCCAGTTCCGTAATCTCATCCTTGTTTCATCCAGTTTATTTGATGCTGCTGACAGGCGAAACCTGATTCCTCGAAAGCCTTAAGTGGATATCTGTCGGATAAGAACAATTAGAGAAGATGTTATACCTCTTTGTAAGATATATGTTTTGGTTGGTATAACGATGTCTAAATATTCCTCTGAACATCTTCCTGATACAAAAACCGCCAGCGTTTCATGGCGAGTTTTTCAATATTCAAAGCTCAGCAATCAATAAAAATCACCAGTTGCCTTTTCGGCTGAATCCATCCACACCGGTTTTGTCTTGGTTTTCGACCAGACGCGATGCTGGAGTAGCTGTAAAAGCGGGCAGATCTTTCCAGAAAAAACGCTGACAGCGCCAGAACCCGCTGTACATAGTCTGACGTAAAAGATAAAAGCCATGCAGAATATTCTCCTGTAGAGTTCCATACTTTTCTCCCCTTTTTAGTATCTACCCGGTGAATGGCACGGAAAATGATTTGTTTATCTGAGTAGAAAATAGTACCATACTTTGTGGCAATTTTACTGCTCATCCGACCCTTATTTTTTGCTTATTGATGGTTTATTTACATTCATATAACAATTTAGGATTTACTTTTAAAAGTTGATAATACTAAAGGCGCGTGAATTAAAATCCTTGGCTTTTGCCATTTATACTTTTACACCCCGCCCATAAGATTTTTGCGAGAATCTTTGTGGGAATTCACCTTCCGGTATCATGCCAGAGCCCACTGGGGGTGCCGCTGTGAGGTGCGGGCGTGAATGTAGCGTATTGCTGGTGTTTTATTACTGGGTTATCTGGTTTATGCCCTGATCAGTACTGGAGGCGTTCTGATGGCTGTAAGGGTTCTACTGATCGCCACGTTTTACTGGGTATTAATGGTGCTGCTTGCGTCTTTAGGCGGCGGGCTGGCGCGGCTGATTAATATTATTCCCTCTTCCCGATTACAGCGGGCGTTGAGCGCAATGCTGCATGCCGCCAGGCGTCTGACCGTGAGATGAGCAAACAATCTTGTGCCATTCTCATTTTACCAGTTAATGCTGGAGCTGGCAGTGCGCCTGTTTTTATATTGCTCGGTCAGCACTATCTGCCGCTTAATCCACAGCAGGTTGCCAGGGCTGTCATTAAGGGTCTGGCGCTGAATACCGCCGATCAACTTTATCACCAATACCAACTGGCAATCTTATGGCGGTGAAACCGTTGAGCTATTTCAGCCGGAATAAATGGAGCTTAACGGGTGCAAACTTTCTTCCTGCCATAGCGAGATTGCGGTGGTGCCCTCATCATTGCGTTGCCGCCAAACAGAGCACACTCGAAATCACCTGGGTCGATCTTTTCACCACTTATCCCCGTTAATGGGTGCGAACCACCATGGCGTTGTTGATTGCACTGTTTTATTCATGAGTGCGCTGCAGAGCTTTCCTACTTATATCAGGCTGGCGAATACCGTTGAAGGAGCGCAACAGCTGTTACCCATGGGACTATGCTTCTCAGGAAGCGATCAGAATGCTCGGTACTAACGGCGCAATGCCAACTCGTACATCCGTTTTGAAAACCAACCACTGACCACTTCGTGCGGATGCTGATCTTCTTGCGATCCCAACGGCGCTTAATGCTTTGCCTTTGGTGAAGTGATGGGCGATCGCCGCCAGAGCTTGCATGTTGCTCGTGGGCGTGTATTGATTTTGTCGTCTCGCGTAAAGGCGTAATTGATGGGCAGAAGTTCAGGGTAATCCTCATCTGCTGGCACTGGGCACGGACAGCAGCATCAATATCAGGAGAAAGTAAAGGCCGTTTCAAGCGTGCTGGTCAATCGCCTATTTGCAGTCGTGACGACTGGCGGCTTCATAATGGCGCGGTTACCGTCGCCGGTTCGTTTACCGCTCTCAGTACTTTGTGCGTGCCGATATTTGGCTGATGCAAATTGGTGAAGTGGTGTTCGGCGGTGTTAATCGAGTTCTGGTCTTTGGCATGATGCTGTTTGTCCTGCTGGTGGCGGTGTTTGTGCCGGGCTGATAGTTGGTCATTACACCAGGAATATCTGGGTAAAATCGACGAGATGAAACTGGCTGCACTGGCAATTCTGGTTACCCCAAACGCTGTTCTTTAATCGGCGCGAAGCGTTGGCGATGATGACCGACGCCGGACGTAGCGCCATGCTCAACCAGCCCGCATGGTTTTAGCGGTGCTGCCGCTTGTCATCCGCCGCTAACAACAACGGCAGCGCCTTTGCCGGTTAAGCGCCAACTCCGTTCTGGAACTGTTTACTGGCGTTCTGCCGTTTATCGGTCGCTTCGGGGTGATTATCGGTGATGTGATGCCGGTTCGCTGAATTGAGTAAAGAGCCAGAAAGCCGCCAGCTCCGGCACGCTGCCAACGCACGGCCCGCTGTTTATTGGCTATTCATCCAACACCGTAATTTGCTGGATGGCGCACTGACCTTTATCCTGCCCTGGCGCTTGGTCCGGTGGCGGAATATCTCTCTGATGATATTAGTGAGCACTGAATACTGGGTATAAATGAAGCAACTGGCGCTATTCAGGCCAAACACTTATCGTTCAGGCACCGAAGCGGTGAAAAATTAAGCCCGCAGGCGCAATGGCGCAATCGATGTTATCGTCTGGATCGGCAGTCTGCTGACACCTGTATTAGCATGCGATAAAACGGTGCGATGCCCCATTCATGCGTAATTTTATGCGGTGCCAGTAACGAGTTGGCTGTGGATCACGCATTACTGTTCGCTGAATTTCGCCAGGGCGCTGGCAGAAGGCCGCAGTAAGCGCAGGCCAACAGTCTCGAGGGTGAAAAACTGCCTTTGCCCGCAAGCTGCGTGAGCCAAAATATGGCTTGCGGCAGACGCAGGTTCCTGCCAGCCAGCTTCGTAAAGGCGATATCATTACTGGTAAACTGGCGGTATTACTCCTGATGGTGAAGTTATTGGAAGAGGTCATCGGTCGATGAAAGCGCCATCACCGAGGGAATCAGCACCGGTGATCCGTGAATCGGCAGCGATTTTGCTTACTCGTCACCGGCGCGCTTTGCGAAATATTCTCTGAAGCTGGCTGGTGATTGGAGTGTAGCGATTAACCCCCGACGAGAGACATTTCTGGATCGGATGATCACCTGATAAATTAAGAAGAGCGCTGGCACAAAACGCCGAACGAACGCCCTGACCATTCCTGCTGATTGCCCTGACCATCGTCTTTTGCTGGCAACCCGCCGCACTGTAACGTTTTCACGTGGGGCGAGTAAAAATGCAGTCAGCGTAACGTACTGAACGGCGCTGCTGGTGTCTGATCCCAGCCACTATTGGCGGCCTGTTGTCGGCGATCCTGGCATCCGCCGGGATGAAACCGGATGCTTTTCGGCACGATATGACCACCACACCAACGGACGCTTCGTTAAACAGCCGACGTGGCGATTCTGCTCACCTGGATCCCGTCGGCGCCATCTACCTCGAACGTCCAGCGTCGATTCTCCCCGCGCAGGGCAGACCGAAAACATGGCTGACGCACAACTAACTTCGCTGGCTGGTGAAACGCCGGAAGGCCGCAGTCATTGTGATCCTCATAAAACGCGTTTTAACCTGCGCGAAGAGCGCAATCATCCTGATCGCTCCATGCATACCGTTACTGCGCAAAGCCGGATGAGCGGGATCAACATCGACAACCGCATGATCCGTAAAGTTTCTGTCGATGCCATTCATCCTCATGTTAGAGTAACGGTGGTCACTTCCCTACCAAATCAGCCCCAGTCAAAAAGTCAATCAAGTTTGCGTGGGAGCCCTTTACCACTTCAGTAGGTGGTGGAAGAGTTCTCGTACTGCGGCGATTGTGCGCTGAAGATATCGTCAAAGGCGAAGGTATTAAAGAAGCGCTGTAGCTGCGCAAAATAGACATTAAAACGGTGATGATTACCGGCGATAACGTCTGACTGCCGCCGCGGTACTGCGGAAGCGGGTGTCGATGATTTTCTCGCCGAAGCGACACCAGGCCAAGCTGGCAATTGATCCGTCGGTATCAGGCGGAAGGTCTGTTTGAAGTAGCGATGACCGGCGGCAGCACCAACGATGCTCCGGCGCTGGCGCAGGCAGATGTCGCGGTGGCGATGAACTCCGGCGCAGGCGGCGAAAGAAGGCCAGGCAATATAGGTCGATCGAGCTCGCCCGACCAAGTTGATCGAGAGTGGGTGCACATTAGCAAACAGATGCTGATAGGCCCGTGGCTCGCTGTTACCACTACAGCAATTTGCCAGCGATATGGCAATAACCGCCATTAGCCCGGCGGCATTTCGCGGCGGCAATCCGCAGTTAAATGCGCTGAACATCGTATTGCCTGCATTCGCCCGACTCGCAATCTCAGTGCGGTGGTTTCGCTGCCGTTATGTCTTTTTGATTCACAGTTAAAGAGGCGTAGAGTTATAACGCTTTACCGCTTCTGCCATGTTGCGCCGTAACTATGGATTTACAGTCATAGGTGGGCTGCTGGTGCGTTTATCGGTATCAAAGTCATTGATTCTGCGGCCGTTTGCACGGTCCTGGTGTGGGGATTTACCATAGGTGGATTACGTCAGCATTATGCTTATTTATCTTTCTATTTATTGATTGCGGCGTTTAACGACTACCGGCTGGGGCAATGGGTGGTTTCCTGGCGGGTAATGGTTCGTTGAGTTCGGTAGAAAAGGTGATACGGTGCGCGGTTTCAGCGTTAATCGGGCGAATTTTGCAAAGCGGCGACTGTTTTTCATAGTCGCCGTCGGCAACGGCAGAAATGCCCTATGATCCACAGCGGGCTTCTGGCGGGAGCAATCTGGCGGTCGTAACTTCAGAGCTGGATAAGCTAACCGCCCGCACGCGTTGCTGCATTTACAGACCGCTAACCCGGATGCGGCGCGAGCGTTCGGATGAACTAAGTGACAGCGTCAAACCGTGGGCTGGATAAATAAATATCACCCTGCGGCGGCGCAACCGGAAATCCCGCAGCTGGCGAAAGCGGCATGTCTCGGCGTTTAAGACAGCTCACGCAACAGTCGCAAAATGCAGCCAACAACCGCTGGTGAAATATATCCCGGCCAGCCGGTTTGTGTATTATTGAACTCAATCTGGCACTGGATAAACTTGATGGAATAACGAACCCTTACGTCCGACCCGTCGTCTGCTGGAACAAACCGCGCCGCCACATCAGAGCTGAAGGATTTTTCTTCGGTTGTAATGCGGGTGATCGGAAGACCTGGGCGATGCTGGCAGAAGCCCAAACGAGCCTACGCAGGCGCAAAGAGAACTGGATATTTGGTGGTTGAAAAAGCATTGGTAAAAGAAACCCGGGCGAAAAATCACCGCCAATGCTGGAAGGGGCTGGCTGTTCGTTAAAGAGCGCCAGGCGTACCGTGGGCGGCATATCAGCGAGTTTGATCGTGCGCACCTCGCCCGCCGCCCGCTATGATCTTAATAGTTGAACTGGCGCACGATAAATGCGCCGGGTTCCCGTCATCGGAAACGCTGGCAGGATATCAGAAAGAACTGCGGAAGCTAGCGATGATCATTTCACTACCGTCAACGTTCATCTGGAAGGTCACAGATGATGTGGTCAGCGGCGTCACCGAATTCCGGGTACGCGAAGCCGATGCCCGATCCTTTTTCGATACCGCCACGACGACGTGGTGCTGGTGGACTTGCCCCCGGACGATGCTGCGCTGGCGGCTGAAGAAACAAAGATCCTATCATGCCAGAGCAGGCGGAGCGCGCCATTGAACATTTTTTCGCAAAGAAATTAATCCCGTGATCGCCTGCGCAGAACTGGCTTTTCGCCATTGCTGCCGATCCGCATTAATTGAGCAAATGCGCGCCTGGCGAACATCCCCAGCAGAAGAGAGAACATGGCACACACGCGCGGCGCGATCCTTTTATGCATCAGCCCATAACGCAGCGGCAAAACGTTCGGCTGCAACTGCAGCCTGGCAATCACGGCTGGAATAGCGTCAGCGCGCCCGGTGTGTTAAAACTACACCGCGCTTGCCGACGTCGAACATTCTCAAGCACCCGTCTGGCTGGGAACTGAGCGCGGGGCGGCAACACTTTCCTGATCAAGCGGGAAGAAAGCGGTGGTGCGTTATGCCCGTGAACAATCTCGGCAAGATTGGGTTAAACACCCAAAGCAGACGCCGAGAGATGAGCATA
+>bec0a1f3-2776-4ace-b372-0a76a9cbed6b
+TTGTTGCCTTCGTTCAGTTACGTATTGCTACTTACTTTGTCGCTCTATCTTCGGCGTCTGCTTGGGTGTTTAACCTTACTAAACATTAGTTAAATCATGGCTTTGCCATTTATACTTACACCCGCCCATAGATTTTTGCGAAATCTTTGCAGCCAAATTCTACCCTTCGATTATCACTTTTAGGCCACTGGAGGTGCACTGTGAGTGCAGGCGTGATAACCGGCGTATTGCTGGTGTTTTATTGCAGGTTATCTGGTTTATGCCTGATCAATGCGGAGGCGTTCTGATGGCTGCGCAAAGGGTTCTTACTGATCGCCACGTTTACTGGTGTTAATGGTGCTGGCGCGTCTTTAGGCAGCGGGCTGGCGCAGCTGATTAATGACATTCCTCTTCGGTACAACGGGCGTTGAAGGCGCGTACTTTTCGCGCACTTGGCGTCTCGACCGTGAGATGAACTGGAAGCAATATCTTTGTGCCATTCTCGGCCTGAACATGCTGGGGCTGGCGGTGCTGTTTTATGTTGCTCGGTCAGCACTATCTGCCGCTTAATCCACAGCAGTTGCCAGGGCTGTCGTGGGATCTGGCGCTGAATACCGCCGTCGGCTTTGTCACCAATACCAACTGGCAATCTTATAGCGGTGAAACCACGTTGAGCTATTTCAATGAATAGCGGGCTTAACGATTTTAAAACTTTCTTTGCCGCCAGCGGGTGCGGTGATTTTGCCCTCATCGTGCGTTTACCCGCCAGAGCATGAGCACGCTCGGGAATGCCTGGGTCGTCTGCTACGCATCGTTATGGTGCCTGAATTCCCTGTGGCGTTGTTGATTGCACTATTTTTGTTCAACAAGGTGCGCTTTACAAAACTTTCTGCCTTATCAGGCTGTGAATACCATTGAAGGCGCAGCAGCTGTTACCCATGGGGCCTGTAGCTTCTCAGGAAGCGATCAGATGCTCAGTACTAACGGCGGTGGCTTCTTTAATGCCAACTCGTCGCATCCGTTTAGAAAACCAACCGCACTGACCAACTTCGCGCAGATCTGGCGATCTTCTTGATCCCAACGGCGCTGTGCTTCCGCCTTTGGTGAAGTGATGGGCGATCGCCGCCAGGCTATGTTGCTATTGGGCGATGTCAGTGATTTTTGTCATCTGCGTAGGCGATAATGGTGATGTGGGCAGAAGTTCAGGGTAATCCTCATCTGCTGGCACTGGGCACGGACAGCAGCATCAATATGGAAGGTAAAAGGCCGTTTCGGCGTGCTGGTCAGTAGCCTGTTTGCGGTCGTGACGACGGCGGCTTCATAATGGCGCGGTGATTGCGATGCATGATTCGTTTACCGCTCTCCGGTGGCATGGTGCCGATGTGGCTGATGCAAATTGGTGAAGTGGTGTTCGGCGGTGTCGGTTCTGGGTCTTTACGGCATGATGCTTCTGTTTGTCCTGCTGGCGGTGTTTATTGCCGGGCTGATGATTGGTCGTACCGGAATATCTGGGTAAAAATCGACGTACGCGAGATGGAAACTGGCTGCACTGGCAATTCTACTGGTTACCCCGACGCTGGTGCTGATGGGCGCAGCGTTGGCGATGATGACCGACGCCGGACGTAACTTTCATGCTCAACCCTGGCCCGCATGGTTTTAGCGAGTGCTGTACGCCGTGTCATCCGCCGCTAACAACCAGCGGCAGCGCCTTTGCCGGATTAAGCGCCAACTCTCCGTTCTGGAACTGTTTACTGGCGTTCTGCATGTTTGTCGGTCGCTTCGGGTGATTATCCCGGTGAGTGAAAACGCGATGCCGGTTCGCTGAGTGGTAAAAGAGCCAAGCCGCCAGCTCCGGCACGCGCTGCCAACGCAGCCGCTGTTTGTTGGCCTGTTAATCGGCACCGTGTTGCTGGTTGGCGCACTGACCTTTATCCCTGCCCTGGCGCTTGGTCGGTGGCGGAATATCTCTCGATGATATTGAGTGAGCACTGAATATGGTCGTAAACAACTGGCGCTATTCGAACCAACACTTGTCGTTCAGGCGCTGAAAGAAGCGGTGAAAAATTAAACCCGCAGGCGCAATGGCGCAATCGGTGATGTTTATCGTCTGGATCGGCAGTCTGCTGACCACCTCGCCAATTAGCATCGCGATGGCAAAGCGAGTGCGATGCCCGGCGCTTTAATCGCTGTTTAGCGCGGCCATTGCTGATTTGGCTATGGATCACCGTACTGTTCATAATTTCGCCGAGGGCGCTGGCAGAAAGGCCGCAGTAAAGCGCAGGCCAACAGTCTGAAAGGGGTAGAAAAAACTGCCTTTGCCCGCAAGCTGCGTGGCCGAAATATGGCGCTGCGGCAGACCAAAGGGATTCCTGCCGACCAACTTCGTAAAAAGGCGATATCGTACTGGTAGAAGCTGGCGATATTATCCCTGCGATGGTGAAGAGTTATTGAAGAGGTGCATCAGTCGATGAAAGCGCGCCATCACCGGGGGAATCGGCACCGGTGATCCGTGGAATCCGGCGGCGATTTTGCCTCCGTCACCGGCGGCACGCGTATTCTTTCTGACTGGCTGGTGTTTGGTGTGGCATTAACCCCGGCTTGAGACATTTCTGGATCGGATAGTCGCGATGGTGGAAGGCGCACAGCGACGCAAAACACGCCGAACAGAAATTGCCCTGACCATTCTGCTGATTGCCCTGACTATCGTCTTTTTTACTGGCAACCGCCACGCGCAGCCCGAAGCCGTTTTCCGCGTGGGGCGGTAATGCAGTCAGCGTAACGGTACTGGTGGCGCTGCTGGTCTGTCTGATCAACCACTATTGGCGGCCTGTTGTCAGCGATCGGCGTCGCCGAGATGAGCGGATGCTGAAGCGCGGAGAAATGTGATTGCCACCAGCGGACGTGCAGTTGAAGCGGCAGGTGACGTTGACGCGTTCTGCTACTGGATAAAACCAGCACCATCACACTCGGCCCGGCAATCCGGGCGTCAGGTTTATCCCGCGCAGGGCGTGGATGAAAAACGCTGGCTGACGCCACTGGCTGGCTTCGCTGGCTGATGAAACGCCGGAAGGCCGCAGTATTGTGATCCTCGCCAAACGGCGTTTTAACCTGCGCGAGCGCGATGTGCAATCGCTCCATGCCACCTTGTACCGTTTACTGCGCAAAGCCGGATGAGCGGGATCAACATCGACAACCACGCTGATCCGTAAAGGTTCTGTCGATGCCATTCGTCGCCATGTTGGGGCTAACGGTGAGTCACTTCCCTACCGATGTTGATCAAAAAGTCGATCAGGTTGCGCGTCAAGGGAGCCGCCGCTGGTGGTGGTGGAAGGTTCTCGTGTGCTGGGCGTTATTGCGCTGAAGATATCGTCAAGGCGGTATTAAGAGCGCTTCGCCCAGCTACGCAAAATAGACATTAAAACAGGTGATGATTACCGGCACGATAACCGTCTGACTGCCGCCGCGATTGCTGCGGAAGCGAGTGTCGATGATTTTCTCGCCAAGCGACACCGGAGGCCAAAGCTGGCATTGATCCGTCAGTAGTAGGCGGAAGGTCGTTTTAGTAGCGATGATAAGGCGACGGCACCAGCGATGCTCCGGCGCTGGCGCAGGCGAAGATCGCCTGGTGGCGATGAACTCCGGCACCAGGCGGCGAAAGGGGCGGGTAATATGGTCGATCTCGACTCTGCCGACCAAGTTGATCGAGGTGGTGCACATTGGCAAACAGATGCTGATGACCCGTGGCTCGCTGACCACCTTCAGCATTGCCAACGATGTGGCAATGCTTCGCCATTATTCCACAACGGCATTCAGCGGCAACGTATCCGCAGTTAAATGCGCTGAACATCATGTGCCGTTCGCCCGACTCCCGCAATCCTCAGTGCGGTGATTTTCAACGCCTTGATTATCGTCTTTTGATTCCCCTGGCGTTAAAGGCGTGAGTTATAAACCGCTTACCGCTTCTGCCATGTTGCGCCGTAACTTATGGATTTACGGTCTGGGCGGGCTGCTGGTGCCGTTTATCGGTATCAAAGTCATTGATTTACTGCTGACCGTTTGCGGTCTGGTGTGAGGTTTACCATGAGTGGATTACGTCCGGCATTATCAACATTTATCTTTCTGTTATTGATTACTGGCGGCGTTTACCGCTATGACCACCGTACTGGGGCAATGGTGGTTTCCCTGGCAGGCCAATGGTTTCGTTGATTCGTGAAGGTGATACGGTGCGCGGTTCGGCATTAATCGGGCAGAATTTACCGGCAACGGCCTATTTTCATGGTCGCCGTCGGCTTACAGCAGCGAAATGCCCTATAATCCACAGGCTTCTGGCAGGAGCAATGGCGGTCAGTAACCTTACAGAGCTGGATAAACTAATAGCCGCACGTTGCTGCATTACGGGCCATAACCCGGATGCCAGCGCGAGCGTTCGATTGAACTGGTGACGGCATCGGCAAGCGGGCTGGACAATATCACCCGCAAGCGGCGGCCTGTAAAATCCCACGCGTGGCGAAAGCGCGTAATCTCGGCGTTGAACATCACGCAACTGATCATAGTAATGTAACAACCGCTGGTGAAATATATCGGCCAGCCGGTTGTCAACATTGTTGAACTCAATCTGGCGCTGGATAAACTTGATGAAGAACTGGCGTGGCGGCGTATTATTCTTTCTTCATATTAATATAACAACGAATTGCCGTCCCGACCCCGATCGTCTGCTGGAACAAACTGCCGCGCCGCATCGGAAGCTGAAAGTTTTCTTCGGTGCCTGTGCGGGCGTCGGAAGACCTGGGCGATGCTGGCAGAAGCCCAGCGACTGCGGAGCGCAAAGGGCTGAATATTGGTTGGCGTGGTAGAAACCCACGGGCGAAAGATACCGCCGCCATGCTGCAGGAAGGCTGGCTGTTCTGCCGTTAAAACGCCAGGCGTACCGTGGGCGGCATATCCAGCGAGGTTTGATCCTCGATGCCGCCCTCGCCCGCCGCCCGGCGCTGATCTTAATGGACGAACTGGCGCACAGTATTGCGCCAGGTTCCGTCATCCCAAACGCTGGCAGGATATCGAGAAGAACTGCTGGAAGCTGGCATTGATGTTTTTCACTACCCGTCGGCGTTCAGCATCTGGAAAGTCACAGATGATGTGGTCAGCGTCACCGGAATTCAGGTACGGAAGCAAATTGCCCGATCTTTTCGATGCCGCCGACGACGTGGTGCTGGTGGACTTGCCCCGGACGATCTGCGCCAGCGGCGGAAAGAAGGCAAAGTCTATATTGCCGGGCAGGCGGAGCGCGCCATTGAACATTTTTTTCCGCAAGGTAATCTGATCGCCCTGCGCGAACTGGCACTGCGCCGTACTGCCGATCGCGTTGATGAGCAAATGCGCGCCTGGCGGGGGCGTCCTGGCGAAGAGAATTAGCCAGCACACGCGCACGACGCGATCCTTTTATGCATCGGCCATAACACCGGCGGCGAAAACTGAGTTAAACGCAAGCAGACGCCGAAGATAGAGCGACAGGCAAACAATACGTAAGCGAAAA
+>56b8515b-fc38-4531-bb1e-757449205298
+ATTGCGCTCGACCGCCGTTCAGTTACGTATTTATTTCTGCCTGTCGCTCCTGCTTCGGCGTCTGCTTGGGTGTTAACCTAATCCCGCCGGTCGAATTTGTTGTAGTGGTTCAGGATACTGATAAATTCCATGCCCCTTTCAACCCATCCGGGTCCCTGAGTAATATACCGCCCCTGCAACGGATCGTAGTACCGGTGACGGTTATAGTACAGCCTGATTCCTCATCATGCTGCTGCCCTGGCAGACAATTTTGGCTGATGATACCACACATGATCACGGGTTCTCCCCTCATTCCAGCTGGATTTGCCCCATTCATCATATTCCGCGCTCCACGCCGTATTTGCCGTCTTCGCTGATAAGCGCCAGCGTGATCCCAGTGGTCGCGAGTGATGAATGAGCTTTTCGCGCCGGTGTGTATTCCGGCTCCACCTGTCTGGCCAGTTGCTCCACCGTCAGCCCGCACTGCGCAAGCCGCGCCCGGCTTTCACTGCTCACGCGGTCTGCCCAGTTTCTTCCTCCAGCCTGTCCAGCAGCCGCACCAAGTTCAGCCGGGAACACCACCACGCCGTGGCCGTTCACCACTCCCTTCCTGCTGGAGCGTCTCTGCCAGGCTGCGCCGCTGCGCTTTTCCGCTCGCCGTTCTCTGTCCTGACCCGGATGGTGGCGTGGGCTCCCCGGCTCATGTATACCGTCTGGATACGTGTGGTGTCCGAATCTGCACCGTCGTCAACCTGTCTCCGTCAACCATACCACGTCACCTCCGGTTTACGCGACAGCGGTATCCACCCGTCAGGTCACGCTCCCGCCGCCCAGACCCGTTTGCCATTCGCCGTCCCAGCGGGTCGTGGGAGTAGCGGCTCTCGTCAGTGGCTCGCCATGCTGTATCCGCGTGTAGAACACCAGGCGGTGCTGGCTGTCGTAATTAGTATTGGTGGGTCCGCTCGTCGTCCGTCCGTATCACACCCGCCGGGATGCGGTCCGTCTTCTCCGTCGGCCTGCCGTATTCATCGTGGCGGTAGAACATAGTGCGCATCCTCCGCGATGCGGTTATCAACCACACTGTGAGATATTGCTGTCCGGGTGCAGCTCAGGTCCGGCAGCCGGTTGCCCGCCAGGTCCGTGGCGCTACGGGATGCGGATGTCAGGTCTGGTGCGAGGTGCGCACTCTCCAGCCTGCCCGTGACGCTGTAGCCGTATTCCCGCGTCTGTCGCCCAGACCGCTGATCGCGCACCAGGTCGCCGTTGTCCTCCACCCGTAGTCACGGTCATATACCAGGCTGTTCAGATTACTGGCTCTGTAACTGGCCTGCGGGGGTGTATGTGCTGATCAGTTCGTATGCGGCATTACTGCCGCCTGCCATGCTGCCGAAGCTGTACCATCTCACGGTGCAGCCTGTCCCGCGTATGCTCGACCGGCGGCGTCGCCCAGCTTCATTCCGCCAGGTAACCGCTGCCATACGTCAGCCTCCACCGGCGGCAGGCTGTCCGGCGTGACGCGGTTTTGCAACCCTGCTCGTTGTATGCGTGTTTCGTCTCATGCTGCCACAGCAGTTCCCCGTCTCCGGGTTCTCCACCGTCTGGCATTCTGCGCCAGTCCAGGCGAAACGCTATCGTCGCCGCCATAGTGGACTGGCAACACGGTGGCCTTCGCTCAATTGGCTGATGTCTGTCAGCCAGCCATGTGCATCGCTCGCTGCCACTGCTCTGCTGGTTCGCCGTTCACCGTGCGGTGGTGATACGGTCCGATTCATCCAGTAGTACCAGAGGATGACAAGTCCTCATCCTCACTCTGGTGGTGAGTTTTCCGGTCAGGTCATAATGATAACGTTGCGTCCGCCCGTCAAAGCCGCTGCTGTACCAGCCGGTCCAGCGCATCGTAACTGAAGACGCTGTGGCTGCCGTTCTCGTTGGTCGGGCTGATGACGTCCAGCGGCATCGACGCCATACTGCGCGTCAGCCCGCCCTGCGTGGTGCTGACCGCCTTTCTACGCATCGTACTGTGTCTCGCTCCGGTTGCCGTCAGAATTTGATAACGGCAGTCAGGTCGCCTGCGGCGGTGTATTCATACCGCGTTTCACGGCCCTGTGCGTCTTTCACCGGAGTTAATGGCCACGGTTGTCATAGCGGCAGTAAAGGCTGATGCCTTCCTCGGTGGACCGCCGAATCCGTCTGGCCGAAACGGTCATTATTCATAACGGGTCTGGTAGCCCGAGCAGTCGGTGAACGCCAGCGCTGCCCGTAAGCAGCTCCAGGTCATCTACCGGTGCTGCTTACGTCCGCATCCGTTGTCGTCGCCGGTAACTCACTGTGCGCGTCATCGTAGCGGTAAGCGTACTGTCTCCCCGCTGCGCGATGTCTCCGATACCAGCTGCGGTTAATCATATTCCAGCGGCTCTCCAGCCCGTCCGGGACACCACGCCGTCAGCTGGTTCCGTCGTTATAGTAAATTTCGTCCGCCCGTCGGTGTGGTGATGTCCGTGGTATCGCCGGACGCATTCAGACCATCACTCTGTCCTCCGTCCCGCCGCGTCCGTCTGCGCCCGTGAGCCTTCCTGCCGCGTCATACCCGCTGCGCGTGACGCTGCCGATCCCGCCAGTTCTCTTTTCACCACCGTTTCAGCCCGGCCCCGCCTTCTGTATGCAGCACCTCACGCCGGTTCAGGCTGTCATTGACGGTGATGCGGTCCTGCTCATAAAGATGGCGGTAAACTAACCCTGCCGGGTTCCAGTTGCTCCACCCGCCCCGTATCGTCGTAGCGGTAGCGCATCTCAGCCCGCGTAACGGTGCGCCACCATCCCAACCCGGGTGCTGCGCGTCATGCGAAGCGCGCACCTGCCGTACTGCGGTCATATACCGCCAGCAGTTCCACCGGCTTCCGTATGCGTGGCACCGCACCAGTGGCGCAGCGGGCAGGCTCTCCGGGTATGCCGGGTCGTGCATCAGCCACACCGCCGAAGGCGGATACCTAATCGGGGCCGTATTCGGTACCGGGCGGTGTCGGGGAACGCTGAGGTTGAGAGAGGGCGGAACTGTCAGAAGAAGATAGCCGAGGTGCAGGCCTCTTCCGCACGCTGCGCCTGCGTGGTCAGCACCAGACCGGAACTCCCGCCCGGCACCGTCCGTCACGCCGGTGATTTCTGGCAGGTCACGGCGACTCACGCCGGTACGATAAGCGTCCGCCCGAAGCGGTCCGCCATCCCAGTAAGCGCAGTACGGCGGCAGCGGCGCTGGCAGTACGATATCAGCACCCGGCACCCGCTCAGACCACCCCGGTATCACCACGGCCCCTGTGCGCTGTTGGTCGCCGGGTAAGATGCGGAACCGGATATCCGGCAGCGCCCACAACCGCGCCAGCGTATGGCCAATCCGGCTGTATGCCTTACCACCGCGCACCAGCCACATTGACTCACTGCGGCTGTACACCGCGCCTCCCGGCAACAGCGGCTCAAGTGAATGCTCCGCCCGCCGTTGTCGTTGAGTATCAGTCCGTCATCACGTAGCTGTGGCGGATATCGAAAGGCGCTTTCCAGCCGGGGCCGAAAACGCCCACCAGTGCAGGCGTCTTCGTCAGTGGCGCTGCTGTAGGTGCGGGAGAATGAACGGCAGCGGGCCGGGCAGCGCAAGTCCAGTCTCGCCGGGCAGCACCTTCGCCCCCAGCAGCCGGTTACCAGGTTGCTTGAAGTCATCCCGCCGGACACACCGAGCACGCCACGCCGGTGGGCGCGCCAGATCTTGAACCCTGGACAATGGGACCGCCATACTGAGTCATATCTCCCTGACGCCGCTGGTTTTCCGCTCATATAAAGTGCCCTTTTAGTTGTTCATATCCTGTGTTAGCAACAAAAAAAAATAAAATGACACACAAGACCAGCTAATGTGTTTATATATTTTCACATAAACTTATTTGTTCTCAATCAGCAACAGCTTCATTGGCCACAGGTCACTCAATATTTTATTCGAAGCTAACATTTTTTAGCACAGATGAATTCATCATCCAACAAATTCACTATGGATAATATCCATTCAACGCATATGATTTGTGATTTTTATTGAAGGTCTGAGTTATTTTTGTGAATATATTTAAAATCAATAAACTCCACGATTCAGATTAATATCAGCAATGAAGATGAAAATCACCAATTCAATAACATCATCAATAGAAACTTATATTGTAGAATTAATTTAAACAAGGCGTTCCATTCAACCAGAACGCCCCTTATTTACTCATCACCCCACCGACTGCTTACGAACAGCGCCTTACCGTAACAATCGCGCATGGCCAGCCGCCGAAAGCGACAGCAGCAGCGCTCGCTGCACGGCAATTTCAATCCACAATCATGGTCTTAAACCACGGAAAATCAAACACTTTCGCCTGCAACACTGCCAGCGCCGTTTCCGCACCAATTGCGGCCACCAGGCCGAAACAAACCAAGCATGGCAGACTCACACCGCAACGTGGTACTTGCGGCGTTTTTCCCCGCGCACCGAGTGTGCGCCACACCACCAGCTCCTGATGACGCTGACGCATTCCCACCTGCACCTGTGCCAGCAGCAGCAACATACCGCCAGGCGGTGACCAGTACCACCATCACTTCCAGCGCCCGACTTACCTGCTCCAGCACCCTGACCATTTTCGTTTTAAAATCCTTAATATCTAACAGGCTAATGGTCGGGAACTGGCGGTTGAGTTGTGTCAACATGCCGTTGCCATTCTCCCAGCGGAAACTGGTAAAGCCAGCTCTGCGGTTGCCGATCTAATGCCTTCAGGAAAATAAAATAGAAATTAGGCCGCAGACTTTTTTCCCAGTCCACTTTGCGCAGGCTGGTCACTTTAGCGCGGAACTCCTGGGTATCGCCCATAAAGTCACGGTATCACCGAGGGCAACGTTTAAGCGTTTCGCTATTATCTTCCCGTCGGCTTCTTCATCGGCTTTTGGCGGCCAGTTACCGGCGACAATCGGATTATGATCCGGGCCGCGTATTTTGCCAGGTAGATTGAGTTCGCGGTTAAAGCGCCTCATCTTCATTACCTTCTGTCGGCTTATCGTTAATCGCCGTCAGCCGCGCCCACCACCACCGGATAAAGAAACGATTCCGGGATTCATCCTGAGTGTTCGCGAGGAACGCTTTTAGCAGTGCTACTGTTCTGTGGCGATGTGGGTAAAAAGTAGTTCGGGCTTTCTGGGTAGCTGCTGCTGCCAGCCGGTCGAGCAGACGCCACGCAACACCAGCAGCGTAGTGCCAGCGGCACAAAGGAGAGCAGCAAAATGCCGAAAGCTGACAACGTTATTACGGCTGACGCCAACAGGCAGTAACCGCCAGGCGAGGCAACGATTTCAGCGTCATGCGGCAGAGAATGCATTCAGCATCCAGCCAGCACACCGCCAGCCAGTACTTGCCGCGCGCCCGCCAGCACCGCCCAGCAGCATGCCTTACCCATTAATCCGGCGAGCAGCAGCACATTCACCACTGACAATCGGCAGATAAAACTTCAAGCGGCCGGACGTTTCGCTACCACATCATTACGTAATGCGCGCTAAAGGGCTGCGTTGCCAGCAACAAGCGATATGGTCGTAGCCCCACCGGCGAGATGACCGTCATGGTGCCAAGCCACAAGCGCGGCCAGAGGCTGGCTGGCGGTAGTGCGAAAGCAGAGGTTGGCTTTAAACAGACGCCGAAGATGGGAACGCA
+>4b09492e-1e14-4c2a-9719-4cd4f1434703
+TTGTTGTAGCGTTCAGTTACGTATTATTGCTCTGTTGGTGCTGATATTGCGGCGTCTGCTTGGGTGTAACCTGCTTCTTTCACGGCAATTAACTGTCACGGCTGTCGTATGCGCAGGTACTGACTCGCTTCTCGCGGTACTGCGCCGTCACCTGACCAAAACGGTCATGATGCATGGCAGGTTATAACTGGAACAGTCAGTGAAGCTCAACAGCAATACCTTAACGGCTCCACGTCATAGCTGGTTTTCCGGCTGCCAGTGGCATCTTCCGTTGCGCAGGGTAAGTCACTGTGTGGATTATCACCAACGGTAGCGGGTGATATCGCCGTCAGGGGCGGTTTCCTGAATCGAACGGCCCCCATTCATCATATTCGGCGTATTTCCAGCCCGTCAGGCCCGGTGGCTGACGTTAACTGGCTGTGGTGGTTTATAATCGCCGCGATGCCCTGCCATCCGGCGCGTGGTGATGCGCGTGATGAGGCCCGTCACACATCGGACTCGCATTCTGTTATCTGCCTGCGGCATCCGTCTGTGTGCCTGTTTACCCACCGCGTCAAACTGACTCTGCGTGACGCTGCCGTCCACGCTGTGTTCCTTTTTCACCGCCCTTCAGCCCGCCTTCACCCTGCGTGTGCAGGACTACGGCAGTTTCAAGGCTGTCGGTGATGGTGATGCGGTCCTTCATACTGATACGTGTAACTTAAGCCTGCAGGTTTAGCTGTTCTGTCACCCGCCCGTCGCTGTCGTAACGGTAACAGATTTCCGGTCGGCCCGTGTGACGGTACGCCACCATCCGGCCCCAGTATTTTATCATCGTAGTAAAGCTGCGCACCTGTGTATTGCTGCGGTCATACGCCGCCGGTTCGCCGCAGAGGCGTCAGCCATAGCGCACCAGCGGCGCGACAGGTAAATTCTCCGGGTATTTGTTGTTATTCGGGTCGTGCGTCAGCCACGGCAGACAGACGGATGCCGTTGTCGGCCATATTCAGTGTAACCCGGCAGGGTATCGGGAAAAGCGGACGGTTCCGTCCGCCGGAAATGGCCTGCTGCCGGGCTTCTTCTGCCCGCTGCGCCTGCGTGGTCGAACAGCCGGAAGTGACGCCCGGCACCATCCGTCACGCCGGTGATTTCGCCGCTGAATTCTGGCGGCTTCGCGGTGGAACGTCTGTAATGCGCCAAGCGGTCCACCAGCCCGGTCAGTACCCGGTACGGCGGCAGCGGCGCAGGCGGCACCTCATCGCTTCCGGCACCGCTCACGCAGCCGAGCAGCCACCACGGCCCTGCGGACTGTTTGTCGCCAGATAACGATGCGGACTTAAGCGGGTTCTTCCGGCAGCGCCTAGCAGAAGTGCGGCCAGCCGGTGACCTTCATCAGTTTCGCCACGCCGCGCGCATAATACAGTGACTCGCTGCGGCAACCGTCCTCACCGGAAACAGGTGCTCAAATGCAGGCTTCTGCCGCCGTTATCACTGAGTATCAGTGTGTTATCCTTGCAACTGTAAGCGGATATCCGCAGGCATTTCCAGCCGGGGCTGAGGCTCCCCACCGGCGCGGGCGTTTTGTCCGGTAACTGCTGTAGGTGCGGGAGAGAATGAAAGACGGCAGCAGGCCGGGGCAGGGGGCGTCAGTTTCACCAGGAAGGACCTTTACCGAGCAGCGGATTGACCGGATGGCCGGACGTCACCCGCGGGGCACCGAACAGGCCACGCCGGTGGGGCACCGATGCGTACCCCGGCTGAACCCTGGACAATGCTGCCGCCATACCGTCATGTCGCCCTGACGCCGCCGGTTTTCCGCTCATCTGCTCATCCTTGTTTTATCGGGTTATTTGTCTGCTGACAGGCGAAACCCTACAGATTTATAAGAAACTAAGTGAGATATCTGTCAGATAAGAACAATTAGGAAAATATTTATATATATTTCCTTGAATATATGTTTCGATTGGTATAACGATGTCACAAATATTCCTCTGAACATCTTCCTGTTAAAAAACCGCCAGCGTTTCCCGCTGGCGGTTTCAATAATATTCAAACTCAGCAATCAATAAAATCACCAGTTGCCTTTTCGGCCTGATCCATCCGCACCGGTTTATCATGGTTTCGATGGAGCGCGATGCAAGGTAGCTGTAAAGCGGGCGCGGTCTTTCCAGAAAAGCATAAGAAAAGAGCCAGCGCCAGAACGCCCGCTGCAACCGCATAAGTACAGCGTAAAGATAAAGCCATGCAGGATATTCTCTGTAGAGTTCCATACTTTTCTCCCCTTTTATCTACCCGATTATGAATGGCACCGGAAAAATGAATTGTTTATCTGATGAAAATAGTACCGCCAGCACGTAGTTTTACTACTCATCCGACCACTTATTTTGCTTATTGATGGTTTATTTACATTCATCCGCAATTAAGTTACACAAAGTTAAATTAATACTAAACATTAGTTAAATCATGGCTTTTGCCATTTTTATACTTTACACCCCGCCCGCAGATTTTGCGAAATCTTTGCAGCCAGGTCTACCTTCGGTATCACTTTTAGGCCACTGGAGGTGCACTGTGAGTGCAGGCGTGATAACCGGCATTATTGCTGGTGTTTTATTACTGGGTTATCTGGTTTGTAACCTGATCCAAATGCGGAGCGTTCTGATGGCTGCGCAAAGGGTTCTTACTGATCGCCACGTTTTTACTGGTGTTATGGGTGCTGGCGCGTCCTTTAGGCAGCGGGCTGGCGCAGCTGATTAATGACATTCCCTTCCCGGTACAACGGGCGTTGAGCGCGTACTTTTTCCTTTGCCCAGCGTCTCTGACCGTGAGAGATGAACTGGAAGCAATATCTTTGTGCCATTCTCGGCCTGAACATGCTGGGGCTGGCGGTGCTGTTTTATGTTATCAGTCAGCACTATCTGCCGCCAATCCACAGCAGTTGCCAGGGCTGTCATTGGGATCTGGCGCTGAATACCGTCAGCTTTGTCACCAATACCAACTGGCAATCTTATAGCGGTGAAACCACGTTGACTTCTTCAGCCAGATGGCGGGCTTAACGGTGCAAACTTTCTTTCTGCCGCCAGCGGGATTGCGGTGATTTTGCCTCATCCGTGCAGTTTACCCGCCAGGTATGAGCACGCTCAAGAATGCCTGGGTCGATCTGCTACGCATCACGTTATGATTGCTAGTCCTGTGGCGTTGTTGATTGCGCTGTTTTTATTCAGCAAGGTGCGCTGCAAACTTTCTGCCTTATCGGGCTGTGAATACCGTTGAAGAGGCGCAACAGCTGTTACCATGGGGCCTGCTGCTTCTCAGGAAGCAGTCAAGATGCTCAGTACTAGCGAAGGCGGTGGCCTAACAATGCCAGCTCAAAATCGCATCCGTTTGAAAACAACCGCGCGGCAACTTCGTGCAGATGCTGGCGATCTTCTTGATCCCAACGGCGCTGGTAATACTTTGCCTTTGGTGAAGTGATGGGCGATCGCCGCCGAGAGCATGTTGCTTATGTGGGCGATGTCGGTAATTTTTTGTGTCATCTCTGCGTAGGCGTGGTGATGTGGGCAGAAGTTCAGGGTAATCCTCATCTGCTGGCACTGGGCACGGACGCTTGTATCAATATGGAAGGTAAAGAGAGCCGTTTCGGCGTGCTGGTCAGTAACCTGTTTGCGGTCGACGGCTGACGGCTTCCTGTGTTGCAGTGATTACGCGATGCATGATTCGTTTACCGCTCTCGGTGGCATGGTGCCGATGTGGCTGATGCTAAATTGGTGGTGGTAATTTCGGCGGTGTCGGTTCTGGTCTTTGGCATGATGCTGTTTGTCCTGCTGGCGGTGTTTTGTGCCGGGCTGATGATTGGGGTCGTACACCGGAATATCTGGGTAAAAAAATCGACGTACGCGAGATGAAGCTGACTGCGCACAGCAGTCTGGTTACCCCGACGCTGGTGCTGATGGGCGCGGCGTTGTGATATTGACCGACGCCGGACGTAGCGCCATGCTCAACCCCTGGCCCGCATGGTTTTAGCGAAGTGCTGCTACGCCATGTCATCACCGCCGCTAACAACAACGGCAGCGCCTTTGCCAGTTCGCGCCAACTCCGTTCTGGAACTGTTTACTGGCGTTCTGCATGTTTTGTCGGTCCTTCGGGGTGATTATCCCGGTGATGGCAGTGCCGGTTCGCTGGTGATAAAAAGAGCCAAACCGCCAGCTCGGCACGCTGCCAGCACACGGCCCGCTGTTTGTTGGCCTGTTAATCGCTGCTGTGTTGCTGGTTGGCACTGAAGCCTTTATCTGCTGGCGGTCAGTGGCGGGAATATCTCTCCTGATGATGTTGGTGAGCACTGGATATGAGTCGTAAACAAACTTCCGGCTATTCAAGACCAACACTTGTCGTTCAGGCGCTGAAAGAAGCGGTGAAAAATTAAACCCGCAGGCGCAATGGCGCAATCCGGTGATGTTATCGTCTGGATCGGCAGTCTGCTGACCACCTGTATTAGCATCGCGATGGCAAAAGCAGGTGCGATGCCCGGCAATGCTGTTTAGCGCGGCCATTAGCGGTTGGCTGTGGGATCACCGTACTGTTCCTTCAATTTCGCCGAGGCGCTGGCAGAAGGCCGCAGTAAGCCTGGGTAACAGTCTGAAGGTGAAAAAACTGCGCTTTGCCCACCAAGCTGCGTGAGCCGAAATATGGCGCTGCGGCAGACCAAAGTTCCTGCGACCAACTTCGTAAAGGCGATATCATGCTGGTAGAAGCTGGCGATATTATCCCCTGCGATGGTGAAGTTATTGAAGGAAATTGCATCGGTCGATAAACTATGCATCACTGCGAGAATCGGCACCGGTGATCCGTGAATCCGGCGGCGTTTTGCCTCGATCACCGGCGGCGCATATTCTTTCTGACTGGCTGGTGATTGGGTGTAGCGTTAACTTGGCAGACATTTCTGGATCGGATGATCGCGATGGTGGAAAGGCGCACAGCGGCGCAAAACGCCGAACGAAATTGCCCTGACCATTCTGCTGATTGCCCTGACTATCGTCACTGCTGGCAACCGCCGCACGCTGTAACCGTTTTCGCGTAGGGCGGTAATGCAGTCAGCGTAACGGTACTGGTGGCGCTGCTGGTCTGTCTGATCCCAAAAGCCACTATTGGCGGCCTGTTGTCAGCAGTCGTCGCCGGGATGAGCCGGATGCTAGGCGCCGAATGTGATTGCCACCAGCGGACGATGCAGTTGAAGCGGCAGGTGACGTTGACGTTCTGCTACTGGATAAAACCAGCACCATCACACTCGGTAACCGTCAGGCGTCGAGTTTATCCCACGCAGAGGGCGTGGATGAAAAAACGCTGGCTGACGCCGCTGGCAGCTTCGCTGGCTGATGAAACGCGGAAGGCCGCAGTATTGATCCTCGCCAAGCAGCGTTTTAACCTGCGCGAGCGCGATGTGCAGTCATCATGCCACCCTTTGTACCGTTTGCAAGCCGGATGAAGCCAGGATCAGCATCGACAACCGCAGGTTAAACACCCAAGCAGACGCCGAAGATGGGGAAACCGTA
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/ecoli_canu_contigs.fa	Fri Jun 08 04:43:41 2018 -0400
@@ -0,0 +1,162 @@
+>tig00000001 len=16089 reads=72 covStat=-49.03 gappedBases=no class=contig suggestRepeat=no suggestCircular=no
+GGTTGAACCGTGAAGGTGATCAATAAAAATGATCAATCTTAATTTATTTAATGATGAGCTTTTTACTCAGTAATATAAAATATTGAATTGTTATTTTGTG
+TGTTGTTTTAAGATAAAAGCCGCTTTATTAATACGGCTTTAATTAATAAAAAGGCAGGCTGTATTAAAATTAATATTCAAAGCATAAACCGATGCCAATA
+CCGGTTTCAGTAATGAAATGGCGTGGGCGGGCGGGATCCTGTTCCAGTTTTTGTCGCAGATGTCCCATATAAATACGCAAATGGTGACTGTGTTCGACCG
+CGTTTGGCCCCCACCTGGTTAAGGAGCTGGCGCTGGGTGAGTACTTTCCGGCATTGTTGAGCAGCACCGCCAGCAGGCGGAACTCAATTGGTGTGAGATG
+CACCTCTTCTCACCCCGGTGAATCACGCGGGCGGCTAAATCGACGGTAACATCGGAAAATTTTACCAGCGGATCGGGCGCGGTGGTGGCAGAGTGGCGGC
+GTAATGCGACGCGCAGACGGGCCTGCAATTCGCCAATGCCAAACGGCTTACTCAGATAATCATCCGCTCCGGCATCCAGCGCGGCGATTTTGTCGCTCTT
+CTGCTGCGTGCGGAAAGCACAATCACCGGCACCGCGCTCCACTGGCGCAGGTCGCGGATAAACTCAATCCCATCACCATCGGGCAGGCCGAGATCGAGAA
+TAATCAAATCTGGCTTACGGGTTGCCGCTTCCAGCAAGCCGCGTTGCAGCGTTTCGGCCTCAAAGACGCGCATCCGTCGCCCTCCAGCGCCGTGCGCAGA
+AAGCGACGAATAGCCTGTTCATCTTCAACAATCAGAACGTTTGTCACATATCCTCATGAAATTCTTCAGTTCAGGGGCAGTTTGCTGGGGAAGTGTAACA
+CGAAAACAGGCACCACCTTCCGGTCGGTTGAACGCGGTAATAGTGCCCCCGTGTACATCCACTATCGCCCGACAAATTGCCAGTCCAAGCCCTACCCCCG
+TACTGCCGACTCTTTTATTCCCGCGAGCAAACTTATCAAATATCGTCTGCTCCTGGCCTGGCGGAAGACCGGGGCCGTTATCCCAGACATCCAGTTGTAG
+ATTTTCGCCCTCAACGTGGGCATCGATACCAATTTCGGCCTGCGCACCCGCATATTTCACCGCGTTCTCCAGCAGATTAATCAGCACCCGTTCAAAGAGA
+GGCCCGTCAACGTGGATTAAGGTCAGCGGTTCTGGCAGAGAAAGATTGATGGGCGACGATAAACCCGGTTCCAGCATTTGCAGCGCTGCCGACTACTTCT
+TCCAGCGTTAACCACTCTTTCTTCAAATTAAAGCCGCCGGACTGAATTCGCGCCATATCCAGTAGATTATTCACCAGTCGGGTAGTGTTCAGCATGCTGA
+CGGATCTCGCTGGCCTGGCGGGCGTGGGTGATCCTCGCTTGCCAGATCGAGCGTTAAGATTTCTGCCTGACCAAACAGCACCGTAAGCGGCGTGCGTAAA
+TCATGCGAAAGCGCCGCCAGCAGGGCGTTGCGGATCTGTTCACGTTCGCTTGCCATCCGCGCCTGTTCTTCGCTGGCGGTTAGCGTCAGCCGCTCAGGGC
+ATTGGCGACTAACAGCGTAACGTCTCCAGCAGGCGCTGCTGTTCCGGGATCATCAACTGGCGCAGATTCCCGGCTCCACCACCACCAGCCCGTAGGTTTT
+CGCCGCTTTTAGCGGCAAAATCTGGTACGGTACACCGGGTAACGTGTCGGTGCCCGCGCCCGCAGGCAGGCCTTTATCAAAACTCCACTGCGCGATGGCA
+TCGTCCCACGGCGTCATTCCTTGCGGATGTGTTAACGGCTGCAATTTACCGTTGTCATCGGGCAACAACACCTGACTGCGGGCATGAAACGTGGAGGCAA
+TAAATTGTTCGCTGGTGGCAGCGATATCCTGCGGACTGCGGCCCACCGCCAGAGCTTTCGACATTTCATATAAGTGCCGTGTGCGTTGCTCGCGGTAACG
+GGCTACCCGCGCCTGATAACGCACGCCAGCAGTAAGGTTCCCGATCACCAGCCCGACGGTTAACATCACCGCGAAGGTCAGCAGATATTGCACATCAGAG
+ACGGCGAGCGTGCCGCGTGGGGCGATAAAAAGAGATCGAAACTCACTACATTAATGACGGTGGCAACCACTGAAGGCCAGCGTCCATAAAATAGCGCCAC
+CACCACCACGCCAAGCAGATACAGCATCACCAGGTTGGCGGCATCAAACGCCATCAGCCACTGCATGGCAATTAAGGTGATAACGGCGCATAACGCGGCG
+GCAACCACGCATCCCTGAATTTGTACACGCCACTTGTCTTTAAAAGAGCGGTTATCCGGCGCGTTGTTAATCGTGCGGGCGGGTGGTTCATCAAGCGCGA
+CCAGCACCTGATCGAGATCGGGGCGATGCGCGCCAGTCGGTCAGCAAACGTTTCCCGACGCCACCAGCGGCGCGAGGCCGGGCGACCGAGAATAATCTTG
+CCGAGATTATGTTCACGGGCATAACGCACTACCGCTTTCTCTTCCGCTGGATCAGAAAGTGTTGCCGTCTCCGCGCCCAGTTCCTGCGCCAGACGTAAGG
+CGCTGAGAATTGCCCGACGTTTTTTCCGGTAAGCGGTGCAGGGCAGGGGTTTCAACATACACCGCGTGCCAGACGCTACCCAGCCGTGACGCCAGCCGCG
+CCGCTGCGCGGACCAGTTTTCGCTGCCGGTGTTATGGCCGATGCATAAAAGGATCGCGTCGCGCGTGTGCCACACTTTCTCTTCGCCAGGATGCCCCGCC
+AGGCGCGCATTTGCTCATCAACGCGATCGGCAGTACGGCGCAGTGCCAGTTCGCGCAGGGCGATCAGATTACCTTTGCGGAAAAATGTTCAATGGCGCGC
+TCCGCCTGCCCGGCAATATAGACTTTGCCTTCTTTCAGCCGCTGGCGCAGATCGTCCGGGGCAAGTCCACCAGCACCACGTCGTCGGCGGCATCGAAAAG
+GATCGGGCACGGTTTCCCGTACCTGAATTCCGGTGACGCCGCTGACCACATCATTCAGACTTTCCAGATGCTGAACGTTGACGGTAGTGAAAACATCAAT
+GCCAGCTTCCAGCAGTTCTTCGATATCCTGCCAGCGTTTGGGATGACGGGAACCTGGCGCATTACTGTGCGCCAGTTCGTCCATTAAGATCAGCGCCGGG
+CGGCGGGCGAGGGCGGCATCGAGATCAAACTCGCTGATATGCCGCCCACGGTACGCCTGGCGTTTTAACGGCAGAACAGCCAGCCCTTCCAGCATGGCGG
+CGGTATCTTTTCGCCCGTGGGTTTCTACCACGCCAACCACAATATCCAGCCCTTGCGCCCGCAGTCGCTGGGCTTCTGCCAGCATCGCCCAGGTCTTCCC
+GACGCCTGCACAGGCACCGAAGAAAACTTTCAGCTTCCCCGATGCGGCGCGGCAGTTTGTTCCAGCAGACGATCGGGGTCGGGACGTAAGGGTTCGTTAT
+TCATCAAGTTTATCCAGCGCCAGATTGAGTTCAACAATGTTGACAACCGGCTGGCCGATATATTTCACCAGCGGTTGTTGGCTGTATTTTGCGATCAGTT
+GCGTGAGCTGTTCAACGCTGAGATTACGCGCTTTCGCCACGCGTGGGATTTGCCAGGCCGCCGCTTGCGGGTGATATTATTGTCCAGCCCGCTTGCCGAT
+GCCGTCACCAGTTCAACCGGAACGCTCGCGCTGGCATCCGGGTTAGCGGCCCGTAATGCAGCAACGCGTGCGGCTATTAGTTTATCCAGCTCAGGGTTAC
+TGACCGCCAGATTGCTCCCGCCAGAAGCCTGTGGATTATAGGGCATTTCTGCCGTTGCCGACGGGCGACCATGAAAATAGCCGTTGCCGGTAAAATTCTG
+CCCGATTAATGCCGAACCGCGCACCGTATCACCTTCACGAATCAACGAACCATTGGCCTGCCAGGAAACCACCATTGCCCCAGTACGGTGGTCAGCAGCG
+GGTAAACGCCGCCAGTAATCAATAACAGAAAGATAAATGTTGATAATGCCGGACGTAATCCACTCATGGTAAACCTCACACCAGACCGCAAACGGTCAGC
+AGTAAATCAATGACTTTGATACCGATAAACGGCACCAGCAGCCCACCCAGACCGTAAATCCATAAGTTACGGCGCAACATGGCAGAAGCGGTAAGCGGTT
+TATAACTCACGCCTTTTAACGCCAGGGGAATCAAAGACGATAATCAAGGCGTTGAAAATCACCGCACTGAGGATTGCGGAGTCGGGCGAATGCAGGCACA
+TGATGTTCAGCGCATTTAACTGCGGATACGTTGCCGCGAATGCCGCCGGAATAATGGCGAAGTATTTCGCCACATCGTTGGCAATGCTGAAGGTGGTCAG
+CGAGCCACGGGTCATCAGCATCTGTTTGCCAATGTGCACCACCTCGATCAACTTGGTCGGGTTAGAGTCGAGATCGACCATATTGCCCGCCTCTTTCGCC
+GCCTGGGTGCCGGAGTTCATCGCCACCGCGACATCTGCCTGCGCCAGCGCCGGAGCATCGTTGGTGCCGTCGCCGGTCATCGCTACCAAACGACCTTCCG
+CCTGATACTGACGGATCAATGCCAGCTTGGCCTCCGGTGTCGCTTCGGCGAGAAAATCATCGACACCCGCTTCCGCAGCAATCGCGGCGGCAGTCAGACG
+GTTATCGCCGGTAATCATCACCGTTTTAATGCCCATTTTGCGCAGCTGGGCGAAGCGCTCTTTAATACCGCCTTTGACGATATCTTTCAGCGCAATAACG
+CCCAGCACACGAGAACCTTCCACCACCACCAGCGGCGTGGCTCCCTGACGCGCAACCTGATCGACTTTTTGATCAACATCGGTAGGGAAGTGACCACCGT
+TAGCCTCAACATGGCGACGAATGGCATCGACAGAACCTTTACGGATCATGCGGTTGTCGATGTTGATCCCGCTCATCCGGCTTTGCGCAGTAAACGGTAC
+AAAGGTGGCATGGAGCGACTGCACATCGCGCTCGCGCAGGTTAAAACGCTGCTTGGCGAGGATCACAATACTGCGGCCTTCCGGCGTTTCATCAGCCAGC
+GAAGCCAGTTGTGCGGCGTCAGCCAGCGTTTTCATCCACGCCCTGCGCGGGGATAAACTCCGACGCCTGACGGTTACCGAGTGTGATGGTGCCGGTTTTA
+TCCAGTAGCAGAACGTCAACGTCACCTGCCGCTTCAACTGCACGTCCGCTGGTGGCAATCACATTCGCGCCTAGCATCCGGCTCATCCCGGCGACGCCGA
+TCGCTGACAACAGGCCGCCAATAGTGGTTGGGATCAGACAGACCAGCAGCGCCACCAGTACCGTTACGCTGACTGCATTACCGCCCCACGCGGAAAACGG
+CCACAGCGTGGCGGTTGCCAGTAAAAGACGATAGTCAGGGCAATCAGCAGAATGGTCAGGGCAATTTCGTTCGGCGTTTTGCGTCGCTGTGCGCCTTCCA
+CCATCGCGATCATCCGATCCAGAAATGTCTCGCCGGGGTTAACGCTACACTCAATCACCAGCCAGTCAGAAAGAATACGCGTGCCGCCGGTGACGGAGGC
+AAAATCGCCGCCGGATTCACGGATCACCGGTGCCGATTCCCCGGTGATGGCGCTTTCATCGACCGATGCACCCCTTCAATAACTTCACCATCGCAGGGGA
+TAATATCGCCAGCTTCTACCAGTACGATATCGCCTTTACGAAGTTGGTCGGCAGGAACTTTGTCCGCCGCAGCGCCATATTTCGGCTCACGCAGCTTGCG
+GGCAAAGGCAGTTTTTCACCCTTTCAGACTGTTGGCCTGCGCTTTACTGCGGCCTTCTGCCAGCGCCTCGGCGAAATTAGCGAACAGTACGGTGATCCAC
+AGCCAACCGCTAATGGCCGCGCTAAACAGCGCATTGCCGGGCATCGCACCGCTTGCCATCGCGATGCTAATACAGGTGGTCAGCAGACTGCCGATCCAGA
+CGATAAACATCACCGGATTGCGCCATTGCGCCTGCGGGTTTAATTTTTCACCGCTTCTTTCAGCGCCTGAACGACAAGTGTTGGTTCGAATAGCGCCAGT
+TGTTTACGACTCATATTCAGTGCTCACTCAATATCATCAGGAGAGATATTCCGCCACCGGACCAAGCGCCAGGGCAGGGATAAAGGTCAGTGCGCCAACC
+AGCAACACGGTGCCGATTAACAGGCCAACAAACAGCGGGCCGTGCGTTGGCAGCGTGCCGGAGCTGGCGGCTTGGCTCTTTTACTCACCAGCGAACCGGC
+AATTGCCATCACCGGGATAATCACCCCGAAGCGACCGACAAACATGCAGAACGCCAGTAAACAGTTCCAGAACGGAGAGTTGGCGCTTAATCCGGCAAAG
+GCGCTGCCGTTGTTGTTAGCGGCGGATGACACGGCGTACAGCACTTCGCTAAAACCATGCGGGCCAGGGTTGAGCATGGCGCTACGTCCGGCGTCGGTCA
+TCATCGCCAACGCCGCGCCCATCAGCACCAGCGTCGGGGTAACCAGAATTGCCAGTGCAGTCAGTTTCATCTCGCGTACGTCGATTTTTTACCCAGATAT
+TCCGGTGTACGACCAATCATCAGCCCGGCAATAAACACCGCCAGCAGGACAAACAGCATCATGCCGTAAAGACCAGAACCGACACCGCCGAACACCACTT
+CACCAATTTGCATCAGCCACATCGGCACCATGCCACCGAGAGCGGTAAACGAATCATGCATCGCAATCACCGCGCCACAGGAAGCCGCCGTCGTCACGAC
+CGCAAACAGGCTACTGACCAGCACGCCGAAACGGCTCTCTTTACCTTCCATATTGATGCTGCTGTCCGTGCCCAGTGCCAGCAGATGAGGATTACCCTGA
+ACTTCTGCCCACATCACCACGCCTACGCAGATGACAAAATCACTGACATCGCCCACAGCAACATGCGCCCCTGGCGGCGATCGCCCATCACTTCACCAAA
+GGCAAAGCACAGCGCCGTTGGGATCAAGAAGATCGCCAGCATCTGCACGAAGTTGGTCAGTGCGGTTGGGTTTTCAAACGGATGCGACGAGTTGGCATTA
+AAGAAGCCACCGCCGTTAGTACCGAGCATCTTGATCGCTTCCTGAGAAGCTACAGGCCCCATGGGTAACAGCTGTTGCGCTCCTTCAACGGTATTCACAG
+CCTGATAAGGCAGAAAGTTTTGCAGCGCACCTTGTTGAATAAAAACAGTGCAATCAACAACGCCACAGGGACTAGCACCCATAACGTGATGCGTAGCAGA
+TCGACCCAGGCATTCCCGAGCGTGCTCATGCTCTGGCGGGTAAACGCACGGATGAGGGCAAAATCACCGCAATCCCGCTGGCGGCAGAAAGAAAGTTTTG
+CACCGTTAAGCCCGCCATCTGGCTGAAATAGCTCAACGTGGTTTCACCGCTATAAGATTGCCAGTTGGTATTGGTGACAAAGCTGACGGCGGTATTCAGC
+GCCAGATCCCACGACAGCCCTGGCAACTGCTGTGGATTAAGCGGCAGATAGTGCTGACCGAGCAACATAAAAACAGCACCGCCAGCCCCAGCATGTTCAG
+GCCGAGAATGGCACAAAGATATTGCTTCCAGTTCATCTCACGGTCAGAGACGCCAAGTGCGCGAAAAGTACGCGCTCAACGCCCGTTGTACCGGGAAGAG
+GAATGTCATTAATCAGCCGCGCCAGCCCGCTGCCTAAAGGACGCGCCAGCACCATTAACACCAGTAAAAACGTGGCGATCAGTAAGAACCCTTGCGCAGC
+CATCAGAACGCCTCCGCATTGATCAGGGCATAAACCAGATAACCCAGTAATAAAACACCAGCAATACGCCGGTTATCACGCCTGCACTCACAGTGCACCT
+CCAGTGGCCTAAAAGTGATACCGGAAGGGTAGAATTCTGGCTGCAAAGATTTCGCAAAATCTGCGGGCGGGGTGTAAAAGTATAAAAATGGCAAAAGCCA
+TGATTTAACTAATGTTTAGTATTAATTTAACTTTTGTGTAACTTAATTACAGGATGAATGTAAATAAACCATCAATAAGCAAAAATAAGTGGTCGGATGA
+GTAGTAAAATTACACAAAAGGCGGTACTATTTTCATCAGATAAACAAATTCATTTTTCCGGTGCCATTCACCGGGTAGATACAAAGGGGAGAAAAGTATG
+GAACTCTACAGAGAATATCCTGCATGGCTTATCTTTTTACGCCGTACTTATGCGGTTGCAGCGGGCGTTCTGGCGCTGCCTTTCATGCTTTTCTGGAAAG
+ACCGCGCCCGCTTTTACAGCTACCTGCATCGCGTCTGGTCGAAAACCAGCGATAAACCGGTGTGGATGGATCAGGCCGAAAAGGCAACTGGTGATTTTAT
+TGATTGCTGAGTTTTGAATACATTGAAAACCGCCAGCGGAAACGCTGGCGGTTTTTGTATCAGGAAGATGTTCAGAGGAATATTTAGACATCGTTATACC
+AATCGAAACATATATTCATGAAATATATATAAATATTTTCCTAATTGTTCTTATCTGACAGATATCTCACTTAAGGCTTTCTTATAAATCTGTAGGGTTT
+CGCCTGTCAGCAGACAAATAACCCGATAAAACAAGGATGAGCAGATGAGCGGAAAACCGGCGGCGCGTCAGGGCGACATGACGCAGTATGGCGGTAGCAT
+TGTCCAGGGTTCAGCCGGGGTACGCATCGGTGCCCCACCGGCGTGGCCTGTTCGGTGTGCCCCGGCGGGTGACGTCCGGCCATCCGGTCAATCCGCTGCT
+CGGTGCAAAGGTCCTTCCCGGTGAAACCGACATCGCCCTGCCCGGCCCGCTGCCGTTCATTCTCTCCCGCACCTACAGCAGTTACCGGACAAAACGCCCG
+CGCCGGTGGGGAGCCTCGGCCCCGGCTGGAAAATGCCTGCGGATATCCGCTTACAGCTGCGCGATAACACACTGATACTCAGTGATAACGGCGGCAGAAG
+CCTGTATTTTGAGCACCTGTTTCCCGGTGAGGACGGTTACAGCCGCAGCGAGTCACTGTGGCTGGTGCGCGGCGGCGTGGCGAAACTGGATGAAGGTCAC
+CGGCTGGCCGCACTCTGGCAGGCGCTGCCGGAAGAACTCCGCTTAAGTCCGCATCGTTATCTGGCGACAAACAGTCCGCAGGGGCCGTGGTGGCTGCTCG
+GCTGGTGTGAGCGGGTGCCGGAAGCGGATGAGGTGCTGCCTGCGCCGCTGCCGCCGTACCGGGTACTGACCGGGCTGGTGGACCGCTTCGGGCGCACACA
+GACGTTCCACCGCGAAGCCGCCGGTGAATTCAGCGGCGAAATCACCGGCGTGACGGATGGTGCCGGGCGTCACTTCCGGCTGGTACTGACCACGCAGGCG
+CAGCGGGCAGAAGAAGCCCGGCAGCAGGCCATTTCCGGCGGGACGGAACCGTCCGCTTTTCCTGATACCCTGCCGGGTTACACCGAATATGGCCGGGACA
+ACGGCATCCGTCTGTCTGCCGTGTGGCTGACGCACGACCCGGAATACCCGGAGAATTTACCTGCCGCGCCGCTGGTGCGCTATGGCTGGACGCCCGCGGC
+GAACTGGCGGCGGTGTATGACCGCAGCAATACACAGGTGCGCAGCTTTACTTACGATGATAAATACCGGGGCCGGATGGTGGCGCACCGTCACACGGGCC
+GACCGGAAATCTGTTACCGTTACGACAGCGACGGGCGGGTGACAGAACAGCTAAACCCGGCAGGCTTAAGTTACACGTATCAGTATGAGAAGGACCGCAT
+CACCATCACCGACAGCCTGAACCGCCGTGAAGTCCTGCACACGCAGGGTGAAGGCGGGCTGAAGCGGGTGGTGAAAAGGAACACGCGGACGGCAGCGTCA
+CGCAGAGTCAGTTTGACGCGGTGGGCAGGCTCAGGGCACAGACGGATGCCGCAGGCAGGACAACAGAATACAGTCCGGATGTGGTGACGGGCCTCATCAC
+GCGCATCACCACGCCGGATGGCAGGGCATCGGCGTTTTACTATAACCACCACAGCCAGTTAACGTCAGCCACCGGGCCTGACGGGCTGGAAATACGCCGG
+GAATATGATGAATGGGGCCGTCTGATTCAGGAAACTGCCCCTGACGGCGATATCACCCGCTACCGTTATGATAATCCACACAGTGACTTACCCTGCGCAA
+CGGAAGATGCCACCGGCAGCCGGAAAACCATGACGTGGAGCCGTTACGGTCAGTTGCTGAGCTTCACTGACTGTTCCGGTTATGTAACCCGCTATGACCA
+TGACCGTTTTGGTCAGGTGACGGCGGTGCACCGCGAGGAAGGGCTGAGTCAGTACCGCGCATACGACAGCCGTGGACAGTTAATTGCCGTGAAAGACACG
+CAGGGCCATGAAACGCGGTATGAATACAACGCCGCCGGTGACCTGACCACCGTCATTGCCCCGGACGGCAGCAGAAACGGGACACAGTACGATGCGTGGG
+GAAAAGCCATCTGTACCACGCAGGGCGGTCTGACGCGCAGTATGGAATACGATGCTGCCGGACGGGTCATCCGCCTGACCAGTGAAAACGGCAGCCACAC
+CACCTTCCGTTACGATGTACTCGACCGGCTGATACAGGAAACCGGCTTTGACGGCCGCACACAGCGTTATCACCACGACCTGACCGGCAAACTTATCCGC
+AGCGAGGATGAGGGCTGGTCACCCACTGGCACTATGACGAAGCAGACCGCCTCACGCACCGCACCGTGAATGGCGAAACCGCAGAGCGGTGGCAGTATGA
+CGAACGCGGCTGGCTGACAGACATCAGCCATATCAGCGAAGGGCACCGGGTGACGGTGCACTATGGTTATGACAGTAAAGGCCGCCTCGCCAGTGAACAC
+CTGACGGTGCATCATCCGCAGACGAATGAACTGCTCTGGCAGCATGAGACCAGACATGCGTACAACGCACAGGGACTGGCGAACCGCTGTATACCGGACA
+GCCTGCCCGCCGTGGAATGGCTGACCTACGGCAGCGGCTGGCTGTCAGGCATGAAACTCGGCGACACACCGCTGGTGGAGTACACCCGCGACCGCCTGCA
+CCGGGAAACGCTGCGCAGCTTCGGCCGTTATGAACTCACCACCGCTTATACCCCTGCCGGGCAGTTACAGAGCCAGCACCTGAACAGCCTGCTGTCTGAC
+CGCGATTACACCTGGAACGACAACGGCGAACTCATCCGCATCAGCAGCCCGCGCCAGACCCGGAGTTACAGCTACAGCACCACCGGCAGGCTGACCGGCG
+TTCACACCACCGCAGCGAATCTGGATATCCGCATCCCGTATACCACAGACCCGGCAGGTAACCGCCTGCCCGACCCGGAGCTGCACCCGGACAGCGCCCT
+CAGCATGTGGCCGGATAACCGTATCGCCCGTGACGCGCACTATCTTTACCGGTATGACCGTCACGGCAGGCTGACAGAGAAACCGACCTCATCCCGGAAG
+GGTTATCCGCACGGATGATGAGCGCACCCACCGGTACCATTACGACAGTCAGCACCGGCTGGTGCACTACACGCGGACACAATATGCAGAGCCGCTGGTC
+GAAAGTCGCTATCTTTACGACCCGCTGGGCCGCAGGGTGGCAAAACGGGTATGGCGGCGTGAACGGGACCTGACGGGCTGGATGTCGCTGTCACGGAAAC
+CGCAAGTGACCTGGTACGGCTGGGACGGCGACCGCCTGACCACGATACAGAACGACAGAACCCGCATCCAGACGATTTATCAGCCGGGGAGCTTCACGCC
+ACTCATCAGGGTTGAAACCGCCACCGGTGAGCTGGCGAAAACGCAGCGCCGCAGCCTGGCGGATACCCTTCAGCAGTCCGGTGGCGAAGACGGTGGCAGT
+GTGGTGTTCCCGCCGGTGCTGGTGCAGATGCTCGACCGGCTGGAAAGTGAAATCCTGGCTGACCGGGTGAGTGAGGAAAGCCGCCGCTGGCTGGCATCGT
+GCGGCCTGACGGTGGCGCAGATGCAAAGCCAGATGGACCCGGTATACACGCCGGCGCGAAAAATTCACCTGTACCACTGCGACCATCGCGGCCTGCCGCT
+GGCCCTATCAGCACGGAAGGGACAACAGCGTGGTACGCAGAATACGATGAATGGGGTAACCTGCTGAATGAAGAGAACCCGCATCAGCTGCAGCAGCTTA
+TCCGCCTGCCGGGGCAGCAGTATGATGAGGAGTCCGGCCTGTATTACAACCGCCACCGCTATTATGACCCGCTGCAGGGGCGATATATCACTCAGGATCC
+GATTGGGCTGAAAGGGGATGGAATTTTATCAGTATCCGTTGAATCCGATCTCAAATATAGATCCATTAGGATTAGAAACACTAAAATGCATTAAGCCACT
+GCATTCAATGGGCGGAACTGGTGAAAGAAGCGGTCCAGATATATGGGGAATCCGTTCTATCATCAATATCTTTGTGTCCCAGATGGTAAAGGGACTATAC
+TTGTGGTGGCCAAGACCAACGGGGAGAATCAAAGGAGATGGTCTATGGGGGCCAGGTAAAGCAAGTAATGATACAAAGAAGCTGCTGGCCGTTGTGACCT
+CGTTGAAACCGATAATAGTTGTGTGGAGAACTGTTTAAAGGAAGTTTAAAGAGGTAAGGCCGCGTTATTCTGTATTGCCTGATATATTCACACCTATAAA
+TTTAGGGCTATTTAAAACTGCCAAGACTGGTCTAATGATTCTTTAGAAACATGTAAGATGAAGTGCTCCGGAAATAACATTGGACGTTTTATTAGATTTG
+TATTCACCGGAGTGATGTAATGAAATATATTATTTTTTATTCAGAGCTATATGGCTGGCTTTATCGCTTTTAATACTATTCTTTTCCATGCATAGACTTT
+CACTATTAGACTCCACTCGTGATGTGAGCGAGTTAATTAGTCTCATGTCTTATGGAATGATGGTAATATGTTTTCCAACAGGCATAGTATTCTTTATTGC
+TCTAATATTTATAGGGACTGTATCAGACATTATTGGCGTAAGGATTGATAGTAAGTATATTATGGCGATAATAATATGGCTTTATTTTCTGTCAGGAGGG
+TATATTCAATGGTTTGTATTAAGTAAGCGCATTATAAACAAATAAATTAAGTTAATTGCTCTTATTATTATATGTAACCTGGGCATTGATATCCCGTATG
+CCACAGACCCGGCAGGTAACCGCCTGCCCGACCGGAGCTGCACCCGGACAGCACCCTCAGCATGTGGCCGGATAACCGTATCGCCCGTGACGCGCACTAT
+CTTTACCGGTATGACCGTCACGGCAGGCTGACGGAGAAAACCGACCTCATCCGGAAGGGTTATCCGCACGGATGATGAGCGCACCCACCGGTACCATTAC
+GACAGTCAGCACCGGCTGGTGCACTACACGCGGACACAATATGCAGAGCCGCTGGTCGAAAGCCGCTATCTTTACGACCCGCTGGGCCGCAGGGTGGCAA
+AACGGGTGTGGCGACGTGAACGGGACCTGACGGGCTGGATGTCGCTGTCACGGAAACCGCAAGTGACCTGGTACGGCTGGGACGGCGACCGCCTGACCAC
+GATACAGAACGACAGAACCCGCATCCAGACGATTTATCAGCCGGGGAGCTTCACGCCACTCATCAGGTTGAAACCGCCACCGGTGAGCTGGCGAAAACGC
+AGCGCCGCAGCCTGGCGGATACCCTTCAGCAGTCCGGCGGCGAAGACGGTGGCAGTGTGGTGTTCCCGCCGGTGCTGGTGCAGATGCTCGACCGGCTGGA
+AAGTGAAATCCTGGCTGACCGGGTGAGTGAGGAAAGCCGCCGCTGGCTGGCATCGTGCGGCCTGACGGTGGAGCAGATGCAAAACCAGATGGACCCGGTG
+TACACGCCGGCGCGAAAAATCCACCTGTACCACTGCGACCATCGCGGCCTGCCGCTGGCGCTTGTCAGCACGGAAGGGGCAACAGAATGGTGCGCAGAAT
+ACGATGAATGGGGCAACCTGCTGAATGAAGAGAACCCGCATCAGCTGCAGCAGCTTATCCGCCTGCCGGGGCAGCAGTATGATGAGGAGTCCGGCCTGTA
+TTACAACCGCCACCGCTATTATGACCCGCTGCAGGGAGGTATATCACTCAGGATCCGATTGGGCTGAAGGGGATGGAATTTTATCAGTATCCGCTGAATC
+CGGTTCAGTATATAGATTCAATGGGACTGGCATCAAAATATGGACACTTAAATAATGGCGGATATGGAGCGAGACCCAACAAACCGCCTACGCCCGATCC
+AAGTAAATTGCCGGACATAGCGAAACAATTAAGACTGCCATATCCTATTGACCAGGCCAGTAGTGCGCCTAATGTTTTCAAAACATTCTTCAGAGCATTA
+AGCCCTACGACTACACACTGTATTGCAGGAAGTGGGTAAAACCAAATCTGACTTGTACGCCACAGGATGATTCCCAGTATCCAGGGATGGATACAAAGAC
+AGCAAGTGATTACCTGCCACAGACAAATTGGCCAACAACTCAATTACCACCAGGATATACTTGTGCAGAACCCTATTTATTCCCAGACATTAATAAACCC
+GATGGGCCAGCAACAGCAGGGATAGATGATTTGGGTGAAATTTTAGCTAAGATGAAACAGAGAACATCGAGAGGAATAAGAAAATGAAAAGAGTTTTGTT
+CTTTTTGCTGATGATATTTGTTAGTTTTGGTGTTATAGCTGATTGCGAAATACAAGCTAAAGATCATGATTGTTTTACTATTTTCGCTAAAGGGTACTAT
+TTTTCCGCGTTTCCTGTCTTAAATAATAAAGCCATGTGGAGATGGTATCAGAATGAGGACATCGGTGAGTATTATTGGCAAACAGAACTGGGTACATGTA
+AAAATAATAAATTCACACCAAGCGGGCGAGACTCTTAATTCGCGTCGGGTCACTACGCCTTAATGAAAATCATGCCATCAAAGGAACGTTGCAGGAGTTG
+ATAAATACAGCAGAAAAACGGCGTTTCTCGGCGATCGGTTTAGAAGTTATATAAGAGCGGGTATCTATCAAAAGAGCAGTGATCCAGTTCAGTTGTTGGC
+AGTCCTTGATAATTCAATCATGGTAAAATATTTTAAAGATGAGAAACCAACTTATGCTCGAATGACAGCACATCTCCCGAACAAAATGAGTCTTACGAAT
+GTTTAATAAAGATACAGCATGAACTAATTCGTAGTGAAGAGAAATAAAATCTCTTCCTGAGAAAACAAATTAATCATTGTGAAAAATTATATAACTCATG
+GAATAGGTGTTTATTTTGCGTTCCATTTGCAGGAAAGATCACGTAACGCTACTTTTTGTACTAAATAATTCGAATTTAAGTTCAACAATTGAGATACTAC
+TTATTGTCTAAAGCTGTTTTTCATAGCTTATACATGATCAAATACTCCTTACATAAATAAGGTGAACAAATGGAACTTAAAAATTGATGGAACATATTTC
+TATTACACCCGATTACAGACAAGCCTGGAAAGTGGTGCATAAATTGTCAGATATTCTACTGTTGACTATTTGTGCCGTTATTTCTGGTGCAGAAGGTTGG
+GAAGATATAAGAGGATTTCGGGGAAACATCTCGATTTTTTGAAGCAATATGGTGATTTTGAAAATGGTATTCCTGTTCACGATACCATTGCCAGAGTTGT
+ATCAGGAAAGATCACGTAACGCTACTTTTTGTACTAAATAATTCGCATTTTATGTTTAAAAATTGAGATATTCCTTATTACCTAAAGCTGTTTTTCATAG
+CTTATACATGATCAAATACTCCTTACATAAATAAGGTGAACAAATGGAACTTAAAAATTGATGGAACATATTTCTATTATTCCCGATTACAGATAAGCCT
+GGAAAGTAGAGCATAAATTGTCCAGGCATCCTACTATTGACTATTTTGCCGTTATTTCTGGTGCGAAAGTTGGGAAGATATAGAGGATTTCGGGAAACAC
+ATCTCGATTTCTTGAAGCAATATGGTGATTTTGAAAATGGTATTCCTGTTCACGATACTATTGCCAGAGTTGTATCCTGTATCAGTCCT
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/ecoli_canu_unitigs.fa	Fri Jun 08 04:43:41 2018 -0400
@@ -0,0 +1,162 @@
+>tig00000001 len=16089 reads=72 covStat=1.00 gappedBases=no class=contig suggestRepeat=no suggestCircular=no
+GGTTGAACCGTGAAGGTGATCAATAAAAATGATCAATCTTAATTTATTTAATGATGAGCTTTTTACTCAGTAATATAAAATATTGAATTGTTATTTTGTG
+TGTTGTTTTAAGATAAAAGCCGCTTTATTAATACGGCTTTAATTAATAAAAAGGCAGGCTGTATTAAAATTAATATTCAAAGCATAAACCGATGCCAATA
+CCGGTTTCAGTAATGAAATGGCGTGGGCGGGCGGGATCCTGTTCCAGTTTTTGTCGCAGATGTCCCATATAAATACGCAAATGGTGACTGTGTTCGACCG
+CGTTTGGCCCCCACCTGGTTAAGGAGCTGGCGCTGGGTGAGTACTTTCCGGCATTGTTGAGCAGCACCGCCAGCAGGCGGAACTCAATTGGTGTGAGATG
+CACCTCTTCTCACCCCGGTGAATCACGCGGGCGGCTAAATCGACGGTAACATCGGAAAATTTTACCAGCGGATCGGGCGCGGTGGTGGCAGAGTGGCGGC
+GTAATGCGACGCGCAGACGGGCCTGCAATTCGCCAATGCCAAACGGCTTACTCAGATAATCATCCGCTCCGGCATCCAGCGCGGCGATTTTGTCGCTCTT
+CTGCTGCGTGCGGAAAGCACAATCACCGGCACCGCGCTCCACTGGCGCAGGTCGCGGATAAACTCAATCCCATCACCATCGGGCAGGCCGAGATCGAGAA
+TAATCAAATCTGGCTTACGGGTTGCCGCTTCCAGCAAGCCGCGTTGCAGCGTTTCGGCCTCAAAGACGCGCATCCGTCGCCCTCCAGCGCCGTGCGCAGA
+AAGCGACGAATAGCCTGTTCATCTTCAACAATCAGAACGTTTGTCACATATCCTCATGAAATTCTTCAGTTCAGGGGCAGTTTGCTGGGGAAGTGTAACA
+CGAAAACAGGCACCACCTTCCGGTCGGTTGAACGCGGTAATAGTGCCCCCGTGTACATCCACTATCGCCCGACAAATTGCCAGTCCAAGCCCTACCCCCG
+TACTGCCGACTCTTTTATTCCCGCGAGCAAACTTATCAAATATCGTCTGCTCCTGGCCTGGCGGAAGACCGGGGCCGTTATCCCAGACATCCAGTTGTAG
+ATTTTCGCCCTCAACGTGGGCATCGATACCAATTTCGGCCTGCGCACCCGCATATTTCACCGCGTTCTCCAGCAGATTAATCAGCACCCGTTCAAAGAGA
+GGCCCGTCAACGTGGATTAAGGTCAGCGGTTCTGGCAGAGAAAGATTGATGGGCGACGATAAACCCGGTTCCAGCATTTGCAGCGCTGCCGACTACTTCT
+TCCAGCGTTAACCACTCTTTCTTCAAATTAAAGCCGCCGGACTGAATTCGCGCCATATCCAGTAGATTATTCACCAGTCGGGTAGTGTTCAGCATGCTGA
+CGGATCTCGCTGGCCTGGCGGGCGTGGGTGATCCTCGCTTGCCAGATCGAGCGTTAAGATTTCTGCCTGACCAAACAGCACCGTAAGCGGCGTGCGTAAA
+TCATGCGAAAGCGCCGCCAGCAGGGCGTTGCGGATCTGTTCACGTTCGCTTGCCATCCGCGCCTGTTCTTCGCTGGCGGTTAGCGTCAGCCGCTCAGGGC
+ATTGGCGACTAACAGCGTAACGTCTCCAGCAGGCGCTGCTGTTCCGGGATCATCAACTGGCGCAGATTCCCGGCTCCACCACCACCAGCCCGTAGGTTTT
+CGCCGCTTTTAGCGGCAAAATCTGGTACGGTACACCGGGTAACGTGTCGGTGCCCGCGCCCGCAGGCAGGCCTTTATCAAAACTCCACTGCGCGATGGCA
+TCGTCCCACGGCGTCATTCCTTGCGGATGTGTTAACGGCTGCAATTTACCGTTGTCATCGGGCAACAACACCTGACTGCGGGCATGAAACGTGGAGGCAA
+TAAATTGTTCGCTGGTGGCAGCGATATCCTGCGGACTGCGGCCCACCGCCAGAGCTTTCGACATTTCATATAAGTGCCGTGTGCGTTGCTCGCGGTAACG
+GGCTACCCGCGCCTGATAACGCACGCCAGCAGTAAGGTTCCCGATCACCAGCCCGACGGTTAACATCACCGCGAAGGTCAGCAGATATTGCACATCAGAG
+ACGGCGAGCGTGCCGCGTGGGGCGATAAAAAGAGATCGAAACTCACTACATTAATGACGGTGGCAACCACTGAAGGCCAGCGTCCATAAAATAGCGCCAC
+CACCACCACGCCAAGCAGATACAGCATCACCAGGTTGGCGGCATCAAACGCCATCAGCCACTGCATGGCAATTAAGGTGATAACGGCGCATAACGCGGCG
+GCAACCACGCATCCCTGAATTTGTACACGCCACTTGTCTTTAAAAGAGCGGTTATCCGGCGCGTTGTTAATCGTGCGGGCGGGTGGTTCATCAAGCGCGA
+CCAGCACCTGATCGAGATCGGGGCGATGCGCGCCAGTCGGTCAGCAAACGTTTCCCGACGCCACCAGCGGCGCGAGGCCGGGCGACCGAGAATAATCTTG
+CCGAGATTATGTTCACGGGCATAACGCACTACCGCTTTCTCTTCCGCTGGATCAGAAAGTGTTGCCGTCTCCGCGCCCAGTTCCTGCGCCAGACGTAAGG
+CGCTGAGAATTGCCCGACGTTTTTTCCGGTAAGCGGTGCAGGGCAGGGGTTTCAACATACACCGCGTGCCAGACGCTACCCAGCCGTGACGCCAGCCGCG
+CCGCTGCGCGGACCAGTTTTCGCTGCCGGTGTTATGGCCGATGCATAAAAGGATCGCGTCGCGCGTGTGCCACACTTTCTCTTCGCCAGGATGCCCCGCC
+AGGCGCGCATTTGCTCATCAACGCGATCGGCAGTACGGCGCAGTGCCAGTTCGCGCAGGGCGATCAGATTACCTTTGCGGAAAAATGTTCAATGGCGCGC
+TCCGCCTGCCCGGCAATATAGACTTTGCCTTCTTTCAGCCGCTGGCGCAGATCGTCCGGGGCAAGTCCACCAGCACCACGTCGTCGGCGGCATCGAAAAG
+GATCGGGCACGGTTTCCCGTACCTGAATTCCGGTGACGCCGCTGACCACATCATTCAGACTTTCCAGATGCTGAACGTTGACGGTAGTGAAAACATCAAT
+GCCAGCTTCCAGCAGTTCTTCGATATCCTGCCAGCGTTTGGGATGACGGGAACCTGGCGCATTACTGTGCGCCAGTTCGTCCATTAAGATCAGCGCCGGG
+CGGCGGGCGAGGGCGGCATCGAGATCAAACTCGCTGATATGCCGCCCACGGTACGCCTGGCGTTTTAACGGCAGAACAGCCAGCCCTTCCAGCATGGCGG
+CGGTATCTTTTCGCCCGTGGGTTTCTACCACGCCAACCACAATATCCAGCCCTTGCGCCCGCAGTCGCTGGGCTTCTGCCAGCATCGCCCAGGTCTTCCC
+GACGCCTGCACAGGCACCGAAGAAAACTTTCAGCTTCCCCGATGCGGCGCGGCAGTTTGTTCCAGCAGACGATCGGGGTCGGGACGTAAGGGTTCGTTAT
+TCATCAAGTTTATCCAGCGCCAGATTGAGTTCAACAATGTTGACAACCGGCTGGCCGATATATTTCACCAGCGGTTGTTGGCTGTATTTTGCGATCAGTT
+GCGTGAGCTGTTCAACGCTGAGATTACGCGCTTTCGCCACGCGTGGGATTTGCCAGGCCGCCGCTTGCGGGTGATATTATTGTCCAGCCCGCTTGCCGAT
+GCCGTCACCAGTTCAACCGGAACGCTCGCGCTGGCATCCGGGTTAGCGGCCCGTAATGCAGCAACGCGTGCGGCTATTAGTTTATCCAGCTCAGGGTTAC
+TGACCGCCAGATTGCTCCCGCCAGAAGCCTGTGGATTATAGGGCATTTCTGCCGTTGCCGACGGGCGACCATGAAAATAGCCGTTGCCGGTAAAATTCTG
+CCCGATTAATGCCGAACCGCGCACCGTATCACCTTCACGAATCAACGAACCATTGGCCTGCCAGGAAACCACCATTGCCCCAGTACGGTGGTCAGCAGCG
+GGTAAACGCCGCCAGTAATCAATAACAGAAAGATAAATGTTGATAATGCCGGACGTAATCCACTCATGGTAAACCTCACACCAGACCGCAAACGGTCAGC
+AGTAAATCAATGACTTTGATACCGATAAACGGCACCAGCAGCCCACCCAGACCGTAAATCCATAAGTTACGGCGCAACATGGCAGAAGCGGTAAGCGGTT
+TATAACTCACGCCTTTTAACGCCAGGGGAATCAAAGACGATAATCAAGGCGTTGAAAATCACCGCACTGAGGATTGCGGAGTCGGGCGAATGCAGGCACA
+TGATGTTCAGCGCATTTAACTGCGGATACGTTGCCGCGAATGCCGCCGGAATAATGGCGAAGTATTTCGCCACATCGTTGGCAATGCTGAAGGTGGTCAG
+CGAGCCACGGGTCATCAGCATCTGTTTGCCAATGTGCACCACCTCGATCAACTTGGTCGGGTTAGAGTCGAGATCGACCATATTGCCCGCCTCTTTCGCC
+GCCTGGGTGCCGGAGTTCATCGCCACCGCGACATCTGCCTGCGCCAGCGCCGGAGCATCGTTGGTGCCGTCGCCGGTCATCGCTACCAAACGACCTTCCG
+CCTGATACTGACGGATCAATGCCAGCTTGGCCTCCGGTGTCGCTTCGGCGAGAAAATCATCGACACCCGCTTCCGCAGCAATCGCGGCGGCAGTCAGACG
+GTTATCGCCGGTAATCATCACCGTTTTAATGCCCATTTTGCGCAGCTGGGCGAAGCGCTCTTTAATACCGCCTTTGACGATATCTTTCAGCGCAATAACG
+CCCAGCACACGAGAACCTTCCACCACCACCAGCGGCGTGGCTCCCTGACGCGCAACCTGATCGACTTTTTGATCAACATCGGTAGGGAAGTGACCACCGT
+TAGCCTCAACATGGCGACGAATGGCATCGACAGAACCTTTACGGATCATGCGGTTGTCGATGTTGATCCCGCTCATCCGGCTTTGCGCAGTAAACGGTAC
+AAAGGTGGCATGGAGCGACTGCACATCGCGCTCGCGCAGGTTAAAACGCTGCTTGGCGAGGATCACAATACTGCGGCCTTCCGGCGTTTCATCAGCCAGC
+GAAGCCAGTTGTGCGGCGTCAGCCAGCGTTTTCATCCACGCCCTGCGCGGGGATAAACTCCGACGCCTGACGGTTACCGAGTGTGATGGTGCCGGTTTTA
+TCCAGTAGCAGAACGTCAACGTCACCTGCCGCTTCAACTGCACGTCCGCTGGTGGCAATCACATTCGCGCCTAGCATCCGGCTCATCCCGGCGACGCCGA
+TCGCTGACAACAGGCCGCCAATAGTGGTTGGGATCAGACAGACCAGCAGCGCCACCAGTACCGTTACGCTGACTGCATTACCGCCCCACGCGGAAAACGG
+CCACAGCGTGGCGGTTGCCAGTAAAAGACGATAGTCAGGGCAATCAGCAGAATGGTCAGGGCAATTTCGTTCGGCGTTTTGCGTCGCTGTGCGCCTTCCA
+CCATCGCGATCATCCGATCCAGAAATGTCTCGCCGGGGTTAACGCTACACTCAATCACCAGCCAGTCAGAAAGAATACGCGTGCCGCCGGTGACGGAGGC
+AAAATCGCCGCCGGATTCACGGATCACCGGTGCCGATTCCCCGGTGATGGCGCTTTCATCGACCGATGCACCCCTTCAATAACTTCACCATCGCAGGGGA
+TAATATCGCCAGCTTCTACCAGTACGATATCGCCTTTACGAAGTTGGTCGGCAGGAACTTTGTCCGCCGCAGCGCCATATTTCGGCTCACGCAGCTTGCG
+GGCAAAGGCAGTTTTTCACCCTTTCAGACTGTTGGCCTGCGCTTTACTGCGGCCTTCTGCCAGCGCCTCGGCGAAATTAGCGAACAGTACGGTGATCCAC
+AGCCAACCGCTAATGGCCGCGCTAAACAGCGCATTGCCGGGCATCGCACCGCTTGCCATCGCGATGCTAATACAGGTGGTCAGCAGACTGCCGATCCAGA
+CGATAAACATCACCGGATTGCGCCATTGCGCCTGCGGGTTTAATTTTTCACCGCTTCTTTCAGCGCCTGAACGACAAGTGTTGGTTCGAATAGCGCCAGT
+TGTTTACGACTCATATTCAGTGCTCACTCAATATCATCAGGAGAGATATTCCGCCACCGGACCAAGCGCCAGGGCAGGGATAAAGGTCAGTGCGCCAACC
+AGCAACACGGTGCCGATTAACAGGCCAACAAACAGCGGGCCGTGCGTTGGCAGCGTGCCGGAGCTGGCGGCTTGGCTCTTTTACTCACCAGCGAACCGGC
+AATTGCCATCACCGGGATAATCACCCCGAAGCGACCGACAAACATGCAGAACGCCAGTAAACAGTTCCAGAACGGAGAGTTGGCGCTTAATCCGGCAAAG
+GCGCTGCCGTTGTTGTTAGCGGCGGATGACACGGCGTACAGCACTTCGCTAAAACCATGCGGGCCAGGGTTGAGCATGGCGCTACGTCCGGCGTCGGTCA
+TCATCGCCAACGCCGCGCCCATCAGCACCAGCGTCGGGGTAACCAGAATTGCCAGTGCAGTCAGTTTCATCTCGCGTACGTCGATTTTTTACCCAGATAT
+TCCGGTGTACGACCAATCATCAGCCCGGCAATAAACACCGCCAGCAGGACAAACAGCATCATGCCGTAAAGACCAGAACCGACACCGCCGAACACCACTT
+CACCAATTTGCATCAGCCACATCGGCACCATGCCACCGAGAGCGGTAAACGAATCATGCATCGCAATCACCGCGCCACAGGAAGCCGCCGTCGTCACGAC
+CGCAAACAGGCTACTGACCAGCACGCCGAAACGGCTCTCTTTACCTTCCATATTGATGCTGCTGTCCGTGCCCAGTGCCAGCAGATGAGGATTACCCTGA
+ACTTCTGCCCACATCACCACGCCTACGCAGATGACAAAATCACTGACATCGCCCACAGCAACATGCGCCCCTGGCGGCGATCGCCCATCACTTCACCAAA
+GGCAAAGCACAGCGCCGTTGGGATCAAGAAGATCGCCAGCATCTGCACGAAGTTGGTCAGTGCGGTTGGGTTTTCAAACGGATGCGACGAGTTGGCATTA
+AAGAAGCCACCGCCGTTAGTACCGAGCATCTTGATCGCTTCCTGAGAAGCTACAGGCCCCATGGGTAACAGCTGTTGCGCTCCTTCAACGGTATTCACAG
+CCTGATAAGGCAGAAAGTTTTGCAGCGCACCTTGTTGAATAAAAACAGTGCAATCAACAACGCCACAGGGACTAGCACCCATAACGTGATGCGTAGCAGA
+TCGACCCAGGCATTCCCGAGCGTGCTCATGCTCTGGCGGGTAAACGCACGGATGAGGGCAAAATCACCGCAATCCCGCTGGCGGCAGAAAGAAAGTTTTG
+CACCGTTAAGCCCGCCATCTGGCTGAAATAGCTCAACGTGGTTTCACCGCTATAAGATTGCCAGTTGGTATTGGTGACAAAGCTGACGGCGGTATTCAGC
+GCCAGATCCCACGACAGCCCTGGCAACTGCTGTGGATTAAGCGGCAGATAGTGCTGACCGAGCAACATAAAAACAGCACCGCCAGCCCCAGCATGTTCAG
+GCCGAGAATGGCACAAAGATATTGCTTCCAGTTCATCTCACGGTCAGAGACGCCAAGTGCGCGAAAAGTACGCGCTCAACGCCCGTTGTACCGGGAAGAG
+GAATGTCATTAATCAGCCGCGCCAGCCCGCTGCCTAAAGGACGCGCCAGCACCATTAACACCAGTAAAAACGTGGCGATCAGTAAGAACCCTTGCGCAGC
+CATCAGAACGCCTCCGCATTGATCAGGGCATAAACCAGATAACCCAGTAATAAAACACCAGCAATACGCCGGTTATCACGCCTGCACTCACAGTGCACCT
+CCAGTGGCCTAAAAGTGATACCGGAAGGGTAGAATTCTGGCTGCAAAGATTTCGCAAAATCTGCGGGCGGGGTGTAAAAGTATAAAAATGGCAAAAGCCA
+TGATTTAACTAATGTTTAGTATTAATTTAACTTTTGTGTAACTTAATTACAGGATGAATGTAAATAAACCATCAATAAGCAAAAATAAGTGGTCGGATGA
+GTAGTAAAATTACACAAAAGGCGGTACTATTTTCATCAGATAAACAAATTCATTTTTCCGGTGCCATTCACCGGGTAGATACAAAGGGGAGAAAAGTATG
+GAACTCTACAGAGAATATCCTGCATGGCTTATCTTTTTACGCCGTACTTATGCGGTTGCAGCGGGCGTTCTGGCGCTGCCTTTCATGCTTTTCTGGAAAG
+ACCGCGCCCGCTTTTACAGCTACCTGCATCGCGTCTGGTCGAAAACCAGCGATAAACCGGTGTGGATGGATCAGGCCGAAAAGGCAACTGGTGATTTTAT
+TGATTGCTGAGTTTTGAATACATTGAAAACCGCCAGCGGAAACGCTGGCGGTTTTTGTATCAGGAAGATGTTCAGAGGAATATTTAGACATCGTTATACC
+AATCGAAACATATATTCATGAAATATATATAAATATTTTCCTAATTGTTCTTATCTGACAGATATCTCACTTAAGGCTTTCTTATAAATCTGTAGGGTTT
+CGCCTGTCAGCAGACAAATAACCCGATAAAACAAGGATGAGCAGATGAGCGGAAAACCGGCGGCGCGTCAGGGCGACATGACGCAGTATGGCGGTAGCAT
+TGTCCAGGGTTCAGCCGGGGTACGCATCGGTGCCCCACCGGCGTGGCCTGTTCGGTGTGCCCCGGCGGGTGACGTCCGGCCATCCGGTCAATCCGCTGCT
+CGGTGCAAAGGTCCTTCCCGGTGAAACCGACATCGCCCTGCCCGGCCCGCTGCCGTTCATTCTCTCCCGCACCTACAGCAGTTACCGGACAAAACGCCCG
+CGCCGGTGGGGAGCCTCGGCCCCGGCTGGAAAATGCCTGCGGATATCCGCTTACAGCTGCGCGATAACACACTGATACTCAGTGATAACGGCGGCAGAAG
+CCTGTATTTTGAGCACCTGTTTCCCGGTGAGGACGGTTACAGCCGCAGCGAGTCACTGTGGCTGGTGCGCGGCGGCGTGGCGAAACTGGATGAAGGTCAC
+CGGCTGGCCGCACTCTGGCAGGCGCTGCCGGAAGAACTCCGCTTAAGTCCGCATCGTTATCTGGCGACAAACAGTCCGCAGGGGCCGTGGTGGCTGCTCG
+GCTGGTGTGAGCGGGTGCCGGAAGCGGATGAGGTGCTGCCTGCGCCGCTGCCGCCGTACCGGGTACTGACCGGGCTGGTGGACCGCTTCGGGCGCACACA
+GACGTTCCACCGCGAAGCCGCCGGTGAATTCAGCGGCGAAATCACCGGCGTGACGGATGGTGCCGGGCGTCACTTCCGGCTGGTACTGACCACGCAGGCG
+CAGCGGGCAGAAGAAGCCCGGCAGCAGGCCATTTCCGGCGGGACGGAACCGTCCGCTTTTCCTGATACCCTGCCGGGTTACACCGAATATGGCCGGGACA
+ACGGCATCCGTCTGTCTGCCGTGTGGCTGACGCACGACCCGGAATACCCGGAGAATTTACCTGCCGCGCCGCTGGTGCGCTATGGCTGGACGCCCGCGGC
+GAACTGGCGGCGGTGTATGACCGCAGCAATACACAGGTGCGCAGCTTTACTTACGATGATAAATACCGGGGCCGGATGGTGGCGCACCGTCACACGGGCC
+GACCGGAAATCTGTTACCGTTACGACAGCGACGGGCGGGTGACAGAACAGCTAAACCCGGCAGGCTTAAGTTACACGTATCAGTATGAGAAGGACCGCAT
+CACCATCACCGACAGCCTGAACCGCCGTGAAGTCCTGCACACGCAGGGTGAAGGCGGGCTGAAGCGGGTGGTGAAAAGGAACACGCGGACGGCAGCGTCA
+CGCAGAGTCAGTTTGACGCGGTGGGCAGGCTCAGGGCACAGACGGATGCCGCAGGCAGGACAACAGAATACAGTCCGGATGTGGTGACGGGCCTCATCAC
+GCGCATCACCACGCCGGATGGCAGGGCATCGGCGTTTTACTATAACCACCACAGCCAGTTAACGTCAGCCACCGGGCCTGACGGGCTGGAAATACGCCGG
+GAATATGATGAATGGGGCCGTCTGATTCAGGAAACTGCCCCTGACGGCGATATCACCCGCTACCGTTATGATAATCCACACAGTGACTTACCCTGCGCAA
+CGGAAGATGCCACCGGCAGCCGGAAAACCATGACGTGGAGCCGTTACGGTCAGTTGCTGAGCTTCACTGACTGTTCCGGTTATGTAACCCGCTATGACCA
+TGACCGTTTTGGTCAGGTGACGGCGGTGCACCGCGAGGAAGGGCTGAGTCAGTACCGCGCATACGACAGCCGTGGACAGTTAATTGCCGTGAAAGACACG
+CAGGGCCATGAAACGCGGTATGAATACAACGCCGCCGGTGACCTGACCACCGTCATTGCCCCGGACGGCAGCAGAAACGGGACACAGTACGATGCGTGGG
+GAAAAGCCATCTGTACCACGCAGGGCGGTCTGACGCGCAGTATGGAATACGATGCTGCCGGACGGGTCATCCGCCTGACCAGTGAAAACGGCAGCCACAC
+CACCTTCCGTTACGATGTACTCGACCGGCTGATACAGGAAACCGGCTTTGACGGCCGCACACAGCGTTATCACCACGACCTGACCGGCAAACTTATCCGC
+AGCGAGGATGAGGGCTGGTCACCCACTGGCACTATGACGAAGCAGACCGCCTCACGCACCGCACCGTGAATGGCGAAACCGCAGAGCGGTGGCAGTATGA
+CGAACGCGGCTGGCTGACAGACATCAGCCATATCAGCGAAGGGCACCGGGTGACGGTGCACTATGGTTATGACAGTAAAGGCCGCCTCGCCAGTGAACAC
+CTGACGGTGCATCATCCGCAGACGAATGAACTGCTCTGGCAGCATGAGACCAGACATGCGTACAACGCACAGGGACTGGCGAACCGCTGTATACCGGACA
+GCCTGCCCGCCGTGGAATGGCTGACCTACGGCAGCGGCTGGCTGTCAGGCATGAAACTCGGCGACACACCGCTGGTGGAGTACACCCGCGACCGCCTGCA
+CCGGGAAACGCTGCGCAGCTTCGGCCGTTATGAACTCACCACCGCTTATACCCCTGCCGGGCAGTTACAGAGCCAGCACCTGAACAGCCTGCTGTCTGAC
+CGCGATTACACCTGGAACGACAACGGCGAACTCATCCGCATCAGCAGCCCGCGCCAGACCCGGAGTTACAGCTACAGCACCACCGGCAGGCTGACCGGCG
+TTCACACCACCGCAGCGAATCTGGATATCCGCATCCCGTATACCACAGACCCGGCAGGTAACCGCCTGCCCGACCCGGAGCTGCACCCGGACAGCGCCCT
+CAGCATGTGGCCGGATAACCGTATCGCCCGTGACGCGCACTATCTTTACCGGTATGACCGTCACGGCAGGCTGACAGAGAAACCGACCTCATCCCGGAAG
+GGTTATCCGCACGGATGATGAGCGCACCCACCGGTACCATTACGACAGTCAGCACCGGCTGGTGCACTACACGCGGACACAATATGCAGAGCCGCTGGTC
+GAAAGTCGCTATCTTTACGACCCGCTGGGCCGCAGGGTGGCAAAACGGGTATGGCGGCGTGAACGGGACCTGACGGGCTGGATGTCGCTGTCACGGAAAC
+CGCAAGTGACCTGGTACGGCTGGGACGGCGACCGCCTGACCACGATACAGAACGACAGAACCCGCATCCAGACGATTTATCAGCCGGGGAGCTTCACGCC
+ACTCATCAGGGTTGAAACCGCCACCGGTGAGCTGGCGAAAACGCAGCGCCGCAGCCTGGCGGATACCCTTCAGCAGTCCGGTGGCGAAGACGGTGGCAGT
+GTGGTGTTCCCGCCGGTGCTGGTGCAGATGCTCGACCGGCTGGAAAGTGAAATCCTGGCTGACCGGGTGAGTGAGGAAAGCCGCCGCTGGCTGGCATCGT
+GCGGCCTGACGGTGGCGCAGATGCAAAGCCAGATGGACCCGGTATACACGCCGGCGCGAAAAATTCACCTGTACCACTGCGACCATCGCGGCCTGCCGCT
+GGCCCTATCAGCACGGAAGGGACAACAGCGTGGTACGCAGAATACGATGAATGGGGTAACCTGCTGAATGAAGAGAACCCGCATCAGCTGCAGCAGCTTA
+TCCGCCTGCCGGGGCAGCAGTATGATGAGGAGTCCGGCCTGTATTACAACCGCCACCGCTATTATGACCCGCTGCAGGGGCGATATATCACTCAGGATCC
+GATTGGGCTGAAAGGGGATGGAATTTTATCAGTATCCGTTGAATCCGATCTCAAATATAGATCCATTAGGATTAGAAACACTAAAATGCATTAAGCCACT
+GCATTCAATGGGCGGAACTGGTGAAAGAAGCGGTCCAGATATATGGGGAATCCGTTCTATCATCAATATCTTTGTGTCCCAGATGGTAAAGGGACTATAC
+TTGTGGTGGCCAAGACCAACGGGGAGAATCAAAGGAGATGGTCTATGGGGGCCAGGTAAAGCAAGTAATGATACAAAGAAGCTGCTGGCCGTTGTGACCT
+CGTTGAAACCGATAATAGTTGTGTGGAGAACTGTTTAAAGGAAGTTTAAAGAGGTAAGGCCGCGTTATTCTGTATTGCCTGATATATTCACACCTATAAA
+TTTAGGGCTATTTAAAACTGCCAAGACTGGTCTAATGATTCTTTAGAAACATGTAAGATGAAGTGCTCCGGAAATAACATTGGACGTTTTATTAGATTTG
+TATTCACCGGAGTGATGTAATGAAATATATTATTTTTTATTCAGAGCTATATGGCTGGCTTTATCGCTTTTAATACTATTCTTTTCCATGCATAGACTTT
+CACTATTAGACTCCACTCGTGATGTGAGCGAGTTAATTAGTCTCATGTCTTATGGAATGATGGTAATATGTTTTCCAACAGGCATAGTATTCTTTATTGC
+TCTAATATTTATAGGGACTGTATCAGACATTATTGGCGTAAGGATTGATAGTAAGTATATTATGGCGATAATAATATGGCTTTATTTTCTGTCAGGAGGG
+TATATTCAATGGTTTGTATTAAGTAAGCGCATTATAAACAAATAAATTAAGTTAATTGCTCTTATTATTATATGTAACCTGGGCATTGATATCCCGTATG
+CCACAGACCCGGCAGGTAACCGCCTGCCCGACCGGAGCTGCACCCGGACAGCACCCTCAGCATGTGGCCGGATAACCGTATCGCCCGTGACGCGCACTAT
+CTTTACCGGTATGACCGTCACGGCAGGCTGACGGAGAAAACCGACCTCATCCGGAAGGGTTATCCGCACGGATGATGAGCGCACCCACCGGTACCATTAC
+GACAGTCAGCACCGGCTGGTGCACTACACGCGGACACAATATGCAGAGCCGCTGGTCGAAAGCCGCTATCTTTACGACCCGCTGGGCCGCAGGGTGGCAA
+AACGGGTGTGGCGACGTGAACGGGACCTGACGGGCTGGATGTCGCTGTCACGGAAACCGCAAGTGACCTGGTACGGCTGGGACGGCGACCGCCTGACCAC
+GATACAGAACGACAGAACCCGCATCCAGACGATTTATCAGCCGGGGAGCTTCACGCCACTCATCAGGTTGAAACCGCCACCGGTGAGCTGGCGAAAACGC
+AGCGCCGCAGCCTGGCGGATACCCTTCAGCAGTCCGGCGGCGAAGACGGTGGCAGTGTGGTGTTCCCGCCGGTGCTGGTGCAGATGCTCGACCGGCTGGA
+AAGTGAAATCCTGGCTGACCGGGTGAGTGAGGAAAGCCGCCGCTGGCTGGCATCGTGCGGCCTGACGGTGGAGCAGATGCAAAACCAGATGGACCCGGTG
+TACACGCCGGCGCGAAAAATCCACCTGTACCACTGCGACCATCGCGGCCTGCCGCTGGCGCTTGTCAGCACGGAAGGGGCAACAGAATGGTGCGCAGAAT
+ACGATGAATGGGGCAACCTGCTGAATGAAGAGAACCCGCATCAGCTGCAGCAGCTTATCCGCCTGCCGGGGCAGCAGTATGATGAGGAGTCCGGCCTGTA
+TTACAACCGCCACCGCTATTATGACCCGCTGCAGGGAGGTATATCACTCAGGATCCGATTGGGCTGAAGGGGATGGAATTTTATCAGTATCCGCTGAATC
+CGGTTCAGTATATAGATTCAATGGGACTGGCATCAAAATATGGACACTTAAATAATGGCGGATATGGAGCGAGACCCAACAAACCGCCTACGCCCGATCC
+AAGTAAATTGCCGGACATAGCGAAACAATTAAGACTGCCATATCCTATTGACCAGGCCAGTAGTGCGCCTAATGTTTTCAAAACATTCTTCAGAGCATTA
+AGCCCTACGACTACACACTGTATTGCAGGAAGTGGGTAAAACCAAATCTGACTTGTACGCCACAGGATGATTCCCAGTATCCAGGGATGGATACAAAGAC
+AGCAAGTGATTACCTGCCACAGACAAATTGGCCAACAACTCAATTACCACCAGGATATACTTGTGCAGAACCCTATTTATTCCCAGACATTAATAAACCC
+GATGGGCCAGCAACAGCAGGGATAGATGATTTGGGTGAAATTTTAGCTAAGATGAAACAGAGAACATCGAGAGGAATAAGAAAATGAAAAGAGTTTTGTT
+CTTTTTGCTGATGATATTTGTTAGTTTTGGTGTTATAGCTGATTGCGAAATACAAGCTAAAGATCATGATTGTTTTACTATTTTCGCTAAAGGGTACTAT
+TTTTCCGCGTTTCCTGTCTTAAATAATAAAGCCATGTGGAGATGGTATCAGAATGAGGACATCGGTGAGTATTATTGGCAAACAGAACTGGGTACATGTA
+AAAATAATAAATTCACACCAAGCGGGCGAGACTCTTAATTCGCGTCGGGTCACTACGCCTTAATGAAAATCATGCCATCAAAGGAACGTTGCAGGAGTTG
+ATAAATACAGCAGAAAAACGGCGTTTCTCGGCGATCGGTTTAGAAGTTATATAAGAGCGGGTATCTATCAAAAGAGCAGTGATCCAGTTCAGTTGTTGGC
+AGTCCTTGATAATTCAATCATGGTAAAATATTTTAAAGATGAGAAACCAACTTATGCTCGAATGACAGCACATCTCCCGAACAAAATGAGTCTTACGAAT
+GTTTAATAAAGATACAGCATGAACTAATTCGTAGTGAAGAGAAATAAAATCTCTTCCTGAGAAAACAAATTAATCATTGTGAAAAATTATATAACTCATG
+GAATAGGTGTTTATTTTGCGTTCCATTTGCAGGAAAGATCACGTAACGCTACTTTTTGTACTAAATAATTCGAATTTAAGTTCAACAATTGAGATACTAC
+TTATTGTCTAAAGCTGTTTTTCATAGCTTATACATGATCAAATACTCCTTACATAAATAAGGTGAACAAATGGAACTTAAAAATTGATGGAACATATTTC
+TATTACACCCGATTACAGACAAGCCTGGAAAGTGGTGCATAAATTGTCAGATATTCTACTGTTGACTATTTGTGCCGTTATTTCTGGTGCAGAAGGTTGG
+GAAGATATAAGAGGATTTCGGGGAAACATCTCGATTTTTTGAAGCAATATGGTGATTTTGAAAATGGTATTCCTGTTCACGATACCATTGCCAGAGTTGT
+ATCAGGAAAGATCACGTAACGCTACTTTTTGTACTAAATAATTCGCATTTTATGTTTAAAAATTGAGATATTCCTTATTACCTAAAGCTGTTTTTCATAG
+CTTATACATGATCAAATACTCCTTACATAAATAAGGTGAACAAATGGAACTTAAAAATTGATGGAACATATTTCTATTATTCCCGATTACAGATAAGCCT
+GGAAAGTAGAGCATAAATTGTCCAGGCATCCTACTATTGACTATTTTGCCGTTATTTCTGGTGCGAAAGTTGGGAAGATATAGAGGATTTCGGGAAACAC
+ATCTCGATTTCTTGAAGCAATATGGTGATTTTGAAAATGGTATTCCTGTTCACGATACTATTGCCAGAGTTGTATCCTGTATCAGTCCT
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/ecoli_unassembled.fa	Fri Jun 08 04:43:41 2018 -0400
@@ -0,0 +1,1162 @@
+>tig00000007 len=3514 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
+GGCTGGATCGCTGCTGAATGTACTTCGCCGCATGACGCTGAAATCGCTGCCTCTGCGCCTGGCGGTTAGCCGCCTGTTACGTCAGCCGTGGTCAACGTTA
+AGTCAGCTTTCGGCATTTTCGCTCTCCTATGCTGCTGGCACTGCTGCTGGTGTTGCGTGGCGATCTGCTCGACCGCTGGCAGCAGCATACTCCAGAGCCC
+GAACTACTTTTTAATTAACATCGCCACAGAACAGGTAGCACCGCTAAAGCGTTCCTCGCGGAACATCAGATAGTCCCGGAATCGTTTTATCCGGTGGTGC
+GGGCGCGGCTGACGGCGATTAACGATAAGCCGACAGAAGGTAATGAAGATGAGGCGCTTAACCGCGAACTCAATCTTACCTGGCAAAATACGCGGCCCGA
+TCATAATCCGATTGTCGCCGGTAACTGGCCGCCAAAAGCCGATGAAGTGTCGATGGAAGAGGGCTGGCGAAACGCTTAAACGTTGCCCTCGGTGATACCG
+TGACTTTTATGGGCGATACCCAGGAGTTCCGCGCTAAAGTGACCAGCCTGCGCAAAGTGGACTGGGAAAGTCTGCGGCCTAATTTCTATTTTATTTTCCC
+TGAAGGGCATTAGACGGGCAACCGCAGAGCTGGCTTACCAGTTTCCGCTGGGAGAATGGCAACGGCATGTTGACACAACTCAACCGCCAGTTCCCGACCA
+TTAGCCTGTTAGATATTGGCGCGATTTTAAAACAGGTCGGTCAGGTGCTGGAGCAGGTAAGTCGGGCGCTGGAAGTGATGGTGGTACTGGTCACCGCCTG
+CGGTATGTTGCTGTTGCTGGCACAGGTGCAGGTGGGAATGCGTCAGCGTCATCAGGAGCTGGTGGTGTGGCGCACACTCGGTGCGGGAAAAACTGCTGCG
+TACCACGTTGTGGTGTGAGTTCGCCATGCTTGGGTTTGTTTCCGGCCTGGTGGCCGCAATTGGTGCGGAAACGGCGCTGGCAGTGTTGCAGGCGAAAGTG
+TTTGATTTTCCGTGGGAGCCAGACTGGCGATTGTGGATTGTTCTGCCGTGCAGCGGAGCGCTGCTGCTGTCGCTTTCGGCGGCTGGCTGGGTGCGGTTGG
+GTAAGGCGCTGTTCAGGCAGTTTGCGGGGATGAGAGTAAATAAGGGGCGTTCTGGTTGAATGGAACGCCTTGTTTAAATTAATTCTACAATATGTTTCAT
+TGATGATGTTATTGAATTGGTGATTTCTATCTTTCTATTGCTGATATTAATCTGAATCGGTGGAGTTTATTGATTTTAAATATAGCCCTACAAAATAACT
+CAGACTAATAAAATCATAAATCATATGCGTTGAATGGATATTATCCATATAGTGAATTTGTTGATGATGAATTCATCTGTGCTAAAAATGTTAGTTTAAT
+AAAATATTGAAAGTGACCTGTAATAACAGTTGTTGTTGATTGAGAACAAATAAGTTTATGTGAAAAATATATAAATACATTAGCTGGTCTTGTGTGTCAT
+TTTATTTTTTGTTGCTAACACAGGGATATGAACAATAACTAAAGGGCACTTTATAGAGCGGAAAACCAGCGGCGCGTCGGGAGATATGACTCAGTATGGC
+GGTCCCATTGTCCAGGGTTCGGCAGGTGTAAAATTGGCGCGCCCACCGGCGTGGCGTGCTCGGTGTGTCCGGGCGGGATGACTTCGGGCAACCCGGTAAA
+TCCGCTGCTGGGGGCGAAGGTGCTGCCCGGCGAGACGGACCTTGCGCTGCCCGGCCCGCTGCCGTTCATTCTCTCCCGCACCTACAGCAGCTACCGGACG
+AAGACGCCTGCACCGGTGGGCGTTTTCGGCCCCGGCTGAAAGCGCCTTCTGATATCCGCTTACAGCTACGTGATGACGGACTGATACTCAACGACAACGG
+CGGGCGGAGCATTCACTTTGAGCCGCTGCTGCCGGGGAGGCGGTGTACAGCCGCAGTGAGTCAATGTGGCTGGTGCGCGGTGGTAAGGCAGCACAGCCGG
+ACGGCCATACGCTGGCGCGGCTGTGGGGGCGCTGCCGCCGGATATCCGGTTAAGCCCGCATCTTTACCTGGCGACCAACAGCGCACAGGGGCCGTGGTGA
+TACTGGGGTGGTCTGAGCGGGTGCCGGGTGCTGAGGACGTACTGCCAGCGCCGCTGCCGTACCGGGTGCTTACCGGGATGGCGGACCGCTTCGGGCGGAC
+GCTGACGTACCGGCGTGAGGCCGCCGGTGACCTGGCCGGAAATCACCGGCGTGACGGACGGTGCCGGGCGGGAGTTCCGTCTGGTGCTGACCACGCAGGC
+GCAGCGTGCGGAAGAGGCCCACCTCTTCGCTATCTTCTTCTGACAGTTCCCGCCCTCTCTCAGCCTCAGCGTTCCCCGACACACTGCCCGGTACCGAATA
+CGGCCCCGAGGTGGGCGGTGATGCACGACCCGGCATACCCGGAGAGCCTGCCCGCTGCGCCACTGGTGCGGTACACGTATACGGAAGCCGGTGAACTGCT
+GGCGGTATATGACCGCAGCAATACGCAGGTGCGCGCTTTCACGTATGACGCGCAGCACCCGGGCCGGATGGTGGCGCACCGTTACGCGGGAAGGCCGGAG
+ATGCGCTACCGCTACGACGATACGGGGCGGGTGGTGGAGCAACTGAACCCGGCAGGGTTAAGCTACCGCTATCTTTATGAGCAGGACCGCATCACCGTCA
+CCGACAGCCTGAACCGGCGTGAGGTGCTGCATACAGAAGGCGGGGCCGGGCTGAAACGGGTGGTGAAAAAGAACTGGCGGACGGCAGCGTCACGCGCAGC
+GGGTATGACGCGGCAGGAAGGCTCACGGCGCAGACGGACGCGGCGGGAGGAGGACAGAGTACGGTCTGAATGTGGTGTCCGGCGATATCACGGACATCAC
+CACACCGGACGGGCGGGAGACGAAATTTTACTATAACGACGGGACCAGCTGACGGCGGTGGTGTCCCGGACGGGCTGGAGAGCCGCCGGAATATGATGAA
+CCGGGCAGGCTGGTATCGGAGACATCGCGCAGCGGGGAGACAGTACGCTACCGCTACGATGACGCGCACAGTGAGTTACCGGCGACGACAACGGATGCGA
+CGGGCGCACCAACAGATGACCTGGAGCCGCTACGGGCGTTGCTGGCGTTCACCGACTGCTCGGGCTACCAGACCCGTTATGAATACGACCGCTTCGGCCA
+GATGACGGCGGTCCACCGCGAAGGCATCAGCCTTTACCGCCGCTATGACAACCGTGGCCGGTTAACCTCGGTGAAAGACGCACAGGGCCGTGAAACGCGG
+TATGAATACAACGCCGCAGAGCGACCTACTGCCGTTATCACCCCGGACGGCAACCGGAGCGAGACACAGTACGATGCGTGGGGAAAGGCGGTCAGCACCA
+CGCAGGGCGGGCTGACGCGCAGTATCATTACGATGCTGCCGGATGTCATCAGCCCTGACCAACGAGAACAGGCAGCCACAGCGTCTTCAGTTACGATGCG
+CTGGACCGGCTGGT
+>tig00000008 len=2220 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
+AGTGCGGTTGGGTTTTTCAAACGGATGCGACAGCAGTTGGCATTAAAGAAGCCACCGCCGTTAGGCGCCGAGCATCTTGATGCTTCCACGAAGCTACGAT
+ACCGCCGGGTAACAGCTGTTGCGCTCCTTCAACGGTATTCCTACGGCCTGTTGAGCAGAAAGTTTTGCAGCGCAGCGAATAAAAACAGTGCAATCAACAA
+CGCCACGGGACTAGCACCCATAACGTGGTGCGTAGCAGATCGACCCAGGCATTCCCGAGCGTGCTCATGCTCTGGCGGGTAAACGCACGGATGGGGCAAA
+ATCACCCTGTCCCGCTGGCGGCAGAAGAAAGTTTTGCACCGTTAGCCCGCCATCTGGCTGAAATAGCTCAACGTGGTTTCACCGCTATAAGATTGCCAGT
+TGGTATTGGTGACAAACGACGGCGGTATTCAGCTCCATTTCAGCCACAGCTGCTGTGGATTAGCGGCAGATAGTGCTGACCGAGCAACATAAAAACAGCA
+CCGCCAGCCCCAGCATGTTTCGGGCCGAGAATGGCACAAAGATATTGCTTCCAGTTCATCTCACGGTCAGAGACGCCAGGTGCGAAAAAGTACGCGCTCA
+ACGCCCGTTGTACCGGGAAGAGGAATCATTAATCTGGCCGCGCCAGCCCGCTGCCTAAAGGACGCGCCAGCACCATTAACACCAGTAAAAACGTGGCGAT
+CAGTAAGAACCCTTGCGCAGCCATCAGACACGCTCCGCATTGATCGGGGCATAAACCAGAATGCGGTAATAAAACACCAGCAATGCGCCGGGTATCGCCT
+GCACTCACAGTGCACCTCCAGTGGCCTAAAAGTGATACCGGAAGGGTGAATTCTGTGGCTGCAAAGATTTCGCAAAATCTGCGGGCGGGGTGTAAAAAGT
+ATAAAAATGGCAAAAGCCTTGATTTAACTAATGTTTAGTATTAATTTAACTTTTGTGTAACTTAATTACAGGATGAATGTAAATAAACATCAATAAGCAA
+AAATAGAGTGGTCGGATGAGTAGTAAAAATTACACAAAAAGGCGGTACTATTTTCATCAGATAAACAAATTCATTTTTCCGGTGCCATTCACCGAATTGG
+GCAAAGGAAAGTATGGAACTCTACAGAGAATATCCTGCATGGCTTATCTTTTACGCCGTATGCCTGCGGTTGCAGCGGGCGTTCTGGCGCTGCCTTTCAT
+GCTTTCTGGAAAGACGCGCCCGCTTTTTGCAATACCATCGCGTCTGATTCGAAAACCAGCGATAAACCAGGTGTGGATGGATCGGGCGAAAAGGCAACTG
+GTGATTTTATTGATTGCTGAGTTTGAATATACATTGAAAACCGCCAGCGGAAACGCTGGCGGTTTTGTATCAGGAAGATGTTCAGAGGAATATTTGAACA
+TCGTTATACCAATCGAAACGTATATTCTGCCAAATATATATAAATATTTTCTAATTGTTCTTATCTGACAGATATCTCTTAAGGCTTTCTTATAAATCTG
+TAGGGTTTCGCCTGTCAGCGAACAAATAACCCGATAAAACAAGGATGAGCAGATGAGCGGAAAACCGGCGGCGCGTCAGGGTGACATGACGCAGTATGGC
+GTAGCATTGTCCAGGAGTTCAGCCGGGGTACGCATCGGTGCCCCACCGGCGTGGCCTGTTCGGTGTGCCCCGGCGAGTGACGTCCGGCCATCCGGTCAAT
+CCGCTGCTCGGTGCAAAGGTCCTTCCCGGTGAAACCGACATCGCCCTGCCCGGCCCGCTGCCGTTCATTCTCTCCCGCACCTACAGCAGTTACCGGACAA
+AAACGCCCGCGCCGGTAGAGGCCTCGGCCCCGGCTGAAAATGCCTGCGGATATCCGCTTACAGCTGCGCGATAACACACTGATACTCAGTGATAACGGCG
+GCAGAAGCCTGTATTTTGAGCACCTGTTTCCCGGTGAGGACGGTTACAGCCGCAGCGAGTCACTGTGGCTGGTGCGCGACGGCGTGAAAGCGAAACTGGA
+TGAAGCAAGGTCTGGCTGGCCGCCTCTGGCAGGCGCTGCCGGAGAAGAACTCGCTTAAGTCCGCATCGTTATCTGGCGACAAACAGTCCACAGGGGCCGT
+GGTGGCTGCTCGGCTGGTGTGAGCGGGTGCCGGAAGCGGATGAGTGCTGCCTGCGCCTTTGCCGCGCCGTACCGGGTACTGACCGGGCTGGTGGACCGCT
+TCGGGCGCACACAGACGTTC
+>tig00000009 len=4261 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
+TGGCCTGCGCTTTACTGCGGCCTTTGCCCAGCGCCTCGGCGAAATTAGCGAACAGTACGGTGATCCACAGCCAACCGCTTCGCCGCGCTTCAGCGCTTTA
+ATTGCCGGGCATCGCACCGCTTGCCATCGCGATGCTAATACAGGTGGTCAGCAGACTGCCGATCCAGACGATAAACATCACCGGATTGCGCCATTGCGCC
+TGCGGGTTTAATTTTCACCGCTTCTTTCAGCGCCTGAACGACAAGTGTTGGTTCGAATAGCGCCAGGCGACTCATATTCAGTGCTCACTCAATATCATCA
+GGAGAGATATTCCGCCACCGGACCAAGCGCCAGGGCAGGGATAAAGGTCACGCCAACCAGCAACACGGTGCCGATTAACAGGCCAACAAACAGCGGGCCG
+TGCGTTGCAGCGCTGCCGGAGCTGGCGGCTTGGCTCTTTTACTCACCAGCGAACCGGCAATTGCATCACCGGGATAATCACCCGAAGCGACCGACAAACA
+TGCAGAACGCCAGTAAACAGTTCCAGAACGGAGAGTTGGCGCTTAATCCGGCAAAGGCGCTGCCGTTGTTGTTAGCGGCGGATGACACGGCGTACAGCAC
+TTCAAAACCATGCGGGCCAGGGTTGAGCATGGCGCTACGTCCGGCGTCGGTCATCATCGCCAACGCCGCGCCCATCAGCACAGCGTCGGGGTAACCAGAA
+TTGCCAGTGCAGTCAGTTTCATCTCGCGTACGTCGATTTTTTATGATATTCCGGTGTACGACCAATCATCAGCCCGGCAATAAACACCGCCAGCAGGACA
+AACAGCATCATGCCGTAAAGACCAGAACCGACACCGCCGAACACCACTTCACCAATTTGCATCAGCCACACATGCACATGCGAGAGCGGTAAACGAATCA
+TGCATCGCAATCACCGCGCCACAGGAAGCCGCCGTCGTCACGACCGCAAACAGGCTACTGACCAGCACGCCGAAACGGCTCTCTTTACCTTCCATATTGA
+TGCTGCTGTCCGTGCCCAGTGCCAGCAGATGAGGATTACCCTGAACTTCTGCCCACATCACCACGCCTACGCAGATGACAAAATCACTGACATCGCCCAC
+AGCAACATGCGCCCTGGCGGCGATCGCCCATCACTTCACCAAAGGCAAAGCACAGCGCCGTTGGGATCAAGAAGATCGCCAGCATCTGCACGAAGTTGGT
+CAGTGCGGTTGGGTTTTCAAACGGATGCGACGAGTTGGCATTAAAGAAGCCACCGCCGTTAGTACCGAGCATCTTGATCGCTTCCTGAGAAGCTACAGGC
+CCCATGGGTAACAGCTGTTGCGCTCCTTCAACGGTATTCACAGCCTGATAAGGCAGAAAGTTTAGCGCAGTTGAAATAAAAACAGTGCAATCAACAACGC
+CACAGGGGACTAGCACCCATAACGTGATGCGATCGACCCAGGCATTCCCGAGCGTGCTCATGCTCTGGCGGGTAAACGCACGGATGAGGGCAAAATCACC
+GCAATCCCGCTGGCGGCAGAAAGTTTTGCACCGTTAAGCCCGCCATCTGGCTGAAATAGCTCAACGTGGTTTCACCGCTATAAGATTGCCAGTTGGTATT
+GGTGACAAAGCTGACGGCGGTATTCAGCGCCAGATCCCACGACCAGCTGGCTGCTGTGGATTAAGCGGCAGATAGTGCTGACCGAGCAACATAAAAACAG
+CACCGCCAGCCCCAGCATGTTCAGGCCGAGAATGGCACAAAGATATTGCTTCCAGTTCATCTCACGGTCAGAGACGCCAAGTGCGAAAAAAGTACGCGCT
+CAACGCCCGTTGTACCGGGAAGAATGTCATTAATCAGCCGCGCCAGCCCGCTGCCTAAAGGACGCGCCAGCACCATTAACACCAGTAAAAACGTGGCGAT
+CAGTAAGAACCCTTGCGCAGCCATCAGAACGCCTCCGCATTGATCAGGGCATAAACCAGATAACCCAGTAATAAAACACCAGCAATACGCCGGTTATCAC
+GCCTGCACTCACAGTGCACCTCCAGTGGCCTAAAAGTGATACCGGAAGGGTAGAATTCTGGCTGCAAAGATTTCGCAAAATCTGCGGGCGTAAAAAAAGT
+ATAAAATGGCAAAAGCCATGATTTAACTAATGTTTAGTATTAATTTAACTTTGTGTAACTTAATTACAGGATGAATGTAAATAAACCATCAATAAGCAAA
+AATAAGTGGTCGGATGAGTAGTAAAATTACACAAAGGCGGTACTATTTTCATCAGATAAACAAATTCATTTTTCCGGTGCCATTCACCGGGTAGATACAA
+AAGGGGAGAAAAGTATGGAACTCTACAGAGAATATCCTGCATGGCTTATCTTTTACGCCGTACTTACATGCGGTTGCAGCGGGCGTTCTGGCGCTGCTTT
+CATGCTTTTCTGGAAAGACCGCGCCCGCTTTTACAGCTACCTGCATCGCGTCTGGTCGAAAACCAGCGATAAACCGGTGTGGATGGATCAGGCCGAAAAA
+GGCAACTGGTGATTTTGATTGCTGAGTTTTGAATATTGAAAACCGCCAGCGGAAACGCTGGCGGTTTTTTATCAGGAAGATGTTCAGAGGAATATTTAGA
+CATCGTTATACCAATCGAAACATATATTCATGAAATATATAAATATTTTCCTAATTGTTCTTATCTGACAGATATCTCACTTAAGGCTTTCTTATAAATC
+GCCTTTCGCCAGCAGACAAATAACCCGATAAAACAAGGATGAGCAGATGAGCGGAAAACCGGCGGCGCGTCAGGGCGACATGACGCAGTATGGCGGTAGC
+ATTGTCCAGGGTTCAGGGGGTACGTCGGTGCCCCACCGGCGTGGCCTGTTCGGTGTGCCCCGGCGGGACGTCCGGCCATCCGGTCAATCCGCTGCTCGGT
+GCAAAGGTCCTTCCCGGTGAAACCGACATCGCCCTGCCCGGCCCGCTGCCGTTCATTCTCTCCGCACCTACAGCAGTTACCGGACAAAACGCCCGCGCCG
+GTGGGGAGCCTCGGCCCCGGCTGGAAAATGCCTGCGGATATCCGCTTACAGCTGCGCGATAACACACTGATACTCAGTGATAACGGCGGCAGAAGCCTGT
+ATTTTGAGCACCTGTTTCCCTGAGGACGGTTACACAGCGAGTCACTGTGGCTGGTGCGGCGGCGTGGCGAAACTGGATGAAGGTCACCGGCTGGCCGCAC
+TCTCTGGCAGGCGCTGCCGGAAGAACTCCGCTTAAGTCCGCATCGTTATCTGGCGACAAACAGTCCGCAGGGGCCGTGGTGGCTGCTCGGCTGGTGTGAG
+CGGGTGCCGGAAGCGGATGAGGTGCTGCCTGCGCCGCTGCCGCCGTACCGGGTACTGACCGGGCTGGTGGACCGCTTCGGGCGCACACAGACGTTCCACC
+GCGAAGCCGCCGGTGAATTCAGCGGCGAAATCACCGGCGTGACGGATGGTGCCGGGCGTCACTTCCGCTGGTACTGACCACGCAGGCGCAGCGGGCAGAA
+GAAGCCCGGCAGCAGGCCATTTCCGGCGGGACGGAACCGTCCGCTTTTCTGATATACCGGGTTACACCGAATATGGCCGGACAACGGCATCCGTCTGTCT
+GCCGTGTGGCTGACGCACGAATACCCGGAGAATTTACCTGCCGCGCCGCTGGTGCGCTATGGCTGGACGCCCGCGGCGAACTGGCGGCGGTGTATGACCG
+CAGCAATACACAGGTGCGCAGCTTTACTTACGATGATAAATACCGGGGCCGGATGGTGGCGCACCGTCACACGGGCCGACCGGAAATCTGTTACCGTTAC
+GACAGCGACGGGCGGGTGACAGAACAGCTAAACCCGGCAGGCTTAAGTTACACGTATCAGTATGAGAAGGACCGCATCACCATCACCGACAGCCTGAACC
+GCCGTGAAGTCCTGCACAAGCAGAAGCGGGCTGAAGGGGTGGTGAAAAGGAACACGCGGACGGCAGCGTCACGCAGAGTCAGTTTGACGCGGTGGGCAGG
+CTCAGGGCACAGACGGATGCCGCAGGCAGGACAACAGAATACAGTCCGGATGTGGTGACGGGCCTCATCACGCATCACCACGCCGGATGGCAGGGCATCG
+GCGTTTTACTATAACCACCACAGCCAGTTAACGTCAGCCACCGGGCCTGACGGGCTACGCCGGGAATATGATGAATGGGGCCGTCTGATTCAGGAAACTG
+CCCCTGACGGCGATATCACCCGCTACCGTTATGATAATCCACACAGTGACTTACCCTGCGC
+>tig00000010 len=6489 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
+CGTCATCTGGCCGAAGCGGTCGTATTCATAACGGGTCTGGTAGCCCGAGCAGTCGGTGAACGCCAGCAACTGCCCGTAGCGGCTCCAGGTCATCTGCCGG
+GTGCTGCCGTCGCATCCGTTGTCGTCGCCGGTAACTCACTGTGCGCGTCATCGTAGCGGTAGCGTACTGTCTCCCCGCTGCGCGATGTCTCCGATACCAG
+CCTGCCCGGTTCATCATATTCCGGCGGCTCTCCAGCCCGTCCGGGGACACCACCGCCGTCAGCTGGTTCCGTCGTTATAGTAAAATTTCGTCTCCCGCCC
+GTCCGGTGTGGTGATGTCCGTGATATCGCCGGACACCACATTCAGACCGTACTCTGTCCTCCGTCCCGCGTCCGTCTGCGCCGTGAGCCTTCCTGCCGCG
+TCATACCCGCTGCGCGTGACGCTGCCGTCCGCCAGTTCTTTTTCACCACCGTTTCAGCCCGGCCCCGCCTTCTGTATGCAGCACCTCACGCCGGTTCAGG
+CTGTCGGTGACGGTGATGCGGTCCTGCTCATAAAGATAGCGGTAGCTTAACCCTGCCGGGTTCAGTTGCTCCACCACCCGCCCCGTATCGTCGTAGCGGT
+AGCGCATCTCCGGCCTTCCCGCGTAACGGTGCGCCACCATCCGGCCCGGGTGCTGCGTCATACGTGAAAGCGCGCACCTGCGTATTGCTGCGGTCATATA
+CCGCCAGCAGTTCACCGGCTTCCGTATGCGTGTACCGCACCAGTGGCGCAGCGGGCAGGCTCTCCGGGTATGCCGGGTCGTGCATCAGCCACACCGCCGA
+AAGGCGGATACCCTGTCGGGGCCGTATTCGGTACCGGGCGGTGTGTCGGGGAACGCTGAGGCTGAGAGAGGGCGGGAACTGTCAGAAGAAGATAGCGAAG
+AGGTGGGCCTCTTCCGCACGCTGCGCCTGCGTGGTCAGCACCAGACGGAACTCCCGCCCGGCACCGTCCGTCACGCCGGTGATTTCCCCGGCCAGGTCAC
+CGGCGGCCTCACGCCGGTACGTCAGCGTCCGCCCGAAGCGGTCCGCCATCCCGGTAAGCACCCGGTACGGCGGCAGCGGCGCTGGCAGTACGTCCTCAGC
+ACCCGGCACCCGCTCAGACCACCCCAGTATCACCACGGCCCCTGTGCGCTGTTGGTCGCCAGGTAAAGATGCGGGCTTAACCGGATATCCGGCGGCAGCG
+CCCCCACAGCCGCGCCAGCGTATGGCCGTCCGGCTGTGCTGCCTTACCACCGCGCACCAGCCACATTGACTCACTGCGGCTGTACACCGCCTCCCCGGCA
+GCAGCGGCTCAAAGTGAATGCTCCGCCCGCCGTTGTCGTTGAGTATCAGTCCGTCATCACGTAGCTGTAAGCGGATATCAGAAGGCGCTTTCAGCCGGGG
+CCGAAAACGCCCACCGGTGCAGGCGTCTTCGTCCGGTAGCTGCTGTAGGTGCGGGAGAGAATGAACGGCAGCGGGCCGGGCAGCGCAAGGTCCGTCTCGC
+CGGGCAGCACCTTCGCCCCCAGCAGCGGATTTACCGGGTTGCCCGAAGTCATCCCGCCCGGACACACCGAGCACGCCACGCCGGTGGGCGCGCCATTCTT
+ACACCTGCCGAACCCTGGACAATGGGACCGCCATACTGAGTCATATCTCCTGACGCGCCGCTGGTTTTCCGCTCATATAAAGTGCCCTTTTAGTTATTGT
+TCATATCCCTGTGTTAGCAACAAAAAATAAAATGACACACAAGACCAGCTAATGTATTTATATATTTTTCACATAAACTTATTTGTTCTCAATCAACAAC
+AACTGTTATTACAGGTCACTTTCAATATTTTATTAAACTAACATTTTGCACAGATGAATTCATCATCAACAAATTCACTATATGGATAATATCCATTCAA
+CGCATATGATTTATGATTTTATTAGTCTGAGTTATTTTTGTAGGGCTATATTTAAAATCAATAAACTCCACCGATTCAGATTAATATCAGCAATAGAAAG
+ATAGAAATCACCAATTCAATAACATCATCAATGAAACATATTGTAGAATTAATTTAAACAAGGCGTTCCATTCAACCAGAACGCCCTTATTTACTCTCAT
+CACCCGCAAACTGCCTGAACAGCGCCTTACCCTTTAACCAGTCGCGCACCCAGCCAGCCGCCGAGCGACAGCAGCAGCGCTCCGCTGCACGGCAGAACAA
+TCCACAATCGCCAGTCTGGCTCCACGGAAAATCAAACACTTTCGCCTGCAACACTGCCAGCGCCGTTTCCGCACCAATTGCGGCCACCAGGCCGGAAACA
+AACCCAAGCATGGCGAACTCACACCACAACGTGGTACGCAGCAGTTTTTCCCGCACCGAGTGTGCGCCACACCACCAGCTCCTGATGACGCTGACGCATT
+CCCACCTGCACCTGTGCCAGCAACAGCAACATACCGCAGGCGGTGACCAGTACCACCATCACTTCCAGCGCCCGACTTACCTGCTCCAGCACCTGACCGA
+CCTGTTTTAAAATCGCGCCAATATCTAACAGGCTAATGGTCGGGAACTGGCGGTTGAGTTGTGTCAACATGCCGTTGCCATTCTCCCAGCGGAAACTGGT
+AAGCCAGCTCTGCGGTTGCCCGTCTAATGCCCTTCAGGGAAAATAAAATAGAAATTAGGCCGCAGACTTTCCCAGTCCACTTTGCGCAGGCTGGTCACTT
+TAGCGCGGAACTCCTGGGTATCGCCCATAAAAGTCACGGTATCACCGAGGGCAACGTTTAAGCGTTTCGCCAGCCCCTCTTCCATCGACACTTCATCGGC
+TTTTGGCGGCCAGTTACCGGCGACAATCGGATTATGATCGGGCGCGTATTTTGCCAGGTAAGATTGAGTTCGCGGTTAAGCGCCTCATCTTCATTACCTT
+CTGTCGGCTTATCGTTAATCGCCGTCAGCCGCGCCCACCACCGGATAAAACGATTCCGGGACTATCTGATGTTCCGCGAGGAACGCTTTTAGCGGTGCTA
+CCTGTTCTGTGGCGATGTTAATTAAAAGTAGTTCGGGCTTTCTGGAGGTAGCTGCTGCCAGCGGTCGAGCAGATCGCCACGCAACACCAGCAGCAGTGCC
+AGCAGCATAAAGGAGAGCGAAAATGCCGAAAGCTGACTTAACGTTGACCACGGCTGACGTAACAGGCGGCTAACCGCCAGGCGCAGAGGCAGCGATTTCA
+GCGTCATGCGGCGAAGTACATTCAGCAGCATCCAGCCCAGCACACCGCAGCAAAGCCAGTACTACCGCGCCCGCCAGCACCGCCCAAAGCAGCATGCTGC
+CACCCATTAATCCGGCGAGCAGCAGCACAACCACCACACTGACAATCGGCAGATAAAACTTCAGCGGCCAGACGTTCGCTACCACATCATTACGTAATAC
+GCGTAAAGGCTGCGTTGCCAGCAACAAGCGATATGGTCGTAGCCCCACCAGCAGCGAGATGACCGTCATGGTGCCAAGCGCCCACAGCCACGGCCAGAGG
+CTGGCTGGCGGTAGTGCAGCAGGCAGAACGGGCTTGAGCAGCACCATCAACACGTTTCGAACAACAGGCCTATGGCCCCACCGGTAACGGCTGAAAGCGT
+CAGCACCATCAACCACTGACCGACGATTAGCTTACGCAGTTGCTCGCCCTGCCCCCAGCGTTTTGAGGATCGCCACCAGATCGTAGCGACTGCGACAGTA
+ATGATTCATCGCTACCGCCACCGCTGCCACTGCCAGCAGCAAGGTCAGAAGCGCCGAAAGCAGCAGGAACTGTTGCGAGCGTTCCATCGATCGCCCCAGC
+GCGCCTTCGTCCTGTTCCAGACCGTACCAGCGTTGTTCGGGTTTAAGCTGGGTAACAACCATTTCATAGCCGTCGAGCTGGTTCTCGTTGCCGCCGAATT
+TATAACGCCAGGTGACCCGACTCCCCGGCTGCACGGCTCCGGTTTTATCGACATCCGCCAGATTCATCATCAGACGCGGAGCCATCTGGAAGGGTTAAAA
+CCGGAATCCGGTTCCTGAATCACTTCTCCGGCAATCCGCAAGGTGGCATCGCCCACGTCAATGGTGTCGCCCGTTTTCAGGTTAAGCAGTGCCATCAGGC
+GTGGGGCCAGCAATACGCTGCCCGCCTGCGGTTTCAGGCCAGGGGATTAGTTTGCAGATCGCCATACATCGGGTAGATATCATCCACCGCTTTGACGTTC
+GCCAGCTGCGGTGTGTCGCCTGCAAAGGTCATTGTGGCGAAAGTCAGCTTGCCGACTTTCAGGCCGCGCTTTGCGCTTCCTCCAGCCACGCTTGCGGCAC
+TTCGCGTGAACTGCGCAACGCCCGATCGCCCGCCATAAACTCACGGCTTTGCTGGCTTAAGCCCTTCTCCATGCGATCGCTGATATTGCCCAGCGCCAGC
+ACGCAGGCCACCGCCAGGCTTAGCGCCAGCCAGACAATTAATAGCGACGGCGAACGCCATTCGCGCCAGAACCAACGTGCAATCATGCTTCCTCCTGCAA
+CTGCCCGTTCACCAGCCGTAAGCAGCGGTCGCAGCGCCGCCAGTTGCAGGTCGTGGGTCACCATAATCAACGTGGTGCCATGTTCACGGTTGAGGAAAAC
+AGCAGGTCGGCAATTTTATCGCCCGTCTGGCGGTCAAGGTTGCCGGTTCGTCGGCAAACAGCATCAGGTCGACCATTAAAGGCTCGTGCCAGCGCCACTC
+GTTGCTGTTCACCGCCGGAAAGCTGTGCCGGAAGATGATCAGACGTTTACCCAGCCCTAACTGTTCGAGCAACGCTTTCGCCCCGTTACGACTTTCCGCG
+CTCTCACCGCGCAGCAGGCCGGAAGCTCGACGTTTTCCAGCGCGTTAAGGGTAGGAATTAACATAAATGACTGAAAAACAAAGCCGACGTGCTTCGCGCG
+CAACTTTGCCCGCGCTTCTTCGTCCATATTATGTGGCGGTTGTCCCCGGAGCTCACTTCGCCACTGCTGCCGTCATCAAGCCCGGCGAGGATCGCCAGCA
+AGGTTGACTTACGATCCCGACTCGCCCACCAGTGCGATGGTCTCGCCGTTTGACAACCAGCTCAACTCCGGTGAGGATGGAGAGTTCATGCTCCCTGACC
+GACGGACTTCTTAAGATGATGAACTTCAACAATGTTTTCCGCTGGCATTTGCCCTTCCTGTTCCTGGTCCCAGTTAACCTTCCGTGCCGCCGCAGCCGTT
+ATTGATTCTGGGTGATAGCCTGAGCGCCGGGTATCGAATGTCTGCCAGCGCGGCCTGGCCTGCCTTGTTGAATGATAAGTGGCAGAGTAAACGTCGGTAG
+TTAATGCCAGCATCAGCGGCGACACCTCGCAACAAGGACTGGCGCCTTCCGGCTCTGCTGAAACAGCATCAGCCGCGTTGGGTGCTGGTTGAACTGGGGG
+CAATGACGGTTTGCGTGGTTTTCAGCCACAGCAAACCGAGCAAACGCTGCGCCAGATTTTGCAGGATGTCAAAGCCGCCAACGCTGAACCATTGTTAATG
+CAAATACGTCTGCCTGCAAACTATGGTCGCCGTTATAATGAAGCCTTTAGCGCCATTTACCCCAAACTCGCCAAAGAGTTTGATGTTCCGCTGCTGCCCT
+TTTTTATGGAAGAGGTCTACCTCAAGCCACAATGGATGCAGGATGACGGTATTCATCCCAACCGCGACGCCCAGCCGTTTATTGCCGACTGGATGGCGAA
+GCAGTTGCAGCCTTTAGTAAATCATGACTCATAAAGCAACGGAGATCCTGACAGGTAAAGTTATGCAAAAATCGGTTAATTACCGGATGTTCCAGTGGAA
+TTGGCCTGGAGCGCTCGAATTAAAACGCCAGGGTTTTCATGCTGGCAGGTTGCCGGAAACCGGATGATGTTGAGCGCACGAACGGCATGGGATTTACCGG
+CGTGTTGATCGATCTGGATTCACCAGAAAGTGTTGATCGCGCAGCCGACGAGGTGATCGCCTGACCGATAATTGTCTGTATGGGATCTTTAACAATGCCG
+GATTCGGCATGTATGGCCCCTTTCCACCATCAGCCGTGCGCAGATGGAACAGCAGTTTCCGCCAACTTTTCGGCGCACACCAGCTCACCATGCGCCTGTT
+ACCCGCGATGTTACCGCACGGTGAGGGCGTATTGTGATGACATCATCGGTGATGGGATTAATCTCCCGCCGGGTCGTGGCGCTTACGCGGCCAGTAAATA
+TGCGCTGGAGGCGTGGTCAGATGCACTGCGCATGGAGCTGCGCCACAGCGGAATTAAAGTCAGCCTGATCGAACCCGGTCCCATTCGTACTCGCTTCACC
+GACAACGTCAACCAGACGCAAAGTGATAAACCAGTCGAAAATCCGGCATCGCCGCCCGCTACGTTGGGACCGGAAGCGGTGGTGGACAAAGTACGCCATG
+CTTTTATTAGCGAAGCCGAAGATGCGCTATCCGGTGACGCTGGTGACCTGGGCGGTAATGGTGCTTAAGCGCCTGCTGCCGGGGCGCGT
+>tig00000011 len=3677 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
+CGGCTCCAGGTCATCTGCCGGGTGCTGCCGTCGCATCCGTTGTCGTCGCCGGTAACTCACTGTGCGCGTCATCGTAGCGGTAGCGTACTGTCTCCCCGCT
+GCGCGATGTCTCCGATACCAGCCTGCCCGGTTCATCATATTCCGGCGGCTCTCCAGCCCGTCCGGGGACACCACCGCCGTCAGCTGGTTCCGTCGTTATA
+GTAAAATTTCGTCTCCCGCCCGTCCGGTGTGGTGATGTCCGTGATATCGCCGGACACCACATTCAGACCGTACTCTGTCCTCCGTCCCGCCGCGTCCGTC
+TGCGCCGTGAGCCTTCCTGCCGCGTCATACCGCTGCGCGTGACGCTGCCGTCCGCCAGTTCTTTTTTCACCGTTTCAGCCCGGCCCCGCCTTCTGTATGC
+AGCACCTCACGCCGGTTCAGGCTGTCGGTGACGGTGATGCGGTCCTGCTCATAAAGATAGCGGTAGCTTAACCCTGCCGGGTTCAGTTGCTCCACCACCC
+GCCCCGTATCGTCGTAGCGGTAGCGCATCTCCGGCCTTCCCGCGTAACGGTGCGCCACCATCCGGCCCGGGTGCTGCGCGTCATACGTGACGCGCACCTG
+CGTATTGCTGCGGTCATATACCGCCAGCAGTTCACCGGCTTCCGTATGCGTGTACCGCACCAGTGGCGCAGCGGGCAGGCTCTCCGGGTATGCCGGGTCG
+TGCATCAGCCACACCGCCGAAAGGCGGATACCCTGTCGGGGCCGTATTCGGTACCGGGCGGTGTCGGGGAACGCTGAGGCTGAGAGGGGGGAACTGTCAG
+AAGAAGATAGCGAAGAGGTGGGCCTCTTCCGCGCTGCGCCTGCGTGGTCAGCACCAGACGGAACTCCCGCCCGGCACCGTCCGTCACGCCGGTGATTTCC
+CGGCCAGGTCACCGGCGGCCTCACGCCGGTACGTCAGCGTCCGCCCGAAGCGGTCCGCCATCCCGGTAAGCACCCGGTACGGCGGCAGCGGCGCTGGCAG
+TACGTCCTCAGCACCCGGCACCCGCTCAGACCACCCCAGTATCACGGCCCCTGTGCGCTGTTGGTCGCCAGGTAAAGATGCGGGCTTAACCGGATATCCG
+GCGGCAGCGCCCCCACAGCCGCGCCAGCGTATGGCCGTCCGGCTGTGCTGCCTTACCACCGCGCACCAGCCACATTGACTCACTGCGGCTGTACACCGCC
+TCCCCGGCAGCAGCGGCTCAAAGTGAATGCTCCGCCCGCCGTTGTCGTTGAGTATCAGTCCGTCATCACGTAGCTGTAAGCGGATATCAGAAGGCGCTTT
+CCAGCCGGGGCCGAAAACGCCCACCGGTGCAGGCGTCTTCGTCCGGTAGCTGCTGTAGGTGCGGGAGAGAATGAACGGCAGCGGGCCGGGCAGCGCAAGG
+TCCGTCTCGCCGGGCAGCACCTTCGCCCCAGCAGCGGATTTACCGGGTTGCCCGAAGTCATCCCGCCCGGACACACCGAGCACGCCACGCCGGTGGGCGC
+GCCAATTTTACACCTGCCGAACCCTGGACAATGGGACCGCCATACTGAGTCATATCTCCTGACGCGCCGCTGGTTTTCCGCTCATAAAGTGCCTTTTAGT
+TATTGTTCATATCCCTGTGTTAGCAACAAAAAATAAAATGACACACAAGACCAGCTAATGTATTTATATATTTTTCACATAAACTTATTTGTTCTCAATC
+AACAACAACTGTTATTACAGGTCACTTTCAATATTTTATTAAACTAACATTTTAGCACAGATGAATTCATCATCAACAAATTCACTATATGGATAATATC
+CATTCAACGCATATGATTTATGATTTTATTAGTCTGAGTTATTTTTGTAGGGCTATATTTAAAATCAATAAACTCCACCGATTCAGATTAATATCAGCAA
+TAGAAAGATAGGAAATCACCAATTCAATAACATCATCAATGAAACATATTGTAGAATTAATTTAAACAAGGCGTTCCATTCAACCAGAACGCCCTTATTT
+ACTCATCACCCGCAAACTGCCTGAACAGCGCCTTACCTTAACCAGTCGCGCAGCCAGCCGCCGAAAGCGACAGCAGCAGCGCTCCGCTGCACGGCAGAAC
+AATCCACAATCGCCAGTCTGGCTCCCACGGAAAATCAAACACTTTCGCCTGCAACACTGCCAGCGCCGTTTCCGCACCAATTGCGGCCACCAGGCCGGAA
+ACAAACCCAAGCATGGCGAACTCACACCACAACGTGGTACGCAGCAGTTTTTCCCGCACCGAGTGTGCGCCACACCACCAGCTCCTGATGACGCTGACGC
+ATTCCCACCTGCACCTGTGCCAGCAACAGCAACATACCGCAGGCGGTGACCAGTACCACCATCACTTCCAGCGCCCGACTTACCTGCTCCAGCACCTGAC
+CGACCTGTTTTAAAATCGCGCCAATATCTAACAGGCTAATGGTCGGGAACTGGCGGTTGAGTTGTGTCAACATGCCGTTGCCATTCTCCCAGCGGAAACT
+GGTAAGCCAGCTCTGCGGTTGCCCGTCTAATGCCCTTCAGGGAAAATAAAATAGAAATTAGGCCGCAGACTTTCCCAGTCCACTTTGCGCAGGCTGGTCA
+CTTTAGCGCGGAACTCCTGGGTATCGCCCATAAAAGTCACGGTATCACCGAGGGCAACGTTTAAGCGTTTCGCCAGCCCCTCTTCCATCGACACTTCATC
+GGCTTTTGGCGGCCAGTTACCGGCGACAATCGGATTATGATCGGGCCGCGTATTTTGCCAGGTAAGATTGAGTTCGCGGTTAAGCGCCTCATCTTCATTA
+CCTTCTGTCGGCTTATCGTTAATCGCCGTCAGCCGCGCCGCACCACCGGATAAAACGATTCCGGGACTATCTGATGTTCCGCGAACGCTTTAGCGGTGCT
+ACCTGTTCTGTGGCGATGTTAATTAAAAAGTAGTTCGGGCTTTCTGGAGGTAGCTGCTGCTGCCAGCGGTCGAGCAGATCGCCACGCAACACCAGCAGCA
+GTGCCAGCAGCATAAAGGAGCGAAAATGCCGAAAGCTGACTTAACGTTGACCACGGCTGACGTAACAGGCGGCTAACCGCCAGGCGCAGAGGCAGCGATT
+TCAGCGTCATGCGGCGAAGTACATTCAGCAGCATCCAGCCCAGCACACCGCACAGCAAAGCCAGTACTACCGCGCCCGCCAGCACCGCCCAAAGCAGCAT
+GCGCCACCCATTAATCCGGCGAGCAGCAGCACAACCACCACACTGACAATCGGCAGATAAAACTTCAGCGGCCAGACGTTCGCTACCACATCATTACGTA
+ATACGCGTAAAGGCTGCGTTGCCAGCAACAAGCGATATGGTCGTAGCCCGCAGCGAGATGACCGTCATGGTGCCAAGCGCCCAGCCACGGCCAGAGGCTG
+GCTGGCGGTAGTGCAGCAGGCAGAACGGGCTTGAGCAGCACCATCAACACGTTTCGAACAACAGGCCTATGGCCCCACCGGTAACGGCTGAAAGCGTCAG
+CACCATCAACCACTGACCGACGATTAGCTTACGCAGTTGCGCTCGCCCTGCCCCCAGCGTTTTGAGGATCGCCACCAGATCGTAGCGACTGCGACAGTAA
+TGATTCATCGCTACCGCCACCGCTGCCACTGCCAGCAGCAAGGTCAGAAGCGCCGAAAGCAGCGGGAACTGTTGCGA
+>tig00000012 len=8727 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
+AGTGCTGGCTACGTTCAGACCAAAATAGAACAGCACCGGAGTGGTCATCGACTGTTCAGAACCTGTTGCAGGTTAGATTCGTTAATGTTGACAATATTTT
+CTACGGACATGGAGTCGCTCTCTGTTGTCGATATTTTCTTTGACATGGGGGCTTAAGCGCGCTTCAACTCACCTGCAATATTTTGTCCATCACGCGCCCC
+GGCAGCAGGCGCTTAAGCACCATTACCGCCCAGGTCACCAGCGTCACCGGATAGCGCATCTTCGGCTTCTCGCTAATAAAAGCATGGCGTACTTTGTCCA
+CCACCGCTTCCGGTCCCAACGTAAAGCGGGCGGCGATGCCGGGATTTTCGACTGGTTTATCACTTTGCGTCTGGTTGACGTTGTCGGTGAAGCGAGTACG
+AATGGGACCGGGTTCGATCAGGCTGACTTTAATTCCGCTGTGGCGCAGCTCCATGCGCAGTGCATCTGACCACGCCTCCAGCGCATATTTACTGGCCGCG
+TAAGCGCCACGACCCGGCATTGAGATTAATCCCATCACCGATGATGTCATCACAATACGCCCTTCACCGTGCGGTAACATCGCGGGTAACAGGCGCATGG
+TGAGCTGGTGTGCGCCGAAAAGTTGGCGGAAACTGCTGTTCCATCTGCGCACGGCTGATGGTGGAAAGGGCCATACATGCCGAATCCGGCATTGTTAAAG
+ATCCCATACAGACAGGTATCGGTCAGGGCGATCACCTCGTCGGCTGCGCGATCAACACTTTCTGGTGAATCCAGATCGATCAACACGCCGGTAAATCCCA
+TGCTGTTCGCGCGCTCAACATCATCCGGTTTCCGGCAACCTGCCAGCGACGAAAACCCTGGCGTTTTAATTCGAGCGCGCTTTCCAGGCCAATTCCACTG
+GAACATCCGGTAATTAAGACCGATTTTTGCATAACTTTACCTGTCAGGGATCTCCGTTGCTTTATGAGTCATGATTTACTAAGGCTGCAACTGCTTCGCC
+ATCCAGTCGGCAATAAACGGCTGGGCGTCGCGGTTGGGATGAATACCGTCATCCTGCATCCATTGTGGCTTGTGGAGCCTCTTCCATAAAAAGGGCAGCA
+GCGGAACATCAAACTCTTTGGCGAGTTTGGGGTAAATGGCGCTAAAGGCTTCATTATAACGGCGACCATAGTTTGCAGGCAGACGTATTTGCATTAACAA
+TGGTTCAGCGTTGGCGGCTTTGACATCCTGCAAAATCTGGCGCAGCGTTTGCTCGGTTTGCTGTGGCTGAAAACCACGCAAACCGTCATTGCCGCCAGTT
+CAACCAACCCAACGCGGCTGATGCTGTTTCAGCAGAGCCGGAAGGCGCGCCAGTCCTTGTTGCGAGGTGTCGCCGCTGATGCTGGCATTAACTACCGACG
+TTTTTACTCTGCCACTTATCATTCAACAAGGCAGGCCAGGCCGCGCTGGCAGACATTCGATACCCGGCGCTCAGGCTATCACCCAGAATCAATAACGTGT
+CCTGCGGCGTACGGGAAGGTTAATGGGACCAGGAACAGGAAGGGCAAATGCCAGCGGAAAACATTGTTGAAGTTCATCATCTTAAGAAGTCCGTCGGTCA
+GGGAGCATGAACTCTCATCCTCACCGGAGTTGAGCTGGTTGTCAAACGTGCGAGACCATCGCACTGGTGGGCGAGTCGGATCGGTAAGTCAACCTTGCTG
+GCGATCCTCGCCGGGCTTGATGACGGCAGCAGTGGCGAAGTGAGTCTGGTGGACAACCGCTACATAATATGGACGAAGCGCGGGCAAAGTTGCGCGCGAA
+GCACGTCGGCTTTGTTTTTCAGTCATTTATGTTAATTCCTACCCTTAACGCGCTGGAAAACGTCGAGCTTCCGGCTCTGCTGCGCGGTGAGTAGCGCGGA
+AAGTCGTAACGGGGCGAAAGCGTTGCTCGAACAGTTAGGGCTGGGTAAACGTCTGATCATCTTCCGGCACAGCTTTCCGGCGGTGAACAGCAACGAGTGG
+CGCTGGCACGAGCCTTTAATGGTCGACCTGATGTGCTGTTTGCCGACGAACCCACCGGCAACCTTGACCGCCAGACGGGCGATAAAATTGCCGACCTGCT
+GTTTTCCTCAACCGTGAACATGGCACCACGTTGATTATGGTGACCCACGACCTGCAACTGGCGGCACGCTGCGACCGCTGCTTACGGCTGGTGAACGGGC
+AGTTGCAGGAGGAAGCATGATTGCACGTTGGTTCTGGCGCGAATGGCGTTCGCCGTCGCTATTAATTGTCTGGCTGGCGCTAAGCCTGGCGGTGGCCTGC
+GTGCTGGCGCTGGGCAATATCAGCGATCGCATGGAGAAGGGCTTAAGCCAGCAAAGCCGTGAGTTTATGGCGGGCGATCGGGCGTTGCGCAGTTCACGCG
+AAGTGCCGCAAGCGTGGCTGGAGGAAGCGCAAAGCGCGGCCTGAAAGTCGGCAAAGCTGACTTTCGCCACAATGACCTTTGCAGGCGACACACCGCAGCT
+GGCGAACGTCAAAGCGGTGGATGATATCTACCCGATGTATGGCGATCTGCAAACTAATCCCCTGGCCTGAAACCGCAGGCGGGCAGCGTATTGCTGGCCC
+CACGCCTGATGGCACTGCTTAACCTGAAAACGGGCGACACCATTGACGTGGGCGATGCCACCTTGCGGATTGCCGGAGAAGTGATTCAGGAACCGGATTC
+CGGTTTTAACCCTTCCAGATGGCTCCGCGTCTGATGATGAATCTGGCGGATGTCGATAAAACCGGAGCCGTGCAGCCGGAGTCGGGTCACCTGGCGTTAT
+AAATTCGGCGGCAACGAGAACCAGCTCGACGGCTATGAGAAATGGTTGTTACCCCTCAGCTTAAACCCGAACAACGCTGGTACGGTCTGGAACAGGACGA
+AGGCGCGCTGGGGCGATCGATGGAACGCTCGCAACAGTTCCTGCTGCTTTCGGCGCTTCTGACCTTGCTGCTGGCAGTGGCAGCGGTGGCGGTAGCGATG
+AATCATTACTGTCGCAGTCGCTACGATCTGGTGGCGATCCTCAAAACGCTGGGGGCAGGGCGAGCGCAACTGCGCGTAAGCTAATCGTCGGTCAGTGGTT
+GATGGTGCTGACGCTTTCAGCCGTTACCGGTGGGGCCATAGGCCTGTTGTTCGAAACGTGTTGATGGTGCTGCTCAAGCCCGTTCTGCCTGCTGCACTAC
+CGCCAGCCAGCCTCTGGCCGTGGCTGTGGGCGCTTGGCACCATGACGGTCATCTCGCTGCTGGTGGGGCTACGACCATATCGCTTGTTGCTGGCAACGCA
+GCCTTTACGCGTATTACGTAATGATGTGGTAGCGAACGTCTGGCCGCTGAAGTTTTATCTGCCGATTGTCAGTGTGGTGGTTGTGCTGCTGCTCGCCGGA
+TTAATGGGTGGCAGCATGCTGCTTTGGGCGGTGCTGGCGGGCGCGGTAGTACTGGCTTTGCTGTGCGGTGTGCTGGGCTGGATGCTGCTGAATGTACTTC
+GCCGCATGACGCTGAAATCGCTGCCTCTCTGCGCCTGGCGGTTAGCCGCCTGTTACGTCAGCCGTGGTCAACGTTAAGTCAGCTTTCGGCATTTTCGCTC
+TCCTTTATGCTGCTGGCACTGCTGCTGGTGTTGCGTGGCGATCTGCTCGACCGCTGGCAGCAGCAGCTACCTCAAGAAAGCCCGAACTACTTTTTAATTA
+ACATCGCCACAGAACAGGTAGCACCGCTAAAGCGTTCCTCGCGGAACATCAGATAGTCCCGGAATCGTTTTATCCGGTGGTGCGGGCGCGGCTGACGGCG
+ATTAACGATAAGCCGACAGAAGGTAATGAAGATGAGGCGCTTAACCGCGAACTCAATCTTACCTGGCAAAATACGCGGCCCGATCATAATCCGATTGTCG
+CCGGTAACTGGCCGCCAAAAGCCGATGAAGTGTCGATGGAAGAGGGGCTGGCGAAACGCTTAAACGTTGCCCTCGGTGATACCGTGACTTTTATGGGCGA
+TACCCAGGAGTTCCGCGCTAAAGTGACCAGCCTGCGCAAAGTGGACTGGGAAAGTCTGCGGCCTAATTTCTATTTTATTTTCCCTGAAGGGCATTAGACG
+GGCAACCGCAGAGCTGGCTTACCAGTTTCCGCTGGGAGAATGGCAACGGCATGTTGACACAACTCAACCGCCAGTTCCCGACCATTAGCCTGTTAGATAT
+TGGCGCGATTTTTAAAACAGGTCGGTCAGGTGCTGGAGCAGGTAAGTCGGGCGCTGGAAGTGATGGTGGTACTGGTCACCGCCTGCGGTATGTTGCTGTT
+GCTGGCACAGGTGCAGGTGGGAATGCGTCAGCGTCATCAGGAGCTGGTGGTGTGGCGCACACTCGGTGCGGGAAAAACTGCTGCGTACCACGTTGTGGTG
+TGAGTTCGCCATGCTTGGGTTTGTTTCCGGCCTGGTGGCCGCAATTGGTGCGGAAACGGCGCTGGCAGTGTGTGCAGGCGAAAGTGTTTGATTTTCCGTG
+GGAGCCAGACTGGCGATTGTGGATTGTTCTGCCGTGCAGCGGGCGCTGCTGCTGTCGCTTTCGGCGGCTGGCTGGGTGCGCGACTGGTTAAGGGTAAGGC
+GCTGTTCAGGCAGTTTGCGGGGTGATGAGAGTAAATAAGGGCGTTCTGGTTGAATGGAACGCCTTGTTTAAATTAATTCTACAATATGTTTCATTGATGA
+TGTTATTGAATTGGTGATTTCCTATCTTTCTATTGCTGATATTAATCTGAATCGGTGGAGTTTATTGATTTTAAATATAGCCCTACAAAAATAACTCAGA
+CTAATAAAATCATAAATCATATGCGTTGAATGGATATTATCCATATAGTGAATTTGTTGATGATGAATTCATCTGTGCTAAAAATGTTAGTTTAATAAAA
+TATTGAAAGTGACCTGTAATAACAGTTGTTGTTGATTGAGAACAAATAAGTTTATGAAAAAATATATAAATACATTAGCTGGTCTTGTGTGTCATTTTAT
+TTTTTGTTGCTAACACAGGGATATGAACAATAACTAAAGGGCACTTTATGAGCGGAAAACCAGCGGCGCGTCAGGAGATATGACTCAGTATGGCGGTCCC
+ATTGTCCAGGGTTCGGCAGGTGTAAAATTGGCGCGCCCACCGGCGTGGCGTGCTCGGTGTGTCCGGGCGGGATGACTTCGGGCAACCCGGTAAATCCGCT
+GCTGGGGGCGAAGGTGCTGCCCGGCGAGACGGACCTTGCGCTGCCCGGCCCGCTGCCGTTCATTCTCTCCCGCACCTACAGCAGCTACCGGACGAAGACG
+CCTGCACCGGTGGGCGTTTTCGGCCCCGGCTGGAAAGCGCCTTCTGATATCCGCTTACAGCTACGTGATGACGGACTGATACTCAACGACAACGGCGGGC
+GGAGCATTCACTTTGAGCCGCTGCTGCCGCGGTGTACAGCCGCAGTGAGTCAATGTGGCTGGTGCGCGGTGGTAAGGCAGCACAGCCGGACGGCCATACG
+CTGGCGCGGCTGTGGGGGCGCTGCCGCCGGATATCCGGTTAAGCCCGCATCTTTACCTGGCGACCAACAGCGCACAGGGGCCGTGGTGATACTGGGGTGG
+TCTGAGCGGGTGCCGGGTGCTGAGGACGTACTGCCAGCGCCGCTGCCGCCGTACCGGGTGCTTACCGGGATGGCGGACCGCTTCGGGCGGACGCTGACGT
+ACCGGCGTGAGGCCGCCGGTGACCTGGCCGGGAAATCACCGGCGTGACGGACGGTGCCGGGCGGGAGTTCCGTCTGGTGCTGACCACGCAGGCGCAGCGT
+GCGGAAGAGGCCCACCTCTTCGCTATCTTCTTCTGACAGTTCCCGCCCTCTCAGCCTCAGCGTTCCCCGACACTGCCCGGTACCGAATACGGCCCCGACA
+GGGTATCCGCCTTTCGGCGGTGTGGCTGATGCACGACCCGGCATACCCGGAGAGCCTGCCCGCTGCGCCACTGGTGCGGTACACGTATACGGAAGCCGGT
+GAACTGCTGGCGGTATATGACCGCAGCAATACGCAGGTGCGCGCTTTCGTATGACGCGCAGCACGGGCCGGATGGTGGCGCACCGTTACGCGGGAAGGCC
+GGAGATGCGCTACCGCTACG