changeset 1:58346ef3116b draft

planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/canu commit 21c4301d86a46ba48759ffeb4a0b7f3c269558e4
author bgruening
date Sat, 09 Jun 2018 13:46:56 -0400
parents 4c8f32256fa8
children c5b7390290b1
files canu.xml test-data/bowtie2-fq1.fq test-data/canu_contigs_result1.fa test-data/canu_contigs_result2.fa test-data/canu_corrected_reads.fa.gz test-data/canu_unassembled_result1.fa test-data/canu_unassembled_result2.fa test-data/canu_unitigs_result1.fa test-data/canu_unitigs_result2.fa test-data/ecoli_canu_contigs.fa test-data/ecoli_canu_contigs_result1.fa test-data/ecoli_canu_contigs_result2.fa test-data/ecoli_canu_corrected_reads.fa test-data/ecoli_canu_corrected_reads_result1.fa.gz test-data/ecoli_canu_corrected_reads_result2.fa.gz test-data/ecoli_canu_corrected_reads_result3.fa.gz test-data/ecoli_canu_trimmed_reads_result1.fa.gz test-data/ecoli_canu_trimmed_reads_result2.fa.gz test-data/ecoli_canu_trimmed_reads_result4.fa.gz test-data/ecoli_canu_unassembled_result1.fa test-data/ecoli_canu_unassembled_result2.fa test-data/ecoli_canu_unitigs.fa test-data/ecoli_canu_unitigs_result1.fa test-data/ecoli_canu_unitigs_result2.fa test-data/ecoli_unassembled.fa
diffstat 25 files changed, 2797 insertions(+), 3099 deletions(-) [+]
line wrap: on
line diff
--- a/canu.xml	Fri Jun 08 04:43:41 2018 -0400
+++ b/canu.xml	Sat Jun 09 13:46:56 2018 -0400
@@ -15,7 +15,9 @@
     #end for
 
     canu
-        $stage
+        #if $stage != 'all':
+            $stage
+        #end if
         -p canu
         -d out_dir
         #if $s:
@@ -63,6 +65,8 @@
             #end if
         #end for
         2>&1
+        &&  
+        echo "Check echo"
     ]]>
     </command>
     <inputs>
@@ -74,13 +78,15 @@
             <option value="-pacbio-corrected">PacBio corrected</option>
         </param>
         <param name="stage" type="select" label="To restrict canu to only a specific stage, use">
-            <option value="" selected="true">all</option>
+            <option value="all" selected="true">all</option>
             <option value="-correct">generate corrected reads</option>
             <option value="-trim">generate trimmed reads</option>
             <option value="-assemble">generate an assembly</option>
             <option value="-trim-assemble">generate trimmed reads and then assemble them</option>
         </param>
-        <param argument="genomeSize" type="text" label="Estimated genome size (e.g. 80m, 15k, 2g)" />
+        <param argument="genomeSize" type="text" label="Estimated genome size (e.g. 80m, 15k, 2g)">
+            <validator type="empty_field" />
+        </param>
         <param argument="rawErrorRate" type="float" value="" optional="true" min="0" max="1"
             label="Maximum raw overlap mismatch" help="The defaults are 0.300 for PacBio reads and 0.500 for Nanopore reads." />
         <param argument="correctedErrorRate" type="float" value="" optional="true" min="0" max="1"
@@ -102,27 +108,33 @@
     </inputs>
     <outputs>
         <data name="contigs" format="fasta" from_work_dir="out_dir/canu.contigs.fasta" label="${tool.name} on ${on_string} (contigs)">
+            <filter>stage == 'all'</filter>
         </data>
-        <data name="unassembled" format="fasta" from_work_dir="out_dir/canu.unassembled.fasta" label="${tool.name} on ${on_string} (contigs)">
+        <data name="unassembled" format="fasta" from_work_dir="out_dir/canu.unassembled.fasta" label="${tool.name} on ${on_string} (unassembled)">
+            <filter>stage == 'all'</filter>
         </data>
         <data name="unitigs" format="fasta" from_work_dir="out_dir/canu.unitigs.fasta" label="${tool.name} on ${on_string} (unitigs)">
+            <filter>stage == 'all'</filter>
         </data>
-        <data name="corrected_reads" format="fasta.gz" from_work_dir="out_dir/canu.correctedReads.fasta.gz" label="${tool.name} on ${on_string} (unitigs)">
+        <data name="corrected_reads" format="fasta.gz" from_work_dir="out_dir/canu.correctedReads.fasta.gz" label="${tool.name} on ${on_string} (corrected reads)">
+            <filter>'-correct' in stage or stage == 'all'</filter>
+        </data>
+        <data name="trimmed_reads" format="fasta.gz" from_work_dir="out_dir/canu.trimmedReads.fasta.gz" label="${tool.name} on ${on_string} (trimmed reads)">
+            <filter>'-trim' in stage or stage == 'all'</filter>
         </data>
     </outputs>
-    <tests>
-        <test>
-            <!-- test multiple input -->
+     <tests>
+       <test expect_num_outputs="5">
             <param name="inputs" ftype="fasta" value="ecoli-reads.fasta"/>
             <param name="genomeSize" value="4.6m" />
-            <param name="minReadLength" value="2000" />            
-            <output name="contigs" ftype="fasta" file="ecoli_canu_contigs.fa"/>
-            <output name="unitigs" ftype="fasta" file="ecoli_canu_unitigs.fa"/>
-            <output name="unassembled" ftype="fasta" file="ecoli_unassembled.fa"/>
+            <param name="minReadLength" value="2000" />
+            <output name="contigs" ftype="fasta" file="ecoli_canu_contigs_result1.fa"/>
+            <output name="unitigs" ftype="fasta" file="ecoli_canu_unitigs_result1.fa"/>
+            <output name="unassembled" ftype="fasta" file="ecoli_canu_unassembled_result1.fa"/>
+            <output name="corrected_reads" ftype="fasta.gz" decompress="True" file="ecoli_canu_corrected_reads_result1.fa.gz"/>
+            <output name="trimmed_reads" ftype="fasta.gz" decompress="True" file="ecoli_canu_trimmed_reads_result1.fa.gz"/>
         </test>
-
-        <test >
-            <!-- test multiple input -->
+        <test expect_num_outputs="5">
             <param name="inputs" ftype="fasta" value="ecoli-reads.fasta"/>
             <param name="genomeSize" value="4.6m" />
             <param name="minReadLength" value="2000" />
@@ -130,21 +142,26 @@
             <param name="rawErrorRate" value="0.2" />
             <param name="correctedErrorRate" value="0.05" />
             <param name="corOutCoverage" value="2" />
-            <output name="contigs" ftype="fasta" file="canu_contigs_result1.fa"/>
-            <output name="unitigs" ftype="fasta" file="canu_unitigs_result1.fa"/>
-            <output name="unassembled" ftype="fasta" file="canu_unassembled_result1.fa"/>
+            <output name="contigs" ftype="fasta" file="ecoli_canu_contigs_result2.fa"/>
+            <output name="unitigs" ftype="fasta" file="ecoli_canu_unitigs_result2.fa"/>
+            <output name="unassembled" ftype="fasta" file="ecoli_canu_unassembled_result2.fa"/>
+            <output name="corrected_reads" ftype="fasta.gz" decompress="True" file="ecoli_canu_corrected_reads_result2.fa.gz"/>
+            <output name="trimmed_reads" ftype="fasta.gz" decompress="True" file="ecoli_canu_trimmed_reads_result2.fa.gz"/>
         </test>
-        <test>
-            <!-- test multiple input -->
+        <test expect_num_outputs="1">
             <param name="inputs" ftype="fasta" value="ecoli-reads.fasta"/>
-            <param name="minReadLength" value="2000" />
             <param name="stage" value="-correct"/>
+            <param name="minReadLength" value="2500" />
             <param name="genomeSize" value="4.6m" />
-            <section name="contigFilter">
-                <param name="minReads" value="10" />
-            </section>
-            <output name="corrected_reads" ftype="fasta.gz" decompress="True" file="canu_corrected_reads.fa.gz"/>
-        </test>
+            <output name="corrected_reads" ftype="fasta.gz" decompress="True" file="ecoli_canu_corrected_reads_result3.fa.gz"/>
+        </test> 
+        <test expect_num_outputs="1">
+            <param name="inputs" ftype="fasta" value="ecoli-reads.fasta"/>
+            <param name="stage" value="-trim"/>
+            <param name="minReadLength" value="2500" />
+            <param name="genomeSize" value="4.6m" />
+            <output name="trimmed_reads" ftype="fasta.gz" compare="sim_size" delta="12000" file="ecoli_canu_trimmed_reads_result4.fa.gz"/>
+        </test>  
     </tests>
     <help>
     <![CDATA[
--- a/test-data/bowtie2-fq1.fq	Fri Jun 08 04:43:41 2018 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,400 +0,0 @@
-@M01368:8:000000000-A3GHV:1:1101:6911:8255/1
-ATCTGGTTCCTACTTCAGGGCCATAAAACCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATCCTATTATTTATCGCACCTACGTTCAATATT
-+
-BCCCCFFFFFFFGGGGGGGGGGGHHHHGHGHHHHHHHHHGGGGGGHHHHGHHHHHHHHHHGHHHHHHGGHGGHHHGHHHHFHHGHHHHHHHHHGHEHEFFGHHEGGCEFGGFHHHBGHHGHHHHGHFHHHGHGHGHGGCDFDDACGGGGGGGAAFFFFFFFFFBAFFFFFB;FFFFFFADDFFFFFFFFFFEFFFFFFFFFFBFFFFFFFFFFFFFFEFFFFFFFFBFEFFFFEFE;DFFFDFBFF/9BFB
-@M01368:8:000000000-A3GHV:1:1101:14518:9998/1
-GTTATTATTATGTCCTACAAGCATTAATTAATTAACACACTTTAGTAAGTATGTTCGCCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGGGATAGACCTGTGATCCATCGTGAT
-+
-AAAAAFFFFFFFGGGGGGGGGGHGGHHHHGHHHHHHHGCGHHHHHHHHHHHHHHHGGGGGHHHHHHHHHGHHGFHFE5BGEEHFGGGHHHHHHHHFBHHGGGGFHGHHFGHHHHGHHHHHHGEGGGGFHFHGEGHHGGCDGDGHGGGDGGHGGCGGGHGHHH/ACDG?.1FGCDCCGCA.CC@CDCHFHGFFGGGEBFGAB//CEFBFGG.:;D;;A0AFFFFFB..:@ABFF//;BFFFFFBF/9D:A//
-@M01368:8:000000000-A3GHV:1:1101:18422:19051/1
-GTATCCGACATCTGGTTCCTACTTCAGGGTCATAAAACCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATCCTATTATTTATCGCACCTACG
-+
-CCCCCFDDDDDFGGGGGGGGGGHHHHHHHHHHHHHHHHGHHHHHHFHHHHGGGGHHHHHHHHHGHHHHHHHHHHHHGGHGGHHHHHHHHHHHHHHHHHHHHHHHHHHHGHHHHHGCGGGHHHHHHHHHHHHHHHHHHHHHHGFDHGFHCFGGGGFGGFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF;FFFFFFFFFFFFFFFFFFFFFFFFFFFFEFBFFFFFFFFFF:FFF.
-@M01368:8:000000000-A3GHV:1:1101:25545:21098/1
-ATTAATTAACACACTTTAGTAAGTATGTTCGCCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATAAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGGCTTATTTAAGGGGAACGGGTGGGG
-+
-33AA?DFD5BDFGGGFEBDGEGHEGHGEGHCEGGHHCHGHHFFHHGFGAGE53FF2FAFFGDE5FFFE5GFBFGAEE1GHHHGHHHEHE3FGHF@GEGEGGHHGG3FAGFFDE?EEE3GFEGFGFGGCG?GHHHFHGGGC@DHFFHD/A<C@EGFDCGGGHFHHHEGFGHBFHG0:CEHFCHGGED.;0CEF.F99B0CFFEEFGGG0FBFBBF0F/FFBDE?/9//9B.FFBFFFFFFBF..A..;@B--
-@M01368:8:000000000-A3GHV:1:1101:5446:12248/1
-AATTAACACACTTTAGTAAGTATGTTCGCCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGGGGAACGTGTGGGCTAT
-+
-CCCCDFFFFCCFGGGGGGGGFGHHHHHGGGGHHHHHHHHHHHHHHHHGBGHGGHGGHHHHHHHHHHGHGHGGGGGHHHHHHHHGHHHHHHHHHGGGGGHHHHFFGHHHGGGGGGHHHGFGGHHGGGGHHHHHHGGGGGGHGHHGGGGGGGHGGGGGGHHHHHHHHHHHHHFHGGGHHHHGGGGGG:FE;EGEGGGGG/;?FGGGGGGGFFFFGGFFFFFFFFFBFFFFFFFFFFBFFFFFFEFFFFFEFFF
-@M01368:8:000000000-A3GHV:1:1101:5861:6452/1
-ATTATGTCCTACAAGCATTAATTAATTAACACACTTTAGTAAGTATGTTCGCCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTT
-+
-ABCCCFFFFFFFGGGGGGGGGGHHHHHHHHHHHGHHHHGHHHHHHHHHHHGGGGHHHHHHHHFHHHHHHGGHGHGGHGGHHHHHHHGGHFHHHGGGGGHHHHHHHHHHHHHHHHHHGGGGGHHHHHEGGHHGGGGGGHHHGGGGHGGGGGHHHHHHGGGDCGHHHHGGGGGGGHEFGGGGHGHHHGHGGGFGGGGGGGEGGGGGGG?E0CEFGGGGGFEE9EEFFFFFBFFFFFFFBFFBD.AFFFFFFF0
-@M01368:8:000000000-A3GHV:1:1102:10403:6021/1
-CGCTCCGGGCCCATAACACTTGGGGGTAGCTAAAGTGAACTGTATCCGACATCTGGTTCCTACTTCAGGGTCATAAAACCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTG
-+
->A@AAAAD2ADDFFGGGGGFGGHA?EAEFBEAGHFABFGG5FDF5DB1EEGAFDFB53FF5FH@G5FFEHGHEFHFFHBE333GF43GCGGGGE@0?BFGGB0B?FHGFDGGHHHBFFDEGGHGFFFDFE@<1>@FFFGHHHHFHEFGDABFFGG/@DCE<CG1<GF0/DD000=<DHGBDFDCECE/:AC?-;-;9B/ABBB-AD9BFB99AB?BDFBAD-.9..@;=;;..9..9/9;BEF;A:9/BFF
-@M01368:8:000000000-A3GHV:1:1102:10677:23253/1
-CCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATCCTATTATTTATCGCACCTACGTTCAATATTACAGGCGAACATACTTACTAAAGTGTGTTAATTCTGTCTCTTATACACA
-+
-ABBBBFFFFFFFGGGGGGGCGGGHHHHHGHHHHHHHHHGHHHHHHHHHHHGHHHHHGGGGGHGHHHHHHHHHHHHHBGFHHHHGHGHGGHGGGCGGGHHHGGGGGGGHHHGHGGGGGGGGGGGGGGGGGGGGFFFFFFFFFFFFFFDFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFBFFFFFFFFFEDBDFFFFFFFEFFFE0F0FBFFFF0FFFFFFFFFFFFFFFFF:
-@M01368:8:000000000-A3GHV:1:1102:13809:1733/1
-ATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGGGGAACGTGAGGGCTATTTAGGTTTTATGCTGTCTCTTATACACATCTCCG
-+
-BCCBCFFFFFBFGGGGGGGGGGHHHHHHHHHHHGHHGGGGGH3EHHHGHGHHHHHHHHHGGCEGGGHHHGGGFHGGGGGGHHGEAEFHHGGGGHHHHHHGGGGGGHHHHGGGGGGGHGGCFFGHHFGHHHGHHHHHHCHGFHHHHGGHGGG00EHGHHHGFHHGEHGHFFFHHGGFHHHGGGGGGGGGB;;CFFGGFGFFBFFDFED;E.:A?DFFFFFFFF:FFFFF0BFFBBBFFFFFBFF0BFBF9F.
-@M01368:8:000000000-A3GHV:1:1102:17584:10050/1
-ATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGTTTTATGACCTGTCTCTTATACACATCTCCGAGCCCACGAGACTAAGGCGAATCTCGTATGCCGTCTTCT
-+
-CCCCCFFFFFFFGGGGGGGGGGGHHHHHGGHHHGGGGGGHHHGFGDHHGGGGHHHHHHGGGGGGHHHHGGGGGGGHGGGEGGHHHHHHHGHGHHGHHHHGHHHHGGGGFDGHFHGEHHHHHHGFFHHHHHHHHHHHHHHHHHGGHHHHHHHHHHFHHHHHHGGGGGHHHHGGGHHGHHHGGGGGGGGGGGFGFFGGGGGGGCFGGGFGGGGGGGFFFFFFFFFFFFFFFFFFF;.BF9ADF/9;A;DFFF0
-@M01368:8:000000000-A3GHV:1:1102:18842:24844/1
-CACTTGGGGGTAGCTAAAGTGAACTGTATCCGACATCTGGTTCCTACTTCAGGGTCATAAAACCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCT
-+
-BBBCBFF@CCBBGGGGGGGGGGHHGHGGHHHGGGGGHHHHHHHHHHHHHHHHHHHHHHHHHHHGHHHHHHFHHHHGGGGGHHHHHHHHHHHHHHHHHHHHGGGHGGHHHHHHGHBFGHHHHHHHHBGHHHHHHGHGGGHFGCGGFHHFHFFHHBHHHHFFHFHHHHGGDHGGBC?;@DFBFFFFFFFFFBFFFFFFFFFFFFFF.B?FB.@;;DFFFFFFFFFFFEE-A./BBBFBFBFFF//BFB/BFF/
-@M01368:8:000000000-A3GHV:1:1102:21788:11027/1
-GCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATCCTATTATTTATCGCACCTACGTTCAATATTACAGGCGAACATACTTACTAAAGTGTGTTAATTCTG
-+
-ABCCBCCBBFFFGGGGGGGGGGGHGHHHHHHGGHGGHHHHHHHHGHHHHHHHHHHHHHHHHHHGHHHHHFGGGGHHHHHHHHHHHHHHHHHHHHHHGHGHGGFCGGCGGGHHHGGGGGGGGGGGGGGGGGGGGGGGGGFFFFFFFFFFFFFFFFFFFFFDFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFEF9EFFFFFFFFFFFBFF0FFBBBBFBFBFFFF0
-@M01368:8:000000000-A3GHV:1:1102:5728:8777/1
-ATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGTTTTATGACCCTGAAGTAGGAACCAGATG
-+
-BBBBBFFFFFAFGG5GGGGGGGHHHGHHHHHHHHHHGGGGGHHHHHHGHHHHHHFGHHHGGGGGFHGHGGGHHHGGGCEGHHGG?F1BGGGGGHHHHHGGGGEGGHHHHGGGGGCGHGGGGCGHHHHHHHHHHHHHHHHGGHHHHGGCEEDFDEGGHHHHHHHCEHHFHHHHGHGFHHHFFGGGFFFGGFGBGFFFFFFFFGFDGGD9EFA.DAFA/;FEFF9FB?/BBF/FFFFBBFFFFF/FFEFFFBB
-@M01368:8:000000000-A3GHV:1:1102:5983:21093/1
-GTATCCGACATCTGGTTCCTACTTCAGGGTCATAAAACCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATCCTATTATTTATCGCACCTACG
-+
-AAABCFCABBCFGGGGGGGGGGHHHHHHGFHHHHHHHHGGHHHGHGHHHGGGGFHHHHHHHHGHHHHHHHHHHHHHGGHGGHHHHHHFHGGHHHHFHGHHEHHHHHHHGHHHHHD@FGGHHHHHFFFHHGGHGH?DHHHHHGHGHEGG/@?ADGFGGFFFFAFFFFFFFFFFFFFFFFFFFFFFFAAFFFFFFDFFFFFFFF;D9BFFFFFFFFFFFFFFFFFEFFFBBFFF0BFFFBBFF0EFFFFFFFA
-@M01368:8:000000000-A3GHV:1:1102:7765:18353/1
-CTCCGGGCCCATAACACTTGGGGGTAGCTAAAGTGAACTGTATCCGACATCTGGTTCCTACTTCAGGGTCATAAAACCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTC
-+
-CCDCCCCCCBCFGGGGGGGGGGGGGGGHHHHHHDHHHHHHHHHHHGGGGGHHGHGHHHGHHHHHHFHHHHGHHHHHHGHGHHHGHHHHHGGGGHHHHHHHHHHHHHHHHHHHHHHGGHGGHHHHHHHGFFHHHHHGHHHHHHHHHHHGHHHHHGCFGGHGHFHHGHGHGHHHHGGFHHHHGGGHGBFGCC=BFFFFFFFF-@DFFFFFFFFFFFFFFFFFFFFFFAFFAEF.::FBFBFFE-A9:BFFFF0
-@M01368:8:000000000-A3GHV:1:1103:10405:17879/1
-GTATCCGACATCTGGTTCCTACTTCAGGGTCATAAAACCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATCCTATTATTTATCGCACCTACG
-+
-CBCCCFCCCCCFGGGGGGGGGGHHHHHHHHHHHHGHHHGHHHHHHHHHHHGGGGGGHHHHHHHHHHHHHHHHHHHHGGHGGHHHGHHGHHGHHHHHHHHHCGGFHHHHGHHHHHGCFGGHHGHHHHHHGFHHHGHHHHHHHGHGHGFF/CC?ADAFGFFFFFFFFFFFFFFDFFFFFFFFAFFFFFFFFFFFEDFFFFFFFFFFAFFFFFFFFFFFFFFFFFFFFFFBBFBFBFFFFFFFFFFFFFFFFF?
-@M01368:8:000000000-A3GHV:1:1103:13493:8205/1
-GTAGCTAAAGTGAACTGTATCCGACATCTGGTTCCTACTTCAGGGTCATAAAACCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATCCTATT
-+
-CCCCCFFFFFFFGGGGGGGGGGGGGGGHFHHHHHHHHHHHHHHHHGHHHHHHHHGHHHIHHHHHHHGGGGFHHHHHHHHHHHHHHHHHHHGHGGHGGHHHHHHHHHGHHHHHHHHHHHHHHHHHGHHHH/FGGGGHHHHHHHGGEHHHHHGHHHHHHGHGHEFEFGGFFFFFFFFFFFFFFFFFFFFFAFDFFFFFAFFFF;;@FFEFFFFFFFFFFE=?AFFFFFFFFFFFFFFFFFFBFBBBFFFFEFF
-@M01368:8:000000000-A3GHV:1:1103:14060:21273/1
-GTATCCGACATCTGGTTCCTACTTCAGGGTCATAAAACCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATCCTATTACTGTCTCTTATACAC
-+
-AAABAFCCCCCFGGGGGGGGGGHHHHHHHHHHHHHHHHGHHHHHHGHHHHGGGGGFHHHHHHHHHHHHHHHGHHHHGGHGGHHHHHHHHHHHHHHHHHH?GGHHHHHHGHHHHHFEGGGHHHHHHHHHHHHHHHGFHHHFHGHGHGFGCGG@@BCFGFFFFFFF?FFFFFFFFAFFFAD?@FFEEFFFFFFFFFFFFFFFFFFD9BFF/B/FFF/:/9FB9/BFA//;BFB:FFFBB/BFFFFFBFFFFB/
-@M01368:8:000000000-A3GHV:1:1103:14528:12993/1
-GCCCATAACACTTGGGGGTAGCTAAAGTGAACTGTATCCGACATCTGGTTCCTACTTCAGGGTCATAAAACCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGAT
-+
-BBBBBFFFBDFFGFBCG2EGFFGHHCF5AFHHHFHFHHHGG?CEHBHHDGFHHGHHGHBGHABFFBGHGDGGGFHGHHGGHHHGGG@E1GEHHHGHHFHH3FEDHHHHGFGHGFHHGHFBGA?FGHHHHHGHHFFGHFDFGGHHH2??<ECFHHGHHHHHHHHHGHH<1DFGHGC<.FCB/<=@DCFFFFFEDA=-AAB9B/9B9B-@?.-;A-AFF.=-=BFEFEDEFFFBFEA-A.B//9F9F//;BBB
-@M01368:8:000000000-A3GHV:1:1103:17657:20856/1
-AAAGCGAACTGTATCCGACATCTGGTTCCTACTTCAGGGTCATAAAACCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATCCTATTATTTAT
-+
-ABB?AABBBBFFGGGGGGGGGGHHHHHHHHGHHHHHHHHHHHHHHHHHGHHHHHHGHHHHGGGGGHHHHHHHGHHFHHHHHHHHHHGGGGGHHHHHHHH3BGGHHHHHHHEHHHHHHHGHHHHGEEGGGHHHHHHHHGHHFHGHGHGHGHHCHGGECCDFGB@AFFFFFFFFFFFFFFFFFDAFFFFFFFFFFFFFCAF;AFFFFEFFBBEFFF9FBBFFFFFFFFFFEFFFFFFFFFFFFF/FFFFBFF9
-@M01368:8:000000000-A3GHV:1:1103:23099:3794/1
-AAGACAGATACTGCGACATAGGGTGTTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCTCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGTTTTATGACCCTGAAGCTGTCTCTTATACACATCTCCGAGCCCACGAGACTAAGGCGAATCTCGGATGCCGTCT
-+
-BBBBBFFFFFFFGGEEGGFGGGGCFGEHCGGGGGGFHFFEDEHFGGDEHHHHHHGGFECGHHHHGFEFGCGHGGFGGGHBGFH3/BF3GGGHHEEEHHG22???BCFFFFFFHHFHFF@FGHH11GHHHHFGFHHHHGGHHHHEFFGFGHFG1DGFGGGGEDCCCAEGGFFHHFHHHHHHCFBBFGBFFF/0;B0B00;B0BBFGBB9BFGEFGGGFFDEEAB;BDDBFBFFFFF@;.9BF..;-./-A=F
-@M01368:8:000000000-A3GHV:1:1103:25465:20010/1
-GACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATCGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGTTCTGTCTCTTATACACATCTCCGAGCCCACGAGACTAAGGCGAATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAAAAACAACAGAC
-+
-ABBBBFFFFBAAGGGFEFGGGGHHFEFFHFGGGGGHHHGHFGGGGGHHHGGGGGGGGHGEEEGGHHHGFHEHFHDGHGHEHGF?FGG?GGGGHHGHF4F?2?DDCDHGHHHHHFG2@FGHHHGH?CFGGHFHFHHHHGDDGGHGGGGGHGFH.<AFAGHHHFHGHHFCGFHHHHHGHHHHBGHHGGDGAGF.CEGCFDGGGGGEFFF=B.FFFEFFFFFFADF?/9//BFF.B/;:>---;--..;.../9
-@M01368:8:000000000-A3GHV:1:1103:25519:6301/1
-AAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGCATCTGTCTTTGATTCCTGCCTCATCCTATTATTTATCGCACCTACGTTCAATATTACAGCTGTCTCTTATACACATCTCCGAGCCCACGAGACTAAGGCGAATTTCGT
-+
-3A3AAFFFFBFFGGG2CF?4FGHGHHCHGGHHBHGFFAGGHHFFHHCGHFEGCECEGHFFFHGHHGFGHFGDAFDGFFEEFEGGBECC/<A@DFBBEGC--:;GHHHGBECG@:9-9.-9C/ABB?B@?.EDAFFFFBAFBFBFBFFFFF//;BBFFFF/;/9BBF/BBFBFFFFFFFFFEFF??BF/.AF./;B/9FFFFFFBFBFFFBFFFBFFFFF/BF/A---9.9A-B?DFFF/B/B?---.//;.
-@M01368:8:000000000-A3GHV:1:1103:6074:6549/1
-TAACACTTGGGGGTAGCTAAAGTGAACTGTATCCGACATCTGGTTCCTACTTCAGGGTCATAAAACCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTG
-+
-CCCBCFFFFFCCGGGGGGGGGG5GFHHHHHGHHHGGGGGHHHGHHHHHHHHHHHHGHHHHHHHHHGGHHHHGHHHHHHGGGGHHHHHHHHHHHHHHGHHHHHHHGGHGGHHHHHHHFGHHGHGHHHHHHHHHHHHHGHHHHHGGGGCHHHHEHGHHHEGHHHFGGHHHHGHGHGHF@CCBDFAFFFFFF-CDFFFFFFFFFFFFFAFFFFFEFF;BFF?FEDFFFFFFFF-A./FFFFFFFFFFFF/BFF/
-@M01368:8:000000000-A3GHV:1:1104:11572:8264/1
-GTATCCGACATCTGGTTCCTACTTCAGGGTCATAAAACCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATCCTATTATTTATCGCACCTACG
-+
-BABCBFBACCCFGGGGGGGGGGGHHGHHGHHHHGFGCHGHHGFFHEHHHHGGGGFGHHHHHHHHHHHHGHHHHHHHGGGGGHHHFFHHGHHHHHHHHHHHEHHHHHHHGHHGHGGEGEGHHHFHHHHGHHHHHHGGHHHHHGHGEGEHCGG-BGDFGFFFFAFFDFFFFEFFCFFDDFFFFFFFEC>;>=EF?AEFFFF;9;=DAFFFFBBFFFBFFF//;BFB.:FBFFBB/BFFFF/BFFE?EFAFEF9
-@M01368:8:000000000-A3GHV:1:1104:11928:24197/1
-ACGTAGGTGCGATAAATAATGGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGTTTTATGACCCTGAAGTAGGAACCAGATGTCGGATA
-+
-CDDCCFCFFFBCGGGGGGGGGGHHHGHHHGGGGGHHHHHHHHHHHHHHHHHHGGGGGHHHHGGGHHHGGGGGGHHHGGGGHHGGGGHHHHHHGGGGGGHHHHGGGGGGGHGGGGGGHHHHHHHHHGHHHHGHHGHHHHGGHGEEGGGGFHHFHHHGHGEHHHHHHHHHHHHHHHHHGGGGGGFGGGGGGGGFFGGGFGFGAEFEFGFEAFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF@D9
-@M01368:8:000000000-A3GHV:1:1104:12288:20635/1
-CACTTGGGGGTAGCTAAAGTGAACTGTATCCGACATCTGGTTCCTACTTCAGGGTCATAAAACCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGCCGCAGCATCTGTCTTTGATTCCTGCCT
-+
-ABA?AFBAB2>AFGGGGFFGD5GGHGFFHGHEGGGGHHHHFFHH5FHGHHHFFHEFHHHHHHGGHHHHHGFHGGHGGGGFHGGGFBHHHFGEGHHHHGHGGGGECEHHFHHGHHFFHFGGGHHHEGHDGHHGHGHFHHHECGCBCHHGFHHFHD1GFHEFHEF?GDCFFEFE0A@;@>BD/9BFBBBBFDFFFF99D=?>DDBFF-AFFEBB9BBEFEFAFFF//-@---;;FBBFBFB///;99999BA9
-@M01368:8:000000000-A3GHV:1:1104:13832:4398/1
-CACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCCTGTCTCTTATACACATCTCCGAGCCCACGAGACTAAGGCGAATCTCGTATGCCGTCTTCTGCTTGACAAAAAAAAACACACAACAACCAACACCCAGTAGACTAGTGCGTC
-+
-AAABABCAFFFFGGGGGGGGGGHFHHHHHHHHHGFFHHGGHGGGGGHHHHHHHHHHFHHHHGHHHHHGGHGHGGHGGGGGGGHGFFGGGGDGGHHHHGGGGFGGGGGCFGGEGCDGGGGGGGGGGGGEGF?;BFFFFFFFFFFFFFFFFFF:FFFFFFFFFFFFFFFFFFFFFFF/FFFFFFC.;BFEAFFFFF;@FFBFFFFEF?/FFFFE----:...:...9....9.9...:.9//9////;/9-.-
-@M01368:8:000000000-A3GHV:1:1104:23670:4161/1
-ATTCAATTGTTATTATTATGTCCTACAAGCATTAATTAATTAACACACTTTAGTAAGTATGTTCGCCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCC
-+
-AAAABFFFFFFFGGGGGGGCGBBGGHHHHHHHHHGHHHHHHHHHHFGGHHHHHHGGFHHHHHHHGGGGGFHHHGHHHHHGHHHHGHHGGGHGGGGHHHHHGHHHHHHEGGGFHHHGFFDGEGHGHFHGHHGEGGGHHBGHGGHGHGGGGG/@FCDFDGFHGGGDFFHFGFFGGGGGHHHHGGGGGGGEGCDG?GGBFFFEE00BFFGABBBAFGGGEGEA.9FFF/./;BFBF./AAF/BFFBBF/F/BFB
-@M01368:8:000000000-A3GHV:1:1104:24927:22253/1
-AGCTAAAGTGAACTGTATCCGACATCTGGTTCCTACTTCAGGGTCATAAAACCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATCCTATTAT
-+
-AAA?AFFF3DFFFGGBGFF3EAEEEHFHHFHHHGHHHHDGHHGAEFGHHHGFCHHGHHHBGHHHAEGGHGGFHFBFHHHHHHHHHHFHH1EEHEEHH1FFDEEFCGHBGHHFHEHHHHHH1FCGHHHHEEFGEEGFFCHHH11>GHHF/FG2DGGCGAGGHGGGG@@@BEFFF?@@@FFEFFFFFF?@@FB@BB@FFFE=;==---A9EFBBB/;E;A9B/B/FFFEF/B///;/;9/A/;/9BFFFBFBB
-@M01368:8:000000000-A3GHV:1:1104:4705:7727/1
-CTACAAGCATTAATTAATTAACACACTTTAGTAAGTATGTTCGCCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGGG
-+
-BBBBBFFBFFFFGGGGGGGGGGHHHGHHHGHHHHH6GHHHHFFGGGHHHHHHHHHHHHHHHGGFGGGEGGGHHHHHHHHHHGHE3FGGGGHHHHHFHHHHHHHHHHHHGGGGGHHFHFCGFHHGGGGGGGHHGGGGHHGGGGGGHHHHGGGADCHHHHGDGGGGGGGGC@DGFHEHHHHHHGHHHHGFGDEGFGFFGGGGCFGBEGFGGGFG;C.BFFFFFFFBFBFFFF/F?.AFFF/BFFEFFFFFEFF
-@M01368:8:000000000-A3GHV:1:1104:7756:4776/1
-GGCCCATAACACTTGGGGGTAGCTAAAGTGAACTGTATCCGACATCTGGTTCCTACTTCAGGGTCATAAAACCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGA
-+
-CCCCCCFFFFFFGGGGGGGEEFHHHHGHGHHHHHHGGHHHGGGGGGHHGHHHHHGHHGHHHGGFHHHHHHHHGHHHFHHGHHGFGGGGHHHHHHHHGHGHFFHFHHHHHHGGHGFGFHHHGHG?FGHHHHHHHHHHHHHHGHGHHGHGGCDGFFHHHHGHHHHHGHHHGFHGHFHGHGHGH/@CABFFFFFFFACAFF?BBFFBFD-@-.D>FFAF.F.:9---;AADFFFFFBEFFF:9FFFFBBFFFF/
-@M01368:8:000000000-A3GHV:1:1105:11310:21761/1
-ATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGTTTTATGACCCTGAAGTAGGAACCAGATGTCGGATACAGTTCACTTT
-+
-CCCCBFFFFFFFGGGGGGGGGGGHHHHHHHHHHHHGHHHHHGGGGGHHHHHGGHHHGGGGGGHHHGGGGHHGGGGHHHHHHGGGGGGHHHHGGGGGGGHGGGGGGHHHHGHHHGHHHGHGHHGHHHHGGHGGG=FFGEHHHHHGHFGGHHGHHHHHFHHHHHHHGGHHHHHHHGHEHHGHHHHHGGGGF9AGE?DEGFFGGGGGGGGGGGGGGFFFF/9FFBFFFFFFFEFFFBFFFFFFFFFFFFEFFF0
-@M01368:8:000000000-A3GHV:1:1105:11578:14676/1
-ATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGTTTTATGACCCTGAAGTAGGAACCAGATGTC
-+
-CDDDDFFFBFFCGGGGGGGGGGHHHHHHHHHHHHGGGGGHHHHHHHHHHHHHHHHHHGGGGGHHHHFGGHHHGGGGGGHHHGGGGHHGGGGHHHHHHGGGGGGHHHHGGGGGGGHGGGGGGHHHHHHHHHHHHHHHHHGHHHHGGGGGGHGGHGHHHHHHH;CHHHHHHHHHHHHHHHGHGGGGFGGGFGGGGGGGGGGGGFGGGEGGFFFFFFFFFFFFFFFFFFFFFFFFF/FFFFFFFFFFFFFFFF0
-@M01368:8:000000000-A3GHV:1:1105:13575:19255/1
-TTAGTAAGTATGTTCGCCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGTTCCCGTGAGTGGTTAATAGGGTGATAGGCCTGTGATCCATCGTGATGTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGTTTTATG
-+
-AA1A1DFFFFFBGG3A111FFAEGDDBGFDHF00F01BBA00BFGEHFBFFA1FABB0FAE?CFHF1BGFHFB0011F121E//>>1F10>B?EFHGCC/?/BFG/EEGFFEE//BCFDE0?E@@B/?11</?//<@?/F<<<A-<FBGH0.00=G0<<C//./0;;GC....<C.=.00;;BB./:.900////.C000;0090;..//000;C/;;/B/9BA9A9-AEEFF?B---;B99//9/;A//9
-@M01368:8:000000000-A3GHV:1:1105:15502:11453/1
-GTCCTACAAGCATTAATTAATTAACACACTTTAGTAAGTATGTTCGCCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCTGTCTCTTATACACATCTC
-+
-A3AAAFFFFFCFGGGGGGGGGGHHGHHHGHHHHHHHHHFGHHHHHGGGGHGHHHHHGFHHHHGHGGGHHGGHGGHHHHHHHHHHHHHHGGGGGFHGHHHGHHHHHGHHHHGGGGGGHGEGFECHEHGGGGGGHHHGADFHHGGGGHHHHH<ECGGGGHHHHGGGGGGGHGGGGGGHHHGHGHHGEHBFFFGFGEGGGGGEDEGF0C;;BFFFGGGBEFFE/FFFFFFFFFFFFFFEFFFFFFFFBFFFBFF
-@M01368:8:000000000-A3GHV:1:1105:16787:9771/1
-GTTATTATTATGTCCTACAAGCATTAATTAATTAACACACTTTAGTAAGTATGTTCGCCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGAT
-+
-AABCCFFFFFFFGGGGGGGGGGHHHHHHHHHHHHHHHHHGHHHHHHHHHHHHHGHHGGGGHIIHHHHHDHHHHHHHGHHHGGHGGHHHHHHHHHHHHHHGGGGGHHHHHHHHHHHHHHHHHHGGGGGHHHHGGGHHHGGGGGGHHHGGGGHHGGGGGHHHHHGGGGGGHHGHGGGGGGGEEGEGFGHHHGGGGFFGGGGGGGGGGGGGGGEG?G;:EFFFFFFFFF:AEFFFFFFFFBFFFFFFFFFEFF/
-@M01368:8:000000000-A3GHV:1:1105:17564:15723/1
-TATGCTCGCCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGTTTTATGACCCTGAA
-+
-EDCCDFFCEEDCGGGGGGGGGGHHHHHGFGHGGHGGHHHHHHHHGHHEHHGGGGGHHHHHHHHHGHHHGHHHHGGGGGHHHHFFGHHHGGGGGGHHHGGGGGHGGGGHHHHHHGGGGGGHHHHGGGGGGGHGGGGGGHHHHHFEHHHHHHHHHHGHHGHGGHGGGCGGGGHHH1FGGGFGGFGGGGGGGGGGEFGGGGGGGGGGGGGGGGGFFFFFFFFFFAEFFFFFFFFFFBBFBBFFFFFE1:BFFB0
-@M01368:8:000000000-A3GHV:1:1105:18108:12091/1
-TAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGTTTTATGACCCTGAAGTAGGAACCAGATGTCGGATACCTGTCTCTTATACAC
-+
-CCCCCFBFFFFFGGGGGGGGGGHHHHHHHHHHHHHGGGGGGFHHHBFGHHHGGGGGGHHGGGGGHHGFGGHHHHHHGGGGGGHGHFGGGGGGDGEGEFGCHHHHHHHHHHGHHHHGEDHHHGGGCDGGGGFHFHGHHHGHHGHFGHHHFHHGFHHHFHHGGHFHFHHGB0CGHGFHCBGGGGEDEE9ADFEFFFGFBFGFFGGFFFFFGGFGFFFFFFFF/A?FEFFFFFEF-A.B//;BFFEF//BB///
-@M01368:8:000000000-A3GHV:1:1105:18331:16683/1
-TCTGGTTCCTACTTCAGGGTCATAAAACCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATCCTATTATTTATCGCACCTACGTTCAATATTA
-+
-BABA?DFFFFFFGGGGGGGGGGHHHHHHGHGHHGGGHHGHGGGGFFHHGHHHGHHHHHHH3FGHHGGGHGGHHHHFHHHFHGHHHGHHHHHHHHHHHHGHHHHGGCGGGHHGHHHHHHHHHHHHHFHHGHHGHGHEFGGGGABFFFGBEGGAFFFFFFFFFFFFFDDFF?DFFFFFFFFAEFFFFFFFFFFFFB;9FFFFFEFFFFFFFFFFFF?FFFFFFF/BFFFFFFFB.DABFFFFFFB.//:FB//
-@M01368:8:000000000-A3GHV:1:1105:20577:18421/1
-GGGGGTAGCTAAAGTGAACTGTATCCGACATCTGGTTCCTACTTCAGGGTCATAAAACCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATCC
-+
-ABB@3>AAFFFFFEAGGGFGGAA6FHDGGCGFHFFHFHFHHHHHGDDDFFFHGFFHGBEGEGHHHFFFHGEEAEGHHHHHFHHHFHGHFEDGGEGBEAGEFHHFFHHHHHHGGHHHGHHGBGHHFHHFGHHHHG?CG?AFHH1FHHHGHFHHHF?DGHFFHCGAGEFHGCBBBB?BFFF?B-B.9/BFFFFFB=-AD?..@FFFF@@-@@?AFD.FFFBBEEBD9/:FFFFFBB/:FF9BF/BF.BBFF/:
-@M01368:8:000000000-A3GHV:1:1105:21099:2895/1
-TAGCTAAAGTGAACTGTATCCGACATCTGGTTCCTACTTCAGGGTCATAAAACCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATCCTATTT
-+
-CBCBBFFFFFFFGGGGGGGGGGGGGFHHHHFHGHHHHHHFHHHHFGFHHHHHHGHHHHHHGHHEHGGGGHHHHHHHHHHHHHHHHHHHHHHGGHGGHHHHHHHHFHHHHGHGHHHGGHHHHHGGHFFGHGCGGGHGHHGHHHFGHHFHH/FGGGHFGFEGGCFCCD;B@DFFFFFFFFFFFFFFFFFFFFFFFFF;F.BEFADFFFF.AEFFFFFFE;D.;:B00099:09BFBFFBFF.0:000BFFBF0
-@M01368:8:000000000-A3GHV:1:1105:26469:19245/1
-TTATGATTATGTCCTACAAGCATTAATTAATTAACACACTTTAGTAAGTATGTTCGCCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCAAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATG
-+
-BAAAAFFFBFFFGGGGGGFFGGHHHHHHHHHHHHGGHHGHHHGGHHHHHHHHHHHDEGGHGHHHHHGEDHFHGFHGGHHGGHGGEHHHGHHGHHGHHHGGEGGGHGHGHHHHHHGHHHHGHGGGGGHFHGGGGHHGGGGCDGHHHGD<EHHGGGGGHHGHH?EDCCDHHHHDGFFGGGHGGFCGGHHHHFG.CFGGGGGGGGGGGBFGDEG.AFFG;AFFFFEB?/A9BBBFFFFFFF/9FFFFBDEFFFF
-@M01368:8:000000000-A3GHV:1:1105:7169:17145/1
-AACCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATCCTATTATTTATCGCACCTACGTTCAATATTACAGGCGAACATACTTACTAAAGTGT
-+
-CCCCCFFFFFFFGGGGGGGGGGHHHHHHHHHHHBHHHHHHHGGHGGHHHHHHFHHHHHHHHHHHHHHHHHHHHGHHHHHGGGGCHHHHHHHHGHHHHHHHFHHHHHGHGHGHHGGGGGFGGHHGGGGGGGGGGGGEGGFGGGFFFFFFFFFFFFFFFFFFFFFFFFFFFDFFFFFFFFFEFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFEFFFFFFFFFFFFF-9@DDBFFFFFFFFBBFFF0
-@M01368:8:000000000-A3GHV:1:1106:15481:16176/1
-CTTTAGTAAGTATGTTCGCCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGTTTTT
-+
-ABBBBFFFFFFFGGGGGGGGGGHHGHGHHHGHHHFGHGFGHFEHGGHGGHHHGHHHHFGHGGFGFFHHFHHHHEGHFHHHHHFGGGGGHGGGHGFHGHGGGGGGHHHGGGGHHGGGGHHHGGHGGGGGGHHHHGGGGGCFHGGGCDGHGHHHFHEHHHHHHHHHEEFHHGG:C:?0<EFGBFGGGGGFE.BFGEFFFGFFGGGGGGFDEF/FFGFFFFFFF;BBFA;.:EFFE:AAFEF.BFFFFF;9FF.
-@M01368:8:000000000-A3GHV:1:1106:17389:18671/1
-CCATAACACTTGGGGGTAGCTAAAGTGAACTGTATCCGACATCTGGTTCCTACTTCAGGGTCATAAAACCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGGCTTTGATTC
-+
-3>>A@FFFFFFFGGGFEECFGGFFB5GBHH5DFH5GBEEAEFHFHHF3F3GHFHHHEF3GAEHBGFHFFEFFHHHHFFB31FGGEGFHGEHHHHHHHHHHHHHHHHHEEEEGHHHFFF3GF3FGF44BBGEHHHHGG2B/BGGHE</ECDFHHBF1DGBFBFGFH<1GHGDGGFDFE0/<--;-9./BBED;BFBD/BF9BFFFDBFDADD;FFF?->;B=.9.;.BBFFF..;A;/B/;B//;;//BBF/
-@M01368:8:000000000-A3GHV:1:1106:22927:3863/1
-GTATCCGACATCTGGTTCCTACTTCAGGGTCATAAAACCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGACTTCTGTCTCTTATACACATCTCCGAGCCCACGAGACTAA
-+
-A>ABAFA?D@AFGGGGFGGGFGFHHHFFH4BCBGHHHHGFFF3G5BF3322EEAFHHHHHHAB5GHFHEHFHHH3BEEHFGF5@13FDF3GDGFHHFGHHHGHHHGFGGHHFCG//?/EGHHHG3F4BFFGHHHEDGFHHB/B/?FBF<@-9?BDEFFF?B--?DFFFB9FA>B;A.BFDB?AB.--@;-.FFAEFFFF9AE;DDFFFFB/9BFFFFFFFB:BF/BB/BFF//FFF-=--.99=--.9///
-@M01368:8:000000000-A3GHV:1:1106:23625:4236/1
-TAGCTAAAGTGAACTGTATCCGACATCTGGTTCCTACTTCAGGGTCATAAAACCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATCCTATTA
-+
-@?AAAFFBFBFFFGGFGFGGGEFCGGHHHHFGHGHFHGHHHHGGFGGFGHHGHGHHHHGHGFFHHGGGGGHHHHHHHHHBFHHEFHHHHHHGF?FAGHGFHHHGDGFHHGGGHGHFHHHGHHHGHHFHHGFFGFHHHGHHHHFFHHHHH/FGHHHHGHGHG<C???B=@ABBFEF@=-AFFFFFFBFAFFDFFFFA?AFFCFFABEFFFFFFFFF?FFFDFFBFF;FFEFFEFFFFFFFAF///9FF/BB/
-@M01368:8:000000000-A3GHV:1:1106:26031:14826/1
-GATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATCCTATTATTTATCGCACCTACGTTCAATATTACAGCTGTCTCTTATACACATCTCCGAGCCCACGAGACTAAGGCGAATATCGTATGCCGTCTTCTGCTTGA
-+
-ABBAAFFF@FFFGGGGGGGGGGHHHHHHGHHHHHGGGGGHHHHHHHHGHGHHHHHHHHHHHGHGHFHFGE?CGDGGHHGGGGGGGHHHHGHGGGGGGFGGGHGHGGGGGGGGGGGGGGGGGGDGAFFGFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFEFFB/9FFBFFFFFFFFFFFFFD@D=BEFFF;FDDB////B=CF-.;BAFFFFFF;;BFE/BFFFFB:
-@M01368:8:000000000-A3GHV:1:1106:27607:15990/1
-GACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGGGGCTGTCTCTTATACACATCTCCGAGCCCACGAGACTAAGGCGAATCTCGTATGCCGACTTCTGCTTGAAAAAAAAAAACTACAACCCACGGACGCA
-+
-BBBBBFFFFFFFGGGGGGGGGGGGHHHGGGGGGHHHGGGGGFCEGGHHHGHHGGGEGGHHHAFGGGGGGAFG//EGHHHHCGEHHHHEEHHFHGHFHHGGEF/FGGC?FDFH2DHHFFGGFGHHHHGGHHFGHHGHGHHGFHDHBGBBGHHFHHGGCCDC<=D<DGHHC;CGFCCFBECDG?FGGA-;EB9FBGFFBBF>DFFFE?FFF/--;;9/:BFFFBA///9----;B.//////;...---9---
-@M01368:8:000000000-A3GHV:1:1106:6455:17124/1
-GTATCCGACATCTGGTTCCTACTTCAGGGTCATAAAACCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATCCTATTATTTATCGCACCTACG
-+
-BBBAAFABDBBFGGGGGGGGGGHHHGHHGHHHHHHHHHGHHGHHGHHHGHGGGEGHHHHHHHHHHHHHGHHHGHHHGGHGGHHHHHHHHHHHHHHHHHHGHHHHHHHHGHHHHHGGCFEHHHGFHHHHGHHFFH?GGHHHHGHGHGHHCFGGGGGGGFFFFFFFFFFFFFFFFFFFFADFA?.FEFAFFFEFFFFFFFFFFFFDABFBBFFFFFFFFEFFBFFFFFFFFFFF/FFBFFFFFFADE>BFFF9
-@M01368:8:000000000-A3GHV:1:1107:14451:26748/1
-GTATGTTCGCCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGTTTTATGACCCTGA
-+
-BABBBFFDABBBGGGGGGGGGGHGHHHHGAGHGGGGGHHHHHHHHGHHHHHGGGGGGFFHHHHHHHHHFHHHHHGGGGCHFHH3FEHHGCGGGDGHHHGFGGHHGGGGHHHHHHG/DGGGHHHHGGGGGCCHGG?CGG1GHHGHHHHBGHHHFHHGHHHHGGADAD00ECEGHEFHHFFAEFFFFFGGFBFBFFFGFFG.;B/99;BCFGGGGEFFFFFFEDA./:ADEB?FBFFFF;FFEBFBFFB./9.
-@M01368:8:000000000-A3GHV:1:1107:18714:24788/1
-GTATGTTCGCCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGTTTTATGACCCTGA
-+
-BBBCCFFFDEDEGGGGGGGGGGHHHHHHGGHHGGHGGHHHHHHHHHHHHHHGGGGGHHHHHHHHHHHHHHHHHHGGGGGHHHHCFGHHHGGGGGGHHHGGGGHHGGGGHHHHHHGGGGGGHHHHGGGGGGGHGGGGGGHHHHHGHHHHHHHHHHHGHHHHGGEGEGCCEGGHHHHHHG:CAFFGGGGGGBFEFGGGGHGAFFGGFGGGGGGGEFFFFFFFFFEF/EDDFFFFFFFFFBFFFFFBBFFBBF/
-@M01368:8:000000000-A3GHV:1:1107:21355:8333/1
-ATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGTTTTATGACCCTGAAGTAGGAACCAGATG
-+
-ABCBBFFFFFAFGGGGGGGGGGHHHHHHHHFHHHHHGGGGGHHHHHHFHHHGHHHHHHHGGGGGHHHHFFGHGHGGGGGGGHGGEGGGHGGGGHHHHHHGGGGGGHHHHGGGGGGGHGGGGGGHGHHHFHHHHHHHHGHFFHHHHGGHGEGHHGHGFHHFHGHCEFHEGHGHHHGHHHGGGGGGCFFFFBFGGFGGGGFBG?FDGGGEGFFFFEFFFFFFFFFFFFFFFFFFFFFFFFFFFFFBFF.AA/9
-@M01368:8:000000000-A3GHV:1:1107:22864:15712/1
-AATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATCCTATTATTTATCGCACCTACGTTCAATATTACCTGTCTCTTATACACATCTCCGAGCCCACGAGACTAAGGCGAATCTCGTATG
-+
-BBBBBFBBFFFFGGGGCEGGGGHGHHDGFHHHHHHHHHHHHHCHHGHFGBGDFGE?GHHGHFBHHFHHHHHHHHHGHFGFGHGHHGGC@DCFGHHGGGGGGGHHHHHHGGGGGFGGGGFFGGGGFADGFEFFFFFFFFFFF9;FFFF/BFFFFFFFFFFFFFFFFFFFFFFFEFFFFFFEAECDFFFFFFFFFBFFFFFFFFFFFFFFEFBFBFFF/FFFDF-;-9;E@>-9DFFF/FFBF;-.:;.9A//
-@M01368:8:000000000-A3GHV:1:1107:24817:14233/1
-CTTCAGGGTCATAAAACCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATCCTATTATTTATCGCACCTACGTTCAATATTACAGGCGAACAT
-+
-3AABABFFBFFFGCFGGGGGGGHHHFGCFGGGFFGHHCGHHHGHGHGHBFFHHHEDGGFGFGHHFFFHGGEGHFHHGHFHGFFHHHFGHHHFHACECEHHHBGFHGFHHHFHHF4GFHFHFHEHGGE/EG:A-CFGGFGADGGGGFGGGGDAAAADFA.-AFFECFDAAFFFFEFFFFBFF;D;BFFFB/;BFFFFFFFFFFFFFFBFFBF/;//;BFFFF?FFFFFFEDAFFFFFBF//:BFBACF--9/
-@M01368:8:000000000-A3GHV:1:1107:24830:14440/1
-AACTGTATCCGACATCTGGTTCCTACTTCAGGGTCATAAAACCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATCCTATTATTTATCGCACC
-+
-ABBBA@FFFFBBGGGGGGGGGGHGHHGHHGHHHGGHHHHHGHGHHGDHHHHHHAGGGGFHHGHHHHHHGHHHHHHHHHHHEGAFGFHFHHHHGEGHHHHHHHHHHHHHHHHHGGHHHGEFEGGHHGHHHHHGGHGFHH/?GHHHHGFGHGFHCGGBBDAFFFEFFFFFFFFFFFFFF=CDDADDFFFFEF=BFFFEFFFBFFFFEEBF./:FFFFFFFFFFFFFFFFFFFEFFFFFFFFFFF/BFBEFFC-
-@M01368:8:000000000-A3GHV:1:1107:26478:23602/1
-GCTAAAGTGAACTGTATCCGACATCTGGTTCCTACTTCAGGGTCATAAAACCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATCTGTCTCTTATACACCTCTC
-+
-1AAAAF1B13BBBEGGGFGGGGGGHHDB1BGFHHHFGFGGG0F00BGBGFGGF1GBGB1BGCGAEE/FGFHGHFHHHHHBFF1B0FGGF//F//FGFGFFF/1@B1DFHHHGGEFEDHFDFAFF0B//</ECCC>1FDD1GFFHHDF?1BD>GF/GCAC0C@?@-;99BBB->@--;-B//99B--9-BF=A--A-:A----9AA9AFBFBBB?E@BBFFFFFFFBFFFFFBFFFBBFFF//B/////-;9
-@M01368:8:000000000-A3GHV:1:1108:11059:23181/1
-GTTATTATTATGTCCTACAAGCATTAATTAATTAACACACTTTAGTAAGTATGTTCGCCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGAT
-+
-CCCCCFFFFFFFGGGGGGGGGGGHHHHHHHHHHHHHHHHGHHHHHHHHHHHHHGHHGGGGHIIIHHHHHHHGHHHHGHHHGGHGGHHHHHHHHHHHHHHGGGGGHHGHHHHHHHHHHHHHHHGGGGGHHHHHFGHHHGGGGGGHHHGGGGGHGGGGHHHHHHGGGGGGHGGHEFGGGGGHGGG-ECHHHGGGGGGGGGFGFFGGGGFGGGCF?EFGG0;BFFFFB?9AAFFFFFFBF;BBFFBFFFFE?F/
-@M01368:8:000000000-A3GHV:1:1108:12233:13498/1
-TAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGTTTTATGACCCTGAAGTAGGAACCCTGTCTCTTATACAC
-+
-BCCBAFFBCCCCGGGGGGGGGGHHHHGGGGGHHHHHHGHGHBGFHHHHHGGGGGHHGGBFGHHGGGGGGGHHHGGGGHHGGGFHHHHHHGGGGGGHGHHGGGGGGGGGGGGGGHHHHFHHHGHGHHHHHHGHGHHGGFGGGDFFGGHHHGHGH/<GHHFGBGFHFBGHHHGHHGEFHFHFGBF0BFGGGFGGGGGEFFF;A?EEG?CFFFFF0:BEFFFFFBFFFFFF0FFEFF?EFFFF0BFFFFBBB00
-@M01368:8:000000000-A3GHV:1:1108:14328:14751/1
-ATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGTTTTATGACCCTGAAGTAGGAACCAGATGTCGGATACCTGTCTCTTATACA
-+
-BCCCBFFFFFFFGGGGGGGGGGHHHHHHHGHGHHHHHGGGGGFHHHFFDGHHGGGGGGHHHGGGGHHGGGGHHHHHHGGGGGGHHGHGGGGGGGGGGGCFGHHHHHHHHHHHHHHHHHGHHHHGGGDGGFGGFGGHHHHHH>FHHHFHGHGHHGHHHGHHBA<CGFHHHHHHHHHHGFHHGDDEGCEGGGGEEFBFGGGGFGGGB0CFF:FFFFFBBFFFFBFEFA.BFFFEFFFBF/BF/FFEFFBFFF/
-@M01368:8:000000000-A3GHV:1:1108:16350:22621/1
-TTAGTAAGTATGTTCGCCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGTTTTATG
-+
-AAAACFFFFFFFGGGFGGGGGGHHHHHHGBGGGFGGGHFGGGGGHHHHHGGHHHHFHGGGGGGHHGFHHHHHGEFHHFFHHGFCEFHHHGFF?GHHEE@ECFHHEGGGGBFFEGGGHFDHHGFG/BFEHHFCDGGGCDEGGGCGFFFHHHFEGHFHHHHGHHDGHHHGGHDED0CE;CFFFFBFF/;CBFFFGG0/FFF0B0:BB?.;BFF0FGFBFFFFFEFE;ADED.;BE.99FAFFFFFFF/;EFF/
-@M01368:8:000000000-A3GHV:1:1108:21791:23272/1
-CTTTAGTAAGTATGTTCGCCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGTTTTA
-+
-3ABBBFFFFF@FGGGGGGGCGGGHHHHHHHHGHHACGDAGFEEHGGHHGHHHHHHHHHHHGGGGGGHHHHGFHFGHGFDDGFFFGGFGHHFF?FEGHHGGGGGGHHHGFFDHHFGG?HEFGHHGGGDDCGFFC?ECCFGDEFGGGGGGFHHHHHHHEFHFCGHHGEGGGGD.:.A;CECAFFFFBFF/;EFFBFFBFB;;BFFFFBBAA./BFFEBB//BFFFFFFFDFFFEEFEFFFBFBFBBFFFFF./
-@M01368:8:000000000-A3GHV:1:1108:23314:26089/1
-ATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGTTTTATGACCCTGAAGTAGGAACCAGATGTG
-+
-BBBBBFFF?FFAGFBFGGEGGGGHGHHFHHHGHHGFGGFHHHHHHHHFHHFHHGHHHGGGGGHHHHFFEHHHGGGGGGHFHGEEGF3FEFGHHHHHFFDEEEEHHHGEEGGGGGHFGGDADGFFFFFHHFGHHHFGBHGHHGBCEHDEDDGADCFFHHHGG/:GCCCGHFGHFFGG0CGFGF.FB/9;BFBB0FFBFG0A-..;C:E/.A9.FFFFFFFF9BFFFFFFBFBBB./:BFFF/F;AA?F////
-@M01368:8:000000000-A3GHV:1:1108:25084:18127/1
-TTATTATGTCCTACAAGCATTAATTAATTAACACACTTTAGTAAGTATGTTCGCCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGAGATAGACCTGTGATCCATCGTGATGTCT
-+
-CCBBCFFFFFFFGGGGGGGGGGHHHHHGHHHHGFGGFHHHHGHHGGFHEHHHCGGGHBHHHHHHFHHGHHHHGGHHGGHGGGHHHEFHHHHEHGHGGGCFHFHHHHHHHHHHHGHEFGDEGGGHFHHCGGHHGGGGGFGHHGGEGDFHEGG/?GFHGHDGGGGGHHHHADFGGGGGEGCGGGEFGHHFEBFFGGG?GGGGEGGFEFAA?.0:A0;BFFFBFF/;9BFFFFEFF9FBFFB/F/.;FFFF/BB
-@M01368:8:000000000-A3GHV:1:1108:7626:10048/1
-ATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGTTCTGTCTCTTATACACATCTCCGAGCCCACGAGACTAAGGCGAATCTCGTATGCCGTCTTCTGCTTGAA
-+
-CCCCCFFFFFFFGGGGGGGGGGGHHHHEFEFHHGGGGGGHHHGEF?GGGGGGHHHHHHGGGEGEHHHHGGGGGGGGGGGGGGHHHHHHHHHHHHFFCGHGHHHHGG/BFGDGG2FFHFHGHH0FHFGFHHHHFFHHHHHHHGG<FHHHFGHHGGGGFHHHGGGGGGHGGHGGGHHHHHHFGGGGGGGFFFGGFGGBFGGGGGGGGGGGFGFFFCFFDFFFFFFFFF;./;AAAFFFFFFAFABBFFFB/;;
-@M01368:8:000000000-A3GHV:1:1109:11270:12255/1
-AATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGTTTTATGACCCTGAGGTAGCTGTCTCTTATACACATCTCCGAGCCCACGAGACTAAGGCGAATCTCGTT
-+
-CCCCCFFFFFFFGGGGGGGGGGGGHHHHFFFHHHGGGFGGFFHGEGCHHGGGGHHHHHHGGGGGGHHGHGGGGGGGGGCEGFCHHHHHGFHFHHHHGFHHGGFHGGGFD/EFGEFFDGFHHGEFCEHFFGHHHGHHHHHHHHHGCGHHHGGFGHHHHGHEHHCFFADGHHHD?CG.CGHBCBFBFFGGFFFGFFFFF.CFBFBCFFFFGFFFFFGGGFFFFFDFAFFFFFF-@DBFFFFBFD---.;BAA.
-@M01368:8:000000000-A3GHV:1:1109:19224:11655/1
-AAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGCATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATCCTATTATTTATCGCACCTACGTTCAATATTACAGGCTGTCTCTTATACACATCTCCGAGCC
-+
-BBB@A4FFFBBBGGGGGGGGGGHHHHHHHHFHHHHGFGHGGGFFAGFHHHFHHHGHHHHHHHHHHHFHGGHGHHGCFFGHHHGHHHGHHFHGGH3BFFGHHGHGEFFH/EG@-CFGGCC@-;BD?FGGGGGG??FGDAGDFFFFEFF@BAAFEFFBFFFFF?FD9BBFFFF/FFFFBFFFFFFF?FFBFFFF/FBBFFBFFFE?F;@B//AFFFFFFFFF//;BFFEF.BFFFB/;F/99/FBFFBDCF;B
-@M01368:8:000000000-A3GHV:1:1109:21978:9490/1
-GGGTCATAAAACCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGTCTCTTATACACATCTCCGAGCCCACGAGACTAAGGCGAATCTCGTATGCAGTT
-+
-?A3AA?DFFFFFGGGGGGGFFGHFGCEGGFHHHHHHHHHGHCBGFEGGHHDEGAFGHGHFGDGBCGHHHHHFHHGHHHHHHHGHHHH1E?EGGGHHHHFGFHFHHHHHEDHHGHH@GGHGHHCGG?CFGFGGGGGFGB.BFGGFFGGFFFBDDBFFFFFF9-;DEFFDFBFFBB.EFF;BFBFFFFFFFFFFFFFFFFFFFFFFFFF/B9/FFFFFFFAFFFF--99AFFFFFFFA;;;FF..9//;/;;/
-@M01368:8:000000000-A3GHV:1:1109:22910:4079/1
-TAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGTTTTATGACCCTGAAGTAGGAACCAGATGTCGGATACAGTCCACTTTAGCTA
-+
-CCCCCFFFFFFFGGGGGGGGGGHHHHHHHHHHHHHHGGGGGHHHHGGEHHHGGGGGGHHHGGGGHHGGGGHHHHHHGGGGGGFHHHGGGGGGGHGGGGGGHHHHHHHHHHHHHHHHHGGHHHGGHGGGHHGHGHHHHHHHGFHHHHHHHHHHHHHHHHHHGGHHHHHHHHHHGHHHHHHGGGGGGGGGGGGGGGGGGGGFFGGGGGGGGGGGFFFFFFFFFFFFFFFFFFFCCDFFFFFFF0BFFFFFFF0
-@M01368:8:000000000-A3GHV:1:1109:24217:19077/1
-AAAGTGAACTGTATCCGACATCTGGTTCCTACTTCAGGGTCATAAAACCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGCCTTTGATTCCTGCCTCATCCTATTACTGTC
-+
->AAA3BDFFFFDGBFFEEGGGGHHGHFHHCFHGHGHHHGF3BFGFHGFEFHFHGH3EGFC1EEGBFGBHFGGFFHHHGHFHGHHGHGGHCEHEBCFF3ED3@GH4FDEG12FFHFFHG/G3FGA/@EFEFCG33FFGBBGHFHH/?BFBGFGFAGC2C/@-;@-;BFFEFADF?DFFFFFF?;AFFA;AD;..FEFFA--;9;D.9BFFBE?;.;///://///99//BB/9;F./B//BBFB9////99/
-@M01368:8:000000000-A3GHV:1:1109:25237:11722/1
-CCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGCTGTCTCTTATACACATCTCCGAGCCCACGAGACTAAGGCGAATATCGTATGCCGT
-+
-AABBBFFFFFBBF5BGGFGABGHGGAEFGFHHHHFHCHFHHBFGGGEHBGGHFFFFGFAEF5FHH?EGGF5AEG3?EBFHD?C/EFHFFEGEE?CFGGGHHFHB3EEFG?EEGHCFGGGGGGGEC<CDFHHHHHE.FD11FFAGBGD.DGHEA<.<<0<EHAHCFHHF./;CC0GFH0::0CFGG0FBFD;9/90BFF0CBBFGB09;B:0;CFF0.-;@AFEEF--;AFFBF/99D-;.//.../9;B-.
-@M01368:8:000000000-A3GHV:1:1109:27103:7153/1
-GTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGTTTTATGACCCTGAAGTAGCTGTCTC
-+
-33>A?FFFDFBFGCG4EGFG??GACFGGHFHCFHCHBECDEFCEGHHHHHFFGGF3AFFHHFGEGCGHHGEHGFGHHEGG?EFHHH?EGGHHGGGGHHHHHHEGGGGGHFHHGFDDGGACFCC@?/FDDGHHHGHEFFHHH0FDHHFFEDCD.<GGEHGF0CHHHF/CAGC000CCGFHFGFGFFG?:CB990;F09;FB0BBGGGGGG?;A9EBDEFA///;FF/:F?BFBBFFBFFFF///;/9B;///
-@M01368:8:000000000-A3GHV:1:1109:8763:7859/1
-TAGTAAGTATGTTCGCCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGCTTTATGC
-+
-BABAADFFFFFFGGGGGGGGFBGFGHHFBHHHHGGHHGGEHGDHHHFGHEHHHHGHHGGGGAGHHFBHHGHFHHHHHHHHGGGCEFGFFFFEHHH?FFG1FFHHFEGGGHGFEEHHHHHGGGFGGGHHHHGGGGG/C/FG-<A<GFHHFFCGHHFHGE0<<CGHHHGCHG.CCCCCE00BBFGFFG.BB0FFBFBCF0;CBFFFEEGBBBFFBF/FFF9BF/9BAFFD9AFEDAA.A/BFFFFFFFFFEB/
-@M01368:8:000000000-A3GHV:1:1110:12808:18367/1
-AATTAACACACTTTAGTAAGTATGTTCGCCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGGGGAACGTGTGGGCCTG
-+
-BBBBBFFFFBBFGGGGGGGGFGFGHHGGGGGHHHHHHHHGFHHGEGGGHHGFGHEEGGHHHHGHHGFFHHGGGGGHHHHGHGHGHHHFGGFHHGGGGGHHFFFGGHHHE?@EGGHFHEGGGHHGGGGHGEFHHGD?/>CFHHGDFGGGGGEFGC?EGHHHB0CGHHGCGHHHHBEHGHH.::ACA;FECFGGGGGFFFEFGGGGGGGFFBBBFGBFFFEFFFFBFFFFFFBBFBFFB9..AF?FFFFFFF9
-@M01368:8:000000000-A3GHV:1:1110:14751:26540/1
-TAACACTTGGGGGTAGCTAAAGTGAACTGTATCCGACATCTGGTTCCTACTTCAGGGTCATAAAACCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACTGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGTTGTGCACGCGATAGCATTGCGCGACGCTGGCGCCGGCGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTG
-+
-AAA?1CFFFFADGEEGFGB1112DGDGHGFGHHCG/ECEBGGHDFGHHFHGHEB1BCGFFE2EGHHGHFFFHHBFFHEFCGGHHFHHHHH111BFFHGHEHBEHGGECEFHGFHFGGDBBGHHBHHHH0GH22FGHGFFFH1BFCG0F@FGG11@GDHFG1D/1FGFHH/FCG.>0><-<@CCFFG.CC-@C?C9FFF0C---;------;9----9-9@-AAFF9B9---9-/;B9BF/9BB//B/;///
-@M01368:8:000000000-A3GHV:1:1110:15519:10008/1
-CTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGTTTTATGACCCTGAAGTAGGAACC
-+
-BBBBBFFFFFFFGGGGGGCBGGE?GGGHHHHHGHHBEGGHHGGGGGHHHHHHHHHHHGGHHHHGFGGGGHGHGCFGHHHGGGCGGHGHGGGGGHFGGGHHHHHHGCEFGGHHHHGGGGGGGHGG/CEGHHHHGFHHHGFHHGFFHGHGHFGGEGFDDGGBCGHHGFHH/CHHHHGHGHF0CFGGGGGGGFFFFFBFFFFFFGFFGGF?DGEDEEFEFFFF?FFFFFFFFFFFFFFFBFFF.BFFFBFBBA;
-@M01368:8:000000000-A3GHV:1:1110:16559:7507/1
-CATTCAATTGTTATTATTATGTCCTACAAGCATTAATTAATTAACACACTTTAGTAAGTATGTTCGCCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAACTGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATC
-+
-ABBBAFFFFFFFFGGGGGGGFGGGGAGHHGCHHGHHHHHHHHHHHGHHGHHHHHHHHHHHHHHHHFGGGHHHHHHHHBDHHHHHGGHFEEGHGGHHHHHHHGHHHEHFGGGGGGHHHF33FGHHG3GDDGH//EEGHHFFBF?GHHFCC@DGFCGGB?DGHAFGGHHGFH0E??<@DGHGGCFGGF?DGGGFFGGGGGGGG.C/0BBF?FBBEGG0FFF.AA9;B9/E////99;;:.//:FFFFBBF//9
-@M01368:8:000000000-A3GHV:1:1110:16700:6843/1
-AAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGTTTTATGACCCTGAAGTAGGAACCTGTCTCTTATACACATCTCCGAGCC
-+
-BBBBBFFFFFFFGGGGGGGGGGHHHHGHHHHHHHHHHHHGGGGGHHHHHGGHGHGGGGGGHHHGFFGHHGGGGHHHHHHCGG@FGHFHFEGGGGGGHGGGGDGHHHHHHHHHHHHHHGHHGHGHHGGGGGCGHEHGHHHFHHHFF.DGHHHHHHGHHHHHHGFGHGCGHGHHHHHHHHGHHHCD?:A::FCDGEGFGFFBFGBFGGGF00CBFFFF/BFBFFFFAE.FBBFBFFFFB/BFFBFFF/ADCAD
-@M01368:8:000000000-A3GHV:1:1110:18014:7856/1
-ATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGGGATAGACCTGTGATCCATCGTGATGCTGTCTCTTATACACATCTCCGAGCCCACGAGACTAAGGCGAATCTCGTATGCCGTCTTCTGCTTGCAAAAAAAAAATAG
-+
-AABBBFFFFFFFCGGGCGGGGGGHHHHHGFHHHHHHGHHHGGGGGFHHGHFGGHHHGGFGGGHHGGGGGHHGGGGHGGHHHGGGGGGHHGHGDGGGGGGGGB/A<GFHFHHHGHBBGFEGGGGHFFFEF/EEGGHGGFEHFHHBA.<ADFFHFHB/CCGHFEFHHGHGEFFGGGGGFFFGGFGFFBFFGGBFGG??DGG?@9-ADFFFFB/@BD;./BFE?BFE/>99FE//BBFFF.9/FF?DA=@9./9
-@M01368:8:000000000-A3GHV:1:1110:23303:11846/1
-ACTTGGGGGTAGCTAAAGTGAACTGTATCCGACATCTGGTTCCTACTTCAGGGTCATAAAACCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGTGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTC
-+
-3ABB?FAB?DAAGGGFBGGBB5AFFFGFHHGGGEGHHHFHHF3EGFHHHHEFHHGGHHHGH3EFHHHHHBDGHHE?ECHGHGHHHHHHFHHHGHHHHHHHGGHGGFHHHFHHGFFHHFEGFHHHHHHEHHFDAGHHHH/BDDFGGH1FDBGHHHHHHHCGHHHFH?0CGCF>CC=@--AFBFFB?=BFDFFF//FDB;-9A-AD-.A.A=?-9-:B/AEB/BFF.A;DDFFFBBFFFF/BBFFFFBFF9B;
-@M01368:8:000000000-A3GHV:1:1111:13195:14562/1
-ATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGTTTTATGACCCTGAAGTAGGAACCAGATGTCGGATACCTGTCTCTTATACACATCTCCGAGCCCACGAGA
-+
-ABAAAFFFFFFFGGGGGGGGGGGHHGG4FDFGFGGCGGGHGHG?EGHEGFFDHFHHHHGGFE@EHHGEEEGFCCEFFGFG/EHHHHHBFBGGHFHFHEHGHEFGGGED/EFDEFFEHHBGHHCFFFDFGGHHGFFFHHHHGFG>0<0DGGFHBGHFBDFGHGFFGGAGHHGCGBHFFHHHFFFBFGGGGF/:FFFCB9F9FF0FEFE?FF0BED-D.//BF9//BBFF/BFFFEFFFFED-DCFF?.:BFA
-@M01368:8:000000000-A3GHV:1:1111:14287:20817/1
-GCCAACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATCCTATTATTCATCGCACCTACGTTCACTATTACAGGCGAACATACTTATTAAAGTGTGTTAATTAAT
-+
->>A3>AAAACFFFGFGFGGGGGHGHHHHHHHGGGGGHGHFFCGHHGBGHFHHHHAGHHHHEHHAGFFEHEAE?GHHHHEGFFFDGHGHBFFHFHHHGHGHGHBECG@@@EHGGEGCGGGGFFGGGG?BGGGGGG.-C.FEDCFFFEFFFAF/99BEFA.:9BFB/9FFFEFFFFFFEFFF/FBBFFFFFFFFFFFB//;.@@//;DFFFF//BBFFFBF;A;DF=>B//;9B//B/;/;9//9//;B/:B9
-@M01368:8:000000000-A3GHV:1:1111:23624:14516/1
-GTCCTACAAGCATTAATTAATTAACACACTTTAGTAAGTATGTTCGCCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGGGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAG
-+
-3>3AAFFFFFAFGGGGGGGGBGHHHHHHGGHGGHEHGHADFHHHHEGGGHBGHFFHHEHHGHFHGG5FBEEGEGHHHGHHHEFDGHHFFGFGGHHGHHHGHBHGHFHFHHGGGGFCFBGFGE?GFBECEGDGHEHGDGCGHGC/DF@GHGFFCGGGGFFFFDD?@C@GFEC?-ADHFFHBGHFBHFG0CC//.;B0/CA.;AA.;@.AB/9BB/A/.AFFFE/BFFF///9B/FBDE9/;99/B/BFFEF/
-@M01368:8:000000000-A3GHV:1:1111:7437:24508/1
-ACACACTTTAGTAAGTATGTTCGCCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTGTCTCTTATACACATCTCCGAGCCCACGAG
-+
-CBCCDCFFFFFFGGGGGGGGGGGGGGHHHHHHHHHHHHHHHHGGGFFEHGGHHHHHHHHHHHGHHGGGGGHHHHHHFHHHHGHHHHGHGGGGGHHHHHGGHHHGGGGGGHHHGGGGHHGGGGHHHHHHGGGGGGHGHHGGGGGGGHGGGGGCGHHHHGHHGHHHHHHHEDHHGHGGGGGD;BEGGGFFGGGGC:CFGGGGGGGGGFGGGFFFGFFFFF;FFF;BFFFFFFFFFFFB:FFFFD=CAEEEF>-
-@M01368:8:000000000-A3GHV:1:1111:8665:25542/1
-TCCTACTTCAGGGTCATAAAACCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTGTCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATCCTATTATTTATCGCACCTACGTTCAATATTACAGGCG
-+
-AA3AAFFFFFFFGGGFGFFGGGGHGH4AGGGFHHCGEE2FGHHHHHHHHHHGFHGF53FHEGGFAF5CFHHGGFGHFHHGGHHHCHHHHHHHFHHGH?EEEG1FFFEHHFHFGGHHGG?F4FBGHGHCHEF0//-9--;0CFGG?@BGDGFFFFEFBBBDA?FFBFFFF=B;-9.AA9EFFFF/;9BD.//;9/9/B:/:BFBFFBFFF/B:BFF//;/B/FFFBFF.A-BFFFBA/F//BFFFBF/;/A-
-@M01368:8:000000000-A3GHV:1:1111:9655:13916/1
-GGCCCATAACACTTGGGGGTAGCTAAAGTGAACTGTATCCGACATCTGGTTCCTACTTCAGGGTCATAAAACCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGCGGTGTCCACGCAATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGA
-+
-1>>1AAFFFFFBGGFE1EEEEGGHGHHH2FGHHHFGFGHGCFGGGEFHGGEGGHHHHGHEFBFEGHHHGHHBEHHHHGHGFHHHGGGGHHEGGGGHHHGFHGHHHH1FHHG?G/AGF1GBFGEFFHF2FDD0FG<GDHBFDGFFCGH//B//?0GFFGFGGHHHFHFB.=1FDFB?FGH.C/.-:::CH0;CAB@-.;0CGFFFGG--9.A@GB>--99@=---AAABA-BF/B?A@F-9BBFF//BB/9/
-@M01368:8:000000000-A3GHV:1:1112:10272:7828/1
-GTATCCGACATCTGGTTCCTACTTCAGGGTCATAAAACCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCTGTCTCTTATACACATCTCCGAGCCCACGAGACTAAGGCGAATCTCGTATGCCGTCTT
-+
-AAABABBBBBBFGGGGGGGGGGHGHHGHGHHHHHHHHHGHHHGGHDGHHHGGGGHHHHHHHHHHHHHHHFHGHHHHGGHGGHHHFHHHHHCGHFFHHHHHHHHHHHHHGHGEFGAEEEEHHGHHGHGHHHHHHHGHHHHHHGHGHFFBC/BA?BGGGFFFFFFFFFFFFFFFC-@DDFFFFFFFEFAFFFFFFBFBFFFFFFFFFFFFFFFFBFF->@FFFFFFFFFFBFBFAD--.99;A?////:.9A.
-@M01368:8:000000000-A3GHV:1:1112:9832:16531/1
-CTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGGGCTGTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGTTTTATGACCTTGAAGTAGGAACC
-+
-AABABFFFFFFFF4GGGGEBGEFGHGGHGHGHHHGGHFBGFGGGGGHHEFHGEHFHFHEHHHHHGCGGGHFHHCFGHE@1EEEFFGB?EEEEHBGGGCHHGHHBEE@>EAHHFAEBDGGGCEFF?CEGFFHHHHHFHHHFHGHCGCAHHF<..C.D=0CD.GFHHHG.CAGHC:CHB0GGGFFB0:CFA.A-;9.;000CBBFFBFGA.9AA;A;EDDE.ABBFFFF9;BEFFF/BF//9/B//9:B//..
-@M01368:8:000000000-A3GHV:1:1112:9832:6701/1
-CGCCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGTTTTATGACCCTGAAGTAGGA
-+
-AABBBBFFFFFFGGGFGGGGGGHHHGGHGGHHHHHHHHHHHGHHGGGGGHHHHHHHHHHHHHHHHHHGGCGDHHHHFGGHHHGGGGGFGGHGGGGHHGGGGHHHHHHGGGGGGHHGGGGDGGFGHGGFCDCHHHHGHHHHGHHFAGFGGEHFGEG.C<EGCECEFCFFHBGHE:GHHGFF0FFFB0CFGGGGAGFFF0;;FFGGGFFGFFCDD.DEFBEDD?9FFFFFFFFFFFFFFF/B./FB///;BF/
-@M01368:8:000000000-A3GHV:1:1113:13532:8618/1
-GGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGTTTTATGACCCTGAAGTAGGAACCAGATGTCGGCTACAGTTCACTTTAGCTACCTCCAAGTGTTATG
-+
-AA?AAFFFFFFFGGGGGFBFGGGGGGH5GHFEDHHGGGGCGFBGH?AEEHFFEEGHGHHHHGGG?0EHGHHGGGGGC?GEE/EE?GHHHGBHFHHHHHHGHHGHHHGGGCG/A@<FGGHHHHHHHFF/GFDGHHHHHHGFFFGHGGHABGHFHHHHHFHEGDGHGDDEEHHBEDDEGFGHGBFFBFFEGGGEFGFGFB000;F0F;FGGEGGEFFF;-.9//B///B9FFFFF/BFFB/:.BB//;FBFFF
-@M01368:8:000000000-A3GHV:1:1113:21679:18011/1
-GATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGAGGGTGTGCACGCGATAGCATTGCGAGACGCTTGAGCCGGAGCACCCTATGTCGCAGTATATGTCTTTGATTCCTGCCTCTTCCTATTATTTATCGCACCTACGTTCAATATTACAGGCGAACATACTTACTAACTGTCTCTTATACACATATCCACGCCCACGAGACTAAGGCGAAGTTCATT
-+
-AA>1>11F1D1DDFFFFGGG1FH3GHGHGHGHFHEC?EC0B1FBGFB1GHHH21AF2HH2FEGEHAE10AAE/>/FFHE?/E/?E1@EFFH?E@/EGGG//B11B//<@@C0F/<0<FFDGGCC?FF221<BDD11@<11@DDCGEF1<111F1<F1FBGHGHCF-CHHFA./</0CGHF<0CC/;C-:-;;09;FFBFBBFFBC0FFFGGFC0009C00090/-:--9--;-;AFFE;/99-9--/;///
-@M01368:8:000000000-A3GHV:1:1113:25528:14016/1
-CCTACAAGCATTAATTAATTAACACACTTTAGTAAGTATGTTCGCCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGG
-+
->AAAAFFFBFFFGGGGGGGGGGHHFHGHHHHGHHHHHHHHHHHGGGGHHHHFHHHHFHGHHHHGAFFEFHEGHHHHHHHHGHEHHGGFGGGHHHHHHFHHHHHGGHHHHGGGGGHFHHFF?HHGGFECEFFGHFFGFHGECDGHGBGFHGDF@@?CGFHCEGGGFD.CCC?EGHBHHHFHHFBCFFGEB/CEGGGGDAA.90C9CEBFGGBBF/9.9FBFFFBBFF//99FFFFEABF//99FFEFFFBFF
-@M01368:8:000000000-A3GHV:1:1113:5741:16959/1
-TAGTAAGTATGTTCGCCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGTTTTATGA
-+
-ABBBBFFFFFFFGGGFGGGGGGHHHGHHGGHBGHGAGFFCAFGHGFFGHHGFHHHHHGGGGGHGHHHHHHHHE3BFFHHHGG0EDF@GHFFGGGHGGGGGGGGGGGGGHHGGEEFHGFHHDDG@DGGGHHGDGGGGGHGG?CF?HHGHHHGHGHHHFFHGGGHHHHGGCD.;0<C;CGGGGEFF/.;0;FFFBF/0;0CFGFFB..9B/;0CBFFBBFFFFBAC?DED9;B9AD;.FFFB/B/;FBA/B//
-@M01368:8:000000000-A3GHV:1:1114:10130:11959/1
-CGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTCTGATCTGTCTCTTATACACATCTCCGAGCCCACGAGACTAAGGCGAATCTCGTATGCCGTCTTCTGCTTGCAACAAACACACATCCAGA
-+
->A33>FFFFFF@FFFGGGGFGGD4EGGGGGHHGFFGHFGGHHHFEFHECFHHHEHGAGBCCGCCEGGHGHEGFBFHFHHHHGGGHFHGHEGGGFEGEGG??@DBGHGGC-@FFGHFHFHB-??DA-DD@9:BEBG@B?E?A.ABBFBFA??F.FF/BFFB/B9B/9;BF9FF9FFFFFFFFFFFFFF?BB?;9EE;-;DDB9//;B-B@;ABFFEFFFF/-.9A.;//9/BF./B/..9.9:...//////
-@M01368:8:000000000-A3GHV:1:1114:14540:5315/1
-CTTTAGTAAGTATGTTCGCCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGGGGAACGTGGGGGCTATTTAGGTTTTT
-+
-AABCCFFFFFFFGGGGGGGGGGHHHHHHHFHHHHGHHGHHGGGHGGHHHHHHHGHHHHHHGGGGGHHFHHHFGHHGGFHHHHHGGGGGHHHGHGGHHHGGGGGGHGHGGGGHHGGGGHHHHHEGDDFGFFFHHGGGGGCDAFCFGFDHHHHGGHGHHHHHHBCGEHHHHGGHG.ACGEHGG0CBFFF:A;BB0;09CGF00CFFFE0AA?//CFFFFFFFFFFFFFFFBEF;A.-=A--:BBFB90;;FE.
-@M01368:8:000000000-A3GHV:1:1114:15066:16302/1
-TAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATCCTATTATTTATCGCACCTACGTTCAATATTACAGGCGAACATACTTACTAACGGTTGTTAATTAATTATTGCTTGTAGGACA
-+
-BBBBAFFBDFBFBGGGGGFGGGBGFFFHGFHHGFFFHGHHHGHHHHFFHHHGHGC?AEFFHEFBFFFGHHHHH1FDGFFHGHGHFEGCGC-<<AHHHGGGGGGGFHH0GHFCCCADGGG?.9/A-???DGGFFF.9F9/EE-;;BBBFFBFFFFFFFFFEFFFFBFFBBFFFFF/BFFBFFFFF-DBFFF;/BFF//BB//9/BEA---9:BFFFFFF/F/.;.:@9.BBFF/;BFF/;/////9/////.
-@M01368:8:000000000-A3GHV:1:1114:16639:15258/1
-CCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGCGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATCCTATTATTTATCGCACCTACGTCCAATATTACAGGCGAACATACTTACTAAATTGTGT
-+
-11>>ABFFFFFFGGCGC1BBF1GHHHBHHHHGFHGH1A100AA/GGEHGFBAA1FFD2FHHHHECG2F1BB/E0FC/A>EE/FGGFGEF1EGBBEHHCGGGHBGEHFHE0B?E--;C?CCGGG@A@GBFBBBB09?@??A-AB--ABE@=-=-9AE9A;FFFFFE=9-//;//;9FF/////;;///9B///;/B////9FFBB;--A@-;/9;9-:-/;;FFFE9BF?@;-9-99/B9F/://///99/;
-@M01368:8:000000000-A3GHV:1:1114:2404:13066/1
-TCCTACAAGCATTAATTAATTAACACACTTTAGTAAGTATGTTCGCCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCTGTCTATTATACACATC
-+
-CCCCCFFFFCFFGGGGGGGGGGHHHHHGHHHHHHHHHFFHHHHHGGGGHHHHHHHHFHHHHHHFGGHHGGHGGHHHHHHGHHFHHHHGGGGGGHHHHHHGHHHHHHHHHHGGGGGGGHH?FGHHHGGGGGGHHGGFGGHHGGGGHHHHHFGGGGFGHGHHGGGGGGGHGGGEGGHHGHHHHHHHHHGFBFFDA0FGGGFFGG0:EFGGGGGGGG;AEBF0B0BFFBFFFFFFFFFFFFFFFFFFFFFEFF0
-@M01368:8:000000000-A3GHV:1:1114:9184:6959/1
-GGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGTTTTATGACCCTGAAGTAGGAACCAGATGTCGGATACAGTTCACTTTCTGTCTCTTA
-+
-AABBBFFFCCCBFGGGGGGGGGHHHHHHHHGGGGGGHHHG3FFHHHFGFGGGHHHGGGEHHGGGGHHHHHHGGGGGGHGHGGGGGGGDEGGGGEGGFHHHHHHHHHHHHGGGFGEHHGGFDGGGDFFGFHHHHGFCFHHHHHEFHFHGGFFGHHGGGHHHHDGHHHFHHHFFFFGFGGG.EFGGGGFGEBFGGGFGFGGGGFFBFGGBBFFFFFB/FEFF?///;A::AABBFFFBFFFFFFFFFBFFFF/
--- a/test-data/canu_contigs_result1.fa	Fri Jun 08 04:43:41 2018 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,155 +0,0 @@
->tig00000001 len=15307 reads=47 covStat=-31.76 gappedBases=no class=contig suggestRepeat=no suggestCircular=no
-AAAATAGTCAATAGTAGGATGCCTGACAATTTATGCTCTACTTTCCAGGCTTATCTGTAATCGGGAATAATAGAAATATGTTCCATCAATTTTTAAGTTC
-CATTTGTTCACCTTATTTATGTAAGGAGTATTTGATCATGTATAAGCTATGAAAAACAGCTTTAGGTAATAAGAATATCTCAATTTTTAAACATAAAATG
-CGAATTATTTAGTACAAAAAGGCGTTACGTGATCTTTCCTGGGATACAACTCTGGCAATGGTATCGTGAACAGGAATACCATTTTCAAAATCACCATATT
-GCTTCAAAAAATCGAGATGTGTTTCCCCGAAATCCTCTATATCTTCCCAACCTTCTGCACCAGAAATAACGGCACAAATAGTCAAACAGTAGAATATCTG
-ACAATTTATGCACCACTTTCAGGCTTGTCTGTAATCGGGTGTAATAGAAATATGTTCCATCAATTTTTTAAGTTCCATTTGTTCACCTTATTTATGTAAG
-GGTATTTGATCATGTATAAGCTATGAAAAAACAGCTTTAGACAATAAGTAGTATCTCAATTGTTGAACTTAAATTCGAATTATTTAGTACAAAAAGTAGC
-GTTACGTGATCTTTCCTGCAAATGGAACGCAAAATAAACACCTATTCCATGAGTTATATAATTTTTCACAATGATTAATTTGTTTTCTCAGGAAGAGATT
-TTATTTCTCTTCACTACGAATTAGTTCATGCTGTATCTTTATTAAACATTCGTAAGACTCATTTTTGTTCGGGAGATGTGCTGTCATTCGAGCATAAGTT
-GGTTTCTCATCTTTAAAATATTTTACCATGATTGAATTATCAAGGACTGCCAACAACTGAACTGGATCACTGCTCTTTTGATAGATACCCGCTCTTATAT
-AACTTCTAAACCGATCGCCGAGAAACGCCGTTTTTCTGCTGTATTTATCAACTCCTGCAACGTTCCTTTGATGGCATGATTTTCATTAAGGCGTAGTGAC
-CCGACGCGAATTAAGAGTCTCGCCCCGCTTGGTGTGAATTTATTATTTTTACATGTACCCAGTTCTGTTTGCCAATAATACTCACCGATGTCCTCATTCT
-GATACCATCTCACATGGCTTTATTATTTAAGACAGGAAACGCGGAAAAATAGTACCCTTAGCGAAAATAGTAAAACAATCATGATCTTTAGCTTGTATTT
-CGCAATCAGCTATAACACCAAAACTAACAAATATCATCAGCAAAAAGAACAAAACTCTTTTCATTTTCTTATTCCTCTCGATGTTCTCTGTTTCATCTTA
-GCTAAAATTTCACCCAAATCATCTATCCCTGCTGTTGCTGGCCCATCGGGTTTATTAATGTCTGGGAATAAATAGGGTTCTGCACAAGTATATCCTGGTG
-GTAATTGAGTTGTTGGCCAATTTGTCTGTGGCAGGTAATCACTTGCTGTCTTTGTATCCATCCCTGGATACTGGGAATCATCCTGTGGCGTACAAGTCAG
-ATTTGGTTTTACCCACTTCCTGCAATACAGTGTGTAGTCGTAGGGCTTAATGCTCTGAAGAATGTTTTGAAAACATTAGGCGCACTACTGGCCTGGTCAA
-TAGGATATGGCAGTCTTAATTGTTTCGCTATGTCCGGCAATTTACTTGGATCGGGCGTAGGCGGTTTGTTGGTCTCGCTCCATATCCGCCATTATTTAAG
-TGTCCATATTTTGATGCCAGTCCCATTGAATCTATATACTGAACCGGATTCAGCGGATACTGATAAAATTCCATCCCCCTTCAGCCCAATCGGATCCTGA
-GTGATATACCTCCCTGCAGCGGGTCATAATAGCGGTGGCGGTTGTAATACAGGCCGGACTCCTCATCATACTGCTGCCCCGGCAGGCGGATAAGCTGCTG
-CAGCTGATGCGGGTTCTCTTCATTCAGCAGGTTGCCCCATTCATCGTATTCTGCGCACCATTCTGTTGCCCCTTCCGTGCTGACAAGCGCCAGCGGCAGG
-CCGCGATGGTCGCAGTGGTACAGGTGGATTTTCGCGCCGGCGTGTACACCGGGTCCATCTGGTTTTGCATCTGCTCCACCGTCAGGCCGCACGATGCCAG
-CCAGCGGCGGCTTTCCTCACTCACCCGGTCAGCCAGGATTTCACTTTCCAGCCGGTCGAGCATCTGCACCAGCACCGGCGGAACACCACACTGCCACCGT
-CTTCGCCGCCGGACTGCTGAAGGGTATCCGCCAGGCTGCGGCGCTGCGTTCGCCAGCTCACCGGTGGCGGTTTCAACCTGATGAGTGGCGTGAAGCTCCC
-CGGCTGATAAATCGTCTGGATGCGGGTTCTGTCGTTCTGTATCGTGGTCAGGCGGTCGCCGTCCCAGCCGTACCAGGTCACTTGCGGTTTCCGTGACAGC
-GACATCCAGCCCGTCAGGTCCCGTTCACGTCGCCACACCCGTTTTGCCACCCTGCGGCCCAGCGGGTCGTAAAGATAGCGGCTTTCGACCAGCGGCTCTG
-CATATTGTGTCCGCGTGTAGTGCACCAGCCGGTGCTGACTGTCGTAATGGTACCGGTGGGTGCGCTCATCATCCGTGCGGATAACCCTTCCGGGATGAGG
-TCGGTTTTCTCCGTCAGCCTGCCGTGACGGTCATACCGGTAAAGATAGTGCGCGTCACGGGCGATACGGTTATCCGGCCACATGCTGAGGGTGCTGTCCG
-GTGCAGCTCCGGTCGGGCAGGCGGTTACCTGCCGGGTCTGTGGCATACGGGATATCAATGCCCAGGTTACATATAATAATAAGAGCAATTAACTTAATTT
-ATTTGTTTATAATGCGCTTACTTAATACAAACCATTGAATATACCCTCCTGACAGAAAATAAAGCCATATTATTATCGCCATAATATACTTACTATCAAT
-CCTTACGCCAATAATGTCTGATACAGTCCCTATAAATATTAGAGCAATAAAGAATACTATGCCTGTTGGAAAACATATTACCATCATTCCATAAGACATG
-AGACTAATTAACTCGCTCACATCACGAGTGGAGTCTAATAGTGAAAGTCTATGCATGGAAAAGAATAGTATTAAAAGCGATAAAGCCAGCCATATAGCTC
-TGAATAAAAAATAATATATTTCATTACATCACTCCGGTGAATACAAATCTAATAAAACGTCCAATGTTATTTCCGGAGCACTTCATCTTACATGTTTCTA
-AAGAATCATTAGACCAGTCTTGGCAGTTTTAAATAGCCCTAAATTTATAGGTGTGAATATATCAGGCAATACAGAATAACGCGGCCTTACCTCTTTAAAC
-TTCCTTTTAAACAGTTCTCCACACAACTATTATCGGTTTCAACGAGGTCACAACGGCCAGCAGCTTCTTTGTATCATTACTTGCTTTACCTGGCCCCCAT
-AGACCATCTCCTTTGATTCTCCCCGTTGGTCTTGGCCACCACAAGTATAGTCCCTTTACCATCTGGGACACAAAGATATTGATGATAGAACGGATTCCCC
-ATATATCTGGACCGCTTCTTTCACCAGTTCCGCCCATTGAATGCAGTGGCTTAATGCATTTTAGTGTTTCTAATCCTAATGGATCTATATTTGAGATCGG
-ATTCAACGGATACTGATAAAATTCCATCCCCTTTCAGCCCAATCGGATCCTGAGTGATATATCGCCCCTGCAGCGGGTCATAATAGCGGTGGCGGTTGTA
-ATACAGGCCGGACTCCTCATCATACTGCTGCCCCGGCAGGCGGATAAGCTGCTGCAGCTGATGCGGGTTCTCTTCATTCAGCAGGTTACCCCATTCATCG
-TATTCTGCGTACCACGCTGTTGTCCCTTCCGTGCTGATATGGGCCAGCGGCAGGCCGCGATGGTCGCAGTGGTACAGGTGAATTTTTCGCGCCGGCGTGT
-ATACCGGGTCCATCTGGCTTTGCATCTGCGCCACCGTCAGGCCGCACGATGCCAGCCAGCGGCGGCTTTCCTCACTCACCCGGTCAGCCAGGATTTCACT
-TTCCAGCCGGTCGAGCATCTGCACCAGCACCGGCGGGAACACCACACTGCCACCGTCTTCGCCACCGGACTGCTGAAGGGTATCCGCCAGGCTGCGGCGC
-TGCGTTTTCGCCAGCTCACCGGTGGCGGTTTCAACCCTGATGAGTGGCGTGAAGCTCCCCGGCTGATAAATCGTCTGGATGCGGGTTCTGTCGTTCTGTA
-TCGTGGTCAGGCGGTCGCCGTCCCAGCCGTACCAGGTCACTTGCGGTTTCCGTGACAGCGACATCCAGCCCGTCAGGTCCCGTTCACGCCGCCATACCCG
-TTTTGCCACCCTGCGGCCCAGCGGGTCGTAAAGATAGCGACTTTCGACCAGCGGCTCTGCATATTGTGTCCGCGTGTAGTGCACCAGCCGGTGCTGACTG
-TCGTAATGGTACCGGTGGGTGCGCTCATCATCCGTGCGGATAACCCTTCCGGGATGAGGTCGGTTTTCTGTCAGCCTGCCGTGACGGTCATACCGGTAAA
-GATAGTGCGCGTCACGGGCGATACGGTTATCCGGCCACATGCTGAGGGCGCTGTCCGGGTGCAGCTCCGGTCGGGCAGGCGGTTACCTGCCGGGTCTGTG
-GTATACGGGATGCGGATATCCAGATTCGCTGCGGTGGTGTGAACGCCGGTCAGCCTGCCGGTGGTGCTGTAGCTGTAACTCCGGGTCTGGCGCGGGCTGC
-TGATGCGGATGAGTTCGCCGTTGTCGTTCCAGGTGTAATCGCGGTCAGACAGCAGGCTGTTCAGGTGCTGGCTCTGTAACTGCCCGGCAGGGGTATAAGC
-GGTGGTGAGTTCATAACGGCCGAAGCTGCGCAGCGTTTCCCGGTGCAGGCGGTCGCGGGTGTACTCCACCAGCGGTGTGTCGCCGAGTTTCATGCCTGAC
-AGCCAGCCGCTGCCGTAGGTCAGCCATTCCACGGCGGGCAGGCTGTCCGGTATACAGCGGTTCGCCAGTCCCTGTGCGTTGTACGCATGTCTGGTCTCAT
-GCTGCCAGAGCAGTTCATTCGTCTGCGGATGATGCACCGTCAGGTGTTCACTGGCGAGGCGGCCTTTACTGTCATAACCATAGTGCACCGTCACCCGGTG
-CCCTTCGCTGATATGGCTGATGTCTGTCAGCCAGCCGCGTTCGTCATACTGCCACCGCTCTGCGGTTTCGCCATTCACGGTGCGGTGCGTGAGGCGGTCT
-GCTTCGTCATAGTGCCAGTGGGTGACCAGCCCTCATCCTCGCTGCGGATAAGTTTGCCGGTCAGGTCGTGGTGATAACGCTGTGTGCGGCCGTCAAAGCC
-GGTTTCCTGTATCAGCCGGTCGAGTACATCGTAACGGAAGGTGGTGTGGCTGCCGTTTTCACTGGTCAGGCGGATGACCCGTCCGGCAGCATCGTATTCC
-ATACTGCGCGTCAGACCGCCCTGCGTGGTACAGATGGCTTTTCCCCACGCATCGTACTGTGTCCCGTTTCTGCTGCCGTCCGGGGCAATGACGGTGGTCA
-GGTCACCGGCGGCGTTGTATTCATACCGCGTTTCATGGCCCTGCGTGTCTTTCACGGCAATTAACTGTCCACGGCTGTCGTATGCGCGGTACTGACTCAG
-CCCTTCCTCGCGGTGCACCGCCGTCACCTGACCAAAACGGTCATGGTCATAGCGGGTTACATAACCGGAACAGTCAGTGAAGCTCAGCAACTGACCGTAA
-CGGCTCCACGTCATGGTTTTCCGGCTGCCGGTGGCATCTTCCGTTGCGCAGGGTAAGTCACTGTGTGGATTATCATAACGGTAGCGGGTGATATCGCCGT
-CAGGGGCAGTTTCCTGAATCAGACGGCCCCATTCATCATATTCCCGGCGTATTTCCAGCCCGTCAGGCCCGGTGGCTGACGTTAACTGGCTGTGGTGGTT
-ATAGTAAAACGCCGATGCCCTGCCATCCGGCGTGGTGATGCGCGTGATGAGGCCCGTCACCACATCCGGACTGTATTCTGTTGTCCTGCCTGCGGCATCC
-GTCTGTGCCCTGAGCCTGCCCACCGCGTCAAACTGACTCTGCGTGACGCTGCCGTCCGCGTGTTCCTTTTCACCACCCGCTTCAGCCCGCCTTCACCCTG
-CGTGTGCAGGACTTCACGGCGGTTCAGGCTGTCGGTGATGGTGATGCGGTCCTTCTCATACTGATACGTGTAACTTAAGCCTGCCGGGTTTAGCTGTTCT
-GTCACCCGCCCGTCGCTGTCGTAACGGTAACAGATTTCCGGTCGGCCCGTGTGACGGTGCGCCACCATCCGGCCCCGGTATTTATCATCGTAAGTAAAGC
-TGCGCACCTGTGTATTGCTGCGGTCATACACCGCCGCCAGTTCGCCGCGGGCGTCCAGCCATAGCGCACCAGCGGCGCGGCAGGTAAATTCTCCGGGTAT
-TCCGGGTCGTGCGTCAGCCACACGGCAGACAGACGGATGCCGTTGTCCCGGCCATATTCGGTGTAACCCGGCAGGGTATCAGGAAAAGCGGACGGTTCCG
-TCCCGCCGGAAATGGCCTGCTGCCGGGCTTCTTCTGCCCGCTGCGCCTGCGTGGTCAGTACCAGCCGGAAGTGACGCCCGGCACCATCCGTCACGCCGGT
-GATTTCGCCGCTGAATTCACCGGCGGCTTCGCGGTGGAACGTCTGTGTGCGCCCGAAGCGGTCCACCAGCCCGGTCAGTACCCGGTACGGCGGCAGCGGC
-GCAGGCAGCACCTCATCCGCTTCCGGCACCCGCTCACACCAGCCGAGCAGCCACCACGGCCCCTGCGGACTGTTTGTCGCCAGATAACGATGCGGACTTA
-AGCGGAGTTCTTCCGGCAGCGCCTGCCAGAGTGCGGCCAGCCGGTGACCTTCATCCAGTTTCGCCACGCCGCCGCGCACCAGCCACAGTGACTCGCTGCG
-GCTGTAACCGTCCTCACCGGGAAACAGGTGCTCAAAATACAGGCTTCTGCCGCCGTTATCACTGAGTATCAGTGTGTTATCGCGCAGCTGTAAGCGGATA
-TCCGCAGGCATTTTCCAGCCGGGGCCGAGGCTCCCCACCGGCGCGGGCGTTTTGTCCGGTAACTGCTGTAGGTGCGGGAGAGAATGAACGGCAGCGGGCC
-GGGCAGGGCGATGTCGGTTTCACCGGGAAGGACCTTTGCACCGAGCAGCGGATTGACCGGATGGCCGGACGTCACCCGCCGGGGCACACCGAACAGGCCA
-CGCCGGTGGGGCACCGATGCGTACCCCGGCTGAACCCTGGACAATGCTACCGCCATACTGCGTCATGTCGCCCTGACGCGCCGCCGGTTTTCCGCTCATC
-TGCTCATCCTTGTTTTATCGGGTTATTTGTCTGCTGACAGGCGAAACCCTACAGATTTATAAGAAAGCCTTAAGTGAGATATCTGTCAGATAAGAACAAT
-TAGGAAAATATTTATATATATTTCATGAATATATGTTTCGATTGGTATAACGATGTCTAAATATTCCTCTGAACATCTTCCTGATACAAAAACCGCCAGC
-GTTTCCGCTGGCGGTTTTCAATGTATTCAAAACTCAGCAATCAATAAAATCACCAGTTGCCTTTTCGGCCTGATCCATCCACACCGGTTTATCGCTGGTT
-TTCGACCAGACGCGATGCAGGTAGCTGTAAAAGCGGGCGCGGTCTTTCCAGAAAAGCATGAAAGGCAGCGCCAGAACGCCCGCTGCAACCGCATAAGTAC
-GGCGTAAAAAGATAAGCCATGCAGGATATTCTCTGTAGAGTTCCATACTTTTCTCCCCTTTTGTATCTACCCGGTGAATGGCACCGGAAAAATGAATTTG
-TTTATCTGATGAAAATAGTACCGCCTTTGTGTAATTTTACTACTCATCCGACCACTTATTTTTGCTTATTGATGGTTTATTTACATTCATCCTGTAATTA
-AGTTACACAAAAGTTAAATTAATACTAAACATTAGTTAAATCATGGCTTTTGCCATTTTTATACTTTTACACCCCGCCCGCAGATTTTTGCGAAATCTTT
-GCAGCCAGAATTCTACCCTTCCGGTATCACTTTTAGGCCACTGGAGGTGCACTGTGAGTGCAGGCGTGATAACCGGCGTATTGCTGGTGTTTTATTACTG
-GGTTATCTGGTTTATGCCCTGATCAATGCGGAGGCGTTCTGATGGCTGCGCAAGGGTTCTTACTGATCGCCACGTTTTTACTGGTGTTAATGGTGCTGGC
-GCGTCCTTTAGGCAGCGGGCTGGCGCGGCTGATTAATGACATTCCTCTTCCCGGTACAACGGGCGTTGAGCGCGTACTTTTCGCGCACTTGGCGTCTCTG
-ACCGTGAGATGAACTGGAAGCAATATCTTTGTGCCATTCTCGGCCTGAACATGCTGGGGCTGGCGGTGCTGTTTTTATGTTGCTCGGTCAGCACTATCTG
-CCGCTTAATCCACAGCAGTTGCCAGGGCTGTCGTGGGATCTGGCGCTGAATACCGCCGTCAGCTTTGTCACCAATACCAACTGGCAATCTTATAGCGGTG
-AAACCACGTTGAGCTATTTCAGCCAGATGGCGGGCTTAACGGTGCAAAACTTTCTTTCTGCCGCCAGCGGGATTGCGGTGATTTTGCCCTCATCCGTGCG
-TTTACCCGCCAGAGCATGAGCACGCTCGGGAATGCCTGGGTCGATCTGCTACGCATCACGTTATGGGTGCTAGTCCCTGTGGCGTTGTTGATTGCACTGT
-TTTTATTCAACAAGGTGCGCTGCAAAACTTTCTGCCTTATCAGGCTGTGAATACCGTTGAAGGAGCGCAACAGCTGTTACCCATGGGGCCTGTAGCTTCT
-CAGGAAGCGATCAAGATGCTCGGTACTAACGGCGGTGGCTTCTTTAATGCCAACTCGTCGCATCCGTTTGAAAACCCAACCGCACTGACCAACTTCGTGC
-AGATGCTGGCGATCTTCTTGATCCCAACGGCGCTGTGCTTTGCCTTTGGTGAAGTGATGGGCGATCGCCGCCAGGGGCGCATGTTGCTGTGGGCGATGTC
-AGTGATTTTGTCATCTGCGTAGGCGTGGTGATGTGGGCAGAAGTTCAGGGTAATCCTCATCTGCTGGCACTGGGCACGGACAGCAGCATCAATATGGAAG
-GTAAAGAGAGCCGTTTCGGCGTGCTGGTCAGTAGCCTGTTTGCGGTCGTGACGACGGCGGCTTCCTGTGGCGCGGTGATTGCGATGCATGATTCGTTTAC
-CGCTCTCGGTGGCATGGTGCCGATGTGGCTGATGCAAATTGGTGAAGTGGTGTTCGGCGGTGTCGGTTCTGGTCTTTACGGCATGATGCTGTTTGTCCTG
-CTGGCGGTGTTTATTGCCGGGCTGATGATTGGTCGTACACCGGAATATCTGGGTAAAAATCGACGTACGCGAGATGAAACTGACTGCACTGGCAATTCTG
-GTTACCCCGACGCTGGTGCTGATGGGCGCGGCGTTGGCGATGATGACCGACGCCGGACGTAGCGCCATGCTCAACCCTGGCCCGCATGGTTTTAGCGAAG
-TGCTGTACGCCGTGTCATCCGCCGCTAACAACAACGGCAGCGCCTTTGCCGGATTAAGCGCCAACTCTCCGTTCTGGAACTGTTTACTGGCGTTCTGCAT
-GTTTGTCGGTCGCTTCGGGGTGATTATCCCGGTGATGGCAATTGCCGGTTCGCTGGTGAGTAAAAGAGCCAAGCCGCCAGCTCCGGCACGCTGCCAACGC
-ACGGCCCGCTGTTTGTTGGCCTGTTAATCGGCACCGTGTTGCTGGTTGGCGCACTGACCTTTATCCCTGCCCTGGCGCTTGGTCCGGTGGCGGAATATCT
-CTCCTGATGATATTGAGTGAGCACTGAATATGAGTCGTAAACAACTGGCGCTATTCGAACCAACACTTGTCGTTCAGGCGCTGAAAGAAGCGGTGAAAAA
-ATTAAACCCGCAGGCGCAATGGCGCAATCCGGTGATGTTTATCGTCTGGATCGGCAGTCTGCTGACCACCTGTATTAGCATCGCGATGGCAAGCGGTGCG
-ATGCCCGGCAATGCGCTGTTTAGCGCGGCCATTAGCGGTTGGCTGTGGATCACCGTACTGTTCGCTAATTTCGCCGAGGCGCTGGCAGAAGGCCGCAGTA
-AAGCGCAGGCCAACAGTCTGAAAGGGTGAAAAACTGCCTTTGCCCGCAAGCTGCGTGAGCCGAAATATGGCGCTGCGGCGGACAAAGTTCCTGCCGACCA
-ACTTCGTAAAGGCGATATCGTACTGGTAGAAGCTGGCGATATTATCCCCTGCGATGGTGAAGTTATTGAAGGGGTGCATCGGTCGATGAAAGCGCCATCA
-CCGGGGAATCGGCACCGGTGATCCGTGAATCCGGCGGCGATTTTGCCTCCGTCACCGGCGGCACGCGTATTCTTTCTGACTGGCTGGTGATTGAGTGTAG
-CGTTAACCCCGGCGAGACATTTCTGGATCGGATGATCGCGATGGTGGAAGGCGCACAGCGACGCAAAACGCCGAACGAAATTGCCCTGACCATTCTGCTG
-ATTGCCCTGACTATCGTCTTTTACTGGCAACCGCCACGCTGTGGCCGTTTTCCGCGTGGGGCGGTAATGCAGTCAGCGTAACGGTACTGGTGGCGCTGCT
-GGTCTGTCTGATCCCAACCACTATTGGCGGCCTGTTGTCAGCGATCGGCGTCGCCGGGATGAGCCGGATGCTAGGCGCGAATGTGATTGCCACCAGCGGA
-CGTGCAGTTGAAGCGGCAGGTGACGTTGACGTTCTGCTACTGGATAAAACCGGCACCATCACACTCGGTAACCGTCAGGCGTCGGAGTTTATCCCCGCGC
-AGGGCGTGGATGAAAAACGCTGGCTGACGCCGCACAACTGGCTTCGCTGGCTGATGAAACGCCGGAAGGCCGCAGTATTGTGATCCTCGCCAAGCAGCGT
-TTTAACCTGCGCGAGCGCGATGTGCAGTCGCTCCATGCCACCTTTGTACCGTTTACTGCGCAAAGCCGGATGAGCGGGATCAACATCGACAACCGCATGA
-TCCGTAAAGGTTCTGTCGATGCCATTCGTCGCCATGTTGAGGCTAACGGTGGTCACTTCCCTACCGATGTTGATCAAAAGTCGATCAGGTTGCGCGTCAG
-GGAGCCACGCCGCTGGTGGTGGTGGAAGGTTCTCGTGTGCTGGGCGTTATTGCGCTGAAAGATATCGTCAAAGGCGGTATTAAAGAGCGCTTCGCCCAGC
-TGCGCAAAATGGGCATTAAAACGGTGATGATTACCGGCGATAACCGTCTGACTGCCGCCGCGATTGCTGCGGAAGCGGGTGTCGATGATTTTCTCGCCGA
-AGCGACACCGGAGGCCAAGCTGGCATTGATCCGTCAGTATCAGGCGGAAGGTCGTTTGGTAGCGATGACCGGCGACGGCACCAACGATGCTCCGGCGCTG
-GCGCAGGCAGATGTCGCGGTGGCGATGAACTCCGGCACCCAGGCGGCGAAAGAGGCGGGCAATATGGTCGATCTCGACTCTAACCCGACCAAGTTGATCG
-AGGTGGTGCACATTGGCAAACAGATGCTGATGACCCGTGGCTCGCTGACCACCTTCAGCATTGCCAACGATGTGGCGAAATACTTCGCCATTATTCCGGC
-GGCATTCGCGGCAACGTATCCGCAGTTAAATGCGCTGAACATCATGTGCCTGCATTCGCCCGACTCCGCAATCCTCAGTGCGGTGATTTTCAACGCCTTG
-ATTATCGTCTTTGATTCCCCTGGCGTTAAAGGCGTGAGTTATAAACCGCTTACCGCTTCTGCCATGTTGCGCCGTAACTTATGGATTTACGGTCTGGGTG
-GGCTGCTGGTGCCGTTTATCGGTATCAAAGTCATTGATTTACTGCTGACCGTTTGCGGTCTGGTGAGGTTTACCATGAGTGGATTACGTCCGGCATTATC
-AACATTTATCTTTCTGTTATTGATTACTGGCGGCGTTTACCCGCTGCTGACCACCGTACTGGGGCAATGGTGGTTTCCTGGCAGGCCAATGGTTCGTTGA
-TTCGTGAAGGTGATACGGTGCGCGGTTCGGCATTAATCGGGCAGAATTTTACCGGCAACGGCTATTTTCATGGTCGCCCGTCGGCAACGGCAGAAATGCC
-CTATAATCCACAGGCTTCTGGCGGGAGCAATCTGGCGGTCAGTAACCCTGAGCTGGATAAACTAATAGCCGCACGCGTTGCTGCATTACGGGCCGCTAAC
-CCGGATGCCAGCGCGAGCGTTCCGGTTGAACTGGTGACGGCATCGGCAAGCGGGCTGGACAATAATATCACCCGCAAGCGGCGGCCTGGCAAATCCCACG
-CGTGGCGAAAGCGCGTAATCTCAGCGTTGAACAGCTCACGCAACTGATCGCAAAATACAGCCAACAACCGCTGGTGAAATATATCGGCCAGCCGGTTGTC
-AACATTGTTGAACTCAATCTGGCGCTGGATAAACTTGATGAATAACGAACCCTTACGTCCCGACCCCGATCGTCTGCTGGAACAAACTGCCGCGCCGCAT
-CGGGGAAGCTGAAAGTTTTCGGTGCCTGTGCAGGCGTCGGGAAGACCTGGGCGATGCTGGCAGAAGCCCAGCGACTGCGGGCGCAAGGGCTGGATATTGT
-GGTTGGCGTGGTAGAAACCCACGGGCGAAAGATACCGCCGCCATGCTGGAAGGGCTGGCTGTTCTGCCGTTAAAACGCCAGGCGTACCGTGGGCGGCATA
-TCAGCGAGTTTGATCTCGATGCCGCCCTCGCCCGCCGCCCGGCGCTGATCTTAATGGACGAACTGGCGCACAGTAATGCGCCAGGTTCCCGTCATCCCAA
-ACGCTGGCAGGATATCGAAGAACTGCTGGAAGCTGGCATTGATGTTTTCACTACCGTCAACGTTCAGCATCTGGAAAGTCTGAATGATGTGGTCAGCGGC
-GTCACCGGAATTCAGGTACGGGAAACCGTGCCCGATCCTTTTCGATGCCGCCGACGACGTGGTGCTGGTGGACTTGCCCCGGACGATCTGCGCCAGCGGC
-TGAAAGAAGGCAAAGTCTATATTGCCGGGCAGGCGGAGCGCGCCATTGAACATTTTTCCGCAAAGGTAATCTGATCGCCCTGCGCGAACTGGCACTGCGC
-CGTACTGCCGATCGCGTTGATGAGCAAATGCGCGCCTGGCGGGGCATCCTGGCGAAGAGAAAGTGGCACACGCGCGACGCGATCCTTTTATGCATCGGCC
-ATAACACCGGCAGCGAAAACTGGTCCGCGCAGCGGCGCGGCTGGCGTCACGGCTGGGTAGCGTCTGGCACGCGGTGTATGTTGAAACCCCTGCCCTGCAC
-CGCTTACCGGAAAAACGTCGGGCAATTCTCAGCGCCTTACGTCTGGCGCAGGAACTGGGCGCGAGACGGCAACACTTTCTGATCCAGCGGAAGAGAAAGC
-GGTAGTGCGTTATGCCCGTGAACATAATCTCGGCAAGATTATTCTCGGTCGCCCGGCCTCGCGCCGCTGGTGGCGTCGGGAAACGTTTGCTGACCGACTG
-GCGCGCATCGCCCCGATCTCGATCAGGTGCTGGTCGCGCTTGATGAACCACCCGCCCGCACGATTAACAACGCGCCGGATAACCGCTCTTTTAAAGACAA
-GTGGCGTGTACAAATTCAGGGATGCGTGGTTGCCGCCGCGTTATGCGCCGTTATCACCTTAATTGCCATGCAGTGGCTGATGGCGTTTGATGCCGCCAAC
-CTGGTGATGCTGTATCTGCTTGGCGTGGTGGTGGTGGCGCTATTTTATGGACGCTGGCCTTCAGTGGTTGCCACCGTCATTAATGTAGTGAGTTTCGATC
-TCTTTTTATCGCCCCACGCGGCACGCTCGCCGTCTCTGATGTGCAATATCTGCTGACCTTCGCGGTGATGTTAACCGTCGGGCTGGTGATCGGGAACCTT
-ACTGCTGGCGTGCGTTATCAGGCGCGGGTAGCCCGTTACCGCGAGCAACGCACACACGGCACTTATATGAAATGTCGAAAGCTCTGGCGGTGGGCCGCAG
-TCCGCAGGATATCGCTGCCACCAGCGAACAATTTATTGCCTCCACGTTTCATGCCCGCAGTCAGGTGTTGTTGCCCGATGACAACGGTAAATTGCAGCCG
-TTAACACATCCGCAAGGAATGACGCCGTGGGACGATGCCATCGCGCAGTGGAGTTTTGATAAAGGCCTGCCTGCGGGCGCGGCACCGACACGTTACCCGG
-TGTACCGTACCAGATTTTGCCGCTAAAAAGCGGCGAGAAACCTACGGGCTGGTGGTGGTGGAGCTGGGAATCTGCGCCAGTTGATGATCCCGGAACAGCA
-GCGCCTGCTGGAGACGTTACGCTGTTAGTCGCCAATGCCCTGAGCGGCTGACGCTAACCGCCAGCGAAGAACAGGCGCGGATGGCAAGCGAACGTGAACA
-GATCCGCAACGCCTGCTGCTGGCGGCGCTTTCGCATGATTTACGCACGCCGCTTACGGTGCTGTTTGGTCAGGCAGAAATCTTAACGCTCGATCTGCAAG
-CGAAGATCACCACGCCCGCCAGGCCAGCGAGATCCGTCAGCATGTGCTGAACACTACCCGACTGGTGAATAATCTACTGGATATGGCGCGAATTCAGTCC
-GGCGGCTTTAATTTGAAGAAAGAGTGGTTAACGCTGGAAGAAGTAGTCGGCAGCGCGCTGCAAATGCTGGAACCGGGTTTATCGTCGCCCATCAATCTTT
-CTCTGCCAGAACCGCTGACCTTAATCCACGTTGACGGGCCACTTTTGAACGGGTGCTGATTAATCTGCTGGAGAACGCGGTGAAATATGCGGGTGCGCAG
-GCCGAAATTGGTATCGATGCCCACGTTGAGGGCGAAAATCTACAACTGGATGTCTGGGATAACGGCCCCGGTCTTCCGCCAGGCCAGGAGCAGACGATAT
-TTGATAAGTTTGTTCGCGGAATAAAAGAGCAGTACCGGGGGTAGGGCTTGGACTGGCAATTTGTCGGGCGATAGTGGATGGTACGGGGGCACTATTACCG
-CGTTCAACCGACCGGAAGGTGGTGCCTGTTTTCGTGTTACACTTCCCCAGCAAACTGCCCCTGAACTTGAAGAATTTCATGAGGATATGTGACAAACGTT
-CTGATTGTTGAAGATGAACAGGCTATTCGTCGCTTTCTGCGCACGGCGCTGGAGGGGCGATGCGCGTCTTTGAGGCCGAAACGCTGCAACGCGGCTTGCT
-GGAAGCGGCAACCCGTAAGCCAGATTTGATTATTCTCGATCTCGGCCTGCCCGATGGTGATGGGATTGAGTTTATCCGCGACCTGCGCCAGTGGAGCGCG
-GTGCCGG
--- a/test-data/canu_contigs_result2.fa	Fri Jun 08 04:43:41 2018 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,10 +0,0 @@
->tig00000001 len=370 reads=77 covStat=-52.68 gappedBases=no class=contig suggestRepeat=no suggestCircular=no
-GTTATTATTATGTCCTACAAGCATTAATTAATTAACACACTTTAGTAAGTATGTTCGCCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGC
-AGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGG
-AGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGTTTTATGACCCTGAA
-GTAGGAACCAGATGTCGGATACAGTTCACTTTAGCTACCCCCAAGTGTTATGGGCTAAGGCGAATCTCGT
->tig00000007 len=305 reads=6 covStat=-3.47 gappedBases=no class=contig suggestRepeat=no suggestCircular=no
-AACACACTTTAGTAAGTATGTTCGCCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTG
-CTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGA
-CCTGTGATCCATCGTGATGTCTTATTTAAGTCTCTTATACACATCTCCGAGCCCACGAGACTAAGGCGAATCTCGTATGCCGTCTTCTGCTTGAAAAAAA
-AAAAC
Binary file test-data/canu_corrected_reads.fa.gz has changed
--- a/test-data/canu_unassembled_result1.fa	Fri Jun 08 04:43:41 2018 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,758 +0,0 @@
->tig00000005 len=6788 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
-CAATACCAACTGGCAATCTTATAGCGGTGAAACCACGTTGAGCTATTTCAGCCAGATGGCGGGCAACAGTGCAAAACTTTCTTTCTGCCGCCAGCGAATT
-GCAGTGATTTTGCCCTCATCCGTGCGTTTTACCCGCCAGAGCATGAGCACGCTCAGGAATGCCTGGGTCGATCTGCTACGCATCACGTTATGGGTGCTAG
-TCCCTGTGGCGTTGTTGATTGCACTGTTTTTTATTCAACAAGGTGCGCTGCAAAACTTTCTGCCTTATCGGGCTGTGAATACCGTTGAAGGGCGCAACAG
-CTGATACCATGGGGCCTGTAGCTTCTCAGGAAGCGATCAAGATGCTCAGTACTAACGGCGGCTTCTTTAATGCCAACTCTGTCGCATCCGTTTGAAAACC
-CAACCGCACTGACCAACTTCGTGCAGATGCTGGCGTCTTCTTGATCCCAACGGCGCTGTGCTTTGCCTTTGGTGAAGTGATGGGCGATCGCCGCCAGGGG
-CGCATGTTGCTGTGGGCGATGTCAGTGATTTTTGTCATCTGCGTAGGCGTGGTGATGTGGGCAGAAGTTCAGGGTAATCCTCATCTGCTGGCACTGGGCA
-CGGACAAGCAGCATCAATATGGAAGGTAAAGAGAGCCGTTTCGGCGTGCTGGTCAGTAGCCTGTTTGCGGTCGTGACGACGGCGGCTTCTGTGGCGCGGT
-GATTGCGATGCATGATTCGTTTACCGCTCTCGGTGGCATGGTGCCGATGTGGCTGATGCAAATTGGTGAAGTGGTGTTCGGCGGTGTCGGTTCTGGTCTT
-TACGGCATGATGCTGTTTGTCCTGCTGGCGGTGTTTATTGCCGGGCTGATGATTGGTCGTACACCGGAATATCTGGGTAAAAAATCGACGTACGCGAGAT
-GAAACTGACTGCACTGGCAATTCTGGTTACCCCGACGCTGGTGCTGATGGGCGCGGCGTTGGCGATGACCGACGCCGGACGTAGCGCCATGCTCAACCCT
-GGCCCGCATGGTTTTGGCGAAGTGCTGTACGCCGTGTCATCCGCCGCTAACAACAGCAGCAGCGCCTTTGCCGGATTAAGCGCCAACTCTCCGTTCTGGA
-ACTGTTTACTGGCGTTCTGCATGTTTGTCGGTCGCTTCCGGGGTGATTATCCCGGTGATGGCAGTGCCGGTTCGCTGGTGAGTAAAGCCAAGCCGCCAGC
-TCCGGCACGCTGCAACGCACGGCCCGCTGTTTGTTGGCCTGTTAATCGGCACCGTGTTGCTGGATTGGCGCACTGACCTTTATCCTGCCCTGGCGCTTGG
-TCCGTGGCGGAATATCTCTCCTGATGATATTGGTGAGCACTGAATATGAGTCGTAAACAACTGGCGCTATTCAGACCAACACTTGTCGTTCAGGCGCTGA
-AAGAAGAAGCGTTGAAAAATTAAACCCGCAGGCGCAATGGCGCAATCCGGTGATGTTTATCGTCTGGATCGGCAGTCTGCTGACCACCTGTAATAGCATC
-GCGATGGCAGGCGGTGCGATGCCCGGCAATGCGCTGTTTAGCGCGGCCATTAGCGGTTGGCTGTGGATCACCGTACTGTTCGCTAATTTCGCCGGGCGCT
-GGCAGAAGGCCGCAGTAAAGCGCAGGCCAACAGTCTGAAAGGGTGAAACTGCCTTTGCCCGCAAGCTGCGTGAGCCGAAATATGGCGCTGCGGCGGACAA
-AGTTCCTGCCGACCAACTTCGTAAAGGCGATATCGTACTGGTAAAGCCTGATATTATCCCCTGCGATGGTGAAGTTATTGAAGAGGGTGCATCGGTCGAT
-GAAAGCGCCATCACCGGGAATCGGCACCGGTGATCCGTGAATCAGCGGCGATTTTGCCTCCGTCACCGGCGGCACGCGTATTCTTTCTGACTGGCTGGTG
-ATTAGTGTAGCGTTAACCCGGCGAGACATTTCTGGATCGGATGATCGCGATGGTGGAAGGCGCACAGCGACGCAAAACGCCGAACGAGAACGCCTGACCA
-TTCTGCTGATTGCCCTGACTATCGTCTTTTACTGGCAACCGCCACGTAGCCGTTTTCCGCGTGGGGCGGTAATGCAGTCAGCGTAACGGTACTGGTGGCG
-CTGCTGGTCTGTCTGATCAACCACTATTGGCGGCCTGTTGTCAGCGATCGGCGTCGCCGGGATGAGCCGGATGCTAGGCGCGAATGTGATTGCCACCAGC
-GGACGTGCAGTTGAAGCGGCAGGTGACGTTGACGTTCTGCTACTGGATAAAACCGGCACCATCACACTCGGTAACCGTCAGGCGTCGGGTTTATCCCCGC
-GCAGGGCGTGGATGAAAAACGCTGGCTGACGCCGCACAACTGGCTTCGCTGGCTGATGAAACGCCGGAAGGCCGCAGTATTGTGATCCTCATAAGCAGCG
-TTTTAACCTGCGCGAGCGCGATGTGCAGTCGCTCCATGCCACCTTTGTACCGTTTACTGCGCAAAGCCGGATAGCAGGATCAACATCGACAACCGCATGA
-TCCGTAAAGGTTCTGTCGATGCCATTCGTCGCCATGTTGAGGCTAACGGTGGTCACTTCCCTACCGATGTTGATCAAAAGTCGATCAGGTTGCGCGTCAG
-GGGAGCCACGCCGCTGGTGGTGGTGGAAGGTTCTCGTGTGCTGGGCGTTATTGCGCTGAAGATATCGTCAAAGGCGGTATTAAAGAGCGCTTCGCCCAGC
-TGCGCAAAATGGGCATTAAAACGGTGATGATTACCGGCGATAACCGTCTGACTGCCGCCGCGATTGCTGCGGAAGCGGGTGTCGATGATTTTCTCGCCGA
-AGCGACACCAGGTAAGCTGGCATTGATCCGTCAGTATCAGGCGGAAGGTCGTTTGGTAGCGATGACCGGCGACGGCATAACGATGCTCCGGCTGGCGCAG
-GCAGATGTCGCAGTGGCGATGACTCCAGCGCAGGCGGCGAAAGGCGGGCAATATGGTCGATCTCGACTCTAACCCGACCAAGTTGATCGAGGTGGTGCAC
-ATTGGCAAACAGATGCTGATGACCCGTGTCGCTGACCACCTTCAGCGTACCAACGATGTGGCGAAATACTTCGCCATTATTCCGGCGGCATTCGCGGCAA
-CGTATCCGCAGTTAAATGCGCTGAACATCATGTGCCTGCATTCGCCCGACTCCGCAATCCTCAGTGCGGTGATTTTCAACATGATTATCGTCTTTGATTC
-CCTGGCGTTAAAAGGCGTGAGTTATAAACCGCTTACCGCTTCTGCCATGTTGCGCCGTAACTTATGGATTTACGGTCTGGGTGGGCTGCTGGTGCCGTTT
-ATCGGTATCAAAGTCATTGATTTACTGCTGACCGTTTGCGGTCTGGTGTAGGTTTACCATGAGTGGATTACGTCCGGCATTATCAACATTTATCTTTCCG
-TTATTGATTACTGGCGTTTACCCGCTGCTGACCACCGTACTGGGGCAATGGTGGTTTCCTGGCAGGCCAATGGTTCGTTGATTCGTGAAGGTGATACGGT
-GCGCGGTTCGGCATTAATCAGGCAGAATTTACCGGCAGCAGCTGTTTTCATGGTCGCCCGTCAGCAGCAGCAGAAATGCCCTATAATCCACAGGCTTCTG
-GCAGGAGCAATCTGGCGGTCAGTAACCCTGAGCTGGATAAACTAATAGCCGCGCGTTGCTGCATTACGGGCCGCTAACCCGGATGCCAGCGCAGGCGTTC
-CAGTTGAACTGGTGACGGCATCGGCAAGCGGGCTGGACAATAATATCACCCATAAGCGGCGGCCTGGCAAATCCCACGCGTGGCGAAAGCGCGTAATCTC
-AGCGTTGACAGCTCACGCAACTGATCGCAAAATACAGCCAACAACCGCTGGTGAAATATATCGGCCAGCCGGTTGTCAACATTATTGAACTCAATCTGGC
-GCTGGATAAACTTGATGAATAACGAACCCTTACGTCCCCACCCCGATCGTCTGCTGGAACAAACTGCCGCGCCGCATCGGGAAGCTGGATTTTCTTCGGT
-GCCTGTGCAGGCGTCGGGAAGACCTGGGCGATGCTGGCAGAAGCCCAGCGACTGCGGAGCGCAAAGGGCTGGATATTGTGGTTGGCGTGGTAGAAACCCA
-CGGGCGAAAGATACCGCCGCCATGCTGGAAGGGCTGGCTGTTCTGCCGTTAAAACGCCAGGCGTACCGTGGGCGGCATATCAGCGAGTTTGATCTCGATG
-CCGCCCTCGCCCGCCGCCCGGCGCTGATCTTAATGGACGAACTGGCGCACAGTAATGCGCCAGGTTCCCGTCATCCCAAACGCTGGCAGGATATCGAAGA
-ACTGCTGGAAGCTGGCATTGATGTTTTCACTACCGTCAACGTTCAGCATCTGGAAAGTCACGATGATGTGGTCAGCGGCGTCACCGGAATTCAGGTACGG
-AAACCGTGCCCGATCCTTTCGATGCCGCCGACGACGTGGTGCTGGTGGACTTGCCCCGGACGATCTGCGCCAGCGGCTGAAAGAAGGCAAAGTCTATATT
-GCCGGGCAGGCGGGCGCGCGCCATTGAACATTTTTCCGCAAAGGTAATCTGATCGCCCTGCGCGAACTGGCACTGCGCCGTACTGCCGATCGCGTTGATG
-AGCAAATGCGCGCCTGGCGGGGGCGTCCTGGCGAAGAGAAAGTGTGGCACACGCGCGACGCGATCCTTTTATGCATCGGCCATAACACCGGCAGCGAAAA
-ACTGGTCCGCGCAGCAGCGCGCAGCGTCACGGCTGGGTGGCGTCTGGCACGCGGTGTATGTTGAAACCCCTGCCCTGCACGCTTACCGGAAAAAACGTCG
-GGCAATTCTCAGCGCCTTACGTCTGGCGCAGGAACTGGGCGCGGGGACGGCAACACTTTCTGATCAGCGGAAGAGAAAGCGGTAGTGCGTTATGCCCGTG
-AACATAATCTCGGCAAGATTATTCTCCGGTCGCCCGCCTCGCGCCGCTGGTGGCGTCGGGGATTTGCTGACCGACTGGCGCGCATCGCCCCGATCTCGAT
-CAGGTGCTGGTCGCGCTTGATGAACCACCCGCCCGCACGATTAACAACGCGCCGGATAACCGCTCTTTTAAAGACAAGTGGCGTGTACAAATTCAGGGGA
-TGCGTGGTTGCCGCCGCGTTATGCGCCGTTATCACCTTAATTGCCATGCAGTGGCTGATGGCGTTGATGCCGCCAACCTGGTGATGCTGTATCTGCTTGG
-CGTGGTGGTGGTGGCGCTATTTATGGACGCTGGCCTTCAGTGGTTGCCACCGTCATTAATGTAGTGAGTTTCGATCTCTTTTATCGCCCGCGGCACGCTC
-GCCGTCTCTGATGTGCAATATCTGCTGACCTTCGCGGTGATGTTAACCGTCGGGCTGGTGATCAGGAACCTTACTGCTGGCGTGCGTTATCAGGCGCGGG
-TAGCCCGTTACCGCGAGCAACGCACACGGCACTTATATGAAATGTCGAAAGCTCTGGCGGTGGGCCGCAGTCCGCAGGATATCTGCCACCAGCAGACAAT
-TTATTGCCTCCACGTTTCATGCCCGCAGTCAGGTGTTGTTGCCCGATGACAACGGTAAATTGCAGCCGTTAACACATCCGCAAGGGAATGACGCCGTGGG
-ACGATGCCATCGCGCAGTGGAGTTTTGATAAAGGCCTGCCTGCGGGCGCGGGCACCGACGTTACCCGGTGTACCGTACCAGATTTTGCCGCTAAAAAGCG
-GCGAGAAAACCTACGGGCTGGTGGTGGTGGAGCCGGGGAATCTGCGCCAGTTGATGATCCCGGAACAGCAGCGCCTGCTGGAACGTTACGCTGTTAGTCG
-CCAATGCCCTTGAGCGGCTGACGCTAACCGCCAGCGAAGAACAGGCGCGGATGGCAAGCGAACGTGAACAGATCCGCAACGCCCTGCTGGCGGCGCTTTC
-GCATGATTTACGCACGCCGCTTACGGTGCTGTTTGGTCAGGCAGAAATCTTAACGCTCGATCTGGCGAAGCGAGGATCACCCCACGCCCGCCAGGCCAGC
-GAGATCCGTCAGCATATTAACTTCACTACCCGACTGGTGAATAATCTACTGGATATGGCGCGAATTCAGTCCGGCGGCTTTAATTTGGAAGAAAGAGTGG
-TTAACGCTGGAAAGAAGTAGTCGGCAGCGCGCTGCAAATGCTGGAACCGGGTTTATCGTCGCCCATCAATCTTTCTCTGCCAGAACCGCTGACCTTAATC
-CACGTTGACGGGCCTCTTTGAACGGGTGCTGATTAATCTGCTGGAGAACGCGGTGAAATATGCGGGTGCGCAGGCCGAAATTGGTATCGATGCCCACGTT
-GAGGGCGAAAATCTACAACTGGATGTCTGGGATAACGGCCCCGGTCTTCCGCCAGGCCAGGAGCAGACGATATTTGATAAGTTTGCTCGCGGGAATAAAG
-AGTCGGCAGTACCGGGGTAGGGCTTGGACTGGCAATTTGTCGGGCGATAGTGGATGTACACGGGGGCACTATTACCGCGTTCAACCGACCGGAAGGTGGT
-GCCTGTTTTTCGTGTTACACTTCCCCAGCCAAACTGCCCTGAACTGAAGAATTTCAGCGGGATATGTGACAAACGTTCTGATTGTTGAAGATGAACAGGC
-TATTCGTCGCTTTCTGCGCACGGCGCTGGAGGGCGACGGATGCGATCTTTGAGGCCGAAACGCTGCAACGCGGCTTGCTGGAAGCGGCAACCCGTAAGCC
-AGATTTGATTATTCTCGATCTCGGCCTGCCCGATGGTGATGGGATTGAGTTTATCCGCGACCTGCGCCAGTGGAGCGCGGTGCCGGTG
->tig00000006 len=6499 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
-CGTCATCTGGCCGAAGCGGTCGTATTCATAACGGGTCTGGTAGCCCGAGCAGTCGGTGAACGCCAGCAACTGCCCGTAGCGGCTCCAGGTCATCTGTTGG
-AGTGCTGCCCGTCGCATCCGTTGTCGTCGCCGGTAACTCACTGTGCGCGTCATCGTAGCGGTAGCGTACTGTCTCCCCGCTGCGCGATGTCTCCGATACC
-AGCCTGCCCGGTTCATCATATTCGGCGGCTCTCCAGCCCGTCCGGGGACACCACCGCCGTCAGCTGGTTCACGTCGTTATAGTAAAATTTCGTCTCCCGC
-CCGTCCGGTGTGGTGATGTCCGTGATATCGCCGGACACCACATTCAGACCGCACTCTGTCCTCCGTCCCCGCGTCCGTCTGCGCCGTGAGCCTTCCTGCC
-GCGTCATACCCGCTGCGCGTGACGCTGCCGTCCGCCAGTTCTTTTTCACCACCCGTTTCCAGCCCGGCCCCGCCTTCTGTATGCAGCACCTCACGCCGGT
-TCAGGCTGTCGGTGACGGTGATGCGGTCCTGCTCATAAAGATAGCGGTAGCTTAACCCTGCCGGGTTCAGTTGCTCCACCACCCGCCCCGTATCGTCGTA
-GCGGTAGCGCATCTCCGGCCTTCCCGCGTAACGGTGCGCCACCATCCGGCCCGGGTGCTGCGTCATACGTGAAAGCGCGCACCTGCGTATTGCTGCGGTC
-ATATACCGCCAGCAGTTCACCGGCTTCCGTATGCGTGTACCGCACCAGTGGCGCAGCGGGCAGGCTCTCCGGGTATGCCGGGTCGTGCATCAGCCACACC
-GCCGAAAGGCGGATACCCTGTCGGGGCCGTATTCGGTACCGGGCAGTGTGTCGAGGAACGCTGAGGCTGAGAGAGGGCGGGAACTGTCAGAAGAAGATAG
-CGAAGAGGTGGGCCTCTTCCGCACGCTGCGCCTGCGTGGTCAGCACCAGACGGAACTCCGCCCGGCACCGTCCGTCACGCCGGTGATTTCCCCGGCCAGG
-TCACCGGCGGCCTCACGCCGGTACGTCAGCGTCCGCCCGAAGCGGTCCGCCATCCCGGTAAGCACCCGGTACGGCGGCAGCGGCGCTGGCAGTACGTCCT
-CAGCACCCGGCACCCGCTCAGACCACCCCAGTATCCACCACGGCCTGTGCGCTGTTGGTCGCCAGGTAAAGATGCGGGCAACCGGATATCCGGCGGCAGC
-GCCCCCACAGCCGCGCCAGCGTATGGCCGTCCGGCTGTGCTGCCTTACCACCGCGCACCAGCCACATTGACTCACTGCGGCTGTACACCGCCTCCCGGCA
-GCAGCGGCTCAAAGTGAATGCTCCGCCCGCCGTTGTCGTTGAGTATCAGTCCGTCATCACGTAGCTGTAAGCGGATATCAGAAGGCGCTTTCAGCCGGGG
-CCGAAAACGCCCACCGGTGCAGGCGTCTTCGTCCGGTAGCTGCTGTAGGTGCGGGAGAGAATGAACGGCAGCGGGCCGGCAGCGCAAGGTCCGTCTCGCC
-GGGCAGCACCTTCGCCCCCAGCAGCGGATTTACCGGGTTGCCCGAAGTCATCCCGCCGGACACACCGAGCACGCCACGCCGGTGGGCGCGCCAATTTACA
-CCTGCCGAACCCTGGACAATGGGACCGCCATACTGAGTCATATCTCCTGACGCGCCGCTGGTTTTCCGCTCATATAAAGTGCCCTTTTAGTTATTGTTCA
-TATCCCTGTGTTAGCAACAAAAAATAAAATGACACACAAGACCAGCTAATGTATTTATATATTTTTCACATAAACTTATTTTGTTCTCAATCAACAACAA
-CTGTTATTACAGGTCACTTTCAATATTTTATTAAACTAACATTTTGCACAGATGAATTCATCATCAGCAAATTCACTATATGGATAATATCCATTCAACG
-CATATGATTTATGATTTTATTAGTCTGAGTTATTTTGTAGGGCTATATTTAAAATCAATAAACTCCACCGATTCAGATTAATATCAGCAATAGAAGATAG
-AAATCACCAATTCAATAACATCATCAATGCGGAAACATATTGTAGAATTAATTTAAACAAGGCGTTCCATTCAACCAGAACGCCCTTATTTACTCTCATC
-ACCCCGCAAACTGCCTGAACAGCGCCTTACCCTTTAACCAGTCGCGCACCCAGCCAGCCGCCGAAAAGCGACAGCAGCAGCGCTCCGCTGCACGGCAGAA
-CAATCCACAATCGCCAGTCTGGCTCCCACGGAAAATCAAACACTCGCCTGCAACACTGCCAGCGCCGTTTCCGCACCAATTGCGGCCACCAGGCCGGAAA
-CAAACCCAAGCATGGCGAACTCACACCACAACGTGGTACGCAGCAGTTTTTCCCGCACCGAGTGTGCGCCACACCACCAGCTCCTGATGACGCTGACGCA
-TTCCCACCTGCACCTGTGCCAGCAACAGCAACATACCGCAGGCGGTGACCAGTACCACCATCACTTCCAGCGCCCGACTTACCTGCTCCAGCACCTGACC
-GACCTGTTTTAAAATCGCGCCAATATCTAACAGGCTAATGGTCGGGAACTGGCGGTTGAGTTGTGTCAACATGCCGTTGCCATTCTCCCAGCGGAAACTG
-GTAAGCCAGTTCTGCGGTTGCCCGTCTAATGCCCCTTCAGGGAAAATAAAATAGAAATTAGGCCGCAGACTTTCCCAGTCCACTTTGCGCAGGCTGGTCA
-CTTTAGCGCGGAACTCTGGGTATCGCCCATAAAAGTCACGGTATCACCGAGGGCAACGTTTAAGCGTTTCGCCAGCCCCTCTTCCATCGACACTTCATCG
-GCTTTTGGCGGCCAGTTACCGGCGACAATCGGATTATGATCGGGCGCGTATTTTGCCAGGTAAGATTGAGTTCGCGGTTAAGCGCCTCATCTTCATTACC
-TTCTGTCGGCTTATCGTTAATCGCCGTCAGCCGCGCCCACCACCGGATAAAACGATTCCGGACTATCTGATGTTCCGCGAGGAACGCTTTAGCGGTGCTA
-CCTGTTCTGTGGCGATGTTAATTAAAAGTAGTTCGGGCTTTCTGGAGGTAGCTGCTGCTGCCAGCGGTCGAGCAGATCGCCACGCAACACCAGCAGCAGT
-GCCAGCAGCATAAAGAGAGCGAAAATGCCGAAAGCTGACTTAACGTTGACCACGGCTGACGTAACAGGCGGCTAACCGCCAGGCGCAGAGGCAGCGATTT
-CAGCGTCATGCGGCGAAGTACATTCAGCAGCATCCAGCCCAGCACACCGCACAGCAAAGCCAGTACTACCGCGCCCGCCAGCACCGCCCAAAGCAGCATG
-CTGCCACCCATTAATCCGGCGAGCAGCAGCACAACCACCACACTGACAATCGGCAGATAAAACTTCAGCGGCCAGACGTTCGCTACCACATCATTACGTA
-ATACGCGTAAAGGCTGCGTTGCCAGCAACAAGCGATATGGTCGTAGCCCCACCAGCAGCGAGATGACCGTCATGGTGCCAAGCGCCCACAGCCACGGCCA
-GAGGCTGGCTGGCGGTAGTGCAGCAGGCAGAACGGGCTTGAGCAGCACCATCAACACGTTTCGAACAACAGGCCTATGGCCCCACCGGTAACGGCTGAAA
-GCGTCAGCACCATCAACCACTGACCGACGATTAGCTTACGCAGTTGCGCTCGCCCTGCCCCCAGCGTTTTGAGGATCGCCACCAGATCGTAGCGACTGCG
-ACAGTAATGATTCATCGCTACCGCCACCGCTGCCACTGCCAGCAGCAGGTCAGAAGCGCCAGCAGCAGGAACTGTTACGAGCGTTCCATCGATCGCCCCA
-GCGCGCCTTCGTCCTGTTCCAGACCGTACCAGCGTTGTTCGGGTTTAAGCTGGTAACAACCATTTCATAGCCGTCGAGCTGGTTCTCGTTGCCCGCCGAA
-TTTATAACGCCAGGTGACCCGACTCCCCGGCTGCACGGCTCCGGTTTTATCGACATCCGCCAGATTCATCATCAGACGCGGAGCCATCTGGAAGGGTTAA
-AACCGGAATCCGGTTCCTGAATCACTTCTCCGGCAATCCGCAAGGTGGCATCGCCCACGCCAATGGTGTCGCCCGTTTTCAGGTTAAGCAGTGCCATCAG
-GCGTGGGGCCAGCAATACGCTGCCCGCCTGCGGTTTCAGGCCAGGGTTAGTTGCAGATCGCCATACATCGGGTAGATATCATCCACCGCTTTGACGTTCG
-CCAGCTGCGGTGTGTCGCCTGCAAAGGTCATTGTGCGAAAGTCAGCTTGCCGACTTTCAGGCCGCGCTTTGCGCTTCCTCCAGCCACGCTTGCGGCACTT
-CGCGTGAACTGCGCAACGCCCGATCGCCCGCCATAAACTCACGGCTTTGCTGGCTTAAGCCCTTCTCCATGCGATCGCTGATATTGCCCAGCGCCAGCAC
-GCAGGCCACCGCCAGGCTTAGCGCCAGCCAGACAATTAATAGCGACGGCGAACGCCATTCGCGCCAGAACCAACGTGCAATCATGCTTCCTCCTGCAACT
-GCCCGTTCACCAGCCGTAAGCAGCGGTCGCAGCGCCGCCAGTTGCAGGTCGTGGGTCACCATAATCAACGTGGTGCCATGTTTACGGTTGAGGAAAACAG
-CAGGTCGGCAATTTTATCGCCCGTCTGGCGGTCAAGGTTGCCGTGTTCGTCGGCAAACAGCATCAGGTCGACCATTAAAGGCTCGTGCCAGCGCTTCCTC
-GTTGCTGTTCACCGCCGGAAAGCTGTGCCGGAAGATGATCAGACGTTTACCCAGCCCTAACTGTTCGAGCAACGCTTTCGCCCCGTTACGACTTTCCGCT
-ACTCTCCACCGCGCAGCAGGCCGGAAGCTCGACGTTTTCCAGCGCGTTAAGGGTAGGAATTAACATAAATGACTGAAAAACAAAGCCGACGTGCTTCGCG
-CGCAACTTTGCCCGCGCTTCTTCGTCCATATTATGTGGCGGTTGTCCCTGGAGCTCACTTCGCCACTGCTGCCGTCATCAAGCCCGGCGAGGATCGCCAG
-CAAGGTTGACTTACCGATCCCGACTCGCCCACCAGTGCGATGGTCTCGCGCGTTTGACAACCAGCTCAACTCCGGTGAGGATGGAGAGTTCATGCTCCCT
-GACCGACGGACTTCTTAAGATGATGAACTTCAACAATGTTTTCCGCTGGCATTTGCCCTTCCTGTTCCTGGTCCCATTAACCTTCCGTGCCGCCGCAGCC
-GTTATTGATTCTGGGTGATAGCCTGAGCGCCGGGTATCGAATGTCTGCCAGCGCGGCCTGGCCTGCCTTGTTGAATGATAAGTGGCAGAGTAAACGTCGG
-TAGTTAATGCCAGCATCAGCGGCGACACCTCGCAACAAGGACTGGCGCCTTCCGGCTCTGCTGAAACAGCATCAGCCGCGTTGGGTGCTGGTTGAACTAT
-GGGCAATGACGGTTTGCGTGGTTTTCAGCCACAGCAAACCGAGCAAACGCTGCGCCAGATTTTGCAGGATGTCAAAGCGCCAACGCTGAACCATTGTTAA
-TGCAAATACGTCTGCCTGCAAACTATGGTCGCCGTTATAATGAAGCCTTTAGCGCCATTTACCCCAAACTCGCCAAAGAGTTTGATGTTCCGCTGCTGCC
-CTTTTTTATGGAAGAGGTCTGCCTCAAGCCACAATGGATGCAGGATGACGGTATTCATCCCAACCGCGACGCCCAGCCGTTTATTGCCGACTGGATGGCG
-AAGCAGTTGCAGCCTTTAGTAAATCATGACTCATAAAGCAACGGAGATCCTGACAGGTAAAGTTATGCAAAAATCGGTCTTAATTACCGGATGTTCCAGT
-GGAATTGGCCTGGAAAGCGCGCTCGAATTAAAACGCCAGGGTTTTCATGCTGGCAGGTTGCCGGAAACCGGATGATGTTGAGCGCACGAACAGCATGGGA
-TTTACCGGCGTGTTGATCGATCTGGATTCACCAGAAAGTGTTGATCGCGCAGCCGACGAGGTGATCGCCTGACCGATAATTGTCTGTATGGGATCTTTAA
-CAATGCCGGATTCGGCATGTATGGCCCCTTTCCTGCATCAGCCGTGCGCAGATGGAACAGCAGTTTCCGCCAACTTTTCGGCGCACACCAGCTCACCATG
-CGCCTGTTACCCGCGATGTTACCGCACGGTGAAGGGCGTATTGTGATGACATCATCGGTGATGGGATTAATCTCCACGCCGGGTCGTGGCGCTTACGCGG
-CCAGTAAATATGCGCTGGAGGCGTGGTCAGATGCACTGCGCATGGAGCTGCGCCACAGCGGAATTAAAGTCAGCCTGATCGAACCCGGTCCCATTCGTAC
-TCGCTTCACCGACAACGTCAACCAGACGCAAAGTGATAAACCAGTCGAAAATCCGGCATCGCCGCCCGCTACGTTGGGACCGGAAGCGGTGGTGGACAAA
-GTACGCCATGCTTTTATTAGCGAAGCCGAAGATGCGCTATCCGGTGACGCTGGTGACCTGGGCGGTAATGGTGCTTAAGCGCCTGCTGCCGGGGCGCGT
->tig00000007 len=3672 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
-CGGCTCCAGGTCATCTGCCGGTGCTGCCCGTCGCATCCGTTGTCGTCGCCGGTAACTCACTGTGCGCGTCATCGTAGCGGTAGCGTACTGTCTCCCCATG
-CGCGATGTCTCCGATACCAGCCTGCCCGGTTCATCATATTCCGGCGGCTCTCCAGCTGATCCGGGGACACCACCGCCGTCAGCTGGTTCCGTCGTTATAG
-TAAAATTTCGTCTCCCGCCTGTCCGGTGTGGTGATGTCCGTGATATCGCCGGACACCACATTCAGACGCACTCTGTCCTCCGTCCCGCCGCGTCCGTCTG
-CGCCGTGAGCCTTCCTGCCGCGTCATACCGCTGCGCGTGACGCTGCCGTCCGCCAGTTCTTTTTTCACCGTTTCAGCCCGGCCCCGCCTTCTGTATGCAG
-CACCTCACGCCGGTTCAGGCTGTCGGTGACGGTGATGCGGTCCTGCTCATAAAGATAGCGGTAGCTTAACCCTGCCGGGTTCAGTTGCTCCACCACCCGC
-CCCGTATCGTCGTAGCGGTAGCGCATCTCCGGCCTTCCCGCGTAACGGTGCGCCACCATCCGGCCGGGTGCTGCGCGTCATACGTGACGCGCACCTGCGT
-ATTGCTGCGGTCATATACCGCCAGCAGTTCACCGGCTTCCGTATACGTGTACCGCACCAGTGGCGCAGCGGGCAGGCTCTCCGGGTATGCCGGGTCGTGC
-ATCAGCCACACCGCCGAAAGGCGGATACCCTGTCGGGGCCGTATTCGGTACCGGGCGGTGTCGGGGAACGCTGAGGCTGAGAGGGGGGAACTGTCAGAAG
-AAGATAGCGAAGAGGTGTGGCCTCTTCCGCGCTGCGCCTGCGTGGTCAGCACCAGACGGAACTCCCGCCCGGCACCGTCCGTCGCCGGTGATTTCCCGGC
-CAGGTCACCGGCGGCCTCACGCCGGTACGTCAGCGTCAAGCGGTCCGCCATCCCGGTAAGCACCCGGTACGGCAGCAGCGGCGCTGGCAGTACGTCCTCA
-GCACCCGGCACCCGCTCAGACCACCCCAGTATCCACCACGGCCCTGTGCGCTGTTGGTCGCCAGGTAAAGATGCGGGCTTAACCGGATATCCGGCGGCAG
-CGCCCCCCACAGCCGCGCCAGCGTATGGCCGTCCGGCTGTGCTTGCCTTACCACCGCGCACCAGCCACATTGACTCACTGCGGCTGTACACCGCCTCCCC
-AGCAGCGGCGGCTCAAAGTGAATGCTCCGCCCGCCGTTGTCGTTGAGTATCAGTCCGTCATCACGTAGCTGTAAGCGGATATCAGAAGGCGCTTCAGCCG
-GGGCCGAAAACGCCCACCGGTGCAGGCGTCTTCGTCCGGTAGCTGCTGTAGGTGCGGGAGAGAATGAACGGCAGCGGGCCGGGCAGCGCAAGGTCCGTCT
-CGCCGGGCAGCACCTTCGCCCCAGCAGCGGATTTACCGGGTTGCCAGAAGTCATCCCGCCCGGACACACCGAGCACGCACGCCGGTGGGCGCGCCAATTT
-TACACCTGCCGAACCCTGGACAATGGGACCGCCATACTGAGTCATATCTCTGACGCGCCGCTGGTTTTCCGCTCATAAAGTGCCCTTTAGTTATTGTTCA
-TATCCCTGTGTTAGCAACAAAAAATAAAATGACACACAAGACCAGCTAATGTATTTATATATTTTTCACATAAACTTATTTGTTCTCAATCAACAACAAC
-TGTTATTACAGGTCACTTTCAATATTTTATTAAACTAACATTTTAGCACAGATGAATTCATCATCAACAAATTCACTATATGGATAATATCCATTCAACG
-CATATGATTTATGATTTTATTAGTCTGAGTTATTTTTGTAGGGCTATATTTAAAATCAATAAACTCACCGATTCAGATTAATATCAGCAATAGAAAGATA
-GGAAATCACCAATTCAATAACATCATCAATGAAACATATTGTAGAATTAATTTAAACAAGGCGTTCCATTCAACCAGAACGCCCTTATTTACTCATCACC
-CCGCAAACTGCCTGAACAGCGCCTTGCCTTTAACCAGTCGCGCACCCAGCCAGCCGCCGAAAAGCGACAGCAGCAGCGCTCCGCTGCACGGCAGAACAAT
-CCACAATCGCCAGTCTGGCTCCCACGGAAAATCAAACACCTTTCGCCTGCAACTGCCAGCGCCGTTTCCGCGCAATTGCGGCCACCAGGCCGGAAACAAA
-CCCAAGCATGGCGAACTCACACCACAACGTGGTACGCAGCAGTTTTTCCCGCACCGAGTGTGCGCCACACCACCAGCTCCTGATGACGCTGACGCATTCC
-CACCTGCACCTGTGCCAGCAGCAGCAACATACCGCAGGCGGTGACCAGTACCACCATCACTTCCAGCGCCCGACTTACCTGCTCCAGCACCTGACCGACC
-TGTTTTAAAATCGCGCCAATATCTAACAGGCTAATGGTCGGGAACTGGCGGTTGAGTTGTGTCAACATGCCGTTGCCATTCTCCCAGCGGAAACTGGTAA
-GCCAGTTCTGCGGTTGCCCGTCTAATGCCCTTCAGGGAAAATAAAATAGAAATTAGGCCGCAGACTTTCCCAGTCCACTTTGCGCAGGCTGGTCACTTTA
-GCGCGGAACTCCTGGGTATCGCCCATAAAAGTCACGGTATCACCGAGGGCAACGTTTGCGTTTCGCCAGCCCCTCTTCATCGACACTTCATCGGCTTTTG
-GCGGCCAGTTACCGGCGACAATCGGATTATGATCGGGCCGCGTATTTTGCCAGGTAAGATTGAGTTCGCGGTTAAGCGCCTCATCTTCATTACCTTCTGT
-CGGCTTATCGTTAATCGCCGTCAGCCGCGCCCGCACCACCGGATAAAACGATTCCGGGACTATCTGATGTTCCGCGAGGAACGCTTTAGCGGTGCTACCT
-GTTCTGTGGCGATGTTAATTAAAAAGTAGTTCGGGCTTTCTGGAGGTAGCTGCTGCTGCCAGCGGTCGAGCAGATCGCCACGCAACACCAGCAGCAGTGC
-CAGCAGCATAAAGGAGCGAAAATGCCGAGCTGACTTAACGTTGACCACGGCTGACGTAACAGGCGGCTAACCGCCAGGCGCAGAGGCAGCGATTTCAGCG
-TCATGCGGCGAAGTACATTCAGCAGCATCCAGCCCAGCACACCGCACAGCAAAGCCAGTACTACCGCGCCCGCCAGCACCGCCCAAAGCAGCATGCGCCA
-CCCATTAATCCGGCGAGCAGCAGCACAACCACCACACTGACAATCGGCAGATAAAACTTCAGCGGCCAGACGTTCGCTACCACATCATTACGTAATACGC
-GTAAAGGCTGCGTTGCCAGCAACAAGCGATATGGTCGTAGCCCCACCAGCAGCGAGATGACCGTCATGGTGCCAAGCGCCCAGCCGGCCAGAGGCTGGCT
-GGCGGTAGTGCAGCAGGCAGAACGGGCTTGAGCAGCACCATCAACACGTTTCGAACAACAGGCCTATGGCCCCACCGGTAACGGCTGAAAGCGTCAGCAC
-CATCAACCACTGACCGACGATTAGCTTACGCGGTTGCGCCTGCCCTGCCCCCAGCGTTTTGAGGATCGCCACCAGATCGTAGCGACTGCGACAGTAATGA
-TTTCATCGCTACCGCCACCGCTGCCACTGCCAGCAGCAAGGTCAGAAGCGCCGAAAGCAGCAGGAACTGTTA
->tig00000008 len=7086 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
-ACGCGCCCCGGCAGCAGGCGCTTAAGCACATTACCGCCCAGGTCACCAGCGTCACCGGATAGCGCATCTTCGGCTTCGCTAATAAAAGCATGGCGTACTT
-TGTCCACCACCGCTTCCGGTCCCAACGTAGCGGGCGGCGATGCCGGATTTTCGACTGGTTTATCACTTTGCGTCTGGTTGACGTTGTCGGTGAAGCGAGT
-ACGAATGGGACCGGGTTCGATCAGGCTGACTTTAATTCCGCTGTGGCGCAGCTCCATGCGCAGTGCATCTGACCACGCCTCCAGCGCATATTTACTGGCC
-GCGTAAGCGCCACGACCCGGCGTTGAGATTAATCCCATCACCGATGATGTCATCACAATACGCCCTTCACCGTGCGGTAACATCGCGGGTAACAGGCGCA
-TGGTGAGCTGGTGTGCGCCGAAAAGTTGGCGGAAACTGCTGTTCCATCTGCGCACGGCTGATGTTGGAAAGGGCCATACATGCCGAATCCGGCATTGTTA
-AAGATCCCATACAGACCACTATCGGTCAGGGCGATCACCTCGTCGGCTGCGCGATCAACACTTTCTGGTGAATCCAGATCGATCAACCGCGCCGGTAAAT
-CCCATGCTGTTCGCGCGCTCAACATCATCCGGTTTCCGGCAACCTGCCAGCACACTTGAAAACCCTGGCGTTTTAATTCGAGCGCGCGCTTTCCAGGCCA
-ATTCCACTGGAACATCCGGTAATTAAGACCGATTTTTGCATAACTTTACCTGTCAGGATCTCCGTTGCTTTATGAGTCATGATTTACTAAAGGCTGCAAC
-TGCTTCGCCATCCAGTCGGCAATAAACGGCTGGGCGTCGCGGTTGGGATGAATACCGTCATCCTGCATCCATTGTGGCTTGAGGAGACCTCTTCCATAAA
-AAGGGCAGCAGCGGAACATCAAACTCTTTGGCGAGTTTGGGGTAAATGGCGCTAAAGGCTTCATTATAACGGCGACCATAGTTTGCAGGCAGACGTATTT
-GCATTAACAATGGTTCAGCGTTGGCGGCTTTGACATCCTGCAAAATCTGGCGCAGCGTTTGCTCGGTTTGCTGTGGCTGAAAACCACGCAAACCGTCATT
-GCCGCCAGTTCAACCAGCACCCAACGCGGCTGATGCTGTTTCAGCAGAGCCGGAAGGCGCGCCAGTCCTTGTTGCGAGGTGTCGCCGCTGATGCTGGCAT
-TAACTACCGACGTTTTTACTCTGCCACTTATCATTCAACAAGGCAGGCCAGGCCGCGCTGGCAGACATTCGATACCCGGCGCTCAGGCTATCACCCAGAA
-TCAATAACGTGTCCTGCGGCGGCACGGAAGGTGCTGGGACCAGGAACAGGAAGGGCAAATGCCAGCGGAAAACATTGTTGAAGTTCATCATCTTAAGAAG
-TCCGTCGGTCAGGGAGCATGAACTCTCCATCCTCACCGGAGTTGAGCTGGTTGTCAAACGGCGAGACCATCGCACTGGTGGGCGAGTCGGGATCGGTAAG
-TCAACCTTGCTGGCGATCCTCGCCGGGCTTGATGACGGCAGCAGTGGCGAAGTGAGTCTGGTGGACAACCGCTACATAATATGGACGAAGCGCGGGCAAA
-GTTGCGCGCGAAGCACGTCGGCTTTGTTTTCAGTCATTTATGTTAATTCCTACCCTTAACGCGCTGGAAAACGTCGAGCTTCCGGCCTGCTGCGCGGTGA
-GTAGCGCGGAAAGTCGTAACGGGGCGAAAGCGTTGCTCGAACAGTTAGGGCTGGGTAAACGTCTGGATCATCTTCCGGCACAGCTTTCCGGCGGTGAACA
-GCAACGAGGAAGCGCTGGCACGAGCCTTTAATGGTCGACCTGATGCTGTTTGCCGACGAACCCACGGCAACCTTGACCGCCAGACGGGCGATAAAATTGC
-CGACCTGCTGTTTTCCTCAACCGTGAACATGGCACCACGTTGATTATGGTGACCCACGACCTGCAACTGGCGGCACGCTGCGACCGCTGCTTACGGCTGG
-TGAACGGGCAGTTGCAGGAGGAAGCATGATTGCACGTTGGTTCTGGCGCGAATGGCGTTCGCCGTCGCTATTAATTGTCTGGCTGGCGCTAAGCCTGGCG
-GTGGCCTGCGTGCTGGCGCTGGGCAATATCAGCGATCGCATGGAGAAGGGCTTAAGCCAGCAAAAGCCGTGAGTTTATGGCGGGCGATCGGGCGTTGCGC
-AGTTCACGCGAAGTGCCGCAAGCGTGGCTGGAGGAAGCGCAAAAGCGCGGCCTGAAAGTCGGCAAAGCTGACTTTCGCCACAATGACCTTGCAGGCGACA
-CACCGCAGCTGGCGAACGTCAAAGCGGTGGATGATATCTACCCGATGTATGGCGATCTGCAAACTAATCCCCTGGCCTGAAACCGCAGGCGGGCAGCGTA
-TTGCTGGCCCCACGCCTGATGGCACTGCTTAACCTGAAAACGGGCGACACCATTGACGTGGGCGATGCCACCTTGCGGATTGCCGGAGAAGTGATTCAGG
-AACCGGATTCCGGTTTTAACCCTTCCAGATGGCTCCGCGTCTGATGATGAATCTGGCGGATGTCGATAAAACCGGAGCCATGCAGCCGGGGAGTCGGGTC
-ACCTGGCGTTATAAATTCGGCGGCAACGAGAACCAGCTCGACGGCTATGAGAAATGGTTGTTACCCCTCAGCTTAAACCCGAACAACGCTGGTACGGTCT
-GGAACAGGACGAAGGCGCGCTGGGGCGATCGATGGAACGCTCGCAACAGTTCCTGCTGCTGGCGCTTCTGACCTTGCTGCTGGCAGTGGCAGCGGTGGCG
-GTAGCGATGAATCATTACTGTCGCAGTCGCTACGATCTGGTGGCGATCCTCAAAACGCTGGGGGCAGGGCAGGCGCAACTGCGTAAGCTAATCGTCGGTC
-AGTGGTTGATGGTGCTGACGCTTTCAGCCGTTACCGGTGGGGCCATAGGCCTGTTGTTCGAAAACGTGTTGATGGTGCTGCTTCAAGCCCGTTCTGCCTG
-CTGCACTACCGCCAGCCAGCCTCTGGCCGTGGCGTGGGCGCTTGGCACCATGACGGTCATCTCGCTGCTGGTGGGGCTACGACCATATCGCTTGTTGCTG
-GCAACGCAGCCTTTACGCGTATTACGTAATGATGTGGTAGCGAACGTCTGGCCGCTGAAGTTTTATCTGCCGATTGTCAGTGTGGTGGTTGTGCTGCTGC
-TCGCCGGATTAATGGGTGGCAGCATGCTGCTTTAGGCGGTGCTGGCGGGCGCGGTAGTACTGGCTTTGCTGTGCGGTGTGCTGGGCTGGATGCTGCTGAA
-TGTACTTCGCCGCATGACGCTGAAATCGCTGCCTCTCTGCGCCTGGCGGTTAGCCGCCTGTTACGTCAGCCGTGGTCAACGTTAAGTCAGCTTTCGGCAT
-TTTCGCTCTCCTTTATGCTGCTGGCACTGCTGCTGGTGTTGCGTGGCGATCTGCTCGACCGCTGGCAGCAGCAGCTACCTCAAGAAAGCCCGAACTACTT
-TTTAATTAACATCGCCACAGAACAGGTAGCACCGCTAAAGCGTTCCTCGCGGAACATCAGATAGTCCCGGAATCGTTTTATCCGGTGGTGCGGGCGCGGC
-TGACGGCGATTAACGATAAGCCGACAGAAGGTAATGAAGATGAGGCGCTTAACCGCGAACTCAATCTTACCTGGCAAAATACGCGGCCCGATCATAATCC
-GATTGTCGCCGGTAACTGGCCGCCAAAAGCCGATGAAGTGTCGATGGAAGAGGGGCTGGCGAAACGCAAACGTTGCCCTCGGTGATACCGTGACTTTATG
-GGCGATACCCAGGAGTTCCGCGCTAAAGTGACCAGCCTGCGCAAAGTGGACTGGGAAAGTCTGCGGCCTAATTTCTATTTTATTTTCCCTGAAGGGGCAT
-TAGACGGGCAACCGCAGAGCTGGCTTACCAGTTTCCGCTGGGAGAATGGCAACGGCATGTTGACACAACTCAACCGCCAGTTCCCGACCATTAGCCTGTT
-AGATATTGGCGCGATTTTTAAAACAGGTCGGTCAGGTGCTGGAGCAGGTAAGTCGGGCGCTGGAAGTGATGGTGGTACTGGTCACCGCCTGCGGTATGTT
-GCTGTTGCTGGCACAGGTGCAGGTGGGAATGCGTCAGCGTCATCAGGAGCTGGTGGTGTGGCGCACACTCGGTGCGGGAAAAACTGCTGCGTACCACGTT
-GTGGTGTGAGTTCGCCATGCTTGGGTTTGTTTCCGGCCTGGTGGCCGCAATTGGTGCGGAAACGGCGCTGGCAGTGTGTTGCAGGCGAAAGTGTTTGATT
-TTCCGTGGGAGCCAGACTGGCGATTGTGGATTGTTCTGCCGTGCAGCAGGCGCTGCTGCTGTCGCTTTCGGCGGCTGGCTGGGTGCGCGACTGGTTAAAG
-GGTAAGGCGCTGTTCAGGCAGTTTGCGGGGTGATGAGAGTAAATAAGGGGCGTTCTGGTTGAATGGAACGCCTTGTTTAAATTAATTCTACAATATGTTT
-CGTTGATGATGTTATTGAATTGGTGATTTCTATCTTCTATTGCTGATATTAATCTGAATCGGTGGAGTTTATTGATTTTAAATATAGCCCTACAAAAATA
-ACTCAGACTAATAAAATCATAAATCATATGCGTTGAATGGATATTATCCATATAGTGAATTTGTTGATGATGAATTCATCTGTGCTAAAAATGTTAGTTT
-AATAAAATATTGAAAGTGACCTGTAATAACAGTTGTTGTTGATTGAGAACAAATAAGTTTATGTGAAAAATATATAAATACATTAGCTGGTCTTGTGTGT
-CATTTTATTTTTTGTTGCTAACACAGGGATATGAACAATAACTAAAAGGGCACTTTATATGAGCGGAAAACCAGCGGCGCGTCAGGAGATATGACTCAGT
-ATGGCGGTCCCATTGTCCAGGGTTCGGCAGGTGTAAATTGGCGCGCCCACCGGCGTGGCGTGCTCGGTGTGTCCGGGCGGGATGACTTCGGGCAACCCGG
-TAAATCCGCTGCTGGGGGCGAAGGTGCTGCCCGGCGAGACGGACCTTGCGCTGCCCGGCCCGCTGCCGTTCATTCTCTCCCGCACCTACAGCAGCTACCG
-GACGAAGACGCCTGCACCGGTGGGCGTTTTCGGCCCCGGCTGAAGCGCCTTCTGATATCCGCTTACAGCTACGTGATGACGGACTGATACTCAACGACAA
-CGGCGGGCGGAGCATTCACTTTGAGCCGCTGCTGCCGGGGCGGTGTACAGCCGCAGTGAGTCAATGTGGCTGGTGCGCGGTGGTAAGGCAGCACAGCCGG
-ACGGCCATACGCTGGCGCGGCTGTGGGGGCGCTGCCGCCGGATATCCGGTTAAGCCCGCATCTTTACCTGGCGACCAACAGCGCACAGGGGCCGTGGTGG
-ATACTGGGGTGGTCTGAGCGGGTGCCGGGTGCTGAGGACGTACTGCCAGCGCCGCTGCCGCCGTACCGGGTGCTTACCGGGATGGCGGACCGCTTCGGGC
-GGACGCTGACGTACCGGCGTGAGGCCGCCGGTGACCTGCCGGGGAAATCACCGGCGTGACGGACGGTGCCGGGCGGGAGTTCCGTCTGGTGCTGACCACG
-CAGGCGCAGCGTGCGGAAGAGGCCCACCTCTTCGCTATCTTCTTCTGACAGTTCCCGCCCTCTCTCAGCCTCAGCGTTCCCCGACACTGCCCGGTACCGA
-ATACGGCCCCGACAGGGTATCCGCCTTTCGGCGGTGTGGCGATGCACGACCCGGCATACCCGGAGAGCCTGCCCGCTGCGCCACTGGTGCGGTACACGTA
-TACGGAAGCCGGTGAACTGCTGGCGGTATATGACCGCAGCAATACGCAGGTGCGCGCTTTCGTATGACGCGCAGCACGGGCCGGATGGTGGCGCACCGTT
-ACGCGGGAAGGCCGGAGATGCGCTACCGCTACGACGATACGGGGCGGTGGTGGAGCAACTGAACCCGGCAGGGTTAAGCTACCGCTATCTTTATGAGCAG
-GACCGCATCACCGTCACCGACAGCCTGAACCGGCGTGAGGTGCTGCATACAGAAGGCGGGGCCGGGCTGAAACGGTGGTGAAAAAGAACTGGCGGACGGC
-AGCGTCACGCGCAGCGGGTATGACGCGGCAGGAAGGCTCACGGCGCAGACGGACGCGGCGGGACGGAGGACAGAGTGCGGTCTGAATGTGGTGTCCGGCG
-ATATCACGGACATCACCACACCGGACGGGCGGGAGACGAAATTTTACTATAACGACGAACCAGCTGACGGTGAATTGTCCCCGGACGGGCTGGAGAGCCG
-CCGGGAATATGATGAACCGGGCAGGCTGGTATCGGAGACATCGCGCAGCGGGGAGACAGTACGCTACCGCTACGATGACGCGCACAGTGAGTTACCGGCG
-ACGACAACGGATGCGACGGGCAGCACCAACAGATGACCTGGAGCCGCTACGGGCAGTGCTGGCGTTCACCGACTGCTCAGGCTACCAGACCCGTTATGAA
-TACGACCCTTCGGCCAGATGACGGCGGTCCACCGCGAGGCATCAGCCTTTACCGCCGCTATGACAACCGTGGCCGGTTAACCTCGGTGAAGACGCACAGG
-GCCGTGAAACGCGGTATGAATACCTTGCCGCAGGCGACCTGACTGCCGTTATCACCCCGGACGGCAACCGGGCGAGACACAGTACGATGCGTGGGGAAAG
-GCGGTCAGCACCACGCAGGGCGGGCTGACGCGCAGTATGGAATTACGATGCTGCCGGACGTGTCATCAGCTGACCAACGAGAACGGCAGCCACAGCGTCT
-TCAGTTACGATGCGCTGGACCGGCTGGTACAGCAGGGCGGCTTTGACGGGCGGACGCAACGTTATCATTATGACCTGACCGGAAAACTCACACCAGAGTG
-AGGATGAGGACTTGTCATCCTCTGGTACTACGATGAATCGGACCGTATCACTCACCGCACGGTGAACGGCGAACCGGCAGAGCAGTGGCAGTATGATGGC
-ACAGCTGGCTGACAGACATCAGCCACCTGAGCGAAGGCCACCGTGTTGCCGTCCACTATGGCTATGACGATAAGGCCGCCTGACCG
->tig00000009 len=2712 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
-TACCAGGTCACTTGCGGTTTCCGTGACAGCGACATCCAGCCCGTCAGGTCCCGTTCACGCCGCCATACCCGTTTTGCCACCCTGCGGCCAGCGGGTCGTA
-AAGATAGCGACTTTCGACCAGCGGCTGCATATTGTGTCCGCGTGGCGAATTGCCAGCCGGTGCTGACTGTCGTAATGGTACCGGTGGGTGCGCTCATCAT
-CCGTGCGGATAAAACGCTTCCGGGATAAGGGTCAGTTTTCTCTGTCAGCCACCGTGACGGTCATACCGGTAAAGATAGTGCGCGTCACGGGTGATACGGT
-TATCCGGCCACATGCTGAGGGCGCTGTCAGGTCACCTTCCGGGTCGAACGACGGTTACCTGCCGGGTCTGTAGTATACGGGATGCGGATATCAGATTCGC
-TGCGGTGGTGTGAGCGCCGGTCAGCCTGCCGGAGTAGTGCTGTAGCTGTAACTCGGGTCTGGCGCGGGCTGCTGATTACGGATGAGTTCGCCGTTGTCGT
-TCCAGTGTAATCGCGGTCAGACAGCAGGCTGTTCAGGTGCTGGCTCTGTAACTGCCCGGCAGGGTATAAGCGGTGGTGAGTTCATAACGGCCGAAGCTGC
-GCAGCGTTTCCCGTGCAGGCGGTCGCGGGTGTACTCCACCAGCGGTGTGTCGCCGAGTTTCATGCCTGACAGCCAGCCGCTGCCGTAGGTCAGCCATTCC
-ACGGCAGGCAGGCTGTCCGGTATACAGCAGTTCGCCAGTCCTGTGCGTTGTACGCATGTCTGGTCTCATGCTGCCAGAGCAGTTCATTCGTCTGCGGATG
-ATGCACCGTCAGGTGTTCACTGGCAGAGGCAGCCTTTACTGTCATAACCATAGTGCACCGTCACCCGGTGCCCTTCGCTGATATGGCTGATGTCTGTCAG
-CCAGCCGCGTTCGTCATGCTGCCACCGCTCTGCGGTTTCGCCATTCACGGTGCGGTGCGTGAGGCGGTCTGCTTCGTCATAGTGCCAGTGGGTGACCAGC
-CCTCATCCTCGCTGCGGATAAGTTTGCCGGTCGGGTCATTAGTGATAACGCGCTGTGTGCGGCCGTCAAAGCCGGTTTCCTGTATCAGCCGGTCGAATTA
-CATCGTAACGGAAGGTGGTGTGGCCTTGTTTTCACTGGTCAGGCGGATGACCCGTCAGCAGCATCGTATTCCATACTGCGCGTCAGACCGCCCTGCGTGG
-TACAGATGGCTTTCCCCGCATCGTACTGTGTCCCGTTTCTGCTGCCGTCCGGGAGGGCAATGACGGTGGTCAGGTCACCGGCGGCGTTGTATTCATACCG
-CGTTTCATGGCCCTGCGTGTCTTCACGGCAATTAACTGTCCACGGCTGTCGTATGCGCGGTACTGACTCAGCCCTTCCTCGCGGTGCACCGCCGTCACCT
-GACAAAACGGTCATGGTCATAGCGGGTTACATAACCGGAACAGTCAGTGAAGCTCAGCAACTGACCGTAACGGCTCCACGTCATGGTTTTCCGGCTGCCG
-GTGGCATCTTCCGTTGCGCAGGGTAAGTCACTGTGTGGATTATCATAACGGTAGCGGGTGATATCGCCGTCAGGGGCAGTTTCCTGAATCAGACGGCCCC
-ATTCATCATATTCCCGGCGTATTTCCAGCCCGTCAGGCCGGTGGCTGACGTTAACTGGCTGTGGTGGTTATAGTAAAACGCCGATGCCCTGCCATCCGGC
-GTGGTGATGCGCGTGATGGGCCCGTCACCATCCGGACTGTATTCTGTTGTCCTGCCTGCGGCATCCGTCGCAATGCCCTGAGCCTGCCCACCGCGTCAAA
-CTGACTCTGCGTGACGCTGCCGTCCGCGTGTTCCTTTTCACCACCCGCTGCCCGCCTTCACCCTGCGTGTGCGGGACTTCACGGCAGTTCAGGCTGTCGG
-TGATGGTGATGCGGTCCTTCTCATACTGATACGTGTAACTTTAAGCTGCCGGGTTTAGCTGTTCTGTCACCCGCCCGTCGCTGTCGTAACGGTAACAGAT
-TTCCGGTCGGCCCGTGTGACGGTGCGCCACCATCCGGCCCCGGTATTTATCATCGTAAGTAAAGCTGCGCACCTGTATTGCTGCGGTCTACACCGCCGCT
-TCGCCGCGGGGCGTCAGCCATAGCGCACCAGCGGCGCGGCAGGTAAATTCTCCGGTATTCCGGGTCGTGCGTCAGCCACACGGCAGACAGACGGATGCCG
-TTGTCCCGGCCATATTCGGTGTAACCCGGCAGGGTATCAGGAAAAGCGGACGGTTCCGTCCGCCGGAAATGGCCTGCTGCCGGGCTTCTTCTGCCCGCTG
-CGCCTGCGTGGTCAGCCGAGTGACGCCCGGCACCATCCGTCGCGCCGGTGATTTCGCCGCTGAATTCACCGGCGGCTTCGCGGTGGAACGTCTGTGTGCG
-CCGAAGCGGTCCACCAGCCCGGTCAGTACCCGGTACGGCGGCGGCGGCGCAGGCAGCACCTCATCCGCTTCCGGCACCCGCTCACCAGCCGAGCAGCCAC
-CACGGCTGCGGACTGTTTGTCGCCAGATAACGATGCGGACTTAAGCGGGTTCTTCCGGCAGCGCCTGCCGGAGTGCGGCCGGTGACCTTCATCCAGTTCG
-CCACGCCGCCGCGCACCATACAGTGACTCGCTGCGGCAACCGTCCTCACCGGGAAACAGGTGCTCAAAATACAGGCTTCTGCCGCCGTTATCACTGGTAT
-CAGTGTGTTATC
->tig00000010 len=4686 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
-CAATGACCTTTGCAGGCGACACACCGCAGCTGGCGAACGTCAAAGCGGTGGATGATATCTACCCGATGTATGGCGATCTGCAAACTAATCCCCTGGCCTG
-AAACCGCAGGCGGGCAGCGTATTGCTGGCCCCACGCCTGATGGCACTGCTTAACCTGAAAACGGGCGACACCATTGGCGTGGGCGATGCCACCTTGCGGA
-TTGCCGGAGAAGTGATTCAGGAACCGGATTCCGGTTTTAACCCCTTCCAGATGGCTCCGCGTCTGATGATGAATCTGGCGGATGTCGATAAAACCGGAGC
-CGTGCAGCCGAGGAGTCGGGTCACCTGGCGTTATAAATTCGGCGGCAACGAGAACCAGCTCGACGGCGAGAATGGTTGTTACCTCAGCTTAAACCCGAAC
-AACGCTGGTACGGTCTGGAACAGGACGAAGAGGCGCGCTGGGGCGATCGATGGAACGCTCGCAACAGTTCCTGCTGCTTTCGGCGCTTCTGACCTTGCTG
-CTGTGGCAGTGGCGGTGGCGGTAGCGATGAATCATTACTGTCGCAGTCGCTACGATCTGGTGGCGATCCTCAAAACGCTGGGGGCAGGGCGAGCGCAACT
-GCGTAAGCTAATCGTCGGTCAGTGGTTGATGGTGCTGACGCTTTCAGCCGTTACCGGTGGGGCCATAGGCCTGTTGTTCGAAACGTGTTGATGGTGCTGC
-TCAAGCCCGTTCTGCCTGCTGCACTACCGCCAGCCAGCCTCTGGCCGTGGCTGTGGGCGCTTGGCACCATGACGGTCATCTCGCTGCTGGTGGGGCTACG
-ACCATATCGCTTGTTGCTGGCAACGCAGCCTTTACGCGTATTACGTAATGATGTGGTAGCGAACGTCTGGCCGCTGAAGTTTTATCTGCCGATTGTCAGT
-GTGGTGGTTGTGCTGCTGCTCGCCGGATTAATGGGTGGCAGCATGCTGCTTTGGGCGGTGCTGGCGGGCGCGGTAGTACTGGCTTTGCTGTGCGGTGTGC
-TGGGCTGGATGCTGCTGAATGTACTTCGCCGCATGACGCTGAAATCGCTGCCTCTGCGCCTGGCGGTTAGCCGCCTGTTACGTCAGCCGTGGTCAACGTT
-AAGTCAGCTTTCGGCATTTTCGCTCTCCTTTATGCTGCTGGCACTGCTGCTGGTGTTGCGTGGCGATCTGCTCGACCGCTGGCAGCAGCAGCTACCTCCA
-GCCCGAACTACTTTTTAATTAACATCGCCAGGAACAGGTAGCACCGCTAAAGGGCGTTCCTCGCGGAACATCAGATAGTCGGAATCGTTTTATCCGGTGG
-TGCGGGCGCGGCTGACGGCGATTAACGATAAGCCGACAGAAGGTAATGAATGAGGCGCTTAACCGCGAACTCAATCTTACCTGGCAAAATACGCGGCCCG
-ATCATAATCCGATTGTCGCCGGTAACTGGCCGCCAAAAGCCGATGAAGTGTCGATGGAAGAGGGGCTGGCGAAACGCAAACGTTGCCCTCGGTGATACCG
-TGACTTTTATGGGCGATACCCAGAGTTCCGCGCTAAAGTGACCAGCCTGCGCAAAGTGGACTGGGAAAGTCTGCGGCCTAATTTCTATTTTATTTTCCCT
-GAAGGGGAGATTAGACGGGCAACCGCAGAACTGGCTTACCAGTTTCCGCTGGGAGAATGGCAACGGCATGTTGACACAACTCAACCGCCAGTTCCCGACC
-ATTAGCCTGTTAGATATTGGCGCGATTTTAAAACAGGTCGGTCAGGTGCTGGAGCAGGTAAGTCGGGCGCTGGAAGTGATGGTGGTACTGGTCACCGCCT
-GCGGTATGTTGCTGTTGCTGGCACAGGTGCAGGTGGGAATGCGTCAGCGTCATCAGGCTGGTGGTGGTGGCGCACACTCGGTGCGGGAAAAACTGCTGCG
-TACCACGTTGTGGTGTGAGTTCGCCATGCTTGGGTTTGTTTCCGGCCTGGTGGCCGCAATTGGTGCGGAAACGGCGCTGGCAGTGTGTTGCAGGCGAAAG
-TGTTTGATTTTCCGTGGGAGCCAGACTGGCGATTGTGGATTGTTCTGCCGTGCAGCGGAGCGCTGCTGCTGTCGCTTTTCGGCGGCTGGCTGGGTGCGCG
-ACTGGTTAAAGGGTAAGGCGCTGTTCAGGCGGTTTGCGGGGGTGATGAGAGTAAATAAGGGCGTTCTGGTTGAATGGAACGCCTTGTTTAAATTAATTCT
-ACAATATGTTTCGTGATGATGTTATTGAATTGGTGATTTCTATCTTTCTATTGCTGATATTAATCTGAATCGGTGGAGTTTATTGATTTTAAATATAGCC
-CTACAAAATAACTCAGACTAATAAAATCATAAATCATATGCGTTGAATGGATATTATCCATATAGTGAATTTGTTGATGAATTCATCTGTGTAAAAATGT
-TAGTTTAATAAAATATTGAAAGTGACCTGTAATAACAGTTGTTGTTGATTGAGAACAAATAAGTTTGTGTGAAAAATATATAAATACATTAGCTGGTCTT
-GTGTGTCATTTTATTTTTGTTGCTAACACAGGGATATGAACAATAACTAAAAAGGCACTTTATGAGCGGAAAACCAGCGGCGCGTCGGGAGATATGACTC
-AGTATGGCGGTCCCATTGTCCAGGGTTCGGCAGGTGTAAATTGGCGCGCCCACCGGCGTGGCGTGCTCGGTGTGTCCGGGCGGGATGACTTCCGGGCAAC
-CCGGTAAATCCGCTGCTGGGAGCGAAGGTGCTGCCCGGCGAGACGGACCTTGCGCTGCCCGGCCCGCTGCCGTTCATTCTCTCCCGCACCTACAGCAGCT
-ACCGGACGAAGACGCCTGCACCGGTGGGCGTTTTCGGCCCCGGCTGAAAGCGCCTTCTGATATCCGCTTACAGCTACGTGATGACGGACTGATACTCAAC
-GACAACGGCGGGCAGACATTCACTTTGAGCCGCTGCTGCCGGGAGGCGGTGTACAGCCGCAGTGAGTCAATGTGGCTGGTGCGCGGTGGTAAGGCAGCAC
-AGCCGGACGGCCCATACGCTGGCGCGGCGTGGGGGCGCTGCCGCCGGATATCCCGGTAAGCCCGCATCTTTACCTGGCGACCAACAGCGCACAGGCCGTG
-GTGAATACTGGGGTGGTCTGAGGCAGCGGTGCCGGGTGCTGAGGACGTACTGCCAGCGCCGCTGCCGCCGTACCGGTGCTTACCGGGATGGCGGACCGCT
-TCGGGCGGACGCTGACGTACCGGCGTGAGGCCGCCGGTGACCTGGCCGGGAAATCACCGGCGTGACGGACGGTGCCGGGCGGGAGTTCCGTCTGGTGCTG
-ACCACGCAGGCGCAGCGTGCGGAAGAGGCCCACACTCTTCGCTATCTTCTTCTGACAGTTCGCCCTCTCTCAGCCTCAGCGTTCCCCGACACACTGCCCG
-GTACCGAATACGGCCCCGACAGGGTATCCGCCTTTCGGCGGTGTGGCTGATGCACGACCCGGCATACCCGGAGAACCTGCCCGCTGCCGCCACTGGTGCG
-GTACACGTATACGGAAGCCGGTGAACTGCTGGCGGTATATGACCGCAGCAATACGCAGGTGCGCGCTTTCACGTATGACGCGCAGCACCCGGGCCGGATG
-GTGGCGCACCGTTACGCGGGAAGGCCGGAGATGCGCTACCGCTACGACGATACGGGGCGGTGGGTGGAGCAACTGAACCCGGCAGGGTTAAGCTACCGCT
-ATCTTTATGAGCAGGACCGCATCACCGTCACCGACAGCCTGAACCGGCGTGAGGTGCTGCATACAGAAAGGCGGGGCCGGGCTGAAACGGGTGGTGAAAA
-AGAACTGGCGGACGGCAGCGTCACGCGCAGCAGGTATGACGCGGCAGGAAGGCTCACGGCGCAGACGGACGCGGCGGACGGAGGACAGAGTAGGTCTGAA
-TGTGGTGTCCGGCGATATCACGGACATCACCACACCGGACGGGCGGGAGACGAAATTTTACTATAACGACGGGAACCAGCTGACGGCGGTGGTGTCCCCG
-GACGAAGCTGGAGAGCCGCCGGGAATATGATGAACCGGGCAGGCTGGTATCGGAGACATCGCGCAGCGGGGAGACAATACGCTACCGCTACGATGACGCG
-CACAGTGAGTTACCGGCGACGACAACGGATGCGACGGGCGCACAACAGATGACCTGGAGCCGCTACGGGCGGTTGCTGGCGTTCACCGACTGCTCGGCTA
-CCAGACCCGTTATGAATACGACCCTTCGGCCAGGATGACGGCGGTCCACCGCGAAGGCATCAGCCTTTACCGCCGCTATGACAACCGTGGCCGGTTAACC
-TCGGTGAAGACGCACAGGGCCGTGAACGCGGTATGAATATAACCGCAGGCGACCTGACTACCGTTATCACCCCGGACGGCAACCGGGCGAGACACAGTAC
-GATGCGTGGGGAAAGGCGGTCAGCACCACGCAGGGCGGGCTGACGCGCAGTATAGGAGTACGATGCTGCCGGACGTGTCATCAGCCTGACCAACGAGAAC
-GGCAGCCACAGCGTCTTCAGTTACGATGCGCTGGACCGGCTGGTACTGCGGGGCGGCTTTGACGGGCGGACCTGGCGTTATCATTATGACCTGAGCCGGA
-AAACTCACACCAGAGTGAGGATGAGGACTTGTCATCCTCTGGTACTACGATGAATCGGACCGTATCACTCACCGCACGGTGAACGG
->tig00000011 len=5118 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
-TTTGCAGGCAGACGTATTTGCATTAACAATGGTTCAGCGTTGGCGGCTTTGACATCCTGCAAAATCTGGCGCAGCGTTTGCTCGGTTTGCTGTGGCTGAA
-AACCACGCAAACCGTCATTGCCGCCAGTTCAACCAGCACCCAACGCGGCTGATGCTGTTTCAGCAGAGCCGGAAGGCGCGCCAGTCCTTGTTGCGAGGTG
-TCGCCGCTGATGCTGGCATTAACTACCGACGTTTTACTCTGCCACTTATCATTCAACAAGGCAGGCCAGGCCGCGCTGGCAGACATTCGATACCCGGCGC
-TCAGGCTATCACCCAGAATCAATAACGTGTCCGCTGCGGCGCTACGGAAAGTTAACTGGGACCAGGAACAGGAAGGGCAAATGCCAGCGGAAAACATTGT
-TGAAGTTCATCATCTTAAGAAGTCCGTCGGTCAGGGGCATGAACTCTCCATCCTCACCGGAGTTGAGCTGGTTGTCAAACGGCGAGACCATCGCACTGGT
-GGGCGAGTCGGGATCGGTAAGTCAACCTTGCTGGCGATCCTCGCCGGGCTTGATGACGGCAGCAGTGGCGAAGTGAGTCTGGTGGGACAACCGCCACATA
-ATATGGACGAAGCGCGGGCAAAGTTGCGCGCGAAGCACGTCGGCTTTGTTTTCAGTCATTTATGTTAATTCCTACCCTTAACGCGCTGGAAAACGTCGAG
-CTTCCGCCCTGCTGCGCGGTGAGTAGCGCGGAAAGTCGTAACGGGGCGAAAGCGTTGCTCGAACAGTTAGGGCTGGGTAAACGTCTGGATCATCTTCCGG
-CACAGCTTTCCGGCGGTGAACAGCAACGAGGAAGCGCTGGCACGAGCCTTTAATGGTCGACCTGATGCTGTTTGCCGACGAACCCACGGCAACCTTGACC
-GCCAGACGGGCGATAAAATTGCCGACCTGCTGTTTTCCCTCAACCGTGAACATGGCACCACGTTGATTATGGTGACCCACGACCTGCAACTGGCGGCACG
-CTGCGACCGCTGCTTACGGCTGGTGAACGGGCAGTTGCAGGAGGAAGCATGATTGCACGTTGGTTCTGGCGCGAATGGCGTTCGCCGTCGCTATTAATTG
-TCTGGCTGGCGCTAAGCCTGGCGGTGGCCTGCGTGCTGGCGCTGGGCAATCAGCGATCGCATGGAGAAGGGCTTAGCCAGCAAAGCCGTGAGTTTATGGC
-GGGCGATCGGGCGTTGCGCAGTTCACGCGAAGTGCCGCAAGCGTGGCTGGAGGAAGCGCAAAAGCGCGGCCTGAAAGTCGGCAAAGCTGACTTTCGCCAC
-AATGACCTTGCAGGCGACACACCGCAGCTGGCGAACGTCAAAGCGGTGGATGATATCTACCCGATGTATGGCGATCTGCAACCAATCCCTGGCCTGAAAC
-CGCAGGCGGGCAGCGTATTGCTGGCCCCACGCCTGATGGCACTGCTTAACCTGAAAACGGGCGACACCATTGACGTGGGCGATGCCACCTTGCGGATTGC
-CGGAGAAGTGATTCAGGAACCGGATTCCGGTTTTAACCCCTTCCAGATGGCTCCGCGTCTGATGATGAATCTGGCGGATGTCGATAAAACCGGAGCCATT
-ACAGCCGGGGAGTCGGGTCACCTGGCGTTATAAATTCGGCGGCAACGAGAACCAGCTCGACGGCTATGAGAAATGGTTGTTACCTCAGCTTAAACCCGAA
-CAACGCTGGTACGGTCTGGAACAGGACGAAGGCGCGCTGGGGCGATCGATGGAACGCTCGCAACAGTTCCTGCTGCTGGCGCTTCTGACCTTGCTGCTGG
-CAGTGGCAGCGGTGGCGGTAGCGATGAATCATTACTGTCGCAGTCGCTACGATCTGGTGGCGATCCTCAAAACGCTGGGGGCAGGGCAGGCGCAACTGCG
-TAAGCTAATCGTCGGTCAGTGGTTGATGGTGCTGACGCTTTCAGCCGTTACCGGTGGGGCCATAGGCCTGTTGTTCGAAAACGTGTTGATGGTGCTGCTC
-AAGCCCGTTCTGCCTGCTGCACTACCGCCAGCCAGCCTCTGGCCGTGGCGTGGGCGCTTGGCACCATGACGGTCATCTCGCTGCTGGTGGGGCTACGACC
-ATATCGCTTGCTGCTGGCAACGCAGCCTTTACGCGTATTACGTAATGATGTGGTAGCGAACGTCTGGCCGCTGAAGTTTTATCTGCCGATTGTCAGTGTG
-GTGGTTGTGCTGCTGCTCGCCGGATTAATGGGTGGCAGCATGCTGCTTTAGGCAGTGTGCTGGCGGGCGCGGTAGTACTGGCTTTGCTGTGCGGTGTGCT
-GGGCTGGATGCTGCTGAATGTACTTCGCCGCATGACGCTGAAATCGCTGCCTCTGCGCGCCTGGCGGTTAGCCGCCTGTTACGTCAGCCGTGGTCAACGT
-TAAGTCAGCTTTCGGCATTTTCGCTCTCCTTATGCTGCTGGCACTGCTGCTGGTGTTGCGTGGCGATCTGCTCGACCGCTGGCAGCAGCAGCGCTACCTC
-AAGCCCGAACTACTTTTTAATTAACATCGCCACAGAACAGGTAGCACCGCTAAAGCGTTCCTCGCGGAACATCAGATAGTCCCGGAATCGTTTTATCCGG
-TGGTGCGGGCGCGGCTGACGGCGATTAACGATAAGCCGACAGAAGGTAATGAAGATGAGGCGCTTAACCGCGAACTCAATCTTACCTGGCAAAATACGCT
-GGCCCGATCATAATCCGATTGTCGCCGGTAACTGGCCGCCAAAAGCCGATGAAGTGTCGATGGAAGAGGGCTGGCGAAACGCAAACGTTGCCCTCGGTGA
-TACCGTGACTTTATGGGCGATACCCAGGAGTTCCGCGCTAAAGTGACCAGCCTGCGCAAAGTGGACTGGGAAAGTCTGGCCCTAATTTCTATTTTTATTT
-TCCCTGAAGGGGCATTAGACGGGCAACCGCAGACTGGCTTACCAGTTTCCGCTGAGAATGGCAACGGCATGTTGACACAACTCAACCGCCAGTTCCCGAC
-CATTAGCCTGTTAGATATTGGCGCGATTTTTAAAACAGGTCGGTCAGGTGCTGGAGCAGGTAAGTCGGGCGCTGGAAGTGATGGTGGTACTGGTCACCGC
-CTGCGGTATGTTGCTGTTGCTGGCACAGGTGCAGGTGGGAATGCGTCAGCGTCATCAGGAGCTGGTGGTGTGGCGCACACTCGGTGCGGGAAAAACTGCT
-GCGTACCACGTTGGTGTGAGTTCGCCATGCTTGGGTTTGTTTCCGGCCTGGTGGCCGCAATTGGTGCGGAAACGGCGCTGGCAGTGTTGCAGGCGAGTGT
-TTGATTTTCCGTGGAGCCAGACTGGCGATTGTGGATTGTTCTGCCGTGCAGCGGAGGCGCTGCTGCTGTCGCTTTCGGCGGCTGGCTGGGTGCGCGACTG
-GTTAAAGGGTAAGGCGCTGTTCAGGCAGTTTGCGGGGGTGATGAGTAAATAAGGGGCGTTCTGGTTGAATGGAACGCCTTGTTTAAATTAATTCTACAAT
-ATGTTTCATTGATGATGTTATTGAATTGGTGATTTCCTATCTTCTATTGCTGATATTAATCTGAATCGGTGGAGTTTATTGATTTTAAATATAGCCCTAC
-AAAAATAACTCAGACTAATAAAATCATAAATCATATGCGTTGAATGGATATTATCCATATAGTGAATTTGTTGATGAATTCATCTGTGCTAAAATGTTAG
-TTTAATAAAATATTGAAAGTGACCTGTAATAACAGTTGTTGTTGATTGAGAACAAATAAGTTTATGTGAAAAATATATAAATACATTAGCTGGTCTTGTG
-TGTCATTTTATTTTTTGTTGCTAACACAGGATATGAACAATAACTAAAGGGCACTTTATATGAGCGGAAAACCAGCGGCGCGTCAGGGAGATATGACTCA
-GTATGGCGGTCCCATTGTCCAGGTTCGGCAGGTGTAAGACTTAGCGCGCCCACCGGCGTGGCGTGCTCAGTGTGTCCGGCGGGATGACTTCGGGCAACCC
-GGTAAATCCGCTGCTGGGGGCGAAGGTGCTGCCCGGCGAGACGGACCTTGCGCTGCCCGGCCCGCTGCCGTTCATTCTCTCCCGCACCTACAGCAGCTAC
-CGGACGAAGACGCCTGCACCGGTGGGCGTTTTCGGCCCCGGCTGAAAACGCCTTCTGATATCCGCTTACAGCTACGTGATGACGGACTGATACTCAACGA
-CAACGGCGGGCGGAGCATTCACTTTGAGCCGCTGCTGCCGGGGAGGCGGTGTACAGCCGCAGTGAGTCAATGTGGCTGGTGCGCGGTGGTAAGGCAGCAC
-AGCCGGACGGCCATACGCTGGCGCGGCTGTGGGGGCGCACCGCCGGATATCCAGTTAAGCCCGCATCTTTACCTGGCGACCAACAGCGCACAGGGGCCGT
-GGTGACTGGGGTGGTCTGGCGGGTGCCGGGTGCTGAGGACGTACTGCCAGCGCCGCTGCCGCCGTACCGGGTGCTTACCGGGATGGCGGACCGCTTCGGG
-CGGACGCTGACGTACCGGCGTGAGGCCGCCGGTGACCTGGCCGGGGAAATCACCGGCGTGACGGACGGTGCCGGGCGGGAGTTCCGTCTGGTGCTGACCA
-CGCAGGCGCAGCGTGCGGAAGAGGCCCACCCTCTTCGCTATCTCCTTCTGACAGTTCCCGCCCTCTCTCAGCCTCAGCGTTCCCCGACACTGCCCGGTAC
-CGAATACGGCCCCGACAGGGTATCCGCCTTTCGGCGGTGTGAAGCTGATGCACGACCCGGCATACCCGGAGAGCCTGCCCGCTGCGCCACTGGTGCGGTA
-CACGTATACGGAAGCCGGTGAACTGCTGGCGGTATATGACCGCAGCAATACGCAGGTGCGCGCTTTCACGTATGACGCGCAGCACCCGGGCCGGATGGTG
-GCGCACCGTTACGCGGGAAGGCCGGAGATGCGCTACCGCTACGACGATACGGGGCGGGTGGTGGAGCAACTGAACCCGGCGGGTTAAGCTACCGCTATCT
-TTATGAGCAGGACCGCATCACCGTCACCGACAGCCTGAACCGGCGTGAGGTGCTGCATACAGAAGGCGGGGCCGGGCTGAAACGAGGTGGTGAAAAAGAA
-CTGGCGGACGGCAGCGTC
->tig00000012 len=2176 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
-AACATAAAAACAGCACCGCCAGCCCCAGCATGTTCAGGCCGAGAATGGCACAAAGATATTGCTTCCAGTTCATCTCACGGTCAGAGACGCCAAGTGCGCG
-AAAAAGTACGCGCTCAACGCCCGTTGTACCGGAAGAGGAATGTCATTAATCAACCGCGCCAGCCCGCTGCCTAAAGGACGCGCCAGCACACCATTAACAC
-CAGTAAAAACGTGGCGATCAGTAAGAACCCTTGCGCAGCCATCAGAACGCCTCCGCATTGATCAGGGCATAAACCAGATAACCCAGTAATAAAAGCACCA
-GCAATACGCCGGTTATCACGCCTGCACTCACAGTGCACCTCCAGTGGCCTAAAAGTGATACCGGAAGGTAGAATTCTGGCTGCAAAGATTTCGCAAAATC
-TGCGGGCGGGGTGTAAAAGTATAAAAATGGCAAAAAGCCATGATTTAACTAATGTTTAGTATTAATTTAACTTTGTGTAACTTAATTGCAGGATGAATGT
-AAATAAACCATCAATAAGCAAAAATAAGTGGTCGGATGAGTAGTAAAATGCACAAAGGCGGTACTATTTCTGCATCAGATAAACAAATTCATTTTTCCGG
-TGCCATTCACCGGGTAGATACAAAGGGGGAGAAAAGTATGGAACTCTGCAGAGAATATCTGCATGGCTTATCTTTACGCCATTACTTATGCGGTTGCAGC
-GGGCGTTCTGGCGCTGCCCTTTCATGCTTTTCTGGAAAGACCGCGCCCGCTTTACAGCTACCTGCATCGCGTCTGGCAGAAACCAGCGATAAACCGGTGT
-GGATGGATCAGGCCGAAAAGGCGGCTGGTGATTTTATTGATTGCTGAGTTTGAATGCATTGAAACCGCCAGCGGAAACGCTGGCGGTTTTTTATCAGGAA
-GATGTTCAGAGGAATATTTAGACATCGTTATACCAATCGAAACATATATTCATGGAAATATATATAAATATTTTCCTAATTGTTCTTATCGACAGATATC
-TCGCCAGGCTTTCTTATAAATCTGTAGGGTTTCGCCCTGTCGGCATAAAATAACCCGATAAAACAAGGATGAGCAGATGAGCGGAAAACCGGCGGCGCGT
-CAGGGCGACATGACGCAGTATGGCGGTAGCATTGTCCCAGGGTTCAGCCAGGGTACGCATCGGTGCCCCACCGGCGTGGCCTGTTCGGTGTGCCCGGCGG
-GTGACGTCCGGCCATCCGGTCAATCCGCTGCTCGGTGCAAAGGTCCTTCCGGTGAAACCGACATCGCCCTGCCCGGCCGCTGCCGTTCATTTCTCTCCAC
-TAGCAGTTACCGGACAAAACGCCCGCGCCGGTGGGGAGCCTCGGCCCCGGCTGGAAAATGCCTGCGGATATCCGCTTACAGCTGCAAGATAACACACTGA
-TACTCAGTGATAACGGCGGCAGAAGCCTGTATTTTGAGCACCTGTTTCCCGGTGAGGACGGTTACAGCCGCAGCGAGTCACTGTGGCTGGTGCGCGGCGG
-CGTGGCGAAACTGGATGAAGGTCACCGGCTGGCCGCACTCTGGCAGGCGCTGCCGGAAGAACTCGCTTAAGTCCGCATCGTTATCTGGCGACAAACAGTC
-CGCAGGGCCGTGGTGGCTGCTCGGCTGGTGTGAGCGGGTGCCGGAAGCTGATGGGGTGCTGCCTGCGCCGCTGCCGCCGTACCGGGTACTGACCGGGCTG
-GTGGACCGCTTCGGCGCATTACAGACGTTCCACCGCGAAGCCGCGGTGAATTCAGCGGCGAAATCACCGGCCCGTGACGGATGGTGCCGGGCGTCACTTC
-CGGCTGGTACTGACCGCAGGCGCAGCGGGCAGAAGAAGCCCGGCAGCAGCCATTTCCGGCGGACGGAACCGTCCGCTTTTCCCGATACCCTGCGGGTTAC
-ACCGGAATATGGCCGGGACAACGGCATCCGTCTGTCTGCCGTGGGCTGACCCCGCACGACCCGGAATACCCGGAGAATTTACCCCTGCCGCGCCGCTGGT
-GCGCTATGGCTGGACGCCCGCGAACTGGCGGCAGTGTATGACCGCAGCAATACACAGGTGCGCAGCTTTACTGATGATAAAATACCGGGGCCGGATGGTG
-GCGTACCGTCACACGGGCCGACCGGAAATCTGTTACCGTTACGACAGCGACGGGCGGGTGACAGAACAGCTAAACC
->tig00000013 len=6987 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
-AATTCTACCCTTCCGGTATCACTTTTAGGCCACTGGAGGTGCACTGTGAGTGAGGCGTGATAACCGGCGTATTGCTGGTGTTTTATTGCTGGGTTATCTG
-GTTTTATGCCTGATCAATGCGGAGGCGTTCTGATGGCTGCGCAAGGTTCTTACTGATCGCCACGTTTTTACTGGTGTTGGTGCTGGCGCGTCCTTTGGGC
-AGCGGGCTGGCGCGGCTGATTAATGACATTCCTCTTCCCGGTACAGCGGGCGTTGAGCGCGTACTTTTTCGCGCACTTGGCGTCTCTCTGACCGTGAGAT
-GAACTGGAAGCAATATCTTTGTGCCATTCTCGGCCTGAACATGCTGGGGCTGGCGGTGCTGTTTTATGTTGCTCGGTCAGCACTGGCATCACCCTTCCAT
-AATCCACAGCAGTTGCCAGGGCTGTCGTGGGATCTGGCGCTGAATACCGCCGTCAGCTTTGTCACCAATACCAACTGGCAATCTTATAGCGGTGAAACCA
-CGTTGAGCTATTTCAGCCAGATGGCGGGCTTAACGGTGCAAAACTTTCTTTCTGCCGCCAGCGGGATTGCGGTGATTTTTGCCCTCATCCGTGCGTTTTA
-CCCGCCAGAGCATGAGCACGCTCAGGAATGCCTGGGTCGATCTGCTACGCATCACGTTATGGGTGCTAGTCCCTGTGGCGTTGTTGATTGCACTGTTTTT
-ATTCAACAAGGTGCGCTGCAAAACTTTCTGCCTTATCGAACTGTGAATACCGTTGAAGGAGCGCAACAGCTGTTACCCATGGGGCCTGTAGCTTCTCAGG
-AAGCGATCAAGATGCTCGGTACTAACGGCGGTGGCTTCTTTAATGCCAACTCGTCGCATCCGTTTGAAAACCAACCGCACTGACCAACTTCGTGCAGATG
-CTGGCGATCTTCTTGATCCCAACGGCGCTGTGCTTTGCCTTTGGTGAAGTGATGGGCGATCGCCGCCAGGGGCGCATGTTGCTAATGGGCGATGTCAGTG
-ATTTTGTCATCTGCGTAGGCGTGGTGATGTGGGCAGAAGTTCAGGGTAATCCTCATCTGCTGGCACTGGGCACGGACAGCAGCATCAATATGGAAGGTAA
-AGAGAGCCGTTTCGGCGTGCTGGTCAGTAGCCTGTTTGCGGTCGTGACGACGGCGGCTTCCTGTGGCGCGGTGATTGCGATGCATGATTCGTTTACCGCT
-CTCGGTGGCATGGTGCCGATGTGGCTGATGCAAATTGGTGAAGTGGTGTTCGGCGGTGTCGGTTCTGGTCTTTACGGCATGATGCTGTTTGTCCTGCTGG
-CGGTGTTGTGCCGGGCTGATGATTGGTCGTACACCGGAATATCTGGGTAAAAAATCGACGTACGCGAGATGAAACTGACTGCACTGGCAATTCTGGTTAC
-CCCGACGCTGGTGCTGATGGGCGCGGCGTTGGCGATGATGACCGACGCCGGACGTAGCGCCATGCTCAACCCTGGCCCGCATGGTTTTGCGAAGTGCTGT
-ACGCCGTGTCATCCGCCGCTAACAACAACGGCAGCGCCTTTGCCGGATTAAGCGCCAACTCTCCGTTCTGGAACTGTTTACTGGCGTTCTGCATGTTTGT
-CGGTCGCTTCGGGTGATTATCCCGGTGATGGCAGTGCCGGTTCGCTGGTGAGTAAAAGAGCCAAGCCGCCAGCTCCGGCACGCTGCCAACGCACGGCCCG
-CTGTTTGTTGGCCTGTTAATCGGCACCGTGTTGCTGGTTGGCGCACTGACCTTTATCCCTGCCCTGGCGCTTGGTCGGTGTGGAATATCTCTCCTGATGA
-TATTGGTGAGCACTGAATATGAGTCGTAAACAACTGGCGCTATTCGAGGCCAACACTTGTCGTTCAGGCGCTGAAAGAAGCGGTGAAAAAATTAAACCCG
-CAGGCGCAATGGCGCAATCCGGTGATGTTTATCGTCTGGATCGGCAGTCTGCTGACCACCTGTATTAGCATCGCGATGGCAAGCGGTGCGATGCCCGACA
-ATGCGCTGTTTAGCGCGGCCATTAGCGGTTGGCTGTGGATCACCGTACTGTTCGCTAATTTCGCCGAGGCGCTGGCGAAGGCCGCAGTAAAGCGCAGGCC
-AACAGTCTGAAGGGGTGAAAAACTGCCTTTGCCCGCAAGCTGCGTGAGCCGAAATATGGCGCTGCGGCGGACAAAGTTCCTGCCGACCAACTTCGTAAAG
-GCGATATCGTACTGGTAGAAGCTGGCGATATTATCCCCTGCGATGGTGAAGTTATTGAAGGGTGCATCGGTCGATGAAAGCGCCATCACCGGGAATCGGC
-ACCGGTGATCCGTGAATCCGGCGATTTTGCCTCCGTCACCGGCGGCACGCGTATTCTTTCTGACTGGCTGGTGATTGAGTGTAGCGTTAACCCCGGCGAG
-ACATTTCTGGATCGGATGATCGCGATGGTGGAAGGCGCACAGCGACGCAAAACGCCGAACAAAATTGCCTGACCATTCTGCTGATTGCCCTGACTATCGT
-CTTTTACTGGCAACCGCCACGCTGGGCCGTTTTCCGCGTGGGGCGGTAATGCAGTCAGCGTAACGGTACTGGTGGCGCTGCTGGTCTGTCTGATCCCAAC
-CACTATTGGCGGCCTGTTGTCAGCGATCGGCGTCGCCGGGATGAGCCGGATGCTAGGCGCGAATGTGATTGCCACCAGCGGACGTGCAGTTGAAGCGGCA
-GGTGACGTTGACGTTCTGCTACTGGATAAAACCGGCACCATCACACTCGGTAACCGTCGGGCGTCGAGTTTATCCCCGCGCAGGGGCGTGGATGAAAAAC
-GCTGGCTGACGCCGCACAACTGGCTTCGCTGGCTGATGAAACGCCGGAAGGCCGCAGTATTGTGATCCTCGTAAAGCAGCGTTTTAACCTGCGCGAGCGC
-GATGTACGAGTATCCATGCCACCTTTGTACCGTTTACTGCGCAAAGCCGGATGAGCGGGATCAACATCGACAACCGCATGATCCGTAAAGGTTCTGTCGA
-TGCCATTCGTCGCCATGTTGAGGCTAACGGTGGTCACTTCCTACCGATGTTGATCAAAAGTCGATCAGGTTGCGCGTCAGGAGCCACGCCGCTGGTGGTG
-GTGGAAGGTTCTCGTGTGCTGGGCGTTATTGCGCTGAAGATATCGTCAAAGGCGGTATTAAAGAGCGCTTCGCCCAGCTGCGCAAAATGGGCATTAAAAC
-GGTGATGATTACCGGCGATAACCGTCTGACTGCCGCCGCGATTGCTGCGGAAGCGGGTGTCGATGATTTTCTCGCCGAAGCGACACCGGGGCCAAGCTGG
-CATTGATCCGTCAGTATCAGGCGGAAGGTCGTTTGGTAGCGATGACCGGCGACGGCACCAACGATGCTCGGCGCTGGCGCAGGCGAATGTCGCGGTGGCG
-ATGAACTCCGGCGCAGGCGGCGAAAGGCGGGCAATATGGTCGATCTCGACTCTAACCCGACCAAGTTGATCGAGGTGGTGCACATTGGCAAACAGATGCT
-GATGACCCGTGGCTCGCTGACCACCTTCAGCGTACCAACGATGTGGCGAAATACTTCGCCATTATTCCGGCGGCATTCGCGGCAACGTATCCGCAGTTAA
-ATGCGCTGAACATCATGTGCTGCATTCGCCCGACTCCGCAATCCTCGGTGCGGTGATTTTCAACGCCTTGATTATCGTCTTTTTGATTCCCCTGGCGTTA
-AAGGCGTGAGTTATAAACCGCTTACCGCTTCTGCCATGTTGCGCCGTAACTTATGGATTTACGGTCTGGGTGGGCTGCTGGTGCCGTTTATCGGTATCAA
-AGTCATTGATTTACTGCTGACCGTTTGCGGTCTGGTGTGAGGTTTACCATGAGTGGATTACGTCCGGCATTATCAACATTTATCTTTCTGTTATTGATTA
-CTGGCGGCGTTTACCGCTGCTGACCACCGTACTGGGGCAATGGTGGTTTCCCTGGCAGGCCAATGGTTCGTTGATTCGTGAAGGTGATACGGTGCGCGGT
-TCGGCATTAATCGGGCAGAATTTTACCGGCAGCTGTTTTCATGGTCGCCCGTCAGCAACAGCAGAAATGCCTATAATCCACAGGCTTCTGGCGGGAGCAA
-TCTGGCAGTCAGTAACCTGAGCTGGATAAACTAATAGCCGCACGCGTTGCTGCATTACGGGCCGCTAACCCGGATGCCAGCGCAGGCGTTCCAGTTGAAC
-TGGTGACGGCATCGGCAAGCGGGCTGGACAATAATATCACCCGCAAGCGGCGGCCTGGCAAATCCACGCGTGGCGAAAGCGCGTAATCTCAGCGTTAGAA
-CAGCTCACGCAACTGATCGCAAAATACAGCCAACAACCGCTGGTGAAATATATCGGCCAGCCGGTTGTCAACATTGTTGACTCAATCTGGCGCTGGATAA
-ACTTGATGAATAACGAACCCTTACGTCCCGACCCCGATCGTCTGCTGGAACAAACTGCCGCGCCGCATCGGGAAGCTGAAAAGTTTCTTCGGTGCCTGTG
-CAGGCGTCAGGAAGACCTGGGCGATGCTGGCAGAAGCCCAGCGACTGCAAAGGGCTGGATATTGTGGTTGGCGTGGTAGAAACCCACGGGCGAAAGATAC
-CGCCGCCATGCTGGAAGGGCTGGCTGTTCTGCCGTTAAAACGCCAGGCGTACCGTGGGCGGCATATCAGCGAGTTTGATCTCGATGCCGCCCTCGCCCGC
-CGCCCGGCGCTGATCTTAATGGACGAACTGGCGCACAATGTGCGCCAGGTTCCCGTCATCCCAAACGCTGGCAGGATATCGAAGAACTGCTGGAAGCTGG
-CATTGATGTTTTCACTACCGTCAGCGTTCAGCATCTGGAAAGTCTGAATGATGTGGTCAGCGGCGTCACCGGAATTCAGGTACGGGAAACCGTGCCCGAT
-CCTTTTCGATGCCGCCGACGACGTGGTGCTGGTGGACTTGCCCCGGACGATCTGCGCCAGCGGCTGAAGAAGGCAAAGTCTATATTGCCGGGCAGGCGGA
-GCGCGCCATTGAACATTTTTCCGCAAAGGTAATCTGATCGCCCTGCGCGAGCTGGCACTGCGCCGTACTGCCGATCGCGTTGATGAGCAAATGCGCGCCT
-GGCGGGGCATCCTGGCGAAGAGAAGTGTAGCACGCGCGACGCGATCCTTTTATGCATCGGCCATAACACCGGCAGCGAAAACTGGTCCGCGCAGCTGCGG
-CTGGCGTCACGGCTGGGTAGCGTCTGGCACGCGGTGTATGTTGAAACCCCTGCCCTGCACCGCTTACCGGAAAAAACGTCGGGCAATTCTCAGCGCCTTA
-CGTCTGGCGCAGGAACTGGGCGCGGGGCGGCAACACTTTCTGATCCAGCGGAAGAGCGGTAGTGCGTTATGCCCGTGAACATAATCTCGGCAAGATTATT
-CTCGGTCGCCCGGCCTCGCGCCGCTGGTGGCGATCGGGAAACGTTTGCTGACCGACTGGCGCGCATCGCCCCGATCTCGATCAGGTGCTGGTCGCGCTTG
-ATGATCACCACGCCCGCACGATTAACAACGCGCCGGATAACCGCTCTTTTAAAGACAAGTGGCGTGTACAAATTCAGGGATGCGTGGTTGCCGCCGCGTT
-ATGCGCCGTTATCACCTTAATTGCCATGCAGTGGCTGATGGCGTTTGATGCCGCCAACCTGGTGATGCTGTATCTGCTTGGCGTGGTGGTGGTGGCGCTA
-TTTATGGACGCTGGCCTTCGGTGGTTGCCACCGTCATTAATGTAGTGAGTTTCGATCTCTTTTTTATCGCCCACGCGGCACGCTCGCCGTCTCTGATGTG
-CAATATCTGCTGACCTTCGCGGTGATGTTAACCGTCGGGCTGGTGATCAGGAACCTTACTGCTGGCGTGCGTTATCAGGCGCGGGTAGCCCGTTACCGCG
-AGCAACGCACGGCACTTATATGAAATGTCGAGCTCTGGCGGTGGGCCGCAGTCCGCAGGATATCGCTGCCACCAGCGAACAATTTATTGCCTCCACGTTT
-CATGCCCGCAGTCAGGTGTTGTTGCCCGATGACAACGGTAAATTGCAGCCGTTAACACATCCGCAAGGAATGACGCCGTGGGACGATGCCATCGCGCAGT
-GGAGTTTGATAAAGGCCTGCCTGCGGGCGCGGGCACCGACACGTTACCCGGTGTACCGTACCAGATTTTGCCGTAAAAGCGGCGAAAACCACGGGCTGGT
-GGTGGTGGAGCCGGGAATCTGCGCCAGTTGATGATCCCGGAACAGCAGCGCCTGCTGGAACGTTACGCTGTTAGTCGCCAATGCCCTTGAGCGGCTGACG
-CTAACCGCCACGAAAAAGAACAGGCGCGGATGGCAAGCGAACGTGAACAGATCCGCAACGCCTGCTGGCGGCGCTTTCGCATAATTTACGCACGCCGCTT
-ACGGTGCTGTTTGGTCAGGCAGAAATCTTAACGCTCGATCTGGCAAGCGAGGATCACCCCGCCCGCCAGGCCAGCGAGATCCGTCAGCATGTGCTGAACA
-CTACCCGACTGGTGAATAATCTACTGGATATGGCGCGAATTCAGTCCGGCGGCTTTAATTTGAAGAAAGAGTGGTTAACGCTGGAAGAAGTAGTCGGCAG
-CGCGCTGCAAATCTGGAACCGGGTTTATCGTCGCCCATCAATCTTTCTCTGCCAGAACCGCTGACCTTAATCCACGTTGACGGGCCTCTTTGAACGGGTG
-CTGATTAATCTGCTGGAGAACGCGGTGAAATATGCGGGTGCGCAGGCCGAAATTGGTATCGATGCCCACGTTGAGGCGAAAATCTACAACTGGATGTCTG
-GGATAGCGGCCCCGGTCTTCCGCCAGGCCAGGAGCAGACGATATTTGATAAGTTTGCTCGCGGGAATAAAGAGTCGGCAGTACCGGGGGTAGGGCTTGGA
-CTGGCAATTTGTCGGGCGATAGTGGATGTACACGGGGCACTATTACGCGTTCAACCGACCGGAAGGTGGTGCCTGTTTTCGTGTTAC
->tig00000014 len=6644 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
-GAATGCCTGGGTCGATCTGCTACGCATCACGTTATGGGTGCTAGTCCCTGTGGCGTTGTTGATTGCACTGTTTTTTATTCAACAAGGTGCGCTGCAAAAC
-TTTCTGCCTTATCAGGCTGTGAATACCGTTGAAAGGCGCAACAGCTGTTATTACCATGGGGCCTGTAGCTTCTCAGGGAAGCGATCAAGATGCTCGTACT
-AACGGCGGTGCTTCTTTAATGCCAACTCGTCGCATCCGTTTGAAAACCCAACCGCACTGACCAACTTCGTGCAGATGCTGGCGATCTTCTTGATCCCAAC
-GGCGCTGTGCTTTGCCTTTGGTGAAGTGATGGGCGATCGCCGCCAGGGGCACTTGTTGCTGTGGGCGATGTCAGTGATTTTTGTCATCTGCGTAGGCGTG
-GTGATGTGGGCAGAAGTTCAGGTGTCCTCATCTGCTGGCACTGGGCACGGACAGCAGCATCAATATGGAAGGTAAAGAGAGCCGTTTCGGCGTGCTGGTC
-AGTAGCCTGTTTGCGGTCGTGACGACGGCGGCTTCTGTGGCGCGGTGATTGCGATGCATGATTCGTTTACCGCTCTCGGTGGCATGGTGCCGATGTGGCT
-GATGCAAATTGGTGAAGTGGTGTTCGGCGGTGTCGGTTCTGGTCTTTACGGCATGATGCTGTTTGTCCTGCTGGCGGTGTTTATTGCCGGGCTGATGATT
-GGTCGTACACCGGAATATCTGGGTAAAAAATCGACGTACGCGAGATGAAACTGACTGCACTGGCAATTCTGGTTACCCCGACGCTGGTGCTGATGGGCGC
-GGCGTTGGCGATGACCGACGCCGGACGTAGCGCCATGCTCAACCCTGGCCCGCATGGTTTTGGCGAAGTGCTGTACGCCGTGTCATCCGCCGCTAACAAC
-AGCAGCAGCGCCTTTGCCGGATTAAGCATATCTCCGTTCTGGAACTGTTTACTGGCGTTCTGCATGTTTGTCGGTCGCTTCAGGGTGATTATCCCGGTGA
-TGGCAGTGCCGGTTCGCTGGTGAGTAAAAGCCAAGCCGCCAGCTCCGGCGCTGCCAACGCACGGCCCGCTGTTTGTTGGCCTGTTAATCGGCACCGTGTT
-GCTGGTTGGCGCACTGACCTTTATCCCTGCCCTGGCGCTTGGTCGGTGGCGGAATATCTCTCCTGATGATATTGAGTGAGCACTGAATATGAGTCGTAAA
-CAACTGGCGCTATTCGAACCAACACTTGTCGTTCAGGCGCTGAAAAGAAGCGGTGAAAAATTAAACCCGCAGGCGCAATGGCGCAATCCGGTGATGTTTA
-TCGTCTGGATCGGCAGTCTGCTGACCACCTGTATTAGCATCGCGATGGCAAGCGGTGCGATGCCCGGCAATGCGCTGTTTAGCGCGGCCATTAGCGGTTG
-GCTGCGGATCACCGTACTGTTCGCTAATTTCGCCGAGGCGCTGGCAGAAGGCCGCAGTAAAGCGCAGGCCAACAGTCTGAAGGGGTGAAAACTGCCTTTG
-CCCGCAAGCTGCGTGAGCCGAAATATGGCGCTGCGGCGGACATTCCTGCCGACCAATACGTAAAAGGCGATATCGTACTGGTAAAGCTGGCGATATTATC
-CCCTGCGATGGTGAAGTTATTGAAGGGGTGCATCGGTCGATGAAAGCGCCATCACCGGAATCGGCACCGGTGATCCGTGAATCCGGCGGCGATTTTGCCT
-CCGTCACCGGCGGCACGCGTATTCTTTCTGACTGGCTGGTGATTGAGTGTAGCGTTAACCCGGCGAGGCATTTCTGGATCGGATGATCGCGATGGTGGAA
-GGCGCACAGCGACGCAAAACGCCGAACAGAAATTGCCTGACCATTCTGCTGATTGCCCTGACTATCGTCTTTTACTGGCAACCGCCACGTAGCCGTTTTC
-GCGTGGGGCGGTAATGCAGTCAGCGTAACGGTACTGGTGGCGCTGCTGGTCTGTCTGATCCCAACCACTATTGGCGGCCTGTTGTCAGCGATCGGCGTCG
-CCGGGATGAACCGGATGCTGAGCGCGCGAATGTGATTGCCACCAGCGGACGTGCAGTTGAAGCGGCAGGTGACGTTGACGTTCTGCTACTGGATAAAACC
-GTACCATCACACTCGGTAACCGTCAGGCGTCAGGTTTATCCCCGCGCAGGGCGTGGATGAAAAACGCTGGCTGACGCCGCACAACTGGCTTCGCTGGCTG
-ATGAAACGCCGGAAGGCCGCAGTATTGTGATCCTCGCCAAGCAGCGTTTAACCTGCGCGAGCGCGATGTGCAGTCGCTCCATGCCACCTTTGTACCGTTG
-CGCAAAGCCGGATAGGCGGGATCAACATCGACAACCGCATGATCCGTAAAGGTTCTGTCGATGCCATTCGTCGCCATGTTGAGAGGCTAACGGTGGTCAC
-TTCCCTACCGATGTTGATCAAAAGTCGATCAGGTTGCGCGTCAAAGGAGCCACGCCGCTGGTGGTGGTGGAAGGTTCTCGTGTGCTGGGCGTTATTGCGC
-TGAAGATATCGTCAAAGGCGGTATTAAAGAGAGCGCTTCATAGCTGCGCAAAATGGGCATTAAAACGGTGATGATTACCGGCGATAACCGTCTGACTGCC
-GCCGCGATTGCTGCGGAAGCGGGTGTCGATGATTTTCTCGCCGAAGAAGCGACACCGAGTAAGCTGGCATTGATCCGTCAGTATCAGGCGGAAGGTCGTT
-TGGTAGCGATGACCGGCGACGGCACCAACGATGCTCCGGCACTGGCGCAGGCAGATGTCGCAGTGGCGATGAACTCCGGCGCAGGCGGCGAAAGGCGGGC
-AATATGGTCGATCTCGACTCTAACCCGACCAAGTTGATCGAGGTGGTGCACATTGGCAAACAGATGCTGATGACCCGTGGCTCATGACCACCTTCAGCGT
-ACTGTGGCGAAATACTTCGCCATTATTCCGGCGGCATTCGCGGCAACGTATCCGCAGTTAATGCGCAGACATCATGTGCCTGCATTCGCCCGACTCCGCA
-ATCCTCGGGTGCGGTGATTTTCAAGCTTTGATTATCGTCTTTGATTCCCTGGCGTTAAAAGGCGTGAGTTATAAACCGCTTACCGCTTCTGCCATATTTG
-CGCCGTAACTTACGGATTACGGTCTGGGTGGGCTGCTGGTGCCGTTTATCGTATCAAAGTCATTGATTTACTGCTGACCGTTTGCGGTCTGGTGTGAGGA
-CTTTACCATAGTGGATTACGTCCGGCATTATCAACATTTATCTTTCTGTTATTGATTACTGGCGTTTACCCGCTTGCTGACCACCGTACTGGGGCAATGG
-TGGTTTCCTGGCAGGCCAATGGTTCGTTGATTCGTGAAGGTGATACGGTGCGCGGTTCGGCATTAATCAGGCAGAATTTACCGGCAACGGCTGTATTTTT
-CATGGTCGCCCGTCAGCAGCAGCAGAAATGCCCTATAATCCACAGGCTTCTGGCAGGAGCAATCTGGCGGTCAGTAACCCTGAGCTGGATAAATTAATAG
-CCGCACGCGTTGCTGCATTACGGGCCGCTAACCCGGATGCCAGCGCAGGCGTTCGGTTGAACTGGTGACGGCATCGGCAAGCGGGCTGACAATAATATCA
-CCCGCAAGCGGCGGCCTGGCAAATCCCACGCGTGGCGAGCGCCATAATCTCAGCGTTGAACAGCTCACGCAACTGATCGCAAAATACAGCCAACAACCGC
-TGGTGAAATATATCGGCCAGCCGGTTGTCAACATGTTGAAACTCAATCTGGCGCTGGATAAACTCGATGAATAACGAACCCTTACGTCCGACCCCGATCG
-TCTGCTGGAACAAACTGCCGCGCCGCATCGGGAAGCTGATTTTCTTCGGTGCCTGTGCAGGCGTCAGGGAAGACCTGGGCGATGCTGGCAGAAGCCCAGC
-GACTGCGAGCGCAAGGGCTGGATATTGTGGTTGGCGTGGTAGAAACCCACGGGCGAAAGATACCGCCGCCATGCTGGAAGGGCTGGCTGTTCTGCCGTTA
-AAACGCCAGGCGTACCGTGGGCGGCATATCAGCGAGTTTGATCTCGATGCCGCCACTCGCCCGCCGCCCGGCGCTGATCTTAATGGACGAACTGGCGCAC
-AGTAATGCGCGGAGTTCCCGTCATCCCAAACGCTGGCAGGATATCGAAGAACTGCTGGAAGCTGGCATTGATGTTTTCACTACCGTCAACGTTCAGCATC
-TGGAAAGTCTGAATGATGTGGTCAGCGGCGTCACCGGAATTCAGGTACGGAAACCGTGCCCGATCCTTTTCGATGCCGCGACGACGTGGTGCTGGTGGAC
-TTGCCCCGGACGATCTGCGCCAGCGGCTGAAAGAAGGCAAAGTCTATATTGCCGGGCAGGCGGAGCGCGCCATTGAACATTTTTCCGCAAAGGTAATCTG
-GTCGCCCTGCATGAACTGGCACTGCGCCGTACTGCCGATCGCGTTGATGAGCAAATGCGCGCCTGGCGGGGGCGTCCTGGCGAAGAGAAAGTGTGCACAC
-GCGACGCGATCCTTTTATGCATCGGCCATAACACCGGCAGCGAAAAACTGGTCCGCGCAGCTGCGCGCTGGCGTCACGGCTGGGTGGCGTCTGGCACGCG
-GTGTTATGTTGAAACCCCTGCCCTGCACCGCTTACCGGAAAAAACGTCGGGCAATTCTCAGCGCCTTACGTCTGGCGCAGGAACTGGGCTGGAGACGGCA
-ACACTTTCTGATCCAGCGGAAGAGAAAGCGGTAGTGCGTTATGCCCGTGAACATAATCTCGGCAAGATTATTCTCAGTCGCGGCCTCGCGCCGCTGGTGG
-CGTCGGGAGACGTTTGCTGACCGACTGGCGCGCATCGCCCCGATCTCGATCAGGTGCTGGTCGCGCTTGATGAACCACCCGCCCGCACGATTAACAACGC
-GCCGGATAACCGCTCTTTTAAAGACAAGTGGCGTGTACAAATTCAGGGATGCGTGGTTGCCGCCGCGTTATGCGCCGTTATCACTTTAATTGCCATGCAG
-TGGCTGATGGCGTTGATGCCGCCAACCTGGTGATGCTGCTGTATCTGCTTGGCGTGGTGGTGGTGGCGCTATTTATGGACGCTGGCCTTCAGTGGTTGCC
-ACCGTCATTAATGTAGTGAGTTTCGATCTCTTTTTATCGCCCCACGCAGCACGCTCGCCGTCTCTGATGTGCAATATCTGCTGACCTTCGCGGTGATGTT
-AACCGTCGGGCTGGTGATCAGGAACCTTACTGCTGGCGTGCGTTATCAGGCGCGGGTAGCCCGTTACCGCGAGCACGCACACGGCACTTATATGAAATGT
-CGAAAGCTCTGGCGGTGGGCCGCAGTCCGCAGGATATCGCTGCCACCAGCAGACAATTTATTGCCTCCACGTTTCATGCCCGCAGTCAGGTGTTGTTGCC
-CGATGACAACGGTAAATTGCAGCCGTTAACACATCCGCAAGGAATGACGCCGTGGGACGATGCCATCGCCGCAGTGGAGTTTTGATAAAGGCCTGCCTGC
-GGGCGCGGGCACCGACACGTTACCCGGTGTACCGTACCAGATTTTGCCATAAAAAGCGGCGAGAAAACCTACGGGCTGGTGGTGGTGGAGCCGGGAATCT
-GCGCCAGTTGATGATCCCGGAACAGCAGCGCCTGCTGGAAGACGTTACGCTGTTAGTCGCCAATGCCCTTGAGCGGCGGCGCTAACCGCCAGCGAAGAAC
-AGGCGCGGATGGCAAGCGAACGTTGAACAGATCCGCAACGCCCTGCTGGCGGCGCTTTCGCATGATTTACGCACGCCGCTTACGGTGCTGTTTGGTCAGG
-CAGAAATCTTAACGCTCGGTCTGGCAAGCGAAGGATCACCCCGCCCGCCAGGCCAGCGGATCCGTCAGCATGTGCTGAACACTACCCGACTGGTGAATAA
-TCTACTGGATATGGCGCGAATTCAGTCCGGCGGCTTTAATTTGAAGAAAGAGTGGTTAACGCTGGAAGAAGTAGTCGGCAGCGCGCTGCAAATGCTGGAA
-CCGGGTTTATCGTCGCCCATCAATCTTTCTCTGCCAGAACCGCTGACCTTAATCCACGTTGACGGGCCCTCTTTGAACGGGTGCTGATTAATCTGCTGGA
-GAACGCGGTGAAATATGCGGGTGCGCAGGCCGAAATTGGTATCGATGCCCACGTTGAGGGCGAAAATCTACAACTGGATGTCTGGGATAACGGCCCCGGT
-CTTCCGCCAGGCCAGGAGCAGACGATATTTGATAAGTTTGCTCGCGGGAATAAAGAGTCGGCAGTACCGGGGTAGGGCTTGGACTGGCAATTTGTCGGGC
-GATAGTGGATGTACACGGGGGCACTATTACCGCGTTCAACCGACCGGAAGGTGGTGCCTGTTTTCGTGTTACACTTCCCCAGCAAACTGCCCCTGAACTG
-AAGAATTTCAGCGAGGATATGTGACAAACGTTCTGATTGTTGAAGATGAACAGGCTATTCGTCGCTTTCTGCGCACGGCGCTGGAGGGCGACGGATGCGC
-GTCTTTGAGGCCGAAACGCTGCAACGCGGCTTGCTGGAAGCGGCAACCCGTAAGCCAGATTTGATTATTCTCGATCTCGGCCTGCCCGATGGTGATGGGA
-TTGAGTTTATCCGCGACCTGCGCCAGTGGAGCGCGGTGCCGGTG
->tig00000015 len=3097 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
-GACAGCCTGGCAACTGCTGTGGATTAAGCGGCAGATGGTGCTGACCGAGCAACGCAAAAACAGCACCGCCAGCCCCAGCATGTTCAGGCCGAGAATGGCA
-CAGATATTGCTTCAGTTCATCTCACGGTCAGAGACGCCAAGTGCGCGAAAAAGTACGCGCTCAACGCCCGTTGTACCGGGAAGAGAATATCATTAATCAA
-CCGCCAGCCCGCTGCCTAAAGGACGCGCCAGCACCATTAACACCAGTAAAACGTGGCGATCAGTAAGAACCCTTGCGCAGCCATCAGAACGCCTCCGCAT
-TGATCAGGGCATAAACCAGATAACCCAGTAATAAAACACCAGCAATACGCCGGTTATCACGCCTGCACTCACAGTGCACCTCCAGTGGCCTAAAGTGATA
-CCGGAAGGGGTAGAATTCTGGCTGCCAAGATTTCGCAAAATCTGCGGGCGGGGTGTAAAAATATAAAATGTGAAAAGCCATGGTTAACTAATGTTTAGTG
-AATTGCTTTTGTAACTTAATTACAGGATGAATGTAAATAAAACCATCAATAAGCAAAATAAGTGGTCGGATGGGTAGTAAAATTACACAAAAGGCATTTA
-TTTTCATCAGATAAACCAAATTCATTTTTCAGTGCCATTCACCGGTAGATACAAAGGGAGAAAAGTATGGAACTCTACAGAATATCACCATGGCTTATCT
-TTTTACGCCGTACTTATGCGGTTTGCGGCGGGCGTTCTGGCGCTGCCTTTCATGCTTTTCTGGAAAGGCCGCGCCCGCTTTACAGCTACCTGCATCGCGT
-CTGGTCGAAAACCAGCGATAAACCGGTGTGGATGGATCAGGCCGAAAAGGCAACTGGTGATTTTATTGATTGCTGGAGTTTGAATACATTGAAAACCGCC
-AGCGGAAACGCTGGCGGTTTTTATCAGGAAGATGTTCAGAGGAATATTTGAACATCGTTATACCAATCCGAAACATATATTCATGAAATATGCCATAAAT
-ATTTTCCTAATTGTTCTTATCTGACCAGATATCTCACTTAAAACAAAGCTTTCATAAATCTGTAGGGTTTCGCCTGGCATCAGCAGATAAATAACCCGAT
-AAAACAAGGATGAGCAGATGAGCGGAAAACCGGCGGCGCGTCAGGGCGACATGACGCGATATGGCTGATAGCATTGTCCAGGTTCAGCCGGGGTACGCAT
-CAGTGCCCCCACCGGCGTGGCCTGTTCGGTGTGCCCGGCGGGGGGTGACGTCGGCCATCGGTCAATCCGCTGCTCGGTGCAAGGTCCTTCCAGTGAAACC
-GACATCGCCCTGCCCGGCCCGCTGCCGTTCATTCTCTCCCGCACCTACAGCAGTTACCGGACAAAAACGCCGCGCCGGTGGGGAGCCTCGGCCCCGGCTG
-GAAAATGCCTGCGGATATCCGCTTACAGCTGCGCGATAACACACTGATACTCAATGATAACGGCGGCAAGCCTGTATTTTGACACCTGTTTCCCGGTAAG
-GACAGTGATTACAGCCACGGCGAGTCACTGTGGCTGGTGCGCGGCGGCGTGGCGAAACTGGATGAAAGGTCACCGGCTGGCCGCACTCTGGCAGCGCTGC
-CGGAAGAACTCCGCTTAAGTCCGCATCGTTATCTGGCGACAAACAGTCCGCAGGGCCGTGGTAGCTGCTCGGCTGGTGTGAGCGGGTGCCGGAAGCGGAT
-GAGGTGCTGCCTGCGCCGCTGCCGCCGTACCGGGTACTGACCGGGCTGGTGGACCGCTTCGGGCGCACACAGACGTTCCACCGAAGCCGCCGGTGAATTC
-AGCGGCGAAATCACCGGCGTGACGGATGGTGCCGGGCGTCACTTCCGGCTGGTACTGACCACGCAGGCGCAGCGGTAGAAGAAGCCCGGCAGCAGGCCAT
-TTCCGGCGGGACGGAACCGTCCGCTTTCCTGATACCTGCCGGGTTACACCGAATATGGCCGGGACAACGGCATCCGTCTGTCTGCCGTGTGGCTGACGCA
-CGACCGGAATACCCGGAGGAATTTACCTGCCGCGCCGCTGGTGCGCTATGGCTGGACGCCCGCGGCGAACTGGCGGCGGTGTATGACCGCAACCAATACA
-CAGGTGCGCAGCTTTACTTACGATGATAAATACCGGGGGCCGGATGGTGGCGCACCGTCACACGGGCCGACCGGAAATCTGTTACCGTTACGACAGCGAC
-GGGCGGGTGACAGAACAGCTAAACCGGCAGGCTTAAGTTACACGTATCAGTATGAGAAGGACCGCATCACCATCACCGACAGCCTGAACCGCCGTGAAGT
-CCTGCACACGCAAATTGAAGGCGGGCTGAAGCGAGTGGTGAAAAGGAACACGCGGACGGCAGCGTCACGCAGAGTCAGTTTGACGCGGTGGGCAGGCTCG
-GGCACTGAACGGATGCCGCAGGCAGGACAACGAATACAGTCCGGATGTGGTGACGGGCCTCATCACGCGCATCACCACGCCGGATGGCGGGGCATCGGCG
-TTTACTATAACCACCACAGCCAGTTAACGTCAGCCACCGGGCCTGACGGGCTGGAAATACGCCAGGAATATAGTGATACGATTGCGTCTGATTCAGGAAA
-CTGCCCCTGACGGCGATATCACCCGCTACCGTTATGATAATCCACACGGTGACTTACCCTGCGCAACGGAAGATGCCACCGGCGGCGGAAAACCATGACG
-TGGAGCCGTTACGGTCAGTTGCTGGGCTTCACTGACTGTTCCGGTTATGTAACCCGCTATGACCATGACCGTTTTGGTCAGGTGACGGCGGTCACCGCGA
-GGAAAGGGCTGAGTCAGTACCGCGCATACACGGCCGTGGACGGTTAATTGCCGTGAAAAGCACGCAGGGCCATAAAGACGCGGTATGAATACAACGCCGC
-CGGTGACCTGACCACCGTCATTGCCCCGGACGGCAGCGAAACGGGACACAGTACGATGCGTGGGGAGAAAACCATCATACCACGCAGGGCGGTCTGACGC
-GCAGTATATGGAATACGATGCGCCGGACGGGTCATCCGCCTGACCAGTGAAAACGGCAGCCACACCACCTTCCGTTACGATGTACTCGACCGGCTGA
->tig00000016 len=5147 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
-CATGGCACCACGTTGATTATGGTGACCCACGACCTGCAACTGGCGGCGCTGCGACCGCTGCTTACGGCTGGTGAACGGGCAGTTGCAGGAGGAAGCATGA
-TTGCACGTTGGTTCTGGCGCGAATGGCGTTCGCCGTCGCTATTAATTGTCTGGCTGGCGCTAAGCCTGGCGGTGGCCTGCGTGCTGGCGCTGGGCAATAT
-CAGCGATCGCATGGAGAAGGGGCTTAAGCCAGCATTAAGCCGTGAGTTTATGGCGGGCGATCGGGCGTTGCGCAGTTCACGCGAAGTGCCGCAAGCGTGG
-CTGGAAGCGCAAGAGCGCGGCCTGAGAATCAGCAAGCGGCTGACTTTCGCCACAATGACCTTGCAGGCGACACACCGCAGCTGGCGAACGTCAAAGCGGT
-GGATGATATCTACCCGATGTATGGCGATCTGCAAACTAATCCCCTGGCCTGAAACCGCAGGCGGGCAGCGTATTACTGGCCCCACGCCTGATGGCACTGC
-TTAACCTGAAAACGGGCGACACCATTGGCGTGGGCGATGCCACCTTGCGGATTGCCGGAGAAGTGATTCAGGAACCGGTTCCGGTTTAACCCTTCCAGAT
-GGCTCCGCGTCTGATGATGAATCGGATGTCGATAAAACCGGAGCCGTGCAGCCGAGGGAGTCAGGTCACCTGGCGTTATAAATTCGGCGGCAACGAGAAC
-CAGCTCGACGGCTATGAAATGGTTGTTACCCTCAGCTTAAACCCGAACAACGCTGGTACGGTCTGGAACAGGACGAAGAGGCGCTGGGGCGATCGATGGA
-ACGCTCGTAACAGTTCCTGCTGCTTTCGGCGCTTCTGACCTGCTGCTGGCAGTGGCAGCGGTGGCGGTAGCGATGAATCATTACTGTCGCAGTCGCTACG
-ATCTGGTGGCGATCCTCAAAACGCTGGGGGCAGGGCGAGCGCAACTGCGTAAGCTAATCGTCGGTCAGTGGTTGATGGTGCTGACGCTTTCAGCCGTTAC
-CGGTGGGGCCATAGGCCTGTTGTTCGAAACGTGTTGATGGTGCTGCTTCAAGCCCGTTCTGCCTGCTGCACCGCCAGCCAGCCTCTGGCCGTGGCTGTGG
-GCGCTTGGCACCATGACGGTCATCTCGCTGCTGGTGGGGCTACGACCATATCGCTTGTTGCTGGCAACGCAGCCTTTACGCGTATTACGTAATGATGTGG
-TAGCGAACGTCTGGCCGCTGAAGTTTTATCTGCCGATTGTCAGTGTGGTGGTTGTGCTGCTGCTCGCCGGATTAATGGGTGGCAGCATGCTGCTTTAGCG
-GTGCTGGCGGGCGCGGTAGTACTGGCTTTGCTGTGCGGTGTGCTGGGCTGGATGCTGCTGAATGTACTACTTCGCCGCATGACGCTGAAATCGCTGCCCT
-CTGCGCCTGGCGGTTAGCCGCCTGTTACGTCAGCCGTGGTCAACGTTAAGTCAGCTTTCGGCATTTTCGCTCTCCTTTATGCTGCTGGCACTGCTGCTGG
-TGTTGCGTGGCGATCTGCTCGACCGCTGGCAGCAGCAGCTACCTCCAGAGAAGCCCGAACTACTTTTAATTAACATCGCCACAGAACAGGTAGCACCGCT
-AAAGCGTTCCTCGCGGAACCATCAGATAGTCGGAATCGTTTTATCCGGTGGTGCGCGGGCGCGTGACGGCGATTAACGATAAGCCGACAGAAGGTAATGA
-AGATGGGCGCTTAACCGCGAACTCAATCTTACCTGGCAAAATACGCGGCCCGATCATAATCCGATTGTCGCCGGTAACTGGCCGCCAAAAGCCGATGAAG
-TGTCGATGGAAGAGGGGCTGGCGAAACGCAAACGTTGCCCTCGGTGATACCGTGACTTTATGGGCGATACCCAGAGAGTTCCGCGCTAAAGTGACCAGCC
-TGCGCAAAGTGGACTGGGAAAGTCTGCGGCCTAATTTCTATTTTATTTTCCCTGAAGGGCATTAGACGGGCAACCGCAGAACTGGCTTACCAGTTTCCGC
-TGGGAGAATGGCAACGGCATGTTGACACAACTCAACCGCCAGTTCCCGACCATTAGCCTGTTAGATATTGGCGCGATTTTAAAAACAGGTCGGTCAGGTG
-CTGGAGCAGGTAAGTCGGGCGCTGGAAGTGATGGTGGTACTGGTCACCGCCTGCGGTATGTTGCTGTTGCTGGCACAGGTGCAGGTGGGAATGCGTCAGC
-GTCATCAGGAGCTGGTGGTGTGGCGCACACTCGGTGCGGGAAAAACTGCTGCGTACCACGTTGTGGTGTGAGTTCGCCATGCTTGGGTTTGTTTCCGGCC
-TGGTGGCCGCAATTGCGGAAACGGCGCTGGCAGTGTTGCAGGCGAAAGTGTTTGATTTTCCGTGGGAGCCAGACTGGCGATTGTGGATTGTTCTGCCGTG
-CAGCGGAGCGCTGCTGCTGTCGCTTTTCGGCGGCTGGCTGGGTGCGCGACTGGTTAAAGAGTAAAGGCGCTGTTCAGCAGGTTTGCGGGGTGATGAGAGT
-AAATAAGGGCGTTCTGGTTGAATGGAACGCCTTGTTTAAATTAATTCTACAATATGTTTCGTGATGATGATGTTATTGAATTGGTGATTTCTATCTTTCT
-ATTGCTGATATTAATCTGAATCGGTGGAGTTTATTGATTTTAAATATAGCCCTACAAAAATAACTCAGACTAATAAAATCATAAATCATATGCGTTGAAT
-GGATATTATCCATATAATGAATTTGTTGATGATGAATTCATCTGTGTGCTAAATGTTAGTTTAATAAAATATTGAAAGTGACCTGTAATAACAGTTGTTG
-TTGATTGAGAACAAATAAGTTTATGTGAAAAATATATAAATACATTAGCTGGTCTTGTGTGTCATTTTATTTTTTGTTGCTAACAGGGATATGAACAATA
-ACTAAAAGGGCACTTTATGAGCGGAAAACCAGCGGCGCGTCAGGAGATATGACTCAGTATGGCGGTCCCATTGTCCAGGGTTCGGCAGGTGTAAATTGGC
-GCGCCCACCGGCGTGGCGTGCTCGGTGTGTCCGGGCGGGATGACTTCCGGGCAACCCGGTAAATCGCTGCTGAGGGCGAAGGTGCTGCCCGGCGAGACGG
-ACCTTGCGCTGCCGGCCCGCTGCCGTTCATTCTCTCCCGCACCTACAGCAGCTACCGGACGAAGACGCCTGCACCGGTGGGCGTTTTCGGCCCCGGCTGA
-AAGCGCCTTCTGATATCCGCTTACAGCTACGTGATGACGGACTGATACTCAACGACAACGGCGGGCGGAGCATTCACTTTGAGCCGCTGCTGCCGGGAGG
-CGGTGTACAGCCGCAGTGAGTCAATGTGGCTGGTGCGCGGTGGTAAAGCAGCACACAGCCGGACGGCCCATACGCTGGCGCGGCTGTGGGGGCGCTGCCG
-CCGGATATCCCGGTTAAGCCCGCATCTTTACCTGGCGACCAACAGCGCACAGGGGCCGTGGTGGATACTGGGGTGGTCTGAGCGGGTGCCGGGTGCTGAG
-GACGTACTGCCAGCGCCGCTGCCGCCGTACCGGGTGCTTACCGGGATGGCGGACCGCTTCGGACGCTGACGTACCGGCGTGAGGCCGCCGGTGACCTGGC
-GAAATCACCGGCGTGACGGACGGTGCCGGGCGGGAGTTCCGTCTGGTGCTGACCACGCAGGCGCAGCGTGCGGAAGAGGCCACACCTCTTCGCTATCTTC
-TTCTGACAGTTCCGCCCTCTCTCAGCCTCAGCGTTCCCCGACACACTGCCCGGTACCGAATACGGCCCCGACAGGTATCCGCCTTTCGGCGGTGTGGCTG
-ATGCACGACCCGGCATACCCGGAGGCCTGCCCGCTGCGCCACTGGTGCGGTACACGTATACGGAAGCCGGTGAACTGCTGGCGGTATATGACCGCAGCAA
-TACGCAGGTGCGCGCTTTCACGTATGACGCGCAGCACCCGGCCGGATGGTGGCGCACCGTTACGCGGGAAGGCCGGAGATGCGCTACCGCTACGACGATA
-CGGGGCGGGTGGTGGAACAACTGAACCCGGCAGGGTTAAGCTACCGCTATCTTTATGAGCAGGACCGCATCACCGTCACCGACAGCCTGAACCGGCGTGA
-GGTGCTGCATACAGAAAGGCGGGGCCGGGCTGGAAACGGGTGGTGAAAAAGAACTGGCGGACGGCAGCGTCACGCGCAGCAGGTATGACGCGGCAGGAAG
-GCTCACGGCGCAGACGGACGCGGCGGGACGGAGGACAGAGCGGTCTGAATGTGGTGTCCGGCGATATCACGGACATCACCACACCGACGGGCAGGAGACG
-AAATTTTACTATAACGACGAGAACCAGCTGACGGCGGTGGTGTCCCCGGACGGGCTGGAGAGCCGCCGGGAATATGATGAACCGGCAGGCTGGTATCGGA
-GACATCGCGCAGCGGGGAGACAGTACGCTACCGCTACGATGACGCGCACAGTGAGTTACCGGCGACGACAACGGATGCGACGGGCAGCACCGGCAACAGA
-TGACCTGGAGCCGCTACGGGCAGTTGCTGGCGTTCACCGACTGCTCAGGCTACCAGACCCGTTATGAATACGACCGCTTCGGCCAGATGACGGCGGTCCA
-CCGCGAGAGAGCATCAGCCTTTACCGCCGCTATGACAACCGTGGCCGGTTAACCTCGGTGAAGACGCACAGGGCCGTGAAACGCGGTATGAATACAACGC
-CGCAGGCGACCTGACTGCCGTTATCACCCCGGACGGCAACCGGGCGAGACACAGTACGATGCGTGGGGAAAGGCGGTCAGCACCACGCAGGGCGGGCTGA
-CGCGCAGTATGGATTACGATGCTGCCGGACGTGTCATCAGCCTGACCAACGAGAACGGCAGCCACAGCGTCTTCAGTTACGATGCGCTGGACCGGCTGGT
-ACAGCAGGGCGGCTTTGACGGGCGGACGCAACGTTATCATTATGACCTGAGCCGGAAAACTCACACCAGAGTGAGGATGAGGACTTGTCATCCTCTGGTA
-CTACGATGAATCGGACCGTATCACTCACCGCACGGTGAACGGCGAACCGGCAGAGCAGTGGCAGTATGATGGCCACGGCTGGCTGACAGACATCAGCCAC
-CTGAGCGAAGGCCACCGTGTTGCCGTCCACTATGGCTATGACGATAA
->tig00000017 len=6305 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
-CTGTCTCCCCGCTGCGCGATGTCTCCGATACCAGCCTGCCCGGTTCATCATATTCCGGCGGCTCTCCAGCCCGTCCGGGGACACCACCGCCGTCAGCTGG
-TTCGTCGTTATAGTAAAATTTCGTCTCCCGCCCGTCCGGTGTGGTGATGTCCGTGATATCGCCGGACACCACATTCAGACCATTACTCTGTCCTCCGTCC
-GCCGCGTCCGTCTGCGCCGTGAGCCTTCCTGCCGCGTCATACCCGCTGCGCGTGACGCTGCCGTCCGCCAGTTCTTTTTCACCACCCGTTTCAGCCCGGC
-CCCGCCTTCTGTATGCAGCACCTCACGCCGGTTCAGGCTGTCGGTGACGGTGATGCGGTCCTGCTCATAAAGATAGCGGTAGCTAACCCTGCCGGGTTCA
-GTTGCTCCACCACCGCCCCGTATCGTCGTAGCGGTAGCGCATCTCCGGCCTTCCCGCGTAACGGTGCGCCACCATCCGGCCCGGGTGCTGCGCGTCATAC
-GTGAAAGCGCGCACCTGCGTATTGCTGCGGTCATATACCGCCAGCAGTTCACCGGCTTCCGTATACGTGTACCGCACCAGTGGCGCAGCGGGCAGGCTCT
-CCGGGTATGCCGGGTCGTGCATCAGCCACACCGCCGAAAGGCGGATACCCTGTCGGGGCCGTATTCGGTACCGGGCAGTGTGTCGAGGGAACGCTGAGGC
-TGAGAGAGGGCGGGAACTGTCAGAAGAAGATAGCGAAGAGGTCGGGCCTCTTCCGCACGCTGCGCCTGCGTGGTCAGCACCAGACGGAACTCCGCCCGGC
-ACCGTCCGTCACGCCGGTGATTTCCCCGGCCAGGTCACCGGCGGCCTCACGCCGGTACGTCAGCGTCCGCCCGAAGCGGTCCGCCATCCCGAAAGCACCC
-GGTACGGCGGCAGCGGCGGCGCTGGCAGTACGTCCTCAGCACCCGGCACCCGCTCAGACCACCCCAGTATCCACCACGGCCTGTGCGCTGTTGGTCGCCA
-GGTAAAGATGCGGGCTTAACCGGATATCCGGCGGCAGCGCCCCCACAGCCGCGCCAGCGTATGGCCGTCCGGCTGTGCTGCCTTACCACCGCGCACCAGC
-CACGTGACTCACTGCGGCTGTACACCGCCTCCCCGGCAGCAGCGGCTCAAAGTGAATGCTCCGCCCGCCGTTGTCGTTGAGTATCAGTCCGTCATCACGT
-AGCTGTAAGCGGATATCAGAAGGCGCTTTCCAGCCGGGGCCGAAAACGCCCACCGGTGCAGGCGTCTTCGTCCGGTAGCTGCTGTAGGTGCGGGAGAGAA
-TGAACGGCAGCGGGCCGGGCAGCGCAAGGTCCGTCTCGCCGGGCAGCACCTTCGCCCCCAGCAGCGGATTTACCGGGTTGCCCGAAGTCATCCCGCCCGG
-ACACACCGAGCACGCCACGCCGGTGGGCGCGCCAATTCTTACACCTGCCGAACCCTGGACAATGGGACCGCCATACTGAGTCATATCTCCTGACGCGCCG
-CTGGTTTTCCGCTCATATAAAGTGCCCTTTTAGTTATTGTTCATATCCTGTGTTAGCAACAAAAAATAAAATGACACACAAGACCAGCTAATGTATTTAT
-ATCTTTTCATAAACTTATTTGTTCTCAATCAACAACAACTGTTATTACAGGTCACTTTCAATATTTTATTAAACTAACATTTTTAGCACAGATGAATTCA
-TCATCAGCAAATTCACTATATGGATAATATCCATTCAACGCATATGATTTATGATTTTATTAGTCTGAGTTATTTTTGTAGGGCTATATTTAAAATCAAT
-AAACTCCACCGATTCAGATTAATATCAGCAATAGAAGATAGAAATCACCAATTCAATAACATCATCAATGAAGACATATTGTAGAATTAATTTAAACAAG
-GCGTTCCATTCAACCAGAACGCCCCTTATTTACTCTCATCACCCGCAAACTGCCTGAACAGCGCCTTACCCTTAACCAGTCGCGCACCCAGCCAGCCGCC
-GAAAGCGACAGCAGCAGCGCCTCCGCTGCACGGCAGAACAATCCACAATCGCCAGTCTGGCTCCACGGAAAATCAAACACTTTCGCCTGCAACACTGCCA
-GCGCCGTTTCCGCACCAATTGCGGCCACCAGGCCGGAAACAAACCCAAGCATGGCGAACTCACACCACAACGTGGTACGCAGCAGTTTTTCCCGCACCGA
-GTGTGCGCCACACCACCAGCTCCTGATGACGCTGACGCATTCCCACCTGCACCTGTGCCAGCAACAGCAACATACCGCAGGCGGTGACCAGTACCACCAT
-CACTTCCAGCGCCCGACTTACCTGCTCCAGCACCTGACCGACCTGTTTTAAAAATCGCGCCAATATCTAACAGGCTAATGGTCGGGAACTGGCGGTTGAG
-TTGTGTCAACATGCCGTTGCCATTCTCAGCGGAAACTGGTAAGCCAGCTCTGCGGTTGCCCGTCTAATGCCCCTTCAGGGAAAATAAAATAGAAATTAGG
-CCGCAGACTTTCCCAGTCCACTTTGCGCAGGCTGGTCACTTTAGCGCGGAACTCCTGGGTATCGCCCATAAAAGTCACGGTATCACCGAGGGCAACGTTT
-GCGTTTCGCCAGCCCTCTTCCATCGACACTTCATCGGCTTTTGGCGGCCAGTTACCGGCGACAATCGGATTATGATCGGGCCGCGTATTTTGCCAGGTAA
-GATTGAGTTCGCGGTTAAGCGCCTCATCTTCATTACCTTCTGTCGGCTTATCGTTAATCGCCGTCAGCCGCGCCGCACCACCGGATAAAACGATTCCGGG
-ACTATCTGATGTTCCGCGAGGAACGCTTTAGCGGTGCTACCTGTTCTGTGGCGATGTTAATTAAAAAGTAGTTCGGGCTTTCTGGAGGTAGCTGCTGCTG
-CCGCAGCGGTCGAGCAGATCGCCACGCAACACCAGCAGCAGTGCCAGCAGCATAAAGGAGAGCGAAAATGCCGAAAGCTGACTTAACGTTGACCACGGCT
-GACGTAACAGGCGGCTAACCGCCAGGCGCAGAGGCAGCGATTTCAGCGTCATGCGGCGAAGTACATTCAGCAGCATCCAGCCCAGCACACCGCACAGCAA
-AGCCAGTACTACCGCGCCCGCCAGCACCGCCCAAAGCAGCATGCTGCCACCCATTAATCCGGCGAGCAGCAGCACAACCACCACACTGACAATCGGCAGA
-TAAAACTTCAGCGGCCAGACGTTCGCTACCACATCATTACGTAATACGCGTAAGGCTGCGTTGCCAGCAAGCAAGCGATATGGTCGTAGCCCCACCAGCA
-GCGAGATGACCGTCATGGTGCCAAGCGCCCACGCCACGGCCAGAGGCTGGCTGGCGGTAGTGCAACAGGCAGAACGGGCTTGAGCAGCACCATCAACACG
-TTTTCGAACAACAGGCCTATGGCCCCACCGGTAACGGCTGAAAGCGTCAGCACCATCAACCACTGACCGACGATTAGCTTACGCAGTTGCGCTCGCCCTG
-CCCCCAGCGTTTTGAGGATCGCCACCAGATCGTAGCGACTGCGACAGTAATGATTCATCGCTACCGCCACCGCTGCCACTGCCAGCAGCAAGGTCAGAAG
-CGCCAGCAGCAGGAACTGTTGCGAGCGTTCCATCGATCGCCCCAGCGCGCCTTCGTCCTGTTCCAGACCGTACCAGCGTTGTTCGGGTTTAAGCTGGGGT
-AACAACCATTTCTCATAGCCGTCGAGCTGGTTCTCGTTGCCGCCGAATTTATAACGCCAGGTGACCCGACTCCCCGGCTGCTGGCTCCGGTTTTATCGAC
-ATCCGCCAGATTCATCATCAGACGCGGAGCCATCTGGAAGGGTTAAAACCGGAATCCGGTTCCTGAATCACTTCTCCGGCAATCCGCAAGGTGGCATCGC
-CCACGTCAATGGTGTCGCCCGTTTTCAGGTTAAGCAGTGCCATCAGGCGTGGGGCCAGCAATACGCTGCCCGCCTGCGGTTTCAGGCCAGGGGATTAGTT
-TGCAGATCGCCATACATCGGGTAGATATCATCCACCGCTTTGACGTTCGCCAGCTGCGGTGTGTCGCCTGCAAAGGTCATTGTGGCGAAAGTCAGCTGCT
-GCCGACTTTCAGGCCGCGCTTTGCGCTTCCTCCAGCCACGCTTGCGGCACTTCGCGTGAACTGCGCAACGCCCGATCGCCCGCCATAAACTCACGGCTTT
-GCTGGCTTAAGCCCTTCTCCATGCGATCGCTGATATTGCCCAGCGCCAGCACGCAGGCCACCGCCAGGCTTAGCGCCAGCCAGACAATTAATAGCGACGG
-CGAACGCCATTCGCGCCAGAACCAACGTGCAATCATGCTTCCTCCTGCAACTGCCCGTTCACCAGCCGTAAAGCAGCGGTCGCAGCGTGCCGCCAGTTGC
-AGGGTCGTGGGTCACCATAATCAACGTGGTGCCATGTTCACGGTTGAGGAAAACAGCAGGTCGGCAATTTTATCGCCCGTCTGGCGGTCAAGGTTGCCGT
-GGGTTCGTCGGCAAACAGCATCAGGTCGACCATTAAAGGCTCGTGCCAGCGCTTCCTCGTTGCTGTTCACCGCCGGAAAGCTGTGCCGGAAGATGATCAG
-ACGTTTACCCAGCCCTAACTGTTCGAGCAACGCTTTCGCCCCGTTACGACTTTCCGCGCTTTCTCACCGCGCAGCAGGGCGGAAGCTCGACGTTTTCCAG
-CGCGTTAAGGTAGGAATTAACATAAATGACTGAAAAACAAAGCCGACGTGCTTCGCGCGCAACTTTGCCCGCGCTTCGTCCATATTATGTGGCGGTTGTC
-CCACCAGACTCACTTCGCCACTGCTGCCGTCATCAAGCCCGGCGAGGATCGCCAGCAAGGTTGACTTACCCGATCCCGACTCGCCCACCAGTGCGATGGT
-CTCGCCGTTTGACAACCAGCTCAACTCCGGTGAGGATGGAGAGTTCATGCTCCCTGACCGACGGACTTCTTAAGATGATGAACCAACAATGTTTTCCGCT
-GGCATTTGCCCTTCCTGTTCCTGGTCCCATTAACCTTCCGTGCCGCCGCAGCGGCACGTTATTGATTCTGGGTGATAGCCTGAGCGCCGGGTATCGAATG
-TCTGCCAGCGCGGCCTGGCCTGCCTTGTTGAATGATAAGTGGCAGAGTAAAGACGTCGGTAGTTAATGCCAGCATCAGCGGCGACACCTCGCAACAAGGA
-CTGGCGCGCCTTCCGGCTCTGCTGAAACAGCATCAGCCGCGTTGGGTGCTGGTTGAACTAATGGGCAATGACGGTTTGCGTGGTTTTCAGCCACAGCAAA
-CCGAGCAAACGCTGCGCCAGATTTTGCAGGATGTCAAAGCCGCCAACGCTGAACCATTGTTAATGCAAATACGTCTGCCTGCAAACTATGGTCGCCGTTA
-TAATGAAGCCTTTAGCGCCATTTACCCCAAACTCGCCAAAGAGTTTGATGTTCCGCTGCTGCCCATTTTTATGGAAGAGGTCTACCTCAAGCCACAATGG
-ATGCAGGATGACGGTATTCATCCCAACCGCGACGCCCAGCCGTTTATTGCCGACTGGATGGCGAAGCAGTTGCAGCCTTTAGTAAATCATGACTCATAAA
-GCAACGGAGATCCTGACAGGTAAAGTTATGCAAAAATCGGTCTTAATTACCGGATGTTCCAGTGGAATTGGCCTGGAAAGCGCGCTCGAATTAAAACGCC
-AGGGTTTTCATGTGTGCTGGCAGGTTGCCGGAAACCGGATGATGTTGAGCGCGCGAACAGCATGGGATTTACCGGCGTGATCGATCTGGATTCACCAGAA
-AGTGTTGATCGCGCAGCCGACGAGGTGATCGCCCTGACCGATAGTGTCTGTATGGGATCTTTAACAATGCCGGATTCGGCATGTATGGCCCTTTCCACCA
-TCAGCCGTGCGCAGATGGAACAGCAGTTTCCGCCAACTTTTCGGCGCACACCAGCTCACCATGCGCCTGTTACCCGCGATGTTACCGCACGGTGAAGGGC
-GTATTGTGATGACATCATCGGTGATGGGATTAATCTCCCGCCGGGTCGTGGCGCTTACGCGGCCAGTAAATATGCGCTGGAGGCGTGGTCAGATGCACTG
-CGCATGGAGCTGCGCCACAGCGGAATTAAAGTCAGCCTGATCGAACCCGGTCCCATTCGTACTCGCTTCACCGACAACGTCAACCAGACGCAAAGTGATA
-AACCAGTCGAAAATCCAGCATCGCCGCCCGCTACGTTGGGACCGGAAGCGGTGGTGGACAAAGTACGCCATGCTTTTATTAGCGAAGCCGAAGATGCGCT
-ATCCG
->tig00000018 len=4534 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
-ACGTCGTTATAGTAAAATTTCGTCTCCCGCCCGTCCGGTGTGGTGATGTCCGTGATATCGCCGGACACCACATTCAGACCATTACTCTGTCCTCCGTCCG
-CCGCGTCCGTCTGCGCCGTGAGCCTTCCTGCCGCGTCATACCCGCTGCGCGTGACGCTGCCGTCCGCCAGTTCTTTTTCACCACCCGTTTCAGCCCGGCC
-CCGCCTTCTGTATGCAGCACCTCACGCCGGTTCAGGCTGTCGGTGACGGTGATGCGGTCCTGCTCATAAAGATAGCGGTAGCTAACCCTGCCGGGTTCAG
-TTGCTCCACCACCCGCCCCGTATCGTCGTAGCGGTAGCGCATCTCCGGCCTTCCCGCGTAACGGTGCGCCACCATCCGGCCCGGGTGCTGCGTCATACGT
-GAAAGCGCGCACCTGCGTATTGCTGCGGTCATATACCGCCAGCAGTTCACCGGCTTCCGTATACGTGTACCGCACCAGTGGCGCAGCGGGCAGGCTCTCC
-GGGTATGCCGGGTCGTGCATCAGCCACACCGCCGAAAGGCGGATACCCTGTCGGGGCCGTATTCGGTACCGGGCAGTGTGTCGGGGAACGCTGAGGCTGA
-GAGAGGGCGGGAACTGTCAGAAGAAGATAGCGAAGTCGGGCCTCTTCCGCGCTGCGCCTGCGTGGTCAGCACCAGACGGAACTCCCGCCCGGCACCGTCC
-GTCACGCCGGTGATTTCCCCGCCAGGTCACCGGCGGCCTCACGCCGGTACGTCAGCGTCCGCCCGAAGCGGTCCGCCATCCCGGTAAGCACCCGGTACAG
-CGGCAGCGGCGCTGGCAGTACGTCCTCAGCACCCGGCACCCACTCAGACCACCCCAGTATCACCACGGCCTGTGCGCTGTTGGTCGCCAGGTAAAGATGC
-GGGCAACCGGATATCCGGCGGCAGCGCCCCCACAGCCGCGCCAGCGTATGGCCGTCCGGCTGTGCTGCCTTACCACCGCGCACCAGCCATTGACTCACTG
-CGGCTGTACCGCCTCCCCGGCAGCAGCGGCTCAAAGTGAATGCTCCGCCCGCCGTTGTCGTTGAGTATCAGTCCGTCATCACGTAGCTGTAAGCGGATAT
-CAGAAGGCGCTTTCAGCCGGGGCCGAAAACGCCCACCGGTGCAGGCGTCTTCGTCCGGTAGCTGCTGTAGGTGCGGGAGAGAATGAACGGCAGCGGGCCG
-GGCAGCGCAAGGTCCGTCTCGCCGGGCAGCACCTTCGCCCCCAGCAGCGGATTTACCGGGTTGCCCGAAGTCATCCCGCCCGGACACACCGAGCACGCCA
-CGCCGGTGGGCGCGCCAATTCTTACACCTGCCGAACCCTGGACAATGGGACCGCCATACTGAGTCATATCTCCCTGACGCGCCGCTGGTTTTCCGCTCAT
-ATAAAGTGCCCTTTTTGGTTATTGTTCATATCCCTGTGTTAGCAACAAAAAATAAAATGACACACAAGACCAGCTAATGTATTTATATATTTTTCACATA
-AGCTTATTTGTTCTCAATCAACAACAACTGTTATTACAGGTCACTTTCAATATTTTATTAAACTAACATTTTTGGCACAGATGAATTCATCATCAGCAAA
-TTCACTATATGGATAATATCCATTCAACGCATATGATTTATGATTTTATTAGTCTGAGTTATTTTTGTAGGGCTATATTTAAAATCAATAAACTCCACCG
-ATTCAGATTAATATCAATAGAAAGATAGAAATCACCAATTCAATAACATCATCAATAAGAACATTGTAGAATTAATTTAAACAAGGCGTTCCATTCAACC
-AGAACGCCCCTATTCTCTCATCACCCCCAAACTGCCTGAACAGCGCCTTACCCTCCAACCAGTCGCGCACCCAGCCAGCCGCCGAAAGCGACAGCAGCAG
-CGCTCCGCTGCACGGCAGAACAATCCACAATCGCCAGTCTGGCTCCCACGGAAAATCAAACACTTTCGCCTGCAACACTGCCAGCGCCGTTTCCGCACCA
-ATTGCGGCCACCAGGCCGGAAACAAACCCAAGCATGGCGAACTCACACCACAACGTGGTACGCAGCAGTTTTTCCCGCACCGAGTGTGCGCCACACCACC
-AGCTCCTGATGACGCTGACGCATTCCCACCTGCACCTGTGCCAGCAACAGCAACATACCGCAGGCGGTGACCAGTACCACCATCACTTCCAGCGCCCGAC
-TTACCTGCTCCAGCACCTGACCGACCTGTTTTAAAATCGCGCCAATATCTAACAGGCTAATGGTCGGGAACTGGCGGTTGAGTTGTGTCAACATGCCGTT
-GCCATTCTCCCAGCGGAAACTGGTAAGCCAGCTCTGCGGTTGCCCGTCTAATGCCCCTTCAGGGAAAATAAAATAGAAATTAGGCCGCAGACTTTCCCAG
-TCCACTTTGCGCAGGCTGGTCACTTTAGCGCGGAACTCCTGGGTATCGCCCATAAAAGTCACGGTATCACCGAGGGCAACGTTTGGCGTTTCGCCAGCCC
-TCTTCCATCGACACTTCATCGGCTTTTGGCGGCCAGTTACCGGCGACAATCGGATTATGATCGGGCCGCGTATTTTGCCAGGTAAGATTGAGTTCGCGGT
-TAAGCGCCTCATCTTCATTACCTTCTGTCGGCTTATCGTTAATCGCCGTCAGCCGCGCCGCACCACCGGATAAAACGATTCCGGGACTATCTGATGTTCC
-GCGAGGAACGCTTTTAGCGGTGCTACCTGTTCTGTGGCGATGTTAATTAAAAAGTAGTTCGGGCTTTCTGGAGGTAGCTGCTGCTGCCAGCGGTCGAGCA
-GATCGCCACGCAACACCAGCAGCAGTGCCAGCAGCATAAAGGAGCGAAAATGCCGAAAGCTGACTTAACGTTGACCACGGCTGACGTAACAGGCGGCTAA
-CCGCCAGGCGCAGAGGCAGCGATTTCAGCGTCATGCGGCGAAGTACATTCAGCAGCATCCAGCCCAGCACACCGCACAGCAAAGCCAGTACTACCGCGCC
-CAGCACCGCCCAAAGCAGCATGCTGCCACCCATTAATCCGGCGAGCAGCAGCACAACCACCACACTGACAATCGGCAGATAAAACTTCAGCGGCCAGACG
-TTCGCTACCACATCATTACGTAATACGCGTAAGGCTGCGTTGCCAGCAACAAGCGATATGGTCGTAGCCCCACCAGCAGCGAGATGACCGTCATGGTGCC
-AAGCGCCCAGCCACGGCCAGAGGCTGGCTGGCGGTAGTGCAACAGGCAGAACGGGCTTGAGCAGCACCATCAACACGTTTTCGAACAACAGGCCTATGGC
-CCCACCGGTAACGGCTGAAAGCGTCAGCACCATCAACCACTGACCGACGATTAGCTTACGCAGTTGCGCCGCCCTGCCCCAGCGTTTTGAGGATCGCCAC
-CAGATCGTAGCGACTGCGACAGTAATGATTCATCGCTACCGCCACCGCTGCCACTGCCAGCAGCAAGGTCAGAAGCGCCAGCAGCAGGAACTGTTGCGAG
-CGTTCCATCGATCGCCCCAGCGCGCCTTCGTCCTGTTCCAGACCGTACCAGCGTTGTTCGGGTTTAAGCTGGGGTAACAACCATTTCTCATAGCCGTCGA
-GCTGGTTCTCGTTGCCCCGAATTTATAACGCCAGGTGACCCGACTCCCCGGCTGCGGCTCCGGTTTTATCGACATCCGCCAGATTCATCATCAGACGCGG
-AGCCATCTGGAAGGGTTAAAACCGGAATCCGGTTCCTGAATCACTTCTCCGGCAATCCGCAAGGTGGCATCGCCCACGTCAATGGTGTCGCCCGTTTTCA
-GGTTAAGCAGTGCCATCAGGCGTGGGGCCAGCAATACGCTGCCCGCCTGCGGTTTCAGGCCAGGGGATTAGTTTGCAGATCGCCATACATCGGGTAGATA
-TCATCCACCGCTTTGACGTTCGCCAGCTGCGGTGTGTCGCCTGCAAAGGTCATTGTGGCGAAAGTCAGCTGCTTGCCGACTTTCAGGCCGCGCTTTGCGC
-TTCCTCCAGCCACGCTTGCGGCACTTCGCGTGAACTGCGCAACGCCCGATCGCCCGCCATAAACTCACGGCTTTGCTGGCTTAAGCCCTTCTCCATGCGA
-TCGCTGATATTGCCCAGCGCCAGCACGCAGGCCACCGCCAGGCTTAGCGCCAGCCAGACAATTAATAGCGACGGCGAACGCCATTCGCGCCAGAACCAAC
-GTGCAATCATGCTTCCTCCTGCAACTGCCCGTTCACCAGCCGTAAAGCAGCGGTCGCAGCGTGCCGCCAGTTGCAGGTCGTGGGTCACCATAATCAACGT
-GGTGCCATGTTCACGGTTGAGGGAAACAGCAGGTCGGCAATTTTATCGCCCGTCTGGCGGTCAAGGTTGCCGGTGGGTTCGTCGGCAAACAGCACATCAG
-GTCGACCATTAAAGGCTCGTGCCAGCGCCTACTCGTTGCTGTTCACCGCCGGAAAGCTGTGCCGGAAGATGATCAGACGTTTACCCAGCCCTAACTGTTC
-GAGCAACGCTTTCGCCCCGTTACGACTTTCCGCT
->tig00000019 len=2223 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
-CGGTCAGGCGGCCTTATCGTCATAGCCATAGTGGACGGCAACACGGTGGCCTTCGCTCAATTGGCTGATGTCTGTCAGCCAGCCGTAGCCATCATACTGC
-CACTGCTCTGCCGGTTCGCCGTTCACCGTGCGGTGAGTGATACGGTCCGATTCATCGTAGTACCAGAGGATGACAAGTCCTCATCCTCACTCTGTGTGAG
-TTTTCCGGTCAGGTCATAATGATAACGTTGCGTCCGCCCGTCAAAGCCGCCCTGCTGTACCAGCCGGTCCAGCGCATCGTAACTGAAGACGCTGTGGCTG
-CCGTTCTCGTTGGTCAGTTGATGACGTCCGGCAGCATCGTAATCCATACTGCGCGTCAGCCCGCCCTGCGTGGTGCTGACCGCCTTTCCTACGCATCGTA
-CTGTGTCTCGCTCGGTTGCCGTCCGGGGTGATAACGGCAGTCAGGTCGCCTGCGGCGTTGTATTCATACCGCGTTTCACGGCCCTGTGCGTCTTTCACCG
-AGTTAACCGGCCACGGTTGTCATAGCGGCGGTAAAGGCTGATGCCTTCCTCGCGGTGGACCGCCGTCCTCATCTGGCCGAAGCGGTCGTATTCATAACGG
-GTCTGGTAGCCCGAGCAGTCGGTGAACGCCAGCAACGCTGCCGTAGCGGCTCCAGGTCATCTGCCGGTGCTGCCGTCGCATCCGTTGTCGTCGCCGGTAA
-CTCACTGTGCGCGTCATCGTAGCGGTAGCGTACTGTCTCCCCGCTGCGCGATGTCTCCGATACCAGCCTGCCCGGTTCATCATATTCCGGCGGCTCTCCA
-GCCGTCCGGGGACACCACCGCCGTCAGCTGGTTCCGTCGTTATAGTAAAATTTCGTCTCCCGCCCGTCCGGTGTGGTGATGTCCGTGATATCGCCGGACA
-CCACATTCAGACCGTACTCTGTCCTCCGTCCCGCCGCGTCCGTCTGCGCCGTGAGCCTTCCTGCCGCGTCATACCGCTGCGCGTGACGCTGCCGTCCGCC
-AGTTCTTTTCACCACCCGTTTCAGCCCGGCCCGCCTTCTGTATGCAGCACCTCACGCCGGTTCAGGCTGTCGGTGACGGTGATGCGGTCCTGCTCATAAA
-GATAGCGGTAAGCTAACCCTGCCGGGTTCAGTTGCTCCACCACCCGCCCCGTATCGTCGTAGCGGTAGCGCATCTCCGGCCTTCCCGCGTAACGGTGCGC
-CACCATCCGGCCCGGGTGCTGCGCGTCATACGTGAAAGCGCGCACCTGCGTATTGCTGCGGTCATATACCGCCAGCAGTTCACCGGCTTCCGTATACGTG
-TACCGCACCAGTGGCGCAGCGGGCAGGCTCTCCGGGTATGCCGGGTCGTGCATCAGCCACACCGCCGAAAGGCGGATACCCTGTCGGGGCCGTATTCGGT
-ACCGGGCGGTGTCGGGGAACGCTGAGGCTGAGAGGGCGGGAACTGTCAGAAGAAGATAGCGAAGAGGTGCGGGCCTCTTCCGCACGCTGCGCCTGCGTGG
-TCAGCACCAGACGGAACTCCCGCCCGGCACCGTCCGTCACGCCGGTGATTTCCCGGCCAGGTCACCGGCGGCCTCACGCCGGTACGTCAGCGTCCGCCGA
-AGCGGTCCGCCATCCCGGTAAGCACCCGAATGCGGCAGCAGCGGCGCTGGCAGTACGTCCTCAGCACCCGGCACCCGCTCAGACCACCCCGGTATCACCA
-CGGCCCTGTGCGCTGTTGGTCGCCAGGTAAAGATGCGGGCTTAACCGGATATCCGGCGGCAGCGCCCCACAGCCGCGCCATATGGCCGTCCGGCTGTGCT
-GCCTTACCACCGCGCACCAGCCACATTGACTCACTGCGGCTGTACACCGCCTCCCGGCAGCAGCGGCTCAAGTGAATGCTCCGCCCGCCGTTGTCGTTGA
-GTATCAGTCCGTCATCACGTAGCTGTGGCGGATATCAGAAGGCGCTTCCAGCCGGGGCCGAAAACGCCCACCGGTGCAGGCGTCTTCGTCCGGTAGCTGC
-TGTAGGTGCGCGGGAGAATGAACGGCAGCGGGCCGGGCAGCGCAAAGTCCGTCTCGCCGGGCAGCACCTTCGCCCCCAGCAGCGGATTTACCGGGTTGCC
-CGAAGTCATCCCGCCCGGACACACCGAGCACGCCACGCCGGTGGGCGCGCCAATTTTACACCTGCCGAACCCTGGACAATGGGACCGCCATACTGAGTCA
-TATCTCTGACGCGCCGCTGGTTT
--- a/test-data/canu_unassembled_result2.fa	Fri Jun 08 04:43:41 2018 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,48 +0,0 @@
->tig00000005 len=254 reads=3 covStat=-1.39 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
-AAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTT
-CGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTCTGATCCTGCCTCATTATATTTATCGA
-GCCCACGAGACTAAGGCGAATCTCGTATGCCGTCTTCTGCTTGCAAAAAAAAAC
->tig00000006 len=268 reads=3 covStat=-1.39 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
-AAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGA
-TAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATCCTATTATTTATCGCACCTACGTTCAATATTAC
-AGCTGTCTCTTATACACATCTCCGAGCCCACGAGACTAAGGCGAATCTCGTATGCCGTCTTCTGCTTG
->tig00000008 len=248 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
-CTCCGGGCCCATAACACTTGGGGGTAGCTAAAGTGAACTGTATCCGACATCTGGTTCCTACTTCAGGGTCATAAAACCTAAATAGCCCACACGTTCCCCT
-TAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCG
-ATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCT
->tig00000009 len=252 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
-AATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGA
-GCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGTTTTATGACCCTGTCTCT
-TATACACATCTCCGAGCCCACGAGACTAAGGCGAATCTCGTATGCCGTCTTC
->tig00000010 len=250 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
-CTCCGGGCCCATAACACTTGGGGGTAGCTAAAGTGAACTGTATCCGACATCTGGTTCCTACTTCAGGGTCATAAAACCTAAATAGCCCACACGTTCCCCT
-TAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCG
-ATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGT
->tig00000011 len=251 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
-AAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTC
-CCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGTTTTATGACCCTGAAGCTGTCT
-CTTATACACATCTCCGAGCCCACGAGACTAAGGCGAATCTCGGATGCCGTC
->tig00000012 len=251 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
-ATTCAATTGTTATTATTATGTCCTACAAGCATTAATTAATTAACACACTTTAGTAAGTATGTTCGCCTGTAATATTGAACGTAGGTGCGATAAATAATAG
-GATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAA
-ATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCC
->tig00000013 len=251 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
-GTATCCGACATCTGGTTCCTACTTCAGGGTCATAAAACCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCT
-ATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTC
-GCAGTATCTGTCTTCTGTCTCTTATACACATCTCCGAGCCCACGAGACTAA
->tig00000014 len=254 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
-AATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGA
-GCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGTTTTATGACCCTGATACA
-CATCTCCGAGCCCACGAGACTAAGGCGAATCTCGTATGCCGTCTTCTGCTTGAA
->tig00000015 len=247 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
-GGGTCATAAAACCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCAT
-GCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGTCT
-CTTATACACATCTCCGAGCCCACGAGACTAAGGCGAATCTCGTATGC
->tig00000016 len=249 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
-ATTCAATTGTTATTATTATGTCCTACAAGCATTAATTAATTAACACACTTTAGTAAGTATGTTCGCCTGTAATATTGAACGTAGGTGCGATAAATAATAG
-GATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAA
-ATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGAT
->tig00000017 len=261 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
-GTATCCGACATCTGGTTCCTACTTCAGGGTCATAAAACCTAAATAGCCCACACGTTCCCCTTAAATAAGACATCACGATGGATCACAGGTCTATCACCCT
-ATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTGGAGCCGGAGCACCCTATGTC
-GCAGTATCTGTATACACATCTCCGAGCCCACGAGACTAAGGCGAATCTCGTATGCCGTCTT
--- a/test-data/canu_unitigs_result1.fa	Fri Jun 08 04:43:41 2018 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,155 +0,0 @@
->tig00000001 len=15307 reads=47 covStat=1.00 gappedBases=no class=contig suggestRepeat=no suggestCircular=no
-AAAATAGTCAATAGTAGGATGCCTGACAATTTATGCTCTACTTTCCAGGCTTATCTGTAATCGGGAATAATAGAAATATGTTCCATCAATTTTTAAGTTC
-CATTTGTTCACCTTATTTATGTAAGGAGTATTTGATCATGTATAAGCTATGAAAAACAGCTTTAGGTAATAAGAATATCTCAATTTTTAAACATAAAATG
-CGAATTATTTAGTACAAAAAGGCGTTACGTGATCTTTCCTGGGATACAACTCTGGCAATGGTATCGTGAACAGGAATACCATTTTCAAAATCACCATATT
-GCTTCAAAAAATCGAGATGTGTTTCCCCGAAATCCTCTATATCTTCCCAACCTTCTGCACCAGAAATAACGGCACAAATAGTCAAACAGTAGAATATCTG
-ACAATTTATGCACCACTTTCAGGCTTGTCTGTAATCGGGTGTAATAGAAATATGTTCCATCAATTTTTTAAGTTCCATTTGTTCACCTTATTTATGTAAG
-GGTATTTGATCATGTATAAGCTATGAAAAAACAGCTTTAGACAATAAGTAGTATCTCAATTGTTGAACTTAAATTCGAATTATTTAGTACAAAAAGTAGC
-GTTACGTGATCTTTCCTGCAAATGGAACGCAAAATAAACACCTATTCCATGAGTTATATAATTTTTCACAATGATTAATTTGTTTTCTCAGGAAGAGATT
-TTATTTCTCTTCACTACGAATTAGTTCATGCTGTATCTTTATTAAACATTCGTAAGACTCATTTTTGTTCGGGAGATGTGCTGTCATTCGAGCATAAGTT
-GGTTTCTCATCTTTAAAATATTTTACCATGATTGAATTATCAAGGACTGCCAACAACTGAACTGGATCACTGCTCTTTTGATAGATACCCGCTCTTATAT
-AACTTCTAAACCGATCGCCGAGAAACGCCGTTTTTCTGCTGTATTTATCAACTCCTGCAACGTTCCTTTGATGGCATGATTTTCATTAAGGCGTAGTGAC
-CCGACGCGAATTAAGAGTCTCGCCCCGCTTGGTGTGAATTTATTATTTTTACATGTACCCAGTTCTGTTTGCCAATAATACTCACCGATGTCCTCATTCT
-GATACCATCTCACATGGCTTTATTATTTAAGACAGGAAACGCGGAAAAATAGTACCCTTAGCGAAAATAGTAAAACAATCATGATCTTTAGCTTGTATTT
-CGCAATCAGCTATAACACCAAAACTAACAAATATCATCAGCAAAAAGAACAAAACTCTTTTCATTTTCTTATTCCTCTCGATGTTCTCTGTTTCATCTTA
-GCTAAAATTTCACCCAAATCATCTATCCCTGCTGTTGCTGGCCCATCGGGTTTATTAATGTCTGGGAATAAATAGGGTTCTGCACAAGTATATCCTGGTG
-GTAATTGAGTTGTTGGCCAATTTGTCTGTGGCAGGTAATCACTTGCTGTCTTTGTATCCATCCCTGGATACTGGGAATCATCCTGTGGCGTACAAGTCAG
-ATTTGGTTTTACCCACTTCCTGCAATACAGTGTGTAGTCGTAGGGCTTAATGCTCTGAAGAATGTTTTGAAAACATTAGGCGCACTACTGGCCTGGTCAA
-TAGGATATGGCAGTCTTAATTGTTTCGCTATGTCCGGCAATTTACTTGGATCGGGCGTAGGCGGTTTGTTGGTCTCGCTCCATATCCGCCATTATTTAAG
-TGTCCATATTTTGATGCCAGTCCCATTGAATCTATATACTGAACCGGATTCAGCGGATACTGATAAAATTCCATCCCCCTTCAGCCCAATCGGATCCTGA
-GTGATATACCTCCCTGCAGCGGGTCATAATAGCGGTGGCGGTTGTAATACAGGCCGGACTCCTCATCATACTGCTGCCCCGGCAGGCGGATAAGCTGCTG
-CAGCTGATGCGGGTTCTCTTCATTCAGCAGGTTGCCCCATTCATCGTATTCTGCGCACCATTCTGTTGCCCCTTCCGTGCTGACAAGCGCCAGCGGCAGG
-CCGCGATGGTCGCAGTGGTACAGGTGGATTTTCGCGCCGGCGTGTACACCGGGTCCATCTGGTTTTGCATCTGCTCCACCGTCAGGCCGCACGATGCCAG
-CCAGCGGCGGCTTTCCTCACTCACCCGGTCAGCCAGGATTTCACTTTCCAGCCGGTCGAGCATCTGCACCAGCACCGGCGGAACACCACACTGCCACCGT
-CTTCGCCGCCGGACTGCTGAAGGGTATCCGCCAGGCTGCGGCGCTGCGTTCGCCAGCTCACCGGTGGCGGTTTCAACCTGATGAGTGGCGTGAAGCTCCC
-CGGCTGATAAATCGTCTGGATGCGGGTTCTGTCGTTCTGTATCGTGGTCAGGCGGTCGCCGTCCCAGCCGTACCAGGTCACTTGCGGTTTCCGTGACAGC
-GACATCCAGCCCGTCAGGTCCCGTTCACGTCGCCACACCCGTTTTGCCACCCTGCGGCCCAGCGGGTCGTAAAGATAGCGGCTTTCGACCAGCGGCTCTG
-CATATTGTGTCCGCGTGTAGTGCACCAGCCGGTGCTGACTGTCGTAATGGTACCGGTGGGTGCGCTCATCATCCGTGCGGATAACCCTTCCGGGATGAGG
-TCGGTTTTCTCCGTCAGCCTGCCGTGACGGTCATACCGGTAAAGATAGTGCGCGTCACGGGCGATACGGTTATCCGGCCACATGCTGAGGGTGCTGTCCG
-GTGCAGCTCCGGTCGGGCAGGCGGTTACCTGCCGGGTCTGTGGCATACGGGATATCAATGCCCAGGTTACATATAATAATAAGAGCAATTAACTTAATTT
-ATTTGTTTATAATGCGCTTACTTAATACAAACCATTGAATATACCCTCCTGACAGAAAATAAAGCCATATTATTATCGCCATAATATACTTACTATCAAT
-CCTTACGCCAATAATGTCTGATACAGTCCCTATAAATATTAGAGCAATAAAGAATACTATGCCTGTTGGAAAACATATTACCATCATTCCATAAGACATG
-AGACTAATTAACTCGCTCACATCACGAGTGGAGTCTAATAGTGAAAGTCTATGCATGGAAAAGAATAGTATTAAAAGCGATAAAGCCAGCCATATAGCTC
-TGAATAAAAAATAATATATTTCATTACATCACTCCGGTGAATACAAATCTAATAAAACGTCCAATGTTATTTCCGGAGCACTTCATCTTACATGTTTCTA
-AAGAATCATTAGACCAGTCTTGGCAGTTTTAAATAGCCCTAAATTTATAGGTGTGAATATATCAGGCAATACAGAATAACGCGGCCTTACCTCTTTAAAC
-TTCCTTTTAAACAGTTCTCCACACAACTATTATCGGTTTCAACGAGGTCACAACGGCCAGCAGCTTCTTTGTATCATTACTTGCTTTACCTGGCCCCCAT
-AGACCATCTCCTTTGATTCTCCCCGTTGGTCTTGGCCACCACAAGTATAGTCCCTTTACCATCTGGGACACAAAGATATTGATGATAGAACGGATTCCCC
-ATATATCTGGACCGCTTCTTTCACCAGTTCCGCCCATTGAATGCAGTGGCTTAATGCATTTTAGTGTTTCTAATCCTAATGGATCTATATTTGAGATCGG
-ATTCAACGGATACTGATAAAATTCCATCCCCTTTCAGCCCAATCGGATCCTGAGTGATATATCGCCCCTGCAGCGGGTCATAATAGCGGTGGCGGTTGTA
-ATACAGGCCGGACTCCTCATCATACTGCTGCCCCGGCAGGCGGATAAGCTGCTGCAGCTGATGCGGGTTCTCTTCATTCAGCAGGTTACCCCATTCATCG
-TATTCTGCGTACCACGCTGTTGTCCCTTCCGTGCTGATATGGGCCAGCGGCAGGCCGCGATGGTCGCAGTGGTACAGGTGAATTTTTCGCGCCGGCGTGT
-ATACCGGGTCCATCTGGCTTTGCATCTGCGCCACCGTCAGGCCGCACGATGCCAGCCAGCGGCGGCTTTCCTCACTCACCCGGTCAGCCAGGATTTCACT
-TTCCAGCCGGTCGAGCATCTGCACCAGCACCGGCGGGAACACCACACTGCCACCGTCTTCGCCACCGGACTGCTGAAGGGTATCCGCCAGGCTGCGGCGC
-TGCGTTTTCGCCAGCTCACCGGTGGCGGTTTCAACCCTGATGAGTGGCGTGAAGCTCCCCGGCTGATAAATCGTCTGGATGCGGGTTCTGTCGTTCTGTA
-TCGTGGTCAGGCGGTCGCCGTCCCAGCCGTACCAGGTCACTTGCGGTTTCCGTGACAGCGACATCCAGCCCGTCAGGTCCCGTTCACGCCGCCATACCCG
-TTTTGCCACCCTGCGGCCCAGCGGGTCGTAAAGATAGCGACTTTCGACCAGCGGCTCTGCATATTGTGTCCGCGTGTAGTGCACCAGCCGGTGCTGACTG
-TCGTAATGGTACCGGTGGGTGCGCTCATCATCCGTGCGGATAACCCTTCCGGGATGAGGTCGGTTTTCTGTCAGCCTGCCGTGACGGTCATACCGGTAAA
-GATAGTGCGCGTCACGGGCGATACGGTTATCCGGCCACATGCTGAGGGCGCTGTCCGGGTGCAGCTCCGGTCGGGCAGGCGGTTACCTGCCGGGTCTGTG
-GTATACGGGATGCGGATATCCAGATTCGCTGCGGTGGTGTGAACGCCGGTCAGCCTGCCGGTGGTGCTGTAGCTGTAACTCCGGGTCTGGCGCGGGCTGC
-TGATGCGGATGAGTTCGCCGTTGTCGTTCCAGGTGTAATCGCGGTCAGACAGCAGGCTGTTCAGGTGCTGGCTCTGTAACTGCCCGGCAGGGGTATAAGC
-GGTGGTGAGTTCATAACGGCCGAAGCTGCGCAGCGTTTCCCGGTGCAGGCGGTCGCGGGTGTACTCCACCAGCGGTGTGTCGCCGAGTTTCATGCCTGAC
-AGCCAGCCGCTGCCGTAGGTCAGCCATTCCACGGCGGGCAGGCTGTCCGGTATACAGCGGTTCGCCAGTCCCTGTGCGTTGTACGCATGTCTGGTCTCAT
-GCTGCCAGAGCAGTTCATTCGTCTGCGGATGATGCACCGTCAGGTGTTCACTGGCGAGGCGGCCTTTACTGTCATAACCATAGTGCACCGTCACCCGGTG
-CCCTTCGCTGATATGGCTGATGTCTGTCAGCCAGCCGCGTTCGTCATACTGCCACCGCTCTGCGGTTTCGCCATTCACGGTGCGGTGCGTGAGGCGGTCT
-GCTTCGTCATAGTGCCAGTGGGTGACCAGCCCTCATCCTCGCTGCGGATAAGTTTGCCGGTCAGGTCGTGGTGATAACGCTGTGTGCGGCCGTCAAAGCC
-GGTTTCCTGTATCAGCCGGTCGAGTACATCGTAACGGAAGGTGGTGTGGCTGCCGTTTTCACTGGTCAGGCGGATGACCCGTCCGGCAGCATCGTATTCC
-ATACTGCGCGTCAGACCGCCCTGCGTGGTACAGATGGCTTTTCCCCACGCATCGTACTGTGTCCCGTTTCTGCTGCCGTCCGGGGCAATGACGGTGGTCA
-GGTCACCGGCGGCGTTGTATTCATACCGCGTTTCATGGCCCTGCGTGTCTTTCACGGCAATTAACTGTCCACGGCTGTCGTATGCGCGGTACTGACTCAG
-CCCTTCCTCGCGGTGCACCGCCGTCACCTGACCAAAACGGTCATGGTCATAGCGGGTTACATAACCGGAACAGTCAGTGAAGCTCAGCAACTGACCGTAA
-CGGCTCCACGTCATGGTTTTCCGGCTGCCGGTGGCATCTTCCGTTGCGCAGGGTAAGTCACTGTGTGGATTATCATAACGGTAGCGGGTGATATCGCCGT
-CAGGGGCAGTTTCCTGAATCAGACGGCCCCATTCATCATATTCCCGGCGTATTTCCAGCCCGTCAGGCCCGGTGGCTGACGTTAACTGGCTGTGGTGGTT
-ATAGTAAAACGCCGATGCCCTGCCATCCGGCGTGGTGATGCGCGTGATGAGGCCCGTCACCACATCCGGACTGTATTCTGTTGTCCTGCCTGCGGCATCC
-GTCTGTGCCCTGAGCCTGCCCACCGCGTCAAACTGACTCTGCGTGACGCTGCCGTCCGCGTGTTCCTTTTCACCACCCGCTTCAGCCCGCCTTCACCCTG
-CGTGTGCAGGACTTCACGGCGGTTCAGGCTGTCGGTGATGGTGATGCGGTCCTTCTCATACTGATACGTGTAACTTAAGCCTGCCGGGTTTAGCTGTTCT
-GTCACCCGCCCGTCGCTGTCGTAACGGTAACAGATTTCCGGTCGGCCCGTGTGACGGTGCGCCACCATCCGGCCCCGGTATTTATCATCGTAAGTAAAGC
-TGCGCACCTGTGTATTGCTGCGGTCATACACCGCCGCCAGTTCGCCGCGGGCGTCCAGCCATAGCGCACCAGCGGCGCGGCAGGTAAATTCTCCGGGTAT
-TCCGGGTCGTGCGTCAGCCACACGGCAGACAGACGGATGCCGTTGTCCCGGCCATATTCGGTGTAACCCGGCAGGGTATCAGGAAAAGCGGACGGTTCCG
-TCCCGCCGGAAATGGCCTGCTGCCGGGCTTCTTCTGCCCGCTGCGCCTGCGTGGTCAGTACCAGCCGGAAGTGACGCCCGGCACCATCCGTCACGCCGGT
-GATTTCGCCGCTGAATTCACCGGCGGCTTCGCGGTGGAACGTCTGTGTGCGCCCGAAGCGGTCCACCAGCCCGGTCAGTACCCGGTACGGCGGCAGCGGC
-GCAGGCAGCACCTCATCCGCTTCCGGCACCCGCTCACACCAGCCGAGCAGCCACCACGGCCCCTGCGGACTGTTTGTCGCCAGATAACGATGCGGACTTA
-AGCGGAGTTCTTCCGGCAGCGCCTGCCAGAGTGCGGCCAGCCGGTGACCTTCATCCAGTTTCGCCACGCCGCCGCGCACCAGCCACAGTGACTCGCTGCG
-GCTGTAACCGTCCTCACCGGGAAACAGGTGCTCAAAATACAGGCTTCTGCCGCCGTTATCACTGAGTATCAGTGTGTTATCGCGCAGCTGTAAGCGGATA
-TCCGCAGGCATTTTCCAGCCGGGGCCGAGGCTCCCCACCGGCGCGGGCGTTTTGTCCGGTAACTGCTGTAGGTGCGGGAGAGAATGAACGGCAGCGGGCC
-GGGCAGGGCGATGTCGGTTTCACCGGGAAGGACCTTTGCACCGAGCAGCGGATTGACCGGATGGCCGGACGTCACCCGCCGGGGCACACCGAACAGGCCA
-CGCCGGTGGGGCACCGATGCGTACCCCGGCTGAACCCTGGACAATGCTACCGCCATACTGCGTCATGTCGCCCTGACGCGCCGCCGGTTTTCCGCTCATC
-TGCTCATCCTTGTTTTATCGGGTTATTTGTCTGCTGACAGGCGAAACCCTACAGATTTATAAGAAAGCCTTAAGTGAGATATCTGTCAGATAAGAACAAT
-TAGGAAAATATTTATATATATTTCATGAATATATGTTTCGATTGGTATAACGATGTCTAAATATTCCTCTGAACATCTTCCTGATACAAAAACCGCCAGC
-GTTTCCGCTGGCGGTTTTCAATGTATTCAAAACTCAGCAATCAATAAAATCACCAGTTGCCTTTTCGGCCTGATCCATCCACACCGGTTTATCGCTGGTT
-TTCGACCAGACGCGATGCAGGTAGCTGTAAAAGCGGGCGCGGTCTTTCCAGAAAAGCATGAAAGGCAGCGCCAGAACGCCCGCTGCAACCGCATAAGTAC
-GGCGTAAAAAGATAAGCCATGCAGGATATTCTCTGTAGAGTTCCATACTTTTCTCCCCTTTTGTATCTACCCGGTGAATGGCACCGGAAAAATGAATTTG
-TTTATCTGATGAAAATAGTACCGCCTTTGTGTAATTTTACTACTCATCCGACCACTTATTTTTGCTTATTGATGGTTTATTTACATTCATCCTGTAATTA
-AGTTACACAAAAGTTAAATTAATACTAAACATTAGTTAAATCATGGCTTTTGCCATTTTTATACTTTTACACCCCGCCCGCAGATTTTTGCGAAATCTTT
-GCAGCCAGAATTCTACCCTTCCGGTATCACTTTTAGGCCACTGGAGGTGCACTGTGAGTGCAGGCGTGATAACCGGCGTATTGCTGGTGTTTTATTACTG
-GGTTATCTGGTTTATGCCCTGATCAATGCGGAGGCGTTCTGATGGCTGCGCAAGGGTTCTTACTGATCGCCACGTTTTTACTGGTGTTAATGGTGCTGGC
-GCGTCCTTTAGGCAGCGGGCTGGCGCGGCTGATTAATGACATTCCTCTTCCCGGTACAACGGGCGTTGAGCGCGTACTTTTCGCGCACTTGGCGTCTCTG
-ACCGTGAGATGAACTGGAAGCAATATCTTTGTGCCATTCTCGGCCTGAACATGCTGGGGCTGGCGGTGCTGTTTTTATGTTGCTCGGTCAGCACTATCTG
-CCGCTTAATCCACAGCAGTTGCCAGGGCTGTCGTGGGATCTGGCGCTGAATACCGCCGTCAGCTTTGTCACCAATACCAACTGGCAATCTTATAGCGGTG
-AAACCACGTTGAGCTATTTCAGCCAGATGGCGGGCTTAACGGTGCAAAACTTTCTTTCTGCCGCCAGCGGGATTGCGGTGATTTTGCCCTCATCCGTGCG
-TTTACCCGCCAGAGCATGAGCACGCTCGGGAATGCCTGGGTCGATCTGCTACGCATCACGTTATGGGTGCTAGTCCCTGTGGCGTTGTTGATTGCACTGT
-TTTTATTCAACAAGGTGCGCTGCAAAACTTTCTGCCTTATCAGGCTGTGAATACCGTTGAAGGAGCGCAACAGCTGTTACCCATGGGGCCTGTAGCTTCT
-CAGGAAGCGATCAAGATGCTCGGTACTAACGGCGGTGGCTTCTTTAATGCCAACTCGTCGCATCCGTTTGAAAACCCAACCGCACTGACCAACTTCGTGC
-AGATGCTGGCGATCTTCTTGATCCCAACGGCGCTGTGCTTTGCCTTTGGTGAAGTGATGGGCGATCGCCGCCAGGGGCGCATGTTGCTGTGGGCGATGTC
-AGTGATTTTGTCATCTGCGTAGGCGTGGTGATGTGGGCAGAAGTTCAGGGTAATCCTCATCTGCTGGCACTGGGCACGGACAGCAGCATCAATATGGAAG
-GTAAAGAGAGCCGTTTCGGCGTGCTGGTCAGTAGCCTGTTTGCGGTCGTGACGACGGCGGCTTCCTGTGGCGCGGTGATTGCGATGCATGATTCGTTTAC
-CGCTCTCGGTGGCATGGTGCCGATGTGGCTGATGCAAATTGGTGAAGTGGTGTTCGGCGGTGTCGGTTCTGGTCTTTACGGCATGATGCTGTTTGTCCTG
-CTGGCGGTGTTTATTGCCGGGCTGATGATTGGTCGTACACCGGAATATCTGGGTAAAAATCGACGTACGCGAGATGAAACTGACTGCACTGGCAATTCTG
-GTTACCCCGACGCTGGTGCTGATGGGCGCGGCGTTGGCGATGATGACCGACGCCGGACGTAGCGCCATGCTCAACCCTGGCCCGCATGGTTTTAGCGAAG
-TGCTGTACGCCGTGTCATCCGCCGCTAACAACAACGGCAGCGCCTTTGCCGGATTAAGCGCCAACTCTCCGTTCTGGAACTGTTTACTGGCGTTCTGCAT
-GTTTGTCGGTCGCTTCGGGGTGATTATCCCGGTGATGGCAATTGCCGGTTCGCTGGTGAGTAAAAGAGCCAAGCCGCCAGCTCCGGCACGCTGCCAACGC
-ACGGCCCGCTGTTTGTTGGCCTGTTAATCGGCACCGTGTTGCTGGTTGGCGCACTGACCTTTATCCCTGCCCTGGCGCTTGGTCCGGTGGCGGAATATCT
-CTCCTGATGATATTGAGTGAGCACTGAATATGAGTCGTAAACAACTGGCGCTATTCGAACCAACACTTGTCGTTCAGGCGCTGAAAGAAGCGGTGAAAAA
-ATTAAACCCGCAGGCGCAATGGCGCAATCCGGTGATGTTTATCGTCTGGATCGGCAGTCTGCTGACCACCTGTATTAGCATCGCGATGGCAAGCGGTGCG
-ATGCCCGGCAATGCGCTGTTTAGCGCGGCCATTAGCGGTTGGCTGTGGATCACCGTACTGTTCGCTAATTTCGCCGAGGCGCTGGCAGAAGGCCGCAGTA
-AAGCGCAGGCCAACAGTCTGAAAGGGTGAAAAACTGCCTTTGCCCGCAAGCTGCGTGAGCCGAAATATGGCGCTGCGGCGGACAAAGTTCCTGCCGACCA
-ACTTCGTAAAGGCGATATCGTACTGGTAGAAGCTGGCGATATTATCCCCTGCGATGGTGAAGTTATTGAAGGGGTGCATCGGTCGATGAAAGCGCCATCA
-CCGGGGAATCGGCACCGGTGATCCGTGAATCCGGCGGCGATTTTGCCTCCGTCACCGGCGGCACGCGTATTCTTTCTGACTGGCTGGTGATTGAGTGTAG
-CGTTAACCCCGGCGAGACATTTCTGGATCGGATGATCGCGATGGTGGAAGGCGCACAGCGACGCAAAACGCCGAACGAAATTGCCCTGACCATTCTGCTG
-ATTGCCCTGACTATCGTCTTTTACTGGCAACCGCCACGCTGTGGCCGTTTTCCGCGTGGGGCGGTAATGCAGTCAGCGTAACGGTACTGGTGGCGCTGCT
-GGTCTGTCTGATCCCAACCACTATTGGCGGCCTGTTGTCAGCGATCGGCGTCGCCGGGATGAGCCGGATGCTAGGCGCGAATGTGATTGCCACCAGCGGA
-CGTGCAGTTGAAGCGGCAGGTGACGTTGACGTTCTGCTACTGGATAAAACCGGCACCATCACACTCGGTAACCGTCAGGCGTCGGAGTTTATCCCCGCGC
-AGGGCGTGGATGAAAAACGCTGGCTGACGCCGCACAACTGGCTTCGCTGGCTGATGAAACGCCGGAAGGCCGCAGTATTGTGATCCTCGCCAAGCAGCGT
-TTTAACCTGCGCGAGCGCGATGTGCAGTCGCTCCATGCCACCTTTGTACCGTTTACTGCGCAAAGCCGGATGAGCGGGATCAACATCGACAACCGCATGA
-TCCGTAAAGGTTCTGTCGATGCCATTCGTCGCCATGTTGAGGCTAACGGTGGTCACTTCCCTACCGATGTTGATCAAAAGTCGATCAGGTTGCGCGTCAG
-GGAGCCACGCCGCTGGTGGTGGTGGAAGGTTCTCGTGTGCTGGGCGTTATTGCGCTGAAAGATATCGTCAAAGGCGGTATTAAAGAGCGCTTCGCCCAGC
-TGCGCAAAATGGGCATTAAAACGGTGATGATTACCGGCGATAACCGTCTGACTGCCGCCGCGATTGCTGCGGAAGCGGGTGTCGATGATTTTCTCGCCGA
-AGCGACACCGGAGGCCAAGCTGGCATTGATCCGTCAGTATCAGGCGGAAGGTCGTTTGGTAGCGATGACCGGCGACGGCACCAACGATGCTCCGGCGCTG
-GCGCAGGCAGATGTCGCGGTGGCGATGAACTCCGGCACCCAGGCGGCGAAAGAGGCGGGCAATATGGTCGATCTCGACTCTAACCCGACCAAGTTGATCG
-AGGTGGTGCACATTGGCAAACAGATGCTGATGACCCGTGGCTCGCTGACCACCTTCAGCATTGCCAACGATGTGGCGAAATACTTCGCCATTATTCCGGC
-GGCATTCGCGGCAACGTATCCGCAGTTAAATGCGCTGAACATCATGTGCCTGCATTCGCCCGACTCCGCAATCCTCAGTGCGGTGATTTTCAACGCCTTG
-ATTATCGTCTTTGATTCCCCTGGCGTTAAAGGCGTGAGTTATAAACCGCTTACCGCTTCTGCCATGTTGCGCCGTAACTTATGGATTTACGGTCTGGGTG
-GGCTGCTGGTGCCGTTTATCGGTATCAAAGTCATTGATTTACTGCTGACCGTTTGCGGTCTGGTGAGGTTTACCATGAGTGGATTACGTCCGGCATTATC
-AACATTTATCTTTCTGTTATTGATTACTGGCGGCGTTTACCCGCTGCTGACCACCGTACTGGGGCAATGGTGGTTTCCTGGCAGGCCAATGGTTCGTTGA
-TTCGTGAAGGTGATACGGTGCGCGGTTCGGCATTAATCGGGCAGAATTTTACCGGCAACGGCTATTTTCATGGTCGCCCGTCGGCAACGGCAGAAATGCC
-CTATAATCCACAGGCTTCTGGCGGGAGCAATCTGGCGGTCAGTAACCCTGAGCTGGATAAACTAATAGCCGCACGCGTTGCTGCATTACGGGCCGCTAAC
-CCGGATGCCAGCGCGAGCGTTCCGGTTGAACTGGTGACGGCATCGGCAAGCGGGCTGGACAATAATATCACCCGCAAGCGGCGGCCTGGCAAATCCCACG
-CGTGGCGAAAGCGCGTAATCTCAGCGTTGAACAGCTCACGCAACTGATCGCAAAATACAGCCAACAACCGCTGGTGAAATATATCGGCCAGCCGGTTGTC
-AACATTGTTGAACTCAATCTGGCGCTGGATAAACTTGATGAATAACGAACCCTTACGTCCCGACCCCGATCGTCTGCTGGAACAAACTGCCGCGCCGCAT
-CGGGGAAGCTGAAAGTTTTCGGTGCCTGTGCAGGCGTCGGGAAGACCTGGGCGATGCTGGCAGAAGCCCAGCGACTGCGGGCGCAAGGGCTGGATATTGT
-GGTTGGCGTGGTAGAAACCCACGGGCGAAAGATACCGCCGCCATGCTGGAAGGGCTGGCTGTTCTGCCGTTAAAACGCCAGGCGTACCGTGGGCGGCATA
-TCAGCGAGTTTGATCTCGATGCCGCCCTCGCCCGCCGCCCGGCGCTGATCTTAATGGACGAACTGGCGCACAGTAATGCGCCAGGTTCCCGTCATCCCAA
-ACGCTGGCAGGATATCGAAGAACTGCTGGAAGCTGGCATTGATGTTTTCACTACCGTCAACGTTCAGCATCTGGAAAGTCTGAATGATGTGGTCAGCGGC
-GTCACCGGAATTCAGGTACGGGAAACCGTGCCCGATCCTTTTCGATGCCGCCGACGACGTGGTGCTGGTGGACTTGCCCCGGACGATCTGCGCCAGCGGC
-TGAAAGAAGGCAAAGTCTATATTGCCGGGCAGGCGGAGCGCGCCATTGAACATTTTTCCGCAAAGGTAATCTGATCGCCCTGCGCGAACTGGCACTGCGC
-CGTACTGCCGATCGCGTTGATGAGCAAATGCGCGCCTGGCGGGGCATCCTGGCGAAGAGAAAGTGGCACACGCGCGACGCGATCCTTTTATGCATCGGCC
-ATAACACCGGCAGCGAAAACTGGTCCGCGCAGCGGCGCGGCTGGCGTCACGGCTGGGTAGCGTCTGGCACGCGGTGTATGTTGAAACCCCTGCCCTGCAC
-CGCTTACCGGAAAAACGTCGGGCAATTCTCAGCGCCTTACGTCTGGCGCAGGAACTGGGCGCGAGACGGCAACACTTTCTGATCCAGCGGAAGAGAAAGC
-GGTAGTGCGTTATGCCCGTGAACATAATCTCGGCAAGATTATTCTCGGTCGCCCGGCCTCGCGCCGCTGGTGGCGTCGGGAAACGTTTGCTGACCGACTG
-GCGCGCATCGCCCCGATCTCGATCAGGTGCTGGTCGCGCTTGATGAACCACCCGCCCGCACGATTAACAACGCGCCGGATAACCGCTCTTTTAAAGACAA
-GTGGCGTGTACAAATTCAGGGATGCGTGGTTGCCGCCGCGTTATGCGCCGTTATCACCTTAATTGCCATGCAGTGGCTGATGGCGTTTGATGCCGCCAAC
-CTGGTGATGCTGTATCTGCTTGGCGTGGTGGTGGTGGCGCTATTTTATGGACGCTGGCCTTCAGTGGTTGCCACCGTCATTAATGTAGTGAGTTTCGATC
-TCTTTTTATCGCCCCACGCGGCACGCTCGCCGTCTCTGATGTGCAATATCTGCTGACCTTCGCGGTGATGTTAACCGTCGGGCTGGTGATCGGGAACCTT
-ACTGCTGGCGTGCGTTATCAGGCGCGGGTAGCCCGTTACCGCGAGCAACGCACACACGGCACTTATATGAAATGTCGAAAGCTCTGGCGGTGGGCCGCAG
-TCCGCAGGATATCGCTGCCACCAGCGAACAATTTATTGCCTCCACGTTTCATGCCCGCAGTCAGGTGTTGTTGCCCGATGACAACGGTAAATTGCAGCCG
-TTAACACATCCGCAAGGAATGACGCCGTGGGACGATGCCATCGCGCAGTGGAGTTTTGATAAAGGCCTGCCTGCGGGCGCGGCACCGACACGTTACCCGG
-TGTACCGTACCAGATTTTGCCGCTAAAAAGCGGCGAGAAACCTACGGGCTGGTGGTGGTGGAGCTGGGAATCTGCGCCAGTTGATGATCCCGGAACAGCA
-GCGCCTGCTGGAGACGTTACGCTGTTAGTCGCCAATGCCCTGAGCGGCTGACGCTAACCGCCAGCGAAGAACAGGCGCGGATGGCAAGCGAACGTGAACA
-GATCCGCAACGCCTGCTGCTGGCGGCGCTTTCGCATGATTTACGCACGCCGCTTACGGTGCTGTTTGGTCAGGCAGAAATCTTAACGCTCGATCTGCAAG
-CGAAGATCACCACGCCCGCCAGGCCAGCGAGATCCGTCAGCATGTGCTGAACACTACCCGACTGGTGAATAATCTACTGGATATGGCGCGAATTCAGTCC
-GGCGGCTTTAATTTGAAGAAAGAGTGGTTAACGCTGGAAGAAGTAGTCGGCAGCGCGCTGCAAATGCTGGAACCGGGTTTATCGTCGCCCATCAATCTTT
-CTCTGCCAGAACCGCTGACCTTAATCCACGTTGACGGGCCACTTTTGAACGGGTGCTGATTAATCTGCTGGAGAACGCGGTGAAATATGCGGGTGCGCAG
-GCCGAAATTGGTATCGATGCCCACGTTGAGGGCGAAAATCTACAACTGGATGTCTGGGATAACGGCCCCGGTCTTCCGCCAGGCCAGGAGCAGACGATAT
-TTGATAAGTTTGTTCGCGGAATAAAAGAGCAGTACCGGGGGTAGGGCTTGGACTGGCAATTTGTCGGGCGATAGTGGATGGTACGGGGGCACTATTACCG
-CGTTCAACCGACCGGAAGGTGGTGCCTGTTTTCGTGTTACACTTCCCCAGCAAACTGCCCCTGAACTTGAAGAATTTCATGAGGATATGTGACAAACGTT
-CTGATTGTTGAAGATGAACAGGCTATTCGTCGCTTTCTGCGCACGGCGCTGGAGGGGCGATGCGCGTCTTTGAGGCCGAAACGCTGCAACGCGGCTTGCT
-GGAAGCGGCAACCCGTAAGCCAGATTTGATTATTCTCGATCTCGGCCTGCCCGATGGTGATGGGATTGAGTTTATCCGCGACCTGCGCCAGTGGAGCGCG
-GTGCCGG
--- a/test-data/canu_unitigs_result2.fa	Fri Jun 08 04:43:41 2018 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,61 +0,0 @@
->tig00000001 len=287 reads=18 covStat=1.00 gappedBases=no class=contig suggestRepeat=no suggestCircular=no
-GTTATTATTATGTCCTACAAGCATTAATTAATTAACACACTTTAGTAAGTATGTTCGCCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGC
-AGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGG
-AGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGTT
->tig00000002 len=251 reads=3 covStat=1.00 gappedBases=no class=contig suggestRepeat=no suggestCircular=no
-CTTTAGTAAGTATGTTCGCCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGG
-CTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTG
-ATCCATCGTGATGTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGTTTTT
->tig00000003 len=252 reads=3 covStat=1.00 gappedBases=no class=contig suggestRepeat=no suggestCircular=no
-TTTAGTAAGTATGTTCGCCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGC
-TCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGA
-TCCATCGTGATGTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGTTTTATT
->tig00000004 len=252 reads=1 covStat=1.00 gappedBases=no class=contig suggestRepeat=no suggestCircular=no
-TTAGTAAGTATGTTCGCCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCT
-CCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGAT
-CCATCGTGATGTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGTTTTATGG
->tig00000005 len=251 reads=1 covStat=1.00 gappedBases=no class=contig suggestRepeat=no suggestCircular=no
-GTATGTTCGCCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGT
-CTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGT
-GATGTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGTTTTATGACCCTGG
->tig00000006 len=250 reads=2 covStat=1.00 gappedBases=no class=contig suggestRepeat=no suggestCircular=no
-TGTTCGCCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTC
-GCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGAT
-GTCTTATTTAAGGGGAACGTGTGGGCTATTTAGGTTTTATGACCCTGAAG
->tig00000007 len=250 reads=1 covStat=1.00 gappedBases=no class=contig suggestRepeat=no suggestCircular=no
-CGCCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAA
-TGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCT
-TATTTAAGGGGAACGTGTGGGCTATTTAGGTTTTATGACCCTGAAGTAGG
->tig00000008 len=250 reads=1 covStat=1.00 gappedBases=no class=contig suggestRepeat=no suggestCircular=no
-GCCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAAT
-GCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTT
-ATTTAAGGGGAACGTGTGGGCTATTTAGGTTTTATGACCCTGAAGTAGGA
->tig00000009 len=252 reads=1 covStat=1.00 gappedBases=no class=contig suggestRepeat=no suggestCircular=no
-CCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATG
-CTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTA
-TTTAAGGGGAACGTGTGGGCTATTTAGGTTTTATGACCCTGAAGTAGGAACC
->tig00000010 len=308 reads=40 covStat=1.00 gappedBases=no class=contig suggestRepeat=no suggestCircular=no
-AATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATC
-GCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAA
-GGGGAACGTGTGGGCTATTTAGGTTTTATGACCCTGAAGTAGGAACCAGATGTCGGATACAGTTCACTTTAGCTACCCCCAAGTGTTATGGGCTAAGGCG
-AATCTCGT
->tig00000011 len=244 reads=1 covStat=1.00 gappedBases=no class=contig suggestRepeat=no suggestCircular=no
-GTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTA
-TCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTT
-AAGGGGAACGTGTGGGCTATTTAGGTTTTATGACCCTGAAGTAG
->tig00000012 len=246 reads=1 covStat=1.00 gappedBases=no class=contig suggestRepeat=no suggestCircular=no
-AATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATC
-GCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAA
-GGGGAACGTGTGGGCTATTTAGGTTTTATGACCCTGTCTCTTATAC
->tig00000013 len=251 reads=2 covStat=1.00 gappedBases=no class=contig suggestRepeat=no suggestCircular=no
-AACACACTTTAGTAAGTATGTTCGCCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTG
-CTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGA
-CCTGTGATCCATCGTGATGTCTGTCTCTTATACACATCTCCGAGCCCACGA
->tig00000014 len=251 reads=1 covStat=1.00 gappedBases=no class=contig suggestRepeat=no suggestCircular=no
-CCTGTAATATTGAACGTAGGTGCGATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATG
-CTATCGCGTGCACACCCCCCAGACGAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTGT
-CTCTTATACACATCTCCGAGCCCACGAGACTAAGGCGAATATCGTATGCCG
->tig00000015 len=258 reads=2 covStat=1.00 gappedBases=no class=contig suggestRepeat=no suggestCircular=no
-ATAAATAATAGGATGAGGCAGGAATCAAAGACAGATACTGCGACATAGGGTGCTCCGGCTCCAGCGTCTCGCAATGCTATCGCGTGCACACCCCCCAGAC
-GAAAATACCAAATGCATGGAGAGCTCCCGTGAGTGGTTAATAGGGTGATAGACCTGTGATCCATCGTGATGTCTTATTTAAGTCTCTTATACACATCTCC
-GAGCCCACGAGACTAAGGCGAATCTCGTATGCCGTCTTCTGCTTGCAAAAAAAAAAAC
--- a/test-data/ecoli_canu_contigs.fa	Fri Jun 08 04:43:41 2018 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,162 +0,0 @@
->tig00000001 len=16089 reads=72 covStat=-49.03 gappedBases=no class=contig suggestRepeat=no suggestCircular=no
-GGTTGAACCGTGAAGGTGATCAATAAAAATGATCAATCTTAATTTATTTAATGATGAGCTTTTTACTCAGTAATATAAAATATTGAATTGTTATTTTGTG
-TGTTGTTTTAAGATAAAAGCCGCTTTATTAATACGGCTTTAATTAATAAAAAGGCAGGCTGTATTAAAATTAATATTCAAAGCATAAACCGATGCCAATA
-CCGGTTTCAGTAATGAAATGGCGTGGGCGGGCGGGATCCTGTTCCAGTTTTTGTCGCAGATGTCCCATATAAATACGCAAATGGTGACTGTGTTCGACCG
-CGTTTGGCCCCCACCTGGTTAAGGAGCTGGCGCTGGGTGAGTACTTTCCGGCATTGTTGAGCAGCACCGCCAGCAGGCGGAACTCAATTGGTGTGAGATG
-CACCTCTTCTCACCCCGGTGAATCACGCGGGCGGCTAAATCGACGGTAACATCGGAAAATTTTACCAGCGGATCGGGCGCGGTGGTGGCAGAGTGGCGGC
-GTAATGCGACGCGCAGACGGGCCTGCAATTCGCCAATGCCAAACGGCTTACTCAGATAATCATCCGCTCCGGCATCCAGCGCGGCGATTTTGTCGCTCTT
-CTGCTGCGTGCGGAAAGCACAATCACCGGCACCGCGCTCCACTGGCGCAGGTCGCGGATAAACTCAATCCCATCACCATCGGGCAGGCCGAGATCGAGAA
-TAATCAAATCTGGCTTACGGGTTGCCGCTTCCAGCAAGCCGCGTTGCAGCGTTTCGGCCTCAAAGACGCGCATCCGTCGCCCTCCAGCGCCGTGCGCAGA
-AAGCGACGAATAGCCTGTTCATCTTCAACAATCAGAACGTTTGTCACATATCCTCATGAAATTCTTCAGTTCAGGGGCAGTTTGCTGGGGAAGTGTAACA
-CGAAAACAGGCACCACCTTCCGGTCGGTTGAACGCGGTAATAGTGCCCCCGTGTACATCCACTATCGCCCGACAAATTGCCAGTCCAAGCCCTACCCCCG
-TACTGCCGACTCTTTTATTCCCGCGAGCAAACTTATCAAATATCGTCTGCTCCTGGCCTGGCGGAAGACCGGGGCCGTTATCCCAGACATCCAGTTGTAG
-ATTTTCGCCCTCAACGTGGGCATCGATACCAATTTCGGCCTGCGCACCCGCATATTTCACCGCGTTCTCCAGCAGATTAATCAGCACCCGTTCAAAGAGA
-GGCCCGTCAACGTGGATTAAGGTCAGCGGTTCTGGCAGAGAAAGATTGATGGGCGACGATAAACCCGGTTCCAGCATTTGCAGCGCTGCCGACTACTTCT
-TCCAGCGTTAACCACTCTTTCTTCAAATTAAAGCCGCCGGACTGAATTCGCGCCATATCCAGTAGATTATTCACCAGTCGGGTAGTGTTCAGCATGCTGA
-CGGATCTCGCTGGCCTGGCGGGCGTGGGTGATCCTCGCTTGCCAGATCGAGCGTTAAGATTTCTGCCTGACCAAACAGCACCGTAAGCGGCGTGCGTAAA
-TCATGCGAAAGCGCCGCCAGCAGGGCGTTGCGGATCTGTTCACGTTCGCTTGCCATCCGCGCCTGTTCTTCGCTGGCGGTTAGCGTCAGCCGCTCAGGGC
-ATTGGCGACTAACAGCGTAACGTCTCCAGCAGGCGCTGCTGTTCCGGGATCATCAACTGGCGCAGATTCCCGGCTCCACCACCACCAGCCCGTAGGTTTT
-CGCCGCTTTTAGCGGCAAAATCTGGTACGGTACACCGGGTAACGTGTCGGTGCCCGCGCCCGCAGGCAGGCCTTTATCAAAACTCCACTGCGCGATGGCA
-TCGTCCCACGGCGTCATTCCTTGCGGATGTGTTAACGGCTGCAATTTACCGTTGTCATCGGGCAACAACACCTGACTGCGGGCATGAAACGTGGAGGCAA
-TAAATTGTTCGCTGGTGGCAGCGATATCCTGCGGACTGCGGCCCACCGCCAGAGCTTTCGACATTTCATATAAGTGCCGTGTGCGTTGCTCGCGGTAACG
-GGCTACCCGCGCCTGATAACGCACGCCAGCAGTAAGGTTCCCGATCACCAGCCCGACGGTTAACATCACCGCGAAGGTCAGCAGATATTGCACATCAGAG
-ACGGCGAGCGTGCCGCGTGGGGCGATAAAAAGAGATCGAAACTCACTACATTAATGACGGTGGCAACCACTGAAGGCCAGCGTCCATAAAATAGCGCCAC
-CACCACCACGCCAAGCAGATACAGCATCACCAGGTTGGCGGCATCAAACGCCATCAGCCACTGCATGGCAATTAAGGTGATAACGGCGCATAACGCGGCG
-GCAACCACGCATCCCTGAATTTGTACACGCCACTTGTCTTTAAAAGAGCGGTTATCCGGCGCGTTGTTAATCGTGCGGGCGGGTGGTTCATCAAGCGCGA
-CCAGCACCTGATCGAGATCGGGGCGATGCGCGCCAGTCGGTCAGCAAACGTTTCCCGACGCCACCAGCGGCGCGAGGCCGGGCGACCGAGAATAATCTTG
-CCGAGATTATGTTCACGGGCATAACGCACTACCGCTTTCTCTTCCGCTGGATCAGAAAGTGTTGCCGTCTCCGCGCCCAGTTCCTGCGCCAGACGTAAGG
-CGCTGAGAATTGCCCGACGTTTTTTCCGGTAAGCGGTGCAGGGCAGGGGTTTCAACATACACCGCGTGCCAGACGCTACCCAGCCGTGACGCCAGCCGCG
-CCGCTGCGCGGACCAGTTTTCGCTGCCGGTGTTATGGCCGATGCATAAAAGGATCGCGTCGCGCGTGTGCCACACTTTCTCTTCGCCAGGATGCCCCGCC
-AGGCGCGCATTTGCTCATCAACGCGATCGGCAGTACGGCGCAGTGCCAGTTCGCGCAGGGCGATCAGATTACCTTTGCGGAAAAATGTTCAATGGCGCGC
-TCCGCCTGCCCGGCAATATAGACTTTGCCTTCTTTCAGCCGCTGGCGCAGATCGTCCGGGGCAAGTCCACCAGCACCACGTCGTCGGCGGCATCGAAAAG
-GATCGGGCACGGTTTCCCGTACCTGAATTCCGGTGACGCCGCTGACCACATCATTCAGACTTTCCAGATGCTGAACGTTGACGGTAGTGAAAACATCAAT
-GCCAGCTTCCAGCAGTTCTTCGATATCCTGCCAGCGTTTGGGATGACGGGAACCTGGCGCATTACTGTGCGCCAGTTCGTCCATTAAGATCAGCGCCGGG
-CGGCGGGCGAGGGCGGCATCGAGATCAAACTCGCTGATATGCCGCCCACGGTACGCCTGGCGTTTTAACGGCAGAACAGCCAGCCCTTCCAGCATGGCGG
-CGGTATCTTTTCGCCCGTGGGTTTCTACCACGCCAACCACAATATCCAGCCCTTGCGCCCGCAGTCGCTGGGCTTCTGCCAGCATCGCCCAGGTCTTCCC
-GACGCCTGCACAGGCACCGAAGAAAACTTTCAGCTTCCCCGATGCGGCGCGGCAGTTTGTTCCAGCAGACGATCGGGGTCGGGACGTAAGGGTTCGTTAT
-TCATCAAGTTTATCCAGCGCCAGATTGAGTTCAACAATGTTGACAACCGGCTGGCCGATATATTTCACCAGCGGTTGTTGGCTGTATTTTGCGATCAGTT
-GCGTGAGCTGTTCAACGCTGAGATTACGCGCTTTCGCCACGCGTGGGATTTGCCAGGCCGCCGCTTGCGGGTGATATTATTGTCCAGCCCGCTTGCCGAT
-GCCGTCACCAGTTCAACCGGAACGCTCGCGCTGGCATCCGGGTTAGCGGCCCGTAATGCAGCAACGCGTGCGGCTATTAGTTTATCCAGCTCAGGGTTAC
-TGACCGCCAGATTGCTCCCGCCAGAAGCCTGTGGATTATAGGGCATTTCTGCCGTTGCCGACGGGCGACCATGAAAATAGCCGTTGCCGGTAAAATTCTG
-CCCGATTAATGCCGAACCGCGCACCGTATCACCTTCACGAATCAACGAACCATTGGCCTGCCAGGAAACCACCATTGCCCCAGTACGGTGGTCAGCAGCG
-GGTAAACGCCGCCAGTAATCAATAACAGAAAGATAAATGTTGATAATGCCGGACGTAATCCACTCATGGTAAACCTCACACCAGACCGCAAACGGTCAGC
-AGTAAATCAATGACTTTGATACCGATAAACGGCACCAGCAGCCCACCCAGACCGTAAATCCATAAGTTACGGCGCAACATGGCAGAAGCGGTAAGCGGTT
-TATAACTCACGCCTTTTAACGCCAGGGGAATCAAAGACGATAATCAAGGCGTTGAAAATCACCGCACTGAGGATTGCGGAGTCGGGCGAATGCAGGCACA
-TGATGTTCAGCGCATTTAACTGCGGATACGTTGCCGCGAATGCCGCCGGAATAATGGCGAAGTATTTCGCCACATCGTTGGCAATGCTGAAGGTGGTCAG
-CGAGCCACGGGTCATCAGCATCTGTTTGCCAATGTGCACCACCTCGATCAACTTGGTCGGGTTAGAGTCGAGATCGACCATATTGCCCGCCTCTTTCGCC
-GCCTGGGTGCCGGAGTTCATCGCCACCGCGACATCTGCCTGCGCCAGCGCCGGAGCATCGTTGGTGCCGTCGCCGGTCATCGCTACCAAACGACCTTCCG
-CCTGATACTGACGGATCAATGCCAGCTTGGCCTCCGGTGTCGCTTCGGCGAGAAAATCATCGACACCCGCTTCCGCAGCAATCGCGGCGGCAGTCAGACG
-GTTATCGCCGGTAATCATCACCGTTTTAATGCCCATTTTGCGCAGCTGGGCGAAGCGCTCTTTAATACCGCCTTTGACGATATCTTTCAGCGCAATAACG
-CCCAGCACACGAGAACCTTCCACCACCACCAGCGGCGTGGCTCCCTGACGCGCAACCTGATCGACTTTTTGATCAACATCGGTAGGGAAGTGACCACCGT
-TAGCCTCAACATGGCGACGAATGGCATCGACAGAACCTTTACGGATCATGCGGTTGTCGATGTTGATCCCGCTCATCCGGCTTTGCGCAGTAAACGGTAC
-AAAGGTGGCATGGAGCGACTGCACATCGCGCTCGCGCAGGTTAAAACGCTGCTTGGCGAGGATCACAATACTGCGGCCTTCCGGCGTTTCATCAGCCAGC
-GAAGCCAGTTGTGCGGCGTCAGCCAGCGTTTTCATCCACGCCCTGCGCGGGGATAAACTCCGACGCCTGACGGTTACCGAGTGTGATGGTGCCGGTTTTA
-TCCAGTAGCAGAACGTCAACGTCACCTGCCGCTTCAACTGCACGTCCGCTGGTGGCAATCACATTCGCGCCTAGCATCCGGCTCATCCCGGCGACGCCGA
-TCGCTGACAACAGGCCGCCAATAGTGGTTGGGATCAGACAGACCAGCAGCGCCACCAGTACCGTTACGCTGACTGCATTACCGCCCCACGCGGAAAACGG
-CCACAGCGTGGCGGTTGCCAGTAAAAGACGATAGTCAGGGCAATCAGCAGAATGGTCAGGGCAATTTCGTTCGGCGTTTTGCGTCGCTGTGCGCCTTCCA
-CCATCGCGATCATCCGATCCAGAAATGTCTCGCCGGGGTTAACGCTACACTCAATCACCAGCCAGTCAGAAAGAATACGCGTGCCGCCGGTGACGGAGGC
-AAAATCGCCGCCGGATTCACGGATCACCGGTGCCGATTCCCCGGTGATGGCGCTTTCATCGACCGATGCACCCCTTCAATAACTTCACCATCGCAGGGGA
-TAATATCGCCAGCTTCTACCAGTACGATATCGCCTTTACGAAGTTGGTCGGCAGGAACTTTGTCCGCCGCAGCGCCATATTTCGGCTCACGCAGCTTGCG
-GGCAAAGGCAGTTTTTCACCCTTTCAGACTGTTGGCCTGCGCTTTACTGCGGCCTTCTGCCAGCGCCTCGGCGAAATTAGCGAACAGTACGGTGATCCAC
-AGCCAACCGCTAATGGCCGCGCTAAACAGCGCATTGCCGGGCATCGCACCGCTTGCCATCGCGATGCTAATACAGGTGGTCAGCAGACTGCCGATCCAGA
-CGATAAACATCACCGGATTGCGCCATTGCGCCTGCGGGTTTAATTTTTCACCGCTTCTTTCAGCGCCTGAACGACAAGTGTTGGTTCGAATAGCGCCAGT
-TGTTTACGACTCATATTCAGTGCTCACTCAATATCATCAGGAGAGATATTCCGCCACCGGACCAAGCGCCAGGGCAGGGATAAAGGTCAGTGCGCCAACC
-AGCAACACGGTGCCGATTAACAGGCCAACAAACAGCGGGCCGTGCGTTGGCAGCGTGCCGGAGCTGGCGGCTTGGCTCTTTTACTCACCAGCGAACCGGC
-AATTGCCATCACCGGGATAATCACCCCGAAGCGACCGACAAACATGCAGAACGCCAGTAAACAGTTCCAGAACGGAGAGTTGGCGCTTAATCCGGCAAAG
-GCGCTGCCGTTGTTGTTAGCGGCGGATGACACGGCGTACAGCACTTCGCTAAAACCATGCGGGCCAGGGTTGAGCATGGCGCTACGTCCGGCGTCGGTCA
-TCATCGCCAACGCCGCGCCCATCAGCACCAGCGTCGGGGTAACCAGAATTGCCAGTGCAGTCAGTTTCATCTCGCGTACGTCGATTTTTTACCCAGATAT
-TCCGGTGTACGACCAATCATCAGCCCGGCAATAAACACCGCCAGCAGGACAAACAGCATCATGCCGTAAAGACCAGAACCGACACCGCCGAACACCACTT
-CACCAATTTGCATCAGCCACATCGGCACCATGCCACCGAGAGCGGTAAACGAATCATGCATCGCAATCACCGCGCCACAGGAAGCCGCCGTCGTCACGAC
-CGCAAACAGGCTACTGACCAGCACGCCGAAACGGCTCTCTTTACCTTCCATATTGATGCTGCTGTCCGTGCCCAGTGCCAGCAGATGAGGATTACCCTGA
-ACTTCTGCCCACATCACCACGCCTACGCAGATGACAAAATCACTGACATCGCCCACAGCAACATGCGCCCCTGGCGGCGATCGCCCATCACTTCACCAAA
-GGCAAAGCACAGCGCCGTTGGGATCAAGAAGATCGCCAGCATCTGCACGAAGTTGGTCAGTGCGGTTGGGTTTTCAAACGGATGCGACGAGTTGGCATTA
-AAGAAGCCACCGCCGTTAGTACCGAGCATCTTGATCGCTTCCTGAGAAGCTACAGGCCCCATGGGTAACAGCTGTTGCGCTCCTTCAACGGTATTCACAG
-CCTGATAAGGCAGAAAGTTTTGCAGCGCACCTTGTTGAATAAAAACAGTGCAATCAACAACGCCACAGGGACTAGCACCCATAACGTGATGCGTAGCAGA
-TCGACCCAGGCATTCCCGAGCGTGCTCATGCTCTGGCGGGTAAACGCACGGATGAGGGCAAAATCACCGCAATCCCGCTGGCGGCAGAAAGAAAGTTTTG
-CACCGTTAAGCCCGCCATCTGGCTGAAATAGCTCAACGTGGTTTCACCGCTATAAGATTGCCAGTTGGTATTGGTGACAAAGCTGACGGCGGTATTCAGC
-GCCAGATCCCACGACAGCCCTGGCAACTGCTGTGGATTAAGCGGCAGATAGTGCTGACCGAGCAACATAAAAACAGCACCGCCAGCCCCAGCATGTTCAG
-GCCGAGAATGGCACAAAGATATTGCTTCCAGTTCATCTCACGGTCAGAGACGCCAAGTGCGCGAAAAGTACGCGCTCAACGCCCGTTGTACCGGGAAGAG
-GAATGTCATTAATCAGCCGCGCCAGCCCGCTGCCTAAAGGACGCGCCAGCACCATTAACACCAGTAAAAACGTGGCGATCAGTAAGAACCCTTGCGCAGC
-CATCAGAACGCCTCCGCATTGATCAGGGCATAAACCAGATAACCCAGTAATAAAACACCAGCAATACGCCGGTTATCACGCCTGCACTCACAGTGCACCT
-CCAGTGGCCTAAAAGTGATACCGGAAGGGTAGAATTCTGGCTGCAAAGATTTCGCAAAATCTGCGGGCGGGGTGTAAAAGTATAAAAATGGCAAAAGCCA
-TGATTTAACTAATGTTTAGTATTAATTTAACTTTTGTGTAACTTAATTACAGGATGAATGTAAATAAACCATCAATAAGCAAAAATAAGTGGTCGGATGA
-GTAGTAAAATTACACAAAAGGCGGTACTATTTTCATCAGATAAACAAATTCATTTTTCCGGTGCCATTCACCGGGTAGATACAAAGGGGAGAAAAGTATG
-GAACTCTACAGAGAATATCCTGCATGGCTTATCTTTTTACGCCGTACTTATGCGGTTGCAGCGGGCGTTCTGGCGCTGCCTTTCATGCTTTTCTGGAAAG
-ACCGCGCCCGCTTTTACAGCTACCTGCATCGCGTCTGGTCGAAAACCAGCGATAAACCGGTGTGGATGGATCAGGCCGAAAAGGCAACTGGTGATTTTAT
-TGATTGCTGAGTTTTGAATACATTGAAAACCGCCAGCGGAAACGCTGGCGGTTTTTGTATCAGGAAGATGTTCAGAGGAATATTTAGACATCGTTATACC
-AATCGAAACATATATTCATGAAATATATATAAATATTTTCCTAATTGTTCTTATCTGACAGATATCTCACTTAAGGCTTTCTTATAAATCTGTAGGGTTT
-CGCCTGTCAGCAGACAAATAACCCGATAAAACAAGGATGAGCAGATGAGCGGAAAACCGGCGGCGCGTCAGGGCGACATGACGCAGTATGGCGGTAGCAT
-TGTCCAGGGTTCAGCCGGGGTACGCATCGGTGCCCCACCGGCGTGGCCTGTTCGGTGTGCCCCGGCGGGTGACGTCCGGCCATCCGGTCAATCCGCTGCT
-CGGTGCAAAGGTCCTTCCCGGTGAAACCGACATCGCCCTGCCCGGCCCGCTGCCGTTCATTCTCTCCCGCACCTACAGCAGTTACCGGACAAAACGCCCG
-CGCCGGTGGGGAGCCTCGGCCCCGGCTGGAAAATGCCTGCGGATATCCGCTTACAGCTGCGCGATAACACACTGATACTCAGTGATAACGGCGGCAGAAG
-CCTGTATTTTGAGCACCTGTTTCCCGGTGAGGACGGTTACAGCCGCAGCGAGTCACTGTGGCTGGTGCGCGGCGGCGTGGCGAAACTGGATGAAGGTCAC
-CGGCTGGCCGCACTCTGGCAGGCGCTGCCGGAAGAACTCCGCTTAAGTCCGCATCGTTATCTGGCGACAAACAGTCCGCAGGGGCCGTGGTGGCTGCTCG
-GCTGGTGTGAGCGGGTGCCGGAAGCGGATGAGGTGCTGCCTGCGCCGCTGCCGCCGTACCGGGTACTGACCGGGCTGGTGGACCGCTTCGGGCGCACACA
-GACGTTCCACCGCGAAGCCGCCGGTGAATTCAGCGGCGAAATCACCGGCGTGACGGATGGTGCCGGGCGTCACTTCCGGCTGGTACTGACCACGCAGGCG
-CAGCGGGCAGAAGAAGCCCGGCAGCAGGCCATTTCCGGCGGGACGGAACCGTCCGCTTTTCCTGATACCCTGCCGGGTTACACCGAATATGGCCGGGACA
-ACGGCATCCGTCTGTCTGCCGTGTGGCTGACGCACGACCCGGAATACCCGGAGAATTTACCTGCCGCGCCGCTGGTGCGCTATGGCTGGACGCCCGCGGC
-GAACTGGCGGCGGTGTATGACCGCAGCAATACACAGGTGCGCAGCTTTACTTACGATGATAAATACCGGGGCCGGATGGTGGCGCACCGTCACACGGGCC
-GACCGGAAATCTGTTACCGTTACGACAGCGACGGGCGGGTGACAGAACAGCTAAACCCGGCAGGCTTAAGTTACACGTATCAGTATGAGAAGGACCGCAT
-CACCATCACCGACAGCCTGAACCGCCGTGAAGTCCTGCACACGCAGGGTGAAGGCGGGCTGAAGCGGGTGGTGAAAAGGAACACGCGGACGGCAGCGTCA
-CGCAGAGTCAGTTTGACGCGGTGGGCAGGCTCAGGGCACAGACGGATGCCGCAGGCAGGACAACAGAATACAGTCCGGATGTGGTGACGGGCCTCATCAC
-GCGCATCACCACGCCGGATGGCAGGGCATCGGCGTTTTACTATAACCACCACAGCCAGTTAACGTCAGCCACCGGGCCTGACGGGCTGGAAATACGCCGG
-GAATATGATGAATGGGGCCGTCTGATTCAGGAAACTGCCCCTGACGGCGATATCACCCGCTACCGTTATGATAATCCACACAGTGACTTACCCTGCGCAA
-CGGAAGATGCCACCGGCAGCCGGAAAACCATGACGTGGAGCCGTTACGGTCAGTTGCTGAGCTTCACTGACTGTTCCGGTTATGTAACCCGCTATGACCA
-TGACCGTTTTGGTCAGGTGACGGCGGTGCACCGCGAGGAAGGGCTGAGTCAGTACCGCGCATACGACAGCCGTGGACAGTTAATTGCCGTGAAAGACACG
-CAGGGCCATGAAACGCGGTATGAATACAACGCCGCCGGTGACCTGACCACCGTCATTGCCCCGGACGGCAGCAGAAACGGGACACAGTACGATGCGTGGG
-GAAAAGCCATCTGTACCACGCAGGGCGGTCTGACGCGCAGTATGGAATACGATGCTGCCGGACGGGTCATCCGCCTGACCAGTGAAAACGGCAGCCACAC
-CACCTTCCGTTACGATGTACTCGACCGGCTGATACAGGAAACCGGCTTTGACGGCCGCACACAGCGTTATCACCACGACCTGACCGGCAAACTTATCCGC
-AGCGAGGATGAGGGCTGGTCACCCACTGGCACTATGACGAAGCAGACCGCCTCACGCACCGCACCGTGAATGGCGAAACCGCAGAGCGGTGGCAGTATGA
-CGAACGCGGCTGGCTGACAGACATCAGCCATATCAGCGAAGGGCACCGGGTGACGGTGCACTATGGTTATGACAGTAAAGGCCGCCTCGCCAGTGAACAC
-CTGACGGTGCATCATCCGCAGACGAATGAACTGCTCTGGCAGCATGAGACCAGACATGCGTACAACGCACAGGGACTGGCGAACCGCTGTATACCGGACA
-GCCTGCCCGCCGTGGAATGGCTGACCTACGGCAGCGGCTGGCTGTCAGGCATGAAACTCGGCGACACACCGCTGGTGGAGTACACCCGCGACCGCCTGCA
-CCGGGAAACGCTGCGCAGCTTCGGCCGTTATGAACTCACCACCGCTTATACCCCTGCCGGGCAGTTACAGAGCCAGCACCTGAACAGCCTGCTGTCTGAC
-CGCGATTACACCTGGAACGACAACGGCGAACTCATCCGCATCAGCAGCCCGCGCCAGACCCGGAGTTACAGCTACAGCACCACCGGCAGGCTGACCGGCG
-TTCACACCACCGCAGCGAATCTGGATATCCGCATCCCGTATACCACAGACCCGGCAGGTAACCGCCTGCCCGACCCGGAGCTGCACCCGGACAGCGCCCT
-CAGCATGTGGCCGGATAACCGTATCGCCCGTGACGCGCACTATCTTTACCGGTATGACCGTCACGGCAGGCTGACAGAGAAACCGACCTCATCCCGGAAG
-GGTTATCCGCACGGATGATGAGCGCACCCACCGGTACCATTACGACAGTCAGCACCGGCTGGTGCACTACACGCGGACACAATATGCAGAGCCGCTGGTC
-GAAAGTCGCTATCTTTACGACCCGCTGGGCCGCAGGGTGGCAAAACGGGTATGGCGGCGTGAACGGGACCTGACGGGCTGGATGTCGCTGTCACGGAAAC
-CGCAAGTGACCTGGTACGGCTGGGACGGCGACCGCCTGACCACGATACAGAACGACAGAACCCGCATCCAGACGATTTATCAGCCGGGGAGCTTCACGCC
-ACTCATCAGGGTTGAAACCGCCACCGGTGAGCTGGCGAAAACGCAGCGCCGCAGCCTGGCGGATACCCTTCAGCAGTCCGGTGGCGAAGACGGTGGCAGT
-GTGGTGTTCCCGCCGGTGCTGGTGCAGATGCTCGACCGGCTGGAAAGTGAAATCCTGGCTGACCGGGTGAGTGAGGAAAGCCGCCGCTGGCTGGCATCGT
-GCGGCCTGACGGTGGCGCAGATGCAAAGCCAGATGGACCCGGTATACACGCCGGCGCGAAAAATTCACCTGTACCACTGCGACCATCGCGGCCTGCCGCT
-GGCCCTATCAGCACGGAAGGGACAACAGCGTGGTACGCAGAATACGATGAATGGGGTAACCTGCTGAATGAAGAGAACCCGCATCAGCTGCAGCAGCTTA
-TCCGCCTGCCGGGGCAGCAGTATGATGAGGAGTCCGGCCTGTATTACAACCGCCACCGCTATTATGACCCGCTGCAGGGGCGATATATCACTCAGGATCC
-GATTGGGCTGAAAGGGGATGGAATTTTATCAGTATCCGTTGAATCCGATCTCAAATATAGATCCATTAGGATTAGAAACACTAAAATGCATTAAGCCACT
-GCATTCAATGGGCGGAACTGGTGAAAGAAGCGGTCCAGATATATGGGGAATCCGTTCTATCATCAATATCTTTGTGTCCCAGATGGTAAAGGGACTATAC
-TTGTGGTGGCCAAGACCAACGGGGAGAATCAAAGGAGATGGTCTATGGGGGCCAGGTAAAGCAAGTAATGATACAAAGAAGCTGCTGGCCGTTGTGACCT
-CGTTGAAACCGATAATAGTTGTGTGGAGAACTGTTTAAAGGAAGTTTAAAGAGGTAAGGCCGCGTTATTCTGTATTGCCTGATATATTCACACCTATAAA
-TTTAGGGCTATTTAAAACTGCCAAGACTGGTCTAATGATTCTTTAGAAACATGTAAGATGAAGTGCTCCGGAAATAACATTGGACGTTTTATTAGATTTG
-TATTCACCGGAGTGATGTAATGAAATATATTATTTTTTATTCAGAGCTATATGGCTGGCTTTATCGCTTTTAATACTATTCTTTTCCATGCATAGACTTT
-CACTATTAGACTCCACTCGTGATGTGAGCGAGTTAATTAGTCTCATGTCTTATGGAATGATGGTAATATGTTTTCCAACAGGCATAGTATTCTTTATTGC
-TCTAATATTTATAGGGACTGTATCAGACATTATTGGCGTAAGGATTGATAGTAAGTATATTATGGCGATAATAATATGGCTTTATTTTCTGTCAGGAGGG
-TATATTCAATGGTTTGTATTAAGTAAGCGCATTATAAACAAATAAATTAAGTTAATTGCTCTTATTATTATATGTAACCTGGGCATTGATATCCCGTATG
-CCACAGACCCGGCAGGTAACCGCCTGCCCGACCGGAGCTGCACCCGGACAGCACCCTCAGCATGTGGCCGGATAACCGTATCGCCCGTGACGCGCACTAT
-CTTTACCGGTATGACCGTCACGGCAGGCTGACGGAGAAAACCGACCTCATCCGGAAGGGTTATCCGCACGGATGATGAGCGCACCCACCGGTACCATTAC
-GACAGTCAGCACCGGCTGGTGCACTACACGCGGACACAATATGCAGAGCCGCTGGTCGAAAGCCGCTATCTTTACGACCCGCTGGGCCGCAGGGTGGCAA
-AACGGGTGTGGCGACGTGAACGGGACCTGACGGGCTGGATGTCGCTGTCACGGAAACCGCAAGTGACCTGGTACGGCTGGGACGGCGACCGCCTGACCAC
-GATACAGAACGACAGAACCCGCATCCAGACGATTTATCAGCCGGGGAGCTTCACGCCACTCATCAGGTTGAAACCGCCACCGGTGAGCTGGCGAAAACGC
-AGCGCCGCAGCCTGGCGGATACCCTTCAGCAGTCCGGCGGCGAAGACGGTGGCAGTGTGGTGTTCCCGCCGGTGCTGGTGCAGATGCTCGACCGGCTGGA
-AAGTGAAATCCTGGCTGACCGGGTGAGTGAGGAAAGCCGCCGCTGGCTGGCATCGTGCGGCCTGACGGTGGAGCAGATGCAAAACCAGATGGACCCGGTG
-TACACGCCGGCGCGAAAAATCCACCTGTACCACTGCGACCATCGCGGCCTGCCGCTGGCGCTTGTCAGCACGGAAGGGGCAACAGAATGGTGCGCAGAAT
-ACGATGAATGGGGCAACCTGCTGAATGAAGAGAACCCGCATCAGCTGCAGCAGCTTATCCGCCTGCCGGGGCAGCAGTATGATGAGGAGTCCGGCCTGTA
-TTACAACCGCCACCGCTATTATGACCCGCTGCAGGGAGGTATATCACTCAGGATCCGATTGGGCTGAAGGGGATGGAATTTTATCAGTATCCGCTGAATC
-CGGTTCAGTATATAGATTCAATGGGACTGGCATCAAAATATGGACACTTAAATAATGGCGGATATGGAGCGAGACCCAACAAACCGCCTACGCCCGATCC
-AAGTAAATTGCCGGACATAGCGAAACAATTAAGACTGCCATATCCTATTGACCAGGCCAGTAGTGCGCCTAATGTTTTCAAAACATTCTTCAGAGCATTA
-AGCCCTACGACTACACACTGTATTGCAGGAAGTGGGTAAAACCAAATCTGACTTGTACGCCACAGGATGATTCCCAGTATCCAGGGATGGATACAAAGAC
-AGCAAGTGATTACCTGCCACAGACAAATTGGCCAACAACTCAATTACCACCAGGATATACTTGTGCAGAACCCTATTTATTCCCAGACATTAATAAACCC
-GATGGGCCAGCAACAGCAGGGATAGATGATTTGGGTGAAATTTTAGCTAAGATGAAACAGAGAACATCGAGAGGAATAAGAAAATGAAAAGAGTTTTGTT
-CTTTTTGCTGATGATATTTGTTAGTTTTGGTGTTATAGCTGATTGCGAAATACAAGCTAAAGATCATGATTGTTTTACTATTTTCGCTAAAGGGTACTAT
-TTTTCCGCGTTTCCTGTCTTAAATAATAAAGCCATGTGGAGATGGTATCAGAATGAGGACATCGGTGAGTATTATTGGCAAACAGAACTGGGTACATGTA
-AAAATAATAAATTCACACCAAGCGGGCGAGACTCTTAATTCGCGTCGGGTCACTACGCCTTAATGAAAATCATGCCATCAAAGGAACGTTGCAGGAGTTG
-ATAAATACAGCAGAAAAACGGCGTTTCTCGGCGATCGGTTTAGAAGTTATATAAGAGCGGGTATCTATCAAAAGAGCAGTGATCCAGTTCAGTTGTTGGC
-AGTCCTTGATAATTCAATCATGGTAAAATATTTTAAAGATGAGAAACCAACTTATGCTCGAATGACAGCACATCTCCCGAACAAAATGAGTCTTACGAAT
-GTTTAATAAAGATACAGCATGAACTAATTCGTAGTGAAGAGAAATAAAATCTCTTCCTGAGAAAACAAATTAATCATTGTGAAAAATTATATAACTCATG
-GAATAGGTGTTTATTTTGCGTTCCATTTGCAGGAAAGATCACGTAACGCTACTTTTTGTACTAAATAATTCGAATTTAAGTTCAACAATTGAGATACTAC
-TTATTGTCTAAAGCTGTTTTTCATAGCTTATACATGATCAAATACTCCTTACATAAATAAGGTGAACAAATGGAACTTAAAAATTGATGGAACATATTTC
-TATTACACCCGATTACAGACAAGCCTGGAAAGTGGTGCATAAATTGTCAGATATTCTACTGTTGACTATTTGTGCCGTTATTTCTGGTGCAGAAGGTTGG
-GAAGATATAAGAGGATTTCGGGGAAACATCTCGATTTTTTGAAGCAATATGGTGATTTTGAAAATGGTATTCCTGTTCACGATACCATTGCCAGAGTTGT
-ATCAGGAAAGATCACGTAACGCTACTTTTTGTACTAAATAATTCGCATTTTATGTTTAAAAATTGAGATATTCCTTATTACCTAAAGCTGTTTTTCATAG
-CTTATACATGATCAAATACTCCTTACATAAATAAGGTGAACAAATGGAACTTAAAAATTGATGGAACATATTTCTATTATTCCCGATTACAGATAAGCCT
-GGAAAGTAGAGCATAAATTGTCCAGGCATCCTACTATTGACTATTTTGCCGTTATTTCTGGTGCGAAAGTTGGGAAGATATAGAGGATTTCGGGAAACAC
-ATCTCGATTTCTTGAAGCAATATGGTGATTTTGAAAATGGTATTCCTGTTCACGATACTATTGCCAGAGTTGTATCCTGTATCAGTCCT
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/ecoli_canu_contigs_result1.fa	Sat Jun 09 13:46:56 2018 -0400
@@ -0,0 +1,162 @@
+>tig00000001 len=16089 reads=72 covStat=-49.03 gappedBases=no class=contig suggestRepeat=no suggestCircular=no
+GGTTGAACCGTGAAGGTGATCAATAAAAATGATCAATCTTAATTTATTTAATGATGAGCTTTTTACTCAGTAATATAAAATATTGAATTGTTATTTTGTG
+TGTTGTTTTAAGATAAAAGCCGCTTTATTAATACGGCTTTAATTAATAAAAAGGCAGGCTGTATTAAAATTAATATTCAAAGCATAAACCGATGCCAATA
+CCGGTTTCAGTAATGAAATGGCGTGGGCGGGCGGGATCCTGTTCCAGTTTTTGTCGCAGATGTCCCATATAAATACGCAAATGGTGACTGTGTTCGACCG
+CGTTTGGCCCCCACCTGGTTAAGGAGCTGGCGCTGGGTGAGTACTTTCCGGCATTGTTGAGCAGCACCGCCAGCAGGCGGAACTCAATTGGTGTGAGATG
+CACCTCTTCTCACCCCGGTGAATCACGCGGGCGGCTAAATCGACGGTAACATCGGAAAATTTTACCAGCGGATCGGGCGCGGTGGTGGCAGAGTGGCGGC
+GTAATGCGACGCGCAGACGGGCCTGCAATTCGCCAATGCCAAACGGCTTACTCAGATAATCATCCGCTCCGGCATCCAGCGCGGCGATTTTGTCGCTCTT
+CTGCTGCGTGCGGAAAGCACAATCACCGGCACCGCGCTCCACTGGCGCAGGTCGCGGATAAACTCAATCCCATCACCATCGGGCAGGCCGAGATCGAGAA
+TAATCAAATCTGGCTTACGGGTTGCCGCTTCCAGCAAGCCGCGTTGCAGCGTTTCGGCCTCAAAGACGCGCATCCGTCGCCCTCCAGCGCCGTGCGCAGA
+AAGCGACGAATAGCCTGTTCATCTTCAACAATCAGAACGTTTGTCACATATCCTCATGAAATTCTTCAGTTCAGGGGCAGTTTGCTGGGGAAGTGTAACA
+CGAAAACAGGCACCACCTTCCGGTCGGTTGAACGCGGTAATAGTGCCCCCGTGTACATCCACTATCGCCCGACAAATTGCCAGTCCAAGCCCTACCCCCG
+TACTGCCGACTCTTTTATTCCCGCGAGCAAACTTATCAAATATCGTCTGCTCCTGGCCTGGCGGAAGACCGGGGCCGTTATCCCAGACATCCAGTTGTAG
+ATTTTCGCCCTCAACGTGGGCATCGATACCAATTTCGGCCTGCGCACCCGCATATTTCACCGCGTTCTCCAGCAGATTAATCAGCACCCGTTCAAAGAGA
+GGCCCGTCAACGTGGATTAAGGTCAGCGGTTCTGGCAGAGAAAGATTGATGGGCGACGATAAACCCGGTTCCAGCATTTGCAGCGCTGCCGACTACTTCT
+TCCAGCGTTAACCACTCTTTCTTCAAATTAAAGCCGCCGGACTGAATTCGCGCCATATCCAGTAGATTATTCACCAGTCGGGTAGTGTTCAGCATGCTGA
+CGGATCTCGCTGGCCTGGCGGGCGTGGGTGATCCTCGCTTGCCAGATCGAGCGTTAAGATTTCTGCCTGACCAAACAGCACCGTAAGCGGCGTGCGTAAA
+TCATGCGAAAGCGCCGCCAGCAGGGCGTTGCGGATCTGTTCACGTTCGCTTGCCATCCGCGCCTGTTCTTCGCTGGCGGTTAGCGTCAGCCGCTCAGGGC
+ATTGGCGACTAACAGCGTAACGTCTCCAGCAGGCGCTGCTGTTCCGGGATCATCAACTGGCGCAGATTCCCGGCTCCACCACCACCAGCCCGTAGGTTTT
+CGCCGCTTTTAGCGGCAAAATCTGGTACGGTACACCGGGTAACGTGTCGGTGCCCGCGCCCGCAGGCAGGCCTTTATCAAAACTCCACTGCGCGATGGCA
+TCGTCCCACGGCGTCATTCCTTGCGGATGTGTTAACGGCTGCAATTTACCGTTGTCATCGGGCAACAACACCTGACTGCGGGCATGAAACGTGGAGGCAA
+TAAATTGTTCGCTGGTGGCAGCGATATCCTGCGGACTGCGGCCCACCGCCAGAGCTTTCGACATTTCATATAAGTGCCGTGTGCGTTGCTCGCGGTAACG
+GGCTACCCGCGCCTGATAACGCACGCCAGCAGTAAGGTTCCCGATCACCAGCCCGACGGTTAACATCACCGCGAAGGTCAGCAGATATTGCACATCAGAG
+ACGGCGAGCGTGCCGCGTGGGGCGATAAAAAGAGATCGAAACTCACTACATTAATGACGGTGGCAACCACTGAAGGCCAGCGTCCATAAAATAGCGCCAC
+CACCACCACGCCAAGCAGATACAGCATCACCAGGTTGGCGGCATCAAACGCCATCAGCCACTGCATGGCAATTAAGGTGATAACGGCGCATAACGCGGCG
+GCAACCACGCATCCCTGAATTTGTACACGCCACTTGTCTTTAAAAGAGCGGTTATCCGGCGCGTTGTTAATCGTGCGGGCGGGTGGTTCATCAAGCGCGA
+CCAGCACCTGATCGAGATCGGGGCGATGCGCGCCAGTCGGTCAGCAAACGTTTCCCGACGCCACCAGCGGCGCGAGGCCGGGCGACCGAGAATAATCTTG
+CCGAGATTATGTTCACGGGCATAACGCACTACCGCTTTCTCTTCCGCTGGATCAGAAAGTGTTGCCGTCTCCGCGCCCAGTTCCTGCGCCAGACGTAAGG
+CGCTGAGAATTGCCCGACGTTTTTTCCGGTAAGCGGTGCAGGGCAGGGGTTTCAACATACACCGCGTGCCAGACGCTACCCAGCCGTGACGCCAGCCGCG
+CCGCTGCGCGGACCAGTTTTCGCTGCCGGTGTTATGGCCGATGCATAAAAGGATCGCGTCGCGCGTGTGCCACACTTTCTCTTCGCCAGGATGCCCCGCC
+AGGCGCGCATTTGCTCATCAACGCGATCGGCAGTACGGCGCAGTGCCAGTTCGCGCAGGGCGATCAGATTACCTTTGCGGAAAAATGTTCAATGGCGCGC
+TCCGCCTGCCCGGCAATATAGACTTTGCCTTCTTTCAGCCGCTGGCGCAGATCGTCCGGGGCAAGTCCACCAGCACCACGTCGTCGGCGGCATCGAAAAG
+GATCGGGCACGGTTTCCCGTACCTGAATTCCGGTGACGCCGCTGACCACATCATTCAGACTTTCCAGATGCTGAACGTTGACGGTAGTGAAAACATCAAT
+GCCAGCTTCCAGCAGTTCTTCGATATCCTGCCAGCGTTTGGGATGACGGGAACCTGGCGCATTACTGTGCGCCAGTTCGTCCATTAAGATCAGCGCCGGG
+CGGCGGGCGAGGGCGGCATCGAGATCAAACTCGCTGATATGCCGCCCACGGTACGCCTGGCGTTTTAACGGCAGAACAGCCAGCCCTTCCAGCATGGCGG
+CGGTATCTTTTCGCCCGTGGGTTTCTACCACGCCAACCACAATATCCAGCCCTTGCGCCCGCAGTCGCTGGGCTTCTGCCAGCATCGCCCAGGTCTTCCC
+GACGCCTGCACAGGCACCGAAGAAAACTTTCAGCTTCCCCGATGCGGCGCGGCAGTTTGTTCCAGCAGACGATCGGGGTCGGGACGTAAGGGTTCGTTAT
+TCATCAAGTTTATCCAGCGCCAGATTGAGTTCAACAATGTTGACAACCGGCTGGCCGATATATTTCACCAGCGGTTGTTGGCTGTATTTTGCGATCAGTT
+GCGTGAGCTGTTCAACGCTGAGATTACGCGCTTTCGCCACGCGTGGGATTTGCCAGGCCGCCGCTTGCGGGTGATATTATTGTCCAGCCCGCTTGCCGAT
+GCCGTCACCAGTTCAACCGGAACGCTCGCGCTGGCATCCGGGTTAGCGGCCCGTAATGCAGCAACGCGTGCGGCTATTAGTTTATCCAGCTCAGGGTTAC
+TGACCGCCAGATTGCTCCCGCCAGAAGCCTGTGGATTATAGGGCATTTCTGCCGTTGCCGACGGGCGACCATGAAAATAGCCGTTGCCGGTAAAATTCTG
+CCCGATTAATGCCGAACCGCGCACCGTATCACCTTCACGAATCAACGAACCATTGGCCTGCCAGGAAACCACCATTGCCCCAGTACGGTGGTCAGCAGCG
+GGTAAACGCCGCCAGTAATCAATAACAGAAAGATAAATGTTGATAATGCCGGACGTAATCCACTCATGGTAAACCTCACACCAGACCGCAAACGGTCAGC
+AGTAAATCAATGACTTTGATACCGATAAACGGCACCAGCAGCCCACCCAGACCGTAAATCCATAAGTTACGGCGCAACATGGCAGAAGCGGTAAGCGGTT
+TATAACTCACGCCTTTTAACGCCAGGGGAATCAAAGACGATAATCAAGGCGTTGAAAATCACCGCACTGAGGATTGCGGAGTCGGGCGAATGCAGGCACA
+TGATGTTCAGCGCATTTAACTGCGGATACGTTGCCGCGAATGCCGCCGGAATAATGGCGAAGTATTTCGCCACATCGTTGGCAATGCTGAAGGTGGTCAG
+CGAGCCACGGGTCATCAGCATCTGTTTGCCAATGTGCACCACCTCGATCAACTTGGTCGGGTTAGAGTCGAGATCGACCATATTGCCCGCCTCTTTCGCC
+GCCTGGGTGCCGGAGTTCATCGCCACCGCGACATCTGCCTGCGCCAGCGCCGGAGCATCGTTGGTGCCGTCGCCGGTCATCGCTACCAAACGACCTTCCG
+CCTGATACTGACGGATCAATGCCAGCTTGGCCTCCGGTGTCGCTTCGGCGAGAAAATCATCGACACCCGCTTCCGCAGCAATCGCGGCGGCAGTCAGACG
+GTTATCGCCGGTAATCATCACCGTTTTAATGCCCATTTTGCGCAGCTGGGCGAAGCGCTCTTTAATACCGCCTTTGACGATATCTTTCAGCGCAATAACG
+CCCAGCACACGAGAACCTTCCACCACCACCAGCGGCGTGGCTCCCTGACGCGCAACCTGATCGACTTTTTGATCAACATCGGTAGGGAAGTGACCACCGT
+TAGCCTCAACATGGCGACGAATGGCATCGACAGAACCTTTACGGATCATGCGGTTGTCGATGTTGATCCCGCTCATCCGGCTTTGCGCAGTAAACGGTAC
+AAAGGTGGCATGGAGCGACTGCACATCGCGCTCGCGCAGGTTAAAACGCTGCTTGGCGAGGATCACAATACTGCGGCCTTCCGGCGTTTCATCAGCCAGC
+GAAGCCAGTTGTGCGGCGTCAGCCAGCGTTTTCATCCACGCCCTGCGCGGGGATAAACTCCGACGCCTGACGGTTACCGAGTGTGATGGTGCCGGTTTTA
+TCCAGTAGCAGAACGTCAACGTCACCTGCCGCTTCAACTGCACGTCCGCTGGTGGCAATCACATTCGCGCCTAGCATCCGGCTCATCCCGGCGACGCCGA
+TCGCTGACAACAGGCCGCCAATAGTGGTTGGGATCAGACAGACCAGCAGCGCCACCAGTACCGTTACGCTGACTGCATTACCGCCCCACGCGGAAAACGG
+CCACAGCGTGGCGGTTGCCAGTAAAAGACGATAGTCAGGGCAATCAGCAGAATGGTCAGGGCAATTTCGTTCGGCGTTTTGCGTCGCTGTGCGCCTTCCA
+CCATCGCGATCATCCGATCCAGAAATGTCTCGCCGGGGTTAACGCTACACTCAATCACCAGCCAGTCAGAAAGAATACGCGTGCCGCCGGTGACGGAGGC
+AAAATCGCCGCCGGATTCACGGATCACCGGTGCCGATTCCCCGGTGATGGCGCTTTCATCGACCGATGCACCCCTTCAATAACTTCACCATCGCAGGGGA
+TAATATCGCCAGCTTCTACCAGTACGATATCGCCTTTACGAAGTTGGTCGGCAGGAACTTTGTCCGCCGCAGCGCCATATTTCGGCTCACGCAGCTTGCG
+GGCAAAGGCAGTTTTTCACCCTTTCAGACTGTTGGCCTGCGCTTTACTGCGGCCTTCTGCCAGCGCCTCGGCGAAATTAGCGAACAGTACGGTGATCCAC
+AGCCAACCGCTAATGGCCGCGCTAAACAGCGCATTGCCGGGCATCGCACCGCTTGCCATCGCGATGCTAATACAGGTGGTCAGCAGACTGCCGATCCAGA
+CGATAAACATCACCGGATTGCGCCATTGCGCCTGCGGGTTTAATTTTTCACCGCTTCTTTCAGCGCCTGAACGACAAGTGTTGGTTCGAATAGCGCCAGT
+TGTTTACGACTCATATTCAGTGCTCACTCAATATCATCAGGAGAGATATTCCGCCACCGGACCAAGCGCCAGGGCAGGGATAAAGGTCAGTGCGCCAACC
+AGCAACACGGTGCCGATTAACAGGCCAACAAACAGCGGGCCGTGCGTTGGCAGCGTGCCGGAGCTGGCGGCTTGGCTCTTTTACTCACCAGCGAACCGGC
+AATTGCCATCACCGGGATAATCACCCCGAAGCGACCGACAAACATGCAGAACGCCAGTAAACAGTTCCAGAACGGAGAGTTGGCGCTTAATCCGGCAAAG
+GCGCTGCCGTTGTTGTTAGCGGCGGATGACACGGCGTACAGCACTTCGCTAAAACCATGCGGGCCAGGGTTGAGCATGGCGCTACGTCCGGCGTCGGTCA
+TCATCGCCAACGCCGCGCCCATCAGCACCAGCGTCGGGGTAACCAGAATTGCCAGTGCAGTCAGTTTCATCTCGCGTACGTCGATTTTTTACCCAGATAT
+TCCGGTGTACGACCAATCATCAGCCCGGCAATAAACACCGCCAGCAGGACAAACAGCATCATGCCGTAAAGACCAGAACCGACACCGCCGAACACCACTT
+CACCAATTTGCATCAGCCACATCGGCACCATGCCACCGAGAGCGGTAAACGAATCATGCATCGCAATCACCGCGCCACAGGAAGCCGCCGTCGTCACGAC
+CGCAAACAGGCTACTGACCAGCACGCCGAAACGGCTCTCTTTACCTTCCATATTGATGCTGCTGTCCGTGCCCAGTGCCAGCAGATGAGGATTACCCTGA
+ACTTCTGCCCACATCACCACGCCTACGCAGATGACAAAATCACTGACATCGCCCACAGCAACATGCGCCCCTGGCGGCGATCGCCCATCACTTCACCAAA
+GGCAAAGCACAGCGCCGTTGGGATCAAGAAGATCGCCAGCATCTGCACGAAGTTGGTCAGTGCGGTTGGGTTTTCAAACGGATGCGACGAGTTGGCATTA
+AAGAAGCCACCGCCGTTAGTACCGAGCATCTTGATCGCTTCCTGAGAAGCTACAGGCCCCATGGGTAACAGCTGTTGCGCTCCTTCAACGGTATTCACAG
+CCTGATAAGGCAGAAAGTTTTGCAGCGCACCTTGTTGAATAAAAACAGTGCAATCAACAACGCCACAGGGACTAGCACCCATAACGTGATGCGTAGCAGA
+TCGACCCAGGCATTCCCGAGCGTGCTCATGCTCTGGCGGGTAAACGCACGGATGAGGGCAAAATCACCGCAATCCCGCTGGCGGCAGAAAGAAAGTTTTG
+CACCGTTAAGCCCGCCATCTGGCTGAAATAGCTCAACGTGGTTTCACCGCTATAAGATTGCCAGTTGGTATTGGTGACAAAGCTGACGGCGGTATTCAGC
+GCCAGATCCCACGACAGCCCTGGCAACTGCTGTGGATTAAGCGGCAGATAGTGCTGACCGAGCAACATAAAAACAGCACCGCCAGCCCCAGCATGTTCAG
+GCCGAGAATGGCACAAAGATATTGCTTCCAGTTCATCTCACGGTCAGAGACGCCAAGTGCGCGAAAAGTACGCGCTCAACGCCCGTTGTACCGGGAAGAG
+GAATGTCATTAATCAGCCGCGCCAGCCCGCTGCCTAAAGGACGCGCCAGCACCATTAACACCAGTAAAAACGTGGCGATCAGTAAGAACCCTTGCGCAGC
+CATCAGAACGCCTCCGCATTGATCAGGGCATAAACCAGATAACCCAGTAATAAAACACCAGCAATACGCCGGTTATCACGCCTGCACTCACAGTGCACCT
+CCAGTGGCCTAAAAGTGATACCGGAAGGGTAGAATTCTGGCTGCAAAGATTTCGCAAAATCTGCGGGCGGGGTGTAAAAGTATAAAAATGGCAAAAGCCA
+TGATTTAACTAATGTTTAGTATTAATTTAACTTTTGTGTAACTTAATTACAGGATGAATGTAAATAAACCATCAATAAGCAAAAATAAGTGGTCGGATGA
+GTAGTAAAATTACACAAAAGGCGGTACTATTTTCATCAGATAAACAAATTCATTTTTCCGGTGCCATTCACCGGGTAGATACAAAGGGGAGAAAAGTATG
+GAACTCTACAGAGAATATCCTGCATGGCTTATCTTTTTACGCCGTACTTATGCGGTTGCAGCGGGCGTTCTGGCGCTGCCTTTCATGCTTTTCTGGAAAG
+ACCGCGCCCGCTTTTACAGCTACCTGCATCGCGTCTGGTCGAAAACCAGCGATAAACCGGTGTGGATGGATCAGGCCGAAAAGGCAACTGGTGATTTTAT
+TGATTGCTGAGTTTTGAATACATTGAAAACCGCCAGCGGAAACGCTGGCGGTTTTTGTATCAGGAAGATGTTCAGAGGAATATTTAGACATCGTTATACC
+AATCGAAACATATATTCATGAAATATATATAAATATTTTCCTAATTGTTCTTATCTGACAGATATCTCACTTAAGGCTTTCTTATAAATCTGTAGGGTTT
+CGCCTGTCAGCAGACAAATAACCCGATAAAACAAGGATGAGCAGATGAGCGGAAAACCGGCGGCGCGTCAGGGCGACATGACGCAGTATGGCGGTAGCAT
+TGTCCAGGGTTCAGCCGGGGTACGCATCGGTGCCCCACCGGCGTGGCCTGTTCGGTGTGCCCCGGCGGGTGACGTCCGGCCATCCGGTCAATCCGCTGCT
+CGGTGCAAAGGTCCTTCCCGGTGAAACCGACATCGCCCTGCCCGGCCCGCTGCCGTTCATTCTCTCCCGCACCTACAGCAGTTACCGGACAAAACGCCCG
+CGCCGGTGGGGAGCCTCGGCCCCGGCTGGAAAATGCCTGCGGATATCCGCTTACAGCTGCGCGATAACACACTGATACTCAGTGATAACGGCGGCAGAAG
+CCTGTATTTTGAGCACCTGTTTCCCGGTGAGGACGGTTACAGCCGCAGCGAGTCACTGTGGCTGGTGCGCGGCGGCGTGGCGAAACTGGATGAAGGTCAC
+CGGCTGGCCGCACTCTGGCAGGCGCTGCCGGAAGAACTCCGCTTAAGTCCGCATCGTTATCTGGCGACAAACAGTCCGCAGGGGCCGTGGTGGCTGCTCG
+GCTGGTGTGAGCGGGTGCCGGAAGCGGATGAGGTGCTGCCTGCGCCGCTGCCGCCGTACCGGGTACTGACCGGGCTGGTGGACCGCTTCGGGCGCACACA
+GACGTTCCACCGCGAAGCCGCCGGTGAATTCAGCGGCGAAATCACCGGCGTGACGGATGGTGCCGGGCGTCACTTCCGGCTGGTACTGACCACGCAGGCG
+CAGCGGGCAGAAGAAGCCCGGCAGCAGGCCATTTCCGGCGGGACGGAACCGTCCGCTTTTCCTGATACCCTGCCGGGTTACACCGAATATGGCCGGGACA
+ACGGCATCCGTCTGTCTGCCGTGTGGCTGACGCACGACCCGGAATACCCGGAGAATTTACCTGCCGCGCCGCTGGTGCGCTATGGCTGGACGCCCGCGGC
+GAACTGGCGGCGGTGTATGACCGCAGCAATACACAGGTGCGCAGCTTTACTTACGATGATAAATACCGGGGCCGGATGGTGGCGCACCGTCACACGGGCC
+GACCGGAAATCTGTTACCGTTACGACAGCGACGGGCGGGTGACAGAACAGCTAAACCCGGCAGGCTTAAGTTACACGTATCAGTATGAGAAGGACCGCAT
+CACCATCACCGACAGCCTGAACCGCCGTGAAGTCCTGCACACGCAGGGTGAAGGCGGGCTGAAGCGGGTGGTGAAAAGGAACACGCGGACGGCAGCGTCA
+CGCAGAGTCAGTTTGACGCGGTGGGCAGGCTCAGGGCACAGACGGATGCCGCAGGCAGGACAACAGAATACAGTCCGGATGTGGTGACGGGCCTCATCAC
+GCGCATCACCACGCCGGATGGCAGGGCATCGGCGTTTTACTATAACCACCACAGCCAGTTAACGTCAGCCACCGGGCCTGACGGGCTGGAAATACGCCGG
+GAATATGATGAATGGGGCCGTCTGATTCAGGAAACTGCCCCTGACGGCGATATCACCCGCTACCGTTATGATAATCCACACAGTGACTTACCCTGCGCAA
+CGGAAGATGCCACCGGCAGCCGGAAAACCATGACGTGGAGCCGTTACGGTCAGTTGCTGAGCTTCACTGACTGTTCCGGTTATGTAACCCGCTATGACCA
+TGACCGTTTTGGTCAGGTGACGGCGGTGCACCGCGAGGAAGGGCTGAGTCAGTACCGCGCATACGACAGCCGTGGACAGTTAATTGCCGTGAAAGACACG
+CAGGGCCATGAAACGCGGTATGAATACAACGCCGCCGGTGACCTGACCACCGTCATTGCCCCGGACGGCAGCAGAAACGGGACACAGTACGATGCGTGGG
+GAAAAGCCATCTGTACCACGCAGGGCGGTCTGACGCGCAGTATGGAATACGATGCTGCCGGACGGGTCATCCGCCTGACCAGTGAAAACGGCAGCCACAC
+CACCTTCCGTTACGATGTACTCGACCGGCTGATACAGGAAACCGGCTTTGACGGCCGCACACAGCGTTATCACCACGACCTGACCGGCAAACTTATCCGC
+AGCGAGGATGAGGGCTGGTCACCCACTGGCACTATGACGAAGCAGACCGCCTCACGCACCGCACCGTGAATGGCGAAACCGCAGAGCGGTGGCAGTATGA
+CGAACGCGGCTGGCTGACAGACATCAGCCATATCAGCGAAGGGCACCGGGTGACGGTGCACTATGGTTATGACAGTAAAGGCCGCCTCGCCAGTGAACAC
+CTGACGGTGCATCATCCGCAGACGAATGAACTGCTCTGGCAGCATGAGACCAGACATGCGTACAACGCACAGGGACTGGCGAACCGCTGTATACCGGACA
+GCCTGCCCGCCGTGGAATGGCTGACCTACGGCAGCGGCTGGCTGTCAGGCATGAAACTCGGCGACACACCGCTGGTGGAGTACACCCGCGACCGCCTGCA
+CCGGGAAACGCTGCGCAGCTTCGGCCGTTATGAACTCACCACCGCTTATACCCCTGCCGGGCAGTTACAGAGCCAGCACCTGAACAGCCTGCTGTCTGAC
+CGCGATTACACCTGGAACGACAACGGCGAACTCATCCGCATCAGCAGCCCGCGCCAGACCCGGAGTTACAGCTACAGCACCACCGGCAGGCTGACCGGCG
+TTCACACCACCGCAGCGAATCTGGATATCCGCATCCCGTATACCACAGACCCGGCAGGTAACCGCCTGCCCGACCCGGAGCTGCACCCGGACAGCGCCCT
+CAGCATGTGGCCGGATAACCGTATCGCCCGTGACGCGCACTATCTTTACCGGTATGACCGTCACGGCAGGCTGACAGAGAAACCGACCTCATCCCGGAAG
+GGTTATCCGCACGGATGATGAGCGCACCCACCGGTACCATTACGACAGTCAGCACCGGCTGGTGCACTACACGCGGACACAATATGCAGAGCCGCTGGTC
+GAAAGTCGCTATCTTTACGACCCGCTGGGCCGCAGGGTGGCAAAACGGGTATGGCGGCGTGAACGGGACCTGACGGGCTGGATGTCGCTGTCACGGAAAC
+CGCAAGTGACCTGGTACGGCTGGGACGGCGACCGCCTGACCACGATACAGAACGACAGAACCCGCATCCAGACGATTTATCAGCCGGGGAGCTTCACGCC
+ACTCATCAGGGTTGAAACCGCCACCGGTGAGCTGGCGAAAACGCAGCGCCGCAGCCTGGCGGATACCCTTCAGCAGTCCGGTGGCGAAGACGGTGGCAGT
+GTGGTGTTCCCGCCGGTGCTGGTGCAGATGCTCGACCGGCTGGAAAGTGAAATCCTGGCTGACCGGGTGAGTGAGGAAAGCCGCCGCTGGCTGGCATCGT
+GCGGCCTGACGGTGGCGCAGATGCAAAGCCAGATGGACCCGGTATACACGCCGGCGCGAAAAATTCACCTGTACCACTGCGACCATCGCGGCCTGCCGCT
+GGCCCTATCAGCACGGAAGGGACAACAGCGTGGTACGCAGAATACGATGAATGGGGTAACCTGCTGAATGAAGAGAACCCGCATCAGCTGCAGCAGCTTA
+TCCGCCTGCCGGGGCAGCAGTATGATGAGGAGTCCGGCCTGTATTACAACCGCCACCGCTATTATGACCCGCTGCAGGGGCGATATATCACTCAGGATCC
+GATTGGGCTGAAAGGGGATGGAATTTTATCAGTATCCGTTGAATCCGATCTCAAATATAGATCCATTAGGATTAGAAACACTAAAATGCATTAAGCCACT
+GCATTCAATGGGCGGAACTGGTGAAAGAAGCGGTCCAGATATATGGGGAATCCGTTCTATCATCAATATCTTTGTGTCCCAGATGGTAAAGGGACTATAC
+TTGTGGTGGCCAAGACCAACGGGGAGAATCAAAGGAGATGGTCTATGGGGGCCAGGTAAAGCAAGTAATGATACAAAGAAGCTGCTGGCCGTTGTGACCT
+CGTTGAAACCGATAATAGTTGTGTGGAGAACTGTTTAAAGGAAGTTTAAAGAGGTAAGGCCGCGTTATTCTGTATTGCCTGATATATTCACACCTATAAA
+TTTAGGGCTATTTAAAACTGCCAAGACTGGTCTAATGATTCTTTAGAAACATGTAAGATGAAGTGCTCCGGAAATAACATTGGACGTTTTATTAGATTTG
+TATTCACCGGAGTGATGTAATGAAATATATTATTTTTTATTCAGAGCTATATGGCTGGCTTTATCGCTTTTAATACTATTCTTTTCCATGCATAGACTTT
+CACTATTAGACTCCACTCGTGATGTGAGCGAGTTAATTAGTCTCATGTCTTATGGAATGATGGTAATATGTTTTCCAACAGGCATAGTATTCTTTATTGC
+TCTAATATTTATAGGGACTGTATCAGACATTATTGGCGTAAGGATTGATAGTAAGTATATTATGGCGATAATAATATGGCTTTATTTTCTGTCAGGAGGG
+TATATTCAATGGTTTGTATTAAGTAAGCGCATTATAAACAAATAAATTAAGTTAATTGCTCTTATTATTATATGTAACCTGGGCATTGATATCCCGTATG
+CCACAGACCCGGCAGGTAACCGCCTGCCCGACCGGAGCTGCACCCGGACAGCACCCTCAGCATGTGGCCGGATAACCGTATCGCCCGTGACGCGCACTAT
+CTTTACCGGTATGACCGTCACGGCAGGCTGACGGAGAAAACCGACCTCATCCGGAAGGGTTATCCGCACGGATGATGAGCGCACCCACCGGTACCATTAC
+GACAGTCAGCACCGGCTGGTGCACTACACGCGGACACAATATGCAGAGCCGCTGGTCGAAAGCCGCTATCTTTACGACCCGCTGGGCCGCAGGGTGGCAA
+AACGGGTGTGGCGACGTGAACGGGACCTGACGGGCTGGATGTCGCTGTCACGGAAACCGCAAGTGACCTGGTACGGCTGGGACGGCGACCGCCTGACCAC
+GATACAGAACGACAGAACCCGCATCCAGACGATTTATCAGCCGGGGAGCTTCACGCCACTCATCAGGTTGAAACCGCCACCGGTGAGCTGGCGAAAACGC
+AGCGCCGCAGCCTGGCGGATACCCTTCAGCAGTCCGGCGGCGAAGACGGTGGCAGTGTGGTGTTCCCGCCGGTGCTGGTGCAGATGCTCGACCGGCTGGA
+AAGTGAAATCCTGGCTGACCGGGTGAGTGAGGAAAGCCGCCGCTGGCTGGCATCGTGCGGCCTGACGGTGGAGCAGATGCAAAACCAGATGGACCCGGTG
+TACACGCCGGCGCGAAAAATCCACCTGTACCACTGCGACCATCGCGGCCTGCCGCTGGCGCTTGTCAGCACGGAAGGGGCAACAGAATGGTGCGCAGAAT
+ACGATGAATGGGGCAACCTGCTGAATGAAGAGAACCCGCATCAGCTGCAGCAGCTTATCCGCCTGCCGGGGCAGCAGTATGATGAGGAGTCCGGCCTGTA
+TTACAACCGCCACCGCTATTATGACCCGCTGCAGGGAGGTATATCACTCAGGATCCGATTGGGCTGAAGGGGATGGAATTTTATCAGTATCCGCTGAATC
+CGGTTCAGTATATAGATTCAATGGGACTGGCATCAAAATATGGACACTTAAATAATGGCGGATATGGAGCGAGACCCAACAAACCGCCTACGCCCGATCC
+AAGTAAATTGCCGGACATAGCGAAACAATTAAGACTGCCATATCCTATTGACCAGGCCAGTAGTGCGCCTAATGTTTTCAAAACATTCTTCAGAGCATTA
+AGCCCTACGACTACACACTGTATTGCAGGAAGTGGGTAAAACCAAATCTGACTTGTACGCCACAGGATGATTCCCAGTATCCAGGGATGGATACAAAGAC
+AGCAAGTGATTACCTGCCACAGACAAATTGGCCAACAACTCAATTACCACCAGGATATACTTGTGCAGAACCCTATTTATTCCCAGACATTAATAAACCC
+GATGGGCCAGCAACAGCAGGGATAGATGATTTGGGTGAAATTTTAGCTAAGATGAAACAGAGAACATCGAGAGGAATAAGAAAATGAAAAGAGTTTTGTT
+CTTTTTGCTGATGATATTTGTTAGTTTTGGTGTTATAGCTGATTGCGAAATACAAGCTAAAGATCATGATTGTTTTACTATTTTCGCTAAAGGGTACTAT
+TTTTCCGCGTTTCCTGTCTTAAATAATAAAGCCATGTGGAGATGGTATCAGAATGAGGACATCGGTGAGTATTATTGGCAAACAGAACTGGGTACATGTA
+AAAATAATAAATTCACACCAAGCGGGCGAGACTCTTAATTCGCGTCGGGTCACTACGCCTTAATGAAAATCATGCCATCAAAGGAACGTTGCAGGAGTTG
+ATAAATACAGCAGAAAAACGGCGTTTCTCGGCGATCGGTTTAGAAGTTATATAAGAGCGGGTATCTATCAAAAGAGCAGTGATCCAGTTCAGTTGTTGGC
+AGTCCTTGATAATTCAATCATGGTAAAATATTTTAAAGATGAGAAACCAACTTATGCTCGAATGACAGCACATCTCCCGAACAAAATGAGTCTTACGAAT
+GTTTAATAAAGATACAGCATGAACTAATTCGTAGTGAAGAGAAATAAAATCTCTTCCTGAGAAAACAAATTAATCATTGTGAAAAATTATATAACTCATG
+GAATAGGTGTTTATTTTGCGTTCCATTTGCAGGAAAGATCACGTAACGCTACTTTTTGTACTAAATAATTCGAATTTAAGTTCAACAATTGAGATACTAC
+TTATTGTCTAAAGCTGTTTTTCATAGCTTATACATGATCAAATACTCCTTACATAAATAAGGTGAACAAATGGAACTTAAAAATTGATGGAACATATTTC
+TATTACACCCGATTACAGACAAGCCTGGAAAGTGGTGCATAAATTGTCAGATATTCTACTGTTGACTATTTGTGCCGTTATTTCTGGTGCAGAAGGTTGG
+GAAGATATAAGAGGATTTCGGGGAAACATCTCGATTTTTTGAAGCAATATGGTGATTTTGAAAATGGTATTCCTGTTCACGATACCATTGCCAGAGTTGT
+ATCAGGAAAGATCACGTAACGCTACTTTTTGTACTAAATAATTCGCATTTTATGTTTAAAAATTGAGATATTCCTTATTACCTAAAGCTGTTTTTCATAG
+CTTATACATGATCAAATACTCCTTACATAAATAAGGTGAACAAATGGAACTTAAAAATTGATGGAACATATTTCTATTATTCCCGATTACAGATAAGCCT
+GGAAAGTAGAGCATAAATTGTCCAGGCATCCTACTATTGACTATTTTGCCGTTATTTCTGGTGCGAAAGTTGGGAAGATATAGAGGATTTCGGGAAACAC
+ATCTCGATTTCTTGAAGCAATATGGTGATTTTGAAAATGGTATTCCTGTTCACGATACTATTGCCAGAGTTGTATCCTGTATCAGTCCT
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/ecoli_canu_contigs_result2.fa	Sat Jun 09 13:46:56 2018 -0400
@@ -0,0 +1,155 @@
+>tig00000001 len=15307 reads=47 covStat=-31.76 gappedBases=no class=contig suggestRepeat=no suggestCircular=no
+AAAATAGTCAATAGTAGGATGCCTGACAATTTATGCTCTACTTTCCAGGCTTATCTGTAATCGGGAATAATAGAAATATGTTCCATCAATTTTTAAGTTC
+CATTTGTTCACCTTATTTATGTAAGGAGTATTTGATCATGTATAAGCTATGAAAAACAGCTTTAGGTAATAAGAATATCTCAATTTTTAAACATAAAATG
+CGAATTATTTAGTACAAAAAGGCGTTACGTGATCTTTCCTGGGATACAACTCTGGCAATGGTATCGTGAACAGGAATACCATTTTCAAAATCACCATATT
+GCTTCAAAAAATCGAGATGTGTTTCCCCGAAATCCTCTATATCTTCCCAACCTTCTGCACCAGAAATAACGGCACAAATAGTCAAACAGTAGAATATCTG
+ACAATTTATGCACCACTTTCAGGCTTGTCTGTAATCGGGTGTAATAGAAATATGTTCCATCAATTTTTTAAGTTCCATTTGTTCACCTTATTTATGTAAG
+GGTATTTGATCATGTATAAGCTATGAAAAAACAGCTTTAGACAATAAGTAGTATCTCAATTGTTGAACTTAAATTCGAATTATTTAGTACAAAAAGTAGC
+GTTACGTGATCTTTCCTGCAAATGGAACGCAAAATAAACACCTATTCCATGAGTTATATAATTTTTCACAATGATTAATTTGTTTTCTCAGGAAGAGATT
+TTATTTCTCTTCACTACGAATTAGTTCATGCTGTATCTTTATTAAACATTCGTAAGACTCATTTTTGTTCGGGAGATGTGCTGTCATTCGAGCATAAGTT
+GGTTTCTCATCTTTAAAATATTTTACCATGATTGAATTATCAAGGACTGCCAACAACTGAACTGGATCACTGCTCTTTTGATAGATACCCGCTCTTATAT
+AACTTCTAAACCGATCGCCGAGAAACGCCGTTTTTCTGCTGTATTTATCAACTCCTGCAACGTTCCTTTGATGGCATGATTTTCATTAAGGCGTAGTGAC
+CCGACGCGAATTAAGAGTCTCGCCCCGCTTGGTGTGAATTTATTATTTTTACATGTACCCAGTTCTGTTTGCCAATAATACTCACCGATGTCCTCATTCT
+GATACCATCTCACATGGCTTTATTATTTAAGACAGGAAACGCGGAAAAATAGTACCCTTAGCGAAAATAGTAAAACAATCATGATCTTTAGCTTGTATTT
+CGCAATCAGCTATAACACCAAAACTAACAAATATCATCAGCAAAAAGAACAAAACTCTTTTCATTTTCTTATTCCTCTCGATGTTCTCTGTTTCATCTTA
+GCTAAAATTTCACCCAAATCATCTATCCCTGCTGTTGCTGGCCCATCGGGTTTATTAATGTCTGGGAATAAATAGGGTTCTGCACAAGTATATCCTGGTG
+GTAATTGAGTTGTTGGCCAATTTGTCTGTGGCAGGTAATCACTTGCTGTCTTTGTATCCATCCCTGGATACTGGGAATCATCCTGTGGCGTACAAGTCAG
+ATTTGGTTTTACCCACTTCCTGCAATACAGTGTGTAGTCGTAGGGCTTAATGCTCTGAAGAATGTTTTGAAAACATTAGGCGCACTACTGGCCTGGTCAA
+TAGGATATGGCAGTCTTAATTGTTTCGCTATGTCCGGCAATTTACTTGGATCGGGCGTAGGCGGTTTGTTGGTCTCGCTCCATATCCGCCATTATTTAAG
+TGTCCATATTTTGATGCCAGTCCCATTGAATCTATATACTGAACCGGATTCAGCGGATACTGATAAAATTCCATCCCCCTTCAGCCCAATCGGATCCTGA
+GTGATATACCTCCCTGCAGCGGGTCATAATAGCGGTGGCGGTTGTAATACAGGCCGGACTCCTCATCATACTGCTGCCCCGGCAGGCGGATAAGCTGCTG
+CAGCTGATGCGGGTTCTCTTCATTCAGCAGGTTGCCCCATTCATCGTATTCTGCGCACCATTCTGTTGCCCCTTCCGTGCTGACAAGCGCCAGCGGCAGG
+CCGCGATGGTCGCAGTGGTACAGGTGGATTTTCGCGCCGGCGTGTACACCGGGTCCATCTGGTTTTGCATCTGCTCCACCGTCAGGCCGCACGATGCCAG
+CCAGCGGCGGCTTTCCTCACTCACCCGGTCAGCCAGGATTTCACTTTCCAGCCGGTCGAGCATCTGCACCAGCACCGGCGGAACACCACACTGCCACCGT
+CTTCGCCGCCGGACTGCTGAAGGGTATCCGCCAGGCTGCGGCGCTGCGTTCGCCAGCTCACCGGTGGCGGTTTCAACCTGATGAGTGGCGTGAAGCTCCC
+CGGCTGATAAATCGTCTGGATGCGGGTTCTGTCGTTCTGTATCGTGGTCAGGCGGTCGCCGTCCCAGCCGTACCAGGTCACTTGCGGTTTCCGTGACAGC
+GACATCCAGCCCGTCAGGTCCCGTTCACGTCGCCACACCCGTTTTGCCACCCTGCGGCCCAGCGGGTCGTAAAGATAGCGGCTTTCGACCAGCGGCTCTG
+CATATTGTGTCCGCGTGTAGTGCACCAGCCGGTGCTGACTGTCGTAATGGTACCGGTGGGTGCGCTCATCATCCGTGCGGATAACCCTTCCGGGATGAGG
+TCGGTTTTCTCCGTCAGCCTGCCGTGACGGTCATACCGGTAAAGATAGTGCGCGTCACGGGCGATACGGTTATCCGGCCACATGCTGAGGGTGCTGTCCG
+GTGCAGCTCCGGTCGGGCAGGCGGTTACCTGCCGGGTCTGTGGCATACGGGATATCAATGCCCAGGTTACATATAATAATAAGAGCAATTAACTTAATTT
+ATTTGTTTATAATGCGCTTACTTAATACAAACCATTGAATATACCCTCCTGACAGAAAATAAAGCCATATTATTATCGCCATAATATACTTACTATCAAT
+CCTTACGCCAATAATGTCTGATACAGTCCCTATAAATATTAGAGCAATAAAGAATACTATGCCTGTTGGAAAACATATTACCATCATTCCATAAGACATG
+AGACTAATTAACTCGCTCACATCACGAGTGGAGTCTAATAGTGAAAGTCTATGCATGGAAAAGAATAGTATTAAAAGCGATAAAGCCAGCCATATAGCTC
+TGAATAAAAAATAATATATTTCATTACATCACTCCGGTGAATACAAATCTAATAAAACGTCCAATGTTATTTCCGGAGCACTTCATCTTACATGTTTCTA
+AAGAATCATTAGACCAGTCTTGGCAGTTTTAAATAGCCCTAAATTTATAGGTGTGAATATATCAGGCAATACAGAATAACGCGGCCTTACCTCTTTAAAC
+TTCCTTTTAAACAGTTCTCCACACAACTATTATCGGTTTCAACGAGGTCACAACGGCCAGCAGCTTCTTTGTATCATTACTTGCTTTACCTGGCCCCCAT
+AGACCATCTCCTTTGATTCTCCCCGTTGGTCTTGGCCACCACAAGTATAGTCCCTTTACCATCTGGGACACAAAGATATTGATGATAGAACGGATTCCCC
+ATATATCTGGACCGCTTCTTTCACCAGTTCCGCCCATTGAATGCAGTGGCTTAATGCATTTTAGTGTTTCTAATCCTAATGGATCTATATTTGAGATCGG
+ATTCAACGGATACTGATAAAATTCCATCCCCTTTCAGCCCAATCGGATCCTGAGTGATATATCGCCCCTGCAGCGGGTCATAATAGCGGTGGCGGTTGTA
+ATACAGGCCGGACTCCTCATCATACTGCTGCCCCGGCAGGCGGATAAGCTGCTGCAGCTGATGCGGGTTCTCTTCATTCAGCAGGTTACCCCATTCATCG
+TATTCTGCGTACCACGCTGTTGTCCCTTCCGTGCTGATATGGGCCAGCGGCAGGCCGCGATGGTCGCAGTGGTACAGGTGAATTTTTCGCGCCGGCGTGT
+ATACCGGGTCCATCTGGCTTTGCATCTGCGCCACCGTCAGGCCGCACGATGCCAGCCAGCGGCGGCTTTCCTCACTCACCCGGTCAGCCAGGATTTCACT
+TTCCAGCCGGTCGAGCATCTGCACCAGCACCGGCGGGAACACCACACTGCCACCGTCTTCGCCACCGGACTGCTGAAGGGTATCCGCCAGGCTGCGGCGC
+TGCGTTTTCGCCAGCTCACCGGTGGCGGTTTCAACCCTGATGAGTGGCGTGAAGCTCCCCGGCTGATAAATCGTCTGGATGCGGGTTCTGTCGTTCTGTA
+TCGTGGTCAGGCGGTCGCCGTCCCAGCCGTACCAGGTCACTTGCGGTTTCCGTGACAGCGACATCCAGCCCGTCAGGTCCCGTTCACGCCGCCATACCCG
+TTTTGCCACCCTGCGGCCCAGCGGGTCGTAAAGATAGCGACTTTCGACCAGCGGCTCTGCATATTGTGTCCGCGTGTAGTGCACCAGCCGGTGCTGACTG
+TCGTAATGGTACCGGTGGGTGCGCTCATCATCCGTGCGGATAACCCTTCCGGGATGAGGTCGGTTTTCTGTCAGCCTGCCGTGACGGTCATACCGGTAAA
+GATAGTGCGCGTCACGGGCGATACGGTTATCCGGCCACATGCTGAGGGCGCTGTCCGGGTGCAGCTCCGGTCGGGCAGGCGGTTACCTGCCGGGTCTGTG
+GTATACGGGATGCGGATATCCAGATTCGCTGCGGTGGTGTGAACGCCGGTCAGCCTGCCGGTGGTGCTGTAGCTGTAACTCCGGGTCTGGCGCGGGCTGC
+TGATGCGGATGAGTTCGCCGTTGTCGTTCCAGGTGTAATCGCGGTCAGACAGCAGGCTGTTCAGGTGCTGGCTCTGTAACTGCCCGGCAGGGGTATAAGC
+GGTGGTGAGTTCATAACGGCCGAAGCTGCGCAGCGTTTCCCGGTGCAGGCGGTCGCGGGTGTACTCCACCAGCGGTGTGTCGCCGAGTTTCATGCCTGAC
+AGCCAGCCGCTGCCGTAGGTCAGCCATTCCACGGCGGGCAGGCTGTCCGGTATACAGCGGTTCGCCAGTCCCTGTGCGTTGTACGCATGTCTGGTCTCAT
+GCTGCCAGAGCAGTTCATTCGTCTGCGGATGATGCACCGTCAGGTGTTCACTGGCGAGGCGGCCTTTACTGTCATAACCATAGTGCACCGTCACCCGGTG
+CCCTTCGCTGATATGGCTGATGTCTGTCAGCCAGCCGCGTTCGTCATACTGCCACCGCTCTGCGGTTTCGCCATTCACGGTGCGGTGCGTGAGGCGGTCT
+GCTTCGTCATAGTGCCAGTGGGTGACCAGCCCTCATCCTCGCTGCGGATAAGTTTGCCGGTCAGGTCGTGGTGATAACGCTGTGTGCGGCCGTCAAAGCC
+GGTTTCCTGTATCAGCCGGTCGAGTACATCGTAACGGAAGGTGGTGTGGCTGCCGTTTTCACTGGTCAGGCGGATGACCCGTCCGGCAGCATCGTATTCC
+ATACTGCGCGTCAGACCGCCCTGCGTGGTACAGATGGCTTTTCCCCACGCATCGTACTGTGTCCCGTTTCTGCTGCCGTCCGGGGCAATGACGGTGGTCA
+GGTCACCGGCGGCGTTGTATTCATACCGCGTTTCATGGCCCTGCGTGTCTTTCACGGCAATTAACTGTCCACGGCTGTCGTATGCGCGGTACTGACTCAG
+CCCTTCCTCGCGGTGCACCGCCGTCACCTGACCAAAACGGTCATGGTCATAGCGGGTTACATAACCGGAACAGTCAGTGAAGCTCAGCAACTGACCGTAA
+CGGCTCCACGTCATGGTTTTCCGGCTGCCGGTGGCATCTTCCGTTGCGCAGGGTAAGTCACTGTGTGGATTATCATAACGGTAGCGGGTGATATCGCCGT
+CAGGGGCAGTTTCCTGAATCAGACGGCCCCATTCATCATATTCCCGGCGTATTTCCAGCCCGTCAGGCCCGGTGGCTGACGTTAACTGGCTGTGGTGGTT
+ATAGTAAAACGCCGATGCCCTGCCATCCGGCGTGGTGATGCGCGTGATGAGGCCCGTCACCACATCCGGACTGTATTCTGTTGTCCTGCCTGCGGCATCC
+GTCTGTGCCCTGAGCCTGCCCACCGCGTCAAACTGACTCTGCGTGACGCTGCCGTCCGCGTGTTCCTTTTCACCACCCGCTTCAGCCCGCCTTCACCCTG
+CGTGTGCAGGACTTCACGGCGGTTCAGGCTGTCGGTGATGGTGATGCGGTCCTTCTCATACTGATACGTGTAACTTAAGCCTGCCGGGTTTAGCTGTTCT
+GTCACCCGCCCGTCGCTGTCGTAACGGTAACAGATTTCCGGTCGGCCCGTGTGACGGTGCGCCACCATCCGGCCCCGGTATTTATCATCGTAAGTAAAGC
+TGCGCACCTGTGTATTGCTGCGGTCATACACCGCCGCCAGTTCGCCGCGGGCGTCCAGCCATAGCGCACCAGCGGCGCGGCAGGTAAATTCTCCGGGTAT
+TCCGGGTCGTGCGTCAGCCACACGGCAGACAGACGGATGCCGTTGTCCCGGCCATATTCGGTGTAACCCGGCAGGGTATCAGGAAAAGCGGACGGTTCCG
+TCCCGCCGGAAATGGCCTGCTGCCGGGCTTCTTCTGCCCGCTGCGCCTGCGTGGTCAGTACCAGCCGGAAGTGACGCCCGGCACCATCCGTCACGCCGGT
+GATTTCGCCGCTGAATTCACCGGCGGCTTCGCGGTGGAACGTCTGTGTGCGCCCGAAGCGGTCCACCAGCCCGGTCAGTACCCGGTACGGCGGCAGCGGC
+GCAGGCAGCACCTCATCCGCTTCCGGCACCCGCTCACACCAGCCGAGCAGCCACCACGGCCCCTGCGGACTGTTTGTCGCCAGATAACGATGCGGACTTA
+AGCGGAGTTCTTCCGGCAGCGCCTGCCAGAGTGCGGCCAGCCGGTGACCTTCATCCAGTTTCGCCACGCCGCCGCGCACCAGCCACAGTGACTCGCTGCG
+GCTGTAACCGTCCTCACCGGGAAACAGGTGCTCAAAATACAGGCTTCTGCCGCCGTTATCACTGAGTATCAGTGTGTTATCGCGCAGCTGTAAGCGGATA
+TCCGCAGGCATTTTCCAGCCGGGGCCGAGGCTCCCCACCGGCGCGGGCGTTTTGTCCGGTAACTGCTGTAGGTGCGGGAGAGAATGAACGGCAGCGGGCC
+GGGCAGGGCGATGTCGGTTTCACCGGGAAGGACCTTTGCACCGAGCAGCGGATTGACCGGATGGCCGGACGTCACCCGCCGGGGCACACCGAACAGGCCA
+CGCCGGTGGGGCACCGATGCGTACCCCGGCTGAACCCTGGACAATGCTACCGCCATACTGCGTCATGTCGCCCTGACGCGCCGCCGGTTTTCCGCTCATC
+TGCTCATCCTTGTTTTATCGGGTTATTTGTCTGCTGACAGGCGAAACCCTACAGATTTATAAGAAAGCCTTAAGTGAGATATCTGTCAGATAAGAACAAT
+TAGGAAAATATTTATATATATTTCATGAATATATGTTTCGATTGGTATAACGATGTCTAAATATTCCTCTGAACATCTTCCTGATACAAAAACCGCCAGC
+GTTTCCGCTGGCGGTTTTCAATGTATTCAAAACTCAGCAATCAATAAAATCACCAGTTGCCTTTTCGGCCTGATCCATCCACACCGGTTTATCGCTGGTT
+TTCGACCAGACGCGATGCAGGTAGCTGTAAAAGCGGGCGCGGTCTTTCCAGAAAAGCATGAAAGGCAGCGCCAGAACGCCCGCTGCAACCGCATAAGTAC
+GGCGTAAAAAGATAAGCCATGCAGGATATTCTCTGTAGAGTTCCATACTTTTCTCCCCTTTTGTATCTACCCGGTGAATGGCACCGGAAAAATGAATTTG
+TTTATCTGATGAAAATAGTACCGCCTTTGTGTAATTTTACTACTCATCCGACCACTTATTTTTGCTTATTGATGGTTTATTTACATTCATCCTGTAATTA
+AGTTACACAAAAGTTAAATTAATACTAAACATTAGTTAAATCATGGCTTTTGCCATTTTTATACTTTTACACCCCGCCCGCAGATTTTTGCGAAATCTTT
+GCAGCCAGAATTCTACCCTTCCGGTATCACTTTTAGGCCACTGGAGGTGCACTGTGAGTGCAGGCGTGATAACCGGCGTATTGCTGGTGTTTTATTACTG
+GGTTATCTGGTTTATGCCCTGATCAATGCGGAGGCGTTCTGATGGCTGCGCAAGGGTTCTTACTGATCGCCACGTTTTTACTGGTGTTAATGGTGCTGGC
+GCGTCCTTTAGGCAGCGGGCTGGCGCGGCTGATTAATGACATTCCTCTTCCCGGTACAACGGGCGTTGAGCGCGTACTTTTCGCGCACTTGGCGTCTCTG
+ACCGTGAGATGAACTGGAAGCAATATCTTTGTGCCATTCTCGGCCTGAACATGCTGGGGCTGGCGGTGCTGTTTTTATGTTGCTCGGTCAGCACTATCTG
+CCGCTTAATCCACAGCAGTTGCCAGGGCTGTCGTGGGATCTGGCGCTGAATACCGCCGTCAGCTTTGTCACCAATACCAACTGGCAATCTTATAGCGGTG
+AAACCACGTTGAGCTATTTCAGCCAGATGGCGGGCTTAACGGTGCAAAACTTTCTTTCTGCCGCCAGCGGGATTGCGGTGATTTTGCCCTCATCCGTGCG
+TTTACCCGCCAGAGCATGAGCACGCTCGGGAATGCCTGGGTCGATCTGCTACGCATCACGTTATGGGTGCTAGTCCCTGTGGCGTTGTTGATTGCACTGT
+TTTTATTCAACAAGGTGCGCTGCAAAACTTTCTGCCTTATCAGGCTGTGAATACCGTTGAAGGAGCGCAACAGCTGTTACCCATGGGGCCTGTAGCTTCT
+CAGGAAGCGATCAAGATGCTCGGTACTAACGGCGGTGGCTTCTTTAATGCCAACTCGTCGCATCCGTTTGAAAACCCAACCGCACTGACCAACTTCGTGC
+AGATGCTGGCGATCTTCTTGATCCCAACGGCGCTGTGCTTTGCCTTTGGTGAAGTGATGGGCGATCGCCGCCAGGGGCGCATGTTGCTGTGGGCGATGTC
+AGTGATTTTGTCATCTGCGTAGGCGTGGTGATGTGGGCAGAAGTTCAGGGTAATCCTCATCTGCTGGCACTGGGCACGGACAGCAGCATCAATATGGAAG
+GTAAAGAGAGCCGTTTCGGCGTGCTGGTCAGTAGCCTGTTTGCGGTCGTGACGACGGCGGCTTCCTGTGGCGCGGTGATTGCGATGCATGATTCGTTTAC
+CGCTCTCGGTGGCATGGTGCCGATGTGGCTGATGCAAATTGGTGAAGTGGTGTTCGGCGGTGTCGGTTCTGGTCTTTACGGCATGATGCTGTTTGTCCTG
+CTGGCGGTGTTTATTGCCGGGCTGATGATTGGTCGTACACCGGAATATCTGGGTAAAAATCGACGTACGCGAGATGAAACTGACTGCACTGGCAATTCTG
+GTTACCCCGACGCTGGTGCTGATGGGCGCGGCGTTGGCGATGATGACCGACGCCGGACGTAGCGCCATGCTCAACCCTGGCCCGCATGGTTTTAGCGAAG
+TGCTGTACGCCGTGTCATCCGCCGCTAACAACAACGGCAGCGCCTTTGCCGGATTAAGCGCCAACTCTCCGTTCTGGAACTGTTTACTGGCGTTCTGCAT
+GTTTGTCGGTCGCTTCGGGGTGATTATCCCGGTGATGGCAATTGCCGGTTCGCTGGTGAGTAAAAGAGCCAAGCCGCCAGCTCCGGCACGCTGCCAACGC
+ACGGCCCGCTGTTTGTTGGCCTGTTAATCGGCACCGTGTTGCTGGTTGGCGCACTGACCTTTATCCCTGCCCTGGCGCTTGGTCCGGTGGCGGAATATCT
+CTCCTGATGATATTGAGTGAGCACTGAATATGAGTCGTAAACAACTGGCGCTATTCGAACCAACACTTGTCGTTCAGGCGCTGAAAGAAGCGGTGAAAAA
+ATTAAACCCGCAGGCGCAATGGCGCAATCCGGTGATGTTTATCGTCTGGATCGGCAGTCTGCTGACCACCTGTATTAGCATCGCGATGGCAAGCGGTGCG
+ATGCCCGGCAATGCGCTGTTTAGCGCGGCCATTAGCGGTTGGCTGTGGATCACCGTACTGTTCGCTAATTTCGCCGAGGCGCTGGCAGAAGGCCGCAGTA
+AAGCGCAGGCCAACAGTCTGAAAGGGTGAAAAACTGCCTTTGCCCGCAAGCTGCGTGAGCCGAAATATGGCGCTGCGGCGGACAAAGTTCCTGCCGACCA
+ACTTCGTAAAGGCGATATCGTACTGGTAGAAGCTGGCGATATTATCCCCTGCGATGGTGAAGTTATTGAAGGGGTGCATCGGTCGATGAAAGCGCCATCA
+CCGGGGAATCGGCACCGGTGATCCGTGAATCCGGCGGCGATTTTGCCTCCGTCACCGGCGGCACGCGTATTCTTTCTGACTGGCTGGTGATTGAGTGTAG
+CGTTAACCCCGGCGAGACATTTCTGGATCGGATGATCGCGATGGTGGAAGGCGCACAGCGACGCAAAACGCCGAACGAAATTGCCCTGACCATTCTGCTG
+ATTGCCCTGACTATCGTCTTTTACTGGCAACCGCCACGCTGTGGCCGTTTTCCGCGTGGGGCGGTAATGCAGTCAGCGTAACGGTACTGGTGGCGCTGCT
+GGTCTGTCTGATCCCAACCACTATTGGCGGCCTGTTGTCAGCGATCGGCGTCGCCGGGATGAGCCGGATGCTAGGCGCGAATGTGATTGCCACCAGCGGA
+CGTGCAGTTGAAGCGGCAGGTGACGTTGACGTTCTGCTACTGGATAAAACCGGCACCATCACACTCGGTAACCGTCAGGCGTCGGAGTTTATCCCCGCGC
+AGGGCGTGGATGAAAAACGCTGGCTGACGCCGCACAACTGGCTTCGCTGGCTGATGAAACGCCGGAAGGCCGCAGTATTGTGATCCTCGCCAAGCAGCGT
+TTTAACCTGCGCGAGCGCGATGTGCAGTCGCTCCATGCCACCTTTGTACCGTTTACTGCGCAAAGCCGGATGAGCGGGATCAACATCGACAACCGCATGA
+TCCGTAAAGGTTCTGTCGATGCCATTCGTCGCCATGTTGAGGCTAACGGTGGTCACTTCCCTACCGATGTTGATCAAAAGTCGATCAGGTTGCGCGTCAG
+GGAGCCACGCCGCTGGTGGTGGTGGAAGGTTCTCGTGTGCTGGGCGTTATTGCGCTGAAAGATATCGTCAAAGGCGGTATTAAAGAGCGCTTCGCCCAGC
+TGCGCAAAATGGGCATTAAAACGGTGATGATTACCGGCGATAACCGTCTGACTGCCGCCGCGATTGCTGCGGAAGCGGGTGTCGATGATTTTCTCGCCGA
+AGCGACACCGGAGGCCAAGCTGGCATTGATCCGTCAGTATCAGGCGGAAGGTCGTTTGGTAGCGATGACCGGCGACGGCACCAACGATGCTCCGGCGCTG
+GCGCAGGCAGATGTCGCGGTGGCGATGAACTCCGGCACCCAGGCGGCGAAAGAGGCGGGCAATATGGTCGATCTCGACTCTAACCCGACCAAGTTGATCG
+AGGTGGTGCACATTGGCAAACAGATGCTGATGACCCGTGGCTCGCTGACCACCTTCAGCATTGCCAACGATGTGGCGAAATACTTCGCCATTATTCCGGC
+GGCATTCGCGGCAACGTATCCGCAGTTAAATGCGCTGAACATCATGTGCCTGCATTCGCCCGACTCCGCAATCCTCAGTGCGGTGATTTTCAACGCCTTG
+ATTATCGTCTTTGATTCCCCTGGCGTTAAAGGCGTGAGTTATAAACCGCTTACCGCTTCTGCCATGTTGCGCCGTAACTTATGGATTTACGGTCTGGGTG
+GGCTGCTGGTGCCGTTTATCGGTATCAAAGTCATTGATTTACTGCTGACCGTTTGCGGTCTGGTGAGGTTTACCATGAGTGGATTACGTCCGGCATTATC
+AACATTTATCTTTCTGTTATTGATTACTGGCGGCGTTTACCCGCTGCTGACCACCGTACTGGGGCAATGGTGGTTTCCTGGCAGGCCAATGGTTCGTTGA
+TTCGTGAAGGTGATACGGTGCGCGGTTCGGCATTAATCGGGCAGAATTTTACCGGCAACGGCTATTTTCATGGTCGCCCGTCGGCAACGGCAGAAATGCC
+CTATAATCCACAGGCTTCTGGCGGGAGCAATCTGGCGGTCAGTAACCCTGAGCTGGATAAACTAATAGCCGCACGCGTTGCTGCATTACGGGCCGCTAAC
+CCGGATGCCAGCGCGAGCGTTCCGGTTGAACTGGTGACGGCATCGGCAAGCGGGCTGGACAATAATATCACCCGCAAGCGGCGGCCTGGCAAATCCCACG
+CGTGGCGAAAGCGCGTAATCTCAGCGTTGAACAGCTCACGCAACTGATCGCAAAATACAGCCAACAACCGCTGGTGAAATATATCGGCCAGCCGGTTGTC
+AACATTGTTGAACTCAATCTGGCGCTGGATAAACTTGATGAATAACGAACCCTTACGTCCCGACCCCGATCGTCTGCTGGAACAAACTGCCGCGCCGCAT
+CGGGGAAGCTGAAAGTTTTCGGTGCCTGTGCAGGCGTCGGGAAGACCTGGGCGATGCTGGCAGAAGCCCAGCGACTGCGGGCGCAAGGGCTGGATATTGT
+GGTTGGCGTGGTAGAAACCCACGGGCGAAAGATACCGCCGCCATGCTGGAAGGGCTGGCTGTTCTGCCGTTAAAACGCCAGGCGTACCGTGGGCGGCATA
+TCAGCGAGTTTGATCTCGATGCCGCCCTCGCCCGCCGCCCGGCGCTGATCTTAATGGACGAACTGGCGCACAGTAATGCGCCAGGTTCCCGTCATCCCAA
+ACGCTGGCAGGATATCGAAGAACTGCTGGAAGCTGGCATTGATGTTTTCACTACCGTCAACGTTCAGCATCTGGAAAGTCTGAATGATGTGGTCAGCGGC
+GTCACCGGAATTCAGGTACGGGAAACCGTGCCCGATCCTTTTCGATGCCGCCGACGACGTGGTGCTGGTGGACTTGCCCCGGACGATCTGCGCCAGCGGC
+TGAAAGAAGGCAAAGTCTATATTGCCGGGCAGGCGGAGCGCGCCATTGAACATTTTTCCGCAAAGGTAATCTGATCGCCCTGCGCGAACTGGCACTGCGC
+CGTACTGCCGATCGCGTTGATGAGCAAATGCGCGCCTGGCGGGGCATCCTGGCGAAGAGAAAGTGGCACACGCGCGACGCGATCCTTTTATGCATCGGCC
+ATAACACCGGCAGCGAAAACTGGTCCGCGCAGCGGCGCGGCTGGCGTCACGGCTGGGTAGCGTCTGGCACGCGGTGTATGTTGAAACCCCTGCCCTGCAC
+CGCTTACCGGAAAAACGTCGGGCAATTCTCAGCGCCTTACGTCTGGCGCAGGAACTGGGCGCGAGACGGCAACACTTTCTGATCCAGCGGAAGAGAAAGC
+GGTAGTGCGTTATGCCCGTGAACATAATCTCGGCAAGATTATTCTCGGTCGCCCGGCCTCGCGCCGCTGGTGGCGTCGGGAAACGTTTGCTGACCGACTG
+GCGCGCATCGCCCCGATCTCGATCAGGTGCTGGTCGCGCTTGATGAACCACCCGCCCGCACGATTAACAACGCGCCGGATAACCGCTCTTTTAAAGACAA
+GTGGCGTGTACAAATTCAGGGATGCGTGGTTGCCGCCGCGTTATGCGCCGTTATCACCTTAATTGCCATGCAGTGGCTGATGGCGTTTGATGCCGCCAAC
+CTGGTGATGCTGTATCTGCTTGGCGTGGTGGTGGTGGCGCTATTTTATGGACGCTGGCCTTCAGTGGTTGCCACCGTCATTAATGTAGTGAGTTTCGATC
+TCTTTTTATCGCCCCACGCGGCACGCTCGCCGTCTCTGATGTGCAATATCTGCTGACCTTCGCGGTGATGTTAACCGTCGGGCTGGTGATCGGGAACCTT
+ACTGCTGGCGTGCGTTATCAGGCGCGGGTAGCCCGTTACCGCGAGCAACGCACACACGGCACTTATATGAAATGTCGAAAGCTCTGGCGGTGGGCCGCAG
+TCCGCAGGATATCGCTGCCACCAGCGAACAATTTATTGCCTCCACGTTTCATGCCCGCAGTCAGGTGTTGTTGCCCGATGACAACGGTAAATTGCAGCCG
+TTAACACATCCGCAAGGAATGACGCCGTGGGACGATGCCATCGCGCAGTGGAGTTTTGATAAAGGCCTGCCTGCGGGCGCGGCACCGACACGTTACCCGG
+TGTACCGTACCAGATTTTGCCGCTAAAAAGCGGCGAGAAACCTACGGGCTGGTGGTGGTGGAGCTGGGAATCTGCGCCAGTTGATGATCCCGGAACAGCA
+GCGCCTGCTGGAGACGTTACGCTGTTAGTCGCCAATGCCCTGAGCGGCTGACGCTAACCGCCAGCGAAGAACAGGCGCGGATGGCAAGCGAACGTGAACA
+GATCCGCAACGCCTGCTGCTGGCGGCGCTTTCGCATGATTTACGCACGCCGCTTACGGTGCTGTTTGGTCAGGCAGAAATCTTAACGCTCGATCTGCAAG
+CGAAGATCACCACGCCCGCCAGGCCAGCGAGATCCGTCAGCATGTGCTGAACACTACCCGACTGGTGAATAATCTACTGGATATGGCGCGAATTCAGTCC
+GGCGGCTTTAATTTGAAGAAAGAGTGGTTAACGCTGGAAGAAGTAGTCGGCAGCGCGCTGCAAATGCTGGAACCGGGTTTATCGTCGCCCATCAATCTTT
+CTCTGCCAGAACCGCTGACCTTAATCCACGTTGACGGGCCACTTTTGAACGGGTGCTGATTAATCTGCTGGAGAACGCGGTGAAATATGCGGGTGCGCAG
+GCCGAAATTGGTATCGATGCCCACGTTGAGGGCGAAAATCTACAACTGGATGTCTGGGATAACGGCCCCGGTCTTCCGCCAGGCCAGGAGCAGACGATAT
+TTGATAAGTTTGTTCGCGGAATAAAAGAGCAGTACCGGGGGTAGGGCTTGGACTGGCAATTTGTCGGGCGATAGTGGATGGTACGGGGGCACTATTACCG
+CGTTCAACCGACCGGAAGGTGGTGCCTGTTTTCGTGTTACACTTCCCCAGCAAACTGCCCCTGAACTTGAAGAATTTCATGAGGATATGTGACAAACGTT
+CTGATTGTTGAAGATGAACAGGCTATTCGTCGCTTTCTGCGCACGGCGCTGGAGGGGCGATGCGCGTCTTTGAGGCCGAAACGCTGCAACGCGGCTTGCT
+GGAAGCGGCAACCCGTAAGCCAGATTTGATTATTCTCGATCTCGGCCTGCCCGATGGTGATGGGATTGAGTTTATCCGCGACCTGCGCCAGTGGAGCGCG
+GTGCCGG
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/ecoli_canu_corrected_reads.fa	Sat Jun 09 13:46:56 2018 -0400
@@ -0,0 +1,200 @@
+>fa9ad683-35c5-4dad-a3af-de7a86b1ffa8 id=1 clr=0,3653
+TTGGTATGCTTCGTTCCAGTTACGTATTACTTTCTGTTGGTGCTGATGTTGCGTCTGCTGATTGTTTAACCTGGCTGGATCGCTGCTGAATGTACTTCGCCGCATGACGCTGAAATCGCTGCCTCTGCGCCTGGCGGTTAGCCGCCTGTTACGTCAGCCGTGGTCAACGTTAAGTCAGCTTTCGGCATTTTCGCTCTCCTATGCTGCTGGCACTGCTGCTGGTGTTGCGTGGCGATCTGCTCGACCGCTGGCAGCAGCATACTCCAGAGCCCGAACTACTTTTTAATTAACATCGCCACAGAACAGGTAGCACCGCTAAAGCGTTCCTCGCGGAACATCAGATAGTCCCGGAATCGTTTTATCCGGTGGTGCGGGCGCGGCTGACGGCGATTAACGATAAGCCGACAGAAGGTAATGAAGATGAGGCGCTTAACCGCGAACTCAATCTTACCTGGCAAAATACGCGGCCCGATCATAATCCGATTGTCGCCGGTAACTGGCCGCCAAAAGCCGATGAAGTGTCGATGGAAGAGGGCTGGCGAAACGCTTAAACGTTGCCCTCGGTGATACCGTGACTTTTATGGGCGATACCCAGGAGTTCCGCGCTAAAGTGACCAGCCTGCGCAAAGTGGACTGGGAAAGTCTGCGGCCTAATTTCTATTTTATTTTCCCTGAAGGGCATTAGACGGGCAACCGCAGAGCTGGCTTACCAGTTTCCGCTGGGAGAATGGCAACGGCATGTTGACACAACTCAACCGCCAGTTCCCGACCATTAGCCTGTTAGATATTGGCGCGATTTTAAAACAGGTCGGTCAGGTGCTGGAGCAGGTAAGTCGGGCGCTGGAAGTGATGGTGGTACTGGTCACCGCCTGCGGTATGTTGCTGTTGCTGGCACAGGTGCAGGTGGGAATGCGTCAGCGTCATCAGGAGCTGGTGGTGTGGCGCACACTCGGTGCGGGAAAAACTGCTGCGTACCACGTTGTGGTGTGAGTTCGCCATGCTTGGGTTTGTTTCCGGCCTGGTGGCCGCAATTGGTGCGGAAACGGCGCTGGCAGTGTTGCAGGCGAAAGTGTTTGATTTTCCGTGGGAGCCAGACTGGCGATTGTGGATTGTTCTGCCGTGCAGCGGAGCGCTGCTGCTGTCGCTTTCGGCGGCTGGCTGGGTGCGGTTGGGTAAGGCGCTGTTCAGGCAGTTTGCGGGGATGAGAGTAAATAAGGGGCGTTCTGGTTGAATGGAACGCCTTGTTTAAATTAATTCTACAATATGTTTCATTGATGATGTTATTGAATTGGTGATTTCTATCTTTCTATTGCTGATATTAATCTGAATCGGTGGAGTTTATTGATTTTAAATATAGCCCTACAAAATAACTCAGACTAATAAAATCATAAATCATATGCGTTGAATGGATATTATCCATATAGTGAATTTGTTGATGATGAATTCATCTGTGCTAAAAATGTTAGTTTAATAAAATATTGAAAGTGACCTGTAATAACAGTTGTTGTTGATTGAGAACAAATAAGTTTATGTGAAAAATATATAAATACATTAGCTGGTCTTGTGTGTCATTTTATTTTTTGTTGCTAACACAGGGATATGAACAATAACTAAAGGGCACTTTATAGAGCGGAAAACCAGCGGCGCGTCGGGAGATATGACTCAGTATGGCGGTCCCATTGTCCAGGGTTCGGCAGGTGTAAAATTGGCGCGCCCACCGGCGTGGCGTGCTCGGTGTGTCCGGGCGGGATGACTTCGGGCAACCCGGTAAATCCGCTGCTGGGGGCGAAGGTGCTGCCCGGCGAGACGGACCTTGCGCTGCCCGGCCCGCTGCCGTTCATTCTCTCCCGCACCTACAGCAGCTACCGGACGAAGACGCCTGCACCGGTGGGCGTTTTCGGCCCCGGCTGAAAGCGCCTTCTGATATCCGCTTACAGCTACGTGATGACGGACTGATACTCAACGACAACGGCGGGCGGAGCATTCACTTTGAGCCGCTGCTGCCGGGGAGGCGGTGTACAGCCGCAGTGAGTCAATGTGGCTGGTGCGCGGTGGTAAGGCAGCACAGCCGGACGGCCATACGCTGGCGCGGCTGTGGGGGCGCTGCCGCCGGATATCCGGTTAAGCCCGCATCTTTACCTGGCGACCAACAGCGCACAGGGGCCGTGGTGATACTGGGGTGGTCTGAGCGGGTGCCGGGTGCTGAGGACGTACTGCCAGCGCCGCTGCCGTACCGGGTGCTTACCGGGATGGCGGACCGCTTCGGGCGGACGCTGACGTACCGGCGTGAGGCCGCCGGTGACCTGGCCGGAAATCACCGGCGTGACGGACGGTGCCGGGCGGGAGTTCCGTCTGGTGCTGACCACGCAGGCGCAGCGTGCGGAAGAGGCCCACCTCTTCGCTATCTTCTTCTGACAGTTCCCGCCCTCTCTCAGCCTCAGCGTTCCCCGACACACTGCCCGGTACCGAATACGGCCCCGAGGTGGGCGGTGATGCACGACCCGGCATACCCGGAGAGCCTGCCCGCTGCGCCACTGGTGCGGTACACGTATACGGAAGCCGGTGAACTGCTGGCGGTATATGACCGCAGCAATACGCAGGTGCGCGCTTTCACGTATGACGCGCAGCACCCGGGCCGGATGGTGGCGCACCGTTACGCGGGAAGGCCGGAGATGCGCTACCGCTACGACGATACGGGGCGGGTGGTGGAGCAACTGAACCCGGCAGGGTTAAGCTACCGCTATCTTTATGAGCAGGACCGCATCACCGTCACCGACAGCCTGAACCGGCGTGAGGTGCTGCATACAGAAGGCGGGGCCGGGCTGAAACGGGTGGTGAAAAAGAACTGGCGGACGGCAGCGTCACGCGCAGCGGGTATGACGCGGCAGGAAGGCTCACGGCGCAGACGGACGCGGCGGGAGGAGGACAGAGTACGGTCTGAATGTGGTGTCCGGCGATATCACGGACATCACCACACCGGACGGGCGGGAGACGAAATTTTACTATAACGACGGGACCAGCTGACGGCGGTGGTGTCCCGGACGGGCTGGAGAGCCGCCGGAATATGATGAACCGGGCAGGCTGGTATCGGAGACATCGCGCAGCGGGGAGACAGTACGCTACCGCTACGATGACGCGCACAGTGAGTTACCGGCGACGACAACGGATGCGACGGGCGCACCAACAGATGACCTGGAGCCGCTACGGGCGTTGCTGGCGTTCACCGACTGCTCGGGCTACCAGACCCGTTATGAATACGACCGCTTCGGCCAGATGACGGCGGTCCACCGCGAAGGCATCAGCCTTTACCGCCGCTATGACAACCGTGGCCGGTTAACCTCGGTGAAAGACGCACAGGGCCGTGAAACGCGGTATGAATACAACGCCGCAGAGCGACCTACTGCCGTTATCACCCCGGACGGCAACCGGAGCGAGACACAGTACGATGCGTGGGGAAAGGCGGTCAGCACCACGCAGGGCGGGCTGACGCGCAGTATCATTACGATGCTGCCGGATGTCATCAGCCCTGACCAACGAGAACAGGCAGCCACAGCGTCTTCAGTTACGATGCGCTGGACCGGCTGGTGGGACAAACACCAAGCAGACGCCGAAGATGAGAACGATGAGCAGTATACCCGTAATGACGCTTCCTT
+>a403a23e-20e7-43f7-a5fa-dae8ebc59a01 id=2 clr=0,2370
+TTGACTGTGCTTCGTTCGGTTACGTATTGCTTTTTCTGTTGGTGCTGATATTGCGGCGTCTGTAGGTGTTTAACCTGCCAGCATCACACGAGATTGGTCAAGTGCGGTTGGGTTTTTCAAACGGATGCGACAGCAGTTGGCATTAAAGAAGCCACCGCCGTTAGGCGCCGAGCATCTTGATGCTTCCACGAAGCTACGATACCGCCGGGTAACAGCTGTTGCGCTCCTTCAACGGTATTCCTACGGCCTGTTGAGCAGAAAGTTTTGCAGCGCAGCGAATAAAAACAGTGCAATCAACAACGCCACGGGACTAGCACCCATAACGTGGTGCGTAGCAGATCGACCCAGGCATTCCCGAGCGTGCTCATGCTCTGGCGGGTAAACGCACGGATGGGGCAAAATCACCCTGTCCCGCTGGCGGCAGAAGAAAGTTTTGCACCGTTAGCCCGCCATCTGGCTGAAATAGCTCAACGTGGTTTCACCGCTATAAGATTGCCAGTTGGTATTGGTGACAAACGACGGCGGTATTCAGCTCCATTTCAGCCACAGCTGCTGTGGATTAGCGGCAGATAGTGCTGACCGAGCAACATAAAAACAGCACCGCCAGCCCCAGCATGTTTCGGGCCGAGAATGGCACAAAGATATTGCTTCCAGTTCATCTCACGGTCAGAGACGCCAGGTGCGAAAAAGTACGCGCTCAACGCCCGTTGTACCGGGAAGAGGAATCATTAATCTGGCCGCGCCAGCCCGCTGCCTAAAGGACGCGCCAGCACCATTAACACCAGTAAAAACGTGGCGATCAGTAAGAACCCTTGCGCAGCCATCAGACACGCTCCGCATTGATCGGGGCATAAACCAGAATGCGGTAATAAAACACCAGCAATGCGCCGGGTATCGCCTGCACTCACAGTGCACCTCCAGTGGCCTAAAAGTGATACCGGAAGGGTGAATTCTGTGGCTGCAAAGATTTCGCAAAATCTGCGGGCGGGGTGTAAAAAGTATAAAAATGGCAAAAGCCTTGATTTAACTAATGTTTAGTATTAATTTAACTTTTGTGTAACTTAATTACAGGATGAATGTAAATAAACATCAATAAGCAAAAATAGAGTGGTCGGATGAGTAGTAAAAATTACACAAAAAGGCGGTACTATTTTCATCAGATAAACAAATTCATTTTTCCGGTGCCATTCACCGAATTGGGCAAAGGAAAGTATGGAACTCTACAGAGAATATCCTGCATGGCTTATCTTTTACGCCGTATGCCTGCGGTTGCAGCGGGCGTTCTGGCGCTGCCTTTCATGCTTTCTGGAAAGACGCGCCCGCTTTTTGCAATACCATCGCGTCTGATTCGAAAACCAGCGATAAACCAGGTGTGGATGGATCGGGCGAAAAGGCAACTGGTGATTTTATTGATTGCTGAGTTTGAATATACATTGAAAACCGCCAGCGGAAACGCTGGCGGTTTTGTATCAGGAAGATGTTCAGAGGAATATTTGAACATCGTTATACCAATCGAAACGTATATTCTGCCAAATATATATAAATATTTTCTAATTGTTCTTATCTGACAGATATCTCTTAAGGCTTTCTTATAAATCTGTAGGGTTTCGCCTGTCAGCGAACAAATAACCCGATAAAACAAGGATGAGCAGATGAGCGGAAAACCGGCGGCGCGTCAGGGTGACATGACGCAGTATGGCGTAGCATTGTCCAGGAGTTCAGCCGGGGTACGCATCGGTGCCCCACCGGCGTGGCCTGTTCGGTGTGCCCCGGCGAGTGACGTCCGGCCATCCGGTCAATCCGCTGCTCGGTGCAAAGGTCCTTCCCGGTGAAACCGACATCGCCCTGCCCGGCCCGCTGCCGTTCATTCTCTCCCGCACCTACAGCAGTTACCGGACAAAAACGCCCGCGCCGGTAGAGGCCTCGGCCCCGGCTGAAAATGCCTGCGGATATCCGCTTACAGCTGCGCGATAACACACTGATACTCAGTGATAACGGCGGCAGAAGCCTGTATTTTGAGCACCTGTTTCCCGGTGAGGACGGTTACAGCCGCAGCGAGTCACTGTGGCTGGTGCGCGACGGCGTGAAAGCGAAACTGGATGAAGCAAGGTCTGGCTGGCCGCCTCTGGCAGGCGCTGCCGGAGAAGAACTCGCTTAAGTCCGCATCGTTATCTGGCGACAAACAGTCCACAGGGGCCGTGGTGGCTGCTCGGCTGGTGTGAGCGGGTGCCGGAAGCGGATGAGTGCTGCCTGCGCCTTTGCCGCGCCGTACCGGGTACTGACCGGGCTGGTGGACCGCTTCGGGCGCACACAGACGTTCGCCGGTGAATTCAGCGGCGAAATCACCGGCGTGACGGATGGTGCGGGCAA
+>ae3ab29f-07ae-4476-85eb-b212d69ce732 id=3 clr=0,4859
+TCACCCTGCGTGTGCAGGACTTCACGGCGGTTCAGGCTGTCGGTGATGGTGATGCGGTCCTTCTCATACTGATACGTGTAACTTAAGCCTGCCGGGTTTAGCTGTTCTGTCACCCGCCCGTCGCTGTCGTAACGGTAACAGATTTCCGGTCGGCCCGTGTGACGGTGCGCCACCATCCGGCCCCGGTATTTATCATCGTAAGTAAAGCTGCGCACCTGTATTGCTGCGGTCATACACCGCCGCCAGTTCGCCGCGGGCGTCCAGCCATAGCGCACCAGCGGCGCGGCAGGTAAATTCTCCGGGTATTCCGGGTCGTGCGTCAGCCACACGGCAGACAGACGGATGCCGTTGTCCCGGCCATATTCGGTGTAACCCGGCAGGGTATCAGGAAAGCGGACGGTTCCGTCCCGCCGGAAATGGCCTGCTGCCGGGCTTCTTCTGCCCGCTGCGCCTGCGTGGTCAGTACCAGCCGGAAGTGACGCCCGGCACCATCCGTCACGCCGGTGATTTCGCCGCTGAATTCACCGGCGGCTTCGCGGTGGAACGTCTGTGTGCGCCCGAAGCGGTCCACCAGCCCGGTCAGTACCCGGTACGGCGGCAGCGGCGCAGGCAGCACCTCATCCGCTTCCGGCACCCGCTCACACCAGCCGAGCAGCCACCACGGCCCCTGCGGACTGTTTGTCGCCAGATAACGATGCGGACTTAAGCGAGTTCTTCCGGCAGCGCCTGCCAGAGTGCGGCCAGCCGGTGACCTTCATCCAGTTTCGCCACGCCGCCGCGCAGCCACAGTGACTCGCTGCGGCTGTAACCGTCCTCACCGGGAAACAGGTGCTCAAAATACAGGCTTCTGCCGCCGTTATCACTGAGTATCAGTGTGTTATCGCGCAGCTGTAAGCGGATATCCGCAGGCATTTTCCAGCCGGGGCCGAGGCTCCCCACCGGCGCGGGCGTTTTGTCCGGTAACTGCTGTAGGTGCGGGAGAGAATGAACGGCAGCGGGCCGGGCAGGGCGATGTCGGTTTCACCGGGAAGGACCTTTGCACCGAGCAGCGGATTGACCGGATGGCCGGACGTCACCCGCCGGGGCACACCGAACAGGCCACGCCGGTGGGGCACCGATGCGTACCCCGGCTGAACCCTGGACAATGCTACCGCCATACTGCGTCATGTCGCCCTGACGCGCCGCCGGTTTTCCGCTCATCTGCTCATCCTTGTTTTATCGGGTTATTTGTCTGCTGACAGGCGAAACCCTACAGATTTATAAGAAAGCCTTAAGTGAGATATCTGTCAGATAAGAACAATTAGGAAAATATTTATATATATTTCATGAATATATGTTTCGATTGGTATAACGATGTCTAAATATTCCTCTGAACATCTTCCTGATAAAAACCGCCAGCGTTTCCGCTGGCGGTTTTCAATATTCAAACTCAGCAATCAATAAAATCACCAGTTGCCTTTTCGGCCTGATCCATCCACACCGGTTTATCGCTGGTTTTCGACCAGACGCGATGCAGGTAGCTGTAAAAGCGGGCGCGGTCTTTCCAGAAAAGCATGAAAGGCAGCGCCAGAACGCCCGCTGCAACCGCATAAGTACGGCGTAAAAGATAAGCCATGCAGGATATTCTCTGTAGAGTTCCATACTTTTCTCCCCTTTTGTATCTACCCGGTGAATGGCACCGGAAAATGAATTTGTTTATCTGATGAAAATAGTACCGCCTTTTGTGTAATTTTACTACTCATCCGACCACTTATTTTTGCTTATTGATGGTTTATTTACATTCATCCTGTAATTAAGTTACACAAAAGTTAAATTAATACTAAACATTAGTTAAATCATGGCTTTTGCCATTTTTATACTTTTACACCCCGCCCGCAGATTTTTGCGAAATCTTTGCAGCCAGAATTCTACCCTTCCGGTATCACTTTTAGGCCACTGGAGGTGCACTGTGAGTGCAGGCGTGATAACCGGCGTATTGCTGGTGTTTTATTACTGGGTTATCTGGTTTATGCCCTGATCAATGCGGAGGCGTTCTGATGGCTGCGCAAGGGTTCTTACTGATCGCCACGTTTTTACTGGTGTTAATGGTGCTGGCGCGTCCTTTAGGCAGCGGGCTGGCGCGGCTGATTAATGACATTCCTCTTCCCGGTACAACGGGCGTTGAGCGCGTACTTTTCGCGCACTTGGCGTCTCTGACCGTGAGATGAACTGGAAGCAATATCTTTGTGCCATTCTCGGCCTGAACATGCTGGGGCTGGCGGTGCTGTTTTATGTTGCTCGGTCAGCACTATCTGCCGCTTAATCCACAGCAGTTGCCAGGGCTGTCGTGGGATCTGGCGCTGAATACCGCCGTCAGCTTTGTCACCAATACCAACTGGCAATCTTATAGCGGTGAAACCACGTTGAGCTATTTCAGCCAGATGGCGGGCTTAACGGTGCAAAACTTTCTTTCTGCCGCCAGCGGGATTGCGGTGATTTTGCCCTCATCCGTGCGTTTACCCGCCAGAGCATGAGCACGCTCGGGAATGCCTGGGTCGATCTGCTACGCATCACGTTATGGGTGCTAGTCCCTGTGGCGTTGTTGATTGCACTGTTTTTATTCAACAAGGTGCGCTGCAAAACTTTCTGCCTTATCAGGCTGTGAATACCGTTGAAGGAGCGCAACAGCTGTTACCCATGGGGCCTGTAGCTTCTCAGGAAGCGATCAAGATGCTCGGTACTAACGGCGGTGGCTTCTTTAATGCCAACTCGTCGCATCCGTTTGAAAACCCAACCGCACTGACCAACTTCGTGCAGATGCTGGCGATCTTCTTGATCCCAACGGCGCTGTGCTTTGCCTTTGGTGAAGTGATGGGCGATCGCCGCCAGGGCGCATGTTGCTGTGGGCGATGTCAGTGATTTTGTCATCTGCGTAGGCGTGGTGATGTGGGCAGAAGTTCAGGGTAATCCTCATCTGCTGGCACTGGGCACGGACAGCAGCATCAATATGGAAGGTAAAGAGAGCCGTTTCGGCGTGCTGGTCAGTAGCCTGTTTGCGGTCGTGACGACGGCGGCTTCCTGTGGCGCGGTGATTGCGATGCATGATTCGTTTACCGCTCTCGGTGGCATGGTGCCGATGTGGCTGATGCAAATTGGTGAAGTGGTGTTCGGCGGTGTCGGTTCTGGTCTTTACGGCATGATGCTGTTTGTCCTGCTGGCGGTGTTTATTGCCGGGCTGATGATTGGTCGTACACCGGAATATCTGGGTAAAAATCGACGTACGCGAGATGAAACTGACTGCACTGGCAATTCTGGTTACCCCGACGCTGGTGCTGATGGGCGCGGCGTTGGCGATGATGACCGACGCCGGACGTAGCGCCATGCTCAACCCTGGCCCGCATGGTTTTAGCGAAGTGCTGTACGCCGTGTCATCCGCCGCTAACAACAACGGCAGCGCCTTTGCCGGATTAAGCGCCAACTCTCCGTTCTGGAACTGTTTACTGGCGTTCTGCATGTTTGTCGGTCGCTTCGGGGTGATTATCCCGGTGATGGCAATTGCCGGTTCGCTGGTGAGTAAAAGAGCCAAGCCGCCAGCTCCGGCACGCTGCCAACGCACGGCCCGCTGTTTGTTGGCCTGTTAATCGGCACCGTGTTGCTGGTTGGCGCACTGACCTTTATCCCTGCCCTGGCGCTTGGTCCGGTGGCGGAATATCTCTCCTGATGATATTGAGTGAGCACTGAATATGAGTCGTAAACAACTGGCGCTATTCGAACCAACACTTGTCGTTCAGGCGCTGAAAGAAGCGGTGAAAAAATTAAACCCGCAGGCGCAATGGCGCAATCCGGTGATGTTTATCGTCTGGATCGGCAGTCTGCTGACCACCTGTATTAGCATCGCGATGGCAAGCGGTGCGATGCCCGGCAATGCGCTGTTTAGCGCGGCCATTAGCGGTTGGCTGTGGATCACCGTACTGTTCGCTAATTTCGCCGAGGCGCTGGCAGAAGGCCGCAGTAAAGCGCAGGCCAACAGTCTGAAAGGTGAAAACTGCCTTTGCCCGCAAGCTGCGTGAGCCGAAATATGGCGCTGCGGCGGACAAAGTTCCTGCCGACCAACTTCGTAAAGGCGATATCGTACTGGTAGAAGCTGGCGATATTATCCCTGCGATGGTGAAGTTATTGAAGGGGTGCATCGGTCGATGAAAGCGCCATCACCGGGGAATCGGCACCGGTGATCCGTGAATCCGGCGGCGATTTTGCCTCCGTCACCGGCGGCACGCGTATTCTTTCTGACTGGCTGGTGATTGAGTGTAGCGTTAACCCCGGCGAGACATTTCTGGATCGGATGATCGCGATGGTGGAAGGCGCACAGCGACGCAAAACGCCGAACGAAATTGCCCTGACCATTCTGCTGATTGCCCTGACTATCGTCTTTTACTGGCAACCGCCACGCTGTGGCCGTTTTCCGCGTGGGGCGGTAATGCAGTCAGCGTAACGGTACTGGTGGCGCTGCTGGTCTGTCTGATCCCAACCACTATTGGCGGCCTGTTGTCAGCGATCGGCGTCGCCGGGATGAGCCGGATGCTAGGCGCGAATGTGATTGCCACCAGCGGACGTGCAGTTGAAGCGGCAGGTGACGTTGACGTTCTGCTACTGGATAAAACCGGCACCATCACACTCGGTAACCGTCAGGCGTCGGAGTTTATCCCCGCGCAGGGCGTGGATGAAAAACGCTGGCTGACGCCGCACAACTGGCTTCGCTGGCTGATGAAACGCCGGAAGGCCGCAGTATTGTGATCCTCGCCAAGCAGCGTTTTAACCTGCGCGAGCGCGATGTGCAGTCGCTCCATGGTTAAACACCCAAGCAGACGCGCAATATCCGG
+>88b1797f-3a41-442f-bab4-cdfedf7ec597 id=4 clr=0,8535
+CTTCGTTCAGTTACGTATTGCTACTTGCCTGTCGCTCTATCTTCGGCGTCTGCTTGGTGTTTAACCTCCGCCTCTTTCGCCGCCTGGGTGCCGGAGTTCATCGCCACCGCGACATCTGCCTGCGCCAGCGCCGGGCATCGTTGGTGCCGTCGCCGGTCATCGCTACCAAACGACCTTCCGCCTGATACTGACGGATCAATGCCAGCTTGGCCTCCGGTGTCGCTTCGGCGAGAAAATCATCGACACCCGCTTCCGCAGCAATCGCGGCGGCAGTCAGACGGTTATCGCCGGTAATCATCACCGTTTTAATGCCCATTTTGCGCAGCTGGGCGAAGCTCTTTAATACCGCCTTTGACGATATCTTTCAGCGCAATAACGCCCAGCACGAGAACCTTCCACCACCACCAGCGGCGTGGCTCCTGACGCGCAACCTGATCGACTTTTGATCAACATCGGTAGGGAAGTGACCACCGTTAGCCTCAACATGGCGACGAATGGCATCGACAGAACCTTTACGGATCATGCGGTTGTCGATGTTGATCCCGCTCATCCGGCTTTGCGCAGTAAACGGTACAAAGGTGGCATGGAGCGACTGCACATCGCGCTCGCGCAGGTTAAAACGCTGCTTGGCGAGGATCACAATACTGCGGCCTTCCGGCGTTTCATCAGCCAGCGAAGCCAGTTGTGCGGCGTCAGCCAGCGTTTTCATCCACGCCCTGCGCGGATAAACTCCGACGCCTGACGGTTACCGAGTGTGATGGTGCCGGTTTTATCCAGTAGCAGAACGTCAACGTCACCTGCCGCTTCAACTGCACGTCCGCTGGTGGCAATCACATTCGCGCCTAGCATCCGGCTCATCCCGGCGACGCCGATCGCTGACAACAGGCCGCCAATAGTGGTTGGGATCAGACAGACCAGCAGCGCCACCAGTACCGTTACGCTGACTGCATTACCGCCCACGCGGAAAACGGCCACAGCGTGGCGGTTGCCAGTAAAAGACGATAGTCAGGGCAATCAGCAGAATGGTCAGGGCAATTTCGTTCGGCGTTTTGCGTCGCTGTGCGCCTTCCACCATCGCGATCATCCGATCCAGAAATGTCTCGCCGGGGTTAACGCTACACTCAATCACCAGCCAGTCAGAAAGAATACGCGTGCCGCCGGTGACGGAGGCAAAATCGCCGCCGGATTCACGGATCACCGGTGCCGATTCCCCGGTGATGGCGCTTTCATCGACCGATGCACCTTCAATAACTTCACCATCGCAGGGATAATATCGCCAGCTTCTACCAGTACGATATCGCCTTTACGAAGTTGGTCGGCAGGAACTTTGTCCGCCGCAGCGCCATATTTCGGCTCACGCAGCTTGCGGGCAAAGGCAGTTTTTCACCCCTTTCAGACTGTTGGCCTGCGCTTTACTGCGGCCTTCTGCCAGCGCCTCGGCGAAATTAGCGAACAGTACGGTGATCCACAGCCAACCGCTAATGGCCGCGCTAAACAGCGCATTGCCGGGCATCGCACGCTTGCCATCGCGATGCTAATACAGGTGGTCAGCAGACTGCCGATCCAGACGATAAACATCACCGGATTGCGCCATTGCGCCTGCGGGTTTAATTTTTCACCGCTTCTTTCAGCGCCTGAACGACAAGTGTTGGTTCGAATAGCGCCAGTTGTTTACGACTCATATTCAGTGCTCACTCAATATCATCAGGAGATATTCCGCCACCGGACCAAGCGCCAGGGCAGGGATAAAGGTCAGTGCGCCAACCAGCAACACGGTGCCGATTAACAGGCCAACAAACAGCGGGCCGTGCGTTGGCAGCGTGCCGGAGCTGGCGGCTTGGCTCTTTTACTCACCAGCGAACCGGCAATTGCCATCACCGGGATAATCACCCCGAAGCGACCGACAAACATGCAGAACGCCAGTAAACAGTTCCAGAACGGAGAGTTGGCGCTTAATCCGGCAAAGGCGCTGCCGTTGTTGTTAGCGGCGGATGACACGGCGTACAGCACTTCGCTAAAACCATGCGGGCCAGGGTTGAGCATGGCGCTACGTCCGGCGTCGGTCATCATCGCCAACGCCGCGCCCATCAGCACCAGCGTCGGGGTAACCAGAATTGCCAGTGCAGTCAGTTTCATCTCGCGTACGTCGATTTTTTACCCAGATATTCCGGTGTACGACCAATCATCAGCCCGGCAATAAACACCGCCAGCAGGACAAACAGCATCATGCCGTAAAGACCAGAACCGACACCGCCGAACACCACTTCACCAATTTGCATCAGCCACATCGGCACCATGCCACCGAGAGCGGTAAACGAATCATGCATCGCAATCACCGCGCCACAGGAAGCCGCCGTCGTCACGACCGCAAACAGGCTACTGACCAGCACGCCGAAACGGCTCTCTTTACCTTCCATATTGATGCTGCTGTCCGTGCCCAGTGCCAGCAGATGAGGATTACCCTGAACTTCTGCCCACATCACCACGCCTACGCAGATGACAAAATCACTGACATCGCCCACAGCAACATGCGCCCCTGGCGGCGATCGCCCATCACTTCACCAAAGGCAAAGCACAGCGCCGTTGGGATCAAGAAGATCGCCAGCATCTGCACGAAGTTGGTCAGTGCGGTTGGGTTTTCAAACGGATGCGACGAGTTGGCATTAAAGAAGCCACCGCCGTTAGTACCGAGCATCTTGATCGCTTCCTGAGAAGCTACAGGCCCCATGGGTAACAGCTGTTGCGCTCCTTCAACGGTATTCACAGCCTGATAAGGCAGAAAGTTTTGCAGCGCACCTTGTTGAATAAAAACAGTGCAATCAACAACGCCACAGGGACTAGCACCCATAACGTGATGCGTAGCAGATCGACCCAGGCATTCCCGAGCGTGCTCATGCTCTGGCGGGTAAACGCACGGATGAGGGCAAAATCACCGCAATCCCGCTGGCGGCAGAAAGAAAGTTTTGCACCGTTAAGCCCGCCATCTGGCTGAAATAGCTCAACGTGGTTTCACCGCTATAAGATTGCCAGTTGGTATTGGTGACAAAGCTGACGGCGGTATTCAGCGCCAGATCCCACGACAGCCCTGGCAACTGCTGTGGATTAAGCGGCAGATAGTGCTGACCGAGCAACATAAAAACAGCACCGCCAGCCCCAGCATGTTCAGGCCGAGAATGGCACAAAGATATTGCTTCCAGTTCATCTCACGGTCAGAGACGCCAAGTGCGCGAAAAGTACGCGCTCAACGCCCGTTGTACCGGGAAGAGGAATGTCATTAATCAGCCGCGCCAGCCCGCTGCCTAAAGGACGCGCCAGCACCATTAACACCAGTAAAAACGTGGCGATCAGTAAGAACCCTTGCGCAGCCATCAGAACGCCTCCGCATTGATCAGGGCATAAACCAGATAACCCAGTAATAAAACACCAGCAATACGCCGGTTATCACGCCTGCACTCACAGTGCACCTCCAGTGGCCTAAAAGTGATACCGGAAGGGTAGAATTCTGGCTGCAAAGATTTCGCAAAATCTGCGGGCGGGGTGTAAAAGTATAAAAATGGCAAAAGCCATGATTTAACTAATGTTTAGTATTAATTTAACTTTTGTGTAACTTAATTACAGGATGAATGTAAATAAACCATCAATAAGCAAAAATAAGTGGTCGGATGAGTAGTAAAATTACACAAAAGGCGGTACTATTTTCATCAGATAAACAAATTCATTTTTCCGGTGCCATTCACCGGGTAGATACAAAGGGGAGAAAAGTATGGAACTCTACAGAGAATATCCTGCATGGCTTATCTTTTTACGCCGTACTTATGCGGTTGCAGCGGGCGTTCTGGCGCTGCCTTTCATGCTTTTCTGGAAAGACCGCGCCCGCTTTTACAGCTACCTGCATCGCGTCTGGTCGAAAACCAGCGATAAACCGGTGTGGATGGATCAGGCCGAAAAGGCAACTGGTTTTTATTGATTGCTGAGTTTTGAATACATTGAAAACCGCCAGCGGAAACGCTGGCGGTTTTTGTATCAGGAAGATGTTCAGAGGAATATTTAGACATCGTTATACCAATCGAAACATATATTCATGAAATATATATAAATATTTTCCTAATTGTTCTTATCTGACAGATATCTCACTTAAGGCTTTCTTATAAATCTGTAGGGTTTCGCCTGTCAGCAGACAAATAACCCGATAAAACAAGGATGAGCAGATGAGCGGAAAACCGGCGGCGCGTCAGGGCGACATGACGCAGTATGGCGGTAGCATTGTCCAGGGTTCAGCCGGGGTACGCATCGGTGCCCCACCGGCGTGGCCTGTTCGGTGTGCCCCGGCGGGTGACGTCCGGCCATCCGGTCAATCCGCTGCTCGGTGCAAAGGTCCTTCCCGGTGAAACCGACATCGCCCTGCCCGGCCCGCTGCCGTTCATTCTCTCCCGCACCTACAGCAGTTACCGGACAAAACGCCCGCGCCGGTGGGGAGCCTCGGCCCCGGCTGGAAAATGCCTGCGGATATCCGCTTACAGCTGCGCGATAACACACTGATACTCAGTGATAACGGCGGCAGAAGCCTGTATTTTGAGCACCTGTTTCCCGGTGAGGACGGTTACAGCCGCAGCGAGTCACTGTGGCTGGTGCGCGGCGGCGTGGCGAAACTGGATGAAGGTCACCGGCTGGCCGCACTCTGGCAGGCGCTGCCGGAAGAACTCCGCTTAAGTCCGCATCGTTATCTGGCGACAAACAGTCCGCAGGGGCCGTGGTGGCTGCTCGGCTGGTGTGAGCGGGTGCCGGAAGCGGATGAGGTGCTGCCTGCGCCGCTGCCGCCGTACCGGGTACTGACCGGGCTGGTGGACCGCTTCGGGCGCACACAGACGTTCCACCGCGAAGCCGCCGGTGAATTCAGCGGCGAAATCACCGGCGTGACGGATGGTGCCGGGCGTCACTTCCGGCTGGTACTGACCACGCAGGCGCAGCGGGCAGAAGAAGCCCGGCAGCAGGCCATTTCCGGCGGGACGGAACCGTCCGCTTTCCTGATACCCTGCCGGGTTACACCGAATATGGCCGGGACAACGGCATCCGTCTGTCTGCCGTGTGGCTGACGCACGACCCGGAATACCCGGAGAATTTACCTGCCGCGCCGCTGGTGCGCTATGGCTGGACGCCCGCGGCGAACTGGCGGCGGTGTATGACCGCAGCAATACACAGGTGCGCAGCTTTACTTACGATGATAAATACCGGGGCCGGATGGTGGCGCACCGTCACACGGGCCGACCGGAAATCTGTTACCGTTACGACAGCGACGGGCGGGTGACAGAACAGCTAAACCCGGCAGGCTTAAGTTACACGTATCAGTATGAGAAGGACCGCATCACCATCACCGACAGCCTGAACCGCCGTGAAGTCCTGCACACGCAGGGTGAAGGCGGGCTGAAGCGGGTGGTGAAAAGGAACACGCGGACGGCAGCGTCACGCAGAGTCAGTTTGACGCGGTGGGCAGGCTCAGGGCACAGACGGATGCCGCAGGCAGGACAACAGAATACAGTCCGGATGTGGTGACGGGCCTCATCACGCGCATCACCACGCCGGATGGCAGGGCATCGGCGTTTTACTATAACCACCACAGCCAGTTAACGTCAGCCACCGGGCCTGACGGGCTGGAAATACGCCGGAATATGATGAATGGGGCCGTCTGATTCAGGAAACTGCCCCTGACGGCGATATCACCCGCTACCGTTATGATAATCCACACAGTGACTTACCCTGCGCAACGGAAGATGCCACCGGCAGCGGAAAACCATGACGTGGAGCCGTTACGGTCAGTTGCTGAGCTTCACTGACTGTTCCGGTTATGTAACCCGCTATGACCATGACCGTTTTGGTCAGGTGACGGCGGTGCACCGCGAGGAAGGGCTGAGTCAGTACCGCGCATACGACAGCCGTGGACAGTTAATTGCCGTGAAAGACACGCAGGGCCATGAAACGCGGTATGAATACAACGCCGCCGGTGACCTGACCACCGTCATTGCCCCGGACGGCAGCAGAAACGGGACACAGTACGATGCGTGGGGAAAAGCCATCTGTACCACGCAGGGCGGTCTGACGCGCAGTATGGAATACGATGCTGCCGGACGGGTCATCCGCCTGACCAGTGAAAACGGCAGCCACACCACCTTCCGTTACGATGTACTCGACCGGCTGATACAGGAAACCGGCTTTGACGGCCGCACACAGCGTTATCACCACGACCTGACCGGCAAACTTATCCGCAGCGAGGATGAGGGCTGGTCACCCACTGGCACTATGACGAAGCAGACCGCCTCACGCACCGCACCGTGAATGGCGAAACCGCAGAGCGGTGGCAGTATGACGAACGCGGCTGGCTGACAGACATCAGCCATATCAGCGAAGGGCACCGGGTGACGGTGCACTATGGTTATGACAGTAAAGGCCGCCTCGCCAGTGAACACCTGACGGTGCATCATCCGCAGACGAATGAACTGCTCTGGCAGCATGAGACCAGACATGCGTACAACGCACAGGGACTGGCGAACCGCTGTATACCGGACAGCCTGCCCGCCGTGGAATGGCTGACCTACGGCAGCGGCTGGCTGTCAGGCATGAAACTCGGCGACACACCGCTGGTGGAGTACACCCGCGACCGCCTGCACCGGGAAACGCTGCGCAGCTTCGGCCGTTATGAACTCACCACCGCTTATACCCTGCCGGGCAGTTACAGAGCCAGCACCTGAACAGCCTGCTGTCTGACCGCGATTACACCTGGAACGACAACGGCGAACTCATCCGCATCAGCAGCCCGCGCCAGACCCGGAGTTACAGCTACAGCACCACCGGCAGGCTGACCGGCGTTCACACCACCGCAGCGAATCTGGATATCCGCATCCCGTATACCACAGACCCGGCAGGTAACCGCCTGCCCGACCCGGAGCTGCCCGGACAGCGCCCTCAGCATGTGGCCGGATAACCGTATCGCCCGTGACGCGCACTATCTTTACCGGTATGACCGTCACGGCAGGCTGACAGAAAACCGACCTCATCCCGGAAGGGTTATCCGCACGGATGATGAGCGCACCCACCGGTACCATTACGACAGTCAGCACCGGCTGGTGCACTACACGCGGACACAATATGCAGAGCCGCTGGTCGAAAGTCGCTATCTTTACGACCCGCTGGGCCGCAGGGTGGCAAAACGGGTATGGCGGCGTGAACGGGACCTGACGGGCTGGATGTCGCTGTCACGGAAACCGCAAGTGACCTGGTACGGCTGGGACGGCGACCGCCTGACCACGATACAGAACGACAGAACCCGCATCCAGACGATTTATCAGCCGGGGAGCTTCACGCCACTCATCAGGGTTGAAACCGCCACCGGTGAGCTGGCGAAAACGCAGCGCGCAGCCTGGCGGATACCCTTCAGCAGTCCGGTGGCGAAGACGGTGGCAGTGTGGTGTTCCCGCCGGTGCTGGTGCAGATGCTCGACCGGCTGGAAAGTGAAATCCTGGCTGACCGGGTGAGTGAGGAAAGCCGCCGCTGGCTGGCATCGTGCGGCCTGACGGTGGCGCAGATGCAAAGCCAGATGGACCCGGTATACACGCCGGCGCGAAAAATTCACCTGTACCACTGCGACCATCGCGGCCTGCCGCTGGCCCTATCAGCACGGAAGGGACAACAGCGTGGTACGCAGAATACGATGAATGGGGTAACCTGCTGAATGAAGAGAACCCGCATCAGCTGCAGCAGCTTATCCGCCTGCCGGGGCAGCAGTATGATGAGGAGTCCGGCCTGTATTACAACCGCCACCGCTATTATGACCCGCTGCAGGGGCGATATATCACTCAGGATCCGATTGGGCTGAAAGGGGATGGAATTTTATCAGTATCCGTTGAATCCGATCTCAAATATAGATCCATTAGGATTAGAAACACTAAAATGCATTAAGCCACTGCATTCAATGGGCGGAACTGGTGAAAAAGCGGTCCAGATATATGGGGAATCCGTTCTATCATCAATATCTTTGTGTCCCAGATGGTAAAGGGACTATACTTGTGGTGGCCAAGACCAACGGGGAGAATCAAAGGAGATGGTCTATGGGGGCCAGGTAAAGCAAGTAATGATACAAAAGAAGCTGCTGGCCGTTGTGACCTCGTTGAAACCGATAATAGTTGTGTGGAGAACTGTTTAAAGGGAAGTTTAAAGAGGTAAGGCCGCGTTATTCTGTATTGCCTGATATATTCACACCTATAAATTTAGGGCTATTTAAAACTGCCAAGACTGGTCTAATGATTCTTTAGAAACATGTAAGATGAAGTGCTCCGGAAATAACATTGGACGTTTTATTAGATTTGTATTCACCGGAGTGATGTAATGAAATATATTATTTTTTATTCAGAGCTATATGGCTGGCTTTATCGCTTTTAATACTATTCTTTTCCATGCATAGACTTTCACTATTAGACTCCACTCGTGATGTGAGCGAGTTAATTAGTCTTATGGAATGATGGTAATATGTTTTCCAACAGGCAA
+>c2cfeb47-1930-4486-ba44-fb1f43519806 id=5 clr=0,2046
+TTGTTATTGCTTCCGGTCAGTTACGTATTGCTTTCTGTTGGTGCTGATGTGCGGCGTCTGTTGGGGTGTTTTAACTACCCTTGCGCCAGCCATCAGAACGCCCTCCGCGATGATCAGGGCGCCAAACCAGATAACCCAGTAATAAAAACGCAAACATGCGCCGGTTATCACGCCTGCACTCACAGTGCACCTCGATGTCTTCATTGATACCGGAAGGGTAGAATTCTGGCCCAAAGATTTCCATAAAATCTGCGGGCGAGATTAATAAAAGTATAAAGCCAGCTAAAAGCCGTGGTTAACTAATGTTTGAAGTAATTCGCTTTTGTATGGCAATTACGGGATGAATGTAAATAAACCATCAATAGCAAAAATAAATTGGTCGGATGAGTAGTAAAATTACACAAAAGGCGGTACTATTTTCATCAGATAAACAATTCATTTTTTCGGTGCCATTCACCGGGTAGATACAAAGGGGAGAAAGAAGTATGGAACTCTACCAGAATATCCTGCATGGCTTATCATTTTTACGCCGTACTTTATGCGGTTACAGCGGGCGTTCTGGCGCTGCCTTTCAATAGCTTTTCTGGAAAGGCCGCGCCCGCTTTGCAGCTACCTGCATGCGCGTCTGGTCGAAAACCAGCGATAAACCGGTGTGATGGATCAGGCCGAAAAGCAACTGGTGATTTTTGAAATTGATTTACCCAGGTTTTGATACATTGAAAACCGCCAGCGGAAACGCTGGCGGTTTTTATCATCAGGAAGATGTTCAGAGAATATTTAGACATCAATTTATACCAATCGAAACATATATTCATAAAGTATATATAAATATTTTCCTAATTGTTCTTATCTGACAGATATCTCGCCAAAGCTCTTATAAATCGCCGGGTTTCGCCTGTCAGCTAACAACTCAACGATAAAACGGATGAGCACTATGAGCGGAAAACCAGCGGCGCGTCAGGGCGATATGACTCAGTATGGCGGTCCCATTGTCCGAGGGTTCGGCAGGTGTAAGCATTAGCGCGCCCACCGGCGTGTAACGTGCTCGGGGTATTAACCGGGCGAAGTGACTTCCGACCATCCGGTAAATCCGCTGCTGGGTGCGAAGGTGCTGCCCGGTGAGACCACCGACCTTGCCCTGCCGGCCCGCTGCCGTTCATTCTCTCCCGCACCTACAGCAGCTACCGGACGAAAACGCCTGCACCGGTAAGGCGTTTTCGGCCCCGGCTGAAAATACCTTCTGATATCCGCTTACAGCTACGTGATGACGGACTGATACTCAACGACAACGGCGGGCGGAGCATTCACTTTGAGCCGCTGCTGCCGGCGAGGCGGTGTACAGCCGCAGTGAGTCAATGTGGCTGAAGATGCGGCGTGGCGAAAACAGGATGAAGGTCACCGGCTGGCCGCCTCTGGCAGGCGCTGCCGGAAGAATCCATGCGCCCGCATCTTTACCTGGCGACCAACAGCGCACAGGGGCCGTGGTGGCTGCTCGGCTGGTGTGAGCAGATGGAAGCGGATGAAGAGGTGCTGCCAGCGCCGCTGCCGCCATTACCAGGTGCTTACCGGGATGGCGGACCGCCGGGCGCACACAGACGTACCGGCGTAGAGGCCGCCGGTGACTTCGGCGGCGAAATCACCGGCGTGACGGACGGTGCCGGGCATGAGTTCCGTCTGGTGCTGACCACGCAGGCGCAGGCGGGCAGAAGGCCCACCACTTCCATCTCCTGACAGTTCCGCCCGTCCGCTTTCTGATACCCTGCCGGGTTACCAGATATGGCCGGGACAACGGCATCCGATCTGTCTGCCGTGTGGCTGACGCACGGCCGGAATACCCGGAGGAATTACCTGCCGCGCGCCGCTGGTGCGCTATGGCTGGGAACGCCCGCGGCGAACTGGCGGCGGTGTATGACCACCGTAATACACAGATTTGCAACTGCCCGTGATAAATACCGGGGCGGATGGTGGCGCACCGCCACACGGAGCCGACCGGAAATGTTACCGTTACGACGACGGGTTAAACGCAAGCAGACGCCGAAGATACCC
+>1c935ec4-4503-44ea-be57-7201fc03eeb6 id=6 clr=0,10822
+ACAACAGGCCGCCAATAGTGGTTGGGATCAGACAGACCAGCAGCGCCACCAGTACCGTTACGCTGACTGCATTACCGCCCACGCGGAAAACGGCCACAGCGTGGCGGTTGCCAGTAAAAGACGATAGTCAGGGCAATCAGCAGAATGGTCAGGGCAATTTCGTTCGGCGTTTTGCGTCGCTGTGCGCCTTCCACCATCGCGATCATCCGATCCAGAAATGTCTCGCCGGGGTTAACGCTACACTCAATCACCAGCCAGTCAGAAAGAATACGCGTGCCGCCGGTGACGGAGGCAAAATCGCCGCCGGATTCACGGATCACCGGTGCCGATTCCCCGGTGATGGCGCTTTCATCGACCGATGCACCCCTTCAATAACTTCACCATCGCAGGGGATAATATCGCCAGCTTCTACCAGTACGATATCGCCTTTACGAAGTTGGTCGGCAGGAACTTTGTCCGCCGCAGCGCCATATTTCGGCTCACGCAGCTTGCGGGCAAAGGCAGTTTTTCACCTTTCAGACTGTTGGCCTGCGCTTTACTGCGGCCTTCTGCCAGCGCCTCGGCGAAATTAGCGAACAGTACGGTGATCCACAGCCAACCGCTAATGGCCGCGCTAAACAGCGCATTGCCGGGCATCGCACCGCTTGCCATCGCGATGCTAATACAGGTGGTCAGCAGACTGCCGATCCAGACGATAAACATCACCGGATTGCGCCATTGCGCCTGCGGGTTTAATTTTTCACCGCTTCTTTCAGCGCCTGAACGACAAGTGTTGGTTCGAATAGCGCCAGTTGTTTACGACTCATATTCAGTGCTCACTCAATATCATCAGGAGAGATATTCCGCCACCGGACCAAGCGCCAGGGCAGGGATAAAGGTCAGTGCGCCAACCAGCAACACGGTGCCGATTAACAGGCCAACAAACAGCGGGCCGTGCGTTGGCAGCGTGCCGGAGCTGGCGGCTTGGCTCTTTTACTCACCAGCGAACCGGCAATTGCCATCACCGGGATAATCACCCCGAAGCGACCGACAAACATGCAGAACGCCAGTAAACAGTTCCAGAACGGAGAGTTGGCGCTTAATCCGGCAAAGGCGCTGCCGTTGTTGTTAGCGGCGGATGACACGGCGTACAGCACTTCGCTAAAACCATGCGGGCCAGGGTTGAGCATGGCGCTACGTCCGGCGTCGGTCATCATCGCCAACGCCGCGCCCATCAGCACCAGCGTCGGGGTAACCAGAATTGCCAGTGCAGTCAGTTTCATCTCGCGTACGTCGATTTTTTACCCAGATATTCCGGTGTACGACCAATCATCAGCCCGGCAATAAACACCGCCAGCAGGACAAACAGCATCATGCCGTAAAGACCAGAACCGACACCGCCGAACACCACTTCACCAATTTGCATCAGCCACATCGGCACCATGCCACCGAGAGCGGTAAACGAATCATGCATCGCAATCACCGCGCCACAGGAAGCCGCCGTCGTCACGACCGCAAACAGGCTACTGACCAGCACGCCGAAACGGCTCTCTTTACCTTCCATATTGATGCTGCTGTCCGTGCCCAGTGCCAGCAGATGAGGATTACCCTGAACTTCTGCCCACATCACCACGCCTACGCAGATGACAAAATCACTGACATCGCCCACAGCAACATGCGCCCCTGGCGGCGATCGCCCATCACTTCACCAAAGGCAAAGCACAGCGCCGTTGGGATCAAGAAGATCGCCAGCATCTGCACGAAGTTGGTCAGTGCGGTTGGGTTTTCAAACGGATGCGACGAGTTGGCATTAAAGAAGCCACCGCCGTTAGTACCGAGCATCTTGATCGCTTCCTGAGCTACAGGCCCCATGGGTAACAGCTGTTGCGCTCCTTCAACGGTATTCACAGCCTGATAAGGCAGAAAGTTTTGCAGCGCACCTTGTTGAATAAAAACAGTGCAATCAACAACGCCACAGGGACTAGCACCCATAACGTGATGCGTAGCAGATCGACCCAGGCATTCCCGAGCGTGCTCATGCTCTGGCGGGTAAACGCACGGATGAGGGCAAAATCACCGCAATCCCGCTGGCGGCAGAAAGTTTTGCACCGTTAAGCCCGCCATCTGGCTGAAATAGCTCAACGTGGTTTCACCGCTATAAGATTGCCAGTTGGTATTGGTGACAAAGCTGACGGCGGTATTCAGCGCCAGATCCCACGACAGCCCTGGCAACTGCTGTGGATTAAGCGGCAGATAGTGCTGACCGAGCAACATAAAAACAGCACCGCCAGCCCCAGCATGTTCAGGCCGAGAATGGCACAAAGATATTGCTTCCAGTTCATCTCACGGTCAGAGACGCCAAGTGCGCGAAAAGTACGCGCTCAACGCCCGTTGTACCGGGAAGAGGAATGTCATTAATCAGCCGCGCCAGCCCGCTGCCTAAAGGACGCGCCAGCACCATTAACACCAGTAAAAACGTGGCGATCAGTAAGAACCCTTGCGCAGCCATCAGAACGCCTCCGCATTGATCAGGGCATAAACCAGATAACCCAGTAATAAAACACCAGCAATACGCCGGTTATCACGCCTGCACTCACAGTGCACCTCCAGTGGCCTAAAAGTGATACCGGAAGGGTAGAATTCTGGCTGCAAAGATTTCGCAAAAATCTGCGGGCGGGGTGTAAAAAGTATAAAAATGGCAAAAGCCATGATTTAACTAATGTTTAGTATTAATTTAACTTTTGTGTAACTTAATTACAGGATGAATGTAAATAAACCATCAATAAGCAAAAATAAGTGGTCGGATGAGTAGTAAAATTACACAAAAGGCGGTACTATTTTCATCAGATAAACAAATTCATTTTTCCGGTGCCATTCACCGGGTAGATAAAAAGGGGAGAAAGTATGGAACTCTACAGAGAATATCCTGCATGGCTTATCTTTTTACGCCGTACTTATGCGGTTGCAGCGGGCGTTCTGGCGCTGCCTTTCATGCTTTTCTGGAAAGACCGCGCCCGCTTTTACAGCTACCTGCATCGCGTCTGGTCGAAAACCAGCGATAAACCGGTGTGGATGGATCAGGCCGAAAAGGCAACTGGTGATTTTATTGATTGCTGAGTTTTGAATACATTGAAAACCGCCAGCGGAAACGCTGGCGGTTTTTGTATCAGGAAGATGTTCAGAGGAATATTTAGACATCGTTATACCAATCGAAACATATATTCATGAAATATATATAAATATTTTCCTAATTGTTCTTATCTGACAGATATCTCACTTAAGGCTTTCTTATAAATCTGTAGGGTTTCGCCTGTCAGCAGACAAATAACCCGATAAAACAAGGATGAGCAGATGAGCGGAAAACCGGCGGCGCGTCAGGGCGACATGACGCAGTATGGCGGTAGCATTGTCCAGGGTTCAGCCGGGGTACGCATCGGTGCCCCACCGGCGTGGCCTGTTCGGTGTGCCCCGGCGGTGACGTCCGGCCATCCGGTCAATCCGCTGCTCGGTGCAAAGGTCCTTCCCGGTGAAACCGACATCGCCCTGCCCGGCCCGCTGCCGTTCATTCTCTCCCGCACCTACAGCAGTTACCGGACAAAACGCCCGCGCCGGTGGGGAGCCTCGGCCCCGGCTGGAAAATGCCTGCGGATATCCGCTTACAGCTGCGCGATAACACACTGATACTCAGTGATAACGGCGGCAGAAGCCTGTATTTTGAGCACCTGTTTCCCGGTGAGGACGGTTACAGCCGCAGCGAGTCACTGTGGCTGGTGCGCGGCGGCGTGGCGAAACTGGATGAAGGTCACCGGCTGGCCGCACTCTGGCAGGCGCTGCCGGAAGAACTCCGCTTAAGTCCGCATCGTTATCTGGCGACAAACAGTCCGCAGGGGCCGTGGTGGCTGCTCGGCTGGTGTGAGCGGGTGCCGGAAGCGGATGAGGTGCTGCCTGCGCCGCTGCCGCCGTACCGGGTACTGACCGGGCTGGTGGACCGCTTCGGGCGCACACAGACGTTCCACCGCGAAGCCGCCGGTGAATTCAGCGGCGAAATCACCGGCGTGACGGATGGTGCCGGGCGTCACTTCCGGCTGGTACTGACCACGCAGGCGCAGCGGGCAGAAGAAGCCCGGCAGCAGGCCATTTCCGGCGGGACGGAACCGTCCGCTTTTCTGATACCCTGCCGGGTTACACCGAATATGGCCGGGACAACGGCATCCGTCTGTCTGCCGTGTGGCTGACGCACGACCCGGAATACCCGGAGAATTTACCTGCCGCGCCGCTGGTGCGCTATGGCTGGACGCCCGCGGCGAACTGGCGGCGGTGTATGACCGCAGCAATACACAGGTGCGCAGCTTTACTTACGATGATAAATACCGGGGCCGGATGGTGGCGCACCGTCACACGGGCCGACCGGAAATCTGTTACCGTTACGACAGCGACGGGCGGGTGACAGAACAGCTAAACCCGGCAGGCTTAAGTTACACGTATCAGTATGAGAAGGACCGCATCACCATCACCGACAGCCTGAACCGCCGTGAAGTCCTGCACGCAGGGTGAAGGCGGGCTGAAGCGGGTGGTGAAAAGGAACACGCGGACGGCAGCGTCACGCAGAGTCAGTTTGACGCGGTGGGCAGGCTCAGGGCACAGACGGATGCCGCAGGCAGGACAACAGAATACAGTCCGGATGTGGTGACGGGCCTCATCACGCGCATCACCACGCCGGATGGCAGGGCATCGGCGTTTTACTATAACCACCACAGCCAGTTAACGTCAGCCACCGGGCCTGACGGGCTGGAAATACGCCGGGAATATGATGAATGGGGCCGTCTGATTCAGGAAACTGCCCTGACGGCGATATCACCCGCTACCGTTATGATAATCCACACAGTGACTTACCCTGCGCAACGGAAGATGCCACCGGCAGCCGGAAAACCATGACGTGGAGCCGTTACGGTCAGTTGCTGAGCTTCACTGACTGTTCCGGTTATGTAACCCGCTATGACCATGACCGTTTTGGTCAGGTGACGGCGGTGCACCGCGAGGAAGGGCTGAGTCAGTACCGCGCATACGACAGCCGTGGACAGTTAATTGCCGTGAAAGACACGCAGGGCCATGAAACGCGGTATGAATACAACGCCGCCGGTGACCTGACCACCGTCATTGCCCCGGACGGCAGCAAACGGGACACAGTACGATGCGTGGGGAAAAGCCATCTGTACCACGCAGGGCGGTCTGACGCGCAGTATGGAATACGATGCTGCCGGACGGGTCATCCGCCTGACCAGTGAAAACGGCAGCCACACCACCTTCCGTTACGATGTACTCGACCGGCTGATACAGGAAACCGGCTTTGACGGCCGCACACAGCGTTATCACCACGACCTGACCGGCAAACTTATCCGCAGCGAGGATGAGGGCTGGTCACCCACTGGCACTATGACGAAGCAGACCGCCTCACGCACCGCACCGTGAATGGCGAAACCGCAGAGCGGTGGCAGTATGACGAACGCGGCTGGCTGACAGACATCAGCCATATCAGCGAAGGGCACCGGGTGACGGTGCACTATGGTTATGACAGTAAAGGCCGCCTCGCCAGTGAACACCTGACGGTGCATCATCCGCAGACGAATGAACTGCTCTGGCAGCATGAGACCAGACATGCGTACAACGCACAGGGACTGGCGAACCGCTGTATACCGGACAGCCTGCCCGCCGTGGAATGGCTGACCTACGGCAGCGGCTGGCTGTCAGGCATGAAACTCGGCGACACACCGCTGGTGGAGTACACCCGCGACCGCCTGCACCGGGAAACGCTGCGCAGCTTCGGCCGTTATGAACTCACCACCGCTTATACCCTGCCGGGCAGTTACAGAGCCAGCACCTGAACAGCCTGCTGTCTGACCGCGATTACACCTGGAACGACAACGGCGAACTCATCCGCATCAGCAGCCCGCGCCAGACCCGGAGTTACAGCTACAGCACCACCGGCAGGCTGACCGGCGTTCACACCACCGCAGCGAATCTGGATATCCGCATCCCGTATACCACAGACCCGGCAGGTAACCGCCTGCCCGACCGGAGCTGCACCCGGACAGCGCCCTCAGCATGTGGCCGGATAACCGTATCGCCCGTGACGCGCACTATCTTTACCGGTATGACCGTCACGGCAGGCTGACAGAAAACCGACCTCATCCCGGAAGGGTTATCCGCACGGATGATGAGCGCACCCACCGGTACCATTACGACAGTCAGCACCGGCTGGTGCACCACGCGGACACAATATGCAGAGCCGCTGGTCGAAAGTCGCTATCTTTACGACCCGCTGGGCCGCAGGGTGGCAAAACGGGTATGGCGGCGTGAACGGGACCTGACGGGCTGGATGTCGCTGTCACGGAAACCGCAAGTGACCTGGTACGGCTGGGACGGCGACCGCCTGACCACGATACAGAACGACAGAACCCGCATCCAGACGATTTATCAGCCGGGGAGCTTCACGCCACTCATCAGGGTTGAAACCGCCACCGGTGAGCTGGCGAAAACGCAGCGCCGCAGCCTGGCGGATACCCTTCAGCAGTCCGGTGGCGAAGACGGTGGCAGTGTGGTGTTCCCGCCGGTGCTGGTGCAGATGCTCGACCGGCTGGAAAGTGAAATCCTGGCTGACCGGGTGAGTGAGGAAAGCCGCCGCTGGCTGGCATCGTGCGGCCTGACGGTGGCGCAGATGCAAAGCCAGATGGACCCGGTATACACGCCGGCGCGAAAAATTCACCTGTACCACTGCGACCATCGCGGCCTGCCGCTGGCCCTATCAGCACGGAAGGGACAACAGCGTGGTACGCAGAATACGATGAATGGGGTAACCTGCTGAATGAAGAGACCCGCATCAGCTGCAGCAGCTTATCCGCCTGCCGGGGCAGCAGTATGATGAGGAGTCCGGCCTGTATTACAACCGCCACCGCTATTATGACCCGCTGCAGGGGCGATATATCACTCAGGATCCGATTGGGCTGAAAGGGGATGGAATTTTATCAGTATCCGTTGAATCCGATCTCAAATATAGATCCATTAGGATTAGAAACACTAAAATGCATTAAGCCACTGCATTCAATGGGCGGAACTGGTGAAAGAAGCGGTCCAGATATATGGGGAATCCGTTCTATCATCAATATCTTTGTGTCCCAGATGGTAAAGGGACTATACTTGTGGTGGCCAAGACCAACGGGGAGAATCAAAGGAGATGGTCTATGGGGGCCAGGTAAAGCAAGTAATGATACAAAGAAGCTGCTGGCCGTTGTGACCTCGTTGAAACCGATAATAGTTGTGTGGAGAACTGTTTAAAGGAAGTTTAAAGAGGTAAGGCCGCGTTATTCTGTATTGCCTGATATATTCACACCTATAAATTTAGGGCTATTTAAAACTGCCAAGACTGGTCTAATGATTCTTTAGAAACATGTAAGATGAAGTGCTCCGGAAATAACATTGGACGTTTTATTAGATTTGTATTCACCGGAGTGATGTAATGAAATATATTATTTTTTATTCAGAGCTATATGGCTGGCTTTATCGCTTTTAATACTATTCTTTTCCATGCATAGACTTTCACTATTAGACTCCACTCGTGATGTGAGCGAGTTAATTAGTCTCATGTCTTATGGAATGATGGTAATATGTTTTCCAACAGGCATAGTATTCTTTATTGCTCTAATATTTATAGGGACTGTATCAGACATTATTGGCGTAAGGATTGATAGTAAGTATATTATGGCGATAATAATATGGCTTTATTTTCTGTCAGGAGGGTATATTCAATGGTTTGTATTAAGTAAGCGCATTATAAACAAATAAATTAAGTTAATTGCTCTTATTATTATATGTAACCTGGGCATTGATATCCCGTATGCCACAGACCCGGCAGGTAACCGCCTGCCCGACCGGAGCTGCACCCGGACAGCACCCTCAGCATGTGGCCGGATAACCGTATCGCCCGTGACGCGCACTATCTTTACCGGTATGACCGTCACGGCAGGCTGACGGAGAAAACCGACCTCATCGGAAGGGTTATCCGCACGGATGATGAGCGCACCCACCGGTACCATTACGACAGTCAGCACCGGCTGGTGCACTACACGCGGACACAATATGCAGAGCCGCTGGTCGAAAGCCGCTATCTTTACGACCCGCTGGGCCGCAGGGTGGCAAAACGGGTGTGGCGACGTGAACGGGACCTGACGGGCTGGATGTCGCTGTCACGGAAACCGCAAGTGACCTGGTACGGCTGGGACGGCGACCGCCTGACCACGATACAGAACGACAGAACCCGCATCCAGACGATTTATCAGCCGGGGAGCTTCACGCCACTCATCAGGTTGAAACCGCCACCGGTGAGCTGGCGAAAACAGCGCCGCAGCCTGGCGGATACCCTTCAGCAGTCCGGCGGCGAAGACGGTGGCAGTGTGGTGTTCCGCCGGTGCTGGTGCAGATGCTCGACCGGCTGGAAAGTGAAATCCTGGCTGACCGGGTGAGTGAGGAAAGCCGCCGCTGGCTGGCATCGTGCGGCCTGACGGTGGAGCAGATGCAAAACCAGATGGACCCGGTGTACACGCCGGCGCGAAAAATCCACCTGTACCACTGCGACCATCGCGGCCTGCCGCTGGCGCTTGTCAGCACGGAAGGGGCAACAGAATGGTGCGCAGAATACGATGAATGGGGCAACCTGCTGAATGAAGAGAACCCGCATCAGCTGCAGCAGCTTATCCGCCTGCCGGGGCAGCAGTATGATGAGGAGTCCGGCCTGTATTACAACCGCCACCGCTATTATGACCCGCTGCAGGGAGGTATATCACTCAGGATCCGATTGGGCTGAAGGGGGATGGAATTTTATCAGTATCCGCTGAATCCGGTTCAGTATATAGATTCAATGGGACTGGCATCAAAATATGGACACTTAAATAATGGCGGATATGGGCGAGACCCAACAAACCGCCTACGCCCGATCCAAGTAAATTGCCGACATAGCGAAACAATTAAGACTGCCATATCCTATTGACCAGGCCAGTAGTGCGCCTAATGTTTTCAAAACATTCTTCAGAGCATTAAGCCCTACGACTACACACTGTATTGCAGGAAGTGGGTAAAACCAAATCTGACTTGTACGCCACAGGATGATTCCCAGTATCCAGGGATGGATACAAAGACAGCAAGTGATTACCTGCCACAGACAAATTGGCCAACAACTCAATTACCACCAGGATATACTTGTGCAGAACCCTATTTATTCCCAGACATTAATAAACCCGATGGGCCAGCAACGGCAGGGATAGATGATTTGGGTGAAATTTTAGCTAAGATGAAAAGAGAACATCGAGAGGAATAAGAAAATGAAAAGAGTTTTGTTCTTTTTGCTGATGATATTTGTTAGTTTTGGTGTTATAGCTGATTGCGAAATACAAGCTAAAGATCATGATTGTTTTACTATTTTCGCTAAAGGGTACTATTTTTCCGCGTTTCCTGTCTTAAATAATAAAGCCATGTGGAGATGGTATCAGAATGAGGACATCGGTGAGTATTATTGGCAAACAGAACTGGGTACATGTAAAAATAATAAATTCACACCAAGCGGGGCGAGACTCTTAATTCGCGTCGGGTCACTACGCCTTAATGAAAATCATGCCATCAAAGGAACGTTGCAGGAGTTGATAAATACAGCAGAAAAACGGCGTTTCTCGGCGATCGGTTTAGAAGTTATATAGAGCGGGTATCTATCAAAAGAGCAGTGATCCAGTTCAGTTGTTGGCAGTCCTTGATAATTCAATCATGGTAAAATATTTTAAAGATGAGAAACCAACTTATGCTCGAATGACAGCACATCTCCCGAACAAAATGAGTCTTACGAATGTTTAATAAAGATACAGCATGAACTAATTCGTAGTGAAGAGAAATAAAATCTCTTCCTGAAGAAAACAAATTAATCATTGTGAAAAATTATATAACTCATGGAATAGGTGTTTATTTTGCGTTCCATTTGCAGGAAAGATCACGTAACGCTACTTTTTGTACTAAATAATTCGAATTTAAGTTCAACAATTGAGATACTACTTATTGTCTAAAGCTGTTTTTCATAGCTTATACATGATCAAATACTCCTTACATAAATAAGGTGAACAAATGGAACTTAAAAATTGATGGAACATATTTCTATTACACCCGATTACAGACAAGCCTGGAAAGTGGTGCATAAATTGTCAGATATTCTACTGTTGGACTATTTGTGCCGTTATTTCTGGTGCAGAAGGTTGGGAAGATATAAGAGGATTTCGGGGAAACATCTCGATTTTTTGAAGCAATATGGTGATTTTGAAAATGGTATTCCTGTTCACGATACCATTGCCAGAGTTGTATCAGGGAAGATCACGTAACGCTACTTTTTGTACTAAATAATTCGCATTTTATGTTTAAAAATTGAGATATTCCTATTACCTAAAGCTGTTTTTCATAGCTTATACATGATCAAATACTCCTTACATAAATAAGGTGAACAAATGGAACTTAAAAATTGATGGAACATATTTCTATTATTCCCGATTACAGATAAGCCTGGAAAGTAGAGCATAAATTGTCAGGCATCCTACTATTGACTATTTTGCCGTTATTTCTGGTGCGAAAGTTGGGAAGATATAGAGGATTTCGGGAAACACATCTCGATTTCTTGAAGCAATATGGTGATTTTGAAAATGGTATTCCTGTTCACGATACTATTGCCAGAGTTGTATCCTGTATCAGTCCTAGGTTAAACACCCAACAGACGCCGAAGATAGAGCGACAGGCAAAGAGCAATGCAATGAAAAAAAGG
+>756abc44-d69f-46e2-8464-2f309b147a27 id=7 clr=0,4332
+TTGCTTGGCATACTTCGTTCAGTTACGTATTGCTACTTGCCTGTCGCTCTATCTTCGTCTGCTTGGTGGTTTAACCTTCAGCTTTATGCCAATACCAACTGGCAATCTTATGCGGTGAAACCACGTTGAGCTATTTCAGCCAGATGGCGGGCTTAACGGTGCAAAACTTTCTTTCTGCCGCCAGCGGGATTGCGGTGATTTTGCCCTCATCCGTGCGTTTACCCGCCAGAGCATGAGCACGCTCGGGAATGCCTGGGTCGATCTGCTACGCATCACGTTATGGGTGCTAGTCCCTGCGTTGTTGATTGCACTGTTTTTATTCAACAAGGTGCGCTGCAAAACTTTCTGCCTTATCAGGCTGTGAATACCGTTGAAGGAGCGCAACAGCTGTTACCCATGGGGCCTGTAGCTTCTCAGGAAGCGATCAAGATGCTCGGTACTAACGGCGGTGGCTTCTTTAATGCCAACTCGTCGCATCCGTTTGAAAACCCAACCGCACTGACCAACTTCGTGCAGATGCTGGCGATCTTCTTGATCCCAACGGCGCTGTGCTTTGCCTTTGGTGAAGTGATGGGCGATCGCCGCCAGGGGCGCATGTTGCTGTGGGCGATGTCAGTGATTTTGTCATCTGCGTAGGCGTGGTGATGTGGGCAGAAGTTCAGGGTAATCCTCATCTGCTGGCACTGGGCACGGACAGCAGCATCAATATGGAAGGTAAAGAGAGCCGTTTCGGCGTGCTGGTCAGTAGCCTGTTTGCGGTCGTGACGACGGCGGCTTCCTGTGGCGCGGTGATTGCGATGCATGATTCGTTTACCGCTCTCGGTGGCATGGTGCCGATGTGGCTGATGCAAATTGGTGAAGTGGTGTTCGGCGGTGTCGGTTCTGGTCTTTACGGCATGATGCTGTTTGTCCTGCTGGCGGTGTTTATTGCCGGGCTGATGATTGGTCGTACACCGGAATATCTGGGTAAAAATCGACGTACGCGAGATGAAACTGACTGCACTGGCAATTCTGGTTACCCCGACGCTGGTGCTGATGGGCGCGGCGTTGGCGATGATGACCGACGCCGGACGTAGCGCCATGCTCAACCCTGGCCCGCATGGTTTTAGCGAAGTGCTGTACGCCGTGTCATCCGCCGCTAACAACAACGGCAGCGCCTTTGCCGGATTAAGCGCCAACTCTCCGTTCTGGAACTGTTTACTGGCGTTCTGCATGTTTGTCGGTCGCTTCGGGGTGATTATCCCGGTGATGGCAATTGCCGGTTCGCTGGTGAGTAAAAGAGCCAAGCCGCCAGCTCCGGCACGCTGCCAACGCACGGCCCGCTGTTTGTTGGCCTGTTAATCGGCACCGTGTTGCTGGTTGGCGCACTGACCTTTATCCTGCCCTGGCGCTTGGTCCGGTGGCGGAATATCTCCCTGATGATATTGAGTGAGCACTGAATATGAGTCGTAAACAACTGGCGCTATTCGAACCAACACTTGTCGTTCAGGCGCTGAAAGAAGCGGTGAAAAATTAAACCCGCAGGCGCAATGGCGCAATCCGGTGATGTTTATCGTCTGGATCGGCAGTCTGCTGACCACCTGTATTAGCATCGCGATGGCAAGCGGTGCGATGCCCGGCAATGCGCTGTTTAGCGCGGCCATTAGCGGTTGGCTGTGATCACCGTACTGTTCGCTAATTTCGCCGAGGCGCTGGCAGAAGGCCGCAGTAAAGCGCAGGCCAACAGTCTGAAAGGGTGAAAAACTGCCTTTGCCCGCAAGCTGCGTGAGCCGAAATATGGCGCTGCGGCGGACAAAGTTCCTGCCGACCAACTTCGTAAAGGCGATATCGTACTGGTAGAAGCTGGCGATATTATCCCCTGCGATGGTGAAGTTATTGAAGGGGTGCATCGGTCGATGAAAGCGCCATCACCGGGGAATCGGCACCGGTGATCCGTGAATCCGGCGGCGATTTTGCCTCCGTCACCGGCGGCACGCGTATTCTTTCTGACTGGCTGGTGATTGAGTGTAGCGTTAACCCCGGCGAGACATTTCTGGATCGGATGATCGCGATGGTGGAAGGCGCACAGCGACGCAAAACGCCGAACGAAATTGCCCTGACCATTCTGCTGATTGCCCTGACTATCGTCTTTTTACTGGCAACCGCCACGCTGTGGCCGTTTTCCGCGTGGGGCGGTAATGCAGTCAGCGTAACGGTACTGGTGGCGCTGCTGGTCTGTCTGATCCCAACCACTATTGGCGGCCTGTTGTCAGCGATCGGCGTCGCCGGGATGAGCCGGATGCTAGGCGCGAATGTGATTGCCACCAGCGGACGTGCAGTTGAAGCGGCAGGTGACGTTGACGTTCTGCTACTGGATAAAACCGGCACCATCACACTCGGTAACCGTCAGGCGTCGGAGTTTATCCCCGCGCAGGGCGTGGATGAAAAACGCTGGCTGACGCCGCACAACTGGCTTCGCTGGCTGATGAAACGCCGGAAGGCCGCAGTATTGTGATCCTCGCCAAGCAGCGTTTTAACCTGCGCGAGCGCGATGCAGTCGCTCCATGCCACCTTTTGTACCGTTTACTGCGCAAAGCCGGATGAGCGGGATCAACATCGACAACCGCATGATCCGTAAAGGTTCTGTCGATGCCATTCGTCGCCATGTTGAGGCTAACGGTGGTCACTTCCCTACCGATGTTGATCAAAAAGTCGATCAGGTTGCGCGTCAGGGAGCCACGCCGCTGGTGGTGGTGGAAGGTTCTCGTGTGCTGGGCGTTATTGCGCTGAAAGATATCGTCAAAGGCGGTATTAAAGAGCGCTTCGCCCAGCTGCGCAAAATGGGCATTAAAACGGTGATGATTACCGGCGATAACCGTCTGACTGCCGCCGCGATTGCTGCGGAAGCGGGTGTCGATGATTTTCTCGCCGAAGCGACACCGGAGGCCAAGCTGGCATTGATCCGTCAGTATCAGGCGGAAGGTCGTTTGGTAGCGATGACCGGCGACGGCACCAACGATGCTCCGGCGCTGGCGCAGGCAGATGTCGCGGTGGCGATGAACTCCGGCACCCAGGCGGCGAAAGGGCGGGCAATATGGTCGATCTCGACTCTAACCCGACCAAGTTGATCGAGGTGGTGCACATTGGCAAACAGATGCTGATGACCCGTGGCTCGCTGACCACCTTCAGCATTGCCAACGATGTGGCGAAATACTTCGCCATTATTCCGGCGGCATTCGCGGCAACGTATCCGCAGTTAAATGCGCTGAACATCATGTGCCTGCATTCGCCCGACTCCGCAATCCTCAGTGCGGTGATTTTCAACGCCTTGATTATCGTCTTTGATTCCCCTGGCGTTAAAGGCGTGAGTTATAAACCGCTTACCGCTTCTGCCATGTTGCGCCGTAACTTATGGATTTACGGTCTGGGTGGGCTGCTGGTGCCGTTTATCGGTATCAAAGTCATTGATTTACTGCTGACCGTTTGCGGTCTGGTGTGAGTTTACCATGAGTGGATTACGTCCGGCATTATCAACATTTATCTTTCTGTTATTGATTACTGGCGGCGTTTACCCGCTGCTGACCACCGTACTGGGGCAATGGTGGTTTCCTGGCAGGCCAATGGTTCGTTGATTCGTGAAGGTGATACGGTGCGCGGTTCGGCATTAATCGGGCAGAATTTTACCGGCAACGGCTATTTTCATGGTCGCCCGTCGGCAACGGCAGAAATGCCCTATAATCCACAGGCTTCTGGCGGGAGCAATCTGGCGGTCAGTAACCCTGAGCTGGATAAACTAATAGCCGCACGCGTTGCTGCATTACGGGCCGCTAACCCGGATGCCAGCGCGAGCGTTCCGGTTGAACTGGTGACGGCATCGGCAAGCGGGCTGGACAATAATATCACCCGCAAGCGGCGGCCTGGCAAATCCCGCGTGGCGAAAGCGCGTAATCTCAGCGTTGAACAGCTCACGCAACTGATCGCAAAATACAGCCAACAACCGCTGGTGAAATATATCGGCCAGCCGGTTGTCAACATTGTTGAACTCAATCTGGCGCTGGATAAACTTGATGAATAACGAACCCTTACGTCCCGACCCCGATCGTCTGCTGGAACAAACTGCCGCGCCGCATCGGGGAAGCTGAATTTTCTTCGGTGCCTGTGCAGGCGTCGGGAAGACCTGGGCGATGCTGGCAGAAGCCCAGCGACTGCGGGCGCAAGGGCTGGATATTGTGGTTGGCGTGGTAGAAACCCACGGGCGAAAAGATACCGCCGCCATGCTGGAAGGGCTGGCTGTTCTGCCGTTAAAACGCCAGGAGGTTAAACACCCAAGCAGACGCCGAAGATAGAACGCCC
+>6ffbbdea-7881-4ec3-b14a-e5a0c37c056d id=8 clr=0,4584
+TCTTACTTCGTTGGTGTAAATATTGCGTGCCCTGTCGCTCCATCTTCGGCGCTCGCGGGTGTTTAACTTCACCCCCGCACTCGGGCGGCTGGCCTGCGCTTTACTGCGGCCTTTGCCCAGCGCCTCGGCGAAATTAGCGAACAGTACGGTGATCCACAGCCAACCGCTTCGCCGCGCTTCAGCGCTTTAATTGCCGGGCATCGCACCGCTTGCCATCGCGATGCTAATACAGGTGGTCAGCAGACTGCCGATCCAGACGATAAACATCACCGGATTGCGCCATTGCGCCTGCGGGTTTAATTTTCACCGCTTCTTTCAGCGCCTGAACGACAAGTGTTGGTTCGAATAGCGCCAGGCGACTCATATTCAGTGCTCACTCAATATCATCAGGAGAGATATTCCGCCACCGGACCAAGCGCCAGGGCAGGGATAAAGGTCACGCCAACCAGCAACACGGTGCCGATTAACAGGCCAACAAACAGCGGGCCGTGCGTTGCAGCGCTGCCGGAGCTGGCGGCTTGGCTCTTTTACTCACCAGCGAACCGGCAATTGCATCACCGGGATAATCACCCGAAGCGACCGACAAACATGCAGAACGCCAGTAAACAGTTCCAGAACGGAGAGTTGGCGCTTAATCCGGCAAAGGCGCTGCCGTTGTTGTTAGCGGCGGATGACACGGCGTACAGCACTTCAAAACCATGCGGGCCAGGGTTGAGCATGGCGCTACGTCCGGCGTCGGTCATCATCGCCAACGCCGCGCCCATCAGCACAGCGTCGGGGTAACCAGAATTGCCAGTGCAGTCAGTTTCATCTCGCGTACGTCGATTTTTTATGATATTCCGGTGTACGACCAATCATCAGCCCGGCAATAAACACCGCCAGCAGGACAAACAGCATCATGCCGTAAAGACCAGAACCGACACCGCCGAACACCACTTCACCAATTTGCATCAGCCACACATGCACATGCGAGAGCGGTAAACGAATCATGCATCGCAATCACCGCGCCACAGGAAGCCGCCGTCGTCACGACCGCAAACAGGCTACTGACCAGCACGCCGAAACGGCTCTCTTTACCTTCCATATTGATGCTGCTGTCCGTGCCCAGTGCCAGCAGATGAGGATTACCCTGAACTTCTGCCCACATCACCACGCCTACGCAGATGACAAAATCACTGACATCGCCCACAGCAACATGCGCCCTGGCGGCGATCGCCCATCACTTCACCAAAGGCAAAGCACAGCGCCGTTGGGATCAAGAAGATCGCCAGCATCTGCACGAAGTTGGTCAGTGCGGTTGGGTTTTCAAACGGATGCGACGAGTTGGCATTAAAGAAGCCACCGCCGTTAGTACCGAGCATCTTGATCGCTTCCTGAGAAGCTACAGGCCCCATGGGTAACAGCTGTTGCGCTCCTTCAACGGTATTCACAGCCTGATAAGGCAGAAAGTTTAGCGCAGTTGAAATAAAAACAGTGCAATCAACAACGCCACAGGGGACTAGCACCCATAACGTGATGCGATCGACCCAGGCATTCCCGAGCGTGCTCATGCTCTGGCGGGTAAACGCACGGATGAGGGCAAAATCACCGCAATCCCGCTGGCGGCAGAAAGTTTTGCACCGTTAAGCCCGCCATCTGGCTGAAATAGCTCAACGTGGTTTCACCGCTATAAGATTGCCAGTTGGTATTGGTGACAAAGCTGACGGCGGTATTCAGCGCCAGATCCCACGACCAGCTGGCTGCTGTGGATTAAGCGGCAGATAGTGCTGACCGAGCAACATAAAAACAGCACCGCCAGCCCCAGCATGTTCAGGCCGAGAATGGCACAAAGATATTGCTTCCAGTTCATCTCACGGTCAGAGACGCCAAGTGCGAAAAAAGTACGCGCTCAACGCCCGTTGTACCGGGAAGAATGTCATTAATCAGCCGCGCCAGCCCGCTGCCTAAAGGACGCGCCAGCACCATTAACACCAGTAAAAACGTGGCGATCAGTAAGAACCCTTGCGCAGCCATCAGAACGCCTCCGCATTGATCAGGGCATAAACCAGATAACCCAGTAATAAAACACCAGCAATACGCCGGTTATCACGCCTGCACTCACAGTGCACCTCCAGTGGCCTAAAAGTGATACCGGAAGGGTAGAATTCTGGCTGCAAAGATTTCGCAAAATCTGCGGGCGTAAAAAAAGTATAAAATGGCAAAAGCCATGATTTAACTAATGTTTAGTATTAATTTAACTTTGTGTAACTTAATTACAGGATGAATGTAAATAAACCATCAATAAGCAAAAATAAGTGGTCGGATGAGTAGTAAAATTACACAAAGGCGGTACTATTTTCATCAGATAAACAAATTCATTTTTCCGGTGCCATTCACCGGGTAGATACAAAAGGGGAGAAAAGTATGGAACTCTACAGAGAATATCCTGCATGGCTTATCTTTTACGCCGTACTTACATGCGGTTGCAGCGGGCGTTCTGGCGCTGCTTTCATGCTTTTCTGGAAAGACCGCGCCCGCTTTTACAGCTACCTGCATCGCGTCTGGTCGAAAACCAGCGATAAACCGGTGTGGATGGATCAGGCCGAAAAAGGCAACTGGTGATTTTGATTGCTGAGTTTTGAATATTGAAAACCGCCAGCGGAAACGCTGGCGGTTTTTTATCAGGAAGATGTTCAGAGGAATATTTAGACATCGTTATACCAATCGAAACATATATTCATGAAATATATAAATATTTTCCTAATTGTTCTTATCTGACAGATATCTCACTTAAGGCTTTCTTATAAATCGCCTTTCGCCAGCAGACAAATAACCCGATAAAACAAGGATGAGCAGATGAGCGGAAAACCGGCGGCGCGTCAGGGCGACATGACGCAGTATGGCGGTAGCATTGTCCAGGGTTCAGGGGGTACGTCGGTGCCCCACCGGCGTGGCCTGTTCGGTGTGCCCCGGCGGGACGTCCGGCCATCCGGTCAATCCGCTGCTCGGTGCAAAGGTCCTTCCCGGTGAAACCGACATCGCCCTGCCCGGCCCGCTGCCGTTCATTCTCTCCGCACCTACAGCAGTTACCGGACAAAACGCCCGCGCCGGTGGGGAGCCTCGGCCCCGGCTGGAAAATGCCTGCGGATATCCGCTTACAGCTGCGCGATAACACACTGATACTCAGTGATAACGGCGGCAGAAGCCTGTATTTTGAGCACCTGTTTCCCTGAGGACGGTTACACAGCGAGTCACTGTGGCTGGTGCGGCGGCGTGGCGAAACTGGATGAAGGTCACCGGCTGGCCGCACTCTCTGGCAGGCGCTGCCGGAAGAACTCCGCTTAAGTCCGCATCGTTATCTGGCGACAAACAGTCCGCAGGGGCCGTGGTGGCTGCTCGGCTGGTGTGAGCGGGTGCCGGAAGCGGATGAGGTGCTGCCTGCGCCGCTGCCGCCGTACCGGGTACTGACCGGGCTGGTGGACCGCTTCGGGCGCACACAGACGTTCCACCGCGAAGCCGCCGGTGAATTCAGCGGCGAAATCACCGGCGTGACGGATGGTGCCGGGCGTCACTTCCGCTGGTACTGACCACGCAGGCGCAGCGGGCAGAAGAAGCCCGGCAGCAGGCCATTTCCGGCGGGACGGAACCGTCCGCTTTTCTGATATACCGGGTTACACCGAATATGGCCGGACAACGGCATCCGTCTGTCTGCCGTGTGGCTGACGCACGAATACCCGGAGAATTTACCTGCCGCGCCGCTGGTGCGCTATGGCTGGACGCCCGCGGCGAACTGGCGGCGGTGTATGACCGCAGCAATACACAGGTGCGCAGCTTTACTTACGATGATAAATACCGGGGCCGGATGGTGGCGCACCGTCACACGGGCCGACCGGAAATCTGTTACCGTTACGACAGCGACGGGCGGGTGACAGAACAGCTAAACCCGGCAGGCTTAAGTTACACGTATCAGTATGAGAAGGACCGCATCACCATCACCGACAGCCTGAACCGCCGTGAAGTCCTGCACAAGCAGAAGCGGGCTGAAGGGGTGGTGAAAAGGAACACGCGGACGGCAGCGTCACGCAGAGTCAGTTTGACGCGGTGGGCAGGCTCAGGGCACAGACGGATGCCGCAGGCAGGACAACAGAATACAGTCCGGATGTGGTGACGGGCCTCATCACGCATCACCACGCCGGATGGCAGGGCATCGGCGTTTTACTATAACCACCACAGCCAGTTAACGTCAGCCACCGGGCCTGACGGGCTACGCCGGGAATATGATGAATGGGGCCGTCTGATTCAGGAAACTGCCCCTGACGGCGATATCACCCGCTACCGTTATGATAATCCACACAGTGACTTACCCTGCGCCGGCGGAAAGATACCACCCGGCGCTGGAAAACCATACGGCGATAAGAACCGTTACGGTCGGTGCTGAAACTACTGACTGTTTCGGTTAATAAACCCTTCTGAAAGCCGCGACCGTTTTGGCGGTGGAGTGACGGCGGGTGCACCACCGAAAGACTGGTCAGTACCGCATCACGACAACCGTGGATAGATTTTACCGTGGAACGGATGGGTAGCGAGGCGGCTTCGATACTACCC
+>adeedf44-dbc5-401b-8b3c-07c944e12deb id=9 clr=0,6319
+TTGCTGCCTGTCGCTCTATCTTCGGCGTTCTTGGTTAACGTATTGCTCCGCCTGTCCTGTCTCATCTTCGGCGTCATAGACGGGTGTTTAACCATCCCTTTCAGCCCAATCGGTCCTGAGTGATATATCGCCCTGCAGCGGGTCATAATAGCGGTGGCGGTTGTAATACAGGCCGGACTCCTCATCATACTGCTGCCCCGGCAGGCGGATAAGCTGCTGCAGCTGATGCGGGTTCTCTTCATTCAGCAGGTTACCCCATTCATCGTATTCTGCGTACCACGCTGTTGTCCCTTCCGTGCTGATATGGGCCAGCGGCAGGCGCGATGGTCGCAGTGGTACAGGTGAATTTTTCGCGCCGGCGTGTATACCGGGTCCATCTGGCTTTGCATCTGCGCCACCGTCAGGCCGCACGATGCCAGCCAGCGGCGGCTTTCCTCACTCACCCGGTCAGCCAGGATTTCACTTTCCAGCCGGTCGAGCATCTGCACCAGCACCGGCGGGAACACCACACTGCCACCGTCTTCGCCACCGGACTGCTGAAGGGTATCCGCCAGGCTGCGGCGCTGCGTTTTCGCCAGCTCACCGGTGGCGGTTTCAACCCTGATGAGTGGCGTGAAGCTCCCCGGCTGATAAATCGTCTGGATGCGGGTTCTGTCGTTCTGTATCGTGGTCAGGCGGTCGCCGTCCCAGCCGTACCAGGTCACTTGCGGTTTCCGTGACAGCGACATCCAGCCCGTCAGGTCCCGTTCACGCCGCCATACCCGTTTTGCCACCCTGCGGCCCAGCGGGTCGTAAAGATAGCGACTTTCGACCAGCGGCTCTGCATATTGTGTCCGCGTAGTGCACCAGCCGGTGCTGACTGTCGTAATGGTACCGGTGGGTGCGCTCATCATCCGTGCGGATAACCCTTCCGGGATGAGGTCGGTTTTCTCTGTCAGCCTGCCGTGACGGTCATACCGGTAAAGATAGTGCGCGTCACGGGCGATACGGTTATCCGGCCACATGCTGAGGGCGCTGTCCGGGTGCAGCTCCGGGTCGGGCAGGCGGTTACCTGCCGGGTCTGTGGTATACGGGATGCGGATATCCAGATTCGCTGCGGTGGTGTGAACGCCGGTCAGCCTGCCGGTGGTGCTGTAGCTGTAACTCCGGGTCTGGCGCGGGCTGCTGATGCGGATGAGTTCGCCGTTGTCGTTCCAGGTGTAATCGCGGTCAGACAGCAGGCTGTTCAGGTGCTGGCTCTGTAACTGCCCGGCAGGGTATAAGCGGTGGTGAGTTCATAACGGCCGAAGCTGCGCAGCGTTTCCCGGTGCAGGCGGTCGCGGGTGTACTCCACCAGCGGTGTGTCGCCGAGTTTCATGCCTGACAGCCAGCCGCTGCCGTAGGTCAGCCATTCCACGGCGGGCAGGCTGTCCGGTATACAGCGGTTCGCCAGTCCCTGTGCGTTGTACGCATGTCTGGTCTCATGCTGCCAGAGCAGTTCATTCGTCTGCGGATGATGCACCGTCAGGTGTTCACTGGCGAGGCGGCCTTTACTGTCATAACCATAGTGCACCGTCACCCGGTGCCCTTCGCTGATATGGCTGATGTCTGTCAGCCAGCCGCGTTCGTCATACTGCCACCGCTCTGCGGTTTCGCCATTCACGGTGCGGTGCGTGAGGCGGTCTGCTTCGTCATAGTGCCAGTGGGTGGCCCTCATCCTCGCTGCGGATAAGTTTGCCGGTCAGGTCGTGGTGATAACGCTGTGTGCGGCCGTCAAAGCCGGTTTCCTGTATCAGCCGGTCGAGTACATCGTAACGGAAGGTGGTGTGGCTGCCGTTTTCACTGGTCAGGCGGATGACCCGTCCGGCAGCATCGTATTCCATACTGCGCGTCAGACCGCCCTGCGTGGTACAGATGGCTTTTCCCCACGCATCGTACTGTGTCCCGTTTCTGCTGCCGTCCGGGGCAATGACGGTGGTCAGGTCACCGGCGGCGTTGTATTCATACCGCGTTTCATGGCCCTGCGTGTCTTTCACGGCAATTAACTGTCCACGGCTGTCGTATGCGCGGTACTGACTCAGCCCTTCCTCGCGGTGCACCGCCGTCACCTGACCAAAACGGTCATGGTCATAGCGGGTTACATAACCGGAACAGTCAGTGAAGCTCAACTGACCGTAACGGCTCCACGTCATGGTTTTCGGCTGCCGGTGGCATCTTCCGTTGCGCAGGGTAAGTCACTGTGTGGATTATCATAACGGTAGCGGGTGATATCGCCGTCAGGGGCAGTTTCCTGAATCAGACGGCCCCATTCATCATATTCCCGGCGTATTTCCAGCCCGTCAGGCCCGGTGGCTGACGTTAACTGGCTGTGGTGGTTATAGTAAAACGCCGATGCCCTGCCATCCGGCGTGGTGATGCGCGTGATGAGGCCCGTCACCACATCCGGACTGTATTCTGTTGTCCTGCCTGCGGCATCCGTCTGTGCCCTGAGCCTGCCCACCGCGTCAAACTGACTCTGCGTGACGCTGCCGTCCGCGTGTTCCTTTTTCACCACCCGCAGCCCGCCTTCACCCTGCGTGTGCAGGACTTCACGGCGGTTCAGGCTGTCGGTGATGGTGATGCGGTCCTTCTCATACTGATACGTGTAACTTAAGCCTGCCGGGTTTAGCTGTTCTGTCACCCGCCCGTCGCTGTCGTAACGGTAACAGATTTCCGGTCGGCCCGTGTGACGGTGCGCCACCATCCGGCGGTATTTATCATCGTAAGTAAAGCTGCGCACCTGTGTATTGCTGCGGTCATACACCGCCGCCAGTTCGCCGCGGGGCGTCCAGCCATAGCGCACCAGCGGCGCGGCAGGTAAATTCTCCGGGTATTCCGGGTCGTGCGTCAGCCACACGGCAGACAGACGGATGCCGTTGTCCCGGCCATATTCGGTGTAACCCGGCAGGGTATCAGGAAAAGCGGACGGTTCCGTCCCGCCGGAAATGGCCTGCTGCCGGGCTTCTTCTGCCCGCTGCGCCTGCGTGGTCAGTACCAGCCGGAAGTGACGCCCGGCACCATCCGTCACGCCGGTGATTTCGCCGCTGAATTCACCGGCGGCTTCGCGGTGGAACGTCTGTGTGCGCCCGAAGCGGTCCACCAGCCCGGTCAGTACCCGGTACGGCGGCAGCGGCGCAGGCAGCACCTCATCCGCTTCCGGCACCCGCTCACACCAGCCGAGCAGCCACCACGGCCCCTGCGGACTGTTTGTCGCCAGATAACGATGCGGACTTAAGCGGAGTTCTTCCGGCAGCGCCTGCCAGAGTGCGGCCAGCCGGTGACCTTCATCCAGTTTCGCCACGCCGCCGCGCACCAGCCACAGTGACTCGCTGCGGCTGTAACCGTCCTCACCGGGAAACAGGTGCTCAAAATACAGGCTTCTGCCGCCGTTATCACTGAGTATCAGTGTGTTATCGCGCAGCTGTAAGCGGATATCCGCAGGCATTTTCCAGCCGGGGCCGAGGCTCCCCACCGGCGCGGGCGTTTTGTCCGGTAACTGCTGTAGGTGCGGAGAGAGAATGAACGGCAGCGGGCCGGGCAGGGCGATGTCGGTTTCACCGGGAAGGACCTTTGCACCGAGCAGCGGATTGACCGGATGGCCGGACACCCGCCGGGGCACACCGAACAGGCCACGCCGGTGGGGCACCGATGCGTACCCCGGCTGAACCCTGGACAATGCTACCGCCATACTGCGTCATGTCGCCCTGACGCGCCGCCGGTTTTCCGCTCATCTGCTCATCCTTGTTTTATCGGGTTATTTGTCTGCTGACAGGCGAAACCCTACAGATTTATAAGAAAGCCTTAAGTGAGATATCTGTCAGATAAGAACAATTAGGAAAATATTTATATATATTTCATGAATATATGTTTCGATTGGTATAACGATGTCTAAATATTCCTCTGAACATCTTCCTGATACAAAACCGCCAGCGTTTCCGCTGGCGGTTTTCAATGCAAAACTCAGCAATCAATAAAAATCACCAGTTGCCTTTTCGGCCTGATCCATCCACACCGGTTTATCGCTGGTTTTCGACCAGACGCGATGCAGGTAGCTGTAAAAGCGGGCGCGGTCTTTCCAGAAAAGCATGAAAGGCAGCGCCAGAACGCCCGCTGCAACCGCATAAGTACGGCGTAAAATAAAGCCATGCAGGATATTCTCTGTAGAGTTCCATACTTTTCTCCCCTTTTGTATCTACCCGGTGAATGGCACCGGAAAAATGAATTTGTTTATCTGATGAAAATAGTACCGCCTTTTGTGTAATTTTACTACTCATCCGACCACTTATTTTTGCTTATTGATGGTTTATTTACATTCATCCTGTAATTAAGTTACACAAAGTTAAATTAATACTAAACATTAGTTAAATCATGGCTTTTGCCATTTTTATACTTTTACACCCCGCCCGCAGATTTTGCGAAATCTTTGCAGCCAGAATTCTACCCTTCCGGTATCACTTTTAGGCCACTGGAGGTGCACTGTGAGTGCAGGCGTGATAACCGGCGTATTGCTGGTGTTTTATTACTGGGTTATCTGGTTTATGCCCTGATCAATGCGGAGGCGTTCTGATGGCTGCGCAAGGGTTCTTACTGATCGCCACGTTTTTACTGGTGTTAATGGTGCTGGCGCGTCCTTTAGGCAGCGGGCTGGCGCGGCTGATTAATGACATTCCTCTTCCCGGTACAACGGGCGTTGAGCGCGTACTTTTTCGCACTTGGCGTCTCTGACCGTGAGATGAACTGGAAGCAATATCTTTGTGCCATTCTCGGCCTGAACATGCTGGGGCTGGCGGTGCTGTTTTTGTGTTGCTCGGTCAGCACTATCTGCCGCTTAATCCACAGCAGTTGCCAGGGCTGTCGTGGGATCTGGCGCTGAATACCGCCGTCAGCTTTGTCACCAATACCAACTGGCAATCTTATAGCGGTGAAACCACGTTGAGCTATTTCAGCCAGATGGCGGGCTTAACGGTGCAAAACTTTCTTTCTGCCAGCGGATTGCGGTGATTTTGCCCTCATCCGTGCGTTTACCCGCCAGAGCATGAGCACGCTCGGGAATGCCTGGGTCGATCTGCTACGCATCACGTTATGGGTGCTAGTCCTGTGGCGTTGTTGATTGCACTGTTTTTATTCAACAAGGTGCGCTGCAAAACTTTCTGCCTTATCAGGCTGTGAATACCGTTGAAGGAGCGCAACAGCTGTTACCCATGGGGCCTGTAGCTTCTCAGGAAGCGATCAAGATGCTCGGTACTAACGGCGGTGGCTTCTTTAATGCCAACTCGTCGCATCCGTTTGAAAACCCAACCGCACTGACCAACTTCGTGCAGATGCTGGCGATCTTCTTGATCCCAACGGCGCTGTGCTTTGCCTTTGGTGAAGTGATGGGCGATCGCCGCCAGGGGCGCATGTTGCTGTGGGCGATGTCAGTGATTTTGTCATCTGCGTAGGCGTGGTGATGTGGGCAGAAGTTCAGGGTAATCCTCATCTGCTGGCACTGGGCACGGACAGCAGCATCAATATGGAAGGTAAAGAGAGCCGTTTCGGCGTGCTGGTCAGTAGCCTGTTTGCGGTCGTGACGACGGCGGCTTCCTGTGGCGCGGTGATTGCGATGCATGATTCGTTTACCGCTCTCGGTGGCATGGTGCCGATGTGGCTGATGCAAATTGGTGAAGTGGTGTTCGGCGGTGTCGGTTCTGGTCTTTACGGCATGATGCTGTTTGTCCTGCTGGCGGTGTTTATTGCCGGGCTGATGATTGGTCGTACACCGGAATATCTGGGTAAAAAATCGACGTACGCGAGATGAAACTGACTGCACTGGCAATTCTGGTTACCCCGACGCTGGTGCTGATGGGCGCGGCGTTGGCGATGATGACCGACGCCGGACGTAGCGCCATGCTCAACCCTGGCCCGCATGGTTTTAGCGAAGTGCTGTACGCCGTCATCCGCCGCTAACAACAACGGCAGCGCCTTTGCCGGATTAAGCGCCAACTCTCCGTTCTGGAACTGTTTACTGGCGTTCTGCATGTTTGTCGGTCGCTTCGGGGTGATTATCCCGGTGATGGCAATTGCCGGTTCGCTGGTGAAAAGAGCCAAGCCGCCAGCTCCGGCACGCTGCCAACGCACGGCCCGCTGTTTGTTGGCCTGTTAATCGGCACCGTGTTGCTGGTTGGCGCACTGACCTTTATCCCTGCCCTGGCGCTTGGTCCGGTGGCGGAATATCTCTCCTGATGATATTGAGTGAGCACTGAATATGAGTCGTAAACAACTGGCGCTATTCGAACCAACACTTGTCGTTCAGGCGCTGAAA
+>40aac17d-56a6-44db-934d-c0dbb853e2cd id=10 clr=0,5027
+TTGTTATTGCTTCGTTCAGTTACGTATGCTTTTCTGTTGGTGCTAATTGCGGCGTCAGACAGCAGGCTGTTCAGGTGCTGGCTCTGTAACTGCCCGGCAGGGTATAAGCGGTGGTGAGTTCATAACGGCCGAAGCTGCGCAGCGTTTCCCGGTGCAGGCGGTCGCGGGTGTACTCCACCAGCGGTGTGTCGCCGAGTTTCATGCCTGACAGCCAGCCGCTGCCGTAGGTCAGCCATTCCACGGCGGGCAGGCTGTCCGGTATACAGCGGTTCGCCAGTCCCTGTGCGTTGTACGCATGTCTGGTCTCATGCTGCCAGAGCAGTTCATTCGTCTGCGGATGATGCACCGTCAGGTGTTCACTGGCGAGGCGGCCTTTACTGTCATAACCATAGTGCACCGTCACCCGGTGCCCTTCGCTGATATGGCTGATGTCTGTCAGCCAGCCGCGTTCGTCATACTGCCACCGCTCTGCGGTTTCGCCATTCACGGTGCGGTGCGTGAGGCGGTCTGCTTCGTCATAGTGCCAGTGGGTGACCAGCCCCTCATCCTCGCTGCGGATAAGTTTGCCGGTCAGGTCGTGGTGATAACGCTGTGTGCGGCCGTCAAAGCCGGTTTCCTGTATCAGCCGGTCGAGTACATCGTAACGGAAGGTGGTGTGGCTGCCGTTTTCACTGGTCAGGCGGATGACCCGTCCGGCAGCATCGTATTCCATACTGCGCGTCAGACCGCCCTGCGTGGTACAGATGGCTTTTCCCCACGCATCGTACTGTGTCCCGTTTCTGCTGCCGTCCGGGGCAATGACGGTGGTCAGGTCACCGGCGGCGTTGTATTCATACCGCGTTTCATGGCCCTGCGTGTCTTTCACGGCAATTAACTGTCCACGGCTGTCGTATGCGCGGTACTGACTCAGCCCTTCCTCGCGGTGCACCGCCGTCACCTGACCAAAACGGTCATGGTCATAGCGGGTTACATAACCGGAACAGTCAGTGAAGCTCAGCAACTGACCGTAACGGCTCCACGTCATGGTTTTCCGGCTGCCGGTGGCATCTTCCGTTGCGCAGGGTAAGTCACTGTGGATTATCATAACGGTAGCGGGTGATATCGCCGTCAGGGGCAGTTTCCTGAATCAGACGGCCCCATTCATCATATTCCCGTATTTCCAGCCCGTCAGGCCCGGTGGCTGACGTTAACTGGCTGTGGTGGTTATAGTAAAACGCCGATGCCCTGCCATCCGGCGTGGTGATGCGCGTGATGAGGCCCGTCACCACATCCGGACTGTATTCTGTTGTCCTGCCTGCGGCATCCGTCTGTGCCCTGAGCCTGCCCACCGCGTCAAACTGACTCTGCGTGACGCTGCCGTCCGCGTGTTCCACCACCCGCTTCAGCCCGCCTTCACCCTGCGTGTGCAGGACTTCACGGCGGTTCAGGCTGTCGGTGATGGTGATGCGGTCCTTCTCATACTGATACGTGTAACTTAAGCCTGCCGGGTTTAGCTGTTCTGTCACCCGCCCGTCGCTGTCGTAACGGTAACAGATTTCCGGTCGGCCCGTGTGACGGTGCGCCACCATCCGGCCCCGGTATTTATCATCGTAAGTAAAGCTGCGCACCTGTGTATTGCTGCGGTCATACACCGCCGCCAGTTCGCCGCGGGGCGTCCAGCCATAGCGCACCAGCGGCGGCAGGTAAATTCTCCGGTATGGACCGGATTAATTGCCGTCAGCCACGGCGAACAGAACGGATGCCCGGTTCCGGCCATTCGCCGCTGTTGATGGTTCCGTCCGGTTGATCCGTGTCGGTGACATCAACAATCCATCAGATGAACGGCTCCGGCATGTTGTGCCATGTCGAACGGATGCCATGCGACGTAAAGTCGTCAGTTTATCCGATCTCTTCCGGGTGAAACCGGTAATCAATCGTCATCATTTTCAATCAGTGGATATATGAGCAGCGGATTGACCGGATGGCCGGACGTCACCCGCCGGGGCACAGGTGACCACGCCGGTGGGGGCACCGATGCGTACCCCGGCTGAACCCTGGACAATGCTACCGCCATACTGCGTCATGTCGCCCTGACGCGCCGCCGGTTTTCCGCTCATCTGCTCATCCTTGTTTTATCGGGTTATTTGTCTGCTGACAGGCGAAACCCTACAGATTTATAAGAAAGCCTTAAGTGAGATATCTGTCAGATAAGAACAATTAGGAAAATATTTATATATATTTCATGAATATATGTTTCGATTGGTATAACGATGTCTAAATATTCCTCTGAACATCTTCCTGATATAAAAACCGCCAGCGTTTCCGCTGGCGGTTTTCAATGTATTCAAACTCAGCAATCAATAAAATCACCAGTTGCCTTTTCGGCCTGATCCATCCACACCGGTTTATCGCTGGTTTTCGACCAGACGCGATGCAGGTAGCTGTAAAAGCGGGCGCGGTCTTTCCAGAAAAGCATGAAAGGCAGCGCCAGAACGCCCGCTGCAACCGCATAAGTACGGCGTAAAAAGATAAGCCATGCAGGATATTCTCTGTAGAGTTCCATACTTTTCTCCCCTTTTGTATCTACCCGGTGAATGGCACCGGAAAAATGAATTTGTTTATCTGATGAAAATAGTACCGCCTTTTGTGTAATTTTACTACTCATCCGACCACTTATTTTTGCTTATTGATGGTTTATTTACATTCATCCTGTAATTAAGTTACACAAAAGTTAAATTAATACTAAACATTAGTTAAATCATGGCTTTTGCCATTTTTATACTTTTACACCCCGCCCGCAGATTTTTGCGAAATCTTTGCAGCCAGAATTCTACCCTTCCGGTATCACTTTTAGGCCACTGGAGGTGCACTGTGAGTGCAGGCGTGATAACCGGCGTATTGCTGGTGTTTTATTACTGGGTTATCTGGTTTATGCCCTGATCAATGCGGAGGCGTTCTGATGGCTGCGCAAGGGTTCTTACTGATCGCCACGTTTTTACTGGTGTTAATGGTGCTGGCGCGTCCTTTAGGCAGCGGGCTGGCGCGGCTGATTAATGACATTCCTCTTCCCGGTACAACGGGCGTTGAGCGCGTACTTTTCGCGCACTTGGCGTCTGACCGTGAGATGAACTGGAAGCAATATCTTTGTGCCATTCTCGGCCTGAACATGCTGGGGCTGGCGGTGCTGTTTTTATGTTGCTCGGTCAGCACTATCTGCCGCTTAATCCACAGCAGTTGCCAGGGCTGTCGTGGGATCTGGCGCTGAATACCGCCGTCAGCTTTGTCACCAATACCAACTGGCAATCTTATAGCGGTGAAACCACGTTGAGCTATTTCAGCCAGATGGCGGGCTTAACGGTGCAAAACTTTCTTTCTGCCGCCAGCGGATTGCGGTGATTTTGCCCTCATCCGTGCGTTTACCCGCCAGAGCATGAGCACGCTCGGGAATGCCTGGGTCGATCTGCTACGCATCACGTTATGGGTGCTAGTCCCTGTGGCGTTGTTGATTGCACTGTTTTTATTCAACAAGGTGCGCTGCAAAACTTTCTGCCTTATCAGGCTGTGAATACCGTTGAAGGAGCGCAACAGCTGTTACCATGGGGCCTGTAGCTTCTCAGGAAGCGATCAAGATGCTCGGTACTAACGGCGGTGGCTTCTTTAATGCCAACTCGTCGCATCCGTTTGAAAACCCAACCGCACTGACCAACTTCGTGCAGATGCTGGCGATCTTCTTGATCCCAACGGCGCTGTGCTTTGCCTTTGGTGAAGTGATGGGCGATCGCCGCCAGGGCGCATGTTGCTGTGGGCGATGTCAGTGATTTTGTCATCTGCGTAGGCGTGGTGATGTGGGCAGAAGTTCAGGGTAATCCTCATCTGCTGGCACTGGGCACGGACAGCAGCATCAATATGGAAGGTAAAGAGAGCCGTTTCGGCGTGCTGGTCAGTAGCCTGTTTGCGGTCGTGACGACGGCGGCTTCCTGTGGCGCGGTGATTGCGATGCATGATTCGTTTACCGCTCTCGGTGGCATGGTGCCGATGTGGCTGATGCAAATTGGTGAAGTGGTGTTCGGCGGTGTCGGTTCTGGTCTTTACGGCATGATGCTGTTTGTCCTGCTGGCGGTGTTTATTGCCGGGCTGATGATTGGTCGTACACCGGAATATCTGGGTAAAAAATCGACGTACGCGAGATGAAACTGACTGCACTGGCAATTCTGGTTACCCCGACGCTGGTGCTGATGGGCGCGGCGTTGGCGATGATGACCGACGCCGGACGTAGCGCCATGCTCAACCCTGGCCCGCATGGTTTTAGCGAAGTGCTGTACGCCGTGTCATCCGCCGCTAACAACAACGGCAGCGCCTTTGCCGGATTAAGCGCCAACTCTCCGTTCTGGAACTGTTTACTGGCGTTCTGCATGTTTGTCGGTCGCTTCGGGGTGATTATCCCGGTGATGGCAATTGCCGGTTCGCTGGTGAGTAAAAGAGCCGCCGCCAGCTCCGGCACGCTGCCAACGCACGGCCCGCTGTTTGTTGGCCTGTTAATCGGCACCGTGTTGCTGGTTGGCGCACTGACCTTTATCCCTGCCCTGGCGCTTGGTCCGGTGGCGGAATATCTCTCCTGATATTGAGTGAGCACTGAATATGAGTCGTAAACAACTGGCGCTATTCGAACCAACACTTGTCGTTCAGGCGCTGAAAGAAGCGGTGAAAAAATTAAACCCGCAGGCGCAATGGCGCAATCCGGTGATGTTTATCGTCTGGATCGGCAGTCTGCTGACCACCTGTATTAGCATCGCGATGGCAAGCGGTGCGATGCCCGGCAATGCGCTGTTTAGCGCGGCCATTAGCGGTTGGCTGTGGATCACCGTACTGTTCGCTAATTTCGCCGAGGCGCTGGCAGAAGGCCGCAGTAAAGCGCAGGCCAACAGTCTGAAAGGGGTGAAAAACTGCCTTTGCCCGCAAGCTGCGTGAGCCGAAATATGGCGCTGCGGCGGACAAAGTTCCTGCCGACCAACTTCGTAAAGGCGATATCGTACTGGTAGAAGCTGGCC
+>1d5ccec9-296a-4afd-ad74-010ebd3732ec id=11 clr=0,7220
+AATACCAACTGGCAATCTTATAGCGGTGAAACCACGTTGAGCTATTTCAGCCAGATGGCGGGCTTAACGGTGCAAAACTTTCTTTCTGCCGCCAGCGGGATTGCGGTGATTTTGCCCTCATCCGTGCGTTTTACCCGCCAGAGCATGAGCACGCTCGGGAATGCCTGGGTCGATCTGCTACGCATCACGTTATGGGTGCTAGTCCCTGTGGCGTTGTTGATTGCACTGTTTTTATTCAACAAGGTGCGCTGCAAAACTTTCTGCCTTATCAGGCTGTGAATACCGTTGAAGGAGCGCAACAGCTGTTACCCATGGGGCCTGTAGCTTCTCAGGAAGCGATCAAGATGCTCGGTACTAACGGCGGTGGCTTCTTTAATGCCAACTCGTCGCATCCGTTTGAAAACCCAACCGCACTGACCAACTTCGTGCAGATGCTGGCGATCTTCTTGATCCCAACGGCGCTGTGCTTTGCCTTTGGTGAAGTGATGGGCGATCGCCGCCAGGGGCGCATGTTGCTGTGGGCGATGTCAGTGATTTTTGTCATCTGCGTAGGCGTGGTGATGTGGGCAGAAGTTCAGGGTAATCCTCATCTGCTGGCACTGGGCACGGACAGCAGCATCAATATGGAAGGTAAAGAGAGCCGTTTCGGCGTGCTGGTCAGTAGCCTGTTTGCGGTCGTGACGACGGCGGCTTCCTGTGGCGCGGTGATTGCGATGCATGATTCGTTTACCGCTCTCGGTGGCATGGTGCCGATGTGGCTGATGCAAATTGGTGAAGTGGTGTTCGGCGGTGTCGGTTCTGGTCTTTACGGCATGATGCTGTTTGTCCTGCTGGCGGTGTTTATTGCCGGGCTGATGATTGGTCGTACACCGGAATATCTGGGTAAAAATCGACGTACGCGAGATGAAACTGACTGCACTGGCAATTCTGGTTACCCCGACGCTGGTGCTGATGGGCGCGGCGTTGGCGATGATGACCGACGCCGGACGTAGCGCCATGCTCAACCCTGGCCCGCATGGTTTTAGCGAAGTGCTGTACGCCGTGTCATCCGCCGCTAACAACAACGGCAGCGCCTTTGCCGGATTAAGCGCCAACTCTCCGTTCTGGAACTGTTTACTGGCGTTCTGCATGTTTGTCGGTCGCTTCGGGGTGATTATCCCGGTGATGGCAATTGCCGGTTCGCTGGTGAGTAAAGAGCCAAGCCGCCAGCTCCGGCACGCTGCCAACGCACGGCCCGCTGTTTGTTGGCCTGTTAATCGGCACCGTGTTGCTGGTTGGCGCACTGACCTTTATCCTGCCCTGGCGCTTGGTCCGGTGGCGGAATATCTCTCCTGATGATATTGGTGAGCACTGAATATGAGTCGTAAACAACTGGCGCTATTCGAACCAACACTTGTCGTTCAGGCGCTGAAAGAAGCGGTGAAAAATTAAACCCGCAGGCGCAATGGCGCAATCCGGTGATGTTTATCGTCTGGATCGGCAGTCTGCTGACCACCTGTATTAGCATCGCGATGGCAAGCGGTGCGATGCCCGGCAATGCGCTGTTTAGCGCGGCCATTAGCGGTTGGCTGTGGATCACCGTACTGTTCGCTAATTTCGCCGAGGCGCTGGCAGAAGGCCGCAGTAAAGCGCAGGCCAACAGTCTGAAAGGGTGAAAAACTGCCTTTGCCCGCAAGCTGCGTGAGCCGAAATATGGCGCTGCGGCGGACAAAGTTCCTGCCGACCAACTTCGTAAAGGCGATATCGTACTGGTAGAAGCTGGCGATATTATCCCCTGCGATGGTGAAGTTATTGAAGGGGTGCATCGGTCGATGAAAGCGCCATCACCGGGGAATCGGCACCGGTGATCCGTGAATCCGGCGGCGATTTTGCCTCCGTCACCGGCGGCACGCGTATTCTTTCTGACTGGCTGGTGATTGAGTGTAGCGTTAACCCCGGCGAGACATTTCTGGATCGGATGATCGCGATGGTGGAAGGCGCACAGCGACGCAAAACGCCGAACGAAATTGCCCTGACCATTCTGCTGATTGCCCTGACTATCGTCTTTTACTGGCAACCGCCACGCTGTGGCCGTTTTCCGCGTGGGGCGGTAATGCAGTCAGCGTAACGGTACTGGTGGCGCTGCTGGTCTGTCTGATCCCAACCACTATTGGCGGCCTGTTGTCAGCGATCGGCGTCGCCGGGATGAGCCGGATGCTAGGCGCGAATGTGATTGCCACCAGCGGACGTGCAGTTGAAGCGGCAGGTGACGTTGACGTTCTGCTACTGGATAAAACCGGCACCATCACACTCGGTAACCGTCAGGCGTCGGAGTTTATCCCCGCGCAGGGCGTGGATGAAAAACGCTGGCTGACGCCGCACAACTGGCTTCGCTGGCTGATGAAACGCCGGAAGGCCGCAGTATTGTGATCCTCGCCAAGCAGCGTTTTAACCTGCGCGAGCGCGATGTGCAGTCGCTCCATGCCACCTTTGTACCGTTTACTGCGCAAAGCCGGATGAGCGGGATCAACATCGACAACCGCATGATCCGTAAAGGTTCTGTCGATGCCATTCGTCGCCATGTTGAGGCTAACGGTGGTCACTTCCCTACCGATGTTGATCAAAAAGTCGATCAGGTTGCGCGTCAGGGAGCCACGCCGCTGGTGGTGGTGGAAGGTTCTCGTGTGCTGGGCGTTATTGCGCTGAAAGATATCGTCAAAGGCGGTATTAAAGAGCGCTTCGCCCAGCTGCGCAAAATGGGCATTAAAACGGTGATGATTACCGGCGATAACCGTCTGACTGCCGCCGCGATTGCTGCGGAAGCGGGTGTCGATGATTTTCTCGCCGAAGCGACACCGAGGCCAAGCTGGCATTGATCCGTCAGTATCAGGCGGAAGGTCGTTTGGTAGCGATGACCGGCGACGGCACCAACGATGCTCCGGCGCTGGCGCAGGCAGATGTCGCGGTGGCGATGAACTCCGGCACCCAGGCGGCGAAAGGCGGGCAATATGGTCGATCTCGACTCTAACCCGACCAAGTTGATCGAGGTGGTGCACATTGGCAAACAGATGCTGATGACCCGTGGCTCGCTGACCACCTTCAGCATTGCCAACGATGTGGCGAAATACTTCGCCATTATTCCGGCGGCATTCGCGGCAACGTATCCGCAGTTAAATGCGCTGAACATCATGTGCCTGCATTCGCCCGACTCCGCAATCCTCAGTGCGGTGATTTTCAACGCCTTGATTATCGTCTTTGATTCCCCTGGCGTTAAAAGGCGTGAGTTATAAACCGCTTACCGCTTCTGCCATGTTGCGCCGTAACTTATGGATTTACGGTCTGGGTGGGCTGCTGGTGCCGTTTATCGGTATCAAAGTCATTGATTTACTGCTGACCGTTTGCGGTCTGGTGTAGGTTTACCATGAGTGGATTACGTCCGGCATTATCAACATTTATCTTTCTGTTATTGATTACTGGCGGCGTTTACCCGCTGCTGACCACCGTACTGGGGCAATGGTGGTTTCCTGGCAGGCCAATGGTTCGTTGATTCGTGAAGGTGATACGGTGCGCGGTTCGGCATTAATCGGGCAGAATTTTACCGGCAACGGCTATTTTCATGGTCGCCCGTCGGCAACGGCAGAAATGCCCTATAATCCACAGGCTTCTGGCGGGAGCAATCTGGCGGTCAGTAACCCTGAGCTGGATAAACTAATAGCCGCACGCGTTGCTGCATTACGGGCCGCTAACCCGGATGCCAGCGCGAGCGTTCCGGTTGAACTGGTGACGGCATCGGCAAGCGGGCTGGACAATAATATCACCCGCAAGCGGCGGCCTGGCAAATCCCACGCGTGGCGAAAGCGCGTAATCTCAGCGTTGAACAGCTCACGCAACTGATCGCAAAATACAGCCAACAACCGCTGGTGAAATATATCGGCCAGCCGGTTGTCAACATTGTTGAACTCAATCTGGCGCTGGATAAACTTGATGAATAACGAACCCTTACGTCCCGACCCCGATCGTCTGCTGGAACAAACTGCCGCGCCGCATCGGGGAAGCTGAATTTTCTTCGGTGCCTGTGCAGGCGTCGGGAAGACCTGGGCGATGCTGGCAGAAGCCCAGCGACTGCGGGCGCAAGGGCTGGATATTGTGGTTGGCGTGGTAGAAACCCACGGGCGAAAAGATACCGCCGCCATGCTGGAAGGGCTGGCTGTTCTGCCGTTAAAACGCCAGGCGTACCGTGGGCGGCATATCAGCGAGTTTGATCTCGATGCCGCCCTCGCCCGCCGCCCGGCGCTGATCTTAATGGACGAACTGGCGCACAGTAATGCGCCAGGTTCCCGTCATCCCAAACGCTGGCAGGATATCGAAGAACTGCTGGAAGCTGGCATTGATGTTTTCACTACCGTCAACGTTCAGCATCTGGAAAGTCTGAATGATGTGGTCAGCGGCGTCACCGGAATTCAGGTACGGGAAACCGTGCCCGATCCTTTTCGATGCCGCCGACGACGTGGTGCTGGTGGACTTGCCCCGGACGATCTGCGCCAGCGGCTGAAAGAAGGCAAAGTCTATATTGCCGGGCAGGCGGAGCGCGCCATTGAACATTTTTCCGCAAAGGTAATCTGATCGCCCTGCGCGAACTGGCACTGCGCCGTACTGCCGATCGCGTTGATGAGCAAATGCGCGCCTGGCGGGGCATCCTGGCGAAGAGAAAGTGTGGCACACGCGCGACGCGATCCTTTTATGCATCGGCCATAACACCGGCAGCGAAAACTGGTCCGCGCAGCGGCGCGGCTGGCGTCACGGCTGGGTAGCGTCTGGCACGCGGTGTATGTTGAAACCCCTGCCCTGCACCGCTTACCGGAAAAAACGTCGGGCAATTCTCAGCGCCTTACGTCTGGCGCAGGAACTGGGCGCGGAGACGGCAACACTTTCTGATCCAGCGGAAGAGAAAGCGGTAGTGCGTTATGCCCGTGAACATAATCTCGGCAAGATTATTCTCGGTCGCCCGGCCTCGCGCCGCTGGTGGCGTCGGGAAACGTTTGCTGACCGACTGGCGCGCATCGCCCCGATCTCGATCAGGTGCTGGTCGCGCTTGATGAACCACCCGCCCGCACGATTAACAACGCGCCGGATAACCGCTCTTTTAAAGACAAGTGGCGTGTACAAATTCAGGGATGCGTGGTTGCCGCCGCGTTATGCGCCGTTATCACCTTAATTGCCATGCAGTGGCTGATGGCGTTGATGCCGCCAACCTGGTGATGCTGTATCTGCTTGGCGTGGTGGTGGTGGCGCTATTTTATGGACGCTGGCCTTCAGTGGTTGCCACCGTCATTAATGTAGTGAGTTTCGATCTCTTTTTATCGCCCCACGCGGCACGCTCGCCGTCTCTGATGTGCAATATCTGCTGACCTTCGCGGTGATGTTAACCGTCGGGCTGGTGATCGGGAACCTTACTGCTGGCGTGCGTTATCAGGCGCGGGTAGCCCGTTACCGCGAGCAACGCACGGCGGCACATATGAAATGTCGAAAGCTCTGGCGGTGGGCCGCAGTCCGCAGGATATCGCTGCCACCAGCGAACAATTTATTGCCTCCACGTTTCATGCCCGCAGTCAGGTGTTGTTGCCCGATGACAACGGTAAATTGCAGCCGTTAACACATCCGCAAGGAATGACGCCGTGGGACGATGCCATCGCGCAGTGGAGTTTTGATAAAGGCCTGCCTGCGGGCGCGGGCACCGACACGTTACCCGGTGTACCGTACCAGATTTTGCCGCTAAAAAGCGGCGAGAAAACCTACGGGCTGGTGGTGGTGGAGCCGGGGAATCTGCGCCAGTTGATGATCCCGGAACAGCAGCGCCTGCTGGAACGTTACGCTGTTAGTCGCCAATGCCCTTGAGCGGCTGACGCTAACCGCCAGCGAAGAACAGGCGCGGATGGCAAGCGAACGTGAACAGATCCGCAACGCCCTGCTGGCGGCGCTTTCGCATGATTTACGCACGCCGCTTACGGTGCTGTTTGGTCAGGCAGAAATCTTAACGCTCGATCTGGCGAAGCGAGGATCACCCCGCCCGCCAGGCCAGCGAGATCCGTCAGCATGTTAACTGAACACTACCCGACTGGTGAATAATCTACTGGATATGGCGCGAATTCAGTCCGGCGGCTTTAATTTGAAGAAAGAGTGGTTAACGCTGGAAGAAGTAGTCGGCAGCGCGCTGCAAATGCTGGAACCGGGTTTATCGTCGCCCATCAATCTTTCTCTGCCAGAACCGCTGACCTTAATCCACGTTGACGGGCCTCTTTGAACGGGTGCTGATTAATCTGCTGGAGAACGCGGTGAAATATGCGGGTGCGCAGGCCGAAATTGGTATCGATGCCCACGTTGAGGGCGAAAATCTACAACTGGATGTCTGGGATAACGGCCCCGGTCTTCCGCCAGGCCAGGAGCAGACGATATTTGATAAGTTTGCTCGCGGGAATAAAGAGTCGGCAGTACCGGGGGTAGGGCTTGGACTGGCAATTTGTCGGGCGATAGTGGATGTACACGGGGGCACTATTACCGCGTTCAACCGACCGGAAGGTGGTGCCTGTTTTTCGTGTTACACTTCCCCAGCAAACTGCCCTGAACTGAAGAATTTCAGCGGGATATGTGACAAACGTTCTGATTGTTGAAGATGAACAGGCTATTCGTCGCTTTCTGCGCACGGCGCTGGAGGGCGACGGATGCGATCTTTGAGGCCGAAACGCTGCAACGCGGCTTGCTGGAAGCGGCAACCCGTAAGCCAGATTTGATTATTCTCGATCTCGGCCTGCCCGATGGTGATGGGATTGAGTTTATCCGCGACCTGCGCCAGTGGAGCGCGGTGCCGGTGATTGACTTTCCGCACGCAGCAGAAGAGCGACAAAATCGCCGCGCTGGATGCCGGGCGGATGATTATCTGAGTAAAGCCGTTTGGCGTGGCGAATTGCAGGCCCGTCTGCGCGTCGCATTACGCCGCCACTCTGCCACCACCGCGCCCGATCCGCTGGTAAAATTTTCCGATGTTACCGTCGATTTAGCCGCCCGCGTGATTCACCGGGGTGAGGAAGGTGCATCTCACACCAATTGAGTTCCGCCTGCTGGCGGTGCTGCTCAACAATGCCGGAAAAATTACTCACCCAGCGCCAGCTCCTTAACCAGGTGCAGCGGTTAAACCCAAGCAGACGCCGAATGGGAGCGACCAGGCAAGTAGCAATACGTAACGG
+>690186f5-a384-40a4-8aae-9a99ad2322f5 id=12 clr=0,3796
+GTACTTCGTTCCAGTTACGTATTGCTTTTCTGTTGGTGCTGATATTGCGCGTCTGCTTGGGTGTTAACCTGGCGGCAGGCGTTTTGTCCGGTAACTGCTGTAGGTGCGGAGAGAATGAACGGCAGCGGGCCGGGCAGGGCGATGTCGGTTTCACCGGGAAGGACCTTTGCACCGAGCAGCGGATTGACCGGATGGCCGGACGTCACCCGCCGGGGCACACCGAACAGGCCACGCCGGTGGGGCACCGATGCGTACCCCGGCTGAACCCTGGACAATGCTACCGCCATACTGCGTCATGTCGCCCTGACGCGCCGCCGGTTTCCGCTCATCTGCTCATCCTTGTTTTATCGGGTTATTTGTCTGCTGACAGGCGAAACCCTACAGATTTATAAGAAAGCCTTAAGTGAGATATCTGTCAGATAAGAACAATTAGGAAAATATTTATATATATTTCATGAATATATGTTTCGATTGGTATAACGATGTCTAAATATTCCTCTGAACATCTTCCTGATACAAAAACCGCCAGCGTTTCCGCTGGCGGTTTCAATATTCAAACTCAGCAATCAATAAAATCACCAGTTGCCTTTTCGGCCTGATCCATCCACACCGGTTTATCGCTGGTTTTCGACCAGACGCGATGCAGGTAGCTGTAAAAGCGGGCGCGGTCTTTCCAGAAAAGCATGAAAGGCAGCGCCAGAACGCCCGCTGCAACCGCATAAGTACGGCGTAAAAGATAAGCCATGCAGGATATTCTCTGTAGAGTTCCATACTTTTCTCCCCTTTGTATCTACCCGGTGAATGGCACCGGAAAAATGAATTGTTTATCTGATGAAAATAGTACCGCCTTTTGTGTAATTTTACTACTCATCCGACCACTTATTTTTGCTTATTGATGGTTTATTTACATTCATCCTGTAATTAAGTTACACAAAAGTTAAATTAATACTAAACATTAGTTAAATCATGGCTTTTGCCATTTTTATACTTTTACACCCCGCCAGATTTTGCGAAATCTTTGCAGCCAGAATTCTACCCTTCCGGTATCACTTTTAGGCCACTGGAGGTGCACTGTGAGTGCAGGCGTGATAACCGGCGTATTGCTGGTGTTTTTATTACTGGGTTATCTGGTTTATGCCCTGATCAATGCGGAGGCGTTCTGATGGCTGCGCAAGGGTTCTTACTGATCGCCACGTTTTTACTGGTGTTAATGGTGCTGGCGCGTCCTTTAGGCAGCGGGCTGGCGCGGCTGATTAATGACATTCCTCTTCCCGGTACAACGGGCGTTGAGCGCGTACTTTTCGCGCACTTGGCGTCTCTGACCGTGAGATGAACTGGAAGCAATATCTTTGTGCCATTCTCGGCCTGAACATGCTGGGGCTGGCGGTGCTGTTTTATGTTGCTCGGTCAGCACTATCTGCCGCTTAATCCACAGCAGTTGCCAGGGCTGTCGTGGGATCTGGCGCTGAATACCGCCGTCAGCTTTGTCACCAATACCAACTGGCAATCTTATAGCGGTGAAACCACGTTGAGCTATTTCAGCCAGATGGCGGGCTTAACGGTGCAAAACTTTCTTTCTGCCGCCAGCGGGATTGCGGTGATTTTGCCCTCATCCGTGCGTTTACCCGCCAGAGCATGAGCACGCTCGGGAATGCCTGGGTCGATCTGCTACGCATCACGTTATGGGTGCTAGTCCCTGTGGCGTTGTTGATTGCACTGTTTTTATTCAACAAGGTGCGCTGCAAAACTTTCTGCCTTATCAGGCTGTGAATACCGTTGAAGGAGCGCAACAGCTGTTACCCATGGGGCCTGTAGCTTCTCAGGAAGCGATCAAGATGCTCGGTACTAACGGCGGTGGCTTCTTTAATGCCAACTCGTCGCATCCGTTTGAAAACCCAACCGCACTGACCAACTTCGTGCAGATGCTGGCGATCTTCTTGATCCCAACGGCGCTGTGCTTTGCCTTTGGTGAAGTGATGGGCGATCGCCGCCAGGGGCGCATGTTGCTGTGGGCGATGTCAGTGATTTTGTCATCTGCGTAGGCGTGGTGATGTGGGCAGAAGTTCAGGGTAATCCTCATCTGCTGGCACTGGGCACGGACAGCAGCATCAATATGGAAGGTAAAGAGAGCCGTTTCGGCGTGCTGGTCAGTAGCCTGTTTGCGGTCGTGACGACGGCGGCTTCCTGTGGCGCGGTGATTGCGATGCATGATTCGTTTACCGCTCTCGGTGGCATGGTGCCGATGTGGCTGATGCAAATTGGTGAAGTGGTGTTCGGCGGTGTCGGTTCTGGTCTTTACGGCATGATGCTGTTTGTCCTGCTGGCGGTGTTTATTGCCGGGCTGATGATTGGTCGTACACCGGAATATCTGGGTAAAAATCGACGTACGCGAGATGAAACTGACTGCACTGGCAATTCTGGTTACCCCGACGCTGGTGCTGATGGGCGCGGCGTTGGCGATGATGACCGACGCCGGACGTAGCGCCATGCTCAACCCTGGCCCGCATGGTTTTAGCGAAGTGCTGTACGCCGTGTCATCCGCCGCTAACAACAACGGCAGCGCCTTTGCCGGATTAAGCGCCAACTCTCCGTTCTGGAACTGTTTACTGGCGTTCTGCATGTTTGTCGGTCGCTTCGGGGTGATTATCCCGGTGATGGCAATTGCCGGTTCGCTGGTGAGTAAAAGAGCCAAGCCGCCAGCTCCGGCACGCTGCCAACGCACGGCCCGCTGTTTGTTGGCCTGTTAATCGGCACCGTGTTGCTGGTTGGCGCACTGACCTTTATCCCTGCCCTGGCGCTTGGTCCGGTGGCGGAATATCTCTCTGATGATATTGAGTGAGCACTGAATATGAGTCGTAAACAACTGGCGCTATTCGAACCAACACTTGTCGTTCAGGCGCTGAAAGAAGCGGTGAAAAAATTAAACCCGCAGGCGCAATGGCGCAATCCGGTGATGTTTATCGTCTGGATCGGCAGTCTGCTGACCACCTGTATTAGCATCGCGATGGCAAGCGGTGCGATGCCCGGCAATGCGCTGTTTAGCGCGGCCATTAGCGGTTGGCTGTGGATCACCGTACTGTTCGCTAATTTCGCCGAGGCGCTGGCAGAAGGCCGCAGTAAAGCGCAGGCCAACAGTCTGAAAGGGTGAAAAACTGCCTTTGCCCGCAAGCTGCGTGAGCCGAAATATGGCGCTGCGGCGGACAAAGTTCCTGCCGACCAACTTCGTAAAGGCGATATCGTACTGGTAGAAGCTGGCGATATTATCCCCTGCGATGGTGAAGTTATTGAAGGGTGCATCGGTCGATGAAAGCGCCATCACCGGGGAATCGGCACCGGTGATCCGTGAATCCGGCGGCGATTTTGCCTCCGTCACCGGCGGCACGCGTATTCTTTCTGACTGGCTGGTGATTGAGTGTAGCGTTAACCCCGGCGAGACATTTCTGGATCGGATGATCGCGATGGTGGAAGGCGCACAGCGACGCAAAACGCCGAACGAAATTGCCCTGACCATTCTGCTGATTGCCCTGACTATCGTCTTTTACTGGCAACCGCCACGCTGTGGCCGTTTTCCGCGTGGGGCGGTAATGCAGTCAGCGTAACGGTACTGGTGGCGCTGCTGGTCTGTCTGATCCCAACCACTATTGGCGGCCTGTTGTCAGCGATCGGCGTCGCCGGGATGAGCCGGATGCTAGGCGCGAATGTGATTGCCACCAGCGGACGTGCAGTTGAAGCGGCAGGTGACGTTGAGAGCTGTTAGGTTAAACGCAGAAAAACAGACGCCGAAGATAGAAGCGCC
+>c7937d7b-d85f-433b-9327-7eb293974905 id=13 clr=0,6636
+CGCATTCTCGTTAGTCGATCGTATCGCTATCGTCAATCATCGCGTCGATCGATATCACGGTTGTCGCCAGCGGCGGTAAGGCTGATGCCTTCCTCGCGGTGGACGCGTCATCTGGCCGAAGCGGTCGTATTCATAACGGGTCTGGTAGCCCGAGCAGTCGGTGAACGCCAGCAACTGCCCGTAGCGGCTCCAGGTCATCTGCCGGGTGCTGCCGTCGCATCCGTTGTCGTCGCCGGTAACTCACTGTGCGCGTCATCGTAGCGGTAGCGTACTGTCTCCCCGCTGCGCGATGTCTCCGATACCAGCCTGCCCGGTTCATCATATTCCGGCGGCTCTCCAGCCCGTCCGGGGACACCACCGCCGTCAGCTGGTTCCGTCGTTATAGTAAAATTTCGTCTCCCGCCCGTCCGGTGTGGTGATGTCCGTGATATCGCCGGACACCACATTCAGACCGTACTCTGTCCTCCGTCCCGCGTCCGTCTGCGCCGTGAGCCTTCCTGCCGCGTCATACCCGCTGCGCGTGACGCTGCCGTCCGCCAGTTCTTTTTCACCACCGTTTCAGCCCGGCCCCGCCTTCTGTATGCAGCACCTCACGCCGGTTCAGGCTGTCGGTGACGGTGATGCGGTCCTGCTCATAAAGATAGCGGTAGCTTAACCCTGCCGGGTTCAGTTGCTCCACCACCCGCCCCGTATCGTCGTAGCGGTAGCGCATCTCCGGCCTTCCCGCGTAACGGTGCGCCACCATCCGGCCCGGGTGCTGCGTCATACGTGAAAGCGCGCACCTGCGTATTGCTGCGGTCATATACCGCCAGCAGTTCACCGGCTTCCGTATGCGTGTACCGCACCAGTGGCGCAGCGGGCAGGCTCTCCGGGTATGCCGGGTCGTGCATCAGCCACACCGCCGAAAGGCGGATACCCTGTCGGGGCCGTATTCGGTACCGGGCGGTGTGTCGGGGAACGCTGAGGCTGAGAGAGGGCGGGAACTGTCAGAAGAAGATAGCGAAGAGGTGGGCCTCTTCCGCACGCTGCGCCTGCGTGGTCAGCACCAGACGGAACTCCCGCCCGGCACCGTCCGTCACGCCGGTGATTTCCCCGGCCAGGTCACCGGCGGCCTCACGCCGGTACGTCAGCGTCCGCCCGAAGCGGTCCGCCATCCCGGTAAGCACCCGGTACGGCGGCAGCGGCGCTGGCAGTACGTCCTCAGCACCCGGCACCCGCTCAGACCACCCCAGTATCACCACGGCCCCTGTGCGCTGTTGGTCGCCAGGTAAAGATGCGGGCTTAACCGGATATCCGGCGGCAGCGCCCCCACAGCCGCGCCAGCGTATGGCCGTCCGGCTGTGCTGCCTTACCACCGCGCACCAGCCACATTGACTCACTGCGGCTGTACACCGCCTCCCCGGCAGCAGCGGCTCAAAGTGAATGCTCCGCCCGCCGTTGTCGTTGAGTATCAGTCCGTCATCACGTAGCTGTAAGCGGATATCAGAAGGCGCTTTCAGCCGGGGCCGAAAACGCCCACCGGTGCAGGCGTCTTCGTCCGGTAGCTGCTGTAGGTGCGGGAGAGAATGAACGGCAGCGGGCCGGGCAGCGCAAGGTCCGTCTCGCCGGGCAGCACCTTCGCCCCCAGCAGCGGATTTACCGGGTTGCCCGAAGTCATCCCGCCCGGACACACCGAGCACGCCACGCCGGTGGGCGCGCCATTCTTACACCTGCCGAACCCTGGACAATGGGACCGCCATACTGAGTCATATCTCCTGACGCGCCGCTGGTTTTCCGCTCATATAAAGTGCCCTTTTAGTTATTGTTCATATCCCTGTGTTAGCAACAAAAAATAAAATGACACACAAGACCAGCTAATGTATTTATATATTTTTCACATAAACTTATTTGTTCTCAATCAACAACAACTGTTATTACAGGTCACTTTCAATATTTTATTAAACTAACATTTTGCACAGATGAATTCATCATCAACAAATTCACTATATGGATAATATCCATTCAACGCATATGATTTATGATTTTATTAGTCTGAGTTATTTTTGTAGGGCTATATTTAAAATCAATAAACTCCACCGATTCAGATTAATATCAGCAATAGAAAGATAGAAATCACCAATTCAATAACATCATCAATGAAACATATTGTAGAATTAATTTAAACAAGGCGTTCCATTCAACCAGAACGCCCTTATTTACTCTCATCACCCGCAAACTGCCTGAACAGCGCCTTACCCTTTAACCAGTCGCGCACCCAGCCAGCCGCCGAGCGACAGCAGCAGCGCTCCGCTGCACGGCAGAACAATCCACAATCGCCAGTCTGGCTCCACGGAAAATCAAACACTTTCGCCTGCAACACTGCCAGCGCCGTTTCCGCACCAATTGCGGCCACCAGGCCGGAAACAAACCCAAGCATGGCGAACTCACACCACAACGTGGTACGCAGCAGTTTTTCCCGCACCGAGTGTGCGCCACACCACCAGCTCCTGATGACGCTGACGCATTCCCACCTGCACCTGTGCCAGCAACAGCAACATACCGCAGGCGGTGACCAGTACCACCATCACTTCCAGCGCCCGACTTACCTGCTCCAGCACCTGACCGACCTGTTTTAAAATCGCGCCAATATCTAACAGGCTAATGGTCGGGAACTGGCGGTTGAGTTGTGTCAACATGCCGTTGCCATTCTCCCAGCGGAAACTGGTAAGCCAGCTCTGCGGTTGCCCGTCTAATGCCCTTCAGGGAAAATAAAATAGAAATTAGGCCGCAGACTTTCCCAGTCCACTTTGCGCAGGCTGGTCACTTTAGCGCGGAACTCCTGGGTATCGCCCATAAAAGTCACGGTATCACCGAGGGCAACGTTTAAGCGTTTCGCCAGCCCCTCTTCCATCGACACTTCATCGGCTTTTGGCGGCCAGTTACCGGCGACAATCGGATTATGATCGGGCGCGTATTTTGCCAGGTAAGATTGAGTTCGCGGTTAAGCGCCTCATCTTCATTACCTTCTGTCGGCTTATCGTTAATCGCCGTCAGCCGCGCCCACCACCGGATAAAACGATTCCGGGACTATCTGATGTTCCGCGAGGAACGCTTTTAGCGGTGCTACCTGTTCTGTGGCGATGTTAATTAAAAGTAGTTCGGGCTTTCTGGAGGTAGCTGCTGCCAGCGGTCGAGCAGATCGCCACGCAACACCAGCAGCAGTGCCAGCAGCATAAAGGAGAGCGAAAATGCCGAAAGCTGACTTAACGTTGACCACGGCTGACGTAACAGGCGGCTAACCGCCAGGCGCAGAGGCAGCGATTTCAGCGTCATGCGGCGAAGTACATTCAGCAGCATCCAGCCCAGCACACCGCAGCAAAGCCAGTACTACCGCGCCCGCCAGCACCGCCCAAAGCAGCATGCTGCCACCCATTAATCCGGCGAGCAGCAGCACAACCACCACACTGACAATCGGCAGATAAAACTTCAGCGGCCAGACGTTCGCTACCACATCATTACGTAATACGCGTAAAGGCTGCGTTGCCAGCAACAAGCGATATGGTCGTAGCCCCACCAGCAGCGAGATGACCGTCATGGTGCCAAGCGCCCACAGCCACGGCCAGAGGCTGGCTGGCGGTAGTGCAGCAGGCAGAACGGGCTTGAGCAGCACCATCAACACGTTTCGAACAACAGGCCTATGGCCCCACCGGTAACGGCTGAAAGCGTCAGCACCATCAACCACTGACCGACGATTAGCTTACGCAGTTGCTCGCCCTGCCCCCAGCGTTTTGAGGATCGCCACCAGATCGTAGCGACTGCGACAGTAATGATTCATCGCTACCGCCACCGCTGCCACTGCCAGCAGCAAGGTCAGAAGCGCCGAAAGCAGCAGGAACTGTTGCGAGCGTTCCATCGATCGCCCCAGCGCGCCTTCGTCCTGTTCCAGACCGTACCAGCGTTGTTCGGGTTTAAGCTGGGTAACAACCATTTCATAGCCGTCGAGCTGGTTCTCGTTGCCGCCGAATTTATAACGCCAGGTGACCCGACTCCCCGGCTGCACGGCTCCGGTTTTATCGACATCCGCCAGATTCATCATCAGACGCGGAGCCATCTGGAAGGGTTAAAACCGGAATCCGGTTCCTGAATCACTTCTCCGGCAATCCGCAAGGTGGCATCGCCCACGTCAATGGTGTCGCCCGTTTTCAGGTTAAGCAGTGCCATCAGGCGTGGGGCCAGCAATACGCTGCCCGCCTGCGGTTTCAGGCCAGGGGATTAGTTTGCAGATCGCCATACATCGGGTAGATATCATCCACCGCTTTGACGTTCGCCAGCTGCGGTGTGTCGCCTGCAAAGGTCATTGTGGCGAAAGTCAGCTTGCCGACTTTCAGGCCGCGCTTTGCGCTTCCTCCAGCCACGCTTGCGGCACTTCGCGTGAACTGCGCAACGCCCGATCGCCCGCCATAAACTCACGGCTTTGCTGGCTTAAGCCCTTCTCCATGCGATCGCTGATATTGCCCAGCGCCAGCACGCAGGCCACCGCCAGGCTTAGCGCCAGCCAGACAATTAATAGCGACGGCGAACGCCATTCGCGCCAGAACCAACGTGCAATCATGCTTCCTCCTGCAACTGCCCGTTCACCAGCCGTAAGCAGCGGTCGCAGCGCCGCCAGTTGCAGGTCGTGGGTCACCATAATCAACGTGGTGCCATGTTCACGGTTGAGGAAAACAGCAGGTCGGCAATTTTATCGCCCGTCTGGCGGTCAAGGTTGCCGGTTCGTCGGCAAACAGCATCAGGTCGACCATTAAAGGCTCGTGCCAGCGCCACTCGTTGCTGTTCACCGCCGGAAAGCTGTGCCGGAAGATGATCAGACGTTTACCCAGCCCTAACTGTTCGAGCAACGCTTTCGCCCCGTTACGACTTTCCGCGCTCTCACCGCGCAGCAGGCCGGAAGCTCGACGTTTTCCAGCGCGTTAAGGGTAGGAATTAACATAAATGACTGAAAAACAAAGCCGACGTGCTTCGCGCGCAACTTTGCCCGCGCTTCTTCGTCCATATTATGTGGCGGTTGTCCCCGGAGCTCACTTCGCCACTGCTGCCGTCATCAAGCCCGGCGAGGATCGCCAGCAAGGTTGACTTACGATCCCGACTCGCCCACCAGTGCGATGGTCTCGCCGTTTGACAACCAGCTCAACTCCGGTGAGGATGGAGAGTTCATGCTCCCTGACCGACGGACTTCTTAAGATGATGAACTTCAACAATGTTTTCCGCTGGCATTTGCCCTTCCTGTTCCTGGTCCCAGTTAACCTTCCGTGCCGCCGCAGCCGTTATTGATTCTGGGTGATAGCCTGAGCGCCGGGTATCGAATGTCTGCCAGCGCGGCCTGGCCTGCCTTGTTGAATGATAAGTGGCAGAGTAAACGTCGGTAGTTAATGCCAGCATCAGCGGCGACACCTCGCAACAAGGACTGGCGCCTTCCGGCTCTGCTGAAACAGCATCAGCCGCGTTGGGTGCTGGTTGAACTGGGGGCAATGACGGTTTGCGTGGTTTTCAGCCACAGCAAACCGAGCAAACGCTGCGCCAGATTTTGCAGGATGTCAAAGCCGCCAACGCTGAACCATTGTTAATGCAAATACGTCTGCCTGCAAACTATGGTCGCCGTTATAATGAAGCCTTTAGCGCCATTTACCCCAAACTCGCCAAAGAGTTTGATGTTCCGCTGCTGCCCTTTTTTATGGAAGAGGTCTACCTCAAGCCACAATGGATGCAGGATGACGGTATTCATCCCAACCGCGACGCCCAGCCGTTTATTGCCGACTGGATGGCGAAGCAGTTGCAGCCTTTAGTAAATCATGACTCATAAAGCAACGGAGATCCTGACAGGTAAAGTTATGCAAAAATCGGTTAATTACCGGATGTTCCAGTGGAATTGGCCTGGAGCGCTCGAATTAAAACGCCAGGGTTTTCATGCTGGCAGGTTGCCGGAAACCGGATGATGTTGAGCGCACGAACGGCATGGGATTTACCGGCGTGTTGATCGATCTGGATTCACCAGAAAGTGTTGATCGCGCAGCCGACGAGGTGATCGCCTGACCGATAATTGTCTGTATGGGATCTTTAACAATGCCGGATTCGGCATGTATGGCCCCTTTCCACCATCAGCCGTGCGCAGATGGAACAGCAGTTTCCGCCAACTTTTCGGCGCACACCAGCTCACCATGCGCCTGTTACCCGCGATGTTACCGCACGGTGAGGGCGTATTGTGATGACATCATCGGTGATGGGATTAATCTCCCGCCGGGTCGTGGCGCTTACGCGGCCAGTAAATATGCGCTGGAGGCGTGGTCAGATGCACTGCGCATGGAGCTGCGCCACAGCGGAATTAAAGTCAGCCTGATCGAACCCGGTCCCATTCGTACTCGCTTCACCGACAACGTCAACCAGACGCAAAGTGATAAACCAGTCGAAAATCCGGCATCGCCGCCCGCTACGTTGGGACCGGAAGCGGTGGTGGACAAAGTACGCCATGCTTTTATTAGCGAAGCCGAAGATGCGCTATCCGGTGACGCTGGTGACCTGGGCGGTAATGGTGCTTAAGCGCCTGCTGCCGGGGCGCGTAGATGGAGGTTAAACGCAAGCAGACGCCGAAGATAGAAACGG
+>0d624d4b-671f-40b8-9798-84f2ccc4d7fc id=14 clr=0,3790
+CTCTTCAGTATTACTTCGTTTCAGTACGTATTGCTTCTTGCCTGTCGCTCCTATCTTCGGCGTCTGCTTGGGTGTTTTAACCTCGGCTCCAGGTCATCTGCCGGGTGCTGCCGTCGCATCCGTTGTCGTCGCCGGTAACTCACTGTGCGCGTCATCGTAGCGGTAGCGTACTGTCTCCCCGCTGCGCGATGTCTCCGATACCAGCCTGCCCGGTTCATCATATTCCGGCGGCTCTCCAGCCCGTCCGGGGACACCACCGCCGTCAGCTGGTTCCGTCGTTATAGTAAAATTTCGTCTCCCGCCCGTCCGGTGTGGTGATGTCCGTGATATCGCCGGACACCACATTCAGACCGTACTCTGTCCTCCGTCCCGCCGCGTCCGTCTGCGCCGTGAGCCTTCCTGCCGCGTCATACCGCTGCGCGTGACGCTGCCGTCCGCCAGTTCTTTTTTCACCGTTTCAGCCCGGCCCCGCCTTCTGTATGCAGCACCTCACGCCGGTTCAGGCTGTCGGTGACGGTGATGCGGTCCTGCTCATAAAGATAGCGGTAGCTTAACCCTGCCGGGTTCAGTTGCTCCACCACCCGCCCCGTATCGTCGTAGCGGTAGCGCATCTCCGGCCTTCCCGCGTAACGGTGCGCCACCATCCGGCCCGGGTGCTGCGCGTCATACGTGACGCGCACCTGCGTATTGCTGCGGTCATATACCGCCAGCAGTTCACCGGCTTCCGTATGCGTGTACCGCACCAGTGGCGCAGCGGGCAGGCTCTCCGGGTATGCCGGGTCGTGCATCAGCCACACCGCCGAAAGGCGGATACCCTGTCGGGGCCGTATTCGGTACCGGGCGGTGTCGGGGAACGCTGAGGCTGAGAGGGGGGAACTGTCAGAAGAAGATAGCGAAGAGGTGGGCCTCTTCCGCGCTGCGCCTGCGTGGTCAGCACCAGACGGAACTCCCGCCCGGCACCGTCCGTCACGCCGGTGATTTCCCGGCCAGGTCACCGGCGGCCTCACGCCGGTACGTCAGCGTCCGCCCGAAGCGGTCCGCCATCCCGGTAAGCACCCGGTACGGCGGCAGCGGCGCTGGCAGTACGTCCTCAGCACCCGGCACCCGCTCAGACCACCCCAGTATCACGGCCCCTGTGCGCTGTTGGTCGCCAGGTAAAGATGCGGGCTTAACCGGATATCCGGCGGCAGCGCCCCCACAGCCGCGCCAGCGTATGGCCGTCCGGCTGTGCTGCCTTACCACCGCGCACCAGCCACATTGACTCACTGCGGCTGTACACCGCCTCCCCGGCAGCAGCGGCTCAAAGTGAATGCTCCGCCCGCCGTTGTCGTTGAGTATCAGTCCGTCATCACGTAGCTGTAAGCGGATATCAGAAGGCGCTTTCCAGCCGGGGCCGAAAACGCCCACCGGTGCAGGCGTCTTCGTCCGGTAGCTGCTGTAGGTGCGGGAGAGAATGAACGGCAGCGGGCCGGGCAGCGCAAGGTCCGTCTCGCCGGGCAGCACCTTCGCCCCAGCAGCGGATTTACCGGGTTGCCCGAAGTCATCCCGCCCGGACACACCGAGCACGCCACGCCGGTGGGCGCGCCAATTTTACACCTGCCGAACCCTGGACAATGGGACCGCCATACTGAGTCATATCTCCTGACGCGCCGCTGGTTTTCCGCTCATAAAGTGCCTTTTAGTTATTGTTCATATCCCTGTGTTAGCAACAAAAAATAAAATGACACACAAGACCAGCTAATGTATTTATATATTTTTCACATAAACTTATTTGTTCTCAATCAACAACAACTGTTATTACAGGTCACTTTCAATATTTTATTAAACTAACATTTTAGCACAGATGAATTCATCATCAACAAATTCACTATATGGATAATATCCATTCAACGCATATGATTTATGATTTTATTAGTCTGAGTTATTTTTGTAGGGCTATATTTAAAATCAATAAACTCCACCGATTCAGATTAATATCAGCAATAGAAAGATAGGAAATCACCAATTCAATAACATCATCAATGAAACATATTGTAGAATTAATTTAAACAAGGCGTTCCATTCAACCAGAACGCCCTTATTTACTCATCACCCGCAAACTGCCTGAACAGCGCCTTACCTTAACCAGTCGCGCAGCCAGCCGCCGAAAGCGACAGCAGCAGCGCTCCGCTGCACGGCAGAACAATCCACAATCGCCAGTCTGGCTCCCACGGAAAATCAAACACTTTCGCCTGCAACACTGCCAGCGCCGTTTCCGCACCAATTGCGGCCACCAGGCCGGAAACAAACCCAAGCATGGCGAACTCACACCACAACGTGGTACGCAGCAGTTTTTCCCGCACCGAGTGTGCGCCACACCACCAGCTCCTGATGACGCTGACGCATTCCCACCTGCACCTGTGCCAGCAACAGCAACATACCGCAGGCGGTGACCAGTACCACCATCACTTCCAGCGCCCGACTTACCTGCTCCAGCACCTGACCGACCTGTTTTAAAATCGCGCCAATATCTAACAGGCTAATGGTCGGGAACTGGCGGTTGAGTTGTGTCAACATGCCGTTGCCATTCTCCCAGCGGAAACTGGTAAGCCAGCTCTGCGGTTGCCCGTCTAATGCCCTTCAGGGAAAATAAAATAGAAATTAGGCCGCAGACTTTCCCAGTCCACTTTGCGCAGGCTGGTCACTTTAGCGCGGAACTCCTGGGTATCGCCCATAAAAGTCACGGTATCACCGAGGGCAACGTTTAAGCGTTTCGCCAGCCCCTCTTCCATCGACACTTCATCGGCTTTTGGCGGCCAGTTACCGGCGACAATCGGATTATGATCGGGCCGCGTATTTTGCCAGGTAAGATTGAGTTCGCGGTTAAGCGCCTCATCTTCATTACCTTCTGTCGGCTTATCGTTAATCGCCGTCAGCCGCGCCGCACCACCGGATAAAACGATTCCGGGACTATCTGATGTTCCGCGAACGCTTTAGCGGTGCTACCTGTTCTGTGGCGATGTTAATTAAAAAGTAGTTCGGGCTTTCTGGAGGTAGCTGCTGCTGCCAGCGGTCGAGCAGATCGCCACGCAACACCAGCAGCAGTGCCAGCAGCATAAAGGAGCGAAAATGCCGAAAGCTGACTTAACGTTGACCACGGCTGACGTAACAGGCGGCTAACCGCCAGGCGCAGAGGCAGCGATTTCAGCGTCATGCGGCGAAGTACATTCAGCAGCATCCAGCCCAGCACACCGCACAGCAAAGCCAGTACTACCGCGCCCGCCAGCACCGCCCAAAGCAGCATGCGCCACCCATTAATCCGGCGAGCAGCAGCACAACCACCACACTGACAATCGGCAGATAAAACTTCAGCGGCCAGACGTTCGCTACCACATCATTACGTAATACGCGTAAAGGCTGCGTTGCCAGCAACAAGCGATATGGTCGTAGCCCGCAGCGAGATGACCGTCATGGTGCCAAGCGCCCAGCCACGGCCAGAGGCTGGCTGGCGGTAGTGCAGCAGGCAGAACGGGCTTGAGCAGCACCATCAACACGTTTCGAACAACAGGCCTATGGCCCCACCGGTAACGGCTGAAAGCGTCAGCACCATCAACCACTGACCGACGATTAGCTTACGCAGTTGCGCTCGCCCTGCCCCCAGCGTTTTGAGGATCGCCACCAGATCGTAGCGACTGCGACAGTAATGATTCATCGCTACCGCCACCGCTGCCACTGCCAGCAGCAAGGTCAGAAGCGCCGAAAGCAGCGGGAACTGTTGCGAAACGCAAGCAGACGCTTACCCAATATCCGG
+>d4402dd6-1f80-4d82-9ce1-f4e7326e5054 id=15 clr=0,5654
+TTGGTACTTCGTTCAGTTATATGCTACTTGCCTGATCGCTCTTGCGCCATTGCGCCTGCGGGTTTTAATTTTTCACCGCTTCTTTCAGCGCCTGAACGACAAGTGTTGGTTCGAATAGCGCCAGTTGTTTACGACTCATATTCAGTGCTCACTCAATATCATCAGGAGAGATATTCACCGCCGGCGCCAGGGCGGGGATAAAGGTCAGTGCGCCAACCAGCAACACGGTGCCGATTAACAGGCCAACAAACAGCGGGCCGTGCGTTGGCATGCCGGAGCTGGCGGCTTGCTCTTTTACTCACCAGCGAACCGGCAATTGCCATCACCGGGATAATCACCCGAAGCGACCGACAAACATGCAGAACGCCAGTAAACAGTTCCAGAACGGAGAGTTGGCGCTTAATCCGGCAAAGGCGCTGCCGTTGTTGTTAGCGGCGGATGACACGGCGTACAGCACTTCCTTCGCCATGCGGGCCAGGGTTGAGCATGGCGCTACGTCCGGCGTCGGTCATCATCGCCAACGCCGCGCCCATCAGCACCAGCGTCGGGGTAACCAGAATTGCCAGTGCAGTCAGTTTCATCTCGCGTACGTCGATTTTTTACCCAGATATTCCGGTGTACGACCAATCATCAGCCCGGCAATAAACACCGCCAGCAGGACAAACAGCATCATGCCGTAAAGACCAGAACCGACACCGCCGAACACCACTTCACCAATTTGCATCAGCCACATCGGCACCATGCCACCGAGAGCGGTAAACGAATCATGCATCGCAATCACCGCGCCACAGGAAGCCGCCGTCGTCACGACCGCAAACAGGCTACTGACCAGCACGCCGAAACGGCTCTCTTTACCTTCCATATTGATGCTGCTGTCCGTGCCCAGTGCCAGCAGATGAGGATTACCCTGAACTTCTGCCCACATCACCACGCCTACGCAGATGACAAAATCACTGACATCGCCCACAGCAACATGCGCCCTGGCGGCGATCGCCCATCACTTCACCAAAGGCAAAGCACAGCGCCGTTGGGATCAAGAAGATCGCCAGCATCTGCACGAAGTTGGTCAGTGCGGTTGGGTTTTCAAACGGATGCGACGAGTTGGCATTAAAGAAGCCACCGCCGTTAGTACCGAGCATCTTGATCGCTTCCTGAGAAGCTACAGGCCCCATGGTAACAGCTGTTGCGCTCCTTCAACGGTATTCACAGCCTGATAAGGCAGAAAGTTTTGCAGCGCACCTTGTTGAATAAAAACAGTGCAATCAACAACGCCACAGGGACTAGCACCCATAACGTGATGCGTAGCAGATCGACTGAGCGTGCTCATGCTCTGGCGGGTAAACGCACGGATGAGGGCAAAATCACCGCAATCCGCTGGCGGCAGAAAGAAAGTTTTGCACCGTTAAGCCCGCCATCTGGCTGAAATAGCTCAACGTGGTTTCACCGCTATAAGATTGCCAGTTGGTATTGGTGACAAAGCTGACGGCGGTATTCAGCGCCAGATCCCACGACAGCCCTGGCAACTGCTGTGGATTAAGCGGCAGATAGTGCTGACCGAGCAACATAAAAACAGCACCGCCAGCCCCAGCATGTTCAGGCCGAGAATGGCACAAAGATATTGCTTCCAGTTCATCTCACGGTCAGAGACGCCAAGTGCGCGAAAAGTACGCGCTCAACGCCCGTTGTACCGGGAAGAGGAATGTCATTAATCAGCCGCGCCAGCTGCCTAAAGGACGCGCCAGCACCATTAACACCAGTAAAAACGTGGCGATCAGTAAGAACCCTTGCGCAGCCATCAGAACGCCTCCGCATTGATCAGGGCATAAACCAGATAACCCAGTAATAAAACACCAGCAATACGCCGGTTATCACGCCTGCACTCACAGTGCACCTCCAGTGGCCTAAAAGTGATACCGGAAGGGTAGAATTCTGGCTGCAAAGATTTCGCAAAATCTGCGGGCGGGGTGTAAAAAGTATAAAAATGGCAAAAGCCATGATTTAACTAATGTTTAGTATTAATTTAACTTTTGTGTAACTTAATTACAGGATGAATGTAAATAAACCATCAATAAGCAAAAAGTGGTCGGATGAGTAGTAAAATTACACAAAAGGCGGTACTATTTTCATCAGATAAACAAATTCATTTTTCGGTGCCATTCACCGGGTAGATACAAAGGGGAGAAAAGTATGGAACTCTACAGAGAATATCCTGCATGGCTTATCTTTTTACGCCGTACTTATGCGGTTGCAGCGGGCGTTCTGGCGCTGCCTTTCATGCTTTTCTGGAAAGACCGCGCCCGCTTTTACAGCTACCTGCATCGCGTCTGGTCGAAAACCAGCGATAAACCGGTGTGGATGGATCAGGCCGAAAAGGCAACTGGTGATTTTATTGATTGCTGAGTTTTGAATACATTGAAAACCGCCAGCGGAAACGCTGGCGGTTTTCAGGAAGATGTTCAGAGGAATATTTAGACATCGTTATACCAATCGAAACATATATTCATGAAATATATATAAATATTTTCCTAATTGTTCTTATCTGACAGATATCTCACTTAAGGCTTTCTTATAAATCTGTAGGGTTTCGCCTGTCAGCAGACAAATAACCCGATAAAACAAGGATGAGCAGATGAGCGGAAAACCGGCGGCGCGTCAGGGCGACATGACGCAGTATGGCGGTAGCATTGTCCAGGGTTCAGCCGGGGTACGCATCGGTGCCCCGGCGTGGCCTGTTCGGTGTGCCCCGGCGGTGACGTCCGGCCATCCGGTCAATCCGCTGCTCGGTGCAAAGGTCCTTCCCGGTGAAACCGACATCGCCCTGCCCGGCCCGCTGCCGTTCATTCTCTCCGCACCTACAGCAGTTACCGGACAAAACGCCCGCGCCGGTGGGGAGCCTCGGCCCCGGCTGGAAAATGCCTGCGGATATCCGCTTACAGCTGCGCGATAACACACTGATACTCAGTGATAACGGCGGCAGAAGCCTGTATTTTGAGCACCTGTTTCCCGGTGAGGACGGTTACAGCCGCAGCGAGTCACTGTGGCTGGTGCGCGGCGGCGTGGCGAAACTGGATGAAGGTCACCGGCTGGCCGCACTCTGGCAGGCGCCGGAAGAACTCCGCTTAAGTCCGCATCGTTATCTGGCGACAAACAGTCCGCAGGGGCCGTGGTGGCTGCTCGGCTGGTGTGAGCGGGTGCCGGAAGCGGATGCTGCCTGCGCCGCTGCCGCCGTACCGGGTACTGACCGGGCTGGTGGACCGCTTCGGGCGCACACAGACGTTCCACCGCGAAGCCGCCGGTGAATTCAGCGGCGAAATCACCGGCGTGACGGATGGTGCCGGGCGTCACTTCCGGCTGGTACTGACCACACAGGCGCAGCGGGCAGAAGAAGCCCGGCAGCAGGCCATTTCCGGCGGGACGGAACCGTCCGCTTTTCTGATACCCTGCCGGGTTACACCGAATATGGCCGGGACAACGGCATCCGTCTGTCTGCCGTGTGGCTGACGCACGACCCGGAATACCCGGAGAATTTACCTGCCGCGCCGCTGGTGCGCTATGGCTGGACGCCCGCGGCGAACTGGCGGCGGTGTATGACCGCAGCAATACACAGGTGCGCAGCTTTACTTACGATGATAAATACCGGGGCCGGATGGTGGCGCACCGTCACACGGGCCGACCGGAAATCTGTTACCGTTACGACAGCGACGGGCGGGTGACAGAACAGCTAAACCCGGCAGGCTTAAGTTACGTATCAGTATGAGAAGGACCGCATCACCATCACCGACAGCCTGAACCGCCGTGAAGTCCTGCACACGCAGGGTGAAGGCGGAAGCGGGTGGTGAAAAAGGAACACGCGGACGGCAGCGTCACGCAGAGTCAGTTTGACGCGGTGGGCAGGCTCAGGGCACAGACGGATGCCGCAGGCAGGACAACAGAATACAGTCCGGATGTGGTGACGGGCCTCATCGCGCACATCACCACGCCGGATGGCAGGGCATCGGCGTTTTACTATAACCACCACAGCCAGTTAACGTCAGCCACCGGGCCTGACGGGCTGGAAATACGCCGGGAATATGATGAATGGGGCCGTCTGATTCAGGAAACTGCCCCTGACGGCGATATCACCCGCTACCGTTATGATAATCCACACAGTGACTTACCCTGCGCAACGGAAGATGCCACCGGCAGCGGAAAACCATGACGTGGAGCCGTTACGGTCAGTTGCTGAGCTTCACTGACTGTTCCGGTTATGTAACCCGCTATGACCATGACCGTTTTGGTCAGGTGACGGCGGTGCACCGCGAGGAAGGGCTGAGTCAGTACCGCGCATACGACAGCCGTGGACAGTTAATTGCCGTGAAAGACACGCAGGGCCATGAAACGCGGTATGAATACAACGCCGCCGGTGACCTGACCACCGTCATTGCCCCGGACGGCAGCAGAAACGGGACACAGTACGATGCGTGGGGAAAAGCCATCTGTACCACGCAGGGCGGTCTGACGCGCAGTATGGAATACGATGCTGCCGGACGGGTCATCCGCCTGACCAGTGAAAACGGCAGCCACACCACCTTCCGTTACGATGTACTCGACCGGCTGATACAGGAAACCGGCTTTGACGGCCGCACACAGCGTTATCACCACGACCTGACCGGCAAACTTATCCGCAGCGAGGATGAGGGCTGGTCACCCACTGGCACTATGACGAAGCAGACCGCCTCACGCACCGCACCGTGAATGGCGAAACCGCAGAGCGGTGGCAGTATGACGAACGCGGCTGGCTGACAGACATCAGCCATATCAGCGAAGGGCACCGGGTGACGGTGCACTATGGTTATGACAGTAAAGGCCGCCTCGCCAGTGAACACCTGACGGTGCATCATCCGCAGACGAATGAACTGCTCTGGCAGCATGAGACCAGACATGCGTACAACGCACAGGGACTGGCGAACCGCTGTATACCGGACAGCCTGCCCGTGGAATGGCTGACCTACGGCAGCGGCTGGCTGTCAGGCATGAAACTCGGCGACACACCGCTGGTGGAGTACACCCGCGACCGCCTGCACCGGAAACGCTGCGCAGCTTCGGCCGTTATGAACTCACCACCGCTTATACCCTGCCGGGCAGTTACAGAGCCAGCACCTGAACAGCCTGCTGTCTGACCGCGATTACACCTGGAACGACAACGGCGAACTCATCCGCATCAGCAGCCCGCGCCAGACCCGGAGTTACAGCTACAGCACCACCGGCAGGCTGACCGGCGTTCACACCACCGCAGCGAATCTGGATATCCGCATCCCGTATACCACAGACCCGGCAGGTAACCGCCTGCCCGACCCGGAGCTGCACGGACAGCGCCCTCAGCATGTGGCCGGATAACCGTATCGCCCGTGACGCGCACTATCTTTACCGGTATGACCGTCACGGCAGGCTGACAGAAAACCGACCTCATCCCGGAAGGGTTATCCGCACGGATGATGAGCGCACCCACCGGTACCATTACGACAGTCAGCACCGGCTGGTGCACCGCGGACACAATATGCAGAGCCGCTGGTCGAAAGTCGCTATCTTTACGACCCGCTGGGCCGCAGGGTGGCAAAACGGGTATGGCGGCGTGAGGTTAACGCCGCAAACGGACATATGCCGAAGATAGGCGG
+>723b3ed8-ede7-42bd-89c3-d269619eea3d id=16 clr=0,9665
+TTGTTGTACTTCGTTCAGTTACGTATTGCTACTTGCCTGTCGCTCTCTATCTTCGGCGCGTCTGCTTGGGTGTTTAACCTTGCCGATCAGCGGAATATCAATACAACAATGCATACAGCTGGCGGCGATACTTCGACGCCAGTGCATCACCCGTACCCAGCGCAGGGATCTCCTGGAACGTTTTACGCGTCTGACCGTCTGCGGCGGTAGAGATCTTTACGCAGATGCCGAACAACAACTCCAGCGCCTCTTCATTGCGCCCAACCTGATGCAGTTGCAGCGCCCGGTTTGCGTCGCCAGTGCGGCATCTTCTGGATCTCCGCCACCTGCTGTTACAGCTGTTGAGATTTCCGGCGTATCAGCCGCCTGCTGGCACCAGTTCGGTTTGCGCCACCAGCCCCTGGCTGTAGGTGTCCTGATCCTGCAACGGAATGGTTTTCCAGCACCGCTTCCGCATCTTCAGAACGGTTCAGCGCAATCCAGCGTTTCTGCCAGCAGCAGGCCGATCTCCCCGTTCTGATTCGACAACTGCCGGGCGTCTTTCAGCAATAGCGGGGCATCGGTGTAATTGCTTTCCTGCATCAGTTGCATCGCCTGCTGCGCTTTCATTCTTCTTCGCGCAGCAGCACTTTATCCAACAGGGCGCGGATCGCCTCTTCCGGTTGCGGGCCTGGAAGCCATCCACCGGTTGCCGTTCTGGAACCGAATGCACGAGGTCGGAATCACGCAGACCAAACTGCGCGGCAATCATCTGCTCCGCGTCGCAGTCAACTTCGCCAGAATAAATTGCCCGTTGTACTGCGCCGCGAGGCACCAGGAGTGGGTTAACTGCACCGTAGTGCTGGCTACGTTCAGACCAAAATAGAACAGCACCGGAGTGGTCATCGACTGTTCAGAACCTGTTGCAGGTTAGATTCGTTAATGTTGACAATATTTTCTACGGACATGGAGTCGCTCTCTGTTGTCGATATTTTCTTTGACATGGGGGCTTAAGCGCGCTTCAACTCACCTGCAATATTTTGTCCATCACGCGCCCCGGCAGCAGGCGCTTAAGCACCATTACCGCCCAGGTCACCAGCGTCACCGGATAGCGCATCTTCGGCTTCTCGCTAATAAAAGCATGGCGTACTTTGTCCACCACCGCTTCCGGTCCCAACGTAAAGCGGGCGGCGATGCCGGGATTTTCGACTGGTTTATCACTTTGCGTCTGGTTGACGTTGTCGGTGAAGCGAGTACGAATGGGACCGGGTTCGATCAGGCTGACTTTAATTCCGCTGTGGCGCAGCTCCATGCGCAGTGCATCTGACCACGCCTCCAGCGCATATTTACTGGCCGCGTAAGCGCCACGACCCGGCATTGAGATTAATCCCATCACCGATGATGTCATCACAATACGCCCTTCACCGTGCGGTAACATCGCGGGTAACAGGCGCATGGTGAGCTGGTGTGCGCCGAAAAGTTGGCGGAAACTGCTGTTCCATCTGCGCACGGCTGATGGTGGAAAGGGCCATACATGCCGAATCCGGCATTGTTAAAGATCCCATACAGACAGGTATCGGTCAGGGCGATCACCTCGTCGGCTGCGCGATCAACACTTTCTGGTGAATCCAGATCGATCAACACGCCGGTAAATCCCATGCTGTTCGCGCGCTCAACATCATCCGGTTTCCGGCAACCTGCCAGCGACGAAAACCCTGGCGTTTTAATTCGAGCGCGCTTTCCAGGCCAATTCCACTGGAACATCCGGTAATTAAGACCGATTTTTGCATAACTTTACCTGTCAGGGATCTCCGTTGCTTTATGAGTCATGATTTACTAAGGCTGCAACTGCTTCGCCATCCAGTCGGCAATAAACGGCTGGGCGTCGCGGTTGGGATGAATACCGTCATCCTGCATCCATTGTGGCTTGTGGAGCCTCTTCCATAAAAAGGGCAGCAGCGGAACATCAAACTCTTTGGCGAGTTTGGGGTAAATGGCGCTAAAGGCTTCATTATAACGGCGACCATAGTTTGCAGGCAGACGTATTTGCATTAACAATGGTTCAGCGTTGGCGGCTTTGACATCCTGCAAAATCTGGCGCAGCGTTTGCTCGGTTTGCTGTGGCTGAAAACCACGCAAACCGTCATTGCCGCCAGTTCAACCAACCCAACGCGGCTGATGCTGTTTCAGCAGAGCCGGAAGGCGCGCCAGTCCTTGTTGCGAGGTGTCGCCGCTGATGCTGGCATTAACTACCGACGTTTTTACTCTGCCACTTATCATTCAACAAGGCAGGCCAGGCCGCGCTGGCAGACATTCGATACCCGGCGCTCAGGCTATCACCCAGAATCAATAACGTGTCCTGCGGCGTACGGGAAGGTTAATGGGACCAGGAACAGGAAGGGCAAATGCCAGCGGAAAACATTGTTGAAGTTCATCATCTTAAGAAGTCCGTCGGTCAGGGAGCATGAACTCTCATCCTCACCGGAGTTGAGCTGGTTGTCAAACGTGCGAGACCATCGCACTGGTGGGCGAGTCGGATCGGTAAGTCAACCTTGCTGGCGATCCTCGCCGGGCTTGATGACGGCAGCAGTGGCGAAGTGAGTCTGGTGGACAACCGCTACATAATATGGACGAAGCGCGGGCAAAGTTGCGCGCGAAGCACGTCGGCTTTGTTTTTCAGTCATTTATGTTAATTCCTACCCTTAACGCGCTGGAAAACGTCGAGCTTCCGGCTCTGCTGCGCGGTGAGTAGCGCGGAAAGTCGTAACGGGGCGAAAGCGTTGCTCGAACAGTTAGGGCTGGGTAAACGTCTGATCATCTTCCGGCACAGCTTTCCGGCGGTGAACAGCAACGAGTGGCGCTGGCACGAGCCTTTAATGGTCGACCTGATGTGCTGTTTGCCGACGAACCCACCGGCAACCTTGACCGCCAGACGGGCGATAAAATTGCCGACCTGCTGTTTTCCTCAACCGTGAACATGGCACCACGTTGATTATGGTGACCCACGACCTGCAACTGGCGGCACGCTGCGACCGCTGCTTACGGCTGGTGAACGGGCAGTTGCAGGAGGAAGCATGATTGCACGTTGGTTCTGGCGCGAATGGCGTTCGCCGTCGCTATTAATTGTCTGGCTGGCGCTAAGCCTGGCGGTGGCCTGCGTGCTGGCGCTGGGCAATATCAGCGATCGCATGGAGAAGGGCTTAAGCCAGCAAAGCCGTGAGTTTATGGCGGGCGATCGGGCGTTGCGCAGTTCACGCGAAGTGCCGCAAGCGTGGCTGGAGGAAGCGCAAAGCGCGGCCTGAAAGTCGGCAAAGCTGACTTTCGCCACAATGACCTTTGCAGGCGACACACCGCAGCTGGCGAACGTCAAAGCGGTGGATGATATCTACCCGATGTATGGCGATCTGCAAACTAATCCCCTGGCCTGAAACCGCAGGCGGGCAGCGTATTGCTGGCCCCACGCCTGATGGCACTGCTTAACCTGAAAACGGGCGACACCATTGACGTGGGCGATGCCACCTTGCGGATTGCCGGAGAAGTGATTCAGGAACCGGATTCCGGTTTTAACCCTTCCAGATGGCTCCGCGTCTGATGATGAATCTGGCGGATGTCGATAAAACCGGAGCCGTGCAGCCGGAGTCGGGTCACCTGGCGTTATAAATTCGGCGGCAACGAGAACCAGCTCGACGGCTATGAGAAATGGTTGTTACCCCTCAGCTTAAACCCGAACAACGCTGGTACGGTCTGGAACAGGACGAAGGCGCGCTGGGGCGATCGATGGAACGCTCGCAACAGTTCCTGCTGCTTTCGGCGCTTCTGACCTTGCTGCTGGCAGTGGCAGCGGTGGCGGTAGCGATGAATCATTACTGTCGCAGTCGCTACGATCTGGTGGCGATCCTCAAAACGCTGGGGGCAGGGCGAGCGCAACTGCGCGTAAGCTAATCGTCGGTCAGTGGTTGATGGTGCTGACGCTTTCAGCCGTTACCGGTGGGGCCATAGGCCTGTTGTTCGAAACGTGTTGATGGTGCTGCTCAAGCCCGTTCTGCCTGCTGCACTACCGCCAGCCAGCCTCTGGCCGTGGCTGTGGGCGCTTGGCACCATGACGGTCATCTCGCTGCTGGTGGGGCTACGACCATATCGCTTGTTGCTGGCAACGCAGCCTTTACGCGTATTACGTAATGATGTGGTAGCGAACGTCTGGCCGCTGAAGTTTTATCTGCCGATTGTCAGTGTGGTGGTTGTGCTGCTGCTCGCCGGATTAATGGGTGGCAGCATGCTGCTTTGGGCGGTGCTGGCGGGCGCGGTAGTACTGGCTTTGCTGTGCGGTGTGCTGGGCTGGATGCTGCTGAATGTACTTCGCCGCATGACGCTGAAATCGCTGCCTCTCTGCGCCTGGCGGTTAGCCGCCTGTTACGTCAGCCGTGGTCAACGTTAAGTCAGCTTTCGGCATTTTCGCTCTCCTTTATGCTGCTGGCACTGCTGCTGGTGTTGCGTGGCGATCTGCTCGACCGCTGGCAGCAGCAGCTACCTCAAGAAAGCCCGAACTACTTTTTAATTAACATCGCCACAGAACAGGTAGCACCGCTAAAGCGTTCCTCGCGGAACATCAGATAGTCCCGGAATCGTTTTATCCGGTGGTGCGGGCGCGGCTGACGGCGATTAACGATAAGCCGACAGAAGGTAATGAAGATGAGGCGCTTAACCGCGAACTCAATCTTACCTGGCAAAATACGCGGCCCGATCATAATCCGATTGTCGCCGGTAACTGGCCGCCAAAAGCCGATGAAGTGTCGATGGAAGAGGGGCTGGCGAAACGCTTAAACGTTGCCCTCGGTGATACCGTGACTTTTATGGGCGATACCCAGGAGTTCCGCGCTAAAGTGACCAGCCTGCGCAAAGTGGACTGGGAAAGTCTGCGGCCTAATTTCTATTTTATTTTCCCTGAAGGGCATTAGACGGGCAACCGCAGAGCTGGCTTACCAGTTTCCGCTGGGAGAATGGCAACGGCATGTTGACACAACTCAACCGCCAGTTCCCGACCATTAGCCTGTTAGATATTGGCGCGATTTTTAAAACAGGTCGGTCAGGTGCTGGAGCAGGTAAGTCGGGCGCTGGAAGTGATGGTGGTACTGGTCACCGCCTGCGGTATGTTGCTGTTGCTGGCACAGGTGCAGGTGGGAATGCGTCAGCGTCATCAGGAGCTGGTGGTGTGGCGCACACTCGGTGCGGGAAAAACTGCTGCGTACCACGTTGTGGTGTGAGTTCGCCATGCTTGGGTTTGTTTCCGGCCTGGTGGCCGCAATTGGTGCGGAAACGGCGCTGGCAGTGTGTGCAGGCGAAAGTGTTTGATTTTCCGTGGGAGCCAGACTGGCGATTGTGGATTGTTCTGCCGTGCAGCGGGCGCTGCTGCTGTCGCTTTCGGCGGCTGGCTGGGTGCGCGACTGGTTAAGGGTAAGGCGCTGTTCAGGCAGTTTGCGGGGTGATGAGAGTAAATAAGGGCGTTCTGGTTGAATGGAACGCCTTGTTTAAATTAATTCTACAATATGTTTCATTGATGATGTTATTGAATTGGTGATTTCCTATCTTTCTATTGCTGATATTAATCTGAATCGGTGGAGTTTATTGATTTTAAATATAGCCCTACAAAAATAACTCAGACTAATAAAATCATAAATCATATGCGTTGAATGGATATTATCCATATAGTGAATTTGTTGATGATGAATTCATCTGTGCTAAAAATGTTAGTTTAATAAAATATTGAAAGTGACCTGTAATAACAGTTGTTGTTGATTGAGAACAAATAAGTTTATGAAAAAATATATAAATACATTAGCTGGTCTTGTGTGTCATTTTATTTTTTGTTGCTAACACAGGGATATGAACAATAACTAAAGGGCACTTTATGAGCGGAAAACCAGCGGCGCGTCAGGAGATATGACTCAGTATGGCGGTCCCATTGTCCAGGGTTCGGCAGGTGTAAAATTGGCGCGCCCACCGGCGTGGCGTGCTCGGTGTGTCCGGGCGGGATGACTTCGGGCAACCCGGTAAATCCGCTGCTGGGGGCGAAGGTGCTGCCCGGCGAGACGGACCTTGCGCTGCCCGGCCCGCTGCCGTTCATTCTCTCCCGCACCTACAGCAGCTACCGGACGAAGACGCCTGCACCGGTGGGCGTTTTCGGCCCCGGCTGGAAAGCGCCTTCTGATATCCGCTTACAGCTACGTGATGACGGACTGATACTCAACGACAACGGCGGGCGGAGCATTCACTTTGAGCCGCTGCTGCCGCGGTGTACAGCCGCAGTGAGTCAATGTGGCTGGTGCGCGGTGGTAAGGCAGCACAGCCGGACGGCCATACGCTGGCGCGGCTGTGGGGGCGCTGCCGCCGGATATCCGGTTAAGCCCGCATCTTTACCTGGCGACCAACAGCGCACAGGGGCCGTGGTGATACTGGGGTGGTCTGAGCGGGTGCCGGGTGCTGAGGACGTACTGCCAGCGCCGCTGCCGCCGTACCGGGTGCTTACCGGGATGGCGGACCGCTTCGGGCGGACGCTGACGTACCGGCGTGAGGCCGCCGGTGACCTGGCCGGGAAATCACCGGCGTGACGGACGGTGCCGGGCGGGAGTTCCGTCTGGTGCTGACCACGCAGGCGCAGCGTGCGGAAGAGGCCCACCTCTTCGCTATCTTCTTCTGACAGTTCCCGCCCTCTCAGCCTCAGCGTTCCCCGACACTGCCCGGTACCGAATACGGCCCCGACAGGGTATCCGCCTTTCGGCGGTGTGGCTGATGCACGACCCGGCATACCCGGAGAGCCTGCCCGCTGCGCCACTGGTGCGGTACACGTATACGGAAGCCGGTGAACTGCTGGCGGTATATGACCGCAGCAATACGCAGGTGCGCGCTTTCGTATGACGCGCAGCACGGGCCGGATGGTGGCGCACCGTTACGCGGGAAGGCCGGAGATGCGCTACCGCTACGACGATACGGGGCGGTGGTGGAGCAACTGAACCCGGCAGGGTTAAGCTACCGCTATCTTTATGAGCAGGACCGCATCACCGTCACCGACAGCCTGAACCGGCGTGAGGTGCTGCATACAGAAGGCGGGGCCGGGCTGAAACGGGTGGTGAAAAAGAACTGGCGGACGGCAGCGTCACGCGCAGCGGGTATGACGCGGCAGGAAGGCTCACGGCGCAGACGGACGCGGCGGGACGGAGGACAGAGTACGGTCTGAATGTGGTGTCCGGCGATATCACGGACATCACCACACCGGACGGGCGGGAGACGAAATTTTACTATAACGACGGGAACCAGCTGACGGCGGTTGTCCCCGGACGGGCTGGAGAGCCGCCGGGAATATGATGAACCGGGCAGGCTGGTATCGGAGACATCGCGCAGCGGGGAGACAGTACGCTACCGCTACGATGACGCGCACAGTGAGTTACCGGCGACGACAACGGATGCGACGGGCAGCACCAACAGATGACCTGGAGCCGCTACGGGCAGTTGCTGGCGTTCACCGACTGCTCAGGCTACCAGACCCGTTATGAATACGACCGCTTCGGCCAGATGACGGCGGTCCACCGCGAGGCATCAGCCTTTACCGCCGCTATGACAACCGTGGCCGGTTAACCTCGGTGAAAGACGCACAGGGCCGTGAAACGCGGTATGAATACAACGCCGCAGGCGACCTGACTGCCGTTATCACCCCGGACGGCAACCGGGCGAGACACAGTACGATGCGTGGGGAAAGGCGGTCAGCACCACGCAGGGCGGGCTGACGCGCAGTATGGAGTTACGATGCTGCCGGACGTGTCATCAGCCTGACCAACGAGAACGGCAGCCACAGCGTCTTCAGTTACGATGCGCTGGACCGGCTGGTACAGCAGGGCGGCTTTGACGGGCGGACGCAACGTTATCATTATGACCTGACCGGAAAACTCACACCAGAGTGAGGATGAGGACTTGTCATCCTCTGGTACTACGATGAATCGGACCGTATCACTCACCGCACGGTGAACGGCGAACCGGCAGAGCAGTGGCAGTATGATGGCCACGGCTGGCTGACAGACATCAGCCACCTGAGCGAAGGCCACCGTGTTGCCGTCCACTATGGCTATGACGATAAGGCCGCCTGACCGGCGATGCCAGACGGTGGAGAACCGGAGACGGGGAACTGCTGTGGCAGCATGAGACGAAAACACGCATACAACGAGCAGGGCTGGCAAACCGCGTCACGCCGGACAGCCTGCCGCCGGTGGAGTGGCTGACGTATGGCAGCGGTTACCTGGCGGAGATGAAGCTGGGCGGACGCCGCTGGTCAGTATACGCGGGACAGGCTGCACCGTGAGACGGTGCGCAGCTTCGGCAGCATGGCAGGCAGTAATGCCGCATACGAACTGACCAGCACATACACCCCGCAGGCCAGTTACAGAGCCAGCACCTGAACAGCCTGGTATATGACCGTGACTACGGGTGGGTGACAACGGCGACCTGGTGCGCATCAGCGGCCCGCGACAGACGCGGGAATACGGCTACAGCGCCACAGGGCAGGCTGGAGAGTATGCGCACCCTCGCACCAGACCTGGACATCCGCATCCCGTATGCCCACGGACCCGGCGGGCAACCGGCTGCGGACCCGAGCTGCACCCGGACGGAAGCACTCCTCACAGTGTGGCCGGATAACCGCATCGCGGAGGATGCGCACTATGTCTACCGCCACGATGAATACGGCAGGCTGACGGAAGAAGACGGACCGCATCCCGGCGGGTGTGATACGGACGGACGACGAGCGGACCCACCACTACCACTACGACAGCCAGCACCGCCTGGTGTTCTACGCGGATACAGCATGGCGAGCCACTGGTCGAGAGCCGCTACCTCTACGACCCGCTGGGACGGCGAATGGCAAAACAGGTCTGGCGGCGGAGCGTGACCTGGCAAGGGTGGATGTCGCTGTCGCGTAAACCGGAGGTGACGTGGTATGGCTGGGACGGAGACAGGCTGACGACGGTGCAGACTGACACCACACGTATCCAGACGGTATACGAGCCGGGAAGCTTCACGCCGCTCATCAGGTCGAGACAGAGAACGGCGAGCGGAAAAAGCGCGCAACGGCGCAGCCTGGCAAGAGACGCTCCAGCAGGAAGGAGTGAGAACGGCCACGGCGTGGTGGTTTCCCGGCTGAACTGGTGCGGCTGCTGGACAGGCTGGAGGAAGAAATCCGGAGCGAACCGCGTGAGCAGTAGAAAGCCGGGCGTGGCTGCACAGTGCGGGCTGACGGTGGAGCAACTGGCCAGACAGGTGGAGCGGAATACACACCGGCGCGAAAAGCTCATCTTTATCACTGCGACCACCGGGGACTGCCGCTGGCGCTTATCGCGAAGACGGCAATACGGCGTGCTGCGCGGAATATGATGAAATTAGGGCAACCAACTTAATGAAAGGAGAACCCGCATCATGTGTATCCTCAGCGTACCGTCTGCCAGGGCAGCAGCATGATGAGAATCAGGGCTATTATATAACCGTCACCGGTACTACGATCCGTTGCAGGGGCGGTATATTACTCAGGGACCCGATGGGGTTGAAGGGGATGGAATTTATATCAGTATCTTTAAATCAGGTTAAACACCCAAAGCAGACGCCGAAGATAAGAGGCGACAGGCAAGTAGCAATACGTAACCCACCAA
+>98eef8ef-3499-4c27-9191-9420b864869c id=17 clr=0,4208
+TTGCTTATTACTTCGTTCCAGTTACGTATTGCTTTTCTGTTGGTGCTGATATTGCGGCGTCTGTTGGGTGTTAACCTTTTTCTGCCAGCTCACCGGTGGCGGTTTCAACCCTGATGAGTGGCGTGAAGCTCCCCGGCTGATAAATCGTCTGGATGCGGGTTCTGTCGTTCTGTATCGTGGTCAGGCGGTCGCCGTCCCAGCCGTACCAGGTCACTTGCGGTTTCCGTGACAGCGACATCCAGCCCGTCAGGTCCCGTTCACGCCGCCATACCCGTTTTGCCACCCTGCGGCCCAGCGGGTCGTAAAGATAGCGACTTTCGACCAGCGGCTCTGCATATTGTGTCCGCGTGGTGCAGCCAGCCGGTGCTGACTGTCGTAATGGTACCGGTGGGTGCGCTCATCATCCGTGCGGATAACCCTTCCGGGATGAGGTCGGTTTTCTCTGTCAGCCTGCCGTGACGGTCATACCGGTAAAGATAGTGCGCGTCACGGGCGATACGGTTATCCGGCCACATGCTGAGGGCGCTGTCCGGTGCAGCTCCGGGTCGGGCAGGCGGTTACCTGCCGGGTCTGTGGTATACGGGATGCGGATATCCAGATTCGCTGCGGTGGTGTGAACGCCGGTCAGCCTGCCGGTGGTGCTGTAGCTGTAACTCCGGGTCTGGCGCGGGCTGCTGATGCGGATGAGTTCGCCGTTGTCGTTCCAGGTGTAATCGCGGTCAGACAGCAGGCTGTTCAGGTGCTGGCTCTGTAACTGCCCGGCAGGGTATAAGCGGTGGTGAGTTCATAACGGCCGAAGCTGCGCAGCGTTTCCCGGTGCAGGCGGTCGCGGGTGTACTCCACCAGCGGTGTGTCGCCGAGTTTCATGCCTGACAGCCAGCCGCTGCCGTAGGTCAGCCATTCCACGGCGGGCAGGCTGTCCGGTATACAGCGGTTCGCCAGTCCTGTGCGTTGTACGCATGTCTGGTCTCATGCTGCCAGAGCAGTTCATTCGTCTGCGGATGATGCACCGTCAGGTGTTCACTGGCGAGGCGGCCTTTACTGTCATAACCATAGTGCACCGTCACCCGGTGCCCTTCGCTGATATGGCTGATGTCTGTCAGCCAGCCGCGTTCGTCATACTGCCACCGCTCTGCGGTTTCGCCATTCACGGTGCGGTGCGTGAGGCGGTCTGCTTCGTCATAGTGCCAGTGGGTGACCAGCCCTCATCCTCGCTGCGGATAAGTTTGCCGGTCAGGTCGTGGTGATAACGCTGTGTGCGGCCGTCAAAGCCGGTTTCCTGTATCAGCCGGTCGAGTACATCGTAACGGAAGGTGGTGTGGCTGCCGTTTTCACTGGTCAGGCGGATGACCCGTCCGGCAGCATCGTATTCCATACTGCGCGTCAGACCGCCCTGCGTGGTACAGATGGCTTTCCCCACGCATCGTACTGTGTCCCGTTTCTGCTGCCGTCCGGGGCAATGACGGTGGTCAGGTCACCGGCGGCGTTGTATTCATACCGCGTTTCATGGCCCTGCGTGTCTTTCACGGCAATTAACTGTCCACGGCTGTCGTATGCGCGGTACTGACTCAGCCCTTCCTCGCGGTGCACCGCCGTCACCTGACCAAAACGGTCATGGTCATAGCGGGTTACATAACCGGAACAGTCAGTGAAGCTCAGCAACTGACCGTAACGGCTCCACGTCATGGTTTTCCGGCTGCCGGTGGCATCTTCCGTTGCGCAGGGTAAGTCACTGTGTGGATTATCATAACGGTAGCGGGTGATATCGCCGTCAGGGGCAGTTTCCTGAATCAGACGGCCCCATTCATCATATTCCCGGCGTATTTCCAGCCCGTCAGGCCCGGTGGCTGACGTTAACTGGCTGTGGTGGTTATAGTAAAACGCCGATGCCCTGCCATCCGGCGTGGTGATGCGCGTGATGAGGCCCGTCACCACATCCGGACTGTATTCTGTTGTCCTGCCTGCGGCATCCGTCTGTGCCCTGAGCCTGCCCACCGCGTCAAACTGACTCTGCGTGACGCTGCCGTCCGCGTGTTCCTTTTCACCACCCGCTTCAGCCCGCCTTCACCCTGCGTGTGCAGGACTTCACGGCGGTTCAGGCTGTCGGTGATGGTGATGCGGTCCTTCTCATACTGATACGTGTAACTTAAGCCTGCCGGGTTTAGCTGTTCTGTCACCCGCCCGTCGCTGTCGTAACGGTAACAGATTTCCGGTCGGCCCGTGTGACGGTGCGCCACCATCCGGCCCCGGTATTTATCATCGTAAGTAAAGCTGCGCTGTGTATTGCTGCGGTCATACACCGCCGCCAGTTCGCCGCGGGGCGTCCAGCCATAGCGCACCAGCGGCGCGGCAGGTAAATTCTCCGGGTATTCCGGGTCGTGCGTCAGCCACACGGCAGACAGACGGATGCCGTTGTCCCGGCCATATTCGGTGTAACCCGGCAGGGTATCAGGAAAAGCGGACGGTTCCGTCCCGCCGGAAATGGCCTGCTGCCGGGCTTCTTCTGCCCGCTGCGCCTGCGTGGTCAGTACCAGGAAGTGACGCCCGGCACCATCCGTCACGCCGGTGATTTCGCCGCTGAATTCACCGGCGGCTTCGCGGTGGAACGTCTGTGTGCGCCCGAAGCGGTCCACCAGCCCGGTCAGTACCCGGTACGGCGGCAGCGGCGCAGGCAGCACCTCATCCGCTTCCGGCACCCGCTCACACCAGCCGAGCAGCCACCACGGCCCCTGCGGACTGTTTGTCGCCAGATAACGATGCGGACTTAAGCGGAGTTCTTCCGGCAGCGCCTGCCAGAGTGCGGGCCGGTGACCTTCATCCAGTTTCGCCACGCCGCCGCGCACCAGCCACAGTGACTCGCTGCGGCTGTAACCGTCCTCACCGGGAAACAGGTGCTCAAAATACAGGCTTCTGCCGCCGTTATCACTGAGTATCAGTGTGTTATCGCGCAGCTGTAAGCGGATATCCGCAGGCATTTTCCAGCCGGGGCCGAGGCTCCCCACCGGCGCGGGCGTTTTGTCCGGTAACTGCTGTAGGTGCGGGAGAATGAACGGCAGCGGGCCGGGCAGGGCGATGTCGGTTTCACCGGGAAGGACCTTTGCACCGAGCAGCGGATTGACCGGATGGCCGGACGTCACCCGCCGGGGCACACCGAACAGGCCACGCCGGTGGGGCACCGATGCGTACCCCGGCTGAACCCTGGACAATGCTACCGCCATACTGCGTCATGTCGCCCTGACGCGCCGCCGGTTTTCCGCTCATCTGCTCATCCTTGTTTTATCGGGTTATTTGTCTGCTGACAGGCGAAACCCTACAGATTTATAAGAAAGCCTTAAGTGAGATATCTGTCAGATAAGAACAATTAGGAAAATATTTATATATATTTCATGAATATATGTTTCGATTGGTATAACGATGTCTAAATATTCCTCTGAACATCTTCCTGATACAAAAACCGCCAGCGTTTCCGCTGGCGGTTTTCAATATTCAAAACTCAGCAATCAATAAAATCACCAGTTGCCTTTTCGGCCTGATCCATCCACACCGGTTTATCGCTGGTTTTCGACCAGACGCGATGCAGGTAGCTGTAAAAGCGGGCGCGGTCTTTCCAGAAAAGCATGAAAGGCAGCGCCAGAACGCCCGCTGCAACCGCATAAGTACGGCGTAAAAGATAAGCCATGCAGGATATTCTCTGTAGAGTTCCATACTTTCTCCCCTTTTATCTACCCGGTGAATGGCACCGGAAAAATGAATTTGTTTATCTGATGAAAATAGTACCGCCTTTTGTGTAATTTTACTACTCATCCGACCACTTATTTTTGCTTATTGATGGTTTATTTACATTCATCCTGTAATTAAGTTACACAAAGTTAAATTAATACTAAACATTAGTTAAATCATGGCTTTTGCCATTTTATACTTTTACACCCCGCCCGCAGATTTTGCGAAATCTTTGCAGCCAGAATTCTACCCTTCCGGTATCACTTTTAGGCCACTGGAGTGCACTGTGAGTGCAGGCGTGATAACCGGCGTATTGCTGGTGTTTTATTACTGGGTTATCTGGTTTATGCCCTGATCAATGCGGAGGCGTTCTGATGGCTGCGCAAGGGTTCTTACTGATCGCCACGTTTTTACTGGTGTTGGTGCTGGCGCGTGCTGGCGCGTCCTTTAGGTCAAACACCGGCAGACGCCGAGATGGAGCACACGCC
+>0a238451-b9ed-446d-a152-badd074006c4 id=18 clr=0,9443
+TTAAAAACTCGGTATGCTTCGTTCGGTTACGTATTACTACTTGCCTGTCGGCTCTATCTTCGGCGTCTGCTTGGCAGCTGACTTTCGCTCAATGACCTTTGCAGGCGACACACCGCAGCTGGCGAACGTCAAAGCGGTGGATGATATCTACCCGATGTATGGCGATCTGCAAACTAATCCCCTGGCCTGAAACCGCAGGCGGGCAGCGTATTGCTGGCCCCACGCCTGATGGCACTGCTTAACCTGAAAACGGGCGACACCATTGACGTGGGCGATGCCACCTTGCGGATTGCCGGAGAAGTGATTCAGGAACCGGATTCCGGTTTTAACCCTTCCAGATGGCTCCGCGTCTGATGATGAATCTGGCGGATGTCGATAAAACCGGAGCCGTGCAGCCGAGAGTCGGGTCACCTGGCGTTATAAATTCGGCGGCAACGAGAACCAGCTCGACGGCTATGAGAAATGGTTGTTACCTCGGCTTAAACCCGAACAACGCTGGTACGGTCTGGAACAGGACGAAGGCGCGCTGGGGCGATCGATGGAACGCTCGCAACAGTTCCTGCTGCTTTCGGCGCTTCTGACCTTGCTGCTGGGCAGTGGCGCGGTGGCGGTAGCGATGAATCATTACTGTCGCAGTCGCTACGATCTGGTGGCGATCCTCAAAACGCTGGGGGCAGGGCGAGCGCAACTGCGTAAGCTAATCGTCGGTCAGTGGTTGATGGTGCTGACGCTTTCAGCCGTTACCGGTGGGGCCATAGGCCTGTTGTTCGAAACGTGTTGATGGTGCTGCTCAAGCCCGTTCTGCCTGCTGCACTACCGCCAGCCAGCCTCTGGCCGTGGCTGTGGGCGCTTGGCACCATGACGGTCATCTCGCTGCTGGTGGGGCTACGACCATATCGCTTGTTGCTGGCAACGCAGCCTTTACGCGTATTATGATGTGGTAGCGAACGTCTGGCCGCTGAAGTTTTATCTGCCGATTGTCAGTGTGGTGGTTGTGCTGCTGCTCGCCGGATTAATGGGTGGCAGCATGCTGCTTTGGGCGGTGCTGGCGGGCGCGGTAGTACTGGCTTTGCTGTGCGGTGTGCTGGGCTGGATGCTGCTGAATGTACTTCGCCGCATGACGCTGAAATCGCTGCCTCTGCGCCTGGCGGTTAGCCGCCTGTTACGTCAGCCGTGGTCAACGTTAAGTCAGCTTTCGGCATTTTCGCTCTCCTTTATGCTGCTGGCACTGCTGCTGGTGTTGCGTGGCGATCTGCTCGACCGCTGGCAGCAGCAGCTACCTCCAGCCCGAACTACTTTTTAATTAACATCGCCACAGAACAGGTAGCACCGCTAAAGGCGTTCCTCGCGGAACATCAGATAGTCCCGGAATCGTTTTATCCGGTGGTGCGGGCGCGGCTGACGGCGATTAACGATAAGCCGACAGAAGGTAATGAAGATGAGGCGCTTAACCGCGAACTCAATCTTACCTGGCAAAATACGCGGCCCGATCATAATCCGATTGTCGCCGGTAACTGGCCGCCAAAAGCCGATGAAGTGTCGATGGAAGAGGGGCTGGCGAAACGCTTAAACGTTGCCCTCGGTGATACCGTGACTTTTATGGGCGATACCCAGGAGTTCCGCGCTAAAGTGACCAGCCTGCGCAAAGTGGACTGGGAAAGTCTGCGGCCTAATTTCTATTTTATTTTCCCTGAAGGGCATTAGACGGGCAACCGCAGAGCTGGCTTACCAGTTTCCGCTGGGAGAATGGCAACGGCATGTTGACACAACTCAACCGCCAGTTCCCGACCATTAGCCTGTTAGATATTGGCGCGATTTTAAAACAGGTCGGTCAGGTGCTGGAGCAGGTAAGTCGGGCGCTGGAAGTGATGGTGGTACTGGTCACCGCCTGCGGTATGTTGCTGTTGCTGGCACAGGTGCAGGTGGGAATGCGTCAGCGTCATCAGGAGCTGGTGGTGTGGCGCACACTCGGTGCGGGAAAAACTGCTGCGTACCACGTTGTGGTGTGAGTTCGCCATGCTTGGGTTTGTTTCCGGCCTGGTGGCCGCAATTGGTGCGGAAACGGCGCTGGCAGTGTGTGCAGGCGAAAGTGTTTGATTTTCCGTGGGAGCCAGACTGGCGATTGTGGATTGTTCTGCCGTGCAGCGGAGCGCTGCTGCTGTCGCTTTCGGCGGCTGGCTGGGTGCGCGACTGGTTAAGGGTAAGGCGCTGTTCAGGCAGTTTGCGGGGGTGATGAGAGTAAATAAGGGCGTTCTGGTTGAATGGAACGCCTTGTTTAAATTAATTCTACAATATGTTTCATTGATGATGTTATTGAATTGGTGATTTCTATCTTTCTATTGCTGATATTAATCTGAATCGGTGGAGTTTATTGATTTTAAATATAGCCCTACAAAAATAACTCAGACTAATAAAATCATAAATCATATGCGTTGAATGGATATTATCCATATAGTGAATTTGTTGATGAATTCATCTGTGCTAAAAATGTTAGTTTAATAAAATATTGAAAGTGACCTGTAATAACAGTTGTTGTTGATTGAGAACAAATAAGTTTATGTGAAAAATATATAAATACATTAGCTGGTCTTGTGTGTCATTTTATTTTTTGTTGCTAACACAGGGATATGAACAATAATAAAAAGGCACTTTATGAGCGGAAAACCAGCGGCGCGTCAGGAGATATGACTCAGTATGGCGGTCCCATTGTCCAGGGTTCGGCAGGTGTAAAATTGGCGCGCCCACCGGCGTGGCGTGCTCGGTGTGTCCGGGCGGGATGACTTCGGGCAACCCGGTAAATCCGCTGCTGGGGGCGAAGGTGCTGCCCGGCGAGACGGACCTTGCGCTGCCCGGCCCGCTGCCGTTCATTCTCTCCCGCACCTACAGCAGCTACCGGACGAAGACGCCTGCACCGGTGGGCGTTTTCGGCCCCGGCTGGAAAGCGCCTTCTGATATCCGCTTACAGCTACGTGATGACGGACTGATACTCAACGACAACGGCGGGCGGAGCATTCACTTTGAGCCGCTGCTGCCGGGAGGCGGTGTACAGCCGCAGTGAGTCAATGTGGCTGGTGCGCGGTGGTAAGGCAGCACAGCCGGACGGCCATACGCTGGCGCGGCTGTGGGGCGCTGCCGCCGGATATCCGGTAAGCCCGCATCTTTACCTGGCGACCAACAGCGCACAGGGGCCGTGGTGGATACTGGGGTGGTCTGAGCGGGTGCCGGGTGCTGAGGACGTACTGCCAGCGCCGCTGCCGCCGTACCGGTGCTTACCGGGATGGCGGACCGCTTCGGGCGGACGCTGACGTACCGGCGTGAGGCCGCCGGTGACCTGGCCGGGGAAATCACCGGCGTGACGGACGGTGCCGGGCGGGAGTTCCGTCTGGTGCTGACCACGCAGGCGCAGCGTGCGGAAGAGGCCCACACCTCTTCGCTATCTTCTTCTGACAGTTCCCCCTCTCTCAGCCTCAGCGTTCCCCGACACACTGCCCGGTACCGAATACGGCCCCGACAGGGTATCCGCCTTTCGGCGGTGTGGCTGATGCACGACCCGGCATACCCGGAGAGCCTGCCCGCTGCGCCACTGGTGCGGTACACGTATACGGAAGCCGGTGAACTGCTGGCGGTATATGACCGCAGCAATACGCAGGTGCGCGCTTTCACGTATGACGCGCAGCACCCGGGCCGGATGGTGGCGCACCGTTACGCGGGAAGGCCGGAGATGCGCTACCGCTACGACGATACGGGGCGGGGGTGGAGCAACTGAACCCGGCAGGGTTAAGCTACCGCTATCTTTATGAGCAGGACCGCATCACCGTCACCGACAGCCTGAACCGGCGTGAGGTGCTGCATACAGAAGGCGGGGCCGGGCTGAAACGGGTGGTGAAAAAGAACTGGCGGACGGCAGCGTCACGCGCAGCGGGTATGACGCGGCAGGAAGGCTCACGGCGCAGACGGACGCGGCGGACGGAGGACAGAGTAGGTCTGAATGTGGTGTCCGGCGATATCACGGACATCACCACACCGGACGGGCGGGAGACGAAATTTTACTATAACGACGGGAACCAGCTGACGGCGGTGGTGTCCCCGGACGGGCTGGAGAGCCGCCGGGAATATGATGAACCGGGCAGGCTGGTATCGGAGACATCGCGCAGCGGGGAGACAGTACGCTACCGCTACGATGACGCGCACAGTGAGTTACCGGCGACGACAACGGATGCGACGGGCGCGCACCAGATGACCTGGAGCCGCTACGGGCGGTTGCTGGCGTTCACCGACTGCTCGGGCTACCAGACCCGTTATGAATACGACCGCTTCGGCCAGGATGACGGCGGTCCACCGAGAAGGCATCAGCCTTTACCGCCGCTATGACAACCGTGGCCGGTTAACCTCGGTGAAAGACGCACAGGGCCGTGAAACGCGGTATGAATACAACGCCGCAGGCGACCTGACTGCCGTTATCACCCCGGACGGCAACCGGGCGAGACACAGTACGATGCGTGGGGAAAGGCGGTCAGCACCACGCAGGGCGGGCTGACGCGCAGTATGGAGTACGATGCTGCCGGACGTGTCATCAGCCTGACCAACGAGAACGGCAGCCACAGCGTCTTCAGTTACGATGCGCTGGACCGGCTGGTACAGCAGGGCGGCTTTGACGGGCGGACGCAACGTTATCATTATGACCTGACCGGAAAACTCACACAGAGTGAGGATGAGGACTTGTCATCCTCTGGTACTACGATGAATCGGACCGTATCACTCGCACGGTGAACGGCGAACCGGCAGAGCAGTGGTGGCAGTATGATGGCCACGGCTGGCTGACAGACATCAGCCACAGAGCGAAGGCCACCGTGTTGCCGTCCACTATGGCTATGACGATAAAGGCCGCCTGACCGGCGATGCCGGGGCGGTGGAGAACCGGAGACAGGGGAACTGCTGTGGCAGCATGAGACGAAACACGCATACAACGAGCAGGGCTGGCAAAACCGTCACGCCGGACAGCCTGCCGCCGGTGGAGTGGCTGACGTATGGCAGCGTTACCTGGCAAAGGAATGAAGCTGGGCGGACGCCGCTGGTCGAATGCGGGACAGGCTGCACCGTGAGACGGTGCGCAGCTTCGGCAGCATGGCAGGCAGTAATGCCGCATACGAACTGACCAGCACATACACACCCCGCAGGCCAGTTACAGAGCCAGCACCTGAACAGCCTGGTATATGACCGTGACTACGGGTGGAGTGACAACGGCGACCTGGTGCGCATCAGCGGCCACGACGACAGACGCGGGAATACGGCTACAGCGCCACAGGCAGGCTGGAGAGTGTGCGCACCCTCGCACCAGACCTGGACATCCGCATCCCGTATGCACGGACCCGGCGGGCAACCGGCTGCCGGACCCGGCTGCACCCGGACAGTACACTCACAGTGTGGCCGGATAACCGCATCGCGGAGGATGCGCACTATGTCTACCGCCACGATGAATACGGCAGGCTGACGGAAGAAGACGGACCGCATCCCGGCGGGTGTGATACGGACGGACGACGAGCGGACCCACCACTACCACTACGACAGCCAGCACCGCCTGGTGTTCTACACGCGGATACAGCATGGCGAGCCACTGGTCGAGAGCCGCTACCTCTACGACCCGCTGGGACGGCGAATGGCAAAACAGGTCTGGCGGCGGGGCGTGACCTGGCAAGGGTGGATGTCGCTGTCGCGTAAACCGGAGGTGACGTGGTATGGCTGGGACGGAGACAGGCTGACGACAGTGCAGACTGACACCACATATCAGACGGTATATACGAGCCGGAAGCTTCACGCCCATCATCGGGTCGAGCAAGAGAACGGCGAGCGGGAAAAGCGCGGCGGCGCAGCCTGGCAAGAGACGCTCCAGCAGGAAGGAGTGAGAACGGCCACGGCGTGGTGGTTTCCCGGCTGAACTGGTGCGGCTGCTGGACAGGCTGGAGGAAGAAATCCGGGCAGACCGCGTGAGCAGTGAAAGCCGGGCGTGGCTGCGCAGTGCGGGCTGACGGTGGAGCAACTGGCCAGACAGGTGGAGCCGGAATACACACCGGCGCGAAAAGCTCATCTTTCACTGCGACCAGGGGACTGCCGCTGGCGCTTATCAGCGAAGACGGCAATACGGCGTGGAGCGCGGAATATGATGGAATGGGGCAACCAGCAATGAGGAGAACCCGCATCATGTGTATCAGCCGTACCGTCTGCCAGGGCAGCAGCATGATGAGGAATCAGGGCTGTACTATAACCGTCACCGGTACTACGATCCGTTGCAGGGGCGGTATATTACTCCAGGACCGATGGGGTTGAAGAGGGATGGGGCGCTGTCGGTATCCTTTAAATCCACTACAACAAATTGACCTATGGGATTATTGCCGAACTTGGGATGATGCCAGATCTGGAGCATCGCAGAGGAAGTTTGTAGGTATTCTTTTCCCATCTCATCGGACCAATGCGAGGTGAAATGAAATGCACGGAGTCTGCATTCGTCTTTAGAAAACGCAGAATAGATCTCTGTCGTAAAAATGATATGGAATCTCTGTTGTCTGTAAAGATACTAATGGAAAATATTTTTGCATCTAAAGGCAACCTGATAATTTAAGAAGGAGTCATATCCTCTGAAAGAAAATGTCCCACAGGTACAGATGAGTTGCTGCTTATCATACTCACGGTACGAATAGATCATGGCAATTATGTTGATGAATTTTTCAAAATGGCGATAAAACTCTTGTAAAGTAAAGATAATAATCTTGAAGCATTTTATCTCACCAGCACCTGATGGACGGGTGGGAGGCACTTAATAATAAAGGAGAATATATTTTTATCAGAAATAGTGTCCCAGGATTAGGTCAGTATGCATACCGTATCATGATTAATTTTAGTGCTTTTAATTGGGGCCTATGGAGATTCAATGAAATATAGTTCAATATTTTCGATGCTTTCATTTTTATACTATTTGCCTGTAAATGAGACAGCTGTTTGCGGTTCTGATGGCAATTATTTTATGAGGTATGTGGAAAATTACATTTAGATAAACCTCTGGCCAAAAATACGGCAAAAGCGAAACAATGAAACAATTAGCTTCGAAATATATGTTAGGCAATTGCATCATATGGCGAACGGATTGCAGAAAAGAAGAAAACCACCATTTAATTGGAACTTACAGATAGTTGGGTTGTTGAGAGCAAAGTTACCTTATGAAGTTGCGGGTGGTGTATTTGATATATAGAAATTAATAAGAAAAATGGATGTTTTGAATTTCCTACATGGTAAATAATAATGCAGCGCTGATGGATGCGGATGGAGACATTGCGTGGAGCGGGGATATGATGAGTGGGGCAACCAGCTGAATGAAGAGAACGCATCACCTGCACCAGCCATTACACCGGCTGCAGGGCAGCAGTATATGATGAGAGTCGGGGCTGTACTACAGCCGGAACCGGTACTACCCGATCCGTTGCAGGGCAGTACTATCACTCAGGGCCGATAGGCTGGAGAGGATGGAGTCCTGTATGTGCGTATCCGCTGAATCCAGGTGAATGGTATTGATCCATTAAAGTTTAAATTCCCGCAGATGTAGCGCTAATATAAGAAGAAAAGATCAACTAAACCATCAAAGAGCATGGGATATGTTATCTGATACTTATGAAGATATGAAGAGACTAAATTTAGGTGGGACTGATCAATTTTCCATTGTATGGCATTTTTGTCGAGTGTCTAAAATTAAATGATGACGCTGGTCAATTAGCCGATCGGCGAAAGAGGGCTGGGTTATGAAAAGAGATTAGAGATTACGGAGTTAAATCTGTTCGAATTGTACGGCAGAAAAGTAAAAGCTATCCCATTCTGAAATGATTGAAGATAATAAAAAAGACTTGGCTGTAAATGACCATGGGTTGACATGTCCATCAACAACAATTGCTCCAGATAGATCTTAGTGATTATGATAATCCAGAGCATAAAAAACGATAAAGGCTTTACAGATGCTGAAGCTATCTCAAGTAATCTATCAAAGATGATAATATTTATTTTTGCTATTATAAGTATTCTTGACATGCGTAATTGCCTTATTTATAAAAGATGGTCTCTTGTAAATATAAACATTACACTTAAGCTATGTAGCAATACCAGAAAATGATGGAGTTTTACGCCAGCTCCCAGATTTTTCCTTTTGTAGCGGTGGATATATCAATATATACCTAAATCTGAAAGACGAAGTGCTTTTCTTATTTTCCCCTAACTTCGTGATGATGGGGTGAGTTTGAAAACATTGACCAGTGAGACCCAGGAACAGATGGCGAAATCAACCATCAAAGAATGATCGATACAAAAATTATTGGTGTAAATATGAGTAGATGCCAGGGCAAGGGGACAATTGGCAAACCTTTTTTTGTTGTTGGTGAAACAATGTTACGCATTATTTTATAACAAATATTGGAGCTGGATTGCCTGATGGTACTTTATACTGCGATAATTCGCTTGAATTAAGAGTCTATCCCATATCGAAGTCCGTCAGCCGTAGTGGGAAAAGTAAAATTCTGAAGCTGAGAAAAGAACATGTCGGCTATTGTGTAAAAGCCATATAGCTCGAGCGATGAATATCCTCGTGATAGTTGTTTTGTGAGGGTGAGTTCCGACCCTCGGCAACAAAATAAAATGAACAGTCAGAGAGTTTACGCCGATTGCACTAATCTCAATGATATCTTCGCCATATTCCAGCCGAAACAAATGAAAATGTTACGTGTTTAATGCGGAGTCTATCTGAAATAAATAATCCTTCGGATTAGAAATAAATTCTTGCCGGGAAAGAAAAGGAAATAAACCATTAGCGGAAAACCAGCGGCACGCCGGTGACATGCCCCAGTACGGCGGCGATAATTAGGAAATTTCAGCGGGGAACACTGATAGTCGCGCCGACTGCATCGAGAACTCCTTACAACTTTTTACAGAACGTCACTGTCGTTGTTCGATATCGTCTTTTTGAATTCTCCAGGTTATGGAGCTGGCAACCCGACGAACGGACACCACTGTCGATAAAAACCCTGTTTACGCAGCTCGTTGCTGGCCCGGTGCTGACCATGTCGGGAAAGCGACGTATTAACAACAGCCTGTTCAGTTGCCTCATCGGTTTTGGTTCTTAAGGTTAGGAGCGCGGCGACTACTGATTAATCTGCGCATCCACCGCCTTCAGCGACCAGTTCGCGGTAACGATAAAACGTATCACATGGCTTTCAGTTACAGGCTTTTGATACGTTGCTGAGTTCTTCCAGCCAGATTGAACAAACCGGCTTTGTGTTTGATGACGGGATTGGCAGTATGAAGCATGAGGTTACCTCTTGTTTTGGATAAAGTTCGACACTCATATCAAAACCGGTAACTCTCAACCTTTCAGAGGTTAAACACCCAAGCAGACGCCGAAGATGAGCACC
+>ac1527fd-d73e-4721-95f5-b7d270cae783 id=19 clr=0,4600
+CGCGGTCAGACAGCAGGCTGTTCAGGTGCTGGCTCTGTAACTGCCCGGCAGGGTATAAGCGGTGGTGAGTTCATAACGGCCGAAGCTGCGCAGCGTTTCCGGTGCAGGCGGTCGCGGGTGTACTCCACCAGCGGTGTGTCGCCGAGTTTCATGCCTGACAGCCAGCCGCTGCCGTAGGTCAGCCATTCCACGGCGGGCAGGCTGTCCGGTATACAGCGGTTCGCCAGTCCCTGTGCGTTGTACGCATGTCTGGTCTCATGCTGCCAGAGCAGTTCATTCGTCTGCGGATGATGCACCGTCAGGTGTTCACTGGCGAGGCGGCCTTTACTGTCATAACCATAGTGCACCGTCACCCGGTGCCCTTCGCTGATATGGCTGATGTCTGTCAGCCAGCCGCGTTCGTCATACTGCCACCGCTCTGCGGTTTCGCCATTCACGGTGCGGTGCGTGAGGCGGTCTGCTTCGTCATAGTGCCAGTGGGTGACCAGCCCTCATCCTCGCTGCGGATAAGTTTGCCGGTCAGGTCGTGGTGATAACGCTGTGTGCGGCCGTCAAAGCCGGTTTCCTGTATCAGCCGGTCGAGTACATCGTAACGGAAGGTGGTGTGGCTGCCGTTTTCACTGGTCAGGCGGATGACCCGTCCGGCAGCATCGTATTCCATACTGCGCGTCAGACCGCCCTGCGTGGTACAGATGGCTTTTCCCCACGCATCGTACTGTGTCCCGTTTCTGCTGCCGTCCGGGGCAATGACGGTGGTCAGGTCACCGGCGGCGTTGTATTCATACCGCGTTTCATGGCCCTGCGTGTCTTTCACGGCAATTAACTGTCCACGGCTGTCGTATGCGCGGTACTGACTCAGCCCTTCCTCGCGGTGCACCGCCGTCACCTGACCAAAACGGTCATGGTCATAGCGGGTTACATAACCGGAACAGTCAGTGAAGCTCAGCAACTGACCGTAACGGCTCCACGTCATGGTTTTCCGGCTGCCGGTGGCATCTTCCGTTGCGCAGGGTAAGTCACTGTGTGGATTATCATAACGGTAGCGGGTGATATCGCCGTCAGGGGCAGTTTCCTGAATCAGACGGCCCCATTCATCATATTCGGCGTATTTCCAGCCCGTCAGGCCCGGTGGCTGACGTTAACTGGCTGTGGTGGTTATAGTAAAACGCCGATGCCCTGCCATCCGGCGTGGTGATGCGCGTGATGAGGCCCGTCACCATCCGGACTGTATTCTGTTGTCCTGCCTGCGGCATCCGTCTGTGCCCTGAGCCTGCCCACCGCGTCAAACTGACTCTGCGTGACGCTGCCGTCCGCGTGTTCCTTTTTCACCACCCGCTTCAGCGCCTTCACCCTGCGTGCAGGACTTCACGGCGGTTCAGGCTGTCGGTGATGGTGATGCGGTCCTTCTCATACTGATACGTGTAACTTAAGCCTGCCGGGTTTAGCTGTTCTGTCACCCGCCCGTCGCTGTCGTAACGGTAACAGATTTCCGGTCGGCCCGTGTGACGGTGCGCCACCATCCGGCCCCGGTATTTATCATCGTAAGTAAAGCTGCGCACCTGTGTATTGCTGCGGTCATACACCGCCGCCAGTTCGCCGCGGGGCGTCCAGCCATAGCGCACCAGCGGCGCGGCAGGTAAATTCTCCGGGTATTCCGGGTCGTGCGTCAGCCACACGGCAGACAGACGGATGCCGTTGTCCCGGCCATATTCGGTGTAACCCGGCAGGGTATCAGGAAAAGCGGACGGTTCCGTCCCGCCGGAAATGGCCTGCTGCCGGGCTTCTTCTGCCCGCTGCGCCTGCGTGGTCAGTACCAGCCGGAAGTGACGCCCGGCACCATCCGTCACGCCGGTGATTTCGCCGCTGAATTCACCGGCGGCTTCGCGGTGGAACGTCTGTGTGCGCCCGAAGCGGTCCACCAGCCCGGTCAGTACCCGGTACGGCGGCAGCGGCGCAGGCAGCACCTCATCCGCTTCCGGCACCCGCTCACACCAGCCGAGCAGCCACCACGGCCCCTGCGGACTGTTTGTCGCCAGATAACGATGCGGACTTAAGCGGAGTTCTTCCGGCAGCGCCTGCCAGAGTGCGGCCAGCCGGTGACCTTCATCCAGTTTCGCCACGCCGCCGCGCGCCAGCCACAGTGACTCGCTGCGGCTGTAACCGTCCTCACCGGGAAACAGGTGCTCAAAATACAGGCTTCTGCCGCCGTTATCACTGAGTATCAGTGTGTTATCGCGCAGCTGTAAGCGGATATCCGCAGGCATTTTCCAGCCGGGGCCGAGGCTCCCCACCGGCGCGGGCGTTTTGTCCGGTAACTGCTGTAGGTGCGGAGAGAATGAACGGCAGCGGGCCGGGCAGGGCGATGTCGGTTTCACCGGGAAGGACCTTTGCACCGAGCAGCGGATTGACCGGATGGCCGGACGTCACCCGCCGGGGCACCGAACAGGCCACGCCGGTGGGGCACCGATGCGTACCCCGGCTGAACCCTGGACAATGCTACCGCCATACTGCGTCATGTCGCCCTGACGCGCCGCCGGTTTTCCGCTCATCTGCTCATCCTTGTTTTATCGGGTTATTTGTCTGCTGACAGGCGAAACCCTACAGATTTATAAGAAAGCCTTAAGTGAGATATCTGTCAGATAAGAACAATTAGGAAAATATTTATATATATTTCATGAATATATGTTTCGATTGGTATAACGATGTCTAAATATTCCTCTGAACATCTTCCTGATACAAAACCGCCAGCGTTTCCGCTGGCGGTTTTCAATATATTCAAAACTCAGCAATCAATAAAATCACCAGTTGCCTTTTCGGCCTGATCCATCCACACCGGTTTATCGCTGGTTTTCGACCAGACGCGATGCAGGTAGCTGTAAAAGCGGGCGCGGTCTTTCCAGAAAAGCATGAAAGGCAGCGCCAGAACGCCCGCTGCAACCGCATAAGTACGGCGTAAAAGATAAGCCATGCAGGATATTCTCTGTAGAGTTCCATACTTTTCTCCCCTTTGTATCTACCCGGTGAATGGCACCGGAAAAATGAATTTGTTTATCTGATGAAAATAGTACCGCCTTTTGTGTAATTTTACTACTCATCCGACCACTTATTTTTGCTTATTGATGGTTTTTTACATTCATCCTGTAATTAAGTTACACAAAGTTAAATTAATACTAAACATTAGTTAAATCATGGCTTTTGCCATTTTTACTTTTACACCCCGCCCGCAGATTTTGCGAAATCTTTGCAGCCAGAATTCTACCCTTCCGGTATCACTTTTAGGCCACTGGAGGTGCACTGTGAGTGCAGGCGTGATAACCGGCGTATTGCTGGTGTTTTATTACTGGGTTATCTGGTTTATGCCCTGATCAATGCGGAGGCGTTCTGATGGCTGCGCAAGGGTTCTTACTGATCGCCACGTTTTTACTGGTGTTAATGGTGCTGGCGCGTCCTTTAGGCAGCGGGCTGGCGCGGCTGATTAATGACATTCCTCTTCCCGGTACAACGGGCGTTGAGCGCGTACTTTTCGCGCACTTGGCGTCTCTGACCGTGAGATGAACTGGAAGCAATATCTTTGTGCCATTCTCGGCCTGAACATGCTGGGGCTGGCGGTGCTGTTTTATGTTGCTCGGTCAGCACTATCTGCCGCTTAATCCACAGCAGTTGCCAGGGCTGTCGTGGGATCTGGCGCTGAATACCGCCGTCAGCTTTGTCACCAATACCAACTGGCAATCTTATAGCGGTGAAACCACGTTGAGCTATTTCAGCCAGATGGCGGGCTTAACGGTGCAAAACTTTCTTTCTGCCGCCAGCGGGATTGCGGTGATTTTGCCCTCATCCGTGCGTTTACCCGCCAGAGCATGAGCACGCTCGGGAATGCCTGGGTCGATCTGCTACGCATCACGTTATGGGTGCTAGTCCTGTGGCGTTGTTGATTGCACTGTTTTTATTCAACAAGGTGCGCTGCAAAACTTTCTGCCTTATCAGGCTGTGAATACCGTTGAAGGAGCGCAACAGCTGTTACCATGGGGCCTGTAGCTTCTCAGGAAGCGATCAAGATGCTCGGTACTAACGGCGGTGGCTTCTTTAATGCCAACTCGTCGCATCCGTTTGAAAACCCAACCGCACTGACCAACTTCGTGCAGATGCTGGCGATCTTCTTGATCCCAACGGCGCTGTGCTTTGCCTTTGGTGAAGTGATGGGCGATCGCCGCCAGGGCGCATGTTGCTGTGGGCGATGTCAGTGATTTTGTCATCTGCGTAGGCGTGGTGATGTGGGCAGAAGTTCAGGGTAATCCTCATCTGCTGGCACTGGGCACGGACAGCAGCATCAATATGGAAGGTAAAGAGAGCCGTTTCGGCGTGCTGGTCAGTAGCCTGTTTGCGGTCGTGACGACGGCGGCTTCCTGTGGCGCGGTGATTGCGATGCATGATTCGTTTACCGCTCTCGGTGGCATGGTGCCGATGTGGCTGATGCAAATTGGTGAAGTGGTGTTCGGCGGTGTCGGTTCTGGTCTTTACGGCATTGCTGTTTGTCCCTGGCGGTGTTTATTGCCGGGCTGATGATTGGTCGTACCAATAGAAAGCAATCGACGTAACGCAA
+>2a021335-d1c5-4881-93fc-a673d8960075 id=20 clr=0,5933
+TGCTTCGGTATTGCTTCGTTCCAGTTACGTATTGCTTTTTCTGTTGGTGCTGATGTTGCGGCGTCTGGCTTGGGTGTTAACCTGTGGCGCTGGGCAATATCAGCGATCGCATGGAGAAGGGCTTAAGCCAGCAAAAGCCGTGAAGTTTATGGCGGGCGATCGGGCGTTGCGCAGTTCACGCGAAGTGCCGCAAGCGTGGCTGGAGGAAGCGCAAAAGCGCGGCCTGATCGGCAAACAGCTGACTTTCGCCACAATGACCTTGCAGGCGACACACCGCAGCTGGCGAACGTCAAAGCGGTGGATGATATCTACCCGATGTATGGCGATCTGCAAACTAATCCCCTGGCCTGAAACCGCAGGCGGGCAGCGTATTGCTGGCCCCACGCCTGATGGCACTGCTTAACCTGAAAACGGGCGACACCATTGGCGTGGGCGATGCCACCTTGCGGATTGCCGGAGAAGTGATTCAGGAACCGGATTCCGGTTTAACCCCTTCAGATGGCTCCGCGTCTGATGATGAATCGGCGGATGTCGATAAAACCGGAGCCGTGCAGCCGAAGTCAGGTCACCTGGCGTTATAAATTCGGCGGCAGCGAGACCAGCTCGACGGCTATGAGAAATGGTTGTTACCTCGGCTTAAACCCGAACAACGCTGGTACGGTCTGGAACAGGACGAAGGCGCGCTGGGGCGATCGATGGAACGCTCGCAACAGTTCCTGCTGCTTTCGGCGCTTCTGACCTTGCTGCTGCTGGCAGTGGCGAGCGGTGGCGGTAGCGATGAATCATTACTGTCGCAGTCGCTACGATCTGGTGGCGATCCTCAAAACGCTGGGGGCAGGGCGAGCGCAACTGCGTAAGCTAATCGTCGGTCAGTGGTTGATGGTGCTGACGCTTTCAGCCGTTACCGGTGTATAGGCCTGTTGTTCGAAAACGTGTTGATGGTGCTGCTCCGAAGCCGTTCTGCCTGCTGCACTACCGCCAGCCAGCCTGGCCGTGGCTGTGGGCGCTTGGCACCATGACGGTCATCTCGCTGCTGGTGGGGCTACGACCATATCGCTTGTTGCTGGCAGCGCAGCGCTACGCGTATTACGTAATGATGTGGTAGCGAACGTCTGGCCGCTGAAGTTTTATCTGCCGATTGTCAGTGTGGTGGTTGTGCTGCTGCTCGCCGGATTAATGGGTGGCAGCATGCTGCTTTGGGCGTGCTGGCGGGCGCGGTAGTACTGGCTTTGCTGTGCGGTGTGCTGGGCTGGATGCTGCTGAATGTACTTCGCCGCATGACGCTGAAATCGCTGCCCCTCTGCGCCTGGCGGTTAGCCGCCTGTTACGTCAGCCGTGGTCAACGTTAAGTCAGCTTTCGGCATTTTCGCTCTCCTTATGCTGCTGGCTGCTGCTGGTGTTGCGTGGCGATCTGCTCGACCGCTGGCAGCAGCACTACCTCTCAAGCCGAACTACTTTTTAATTAACATCGCCACAGAACAGGTAGCACCGCTAAAGCGTTCCTCGCGGAACATCAGATAGTCCCGGAATCGTTTTATCCGGTGGTGCGGGCGCGGCTGACGGCGATTAACGATAAGCCGACAGAAGGTAATGAAGATGGGCGCTTAACCGCGAACTCAATCTTACCTGGCAAAATACGCGGCCCGATCATAATCCGATTGTCGCCGGTAACTGGCCGCCAAAGCCGATGAAGTGTCGATGGAAGAGGGGCTGGCGAAACGCTTAAACGTTGCCCTCGGTGATACCGTGACTTTTATGGGCGATACCCAGGAGTTCCGCGCTAAAGTGACCAGCCTGCGCAAAGTGGACTGGGAAAGTCTGCGGCCTAATTTCTATTTTATTTTCCCTGAAGGGCATTAGACGGGCAACCGCAGAACTGGCTTACCAGTTTCCGCTGGGAGAATGGCAACGGCATGTTGACACAACTCAACCGCCAGTTCCCGACCATTAGCCTGTTAGATATTGGCGCGATTTTTAAAACAGGTCGGTCAGGTGCTGGAGCAGGTAAGTCGGGCGCTGGAAGTGATGGTGTAGTACTGGTCACCGCCTGCGGTATGTTGCTGTTGCTGGCACAGGTGCAGGTGGGAATGCGTCAGCGTCATCAGGGAGCTGGTGGTGTGGCGCACACTCGGTGCGGAAAAACTGCTGCGTACCACGTTGTGTGTGTGAGTTCGCCATGCTTGGGTTTGTTTCCGGCCTGGTGGCCGGTGGTGCGGAAACGGCGCTGGCGGTGTTGCAGGCGAAGTGTTTGATTTTCCGTGGGAGCCAGACTGGCGATTGTGGATTGTTCTGCCGTGCAGCAGGCGCTGCTGCTGTCGCTTTTCGGCGGCTGGCTGGGTGCGCGACTGGTTAAGGGTAAGGCGCTGTTCAGGCGGTTTGCGGGGTGATGAGAGTAAATAAGGGGGCGTTCTGGTTGAATGGAACGCCTTGTTTAAATAATTCTACCACATATGTTTCATTGATGATGTTATTGAATTGGTGATTTCCTATCTTTCTATTGCTGATATTAATCTGAATCGGTGGAGTTTATTGATTTTAAATATAGCCCTACAAAAATAACTCAGACTAATAAAATCATAAATCATATGCGTTGAATGGATATTATCCATATAGTGGGCCTGTTGATGATGAATTCATCTGTGCTAAAAATGTTAGTTTAATAAAATATTGAAAGTGACCTGTAATAACAGTTGTTGTTGATTGAGAACAAATAAGTTTATAATGAAAAATATATAAATACATTAGCTGGTCTTGTGTGTCATTTTATTTTTTGTTGCTAACACAGGGATATGAACAATAATAACTAAAGGGCACTTTATGAGCGGAAAACCAGCGGCGCGTCAGGGAGATATGACTCAGTATGGCGGTCCCATTGTCCAGGGGTTCGGCAGGTGTAAATTGGCGCGCCCACCGGCGTGGCGTGCTCGGTGTGTCCGGGCGGGATGACTTCAGGCAGCCCGGTAAATCCACTGCTGGGCGAGGTGCTGCCCGGCGAGGGCGGACCTTGCGCTGCCGGCCCGCTGCCGTTCATTCTCTCCCGCACCTACAGCAGCTACCGGACGAAGACGCCTGCACCGGTGGGCGTTTTCGGCCGGTAGCTGCTGTAGGTGCAGGAGAGAATGAACGGCAGCGGGCCGGGCAGCGCAGGTCATCTCGCCGGGCAGCACCTTCGCCCCAGCAGCGGATTTACCGGGTTGCCCGAAGTCATCCCGCCCGGACACACCGAGCACGCCACGCCGGTTGGGCGCGCCACCTGCCGAACCCTGGACAATGGGACCGCCATACTGAGTCATATCTCCCTGACGCGCCGCTGGTTTTCCGCTCATATAAAGTGCCCTTTTAGTTATTGTTCATATCCCGTGTTAGCAACAAAAAAATAAAATGCACACAAGACCAGCTAATGTATTTATATATTTTTCACATAAACTGTTCTCAATCAGCAACAACTGTTATTACAGGTCACTTTCAATATTTTATTAAACTAACATTTTTTAGCACAGATGAATTCATCATCAACAAATTCACTATATGGATAATATCCATTCAACGCATATGATTTATGATTTTATTAGTCTGAGTTATTTTTGTAGGGCTATATTTAAAATCAATAAACTCCACCGATTCAGATTAATATCAGCAATAGAAGATAGGAAATCACCAATTCAATAACATCATCAATGAAACATATTGTAGAATTAATTTAAACAAGGCGTTCCATTCAACCAGAACGCCCATTTACTCTCATCACCCGCAAACTGCCTGAACAGCGCCTTACCCTTAACCAGTCGCGCACCCAGCCAGCCGCCGAAAGCGACAGCAGCAGCGCTCCGCTGCACGGCGCAATCCACAATCGCCAGTCTGGCTCCCGGAAAATCAAACACTTTCGCCTGCAACACTGCCAGCGCCGTTTCCGCACCAATTGCGGCCACCAGGCCGAAACAAACCAAGCATGGCGACTCACACCACAACGTGGTACGCAGCAGTTTTTCCCGCACCGAGTGTGCGCCACACCACCAGCTCCTGATGACGCTGACGCATTCCCACCTGCACCTGTGCCAGCAACAGCAACATACCGCAGGCGGTGACCAGTACCACCATCACTTCCAGCGCCCGATACCTGCTCCAGCACCTGACCGACCTGTTTTAAATCCCGCGCCAATATCTAACAGGCTAATGGTCGGGAACTGGCGGTTGAGTTGTCAACATGCCGTTGCCATTCTCCCAGCGGAAACTGGTAAGCCAGCTCTGCGGTTGCCCGTCTAATGCAGGGAAAATAAAATAGAAATTAGGCCGCAGACTTTCCCAGTCCACTTTGCGCAGGCTGGTCACTTTAGCGCGGAACTCCTGGGTATCGCCCATAAAGTACACGGTATCACCCAACAATCGATTATGATGTTAATTACCACATCGTTCGGATGATGTTCCTGTTCTGTCGGCTTATCGTTAATCGCCGTCAGCCGCGCCCACCACCGGATAAAACGATAGATGTTCCGCGAGCTTTCTGGTTCTGGATGTTAATTAAAAGTAGTTCGGGCTGCTGTGCTGCCAGCGGTCGAGCAGATCGCCACGCAACACCAGCAGCAGTGCCAGCAGCATAAAGGAGGCGAAAATGCCGAAAGCTGACAACGTTGACCACGGCTGACGTAACAGGCGGCTAACCGCCAGGCGCAGAGGCAGATTTCAGCGTCATGCGGCGAAGTACATTCAGCAGCATCCAGCCCAGCACACCGCACAGCAAGCCAGTACTACCGCGCCCGCCAGCACCGCCCAAAACGGCATTAATCCGGCGAGCAGCAGCACAGCCACCACACTGACAATCGGCAGATAAAACTTCAGCGGCCAGACGTTCGCTACCACATCATTACGTAATACGCGTAAAGGGCGTTGCCAGCAACAAGCGATATGGTCGTAGCCCACCAGCAGCGAGATGACCGTCATGGTGCCAAGCGCCCACAGCCACGGCCAGAGGCTGGCTGGCGGTAGTGCAGCAGGCAGAACGGGCGAGCAGCACCATCAACACGTTTCGAACAACAGGCCTATGGCCCCACCGGTAACGGCTGAAGCGTCAGCACCATCAACCACTGACCGACGATTGGCTTACGCGGTTGCTCGCCCTGCCCCCAGCGTTTGAGGATCGCCACCAGATCGTAGCGACTGCGACAGTAATGATTCATCGCTACCGCCACCGCTGCCACTGCCAGCAGCAAGGTCAGAAGCGCCGAAAGCAGCAGGAACTGTTGCGAGCGTTCCATCGATCGCCCAGCGCGCCTTCGTCCTGTTCCAGACCGTACCAGCGTTGTTCGGGTTTAAGCTGAGGTAACAACCATTTCTCATAGCCGTCGAGCTGGTTCTCGTTGCCGCCGAATTTATAACGCCAGGTGACCCGACTCCCCGGCTGCACGCTCCGGTTTTATCGACATCCGCCAGATTCATCATCAGACGCGGAGCCATCTGGAAGGGTTAAAACCGGAATCCGGTTCCTGAATCACTTCTCCGGCAATCCGCAGGTGGCATCGCCCACGTCAATGGTGTCGCCCGTTTTTCCGGGTTAAAGCAGTGCCATCAGGCGTGGGCCAGCAATACGCGCTGCCCGCCTGCGGTTTCAGGCCAGGGGATTAGTTTGCAGATCGCCATACATCGGGTAGATATCATCCACCGCTTTGACGTTCGCCAGCTGCGGTGTGTCGCCTGCAAAGGTCATTGTGGCGAAAGTGGCTGCTTGCCGACTTTCAGGCCGCGCTTTGCGCTTCCTCCAGCCACGCTTGCGGCACTTCGCGTGAACTGCGCAACGCCCGATCGCCCGCCATAAACTCACGGCTTTGCTGGCTTAAGCCCTTCTCCGTACGATCGCTGATATTGCCAGCACCAGGTTAAACGCAAGCAGACGCCGCAATATCAGCACCAACAGAAAAAGCAATGCGTAATGACACGGG
+>8b55f8dd-3fcb-478c-8384-6df32ed6400b id=21 clr=0,5250
+CCCCATCGGTATGCTTCGTTCCGGTTACGTATTGCTACTTGCCTGCTCGCTCTATCTTCGGCGTCTGCCCGGGACCATAGCCTTTGCAGGCAGACGTATTTGCATTAACAATGGTTCAGCGTTGGCGGCTTTGACATCCTGCAAAATCTGGCGCAGCGTTTGCTCGGTTTGCTGTGGCTGAAAACCACGCAAACCGTCATTGCCGCCAGTTCAACCAGCACCCAACGCGGCTGATGCTGTTTCAGCAGAGCCGGAAGGCGCGCCAGTCCTTGTTGCGAGGTGTCGCCGCTGATGCTGGCATTAACTACCGACGTTTTACTCTGCCACTTATCATTCAACAAGGCAGGCCAGGCCGCGCTGGCAGACATTCGATACCCGGCGCTCAGGCTATCACCCAGAATCAATAACGTGTCCGCTGCGGCGCTACGGAAAGTTAACTGGGACCAGGAACAGGAAGGGCAAATGCCAGCGGAAAACATTGTTGATTCATCATCTTAAGAAGTCCGTCGGTCAGGGGCATGAACTCTCCATCCTCACCGGAGTTGAGCTGGTTGTCAAACGGCGAGACCATCGCACTGGTGGGCGAGTCGGAATCGGTAAGTCAACCTTGCTGGCGATCCTCGCCGGGCTTGATGACGGCAGCAGTGGCGAAGTGAGTCTGGTGGGACAACCGCTCACATAATATGGACGAAGCGCGGGCAAAGTTGCGCGCGAAGCACGTCGGCTTTGTTTTTCAGTCATTTATGTTAATTCCTACCCCAACGCGCTGGAAAACGTCGAGCTTCCGGCTGCTGCTGCGCGGTGAGTAGCGCGGAAAGTCGTAACGGGGCGAAAGCGTTGCTCGAACAGTTAGGGCTGGGTAAACGTCTGATCATCTTCCGGCACAGCTTTCCGGCGGTGAACAGCAACGAGTGGCGCTGGCACGAGCCTTTAATGGTCGACCTGATGTGCTGTTTGCCGACGAACCCACCGGCAACCTTGACCGCCAGACGGGCGATAAAATTGCCGACCTGCTGTTTTCCTCAACCGTGAACATGGCACCACGTTGATTATGGTGACCCGACCTGCAACTGGCGGCACGCTGCGACCGCTGCTTACGGCTGGTGAACGGGCAGTTGCAGGAGGAAGCATGATTGCACGTTGGTTCTGGCGCGAATGGCGTTCGCCGTCGCTATTAATTGTCTGGCTGGCGCTAAGCCTGGCGGTGGCCTGCGTGCTGGCGCTGGGCAATCAGCGATCGCATGGAGAAGGGCTTAAGCCAGCAAAGCCGTGAGTTTATGGCGGGCGATCGGGCGTTGCGCAGTTCACGCGAAGTGCCGCAAGCGTGGCTGGAGGAAGCGCAAAGCGCGGCCTGAAAGTCGGCAAGCAGCTGACTTTCGCCACAATGACCTTGCAGGCGACACACCGCAGCTGGCGAACGTCAAAGCGGTGGATGATATCTACCCGATGTATGGCGATCTGCAAACTAATCCCCTGGCCTGAAACCGCAGGCGGGCAGCGTATTGCTGGCCCCACGCCTGATGGCACTGCTTAACCTGAAAACGGGCGACACCATTGACGTGGGCGATGCCACCTTGCGGATTGCCGGAGAAGTGATTCAGGAACCGGATTCCGGTTTTAACCCTTCCAGATGGCTCCGCGTCTGATGATGAATCTGGCGGATGTCGATAAAACCGGAGCCGTGCAGCCGAAGTCGGGTCACCTGGCGTTATAAATTCGGCGGCAACGAGAACCAGCTCGACGGCTATGAGAAATGGTTGTTACCTCGGCTTAAACCCGAACAACGCTGGTACGGTCTGGAACAGGACGAAGGCGCGCTGGGGCGATCGATGGAACGCTCGCAACAGTTCCTGCTGCTTTCGGCGCTTCTGACCTTGCTGCTGGCAGTGGCAGCGGTGGCGGTAGCGATGAATCATTACTGTCGCAGTCGCTACGATCTGGTGGCGATCCTCAAAACGCTGGGGGCAGGGCGAGCGCAACTGCGTAAGCTAATCGTCGGTCAGTGGTTGATGGTGCTGACGCTTTCAGCCGTTACCGGTGGGGCCATAGGCCTGTTGTTCGAAAACGTGTTGATGGTGCTGCTCAAGCCCGTTCTGCCTGCTGCACTACCGCCAGCCAGCCTCTGGCCGTGGCTGTGGGCGCTTGGCACCATGACGGTCATCTCGCTGCTGGTGGGGCTACGACCATATCGCTTGTTGCTGGCAACGCAGCTTTACGCGTATTACGTAATGATGTGGTAGCGAACGTCTGGCCGCTGAAGTTTTATCTGCCGATTGTCAGTGTGGTGGTTGTGCTGCTGCTCGCCGGATTAATGGGTGGCAGCATGCTGCTTTGGGCGGTGCTGGCGGGCGCGGTAGTACTGGCTTTGCTGTGCGGTGTGCTGGGCTGGATGCTGCTGAATGTACTTCGCCGCATGACGCTGAAATCGCTGCCTCTGCGCGCTGGCGGTTAGCCGCCTGTTACGTCAGCCGTGGTCAACGTTAAGTCAGCTTTCGGCATTTTCGCTCTCCTTTATGCTGCTGGCACTGCTGCTGGTGTTGCGTGGCGATCTGCTCGACCGCTGGCAGCAGCAGCTACCTCAAGCCCGAACTACTTTTTAATTAACATCGCCACAGAACAGGTAGCACCGCTAAAGCGTTCCTCGCGGAACATCAGATAGTCCCGGAATCGTTTTATCCGGTGGTGCGGGCGCGGCTGACGGCGATTAACGATAAGCCGACAGAAGGTAATGAAGATGAGGCGCTTAACCGCGAACTCAATCTTACCTGGCAAAATACGCGGCCCGATCATAATCCGATTGTCGCCGGTAACTGGCCGCCAAAAGCCGATGAAGTGTCGATGGAAGAGGGGCTGGCGAAACGCTTAAACGTTGCCCTCGGTGATACCGTGACTTTTATGGGCGATACCCAGGAGTTCCGCGCTAAAGTGACCAGCCTGCGCAAAGTGGACTGGGAAAGTCTGCGGCCTAATTTCTATTTTATTTTCCCTGAAGGGCATTAGACGGGCAACCGCAGAGCTGGCTTACCAGTTTCCGCTGGGAGAATGGCAACGGCATGTTGACACAACTCAACCGCCAGTTCCCGACCATTAGCCTGTTAGATATTGGCGCGATTTTAAAACAGGTCGGTCAGGTGCTGGAGCAGGTAAGTCGGGCGCTGGAAGTGATGGTGGTACTGGTCACCGCCTGCGGTATGTTGCTGTTGCTGGCACAGGTGCAGGTGGGAATGCGTCAGCGTCATCAGGAGCTGGTGGTGTGGCGCACACTCGGTGCGGGAAAAACTGCTGCGTACCACGTTGTGGTGTGAGTTCGCCATGCTTGGGTTTGTTTCCGGCCTGGTGGCCGCAATTGGTGCGGAAACGGCGCTGGCAGTGTTGCAGGCGAAAGTGTTTGATTTTCCGTGGGAGCCAGACTGGCGATTGTGGATTGTTCTGCCGTGCAGGAGCGCTGCTGCTGTCGCTTTCGGCGGCTGGCTGGGTGCGCGACTGGTTAAGGGTAAGGCGCTGTTCAGGCAGTTTGCGGGGTGATGAGTAAATAAGGGGCGTTCTGGTTGAATGGAACGCCTTGTTTAAATTAATTCTACAATATGTTTCATTGATGATGTTATTGAATTGGTGATTTCCTATCTTTCTATTGCTGATATTAATCTGAATCGGTGGAGTTTATTGATTTTAAATATAGCCCTACAAAAATAACTCAGACTAATAAAATCATAAATCATATGCGTTGAATGGATATTATCCATATAGTGAATTTGTTGATGATGAATTCATCTGTGCTAAAAATGTTAGTTTAATAAAATATTGAAAGTGACCTGTAATAACAGTTGTTGTTGATTGAGAACAAATAAGTTTATGTGAAAAATATATAAATACATTAGCTGGTCTTGTGTGTCATTTTATTTTTTGTTGCTAACACAGGGATATGAACAATAACTAAAGGGCACTTTATGAGCGGAAAACCAGCGGCGCGTCAGGGAGATATGACTCAGTATGGCGGTCCCATTGTCCAGGGTTCGGCAGGTGTAAGAATTGGCGCGCCCACCGGCGTGGCGTGCTCGGTGTGTCCGGGCGGGATGACTTCGGAACCCGGTAAATCCGCTGCTGGGGGCGAAGGTGCTGCCCGGCGAGACGGACCTTGCGCTGCCCGGCCCGCTGCCGTTCATTCTCTCCCGCACCTACAGCAGCTACCGGACGAAGACGCCTGCACCGGTGGGCGTTTTCGGCCCCGGCTGAAAAGCGCCTTCTGATATCCGCTTACAGCTACGTGATGACGGACTGATACTCAACGACAACGGCGGGCGGAGCATTCACTTTGAGCCGCTGCTGCCGGGGAGGCGGTGTACAGCCGCAGTGAGTCAATGTGGCTGGTGCGCGGTGGTAAGGCAGCACAGCCGGACGGCCATACGCTGGCGCGGCTGTGGGGGCGCTGCCGCCGGATATCCGGTTAAGCCCGCATCTTTACCTGGCGACCAACAGCGCACAGGGGCCGTGGTGACTGGGGTGGTCTGAGCGGGTGCCGGGTGCTGAGGACGTACTGCCAGCGCCGCTGCCGCCGTACCGGGTGCTTACCGGGATGGCGGACCGCTTCGGGCGGACGCTGACGTACCGGCGTGAGGCCGCCGGTGACCTGGCCGGGGAAATCACCGGCGTGACGGACGGTGCCGGGCGGGAGTTCCGTCTGGTGCTGACCACGCAGGCGCAGCGTGCGGAAGAGGCCCACACCTCTTCGCTATCTTCTTCTGACAGTTCCCGCCCTCTCTCAGCCTCAGCGTTCCCCGACACACTGCCCGGTACCGAATACGGCCCCGACAGGGTATCCGCCTTTCGGCGGTGTGGCTGATGCACGACCCGGCATACCCGGAGAGCCTGCCCGCTGCGCCACTGGTGCGGTACACGTATACGGAAGCCGGTGAACTGCTGGCGGTATATGACCGCAGCAATACGCAGGTGCGCGCTTTCACGTATGACGCGCAGCACCCGGGCCGGATGGTGGCGCACCGTTACGCGGGAAGGCCGGAGATGCGCTACCGCTACGACGATACGGGGCGGGTGGTGGAGCAACTGAACCCGGCAGGGTTAAGCTACCGCTATCTTTATGAGCAGGACCGCATCACCGTCACCGACAGCCTGAACCGGCGTGAGGTGCTGCATACAGAAGGCGGGGCCGGGCTGAAACGGGTGGTGAAAAAGAACTGGCGGACGGCAGCGTCGCGCAGCGGGAGTTAAGCTGCAAGCAGCACGCCGAACGAA
+>fb405411-031d-4447-8096-b603693b1fe7 id=22 clr=0,8236
+TTGTTATTGCTTCGTTCCAGTTGCATTGCTTTTCTGTTGGTGCTGATCGTTGCAGCGTCTGGCGGGTGTTTAACGCTGGCGAGGATCACAATACTGCGGCCTTCCGGCGTTTCATCAGCCAGCGAAGCCAGTTGTGCGGCGTCAGCCAGCGTTTTTCATCCACGCCCTGCGCGGATAAACTCCGACGCCTGACGGTTACCGAGTGTGATGGTGCCGGTTTTATCCAGTAGCAGAACGTCAACGTCACCTGCCGCTTCAACTGCACGTCCGCTGGTGGCAATCACATTCGCGCCTAGCATCCGGCTCATCCCGACGCCGATCGCTGACAACAGGCCGCCAATAGTGGTTGGGATCAGACAGACCAGCAGCGCCACCAGTACCGTTACGCTGACTGCATTACCGCCCCACGCGGAAAACGGCCACAGCGTGGCGGTTGCCAGTAAAAGACGATAGTCAGGGCAATCAGCAGAATGGTCAGGGCAATTTCGTTCGGCGTTTTGCGTCGCTGTGCGCCTTCCACCATCGCGATCATCCGATCCAGAAATGTCTCGCCGGGGTTAACGCTACACTCAATCACCAGCCAGTCAGAAAGAATACGCGTGCCGCCGGTGACGGAGGCAAAATCGCCGCCGGATTCACGGATCACCGGTGCCGATTCCCCGGTGATGGCGCTTTCATCGACCGATGCCCCTTCAATAACTTCACCATCGCAGGGATAATATCGCCAGCTTCTACCAGTACGATATCGCCTTTACGAAGTTGGTCGGCAGGAACTTTGTCCGCCGCAGCGCCATATTTCGGCTCACGCAGCTTGCGGGCAAAGGCAGTTTTTCACCCCTTTCAGACTGTTGGCCTGCGCTTTACTGCGGCCTTCTGCCAGCGCCTCGGCGAAATTAGCGAACAGTACGGTGATCCACAGCCAACCGCTAATGGCCGCGCTAAACAGCGCATTGCCGGGCATCGCACCGCTTGCCATCGCGATGCTAATACAGGTGGTCAGCAGACTGCCGATCCAGACGATAAACATCACCGGATTGCGCCATTGCGCCTGCGGGTTTAATTTTTCACCGCTTCTTTCAGCGCCTGAACGACAAGTGTTGGTTCGAATAGCGCCAGTTGTTTACGACTCATATTCAGTGCTCACTCAATATCATCAGGAGATATTCCGCCACCGGACCAAGCGCCAGGGCAGGGATAAAGGTCAGTGCGCCAACCAGCAACACGGTGCCGATTAACAGGCCAACAAACAGCGGGCCGTGCGTTGGCAGCGTGCCGGAGCTGGCGGCTTGGCTCTTTTACTCACCAGCGAACCGGCAATTGCCATCACCGGGATAATCACCCCGAAGCGACCGACAAACATGCAGAACGCCAGTAAACAGTTCCAGAACGGAGAGTTGGCGCTTAATCCGGCAAAGGCGCTGCCGTTGTTAGCGGCGGATGACACGGCGTACAGCACTTCGCTAAAACCATGCGGGCCAGGGTTGAGCATGGCGCTACGTCCGGCGTCGGTCATCATCGCCAACGCCGCGCCCATCAGCACCAGCGTCGGGGTAACCAGAATTGCCAGTGCAGTCAGTTTCATCTCGCGTACGTCGATTTTTTACCCAGATATTCCGGTGTACGACCAATCATCAGCCCGGCAATAAACACCGCCAGCAGGACAAACAGCATCATGCCGTAAAGACCAGAACCGACACCGCCGAACACCACTTCACCAATTTGCATCAGCCACATCGGCACCATGCCACCGAGAGCGGTAAACGAATCATGCATCGCAATCACCGCGCCACAGGAAGCCGCCGTCGTCACGACCGCAAACAGGCTACTGACCAGCACGCCGAAACGGCTCTCTTTACCTTCCATATTGATGCTGCTGTCCGTGCCCAGTGCCAGCAGATGAGGATTACCCTGAACTTCTGCCCACATCACCACGCCTACGCAGATGACAAAAATCACTGACATCGCCCACAGCAACATGCGCCCCTGGCGGCGATCGCCCATCACTTCACCAAAGGCAAAGCACAGCGCCGTTGGGATCAAGAAGATCGCCAGCATCTGCACGAAGTTGGTCAGTGCGGTTGGGTTTTCAAACGGATGCGACGAGTTGGCATTAAAGAAGCCACCGCCGTTAGTACCGAGCATCTTGATCGCTTCCTGAGAAGCTACAGGCCCCATGGGTAACAGCTGTTGCGCTCCTTCAACGGTATTCACAGCCTGATAAGGCAGAAAGTTTTGCAGCGCACCTTGTTGAATAAAAACAGTGCAATCAACAACGCCACAGGGACTAGCACCCATAACGTGATGCGTAGCAGATCGACCCAGGCATTCCCGAGCGTGCTCATGCTCTGGCGGGTAAACGCACGGATGAGGGCAAAATCACCGCAATCCCGCTGGCGGCAGAAAGAAAGTTTTGCACCGTTAAGCCCGCCATCTGGCTGAAATAGCTCAACGTGGTTTCACCGCTATAAGATTGCCAGTTGGTATTGGTGACAAAGCTGACGGCGGTATTCAGCGCCAGATCCCACGACAGCCCTGGCAACTGCTGTGGATTAAGCGGCAGATAGTGCTGACCGAGCAACATAAAAACAGCACCGCCAGCCCCAGCATGTTCAGGCCGAGAATGGCACAAAGATATTGCTTCCAGTTCATCTCACGGTCAGAGACGCCAAGTGCGCGAAAAGTACGCGCTCAACGCCCGTTGTACCGGGAAGAGGAATGTCATTAATCAGCCGCGCCAGCCCGCTGCCTAAAGGACGCGCCAGCACCATTAACACCAGTAAAAACGTGGCGATCAGTAAGAACCCTTGCGCAGCCATCAGAACGCCTCCGCATTGATCAGGGCATAAACCAGATAACCCAGTAATAAAACACCAGCAATACGCCGGTTATCACGCCTGCACTCACAGTGCACCTCCAGTGGCCTAAAAGTGATACCGGAAGGGTAGAATTCTGGCTGCAAAGATTTCGCAAAAATCTGCGGGCGGGGTGTAAAAAATATAAAATGGCAAAAGCCATGATTTAACTAATGTTTAGTATTAATTTAACTTTTGTGTAACTTAATTACAGGATGAATGTAAATAAACCATCAATAAGCAAAAATAAGTGGTCGGATGAGTAGTAAAATTACACAAAAGGCGGTACTATTTTCATCAGATAAACAAATTCATTTTTCCGGTGCCATTCACCGGGTAGATACAAAAGGGGAGAAAAGTATGGAACTCTACAGAGAATATCCTGCATGGCTTATCTTTTTACGCCGTACTTATGCGGTTGCAGCGGGCGTTCTGGCGCTGCCTTTCATGCTTTTCTGGAAAGACCGCGCCCGCTTTTACAGCTACCTGCATCGCGTCTGGTCGAAAACCAGCGATAAACCGGTGTGGATGGATCAGGCCGAAAAGGCAACTGGTGATTTTATTGATTGCTGAGTTTTGAATACATTGAAAACCGCCAGCGGAAACGCTGGCGGTTTTATCAGGAAGATGTTCAGAGGAATATTTAGACATCGTTATACCAATCGAAACATATATTCATGAAATATATATAAATATTTTCCTAATTGTTCTTATCTGACAGATATCTCACTTAAGGCTTTCTTATAAATCTGTAGGGTTTCGCCTGTCAGCAGACAAATAACCCGATAAAACAAGGATGAGCAGATGAGCGGAAAACCGGCGGCGCGTCAGGGCGACATGACGCAGTATGGCGGTAGCATTGTCCAGGGTTCAGCCGGGGTACGCATCGGTGCCCCACCGGCGTGGCCTGTTCGGTGCCCCGGCGGGTGACGTCCGGCCATCCGGTCAATCCGCTGCTCGGTGCAAAGGTCCTTCCCGGTGAAACCGACATCGCCCTGCCCGGCCCGCTGCCGTTCATTCTCTCCCGCACCTACAGCAGTTACCGGACAAAACGCCCGCGCCGGTGGGGAGCCTCGGCCCCGGCTGGAAAATGCCTGCGGATATCCGCTTACAGCTGCGCGATAACACACTGATACTCAGTGATAACGGCGGCAGAAGCCTGTATTTTGAGCACCTGTTTCCCGGTGAGGACGGTTACAGCCGCAGCGAGTCACTGTGGCTGGTGCGCGGCGGCGTGGCGAAACTGGATGAAGGTCACCGGCTGGCCGCACTCTGGCAGGCGCTGCCGGAAGAACTCCGCTTAAGTCCGCATCGTTATCTGGCGACAAACAGTCCGCAGGGGCCGTGGTGGCTGCTCGGCTGGTGTGAGCGGGTGCCGGAAGCGGATGAGGTGCTGCCTGCGCCGCTGCCGCCGTACCGGGTACTGACCGGGCTGGTGGACCGCTTCGGGCGCACACAGACGTTCCACCGCGAAGCCGCCGGTGAATTCAGCGGCGAAATCACCGGCGTGACGGATGGTGCCGGGCGTCACTTCCGGCTGGTACTGACCACGCAGGCGCAGCGGGCAGAAGAAGCCCGGCAGCAGGCCATTTCCGGCGGGACGGAACCGTCCGCTTTTCCTGATACCCTGCCGGGTTACACCGAATATGGCCGGGACAACGGCATCCGTCTGTCTGCCGTGTGGCTGACGCACGACCCGGAATACCCGGAGAATTTACCTGCCGCGCCGCTGGTGCGCTATGGCTGGACGCCCGCGGCGAACTGGCGGCGGTGTATGACCGCAGCAATACACAGGTGCGCAGCTTTACTTACGATGATAAATACCGGGGCCGGATGGTGGCGCACCGTCACACGGGCCGACCGGAAATCTGTTACCGTTACGACAGCGACGGGCGGGTGACAGAACAGCTAAACCCGGCAGGCTTAAGTTACGTATCAGTATGAGAAGGACCGCATCACCATCACCGACAGCCTGAACCGCCGTGAAGTCCTGCACACGCAGGGTGAAGGCGGGCTGAAGCGGGTGGTGAAAAGGAACACGCGGACGGCAGCGTCACGCAGAGTCAGTTTGACGCGGTGGGCAGGCTCAGGGCACAGACGGATGCCGCAGGCAGGACAACAGAATACAGTCCGGATGTGGTGACGGGCCTCATCACGCGCATCACCACGCCGGATGGCAGGGCATCGGCGTTTTACTATAACCACCACAGCCAGTTAACGTCAGCCACCGGGCCTGACGGGCTGGAAATACGCCGGGAATATGATGAATGGGGCCGTCTGATTCAGGAAACTGCCCCTGACGGCGATATCACCCGCTACCGTTATGATAATCCACAGTGACTTACCCTGCGCAACGGAAGATGCCACCGGCAGCGGAAAACCATGACGTGGAGCCGTTACGGTCAGTTGCTGAGCTTCACTGACTGTTCCGGTTATGTAACCCGCTATGACCATGACCGTTTTGGTCAGGTGACGGCGGTGCACCGCGAGGAAGGGCTGAGTCAGTACCGCGCATACGACAGCCGTGGACAGTTAATTGCCGTGAAAGACACGCAGGGCCATGAAACGCGGTATGAATACAACGCCGCCGGTGACCTGACCACCGTCATTGCCCCGGACGGCAGCAGAAACGGGACACAGTACGATGCGTGGGGAAAAGCCATCTGTACCACGCAGGGCGGTCTGACGCGCAGTATGGAATACGATGCTGCCGGACGGGTCATCCGCCTGACCAGTGAAAACGGCAGCCACACCACCTTCCGTTACGATGTACTCGACCGGCTGATACAGGAAACCGGCTTTGACGGCCGCACACAGCGTTATCACCACGACCTGACCGGCAAACTTATCCGCAGCGAGGATGAGGGCTGGTCACCCACTGGCACTATGACGAAGCAGACCGCCTCACGCACCGCACCGTGAATGGCGAAACCGCAGAGCGGTGGCAGTATGACGAACGCGGCTGGCTGACAGACATCAGCCATATCAGCGAAGGGCACCGGGTGACGGTGCACTATGGTTATGACAGTAAAGGCCGCCTCGCCAGTGAACACCTGACGGTGCATCATCCGCAGACGAATGAACTGCTCTGGCAGCATGAGACCAGACATGCGTACAACGCACAGGGACTGGCGAACCGCTGTATACCGGACAGCCTGCCCGCCGTGGAATGGCTGACCTACGGCAGCGGCTGGCTGTCAGGCATGAAACTCGGCGACACACCGCTGGTGGAGTACACCCGCGACCGCCTGCACCGGGAAACGCTGCGCAGCTTCGGCCGTTATGAACTCACCACCGCTTATACCCCTGCCGGGCAGTTACAGAGCCAGCACCTGAACAGCCTGCTGTCTGACCGCGATTACACCTGGAACGACAACGGCGAACTCATCCGCATCAGCAGCCCGCGCCAGACCCGGAGTTACAGCTACAGCACCACCGGCAGGCTGACCGGCGTTCACACCACCGCAGCGAATCTGGATATCCGCATCCCGTATACCACAGACCCGGCAGGTAACCGCCTGCCCGACCCGGAGCTGCACCCGGACAGCGCCCTCAGCATGTGGCCGGATAACCGTATCGCCCGTGACGCGCACTATCTTTACCGGTATGACCGTCACGGCAGGCTGACAGAAAACCGACCTCATCCCGGAAGGGTTATCCGCACGGATGATGAGCGCACCCACCGGTACCATTACGACAGTCAGCACCGGCTGGTGCACTACGCGCGGACACAATATGCAGAGCCGCTGGTCGAAAGTCGCTATCTTTACGACCCGCTGGGCCGCAGGGTGGCAAAACGGGTATGGCGGCGTGAACGGGACCTGACGGGCTGGATGTCGCTGTCACGGAAACCGCAAGTGACCTGGTACGGCTGGGACGGCGACCGCCTGACCACGATACAGAACGACAGAACCCGCATCCAGACGATTTATCAGCCGGGGAGCTTCACGCCACTCATCAGGGTTGAAACCGCCACCGGTGAGCTGGCGAAAACGCAGCGCCGCAGCCTGGCGGATACCCTTCAGCAGTCCGGTGGCGAAGACGGTGGCAGTGTGGTGTTCCCGCCGGTGCTGGTGCAGATGCTCGACCGGCTGGAAAGTGAAATCCTGGCTGACCGGGTGAGTGAGGAAAGCCGCCGCTGGCTGGCATCGTGCGGCCTGACGGTGGCGCAGATGCAAAGCCAGATGGACCCGGTATACACGCCGGCGCGAAAAATTCACCTGTACCACTGCGACCATCGCGGCCTGCCGCTGGCCCTTATCAGCACGGAAGGGACAACAGCGTGGTACGCAGAATACGATGAATGGGGTAACCTGCTGAATGAAGAGAACCCGCATCAGCTGCAGCAGCTTATCCGCCTGCCGGGGCAGCAGTATGATGAGGAGTCCGGCCTGTATTACAACCGCCACCGCTATTATGACCCGCTGCAGGGGCGATATATCACTCAGGATCCGATTGGGCTGAAAGGGGATGGAATTTTATCAGTATCCGTTGAATCCGATCTCAAATATAGATCCATTAGGATTAGAAACACTAAAATGCATTAAGCCACTGCATTCAATGGGCGGAACTGGTGAAAAAGCGGTCCAGATATATGGGGAATCCGTTCTATCATCAATATCTTTGTGTCCCAGATGGTAAAGGGACTATACTTGTGGTGGCCAAGACCAACGGGGAGAATCAAAGGAGATGGTCTATGGGGGCCAGGTAAAGCAAGTAATGATACAAAAGCTGCTGGCCGTTGTGACCTCGTTGAAACCGATAATAGTTGTGTGGAGAACTGTTTAAAGGAAGTTTAAAGAGGTAAGGCCGCGTTATTCTGTATTGCCTGATATATTCACACCTATAAATTTAGGGCTATTTAAAACTGCCAAGACTGGTCTAATGATTCTTTAGAAACATGTAAGATGAAGTGCTCCGGAAATAACATTGGACGTTTTATTAGATTTGTATTCACCGGAGTGATGTAATGAAATATATTATTTTTTATTCAGAGCTATATGGCTGGCTTTATCGCTTTTAATACTATTCTTTTCCATGCATAGACTTTCACTATTAGACTCCACTCGTGATGTGAGCGAGTTAATTAGTCTCATGTCTTATGGAATGATGGTAATATGTTTTCCAACAGGCATAGTATTCTTTATTGCTCTAATATTTATAGGGACTGTATCAGACATTATTGGCGTAAGTTGATGATATAAGTATATTATGGCGATAATAATATGGCTTTATTTTCTGTCAGGAGGGTATATTCAATGGTTTGTATTAAGTAAGCGCATTATAAACAAATAAATTAAGTTAATTGCTCTTATTATTATATGTAACCTGGCAAGACAGAACGCCGAAGATAGAGCGACAGGCAAAGCAGCAATACGTAACTT
+>5e348aa0-252a-4ba2-b659-f460207d0f86 id=23 clr=0,3596
+TTGGTATTGCTTCGTTCAGTTGCGTATTGCTACTTGCTGTCGGCTGCTATCTTCGGCGTCTGCTTGGGTGTTAACTAGATGGCTTTCCCGGCATCGTACTGTGTCCCGTTTCTGCTGCCGTCGGGGCAGCCATGACGGTGGTCAGGTCACCGGCGGCTTGTATTCATACCGCGTTTCATGGCCCTGCGTGTCTTTCTGGCAATTAACTGTCCACGGCTGTCGTATGCGCCGGTACTGACTCAGCCCTTCCTCGCGGTGCACCGCCGTCCACCTGACCAAAACGGTCATGGTCGCGGGTTACATAACCGGAACAGTCGTGAAGCTCAACCTTTGACCGTAACGGCTCCACGTCATGGTTTTCCGGCTGCCGGTGGCATCTTCCGTTGCGCAGGGTAAGTCACTGTGTGGATTATCATAACGGTAGCGGGTGATATCGCCGTCAGGGGCAGTTTCCTGAATCAGACGGCCCCATTCATCATATTCCGGCGTATTTCCAGCCCGTCAGGCCCGGTGGCTGACGTTAACTGGCTGGTGGTTATAGTAAAACGCCGATGCCCTGCCATCCGGCGTGGTGATGCGCGTGATGAGGCCCGTCACCACATCCGGACTGTATTCTGTGTCCTGCCTGCGGCATCCGTCTGTGCCCTGGAGCCTGCCCACCGCGTCAAACTGACTCTGCGTGACGCTGCCGTCCGCGTGTTCCTTTTTCACCACTTCAGCCCGCCTTCACCCTGCGTGCAGGACTTCACGGCGGTTCAGGCTGTCGGTGATGGTGATGCGTCCTTCTCATACTGATACGTGTAACTTAAGCCTGCCGGGTTTAGCTGTTCTGTCACCCGCCCGTCGCTGTCGTAACGGTAACAGATTTCCGGTCGGCCCGTGTGACGGTGCGCCACCATCCGGCGGTATTTATCATCGTAAGTAAAGCTGCGCACCTGTGTGCTGCGGTCATACACCGCCGCCAGTTCGCCGCGGGGCGTCAGCCATAGCGCACCAGCGGCGCGGCAGGTAAATTCTCCGGGTATTCCGGGTCGTGCGTCCAGCCACGGCAGACAGACGGATGCCGTTGTCCCGCCATATTCGGTGTAACCCGGCAGGGTATCAGGCGGACGGTTCCGTCCCGCCGGAAATGGCCTGCTGCCGGGCTTCTTCTGCCCGCTGCGCCTGCGTGGTCAGTACCAGCCGGAAGTGACGCCCGGCACCATCCGTCACGCCGGTGATTTCGCCGCTGAATTCACCGGCGGCTTCGCGGTGGAACGTCTGTGTGCGCCCGAAGCGGTCCACCAGCCCGGTCAGTACCCGGTACGGCGGCAGCGGCGCAGGCAGCACCTCATCCGCTTCCGGCACCCGCTCACACCAGCCGAGCAGCCACCACGGCCCCTGCGGACTGTTTGTCGCCAGATAACGATGCGGACTTAAGCGGAGTTCTTCCGGCAGCGCCTGCCAGAGTGCGGCCAGCCGGTGACCTTCATCCAGTTTCGCCACGCCGCCGCGCACCAGCCACAGTGACTCGCTGCGGCTGTAACCGTCCTCACCGGGAAACAGGTGCTCAAAATACAGGCTTCTGCCGCCGTTATCACTGAGTATCAGTGTGTTATCGCCAGCTGTAAGCGGATATCCGCAGGCATTTTCCAGCCGGGGCCGAGGCTCCCCACCGGCGCGGGCGTTTTTGTCCGGTAACTGCTGTAGGTGCGGGAGAATGAACGGCAGCGGGCCGGGCAGGGCGATGTCGGTTTCACCGGGAAGGACCTTTGCACCGAGCAGCGGATTGACCGGATGGCCGGACGTCACCCCGCCGGGGCACACCGAACAGGCCACGCCGGTGGGGGCACCGATGCGTACCCCGCTGAACCCTGGACAATGCTACCGCCATACTGCGTCATGTCGCCCTGACGCGCCGCCGGTTTTCCGCTCATCTGCTCATCATCTTGTTTTATCGGGTTATTTGTCTGCTGACAGGCGAAACCCTACAGATTTATAAGAAAGCCTTAAGTGAGATATCTGTCAGATAAGAACAATTAGGAAAATATTTATATATATTTCATGAATATATGTTTCGATTGGTATAACGATGTCTAAATATTCCTCTGAACATCTTCCTGATGCAAAAAACCGCCAGCGTTTCCGCTGGCGGTTTTCAATGTATTCAAACTCAGCAATCAATAAAAATCACCAGTTGCCTTTTCGGCCTGATCCATCCACACCGGTTTATCGCTGGTTTTCGACCAGACGCGATGCAGGTAGCTAAAAGCGGGCGCGGTCTTTCCAGAAAAGCATGAAAGGCAGCGCCAGAACGCCCGCTGCAACCGCATAAGTACGGCGTAAAAAGATAAGCCATGCAGGATATTCTCTGTAGAGTTCCATACTTTTCTCCCCTTTTGTATCTACCCGGTGAATGGCACCGGAAAAATGAATTTGTTTATCTGATGAAAATAGTACCGCCTTTTGTGTAATTTTACTACTCATCGACCACTTATTTTTGCTTATTGATGGTTTATTTACATTCATCCTGTAATTAAGTTACACAAAGTTAAATTAATACTAAACATTAGTTAAATCATGGCTTTTGCCATTTTATATACTTTTACACCCGCCCGCAGATTTTGCGAAATCTTTGCAGCCAAATTCTACCCTTCCGGTATCACTTTTAGGCCACTGGAGGTGCACTGAGTGCAGGCGTGATAACCGGCGTATTGCTGGTGTTTTATTACTGGGTTATCTGGTTTATGCCCTGATCAATGCGGAGGCGTTCTGATGGCTGCGCAAGGGTTCTTACTGATCGCCACGTTTTTACTGGTGTTAATGGTGCTGGCGCGTCCTTTAGGCAGCGGGCTGGCGCGGCTGATTAATGACATTCCTCTTCCCGGTACAACGGGCGTTGAGCGCGTACTTTTCGCGCTTGGCGTCTCTGACCGTGAGATGAACTGGAAGCAATATCTTTGTGCCATTCTCGGCCTGAACATGCTGGGGCTGGCGGTGCTGTTTTTATGTTGCTCGGTCAGCACTATCTGCCGCTTAATCCACAGCGGTTGCCAGGGCTGTCGTGGGATCTGGCGCTGAATACCGCCGTCAGCTTTGTCACCAATACCAACTGGCAATCTTATAGCGGTGAAACCACGTTGAGCTATTTCAGCCAGATGGCGGGCTTAACGGTGCAAAACTTTCTTTCTGCCGCCAGCGATTGCGGTGATTTTTGCCCTCATCCGTGCGTTTACCCGCCAGAGCATGAGCACGCTCGGGAATGCCTGGGTCGATCTGCTACGCATCACGTTATGGGTGCTAGTCCTGTGGCGTTGTTGATTGCACTGTTTTTATTCAACAAAGTGCGCTGCAAAACTTTCTGCCTTATCAGGCTGTGAATACCGTTGAAGGAGCGCAACAGCTGTTACCATGGGGCCTGTAGCTTCTCAGGAAGCGATCAAGATGCTCGGTACTAACGGCGGTGGCTTCTTTAATGCCAACTCGTCGCATCCGTTTGAAAACCAACCGCGACCAACTTCGTGCAGATGCTGGCGATCTTCTTGATCAACGGCGCTGTGCTTTGCTTTGGTGAAGTGAGGTTAAACACCCAAACAGACGCCGCAATATCCAGCACC
+>f3bfcfc6-b5f3-4573-a280-2718d104f8d4 id=24 clr=0,6361
+TTGGTATGCTTCGTTCAGTTGCATTGCTGCTTCGCACCGCTCTATCTTGGCGTCTGGCGGAATTGCCGCGCCCATCAGCACCAGCGTCAGGGTAACCAGAATTGCCAGTGCAGTCAGTTTCATCTCGCGTACGTCGATTTTTTACCCAGATATTCCGGTGTACGACCAATCATCAGCCCGGCAATAAACACCGCCAGCAGGACAAACAGCATCATGCCGTAAAGACCAGAACCGACACCGCCGAACACCACTTCACCAATTTGCATCAGCCACATCGGCACCATGCCACCGAGCGGTAAACGAATCATGCATCGCAATCACCGCGCCACAGGAAGCCGCCGTCGTCACGACCGCAAACAGGCTACTGACCAGCACGCCGAAACGGCTCTCTTTACCTTCCATATTGATGCTGCTGTCCGTGCCCAGTGCCAGCAGATGAGGATTACCCTGAACTTCTGCCCACATCACCACGCCTACGCAGATGACAAAATCACTGACATCGCCCACAGCAACATGCGCCCCTGGCGGCGATCGCCCATCACTTCACCAAAGGCAAAGCACAGCGCCGTTGGGATCAAGAAGATCGCCAGCATCTGCACGAAGTTGGTCAGTGCGGTTGGGTTTTCAAACGGATGCGACGAGTTGGCATTAAAGAAGCCACCGCCGTTAGTACCGAGCATCTTGATCGCTTCCTGAGAAGCTACAGGCCCCATGGGTAACAGCTGTTGCGCTCCTTCAACGGTATTCACAGCCTGATAAGGCAGAAAGTTTTGCAGCGCACCTTGTTGAATAAAAACAGTGCAATCAACAACGCCACAGGGACTAGCACCCATAACGTGATGCGTAGCAGATCGACCCAGGCATTCCCGAGCGTGCTCATGCTCTGGCGGGTAAACGCACGGATGAGGGCAAAATCACCGCAATCCGCTGGCGGCAGAAAGAAAGTTTTGCACCGTTAAGCCCGCCATCTGGCTGAAATAGCTCAACGTGGTTTCACCGCTATAAGATTGCCAGTTGGTATTGGTGACAAAGCTGACGGCGGTATTCAGCGCCAGATCCCACGACAGCCCTGGCAACTGCTGTGGATTAAGCGGCAGATAGTGCTGACCGAGCAACATAAAAACAGCACCGCCAGCCCCAGCATGTTCAGGCCGAGAATGGCACAAAGATATTGCTTCCAGTTCATCTCACGGTCAGAGACGCCAAGTGCGCGAAAAGTACGCGCTCAACGCCCGTTGTACCGGGAAGAGGAATGTCATTAATCAGCCGCGCCAGCCCGCTGCCTAAAGGACGCGCCAGCACCATTAACACCAGTAAAAACGTGGCGATCAGTAAGAACCCTTGCGCAGCCATCAGAACGCCTCCGCATTGATCAGGGCATAAACCAGATAACCCAGTAATAAAACACCAGCAATACGCCGGTTATCACGCCTGCACTCACAGTGCACCTCCAGTGGCCTAAAAGTGATACCGGAAGGGTAGAATTCTGGCTGCAAAGATTTCGCAAAAATCTGCGGGCGGGGTGTAAAAGTATAAAATGGCAAAAGCCATGATTTAACTAATGTTTAGTATTAATTTAACTTTTGTGTAACTTAATTACAGGATGAATGTAAATAAACCATCAATAAGCAAAAATAAGTGGTCGGATGAGTAGTAAAATTACACAAAAGGCGGTACTATTTTCATCAGATAAACAAATTCATTTTTCCGGTGCCATTCACCGGGTAGATACAAAGGGGAGAAAAGTATGGAACTCTACAGAGAATATCCTGCATGGCTTATCTTTTTACGCCGTACTTATGCGGTTGCAGCGGGCGTTCTGGCGCTGCCTTTCATGCTTTTCTGGAAAGACCGCGCCCGCTTTTACAGCTACCTGCATCGCGTCTGGTCGAAAACCAGCGATAAACCGGTGTGGATGGATCAGGCCGAAAAGGCAACTGGTGATTTTATTGATTGCTGAGTTTTGAATACATGAAAACCGCCAGCGGAAACGCTGGCGGTTTTGTATCAGGAAGATGTTCAGAGGAATATTTAGACATCGTTATACCAATCGAAACATATATTCATGAAATATATATAAATATTTTCCTAATTGTTCTTATCTGACAGATATCTCACTTAAGGCTTTCTTATAAATCTGTAGGGTTTCGCCTGTCAGCAGACAAATAACCCGATAAAACAAGGATGAGCAGATGAGCGGAAAACCGGCGGCGCGTCAGGGCGACATGACGCAGCGGTAGCATTGTCCAGGGTTCAGCCGGGGTACGCATCGGTGCCCCACCGGCGTGGCCTGTTCGGTGTGCCCCGGCGGGGTGACGTCCGGCCATCCGGTCAATCCGCTGCTCGGTGCAAAGGTCCTTCCCGGTGAAACCGACATCGCCCTGCCCGGCCCGCTGCCGTTCATTCTCTCCCGCACCTACAGCAGTTACCGGACAAAACGCCCGCGCCGGTGGGGAGCCTCGGCCCCGGCTGGAAAATGCCTGCGGATATCCGCTTACAGCTGCGCGATAACACACTGATACTCAGTGATAACGGCGGCAGAAGCCTGTATTTTGAGCACCTGTTTCCCGGTGAGGACGGTTACAGCCGCAGCGAGTCACTGTGGCTGGTGCGCGGCGGCGTGGCGAAACTGGATGAAGGTCACCGGCTGGCCGCACTCTGGCAGGCGCTGCCGGAAGAACTCCGCTTAAGTCCGCATCGTTATCTGGCGACAAACAGTCCGCAGGGGCCGTGGTGGCTGCTCGGCTGGTGTGAGCGGGTGCCGGAAGCGGATGAGGTGCTGCCTGCGCCGCTGCCGCCGTACCGGGTACTGACCGGGCTGGTGGACCGCTTCGGGCGCACACAGACGTTCCACCGCGAAGCCGCCGGTGAATTCAGCGGCGAAATCACCGGCGTGACGGATGGTGCCGGGCGTCACTTCCGGCTGGTACTGACCACGCAGGCGCAGCGGGCAGAAGAAGCCCGGCAGCAGGCCATTTCCGGCGGGACGGAACCGTCCGCTTTTCCTGATACCCTGCCGGGTTACACCGAATATGGCCGGGACAACGGCATCCGTCTGTCTGCCGTGTGGCTGACGCACGACCCGGAATACCCGGAGAATTTACCTGCCGCGCCGCTGGTGCGCTATGGCTGGACGCCCGCGGCGAACTGGCGGCGGTGTATGACCGCAGCAATACACAGGTGCGCAGCTTTACTTACGATGATAAATACCGGGGCCGGATGGTGGCGCACCGTCACACGGGCCGACCGGAAATCTGTTACCGTTACGACAGCGACGGGCGGGTGACAGAACAGCTAAACCCGGCAGGCTTAAGTTACGTATCAGTATGAGAAGGACCGCATCACCATCACCGACAGCCTGAACCGCCGTGAAGTCCTGCACGCAGGGTGAAGGCGGGCTGAAGCGGGTGGTGAAAAGGAACACGCGGCAGCGTCACGCAGAGTCAGTTTGACGCGGTGGGCAGGCTCAGGGCACAGACGGATGCCGCAGGCAGGACAACAGAATACAGTCCGGATGTGGTGACGGGCCTCATCACGCGCATCACCACGCCGGATGGCAGGGCATCGGCGTTTTACTATAACCACCACAGCCAGTTAACGTCAGCCACCGGGCCTGACGGGCTGGAAATACGCCGGAATATGATGAATGGGGCCGTCTGATTCAGGAAACTGCCCCTGACGGCGATATCACCCGCTACCGTTATGATAATCCACACAGTGACTTACCCTGCGCAACGGAAGATGCCACCGGCAGCGGAAAACCATGACGTGGAGCCGTTACGGTCAGTTGCTGAGCTTCACTGACTGTTCCGGTTATGTAACCCGCTATGACCATGACCGTTTTGGTCAGGTGACGGCGGTGCACCGCGAGGAAGGGCTGAGTCAGTACCGCGCATACGACAGCCGTGGACAGTTAATTGCCGTGAAAGACACGCAGGGCCATGAAACGCGGTATGAATACAACGCCGCCGGTGACCTGACCACCGTCATTGCCCCGGACGGCAGCAGAAACGGGACACAGTACGATGCGTGGGGAAAGCCATCTGTACCACGCAGGGCGGTCTGACGCGCAGTATGGAATACGATGCTGCCGGACGGGTCATCCGCCTGACCAGTGAAAACGGCAGCCACACCACCTTCCGTTACGATGTACTCGACCGGCTGATACAGGAAACCGGCTTTGACGGCCGCACACAGCGTTATCACCACGACCTGACCGGCAAACTTATCCGCAGCGAGGATGAGGGCTGGTCACCCACTGGCACTATGACGAAGCAGACCGCCTCACGCACCGCACCGTGAATGGCGAAACCGCAGAGCGGTGGCAGTATGACGAACGCGGCTGGCTGACAGACATCAGCCATATCAGCGAAGGGCACCGGGTGACGGTGCACTATGGTTATGACAGTAAAGGCCGCCTCGCCAGTGAACACCTGACGGTGCATCATCCGCAGACGAATGAACTGCTCTGGCAGCATGAGACCAGACATGCGTACAACGCACAGGGACTGGCGAACCGCTGTATACCGGACAGCCTGCCTGCGCCGTGGAATGGCTGACCTACGGCAGCGGCTGGCTGTCAGGCATGAAACTCGGCGACACACCGCTGGTGGAGTACACCCCGACCGCCTGCAGGAAACGCTGCGCAGCTTCGGCCGTTATGAACTCACCACCGCTTATACCCTGCCGGGCAGTTACAGAGCCAGCACCTGAACAGCCTGCTGTCTGACCGCGATTACACCTGGAACGACAACGGCGAACTCATCCGCATCAGCAGCCCGCGCCAGACCCGGAGTTACAGCTACAGCACCACCGGCAGGCTGACCGGCGTTCACACCACCGCAGCGAATCTGGATATCCGCATCCCGTATACCACAGACCCGGCAGGTAACCGCCTGCCCGACCCGGAGCTGCACCCGGACAGCGCCCTCAGCATGTGGCCGGATAACCGTATCGCCCGTGACGCGCACTATCTTTACCGGTATGACCGTCACGGCAGGCTGACAGAGAAAACCGACCTCATCCCGGAAGGGTTATCCGCACGGATGATGAGCGCACCGGTACCATTACGACAGTCAGCACCGGCTGGTGCACTACGCGGACACAATATGCAGAGCCGCTGGTCGAAAGTCGCTATCTTTACGACCCGCTGGGCCGCAGGGTGGCAAAACGGGTATGGCGGCGTGAACGGGACCTGACGGGCTGGATGTCGCTGTCACGGAAACCGCAAGTGACCTGGTACGGCTGGGACGGCGACCGCCTGACCACGATACAGAACGACAGAACCCGCATCCAGACGATTTATCAGCCGGGGAGCTTCACGCCACTCATCAGGGTTGAAACCGCCACCGGTGAGCTGGCGAAAACGCAGCGCCGCAGCCTGGCGGATACCCTTCAGCAGTCCGGTGGCGAAGACGGTGGCAGTGTGGTGTTCCCGCCGGTGCTGGTGCAGATGCTCGACCGGCTGGAAAGTGAAATCCTGGCTGACCGGGTGAGTGAGGAAAGCCGCCGCTGGCTGGCATCGTGCGGCCTGACGGTGGCGCAGATGCAAAGCCAGATGGACCCGGTATACACGCCGGCGCGAAAAATTCACCTGTACCACTGCGACCATCGCGGCCTGCCGCTGGCCCTTATCAGCACGGAAGGGACAACAGCGTGGTACGCAGAATACGATGAATGGGGTAACCTGCTGAATGAAGAGAACCCGCATCAGCTGCAGCAGCTTATCCGCCTGCCGGGGCAGCAGTATGATGAGGAGTCCGGCCTGTATTACAACCGCCACCGCTATTATGACCCGCTGCAGGGGCGATATATCACTCAGGATCCGATTGGGCTGAAAGGGGATGGAATTTTATCAGTATCCGTTGAATCCGATCTCAAATATAGATCCATTAGGATTAGAAACACTAAAATGCATTAAGCCACTGCATTCAATGGGCGGAACTGGTGAAAGAAGCGGTCCAGATATATGGGGAATCCGTTCTATCATCAATATCTTTGTGTCCCAGATGGTAAAGGGACTATACTTGTGGTGGCCAAGACCAACGGGGAGAATCAAAGGAGATGGTCTATGGGGGCCAGGTAAAGCAAGTAATGATACAAAAGAAGCTGCTGGCCGTTGTGACCTCGTTGAAACCGATAATAGTTGTGTGGAGAACTGTTTAAAGGAAGTTTAAAGAGGTAAGGCCGCGTTATTCTGTATTGCCTGATATATTCACACCTATAAATTTAGGGCTATTTAAAACTGCCAAGACTGGTCTAATGATTCTTTAGAAACATGTAAGATGAAGTGCTCCGGAAATAACATTGGACGTTTTATTAGATTTGTATTCACCGGGTGATGTAATGAAATATATTATTT
+>3221ccdb-0395-4983-8a44-e5558664096f id=25 clr=0,12590
+TGGTAACACTTCGTTCAGTTACGTATTGCTACTTGCCTGTCGCTCTATCTTCGGCGTCTGCCCGGGTGTTTAACCTGGCGACCATAAAATTCTCGTGCAGATTCGCAATTCTCAAAGACACCCGAAATACAGGGCAAATACTCTGCGAATTACACACGTTCTGATTTTCGGTAGCAATAAATGCCGGGATGCCATAACCCGTGGCATCGATTTCATCGGGGATTTCCGCCATAACATCGTTGAACTGATAAAACTATTGCCGCCACATCGATATTACGACTTTCATTAATGTAGATACATTCTCGCTGCGTGGTAAAACGGTCCGGGCAAGAATCTAACTAACCGCAATTTTTAATTTTGGCATTTTCATCTCTTTATTTTAGGTAATAGCAGGTCCTCAATTTCTCGAATGAGAAATCGATCGTGCTGAAAAAGCAAAATTACCCCGCTGATAAATAAATCAGGTGATTGCTTTTTCTGAGAATCTGAGAGCCTGGTCAGGTGGCTGATAATGGGGTTAACAGAGAATGAGCACTGCGGAGCTAAGGCATATACCTGTAGCCTGAAAGTCAGGAAGACTGTACGCTGAAGTGCCTGAGTCGGTAGACTAACGGGCATTGAAAGTGAAGATCGAAGCTATTGCGATGAGCAAACTTCATAATATGGAGTTGTCCGCCTTATATGGGAGCATAAACGGCTGTTATTTTCCATTTAATTTACCTTTCCTGATGATGTGGAATGAAGGTGAAGATATTATCAGGAAATACCTGGTTGAACCGTGAAGGTGATCAATAAAAATGATCAATCTTAATTTATTTAATGATGAGCTTTTTACTCAGTAATATAAAATATTGAATTGTTATTTTGTGTGTTGTTTTAAGATAAAAGCCGGCAATTTATTAATACGGCTTTAATTAATAAAAAGGCAGGCTGTATTAAAATTAATATTCAAAGCATAAACCGATAGCCAATACCGGTTTCAGTAATGAAATGGCGTGGGCGGGCGGGATCCTGTTCCAGTTTTTGTCGCAGATGTCCCATATAAATACGCAAATGGTGACTGTGTTCGACCGCGTTTGGCCCCCACCTGGTTAAGGAGCTGGCGCTGGGTGAGTACTTTCCGGCATTGTTGAGCAGCACCGCCAGCAGGCGGAACTCAATTGGTGTGAGATGCACCTCTTCTCACCCATTCTGAATCACGCGGGCGGCTAAATCGACGGTAACATCGGAAAATTTTACCAGCGGATCGGGCGCGGTGGTGGCAGAGTGTAGCGGCGTAACGACGCGCAGACGGGCCTGCAATTCGCCAATGCCAAACGGCTTACTCGATAATCATCCGCTCCGGCATCCAGCGCGGCGATTTTGTCGCTCTTTGCTGCGCGTGCGGAAAGCACAATCACCGGCACCGCGCTCCACTGGCGCAGGTCGCGGATAAACTCAATCCCATCACCATCGGGCAGGCCGAGATCGAGAATAATCAAATCTGGCTTACGGGTTGCCGCTTCCAGCAAGCCGCGTTGCAGCGTTTCGGCCTCAAAGACGCGCATCCGTCGCCCTCCAGCGCCGTGCGCAGAAAGCGACGAATAGCCTGTTCATCTTCAACAATCAGAACGTTTGTCACATATCCTCATGAAATTCTTCAGTTCAGGGGCAGTTTGCTGGGGAAGTGTAACACGAAAACAGGCACCACCTTCCGGTCGGTTGAACGCGGTAATAGTGCCCCCGTGTACATCCACTATCGCCCGACAAATTGCCAGTCCAAGCCCTACCCCCGTACTGCCGACTCTTTTATTCCCGCGAGCAAACTTATCAAATATCGTCTGCTCCTGGCCTGGCGGAAGACCGGGGCCGTTATCCCAGACATCCAGTTGTAGATTTTCGCCCTCAACGTGGGCATCGATACCAATTTCGGCCTGCGCACCGCATATTTCACCGCGTTCTCCAGCAGATTAATCAGCACCCGTTCAAGAGTGGCCCGTCAACGTGGATTAAGGTCAGCGGTTCTGGCAGAGAAAGATTGATGGGCGACGATAAACCCGGTTCCAGCATTTGCAGCGCTGCCGACTACTTCTTCCAGCGTTAACCACTCTTTCTTCAAATTAAAGCCGCCGGACTGAATTCGCGCCATATCCAGTAGATTATTCACCAGTCGGGTAGTGTTCAGCATGCTGACGGATCTCGCTGGCCTGGCGGGCGTGGGTGATCCTCGCTTCGCCAGATCGAGCGTTAAGATTTCTGCCTGACCAAACAGCACCGTAAGCGGCGTGCGTAAATCATGCGAAAGCGCCGCCAGCAGGGCGTTGCGGATCTGTTCACGTTCGCTTGCCATCCGCGCCTGTTCTTCGCTGGCGGTTAGCGTCAGCCGCTCAGGGCATTGGCGACTAACAGCGTAACGTCTCCAGCAGGCGCTGCTGTTCCGGATCATCAACTGGCGCAGATCCCCGGCTCCACCACCACCAGCCCGTAGGTTTTCTCGCCGCTTTTAGCGGCAAAATCTGGCACGGTACACCGGGTAACGTGTCGGTGCCCGCGCCCGCAGGCAGGCCTTTATCAAAACTCCACTGCGCGATGGCATCGTCCCACGGCGTCATTCCTTGCGGATGTGTTAACGGCTGCAATTTACCGTTGTCATCGGGCAACAACACCTGACTGCGGGCATGAAACGTGGAGGCAATAAATTGTTCGCTGGTGGCAGCGATATCCTGCGGACTGCGGCCCACCGCCAGAGCTTTCGACATTTCATATAAGTGCCGTGTGCGTTGCTCGCGGTAACGGGCTACCCGCGCCTGATAACGCACGCCAGCAGTAAGGTTCCCGATCACCAGCCCGACGGTTAACATCACCGCGAAGGTCAGCAGATATTGCACATCAGAGACGGCGAGCGTGCCGCGTGGGGCGATAAAAAGAGATCGAAACTCACTACATTAATGACGGTGGCAACCACTGAAGGCCAGCGTCCATAAAATAGCGCCACCACCACCACGCCAAGCAGATACAGCATCACCAGGTTGGCGGCATCAAACGCCATCAGCCACTGCATGGCAATTAAGGTGATAACGGCGCATAACGCGGCGGCAACCACGCATCCCTGAATTTGTACACGCCACTTGTCTTTAAAAGAGCGGTTATCCGGCGCGTTGTTAATCGTGCGGGCGGGTGGTTCATCAAGCGCGACCAGCACCTGATCGAGATCGGGGCGATGCGCGCCAGTCGGTCAGCAAACGTTTCCCGACGCCCACCAGCGGCGCGAGGCCGGGCGACCGAGAATAATCTTGCCGAGATTATGTTCACGGGCATAACGCACTACCGCTTTCTCTTCCGCTGGATCAGAAAGTGTTGCCGTCTCGCGCCCAGTTCCTGCGCCAGACGTAAGGCGCTGAGAATTGCCCGACGTTTTTTCCGGTAAGCGGTGCAGGGCAGGGGTTTCAACATACACCGCGTGCCAGACGCTACCCAGCCGTGACGCCAGCCGCGCCGCTGCGCGGACCAGTTTTCGCTGCCGGTGTTATGGCCGATGCATAAAAGGATCGCGTCGCGCGTGTGCCACACTTTCTCTTCGCCAGGATGCCCCGCCAGGCGCGCATTTGCTCATCAACGCGATCGGCAGTACGGCGCAGTGCCAGTTCGCGCAGGGCGATCAGATTACCTTTGCGGAAAAATGTTCAATGGCGCGCTCCGCCTGCCCGGCAATATAGACTTTGCCTTCTTTCAGCCGCTGGCGCAGATCGTCCGGGGCAAGTCCACCAGCACCACGTCGTCGGCGGCATCGAAAAGGATCGGGCACGGTTTCCCGTACCTGAATTCCGGTGACGCCGCTGACCACATCATTCAGACTTTCCAGATGCTGAACGTTGACGGTAGTGAAAACATCAATGCCAGCTTCCAGCAGTTCTTCGATATCCTGCCAGCGTTTGGGATGACGGGAACCTGGCGCATTACTGTGCGCCAGTTCGTCCATTAAGATCAGCGCCGGGCGGCGGGCGAGGGCGGCATCGAGATCAAACTCGCTGATATGCCGCCCACGGTACGCCTGGCGTTTTAACGGCAGAACAGCCAGCCCTTCCAGCATGGCGGCGGTATCTTTCGCCCGTGGGTTTCTACCACGCCAACCACAATATCCAGCCCTTGCGCCCGCAGTCGCTGGGCTTCTGCCAGCATCGCCCAGGTCTTCCCGACGCCTGCACAGGCACCGAAGACTTTCAGCTTCCCCGATGCGGCGCGGCAGTTTGTTCCAGCAGACGATCGGGGTCGGGACGTAAGGGTTCGTTATTCATCAAGTTTATCCAGCGCCAGATTGAGTTCAACAATGTTGACAACCGGCTGGCCGATATATTTCACCAGCGGTTGTTGGCTGTATTTTGCGATCAGTTGCGTGAGCTGTTCAACGCTGAGATTACGCGCTTTCGCCACGCGTGGGATTTGCCAGGCCGCCGCTTGCGGGTGATATTATTGTCCAGCCCGCTTGCCGATGCCGTCACCAGTTCAACCGGAACGCTCGCGCTGGCATCCGGGTTAGCGGCCCGTAATGCAGCAACGCGTGCGGCTATTAGTTTATCCAGCTCAGGGTTACTGACCGCCAGATTGCTCCCGCCAGAAGCCTGTGGATTATAGGGCATTTCTGCCGTTGCCGACGGGCGACCATGAAAATAGCCGTTGCCGGTAAATTCTGCCCGATTAATGCCGAACCGCGCACCGTATCACCTTCACGAATCAACGAACCATTGGCCTGCCAGGAAACCACCATTGCCCCAGTACGGTGGTCAGCAGCGGGTAAACGCCGCCAGTAATCAATAACAGAAAGATAAATGTTGATAATGCCGGACGTAATCCACTCATGGTAAACCTCACACCAGACCGCAAACGGTCAGCAGTAAATCAATGACTTTGATACCGATAAACGGCACCAGCAGCCCACCCAGACCGTAAATCCATAAGTTACGGCGCAACATGGCAGAAGCGGTAAGCGGTTTATAACTCACGCCTTTAACGCCAGGGGAATCAAAGACGATAATCAAGGCGTTGAAAATCACCGCACTGAGGATTGCGGAGTCGGGCGAATGCAGGCACATGATGTTCAGCGCATTTAACTGCGGATACGTTGCCGCGAATGCCGCCGGAATAATGGCGAAGTATTTCGCCACATCGTTACAATGCTGAAGGTGGTCAGCGAGCCACGGGTCATCAGCATCTGTTTGCCAATGTGCACCACCTCGATCAACTTGGTCGGGTTAGAGTCGAGATCGACCATATTGCCCGCCTCTTTCGCCGCCTGGGTGCCGGAGTTCATCGCCACCGCGACATCTGCCTGCGCCAGCGCCGGGCATCGTTGGTGCCGTCGCCGGTCATCGCTACCAAACGACCTTCCGCCTGATACTGACGGATCAATGCCAGCTTGGCCTCCGGTGTCGCTTCGGCGAGAAAATCATCGACACCCGCTTCCGCAGCAATCGCGGCGGCAGTCAGACGGTTATCGCCGGTAATCATCACCGTTTTAATGCCCATTTTGCGCAGCTGGGCGAAGCGCTCTTTAATACCGCCTTTGACGATATCTTTCAGCGCAATAACGCCCAGCACGAGAACCTTCCACCACCACCAGCGGCGTGGCTCCTGACGCGCAACCTGATCGACTTTTTGATCAACATCGGTAGGGAAGTGACCACCGTTAGCCTCAACATGGCGACGAATGGCATCGACAGAACCTTTACGGATCATGCGGTTGTCGATGTTGATCCCGCTCATCCGGCTTTGCGCAGTAAACGGTACAAAGGTGGCATGGAGCGACTGCACATCGCGCTCGCGCAGGTTAAAACGCGCTTGGCGGGATCACAATACTGCGGCCTTCCGGCGTTTCATCAGCCAGCGAAGCCAGTTGTGCGGCGTCAGCCAGCGTTTTTCATCCACGCCCTGCGCGGATAAACTCCGACGCCTGACGGTTACCGAGTGTGATGGTGCCGGTTTTATCCAGTAGCAGAACGTCAACGTCACCTGCCGCTTCAACTGCACGTCCGCTGGTGGCAATCACATTCGCGCCTAGCATCCGGCTCATCCCGGCGACGCCGATCGCTGACAACAGGCCGCCAATAGTGGTTGGGATCAGACAGACCAGCAGCGCCACCAGTACCGTTACGCTGACTGCATTACCGCCCACGCGGAAAACGGCCACAGCGTGGCGGTTGCCAGTAAAAGACGATAGTCAGGGCAATCAGCAGAATGGTCAGGGCAATTTCGTTCGGCGTTTTGCGTCGCTGTGCGCCTTCCACCATCGCGATCATCCGATCCAGAAATGTCTCGCCGGGGTTAACGCTACACTCAATCACCAGCCAGTCAGAAAGAATACGCGTGCCGCCGGTGACGGAGGCAAAATCGCCGCCGGATTCACGGATCACCGGTGCCGATTCCCCGGTGATGGCGCTTTCATCGACCGATGCACCCCTTCAATAACTTCACCATCGCAGGGGATAATATCGCCAGCTTCTACCAGTACGATATCGCCTTTACGAAGTTGGTCGGCAGGAACTTTGTCCGCCGCAGCGCCATATTTCGGCTCACGCAGCTTGCGGGCAAAGGCAGTTTTCACCCCTTTCAGACTGTTGGCCTGCGCTTTACTGCGGCCTTCTGCCAGCGCCTCGGCGAAATTAGCGAACAGTACGGTGATCCACAGCCAACCGCTAATGGCCGCGCTAAACAGCGCATTGCCGGGCATCGCACCGCTTGCCATCGCGATGCTAATACAGGTGGTCAGCAGACTGCCGATCCAGACGATAAACATCACCGGATTGCGCCATTGCGCCTGCGGGTTTAATTTTTCACCGCTTCTTTCAGCGCCTGAACGACAAGTGTTGGTTCGAATAGCGCCAGTTGTTTACGACTCATATTCAGTGCTCACTCAATATCATCAGGAGAGATATTCCGCCACCGGACCAAGCGCCAGGGCAGGGATAAAGGTCAGTGCGCCAACCAGCAACACGGTGCCGATTAACAGGCCAACAAACAGCGGGCCGTGCGTTGGCAGCGTGCCGGAGCTGGCGGCTTGGCTCTTTTACTCACCAGCGAACCGGCAATTGCCATCACCGGGATAATCACCCCGAAGCGACCGACAAACATGCAGAACGCCAGTAAACAGTTCCAGAACGGAGAGTTGGCGCTTAATCCGGCAAAGGCGCTGCCGTTGTTGTTAGCGGCGGATGACACGGCGTACAGCACTTCGCTAAAACCATGCGGGCCAGGGTTGAGCATGGCGCTACGTCCGGCGTCGGTCATCATCGCCAACGCCGCGCCCATCAGCACCAGCGTCGGGGTAACCAGAATTGCCAGTGCAGTCAGTTTCATCTCGCGTACGTCGATTTTTTACCCAGATATTCCGGTGTACGACCAATCATCAGCCCGGCAATAAACACCGCCAGCAGGACAAACAGCATCATGCCGTAAAGACCAGAACCGACACCGCCGAACACCACTTCACCAATTTGCATCAGCCACATCGGCACCATGCCACCGAGAGCGGTAAACGAATCATGCATCGCAATCACCGCGCCACAGGAAGCCGCCGTCGTCACGACCGCAAACAGGCTACTGACCAGCACGCCGAAACGGCTCTCTTTACCTTCCATATTGATGCTGCTGTCCGTGCCCAGTGCCAGCAGATGAGGATTACCCTGAACTTCTGCCCACATCACCACGCCTACGCAGATGACAAAATCACTGACATCGCCCACAGCAACATGCGCCCCTGGCGGCGATCGCCCATCACTTCACCAAAGGCAAAGCACAGCGCCGTTGGGATCAAGAAGATCGCCAGCATCTGCACGAAGTTGGTCAGTGCGGTTGGGTTTTCAAACGGATGCGACGAGTTGGCATTAAAGAAGCCACCGCCGTTAGTACCGAGCATCTTGATCGCTTCCTGAGAAGCTACAGGCCCCATGGGTAACAGCTGTTGCGCTCCTTCAACGGTATTCACAGCCTGATAAGGCAGAAAGTTTTGCAGCGCACCTTGTTGAATAAAAACAGTGCAATCAACAACGCCACAGGGACTAGCACCCATAACGTGATGCGTAGCAGATCGACCCAGGCATTCCCGAGCGTGCTCATGCTCTGGCGGGTAAACGCACGGATGAGGGCAAAATCACCGCAATCCCGCTGGCGGCAGAAAGAAAGTTTTGCACCGTTAAGCCCGCCATCTGGCTGAAATAGCTCAACGTGGTTTCACCGCTATAAGATTGCCAGTTGGTATTGGTGACAAAGCTGACGGCGGTATTCAGCGCCAGATCCCACGACAGCCCTGGCAACTGCTGTGGATTAAGCGGCAGATAGTGCTGACCGAGCAACATAAAAACAGCACCGCCAGCCCCAGCATGTTCAGGCCGAGAATGGCACAAAGATATTGCTTCCAGTTCATCTCACGGTCAGAGACGCCAAGTGCGCGAAAAGTACGCGCTCAACGCCCGTTGTACCGGGAAGAGGAATGTCATTAATCAGCCGCGCCAGCCCGCTGCCTAAAGGACGCGCCAGCACCATTAACACCAGTAAAAACGTGGCGATCAGTAAGAACCCTTGCGCAGCCATCAGAACGCCTCCGCATTGATCAGGGCATAAACCAGATAACCCAGTAATAAAACACCAGCAATACGCCGGTTATCACGCCTGCACTCACAGTGCACCTCCAGTGGCCTAAAAGTGATACCGGAAGGGTAGAATTCTGGCTGCAAAGATTTCGCAAAATCTGCGGGCGGGGTGTAAAAAGTATAAAAATGGCAAAAGCCATGATTTAACTAATGTTTAGTATTAATTTAACTTTTGTGTAAAATTACAGGATGAATGTAAATAAACCATCAATAAGCAAAAATAAGTGGTCGGATGAGTAGTAAAATTACACAAAAGGCGGTACTATTTTCATCAGATAAACAAATTCATTTTTCCGGTGCCATTCACCGGGTAGATACAAAGGGGAGAAAGTATGGAACTCTACAGAGAATATCCTGCATGGCTTATCTTTTTACGCCGTACTTATGCGGTTGCAGCGGGCGTTCTGGCGCTGCCTTTCATGCTTTTCTGGAAAGACCGCGCCCGCTTTTACAGCTACCTGCATCGCGTCTGGTCGAAAACCAGCGATAAACCGGTGTGGATGGATCAGGCCGAAAAGGCAACTGGTGATTTTATTGATTGCTGAGTTTTGAATACATTGAAAACCGCCAGCGGAAACGCTGGCGGTTTTTGTATCAGGAAGATGTTCAGAGGAATATTTAGACATCGTTATACCAATCGAAACATATATTCATGAAATATATATAAATATTTTCCTAATTGTTCTTATCTGACAGATATCTCACTTAAGGCTTTCTTATAAATCTGTAGGGTTTCGCCTGTCAGCAGACAAATAACCCGATAAAACAAGGATGAGCAGATGAGCGGAAAACCGGCGGCGCGTCAGGGCGACATGACGCAGTATGGCGGTAGCATTGTCCAGGGTTCAGCCGGGGTACGCATCGGTGCCCCACCGGCGTGGCCTGTTCGGTGTGCCCCGGCGGGTGACGTCCGGCCATCCGGTCAATCCGCTGCTCGGTGCAAAGGTCCTTCCCGGTGAAACCGACATCGCCCTGCCCGGCCCGCTGCCGTTCATTCTCTCCCGCACCTACAGCAGTTACCGGACAAAACGCCCGCGCCGGTGGGGAGCCTCGGCCCCGGCTGGAAAATGCCTGCGGATATCCGCTTACAGCTGCGCGATAACACACTGATACTCAGTGATAACGGCGGCAGAAGCCTGTATTTTGAGCACCTGTTTCCCGGTGAGGACGGTTACAGCCGCAGCGAGTCACTGTGGCTGGTGCGCGGCGGCGTGGCGAAACTGGATGAAGGTCACCGGCTGGCCGCACTCTGGCAGGCGCTGCCGGAAGAACTCCTTAAGTCCGCATCGTTATCTGGCGACAAACAGTCCGCAGGGGCCGTGGTGGCTGCTCGGCTGGTGTGAGCGGGTGCCGGAAGCGGATGAGGTGCTGCCTGCGCCGCTGCCGCCGTACCGGGTACTGACCGGGCTGGTGGACCGCTTCGGGCGCACACAGACGTTCCACCGCGAAGCCGCCGGTGAATTCAGCGGCGAAATCACCGGCGTGACGGATGGTGCCGGGCGTCACTTCCGGCTGGTACTGACCACGCAGGCGCAGCGGGCAGAAGAAGCCCGGCAGCAGGCCATTTCCGGCGGGACGGAACCGTCCGCTTTCCTGATACCCTGCCGGGTTACACCGAATATGGCCGGGACAACGGCATCCGTCTGTCTGCCGTGTGGCTGACGCACGACCCGGAATACCCGGAGAATTTACCTGCCGCGCCGCTGGTGCGCTATGGCTGGACGCCCGCGGCGAACTGGCGGCGGTGTATGACCGCAGCAATACACAGGTGCGCAGCTTTACTTACGATGATAAATACCGGGGCCGGATGGTGGCGCACCGTCACACGGGCCGACCGGAAATCTGTTACCGTTACGACAGCGACGGGCGGGTGACAGAACAGCTAAACCCGGCAGGCTTAAGTTACGTATCAGTATGAGAAGGACCGCATCACCATCACCGACAGCCTGAACCGCCGTGAAGTCCTGCACACGCAGGGTGAAGGCGGGCTGAAGCGGGTGGTGAAAAGGAACACGCGGACGGCAGCGTCACGCAGAGTCAGTTTGACGCGGTGGGCAGGCTCAGGGCACAGACGGATGCCGCAGGCAGGACAACAGAATACAGTCCGGATGTGGTGACGGGCCTCATCACGCGCATCACCACGCCGGATGGCAGGGCATCGGCGTTTTACTATAACCACCACAGCCAGTTAACGTCAGCCACCGGGCCTGACGGGCTGGAAATACGCCGGGAATATGATGAATGGGGCCGTCTGATTCAGGAAACTGCCCCTGACGGCGATATCACCCGCTACCGTTATGATAATCCACAGTGACTTACCCTGCGCAACGGAAGATGCCACCGGCAGCGGAAAACCATGACGTGGAGCCGTTACGGTCAGTTGCTGAGCTTCACTGACTGTTCCGGTTATGTAACCCGCTATGACCATGACCGTTTTGGTCAGGTGACGGCGGTGCACCGCGAGGAAGGGCTGAGTCAGTACCGCGCATACGACAGCCGTGGACAGTTAATTGCCGTGAAAGACACGCAGGGCCATGAAACGCGGTATGAATACAACGCCGCCGGTGACCTGACCACCGTCATTGCCCCGGACGGCAGCAGAAACGGGACACAGTACGATGCGTGGGGAAAAGCCATCTGTACCACGCAGGGCGGTCTGACGCGCAGTATGGAATACGATGCTGCCGGACGGGTCATCCGCCTGACCAGTGAAAACGGCAGCCACACCACCTTCCGTTACGATGTACTCGACCGGCTGATACAGGAAACCGGCTTTGACGGCCGCACACAGCGTTATCACCACGACCTGACCGGCAAACTTATCCGCAGCGAGGATGAGGGGCTGGTCACCCACTGGCACTATGACGAAGCAGACCGCCTCACGCACCGCACCGTGAATGGCGAAACCGCAGAGCGGTGGCAGTATGACGAACGCGGCTGGCTGACAGACATCAGCCATATCAGCGAAGGGCACCGGGTGACGGTGCACTATGGTTATGACAGTAAAGGCCGCCTCGCCAGTGAACACCTGACGGTGCATCATCCGCAGACGAATGAACTGCTCTGGCAGCATGAGACCAGACATGCGTACAACGCACAGGGACTGGCGAACCGCTGTATACCGGACAGCCTGCCCGCCGTGGAATGGCTGACCTACGGCAGCGGCTGGCTGTCAGGCATGAAACTCGGCGACACACCGCTGGTGGAGTACACCCGCGACCGCCTGCACCGGAAACGCTGCGCAGCTTCGGCCGTTATGAACTCACCACCGCTTATACCCCTGCCGGGCAGTTACAGAGCCAGCACCTGAACAGCCTGCTGTCTGACCGCGATTACACCTGGAACGACAACGGCGAACTCATCCGCATCAGCAGCCCGCGCCAGACCCGGAGTTACAGCTACAGCACCGGCAGGCTGACCGGCGTTCACACCACCGCAGCGAATCTGGATATCCGCATCCCGTATACCACAGACCCGGCAGGTAACCGCCTGCCCGACCCGGAGCTGCACCCGGACAGCGCCCTCAGCATGTGGCCGGATAACCGTATCGCCCGTGACGCGCACTATCTTTACCGGTATGACCGTCACGGCAGGCTGACAGAAAACCGACCTCATCCCGGAAGGGTTATCCGCACGGATGATGAGCGCACCCACCGGTACCATTACGACAGTCAGCACCGGCTGGTGCACTACACGCGGACACAATATGCAGAGCCGCTGGTCGAAAGTCGCTATCTTTACGACCCGCTGGGCCGCAGGGTGGCAAAACGGGTATGGCGGCGTGAACGGGACCTGACGGGCTGGATGTCGCTGTCACGGAAACCGCAAGTGACCTGGTACGGCTGGGACGGCGACCGCCTGACCACGATACAGAACGACAGAACCCGCATCCAGACGATTTATCAGCCGGGGAGCTTCACGCCACTCATCAGGGTTGAAACCGCCACCGGTGAGCTGGCGAAAAAGCGG
+>71408c92-f605-49e0-9230-1809837ae8c8 id=26 clr=0,6620
+TTGGTATGCTTCGTTCAGTTACGTATTGCTCTTGCCTGTCGCTCTATCTTCGGCGTCTGGCAGGTGTTTAACCTCCAGTACACGGCGAACGATAGAATTTTGGTCGCGCTCGTTTACCGCCAGATGGTGTCAACGCTATCGATGGAGTATCAACAATAACGCGGTGACGATCAGCCCGCGCACGCCCCAGCAGCAGTCATCTTGTGGAACAGCAAATTGTTCGATATACCGCTGGAATAACATCGCCAGTAGCAGGGCAGAAAGTTGGCAAAAATAAAGTGACGTAACTGAATGTGACGTCGGAAAACATAGGAAAAGCGGCGAAAGCGCAAAAACAACGGCAACCAGCGGCACTAATGAGAGAGCAACGACACATAGGCAAGGTTACCTGCCAGGGTTGTCATGTTGTCCTCGTAATGCGTTAAGTGAACACCAGCCAGGCCCTTAGTGGACCGGAGTACGGTGCCTGGCTTTGTCCTGAATGGTTTTAGCATAACACCTTCGCGAAATAGTCCGGGATGGTGGTTTTATCTTTCACCAGAATACTGGTAATGCTGCCCAGCTGATTGGCTCCTTCTATATTATCGGCGTTATCGTCGAAAAAGACCATATCGCTGGGTGAAAAACCAGCTCCGCCTGCAAAACATGCTGGTAAATTCGTGCTTCAGGTTTACGCATCCCCAGATCTTGCGACAGATAGATGGTCAGCAGCATCACGAATTTCCGAATTCTTCCGGCCGAAGGTGGTATGCAGGCGGTTGGTAAGAAAACACCACCACGCGATGCCCCTGCTCACGCAGTTTATGCATGATGGCGATCACTTCGGGCGCAGCGCAACAAACACCGCCTGCCAGCCATTGAAGGCTGCTCGTAGCAGCGAGTGAGAGCCATCTCATAACCACAGCGCCTGCGACGCTTCGTCGCCTAATTTCCCGCTCATGCTGGTGAAACGCCTCCCCATGAAAACTCTTCTTAAGCGATGCCAGCCGGAATACGCGTTAAATCGCTCCAGGCTCCCAGCACACGGTTAAAGTCGATATCGACAATCACATTACCTAAATCAAAGATATAGAGCATTTTTTACCTCCTTTCGCGCCACAAAGAAGTGCTATGCGGCGGGAAAGGATGGGTTTAACTGTATGTGGCCAATTATGAAGCCAGGTTAACGGTCACAAAATCTACGCGTCTTCCTGGGAAGAATGATTTCAAGTGGCTGTCTTGTAAGCGTGATTTTTAGCGCAGCGAGCGGCAGCTCGTCGGTAAAGAGCGCAGTGACCTGTGCCACGTTACCAATTTCAACCGCGCCGAAGCATGATACTTAGATGTGATCGGCGACCGGCAAATATTTCTCGCGTGCGCCATCATCGTTTTCACCACGTTAGCCGTTTACATCAAACTCCATCAACGCGCCATCATCTCCAATCGCCTGACGCTTGTACAGATAATCAGCACGAAAATCAGCCACAAAGGACGCCGCTGGGGCCAATGATCCCGCGCTATTGTAGAGAGCGCAACGTACCGCCGAACCATCACTTCAAAGCGCGGGTTGTGGTAAAGAATATGCGCCACGCAGGCTGTTGGTGATTATCCGCAAATGATTATGGTTAAAGTAACGCCCGGGCAACATGCTCAACAGTCGTACCAATGGTGATAAATATTGTTGAACCATCAGGAATATATCAGTCTGCCACCGCTACGGCAATCGCTTTTTCCTCGGTTTGCGAAACCTCGCTGCTCGAACGCCGTATTAACGACGCTTCATTGACCCGCGCCACCGTGATGGCATCATCGAACCTGCTCAGCAATTTACGAATAACCGGCGGACCGTCTGCGTGAGACATCCAACAGATTTGCCAGGCTCATCAATATTCATATACCCACGCTCGGCGATCAGCATGAGTTAGTCGTGCCGCGGGACACCGGTTAGTTCGGTAAGGCTCACGAAAATTCCTCGAAAACCACCATCACCCGGCATTTTATACAAAAGTGACAAAAGATCGGGTTTGATCACAGTCAGGATCTGGCTCCGTCCGCAGGACGTGTGCATTTTAACGCCGCCGCTACACCGCTGGCGAAGCGGACTGACTCCATAAATCCCCACTTGTTTAGCGCCACCGCCAAAGCGCCGTGAAAAACATCACACCCGCACCTGTGGTATCTACCACATCAACTTTGAGGCAGAGTTGATGCTGACGCCCACCATTTTCCAGCCAGTCGCGGCCTGCGCTTACCCTGGTCACGCAGACGCTGACCATTTTGTGACGTTTGTGCCTGTTTTTAGCGCTGGCATCTCTTTCACGCCGTTAAGCGCACCAGACCCGGTTCTGAAAGGCCGCGTGATCCGGCAATGCCACCACCAGCTCACTGATATCCTGCGGCGTAATGTCCCCAGTCCAGAACGGTCATCACCCGCCCTGACGGGCCAGGAGTGAAGGCTTTTTCGCGCCGTCATTACCAGCGTACATCTGCCAGCACAACATCCCACTGAGAGAAATCAATTTCCTCCAACCACTCTGCGTCAGGCAGCAGATCCGACTGGGGTAATGGTTAATGATTAATCAACTCGCCTTTGGCAGGTATCCGCCATGATGGCGGATGCGAAGATTTCGCCTGGTTATACCGTTTGGTGTAACGGGTGTTAACGCCCCAGGATTCCAGCTCTGCCAGCAGGCTGTTGCCATCGTCATCACCTACGCGATAATAAAATCGACCTGCGCCCCCAGCCTTGCCGCCGCAACCTCTGCCATCGCCACTGGCCGCCACCAACTTCGTATAATTTCATACGTATTTACCGCTCTCCGTCGGTAACCTTCCACATGTCGATGCGATCCATCACGGTTATACCTACACAAACACTTACAAGATCATGGTCATTCCTTAAACATTTTTGGGATGCGTTCATTTTAATTCACCAATTGTTTAAAAAGCGGCAGCTGTCAATTTTGACGATAAATTACAAATACGATCAAAACGAACAAACAAAGCGTATCATAAATGACAAAAGTGACATAACTGTATTCAGGAGAGGTTATGGCAGCAATCGCGTTTATCGGTTAGGACAAATGGGTTCGCCAATGGCGGCAATTTATTACCCAGCAAGGGCATCAACTTCGCGTCTTTGATGCTTGAACGCCGAAGCTGTGCGGCATCTGGTAGACAAGGTGCGGCTCCGCCGCCAACCAGCGCAGACGCTAAAAGATGCCGAATTTATCATTACCATGTTGCCGAATGGCGATCTGGTGCGCAACGTGTTGTTCGGTGAAAACGGCGTTTGCGAAGGCTTATCTACCGATGCGCTGGTCATTGATATATCCACCATCCATCCGCTGCAAACCGATAAGTGATTGCCGATAATATACTAAACAAGGCTTCAGCATGATGGATGTTCGGTAAGGCCGTACTTCTGCAAATGCCATTACCGGTACTCTGTTACTGCTGGCTGGCGCTGCTGAACAAGTTGAATGCCACCGATCCTGATGGCGATGGGCAGTGAGTTGATCAACGCAGCGGTCCGGGCATGGGGATCCGCGTTAAGCTCATCAACAGCTTCGCCAGGCATCGCGCGCTCAATGCGCTTTCGGCAGAAGCCGCCGTTTTATTGCGAAGCCTGAATCTTCCTTCGATGTTGCCGTCAAAGTGATGGCGACGGTACCGCCGCCGGTAAAGGTCACTTCACCACTTCCTGTGAAACAAAGTCCTCAGCGGAGATCTTTCTCCCGCCTTCATGATCGTTGCCCATAGGATCTTGGCATCGCCCTTGATGTCGCCAACCAGCTTCCGTATGAAATGCCGCTGGGGCATCTGAGGTTTTATAGCCAGGCGCGCGCAACTTGGCGGTCGCGGTCGCCAGATGGTCCGCCATTCTGGGACAGGTCCGTGTCGAATGCCGGGATGACTGCCAAAGTAAAAATGTAACGACTGGATAAAGGAATAAATGAATGGGCAAACACATCCTTTGACATTACGCGCGCATCCGGGCGGTTTTGCCATGCTGGCGGTCGATCAGCGCGAAACCATGCGCGCCGATGTTTTGCCGCGGCTGGGCACCCGCTCGGTAGCCGATAGCGTTTTAACTGATTTCAAAGTTAACGCTGCAAAGGCCCTCTCGCCCCTTATGCCTCCGGCGATTCTGGTGATCAACAATTCTGCTACCGCCAGGTGGTTGAGCAAAACGCGATTGCCAAAAGTTGCGCCATGATTGTCGCCGCCGGTAGGTTCATTCCTGGCAACGGTATTCGGTCGATAGCGTGGTTATTGACCGCAAAATCAATCGCTAAGATCAAACAAGACGGTGCTGAAGCCAAAACTGCTGGTGCTGTGGCGTAGTGATGAAGATGCGCAGCAACGTCTGGATATGGTGAAAGAGTTCAACGAACTGTGCCACTCACGCGGTCTGGTAAAGCATCATTGAGCCGGTGATGCGCCCACCGCGTCGTGGCGATAAATTCGATCGCGAACAAGCGATCATCGATGCCATAAAGAGCTGGGCGACAATTGGCGCTATCTAAGTTGAAATGCCGCTTTTGGCAAAGGTCCGCAACAAGAGCTTCTCGTAGCTTCTGGCATCTGAATGACCATATCAATATGCCATGGGTGATCCTCTCTTCCGGTGTCGACGAAAAACTGTTTCCCGCGTGCCCGTACGCGTGGCTTGTGACAGCGGGCGCATCAAGTTCCTGGCAGGCCGTGCAGTCTGGGCATCGGTCGTCGGTTTACCGAACCGCAGGCTGATGTAGCGGCGTTTGCGCACCGAAATTACAGCAACGGCGTATTGTCCTGACGAAATGATGTAAAAGCACCGCTAAGATGAGGATAAAAGGAATGAAATGGTTTACTAAGCCACAACCGTGGCTGGAACGAAATCAAATGCATCTTTGATTTTGGTAAAAAATTTCCGTAGTGCCGACTGGTTTTGGCTGGTTTAGGTAATAAAGGGCAAATCAAAGAAGAGATGGGCACCCATCTGCATGGATCTGCTAAATATATTGCGTTTATTCCGTTGCTGCGGCGATGGGTCGACCTGGCGCTTACTCGTTGGTTGATCACGGTATCAAAGCCATATTTAAGCGCACGTGATAAAATATGGCGGTTGGTATGCCTGCGTGAATGGCGAGGGCGTGGTGGATGCCTCCAAACAGGGCTATCAACACTTCTTTGCTCTGCTGGTGCCATGGCATACGTCTGCTGCAGATCACCAGGAAGCGCGCAAATAACTCGGTGCCGCCGTGGAAATTATCGAGAAATGTTCTGGGCGAAGAGCAGATGTGCCTGGAATCCTCAGGACGAAGCCTTCCAGCAAAACCGAAAGTACCGCGGCGGCAATGCCAATATGCGCGGTGGAAGCCTCTTGATTGTTTATGACGTCACTCACGACAAAAATGGGCTGGATCGCGCATTCGCGTGGCTTCCGTGATTATCGACGTCGCCGAAATAATCATTATCGCGTTAACGAACACTTCGTACCAGTGGAATCCGCTGCGGATTTATACAAAGATATTGACGCATCCTTCCGCGCGTTCGGAAGTACCTGAGCCACTGGATCAGATGGGGCCGTTTAATGCTGCTTTTATCCATGCTGCCCTGGAAGCCCGTTGCGAACAACCACCAGCATGGCTGCTAGAAGATGCAAAGGTCTGTTTAACGCCACCGTGCGCGCGATGCCTGGGCACCACGATGGCGCGGACGGGATTGTTTATACCGTTGACTGGGAAGGAAAACCGGTGGTCCGCGAACGTGTACGTTGGCCTATCGTCGAAGCAATGGGCTGGCCTACGCGCTCTACACCGTCACTGGCGTCGCCAGTAAACCTGATCAAACATGGTGGGAGTACTGCATTAAGTACTGATGGACTATGAAAATGGGTTTCTGGTGGCAGGAGCTGGATGCGGACAATAAGATTTCACAAAGTCTGGGACGGCAAACAGGATATTCACCTGCTGCATTGCCTGGTGATCACGCGTATCTACGTTAGCGCCCGGCATGGCTCCAGCGGTTGCGGCGGGTCTGCTGGATGTGCAGAAATAACTGATCTGAAAATAGGGTGCGGGTTTCCCCTCTCCTAACCCCTCTCCCAAAGGGGTGAGGACCGTCAGTGCAGTTTTTGGGTTTGACATCAGCTCACGGGAGGCTGTATGTCAGATGATGCGTGCAATGCAGAAATCACCAGCTGCCGTGCAGTGGACAGACCGTTTCGCGCCGCGGGGATTATCCGCGACCATTAGCGACCGTCGGTGCTGTCACCGTGAATTAACCTTCCAGGGTTATCATTTAGTCATCGCACAAACCCGAAGAGATGCCGCTGGCGCATCTGGTAAAGTGCTTATTCCGGTATGAACCGGATCGCCAACTGGCCCAGTTCATCTCACGGTCAGAGACGCCAAAGTGCGCCGAAAAATTACGCGCTCAACGCCCGTTGTACCGGGAAAGAATTCGTCATTAATCCCGGCCGCAACCCGCTGCCTAAAGGACGCGCCAGCACCAGTAACACAGTAAAACGTGGCGATCGAGTAAGAACCCTTGCGCGGCCATCAGGAACGCCTCCCGTGATCAGGGCATAAACCAGATAACCCAGTAATAAAAACAGGTTAAACACCCGAAGCAGACGCCAAGATAGAACGCCC
+>67ee25a0-86c1-44be-9b64-5a0db853eaf2 id=27 clr=0,6760
+CCTTCGGCGTTTCATCAGCCAGCGAAGCCAGTTGTGCGGCGTCAGCCAGCGTTTTTCATCCACGCCCTGCGCGGGGATAAACTCCGACGCCTGACGGTTACCGAGTGTGATGGTGCCGGTTTTATCCAGTAGCAGAACGTCAACGTCACCTGCCGCTTCAACTGCACGTCCGCTGGTGGCAATCACATTCGCGCCTAGCATCCGGCTCATCCCGGCGACGCCGATCGCTGACAACAGGCCGCCAATAGTGGTTGGGATCAGACAGACCAGCAGCGCCACCAGTACCGTTACGCTGACTGCATTACCGCCCCACGCGGAAAACGGCCACAGCGTGGCGGTTGCCAGTAAAAGACGATAGTCAGGGCAATCAGCAGAATGGTCAGGGCAATTTCGTTCGGCGTTTTGCGTCGCTGTGCGCCTTCCACCATCGCGATCATCCGATCCAGAAATGTCTCGCCGGGGTTAACGCTACACTCAATCACCAGCCAGTCAGAAAGAATACGCGTGCCGCCGGTGACGGAGGCAAAATCGCCGCCGGATTCACGGATCACCGGTGCCGATTCCCCGGTGATGGCGCTTTCATCGACCGATGCACCCCTTCAATAACTTCACCATCGCAGGGGATAATATCGCCAGCTTCTACCAGTACGATATCGCCTTTACGAAGTTGGTCGGCAGGAACTTTGTCCGCCGCAGCGCCATATTTCGGCTCACGCAGCTTGCGGGCAAAGGCAGTTTTTCACCTTTCAGACTGTTGGCCTGCGCTTTACTGCGGCCTTCTGCCAGCGCCTCGGCGAAATTAGCGAACAGTACGGTGATCCACAGCCAACCGCTAATGGCCGCGCTAAACAGCGCATTGCCGGGCATCGCACCGCTTGCCATCGCGATGCTAATACAGGTGGTCAGCAGACTGCCGATCCAGACGATAAACATCACCGGATTGCGCCATTGCGCCTGCGGGTTTAATTTTTCACCGCTTCTTTCAGCGCCTGAACGACAAGTGTTGGTTCGAATAGCGCCAGTTGTTTACGACTCATATTCAGTGCTCACTCAATATCATCAGGAGATATTCCGCCACCGGACCAAGCGCCAGGGCAGGGATAAAGGTCAGTGCGCCAACCAGCAACACGGTGCCGATTAACAGGCCAACAAACAGCGGGCCGTGCGTTGGCAGCGTGCCGGAGCTGGCGGCTTGGCTCTTTTACTCACCAGCGAACCGGCAATTGCCATCACCGGGATAATCACCCCGAAGCGACCGACAAACATGCAGAACGCCAGTAAACAGTTCCAGAACGGAGAGTTGGCGCTTAATCCGGCAAAGGCGCTGCCGTTGTTAGCGGCGGATGACACGGCGTACAGCACTTCGCTAAAACCATGCGGGCCAGGGTTGAGCATGGCGCTACGTCCGGCGTCGGTCATCATCGCCAACGCCGCGCCCATCAGCACCAGCGTCGGGGTAACCAGAATTGCCAGTGCAGTCAGTTTCATCTCGCGTACGTCGATTTTTTACCCAGATATTCCGGTGTACGACCAATCATCAGCCCGGCAATAAACACCGCCAGCAGGACAAACAGCATCATGCCGTAAAGACCAGAACCGACACCGCCGAACACCACTTCACCAATTTGCATCAGCCACATCGGCACCATGCCACCGAGAGCGGTAAACGAATCATGCATCGCAATCACCGCGCCACAGGAAGCCGCCGTCGTCACGACCGCAAACAGGCTACTGACCAGCACGCCGAAACGGCTCTCTTTACCTTCCATATTGATGCTGCTGTCCGTGCCCAGTGCCAGCAGATGAGGATTACCCTGAACTTCTGCCCACATCACCACGCCTACGCAGATGACAAAATCACTGACATCGCCCACAGCAACATGCGCCCCTGGCGGCGATCGCCCATCACTTCACCAAAGGCAAAGCACAGCGCCGTTGGGATCAAGAAGATCGCCAGCATCTGCACGAAGTTGGTCAGTGCGGTTGGGTTTTCAAACGGATGCGACGAGTTGGCATTAAAGAAGCCACCGCCGTTAGTACCGAGCATCTTGATCGCTTCCTGAGAAGCTACAGGCCCCATGGGTAACAGCTGTTGCGCTCCTTCAACGGTATTCACAGCCTGATAAGGCAGAAAGTTTTGCAGCGCACCTTGTTGAATAAAAACAGTGCAATCAACAACGCCACAGGGACTAGCACCCATAACGTGATGCGTAGCAGATCGACCCAGGCATTCCCGAGCGTGCTCATGCTCTGGCGGGTAAACGCACGGATGAGGGCAAAATCACCGCAATCCCGCTGGCGGCAGAAAGAAAGTTTTGCACCGTTAAGCCCGCCATCTGGCTGAAATAGCTCAACGTGGTTTCACCGCTATAAGATTGCCAGTTGGTATTGGTGACAAAGCTGACGGCGGTATTCAGCGCCAGATCCCACGACAGCCCTGGCAACTGCTGTGGATTAAGCGGCAGATAGTGCTGACCGAGCAACATAAAAACAGCACCGCCAGCCCCAGCATGTTCAGGCCGAGAATGGCACAAAGATATTGCTTCCAGTTCATCTCACGGTCAGAGACGCCAAGTGCGCGAAAAGTACGCGCTCAACGCCCGTTGTACCGGGAAGAGGAATGTCATTAATCAGCCGCGCCAGCCCGCTGCCTAAAGGACGCGCCAGCACCATTAACACCAGTAAAAACGTGGCGATCAGTAAGAACCCTTGCGCAGCCATCAGAACGCCTCCGCATTGATCAGGGCATAAACCAGATAACCCAGTAATAAAACACCAGCAATACGCCGGTTATCACGCCTGCACTCACAGTGCACCTCCAGTGGCCTAAAAGTGATACCGGAAGGGTAGAATTCTGGCTGCAAAGATTTCGCAAAAATCTGCGGGCGGTGTAAAAAGTATAAAAATGGCAAAAGCCATGATTTAACTAATGTTTAGTATTAATTTAACTTTTGTGTAACTTAATTACAGGATGAATGTAAATAAACCATCAATAAGCAAAAATAAGTGGTCGGATGAGTAGTAAAATTACACAAAAGGCGGTACTATTTTCATCAGATAAACAAATTCATCCGGTGCCATTCACCGGGTAGATACAAAAGGGGAGAAAAGTATGGAACTCTACAGAGAATATCCTGCATGGCTTATCTTTTACGCCGTACTTATGCGGTTGCAGCGGGCGTTCTGGCGCTGCCTTTCATGCTTTTCTGGAAAGACCGCGCCCGCTTTTACAGCTACCATCGCGTCTGGTCGAAAACCAGCGATAAACCGGTGTGGATGGATCAGGCCGAAAAGGCAACTGGTGATTTTATTGATTGCTGAGTTTTGAATATTGAAAACCGCCAGCGGAAACGCTGGCGGTTTTTGTATCAGGAAGATGTTCAGAGGAATATTTAGACATCGTTATACCAATCGAAACATATATTCATGAAATATATATAAATATTTTCCTAATTGTTCTTATCTGACAGATATCTCACTTAAGGCTTTCTTATAAATCTGTAGGGTTTCGCCTGTCAGCAGACAAATAACCCGATAAAACAAGGATGAGCAGATGAGCGGAAAACCGGCGGCGCGTCAGGGCGACATGACGCAGTATGGCGGTAGCATTGTCCAGGGTTCAGCCGGGGTACGCATCGGTGCCCCACCGGCGTGGCCTGTTCGGTGTGCCCCGGCGGGTGACGTCCGGCCATCCGGTCAATCCGCTGCTCGGTGCAAAGGTCCTTCCCGGTGAAACCGACATCGCCCTGCCCGGCCCGCTGCCGTTCATTCTCTCCCGCACCTACAGCAGTTACCGGACAAAACGCCCGCGCCGGTGGGGAGCCTCGGCCCCGGCTGGAAAATGCCTGCGGATATCCGCTTACAGCTGCGCGATAACACACTGATACTCAGTGATAACGGCGGCAGAAGCCTGTATTTTGAGCACCTTTCCCGGTGAGGACGCCGCAGCCGCAGCCACTGTGGCTGTCGCGCGGCGTCGGCGAACTGGATGGGTGGTGCAACCTGCGGCTCAAAGTGATGCTCCGCCCGCCGTTGTCGTTGAGTATCAGTCCGTCATCACGTAGCTGTAAGCGGATATCAGAAGGCGCTTTCCAGCCGGGCCGAAAACGCCCACCGGTGCAGGCGTCTTCGTCCGGTAGCTGCTGTAGGTGCAGAGAATGAACGGCAGCGGGCGGGCAGCGCAAGGTCCGTCTCGCCGGGCAGCACCTTCGCCCCCAGCAGCGGATTTACCGGGTTGCCCGAAGTCATCCCGCCGGACACACCGAGCACGCCACGCCGGTGGGCGCGCCAATTCTTACACCTGCCGAACCCTGGACAATGGGACCGCCATACTGAGTCATATCTCCCTGACGCGCCGCTGGTTTTCCGCTCATATAAAGTGCCCTTTTAGTTATTGTTCATATCCCTGTGTTGAGCAAAAAAAATAAAATGACACAAGACCAGCTAATGTATTTATATATTTTTCACATAAACTTATTGTTCTCAATCAACAACGCTGTTATTACAGGTCACTTTCAATATTTTATTAAAGCTAACATTTTAGCACAGATGAATTCATCATCAACAAATTCACTATATGGATAATATCCATTCAACGCATATGATTTATGATTTTATTAGTCTGAGTTATTTTTGTAGGGCTATATTTAAAATCAATAAACTCCACCGATTCAGATTAATATCAGCAATAGAAAGATAGGAAATCACCAATTCAATAACATCATCAATGAAACATATTGTAGAATTAATTTAAACAAGGCGTTCCATTCAACCAGAACGCCCTTATTTACTCTCATCACCCGCAAACTGCCTGAACAGCGCCTTACCCTTAACCAGTCGCGCACCCAGCCAGCCGCCGAAAGCGACAGCAGCAGCGCTCCGCTGCACGGCAGAACAATCCACAATCGCCAGTCTGGCTCCACGGAAAATCAAACACTTTCGCCTGCAACACTGCCAGCGCCGTTTCCGCACCAATTGCGGCCACCAGGCCGGAAACAAACCAAGCATGGCGAACTCACACCACAACGTGGTACGCAGCAGTTTTTCCCCGCACCGAGTGTGCGCCACACCACCAGCTCCTGATGACGCTGACGCATTCCCACCTGCACCTGCCAGCAACAGCAACATACCGCAGGCGGTGACCAGTACCATCACTTCCAGCGCCCGACCTGCTCAGCACCTGACCGACCTGTTTTAAAATCGCGCCAATATCTAACAGGCTAATGGTCGGGAACTGGCGGTTGAGTTGTGTCAACATGCCGTTGCCATTCTCCCAGCGAAACTGGTAAGCCAGCTCTGCGGTTGCCGTCTAATGCCCTAGGGGAAAATAAAATAGAAATTAGGCCGCAGACTTTCCCAGTCCACTTTGCGCAGGCTGGTCACTTTAGCGCGGAACTCCTGGTATCGCCCATAAAAGTCACGGTATCACCGAGGGCAACGTTTAAGCGTTTCGCCAGCCTCTTCCATCGACACTTCATCGGCTTTTGGCGGCCAGTTACCGGCGACAATCGGATTATGATCGGGCCGCGTATTTTGCCAGGTAAGATTGAGTTCGCGGTTAAGCGCCTCATCTTCATTTCTGTCGGCTTATCGTTAATCGCCGTCAGCCGCGCCCACCACCGGATAAAACGATTCCGGGACTATCTGATGTTCCGCGAGGAACGCTTTAGCGGTGCTACCTGTTCTGTGGCGATGTTAATTAAAAAGTAGTTCGGGCTTTCTGGAGTAGCTGCTGCTGGCGGTCGGCAGATCGCCACGCAACACCAGCAGCAGTGCCAGCAGCATAAAGGAGCGAAAATGCCGAGCTGACTTAACGTTGACCACGGCTGACGTAACAGGCGGCTAACCGCCAGGCGCAGAGGCAGCGATTTCAGCGTCATGCGGCGAAGTACATTCAGCAGCATCCAGCCCAGCACACCGCACAGCAAAGCCAGTACTACCGCGCCCGCCAGCACCGCCCAAAGCAGCATGCACCACCCATTAATCCGGCGAGCAGCAGCACAACCACCACACTGACAATCGGCAGATAAAACTTCAGCGGCCAGACGTTCGCTACCACATCATTACGTAATACGCGTAAAGGGCTGCGTTGCCAGCAACAAGCGATATGGTCGTAGCCCACCAGCAGCGAGATGACCGTCATGGTGCCAAGCGCCCACAGCCGGCCAGAGGCTGGCTGGCGGTAGTGCAGCAGGCAGAACGGGCGAGCAGCACCATCAACACGTTTTCGAACAACAGGCCTATGGCCCCACCGGTAACGGCTGGCGTCAGCACCATCAACCACTGACCGACGATTAGCTTACGCAGTTGCGCTCGCCCTGCCCCCAGCGTTTTGAGGATCGCCACCAGATCGTAGCGACTGCGACAGTAATGATTCATCGCTACCGCCACCGCTGCCACTGCCAGCAGCAAGGTCAGAAGCGCCGAAAGCAGCAGGAACTGTTTGAGCGTTCCATCGATCGCCCAAGCGCGCCTTCGTCCTGTTCAGACCGTACCAGCGTTGTTCGGGTTTAAGCTGAGGTAACAACCATTTCTCGCCTAGGTCGAGCTGGTTCTCGTTGCCGCCAATTTATAACGCCAGGTGACCCGACTCCCCGGCTGCGGCTCCGGTTTTATCGACATCCGCCAGATTCATCATCAGACGCGGAGCCATCTGGAAGGGTTAAAACCGGAATCCGGTTCCTGAATCACTTCTCCGGCAATCCGCCCGGAGCAGACGCCGCAATATCAGCACCAACAGAAAAGCAATACGTAACCCGCC
+>ce4d48fa-9112-4aa8-b655-10c5064129db id=28 clr=0,5726
+AAACAGTGCAATCAACAACGCCACAGGGACTAGCACCCATAACGTGATGCGTGCAGATCGACCCAGGCATTCCCGAGCGTGCTCATGCTCTGGCGGGTAAACGCACGGATGAGGGCAAAATCACCGCAATCCGCTGGCGGCAGAAAGAAAGTTTTGCACCGTTAAGCCCGCCATCTGGCTGAAATAGCTCAACGTGGTTTCACCGCTATAAGATTGCCAGTTGGTATTGGTGACAAAGCTGACGGCGGTATTCAGCGCCAGATCCCACGACAGCCCTGGCAACTGCTGTGGATTAAGCGGCAGATAGTGCTGACCGAGCAACATAAAAACAGCACCGCCAGCCCCAGCATGTTCAGGCCGAGAATGGCACAAAGATATTGCTTCCAGTTCATCTCACGGTCAGAGACGCCAAGTGCGCGAAAAGTACGCGCTCAACGCCCGTTGTACCGGGAAGAGGAATGTCATTAATCAGCCGCGCCAGCCCGCTGCCTAAAGGACGCGCCAGCACCATTAACACCAGTAAAAACGTGGCGATCAGTAGAACCCTTGCGCAGCCATCAGAACGCCTCCGCATTGATCAGGGCATAAACCAGATAACCCAGTAATAAAACACCAGCAATACGCCGGTTATCACGCCTGCACTCACAGTGCACCTCCAGTGGCCTAAAAGTGATACCGGAAGGGTAGAATTCTGGCTGCAAAGATTTCAAAAATCTGCGGGCGGGGTGTAAAAAGTATAAAAATGGCAAAAGCCATGATTTAACTAATGTTTAGTATTAATTTAACTTTTGTGTAACTTAATTACAGGATGAATGTAAATAAACCATCAATAAGCAAAAATAAGTGGTCGGATGAGTAGTAAAATTACACAAAAGGCGGTACTATTTTCATCAGATAAACAAATTCATTTTTCCGGTGCCATTCACCGGGTAGATACAAAGGGGAGAAAGTATGGAACTCTACAGAGAATATCCTGCATGGCTTATCTTTTTACGCCGTACTTATGCGGTTGCAGCGGGCGTTCTGGCGCTGCCTTTCATGCTTTTCTGGAAAGACCGCGCCCGCTTTTACAGCTACCTGCATCGCGTCTGGTCGAAAACCAGCGATAAACCGGTGTGGATGGATCAGGCCGAAAAGGCAACTGGTGATTTTTATTGATTGCTGAGTTTTGAATACATTGAAAACCGCCAGCGGAAACGCTGGCGGTTTTTTATCAGGAAGATGTTCAGAGGAATATTTAGACATCGTTATACCAATCGAAACATATATTCATGAAATATATATAAATATTTTCCTAATTGTTCTTATCTGACAGATATCTCACTTAAGGCTTTCTTATAAATCTGTAGGGTTTCGCCTGTCAGCAGACAAATAACCCGATAAAACAAGGATGAGCAGATGAGCGGAAAACCGGCGGCGCGTCAGGGCGACATGACGCAGTATGGCGGTAGCATTGTCCAGGGTTCAGCCGGGGTACGCATCGGTGCCCCACCGGCGTGGCCTGTTCGGTGTGCCCCGGCGGGTGACGTCCGGCCATCCGGTCAATCCGCTGCTCGGTGCAAAGGTCCTTCCCGGTGAAACCGACATCGCCCTGCCCGGCCCGCTGCCGTTCATTCTCTCCGCACCTACAGCAGTTACCGGACAAAACGCCCGCGCCGGTGGGAGCCTCGGCCCCGGCTGGAAAATGCCTGCGGATATCCGCTTACAGCTGCGCGATAACACACTGATACTCAGTGATAACGGCGGCAGAAGCCTGTATTTTGAGCACCTGTTTCCCGGTGAGGACGGTTACAGCCGCAGCGAGTCACTGTGGCTGGTGCGCGGCGGCGTGGCGAAACTGGATGAAGGTCACCGGCTGGCCGCCTCTGGCAGGCGCTGCCGGAAGAACTCCGCTTAAGTCCGCATCGTTATCTGGCGACAAACAGTCCGCAGGGGCCGTGGTGGCTGCTCGGCTGGTGTGAGCGGGTGCCGGAAGCGGATGAGGTGCTGCCTGCGCCGCTGCCGCCGTACCGGGTACTGACCGGGCTGGTGGACCGCTTCGGGCGCACACAGACGTTCCACCGCGAAGCCGCCGGTGAATTCAGCGGCGAAATCACCGGCGTGACGGATGGTGCCGGGCGTCACTTCCGGCTGGTACTGACCACGCAGGCGCAGCGGGCAGAAGAAGCCCGGCAGCAGGCCATTTCCGGCGGGACGGAACCGTCCGCTTTTCCTGATACCCTGCCGGGTTACACCGAATATGGCCGGGACAACGGCATCCGTCTGTCTGCCGTGTGGCTGACGCACGACCCGGAATACCCGGAGAATTTACCTGCCGCGCCGCTGGTGCGCTATGGCTGGACGCCCGCGGCGAACTGGCGGCGGTGTATGACCGCAGCAATACACAGGTGCGCAGCTTTACTTACGATGATAAATACCGGGGCCGGATGGTGGCGCACCGTCACACGGGCCGACCGGAAATCTGTTACCGTTACGACAGCGACGGGCGGGTGACAGAACAGCTAAACCCGGCAGGCTTAAGTTACACGTATCAGTATGAGAAGGACCGCATCACCATCACCGACAGCCTGAACCGCCGTGAAGTCCTGCACACGCAGGGTGAAGGCGGGCTGAAGCGGGTGGTGAAAAGGAACACGCGGACGGCAGCGTCACGCAGAGTCAGTTTGACGCGGTGGGCAGGCTCAGGGCACAGACGGATGCCGCAGGCAGGACAACAGAATACAGTCCGGATGTGGTGACGGGCCTCATCACGCGCATCACCACGCCGGATGGCAGGGCATCGGCGTTTTACTATAACCACCACAGCCAGTTAACGTCAGCCACCGGGCCTGACGGGCTGGAAATACGCCGGGAATATGATGAATGGGGCCGTCTGATTCAGGAAACTGCCCCTGACGGCGATATCACCCGCTACCGTTATGATAATCCACACAGTGACTTACCCTGCGCAACGGAAGATGCCACCGGCAGCGGAAAACCATGACGTGGAGCCGTTACGGTCAGTTGCTGAGCTTCACTGACTGTTCCGGTTATGTAACCCGCTATGACCATGACCGTTTTGGTCAGGTGACGGCGGTGCACCGCGAGGAAGGGCTGAGTCAGTACCGCGCATACGACAGCCGTGGACAGTTAATTGCCGTGAAAGACACGCAGGGCCATGAAACGCGGTATGAATACAACGCCGCCGGTGACCTGACCACCGTCATTGCCCCGGACGGCAGCAGAAACGGGACACAGTACGATGCGTGGGGAAAAGCCATCTGTACCACGCAGGGCGGTCTGACGCGCAGTATGGAATACGATGCTGCCGGACGGGTCATCCGCCTGACCAGTGAAAACGGCAGCCACACCACCTTCCGTTACGATGTACTCGACCGGCTGATACAGGAAACCGGCTTTGACGGCCGCACACAGCGTTATCACCACGACCTGACCGGCAAACTTATCCGCAGCGAGGATGAGGGGCTGGTCACCCACTGGCACTATGACGAAGCAGACCGCCTCACGCACCGCACCGTGAATGGCGAAACCGCAGAGCGGTGGCAGTATGACGAACGCGGCTGGCTGACAGACATCAGCCATATCAGCGAAGGGCACCGGGTGACGGTGCACTATGGTTATGACAGTAAAGGCCGCCTCGCCAGTGAACACCTGACGGTGCATCATCCGCAGACGAATGAACTGCTCTGGCAGCATGAGACCAGACATGCGTACAACGCACAGGGACTGGCGAACCGCTGTATACCGGACAGCCTGCCCGCCGTGGAATGGCTGACCTACGGCAGCGGCTGGCTGTCAGGCATGAAACTCGGCGACACACCGCTGGTGGAGTACACCCGCGACCGCCTGCACCGGGAAACGCTGCGCAGCTTCGGCCGTTATGAACTCACCACCGCTTATACCCCTGCCGGGCAGTTACAGAGCCAGCACCTGAACAGCCTGCTGTCTGACCGCGATTACACCTGGAACGACAACGGCGAACTCATCCGCATCAGCAGCCCGCGCCAGACCCGGAGTTACAGCTACAGCACCACCGGCAGGCTGACCGGCGTTCACACCACCGCAGCGAATCTGGATATCCGCATCCCGTATACCACAGACCCGGCAGGTAACCGCCTGCCCGACCCGGAGCTGCACCCGGACAGCGCCCTCAGCATGTGGCCGGATAACCGTATCGCCCGTGACGCGCACTATCTTTACCGGTATGACCGTCACGGCAGGCTGACAGAGAAACCGACCTCATCCCGGAAGGGTTATCCGCACGGATGATGAGCGCACCCACCGGTACCATTACGACAGTCAGCACCGGCTGGTGCACTACACGCGGACACAATATGCAGAGCCGCTGGTCGAAAGTCGCTATCTTTACGACCCGCTGGGCCGCAGGGTGGCAAAACGGGTATGGCGGCGTGAACGGGACCTGACGGGCTGGATGTCGCTGTCACGGAAACCGCAAGTGACCTGGTACGGCTGGGACGGCGACCGCCTGACCACGATACAGAACGACAGAACCCGCATCCAGACGATTTATCAGCCGGGGAGCTTCACGCCACTCATCAGGGTTGAAACCGCCACCGGTGAGCTGGCGAAAACGCAGCGCCGCAGCCTGGCGGATACCCTTCAGCAGTCCGGTGGCGAAGACGGTGGCAGTGTGGTGTTCCCGCCGGTGCTGGTGCAGATGCTCGACCGGCTGGAAAGTGAAATCCTGGCTGACCGGGTGAGTGAGGAAAGCCGCCGCTGGCTGGCATCGTGCGGCCTGACGGTGGCGCAGATGCAAAGCCAGATGGACCCGGTATACACGCCGGCGCGAAAAATTCACCTGTACCACTGCGACCATCGCGGCCTGCCGCTGGCCCTATCAGCACGGAAGGGACAACAGCGTGGTACGCAGAATACGATGAATGGGGTAACCTGCTGAATGAAGAGAACCCGCATCAGCTGCAGCAGCTTATCCGCCTGCCGGGGCAGCAGTATGATGAGGAGTCCGGCCTGTATTACAACCGCCACCGCTATTATGACCCGCTGCAGGGGCGATATCACTCAGGATCCGATTGGGCTGAAAGGGGATGGAATTTTATCAGTATCCGTTGAATCCGATCTCAAATATAGATCCATTAGGATTAGAAACACTAAAATGCATTAAGCCACTGCATTCAATGGGCGGAACTGGTGAAAGAAGCGGTCCAGATATATGGGGAATCCGTTCTATCATCAATATCTTTGTGTCCCAGATGGTAAAGGGACTATACTTGTGGTGGCCAAGACCAACGGGGAGAATCAAAGGAGATGGTCTATGGGGGCCAGGTAAAGCAAGTAATGATACAAAGAAGCTGCTGGCCGTTGTGACCTCGTTGAAACCGATAATAGTTGTGTGGAGAACTGTTTAAAGGGAAGTTTAAAGAGGTAAGGCCGCGTTATTCTGTATTGCCTGATATATTCACACCTATAAATTTAGGGCTATTTAAAACTGCCAAGACTGGTCTAATGATTCTTTAGAAACATGTAAGATGAAGTGCTCCGGAAATAACATTGGACGTTTTATTAGATTTGTATTCACCGGAGTGATGTAATGAAATATATTATTTTTTATTCAGAGCTATATGGCTGGCTTTATCGCTTTTAATACTATTCTTTTCCATGCATAGACTTTCACTATTAGACTCCACTCAAGCGAGAATTAGCCGAAGATAGAATATGTTTTCCAACAGGCAAGTAGCAATACGTAA
+>3048e786-5b3d-4587-b5d0-714b40192268 id=29 clr=0,6692
+CTTCGTTCAGTTACGTATTGCTCTTGCCTGTCGCTCTATTTTCGGCGCCAGATTGGTGTTTAACAACCGGCTGGCCGATATATTTCACCAGCGGTTGTTGGCTGTATTTTGCGATCAGTTGCGTGAGCTGTTCAACGCTGAGATTACGCGCTTTCGCCACGCGTGGGATTTGCCAGGCCGCCGCTTGCGGGTGATATTATTGTCCAGCCCGCTTGCCGATGCCGTCACCAGTTCAACCGGAACGCTCGCGCTGGCATCCGGGTTAGCGGCCCGTAATGCAGCAACGCGTGCGGCTATTAGTTTATCCAGCTCAGGGTTACTGACCGCCAGATTGCTCCCGCCAGAAGCCTGTGGATTATAGGGCATTTCTGCCGTTGCCGACGGGCGACCATGAAAATAGCCGTTGCCGGTAAATTCTGCCCGATTAATGCCGAACCGCGCACCGTATCACCTTCACGAATCAACGAACCATTGGCCTGCCAGGAAACCACCATTGCCCCAGTACGGTGGTCAGCGGCGGGTAAACGCCGCCAGTAATCAATAACAGAAAGATAAATGTTGATAATGCCGGACGTAATCCACTCATGGTAAACCTCACACCAGACCGCAAACGGTCAGCAGTAAATCAATGACTTTGATACCGATAAACGGCACCAGCAGCCCACCCAGACCGTAAATCCATAAGTTACGGCGCAACATGGCAGAAGCGGTAAGCGGTTTATAACTCACGCCTTTTAACGCCAGGGGAATCAAAGACGATAATCAAGGCGTTGAAAATCACCGCACTGAGGATTGCGGAGTCGGGCGAATGCAGGCACATGATGTTCAGCGCATTTAACTGCGGATACGTTGCCGCGAATGCCGCCGGAATAATGGCGAAGTATTTCGCCACATCGTTGGCAATGCTGAAGGTGGTCAGCGAGCCACGGGTCATCAGCATCTGTTTGCCAATGTGCACCACCTCGATCAACTTGGTCGGGTTAGAGTCGAGATCGACCATATTGCCTCTTTCGCCGCCTGGGTGCCGGAGTTCATCGCCACCGCGACATCTGCCTGCGCCAGCGCCGGAGCATCGTTGGTGCCGTCGCCGGTCATCGCTACCAAACGACCTTCCGCCTGATACTGACGGATCAATGCCAGCTTGGCCTCCGGTGTCGCTTCGGCGAGAAAATCATCGACACCCGCTTCCGCAGCAATCGCGGCGGCAGTCAGACGGTTATCGCCGGTAATCATCACCGTTTTAATGCCCATTTTGCGCAGCTGGGCGAAGCGCTCTTTAATACCGCCTTTGACGATATCTTTCAGCGCAATAACGCCCAGCACACGAGAACCTTCCACCACCACCAGCGGCGTGGCTCCTGACGCGCAACCTGATCGACTTTTGATCAACATCGGTAGGGAAGTGACCACCGTTAGCCTCAACATGGCGACGAATGGCATCGACAGAACCTTTACGGATCATGCGGTTGTCGATGTTGATCCCGCTCATCCGGCTTTGCGCAGTAAACGGTACAAAGGTGGCATGGAGCGACTGCATCGCGCTCGCGCAGGTTAAAACGCTGCTTGGCGAGGATCACAATACTGCGGCCTTCCGGCGTTTCATCAGCCAGCGAAGCCAGTTGTGCGGCGTCAGCCAGCGTTTTTCATCCACGCCCTGCGCGGGATAAACTCCGACGCCTGACGGTTACCGAGTGTGATGGTGCCGGTTTTATCCAGTAGCAGAACGTCAACGTCACCTGCCGCTTCAACTGCACGTCCGCTGGTGGCAATCACATTCGCGCCTAGCATCCGGCTCATCCCGGCGACGCCGATCGCTGACAACAGGCCGCCAATAGTGGTTGGGATCAGACAGACCAGCAGCGCCACCAGTACCGTTACGCTGACTGCATTACCGCCCCACGCGGAAAACGGCCACAGCGTGGCGGTTGCCAGTAAAAGACGATAGTCAGGGCAATCAGCAGAATGGTCAGGGCAATTTCGTTCGGCGTTTTGCGTCGCTGTGCGCCTTCCACCATCGCGATCATCCGATCCAGAAATGTCTCGCCGGGGTTAACGCTACACTCAATCACCAGCCAGTCAGAAAGAATACGCGTGCCGCCGGTGACGGAGGCAAAATCGCCGCCGGATTCACGGATCACCGGTGCCGATTCCCCGGTGATGGCGCTTTCATCGACCGATGCACCCTTCAATAACTTCACCATCGCGGGGATAATATCGCCAGCTTCTACCAGTACGATATCGCCTTTACGAAGTTGGTCGGCAGGAACTTTGTCCGCCGCAGCGCCATATTTCGGCTCACGCAGCTTGCGGGCAAAGGCAGTTTTCACCCCTTTCAGACTGTTGGCCTGCGCTTTACTGCGGCCTTCTGCCAGCGCCTCGGCGAAATTAGCGAACAGTACGGTGATCCACAGCCAACCGCTAATGGCCGCGCTAAACAGCGCATTGCCGGGCATCGCACCGCTTGCCATCGCGATGCTAATACAGGTGGTCAGCAGACTGCCGATCCAGACGATAAACATCACCGGATTGCGCCATTGCGCCTGCGGGTTTAATTTTTCACCGCTTCTTTCAGCGCCTGAACGACAAGTGTTGGTTCGAATAGCGCCAGTTGTTTACGACTCATATTCAGTGCTCACTCAATATCATCAGGAGAGATATTCCGCCACCGGACCAAGCGCCAGGGCAGGGATAAAGGTCAGTGCGCCAACCAGCAACACGGTGCCGATTAACAGGCCAACAAACAGCGGGCCGTGCGTTGGCAGCGTGCCGGAGCTGGCGGCTTGGCTCTTTTACTCACCAGCGAACCGGCAATTGCCATCACCGGGATAATCACCCCGAAGCGACCGACAAACATGCAGAACGCCAGTAAACAGTTCCAGAACGGAGAGTTGGCGCTTAATCCGGCAAAGGCGCTGCCGTTGTTAGCGGTGCGTACAGCACTTCGCTTCAAACCATGCGGGCCAGGGTTGAGCATGGCGCTACGTCCGGCGTCGGTCATCATCGCCAACGCCGCGCCCATCAGCACCAGCGTCGGGGTAACCAGAATTGCCAGTGCAGTCAGTTTCATCTCGCGTACGTCGATTTTTTACCCAGATATTCCGGTGTACGACCAATCATCAGCCCGGCAATAAACACCGCCAGCAGGACAAACAGCATCATGCCGTAAAGACCAGAACCGACACCGCCGAACACCACTTCACCAATTTGCATCAGCCACATCGGCACCATGCCACCGAGCGGTAAACGAATCATGCATCGCAATCACCGCGCCACAGGAAGCCGCCGTCGTCACGACCGCAAACAGGCTACTGACCAGCACGCCGAAACGGCTCTCTTTACCTTCCATATTGATGCTGCTGTCCGTGCCCAGTGCCAGCAGATGAGGATTACCCTGAACTTCTGCCCACATCACCACGCCTACGCAGATGACAAAATCACTGACATCGCCCACAGCAACATGCGCCCCTGCGGCGATCGCCCATCACTTCACCAAAGGCAAAGCACAGCGCCGTTGGGATCAAGAAGATCGCCAGCATCTGCACGAAGTTGGTCAGTGCGGTTGGGTTTTCAAACGGATGCGACGAGTTGGCATTAAAGAAGCCACCGCCGTTAGTACCGAGCATCTTGATCGCTTCCTGAGAAGCTACAGGCCCCATGGGTAACAGCTGTTGCGCTCCTTCAACGGTATTCACAGCCTGATAAGGCAGAAAGTTTTGCAGCGCACCTTGTTGAATAAAAACAGTGCAATCAACAACGCCACAGGGACTAGCACCCATAACGTGATGCGTAGCAGATCGACCCAGGCATTCCCGAGCGTGCTCATGCTCTGGCGGGTAAACGCACGGATGAGGGCAAAATCACCGCAATCCCGCTGGCGGCAGAAAGAAAGTTTTGCACCGTTAAGCCCGCCATCTGGCTGAAATAGCTCAACGTGGTTTCACCGCTATAAGATTGCCAGTTGGTATTGGTGACAAAGCTGACGGCGGTATTCAGCGCCAGATCCCGACAGCCCTGGCAACTGCTGTGGATTAAGCGGCAGATAGTGCTGACCGAGCAACATAAAAACAGCACCGCCAGCCCCAGCATGTTCAGGCCGAGAATGGCACAAAGATATTGCTTCCAGTTCATCTCACGGTCAGAGACGCCAAGTGCGCGAAAAAGTACGCGCTCAACGCCCGTTGTACCGGGAAGAGGAATGTCATTAATCAGCCGCGCCAGCCCGCTGCCTAAAGGACGCGCCAGCACCATTAACACCAGTAAAAACGTGGCGATCAGTAAGAACCCTTGCGCAGCCATCAGAACGCCTCCGCATTGATCAGGGCATAAACCAGATAACCCAGTAATAAAACACCAGCAATACGCCGGTTATCACGCCTGCACTCACAGTGCACCTCCAGTGGCCTAAAAGTGATACCGGAAGGGTAGAATTCTGGCTGCAAAGATTTCGCAAAAATCTGCGGGCGGGGTGTAAAAAGTATAAAAATGGCAAAAGCCATGATTTAACTAATGTTTAGTATTAATTTAACTTTTGTGTAACTTAATTACAGGATGAATGTAAATAAACCATCAATAAGCAAAAATAAGTGGTCGGATGAGTAGTAAAATTACACAAAAGGCGGTACTATTTTCATCAGATAAACAAATTCATTTTCCGGTGCCATTCACCGGGTAGATACAAAGGGGGAGAAAAGTATGGAACTCTACAGAGAATATCCTGCATGGCTTATCTTTTACGCCGTACTTATGCGGTTGCAGCGGGCGTTCTGGCGCTGCCTTTCATGCTTTTCTGGAAAGACCGCGCCCGCTTTTACAGCTACCTGCATCGCGTCTGGTCGAAAACCAGCGATAAACCGGTGTGGATGGATCAGGCCGAAAAGGCAACTGGTGATTTTATTGATTGCTGAGTTTGAATACATTGAAAACCGCCAGCGGAAACGCTGGCGGTTTTTATCAGGAAGATGTTCAGAGGAATATTTAGACATCGTTATACCAATCGAAACATATATTCATGAAATATATATAAATATTTTCCTAATTGTTCTTATCTGACAGATATCTCACTTAAGGCTTTCTTATAAATCTGTAGGGTTTCGCCTGTCAGCAGACAAATAACCCGATAAAACAAGGATGAGCAGATGAGCGGAAAACCGGCGGCGCGTCAGGGCGACATGACGCAGTATGGCGGTAGCATTGTCCAGGGTTCAGCCGGGGTACGCATCGGTGCCCCACCGGCGTGGCCTGTTCGGTGTGCCCCGGCGGGTGACGTCCGGCCATCCGGTCAATCCGCTGCTCGGTGCAAAGGTCCTTCCCGGTGAAACCGACATCGCCCTGCCCGGCCCGCTGCCGTTCATTCTCTCCCGCACCTACAGCAGTTACCGGACAAAACGCCCGCGCCGGTGGGGAGCCTCGGCCCCGGCTGGAAAATGCCTGCGGATATCCGCTTACAGCTGCGCGATAACACACTGATACTCAGTGATAACGGCGGCAGAAGCCTGTATTTTGAGCACCTGTTTCCCGGTGAGGACGGTTACAGCCGCAGCGAGTCACTGTGGCTGGTGCGCGGCGGCGTGGCGAAACTGGATGAAGGTCACCGGCTGGCCGCACTCTGGCAGGCGCTGCCGGAAGAACTCCGCTTAAGTCCGCATCGTTATCTGGCGACAAACAGTCCGCAGGGGCCGTGGTGGCTGCTCGGCTGGTGTGAGCGGGTGCCGGAAGCGGATGAGGTGCTGCCTGCGCCGCTGCCGCCGTACCGGGTACTGACCGGGCTGGTGGACCGCTTCGGGCGCACACAGACGTTCCACCGCGAAGCCGCCGGTGAATTCAGCGGCGAAATCACCGGCGTGACGGATGGTGCCGGGCGTCACTTCCGGCTGGTACTGACCACGCAGGCGCAGCGGGCAGAAGAAGCCCGGCAGCAGGCCATTTCCGGCGGGACGGAACCGTCCGCTTTCCTGATACCCTGCCGGGTTACACCGAATATGGCCGGGACAACGGCATCCGTCTGTCTGCCGTGTGGCTGACGCACGACCCGGAATACCCGGAGAATTTACCTGCCGCGCCGCTGGTGCGCTATGGCTGGACGCCCGCGGCGAACTGGCGGCGGTGTATGACCGCAGCAATACACAGGTGCGCAGCTTTACTTACGATGATAAATACCGGGGCCGGATGGTGGCGCACCGTCACACGGGCCGACCGGAAATCTGTTACCGTTACGACAGCGACGGGCGGGTGACAGAACAGCTAAACCCGGCAGGCTTAAGTTACACGTATCAGTATGAGAAGGACCGCATCACCATCACCGACAGCCTGAACCGCCGTGAAGTCCTGCACGCAGGGTGAAGGCGGGCTGAAGCGGTGGTGAAAAGGAACACGCGGACGGCAGCGTCACGCAGAGTCAGTTTGACGCGGTGGGCAGGCTCAGGGCACAGACGGATGCCGCAGGCAGGACAACAGAATACAGTCCGGATGTGGTGACGGGCCTCATCACGCGCATCACCACGCCGGATGGCAGGGCATCGGCGTTTTACTATAACCACCACAGCCAGTTAACGTCAGCCACCGGGCCTGACGGGCTGGAAATACGCCGGGAATATGATGAATGGGGCCGTCTGATTCAGGAAACTGCCCCTGACGGCGATATCACCGCTACCGTTATGAACGCAGAAAACGGAGCCGCCGAAGATGAAACCGTT
+>d7bbdb5c-225f-4910-a264-6444e1ace544 id=30 clr=0,2999
+TTGTTGTACTTCGTTTCAGTTACGTATTGCTACTTGCCTGTCATCATCTTCGGCGTCATAGCGATTTTCACCATCAGCATCTGTTTGCCAATGTGCACCACCTCGATCAACTTGGTCGGGTTAGAGTCGAGATCGACCATATTGCCCGCCTCTTTCGCCGCCTGGGTGCCGGAGTTCATCGCCACCGCGACATCTGCCTGCGCCAGCGGAGCATCGTTGGTGCCGTCGCCGGTCATCGCCAAAACGACCTTCCGCCTGATACTGACGGATCAATGCCAGCTTGGCCTCCGGTGTCGCTTCGGCGAGAAAATCATCGACACCCGCTTCCGCAGCAATCGCGGCGGCAGTCAGACGGTTATCGCCGGTAATCATCACCGTTTTAATGCCCATTTTGCGCAGCTGGGCGAAGCGCTCTTTAATACCGCCTTTGACGATATCTTTCAGCGCAATAACGCCCAGCACACGAGAACCTTCCACCACCACCAGCGGCGTGGCTCCCTGACGCGCAACCTGATCGACTTTTGATCAACATCGGTAGGGAAGTGACCACCGTTAGCCTCAACATGGCGACGAATGGCATCGACAGAACCTTTACGGATCATGCGGTTGTCGATGTTGATCCCGCTCATCCGGCTTTGCGCAGTAAACGGTACAAAGGTGGCATGGAGCGACTGCACATCGCGCTCGCGCAGGTTAAAACGCTGCTTGGCGAGGATCACAATACTGCGGCCTTCCGGCGTTTCATCAGCCAGCGAAGCCAGTTGTGCGGCGTCAGCCAGCGTTTTTCATCCACGCCCTGCGCGGGGATAAACTCCGACGCCTGACGGTTACCGAGTGTGATGGTGCCGGTTTTATCCAGTAGCAGAACGTCAACGTCACCTGCCGCTTCAACTGCACGTCCGCTGGTGGCAATCACATTCGCGCCTAGCATCCGGCTCATCCCGGCGACGCCGATCGCTGACAACAGGCCGCCAATAGTGGTTGGGATCAGACAGACCAGCAGCGCCACCAGTACCGTTACGCTGACTGCATTACCGCCCCACGCGGAAAACGGCCACAGCGTGGCGGTTGCCAGTAAAAGACGATAGTCAGGGCAATCAGCAGAATGGTCAGGGCAATTTCGTTCGGCGTTTTGCGTCGCTGTGCGCCTTCCACCATCGCGATCATCCGATCCAGAAATGTCTCGCCGGGGTTAACGCTACACTCAATCACCAGCCAGTCAGAAAGAATACGCGTGCCGCCGGTGACGGAGGCAAAATCGCCGCCGGATTCACGGATCACCGGTGCCGATTCCCCGGTGATGGCGCTTTCATCGACCGATGCACCCCTTCAATAACTTCACCATCGCAGGGGATAATATCGCCAGCTTCTACCAGTACGATATCGCCTTTACGAAGTTGGTCGGCAGGAACTTTGTCCGCCGCAGCGCCATATTTCGGCTCACGCAGCTTGCGGGCAAAGGCAGTTTTTCACCCCTTTCAGACTGTTGGCCTGCGCTTTACTGCGGCCTTCTGCCAGCGCCTCGGCGAAATTAGCGAACAGTACGGTGATCCACAGCCAACCGCTAATGGCCGCGCTAAACAGCGCATTGCCGGGCATCGCACCGCTTGCCATCGCGATGCTAATACAGGTGGTCAGCAGACTGCCGATCCAGACGATAAACATCACCGGATTGCGCCATTGCGCCTGCGGGTTTAATTTTTCACCGCTTCTTTCAGCGCCTGAACGACAAGTGTTGGTTCGAATAGCGCCAGTTGTTTACGACTCATATTCAGTGCTCACTATCATCAGGAGAGATATTCCGCCACCGGACCAAGCGCCAGGGCAGGGATAAAGGTCAGTGCGCCAACCAGCAACACGGTGCCGATTAACAGGCCAACAAACAGCGGGCCGTGCGTTGGCAGCGTGCCGGAGCTGGCGGCTTGGCTCTTTTACTCACCAGCGAACCGGCAATTGCCATCACCGGGATAATCACCCCGAAGCGACCGACAAACATGCAGAACGCCAGTAAACAGTTCCAGAACGGAGAGTTGGCGCTTAATCCGGCAAAGGCGCTGCCGTTGTTGTTAGCGGCGGATGACACGGCGTACAGCACTTCGCTAAAACCATGCGGGCCAGGGTTGAGCATGGCGCTACGTCCGGCGTCGGTCATCATCGCCAACGCCGCGCCCATCAGCACCAGCGTCGGGGTAACCAGAATTGCCAGTGCAGTCAGTTTCATCTCGCGTACGTCGATTTTTACCCAGATATTCCGGTGTACGACCAATCATCAGCCCGGCAATAAACACCGCCAGCAGGACAAACAGCATCATGCCGTAAAGACCAGAACCGACACCGCCGAACACCACTTCACCAATTTGCATCAGCCACATCGGCACCATGCCACCGAGAGCGGTAAACGAATCATGCATCGCAATCACCGCGCCACAGGAAGCCGCCGTCGTCACGACCGCAAACAGGCTACTGACCAGCACGCCGAAACGGCTCTCTTTACCTTCCATATTGATGCTGCTGTCCGTGCCCAGTGCCAGCAGATGAGGATTACCCTGAACTTCTGCCCACATCACCACGCCTACGCAGATGACAAAAATCACTGACATCGCCCACAGCAACATGCGCCCCTGGCGGCGATCGCCCATCACTTCACCAAAGGCAAAGCACAGCGCCGTTGGGATCAAGAAGATCGCCAGCATCTGCACGAAGTTGGTCAGTGCGGTTGGGTTTTCAAACGGATGCGACGAGTTGGCATTAAAGAAGCCACCGCCGTTAGTACCGAGCATCTTGATCGCTTCCTGAGAAGCTACAGGCCCCATGGGTAACAGCTGTTGCGCTCCTTCAACGGTATTCACAGCCTGATAAGGCAGAAAGTTTTGCAGCGCACCTTGTTGAATAAAAACAGTGCAATCAACAACGCCACAGGGACTAGCACCCATAACGTGATGCGTAGCAGATCGACCCAGGCATTCCAGAGCGTGCTCATGCTCTGGCGGGTAAACGCC
+>c39789a3-7c1c-4b1e-bc6d-dc0df49e969c id=31 clr=0,6839
+ATGCCCCCGCCAGGCGCGCATTTGCTCATCAACGCGATCGGCAGTACGGCGCAGTGCCAGTTCGCGCAGGGCGATCAGATTACCTTTGCGGAAAAATGTTCAATGGCGCGCTCCGCCTGCCCGGCAATATAGACTTTGCCTTCTTTCAGCCGCTGGCGCAGATCGTCCGGGGCAAGTCCACCAGCACCACGTCGTCGGCGGCATCGAAAAAGGATCGGGCACGGTTTCCCGTACCTGAATTCCGGTGACGCCGCTGACCACATCATTCAGACTTTCCAGATGCTGAACGTTGACGGTAGTGAAAACATCAATGCCAGCTTCCAGCAGTTCTTCGATATCCTGCCAGCGTTTGGGATGACGGGAACCTGGCGCATTACTGTGCGCCAGTTCGTCCATTAAGATCAGCGCCGGGCGGCGGGCGAGGGCGGCATCGAGATCAAACTCGCTGATATGCCGCCCACGGTACGCCTGGCGTTTTAACGGCAGAACAGCCAGCCCTTCCAGCATGGCGGCGGTATTTTCGCCCGTGGGTTTCTACCACGCCAACCACAATATCCAGCCCTTGCGCCCGCAGTCGCTGGGCTTCTGCCAGCATCGCCCAGGTCTTCCCGACGCCTGCACAGGCACCGAAGAAAACTTTCAGCTTCCCCGATGCGGCGCGGCAGTTTGTTCCAGCAGACGATCGGGGTCGGGACGTAAGGGTTCGTTATTCATCAAGTTTATCCAGCGCCAGATTGAGTTCAACAATGTTGACAACCGGCTGGCCGATATATTTCACCAGCGTTGTTGGCTGTATTTTGCGATCAGTTGCGTGAGCTGTTCAACGCTGAGATTACGCGCTTTCGCCACGCGTGTTTGCCAGGCCGCCGCTTGCGGGTGATATTATTGTCCAGCCCGCTTGCCGATGCCGTCACCAGTTCAACCGGAACGCTCGCGCTGGCATCCGGGTTAGCGGCCCGTAATGCAGCAACGCGTGCGGCTATTAGTTTATCCAGCTCAGGGTTACTGACCGCCAGATTGCTCCCGCCAGAAGCCTGTGGATTATAGGGCATTTCTGCCGTTGCCGACGGGCGACCATGAAAATAGCCGTTGCCGGTAAAATTCTGCCCGATTAATGCCGAACCGCGCACCGTATCACCTTCACGAATCAACGAACCATTGGCCTGCCAGGAAACCACCATTGCCCCAGTACGGTGGTCAGCAGCGGGTAAACGCCGCCAGTAATCAATAACAGAAAGATAAATGTTGATAATGCCGGACGTAATCCACTCATGGTAAACCTCACCAGACCGCAAACGGTCAGCAGTAAATCAATGACTTTGATACCGATAAACGGCACCAGCAGCCCACCCAGACCGTAAATCCATAAGTTACGGCGCAACATGGCAGAAGCGGTAAGCGGTTTATAACTCACGCCTTTTAACGCCAGGGGAATCAAAGACGATAATCAAGGCGTTGAAAATCACCGCACTGAGGATTGCGGAGTCGGGCGAATGCAGGCACATGATGTTCAGCGCATTTAACTGCGGATACGTTGCCGCGAATGCCGCCGGAATAATGGCGAAGTATTTCGCCACATCGTTGGCAATGCTGAAGGTGGTCAGAGCCACGGGTCATCAGCATCTGTTTGCCAATGTGCACCACCTCGATCAACTTGGTCGGGTTAGAGTCGAGATCGACCATATTGCCCGCCTCTTTCGCCGCCTGGGTGCCGGAGTTCATCGCCACCGCGACATCTGCCTGCGCCAGCGCCGGAGCATCGTTGGTGCCGTCGCCGGTCATCGCTACCAAACGACCTTCCGCCTGATACTGACGGATCAATGCCAGCTTGGCCTCCGGTGTCGCTTCGGCGAGAAAATCATCGACACCCGCTTCCGCAGCAATCGCGGCGGCAGTCAGACGGTTATCGCCGGTAATCATCACCGTTTTAATGCCCATTTTGCGCAGCTGGGCGAAGCGCTCTTTAATACCGCCTTTGACGATATCTTTCAGCGCAATAACGCCCAGCACGAGAACCTTCCACCACCACCAGCGGCGTGGCTCCCTGACGCGCAACCTGATCGACTTTTGATCAACATCGGTAGGGAAGTGACCACCGTTAGCCTCAACATGGCGACGAATGGCATCGACAGAACCTTTACGGATCATGCGGTTGTCGATGTTGATCCCGCTCATCCGGCTTTGCGCAGTAAACGGTACAAAGGTGGCATGGAGCGACTGCACATCGCGCTCGCGCAGGTTAAAACGCTGCTTGGCGAGGATCACAATACTGCGGCCTTCCGGCGTTTCATCAGCCAGCGAAGCCAGTTGTGCGGCGTCAGCCAGCGTTTTCATCCACGCCCTGCGCGGATAAACTCCGACGCCTGACGGTTACCGAGTGTGATGGTGCCGGTTTTATCCAGTAGCAGAACGTCAACGTCACCTGCCGCTTCAACTGCACGTCCGCTGGTGGCAATCACATTCGCGCCTAGCATCCGGCTCATCCCGGCGACGCCGATCGCTGACAACAGGCCGCCAATAGTGGTTGGGATCAGACAGACCAGCAGCGCCACCAGTACCGTTACGCTGACTGCATTACCGCCCCACGCGGAAAACGGCCACAGCGTGGCGGTTGCCAGTAAAAAGACGATAGTCAGGGCAATCAGCAGAATGGTCAGGGCAATTTCGTTCGGCGTTTTGCGTCGCTGTGCGCCTTCCACCATCGCGATCATCCGATCCAGAAATGTCTCGCCGGGGTTAACGCTACACTCAATCACCAGCCAGTCAGAAAGAATACGCGTGCCGCCGGTGACGGAGGCAAAATCGCCGCCGGATTCACGGATCACCGGTGCCGATTCCCCGGTGATGGCGCTTTCATCGACCGATGCACCTTCAATAACTTCACCATCGCGGGGATAATATCGCCAGCTTCTACCAGTACGATATCGCCTTTACGAAGTTGGTCGGCAGGAACTTTGTCCGCCGCAGCGCCATATTTCGGCTCACGCAGCTTGCGGGCAAAGGCAGTTTTTCACCCTTTCAGACTGTTGGCCTGCGCTTTACTGCGGCCTTCTGCCAGCGCCTCGGCGAAATTAGCGAACAGTACGGTGATCCACAGCCAACCGCTAATGGCCGCGCTAAACAGCGCATTGCCGGGCATCGCACCGCTTGCCATCGCGATGCTAATACAGGTGGTCAGCAGACTGCCGATCCAGACGATAAACATCACCGGATTGCGCCATTGCGCCTGCGGGTTTAATTTTTCACCGCTTCTTTCAGCGCCTGAACGACAAGTGTTGGTTCGAATAGCGCCAGTTGTTTACGACTCATATTCAGTGCTCACTCAATATCATCAGGAGATATTCCGCCACCGGACCAAGCGCCAGGGCAGGGATAAAGGTCAGTGCGCCAACCAGCAACACGGTGCCGATTAACAGGCCAACAAACAGCGGGCCGTGCGTTGGCAGCGTGCCGGAGCTGGCGGCTTGGCTCTTTTACTCACCAGCGAACCGGCAATTGCCATCACCGGGATAATCACCCCGAAGCGACCGACAAACATGCAGAACGCCAGTAAACAGTTCCAGAACGGAGAGTTGGCGCTTAATCCGGCAAAGGCGCTGCCGTTGTTGTTAGCGGCGGATGACACGGCGTACAGCACTTCGCTAAAACCATGCGGGCCAGGGTTGAGCATGGCGCTACGTCCGGCGTCGGTCATCATCGCCAACGCCGCGCCCATCAGCACCAGCGTCGGGGTAACCAGAATTGCCAGTGCAGTCAGTTTCATCTCGCGTACGTCGATTTTTACCCAGATATTCCGGTGTACGACCAATCATCAGCCCGGCAATAAACACCGCCAGCAGGACAAACAGCATCATGCCGTAAAGACCAGAACCGACACCGCCGAACACCACTTCACCAATTTGCATCAGCCACATCGGCACCATGCCACCGAGAGCGGTAAACGAATCATGCATCGCAATCACCGCGCCACAGGAAGCCGCCGTCGTCACGACCGCAAACAGGCTACTGACCAGCACGCCGAAACGGCTCTCTTTACCTTCCATATTGATGCTGCTGTCCGTGCCCAGTGCCAGCAGATGAGGATTACCCTGAACTTCTGCCCACATCACCACGCCTACGCAGATGACAAAATCACTGACATCGCCCACAGCAACATGCGCCCCTGGCGGCGATCGCCCATCACTTCACCAAAGGCAAAGCACAGCGCCGTTGGGATCAAGAAGATCGCCAGCATCTGCACGAAGTTGGTCAGTGCGGTTGGGTTTTCAAACGGATGCGACGAGTTGGCATTAAAGAAGCCACCGCCGTTAGTACCGAGCATCTTGATCGCTTCCTGAGAAGCTACAGGCCCCATGGGTAACAGCTGTTGCGCTCCTTCAACGGTATTCACAGCCTGATAAGGCAGAAAGTTTTGCAGCGCACCTTGTTGAATAAAAACAGTGCAATCAACAACGCCACAGGGACTAGCACCCATAACGTGATGCGTAGCAGATCGACCCAGGCATTCCCGAGCGTGCTCATGCTCTGGCGGGTAAACGCACGGATGAGGGCAAAATCACCGCAATCCCGCTGGCGGCAGAAAGTTTTGCACCGTTAAGCCCGCCATCTGGCTGAAATAGCTCAACGTGGTTTCACCGCTATAAGATTGCCAGTTGGTATTGGTGACAAAGCTGACGGCGGTATTCAGCGCCAGATCCCACGACAGCCCTGGCAACTGCTGTGGATTAAGCGGCAGATAGTGCTGACCGAGCAACATAAAAACAGCACCGCCAGCCCCAGCATGTTCAGGCCGAGAATGGCACAAAGATATTGCTTCCAGTTCATCTCACGGTCAGAGACGCCAAGTGCGCGAAAAGTACGCGCTCAACGCCCGTTGTACCGGGAAGAGGAATGTCATTAATCAGCCGCGCCAGCCCGCTGCCTAAAGGACGCGCCAGCACCATTAACACCAGTAAAAACGTGGCGATCAGTAAGAACCCTTGCGCAGCCATCAGAACGCCTCCGCATTGATCAGGGCATAAACCAGATAACCCAGTAATAAAACACCAGCAATACGCCGGTTATCACGCCTGCACTCACAGTGCACCTCCAGTGGCCTAAAAGTGATACCGGAAGGGTAGAATTCTGGCTGCAAAGATTTCGCAAAAATCTGCGGGCGGGGTGTAAAAAGTATAAAAATGGCAAAAGCCATGATTTAACTAATGTTTAGTATTAATTTAACTTTGTGTAACTTAATTACAGGATGAATGTAAATAAACCATCAATAAGCAAAAATAAGTGGTCGGATGAGTAGTAAAATTACACAAAAGGCGGTACTATTTTCATCAGATAAACAAATTCATTTTTCGGTGCCATTCACCGGGTAGATACAAAAGGGGAGAAAAGTATGGAACTCTACAGAGAATATCCTGCATGGCTTATCTTTTTACGCCGTACTTATGCGGTTGCAGCGGGCGTTCTGGCGCTGCCTTTCATGCTTTTCTGGAAAGACCGCGCCCGCTTTTACAGCTACCTGCATCGCGTCTGGTCGAAAACCAGCGATAAACCGGTGTGGATGGATCAGGCCGAAAAGGCAACTGGTGATTTTATTGATTGCTGAGTTTTGAATACATTGAAAACCGCCAGCGGAAACGCTGGCGGTTTTTGTATCAGGAAGATGTTCAGAGGAATATTTAGACATCGTTATACCAATCGAAACATATATTCATGAAATATATATAAATATTTTCCTAATTGTTCTTATCTGACAGATATCTCACTTAAGGCTTTCTTATAAATCTGTAGGGTTTCGCCTGTCAGCAGACAAATAACCCGATAAAACAAGGATGAGCAGATGAGCGGAAAACCGGCGGCGCGTCAGGGCGACATGACGCAGTATGGCGGTAGCATTGTCCAGGGTTCAGCCGGGGTACGCATCGGTGCCCCACCGGCGTGGCCTGTTCGGTGTGCCCCGGCGGGTGACGTCCGGCCATCCGGTCAATCCGCTGCTCGGTGCAAAGGTCCTTCCCGGTGAAACCGACATCGCCCTGCCCGGCCCGCTGCCGTTCATTCTCTCCCGCACCTACAGCAGTTACCGGACAAAACGCCCGCGCCGGTGGGGCCTCGGCCCCGGCTGGAAAATGCCTGCGGATATCCGCTTACAGCTGCGCGATAACACACTGATACTCAGTGATAACGGCGGCAGAAGCCTGTATTTTGAGCACCTGTTTCCCGGTGAGGACGGTTACAGCCGCAGCGAGTCACTGTGGCTGGTGCGCGGCGGCGTGGCGAAACTGGATGAAGGTCACCGGCTGGCCGCACTCTGGCAGGCGCTGCCGGAAGAACTCCGCTTAAGTCCGCATCGTTATCTGGCGACAAACAGTCCGCAGGGGCCGTGGTGGCTGCTCGGCTGGTGTGAGCGGGTGCCGGAAGCGGATGAGGTGCTGCCTGCGCCGCTGCCGCCGTACCGGGTACTGACCGGGCTGGTGGACCGCTTCGGGCGCACACAGACGTTCCACCGCGAAGCCGCCGGTGAATTCAGCGGCGAAATCACCGGCGTGACGGATGGTGCCGGGCGTCACTTCCGGCTGGTACTGACCACGCAGGCGCAGCGGGCAGAAGAAGCCCGGCAGCAGGCCATTTCCGGCGGGACGGAACCGTCCGCTTTCCTGATACCCTGCCGGGTTACACCGAATATGGCCGGGACAACGGCATCCGTCTGCCGTGTGGCTGACGCACGACCCGGAATACCCGGAGAATTTACCTGCCGCGCCGCTGGTGCGCTGTAACTGGACGCTAGGTTTTAAACACCCAAGCAGACGCCGAAGATAGAGCGACAGGCAAGTAGCAATACGTAACTT
+>9388888e-4344-4e51-a44c-54c3b3c62b8b id=32 clr=0,8184
+GCTGCCTGTCGCTCTATCTTCGGCGTCTGCGGGTGTTTAACCCACTTGTCTTTAAAGAGCGGTTATCCGGCGCGTTGTTAATCGTGCGGGCGGGTGGTTCATCAAGCGCGACCAGCACCTGATCGAGATCGGGGCGATGCGCGCCAGTCGGTCAGCAAACGTTTCCCGACGCCACCAGCGGCGCGAGGCCGGGCGACCGAGAATAATCTTGCCGAGATTATGTTCACGGGCATAACGCACTACCGCTTTCTCTTCCGCTGGATCAGAAAGTGTTGCCGTCTCGCGCCCAGTTCCTGCGCCAGACGTAAGGCGCTGAGAATTGCCCGACGTTTTTCCGGTAAGCGGTGCAGGGCAGGGGTTTCAACATACACCGCGTGCCAGACGCTACCCAGCCGTGACGCCAGCCGCGCCGCTGCGCGGACCAGTTTTCGCTGCCGGTGTTATGGCCGATGCATAAAAGGATCGCGTCGCGCGTGTGCCACACTTTCTCTTCGCCAGGATGCCCCGCCAGGCGCGCATTTGCTCATCAACGCGATCGGCAGTACGGCGCAGTGCCAGTTCGCGCAGGGCGATCAGATTACCTTTGCGGAAAAATGTTCAATGGCGCGCTCCGCCTGCCCGGCAATATAGACTTTGCCTTCTTTCAGCCGCTGGCGCAGATCGTCCGGGGCAAGTCCACCAGCACCACGTCGTCGGCGGCATCGAAAAGGATCGGGCACGGTTTCCCGTACCTGAATTCCGGTGACGCCGCTGACCACATCATTCAGACTTTCCAGATGCTGAACGTTGACGGTAGTGAAAACATCAATGCCAGCTTCCAGCAGTTCTTCGATATCCTGCCAGCGTTTGGGATGACGGGAACCTGGCGCATTACTGTGCGCCAGTTCGTCCATTAAGATCAGCGCCGGGCGGCGGGCGAGGGCGGCATCGAGATCAAACTCGCTGATATGCCGCCCACGGTACGCCTGGCGTTTTAACGGCAGAACAGCCAGCCCTTCCAGCATGGCGGCGGTATCTTTTCGCCCGTGGGTTTCTACCACGCCAACCACAATATCCAGCCCTTGCGCCCGCAGTCGCTGGGCTTCTGCCAGCATCGCCCAGGTCTTCCCGACGCCTGCACAGGCACCGAAGAAAACTTTCAGCTTCCCCGATGCGGCGCGGCAGTTTGTTCCAGCAGACGATCGGGGTCGGGACGTAAGGGTTCGTTATTCATCAAGTTTATCCAGCGCCAGATTGAGTTCAACAATGTTGACAACCGGCTGGCCGATATATTTCACCAGCGGTTGTTGGCTGTATTTTGCGATCAGTTGCGTGAGCTGTTCAACGCTGAGATTACGCGCTTTCGCCACGCGTGGGATTTGCCAGGCCGCCGCTTGCGGGGTGATATTATTGTCCAGCCCGCTTGCCGATGCCGTCACCAGTTCAACCGGAACGCTCGCGCTGGCATCCGGGTTAGCGGCCCGTAATGCAGCAACGCGTGCGGCTATTAGTTTATCCAGCTCAGGGTTACTGACCGCCAGATTGCTCCCGCCAGAAGCCTGTGGATTATAGGGCATTTCTGCCGTTGCCGACGGGCGACCATGAAAATAGCCGTTGCCGGTAAAATTCTGCCCGATTAATGCCGAACCGCGCACCGTATCACCTTCACGAATCAACGAACCATTGGCCTGCCAGGAAACCACCATTGCCCCAGTACGGTGGTCAGCAGCGGGTAAACGCCGCCAGTAATCAATAACAGAAAGATAAATGTTGATAATGCCGGACGTAATCCACTCATGGTAAACCTCACCAGACCGCAAACGGTCAGCAGTAAATCAATGACTTTGATACCGATAAACGGCACCAGCAGCCCACCCAGACCGTAAATCCATAAGTTACGGCGCAACATGGCAGAAGCGGTAAGCGGTTTATAACTCACGCCTTTAACGCCAGGGGAATCAAAGACGATAATCAAGGCGTTGAAAATCACCGCACTGAGGATTGCGGAGTCGGGCGAATGCAGGCACATGATGTTCAGCGCATTTAACTGCGGATACGTTGCCGCGAATGCCGCCGGAATAATGGCGAAGTATTTCGCCACATCGTTGGCAATGCTGAAGGTGGTCAGCGAGCCACGGGTCATCAGCATCTGTTTGCCAATGTGCACCACCTCGATCAACTTGGTCGGGTTAGAGTCGAGATCGACCATATTGCCCCCTCTTTCGCCGCCTGGGTGCCGGAGTTCATCGCCACCGCGACATCTGCCTGCGCCAGCGCCGGAGCATCGTTGCCGTCGCCGGTCATCGCTACCAAACGACCTTCCGCCTGATACTGACGGATCAATGCCAGCTTGGCCTCCGGTGTCGCTTCGGCGAGAAAATCATCGACACCCGCTTCCGCAGCAATCGCGGCGGCAGTCAGACGGTTATCGCCGGTAATCATCACCGTTTTAATGCCCATTTTGCGCAGCTGGGCGAAGCGCTCTTTAATACCGCCTTTGACGATATCTTTCAGCGCAATAACGCCCAGCACGAGAACCTTCCACCACCACCAGCGGCGTGGCTCCTGACGCGCAACCTGATCGACTTTTGATCAACATCGGTAGGGAAGTGACCACCGTTAGCCTCAACATGGCGACGAATGGCATCGACAGAACCTTTACGGATCATGCGGTTGTCGATGTTGATCCCGCTCATCCGGCTTTGCGCAGTAAACGGTACAAAGGTGGCATGGAGCGACTGCACATCGCTCGCGCAGGTTAAAACGCTGCTTGGCGAGGATCACAATACTGCGGCCTTCCGGCGTTTCATCAGCCAGCGAAGCCAGTTGTGCGGCGTCAGCCAGCGTTTTCATCCACGCCCTGCGCGGATAAACTCCGACGCCTGACGGTTACCGAGTGTGATGGTGCCGGTTTTATCCAGTAGCAGAACGTCAACGTCACCTGCCGCTTCAACTGCACGTCCGCTGGTGGCAATCACATTCGCGCCTAGCATCCGGCTCATCCCGGCGACGCCGATCGCTGACAACAGGCCGCCAATAGTGGTTGGGATCAGACAGACCAGCAGCGCCACCAGTACCGTTACGCTGACTGCATTACCGCCCCACGCGGAAAACGGCCACAGCGTGGCGGTTGCCAGTAAAAAGACGATAGTCAGGGCAATCAGCAGAATGGTCAGGGCAATTTCGTTCGGCGTTTTGCGTCGCTGTGCGCCTTCCACCATCGCGATCATCCGATCCAGAAATGTCTCGCCGGGGTTAACGCTACACTCAATCCAGCCAGTCAGAAAGAATACGCGTGCCGCCGGTGACGGAGGCAAAATCGCCGCCGGATTCACGGATCACCGGTGCCGATTCCCCGGTGATGGCGCTTTCATCGACCGATGCACCCCTTCAATAACTTCACCATCGCAGGGATAATATCGCCAGCTTCTACCAGTACGATATCGCCTTTACGAAGTTGGTCGGCAGGAACTTTGTCCGCCGCAGCGCCATATTTCGGCTCACGCAGCTTGCGGGCAAAGGCAGTTTTTCACCCCTTTCAGACTGTTGGCCTGCGCTTTACTGCGGCCTTCTGCCAGCGCCTCGGCGAAATTAGCGAACAGTACGGTGATCCACAGCCAACCGCTAATGGCCGCGCTAAACAGCGCATTGCCGGGCATCGCACCGCTTGCCATCGCGATGCTAATACAGGTGGTCAGCAGACTGCCGATCCAGACGATAAACATCACCGGATTGCGCCATTGCGCCTGCGGGTTTAATTTTTCACCGCTTCTTTCAGCGCCTGAACGACAAGTGTTGGTTCGAATAGCGCCAGTTGTTTACGACTCATATTCAGTGCTCACTCAATATCATCAGGAGAGATATTCCGCCACCGGACCAAGCGCCAGGGCAGGGATAAAGGTCAGTGCGCCAACCAGCAACACGGTGCCGATTAACAGGCCAACAAACAGCGGGCCGTGCGTTGGCAGCGTGCCGGAGCTGGCGGCTTGGCTCTTTTACTCACCAGCGAACCGGCAATTGCCATCACCGGGATAATCACCCCGAAGCGACCGACAAACATGCAGAACGCCAGTAAACAGTTCCAGAACGGAGAGTTGGCGCTTAATCCGGCAAAGGCGCTGCCGTTGTTGTTAGCGGCGGATGACACGGCGTACAGCACTTCGCTAAAACCATGCGGGCCAGGGTTGAGCATGGCGCTACGTCCGGCGTCGGTCATCATCGCCAACGCCGCGCCCATCAGCACCAGCGTCGGGGTAACCAGAATTGCCAGTGCAGTCAGTTTCATCTCGCGTACGTCGATTTTTTACCCAGATATTCCGGTGTACGACCAATCATCAGCCCGGCAATAAACACCGCCAGCAGGACAAACAGCATCATGCCGTAAAGACCAGAACCGACACCGCCGAACACCACTTCACCAATTTGCATCAGCCACATCGGCACCATGCCACCGAGCGGTAAACGAATCATGCGCAATCACCGCGCCACAGGAAGCCGCCGTCGTCACGACCGCAAACAGGCTACTGACCAGCACGCCGAAACGGCTCTCTTTACCTTCCATATTGATGCTGCTGTCCGTGCCCAGTGCCAGCAGATGAGGATTACCCTGAACTTCTGCCCACATCACCACGCCTACGCAGATGACAAAATCACTGACATCGCCCACAGCAACATGCGCCCCTGGCGGCGATCGCCCATCACTTCACCAAAGGCAAAGCACAGCGCCGTTGGGATCAAGAAGATCGCCAGCATCTGCACGAAGTTGGTCAGTGCGGTTGGGTTTTCAAACGGATGCGACGAGTTGGCATTAAAGAAGCCACCGCCGTTAGTACCGAGCATCTTGATCGCTTCCTGAGAAGCTACAGGCCCCATGGGTAACAGCTGTTGCGCTCCTTCAACGGTATTCACAGCCTGATAAGGCAGAAAGTTTTGCAGCGCACCTTGTTGAATAAAAACAGTGCAATCAACAACGCCACAGGGACTAGCACCCATAACGTGATGCGTAGCAGATCGACCCAGGCATTCCCGAGCGTGCTCATGCTCTGGCGGGTAAACGCACGGATGAGGGCAAAATCACCGCAATCCCGCTGGCGGCAGAAAGAAAGTTTTGCACCGTTAAGCCCGCCATCTGGCTGAAATAGCTCAACGTGGTTTCACCGCTATAAGATTGCCAGTTGGTATTGGTGACAAAGCTGACGGCGGTATTCAGCGCCAGATCCCACGACAGCCCTGGCAACTGCTGTGGATTAAGCAGATAGTGCTGACCGAGCAACATAAAAACAGCACCGCCAGCCCCAGCATGTTCAGGCCGAGAATGGCACAAAGATATTGCTTCCAGTTCATCTCACGGTCAGAGACGCCAAGTGCGCGAAAAGTACGCGCTCAACGCCCGTTGTACCGGGAAGAGGAATGTCATTAATCAGCCGCGCCAGCCCGCTGCCTAAAGGACGCGCCAGCACCATTAACACCAGTAAAAACGTGGCGATCAGTAAGAACCCTTGCGCAGCCATCAGAACGCCTCCGCATTGATCAGGGCATAAACCAGATAACCCAGTAATAAAACACCAGCAATACGCCGGTTATCACGCCTGCACTCACAGTGCACCTCCAGTGGCCTAAAAGTGATACCGGAAGGGTAGAATTCTGGCTGCAAAGATTTCGCAAAATCTGCGGGCGGGGTGTAAAGTATAAAAATGGCAAAAGCCATGATTTAACTAATGTTTAGTATTAATTTAACTTTGTGTAACTTAATTACAGGATGAATGTAAATAAACCATCAATAAGCAAAAATAAGTGGTCGGATGAGTAGTAAAATTACACAAAAGGCGGTACTATTTTCATCAGATAAACAAATTCATTTTTCCGGTGCCATTCACCGGGTAGATACAAAAGGGGAGAAAAGTATGGAACTCTACAGAGAATATCCTGCATGGCTTATCTTTTTACGCCGTACTTATGCGGTTGCAGCGGGCGTTCTGGCGCTGCCTTTCATGCTTTTCTGGAAAGACCGCGCCCGCTTTTACAGCTACCTGCATCGCGTCTGGTCGAAAACCAGCGATAAACCGGTGTGGATGGATCAGGCCGAAAAGGCAACTGGTGATTTTATTGATTGCTGAGTTTTGAATACATTGAAAACCGCCAGCGGAAACGCTGGCGGTTTTTGTATCAGGAAGATGTTCAGAGGAATATTTAGACATCGTTATACCAATCGAAACATATATTCATGAAATATATATAAATATTTTCCTAATTGTTCTTATCTGACAGATATCTCACTTAAGGCTTTCTTATAAATCTGTAGGGTTTCGCCTGTCAGCAGACAAATAACCCGATAAAACAAGGATGAGCAGATGAGCGGAAAACCGGCGGCGCGTCAGGGCGACATGACGCAGTATGGCGGTAGCATTGTCCAGGGTTCAGCCGGGGTACGCATCGGTGCCCCACCGGCGTGGCCTGTTCGGTGTGCCCCGGCGGGTGACGTCCGGCCATCCGGTCAATCCGCTGCTCGGTGCAAAGGTCCTTCCCGGTGAAACCGACATCGCCCTGCCCGGCCCGCTGCCGTTCATTCTCTCCGCACCTACAGCAGTTACCGGACAAAACGCCCGCGCCGGTGGGGAGCCTCGGCCCCGGCTGGAAAATGCCTGCGGATATCCGCTTACAGCTGCGCGATAACACACTGATACTCAGTGATAACGGCGGCAGAAGCCTATTTTGAGCACCTGTTTCCCGGTGAGGACGGTTACAGCCGCAGCGAGTCACTGTGGCTGGTGCGCGGCGGCGTGGCGAAACTGGATGAAGGTCACCGGCTGGCCGCACTCTGGCAGGCGCTGCCGGAAGAACTCGCTTAAGTCCGCATCGTTATCTGGCGACAAACAGTCCGCAGGGGCCGTGGTGGCTGCTCGGCTGGTGTGAGCGGGTGCCGGAAGCGGATGAGGTGCTGCCTGCGCCGCTGCCGCCGTACCGGGTACTGACCGGGCTGGTGGACCGCTTCGGGCACACAGACGTTCCACCGCGAAGCCGCCGGTGAATTCAGCGGCGAAATCACCGGCGTGACGGATGGTGCCGGGCGTCACTTCCGGCTGGTACTGACCACGCAGGCGCAGCGGGCAGAAGAAGCCCGGCAGCAGGCCATTTCCGGCGGGACGGAACCGTCCGCTTTTCCTGATACCCTGCCGGGTTACACCGAATATGGCCGGGACAACGGCATCCGTCTGTCTGCCGTGTGGCTGACGCACGACCCGGAATACCCGGAGAATTTACCTGCCGCGCCGCTGGTGCGCTATGGCTGGACGCCCGCGGCGAACTGGCGGCGGTGTATGACCGCAGCAATACACAGGTGCGCAGCTTTACCGATGATAAATACCGGGGCCGGATGGTGGCGCACCGTCACACGGGCCGACCGGAAATCTGTTACCGTTACGACAGCGACGGGCGGGTGACAGAACAAACCCGGCAGCTTAAGTTACACGTATCAGTATGAGAAGGACCGCATCACCATCACCGACAGCCTGAACCGCCGTGAAGTCCTGCAGCAGGTGAAGGCGGGCTGAAGCGGGTGGTGAAAAAGGAACACGCGGACGGCAGCGTCACGCAGAGTCAGTTTGACGCGGTGGGCAGGCTCAGGCACAGACGGATGCCGCAGGCAGGACAACAGAATACAGTCCGGATGTGGTGACGGGCCTCATCACGCGCATCACCACGCCGGATGGCAGGGCATCGGCGTTTTACTATAACCACCACAGCCAGTTAACGTCAGCCACCGGGCCTGACGGGCTGGAAATACGCCGGGAATATGATGAATGGGGCCGTCTGATTCAGGAAACTGCCCTGACGGCGATATCACCCGCTACCGTTATGATAATCCACAGTGACTTACCCTGCGCAACGGAAGATGCCACCGGCAGCGGAAAACCATGACGTGGAGCCGTTACGGTCAGTTGCTGAGCTTCACTGACTGTTCCGGTTATGTAACCCGCTATGACCATGACCGTTTTGGTCAGGTGACGGCGGTGCACCGCGAGGAAGGGCTGAGTCAGTACCGCGCATACGACAGCCGTGGACAGTTAATTGCCGTGAAAGACACGCAGGGCCATGAAACGCGGTATGAATACAACGCCGCCGGTGACCTGACCACCGTCATTGCCCCGGACGGCAGCAGAAACGGGACACAGTACGATGCGTGGGGAAAAGCCATCTGTACCACGG
+>c30b48fc-11eb-4d3d-9c89-58ad29b2631d id=33 clr=0,4124
+TTGGTATGCTTCGTTCAGTTACGTATTGCTCTTGCCTGTCGCTCTCTATCTTCGGCGTCTGCTTGGGTGTTTAACCTACCCTTGCGCAGCCATCAGAACGCCTCCGCATTGATCAGGGCATAAACCAGATAACCCAGTAATAAAACACCAGCAATACGCCGGTTATCACGCCTGCACTCAGGTGCACCTCCAGTGGCCTAAAAGTGATACCGGAAGGGTAGAATTCTGGCTGCAAAGATTTCGCAAAAATCTGCGGGCGGGGTGTAAAAAGTATAAAATGGCAAAAGCCATGATTTAACTAATGTTTAGTATTAATTTAACTTTGTGTAACTTAATTACAGGATGAATGTAAATAAACCATCAATAAGCAAAAATAAGTGGTCGGATGAGTAGTAAAATTACACAAAAGGCGGTACTATTTTCATCAGATAAACAAATTCATTTTTCCGTGCCATTCACCGGGTAGATACAAAGGGGAGAAAGTATGGAACTCTACAGAGAATATCCTGCATGGCTTATCTTTTTACGCCGTACTTATGCGGTTGCAGCGGGCGTTCTGGCGCTGCCTTTCATGCTTTTCTGGAAAGACCGCGCCCGCTTTTACAGCTACCTGCATCGCGTCTGGTCGAAAACCAGCGATAAACCGGTGTGGATGGATCAGGCCGAAAAGGCAACTGGTGATTTTATTGATTGCTGAGTTTTGAATACATTGAAAACCGCCAGCGGAAACGCTGGCGGTTTTTATATCAGGAAGATGTTCAGAGGAATATTTAGACATCGTTATACCAATCGAAACATATATTCATGAAATATATATAAATATTTTCCTAATTGTTCTTATCTGACAGATATCTCACTTAAGGCTTTCTTATAAATCTGTAGGGTTTCGCCTGTCAGCAGACAAATAACCCGATAAAACAAGGATGAGCAGATGAGCGGAAAACCGGCGGCGCGTCAGGGCGACATGACGCAGTATGGCGGTAGCATTGTCCAGGGTTCAGCCGGGGTACGCATCGGTGCCCCACCGGCGTGGCCTGTTCGGTGTGCCCCGGCGGGTGACGTCCGGCCATCCGGTCAATCCGCTGCTCGGTGCAAAGGTCCTTCCCGGTGAAACCGACATCGCCCTGCCCGGCCCGCTGCCGTTCATTCTCTCCGCACCTACAGCAGTTACCGGACAAAACGCCCGCGCCGGTGGAGCCTCGGCCCCGGCTGGAAAATGCCTGCGGATATCCGCTTACAGCTGCGCGATAACACACTGATACTCAGTGATAACGGCGGCAGAAGCCTGTATTTTGAGCACCTGTTTCCCGGTGAGGACGGTTACAGCCGCAGCGAGTCACTGTGGCTGGTGCGCGGCGGCGTGGCGAAACTGGATGAAGGTCACCGGCTGGCCGCCTCTGGCAGGCGCTGCCGGAAGAACTCCGCTTAAGTCCGCATCGTTATCTGGCGACAAACAGTCCGCAGGGGCCGTGGTGGCTGCTCGGCTGGTGTGAGCGGGTGCCGGAAGCGGATGAGGTGCTGCCTGCGCCGCTGCCGCCGTACCGGGTACTGACCGGGCTGGTGGACCGCTTCGGGCGCACACAGACGTTCCACCGCGAAGCCGCCGGTGAATTCAGCGGCGAAATCACCGGCGTGACGGATGGTGCGTCACTTCCGGCTGGTACTGACCACGCAGGCGCAGCGGGCAGAAGAAGCCCGGCAGCAGGCCATTTCCGGCGGGACGGAACCGTCCGCTTTTCTGATACCCTGCCGGGTTACACCGAATATGGCGGGACAACGGCATCCGTCTGTCTGCCGTGTGGCTGACGCACGACCCGGAATACCCGGAGAATTTACCTGCCGCGCCGCTGGTGCGCTATGGCTGGACGCCCCGCGGCGAACTGGCGGCGGTGTATGACCGCAGCAATACACAGGTGCGCAGCTTTACTTACGATGATAAATACCGGGGCCGGATGGTGGCGCACCGTCACACGGGCCGACCGGAAATCTGTTACCGTTACGACAGCGACGGGCGGGTGACAGAACAGCTAAACCCGGCAGGCTTAAGTTACGTATCAGTATGAGAAGGACCGCATCACCATCACCGACAGCCTGAACCGCCGTGAAGTCCTGCACGCAGGGTGAAGGCGGGCTGAAGCGGGTGGTGAAAAGGAACACGCGGACGGCAGCGTCACGCAGAGTCAGTTTGACGCGGTGGGCAGGCTCAGGGCACAGACGGATGCCGCAGGCAGGACAACAGAATACAGTCCGGATGTGGTGACGGGCCTCATCACGCGCATCACCACGCCGGATGGCAGGGCATCGGCGTTTTACTATAACCACCACAGCCAGTTAACGTCAGCCACCGGGCCTGACGGGCTGGAAATACGCCGGAATATGATGAATGGGGCCGTCTGATTCAGGAAACTGCCCCTGACGGCGATATCACCCGCTACCGTTATGATAATCCACACAGTGACTTACCCTGCGCAACGGAAGATGCCACCGGCAGCCGGAAAACCATGACGTGGAGCCGTTACGGTCAGTTGCTGAGCTTCACTGACTGTTCCGGTTATGTAACCCGCTATGACCATGACCGTTTTGGTCAGGTGACGGCGGTGCACCGCGAGGAAGGGCTGAGTCAGTACCGCGCATACGACAGCCGTGGACAGTTAATTGCCGTGAAAGACACGCAGGGCCATGAAACGCGGTATGAATACAACGCCGCCGGTGACCTGACCACCGTCATTGCCCCGGACGGCAGCAGAAACGGGACACAGTACGATGCGTGGGGAAAAGCCATCTGTACCACGCAGGGCGGTCTGACGCGCAGTATGGAATACGATGCTGCCGGACGGGTCATCCGCCTGACCAGTGAAAACGGCAGCCACACCACCTTCCGTTACGATGTACTCGACCGGCTGATACAGGAAACCGGCTTTGACGGCCGCACACAGCGTTATCACCACGACCTGACCGGCAAACTTATCCGCAGCGAGGATGAGGGCTGGTCACCCACTGGCACTATGACGAAGCAGACCGCCTCACGCACCGCACCGTGAATGGCGAAACCGCAGAGCGGTGGCAGTATGACGAACGCGGCTGGCTGACAGACATCAGCCATATCAGCGAAGGGCACCGGGTGACGGTGCACTATGGTTATGACAGTAAAGGCCGCCTCGCCAGTGAACACCTGACGGTGCATCATCCGCAGACGAATGAACTGCTCTGGCAGCATGAGACCAGACATGCGTACAACGCACAGGGACTGGCGAACCGCTGTATACCGGACAGCCTGCCCGCCGTGGAATGGCTGACCTACGGCAGCGGCTGGCTGTCAGGCATGAAACTCGGCGACACACCGCTGGTGGAGTACACCCGCGACCGCCTGCACCGGGAAACGCTGCGCAGCTTCGGCCGTTATGAACTCACCACCGCTTATACCCTGCCGGGCAGTTACAGAGCCAGCACCTGAACAGCCTGCTGTCTGACCGCGATTACACCTGGAACGACAACGGCGAACTCATCCGCATCAGCAGCCCGCGCCAGACCCGGAGTTACAGCTACAGCACCACCGGCAGGCTGACCGGCGTTCACACCACCGCAGCGAATCTGGATATCCGCATCCCGTATACCACAGACCCGGCAGGTAACCGCCTGCCCGACCCGGAGCACCCGGACAGCGCCCTCAGCATGTGGCCGGATAACCGTATCGCCCGTGACGCGCACTATCTTTACCGGTATGACCGTCACGGCAGGCTGACAGAGAAACCGACCTCATCCCGGAAGGGGTTATCCGCACGGATGATGAGCGCACCCACCGGTACCATTACGACAGTCAGCACCGGCTGGTGCACTACACGCGGACACAATATGCAGAGCCGCTGGTCGAAAGTCGCTATCTTTACGACCCGCTGGGCCGCAGGGTGGCAAAACGGGTATGGCGGCGTGAACGGGACCTGACGGGCTGGATGTCGCTGTCACGGAAACCGCAAGTGACCTGGTACGGCTGGGACGGCGACCGCCTGACCACGATACAGAACGACAGAACCCGCATCCAGACGATTTATCAGCCGGGGAGCTTCACGCCACTCATCAGGGTTGAAACCGCCACCGGTGAGCGCAGAAGCAGACGCCGAAGACGG
+>237f1f8e-b267-437b-b8d0-464a8f838fc0 id=34 clr=0,5073
+TTCGTGTATGCGCTGGTTTCAGTTACGTATTGCTACGCCTGTCGCTCTATCTTCGGCGTCTGCTTGGGTGTTTAACCTGCCTGATCGCATGAGCCACCAGTGCCATTTATCGCGCGCAACTCGCCACCAGGCATTTTCCAGCCAGGGCCGAGGCTCCCCACCGGCGCGGGCGTTTTGTCCGGTAACTGCTGTAGGTGCGGGAGAGAATGATGAACGGCAGCGGGCCGGGCAGGGCGATGTCGGTTTCACCGGGAAGGACCTTTGCACCGAGCAGCGGATTGACCGGATGGCGGACGTCACCCGCCGGGGCACCGAACAGGCCACGCCGGTGGGGCACCGATGCGTACCCCGGCTGAACCCTGGACAATGCTACCGCCATACTGCGTCATGTCGCCCTGACGCGCCGCCGGTTTTCCGCTCATCTGCTCATCCTTGTTTTATCGGGTTATTTGTCTGCTGACAGGGCGAAACCCTACAGATTTATAAGAAAGCCTTAAGTGAGATATCTGTCAGATAAGAACAATTAGGAAAATATTTATATATATTTCATGAATATATGTTTCGATTGGTATAACGATGTCTAAATATTCCTCTGAACATCTTCCTGATACAAAAACCGCCAGCGTTTCCGCTGGCGGTTTTCAATATTCAAAACTCAGCAATCAATAAAATCACCAGTTGCCTTTTCGGCCTGATCCATCCACACCGGTTTATCGCTGGTTTTCGACCAGACGCGATGCAGGTAGCTGTAAAAGCGGGCGCGGTCTTTCCAGAAAAGCATGAAAGGCAGCGCCAGAACGCCCGCTGCAACCGCATAAGTACGGCGTAAAATAAGCCATGCAGGATATTCTCTGTAGAGTTCCATACTTTTCTCCCCTTTTGTATCTACCCGGTGAATGGCACCGGAAAATGAATTTGTTTATCTGATGAAAATAGTACCGCCTTTTGTGTAATTTTACTACTCATCCGACCACTTATTTTTGCTTATTGATGGTTTATTTACATTCATCCTGTAATTAAGTTACACAAAAGTTAAATTAATACTAAACATTAGTTAAATCATGGCTTTTGCCATTTTTATACTTGCCCGCAGATTTTTGCGAAATCTTTGCAGCCAGAATTCTACCCTTCCGGTATCACTTTTAGGCCACTGGAGGTGCACTGTGAGTGCAGGCGTGATAACCGGCGTATTGCTGGTTTTTTATTACTGGGTTATCTGGTTTATGCCCTGATCAATGCGGAGGCGTTCTGATGGCTGCGCAAGGGTTCTTACTGATCGCCACGTTTTTACTGGTGTTAATGGTGCTGGCGCGTCCTTTAGGCAGCGGGCTGGCGCGGCTGATTAATGACATTCCTCTTCCCGGTACAACGGGCGTTGAGCGCGTACTTTTTCGCGCACTTGGCGTCTCTGACCGTGAGATGAACTGGAAGCAATATCTTTGTGCCATTCTCGGCCTGAACATGCTGGGGCTGGCGGTGCTGTTTTTATGTTGCTCGGTCAGCACTATCTGCCGCTTAATCCACAGCAGTTGCCAGGGCTGTCGTGGGATCTGGCGCTGAATACCGCCGTCAGCTTTGTCACCAATACCAACTGGCAATCTTATAGCGGTGAAACCACGTTGAGCTATTTCAGCCAGATGGCGGGCTTAACGGTGCAAAACTTTCTTTCTGCCGCCAGCGGGATTGCGGTGATTTTGCCCTCATCCGTGCGTTTACCCGCCAGAGCATGAGCACGCTCGGGAATGCCTGGGTCGATCTGCTACGCATCACGTTATGGGTGCTAGTCCCTGTGGCGTTGTTGATTGCACTGTTTTTATTCAACAAGGTGCGCTGCAAAACTTTCTGCCTTATCAGGCTGTGAATACCGTTGAAGGAGCGCAACAGCTGTTACCCATGGGGCCTGTAGCTTCTCAGGAAGCGATCAAGATGCTCGGTACTAACGGCGGTGGCTTCTTTAATGCCAACTCGTCGCATCCGTTTGAAAACCCAACCGCACTGACCAACTTCGTGCAGATGCTGGCGATCTTCTTGATCCCAACGGCGCTGTGCTTTGCCTTTGGTGAAGTGATGGGCGATCGCCGCCAGGGGCGCATGTTGCTGTGGGCGATGTCAGTGATTTTTGTCATCTGCGTAGGCGTGGTGATGTGGGCAGAAGTTCAGGGTAATCCTCATCTGCTGGCACTGGGCACGGACAGCAGCATCAATATGGAAGGTAAAGAGAGCCGTTTCGGCGTGCTGGTCAGTAGCCTGTTTGCGGTCGTGACGACGGCGGCTTCCTGTGCGCGGTGATTGCGATGCATGATTCGTTTACCGCTCTCGGTGGCATGGTGCCGATGTGGCTGATGCAAATTGGTGAAGTGGTGTTCGGCGGTGTCGGTTCTGGTCTTTACGGCATGATGCTGTTTGTCCTGCTGGCGGTGTTTATTGCCGGGCTGATGATTGGTCGTACACCGGAATATCTGGGTAAAAATCGACGTACGCGAGATGAAACTGACTGCACTGGCAATTCTGGTTACCCCGACGCTGGTGCTGATGGGCGCGGCGTTGGCGATGATGACCGACGCCGGACGTAGCGCCATGCTCAACCCTGGCCCGCATGGTTTTAGCGAAGTGCTGTACGCCGTGTCATCCGCCGCTAACAACAACGGCAGCGCCTTTGCCGGATTAAGCGCCAACTCTCCGTTCTGGAACTGTTTACTGGCGTTCTGCATGTTTGTCGGTCGCTTCGGGGTGATTATCCCGGTGATGGCAATTGCCGGTTCGCTGGTGAGTAAAGAGCCAAGCCGCCAGCTCCGGCACGCTGCCAACGCACGGCCCGCTGTTTGTTGGCCTGTTAATCGGCACCGTGTTGCTGGTTGGCGCACTGACCTTTATCCTGCCCTGGCGCTTGGTCCGGTGGCGGAATATCTCTCCTGATGATATTGAGTGAGCACTGAATATGAGTCGTAAACAACTGGCGCTATTCGAACCAACACTTGTCGTTCAGGCGCTGAAAGAAGCGGTGAAAAATTAAACCCGCAGGCGCAATGGCGCAATCCGGTGATGTTTATCGTCTGGATCGGCAGTCTGCTGACCACCTGTATTAGCATCGCGATGGCAAGCGGTGCGATGCCCGGCAATGCGCTGTTTAGCGCGGCCATTAGCGGTTGGCTGTGGATCACCGTACTGTTCGCTAATTTCGCCGAGGCGCTGGCAGAAGGCCGCAGTAAAGCGCAGGCCAACAGTCTGAAAGGGAAAAAACTGCCTTTGCCCGCAAGCTGCGTGAGCCGAAATATGGCGCTGCGGCGGACAAAGTTCCTGACCAACTTCGTAAAGGCGATATCGTACTGGTAGAAGCTGGCGATATTATCCCTGCGATGGTGAAGTTATTGAAGGGTGCATCGGTCGATGAAAGCGCCATCACCGGGGAATCGGCACCGGTGATCCGTGAATCCGGCGGCGATTTTGCCTCCGTCACCGGCGGCACGCGTATTCTTTCTGACTGGCTGGTGATTGAGTGTAGCGTTAACCCCGGCGAGACATTTCTGGATCGGATGATCGCGATGGTGGAAGGCGCACAGCGACGCAAAACGCCGAACGAAATTGCCCTGACCATTCTGCTGATTGCCCTGACTATCGTCTTTTTACTGGCAACCGCCACGCTGTGGCCGTTTTCCGCGTGGGGCGGTAATGCAGTCAGCGTAACGGTACTGGTGGCGCTGCTGGTCTGTCTGATCCCAACCACTATTGGCGGCCTGTTGTCAGCGATCGGCGTCGCCGGGATGAGCCGGATGCTAGGCGCGAATGTGATTGCCACCAGCGGACGTGCAGTTGAAGCGGCAGGTGACGTTGACGTTCTGCTACTGGATAAAACCGGCACCATCACACTCGGTAACCGTCAGGCGTCGGAGTTTATCCCCGCGCAGGGCGTGGATGAAAACGCTGGCTGACGCCGCACAACTGGCTTCGCTGGCTGATGAAACGCCGGAAGGCCGCAGTATTGTGATCCTCGCCAAGCAGCGTTTTAACCTGCGCGAGCGCGATGCAGTCGCTCCATGCCACCTTTGTACCGTTTACTGCGCAAAGCCGGATGAGCGGGATCAACATCGACAACCGCATGATCCGTAAAGGTTCTGTCGATGCCATTCGTCGCCATGTTGAGGCTAACGGTGGTCACTTCCCTACCGATGTTGATCAAAAGTCGATCAGGTTGCGCGTCGGGAGCCACGCCGCTGGTGGTGGTGGAAGGTTCTCGTGTGCTGGGCGTTATTGCGCTGAAAGATATCGTCAAAGGCGGTATTAAAGAGCGCTTCGCCCAGCTGCGCAAAATGGGCATTAAAACGGTGATGATTACCGGCGATAACCGTCTGACTGCCGCCGCGATTGCTGCGGAAGCGGGTGTCGATGATTTTCTCGCCGAAGCGACACCGGAGGCCAAGCTGGCATTGATCCGTCAGTATCAGGCGGAAGGTCGTTTGGTAGCGATGACCGGCGACGGCACCAACGATGCTCCGGCGCTGGCGCAGGCAGATGTCGCGGTGGCGATGAACTCCGGCACCCAGGCGGCGAAAGGGCGGGCAATATGGTCGATCTCGACTCTAACCCGACCAAGTTGATCGAGGTGGTGCACATTGGCAAACAGATGCTGATGACCCGTGGCTCGCTGACCACCTTCAGCATTGCCAACGATGTGGCGAAATACTTCGCCATTATTCCGGCGGCATTCGCGGCAACGTATCCGCAGTTAAATGCGCTGAACATCATGTGCCTGCATTCGCCCGACTCCGCAATCCTCAGTGCGGTGATTTTCAACGCCTTGATTATCGTCTTTGATTCCCCTGGCGTTAAAAATGAGTTATAAACCGCTTACCGCTTCTGCCATGTTGCGCCGTAACTTATGGATTTACGGTCTGGGTGGGCTGCTGGTGCCGTTTATCGGTATCAAAGTCATTGATTTACTGCTGACCGTTTGCGGTCTGGTGTGGTTTACCATGAGTGGATTACGTCCGGCATTATCAACATTTATCTTTCTGTTATTGATTACTGGCGGCGTTTACCCGCACGCAAGCACCGTACGGGGCAATATCAACCGCC
+>463d6152-c15a-4ad9-b4b6-a85be09d62c3 id=35 clr=0,3056
+TTGTTGTACTTCGTTCAGTTGTGCTTTTCTGTTGGTGCTGATATTGCGGCGTCTGCTTGGGTGTTTTAGACATCGTTATACCAATCGAAACATATATTCATGAAATATATAAAATATTTTCCTAATTGTTCTTATCTGACAGATATCTCACTTAAGGCTTTCTTATAAATCTGTAGGGTTTCGCCTGTCAGCAGACAAATAACCCGATAAAACAAGGATGAGCAGATGAGCGGAAAACCGGCGGCGCGTCAGGGCGACATGACGCAATGGCGGTAGCAGCATTGTCCAGGGTTCAGCCGGGGTACGCATCGGTGCCCCACCGGCGTGGCCTGTTCGGTGTGCCCCGGCGGTGACGTCCGGCCATCCGGTCAATCCGCTGCTCGGTGCAAAGGTCCTTCCCGGTGAAACCGACATCGCCCTGCCCGGCCCGCTGCCGTTCATTCTCTCCCGCACCTACAGCAGTTACCGGACAAAACGCCCGCGCCGGTGGGAGCCTCGGCCCCGGCTGGAAAATGCCTGCGGATATCCGCTTACAGCTGCGCGATAACACACTGATACTCAGTGATAACGGCGGCAGAAGCCTGTATTTTGAGCACCTGTTTCCCGGTGAGGACGGTTACAGCCGCAGCGAGTCACTGTGGCTGGTGCGCGGCGGCGTGGCGAAACTGGATGAAGGTCACCGGCTGGCCGCACTCTGGCAGGCGCTGCCGGAAGAACTCCGCTTAAGTCCGCATCGTTATCTGGCGACAAACAGTCCGCAGGGGCCGTGGTGGCTGCTCGGCTGGTGTGAGCGGGTGCCGGAAGCGGATGAGGTGCTGCCTGCGCCGCTGCCGCCGTACCGGGTACTGACCGGGCTGGTGGACCGCTTCGGGCGCACACAGACGTTCCACCGCGAAGCCGCCGGTGAATTCAGCGGCGAAATCACCGGCGTGACGGATGGTGCCGGGTCACTTCCGGCTGGTACTGACCACGCAGGCGCAGCGGGCAGAAGAAGCCCGGCAGCAGGCCATTTCCGGCGGGACGGAACCGTCCGCTTTTCCTGATACCCTGCCGGGTTACACCGAATATGGCCGGGACAACGGCATCCGTCTGTCTGCCGTGTGGCTGACGCACGACCCGGAATACCCGGAGAATTTACCTGCCGCGCCGCTGGTGCGCTATGGCTGGACGCCCGCGGCGAACTGGCGGCGGTGTATGACCGCAGCAATACACAGGTGCGCAGCTTTACTTACGATGATAAATACCGGGGCCGGATGGTGGCGCACCGTCACACGGGCCGACCGGAAATCTGTTACCGTTACGACAGCGACGGGCGGGTGACAGAACAGCTAAACCCGGCAGGCTTAAGTTACACGTATCAGTATGAGAGGACCGCATCACCATCACCGACAGCCTGAACCGCCGTGAAGTCCTGCACACGCAGGGTGAAGGCGGGCTGAAGCGGGTGGTGAAAAAGAACACGCGGACGGCAGCGTCACGCAGAGTCAGTTTGACGCGGTGGGCAGGCTCAGGGCACAGACGGATGCCGCAGGCAGGACAACAGAATACAGTCCGGATGTGGTGACGGGCCTCATCACGCGCATCACCACGCCGGATGGCAGGGCATCGGCGTTTTACTATAACCACCACAGCCAGTTAACGTCAGCCACCGGGCCTGACGGGCTGGAAATACGCCGGAATATGATGAATGGGGCCGTCTGATTCAGGAAACTGCCCCTGACGGCGATATCACCGCTACCGTTATGATAATCCACACAGTGACTTACCCTGCGCAACGGAAGATGCCACCGGCAGCCGGAAAACCATGACGTGGAGCCGTTACGGTCAGTTGCTGAGCTTCACTGACTGTTCCGGTTATGTAACCCGCTATGACCATGACCGTTTTGGTCAGGTGACGGCGGTGCACCGCGAGGAAGGGCTGAGTCAGTACCGCGCATACGACAGCCGTGGACAGTTAATTGCCGTGAAAGACACGCAGGGCCATGAAACGCGGTATGAATACAACGCCGCCGGTGACCTGACCACCGTCATTGCCCCGGACGGCAGCAGAAACGGACACAGTACGATGCGTGGGAAAAGCCATCTGTACCACGCAGGGCGGTCTGACGCGCAGTATGGAATACGATGCTGCCGGACGGGTCATCCGCCTGACCAGTGAAAACGGCAGCCACACCACCTTCCGTTACGATGTACTCGACCGGCTGATACAGGAAACCGGCTTTGACGGCCGCACACAGCGTTATCACCACGACCTGACCGGCAAACTTATCCGCAGCGAGGATGAGGGCTGGTCACCCACTAACACTATGACGAAGCAGACCGCCTCACGCACCGCACCGTGAATGGCGAAACCGCAGAGCGGTGGCAGTATGACGAACGCGGCTGGCTGACAGACATCAGCCATATCAGCGAAGGGCACCGGGTGACGGTGCACTATGGTTATGACAGTAAAGGCCGCCTCGCCAGTGAACACCTGACGGTGCATCATCCGCAGACGAATGAACTGCTCTGGCAGCATGAGACCAGACATGCGTACAACGCACAGGGACTGGCGAACCGCTGTATACCGGACAGCCTGCCCGCCGTGGAATGGCTGACCTACGGCAGCGGCTGGCTGTCAGGCATGAAACTCGGCGACACACCGCTGGTGGTACACCCGCGACCGCCTGCACCGGGAAACGCTGCGCAGCTTCGGCCGTTATGAACTCACCACCGCTTATACCCCTGCCGGGCAGTTACAGAGCCAGCACCTGAACAGCCTGCTGTCTGACCGCGATTACACCTGGAACGACAACGGCGAACTCATCCGCATCAGCAGCCCGCGCCAGACCCGGAGTTACAGCTACAGCACCACCGGCAGGCTGACCGGCGTTCACACCACCGCAGCGAATCTGGATATCCGCATCCCGTATACCACAGACCCGGCAGGTAACCGCCTGCCCGACCCGGAGCTGCACCCGGACAGCGCCCTCAGCATGTGGCCGGATAACCGTATCGCCCGTGACGCGCACTATCTTTAACACCCAAGCACGACGCCGACAGATAAGAACGCGGCC
+>be16c798-0278-462a-b65b-6e77e03c7432 id=36 clr=0,6698
+TTCGGCGTAGCCCTTGCTTCAGCTTTCATCGTTGCATTGCTGCCTTGCCTGTCATCTATAATCACTTCGGCCGTCTGCTTGGGTGTTAACTGGGTCGAGCATCTGCACCAGCACCGGCGGGAACACCACACTGCCACCGTCTTCGCCGCCGGACTGCTGAAGGGTATCCGCCAGGCTGCGGCGCTGCGTTTTCGCCAGCTCACCGGTGGCGGTTTCAACCTGATGAGTGGCGTGGCTCCCCGGCTGATAAATCGTCTGGATGCGGGTTCTGTCGTTCTGTATCGTGGTCAGGCGGTCGCCGTCCCAGCCGTACCAGGTCACTTGCGGTTTCCGTGACAGCGACATCCAGCCCGTCAGGTCCCGTTCACGTCGCCACACCCGTTTTGCCACCCGCGGCCCAGCGGGTCGTAAAGATAGCGGCTTTCGACCAGCGGCTCTGCATATTGTGTCCGCGTGTAGTGCACCAGCCGGTGCTGACTGTCGTAATGGTACCGGTGGGTGCGCTCATCATCCGTGCGGATAACCCCTTCCGGGATGGTCGGTTTTCTCCGTCAGCCTGCCGTGACGGTCATACCGGTAAAGATAGTGCGCGTCACGGGCGATACGGTTATCCGGCCACATGCTGAGGGTGCTGTCCGGGTGCAGCTCGGGTCGGGCAGGCGGTTACCTGCCGGTCTGTGGCATACGGGATATCAATGCCCAGGTTACATATAATAATAAGAGCAATTAACTTAATTTATTTGTTTATAATGCGCTTACTTAATACAAACCATTGAATATACCCTCCTGACAGAAAATAAAGCCATATTATTATCGCCATAATATACTTACTATCAATCCTTACGCCAATAATGTCTGATACAGTCCCTATAAATATTAGAGCAATAAAGAATACTATGCCTGTTGGAAAACATATTACCATCATTCCATAAGACATGAGACTAATTAACTCGCTCACATCACGAGTGGAGTCTAATAGTGAAAGTCTATGCATGGAAAAGAATAGTATTAAAAGCGATAAAGCCAGCCATATAGCTCTGAATAAAAAATAATATATTTCATTACATCACTCCGGTGAATACAAATCTAATAAAACGTCCAATGTTATTTCCGGAGCACTTCATCTTACATGTTTCTAAAGAATCATTAGACCAGTCTTGGCAGTTTTAAATAGCCCTAAATTTATAGGTGTGAATATATCAGGCAATACAGAATAACGCGGCCTTACCTCTTTAAACTTCCTTTTAAACAGTTCTCCACACAACTATTATCGGTTTCAACGAGGTCACAACGGCCAGCAGCTTCTTTGTATCATTACTTGCTTTACCTGGCCCCCATAGACCATCTCCTTTGATTCTCCCCGTTGGTCTTGGCCACCACAAGTATAGTCCCTTTACCATCTGGGACACAAAGATATTGATGATAGAACGGATTCCCCATATATCTGGACCGCTTCTTTCACCAGTTCCGCCCATTGAATGCAGTGGCTTAATGCATTTTAGTGTTTCTAATCCTAATGGATCTATATTTGAGATCGGATTCAACGGATACTGATAAAATTCCATCCCCTTTCAGCCCAATCGGATCCTGAGTGATATATCGCCCCTGCAGCGGGTCATAATAGCGGTGGCGGTTGTAATACAGGCCGGACTCCTCATCATACTGCTGCCCCGGCAGGCGGATAAGCTGCTGCAGCTGATGCGGGTTCTCTTCATTCAGCAGGTTACCCCATTCATCGTATTCTGCGTACCACGCTGTTGTCCCTTCCGTGCTGATATGGGCCAGCGGCAGGCCGCGATGGTCGCAGTGGTACAGGTGAATTTTTCGCGCCGGCGTGTATACCGGGTCCATCTGGCTTTGCATCTGCGCCACCGTCAGGCCGCACGATGCCAGCCAGCGGCGGCTTTCCTCACTCACCCGGTCAGCCAGGATTTCACTTTCCAGCCGGTCGAGCATCTGCACCAGCACCGGCGGGAACACCACTGCCACCGTCTTCGCCACCGGACTGCTGAAGGGTATCCGCCAGGCTGCGGCGCTGCGTTTTCGCCAGCTCACCGGTGGCGGTTTCAACCCTGATGAGTGGCGTGAAGCTCCCCGGCTGATAAATCGTCTGGATGCGGGTTCTGTCGTTCTGTATCGTGGTCAGGCGGTCGCCGTCCCAGCCGTACCAGGTCACTTGCGGTTTCCGTGACAGCGACATCCAGCCCGTCAGGTCCCGTTCACGCCGCCATACCCGTTTTGCCACCCTGCGGCCCAGCGGGTCGTAAAGATAGCGACTTTCGACCAGCGGCTCTGCATATTGTGTCCGCGTGTAGTGCACCAGCCGGTGCTGACTGTCGTAATGGTACCGGTGGGTGCGCTCATCATCCGTGCGGATAACCCTTCCGGGATGAGGTCGGTTTTCTCTCAGCCTGCCGTGACGGTCATACCGGTAAAGATAGTGCGCGTCACGGGCGATACGGTTATCCGGCCACATGCTGAGGGCGCTGTCCGGGTGCAGCTCCGGGTCGGGCAGGCGGTTACCTGCCGGGTCTGTGGTATACGGGATGCGGATATCCAGATTCGCTGCGGTGGTGTGAACGCCGGTCAGCCTGCCGGTGGTGCTGTAGCTGTAACTCCGGGTCTGGCGCGGGCTGCTGATGCGGATGAGTTCGCCGTTGTCGTTCCAGGTGTAATCGCGGTCAGACAGCAGGCTGTTCAGGTGCTGGCTCTGTAACTGCCCGGCAGGGTATAAGCGGTGGTGAGTTCATAACGGCCGAAGCTGCGCAGCGTTTCCCGGTGCAGGCGGTCGCGGGTGTACTCCACCAGCGGTGTGTCGCCGAGTTTCATGCCTGACAGCCAGCCGCTGCCGTAGGTCAGCCATTCCACGGCGGGCAGGCTGTCCGGTATACAGCGGTTCGCCAGTCCTGTGCGTTGTACGCATGTCTGGTCTCATGCTGCCAGAGCAGTTCATTCGTCTGCGGATGATGCACCGTCAGGTGTTCACTGGCGAGGCGGCCTTTACTGTCATAACCATAGTGCACCGTCACCCGGTGCCCTTCGCTGATATGGCTGATGTCTGTCAGCCAGCCGCGTTCGTCATACTGCCACCGCTCTGCGGTTTCGCCATTCACGGTGCGGTGCGTGAGGCGGTCTGCTTCGTCATAGTGCCAGTGGGTGACCAGCCCCTCATCCTCGCTGCGGATAAGTTTGCCGGTCAGGTCGTGGTGATAACGCTGTGTGCGGCCGTCAAAGCCGGTTTCCTGTATCAGCCGGTCGAGTACATCGTAACGGAAGGTGGTGTGGCTGCCGTTTTCACTGGTCAGGCGGATGACCCGTCCGGCAGCATCGTATTCCATACTGCGCGTCAGACCGCCCTGCGTGGTACAGATGGCTTTCCCCACGCATCGTACTGTGTCCCGTTTCTGCTGCCGTCCGGGGCAATGACGGTGGTCAGGTCACCGGCGGCGTTGTATTCATACCGCGTTTCATGGCCCTGCGTGTCTTTCACGGCAATTAACTGTCCACGGCTGTCGTATGCGCGGTACTGACTCAGCCCTTCCTCGCGGTGCACCGCCGTCACCTGACCAAAACGGTCATGGTCATAGCGGGTTACATAACCGGAACAGTCAGTGAAGCTCAGCAACTGACCGTAACGGCTCCACGTCATGGTTTTCCGGCTGCCGGTGGCATCTTCCGTTGCGCAGGGTAAGTCACTGTGTGGATTATCATAACGGTAGCGGGTGATATCGCCGTCAGGGGCAGTTTCCTGAATCAGACGGCCCCATTCATCATATTCCGGCGTATTTCCAGCCCGTCAGGCCCGGTGGCTGACGTTAACTGGCTGTGGTGGTTATAGTAAAACGCCGATGCCCTGCCATCCGGCGTGGTGATGCGCGTGATGGGCCCGTCACCACATCCGGACTGTATTCTGTTGTCCTGCCTGCGGCATCCGTCTGTGCCCTGAGCCTGCCCACCGCGTCAAACTGACTCTGCGTGACGCTGCCGTCCGCGTGTTCCTTTTCACCACCCGCTTCAGCCCGCCTTCACCCTGCGTGTGCAGGACTTCACGGCGGTTCAGGCTGTCGGTGATGCGGTCCTTCTCATACTGATACGTGTAACTTAAGCCTGCCGGGTTTAGCTGTTCTGTCACCCGCCCGTCGCTGTCGTAACGGTAACAGATTTCCGGTCGGCCCGTGTGACGGTGCGCCACCATCCGGCCCCGGTATTTATCATCGTAAGTAAAGCTGCGCACCTGTGTATTGCTGCGGTCATACACCGCCGCCAGTTCGCCGCGGGCGTCCAGCCATAGCGCACCAGCGGCGCGGCAGGTAAATTCTCCGGGTATTCCGGGTCGTGCGTCAGCCACACGGCAGACAGACGGATGCCGTTGTCCCGGCCATATTCGGTGTAACCCGGCAGGGTATCAGGAAAAGCGGACGGTTCCGTCCCGCCGGAAATGGCCTGCTGCCGGGCTTCTTCTGCCCGCTGCGCCTGCGTGGTCAGTACCAGCCGGAAGTGACGCCCGGCACCATCCGTCACGCCGGTGATTTCGCCGCTGAATTCACCGGCGGCTTCGCGGTGGAACGTCTGTGCGCCCGAAGCGGTCCACCAGCCCGGTCAGTACCCGGTACGGCGGCAGCGGCGCAGCAGCACCTCATCCGCTTCCGGCACCCGCTCACACCAGCCGAGCAGCCACCACGGCCCCTGCGGACTGTTTGTCGCCAGATAACGATGCGGACTTAAGCGGAGTTCTTCCGGCAGCGCCTGCCAGAGTGCGGCCAGCCGGTGACCTTCATCCAGTTTCGCCACGCCGCCGCGCACCAGCCACAGTGACTCGCTGCGGCTGTAACCGTCCTCACCGGGAAACAGGTGCTCAAAATACAGGCTTCTGCCGCCGTTATCACTGAGTATCAGTGTGTTATCGCGCAGCTGTAAGCGGATATCCGCAGGCATTTTCCAGCCGGGGCCGAGGCTCCCCACCGGCGCGGGCGTTTTGTCCGGTAACTGCTGTAGGTGCGGGAGAGAATGAACGGCAGCGGGCCGGGCAGGGCGATGTCGGTTTCACCGGGACCTTTGCACCGAGCAGCGGATTGACCGGATGGCCGGACGTCACCCGCCGGGGCACACCGAACAGGCCACGCCGGTGGGGCACCGATGCGTACCCCGGCTGAACCCTGGACAATGCTACCGCCATACTGCGTCATGTCGCCCTGACGCGCCGCCGGTTTTCCGCTCATCTGCTCATCCTTGTTTTATCGGGTTATTTGTCTGCTGACAGGCGAAACCCTACAGATTTATAAGAAAGCCTTAAGTGAGATATCTGTCAGATAAGAACAATTAGGAAAATATTTATATATATTTCATGAATATATGTTTCGATTGGTATAACGATGTCTAAATATTCCTCTGAACATCTTCCTGATACAAAAACCGCCAGCGTTTCCGCTGGCGGTTTTCAATGTATTCAAAACTCAGCAATCAATAAAAATCACCAGTTGCCTTTTCGGCCTGATCCATCCACACCGGTTTATCGCTGGTTTTCGACCAGACGCGATGCAGGTAGCTGTAAAAGCGGGCGCGGTCTTTCCAGAAAAGCATGAAAGGCAGCGCCAGAACGCCCGCTGCAACCGCATAAGTACGGCGTAAAAGATAAGCCATGCAGGATATTCTCTGTAGAGTTCCATACTTTTCTCCCCTTTTATCTACCCGGTGAATGGCACCGGAAAAATGAATTTGTTTATCTGATGAAAATAGTACCGCCTTTTGTGTAATTTTACTACTCATCCGACCACTTATTTTTGCTTATTGATGGTTTATTTACATTCATCCTGTAATTAAGTTACACAAAAGTTAAATTAATACTAAACATTAGTTAAATCATGGCTTTTGCCATTTTTATACTTTTACACCCCGCCCGCAGATTTTGCGAAATCTTTGCAGCCAGAATTCTACCCTTCCGGTATCACTTTTAGGCCACTGGAGGTGCACTGTGAGTGCAGGCGTGATAACCGGCGTATTGCTGGTGTTTTATTACTGGGTTATCTGGTTTATGCCCTGATCAATGCGGAGGCGTTCTGATGGCTGCGCAAGGGTTCTTACTGATCGCCACGTTTTTACTGGTGTTAATGGTGCTGGCGCGTCCTTTAGGCAGCGGGCTGGCGCGGCTGATTAATGACATTCCTCTTCCCGGTACAACGGGCGTTGAGCGCGTACTTTTCGCGCACTTGGCGTCTCTGACCGTGAGATGAACTGGAAGCAATATCTTTGTGCCATTCTCGGCCTGAACATGCTGGGGCTGGCGGTGCTGTTTTTATGTTGCTCGGTCAGCACTATCTGCCGCTTAATCCACAGCAGTTGCCAGGGCTGTCGTGGGATCTGGCGCTGAATACCGCCGTCAGCTTTGTCACCAATACCAACTGGCAATCTTATAGCGGTGAAACCACGTTGAGCTATTTCAGCCAGATGGCGGGCTTAACGGTGCAAAACTTTCTTTCTGCCGCCAGCGGATTGCGGTGATTTTGCCCTCATCCGTGCGTTTACCCGCCAGAGCATGAGCACGCTCGGGAATGCCTGGGTCGATCTGCTACGCATCACGTTATGGGTGCTAGTCCCTGTGGCGTTGTTGATTGCACTGTTTTTATTCAACAAGGTGCGCTGCAAAACTTTCTGCCTTATCAGGCTGTGAATACCGTTGAAGGAGCGCAACGGCTGTTACC
+>8d9d3bb4-cec7-4960-a3c6-9c3e59aab4a7 id=37 clr=0,4394
+TTGGTATTGCTTCGTTCAGTTACGTATTGCTTTTCTGTTGGTGCTGATATTGCGGCGTCTGTAGGGTGTTTAACCTAGACATCAGTTATGCCAATCGAAACATATATTCATGAAATATATATAAATATTTTCCTAATTGTTCTTATCTGACAGATATCTCACTTAAGGCTTTCTTATAAATCTGTAGGGTTTCGCCTGTCAGCAGACAAATAACCCGATAAAACAAGGATGAGCAGATGAGCGGAAAACCGGCGGCGCGTCAGGGCGACATGACGCAGTATGGCGGTAGCATTGTCCAGGGTTCAGCCGGGGTACGCATCGGTGCCCCACCGGCGTGGCCTGTTCGGTGTGCCCCGGCGGTGACGTCCGGCCATCCGGTCAATCCGCTGCTCGGTGCAAAGGTCCCCGGTGAAACCGACATCGCCCTGCCCGGCCCGCTGCCGTTCATTCTCTCCCACCTACAGCAGTTACCGGACAAAACGCCCGCGCCGGTGAGCCTCGGCCCCGGCTGGAAAATGCCTGCGGATATCCGCTTACAGCTGCGCGATAACACACTGATACTCAGTGATAACGGCGGCAGAAGCCTGTATTTTGAGCACCTGTTTCCCGGTGAGGACGGTTACAGCCGCAGCGAGTCACTGTGGCTGGTGCGCGGCGGCGTGGCGAAACTGGATGAAGGTCACCGGCTGGCCGCACTCTGGCAGGCGCTGCCGGAAGAACTCCGCTTAAGTCCGCATCGTTATCTGGCGACAAACAGTCCGCAGGGGCCGTGGTGGCTGCTCGGCTGGTGTGAGCGGGTGCCGGAAGCGGATGAGGTGCTGCCTGCGCCGCTGCCGCCGTACCGGGTACTGACCGGGCTGGTGGACCGCTTCGGGCGCACACAGACGTTCCACCGCGAAGCCGCCGGTGAATTCAGCGGCGAAATCACCGGCGTGACGGATGGTGCCGGGCGTCACTTCCGGCTGGTACTGACCACGCAGGCGCAGCGGGCAGAAGAAGCCCGGCAGCAGGCCATTTCCGGCGGGACGGAACCGTCCGCTTTTCCTGATACCCTGCCGGGTTACACCGAATATGGCCGGGACAACGGCATCCGTCTGTCTGCCGTGTGGCTGACGCACGACCCGGAATACCCGGAGAATTTACCTGCCGCGCCGCTGGTGCGCTATGGCTGGACGCCCGCGGCGAACTGGCGGCGGTGTATGACCGCAGCAATACACAGGTGCGCAGCTTTACTTACGATGATAAATACCGGGGCCGGATGGTGGCGCACCGTCACACGGGCCGACCGGAAATCTGTTACCGTTACGACAGCGACGGGCGGGTGACAGAACAGCTAAACCCGGCAGGCTTAAGTTACGTATCAGTATGAGAAGGACCGCATCACCATCACCGACAGCCTGAACCGCCGTGAAGTCCTGCACACGCAGGGTGAAGGCGGGCTGAAGCGGGTGGTGAAAAAGAACACGCGGACGGCAGCGTCACGCAGAGTCAGTTTGACGCGGTGGGCAGGCTCAGGGCACAGACGGATGCCGCAGGCAGGACAACAGAATACAGTCCGGATGTGGTGACGGGCCTCATCACGCGCATCACCACGCCGGATGGCAGGGCATCGGCGTTTTACTATAACCACCACAGCCAGTTAACGTCAGCCACCGGGCCTGACGGGCTGGAAATACGCCGGGAATATGATGAATGGGGCCGTCTGATTCAGGAAACTGCCCCTGACGGCGATATCACCCGCTACCGTTATGATAATCCACACAGTGACTTACCCTGCGCAACGGAAGATGCCACCGGCAGCCGGAAAACCATGACGTGGAGCCGTTACGGTCAGTTGCTGAGCTTCACTGACTGTTCCGGTTATGTAACCCGCTATGACCATGACCGTTTTGGTCAGGTGACGGCGGTGCACCGCGAGGAAGGGCTGAGTCAGTACCGCGCATACGACAGCCGTGGACAGTTAATTGCCGTGAAAGACACGCAGGGCCATGAAACGCGGTATGAATACAACGCCGCCGGTGACCTGACCACCGTCATTGCCCCGGACGGCAGCAGAAACGGGACACAGTACGATGCGTGGGGAAAAGCCATCTGTACCACGCAGGGCGGTCTGACGCGCAGTATGGAATACGATGCTGCCGGACGGGTCATCCGCCTGACCAGTGAAAACGGCAGCCACACCACCTTCCGTTACGATGTACTCGACCGGCTGATACAGGAAACCGGCTTTGACGGCCGCACACAGCGTTATCACCACGACCTGACCGGCAAACTTATCCGCAGCGAGGATGAGGGCTGGTCACCCACTACTGACGAAGCAGACCGCCTCACGCACCGCACCGTGAATGGCGAAACCGCAGAGCGGTGGCAGTATGACGAACGCGGCTGGCTGACAGACATCAGCCATATCAGCGAAGGGCACCGGGTGACGGTGCACTATGGTTATGACAGTAAAGGCCGCCTCGCCAGTGAACACCTGACGGTGCATCATCCGCAGACGAATGAACTGCTCTGGCAGCATGAGACCAGACATGCGTACAACGCACAGGGACTGGCGAACCGCTGTATACCGGACAGCCTGCCCGCCGTGGAATGGCTGACCTACGGCAGCGGCTGGCTGTCAGGCATGAAACTCGGCGACACACCGCTGGTGGAGTACACCCGCGACCGCCTGCACCGGGAAACGCTGCGCAGCTTCGGCCGTTATGAACTCACCACCGCTTATACCCCTGCCGGGCAGTTACAGAGCCAGCACCTGAACAGCCTGCTGTCTGACCGCGATTACACCTGGAACGACAACGGCGAACTCATCCGCATCAGCAGCCCGCGCCAGACCCGGAGTTACAGCTACAGCACCACCGGCAGGCTGACCGGCGTTCACACCACCGCAGCGAATCTGGATATCCGCATCCCGTATACCACAGACCCGGCAGGTAACCGCCTGCCCGACCCGGAGCTGCACCCGGACAGCGCCCTCAGCATGTGGCCGGATAACCGTATCGCCCGTGACGCGCACTATCTTTACCGGTATGACCGTCACGGCAGGCTGACAGAGAAACCGACCTCATCCCGGAAGGGGTTATCCGCACGGATGATGAGCGCACCCACCGGTACCATTACGACAGTCAGCACCGGCTGGTGCACTACGCGGACACAATATGCAGAGCCGCTGGTCGAAAGTCGCTATCTTTACGACCCGCTGGGCCGCAGGGTGGCAAAACGGGTATGGCGGCGTGAACGGGACCTGACGGGCTGGATGTCGCTGTCACGGAAACCGCAAGTGACCTGGTACGGCTGGGACGGCGACCGCCTGACCACGATACAGAACGACAGAACCCGCATCCAGACGATTTATCAGCCGGGGCTTCACGCCACTCATCAGGGTTGAAACCGCCACCGGTGAGCTGGCGAAAACGCAGCGCCGCAGCCTGGCGGATACCCTTCAGCAGTCCGGTGGCGAAGACGGTGGCAGTGTGGTGTTCCCGCCGGTGCTGGTGCAGATGCTCGACCGGCTGGAAAGTGAAATCCTGGCTGACCGGGTGAGTGAGGAAAGCCGCCGCTGGCTGGCATCGTGCGGCCTGACGGTGGCGCAGATGCAAAGCCAGATGGACCCGGTATACACGCCGGCGCGAAAAATTCACCTGTACCACTGCGACCATCGCGGCCTGCCGCTGGCCCTATCAGCACGGAAGGGACAACAGCGTGGTACGCAGAATACGATGAATGGGGTAACCTGCTGAATGAAGAGAACCCGCATCAGCTGCAGCAGCTTATCCGCCTGCCGGGGCAGCAGTATGATGAGGAGTCCGGCCTGTATTACAACCGCCACCGCTATTATGACCCGCTGCAGGGGCGATATATCACTCAGGATCCGATTGGGCTGAAAGGGGATGGAATTTTATCAGTATCCGTTGAATCCGATCTCAAATATAGATCCATTAGGATTAGAAACACTAAAATGCATTAAGCCACTGCATTCAATGGGCGGAACTGGTGAAAGAAGCGGTCCAGATATATGGGGAATCCGTTCTATCATCAATATCTTTGTGTCCCAGATGGTAAAGGGACTATACTTGTGGTGGCCAAGACCAACGGGGAGAATCAAAGGAGATGGTCTATGGGGGCCAGGTAAAGCAAGTAATGATACAAAGAAGCTGCTGGCCGTTGTGACCTCGTTGAAACCGATAATAGTTGTGTGGAGAACTGTTTAAAAGGGAAGTTTAAAGAGGTAAGGCCGCGTTATTCTGTATTGCCTGATATATTCACACCTATAAATTTAGGGCTATTTAAAACTGCCAAGACTGGTCTAATGATTCAAGCATGATGAAGCTCGGAAATAACAGCGATTAGATTTGTATTCAAGATGTAATGAAATATATTATTTTTTATTCAGG
+>a724164e-c45d-4870-8cc1-b5973253fe9c id=38 clr=0,3271
+ATCGGTAGCCTTCGTTCAGTTACGTATTGCTCTTGCCTGTCGCTCTATCTTCGGCGTCTGCTTGGGTGTTTAACCTCTGCACGTCCGCTGGTGGCAATCCACATTCGCGCCTAGCATCCGGCTCATCCCGGCGACGCCGATCGCTGACAACAGGCCGCCAATAGTGGTTGGGATCAGACAGACCAGCAGCGCCACCAGTACCGTTACGCTGACTGCATTACCGCCCCACGCGGAAAACGGCCACAGCGTGGCGGTTGCCAGTAAAAGACGATAGTCAGGGCAATCAGCAGAATGGTCAGGGCAATTTCGTTCGGCGTTTTGCGTCGCTGTGCGCCTTCCACCATCGCGATCATCCGATCCAGAAATGTCTCGCCGGGGTTAACGCTACACTCAATCACCAGCCAGTCAGAAAGAATACGCGTGCCGCCGGTGACGGAGGCAAAATCGCCGCCGGATTCACGGATCACCGGTGCCGATTCCCCGGTGATGGCGCTTTCATCGACCGATGCACCCCTTCAATAACTTCACCATCGCAGGGGATAATATCGCCAGCTTCTACCAGTACGATATCGCCTTTACGAAGTTGGTCGGCAGGAACTTTGTCCGCCGCAGCGCCATATTTCGGCTCACGCAGCTTGCGGGCAAAGGCAGTTTTTCACCTTTCAGACTGTTGGCCTGCGCTTTACTGCGGCCTTCTGCCAGCGCCTCGGCGAAATTAGCGAACAGTACGGTGATCCACAGCCAACCGCTAATGGCCGCGCTAAACAGCGCATTGCCGGGCATCGCACCGCTTGCCATCGCGATGCTAATACAGGTGGTCAGCAGACTGCCGATCCAGACGATAAACATCACCGGATTGCGCCATTGCGCCTGCGGGTTTAATTTTTTCACCGCTTCTTTCAGCGCCTGAACGACAAGTGTTGGTTCGAATAGCGCCAGTTGTTTACGACTCATATTCAGTGCTCACTCAATATCATCAGGAGATATTCCGCCACCGGACCAAGCGCCAGGGCAGGGATAAAGGTCAGTGCGCCAACCAGCAACACGGTGCCGATTAACAGGCCAACAAACAGCGGGCCGTGCGTTGGCAGCGTGCCGGAGCTGGCGGCTTGGCTCTTTTACTCACCAGCGAACCGGCAATTGCCATCACCGGGATAATCACCCCGAAGCGACCGACAAACATGCAGAACGCCAGTAAACAGTTCCAGAACGGAGAGTTGGCGCTTAATCCGGCAAAGGCGCTGCCGTTGTTGTTAGCGGCGGATGACACGGCGTACAGCACTTCGCTAAAACCATGCGGGCCAGGGTTGAGCATGGCGCTACGTCCGGCGTCGGTCATCATCGCCAACGCCGCGCCCATCAGCACCAGCGTCGGGGTAACCAGAATTGCCAGTGCAGTCAGTTTCATCTCGCGTACGTCGATTTTTACCCAGATATTCCGGTGTACGACCAATCATCAGCCCGGCAATAAACACCGCCAGCAGGACAAACAGCATCATGCCGTAAAGACCAGAACCGACACCGCCGAACACCACTTCACCAATTTGCATCAGCCACATCGGCACCATGCCACCGAGAGCGGTAAACGAATCATGCATCGCAATCACCGCGCCACAGGAAGCCGCCGTCGTCACGACCGCAAACAGGCTACTGACCAGCACGCCGAAACGGCTCTCTTTACCTTCCATATTGATGCTGCTGTCCGTGCCCAGTGCCAGCAGATGAGGATTACCCTGAACTTCTGCCCACATCACCACGCCTACGCAGATGACAAAATCACTGACATCGCCCACAGCAACATGCGCCCTGGCGGCGATCGCCCATCACTTCACCAAAGGCAAAGCACAGCGCCGTTGGGATCAAGAAGATCGCCAGCATCTGCACGAAGTTGGTCAGTGCGGTTGGGTTTTCAAACGGATGCGACGAGTTGGCATTAAAGAAGCCACCGCCGTTAGTACCGAGCATCTTGATCGCTTCCTGAGAAGCTACAGGCCCCATGGGTAACAGCTGTTGCGCTCCTTCAACGGTATTCACAGCCTGATAAGGCAGAAAGTTTTGCAGCGCACCTTGTTGAATAAAAACAGTGCAATCAACAACGCCACAGGGACTAGCACCCATAACGTGATGCGTAGCAGATCGACCCAGGCATTCCCGAGCGTGCTCATGCTCTGGCGGGTAAACGCACGGATGAGGGCAAAATCACCGCAATCCCGCTGGCGGCAGAAAGAAAGTTTTGCACCGTTAAGCCCGCCATCTGGCTGAAATAGCTCAACGTGGTTTCACCGCTATAAGATTGCCAGTTGGTATTGGTGACAAAGCTGACGGCGGTATTCAGCGCCAGATCCCACGACAGCCCTGGCAACTGCTGTGGATTAAGCGGCAGATAGTGCTGACCGAGCAACATAAAAACAGCACCGCCAGCCCCAGCATGTTCAGGCCGAGAATGGCACAAAGATATTGCTTCCAGTTCATCTCACGGTCAGAGACGCCAAGTGCGCGAAAAGTACGCGCTCAACGCCCGTTGTACCGGGAAGAGGAATCATTAATCAGCCGCGCCAGCCCGCTGCCTAAAGGACGCGCCAGCACCATTAACACCAGTAAAAACGTGGCGATCAGTAAGAACCCTTGCGCAGCCATCAGAACGCCTCCGCATTGATCAGGGCATAAACCAGATAACCCAGTAATAAAAACACCAGCAATACGCCGGTTATCACGCCTGCTCACAGTGCACCTCCAGTGGCCTAAAAGTGATACCGGAAGGGTAGAATTCTGGCTGCAAAGATTTCGCAAAAATCTGCGGGCGGGGTAAAAAAGTAAAATGGCAAAAGCCATGATTTAACTAATGTTTAGTATTAATTTAACTTTTGTGTAACTTAATTACAGGATGAATGTAAATAAACCATCAATAAGCAAAAATAAGTGGTCGGATGAGTAGTAAAATTACACAAAAGGCGGTACTATTTTCATCAGATAAACAATTCATTTTTCCGGTGCCATTCACCGGGTAGATACAAAGGGGAGAAAAGTATGGAACTCTACAGAGAATATCCTGCATGGCTTATCTTTTACGCCGTACTTATGCGGTTGCAGCGGGCGTTCTGGCGCTGCCTTTCATGCTTTTCTGGAAAGACCGCGCCCTTTTACAGCTACCTGCATCGCGTCTGGTCGAAAACCAGCGATAAAACCGGTGGGATGGATCAGGCCGAAAAGGCAACCTGGTGATTTTTATTGATGGGTTAAACTACCCAAGCAGACGCCGCAATATCACGGG
+>cdf5b34b-6170-45bb-9691-6fcdaadb4713 id=39 clr=0,12443
+CTTCGTTCAGTTACGTATTGCTACTTGCCTGTCGCTCTATCTTCGGCGTCTGCTTGGGTGTTTAACCTACCATGATTAGTTATCAAGGACTGCCAACAACTGAACTGGATCACTGCTCTTTTGATAGATACCCGCTCTTATATAACTTCTAAACCGATCGCCGAGAAACGCCGTTTTTTCTGCTGTTTATCAACTCCTGCAACGTTCCTTTGATGGCATGATTTTCATTAAGCGTAGTGACTGACGCGAATTAAGAGTCTCGCCCGCTTGGTGAATTTATTATTTTTACATGTACAGTTCTGTTTGCCAATAATACTCACCGATGTCCTCATTCTGATACCATCTCCACATGGCTTTATTATTTAAGACAGGAAACGCGGAAAAATAGTACCCTTAGCGAAAATAGTAAAACAATCATGATCTTTTAGCTTGTATTTCGCAATCAGCTATAACACCAAAACTAACAAATATCATCAGCAAAAAGAACAAAACTCTTTTCATTTTCTTATTCCTCTCGATGTTCTCTGTTTCATCTTAGCTAAAATTTCACCCAAATCATCTATCCCTGCTGTTGCTGGCCCATCGGGTTTATTAATGTCTGGGAATAAATAGGGTTCTGCACAAGTATATCCTGGTGGTAATTGAGTTGTTGGCCAATTTGTCTGTGGCAGGTAATCACTTGCTGTCTTTGTATCCATCCCTGGATACTGGGAATCATCCTGTGGCGTACAAGTCAGATTTGGTTTTACCCACTTCCTGCAATACAGTGTGTAGTCGTAGGGCTTAATGCTCTGAAGAATGTTTTGAAAACATTAGGCGCACTACTGGCCTGGTCAATAGGATATGGCAGTCTTAATTGTTTCGCTATGTCCGGCAATTTACTTGGATCGGGCGTAGGCGGTTTGTTGGGTCTCGCTCCATATCCGCCATTATTTAAGTGTCCATATTTTGATGCCAGTCCCATTGAATCTATATACTGAACCGGATTCAGCGGATACTGATAAAATTCCATCCCCTTCAGCCCAATCGGATCCTGAGTGATATACCTCCCTGCAGCGGGTCATAATAGCGGTGGCGGTTGTAATACAGGCCGGACTCCTCATCATACTGCTGCCCCGGCAGGCGGATAAGCTGCTGCAGCTGATGCGGGTTCTCTTCATTCAGCAGGTTGCCCCATTCATCGTATTCTGCGCACCATTCTGTTGCCCCTTCCGTGCTGACAAGCGCCAGCGGCAGGCCGCGATGGTCGCAGTGGTACAGGTGGATTTTTCGCGCCGGCGTGTACACCGGGTCCATCTGGTTTTGCATCTGCTCCACCGTCAGGCCGCACGATGCCAGCCAGCGGCGGCTTTCCTCACTCACCCGGTCAGCCAGGATTTCACTTTCCAGCCGGTCGAGCATCTGCACCAGCACCGGCGGGAACACCACACTGCCACCGTCTTCGCCGCCGGACTGCTGAAGGGTATCCGCCAGGCTGCGGCGCTGCGTTTTCGCCAGCTCACCGGTGGCGGTTTCAACCCTGATGAGTGGCGTGAAGCTCCCCGGCTGATAAATCGTCTGGATGCGGGTTCTGTCGTTCTGTATCGTGGTCAGGCGGTCGCCGTCCCAGCCGTACCAGGTCACTTGCGGTTTCCGTGACAGCGACATCCAGCCCGTCAGGTCCCGTTCACGTCGCCACACCCGTTTTGCCACCCTGCGGCCCAGCGGGTCGTAAAGATAGCGGCTTTCGACCAGCGGCTCTGCATATTGTGTCCGCGTGTAGTGCACCAGCCGGTGCTGACTGTCGTAATGGTACCGGTGGGTGCGCTCATCATCCGTGCGGATAACCCTTCCGGGATGAGGTCGGTTTTCTCCGTCAGCCTGCCGTGACGGTCATACCGGTAAAGATAGTGCGCGTCACGGGCGATACGGTTATCCGGCCACATGCTGAGGGTGCTGTCCGGGTGCAGCTCCGGTCGGGCAGGCGGTTACCTGCCGGGTCTGTGGCATACGGGATATCAATGCCCAGGTTACATATAATAATAAGAGCAATTAACTTAATTTATTTGTTTATAATGCGCTTACTTAATACAAACCATTGAATATACCCTCCTGACAGAAAATAAAGCCATATTATTATCGCCATAATATACTTACTATCAATCCTTACGCCAATAATGTCTGATACAGTCCCTATAAATATTAGAGCAATAAAGAATACTATGCCTGTTGGAAAACATATTACCATCATTCCATAAGACATGAGACTAATTAACTCGCTCACATCACGAGTGGAGTCTAATAGTGAAAGTCTATGCATGGAAAAGAATAGTATTAAAAGCGATAAAGCCAGCCATATAGCTCTGAATAAAAAATAATATATTTCATTACATCACTCCGGTGAATACAAATCTAATAAAACGTCCAATGTTATTTCCGGAGCACTTCATCTTACATGTTTCTAAAGAATCATTAGACCAGTCTTGGCAGTTTTAAATAGCCCTAAATTTATAGGTGTGAATATATCAGGCAATACAGAATAACGCGGCTTACCTCTTTAAACTTCCTTTTAAACAGTTCTCCACACAACTATTATCGGTTTCAACGAGGTCACAACGGCCAGCAGCTTCTTTTGTATCATTACTTGCTTTACCTGGCCCCCATAGACCATCTCCTTTGATTCTCCCCGTTGGTCTTGGCCACCACAAGTATAGTCCCTTTACCATCTGGGACACAAAGATATTGATGATAGAACGGATTCCCCATATATCTGGACCGCTTCTTTCACCAGTTCCGCCCATTGAATGCAGTGGCTTAATGCATTTTAGTGTTTCTAATCCTAATGGATCTATATTTGAGATCGGATTCAACGGATACTGATAAAATTCCATCCCCTTTCAGCCCAATCGGATCCTGAGTGATATATCGCCCCTGCAGCGGGTCATAATAGCGGTGGCGGTTGTAATACAGGCCGGACTCCTCATCATACTGCTGCCCCGGCAGGCGGATAAGCTGCTGCAGCTGATGCGGGTTCTCTTCATTCAGCAGGTTACCCCATTCATCGTATTCTGCGTACCACGCTGTTGTCCCTTCCGTGCTGATAAGGGCCAGCGGCAGGCCGCGATGGTCGCAGTGGTACAGGTGAATTTTTCGCGCCGGCGTGTATACCGGGTCCATCTGGCTTTGCATCTGCGCCACCGTCAGGCCGCACGATGCCAGCCAGCGGCGGCTTTCCTCACTCACCCGGTCAGCCAGGATTTCACTTTCCAGCCGGTCGAGCATCTGCACCAGCACCGGCGGGAACACCACACTGCCACCGTCTTCGCCACCGGACTGCTGAAGGGTATCCGCCAGGCTGCGGCGCTGCGTTTTCGCCAGCTCACCGGTGGCGGTTTCAACCCTGATGAGTGGCGTGAAGCTCCCCGGCTGATAAATCGTCTGGATGCGGGTTCTGTCGTTCTGTATCGTGGTCAGGCGGTCGCCGTCCCAGCCGTACCAGGTCACTTGCGGTTTCCGTGACAGCGACATCCAGCCCGTCAGGTCCCGTTCACGCCGCCATACCCGTTTTGCCACCCTGCGGCCCAGCGGGTCGTAAAGATAGCGACTTTCGACCAGCGGCTCTGCATATTGTGTCCGCGTGTAGTGCACCAGCCGGTGCTGACTGTCGTAATGGTACCGGTGGGTGCGCTCATCATCCGTGCGGATAACCCTTCCGGGATGAGGTCGGTTTCTCTGTCAGCCTGCCGTGACGGTCATACCGGTAAAGATAGTGCGCGTCACGGGCGATACGGTTATCCGGCCACATGCTGAGGGCGCTGTCCGGGTGCAGCTCCGGGTCGGGCAGGCGGTTACCTGCCGGGTCTGTGGTATACGGGATGCGGATATCCAGATTCGCTGCGGTGGTGTGAACGCCGGTCAGCCTGCCGGTGGTGCTGTAGCTGTAACTCCGGGTCTGGCGCGGGCTGCTGATGCGGATGAGTTCGCCGTTGTCGTTCCAGGTGTAATCGCGGTCAGACAGCAGGCTGTTCAGGTGCTGGCTCTGTAACTGCCCGGCAGGGGTATAAGCGGTGGTGAGTTCATAACGGCCGAAGCTGCGCAGCGTTTCCCGGTGCAGGCGGTCGCGGGTGTACTCCACCAGCGGTGTGTCGCCGAGTTTCATGCCTGACAGCCAGCCGCTGCCGTAGGTCAGCCATTCCACGGCGGGCAGGCTGTCCGGTATACAGCGGTTCGCCAGTCCTGTGCGTTGTACGCATGTCTGGTCTCATGCTGCCAGAGCAGTTCATTCGTCTGCGGATGATGCACCGTCAGGTGTTCACTGGCGAGGCGGCCTTTACTGTCATAACCATAGTGCACCGTCACCCGGTGCCCTTCGCTGATATGGCTGATGTCTGTCAGCCAGCCGCGTTCGTCATACTGCCACCGCTCTGCGGTTTCGCCATTCACGGTGCGGTGCGTGAGGCGGTCTGCTTCGTCATAGTGCCAGTGGGTGACCAGCCCCTCATCCTCGCTGCGGATAAGTTTGCCGGTCAGGTCGTGGTGATAACGCTGTGTGCGGCCGTCAAAGCCGGTTTCCTGTATCAGCCGGTCGAGTACATCGTAACGGAAGGTGGTGTGGCTGCCGTTTTCACTGGTCAGGCGGATGACCCGTCCGGCAGCATCGTATTCCATACTGCGCGTCAGACCGCCCTGCGTGGTACAGATGGCTTTTCCCCGCATCGTACTGTGTCCCGTTTCTGCTGCCGTCCGGGGCAATGACGGTGGTCAGGTCACCGGCGGCGTTGTATTCATACCGCGTTTCATGGCCCTGCGTGTCTTTCACGGCAATTAACTGTCCACGGCTGTCGTATGCGCGGTACTGACTCAGCCCTTCCTCGCGGTGCACCGCCGTCACCTGACCAAAACGGTCATGGTCATAGCGGGTTACATAACCGGAACAGTCAGTGAAGCTCAGCAACTGACCGTAACGGCTCCACGTCATGGTTTTCCGGCTGCCGGTGGCATCTTCCGTTGCGCAGGGTAAGTCACTGTGTGGATTATCATAACGGTAGCGGGTGATATCGCCGTCAGGGGCAGTTTCCTGAATCAGACGGCCCCATTCATCATATTCCCGGCGTATTTCCAGCCCGTCAGGCCCGGTGGCTGACGTTAACTGGCTGTGGTGGTTATAGTAAAACGCCGATGCCCTGCCATCCGGCGTGGTGATGCGCGTGATGAGGCCCGTCACCACATCCGGACTGTATTCTGTTGTCCTGCCTGCGGCATCCGTCTGTGCCCTGAGCCTGCCCACCGCGTCAAACTGACTCTGCGTGACGCTGCCGTCCGCGTGTTCCTTTTTCACCACCCGCTTCAGCCCGCCTTCACCCTGCGTGTGCAGGACTTCACGGCGGTTCAGGCTGTCGGTGATGGTGATGCGGTCCTTCTCATACTGATACGTGTAACTTAAGCCTGCCGGGTTTAGCTGTTCTGTCACCCGCCCGTCGCTGTCGTAACGGTAACAGATTTCCGGTCGGCCCGTGTGACGGTGCGCCACCATCCGGCCCCGGTATTTATCATCGTAAGTAAAGCTGCGCACCTGTGTATTGCTGCGGTCATACACCGCCGCCAGTTCGCCGCGGGCGTCCAGCCATAGCGCACCAGCGGCGCGGCAGGTAAATTCTCCGGGTATTCCGGGTCGTGCGTCAGCCACACGGCAGACAGACGGATGCCGTTGTCCCGGCCATATTCGGTGTAACCCGGCAGGGTATCAGGAAAAGCGGACGGTTCCGTCCCGCCGGAAATGGCCTGCTGCCGGGCTTCTTCTGCCCGCTGCGCCTGCGTGGTCAGTACCAGCCGGAAGTGACGCCCGGCACCATCCGTCACGCCGGTGATTTCGCCGCTGAATTCACCGGCGGCTTCGCGGTGGAACGTCTGTGTGCGCCCGAAGCGGTCCACCAGCCCGGTCAGTACCCGGTACGGCGGCAGCGGCGCAGGCAGCACCTCATCCGCTTCCGGCACCCGCTCACACCAGCCGAGCAGCCACCACGGCCCCTGCGGACTGTTTGTCGCCAGATAACGATGCGGACTTAAGCGGAGTTCTTCCGGCAGCGCCTGCCAGAGTGCGGCCAGCCGGTGACCTTCATCCAGTTTCGCCACGCCGCCGCGCAGCCACAGTGACTCGCTGCGGCTGTAACCGTCCTCACCGGGAAACAGGTGCTCAAAATACAGGCTTCTGCCGCCGTTATCACTGAGTATCAGTGTGTTATCGCGCAGCTGTAAGCGGATATCCGCAGGCATTTTCCAGCCGGGGCCGAGGCTCCCCACCGGCGCGGGCGTTTTGTCCGGTAACTGCTGTAGGTGCGGGAGAATGAACGGCAGCGGGCCGGGCAGGGCGATGTCGGTTTCACCGGGAAGGACCTTTGCACCGAGCAGCGGATTGACCGGATGGCCGGACGTCACCCGCCGGGGCACCGAACAGGCCACGCCGGTGGGGCACCGATGCGTACCCCGGCTGAACCCTGGACAATGCTACCGCCATACTGCGTCATGTCGCCCTGACGCGCCGCCGGTTTTCCGCTCATCTGCTCATCCTTGTTTTATCGGGTTATTTGTCTGCTGACAGGCGAAACCCTACAGATTTATAAGAAAGCCTTAAGTGAGATATCTGTCAGATAAGAACAATTAGGAAAATATTTATATATATTTCATGAATATATGTTTCGATTGGTATAACGATGTCTAAATATTCCTCTGAACATCTTCCTGATACAAAACCGCCAGCGTTTCCGCTGGCGGTTTTCAATATTCAAAACTCAGCAATCAATAAAATCACCAGTTGCCTTTTCGGCCTGATCCATCCACACCGGTTTATCGCTGGTTTTCGACCAGACGCGATGCAGGTAGCTGTAAAAGCGGGCGCGGTCTTTCCAGAAAAGCATGAAAGGCAGCGCCAGAACGCCCGCTGCAACCGCATAAGTACGGCGTAAAAGATAAGCCATGCAGGATATTCTCTGTAGAGTTCCATACTTTTCTCCCCTTTTGTATCTACCCGGTGAATGGCACCGGAAAAATGAATTTGTTTATCTGATGAAAATAGTACCGCCTTTTGTGTAATTTTACTACTCATCCGACCACTTATTTTTGCTTATTGATGGTTTATTTACATTCATCCTGTAATTAAGTTACACAAAAGTTAAATTAATACTAAACATTAGTTAAATCATGGCTTTTGCCATTTTATACTTTTACACCCCGCCCGCAGATTTTGCGAAATCTTTGCAGCCAGAATTCTACCCTTCCGGTATCACTTTTAGGCCACTGGAGGTGCACTGTGAGTGCAGGCGTGATAACCGGCGTATTGCTGGTGTTTTATTACTGGGTTATCTGGTTTATGCCCTGATCAATGCGGAGGCGTTCTGATGGCTGCGCAAGGGTTCTTACTGATCGCCACGTTTTTACTGGTGTTAATGGTGCTGGCGCGTCCTTTAGGCAGCGGGCTGGCGCGGCTGATTAATGACATTCCTCTTCCCGGTACAACGGGCGTTGAGCGCGTACTTTTCGCGCACTTGGCGTCTCTGACCGTGAGATGAACTGGAAGCAATATCTTTGTGCCATTCTCGGCCTGAACATGCTGGGGCTGGCGGTGCTGTTTTATGTTGCTCGGTCAGCACTATCTGCCGCTTAATCCACAGCAGTTGCCAGGGCTGTCGTGGGATCTGGCGCTGAATACCGCCGTCAGCTTTGTCACCAATACCAACTGGCAATCTTATAGCGGTGAAACCACGTTGAGCTATTTCAGCCAGATGGCGGGCTTAACGGTGCAAAACTTTCTTTCTGCCGCCAGCGGATTGCGGTGATTTTGCCCTCATCCGTGCGTTTACCCGCCAGAGCATGAGCACGCTCGGGAATGCCTGGGTCGATCTGCTACGCATCACGTTATGGGTGCTAGTCCTGTGGCGTTGTTGATTGCACTGTTTTTATTCAACAAGGTGCGCTGCAAAACTTTCTGCCTTATCAGGCTGTGAATACCGTTGAAGGAGCGCAACAGCTGTTACCCATGGGGCCTGTAGCTTCTCAGGAAGCGATCAAGATGCTCGGTACTAACGGCGGTGGCTTCTTTAATGCCAACTCGTCGCATCCGTTTGAAAACCCAACCGCACTGACCAACTTCGTGCAGATGCTGGCGATCTTCTTGATCCCAACGGCGCTGTGCTTTGCCTTTGGTGAAGTGATGGGCGATCGCCGCCAGGGGCGCATGTTGCTGTGGGCGATGTCAGTGATTTTGTCATCTGCGTAGGCGTGGTGATGTGGGCAGAAGTTCAGGGTAATCCTCATCTGCTGGCACTGGGCACGGACAGCAGCATCAATATGGAAGGTAAAGAGAGCCGTTTCGGCGTGCTGGTCAGTAGCCTGTTTGCGGTCGTGACGACGGCGGCTTCCTGTGGCGCGGTGATTGCGATGCATGATTCGTTTACCGCTCTCGGTGGCATGGTGCCGATGTGGCTGATGCAAATTGGTGAAGTGGTGTTCGGCGGTGTCGGTTCTGGTCTTTACGGCATGATGCTGTTTGTCCTGCTGGCGGTGTTTATTGCCGGGCTGATGATTGGTCGTACACCGGAATATCTGGGTAAAAAATCGACGTACGCGAGATGAAACTGACTGCACTGGCAATTCTGGTTACCCTGACGCTGGTGCTGATGCCGAAGATGGAGCGACAGGCGAAATTGCGCCATGGCTCTATCGGCGTCTGAAATGTGCTTCCGCATGTGTTATGCGAAGGCCGCATCGTTACCCGGCACTAAGCCCTGGCTGGAACGGTTGGTGCCGTCTGCGCCTTAACCCCGCGTGGCACCTTGTGTTATGGCAACCAACTGTTGCGTTTCTCCTTGAGATACCGCGTGCTCCGGCAAGCTGGCAACACGGCAGCGGTTGGGTCGGCAACTGGCTGTGCGCCTGAACCACAGGGGCCGCGTTGGTCCTGGTGGATATCTCCGTGTATTGTCGCAAACCCATTGTTTGCAGCGCCGCGGCTTCCTTGATGCTGTTCTGGAAATACCTGAAGTAATTGAAATTAAACCCGCACCAAGGGGCAATCCGGTGATGTTATATTAGCGATCGGGTTGGTGACCGATGCGATGCTGACGCGTGTTATGCCGCCCTGCGCATCTCCAGCGGCATTTATTGCCGCTTTTGTTTTATATTCTGTTCGCTAAACAATTTCCCATTTCGCCAGCGTAAACGCAGGCCAACAGTCTGAAAGTGAAAACTGCCTTTGCCCGCATTTATGAGATGCGCTGCGGCGACAAATTCCAACCAACTTCGTAAAGCGATATCGTACTGGTGAAGCTGGCGATATTATCCCGCGATGGTGTTATTGAAGGGGTATCGGTCGATGGCGCCATCGGGGAATCGCGCAAACCGATCCGTGAATCCGGCGATTTTGCCTCCGTCACCGGCGGCGCGCATTCTTCTGACTGGCTGGTGATTGAGGTAGCGTTAACAGGGCGTAATGGGCGCTGATCGGCTGATTACGATTGCTCACAGCTGTTTTATGGCCCGAAATTCCCTGACCATATGGGCTGCCGACCGGTGTCCTTTTCTGGCAACCGCCACGTTATGCCGTAACGCTGGTCGCGGTCACGACCTCCAGTTTGACGGTGTTGATTGCCGCCAGCGCGATGCCGCGATCGGCACCGGCGTTGGCAGCATAATGGCGCGTAATGCTTTACCGCGAGATTTAATGGCGGACACAGTTGCGCCATGCTAACAGCCTGTTAAACATATGGGGATTCTCGCCAGTCGTTGCTCGCACCGCTAATCGCCGGTCTGCTGGCTGCGATGTGGAACTGGCGCAGCCGTGTTGATCTCGTTTTGTTGCGTTCTTTGTGCTGGTGTGACGGTATGGCCCGCTGGATGCTCGGAAACGCGTCCGGTCGATGCACCGCGCATGCGCGCCTGCTTACCAGTTTGAAACCTTTTCGCCAACAGCGGTTAACGGTTCATTTGCTGATGCTGATCCGCGGGTCTGGCCGGGATTGCCGCCTTTGAAGCCCTGCTCGGCGCGTGCTGATGGGCGCGGTGTTAGGGCTGATCAGTTGACGGTCAGTATTTTGTTGTTTATTCTGCCGATTCCGGCAGCGTTTTTGGCGCATGGTTTGCCGGACGTCCCCAATAAACGCTTCTGCCCAGCGTTAATGTGGCAGTCGGTTATCTGATGCCTGCCGGCTGGCTTGCTGATGTGGATCCCCGACTGGTTTGGCGTGATGAATGTCTGCGACGCTGCTCGTTCCCGCCGCGCTGTTCCAGCCGGTGCCGGCGATGCTGCTGTTTCCGCTGGCGGCGAACGGCGCGATGAATCGTTCCCCTTCCTGGCGGGCACGGCTGGCGCGAGCTGGTCGCACGGTCCGCAAAAGATTGGTTCCGGCGTGCTGGCGTCGCTCTCTGCGATGTTACCGCAAACCGGTCAGGGCAGCCTGGGGTTGTTGATGACCTTAATGCCTGATTGTTGATCGTGCTGTGCTGGCTGCCGCTGGCGGCGCGGATGTCGCGTAACGGCAGCCCGTTTTAAACGCACGTCACCATCCAGCCTCATCAGCTCCGTGGGAGCACGATGCTGCTTTATCAGATCACATCACCCTGCATATGCGGTGCCCGGAGTAAGAATAAAACGCCTGATAGCCGCACAAAGCACTGTCTGGCGTCTCCTGCCGAGCGATGCGGGCACAGGCGATGCCAGTCGCACGCCTGGCAGTCACAACGCGGTTGCGGGTTTTTCGCTGCCACACCATTTTTTGTAAGGTGGCGTCAAAAGCTCAATCGAGATACGACTGATATCTGCCCGCACCCAACACTCGAACAGGGCAGTGCAAAATTTCCCCACGAAGCTCTGCTGTCACGAAGCGGCCGTCCAGATCGCCCGGTCGTAAATTCAAGATAGGGGAATGGGCTGTACGGGCGGATGCCCGCTGTTTGAAATTATTGATAAAATCGGCGGGTTGCAGAGCATCCTTGTACTCTACAACCAGTTTATGCCCCGCAATCTCTTCAGCATCAATGACCTGACTTCCTGCCATGCGACTCTCAATAAATACGATAAGAAGTTGATGTATGCGTTACGGCAAACGTATTGCGAGATAACACCGCGAGGAGATCAAAAATTTGTCACGGACTACGTGAAATTGGGAAAATCGCTATTCATTGACATCCATTAGAAGTGCGATTACGTTAGCGAATCGCGGAAGGATCAGCGCCACGATGGCGAAATGCCAATCGAAATCAGAATAACATGCCCGCCTGGTACCCAGTTGTGTTTGATAGCCAACGCCATCAACGCCGTAGCCAGCGTGGTACGAAACCACGCCGGTGATATTGCGCTCCGGCTGCAGTCCTGGGTCGGCAATGCGTCTGGCTTTGCGGCTATCCGGCATACAACGCCAGTCCATAACGATCACCGCCACGACCATCAATATTAAGCTAATGATTAATGGCTGTTGGTGTAGGAGCGGATCCTCTTTCAGACGCATCGCTTTTTCATTGCGCGCCAGCGCAAGTAGCCATACATCGCTAACCGCCGGAAAACAGACACAACAACAACGCCAGCAGTTCGCGAATGACGGGCGTGGCGAAATCCTGGCGCAAGTTGATTGAAGCCCAACCCCGCCGCCAGAAATCCTGGTGCAGTACGGATCCACGCCAGAAAAGTACGCTCATTAGCCAGCGAGAAGCGGTAATCAGGCGCTTCTCCGGGCGGGAAAATTTTCATTGTTGCTCCTTTGCAATTTCACTAACGCGCTCTACCTTTAGCGGTTTTTAAAATTTCCGTCCGCCCGTTTCCTGATATGCTTTTGCCATCCGCTACAAAGGGAGGTCAGATGGGTATCATGGCTCAAAATAAAATCCAGTTCATTGGGCATGCTGTTCGGTGCCATCGCTTTAATGATGGGGATTATCCACTTTTCATTCGGCGCTTTCTCCGCACCATAACGTTTGAAAGCATCGTGGCGAGACCGAAACGGCGAAATTAAAGGGTCTTCTCGCCGGAATAAAAGGCAGAAAAAATTACCACCGTGGAGAAAAAAGAGGACGTAGATGTCGATAAAATCCTCAATCAAAGCGGTATCGCACTGGCCATTGCTGCGCTACTGCGCATTTATTGGCGGTATGCGTAAGGAGAAAATCCTTCTGGGGCATTCGCGGCTGCGCTGGTTTTGGCGGCGGGACGCTGGCTTTCCATACCTTGCTTTTGGTATCGGCATCGTGTGCGGCGATTTTGCTGATATTCCTTATCTTTTTCCTTCCTGACCGGCGGTTCACTGGTTTAAACAGCCTGAATAATTGCCCGCCGGGTGATCATCAGCGGGCATTATCGTCAGAACTTCTGTTTTTCTCCTCACCTTCACCCTTGTGTCCGGTAGGCCGGTGTCATAGTCGCGTACAGCTGGCGAATAGCGGGTTAAACGCCTAGCAGACGCCGCAATATCAGCACCGCC
+>84c0329b-2fe2-4fd8-ae10-f17ed9b2e0f9 id=40 clr=0,3468
+TTCGTGCTGCTGCGTTTAGTTACGTATTGCTACTTGCCTGTCGCTCTATCGCTACGTCTGCTTGGGTGTTTAACCTACACCGCCGCCAGTTCGCCGCGGGCGTCAGCCGCCAGCGCACCAGCGGCGCGGCGAGGTAAATTCTCCGGTATTCCGGGTCGTGCGTCAACCACGGCGAACAGACAGATGCCGTTGTCCCGCCATATTCGGTGTAACCGGCAGGGTATCAGAAAAGCGGACGGTTCCGTCCCGCCGGAAATAATACTGCCCGGCTTCTTCTGCCCGCTGCGCCTGCCGTGGTCAGTACCAGCCGGAAGTGACGCCCGGCACCATCCATCCACGCCGGTGATTTCGCCGCTGAATTCACCGGCGGCTTCGCGGTGGAACGTCTGGATGCGCCGAAGCGGTCCACCAGCCCGGTCAGTACCCGGTACGGCGGCAGCGGCGCAGCAGCACCTCATCCGCTTCCGGCACCCGCTCACACCAGCCGAGCAGCCACCACGGCCTACGGACTGTTTGTCGCCAGATAACGATGCGGACTTAAGCGGAGTTCTTCCGGCAGCGCCTGCAGAGTGCGGCCAGCCGGTGACCTTCATCCAGTTTCGCCACGCCGCCGCGCACCAGCCACAGTGACTCATGCGGCGTAACCCGTCTCACCGGGAAACAGGTGCTCAAATATACGGGCTTCTGCCGCTGGTATCAGTGTGTTATAACGCAGCTGTAAGCGGATATCCGCAGGCATTTTCCAGCCGGGGCCGAGGCTCCCCACCGGCGCGGGCGTTTTGTCCGGTAACTGCTGTAGGTGCGGGAGAAGAATGAACGGCAGCGGGCCGGGCAGGGCGATCGGTTTCACCGGGAAGGACCTTTGCACCGAGCAGCGGATTGACCGGATGGCCGGACGTCACCCGCCGGGGCACACCGAACAGGCCACGCCGGTGGGGCACCGATGCGTACTGGCTGAACCCTGGACAATGCTACCGCCATACTGCGTCATGTCGCCCTGACGCGCCGCCGGTTTTCCGCTCATCTGCTCATCCTTGTTTTATCGGGTTATTTGTCTGCTGACGGAAACCGAATTTATAAAGAAAGCCTGAGGCGAGATATCTGTCAGATAAGAACAATTAGGAAAATATTTATATATTTCATGAATATATGTTTCGATTGGTATAACGATGTCTAAATATTCCTCTGAACATCTTCCTGATACAAAAACCGCCAGCGTTTCCGCTGGCGGTTTTCAATATTCAAACTCAGCAATCAATAAAATCACCAGTTGCCTTTTCGGCCTGATCCATCCACACCGGTTTATCGCTGGTTTTCGACCAGACGCGATGCAGGTAGCTGTAAAAGCGGGCGCGGTCTTTCCAGAAAAGCATGAAGGCAGCGCCAGAACGCCCGCTGCAACCGCATGAGTGCGGCGTAAAAGATAAGCCATGCAGGATATTCTCTGTAGAGTTCCATACTTTCTCCCCTTTTGTATCTACCCGGTGAATGGCACCGGAAAAATGAATTTGTTTATCTGATGAAAATAGTACCGCCTTTTTGTGTAATTTTACTACTCATCCGACCACTTATTTTTGCTTATTGATGGTTTATTTACATTCATCCTGTAATTAAGTTTACAAAGTTAAATTAATACTAAACATGGATTAAATCATGGCTTTTGCCATTTTATACTTTTACACCCCGCCCGCAGATTTTTGCGAAATCTTTGCAGCCAAATTCTACCTTCGGTATCACTTTTAGGCCACTGGAGGTGCACTGTGAGTGCAGGCGTGATAACCGGCGTATTGCTGGTGTTTTTATTACTGGGTTATCTGGTTTATGCCTGATCAATGCGGAGGCGTTCTGATGGCTGCGCAAGGGTTCTTACTGATCGCCACGTTTTTACTGGTGTTAATGGTGCTGGCGCGTCCTTTAGGCAGCGGGCTGGCGCGGCTGATTAATGACATTCCTCTTCCCGGTACAACGGGCGTTGAGCGCGTACTTTTCGCGCCTTGGCGTCTCTGACCGTGAGATGAACTGGAAGCAATATCTTTGTGCCATTCTCGGCCTGAACATGCTGGGGCTGGCGGTGCTGTTTTATGTTGCTCGGTCAGCACTATCTGCCGCTTAATCCACAGCAGTTTGCTAGGGCTGTCGTGGGATCTGGCGCTGAATACCGCCGTCAGCTTTGTCACCAATACCAACTGGCAATCTTATAGCGGTGAAACCACGTTGAGCTATTTCAGCCAGATGGCGGGCTTAACGGTGCAAAACTTTCTTTCTGCCGCCAGCGGGATTGCGGTGATTTTTGCCCTCATCCGTGCGTTTACCCGCCAGAGCATGAGCACGCTCGAGATGCCTGGGTCGATCTGCTACGCATCGTTATGGTGCTAGTCCTGTGGCGTTGTTGATTGCACTGTTTTTATTCAACAAAGGTGCGCTGCAAAACTTTCTGCCTTATCAGGCTGTGAATACCGTTGAAGGAGCGCAACGGCTGTTACCATGGGGCCTGTAGCTTCTCAGGAAGCGATCAAGATGCTCGGTACTAACGGCGGTGGCTTCTTTAATGCCAACTCGTCGCATCCGTTTGAAAACCCAACCGCACTGACCAACTTCGTGCAGATGCTGGCGATCTTCTTGATCCCAACGTGTGCTGCCTTTGGTGAAGTGATGGGCGATCGCCGCCAGGGCGCATGTTGCTGTGGGCGATGTCGGTGATTTTGTCATCTGCGTAGGCGTGGTGATGTGGGCAGAAGTTCAGGGTAATCCTCATCTGCTGGCACTGGGCACGGACAGCAGCATCAATATGGAAGGTAAAGAGAGCCGTTTCGGCGTGCTGGTCAGTAGCCTGTTTGCGGTCGTGACGACGGCGGCTTCCTGTGGCGCGGTGATTGCGATGCATGATTCGTTTACCGCTCGGTGGCATGGTGCCGATGTGGCTGTCACAAATTGGTGAAGTGGTGTTCGGCGGTGTCGGTTCTGGTCTTTACGGCATGATGCTGTTTGTCCTGCTGGCGGTGTTTATTGCCGGGCTGATGATTGGTCGTACACCGGAATATCTGGGTAAAAAATCGACGTACGCGAGATGAAACTGACTGCACTGGCAATTCTGGTTACCCCGACGCTGGTGCTGATGGGCGCGGCGTTGGCGATGATGAATGACGCCGGACGTAGCGCCATGCTCGCTATGGCCCGCATGGTTTTAGCGAAGTGCTGTACGCCGTGTCATCCGCCGCTAACAACAACGGCAGCGCCTTTGCGGCGGATTAGCGCCAACTCTCGTTCTGGAACTGTTTACTGGCGTTCTGCATGTTTGTCGATCGCTTCGAATGATTATCCCGGTGATAGCAGTGCGGTTCGCTGGTGATAAAAGGCAAACCGCCAGCTCCGGCGCGCTGCCAACGCACGTAACTGTTTGTTGGCCTGTTAAATCCGGCACCGTATTTGCGGGGTTAAACACCCAACGAACGCCGCAATATCGGCGGG
+>c0789440-f511-4522-8231-d4d179a7a487 id=41 clr=0,3176
+TTGTTGTACTTCGTTCAGTTACGTATTGCTCTTGCCTGTCGCTCTATCTTCGGCGTCTGCTTAGGTGTTTAACCTATCTCACGGTCAGAGACGCCAAGTGCGCGAAAAAGTACGCTCAACGCCCGTTGTACCAGGAGGAGATGTCATTAATCAGCCGCGCCAGCCCGCTGCCTAAAGAGACAGCGCCAGCGCACCATTAACACCAGTAAAACGTGGCGATCAGTAGAACCCTTGCGCAGCCATCAGAACGCCTCCGCATTGATCAGGGCATAAACCAGATAACCCAGTAATAAAACACCAGCAATACGCCGGTTATCACGCCTGCACTCTAGTGCACCTCCAGTGGCCTAAAAGTGATACCGGAAGGGTAGAATTCTGGCTGCAAAGATTTCGCAAAAATCTGCGGGCGGGGTGTAAAAAGTATAAAATGGCAAAAGCCATGATTTAACTAATGTTTAGTATTAATTTAACTTTTGTAAACTTAATTACAGGATGAATGTAAATAAACCATCAATAAGCAAAAATAAGTGGTCGGATGAGTAGTAAAATTACACAAAAGGCGGTACTATTTTCATCAGATAAACAAATTCATTTTTCCGGTGCCATTCACCGGGTAGATACAAAGGGGGAGAAAGTATGGAACTCTACAGAGAATATCCTGCATGGCTTATCTTTTACGCCTTACGCCGTACTTATGCGGTTGCAGCGGGCGTTCTGGCGCTGCCTTTCATGCTTTTCTGGAAAGACCGCGCCCGCTTTTACCTTCTGCATCGCGTCTGGTCGAAAACCAGCGATAAACCGGTGTGGATGGATCAGGCCGAAAAGGCAACTGGTGATTTTATTGATTGCTGAGTTTTGAATACATTGAAAACCGCCAGCGGAAACGCTGGCGGTTTTATATCAGGAAGATGTTCAGAGGAATATTTAGACATCGTTATACCAATCGAAACATATATTCATGAAATATATATAAATATTTTCCTAATTGTTCTTATCTGACAGATATCTCACTTAAGGCTTTCTTATAAATCTGTAGGGTTTCGCCTGTCAGCAGACAAATAACCCGATAAAACAAGGATGAGCAGATGAGCGGAAAACCGGCGGCGCGTCAGGGCGACATGACGCAGTATGGCGGTAGCATTGTCCAGGGTTCAGCCGGGGTACGCATCGGTGCCCCACCGGCGTGGCCTGTTCGGTGTGCCCCGGCGGGTGACGTCCGGCCATCCGGTCAATCCGCTGCTCGGTGCAAAGGTCCTTCCCGGTGAAACCGACATCGCCCTGCCCGGCCCGCTGCCGTTCATTCTCTCCCGCACCTACAGCAGTTACCGGACAAAACGCCCGCGCCGGTGGGGCCTCGGCCCCGGCTGGAAAATGCCTGCGGATATCCGCTTACAGCTGCGCGATAACACACTGATACTCAGTGATAACGGCGGCAGAAGCCTGTATTTTGAGCACCTGTTTCCCGGTGAGGACGGTTACAGCCGCAGCGAGTCACTGTGGCTGGTGCGCGGCGGCGTGGCGAAACTGGATGAAGGTCACCGGCTGGCCGCCTCTGGCAGGCGCTGCCGGAAGAACTCGCTTAAGTCCGCATCGTTATCTGGCGACAAACAGTCCGCAGGGGCCGTGGTGGCTGCTCGGCTGGTGTGAGCGGGTGCCGGAAGCGGATGAGGTGCTGCCTGCGCCGCTGCCGCCGTACCGGGTACTGACCGGGCTGGTGGACCGCTTCGGGCGCACACAGACGTTCCACCGCGAAGCCGCCGGTGAATTCAGCGGCGAAATCACCGGCGTGACGGATGGTGCCGGGCGTCACTTCCGGCTGGTACTGACCACGCAGGCGCAGCGGGCAGAAGAAGCCCGGCAGCAGGCCATTTCCGGCGGGACGGAACCGTCCGCTTTTCCTGATACCCTGCCGGGTTACACCGAATATGGCCGGGACAACGGCATCCGTCTGTCTGCCGTGTGGCTGACGCACGACCCGGAATACCCGGAGAATTTACCTGCCGCGCCGCTGGTGCGCTATGGCTGGACGCCCGCGGCGAACTGGCGGCGGTGTATGACCGCAGCAATACACAGGTGCGCAGCTTTACTTACGATGATAAATACCGGGGCCGGATGGTGGCGCACCGTCACACGGGCCGACCGGAAATCTGTTACCGTTACGACAGCGACGGGCGGGTGACAGAACAGCTAAACCCGGCAGGCTTAAGTTACACGTATCAGTATGAGAGGACCGCATCACCATCACCGACAGCCTGAACCGCCGTGAAGTCCTGCACACGCAGGGTGAAGGCGGGCTGAAGCGGGTGGTGAAAAGGAACACGCGGACGGCAGCGTCACGCAGAGTCAGTTTGACGCGGTGGGCAGGCTCAGGGCACAGACGGATGCCGCAGGCAGGACAACAGAATACAGTCCGGATGTGGTGACGGGCCTCATCACGCGCATCACCACGCCGGATGGCAGGGCATCGGCGTTTTACTATAACCACCACAGCCAGTTAACGTCAGCCACCGGGCCTGACGGGCTGGAAATACGCCGGGAATATGATGAATGGGGCCGTCTGATTCAGGAAACTGCCCCTGACGGCGATATCACCCGCTACCGTTATGATAATCCACAGTGACTTACCCTGCGCAACGGAAGATGCCACCGGCGGCGGAAAACCATGACGTGGAGCCGTTACGGTCAGTTGCTGAGCTTCACTGACTGTTCCGGTTATGTAACCCGCTATGACCATGACCGTTTTGGTCAGGTGACGGCGGTGCACCGCGAGGAACTGAGTCAGTACCGCGCATACGACAGCCGTGGACAGTTAATTGCCGTGAAAGACACGCAGGGCCATGAAACGCGGTATGAATACAACGCCGCCGGTGACCTGACCACCGTCATTGCCCCGGACGGCAGCAGAAACGGGACACAGTACGATGCGTGGGAAAAGCCATCTGTACCACGCAGGGCGGTCTGACGCGCAGTATGGAATACGATGCTGCCGGACGGGTCATCCGCCTGACCAGTGAAAACGGCAGCCACACCACCTTCCGTTACGATGTACTCGACCGGCTGATACAGGAAACCGGCTTTGACGGCCGCACACAGCGTTATCACCACGACCTGACCGCCGGCAAACTTATCCGCAGCGAGGATGAGGTAAACACCAGCAGACGCCCGCAATATCGGCC
+>7caaf6c8-af5c-484f-ad5f-981112218eb0 id=42 clr=0,8189
+TGCATGGCTTATCTTTTTACGCCGTACTTATGCGGTTGCAGCGGGCGTTCTGGCGCTGCCTTTCATGCTTTCTGGAAAGACCGCGCCCGCTTTTACAGCTACCATCGCGTCTGGTCGAAAACCAGCGATAAACCGGTGTGGATGGATCAGGCCGAAAAGGCAACTGGTGATTTTATTGATTGCTGAGTTTTGAATACATTGAAAACCGCCAGCGGAAACGCTGGCGGTTTTAATATCAGGAAGATGTTCAGAGGAATATTTAGACATCGTTATACCAATCGAAACATATATTCATGAAATATATATAAATATTTTCCTAATTGTTCTTATCTGACAGATATCTCACTTAAGGCTTTCTTATAAATCTGGGTTTCGCCTGTCAGCAGACAAATAACCCGATAAAACAAGGATGAGCAGATGAGCGGAAAACCGGCGGCGCGTCAGGGCGACATGACGCAGTATGGCGGTAGCATTGTCCAGGGTTCAGCCGGGGTACGCATCGGTGCCCCACCGGCGTGGCCTGTTCGGTGTGCCCCGGCGGTGTGACGTCCGGCCATCCGGTCAATCCGCTGCTCGGTGCAAAGGTCCTTCCCGGTGAAACCGACATCGCCCTGCCCGGCCCGCTGCCGTTCATTCTCTCCCGCACCTACAGCAGTTACCGGACAAAACGCCCGCGCCGGTGGGAGCCTCGGCCCCGGCTGGAAAATGCCTGCGGATATCCGCTTACAGCTGCGCGATAACACACTGATACTCAGTGATAACGGCGGCAGAAGCCTGTATTTTGAGCACCTGTTTCCCGGTGAGGACGGTTACAGCCGCAGCGAGTCACTGTGGCTGGTGCGCGGCGGCGTGGCGAAACTGGATGAAGGTCACCGGCTGGCCGCACTCTGGCAGGCGCTGCCGGAAGAACTCCGCTTAAGTCCGCATCGTTATCTGGCGACAAACAGTCCGCAGGGGCCGTGGTGGCTGCTCGGCTGGTGTGAGCGGGTGCCGGAAGCGGATGAGGTGCTGCCTGCGCCGCTGCCGCCGTACCGGGTACTGACCGGGCTGGTGGACCGCTTCGGGCGCACACAGACGTTCCACCGCGAAGCCGCCGGTGAATTCAGCGGCGAAATCACCGGCGTGACGGATGGTGCCGGGCGTCACTTCCGGCTGGTACTGACCACGCAGGCGCAGCGGGCAGAAGAAGCCCGGCAGCAGGCCATTTCCGGCGGGACGGAACCGTCCGCTTTTCCTGATACCCTGCCGGGTTACACCGAATATGGCCGGGACAACGGCATCCGTCTGTCTGCCGTGTGGCTGACGCACGACCCGGAATACCCGGAGAATTTACCTGCCGCGCCGCTGGTGCGCTATGGCTGGACGCCCGCGGCGAACTGGCGGCGGTGTATGACCGCAGCAATACACAGGTGCGCAGCTTTACTTACGATGATAAATACCGGGGCCGGATGGTGGCGCACCGTCACACGGGCCGACCGGAAATCTGTTACCGTTACGACAGCGACGGGCGGGTGACAGAACAGCTAAACCCGGCAGGCTTAAGTTACGTATCAGTATGAGAAGGACCGCATCACCATCACCGACAGCCTGAACCGCCGTGAAGTCCTGCACACGCAGGGTGAAGGCGGGCTGAAGCGGGTGGTGAAAAGGAACACGCGGACGGCAGCGTCACGCAGAGTCAGTTTGACGCGGTGGGCAGGCTCAGGGCACAGACGGATGCCGCAGGCAGGACAACAGAATACAGTCCGGATGTGGTGACGGGCCTCATCACGCGCATCACCACGCCGGATGGCAGGGCATCGGCGTTTTACTATAACCACCACAGCCAGTTAACGTCAGCCACCGGGCCTGACGGGCTGGAAATACGCCGGGAATATGATGAATGGGGCCGTCTGATTCAGGAAACTGCCCCTGACGGCGATATCACCCGCTACCGTTATGATAATCCACACAGTGACTTACCCTGCGCAACGGAAGATGCCACCGGCAGCCGGAAAACCATGACGTGGAGCCGTTACGGTCAGTTGCTGAGCTTCACTGACTGTTCCGGTTATGTAACCCGCTATGACCATGACCGTTTTGGTCAGGTGACGGCGGTGCACCGCGAGGAAGGGCTGAGTCAGTACCGCGCATACGACAGCCGTGGACAGTTAATTGCCGTGAAAGACACGCAGGGCCATGAAACGCGGTATGAATACAACGCCGCCGGTGACCTGACCACCGTCATTGCCCCGGACGGCAGCAGAAACGGGACACAGTACGATGCGTGGGGAAAAGCCATCTGTACCACGCAGGGCGGTCTGACGCGCAGTATGGAATACGATGCTGCCGGACGGGTCATCCGCCTGACCAGTGAAAACGGCAGCCACACCACCTTCCGTTACGATGTACTCGACCGGCTGATACAGGAAACCGGCTTTGACGGCCGCACACAGCGTTATCACCACGACCTGACCGGCAAACTTATCCGCAGCGAGGATGAGGGCTGGTCACCCACTGGCACTATGACGAAGCAGACCGCCTCACGCACCGCACCGTGAATGGCGAAACCGCAGAGCGGTGGCAGTATGACGAACGCGGCTGGCTGACAGACATCAGCCATATCAGCGAAGGGCACCGGGTGACGGTGCACTATGGTTATGACAGTAAAGGCCGCCTCGCCAGTGAACACCTGACGGTGCATCATCCGCAGACGAATGAACTGCTCTGGCAGCATGAGACCAGACATGCGTACAACGCACAGGGACTGGCGAACCGCTGTATACCGGACAGCCTGCCCGCCGTGGAATGGCTGACCTACGGCAGCGGCTGGCTGTCAGGCATGAAACTCGGCGACACACCGCTGGTGGAGTACACCCGCGACCGCCTGCACCGGGAAACGCTGCGCAGCTTCGGCCGTTATGAACTCACCACCGCTTATACCCCTGCCGGGCAGTTACAGAGCCAGCACCTGAACAGCCTGCTGTCTGACCGCGATTACACCTGGAACGACAACGGCGAACTCATCCGCATCAGCAGCCCGCGCCAGACCCGGAGTTACAGCTACAGCACCACCGGCAGGCTGACCGGCGTTCACACCACCGCAGCGAATCTGGATATCCGCATCCCGTATACCACAGACCCGGCAGGTAACCGCCTGCCCGACCCGGAGCTGCACCCGGACAGCGCCCTCAGCATGTGGCCGGATAACCGTATCGCCCGTGACGCGCACTATCTTTACCGGTATGACCGTCACGGCAGGCTGACAGAGAAACCGACCTCATCCCGGAAGGGGTTATCCGCACGGATGATGAGCGCACCCACCGGTACCATTACGACAGTCAGCACCGGCTGGTGCACTACGCGGACACAATATGCAGAGCCGCTGGTCGAAAGTCGCTATCTTTACGACCCGCTGGGCCGCAGGGTGGCAAAACGGGTATGGCGGCGTGAACGGGACCTGACGGGCTGGATGTCGCTGTCACGGAAACCGCAAGTGACCTGGTACGGCTGGGACGGCGACCGCCTGACCACGATACAGAACGACAGAACCCGCATCCAGACGATTTATCAGCCGGGGCTTCACGCCACTCATCAGGGTTGAAACCGCCACCGGTGAGCTGGCGAAAACGCAGCGCCGCAGCCTGGCGGATACCCTTCAGCAGTCCGGTGGCGAAGACGGTGGCAGTGTGGTGTTCCCGCCGGTGCTGGTGCAGATGCTCGACCGGCTGGAAAGTGAAATCCTGGCTGACCGGGTGAGTGAGGAAGCCGCCGCTGGCTGGCATCGTGCGGCCTGACGGTGGCGCAGATGCAAAGCCAGATGGACCCGGTATACACGCCGGCGCGAAAAATTCACCTGTACCACTGCGACCATCGCGGCCTGCCGCTGGCCCTTATCAGCACGGAAGGGACAACAGCGTGGTACGCAGAATACGATGAATGGGGTAACCTGCTGAATGAAGAGAACCCGCATCAGCTGCAGCAGCTTATCCGCCTGCCGGGGCAGCAGTATGATGAGGAGTCCGGCCTGTATTACAACCGCCACCGCTATTATGACCCGCTGCAGGGGCGATATATCACTCAGGATCCGATTGGGCTGAAAGGGGATGGAATTTTATCAGTATCCGTTGAATCCGATCTCAAATATAGATCCATTAGGATTAGAAACACTAAAATGCATTAAGCCACTGCATTCAATGGGCGGAACTGGTGAAAGAAGCGGTCCAGATATATGGGGAATCCGTTCTATCATCAATATCTTTGTGTCCCAGATGGTAAAGGGACTATACTTGTGGTGGCCAAGACCAACGGGGAGAATCAAAGGAGATGGTCTATGGGGGCCAGGTAAAGCAAGTAATGATACAAAGAAGCTGCTGGCCGTTGTGACCTCGTTGAAACCGATAATAGTTGTGTGGAGAACTGTTTAAAGGGAAGTTTAAAGAGGTAAGGCCGCGTTATTCTGTATTGCCTGATATATTCACCTATAAATTTAGGGCTATTTAAAACTGCCAAGACTGGTCTAATGATTCTTTAGAAACATGTAAGATGAAGTGCTCCGGAAATAACATTGGACGTTTTATTAGATTTGTATTCACCGGAGTGATGTAATGAAATATATTATTTTTTATTCAGAGCTATATGGCTGGCTTTATCGCTTTTAATACTATTCTTTTCCATGCATAGACTTTCACTATTAGACTCCACTCGTGATGTGAGCGAGTTAATTAGTCTCATGTCTTATGGAATGATGGTAATATGTTTTCCAACAGGCATAGTATTCTTTATTGCTCTAATATTTATAGGGACTGTATCAGACATTATTGGCGTAAGTTGATAGTAAGTATATTATGGCGATAATAATATGGCTTTATTTTCTGTCAGGAGGGTATATTCAATGGTTTGTATTAAGTAAGCGCATTATAAACAAATAAATTAAGTTAATTGCTCTTATTATTATATGTAACCTGGGCATTGATATCCCGTATGCCACAGACCCGGCAGGTAACCGCCTGCCCGACCGGAGCTGCACGGACAGCACCCTCAGCATGTGGCCGGATAACCGTATCGCCCGTGACGCGCACTATCTTTACCGGTATGACCGTCACGGCAGGCTGACGGAGAAACCGACCTCATCCCGGAAGGGTTATCCGCACGGATGATGAGCGCACCCACCGGTACCATTACGACAGTCAGCACCGGCTGGTGCACTACACGCGGACACAATATGCAGAGCCGCTGGTCGAAAGCCGCTATCTTTACGACCCGCTGGGCCGCAGGGTGGCAAAACGGGTGTGGCGACGTGAACGGGACCTGACGGGCTGGATGTCGCTGTCACGGAAACCGCAAGTGACCTGGTACGGCTGGGACGGCGACCGCCTGACCACGATACAGAACGACAGAACCCGCATCCAGACGATTTATCAGCCGGGGCTTCACGCCACTCATCAGGTTGAAACCGCCACCGGTGAGCTGGCGAAAACGCAGCGCCGCAGCCTGGCGGATACCCTTCAGCAGTCCGGCGGCGAAGACGGTGGCAGTGTGGTGTTCCGCCGGTGCTGGTGCAGATGCTCGACCGGCTGGAAAGTGAAATCCTGGCTGACCGGGTGAGTGAGGAAAGCCGCCGCTGGCTGGCATCGTGCGGCCTGACGGTGGAGCAGATGCAAAACCAGATGGACCCGGTGTACACGCCGGCGCGAAAAATCCACCTGTACCACTGCGACCATCGCGGCCTGCCGCTGGCGCTTGTCAGCACGGAAGGGGCAACAGAATGGTGCGCAGAATACGATGAATGGGGCAACCTGCTGAATGAAGAGAACCCGCATCAGCTGCAGCAGCTTATCCGCCTGCCGGGGCAGCAGTATGATGAGTCCGGCCTGTATTACAACCGCCACCGCTATTATGACCCGCTGCAGGGAGGTATATCACTCAGGATCCGATTGGGCTGAAGGGGATGGAATTTTATCAGTATCCGCTGAATCCGGTTCAGTATATAGATTCAATGGGACTGGCATCAAAATATGGACACTTAAATAATGGCGGATATGGGCGAGACCCAACAAACCGCCGCCCGATCCAAGTAAATTGCCGGACATAGCGAAACAATTAAGACTGCCATATCCTATTGACCAGGCCAGTAGTGCGCCTAATGTTTTCAAAACATTCTTCAGAGCATTAAGCCCACGACTACACACTGTATTGCAGGAAGTGGGTAAAACCAAATCTGACTTGTACGCCACAGGATGATTCCCAGTATCCAGGGATGGATACAAAGACAGCAAGTGATTACCTGCCACAGACAAATTGGCCAACAACTCAATTACCACCAGGATATACTTGTGCAGAACCCTATTTATTCCCAGACATTAATAAACCCGATGGGCCAGCAACGGGGATAGATGATTTGGGTGAAATTTTAGCTAAGATGAAAGCAGAACATCGAGAGGAATAAGAAAATGAAAAGAGTTTTGTTCTTTTTGCTGATGATATTTGTTAGTTTTGGTGTTATAGCTGATTGCGAAATACAAGCTAAAGATCATGATTGTTTTACTATTTTCGCTAAGGGTACTATTTTTCCGCGTTTCCTGTCTTAAATAATAAAGCCATGTGGAGATGGTATCAGAATGAGGACATCGGTGAGTATTATTGGCAAACAGAACTGGGTACATGTAAAATAATAAATTCACACCAAGCGGGGCGAGACTCTTAATTCGCGTCGGGTCACTACGCCTTAATGAAAATCATGCCATCAAAGGAACGTTGCAGGAGTTGATAAATACAGCAGAAAAACGGCGTTTCTCGGCGATCGGTTTAGAATATATAAGAGCGGGTATCTATCAAAAGAGCAGTGATCCAGTTCAGTTGTTGGCAGTCCTTGATAATTCAATCATGGTAAAATATTTTAAAGATGAGAAACCAACTTATGCTCGAATGACAGCACATCTCCCGAACAAAATATGAGTCTTACGAATGTTTAATAAAGATACAGCATGAACTAATTCGTAGTGAAGAGAAATAAAATCTCTTCCTGAGAAAACAAATTAATCATTGTGAAAAATTATATAACTCATGGAATAGGTGTTTATTTTGCGTTCCATTTGCAGGAAAGATCACGTAACGCTACTTTTTGTACTAAATAATTCGAATTTTAAGTTCAACAATTGAGATACTTTATTGTCTAAAGCTGTTTTTCTAGCTTATACATGATCAAATACTCCTTACATAAATAAGGTGAACAAATGGAACTTAAAAATTGATGGAACATATTTCTATTACACCCGATTACAGACAAGCCTGGAAAGTGGTGCATAAATTGTCAGATATTCTACTGTTGACTATTTGTGCCGTTATTTCTGGTGCAGAAGGTTGGGAAGATATAAGAGGATTTCGAAACACATCTCGATTTTTTGAAGCAATATGGTGATTTTGAAAATGGTATTCCTGTTCACGATACCATTGCCAGAGTTGTATCAGGGAAAGATCACGTAACGCTACTTTTGTACTAAATAATTCGCATTTTATGTTTAAAAATTGAGATATTCCTTATTACCTAAAGCTGTTTTCATAGCTTATACATGATCAAATACTCCTTACATAAATAAGGTGAACAAATGGAACTTAAAAATTGATGGAACATATTTCTATTATTCCCGATTACAGATAAGCCTGGAAAGTAGAGCATAAATTGTCAGGCATCCTACTATTGACTATTTTGCCGTTATTTCTGGTTACGAAGTTGGGAAGATATAGAGGATTTCGAAACACATCTCGATTCTTGAAGCAATATGGTGATTTTGAAAATGGTATTCCTGTTCACGATACTGTTGCCAGGTTGTATCCTGTATCAGTCCTGCAAAATTTCACGAGTGCTTTATTAACTGGATGCGTGATTGCCATTCATCAAATGATAAAAGACGTCATTGCAATTGATGGAAAAAACGCTCCGGCACTCTTATGACAAGAGTCGCCACGGGAGCGGTCATGTCATTAGTGCGTTCTCAACAATGCACAGTCTGGTCATCGGGCAGATCAAGACGGATAAGAAATCAATGAGATCACAGCTATCCTGAACTTCTTAACATGCTGGATATTAAAGGAAAAATCATCACAACTGATGCGATGGGTTGCCAGAAAGATATTGCAGAGAAGATGCAAAAACAGGGAGGTGATTGGTTAAACTTACCAAGCAGACGCGCCGCAATATCAGCACCGCC
+>cc70a582-d0ee-47f5-890d-9d097df3619a id=43 clr=0,2686
+CTGTTGCCCCGTTTCCAGTTGTGTTGCTACTTGCCTGTCGCTCTATCTTCGGCGTCTGCTTGGGTTTAACCTCGGATATCCGCAGGCATTTTCCAGCCAGGGCCAGAAGCTCCCCACCAGCGCAGGCGTTTTGTCAATAACTGCTGTAGGTGCAGGAGAGAATGAACGGCAACGGGCCGGGCAGGGCGATATCAGTTTCACCGGGAAGGACCTTTGCACCGAGCAGCGGATTGACCAGATGGTGATCACCCGCCAGGGCACCGAACAGGCCACGCCGGTGGGGCACCGATGCGTACCCCAGCTGAACCCTGGACAATGCTACCACCGCCATACTGCGTCATGTCGCCCTGACGCGCCGCCGGTTTTCCGCTCATCTGCTCATCCCTTGTTTTATCGGGTTATTGTCTGCTGACAGGCGAAACCCTACAGATTTATAAGAAAGCCTTCGTGAGATATCTGTCAAGATAAGAACAATTAGGAAAATATTTATATATATTTTCATGAATATATCGATGTTTCGATTGGTATAACGATGTCGTATTCCTCTGAACATCTTCCTGATAAAAACCGCCAGCGTTTCGCTGGCGGTTTTCTAATATTCAAACTCAGCAATCAATAAAAATCACCAGTTGCCTTTTCAGGCCTGATCCATCCACCGGTTTATCGCTGGTTTCGACCAGACGCGATGCAGGTAGCTGTAAAAGCGGCGCGGTCTTTCCAGAAAAGCATGAAAGGCAGCGCCAGAACGCCCGCTGCAACCGCATGAAATACGGCGGCAAGATAAGCCATGCAGGATATTCTCTGTAGGTTCCCACTTTTCTCCCCTTTTGTATCTACCCGGTGAATGGCGCCGGAAAAATGAATTTGTTTATCTGATGAAAATAGTACCGCCTTTTTGTGTAATTTTTACTACTCATCCGACCACTTATTTTTGCTTATTGATGGTTTTATTTACATTCATCCTGTAATTAAGTTACACAAAAGTTAAATTAATACTAAACGTGGTTAAATCATGGCTTTTGCCATTTTATACTTTTACACCCCGCCCACCAGATTTTTGCGAAATCTTTGCGTAGAATTCTACCCTTCGGTATCACTTTTAGGCCACTGGAGTGCACTGTGAGTGCAGGCGTGATAACCGGCGTATTGCTGGTGTTTTATTACTGGGTTATCTGGTTTATGCCTGATCAATGCGGTGGCGTTCTGATGGCTGCGCAAGGGTTCTTACTGATCGCCACGTTTTTACTGGTGTTAATGGTGCTGGCGCGTCCTTTAGGGCAGGCTGGCGCGGCTGATTAATGACATTCCTCTTCCCGGTACAACGGGCGTTGAGCGCTGTGCTTTTCGCGCACTTGGCGTCTCTGACCGTGAGATGAACTGGAAGCTTATCTTTGTGCCATTCTCGGCCTGAACATGCTGGGGCTGGCGGTGCTGTTTTTATGTTGCTCGGTCAGCACTATCTGCCGCTTAATCCCACAGCAGCAGTTGCCAAGCTGTCGTGGGATCTGGCGCTGAATACCGCCGTCAGCTTGTCACCAATACCAGCTGGCAATCTTATAGCGGTGAAACCACGTTGAGCTATTTCAGCCAGATGGCGGGCTTAACGGTGCAAAACTTTCTTTCTGCCGCCAGCGGGATTGCGGAGATTTTGCCCTCATCCGTGCGTTTACCCGCCAGAGCATGAGCACGCTCGGGAATGCCTGGGTCGATCTGCTACGCATCACGTTATGGGTGCTAGTCCTGTGGCGTTGTTGATTGCACTGTTTTTATTCAACAAGGTGCGCTGCAAAACTTTCTGCCTTATCAGGCTGTGAATACCGTTGAAGGAGCGCAACAGCTGTTACCCGTGGGGCCTGTGGCTTCTCAGGAAGCGATCAAGATGCTCGGTACTAACGGCGGTGGCTTCTTTAATGCCAACTCGTCGCATCCGTTTGAAAACCCAACCGCACTGACCAACTTCGTGCGATGCCAGCGTCTTCTTGATCCCAACGGCGCTGTGCTGCCTTTAATTTAGAAGTGATGGGCGACCGCCGCCAGGGCATGTTGCTGTGGGCGATGTCAGTGATTTTTGTCATCTGCGTAAGCGTGTTGATGTGGGCAGAAGTTCAGGGGTAATCCTCAATCTGCTGCTGGCACTGGGCACGGACAGCAGCATCAATATGGAAGGTAAAGAGAGCCGTTTCGGCGTGCTGGTCCAGTAAGCCTGTTTGCGGTCGTGACGACGGCGGCTTCCTGTGGCGCGGTGATTACGATGCATGATTCGTTTACACCGCTCTCGGTATGGTGCCGAATGTGGCTGATGCAAATTGGTGAAGTGGTGAATTCGGCGGTGTCGGTTCTGGTCTTTACGGCATGATGCTGTTTGTCCTGCTGGCGGTGATTTTAATGCCAGGCGGCTGAAGTAGTTAAGGTCCGTACCACCAGAATGTCTGGGTAAAAAATCGAGCCCGTACGCGAGATGCAACTGACTGCACTGGCAATTCTGGTTACCCCGACGCTGTGCTGATGGAAGCGCAAGCGCTAGCGTGATGACCGACGCCGGACCCGAAATCAGCGCCATGCTCAACCCTGGCCCGCATGGTTTTAGCGAAGTGCTGTACGCCGTATCATCCGCCGCTAACAACAACGGCAAGGTTAAACGCAGAAGCAGACGCCGTATCAGCACCAACAGAAGCAATACGTAACC
+>eaa48d4e-1945-4011-8bae-ded748af1fca id=44 clr=0,10144
+TTGTTATGCTTCGTTCAGTTACGTATTGCTACTTGCCTGTCGCTATCTTCGGCGTCTGCTTGGGAACTGTTTAACGGGCTAGTGCGGTCGCGCAAGCGTTTCCCAGCGCCACCAGCGGCGCGAGGCCGGGCGACCGAGAATAATCTTGCCGAGATTATTCACGGGCATAACGCACTACCGCTTTCTCTTCCGCTGGATCAGAAAGTGTTGCCGTCTCGCGCCCAGTTCCTGCGCCAGACGTAAGGCGCTGAGAATTGCCCGACGTTTTTCCGGTAAGCGGTGCAGGGCAGGGGTTTCAACATACACCGCGTGCCAGACGCTACCCAGCCGTGACGCCAGCCGCGCCGCTGCGCGGACCAGTTTTTCGCTGCCGGTGTTATGGCCGATGCATAAAAGGATCGCGTCGCGCGTGTGCCACACTTTCTCTTCGCCAGGATGCCCCGCCAGGCGCGCATTTGCTCATCAACGCGATCGGCAGTACGGCGCAGTGCCAGTTCGCGCAGGGCGATCAGATTACCTTTGCGGAAAAATGTTCAATGGCGCGCTCCGCCTGCCCGGCAATATAGACTTTGCCTTCTTTCAGCCGCTGGCGCAGATCGTCCGGGGCAAGTCCACCAGCACCACGTCGTCGGCGGCATCGAAAAGGATCGGGCACGGTTTCCCGTACCTGAATTCCGGTGACGCCGCTGACCACATCATTCAGACTTTCCAGATGCTGAACGTTGACGGTAGTGAAAACATCAATGCCAGCTTCCAGCAGTTCTTCGATATCCTGCCAGCGTTTGGGATGACGGGAACCTGGCGCATTACTGTGCGCCAGTTCGTCCATTAAGATCAGCGCCGGGCGGCGGGCGAGGGCGGCATCGAGATCAAACTCGCTGATATGCCGCCCACGGTACGCCTGGCGTTTTAACGGCAGAACAGCCAGCCCTTCCAGCATGGCGGCGGTATCTTTTCGCCCGTGGGTTTCTACCACGCCAACCACAATATCCAGCCCTTGCGCCCGCAGTCGCTGGGCTTCTGCCAGCATCGCCCAGGTCTTCCCGACGCCTGCACAGGCACCGAAGAAAACTTTCAGCTTCCCCGATGCGGCGCGGCAGTTTGTTCCAGCAGACGATCGGGGTCGGGACGTAAGGGTTCGTTATTCATCAAGTTTATCCAGCGCCAGATTGAGTTCAACAATGTTGACAACCGGCTGGCCGATATATTTCACCAGCGGTTGTTGGCTGTATTTTGCGATCAGTTGCGTGAGCTGTTCAACGCTGAGATTACGCGCTTTCGCCACGCGTGGGATTTGCCAGGCCGCCGCTTGCGGGTGATATTATTGTCCAGCCCGCTTGCCGATGCCGTCACCAGTTCAACCGGAACGCTCGCGCTGGCATCCGGGTTAGCGGCCCGTAATGCAGCAACGCGTGCGGCTATTAGTTTATCCAGCTCAGGGTTACTGACCGCCAGATTGCTCCCGCCAGAAGCCTGTGGATTATAGGGCATGCCGTTGCCGACGGGCGACCATGAAAATAGCCGTTGCCGGTAAATTCTGCCCGATTAATGCCGAACCGCGCACCGTATCACCTTCACGAATCAACGAACCATTGGCCTGCCAGAAACCACCATTGCCCCAGTACGGTGGTCAGCAGCGGGTAAACGCCGCCAGTAATCAATAACAGAAAGATAAATGTTGATAATGCCGGACGTAATCCACTCATGGTAAACCTCACACCAGACCGCAAACGGTCAGCAGTAAATCAATGACTTTGATACCGATAAACGGCACCAGCAGCCCACCCAGACCGTAAATCCATAAGTTACGGCGCAACATGGCAGAAGCGGTAAGCGGTTTATAACTCACGCCTTTTAACGCCAGGGGAATCAAAGACGATAATCAAGGCGTTGAAAATCACCGCACTGAGGATTGCGGAGTCGGGCGAATGCAGGCACATGATGTTCAGCGCATTTAACTGCGGATACGTTGCCGCGAATGCCGCCGGAATAATGGCGAAGTATTTCGCCACATCGTTGGCAATGCTGAAGGTCAGCGAGCCACGGGTCATCAGCATCTGTTTGCCAATGTGCACCACCTCGATCAACTTGGTCGGGTTAGAGTCGAGATCGACCATATTGCCCGCCTCTTTCGCCGCCTGGGTGCCGGAGTTCATCGCCACCGCGACATCTGCCTGCGCCAGCGGAGCATCGTTGGTGCCGTCGCCGGTCATCGCTACCAAACGACCTTCCGCCTGATACTGACGGATCAATGCCAGCTTGGCCTCCGGTGTCGCTTCGGCGAGAAAATCATCGACACCCGCTTCCGCAGCAATCGCGGCGGCAGTCAGACGGTTATCGCCGGTAATCATCACCGTTTTAATGCCCATTTTGCGCAGCTGGGCGAAGCGCTCTTTAATACCGCCTTTGACGATATCTTTCAGCGCAATAACGCCCAGCACGAGAACCTTCCACCACCACCAGCGGCGTGGCTCCCTGACGCGCAACCTGATCGACTTTTTGATCAACATCGGTAGGGAAGTGACCACCGTTAGCCTCAACATGGCGACGAATGGCATCGACAGAACCTTTACGGATCATGCGGTTGTCGATGTTGATCCCGCTCATCCGGCTTTGCGCAGTAAACGGTACAAAGGTGGCATGGAGCGACTGCACATCGCGCTCGCGCAGGTTAAAACGCTGCTTGCGAGGATCACAATACTGCGGCCTTCCGGCGTTTCATCAGCCAGCGAAGCCAGTTGTGCGGCGTCAGCCAGCGTTTTCATCCACGCCCTGCGCGGGATAAACTCCGACGCCTGACGGTTACCGAGTGTGATGGTGCCGGTTTTATCCAGTAGCAGAACGTCAACGTCACCTGCCGCTTCAACTGCACGTCCGCTGGTGGCAATCACATTCGCGCCTAGCATCCGGCTCATCCCGGCGACGCCGATCGCTGACAACAGGCCGCCAATAGTGGTTGGGATCAGACAGACCAGCAGCGCCACCAGTACCGTTACGCTGACTGCATTACCGCCCCACGCGGAAAACGGCCACAGCGTGGCGGTTGCCAGTAAAAGACGATAGTCAGGGCAATCAGCAGAATGGTCAGGGCAATTTCGTTCGGCGTTTTGCGTCGCTGTGCGCCTTCCACCATCGCGATCATCCGATCCAGAAATGTCTCGCCGGGGTTAACGCTACACTCAATCACCAGCCAGTCAGAAAGAATACGCGTGCCGCCGGTGACGGAGGCAAAATCGCCGGATTCACGGATCACCGGTGCCGATTCCCCGGTGATGGCGCTTTCATCGACCGATGCCCCCTTCAATAACTTCACCATCGCGGGGATAATATCGCCAGCTTCTACCAGTACGATATCGCCTTTACGAAGTTGGTCGGCAGGAACTTTGTCCGCCGCAGCGCCATATTTCGGCTCACGCAGCTTGCGGGCAAAGGCAGTTTTTCACCCCTTTCAGACTGTTGGCCTGCGCTTTACTGCGGCCTTCTGCCAGCGCCTCGGCGAAATTAGCGAACAGTACGGTGATCCACAGCCAACCGCTAATGGCCGCGCTAAACAGCGCATTGCCGGGCATCGCACCGCTTGCCATCGCGATGCTAATACAGGTGGTCAGCAGACTGCCGATCCAGACGATAAACATCACCGGATTGCGCCATTGCGCCTGCGGGTTTAATTTTTCACCGCTTCTTTCAGCGCCTGAACGACAAGTGTTGGTTCGAATAGCGCCAGTTGTTTACGACTCATATTCAGTGCTCACTCAATATCATCAGGAGATATTCCGCCACCGGACCAAGCGCCAGGGCAGGGATAAAGGTCAGTGCGCCAACCAGCAACACGGTGCCGATTAACAGGCCAACAAACAGCGGGCCGTGCGTTGGCAGCGTGCCGGAGCTGGCGGCTTGGCTCTTTTACTCACCAGCGAACCGGCAATTGCCATCACCGGGATAATCACCCCGAAGCGACCGACAAACATGCAGAACGCCAGTAAACAGTTCCAGAACGGAGAGTTGGCGCTTAATCCGGCAAAGGCGCTGCCGTTGTTGTTAGCGGCGGATGACACGGCGTACAGCACTTCGCTAAAACCATGCGGGCCAGGGTTGAGCATGGCGCTACGTCCGGCGTCGGTCATCATCGCCAACGCCGCGCCCATCAGCACCAGCGTCGGGGTAACCAGAATTGCCAGTGCAGTCAGTTTCATCTCGCGTACGTCGATTTTTTACCCAGATATTCCGGTGTACGACCAATCATCAGCCCGGCAATAAACACCGCCAGCAGGACAAACAGCATCATGCCGTAAAGACCAGAACCGACACCGCCGAACACCACTTCACCAATTTGCATCAGCCACATCGGCACCATGCCACCGAGAGCGGTAAACGAATCATGCATCGCAATCACCGCGCCACAGGAAGCCGCCGTCGTCACGACCGCAAACAGGCTACTGACCAGCACGCCGAAACGGCTCTCTTTACCTTCCATATTGATGCTGCTGTCCGTGCCCAGTGCCAGCAGATGAGGATTACCCTGAACTTCTGCCCACATCACCACGCCTACGCAGATGACAAAATCACTGACATCGCCCACAGCAACATGCGCCCCTGGCGGCGATCGCCCATCACTTCACCAAAGGCAAAGCACAGCGCCGTTGGGATCAAGAAGATCGCCAGCATCTGCACGAAGTTGGTCAGTGCGGTTGGGTTTTCAAACGGATGCGACGAGTTGGCATTAAAGAAGCCACCGCCGTTAGTACCGAGCATCTTGATCGCTTCCTGAGAAGCTACAGGCCCCATGGGTAACAGCTGTTGCGCTCCTTCAACGGTATTCACAGCCTGATAAGGCAGAAAGTTTTGCAGCGCACCTTGTTGAATAAAAACAGTGCAATCAACAACGCCACAGGGACTAGCACCCATAACGTGATGCGTAGCAGATCGACCCAGGCATTCCCGAGCGTGCTCATGCTCTGGCGGGTAAACGCACGGATGAGGGCAAAATCACCGCAATCCCGCTGGCGGCAGAAAGAAAGTTTTGCACCGTTAAGCCCGCCATCTGGCTGAAATAGCTCAACGTGGTTTCACCGCTATAAGATTGCCAGTTGGTATTGGTGACAAAGCTGACGGCGGTATTCAGCGCCAGATCCCACGACAGCCCTGGCAACTGCTGTGGATTAAGCGGCAGATAGTGCTGACCGAGCAACATAAAAACAGCACCGCCAGCCCCAGCATGTTCAGGCCGAGAATGGCACAAAGATATTGCTTCCAGTTCATCTCACGGTCAGAGACGCCAAGTGCGCGAAAAGTACGCGCTCAACGCCCGTTGTACCGGGAAGAGGAATGTCATTAATCAGCCGCGCCAGCCCGCTGCCTAAAGGACGCGCCAGCACCATTAACACCAGTAAAAACGTGGCGATCAGTAAGAACCCTTGCGCAGCCATCAGAACGCCTCCGCATTGATCAGGGCATAAACCAGATAACCCAGTAATAAAACACCAGCAATACGCCGGTTATCACGCCTGCACTCACAGTGCACCTCTAAATTTCAAAATCTGCGGGCGGGGTGTAAAAAGTATAAAAATGGCAAAAGCCATGATTTAACTAATGTTTAGTATTAATTTAACTTTGTGTAACTTAATTACAGGATGAATGTAAATAAACCATCAATAAGCAAAAATAAGTGGTCGGATGAGTAGTAAAATTACACAAAAGGCGGTACTATTTTCATCAGATAAACAAATTCATTTTTCCGGTGCCATTCACCGGGTAGATACAAAAGGGGAGAAAAGTATGGAACTCTACAGAGAATATCCTGCATGGCTTATCTTTTTACGCCGTACTTATGCGGTTGCAGCGGGCGTTCTGGCGCTGCCTTTCATGCTTTTCTGGAAAGACCGCGCCCGCTTTTACAGCTACCTGCATCGCGTCTGGTCGAAAACCAGCGATAAACCGGTGTGGATGGATCAGGCCGAAAAGGCAACTGGTGATTTTATTGATTGCTGAGTTTTGAATACATTGAAAACCGCCAGCGGAAACGCTGGCGGTTTTTTATCAGGAAGATGTTCAGAGGAATATTTAGACATCGTTATACCAATCGAAACATATATTCATGAAATATATATAAATATTTTCCTAATTGTTCTTATCTGACAGATATCTCACTTAAGGCTTTCTTATAAATCTGTAGGGTTTCGCCTGTCAGCAGACAAATAACCCGATAAAACAAGGATGAGCAGATGAGCGGAAAACCGGCGGCGCGTCAGGGCGACATGACGCAGTATGGCGGTAGCATTGTCCAGGGTTCAGCCGGGGTACGCATCGGTGCCCCACCGGCGTGGCCTGTTCGGTGTGCCCCGGCGGGTGACGTCCGGCCATCCGGTCAATCCGCTGCTCGGTGCAAAGGTCCTTCCCGGTGAAACCGACATCGCCCTGCCCGGCCCGCTGCCGTTCATTCTCTCCCGCACCTACAGCAGTTACCGGACAAAACGCCCGCGCCGGTGGGGAGCCTCGGCCCCGGCTGGAAAATGCCTGCGGATATCCGCTTACAGCTGCGCGATAACACACTGATACTCAGTGATAACGGCGGCAGAAGCCTGTATTTTGAGCACCTGTTTCCCGGTGAGGACGGTTACAGCCGCAGCGAGTCACTGTGGCTGGTGCGCGGCGGCGTGGCGAAACTGGATGAAGGTCACCGGCTGGCCGCACTCTGGCAGGCGCTGCCGGAAGAACTCCGCTTAAGTCCGCATCGTTATCTGGCGACAAACAGTCCGCAGGGGCCGTGGTGGCTGCTCGGCTGGTGTGAGCGGGTGCCGGAAGCGGATGAGGTGCTGCCTGCGCCGCTGCCGCCGTACCGGGTACTGACCGGGCTGGTGGACCGCTTCGGGCGCACACAGACGTTCCACCGCGAAGCCGCCGGTGAATTCAGCGGCGAAATCACCGGCGTGACGGATGGTGCCGGGCGTCACTTCCGGCTGGTACTGACCACGCAGGCGCAGCGGGCAGAAGAAGCCCGGCAGCAGGCCATTTCCGGCGGGACGGAACCGTCCGCTTTCCTGATACCCTGCCGGGTTACACCGAATATGGCCGGGACAACGGCATCCGTCTGTCTGCCGTGTGGCTGACGCACGACCCGGAATACCCGGAGAATTTACCTGCCGCGCCGCTGGTGCGCTATGGCTGGACGCCCGCGGCGAACTGGCGGCGGTGTATGACCGCAGCAATACACAGGTGCGCAGCTTTACTTACGATGATAAATACCGGGGCCGGATGGTGGCGCACCGTCACACGGGCCGACCGGAAATCTGTTACCGTTACGACAGCGACGGGCGGGTGACAGAACAGCTAAACCCGGCAGGCTTAAGTTACGTATCAGTATGAGAAGGACCGCATCACCATCACCGACAGCCTGAACCGCCGTGAAGTCCTGCACACGCAGGGTGAAGGCGGGCTGAAGCGGGTGGTGAAAAGGAACACGCGGACGGCAGCGTCACGCAGAGTCAGTTTGACGCGGTGGGCAGGCTCAGGGCACAGACGGATGCCGCAGGCAGGACAACAGAATACAGTCCGGATGTGGTGACGGGCCTCATCACGCGCATCACCACGCCGGATGGCAGGGCATCGGCGTTTTACTATAACCACCACAGCCAGTTAACGTCAGCCACCGGGCCTGACGGGCTGGAAATACGCCGGAATATGATGAATGGGGCCGTCTGATTCAGGAAACTGCCCCTGACGGCGATATCACCCGCTACCGTTATGATAATCCACACAGTGACTTACCCTGCGCAACGGAAGATGCCACCGGCAGCCGGAAAACCATGACGTGGAGCCGTTACGGTCAGTTGCTGAGCTTCACTGACTGTTCCGGTTATGTAACCCGCTATGACCATGACCGTTTTGGTCAGGTGACGGTGCACCGCGAGGAAGGGCTGAGTCAGTACCGCGCATACGACCCGTGGACAGTTAATTGCCGTGAAAGACACGCAGGGCCATGAAACGCGGTATGAATACAACGCCGCCGGTGACCTGACCACCGTCATTGCCCCGGACGGCAGCAGAAACGGGACACAGTACGATGCGTGGGGAAAAGCCATCTGTACCACGCAGGGCGGTCTGACGCGCAGTATGGAATACGATGCTGCCGGACGGGTCATCCGCCTGACCAGTGAAAACGGCAGCCACACCACCTTCCGTTACGATGTACTCGACCGGCTGATACAGGAAACCGGCTTTGACGGCCGCACACAGCGTTATCACCACGACCTGACCGGCAAACTTATCCGCAGCGAGGATGAGGGGCTGGTCACCCACTGGCACTATGACGAAGCAGACCGCCTCACGCACCGCACCGTGAATGGCGAAACCGCAGAGCGGTGGCAGTATGACGAACGCGGCTGGCTGACAGACATCAGCCATATCAGCGAAGGGCACCGGGTGACGGTGCACTATGGTTATGACAGTAAAGGCCGCCTCGCCAGTGAACACCTGACGGTGCATCATCCGCAGACGAATGAACTGCTCTGGCAGCATGAGACCAGACATGCGTACAACGCACAGGGACTGGCGAACCGCTGTATACCGGACAGCCTGCCCGCCGTGGAATGGCTGACCTACGGCAGCGGCTGGCTGTCAGGCATGAAACTCGGCGACACACCGCTGGTGGAGTACACCCGCGACCGCCTGCACCGGAAACGCTGCGCAGCTTCGGCCGTTATGAACTCACCACCGCTTATACCCCTGCCGGGCAGTTACAGAGCCAGCACCTGAACAGCCTGCTGTCTGACCGCGATTACACCTGGAACGACAACGGCGAACTCATCCGCATCAGCAGCCCGCGCCAGACCCGGAGTTACAGCTACAGCACCACCGGCAGGCTGACCGGCGTTCACACCACCGCAGCGAATCTGGATATCCGCATCCCGTATACCACAGACCCGGCAGGTAACCGCCTGCCCGACCGGAGCTGCACCCGGACAGCGCCCTCAGCATGTGGCCGGATAACCGTATCGCCCGTGACGCGCACTATCTTTACCGGTATGACCGTCACGGCAGGCTGACAGAAAACCGACCTCATCCCGGAAGGGTTATCCGCACGGATGATGAGCGCACCCACCGGTACCATTACGACAGTCAGCACCGGCTGGTGCACTACACGACACAATATGCAGAGCCGCTGGTCGAAAGTCGCTATCTTTACGACCCGCTGGGCCGCAGGGTGGCAAAACGGGTATGGCGGCGTGAACGGGACCTGACGGGCTGGATGTCGCTGTCACGGAAACCGCAAGTGACCTGGTACGGCTGGGACGGCGACCGCCTGACCACGATACAGAACGACAGAACCCGCATCCAGACGATTTATCAGCCGGGGAGCTTCACGCCACTCATCAGGGTTGAAACCGCCACCGGTGAGCTGGCGAAAACGCAGCGCCGCAGCCTGGCGGATACCCTTCAGCAGTCCGGTGGCGAAGACGGTGGCAGTGTGGTGTTCCCGCCGGTGCTGGTGCAGATGCTCGACCGGCTGGAAAGTGAAATCCTGGCTGACCGGGTGAGTGAGGAAAGCCGCCGCTGGCTGGCATCGTGCGGCCTGACGGTGGCGCAGATGCAAAGCCAGATGGACCCGGTATACACGCCGGCGCGAAAAATTCACCTGTACCACTGCGACCATCGCGGCCTGCCGCTGGCCATATCAGCACGGAAGGGACAACAGCGTGGTACGCAGAATACGATGAATGGGGTAACCTGCTGAATGAAGAGAACCCGCATCAGCTGCAGCAGCTTATCCGCCTGCCGGGGCAGCAGTATGATGAGGAGTCCGGCCTGTATTACAACCGCCACCGCTATTATGACCCGCTGCAGGGGCGATATATCACTCAGGATCCGATTGGGCTGAAAGGGGATGGAATTTTATCAGTATCCGTTGAATCCGATCTCAAATATAGATCCATTAGGATTAGAAACACTAAAATGCATTAAGCCACTGCATTCAATGGGCGGAACTGGTGAAAAGCGGTCCAGATATATGGGGAATCCGTTCTATCATCAATATCTTTGTGTCCCAGATGGTAAAGGGACTATACTTGTGGTGGCCAAGACCAACGGGGAGAATCAAAGGAGATGGTCTATGGGGGCCAGGTAAAGCAAGTAATGATACAAAGAAGCC
+>95ff70e7-2b87-42d1-a957-21f9f276595c id=45 clr=0,10412
+TTGGTAGCGCTACGTTTCAGTTACGTATTGCTACTTGCCTGTCGCTCTATCTTCGGCGTCTGCTTGGGTGTTTTAACCTGAGTGCCGGGCGTTTTCCATCAATTGCAATGACGTCTTTATCATTTGATGAATGGCAATCACGCATCCAGTTAATAAAGCACTCGTGAAATTTTGCAGGACTGATACAGGATACAACTCTGGCAATAGTATCGTGAACAGGAATACCATTTTCAAAATCACCATATTGCTTCAGAAAATCGAGATGTGTTTCCCCGTCCTCTATATCTTCCCAACTTTCTGCACCAGAAATAACGGCAAAATAGTCAATAGTAGGATGCCTGACAATTTATGCTCTACTTTCCAGGCTTATCTGTAATCGGGAATAATAGAAATATGTTCCATCAATTTTTAAGTTCCATTTGTTCACCTTATTTATGTAAGGAGTATTTGATCATGTATAAGCTATGAAAAACAGCTTTAGGTAATAAGAATATCTCAATTTTTAAACATAAAATGCGAATTATTTAGTACAAAAAGGCGTTACGTGATCTTTCCTGGGATACAACTCTGGCAATGGTATCGTGAACAGGAATACCATTTTCAAAATCACCATATTGCTTCAAAAATCGAGATGTGTTTCCCCGAAATCCTCTATATCTTCCCAACCTTCTGCACCAGAAATAACGGCACAAATAGTCCAACAGTAGAATATCTGACAATTTATGCACCACTTTCCAGGCTTGTCTGTAATCGGGTGTAATAGAAATATGTTCCATCAATTTTTTAAGTTCCATTTGTTCACCTTATTTATGTAAGGAGTATTTGATCATGTATAAGCTATGAAAAACAGCTTTAGACAATAAGTAGTATCTCAATTGTTGAACTTAAATTCGAATTATTTAGTACAAAAAGTAGCGTTACGTGATCTTTCCTGCAAATGGAACGCAAAATAAACACCTATTCCATGAGTTATATAATTTTTCACAATGATTAATTTGTTTTCTCAGGAAGAGATTTTATTTCTCTTCACTACGAATTAGTTCATGCTGTATCTTTATTAAACATTCGTAAGACTCATTTTTGTTCGGGAGATGTGCTGTCATTCGAGCATAAGTTGGTTTCTCATCTTTAAAATATTTTACCATGATTGAATTATCAAGGACTGCCAACAACTGAACTGGATCACTGCTCTTTTGATAGATACCCGCTCTTATATAACTTCTAAACCGATCGCCGAGAAACGCCGTTTTTCTGCTGTATTTATCAACTCCTGCAACGTTCCTTTGATGGCATGATTTTCATTAAGGCGTAGTGACCCGACGCGAATTAAGAGTCTCGCCCCGCTTGGTGTGAATTTATTATTTTTACATGTACCCAGTTCTGTTTGCCAATAATACTCACCGATGTCCTCATTCTGATACCATCTCCACATGGCTTTATTATTTAAGACAGAAACGCGGAAAAATAGTACCCTTAGCGAAAATAGTAAAACAATCATGATCTTTAGCTTGTATTTCGCAATCAGCTATAACACCAAAACTAACAAATATCATCAGCAAAAAGAACAAAACTCTTTTCATTTTCTTATTCCTCTCGATGTTCTCTGTTTCATCTTAGCTAAAATTTCACCCAAATCATCTATCCCTGCTGTTGCTGGCCCATCGGGTTTATTAATGTCTGGGAATAAATAGGGTTCTGCACAAGTATATCCTGGTGGTAATTGAGTTGTTGGCCAATTTGTCTGTGGCAGGTAATCACTTGCTGTCTTTGTATCCATCCCTGGATACTGGGAATCATCCTGTGGCGTACAAGTCAGATTTGGTTTTACCCACTTCCTGCAATACAGTGTGTAGTCGTAGGGCTTAATGCTCTGAAGAATGTTTTGAAAACATTAGGCGCACTACTGGCCTGGTCAATAGGATATGGCAGTCTTAATTGTTTCGCTATGTCCGGCAATTTACTTGGATCGGGCGTAGGCGGTTTGTTGGGTCTCGCTCCATATCCGCCATTATTTAAGTGTCCATATTTTGATGCCAGTCCCATTGAATCTATATACTGAACCGGATTCAGCGGATACTGATAAAATTCCATCCCCTTCAGCCCAATCGGATCCTGAGTGATATACCTCCCTGCAGCGGGTCATAATAGCGGTGGCGGTTGTAATACAGGCCGGACTCCTCATCATACTGCTGCCCCGGCAGGCGGATAAGCTGCTGCAGCTGATGCGGGTTCTCTTCATTCAGCAGGTTGCCCCATTCATCGTATTCTGCGCACCATTCTGTTGCCCCTTCCGTGCTGACAAGCGCCAGCGGCAGGCCGCGATGGTCGCAGTGGTACAGGTGGATTTTTCGCGCCGGCGTGTACACCGGGTCCATCTGGTTTTGCATCTGCTCCACCGTCAGGCCGCACGATGCCAGCCAGCGGCGGCTTTCCTCACTCACCCGGTCAGCCAGGATTTCACTTTCCAGCCGGTCGAGCATCTGCACCAGCACCGGCGGAACACCACTGCCACCGTCTTCGCCGCCGGACTGCTGAAGGGTATCCGCCAGGCTGCGGCGCTGCGTTTTCGCCAGCTCACCGGTGGCGGTTTCAACCTGATGAGTGGCGTGAAGCTCCCCGGCTGATAAATCGTCTGGATGCGGGTTCTGTCGTTCTGTATCGTGGTCAGGCGGTCGCCGTCCCAGCCGTACCAGGTCACTTGCGGTTTCCGTGACAGCGACATCCAGCCCGTCAGGTCCCGTTCACGTCGCCACACCCGTTTTGCCACCCTGCGGCCCAGCGGGTCGTAAAGATAGCGGCTTTCGACCAGCGGCTCTGCATATTGTGTCCGCGTGTAGTGCACCAGCCGGTGCTGACTGTCGTAATGGTACCGGTGGGTGCGCTCATCATCCGTGCGGATAACCCTTCCGGGATGAGTCGGTTTTCTCCGTCAGCCTGCCGTGACGGTCATACCGGTAAAGATAGTGCGCGTCACGGGCGATACGGTTATCCGGCCACATGCTGAGGGTGCTGTCCGGTGCAGCTCCGGGTCGGGCAGGCGGTTACCTGCCGGGTCTGTGGCATACGGGATATCAATGCCCAGGTTACATATAATAATAAGAGCAATTAACTTAATTTATTTGTTTATAATGCGCTTACTTAATACAAACCATTGAATATACCCTCCTGACAGAAAATAAAGCCATATTATTATCGCCATAATATACTTACTATCAATCCTTACGCCAATAATGTCTGATACAGTCCCTATAAATATTAGAGCAATAAAGAATACTATGCCTGTTGGAAAACATATTACCATCATTCCATAAGACATGAGACTAATTAACTCGCTCACATCACGAGTGGAGTCTAATAGTGAAAGTCTATGCATGGAAAAGAATAGTATTAAAAGCGATAAAGCCAGCCATATAGCTCTGAATAAAAAAATAATATATTTCATTACATCACTCCGGTGAATACAAATCTAATAAAACGTCCAATGTTATTTCCGGAGCACTTCATCTTACATGTTTCTAAAGAATCATTAGACCAGTCTTGGCAGTTTTAAATAGCCCTAAATTTATAGGTGTGAATATATCAGGCAATACAGAATAACGCGGCCTTACCTCTTTAAACTTCCTTTTAAACAGTTCTCCACACAACTATTATCGGTTTCAACGAGGTCACAACGGCCAGCAGCTTCTTTGTATCATTACTTGCTTTACCTGGCCCCCATAGACCATCTCCTTTGATTCTCCCCGTTGGTCTTGGCCACCACAAGTATAGTCCCTTTACCATCTGGGACACAAAGATATTGATGATAGAACGGATTCCCCATATATCTGGACCGCTTCTTTCACCAGTTCCGCCCATTGAATGCAGTGGCTTAATGCATTTTAGTGTTTCTAATCCTAATGGATCTATATTTGAGATCGGATTCAACGGATACTGATAAAATTCCATCCCCTTTCAGCCCAATCGGATCCTGAGTGATATATCGCCCCTGCAGCGGGTCATAATAGCGGTGGCGGTTGTAATACAGGCCGGACTCCTCATCATACTGCTGCCCCGGCATGGATAAGCTGCTGCAGCTGATGCGGGTTCTCTTCATTCAGCAGGTTACCCCATTCATCGTATTCTGCGTACCACGCTGTTGTCCCTTCCGTGCTGATATGGGCCAGCGGCAGGCCGCGATGGTCGCAGTGGTACAGGTGAATTTTTCGCGCCGGCGTGTATACCGGGTCCATCTGGCTTTGCATCTGCGCCACCGTCAGGCCGCACGATGCCAGCCAGCGGCGGCTTTCCTCACTCACCCGGTCAGCCAGGATTTCACTTTCCAGCCGGTCGAGCATCTGCACCAGCACCGGCGGAACACCACACTGCCACCGTCTTCGCCACCGGACTGCTGAAGGGTATCCGCCAGGCTGCGGCGCTGCGTTTTCGCCAGCTCACCGGTGGCGGTTTCAACCCTGATGAGTGGCGTGAAGCTCCCCGGCTGATAAATCGTCTGGATGCGGGTTCTGTCGTTCTGTATCGTGGTCAGGCGGTCGCCGTCCCAGCCGTACCAGGTCACTTGCGGTTTCCGTGACAGCGACATCCAGCCCGTCAGGTCCCGTTCACGCCGCCATACCCGTTTTGCCACCCTGCGGCCCAGCGGGTCGTAAAGATAGCGACTTTCGACCAGCGGCTCTGCATATTGTGTCCGCGTGTAGTGCACCAGCCGGTGCTGACTGTCGTAATGGTACCGGTGGGTGCGCTCATCATCCGTGCGGATAACCCTTCCGGGATGAGGTCGGTTTCTCTGTCAGCCTGCCGTGACGGTCATACCGGTAAAGATAGTGCGCGTCACGGGCGATACGGTTATCCGGCCACATGCTGAGGGCGCTGTCCGGGTGCAGCTCCGGTCGGGCAGGCGGTTACCTGCCGGGTCTGTGGTATACGGGATGCGGATATCCAGATTCGCTGCGGTGGTGTGAACGCCGGTCAGCCTGCCGGTGGTGCTGTAGCTGTAACTCCGGGTCTGGCGCGGGCTGCTGATGCGGATGAGTTCGCCGTTGTCGTTCCAGGTGTAATCGCGGTCAGACAGCAGGCTGTTCAGGTGCTGGCTCTGTAACTGCCCGGCAGGGTATAAGCGGTGGTGAGTTCATAACGGCCGAAGCTGCGCAGCGTTTCCCGTGCAGGCGGTCGCGGGTGTACTCCACCAGCGGTGTGTCGCCGAGTTTCATGCCTGACAGCCAGCCGCTGCCGTAGGTCAGCCATTCCACGGCGGGCAGGCTGTCCGGTATACAGCGGTTCGCCAGTCCCTGTGCGTTGTACGCATGTCTGGTCTCATGCTGCCAGAGCAGTTCATTCGTCTGCGGATGATGCACCGTCAGGTGTTCACTGGCGAGGCGGCCTTTACTGTCATAACCATAGTGCACCGTCACCCGGTGCCCTTCGCTGATATGGCTGATGTCTGTCAGCCAGCCGCGTTCGTCATACTGCCACCGCTCTGCGGTTTCGCCATTCACGGTGCGGTGCGTGAGGCGGTCTGCTTCGTCATAGTGCCAGTGGGTGACCAGCCCCTCATCCTCGCTGCGGATAAGTTTGCCGGTCAGGTCGTGGTGATAACGCTGTGTGCGGCCGTCAAAGCCGGTTTCCTGTATCAGCCGGTCGAGTACATCGTAACGGAAGGTGGTGTGGCTGCCGTTTTCACTGGTCAGGCGGATGACCCGTCCGGCAGCATCGTATTCCATACTGCGCGTCAGACCGCCCTGCGTGGTACAGATGGCTTTTCCCCGCATCGTACTGTGTCCCGTTTCTGCTGCCGTCCGGGGCAATGACGGTGGTCAGGTCACCGGCGGCGTTGTATTCATACCGCGTTTCATGGCCCTGCGTGTCTTTCACGGCAATTAACTGTCCACGGCTGTCGTATGCGCGGTACTGACTCAGCCCTTCCTCGCGGTGCACCGCCGTCACCTGACCAAAACGGTCATGGTCATAGCGGGTTACATAACCGGAACAGTCAGTGAAGCTCAGCAACTGACCGTAACGGCTCCACGTCATGGTTTTCCGGCTGCCGGTGGCATCTTCCGTTGCGCAGGGTAAGTCACTGTGTGGATTATCATAACGGTAGCGGGTGATATCGCCGTCAGGGGCAGTTTCCTGAATCAGACGGCCCCATTCATCATATTCCGGCGTATTTCCAGCCCGTCAGGCCCGGTGGCTGACGTTAACTGGCTGTGGTGGTTATAGTAAAACGCCGATGCCCTGCCATCCGGCGTGGTGATGCGCGTGATGAGGCCCGTCACCACATCCGGACTGTATTCTGTTGTCCTGCCTGCGGCATCCGTCTGTGCCCTGAGCCTGCCCACCGCGTCAAACTGACTCTGCGTGACGCTGCCGTCCGCGTGTTCCTTTTCACCACCCGCTTCAGCCCGCCTTCACCCTGCGTGTGCAGGACTTCACGGCGGTTCAGGCTGTCGGTGATGGTGATGCGGTCCTTCTCATACTGATACGTGTAACCTGCCGGGTTTAGCTGTTCTGTCACCCGCCCGTCGCTGTCGTAACGGTAACAGATTTCCGGTCGGCCCGTGTGACGGTGCGCCACCATCCGGCCCCGGTATTTATCATCGTAAGTAAAGCTGCGCACCTGTGTATTGCTGCGGTCATACACCGCCGCCAGTTCGCCGCGGGGCGTCCAGCCATAGCGCACCAGCGGCGCGGCAGGTAAATTCTCCGGGTATTCCGGGTCGTGCGTCAGCCACACGGCAGACAGACGGATGCCGTTGTCCCGGCCATATTCGGTGTAACCCGGCAGGGTATCAGGAAAAGCGGACGGTTCCGTCCCGCCGGAAATGGCCTGCTGCCGGGCTTCTTCTGCCCGCTGCGCCTGCGTGGTCAGTACCAGCCGGAAGTGACGCCCGGCACCATCCGTCACGCCGGTGATTTCGCCGCTGAATTCACCGGCGGCTTCGCGGTGGAACGTCTGTGTGCGCCCGAAGCGGTCCACCAGCCCGGTCAGTACCCGGTACGGCGGCAGCGGCGCAGGCAGCACCTCATCCGCTTCCGGCACCCGCTCACACCAGCCGAGCAGCCACCACGGCCCCTGCGGACTGTTTGTCGCCAGATAACGATGCGGACTTAAGCGGAGTTCTTCCGGCAGCGCCTGCCAGTGCGGCCAGCCGGTGACCTTCATCCAGTTTCGCCACGCCGCCGCGCACCAGCCACAGTGACTCGCTGCGGCTGTAACCGTCCTCACCGGGAAACAGGTGCTCAAAATACAGGCTTCTGCCGCCGTTATCACTGAGTATCAGTGTGTTATCGCGCAGCTGTAAGCGGATATCCGCAGGCATTTTCCAGCCGGGGCCGAGGCTCCCCACCGGCGCGGGCGTTTTGTCCGGTAACTGCTGTAGGTGCGGAGAGAATGAACGGCAGCGGGCCGGGCAGGGCGATGTCGGTTTCACCGGGAAGGACCTTTGCACCGAGCAGCGGATTGACCGGATGGCCGGACGTCACCCGCCGGGGCACCGAACAGGCCACGCCGGTGGGGCACCGATGCGTACCCCGGCTGAACCCTGGACAATGCTACCGCCATACTGCGTCATGTCGCCCTGACGCGCCGCCGGTTTTCCGCTCATCTGCTCATCCTTGTTTTATCGGGTTATTTGTCTGCTGACAGGCGAAACCCTACAGATTTATAAGAAAGCCTTAAGTGAGATATCTGTCAGATAAGAACAATTAGGAAAATATTTATATATATTTCATGAATATATGTTTCGATTGGTATAACGATGTCTAAATATTCCTCTGAACATCTTCCTGATACAAAAACCGCCAGCGTTTCCGCTGGCGGTTTTCAATATTCAAAACTCAGCAATCAATAAAATCACCAGTTGCCTTTTCGGCCTGATCCATCCACACCGGTTTATCGCTGGTTTTCGACCAGACGCGATGCAGGTAGCAAAAGCGGGCGCGGTCTTTCCAGAAAAGCATGAAAGGCAGCGCCAGAACGCCCGCTGCAACCGCATAAGTACGGCGTAAAAAGATAAGCCATGCAGGATATTCTCTGTAGAGTTCCATACTTTTCTCCCCTTTTGTATCTACCCGGTGAATGGCACCGGAAAAATGAATTTGTTTATCTGATGAAAATAGTACCGCCTTTTGTGTAATTTTACTACTCATCCGACCACTTATTTTTGCTTATTGATGGTTTATTTACATTCATCCTGTAATTAAGTTACACAAAAGTTAAATTAATACTAAACATTAGTTAAATCATGGCTTTTGCCATTTTTATACTTTTACACCCCGCCCGCAGATTTTGCGAAATCTTTGCAGCCAGAATTCTACCCTTCCGGTATCACTTTTAGGCCACTGGAGGTGCACTGTGAGTGCAGGCGTGATAACCGGCGTATTGCTGGTGTTTTATTACTGGGTTATCTGGTTTATGCCCTGATCAATGCGGAGGCGTTCTGATGGCTGCGCAAGGGTTCTTACTGATCGCCACGTTTTTACTGGTGTTAATGGTGCTGGCGCGTCCTTTAGGCAGCGGGCTGGCGCGGCTGATTAATGACATTCCTCTTCCCGGTACAACGGGCGTTGAGCGCGTACTTTTCGCGCACTTGGCGTCTCTGACCGTGAGATGAACTGGAAGCAATATCTTTGTGCCATTCTCGGCCTGAACATGCTGGGGCTGGCGGTGCTGTTTTATGTTGCTCGGTCAGCACTATCTGCCGCTTAATCCACAGCAGTTGCCAGGGCTGTCGTGGGATCTGGCGCTGAATACCGCCGTCAGCTTTGTCACCAATACCAACTGGCAATCTTATAGCGGTGAAACCACGTTGAGCTATTTCAGCCAGATGGCGGGCTTAACGGTGCAAAACTTTCTTTCTGCCGCCAGCGGGATTGCGGTGATTTTGCCCTCATCCGTGCGTTTACCCGCCAGAGCATGAGCACGCTCGGGAATGCCTGGGTCGATCTGCTACGCATCACGTTATGGGTGCTAGTCCCTGTGGCGTTGTTGATTGCACTGTTTTTATTCAACAAGGTGCGCTGCAAAACTTTCTGCCTTATCAGGCTGTGAATACCGTTGAAGGAGCGCAACAGCTGTTACCCATGGGGCCTGTAGCTTCTCAGGAAGCGATCAAGATGCTCGGTACTAACGGCGGTGGCTTCTTTAATGCCAACTCGTCGCATCCGTTTGAAAACCCAACCGCACTGACCAACTTCGTGCAGATGCTGGCGATCTTCTTGATCCCAACGGCGCTGTGCTTTGCCTTTGGTGAAGTGATGGGCGATCGCCGCCAGGGGCGCATGTTGCTGTGGGCGATGTCAGTGATTTTGTCATCTGCGTAGGCGTGGTGATGTGGGCAGAAGTTCAGGGTAATCCTCATCTGCTGGCACTGGGCACGGACAGCAGCATCAATATGGAAGGTAAAGAGAGCCGTTTCGGCGTGCTGGTCAGTAGCCTGTTTGCGGTCGTGACGACGGCGGCTTCCTGTGGCGCGGTGATTGCGATGCATGATTCGTTTACCGCTCTCGGTGGCATGGTGCCGATGTGGCTGATGCAAATTGGTGAAGTGGTGTTCGGCGGTGTCGGTTCTGGTCTTTACGGCATGATGCTGTTTGTCCTGCTGGCGGTGTTTATTGCCGGGCTGATGATTGGTCGTACACCGGAATATCTGGGTAAAAAATCGACGTACGCGAGATGAAACTGACTGCACTGGCAATTCTGGTTACCCCGACGCTGGTGCTGATGGGCGCGGCGTTGGCGATGATGACCGACGCCGGACGTAGCGCCATGCTCAACCCTGGCCCGCATGGTTTTAGCGAAGTGCTGTACGCCGTGTCATCCGCCGCTAACAACAACGGCAGCGCCTTTGCCGGATTAAGCGCCAACTCTCCGTTCTGGAACTGTTTACTGGCGTTCTGCATGTTTGTCGGTCGCTTCGGGGTGATTATCCCGGTGATGGCAATTGCCGGTTCGCTGGTGAGTAAAAGAGCCAAGCCGCCAGCTCCGGCACGCTGCCAACGCACGGCCCGCTGTTTGTTGGCCTGTTAATCGGCACCGTGTTGCTGGTTGGCGCACTGACCTTTATCCCTGCCCTGGCGCTTGGTCCGGTGGCGGAATATCTCTCCTGATGATATTGAGTGAGCACTGAATATGAGTCGTAAACAACTGGCGCTATTCGAACCAACACTTGTCGTTCAGGCGCTGAAAGAAGCGGTGAAAAATTAAACCCGCAGGCGCAATGGCGCAATCCGGTGATGTTTATCGTCTGGATCGGCAGTCTGCTGACCACCTGTATTAGCATCGCGATGGCAAGCGGTGCGATGCCCGGCAATGCGCTGTTTAGCGCGGCCATTAGCGGTTGGCTGTGGATCACCGTACTGTTCGCTAATTTCGCCGAGGCGCTGGCAAGTTAAACACCCAAGCAGACGCCGAAGAA
+>f58173f7-dbfb-4c47-92c1-0124626bf4c2 id=46 clr=0,7422
+TTGTGTAGCGCTTCGTTCAGTTACGTATTGCTACTTGCCTGTCGCTCTATCTTCGGCGTCTGCTTGGGTGTTTAACCTGAAAAATGAATTTGTTTATCTGATGAAAATAGTACCGCCTTTTGTGTAATTTTACTACTCATCCGACCACTTATTTTTGCTTATTGATGGTTTATTTACATTCATCCTGTAATTAAGTTACACAAAAGTTAAATTAATACTAAACATTAGTTAAATCATGGCTTTTGCCATTTTATACTTTTACACCCCGCCCGCAGATTTTGCGAAATCTTTGCAGCCAGAATTCTACCCTTCCGGTATCACTTTTAGGCCACTGGAGGTGCACTGTGAGTGCAGGCGTGATAACCGGCGTATTGCTGGTGTTTTATTACTGGGTTATCTGGTTTATGCCCTGATCAATGCGGAGGCGTTCTGATGGCTGCGCAAGGGTTCTTACTGATCGCCACGTTTTTACTGGTGTTAATGGTGCTGGCGCGTCCTTTAGGCAGCGGGCTGGCGCGGCTGATTAATGACATTCCTCTTCCCGGTACAACGGGCGTTGAGCGCGTACTTTTTCGCGCACTTGGCGTCTCTGACCGTGAGATGAACTGGAAGCAATATCTTTGTGCCATTCTCGGCCTGAACATGCTGGGGCTGGCGGTGCTGTTTTTATGTTGCTCGGTCAGCACTATCTGCCGCTTAATCCACAGCAGTTGCCAGGGCTGTCGTGGGATCTGGCGCTGAATACCGCCGTCAGCTTTGTCACCAATACCAACTGGCAATCTTATAGCGGTGAAACCACGTTGAGCTATTTCAGCCAGATGGCGGGCTTAACGGTGCAAAACTTTCTTTCTGCCGCCAGCGGGATTGCGGTGATTTTGCCCTCATCCGTGCGTTTACCCGCCAGAGCATGAGCACGCTCGGGAATGCCTGGGTCGATCTGCTACGCATCACGTTATGGGTGCTAGTCCCTGTGGCGTTGTTGATTGCACTGTTTTTATTCAACAAGGTGCGCTGCAAAACTTTCTGCCTTATCAGGCTGTGAATACCGTTGAAGGAGCGCAACAGCTGTTACCCATGGGGCCTGTAGCTTCTCAGGAAGCGATCAAGATGCTCGGTACTAACGGCGGTGGCTTCTTTAATGCCAACTCGTCGCATCCGTTTGAAAACCCAACCGCACTGACCAACTTCGTGCAGATGCTGGCGATCTTCTTGATCCCAACGGCGCTGTGCTTTGCCTTTGGTGAAGTGATGGGCGATCGCCGCCAGGGGCGCATGTTGCTGTGGGCGATGTCAGTGATTTTGTCATCTGCGTAGGCGTGGTGATGTGGGCAGAAGTTCAGGGTAATCCTCATCTGCTGGCACTGGGCACGGACAGCAGCATCAATATGGAAGGTAAAGAGAGCCGTTTCGGCGTGCTGGTCAGTAGCCTGTTTGCGGTCGTGACGACGGCGGCTTCCTGTGGCGCGGTGATTGCGATGCATGATTCGTTTACCGCTCTCGGTGGCATGGTGCCGATGTGGCTGATGCAAATTGGTGAAGTGGTGTTCGGCGGTGTCGGTTCTGGTCTTTACGGCATGATGCTGTTTGTCCTGCTGGCGGTGTTTATTGCCGGGCTGATGATTGGTCGTACACCGGAATATCTGGGTAAAAATCGACGTACGCGAGATGAAACTGACTGCACTGGCAATTCTGGTTACCCCGACGCTGGTGCTGATGGGCGCGGCGTTGGCGATGATGACCGACGCCGGACGTAGCGCCATGCTCAACCCTGGCCCGCATGGTTTTAGCGAAGTGCTGTACGCCGTGTCATCCGCCGCTAACAACAACGGCAGCGCCTTTGCCGGATTAAGCGCCAACTCTCCGTTCTGGAACTGTTTACTGGCGTTCTGCATGTTTGTCGGTCGCTTCGGGGTGATTATCCCGGTGATGGCAATTGCCGGTTCGCTGGTGAGTAAAAGAGCCAAGCCGCCAGCTCCGGCACGCTGCCAACGCACGGCCCGCTGTTTGTTGGCCTGTTAATCGGCACCGTGTTGCTGGTTGGCGCACTGACCTTTATCCCTGCCCTGGCGCTTGGTCCGGTGGCGGAATATCTCTCCTGATGATATTGAGTGAGCACTGAATATGAGTCGTAAACAACTGGCGCTATTCGAACCAACACTTGTCGTTCAGGCGCTGAAAGAAGCGGTGAAAAATTAAACCCGCAGGCGCAATGGCGCAATCCGGTGATGTTTATCGTCTGGATCGGCAGTCTGCTGACCACCTGTATTAGCATCGCGATGGCAAGCGGTGCGATGCCCGGCAATGCGCTGTTTAGCGCGGCCATTAGCGGTTGGCTGTGGATCACCGTACTGTTCGCTAATTTCGCCGAGGCGCTGGCAGAAGGCCGCAGTAAAGCGCAGGCCAACAGTCTGAAAGGGTGAAAAACTGCCTTTGCCCGCAAGCTGCGTGAGCCGAAATATGGCGCTGCGGCGGACAAAGTTCCTGCCGACCAACTTCGTAAAGGCGATATCGTACTGGTAGAAGCTGGCGATATTATCCCCTGCGATGGTGAAGTTATTGAAGGGTGCATCGGTCGATGAAAGCGCCATCACCGGGGAATCGGCACCGGTGATCCGTGAATCCGGCGATTTTGCCTCCGTCACCGGCGGCACGCGTATTCTTTCTGACTGGCTGGTGATTGAGTGTAGCGTTAACCCCGGCGAGACATTTCTGGATCGGATGATCGCGATGGTGGAAGGCGCACAGCGACGCAAAACGCCGAACGAAATTGCCCTGACCATTCTGCTGATTGCCCTGACTATCGTCTTTTACTGGCAACCGCCACGCTGTGGCCGTTTTCCGCGTGGGGCGGTAATGCAGTCAGCGTAACGGTACTGGTGGCGCTGCTGGTCTGTCTGATCCCAACCACTATTGGCGGCCTGTTGTCAGCGATCGGCGTCGCCGGGATGAGCCGGATGCTAGGCGCGAATGTGATTGCCACCAGCGGACGTGCAGTTGAAGCGGCAGGTGACGTTGACGTTCTGCTACTGGATAAAACCGGCACCATCACACTCGGTAACCGTCAGGCGTCGGAGTTTATCCCCGCGCAGGGCGTGGATGAAAACGCTGGCTGACGCCGCACAACTGGCTTCGCTGGCTGATGAAACGCCGGAAGGCCGCAGTATTGTGATCCTCGCCAAGCAGCGTTTTAACCTGCGCGAGCGCGATGTGCAGTCGCTCCATGCCACCTTTGTACCGTTTACTGCGCAAAGCCGGATGAGCGGGATCAACATCGACAACCGCATGATCCGTAAAGGTTCTGTCGATGCCATTCGTCGCCATGTTGAGGCTAACGGTGGTCACTTCCCTACCGATGTTGATCAAAAAGTCGATCAGGTTGCGCGTCAGGAGCCGCCGCTGGTGGTGGTGGAAGGTTCTCGTGTGCTGGGCGTTATTGCGCTGAAAGATATCGTCAAAGGCGGTATTAAAGAGCGCTTCGCCCAGCTGCGCAAAATGGGCATTAAAACGGTGATGATTACCGGCGATAACCGTCTGACTGCCGCCGCGATTGCTGCGGAAGCGGGTGTCGATGATTTTCTCGCCGAAGCGACACCGGAGGCCAAGCTGGCATTGATCCGTCAGTATCAGGCGGAAGGTCGTTTGGTAGCGATGACCGGCGACGGCACCAACGATGCTCCGGCGCTGGCGCAGGCAGATGTCGCGGTGGCGATGAACTCCGGCACCCAGGCGGCGAAAGAGGCGGGCAATATGGTCGATCTCGACTCTAACCCGACCAAGTTGATCGAGGTGGTGCACATTGGCAAACAGATGCTGATGACCCGTGGCTCGCTGACCACCTTCAGCATTGCCAACGATGTGGCGAAATACTTCGCCATTATTCCGGCGGCATTCGCGGCAACGTATCCGCAGTTAAATGCGCTGAACATCATGTGCCTGCATTCGCCCGACTCCGCAATCCTCAGTGCGGTGATTTTCAACGCCTTGATTATCGTCTTTGATTCCCCTGGCGTTAAAGGCGTGAGTTATAAACCGCTTACCGCTTCTGCCATGTTGCGCCGTAACTTATGGATTTACGGTCTGGGTGGGCTGCTGGTGCCGTTTATCGGTATCAAAGTCATTGATTTACTGCTGACCGTTTGCGGTCTGGTGTGAGTTTACCATGAGTGGATTACGTCCGGCATTATCAACATTTATCTTTCTGTTATTGATTACTGGCGGCGTTTACCCGCTGCTGACCACCGTACTGGGGCAATGGTGGTTTCCTGGCAGGCCAATGGTTCGTTGATTCGTGAAGGTGATACGGTGCGCGGTTCGGCATTAATCGGGCAGAATTTTACCGGCAACGCTATTTTCATGGTCGCCCGTCGGCAACGGCAGAAATGCCCTATAATCCACAGGCTTCTGGCGGGAGCAATCTGGCGGTCAGTAACCCTGAGCTGGATAAACTAATAGCCGCACGCGTTGCTGCATTACGGGCCGCTAACCCGGATGCCAGCGCGAGCGTTCCGGTTGAACTGGTGACGGCATCGGCAAGCGGGCTGGACAATAATATCACCCGCAAGCGGCGGCCTGGCAAATCCCACGCGTGGCGAAAGCGCGTAATCTCAGCGTTGAACAGCTCACGCAACTGATCGCAAAATACAGCCAACAACCGCTGGTGAAATATATCGGCCAGCCGGTTGTCAACATTGTTGAACTCAATCTGGCGCTGGATAAACTTGATGAATAACGAACCCTTACGTCCCGACCCCGATCGTCTGCTGGAACAAACTGCCGCGCCGCATCGGGGAAGCTGAAAGTTTCTTCGGTGCCTGTGCAGGCGTCGGGAAGACCTGGGCGATGCTGGCAGAAGCCCAGCGACTGCGGGCGCAAGGGCTGGATATTGTGGTTGGCGTGGTAGAAACCCACGGGCGAAAAGATACCGCCGCCATGCTGGAAGGGCTGGCTGTTCTGCCGTTAAAACGCCAGGCGTACCGTGGGCGGCATATCAGCGAGTTTGATCTCGATGCCGCCCTCGCCCGCCGCCCGGCGCTGATCTTAATGGACGAACTGGCGCACAGTAATGCGCCAGGTTCCCGTCATCCCAAACGCTGGCAGGATATCGAAGAACTGCTGGAAGCTGGCATTGATGTTTTCACTACCGTCAACGTTCAGCATCTGGAAAGTCTGAATGATGTGGTCAGCGGCGTCACCGGAATTCAGGTACGGGAAACCGTGCCCGATCCTTTTCGATGCCGCCGACGACGTGGTGCTGGTGGACTTGCCCCGGACGATCTGCGCCAGCGGCTGAAAGAAGGCAAAGTCTATATTGCCGGGCAGGCGGAGCGCGCCATTGAACATTTTTCCGCAAAGGTAATCTGATCGCCCTGCGCGAACTGGCACTGCGCCGTACTGCCGATCGCGTTGATGAGCAAATGCGCGCCTGGCGGGGCATCCTGGCGAAGAGAAAGTGTGGCACGCGCGACGCGATCCTTTTATGCATCGGCCATAACACCGGCAGCGAAAACTGGTCCGCGCAGCGGCGCGGCTGGCGTCACGGCTGGGTAGCGTCTGGCACGCGGTGTATGTTGAAACCCCTGCCCTGCACCGCTTACCGGAAAAAACGTCGGGCAATTCTCAGCGCCTTACGTCTGGCGCAGGAACTGGGCGCGGGGACGGCAACACTTTCTGATCCAGCGGAAGAGAAAGCGGTAGTGCGTTATGCCCGTGAACATAATCTCGGCAAGATTATTCTCGGTCGCCCGGCCTCGCGCCGCTGGTGGCGTCGGGAAACGTTTGCTGACCGACTGGCGCGCATCGCCCCGATCTCGATCAGGTGCTGGTCGCGCTTGATGAACCACCCGCCCGCACGATTAACAACGCGCCGGATAACCGCTCTTTTAAAGACAAGTGGCGTGTACAAATTCAGGGATGCGTGGTTGCCGCCGCGTTATGCGCCGTTATCACCTTAATTGCCATGCAGTGGCTGATGGCGTTTGATGCCGCCAACCTGGTGATGCTGTATCTGCTTGGCGTGGTGGTGGTGGCGCTATTTTATGGACGCTGGCCTTCAGTGGTTGCCACCGTCATTAATGTAGTGAGTTTCGATCTCTTTTTATCGCCCCACGCGGCACGCTCGCCGTCTCTGATGTGCAATATCTGCTGACCTTCGCGGTGATGTTAACCGTCGGGCTGGTGATCGGGAACCTTACTGCTGGCGTGCGTTATCAGGCGCGGGTAGCCCGTTACCGCGAGCAACGCACGGCACTTATATGAAATGTCGAGCTCTGGCGGTGGGCCGCAGTCCGCAGATATCGCTGCCACCAGCGAACAATTTATTGCCTCCACGTTTCATGCCCGCAGTCAGGTGTTGTTGCCCGATGACAACGGTAAATTGCAGCCGTTAACACATCCGCAAGGAATGACGCCGTGGGACGATGCCATCGCGCAGTGGAGTTTGATAAAGGCCTGCCTGCGGGCGCGGGCACCGACACGTTACCCGGTGTACCGTACCAGATTTTGCCGCTAAAAGCGGCGAGAAAACCTACGGGCTGGTGGTGGTGGAGCCGGGAATCTGCGCCAGTTGATGATCCCGGAACAGCAGCGCCTGCTGGAGACGTTACGCTGTTAGTCGCCAATGCCCATGAGCGGCTGACGCTAACCGCCAGCGAAGAACAGGCGCGGATGGCAAGCGAACGTGAACAGATCCGCAACGCCTGCTGGCGGCGCTTTCGCATGATTTACGCACGCCGCTTACGGTGCTGTTTGGTCAGGCAGAAATCTTAACGCTCGATCTGGCAAGCGAGGATCACCCCGCCCGCCAGGCCAGCGAGATCCGTCAGCATGTGCTGAACACTACCCGACTGGTGAATAATCTACTGGATATGGCGCGAATTCAGTCCGGCGGCTTTAATTTGAAGAAAGAGTGGTTAACGCTGGAAGAAGTAGTCGGCAGCGCTGCAAATGCTGGAACCGGGTTTATCGTCGCCCATCAATCTTTCTCTGCCAGAACCGCTGACCTTAATCCACGTTGACGGGCCTCTTTGAACGGGTGCTGATTAATCTGCTGGAACGCGGTGAAATATGCGGGTGCGCAGGCCGAAATTGGTATCGATGCCCACGTTGAGGGCGAAAATCTACAACTGGATGTCTGGGATAACGGCCCCGGTCTTCCGCCAGGCCAGGAGCAGACGATATTTGATAAGTTTGCTCTCGCGAATAAAAGAGTCGGCAGTACCGGGGGTAGGGCTTGGACTGGCAATTTGTCGGGCGATAGTGGATGTACACGGGGCACTATTACCGCGTTCAACCGACCGGAAGGTGGTGCCTGTTTTCGTGTTACTTCCCCAGCAAACTGCCCCTGAACTGAAGAATTTCATGAGGATATGTGACAAACGTTCTGATTGTTGAAGATGAACAGGCTATTCGTCGCTTTCTGCGCAA
+>745b1774-6cd3-42d6-b574-a26fb2065d9c id=47 clr=0,2705
+TTGGTAATGCTTCGTTCCAGTTACGTATTGCTCTTGCCTGTCGCTCTATCTTCAGCGTCTGGCAGGTGTTTAACCTCTGCGCGGGGATAAACTCCGACGCCTGACGGTTACCGAGTGTGATGGTGCCGGTTTTATCCAGTAGCAGAACGTCAACGTCACCTGCCGCTTCAACTGCACGTCCGCTGGTGGCAATCACATTCGCGCCTAGCATCCGGCTCATCCCGGCGACGCCGATCGCTGACAACAGGCCGCCAATAGTGGTTGGGATCAGACAGACCAGCAGCGCCACCAGTACCGTTACGCTGACTGCATTACCGCCCCACGCGGAAAACGGCCACAGCGTGGCGGTTGCCAGTAAAAGACGATAGTCAGGGCAATCAGCAGAATGGTCAGGGCAATTTCGTTCGGCGTTTTGCGTCGCTGTGCGCCTTCCACCATCGCGATCATCCGATCCAGAAATGTCTCGCCGGGGTTAACGCTACACTCAATCACCAGCCAGTCAGAAAGAATACGCGTGCCGCCGGTGACGGAGGCAAAAATCGCCGCCGGATTCACGGATCACCGGTGCCGATTCCCCGGTGATGGCGCTTTCATCGACCGATGCACCCCTTCAATAACTTCACCATCGCAGGGGATAATATCGCCAGCTTCTACCAGTACGATATCGCCTTTACGAAGTTGGTCGGCAGGAACTTTGTCCGCCGCAGCGCCATATTTCGGCTCACGCAGCTTGCGGGCAAAGGCAGTTTTTCACCCTTTCAGACTGTTGGCCTGCGCTTTACTGCGGCCTTCTGCCAGCGCCTCGGCGAAATTAGCGAACAGTACGGTGATCCACAGCCAACCGCTAATGGCCGCGCTAAACAGCGCATTGCCGGGCATCGCACCGCTTGCCATCGCGATGCTAATACAGGTGGTCAGCAGACTGCCGATCCAGACGATAAACATCACCGGATTGCGCCATTGCGCCTGCGGGTTTAATTTTTCACCGCTTCTTTCAGCGCCTGAACGACAAGTGTTGGTTCGAATAGCGCCAGTTGTTTACGACTCATATTCAGTGCTCCTCAATATCATCAGGAGATATTCCGCCACCGGACCAAGCGCCAGGGCAGGATAAAGGTCAGTGCGCCAACCAGCAACACGGTGCCGATTAACAGGCCAACAAACAGCGGGCCGTGCGTTGGCAGCGTGCCGGAGCTGGCGGCTTGGCTCTTTTACTCACCAGCGAACCGGCAATTGCCATCACCGGGATAATCACCCCGAAGCGACCGACAAACATGCAGAACGCCAGTAAACAGTTCCAGAACGGAGAGTTGGCGCTTAATCCGGCAAAGGCGCTGCCGTTGTTGTTAGCGGCGGATGACACGGCGTACAGCACTTCGCTAAAACCATGCGGGCCAGGGTTGAGCATGGCGCTACGGCGTCGGTCATCATCGCCAACGCCGCGCCCATCAGCACCAGCGTCGGGGTAACCAGAATTGCCAGTGCAGTCAGTTTCATCTCGCGTACGTCGATTTTTACCCAGATATTCCGGTGTACGACCAATCATCAGCCCGGCAATAAACACCGCCAGCAGGACAAACAGCATCATGCCGTAAAGACCAGAACCGACACCGCCGAACACCACTTCACCAATTTGCATCAGCCACATCGGCACCATGCCACCGAGAGCGGTAAACGAATCATGCATCGCAATCACCGCGCCACAGGAAGCCGCCGTCGTCACGACCGCAAACAGGCTACTGACCAGCACGCCGAAACGGCTCTCTTTACCTTCCATATTGATGCTGCTGTCCGTGCCCAGTGCCAGCAGATGAGGATTACCCTGAACTTCTGCCCACATCACCACGCCTACGCAGATGACAAAAATCACTGACATCGCCCACAGCAACATGCGCCCTGGCGGCGATCGCCCATCACTTCACCAAAGGCAAAGCACAGCGCCGTTGGGATCAAGAAGATCGCCAGCATCTGCACGAAGTTGGTCAGTGCGGTTGGGTTTTCAAACGGATGCGACGAGTTGGCATTAAAGAAGCCACCGCCGTTAGTACCGAGCATCTTGATCGCTTCCTGAGAAGCTACAGGCCCCATGGGTAACAGCTGTTGCGCTCCTTCAACGGTATTCACAGCCTGATAAGGCAGAAAGTTTTGCAGCGCACCTTGTTGAATAAAAACAGTGCAATCAACAACGCCACAGGGACTAGCACCCATAACGTGATGCGTAGCAGATCGACCCAGGCATTCCCGAGCGTGCTCATGCTCTGGCGGGTAAACGCACGGATGAGGGCAAAATCACCGCAATCCCGCTGGCGGCAGAAGAAAGTTTTGCACCGTTAAGCCCGCCATCTGGCTGAAATAGCTCAACGTGGTTTCACCGCTATAAGATTGCCAGTTGGTATTGGTGACAAAGCTGACGGCGGTATTCAGCGCCAGATCCCACGACAGCCCTGGCAACTGCTGTGGATTAAGCGGCAGATAGTGCTGACCGAGCAACATAAAAACAGCACCGCCAGCCCCAGCATGTTCGGGGCCGAGAATGGCACAAAGATATTGCTTCCAGTTCATCTCACGGTCAGAGACGCCAAGTGCGCGAAAAGTACGCGCTCAACGCCCGTTGTACCGGGAAGAGGAATGTCATTAATCAGCCGCGCCAGCCCGCTGCCCTAAAGGACGCGCCAGCACCATTAACGGGTTAAGAACCAGCCCAA
+>6a470b8f-d316-4d8c-b93f-ea7bd154775d id=48 clr=0,6919
+TGCCTGGGTCGATCTGCTACGCATCACGTTATGGGTGCTAGTCCCTGTGGCGTTGTTGATTGCACTGTTTTTATTCAACAAGGTGCGCTGCAAAACTTTCTGCCTTATCAGGCTGTGAATACCGTTGAAGGGCGCAACAGCTGTTACCCATGGGGCCTGTAGCTTCTCAGGAAGCGATCAAGATGCTCGGTACTAACGGCGGTGGCTTCTTTAATGCCAACTCGTCGCATCCGTTTGAAAACCCAACCGCACTGACCAACTTCGTGCAGATGCTGGCGATCTTCTTGATCCCAACGGCGCTGTGCTTTGCCTTTGGTGAAGTGATGGGCGATCGCCGCCAGGGGCGCATGTTGCTGTGGGCGATGTCAGTGATTTTTGTCATCTGCGTAGGCGTGGTGATGTGGGCAGAAGTTCAGGGTAATCCTCATCTGCTGGCACTGGGCACGGACAGCAGCATCAATATGGAAGGTAAAGAGCCGTTTCGGCGTGCTGGTCAGTAGCCTGTTTGCGGTCGTGACGACGGCGGCTTCCTGTGGCGCGGTGATTGCGATGCATGATTCGTTTACCGCTCTCGGTGGCATGGTGCCGATGTGGCTGATGCAAATTGGTGAAGTGGTGTTCGGCGGTGTCGGTTCTGGTCTTTACGGCATGATGCTGTTTGTCCTGCTGGCGGTGTTTATTGCCGGGCTGATGATTGGTCGTACACCGGAATATCTGGGTAAAAATCGACGTACGCGAGATGAAACTGACTGCACTGGCAATTCTGGTTACCCCGACGCTGGTGCTGATGGGCGCGGCGTTGGCGATGATGACCGACGCCGGACGTAGCGCCATGCTCAACCCTGGCCCGCATGGTTTTAGCGAAGTGCTGTACGCCGTGTCATCCGCCGCTAACAACAACGGCAGCGCCTTTGCCGGATTAAGCGCCAACTCTCCGTTCTGGAACTGTTTACTGGCGTTCTGCATGTTTGTCGGTCGCTTCGGGGTGATTATCCCGGTGATGGCAATTGCCGGTTCGCTGGTGAGTAAAAGAGCCAAGCCGCCAGCTCCGGCACGCTGCCAACGCACGGCCCGCTGTTTGTTGGCCTGTTAATCGGCACCGTGTTGCTGGTTGGCGCACTGACCTTTATCCTGCCCTGGCGCTTGGTCCGGTGGCGGAATATCTCTCCTGATGATATTGAGTGAGCACTGAATATGAGTCGTAAACAACTGGCGCTATTCGAACCAACACTTGTCGTTCAGGCGCTGAAAGAAGCGGTGAAAAATTAAACCCGCAGGCGCAATGGCGCAATCCGGTGATGTTTATCGTCTGGATCGGCAGTCTGCTGACCACCTGTATTAGCATCGCGATGGCAAGCGGTGCGATGCCCGGCAATGCGCTGTTTAGCGCGGCCATTAGCGGTTGGCTGTGGATCACCGTACTGTTCGCTAATTTCGCCGAGGCGCTGGCAGAAGGCCGCAGTAAAGCGCAGGCCAACAGTCTGAAAGGGTGAAAAACTGCCTTTGCCCGCAAGCTGCGTGAGCCGAAATATGGCGCTGCGGCGGACAAAGTTCCTGCCGACCAACTTCGTAAAGGCGATATCGTACTGGTAGAAGCTGGCGATATTATCCCCTGCGATGGTGAAGTTATTGAAGGGGTGCATCGGTCGATGAAAGCGCCATCACCGGGGAATCGGCACCGGTGATCCGTGAATCCGGCGGCGATTTTGCCTCCGTCACCGGCGGCACGCGTATTCTTTCTGACTGGCTGGTGATTGAGTGTAGCGTTAACCCCGGCGAGACATTTCTGGATCGGATGATCGCGATGGTGGAAGGCGCACAGCGACGCAAAACGCCGAACGAAATTGCCCTGACCATTCTGCTGATTGCCCTGACTATCGTCTTTTACTGGCAACCGCCACGCTGTGGCCGTTTTCCGCGTGGGGCGGTAATGCAGTCAGCGTAACGGTACTGGTGGCGCTGCTGGTCTGTCTGATCCCAACCACTATTGGCGGCCTGTTGTCAGCGATCGGCGTCGCCGGGATGAGCCGGATGCTAGGCGCGAATGTGATTGCCACCAGCGGACGTGCAGTTGAAGCGGCAGGTGACGTTGACGTTCTGCTACTGGATAAAACCGGCACCATCACACTCGGTAACCGTCAGGCGTCGGAGTTTATCCCCGCGCAGGGCGTGGATGAAAACGCTGGCTGACGCCGCACAACTGGCTTCGCTGGCTGATGAAACGCCGGAAGGCCGCAGTATTGTGATCCTCGCCAAGCAGCGTTTTAACCTGCGCGAGCGCGATGTGCAGTCGCTCCATGCCACCTTTGTACCGTTTACTGCGCAAAGCCGGATGAGCGGGATCAACATCGACAACCGCATGATCCGTAAAGGTTCTGTCGATGCCATTCGTCGCCATGTTGAGGCTAACGGTGGTCACTTCCCTACCGATGTTGATCAAAAAGTCGATCAGGTTGCGCGTCAGGGAGCCACGCCGCTGGTGGTGGTGGAAGGTTCTCGTGTGCTGGGCGTTATTGCGCTGAAAGATATCGTCAAAGGCGGTATTAAAGAGCGCTTCGCCCAGCTGCGCAAAATGGGCATTAAAACGGTGATGATTACCGGCGATAACCGTCTGACTGCCGCCGCGATTGCTGCGGAAGCGGGTGTCGATGATTTTCTCGCCGAAGCGACACCGGAGGCCAAGCTGGCATTGATCCGTCAGTATCAGGCGGAAGGTCGTTTGGTAGCGATGACCGGCGACGGCACCAACGATGCTCCGGCGCTGGCGCAGGCAGATGTCGCGGTGGCGATGAACTCCGGCACCCAGGCGGCGAAAGAGGCGGGCAATATGGTCGATCTCGACTCTAACCCGACCAAGTTGATCGAGGTGGTGCACATTGGCAAACAGATGCTGATGACCCGTGGCTCGCTGACCACCTTCAGCGTACGATGTGGCGAAATACTTCGCCATTATTCCGGCGGCATTCGCGGCAACGTATCCGCAGTTAAATGCGCTGAACATCATGTGCCTGCATTCGCCCGACTCCGCAATCCTCAGTGCGGTGATTTTCAACGCCTTGATTATCGTCTTTGATTCCCCTGGCGTTAAAAGGCGTGAGTTATAAACCGCTTACCGCTTCTGCCATGTTGCGCCGTAACTTATGGATTTACGGTCTGGGTGGGCTGCTGGTGCCGTTTATCGGTATCAAAGTCATTGATTTACTGCTGACCGTTTGCGGTCTGGTGTGAGGTTTACCATGAGTGGATTACGTCCGGCATTATCAACATTTATCTTTCTGTTATTGATTACTGGCGGCGTTTACCCGCTGCTGACCACCGTACTGGGGCAATGGTGGTTTCCTGGCAGGCCAATGGTTCGTTGATTCGTGAAGGTGATACGGTGCGCGGTTCGGCATTAATCGGGCAGAATTTTACCGGCAACGGCTATTTTCATGGTCGCCCGTCGGCAACGGCAGAAATGCCCTATAATCCACAGGCTTCTGGCGGGAGCAATCTGGCGGTCAGTAACCCTGAGCTGGATAAACTAATAGCCGCACGCGTTGCTGCATTACGGGCCGCTAACCCGGATGCCAGCGCGAGCGTTCGGTTGAACTGGTGACGGCATCGGCAAGCGGGCTGGACAATAATATCACCCGCAAGCGGCGGCCTGGCAAATCCCACGCGTGGCGAAAGCGCGTAATCTCAGCGTTGAACAGCTCACGCAACTGATCGCAAAATACAGCCAACAACCGCTGGTGAAATATATCGGCCAGCCGGTTGTCAACATTGTTGAACTCAATCTGGCGCTGGATAAACTTGATGAATAACGAACCCTTACGTCCCGACCCCGATCGTCTGCTGGAACAAACTGCCGCGCCGCATCGGGGAAGCTGATTTTCTTCGGTGCCTGTGCAGGCGTCGGGAAGACCTGGGCGATGCTGGCAGAAGCCCAGCGACTGCGGGCGCAAGGGCTGGATATTGTGGTTGGCGTGGTAGAAACCCACGGGCGAAAGATACCGCCGCCATGCTGGAAGGGCTGGCTGTTCTGCCGTTAAAACGCCAGGCGTACCGTGGGCGGCATATCAGCGAGTTTGATCTCGATGCCGCCCTCGCCCGCCGCCCGGCGCTGATCTTAATGGACGAACTGGCGCACAGTAATGCGCCAGGTTCCCGTCATCCCAAACGCTGGCAGGATATCGAAGAACTGCTGGAAGCTGGCATTGATGTTTTCACTACCGTCAACGTTCAGCATCTGGAAAGTCTGAATGATGTGGTCAGCGGCGTCACCGGAATTCAGGTACGGGAAACCGTGCCCGATCCTTTTCGATGCCGCCGACGACGTGGTGCTGGTGGACTTGCCCCGGACGATCTGCGCCAGCGGCTGAAAGAAGGCAAAGTCTATATTGCCGGGCAGGCGGAGCGCGCCATTGAACATTTTTCCGCAAAGGTAATCTGATCGCCCTGCGCGAACTGGCACTGCGCCGTACTGCCGATCGCGTTGATGAGCAAATGCGCGCCTGGCGGGGCATCCTGGCGAAGAGAAAGTGGCACACGCGACGCGATCCTTTTATGCATCGGCCATAACACCGGCAGCGAAAACTGGTCCGCGCAGCGGCGCGCTGGCGTCACGGCTGGGTAGCGTCTGGCACGCGGTGTATGTTGAAACCCCTGCCCTGCACCGCTTACCGGAAAAAACGTCGGGCAATTCTCAGCGCCCCGTCTGGCGCAGGAACTGGGCGCGGAGACGGCAACACTTTCTGATCCAGCGGAAGAGAAAGCGGTAGTGCGTTATGCCCGTGAACATAATCTCGGCAAGATTATTCTCGGTCGCGGCCTCGCGCCGCTGGTGGCGTCGGGAAACGTTTGCTGACCGACTGGCGCGCATCGCCCCGATCTCGATCAGGTGCTGGTCGCGCTTGATGAACCACCCGCCCGCACGATTAACAACGCGCCGGATAACCGCTCTTTTAAAGACAAGTGGCGTGTACAAATTCAGGGATGCGTGGTTGCCGCCGCGTTATGCGCCGTTATCACCTTAATTGCCATGCAGTGGCTGATGGCGTTGATGCCGCCAACCTGGTGATGCTGTATCTGCTTGGCGTGGTGGTGGTGGCGCTATTTTATGGACGCTGGCCTTCAGTGGTTGCCACCGTCATTAATGTAGTGAGTTTCGATCTCTTTTTATCGCCCCACGCGGCACGCTCGCCGTCTCTGATGTGCAATATCTGCTGACCTTCGCGGTGATGTTAACCGTCGGGCTGGTGATCGGGAACCTTACTGCTGGCGTGCGTTATCAGGCGCGGGTAGCCCGTTACCGCGAGCAACGCACACGGCACTTATATGAAATGTCGAAAGCTCTGGCGGTGGGCCGCAGTCCGCAGGATATCGCTGCCACCAGCGAACAATTTATTGCCTCCACGTTTCATGCCCGCAGTCAGGTGTTGTTGCCCGATGACAACGGTAAATTGCAGCCGTTAACACATCCGCAAGGAATGACGCCGTGGGACGATGCCATCGCGCAGTGGAGTTTGATAAAGGCCTGCCTGCGGGCGCGGGCACCGACACGTTACCCGGTGTACCGTACCAGATTTTGCCGCTAAAAGCGGCGAAAACTACGGGCTGGTGGTGGTGGAGCCGGGAATCTGCGCCAGTTGATGATCCCGGAACAGCAGCGCCTGCTGGAGACGTTACGCTGTTAGTCGCCAATGCCCTTGAGCGGCTGACGCTAACCGCCAGCGAAGAACAGGCGCGGATGGCAAGCGAACGTGAACAGATCCGCAACGCCTGCTGGCGGCGCTTTCGCATGATTTACGCACGCCGCTTACGGTGCTGTTTGGTCAGGCAGAAATCTTAACGCTCGATCTGGCAAGCGAAGGATCACCCCGCCCGCCAGGCCAGCGAGATCCGTCAGCATGTGCTGAACACTACCCGACTGGTGAATAATCTACTGGATATGGCGCGAATTCAGTCCGGCGGCTTTAATTTGAAGAAAGAGTGGTTAACGCTGGAAGAAGTAGTCGGCAGCGCGCTGCAAATGCTGGAACCGGGTTTATCGTCGCCCATCAATCTTTCTCTGCCAGAACCGCTGACCTTAATCCACGTTGACGGGCCCTCTTTGAACGGGTGCTGATTAATCTGCTGGAGAACGCGGTGAAATATGCGGGTGCGCAGGCCGAAATTGGTATCGATGCCCACGTTGAGGGCGAAAATCTACAACTGGATGTCTGGGATAACGGCCCCGGTCTTCCGCCAGGCCAGGAGCAGACGATATTTGATAAGTTTGCTCGCGGGAATAAAGAGTCGGCAGTACCGGGGTAGGGCTTGGACTGGCAATTTGTCGGGCGATAGTGGATGTACACGGGGCACTATTACCGCGTTCAACCGACCGGAAGGTGGTGCCTGTTTTCGTGTTACACTTCCCCAGCAAACTGCCCCTGAACTGAAGAATTTCAGCGAGGATATGTGACAAACGTTCTGATTGTTGAAGATGAACAGGCTATTCGTCGCTTTCTGCGCACGGCGCTGGAGGGCGACGGATGCGCGTCTTTGAGGCCGAAACGCTGCAACGCGGCTTGCTGGAAGCAGGCAACCCGTAAGCCAGATTTGATTATTCTCGATCTCGGCCTGCCCGATGGTGATGGGATTGAGTTTATCCGCGACCTGCGCCAGTGGAGCGCGGTGCCGGTGTTAATGCTTTCCGCGCAGCGAAAAGCGACAAAATCGCCGCGCTGGATGCCGGAGCGGATGATTATCTGAGTAAGCCGTTTGGCATTGGCGGAATTGCAGGCCCGTCTGCGCGTCGCATTACGCCGCCACTCTGCACCACCGCGCCCGATCGCTGGTAAAATTTTCCGATGTTACCGTCGATTTAGCCGCCCGCGTGATTCACCGGGGTGAGGAAGGTTAAACACCCAAGCAGACGCCGAAGATAGAGCACGCC
+>1896c369-b7d0-4e98-aa23-830f7a9f001f id=49 clr=0,5295
+ATTGCATCGGTATTGCTTCCCGTTCGAAGTTACGTATCAGCGCTTCGGCGGCTGGCGGGTGTTTAACATTCAAACTCGCTGATATGCCGCCCACGGTACGCCTGGCGTTTTAACGGCAGAACAGCCAGCCCTTCCAGCATGGCGGCGGTATCTTTTCGCCCGTGGGTTTCTACCACGCCAACCACAATATCCAGCCCTTGCGCCCGCAGTCGCTGGGCTTCTGCCAGCATCGCCCAGGTCTTCCCGACGCCTGCACAGGCACCGAAGAAAACTTTCAGCTTCCCCGATGCGGCGCGGCAGTTTGTTCCAGCAGACGATCGGGGTCGGGACGTAAGGGTTCGTTATTCATCAAGTTTATCCAGCGCCAGATTGAGTTCAACAATGTTGACAACCGGCTGGCCGATATATTTCACCAGCGGTTGTTGGCTGTATTTTGCGATCAGTTGCGTGAGCTGTTCAACGCTGAGATTACGCGCTTTCGCCACGCGTGGGTTTGCCAGGCCGCCGCTTGCGGGTGATATTATTGTCCAGCCCGCTTGCCGATGCCGTCACCAGTTCAACCGGAACGCTCGCGCTGGCATCCGGGTTAGCGGCCCGTAATGCAGCAACGCGTGCGGCTATTAGTTTATCCAGCTCAGGGTTACTGACCGCCAGATTGCTCCCGCCAGAAGCCTGTGGATTATAGGGCATTTCTGCCGTTGCCGACGGGCGACCATGAAAATAGCCGTTGCCGGTAAAATTCTGCCCGATTAATGCCGAACCGCGCACCGTATCACCTTCACGAATCAACGAACCATTGGCCTGCCAGGAAACCACCATTGCCCCAGTACGGTGGTCAGCAGCGGGTAAACGCCGCCAGTAATCAATAACAGAAAGATAAATGTTGATAATGCCGGACGTAATCCACTCATGGTAAACCTCACCAGACCGCAAACGGTCAGCAGTAAATCAATGACTTTGATACCGATAAACGGCACCAGCAGCCCACCCAGACCGTAAATCCATAAGTTACGGCGCAACATGGCAGAAGCGGTAAGCGGTTTATAACTCACGCCTTTTAACGCCAGGGGATCAAAGACGATAATCAAGGCGTTGAAAATCACCGCACTGAGGATTGCGGAGTCGGGCGAATGCAGGCACATGATGTTCAGCGCATTTAACTGCGGATACGTTGCCGCGAATGCCGGAATAATGGCGAAGTATTTCGCCACATCGTTGGCAATGCTGAAGGTGGTCAGCGAGCCACGGGTCATCAGCATCTGTTTGCCAATGTGCACCACCTCGATCAACTTGGTCGGGTTAGAGTCGAGATCGACCATATTGCCCGCCTCTTTCGCCGCCTGGGTGCCGGAGTTCATCGCCACCGCGACATCTGCCTGCGCCAGCGCCGGAGCATCGTTGGTGCCGTCGCCGGTCATCGCTACCAAACGACCTTCCGCCTGATACTGACGGATCAATGCCAGCTTGGCCTCCGGTGTCGCTTCGGCGAGAAAATCATCGACACCCGCTTCCGCAGCAATCGCGGCGGCAGTCAGACGGTTATCGCCGGTAATCATCACCGTTTTAATGCCCATTTTGCGCAGCTGGGCGAAGCGCTCTTTAATACCGCCTTTGACGATATCTTTCAGCGCAATAACGCCCAGCACGAGAACCTTCCACCACCACCAGCGGCGTGGCTCCTGACGCGCAACCTGATCGACTTTTTGATCAACATCGGTAGGGAAGTGACCACCGTTAGCCTCAACATGGCGACGAATGGCATCGACAGAACCTTTACGGATCATGCGGTTGTCGATGTTGATCCCGCTCATCCGGCTTTGCGCAGTAAACGGTACAAAGGTGGCATGGAGCGACTGCGCATCGCGCAGGTTAAAACGCTGCTTGGCGAGGATCACAATACTGCGGCCTTCCGGCGTTTCATCAGCCAGCGAAGCCAGTTGTGCGGCGTCAGCCAGCGTTTTCATCCACGCCCTGCGCGGATAAACTCCGACGCCTGACGGTTACCGAGTGTGATGGTGCCGGTTTTATCCAGTAGCAGAACGTCAACGTCACCTGCCGCTTCAACTGCACGTCCGCTGGTGGCAATCACATTCGCGCCTAGCATCCGGCTCATCCCGGCGACGCCGATCGCTGACAACAGGCCGCCAATAGTGGTTGGGATCAGACAGACCAGCAGCGCCACCAGTACCGTTACGCTGACTGCATTACCGCCCGCGGAAAACGGCCACAGCGTGGCGGTTGCCAGTAAAAGACGATAGTCAGGGCAATCAGCAGAATGGTCAGGGCAATTTCGTTCGGCGTTTTGCGTCGCTGTGCGCCTTCCACCATCGCGATCATCCGATCCAGAAATGTCTCGCCGGGGTTAACGCTACACTCAATCACCAGCCAGTCAGAAAGAATACGCGTGCCGCCGGTGACGGAGGCAAAATCGCCGCCGGATTCACGGATCACCGGTGCCGATTCCCCGGTGATGGCGCTTTCATCGACCGATGCCCCCTTCAATAACTTCACCATCGCAGGGATAATATCGCCAGCTTCTACCAGTACGATATCGCCTTTACGAAGTTGGTCGGCAGGAACTTTGTCCGCCGCAGCGCCATATTTCGGCTCACGCAGCTTGCGGGCAAAGGCAGTTTTTCACCTTTCAGACTGTTGGCCTGCGCTTTACTGCGGCCTTCTGCCAGCGCCTCGGCGAAATTAGCGAACAGTACGGTGATCCACAGCCAACCGCTAATGGCCGCGCTAAACAGCGCATTGCCGGGCATCGCACCGCTTGCCATCGCGATGCTAATACAGGTGGTCAGCAGACTGCCGATCCAGACGATAAACATCACCGGATTGCGCCATTGCGCCTGCGGGTTTAATTTTTTCACCGCTTCTTTCAGCGCCTGAACGACAAGTGTTGGTTCGAATAGCGCCAGTTGTTTACGACTCATATTCAGTGCTCACTCAATATCATCAGAGAGATATTCCGCCACCGGACCAAGCGCCAGGGCAGGGATAAAGGTCAGTGCGCCAACCAGCAACACGGTGCCGATTAACAGGCCAACAAACAGCGGGCCGTGCGTTGGCAGCGTGCCGGAGCTGGCGGCGGCTCTTTACTCACCAGCGAACCGGCAATTGCCATCACCGGGATAATCACCCCGAAGCGACCGACAAACATGCAGAACGCCAGTAAACAGTTCCAGAACGGAGAGTTGGCGCTTAATCCGGCAAAGGCGCTGCCGTTGTTGTTAGCGGCGGATGACACGGCGTACAGCACTTTAAAAATGCGGGCCAGGGTTGAGCATGGCGCTACGTCCGGCGTCGGTCATCATCGCCAACGCCGCGCCCATCAGCACCAGCGTCGGGGTAACCAGAATTGCCAGTGCAGTCAGTTTCATCTCGCGTACGTCGATTTTTACCCAGATATTCCGGTGTACGACCAATCATCAGCCCGGCAATAAACACCGCCAGCAGGACAAACAGCATCATGCCGTAAAGACCAGAACCGACACCGCCGAACACCACTTCACCAATTTGCATCAGCCACATCGGCACCATGCCACCGAGAGCGGTAAACGATCATGCATCGCAATCACCGCGCCACAGGAAGCCGCCGTCGTCACGACCGCAAACAGGCTACTGACCAGCACGCCGAAACGGCTCTCTTTACCTTCCATATTGATGCTGCTGTCCGTGCCCAGTGCCAGCAGATGAGGATTACCCTGAACTTCTGCCCACATCACCACGCCTACGCAGATGACAAAATCACTGACATCGCCCACAGCAACATGCGCCCCTGGCGGCGATCGCCCATCACTTCACCAAAGGCAAAGCACAGCGCCGTTGGGATCAAGAAGATCGCCAGCATCTGCACGAAGTTGGTCAGTGCGGTTGGGTTTTCAAACGGATGCGACGAGTTGGCATTAAAGAAGCCACCGCCGTTAGTACCGAGCATCTTGATCGCTTCCTGAGCTACAGGCCCCATGGGTAACAGCTGTTGCGCTCCTTCAACGGTATTCACAGCCTGATAAGGCAGAAAGTTTTGCAGCGCACCTTGTTGAATAAAAACAGTGCAATCAACAACGCCACAGGGACTAGCACCCATAACGTGATGCGTAGCAGATCGACCCAGGCATTCCCGAGCGTGCTCATGCTCTGGCGGGTAAACGCACGGATGAGGGCAAAATCACCGCAATCCCGCTGGCGGCAGAAAAGTTTTGCACCGTTAAGCCCGCCATCTGGCTGAAATAGCTCAACGTGGTTTCACCGCTATAAGATTGCCAGTTGGTATTGGTGACAAAGCTGACGGCGGTATTCAGCGCCAGATCCCACGACAGCCCTGGCAACTGCTGTGGATTAAGCGGCAGATAGTGCTGACCGAGCAACATAAAAACAGCACCGCCAGCCCCAGCATGTTCAGGCCGAGAATGGCACAAAGATATTGCTTCCAGTTCATCTCACGGTCAGAGACGCCAAGTGCGCGAAAAGTACGCGCTCAACGCCCGTTGTACCGGGAAGAGGAATCATTAATCAGCCGCGCCAGCCCGCTGCCTAAAGGACGCGCCAGCACCATTAACACCAGTAAAACGTGGCGATCAGTAAGAACCCTTGCGCAGCCATCAGAACGCCTCCGCATTGATCAGGGCATAAACCAGATAACCCAGTAATAAAACACCAGCAATACGCCGGTTATCACGCCTGCACTCACAGTGCACCTCCAGTGGCCTAAAAGTGATACCGGAAGGGTAATTCTGGCTGCAAAGATTTCGCAAAAATCTGCGGGCGGGGTGTAAAAAAGTATAAAATGGCAAAAGCCATGATTTAACTAATGTTTAGTATTAATTTAACTTTTGTGTAACTTAATTACAGGATGAATGTAAATAAACCATCAATAAGCAAAAATAAGTGGTCGGATGAGTAGTAAAATTACACAAAAGGCGGTACTATTTTCATCAGATAAACAAATTCATTTTTCCGGTGCCATTCACCGGGTAGATACAAAGGGGAAAAGTATGGAACTCTACAGAGAATATCCTGCATGGCTTATCTTTTTACGCCGTACTTATGCGGTTAGCGGGCGTTCTGGCGCTGCCTTTCATGCTTTTCTGGAAAGACCGCGCCCGCTTTTACAGCTACCTGCATCGCGTCTGGTCGAAAACCAGCGATAAACCGGTGTGGATGGATCAGGCCGAAAAGGCAACTGGTTTTTATTGATTGCTGAGTTTTGAATACATTGAGAACCGCCAGCGGTTTAAACGCAAACGGACCGCTATCAGCACCAACAGAAAAGCAGTAAATGAAAAAAGAAAA
+>c1709263-8322-4cbd-86de-5f40eb0457c1 id=50 clr=0,11542
+TTGCCAGGCCGCCGCTTGCGGGTGATATTATTGTCCAGCCCGCTTGCCGATGCCGTCACCAGTTCAACCGGAACGCTCGCGCTGGCATCCGGGTTAGCGGCCCGTAATGCAGCAACGCGTGCGGCTATTAGTTTATCCAGCTCAGGGTTACTGACCGCCAGATTGCTCCCGCCAGAAGCCTGTGGATTATAGGGCATTTCTGCCGTTGCCGACGGGCGACCATGAAAATAGCCGTTGCCGGTAAAATTCTGCCCGATTAATGCCGAACCGCGCACCGTATCACCTTCACGAATCAACGAACCATTGGCCTGCCAGGAAACCACCATTGCCCCAGTACGGTGGTCAGCAGCGGGTAAACGCCGCCAGTAATCAATAACAGAAAGATAAATGTTGATAATGCCGGACGTAATCCACTCATGGTAAACCTCACCAGACCGCAAACGGTCAGCAGTAAATCAATGACTTTGATACCGATAAACGGCACCAGCAGCCCACCCAGACCGTAAATCCATAAGTTACGGCGCAACATGGCAGAAGCGGTAAGCGGTTTATAACTCACGCCTTTTAACGCCAGGGGAATCAAAGACGATAATCAAGGCGTTGAAAATCACCGCACTGAGGATTGCGGAGTCGGGCGAATGCAGGCACATGATGTTCAGCGCATTTAACTGCGGATACGTTGCCGCGAATGCCGCCGGAATAATGGCGAAGTATTTCGCCACATCGTTGGCAATGCTGAAGGTGGTCAGCGAGCGGTCATCAGCATCTGTTTGCCAATGTGCACCACCTCGATCAACTTGGTCGGGTTAGAGTCGAGATCGACCATATTGCCCGCCTCTTTCGCCGCCTGGGTGCCGGAGTTCATCGCCACCGCGACATCTGCCTGCGCCAGCGCCGGAGCATCGTTGGTGCCGTCGCCGGTCATCGCTACCAAACGACCTTCCGCCTGATACTGACGGATCAATGCCAGCTTGGCCTCCGGTGTCGCTTCGGCGAGAAAATCATCGACACCCGCTTCCGCAGCAATCGCGGCGGCAGTCAGACGGTTATCGCCGGTAATCATCACCGTTTTAATGCCCATTTTGCGCAGCTGGGCGAAGCGCTCTTTAATACCGCCTTTGACGATATCTTTCAGCGCAATAACGCCCAGCACGAGAACCTTCCACCACCACCAGCGGCGTGGCTCCCTGACGCGCAACCTGATCGACTTTTTGATCAACATCGGTAGGGAAGTGACCACCGTTAGCCTCAACATGGCGACGAATGGCATCGACAGAACCTTTACGGATCATGCGGTTGTCGATGTTGATCCCGCTCATCCGGCTTTGCGCAGTAAACGGTACAAAGGTGGCATGGAGCGACTGCATCGCGCTCGCGCAGGTTAAAACGCTGCTTGGCGAGGATCACAATACTGCGGCCTTCCGGCGTTTCATCAGCCAGCGAAGCCAGTTGTGCGGCGTCAGCCAGCGTTTTCATCCACGCCCTGCGCGGGGATAAACTCCGACGCCTGACGGTTACCGAGTGTGATGGTGCCGGTTTTATCCAGTAGCAGAACGTCAACGTCACCTGCCGCTTCAACTGCACGTCCGCTGGTGGCAATCACATTCGCGCCTAGCATCCGGCTCATCCCGGCGACGCCGATCGCTGACAACAGGCCGCCAATAGTGGTTGGGATCAGACAGACCAGCAGCGCCACCAGTACCGTTACGCTGACTGCATTACCGCCCACGCGGAAAACGGCCACAGCGTGGCGGTTGCCAGTAAAAAGACGATAGTCAGGGCAATCAGCAGAATGGTCAGGGCAATTTCGTTCGGCGTTTTGCGTCGCTGTGCGCCTTCCACCATCGCGATCATCCGATCCAGAAATGTCTCGCCGGGGTTAACGCTACACTCAATCACCAGCCAGTCAGAAAGAATACGCGTGCCGCCGGTGACGGAGGCAAAATCGCCGGATTCACGGATCACCGGTGCCGATTCCCCGGTGATGGCGCTTTCATCGACCGATGCACCTTCAATAACTTCACCATCGCAGGGGATAATATCGCCAGCTTCTACCAGTACGATATCGCCTTTACGAAGTTGGTCGGCAGGAACTTTGTCCGCCGCAGCGCCATATTTCGGCTCACGCAGCTTGCGGGCAAAGGCAGTTTTTCACCCTTTCAGACTGTTGGCCTGCGCTTTACTGCGGCCTTCTGCCAGCGCCTCGGCGAAATTAGCGAACAGTACGGTGATCCACAGCCAACCGCTAATGGCCGCGCTAAACAGCGCATTGCCGGGCATCGCACCGCTTGCCATCGCGATGCTAATACAGGTGGTCAGCAGACTGCCGATCCAGACGATAAACATCACCGGATTGCGCCATTGCGCCTGCGGGTTTAATTTTTCACCGCTTCTTTCAGCGCCTGAACGACAAGTGTTGGTTCGAATAGCGCCAGTTGTTTACGACTCATATTCAGTGCTCACTCAATATCATCAGGAGAGATATTCCGCCACCGGACCAGGCGCAGGGATAAAGGTCAGTGCGCCAACCAGCAACACGGTGCCGATTAACAGGCCAACAAACAGCGGGCCGTGCGTTGGCAGCGTGCCGGAGCTGGCGGCTTGGCTCTTTTACTCACCAGCGAACCGGCAATTGCCATCACCGGGATAATCACCCCGAAGCGACCGACAAACATGCAGAACGCCAGTAAACAGTTCCAGAACGGAGAGTTGGCGCTTAATCCGGCAAAGGCGCTGCCGTTGTTGTTAGCGGCGGATGACACGGCGTACAGCACTTCGCTAAAACCATGCGGGCCAGGGTTGAGCATGGCGCTACGTCCGGCGTCGGTCATCATCGCCAACGCCGCGCCCATCAGCACCAGCGTCGGGGTAACCAGAATTGCCAGTGCAGTCAGTTTCATCTCGCGTACGTCGATTTTTTACCCAGATATTCCGGTGTACGACCAATCATCAGCCCGGCAATAAACACCGCCAGCAGGACAAACAGCATCATGCCGTAAAGACCAGAACCGACACCGCCGAACACCACTTCACCAATTTGCATCAGCCACATCGGCACCATGCCACCGAGAGCGGTAAACGAATCATGCATCGCAATCACCGCGCCACAGGAAGCCGCCGTCGTCACGACCGCAAACAGGCTACTGACCAGCACGCCGAAACGGCTCTCTTTACCTTCCATATTGATGCTGCTGTCCGTGCCCAGTGCCAGCAGATGAGGATTACCCTGAACTTCTGCCCACATCACCACGCCTACGCAGATGACAAAATCACTGACATCGCCCACAGCAACATGCGCCCCTGGCGGCGATCGCCCATCACTTCACCAAAGGCAAAGCACAGCGCCGTTGGGATCAAGAAGATCGCCAGCATCTGCACGAAGTTGGTCAGTGCGGTTGGGTTTTCAAACGGATGCGACGAGTTGGCATTAAAGAAGCCACCGCCGTTAGTACCGAGCATCTTGATCGCTTCCTGAGAAGCTACAGGCCCCATGGGTAACAGCTGTTGCGCTCCTTCAACGGTATTCACAGCCTGATAAGGCAGAAAGTTTTGCAGCGCACCTTGTTGAATAAAAACAGTGCAATCAACAACGCCACAGGGACTAGCACCCATAACGTGATGCGTAGCAGATCGACCCAGGCATTCCCGAGCGTGCTCATGCTCTGGCGGGTAAACGCACGGATGAGGGCAAAATCACCGCAATCCCGCTGGCGGCAGAAAGAAAGTTTTGCACCGTTAAGCCCGCCATCTGGCTGAAATAGCTCAACGTGGTTTCACCGCTATAAGATTGCCAGTTGGTATTGGTGACAAAGCTGACGGCGGTATTCAGCGCCAGATCCCACGACAGCCCTGGCAACTGCTGTGGATTAAGCGGCAGATAGTGCTGACCGAGCAACATAAAAACAGCACCGCCAGCCCCAGCATGTTCAGGCCGAGAATGGCACAAAGATATTGCTTCCAGTTCATCTCACGGTCAGAGACGCCAAGTGCGCGAAAAGTACGCGCTCAACGCCCGTTGTACCGGGAAGAGGAATGTCATTAATCAGCCGCGCCAGCCCGCTGCCTAAAGGACGCGCCAGCACCATTAACACCAGTAAAAACGTGGCGATCAGTAAGAACCCTTGCGCAGCCATCAGAACGCCTCCGCATTGATCAGGGCATAAACCAGATAACCCAGTAATAAAACACCAGCAATACGCCGGTTATCACGCCTGCACTCACAGTGCACCTCCAGTGGCCTAAAAGTGATACCGGAAGGGTAGAATTCTGGCTGCAAAGATTTCGCAAAATCTGCGGGCGGGGTGTAAAAGTATAAAAATGGCAAAAGCCATGATTTAACTAATGTTTAGTATTAATTTAACTTTTGTGTAACTTAATTACAGGATGAATGTAAATAAACCATCAATAAGCAAAAATAAGTGGTCGGATGAGTAGTAAAATTACACAAAAGGCGGTACTATTTTCATCAGATAAACAAATTCATTTTTCCGGTGCCATTCACCGGGTAGATACAAAGGGGAGAAAAGTATGGAACTCTACAGAGAATATCCTGCATGGCTTATCTTTTTACGCCGTACTTATGCGGTTGCAGCGGGCGTTCTGGCGCTGCCTTTCATGCTTTTCTGGAAAGACCGCGCCCGCTTTTACAGCTACCTGCATCGCGTCTGGTCGAAAACCAGCGATAAACCGGTGTGGATGGATCAGGCCGAAAAGGCAACTGGTGATTTTATTGATTGCTGAGTTTTGAATACATTGAAAACCGCCAGCGGAAACGCTGGCGGTTTTTATCAGGAAGATGTTCAGAGGAATATTTAGACATCGTTATACCAATCGAAACATATATTCATGAAATATATATAAATATTTTCCTAATTGTTCTTATCTGACAGATATCTCACTTAAGGCTTTCTTATAAATCTGTAGGGTTTCGCCTGTCAGCAGACAAATAACCCGATAAAACAAGGATGAGCAGATGAGCGGAAAACCGGCGGCGCGTCAGGGCGACATGACGCAGTATGGCGGTAGCATTGTCCAGGGTTCAGCCGGGGTACGCATCGGTGCCCCACCGGCGTGGCCTGTTCGGTGTGCCCCGGCGGTGTGACGTCCGGCCATCCGGTCAATCCGCTGCTCGGTGCAAAGGTCCTTCCCGGTGAAACCGACATCGCCCTGCCCGGCCCGCTGCCGTTCATTCTCTCCGCACCTACAGCAGTTACCGGACAAAACGCCCGCGCCGGTGGGGAGCCTCGGCCCCGGCTGGAAAATGCCTGCGGATATCCGCTTACAGCTGCGCGATAACACACTGATACTCAGTGATAACGGCGGCAGAAGCCTGTATTTTGAGCACCTGTTTCCCGGTGAGGACGGTTACAGCCGCAGCGAGTCACTGTGGCTGGTGCGCGGCGGCGTGGCGAAACTGGATGAAGGTCACCGGCTGGCCGCACTCTGGCAGGCGCTGCCGGAAGAACTCCGCTTAAGTCCGCATCGTTATCTGGCGACAAACAGTCCGCAGGGGCCGTGGTGGCTGCTCGGCTGGTGTGAGCGGGTGCCGGAAGCGGATGAGGTGCTGCCTGCGCCGCTGCCGCCGTACCGGGTACTGACCGGGCTGGTGGACCGCTTCGGGCGCACACAGACGTTCCACCGCGAAGCCGCCGGTGAATTCAGCGGCGAAATCACCGGCGTGACGGATGGTGCCGGGCGTCACTTCCGGCTGGTACTGACCACGCAGGCGCAGCGGGCAGAAGAAGCCCGGCAGCAGGCCATTTCCGGCGGGACGGAACCGTCCGCTTTTCCTGATACCCTGCCGGGTTACACCGAATATGGCCGGGACAACGGCATCCGTCTGTCTGCCGTGTGGCTGACGCACGACCCGGAATACCCGGAGAATTTACCTGCCGCGCCGCTGGTGCGCTATGGCTGGACGCCCGCGGCGAACTGGCGGCGGTGTATGACCGCAGCAATACACAGGTGCGCAGCTTTACTTACGATGATAAATACCGGGGCCGGATGGTGGCGCACCGTCACACGGGCCGACCGGAAATCTGTTACCGTTACGACAGCGACGGGCGGGTGACAGAACAGCTAAACCCGGCAGGCTTAAGTTACGTATCAGTATGAGGACCGCATCACCATCACCGACAGCCTGAACCGCCGTGAAGTCCTGCACACGCAGGGTGAAGGCGGGCTGAAGCGGGTGGTGAAAAAGGAACGCGGACGGCAGCGTCACGCAGAGTCAGTTTGACGCGGTGGGCAGGCTCAGGGCACAGACGGATGCCGCAGGCAGGACAACAGAATACAGTCCGGATGTGGTGACGGGCCTCATCACGCGCATCACCACGCCGGATGGCAGGGCATCGGCGTTTTACTATAACCACCACAGCCAGTTAACGTCAGCCACCGGGCCTGACGGGCTGGAAATACGCCGGGAATATGATGAATGGGGCCGTCTGATTCAGGAAACTGCCCCTGACGGCGATATCACCCGCTACCGTTATGATAATCCACAGTGACTTACCCTGCGCAACGGAAGATGCCACCGGCAGCGGAAAACCATGACGTGGAGCCGTTACGGTCAGTTGCTGAGCTTCACTGACTGTTCCGGTTATGTAACCCGCTATGACCATGACCGTTTTGGTCAGGTGACGGCGGTGCACCGCGAGGAAGGGCTGAGTCAGTACCGCGCATACGACAGCCGTGGACAGTTAATTGCCGTGAAAGACACGCAGGGCCATGAAACGCGGTATGAATACAACGCCGCCGGTGACCTGACCACCGTCATTGCCCCGGACGGCAGCAGAAACGGGACACAGTACGATGCGTGGGGAAAAGCCATCTGTACCACGCAGGGCGGTCTGACGCGCAGTATGGAATACGATGCTGCCGGACGGGTCATCCGCCTGACCAGTGAAAACGGCAGCCACACCACCTTCCGTTACGATGTACTCGACCGGCTGATACAGGAAACCGGCTTTGACGGCCGCACACAGCGTTATCACCACGACCTGACCGGCAAACTTATCCGCAGCGAGGATGAGGGCTGGTCACCCACTGGCACTATGACGAAGCAGACCGCCTCACGCACCGTGAATGGCGAAACCGCAGAGCGGTGGCAGTATGACGAACGCGGCTGGCTGACAGACATCAGCCATATCAGCGAAGGGCACCGGGTGACGGTGCACTATGGTTATGACAGTAAAGGCCGCCTCGCCAGTGAACACCTGACGGTGCATCATCCGCAGACGAATGAACTGCTCTGGCAGCATGAGACCAGACATGCGTACAACGCACAGGGACTGGCGAACCGCTGTATACCGGACAGCCTGCCCGCCGTGGAATGGCTGACCTACGGCAGCGGCTGGCTGTCAGGCATGAAACTCGGCGACACACCGCTGGTGGAGTACACCCGCGACCGCCTGCACCGGAAACGCTGCGCAGCTTCGGCCGTTATGAACTCACCACCGCTTATACCCCTGCCGGGCAGTTACAGAGCCAGCACCTGAACAGCCTGCTGTCTGACCGCGATTACACCTGGAACGACAACGGCGAACTCATCCGCATCAGCAGCCCGCGCGCCAGGAGTTACAGCTACAGCACCACCGGCAGGCTGACCGGCGTTCACACCACCGCAGCGAATCTGGATATCCGCATCCCGTATACCACAGACCCGGCAGGTAACCGCCTGCCCGACCCGAGCTGCACGGACAGCGCCCTCAGCATGTGGCCGGATAACCGTATCGCCCGTGACGCGCACTATCTTTACCGGTATGACCGTCACGGCAGGCTGACAGAGAAAACGACCTCATCCCGGAAGGGTTATCCGCACGGATGATGAGCGCACCCACCGGTACCATTACGACAGTCAGCACCGGCTGGTGCACTACGCGGACACAATATGCAGAGCCGCTGGTCGAAAGTCGCTATCTTTACGACCCGCTGGGCCGCAGGGTGGCAAAACGGGTATGGCGGCGTGAACGGGACCTGACGGGCTGGATGTCGCTGTCACGGAAACCGCAAGTGACCTGGTACGGCTGGGACGGCGACCGCCTGACCACGATACAGAACGACAGAACCCGCATCCAGACGATTTATCAGCCGGGGAGCTTCACGCCACTCATCAGGGTTGAAACCGCCACCGGTGAGCTGGCGAAAACGCAGCGCCGCAGCCTGGCGGATACCCTTCAGCAGTCCGGTGGCGAAGACGGTGGCAGTGTGGTGTTCCCGCCGGTGCTGGTGCAGATGCTCGACCGGCTGGAAAGTGAAATCCTGGCTGACCGGGTGAGTGAGGAAAGCCGCCGCTGGCTGGCATCGTGCGGCCTGACGGTGGCGCAGATGCAAAGCCAGATGGACCCGGTATACACGCCGGCGCGAAAAATTCACCTGTACCACTGCGACCATCGCGGCCTGCCGCTGGCCCTTATCAGCACGGAAGGGACAACAGCGTGGTACGCAGAATACGATGAATGGGGTAACCTGCTGAATGAAGAGAACCCGCATCAGCTGCAGCAGCTTATCCGCCTGCCGGGGCAGCAGTATGATGAGGAGTCCGGCCTGTATTACAACCGCCACCGCTATTATGACCCGCTGCAGGGGCGATATATCACTCAGGATCCGATTGGGCTGAAAGGGGATGGAATTTTATCAGTATCCGTTGAATCCGATCTCAAATATAGATCCATTAGGATTAGAAACACTAAAATGCATTAAGCCACTGCATTCAATGGGCGGAACTGGTGAAAGAAGCGGTCCAGATATATGGGGAATCCGTTCTATCATCAATATCTTTGTGTCCCAGATGGTAAAGGGACTATACTTGTGGTGGCCAAGACCAACGGGGAGAATCAAAGGAGATGGTCTATGGGGGCCAGGTAAAGCAAGTAATGATACAAAGAAGCTGCTGGCCGTTGTGACCTCGTTGAAACCGATAATAGTTGTGTGGAGAACTGTTTAAAGGAAGTTTAAAGAGGTAAGGCCGCGTTATTCTGTATTGCCTGATATATTCACCTATAAATTTAGGGCTATTTAAAACTGCCAAGACTGGTCTAATGATTCTTTAGAAACATGTAAGATGAAGTGCTCCGGAAATAACATTGGACGTTTTATTAGATTTGTATTCACCGGAGTGATGTAATGAAATATATTATTTTTTATTCAGAGCTATATGGCTGGCTTTATCGCTTTTAATACTATTCTTTTCCATGCATAGACTTTCACTATTAGACTCCACTCGTGATGTGAGCGAGTTAATTAGTCTCATGTCTTATGGAATGATGGTAATATGTTTTCCAACAGGCATAGTATTCTTTATTGCTCTAATATTTATAGGGACTGTATCAGACATTATTGGCGTAAGGATTGATAGTAAGTATATTATGGCGATAATAATATGGCTTTATTTTCTGTCAGGAGGGTATATTCAATGGTTTGTATTAAGTAAGCGCATTATAAACAAATAAATTAAGTTAATTGCTCTTATTATTATATGTAACCTGGGCATTGATATCCCGTATGCCACAGACCCGCGAGGTAACCGCCTGCCCGACCCGAGCTGCACCCGGACAGCACCCTCAGCATGTGGCCGGATAACCGTATCGCCCGTGACGCGCACTATCTTTACCGGTATGACCGTCACGGCAGGCTGACGGAGAAAACCTCATCCCGGAAGGGTTATCCGCACGGATGATGAGCGCACCCACCGGTACCATTACGACAGTCAGCACCGGCTGGTGCACTACGCGGACACAATATGCAGAGCCGCTGGTCGAAAGCCGCTATCTTTACGACCCGCTGGGCCGCAGGGTGGCAAAACGGGTGTGGCGACGTGAACGGGACCTGACGGGCTGGATGTCGCTGTCACGGAAACCGCAAGTGACCTGGTACGGCTGGGACGGCGACCGCCTGACCACGATACAGAACGACAGAACCCGCATCCAGACGATTTATCAGCCGGGGCTTCACGCCACTCATCAGGTTGAAACCGCCACCGGTGAGCTGGCGAAAACGCAGCGCCGCAGCCTGGCGGATACCCTTCAGCAGTCCGGCGGCGAAGACGGTGGCAGTGTGGTGTTCCGCCGGTGCTGGTGCAGATGCTCGACCGGCTGGAAAGTGAAATCCTGGCTGACCGGGTGAGTGAGGAAAGCCGCCGCTGGCTGGCATCGTGCGGCCTGACGGTGGAGCAGATGCAAAACCAGATGGACCCGGTGTACACGCCGGCGCGAAAAATCCACCTGTACCACTGCGACCATCGCGGCCTGCCGCTGGCGCTTGTCAGCACGGAAGGGGCAACAGAATGGTGCGCAGAATACGATGAATGGGGCAACCTGCTGAATGAAGAGAACCCGCATCAGCTGCAGCAGCTTATCCGCCTGCCGGGGCAGCAGTATGATGAGGAGTCCGGCCTGTATTACAACCGCCACCGCTATTATGACCCGCTGCAGGGGTATATCACTCAGGATCCGATTGGGCTGAAGGGGATGGAATTTTATCAGTATCCGCTGAATCCGGTTCAGTATATAGATTCAATGGGACTGGCATCAAAATATGGACACTTAAATAATGGCGGATATGGGCGAGACCCAACAAACCGCCTACGCCCGATCCAAGTAAATTGCCGGACATAGCGAAACAATTAAGACTGCCATATCCTATTGACCAGGCCAGTAGTGCGCCTAATGTTTTCAAAACATTCTTCAGAGCATTAAGCCCTTACGACTACACTGTATTGCAGGAAGTGGGTAAAACCAAATCTGACTTGTACGCCACAGGATGATTCCCAGTATCCAGGGATGGATACAAAGACAGCAAGTGATTACCTGCCACAGACAAATTGGCCAACAACTCAATTACCACCAGGATATACTTGTGCAGAACCCTATTTATTCCCAGACATTAATAAACCCGATGGGCCAGCAACAGCAGGGATAGATGATTTGGGTGAAATTTTAGCTAAGATGAAACAGAGAACATCGAGAGGTAGAAAAAATGAAAAGAGTTTTGTTCTTTTTGCTGATGATATTTGTTAGTTTTGGTGTTATAGCTGATTGCGAAATACAAGCTAAAGATCATGATTGTTTTACTATTTTCGCTAAAGGGTACTATTTTTTCGCGTTTCCTGTCTTAAATAATAAAGCCATGTGGAGATGGTATCAGAATGAGGACATCGGTGAGTATTATTGGCAAACAGAACTGGGTACATGTAAAAATAATAAATTCCACCAAGCGGGCGAGACTCTTAATTCGCGTCGGGTCACTACGCCTTAATGAAAATCATGCCATCAAAGGAACGTTGCAGGAGTTGATAAATACAGCAGAAAAAACGGCGTTTCTCGGCGATCGGTTTAGAAGTTATATATAGAGCGATTATCTATCAAAAGAGCAGTGATCCAGTTCAGTTGTTGGCAGTCCTTGATAATTCAATCATGGTAAAATATTTTAAAGATGAGAAACCAACTTATGCTCGAATGACGGCACATCTCCCGAACAAAATGAGTCTTACAGATGTTTAATAAAGATACAGCATGAACTAATTCATAGTGAAGAGAAATAAAAA
+>f20007a8-a22e-47c3-87d7-7c0f9744f792 id=51 clr=0,2713
+TTCGTGCTTACAGGTTTACGTATTGCTTTTCTGTTGGTGCTGATATTGCGGCGTCTGGCGGGTGACAACCGCGTTGGTGTTCGCTGGCAGTGGGCAGGCGCGGCTGTCATGGGCATAGTGCACCGATGCCCGGTGCCCTTCGCTGATATGGCGATGTCTGTCAGCCAGCCGCGTTCGTCATACTGCCACCGCTCTGCGGTTTCGCCATTCACGGTGCGGTGCGTGAGGCGGTCTGCTTCGTCATAGTACTGGTGGGTGACCAGCCCTCATCCTCGCTGCGGATAAGTTTGCCGGTCAGGTCGTGGTGATAACGCTGTGTGCGGCCGTCAAAGCCGGTTTCCTGTATCAGCCGGTCGAGTCGTAACGGAAGGTGGTGTGGCTGCCGTTTTCACTGGTCAGGCGGATGACCCGTCCGGCAGCATCGTATTCCATACTGCGCGTCAGACCGCCTGCGTGGTACAGATGGCTTTTCCCCACGCATCGTACTGTGTCCATTTCTGCTGCCGTCCGGGGCAATGACGGTGGTCAGGTCACCGGCGGCGTTGTCATACCGCGTTTCATGGCCCTGCGTGTCTTTCACGGCAATTAACTGTCCACGGCTGTCGCATGCGCGGTACTGACTCAGCCCTTCCTCGCGGTGCACCGCCGTCACCTGACCAAAACGGTCATGGTCATAGCGGGTTACATAACCGGAACAGTCAGTGAAGCTCAGCGCAACTGACCGTAACGGCTCCACGTCATGGTTTTCCGGCTGCCGGTGGCATCTTCCGTTGCGCAGGGTAAGTCTGTGTGGATTATCATAACGGTAGCGGGTGATATCGCCGTCAGGGGCAGTTTCCTGAATCAGACGGCCCCATTCATCATATTCCTGCGTATTTCCAGCCCGTCAGGCCCGGTGGCTGACGTTAACTGGCTGTGGTGGTTATAGTAAAACGCCGATGCCCCTGCCATCCGGCGTGGTGATGCGCGTGATGAGGCCCGTCACCACATCCGGACTGTATTCTGTTGTCCTGCCTGCGGCATCCGTCTGTGCCCTGAGCCTGCCCACCGCAAACTGACTCTGCGTGACGCTGCCGTCCGCGTGTTCCTTTTCACCACCCGCTTCAGCCCGCCTTCACCCTGCGTGTGCAGGACTTCACGGCGGTTCAGGCTGTCGGTGATGGTGATGCGGTCCTCTCATACTGATACGATATTAACCGGCCTGCCGGGTTTAGCTGTTCTGTCACCCGCCCGTCGCTGTCGTAACGGTAACAGATTTCCGGTCGGCCCGTGTGACGGTGCGCCACCATCCGGCCCCGGTATTTATCATCGTAAGTAAAGCTGCGCTGTATTGCTGCGGTCATACACGCCGCCAGTTCGCCGCGGGGCGTCCAGCCATAGCGCACCAGCGGCGCGGCAGGTAAATTCTCCGGGTATTCCGGGTCGTGCGTCAGCCACGGCAGCGACAGAGATGCCGTTGTCCCGACCATATTCGGTGTAACCCGGCAGGGTATCAGGAAAACGGACGGTTCCGTCCGCCGGAAATGGCCTGCTGCCGGGCTTCTTCTGCCCGCTGCGCCTGCGTGGTCAGTACCAGCCGGAAGTGACGCGGCACCATCCGTCACCCGGTGATTTCGCCGCTGAATTCCGGCGGCTTCGCGGTGGAACGTCTGTGTGCGCCCGAAGCGGTCCACCAGCCCGGTCAGTACCCGGTACGGCGGCAGCGGCGCAGGCAGCACCTCATCCGCTTCCGGCACCCGCTCACACCAGCCGAGCAGCCACCACGGCCCCTGCGGACTGTCGCCAGATAACGATGCGGACTTAAGCGGAGTTCTTCCGGCAGCGCCTGCCAGAGTGCGCGCCAGCCGGTGACCTTCATCCAGTTTCGCCACGCCGCCGCGCAGCCACAGTGACTCGCTGCGGCTGTAACCGTCCTCACCGGGAAACAGGTGCTCAAATACAGGCTTCTGCCGCCGTTATCACTGAGTATCAGTGTGTTATCGCGCAGCTGTAAGCGGATATCCGCAGGCATTTTCCAGCCGGGGCCGAGGCTCCCACCGGCGCGGGCGTTTTGTCCGGTAACTGTAGGTGCGGGAGAGAATGAACGGCAGCGGGCCGGGCAGGGCGATGTCGGTTTCACCGGGAAGGACCTTTGCACCGAGCAGCGGATTGACCGGATGGCCGGACGTCACCGCCGCCGGGCACACCGAACAGGCGCCGGTGGGGCACCGATGCGTACCCCGGCTGAACCCTGGGACAATGCTACGCCATACTGCGTCATGTCGCCCTGACGCGCCGCCGGTTTTCCGCTCATCTGCTCATCCTTGTTTTATCGGGTTATTTGTCTGCTGACGGCGAAACCCTGGGATTTAAAGCAACAAGTGAGATATCTGTCAGATAAGAACAATTGGAAAATATTTATATATATTTCATGAATATATGTTTCGATTGGTATAACGATAAAATGTTCCTGCTGAACATCTTCCAATGCACAAAACCATGACGGCGTTTCCGCTGGCGGTTTTCAATATTCAAACTCAACAATCAATAAAATCACCAGTTGCCTTTCGGCCTGATCCATCCGCACCGGTTTATCGCTGGTTTTCGACCAGACGCGGAATGCCGTGGCACAAAGAAAGCGGGACGCAGTCTTTCCCAGAAAAGCATGAAAGGCAACCGGAACGCCCGCGCTGCGGGTTTATTTAAACAGACGCCGAAGACGAAGAAGAGGGGG
+>c2ba4328-d217-4343-a959-874cf5addce4 id=52 clr=0,7233
+GAAGTGACGCCCGGCACCATCCGTCACGCCGGTGATTTCGCCGCTGAATTCACCGGCGGCTTCGCGGTGGAACGTCTGTGTGCGCCCGAAGCGGTCCACCAGCCCGGTCAGTACCCGGTACGGCGGCAGCGGCGCAGGCAGCACCTCATCCGCTTCCGGCACCCGCTCACACCAGCCGAGCAGCCACCACGGCCCCTGCGGACTGTTTGTCGCCAGATAACGATGCGGACTTAAGCGGAGTTCTTCCGGCAGCGCCTGCCAGAGTGCGGCCAGCCGGTGACCTTCATCCAGTTTCGCCACGCCGCCGCGCACCAGCCACAGTGACTCGCTGCGGCTGTAACCGTCCTCACCGGGAAACAGGTGCTCAAAATACAGGCTTCTGCCGCCGTTATCACTGAGTATCAGTGTGTTATCGCGCAGCTGTAAGCGGATATCCGCAGGCATTTTCCAGCCGGGGCCGAGGCTCCCCACCGGCGCGGGCGTTTTGTCCGGTAACTGCTGTAGGTGCGGGAGAGAATGAACGGCAGCGGGCCGGGCAGGGCGATGTCGGTTTCACCGGGAAGGACCTTTGCACCGAGCAGCGGATTGACCGGATGGCCGGACGTCACCCGCCGGGGCACACCGAACAGGCCACGCCGGTGGGGCACCGATGCGTACCCCGGCTGAACCCTGGACAATGCTACCGCCATACTGCGTCATGTCGCCCTGACGCGCCGCCGGTTTTCCGCTCATCTGCTCATCCTTGTTTTATCGGGTTATTTGTCTGCTGACAGGCGAAACCCTACAGATTTATAAGAAAGCCTTAAGTGAGATATCTGTCAGATAAGAACAATTAGGAAAATATTTATATATATTTCATGAATATATGTTTCGATTGGTATAACGATGTCTAAATATTCCTCTGAACATCTTCCTGATACAAAAACCGCCAGCGTTTCCGCTGGCGGTTTTCAATGTATTCAAACTCAGCAATCAATAAAATCACCAGTTGCCTTTTCGGCCTGATCCATCCACACCGGTTTATCGCTGGTTTTCGACCAGACGCGATGCAGGTAGCTGTAAAGCGGGCGCGGTCTTTCCAGAAAAGCATGAAAGGCAGCGCCAGAACGCCCGCTGCAACCGCATAAGTACGGCGTAAAAAGATAAGCCATGCAGGATATTCTCTGTAGAGTTCCATACTTTTCTCCCTTTTGTATCTACCCGGTGAATGGCACCGGAAAAATGAATTTGTTTATCTGATGAAAATAGTACCGCCTTTTGTGTAATTTTACTACTCATCCGACCACTTATTTTTGCTTATTGATGGTTTATTTACATTCATCCTGTAATTAAGTTACACAAAAGTTAAATTAATACTAAACATTAGTTAAATCATGGCTTTTGCCATTTTTATACTTTTTACACCCCGCCCGCAGATTTTGCGAAATCTTTGCAGCCAGAATTCTACCCTTCCGGTATCACTTTTAGGCCACTGGAGGTGCACTGTGAGTGCAGGCGTGATAACCGGCGTATTGCTGGTGTTTTATTACTGGGTTATCTGGTTTATGCCCTGATCAATGCGGAGGCGTTCTGATGGCTGCGCAAGGGTTCTTACTGATCGCCACGTTTTTACTGGTGTTAATGGTGCTGGCGCGTCCTTTAGGCAGCGGGCTGGCGCGGCTGATTAATGACATTCCTCTTCCCGGTACAACGGGCGTTGAGCGCGTACTTTTCGCGCACTTGGCGTCTCTGACCGTGAGATGAACTGGAAGCAATATCTTTGTGCCATTCTCGGCCTGAACATGCTGGGGCTGGCGGTGCTGTTTTATGTTGCTCGGTCAGCACTATCTGCCGCTTAATCCACAGCAGTTGCCAGGGCTGTCGTGGGATCTGGCGCTGAATACCGCCGTCAGCTTTGTCACCAATACCAACTGGCAATCTTATAGCGGTGAAACCACGTTGAGCTATTTCAGCCAGATGGCGGGCTTAACGGTGCAAAACTTTCTTTCTGCCGCCAGCGGGATTGCGGTGATTTTGCCCTCATCCGTGCGTTTACCCGCCAGAGCATGAGCACGCTCGGGAACCTGGGTCGATCTGCTACGCATCACGTTATGGGTGCTAGTCCCTGTGGCGTTGTTGATTGCACTGTTTTTATTCAACAAGGTGCGCTGCAAAACTTTCTGCCTTATCAGGCTGTGAATACCGTTGAAGGAGCGCAACAGCTGTTACCCATGGGGCCTGCTTCTCAGGAAGCGATCAAGATGCTCGGTACTAACGGCGGTGGCTTCTTTAATGCCAACTCGTCGCATCCGTTTGAAAACCCAACCGCACTGACCAACTTCGTGCAGATGCTGGCGATCTTCTTGATCCCAACGGCGCTGTGCTTTGCCTTTGGTGAAGTGATGGGCGATCGCCGCCAGGGGCGCATGTTGCTGTGGGCGATGTCAGTGATTTTGTCATCTGCGTAGGCGTGGTGATGTGGGCAGAAGTTCAGGGTAATCCTCATCTGCTGGCACTGGGCACGGACAGCAGCATCAATATGGAAGGTAAAGAGAGCCGTTTCGGCGTGCTGGTCAGTAGCCTGTTTGCGGTCGTGACGACGGCGGCTTCCTGTGGCGCGGTGATTGCGATGCATGATTCGTTTACCGCTCTCGGTGGCATGGTGCCGATGTGGCTGATGCAAATTGGTGAAGTGGTGTTCGGCGGTGTCGGTTCTGGTCTTTACGGCATGATGCTGTTTGTCCTGCTGGCGGTGTTTATTGCCGGGCTGATGATTGGTCGTACACCGGAATATCTGGGTAAAAATCGACGTACGCGAGATGAAACTGACTGCACTGGCAATTCTGGTTACCCCGACGCTGGTGCTGATGGGCGCGGCGTTGGCGATGATGACCGACGCCGGACGTAGCGCCATGCTCAACCCTGGCCCGCATGGTTTTAGCGAAGTGCTGTACGCCGTGTCATCCGCCGCTAACAACAACGGCAGCGCTTTGCCGGATTAAGCGCCAACTCTCCGTTCTGGAACTGTTTACTGGCGTTCTGCATGTTTGTCGGTCGCTTCGGGGTGATTATCCCGGTGATGGCAATTGCCGGTTCGCTGGTGAGTAAAAAGCCAAGCCGCCAGCTCCGGCACGCTGCCAACGCACGGCCCGCTGTTTGTTGGCCTGTTAATCGGCACCGTGTTGCTGGTTGGCGCACTGACCTTTATCCCTGCCCTGGCGCTTGGTCCGGTGGCGGAATCTCTCCTGATGATATTGAGTGAGCACTGAATATGAGTCGTAAACAACTGGCGCTATTCGAACCAACACTTGTCGTTCAGGCGCTGAAAGAAGCGGTGAAAAATTAAACCCGCAGGCGCAATGGCGCAATCCGGTGATGTTTATCGTCTGGATCGGCAGTCTGCTGACCACCTGTATTAGCATCGCGATGGCAAGCGGTGCGATGCCCGGCAATGCGCTGTTTAGCGCGGCCATTAGCGGTTGGCTGTGGATCACCGTACTGTTCGCTAATTTCGCCGAGGCGCTGGCAGAAGGCCGCAGTAAAGCGCAGGCCAACAGTCTGAAAGGGTGAAAAACTGCCTTTGCCCGCAAGCTGCGTGAGCCGAAATATGGCGCTGCGGCGGACAAAGTTCCTGCCGACCAACTTCGTAAAGGCGATATCGTACTGGTAGAAGCTGGCGATATTATCCCCTGCGATGGTGAAGTTATTGAAGGGTGCATCGGTCGATGAAAGCGCCATCACCGGGGAATCGGCACCGGTGATCCGTGAATCCGGCGGCGATTTTGCCTCCGTCACCGGCGGCACGCGTATTCTTTCTGACTGGCTGGTGATTGAGTGTAGCGTTAACCCCGGCGAGACATTTCTGGATCGGATGATCGCGATGGTGGAAGGCGCACAGCGACGCAAAACGCCGAACGAAATTGCCCTGACCATTCTGCTGATTGCCCTGACTATCGTCTTTTACTGGCAACCGCCACGCTGTGGCCGTTTTCCGCGTGGGGCGGTAATGCAGTCAGCGTAACGGTACTGGTGGCGCTGCTGGTCTGTCTGATCCCAACCACTATTGGCGGCCTGTTGTCAGCGATCGGCGTCGCCGGGATGAGCCGGATGCTAGGCGCGAATGTGATTGCCACCAGCGGACGTGCAGTTGAAGCGGCAGGTGACGTTGACGTTCTGCTACTGGATAAAACCGGCACCATCACACTCGGTAACCGTCAGGCGTCGGAGTTTATCCCCGCGCAGGGCGTGGATGAAAAACGCTGGCTGACGCCGCACAACTGGCTTCGCTGGCTGATGAAACGCCGGAAGGCCGCAGTATTGTGATCCTCGCCAAGCAGCGTTTTAACCTGCGCGAGCGCGATGTGCAGTCGCTCCATGCCACCTTTGTACCGTTTACTGCGCAAAGCCGGATGAGCGGGATCAACATCGACAACCGCATGATCCGTAAAGGTTCTGTCGATGCCATTCGTCGCCATGTTGAGGCTAACGGTGGTCACTTCCCTACCGATGTTGATCAAAAAGTCGATCAGGTTGCGCGTCAGGGAGCCACGCCGCTGGTGGTGGTGGAAGGTTCTCGTGTGCTGGGCGTTATTGCGCTGAAAGATATCGTCAAAGGCGGTATTAAAGAGCGCTTCGCCCAGCTGCGCAAAATGGGCATTAAAACGGTGATGATTACCGGCGATAACCGTCTGACTGCCGCCGCGATTGCTGCGGAAGCGGGTGTCGATGATTTTCTCGCCGAAGCGACACCGGAGGCCAAGCTGGCATTGATCCGTCAGTATCAGGCGGAAGGTCGTTTGGTAGCGATGACCGGCGACGGCACCAACGATGCTCCGGCGCTGGCGCAGGCAGATGTCGCGGTGGCGATGAACTCCGGCACCCAGGCGGCGAAAGAGGCGGGCAATATGGTCGATCTCGACTCTAACCCGACCAAGTTGATCGAGGTGGTGCACATTGGCAAACAGATGCTGATGACCCGTGGCTCGCTGACCACCTTCAGCATTGCCAACGATGTGGCGAAATACTTCGCCATTATTCCGGCGGCATTCGCGGCAACGTATCCGCAGTTAAATGCGCTGAACATCATGTGCCTGCATTCGCCCGACTCCGCAATCCTCAGTGCGGTGATTTTCAACGCCTTGATTATCGTCTTTGATTCCCCTGGCGTTAAAAGGCGTGAGTTATAAACCGCTTACCGCTTCTGCCATGTTGCGCCGTAACTATGGATTTACGGTCTGGGTGGGCTGCTGGTGCCGTTTATCGGTATCAAAGTCATTGATTTACTGCTGACCGTTTGCGGTCTGGTGTGAGTTTACCATGAGTGGATTACGTCCGGCATTATCAACATTTATCTTTCTGTTATTGATTACTGGCGGCGTTTACCCGCTGCTGACCACCGTACTGGGGCAATGGTGGTTTCCTGGCAGGCCAATGGTTCGTTGATTCGTGAAGGTGATACGGTGCGCGGTTCGGCATTAATCGGGCAGAATTTTACCGGCAACGGCTATTTTCATGGTCGCCCGTCGGCAACGGCAGAAATGCCCTATAATCCACAGGCTTCTGGCGGGAGCAATCTGGCGGTCAGTAACCCTGAGCTGGATAAACTAATAGCCGCACGCGTTGCTGCATTACGGGCCGCTAACCCGGATGCCAGCGCGAGCGTTCCGGTTGAACTGGTGACGGCATCGGCAAGCGGGCTGGACAATAATATCACCCGCAAGCGGCGGCCTGGCAAATCCCACGCGTGGCGAAAGCGCGTAATCTCAGCGTTGAACAGCTCACGCAACTGATCGCAAAATACAGCCAACAACCGCTGGTGAAATATATCGGCCAGCCGGTTGTCAACATTGTTGAACTCAATCTGGCGCTGGATAAACTTGATGAATAACGAACCCTTACGTCCCGACCCCGATCGTCTGCTGGAACAAACTGCCGCGCCGCATCGGGGAAGCTGAAAGTTTCTTCGGTGCCTGTGCAGGCGTCGGGAAGACCTGGGCGATGCTGGCAGAAGCCCAGCGACTGCGGGCGCAAGGGCTGGATATTGTGGTTGGCGTGGTAGAAACCCACGGGCGAAAAGATACCGCCGCCATGCTGGAAGGGCTGGCTGTTCTGCCGTTAAAACGCCAGGCGTACCGTGGGCGGCATATCAGCGAGTTTGATCTCGATGCCGCCCTCGCCCGCCGCCCGGCGCTGATCTTAATGGACGAACTGGCGCACAGTAATGCGCCAGGTTCCCGTCATCCCAAACGCTGGCAGGATATCGAAGAACTGCTGGAAGCTGGCATTGATGTTTTCACTACCGTCAACGTTCAGCATCTGGAAAGTCTGAATGATGTGGTCAGCGGCGTCACCGGAATTCAGGTACGGGAAACCGTGCCCGATCCTTTTCGATGCCGCCGACGACGTGGTGCTGGTGGACTTGCCCCGGACGATCTGCGCCAGCGGCTGAAAGAAGGCAAAGTCTATATTGCCGGGCAGGCGGAGCGCGCCATTGAACATTTTTCCGCAAAGGTAATCTGATCGCCCTGCGCGAACTGGCACTGCGCCGTACTGCCGATCGCGTTGATGAGCAAATGCGCGCCTGGCGGGGCATCCTGGCGAAGAGAAAGTGTGGCACACGCGACGCGATCCTTTTATGCATCGGCCATAACACCGGCAGCGAAAAACTGGTCGCGCAGCGGCGCGGCTGGCGTCACGGCTGGGTAGCGTCTGGCACGCGGTGTATGTTGAAACCCCTGCCCTGCACCGCTTACCGGAAAAAACGTCGGGCAATTCTCAGCGCCTTACGTCTGGCGCAGGAACTGGGCGCGGAGACGGCAACACTTTCTGATCCAGCGGAAGAGAAAGCGGTAGTGCGTTATGCCCGTGAACATAATCTCGGCAAGATTATTCTCGGTCGCCCGGCCTCGCGCCGCTGGTGGCGTCGGGAAACGTTTGCTGACCGACTGGCGCGCATCGCTGATCTCGATCAGGTGCTGGTCGCGCTTGATGAACCACCCGCCCGCACGATTAACAACGCGCCGGATAACCGCTCTTTTAAAGACAAGTGGCGTGTACAAATTCAGGGATGCGTGGTTGCCGCCGCGTTATGCGCCGTTATCACCTTAATTGCCATGCAGTGGCTGATGGCGTTGATGCCGCCAACCTGGTGATGCTGTATCTGCTTGGCGTGGTGGTGGTGGCGCTATTTTATGGACTGGTTAAACACCGTCATTACGCCGAAGATAGGCGACAGGCAAGTAGCAATACGTAACC
+>bbe44e2d-c0b1-4a30-997b-7a077a66c189 id=53 clr=0,5362
+CGGTATTGCTTCGTTCAGTTACGTATTGCGCTGCGCGCATAAACTCTATCTTCGGCGTCTGCTTGGGTGACAACCTCCGACGCCTGCCGGTTACCGAGTGTGATGGTGCCGGTTTTATCCAGTAGCAGAACGTCAACGTCACCTGCCGCTTCAACTGCGTCCGCTGGTGGCAATCACATTCGCGCCTAGCATCCGGCTCATCCCGGCGACGCCGATCGCTGACAACAGGCCGCCAATAGTGGTTGGGATCAGACAGACCAGCAGCGCCACCAGTACCGTTACGCTGACTGCATTACCGCCCCACGCGGAAAACGGCCACAGCGTGGCGGTTGCCAGTAAAAAGACGATAGTCAGGGCAATCAGCAGAATGGTCAGGGCAATTTCGTTCGGCGTTTTGCGTCGCTGTGCGCCTTCCACCATCGCGATCATCCGATCCAGAAATGTCTCGCCGGGGTTAACGCTACACTCAATCACCAGCCAGTCAGAAAGAATACGCGTGCCGCCGGTGACGGAGGCAAAATCGCCGCCGGATTCACGGATCACCGGTGCCGATTCCCCGGTGATGGCGCTTTCATCGACCGATGCACCCTTCAATAACTTCACCATCGCAGGGATAATATCGCCAGCTTCTACCAGTACGATATCGCCTTTACGAAGTTGGTCGGCAGGAACTTTGTCCGCCGCAGCGCCATATTTCGGCTCACGCAGCTTGCGGGCAAAGGCAGTTTTTCACCTTTCAGACTGTTGGCCTGCGCTTTACTGCGGCCTTCTGCCAGCGCCTCGGCGAAATTAGCGAACAGTACGGTGATCCACAGCCAACCGCTAATGGCCGCGCTAAACAGCGCATTGCCGGGCATCGCACCTTTGCCATCGCGATGCTAATACAGGTGGTCAGCAGACTGCCGATCCAGACGATAAACATCACCGGATTGCGCCATTGCGCCTGCGGGTTTAATTTTTCACCGCTTCTTTCAGCGCCTGAACGACAAGTGTTGGTTCGAATAGCGCCAGTTGTTTACGACTCATATTCAGTGCTCACTCAATATCATCAGGAGAGATATTCCGCCACCGGACCAAGCGCCAGGGCAGGGATAAAGGTCAGTGCGCCAACCAACACGGTGCCGATTAACAGGCCAACAAACAGCGGGCCGTGCGTTGGCAGCGTGCCGGAGCTGGCGGCTTGGCTCACTCACCAGAACCGGCAATTGCCATCACCGGGATAATCACCCCGAAGCGACCGACAAACATGCAGAACGCCAGTAAACAGTTCCAGAACGGAGAGTTGGCGCTTAATCCGGCAAAGGCGCTGCCGTTGTTGTTAGCGGCGGATGACACGGCGTACAGCACTTCGCTAAAACCATGCGGGCCAGGGTTGAGCATGGCGCTACGTCCGGCGTCGGTCATCATCGCCAACGCCGCGCCCATCAGCACCAGCGTCGGGGTAACCAGAATTGCCAGTGCAGTCAGTTTCATCTCGCGTACGTCGATTTTTTACCCAGATATTCCGGTGTACGACCAATCATCAGCCCGGCAATAAACACCGCCAGCAGGACAAACAGCATCATGCCGTAAAGACCAGAACCGACACCGCCGAACACCACTTCACCAATTTGCATCAGCCACATCGGCACCATGCCACCGAGAGCGGTAAACGAATCATGCATCGCAATCACCGCGCCACAGGAAGCCGCCGTCGTCACGACCGCAAACAGGCTACTGACCAGCACGCCGAAACGGCTCTCTTTACCTTCCATATTGATGCTGCTGTCCGTGCCCAGTGCCAGCAGATGAGGATTACCCTGAACTTCTGCCCACATCACCACGCCTACGCAGATGACAAAATCACTGACATCGCCCACAGCAACATGCGCCCCTGGCGGCGATCGCCCATCACTTCACCAAAGGCAAAGCACAGCGCCGTTGGGATCAAGAAGATCGCCAGCATCTGCACGAAGTTGGTCAGTGCGGTTGGGTTTTCAAACGGATGCGACGAGTTGGCATTAAAGAAGCCACCGCCGTTAGTACCGAGCATCTTGATCGCTTCCTGAGAAGCTACAGGCCCCATGGGTAACAGCTGTTGCGCTCCTTCAACGGTATTCACAGCCTGATAAGGCAGAAAGTTTTGCAGCGCACCTTGTTGAATAAAAACAGTGCAATCAACAACGCCACAGGGACTAGCACCCATAACGTGATGCGTAGCAGATCGACCCAGGCATTCCCGAGCGTGCTCATGCTCTGGCGGGTAAACGCACGGATGAGGGCAAAATCACCGCAATCCCGCTGGCGGCAGAAAGAAAGTTTTGCACCGTTAAGCCCGCCATCTGGCTGAAATAGCTCAACGTGGTTTCACCGCTATAAGATTGCCAGTTGGTATTGGTGACAAAGCTGACGGCGGTATTCAGCGCCAGATCCCACGACAGCCCTGGCAACTGCTGTGGATTAAGCGGCAGATAGTGCTGACCGAGCAACATAAAACAGCACCGCCAGCCCCAGCATGTTCAGGCCGAGAATGGCACAAAGATATTGCTTCCAGTTCATCTCACGGTCAGAGACGCCAAGTGCGCGAAAAGTACGCGCTCAACGCCCGTTGTACCGGGAAGAGGAATGTCATTAATCAGCCGCGCCAGCCCGCTGCCTAAAGGACGCGCCAGCACCATTAACACCAGTAAAAACGTGGCGATCAGTAAGAACCCTTGCGCAGCCATCAGAACGCCTCCGCATTGATCAGGGCATAAACCAGATAACCCAGTAATAAAACACCAGCAATACGCCGGTTATCACGCCTGCACTCACAGTGCACCTCCAGTGGCCTAAAAGTGATACCGGAAGGGTAGAATTCTGGCTGCAAAGATTTCGCAAAAATCTGCGGGCGGGGTGTAAAAGTATAAAAATGGCAAAAGCCATGATTTAACTAATGTTTAGTATTAATTTAACTTTTGTGTAACTTAATTACAGGATGAATGTAAATAAACCATCAATAAGCAAAATAAGTGGTCGGATGAGTAGTAAAATTACACAAAAGGCGGTACTATTTTCATCAGATAAACAAATTCATTTTTCGGTGCCATTCACCGGGTAGATACAAAGGGGAGAAAAGTATGGAACTCTACAGAGAATATCCTGCATGGCTTATCTTTTACGCCGTACTTATGCGGTTGCAGCGGGCGTTCTGGCGCTGCCTTTCATGCTTTTCTGGAAAGACCGCGCCCGCTTTTACAGCTACCTGCATCGCGTCTGGTCGAAAACCAGCGATAAACCGGTGTGGATGGATCAGGCCGAAAAGGCAACTGGTGATTTTTATTGATTGCTGAGTTTTGAATACATTGAAAACCGCCAGCGGAAACGCTGGCGGTTTTTTATCAGGAAGATGTTCAGAGGAATATTTAGACATCGTTATACCAATCGAAACATATATTCATGAAATATATAAATATTTTCCTAATTGTTCTTATCTGACAGATATCTCACTTAAGGCTTTCTTATAAATCTGTAGGGTTTCGCCTGTCAGCAGACAAATAACCCGATAAAACAAGGATGAGCAGATGAGCGGAAAACCGGCGGCGCGTCAGGGCGACATGACGCAGTATGGCGGTAGCATTGTCCAGGGTTCAGCCGGGGTACGCATCGGTGCCCCACCGGCGTGGCCTGTTCGGTGTGCCCCGGCGGGTGACGTCCGGCCATCCGGTCAATCCGCTGCTCGGTGCAAAGGTCCTTCCCGGTGAAACCGACATCGCCCTGCCCGGCCCGCTGCCGTTCATTCTCTCCGCACCTACAGCAGTTACCGGACAAAACGCCCGCGCCGGTGGGGCCTCGGCCCCGGCTGGAAAATGCCTGCGGATATCCGCTTACAGCTGCGCGATAACACACTGATACTCAGTGATAACGGCGGCAGAAGCCTGTATTTTGAGCACCTGTTTCCCGGTGAGGACGGTTACAGCCGCAGCGAGTCACTGTGGCTGGTGCGCGGCGGCGTGGCGAAACTGGATGAAGGTCACCGGCTGGCCGCACTCTGGCAGGCGCTGCCGGAAGAACTCCGCTTAAGTCCGCATCGTTATCTGGCGACAAACAGTCCGCAGGGGCCGTGGTGGCTGCTCGGCTGGTGTGAGCGGGTGCCGGAAGCGGATGAGGTGCTGCCTGCGCCGCTGCCGCCGTACCGGGTACTGACCGGGCTGGTGGACCGCTTCGGGCGCACACAGACGTTCCACCGCGAAGCCGCCGGTGAATTCAGCGGCGAAATCACCGGCGTGACGGATGGTGCCGGGCGTCACTTCCGGCTGGTACTGACCACGCAGGCGCAGCGGGCAGAAGAAGCCCGGCAGCAGGCCATTTCCGGCGGGACGGAACCGTCCGCTTTTCTGATACCCTGCCGGGTTACACCGAATATGGCCGGGACAACGGCATCCGTCTGTCTGCCGTGTGGCTGACGCACGACCCGGAATACCCGGAGAATTTACCTGCCGCGCCGCTGGTGCGCTATGGCTGGACGCCCGCGGCGAACTGGCGGCGGTGTATGACCGCAGCAATACACAGGTGCGCAGCTTTACTTACGATGATAAATACCGGGGCCGGATGGTGGCGCACCGTCACACGGGCCGACCGGAAATCTGTTACCGTTACGACAGCGACGGGCGGGTGACAGAACAGCTAAACCCGGCAGGCTTAAGTTACACGTATCAGTATGAGAAGGACCGCATCACCATCACCGACAGCCTGAACCGCCGTGAAGTCCTGCACGCAGGGTGAAGGCGGGCTGAAGCGGGTGGTGAAAAGGAACACGCGGACGGCAGCGTCACGCAGAGTCAGTTTGACGCGGTGGGCAGGCTCAGGGCACAGACGGATGCCGCAGGCAGGACAACAGAATACAGTCCGGATGTGGTGACGGGCCTCATCACGCGCATCACCACGCCGGATGGCAGGGCATCGGCGTTTTACTATAACCACCACAGCCAGTTAACGTCAGCCACCGGGCCTGACGGGCTGGAAATACGCCGGGAATATGATGAATGGGGCCGTCTGATTCAGGAAACTGCCCCTGACGGCGATATCACCCGCTACCGTTATGATAATCCACACAGTGACTTACCCTGCGCAACGGAAGATGCCACCGGCAGCGGAAAACCATGACGTGGAGCCGTTACGGTCAGTTGCTGAGCTTCACTGACTGTTCCGGTTATGTAACCCGCTATGACCATGACCGTTTTGGTCAGGTGACGGCGGTGCACCGCGAGGAAGGGCTGAGTCAGTACCGCGCATACGACAGCCGTGGACAGTTAATTGCCGTGAAAGACACGCAGGGCCATGAAACGCGGTATGAATACAACGCCGCCGTTAAACACCGGCAGACTCCGCAATATCAGCGTAA
+>b070b35d-1771-4ec6-9fde-9d52b973d2d5 id=54 clr=0,5408
+TTGTTGGCACTTCGTTTCAGTTACGTATTGCTCTTGCCTGTCGCTCTATCTTCGGCGTCTGCTGGGTGTTTAACCTAACCAGGCTTGCTGCCAGCACGCCGAAACGCTCTTTACCTTCCATATTGATGCTGCTGTCCGTGCCCAGTGCCAGCAGATGAGGATTACCCTGAACTTCTGCCCACATCACCACGCCTACGCAGATGACAAAATCACTGACATCGCCCACAGCAACATGCGCCCCTGGCGGCGATCGCCCATCACTTCACCAAAGGCAAAGCACAGCGCCGTTGGGATCAAGAAGATCGCCAGCATCTGCACGAAGTTGGTCAGTGCGGTTGGGTTTTCAAACGGATGCGACGAGTTGGCATTAAAGAAGCCACCGCCGTTAGTACCGAGCATCTTGATCGCTTCCTGAGCTACAGGCCCCATGGGTAACAGCTGTTGCGCTCCTTCAACGGTATTCACAGCCTGATAAGGCAGAAAGTTTTGCAGCGCACCTTGTTGAATAAAAACAGTGCAATCAACAACGCCACAGGACTAGCACCCATAACGTGATGCGTAGCAGATCGACCCAGGCATTCCCGAGCGTGCTCATGCTCTGGCGGGTAAACGCACGGATGAGGGCAAAATCACCGCAATCCCGCTGGCGGCAGAAAGAAAGTTTTGCACCGTTAAGCCCGCCATCTGGCTGAAATAGCTCAACGTGGTTTCACCGCTATAAGATTGCCAGTTGGTATTGGTGACAAAGCTGACGGCGGTATTCAGCGCCAGATCCCACGACAGCCCTGGCAACTGCTGTGGATTAAGCGGCAGATAGTGCTGACCGAGCAACATAAAAACAGCACCGCCAGCCCCAGCATGTTCAGGCCGAGAATGGCACAAAGATATTGCTTCCAGTTCATCTCACGGTCAGAGACGCCAAGTGCGCGAAAAGTACGCGCTCAACGCCCGTTGTACCGGGAAGAGGAATGTCATTAATCAGCCGCGCCAGCCCGCTGCCTAAAGGACGCGCCAGCACCATTAACACCAGTAAAAACGTGGCGATCAGTAAGAACCTTGCGCAGCCATCAGAACGCCTCCGCATTGATCAGGGCATAAACCAGATAACCCAGTAATAAAACACCAGCAATACGCCGGTTATCACGCCTGCACTCACAGTGCACCTCCAGTGGCCTAAAAGTGATACCGGAAGGGTAGAATTCTGGCTGCAAAGATTTCGCAAAATCTGCGGGCGGGGTGTAAAAAGTATAAAAATGGCAAAAGCCATGATTTAACTAATGTTTAGTATTAATTTAACTTTTGTGTAACTTAATTACAGGATGAATGTAAATAAACCATCAATAAGCAAAAATAAGTGGTCGGATGAGTAGTAAAATTACACAAAAGGCGGTACTATTTTCATCAGATAAACAAATTCATTTTTCCGGTGCCATTCACCGGGTAGATACAAAGGGGAGAAAAGTATGGAACTCTACAGAGAATATCCTGCATGGCTTATCTTTTTACGCCGTACTTATGCGGTTGCAGCGGGCGTTCTGGCGCTGCCTTTCATGCTTTTCTGGAAAGACCGCGCCCGCTTTTACAGCTACCTGCATCGCGTCTGGTCGAAAACCAGCGATAAACCGGTGTGGATGGATCAGGCCGAAAAGGCAACTGGTGATTTTATTGATTGCTGAGTTTTGAATACATTGAAAACCGCCAGCGGAAACGCTGGCGGTTTTTGTATCAGGAAGATGTTCAGAGGAATATTTAGACATCGTTATACCAATCGAAACATATATTCATGAAATATATATAAATATTTTCCTAATTGTTCTTATCTGACAGATATCTCACTTAAGGCTTTCTTATAAATCTGTAGGGTTTCGCCTGTCAGCAGACAAATAACCCGATAAAACAAGGATGAGCAGATGAGCGGAAAACCGGCGGCGCGTCAGGGCGACATGACGCAGTATGGCGGTAGCATTGTCCAGGGTTCAGCCGGGGTACGCATCGGTGCCCCACCGGCGTGGCCTGTTCGGTGTGCCCCGGCGGGTGACGTCCGGCCATCCGGTCAATCCGCTGCTCGGTGCAAAGGTCCTTCCCGGTGAAACCGACATCGCCCTGCCCGGCCCGCTGCCGTTCATTCTCTCCGCACCTACAGCAGTTACCGGACAAAACGCCCGCGCCGGTGGGGAGCCTCGGCCCCGGCTGGAAAATGCCTGCGGATATCCGCTTACAGCTGCGCGATAACACACTGATACTCAGTGATAACGGCGGCAGAAGCCTGTATTTTGAGCACCTGTTTCCCGGTGAGGACGGTTACAGCCGCAGCGAGTCACTGTGGCTGGTGCGCGGCGTGGCGAAACTGGATGAAGGTCACCGGCTGGCCGCACTCTGGCAGGCGCTGCCGGAAGAACTCCGCTTAAGTCCGCATCGTTATCTGGCGACAAACAGTCCGCAGGGGCCGTGGTGGCTGCTCGGCTGGTGTGAGCGGGTGCCGGAAGCGGATGAGGTGCTGCCTGCGCCGCTGCCGCCGTACCGGGTACTGACCGGGCTGGTGGACCGCTTCGGGCGCACACAGACGTTCCACCGCGAAGCCGCCGGTGAATTCAGCGGCGAAATCACCGGCGTGACGGATGGTGCCGGGCGTCACTTCCGGCTGGTACTGACCACGCAGGCGCAGCGGGCAGAAGAAGCCCGGCAGCAGGCCATTTCCGGCGGGACGGAACCGTCCGCTTTTCCTGATACCCTGCCGGGTTACACCGAATATGGCCGGGACAACGGCATCCGTCTGTCTGCCGTGTGGCTGACGCACGACCCGGAATACCCGGAGAATTTACCTGCCGCGCCGCTGGTGCGCTATGGCTGGACGCCCGCGGCGAACTGGCGGCGGTGTATGACCGCAGCAATACACAGGTGCGCAGCTTTACTTACGATGATAAATACCGGGGCCGGATGGTGGCGCACCGTCACACGGGCCGACCGGAAATCTGTTACCGTTACGACAGCGACGGGCGGGTGACAGAACAGCTAAACCCGGCAGGCTTAAGTTACACGTATCAGTATGAGAAGGACCGCATCACCATCACCGACAGCCTGAACCGCCGTGAAGTCCTGCACGCAGGGTGAAGGCGGGCTGAAGCGGGTGGTGAAAAGGAACACGCGGACGGCAGCGTCACGCAGAGTCAGTTTGACGCGGTGGGCAGGCTCAGGGCACAGACGGATGCCGCAGGCAGGACAACAGAATACAGTCCGGATGTGGTGACGGGCCTCATCACGCGCATCACCACGCCGGATGGCAGGGCATCGGCGTTTTACTATAACCACCACAGCCAGTTAACGTCAGCCACCGGGCCTGACGGGCTGGAAATACGCCGGGAATATGATGAATGGGGCCGTCTGATTCAGGAAACTGCCCCTGACGGCGATATCACCCGCTACCGTTATGATAATCCACACAGTGACTTACCCTGCGCAACGGAAGATGCCACCGGCAGCCGGAAAACCATGACGTGGAGCCGTTACGGTCAGTTGCTGAGCTTCACTGACTGTTCCGGTTATGTAACCCGCTATGACCATGACCGTTTTGGTCAGGTGACGGCGGTGCACCGCGAGGAAGGGCTGAGTCAGTACCGCGCATACGACAGCCGTGGACAGTTAATTGCCGTGAAAGACACGCAGGGCCATGAAACGCGGTATGAATACAACGCCGCCGGTGACCTGACCACCGTCATTGCCCCGGACGGCAGCAGAAACGGGACACAGTACGATGCGTGGGGAAAAGCCATCTGTACCACGCAGGGCGGTCTGACGCGCAGTATGGAATACGATGCTGCCGGACGGGTCATCCGCCTGACCAGTGAAAACGGCAGCCACACCACCTTCCGTTACGATGTACTCGACCGGCTGATACAGGAAACCGGCTTTGACGGCCGCACACAGCGTTATCACCACGACCTGACCGGCAAACTTATCCGCAGCGAGGATGAGGGCTGGTCACCCACTAACTATGACGAAGCAGACCGCCTCACGCACCGCACCGTGAATGGCGAAACCGCAGAGCGGTGGCAGTATGACGAACGCGGCTGGCTGACAGACATCAGCCATATCAGCGAAGGGCACCGGGTGACGGTGCACTATGGTTATGACAGTAAAGGCCGCCTCGCCAGTGAACACCTGACGGTGCATCATCCGCAGACGAATGAACTGCTCTGGCAGCATGAGACCAGACATGCGTACAACGCACAGGGACTGGCGAACCGCTGTATACCGGACAGCCTGCCCGCCGTGGAATGGCTGACCTACGGCAGCGGCTGGCTGTCAGGCATGAAACTCGGCGACACACCGCTGGTGGAGTACACCCGCGACCGCCTGCACCGGAAACGCTGCGCAGCTTCGGCCGTTATGAACTCACCACCGCTTATACCCCTGCCGGGCAGTTACAGAGCCAGCACCTGAACAGCCTGCTGTCTGACCGCGATTACACCTGGAACGACAACGGCGAACTCATCCGCATCAGCAGCCCGCGCCAGACCCGGAGTTACAGCTACAGCACCACCGGCAGGCTGACCGGCGTTCACACCACCGCAGCGAATCTGGATATCCGCATCCCGTATACCACAGACCCGGCAGGTAACCGCCTGCCCGACCCGGAGCTGCACCCGGACAGCGCCCTCAGCATGTGGCCGGATAACCGTATCGCCCGTGACGCGCACTATCTTTACCGGTATGACCGTCACGGCAGGCTGACAGAGAAAACCGACCTCATCCCGGAAGGGTTATCCGCACGGATGATGAGCGCACCCACCGGTACCATTACGACAGTCAGCACCGGCTGGTGCCACGCGGACACAATATGCAGAGCCGCTGGTCGAAAGTCGCTATCTTTACGACCCGCTGGGCCGCAGGGTGGCAAAACGGGTATGGCGGCGTGAACGGGACCTGACGGGCTGGATGTCGCTGTCACGGAAACCGCAAGTGACCTGGTACGGCTGGGACGGCGACCGCCTGACCACGATACAGAACGACAGAACCCGCATCCAGACGATTTATCAGCCGGGGAGCTTCACGCCACTCATCAGGGTTGAAACCGCCACCGGTGAGCTGGCGAAAACGCAGCGCCGCAGCCTGGCGGATACCCTTCAGCAGTCCGGTGGCGAAGACGGTGGCAGTGTGGTGTTCCCGCCGGTGCTGGTGCAGATGCTCGACCGGCTGGAAAGTGAAATCCTGGCTGACCGGGTGAGTGAGGAAAGCCGCCGCTGGCTGGCATCGTGCGGCCTGACGGTGGCGCAGATGCAAAGCCAGATGGACCCGGTATACACGCCGGCGCGAAAAATTCACCTGTACCACTGCGACCATCGCGGCCTGCCGCTGGCCCTATCAGCACGGAAGGGACAACAGCGTGGTACGCAGAATACGATGAATGG
+>29fcf315-e502-472c-8e1f-80e65e5b4972 id=55 clr=0,6406
+GCTGCGCAGCGTTTCCCGGTGCAGGCGGTCGCGGGTGTACTCCACCAGCGGTGTGTCGCCGAGTTTCATGCCTGACAGCCAGCCGCTGCCGTAGGTCAGCCATTCCACGGCGGGCAGGCTGTCCGGTATACAGCGGTTCGCCAGTCCCTGTGCGTTGTACGCATGTCTGGTCTCATGCTGCCAGAGCAGTTCATTCGTCTGCGGATGATGCACCGTCAGGTGTTCACTGGCGAGGCGGCCTTTACTGTCATAACCATAGTGCACCGTCACCCGGTGCCCTTCGCTGATATGGCTGATGTCTGTCAGCCAGCCGCGTTCGTCATACTGCCACCGCTCTGCGGTTTCGCCATTCACGGTGCGGTGCGTGAGGCGGTCTGCTTCGTCATAGTGCCAGTGGGTGACCAGCCCTCATCCTCGCTGCGGATAAGTTTGCCGGTCAGGTCGTGGTGATAACGCTGTGTGCGGCCGTCAAAGCCGGTTTCCTGTATCAGCCGGTCGAGTACATCGTAACGGAAGGTGGTGTGGCTGCCGTTTTCACTGGTCAGGCGGATGACCCGTCCGGCAGCATCGTATTCCATACTGCGCGTCAGACCGCCCTGCGTGGTACAGATGGCTTTTCCCCGCATCGTACTGTGTCCCGTTTCTGCTGCCGTCCGGGGCAATGACGGTGGTCAGGTCACCGGCGGCGTTGTATTCATACCGCGTTTCATGGCCCTGCGTGTCTTTCACGGCAATTAACTGTCCACGGCTGTCGTATGCGCGGTACTGACTCAGCCCTTCCTCGCGGTGCACCGCCGTCACCTGACCAAAACGGTCATGGTCATAGCGGGTTACATAACCGGAACAGTCAGTGAAGCTCAGCAACTGACCGTAACGGCTCCACGTCATGGTTTTCCGGCTGCCGGTGGCATCTTCCGTTGCGCAGGGTAAGTCACTGTGTGGATTATCATAACGGTAGCGGGTGATATCGCCGTCAGGGGCAGTTTCCTGAATCAGACGGCCCCATTCATCATATTCCGGCGTATTTCCAGCCCGTCAGGCCCGGTGGCTGACGTTAACTGGCTGTGGTGGTTATAGTAAAACGCCGATGCCCTGCCATCCGGCGTGGTGATGCGCGTGATGAGGCCCGTCACCACATCCGGACTGTATTCTGTTGTCCTGCCTGCGGCATCCGTCTGTGCCCTGAGCCTGCCCACCGCGTCAAACTGACTCTGCGTGACGCTGCCGTCCGCGTGTTCCTTTTCACCACCCGCTTCAGCCCGCCTTCACCCTGCGTGTGCAGGACTTCACGGCGGTTCAGGCTGTCGGTGATGGTGATGCGGTCCTTCTCATACTGATACGTGTAACTTAAGCCTGCCGGGTTTAGCTGTTCTGTCACCCGCCCGTCGCTGTCGTAACGGTAACAGATTTCCGGTCGGCCCGTGTGACGGTGCGCCACCATCCGGCCCCGGTATTTATCATCGTAAGTAAAGCTGCGCACCTGTGTATTGCTGCGGTCATACACCGCCGCCAGTTCGCCGCGGGCGTCCAGCCATAGCGCACCAGCGGCGCGGCAGGTAAATTCTCCGGGTATTCCGGGTCGTGCGTCAGCCACACGGCAGACAGACGGATGCCGTTGGCCATATTCGGTGTAACCCGGCAGGGTATCAGGAAAGCGGACGGTTCCGTCCCGCCGGAAATGGCCTGCTGCCGGGCTTCTTCTGCCCGCTGCGCCTGCGTGGTCAGTACCAGCCGGAAGTGACGCCCGGCACCATCCGTCACGCCGGTGATTTCGCCGCTGAATTCACCGGCGGCTTCGCGGTGGAACGTCTGTGTGCGCCCGAAGCGGTCCACCAGCCCGGTCAGTACCCGGTACGGCGGCAGCGGCGCAGGCAGCACCTCATCCGCTTCCGGCACCCGCTCACACCAGCCGAGCAGCCACCACGGCCCCTGCGGACTGTTTGTCGCCAGATAACGATGCGGACTTAAGCGGAGTTCTTCCGGCAGCGCCTGCCAGAGTGCGGCCAGCCGGTGACCTTCATCCAGTTTCGCCACGCCGCCGCGCACCAGCCACAGTGACTCGCTGCGGCTGTAACCGTCCTCACCGGGAAACAGGTGCTCAAAATACAGGCTTCTGCCGCCGTTATCACTGAGTATCAGTGTGTTATCGCGCAGCTGTAAGCGGATATCCGCAGGCATTTTCCAGCCGGGGCCGAGGCTCCCCACCGGCGCGGGCGTTTTGTCCGGTAACTGCTGTAGGTGCGGGAGAATGAACGGCAGCGGGCCGGGCAGGGCGATGTCGGTTTCACCGGGAAGGACCTTTGCACCGAGCAGCGGATTGACCGGATGGCCGGACGTCACCCGCCGGGGCACACCGAACAGGCCACGCCGGTGGGGCACCGATGCGTACCCCGGCTGAACCCTGGACAATGCTACCGCCATACTGCGTCATGTCGCCCTGACGCGCCGCCGGTTTTCCGCTCATCTGCTCATCCTTGTTTTATCGGGTTATTTGTCTGCTGACAGGCGAAACCCTACAGATTTATAAGAAAGCCTTAAGTGAGATATCTGTCAGATAAGAACAATTAGGAAAATATTTATATATATTTCATGAATATATGTTTCGATTGGTATAACGATGTCTAAATATTCCTCTGAACATCTTCCTGATACAAAAACCGCCAGCGTTTCCGCTGGCGGTTTTCAATATTCAAAACTCAGCAATCAATAAAATCACCAGTTGCCTTTTCGGCCTGATCCATCCACACCGGTTTATCGCTGGTTTTCGACCAGACGCGATGCAGGTAGCTGTAAAAGCGGGCGCGGTCTTTCCAGAAAAGCATGAAAGGCAGCGCCAGAACGCCCGCTGCAACCGCATAAGTACGGCGTAAAAGATAAGCCATGCAGGATATTCTCTGTAGAGTTCCATACTTTTCTCCCCTTTTGTATCTACCCGGTGAATGGCACCGGAAAAATGAATTTGTTTATCTGATGAAAATAGTACCGCCTTTTGTGTAATTTTACTACTCATCCGACCACTTTTTTTGCTTATTGATGGTTTATTTACATTCATCCTGTAATTAAGTTACACAAAAGTTAAATTAATACTAAACATTAGTTAAATCATGGCTTTTGCCATTTTTATACTTTTACACCCCGCCCGCAGATTTTGCGAAATCTTTGCAGCCAGAATTCTACCCTTCCGGTATCACTTTTAGGCCACTGGAGGTGCACTGTGAGTGCAGGCGTGATAACCGGCGTATTGCTGGTGTTTTATTACTGGGTTATCTGGTTTATGCCCTGATCAATGCGGAGGCGTTCTGATGGCTGCGCAAGGGTTCTTACTGATCGCCACGTTTTTACTGGTGTTAATGGTGCTGGCGCGTCCTTTAGGCAGCGGGCTGGCGCGGCTGATTAATGACATTCCTCTTCCCGGTACAACGGGCGTTGAGCGCGTACTTTTCGCGCACTTGGCGTCTCTGACCGTGAGATGAACTGGAAGCAATATCTTTGTGCCATTCTCGGCCTGAACATGCTGGGGCTGGCGGTGCTGTTTTTATGTTGCTCGGTCAGCACTATCTGCCGCTTAATCCACAGCAGTTGCCAGGGCTGTCGTGGGATCTGGCGCTGAATACCGCCGTCAGCTTTGTCACCAATACCAACTGGCAATCTTATAGCGGTGAAACCACGTTGAGCTATTTCAGCCAGATGGCGGGCTTAACGGTGCAAAACTTTCTTTCTGCCGCCAGCGGGATTGCGGTGATTTTGCCCTCATCCGTGCGTTTACCCGCCAGAGCATGAGCACGCTCGGGAATGCCTGGGTCGATCTGCTACGCATCACGTTATGGGTGCTAGTCCTGTGGCGTTGTTGATTGCACTGTTTTTATTCAACAAGGTGCGCTGCAAAACTTTCTGCCTTATCAGGCTGTGAATACCGTTGAAGGAGCGCAACAGCTGTTACCCATGGGGCCTGTAGCTTCTCAGGAAGCGATCAAGATGCTCGGTACTAACGGCGGTGGCTTCTTTAATGCCAACTCGTCGCATCCGTTTGAAAACCCAACCGCACTGACCAACTTCGTGCAGATGCTGGCGATCTTCTTGATCCCAACGGCGCTGTGCTTTGCCTTTGGTGAAGTGATGGGCGATCGCCGCCAGGGGCGCATGTTGCTGTGGGCGATGTCAGTGATTTTGTCATCTGCGTAGGCGTGGTGATGTGGGCAGAAGTTCAGGGTAATCCTCATCTGCTGGCACTGGGCACGGACAGCAGCATCAATATGGAAGGTAAAGAGAGCCGTTTCGGCGTGCTGGTCAGTAGCCTGTTTGCGGTCGTGACGACGGCGGCTTCCTGTGGCGCGGTGATTGCGATGCATGATTCGTTTACCGCTCTCGGTGGCATGGTGCCGATGTGGCTGATGCAAATTGGTGAAGTGGTGTTCGGCGGTGTCGGTTCTGGTCTTTACGGCATGATGCTGTTTGTCCTGCTGGCGGTGTTTATTGCCGGGCTGATGATTGGTCGTACACCGGAATATCTGGGTAAAAAATCGACGTACGCGAGATGAAACTGACTGCACTGGCAATTCTGGTTACCCCGACGCTGGTGCTGATGGGCGCGGCGTTGGCGATGATGACCGACGCCGGACGTAGCGCCATGCTCAACCCTGGCCCGCATGGTTTTAGCGAAGTGCTGTACGCCGTGTCATCCGCCGCTAACAACAACGGCAGCGCCTTTGCCGGATTAAGCGCCAACTCTCCGTTCTGGAACTGTTTACTGGCGTTCTGCATGTTTGTCGGTCGCTTCGGGGTGATTATCCCGGTGATGGCAATTGCCGGTTCGCTGGTGAGTAAAAGAGCCAAGCCGCCAGCTCCGGCACGCTGCCAACGCACGGCCCGCTGTTTGTTGGCCTGTTAATCGGCACCGTGTTGCTGGTTGGCGCACTGACCTTTATCCCTGCCCTGGCGCTTGGTCCGGTGGCGGAATATCTCTCCTGATGATATTGAGTGAGCACTGAATATGAGTCGTAAACAACTGGCGCTATTCGAACCAACACTTGTCGTTCAGGCGCTGAAAGAAGCGGTGAAAAATTAAACCCGCAGGCGCAATGGCGCAATCCGGTGATGTTTATCGTCTGGATCGGCAGTCTGCTGACCACCTGTATTAGCATCGCGATGGCAAGCGGTGCGATGCCCGGCAATGCGCTGTTTAGCGCGGCCATTAGCGGTTGGCTGTGGATCACCGTACTGTTCGCTAATTTCGCCGAGGCGCTGGCAGAAGGCCGCAGTAAAGCGCAGGCCAACAGTCTGAAAGGGTGAAAAACTGCCTTTGCCCGCAAGCTGCGTGAGCCGAAATATGGCGCTGCGGCGGACAAAGTTCCTGCCGACCAACTTCGTAAAGGCGATATCGTACTGGTAGAAGCTGGCGATATTATCCCCTGCGATGGTGAAGTTATTGAAGGGGTGCATCGGTCGATGAAAGCGCCATCACCGGGGAATCGGCACCGGTGATCCGTGAATCCGGCGGCGATTTTGCCTCCGTCACCGGCGGCACGCGTATTCTTTCTGACTGGCTGGTGATTGAGTGTAGCGTTAACCCCGGCGAGACATTTCTGGATCGGATGATCGCGATGGTGGAAGGCGCACAGCGACGCAAAACGCCGAACGAAATTGCCCTGACCATTCTGCTGATTGCCCTGACTATCGTCTTTTACTGGCAACCGCCACGCTGTGGCCGTTTTCCGCGTGGGGCGGTAATGCAGTCAGCGTAACGGTACTGGTGGCGCTGCTGGTCTGTCTGATCCCAACCACTATTGGCGGCCTGTTGTCAGCGATCGGCGTCGCCGGGATGAGCCGGATGCTAGGCGCGAATGTGATTGCCACCAGCGGACGTGCAGTTGAAGCGGCAGGTGACGTTGACGTTCTGCTACTGGATAAAACCGGCACCATCACACTCGGTAACCGTCAGGCGTCGGAGTTTATCCCGCGCAGGGCGTGGATGAAAAACGCTGGCTGACGCCGCACAACTGGCTTCTGGCTGATGAAACGCCGGAAGGCCGCAGTATTGTGATCCTCGCCAAGCAGCGTTTTAACCTGCGCGAGCGCGATGTGCAGTCGCTCCATGCCACCTTTGTACCGTTTACTGCGCAAAGCCGGATGAGCGGGATCAACATCGACAACCGCATGATCCGTAAAGGTTCTGTCGATGCCATTCGTCGCCATGTTGAGGCTAACGGTGGTCACTTCCCCCGATGTTGATCAAAAGTCGATCAGGTTGCGCGTCAGGGAGCCACGCCGCTGGTGGTGGTGGAAGGTTCTCGTGTGCTGGGCGTTATTGCGCTGAAAGATATCGTCAAAGGCGGTATTAAAGAGCGCTTCGCCCAGCTGCGCAAAATGGGCATTAAACACCCAAGCGAACGCCGAAGATAAAGAAGTT
+>baeacbab-db71-4be4-a4ac-c2fe5e26570d id=56 clr=0,5631
+TTGTTATTGCTTCGTTCCAGTTACGTATTGCTGCCTGTCGCTCTATCTTCGGCGTCTGCTTAACGTTGTTTCCTTCAGGTGTAATCGCGGTCAGACACAGGCACAGGCCAGGTGCTGGCTCTGTAACTGCCCGGCAGGGGTATAAGCGGTGGTGAGTTCATAACGGCCGAAGCTGCGCAGCGTTTCCCGTGCAGGCGGTCGCGGGTGTACTCCACCAGCGGTGTGTCGCCGAGTTTCATGCCTGACAGCCAGCCGCTGCCGTAGGTCAGCCATTCCACGGCGGGCAGGCTGTCCGGTATACAGCGGTTCGCCAGTCCCTGTGCGTTGTACGCATGTCTGGTCTCATGCTGCCAGAGCAGTTCATTCGTCTGCGGATGATGCACCGTCAGGTGTTCACTGGCGAGGCGGCCTTTACTGTCATAACCATAGTGCACCGTCACCCGGTGCCCTTCGCTGATATGGCTGATGTCTGTCAGCCAGCCGCGTTCGTCATACTGCCACCGCTCTGCGGTTTCGCCATTCACGGTGCGGTGCGTGAGGCGGTCTGCTTCGTCATAGTGCCAGTGACCAGCCCCTCATCCTCGCTGCGGATAAGTTTGCCGGTCAGGTCGTGGTGATAACGCTGTGTGCGGCCGTCAAAGCCGGTTTCCTGTATCAGCCGGTCGAGTACATCGTAACGGAAGGTGGTGTGGCTGCCGTTTTCACTGGTCAGGCGGATGACCCGTCCGGCAGCATCGTATTCCATACTGCGCGTCAGACCGCCCTGCGTGGTACAGATGGCTTTTCCCCGCATCGTACTGTGTCCCGTTTCTGCTGCCGTCCGGGGCAATGACGGTGGTCAGGTCACCGGCGGCGTTGTATTCATACCGCGTTTCATGGCCCTGCGTGTCTTTCACGGCAATTAACTGTCCACGGCTGTCGTATGCGCGGTACTGACTCAGCCCTTCCTCGCGGTGCACCGCCGTCACCTGACCAAAACGGTCATGGTCATAGCGGGTTACATAACCGGAACAGTCAGTGAAGCTCAGCAACTGACCGTAACGGCTCCACGTCATGGTTTTCCGGCTGCCGGTGGCATCTTCCGTTGCGCAGGGTAAGTCACTGTGTGGATTATCATAACGGTAGCGGGTGATATCGCCGTCAGGGGCAGTTTCCTGAATCAGACGGCCCCATTCATCATATTCCCGGCGTATTTCCAGCCCGTCAGGCCCGGTGGCTGACGTTAACTGGCTGTGGTGGTTATAGTAAAACGCCGATGCCCTGCCATCCGGCGTGGTGATGCGCGTGATGAGGCCCGTCACCACATCCGGACTGTATTCTGTTGTCCTGCCTGCGGCATCCGTCTGTGCCCTGAGCCTGCCCACCGCGTCAAACTGACTCTGCGTGACGCTGCCGTCCGCGTGTTCCTTTTTCACCACCCGGCCCGCCTTCACCCTGCGTGTGCAGGACTTCACGGCGGTTCAGGCTGTCGGTGATGGTGATGCGGTCCTTCTCATACTGATACGTGTAACTTAAGCCTGCCGGGTTTAGCTGTTCTGTCACCCGCCCGTCGCTGTCGTAACGGTAACAGATTTCCGGTCGGCCCGTGTGACGGTGCGCCACCATCCGGCCCCGGTATTTATCATCGTAAGTAAAGCTGCGCACCTGTGTATTGCTGCGGTCATACACCGCCGCCAGTTCGCCGCGGGCGTCCAGCCATAGCGCACCAGCGGCGCGGCAGGTAAATTCTCCGGGTATTCCGGGTCGTGCGTCAGCCACGGCAGACAGACGGATGCCGTTGTCCCGGCCATATTCGGTGTAACCCGGCAGGGTATCAGGAAAAGCGGACGGTTCCGTCCCGCCGGAAATGGCCTGCTGCCGGGCTTCTTCTGCCCGCTGCGCCTGCGTGGTCAGTACCAGCCGGAAGTGACGCCCGGCACCATCCGTCACGCCGGTGATTTCGCCGCTGAATTCACCGGCGGCTTCGCGGTGGAACGTCTGTGTGCGCCCGAAGCGGTCCACCAGCCCGGTCAGTACCCGGTACGGCGGCAGCGGCGCAGGCAGCACCTCATCCGCTTCCGGCACCCGCTCACACCAGCCGAGCAGCCACCACGGCCCCTGCGGACTGTTTGTCGCCAGATAACGATGCGGACTTAAGCGGAGTTCTTCCGGCAGCGCCAGAGTGCGGCCAGCCGGTGACCTTCATCCAGTTTCGCCACGCCGCCGCGCACCAGCCACAGTGACTCGCTGCGGCTGTAACCGTCCTCACCGGGAAACAGGTGCTCAAAATACAGGCTTCTGCCGCCGTTATCACTGAGTATCAGTGTGTTATCGCGCAGCTGTAAGCGGATATCCGCAGGCATTTTCCAGCCGGGGCCGTCCCCACCGGCGCGGGCGTTTTGTCCGGTAACTGCTGTAGGTGCGGGAGAATGAACGGCAGCGGGCCGGGCAGGGCGATGTCGGTTTCACCGGGAAGGACCTTTGCACCGAGCAGCGGATTGACCGGATGGCCGGACGTCACCCGCCGGGGCACACCGAACAGGCCACGCCGGTGGGGCACCGATGCGTACCCCGGCTGAACCCTGGACAATGCTACCGCCATACTGCGTCATGTCGCCCTGACGCGCCGCCGGTTTTCCGCTCATCTGCTCATCCTTGTTTTATCGGGTTATTTGTCTGCTGACAGGCGAAACCCTACAGATTTATAAGAAAGCCTTAAGTGAGATATCTGTCAGATAAGAACAATTAGGAAAATATTTATATATATTTCATGAATATATGTTTCGATTGGTATAACGATGTCTAAATATTCCTCTGAACATCTTCCTGATACAAAAACCGCCAGCGTTTCCGCTGGCGGTTTTCAATGTAAAAACTCAGCAATCAATAAAATCACCAGTTGCCTTTTCGGCCTGATCCATCCACACCGGTTTATCGCTGGTTTTCGACCAGACGCGATGCAGGTAGCTGTAAAAGCGGGCGCGGTCTTTCCAGAAAAGCATGAAAGGCAGCGCCAGAACGCCCGCTGCAACCGCATAAGTACGGCGTAAAAGATAAGCCATGCAGGATATTCTCTGTAGAGTTCCATACTTTTCTCCCTTTTTTATCTACCCGGTGAATGGCACCGGAAAAATGAATTTGTTTATCTGATGAAAATAGTACCGCCTTTTGTGTAATTTTACTACTCATCCGACCACTTATTTTTGCTTATTGATGGTTTATTTACATTCATCCTGTAATTAAGTTACACAAAAGTTAAATTAATACTAAACATTAGTTAAATCATGGCTTTTGCCATTTTTATACTTTTACACCCCGCCCGCAGATTTTGCGAAATCTTTGCAGCCAGAATTCTACCCTTCCGGTATCACTTTTAGGCCACTGGAGGTGCACTGTGAGTGCAGGCGTGATAACCGGCGTATTGCTGGTGTTTTATTACTGGGTTATCTGGTTTATGCCCTGATCAATGCGGAGGCGTTCTGATGGCTGCGCAAGGGTTCTTACTGATCGCCACGTTTTTACTGGTGTTAATGGTGCTGGCGCGTCCTTTAGGCAGCGGGCTGGCGCGGCTTTAATGACATTCCTCTTCCCGGTACAACGGGCGTTGAGCGCGTACTTTTCGCGCACTTGGCGTCTCTGACCGTGAGATGAACTGGAAGCAATATCTTTGTGCCATTCTCGGCCTGAACATGCTGGGGCTGGCGGTGCTGTTTTTATGTTGCTCGGTCAGCACTATCTGCCGCTTAATCCACAGCAGTTGCCAGGGCTGTCGTGGGATCTGGCGCTGAATACCGCCGTCAGCTTTGTCACCAATACCAACTGGCAATCTTATAGCGGTGAAACCACGTTGAGCTATTTCAGCCAGATGGCGGGCTTAACGGTGCAAAACTTTCTTTCTGCCGCCAGCGGGATTGCGGTGATTTTGCCCTCATCCGTGCGTTTACCCGCCAGAGCATGAGCACGCTCGGGAATGCCTGGGTCGATCTGCTACGCATCACGTTATGGGTGCTAGTCCCTGTGGCGTTGTTGATTGCACTGTTTTTATTCAACAAGGTGCGCTGCAAAACTTTCTGCCTTATCAGGCTGTGAATACCGTTGAAGGAGCGCAACAGCTGTTACCCATGGGGCCTGTTCTCAGGAAGCGATCAAGATGCTCGGTACTAACGGCGGTGGCTTCTTTAATGCCAACTCGTCGCATCCGTTTGAAAACCCAACCGCACTGACCAACTTCGTGCAGATGCTGGCGATCTTCTTGATCCCAACGGCGCTGTGCTTTGCCTTTGGTGAAGTGATGGGCGATCGCCGCCAGGGGCGCATGTTGCTGTGGGCGATGTCAGTGATTTTGTCATCTGCGTAGGCGTGGTGATGTGGGCAGAAGTTCAGGGTAATCCTCATCTGCTGGCACTGGGCACGGACAGCAGCATCAATATGGAAGGTAAAGAGAGCCGTTTCGGCGTGCTGGTCAGTAGCCTGTTTGCGGTCGTGACGACGGCGGCTTCCTGTGGCGCGGTGATTGCGATGCATGATTCGTTTACCGCTCGGTGGCATGGTGCCGATGTGGCTGATGCAAATTGGTGAAGTGGTGTTCGGCGGTGTCGGTTCTGGTCTTTACGGCATGATGCTGTTTGTCCTGCTGGCGGTGTTTATTGCCGGGCTGATGATTGGTCGTACACCGGAATATCTGGGTAAAAAATCGACGTACGCGAGATGAAACTGACTGCACTGGCAATTCTGGTTACCCCGACGCTGGTGCTGATGGGCGCGGCGTTGGCGATGATGACCGACGCCGGACGTAGCGCCATGCTCAACCCTGGCCCGCATGGTTTTAGCGAAGTGCTGTACGCCGTGTCATCCGCCGCTAACAACAACGGCAGCGCCTTTGCCGGATTAAGCGCCAACTCTCCGTTCTGGAACTGTTTACTGGCGTTCTGCATGTTTGTCGGTCGCTTCGGGTGATTATCCCGGTGATGGCAATGCCGGTTCGCTGGTGAGTAAAAGAGCCAAGCCGCCAGCTCCGGCACGCTGCCAACGCACGGCCCGCTGTTTGTTGGCCTGTTAATCGGCACCGTGTTGCTGGTTGGCGCACTGACCTTTATCCCTGCCCTGGCGCTTGGTCCGGTGGCGGAATATCTCTGATGATATTGAGTGAGCACTGAATATGAGTCGTAAACAACTGGCGCTATTCGAACCAACACTTGTCGTTCAGGCGCTGAAAGAAGCGGTGAAAAATTAAACCCGCAGGCGCAATGGCGCAATCCGGTGATGTTTATCGTCTGGATCGGCAGTCTGCTGACCACCTGTATTAGCATCGCGATGGCAAGCGGTGCGATGCCCGGCAATGCGCTGAGCGCGGCCATTAGCGGTTGGCTGTGGATCACCGTACTGTTCGCTAATTTCGCCGAGGCGCTGGCAGAAGGCCGCAGTAAAGCGCAGGCCAACAGTCTGAAAGGGTGAAAAACTGCCTTTGCCCGCAAGCTGCGTGAGCCGAAATATGGCGCTGCGGCGGACAAAGTTCCTGCCGACCAACTTCGTAAAGGCGATATCGTACTGGTAGAAGCTGGCGATATTATCCCTGCGATGGTGAAGTTATTGAAGGTTAAACACCCAAGCAGACGCCGAAGATAGAGCGACAGGCAAGTAGCAATACGTAAA
+>7f343574-f2bc-4388-91b9-84b99e39256a id=57 clr=0,6920
+TTGTTCAGTTACGTATTGCGCTGATCGTCTCCAGTTACGTATTGCTACTTGCCTGTCGCTCTATCTTCGGCGTCTGCTTGGGTGTTTAACCTTCTGTCAGATAAGAACAATTAGGAAAATATTTATATATATTTCATGAATATATGTTTCGATTGGTATAACGATGTCTAAATATTCCTCTGAACATCTTCCTGATACAAAAACCGCCAGCGTTTCCGCTGGCGGTTTTCAATCAAAACTCAGCAATCAATAAAAATCACCAGTTGCCTTTTCGGCCTGATCCATCCACACCGGTTTATCGCTGGTTTTCGACCAGACGCGATGCTGCGAATAATATGCGTAAGATATGCTATGTATTCCATTATCTGATAAAATAGAATTATCTGATGATCCGCCTTTTGTGTAATTTTACTACTCATCCGACCACTTATTTTTGCTTATTGATGGTTTATTTACATTCATCCTGTAATTAAGTTACACAAAAGTTAAATTAATACTAAACATTAGTTAAATCATGGCTTTTGCCATTTTATACTTTTACACCCCGCCCGCAGATTTTTGCGAAATCTTTGCAGCCAGAATTCTACCCTTCCGGTATCACTTTTAGGCCACTGGAGGTGCACTGTGAGTGCAGGCGTGATAACCGGCGTATTGCTGGTGTTTTATTACTGGGTTATCTGGTTTATGCCCTGATCAATGCGGAGGCGTTCTGATGGCTGCGCAAGGGTTCTTACTGATCGCCACGTTTTTACTGGTGTTAATGGTGCTGGCGCGTCCTTTAGGCAGCGGGCTGGCGCGGCTGATTAATGACATTCCTCTTCCCGGTACAACGGGCGTTGAGCGCGTACTTTTCGCGCACTTGGCGTCTCTGACCGTGAGATGAACTGGAAGCAATATCTTTGCCATTCTCGGCCTGAACATGCTGGGGCTGGCGGTGCTGTTTTATGTTGCTCGGTCAGCACTATCTGCCGCTTAATCCACAGCAGTTGCCAGGGCTGTCGTGGGATCTGGCGCTGAATACCGCCGTCAGCTTTGTCACCAATACCAACTGGCAATCTTATAGCGGTGAAACCACGTTGAGCTATTTCAGCCAGATGGCGGGCTTAACGGTGCAAAACTTTCTTTCTGCCGCCAGCGGGATTGCGGTGATTTTGCCCTCATCCGTGCGTTTACCCGCCAGAGCATGAGCACGCTCGGGAATGCCTGGGTCGATCTGCTACGCATCACGTTATGGGTGCTAGTCCCTGTGGCGTTGTTGATTGCACTGTTTTTATTCAACAAGGTGCGCTGCAAAACTTTCTGCCTTATCAGGCTGTGAATACCGTTGAAGGAGCGCAACAGCTGTTACCCATGGGGCCTGTAGCTTCTCAGGAAGCGATCAAGATGCTCGGTACTAACGGCGGTGGCTTCTTTAATGCCAACTCGTCGCATCCGTTTGAAAACCCAACCGCACTGACCAACTTCGTGCAGATGCTGGCGATCTTCTTGATCCCAACGGCGCTGTGCTTTGCCTTTGGTGAAGTGATGGGCGATCGCCGCCAGGGGCGCATGTTGCTGTGGGCGATGTCAGTGATTTTGTCATCTGCGTAGGCGTGGTGATGTGGGCAGAAGTTCAGGGTAATCCTCATCTGCTGGCACTGGGCACGGACAGCAGCATCAATATGGAAGGTAAAGAGAGCCGTTTCGGCGTGCTGGTCAGTAGCCTGTTTGCGGTCGTGACGACGGCGGCTTCCTGTGGCGCGGTGATTGCGATGCATGATTCGTTTACCGCTCTCGGTGGCATGGTGCCGATGTGGCTGATGCAAATTGGTGAAGTGGTGTTCGGCGGTGTCGGTTCTGGTCTTTACGGCATGATGCTGTTTGTCCTGCTGGCGGTGTTTATTGCCGGGCTGATGATTGGTCGTACACCGGAATATCTGGGTAAAAAATCGACGTACGCGAGATGAAACTGACTGCACTGGCAATTCTGGTTACCCCGACGCTGGTGCTGATGGGCGCGGCGTTGGCGATGATGACCGACGCCGGACGTAGCGCCATGCTCAACCCTGGCCCGCATGGTTTTAGCGAAGTGCTGTACGCCGTGTCATCCGCCGCTAACAACGGCAGCGCCTTTGCCGGATTAAGCGCCAACTCTCCGTTCTGGAACTGTTTACTGGCGTTCTGCATGTTTGTCGGTCGCTTCGGGGTGATTATCCCGGTGATGGCAATTGCCGGTTCGCTGGTGAGTAAAAGAGCCAAGCCGCCAGCTCCGGCACGCTGCCAACGCACGGCCCGCTGTTTGTTGGCCTGTTAATCGGCACCGTGTTGCTGGTTGGCGCACTGACCTTTATCCTGCCCTGGCGCTTGGTCCGGTGGCGGAATATCTCCCTGATGATATTGAGTGAGCACTGAATATGAGTCGTAAACAACTGGCGCTATTCGAACCAACACTTGTCGTTCAGGCGCTGAAAGAAGCGGTGAAAAATTAAACCCGCAGGCGCAATGGCGCAATCCGGTGATGTTTATCGTCTGGATCGGCAGTCTGCTGACCACCTGTATTAGCATCGCGATGGCAAGCGGTGCGATGCCCGGCAATGCGCTGTTTAGCGCGGCCATTAGCGGTTGGCTGTGGATCACCGTACTGTTCGCTAATTTCGCCGAGGCGCTGGCAGAAGGCCGCAGTAAAGCGCAGGCCAACAGTCTGAAAGGGGTGAAAACTGCCTTTGCCCGCAAGCTGCGTGAGCCGAAATATGGCGCTGCGGCGGACAAAGTTCCTGCCGACCAACTTCGTAAAGGCGATATCGTACTGGTAGAAGCTGGCGATATTATCCCCTGCGATGGTGAAGTTATTGAAGGTGCATCGGTCGATGAAAGCGCCATCACCGGGGAATCGGCACCGGTGATCCGTGAATCCGGCGGCGATTTTGCCTCCGTCACCGGCGGCACGCGTATTCTTTCTGACTGGCTGGTGATTGAGTGTAGCGTTAACCCCGGCGAGACATTTCTGGATCGGATGATCGCGATGGTGGAAGGCGCACAGCGACGCAAAACGCCGAACGAAATTGCCCTGACCATTCTGCTGATTGCCCTGACTATCGTCTTTTACTGGCAACCGCCACGCTGTGGCCGTTTTCCGCGTGGGGCGGTAATGCAGTCAGCGTAACGGTACTGGTGGCGCTGCTGGTCTGTCTGATCCCAACCACTATTGGCGGCCTGTTGTCAGCGATCGGCGTCGCCGGGATGAGCCGGATGCTAGGCGCGAATGTGATTGCCACCAGCGGACGTGCAGTTGAAGCGGCAGGTGACGTTGACGTTCTGCTACTGGATAAAACCGGCACCATCACACTCGGTAACCGTCAGGCGTCGGAGTTTATCCCCGCGCAGGGCGTGGATGAAAAACGCTGGCTGACGCCGCACAACTGGCTTCGCTGGCTGATGAAACGCCGGAAGGCCGCAGTATTGTGATCCTCGCCAAGCAGCGTTTTAACCTGCGCGAGCGCGATGCAGTCGCTCCATGCCACCTTTGTACCGTTTACTGCGCAAAGCCGGATGAGCGGGATCAACATCGACAACCGCATGATCCGTAAAGGTTCTGTCGATGCCATTCGTCGCCATGTTGAGGCTAACGGTGGTCACTTCCCTACCGATGTTGATCAAAAAGTCGATCAGGTTGCGCGTCAGGCCACGCCGCTGGTGGTGGTGGAAGGTTCTCGTGTGCTGGGCGTTATTGCGCTGAAAGATATCGTCAAAGGCGGTATTAAAGAGCGCTTCGCCCAGCTGCGCAAAATGGGCATTAAAACGGTGATGATTACCGGCGATAACCGTCTGACTGCCGCCGCGATTGCTGCGGAAGCGGGTGTCGATGATTTTCTCGCCGAAGCGACACCGGAGGCCAAGCTGGCATTGATCCGTCAGTATCAGGCGGAAGGTCGTTTGGTAGCGATGACCGGCGACGGCACCAACGATGCTCCGGCGCTGGCGCAGGCAGATGTCGCGGTGGCGATGAACTCCGGCACCCAGGCGGCGAAAGAGGCGGGCAATATGGTCGATCTCGACTCTAACCCGACCAAGTTGATCGAGGTGGTGCACATTGGCAAACAGATGCTGATGACCCGTGGCTCGCTGACCACCTTCAGCATTGCCAACGATGTGGCGAAATACTTCGCCATTATTCCGGCGGCATTCGCGGCAACGTATCCGCAGTTAAATGCGCTGAACATCATGTGCCTGCATTCGCCCGACTCCGCAATCCTCAGTGCGGTGATTTTCAACGCCTTGATTATCGTCTTTGATTCCCCTGGCGTTAAAGGCGTGAGTTATAAACCGCTTACCGCTTCTGCCATGTTGCGCCGTAACTTATGGATTTACGGTCTGGGTGGGCTGCTGGTGCCGTTTATCGGTATCAAAGTCATTGATTTACTGCTGACCGTTTGCGGTCTGGTGTGAGGTTTACCATGAGTGGATTACGTCCGGCATTATCAACATTTATCTTTCTGTTATTGATTACTGGCGGCGTTTACCCGCTGCTGACCACCGTACTGGGGCAATGGTGGTTTCCTGGCAGGCCAATGGTTCGTTGATTCGTGAAGGTGATACGGTGCGCGGTTCGGCATTAATCGGGCAGAATTTTACCGGCAACGGCTATTTTCATGGTCGCCCGTCGGCAACGGCAGAAATGCCCTATAATCCACAGGCTTCTGGCGGGAGCAATCTGGCGGTCAGTAACCCTGAGCTGGATAAACTAATAGCCGCACGCGTTGCTGCATTACGGGCCGCTAACCCGGATGCCAGCGCGAGCGTTCCGGTTGAACTGGTGACGGCATCGGCAAGCGGGCTGGACAATAATATCACCCGCAAGCGGCGGCCTGGCAAATCCCACGCGTGGCGAAAGCGCGTAATCTCAGCGTTGAACAGCTCACGCAACTGATCGCAAAATACAGCCAACAACCGCTGGTGAAATATATCGGCCAGCCGGTTGTCAACATTGTTGAACTCAATCTGGCGCTGGATAAACTTGATGAATAACGAACCCTTACGTCCCGACCCCGATCGTCTGCTGGAACAAACTGCCGCGCCGCATCGGGGAAGCTGAAAGTTTTCTTCGGTGCCTGTGCAGGCGTCGGGAAGACCTGGGCGATGCTGGCAGAAGCCCAGCGACTGCGGGCGCAAGGGCTGGATATTGTGGTTGGCGTGGTAGAAACCCACGGGCGAAAAGATACCGCCGCCATGCTGGAAGGGCTGGCTGTTCTGCCGTTAAAACGCCAGGCGTACCGTGGGCGGCATATCAGCGAGTTTGATCTCGATGCCGCCCTCGCCCGCCGCCCGGCGCTGATCTTAATGGACGAACTGGCGCACAGTAATGCGCCAGGTTCCCGTCATCCCAAACGCTGGCAGGATATCGAAGAACTGCTGGAAGCTGGCATTGATGTTTTCACTACCGTCAACGTTCAGCATCTGGAAAGTCTGAATGATGTGGTCAGCGGCGTCACCGGAATTCAGGTACGGGAAACCGTGCCCGATCCTTTTCGATGCCGCCGACGACGTGGTGCTGGTGGACTTGCCCCGGACGATCTGCGCCAGCGGCTGAAAGAAGGCAAAGTCTATATTGCCGGGCAGGCGGAGCGCGCCATTGAACATTTTTCCGCAAAGGTAATCTGATCGCCCTGCGCGAACTGGCACTGCGCCGTACTGCCGATCGCGTTGATGAGCAAATGCGCGCCTGGCGGGGCATCCTGGCGAAGAGAAAGTGGCACACGCGACGCGATCCTTTTATGCATCGGCCATAACACCGGCAGCGAAAACTGGTCGCGCAGCGGCGCTGGCGTCACGGCTGGGTAGCGTCTGGCACGCGGTGTATGTTGAAACCCCTGCCCTGCACCGCTTACCGGAAAAAACGTCGGGCAATTCTCAGCGCCTTACGTCTGGCGCAGGAACTGGGCGCGGAGACGGCAACACTTTCTGATCCAGCGGAAGAGAAAGCGGTAGTGCGTTATGCCCGTGAACATAATCTCGGCAAGATTATTCTCGGTCGCCCGGCCTCGCGCCGCTGGTGGCGTCGGGAAACGTTTGCTGACCGACTGGCGCGCATCGCCCCGATCTCGATCAGGTGCTGGTCGCGCTTGATGAACCACCCGCCCGCACGATTAACAACGCGCCGGATAACCGCTCTTTTAAAGACAAGTGGCGTGTACAAATTCAGGGATGCGTGGTTGCCGCCGCGTTATGCGCCGTTATCACCTTAATTGCCATGCAGTGGCTGATGGCGTTTGATGCCGCCAACCTGGTGATGCTGTATCTGCTTGGCGTGGTGGTGGTGGCGCTATTTTATGGACGCTGGCCTTCAGTGGTTGCCACCGTCATTAATGTAGTGAGTTTCGATCTCTTTTTATCGCCCCACGCGGCACGCTCGCCGTCTCTGATGTGCAATATCTGCTGACCTTCGCGGTGATGTTAACCGTCGGGCTGGTGATCGGGAACCTTACTGCTGGCGTGCGTTATCAGGCGCGGGTAGCCCGTTACCGCGAGCAACGCACGGCACTTATGAAATGTCGAAAGCTCTGGCGGTGGGCCGCAGTCCGCAGGATATCGCTGCCACCAGCGAACAATTTATTGCCTCCACGTTTCATGCCCGCAGTCAGGTGTTGTTGCCCGATGACAACGGTAAATTGCAGCCGTTAACACATCCGCAAGGAATGACGCCGTGGGACGATGCCATCGCGCAGTGGAGTTTTGATAAAGGCCTGCCTGCGGGCGCGGGCACCGACACGTTACCCGGTGTACCGTACCAGATTTTGCCGCTAAAAGCGGCGAAAACTACGGGCTGGTGGTGGTGGAGCCGGGGAATCTGCGCCAGTTGATGATCCCGGAACAGCAGCGCCTGCTGGAACGTTACGCTGTTAGTAGGTTAAACACCCAAACAAGACGCCGAAGATAGAGCACCC
+>d69c6ac9-3c79-4ee4-a3d2-92762f8b7433 id=58 clr=0,3423
+TTGGTATGCTTCGTTCAGTTACGTATTGCTTTCCTGTTGGTACGATATTGCGGCGGCGTCTGCTGATTGTTTAACCTAGCTGCAGCAACTGGCCATGTCGGCTCCACGTCATGGTTTCCGGCTGCCGCTCTTCCGTTGCGCAGGGTAAGTCACTGTGTGGATTATCGCCAACGGTAGCGGGTGATACATCGCCGTCAGGGGCAGTTTCCTGAATCAGACGGCCCCATTCATCATATTCGGCGTATTTCCAGCCCGTCAGGCCCGGTGGCTGACGTTAACTGGCTGTGGTGGTTATAGTAAAACGCCGATGCCCTGCCATCCGGCGTGGTGATGCGCGTGATGAGGCCCGTCACCACATCGGACTGTATTCTGTTGTCCTGCCTGCGGCATCGTCTGTGCCCTGGAGCCTGCCCACCGCGTCAAACTGACTCTGCGTGACGCTGCCGTCCGCGTGTTCCTTTTTCACCACCGCTGCAGCCCACCCTGCGTGCAGGACTTCACGGCAGTTCAGGCTGTCGGTGATGGTGATGCGGTCCTTCATACTGATACGTGTAACTTAAGCCTGCCGGGTTTAGGCTGTTCTGTCACCGCCCGTCGCTGTCGTAACGGTAACAGATTTCCGGTCGGCCCGTGTGACGGTGCGCCACCATCCGGCCCGTATATCATCGCCGATAAGCTGCGCACCTGTGTATTGCTGCGGTCATACACCGCCGCCAGTTCGCCGCGGGCGTCATCCATATAGCGCACCAGCGGCGCGGCAGGTAAATTCTCCGGGTATTCCGGGTCGTGCGTCGCCACACGGCGAGAAGACGGATGCCGTTGTCCAGCCATATTCGGTGTAACCCGGCAGGGTATCAGAAAAGCGGACGGTTCCGTCCCGCCGATAAGCCCTGCCGGGCTTCTTCTGCCCGCTGCGCCTGTGGTCAGTACCAGCCGGAAGTGACGCCCGCACCATCCGTCACGCCGGTGATTTCGCCGCTGAATTCACCGGCGGCTTCGCGGTGGAACGTCTGTGTGCGCCCGAAGCGGTCCACCAGCCCGGTCAGTACCCGGTACGGCGGCACGGCGGCAGGCAGCACCTCATCCGCTTCCGGCACCGCTCACACCAGCGAGCAGCCACCACGGCCCCTGCGGACTGTTTGTCGCCAGATAACGATGCGGACTTAAGCGGAGTTCTTCCGGCAGCGCCTGCCAGATGCGGCCAGCCGGTGACCTTCATCCAGTTTCGCCACGCCGCCGCGCACCAGCCACAGTGACTCGCTGCGGCTGTAGCCGTCACCGAAACAGGTGCTCAAATACAGGCTTCTGCCGCCGTTATCACTGAGTATCAGTGTGTTATCCGCAGCTGTAAGCGGATATCCGCAGGCATTTTCCAGCCGGGGCCGAGGCTCCACCGGCGCGGGCGTTTTTGTCCGGTAACTGCTGTAGGTGCGGGAGAGAATGAACGGCAGCGGGCCGGGCAGGGCGATGTCGGTTTCACCGGGAAGGACCTTTGCACCGAGCAGCGGATTGACCGGATGGCCGGACGTCACCCCGCCGGGGCACCCGAACAGGCCACGCCGGTGGGGCACCGATGCGTACCCCGGCTGAACCCTGGACAATGCTACCGCCATACTGCGTCATGTCGCCCTGACGCGCCGCCGGTTTTCCGCTCATCTGCTCATCCTTGTTTTATCGGGTTATTTGTCTGCTGACAGGCGAAACCCTACAGATTTATAAGAGCCAGTGAGATATCTGTCAGATAAGAACAATTAGAAAATATTTATATATATTTCATGAATATATGTTTCGATTGGTATAACGATGTCTAAATATTCCTCTGAACATCTTCCTGATGCAAAAACCGCCAGCGTTTCCGCTGGCGGTTTTCAATAATTCAAAACTCAGCAATCAATAAAATCACCAGTTGCCTTTTCGGCCTGATCCATCCACACCGGTTTATCGCTGGTTTTCGACCAGACGCGATGCAGGTAGCTGTAAAAGCGGGCGCGGTCTTTCCAGAAAAGCATGAGAAGGCAGCGCCAGAACGCCCGCTGCAACCGCATAAGTACGGCGTAAAAAGATAAGCCATGCAGGATATTCTCTGTAGAGTTCCATACTTTTCTCCCCTTTTGTATCTACCCGGTGAATGGCACCGGAAAAATGAATTGTTTATCTGATGAAAATAGTACCGCCTTTTGTGTAATTTTACTACTCATCCGACCACTTATTTTTGCTTATTGATGGTTTATACATTCATCCTGTAATTAAGTTACACAAAAGTTAAATTAATACTAAACATTAGTTAAATCATGGCTTTTGCCATTTTTATACTTTTTTCACCCCGCCCGCAGATTTTTGCGAAATCTTTGCAGCCAGAATTCTACCCTTCCGGTATCACTTTTAGGCCACTGGAGGTGCACTGTGAGTGCAGGCGTGATAACCGGCGTATTGCTGGTGTTTTATTACTGGGTTATCTGGTTTATGCCCTGATCAATGCGGAGGCGTTCTGATGGCTGCGCAAGGGTTCTTACTGATCGCCACGTTTTTACTGGTGTTAATGGTGCTGGCGCGTCCTTTAGGCAGCGGGCTGGCGCGGCTGATTAATGACATTCCTCTTCCCGGTACAACGGGCGTTGAGCGCGTACTTTTTCGCGCCTGGCGTCTCTGACCGTGAGATGAACTGGAAGCAATATCTTTGTGCCATTCTCGGCCTGAACATGCTGGGGCTGGCGGTGCTGTTTTTATGTTGCTCGGTCAGCACTATCTGCCGCTTAATCACAGCAGTGCCAGGGCTGTCATTGGATCTGGCGCTGAATACCGCCGTCAGCTTTGTCACCAATACCAACTGGCAATCTTATAGCGGTGAAACCACGTTGACTATTTCAGCCAGATGGCGGGCTTAACGGTGCAAACTTTCTTTCTGCCGCCAGCGGGATTGCGGTGATTTTGCCCTCATCCGTGCGTTTACCCGCCAGAGCATGAGCACGCTCGAGATGCCTGGGTCGATCTGCTACGCATCACGTTATGATTACTAGTCCTGTGGCGTTGTTGATTGCACTGTTTTTATTCAACAAGGTGCGCTGCAAAACTTTCTGCCTTATCGGGCTGTGAATACCGTTGAAGGAGCGCAACTGGCTGTTTATGGGGCCTGTAGCTTCTCAGGAAGCGATCAAGATGCTCGGTACTAACGGCGGTGGCTTCTTTAATGCCACTCTTCGCATCCGTTTGAACCCAACCGCGACCAACTTCGTGCAGATGCTGGCGATCTTCTTGATCCCAACGGCGCTGTGCTTTGGTGAAGTGATGGGCGATCGCCGCCAGGGGCGCATGTTGCTGTGGGCGATGTCGGTGATTTTGTCATCTGCGTAGGCGTGGTGATATGGGCAGAAGTTCACTGAAGCAGACGCCGGGCTGAGCGACGGAACGTAATGCGTAACTGGG
+>fa215e11-ce27-464d-9a53-f0186fea1dc9 id=59 clr=0,4234
+TATTTCCAGCCCGTCAGGCCCGGTGGCTGACGTTAACTGGCTGTGGTGGTTATAGTAAAACGCCGATGCCCTGCCATCCGGCGTGGTGATGCGCGTGATGAGGCCCGTCACCACATCCGGACTGTATTCTGTTGTCCTGCCTGCGGCATCCGTCTGTGCCCTGAGCCTGCCCACCGCGTCAAACTGACTCTGCGTGACGCTGCCGTCCGCGTGTTCCTTTTCACCACCACTTCAGCCCGCCTTCCCCTGCGTGCAGGACTTCACGGCGGTTCAGGCTGTCGGTGATGGTGATGCGGTCCTTCTCATACTGATACGTGTAACTTAAGCCTGCCGGGTTTAGCTGTTCTGTCACCCGCCCGTCGCTGTCGTAACGGTAACAGATTTCCGGTCGGCCCGTGTGACGGTGCGCCACCATCCGGCCCCGGTATTTATCATCGTAAGTAAAGCTGCGCACCTGTGTATTGCTGCGGTCATACACCGCCGCCAGTTCGCCGCGGGCGTCCAGCCATAGCGCACCAGCGGCGCGGCAGGTAAATTCTCCGGGTATTCCGGGTCGTGCGTCAGCCACACGGCAGACAGACGGATGCCGTTGTCCCGCCATATTCGGTGTAACCCGGCAGGGTATCAGAAAAGCGGACGGTTCCGTCCCGCCGGAAATGGCCTGCTGCCGGGCTTCTTCTGCCCGCTGCGCCTGCGTGGTCAGTACCAGCCGGAAGTGACGCCCGGCACCATCCGTCACGCCGGTGATTTCGCCGCTGAATTCACCGGCGGCTTCGCGGTGGAACGTCTGTGTGCGCCCGAAGCGGTCCACCAGCCCGGTCAGTACCCGGTACGGCGGCAGCGGCGCAGGCAGCACCTCATCCGCTTCCGGCACCCGCTCACACCAGCCGAGCAGCCACCACGGCCCCTGCGGACTGTTTGTCGCCAGATAACGATGCGGACTTAAGCGGAGTTCTTCCGGCAGCGCCTGCCAGAGTGCGGCCAGCCGGTGACCTTCATCCAGTTTCGCCACGCCGCCGCGCACCAGCCACAGTGACTCGCTGCGGCTGTAACCGTCCTCACCGGGAAACAGGTGCTCAAAATACAGGCTTCTGCCGCCGTTATCACTGAGTATCAGTGTGTTATCGCGCAGTGTAAGCGGATATCCGCAGGCATTTTCCAGCCGGGGCCGAGGCTCCCGGCGCGGGCGTTTTGTCCGGTAACTGCTGTAGGTGCGGGAGAGAATGAACGGCAGCGGGCCGGGCAGGGCGATGTCGGTTTCACCGGGAAGGACCTTTGCACCGAGCAGCGGATTGACCGGATGGCCGGACGTCACCCCGCCGGGGCACACCGAACAGGCCACGCCGGTGGGGCACCGATGCGTACCCCGGCTGAACCCTGGACAATGCTACCGCCATACTGCGTCATGTCGCCCTGACGCGCCGCCGGTTTTCCGCTCATCTGCTCATCCTTGTTTTATCGGGTTATTTGTCTGCTGACAGGCGAAACCCTACAGATTTATAAGAAAGCCTTAAGTGAGATATCTGTCAGATAAGAACAATTAGGAAAATATTTATATATATTTCATGATATATGTGATTGGTATATAACGATGTCTAAATATTCCTCTGAACATCTTCCTGATACAAAACCGCCAGCGTTTCCGCTGGCGGTTTTCAATGTATTCAAAACTCAGCAATCAATAAAATCACCAGTTGCCTTTTCGGCCTGATCCATCCACACCGGTTTATCGCTGGTTTTCGACCAGACGCGATGCAGGTAGCTGTAAAAGCGGGCGCGGTCTTTCCAGAAAAGCATGAAAGGCAGCGCCAGAACGCCCGCTGCAACCGCATAAGTACGGCGTAAAAGATAAGCCATGCAGGATATTCTCTGTAGAGTTCCATACTTTTCTCCCCTTTTGTATCTACCCGGTGAATGGCACCGGAAAAATGAATTGTTTATCTGATGAAAATAGTACCGCCTTTTGTGTAATTTTACTACTCAACCACTTATTTTTTATTGATGGTTTATTTACATTCATCCTGTAATTAAGTTACACAAAGTTAAATTAATACTAAACATTAGTTAAATCATGGCTTTTGCCATTTTTATACTTTTACACCCCGCCCGCAGATTTTGCGAAATCTTTGCAGCCAGAATTCTACCCTTCCGGTATCACTTTTAGGCTGGAGGTGCACTGTGAGTGCAGGCGTGATAACCGGCGTATTGCTGGTGTTTTATTACTGGGTTATCTGGTTTATGCCCTGATCAATGCGGAGGCGTTCTGATGGCTGCGCAAGGGTTCTTACTGATCGCCACGTTTTTACTGGTGTTAATGGTGCTGGCGCGTCCTTTAGGCAGCGGGCTGGCGCGCTGATTAATGACATTCCTCTTCCCGGTACAACGGGCGTTGAGCGCGTACTTTTCGCGCACTTGGCGTCTCTGACCGTGAGATGAACTGGAAGCAATATCTTTGTGCCATTCTCGGCCTGAACATGCTGGGGCTGGCGGTGCTGTTTTTATGTTGCTCGGTCAGCACTATCTGCCGCTTAATCCACAGCAGTTGCCAGGGCTGTCGTGGGATCTGGCGCTGAATACCGCCGTCAGCTTTGTCACCAATACTGGCAATCTTATAGCGGTGAAACCACGTTGAGCTATTTCAGCCAGATGGCGGGCTTAACGGTGCAAAACTTTCTTTCTGCCGCCAGCGGGATTGCGGTGATTTTGCCCTCATCCGTGCGTTTACCCGCCAGAGCATGAGCACGCTCGGGAATGCCTGGGTCGATCTGCTACGCATCGTTACGTTATGGGTGCTAGTCCTGTGGCGTTGTTGATTGCACTGTTTTTATTCAACAAGGTGCGCTGCAAAACTTTCTGCCTTATCAGGCTGTGAATACCGTTGAAGGAGCGCAACAGCTGTTACCCATGGGGCCTGTAGCTTCTCAGGAAGCGATCAAGATGCTCGGTACTAACGGCGGTGGCTTCTTTAATGCCAACTCGTCGCATCCGTTTGAAAACCCAACCGCACTGACCAACTTCGTGCAGATGCTGGCGATCTTCTTGATCCCAACGGCGCTGTGCTTTGCCTTTGGTGAAGTGATGGGCGATCGCCGCCAGGGGCGCATGTTGCTGTGGGCGATGTCAGTGATTTTGTCATCTGCGTAGGCGTGGTGATGTGGGCAGAAGTTCAGGGTAATCCTCATCTGCTGGCACTGGGCACGGACAGCAGCATCAATATGGAAGGTAAAGAGAGCCGTTTCGGCGTGCTGGTCAGTAGCCTGTTTGCGGTCGTGACGACGGCGGCTTCCTGTGGCGCGGTGATTGCGATGCATGATTCGTTTACCGCTCGGTGGCATGGTGCCGATGTGGCTGATGCAAATTGGTGAAGTGGTGTTCGGCGGTGTCGGTTCTGGTCTTTACGGCATGATGCTGTTTGTCCTGCTGGCGGTGTTTATTGCCGGGCTGATGATTGGTCGTACACCGGAATATCTGGGTAAAAAATCGACGTACGCGAGATGAAACTGACTGCACTGGCAATTCTGGTTACCCCGACGCTGGTGCTGATGGGCGCGGCGTTGGCGATGATGACCGACGCCGGACGTAGCGCCATGCTCAACCCTGGCCCGCATGGTTTTAGCGAAGTGCTGTACGCCGTGTCATCCGCCGCTAACAACAACGGCAGCGCCTTTGCCGGATTAAGCGCCAACTCTCCGTTCTGGAACTGTTTACTGGCGTTCTGCATGTTTGTCGGTCGCTTCGGGAATTATCCCGGTGATGGCAATTGGTTCGCTGGTGAGTAAAAAGAGCCAAGCCGCCAGCTCCGGCACGCTGCCAACGCACGGCCCGCTGTTTGTTGGCCTGTTAATCGGCACCGTGTTGCTGGTTGGCGCACTGACCTTTATCCCTGCCCTGGCGCTTGGTCGGTCGGTGGCGGAATATCTCCTGATGATATTGAGTGAGCACTGAATATGAGTCGTAAACAACTGGCGCTATTCGAACCAACACTTGTCGTTCAGGCGCTGAAAGAAGCGGTGAAAAAATTAAACCCGCAGGCGCAATGGCGCAATCCGGTGATGTTTATCGTCTGGATCGGCAGTCTGCTGACCACCTGTATTAGCATCGCGATGGCAAACGGTGCGATGCCCGGCAATGCGCTGTTTAGCGCGGCCATTAGCGGTTGGCTGTGGATCACCGTACTGTTCGCTAATTTCGCCGAGGCGCTGGCAGAAGGCCGCAGTAAAGCGCAGGCCAACAA
+>4148f43d-5b21-441b-a6cf-d4044e318987 id=60 clr=0,5010
+GCGTGCTTGTATCGCGAGTCATCCGATCAGAAATGTCTCGCCGGGGTTAACGCTACACTCAATCACCAGCCAGTCAGAAAGAATACGCGTGCCGCCGGTGACGGAGGCAAAATCGCCGGATTCACGGATCACCGGTGCCGATTCCCCGGTGATGGCGCTTTCATCGACCGATGCACCCTTCAATAACTTCACCATCGCAGGGGATAATATCGCCAGCTTCTACCAGTACGATATCGCCTTTACGAAGTTGGTCGGCAGGAACTTTGTCCGCCGCAGCGCCATATTTCGGCTCACGCAGCTTGCGGGCAAAGGCAGTTTTTCACCCTTTCAGACTGTTGGCCTGCGCTTTACTGCGGCCTTCTGCCAGCGCCTCGGCGAAATTAGCGAACAGTACGGTGATCCACAGCCAACCGCTAATGGCCGCGCTAAACAGCGCATTGCCGGGCATCGCACCGCTTGCCATCGCGATGCTAATACAGGTGGTCAGCAGACTGCCGATCCAGACGATAAACATCACCGGATTGCGCCATTGCGCCTGCGGGTTTAATTTTTCACCGCTTCTTTCAGCGCCTGAACGACAAGTGTTGGTTCGAATAGCGCCAGTTGTTTACGACTCATATTCAGTGCTCACTCAATATCATCAGGAGAGATATTCCGCCACCGGACCAAGCGCCAGGGCAGGGATAAAGGTCAGTGCGCCAACCAGCAACACGGTGCCGATTAACAGGCCAACAAACAGCGGGCCGTGCGTTGGCAGCGTGCCGGAGCTGGCGGCTTGGCTCTTTTACTCACCAGCGAACCGGCAATTGCCATCACCGGGATAATCACCCCGAAGCGACCGACAAACATGCAGAACGCCAGTAAACAGTTCCAGAACGGAGAGTTGGCGCTTAATCCGGCAAAGGCGCTGCCGTTGTTGTTAGCGGCGGATGACACGGCGTACAGCACTTCGCTAAAACCATGCGGGCCAGGGTTGAGCATGGCGCTACGTCCGGCGTCGGTCATCATCGCCAACGCCGCGCCCATCAGCACCAGCGTCGGGGTAACCAGAATTGCCAGTGCAGTCAGTTTCATCTCGCGTACGTCGATTTTTTACCCAGATATTCCGGTGTACGACCAATCATCAGCCCGGCAATAAACACCGCCAGCAGGACAAACAGCATCATGCCGTAAAGACCAGAACCGACACCGCCGAACACCACTTCACCAATTTGCATCAGCCACATCGGCACCATGCCACCGAGAGCGGTAAACGAATCATGCATCGCAATCACCGCGCCACAGGAAGCCGCCGTCGTCACGACCGCAAACAGGCTACTGACCAGCACGCCGAAACGGCTCTCTTTACCTTCCATATTGATGCTGCTGTCCGTGCCCAGTGCCAGCAGATGAGGATTACCCTGAACTTCTGCCCACATCACCACGCCTACGCAGATGACAAAATCACTGACATCGCCCACAGCAACATGCGCCCCTGGCGGCGATCGCCCATCACTTCACCAAAGGCAAAGCACAGCGCCGTTGGGATCAAGAAGATCGCCAGCATCTGCACGAAGTTGGTCAGTGCGGTTGGGTTTTCAAACGGATGCGACGAGTTGGCATTAAAGAAGCCACCGCCGTTAGTACCGAGCATCTTGATCGCTTCCTGAGAAGCTACAGGCCCCATGGGTAACAGCTGTTGCGCTCCTTCAACGGTATTCACAGCCTGATAAGGCAGAAAGTTTTGCAGCGCACCTTGTTGAATAAAAACAGTGCAATCAACAACGCCACAGGGACTAGCACCCATAACGTGATGCGTAGCAGATCGACCCAGGCATTCCCGAGCGTGCTCATGCTCTGGCGGGTAAACGCACGGATGAGGGCAAAAATCACCGCAATCCCGCTGGCGGCAGAAAGAAAGTTTTGCACCGTTAAGCCCGCCATCTGGCTGAAATAGCTCAACGTGGTTTCACCGCTATAAGATTGCCAGTTGGTATTGGTGACAAAGCTGACGGCGGTATTCAGCGCCAGATCCCACGACAGCCCTGGCAACTGCTGTGGATTAAGCGGCAGATAGTGCTGACCGAGCAACATAAAAACAGCACCGCCAGCCCCAGCATGTTCAGGCCGAGAATGGCACAAAGATATTGCTTCCAGTTCATCTCACGGTCAGAGACGCCAAGTGCGCGAAAAGTACGCGCTCAACGCCCGTTGTACCGGGAAGAGGAATGTCATTAATCAGCCGCGCCAGCCCGCTGCCTAAAGGACGCGCCAGCACCATTAACACCAGTAAAAACGTGGCGATCAGTAAGAACCCTTGCGCAGCCATCAGAACGCCTCCGCATTGATCAGGGCATAAACCAGATAACCCAGTAATAAAACACCAGCAATACGCCGGTTATCACGCCTGCACTCACAGTGCACCTCCAGTGGCCTAAAAGTGATACCGGAAGGGTAGAATTCTGGCTGCAAAGATTTCGCAAAATCTGCGGGCGGGGTGTAAAAAGTATAAAAATGGCAAAAGCCATGATTTAACTAATGTTTAGTATTAATTTAACTTTTGTGTAACTTAATTACAGGATGAATGTAAATAAACCATCAATAAGCAAAAATAAGTGGTCGGATGAGTAGTAAAATTACACAAAAGGCGGTACTATTTTCATCAGATAAACAAATTCATTTTCCGGTGCCATTCACCGGGTAGATACGGGGAGAAAAGTATGGAACTCTACAGAGAATATCCTGCATGGCTTATCTTTTTACGCCGTACTTATGCGGTTGCAGCGGGCGTTCTGGCGCTGCCTTTCATGCTTTTCTGGAAAGACCGCGCCCGCTTTTACAGCTACCTGCATCGCGTCTGGTCGAAAACCAGCGATAAACCGGTGTGTGGATGGATCAGGCCGAAAAGGCAACTGGTGATTTTATTGATTGCTGAGTTTGAATACATTGAAAACCGCCAGCGGAAACGCTGGCGGTTTTTATCAGGAAGATGTTCAGAGGAATATTTAGACATCGTTATACCAATCGAAACATATATTCATGAAATATATATAAATATTTTCCTAATTGTTCTTATCTGACAGATATCTCACTTAAGGCTTTCTTATAAATCTGTAGGGTTTCGCCTGTCAGCAGACAAATAACCCGATAAAACAAGGATGAGCAGATGAGCGGAAAACCGGCGGCGCGTCAGGGCGACATGACGCAGTATGGCGGTAGCATTGTCCAGGGTTCAGCCGGGGTACGCATCGGTGCCCCACCGGCGTGGCCTGTTCGGTGTGCCCCGGCGGGTGACGTCCGGCCATCCGGTCAATCCGCTGCTCGGTGCAAAGGTCCTTCCCGGTGAAACCGACATCGCCCTGCCCGGCCCGCTGCCGTTCATTCTCTCCCGCACCTACAGCAGTTACCGGAAAAACGCCCGCGCCGGTGGGGAGCCTCGGCCCCGGCTGGAAAATGCCTGCGGATATCCGCTTACAGCTGCGCGATAACACACTGATACTCAGTGATAACGGCGGCAGAAGCCTGTATTTTGAGCACCTGTTTCCCGGTGAGGACGGTTACACCGCAGCGAGTCACTGTGGCTGGTGCGCGGCGGCGTGGCGAAACTGGATGAAGGTCACCGGCTGGCCGCACTCTGGCAGGCGCTGCCGGAAGAACTCCGCTTAAGTCCGCATCGTTATCTGGCGACAAACAGTCCGCAGGGGCCGTGGTGGCTGCTCGGCTGGTGTGAGCGGGTGCCGGAAGCGGATGAGGTGCTGCCTGCGCCGCTGCCGCCGTACCGGGTACTGACCGGGCTGGTGGACCGCTTCGGGCGCACAGACGTTCCACCGCGAAGCCGCCGGTGAATTCAGCGGCGAAATCACCGGCGTGACGGATGGTGCCGGGCGTCACTTCCGGCTGGTACTGACCACGCAGGCGCAGCGGGCAGAAGAAGCCCGGCAGCAGGCCATTTCCGGCGGGACGGAACCGTCCGCTTTCCTGATACCCTGCCGGGTTACACCGAATATGGCCGGGACAACGGCATCCGTCTGTCTGCCGTGTGGCTGACGCACGACCCGGAATACCCGGAGAATTTACCTGCCGCGCCGCTGGTGCGCTATGGCTGGACGCCCGCGGCGAACTGGCGGCGGTGTATGACCGCAGCAATACACAGGTGCGCAGCTTTACTTACGATGATAAATACCGGGGCCGGATGGTGGCGCACCGTCACACGGGCCGACCGGAAATCTGTTACCGTTACGACAGCGACGGGCGGGTGACAGAACAGCTAAACCCGGCAGGCTTAAGTTACACGTATCAGTATGAGAAGGACCGCATCACCATCACCGACAGCCTGAACCGCCGTGAAGTCCTGCACGCAGGGTGAAGGCGGGCTGAAGGGTGGTGAAAAGGAACACGCGGACGGCAGCGTCACGCAGAGTCAGTTTGACGCGGTGGGCAGGCTCAGGGCACAGACGGATGCCGCAGGCAGGACAACAGAATACAGTCCGGATGTGGTGACGGGCCTCATCACGCGCATCACCACGCCGGATGGCAGGGCATCGGCGTTTTACTATAACCACCACAGCCAGTTAACGTCAGCCACCGGGCCTGACGGGCTGGAAATACGCCGGGAATATGATGAATGGGGCCGTCTGATTCAGGAAACTGCCCCTGACGGCGATATCACCCGCTACCGTTATGATAATCCACACAGTGACTTACCCTGCGCAACGGAAGATGCCACCGGCGGAAAACCATGACGTGGAGCCGTTACGGTCAGTTGCTGAGCTTCACTGACTGTTCCGGTTATGTAACCCGCTATGACCATGACCGTTTTGGTCAGGTGACGGCGGTGCACCGCGAGGAAGGGCTGAGTCAGTACCGCGCATACGACAGCCGTGGACAGTTAATTGCCGTGAAAGACACGCAGGGCCATGAAACGCGGTATGAATACAACGCCGCCGGTGACCTGACCACCGTCATTGCCCCGGACGGCAGCAGAAACGGGACACAGTACGATAAACATCGAAGCAGACGCCGAAGATGGGG
+>8f548fb1-92c4-43a0-a032-74593f3988d4 id=61 clr=0,9636
+ATCATTGGTACTTCGTTCAGTTACGTATTGCTACTTGCCTGTCGCTCTAGCTTCGGCGTCTGCTTGGGTGTTTAACCTATAACGGCAAAAATAGTCAATAGTAGGATGCCTGGACAATTTATGCTCTACTTTCCAGGCTTATCTGTAATCGGGAATAATAGAAATATGTTCCATCAATTTTTAAGTTCCATTTGTTCACCTTATTTATGTAAGGAGTATTTGATCATGTATAAGCTATGAAAAACAGCTTTAGGTAATAAGGAATATCTCAATTTTTAAACATAAAATGCGAATTATTTAGTACAAAAAGTAGCGTTACGTGATCTTTCCTGGGATACAACTCTGGCAATGGTATCGTGAACAGGAATACCATTTTCAAAATCACCATATTGCTTCAAAAAATCGAGATGTGTTTCCCGAAATCCTCTATATCTTCCCAACCTTCTGCACCAGAAATAACGGCACAAATAGTCAACAGTAGAATATATCTGACAATTTATGCACACTTTCCAGGCTTGTCTGTAATCGGGTGTAATAGAAATATGTTCCATCAATTTTTAAGTTCCATTTGTTCACCTTATTTATGTAAGGAGTATTTGATCATGTATAAGCTATGAAAAACAGCTTTAGACAATAAGTAGTATCTCAATTGTTGAACTTAAATTCGAATTATTTAGTACAAAAAGTAGCGTTACGTGATCTTTCCTGCAAATGGAACGCAAAATAAACACCTATTCCATGAGTTATATAATTTTTCACAATGATTAATTTGTTTTCTCAGGAAGAGATTTTATTTCTCTTCACTACGAATTAGTTCATGCTGTATCTTTATTAAACATTCGTAAGACTCATTTTTGTTCGGGAGATGTGCTGTCATTCGAGCATAAGTTGGTTTCTCATCTTTAAAATATTTTACCATGATTGAATTATCAAGGACTGCCAACAACTGAACTGGATCACTGCTCTTTTGATAGATACCCGCTCTTATATAACTTCTAAACCGATCGCCGAGAAACGCCGTTTTTCTGCTGTATTTATCAACTCCTGCAACGTTCCTTTGATGGCATGATTTTCATTAAGGCGTAGTGACCCGACGCGAATTAAGAGTCTCGCCCGCTTGGTGTGAATTTATTATTTTTACATGTACCCAGTTCTGTTTGCCAATAATACTCACCGATGTCCTCATTCTGATACCATCTCCACATGGCTTTATTATTTAAGACAGGAAACGCGGAAAAATAGTACCCTTAGCGAAAATAGTAAAACAATCATGATCTTTAGCTTGTATTTCGCAATCAGCTATAACACCAAAACTAACAAATATCATCAGCAAAAAGAACAAAACTCTTTTCATTTTCTTATTCCTCTCGATGTTCTCTGTTTCATCTTAGCTAAAATTTCACCCAAATCATCTATCCCTGCTGTTGCTGGCCCATCGGGTTTATTAATGTCTGGGAATAAATAGGTTCTGCACAAGTATATCCTGGTGGTAATTGAGTTGTTGGCCAATTTGTCTGTGGCAGGTAATCACTTGCTGTCTTTGTATCCATCCCTGGATACTGGGAATCATCCTGTGGCGTACAAGTCAGATTTGGTTTTACCCACTTCCTGCAATACAGTGTGTAGTCGTAGGGCTTAATGCTCTGAAGAATGTTTTGAAAACATTAGGCGCACTACTGGCCTGGTCAATAGGATATGGCAGTCTTAATTGTTTCGCTATGTCCGGCAATTTACTTGGATCGGGCGTAGGCGGTTTGTTGGGTCTCGCTCCATATCCGCCATTATTTAAGTGTCCATATTTTGATGCCAGTCCCATTGAATCTATATACTGAACCGGATTCAGCGGATACTGATAAAATTCCATCCCCTTCAGCCCAATCGGATCCTGAGTGATATACCTCCCTGCAGCGGGTCATAATAGCGGTGGCGGTTGTAATACAGGCCGGACTCCTCATCATACTGCTGCCCCGGCAGGCGGATAAGCTGCTGCAGCTGATGCGGGTTCTCTTCATTCAGCAGGTTGCCCCATTCATCGTATTCTGCGCACCATTCTGTTGCCCCTTCCGTGCTGACAAGCGCCAGCGGCAGGCCGCGATGGTCGCAGTGGTACAGGTGGATTTTTCGCGCCGGCGTGTACACCGGGTCCATCTGGTTTTGCATCTGCTCCACCGTCAGGCCGCACGATGCCAGCCAGCGGCGGCTTTCCTCACTCACCCGGTCAGCCAGGATTTCACTTTCCAGCCGGTCGAGCATCTGCACCAGCACCGGCGGGAACACCACTGCCACCGTCTTCGCCGCCGGACTGCTGAAGGGTATCCGCCAGGCTGCGGCGCTGCGTTTTCGCCAGCTCACCGGTGGCGGTTTCAACCCTGATGAGTGGCGTGAAGCTCCCCGGCTGATAAATCGTCTGGATGCGGGTTCTGTCGTTCTGTATCGTGGTCAGGCGGTCGCCGTCCCAGCCGTACCAGGTCACTTGCGGTTTCCGTGACAGCGACATCCAGCCCGTCAGGTCCCGTTCACGTCGCCACACCCGTTTTGCCACCCTGCGGCCCAGCGGGTCGTAAAGATAGCGGCTTTCGACCAGCGGCTCTGCATATTGTGTCCGCGTGTAGTGCACCAGCCGGTGCTGACTGTCGTAATGGTACCGGTGGGTGCGCTCATCATCCGTGCGGATAACCCTTCCGGATGAGGTCGGTTTTCTCCGTCAGCCTGCCGTGACGGTCATACCGGTAAAGATAGTGCGCGTCACGGGCGATACGGTTATCCGGCCACATGCTGAGGGTGCTGTCCGGTGCAGCTCCGGGTCGGGCAGGCGGTTACCTGCCGGGTCTGTGGCATACGGGATATCAATGCCCAGGTTACATATAATAATAAGAGCAATTAACTTTTTATTTGTTTATAATGCGCTTACTTAATACAAACCATTGAATATACCCTCCTGACAGAAAATAAAGCCATATTATTATCGCCATAATATACTTACTATCAACCCTTACGCCAATAATGTCTGATACAGTCCCTATAAATATTAGAGCAATAAAGAATACTATGCCTGTTGGAAAACATATTACCATCATTCCATAGACATGAGACTAATTAACTCGCTCACATCACGAGTGGAGTCTAATAGTGAAAGTCTATGCATGGAAAAGAATAGTATTAAAAGCGATAAAGCCAGCCATATAGCTCTGAATAAAAAATAATATATTTCATTACATCACTCCGGTGAATACAAATCTAATAAAACGTCCAATGTTATTTCCGGAGCACTTCATCTTACATGTTTCTAAAGAATCATTAGACCAGTCTTGGCAGTTTTAAATAGCCCTAAATTTATAGGTGTGCGAATATATCAGGCAATACAGAATAACGCGGCCTTACCTCTTTAAACTTCCTTTTAAACAGTTCTCCACACAACTATTATCGGTTTCAACGAGGTCACAACGGCCAGCAGCTTCTTTGTATCATTACTTGCTTTACCTGGCCCCCATAGACCATCTCCTTTGATTCTCCCCGTTGGTCTTGGCCACCACAAGTATAGTCCCTTTACCATCTGGGACACAAAGATATTGATGATAGAACGGATTCCCCATATATCTGGACCGCTTCTTTCACCAGTTCCGCCCATTGAATGCAGTGGCTTAATGCATTTTAGTGTTTCTAATCCTAATGGATCTATATTTGAGATCGGATTCAACGGATACTGATAAAATTCCATCCCCTTTCAGCCCAATCGGATCCTGAGTGATATCGCCCCTGCAGCGGGTCATAATAGCGGTGGCGGTTGTAATACAGGCCGGACTCCTCATCATACTGCTGCCCCGGCAGGCGGATAAGCTGCTGCAGCTGATGCGGGTTCTCTTCATTCAGCAGGTTACCCCATTCATCGTATTCTGCGTACCACGCTGTTGTCCCTTCCGTGCTGATATGGGCCAGCGGCAGGCCGCGATGGTCGCAGTGGTACAGGTGAATTTTTCGCGCCGGCGTGTATACCGGGTCCATCTGGCTTTGCATCTGCGCCACCGTCAGGCCGCACGATGCCAGCCAGCGGCGGCTCACTCACCCGGTCAGCCAGGATTTCACTTTCCAGCCGGTCGAGCATCTGCACCAGCACCGGCGGGAACACCACTGCCACCGTCTTCGCCACCGGACTGCTGAAGGGTATCCGCCAGGCTGCGGCGCTGCGTTTTCGCCAGCTCACCGGTGGCGGTTTCAACCCTGATGAGTGGCGTGGCTCCCCGGCTGATAAATCGTCTGGATGCGGGTTCTGTCGTTCTGTATCGTGGTCAGGCGGTCGCCGTCCCAGCCGTACCAGGTCACTTGCGGTTTCCGTGACAGCGACATCCAGCCCGTCAGGTCCCGTTCACGCCGCCATACCCGTTTTGCCACCCTGCGGCCCAGCGTCGTAAAGATAGCGACTTTCGACCAGCGGCTCTGCATATTGTGTCCGCGTGGTGCACCAGCCGGTGCTGACTGTCGTAATGGTACCGGTGGGTGCGCTCATCATCCGTGCGGATAACCCTTCCGGGATGAGGTCGGTTTCTCTGTCAGCCTGCCGTGACGGTCATACCGGTAAAGATAGTGCGCGTCACGGGCGATACGGTTATCCGGCCACATGCTGAGGGCGCTGTCCGGGTGCAGCTCCGGGTCGGGCAGGCGGTTACCTGCCGGGTCTGTGGTATACGGGATGCGGATATCCAGATTCGCTGCGGTGGTGTGAACGCCGGTCAGCCTGCCGGTGGTGCTGTAGCTGTAACTCCGGGTCTGGCGCGGGCTGCTGATGCGGATGAGTTCGCCGTTGTCGTTCCAGGTGTAATCGCGGTCAGACAGCAGGCTGTTCAGGTGCTGGCTCTGTAACTGCCCGGCAGGGTATAAGCGGTGGTGAGTTCATAACGGCCGAAGCTGCGCAGCGTTTCCCGTGCAGGCGGTCGCGGGTGTACTCCACCAGCGGTGTGTCGCCGAGTTTCATGCCTGACAGCCAGCCGCTGCCGTAGGTCAGCCATTCCACGGCGGGCAGGCTGTCCGGTATACAGCGGTTCGCCAGTCCCTGTGCGTTGTACGCATGTCTGGTCTCATGCTGCCAGAGCAGTTCATTCGTCTGCGGATGATGCACCGTCAGGTGTTCACTGGCGAGGCGGCCTTTACTGTCATAACCATAGTGCACCGTCACCCGGTGCCCTTCGCTGATATGGCTGATGTCTGTCAGCCAGCCGCGTTCGTCATACTGCCACCGCTCTGCGGTTTCGCCATTCACGGTGCGGTGCGTGAGGCGGTCTGCTTCGTCATAGTGCCAGTGGGTGACCAGCCCCTCATCCTCGCTGCGGATAAGTTTGCCGGTCAGGTCGTGGTGATAACGCTGTGTGCGGCCGTCAAAGCCGGTTTCCTGTATCAGCCGGTCGAGTACATCGTAACGGAAGGTGGTGTGGCTGCCGTTTTCACTGGTCAGGCGGATGACCCGTCCGGCAGCATCGTATTCCATACTGCGCGTCAGACCGCCCTGCGTGGTACAGATGGCTTTTCCCCACGCATCGTACTGTGTCCCGTTTCTGCTGCCGTCCGGGGCAATGACGGTGGTCAGGTCACCGGCGGCGTTGTATTCATACCGCGTTTCATGGCCCTGCGTGTCTTTCACGGCAATTAACTGTCCACGGCTGTCGTATGCGCGGTACTGACTCAGCCCTTCCTCGCGGTGCACCGCCGTCACCTGACCAAAACGGTCATGGTCATAGCGGGTTACATAACCGGAACAGTCAGAAGCTCAGCAACTGACCGTAACGGCTCCACGTCATGGTTTTCCGGCTGCCGGTGGCATCTTCCGTTGCGCAGGGTAAGTCACTGTGTGGATTATCATAACGGTAGCGGGTGATATCGCCGTCAGGGGCAGTTTCCTGAATCAGACGGCCCCATTCATCATATTCCCGGCGTATTTCCAGCCCGTCAGGCCCGGTGGCTGACGTTAACTGGCTGTGGTGGTTATAGTAAAACGCCGATGCCCTGCCATCCGGCGTGGTGATGCGCGTGATGAGGCCCGTCACCACATCCGGACTGTATTCTGTTGTCCTGCCTGCGGCATCCGTCTGTGCCCTGAGCCTGCCCACCGCGTCAAACTGACTCTGCGTGACGCTGCCGTCCGCGTGTTCCTTTTCACCACCCGCTTCAGCCCGCCTTCACCCTGCGTGTGCAGGACTTCACGGCGGTTCAGGCTGTCGGTGATGGTGATGCGGTCCTTCTCATACTGATACGTGTAACTTAAGCCTGCCGGGTTTAGCTTTCTGTCACCCGCCCGTCGCTGTCGTAACGGTAACAGATTTCCGGTCGGCCCGTGTGACGGTGCGCCACCATCCGGCCCCGGTATTTATCATCGTAAGTAAAGCTGCGCACCTGTGTATTGCTGCGGTCATACACCGCCGCCAGTTCGCCGCGGGCGTCCAGCCATAGCGCACCAGCGGCGCGGCAGGTAAATTCTCCGGGTATTCCGGGTCGTGCGTCAGCCACGGCAGACAGACGGATGCCGTTGTCCCGGCCATATTCGGTGTAACCCGGCAGGGTATCAGGAAAAGCGGACGGTTCCGTCCCGCCGGAAATGGCCTGCTGCCGGGCTTCTTCTGCCCGCTGCGCCTGCGTGGTCAGTACCAGCCGGAAGTGACGCCCGGCACCATCCGTCACGCCGGTGATTTCGCCGCTGAATTCACCGGCGGCTTCGCGGTGGAACGTCTGTGTGCGCCCGAAGCGGTCCACCAGCCCGGTCAGTACCCGGTACGGCGGCAGCGGCGCAGGCAGCACCTCATCCGCTTCCGGCACCCGCTCACACCAGCCGAGCAGCCACCACGGCCCCTGCGGACTGTTTGTCGCCAGATAACGATGCGGACTTAAGCGGAGTTCTTCCGGCAGCGCCTGCCAGAGTGCGGCCAGCCGGTGACCTTCATCCAGTTTCGCCACGCCGCCGCACCAGCCACAGTGACTCGCTGCGGCTGTAACCGTCCTCACCGGGAAACAGGTGCTCAAAATACAGGCTTCTGCCGCCGTTATCACTGAGTATCAGTGTGTTATCGCGCAGCTGTAAGCGGATATCCGCAGGCATTTTCCAGCCGGGGCCGAGGCTCCCCACCGGCGCGGGCGTTTTGTCCGGTAACTGCTGTAGGTGCGGGAGAGAATGAACGGCAGCGGGCCGGGCAGGGCGATGTCGGTTTCACCGGGAAGGACCTTTGCACCGAGCAGCGGATTGACCGGATGGCCGGACGTCACCCGCCGGGGCACCCGAACAGGCCACGCCGGTGGGGCACCGATGCGTACCCCGGCTGAACCCTGGACAATGCTACCGCCATACTGCGTCATGTCGCCCTGACGCGCCGCCGGTTTTCCGCTCATCTGCTCATCCTTGTTTTATCGGGTTATTTGTCTGCTGACAGGCGAAACCCTACAGATTTATAAGAAAGCCTTAAGTGAGATATCTGTCAGATAAGAACAATTAGGAAAATATTTATATATATTTCATGAATATATGTTTCGATTGGTATAACGATGTCTAAATATTCCTCTGAACATCTTCCTGATACAAAAACCGCCAGCGTTTCCGCTGGCGGTTTTCAATGTATTCAAAACTCAGCAATCAATAAAATCACCAGTTGCCTTTTCGGCCTGATCCATCCACACCGGTTTATCGCTGGTTTTCGACCAGACGCGATGCAGGTAGCTGTAAAAGCGGGCGCGGTCTTTCCAGAAAAGCATGAAAGGCAGCGCCAGAACGCCCGCTGCAACCGCATAAGTACGGCGTAAAAGATAAGCCATGCAGGATATTCTCTGTAGAGTTCCATACTTTTCTCCCGTATCTACCCGGTGAATGGCACCGGAAAAATGAATTTGTTTATCTGATGAAAATAGTACCGCCTTTTGTGTAATTTTACTACTCATCCGACCACTTATTTTTGCTTATTGATGGTTTATTTACATTCATCCTGTAATTAAGTTACACAAAGTTAAATTAATACTAAACATTAGTTAAATCATGGCTTTTGCCATTTTATACTTTTACACCCCGCCCGCAGATTTTGCGAAATCTTTGCAGCCAGAATTCTACCCTTCCGGTATCACTTTTAGGCCACTGGAGGTGCACTGTGAGTGCAGGCGTGATAACCGGCGTATTGCTGGTGTTTTATTACTGGGTTATCTGGTTTATGCCCTGATCAATGCGGAGGCGTTCTGATGGCTGCGCAAGGGTTCTTACTGATCGCCACGTTTTTACTGGTGTTAATGGTGCTGGCGCGTCCTTTAGGCAGCGGGCTGGCGCGGCTGATTAATGACATTCCTCTTCCCGGTACAACGGGCGTTGAGCGCGTACTTTTCGCGCACTTGGCGTCTCTGACCGTGAGATGAACTGGAAGCAATATCTTTGTGCCATTCTCGGCCTGAACATGCTGGGGCTGGCGGTGCTGTTTTATGTTGCTCGGTCAGCACTATCTGCCGCTTAATCCACAGCAGTTGCCAGGGCTGTCGTGGGATCTGGCGCTGAATACCGCCGTCAGCTTTGTCACCAATACCAACTGGCAATCTTATAGCGGTGAAACCACGTTGAGCTATTTCAGCCAGATGGCGGGCTTAACGGTGCAAAACTTTCTTTCTGCCGCCAGCGGATTGCGGTGATTTTGCCCTCATCCGTGCGTTTACCCGCCAGAGCATGAGCACGCTCGGGAATGCCTGGGTCGATCTGCTACGCATCACGTTATGGGTGCTAGTCCTGTGGCGTTGTTGATTGCACTGTTTTTATTCAACAAGGTGCGCTGCAAAACTTTCTGCCTTATCAGGCTGTGAATACCGTTGAAGGAGCGCAACAGCTGTTACCCATGGGGCCTGTAGCTTCTCAGGAAGCGATCAAGATGCTCGGTACTAACGGCGGTGGCTTCTTTAATGCCAACTCGTCGCATCCGTTTGAAAACCCAACCACTGACCAACTTCGTGCAGATGCTGGCGATCTTCTTGATCCCAACGGCGCTGTGCTTTGCCTTTGGTGAAGTGATGGGCGATCGCCGCCAGGGCGCATGTTGCTGTGGGCGATGTCAGTGATTTTGTCATCTGCGTAGGCGTGGTGATGTGGGCAGAAGTTCAGGGTAATCCTCATCTGCTGGCACTGGGCACGGACAGCAGCATCAATATGGAAGGTAAAGAGAGCCGTTTCGGCGTGCTGGTCAGTAGCCTGTTTGCGGTCGTGACGACGGCGGCCTGTGGCGCGGTGATTGCGATGCATGATTCGTTTACCGCTCTCGGTGGCATGGTGCCGATGTGGCTGATGCAAATTGGTGAAGTGGTGTTCGGCGGTGTCGGTTCTGGTCTTTACGGCATGATGCTGTTTGTCCTGCTGGCGGTGTTTTTGCCGGGCTGATGATTGGTCGTACACCGGAATATCTGGGTAAAAAATCGACGTACGCGAGATGAAACTGACTGCACTGGCAATTCTGGTTACCCCGACGCTGGTGCTGATGGGCGCGGCGTTGGCGATGATGACCGACGCCGGACGTAGCGCCATGCTCAACCCTGGCCCGCATGGTTTTAGCGAAGTGCTGTACGCCGTGTCATCCGCCGCTAACAACAACGGCAGCGCCTTTGCCGGATTAAGCGCCAACTCTCGTTCTGGAACTGTTT
+>4205dba9-c9b2-4574-a9e3-25b8f7bfc601 id=62 clr=0,2345
+ATCGGTATTACTTCGTTCAGTTACGGCGTATTGCTTTTCTGTGTTGGTGCTGATATTGCGGCGTCTGCTTGGGTGTTTAACCTGTACAGCGTGGCGGTTGCCAGTAAAAAGATAGTCAGGGCAATCAGCAGAATGGTCAGGGCAATTTCGTTCGGCGTTTTGCGTCGCTGTGCGCCTTCCACCATCGCGATCATCCGATCCAGAAATGTCTCGCCGGGGTTAACGCTACACTCAATCACCAGCCAGTCAGAAAGAATACGCGTGCCGCCGGTGACGGAGGCAAAATCGCCGCCAGATTCACGGATCACCGGTGCCGATTCCCCGGTGATGGCGCTTTCATCGACCGATGCACCCCTTCAATAACTTCACCATCGCAGGGGATAATATCGCCAGCTTCTACCAGTACGATATCGCCTTTACGAAGTTGGTCGGCAGGAACTTTGTCCGCCGCAGCGCCATATTTCGGCTCACGCAGCTTGCGGGCAAAGGCAGTTTTTCACCTTTCAGACTGTTGGCCTGCGCTTTACTGCGGCCTTCTGCCAGCGCCTCGGCGAAATTAGCGAACAGTACGGTGATCCACAGCCAACCGCTAATGGCCGCGCTAAACAGCGCATTGCCGGGCATCGCACCGCTTGCCATCGCGATGCTAATACAGGTGGTCAGCAGACTGCCGATCCAGACGATAAACATCACCGGATTGCGCCATTGCGCCTGCGGGTTTAATTTTTCACCGCTTCTTTCAGCGCCTGAACGACAAGTGTTGGTTCGAATAGCGCCAGTTGTTTACGACTCATATTCAGTGCTCACTCAATATCATCAGGAGAGATATTCCGCCACCGGACCAAGCGCCAGGGCAGGGATAAAGGTCAGTGCGCCAACCAGCAACACGGTGCCGATTAACAGGCCAACAAACAGCGGGCCGTGCGTTGGCAGCGTGCCGGAGCTGGCGGCTTGGCTCTTTTACTCACCAGCGAACCGGCAATTGCCATCACCGGGATAATCACCCCGAAGCGACCGACAAACATGCAGAACGCCAGTAAACAGTTCCAGAACGGAGAGTTGGCGCTTAATCCGGCAAAGGCGCTGCCGTTGTTGTTAGCGGCGGATGACACGGCGTACAGCACTTCGCTAAAACCATGCGGGCCAGGGTTGAGCATGGCGCTACGTCCGGCGTCGGTCATCATCGCCAACGCCGCGCCCATCAGCACCAGCGTCGGGGTAACCAGAATTGCCAGTGCAGTCAGTTTCATCTCGCGTACGTCGATTTTTACCCAGATATTCCGGTGTACGACCAATCATCAGCCCGGCAATAAACACCGCCAGCAGGACAAACAGCATCATGCCGTAAAGACCAGAACCGACACCGCCGAACACCACTTCACCAATTTGCATCAGCCACATCGGCACCATGCCACCGAGAGCGGTAAACGAATCATGCATCGCAATCACCGCGCCACAGGAAGCCGCCGTCGTCACGACCGCAAACAGGCTACTGACCAGCACGCCGAAACGGCTCTCTTTACCTTCCATATTGATGCTGCTGTCCGTGCCCAGTGCCAGCAGATGAGGATTACCCTGAACTTCTGCCCACATCACCACGCCTACGCAGATGACAAAAATCACTGACATCGCCCACAGCAACATGCGCCCTGGCGGCGATCGCCCATCACTTCACCAAAGGCAAAGCACAGCGCCGTTGGGATCAAGAAGATCGCCAGCATCTGCACGAAGTTGGTCAGTGCGGTTGGGTTTTCAAACGGATGCGACGAGTTGGCATTAAAGAAGCCACCGCCGTTAGTACCGAGCATCTTGATCGCTTCCTGAGAAGCTACAGGCCCCATGGGTAACAGCTGTTGCGCTCCTTCAGCGGTATTCACAGCCTGATAAGGCAGAAAGTTTTGCAGCGCACCTTGTTGAATAAAAACAGTGCAATCAACAACGCCACAGGGACTAGCACCCATAACGTGATGCGTAGCAGATCGACCCAGGCATTCCCGAGCGTGCTCATGCTCTGGCGGGTAAACGCACGGATGAGGGCAAAATCACCGCAATCCCGCTGGCGGCAGAAAGAAAGTTTTGCACCGTTAAGCCCGCCATCTGGCTGAAATAGCTCAACGTGGTTTCACCGCTATAAGATTGCCAGTTGGTATTGGTGACAAAGCTGACGGCGGTATTCAGCGCCAGATCCCACGACAGCCCTGGCAACTGCTGTGGATTAAGCGGCAGATAGTGCTGACCGAGCAACATAAAACAGCACCGCCAGCCCCAGCATGTTCGAAGGCCGAGAATGGCACAAAGATATTGCTTCCAGTTCATCTCACGCGAGAGCAGACGCGCGAAAAGTT
+>fb54982a-a9ad-4aeb-82e8-a4eea0e527a1 id=63 clr=0,3343
+TTGGTAACACTTCGTTCAGTTACGTAACGCTTTTCTGTTGGTGCTGATATTGCGGCGTCTGGCGGGTGTTTTCCTGCCAGCTCACCGGTGGCGGTTTCAACCCTGATGAGTGGCGTGAAGCTCCCCGGCTGATAAATCGTCTGGATGCGGGTTCTGTCGTTCTGTATCGTGGTCAGGCGGTCGCCGTCCCAGCCGTACCAGGTCACTTGCGGTTTCCGTGACAGCGACATCCAGCCCGTCAGGTCCCGTTCACGCCGCCATACCCGTTTTGCCACCCTGCGGCCCAGCGGGTCGTAAAGATAGCGACTTTCGACCAGCGGCTCTGCATATTGTGTCCGCGTGTAGTGCACCAGCCGGTGCTGACTGTCGTAATGGTACCGGTGGGTGCGCTCATCATCCGTGCGGATAACCCCTTCCGGGATGAGGTCGGTTTTCTCTGTCAGCCTGCCGTGACGGTCATACCGGTAAAGATAGTGCGCGTCACGGGCGATACGGTTATCCGGCCACATGCTGAGGGCGCTGTCCGGGTGCAGCTCCGGGTCGGGCAGGCGGTTACCTGCCGGGTCTGTGGTATACGGGATGCGGATATCCAGATTCGCTGCGGTGGTGTGAACGCCGGTCAGCCTGCCGGTGGTGCTGTAGCTGTAACTCCGGGTCTGGCGCGGGCTGCTGATGCGGATGAGTTCGCCGTTGTCGTTCCAGGTGTAATCGCGGTCAGACAGCAGGCTGTTCAGGTGCTGGCTCTGTAACTGCCCGGCAGGGGTATAAGCGGTGGTGAGTTCATAACGGCCGAAGCTGCGCAGCGTTTCCCGGTGCAGGCGGTCGCGGGTGTACTCCACCAGCGGTGTGTCGCCGAGTTTCATGCCTGACAGCCAGCCGCTGCCGTAGGTCAGCCATTCCACGGCGGGCAGGCTGTCCGGTATACAGCGGTTCGCCAGTCCCTGTGCGTTGTACGCATGTCTGGTCTCATGCTGCCAGAGCAGTTCATTCGTCTGCGGATGATGCACCGTCAGGTGTTCACTGGCGAGGCGGCCTTTACTGTCATAACCATAGTGCACCGTCACCCGGTGCCCTTCGCTGATATGGCTGATGTCTGTCAGCCAGCCGCGTTCGTCATACTGCCACCGCTCTGCGGTTTCGCCATTCACGGTGCGGTGCGTGAGGCGGTCTGCTTCGTCATAGTGCCAGTGGGTGACCAGCCCTCATCCTCGCTGCGGATAAGTTTGCCGGTCAGGTCGTGGTGATAACGCTGTGTGCGGCCGTCAAAGCCGGTTTCCTGTATCAGCCGGTCGAGTACATCGTAACGGAAGGTGGTGTGGCTGCCGTTTTCACTGGTCAGGCGGATGACCCGTCCGGCAGCATCGTATTCCATACTGCGCGTCAGACCGCCCTGCGTGGTACAGATGGCTTTTCCCCACGCATCGTACTGTGTCCCGTTTCTGCTGCCGTCCGGGAATGACGGTGGTCAGGTCACCGGCGGCGTTGTATTCATACCGCGTTTCATGGCCCTGCGTGTCTTTCACGGCAATTAACTGTCCACGGCTGTCGTATGCGCGGTACTGACTCAGCCCTTCCTCGCGGTGCACCGCCGTCACCTGACCAAAACGGTCATGGTCATAGCGGGTTACATAACCGGAACAGTCAGTGAAGCTCAGCAACTGACCGTAACGGCTCCACGTCATGGTTTTCCGGCTGCCGGTGGCATCTTCCGTTGCGCAGGGTAAGTCACTGTGGATTATCATAACGGTAGCGGGTGATATCGCCGTCAGGGGCAGTTTCCTGAATCAGACGGCCCCATTCATCATATTCCCGGCGTATTTCCAGCCCGTCAGGCCCGGTGGCTGACGTTAACTGGCTGTGGTGGTTATAGTAAAACGCCGATGCCCTGCCATCCGGCGTGGTGATGCGCGTGATGAGGCCCGTCACCACATCCGGACTGTATTCTGTTGTCCTGCCTGCGGCATCCGTCTGTGCCCTGAGCCTGCCCACCGCGTCAAACTGACTCTGCGTGACGCTGCCGTCCGCGTGTTCCTTTTCACCACCCGCTTCAGCCCGCCTTCACCCTGCGTGTGCAGGACTTCACGGCGGTTCAGGCTGTCGGTGATGGTGATGCGGTCCTTCTCATACTGATACGTGTAACTTAAGCCTGCCGGGTTTAGCTGTTCTGTCACCCGCCCGTCGCTGTCGTAACGGTAACAGATTTCCGGTCGGCCCGTGTGACGGTGCGCCACCATCCGGCCCCGGTATTTATCATCGTAAGTAAAGCTGCGCACCTGTGTATTGCTGCGGTCATACACCGCCGCCAGTTCGCCGCGGGGCGTCCAGCCATAGCGCACCAGCGGCGCGGCAGGTAAATTCTCCGGGTATTCCGGGTCGTGCGTCAGCCACACGGCAGACAGACGGATGCCGTTGTCCCGGCCATATTCGGTGTAACCCGGCAGGGTATCAGGAAAAGCGGACGGTTCCGTCCCGCCGGAAATGGCCTGCTGCCGGGCTTCTTCTGCCCGCTGCGCCTGCGTGGTCAGTACCAGCCGGAAGTGACGCCCGGCACCATCCGTCACGCCGGTGATTTCGCCGCTGAATTCACCGGCGGCTTCGCGGTGGAACGTCTGTGTGCGCCCGAAGCGGTCCACCAGCCCGGTCAGTACCCGGTACGGCGGCAGCGGCGCAGGCAGCACCTCATCCGCTTCCGGCACCCGCTCACACCAGCCGAGCAGCCACCACGGCCCCTGCGGACTGTTTGTCGCCAGATAACGATGCGGACTTAAGCGGAGTTCTTCCGGCAGCGCCTGCCAGTGCGGCCAGCCGGTGACCTTCATCCAGTTTCGCCACGCCGCCGCGCACCAGCCACAGTGACTCGCTGCGGCTGTAACCGTCCTCACCGGGAAACAGGTGCTCAAAATACAGGCTTCTGCCGCCGTTATCACTGAGTATCAGTGTGTTATCGCGCAGCTGTAAGCGGATATCCGCAGGCATTTTCCAGCCGGGGCCGAGGCTCCCCACCGGCGCGGGCGTTTTGTCCGGTAACTGCTGTAGGTGCGGAGAGAATGAACGGCAGCGGGCCGGGCAGGGCGATGTCGGTTTCACCGGGAAGGACCTTTGCACCGAGCAGCGGATTGACCGGATGGCCGGACGTCACCGCCGGGGCACACCGAACAGGCCACGCCGGTGGGGCACCGATGCGTACCCCGGCTGAACCCTGGACAATGCTACCGCCATACTGCGTCATGTCGCCCTGACGCGCCGCCGGTTTTCCGCTCATCTGCTCATCCTTGTTTTATCGGGTTATTTGTCTGCTGACAGGCAAACCCGAAGCAGACGCCGAAGATAGAGCGACAGGCAA
+>a6ec2107-dc02-44f1-96cc-704dfe885902 id=64 clr=0,4315
+TTCCATCCCCTTTCAGCCCAATCGGATCTGGTGATATATCGCCCCTGCAGCGGGTCATAATAGCGGTGGCGGTTGTAATACAGGCCGGACTCCTCATCATACTGCTGCCCCGGCAGTGGATAAGCTGCTGCAGCTGATGCGGGTTCTCTTCATTCAGCAGGTTACCCCATTCATCGTATTCTGCGTACCACGCTGTTGTCCCTTCCGTGCTGATAGGGCCAGCGGCAGGCCGCGATGGTCGCAGTGGTACAGGTGAATTTTTCGCGCCGGCGTGTATACCGGGTCCATCTGGCTTTGCATCTGCGCCACCGTCAGGCCGCACGATGCCAGCCAGCGGCGGCTTTCCTCACTCACCCGGTCAGCCAGGATTTCACTTTCCAGCCGGTCGAGCATCTGCACCAGCACCGGCGGGAACACCACACTGCCACCGTCTTCGCCACCGGACTGCTGAAGGGTATCCGCCAGGCTGCGGCGCTGCGTTTTCGCCAGCTCACCGGTGGCGGTTTCAACCCTGATGAGTGGCGTGAAGCTCCCCGGCTGATAAATCGTCTGGATGCGGGTTCTGTCGTTCTGTATCGTGGTCAGGCGGTCGCCGTCCCAGCCGTACCAGGTCACTTGCGGTTTCCGTGACAGCGACATCCAGCCCGTCAGGTCCCGTTCACGCCGCCATACCCGTTTTGCCACCCTGCGGCCCAGCGGGTCGTAAAGATAGCGACTTTCGACCAGCGGCTCTGCATATTGTGTCCGCGTGGTGCACCAGCCGGTGCTGACTGTCGTAATGGTACCGGTGGGTGCGCTCATCATCCGTGCGGATAACCCTTCCGGGATGAGGTCGGTTTTCTCTGTCAGCCTGCCGTGACGGTCATACCGGTAAAGATAGTGCGCGTCACGGGCGATACGGTTATCCGGCCACATGCTGAGGGCGCTGTCCGGGTGCAGCTCCGGGTCGGGCAGGCGGTTACCTGCCGGGTCTGTGGTATACGGGATGCGGATATCCAGATTCGCTGCGGTGGTGTGAACGCCGGTCAGCCTGCCGGTGGTGCTGTAGCTGTAACTCCGGGTCTGGCGCGGGCTGCTGATGCGGATGAGTTCGCCGTTGTCGTTCCAGGTGTAATCGCGGTCAGACAGCAGGCTGTTCAGGTGCTGGCTCTGTAACTGCCCGGCAGGGTATAAGCGGTGGTGAGTTCATAACGGCCGAAGCTGCGCAGCGTTTCCCGGTGCAGGCGGTCGCGGGTGTACTCCACCAGCGGTGTGTCGCCGAGTTTCATGCCTGACAGCCAGCCGCTGCCGTAGGTCAGCCATTCCACGGCGGGCAGGCTGTCCGGTATACAGCGGTTCGCCAGTCCCTGTGCGTTGTACGCATGTCTGGTCTCATGCTGCCAGAGCAGTTCATTCGTCTGCGGATGATGCACCGTCAGGTGTTCACTGGCGAGGCGGCCTTTACTGTCATAACCATAGTGCACCGTCACCCGGTGCCCTTCGCTGATATGGCTGATGTCTGTCAGCCAGCCGCGTTCGTCATACTGCCACCGCTCTGCGGTTTCGCCATTCACGGTGCGGTGCGTGAGGCGGTCTGCTTCGTCATAGTGCCAGTGGGTGACCAGCCCTCATCCTCGCTGCGGATAAGTTTGCCGGTCAGGTCGTGGTGATAACGCTGTGTGCGGCCGTCAAAGCCGGTTTCCTGTATCAGCCGGTCGAGTACATCGTAACGGAAGGTGGTGTGGCTGCCGTTTTCACTGGTCAGGCGGATGACCCGTCCGGCAGCATCGTATTCCATACTGCGCGTCAGACCGCCCTGCGTGGTACAGATGGCTTTTCCCCACGCATCGTACTGTGTCCCGTTTCTGCTGCCGTCCGGGGCAATGACGGTGGTCAGGTCACCGGCGGCGTTGTATTCATACCGCGTTTCATGGCCCTGCGTGTCTTTCACGGCAATTAACTGTCCACGGCTGTCGTATGCGCGGTACTGACTCAGCCCTTCCTCGCGGTGCACCGCCGTCACCTGACCAAAACGGTCATGGTCATAGCGGGTTACATAACCGGAACAGTCAGTGAAGCTCAGCAACTGACCGTAACGGCTCCACGTCATGGTTTTCCGGCTGCCGGTGGCATCTTCCGTTGCGCAGGGTAAGTCACTGTGTGGATTATCATAACGGTAGCGGGTGATATCGCCGTCAGGGGCAGTTTCCTGAATCAGACGGCCCCATTCATCATATTCCCGGCGTATTTCCAGCCCGTCAGGCCCGGTGGCTGACGTTAACTGGCTGTGGTGGTTATAGTAAAACGCCGATGCCCTGCCATCCGGCGTGGTGATGCGCGTGATGAGGCCCGTCACCACATCCGGACTGTATTCTGTTGTCCTGCCTGCGGCATCCGTCTGTGCCCTGAGCCTGCCCACCGCGTCAAACTGACTCTGCGTGACGCTGCCGTCCGCGTGTTCCTTTTTCACCACCCGCTTCAGCCCGCCTTCACCCTGCGTGTGCAGGACTTCACGGCGGTTCAGGCTGTCGGTGATGGTGATGCGGTCCTTCTCATACTGATACGTGTAACTTAAGCCTGCCGGGTTTAGCTGTTCTGTCACCCGCCCGTCGCTGTCGTAACGGTAACAGATTTCCGGTCGGCCCGTGTGACGGTGCGCCACCATCCGGCCCCGGTATTTATCATCGTAAGTAAAGCTGCGCACCTGTGTATTGCTGCGGTCATACACCGCCGCCAGTTCGCCGCGGGCGTCCAGCCATAGCGCACCAGCGGCGCGGCAGGTAAATTCTCCGGGTATTCCGGGTCGTGCGTCAGCCACACGGCAGACAGACGGATGCCGTTGTCCCGGCCATATTCGGTGTAACCCGGCAGGGTATCAGGAAAAGCGGACGGTTCCGTCCCGCCGGAAATGGCCTGCTGCCGGGCTTCTTCTGCCGCTGCGCCTGCGTGGTCAGTACCAGCCGGAAGTGACGCCCGGCACCATCCGTCACGCCGGTGATTTCGCCGCTGAATTCACCGGCGGCTTCGCGGTGGAACGTCTGTGTGCGCCCGAAGCGGTCCACCAGCCCGGTCAGTACCCGGTACGGCGGCAGCGGCGCAGGCAGCACCTCATCCGCTTCCGGCACCCGCTCACACCAGCCGAGCAGCCACCACGGCCCCTGCGGACTGTTTGTCGCCAGATAACGATGCGGACTTAAGCGGAGTTCTTCCGGCAGCGCCTGCCAGAGTGCGGCCAGCCGGTGACCTTCATCCAGTTTCGCCACGCCGCCGCGCACCAGCCACAGTGACTCGCTGCGGCTGTAACCGTCCTCACCGGGAAACAGGTGCTCAAAATACAGGCTTCTGCCGCCGTTATCACTGAGTATCAGTGTGTTATCGCGCAGCTGTAAGCGGATATCCGCAGGCATTTTCCAGCCGGGGCCGAGGCTCCCCACCGGCGCGGGCGTTTTGTCCGGTAACTGCTGTAGGTGCGGGAGAATGAACGGCAGCGGGCCGGGCAGGGCGATGTCGGTTTCACCGGGAAGGACCTTTGCACCGAGCAGCGGATTGACCGGATGGCCGGACGTCACCCGCCGGGGCACCGAACAGGCCACGCCGGTGGGGCACCGATGCGTACCCCGGCTGAACCCTGGACAATGCTACCGCCATACTGCGTCATGTCGCCCTGACGCGCCGCCGGTTTTCCGCTCATCTGCTCATCCTTGTTTTATCGGGTTATTTGTCTGCTGACAGGCGAAACCCTACAGATTTATAAGAAAGCCTTAAGTGAGATATCTGTCAGATAAGAACAATTAGGAAAATATTTATATATATTTCATGAATATATGTTTCGATTGGTATAACGATGTCTAAATATTCCTCTGAACATCTTCCTGATACAAAACCGCCAGCGTTTCCGCTGGCGGTTTTCAATATTCAAAACTCAGCAATCAATAAAATCACCAGTTGCCTTTTCGGCCTGATCCATCCACACCGGTTTATCGCTGGTTTTCGACCAGACGCGATGCAGGTAGCTGTAAAAGCGGGCGCGGTCTTTCCAGAAAAGCATGAAAGGCAGCGCCAGAACGCCCGCTGCAACCGCATAAGTACGGCGTAAAAAGATAAGCCATGCAGGATATTCTCTGTAGAGTTCCACTTTTCTCCCCTTTTGTATCTACCCGGTGAATGGCACCGGAAAAATGAATTTGTTTATCTGATGAAAATAGTACCGCCTTTTGTGTAATTTTACTACTCATCCGACCACTTATTTTTGCTTATTGATGGTTTATTTACATTCATCCTGTAATTAAGTTACACAAAGTTAAATTAATACTAAACATTAGTTAAATCATGGCTT
+>38f657d9-0701-44bb-8c13-d9446f8fe441 id=65 clr=0,8618
+TTTCTCTTCGCCAGGATGCCCCCGCCAGGCGCGCATTTGCTCATCAACGCGATCGGCAGTACGGCGCAGTGCCAGTTCGCGCAGGGCGATCAGATTACCTTTGCGGAAAAATGTTCAATGGCGCGCTCCGCCTGCCCGGCAATATAGACTTTGCCTTCTTTCAGCCGCTGGCGCAGATCGTCCGGGGCAAGTCCACCAGCACCACGTCGTCGGCGGCATCGAAAAAGGATCGGGCACGGTTTCCCGTACCTGAATTCCGGTGACGCCGCTGACCACATCATTCAGACTTTCCAGATGCTGAACGTTGACGGTAGTGAAAACATCAATGCCAGCTTCCAGCAGTTCTTCGATATCCTGCCAGCGTTTGGGATGACGGGAACCTGGCGCATTACTGTGCGCCAGTTCGTCCATTAAGATCAGCGCCGGGCGGCGGGCGAGGGCGGCATCGAGATCAAACTCGCTGATATGCCGCCCACGGTACGCCTGGCGTTTTAACGGCAGAACAGCCAGCCCTTCCAGCATGGCGGCGGTATCTTTTCGCCCGTGGGTTTCTACCACGCCAACCACAATATCCAGCCGCGCCCGCAGTCGCTGGGCTTCTGCCAGCATCGCCCAGGTCTTCCCGACGCCTGCACAGGCACCGAAGAAACTTTCAGCTTCCCCGATGCGGCGCGGCAGTTTGTTCCAGCAGACGATCGGGGTCGGGACGTAAGGGTTCGTTATTCATCAAGTTTATCCAGCGCCAGATTGAGTTCAACAATGTTGACAACCGGCTGGCCGATATATTTCACCAGCGGTTGTTGGCTGTATTTTGCGATCAGTTGCGTGAGCTGTTCAACGCTGAGATTACGCGCTTTCGCCACGCGTGGATTTGCCAGGCCGCCGCTTGCGGGTGATATTATTGTCCAGCCCGCTTGCCGATGCCGTCACCAGTTCAACCGGAACGCTCGCGCTGGCATCCGGGTTAGCGGCCCGTAATGCAGCAACGCGTGCGGCTATTAGTTTATCCAGCTCAGGGTTACTGACCGCCAGATTGCTCCCGCCAGAAGCCTGTGGATTATAGGGCATTTCTGCCGTTGCCGACGGGCGACCATGAAAATAGCCGTTGCCGGTAAAATTCTGCCCGATTAATGCCGAACCGCGCACCGTATCACCTTCACGAATCAACGAACCATTGGCCTGCCAGGAAACCACCATTGCCCCAGTACGGTGGTCAGCAGCGGGTAAACGCCGCCAGTAATCAATAACAGAAAGATAAATGTTGATAATGCCGGACGTAATCCACTCATGGTAAACCTCACACCAGACCGCAAACGGTCAGCAGTAAATCAATGACTTTGATACCGATAAACGGCACCAGCAGCCCACCCAGACCGTAAATCCATAAGTTACGGCGCAACATGGCAGAAGCGGTAAGCGGTTTATAACTCACGCCTTTTAACGCCAGGGGAATCAAAGACGATAATCAAGGCGTTGAAAATCACCGCACTGAGGATTGCGGAGTCGGGCGAATGCAGGCACATGATGTTCAGCGCATTTAACTGCGGATACGTTGCCGCGAATGCCGCCGGAATAATGGCGAAGTATTTCGCCACATCGTTGGCAATGCTGAAGGTGGTCAGCGAGCCACGGGTCATCAGCATCTGTTTGCCAATGTGCACCACCTCGATCAACTTGGTCGGGTTAGAGTCGAGATCGACCATATTGCCCGCCTCTTTCGCCGCCTGGGTGCCGGAGTTCATCGCCACCGCGACATCTGCCTGCGCCAGCGCCGGAGCATCGTTGGTGCCGTCGCCGGTCATCGCTACCAAACGACCTTCCGCCTGATACTGACGGATCAATGCCAGCTTGGCCTCCGGTGTCGCTTCGGCGAGAAAATCATCGACACCCGCTTCCGCAGCAATCGCGGCGGCAGTCAGACGGTTATCGCCGGTAATCATCACCGTTTTAATGCCCATTTTGCGCAGCTGGGCGAAGCGCTCTTTAATACCGCCTTTGACGATATCTTTCAGCGCAATAACGCCCAGCACGAGAACCTTCCACCACCACCAGCGGCGTGGCTCCTGACGCGCAACCTGATCGACTTTTTGATCAACATCGGTAGGGAAGTGACCACCGTTAGCCTCAACATGGCGACGAATGGCATCGACAGAACCTTTACGGATCATGCGGTTGTCGATGTTGATCCCGCTCATCCGGCTTTGCGCAGTAAACGGTACAAAGGTGGCATGGAGCGACTGCACATCGCGCTCGCGCAGGTTAAAACGCTGGCGAGGATCACAATACTGCGGCCTTCCGGCGTTTCATCAGCCAGCGAAGCCAGTTGTGCGGCGTCAGCCAGCGTTTTTCATCCACGCCCTGCGCGGATAAACTCCGACGCCTGACGGTTACCGAGTGTGATGGTGCCGGTTTTATCCAGTAGCAGAACGTCAACGTCACCTGCCGCTTCAACTGCACGTCCGCTGGTGGCAATCACATTCGCGCCTAGCATCCGGCTCATCCCGGCGACGCCGATCGCTGACAACAGGCCGCCAATAGTGGTTGGGATCAGACAGACCAGCAGCGCCACCAGTACCGTTACGCTGACTGCATTACCGCCCCACGCGGAAAACGGCCACAGCGTGGCGGTTGCCAGTAAAAGACGATAGTCAGGGCAATCAGCAGAATGGTCAGGGCAATTTCGTTCGGCGTTTTGCGTCGCTGTGCGCCTTCCACCATCGCGATCATCCGATCCAGAAATGTCTCGCCGGGGTTAACGCTACACTCAATCACCAGCCAGTCAGAAAGAATACGCGTGCCGCCGGTGACGGAGGCAAAATCGCCGCCGGATTCACGGATCACCGGTGCCGATTCCCCGGTGATGGCGCTTTCATCGACCGATGCACCCTCAATAACTTCACCATCGCGGGGATAATATCGCCAGCTTCTACCAGTACGATATCGCCTTTACGAAGTTGGTCGGCAGGAACTTTGTCCGCCGCAGCGCCATATTTCGGCTCACGCAGCTTGCGGGCAAAGGCAGTTTTTCACCCTTTCAGACTGTTGGCCTGCGCTTTACTGCGGCCTTCTGCCAGCGCCTCGGCGAAATTAGCGAACAGTACGGTGATCCACAGCCAACCGCTAATGGCCGCGCTAAACAGCGCATTGCCGGGCATCGCACCGCTTGCCATCGCGATGCTAATACAGGTGGTCAGCAGACTGCCGATCCAGACGATAAACATCACCGGATTGCGCCATTGCGCCTGCGGGTTTAATTTTTCACCGCTTCTTTCAGCGCCTGAACGACAAGTGTTGGTTCGAATAGCGCCAGTTGTTTACGACTCATATTCAGTGCTCACTCAATATCATCAGGAGAGATATTCCGCCACCGGACCAAGCGCCAGGGCAGGGATAAAGGTCAGTGCGCCAACCAGCAACACGGTGCCGATTAACAGGCCAACAAACAGCGGGCCGTGCGTTGGCAGCGTGCCGGAGCTGGCGGCTTGGCTCTTTTACTCACCAGCGAACCGGCAATTGCCATCACCGGGATAATCACCCCGAAGCGACCGACAAACATGCAGAACGCCAGTAAACAGTTCCAGAACGGAGAGTTGGCGCTTAATCCGGCAAAGGCGCTGCCGTTGTTGTTAGCGGCGGATGACACGGCGTACAGCACTTCGCTAAAACCATGCGGGCCAGGGTTGAGCATGGCGCTACGTCCGGCGTCGGTCATCATCGCCAACGCCGCGCCCATCAGCACCAGCGTCGGGGTAACCAGAATTGCCAGTGCAGTCAGTTTCATCTCGCGTACGTCGATTTTTTACCCAGATATTCCGGTGTACGACCAATCATCAGCCCGGCAATAAACACCGCCAGCAGGACAAACAGCATCATGCCGTAAAGACCAGAACCGACACCGCCGAACACCACTTCACCAATTTGCATCAGCCACATCGGCACCATGCCACCGAGCGGTAAACGAATCATGCATCGCAATCACCGCGCCACAGGAAGCCGCCGTCGTCACGACCGCAAACAGGCTACTGACCAGCACGCCGAAACGGCTCTCTTTACCTTCCATATTGATGCTGCTGTCCGTGCCCAGTGCCAGCAGATGAGGATTACCCTGAACTTCTGCCCACATCACCACGCCTACGCAGATGACAAAATCACTGACATCGCCCACAGCAACATGCGCCCCTGGCGATCGCCCATCACTTCACCAAAGGCAAAGCACAGCGCCGTTGGGATCAAGAAGATCGCCAGCATCTGCACGAAGTTGGTCAGTGCGGTTGGGTTTTCAAACGGATGCGACGAGTTGGCATTAAAGAAGCCACCGCCGTTAGTACCGAGCATCTTGATCGCTTCCTGAGAAGCTACAGGCCCCATGGGTAACAGCTGTTGCGCTCCTTCAACGGTATTCACAGCCTGATAAGGCAGAAAGTTTTGCAGCGCACCTTGTTGAATAAAAACAGTGCAATCAACAACGCCACAGGGACTAGCACCCATAACGTGATGCGTAGCAGATCGACCCAGGCATTCCCGAGCGTGCTCATGCTCTGGCGGGTAAACGCACGGATGAGGGCAAAATCACCGCAATCCCGCTGGCGGCAGAAAGAAAGTTTTGCACCGTTAAGCCCGCCATCTGGCTGAAATAGCTCAACGTGGTTTCACCGCTATAAGATTGCCAGTTGGTATTGGTGACAAAGCTGACGGCGGTATTCAGCGCCAGATCCCACGACAGCCCTGGCAACTGCTGTGGATTAAGCGGCAGATAGTGCTGACCGAGCAACATAAAAACAGCACCGCCAGCCCCAGCATGTTCAGGCCGAGAATGGCACAAAGATATTGCTTCCAGTTCATCTCACGGTCAGAGACGCCAAGTGCGCGAAAAGTACGCGCTCAACGCCCGTTGTACCGGGAAGAGGAATGTCATTAATCAGCCGCGCCAGCCCGCTGCCTAAAGGACGCGCCAGCACCATTAACACCAGTAAAAACGTGGCGATCAGTAAGAACCCTTGCGCAGCCATCAGAACGCCTCCGCATTGATCAGGGCATAAACCAGATAACCCAGTAATAAAACACCAGCAATACGCCGGTTATCACGCCTGCACTCACAGTGCACCTCCAGTGGCCTAAAAGTGATACCGGAAGGGTAGAATTCTGGCTGCAAAGATTTCGCAAAAATCTGCGGGCGGGGTGTAAAAGTATAAAATGGCAAAAGCCATGATTTAACTAATGTTTAGTATTAATTTAACTTTTGTAACTTAATTACAGGATGAATGTAAATAAACCATCAATAAGCAAAAATAAGTGGTCGGATGAGTAGTAAAATTACACAAAAGGCGGTACTATTTTCATCAGATAAACAAATTCATTTTTCCGTGCCATTCACCGGGTAGATACAAAGGGGAGAAAAGTATGGAACTCTACAGAGAATATCCTGCATGGCTTATCTTTTTACGCCGTACTTATGCGGTTGCAGCGGGCGTTCTGGCGCTGCCTTTCATGCTTTTCTGGAAAGACCGCGCCCGCTTTTACAGCTACCTGCATCGCGTCTGGTCGAAAACCAGCGATAAACCGGTGTGGATGGATCAGGCCGAAAAGGCAACTGGTGATTTTATTGATTGCTGAGTTTGAATACATTGAAAACCGCCAGCGGAAACGCTGGCGGTTTTTATCAGGAAGATGTTCAGAGGAATATTTAGACATCGTTATACCAATCGAAACATATATTCATGAAATATATATAAATATTTTCCTAATTGTTCTTATCTGACAGATATCTCACTTAAGGCTTTCTTATAAATCTGTAGGGTTTCGCCTGTCAGCAGACAAATAACCCGATAAAACAAGGATGAGCAGATGAGCGGAAAACCGGCGGCGCGTCAGGGCGACATGACGCAGTATGGCGGTAGCATTGTCCAGGGTTCAGCCGGGGTACGCATCGGTGCCCCACCGGCGTGGCCTGTTCGGTGTGCCCCGGCGGGGTGACCGGCCATCCGGTCAATCCGCTGCTCGGTGCAAAGGTCCTTCCCGGTGAAACCGACATCGCCCTGCCCGGCCCGCTGCCGTTCATTCTCTCCCGCACCTACAGCAGTTACCGGACAAAACGCCCGCGCCGGTGGGGAGCCTCGGCCCCGGCTGGAAAATGCCTGCGGATATCCGCTTACAGCTGCGCGATAACACACTGATACTCAGTGATAACGGCGGCAGAAGCCTGTATTTTGAGCACCTGTTTCCCGGTGAGGACGGTTACAGCCGCAGCGAGTCACTGTGGCTGGTGCGCGGCGGCGTGGCGAAACTGGATGAAGGTCACCGGCTGGCCGCACTCTGGCAGGCGCTGCCGGAAGAACTCCGCTTAAGTCCGCATCGTTATCTGGCGACAAACAGTCCGCAGGGGCCGTGGTGGCTGCTCGGCTGGTGTGAGCGGGTGCCGGAAGCGGATGAGGTGCTGCCTGCGCCGCTGCCGCCGTACCGGGTACTGACCGGGCTGGTGGACCGCTTCGGGCGCACACAGACGTTCCACCGCGAAGCCGCCGGTGAATTCAGCGGCGAAATCACCGGCGTGACGGATGGTGCCGGGCGTCACTTCCGGCTGGTACTGACCACGCAGGCGCAGCGGGCAGAAGAAGCCCGGCAGCAGGCCATTTCCGGCGGGACGGAACCGTCCGCTTTTCCTGATACCCTGCCGGGTTACACCGAATATGGCCGGGACAACGGCATCCGTCTGTCTGCCGTGTGGCTGACGCACGACCCGGAATACCCGGAGAATTTACCTGCCGCGCCGCTGGTGCGCTATGGCTGGACGCCCGCGGCGAACTGGCGGCGGTGTATGACCGCAGCAATACACAGGTGCGCAGCTTTACTTACGATGATAAATACCGGGGCCGGATGGTGGCGCACCGTCACACGGGCCGACCGGAAATCTGTTACCGTTACGACAGCGACGGGCGGGTGACAGAACAGCTAAACCCGGCAGGCTTAAGTTACACGTATCAGTATGAGAAGGACCGCATCACCATCACCGACAGCCTGAACCGCCGTGAAGTCCTGCACACGCAGGGTGAAGGCGGGCTGAAGCGGGTGGTGAAAAGGAACACGCGGACGGCAGCGTCACGCAGAGTCAGTTTGACGCGGTGGGCAGGCTCAGGGCACAGACGGATGCCGCAGGCAGGACAACAGAATACAGTCCGGATGTGGTGACGGGCCTCATCACGCGCATCACCACGCCGGATGGCAGGGCATCGGCGTTTTACTATAACCACCACAGCCAGTTAACGTCAGCCACCGGGCCTGACGGGCTGGAAATACGCCGGAATATGATGAATGGGGCCGTCTGATTCAGGAAACTGCCCCTGACGGCGATATCACCCGCTACCGTTATGATAATCCACACAGTGACTTACCCTGCGCAACGGAAGATGCCACCGGCAGCGGAAAAACCATGACGTGGAGCCGTTACGGTCAGTTGCTGAGCTTCACTGACTGTTCCGGTTATGTAACCCGCTATGACCATGACCGTTTTGGTCAGGTGACGGCGGTGCACCGCGAGGAAGGGCTGAGTCAGTACCGCGCATACGACAGCCGTGGACAGTTAATTGCCGTGAAAGACACGCAGGGCCATGAAACGCGGTATGAATACAACGCCGCCGGTGACCTGACCACCGTCATTGCCCCGGACGGCAGCAGAAACGGGACACAGTACGATGCGTGGGGAAAAGCCATCTGTACCACGCAGGGCGGTCTGACGCGCAGTATGGAATACGATGCTGCCGGACGGGTCATCCGCCTGACCAGTGAAAACGGCAGCCACACCACCTTCCGTTACGATGTACTCGACCGGCTGATACAGGAAACCGGCTTTGACGGCCGCACACAGCGTTATCACCACGACCTGACCGGCAAACTTATCCGCAGCGAGGATGAGGGCTGGTCACCCACTGGCACTATGACGAAGCAGACCGCCTCACGCACCGCACCGTGAATGGCGAAACCGCAGAGCGGTGGCAGTATGACGAACGCGGCTGGCTGACAGACATCAGCCATATCAGCGAAGGGCACCGGGTGACGGTGCACTATGGTTATGACAGTAAAGGCCGCCTCGCCAGTGAACACCTGACGGTGCATCATCCGCAGACGAATGAACTGCTCTGGCAGCATGAGACCAGACATGCGTACAACGCACAGGGACTGGCGAACCGCTGTATACCGGACAGCCTGCCCGCCGTGGAATGGCTGACCTACGGCAGCGGCTGGCTGTCAGGCATGAAACTCGGCGACACACCGCTGGTGGAGTACACCCGCGACCGCCTGCACCGGGAAACGCTGCGCAGCTTCGGCCGTTATGAACTCACCACCGCTTATACCCCTGCCGGGCAGTTACAGAGCCAGCACCTGAACAGCCTGCTGTCTGACCGCGATTACACCTGGAACGACAACGGCGAACTCATCCGCATCAGCAGCCCGCGCCAGACCCGGAGTTACAGCTACAGCACCACCGGCAGGCTGACCGGCGTTCACACCACCGCAGCGAATCTGGATATCCGCATCCCGTATACCACAGAGGTAAACGCAGCAGACCGCCGAAGATGGGGAGCGACAGGCAAGAGTAGGCGGGCTGAATACGTGGAAAAAGG
+>ff281c20-4a4b-4775-9b8a-552530cf0b30 id=66 clr=0,2061
+TTGTTGTACTTCGTTTCAGTTACGTATTGCTACTTGCCTGTCGCTCTATCTTCAGCGTCTGCTTGGGTGTTTAACCTACCAGCCACAGTGACTCGCTGCGGCTGTAACCGTCCTCACCGGGAAACAGGTGCTCAAAATACAGGCTTCTGCCGCCGTTATCACTGAGTATCGGCAGTGTTATCGCGCAGCTGGCGGATATCCGCAGGCATTTTCAATAGAGCCGAGGCTCCCCACCGGCGCGGAGCGTTTTTGTCAGCTCGCTGCTGTAGGTGCGGGAGAGAATGAACGGCAGCGGGCCGGGCAGAACGTCATCGGTTTTCACCGGGGAGGACAGCTTTGCACCGAGCAGCGGATTGACCGGATGGCCGGACGTCACCCCGCCGGGGCACGGTGGAAGGCCACGCCGGTGGGGCACCGATGCATTACCCCGGCTGAACCCTGGACAATGCTACCGCCATACTGCGTCATGTCGCCCTGACGCGCCGCCGGTTTTCCGCTCATCTGCTCATCGCTTGTTTTATCGGGTTATTTGTCTGCTGACAGGCGAAACCTACAGATTTATAAGAAAGCCTTAAGTGAGATATCTGTCAAGATAAGAACAATTAGAAAATACTTATATATATTTCCTTGAAGGAATATATGTTTCGATTGGTATAACGATGTCTAAATATTCCTCGAACATCTTCCTGTTAAAACGCCCAGCGTTTCCGCTGGCGGTTTTCAATATTCAAAACTCAGCAATCAATAAAAATCACCAGTTGCCTTTTCGGCCTGATCATCCACACCGGTTTATCGCTGGTTTTCGACCAGACGCGATGCAGGTAGCTGTAAAAGCGGGCGCGGTCTTTCCAGAAAAGCATGAAAGGCAGCGCCAGAACATCCACTGCAACCGCATAAATACGGCGTAAAGATAAGCCATGCAGGATATTCTCTGTAGAGTTCGCACTTTTCTCCCCTTTTGTATCTACCCGGTGAATGGCGCGGAAAAATGGAATTTGTTTATCTGATGAAAATAGTACCGCCTTTGTGTGAATTTTTACTACTCATCGACCACTTATTTTTGCTTATTGATGGTTTATTTACATTCATCCTGTAATTAAGTTACACAAAAGTTAAATTAATACTAAACGTGGTTAAATCATGGCTTTTGCCATTTTTATACTTTTACACCCCGCCCGCAGATTACGCGAAATCTTTGCGTAGATTCTACCGGTATCGCGCAGGCCACTGGAGTTGCACTGTAGTGCAGGCGTGATAACCGGCGGCCATTGCTGGTGTTTTATTACTGGGTTATCTGGTTTTATGCCCTGATCAATGCGGGCGTTCTGATGGCTGCGCAAGGGTTCTTACTGATCGCCACGTTTTTACTGGTGTTAATGGTACTGGCGCGTCCGCTTTAGGCAGCAGGCTGGCGCGGCTGATTAATGACATTCCTCTTCCCGGTACAACGGGCGTTGAGCGCGTACTTTTTCGCGCACTTGGCGTCTCTGACCGTGAGATGAACTGGAAGCAATATCTTTGTGCCATTCTCGGCCTGAACATGCTGGGGCTGGCGGTGCTGTTTTTATGTTGCTCGGTCAGCACTATCTGCCGCTTAATCCCACAGCAGTTGCCAGGGCACGATAAATCCGGATCTGGCGCTGAATACCGCCGTAAGCTTGTCACCAATACCAATAGCAATCTTATAGCGGTGAAACCACGTTGAACTATTTCAGCCAGATGGCGGGCAACGGTGCAACTTTCTTTCCTACCATAGCGGATTGCGGTGATTTTGCCCATCGTGCGTTTACCCGCCAGGTATGGTACGCTCGGGAATGCCTGAGTCGATCTGCTCGCATCACGTTATGGAGTGCTAGTCCTGTGGCGTTATTGATTGCACTGTTTTTATTCAACAAGGTGCGCTGCAAAACTTTCTGCCTTATCGGGCTGTGAATACCGTTGAAGGAGCGCAGCAGCTGTGCCATAGATTTCTTCTCAGGAAGCGATCAAGATGCTCGGTACTTAACGGCGGTGGCCTCTTTAATGGGTTAAACGCGAAGCGAACGCCGCAATATCAGCACC
+>d1ecaa6c-a911-4cd4-86ab-f16ed29ddfde id=67 clr=0,7715
+TCAGCAGACTGCCGATCCAGACGATAAACATCACCGGATTGCGCCATTGCGCCTGCGGGTTTAATTTTTCACCGCTTCTTTCAGCGCCTGAACGACAAGTGTTGGTTCGAATAGCGCCAGTTGTTTACGACTCATATTCAGTGCTCACTCAATATCATCAGGAGAGATATTCCGCCACCGGACCAAGCGCCAGGGCAGGATAAAGGTCAGTGCGCCAACCAGCAACACGGTGCCGATTAACAGGCCAACAAACAGCGGGCCGTGCGTTGGCAGCGTGCCGGAGCTGGCGGCGGCTCTTTTACTCACCAGCGAACCGGCAATTGCCATCACCGGGATAATCACCCCGAAGCGACCGACAAACATGCAGAACGCCAGTAAACAGTTCCAGAACGGAGAGTTGGCGCTTAATCCGGCAAAGGCGCTGCCGTTGTTGTTAGCGGCGGATGACACGGCGTACAGCACTTCGCTAAAACCATGCGGGCCAGGGTTGAGCATGGCGCTACGTCCGGCGTCGGTCATCATCGCCAACGCCGCGCCCATCAGCACCAGCGTCGGGGTAACCAGAATTGCCAGTGCAGTCAGTTTCATCTCGCGTACGTCGATTTTTTACCCAGATATTCCGGTGTACGACCAATCATCAGCCCGGCAATAAACACCGCCAGCAGGACAAACAGCATCATGCCGTAAAGACCAGAACCGACACCGCCGAACACCACTTCACCAATTTGCATCAGCCACATCGGCACCATGCCACCGAGAGCGGTAAACGAATCATGCATCGCAATCACCGCGCCACAGGAAGCCGCCGTCGTCACGACCGCAAACAGGCTACTGACCAGCACGCCGAAACGGCTCTCTTTACCTTCCATATTGATGCTGCTGTCCGTGCCCAGTGCCAGCAGATGAGGATTACCCTGAACTTCTGCCCACATCACCACGCCTACGCAGATGACAAAATCACTGACATCGCCCACAGCAACATGCGCCCCTGGCGGCGATCGCCCATCACTTCACCAAAGGCAAAGCACAGCGCCGTTGGGATCAAGAAGATCGCCAGCATCTGCACGAAGTTGGTCAGTGCGGTTGGGTTTTCAAACGGATGCGACGAGTTGGCATTAAAGAAGCCACCGCCGTTAGTACCGAGCATCTTGATCGCTTCCTGAGAAGCTACAGGCCCCATGGTAACAGCTGTTGCGCTCCTTCAACGGTATTCACAGCCTGATAAGGCAGAAAGTTTTGCAGCGCACCTTGTTGAATAAAAACAGTGCAATCAACAACGCCACAGGGACTAGCACCCATAACGTGATGCGTAGCAGATCGACCCAGGCATTCCCGAGCGTGCTCATGCTCTGGCGGGTAAACGCACGGATGAGGGCAAAATCACCGCAATCCGCTGGCGGCAGAAAGAAAGTTTTGCACCGTTAAGCCCGCCATCTGGCTGAAATAGCTCAACGTGGTTTCACCGCTATAAGATTGCCAGTTGGTATTGGTGACAAAGCTGACGGCGGTATTCAGCGCCAGATCCCACGACAGCCCTGGCAACTGCTGTGGATTAAGCGGCAGATAGTGCTGACCGAGCAACATAAAAACAGCACCGCCAGCCCCAGCATGTTCAGGCCGAGAATGGCACAAAGATATTGCTTCCAGTTCATCTCACGGTCAGAGACGCCAAGTGCGCGAAAAGTACGCGCTCAACGCCCGTTGTACCGGGAAGAGGAATGTCATTAATCAGCCGCGCCAGCCCGCTGCCTAAAGGACGCGCCAGCACCATTAACACCAGTAAAAACGTGGCGATCAGTAAGAACCCTTGCGCAGCCATCAGAACGCCTCCGCATTGATCAGGGCATAAACCAGATAACCCAGTAATAAAACACCAGCAATACGCCGGTTATCACGCCTGCACTCACAGTGCACCTCCAGTGGCCTAAAAGTGATACCGGAAGGGTAGAATTCTGGCTGCAAAGATTTCGCAAAAATCTGCGGGCGGGGTGTAAAAGTATAAAAATGGCAAAAGCCATGATTTAACTAATGTTTAGTATTAATTTAACTTTGTGTAACTTAATTACAGGATGAATGTAAATAAACCATCAATAAGCAAAAATAAGTGGTCGGATGAGTAGTAAAATTACACAAAAGGGTACTATTTTCATCAGATAAACAAATTCATTTTTCCGGTGCCATTCACCGGGTAGATACAAAAGGGGAGAAAAGTATGGAACTCTACAGAGAATATCCTGCATGGCTTATCTTTTTACGCCGTACTTATGCGGTTGCAGCGGGCGTTCTGGCGCTGCCTTTCATGCTTTTCTGGAAAGACCGCGCCCGCTTTTACAGCTACCTGCATCGCGTCTGGTCGAAAACCAGCGATAAACCGGTGTGGATGGATCAGGCCGAAAAGGCAACTGGTGATTTTTTGATTGCTGAGTTTTGAATACATTGAAAACCGCCAGCGGAAACGCTGGCGGTTTTTGTATCAGGAAGATGTTCAGAGGAATATTTAGACATCGTTATACCAATCGAAACATATATTCATGAAATATATATAAATATTTTCCTAATTGTTCTTATCTGACAGATATCTCACTTAAGGCTTTCTTATAAATCTGTAGGGTTTCGCCTGTCAGCAGACAAATAACCCGATAAAACAAGGATGAGCAGATGAGCGGAAAACCGGCGGCGCGTCAGGGCGACATGACGCAGTATGGCGGTAGCATTGTCCAGGGTTCAGCCGGGGTACGCATCGGTGCCCCACCGGCGTGGCCTGTTCGGTGTGCCCCGGCGGTGACGTCCGGCCATCCGGTCAATCCGCTGCTCGGTGCAAAGGTCCTTCCCGGTGAAACCGACATCGCCCTGCCCGGCCCGCTGCCGTTCATTCTCTCCCGCACCTACAGCAGTTACCGGACAAAACGCCCGCGCCGGTGGGGCCTCGGCCCCGGCTGGAAAATGCCTGCGGATATCCGCTTACAGCTGCGCGATAACACACTGATACTCAGTGATAACGGCGGCAGAAGCCTGTATTTTGAGCACCTGTTTCCCGGTGAGGACGGTTACAGCCGCAGCGAGTCACTGTGGCTGGTGCGCGGCGGCGTGGCGAAACTGGATGAAGGTCACCGGCTGGCCGCACTCTGGCAGGCGCTGCCGGAAGAACTCCGCTTAAGTCCGCATCGTTATCTGGCGACAAACAGTCCGCAGGGGCCGTGGTGGCTGCTCGGCTGGTGTGAGCGGGTGCCGGAAGCGGATGAGGTGCTGCCTGCGCCGCTGCCGCCGTACCGGGTACTGACCGGGCTGGTGGACCGCTTCGGGCGCACACAGACGTTCCACCGCGAAGCCGCCGGTGAATTCAGCGGCGAAATCACCGGCGTGACGGATGGTGCCGGGCGTCACTTCCGGCTGGTACTGACCACGCAGGCGCAGCGCAGAAGAAGCCCGGCAGCAGGCCATTTCCGGCGGGACGGAACCGTCCGCTTTTCTGATACCCTGCCGGGTTACACCGAATATGGCCGGGACAACGGCATCCGTCTGTCTGCCGTGTGGCTGACGCACGACCCGGAATACCCGGAGAATTTACCTGCCGCGCCGCTGGTGCGCTATGGCTGGACGCCCGCGGCGAACTGGCGGCGGTGTATGACCGCAGCAATACACAGGTGCGCAGCTTTACTTACGATGATAAATACCGGGGCCGGATGGTGGCGCACCGTCACACGGGCCGACCGGAAATCTGTTACCGTTACGACAGCGACGGGCGGGTGACAGAACAGCTAAACCCGGCAGGCTTAAGTTACACGTATCAGTATGAGAAGGACCGCATCACCATCACCGACAGCCTGAACCGCCGTGAAGTCCTGCACACGCAGGGTGAAGGCGGGCTGAAGCGGGTGGTGAAAAGGAACACGCGGACGGCAGCGTCACGCAGAGTCAGTTTGACGCGGTGGGCAGGCTCAGGGCACAGACGGATGCCGCAGGCAGGACAACAGAATACAGTCCGGATGTGGTGACGGGCCTCATCACGCGCATCACCACGCCGGATGGCAGGGCATCGGCGTTTTACTATAACCACCACAGCCAGTTAACGTCAGCCACCGGGCCTGACGGGCTGGAAATACGCCGGAATATGATGAATGGGGCCGTCTGATTCAGGAAACTGCCCCTGACGGCGATATCACCCGCTACCGTTATGATAATCCACACAGTGACTTACCCTGCGCAACGGAAGATGCCACCGGCAGCGGAAAACCATGACGTGGAGCCGTTACGGTCAGTTGCTGAGCTTCACTGACTGTTCCGGTTATGTAACCCGCTATGACCATGACCGTTTTGGTCAGGTGACGGCGGTGCACCGCGAGGAAGGGCTGAGTCAGTACCGCGCATACGACAGCCGTGGACAGTTAATTGCCGTGAAAGACACGCAGGGCCATGAAACGCGGTATGAATACAACGCCGCCGGTGACCTGACCACCGTCATTGCCCCGGACGGCAGCAGAAACGGGACACAGTACGATGCGTGGGGAAAAGCCATCTGTACCACGCAGGGCGGTCTGACGCGCAGTATGGAATACGATGCTGCCGGACGGGTCATCCGCCTGACCAGTGAAAACGGCAGCCACACCACCTTCCGTTACGATGTACTCGACCGGCTGATACAGGAAACCGGCTTTGACGGCCGCACACAGCGTTATCACCACGACCTGACCGGCAAACTTATCCGCAGCGAGGATGAGGGCTGGTCACCCACTGGCACTATGACGAAGCAGACCGCCTCACGCACCGCACCGTGAATGGCGAAACCGCAGAGCGGTGGCAGTATGACGAACGCGGCTGGCTGACAGACATCAGCCATATCAGCGAAGGGCACCGGGTGACGGTGCACTATGGTTATGACAGTAAAGGCCGCCTCGCCAGTGAACACCTGACGGTGCATCATCCGCAGACGAATGAACTGCTCTGGCAGCATGAGACCAGACATGCGTACAACGCACAGGGACTGGCGAACCGCTGTATACCGGACAGCCTGCCCGCCGTGGAATGGCTGACCTACGGCAGCGGCTGGCTGTCAGGCATGAAACTCGGCGACACACCGCTGGTGGAGTACACCCGCGACCGCCTGCACCGGGAAACGCTGCGCAGCTTCGGCCGTTATGAACTCACCACCGCTTATACCCTGCCGGGCAGTTACAGAGCCAGCACCTGAACAGCCTGCTGTCTGACCGCGATTACACCTGGAACGACAACGGCGAACTCATCCGCATCAGCAGCCCGCGCCAGACCGGAGTTACAGCTACAGCACCACCGGCAGGCTGACCGGCGTTCACACCACCGCAGCGAATCTGGATATCCGCATCCCGTATACCACAGACCCGGCAGGTAACCGCCTGCCCGACCCGGACTGCCGGACAGCGCCCTCAGCATGTGGCCGGATAACCGTATCGCCCGTGACGCGCACTATCTTTACCGGTATGACCGTCACGGCAGGCTGACAGAAAAACCGACCTCATCCCGGAAGGGTTATCCGCACGGATGATGAGCGCACCCACCGGTACCATTACGACAGTCAGCACCGGCTGGTGCACTACACGCGACACAATATGCAGAGCCGCTGGTCGAAAGTCGCTATCTTTACGACCCGCTGGGCCGCAGGGTGGCAAAACGGGTATGGCGGCGTGAACGGGACCTGACGGGCTGGATGTCGCTGTCACGGAAACCGCAAGTGACCTGGTACGGCTGGGACGGCGACCGCCTGACCACGATACAGAACGACAGAACCCGCATCCAGACGATTTATCAGCCGGGGCTTCACGCCACTCATCAGGGTTGAAACCGCCACCGGTGAGCTGGCGAAAACGCAGCGCCGCAGCCTGGCGGATACCCTTCAGCAGTCCGGTGGCGAAGACGGTGGCAGTGTGGTGTTCCCGCCGGTGCTGGTGCAGATGCTCGACCGGCTGGAAAGTGAAATCCTGGCTGACCGGGTGAGTGAGGAAAGCCGCCGCTGGCTGGCATCGTGCGGCCTGACGGTGGCGCAGATGCAAAGCCAGATGGACCCGGTATACACGCCGGCGCGAAAAATTCACCTGTACCACTGCGACCATCGCGGCCTGCCGCTGGCCCTATCAGCACGGAAGGGACAACAGCGTGGTACGCAGAATACGATGAATGGGGTAACCTGCTGAATGAAGAGACCCGCATCAGCTGCAGCAGCTTATCCGCCTGCCGGGGCAGCAGTATGATGAGGAGTCCGGCCTGTATTACAACCGCCACCGCTATTATGACCCGCTGCAGGGGCGATATATCACTCAGGATCCGATTGGGCTGAAAGGGGATGGAATTTTATCAGTATCCGTTGAATCCGATCTCAAATATAGATCCATTAGGATTAGAAACACTAAAATGCATTAAGCCACTGCATTCAATGGGCGGAACTGGTGAAAGAAGCGGTCCAGATATATGGGGAATCCGTTCTATCATCAATATCTTTGTGTCCCAGATGGTAAAGGGACTATACTTGTGGTGGCCAAGACCAACGGGGAGAATCAAAGGAGATGGTCTATGGGGGCCAGGTAAAGCAAGTAATGATACAAAGAAGCTGCTGGCCGTTGTGACCTCGTTGAAACCGATAATAGTTGTGTGGAGAACTGTTTAAAAGGGAAGTTTAAAGAGGTAAGGCCGCGTTATTCTGTATTGCCTGATATATTCACACCTATAAATTTAGGGCTATTTAAAACTGCCAAGACTGGTCTAATGATTCTTTAGAAACATGTAAGATGAAGTGCTCCGGAAATAACATTGGACGTTTTATTAGATTTGTATTCACCGGAGTGATGTAATGAAATATATTATTTTTTATTCAGAGCTATATGGCTGGCTTTATCGCTTTTAATACTATTCTTTTCCATGCATAGACTTTCACTATTAGACTCCACTCGTGATGTGAGCGAGTTAATTAGTCTCATGTCTTATGGAATGATGGTAATATGTTTTCCAACAGGCATAGTATTCTTTATTGCTCTAATATTTATAGGGACTGTATCAGACATTATTGGCGTAAGGTTGATAGTAAGTATATTATGGCGATAATAATATGGCTTTATTTTCTGTCAGGAGGGTATATTCAATGGTTTGTATTAAGTAAGCGCATTATAAACAAATAAATTAAGTTAATTGCTCTTATTATTATATGTAACCTGGGCATTGATATCCCGTATGCCACAGACCCGGCAGGTAACCGCCTGCCCGACCGGAGCTGCACGGACACCCCTCAGCATGTGGCCGGATAACCGTATCGCCCGTGACGCGCACTATCTTTACCGGTATGACCGTCACGGCAGGCTGACGGAGAAACCGACCTCATCCCGGAAGGGGTTATCCGCACGGATGATGAGCGCACCACCGGTACATTACGACAGTCAGCACCGGCTGGTGCACTACACGCGGACACAATATGCAGAGCCGCTGGTCGAAAGCCGCTATCTTTACGACCCGCTGGGCCGCAGGGTGGCAAAACGGGTGTGGCGACGTGAACGGGACCTGACGGGCTGGATGTCGCTGTCACGGAAACCGCAAGTGACCTGGTACGGCTGGGACGGCGACCGCCTGACCACGATACAGAACGACAGAACCCGCATCCAGACGATTTATCAGCCGGGGAGCTTCGCCACTCATCAGGTTGAAACCGCCACCGGTGAGCTGGCGAAAACGCAGCGCCGCAGCCTGGCGGATACCCC
+>4dbe677b-04b0-4738-8777-a15ee6cd652b id=68 clr=0,2079
+TCGGTACTTCGTTCCGGTTACGTATGCCTGTCGCTCTATCTTCGGCGTCTGCTTGGGTGTTTAACCTGCCACAGCGTGGCGGTTTGCCAGTAAAGACGATAGTCAGGGCAATCAGCAGAATGGTCAGGGCAATTTCGTTCGGCGTTTTGCGTCGCTGTGCGCCTTCCACCATCGCGATCATCCGATCCAGAAATGTCTCGCCGGGGTTAACGCTACACTCAATCACCAGCCAGTCAGAAAGAATACGCGTGCCGCCGGTGACGGAGGCAAAATCGCCGCCGGATTCACGGATCACCGGTGCCGATTCCCCGGTGATGGCGCTTTCATCGACCGATGCACCCCTTCAATAACTTCACCATCGCAGGGGATAATATCGCCAGCTTCTACCAGTACGATATCGCCTTTACGAAGTTGGTCGGCAGGAACTTTGTCCGCCGCAGCGCCATATTTCGGCTCACGCGGGCAAAGGCAGTTTTTCACCCTTTCAGACTGTTGGCCTGCGCTTTACTGCGGCCTTCTGCCAGCGCCTCGGCGAAATTAGCGAACAGTACGGTGATCCACAGCCAACCGCTAATGGCCGCGCTAAACAGCGCATTGCCGGGCATCGCACCGCTTGCCATCGCGATGCTAATACAGGTGGTCAGCAGACTGCCGATCCAGACGATAAACATCACCGGATTGCGCCATTGCGCCTGCGGGTTTAATTTTTCACCGCTTCTTTCAGCGCCTGAACGACAAGTGTTGGTTCGAATAGCGCCAGTTGTTTACGACTCATATTCAGTGCTCACTCAATATCATCAGGAGAGATATTCCGCCACCGGACCAAGCGCCAGGGCAGGATAAAGGTCAGTGCGCCAACCAGCAACACGGTGCCGATTAACAGGCCAACAAACAGCGGGCCGTGCGTTGGCAGCGTGCCGGAGCTGGCGGCTTGGCTCTTTTACTCACCAGCGAACCGGCAATTGCCATCACCGGGATAATCACCCCGAAGCGACCGACAAACATGCAGAACGCCAGTAAACAGTTCCAGAACGGAGAGTTGGCGCTTAATCCGGCAAAGGCGCTGCCGTTGTTGTTAGCGGCGGATGACACGGCGTACAGCACTTCGCTAAAACCATGCGGGCCAGGGTTGAGCATGGCGCTACGTCCGGCGTCGGTCATCATCGCCAACGCCGCGCCCATCAGCACCAGCGTCAGGGGTAACCAGAATTGCCAGTGCAGTCAGTTTCATCTCGCGTACGTCGATTTTTACCCAGATATTCCGGTGTACGACCAATCATCAGCCCGGCAATAAACACCGCCAGCAGGACAAACAGCATCATGCCGTAAAGACCAGAACCGACACCGCCGAACACCACTTCACCAATTTGCATCAGCCACATCGGCACCATGCCACCGAGAGCGGTAAACGAATCATGCATCGCAATCACCGCGCCACAGGAAGCCGCCGTCGTCACGACCGCAAACAGGCTACTGACCAGCACGCCGAAACGGCTCTCTTTACCTTCCATATTGATGCTGCTGTCCGTGCCCAGTGCCAGCAGATGAGGATTACCCTGAACTTCTGCCCACATCACCACGCCTACGCAGATGACAAAATCACTGACATCGCCCACAGCAACATGCGCCCCTGGCGGCTGATCGCCCATCACTTCACCAAAGGCAAAGCACAGCGCCGTTGGGATCAAGAAGATCGCCAGCATCTGCACGAAGTTGGTCAGTGCGGTTGGGTTTTCAAACGGATGCGACGAGTTGGCATTAAAGAAGCCACCGCCGTTAGTACCGAGCATCTTGATCGCTTCCTGAGAAGCTACAGGCCCCATGGGTAACAGCTGTTGCTCCTTCAACGGTATTCACAGCCTGATAAGGCAGAAAGTTTTGCAGCGCACCTTGTTGAATAAAAACAGTGCAATCAACAACGCCACAGGGACTAGCACCCATAACGTGATGCGTAGCAGATCGACCCAGGCATTCCAGAGCGTGCTCATGCTCTGGCGGGTAAACACGCGGATGAGGGCAAAATCACCGCAATCCCGCTGAGGTTAAACACCCAAGCGAACATGCCAATATCCCGGCACC
+>9b070b44-f197-4952-8863-7e27e04ff558 id=69 clr=0,6231
+ATTGCATCGGTAGCCGCTTCGTTCAGTTACGTATTGCTCTTGCCTGTCGCTCTATCTTCGGCGTCTGGCAGGTGTTCAACCGTGAACATGGCACCACGTTGATTATGGTGACCCACGACCTGCAACTGGCGGCACGCTGCGACCGCTGCTTACGGCTGGTGAACGGGCAGTTGCAGGAGGAAGCATGATTGCACGTTGGTTCTGGCGCGAATGGCGTTCGCCGTCGCTATTAATTGTCTGGCTGGCGCTAAGCCTGGCGGTGGCCTGCGTGCTGGCGCTGGGCAATATCAGCGATCGCATGGAGAAGGGCTTAAGCCAGCAAAGCCGTGAGTTTATGGCGGGCGATCGGGCGTTGCGCAGTTCACGCGAAGTGCCGCAAGCGTGGCTGGAGGAAGCGCAAAGCGCGGCCTGAAAGTCGGCAAGCAGCTGACTTTCGCCACAATGACCTTGCAGGCGACACACCGCAGCTGGCGAACGTCAAAGCGGTGGATGATATCTACCCGATGTATGGCGATCTGCAAACTAATCCCCTGGCCTGAAACCGCAGGCGGGCAGCGTATTGCTGGCCCCACGCCTGATGGCACTGCTTAACCTGAAAACGGGCGACACCATTGGCGTGGGCGATGCCACCTTGCGGATTGCCGGAGAAGTGATTCAGGAACCGGATTCCGGTTTTAACCCTTCCAGATGGCTCCGCGTCTGATGATGAATCTGGCGGATGTCGATAAAACCGGAGCCGTGCAGCCGAGAGTCGGGTCACCTGGCGTTATAAATTCGGCGGCAACGAGAACCAGCTCGACGGCTATGAGAATGGTTGTTACCTCAGCTTAAACCCGAACAACGCTGGTACGGTCTGGAACAGGACGAAGGCGCGCTGGGGCGATCGATGGAACGCTCGCAACAGTTCCTGCTGCTTTCGGCGCTTCTGACCTTGCTGCTGGCAGTGGCAGCGGTGGCGGTAGCGATGAATCATTACTGTCGCAGTCGCTACGATCTGGTGGCGATCCTCAAAACGCTGGGGGCAGGGCGAGCGCAACTGCGTAAGCTAATCGTCGGTCAGTGGTTGATGGTGCTGACGCTTTCAGCCGTTACCGGTGGGGCCATAGGCCTGTTGTTCGAAACGTGTTGATGGTGCTGCTCAAGCCCGTTCTGCCTGCTGCACTACCGCCAGCCAGCCTCTGGCCGTGGCTGTGGGCGCTTGGCACCATGACGGTCATCTCGCTGCTGGTGGGGCTACGACCATATCGCTTGTTGCTGGCAACGCAGCCTTTACGCGTATTACGTAATGATGTGGTAGCGAACGTCTGGCCGCTGAAGTTTTATCTGCCGATTGTCAGTGTGGTGGTTGTGCTGCTGCTCGCCGGATTAATGGGTGGCAGCATGCTGCTTTGGGCGGTGCTGGCGGGCGCGGTAGTACTGGCTTTGCTGTGCGGTGTGCTGGGCTGGATGCTGCTGAATGTACTTCGCCGCATGACGCTGAAATCGCTGCCCTCTGCGCCTGGCGGTTAGCCGCCTGTTACGTCAGCCGTGGTCAACGTTAAGTCAGCTTTCGGCATTTTCGCTCTCCTTTATGCTGCTGGCACTGCTGCTGGTGTTGCGTGGCGATCTGCTCGACCGCTGGCAGCAGCAGCTACCTCAGAAAGCCCGAACTACTTTTTAATTAACATCGCCACAGAACAGGTAGCACCGCTAAAGCGTTCCTCGCGGAACATCAGATAGTCCCGGAATCGTTTTATCCGGTGGTGCGGGCGCGGCTGACGGCGATTAACGATAAGCCGACAGAAGGTAATGAAGATGAGGCGCTTAACCGCGAACTCAATCTTACCTGGCAAAATACGCGGCCCGATCATAATCCGATTGTCGCCGGTAACTGGCCGCCAAAAGCCGATGAAGTGTCGATGGAAGAGGGGCTGGCGAAACGCTTAAACGTTGCCCTCGGTGATACCGTGACTTTTATGGGCGATACCCAGGAGTTCCGCGCTAAAGTGACCAGCCTGCGCAAAGTGGACTGGGAAAGTCTGCGGCCTAATTTCTATTTTATTTTCCCTGAAGGGCATTAGACGGGCAACCGCAGAGCTGGCTTACCAGTTTCCGCTGGGAGAATGGCAACGGCATGTTGACACAACTCAACCGCCAGTTCCCGACCATTAGCCTGTTAGATATTGGCGCGATTTTAAAAACAGGTCGGTCAGGTGCTGGAGCAGGTAAGTCGGGCGCTGGAAGTGATGGTGGTACTGGTCACCGCCTGCGGTATGTTGCTGTTGCTGGCACAGGTGCAGGTGGGAATGCGTCAGCGTCATCAGGAGCTGGTGGTGTGGCGCACACTCGGTGCGGGAAAAACTGCTGCGTACCACGTTGTGGTGTGAGTTCGCCATGCTTGGGTTTGTTTCCGGCCTGGTGGCCGCAATTGCGGAAACGGCGCTGGCAGTGTTGCAGGCGAAAGTGTTTGATTTTCCGTGGGAGCCAGACTGGCGATTGTGGATTGTTCTGCCGTGCAGCGGAGCGCTGCTGCTGTCGCTTTCGGCGGCTGGCTGGGTGCGCGACTGGTTAAGGGTAAGGCGCTGTTCAGGCAGTTTGCGGGGTGATGAGAGTAAATAAGGGGCGTTCTGGTTGAATGGAACGCCTTGTTTAAATTAATTCTACAATATGTTTCATGATGATGTTATTGAATTGGTGATTTCTATCTTTCTATTGCTGATATTAATCTGAATCGGTGGAGTTTATTGATTTTAAATATAGCCCTACAAAAATAACTCAGACTAATAAAATCATAAATCATATGCGTTGAATGGATATTATCCATATAGTGAATTTGTTGATGATGAATTCATCTGTGCTAAATGTTAGTTTAATAAAATATTGAAAGTGACCTGTAATAACAGTTGTTGTTGATTGAGAACAAATAAGTTTATGTGAAAAATATATAAATACATTAGCTGGTCTTGTGTGTCATTTTATTTTTTGTTGCTAACACAGGGATATGAACAATAACTAAAAGGGCACTTTATGAGCGGAAAACCAGCGGCGCGTCAGGAGATATGACTCAGTATGGCGGTCCCATTGTCCAGGGTTCGGCAGGTGTAAAATTGGCGCGCCCACCGGCGTGGCGTGCTCGGTGTGTCCGGGCGGGATGACTTCGGGCAACCCGGTAAATCCGCTGCTGGGGGCGAAGGTGCTGCCCGGCGAGACGGACCTTGCGCTGCCCGGCCCGCTGCCGTTCATTCTCTCCCGCACCTACAGCAGCTACCGGACGAAGACGCCTGCACCGGTGGGCGTTTTCGGCCCCGGCTGAAAGCGCCTTCTGATATCCGCTTACAGCTACGTGATGACGGACTGATACTCAACGACAACGGCGGGCGGAGCATTCACTTTGAGCCGCTGCTGCCGGGAGGCGGTGTACAGCCGCAGTGAGTCAATGTGGCTGGTGCGCGGTGGTAAGGCAGCACAGCCGGACGGCCATACGCTGGCGCGGCTGTGGGGGCGCTGCCGCCGGATATCCGGTTAAGCCCGCATCTTTACCTGGCGACCAACAGCGCACAGGGGCCGTGGTGATACTGGGGTGGTCTGAGCGGGTGCCGGGTGCTGAGGACGTACTGCCAGCGCCGCTGCCGCCGTACCGGGTGCTTACCGGGATGGCGGACCGCTTCGGACGCTGACGTACCGGCGTGAGGCCGCCGGTGACCTGGCCGAAATCACCGGCGTGACGGACGGTGCCGGGCGGGAGTTCCGTCTGGTGCTGACCACGCAGGCGCAGCGTGCGGAAGAGGCCCACCTCTTCGCTATCTTCTTCTGACAGTTCCCGCCCTCTCTCAGCCTCAGCGTTCCCCGACACACTGCCCGGTACCGAATACGGCCCCGACAGGGTATCCGCCTTTCGGCGGTGTGGCTGATGCACGACCCGGCATACCCGGAGAGCCTGCCCGCTGCGCCACTGGTGCGGTACACGTATACGGAAGCCGGTGAACTGCTGGCGGTATATGACCGCAGCAATACGCAGGTGCGCGCTTTCACGTATGACGCGCAGCACCCGGCCGGATGGTGGCGCACCGTTACGCGGGAAGGCCGGAGATGCGCTACCGCTACGACGATACGGGGCGGGTGGTGGAGCAACTGAACCCGGCAGGGTTAAGCTACCGCTATCTTTATGAGCAGGACCGCATCACCGTCACCGACAGCCTGAACCGGCGTGAGGTGCTGCATACAGAAGGCGGGGCCGGGCTGAAACGGGTGGTGAAAAAGAACTGGCGGACGGCAGCGTCACGCGCAGCGGGTATGACGCGGCAGGAAGGCTCACGGCGCAGACGGACGCGGCGGGACGGAGGACAGAGCGGTCTGAATGTGGTGTCCGGCGATATCACGGACATCACCACACCGGACGGGCGGGAGACGAAATTTTACTATAACGACGGAACCAGCTGACGGCGGTGGTGTCCCCGGACGGGCTGGAGAGCCGCCGGAATATGATGAACCGGGCAGGCTGGTATCGGAGACATCGCGCAGCGGGGAGACAGTACGCTACCGCTACGATGACGCGCACAGTGAGTTACCGGCGACGACAACGGATGCGACGGGCAGCACCGGCAACAGATGACCTGGAGCCGCTACGGGCGGTGCTGGCGTTCACCGACTGCTCAGGCTACCAGACCCGTTATGAATACGACCGCTTCGGCCAGATGACGGCGGTCCACCGCGAGAGGCATCAGCCTTTACCGCCGCTATGACAACCGTGGCCGGTTAACCTCGGTGAAGACGCACAGGGCCGTGAAACGCGGTATGAATACAACGCCGCAGGCGACCTGACTGCCGTTATCACCCCGGACGGCAACCGGGCGAGACACAGTACGATGCGTGGGGAAAGGCGGTCAGCACCACGCAGGGCGGGCTGACGCGCAGTATGGATTACGATGCTGCCGGACGTGTCATCAGCCTGACCAACGAGAACGGCAGCCACAGCGTCTTCAGTTACGATGCGCTGGACCGGCTGGTACAGCAGGGCGGCTTTGACGGGCGGACGCAACGTTATCATTATGACCTGACCGGAAAACTCACACAGAGTGAGGATGAGGACTTGTCATCCTCTGGTACTACGATGAATCGGACCGTATCATCACCGCACGGTGAACGGCGAACCGGCAGAGCAGTGGCAGTATGATGGCCACGGCTGGCTGACAGACATCAGCCACCTGAGCGAAGGCCACCGTGTTGCCGTCCACTATGGCTATGACGATAAAGGCCGCCTGACCGGCGAATGCCAGACCCGGTGGAGAACCCGGAGACAGGGGAACTGCTGTGGCAGCATGGGACGAAACACGCATACAACGAGCAGGGGCTGGCAAACCGCGCGTCGCCGGACAGCCTGCCGCCGGTGGAGTGGCTGACGTATGGCGTTACCTGGCGGGAATGAAGCTGGGCGACGCCGCTGGTCGATATACGCGGGACAGGCTGCACCGTGAGACGGTACGCAGCTTCGGCAGCATGGCAGGCAGTAATGCCGCATACGAACTGACCAGCTTTGCACCCCGCAGGCCAGTTACAGAGCCAGCACCTGAACAGCCTGGTATGACCGTGACTACGGGTGGAGTGACAACGGCGACCTGGTGCGCATCAGCGGCCGCGACAGACGCGGGAATACGGCTACAGCGCCACGGGCAGGCTGGAGGTGTGCGCACCTCGCACCAGACCTGGACATCCGCATCCCGTATGCCACGGACCCGGCGGGCAACCGGCTGCGGGCCAGAGCTGCACCCGGACGGTACACTCACAGTGTGGCCGGATAACCGCATCGCGGAGGATGCGCACTATGTCTACCGCCACGATGAATACGGCAGGCTGACGGAGAAGAAGACGGACCGCATCCCGGCGGGTGTGATACGGACGGACGACGAGCGGACCCACCACTACCACTACGACAGCCAGCACCGCCTGGTGTTCTACACGCGGATACAGCATGGCGAGCCACTGGTCGAGAGCCGCTACCTCTACGACCCGCTGGGACGGCGAATGGCAAAACGGGTCTGGCGGCGGGGCGTGACCTGGCAAGTGGATGTCGCTGTCGCGTAAACCGGAGGTGACGTGGTATGGCTGGGACGGAGACAGGCTGACGACAGTGCAGACTGACACCACACGTATCAGACGGTATACGAGCCGGGAAGCTTCACGCCGCTCATCCGGGTCGAGACGAACGGAAGGCGGGAAAAACGGGTTAAAGCAAGCAGACGCCGAATGAAACGG
+>70a6e1ac-2b52-46e4-83ac-0a49cdc637d4 id=70 clr=0,8316
+GCTTTGGTTTCAGTTACGTATTACTGCTGCCGCAATCGCTCTATATTCCGGCTCTCTTTAAGATTGTTTAACCTGGGATCATCAGCATCATTTTGCAATATTACCCTCGATCGCCTGGTCGGGTTTAGAGTCGAGATCGACCATATTGCCTCTTTCGCCGCCTGGGTGCCGGAGTTCATCGCCACCGCGACATCTGCCTGCGCCAGCGCCGAGCATCGTTGGTGCCGTCGCCGGTCATCGCTACCAAACGACCTTCCGCCTGATACTGACGGATCAATGCCAGCTTGGCCTCCGGTGTCGCTTCGGCGAGAAAATCATCGACACCCGCTTCCGCAGCAATCGCGGCGGCAGTCAGACGGTTATCGCCGGTAATCATCACCGTTTTAATGCCCATTTTGCGCAGCTGGGCGAAGCGCTCTTTAATACCGCCTTTGACGATATCTTTCAGCGCAATAACGCCCAGCACACGAGAACCTTCCACCACCACCAGCGGCGTGGCTCCCTGACGCGCAACCTGATCGACTTTTGATCAACATCGGTAGGGAAGTGACCACCGTTAGCCTCAACATGGCGACGAATGGCATCGACAGAACCTTTACGGATCATGCGGTTGTCGATGTTGATCCCGCTCATCCGGCTTTGCGCAGTAAACGGTACAAAGGTGGCATGGAGCGACTGCACATCGCGCTCGCGCAGGTTAAAACGCTGCTTGGCGAGGATCACAATACTGCGGCCTTCCGGCGTTTCATCAGCCAGCGAAGCCAGTTGTGCGGCGTCAGCCAGCGTTTTTCATCCACGCCCTGCGCGGGATAAACTCCGACGCCTGACGGTTACCGAGTGTGATGGTGCCGGTTTTATCCAGTAGCAGAACGTCAACGTCACCTGCCGCTTCAACTGCACGTCCGCTGGTGGCAATCACATTCGCGCCTAGCATCCGGCTCATCCCGGCGACGCCGATCGCTGACAACAGGCCGCCAATAGTGGTTGGGATCAGACAGACCAGCAGCGCCACCAGTACCGTTACGCTGACTGCATTACCGCCCCACGCGGAAAACGGCCACAGCGTGGCGGTTGCCAGTAAAAGACGATAGTCAGGGCAATCAGCAGAATGGTCAGGGCAATTTCGTTCGGCGTTTTGCGTCGCTGTGCGCCTTCCACCATCGCGATCATCCGATCCAGAAATGTCTCGCCGGGGTTAACGCTACACTCAATCACCAGCCAGTCAGAAAGAATACGCGTGCCGCCGGTGACGGAGGCAAAATCGCCGCCGGATTCACGGATCACCGGTGCCGATTCCCCGGTGATGGCGCTTTCATCGACCGATGCACCCCTTCAATAACTTCACCATCGCAGGGATAATATCGCCAGCTTCTACCAGTACGATATCGCCTTTACGAAGTTGGTCGGCAGGAACTTTGTCCGCCGCAGCGCCATATTTCGGCTCACGCAGCTTGCGGGCAAAGGCAGTTTTTCACCCTTTCAGACTGTTGGCCTGCGCTTTACTGCGGCCTTCTGCCAGCTCGGCGAAATTAGCGAACAGTACGGTGATCCACAGCCAACCGCTAATGGCCGCGCTAAACAGCGCATTGCCGGGCATCGCACCGCTTGCCATCGCGATGCTAATACAGGTGGTCAGCAGACTGCCGATCCAGACGATAAACATCACCGGATTGCGCCATTGCGCCTGCGGGTTTAATTTTTTCACCGCTTCTTTCAGCGCCTGAACGACAAGTGTTGGTTCGAATAGCGCCAGTTGTTTACGACTCATATTCAGTGCTCACTCAATATCATCAGGAGAGATATTCCGCCACCGGACCAAGCGCCAGGGCAGGGATAAAGGTCAGTGCGCCAACCAGCAACACGGTGCCGATTAACAGGCCAACAAACAGCGGGCGAGCGGCGTGGCAGCGGCATCACCGGGATACTCGACCGACCAAACATGCAGAAGCGACCGACAAACATGCAGAACGCCAGTACAGTTCCAGAGGTTGGCGCTTAATCCGGCAAAGGCGCTGCCGTTGTTGTTAGCGGCGGATGACACGGCGTACAGCACTTCGCTAAAACCATGCGGGCCAGGGTTGAGCATGGCGCTACGTCCGGCGTCGGTCATCATCGCCAACGCCGCGCCCATCAGCACCAGCGTCGGGGTAACCAGAATTGCCAGTGCAGTCAGTTTCATCTCGCGTACGTCGATTTTTTACCCAGATATTCCGGTGTACGACCAATCATCAGCCCGGCAATAAACACCGCCAGCAGGACAAACAGCATCATGCCGTAAAGACCAGAACCGACACCGCCGAACACCACTTCACCAATTTGCATCAGCCACATCGGCACCATGCCACCGAGAGCGGTAAACGAATCATGCATCGCAATCACCGCGCCACAGGAAGCCGCCGTCGTCACGACCGCAAACAGGCTACTGACCAGCACGCCGAAACGGCTCTCTTTACCTTCCATATTGATGCTGCTGTCCGTGCCCAGTGCCAGCAGATGAGGATTACCCTGAACTTCTGCCCACATCACCACGCCTACGCAGATGACAAAATCACTGACATCGCCCACAGCAACATGCGCCCCTGGCGGCGATCGCCCATCACTTCACCAAAGGCAAAGCACAGCGCCGTTGGGATCAAGAAGATCGCCAGCATCTGCACGAAGTTGGTCAGTGCGGTTGGGTTTTCAAACGGATGCGACGAGTTGGCATTAAAGAAGCCACCGCCGTTAGTACCGAGCATCTTGATCGCTTCCTGAGAAGCTACAGGCCCCATGGGTAACAGCTGTTGCGCTCCTTCAACGGTATTCACAGCCTGATAAGGCAGAAAGTTTTGCAGCGCACCTTGTTGAATAAAAACAGTGCAATCAACAACGCCACAGGGACTAGCACCCATAACGTGATGCGTAGCAGATCGACCCAGGCATTCCCGAGCGTGCTCATGCTCTGGCGGGTAAACGCACGGATGAGGGCAAAATCACCGCAATCCCGCTGGCGGCAGAAAGAAAGTTTTGCACCGTTAAGCCCGCCATCTGGCTGAAATAGCTCAACGTGGTTTCACCGCTATAAGATTGCCAGTTGGTATTGGTGACAAAGCTGACGGCGGTATTCAGCGCCAGATCCCACGACAGCCCTGGCAACTGCTGTGGATTAAGCGGCAGATAGTGCTGACCGAGCAACATAAAAACAGCACCGCCAGCCCCAGCATGTTCAGGCCGAGAATGGCACAAAGATATTGCTTCCAGTTCATCTCACGGTCAGAGACGCCAAGTGCGCGAAAAAGTACGCGCTCAACGCCCGTTGTACCGGGAAGAGGAATGTCATTAATCAGCCGCGCCAGCCCGCTGCCTAAAGGACGCGCCAGCACCATTAACACCAGTAAAAACGTGGCGATCAGTAAGAACCCTTGCGCAGCCATCAGAACGCCTCCGCATTGATCAGGGCATAAACCAGATAACCCAGTAATAAAACACCAGCAAATACGCCGGTTATCACGCCTGCACTCACAGTGCACCTCCAGTGGCCTAAAAGTGATACCGGAAGGGTAGAATTCTGGCTGCAAAGATTTCGCAAAATCTGCGGGCGGGGTGTAAAAAATATAAAATGGCAAAAGCCATGATTTAACTAATGTTTAGTATTAATTTAACTTTTGTGTAACTTAATTACAGGATGAATGTAAATAAACCATCAATAAGCAAAAATAAGTGGTCGGATGAGTAGTAAAATTACACAAAAGGCGGTACTATTTTCATCAGATAAACAAATTCATTTTTCCGGTGCCATTCACCGGGTAGATACAAAGGGGAGAAAGTATGGAACTCTACAGAGAATATCCTGCATGGCTTATCTTTTGCCGTACTTATGCGGTTGCAGCGGGCGTTCTGGCGCTGCCTTTCATGCTTTTCTGGAAAGACCGCGCCCGCTTTTACAGCTACCTGCATCGCGTCTGGTCGAAAACCAGCGATAAACCGGTGTGGATGGATCAGGCCGAAAAGGCAACTGGTGATTTTATTGATTGCTGAGTTTTGAATACATTGAAAACCGCCAGCGGAAACGCTGGCGGTTTTTGTATCAGGAAGATGTTCAGAGGAATATTTAGACATCGTTATACCAATCGAAACATATATTCATGAAATATATATAAATATTTTCCTAATTGTTCTTATCTGACAGATATCTCACTTAAGGCTTTCTTATAAATCTGTAGGGTTTCGCCTGTCAGCAGACAAATAACCCGATAAAACAAGGATGAGCAGATGAGCGGAAAACCGGCGGCGCGTCAGGGCGACATGACGCAGTATGGCGGTAGCATTGTCCAGGGTTCAGCCGGGGTACGCATCGGTGCCCCACCGGCGTGGCCTGTTCGGTGTGCCCCGGCGGGTGACGTCCGGCCATCCGGTCAATCCGCTGCTCGGTGCAAAGGTCCTTCCCGGTGAAACCGACATCGCCCTGCCCGGCCCGCTGCCGTTCATTCTCTCCCGCACCTACAGCAGTTACCGGACAAAACGCCCGCGCCGGTGGGGAGCCTCGGCCCCGGCTGGAAAATGCCTGCGGATATCCGCTTACAGCTGCGCGATAACACACTGATACTCAGTGATAACGGCGGCAGAAGCCTATTTTGAGCACCTGTTTCCCGGTGAGGACGGTTACAGCCGCAGCGAGTCACTGTGGCTGGTGCGCGGCGGCGTGGCGAAACTGGATGAAGGTCACCGGCTGGCCGCACTCTGGCAGGCGCTGCCGGAAGAACTCCGCTTAAGTCCGCATCGTTATCTGGCGACAAACAGTCCGCAGGGGCCGTGGTGGCTGCTCGGCTGGTGTGAGCGGGTGCCGGAAGCGGATGAGGTGCTGCCTGCGCCGCTGCCGCCGTACCGGGTACTGACCGGGCTGGTGGACCGCTTCGGGCGCACACAGACGTTCCACCGCGAAGCCGCCGGTGAATTCAGCGGCGAAATCACCGGCGTGACGGATGGTGCCGGGCGTCACTTCCGGCTGGTACTGACCACGCAGGCGCAGCGGGCAGAAGAAGCCCGGCAGCAGGCCATTTCCGGCGGGACGGAACCGTCCGCTTTCCTGATACCCTGCCGGGTTACACCGAATATGGCCGGGACAACGGCATCCGTCTGTCTGCCGTGTGGCTGACGCACGACCCGGAATACCCGGAGAATTTACCTGCCGCGCCGCTGGTGCGCTATGGCTGGACGCCCGCGGCGAACTGGCGGCGGTGTATGACCGCAGCAATACACAGGTGCGCAGCTTTACTTACGATGATAAATACCGGGGCCGGATGGTGGCGCACCGTCACACGGGCCGACCGGAAATCTGTTACCGTTACGACAGCGACGGGCGGGTGACAGAACAGCTAAACCCGGCAGGCTTAAGTTACACGTATCAGTATGAGAAGGACCGCATCACCATCACCGACAGCCTGAACCGCCGTGAAGTCCTGCACACGCAGGGTGAAGGCGGGCTGAAGCGGGTGGTGAAAAGAACACGCGGACGGCAGCGTCACGCAGAGTCAGTTTGACGCGGTGGGCAGGCTCAGGGCACAGACGGATGCCGCAGGCAGGACAACAGAATACAGTCCGGATGTGGTGACGGGCCTCATCACGCGCATCACCACGCCGGATGGCAGGGCATCGGCGTTTTACTATAACCACCACAGCCAGTTAACGTCAGCCACCGGGCCTGACGGGCTGGAAATACGCCGGGAATATGATGAATGGGGCCGTCTGATTCAGGAAACTGCCCCTGACGGCGATATCACCCGCTACCGTTATGATAATCCACACAGTGACTTACCCTGCGCAACGGAAGATGCCACCGGCAGCCGGAAAACCATGACGTGGAGCCGTTACGGTCAGTTGCTGAGCTTCACTGACTGTTCCGGTTATGTAACCCGCTATGACCATGACCGTTTTGGTCAGGTGACGGCGGTGCACCGCGAGGAAGGGCTGAGTCAGTACCGCGCATACGACAGCCGTGGACAGTTAATTGCCGTGAAAGACACGCAGGGCCATGAAACGCGGTATGAATACAACGCCGCCGGTGACCTGACCACCGTCATTGCCCCGGACGGCAGCAGAAACGGGACACAGTACGATGCGTGGGGAAAAGCCATCTGTACCACAGGGCGGTCTGACGCGCAGTATGGAATACGATGCTGCCGGACGGGTCATCCGCCTGACCAGTGAAAACGGCAGCCACACCACCTTCCGTTACGATGTACTCGACCGGCTGATACAGGAAACCGGCTTTGACGGCCGCACACAGCGTTATCACCACGACCTGACCGGCAAACTTATCCGCAGCGAGGATGAGGGGCTGGTCACCCACTGGCACTATGACGAAGCAGACCGCCTCACGCACCGCACCGTGAATGGCGAAACCGCAGAGCGGTGGCAGTATGACGAACGCGGCTGGCTGACAGACATCAGCCATATCAGCGAAGGGCACCGGGTGACGGTGCACTATGGTTATGACAGTAAAGGCCGCCTCGCCAGTGAACACCTGACGGTGCATCATCCGCAGACGAATGAACTGCTCTGGCAGCATGAGACCAGACATGCGTACAACGCACAGGGACTGGCGAACCGCTGTATACCGGACAGCCTGCCCGCCGTGGAATGGCTGACCTACGGCAGCGGCTGGCTGTCAGGCATGAAACTCGGCGACACACCGCTGGTGGAGTACACCCGCGACCGCCTGCACCGGAAACGCTGCGCAGCTTCGGCCGTTATGAACTCACCACCGCTTATACCCCTGCCGGGCAGTTACAGAGCCAGCACCTGAACAGCCTGCTGTCTGACCGCGATTACACCTGGAACGACAACGGCGAACTCATCCGCATCAGCAGCCCGCGCCAGACCCGGAGTTACAGCTACAGCACCACCGGCAGGCTGACCGGCGTTCACACCACCGCAGCGAATCTGGATATCCGCATCCCGTATACCACAGACCCGGCAGGTAACCGCCTGACCCGGAGCTGCACCCGGACAGCGCCCTCAGCATGTGGCCGGATAACCGTATCGCCCGTGACGCGCACTATCTTTACCGGTATGACCGTCACGGCAGGCTGACAGAGAAAACCGACCTCATCCCGGAAGGGTTATCCGCACGGATGATGAGCGCACCCACCGGTACCATTACGACAGTCAGCACCGGCTGGTGCACACGCGGACACAATATGCAGAGCCGCTGGTCGAAAGTCGCTATCTTTACGACCCGCTGGGCCGCAGGGTGGCAAAACGGGTATGGCGGCGTGAACGGGACCTGACGGGCTGGATGTCGCTGTCACGGAAACCGCAAGTGACCTGGTACGGCTGGGACGGCGACCGCCTGACCACGATACAGAACGACAGAACCCGCATCCAGACGATTTATCAGCCGGGGCTTCACGCCACTCATCAGGGTTGAAACCGCCACCGGTGAGCTGGCGAAAACGCAGCGCCGCAGCCTGGCGGATACCCTTCAGCAGTCCGGTGGCGAAGACGGTGGCAGTGTGGTGTTCCCGCCGGTGCTGGTGCAGATGCTCGACCGGCTGGAAAGTGAAATCCTGGCTGACCGGGTGAGTGAGGAAAGCCGCCGCTGGCTGGCATCGTGCGGCCTGACGGTGGCGCAGATGCAAAGCCAGATGGACCCGGTATACGCCGGCGCGAAAATCACCTGTACCACGCGACCATCGCGGCCTGCCGCTGGCCCTTATCAGCACGGAAGGGACAACAGCGTGGTACGCAGAATACGATGAATGGGGTAACCTGCTGAATGAAGAGAACCCGCATCAGCTGCAGCAGCTTATCCGCCTGCCGGGGCAGCAGTATGATGAGGAGTCCGGCCTGTATTACAACCGCCACCGCTATTATGACCCGCTGCAGGGGCGATATATCACTCAGGATCCGATTGGGCTGAAAGGGGATGGAATTTTATCAGTATCCGTTGAATCCGATCTCAAATATAGATCCATTAGGATTAGAAACACTAAAATGCATTAAGCCACTGCATTCAATGGGCGGAACTGGTGAAAGAAGCGGTCCAGATATATGGGGAATCCGTTCTATCATCAATATCTTTGTGTCCCAGATGGTAAAGGGACTATACTTGTGGTGGCCAAGACCAACGGGGAGAATCAAAGGAGATGGTCTATGGGGGCCAGGTAAAGCAAGTAATGATACAAAAGAAGCTGCTGGCCGTTGTGACCTCGTTGAAACCGATAATAGTTGTGTGGAGAACTGTTTAAAGGGAAGTTTAAAGAGGTAAGGCCGCGTTATTCTGTATTGCCTGATATATTCGGTTAACCACCCTAGCAGACTTCGAATGAAGAACAA
+>7baacba0-bf17-4cee-98b8-2d382f7eb308 id=71 clr=0,2360
+TTGCCTGTCGCTCTATCTTCGGCGTCTGCTTGGGTGTTTAACCTGGGTTTCGCCTGTCAGCAGACAAATAACCCGATAAAACAAGGATGAGCAGATGAGCGGAAAACCGGCGGCGCGTCAGGGCGACATGACGCAGTATGGCGTAGCATTGTCCAGGGTTCAGCCGGGGTACGCATCGGTGCCCCACCGGCGTGGCCTGTTCGGTGTGCCCCGGCGGTGACGTCCGGCCATCCGGTCAATCCGCTGCTCGGTGCAAAGGTCCTTCCCGGTGAAACCGACATCGCCCTGCCCGGCCCGCTGCCGTTCATTCTCTCCCGCACCTACAGCAGTTACCGGACAAAACGCCCGCGCCGGTGGGAGCCTCGGCCCCGGCTGGAAAATGCCTGCGGATATCCGCTTACAGCTGCGCGATAACACACTGATACTCAGTGATAACGGCGGCAGAAGCCTGTATTTTGAGCACCTGTTTCCCGGTGAGGACGGTTACAGCCGCAGCGAGTCACTGTGGCTGGTGCGCGGCGGCGTGGCGAAACTGGATGAAGGTCACCGGCTGGCCGCACTCTGGCAGGCGCTGCCGGAAGAACTCCGCTTAAGTCCGCATCGTTATCTGGCGACAAACAGTCCGCAGGGGCCGTGGTGGCTGCTCGGCTGGTGTGAGCGGGTGCCGGAAGCGGATGAGGTGCTGCCTGCGCCGCTGCCGCCGTACCGGGTACTGACCGGGCTGGTGGACCGCTTCGGGCGCACACAGACGTTCCACCGCGAAGCCGCCGGTGAATTCAGCGGCGAAATCACCGGCGTGACGGATGGTGCCAGGCGTCACTTCCGGCTGGTACTGACCACGCAGGCGCAGCGGGCAGAAGAAGCCCGGCAGCAGGCCATTTCCGGCGGGACGGAACCGTCCGCTTTTCCTGATACCCTGCCGGGTTACACCGAATATGGCCGGGACAACGGCATCCGTCTGTCTGCCGTGTGGCTGACGCACGACCCGGAATACCCGGAGAATTTACCTGCCGCGCCGCTGGTGCGCTATGGCTGGACGCCCCGCGGCGAACTGGCGGCGGTGTATGACCGCAGCAATACACAGGTGCGCAGCTTTACTTACGATGATAAATACCGGGGCCGGATGGTGGCGCACCGTCACACGGGCCGACCGGAAATCTGTTACCGTTACGACAGCGACGGGCGGGTGACAGAACAGCTAAACCCGGCAGGCTTAAGTTACACGTATCAGTATGAGAAGGACCGCATCACCATCACCGACAGCCTGAACCGCCGTGAAGTCCTGCACACGCAGGGTGAAGGCGGGCTGAAGCGGGTGGTGAAAAGGAACACGCGGACGGCAGCGTCACGCAGAGTCAGTTTGACGCGGTGGGCAGGCTCAGGGCACAGACGGATGCCGCAGGCAGGACAACAGAATACAGTCCGGATGTGGTGACGGGCCTCATCACGCGCATCACCACGCCGGATGGCAGGGCATCGGCGTTTTACTAAACCACCACAGCCAGTTAACGTCAGCCACCGGGCCTGACGGGCTGGAAATACGCCAGGAATATGATGAATGGGGCCGTCTGATTCAGGAAACTGCCCCTGACGGCGATATCACCGCTACCGTTATGATAATCCACGGTGACTTACCCTGCGCAACGGAAGATGCCACCGGCAGCCGGAAAACCATGACGTGGAGCCGTTACGGTCAGTTGCTGAGCTTCACTGACTGTTCCGGTTATGTAACCCGCTATGACCATGACCGTTTTGGTCAGGTGACGGCGGTGCACCGCGAGGAAGGGCTGAGTCAGTACCGCGCATACGACAGCCGTGGACAGTTAATTGCCGTGAAAGACACGCAGGGCCATGAAACGCGGTATGAATACAACGCCGCCGGTGACCTGACCACCGTCATTGCCCCGGACGGCAGCAGAAACGGGACACAGTACGATGCGTGGGGAAAAGCCATCTGTACCACGCAGGGCGGTCTGACGCGCAGTATGGAATACGATGCTGCCGGACGGGTCATCCGCCTGACCAGTGAAAACGGCAGCCACACCACCTTCCGTTACGATGTACTCGACCGGCTGATACAGGAAACCGGCTTTGACGGCCGCACACAGCGTTATCACCACGACCTGGCCGGCAAACTTATCCGCAGCGAGGATGAGGGCTGGTCACCCACTAACTATGACGAAGCAGACCGCCTCACGCACCGCACCGTGAATGGCGAAACCGCAGAGCGGTGGCAGTATGACGAACGCGGCTGGCTGACAGACATCAGCCATATCAGCGAAGGGCACCGGGTGACGGTGCACTATGGTTATGACAGTAAAGGTTAAATACCCAGAAGCGGGCATACCAATATCGCGTAA
+>bc5615d7-dc94-4315-9cf1-5112555c19d5 id=72 clr=0,7154
+TCGGTATTACTTCGTTCAGTTACGTATTGCTGCTTGCCTGTCGCTCTATCTTCGGCGTGGGTGTTTACCTGTCTGTGGCATACGGGATATCAATGCCCAGGTTACATATAATAATAGCAATTAACTTAATTTATTTGTTTATAATGCGCTTACTTAATACAAACCATTGAATATACCCTCCTGACAGAAAATAAAGCCATATTATTATCGCCATAATATACTTACTATCAATCTTACGCCAATAATGTCTGATACAGTCCCTATAAATATTAGAGCAATAAAGAATACTATGCCTGTTGGAAAACATATTACCATCATTCCATAAGACATGAGACTAATTAACTCGCTCACATCACGAGTGGAGTCTAATAGTGAAAGTCTATGCATGGAAAAGAATAGTATTAAAAGCGATAAAGCCAGCCATATAGCTCTGAATAAAAAATAATATATTTCATTACATCACTCCGGTGAATACAAATCTAATAAAACGTCCAATGTTATTTCCGGAGCACTTCATCTTACATGTTTCTAAAGAATCATTAGACCAGTCTTGGCAGTTTTAAATAGCCCTAAATTTATAGGTGTGAATATATCAGGCAATACAGAATAACGCGGCCTTACCTCTTTAAACTTCCCTTTTAAACAGTTCTCCACACAACTATTATCGGTTTCAACGAGGTCACAACGGCCAGCAGCTTCTTTTGTATCATGCTTTACCTGGCCCCCATAGACCATCTCCTTTGATTCTCCCCGTTGGTCTTGGCCACCACAAGTATAGTCCCTTTACCATCTGGGACACAAAGATATTGATGATAGAACGGATTCCCCATATATCTGGACCGCTTCTTTCACCAGTTCCGCCCATTGAATGCAGTGGCTTAATGCATTTTAGTGTTTCTAATCCTAATGGATCTATATTTGAGATCGGATTCAACGGATACTGATAAAATTCCATCCCCTTTCAGCCCAATCGGATCCTGAGTGATATATCGCCCCTGCAGCGGGTCATAATAGCGGTGGCGGTTGTAATACAGGCCGGACTCCTCATCATACTGCTGCCCCGGCAGGCGGATAAGCTGCTGCAGCTGATGCGGGTTCTCTTCATTCAGCAGGTTACCCCATTCATCGTATTCTGCGTACCACGCTGTTGTCCCTTCCGTGCTGATATGGGCCAGCGGCAGGCCGCGATGGTCGTCAGTGGTACAGGTGAATTTTTCGCGCCGGCGTGTATACCGGGTCCATCTGGCTTTGCATCTGCGCCACCGTCAGGCCGCACGATGCCAGCCAGCGGCGGCTTTCCTCACTCACCCGGTCAGCCAGGATTTCACTTTCCAGCCGGTCGAGCATCTGCACCAGCACCGGCGGGAACACCACACTGCCACCGTCTTCGCCACCGGACTGCTGAAGGGTATCCGCCAGGCTGCGGCGCTGCGTTTTCGCCAGCTCACCGGTGGCGGTTTCAACCCTGATGAGTGGCGTGAAGCTCCCCGGCTGATAAATCGTCTGGATGCGGGTTCTGTCGTTCTGTATCGTGGTCAGGCGGTCGCCGTCCCAGCCGTACCAGGTCACTTGCGGTTTCCGTGACAGCGACATCCAGCCCGTCAGGTCCCGTTCACGCCGCCATACCCGTTTTGCCACCCTGCGGCCCAGCGGGTCGTAAAGATAGCGACTTTCGACCAGCGGCTCTGCATATTGTGTCCGCGTGTAGTGCACCAGCCGGTGCTGACTGTCGTAATGGTACCGGTGGGTGCGCTCATCATCCGTGCGGATAACCCTTCCGGGATGAGGTCGGTTTCTCTGTCAGCCTGCCGTGACGGTCATACCGGTAAAGATAGTGCGCGTCACGGGCGATACGGTTATCCGGCCACATGCTGAGGGCGCTGTCCGGGTGCAGCTCCGGGTCGGGCAGGCGGTTACCTGCCGGGTCTGTGGTATACGGGATGCGGATATCCAGATTCGCTGCGGTGGTGTGAACGCCGGTCAGCCTGCCGGTGGTGCTGTAGCTGTAACTCCGGGTCTGGCGCGGGCTGCTGATGCGGATGAGTTCGCCGTTGTCGTTCCAGGTGTAATCGCGGTCAGACAGCAGGCTGTTCAGGTGCTGGCTCTGTAACTGCCCGGCAGGGTATAAGCGGTGGTGAGTTCATAACGGCCGAAGCTGCGCAGCGTTTCCCGGTGCAGGCGGTCGCGGGTGTACTCCACCAGCGGTGTGTCGCCGAGTTTCATGCCTGACAGCCAGCCGCTGCCGTAGGTCAGCCATTCCACGGCGGGCAGGCTGTCCGGTATACAGCGGTTCGCCAGTCCCTGTGCGTTGTACGCATGTCTGGTCTCATGCTGCCAGAGCAGTTCATTCGTCTGCGGATGATGCACCGTCAGGTGTTCACTGGCGAGGCGGCCTTTACTGTCATAACCATAGTGCACCGTCACCCGGTGCCCTTCGCTGATATGGCTGATGTCTGTCAGCCAGCCGCGTTCGTCATACTGCCACCGCTCTGCGGTTTCGCCATTCACGGTGCGGTGCGTGAGGCGGTCTGCTTCGTCATAGTGCCAGTGGGTGACCAGCCCCTCATCCTCGCTGCGGATAAGTTTGCCGGTCAGGTCGTGGTGATAACGCTGTGTGCGGCCGTCAAAGCCGGTTTCCTGTATCAGCCGGTCGAGTACATCGTAACGGAAGGTGGTGTGGCTGCCGTTTTCACTGGTCAGGCGGATGACCCGTCCGGCAGCATCGTATTCCATACTGCGCGTCAGACCGCCCTGCGTGGTACAGATGGCTTTTCCCCACGCATCGTACTGTGTCCCGTTTCTGCTGCCGTCCGGGGCAATGACGGTGGTCAGGTCACCGGCGGCGTTGTATTCATACCGCGTTTCATGGCCCTGCGTGTCTTTCACGGCAATTAACTGTCCACGGCTGTCGTATGCGCGGTACTGACTCAGCCCTTCCTCGCGGTGCACCGCCGTCACCTGACCAAAACGGTCATGGTCATAGCGGGTTACATAACCGGAACAGTCAGTGAAGCTCAGCAACTGACCGTAACGGCTCCACGTCATGGTTTTCCGGCTGCCGGTGGCATCTTCCGTTGCGCAGGGTAAGTCACTGTGTGGATTATCATAACGGTAGCGGGTGATATCGCCGTCAGGGGCAGTTTCCTGAATCAGACGGCCCCATTCATCATATTCCGGCGTATTTCCAGCCCGTCAGGCCCGGTGGCTGACGTTAACTGGCTGTGGTGGTTATAGTAAAACGCCGATGCCCTGCCATCCGGCGTGGTGATGCGCGTGATGAGGCCCGTCACCACATCCGGACTGTATTCTGTTGTCCTGCCTGCGGCATCCGTCTGTGCCCTGAGCCTGCCCACCGCGTCAAACTGACTCTGCGTGACGCTGCCGTCCGCGTGTTCCTTTTCACCACCCGCTTCAGCCCGCCTTCACCCTGCGTGTGCAGGACTTCACGGCGGTTCAGGCTGTCGGTGATGGTGATGCGGTCCTTCTCATACTGATACGTGTAACTTAAGCCTGCCGGGTTTAGCTGTTCTGTCACCCGCCCGTCGCTGTCGTAACGGTAACAGATTTCCGGTCGGCCCGTGTGACGGTGCGCCACCATCCGGCCCCGGTATTTATCATCGTAAGTAAAGCTGCGCACCTGTGTATTGCTGCGGTCATACACCGCCGCCAGTTCGCCGCGGGCGTCCAGCCATAGCGCACCAGCGGCGCGGCAGGTAAATTCTCCGGGTATTCCGGGTCGTGCGTCAGCCACGGCAGACAGACGGATGCCGTTGTCCCGGCCATATTCGGTGTAACCCGGCAGGGTATCAGGAAAAGCGGACGGTTCCGTCCCGCCGGAAATGGCCTGCTGCCGGGCTTCTTCTGCCCGCTGCGCCTGCGTGGTCAGTACCAGCCGGAAGTGACGCCCGGCACCATCCGTCACGCCGGTGATTTCGCCGCTGAATTCACCGGCGGCTTCGCGGTGGAACGTCTGTGTGCGCCCGAAGCGGTCCACCAGCCCGGTCAGTACCCGGTACGGCGGCAGCGGCGCAGGCAGCACCTCATCCGCTTCCGGCACCCGCTCACACCAGCCGAGCAGCCACCACGGCCCCTGCGGACTGTTTGTCGCCAGATAACGATGCGGACTTAAGCGGAGTTCTTCCGGCAGCGCCTGCCAGAGTGCGGCCAGCCGGTGACCTTCATCCAGTTTCGCCACGCCGCCGCGCACCAGCCACAGTGACTCGCTGCGGCTGTAACCGTCCTCACCGGGAAACAGGTGCTCAAAATACAGGCTTCTGCCGCCGTTATCACTGAGTATCAGTGTGTTATCGCGCAGCTGTAAGCGGATATCCGCAGGCATTTTCCAGCCGGGGCCGAGGCTCCCCACCGGCGCGGGCGTTTTGTCCGGTAACTGCTGTAGGTGCGGGAGAGAATGAACGGCAGCGGGCCGGGCAGGGCGATGTCGGTTTCACCGGGAAGGACCTTTGCACCGAGCAGCGGATTGACCGGATGGCCGGACGTCACCCCGCCGGGGCACCGAACAGGCCACGCCGGTGGGGCACCGATGCGTACCCCGGCTGAACCCTGGACAATGCTACCGCCATACTGCGTCATGTCGCCCTGACGCGCCGCCGGTTTTCCGCTCATCTGCTCATCCTTGTTTTATCGGGTTATTTGTCTGCTGACAGGCGAAACCCTACAGATTTATAAGAAAGCCTTAAGTGAGATATCTGTCAGATAAGAACAATTAGGAAAATATTTATATATATTTCATGAATATATGTTTCGATTGGTATAACGATGTCTAAATATTCCTCTGAACATCTTCCTGATACAAAAACCGCCAGCGTTTCCGCTGGCGGTTTTCAATATTCAAAACTCAGCAATCAATAAAATCACCAGTTGCCTTTTCGGCCTGATCCATCCACACCGGTTTATCGCTGGTTTTCGACCAGACGCGATGCAGGTAGCTGTAAAAGCGGGCGCGGTCTTTCCAGAAAAGCATGAAAGGCAGCGCCAGAACGCCCGCTGCAACCGCATAAGTACGGCGTAAAAAGATAAGCCATGCAGGATATTCTCTGTAGAGTTCCATACTTTTCTCCCCTTTTGTATCTACCCGGTGAATGGCACCGGAAAATGAATTTGTTTATCTGATGAAAATAGTACCGCCTTTTGTGTAATTTTACTACTCATCCGACCACTTATTTTTGCTTATTGATGGTTTATTTACATTCATCCTGTAATTAAGTTACACAAAGTTAAATTAATACTAAACATTAGTTAAATCATGGCTTTTGCCATTTTTATACTTTTACACCCCGCCCGCAGATTTTTGCGAAATCTTTGCAGCCAGAATTCTACCCTTCCGGTATCACTTTTAGGCCACTGGAGGTGCACTGTGAGTGCAGGCGTGATAACCGGCGTATTGCTGGTGTTTTATTACTGGGTTATCTGGTTTATGCCCTGATCAATGCGGAGGCGTTCTGATGGCTGCGCAAGGGTTCTTACTGATCGCCACGTTTTTACTGGTGTTAATGGTGCTGGCGCGTCCTTTAGGCAGCGGGCTGGCGCGGCTGATTAATGACATTCCTCTTCCCGGTACAACGGGCGTTGAGCGCGTACTTTTCGCGCACTTGGCGTCTCTGACCGTGAGATGAACTGGAAGCAATATCTTTGTGCCATTCTCGGCCTGAACATGCTGGGGCTGGCGGTGCTGTTTTTATGTTGCTCGGTCAGCACTATCTGCCGCTTAATCCACAGCAGTTGCCAGGGCTGTCGTGGGATCTGGCGCTGAATACCGCCGTCAGCTTTGTCACCAATACCAACTGGCAATCTTATAGCGGTGAAACCACGTTGAGCTATTTCAGCCAGATGGCGGGCTTAACGGTGCAAAACTTTCTTTCTGCCGCCAGCGGGATTGCGGTGATTTTGCCCTCATCCGTGCGTTTACCCGCCAGAGCATGAGCACGCTCGGGAATGCCTGGGTCGATCTGCTACGCATCACGTTATGGGTGCTAGTCCTGTGGCGTTGTTGATTGCACTGTTTTTATTCAACAAGGTGCGCTGCAAAACTTTCTGCCTTATCAGGCTGTGAATACCGTTGAAGGAGCGCAACAGCTGTTACCCATGGGGCCTGTAGCTTCTCAGGAAGCGATCAAGATGCTCGGTACTAACGGCGGTGGCTTCTTTAATGCCAACTCGTCGCATCCGTTTGAAAACCCGCACTGACCAACTTCGTGCAGATGCTGGCGATCTTCTTGATCCCAACGGCGCTGTGCTTTGCCTTTGGTGAAGTGATGGGCGATCGCCGCCAGGGGCGCATGTTGCTGTGGGCGATGTCAGTGATTTTGTCATCTGCGTAGGCGTGGTGATGTGGGCAGAAGTTCAGGGTAATCCTCATCTGCTGGCACTGGGCACGGACAGCAGCATCAATATGGAAGGTAAAGAGAGCCGTTTCGGCGTGCTGGTCAGTAGCCTGTTTGCGGTCGTGACGACGGCGGCTTCCTGTGGCGCGGTGATTGCGATGCATGATTCGTTTACCGCTCTCGGTGGCATGGTGCCGATGTGGCTGATGCAAATTGGTGAAGTGGTGTTCGGCGGTGTCGGTTCTGGTCTTTACGGCATGATGCTGTTTGTCCTGCTGGCGGTGTTTATTGCCGGGCTGATGATTGGTCGTACACCGGAATATCTGGGTAAAAAATCGACGTACGCGAGATGAAACTGACTGCACTGGCAATTCTGGTTACCCCGACGCTGGTGCTGATGGGCGCGGCGTTGGCGATGATGACCGACGCCGGACGTAGCGCCATGCTCAACCCTGGCCCGCATGGTTTTAGCGAAGTGCTGTACGCCGTGTCATCCGCCGCTAACAACAACGGCAGCGCCTTTGCCGGATTAAGCGCCAACTCTCCGTTCTGGAACTGTTTACTGGCGTTCTGCATGTTTGTCGGTCGCTTCGGGGTGATTATCCCGGTGATGGCAATTGCCGGTTCGCTGGTGAGTAAAAGAGCCAAGCCGCCAGCTCCGGCACGCTGCCAACGCACGGCCCGCTGTTTGTTGGCCTGTTAATCGGCACCGTGTTGCTGGTTGGCGCACTGACCTTTATCCTGCCCTGGCGCTTGGTCCGGTGGCGGAATATCTCTCCTGATGATATTGAGTGAGCACTGAATATGAGG
+>5c46f248-1989-4a1e-bdf7-265af033510b id=73 clr=0,2545
+TTGGTATGCTTCGTTCCGGTTACCTGCCGCTCTGTGGTATACGGGATGCGGATATCCAGATTCGCTGCGGTGGTGTGAACGCCGGTCAGCCTGCCGGTGGTGCTGTAGCTGTAACTCCGGGTCTGGCGCGGGCTGCTGATGCGGATGAGTTCGCCGTTGTCGTTCCAGGTGTAATCGCGGTCAGACAGCAGGCTGTTCAGGTGCTGGCTCTGTAACTGCCCGGCAGGGGTATAAGCGGTGGTGAGTTCATAACGGCCGAAGCTGCGCAGCGTTTCCCGGTGCAGGCGGTCGCGGGTGTACTCCACCAGCGGTGTGTCGCCGAGTTTCATGCCTGACAGCCAGCCGCTGCCGTAGGTCAGCCATTCCACGGCGGGCAGGCTGTCCGGTATACAGCGGTTCGCCAGTCCCCGTGCGTTGTACGCATGTCTGGTCTCATGCTGCCAGAGCAGTTCATTCGTCTGCGGATGATGCACCGTCAGGTGTTCACTGGCGAGGCGGCCTTTACTGTCATAACCATAGTGCACCGTCACCCGGTGCCCTTCGCTGATATGGCTGATGTCTGTCAGCCAGCCGCGTTCGTCATACTGCCACCGCTCTGCGGTTTCGCCATTCACGGTGCGGTGCGTGAGGCGGTCTGCTTCGTCATAGTGCCAGGTGGGTGACCAGCCCTCATCCTCGCTGCGGATAAGTTTGCCGGTCAGGTCGTGGTGATAACGCTGTGTGCGGCCGTCAAAGCCGGTTTCCTGTATCAGCCGGTCGAGTACATCGTAACGGAAGGTGGTGTGGCTGCCGTTTTCACTGGTCAGGCGGATGACCCGTCCGGCAGCATCGTATTCCATACTGCGCGTCAGACCGCCCTGCGTGGTACAGATGGCTTTTCCCCACGCATCGTACTGTGTCCCGTTTCTGCTGCCGTCCGGGGCAATGACGGTGGTCAGGTCACCGGCGGCGTTGTATTCATACCGCGTTTCATGGCCCTGCGTGTCTTTCACGGCAATTAACTGTCCACGGCTGTCGTATGCGCGGTACTGACTCAGCCCTTCCTCGCGGTGCACCGCCGTCACCTGACCAAAACGGTCATGGTCATAGCGGGTTACATAACCGGAACAGTCAGTGAAGCTCAGCAACTGACCGTAACGGCTCCACGTCATGGTTTTCCGGCTGCCGGTGGCATCTTCCGTTGCGCAGGGTAAGTCACTGTGTGGATTATCATAACGGTAGCGGGTGATATCGCCGTCAGGGGCAGTTTCCTGAATCAGACGGCCCCATTCATCATATTCCTGGCGTATTTCCAGCCCGTCAGGCCCGGTGGCTGACGTTAACTGGCTGTGGTGGTTATAGTAAAACGCCGATGCCCTGCCATCCGGCGTGGTGATGCGCGTGATGAGGCCCGTCACCACATCCGGACTGTATTCTGTTGTCCTGCCTGCGGCATCCGTCTGTGCCCTGAGCCTGCCCACCGCGTCAAACTGACTCTGCGTGACGCTGCCGTCCGCGTGTTCCTTTTTCACCACCCGCTTCAGCCCGCCTTCACCCTGCGTGTGCAGGACTTCACGGCGGTTCAGGCTGTCGGTGATGGTGATGCGGTCCTTCTCATACTGATACGTGTAACTTAAGCCTGCCGGGTTTAGCTGTTCTGTCACCCGCCCGTCGCTGTCGTAACGGTAACAGATTTCCGGTCGGCCCGTGTGACGGTGCGCCACCATCCGGCCCCGGTATTTATCATCGTAAGTAAAGCTGCGCACCTGTGTATTGCTGGTCATACACCGCCGCCAGTTCGCCGCGGGGCGTCCAGCCATAGCGCACCAGCGGCGCGGCAGGTAAATTCTCCGGGTATTCCGGGTCGTGCGTCAGCCACGGCAGACAGACGGATGCCGTTGTCCCGGCCATATTCGGTGTAACCCGGCAGGGTATCAGGAAAACGGACGGTTCCGTCCCGCCGGAAATGGCCTGCTGCCGGGCTTCTTCTGCCCGCTGCGCCTGCGTGGTCAGTACCAGCCGGAAGTGACGCCCGGCACCATCCGTCACGCCGGTGATTTCGCCGCTGAATTCACCGGCGGCTTCGCGGTGGAACGTCTGTGTGCGCCCGAAGCGGTCCACCAGCCCGGTCAGTACCCGGTACGGCGGCAGCGGCGCAGGCAGCACCTCATCCGCTTCCGGCACCCGCTCACACCAGCCGAGCAGCCACCACGGCCCCTGCGGACTGTTTGTCGCCAGATAACGATGCGGACTTAAGCGGAGTTCTTCCGGCAGCGCCTGCCAGTGCGGCAGCCGGTGACCTTCATCCAGTTTCGCCACGCCGCCGCGCAGCCACAGTGACTCGCTGCGGCTGTAACCGTCCTCACCGGGAAACAGGTGCTCAAAATACAGGCTTCTGCCGCCGTTATCACTGAGTATCAGTGTGTTATCGCGCAGCTGTAAGCGGATATCCGCAGGCATTTTCCAGCCGGGGCCGAGGCTCCCACCGGCGCGGGCGTTTTGTCCGGTAACTGCTGTAGGTGGGCCGGTGAGAAACACCGGCAGACCGCCGCAATATCCGGCACCC
+>b1594985-30ce-4f59-9230-dff6ec966710 id=74 clr=0,11912
+TTGTTATTGCTTCGTTCAGTTACGTATTGCTGCTTGCGCAATAACTCTATCTTCGGCGTCTGCTTGGGTGTTTAAGCCTGTAGCGGTATGCTGTCTCCCCGCTGCGCGATGTCTCCGATACCAGCCTGCCCGGTTCATCATATTCCGGCGGCTCTCCAGCCCGTCCGGGGACACCACCGCCGTCAGCTGGTTCCGTCGTTATAGTAAAATTTCGTCTCCGCCCGTCCGGTGTGGTGATGTCCGTGATATCGCCGGACACCACATTCAGACCGTACTCTGTCCTCCGTCCGCCGCGTCCGTCTGCGCCGTGAGCCTTCCTGCCGCGTCATACCCGCTGCGCGTGACGCTGCCGTCCGCCAGTTCTTTTTCACCACCCGTTTCAGCCCGGCCCCGCCTTCTGTATGCAGCACCTCACGCCGGTTCAGGCTGTCGGTGACGGTGATGCGGTCCTGCTCATAAAGATAGCGGTAGCTTAACCCTGCCGGGTTCAGTTGCTCCACCACCGCCCCGTATCGTCGTAGCGGTAGCGCATCTCCGGCCTTCCCGCGTAACGGTGCGCCACCATCCGGCCCGGTGCTGCGCGTCATACGTGAAAGCGCGCACCTGCGTATTGCTGCGGTCATATACCGCCAGCAGTTCACCGGCTTCCGTATGCGTGTACCGCACCAGTGGCGCAGCGGGCAGGCTCTCCGGGTATGCCGGGTCGTGCATCAGCCACACCGCCGAAAGGCGGATACCCTGTCGGGGCCGTATTCGGTACCGGGCAGTGTCGGGGAACGCTGAGGCTGAGAGAGGGCGGGAACTGTCAGAAGAAGATAGCGAAGAGGTGGGCCTCTTCCGCACGCTGCGCCTGCGTGGTCAGCACCAGACGGAACTCCCGCCCGGCACCGTCCGTCACGCCGGTGATTTCCCCGGCCAGGTCACCGGCGGCCTCACGCCGGTACGTCAGCGTCCGCCCGAAGCGGTCCGCCATCCCGAAAGCACCCGGTACGGCGGCAGCGGCGGCGCTGGCAGTACGTCCTCAGCACCCGGCACCCGCTCAGACCACCCCAGTATCCACCACGGCCTGTGCGCTGTTGGTCGCCAGGTAAAGATGCGGGCTTAACCGGATATCCGGCGGCAGCGCCCCCACAGCCGCGCCAGCGTATGGCCGTCCGGCTGTGCTGCCTTACCACCGCGCACCAGCCACATTGACTCACTGCGGCTGTACACCGCCTCCCGGCAGCAGCGGCTCAAAGTGAATGCTCCGCCCGCCGTTGTCGTTGAGTATCAGTCCGTCATCACGTAGCTGTAAGCGGATATCAGAAGGCGCTTTCCAGCCGGGGCCGAAAACGCCCACCGGTGCAGGCGTCTTCGTCCGGTAGCTGCTGTAGGTGCGGGAGAGAATGAACGGCAGCGGGCCGGGCAGCAAGGTCCGTCTCGCCGGGCAGCACCTTCGCCCCCAGCAGCGGATTTACCGGGTTGCCCGAAGTCATCCCGCCCGGACACACCGAGCACGCCACGCCGGTGGGCGCGCCAATCTTACACCTGCCGAACCCTGGACAATGGGACCGCCATACTGAGTCATATCTCCTGACGCGCCGCTGGTTTTCCGCTCATATAAAGTGCCCTTTTAGTTATTGTTCATATCCTGTGTTAGCAACAAAAAATAAAATGACACACAAGACCAGCTAATGTATTTATATATTTTCATAAACTTATTTGTTCTCAATCAACAACAACTGTTATTACAGGTCACTTTCAATATTTTATTAAACTAACATTTTTAGCACAGATGAATTCATCATCAACAAATTCACTATATGGATAATATCCATTCAACGCATATGATTTATGATTTTATTAGTCTGAGTTATTTTTGTAGGGCTATATTTAAAATCAATAAACTCCACCGATTCAGATTAATATCAGCAATAGAAAGATAGAAATCACCAATTCAATAACATCATCAATGAAACATATTGTAGAATTAATTTAAACAAGGCGTTCCATTCAACCAGAACGCCCCTTATTTACTCTCATCACCCGCAAACTGCCTGAACAGCGCCTTACCCTTAACCAGTCGCGCACCCAGCCAGCCGCCGAGCGACAGCAGCAGCGCTCCGCTGCACGGCAGAACAATCCACAATCGCCAGTCTGGCTCCACGGAAAATCAAACACTTTCGCCTGCAACACTGCCAGCGCCGTTTCCGCACCAATTGCGGCCACCAGGCCGGAAACAAACCCAAGCATGGCGAACTCACACCACAACGTGGTACGCAGCAGTTTTTCCCGCACCGAGTGTGCGCCACACCACCAGCTCCTGATGACGCTGACGCATTCCCACCTGCACCTGTGCCAGCAACAGCAACATACCGCAGGCGGTGACCAGTACCACCATCACTTCCAGCGCCCGACTTACCTGCTCCAGCACCTGACCGACCTGTTTTAAAAATCGCGCCAATATCTAACAGGCTAATGGTCGGGAACTGGCGGTTGAGTTGTGTCAACATGCCGTTGCCATTCTCCCAGCGGAAACTGGTAAGCCAGCTCTGCGGTTGCCCGTCTAATGCCCTTCAGGGAAAATAAAATAGAAATTAGGCCGCAGACTTTCCCAGTCCACTTTGCGCAGGCTGGTCACTTTAGCGCGGAACTCCTGGGTATCGCCCATAAAAGTCACGGTATCACCGAGGGCAACGTTTAAGCGTTTCGCCAGCCCCTCTTCCATCGACACTTCATCGGCTTTTGGCGGCCAGTTACCGGCGACAATCGGATTATGATCGGGCCGCGTATTTTGCCAGGTAAGATTGAGTTCGCGGTTAAGCGCCTCATCTTCATTACCTTCTGTCGGCTTATCGTTAATCGCCGTCAGCCGCGCCGCACCACCGGATAAAACGATTCCGGGACTATCTGATGTTCCGCGAGGAACGCTTTTAGCGGTGCTACCTGTTCTGTGGCGATGTTAATTAAAAAGTAGTTCGGGCTTTCTGGGGTAGCTGCTGCTGCCAGCGGTCGAGCAGATCGCCACGCAACACCAGCAGCAGTGCCAGCAGCATAAAGGAGAGCGAAAATGCCGAAAGCTGACTTAACGTTGACCACGGCTGACGTAACAGGCGGCTAACCGCCAGGCGCAGAGGCAGCGATTTCAGCGTCATGCGGCGAAGTACATTCAGCAGCATCCAGCCCAGCACACCGCACAGCAAAGCCAGTACTACCGCGCCCGCCAGCACCGCCCAAAGCAGCATGCTGCCACCCATTAATCCGGCGAGCAGCAGCACAACCACCACACTGACAATCGGCAGATAAAACTTCAGCGGCCAGACGTTCGCTACCACATCATTACGTAATACGCGTAAAGGCTGCGTTGCCAGCAACAAGCGATATGGTCGTAGCCCCACCAGCAGCGAGATGACCGTCATGGTGCCAAGCGCCCACAGCCACGGCCAGAGGCTGGCTGGCGGTAGTGCAGCAGGCAGAACGGGCTTGAGCAGCACCATCAACACGTTTCGAACAACAGGCCTATGGCCCCACCGGTAACGGCTGAAAGCGTCAGCACCATCAACCACTGACCGACGATTAGCTTACGCAGTTGCGCTCGCCCTGCCCCCAGCGTTTTGAGGATCGCCACCAGATCGTAGCGACTGCGACAGTAATGATTCATCGCTACCGCCACCGCTGCCACTGCCAGCAGCAAGGTCAGAAGCGCCGAAAGCAGCAGGAACTGTTGCGAGCGTTCCATCGATCGCCCCAGCGCGCCTTCGTCCTGTTCCAGACCGTACCAGCGTTGTTCGGGTTTAAGCTGAGGTAACAACCATTTCTCATAGCCGTCGAGCTGGTTCTCGTTGCCGCCGAATTTATAACGCCAGGTGACCCGACTCCCCGGCTGCACGGCTCCGGTTTTATCGACATCCGCCAGATTCATCATCAGACGCGGAGCCATCTGGAAGGGTTAAAACCGGAATCCGGTTCCTGAATCACTTCTCCGGCAATCCGCAAGGTGGCATCGCCCACGTCAATGGTGTCGCCCGTTTTCAGGTTAAGCAGTGCCATCAGGCGTGGGGCCAGCAATACGCTGCCCGCCTGCGGTTTCAGGCCAGGGGATTAGTTTGCAGATCGCCATACATCGGGTAGATATCATCCACCGCTTTGACGTTCGCCAGCTGCGGTGTGTCGCCTGCAAAGGTCATTGTGGCGAAAGTCAGCTGCTTGCCGACTTTCAGGCCGCGCTTTGCGCTTCCTCCAGCCACGCTTGCGGCACTTCGCGTGAACTGCGCAACGCCCGATCGCCCGCCATAAACTCACGGCTTTGCTGGCTTAAGCCCTTCTCCATGCGATCGCTGATATTGCCCAGCGCCAGCACGCAGGCCACCGCCAGGCTTAGCGCCAGCCAGACAATTAATAGCGACGGCGAACGCCATTCGCGCCAGAACCAACGTGCAATCATGCTTCCTCCTGCAACTGCCCGTTCACCAGCCGTAAGCAGCGGTCGCAGCGTGCCGCCAGTTGCAGGGTCGTGGGTCACCATAATCAACGTGGTGCCATGTTCACGGTTGAGGAAAACAGCAGGTCGGCAATTTTATCGCCCGTCTGGCGGTCAAGGTTGCCGTGGGTTCGTCGGCAAACAGCATCAGGTCGACCATTAAAGGCTCGTGCCAGCGCTTCCTCGTTGCTGTTCACCGCCGGAAAGCTGTGCCGGAAGATGATCAGACGTTTACCCAGCCCTAACTGTTCGAGCAACGCTTTCGCCCCGTTACGACTTTCCGCGCTTTCTCACCGCGCAGCAGGGCGGAAGCTCGACGTTTTCCAGCGCGTTAAGGTAGGAATTAACATAAATGACTGAAAAACAAAGCCGACGTGCTTCGCGCGCAACTTTGCCCGCTTCTTCGTCCATATTATGGCGGTTGTCCCACCAGACTCACTTCGCCACTGCTGCCGTCATCAAGCCCGGCGAGGATCGCCAGCAAGGTTGACTTACCCGATCCCGACTCGCCCACCAGTGCGATGGTCTCGCCGTTTGACAACCAGCTCAACTCCGGTGAGGATGGAGAGTTCATGCTCCCCTGACCGACGGACTTCTTAAGATGATGAACTTCAACAATGTTTTCCGCTGGCATTTGCCCTTCCTGTTCCTGGTCCCATTAACCTTCCGTGCCGCCGCAGCGACACGTTATTGATTCTGGGTGATAGCCTGAGCGCCGGGTATCGAATGTCTGCCAGCGCGGCCTGGCCTGCCTTGTTGAATGATAAGTGGCAGAGTAAAACGTCGGTAGTTAATGCCAGCATCAGCGGCGACACCTCGCAACAAGGACTGGCGCGCCTTCCGGCTCTGCTGAAACAGCATCAGCCGCGTTGGGTGCTGGTTGAACTGGGGGCAATGACGGTTTGCGTGGTTTTCAGCCACAGCAAACCGAGCAAACGCTGCGCCAGATTTTGCAGGATGTCAAAGCCGCCAACGCTGAACCATTGTTAATGCAAATACGTCTGCCTGCAAACTATGGTCGCCGTTATAATGGAAGCCTTTAGCGCCATTTACCCCAAACTCGCCAAAGAGTTTGATGTTCCGCTGCTGCCCTTTTTATGGAAGAGGTCTACCTCAAGCCACAATGGATGCAGGATGACGGTATTCATCCCAACCGCGACGCCCAGCCGTTTATTGCCGACTGGATGGCGAAGCAGTTGCAGCCTTTAGTAAATCATGACTCATAAAGCAACGGAGATCCTGACAGGTAAAGTTATGCAAAAATCGGTCTTAATTACCGGATGTTCCAGTGGAATTGGCCTGGAAAGCGCGCTCGAATTAAAACGCCAGGGTTTCATGTGTGCTGGCAGGTTGCCGGAAACCGGATGATGTTGAGCGCGCGAACAGCATGGGATTTACCGGCGTGTTGATCGATCTGGATTCACCAGAAAGTGTTGATCGCGCAGCCGACGAGGTGATCGCCTGACCGATAGTGTCTGTATGGGATCTTTAACAATGCCGGATTCGGCATGTATGGCTACTTTCCACCATCAGCCGTGCGCAGATGGAACAGCAGTTTCCGCCAACTTTTCGGCGCACACCAGCTCACCATGCGCTGTTACCCGCGATGTTACCGCACGGTGAAGGGCGTATTGTGATGACATCATCGGTGATGGGATTAATCTCCCGCCGGGTCGTGGCGCTTACGCGGCCAGTAAATATGCGCTGGAGGCGTGGTCAGATGCACTGCGCATGGAGCTGCGCCACAGCGGAATTAAAGTCAGCCTGATCGAACCCGGTCCCATTCGTACTCGCTTCACCGACAACGTCAACCAGACGCAAAGTGATAAACCAGTCGAAAATCCAGCATCGCCGCCCGCTACGTTGGGACCGGAAGCGGTGGTGGACAAAGTACGCCATGCTTTTATTAGCGAAGCCGAAGATGCGCTATCCGGGCGGCGCTGTTGACCTGGGCGGTAATGTGCTTAAGCGCCTGCTGCAGGGGCGCGTGATGGACAAAATATTGCAGGTGAGGTTGAAGCGCGCTTAAAGCCCCATGTCAAAGAAAATATCGACAACAGAGAGCGACTCCATGTCCGTAGAAAATATTGTCAACATTAACGAATCTAACCTGCAGCAGGTTCTGAACAGTCGATGACCACTCCGGTGCTGTTCTGTTTTGGTCTGAACGTAGCCAGCACTGTTTGCAGTTAACCCACTTCTGGAAAGCCTCGGCGCGAACCGCAACGAACCAGCTATTCTGGCGAAGCTGACTGCGACGCGGAGCAGATGATTGCCGCGCAGTTTGGTCTGCGTGCGATTCCGACCGTGTCTGTTCCCAGAACGGGCAACCGGTAGATGGCTTCCAGGGGCCGCAACCGGTTGCCCGTTCTGGAACAGATACGGTGGAATCGCACGCAGACCAAACTGCGCGGCAATCATCTGCTCCGCGTCGCAGTCCAGCTTCGCCAGAATAAATTGCCCGTTGTACTGCCGCGAGGCACCAGAATTGGGGTTAACTGCAAACGGTGCTGGCGTTCAGACCAAAAACAGAACAGCACCGGGTGGTCATCATTGTTCAGAACCTGTTGCGGGTTAGATTCGTTAATGTTGACAATATTTTCTGCGGACGTAGGTCGCTCTCTGTTGTCGTGTTGCCTAACGACATGAGAGAAACTAACGCTCACCCTACCCGGCTGAGCGCTCATACCGCGCCAGGCTGGCGTACATCACCAGATAACACCATCGCTTCTCACAATAAACATGGCGTCGTAATCACCACCGATTCTGGCGCAACGGCGGCTGTCTCGAACTGGTTATCACTTGCGTCTGTTGATTGTCGGTAAGTACAGGCAGAGACCGAATTCGATCGAGCTGACTTTATTCGCCAATGACTTTATCCTGTTTACGCCTCCATATTACTGACCGCGTAACATACACGACTTAACGATGAAGATATCCATCACCGACTGATAAATGCAATACGCCCTTTCATAAATTATCGCGGTAATGGCACGTAATTAACTGTTATGCGCCGAACCGGCGGCTGCGCACGGCCGAATCCACGTACATTGATCCCATACAGGCACGTCGGGAACGATAACTGCGCGATCAACTACTCTGTGAATCGAATCGTCGGCACCGGTAAATCATTCATGCGGCACAACATCATCCGATTTCCGGCTGCTCTACCAACATGGCGTTCGTCGAACGCTTCCTGGTGATAATTGAACCGTTACCATATTTACCTGTCGAGATAACTCCGTTGCTGTAATTACTAAAGGCTGCAACTTTCGCCATCGATCAAACCGTGGCTGGGCATTCTCCGGTGATTGAATGAATACCGTCTTCCGGCTCCGACCCGGCGAAGGCTCTTTCCAGCAAAAAGAACGGCAACGAACATCCAGTTTGAAATGGCAGCTAAAATTTCATTATAACGGCGACATATTTCAACAATGGTTCGGCGTTGGCGGCGCTGACGTCTGCAAAATCTGGCGCGGCGTTTGCTTTCGGTTTTAGCGTGGCTGGCTCGCGCAAACGCCCGGTCAACGGCACCCAACGCGGCTGATGCTGTTTCAGCTTGAGTCGCATTAACAACACTGGGCGTTTTTCACTCTGCCGCCCATCATTCACTGAGCATTTCCTTACGCGACGAGACGTCGACACCCGCGTATCTCGCGATAACTCAACGTGTCGCTGCTGTTGTCTGAAGGTGCTTTGGACCGAAGGCGAAGAGGCGAAATGCCAGCGAACCGCTGTTGAAGTTCGTCGTCTTGAAGTCGTCGGTCGAGAATGAACTCCGTCACCGGAGACGCGTAACGAACATCGACCAGATCATGCTGGCGTCTCACCGGGCTTGACTGTTTGGCGGCGTGGCGAGAAATCTGGTGGTTTCTTCGCTACGCCAATGGACGGCGCGAACTGGCGGCTTACGTCGACTTTGTTTTCGTCATTTATGTTAATTCTACCCATGCACGCTGAGCGTCAAGGCGGCTGCTGCGCGCGGAAGGAATAAACGACGGGCAGCCTTAACTCGGCACGGTGAAACTGGTGGATATCTTCGGCAGTGACGCTGGCTGGCTGATATTAACTGTTGCCGACGAAGACCACCGGCGGCCTTGACCGAACGGCATTAAACCACCGACTACTTCATTTTCCCTCGACAGAAATAACCGCGTTATCGACGACCCACGACACGGCTTCGGCACCTTTTGACGACATGTACACGTTAAGCCGTCATCAACAGTGAAACGGCGCTAACCTGACGCGTTGACGGCGCTGGTATCATCTGCGAGGGCAAGCATGAAAACCGTGGCGGGCGTCGGCGTTGCTACGCGAGAGACGCGCAACGTGGCTGGAGAAAGCGACCTGAAACGAAGCAGCGATTTCGCCGTTTCTGGCTGCTTTGCGGCGACACGTTCCGGTGAATATTGATAACGACGTCTGCAAACTAATCCCCTGACCTGGCGTGCGCGCTGATGGCATAACCTGAGCGAACGTGCGTGAGCGTGCTACACGCTGCCGTTGCCGGGCTGTTCGAACAGCCGGTGCCCTTCCGGATGGCTCCGCGTCTGACGACCGTACGGCCAGTCGTCTGGCGTCGGCGACGGCGAATTTCAGCTCGACGACAAATGATTTGTTACCTCGGCAAACCGGTATCTGTGCGATGCTGGAATTGGACGAAGAAATGCCTTTGGCGATCGATGGAACATTCTGTTGCTGGCAGTGTTTAACGATGACGGCAACAGTCATTACTGTCGCGGTCTGCGTCCTGAAAACGCTGAGAACGAAGTTTGCTGCCTGGTAATCGATATTAACGACGCTTTCGGCGTTGCCGTGAGACCGCCAGGCCTGACGATTGAAAACTTTCGTTGATGTTCAAGCCTGCTACCTGCTGCACTACCGCTCGGCCTGGCCGTGATGGCATGACGTGCTGATGAATTACGACCGCTATCTTCGTTGTAACGGCAACACTTTATTACATGACCGATATTGATGACGAACGTCTGGCACTGAGGCTGTCTGCCGATTATTGATGATTATGCTACGCTCGCCGAACAATGGTGACGGCTCTTTAACTTTGAACAGTAACTTTGCTGTTAGCGTGTGCTGGTGGTGCTGCTGGTACTTCGCCGCATGTCGCTGAAATCGCTCGCCTGGCGGTTAACCGCCTGTTCCGTCGTGATCCCGTCGGCTTTCGACACTACTTCTCGCTTATTAACGGCACTTTAACTGCTGATGATCTCAACTCGACGCTGACGGCGGCTTACCTCCAGAAAACCGAACTGCACCAGGTGGCGGCTCATGCGGAACGGTAACGCCGCCGCGTATCGCGGAGACATCGAATGATCGGGATCGTTATCCGATGATGCTGGCGCGACTTTGACGTCAGCAGCTTCGACAGGCGCGCTTATTCCTGTCTTACCGGCGAAAATACGCGATACGATCATAAATGTCGGTGTCATGGCCGCCGCCGATAATGTCGATGAAGGGCTGACGGCTGCAAACGTTAACCTCATTGATACTGCGTGACTTTCGATGCCGGAGTTCGCGCTAAAGCCGGCCTTATGGCGCATTCTTCCTTTTGTACAGTGAACGGGCAACCACTGACTTTGACTGCAGTTTCCGCTGGGCGGCGGCATGTTGACTGGCTGCTGCCGGTTCGACCGTTAACCTGGGCCAGATATTGGCGCGATTTCGCGCAGGTCGGTCGATCTTCATGAAGTGATGATACTATTCTGCCGCGATATGTTGTTGGCGAAAACCGTCATCGAAACTGTTGTTGTGGCACGCGAACTGCTGCGCTTGATGATTCGTGGCGAATTTTGTTCCGACACAGTGTGGTGGGCTGGCGCTGGCGTGTTACGAAGACATCGATTTCCGTGGAGCCGGGCTTGGCGACGGCTGGTGCTGGGCAACGGAGCGCGCTGCTCTTGGTATATTCGGTGGTGGGCGCTGTTCAGTTTGCGAAGACGATGAAATGAGGGCGTTACCGGTTGATGGGGCGCTGTTTGAGTAATTCTGCAATATGTTTCATTGATGATGATTGTTGCTGATGTAATCTGAATATTCCGACCGATTTTAAATACAAAAATAACTTTCGAACTATTAATCTCCGTCGACAGACGGATGATATTATCCTATAGTAATTGATTGTTCATCGCATTATTAAAATCGGTTTATCGTGTTAATGGCGGTTGATTGCCCGATTGGTAAACTGGTTTATGTGAAAAATATATAAATACGTGTGATGTGATGATGTCGTTGTACACTGTTCACGGATATGAACGGCGTAACTAAAAGGGGCATATGAGCGGAAAACCGGCGGCGCGTCGGTATGACTTCGGTAATAAACGGTCCCCGTTGTCGAAGTCATTGAATACCGGCGCGCCCGCCGGTGGCGTTATTCGACGACGATAAATCTAACGAGCGAAATTTCGGTTGCTTATCTCCCGCATACAGCGCAACTTACCGTTGGCACCGATGAACGTTGCCCGGCTGGAAAGCGCCTTCTGATATCGCTTACGGCTTACGTGATGAACGGACTGATACTCGACTGACTTCGCTACCGAGGCGATTATTACGGCCGCGATGATGCTTCGATATTAACGACTTCCTTCGCTGGCGCATTTTGCTGCGGTCGTTAACTTCCGCATCTTCCTGACCAACAGCTTTACGAAGGCCGTGGTATTCACTGATTGATCTCGATTAACGTTACTGGTGCCGGCACGCCGCCGCCGTACCGACCAGCCGGATGACGGTCGCCGACGTTTGCTGCGTTACGAACCTCGGCGAATCGGCGAACGGTGCCGAGCGAATCACCGGTGCTACGAGCTTTTGGCGAGCCGCACCCTCTTCGTATCTTCTGACGGTTCCGCCTCTCTCTCGACGCATCGTTCCCCGGTACTAACCCGATACGCCGAATACGACTTACGACAGCGGCCTTTCGACGGGAGGTATTCGGCTGATGCACGACCCGGCATTACCGAAACCTGCCCGCTGTATATGCGAAACCGATGAACTGCTGGCGACATATGTTACCGGCAACTCACGGATACGCTTTCGTATGACGCGTACGCAGACCGGCACCGTTACATGAACGATCCATACCGCTACGACGCAATACGGGCGAACAGTAAACTACCTTCTCTTCGGTTGAGTTCGTCGCCGACAGCCTGAACCGGCGTCGATGCTGCTACGAAGGCGGTAAACTGAAGCGCAATTGATGAACTTCGGCGGACGGCAACTCGCGCGGCGCTGACATGTTTGATACTGATCTGATGGGGGTGATCGACGTTATCACGGACATCTACGCCGAATTACTATGGCGGAACCAATGACGACGTGTTTAATCGGCGGGCTGGAAGCTTGCGCCGAGATATATTGAACCGGGCGAGCTTATTATCGGCGGCAATACATGCCGCTACGAGTTTAAACACCCAGAGCGACGACAATGGCAATACGTAACACGGCC
+>d5943c57-7a5d-4b70-9db0-78c47b331a56 id=75 clr=0,6972
+TTGGTATTGCTTCGTTCAGTTACGTATTGCTCGCCTGTCGCTCTATCTTCGGCGTCTGCTTGGGTGTTTAACCTCAGGAAGAGATGTCATTAATCAGCCGCGCCAGCCCGCTGCCTAAAGGACGCGCCAGCACCATTAACACCAGTAAAAACGTGGCGATCAGTAAGAACCCTTGCGCAGCCATCAGAACGCCTCCGCATTGATCAGGGCATAAACCAGATAACCCAGTAATAAAACACCAGCAATACGCCGGTTATCACGCCTGCACTCACAGTGCACCTCCAGTGGCCTAAAAGTGATACCGGAAGGGTAGAATTCTGGCTGCAAAGATTTCGCAAAATCTGCGGGCGGGGTGTAAAAGTATAAAATGGCAAAAGCCATGATTTAACTAATGTTTAGTATTAATTTAACTTTGTGTAACTTAATTACAGGATGAATGTAAATAAACCATCAATAAGCAAAAATAAGTGGTCGGATGAGTAGTAAAATTACACAAAGGCGGTACTATTTTCATCAGATAAACAAATTCATTTTCCGGTGCCATTCACCGGGTAGATACAAAAGGGGAGAAAGTATGGAACTCTACAGAGAATATCCTGCATGGCTTATCTTTTTACGCCGTACTTATGCGGTTGCAGCGGGCGTTCTGGCGCTGCCTTTCATGCTTTCTGGAAAGACCGCGCCCGCTTTTACAGCTACCTGCATCGCGTCTGGTCGAAAACCAGCGATAAACCGGTGTGGATGGATCAGGCCGAAAAGGCAACTGGTGATTTTATTGATTGCTGAGTTTTGAATACATTGAAAACCGCCAGCGGAAACGCTGGCGGTTTTATCAGGAAGATGTTCAGAGGAATATTTAGACATCGTTATACCAATCGAAACATATATTCATGAAATATATATAAATATTTTCCTAATTGTTCTTATCTGACAGATATCTCACTTAAGGCTTTCTTATAAATCTGTAGGGTTTCGCCTGTCAGCAGACAAATAACCCGATAAAACAAGGATGAGCAGATGAGCGGAAAACCGGCGGCGCGTCAGGGCGACATGACGCAGTATGGCGGTAGCATTGTCCAGGGTTCAGCCGGGGTACGCATCGGTGCCCCACCGGCGTGGCCTGTTCGGTGTGCCCCGGCGGTGACGTCCGGCCATCCGGTCAATCCGCTGCTCGGTGCAAAGGTCCTTCCCGGTGAAACCGACATCGCCCTGCCCGGCCCGCTGCCGTTCATTCTCTCCGCACCTACAGCAGTTACCGGACAAAACGCCCGCGCCGGTGGGAGCCTCGGCCCCGGCTGGAAAATGCCTGCGGATATCCGCTTACAGCTGCGCGATAACACACTGATACTCAGTGATAACGGCGGCAGAAGCCTGCAATTTTATGCGGTGGATGATCACCGGCTGGCCGCACTCTGGCAGGCGCTGCCGGAAGAACTCCGCTTAAGTCCGCATCGTTATCTGGCGACAAACAGTCCGCAGGGGCCGTGGTGGCTGCTCGGCTGGTGTGAGCGGGTGCCGGAAGCGGATGAGGTGCTGCCTGCGCCGCTGCCGCCGTACCGGGTACTGACCGGGCTGGTGGACCGCTTCGGGCGCACACAGACGTTCCACCGCGAAGCCGCCGGTGAATTCAGCGGCGAAATCACCGGCGTGACGGATGGTGGGCGTCACTTCCGGCTGGTACTGACCACGCAGGCGCAGCGGGCAGAAGAAGCCCGGCAGCAGGCCATTTCCGGCGGGACGGAACCGTCCGCTTTTCCTGATACCCTGCCGGGTTACACCGAATATGGCCGGGACAACGGCATCCGTCTGTCTGCCGTGTGGCTGACGCACGACCCGGAATACCCGGAGAATTTACCTGCCGCGCCGCTGGTGCGCTATGGCTGGACGCCCGCGGCGAACTGGCGGCGGTGTATGACCGCAGCAATACACAGGTGCGCAGCTTTACTTACGATGATAAATACCGGGGCCGGATGGTGGCGCACCGTCACACGGGCCGACCGGAAATCTGTTACCGTTACGACAGCGACGGGCGGGTGACAGAACAGCTAAACCCGGCAGGCTTAAGTTACACGTATCAGTATGAGAAGGACCGCATCACCATCACCGACAGCCTGAACCGCCGTGAAGTCCTGCACGCAGGGTGAAGGCGGGCTGAAGCGGGTGGTGAAAAGGAACACGGACGGCAGCGTCACGCAGAGTCAGTTTGACGCGGTGGGCAGGCTCAGGGCACAGACGGATGCCGCAGGCAGGACAACAGAATACAGTCCGGATGTGGTGACGGGCCTCATCACGCGCATCACCACGCCGGATGGCAGGGCATCGGCGTTTTACTATAACCACCACAGCCAGTTAACGTCAGCCACCGGGCCTGACGGGCTGGAAATACGCCGGAATATGATGAATGGGGCCGTCTGATTCAGGAAACTGCCCCTGACGGCGATATCACCCGCTACCGTTATGATAATCCACACAGTGACTTACCCTGCGCAACGGAAGATGCCACCGGCAGCGGAAAACCATGACGTGGAGCCGTTACGGTCAGTTGCTGAGCTTCACTGACTGTTCCGGTTATGTAACCCGCTATGACCATGACCGTTTTGGTCAGGTGACGGCGGTGCACCGCGAGGAAGGGCTGAGTCAGTACCGCGCATACGACAGCCGTGGACAGTTAATTGCCGTGAAAGACACGCAGGGCCATGAAACGCGGTATGAATACAACGCCGCCGGTGACCTGACCACCGTCATTGCCCCGGACGGCAGCAGAAACGGGACACAGTACGATGCGTGGGGAAAAGCCATCTGTACCACGCAGGGCGGTCTGACGCGCAGTATGGAATACGATGCTGCCGGACGGGTCATCCGCCTGACCAGTGAAAACGGCAGCCACACCACCTTCCGTTACGATGTACTCGACCGGCTGATACAGGAAACCGGCTTTGACGGCCGCACACAGCGTTATCACCACGACCTGACCGGCAAACTTATCCGCAGCGAGGATGAGGGGCTGGTCACCCACTGGCACTATGACGAAGCAGACCGCCTCACGCACCGCACCGTGAATGGCGAAACCGCAGAGCGGTGGCAGTATGACGAACGCGGCTGGCTGACAGACATCAGCCATATCAGCGAAGGGCACCGGGTGACGGTGCACTATGGTTATGACAGTAAAGGCCGCCTCGCCAGTGAACACCTGACGGTGCATCATCCGCAGACGAATGAACTGCTCTGGCAGCATGAGACCAGACATGCGTACAACGCACAGGGACTGGCGAACCGCTGTATACCGGACAGCCTGCCCGCCGTGGAATGGCTGACCTACGGCAGCGGCTGGCTGTCAGGCATGAAACTCGGCGACACACCGCTGGTGGAGTACACCCGCGACCGCCTGCACCGGGAAACGCTGCGCAGCTTCGGCCGTTATGAACTCACCACCGCTTATACCCCTGCCGGGCAGTTACAGAGCCAGCACCTGAACAGCCTGCTGTCTGACCGCGATTACACCTGGAACGACAACGGCGAACTCATCCGCATCAGCAGCCCGCGCCAGACCCGGAGTTACAGCTACAGCACCACCGGCAGGCTGACCGGCGTTCACACCACCGCAGCGAATCTGGATATCCGCATCCCGTATACCACAGACCCGGCAGGTAACCGCCTGCCCGACCCGGAGCTGCACGGACAGCGCCCTCAGCATGTGGCCGGATAACCGTATCGCCCGTGACGCGCACTATCTTTACCGGTATGACCGTCACGGCAGGCTGACAGAGAAACCGACCTCATCCCGGAAGGGTTATCCGCACGGATGATGAGCGCACCCACCGGTACCATGACAGTCAGCACCGGCTGGTGCACTACGCGGACACAATATGCAGAGCCGCTGGTCGAAAGTCGCTATCTTTACGACCCGCTGGGCCGCAGGGTGGCAAAACGGGTATGGCGGCGTGAACGGGACCTGACGGGCTGGATGTCGCTGTCACGGAAACCGCAAGTGACCTGGTACGGCTGGGACGGCGACCGCCTGACCACGATACAGAACGACAGAACCCGCATCCAGACGATTTATCAGCCGGGGAGCTTCACGCCACTCATCAGGGTTGAAACCGCCACCGGTGAGCTGGCGAAAACGCAGCGCCGCAGCCTGGCGGATACCCTTCAGCAGTCCGGTGGCGAAGACGGTGGCAGTGTGGTGTTCCCGCCGGTGCTGGTGCAGATGCTCGACCGGCTGGAAAGTGAAATCCTGGCTGACCGGGTGAGTGAGGAAAGCCGCCGCTGGCTGGCATCGTGCGGCCTGACGGTGGCGCAGATGCAAAGCCAGATGGACCCGGTATACACGCCGGCGCGAAAAATTCACCTGTACCACTGCGACCATCGCGGCCGCCGCTGGCCCTTATCAGCACGGAAGGGACAACAGCGTGGTACGCAGAATACGATGAATGGGGTAACCTGCTGAATGAAGAGAACCCGCATCAGCTGCAGCAGCTTATCCGCCTGCCGGGGCAGCAGTATGATGAGGAGTCCGGCCTGTATTACAACCGCCACCGCTATTATGACCCGCTGCAGGGGCGATATATCACTCAGGATCCGATTGGGCTGAAAGGGGATGGAATTTTATCAGTATCCGTTGAATCCGATCTCAAATATAGATCCATTAGGATTAGAAACACTAAAATGCATTAAGCCACTGCATTCAATGGGCGGAACTGGTGAAAGAAGCGGTCCAGATATATGGGGAATCCGTTCTATCATCAATATCTTTGTGTCCCAGATGGTAAAGGGACTATACTTGTGGTGGCCAAGACCAACGGGGAGAATCAAAGGAGATGGTCTATGGGGGCCAGGTAAAGCAAGTAATGATACAAAAGCTGCTGGCCGTTGTGACCTCGTTGAAACCGATAATAGTTGTGTGGAGAACTGTTTAAAGGAAGTTTAAAGAGGTAAGGCCGCGTTATTCTGTATTGCCTGATATATTCCACCTATAAATTTAGGGCTATTTAAAACTGCCAAGACTGGTCTAATGATTCTTTAGAAACATGTAAGATGAAGTGCTCCGGAAATAACATTGGACGTTTTATTAGATTTGTATTCACCGGAGTGATGTAATGAAATATATTATTTTTTATTCAGAGCTATATGGCTGGCTTTATCGCTTTTAATACTATTCTTTTCCATGCATAGACTTTCACTATTAGACTCCACTCGTGATGTGAGCGAGTTAATTAGTCTCATGTCTTATGGAATGATGGTAATATGTTTTCCAACAGGCATAGTATTCTTTATTGCTCTAATATTTATAGGGACTGTATCAGACATTATTGGCGTAAGGATTGATAGTAAGTATATTATGGCGATAATAATATGGCTTTATTTTCTGTCAGGAGGGTATATTCAATGGTTTGTATTAAGTAAGCGCATTATAAACAAATAAATTAAGTTAATTGCTCTTATTATTATATGTAACCTGGGCATTGATATCCCGTATGCCACAGACCCGGCAGGTAACCGCCTGCCCGACCCGGAGCTGCACCCGGACAGCACCCTCAGCATGTGGCCGGATAACCGTATCGCCCGTGACGCGCACTATCTTTACCGGTATGACCGTCACGGCAGGCTGACGGAAAAACCGACCTCATCCGGAAGGGTTATCCGCACGGATGATGAGCGCACCCACCGGTACCATTACGACAGTCAGCACCGGCTGGTGCACTACACGCGGACACAATATGCAGAGCCGCTGGTCGAAAGCCGCTATCTTTACGACCCGCTGGGCCGCAGGGTGGCAAAACGGGTGTGGCGACGTGAACGGGACCTGACGGGCTGGATGTCGCTGTCACGGAAACCGCAAGTGACCTGGTACGGCTGGGACGGCGACCGCCTGACCACGATACAGAACGACAGAACCCGCATCCAGACGATTTATCAGCCGGGGAGCTTCACGCCACTCATCAGGTTGAAACCGCCACCGGTGAGCTGGCGAACGCAGCGCCGCAGCCTGGCGGATACCCTTCAGCAGTCCGGCGGCGAAGACGGTGGCAGTGTGTGTTCCCGCCGGTGCTGGTGCAGATGCTCGACCGGCTGGAAAGTGAAATCCTGGCTGACCGGGTGAGTGAGGAAAGCCGCCGCTGGCTGGCATCGTGCGGCCTGACGGTGGAGCAGATGCAAAACCAGATGGACCCGGTGTACACGCCGGCGCGAAAAATCCACCTGTACCACTGCGACCATCGCGGCCTGCCGCTGGCGCTTGTCAGCACGGAAGGGGCAACAGAATGGTGCGCAGAATACGATGAATGGGGCAACCTGCTGAATGAAGAGAACCCGCATCAGCTGCAGCAGCTTATCCGCCTGCCGGGGCAGCAGTATGATGAGGAGTCCGGCCTGTATTACAACCGCCACCGCTATTATGACCCGCTGCAGGGAGGTATATCACTCAGGATCCGATTGGGCTGAAGGGGATGGAATTTTATCAGTATCCGCTGAATCCGGTTCAGTATATAGATTCAATGGGACTGGCATCAAAATATGGACACTTAAATAATGGCGGATATGGGCGAGACCCAACAAACCGCCTACGCCCGATCCAAGTAAATTGCCGGACATAGCGAAACAATTAAGACTGCCATATCCTATTGACCAGGCCAGTAGTGCGCCTAATGTTTTCAAAACATTCTTCAGAGCATTAAGCCCTACGACTACACACTGTATTGCAGGAAGTGGGTAAAACCAAATCTGACTTGTACGCCACAGGATGATTCCCAGTATCCAGGGATGGATACAAAGACAGCAAGTGATTACCTGCCACAGACAAATTGGCCAACAACTCAATTACCACCAGGATATACTTGTGCAGAACCTATTTATTCCCAGACATTAATAAACCCGATGGGCCAGCAACAGCAGGGATAGATGATTTGGGTGAAATTTTGGCTAAGATGAAACAGAAAGGTTAAACGCAAGCAGACGCCGAAGATGAAACGG
+>8a553dac-a603-4a38-ab2b-4c9cc41bd7ac id=76 clr=0,4596
+GGTTCCGTCGTTATAGTAAAATTTCGTCTCCCGCCCGTCCGGTGTGGTGATGTCCGTGATATCGCCGGACACCACATTCAGACCATACTCTGTCCTCCGTCCCGCCGCGTCCGTCTGCGCCGTGAGCCTTCCTGCCGCGTCATACCCGCTGCGCGTGACGCTGCCGTCCGCCAGTTCTTTTTCACCACCCGTTTCAGCCCGGCCCCGCCTTCTGTATGCAGCACCTCACGCCGGTTCAGGCTGTCGGTGACGGTGATGCGGTCCTGCTCATAAAGATAGCGGTAGCTTAACCCTGCCGGGTTCAGTTGCTCCACCACCCGCCCCGTATCGTCGTAGCGGTAGCGCATCTCCGGCCTTCCCGCGTAACGGTGCGCCACCATCCGGCCCGGGTGCTGCGCGTCATACGTGAAAGCGCGCACCTGCGTATTGCTGCGGTCATATACCGCCAGCAGTTCACCGGCTTCCGTATACGTGTACCGCACCAGTGGCGCAGCGGGCAGGCTCTCCGGGTATGCCGGGTCGTGCATCAGCCACACCGCCGAAAGGCGGATACCCTGTCGGGGCCGTATTCGGTACCGGGCGGTGTGTCGGGGAACGCTGAGGCTGAGAGGGCGGGAACTGTCAGAAGAAGATAGCGAAGAGGGGCCTCTTCCGCGCTGCGCCTGCGTGGTCAGCACCAGACGGAACTCCCGCCCGGCACCGTCCGTCACGCCGGTGATTTCCCGGCCAGGTCACCGGCGGCCTCACGCCGGTACGTCAGCGTCCGCCCGAAGCGGTCCGCCATCCCGGCACCCAATACGGCGGCAGCGGCGCTGGCAGTACGTCCTCAGCACCCGGCACCCGCTCAGACCACCCCAGTATCACCACGGCCCCTGTGCGCTGTTGGTCGCCAGGTAAAGATGCGGGCTTAACCGGATATCCGGCGGCAGCGCCCCCACAGCCGCGCCAGCGTATGGCCGTCCGGCTGTGCTGCCTTACCACCGCGCACCAGCCACATTGACTCACTGCGGCTGTACACCGCCTCCCCGGCAGCAGCGGCTCAAAGTGAATGCTCCGCCCGCCGTTGTCGTTGAGTATCAGTCCGTCATCACGTAGCTGTAAGCGGATATCAGAAGGCGCTTTCCAGCCGGGGCCGAAAACGCCCACCGGTGCAGGCGTCTTCGTCCGGTAGCTGCTGTAGGTGCGGGAGAGAATGAACGGCAGCGGGCCGGGCAGCGCAAGGTCCGTCTCGCCGGGCAGCACCTTCGCCCCCAGCAGCGGATTTACCGGGTTGCCCGAAGTCATCCCGCCCGGACACACCGAGCACGCCACGCCGGTGGGCGCGCCAATTCTTACACCTGCCGAACCCTGGACAATGGGACCGCCATACTGAGTCATATCTCCCTGACGCGCCGCTGGTTTTCCGCTCATATAAAGTGCCCTTTAGTTATTGTTCATATCCCTGTGTTAGCAACAAAAAATAAAATGACACACAAGACCAGCTAATGTATTTATATATTTTTCACATAAACTTATTTGTTCTCAATCAACAACAACTGTTATTACAGGTCACTTTCAATATTTTATTAAACTAACATTTTTACACAGATGAATTCATCATCAACAAATTCACTATATGGATAATATCCATTCAACGCATATGATTTATGATTTTATTAGTCTGAGTTATTTTTGTAGGGCTATATTTAAAATCAATAAACTCCACCGATTCAGATTAATATCAAATAGAAAGAAGATCACCAATTCAATAACATCATCAATAACACATATTGTAGAATTAATTTAAACAAGGCGTTCCATTCAACCAGAACGCCCCTATTTCTCATCACCCCCAAACTGCCTGAACAGCGCCTTACCCTTAACCAGTCGCGCACCCAGCCAGCCGCCGAAAGCGACAGCAGCAGCGCTCCGCTGCACGGCAGAACAATCCACAATCGCCAGTCTGGCTCCCACGGAAAATCAAACACTTTCGCCTGCAACACTGCCAGCGCCGTTTCCGCACCAATTGCGGCCAGGCCGGAAACAAACCCAAGCATGGCGAACTCACACCACAACGTGGTACGCAGCAGTTTTTCCCGCACCGAGTGTGCGCCACACCACCAGCTCCTGATGACGCTGACGCATTCCCACCTGCACCTGTGCCAGCAACAGCAACATACCGCAGGCGGTGACCAGTACCACCATCACTTCCAGCGCCCGACTTACCTGCTCCAGCTGACCGACCTGTTTTAAAATCGCGCCAATATCTAACAGGCTAATGGTCGGGAACTGGCGGTTGAGTTGTGTCAACATGCCGTTGCCATTCTCCCAGCGGAAACTGGTAAGCCAGCTCTGCGGTTGCCCGTCTAATGCCCTTCAGGGAAAATAAAATAGAAATTAGGCCGCAGACTTTCCCAGTCCACTTTGCGCAGGCTGGTCACTTTAGCGCGGAACTCCTGGGTATCGCCCATAAAAGTCACGGTATCACCGAGGGCAACGTTTAAGCGTTTCGCCAGCCCCTCTTCCATCGACACTTCATCGGCTTTTGGCGGCCAGTTACCGGCGACAATCGGATTATGATCGGGCCGCGTATTTTGCCAGGTAAGATTGAGTTCGCGGTTAAGCGCCTCATCTTCATTACCTTCTGTCGGCTTATCGTTAATCGCCGTCAGCCGCGCCGCACCACCGGATAAAACGATTCCGGGACTATCTGATGTTCCGCGAGGAACGCTTTTAGCGGTGCTACCTGTTCTGTGGCGATGTTAATTAAAAAGTAGTTCGGGCTTTCTGGAGGTAGCTGCTGCTGCCAGCGGTCGAGCAGATCGCCACGCAACACCAGCAGCAGTGCCAGCAGCATAAAGGAGAGCGAAAATGCCGAAAGCTGACTTAACGTTGACCACGGCTGACGTAACAGGCGGCTAACCGCCAGGCGCAGAGGCAGCGATTTCAGCGTCATGCGGCGAAGTACATTCAGCAGCATCCAGCCCAGCACACCGCACAGCAAAGCCAGTACTACCGCGCCCGCCAGCACCGCCCAAAGCAGCATGCTGCCATTAATCCGGCGAGCAGCAGCACAACCACCACACTGACAATCGGCAGATAAAACTTCAGCGGCCAGACGTTCGCTACCACATCATTACGTAATACGCGTAAAGGCTGCGTTGCCAGCAACAAGCGATATGGTCGTAGCCCCACCAGCAGCGAGATGACCGTCATGGTGCCAAGCGCCCAGCCACGGCCAGAGGCTGGCTGGCGGTAGTGCAGCAGGCAGAACGGGCTTGAGCAGCACCATCAACACGTTTCGAACAACAGGCCTATGGCCCCACCGGTAACGGCTGAAAGCGTCAGCACCATCAACCACTGACCGACGATTAGCTTACGCAGTTGCATCGCCCTGCCCCCAGCGTTTTGAGGATCGCCACCAGATCGTAGCGACTGCGACAGTAATGATTCATCGCTACCGCCACCGCTGCCACTGCCAGCAGCAAGGTCAGAAGCGCCGAAAGCAGCAGGAACTGTTGCGAGCGTTCCATCGATCGCCCCAGCGCGCCTTCGTCCTGTTCCAGACCGTACCAGCGTTGTTCGGGTTTAAGCTGAGGTAACAACCATTTCTCATAGCCGTCGAGCTGGTTCTCGTTGCCGCCGAATTTATAACGCCAGGTGACCCGACTCCCCGGCTGCGGCTCCGGTTTTATCGACATCCGCCAGATTCATCATCAGACGCGGAGCCATCTGGAAGGGTTAAAACCGGAATCCGGTTCCTGAATCACTTCTCCGGCAATCCGCAAGGTGGCATCGCCCACGTCAATGGTGTCGCCCGTTTTCAGGTTAAGCAGTGCCATCAGGCGTGGGGCCAGCAATACGCTGCCCGCCTGCGGTTTCAGGCCAGGGGATTAGTTTGCAGATCGCCATACATCGGGTAGATATCATCCACCGCTTTGACGTTCGCCAGCTGCGGTGTGTCGCCTGCAAAGGTCATTGTGGCGAAAGTCAGCTGCTTGCCGACTTTCAGGCCGCGCTTTGCGCTTCCTCCAGCCACGCTTGCGGCACTTCGCGTGAACTGCGCAACGCCCGATCGCCCGCCATAAACTCACGGCTTTGCTGGCTTAAGCCCTTCTCCATGCGATCGCTGATATTGCCCAGCGCCAGCACGCAGGCCACCGCCAGGCTTAGCGCCAGCCAGACAATTAATAGCGACGGCGAACGCCATTCGCGCCAGAACCAACGTGCAATCATGCTTCCTCCTGCAACTGCCCGTTCACCAGCCGTAAGCAGCGGTCGCAGCGTGCCGCCAGTTGCAGGTCGTGGGTCACCATAATCAACGTGGTGCCATGTTCACGGTTGAGGGAAACAGCAGGTCGGCAATTTTATCGCCCGTCTGGCGGTCAAGGTTGCCGGTGGGTTCGTCGGCAAACAGCACATCAGGTCGACCATTAAAGGCTCGTGCCAGGCCTCACTCGTTGCTGTTCACCGCCGGAAAGCTGTGCCGGAAGATGATCAGACGTTTACCCAGCCCTAACTGTTCGAGCAACGCTTTCGCCCCGTTACGACTTTCCGCTTCTCTCACCGCGCAGCCAGAAGGTTAAACACGAAGCAGACGCCGCAATATCCAGCGGG
+>0e56d03e-268c-42cc-a0f3-90d688115d07 id=77 clr=0,7775
+CGTTCAGTTACGTATTGCTACTTGCCTGTCGCTCTATCTTCGGCGTCTGCTTGGGTGTTTAACCTTCCATTTGTTCACCTTATTTATGTAAGGAGTATTTGATCATGTATAAGCTATGAAAACAGCTTTAGGTAATAAGGAATATCTCAATTTTTAAACATAAAATGCGAATTATTTAGTACAAAAGTAGCGTTACGTGATCTTTCCTGGGACTACTCTGGCAATGGTATCGTGAACAGGAATACCATTTTCAAAATCACCATATTGCTTCAAAATCGAGGTGTTTCCCCGAAATCCTCTATATCTTCCCAACCTTCTGCACCAGAAATAACGGCACAAATAGTCAACAGTAGAATATCTGACAATTTATGCACCACTTTCCAGGCTTGTCTGTAATCGGGTGTAATAGAAATATGTTCCATCAATTTTTAAGTTCCATTTGTTCACCTTATTTATGTAAGGAGTATTTGATCATGTATAAGCTATGAAAAACAGCTTTAGACAATAAGTAGTATCTCAATTGTTGAACTTAAATTCGAATTATTTAGTACAAAAAAGTAGCGTTACGTGATCTTTCCTGCAAATGGAACGCAAAATAAACACCTATTCCATGAGTTATATAATTTTTCACAATGATTAATTTGTTTTCTCAGGAAGAGATTTTATTTCTCTTCACTACGAATTAGTTCATGCTGTATCTTTATTAAACATTCGTAAGACTCATTTTGTTCGGGAGATGTGCTGTCATTCGAGCATAAGTTGGTTTCTCATCTTTAAAATATTTTACCATGATTGAATTATCAAGGACTGCCAACAACTGAACTGGATCACTGCTCTTTTGATAGATACCCGCTCTTATATAACTTCTAAACCGATCGCCGAGAAACGCCGTTTTTCTGCTGTATTTATCAACTCCTGCAACGTTCCTTTGATGGCATGATTTTCATTAAGGCGTAGTGACCCGACGCGATTAAGAGTCTCGCCCGCTTGGTGTGAATTTATTATTTTTACATGTACCCAGTTCTGTTTGCCAATAATACTCACCGATGTCCTCATTCTGATACCATCTCCACATGGCTTTATTATTTAAGACAGGAAACGCGGAAAAATAGTACCCTTAGCGAAAATAGTAAAACAATCATGATCTTTAGCTTGTATTTCGCAATCAGCTATAACACCAAAACTAACAAATATCATCAGCAAAAAGAACAAAACTCTTTTCATTTTCTTATTCCTCTCGATGTTCTCTGTTTCATCTTAGCTAAAATTTCACCCAAATCATCTATCCCTGCTGTTGCTGGCCCATCGGGTTTATTAATGTCTGGGAATAAATAGGGTTCTGCACAAGTATATCCTGGTGGTAATTGAGTTGTTGGCCAATTTGTCTGTGGCAGGTAATCACTTGCTGTCTTTGTATCCATCCCTGGATACTGGGAATCATCCTGTGGCGTACAAGTCAGATTTGGTTTTACCCACTTCCTGCAATACAGTGTGTAGTCGTAGGGCTTAATGCTCTGAAGAATGTTTTGAAAACATTAGGCGCACTACTGGCCTGGTCAATAGGATATGGCAGTCTTAATTGTTTCGCTATGTCCGGCAATTTACTTTTGGATCGGGCGTAGGCGGTTTGTTGGGTCTCGCTCCATATCCGCCATTATTTAAGTGTCCATATTTTGATGCCAGTCCCATTGAATCTATATACTGAACCGGATTCAGCGGATACTGATAAAATTCCATCCCCTTCAGCCCAATCGGATCCTGAGTGATATACCTCCCTGCAGCGGGTCATAATAGCGGTGGCGGTTGTAATACAGGCCGGACTCCTCATCATACTGCCCCGGCAGGCGGATAAGCTGCTGCAGCTGATGCGGGTTCTCTTCATTCAGCAGGTTGCCCCATTCATCGTATTCTGCGCACCATTCTGTTGCCCCTTCCGTGCTGACAAGCGCCAGCGGCAGCCGCGATGGTCGCAGTGGTACAGGTGGATTTTTCGCGCCGGCGTGTACACCGGGTCCATCTGGTTTTGCATCTGCTCCACCGTCAGGCCGCACGATGCCAGCCAGCGGCGGCTTTCCTCACTCACCCGGTCAGCCAGGATTTCACTTTCCAGCCGGTCGAGCATCTGCACCAGCACCGGCGGGAACACCACACTGCCACCGTCTTCGCCGCCGGACTGCTGAAGGGTATCCGCCAGGCTGCGGCGCTGCGTTTTCGCCAGCTCACCGGTGGCGGTTTCAACCCTGATGAGTGGCGTGAAGCTCCCCGGCTGATAAATCGTCTGGATGCGGGTTCTGTCGTTCTGTATCGTGGTCAGGCGGTCGCCGTCCCAGCCGTACCAGGTCACTTGCGGTTTCCGTGACAGCGACATCCAGCCCGTCAGGTCCCGTTCACGTCGCCACACCCGTTTTGCCACCCTGCGGCCCAGCGGGTCGTAAAGATAGCGGCTTTCGACCAGCGGCTCTGCATATTGTGTCCGCGTGTAGTGCACCAGCCGGTGCTGACTGTCGTAATGGTACCGGTGGGTGCGCTCATCATCCGTGCGGATAACCCTTCCGGGATGAGGTCGGTTTTCTCCGTCAGCCTGCCGTGACGGTCATACCGGTAAAGATAGTGCGCGTCACGGGCGATACGGTTATCCGGCCACATGCTGAGGGTGCTGTCCGGGTGCAGCTCCGGTCGGGCAGGCGGTTACCTGCCGGGTCTGTGGCATACGGGATATCAATGCCCAGGTTACATATAATAATAAGAGCAATTAACTTAATTTATTTGTTTATAATGCGCTTACTTAATACAAACCATTGAATATACCCTCCTGACAGAAAATAAAGCCATATTATTATCGCCATAATATACTTACTATCAATCCTTACGCCAATAATGTCTGATACAGTCCCTATAAATATTAGAGCAATAAAGAATACTATGCCTGTTGGAAAACATATTACCATCATTCCATAAGACATGAGACTAATTAACTCGCTCACATCACGAGTGGAGTCTAATAGTGAAAGTCTATGCATGGAAAAGAATAGTATTAAAAGCGATAAAGCCAGCCATATAGCTCTGAATAAAAAATAATATATTTCATTACATCACTCCGGTGAATACAAATCTAATAAAACGTCCAATGTTATTTCCGGAGCACTTCATCTTACATGTTTCTAAAGAATCATTAGACCAGTCTTGGCAGTTTTAAATAGCCCTAAATTTATAGGTGTGAATATATCAGGCAATACAGAATAACGCGGCCTTACCTCTTTAAACTTCCCTTTAAACAGTTCTCCACACAACTATTATCGGTTTCAACGAGGTCACAACGGCCAGCAGCTTCTTTTGTATCATTACTTGCTTTACCTGGCCCCCATAGACCATCTCCTTTGATTCTCCCCGTTGGTCTTGGCCACCACAAGTATAGTCCCTTTACCATCTGGGACACAAAGATATTGATGATAGAACGGATTCCCCATATATCTGGACCGCTTCTTTCACCAGTTCCGCCCATTGAATGCAGTGGCTTAATGCATTTTAGTGTTTCTAATCCTAATGGATCTATATTTGAGATCGGATTCAACGGATACTGATAAAATTCCATCCCCTTTCAGCCCAATCGGATCCTGAGTGATATATCGCCCCTGCAGCGGGTCATAATAGCGGTGGCGGTTGTAATACAGGCCGGACTCCTCATCATACTGCTGCCCCGGCAGGCGGATAAGCTGCTGCTGATGCGGGTTCTCTTCATTCAGCAGGTTACCCCATTCATCGTATTCTGCGTACCACGCTGTTGTCCCTTCCGTGCTGATATGGGCCAGCGGCAGGCGCGATGGTCGCAGTGGTACAGGTGAATTTTTCGCGCCGGCGTGTATACCGGGTCCATCTGGCTTTGCATCTGCGCCACCGTCAGGCCGCACGATGCCAGCCAGCGGCGGCTTTCCTCACTCACCCGGTCAGCCAGGATTTCACTTTCCAGCCGGTCGAGCATCTGCACCAGCACCGGCGGGAACACCACCACCGTCTTCGCCACCGGACTGCTGAAGGGTATCCGCCAGGCTGCGGCGCTGCGTTTTCGCCAGCTCACCGGTGGCGGTTTCAACCCTGATGAGTGGCGTGAAGCTCCCCGGCTGATAAATCGTCTGGATGCGGGTTCTGTCGTTCTGTATCGTGGTCAGGCGGTCGCCGTCCCAGCCGTACCAGGTCACTTGCGGTTTCCGTGACAGCGACATCCAGCCCGTCAGGTCCCGTTCACGCCGCCATACCCGTTTTGCCACCCTGCGGCCCAGCGGGTCGTAAAGATAGCGACTTTCGACCAGCGGCTCTGCATATTGTGTCCGCGTGTAGTGCACCAGCCGGTGCTGACTGTCGTAATGGTACCGGTGGGTGCGCTCATCATCCGTGCGGATAACCCTTCCGGGATGAGGTCGGTTTCTCTGTCAGCCTGCCGTGACGGTCATACCGGTAAAGATAGTGCGCGTCACGGGCGATACGGTTATCCGGCCACATGCTGAGGGCGCTGTCCGGGTGCAGCTCCGGTCGGGCAGGCGGTTACCTGCCGGGTCTGTGGTATACGGGATGCGGATATCCAGATTCGCTGCGGTGGTGTGAACGCCGGTCAGCCTGCCGGTGGTGCTGTAGCTGTAACTCCGGGTCTGGCGCGGGCTGCTGATGCGGATGAGTTCGCCGTTGTCGTTCCAGGTGTAATCGCGGTCAGACAGCAGGCTGTTCAGGTGCTGGCTCTGTAACTGCCCGGCAGGGGTATAAGCGGTGGTGAGTTCATAACGGCCGAAGCTGCGCAGCGTTTCCCGTGCAGGCGGTCGCGGGTGTACTCCACCAGCGGTGTGTCGCCGAGTTTCATGCCTGACAGCCAGCCGCTGCCGTAGGTCAGCCATTCCACGGCAGGCTGTCCGGTATACAGCGGTTCGCCAGTCCCTGTGCGTTGTACGCATGTCTGGTCTCATGCTGCCAGAGCAGTTCATTCGTCTGCGGATGATGCACCGTCAGGTGTTCACTGGCGAGGCGGCCTTTACTGTCATAACCATAGTGCACCGTCACCCGGTGCCCTTCGCTGATATGGCTGATGTCTGTCAGCCAGCCGCGTTCGTCATACTGCCACCGCTCTGCGGTTTCGCCATTCACGGTGCGGTGCGTGAGGCGGTCTGCTTCGTCATAGTGCCAGTGGGTGACCAGCCCTCATCCTCGCTGCGGATAAGTTTGCCGGTCAGGTCGTGGTGATAACGCTGTGTGCGGCCGTCAAAGCCGGTTTCCTGTATCAGCCGGTCGAGTACATCGTAACGGAAGGTGGTGTGGCTGCCGTTTTCACTGGTCAGGCGGATGACCCGTCCGGCAGCATCGTATTCCATACTGCGCGTCAGACCGCCCTGCGTGGTACAGATGGCTTTTCCCCACGCATCGTACTGTGTCCCGTTTCTGCTGCCGTCCGGGCAATGACGGTGGTCAGGTCACCGGCGGCGTTGTATTCATACCGCGTTTCATGGCCCTGCGTGTCTTTCACGGCAATTAACTGTCCACGGCTGTCGTATGCGCGGTACTGACTCAGCCCTTCCTCGCGGTGCACCGCCGTCACCTGACCAAAACGGTCATGGTCATAGCGGGTTACATAACCGGAACAGTCAGTGAAGCTCAGCAACTGACCGTAACGGCTCCACGTCATGGTTTTCCGGCTGCCGGTGGCATCTTCCGTTGCGCAGGGTAAGTCACTGTGGATTATCATAACGGTAGCGGGTGATATCGCCGTCAGGGGCAGTTTCCTGAATCAGACGGCCCCATTCATCATATTCCCGGCGTATTTCCAGCCCGTCAGGCCCGGTGGCTGACGTTAACTGGCTGTGGTGGTTATAGTAAAACGCCGATGCCCTGCCATCCGGCGTGGTGATGCGCGTGATGAGGCCCGTCACCACATCCGGACTGTATTCTGTTGTCCTGCCTGCGGCATCCGTCTGTGCCCTGAGCCTGCCCACCGCGTCAAACTGACTCTGCGTGACGCTGCCGTCCGCGTGTTCCTTTTCACCACCCGCTTCAGCCCGCCTTCACCCTGCGTGTGCAGGACTTCACGGCGGTTCAGGCTGTCGGTGATGGTGATGCGGTCCTTCTCATACTGATACGTGTAACTTAAGCCTGCCGGGTTTAGCTGTTCTGTCACCCGCCCGTCGCTGTCGTAACGGTAACAGATTTCCGGTCGGCCCGTGTGACGGTGCGCCACCATCCGGCCCCGGTATTTATCATCGTAAGTAAAGCTGCGCACCTGTGTATTGCTGCGGTCATACACCGCCGCCAGTTCGCCGCGGGCGTCCAGCCATAGCGCACCAGCGGCGCGGCAGGTAAATTCTCCGGGTATTCCGGGTCGTGCGTCAGCCACACGGCAGACAGACGGATGCCGTTGTCCCGGCCATATTCGGTGTAACCCGGCAGGGTATCAGGAAAAGCGGACGGTTCCGTCCCGCCGGAAATGGCCTGCTGCGGGCTTCTTCTGCCCGCTGCGCCTGCGTGGTCAGTACCAGCCGGAAGTGACGCCCGGCACCATCCGTCACGCCGGTGATTTCGCCGCTGAATTCACCGGCGGCTTCGCGGTGGAACGTCTGTGTGCGCCCGAAGCGGTCCACCAGCCCGGTCAGTACCCGGTACGGCGGCAGCGGCGCAGGCAGCACCTCATCCGCTTCCGGCACCCGCTCACACCAGCCGAGCAGCCACCACGGCCCCTGCGGACTGTTTGTCGCCAGATAACGATGCGGACTTAAGCGGAGTTCTTCCGGCAGCGCCTGCCAGAGTGCGGCCAGCCGGTGACCTTCATCCAGTTTCGCCACGCCGCCGCGCAGCCACAGTGACTCGCTGCGGCTGTAACCGTCCTCACCGGGAAACAGGTGCTCAAAATACAGGCTTCTGCCGCCGTTATCACTGAGTATCAGTGTGTTATCGCGCAGCTGTAAGCGGATATCCGCAGGCATTTTCCAGCCGGGGCCGAGGCTCCCCACCGGCGCGGGCGTTTTGTCCGGTAACTGCTGTAGGTGCGGGAGAGAATGAACGGCAGCGGGCCGGGCAGGGCGATGTCGGTTTCACCGGGAAGGACCTTTGCACCGAGCAGCGGATTGACCGGATGGCCGGACGTCACCGCCGGGGCACACGAACAGGCCACGCCGGTGGGGCACCGATGCGTACCCCGGCTGAACCCTGGACAATGCTACCGCCATACTGCGTCATGTCGCCCTGACGCGCCGCCGGTTTTCCGCTCATCTGCTCATCCTTGTTTTATCGGGTTATTTGTCTGCTGACAGGCGAAACCCTACAGATTTATAAGAAAGCCTTAAGTGAGATATCTGTCAGATAAGAACAATTAGGAAAATATTTATATATATTTCATGAATATATGTTTCGATTGGTATAACGATGTCTAAATATTCCTCTGAACATCTTCCTGATACAAAAACCGCCAGCGTTTCCGCTGGCGGTTTTCAATGTATTCAAACTCAGCAATCAATAAAATCACCAGTTGCCTTTTCGGCCTGATCCATCCACACCGGTTTATCGCTGGTTTTCGACCAGACGCGATGCAGGTAGCTGTAAAAGCGGGCGCGGTCTTTCCAGAAAGCATGAAAGGCAGCGCCAGAACGCCCGCTGCAACCGCATAAGTACGGCGTAAAAAGATAAGCCATGCAGGATATTCTCTGTAGAGTTCCATACTTTTCTCCCCTTTTGTATCTACCCGGTGAATGGCACCGGAAAAATGAATTTGTTTATAAGACGGCTTTAAACGAACGCCGCAATAA
+>bdfab7a9-1792-4c9a-9428-261e109cdfae id=78 clr=0,7783
+CGGCTGATTAATGACATTCCTCTTCCCGGTACAGGGCGTTGAGCGCGTACTTTTTCGCGCACTTGCGTCTCTGACCGTGAGATGAACTGGAAGCAATATCTTTGCCATTCTCGGCCTGAACATGCTGGGGCTGGCGGTGCTGTTTTTATGTTGCTCGGTCAGCACTATCTGCCGCTTAATCCACAGCAGTTGCCAGGGCTGTCGTGGGATCTGGCGCTGAATACCGCCGTCAGCTTTGTCACCAATACCAACTGGCAATCTTATAGCGGTGAAACCACGTTGAGCTATTTCAGCCAGATGGCGGGCTTAACGGTGCAAAACTTTCTTCTGCCGCCAGCGGGATTGCGGTGATTTTGCCCTCATCCGTGCGTTTACCCGCCAGAGCATGAGCACGCTCGGGAATGCCTGGGTCGATCTGCTACGCATCACGTTATGGGTGCTAGTCCCTGTGGCGTTGTTGATTGCACTGTTTTTATTCAACAAGGTGCGCTGCAAAACTTTCTGCCTTATCAGGCTGTGAATACCGTTGAAGGAGCGCAACAGCTGTTACCCATGGGGCCTGTAGCTTCTCAGGAAGCGATCAAGATGCTCGGTACTAACGGCGGTGGCTTCTTTAATGCCAACTCGTCGCATCCGTTTGAAAACCCAACCGCACTGACCAACTTCGTGCAGATGCTGGCGATCTTCTTGATCCCAACGGCGCTGTGCTTTGCCTTTGGTGAAGTGATGGGCGATCGCCGCCAGCATGTTGCTGTGGGCGATGTCAGTGATTTTTGTCATCTGCGTAGGCGTGGTGATGTGGGCAGAAGTTCAGGGTAATCCTCATCTGCTGGCACTGGGCACGGACAGCAGCATCAATATGGAAGGTAAAGAGAGCCGTTTCGGCGTGCTGGTCAGTAGCCTGTTTGCGGTCGTGACGACGGCGGCTTCCTGTGGCGCGGTGATTGCGATGCATGATTCGTTTACCGCTCTCGGTGGCATGGTGCCGATGTGGCTGATGCAAATTGGTGAAGTGGTGTTCGGCGGTGTCGGTTCTGGTCTTTACGGCATGATGCTGTTTGTCCTGCTGGCGGTGTTTATTGCCGGGCTGATGATTGGTCGTACACCGGAATATCTGGGTAAAAATCGACGTACGCGAGATGAAACTGACTGCACTGGCAATTCTGGTTACCCCGACGCTGGTGCTGATGGGCGCGGCGTTGGCGATGATGACCGACGCCGGACGTAGCGCCATGCTCAACCCTGGCCCGCATGGTTTTAGCGAAGTGCTGTACGCCGTGTCATCCGCTAACAACAACGGCAGCGCCTTTGCCGGATTAAGCGCCAACTCTCCGTTCTGGAACTGTTTACTGGCGTTCTGCATGTTTGTCGGTCGCTTCGGGGTGATTATCCCGGTGATGGCAATTGCCGGTTCGCTGGTGAGTAAAAGAGCCAAGCCGCCAGCTCCGGCACGCTGCCAACGCACGGCCCGCTGTTTGTTGGCCTGTTAATCGGCACCGTGTTGCTGGTTGGCGCACTGACCTTTATCCTGCCCTGGCGCTTGGTCCGGTGGCGGAATATCTCTCTGATGATATTGGTGAGCACTGAATATGAGTCGTAAACAACTGGCGCTATTCGAACCAACACTTGTCGTTCAGGCGCTGAAAGAAGCGGTGAAAAATTAAACCCGCAGGCGCAATGGCGCAATCCGGTGATGTTTATCGTCTGGATCGGCAGTCTGCTGACCACCTGTATTAGCATCGCGATGGGCAGTGCGATGCCCGGCAATGCGCTGTTTAGCGCGGCCATAGCGGTTGGCTGTGGATCACCGTACTGTTCGCTAATTTCGCCGAGGCGCTGGCAGAAGGCCGCAGTAAAGCGCAGGCCAACAGTCTGAAAGGGTGAAAAACTGCCTTTGCCCGCAAGCTGCGTGAGCCGAAATATGGCGCTGCGGCGGACAAAGTTCCTGCCGACCAACTTCGTAAAGGCGATATCGTACTGGTAGAAGCTGGCGATATTATCCCGCGATGGTGAAGTTATTGAAGGGGTGCATCGGTCGATGAAAGCGCCATCACCGGGGAATCGGCACCGGTGATCCGTGAATCCGGCGGCGATTTTGCCTCCGTCACCGGCGGCACGCGTATTCTTTCTGACTGGCTGGTGATTGAGTGTAGCGTTAACCCCGGCGAGACATTTCTGGATCGGATGATCGCGATGGTGGAAGGCGCACAGCGACGCAAAACGCCGAACGAAATTGCCCTGACCATTCTGCTGATTGCCCTGACTATCGTCTTTTACTGGCAACCGCCACGCTGTGGCCGTTTTCCGCGTGGGGCGGTAATGCAGTCAGCGTAACGGTACTGGTGGCGCTGCTGGTCTGTCTGATCCCAACCACTATTGGCGGCCTGTTGTCAGCGATCGGCGTCGCCGGGATGAGCCGGATGCTAGGCGCGAATGTGATTGCCACCAGCGGACGTGCAGTTGAAGCGGCAGGTGACGTTGACGTTCTGCTACTGGATAAAACCGGCACCATCACACTCGGTAACCGTCAGGCGTCGGAGTTTATCCCCGCGCAGGGCGTGGATGAAAACGCTGGCTGACGCCGCACAACTGGCTTCGCTGGCTGATGAAACGCCGGAAGGCCGCAGTATTGTGATCCTCGCCAAGCAGCGTTTTAACCTGCGCGAGCGCGATGTGCAGTCGCTCCATGCCACCTTTGTACCGTTTACTGCGCAAAGCCGGATGAGCGGGATCAACATCGACAACCGCATGATCCGTAAAGGTTCTGTCGATGCCATTCGTCGCCATGTTGAGGCTAACGGTGGTCACTTCCCTACCGATGTTGATCAAAAAGTCGATCAGGTTGCGCGTCAGGGAGCCACGCCGCTGGTGGTGGTGGAAGGTTCTCGTGTGCTGGGCGTTATTGCGCTGAAAGATATCGTCAAAGGCGGTATTAAAGAGCGCTTCGCCCAGCTGCGCAAAATGGGCATTAAAACGGTGATGATTACCGGCGATAACCGTCTGACTGCCGCCGCGATTGCTGCGGAAGCGGGTGTCGATGATTTTCTCGCCGAAGCGACACCGGAGGCCAAGCTGGCATTGATCCGTCAGTATCAGGCGGAAGGTCGTTTGGTAGCGATGACCGGCGACGGCACCAACGATGCTCCGGCGCTGGCGCAGGCAGATGTCGCGGTGGCGATGAACTCCGGCACCCAGGCGGCGAAAGAGGCGGGCAATATGGTCGATCTCGACTCTAACCCGACCAAGTTGATCGAGGTGGTGCACATTGGCAAACAGATGCTGATGACCCGTGGCTCGCTGACCACCTTCAGCATACCAACGATGTGGCGAAATACTTCGCCATTATTCCGGCGGCATTCGCGGCAACGTATCCGCAGTTAAATGCGCTGAACATCATGTGCCTGCATTCGCCCGACTCCGCAATCCTCAGTGCGGTGATTTTCAACGCCTTGATTATCGTCTTTGATTCCCCTGGCGTTAAAAGGCGTGAGTTATAAACCGCTTACCGCTTCTGCCATGTTGCGCCGTAACTTATGGATTTACGGTCTGGGTGGGCTGCTGGTGCCGTTTATCGGTATCAAAGTCATTGATTTACTGCTGACCGTTTGCGGTCTGGTGAGGTTTACCATGAGTGGATTACGTCCGGCATTATCAACATTTATCTTTCTGTTATTGATTACTGGCGGCGTTTACCCGCTGCTGACCACCGTACTGGGGCAATGGTGGTTTCCTGGCAGGCCAATGGTTCGTTGATTCGTGAAGGTGATACGGTGCGCGGTTCGGCATTAATCGGGCAGAATTTTACCGGCAACGGCTATTTTCATGGTCGCCCGTCGGCAACGGCAGAAATGCCCTATAATCCACAGGCTTCTGGCGGGAGCAATCTGGCGGTCAGTAACCCTGAGCTGGATAAACTAATAGCCGCACGCGTTGCTGCATTACGGGCCGCTAACCCGGATGCCAGCGCGAGCGTTCCGGAACTGGTGACGGCATCGGCAAGCGGGCTGGACAATAATATCACCCGCAAGCGGCGGCCTGGCAAATCCCACGCGTGGCGAAAGCGCGTAATCTCAGCGTTGAACAGCTCACGCAACTGATCGCAAAATACAGCCAACAACCGCTGGTGAAATATATCGGCCAGCCGGTTGTCAACATTGTTGAACTCAATCTGGCGCTGGATAAACTTGATGAATAACGAACCCTTACGTCCCGACCCCGATCGTCTGCTGGAACAAACTGCCGCGCCGCATCGGGGAAGCTGAAAGTTTTTCTTCGGTGCCTGTGCAGGCGTCGGGAAGACCTGGGCGATGCTGGCAGAAGCCCAGCGACTGCGGGCGCAAGGGCTGGATATTGTGGTTGGCGTGGTAGAAACCCACGGGCGAAAAGATACCGCCGCCATGCTGGAAGGGCTGGCTGTTCTGCCGTTAAAACGCCAGGCGTACCGTGGGCGGCATATCAGCGAGTTTGATCTCGATGCCGCCCTCGCCCGCCGCCCGGCGCTGATCTTAATGGACGAACTGGCGCACAGTAATGCGCCAGGTTCCCGTCATCCCAAACGCTGGCAGGATATCGAAGAACTGCTGGAAGCTGGCATTGATGTTTTCACTACCGTCAACGTTCAGCATCTGGAAAGTCTGAATGATGTGGTCAGCGGCGTCACCGGAATTCAGGTACGGGAAACCGTGCCCGATCCTTTTCGATGCCGCCGACGACGTGGTGCTGGTGGACTTGCCCCGGACGATCTGCGCCAGCGGCTGAAAGAAGGCAAAGTCTATATTGCCGGGCAGGCGGAGCGCGCCATTGAACATTTTTCCGCAAAGGTAATCTGATCGCCCTGCGCGAACTGGCACTGCGCCGTACTGCCGATCGCGTTGATGAGCAAATGCGCGCCTGGCGGGGCATCCTGGCGAAGAGAAAGTGGCACGCGCGACGCGATCCTTTTATGCATCGGCCATAACACCGGCAGCGAAAAACTGGTCCGCAGCGGCGCGGCTGGCGTCACGGCTGGGTAGCGTCTGGCACGCGGTGTATGTTGAAACCCCTGCCCTGCACCGCTTACCGGAAAAAACGTCGGGCAATTCTCAGCGCCTTACGTCTGGCGCAGGAACTGGGCGCGGGAGACGGCAACACTTTCTGATCCAGCGGAAGAGAAAGCGGTAGTGCGTTATGCCCGTGAACATAATCTCGGCAAGATTATTCTCGGTCGCCCGGCCTCGCGCCGCTGGTGGCGTCGGGAAACGTTTGCTGACCGACTGGCGCGCATCGCCCCGATCTCGATCAGGTGCTGGTCGCGCTTGATGAACCACCCGCCCGCACGATTAACAACGCGCCGGATAACCGCTCTTTTAAAGACAAGTGGCGTGTACAAATTCAGGGATGCGTGGTTGCCGCCGCGTTATGCGCCGTTATCACCTTAATTGCCATGCAGTGGCTGATGGCGTTGATGCCGCCAACCTGGTGATGCTGTATCTGCTTGGCGTGGTGGTGGTGGCGCTATTTTATGGACGCTGGCCTTCAGTGGTTGCCACCGTCATTAATGTAGTGAGTTTCGATCTCTTTTTATCGCCCCACGCGGCACGCTCGCCGTCTCTGATGTGCAATATCTGCTGACCTTCGCGGTGATGTTAACCGTCGGGCTGGTGATCGGGAACCTTACTGCTGGCGTGCGTTATCAGGCGCGGGTAGCCCGTTACCGCGAGCAACGCACACGGCACTTATATGAAATGTCGAAAGCTCTGGCGGTGGGCCGCAGTCCGCAGGATATCGCTGCCACCAGCGAACAATTTATTGCCTCCACGTTTCATGCCCGCAGTCAGGTGTTGTTGCCCGATGACAACGGTAAATTGCAGCCGTTAACACATCCGGGAATGACGCCGTGGGACGATGCCATCGCGCAGTGGAGTTTTGATAAAGGCCTGCCTGCGGGCGCGGGCACCGACACGTTACCCGGTGTACCGTACCAGATTTTGCCGCTAAAAGCGGCGAAAACCTACGGGCTGGTGGTGGTGGAGCCGGGGATCTGCGCCAGTTGATGATCCCGGAACAGCAGCGCCTGCTGGAACGTTACGCTGTTAGTCGCCAATGCATGGAGCGGCTGACGCTAACCGCCAGCGAAGAACAGGCGCGGATGGCAAGCGAACGTGAACAGATCCGCAACGCCTGCTGGCGGCGCTTTCGCATGATTTACGCACGCCGCTTACGGTGCTGTTTGGTCAGGCAGAAATCTTAACGCTCGATCTGGCAAAGCGAGGATCACCCCACGCCCGCCAGGCCAGCGAGATCCGTCAGCATGTAGCGAACACTACCCGACTGGTGAATAATCTACTGGATATGGCGCGAATTCAGTCCGGCGGCTTTAATTTGGAAAAGTGGTTAACGCTGGAAGAAGTAGTCGGCAGCGCTGCAAATGCTGGAACCGGGTTTATCGTCGCCCATCAATCTTTCTCTGCCAGAACCGCTGACCTTAATCCACGTTGACGGGCCACTCTTTGAACGGGTGCTGATTAATCTGCTGGAGAACGCGGTGAAATATGCGGGTGCGCAGGCCGAAATTGGTATCGATGCCCACGTTGAGGGCGAAAATCTACAACTGGATGTCTGGGATAACGGCCCCGGTCTTCCGCCAGGCCAGGAGCAGACGATATTTGATAAGTTTGCTCGCGGGAATAAAGAGTCGGCAGTACCGGGGTAGGGCTTGGACTGGCAATTTGTCGGGCGATAGTGGATGTACACGGGGCACTATTACCGCGTTCAACCGACCGGAAGGTGGTGCCTGTTTTTCGTGTTACACTTCCCCAGCAAACTGCCCCTGAACTGAAGAATTTCATGAGGATATGTGACAAACGTTCTGATTGTTGAAGATGAACAGGCTATTCGTCGCTTTCTGCGCACGGCGCTGGAGGGCGACGGGATGCGCGTCTTTGAGGCCGAAACGCTGCAACGCGGCTTGCTGGAAGCAGCAACCCGTAAGCCAGATTTGATTATTCTCGATCTCGGCGGCCTGCCCGATGGTGATGGGATTGAGTTTATCCGCGACCTGCGCCAGTGGAGCGCGGTGCCGGTGTTGTGCTTTCCGCACGCAGCGAAGAGCGACAAAATCGCCGCGCTGGATGCCGGAGCGGATGATTATCTGAGTAAGCCGTTTGGCATGGCGAATTGGGCCCGTCTGCGCGTCGCATTACACCGCCACTCTGCCACCACCGCGCCCGATCCGCTGGTAAAATTTTCCGATGTTACCGTCGATTTAGCCGCCCGCGTGATTCACCGGGGTGAGGAAGAGGTGCATCTCACACCAATTGAGTTCCGCCTGCTGGCGGTGCTGCTAACAATGCCGGAAGAATTACTCACCCAGCGCCAGCTCCTTAACCAGGTGTGGGGGCCAAACGCGGTCGAACACAGTCACTATTTGCGTATTTATATGGGACATCTGCGACAAAAACTGGAACAGGATCCCGCCCGCCCAGCCATTTCATTACTGGAAACCGGTATTGAAAACATCGGTTTATGCTTTTGAATATTAATTTTAATACAGCTGCCTTTTATTAATTAAAGCCGTAATAATAAAGCGGCTTTTATCTTCACAAAACAACACACAAAATAACAATTCAATATTTTATATTACTGAGTAAAAAGCTCATCATTAAATAAATTAAGATTGATCATTTTTATTGATCACCTTCACGGTTCAACCGCTATTTCTGGATAGAATATCTTCACCTTCATGGACAAACACCCAAGCAGACGCCGAAGATAGGCGACAGGCAAGTAGCAATACGTAACCGCC
+>480b21b8-8901-4db2-939d-ed2eb1fb0a64 id=79 clr=0,5389
+TTGTTGCTTCGTTCAGTTACGTATTGCTCTTGCCTGTCGCTCTATCTTCGCGTCTGCGGGTGTTGTATGACCCAGCTCGCCCACTCAATAACGTGATGCCTGTCGCTCTATCCTTCGGCGCGGATGGCGGGCAAAATCACCGCATCCCCGCTGGCGGCAGAAAGAAAGTTTTGCACCGTTAAGCCCGCCATCTGGCTGAAATAGCTCAACGTGGTTTCACCGCTATAAGATTGCCAGTTGGTATTGGTGACAAAGCTGACGGCGGTATTCAGCGCCAGATCCCACGACAGCCCTGGCAACTGCTGTGGATTAAGCGGCAGATAGTGCTGACCGAGCAACATAAAAACAGCACCGCCAGCCCCAGCATGTTCAGGCCGAGAATGGCACAAAGATATTGCTTCCAGTTCATCTCACGGTCAGAGACGCCAAGTGCGCGAAAAGTACGCGCTCAACGCCCGTTGTACCGGGAAGAGGAATGTCATTAATCAGCCGCGCCAGCCCGCTGCCTAAAGGACGCGCCAGCACCATTAACACCAGTAAAAACGTGGCGATCAGTAGAACCCTTGCGCAGCCATCAGAACGCCTCCGCATTGATCAGGGCATAAACCAGATAACCCAGTAATAAAACACCAGCAATACGCCGGTTATCACGCCTGCACTCACAGTGCACCTCCAGTGGCCTAAAAGTGATACCGGAAGGGTAGAATTCTGGCTGCAAAGATTTCGCAAAATCTGCGGGCGGGGTGTAAAAAGTATAAAAAAAGCCATGATTTAACTAATGTTTAGTATTAATTTAACTTTTGTAACTTAATTACAGGATGAATGTAAATAAACCATCAATAAGCAAAAATAAGTGGTCGGATGAGTAGTAAAATTACACAAAAGGCGGTACTATTTTCATCAGATAAACAAATTCATTTTTCCGGTGCCATTCACCGGGTAGATACAAAAGGGAGAAAAGTATGGAACTCTACAGAGAATATCCTGCATGGCTTATCTTTTTACGCCGTACTTATGCGGTTGCAGCGGGCGTTCTGGCGCTGCCTTTCATGCTTTCTGGAAAGACCGCGCCCGCTTTTACAGCTACCTGCATCGCGTCTGGTCGAAAACCAGCGATAAACCGGTGTGGATGGATCAGGCCGAAAAGGCAACTGGTGATTTTATTGATTGCTGAGTTTTGAATACATTGAAAACCGCCAGCGGAAACGCTGGCGGTTTTTATATCAGGAAGATGTTCAGAGGAATATTTAGACATCGTTATACCAATCGAAACATATATTCATGAAATATATATAAATATTTTCCTAATTGTTCTTATCTGACAGATATCTCACTTAAGGCTTTCTTATAAATCTGTAGGGTTTCGCCTGTCAGCAGACAAATAACCCGATAAAACAAGGATGAGCAGATGAGCGGAAAACCGGCGGCGCGTCAGGGCGACATGACGCAGTATGGCGGTAGCATTGTCCAGGGTTCAGCCGGGGTACGCATCGGTGCCCCACCGGCGTGGCCTGTTCGGTGTGCCCCGGCGGTGACGTCCGGCCATCCGGTCAATCCGCTGCTCGGTGCAAAGGTCCTTCCCGGTGAAACCGACATCGCCCTGCCCGGCCCGCTGCCGTTCATTCTCTCCGCACCTACAGCAGTTACCGGACAAAACGCCCGCGCCGGTGGGGCCTCGGCCCCGGCTGGAAAATGCCTGCGGATATCCGCTTACAGCTGCGCGATAACACACTGATACTCAGTGATAACGGCGGCAGAAGCCTGTATTTTGAGCACCTGTTTCCCGGTGAGGACGGTTACAGCCGCAGCGAGTCACTGTGGCTGGTGCGCGGCGGCGTGGCGAAACTGGATGAAGGTCACCGGCTGGCCGCACTCTGGCAGGCGCTGCCGGAAGAACTCCGCTTAAGTCCGCATCGTTATCTGGCGACAAACAGTCCGCAGGGGCCGTGGTGGCTGCTCGGCTGGTGTGAGCGGGTGCCGGAAGCGGATGAGGTGCTGCCTGCGCCGCTGCCGCCGTACCGGGTACTGACCGGGCTGGTGGACCGCTTCGGGCGCACACAGACGTTCCACCGCGAAGCCGCCGGTGAATTCAGCGGCGAAATCACCGGCGTGACGGATGGTGCCGGGCGTCACTTCCGGCTGGTACTGACCACGCAGGCGCAGCGGGCAGAAGAAGCCCGGCAGCAGGCCATTTCCGGCGGGACGGAACCGTCCGCTTTTCTGATACCCTGCCGGGTTACACCGAATATGGCCGGGACAACGGCATCCGTCTGTCTGCCGTGTGGCTGACGCACGACCCGGAATACCCGGAGAATTTACCTGCCGCGCCGCTGGTGCGCTATGGCTGGACGCCCGCGGCGAACTGGCGGCGGTGTATGACCGCAGCAATACACAGGTGCGCAGCTTTACTTACGATGATAAATACCGGGGCCGGATGGTGGCGCACCGTCACACGGGCCGACCGGAAATCTGTTACCGTTACGACAGCGACGGGCGGGTGACAGAACAGCTAAACCCGGCAGGCTTAAGTTACGTATCAGTATGAGAAGGACCGCATCACCATCACCGACAGCCTGAACCGCCGTGAAGTCCTGCACACGCAGGGTGAAGGCGGGCTGAAGCGGGTGGTGAAAAAGAACACGCGGACGGCAGCGTCACGCAGAGTCAGTTTGACGCGGTGGGCAGGCTCAGGGCACAGACGGATGCCGCAGGCAGGACAACAGAATACAGTCCGGATGTGGTGACGGGCCTCATCACGCGCATCACCACGCCGGATGGCAGGGCATCGGCGTTTTACTATAACCACCACAGCCAGTTAACGTCAGCCACCGGGCCTGACGGGCTGGAAATACGCCGGGAATATGATGAATGGGGCCGTCTGATTCAGGAAACTGCCCCTGACGGCGATATCACCCGCTACCGTTATGATAATCCACACAGTGACTTACCCTGCGCAACGGAAGATGCCACCGGCAGCCGGAAAACCATGACGTGGAGCCGTTACGGTCAGTTGCTGAGCTTCACTGACTGTTCCGGTTATGTAACCCGCTATGACCATGACCGTTTTGGTCAGGTGACGGCGGTGCACCGCGAGGAAGGGCTGAGTCAGTACCGCGCATACGACAGCCGTGGACAGTTAATTGCCGTGAAAGACACGCAGGGCCATGAAACGCGGTATGAATACAACGCCGCCGGTGACCTGACCACCGTCATTGCCCCGGACGGCAGCAGAAACGGGACACAGTACGATGCGTGGGGAAAAGCCATCTGTACCACGCAGGGCGGTCTGACGCGCAGTATGGAATACGATGCTGCCGGACGGGTCATCCGCCTGACCAGTGAAAACGCAGCCACACCACCTTCCGTTACGATGTACTCGACCGGCTGATACAGGAAACCGGCTTTGACGGCCGCACACAGCGTTATCACCACGACCTGACCGGCAAACTTATCCGCAGCGAGGATGAGGGGCTGGTCACCCACTGGCACTATGACGAAGCAGACCGCCTCACGCACCGCACCGTGAATGGCGAAACCGCAGAGCGGTGGCAGTATGACGAACGCGGCTGGCTGACAGACATCAGCCATATCAGCGAAGGGCACCGGGTGACGGTGCACTATGGTTATGACAGTAAAGGCCGCCTCGCCAGTGAACACCTGACGGTGCATCATCCGCAGACGAATGAACTGCTCTGGCAGCATGAGACCAGACATGCGTACAACGCACAGGGACTGGCGAACCGCTGTATACCGGACAGCCTGCCCGCCGTGGAATGGCTGACCTACGGCAGCGGCTGGCTGTCAGGCATGAAACTCGGCGACACACCGCTGGTGGAGTACACCCGCGACCGCCTGCACGGAAACGCTGCGCAGCTTCGGCCGTTATGAACTCACCACCGCTTATACCCTGCCGGGCAGTTACAGAGCCAGCACCTGAACAGCCTGCTGTCTGACCGCGATTACACCTGGAACGACAACGGCGAACTCATCCGCATCAGCAGCCCGCGCCAGACCCGGAGTTACAGCTACAGCACCACCGGCAGGCTGACCGGCGTTCACACCACCGCAGCGAATCTGGATATCCGCATCCCGTATACCACAGACCCGGCAGGTAACCGCCTGCCCGACCCGGAGCTGCACCCGGACAGCGCCCTCAGCATGTGGCCGGATAACCGTATCGCCCGTGACGCGCACTATCTTTACCGGTATGACCGTCACGGCAGGCTGACAGAAAACCGACCTCATCCCGGAAGGGTTATCCGCACGGATGATGAGCGCACCCACCGGTACCATTACGACAGTCAGCACCGGCTGGTGCACTACGCGGACACAATATGCAGAGCCGCTGGTCGAAAGTCGCTATCTTTACGACCCGCTGGGCCGCAGGGTGGCAAAACGGGTATGGCGGCGTGAACGGGACCTGACGGGCTGGATGTCGCTGTCACGGAAACCGCAAGTGACCTGGTACGGCTGGGACGGCGACCGCCTGACCACGATACAGAACGACAGAACCCGCATCCAGACGATTTATCAGCCGGGGAGCTTCACGCCACTCATCAGGGTTGAAACCGCCACCGGTGAGCTGGCGAAAACGCAGCGCCGCAGCCTGGCGGATACCCTTCAGCAGTCCGGTGGCGAAGACGGTGGCAGTGTGTGTCCCGCCGGTGCTGGTGCAGATGCTCGACCGGCTGGAAAGTGAAATCCTGGCTGACCGGGTGAGTGAGGAAAGCCGCCGCTGGCTGGCATCGTGCGGCCTGACGGTGGCGCAGATGCAAAGCCAGATGGACCCGGTATACACGCCGGCGCGAAAAATTCACCTGTACCACTGCGACCATCGCGGCCTGCCGCTGGCCCTTATCAGCACGGAAGGGACAACAGCGTGGTACGCAGAATACGATGAATGGGGTAACCTGCTGAATGAAGAGAACCCGCATCAGCTGCAGCAGCTTATCATCGCCTGCCGGGGCAGCAGTATGATGAGGAGTCCGGCCTGTATTACAACCGCCACCGCTATTATGACCCGCTGCAGGGCGATATATCACTCAGGATCCGATTGGGCTGAAAGGGGATGGAATTTTATCAGTATCCGTTGAATCCGATCTCAAATATAGATCCATTAGGATTAGAAACACTAAAATGCATTAAGCCACTGCATTCAATGGGCGGAACTGGTGAAAAAGCGGTCCAGATATATGGGGAATCCGTTCTATCATCAATATCTTTGTGTCCCAGATGGTAAAGGGACTATACTTGTGGTGGCCAAGACCAACGGGGAGAATCAAAGGAGATGGTCTATGGGGGCCAGGTAAAGCAAGTAATGATACAAAAGAAGCTGCTGGCCGTTGTGACCTCGTTGAAACCGATAATAGTTGTAGGTTTAAATTTAAAA
+>44b26523-eaf0-4f28-87ad-4cca044fabc8 id=80 clr=0,6013
+ATCTTGTTGCCTCGCATGCATGCTTTCGTTCCGGTTACGTATTACTGCTCTGCCTGTCGCTCTATCTTCGGCGTCTGCTTGCGGTGTTTAACCTCGACATTTCATATAAGTGCCGTGTGCGTTGCTCGCGGTAACGGGCTACCCGCGCCTGATAACGCACGCCAGCAGTAAGGTTCCCGATCACCAGCCCGACGGTTAACATCACCGCGAAGGTCAGCAGATATTGCACATCAGAGACGGCGAGCGTGCCGCGTGGGGCGATAAAAAGAGATCGAAACTCACTACATTAATGACGGTGGCAACCACTGAAGGCCAGCGTCCATAAAATAGCGCCACCACCACCACGCCAAGCAGATACAGCATCACCAGGTTGGCGGCATCAAACGCCATCAGCCACTGCATGGCAATTAAGGTGATAACGGCGCATAACGCGGCGGCAACCACGCATCCCTGAATTTGTACACGCCACTTGTCTTTAAAAGAGCGGTTATCCGGCGCGTTGTTAATCGTGCGGGCGGGTGGTTCATCAAGCGCGACCAGCACCTGATCGAGATCGGGGCGATGCGCGCCAGTCGGTCAGCAAACGTTTCCCGACGCCACCAGCGGCGCGAGGCCGGGCGACCGAGAATAATCTTGCCGAGATTATGTTCACGGGCATAACGCACTACCGCTTTCTCTTCCGCTGGATCAGAAAGTGTTGCCGTCTCGCGCCCAGTTCCTGCGCCAGACGTAAGGCGCTGAGAATTGCCCGACGTTTTTTCCGGTAAGCGGTGCAGGGCAGGGGTTTCAACATACACCGCGTGCCAGACGCTACCCAGCCGTGACGCCAGCCGCGCCGCTGCGCGGACCAGTTTTCGCTGCCGGTGTTATGGCCGATGCATAAAAGGATCGCGTCGCGCGTGTGCCACACTTTCTCTTCGCCAGGATGCCCCGCCAGGCGCGCATTTGCTCATCAACGCGATCGGCAGTACGGCGCAGTGCCAGTTCGCGCAGGGCGATCAGATTACCTTTGCGGAAAAATGTTCAATGGCGCGCTCCGCCTGCCCGGCAATATAGACTTTGCCTTCTTTCAGCCGCTGGCGCAGATCGTCCGGGGCAAGTCCACCAGCACCACGTCGTCGGCGGCATCGAAAAGGATCGGGCACGGTTTCCCGTACCTGAATTCCGGTGACGCCGCTGACCACATCATTCAGACTTTCCAGATGCTGAACGTTGACGGTAGTGAAAACATCAATGCCAGCTTCCAGCAGTTCTTCGATATCCTGCCAGCGTTTGGGATGACGGGAACCTGGCGCATTACTGTGCGCCAGTTCGTCCATTAAGATCAGCGCCGGGCGGCGGGCGAGGGCGGCATCGAGATCAAACTCGCTGATATGCCGCCCACGGTACGCCTGGCGTTTTAACGGCAGAACAGCCAGCCCTTCCAGCATGGCGGCGGTATCTTTTCGCCCGTGGGTTTCTACCACGCCAACCACAATATCCAGCCCTTGCGCCCGCAGTCGCTGGGCTTCTGCCAGCATCGCCCAGGTCTTCCCGACGCCTGCACAGGCACCGAAGAACTTTCAGCTTCCCCGATGCGGCGCGGCAGTTTGTTCCAGCAGACGATCGGGGTCGGGACGTAAGGGTTCGTTATTCATCAAGTTTATCCAGCGCCAGATTGAGTTCAACAATGTTGACAACCGGCTGGCCGATATATTTCACCAGCGGTTGTTGGCTGTATTTTGCGATCAGTTGCGTGAGCTGTTCAACGCTGAGATTACGCGCTTTCGCCACGCGTGGGTTTTGAGGCCGCCGCTTGCGGGTGATATTATTGTCCAGCCCGCTTGCCGATGCCGTCACCAGTTCAACCGGAACGCTCGCGCTGGCATCCGGGTTAGCGGCCCGTAATGCAGCAACGCGTGCGGCTATTAGTTTATCCAGCTCAGGGTTACTGACCGCCAGATTGCTCCCGCCAGAAGCCTGTGGATTATAGGGCATTTCTGCCGTTGCCGACGGGCGACCATGAAAATAGCCGTTGCCGGTAAAATTCTGCCCGATTAATGCCGAACCGCGCACCGTATCACCTTCACGAATCAACGAACCATTGGCCTGCCAGGAAACCACCATTGCCCCAGTACGGTGGTCAGCGGCGGGTAAACGCCGCCAGTAATCAATAACAGAAAGATAAATGTTGATAATGCCGGACGTAATCCACTCATGGTAAACCTCACAGACCGCAAACGGTCAGCAGTAAATCAATGACTTTGATACCGATAAACGGCACCAGCAGCCCACCCAGACCGTAAATCCATAAGTTACGGCGCAACATGGCAGAAGCGGTAAGCGGTTTATAACTCACGCCTTTTAACGCCAGGGGAATCAAAGACGATAATCAAGGCGTTGAAAATCACCGCACTGAGGATTGCGGAGTCGGGCGAATGCAGGCACATGATGTTCAGCGCATTTAACTGCGGATACGTTGCCGCGAATGCCGCCGGAATAATGGCGAAGTATTTCGCCACATCGTTGGCAATGCTGAAGGTGGTCAGCGAGCCACGGGTCATCAGCATCTGTTTGCCAATGTGCACCACCTCGATCAACTTGGTCGGGTTAGAGTCGAGATCGACCATATTGCCCGCCTCTTTCGCCGCCTGGGTGCCGGAGTTCATCGCCACCGCGACATCTGCCTGCGCCAGCGCCGGAGCATCGTTGGTGCCGTCGCCGGTCATCGCTACCAAACGACCTTCCGCCTGATACTGACGGATCAATGCCAGCTTGGCCTCCGGTGTCGCTTCGGCGAGAAAATCATCGACACCCGCTTCCGCAGCAATCGCGGCGGCAGTCAGACGGTTATCGCCGGTAATCATCACCGTTTTAATGCCCATTTTGCGCAGCTGGGCGAAGCGCTCTTTAATACCGCCTTTGACGATATCTTTCAGCGCAATAACGCCCAGCACACGAGAACCTTCCACCACCACCAGCGGCGTGGCTCCCTGACGCGCAACCTGATCGACTTTTTGATCAACATCGGTAGGGAAGTGACCACCGTTAGCCTCAACATGGCGACGAATGGCATCGACAGAACCTTTACGGATCATGCGGTTGTCGATGTTGATCCCGCTCATCCGGCTTTGCGCAGTAAACGGTACAAAGGTGGCATGGAGCGACTGCACATCGCGCTCGCGCAGGTTAAAACGCTGCTTGGCGAGGATCACAATACTGCGGCCTTCCGGCGTTTCATCAGCCAGCGAAGCCAGTTGTGCGGCGTCAGCCAGCGTTTTCATCCACGCCCTGCGCGGGGATCCGACGCCTGACGGTTACCGAGTGTGATGGTGCCGGTTTTATCCAGTAGCAGAACGTCAACGTCACCTGCCGCTTCAACTGCACGTCCGCTGGTGGCAATCACATTCGCGCCTAGCATCCGGCTCATCCCGGCGACGCCGATCGCTGACAACAGGCCGCCAATAGTGGTTGGGATCAGACAGACCAGCAGCGCCACCAGTACCGTTACGCTGACTGCATTACCGCCCCACGCGGAAAACGGCCACAGCGTGGCGGTTGCCAGTAAAAGACGATAGTCAGGGCAATCAGCAGAATGGTCAGGGCAATTTCGTTCGGCGTTTTGCGTCGCTGTGCGCCTTCCACCATCGCGATCATCCGATCCAGAAATGTCTCGCCGGGGTTAACGCTACACTCAATCACCAGCCAGTCAGAAAGAATACGCGTGCCGCCGGTGACGGAGGCAAAATCGCCGCCGGATTCACGGATCACCGGTGCCGATTCCCCGGTGATGGCGCTTTCATCGACCGATGCCCCTTCAATAACTTCACCATCGCAGGGATAATATCGCCAGCTTCTACCAGTACGATATCGCCTTTACGAAGTTGGTCGGCAGGAACTTTGTCCGCCGCAGCGCCATATTTCGGCTCACGCAGCTTGCGGGCAAAGGCAGTTTTTCACCTTTCAGACTGTTGGCCTGCGCTTTACTGCGGCCTTCTGCCAGCGCCTCGGCGAAATTAGCGAACAGTACGGTGATCCACAGCCAACCGCTAATGGCCGCGCTAAACAGCGCATTGCCGGGCATCGCACCGCTTGCCATCGCGATGCTAATACAGGTGGTCAGCAGACTGCCGATCCAGACGATAAACATCACCGGATTGCGCCATTGCGCCTGCGGGTTTAATTTTTCACCGCTTCTTTCAGCGCCTGAACGACAAGTGTTGGTTCGAATAGCGCCAGTTGTTTACGACTCATCAGTGCTCACTCAATATCATCAGGAGATATTCCGCCACCGGACCAAGCGCCAGGGCAGGGATAAAGGTCAGTGCGCCAACCAGCAACACGGTGCCGATTAACAGGCCAACAAACAGCGGGCCGTGCGTTGGCAGCGTGCCGGAGCTGGCGGCTTGGCTCTTTTACTCACCAGCGAACCGGCAATTGCCATCACCGGGATAATCACCCCGAAGCGACCGACAAACATGCAGAACGCCAGTAAACAGTTCCAGAACGGAGAGTTGGCGCTTAATCCGGCAAAGGCGCTGCCGTTGTTGTTAGCGGCGGATGACACGGCGTACAGCACTTCGCTAAAACCATGCGGGCCAGGGTTGAGCATGGCGCTACGTCCGGCGTCGGTCATCATCGCCAACGCCGCGCCCATCAGCACCAGCGTCGGGGTAACCAGAATTGCCAGTGCAGTCAGTTTCATCTCGCGTACGTCGATTTTTACCCAGATATTCCGGTGTACGACCAATCATCAGCCCGGCAATAAACACCGCCAGCAGGACAAACAGCATCATGCCGTAAAGACCAGAACCGACACCGCCGAACACCACTTCACCAATTTGCATCAGCCACATCGGCACCATGCCACCGAGCGGTAAACGAATCATGCATCGCAATCACCGCGCCACAGGAAGCCGCCGTCGTCACGACCGCAAACAGGCTACTGACCAGCACGCCGAAACGGCTCTCTTTACCTTCCATATTGATGCTGCTGTCCGTGCCCAGTGCCAGCAGATGAGGATTACCCTGAACTTCTGCCCACATCACCACGCCTACGCAGATGACAAAAATCACTGACATCGCCCACAGCAACATGCGCCCCTGGCGGCGATCGCCCATCACTTCACCAAAGGCAAAGCACAGCGCCGTTGGGATCAAGAAGATCGCCAGCATCTGCACGAAGTTGGTCAGTGCGGTTGGGTTTTCAAACGGATGCGACGAGTTGGCATTAAAGAAGCCACCGCCGTTAGTACCGAGCATCTTGATCGCTTCCTGAGAAGCTACAGGCCCCATGGGTAACAGCTGTTGCGCTCCTTCAACGGTATTCACAGCCTGATAAGGCAGAAAGTTTTGCAGCGCACCTTGTTGAATAAAAACAGTGCAATCAACAACGCCACAGGGACTAGCACCCATAACGTGATGCGTAGCAGATCGACCCAGGCATTCCAGCGTGCTCATGCTCTGGCGGGTAAACGCACGGATGAGGGCAAAATCACCGCAATCCCGCTGGCGGCAGAAGAAAGTTTTGCACCGTTAAGCCCGCCATCTGGCTGAAATAGCTCAACGTGGTTTCACCGCTATAAGATTGCCAGTTGGTATTGGTGACAAAGCTGACGGCGGTATTCAGCGCCAGATCCCACGACAGCCCTGGCAACTGCTGTGGATTAAGCGGCAGATAGTGCTGACCGAGCAACATAAAAACAGCACCGCCAGCCCCAGCATGTTCAGGCCGAGAATGGCACAAAGATATTGCTTCCAGTTCATCTCACGGTCAGAGACGCCAAGTGCGCGAAAAGTACGCGCTCAACGCCCGTTGTACCGGGAAGAGGAATGTCATTAATCAGCCGCGCCAGCCCGCTGCCTAAAGGACGCGCCAGCACCATTAACACCAGTAAAACGTGGCGATCAGTAAGAACCCTTGCGCAGCCATCAGAACGCCTCCGCATTGATCAGGGCATAAACCAGATAACCCAAATTAAACGCAAGCAGACGCCGAAGATAAGAGGCGACGGGCAAGTGGCAATACGTAATT
+>380cc868-0f9e-478b-b1df-70cbe6602339 id=81 clr=0,7599
+ACAGACGGATGCCGTTGTCCCGGCCATATTCGGTGTAACCCGGCAGGGTATCAGGAAAGCGGACGGTTCCGTCCCGCCGGAAATGGCCTGCTGCCGGGCTTCTTCTGCCCGCTGCGCCTGCGTGGTCAGTACCAGCCGGAAGTGACGCCCGGCACCATCCGTCACGCCGGTGATTTCGCCGCTGAATTCACCGGCGGCGCGCGGTGGAACGTCTGTGTGCGCCCGAAGCGGTCCACCAGCCCGGTCAGTACCCGGTACGGCGGCAGCGGCGCAGGCAGCACCTCATCCGCTTCCGGCACCCGCTCACACCAGCCGAGCAGCCACCACGGCCCCTGCGGACTGTTTGTCGCCAGATAACGATGCGGACTTAAGCGGAGTTCTTCCGGCAGCGCCTGCCAGAGTGCGGCCAGCCGGTGACCTTCATCCAGTTTCGCCACGCCGCCGCGCAGCCACAGTGACTCGCTGCGGCTGTAACCGTCCTCACCGGGAAACAGGTGCTCAAATACAGGCTTCTGCCGCCGTTATCACTGAGTATCAGTGTGTTATCGCGCAGCTGTAAGCGGATATCCGCAGGCATTTTCCAGCCGGGGCCGAGGCTCCCCACCGGCGCGGGCGTTTTGTCCGGTAACTGCTGTAGGTGCGGGAGAGAATGAACGGCAGCGGGCCGGGCAGGGCGATGTCGGTTTCACCGGGAAGGACCTTTGCACCGAGCAGCGGATTGACCGGATGGCCGGACGTCACCCGCCGGGGCACACCGAACAGGCCACGCCGGTGGGGGCACCGATGCGTACCCCGGCTGAACCCTGGACAATGCTACCGCCATACTGCGTCATGTCGCCCTGACGCGCCGCCGGTTTTCCGCTCATCTGCTCATCCTTGTTTTATCGGGTTATTTGTCTGCTGACAGGCGAAACCCTACAGATTTATAAGAAAGCCTTAAGTGAGATATCTGTCAGATAAGAACAATTAGGAAAATATTTATATATATTTCATGAATATATGTTTCGATTGGTATAACGATGTCTAAATATTCCTCTGAACATCTTCCTGATACAAAAACCGCCAGCGTTTCCGCTGGCGGTTTTCAATATTCAAACTCAGCAATCAATAAAATCACCAGTTGCCTTTTCGGCCTGATCCATCCACACCGGTTTATCGCTGGTTTTCGACCAGACGCGATGCAGGTAGCTGTAAAAGCGGGCGCGGTCTTTCCAGAAAAGCATGAAAGGCAGCGCCAGAACGCCCGCTGCAACCGCATAAGTACGGCGTAAAAGATAAGCCATGCAGGATATTCTCTGTAGAGTTCCATACTTTTCTCCCTTTTGTATCTACCCGGTGAATGGCACCGGAAAAATGAATTTGTTTATCTGATGAAAATAGTACCGCCTTTTGTGTAATTTTACTACTCATCCGACCACTTATTTTTGCTTATTGATGGTTTATTTACATTCATCCTGTAATTAAGTTACACAAAGTTAAATTAATACTAAACATTAGTTAAATCATGGCTTTTGCCATTTTTATACTTTTTACACCCCGCCCGCAGATTTTGCGAAATCTTTGCAGCCAGAATTCTACCCTTCCGGTATCACTTTTAGGCCACTGGAGGTGCACTGTGAGTGCAGGCGTGATAACCGGCGTATTGCTGGTGTTTTATTACTGGGTTATCTGGTTTATGCCCTGATCAATGCGGAGGCGTTCTGATGGCTGCGCAAGGGTTCTTACTGATCGCCACGTTTTTACTGGTGTTAATGGTGCTGGCGCGTCCTTTAGGCAGCGGGCTGGCGCGGCTGATTAATGACATTCCTCTTCCCGGTACAACGGGCGTTGAGCGCGTACTTTTTCGCGCACTTGGCGTCTCTGACCGTGAGATGAACTGGAAGCAATATCTTTGTGCCATTCTCGGCCTGAACATGCTGGGGCTGGCGGTGCTGTTTTATGTTGCTCGGTCAGCACTATCTGCCGCTTAATCCACAGCAGTTGCCAGGGCTGTCGTGGGATCTGGCGCTGAATACCGCCGTCAGCTTTGTCACCAATACCAACTGGCAATCTTATAGCGGTGAAACCACGTTGAGCTATTTCAGCCAGATGGCGGGCTTAACGGTGCAAAACTTTTCTGCCGCCAGCGGGATTGCGGTGATTTTGCCCTCATCCGTGCGTTTACCCGCCAGAGCATGAGCACGCTCGGGAATGCCTGGGTCGATCTGCTACGCATCACGTTATGGGTGCTAGTCCCTGTGGCGTTGTTGATTGCACTGTTTTTATTCAACAAGGTGCGCTGCAAAACTTTCTGCCTTATCAGGCTGTGAATACCGTTGAAGGAGCGCAACAGCTGTTACCCATGGGGCCTGTAGCTTCTCAGGAAGCGATCAAGATGCTCGGTACTAACGGCGGTGGCTTCTTTAATGCCAACTCGTCGCATCCGTTTGAAAACCCAACCGCACTGACCAACTTCGTGCAGATGCTGGCGATCTTCTTGATCCCAACGGCGCTGTGCTTTGCCTTTGGTGAAGTGATGGGCGATCGCCGCCAGGGGCGCATTGCTGTGGGCGATGTCAGTGATTTTGTCATCTGCGTAGGCGTGGTGATGTGGGCAGAAGTTCAGGGTAATCCTCATCTGCTGGCACTGGGCACGGACAGCAGCATCAATATGGAAGGTAAAGAGAGCCGTTTCGGCGTGCTGGTCAGTAGCCTGTTTGCGGTCGTGACGACGGCGGCTTCCTGTGGCGCGGTGATTGCGATGCATGATTCGTTTACCGCTCTCGGTGGCATGGTGCCGATGTGGCTGATGCAAATTGGTGAAGTGGTGTTCGGCGGTGTCGGTTCTGGTCTTTACGGCATGATGCTGTTTGTCCTGCTGGCGGTGTTTATTGCCGGGCTGATGATTGGTCGTACACCGGAATATCTGGGTAAAAAATCGACGTACGCGAGATGAAACTGACTGCACTGGCAATTCTGGTTACCCCGACGCTGGTGCTGATGGGCGCGGCGTTGGCGATGATGACCGACGCCGGACGTAGCGCCATGCTCAACCCTGGCCCGCATGGTTTTAGCGAAGTGCTGTACGCCGTGTCATCCGCCGCTAACAACAACGGCAGCGCCTTTGCCGGATTAAGCGCCAACTCTCCGTTCTGGAACTGTTTACTGGCGTTCTGCATGTTTGTCGGTCGCTTCGGGGTGATTATCCCGGTGATGGCAATTGCCGGTTCGCTGGTGAGTAAAAGAGCCAAGCCGCCAGCTCCGGCACGCTGCCAACGCACGGCCCGCTGTTTGTTGGCCTGTTAATCGGCACCGTGTTGCTGGTTGGCGCACTGACCTTTATCCCTGCCCTGGCGCTTGGTCCGGTGGCGGAATATCTCCTGATGATATTGAGTGAGCACTGAATATGAGTCGTAAACAACTGGCGCTATTCGAACCAACACTTGTCGTTCAGGCGCTGAAAGAAGCGGTGAAAAATTAAACCCGCAGGCGCAATGGCGCAATCCGGTGATGTTTATCGTCTGGATCGGCAGTCTGCTGACCACCTGTATTAGCATCGCGATGGCAAGCGGTGCGATGCCCGGCAATGCGCTGTTTAGCGCGGCCATTAGCGGTTGGCTGTGGATCACCGTACTGTTCGCTAATTTCGCCGAGGCGCTGGCAGAAGGCCGCAGTAAAGCGCAGGCCAACAGTCTGAAAGGGTGAAAAACTGCCTTTGCCCGCAAGCTGCGTGAGCCGAAATATGGCGCTGCGGCGGACAAAGTTCCTGCCGACCAACTTCGTAAAGGCGATATCGTACTGGTAGAAGCTGGCGATATTATCCCCTGCGATGGTGAAGTTATTGAAGGGGTGCATCGGTCGATGAAAGCGCCATCACCGGGGAATCGGCACCGGTGATCCGTGAATCCGGCGGCGATTTTGCCTCCGTCACCGGCGGCACGCGTATTCTTTCTGACTGGCTGGTGATTGAGTGTAGCGTTAACCCCGGCGAGACATTTCTGGATCGGATGATCGCGATGGTGGAAGGCGCACAGCGACGCAAAACGCCGAACGAAATTGCCCTGACCATTCTGCTGATTGCCCTGACTATCGTCTTTTACTGGCAACCGCCACGCTGTGGCCGTTTTCCGCGTGGGGCGGTAATGCAGTCAGCGTAACGGTACTGGTGGCGCTGCTGGTCTGTCTGATCCCAACCACTATTGGCGGCCTGTTGTCAGCGATCGGCGTCGCCGGGATGAGCCGGATGCTAGGCGCGAATGTGATTGCCACCAGCGGACGTGCAGTTGAAGCGGCAGGTGACGTTGACGTTCTGCTACTGGATAAAACCGGCACCATCACACTCGGTAACCGTCAGGCGTCGGAGTTTATCCCCGCGCAGGGCGTGGATGAAAACGCTGGCTGACGCCGCACAACTGGCTTCGCTGGCTGATGAAACGCCGGAAGGCCGCAGTATTGTGATCCTCGCCAAGCAGCGTTTTAACCTGCGCGAGCGCGATGTGCAGTCGCTCCATGCCACCTTTGTACCGTTTACTGCGCAAAGCCGGATGAGCGGGATCAACATCGACAACCGCATGATCCGTAAAGGTTCTGTCGATGCCATTCGTCGCCATGTTGAGGCTAACGGTGGTCACTTCCCTACCGATGTTGATCAAAAAGTCGATCAGGTTGCGCGTCAGGGAGCCACGCCGCTGGTGGTGGTGGAAGGTTCTCGTGTGCTGGGCGTTATTGCGCTGAAAGATATCGTCAAAGGCGGTATTAAAGAGCGCTTCGCCCAGCTGCGCAAAATGGGCATTAAAACGGTGATGATTACCGGCGATAACCGTCTGACTGCCGCCGCGATTGCTGCGGAAGCGGGTGTCGATGATTTTCTCGCCGAAGCGACACCGGAGGCCAAGCTGGCATTGATCCGTCAGTATCAGGCGGAAGGTCGTTTGGTAGCGATGACCGGCGACGGCACCAACGATGCTCGGCGCTGGCGCAGGCAGATGTCGCGGTGGCGATGAACTCCGGCACCCAGGCGGCGAAAGAGGCGGGCAATATGGTCGATCTCGACTCTAACCCGACCAAGTTGATCGAGGTGGTGCACATTGGCAAACAGATGCTGATGACCCGTGGCTCGCTGACCACCTTCAGCATTGCCAACGATGTGGCGAAATACTTCGCCATTATTCCGGCGGCATTCGCGGCAACGTATCCGCAGTTAAATGCGCTGAACATCATGTGCCTGCATTCGCCCGACTCCGCAATCCTCAGTGCGGTGATTTTCAACGCCTTGATTATCGTCTTTGATTCCCCTGGCGTTAAAGGCGTGAGTTATAAACCGCTTACCGCTTCTGCCATGTTGCGCCGTAACTATGGATTTACGGTCTGGGTGGGCTGCTGGTGCCGTTTATCGGTATCAAAGTCATTGATTTACTGCTGACCGTTTGCGGTCTGGTGTGAGGTTTACCATGAGTGGATTACGTCCGGCATTATCAACATTTATCTTTCTGTTATTGATTACTGGCGGCGTTTACCCGCTGCTGACCACCGTACTGGGGCAATGGTGGTTTCCTGGCAGGCCAATGGTTCGTTGATTCGTGAAGGTGATACGGTGCGCGGTTCGGCATTAATCGGGCAGAATTTTACCGGCAACGGCTATTTTCATGGTCGCCCGTCGGCAACGGCAGAAATGCCCTATAATCCACAGGCTTCTGGCGGGAGCAATCTGGCGGTCAGTAACCCTGAGCTGGATAAACTAATAGCCGCACGCGTTGCTGCATTACGGGCCGCTAACCCGGATGCCAGCGCGAGCGTTCCGGTTGAACTGGTGACGGCATCGGCAAGCGGGCTGGACAATAATATCACCCGCAAGCGGCGGCCTGGCAAATCCACGCGTGGCGAAAGCGCGTAATCTCAGCGTTGAACAGCTCACGCAACTGATCGCAAAATACAGCCAACAACCGCTGGTGAAATATATCGGCCAGCCGGTTGTCAACATTGTTGAACTCAATCTGGCGCTGGATAAACTTGATGAATAACGAACCCTTACGTCCCGACCCCGATCGTCTGCTGGAACAAACTGCCGCGCCGCATCGGGGAAGCTGAAAGTTTTCTTCGGTGCCTGTGCAGGCGTCGGGAAGACCTGGGCGATGCTGGCAGAAGCCCAGCGACTGCGGGCGCAAAGGCTGGATATTGTGGTTGGCGTGGTAGAAACCCACGGGCGAAAAGATACCGCCGCCATGCTGGAAGGGCTGGCTGTTCTGCCGTTAAAACGCCAGGCGTACCGTGGGCGGCATATCAGCGAGTTTGATCTCGATGCCGCCCTCGCCCGCCGCCCGGCGCTGATCTTAATGGACGAACTGGCGCACAGTAATGCGCCAGGTTCCCGTCATCCCAAACGCTGGCAGGATATCGAAGAACTGCTGGAAGCTGGCATTGATGTTTTCACTACCGTCAACGTTCAGCATCTGGAAAGTCTGAATGATGTGGTCAGCGGCGTCACCGGAATTCAGGTACGGGAAACCGTGCCCGATCCTTTTCGATGCCGCCGACGACGTGGTGCTGGTGGACTTGCCCCGGACGATCTGCGCCAGCGGCTGAAAGAAGGCAAAGTCTATATTGCCGGGCAGGCGGAGCGCGCCATTGAACATTTTTCCGCAAAGGTAATCTGATCGCCCTGCGCGAACTGGCACTGCGCCGTACTGCCGATCGCGTTGATGAGCAAATGCGCGCCTGGCGGGGCATCCTGGCGAAGAGAAAGTGTGGCACACGCGCGACGCGATCCTTTTATGCATCGGCCATAACACCGGCAGCGAAAACTGGTCCGCGCAGCGCGGCTGGCGTCACGGCTGGGTAGCGTCTGGCACGCGGTGTATGTTGAAACCCCTGCCCTGCACCGCTTACCGGAAAAAACGTCGGGCAATTCTCAGCGCCTTACGTCTGGCGCAGGAACTGGGCGCGGAGACGGCAACACTTTCTGATCCAGCGGAAGAGAAAGCGGTAGTGCGTTATGCCCGTGAACATAATCTCGGCAAGATTATTCTCGGTCGCCCGGCCTCGCGCCGCTGGTGGCGTCGGGAAACGTTTGCTGACCGACTGGCGCGCATCGCCCCGATCTCGATCAGGTGCTGGTCGCGCTTGATGAACCACCCGCCCGCACGATTAACAACGCGCCGGATAACCGCTCTTTAAAGACAAGTGGCGTGTACAAATTCAGGGATGCGTGGTTGCCGCCGCGTTATGCGCCGTTATCACCTTAATTGCCATGCAGTGGCTGATGGCGTTTGATGCCGCCAACCTGGTGATGCTGTATCTGCTTGGCGTGGTGGTGGTGGCGCTATTTTATGGACGCTGGCCTTCAGTGGTTGCCACCGTCATTAATGTAGTGAGTTTCGATCTCTTTTTATCGCCCCACGCGGCACGCTCGCCGTCTCTGATGTGCAATATCTGCTGACCTTCGCGGTGATGTTAACCGTCGGGCTGGTGGGGAACCTTACTGCTGGCGTGCGTTATCAGGCGCGGGTAGCCCGTTACCGCGAGCAACGCACGGCACTTATGAAATGTCGAAAGCTAGCGTTAAACACCCGAAGCAGACGCCGAAGATAGAGCGACAGGCAAAGATGCTGTACGTGAAAAGCC
+>60664444-cccc-41e7-b7a6-5c4c14343658 id=82 clr=0,5965
+TTGTGTTACTTCGTTCCAGTTACGTATTGCTTTTCTGTTGGTGCTGATATTGCGGCGTCTGGCCGGTGGGTGCGCTCATCATCCGTGCGGATAACCCCTTCCGGGATGAGGTCGGTTTTCTCTGTCAGCCTGCCGTGACGGTCATACCGGTAAAGATAGTGCGCGTCACGGGCGATACGGTTATCCGGCCACATGCTGAGGGCGCTGTCCGGGTGCAGCTCCGGGTCGGGCAGGCGGTTACCTGCCGGGTCTGTGGTATACGGGATGCGGATATCCAGATTCGCTGCGGTGGTGTGAACGCCGGTCAGCCTGCCGGTGGTGCTGTAGCTGTAACTCCGGGTCTGGCGCGGGCTGCTGATGCGGATGAGTTCGCCGTTGTCGTTCCAGGTGTAATCGCGGTCAGACAGCAGGCTGTTCAGGTGCTGGCTCTGTAACTGCCCGGCAGGGTATAAGCGGTGGTGAGTTCATAACGGCCGAAGCTGCGCAGCGTTTCCCGTGCAGGCGGTCGCGGGTGTACTCCACCAGCGGTGTGTCGCCGAGTTTCATGCCTGACAGCCAGCCGCTGCCGTAGGTCAGCCATTCCACGGCGGGCAGGCTGTCCGGTATACAGCGGTTCGCCAGTCCTGTGCGTTGTACGCATGTCTGGTCTCATGCTGCCAGAGCAGTTCATTCGTCTGCGGATGATGCACCGTCAGGTGTTCACTGGCGAGGCGGCCTTTACTGTCATAACCATAGTGCACCGTCACCCGGTGCCCTTCGCTGATATGGCTGATGTCTGTCAGCCAGCCGCGTTCGTCATACTGCCACCGCTCTGCGGTTTCGCCATTCACGGTGCGGTGCGTGAGGCGGTCTGCTTCGTCATAGTGCCAGTGGGTGACCAGCCCCTCATCCTCGCTGCGGATAAGTTTGCCGGTCAGGTCGTGGTGATAACGCTGTGTGCGGCCGTCAAAGCCGGTTTCCTGTATCAGCCGGTCGAGTACATCGTAACGGAAGGTGGTGTGGCTGCCGTTTTCACTGGTCAGGCGGATGACCCGTCCGGCAGCATCGTATTCCATACTGCGCGTCAGACCGCCCTGCGTGGTACAGATGGCTTTTCCCGCATCGTACTGTGTCCCGTTTCTGCTGCCGTCCGGGGCAATGACGGTGGTCAGGTCACCGGCGGCGTTGTATTCATACCGCGTTTCATGGCCCTGCGTGTCTTTCACGGCAATTAACTGTCCACGGCTGTCGTATGCGCGGTACTGACTCAGCCCTTCCTCGCGGTGCACCGCCGTCACCTGACCAAAACGGTCATGGTCATAGCGGGTTACATAACCGGAACAGTCAGTGAAGCTCAGCAACTGACCGTAACGGCTCCACGTCATGGTTTTCCGGCTGCCGGTGGCATCTTCCGTTGCGCAGGGTAAGTCACTGTGGATTATCATAACGGTAGCGGGTGATATCGCCGTCAGGGGCAGTTTCCTGAATCAGACGGCCCCATTCATCATATTCCGGCGTATTTCCAGCCCGTCAGGCCCGGTGGCTGACGTTAACTGGCTGTGGTGGTTATAGTAAAACGCCGATGCCCTGCCATCCGGCGTGGTGATGCGCGTGATGAGGCCCGTCACCACATCCGGACTGTATTCTGTTGTCCTGCCTGCGGCATCCGTCTGTGCCCTGAGCCTGCCCACCGCGTCAAACTGACTCTGCGTGACGCTGCCGTCCGCGTGTTCCTTTTCACCACCCGCTTCAGCCCGCCTTCACCCTGCGTGTGCAGGACTTCACGGCGGTTCAGGCTGTCGGTGATGGTGATGCGGTCCTTCTCATACTGATACGTAACTTAAGCCTGCCGGGTTTAGCTGTTCTGTCACCCGCCCGTCGCTGTCGTAACGGTAACAGATTTCCGGTCGGCCCGTGTGACGGTGCGCCACCATCCGGCCCCGGTATTTATCATCGTAAGTAAAGCTGCGCACCTGTATTGCTGCGGTCATACACCGCCGCCAGTTCGCCGCGGGGCGTCCAGCCATAGCGCACCAGCGGCGCGGCAGGTAAATTCTCCGGGTATTCCGGGTCGTGCGTCAGCCACGGCAGACAGACGGATGCCGTTGTCCCGGCCATATTCGGTGTAACCCGGCAGGGTATCAGGAAAGCGGACGGTTCCGTCCCGCCGGAAATGGCCTGCTGCCGGGCTTCTTCTGCCCGCTGCGCCTGCGTGGTCAGTACCAGCCGGAAGTGACGCCCGGCACCATCCGTCACGCCGGTGATTTCGCCGCTGAATTCACCGGCGGCTTCGCGGTGGAACGTCTGTGTGCGCCCGAAGCGGTCCACCAGCCCGGTCAGTACCCGGTACGGCGGCAGCGGCGCAGGCAGCACCTCATCCGCTTCCGGCACCCGCTCACACCAGCCGAGCAGCCACCACGGCCCCTGCGGACTGTTTGTCGCCAGATAACGATGCGGACTTAAGCGGAGTTCTTCCGGCAGCGCCTGCCAGAGTGCGGCCAGCCGGTGACCTTCATCCAGTTTCGCCACGCCGCCGCGCACCAGCCACAGTGACTCGCTGCGGCTGTAACCGTCCTCACCGGGAAACAGGTGCTCAAAATACAGGCTTCTGCCGCCGTTATCACTGAGTATCAGTGTGTTATCGCGCAGCTGTAAGCGGATATCCGCAGGCATTTTCCAGCCGGGGCCGAGGCTCCCCACCGGCGCGGGCGTTTTGTCCGGTAACTGCTGTAGGTGCGGGAGAGAATGAACGGCAGCGGGCCGGGCAGGGCGATGTCGGTTTCACCGGGAAGGACCTTTGCACCGAGCAGCGGATTGACCGGATGGCCGGACGTCACCCGCCGGGGCACACCGAACAGGCCACGCCGGTGGGGGCACCGATGCGTACCCCGGCTGAACCCTGGACAATGCTACCGCCATACTGCGTCATGTCGCCCTGACGCGCCGCCGGTTTTCCGCTCATCTGCTCATCCTTGTTTTATCGGGTTATTTGTCTGCTGACAGGCGAAACCCTACAGATTTATAAGAAAGCCTTAAGTGAGATATCTGTCAGATAAGAACAATTAGGAAAATATTTATATATATTTCATGAATATATGTTTCGATTGGTATAACGATGTCTAAATATTCCTCTGAACATCTTCCTGATACAAAAACCGCCAGCGTTTCCGCTGGCGGTTTTCAATGTATTCAAAACTCAGCAATCAATAAAATCACCAGTTGCCTTTTCGGCCTGATCCATCCACACCGGTTTATCGCTGGTTTTCGACCAGACGCGATGCAGGTAGCTGTAAAAGCGGGCGCGGTCTTTCCAGAAAAGCATGAAAGGCAGCGCCAGAACGCCCGCTGCAACCGCATAAGTACGGCGTAAAAGATAAGCCATGCAGGATATTCTCTGTAGAGTTCCATACTTTTCTCCCCTTTTGTATCTACCCGGTGAATGGCACCGGAAAAATGAATTTGTTTATCTGATGAAAATAGTACCGCCTTTTGTGTAATTTTACTACTCATCCGACCACTTATTTTTGCTTATTGATGGTTTATTTACATTCATCCTGTAATTAAGTTACACAAAAGTTAAATTAATACTAAACATTAGTTAAATCATGGCTTTTGCCATTTTATACTTTTACACCCCGCCCGCAGATTTTTGCGAAATCTTTGCAGCCAAATTCTACCCTTCCGGTATCACTTTTAGGCCACTGGAGGTGCACTGTGAGTGCAGGCGTGATAACCGGCGTATTGCTGGTGTTTTATTACTGGGTTATCTGGTTTATGCCCTGATCAATGCGGAGGCGTTCTGATGGCTGCGCAAGGGTTCTTACTGATCGCCACGTTTTTACTGGTGTTAATGGTGCTGGCGCGTCCTTTAGGCAGCGGGCTGGCGCGGCTGATTAATGACATTCCTCTTCCCGGTACAACGGGCGTTGAGCGCGTACTTTTCGCGCACTTGGCGTCTCTGACCGTGAGATGAACTGGAAGCAATATCTTTGTGCCATTCTCGGCCTGAACATGCTGGGGCTGGCGGTGCTGTTTTTATGTTGCTCGGTCAGCACTATCTGCCGCTTAATCCACAGCAGTTGCCAGGGCTGTCGTGGGATCTGGCGCTGAATACCGCCGTCAGCTTTGTCACCAATACCAACTGGCAATCTTATAGCGGTGAAACCACGTTGAGCTATTTCAGCCAGATGGCGGGCTTAACGGTGCAAAACTTTCTTTCTGCCGCCAGCGGGATTGCGGTGATTTTGCCCTCATCCGTGCGTTTACCCGCCAGAGCATGAGCACGCTCGGGAATGCCTGGGTCGATCTGCTACGCATCACGTTATGGGTGCTAGTCCCTGTGGCGTTGTTGATTGCACTGTTTTTATTCAACAAGGTGCGCTGCAAAACTTTCTGCCTTATCAGGCTGTGAATACCGTTGAAGGAGCGCAACAGCTGTTACCCATGGGGCCTGTAGCTTCTCAGGAAGCGATCAAGATGCTCGGTACTAACGGCGGTGGCTTCTTTAATGCCAACTCGTCGCATCCGTTTGAAAACCCAACCGCACTGACCAACTTCGTGCAGATGCTGGCGATCTTCTTGATCCCAACGGCGCTGTGCTTTGCCTTTGGTGAAGTGATGGGCGATCGCCGCCAGGGGCGCATGTTGCTGTGGGCGATGTCAGTGATTTTGTCATCTGCGTAGGCGTGGTGATGTGGGCAGAAGTTCAGGGTAATCCTCATCTGCTGGCACTGGGCACGGACAGCAGCATCAATATGGAAGGTAAAGAGAGCCGTTTCGGCGTGCTGGTCAGTAGCCTGTTTGCGGTCGTGACGACGGCGGCTTCCTGTGGCGCGGTGATTGCGATGCATGATTCGTTTACCGCTCTCGGTGGCATGGTGCCGATGTGGCTGATGCAAATTGGTGAAGTGGTGTTCGGCGGTGTCGGTTCTGGTCTTTACGGCATGATGCTGTTTGTCCTGCTGGCGGTGTTTATTGCCGGGCTGATGATTGGTCGTACACCGGAATATCTGGGTAAAAAATCGACGTACGCGAGATGAAACTGACTGCACTGGCAATTCTGGTTACCCCGACGCTGGTGCTGATGGGCGCGGCGTTGGCGATGATGACCGACGCCGGACGTAGCGCCATGCTCAACCCTGGCCCGCATGGTTTTAGCGAAGTGCTGTACGCCGTGTCATCCGCCGCTAACAACAACGGCAGCGCCTTTGCCGGATTAAGCGCCAACTCTCCGTTCTGGAACTGTTTACTGGCGTTCTGCATGTTTGTCGGTCGCTTCGGGGTGATTATCCCGGTGATGGCAATTGCCGGTTCGCTGGTGAGTAAAAGAGCCAAGCCGCCAGCTCCGGCACGCTGCCAACGCACGGCCCGCTGTTTGTTGGCCTGTTAATCGGCACCGTGTTGCTGGTTGGCGCACTGACCTTTATCCCTGCCCTGGCGCTTGGTCCGGTGGCGGAATATCTCTCCTGATATTGAGTGAGCACTGAATATGAGTCGTAAACAACTGGCGCTATTCGAACCAACACTTGTCGTTCAGGCGCTGAAAGAAGCGGTGAAAAATTAAACCCGCAGGCGCAATGGCGCAATCCGGTGATGTTTATCGTCTGGATCGGCAGTCTGCTGACCACCTGTATTAGCATCGCGATGGCAAGCGGTGCGATGCCCGGCAATGCGCTGTTTAGCGCGGCCATTAGCGGTTGGCTGTGGATCACCGTACTGTTCGCTAATTTCGCCGAGGCGCTGGCAGAAGGCCGCAGTAAAGCGCAGGCCAACAGTCTGAAAGGGTGAAAAACTGCCTTTGCCCGCAAGCTGCGTGAGCCGAAATATGGCGCTGCGGCGGACAAAGTTCCTGCCGACCAACTTCGTAAAGGCGATATCGTACTGGTAGAAGCTGGCGATATTATCCCTGCGATGGTGAAGTTATTGAAGGTGCATCGGTCGATGAAAGCGCCATCACCGGGGAATCGGCACCGGTGATCCGTGAATT
+>e744ac28-518e-4933-b2a9-e59adecd6512 id=83 clr=0,5328
+TTGGTATTACTTCGTTCAGTTGCGTATTGCTACTTGCGCAACCGGCTCTATCTGCGGCGTCTGGCGCTGTTTCATGCTTTTCTGGAAAGACCGCGCCCGCTTTTACAGCTACCTGCATCGCGTCTGGTCGAAAACCAGCGATAAACCGGTGTGGATGGATCAGGCCGAAAAGGCAACTGGTGATTTTATTGATTGCTGAGTTTTGAATACATTGAAAACCGCCAGCGGAAACGCTGGCGGTTTTTGTATCAGGAAGATGTTCAGAGGAATATTTAGACATCGTTATACCAATCGAAACATATATTCATGAAATATATATAAATATTTTCCTAATTGTTCTTATCTGACAGATATCTCACTTAAGGCTTTCTTATAAATCAGGGTTTCGCCTGTCAGCAGACAAATAACCCGATAAAACAAGGATGAGCAGATGAGCGGAAAACCGGCGGCGCGTCAGGGCGACATGACGCAGTATGGCGGTAGCATTGTCCAGGGTTCAGCCGGGGTACGCATCGGTGCCCCACCGGCGTGGCCTGTTCGGTGTGCCCCGGCGGGTGACGTCCGGCCATCCGGTCAATCCGCTGCTCGGTGCAAAGGTCCTTCCCGGTGAAACCGACATCGCCCTGCCCGGCCCGCTGCCGTTCATTCTCTCCGCACCTACAGCAGTTACCGGACAAAACGCCCGCGCCGGTGGGGAGCCTCGGCCCCGGCTGGAAAATGCCTGCGGATATCCGCTTACAGCTGCGCGATAACACACTGATACTCAGTGATAACGGCGGCAGAAGCCTGTATTTTGAGCACCTGTTTCCCGGTGAGGACGGTTACAGCCGCAGCGAGTCACTGTGGCTGGTGCGCGGCGGCGTGGCGAAACTGGATGAAGGTCACCGGCTGGCCGCACTCTGGCAGGCGCTGCCGGAAGAACTCCGCTTAAGTCCGCATCGTTATCTGGCGACAAACAGTCCAGGGGCGTGGTGGCTGCTCGGCTGGTGTGAGCGGGTGCCGGAAGCGGATGAGGTGCTGCCTGCGCCGCTGCCGCCGTACCGGGTACTGACCGGGCTGGTGGACCGCTTCGGGCGCACACAGACGTTCCACCGCGAAGCCGCCGGTGAATTCAGCGGCGAAATCACCGGCGTGACGGATGGTGCCGGGCGTCACTTCCGGCTGGTACTGACCACGCAGGCGCAGCGGGCAGAAGAAGCCCGGCAGCAGGCCATTTCCGGCGGGACGGAACCGTCCGCTTTTCCTGATACCCTGCCGGGTTACACCGAATATGGCCGGGACAACGGCATCGTCTGTCTGCCGTGTGGCTGACGCACGACCCGGAATACCCGGAGAATTTACCTGCCGCGCCGCTGGTGCGCTATGGCTGGACGCCCGCGGCGAACTGGCGGCGGTGTATGACCGCAGCAATACAGGTGCGCAGCTTTACTTACGATGATAAATACCGGGGCCGGATGGTGGCGCACCGTCACACGGGCCGACCGGAAATCTGTTACCGTTACGACAGCGACGGGCGGGTGACAGAACAGCTAAACCCGGCAGGCTTAAGTTACACGTATCAGTATGAGAAGGACCGCATCACCATCACCGACAGCCTGAACCGCCGTGAAGTCCTGCACACGCAGGGTGAAGGCGGGCTGAAGCGGGTGGTGAAAAGGAACACGCGGACGGCAGCGTCACGCAGAGTCAGTTTGACGCGGTGGGCAGGCTCAGGGCACAGACGGATGCCGCAGGCAGGACAACAGAATACAGTCCGGATGTGGTGACGGGCCTCATCACGCGCATCACCACGCCGGATGGCAGGGCATCGGCGTTTTACTATAACCACCACAGCCAGTTAACGTCAGCCACCGGGCCTGACGGGCTGGAAATACGCCGGAATATGATGAATGGGGCCGTCTGATTCAGGAAACTGCCCCTGACGGCGATATCACCCGCTACCGTTATGATAATCCACACAGTGACTTACCCTGCGCAACGGAAGATGCCACCGGCAGCCGGAAAACCATGACGTGGAGCCGTTACGGTCAGTTGCTGAGCTTCACTGACTGTTCCGGTTATGTAACCCGCTATGACCATGACCGTTTTGGTCAGGTGACGGCGGTGCACCGCGAGGAAGGGCTGAGTCAGTACCGCGCATACGACAGCCGTGGACAGTTAATTGCCGTGAAAGACACGCAGGGCCATGAAACGCGGTATGAATACAACGCCGCCGGTGACCTGACCACCGTCATTGCCCCGGACGGCAGCAGAAACGGGACACAGTACGATGCGTGGGGAAAAGCCATCTGTACCACGCAGGGCGGTCTGACGCGCAGTATGGAATACGATGCTGCCGGACGGGTCATCCGCCTGACCAGTGAAAACGGCAGCCACACCACCTTCCGTTACGATGTACTCGACCGGCTGATACAGGAAACCGGCTTTGACGGCCGCACACAGCGTTATCACCACGACCTGACCGGCAAACTTATCCGCAGCGAGGATGAGGGGCTGGTCACCCACTGGCACTATGACGAAGCAGACCGCCTCACGCACCGCACCGTGAATGGCGAAACCGCAGAGCGGTGGCAGTATGACGAACGCGGCTGGCTGACAGACATCAGCCATATCAGCGAAGGGCACCGGGTGACGGTGCACTATGGTTATGACAGTAAAGGCCGCCTCGCCAGTGAACACCTGACGGTGCATCATCCGCAGACGAATGAACTGCTCTGGCAGCATGAGACCAGACATGCGTACAACGCACAGGGACTGGCGAACCGCTGTATACCGGACAGCCTGCCCGCCGTGGAATGGCTGACCTACGGCAGCGGCTGGCTGTCAGGCATGAAACTCGGCGACACACCGCTGGTGGAGTACACCCGCGACCGCCTGCACCGGGAAACGCTGCGCAGCTTCGGCCGTTATGAACTCACCACCGCTTATACCCCTGCCGGGCAGTTACAGAGCCAGCACCTGAACAGCCTGCTGTCTGACCGCGATTACACCTGGAACGACAACGGCGAACTCATCCGCATCAGCAGCCCGCGCCAGACCCGGAGTTACAGCTACAGCACCACCGGCAGGCTGACCGGCGTTCACACCACCGCAGCGAATCTGGATATCCGCATCCCGTATACCACAGACCCGGCAGGTAACCGCCTGCCCGACCCGGAGCTGCACCCGGACAGCGCCCTCAGCATGTGGCCGGATAACCGTATCGCCCGTGACGCGCACTATCTTTACCGGTATGACCGTCACGGCAGGCTGACAGAGAAAACCGACCTCATCCCGGAAGGGTTATCCGCACGGATGATGAGCGCACCCACCGGTACCATTACGACAGTCAGCACCGGCTGGTGCACTACGCGGACACAATATGCAGAGCCGCTGGTCGAAAGTCGCTATCTTTACGACCCGCTGGGCCGCAGGGTGGCAAAACGGGTATGGCGGCGTGAACGGGACCTGACGGGCTGGATGTCGCTGTCACGGAAACCGCAAGTGACCTGGTACGGCTGGGACGGCGACCGCCTGACCACGATACAGAACGACAGAACCCGCATCCAGACGATTTATCAGCCGGGGAGCTTCACGCCACTCATCAGGGTTGAAACCGCCACCGGTGAGCTGGCGAAAACGCAGCGCCGCAGCCTGGCGGATACCCTTCAGCAGTCCGGTGGCGAAGACGGTGGCAGTGTGGTGTTCCCGCCGGTGCTGGTGCAGATGCTCGACCGGCTGGAAAGTGAAATCCTGGCTGACCGGGTGAGTGAGGAAAGCCGCCGCTGGCTGGCATCGTGCGGCCTGACGGTGGCGCAGATGCAAAGCCAGATGGACCCGGTATACACGCCGGCGCGAAAAATTCACCTGTACCACTGCGACCATCGCGGCCTGCCGCTGGCCCTTATCAGCACGGAAGGGACAACAGCGTGGTACGCAGAATACGATGAATGGGGTAACCTGCTGAATGAAGAGACCCGCATCAGCTGCAGCAGCATCCGCCTGCCGGGGCAGCAGTATGATGAGGAGTCCGGCCTGTATTACAACCGCCACCGCTATTATGACCCGCTGCAGGGGCGATATATCACTCAGGATCCGATTGGGCTGAAAGGGGATGGAATTTTATCAGTATCCGTTGAATCCGATCTCAAATATAGATCCATTAGGATTAGAAACACTAAAATGCATTAAGCCACTGCATTCAATGGGCGGAACTGGTGAAAGAAGCGGTCCAGATATATGGGGAATCCGTTCTATCATCAATATCTTTGTGTCCCAGATGGTAAAGGGACTATACTTGTGGTGGCCAAGACCAACGGGGAGAATCAAAGGAGATGGTCTATGGGGGCCAGGTAAAGCAAGTAATGATACAAAGAAGCTGCTGGCCGTTGTGACCTCGTTGAAACCGATAATAGTTGTGTGGAGAACTGTTTAAAGGGAAGTTTAAAGAGGTAAGGCCGCGTTATTCTGTATTGCCTGATATATTCACACCTATAAATTTAGGGCTATTTAAAACTGCCAAGACTGGTCTAATGATTCTTTAGAAACATGTAAGATGAAGTGCTCCGGAAATAACATTGGACGTTTTATTAGATTTGTATTCACCGGAGTGATGTAATGAAATATATTATTTTTTATTCAGAGCTATATGGCTGGCTTTATCGCTTTTAATACTATTCTTTTCCATGCATAGACTTTCACTATTAGACTCCACTCGTGATGTGAGCGAGTTAATTAGTCTCATGTCTTATGGAATGATGGTAATATGTTTTCCAACAGGCATAGTATTCTTTATTGCTCTAATATTTATAGGGACTGTATCAGACATTATTGGCGTAAGTTGATAGTAAGTATATTATGGCGATAATAATATGGCTTTATTTTCTGTCAGGAGGGTATATTCAATGGTTTGTATTAAGTAAGCGCATTATAAACAAATAAATTAAGTTAATTGCTCTTATTATTATATGTAACCTGGGCATTGATATCCCGTATGCCACAGACCCGAGGTAACCGCCTGCCCGACCCGGAGCTGCACCCGGACAGCACCCTCAGCATGTGGCCGGATAACCGTATCGCCCGTGACGCGCACTATCTTTACCGGTATGACCGTCACGGCAGGCTGACGGAGAAACCGACCTCATCCCGGAGTTATCCGCACGGATGATGAGCGCACCCACCGGTACCATTACGACAGTCAGCACCGGCTGGTGCACTACACGCGGACACAATATGCAGAGCCGCTGGTCGAAAGCCGCTATCTTTACGACCCGCTGGGCCGCAGGGTGGCAAAGGTTAAAACACCCAGACGCCGCAATATCAGCACCAACAAGTAATACGTAAAAAAGG
+>2c468ad4-194a-4af0-93d4-3fcbe17a9be7 id=84 clr=0,5144
+TGCCTGTCGCTCTATCTTCGGCGTCTGCTGGGTGTTTAACCTCACTTGTCTTTAAAGAGCGGTTATCCGGCGCGTTGTTAATCGTGCGGGCGGGTGGTTCATCAAGCGCGACCAGCACCTGATCGAGATCGGGGCGATGCGCGCCAGTCGGTCAGCAAACGTTTCCCGACGCCACCAGCGGCGCGAGGCCGGGCGACCGAGAATAATCTTGCCGAGATTATGTTCACGGGCATAACGCACTACCGCTTTCTCTTCCGCTGGATCAGAAAGTGTTGCCGTCTCCGCGCCCAGTTCCTGCGCCAGACGTAAGGCGCTGAGAATTGCCCGACGTTTTTTCCGGTAAGCGGTGCAGGGCAGGGGTTTCAACATACACCGCGTGCCAGACGCTACCCAGCCGTGACGCCAGCCGCGCCGCTGCGCGGACCAGTTTTCGCTGCCGGTGTTATGGCCGATGCATAAAAGGATCGCGTCGCGCGTGCCACACTTTCTCTTCGCCAGGATGCCCCGCCAGGCGCGCATTTGCTCATCAACGCGATCGGCAGTACGGCGCAGTGCCAGTTCGCGCAGGGCGATCAGATTACCTTTGCGGAAAAATGTTCAATGGCGCGCTCCGCCTGCCCGGCAATATAGACTTTGCCTTCTTTCAGCCGCTGGCGCAGATCGTCCGGGGCAAGTCCACCAGCACCACGTCGTCGGCGGCATCGAAAAGGATCGGGCACGGTTTCCCGTACCTGAATTCCGGTGACGCCGCTGACCACATCATTCAGACTTTCCAGATGCTGAACGTTGACGGTAGTGAAAACATCAATGCCAGCTTCCAGCAGTTCTTCGATATCCTGCCAGCGTTTGGGATGACGGGAACCTGGCGCATTACTGTGCGCCAGTTCGTCCATTAAGATCAGCGCCGGGCGGCGGGCGAGGGCGGCATCGAGATCAAACTCGCTGATATGCCGCCCACGGTACGCCTGGCGTTTTAACGGCAGAACAGCCAGCCCTTCCAGCATGGCGGCGGTATCTTTCGCCCGTGGGTTTCTACCACGCCAACCACAATATCCAGCCCTTGCGCCCGCAGTCGCTGGGCTTCTGCCAGCATCGCCCAGGTCTTCCCGACGCCTGCACAGGCACCGAAGCTTTCAGCTTCCCCGATGCGGCGCGGCAGTTTGTTCCAGCAGACGATCGGGGTCGGGACGTAAGGGTTCGTTATTCATCAAGTTTATCCAGCGCCAGATTGAGTTCAACAATGTTGACAACCGGCTGGCCGATATATTTCACCAGCGGTTGTTGGCTGTATTTTGCGATCAGTTGCGTGAGCTGTTCAACGCTGAGATTACGCGCTTTCGCCACGCGTGGGTTTGCCAGGCCGCCGCTTGCGGGTGATATTATTGTCCAGCCCGCTTGCCGATGCCGTCACCAGTTCAACCGGAACGCTCGCGCTGGCATCCGGGTTAGCGGCCCGTAATGCAGCAACGCGTGCGGCTATTAGTTTATCCAGCTCAGGGTTACTGACCGCCAGATTGCTCCCGCCAGAAGCCTGTGGATTATAGGGCATTTCTGCCGTTGCCGACGGGCGACCATGAAAATAGCCGTTGCCGGTAAAATTCTGCCCGATTAATGCCGAACCGCGCACCGTATCACCTTCACGAATCAACGAACCATTGGCCTGCCAGGAAACCACCATTGCCCCAGTACGGTGGTCAGCAGCGGGTAAACGCCGCCAGTAATCAATAACAGAAAGATAAATGTTGATAATGCCGGACGTAATCCACTCATGGTAAACCTCACACCAGACCGCAAACGGTCAGCAGTAAATCAATGACTTTGATACCGATAAACGGCACCAGCAGCCCACCCAGACCGTAAATCCATAAGTTACGGCGCAACATGGCAGAAGCGGTAAGCGGTTTATAACTCACGCCTTTTAACGCCAGGGGAATCAAAGACGATAATCAAGGCGTTGAAAATCACCGCACTGAGGATTGCGGAGTCGGGCGAATGCAGGCACATGATGTTCAGCGCATTTAACTGCGGATACGTTGCCGCGAATGCCGCCGGAATAATGGCGAAGTATTTCGCCACATCGTTGGCAATGCTGAAGGTGGTCAGCGAGCCACGGGTCATCAGCATCTGTTTGCCAATGTGCACCACCTCGATCAACTTGGTCGGGTTAGAGTCGAGATCGACCATATTGCCCGCCTCTTTCGCCGCCTGGGTGCCGGAGTTCATCGCCACCGCGACATCTGCCTGCGCCAGCGCCGAGCATCGTTGGTGCCGTCGCCGGTCATCGCTACCAAACGACCTTCCGCCTGATACTGACGGATCAATGCCAGCTTGGCCTCCGGTGTCGCTTCGGCGAGAAAATCATCGACACCCGCTTCCGCAGCAATCGCGGCGGCAGTCAGACGGTTATCGCCGGTAATCATCACCGTTTTAATGCCCATTTTGCGCAGCTGGGCGAAGCGCTCTTTAATACCGCCTTTGACGATATCTTTCAGCGCAATAACGCCCAGCACACGAGAACCTTCCACCACCACCAGCGGCGTGGCTCCCCTGACGCGCAACCTGATCGACTTTTTGATCAACATCGGTAGGGAAGTGACCACCGTTAGCCTCAACATGGCGACGAATGGCATCGACAGAACCTTTACGGATCATGCGGTTGTCGATGTTGATCCCGCTCATCCGGCTTTGCGCAGTAAACGGTACAAAGGTGGCATGGAGCGACTGCATCGCGCTCGCGCAGGTTAAAACGCTGCTTGGCGAGGATCACAATACTGCGGCCTTCCGGCGTTTCATCAGCCAGCGAAGCCAGTTGTGCGGCGTCAGCCAGCGTTTTCATCCACGCCCTGCGCGGGATAAACTCCGACGCCTGACGGTTACCGAGTGTGATGGTGCCGGTTTTATCCAGTAGCAGAACGTCAACGTCACCTGCCGCTTCAACTGCACGTCCGCTGGTGGCAATCACATTCGCGCCTAGCATCCGGCTCATCCCGGCGACGCCGATCGCTGACAACAGGCCGCCAATAGTGGTTGGGATCAGACAGACCAGCAGCGCCACCAGTACCGTTACGCTGACTGCATTACCGCCCCACGCGGAAAACGGCCACAGCGTGGCGGTTGCCAGTAAAAGACGATAGTCAGGGCAATCAGCAGAATGGTCAGGGCAATTTCGTTCGGCGTTTTGCGTCGCTGTGCGCCTTCCACCATCGCGATCATCCGATCCAGAAATGTCTCGCCGGGGTTAACGCTACACTCAATCACCAGCCAGTCAGAAAGAATACGCGTGCCGCCGGTGACGGAGCAAAATCGCCGCCGGATTCACGGATCACCGGTGCCGATTCCCCGGTGATGGCGCTTTCATCGACCGATGCACCTTCAATAACTTCACCATCGCAGGGATAATATCGCCAGCTTCTACCAGTACGATATCGCCTTTACGAAGTTGGTCGGCAGGAACTTTGTCCGCCGCAGCGCCATATTTCGGCTCACGCAGCTTGCGGGCAAAGGCAGTTTTTCACCCTTTCAGACTGTTGGCCTGCGCTTTACTGCGGCCTTCTGCCAGCGCCTCGGCGAAATTAGCGAACAGTACGGTGATCCACAGCCAACCGCTAATGGCCGCGCTAAACAGCGCATTGCCGGGCATCGCACCGCTTGCCATCGCGATGCTAATACAGGTGGTCAGCAGACTGCCGATCCAGACGATAAACATCACCGGATTGCGCCATTGCGCCTGCGGGTTTAATTTTTCACCGCTTCTTTCAGCGCCTGAACGACAAGTGTTGGTTCGAATAGCGCCAGTTGTTTACGACTCATATTCAGTGCTCACTCAATATCATCAGGAGAGATATTCCGCCACCGGACCAAGCGCCAGGGCAGGGATAAAGGTCAGTGCGCCAACCAGCAACACGGTGCCGATTAACAGGCCAACAAACAGCGGGCCGTGCGTTGGCAGCGTGCCGGAGCTGGCGGCTTGGCTCTTTTACTCACCAGCGAACCGGCAATTGCCATCACCGGGATAATCACCCCGAAGCGACCGACAAACATGCAGAACGCCAGTAAACAGTTCCAGAACGGAGAGTTGGCGCTTAATCCGGCAAAGGCGCTGCCGTTGTTGTTAGCGGCGGATGACACGGCGTACAGCACTTCGCTAAAACCATGCGGGCCAGGGTTGAGCATGGCGCTACGTCCGGCGTCGGTCATCATCGCCAACGCCGCGCCCATCAGCACCAGCGTCGGGGTAACCAGAATTGCCAGTGCAGTCAGTTTCATCTCGCGTACGTCGATTTTTACCCAGATATTCCGGTGTACGACCAATCATCAGCCCGGCAATAAACACCGCCAGCAGGACAAACAGCATCATGCCGTAAAGACCAGAACCGACACCGCCGAACACCACTTCACCAATTTGCATCAGCCACATCGGCACCATGCCACCGAGCGGTAAACGAATCATGCATCGCAATCACCGCGCCACAGGAAGCCGCCGTCGTCACGACCGCAAACAGGCTACTGACCAGCACGCCGAAACGGCTCTCTTTACCTTCCATATTGATGCTGCTGTCCGTGCCCAGTGCCAGCAGATGAGGATTACCCTGAACTTCTGCCCACATCACCACGCCTACGCAGATGACAAAATCACTGACATCGCCCACAGCAACATGCGCCCCTGGCGGCGATCGCCCATCACTTCACCAAAGGCAAAGCACAGCGCCGTTGGGATCAAGAAGATCGCCAGCATCTGCACGAAGTTGGTCAGTGCGGTTGGGTTTTCAAACGGATGCGACGAGTTGGCATTAAAGAAGCCACCGCCGTTAGTACCGAGCATCTTGATCGCTTCCTGAGAAGCTACAGGCCCCATGGGTAACAGCTGTTGCGCTCCTAACGGTATTCACAGCCTGATAAGGCAGAAAGTTTTGCAGCGCACCTTGTTGAATAAAAACAGTGCAATCAACAACGCCACAGGGACTAGCACCCATAACGTGATGCGTAGCAGATCGACCCAGGCATTCCAGAGCGTGCTCATGCTCTGGCGGGTAAACGCACGGATGAGGGCAAAATCACCGCAATCCCGCTGGCGGCAGAAGAAAGTTTTGCACCGTTAAGCCCGCCATCTGGCTGAAATAGCTCAACGTGGTTTCACCGCTATT
+>ead9981c-1001-491b-8db1-e0c05553899a id=85 clr=0,6330
+TTGGTAGCCTTCGTTCGATTTACATGTTGCTTCTTGCCTGTCATCTATCTTCCGGCGTCTTTAGCGGGTGTTTAACCTAGAGGAATATTTAGACATCGTTATACCAATCGAAACATATATTCATGAAATATATATAAATATTTTCCTAATTGTTCTTATCTGACAGATATCTCACTTAAGGCTTTCTTATAAATCTGTAGGGTTTCGCCTGTCAGCAGACAAATAACCCGATAAAACAAGGATGAGCAGATGAGCGGAAAACCGGCGGCGCGTCAGGGCGACATGACGCAGTATGGCGGTAGTCCAGGGTTCAGCCGGGGTACGCATCGGTGCCCCACCGGCGTGGCCTGTTCGGTGTGCCCCGGCGGTGACGTCCGGCCATCCGGTCAATCCGCTGCTCGGTGCAAAGGTCCTTCCCGGTGAAACCGACATCGCCCTGCCCGGCCCGCTGCCGTTCATTCTCTCCGCACCTACAGCAGTTACCGGACAAAACGCCCGCGCCGGTGGGAGCCTCGGCCCCGGCTGGAAAATGCCTGCGGATATCCGCTTACAGCTGCGCGATAACACACTGATACTCAGTGATAACGGCGGCAGAAGCCTGTATTTTGAGCACCTGTTTCCCGGTGAGGACGGTTACAGCCGCAGCGAGTCACTGTGGCTGGTGCGCGGCGGCGTGGCGAAACTGGATGAAGGTCACCGGCTGGCCGCACTCTGGCAGGCGCTGCCGGAAGAACTCCGCTTAAGTCCGCATCGTTATCTGGCGACAAACAGTCCGCAGGGGCCGTGGTGGCTGCTCGGCTGGTGTGAGCGGGTGCCGGAAGCGGATGAGGTGCTGCCTGCGCCGCTGCCGCCGTACCGGGTACTGACCGGGCTGGTGGACCGCTTCGGGCGCACACAGACGTTCCACCGCGAAGCCGCCGGTGAATTCAGCGGCGAAATCACCGGCGTGACGGATGGTGCCGGGCGTCACTTCCGGCTGGTACTGACCACGCAGGCGCAGCGGGCAGAAGAAGCCCGGCAGCAGGCCATTTCCGGCGGGACGGAACCGTCCGCTTTTCCTGATACCCTGCCGGGTTACACCGAATATGGCGGGACAACGGCATCCGTCTGTCTGCCGTGTGGCTGACGCACGACCCGAATACCCGGAGAATTTACCTGCCGCGCCGCTGGTGCGCTATGGCTGGACGCCCGCGGCGAACTGGCGGCGGTGTATGACCGCAGCAATACACAGGTGCGCAGCTTTACTTACGATGATAAATACCGGGGCCGGATGGTGGCGCACCGTCACACGGGCCGACCGGAAATCTGTTACCGTTACGACAGCGACGGGCGGGTGACAGAACAGCTAAACCCGGCAGGCTTAAGTTACACGTATCAGTATGAGAAGGACCGCATCACCATCACCGACAGCCTGAACCGCCGTGAAGTCCTGCACACGCAGGGTGAAGGCGGGCTGAAGCGGGTGGTGAAAAAACACGCGGACGGCAGCGTCACGCAGAGTCAGTTTGACGCGGTGGGCAGGCTCAGGGCACAGACGGATGCCGCAGGCAGGACAACAGAATACAGTCCGGATGTGGTGACGGGCCTCATCACGCGCATCACCACGCCGGATGGCAGGGCATCGGCGTTTTACTATAACCACCACAGCCAGTTAACGTCAGCCACCGGGCCTGACGGGCTGGAAATACGCCGGGAATATGATGAATGGGGCCGTCTGATTCAGGAAACTGCCCCTGACGGCGATATCACCCGCTACCGTTATGATAATCCACACAGTGACTTACCCTGCGCAACGGAAGATGCCACCGGCAGCGGAAAACCATGACGTGGAGCCGTTACGGTCAGTTGCTGAGCTTCACTGACTGTTCCGGTTATGTAACCCGCTATGACCATGACCGTTTTGGTCAGGTGACGGCGGTGCACCGCGAGGAAGGGCTGAGTCAGTACCGCGCATACGACAGCCGTGGACAGTTAATTGCCGTGAAAGACACGCAGGGCCATGAAACGCGGTATGAATACAACGCCGCCGGTGACCTGACCACCGTCATTGCCCCGGACGGCAGCAGAAACGGGACACAGTACGATGCGTGGGGAAAAGCCATCTGTACCACGCAGGGCGGTCTGACGCGCAGTATGGAATACGATGCTGCCGGACGGGTCATCCGCCTGACCAGTGAAAACGGCAGCCACACCACCTTCCGTTACGATGTACTCGACCGGCTGATACAGGAAACCGGCTTTGACGGCCGCACACAGCGTTATCACCACGACCTGACCGGCAAACTTATCCGCAGCGAGGATGAGGGGCTGGTCACCCACTGGCACTATGACGAAGCAGACCGCCTCACGCACCGCACCGTGAATGGCGAAACCGCAGAGCGGTGGCAGTATGACGAACGCGGCTGGCTGACAGACATCAGCCATATCAGCGAAGGGCACCGGGTGACGGTGCACTATGGTTATGACAGTAAAGGCCGCCTCGCCAGTGAACACCTGACGGTGCATCATCCGCAGACGAATGAACTGCTCTGGCAGCATGAGACCAGACATGCGTACAACGCACAGGGACTGGCGAACCGCTGTATACCGGACAGCCTGCCCGCCGTGGAATGGCTGACCTACGGCAGCGGCTGGCTGTCAGGCATGAAACTCGGCGACACACCGCTGGTGGAGTACACCCGCGACCGCCTGCACCGGGAAACGCTGCGCAGCTTCGGCCGTTATGAACTCACCACCGCTTATACCCTGCCGGGCAGTTACAGAGCCAGCACCTGAACAGCCTGCTGTCTGACCGCGATTACACCTGGAACGACAACGGCGAACTCATCCGCATCAGCAGCCCGCGCCAGACCCGGAGTTACAGCTACAGCACCACCGGCAGGCTGACCGGCGTTCACACCACCGCAGCGAATCTGGATATCCGCATCCCGTATACCACAGACCCGGCAGGTAACCGCCTGCCCGACCCGAGCTGCACCCGGACAGCGCCCTCAGCATGTGGCCGGATAACCGTATCGCCCGTGACGCGCACTATCTTTACCGGTATGACCGTCACGGCAGGCTGACAGAGAAACCGACCTCATCCCGGAAGGGGTTATCCGCACGGATGATGAGCGCACCCACCGGTACCATTACGACAGTCAGCACCGGCTGGTGCACTACGCGGACACAATATGCAGAGCCGCTGGTCGAAAGTCGCTATCTTTACGACCCGCTGGGCCGCAGGGTGGCAAAACGGGTATGGCGGCGTGAACGGGACCTGACGGGCTGGATGTCGCTGTCACGGAAACCGCAAGTGACCTGGTACGGCTGGGACGGCGACCGCCTGACCACGATACAGAACGACAGAACCCGCATCCAGACGATTTATCAGCCGGGGAGCTTCACGCCACTCATCAGGGTTGAAACCGCCACCGGTGAGCTGGCGAAAACGCAGCGCCGCAGCCTGGCGGATACCCTTCAGCAGTCCGGTGGCGAAGACGGTGGCAGTGTGGTGTTCCCGCCGGTGCTGGTGCAGATGCTCGACCGGCTGGAAAGTGAAATCCTGGCTGACCGGGTGAGTGAGGAAAGCCGCCGCTGGCTGGCATCGTGCGGCCTGACGGTGGCGCAGATGCAAAGCCAGATGGACCCGGTATACACGCCGGCGCGAAAAATTCACCTGTACCACTGCGACCATCGCGGCCTGCCGCTGGCCCTTATCAGCACGGAAGGGACAACAGCGTGGTACGCAGAATACGATGAATGGGGTAACCTGCTGAATGAAGAGAACCCGCATCAGCTGCAGCAGCTTATCCATGCCGGGGCAGCAGTATGATGAGGAGTCCGGCCTGTATTACAACCGCCACCGCTATTATGACCCGCTGCAGGGGCGATATATCACTCAGGATCCGATTGGGCTGAAAGGGGATGGAATTTTATCAGTATCCGTTGAATCCGATCTCAAATATAGATCCATTAGGATTAGAAACACTAAAATGCATTAAGCCACTGCATTCAATGGGCGGAACTGGTGAAAGAAGCGGTCCAGATATATGGGGAATCCGTTCTATCATCAATATCTTTGTGTCCCAGATGGTAAAGGGACTATACTTGTGGTGGCCAAGACCAACGGGGAGAATCAAAGGAGATGGTCTATGGGGGCCAGGTAAAGCAAGTAATGATACAAAGCTGCTGGCCGTTGTGACCTCGTTGAAACCGATAATAGTTGTGTGGAGAACTGTTTAAAAGGAAGTTTAAAGAGGTAAGGCCGCGTTATTCTGTATTGCCTGATATATTCACACCTATAAATTTAGGGCTATTTAAAACTGCCAAGACTGGTCTAATGATTCTTTAGAAACATGTAAGATGAAGTGCTCCGGAAATAACATTGGACGTTTTATTAGATTTGTATTCACCGGAGTGATGTAATGAAATATATTATTTTTTATTCAGAGCTATATGGCTGGCTTTATCGCTTTTAATACTATTCTTTTCCATGCATAGACTTTCACTATTAGACTCCACTCGTGATGTGAGCGAGTTAATTAGTCTCATGTCTTATGGAATGATGGTAATATGTTTTCCAACAGGCATAGTATTCTTTATTGCTCTAATATTTATAGGGACTGTATCAGACATTATTGGCGGGATTGATAGTAAGTATATTATGGCGATAATAATATGGCTTTATTTTCTGTCAGGAGGGTATATTCAATGGTTTGTATTAAGTAAGCGCATTATAAACAAATAAATTAAGTTAATTGCTCTTATTATTATATGTAACCTGGGCATTGATATCCCGTATGCCACAGACCCGGCAGGTAACCGCCCCCGACCCGGCTGCACCCGGACAGCACCCTCAGCATGTGGCCGGATAACCGTATCGCCCGTGACGCGCACTATCTTTACCGGTATGACCGTCACGGCAGGCTGACGGAGAAACCGACCTCCTCGGAAGGGTTATCCGCACGGATGATGAGCGCACCCACCGGTACCATTACGACAGTCAGCACCGGCTGGTGCACTACACGCGGACACAATATGCAGAGCCGCTGGTCGAAAGCCGCTATCTTTACGACCCGCTGGGCCGCAGGGTGGCAAAACGGGTGTGGCGACGTGAACGGGACCTGACGGGCTGGATGTCGCTGTCACGGAAACCGCAAGTGACCTGGTACGGCTGGGACGGCGACCGCCTGACCACGATACAGAACGACAGAACCCGCATCCAGACGATTTATCAGCCGGGGAGCTTCACGCCACTCATCAGGTTGAAACCGCCACCGGTGAGCTGGCGAAAACGCAGCGCCGCAGCCTGGCGGATACCCTTCAGCAGTCCGGCGGCGAAGACGGTGGCAGTGTGGTGTTCCGCCGGTGCTGGTGCAGATGCTCGACCGGCTGGAAAGTGAAATCCTGGCTGACCGGGTGAGTGAGGAAAGCCGCCGCTGGCTGGCATCGTGCGGCCTGACGGTGGAGCAGATGCAAAACCAGATGGACCCGGTGTACACGCCGGCGCGAAAAATCCACCTGTACCACTGCGACCATCGCGGCCTGCCGCTGGCGCTTGTCAGCACGGAAGGGGCAACAGAATGGTGCGCAGAATACGATGAATGGGGCAACCTGCTGAATGAAGAGAACCCGCATCAGCTGCAGCAGCTTATCCGCCTGCCGGGGCAGCAGTATGATGAGAGTCCGGCCTGTATTACAACCGCCACCGCTATTATGACCCGCTGCAGGGAGGTATATCACTCAGGATCCGATTGGGCTGAAGGGGATGGAATTTTATCAGTATCCGCTGAATCCGGTTCAGTATATAGATTCAATGGGACTGGCATCAAAATATGGACACTTAAATAATGGCGGATATGGAGCGAGACCCAACAAACCGCCTACGCCCGATCCAAGTAAATTGCCGGACATAGCGAAACAATTAAGACTGCCATATCCTATTGACCAGGCCAGTAGTGCGCCTAATGTTTTCAAAACATTCTTCAGAGCATTAAGCCCTTACGACTACACACTGTATTGCAGGAAGTGGGTAAAACCAAATCTGACTTGTACGCCACAGGATGATTCCCAGTATCCAGGGATGGATACAAAGACAGCAAGTGATTACCTGCCACAGACAAATTGGCCAACAACTCAATTACCACCAGGATATACTTGTGCAGAACCTATTTATTCCCAGACATTAATAAACCCGATGGGCCAGCAACGCAGGGATAGATGATTTGGGTGAAATTTTAGCTAAGATGAAACAGAGAGAACATCGAGAGGAATAAGAAAATGAAAAGAGTTTTGTTCTTTTTGCTGATGATATTTGTTAGTTTTGGTGTTATAGCTGATTGCGAAATT
+>bd76fe67-db4b-4d72-95df-e23f07aea51a id=86 clr=0,9968
+CTGATGTGCTTCGGACAGTTGCGTATTGCTACTTGCCTGTCGCTCTATCTTCGGCGTCTGCCCGTTGTTTAACCTGTTCCACCCCAGCGGGCGGCGAGCGGCCGTCAGGATGTAAACATGCCACCACTCCAACCCAGCCAGCCGAACCCCACCAGGCCGGTAATCTGCCGCTGCCGCCGCTCCACAACAAACTATACTTCACTTCCAGCATCTCGGCGCAGCGGCAAACCGCCGAGACTGAGCCCAGAAAATATGTGGATGAACGACCATTAACGCCATCGCTGGCTGAGGTCCGTTTAATTTGGCTTCCATCTTTCCGCCAGCTCGGCAATCCGGCAATCGACCCATCAGGCTGCTGGCCTCAGCCATCATCACTACTTTGCTGTTACTGGAGGAACCGATCTGCTGTAACGCTTCGGTTATTTCTGCGCTACAGAGAAGTTCACCGCCTGAATATCACGGGGCGATAGCTCGAACACACACCATTTGGTGGCGCGGGCTTCTCGCCAGGCGGAACGTTCACGCGCTTCAGCCTGTAAAAACGCCGACTGACGTTTTCGCCTTCCTTTCAGGATTTGACTGTTTTCACCTTCGGCACGAAGTTTCCGCCTGACGGATCCCTTCCGCTTCCGATATAGCCTTGACGGTACCGTTCAACTTTCATCTGCGCGTTCATTGAAGAGATAAGCTCTGCCGGTGGGCGCACGTCGCGAATTTCAATACGAGCTTTAATCCCCACGGGTTGGTGAAAGCTACCATCAAGGCAATACACCCCAGCGGGCGGAGTTGATGCTGTCGCGCTGAAACATTTTGTCAAAGTTCCATTAGACCCAGCACGGTACGGATGTTAATTAACGGTCAGGTTGATGATGCCAGCTCAGGTTGCTGGCCATAGCCGCGCGTCGATCACCTGAATAAAGCACAGCGTCGATGGTAACGTTGGCGTTTATCTTCGGATAACTTCTCTGGGAAGGGATATCGACGCGCTCCATCATATTGATCTTGCGGCAATGCGATCCATAAGCGGCACCACCAGACTGGGCCCCGTACCAACGTTTGGTATAGCGACCGGCGTTCTACTGTCCACTGATGGCCTGCGAGTACGATTTGACACCCGCGCCGGCAATGACCAGCGCGGCAAAATGAATCGGGATAAAGGTAAGCATGGAAAAACCTCATTACCGTCAATCCAGCAGGCCTGCTTGATTAAATAAATTATACCTGATTACTGAAGAGGTTCCCCTTATTCCTGCGAAGGATGAAGCTGTTTTAGTAAATCAGAAAGGGAACAGCGATGGGGAAAATGAAGATCGCTTTAGCTTCAGCCGCTTGTGGATATCTGGCGTTGATGCGAAGTGCTGGCAACATCAATTTTTCATACGTGCTGGCGAATTTAAGTTCATTACTGTTCCTTCTGGTTTGGCAAAGTACGCTGCTAAAAATAGTTGCTTCATTGATAAGCTATGCTTCCGGAACATTCTGTTGAAAATTGAGGATGTCAGCGCAAAGCCGAAATCACCGCCAATGAAGTCTCTTTTTTCGCCCGGGCACCGACGCTGTTGGCGATACGGTATCCACGATATCTGAGTCTTTCACCGGCAGATCCGTAGCGGCATTGACCAGCCATTTTTTCTCGGTTATATCAGACGCTTTAGCGCGGACAGCATTTTGACGAAGAATATCGCCGAGCTATCTGGTGGTGAAAAACAACGCATCTCATTGATTCGTAACCTGCAATTTATGCCAGAAAGGTTTTATTACCGGATGAAATAACCAGTCGCTGGATGAAAGTAATAAACATAACGTCAATGAGATGATCCATCGTTATTGCGCACGGCAAAATATTGCCGATGCTGTGGGTGATACGATAAAGACAGGAAATTAATCATGGATAAAATTGATTACACTGCAACCACGCCGGGCATCAGGAAGCACGCTAGCAGACTCGCATAATATTGCTAACGATCGACCGCACTGGCATTAATCTTAGTGGTGAGGTGGCAATCAATTAGCCATAAAGAAAAACTGGCGCTGGAAAAGATGTCTCTGAATCCGGGGCAGCGATAATTCAGCTGATTATTGTCGGCTATGCTGAAGTATATTTTCAGCGTGATACCAGCCTGGTATTCTGTAAGTGGGTGTTATTTATCGCTTTATTTTGGCGTGGAACGCATAAAAAGCAATCATCTCATTGCGCTAAGCACTATCTCCATCGTTTAACACCATTGCGGTCAGGCTGAAATTACCCTGGCGTGCTGATTCTCTCAGGGTCGATTGATTTATCGATGCGATGATCCCTATCGCCGGATAAATTACGCCGGTAACGCCATGGTAGCGGTGGGGATTATGTTGCAACAAAATTTGCAGGGGCAACGGGTCAGCCGAACAACAACAGATTCAGAAACTGAGTCGCCCGGTGCGACGCCGGCAAACTTCAGCGATATTGATTCACTGGCGCAGTAATTGTACGCGGCGCAATTCCGACGAATTGAATTCGTAAAAACGGATTTGGCCAGTGAGTTTACCAGAGATGATGTCCAGGGCTAAGTATTTGCAGGATGGTCGGTGAAGGCGATTATCTCAAGATTATGGTGACCTTTAATGTGCGCCAACCGCCAGCTTATGGGCAACAACGCACTGCTATTTAACTTCATCAACAGTTTATAATTCCGCTTACCAGTTGGTGGTGACTAAATTCAGAAAGAAATGATGCGATGCCGGGTGCCAGCATCATCGGTAGCGGTTATGTGCCGATCAGCAGATATCCGTAAATGCATACAGCTGGCGGCGATACTTCGACGCCAATTATCATGCCAACGGCGAGGATCTTCTGGAACATTTTGCGCGTCTGAAGCTGTCCGGCGGTGAGATCCTGCAGATGCCCGAACGGCAACTCAGCGCTTCTTCGTTGCGCCCAACCTGATGCAGGTGCAGCGCAGTTTGCATCGCCGGTGAAGCATCTTTGATTCTCACCTGCCATTTGCAACTGTTGAATTTCAGCATCAGCGCCTACGCTTCCAACAGTTCATTGCCACCAGCCCTGGTAGCGCGGAACGTCCTGATCACCAACGGAATGGTTTTCAGCACCGCTGCATCGCCAAGACGGTTCAGCGCGTCAATACGTTTCTGCTGGCAACAATTTAGATCTCCCCGTTCTGTTCGACGCTGCCAGAGCGTCGCTCCAGCAGCCAACGAGGGCATCCTGGTATGTGCTTTTTCCTGCATCGATTTATCGCTGCGCGCTTTCAGCTCTTCTTTAGCGGCAACGCACATCAGCACGGGGCGCGGATCACCTCTTCCGGTTGCGGCCTGGAAGCCTACATCCGGTTGCCGTTCTGGAACGAATACGCGGTCGGAATCACGCAGACCAAACTGCGCGGCAATCATCTGCTCCGCGTCGCAGTCAGCTTCGCCAGAATCAGTACCCGTTGTATGCCGCCGCAGGCTTTTCAGAGTGGGTTAACTGCGACAGTGCTGGCTGCGTTCAGACCAAATAAGAACAGCACCGGAGTGGTCATCGACTGTTCAGAACCTGTTGCAGGTTAGATTCGTTAATGTTGACAATATTTTCTACGGACATGGAGTCGCTCTCTGTTGTCGATATTTTCTTTGACATGGGGAAGATAAGCGCGCTTCAACTCACCTGCAATATTTTGTCCATCACGCGCCCCGGCAGCAGGCGCTTAAGCACCATTACCGCCCAGGTCACCAGCGTCACCGGATAGCGCATCTTCGGCTTCTCGCTAATAAAAGCATGGCGTACTTTGTCCACCACCGCTTCCGGTCCCAACGTAAAGCGGGCGGCGATGCCGGATTTTCGACTGGTTTATCACTTTGCGTCTGGTTGACGTTGTCGGTGAAGCGAGTACGAATGGGACCGGGTTCGATCAGGCTGACTTTAATTCCGCTGTGGCGCAGCTCCATGCGCAGTGCATCTGACCACGCCTCAGCGCATATTTACTGGCCGCGTAAGCGCCACGACCATTGCGGGAGATTAATCCCATCACCGATGATGTCATCACAATACGCCCTTCACCGTGTTTATCGCGGGTAACAGGCGCATGGTGAGCTGGTGTGCGCCGAAAAGTTGGCGGAAACTGCTGTTCCATCTGCGCACGGCTGATGGTTGGAAAGTCGCCATACCGGAATCCGGCATTGTTAAAGATCCCATACAGACATGGTATCGGTCAGGCGATCGTCGGCTGCGCGATCAACACTTTCTGGTGAATCCAGATCGATCAACACGCCGGTAATCCCATGCCGTTCGCCGCTCAACATCATCCGGTTTCCGCAACCTGCCACGCATGAAAACCCTGGCGTTTTAATTCGAGCGCGCTTTCCAGGCCAATTCCACTGGAACATCCGGTAATTAAGACCGATTTTTGCATAACTTTACCTGTCAGGATCTCCGTTGCTTTATGAGTCATGATTTACTAAAGGCTGCAACTGCTTCGCCATCCAGTCGGCAATAAACGGCTGGGCGTCGCGTTGGGATGAATACCGTCATCCTGCATCCATTGTGGCTTGAGGTGGACCTCTTCCATAAAAAGGGCAGCAGCGGAACATCAAACTCTTTGGCGAGTTTGGGGTAAATGCGCTAAAGGCTTCCATTATAACGGCGACCATAGTTTGCAGGCAGACGTATTTGCATTAACAATGGTTCAGCGTTGGCGGCTTTGACATCCTGCAAAATCTGGCGCAGCGTTTGCTCGGTTGCTGTAAAACCACGCAAACCGTCGTTGCCTGAGTTCAGCCAGCACCCAACGCGGCTGATGCTGTTTCAGCAGAGCCGGAAGGCGCCAGTCCTTGTTGCAGAGGTGTCGCCGCTGATGCTGGCATTAACTACCGTTTACTCTCGCTTATCATTCAACAAGGCAGGCCAGGCCGCGCTGGCAGACATTCGATACCCGGCGCTCAGGCTATCACCCAGAATCAATATGTCGCTGCGGCGGCACGGAAGGTTAATGGGACCAGGGAAGGGCAAATGCCAGCGGAAAACATTGTTGAAGTTCATCATCTTAGAAGTCCGTCGGTCAGGGAGTATGAACTCTCATCCTCACCGGAGTTGAGCTGGTTGTCAAACGTGAGACCATCGCACTGGTGGGCGAGTCGGGATCGGTAAGAATCAACTGCTGGCGATCCTCGCCGGGCTTGATGACGGCAGCAGTGGCGAAGTGAGTCCGGTGGGACAACCGCCATAATATGGACGAAGGCGCGGGCAAAGTTGCGCGAAAGCACGTCGGCTTTGTTTTTCAGTCATTTATGTTAATTCCTACCTTAACGCGCTGGAAAACGTCGAGCTTCCAGCTGCTGCTGCGCGGTGAGTAAGCGCGGAAAGTCGTAACGGGGCGAAAGCGTTGCTCGAACAGTTAGGGCTGGGTAAACGTCTGGATCATCTTCCGGCACAGCTTTCCGCGGTGAACAGCAACGAAACTGGCACGAGCCTTTAATGGTCGACCTGATGTGTGCTGTTTGCCGACAACCCACCGGCAACCTTGACCGCCAGACGGGCGATAAAATTGCCGACCTGCTGTTTTCCTCAACCGTGAACATGGCACCACGTTGATTATGGTGACCCACGACCTGCAACTGGCGGCACGCTGCGACCGCTGCTTACGGCTGGTGAACGGGCAGTTGCAGGAGGAAGCATGATTGCACGTTGGTTCTGGCGCGAATGGCGTTAATTATTGTCTGGCTGGCGCTAAGCCTGGCGGTGGCCTGCGTGCTGGCGCTGGGCAATATCAGCGATCGCATGGAGAAGGGCTTAAGCCAGCAAAGCCGTGAGTTTATGGCGGGCGATCGGGCGTTGCGCAGTTCACGCGAAGTGCCGCAAGCGTGGCTGGAGGAAGCGCAAAGCGCGGCCTGAAAGTCGGCAAGCAGCTGACTTTCGCCACAATGACCTTTGCAGGCGACACACCGCAGCTGGCGAACGTCAAAGCGGTGGATGATATCTACCCGATGTATGGCGATCTGCAAACTAATCCCCTGGCCTGAAACCGCAGGCGGGCAGCGTATTGCTGGCCCCACGCCTGATGGCACTGCTTAACCTGAAAACGGGCGACACCATTGGCGTGGGCGATGCCACCTTGCGGATTGCCGGAGAAGTGATTCAGGAACCGGATTCCGGTTTTAACCCTTCCAGATGGCTCCGCGTCTGATGATGAATCTGGCGGATGTCGATAAAACCGGAGCCGTGCAGCCGGAAGTCAGGTCACCTGGCGTTATAAATTCCAGCAACAGCAGAACCAGCTCGACGGCTATGAAATGGTTGTTACCTCGGCTTAAACCCGAACAACGCTGGTACGGTCTGGAACAGGACGAAGGCGCGCTGGGGCGATCGATGGAACGCTCGCAACAGTTCCTGCTGCTTTCGGCGCTTCTGACCTTGCTGCTGGCAGTGGCAGCGGTGGCGGTAGCGATGAATCATTACTGTCGCAGTCGCTACGATCTGGTGGCGATCCTCAAAACGCTGGGGGCAGGGCGAGCGCAACTGCGTAAGCTAATCGTCGGTCAGTGGTTGATGGTGCTGACGCTTTCAGCCGTTACCGGTGGGGCCATAGGCCTGTTGTTCGAAAACGTGTTGATGGTGCTGCTCAAGCCCGTTCTGCCTGCTGCACTACCGCCAGCCAGCCTCTGGCCGTGGCTGTGGGCGCTTGGCACCATGACGGTCATCTCGCTGCTGGTGGGCTACGACCATATCGCTTGTTGCTGGCAACGCAGCCTTTACGCGTATTACGTAATGATGTGGTAGCGAACGTCTGGCCGCTGAAGTTTTATCTGCCGATTGTCAGTGTGGTGGTTGTGCTGCTGCTCGCCGGATTAATGGGTGGCAGCATGCTGCTTTGGGCGGTGCTGGCGGGCGCGGTAGTACTGGCTTTGCTGTGCGGTGTGCTGGGCTGGATGCTGCTGAATGTACTTCGCCGCATGACGCTGAAATCGCTGCCTCTGCTGGCGGCGGTTAGCCGCCTGTTACGTCAGCCGTGGTCAACGTTAAGTCAGCTTTCGGCATTTTCGCTCTCCTTTATGCTGCTGGCACTGCTGCTGGTGTTGCGTGGCGATCTGCTCGACCGCTGGCAGCAGCAGCTACTCAGCCCGAACTACTTTTTAATTAACATCGCCACAGAACAGGTAGCACCGCTAAAAGCGTTCCTCGCGGAACATCAGATAGTCCCGGAATCGTTTTATCCGGTGGTGCGGGCGCGGCTGACGGCGATTAACGATAAGCCGACAGAAGGTAATGAAGATGAGGCGCTTAACCGCGAACTCAATCTTACCTGGCAAAATACGCGGCCCGATCATAATCCGATTGTCGCCGGTAACTGGCCGCCAAAAGCCGATGAAGTGTCGATGGAAGAGGGGCTGGCGAAACGCTTAAACGTTGCCCTCGGTGATACCGTGACTTTTATGGGCGATACCCAGGAGTTCCGCGCTAAAGTGACCAGCCTGCGCAAAGTGGACTGGGAAAGTCTGCGGCCTAATTTCTATTTTATTTTCCCTGAAGGGGGCAGACGGGCAACCGCAGAGCTGGCTTACCAGTTTCCGCTGGGAGAATGGCAACGGCATGTTGACACAACTCAACCGCCAGTTCCCGACCATTAGCCTGTTAGATATTGGCGCGATTTTAAAAACAGGTCGGTCAGGTGCTGGAGCAGGTAAGTCGGGCGCTGGAAGTGATGGTGGTACTGGTCACCGCCTGCGGTATGTTGCTGTTGCTGGCACAGGTGCAGGTGGGAATGCGTCAGCGTCATCAGGAGCTGGTGGTGTGGCGCACACTCGGTGCGGGAAAAACTGCTGCGTACCACGTTGTGGTGTGAGTTCGCCATGCTTGGGTTTGTTTCCGGCCTGGTGGCCGCAATTGGTGCGGAAACGGCGCTGGCAGTGTTGCAGGCGAAAGTGTTTGATTTTCCGTGGGAGCCAGACTGGCGATTGTGGATTGTTCTGCCGTGCAGCGGAGCGCTGCTGCTGTCGCTTTGGCGGCTGGCTGGGTGCGCGACTGGTTAAGGGTAAGGCGCTGTTCAGGCAGTTTGCGGGGATGATAGAGTAGTAAGGGGCGTTCTGGTTGAATGGAACGCCTTGTTTAAATTAATTCTACAATATGTTTCATGATGATGTTTTGAATTGGTGATTTCCTATCTTTCTATTGCTGATATTATCTGAATCGGTGGAGTTTATTGATTTTAAATATAGCCCTACAAAAATAACTCAGACTAATAAAATCATAAATCATATGCGTTGAATGGATATTATCCATATAGTGAATTTGTTGATGATGAATTCATCTGTGCTAAAAATGTTAGTTTAATAAAATATTGAAAGTGACCTGTAATAACAGTTGTTGTTGATTGAGAACAAATAAGTTTATGTGAAAATATATAAATACATTAGCTGGTCTTGTGTGTCATTTTATTTTTGTTGCTAACACAGGGATATGAACAATAACTAAAGGGCACTTTATGAGCGGAAAACCAGCGGCGCGTCAGGAGATATGACTCAGTATGGCGGTCCCATTGTCCAGGGTTCGGCAGGTGTAAAATTGGCGCGCCCACCGGCGTGGCGTGCTCGGTGTGTCCGGGCGGGATGACTTCGGGCAACCCGGTAAATCCGCTGCTGGGGCGAAGGTGCTGCCCGGCGAGACGGACCTTGCGCTGCCCGGCCCGCTGCCGTTCATTCTCTCCCGCACCTACAGCAGCTACCGGACGAAGACGCCTGCACCGGTGGGCGTTTTCGGCCCCGGCTGAAAGCGCCTTCTGATATCCGCTTACAGCTACGTGATGACGGACTGATACTCAACGACAACGGCGGGCGGAGCATTCACTTTGAGCCGCTGCTGCCGGGAGGCGGTGTACAGCCGCAGTGAGTCAATGTGGCTGGTGCGCGGTGGTAAGGCAGCACAGCCGGACGGCCATACGCTGGCGCGGCTGTGGGGCGCTGCCGCCGGATATCCGGTTAAGCCCGCATCTTTACCTGGCGACCAACAGCGCACAGGGGCCGTGGTGATACTGGGGTGGTCTGAGCGGGTGCCGGGTGCTGAGGACGTACTGCCAGCGCCGCTGCCGCCGTACCGGGTGCTTACCGGGATGGCGGACCGCTTCGGGCGGACGCTGACGTACCGGCGTGAGGCCGCCGGTGACCGAAATCACCGGCGTGACGGACGGTGCCGGGCGGGAGTTCCGTCTGGTGCTGACCACGCAGGCGCAGCGTGCGGAAGAGGCCTCTTCGCTATCTTTCTGACAGTTCCCGCCCTCTCAGCCTCAGCGTTCCCCGACACCTGCCCGGTACCGAATACGGCCCCGACAGGGTATCCGCCTTTCGGCGGCTGATGCACGACCCATACCCGGAGAGCCTGCCCGCTGCGCCACTGGTGCGGTACACGTACGGAAGCCGGTGAACTGCTGGCGGTATATGACCGCAGCATACGCAGGTGCGCGCTTTCACGTATGACGCGCAGCACCCGGATGGTGGCGCACCGTTACGCGGGAAGGCCGGAGATGCGCTACCGCTACGACGATACGGGGCGGTGGTGGAGCAACTGAACCCGGCAGGGTTAAGCTACCGCTATCTTTATGAGCAGGACCGCATCACCGTCACCGACAGCCTGAACCGGCGTGAGGTGCTGCATACAGAAGGCGGGGCCGGGCTGAAACGGGTGGTGAAAAAGAACTGGCGGACGGCAGCGTCACGCGCAGCAGTATGACGCGGCAGGAAGGCTCACGGCGCAGACGGACGCGGCGGGACGGAGGACAGAGTACGGTCTGAATGTGGTGTCCGGCGATATCACGGACATCACCACACCGGACGGGCGGAGACGAAATTTTCAACGTGAGAGACCGGCAGGCGGCGGTGAACATCTGGACGGTGGAAACCTACCGGTCGATGAACCGGGCAGGCTGACATCCAGCGTAACGTGGGGAGATGAAACCACTTCGACGACGGTTCGCTGCCGAAGCGGGCGCCGCAATTAACCGGCC
+>f1b306de-8038-46af-b38f-7cf0d4c292ad id=87 clr=0,8198
+TTGGTATGCTTCGTTCAGTTACGTATTGCTTTTCTGTTGGTGCTGATATTGCGGCGTCTGCTTGGGTGTTTAACCTAATAAAAACACCAGCAATACGCCGGTTATCCGCCTGCACTCGGGTGCACCTCAGTGGCCTAAAAGTGATACCGGAAGGGTAGAATTCTGGCTGCAAAGATTTCGCAAAATCTGCGGGCGGGGTGTAAAAGTATAAAAATGGCAAAAGCCATGATTTAACTAATGTTTAGTATTAATTTAACTTTGTGTAACTTAATTACAGGATGAATGTAAATAAACCATCAATAAGCAAAAATAAGTGGTCGGATGAGTAGTAAAATTACACAAAAGGCGGTACTATTTTCATCAGATAAACAAATTCATTTTTCCGGTGCCATTCACCGGGTAGATACAAAGGGGAGAAAGTATGGAACTCTACAGAGAATATCCTGCATGGCTTATCTTTTTACGCCGTACTTATGCGGTTGCAGCGGGCGTTCTGGCGCTGCCTTTCATGCTTTCTGGAAAGACCGCGCCCGCTTTTACAGCTACCTGCATCGCGTCTGGTCGAAAACCAGCGATAAACCGGTGTGGATGGATCAGGCCGAAAAGGCAACTGGTGATTTTATTGATTGCTGAGTTTTGAATACATTGAAAACCGCCAGCGGAAACGCTGGCGGTTTTTATATCAGGAAGATGTTCAGAGGAATATTTAGACATCGTTATACCAATCGAAACATATATTCATGAAATATATATAAATATTTTCCTAATTGTTCTTATCTGACAGATATCTCACTTAAGGCTTTCTTATAAATCTGTAGGGTTTCGCCTGTCAGCAGACAAATAACCCGATAAAACAAGGATGAGCAGATGAGCGGAAAACCGGCGGCGCGTCAGGGCGACATGACGCAGTATGGCGGTAGCATTGTCCAGGGTTCAGCCGGGGTACGCATCGGTGCCCCACCGGCGTGGCCTGTTCGGTGTGCCCGGCGGTGACGTCCGGCCATCCGGTCAATCCGCTGCTCGGTGCAAAGGTCCTTCCCGGTGAAACCGACATCGCCCTGCCCGGCCCGCTGCCGTTCATTCTCTCCCACCTACAGCAGTTACCGGACAAAACGCCCGCGCCGGTGGGGAGCCTCGGCCCCGGCTGGAAAATGCCTGCGGATATCCGCTTACAGCTGCGCGATAACACACTGATACTCAGTGATAACGGCGGCAGAAGCCTGTATTTTGAGCACCTGTTTCCCGGTGAGGACGGTTACAGCCGCAGCGAGTCACTGTGGCTGGTGCGCGGCGGCGTGGCGAAACTGGATGAAGGTCACCGGCTGGCCGCACTCTGGCAGGCGCTGCCGGAAGAACTCCGCTTAAGTCCGCATCGTTATCTGGCGACAAACAGTCCGCAGGGGCCGTGGTGGCTGCTCGGCTGGTGTGAGCGGGTGCCGGAAGCGGATGAGGTGCTGCCTGCGCCGCTGCCGCCGTACCGGGTACTGACCGGGCTGGTGGACCGCTTCGGGCGCACACAGACGTTCCACCGCGAAGCCGCCGGTGAATTCAGCGGCGAAATCACCGGCGTGACGGATGGTGCCGGGCGTCACTTCCGGCTGGTACTGACCACGCAGGCGCAGCGGGCAGAAGAAGCCCGGCAGCAGGCCATTTCCGGCGGGACGGAACCGTCCGCTTTTCCTGATACCCTGCCGGGTTACACCGAATATGGCCGGGACAACGGCATCCGTCTGTCTGCCGTGTGGCTGACGCACGACCCGAATACCCGGAGAATTTACCTGCCGCGCCGCTGGTGCGCTATGGCTGGACGCCCGCGGCGAACTGGCGGCGGTGTATGACCGCAGCAATACACAGGTGCGCAGCTTTACTTACGATGATAAATACCGGGGCCGGATGGTGGCGCACCGTCACACGGGCCGACCGGAAATCTGTTACCGTTACGACAGCGACGGGCGGGTGACAGAACAGCTAAACCCGGCAGGCTTAAGTTACACGTATCAGTATGAGAAGGACCGCATCACCATCACCGACAGCCTGAACCGCCGTGAAGTCCTGCACACGCAGGGTGAAGGCGGGCTGAAGCGGGTGGTGAAAAGGAACACGCGGACGGCAGCGTCACGCAGAGTCAGTTTGACGCGGTGGGCAGGCTCAGGGCACAGACGGATGCCGCAGGCAGGACAACAGAATACAGTCCGGATGTGGTGACGGGCCTCATCACGCGCATCACCACGCCGGATGGCAGGGCATCGGCGTTTTACTATAACCACCACAGCCAGTTAACGTCAGCCACCGGGCCTGACGGGCTGGAAATACGCCGGGAATATGATGAATGGGGCCGTCTGATTCAGGAAACTGCCCCTGACGGCGATATCACCCGCTACCGTTATGATAATCCACACAGTGACTTACCCTGCGCAACGGAAGATGCCACCGGCAGCGGAAAACCATGACGTGGAGCCGTTACGGTCAGTTGCTGAGCTTCACTGACTGTTCCGGTTATGTAACCCGCTATGACCATGACCGTTTTGGTCAGGTGACGGCGGTGCACCGCGAGGAAGGGCTGAGTCAGTACCGCGCATACGACAGCCGTGGACAGTTAATTGCCGTGAAAGACACGCAGGGCCATGAAACGCGGTATGAATACAACGCCGCCGGTGACCTGACCACCGTCATTGCCCCGGACAGCAGAAACGGGACACAGTACGATGCGTGGGGAAAAGCCATCTGTACCACGCAGGGCGGTCTGACGCGCAGTATGGAATACGATGCTGCCGGACGGGTCATCCGCCTGACCAGTGAAAACGGCAGCCACACCACCTTCCGTTACGATGTACTCGACCGGCTGATACAGGAAACCGGCTTTGACGGCCGCACACAGCGTTATCACCACGACCTGACCGGCAAACTTATCCGCAGCGAGGATGAGGGGCTGGTCACCCACTGGCACTATGACGAAGCAGACCGCCTCACGCACCGCACCGTGAATGGCGAAACCGCAGAGCGGTGGCAGTATGACGAACGCGGCTGGCTGACAGACATCAGCCATATCAGCGAAGGGCACCGGGTGACGGTGCACTATGGTTATGACAGTAAAGGCCGCCTCGCCAGTGAACACCTGACGGTGCATCATCCGCAGACGAATGAACTGCTCTGGCAGCATGAGACCAGACATGCGTACAACGCACAGGGACTGGCGAACCGCTGTATACCGGACAGCCTGCCCGCCGTGGAATGGCTGACCTACGGCAGCGGCTGGCTGTCAGGCATGAAACTCGGCGACACACCGCTGGTGGAGTACACCCGCGACCGCCTGCACCGGGAAACGCTGCGCAGCTTCGGCCGTTATGAACTCACCACCGCTTATACCCTGCCGGGCAGTTACAGAGCCAGCACCTGAACAGCCTGCTGTCTGACCGCGATTACACCTGGAACGACAACGGCGAACTCATCCGCATCAGCAGCCCGCGCCAGACCCGGAGTTACAGCTACAGCACCACCGGCAGGCTGACCGGCGTTCACACCACCGCAGCGAATCTGGATATCCGCATCCCGTATACCACAGACCCGGCAGGTAACCGCCTGCCCGACCCGGAGCTGCACCCGGACAGCGCCCTCAGCATGTGGCCGGATAACCGTATCGCCCGTGACGCGCACTATCTTTACCGGTATGACCGTCACGGCAGGCTGACAGAAAACCGACCTCATCCCGGAAGGGTTATCCGCACGGATGATGAGCGCACCCACCGGTACCATTACGACAGTCAGCACCGGCTGGTGCACTACGCGGACACAATATGCAGAGCCGCTGGTCGAAAGTCGCTATCTTTACGACCCGCTGGGCCGCAGGGTGGCAAAACGGGTATGGCGGCGTGAACGGGACCTGACGGGCTGGATGTCGCTGTCACGGAAACCGCAAGTGACCTGGTACGGCTGGGACGGCGACCGCCTGACCACGATACAGAACGACAGAACCCGCATCCAGACGATTTATCAGCCGGGGAGCTTCACGCCACTCATCAGGGTTGAAACCGCCACCGGTGAGCTGGCGAAAACGCAGCGCCGCAGCCTGGCGGATACCCTTCAGCAGTCCGGTGGCGAAGACGGTGGCAGTGTGGTGTTCCCGCCGGTGCTGGTGCAGATGCTCGACCGGCTGGAAAGTGAAATCCTGGCTGACCGGGTGAGTGAGGAAAGCCGCCGCTGGCTGGCATCGTGCGGCCTGACGGTGGCGCAGATGCAAAGCCAGATGGACCCGGTATACACGCCGGCGCGAAAAATTCACCTGTACCACTGCGACCATCGCGGCCTGCCGCTGGCCCTATCAGCACGGAAGGGACAACAGCGTGGTACGCAGAATACGATGAATGGGGTAACCTGCTGAATGAAGAGACCCGCATCAGCTGCAGCAGCTTATCCGCCTGCCGGGGCAGCAGTATGATGAGGAGTCCGGCCTGTATTACAACCGCCACCGCTATTATGACCCGCTGCAGGGGCGATATATCACTCAGGATCCGATTGGGCTGAAAGGGGATGGAATTTTATCAGTATCCGTTGAATCCGATCTCAAATATAGATCCATTAGGATTAGAAACACTAAAATGCATTAAGCCACTGCATTCAATGGGCGGAACTGGTGAAAGAAGCGGTCCAGATATATGGGGAATCCGTTCTATCATCAATATCTTTGTGTCCCAGATGGTAAAGGGACTATACTTGTGGTGGCCAAGACCAACGGGGAGAATCAAAGGAGATGGTCTATGGGGGCCAGGTAAAGCAAGTAATGATACAAAGAAGCTGCTGGCCGTTGTGACCTCGTTGAAACCGATAATAGTTGTGTGGAGAACTGTTTAAAGGAAGTTTAAAGAGGTAAGGCCGCGTTATTCTGTATTGCCTGATATATTCACACCTATAAATTTAGGGCTATTTAAAACTGCCAAGACTGGTCTAATGATTCTTTAGAAACATGTAAGATGAAGTGCTCCGGAAATAACATTGGACGTTTTATTAGATTTGTATTCACCGGAGTGATGTAATGAAATATATTATTTTTTATTCAGAGCTATATGGCTGGCTTTATCGCTTTTAATACTATTCTTTTCCATGCATAGACTTTCACTATTAGACTCCACTCGTGATGTGAGCGAGTTAATTAGTCTCATGTCTTATGGAATGATGGTAATATGTTTTCCAACAGGCATAGTATTCTTTATTGCTCTAATATTTATAGGGACTGTATCAGACATTATTGGCGTAAGGTTGATAGTAAGTATATTATGGCGATAATAATATGGCTTTATTTTCTGTCAGGAGGGTATATTCAATGGTTTGTATTAAGTAAGCGCATTATAAACAAATAAATTAAGTTAATTGCTCTTATTATTATATGTAACCTGGGCATTGATATCCCGTATGCCACAGACCCGGCAGGTAACCGCCTGCCCGACCGGAGCTGCACCCGGACAGCACCCTCAGCATGTGGCCGGATAACCGTATCGCCCGTGACGCGCACTATCTTTACCGGTATGACCGTCACGGCAGGCTGACGGAAAACCGACCTCATCCGGAAGGGTTATCCGCACGGATGATGAGCGCACCCACCGGTACCATTACGACAGTCAGCACCGGCTGGTGCACTACACGCGGACACAATATGCAGAGCCGCTGGTCGAAAGCCGCTATCTTTACGACCCGCTGGGCCGCAGGGTGGCAAAACGGGTGTGGCGACGTGAACGGGACCTGACGGGCTGGATGTCGCTGTCACGGAAACCGCAAGTGACCTGGTACGGCTGGGACGGCGACCGCCTGACCACGATACAGAACGACAGAACCCGCATCCAGACGATTTATCAGCCGGGGAGCTTCACGCCACTCATCAGGTTGAAACCGCCACCGGTGAGCTGGCGAAAACAGCGCCGCAGCCTGGCGGATACCCTTCAGCAGTCCGGCGGCGAAGACGGTGGCAGTGTGGTGTTCCGCCGGTGCTGGTGCAGATGCTCGACCGGCTGGAAAGTGAAATCCTGGCTGACCGGGTGAGTGAGGAAAGCCGCCGCTGGCTGGCATCGTGCGGCCTGACGGTGGAGCAGATGCAAAACCAGATGGACCCGGTGTACACGCCGGCGCGAAAAATCCACCTGTACCACTGCGACCATCGCGGCCTGCCGCTGGCGCTTGTCAGCACGGAAGGGGCAACAGAATGGTGCGCAGAATACGATGAATGGGGCAACCTGCTGAATGAAGAGAACCCGCATCAGCTGCAGCAGCTTATCCGCCTGCCGGGGCAGCAGTATGATGAGGAGTCCGGCCTGTATTACAACCGCCACCGCTATTATGACCCGCTGCAGGGAGGTATATCACTCAGGATCCGATTGGGCTGAAGGGGATGGAATTTTATCAGTATCCGCTGAATCCGGTTCAGTATATAGATTCAATGGGACTGGCATCAAAATATGGACACTTAAATAATGGCGGATATGGGCGAGACCCAACAAACCGCCGCCCGATCCAAGTAAATTGCCGGACATAGCGAAACAATTAAGACTGCCATATCCTATTGACCAGGCCAGTAGTGCGCCTAATGTTTTCAAAACATTCTTCAGAGCATTAAGCCCTACGACTACACACTGTATTGCAGGAAGTGGGTAAAACCAAATCTGACTTGTACGCCACAGGATGATTCCCAGTATCCAGGGATGGATACAAAGACAGCAAGTGATTACCTGCCACAGACAAATTGGCCAACAACTCAATTACCACCAGGATATACTTGTGCAGAACCTATTTATTCCCAGACATTAATAAACCCGATGGGCCAGCAACAGCAGGGATAGATGATTTGGGTGAAATTTTAGCTAAGATGAACAGAGAACATCGAGAGGAATAAGAAAATGAAAAGAGTTTTGTTCTTTTTGCTGATGATATTTGTTAGTTTTGGTGTTATAGCTGATTGCGAAATACAAGCTAAAGATCATGATTGTTTTACTATTTTCGCTAAAGGGTACTATTTTTCCGCGTTTCCTGTCTTAAATAATAAAGCCATGTGGAGATGGTATCAGAATGAGGACATCGGTGAGTATTATTGGCAAACAGAACTGGGTACATGTAAAAATAATAAATTCACACCAAGCGGGGCGAGACTCTTAATTCGCGTCGGGTCACTACGCCTTAATGAAAATCATGCCATCAAAGGAACGTTGCAGGAGTTGATAAATACAGCAGAAAAACGGCGTTTCTCGGCGATCGGTTTAGAAGTTATATAAGAGCGGGTATCTATCAAAAGAGCAGTGATCCAGTTCAGTTGTTGGCAGTCCTTGATAATTCAATCATGGTAAAATATTTTAAAGATGAGAAACCAACTTATGCTCGAATGACAGCACATCTCCGAACAAAAATGAGTCTTACGAATGTTTAATAAAGATACAGCATGAACTAATTCGTAGTGAAGAGAAATAAAATCTCTTCCTGAGAAAACAAATTAATCATTGTGAAAAATTATATAACTCATGGAATAGGTGTTTATTTTGCGTTCCATTTGCAGGAAAGATCACGTAACGCTACTTTTTGTACTAAATAATTCGAATTTAAGTTCAACAATTGAGATACTACTTATTGTCTAAAGCTGTTTTTCATAGCTTATACATGATCAAATACTCCTTACATAAATAAGGTGAACAAATGGAACTTAAAAATTGATGGAACATATTTCTATTACACCCGATTACAGACAAGCCTGGAAAGTGGTGCATAAATTGTCAGATATTCTACTGTTTGACTATTTGTGCCGTTATTTCTGGTGCAGAAGGTTGGGAAGATATAAGAGGATTTCGGAAACACATCTCGATTTTTTGAAGCAATATGGTGATTTTGAAAATGGTATTCCTGTTCACGATACCATTGCCAGAGTTGTATCCCAGGAAAGATCACGTAACGCTACTTTTGTACTAAATAATTCGCATTTTATGTTTAAAAATTGAGATATTCCTTATTACCTAAAGCTGTTTTCATAGCTTATACATGATCAAATACTCCTTACATAAATAAGGTGAACAAATGGAACTTAAAAATTGATGGAACATATTTCTATTATTCCCGATTACAGATAAGCCTGGAAAGTAGAGCATAAATTGTCCAGGCATCAGTTGGGAAGATATAGAGGACGGGAAACACATCTCGATTTCAAGCAGATGCCGAAGATAGATTGCATT
+>f432cb50-8c47-4c54-825f-ab04a38b5225 id=88 clr=0,2356
+TCGGTACTTCGTTCGGTTACGTATTGCTTGCCTGTCGCTCTATCTTCGGCGTCTGCTTGGGTGTTTTAACCTCTGGCATTCGCCGGTCAGGCGGCCTTTATCGTCATAGCCATAGTGGACGGCAACACGGTGGCCTTCGCTCAATTGGCTGATGTCTGTCAGCCAGCCGTGGCCATCATACTGCCACTGCTCTGCCGGTTCGCCGTTCACCGTGCGGTGATGATACGGTCCGATTCATCGTAGTACCAGAGGATGACAAGTCCTCATCCTCACTCTGTGTGAGTTTTCCGGTCAGGTCATAATGATAACGTTGCGTCCGCCCGTCAAAGCCGCCGCCCTGCTGTACCAGCCGGTCCAGCGCATCGTAACTGAAGACGCTGTGGCTGCCGTTCTCGTTGGTCAGGCTGATGACACGTCCGGCAGCATCGTAATCCATACTGCGCGTCAGCCTGCGTGGTGCTGACCGCCTTTCCCCACGCATCGTACTGTGTCTCGCTCGGTTGCCGTCCGGGGTGATAACGGCAGTCAGGTCGCCTGCGGCGTTGTATTCATACCGCGTTTCACGGCCCTGTGCGTCTTTCACCGAGGTTAACCGGCCACGGTTGTCATAGCGGCGGTAAAGGCTGATGCCTTCCTCGCGGTGGACCGCCGTCATCATCTGGCCGAAGCGGTCGTATTCATAACGGGTCTGGTAGCCCGAGCAGTCGGTGAACGCCAGCAACGCTGCCGTAGCGGCTCCAGGTCATCTGCCGGTGCTGCCGTCGCATCCGTTGTCGTCGCCGGTAACTCACTGTGCGCGTCATCGTAGCGGTAGCGTACTGTCTCCCCGCTGCGCGATGTCTCCGATACCAGCCTGCCCGGTTCATCATATTCCGGCGGCTCTCCAGCCCGTCCGGGGACACCACCGCCGTCAGCTGGTTCCGTCGTTATAGTAAAATTTCGTCTCCCGCCCGTCCGGTGTGGTGATGTCCGTGATATCGCCGGACACCACATTCAGACCGTACTCTGTCCTCCGTCCCGCCGCGTCCGTCTGCGCCGTGAGCCTTCCTGCCGCGTCATACCGCTGCGCGTGACGCTGCCGTCCGCCAGTTCTTTTTCACCACCCGTTTCAGCCCGGCCCCGCCTTCTGTATGCAGCACCTCACGCCGGTTCAGGCTGTCGGTGACGGTGATGCGGTCCTGCTCATAAAGATAGCGGTAGCTTAACCCTGCCGGGTTCAGTTGCTCCACCACCCGCCCCGTATCGTCGTAGCGGTAGCGCATCTCCGGCCTTCCCGCGTAACGGTGCGCCACCATCCGGCCCGGGTGCTGCGCGTCATACGTGAAAGCGCGCACCTGCGTATTGCTGCGGTCATATACCGCCAGCAGTTCACCGGCTTCCGTATACGTGTACCGCACCAGTGGCGCAGCGGGCAGGCTCTCCGGGTATGCCGGGTCGTGCATCAGCCACACCGCCGAAAGGCGGATACCCTGTCGGGGCCGTATTCGGTACCGGGCGGTGTGTCGGGGAACGCTGAGGCTGAGAGGGGCGGGAACTGTCAGAAGAAGATAGCGAAGAGGTGTGGGCCTCTTCCGCACGCTGCGCCTGCGTGGTCAGCACCAGACGGAACTCCCGCCCGGCACCGTCCGTCACGCCGGTGATTTCCCGGCCAGGTCACCGGCGGCCTCACGCCGGTACGTCAGCGTCCGCCCGAAGCGGTCCGCCATCCCGGTAAGCACCCGGTACGGCAGCAGCGGCGCTGGCAGTACGTCCTCAGCACCCGGCACCCGCTCAGACCACCCCAGTATCACCACGGCCCTGTGCGCTGTTGGTCGCCAGGTAAAGATGCGGGCTTAACCGGATATCCGGCGGCAGCGCCCCCACAGCCGCGCCAGCGTATGGCCGTCCGGCTGTGCTGCCTTACCACCGCGCACCAGCCACATTGACTCACTGCGGCTGTACACCGCCTCCCCGGCAGCAGCGGCTCAAAGTGAATGCTCCGCCCGCCGTTGTCGTTGAGTATCAGTCCGTCATCACGTAGCTGTAAGCGGATATCAGAAGGCGCTTTCCAGCCGGGGCCGAAAACGCCCACCGGTGCAGGCGTCTTCGTCCGGTAGCTGCTGTAGGTGCGGGAGAGAATGAACGGCAGCGGGCCGGGCAGCGCAAGGTCCGTCTCGCCGGGCAGCACCTTCGCCCCCAGCAGCGGATTTACCGGGTTGCCCGAAGTCATCCCGCCCGGACACACCGAGCACGCCACGCCGGTGGGCGCGCCAATTCTTACACCTGCCGAACCCTGGACAATGGGACCGCCATACTGAGTCATATCTCTGACGCGCCGCTGGTTTAGGTTAAACACCCAAGACGCCGTATCGCCGCC
+>d57afb7d-903e-46cf-a43d-0e17fb0949d8 id=89 clr=0,9835
+TTGGTATGCTTCGTTCAGTTGCATGCCTGCTGCTTGCCTGTCGCTCTATCTTCGAGCGATCTCAGCGGGTGTTTAGCCTGCGTTAATGCCATTTACACACAATCCATCCACACATATTACGACCGCTGACACCTTCATGCCATTTTGGCGTTGATGTTCGGTGCGGCAAACAGCAGATCAGAACGGGCTGGTGGAAGCGTACATCCATAAAGGCGTGTTCATGCGTTTGTGCGGTATAACTGTTGCCTTCCAGTGTGGCTGTCTTTTATGAATTTGCCGAAGTCTGAAAGAAAACAGCTGTTGTTTGCTCACCAATTGCGCCAAGCAGAATACCGGATCGTTCTCTCATTAAAGATCCCAGCAACAGCAGCGAACAGTCCCGCCATCATCGAATAAACTGTTCATAGCCGACCCATGCTGAGTCAAACAGGATCGCCAGTCACACCGGATGACCCATTTTATCCACCATGGCGGGCGTTGCAAATCGTGCGTCGGCCAGGTTTAACTGAATCACCATGACGGAAGGACGAGCCTCACGCCCGCTGCGGTGCGACTTCCGCGATCGCTCACGCAAAGCCAGCTTTCTTTAAAACGGTGCGCATCCAGTACCACCGATAAAGCCATACGGGTTACATTACGTTTCCAGATAAACCCAAATTATTTTCAGCCTGGCAACACGCTCCGTGGTGGATTTACGTTGTGGTTGTGCGATCAAACAGCACCAGATCACGGTATTGGCAGGGCGTTAAAACCACTTTGTTTAGAAGATGAGTGCCATTTAAACGAAGTAGGTTTTATCGGCATTAAACACACCGCAGCTGTTGCTGTGCAATGCACGGCGCACCTTCGTGAATCAGCAGATCGCCCATCGCTACGTCGGCGTTGCTGGAATCGGCACGGAACAACTGCCTCACCAAAAGTATTCCCAAACTGATTCCCCACCACCGGATGGCGCTGGAAAATTCGCCCTGATGACCAGGGCAATCAAATGCCGCTGTTACCTTGGTTGACATAATCGATATGATGCGCCGGAAGAAAAGGTGGGCGCAGTTGGTTTCATAATGGCTGGCGGCGGTTTCCAGCTGGCGACCGCAAAATTCTCGATGCGTTCACCAGTTCTCAAAGACCCCGAAATAAGGGCAAATACTCTCACGGTGCGATTCTTGATTTTCAGTAGCAATAAATACGAAAGGATTACGCAACCGTGGCATCGATTTCATGTCGATTTTCGCATGCCAACATCGTTGGCGATAAAACTATTGCGCCATGCGATATTACGACTTTTTCGTAATGTAGATGCAATTCTCGCTGCGTGGTAAAACAGTCCGGGCCGCAAGAATCACTAACCTGCTTTTAATTTGTTGTTTTTCATCTCTTTAGTACAGGAGTAACGGTCATAATTTCTCAGATAGAAATCAGTCGATGCCGGAAAAAAGCAAATTCTTTCCCCGCTGATAAATAAATCAGAGTGGAGTGCTTTTTCAGAATGCGAGCCCTTACCAGTCAGGTGGCTGATAAATGCAAGGTTAACAGAGAGAATGAGCACCACGGAATACAGGCCTCACCTGCTAATACAGAGAGAGTCAGAAGGAAGACCTGTACGCTGAAGTGCCCTTAGTCCGGTGACTAACGGGCGATGAAGAAATGCTGAAGATCAAGCCCTATGCGTTAGGCAAACTTCATAATATGATTGTCACTTTGCTTATATGGGGCGCCAAATTGGCTGGTATTTTCCATTTAATTGCTTTCCTGAGTCTCTTGAATGAAGGTGAGAATATTCTATCCGGGAAGCTGAGTTTGAACCATGAAGGTGATCAATAAAAATGATCAATCTTAATTTATTTAATGATGAGCTTTTTACTCAGTAATATAAAATATTGAATTGTTATTTTGTGTGTTGTTGCAAGATAAAAGCCGTATTTTATTAATTGGCTTTAATTAATAAAAGAGCAGGCTGTATTAAAATTAATATTCAAAGCATAAACCGATGGCAATACCGGTTTCAATGCAATGAAATGGCGTGGGCGGGCGGGATCCTGTTCCAGTTTTTGTCGCAGATGTCCCATATAAATACGCAAATGGTGACTGTGTTCGACCGCGTTTGGCCCCCACACCTGGTTAAGGAGCTGGCGCTGGGTGAAATTACTTCCGGCATTGTTGAGCAGCACCGCCAGCAGGCGGAACTCAATTGGTGTGAGATGCACCTCTTCTCCCCGGTCTGAATCACGCGGGCGGCTAAATCGACGGTAACATCGGAAAATTTTACCAGCGGATCGGGCGCGGTGGTGGCAGAGTAGCGGCGTGTGCGACGCGCAGACGGGCCTGTTGCCAATGCCAAACGGCTTACTCAGATAATCATCCGCTCCGGCATCCAGCGCGGCGATTTTGTCGCTCTTCTGCTGCGTGCGGAAAGCAATCACCGGCACCGCGCTCCACTGGCGCAGGTCGCGGATAAACTCAATCCCATCACCATCGGGCAGGCCGAGATCGAGAATAATCAAATCTGGCTTACGGGTTGCCGCTTCCAGCAAGCCGCGTTGCAGCGTTTCGGCCTCAAAGACGCGCATCGCCCCTCCAGCGCCGTGCGCAGAAAGCGACGAATAGCCTGTTCATCTTCAACAATCAGAACGTTTGTCACATATCCTCATGAAATTCTTCAGTTCAGGGGCAGTTTGCTGGGGAAGTAACACGAAAACAGGCACCCACCTTCCGGTCGGTTGAACGCGGTAATAGTGCCCCCGTAGTACATCCACTATCGCCCGACAAATTGCCAGTCCAAGCCCTACCCCCGGTACTGCTCTTTTATTCCCGCGAGCAAACTTATCAAATATCGTCTGCTCCTGGCCTGGCGGAAGACCGGGGCCGTTATCCCAGACATCCAGTTGTAGATTTTCGCCCTCAACGTGGGCATCGATACCAATTTCGGCCTGCGCACCGCATATTTCACCGCGTTCTCCAGCAGATTAATCAGCACCCGTTCAAAAGAGGCCCGTCAACGTGGATTAAGGTCAGCGGTTCTGGCAGAGAAAGATTGATGGGCGACGATAAACCCGGTTCCAGCATTTGCAGCGCGCTGCCGACTACTTCTTCCAGCGTTAACCACTCTTTCTTCAAATTAAAGCCGCCGGACTGAATTCGCGCCATATCCAGTAGATTATTCACCAGTCGGGTAGTGTTCAGTTATGCTGACGGATCTCGCTGGCCTGGCGGGCGTGGGGTGATCTTCGCTTGCCAGATCGAGCGTTAAGATTTCTGCCTGACCAAACAGCACCGTAAGCGGCGTGCGTAAATCATGCGAAAGCGCCGCCAGCAGGGCGTTGCGGATCTGTTCACGTTCGCTTGCCATCCGCGCCTGTTCTTCGCTGGCGGTTAGCGTCAGCCGCTCAGGGCATTGGCGATAACAGCGTAACGTCTCCAGCAGGCGCTGCTGTTCCGGGATCATCAACTGGCGCAGATTCCCAGCTCCACCACCACCAGCCCGTAGGTTTTCGCCGCTTTTAGCGGCAAAATCTGGTACGGTACACCGGGTAACGTGTCGGTGCCGCGCCCGCAGGCAGGCCTTTATCAAAACTCCACTGCGCGATGGCATCGTCCCACGGCGTCATTCCTTGCGGATGTGTTAACGGCTGCAATTTACCGTTGTCATCGGGCAACAACACCTGACTGCGGGCATGAAACGTGGAGGCAATAAATTGTTCGCTGGTGGCAGCGATATCCTGCGGACTGCGGCCCACCGCCAGAGCTTTCGACATTTCATAAGTGCCGTGTGCGTTGCTCGCGGTAACGGGCTACCCGCGCCTGATAACGCACGCCAGCAGTAAGGTTCCCGATCACCAGCCCGACGGTTAACATCACCGCGAAGGTCAGCAGATATTGCACATCAGAGACGGCGAGCGTGCCGCGTGGGGCGATAAAAAGAGATCGAAACTCACTACATTAATGACGGTGGCAACCACTGAAGGCCAGCGTCCATAAAATAGCGCCACCACCACCACGCCAAGCAGATACAGCATCACCAGGTTGGCGGCATCAAACGCCATCAGCCACTGCATGGCAATTAAGGTGATAACGGCGCATAACGCGGCGGCAACCACGCATCCCTGAATTTGTACACGCCACTTGTCTTTAAAAGAGCGGTTATCCGGCGCGTTGTTAATCGTGCGGGCGGGTGGTTCATCAAGCGCGACCAGCACCTGATCGAGATCGGGGCGATGCGCGCCAGTCGGTCAGCAAACGTTTCCCGACGCCACCAGCGGCGCGAGGCCGGGCGACCGAGAATAATCTTGCCGAGATTATGTTCACGGGCATAACGCACTACCGCTTTCTCTTCCGCTGGATCAGAAAGTGTTGCCGTCTCCGCGCCCAGTTCCTGCGCCAGACGTAAGGCGCTGAGAATTGACGTTTTTTCCGGTAAGCGGTGCAGGGCAGGGGTTTCAACATACACCGCGTGCCAGACGCTACCAGCCGTGACGCCAGCCGCGCCGCTGCGCGGACCAGTTTTCGCTGCCGGTGTTATGGCCGATGCATAAAAGGATCGCGTCGCGCGTGTGCCACTTTCTCTTCGCCAGGATGCCCCGCCAGGCGCGCATTTGCTCATCAACGCGATCGGCAGTACGGCGCAGTGCCAGTTCGCGCAGGGCGATCAGATTACCTTTGCGGAAAAATGTTCAATGGCGCGCTCCGCCTGCCCGGCAATATAGACTTTGCCTTCTTTCAGCCGCTGGCGCAGATCGTCCGGGGCAAGTCCACCAGCACCACGTCGTCGGCGGCATCGAAAAGGATCGGGCACGGTTTCCCGTACCTGAATTCCGGTGACGCCGCTGACCACATCATTCAGACTTTCCAGATGCTGAACGTTGACGGTAGTGAAAACATCAATGCCAGCTTCCAGCAGTTCTTCGATATCCTGCCAGCGTTTGGGATGACGGGAACCTGGCGCATTACTGTGCGCCAGTTCGTCCATTAAGATCAGCGCCGGGCGGCGGGCGAGGGCGGCATCGAGATCAAACTCGCTGATATGCCGCCCACGGTACGCCTGGCGTTTTAACGGCAGAACAGCCAGCCCTTCCAGCATGGCGGCGGTATCTTTTCGCCCGTGGGTTTCTACCACGCCAACCACAATATCCAGCCCTTGCGCCCGCAGTCGCTGGGCTTCTGCCAGCATCGCCCAGGTCTTCCCGCGCCTGCACAGGCACCGAAGAAAACTTTCAGCTTCCCCGATGCGGCGCGGCAGTTTGTTCCAGCAGACGATCGGGGTCGGGACGTAAGGGTTCGTTATTCATCAAGTTTATCCAGCGCCAGATTGAGTTCAACAATGTTGACAACCGGCTGGCCGATATATTTCACCAGCGGTTGTTGGCTGTATTTTGCGATCAGTTGCGTGAGCTGTTCAACGCTGAGATTACGCGCTTTCGCCACGCGTGGGATTTGCCAGGCCGCCGCTTGCGGGTGATATTATTGTCCAGCCCGCTTGCCGATGCCGTCACCAGTTCAACCGGAACGCTCGCGCTGGCATCCGGGTTAGCGGCCCGTAATGCAGCAACGCGTGCGGCTATTAGTTTATCCAGCTCAGGGTTACTGACCGCCAGATTGCTCCCGCCAGAAGCCTGTGGATTATAGGGCATTTCTGCCGTTGCCGACGGGCGACCATGAAAATAGCCGTTGCCGGTAAAATTCTGCCCGATTAATGCCGAACCGCGCACCGTATCACCTTCACGAATCAACGAACCATTGGCCTGCCAGGAAACCACCATTGCCCCAGTACGGTGGTCAGCGGCGGGTAAACGCCGCCAGTAATCAATAACAGAAAGATAAATGTTGATAATGCCGGACGTAATCCACTCATGGTAAACCTCACCAGACCGCAAACGGTCAGCAGTAAATCAATGACTTTGATACCGATAAACGGCACCAGCAGCCCGACCGTAAATCCATAAGTTACGGCGCAACATGGCAGAAGCGGTAAGCGGTTTATAACTCACGCCTTTAACGCCAGGGGAATCAAAGACGATAATCAAGGCGTTGAAAATCACCGCACTGAGGATTGCGGAGTCGGGCGAATGCAGGCACATGATGTTCAGCGCATTTAACTGCGGATACGTTGCCGCGAATGCCGCCGGAATAATGGCGAAGTATTTCGCCACATCGTTGGCAATGCTGAAGGTGGTCAGCGAGCCACGGGTCATCAGCATCTGTTTGCCAATGTGCACCACCTCGATCAACTTGGTCGGGTTAGAGTCGAGATCGACCATATTGCCCGCCTCTTTCGCCGCCTGGGTGCCGGAGTTCATCGCCACCGCGACATCTGCCTGCGCCAGCGCCGGAGCATCGTTGGTGCCGTCGCCGGTCATCGCTACCAAACGACCTTCCGCCTGATACTGACGGATCAATGCCAGCTTGGCCTCCGGTGTCGCTTCGGCGAGAAAATCATCGACACCCGCTTCCGCAGCAATCGCGGCGGCAGTCAGACGGTTATCGCCGGTAATCATCACCGTTTTAATGCCCATTTTGCGCAGCTGGGCGAAGCGCTCTTTAATACCGCCTTTGACGATATCTTTCAGCGCAATAACGCCCAGCACACGAGAACCTTCCACCACCACCAGCGGCGTGGCTCCCTGACGCGCAACCTGATCGACTTTTTGATCAACATCGGTAGGGAAGTGACCACCGTTAGCCTCAACATGGCGACGAATGGCATCGACAGAACCTTTACGGATCATGCGGTTGTCGATGTTGATCCCGCTCATCCGGCTTTGCGCAGTAAACGGTACAAAGGTGGCATGGAGCGACTGCATCGCGCTCGCGCAGGTTAAAACGCTGCTTGGCGAGGATCACAATACTGCGGCCTTCCGGCGTTTCATCAGCCAGCGAAGCCAGTTGTGCGGCGTCAGCCAGCGTTTTCATCCACGCCCTGCGCGGGATAAACTCCGACGCCTGACGGTTACCGAGTGTGATGGTGCCGGTTTTATCCAGTAGCAGAACGTCAACGTCACCTGCCGCTTCAACTGCACGTCCGCTGGTGGCAATCACATTCGCGCCTAGCATCCGGCTCATCCCGGCGACGCCGATCGCTGACAACAGGCCGCCAATAGTGGTTGGGATCAGACAGACCAGCAGCGCCACCAGTACCGTTACGCTGACTGCATTACCGCCCCGCGGAAAACGGCCACAGCGTGGCGGTTGCCAGTAAAAGACGATAGTCAGGGCAATCAGCAGAATGGTCAGGGCAATTTCGTTCGGCGTTTTGCGTCGCTGTGCGCCTTCCACCATCGCGATCATCCGATCCAGAAATGTCTCGCCGGGGTTAACGCTACACTCAATCACCAGCCAGTCAGAAAGAATACGCGTGCCGCCGGTGACGGAGGCAAAATCGCCGCCGGATTCACGGATCACCGGTGCCGATTCCCCGGTGATGGCGCTTTCATCGACCGATGCCCCCTTCAATAACTTCACCATCGCAGGGATAATATCGCCAGCTTCTACCAGTACGATATCGCCTTTACGAAGTTGGTCGGCAGGAACTTTGTCCGCCGCAGCGCCATATTTCGGCTCACGCAGCTTGCGGGCAAAGGCAGTTTTTCACCCTTTCAGACTGTTGGCCTGCGCTTTACTGCGGCCTTCTGCCAGCGCCTCGGCGAAATTAGCGAACAGTACGGTGATCCACAGCCAACCGCTAATGGCCGCGCTAAACAGCGCATTGCCGGGCATCGCACCGCTTGCCATCGCGATGCTAATACAGGTGGTCAGCAGACTGCCGATCCAGACGATAAACATCACCGGATTGCGCCATTGCGCCTGCGGGTTTAATTTTTCACCGCTTCTTTCAGCGCCTGAACGACAAGTGTTGGTTCGAATAGCGCCAGTTGTTTACGACTCATATTCAGTGCTCACTCAATATCATCAGGAGATATTCCGCCACCGGACCAAGCGCCAGGGCAGGGATAAAGGTCAGTGCGCCAACCAGCAACACGGTGCCGATTAACAGGCCAACAAACAGCGGGCCGTGCGTTGGCAGCGTGCCGGAGCTGGCGGCTTGGCTCTTTTACTCACCAGCGAACCGGCAATTGCCATCACCGGGATAATCACCCCGAAGCGACCGACAAACATGCAGAACGCCAGTAAACAGTTCCAGAACGGAGAGTTGGCGCTTAATCCGGCAAAGGCGCTGCCGTTGTTGTTAGCGGCGGATGACACGGCGTACAGCACTTCGCTAAAACCATGCGGGCCAGGGTTGAGCATGGCGCTACGTCCGGCGTCGGTCATCATCGCCAACGCCGCGCCCATCAGCACCAGCGTCGGGGTAACCAGAATTGCCAGTGCAGTCAGTTTCATCTCGCGTACGTCGATTTTTACCCAGATATTCCGGTGTACGACCAATCATCAGCCCGGCAATAAACACCGCCAGCAGGACAAACAGCATCATGCCGTAAAGACCAGAACCGACACCGCCGAACACCACTTCACCAATTTGCATCAGCCACATCGGCACCATGCCACCGAGAGCGGTAAACGAATCATGCATCGCAATCACCGCGCCACAGGAAGCCGCCGTCGTCACGACCGCAAACAGGCTACTGACCAGCACGCCGAAACGGCTCTCTTTACCTTCCATATTGATGCTGCTGTCCGTGCCCAGTGCCAGCAGATGAGGATTACCCTGAACTTCTGCCCACATCACCACGCCTACGCAGATGACAAAATCACTGACATCGCCCACAGCAACATGCGCCCTGGCGGCGATCGCCCATCACTTCACCAAAGGCAAAGCACAGCGCCGTTGGGATCAAGAAGATCGCCAGCATCTGCACGAAGTTGGTCAGTGCGGTTGGGTTTTCAAACGGATGCGACGAGTTGGCATTAAAGAAGCCACCGCCGTTAGTACCGAGCATCTTGATCGCTTCCTGAGAAGCTACAGGCCCCATGGGTAACAGCTGTTGCGCTCCTTCAACGGTATTCACAGCCTGATAAGGCAGAAAGTTTTGCAGCGCACCTTGTTGAATAAAAACAGTGCAATCAACAACGCCACAGGGACTAGCACCCATAACGTGATGCGTAGCAGATCGACCCAGGCATTCCCGAGCGTGCTCATGCTCTGGCGGGTAAACGCACGGATGAGGGCAAAATCACCGCAATCCCGCTGGCGGCAGAAGAAAGTTTTGCACCGTTAAGCCCGCCATCTGGCTGAAATAGCTCAACGTGGTTTCACCGCTATAAGATTGCCAGTTGGTATTGGTGACAAAGCTGACGGCGGTATTCAGCGCCAGATCCCACGACAGCCCTGGCAACTGCTGTGGATTAAGCGGCAGATAGTGCTGACCGAGCAACATAAAAACAGCACCGCCAGCCCCAGCATGTTCAGGCCGAGAATGGCACAAAGATATTGCTTCCAGTTCATCTCACGGTCAGAGACGCCAAGTGCGCGAAAAAGTACGCGCTCAACGCCCGTTGTACCGGGAAGAGGAATGTCATTAATCAGCCGCGCCAGCCCGCTGCCTAAAGGACGCGCCAGCACCATTAACACCAGTAAAAACGTGGCGATCAGTAAGAACCCTTGCGCAGCCATCAGAACGCCTCCGCATTGATCAGGGCATAAACCAGATAACCCAGTAATAAAACACCAGCAATACGCCGGTTATCACGCCTGCACTCACAGTGCACCTCCAGTGGCCTAAAAGTGATACCGGAAGGGTAGAATTCTGGCTGCAAAGATTTCGCAAAATCTGCGGGCGGGGTGTAAAAAGTATAAAAATGGCAAAAGCCATGATTTAACTAATGTTTGTAGTAATGAATTTAAGGTTCGCTTACCCAAGCAGACGCCAGAAGATGGAGCACCGCC
+>f51c19c0-2613-48a7-a9a1-ec59658cbd2d id=90 clr=0,3527
+TTCGTTATACTTCGTTCAGTTACGTATTTAGCCTGCTCATCTTCGGCGTCTGGCAGGTGTTTTTAACCGATGCGTACTGGCTGAACCCTGGACAATGCTACCGCCATACTGCGTCATGTCGCCCTGACGCGCCGCCGGTTTCCGCTCATCTGCTCATCCTTGTTTTATCGGGTTATTTGTCTGCTGACAGGCGAAACCCTACAGATTTATAAGAAAGCCTTAAGTGAGATATCTGTCAGATAAGAACAATTAGGAAAATATTTATATATGTTCGCATGAATATATGTTTCGATTGGTATAACGATGTCTAAATATTCCTCTGAACATCTTCCTGATACAAAAACCGCCAGCGTTTCCGCTGGCGGTTTTCAATATTCAAAACTCAGCAATCAATAAAATCACCAGTTGCCTTTTCGGCCTGATCCATCCACACCGGTTTTATCGCTGGTTTTCGACCAGACGCGATGCAGGTAGCTGTAAAAGCGGGCGCGGTCTTTCCAGAAAAGCATGAAAGGCAGCGCCAGAACGCCCGCTGCAACCGCATAAGTACGGCGTAAAAGATAAGCCATGCAGGATATTCTCTGTAGAGTTCCATACTTTTCTCCCCTTTTGTATCTACCCGGTGAATGGCACCGGAAAAATGAATTGTTTATCTGATGAAAATAGTACCGCCTTTTGTGTAATTTTACTACTCATCCGACCACTTATTTTTGCTTATTGATGGTTTATTTACATTCATCCTGTAATTAAGTTACACAAAAGTTAAATTAATACTAAACATTAGTTAAATCATGGCTTTTGCCATTTTTATACTTTTACACCCCGCCCGCAGATTTTTGCGAAATCTTTGCAGCCAGAATTCTACCCTTCCGGTATCACTTTTAGGCCACTGGAGGTGCACTGTGAGTGCAGGCGTGATAACCGGCGTATTGCTGGTGTTTTATTATTACTGGGTTATCTGGTTTATGCCTGATCAATGCGGAGGCGTTCTGATGGCTGCGCAAGGGTTCTTACTGATCGCCACGTTTTTACTGGTGTTAATGGTGCTGGCGCGTCCTTTAGGCAGCGGGCTGGCGCGGCTGATTAATGACATTCCTCTTCCCGGTACAACGGGCGTTGAGCGCGTACTTTTTCGCGCACTTGGCGTCTCTGACCGTGAGATGAACTGGAAGCAATATCTTTGTGCCATTCTCGGCCTGAACATGCTGGGGCTGGCGGTGTTTTTTATGTTGCTCGGTCAGCACTATCTGCCGCTTAATCCACAGCAGTTGCCAGGGCTGTCGTGGGATCTGGCGCTGAATACCGCCGTCAGCTTTGTCACCAATACCAACTGGCAATCTTATAGCGGTGAAACCACGTTGAGCTATTTCAGCCAGATGGCGGGCTTAACGGTGCAAAACTTTCTTTCTGCCAGCGGGATTGCGGTGATTTTGCCCTCATCCGTGCGTTTACCCGCCAGAGCATGAGCACGCTCGGGAATGCCTGGGTCGATCTGCTACGCATCACGTTATGGGTGCTAGTCCTGTGGCGTTGTTGATTGCACTGTTTTTATTCAACAAGGTGCGCTGCAAAACTTTCTGCCTTATCAGGCTGTGAATACCGTTGAAGGAGCGCAACAGCTGTTACCCATGGGGCCTGTAGCTTCTCAGGAAGCGATCAAGATGCTCGGTACTAACGGCGGTGGCTTCTTTAATGCCAACTCGTCGCATCCGTTTGAAAACCCAACCGCACTGACCAACTTCGTGCAGATGCTGGCGATCTTCTTGATCCCAACGGCGCTGTGCTTTGCCTTTGGTGAAGTGATGGGCGATCGCCGCCAGGGGCGCATGTTGCTGTGGGCGATGTCAGTGATTTTGTCATCTGCGTAGGCGTGGTGATGTGGGCAGAAGTTCAGGGTAATCCTCATCTGCTGGCACTGGGCACGGACAGCAGCATCAATATGGAAGGTAAAGAGAGCCGTTTCGGCGTGCTGGTCAGTAGCCTGTTTGCGGTCGTGACGACGGCGGCTTCCTGTGGCGCGGTGATTGCGATGCATGATTCGTTTACCGCTCTCGGTGGCATGGTGCCGATGTGGCTGATGCAAATTGGTGAAGTGGTGTTCGGCGGTGTCGGTTCTGGTCTTTACGGCATGATGCTGTTTGTCCTGCTGGCGGTGTTTATTGCCGGGCTGATGATTGGTCGTACACCGGAATATCTGGGTAAAAATCGACGTACGCGAGATGAAACTGACTGCACTGGCAATTCTGGTTACCCCGACGCTGGTGCTGATGGGCGCGGCGTTGGCGATGATGACCGACGCCGGACGTAGCGCCATGCTCAACCCTGGCCCGCATGGTTTTAGCGAAGTGCTGTACGCCGTGTCATCCGCCGCTAACAACAACGGCAGCGCTTTGCCGGATTAAGCGCCAACTCTCCGTTCTGGAACTGTTTACTGGCGTTCTGCATGTTTGTCGGTCGCTTCGGGGTGATTATCCCGGTGATGGCAATTGCCGGTTCGCTGGTGAGTAAAAGAGCCAAGCCGCCAGCTCCGGCACGCTGCCAACGCACGGCCCGCTGTTTGTTGGCCTGTTAATCGGCACCGTGTTGCTGGTTGGCGCACTGACCTTTATCCCTGCCCTGGCGCTTGGTCCGGTGGCGGAATATCTCTGATGATATTGAGTGAGCACTGAATATGAGTCGTAAACAACTGGCGCTATTCGAACCAACACTTGTCGTTCAGGCGCTGAAAGAAGCGGTGAAAAATTAAACCCGCAGGCGCAATGGCGCAATCCGGTGATGTTTATCGTCTGGATCGGCAGTCTGCTGACCACCTGTATTAGCATCGCGATGGCAAGCGGTGCGATGCCCGGCAATGCGCTGTTTAGCGCGGCCATTAGCGGTTGGCTGTGGATCACCGTACTGTTCGCTAATTTCGCCGAGGCGCTGGCAGAAGGCCGCAGTAAAGCGCAGGCCAACAGTCTGAAAGGGGTGAAAAAACTGCCTTTGCCCGCAAGCTGCGTGAGCCGAAATATGGCGCTGCGGCGGACAAAGTTCCTGCCGACCAACTTCGTAAAGGCGATATCGTACTGGTAGAAGCTGGCGATATTATCCCCTGCGATGGTGAAGTTATTGAAGGGGTGCATCGGTCGATGAAAGCGCCATCACCGGGGAATCGGCACCGGTGATCCGTGAATCCGGCGATTTTGCCTCCGTCACCGGCGGCACGCGTATTCTTTCTGACTGGCTGGTGATTGAGTGTAGCGTTAACCCCGGCGAGACATTTCTGGATCGGATGATCGCGATGGTGGAAGGCGCACAGCGACGCAAAACGCCGAACGAAATTGCCCTGACCATTCTGCTGATTGCCCTGACTATCGTCTTTTACTGGCAACCGCCACGCTGTGGCCGTTTTCCGCGTGGGGCAATGCAGTCAGCGTAACGGTACTGGTGGCGCTGCTGGTCTGTCTGATCCCAACCACTATTGGCGGCCTGTTGTCAGCGATCGGCGTCGCCGGGATGAGCCGGATGCTAGGCGCGAATGTGATTGG
+>fea3d3b3-af6c-451a-b862-6043d17ec775 id=91 clr=0,5770
+TTGTTGTGCTTCGTTCGGTTACGTATTGCTACCCTGTCGCTCTATCTTCGGCGTCTGCTTGGGTGAACAACCGCAGCTGATGCGGGTTCTCTTCATTCAGCAGGTTGCCCCATTCATCGTATTCTGCGCACCATTCTGTTGCCCCTTCCGTGCTGACAAGCGCCAGCGGCAGGCCGCGATGGTCGCAGTGGTACAGGTGGATTTTTCGCGCCGGCGTGTACACCGGGTCCATCTGGTTTTGCATCTGCTCCACCGTCAGGCCGCACGATGCCAGCCAGCGGCGGCTTTCCTCACTCACCCGGTCAGCCAGGATTTCACTTTCCAGCCGGTCGAGCATCTGCACCAGCACCGGCGGGAACACCACACTGCCACCGTCTTCGCCGCCGGACTGCTGAAGGGTATCCGCCAGGCTGCGGCGCTGCGTTTTCGCCAGCTCACCGGTGGCGGTTTCAACCTGATGAGTGGCGTGAAGCTCCCCGGCTGATAAATCGTCTGGATGCGGGTTCTGTCGTTCTGTATCGTGGTCAGGCGGTCGCCGTCCCAGCCGTACCAGGTCACTTGCGGTTTCCGTGACAGCGACATCCAGCCCGTCAGGTCCCGTTCACGTCGCCACACCCGTTTTGCCACCCTGCGGCCCAGCGGGTCGTAAAGATAGCGGCTTTCGACCAGCGGCTCTGCATATTGTGTCCGCGTGTAGTGCACCAGCCGGTGCTGACTGTCGTAATGGTACCGGTGGGTGCGCTCATCATCCGTGCGGATAACCCTTCCGGGATGGTCGGTTTTCTCCGTCAGCCTGCCGTGACGGTCATACCGGTAAAGATAGTGCGCGTCACGGGCGATACGGTTATCCGGCCACATGCTGAGGGTGCTGTCCGGGTGCAGCTCCGGTCGGGCAGGCGGTTACCTGCCGGGTCTGTGGCATACGGGATATCAATGCCCAGGTTACATATAATAAGAGCAATTAACTTAATTTATTTGTTTATAATGCGCTTACTTAATACAAACCATTGAATATACCCTCCTGACAGAAAATAAAGCCATATTATTATCGCCATAATATACTTACTATCAATCCTTACGCCAATAATGTCTGATACAGTCCCTATAAATATTAGAGCAATAAAGAATACTATGCCTGTTGGAAAACATATTACCATCATTCCATAAGACATGAGACTAATTAACTCGCTCACATCACGAGTGGAGTCTAATAGTGAAAGTCTATGCATGGAAAAGAATAGTATTAAAAGCGATAAAGCCAGCCATATAGCTCTGAATAAAAAATAATATATTTCATTACATCACTCCGGTGAATACAAATCTAATAAAACGTCCAATGTTATTTCCGGAGCACTTCATCTTACATGTTTCTAAAGAATCATTAGACCAGTCTTGGCAGTTTTAAATAGCCCTAAATTTATAGGTGTGAATATATCAGGCAATACAGAATAACGCGGCCTTACCTCTTTAAACTTCCTTTTAAACAGTTCTCCACACAACTATTATCGGTTTCAACGAGGTCACAACGGCCAGCAGCTTCTTTGTATCATTACTTGCTTTACCTGGCCCCCATAGACCATCTCCTTTGATTCTCCCCGTTGGTCTTGGCCACCACAAGTATAGTCCCTTTACCATCTGGGACACAAAGATATTGATGATAGAACGGATTCCCCATATATCTGGACCGCTTCTTTCACCAGTTCCGCCCATTGAATGCAGTGGCTTAATGCATTTTAGTGTTTCTAATCCTAATGGATCTATATTTGAGATCGGATTCAACGGATACTGATAAAATTCCATCCCCTTTCAGCCCAATCGGATCCTGAGTGATATATCGCCCCTGCAGCGGGTCATAATAGCGGTGGCGGTTGTAATACAGGCCGGACTCCTCATCATACTGCTGCCCCGGCAGGCGGATAAGCTGCTGCAGCTGATGCGGGTTCTCTTCATTCAGCAGGTTACCCCATTCATCGTATTCTGCGTACCACGCTGTTGTCCCTTCCGTGCTGATAGGGCCAGCGGCAGGCCGCGATGGTCGCAGTGGTACAGGTGAATTTTTCGCGCCGGCGTGTATACCGGGTCCATCTGGCTTTGCATCTGCGCCACCGTCAGGCCGCACGATGCCAGCCAGCGGCGGCTTTCCTCACTCACCCGGTCAGCCAGGATTTCACTTTCCAGCCGGTCGAGCATCTGCACCAGCACCGGCGGAACACCTGCCACCGTCTTCGCCACCGGACTGCTGAAGGGTATCCGCCAGGCTGCGGCGCTGCGTTTTCGCCAGCTCACCGGTGGCGGTTTCAACCCTGATGAGTGGCGTGAAGCTCCCCGGCTGATAAATCGTCTGGATGCGGGTTCTGTCGTTCTGTATCGTGGTCAGGCGGTCGCCGTCCCAGCCGTACCAGGTCACTTGCGGTTTCCGTGACAGCGACATCCAGCCCGTCAGGTCCCGTTCACGCCGCCATACCCGTTTTGCCACCCTGCGGCCCAGCGGGTCGTAAAGATAGCGACTTTCGACCAGCGGCTCTGCATATTGTGTCCGCGTGTAGTGCACCAGCCGGTGCTGACTGTCGTAATGGTACCGGTGGGTGCGCTCATCATCCGTGCGGATAACCCTTCCGGGATGAGGTCGGTTTTCTCTGTCAGCCTGCCGTGACGGTCATACCGGTAAAGATAGTGCGCGTCACGGGCGATACGGTTATCCGGCCACATGCTGAGGGCGCTGTCCGGGTGCAGCTCCGGTCGGGCAGGCGGTTACCTGCCGGGTCTGTGGTATACGGGATGCGGATATCCAGATTCGCTGCGGTGGTGTGAACGCCGGTCAGCCTGCCGGTGGTGCTGTAGCTGTAACTCCGGGTCTGGCGCGGGCTGCTGATGCGGATGAGTTCGCCGTTGTCGTTCCAGGTGTAATCGCGGTCAGACAGCAGGCTGTTCAGGTGCTGGCTCTGTAACTGCCCGGCAGGGTATAAGCGGTGGTGAGTTCATAACGGCCGAAGCTGCGCAGCGTTTCCCGGTGCAGGCGGTCGCGGGTGTACTCCACCAGCGGTGTGTCGCCGAGTTTCATGCCTGACAGCCAGCCGCTGCCGTAGGTCAGCCATTCCACGGCGGGCAGGCTGTCCGGTATACAGCGGTTCGCCAGTCCCTGTGCGTTGTACGCATGTCTGGTCTCATGCTGCCAGAGCAGTTCATTCGTCTGCGGATGATGCACCGTCAGGTGTTCACTGGCGAGGCGGCCTTTACTGTCATAACCATAGTGCACCGTCACCCGGTGCCCTTCGCTGATATGGCTGATGTCTGTCAGCCAGCCGCGTTCGTCATACTGCCACCGCTCTGCGGTTTCGCCATTCACGGTGCGGTGCGTGAGGCGGTCTGCTTCGTCATAGTGCCAGTGGGTGACCAGCCCTCATCCTCGCTGCGGATAAGTTTGCCGGTCAGGTCGTGGTGATAACGCTGTGTGCGGCCGTCAAAGCCGGTTTCCTGTATCAGCCGGTCGAGTACATCGTAACGGAAGGTGGTGTGGCTGCCGTTTTCACTGGTCAGGCGGATGACCCGTCCGGCAGCATCGTATTCCATACTGCGCGTCAGACCGCCCTGCGTGGTACAGATGGCTTTTCCCCACGCATCGTACTGTGTCCCGTTTCTGCCGTCCGGGGCAATGACGGTGGTCAGGTCACCGGCGGCGTTGTATTCATACCGCGTTTCATGGCCCTGCGTGTCTTTCACGGCAATTAACTGTCCACGGCTGTCGTATGCGCGGTACTGACTCAGCCCTTCCTCGCGGTGCACCGCCGTCACCTGACCAAAACGGTCATGGTCATAGCGGGTTACATAACCGGAACAGTCAGTGAAGCTCAGCAACTGACCGTAACGGCTCCACGTCATGGTTTTCCGGCTGCCGGTGGCATCTTCCGTTGCGCAGGGTAAGTCACTGTGTGGATTATCATAACGGTAGCGGGTGATATCGCCGTCAGGGGCAGTTTCCTGAATCAGACGGCCCCATTCATCATATTCCCGGCGTATTTCCAGCCCGTCAGGCCCGGTGGCTGACGTTAACTGGCTGTGGTGGTTATAGTAAAACGCCGATGCCCTGCCATCCGGCGTGGTGATGCGCGTGATGAGGCCCGTCACCACATCCGGACTGTATTCTGTTGTCCTGCCTGCGGCATCCGTCTGTGCCCTGAGCCTGCCCACCGCGTCAAACTGACTCTGCGTGACGCTGCCGTCCGCGTGTTCCTTTTCACCACCCGCTTCAGCCCGCCTTCACCCTGCGTGTGCAGGACTTCACGGCGGTTCAGGCTGTCGGTGATGGTGATGCGGTCCTTCTCATACTGATACGTGTAACTTAAGCCTGCCGGGTTTAGCTGTTCTGTCACCCGCCCGTCGCTGTCGTAACGGTAACAGATTTCCGGTCGGCCCGTGTGACGGTGCGCCACCATCCGGCCCCGGTATTTATCATCGTAAGTAAAGCTGCGCACCTGTGTATTGCTGCGGTCATACACCGCCGCCAGTTCGCCGCGGGCGTCCAGCCATAGCGCACCAGCGGCGCGGCAGGTAAATTCTCCGGGTATTCCGGGTCGTGCGTCAGCCACACGGCAGACAGACGGATGCCGTTGTCCCGGCCATATTCGGTGTAACCCGGCAGGGTATCAGGAAAAGCGGACGGTTCCGTCCCGCCGGAAATGGCCTGCTGCCGGGCTTCTTCTGCCCGCTGCGCCTGCGTGGTCAGTACCAGCCGGAAGTGACGCCCGGCACCATCCGTCACGCCGGTGATTTCGCCGCTGAATTCACCGGCGGCTTCGCGGTGGAACGTCTGTGTGCGCCCGAAGCGGTCCACCAGCCCGGTCAGTACCCGGTACGGCGGCAGCGGCGCAGGCAGCACCTCATCCGCTTCCGGCACCTCACACCAGCCGAGCAGCCACCACGGCCCCTGCGGACTGTTTGTCGCCAGATAACGATGCGGACTTAAGCGGAGTTCTTCCGGCAGCGCCTGCCAGAGTGCGGCCAGCCGGTGACCTTCATCCAGTTTCGCCACGCCGCCGCGCAGCCACAGTGACTCGCTGCGGCTGTAACCGTCCTCACCGGGAAACAGGTGCTCAAAATACAGGCTTCTGCCGCCGTTATCACTGAGTATCAGTGTGTTATCGCGCAGCTGTAAGCGGATATCCGCAGGCATTTTCCAGCCGGGGCCGAGGCTCCCCACCGGCGCGGGCGTTTTGTCCGGTAACTGCTGTAGGTGCGGGAGAGAATGAACGGCAGCGGGCCGGGCAGGGCGATGTCGGTTTCACCGGGAAGGACCTTTGCACCGAGCAGCGGATTGACCGGATGGCCGGACGTCACCGCCGGGGCACACCGAACAGGCCACGCCGGTGGGGCACCGATGCGTACCCCGGCTGAACCCTGGACAATGCTACCGCCATACTGCGTCATGTCGCCCTGACGCGCCGCCGGTTTTCCGCTCATCTGCTCATCCTTGTTTTATCGGGTTATTTGTCTGCTGACAGGCGAAACCCTACAGATTTATAAGAAAGCCTTAAGTGAGATATCTGTCAGATAAGAACAATTAGGAAAATATTTATATATATTTCATGAATATATGTTTCGATTGGTATAACGATGTCTAAATATTCCTCTGAACATCTTCCTGATACAAAACCGCCAGCGTTTCCGCTGGCGGTTTTCAATGTATTCAAAACTCAGCAATCAATAAAATCACCAGTTGCCTTTTCGGCCTGATCCATCCACACCGGTTTATCGCTGGTTTTCGACCAGACGG
+>dbe28df8-d40f-4a1a-9666-9e8bc64c6204 id=92 clr=0,3709
+CTGGTACTTCGTTCAGTTACGTATTGCTACTTGCCTGTCGCTCATCTTCGGCGTCTGCTTGGGTGTTTAACCTGCGCAGCTGGGCGCGAAGCGCTCTTTAATACCGCCTTTGACGATATCTTTCAGCGCAATAACGCCCAGCACACGAGAACCTTCCACCACCACCAGCGGCGTGGCTCCCTGACGCGCAACCTGATCGACTTTTTGATCAACATCGGTAGGGAAGTGACCACCGTTAGCCTCAACATGGCGACGAATGGCATCGACAGAACCTTTACGGATCATGCGGTTGTCGATGTTGATCCCGCTCATCCGGCTTTGCGCAGTAAACGGTACAAAGGTGGCATGGAGCGACTGCACATCGCGCTCGCGCAGGTTAAAACGCTGCTTGGCGAGGATCACAATACTGCGGCCTTCCGGCGTTTCATCAGCCAGCGAAGCCAGTTGTGCGGCGTCAGCCAGCGTTTTTCATCCACGCCCTGCGCGGGGATAAACTCCGACGCCTGACGGTTACCGAGTGTGATGGTGCCGGTTTTATCCAGTAGCAGAACGTCAACGTCACCTGCCGCTTCAACTGCACGTCCGCTGGTGGCAATCACATTCGCGCCTAGCATCCGGCTCATCCCGGCGACGCCGATCGCTGACAACAGGCCGCCAATAGTGGTTGGGATCAGACAGACCAGCAGCGCCACCAGTACCGTTACGCTGACTGCATTACCGCCCGCGGAAAACGGCCACAGCGTGGCGGTTGCCAGTAAAAAGACGATAGTCAGGGCAATCAGCAGAATGGTCAGGGCAATTTCGTTCGGCGTTTTGCGTCGCTGTGCGCCTTCCACCATCGCGATCATCCGATCCAGAAATGTCTCGCCGGGGTTAACGCTACACTCAATCACCAGCCAGTCAGAAAGAATACGCGTGCCGCCGGTGACGGAGGCAAAATCGCCGCCGGATTCACGGATCACCGGTGCCGATTCCCCGGTGATGGCGCTTTCATCGACCGATGCACCCCTTCAATAACTTCACCATCGCAGGGGATAATATCGCCAGCTTCTACCAGTACGATATCGCCTTTACGAAGTTGGTCGGCAGGAACTTTGTCCGCCGCAGCGCCATATTTCGGCTCACGCAGCTTGCGGGCAAAGGCAGTTTTTCACCCTTTCAGACTGTTGGCCTGCGCTTTACTGCGGCCTTCTGCCAGCGCCTCGGCGAAATTAGCGAACAGTACGGTGATCCACAGCCAACCGCTAATGGCCGCGCTAAACAGCGCATTGCCGGGCATCGCACCGCTTGCCATCGCGATGCTAATACAGGTGGTCAGCAGACTGCCGATCCAGACGATAAACATCACCGGATTGCGCCATTGCGCCTGCGGGTTTAATTTTTTCACCGCTTCTTTCAGCGCCTGAACGACAAGTGTTGGTTCGAATAGCGCCAGTTGTTTACGACTCATATTCAGTGCTCACCAATATCATCAGGAGAGATATTCCGCCACCGGACCAAGCGCCAGGGCAGGGATAAAGGTCAGTGCGCCAACCAGCAACACGGTGCCGATTAACAGGCCAACAAACAGCGGGCCGTGCGTTGGCAGCGTGCCGGAGCTGGCGGCTTGGCTCTTTTACTCACCAGCGAACCGGCAATTGCCATCACCGGGATAATCACCCCGAAGCGACCGACAAACATGCAGAACGCCAGTAAACAGTTCCAGAACGGAGAGTTGGCGCTTAATCCGGCAAAGGCGCTGCCGTTGTTGTTAGCGGCGGATGACACGGCGTACAGCACTTCGCTAAAACCATGCGGGCCAGGGTTGAGCATGGCGCTACGTCCGGCGTCGGTCATCATCGCCAACGCCGCGCCCATCAGCACCAGCGTCGGGGTAACCAGAATTGCCAGTGCAGTCAGTTTCATCTCGCGTACGTCGATTTTTACCCAGATATTCCGGTGTACGACCAATCATCAGCCCGGCAATAAACACCGCCAGCAGGACAAACAGCATCATGCCGTAAAGACCAGAACCGACACCGCCGAACACCACTTCACCAATTTGCATCAGCCACATCGGCACCATGCCACCGAGAGCGGTAAACGAATCATGCATCGCAATCACCGCGCCACAGGAAGCCGCCGTCGTCACGACCGCAAACAGGCTACTGACCAGCACGCCGAAACGGCTCTCTTTACCTTCCATATTGATGCTGCTGTCCGTGCCCAGTGCCAGCAGATGAGGATTACCCTGAACTTCTGCCCACATCACCACGCCTACGCAGATGACAAAATCACTGACATCGCCCACAGCAACATGCGCCCCTGGCGGCGATCGCCCATCACTTCACCAAAGGCAAAGCACAGCGCCGTTGGGATCAAGAAGATCGCCAGCATCTGCACGAAGTTGGTCAGTGCGGTTGGGTTTTCAAACGGATGCGACGAGTTGGCATTAAAGAAGCCACCGCCGTTAGTACCGAGCATCTTGATCGCTTCCTGAGAAGCTACAGGCCCCATGGGTAACAGCTGTTGCGCTCCTTCAACGGTATTCACAGCCTGATAAGGCAGAAAGTTTTGCAGCGCACCTTGTTGAATAAAAACAGTGCAATCAACAACGCCACAGGGACTAGCACCCATAACGTGATGCGTAGCAGATCGACCCAGGCATTCCCGAGCGTGCTCATGCTCTGGCGGGTAAACGCACGGATGAGGGCAAAATCACCGCAATCCCGCTGGCGGCAGAAGAAAGTTTTGCACCGTTAAGCCCGCCATCTGGCTGAAATAGCTCAACGTGGTTTCACCGCTATAAGATTGCCAGTTGGTATTGGTGACAAAGCTGACGGCGGTATTCAGCGCCAGATCCCACGACAGCCCTGGCAACTGCTGTGGATTAAGCGGCAGATAGTGCTGACCGAGCAACATAAAAACAGCACCGCCAGCCCCAGCATGTTCAGGCCGAGAATGGCACAAGATATTGCTTCCAGTTCATCTCACGGTCAGAGACGCCAAGTGCGCGAAAAGTACGCGCTCAACGCCCGTTGTACCGGGAAGAGGAATGTCATTAATCAGCCGCGCCAGCCCGCTGCCTAAAGGACGCGCCAGCACCATTAACACCAGTAAAAACGTGGCGATCAGTAAGAACCCTTGCGCAGCCATCAGAACGCCTCCGCATTGATCAGGGCATAAACCAGATAACCCAGTAATAAAAACACCAGCAATACGCCGGTTATCACGCCTGCACTCACAGTGCACCTCCAGTGGCCTAAAAGTGATACCGGAAGGGTAGAATTCTGGCTGCAAAGATTTCGCAAAAATCTGCGGGCGGGGTGTAAAAAGTATAAAATGGCAAAAGCCATGATTTAACTAATGTTTAGTATTAATTTAACTTTTGTGTAACTTAATTACAGGATGAATGTAAATAAACCATCAATAAGCAAAAATAAGTGGTCGGATGAGTAGTAAAATTACACAAAAGGCGGTACTATTTTCATCAGATAAACAAATTCATTTTTCGGTGCCATTCACCGGGTAGATACAAAAGGGGAAAAGTATGGAACTCTACAGAGAATATCCTGCATGGCATCTTTTTACGCCGTACTTATGCGGTTGCAGCGGGCGTTCTGGCGCTGCCTTTGTCTTTTCTGGAAAGACCGCGCCCGCCCAGCTTTACGGCTGACCTGGGTTAAACCGAAACAGACGCCGAAGATAGAGCGACAGGCAAGTGGCAATT
+>458e15d1-ec66-4e53-a4c8-97593504bf11 id=93 clr=0,2149
+TTGTTGTGCTTCGTTCGGTTACGTATTGCTGCGCCTGTCGCTCTATCTTCGGCGTCTGGCAGGTGTTTAACCTTCACGACCGCAAGCAGGCTACGACCAGCACGCCGAAACGGCTCTCTTTACCTTCATATTGATGCTGCTGTCATTGCCCGGTGCCAGCGGATGAGGATTACCCTGAACTTCTGCCCACATCACCACGCCTACGCAGATGACAAAATCACTGACATCGCCCACAGCAGCATGCGCCCTGGCGTGATCATACATCACTTCACCAAGGCAAAGCACAGCGCCATTGGGATCAAAGAAGATCGCCAGCATCGCACGAAGTTGGTCAGTGCGTTTGGGTTGGTTTTCAAACGGATGCGGCAGGTTGGCATTAAAGCCTACCGCCGTTGGTACCCAATCATGATCGCTTCTGAAGCTACAGGCCCCATGGGTAACAGCGCAAACTCCTTCAGCGGTATTCACAGCCTGATAAAGACAGAAAGTTTTGCAGCGCATTGTTGAATAAAAACAGTGCAATCAGCAACGCGCCACAGGGACCTAGCACCCATAACAACGTGATGTGCGTAACCAGATCATTAGGCATTCCCGAGCGTGCTCATGCTCTGGCGGGTAAACGCACGGATGAGGGCAAAAAATCTACCCGCAATCCCGCTGGCGGCGAAGTTTTGCACCGTTAAGCCCGCCATCTGGCTGAAATAGCTCAACGTGGTTCACCGCTATAAGATTATGGTGGTATTGGTGACCAAAGCTGACGGCGGTAATTCAGCGCCAGATCCACGACAGCCACAGCGGCTGCTGTGGATGGCGGCAGATAGTGCTGACCGAGCAACATAAAAACAACACCGCCAGCCCCAGCATGTTCCGGGCGAGAATGGCACAAAGATGTTACTTCAGTTCATCTACGGTCAGAGACGCCAGTGCGAAAAAGTGGCGCTCAACCGTTGTACCGGGAAGGAGAATGTCGTGGCTGCCAGCCCGCTGCCTAAAGGACAGCGCCAGCACCATTAACACCAGTAAAAACGTGGCGATCAGTAAGAACCCTTGCGCAGCCATCAGAACGCGCCTCCACATTGATCGGGGCGCTCGCCAGTAATGTAAAACACCAGCAATACGCCGGTATCCGCCTGCATCACAGTGCACCTTCAATTAACTAAAAGTGATACCGGAAGGGTAAAATTCTGGCTGCAAAGATTTCCATAAAAAATCTGCGGGCGCGGGGAATTGTAAAAAGTATAAAATGGCAAAAGCCATGTGATTTAACTATCATTTAGTGTTAATTTAGCTTTTGTGCCAACTTAATTACAAGATGAATGTAAATAAACATCAATAAGCAAAAATAGAGTGGTCGGATAGTGGTAAAGAATTACACAAAGGCGGTACATTTCCATCAGATAAACAAATTCATTTTCGGTGCCATTCACCGGTGAATCTCAAGGGGGAGAAAAGTATGAATCTACAGAGAATATCCTGCATGGCTTATCTTTTGCCGCCGTATGCCAATGCGGTTGCAGCGGGCGTTCTGGCGCTGCCTTTCTTTCCTTGAGCGCTTACCCTGCAGTGAAAGCCAGCTTGTTGATAAGCCGGTAATGGATGGATCGGTAAAGGCAACTGGTGATTTTATTGGTGCTGAGTTTGAATACATTGCTGAAAACCGCCAGCGGCTTTGGCGGTTTTTATGGAGAGATGTTCAGAGATATTTGAACATCGTTATACCAATCCAGAAACGCTTATATTCATGAAATATATAAATATTTTCCTAATTGTTCTTATCGACAGATATATCTTTCGCCAAGGCTTTCTTATATAAAATAGCGGGTTTCGCCTGTCGAATAATAACCGATAAAACAAGGATGAGCAGATGAGCGGAAAACCAGCGGCGCGTCAGGGCATGAACGCATGACGCAGTATGTGACTGTAGCATTGTCCAGAGGTTCAGCCGGGTACGCATCAGTGCCCCACCGGCGTGGCCTGTTCGGTGTGCCCGGCGGTGTCAACCATCAGTCAATCCGCTGCTCGGTGCAGGCCTTCCCGGTGAAACCGACATCGCCCTGCCAGCCCGCTGCCCGTTCATTCTGGCAGTTACCGGACAAAAACGCCCGCGCCGGAGGTTAAGCGCACCCAAGCGGACGCCGCAATACCGGCC
+>77635ef8-3824-401c-8442-7fdec33235a8 id=94 clr=0,8451
+TCGTATTGCTTCGTTCAGTTACATTGCTGCCGCGCAATATTATCACCGGCGTCTCTCTGGCGGTTTCGCCATTCACGGTGCGGTGCGTGAGGCGGTCTGCTTCGTCATAGTTGGTGTGACCAGCCCTCATCCTCGCTGCGGATAAGTTTGCCGGTCAGGTCGTGGTGATAACGCTGTGTGCGGCCGTCAAAGCCGGTTTCCTATCAGCCGGTCGAGTACATCGTAACGGAAGGTGGTGTGGCTGCCGTTTTCACTGGTCAGGCGGATGACCCGTCCGGCAGCATCGTATTCCATACTGCGCGTCAGACCGCCCTGCGTGGTACAGATGGCTTTTCCCCGCATCGTACTGTGTCCCGTTTCTGCTGCCGTCCGGGGCAATGACGGTGGTCAGGTCACCGGCGGCGTTGTATTCATACCGCGTTTCATGGCCCTGCGTGTCTTTCACGGCAATTAACTGTCCACGGCTGTCGTATGCGCGGTACTGACTCAGCCCTTCCTCGCGGTGCACCGCCGTCACCTGACCAAAACGGTCATGGTCATAGCGGGTTACATAACCGGAACAGTCAGTGAAGCTCAGCAACAACTGACCGTAACGGCTCCACGTCATGGTTTTCGGCTGCCGGTGGCATCTTCCGTTGCGCAGGGTAAGTCACTGTGTGGATTATCATACGGTAGCGGGTGATATCGCCGTCAGGGGCAGTTTCCTGAATCAGACGGCCCCATTCATCATATTCCGGCGTATTTCCAGCCCGTCAGGCCCGGTGGCTGACGTTAACTGGCTGTGGTGGTTATAGTAAAACGCCGATGCCCTGCCATCCGGCGTGGTGATGCGCGTGATGAGGCCCGTCACCATCCGGACTGTATTCTGTTGTCCTGCCTGCGGCATCCGTCTGCCAGCCTGCCCACCGCGTCAAACTGACTCTGCGTGACGCTGCCGTCCGCGTGTTCCTTTTCACCACCGCTTCAGCCCGCCTTCACCCTGCGTGTGCAGGACTTCACGGCGGTTCAGGCTGTCGGTGATGGTGATGCGGTCCTTCTCATACTGATACGTGTAACTTAAGCCTGCCGGGTTTAGCTGTTCTGTCACCCGCCCGTCGCTGTCGTAACGGTAACAGATTTCCGGTCGGCCCGTGTGACGGTGCGCCACCATCCGGCCCCGGTATTTATCATCGTAAGTAAAGCTGCGCACCTGTGTATTGCTGCGGTCATACACCGCCGCCAGTTCGCCGCGGGCGTCCAGCCATAGCGCACCAGCGGCGCGGCAGGTAAATTCTCCGGGTATTCCGGGTCGTGCGTCAGCCACGGCAGACAGACGGATGCCGTTGTCCCGCCATATTCGGTGTAACCCGGCAGGGTATCAGGAAAAGCGGACGGTTCCGTCCCGCCGGAAATGGCCTGCTGCCGGGCTTCTTCTGCCCGCTGCGCCTGCGTGGTCAGTACCAGCCGGAAGTGACGCCCGGCACCATCCGTCACGCCGGTGATTTCGCCGCTGAATTCACCGGCGGCTTCGCGGTGGAACGTCTGTGTGCGCCCGAAGCGGTCCACCAGCCCGGTCAGTACCCGGTACGGCGGCAGCGGCGCAGGCAGCACCTCATCCGCTTCCGGCACCTCACACCAGCCGAGCAGCCACCACGGCCCCTGCGGACTGTTTGTCGCCAGATAACGATGCGGACTTAAGCGGAGTTCTTCCGGCAGCGCCTGCCAGAGTGCGGCCAGCCGGTGACCTTCATCCAGTTTCGCCACGCCGCCGCACCAGCCACAGTGACTCGCTGCGGCTGTAACCGTCCTCACCGGGAAACAGGTGCTCAAAATACAGGCTTCTGCCGCCGTTATCACTGAGTATCAGTGTGTTATCGCGCAGCTGTAAGCGGATATCCGCAGGCATTTTCCAGCCGGGGCCGAGGCTCCCCACCGGCGCGTTTTTGTCCGGTAACTGCTGTAGGTGCGGGAGAGAATGAACGGCAGCGGGCCGGGCAGGGCGATGTCGGTTTCACCGGGAAGGACCTTTGCACCGAGCAGCGGATTGACCGGATGGCCGGACGTCACCCGCCGGGGCACACCGAACAGGCCACGCCGGTGGGGCAGATGCGTACCCCGGCTGAACCCTGGACAATGCTACCGCCATACTGCGTCATGTCGCCCTGACGCGCCGCCGGTTTTCCGCTCATCTGCTCATCCTTGTTTTATCGGGTTATTTGTCTGCTGACAGGCGAAACCCTACAGATTTATAAGAAAGCCTTAAGTGAGATATCTGTCAGATAAGAACAATTAGGAAAATATTTATATATATTTCATGAATATATGTTTCGATTGGTATAACGATGTCTAAATATTCCTCTGAACATCTTCCTGATACAAAACCGCCAGCGTTTCCGCTGGCGGTTTTCAATATTCAAAACTCAGCAATCAATAAAATCACCAGTTGCCTTTTCGGCCTGATCCATCCACACCGGTTTATCGCTGGTTTTCGACCAGACGCGATGCAGGTAGCTGTAAAAGCGGGCGCGGTCTTTCCAGAAAAGCATGAAAGGCAGCGCCAGAACGCCCGCCGCATAAGTACGGCGTAAAAGATAAGCCATGCAGGATATTCTCTGTAGAGTTCCATACTTTTCTCCCCTTTGTATCTACCCGGTGAATGGCACCGGAAAATGAATTTGTTTATCTGATGAAAATAGTACCGCCTTTTGTGTAATTTTACTACTCATCCGACCACTTATTTTGCTTATTGATGGTTTATTTACATTCATCCTGTAATTAAGTTACACAAAAGTTAAATTAATACTAAACATTAGTTAAATCATGGCTTTTGCCATTTTTACTTACCCCGCCCGCAGATTTTGCGAAATCTTTGCAGCCAGAATTCTACCCTTCCGGTTTTTAGGCCACTGGAGGTGCACTGTGAGTGCAGGCGTGATAACCGGCGTATTGCTGGTGTTTTATTACTGGGTTATCTGGTTTATGCCCTGATCAATGCGGAGGCGTTCTGATGGCTGCGCAAGGGTTCTTACTGATCGCCACGTTTTTACTGGTGTTAATGGTGCTGGCGCGTCCTTTAGGCAGCGGGCTGGCGCGGCTGATTAATGACATTCCTCTTCCCGGTACAACGGGCGTTGAGCGCGTACTTTTCGCGCACTTGGCGTCTCTGACCGTGAGATGAACTGGAAGCAATATCTTTGTGCCATTCTCGGCCTGAACATGCTGGGGCTGGCGGTGCTGTTTTTATGTTGCTCGGTCAGCACTATCTGCCGCTTAATCCACAGCAGTTGCCAGGGCTGTCGTGGGATCTGGCGCTGAATACCGCCGTCAGCTTTGTCACCAATACCAACTGGCAATCTTATAGCGGTGAAACCACGTTGAGCTATTTCAGCCAGATGGCGGGCTTAACGGTGCAAAACTTTCTTTCTGCCGCCAGCGGGATTGCGGTGATTTTGCCCTCATCCGTGCGTTTACCCGCCAGAGCATGAGCACGCTCGGGAATGCCTGGGTCGATCTGCTACGCATCACGTTATGGGTGCTAGTCCCTGTGGCGTTGTTGATTGCACTGTTTTTATTCAACAAGGTGCGCTGCAAAACTTTCTGCCTTATCAGGCTGTGAATACCGTTGAAGGAGCGCAACAGCTGTTACCCATGGGGCCTGTAGCTTCTCAGGAAGCGATCAAGATGCTCGGTACTAACGGCGGTGGCTTCTTTAATGCCAACTCGTCGCATCCGTTTGAAAACCCAACCGCACTGACCAACTTCGTGCAGATGCTGGCGATCTTCTTGATCCCAACGGCGCTGTGCTTTGCCTTTGGTGAAGTGATGGGCGATCGCCGCCAGGGGCGCATGTTGCTGTGGGCGATGTCAGTGATTTTGTGTCTGCGTAGGCGTGGTGATGTGGGCAGAAGTTCAGGGTAATCCTCATCTGCTGGCACTGGGCACGGACAGCAGCATCAATATGGAAGGTAAAGAGAGCCGTTTCGGCGTGCTGGTCAGTAGCCTGTTTGCGGTCGTGACGACGGCGGCTTCCTGTGGCGCGGTGATTGCGATGCATGATTCGTTTACCGCTCTCGGTGGCATGGTGCCGATGTGGCTGATGCAAATTGGTGAAGTGGTGTTCGGCGGTGTCGGTTCTGGTCTTTACGGCATGATGCTGTTTGTCCTGCTGGCGGTGTTTATTGCCGGGCTGATGATTGGTCGTACACCGGAATATAAAAAATCGACGTACGCGAGATGAAACTGACTGCACTGGCAATTCTGGTTACCCCGACGCTGGTGCTGATGGGCGCGGCGTTGGCGATGATGACCGACGCCGGACGTAGCGCCATGCTCAACCCTGGCCCGCATGGTTTTAGCGAAGTGCTGTACGCCGTGTCATCCGCCGCTAACAACAACGGCAGCGCCTTTGCCGGATTAAGCGCCAACTCTCCGTTCTGGAACTGTTTACTGGCGTTCTGCATGTTTGTCGGTCGCTTCGGGGTGATTATCCCGGTGATGGCAATTGCCGGTTCGCTGGTGAGTAAAAGAGCCAAGCCGCCAGCTCCGGCACGCTGCCAACGCACGGCCCGCTGTTTGTTGGCCTGTTAATCGGCACCGTGTTGCTGGTTGGCGCACTGACCTTTATCCCTGCCCTGGCGCTTGGTCCGGTGGCGGAATATCTCTGATGATATTGAGTGAGCACTGAATATGAGTCGTAAACAACTGGCGCTATTCGAACCAACACTTGTCGTTCAGGCGCTGAAAGAAGCGGTGAAAAATTAAACCCGCAGGCGCAATGGCGCAATCCGGTGATGTTTATCGTCTGGATCGGCAGTCTGCTGACCACCTGTATTAGCATCGCGATGGCAAGCGGTGCGATGCCCGGCAATGCGCTGTTTAGCGCGGCCATTAGCGGTTGGCTGTGGATCACCGTACTGTTCGCTAATTTCGCCGAGGCGCTGGCAGAAGGCCGCAGTAAAGCGCAGGCCAACAGTCTGAAAGGTGAAAAAACTGCCTTTGCCCGCAAGCTGCGTGAGCCGAAATATGGCGCTGCGGCGGACAAAGTTCCTGCCGACCAACTTCGTAAAGGCGATATCGTACTGGTAGAAGCTGGCGATATTATCCCTGCGATGGTGAAGTTATTGAAGGGGCATCGGTCGATGAAAGCGCCATCACCGGGGAATCGGCACCGGTGATCCGTGAATCCGGCGGCGATTTTGCCTCCGTCACCGGCGGCACGCGTATTCTTTCTGACTGGCTGGTGATTGAGTGTAGCGTTAACCCCGGCGAGACATTTCTGGATCGGATGATCGCGATGGTGGAAGGCGCACAGCGACGCAAAACGCCGAACGAAATTGCCCTGACCATTCTGCTGATTGCCCTGACTATCGTCTTTTACTGGCAACCGCCACGCCGTTTTCCGCGTGGGGCGGTAATGCAGTCAGCGTAACGGTACTGGTGGCGCTGCTGGTCTGTCTGATCCCAACCACTATTGGCGGCCTGTTGTCAGCGATCGGCGTCGCCGGGATGAGCCGGATGCTAGGCGCGAATGTGATTGCCACCAGCGGACGTGCAGTTGAAGCGGCAGGTGACGTTGACGTTCTGCTACTGGATAAAACCGGCACCATCACACTCGGTAACCGTCAGGCGTCGGAGTTTATCCGCGCAGGGCGTGGATGAAAACGCTGGCTGACGCCACAACTGGCTTCGCTGGCTGATGAAACGCCGGAAGGCCGCAGTATTGTGATCCTCGCCAAGCAGTTTTAACCTGCGCGAGCGCGATGTGCAGTCGCTCCATGCCACCTTTGTACCGTTTACTGCGCAAAGCCGGATGAGCGGGATCAACATCGACAACCGCATGATCCGTAAAGGTTCTGTCGATGCCATTCGTCGCCATGTTGAGGCTAACGGTGGTCACTTCCCTACCGATGTTGATCAAAAGTCGATCAGGTTGCGCGTCAGGCCGCGCCGCTGGTGGTGGTGGAAGGTTCTCGTGTGCTGGGCGTTATTGCGCTGAAAGATATCGTCAAAGGCGGTATTAAAGAGCGCTTCGCCCAGCTGCGCAAAATGGGCATTAAAACGGTGATGATTACCGGCGATAACCGTCTGACTGCCGCCGCGATTGCTGCGGAAGCGGGTGTCGATGATTTTCTCGCCGAAGCGACACCGGAGGCCAAGCTGGCATTGATCCGTCAGTATCAGGCGGAAGGTCGTTTGGTAGCGATGACCGGCGACGGCACCAACGATGCTCCGGCGCTGGCGCAGGCAGATGTCGCGGTGGCGATGAACTCCGGCACCCAGGCGGCGAAAGAGGCGGGCAATATGGTCGATCTCGACTCTAACCCGACCAAGTTGATCGAGGTGGTGCACATTGGCAAACAGATGCTGATGACCCGTGGCTCGCTGACCACCTTCAGCATTGCCAACGATGTGGCGAAATACTTCGCCATTATTCCGGCGGCATTCGCGGCAACGTATCCGCAGTTAAATGCGCTGAACATCATGTGCCTGCATTCGCCCGACTCCGCAATCCTCAGTGCGGTGATTTTCAACGCCTTGATTATCGTCTTTGATTCCCCTGGCGTTAAAGGCGTGAGTTATAAACCGCTTACCGCTTCTGCCATGTTGCGCCGTAACTTATGGATTTACGGTCTGGGTGGGCTGCTGGTGCCGTTTATCGGTATCAAAGTCATTGATTTACTGCTGACCGTTTGCGGTCTGGTGTGAGGTTTACCATGAGTGGATTACGTCCGGCATTATCATTTATCTTTCTGTTATTGATTACTGGCGGCGTTTACCCGCTGCTGACCACCGTACTGGGGCAATGGTGGTTTCCTGGCAGGCCAATGGTTCGTTGATTCGTGAAGGTGATACGGTGCGCGGTTCGGCATTAATCGGGCAGAATTTTACCGGCAACGGCTATTTTCATGGTCGCCCGTCGGCAACGGCAGAAATGCCCTATAATCCACAGGCTTCTGGCGGGAGCAATCTGGCGGTCAGTAACCCTGAGCTGGATAAACTAATAGCCGCACGCGTTGCTGCATTACGGGCCGCTAACCCGGATGCCAGCGCGAGCGTTCCGGTTGAACTGGTGACGGCATCGTCGGCAAGCGGACAATAATATCACCCGCAAGCGGCGGCCTGGCAAATCCCGCGTGGCGAAAGCGCGTAATCTCAGCGTTGAACAGCTCACGCAACTGATCGCAAAATACAGCCAACAACCGCTGGTGAAATATATCGGCCAGCCGGTTGTCAACATTGTTGAACTCAATCTGGCGCTGGATAAACTTGATGAATAACGAACCCTTACGTCCCGACCCCGATCGTCTGCTGGAACAAACTGCCGCGCCGCATCGGGGAAGCTGAAAGTTTTCTTCGGTGCCTGTGCAGGCGTCGGGAAGACCTGGGCGATGCTGGCAGAAGCCCAGCGACTGCGGGCGCAAGGGCTGGATATTGTGGTTGGCGTGGTAGAAACCCACGGGCGAAAAGATACCGCCGCCATGCTGGAAGGGCTGGCTGTTCTGCCGTTAAAACGCCAGGCGTACCGTGGGCGGCATATCAGCGAGTTTGATCTCGATGCCGCCCTCGCGCCCGGCGCTGATCTTAATGGACGAACTGGTAATGCGCCAGGTTCCCGTCATCCCAAACGCTGGCAGGATATCGAAGAACTGCTGGAAGCTGGCATTGATGTTTTCACTACCGTCAACGTTCAGCATCTGGAAAGTCTGAATGATGTGGTCAGCGGCGTCACCGGAATTCAGGTACGGGAAACCGTGCCCGATCCTTTTCGATGCCGCCGACGACGTGGTGCTGGTGGACTTGCCCCGGACGATCTGCGCCAGCGGCTGAAAGAAGGCAAAGTCTATATTGCCGGGCAGGCGGAGCGCGCCATTGAACATTTTTCCGCAAAGGTAATCTGATCGCCCTGCGCGAACTGGCACTGCGCCGTACTGCCGATCGCGTTGATGAGCAAATGCGCGCCTGGCGGGGCATCCTGGCGAAGAGAAAGTGTGGCACACGCGCGACGCGATCCTTTTATGCATCGGCCATAACACCGGCAGCGAAAACTGGTCCGCGCAGCGGCGCGGCGTCACGGCTGGGTAGCGTCTGGCACGCGGTGTATGTTGAAACCCCTGCCCTGCACCGCTTACCGGAAAAAACGTCGGGCAATTCTCAGCGCCTTACGTCTGGCGCAGGAACTGGGCGGGAGACGGCAACACTTTCTGATCCAGCGGAAGAGAAAGCGGTAGTGCGTTATGCCCGTGAACATAATCTCGGCAAGATTATTCTCGGTCGCGGCCTCGCGCCGCTGGTGGCGTCGGGAAACGTTTGCTGACCGACTGGCGCGCATCGCCCCGATCTCGATCAGGTGCTGGTCGCGCTTGATGAACCACCCGCCCGCACGATTAACAACGCGCCGGATCGCCGCTCTTTTAGAATAGTGGCGTGTGTGGTTAAACAACACAAACCAGACGCCGAAGATACGAAAGCGGG
+>10df3a9d-60a4-4cb5-ab3d-46483be7bb59 id=95 clr=0,5141
+TTGCTCGGTACTTCGTTCAGTTACGTATTGCTACTTGCCTGTCGCTCTATCTTCGGCGTCTGCTTGGGTGTTTAACCAGCAATCAGCAGAATGGTCAGGGCAATTTCGTTCGGCGTTTTGCGTCGCTGTGCGCCTTCCACCATCGCGATCATCCGATCCAGAAATGTCTCGCCGGGTTAACGCTACACTCAATCACCAGCCAGTCAGAAAGAATACGCGTGCCGCCGGTGACGGAGGCAAAATCGCCGCCGGATTCACGGATCACCGGTGCCGATTCCCCGGTGATGGCGCTTTCATCGACCGATGCCCCCTTCAATAACTTCACCATCGCGGGGATAATATCGCCAGCTTCTACCAGTACGATATCGCCTTTACGAAGTTGGTCGGCAGGAACTTTGTCCGCCGCAGCGCCATATTTCGGCTCACGCAGCTTGCGGGCAAAGGCAGTTTTTCACCCCTTTCAGACTGTTGGCCTGCGCTTTACTGCGGCCTTCTGCCAGCGCCTCGGCGAAATTAGCGAACAGTACGGTGATCCACAGCCAACCGCTAATGGCCGCGCTAAACAGCGCATTGCCGGGCATCGCACCGCTTGCCATCGCGATGCTAATACAGGTGGTCAGCAGACTGCCGATCCAGACGATAAACATCACCGGATTGCGCCATTGCGCCTGCGGGTTTAATTTTTCACCGCTTCTTTCAGCGCCTGAACGACAAGTGTTGGTTCGAATAGCGCCAGTTGTTTACGACTCATATTCAGTGCTCACTCAATATCATCAGGAGATATTCCGCCACCGGACCAAGCGCCAGGGCAGGGATAAAGGTCAGTGCGCCAACCAGCAACACGGTGCCGATTAACAGGCCAACAAACAGCGGGCCGTGCGTTGGCAGCGTGCCGGAGCTGGCGGCTTGGCTCTTTTACTCACCAGCGAACCGGCAATTGCCATCACCGGGATAATCACCCCGAAGCGACCGACAAACATGCAGAACGCCAGTAAACAGTTCCAGAACGGAGAGTTGGCGCTTAATCCGGCAAAGGCGCTGCCGTTGTTGTTAGCGGCGGATGACACGGCGTACAGCACTTCGCTAAAACCATGCGGGCCAGGGTTGAGCATGGCGCTACGTCCGGCGTCGGTCATCATCGCCAACGCCGCGCCCATCAGCACCAGCGTCGGGGTAACCAGAATTGCCAGTGCAGTCAGTTTCATCTCGCGTACGTCGATTTTTTACCCAGATATTCCGGTGTACGACCAATCATCAGCCCGGCAATAAACACCGCCAGCAGGACAAACAGCATCATGCCGTAAAGACCAGAACCGACACCGCCGAACACCACTTCACCAATTTGCATCAGCCACATCGGCACCATGCCACCGAGAGCGGTAAACGAATCATGCATCGCAATCACCGCGCCACAGGAAGCCGCCGTCGTCACGACCGCAAACAGGCTACTGACCAGCACGCCGAAACGGCTCTCTTTACCTTCCATATTGATGCTGCTGTCCGTGCCCAGTGCCAGCAGATGAGGATTACCCTGAACTTCTGCCCACATCACCACGCCTACGCAGATGACAAAATCACTGACATCGCCCACAGCAACATGCGCCCCTGGCGGCGATCGCCCATCACTTCACCAAAGGCAAAGCACAGCGCCGTTGGGATCAAGAAGATCGCCAGCATCTGCACGAAGTTGGTCAGTGCGGTTGGGTTTTCAAACGGATGCGACGAGTTGGCATTAAAGAAGCCACCGCCGTTAGTACCGAGCATCTTGATCGCTTCCTGAGAAGCTACAGGCCCCATGGGTAACAGCTGTTGCGCTCCTTCAACGGTATTCACAGCCTGATAAGGCAGAAAGTTTTGCAGCGCACCTTGTTGAATAAAAACAGTGCAATCAACAACGCCACAGGGACTAGCACCCATAACGTGATGCGTAGCAGATCGACCCAGGCATTCCCGAGCGTGCTCATGCTCTGGCGGGTAAACGCACGGATGAGGGCAAAATCACCGCAATCCCGCTGGCGGCAGAAAGAAAGTTTTGCACCGTTAAGCCCGCCATCTGGCTGAAATAGCTCAACGTGGTTTCACCGCTATAAGATTGCCAGTTGGTATTGGTGACAAAGCTGACGGCGGTATTCAGCGCCAGATCCCACGACAGCCCTGGCAACTGCTGTGGATTAAGCGGCAGATAGTGCTGACCGAGCAACATAAAAACAGCACCGCCAGCCCCAGCATGTTCAGGCCGAGAATGGCACAAAGATATTGCTTCCAGTTCATCTCACGGTCAGAGACGCCAAGTGCGCGAAAAAGTACGCGCTCAACGCCCGTTGTACCGGGAAGAGGAATGTCATTAATCAGCCGCGCCAGCCCGCTGCCTAAAGGACGCGCCAGCACCATTAACACCAGTAAAAACGTGGCGATCAGTAAGAACCCTTGCGCAGCCATCAGAACGCCTCCGCATTGATCAGGGCATAAACCAGATAACCCAGTAATAAAACACCAGCAATACGCCGGTTATCACGCCTGCACTCACAGTGCACCTCCAGTGGCCTAAAAGTGATACCGGAAGGGTAGAATTCTGGCTGCAAAGATTTCGCAAAATCTGCGGGCGGGGTGTAAAAGTATAAAAATGGCAAAAGCCATGATTTAACTAATGTTTAGTATTAATTTAACTTTTGTGTAACTTAATTACAGGATGAATGTAAATAAACCATCAATAAGCAAAAATAAGTGGTCGGATGAGTAGTAAAATTACACAAAAGGCGGTACTATTTTCATCAGATAAACAAATTCATTTTCCGGTGCCATTCACCGGGTAGATACAAAGGGGGAGAAAGTATGGAACTCTACAGAGAATATCCTGCATGGCTTATCTTTTACGCCGTACTTATGCGGTTGCAGCGGGCGTTCTGGCGCTGCCTTTCATGCTTTTCTGGAAAGACCGCGCCCGCTTTTACAGCTACCTGCATCGCGTCTGGTCGAAAACCAGCGATAAACCGGTGTGGATGGATCAGGCCGAAAAGGCAACTGGTGATTTTATTGATTGCTGAGTTTTGAATACATTGAAAACCGCCAGCGGAAACGCTGGCGGTTTTTTATCAGGAAGATGTTCAGAGGAATATTTAGACATCGTTATACCAATCGAAACATATATTCATGAAATATATATAAATATTTTCCTAATTGTTCTTATCTGACAGATATCTCACTTAAGGCTTTCTTATAAATCTGTAGGGTTTCGCCTGTCAGCAGACAAATAACCCGATAAAACAAGGATGAGCAGATGAGCGGAAAACCGGCGGCGCGTCAGGGCGACATGACGCAGTATGGCGGTAGCATTGTCCAGGGTTCAGCCGGGGTACGCATCGGTGCCCCACCGGCGTGGCCTGTTCGGTGTGCCCCGGCGGGTGACGTCCGGCCATCCGGTCAATCCGCTGCTCGGTGCAAAGGTCCTTCCCGGTGAAACCGACATCGCCCTGCCCGGCCCGCTGCCGTTCATTCTCTCCCGCACCTACAGCAGTTACCGGACAAAACGCCCGCGCCGGTGGGGAGCCTCGGCCCCGGCTGGAAAATGCCTGCGGATATCCGCTTACAGCTGCGCGATAACACACTGATACTCAGTGATAACGGCGGCAGAAGCCTGTATTTTGAGCACCTGTTTCCCGGTGAGGACGGTTACAGCCGCAGCGAGTCACTGTGGCTGGTGCGCGGCGGCGTGGCGAAACTGGATGAAGGTCACCGGCTGGCCGCACTCTGGCAGGCGCTGCCGGAAGAACTCCGCTTAAGTCCGCATCGTTATCTGGCGACAAACAGTCCGCAGGGGCCGTGGTGGCTGCTCGGCTGGTGTGAGCGGGTGCCGGAAGCGGATGAGGTGCTGCCTGCGCCGCTGCCGCCGTACCGGGTACTGACCGGGCTGGTGGACCGCTTCGGGCGCACACAGACGTTCCACCGCGAAGCCGCCGGTGAATTCAGCGGCGAAATCACCGGCGTGACGGATGGTGCCGGGCGTCACTTCCGGCTGGTACTGACCACGCAGGCGCAGCGGGCAGAAGAAGCCCGGCAGCAGGCCATTTCCGGCGGGACGGAACCGTCCGCTTTTCCTGATACCCTGCCGGGTTACACCGAATATGGCCGGGACAACGGCATCCGTCTGTCTGCCGTGTGGCTGACGCACGACCCGGAATACCGGAGAATTTACCTGCCGCGCCGCTGGTGCGCTATGGCTGGACGCCCGCGGCGAACTGGCGGCGGTGTATGACCGCAGCAATACACAGGTGGTGCAGCTTTACTTACGATGATAAATACCGGGGCCGGATGGTGGCGCACCGTCACACGGGCCGACCGGAAATCTGTTACCGTTACGACAGCGACGGGCGGGTGACAGAACAGCTAAACCCGGCAGGCTTAAGTTACACGTATCAGTATGAGAAGGACCGCATCACCATCACCGACAGCCTGAACCGCCGTGAAGTCCTGCACACGCAGGGTGAAGGCGGGCTGAAGCGGGTGGTGAAAAGGAACACGCGGACGGCAGCGTCACGCAGAGTCAGTTTGACGCGGTGGGCAGGCTCAGGGCACAGACGGATGCCGCAGGCAGGACAACAGAATACAGTCCGGATGTGGTGACGGGCCTCATCACGCGCATCACCACGCCGGATGGCAGGGCATCGGCGTTTTACTATAACCACCACAGCCAGTTAACGTCAGCCACCGGGCCTGACGGGCTGGAAATACGCCGGGAATATGATGAATGGGGCCGTCTGATTCAGGAAACTGCCCCTGACGGCGATATCACCCGCTACCGTTATGATAATCCACACAGTGACTTACCCTGCGCAACGGAAGATGCCACCGGCAGCGGAAAACCATGACGTGGAGCCGTTACGGTCAGTTGCTGAGCTTCACTGACTGTTCCGGTTATGTAACCCGCTATGACCATGACCGTTTTGGTCAGGTGACGGCGGTGCACCGCGAGGAAGGGCTGAGTCAGTACCGCGCATACGACAGCCGTGGACAGTTAATTGCCGTGAAAGACACGCAGGGCCATGAAACGCGGTATGAATACAACGCCGCCGGTGACCTGACCACCGTCATTGCCCCGGACGGCAGCAGAGGGAAACAGCAAGCAGACGCCGAAGATAGAGCAA
+>a46ed4fe-5181-4a9d-ad1a-9e7ac83a0f95 id=96 clr=0,3984
+TTGGTATACGTTCAGTTACATTATTGCTGCGCCTGTCGCTCTATCTTCGGCGCCAGCGTATGGCCGTCCGGCTGTGCTGCCTTACCACCGCGCACCAGCCACATTGACTCACTGCGGCTGTACACCGCCTCCCCGGCAGCGAAGTGAATGCTCCGCCCGCCGTTGTCGTTGAGTATCAGTCCGTCATCACGTAGCTGTAAGCGGATATCAGAAGGCGCTTTCCAGCCGGGGCCGAAAACGCCCACCGGTGCAGGCGTCTTCGTCCGGTAGCTGCTGTAGGTGCGGGAGAGAATGAACGGCAGCGGGCCGGGCAGCGCAAGGTCCGTCTCGCCGGGCAGCACCTTCGCCAGCAGCGGATTTACCGGGTTGCCGAAGTCATCCCGCCCGGACACACCGAGCACGCCACGCCGGTGGGCGCGCCAATCTTACACCTGCCGAACCCTGGACAATGGGACCGCCATACTGAGTCATATCTCCTGACGCGCCGCTGGTTTTCCGCTCATATAAAGTGCCCTTTAGTTATTGTTCATATCCTGTGTTAGCAACAAAAAATAAAATGACACACAAGACCAGCTAATGTATTTATATATTTTCACATAAACTTATTTGTTCTCAATCAACAACAACTGTTATTACAGGTCACTTTCAATATTTTATTAAACTAACATTTTAGCACAGATGAATTCATCATCAACAAATTCACTATATGGATAATATCCATTCAACGCATATGATTTATGATTTTATTAGTCTGAGTTATTTTTGTAGGGCTATATTTAAAATCAATAAACTCCACCGATTCAGATTAATATCAGCAATAGAAAGATGGAAATCACCAATTCAATAACATCATCAATGAAACATATTGTAGAATTAATTTAAACAAGGCGTTCCATTCAACCAGAACGCCCTTATTTACTCATCACCCGCAAACTGCCTGAACAGCGCCTTACCCTTAACCAGTCGCGCACCCAGCCAGCCGCCGAGCGACAGCAGCAGCGCTCCGCTGCACGGCAGAACAATCCACAATCGCCAGTCTGGCTCCACGGAAAATCAAACACTTTCGCCTGCAACACTGCCAGCGCCGTTTCCGCACCAATTGCGGCCACCAGGCCGGAAACAAACCTGGCGAACTCACACCACAACGTGGTACGCAGCAGTTTTTCCCGCACCGAGTGTGCGCCACACCACCAGCTCCTGATGACGCTGACGCATTCCCACCTGCACCTGTGCCAGCAACAGCAACATACCGCAGGCGGTGACCAGTACCATCACTTCCAGCGCCCGACGCTCCAGCACCTGACCGACCTGTTTTAAAATCGCGCCAATATCTAACAGGCTAATGGTCGGGAACTGGCGGTTGAGTTGTGTCAACATGCCGTTGCCATTCTCCCAGCGGAAACTGGTAAGCCAGCTCTGCGGTTGCCCGTCTAATGCCCTTCAGGGAAAATAAAATAGAAATTAGGCCGCAGACTTTCCCAGTCCACTTTGCGCAGGCTGGTCACTTTAGCGCGGAACTCCTGGGTATCGCCCATAAAAGTCACGGTATCACCGAGGGCAACGTTTAAGCGTTTCGCCAGCCCCTCTTCCATCGACACTTCATCGGCTTTTGGCGGCCAGTTACCGGCGACAATCGGATTATGATCGGGCCGCGTATTTTGCCAGGTAAGATTGAGTTCGCGGTTAAGCGCCTCATCATTACCTTCTGTCGGCTTATCGTTAATCGCCGTCAGCCGCGCCCGCACCACCGGATAAAACGATTCCGGGACTATCTGATGTTCCGCGAGGAACGCTTTTAGCGGTGCTACCTGTTCTGTGGCGATGTTAATTAAAAAGTAGTTCGGGCTTTCTGGGTAGCTGCTGCTGCCAGGCGGTCGAGCAGATCGCCACGCAACACCAGCAGCAGTGCCAGCAGCATAAAGGAGAGCGAAAATGCCGAAAGCTGACTTAACGTTGACCACGGCTGACGTAACAGGCGGCTAACCGCCAGGCGCAGAGGCAGCGATTTCAGCGTCATGCGGCGAAGTACATTCAGCAGCATCCAGCCCAGCACACCGCACAGCAAAGCCAGTACTACCGCGCCCGCCAGCACCGCCCAAAGCAGCATACCCATTAATCCGGCGAGCAGCAGCACAACCACCACACTGACAATCGGCAGATAAAACTTCAGCGGCCAGACGTTCGCTACCACATCATTACGTAATACGCGTAAAGGCTGCGTTGCCAGCAACAAGCGATATGGTCGTAGCCCCACCAGCAGCGAGATGACCGTCATGGTGCCAAGCGCCCACAGCCACGGCCAGAGGCTGGCTGGCGGTAGTGCAGCAGGCAGAACGGGCTTGAGCAGCATCAACGTTTTTCGAACAACAGGCCTATGGCCCCACCGGTAACGGCTGAAAGCGTCAGCACCATCAACCACTGACCGACGATTAGCGCGCAGTTGCGCTCGCCCTGCCCCCAGCGTTTTGAGGATCGCCACCAGATCGTAGCGACTGCGACAGTAATGATTCATCGCTACCGCCACCGCTGCCACTGCCAGCAGCAAGGTCAGAAGCGCCGAAAGCAGCAGGAACTGTTGCGAGCGTTCCATCGATCGCCCCAGCTTCGTCCTGTTCCAGACCGTACCAGCGTTGTTCGGGTTTAAGCTGAGGTAACAACCATTTCTCATAGCCGTCGAGCTGGTTCTCGTTGCCGCCGAATTTATAACGCCAGGTGACCCGACTCCCCGGCTGCGGCTCCGGTTTTATCGACATCCGCCAGATTCATCATCAGACGCGGAGCCATCTGGAAGGGTTAAAACCGGAATCGGTTCCTGAATCACTTCTCCGGCAATCCGCAAGGTGGCATCGCCCACGTCAATGGTGTCGCCCGTTTTCAGGTTAAGCAGTGCCATCAGGCGTGGGGCCAGCAATACGCTGCCCGCCTGCGGTTTCAGGCCAGGGGATTAGTTTGCAGATCGCCATACATCGGGTAGATATCATCCACCGCTTTGACGTTCGCCAGCTGCGGTGTGTCGCCTGCAAAGGTCATTGTGGCGAAAGTCAGCTGCTTGCCGACTTTCAGGCCGCGCTTTGCGCTTCCTCCAGCCACGCTTGCGGCACTTCGCGTGAACTGCGCAACGCCCGATCGCCCGCCATAAACTCACGGCTTTGCTGGCTTAAGCCCTTCTCCATGCGATCGCTGATATTGCCCAGCGCCAGCACGCAGGCCACCGCCAGGCTTAGCGCCAGCGCCAATAATAATGACGGCGACGGCGACGCCAGAGACCAACGTGCAATCATGCTTCTCCTGCAACTGCCCGTTCACCAGCCGTAAGCAGCGGTCGCAGCGTGCCGCCAGTTGCAGGTCGTGGTCACCATAATCAACGTGGTGCCATGTTCACGGTTGAGAAAACAGCAGGTCGGCAATTTTATCGCCCGTCTGGCGGTCAAGGTTGCCGGTGGGTTCGTCGGCAAACAACAGCACATCAGGTCGACCATTAAAGGCTCGTGCCAGCGCCACTCGTTGCTGTTCACCGCCGGAAAGCTGTGCCGGAAGATGATCAGACGTTTACCCAGCCCTAACTGTTCGAGCAACGCTTTCGCCCCGTTACGACTTTCCGCGCGCTCTCACCGCGCAGCAGGGCAGCCGGAGCTCGACGTTTTCCAGCGCGTTAAGGGTAGGAATTAACATAAATGACTGAAAAACAAAGCCGACGTGCTTCGCGCGCAACTTTGCCCTTCTTCGTCCATATTATGTAGCGGTTGTCCCCCAGACTCACTTCGCCACTGCTGCCGTCATCAAGCCCGGCGAGGATCGCCAGCAAGGTTGACTTACGATCCGACTCGCCCACCAGTGCGATGGTCTCGCCACGTTTGACAACCAGCTCAACTCCGGTGAGGATGGAGTTCATGCTCCCTGACCGACGGACTTCTTAAGATGATGAACTTCAACAAATGTTTTTCAGGTTTAACCCCAAGCAGACGCCGAAGATGGGCACGCGGG
+>9a1776fd-9328-408e-9d54-e16535cbe064 id=97 clr=0,6946
+TTTAGAATCTGTATGCATTCAGATTAATAATAGAAATATGTTCCATCAATTTTTTAGTTCCATTTGTTCACCTTATTTATGTAAAGATATTGATCATGTATAAGCTATGAAAAACAGCTTTAGACAATAAGTAGTATGTTGAACTTAAATTCGAATTATTTAGTACAAAAAAGTAGCGTTACGTGATCTTTCCTGCAAATGGAACGCAAAATAAACACCTATTCCATGAGTTATATAATTTTTCACAATGATTAATTTGTTTTCTCAGGAAGAGATTTTATTTCTCTTCACTACGAATTAGTTCATGCTGTATCTTTATTAAACATTCGTAAGACTCATTTTTTGTTCGGGAGATGTGCTTCATTCGAGCATAAGTTGGTTTCTCATCTTTAAATATTTTACCATGATTGAATTATCAAGGACTGCCAACAACTGAACTGGATCACTGCTCTTTTGATAGATACCCGCTCTTATATAACTTCTAAACCGATCGCCGAGAAACGCCGTTTTTCTGCTGTATTTATCAACTCCTGCAACGTTCCTTTGATGGCATGATTTTCATTAAGGCGTAGTGACCCGACGCGAATTAAGAGTCTCGCCCCGCTTGGTGTGAATTTATTATTTTTACATGTACCCAGTTCTGTTTGCCAATAATACTCACCGATGTCCTCATTCTGATACCATCTCCACATGGCTTTATTATTTAAGAAGGAAACGCGGAAAAATAGTACCCTCTTGAAAATAGTAAAACAATCATGATCTTTTAGCTTGTATTTCGCAATCAGCTATAACACCAAAACTAACAAATATCATCAGCAAAAAGAACAAAACTCTTTTTTTTCTTATTCCTCTCGATGTTCTCTGTTCATCTTAGCTAAAATTTCACCCAAATCATCTATCCCTGCTTGCTGGCCCATCGGGTTTATTAATGTCTGGGAATAAATAGGGTTCTGCACAAGTATATCCTGGTGGTAATTGAGTTGTTGGCCAATTTGTCTGTGGCAGGTAATCACTTGCTGTCTTTGTATCCATCCCTGGATACTGGGAATCATCCTGTGGCGTACAAGTCAGATTTGGTTTTACCCACTTCCTGCAATACAGTGTGTAGTCGTAAGGGCTTAATGCTCTGAAGAATGTTTTGAAAACATTAGGCGCACTACTGGCCTGGTCAATAGGATATGGCAGTCTTAATTGTTTCGCTGCTGTCCGGCAATTTACTTGGATCGGGCGTAGGCGGTTTGTTGGTCTCGCTCCATATCCGCCATTATTTAAGTGTCCATATTTTGATGCCAGTCCCATTGAATCTATATACTGAACCGGATTCAGCGGATACTGATAAAATTCCATCCCCTTCAGCCCAATCGGATCCTGAGTGATATACCTCCCTGCAGCGGGTCATAATAGCGGTGGCGGTTGTAATACAGGCCGGACTCCTCATCATGCTGCCCCGGCGGGCGTGGATAAGCTGCTGCAGCTGATGCGGGTTCTCTTCATTCAGCAGGTTGCCCCATTCATCGTATTCTGCGCACCATTCTGTTGCCCCTTCCGTGCTGACAAGCGCCAGCGGCAGGCCGCGATGGTCGCAGTGGTACAGGTGGATTTTTCGCGCCGGCGTGTACACCGGGTCCATCTGGTTTTGCATCTGCTCCACCGTCAGGCCGCACGATGCCAGCCAGCGGCGGCTTTCCTCACTCACCCGGTCAGCCAGGATTTCACTTTCCAGCCGGTCGAGCATCTGCACCAGCACCGGCGGAACACCACTGCCACCGTCTTCGCCGCCGGACTGCTGAAGGGTATCCGCCAGGCTGCGGCGCTGCGTTTTCGCCAGCTCACCGGTGGCGGTTTCAACCTGATGAGTGGCGTGAAGCTCCCCGGCTGATAAATCGTCTGGATGCGGGTTCTGTCGTTCTGTATCGTGGTCAGGCGGTCGCCGTCCCAGCCGTACCAGGTCACTTGCGGTTTCCGTGACAGCGACATCCAGCCCGTCAGGTCCCGTTCACGTCGCCACACCCGTTTTGCCACCCTGCGGCCCAGCGGGTCGTAAAGATAGCGGCTTTCGACCAGCGGCTCTGCATATTGTCCGCGTGTAGTTACCACCAGCCGGTGCTGACTGTCGTAATGGTACCGGTGGGTGCTCATCATCCATCGCGGATAACCCTTCCGGATGAGGTCGGTTTCTCCGTCAGCCTGCCGTGACGGTCATACCGGTAAAGATAGTGCGCGTCACGGGCGATACGGTTATCCGGCCACATGCTGAGGGTGCTGTCCGGGTGCAGCTCCGGTCGGGCAGGCGGTTACCTGCCGGGTCTGGCATACGGGATATCAATGCCCAGGTTACATATATAATAAGAGCAATTAACTTAATTTATTTGTTTATAATGCGCTTACTTAATACAAACCATTGAATATACCCTCCTGACAGAAAATAAAGCCATATTATTATCGCCATAATATACTTACTATCAATCCTTACGCCAATAATGTCTGATACAGTCCCTATAAATATTAGAGCAATAAAGAATACTATGCCTGTTGGAAAACATATTACCATCATTCCATAAGACATGAGACTAATTAACTCGCTCACATCACGAGTGGAGTCTAATAGTGAAAGTCTATGCATGGAAAAGAATAGTATTAAAAGCGATAAAGCCAGCCATATAGCCTGAATAAAAAATAATATATTTCATTACATCACTCCGGTGAATACAAATCTAATAAAACGTCCAATGTTATTTCCGGAGCACTTCATCTTACATGTTTCTAAAGAATCATTAGACCAGTCTTGGCAGTTTTAAATAGCCCTAAATTTATAGGTGTGAATATATCAGGCAATACAGAATAACGCGGCCTTACCTCTTTAAACTTCCTTTTAAACAGTTCTCCACACAACTATTATCGGTTTCAACGAGGTCACAACGGCCAGCAGCTTCTTTGTATCATTACTTGCTTTACCTGGCCCCCATAGACCATCTCCTTTGATTCTCCCCGTTGGTCTTGGCCACCACAAGTATAGTCCCTTTACCATCTGGGACACAAAGATATTGATGATAGAACGGATTCCCCATATATCTGGACCGCTTCTTTCACCAGTTCCGCCCATTGAATGCAGTGGCTTAATGCATTTTAGTGTTTCTAATCCTAATGGATCTATATTTGAGATCGGATTCAACGGATACTGATAAAATTCCATCCCCTTTCAGCCCAATCGGATCCTGAGTGATATATCGCCCCTGCAGCGGGTCATAATAGCGGTGGCGGTTGTAATACAGGCCGGACTCCTCATCATACTGCTGCCCCGGCAGGCGGATAAGCTGCTGCAGCTGATGCGGGTTCTCTTCATTCAGCAGGTTACCCCATTCATCGTATTCTGCGTACCACGCTGTTGTCCCTTCCGTGCTGATAAGGGCCAGCGGCAGGCCGATGGTCGCAGTGGTACAGGTGAATTTTTCGCGCCGGCGTGTATACCGGGTCCATCTGGCTTTGCATCTGCGCCACCGTCAGGCCGCACGATGCCAGCCAGCGGCGGCTTTCCTCACTCACCCGGTCAGCCAGGATTTCACTTTCCAGCCGGTCGAGCATCTGCACCAGCACCGGCGGGAACACCACTGCCACCGTCTTCGCCACCGGACTGCTGAAGGGTATCCGCCAGGCTGCGGCGCTGCGTTTTCGCCAGCTCACCGGTGGCGGTTTCAACCCTGATGAGTGGCGTGAAGCTCCCCGGCTGATAAATCGTCTGGATGCGGGTTCTGTCGTTCTGTATCGTGGTCAGGCGGTCGCCGTCCCAGCCGTACCAGGTCACTTGCGGTTTCCGTGACAGCGACATCCAGCCCGTCAGGTCCCGTTCACGCCGCCATACCCGTTTTGCCACCCTGCGGCCCAGCGGGTAAAGATAGCGACTTTCGACCAGCGGCTCTGCATATTGTGTCCGCGTGTAGTGCACCAGCCGGTGCTGACTGTCGTAATGGTACCGGTGGGTGCGCTCATCATCCGTGCGGATAACCCCTTCCGGGATGAGGTCGGTTTCTCTGTCAGCCTGCCGTGACGGTCATACCGGTAAAGATAGTGCGCGTCACGGGCGATACGGTTATCCGGCCACATGCTGAGGGCGCTGTCCGGTGCAGCTCCGGGTCGGGCAGGCGGTTACCTGCCGGGTCTGTGGTATACGGGATGCGGATATCCAGATTCGCTGCGGTGGTGTGAACGCCGGTCAGCCTGCCGGTGGTGCTGTAGCTGTAACTCCGGGTCTGGCGCGGGCTGCTGATGCGGATGAGTTCGCCGTTGTCGTTCCAGGTGTAATCGCGGTCAGACAGCAGGCTGTTCAGGTGCTGGCTCTGTAACTGCCCGGCAGGGGTAAGCGGTGGTGAGTTCATAACGGCCGAAGCTGCGCAGCGTTTCCCGGTGCAGGCGGTCGCGGGTGTACTCCACCAGCGGTGTGTCGCCGAGTTTCATGCCTGACAGCCAGCCGCTGCCGTAGGTCAGCCATTCCACGGCGGGCAGGCTGTCCGGTATACAGCGGTTCGCCAGTCCTGTGCGTTGTACGCATGTCTGGTCTCATGCTGCCAGAGCAGTTCATTCGTCTGCGGATGATGCACCGTCAGGTGTTCACTGGCGAGGCGGCCTGTCATAACCATAGTGCACCGTCACCCGGTGCCCTTCGCTGATATGGCTGATGTCTGTCAGCCAGCCGCGTTCGTCATACTGCCACCGCTCTGCGGTTTCGCCATTCACGGTGCGGTGCGTGAGGCGGTCTGCTTCGTCATAGTGAGTGGGTGACCAGCCCTCATCCTCGCTGCGGATAAGTTTGCCGGTCAGGTCGTGGTGATAACGCTGTGTGCGGCCGTCAAAGCCGGTTTCCTGTATCAGCCGGTCGAGTACATCGTAACGGAAGGTGGTGTGGCTGCGTTTTCACTGGTCAGGCGGATGACCCGTCCGGCAGCATCGTATTCCATACTGCGCGTCAGACCGCCCTGCGTGGTACAGATGGCTTTTCCCGCATCGTACTGTGTCCCGTTTCTGCTGCCGTCCGGGCAATGACGGTGGTCAGGTCACCGGCGGCGTTGTATTCATACCGCGTTTCATGGCCCTGCGTGTCTTTCACGGCAATTAACTGTCCACGGCTGTCGTATGCGCGGTACTGACTCAGCCCTTCCTCGCGGTGCACCGCCGTCACCTGACCAAAACGGTCATGGTCATAGCGGGTTACATAACCGGAACAGTCAGTGAAGCTCAGCAACTGACCGTAACGGCTCCACGTCATGGTTTTCCGGCTGCCGGTGGCATCTTCCGTTGCGCAGGGTAAGTCACTGTGTGGATTATCATAACGGTAGCGGGTGATATCGCCGTCAGGGGCAGTTTCCTGAATCAGACGGCCCCATTCATCATATTCCCGGCGTATTTCCAGCCCGTCAGGCCCGGTGGCTGACGTTAACTGGCTGTGGTGGTTATAGTAAAACGCCGATGCCCTGCCATCCGGCGTGGTGATGCGCGTGATGAGGCCCGTCACCACATCCGGACTGTATTCTGTTGTCCTGCCTGCGGCATCCGTCTGTGCCCTGAGCCTGCCCACCGCGTCAAACTGACTCTGCGTGACGCTGCCGTCCGCGTGTTCTTTTCACCACCCGCTTCAGCCCGCCTTCACCCTGCGTGTGCAGGACTTCACGGCGGTTCAGGCTGTCGGTGATGGTGATGCGGTCCTTCTCATACTGATACGTGTAACTTAAGCCTGCCGGGTTTAGCTGTTCTGTCACCCGCCCGTCGCTGTCGTAACGGTAACAGATTTCCGGTCGGCCCGTGTGACGGTGCGCCACCATCCGGCCCCGGTATTTATCATCGTAAGTAAAGCTGCGCACCTGTGTATTGCTGCGGTCATACACCGCCGCCAGTTCGCCGCGGGCGTCCAGCCATAGCGCACCAGCGGCGCGGCAGGTAAATTCTCCGGGTATTCCGGGTCGTGCGTCAGCCACACGGCAGACAGACGGATGCCGTTGTCCCGGCCATATTCGGTGTAACCCGGCAGGGTATCAGGAAAAGCGGACGGTTCCGTCCCGCCGGAAATGGCCTGCTGCCGGGCTTCTTCTGCCCGCTGCGCCTGCGTGGTCAGTACCAGCCGGAAGCGCCCGGCACCATCCGTCACGCCGGTGATTTCGCCGCTGAATTCACCGGCGGCTTCGCGGTGGAACGTCTGTGTGCGCCCGAAGCGGTCCACCAGCCCGGTCAGTACCCGGTACGGCGGCAGCGGCGCAGGCAGCACCTCATCCGCTTCCGGCACCCGCTCACACCAGCCGAGCAGCCACCACGGCCCCTGCGGACTGTTTGTCGCCAGATAACGATGCGGACTTAAGCGGAGTTCTTCCGGCAGCGCCTGCCAGAGTGCGGCCAGCCGGTGACCTTCATCCAGTTTCGCCACGCCGCCGCGCACCAGCCACAGTGACTCGCTGCGGCTGTAACCGTCCTCACCGGGAAACAGGTGCTCAAAATACAGGCTTCTGCCGCCGTTATCACTGAGTATCAGTGTGTTATCGCGCAGCTGTAAGCGGATATCCGCAGGCATTTTCCAGCCGGGGCCGAGGCTCCCCGGCGCGGGCGTTTTGTCCGGTAACTGCTGTAGGTGCGGAGAGAATGAACGGCAGCGGGCCGGGCAGGGCGATGTCGGTTTCACCGGGAAGGACCTTGCACGAGCAGCGGATTGACCGGATGGCCGGACGTCACCGCCGGGGCACACCAAACAGGCCACGCCGGTGGGGGCACTGATGCGTACCCCGGCTGAACCCCTGGACCGTGCTATACTGCGTCATCATTCGCCCGCGCCCGCCGGTTTTCCGCTCATCTGCTCATCCTTGTTTTATCGGGTTATTTGTCTGCTGACAGGCGAAACCCTACAGATTTATAAGAAAGCCTAAGTGAGATATCTGTCAGATAAGAACAATTAGGAACAATTATATAA
+>44442ba9-9951-4bac-90ab-2acc8d1c4015 id=98 clr=0,7785
+CTGGTAACCGCCCGTTTCAGATTTACGTGTTGCTGCTTGCCTGTCCGCACTGTCGCTGACGTCTCGCCGCTGTTTTTCATTCTTCCGTTGCGCAGGGTAAGTCACTGTGTGGATTATCATAACGGTAGCGGGTGATATCGCCGTCAGGGGCAGTTTCCTGAATCAGACGGCCCCATTCATCATATTCCCGGCGTATTTCCAGCCCGTCAGGCCCGGTGGCTGACGTTAACTGGCTGTGGTGGTTATAGTAAAACGCCGATGCCCTGCCATCCGGCGTGGTGATGCGCGTGATGAGGCCCGTCACCACATCCGGACTGTATTCTGTTGTCCTGCCTGCGGCATCCGTCTGTGCCCTGAGCCTGCCCACCGCGTCAAACTGACTCTGCGTGACGCTGCCGTCCGCGTGTTCCTTTTTCACCACCCGCTTCAGCCCCTTTCACCCTGCGTGTGCAGGACTTCACGGCGGTTCAGGCTGTCGGTGATGGTGATGCGGTCCTTCTCATACTGATACGTGTAACTTAAGCCTGCCGGGTTTAGCTGTTCTGTCACCCGCCCGTCGCTGTCGTAACGGTAACAGATTTCCGGTCGGCCCGTGTGACGGTGCGCCACCATCCGGCCCCGGTATTTATCATCGTAAGTAAAGCTGCACCTGTGTATTGCTGCGGTCATACACCGCCGCCAGTTCGCCGCGGGCGTCCAGCCATAGCGCACCAGCGGCGCGGCAGGTAAATTCTCCGGGTATTCCGGGTCGTGCGTCAGCCACACGGCAGACAGACGGATGCCGTTGTCCCGCCATATTCGGTGTAACCCGGCAGGGTATCAGGAAAAGCGGACGGTTCCGTCCCGCCGGAAATGGCCTGCTGCCGGGCTTCTTCTGCCCGCTGCGCCTGCGTGGTCAGTACCAGCCGGAAGTGACGCCCGGCACCATCCGTCACGCCGGTGATTTCGCCGCTGAATTCACCGGCGGCTTCGCGGTGGAACGTCTGTGTGCGCCCGAAGCGGTCCACCAGCCCGGTCAGTACCCGGTACGGCGGCAGCGGCGCAGGCAGCACCTCATCCGCTTCCGGCACCCGCTCACACCAGCCGAGCAGCCACCACGGCCCCTGCGGACTGTTTGTCGCCAGATAACGATGCGGACTTAAGCGGAGTTCTTCCGGCAGCGCCTGCCAGAGTGCGGCCAGCCGGTGACCTTCATCCAGTTTCGCCACGCCGCCGCGCACCAGCCACAGTGACTCGCTGCGGCTGTAACCGTCCTCACCGGGAAACAGGTGCTCAAAATACAGGCTTCTGCCGCCGTTATCACTGAGTATCAGTGTGTTATCGCGCAGCTGTAAGCGGATATCCGCAGGCATTTTCCAGCCGGGGCCGAGGCTCCCCACCGGCGCGGGCGTTTTTCCGGTAACTGCTGTAGGTGCGGGAGAGAATGAACGGCAGCGGGCCGGGCAGGGCGATGTCGGTTTCACCGGGACCTTTGCACCGAGCAGCGGATTGACCGGATGGCCGGACGTCACCCGCCGGGGCACCGAACAGGCCACGCCGGTGGGGCACCGATGCGTACCCCGGCTGAACCCTGGACAATGCTACCGCCATACTGCGTCATGTCGCCCTGACGCGCCGCCGGTTTTCCGCTCATCTGCTCATCCTTGTTTTATCGGGTTATTTGTCTGCTGACAGGCGAAACCCTACAGATTTATAAGAAAGCCTTAAGTGAGATATCTGTCAGATAAGAACAATTAGGAAAATATTTATATATATTTCATGAATATATGTTTCGATTGGTATAACGATGTCTAAATATTCCTCTGAACATCTTCCTGATACAAAAACCGCCAGCGTTTCCGCTGGCGGTTTTCAATATTCAAAACTCAGCAATCAATAAAAATCACCAGTTGCCTTTTCGGCCTGATCCATCCACACCGGTTTATCGCTGGTTTTCGACCAGACGCGATGCAGGTAGCTGTAAAAGCGGGCGCGGTCTTTCCAGAAAAGCATGAAAGGCAGCGCCAGAACGCCCGCTGCAACCGCATAAGTACGGCGTAAAAGATAAGCCATGCAGGATATTCTCTGTAGAGTTCCATACTTTTCTCCCCTTTTGTATCTACCCGGTGAATGGCACCGGAAAAATGAATTTGTTTATCTGATGAAAATAGTACCGCCTTTGTGTAATTTTACTACTCATCCGACCACTTATTTTTGCTTATTGATGGTTTATTTACATTCATCCTGTAATTAAGTTACACAAAAGTTAAATTAATACTAAACATTAGTTAAATCATGGCTTTTGCCATTTTTATACTTTTACACCCCGCCCGCAGATTTTTGCGAAATCTTTGCAGCCAGAATTCTACCCTTCCGGTATCACTTTTAGGCCACTGGAGGTGCACTGTGAGTGCAGGCGTGATAACCGGCGTATTGCTGGTGTTTTATTACTGGGTTATCTGGTTTATGCCCTGATCAATGCGGAGGCGTTCTGATGGCTGCGCAAGGGTTCTTACTGATCGCCACGTTTTACTGGTGTTAATGGTGCTGGCGCGTCCTTTAGGCAGCGGGCTGGCGCGGCTGATTAATGACATTCCTCTTCCCGGTACAACGGGCGTTGAGCGCGTACTTTTCGCGCACTTGGCGTCTCTGACCGTGAGATGAACTGGAAGCAATATCTTTGTGCCATTCTCGGCCTGAACATGCTGGGGCTGGCGGTGCTGTTTTTATGTTGCTCGGTCAGCACTATCTGCCGCTTAATCCACAGCAGTTGCCAGGGCTGTCGTGGGATCTGGCGCTGAATACCGCCGTCAGCTTTGTCACCAATACCAACTGGCAATCTTATAGCGGTGAAACCACGTTGAGCTATTTCAGCCAGATGGCGGGCTTAACGGTGCAAAACTTTCTTTCTGCCGCCAGCGGGATTGCGGTGATTTTGCCCTCATCCGTGCGTTTACCCGCCAGAGCATGAGCACGCTCGGGAATGCCTGGGTCGATCTGCTACGCATCACGTTATGGGTGCTAGTCCCTGTGGCGTTGTTGATTGCACTGTTTTTATTCAACAAGGTGCGCTGCAAAACTTTCTGCCTTATCAGGCTGTGAATACCGTTGAAGGAGCGCAACAGCTGTTACCCATGGGGCCTGTAGCTTCTCAGGAAGCGATCAAGATGCTCGGTACTAACGGCGGTGGCTTCTTTAATGCCAACTCGTCGCATCCGTTTGAAAACCCAACCGCACTGACCAACTTCGTGCAGATGCTGGCGATCTTCTTGATCCCAACGGCGCTGTGCTTTGCCTTTGGTGAAGTGATGGGCGATCGCCGCCAGGGCGCATGTTGCTGTGGGCGATGTCAGTGATTTTGTCATCTGCGTAGGCGTGGTGATGTGGGCAGAAGTTCAGGGTAATCCTCATCTGCTGGCACTGGGCACGGACAGCAGCATCAATATGGAAGGTAAAGAGCCGTTTCGGCGTGCTGGTCAGTAGCCTGTTTGCGGTCGTGACGACGGCGGCTTCCTGTGGCGCGGTGATTGCGATGCATGATTCGTTTACCGCTCTCGGTGGCATGGTGCCGATGTGGCTGATGCAAATTGGTGAAGTGGTGTTCGGCGGTGTCGGTTCTGGTCTTTACGGCATGATGCTGTTTGTCCTGCTGGCGGTGTTTATTGCCGGGCTGATGATTGGTCGTACACCGGAATATCTGGGTAAAAATCGACGTACGCGAGATGAAACTGACTGCACTGGCAATTCTGGTTACCCCGACGCTGGTGCTGATGGGCGCGGCGTTGGCGATGATGACCGACGCCGGACGTAGCGCCATGCTCAACCCTGGCCCGCATGGTTTTAGCGAAGTGCTGTACGCCGTGTCATCCGCCGCTAACAACAACGGCAGCGCCTTTGCCGGATTAAGCGCCAACTCTCCGTTCTGGAACTGTTTACTGGCGTTCTGCATGTTTGTCGGTCGCTTCGGGGTGATTATCCCGGTGATGGCAATTGCCGGTTCGCTGGTGAGTAAAGAGCCAAGCCGCCAGCTCCGGCACGCTGCCAACGCACGGCCCGCTGTTTGTTGGCCTGTTAATCGGCACCGTGTTGCTGGTTGGCGCACTGACCTTTATCCCTGCCCTGGCGCTTGGTCCGGTGGCGGAATATCTCTCTGATGATATTGAGTGAGCACTGAATATGAGTCGTAAACAACTGGCGCTATTCGAACCAACACTTGTCGTTCAGGCGCTGAAAGAAGCGGTGAAAAATTAAACCCGCAGGCGCAATGGCGCAATCCGGTGATGTTTATCGTCTGGATCGGCAGTCTGCTGACCACCTGTATTAGCATCGCGATGGCAAGCGGTGCGATGCCCGGCAATGCGCTGTTTAGCGCGGCCATTAGCGGTTGGCTGTGGATCACCGTACTGTTCGCTAATTTCGCCGAGGCGCTGGCAGAAGGCCGCAGTAAAGCGCAGGCCAACAGTCTGAAAGGGTGAAAAACTGCCTTTGCCCGCAAGCTGCGTGAGCCGAAATATGGCGCTGCGGCGGACAAAGTTCCTGCCGACCAACTTCGTAAAGGCGATATCGTACTGGTAGAAGCTGGCGATATTATCCCCTGCGATGGTGAAGTTATTGAAGGGGTGCATCGGTCGATGAAAGCGCCATCACCGGGGAATCGGCACCGGTGATCCGTGAATCCGGCGGCGATTTTGCCTCCGTCACCGGCGGCACGCGTATTCTTTCTGACTGGCTGGTGATTGAGTGTAGCGTTAACCCCGGCGAGACATTTCTGGATCGGATGATCGCGATGGTGGAAGGCGCACAGCGACAAAACGCCGAACGAAATTGCCCTGACCATTCTGCTGATTGCCCTGACTATCGTCTTTTACTGGCAACCGCCACGCTGTGGCCGTTTTCCGCGTGGGGCGGTAATGCAGTCAGCGTAACGGTACTGGTGGCGCTGCTGGTCTGTCTGATCCCAACCACTATTGGCGGCCTGTTGTCAGCGATCGGCGTCGCCGGGATGAGCCGGATGCTAGGCGCGAATGTGATTGCCACCAGCGGACGTGCAGTTGAAGCGGCAGGTGACGTTGACGTTCTGCTACTGGATAAAACCGGCACCATCACACTCGGTAACCGTCAGGCGTCGGAGTTTATCCCCGCGCAGGGCGTGGATGAAAACGCTGGCTGACGCCGCACAACTGGCTTCGCTGGCTGATGAAACGCCGGAAGGCCGCAGTATTGTGATCCTCGCCAAGCAGCGTTTTAACCTGCGCGAGCGCGATGTCCAGTCGCTCCATGCTACCGTTTACTGCGCAAAGCCGGATGAGCGGGATCAACATCGACAACCGCATGATCCGTAAAGGTTCTGTCGATGCCATTCGTCGCCATGTTGAGGCTAACGGTGGTCACTTCCCTACCGATGTTGATCAAAAAGTCGATCAGGTTGCGCGTGGGAGCCCGCCGCTGGTGGTGGTGGAAGGTTCTCGTGCTGGGCGTTATTGCGCTGAAAGATATCGTCAAAGGCGGTATTAAAGAGCGCTTCGCCCAGCTGCGCAAAATGGGCATTAAAACGGTGATGATTACCGGCGATAACCGTCTGACTGCCGCCGCGATTGCTGCGGAAGCGGGTGTCGATGATTTTCTCGCCGAAGCGACACCGGAGGCCAAGCTGGCATTGATCCGTCAGTATCAGGCGGAAGGTCGTTTGGTAGCGATGACCGGCGACGGCACCAACGATGCTCCGGCGCTGGCGCAGGCAGATGTCGCGGTGGCGATGAACTCCGGCACCCAGGCGGCGAAAGAGGCGGGCAATATGGTCGATCTCGACTCTAACCCGACCAAGTTGATCGAGGTGGTGCACATTGGCAAACAGATGCTGATGACCCGTGGCTCGCTGACCACCTTCAGCATTGCCAACGATGTGGCGAAATACTTCGCCATTATTCCGGCGGCATTCGCGGCAACGTATCCGCAGTTAAATGCGCTGAACATCATGTGCCTGCATTCGCCCGACTCCGCAATCCTCAGTGCGGTGATTTTCAACGCCTTGATTATCGTCTTTTGATTCCCCTGGCGTTAAAAGGCGTGAGTTATAAACCGCTTACCGCTTCTGCCATGTTGCGCCGTAACTTATGGATTTACGGTCTGGGTGGGCTGCTGGTGCCGTTTATCGGTATCAAAGTCATTGATTTACTGCTGACCGTTTGCGGTCTGGTGTGAGGTTTACCATGAGTGGATTACGTCCGGCATTATCAACATTTATCTTTCTGTTATTGATTACTGGCGGCGTTTACCCGCCTGACCACCGTACTGGGGCAATGGTGGTTTCCTGGCAGGCCAATGGTTCGTTGATTCGTGAAGGTGATACGGTGCGCGGTTCGGCATTAATCGGGCAGAATTTTACCGGCGGCGGCTATTTTCATGGTCGCCCGTCGGCAACGGCAGAAATGCCCTATAATCCACAGGCTTCTGGCGGGAGCAATCTGGCGGTCAGTAACCCTGAGCTGGATAAACTAATAGCCGCACGCGTTGCTGCATTACGGGCCGCTAACCCGGATGCCAGCGCGAGCGTTCCGGTTGAACTGGTGACGGCATCGGCAAGCGGGCTGGACAATAATATCACCCGCAAGCGGCGGCCTGGCAAATCCCACGCGTGGCGAAAGCGCGTAATCTCAGCGTTGAACAGCTCACGCAACTGATCGCAAAATACAGCCAACAACCGCTGGTGAAATATATCGGCCAGCCGGTTGTCAATTGTTGAACTCAATCTGGCGCTGGATAAACTTGATGAATAACGAACCCTTACGTCCCGACCCCGATCGTCTGCTGGAACAAACTGCCGCGCCGCATCGGAAGCTGAAAGTTTTCTTCGGTGCCTGTGCAGGCGTCGGGAAGACCTGGGCGATGCTGGCAGAAGCCCAGCGACTGCGGGCGCAAGGGCTGGATATTGTGGTTGGCGTGGTAGAAACCCACGGGCGAAAAGATACCGCCGCCATGCTGGAAGGGCTGGCTGTTCTGCCGTTAAAACGCCAGGCGTACCGTGGGCGGCATATCAGCGAGTTTGATCTCGATGCCGCCCTCGCCCGCCGCCCGGCGCTGATCTTAATGGACGAACTGGCGCACAGTAATGCGCCAGGTTCCCGTCATCCCAAACGCTGGCAGGATATCGAAGAACTGCTGGAAGCTGGCATTGATGTTTTCACTACCGTCAACGTTCAGCATCTGGAAAGTCTGAATGATGTGGTCAGCGGCGTCACCGGAATTCAGGTACGGGAAACCGTGCCCGATCCTTTTCGATGCCGCCGACGACGTGGTGCTGGTGGACTTGCCCCGGACGATCTGCGCCAGCGGCTGAAAGAAGGCAAAGTCTATATTGCCGGGCAGGCGGAGCGCGCCATTGAACATTTTTCCGCAAAGGTAATCTGATCGCCCTGCGCGAACTGGCACTGCGCCGTACTGCCGATCGCGTTGATGAGCAAATGCGCGCCTGGCGGGGCATCCTGGCGAAGAGAAAGTGGCACACACGCGCGACGCGATCCTTTTATGCATCGGCCATAACACCGGCGGCGAAAACTGGTCGGCGCAGCTGCGCCTGGCGTCACGGCTGGGTAGCGTCTGGCACGCGGTGTGTTGAAACCCCCCGCACCGCTTACCGGAAAAAACGTCGGGCAATTCTCAGCGCCCGTCTGGCGGGAACTGGGCGCGGGGCGGCAACACTTTCTGATCCAGCGGGAAGAAAGCGGTAGTGCGTTATGCCCGTGAACATAATCTCGGCAAGATTGGGTTAAACACCCAAAGCAGACGCCGAAGATAGAGCGACAGGCC
+>bec0a1f3-2776-4ace-b372-0a76a9cbed6b id=99 clr=0,5459
+TTGTTGCCTTCGTTCAGTTACGTATTGCTACTTGCTTTGTCGCTCTATCTTCGGCGTCTGCTTGGGTGTTTAAATTTACTAAACATTAGTTAAATCATGGCTTTTGCCATTTTATACTTTTACACCCCGCCCGCAGATTTTTGCGAAATCTTTGCAGCCAGAATTCTACCCTTCCGGTATCACTTTTAGGCCACTGGAGGTGCACTGTGAGTGCAGGCGTGATAACCGGCGTATTGCTGGTGTTTTATTACTGGGTTATCTGGTTTATGCCCTGATCAATGCGGAGGCGTTCTGATGGCTGCGCAAGGGTTCTTACTGATCGCCACGTTTTACTGGTGTTAATGGTGCTGGCGCGTCCTTTAGGCAGCGGGCTGGCGCGGCTGATTAATGACATTCCTCTTCCCGGTACAACGGGCGTTGAGCGCGTACTTTTCGCGCACTTGGCGTCTCTGACCGTGAGATGAACTGGAAGCAATATCTTTGTGCCATTCTCGGCCTGAACATGCTGGGGCTGGCGGTGCTGTTTTATGTTGCTCGGTCAGCACTATCTGCCGCTTAATCCACAGCAGTTGCCAGGGCTGTCGTGGGATCTGGCGCTGAATACCGCCGTCAGCTTTGTCACCAATACCAACTGGCAATCTTATAGCGGTGAAACCACGTTGAGCTATTTCAGCCAGATGGCGGGCTTAACGGTGCAAAACTTTCTTTGCCGCCAGCGGGATTGCGGTGATTTTGCCCTCATCCGTGCGTTTACCCGCCAGAGCATGAGCACGCTCGGGAATGCCTGGGTCGATCTGCTACGCATCACGTTATGGGTGCTAGTCCCTGTGGCGTTGTTGATTGCACTGTTTTTATTCAACAAGGTGCGCTGCAAAACTTTCTGCCTTATCAGGCTGTGAATACCGTTGAAGGAGCGCAACAGCTGTTACCCATGGGGCCTGTAGCTTCTCAGGAAGCGATCAAGATGCTCGGTACTAACGGCGGTGGCTTCTTTAATGCCAACTCGTCGCATCCGTTTGAAAACCCAACCGCACTGACCAACTTCGTGCAGATGCTGGCGATCTTCTTGATCCCAACGGCGCTGTGCTTTGCCTTTGGTGAAGTGATGGGCGATCGCCGCCAGGGGCGCATGTTGCTGTGGGCGATGTCAGTGATTTTGTCATCTGCGTAGGCGTGGTGATGTGGGCAGAAGTTCAGGGTAATCCTCATCTGCTGGCACTGGGCACGGACAGCAGCATCAATATGGAAGGTAAAGAGAGCCGTTTCGGCGTGCTGGTCAGTAGCCTGTTTGCGGTCGTGACGACGGCGGCTTCCTGTGGCGCGGTGATTGCGATGCATGATTCGTTTACCGCTCTCGGTGGCATGGTGCCGATGTGGCTGATGCAAATTGGTGAAGTGGTGTTCGGCGGTGTCGGTTCTGGTCTTTACGGCATGATGCTGTTTGTCCTGCTGGCGGTGTTTATTGCCGGGCTGATGATTGGTCGTACACCGGAATATCTGGGTAAAAATCGACGTACGCGAGATGAAACTGACTGCACTGGCAATTCTGGTTACCCCGACGCTGGTGCTGATGGGCGCGGCGTTGGCGATGATGACCGACGCCGGACGTAGCGCCATGCTCAACCCTGGCCCGCATGGTTTTAGCGAAGTGCTGTACGCCGTGTCATCCGCCGCTAACAACAACGGCAGCGCCTTTGCCGGATTAAGCGCCAACTCTCCGTTCTGGAACTGTTTACTGGCGTTCTGCATGTTTGTCGGTCGCTTCGGGGTGATTATCCCGGTGATGGCAATGCCGGTTCGCTGGTGAGTAAAAGAGCCAAGCCGCCAGCTCCGGCACGCTGCCAACGCACGGCCCGCTGTTTGTTGGCCTGTTAATCGGCACCGTGTTGCTGGTTGGCGCACTGACCTTTATCCCTGCCCTGGCGCTTGGTCCGGTGGCGGAATATCTCTCTGATGATATTGAGTGAGCACTGAATATGAGTCGTAAACAACTGGCGCTATTCGAACCAACACTTGTCGTTCAGGCGCTGAAAGAAGCGGTGAAAAATTAAACCCGCAGGCGCAATGGCGCAATCCGGTGATGTTTATCGTCTGGATCGGCAGTCTGCTGACCACCTGTATTAGCATCGCGATGGCAAGCGGTGCGATGCCCGGCAATGCGCTGTTTAGCGCGGCCATTAGCGGTTGGCTGTGGATCACCGTACTGTTCGCTAATTTCGCCGAGGCGCTGGCAGAAGGCCGCAGTAAAGCGCAGGCCAACAGTCTGAAAGGGTGAAAAACTGCCTTTGCCCGCAAGCTGCGTGAGCCGAAATATGGCGCTGCGGCGGACAAAGTTCCTGCCGACCAACTTCGTAAAGGCGATATCGTACTGGTAGAAGCTGGCGATATTATCCCCTGCGATGGTGAAGTTATTGAAGGGGTGCATCGGTCGATGAAAGCGCCATCACCGGGGAATCGGCACCGGTGATCCGTGAATCCGGCGGCGATTTTGCCTCCGTCACCGGCGGCACGCGTATTCTTTCTGACTGGCTGGTGATTGAGTGTAGCGTTAACCCCGGCGAGACATTTCTGGATCGGATGATCGCGATGGTGGAAGGCGCACAGCGACGCAAAACGCCGAACGAAATTGCCCTGACCATTCTGCTGATTGCCCTGACTATCGTCTTTTACTGGCAACCGCCACGCTGTGGCCGTTTTCCGCGTGGGGCGGTAATGCAGTCAGCGTAACGGTACTGGTGGCGCTGCTGGTCTGTCTGATCCCAACCACTATTGGCGGCCTGTTGTCAGCGATCGGCGTCGCCGGGATGAGCCGGATGCTAGGCGCGAATGTGATTGCCACCAGCGGACGTGCAGTTGAAGCGGCAGGTGACGTTGACGTTCTGCTACTGGATAAAACCGGCACCATCACACTCGGTAACCGTCAGGCGTCGGAGTTTATCCCCGCGCAGGGCGTGGATGAAAACGCTGGCTGACGCCGCACAACTGGCTTCGCTGGCTGATGAAACGCCGGAAGGCCGCAGTATTGTGATCCTCGCCAAGCAGCGTTTTAACCTGCGCGAGCGCGATGTGCAGTCGCTCCATGCCACCTTTGTACCGTTTACTGCGCAAAGCCGGATGAGCGGGATCAACATCGACAACCGCATGATCCGTAAAGGTTCTGTCGATGCCATTCGTCGCCATGTTGAGGCTAACGGTGGTCACTTCCCTACCGATGTTGATCAAAAAGTCGATCAGGTTGCGCGTCAGGGAGCCGCCGCTGGTGGTGGTGGAAGGTTCTCGTGTGCTGGGCGTTATTGCGCTGAAAGATATCGTCAAAGGCGGTATTAAAGAGCGCTTCGCCCAGCTGCGCAAAATGGGCATTAAAACGGTGATGATTACCGGCGATAACCGTCTGACTGCCGCCGCGATTGCTGCGGAAGCGGGTGTCGATGATTTTCTCGCCGAAGCGACACCGGAGGCCAAGCTGGCATTGATCCGTCAGTATCAGGCGGAAGGTCGTTTGGTAGCGATGACCGGCGACGGCACCAACGATGCTCCGGCGCTGGCGCAGGCAGATGTCGCGGTGGCGATGAACTCCGGCACCCAGGCGGCGAAAGAGGCGGGCAATATGGTCGATCTCGACTCTAACCCGACCAAGTTGATCGAGGTGGTGCACATTGGCAAACAGATGCTGATGACCCGTGGCTCGCTGACCACCTTCAGCATTGCCAACGATGTGGCGAAATACTTCGCCATTATTCCGGCGGCATTCGCGGCAACGTATCCGCAGTTAAATGCGCTGAACATCATGTGCCTGCATTCGCCCGACTCCGCAATCCTCAGTGCGGTGATTTTCAACGCCTTGATTATCGTCTTTGATTCCCCTGGCGTTAAAGGCGTGAGTTATAAACCGCTTACCGCTTCTGCCATGTTGCGCCGTAACTTATGGATTTACGGTCTGGGTGGGCTGCTGGTGCCGTTTATCGGTATCAAAGTCATTGATTTACTGCTGACCGTTTGCGGTCTGGTGTGAGGTTTACCATGAGTGGATTACGTCCGGCATTATCAACATTTATCTTTCTGTTATTGATTACTGGCGGCGTTTACCCGCTGCTGACCACCGTACTGGGGCAATGGTGGTTTCCTGGCAGGCCAATGGTTCGTTGATTCGTGAAGGTGATACGGTGCGCGGTTCGGCATTAATCGGGCAGAATTTTACCGGCAACGGCTATTTTCATGGTCGCCCGTCGGCAACGGCAGAAATGCCCTATAATCCACAGGCTTCTGGCGGGAGCAATCTGGCGGTCAGTAACCCTGAGCTGGATAAACTAATAGCCGCACGCGTTGCTGCATTACGGGCCGCTAACCCGGATGCCAGCGCGAGCGTTCCGGTTGAACTGGTGACGGCATCGGCAAGCGGGCTGGACAATAATATCACCCGCAAGCGGCGGCCTGGCAAATCCCACGCGTGGCGAAAGCGCGTAATCTCAGCGTTGAACAGCTCACGCAACTGATCGCAAAATACAGCCAACAACCGCTGGTGAAATATATCGGCCAGCCGGTTGTCAACATTGTTGAACTCAATCTGGCGCTGGATAAACTTGATGAATAACGAACCCTTACGTCCCGACCCCGATCGTCTGCTGGAACAAACTGCCGCGCCGCATCGGGGAAGCTGAAAGTTTTCTTCGGTGCCTGTGCAGGCGTCGGGAAGACCTGGGCGATGCTGGCAGAAGCCCAGCGACTGCGGGCGCAAGGGCTGGATATTGTGGTTGGCGTGGTAGAAACCCACGGGCGAAAAGATACCGCCGCCATGCTGGAAGGGCTGGCTGTTCTGCCGTTAAAACGCCAGGCGTACCGTGGGCGGCATATCAGCGAGTTTGATCTCGATGCCGCCCTCGCCCGCCGCCCGGCGCTGATCTTAATGGACGAACTGGCGCACAGTAATGCGCCAGGTTCCCGTCATCCCAAACGCTGGCAGGATATCGAAGAACTGCTGGAAGCTGGCATTGATGTTTTCACTACCGTCAACGTTCAGCATCTGGAAAGTCTGAATGATGTGGTCAGCGGCGTCACCGGAATTCAGGTACGGAAACCGTGCCCGATCCTTTTCGATGCCGCCGACGACGTGGTGCTGGTGGACTTGCCCCGGACGATCTGCGCCAGCGGCTGAAAGAAGGCAAAGTCTATATTGCCGGGCAGGCGGAGCGCGCCATTGAACATTTTTCCGCAAAGGTAATCTGATCGCCCTGCGCGAACTGGCACTGCGCCGTACTGCCGATCGCGTTGATGAGCAAATGCGCGCCTGGCGGGGGCATCCTGGCGAAGAGAAGTGCCAGCACACGCGCGACGCGATCCTTTTATGCATCGGCCATAACACCGGCGGCGAAAACTGAGTTAAACGCAAGCAGACGCGCGAAGATAGGTGCTGATGAACCACCCGCCCGCACGAACAACGCTAACGCTCTTTAAGACGAAAA
+>56b8515b-fc38-4531-bb1e-757449205298 id=100 clr=0,5680
+ATTGCGCTCGACCGCCGTTCAGTTACGTATTTATTTCTGCCTGTCGCTCCTGCTTCGGCGTCTGCTTGGGTGTTAACCTAATCCCGCCGGTCGAATTTGTTGTAGTGGTTCAGGATACTGATAAATTCCATGCCCTCTTTCAACCCCATCGGGTCCTGAGTAATATACCGCCCCTGCAACGGATCGTAGTACCGGTGACGGTTATAGTACAGCCCTGATTCCTCATCATGCTGCTGCCCTGGCAGACAATACGGCTGGGATACACACATGATCACGGGTTCTCCCCTCATTCCAGCTGGTTGCCCCATTCATCATATTCCGCGCTCCACGCCGTATTTGCCGTCTTCGCTGATAAGCGCCAGCGGCATCCCAGTGGTCGCAGTGATGAATGAGCTTTTCGCGCCGGTGTGTATTCCGGCTCCACCTGTCTGGCCAGTTGCTCCACCGTCAGCCCGCACTGCGCAAGCCGCGCCCGGCTTTCACTGCTCACGCGGTCTGCCCGGTTTCTTCCTCCAGCCTGTCCAGCAGCCGCACCAGTTCAGCCGGGAACACCACCACGCCGTGGCCGTTCTCCACTCCTTCCTGCTGGAGCGTCTCTGCCAGGCTGCGCCGCTGCGCTTTTCCGCTCGCCGTTCTCTGTCCTCGACCCGATGGTGGCGTGGGCTCCCCGGCTCATGTATACCGTCTGGATACGTGTGGTGTCAGTCTGCACCGTCGTCAACCTGTCTCCGTCCCAGCCATACCACGTCACCTCCGGTTTACGCGACAGCGGTATCCACCCGTCAGGTCACGCTCCCGCCGCCAGACCCGTTTTGCCATTCGCCGTCCCAGCGGGTCGTAGAGGTAGCGGCTCTCGACAGTGGCTCGCCATGCTGTATCCGCGTGTAGAACACCAGGCGGTGCTGGCTGTCGTAGTGGTAGTGGTGGGTCCGCTCGTCGTCCGTCCGTATCACACCCGCCGGGATGCGGTCCGTCTTCTCCGTCAGCCTGCCGTATTCATCGTGGCGGTAGACATAGTGCGCATCCTCCGCGATGCGGTTATCCGGCCACACTGTGAGTGTTGCTGTCCGGGTGCAGCTCCGGTCCGGCAGCCGGTTGCCCGCCGGGTCCGTGGCGCTACGGGATGCGGATGTCCAGGTCTGGTGCGAGGTGCGCACTCTCCAGCCTGCCCGTGGCGCTGTAGCCGTATTCCCGCGTCTGTCGCCCAGCCGCTGATGCGCACCAGGTCGCCGTTGTCCTCCACCCGTAGTCACGGTCATATACCAGGCTGTTCAGGTGCTGGCTCTGTAACTGGCCTGCGGGGGTGTATGTGCTGGTCAGTTCGTATGCGGCATTACTGCCGCCTGCCATGCTGCCGAAGCTGTACCGTCTCACGGTGCAGCCTGTCCCGCGTATACTCGACCGGCGGCGTCGCCCAGCTTCATTCCGCCAGGTAACCGCTGCCATACGTCAGCCTCCACCGGCGGCAGGCTGTCCGGCGTGACGCGGTTTTGCCAGCCCTGCTCGTTGTATGCGTGTTTCGTCTCATGCTGCCACAGCAGTTCCCCGTCTCCGGGTTCTCCACCGTCTGGCATTCTGCGCCAGTCAGGCGGCGCTATCGTCATAGCCATAGTGGACGGCAACACGGTGGCCTTCGCTCAATTGGCTGATGTCTGTCAGCCAGCCATGTGCCATCATACTGCCACTGCTCTGCCGGTTCGCCGTTCACCGTGCGGTGGTGATACGGTCCGATTCATCGTAGTACCAGAGGATGACAAGTCCTCATCCTCACTCTGGTGTGAGTTTTCCGGTCAGGTCATAATGATAACGTTGCGTCCGCCCGTCAAAGCCGCTGCTGTACCAGCCGGTCCAGCGCATCGTAACTGAAGACGCTGTGGCTGCCGTTCTCGTTGGTCAGGCTGATGACGTCCGGCAGCATCGTAATCCATACTGCGCGTCAGCCCGCCCTGCGTGGTGCTGACCGCCTTTCCCCACGCATCGTACTGTGTCTCGCTCCGGTTGCCGTCCGGGGTGATAACGGCAGTCAGGTCGCCTGCGGCGTTGTATTCATACCGCGTTTCACGGCCCTGTGCGTCTTTCACCGAGGTTAACCGGCCACGGTTGTCATAGCGGCGGTAAAGGCTGATGCCTTCCTCGGTGGACCGCCGTCATCTGGCCGAAGCGGTCGTATTCATAACGGGTCTGGTAGCCCGAGCAGTCGGTGAACGCCAGCAACTGCCCGTAGCGGCTCCAGGTCATCTGCCGGTGCTGCCCGTCGCATCCGTTGTCGTCGCCGGTAACTCACTGTGCGCGTCATCGTAGCGGTAGCGTACTGTCTCCCCGCTGCGCGATGTCTCCGATACCAGCCTGCCCGGTTCATCATATTCCGGCGGCTCTCCAGCCCGTCCGGGACACCACCGCCGTCAGCTGGTTCCGTCGTTATAGTAAAATTTCGTCTCCGCCCGTCCGGTGTGGTGATGTCCGTGATATCGCCGGACACCACATTCAGACCATACTCTGTCCTCCGTCCCGCCGCGTCCGTCTGCGCCGTGAGCCTTCCTGCCGCGTCATACCCGCTGCGCGTGACGCTGCCGTCCGCCAGTTCTTTTTCACCACCGTTTCAGCCCGGCCCCGCCTTCTGTATGCAGCACCTCACGCCGGTTCAGGCTGTCGGTGACGGTGATGCGGTCCTGCTCATAAAGATAGCGGTAGCTAACCCTGCCGGGTTCAGTTGCTCCACCACGCCCCGTATCGTCGTAGCGGTAGCGCATCTCCGGCCTTCCCGCGTAACGGTGCGCCACCATCCGGCCCGGGTGCTGCGCGTCATACGAAAGCGCGCACCTGCGTATTGCTGCGGTCATATACCGCCAGCAGTTCACCGGCTTCCGTATACGTGTACCGCACCAGTGGCGCAGCGGGCAGGCTCTCCGGGTATGCCGGGTCGTGCATCAGCCACACCGCCGAAGGCGGATACCTGTCGGGGCCGTATTCGGTACCGGGCGGTGTCGGGGAACGCTGAGGCTGAGAGAGGGCGGGAACTGTCAGAAGAAGATAGCGAAGAGGTGCGGGCCTCTTCCGCACGCTGCGCCTGCGTGGTCAGCACCAGACGGAACTCCCGCCCGGCACCGTCCGTCACGCCGGTGATTTCTGGCCAGGTCACCGGCGGCCTCACGCCGGTACGTCAGCGTCCGCCCGAAGCGGTCCGCCATCCCGGTAAGCACCGGTACGGCGGCAGCGGCGCTGGCAGTACGTCCTCAGCACCCGGCACCCGCTCAGACCACCCCAGTATCACCACGGCCCCTGTGCGCTGTTGGTCGCCAGGTAAAGATGCGGAACCGGATATCCGGCAGCGCCCACAACCGCGCCAGCGTATGGCCGTCCGGCTGTGCTGCCTTACCACCGCGCACCAGCCACATTGACTCACTGCGGCTGTACACCGCCTCCCGGCAGCAGCGGCTCAAAGTGAATGCTCCGCCCGCCGTTGTCGTTGAGTATCAGTCCGTCATCACGTAGCTGTAAGCGGATATCAGAAGGCGCTTTCCAGCCGGGGCCGAAAACGCCCACCGGTGCAGGCGTCTTCGTCCGGTAGCTGCTGTAGGTGCGGGAGAAATGAACGGCAGCGGGCCGGGCAGCGCAAGTCCGTCTCGCCGGGCAGCACCTTCGCCCCCAGCAGCGGATTTACCGGGTTGCCCGAAGTCATCCCGCCCGGACACACCGAGCACGCCACGCCGGTGGGCGCGCCAATCTTGCCGAACCCTGGACAATGGGACCGCCATACTGAGTCATATCTCCCTGACGCGCCGCTGGTTTTCCGCTCATATAAAGTGCCCTTTTAGTTATTGTTCATATCCCTGTGTTAGCAACAAAAAATAAAATGACACACAAGACCAGCTAATGTATTTATATATTTTTCACATAAACTTATTTGTTCTCAATCAACAACAACTTTATTACAGGTCACTTTCAATATTTTATTAAACTAACATTTTAGCACAGATGAATTCATCATCAACAAATTCACTATATGGATAATATCCATTCAACGCATATGATTTATGATTTTATTAGTCTGAGTTATTTTTGTAGGGCTATATTTAAAATCAATAAACTCCACCGATTCAGATTAATATCAGCAATAGAAAGATAGAAAATCACCAATTCAATAACATCATCAATGAAACATATTGTAGAATTAATTTAAACAAGGCGTTCCATTCAACCAGAACGCCCTTATTTACTCATCACCCCAAACTGCCTGAACAGCGCCTTACCCTTAACCAGTCGCGCACCCAGCCAGCCGCCGAAAGCGACAGCAGCAGCGCTCCGCTGCACGGCAGAACAATCCACAATCGCCAGTCTGGCTCCACGGAAAATCAAACACTTTCGCCTGCAACACTGCCAGCGCCGTTTCCGCACCAATTGCGGCCACCAGGCCGGAAACAAACCAAGCATGGCGAACTCACACCACAACGTGGTACGCAGCAGTTTTTCCCGCACCGAGTGTGCGCCACACCACCAGCTCCTGATGACGCTGACGCATTCCCACCTGCACCTGTGCCAGCAACAGCAACATACCGCAGGCGGTGACCAGTACCACCATCACTTCCAGCGCCCGACTTACCTGCTCCAGCACCTGACCGACCTGTTTTAAAATCGCGCCAATATCTAACAGGCTAATGGTCGGGAACTGGCGGTTGAGTTGTGTCAACATGCCGTTGCCATTCTCCCAGCGGAAACTGGTAAGCCAGCTCTGCGGTTGCCCGTCTAATGCCCTTCAGGAAAATAAAATAGAAATTAGGCCGCAGACTTTCCCAGTCCACTTTGCGCAGGCTGGTCACTTTAGCGCGGAACTCCTGGGTATCGCCCATAAAAGTCACGGTATCACCGAGGGCAACGTTTAAGCGTTTCGCCAGCCCTCTTCCATCGACACTTCATCGGCTTTTGGCGGCCAGTTACCGGCGACAATCGGATTATGATCGGGCCGCGTATTTTGCCAGGTAAGATTGAGTTCGCGGTTAAGCGCCTCATCTTCATTACCTTCTGTCGGCTTATCGTTAATCGCCGTCAGCCGCGCCCGCACCACCGGATAAAACGATTCCGGGACTATCTGATGTTCGCGAGGAACGCTTTTAGCGGTGCTACCTGTTCTGTGGCGATGTTAATTAAAAAGTAGTTCGGGCTTTCTGGGTAGCTGCTGCTGCCAGCGGTCGAGCAGATCGCCACGCAACACCAGCAGCAGTGCCAGCAGCATAAAGGAGAGCGAAAATGCCGAAAGCTGACTTAACGTTGACCACGGCTGACGTAACAGGCGGCTAACCGCCAGGCGCAGAGCAGCGATTTCAGCGTCATGCGGCGAAGTACATTCAGCAGCATCCAGCCCAGCACACCGCACAGCCCAGTACTACCGCGCCCGCCAGCACCGCCCAAAGCAGCATGCTGCCACCCATTAATCCGGCGAGCAGCAGCACAACCACCACACTGACAATCGGCAGATAAAACTTCAGCGGCCAGACGTTCGCTACCACATCATTACGTAATACGCGTAAAGGCTGCGTTGCCAGCAACAAGCGATATGGTCGTAGCCCCACCAGCAGCGAGATGACCGTCATGGTGCCAAGCGCCCAGCCACGGCCAGAGGCTGGCTGGCGGTAGTGCAGAAAGCAGAGGTTGGCTTTAAACAGACGCCGAAGATGGGAACGCC
Binary file test-data/ecoli_canu_corrected_reads_result1.fa.gz has changed
Binary file test-data/ecoli_canu_corrected_reads_result2.fa.gz has changed
Binary file test-data/ecoli_canu_corrected_reads_result3.fa.gz has changed
Binary file test-data/ecoli_canu_trimmed_reads_result1.fa.gz has changed
Binary file test-data/ecoli_canu_trimmed_reads_result2.fa.gz has changed
Binary file test-data/ecoli_canu_trimmed_reads_result4.fa.gz has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/ecoli_canu_unassembled_result1.fa	Sat Jun 09 13:46:56 2018 -0400
@@ -0,0 +1,1162 @@
+>tig00000007 len=3514 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
+GGCTGGATCGCTGCTGAATGTACTTCGCCGCATGACGCTGAAATCGCTGCCTCTGCGCCTGGCGGTTAGCCGCCTGTTACGTCAGCCGTGGTCAACGTTA
+AGTCAGCTTTCGGCATTTTCGCTCTCCTATGCTGCTGGCACTGCTGCTGGTGTTGCGTGGCGATCTGCTCGACCGCTGGCAGCAGCATACTCCAGAGCCC
+GAACTACTTTTTAATTAACATCGCCACAGAACAGGTAGCACCGCTAAAGCGTTCCTCGCGGAACATCAGATAGTCCCGGAATCGTTTTATCCGGTGGTGC
+GGGCGCGGCTGACGGCGATTAACGATAAGCCGACAGAAGGTAATGAAGATGAGGCGCTTAACCGCGAACTCAATCTTACCTGGCAAAATACGCGGCCCGA
+TCATAATCCGATTGTCGCCGGTAACTGGCCGCCAAAAGCCGATGAAGTGTCGATGGAAGAGGGCTGGCGAAACGCTTAAACGTTGCCCTCGGTGATACCG
+TGACTTTTATGGGCGATACCCAGGAGTTCCGCGCTAAAGTGACCAGCCTGCGCAAAGTGGACTGGGAAAGTCTGCGGCCTAATTTCTATTTTATTTTCCC
+TGAAGGGCATTAGACGGGCAACCGCAGAGCTGGCTTACCAGTTTCCGCTGGGAGAATGGCAACGGCATGTTGACACAACTCAACCGCCAGTTCCCGACCA
+TTAGCCTGTTAGATATTGGCGCGATTTTAAAACAGGTCGGTCAGGTGCTGGAGCAGGTAAGTCGGGCGCTGGAAGTGATGGTGGTACTGGTCACCGCCTG
+CGGTATGTTGCTGTTGCTGGCACAGGTGCAGGTGGGAATGCGTCAGCGTCATCAGGAGCTGGTGGTGTGGCGCACACTCGGTGCGGGAAAAACTGCTGCG
+TACCACGTTGTGGTGTGAGTTCGCCATGCTTGGGTTTGTTTCCGGCCTGGTGGCCGCAATTGGTGCGGAAACGGCGCTGGCAGTGTTGCAGGCGAAAGTG
+TTTGATTTTCCGTGGGAGCCAGACTGGCGATTGTGGATTGTTCTGCCGTGCAGCGGAGCGCTGCTGCTGTCGCTTTCGGCGGCTGGCTGGGTGCGGTTGG
+GTAAGGCGCTGTTCAGGCAGTTTGCGGGGATGAGAGTAAATAAGGGGCGTTCTGGTTGAATGGAACGCCTTGTTTAAATTAATTCTACAATATGTTTCAT
+TGATGATGTTATTGAATTGGTGATTTCTATCTTTCTATTGCTGATATTAATCTGAATCGGTGGAGTTTATTGATTTTAAATATAGCCCTACAAAATAACT
+CAGACTAATAAAATCATAAATCATATGCGTTGAATGGATATTATCCATATAGTGAATTTGTTGATGATGAATTCATCTGTGCTAAAAATGTTAGTTTAAT
+AAAATATTGAAAGTGACCTGTAATAACAGTTGTTGTTGATTGAGAACAAATAAGTTTATGTGAAAAATATATAAATACATTAGCTGGTCTTGTGTGTCAT
+TTTATTTTTTGTTGCTAACACAGGGATATGAACAATAACTAAAGGGCACTTTATAGAGCGGAAAACCAGCGGCGCGTCGGGAGATATGACTCAGTATGGC
+GGTCCCATTGTCCAGGGTTCGGCAGGTGTAAAATTGGCGCGCCCACCGGCGTGGCGTGCTCGGTGTGTCCGGGCGGGATGACTTCGGGCAACCCGGTAAA
+TCCGCTGCTGGGGGCGAAGGTGCTGCCCGGCGAGACGGACCTTGCGCTGCCCGGCCCGCTGCCGTTCATTCTCTCCCGCACCTACAGCAGCTACCGGACG
+AAGACGCCTGCACCGGTGGGCGTTTTCGGCCCCGGCTGAAAGCGCCTTCTGATATCCGCTTACAGCTACGTGATGACGGACTGATACTCAACGACAACGG
+CGGGCGGAGCATTCACTTTGAGCCGCTGCTGCCGGGGAGGCGGTGTACAGCCGCAGTGAGTCAATGTGGCTGGTGCGCGGTGGTAAGGCAGCACAGCCGG
+ACGGCCATACGCTGGCGCGGCTGTGGGGGCGCTGCCGCCGGATATCCGGTTAAGCCCGCATCTTTACCTGGCGACCAACAGCGCACAGGGGCCGTGGTGA
+TACTGGGGTGGTCTGAGCGGGTGCCGGGTGCTGAGGACGTACTGCCAGCGCCGCTGCCGTACCGGGTGCTTACCGGGATGGCGGACCGCTTCGGGCGGAC
+GCTGACGTACCGGCGTGAGGCCGCCGGTGACCTGGCCGGAAATCACCGGCGTGACGGACGGTGCCGGGCGGGAGTTCCGTCTGGTGCTGACCACGCAGGC
+GCAGCGTGCGGAAGAGGCCCACCTCTTCGCTATCTTCTTCTGACAGTTCCCGCCCTCTCTCAGCCTCAGCGTTCCCCGACACACTGCCCGGTACCGAATA
+CGGCCCCGAGGTGGGCGGTGATGCACGACCCGGCATACCCGGAGAGCCTGCCCGCTGCGCCACTGGTGCGGTACACGTATACGGAAGCCGGTGAACTGCT
+GGCGGTATATGACCGCAGCAATACGCAGGTGCGCGCTTTCACGTATGACGCGCAGCACCCGGGCCGGATGGTGGCGCACCGTTACGCGGGAAGGCCGGAG
+ATGCGCTACCGCTACGACGATACGGGGCGGGTGGTGGAGCAACTGAACCCGGCAGGGTTAAGCTACCGCTATCTTTATGAGCAGGACCGCATCACCGTCA
+CCGACAGCCTGAACCGGCGTGAGGTGCTGCATACAGAAGGCGGGGCCGGGCTGAAACGGGTGGTGAAAAAGAACTGGCGGACGGCAGCGTCACGCGCAGC
+GGGTATGACGCGGCAGGAAGGCTCACGGCGCAGACGGACGCGGCGGGAGGAGGACAGAGTACGGTCTGAATGTGGTGTCCGGCGATATCACGGACATCAC
+CACACCGGACGGGCGGGAGACGAAATTTTACTATAACGACGGGACCAGCTGACGGCGGTGGTGTCCCGGACGGGCTGGAGAGCCGCCGGAATATGATGAA
+CCGGGCAGGCTGGTATCGGAGACATCGCGCAGCGGGGAGACAGTACGCTACCGCTACGATGACGCGCACAGTGAGTTACCGGCGACGACAACGGATGCGA
+CGGGCGCACCAACAGATGACCTGGAGCCGCTACGGGCGTTGCTGGCGTTCACCGACTGCTCGGGCTACCAGACCCGTTATGAATACGACCGCTTCGGCCA
+GATGACGGCGGTCCACCGCGAAGGCATCAGCCTTTACCGCCGCTATGACAACCGTGGCCGGTTAACCTCGGTGAAAGACGCACAGGGCCGTGAAACGCGG
+TATGAATACAACGCCGCAGAGCGACCTACTGCCGTTATCACCCCGGACGGCAACCGGAGCGAGACACAGTACGATGCGTGGGGAAAGGCGGTCAGCACCA
+CGCAGGGCGGGCTGACGCGCAGTATCATTACGATGCTGCCGGATGTCATCAGCCCTGACCAACGAGAACAGGCAGCCACAGCGTCTTCAGTTACGATGCG
+CTGGACCGGCTGGT
+>tig00000008 len=2220 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
+AGTGCGGTTGGGTTTTTCAAACGGATGCGACAGCAGTTGGCATTAAAGAAGCCACCGCCGTTAGGCGCCGAGCATCTTGATGCTTCCACGAAGCTACGAT
+ACCGCCGGGTAACAGCTGTTGCGCTCCTTCAACGGTATTCCTACGGCCTGTTGAGCAGAAAGTTTTGCAGCGCAGCGAATAAAAACAGTGCAATCAACAA
+CGCCACGGGACTAGCACCCATAACGTGGTGCGTAGCAGATCGACCCAGGCATTCCCGAGCGTGCTCATGCTCTGGCGGGTAAACGCACGGATGGGGCAAA
+ATCACCCTGTCCCGCTGGCGGCAGAAGAAAGTTTTGCACCGTTAGCCCGCCATCTGGCTGAAATAGCTCAACGTGGTTTCACCGCTATAAGATTGCCAGT
+TGGTATTGGTGACAAACGACGGCGGTATTCAGCTCCATTTCAGCCACAGCTGCTGTGGATTAGCGGCAGATAGTGCTGACCGAGCAACATAAAAACAGCA
+CCGCCAGCCCCAGCATGTTTCGGGCCGAGAATGGCACAAAGATATTGCTTCCAGTTCATCTCACGGTCAGAGACGCCAGGTGCGAAAAAGTACGCGCTCA
+ACGCCCGTTGTACCGGGAAGAGGAATCATTAATCTGGCCGCGCCAGCCCGCTGCCTAAAGGACGCGCCAGCACCATTAACACCAGTAAAAACGTGGCGAT
+CAGTAAGAACCCTTGCGCAGCCATCAGACACGCTCCGCATTGATCGGGGCATAAACCAGAATGCGGTAATAAAACACCAGCAATGCGCCGGGTATCGCCT
+GCACTCACAGTGCACCTCCAGTGGCCTAAAAGTGATACCGGAAGGGTGAATTCTGTGGCTGCAAAGATTTCGCAAAATCTGCGGGCGGGGTGTAAAAAGT
+ATAAAAATGGCAAAAGCCTTGATTTAACTAATGTTTAGTATTAATTTAACTTTTGTGTAACTTAATTACAGGATGAATGTAAATAAACATCAATAAGCAA
+AAATAGAGTGGTCGGATGAGTAGTAAAAATTACACAAAAAGGCGGTACTATTTTCATCAGATAAACAAATTCATTTTTCCGGTGCCATTCACCGAATTGG
+GCAAAGGAAAGTATGGAACTCTACAGAGAATATCCTGCATGGCTTATCTTTTACGCCGTATGCCTGCGGTTGCAGCGGGCGTTCTGGCGCTGCCTTTCAT
+GCTTTCTGGAAAGACGCGCCCGCTTTTTGCAATACCATCGCGTCTGATTCGAAAACCAGCGATAAACCAGGTGTGGATGGATCGGGCGAAAAGGCAACTG
+GTGATTTTATTGATTGCTGAGTTTGAATATACATTGAAAACCGCCAGCGGAAACGCTGGCGGTTTTGTATCAGGAAGATGTTCAGAGGAATATTTGAACA
+TCGTTATACCAATCGAAACGTATATTCTGCCAAATATATATAAATATTTTCTAATTGTTCTTATCTGACAGATATCTCTTAAGGCTTTCTTATAAATCTG
+TAGGGTTTCGCCTGTCAGCGAACAAATAACCCGATAAAACAAGGATGAGCAGATGAGCGGAAAACCGGCGGCGCGTCAGGGTGACATGACGCAGTATGGC
+GTAGCATTGTCCAGGAGTTCAGCCGGGGTACGCATCGGTGCCCCACCGGCGTGGCCTGTTCGGTGTGCCCCGGCGAGTGACGTCCGGCCATCCGGTCAAT
+CCGCTGCTCGGTGCAAAGGTCCTTCCCGGTGAAACCGACATCGCCCTGCCCGGCCCGCTGCCGTTCATTCTCTCCCGCACCTACAGCAGTTACCGGACAA
+AAACGCCCGCGCCGGTAGAGGCCTCGGCCCCGGCTGAAAATGCCTGCGGATATCCGCTTACAGCTGCGCGATAACACACTGATACTCAGTGATAACGGCG
+GCAGAAGCCTGTATTTTGAGCACCTGTTTCCCGGTGAGGACGGTTACAGCCGCAGCGAGTCACTGTGGCTGGTGCGCGACGGCGTGAAAGCGAAACTGGA
+TGAAGCAAGGTCTGGCTGGCCGCCTCTGGCAGGCGCTGCCGGAGAAGAACTCGCTTAAGTCCGCATCGTTATCTGGCGACAAACAGTCCACAGGGGCCGT
+GGTGGCTGCTCGGCTGGTGTGAGCGGGTGCCGGAAGCGGATGAGTGCTGCCTGCGCCTTTGCCGCGCCGTACCGGGTACTGACCGGGCTGGTGGACCGCT
+TCGGGCGCACACAGACGTTC
+>tig00000009 len=4261 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
+TGGCCTGCGCTTTACTGCGGCCTTTGCCCAGCGCCTCGGCGAAATTAGCGAACAGTACGGTGATCCACAGCCAACCGCTTCGCCGCGCTTCAGCGCTTTA
+ATTGCCGGGCATCGCACCGCTTGCCATCGCGATGCTAATACAGGTGGTCAGCAGACTGCCGATCCAGACGATAAACATCACCGGATTGCGCCATTGCGCC
+TGCGGGTTTAATTTTCACCGCTTCTTTCAGCGCCTGAACGACAAGTGTTGGTTCGAATAGCGCCAGGCGACTCATATTCAGTGCTCACTCAATATCATCA
+GGAGAGATATTCCGCCACCGGACCAAGCGCCAGGGCAGGGATAAAGGTCACGCCAACCAGCAACACGGTGCCGATTAACAGGCCAACAAACAGCGGGCCG
+TGCGTTGCAGCGCTGCCGGAGCTGGCGGCTTGGCTCTTTTACTCACCAGCGAACCGGCAATTGCATCACCGGGATAATCACCCGAAGCGACCGACAAACA
+TGCAGAACGCCAGTAAACAGTTCCAGAACGGAGAGTTGGCGCTTAATCCGGCAAAGGCGCTGCCGTTGTTGTTAGCGGCGGATGACACGGCGTACAGCAC
+TTCAAAACCATGCGGGCCAGGGTTGAGCATGGCGCTACGTCCGGCGTCGGTCATCATCGCCAACGCCGCGCCCATCAGCACAGCGTCGGGGTAACCAGAA
+TTGCCAGTGCAGTCAGTTTCATCTCGCGTACGTCGATTTTTTATGATATTCCGGTGTACGACCAATCATCAGCCCGGCAATAAACACCGCCAGCAGGACA
+AACAGCATCATGCCGTAAAGACCAGAACCGACACCGCCGAACACCACTTCACCAATTTGCATCAGCCACACATGCACATGCGAGAGCGGTAAACGAATCA
+TGCATCGCAATCACCGCGCCACAGGAAGCCGCCGTCGTCACGACCGCAAACAGGCTACTGACCAGCACGCCGAAACGGCTCTCTTTACCTTCCATATTGA
+TGCTGCTGTCCGTGCCCAGTGCCAGCAGATGAGGATTACCCTGAACTTCTGCCCACATCACCACGCCTACGCAGATGACAAAATCACTGACATCGCCCAC
+AGCAACATGCGCCCTGGCGGCGATCGCCCATCACTTCACCAAAGGCAAAGCACAGCGCCGTTGGGATCAAGAAGATCGCCAGCATCTGCACGAAGTTGGT
+CAGTGCGGTTGGGTTTTCAAACGGATGCGACGAGTTGGCATTAAAGAAGCCACCGCCGTTAGTACCGAGCATCTTGATCGCTTCCTGAGAAGCTACAGGC
+CCCATGGGTAACAGCTGTTGCGCTCCTTCAACGGTATTCACAGCCTGATAAGGCAGAAAGTTTAGCGCAGTTGAAATAAAAACAGTGCAATCAACAACGC
+CACAGGGGACTAGCACCCATAACGTGATGCGATCGACCCAGGCATTCCCGAGCGTGCTCATGCTCTGGCGGGTAAACGCACGGATGAGGGCAAAATCACC
+GCAATCCCGCTGGCGGCAGAAAGTTTTGCACCGTTAAGCCCGCCATCTGGCTGAAATAGCTCAACGTGGTTTCACCGCTATAAGATTGCCAGTTGGTATT
+GGTGACAAAGCTGACGGCGGTATTCAGCGCCAGATCCCACGACCAGCTGGCTGCTGTGGATTAAGCGGCAGATAGTGCTGACCGAGCAACATAAAAACAG
+CACCGCCAGCCCCAGCATGTTCAGGCCGAGAATGGCACAAAGATATTGCTTCCAGTTCATCTCACGGTCAGAGACGCCAAGTGCGAAAAAAGTACGCGCT
+CAACGCCCGTTGTACCGGGAAGAATGTCATTAATCAGCCGCGCCAGCCCGCTGCCTAAAGGACGCGCCAGCACCATTAACACCAGTAAAAACGTGGCGAT
+CAGTAAGAACCCTTGCGCAGCCATCAGAACGCCTCCGCATTGATCAGGGCATAAACCAGATAACCCAGTAATAAAACACCAGCAATACGCCGGTTATCAC
+GCCTGCACTCACAGTGCACCTCCAGTGGCCTAAAAGTGATACCGGAAGGGTAGAATTCTGGCTGCAAAGATTTCGCAAAATCTGCGGGCGTAAAAAAAGT
+ATAAAATGGCAAAAGCCATGATTTAACTAATGTTTAGTATTAATTTAACTTTGTGTAACTTAATTACAGGATGAATGTAAATAAACCATCAATAAGCAAA
+AATAAGTGGTCGGATGAGTAGTAAAATTACACAAAGGCGGTACTATTTTCATCAGATAAACAAATTCATTTTTCCGGTGCCATTCACCGGGTAGATACAA
+AAGGGGAGAAAAGTATGGAACTCTACAGAGAATATCCTGCATGGCTTATCTTTTACGCCGTACTTACATGCGGTTGCAGCGGGCGTTCTGGCGCTGCTTT
+CATGCTTTTCTGGAAAGACCGCGCCCGCTTTTACAGCTACCTGCATCGCGTCTGGTCGAAAACCAGCGATAAACCGGTGTGGATGGATCAGGCCGAAAAA
+GGCAACTGGTGATTTTGATTGCTGAGTTTTGAATATTGAAAACCGCCAGCGGAAACGCTGGCGGTTTTTTATCAGGAAGATGTTCAGAGGAATATTTAGA
+CATCGTTATACCAATCGAAACATATATTCATGAAATATATAAATATTTTCCTAATTGTTCTTATCTGACAGATATCTCACTTAAGGCTTTCTTATAAATC
+GCCTTTCGCCAGCAGACAAATAACCCGATAAAACAAGGATGAGCAGATGAGCGGAAAACCGGCGGCGCGTCAGGGCGACATGACGCAGTATGGCGGTAGC
+ATTGTCCAGGGTTCAGGGGGTACGTCGGTGCCCCACCGGCGTGGCCTGTTCGGTGTGCCCCGGCGGGACGTCCGGCCATCCGGTCAATCCGCTGCTCGGT
+GCAAAGGTCCTTCCCGGTGAAACCGACATCGCCCTGCCCGGCCCGCTGCCGTTCATTCTCTCCGCACCTACAGCAGTTACCGGACAAAACGCCCGCGCCG
+GTGGGGAGCCTCGGCCCCGGCTGGAAAATGCCTGCGGATATCCGCTTACAGCTGCGCGATAACACACTGATACTCAGTGATAACGGCGGCAGAAGCCTGT
+ATTTTGAGCACCTGTTTCCCTGAGGACGGTTACACAGCGAGTCACTGTGGCTGGTGCGGCGGCGTGGCGAAACTGGATGAAGGTCACCGGCTGGCCGCAC
+TCTCTGGCAGGCGCTGCCGGAAGAACTCCGCTTAAGTCCGCATCGTTATCTGGCGACAAACAGTCCGCAGGGGCCGTGGTGGCTGCTCGGCTGGTGTGAG
+CGGGTGCCGGAAGCGGATGAGGTGCTGCCTGCGCCGCTGCCGCCGTACCGGGTACTGACCGGGCTGGTGGACCGCTTCGGGCGCACACAGACGTTCCACC
+GCGAAGCCGCCGGTGAATTCAGCGGCGAAATCACCGGCGTGACGGATGGTGCCGGGCGTCACTTCCGCTGGTACTGACCACGCAGGCGCAGCGGGCAGAA
+GAAGCCCGGCAGCAGGCCATTTCCGGCGGGACGGAACCGTCCGCTTTTCTGATATACCGGGTTACACCGAATATGGCCGGACAACGGCATCCGTCTGTCT
+GCCGTGTGGCTGACGCACGAATACCCGGAGAATTTACCTGCCGCGCCGCTGGTGCGCTATGGCTGGACGCCCGCGGCGAACTGGCGGCGGTGTATGACCG
+CAGCAATACACAGGTGCGCAGCTTTACTTACGATGATAAATACCGGGGCCGGATGGTGGCGCACCGTCACACGGGCCGACCGGAAATCTGTTACCGTTAC
+GACAGCGACGGGCGGGTGACAGAACAGCTAAACCCGGCAGGCTTAAGTTACACGTATCAGTATGAGAAGGACCGCATCACCATCACCGACAGCCTGAACC
+GCCGTGAAGTCCTGCACAAGCAGAAGCGGGCTGAAGGGGTGGTGAAAAGGAACACGCGGACGGCAGCGTCACGCAGAGTCAGTTTGACGCGGTGGGCAGG
+CTCAGGGCACAGACGGATGCCGCAGGCAGGACAACAGAATACAGTCCGGATGTGGTGACGGGCCTCATCACGCATCACCACGCCGGATGGCAGGGCATCG
+GCGTTTTACTATAACCACCACAGCCAGTTAACGTCAGCCACCGGGCCTGACGGGCTACGCCGGGAATATGATGAATGGGGCCGTCTGATTCAGGAAACTG
+CCCCTGACGGCGATATCACCCGCTACCGTTATGATAATCCACACAGTGACTTACCCTGCGC
+>tig00000010 len=6489 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
+CGTCATCTGGCCGAAGCGGTCGTATTCATAACGGGTCTGGTAGCCCGAGCAGTCGGTGAACGCCAGCAACTGCCCGTAGCGGCTCCAGGTCATCTGCCGG
+GTGCTGCCGTCGCATCCGTTGTCGTCGCCGGTAACTCACTGTGCGCGTCATCGTAGCGGTAGCGTACTGTCTCCCCGCTGCGCGATGTCTCCGATACCAG
+CCTGCCCGGTTCATCATATTCCGGCGGCTCTCCAGCCCGTCCGGGGACACCACCGCCGTCAGCTGGTTCCGTCGTTATAGTAAAATTTCGTCTCCCGCCC
+GTCCGGTGTGGTGATGTCCGTGATATCGCCGGACACCACATTCAGACCGTACTCTGTCCTCCGTCCCGCGTCCGTCTGCGCCGTGAGCCTTCCTGCCGCG
+TCATACCCGCTGCGCGTGACGCTGCCGTCCGCCAGTTCTTTTTCACCACCGTTTCAGCCCGGCCCCGCCTTCTGTATGCAGCACCTCACGCCGGTTCAGG
+CTGTCGGTGACGGTGATGCGGTCCTGCTCATAAAGATAGCGGTAGCTTAACCCTGCCGGGTTCAGTTGCTCCACCACCCGCCCCGTATCGTCGTAGCGGT
+AGCGCATCTCCGGCCTTCCCGCGTAACGGTGCGCCACCATCCGGCCCGGGTGCTGCGTCATACGTGAAAGCGCGCACCTGCGTATTGCTGCGGTCATATA
+CCGCCAGCAGTTCACCGGCTTCCGTATGCGTGTACCGCACCAGTGGCGCAGCGGGCAGGCTCTCCGGGTATGCCGGGTCGTGCATCAGCCACACCGCCGA
+AAGGCGGATACCCTGTCGGGGCCGTATTCGGTACCGGGCGGTGTGTCGGGGAACGCTGAGGCTGAGAGAGGGCGGGAACTGTCAGAAGAAGATAGCGAAG
+AGGTGGGCCTCTTCCGCACGCTGCGCCTGCGTGGTCAGCACCAGACGGAACTCCCGCCCGGCACCGTCCGTCACGCCGGTGATTTCCCCGGCCAGGTCAC
+CGGCGGCCTCACGCCGGTACGTCAGCGTCCGCCCGAAGCGGTCCGCCATCCCGGTAAGCACCCGGTACGGCGGCAGCGGCGCTGGCAGTACGTCCTCAGC
+ACCCGGCACCCGCTCAGACCACCCCAGTATCACCACGGCCCCTGTGCGCTGTTGGTCGCCAGGTAAAGATGCGGGCTTAACCGGATATCCGGCGGCAGCG
+CCCCCACAGCCGCGCCAGCGTATGGCCGTCCGGCTGTGCTGCCTTACCACCGCGCACCAGCCACATTGACTCACTGCGGCTGTACACCGCCTCCCCGGCA
+GCAGCGGCTCAAAGTGAATGCTCCGCCCGCCGTTGTCGTTGAGTATCAGTCCGTCATCACGTAGCTGTAAGCGGATATCAGAAGGCGCTTTCAGCCGGGG
+CCGAAAACGCCCACCGGTGCAGGCGTCTTCGTCCGGTAGCTGCTGTAGGTGCGGGAGAGAATGAACGGCAGCGGGCCGGGCAGCGCAAGGTCCGTCTCGC
+CGGGCAGCACCTTCGCCCCCAGCAGCGGATTTACCGGGTTGCCCGAAGTCATCCCGCCCGGACACACCGAGCACGCCACGCCGGTGGGCGCGCCATTCTT
+ACACCTGCCGAACCCTGGACAATGGGACCGCCATACTGAGTCATATCTCCTGACGCGCCGCTGGTTTTCCGCTCATATAAAGTGCCCTTTTAGTTATTGT
+TCATATCCCTGTGTTAGCAACAAAAAATAAAATGACACACAAGACCAGCTAATGTATTTATATATTTTTCACATAAACTTATTTGTTCTCAATCAACAAC
+AACTGTTATTACAGGTCACTTTCAATATTTTATTAAACTAACATTTTGCACAGATGAATTCATCATCAACAAATTCACTATATGGATAATATCCATTCAA
+CGCATATGATTTATGATTTTATTAGTCTGAGTTATTTTTGTAGGGCTATATTTAAAATCAATAAACTCCACCGATTCAGATTAATATCAGCAATAGAAAG
+ATAGAAATCACCAATTCAATAACATCATCAATGAAACATATTGTAGAATTAATTTAAACAAGGCGTTCCATTCAACCAGAACGCCCTTATTTACTCTCAT
+CACCCGCAAACTGCCTGAACAGCGCCTTACCCTTTAACCAGTCGCGCACCCAGCCAGCCGCCGAGCGACAGCAGCAGCGCTCCGCTGCACGGCAGAACAA
+TCCACAATCGCCAGTCTGGCTCCACGGAAAATCAAACACTTTCGCCTGCAACACTGCCAGCGCCGTTTCCGCACCAATTGCGGCCACCAGGCCGGAAACA
+AACCCAAGCATGGCGAACTCACACCACAACGTGGTACGCAGCAGTTTTTCCCGCACCGAGTGTGCGCCACACCACCAGCTCCTGATGACGCTGACGCATT
+CCCACCTGCACCTGTGCCAGCAACAGCAACATACCGCAGGCGGTGACCAGTACCACCATCACTTCCAGCGCCCGACTTACCTGCTCCAGCACCTGACCGA
+CCTGTTTTAAAATCGCGCCAATATCTAACAGGCTAATGGTCGGGAACTGGCGGTTGAGTTGTGTCAACATGCCGTTGCCATTCTCCCAGCGGAAACTGGT
+AAGCCAGCTCTGCGGTTGCCCGTCTAATGCCCTTCAGGGAAAATAAAATAGAAATTAGGCCGCAGACTTTCCCAGTCCACTTTGCGCAGGCTGGTCACTT
+TAGCGCGGAACTCCTGGGTATCGCCCATAAAAGTCACGGTATCACCGAGGGCAACGTTTAAGCGTTTCGCCAGCCCCTCTTCCATCGACACTTCATCGGC
+TTTTGGCGGCCAGTTACCGGCGACAATCGGATTATGATCGGGCGCGTATTTTGCCAGGTAAGATTGAGTTCGCGGTTAAGCGCCTCATCTTCATTACCTT
+CTGTCGGCTTATCGTTAATCGCCGTCAGCCGCGCCCACCACCGGATAAAACGATTCCGGGACTATCTGATGTTCCGCGAGGAACGCTTTTAGCGGTGCTA
+CCTGTTCTGTGGCGATGTTAATTAAAAGTAGTTCGGGCTTTCTGGAGGTAGCTGCTGCCAGCGGTCGAGCAGATCGCCACGCAACACCAGCAGCAGTGCC
+AGCAGCATAAAGGAGAGCGAAAATGCCGAAAGCTGACTTAACGTTGACCACGGCTGACGTAACAGGCGGCTAACCGCCAGGCGCAGAGGCAGCGATTTCA
+GCGTCATGCGGCGAAGTACATTCAGCAGCATCCAGCCCAGCACACCGCAGCAAAGCCAGTACTACCGCGCCCGCCAGCACCGCCCAAAGCAGCATGCTGC
+CACCCATTAATCCGGCGAGCAGCAGCACAACCACCACACTGACAATCGGCAGATAAAACTTCAGCGGCCAGACGTTCGCTACCACATCATTACGTAATAC
+GCGTAAAGGCTGCGTTGCCAGCAACAAGCGATATGGTCGTAGCCCCACCAGCAGCGAGATGACCGTCATGGTGCCAAGCGCCCACAGCCACGGCCAGAGG
+CTGGCTGGCGGTAGTGCAGCAGGCAGAACGGGCTTGAGCAGCACCATCAACACGTTTCGAACAACAGGCCTATGGCCCCACCGGTAACGGCTGAAAGCGT
+CAGCACCATCAACCACTGACCGACGATTAGCTTACGCAGTTGCTCGCCCTGCCCCCAGCGTTTTGAGGATCGCCACCAGATCGTAGCGACTGCGACAGTA
+ATGATTCATCGCTACCGCCACCGCTGCCACTGCCAGCAGCAAGGTCAGAAGCGCCGAAAGCAGCAGGAACTGTTGCGAGCGTTCCATCGATCGCCCCAGC
+GCGCCTTCGTCCTGTTCCAGACCGTACCAGCGTTGTTCGGGTTTAAGCTGGGTAACAACCATTTCATAGCCGTCGAGCTGGTTCTCGTTGCCGCCGAATT
+TATAACGCCAGGTGACCCGACTCCCCGGCTGCACGGCTCCGGTTTTATCGACATCCGCCAGATTCATCATCAGACGCGGAGCCATCTGGAAGGGTTAAAA
+CCGGAATCCGGTTCCTGAATCACTTCTCCGGCAATCCGCAAGGTGGCATCGCCCACGTCAATGGTGTCGCCCGTTTTCAGGTTAAGCAGTGCCATCAGGC
+GTGGGGCCAGCAATACGCTGCCCGCCTGCGGTTTCAGGCCAGGGGATTAGTTTGCAGATCGCCATACATCGGGTAGATATCATCCACCGCTTTGACGTTC
+GCCAGCTGCGGTGTGTCGCCTGCAAAGGTCATTGTGGCGAAAGTCAGCTTGCCGACTTTCAGGCCGCGCTTTGCGCTTCCTCCAGCCACGCTTGCGGCAC
+TTCGCGTGAACTGCGCAACGCCCGATCGCCCGCCATAAACTCACGGCTTTGCTGGCTTAAGCCCTTCTCCATGCGATCGCTGATATTGCCCAGCGCCAGC
+ACGCAGGCCACCGCCAGGCTTAGCGCCAGCCAGACAATTAATAGCGACGGCGAACGCCATTCGCGCCAGAACCAACGTGCAATCATGCTTCCTCCTGCAA
+CTGCCCGTTCACCAGCCGTAAGCAGCGGTCGCAGCGCCGCCAGTTGCAGGTCGTGGGTCACCATAATCAACGTGGTGCCATGTTCACGGTTGAGGAAAAC
+AGCAGGTCGGCAATTTTATCGCCCGTCTGGCGGTCAAGGTTGCCGGTTCGTCGGCAAACAGCATCAGGTCGACCATTAAAGGCTCGTGCCAGCGCCACTC
+GTTGCTGTTCACCGCCGGAAAGCTGTGCCGGAAGATGATCAGACGTTTACCCAGCCCTAACTGTTCGAGCAACGCTTTCGCCCCGTTACGACTTTCCGCG
+CTCTCACCGCGCAGCAGGCCGGAAGCTCGACGTTTTCCAGCGCGTTAAGGGTAGGAATTAACATAAATGACTGAAAAACAAAGCCGACGTGCTTCGCGCG
+CAACTTTGCCCGCGCTTCTTCGTCCATATTATGTGGCGGTTGTCCCCGGAGCTCACTTCGCCACTGCTGCCGTCATCAAGCCCGGCGAGGATCGCCAGCA
+AGGTTGACTTACGATCCCGACTCGCCCACCAGTGCGATGGTCTCGCCGTTTGACAACCAGCTCAACTCCGGTGAGGATGGAGAGTTCATGCTCCCTGACC
+GACGGACTTCTTAAGATGATGAACTTCAACAATGTTTTCCGCTGGCATTTGCCCTTCCTGTTCCTGGTCCCAGTTAACCTTCCGTGCCGCCGCAGCCGTT
+ATTGATTCTGGGTGATAGCCTGAGCGCCGGGTATCGAATGTCTGCCAGCGCGGCCTGGCCTGCCTTGTTGAATGATAAGTGGCAGAGTAAACGTCGGTAG
+TTAATGCCAGCATCAGCGGCGACACCTCGCAACAAGGACTGGCGCCTTCCGGCTCTGCTGAAACAGCATCAGCCGCGTTGGGTGCTGGTTGAACTGGGGG
+CAATGACGGTTTGCGTGGTTTTCAGCCACAGCAAACCGAGCAAACGCTGCGCCAGATTTTGCAGGATGTCAAAGCCGCCAACGCTGAACCATTGTTAATG
+CAAATACGTCTGCCTGCAAACTATGGTCGCCGTTATAATGAAGCCTTTAGCGCCATTTACCCCAAACTCGCCAAAGAGTTTGATGTTCCGCTGCTGCCCT
+TTTTTATGGAAGAGGTCTACCTCAAGCCACAATGGATGCAGGATGACGGTATTCATCCCAACCGCGACGCCCAGCCGTTTATTGCCGACTGGATGGCGAA
+GCAGTTGCAGCCTTTAGTAAATCATGACTCATAAAGCAACGGAGATCCTGACAGGTAAAGTTATGCAAAAATCGGTTAATTACCGGATGTTCCAGTGGAA
+TTGGCCTGGAGCGCTCGAATTAAAACGCCAGGGTTTTCATGCTGGCAGGTTGCCGGAAACCGGATGATGTTGAGCGCACGAACGGCATGGGATTTACCGG
+CGTGTTGATCGATCTGGATTCACCAGAAAGTGTTGATCGCGCAGCCGACGAGGTGATCGCCTGACCGATAATTGTCTGTATGGGATCTTTAACAATGCCG
+GATTCGGCATGTATGGCCCCTTTCCACCATCAGCCGTGCGCAGATGGAACAGCAGTTTCCGCCAACTTTTCGGCGCACACCAGCTCACCATGCGCCTGTT
+ACCCGCGATGTTACCGCACGGTGAGGGCGTATTGTGATGACATCATCGGTGATGGGATTAATCTCCCGCCGGGTCGTGGCGCTTACGCGGCCAGTAAATA
+TGCGCTGGAGGCGTGGTCAGATGCACTGCGCATGGAGCTGCGCCACAGCGGAATTAAAGTCAGCCTGATCGAACCCGGTCCCATTCGTACTCGCTTCACC
+GACAACGTCAACCAGACGCAAAGTGATAAACCAGTCGAAAATCCGGCATCGCCGCCCGCTACGTTGGGACCGGAAGCGGTGGTGGACAAAGTACGCCATG
+CTTTTATTAGCGAAGCCGAAGATGCGCTATCCGGTGACGCTGGTGACCTGGGCGGTAATGGTGCTTAAGCGCCTGCTGCCGGGGCGCGT
+>tig00000011 len=3677 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
+CGGCTCCAGGTCATCTGCCGGGTGCTGCCGTCGCATCCGTTGTCGTCGCCGGTAACTCACTGTGCGCGTCATCGTAGCGGTAGCGTACTGTCTCCCCGCT
+GCGCGATGTCTCCGATACCAGCCTGCCCGGTTCATCATATTCCGGCGGCTCTCCAGCCCGTCCGGGGACACCACCGCCGTCAGCTGGTTCCGTCGTTATA
+GTAAAATTTCGTCTCCCGCCCGTCCGGTGTGGTGATGTCCGTGATATCGCCGGACACCACATTCAGACCGTACTCTGTCCTCCGTCCCGCCGCGTCCGTC
+TGCGCCGTGAGCCTTCCTGCCGCGTCATACCGCTGCGCGTGACGCTGCCGTCCGCCAGTTCTTTTTTCACCGTTTCAGCCCGGCCCCGCCTTCTGTATGC
+AGCACCTCACGCCGGTTCAGGCTGTCGGTGACGGTGATGCGGTCCTGCTCATAAAGATAGCGGTAGCTTAACCCTGCCGGGTTCAGTTGCTCCACCACCC
+GCCCCGTATCGTCGTAGCGGTAGCGCATCTCCGGCCTTCCCGCGTAACGGTGCGCCACCATCCGGCCCGGGTGCTGCGCGTCATACGTGACGCGCACCTG
+CGTATTGCTGCGGTCATATACCGCCAGCAGTTCACCGGCTTCCGTATGCGTGTACCGCACCAGTGGCGCAGCGGGCAGGCTCTCCGGGTATGCCGGGTCG
+TGCATCAGCCACACCGCCGAAAGGCGGATACCCTGTCGGGGCCGTATTCGGTACCGGGCGGTGTCGGGGAACGCTGAGGCTGAGAGGGGGGAACTGTCAG
+AAGAAGATAGCGAAGAGGTGGGCCTCTTCCGCGCTGCGCCTGCGTGGTCAGCACCAGACGGAACTCCCGCCCGGCACCGTCCGTCACGCCGGTGATTTCC
+CGGCCAGGTCACCGGCGGCCTCACGCCGGTACGTCAGCGTCCGCCCGAAGCGGTCCGCCATCCCGGTAAGCACCCGGTACGGCGGCAGCGGCGCTGGCAG
+TACGTCCTCAGCACCCGGCACCCGCTCAGACCACCCCAGTATCACGGCCCCTGTGCGCTGTTGGTCGCCAGGTAAAGATGCGGGCTTAACCGGATATCCG
+GCGGCAGCGCCCCCACAGCCGCGCCAGCGTATGGCCGTCCGGCTGTGCTGCCTTACCACCGCGCACCAGCCACATTGACTCACTGCGGCTGTACACCGCC
+TCCCCGGCAGCAGCGGCTCAAAGTGAATGCTCCGCCCGCCGTTGTCGTTGAGTATCAGTCCGTCATCACGTAGCTGTAAGCGGATATCAGAAGGCGCTTT
+CCAGCCGGGGCCGAAAACGCCCACCGGTGCAGGCGTCTTCGTCCGGTAGCTGCTGTAGGTGCGGGAGAGAATGAACGGCAGCGGGCCGGGCAGCGCAAGG
+TCCGTCTCGCCGGGCAGCACCTTCGCCCCAGCAGCGGATTTACCGGGTTGCCCGAAGTCATCCCGCCCGGACACACCGAGCACGCCACGCCGGTGGGCGC
+GCCAATTTTACACCTGCCGAACCCTGGACAATGGGACCGCCATACTGAGTCATATCTCCTGACGCGCCGCTGGTTTTCCGCTCATAAAGTGCCTTTTAGT
+TATTGTTCATATCCCTGTGTTAGCAACAAAAAATAAAATGACACACAAGACCAGCTAATGTATTTATATATTTTTCACATAAACTTATTTGTTCTCAATC
+AACAACAACTGTTATTACAGGTCACTTTCAATATTTTATTAAACTAACATTTTAGCACAGATGAATTCATCATCAACAAATTCACTATATGGATAATATC
+CATTCAACGCATATGATTTATGATTTTATTAGTCTGAGTTATTTTTGTAGGGCTATATTTAAAATCAATAAACTCCACCGATTCAGATTAATATCAGCAA
+TAGAAAGATAGGAAATCACCAATTCAATAACATCATCAATGAAACATATTGTAGAATTAATTTAAACAAGGCGTTCCATTCAACCAGAACGCCCTTATTT
+ACTCATCACCCGCAAACTGCCTGAACAGCGCCTTACCTTAACCAGTCGCGCAGCCAGCCGCCGAAAGCGACAGCAGCAGCGCTCCGCTGCACGGCAGAAC
+AATCCACAATCGCCAGTCTGGCTCCCACGGAAAATCAAACACTTTCGCCTGCAACACTGCCAGCGCCGTTTCCGCACCAATTGCGGCCACCAGGCCGGAA
+ACAAACCCAAGCATGGCGAACTCACACCACAACGTGGTACGCAGCAGTTTTTCCCGCACCGAGTGTGCGCCACACCACCAGCTCCTGATGACGCTGACGC
+ATTCCCACCTGCACCTGTGCCAGCAACAGCAACATACCGCAGGCGGTGACCAGTACCACCATCACTTCCAGCGCCCGACTTACCTGCTCCAGCACCTGAC
+CGACCTGTTTTAAAATCGCGCCAATATCTAACAGGCTAATGGTCGGGAACTGGCGGTTGAGTTGTGTCAACATGCCGTTGCCATTCTCCCAGCGGAAACT
+GGTAAGCCAGCTCTGCGGTTGCCCGTCTAATGCCCTTCAGGGAAAATAAAATAGAAATTAGGCCGCAGACTTTCCCAGTCCACTTTGCGCAGGCTGGTCA
+CTTTAGCGCGGAACTCCTGGGTATCGCCCATAAAAGTCACGGTATCACCGAGGGCAACGTTTAAGCGTTTCGCCAGCCCCTCTTCCATCGACACTTCATC
+GGCTTTTGGCGGCCAGTTACCGGCGACAATCGGATTATGATCGGGCCGCGTATTTTGCCAGGTAAGATTGAGTTCGCGGTTAAGCGCCTCATCTTCATTA
+CCTTCTGTCGGCTTATCGTTAATCGCCGTCAGCCGCGCCGCACCACCGGATAAAACGATTCCGGGACTATCTGATGTTCCGCGAACGCTTTAGCGGTGCT
+ACCTGTTCTGTGGCGATGTTAATTAAAAAGTAGTTCGGGCTTTCTGGAGGTAGCTGCTGCTGCCAGCGGTCGAGCAGATCGCCACGCAACACCAGCAGCA
+GTGCCAGCAGCATAAAGGAGCGAAAATGCCGAAAGCTGACTTAACGTTGACCACGGCTGACGTAACAGGCGGCTAACCGCCAGGCGCAGAGGCAGCGATT
+TCAGCGTCATGCGGCGAAGTACATTCAGCAGCATCCAGCCCAGCACACCGCACAGCAAAGCCAGTACTACCGCGCCCGCCAGCACCGCCCAAAGCAGCAT
+GCGCCACCCATTAATCCGGCGAGCAGCAGCACAACCACCACACTGACAATCGGCAGATAAAACTTCAGCGGCCAGACGTTCGCTACCACATCATTACGTA
+ATACGCGTAAAGGCTGCGTTGCCAGCAACAAGCGATATGGTCGTAGCCCGCAGCGAGATGACCGTCATGGTGCCAAGCGCCCAGCCACGGCCAGAGGCTG
+GCTGGCGGTAGTGCAGCAGGCAGAACGGGCTTGAGCAGCACCATCAACACGTTTCGAACAACAGGCCTATGGCCCCACCGGTAACGGCTGAAAGCGTCAG
+CACCATCAACCACTGACCGACGATTAGCTTACGCAGTTGCGCTCGCCCTGCCCCCAGCGTTTTGAGGATCGCCACCAGATCGTAGCGACTGCGACAGTAA
+TGATTCATCGCTACCGCCACCGCTGCCACTGCCAGCAGCAAGGTCAGAAGCGCCGAAAGCAGCGGGAACTGTTGCGA
+>tig00000012 len=8727 reads=1 covStat=0.00 gappedBases=no class=unassm suggestRepeat=no suggestCircular=no
+AGTGCTGGCTACGTTCAGACCAAAATAGAACAGCACCGGAGTGGTCATCGACTGTTCAGAACCTGTTGCAGGTTAGATTCGTTAATGTTGACAATATTTT
+CTACGGACATGGAGTCGCTCTCTGTTGTCGATATTTTCTTTGACATGGGGGCTTAAGCGCGCTTCAACTCACCTGCAATATTTTGTCCATCACGCGCCCC
+GGCAGCAGGCGCTTAAGCACCATTACCGCCCAGGTCACCAGCGTCACCGGATAGCGCATCTTCGGCTTCTCGCTAATAAAAGCATGGCGTACTTTGTCCA
+CCACCGCTTCCGGTCCCAACGTAAAGCGGGCGGCGATGCCGGGATTTTCGACTGGTTTATCACTTTGCGTCTGGTTGACGTTGTCGGTGAAGCGAGTACG
+AATGGGACCGGGTTCGATCAGGCTGACTTTAATTCCGCTGTGGCGCAGCTCCATGCGCAGTGCATCTGACCACGCCTCCAGCGCATATTTACTGGCCGCG
+TAAGCGCCACGACCCGGCATTGAGATTAATCCCATCACCGATGATGTCATCACAATACGCCCTTCACCGTGCGGTAACATCGCGGGTAACAGGCGCATGG
+TGAGCTGGTGTGCGCCGAAAAGTTGGCGGAAACTGCTGTTCCATCTGCGCACGGCTGATGGTGGAAAGGGCCATACATGCCGAATCCGGCATTGTTAAAG
+ATCCCATACAGACAGGTATCGGTCAGGGCGATCACCTCGTCGGCTGCGCGATCAACACTTTCTGGTGAATCCAGATCGATCAACACGCCGGTAAATCCCA
+TGCTGTTCGCGCGCTCAACATCATCCGGTTTCCGGCAACCTGCCAGCGACGAAAACCCTGGCGTTTTAATTCGAGCGCGCTTTCCAGGCCAATTCCACTG
+GAACATCCGGTAATTAAGACCGATTTTTGCATAACTTTACCTGTCAGGGATCTCCGTTGCTTTATGAGTCATGATTTACTAAGGCTGCAACTGCTTCGCC
+ATCCAGTCGGCAATAAACGGCTGGGCGTCGCGGTTGGGATGAATACCGTCATCCTGCATCCATTGTGGCTTGTGGAGCCTCTTCCATAAAAAGGGCAGCA
+GCGGAACATCAAACTCTTTGGCGAGTTTGGGGTAAATGGCGCTAAAGGCTTCATTATAACGGCGACCATAGTTTGCAGGCAGACGTATTTGCATTAACAA
+TGGTTCAGCGTTGGCGGCTTTGACATCCTGCAAAATCTGGCGCAGCGTTTGCTCGGTTTGCTGTGGCTGAAAACCACGCAAACCGTCATTGCCGCCAGTT
+CAACCAACCCAACGCGGCTGATGCTGTTTCAGCAGAGCCGGAAGGCGCGCCAGTCCTTGTTGCGAGGTGTCGCCGCTGATGCTGGCATTAACTACCGACG
+TTTTTACTCTGCCACTTATCATTCAACAAGGCAGGCCAGGCCGCGCTGGCAGACATTCGATACCCGGCGCTCAGGCTATCACCCAGAATCAATAACGTGT
+CCTGCGGCGTACGGGAAGGTTAATGGGACCAGGAACAGGAAGGGCAAATGCCAGCGGAAAACATTGTTGAAGTTCATCATCTTAAGAAGTCCGTCGGTCA
+GGGAGCATGAACTCTCATCCTCACCGGAGTTGAGCTGGTTGTCAAACGTGCGAGACCATCGCACTGGTGGGCGAGTCGGATCGGTAAGTCAACCTTGCTG
+GCGATCCTCGCCGGGCTTGATGACGGCAGCAGTGGCGAAGTGAGTCTGGTGGACAACCGCTACATAATATGGACGAAGCGCGGGCAAAGTTGCGCGCGAA
+GCACGTCGGCTTTGTTTTTCAGTCATTTATGTTAATTCCTACCCTTAACGCGCTGGAAAACGTCGAGCTTCCGGCTCTGCTGCGCGGTGAGTAGCGCGGA
+AAGTCGTAACGGGGCGAAAGCGTTGCTCGAACAGTTAGGGCTGGGTAAACGTCTGATCATCTTCCGGCACAGCTTTCCGGCGGTGAACAGCAACGAGTGG
+CGCTGGCACGAGCCTTTAATGGTCGACCTGATGTGCTGTTTGCCGACGAACCCACCGGCAACCTTGACCGCCAGACGGGCGATAAAATTGCCGACCTGCT
+GTTTTCCTCAACCGTGAACATGGCACCACGTTGATTATGGTGACCCACGACCTGCAACTGGCGGCACGCTGCGACCGCTGCTTACGGCTGGTGAACGGGC
+AGTTGCAGGAGGAAGCATGATTGCACGTTGGTTCTGGCGCGAATGGCGTTCGCCGTCGCTATTAATTGTCTGGCTGGCGCTAAGCCTGGCGGTGGCCTGC
+GTGCTGGCGCTGGGCAATATCAGCGATCGCATGGAGAAGGGCTTAAGCCAGCAAAGCCGTGAGTTTATGGCGGGCGATCGGGCGTTGCGCAGTTCACGCG
+AAGTGCCGCAAGCGTGGCTGGAGGAAGCGCAAAGCGCGGCCTGAAAGTCGGCAAAGCTGACTTTCGCCACAATGACCTTTGCAGGCGACACACCGCAGCT
+GGCGAACGTCAAAGCGGTGGATGATATCTACCCGATGTATGGCGATCTGCAAACTAATCCCCTGGCCTGAAACCGCAGGCGGGCAGCGTATTGCTGGCCC
+CACGCCTGATGGCACTGCTTAACCTGAAAACGGGCGACACCATTGACGTGGGCGATGCCACCTTGCGGATTGCCGGAGAAGTGATTCAGGAACCGGATTC
+CGGTTTTAACCCTTCCAGATGGCTCCGCGTCTGATGATGAATCTGGCGGATGTCGATAAAACCGGAGCCGTGCAGCCGGAGTCGGGTCACCTGGCGTTAT
+AAATTCGGCGGCAACGAGAACCAGCTCGACGGCTATGAGAAATGGTTGTTACCCCTCAGCTTAAACCCGAACAACGCTGGTACGGTCTGGAACAGGACGA
+AGGCGCGCTGGGGCGATCGATGGAACGCTCGCAACAGTTCCTGCTGCTTTCGGCGCTTCTGACCTTGCTGCTGGCAGTGGCAGCGGTGGCGGTAGCGATG
+AATCATTACTGTCGCAGTCGCTACGATCTGGTGGCGATCCTCAAAACGCTGGGGGCAGGGCGAGCGCAACTGCGCGTAAGCTAATCGTCGGTCAGTGGTT
+GATGGTGCTGACGCTTTCAGCCGTTACCGGTGGGGCCATAGGCCTGTTGTTCGAAACGTGTTGATGGTGCTGCTCAAGCCCGTTCTGCCTGCTGCACTAC
+CGCCAGCCAGCCTCTGGCCGTGGCTGTGGGCGCTTGGCACCATGACGGTCATCTCGCTGCTGGTGGGGCTACGACCATATCGCTTGTTGCTGGCAACGCA
+GCCTTTACGCGTATTACGTAATGATGTGGTAGCGAACGTCTGGCCGCTGAAGTTTTATCTGCCGATTGTCAGTGTGGTGGTTGTGCTGCTGCTCGCCGGA
+TTAATGGGTGGCAGCATGCTGCTTTGGGCGGTGCTGGCGGGCGCGGTAGTACTGGCTTTGCTGTGCGGTGTGCTGGGCTGGATGCTGCTGAATGTACTTC
+GCCGCATGACGCTGAAATCGCTGCCTCTCTGCGCCTGGCGGTTAGCCGCCTGTTACGTCAGCCGTGGTCAACGTTAAGTCAGCTTTCGGCATTTTCGCTC
+TCCTTTATGCTGCTGGCACTGCTGCTGGTGTTGCGTGGCGATCTGCTCGACCGCTGGCAGCAGCAGCTACCTCAAGAAAGCCCGAACTACTTTTTAATTA
+ACATCGCCACAGAACAGGTAGCACCGCTAAAGCGTTCCTCGCGGAACATCAGATAGTCCCGGAATCGTTTTATCCGGTGGTGCGGGCGCGGCTGACGGCG
+ATTAACGATAAGCCGACAGAAGGTAATGAAGATGAGGCGCTTAACCGCGAACTCAATCTTACCTGGCAAAATACGCGGCCCGATCATAATCCGATTGTCG
+CCGGTAACTGGCCGCCAAAAGCCGATGAAGTGTCGATGGAAGAGGGGCTGGCGAAACGCTTAAACGTTGCCCTCGGTGATACCGTGACTTTTATGGGCGA
+TACCCAGGAGTTCCGCGCTAAAGTGACCAGCCTGCGCAAAGTGGACTGGGAAAGTCTGCGGCCTAATTTCTATTTTATTTTCCCTGAAGGGCATTAGACG
+GGCAACCGCAGAGCTGGCTTACCAGTTTCCGCTGGGAGAATGGCAACGGCATGTTGACACAACTCAACCGCCAGTTCCCGACCATTAGCCTGTTAGATAT
+TGGCGCGATTTT