Mercurial > repos > bgruening > deeptools
changeset 30:5231f398d784 draft
planemo upload for repository https://github.com/fidelram/deepTools/tree/master/galaxy/wrapper/ commit 3bc1d1c6f4e28ac7ff8df79fe4e3f00a195938e6-dirty
line wrap: on
line diff
--- a/bamCompare.xml Tue Sep 16 13:46:05 2014 -0400 +++ b/bamCompare.xml Tue Oct 20 14:43:12 2015 -0400 @@ -1,59 +1,59 @@ <tool id="deeptools_bamCompare" name="bamCompare" version="@WRAPPER_VERSION@.0"> <description>normalizes and compares two BAM files to obtain the ratio, log2ratio or difference. (bam2bigwig)</description> - <expand macro="requirements" /> - <expand macro="stdio" /> <macros> <token name="@BINARY@">bamCompare</token> <import>deepTools_macros.xml</import> </macros> + <expand macro="requirements" /> <command> +<![CDATA[ bamCompare @THREADS@ - --bamfile1 '$bamFile1' - -bai1 '${bamFile1.metadata.bam_index}' - --bamfile2 '$bamFile2' - -bai2 '${bamFile2.metadata.bam_index}' + --bamfile1 '$bamFile1' + -bai1 '${bamFile1.metadata.bam_index}' + --bamfile2 '$bamFile2' + -bai2 '${bamFile2.metadata.bam_index}' - --outFileName '$outFileName' - --outFileFormat '$outFileFormat' + --outFileName '$outFileName' + --outFileFormat '$outFileFormat' - --fragmentLength $fragmentLength - --binSize $binSize + --fragmentLength $fragmentLength + --binSize $binSize - #if $scaling.method == 'SES': - --scaleFactorsMethod SES - --sampleLength $scaling.sampleLength - #elif $scaling.method == 'readCount': - --scaleFactorsMethod readCount - #elif $scaling.method == 'own': - --scaleFactors '$scaling.scaleFactor1:$scaling.scaleFactor2' - #end if + #if $scaling.method == 'SES': + --scaleFactorsMethod SES + --sampleLength $scaling.sampleLength + #elif $scaling.method == 'readCount': + --scaleFactorsMethod readCount + #elif $scaling.method == 'own': + --scaleFactors '$scaling.scaleFactor1:$scaling.scaleFactor2' + #end if - --ratio $comparison.type + --ratio $comparison.type - #if $comparison.type=='subtract': - #if $comparison.normalization.type=='rpkm': - --normalizeUsingRPKM - #elif $comparison.normalization.type=='1x': + #if $comparison.type=='subtract': + #if $comparison.normalization.type=='rpkm': + --normalizeUsingRPKM + #elif $comparison.normalization.type=='1x': - #if $comparison.normalization.effectiveGenomeSize.effectiveGenomeSize_opt == "specific": - --normalizeTo1x $comparison.normalization.effectiveGenomeSize.effectiveGenomeSize - #else: - --normalizeTo1x $comparison.normalization.effectiveGenomeSize.effectiveGenomeSize_opt - #end if + #if $comparison.normalization.effectiveGenomeSize.effectiveGenomeSize_opt == "specific": + --normalizeTo1x $comparison.normalization.effectiveGenomeSize.effectiveGenomeSize + #else: + --normalizeTo1x $comparison.normalization.effectiveGenomeSize.effectiveGenomeSize_opt + #end if - #end if - #elif $comparison.type in ['ratio','log2']: - --pseudocount $comparison.pseudocount - #end if + #end if + #elif $comparison.type in ['ratio','log2']: + --pseudocount $comparison.pseudocount + #end if - #if str($region).strip() != '': - --region '$region' - #end if + #if str($region).strip() != '': + --region '$region' + #end if - #if $advancedOpt.showAdvancedOpt == "yes": + #if $advancedOpt.showAdvancedOpt == "yes": #if $advancedOpt.smoothLength: --smoothLength '$advancedOpt.smoothLength' #end if @@ -68,27 +68,26 @@ --missingDataAsZero $advancedOpt.missingDataAsZero #if str($advancedOpt.ignoreForNormalization).strip() != '': - --ignoreForNormalization $advancedOpt.ignoreForNormalization + --ignoreForNormalization '$advancedOpt.ignoreForNormalization' #end if - - #end if - + #if $samFlag: + --samFlag $samFlag + #end if + #end if +]]> </command> - <inputs> <param name="bamFile1" format="bam" type="data" label="First BAM file (e.g. treated sample)" help="The BAM file must be sorted."/> - <param name="bamFile2" format="bam" type="data" label="Second BAM file (e.g. control sample)" help="The BAM file must be sorted."/> - - <param name="fragmentLength" type="integer" value="300" min="1" + <param name="fragmentLength" type="integer" value="200" min="1" label="Length of the average fragment size" - help ="Reads will be extended to match this length unless they are paired-end, in which case they will be extended to match the fragment length. If this value is set to the read length or smaller, the read will not be extended. *Warning* the fragment length affects the normalization to 1x (see "normalize coverage to 1x"). The formula to normalize using the sequencing depth is genomeSize/(number of mapped reads * fragment length). *NOTE*: If the BAM files contain mated and unmated paired-end reads, unmated reads will be extended to match the fragment length."/> + help ="Reads will be extended to match this length unless they are paired-end, in which case they will be extended to match the fragment length. If this value is set to the read length or smaller, the read will not be extended. *Warning* the fragment length affects the normalization to 1x (see "normalize coverage to 1x"). The formula to normalize using the sequencing depth is genomeSize/(number of mapped reads * fragment length). *NOTE*: If the BAM files contain mated and unmated paired-end reads, unmated reads will be extended to match the fragment length. (--fragmentLength)"/> <param name="binSize" type="integer" value="50" min="1" label="Bin size in bp" - help="The genome will be divided in bins (also called tiles) of the specified length. For each bin the overlaping number of fragments (or reads) will be reported. If only half a fragment overlaps, this fraction will be reported. "/> + help="The genome will be divided in bins (also called tiles) of the specified length. For each bin the overlaping number of fragments (or reads) will be reported. If only half a fragment overlaps, this fraction will be reported. (--binSize)"/> <conditional name="scaling"> <param name="method" type="select" @@ -104,20 +103,21 @@ </when> <when value="readCount" /> <when value="own"> - <param name="scaleFactor1" type="float" value="1" - label="Scale factor for treatment"/> - - <param name="scaleFactor2" type="float" value="1" - label="Scale factor for input"/> + <expand macro="scaleFactor" /> </when> </conditional> <conditional name="comparison"> <param name="type" type="select" - label="How to compare the two files"> - <option value="log2" selected="true">compute log2 of the number of reads ratio</option> - <option value="ratio">compute the ratio of the number of reads</option> - <option value="subtract">compute difference (subtract input from treatment) of the number of reads</option> + label="How to compare the two files" + help="The default is to output the log2ratio between the two samples. + The reciprocal ratio returns the negative of the inverse of the ratio if + the ratio is less than 0. The resulting values are interpreted as negative fold changes."> + <option value="log2" selected="true">Compute log2 of the number of reads ratio</option> + <option value="ratio">Compute the ratio of the number of reads</option> + <option value="subtract">Compute difference (subtract input from treatment) of the number of reads</option> + <option value="add">Compute the sum of number of reads</option> + <option value="reciprocal_ratio">Computes the fold change. If the fold change is less than 1, the negative of the inverse is reported. E.g. A fold change of 10 to 5 would be reported not as 0.5 but as -2</option> </param> <when value="log2"> <expand macro="pseudocount" /> @@ -125,6 +125,10 @@ <when value="ratio"> <expand macro="pseudocount" /> </when> + <when value="add" /> + <when value="reciprocal_ratio"> + <expand macro="pseudocount" /> + </when> <when value="subtract"> <conditional name="normalization"> <param name="type" type="select" label="Normalization method" > @@ -145,9 +149,7 @@ <option value="bigwig" selected="true">bigwig</option> <option value="bedgraph">bedgraph</option> </param> - <expand macro="region_limit_operation" /> - <conditional name="advancedOpt"> <param name="showAdvancedOpt" type="select" label="Show advanced options" > <option value="no" selected="true">no</option> @@ -155,32 +157,19 @@ </param> <when value="no" /> <when value="yes"> - <param name="smoothLength" type="integer" value="1" optional="true" min="1" label="Smooth values using the following length (in bp)" - help ="The smooth length defines a window, larger than the bin size, to average the number of reads. For example, if the bin size is set to 20 bp and the smooth length is set to 60 bp, then, for each bin size the average of it and its left and right neighbors is considered. Any value smaller than the bin size will be ignored and no smoothing will be applied."/> - - <param name="doNotExtendPairedEnds" type="boolean" truevalue="--doNotExtendPairedEnds" falsevalue="" - label="Do not extend paired ends" - help="If set, reads are not extended to match the fragment length reported in the BAM file, instead they will be extended to match the fragment length. Default is to extend the reads if paired end information is available."/> - - <param name="ignoreDuplicates" type="boolean" truevalue="--ignoreDuplicates" falsevalue="" - label="Ignore duplicates" - help="If set, reads that have the same orientation and start position will be considered only once. If reads are paired, the mate position also has to coincide to ignore a read." /> - - <param name="minMappingQuality" type="integer" optional="true" value="1" min="1" - label="Minimum mapping quality (e.g. BOWTIE2 measures)" - help= "If set, only reads that have a mapping quality score higher than the given value are considered. *Note* Bowtie's Mapping quality is related to uniqueness: the higher the score, the more unique is a read. A mapping quality defined by Bowtie of 10 or less indicates that there is at least a 1 in 10 chance that the read truly originated elsewhere."/> - + help ="The smooth length defines a window, larger than the bin size, to average the number of reads. For example, if the bin size is set to 20 bp and the smooth length is set to 60 bp, then, for each bin size the average of it and its left and right neighbors is considered. Any value smaller than the bin size will be ignored and no smoothing will be applied. (--smoothLength)"/> + <expand macro="doNotExtendPairedEnds" /> + <expand macro="ignoreDuplicates" /> + <expand macro="minMappingQuality" /> <expand macro="missingDataAsZero" /> - <param name="ignoreForNormalization" type="text" value="" size="50" label="regions that should be excluded for calculating the scaling factor" help="Sometimes it makes sense to exclude certain regions when calculating the scaling factor. For example, if you know some regions that you suspect to be present more often in your sample's genome than in the reference genome that will therefore accumulate reads (CNV). Another typical example is the single X chromosome in male samples that should be scaled separately from the diploid autosomes. For example chrX,chrY,chr3. or chr10:12220-128932" /> - + <expand macro="samFlag" /> </when> </conditional> - </inputs> <outputs> <data format="bigwig" name="outFileName"> @@ -190,8 +179,21 @@ </change_format> </data> </outputs> + <tests> + <test> + <param name="bamFile1" value="bowtie2-test1.bam" ftype="bam" /> + <param name="bamFile2" value="bowtie2-test1.bam" ftype="bam" /> + <param name="showAdvancedOpt" value="no" /> + <param name="outFileFormat" value="bigwig" /> + <param name="fragmentLength" value="100" /> + <param name="outFileFormat" value="bedgraph" /> + <param name="binSize" value="5" /> + <param name="type" value="ratio" /> + <output name="outFileName" file="bamCompare_result1.bg" ftype="bedgraph" /> + </test> + </tests> <help> - +<![CDATA[ **What it does** This tool compares two BAM files based on the number of mapped reads. To @@ -224,7 +226,7 @@ ----- @REFERENCES@ - +]]> </help> <expand macro="citations" /> </tool>
--- a/bamCorrelate.xml Tue Sep 16 13:46:05 2014 -0400 +++ b/bamCorrelate.xml Tue Oct 20 14:43:12 2015 -0400 @@ -1,12 +1,12 @@ <tool id="deeptools_bamCorrelate" name="bamCorrelate" version="@WRAPPER_VERSION@.0"> <description>correlates pairs of BAM files</description> - <expand macro="requirements" /> - <expand macro="stdio" /> <macros> <token name="@BINARY@">bamCorrelate</token> <import>deepTools_macros.xml</import> </macros> + <expand macro="requirements" /> <command> +<![CDATA[ #set files=[] #set labels=[] @@ -18,8 +18,8 @@ @THREADS@ - --bamfiles #echo " ".join($files) - --labels #echo " ".join($labels) + --bamfiles '#echo "' '".join($files)#' + --labels '#echo "' '".join($labels)#' --fragmentLength $fragmentLength --corMethod $corMethod @@ -28,7 +28,7 @@ #if $output.showOutputSettings == "yes" --outRawCounts '$outFileRawCounts' --outFileCorMatrix '$outFileCorMatrix' - --plotFileFormat $output.outFileFormat + --plotFileFormat '$output.outFileFormat' #else: --plotFileFormat 'png' #end if @@ -37,7 +37,6 @@ --binSize '$mode.binSize' --distanceBetweenBins '$mode.distanceBetweenBins' $mode.doNotRemoveOutliers - #else: --BED $mode.region_file #end if @@ -47,6 +46,10 @@ --region '$mode.region' #end if + #if $plotTitle and str($plotTitle).strip() != "": + --plotTitle '$plotTitle' + #end if + $plotNumbers #if $mode.advancedOpt.showAdvancedOpt == "yes": $mode.advancedOpt.doNotExtendPairedEnds @@ -66,14 +69,18 @@ --colorMap '$mode.advancedOpt.colorMap' #end if +]]> </command> <inputs> <expand macro="multiple_input_bams" /> - <param name="fragmentLength" type="integer" value="300" min="1" + <param name="fragmentLength" type="integer" value="200" min="1" label="Length of the average fragment size" - help ="Reads will be extended to match this length unless they are paired-end, in which case they will be extended to match the fragment length. *NOTE*: If the BAM files contain mated and unmated paired-end reads, unmated reads will be extended to match the fragment length."/> + help ="Reads will be extended to match this length unless they are paired-end, + in which case they will be extended to match the fragment length. + *NOTE*: If the BAM files contain mated and unmated paired-end reads, unmated reads will + be extended to match the fragment length. (--fragmentLength)"/> <param name="corMethod" type="select" label="Correlation method"> <option value="spearman" selected="True">Spearman</option> @@ -82,14 +89,18 @@ <conditional name="mode"> <param name="modeOpt" type="select" label="Choose computation mode" - help="In the bins mode, the correlation is computed based on equal length bins. In the BED file mode, as list of genomic regions in BED format has to be given. For each region in the BED file the number of overlapping reads is counted in each of the BAM files. Then the correlation is computed."> + help="In the bins mode, the correlation is computed based on equal + length bins. In the BED file mode, as list of genomic regions in BED + format has to be given. For each region in the BED file the number of + overlapping reads is counted in each of the BAM files. + Then the correlation is computed."> <option value="bins" selected="true">Bins</option> <option value="BED-file">Limit correlation to certain regions (BED file)</option> </param> <when value="bins"> <param name="binSize" type="integer" value="10000" min="1" label="Bin size in bp" - help="Length in base pairs for a window used to sample the genome."/> + help="Length in base pairs for a window used to sample the genome. (--binSize)"/> <param name="distanceBetweenBins" type="integer" value="0" min="0" label="Distance between bins" @@ -97,7 +108,7 @@ the specified 'Bin size'. However, to reduce the computation time, a larger distance between bins can by given. Larger distances result in less bins being - considered"/> + considered. (--distanceBetweenBins)"/> <param name="doNotRemoveOutliers" type="boolean" truevalue="--doNotRemoveOutliers" falsevalue="" label="Do not filter outliers" @@ -111,17 +122,19 @@ bamCorrelate tries to remove outliers using the median absolute deviation (MAD) method applying a threshold of 200 to only consider extremely large - deviations from the median."/> + deviations from the median. (--doNotRemoveOutliers)"/> <expand macro="bamCorrelate_mode_actions" /> </when> <when value="BED-file"> - <param name="region_file" type="data" format="bed" label="Region file in BED format" help="Correlation is computed for the number of reads that overlap such regions."/> + <param name="region_file" type="data" format="bed" + label="Region file in BED format" + help="Correlation is computed for the number of reads that overlap such regions."/> <expand macro="bamCorrelate_mode_actions" /> </when> - </conditional> - + <expand macro="plotTitle" /> + <expand macro="plotNumbers" /> <conditional name="output"> <param name="showOutputSettings" type="select" label="Show advanced output settings" > <option value="no" selected="true">no</option> @@ -155,8 +168,24 @@ </filter> </data> </outputs> + <tests> + <test> + <repeat name="input_files"> + <param name="bamfile" value="bowtie2-test1.bam" ftype="bam" /> + <param name="label" value="first BAM file" /> + </repeat> + <repeat name="input_files"> + <param name="bamfile" value="bowtie2-test1.bam" ftype="bam" /> + <param name="label" value="second BAM file" /> + </repeat> + <param name="modeOpt" value="bins" /> + <param name="binSize" value="10" /> + <param name="showOutputSettings" value="no" /> + <output name="outFileName" file="bamCorrelate_result1.png" ftype="png" compare="sim_size" /> + </test> + </tests> <help> - +<![CDATA[ **What it does** This tool is useful to assess the overall similarity of different BAM files. A typical application @@ -183,7 +212,7 @@ ----- @REFERENCES@ - +]]> </help> <expand macro="citations" /> </tool>
--- a/bamCoverage.xml Tue Sep 16 13:46:05 2014 -0400 +++ b/bamCoverage.xml Tue Oct 20 14:43:12 2015 -0400 @@ -1,68 +1,71 @@ <tool id="deeptools_bamCoverage" name="bamCoverage" version="@WRAPPER_VERSION@.0"> <description> generates a coverage bigWig file from a given BAM file. Multiple options are available to count reads and normalize coverage. (bam2bigwig)</description> - <expand macro="requirements" /> - <expand macro="stdio" /> <macros> <token name="@BINARY@">bamCoverage</token> <import>deepTools_macros.xml</import> </macros> + <expand macro="requirements" /> <command> +<![CDATA[ bamCoverage - @THREADS@ + @THREADS@ - --bam '$bamInput' - --bamIndex ${bamInput.metadata.bam_index} - --outFileName '$outFileName' - --outFileFormat '$outFileFormat' + --bam '$bamInput' + --bamIndex ${bamInput.metadata.bam_index} + --outFileName '$outFileName' + --outFileFormat '$outFileFormat' - --fragmentLength $fragmentLength - --binSize $binSize + --fragmentLength $fragmentLength + --binSize $binSize - #if $scaling.type=='rpkm': - --normalizeUsingRPKM - #elif $scaling.type=='1x': - #if $scaling.effectiveGenomeSize.effectiveGenomeSize_opt == "specific": - --normalizeTo1x $scaling.effectiveGenomeSize.effectiveGenomeSize - #else: - --normalizeTo1x $scaling.effectiveGenomeSize.effectiveGenomeSize_opt - #end if - #elif $scaling.type=='own': - --scaleFactor $scaling.scaleFactor - #end if - - #if str($region).strip() != '': - --region '$region' - #end if - - #if $advancedOpt.showAdvancedOpt == "yes": - #if $advancedOpt.smoothLength: - --smoothLength '$advancedOpt.smoothLength' + #if $scaling.type=='rpkm': + --normalizeUsingRPKM + #elif $scaling.type=='1x': + #if $scaling.effectiveGenomeSize.effectiveGenomeSize_opt == "specific": + --normalizeTo1x $scaling.effectiveGenomeSize.effectiveGenomeSize + #else: + --normalizeTo1x $scaling.effectiveGenomeSize.effectiveGenomeSize_opt + #end if + #elif $scaling.type=='own': + --scaleFactor $scaling.scaleFactor #end if - $advancedOpt.doNotExtendPairedEnds - $advancedOpt.ignoreDuplicates - - #if $advancedOpt.minMappingQuality: - --minMappingQuality '$advancedOpt.minMappingQuality' + #if str($region).strip() != '': + --region '$region' #end if - --missingDataAsZero $advancedOpt.missingDataAsZero + #if $advancedOpt.showAdvancedOpt == "yes": + #if $advancedOpt.smoothLength: + --smoothLength '$advancedOpt.smoothLength' + #end if + + $advancedOpt.doNotExtendPairedEnds + $advancedOpt.ignoreDuplicates - ##if str($advancedOpt.ignoreForNormalization).strip() != '': - ## --ignoreForNormalization $advancedOpt.ignoreForNormalization - ##end if + #if $advancedOpt.minMappingQuality: + --minMappingQuality '$advancedOpt.minMappingQuality' + #end if + + --missingDataAsZero $advancedOpt.missingDataAsZero - #end if + ##if str($advancedOpt.ignoreForNormalization).strip() != '': + ## --ignoreForNormalization $advancedOpt.ignoreForNormalization + ##end if + #if $samFlag: + --samFlag $samFlag + #end if + #end if +]]> </command> <inputs> <param name="bamInput" format="bam" type="data" label="BAM file" help="The BAM file must be sorted."/> - <param name="fragmentLength" type="integer" value="300" min="1" + <param name="fragmentLength" type="integer" value="200" min="1" label="Length of the average fragment size" - help ="Reads will be extended to match this length unless they are paired-end, in which case they will be extended to match the fragment length. If this value is set to the read length or smaller, the read will not be extended. *Warning* the fragment length affects the normalization to 1x (see "normalize coverage to 1x"). Sequencing depth is defined as: (total number of mapped reads * fragment length) / effective genome size. *NOTE*: If the BAM files contain mated and unmated paired-end reads, unmated reads will be extended to match the fragment length."/> + help ="Reads will be extended to match this length unless they are paired-end, in which case they will be extended to match the fragment length. If this value is set to the read length or smaller, the read will not be extended. *Warning* the fragment length affects the normalization to 1x (see "normalize coverage to 1x"). Sequencing depth is defined as: (total number of mapped reads * fragment length) / effective genome size. *NOTE*: If the BAM files contain mated and unmated paired-end reads, unmated reads will be extended to match the fragment length. (--fragmentLength)"/> <param name="binSize" type="integer" value="50" min="1" label="Bin size in bp" @@ -102,22 +105,13 @@ <when value="yes"> <param name="smoothLength" type="integer" value="1" optional="true" min="1" label="Smooth values using the following length (in bp)" - help ="The smooth length defines a window, larger than the bin size, to average the number of reads. For example, if the bin size is set to 20 bp and the smooth length is set to 60 bp, then, for each bin size the average of it and its left and right neighbors is considered. Any value smaller than the bin size will be ignored and no smoothing will be applied."/> - - <param name="doNotExtendPairedEnds" type="boolean" truevalue="--doNotExtendPairedEnds" falsevalue="" - label="Do not extend paired ends" - help="If set, reads are not extended to match the fragment length reported in the BAM file, instead they will be extended to match the fragment length. Default is to extend the reads if paired end information is available."/> + help ="The smooth length defines a window, larger than the bin size, to average the number of reads. For example, if the bin size is set to 20 bp and the smooth length is set to 60 bp, then, for each bin size the average of it and its left and right neighbors is considered. Any value smaller than the bin size will be ignored and no smoothing will be applied. (--smoothLength)"/> - <param name="ignoreDuplicates" type="boolean" truevalue="--ignoreDuplicates" falsevalue="" - label="Ignore duplicates" - help="If set, reads that have the same orientation and start position will be considered only once. If reads are paired, the mate position also has to coincide to ignore a read." /> - - <param name="minMappingQuality" type="integer" optional="true" value="1" min="1" - label="Minimum mapping quality" - help= "If set, only reads that have a mapping quality score higher than the given value are considered. *Note* Bowtie's Mapping quality is related to uniqueness: the higher the score, the more unique is a read. A mapping quality defined by Bowtie of 10 or less indicates that there is at least a 1 in 10 chance that the read truly originated elsewhere."/> - + <expand macro="doNotExtendPairedEnds" /> + <expand macro="ignoreDuplicates" /> + <expand macro="minMappingQuality" /> <expand macro="missingDataAsZero" /> - + <expand macro="samFlag" /> <!-- <param name="ignoreForNormalization" type="text" value="" size="50" label="regions that should be excluded for calculating the scaling factor" help="Sometimes it makes sense to exclude certain regions when calculating the scaling factor. For example, if you know some regions that you suspect to be present more often in your sample's genome than in the reference genome that will therefore accumulate reads (CNV). Another typical example is the single X chromosome in male samples that should be scaled separately from the diploid autosomes. For example chrX,chrY,chr3. or chr10:12220-128932" /> @@ -133,8 +127,46 @@ </change_format> </data> </outputs> + <tests> + <test> + <param name="bamInput" value="bowtie2-test1.bam" ftype="bam" /> + <param name="outFileFormat" value="bigwig" /> + <param name="showAdvancedOpt" value="no" /> + <param name="binSize" value="10" /> + <param name="type" value="no" /> + <output name="outFileName" file="bamCoverage_result1.bw" ftype="bigwig" /> + </test> + <test> + <param name="bamInput" value="bowtie2-test1.bam" ftype="bam" /> + <param name="outFileFormat" value="bigwig" /> + <param name="showAdvancedOpt" value="no" /> + <param name="binSize" value="10" /> + <output name="outFileName" file="bamCoverage_result2.bw" ftype="bigwig" /> + </test> + <test> + <param name="bamInput" value="bowtie2-test1.bam" ftype="bam" /> + <param name="outFileFormat" value="bedgraph" /> + <param name="showAdvancedOpt" value="no" /> + <param name="binSize" value="10" /> + <output name="outFileName" file="bamCoverage_result3.bg" ftype="bedgraph" /> + </test> + <test> + <param name="bamInput" value="phiX.bam" ftype="bam" /> + <param name="outFileFormat" value="bigwig" /> + <param name="showAdvancedOpt" value="no" /> + <param name="binSize" value="10" /> + <output name="outFileName" file="bamCoverage_result4.bw" ftype="bigwig" /> + </test> + <test> + <param name="bamInput" value="phiX.bam" ftype="bam" /> + <param name="outFileFormat" value="bedgraph" /> + <param name="showAdvancedOpt" value="no" /> + <param name="binSize" value="10" /> + <output name="outFileName" file="bamCoverage_result4.bg" ftype="bedgraph" /> + </test> + </tests> <help> - +<![CDATA[ **What it does** Given a BAM file, this tool generates a bigWig or bedGraph file of fragment or @@ -160,7 +192,7 @@ ----- @REFERENCES@ - +]]> </help> <expand macro="citations" /> </tool>
--- a/bamFingerprint.xml Tue Sep 16 13:46:05 2014 -0400 +++ b/bamFingerprint.xml Tue Oct 20 14:43:12 2015 -0400 @@ -1,62 +1,61 @@ <tool id="deeptools_bamFingerprint" name="bamFingerprint" version="@WRAPPER_VERSION@.0"> <description>plots profiles of BAM files; useful for assesing ChIP signal strength</description> - <expand macro="requirements" /> - <expand macro="stdio" /> <macros> <token name="@BINARY@">bamFingerprint</token> <import>deepTools_macros.xml</import> </macros> + <expand macro="requirements" /> <command> +<![CDATA[ @multiple_input_bams@ - bamFingerprint + bamFingerprint + + @THREADS@ - @THREADS@ + --bamfiles #echo " ".join($files) + --labels #echo " ".join($labels) + + --fragmentLength $fragmentLength - --bamfiles #echo " ".join($files) - --labels #echo " ".join($labels) + --plotFile $outFileName - --fragmentLength $fragmentLength - - #set newoutFileName=str($outFileName)+".png" - --plotFile $newoutFileName + #if $output.showOutputSettings == "yes" + --plotFileFormat $output.outFileFormat + #if $output.saveRawCounts: + --outRawCounts '$outFileRawCounts' + #end if + #else + --plotFileFormat 'png' + #end if - #if $output.showOutputSettings == "yes" - --plotFileFormat $output.outFileFormat - #if $output.saveRawCounts: - --outRawCounts '$outFileRawCounts' - #end if - #else - --plotFileFormat 'png' - #end if + #if str($region).strip() != '': + --region '$region' + #end if - #if str($region).strip() != '': - --region '$region' - #end if + #if $advancedOpt.showAdvancedOpt == "yes": + --binSize '$advancedOpt.binSize' + --numberOfSamples '$advancedOpt.numberOfSamples' - #if $advancedOpt.showAdvancedOpt == "yes": - --binSize '$advancedOpt.binSize' - --numberOfSamples '$advancedOpt.numberOfSamples' + $advancedOpt.doNotExtendPairedEnds + $advancedOpt.ignoreDuplicates + $advancedOpt.skipZeros - $advancedOpt.doNotExtendPairedEnds - $advancedOpt.ignoreDuplicates - $advancedOpt.skipZeros + #if $advancedOpt.minMappingQuality: + --minMappingQuality '$advancedOpt.minMappingQuality' + #end if - #if $advancedOpt.minMappingQuality: - --minMappingQuality '$advancedOpt.minMappingQuality' - #end if - #end if - ; mv $newoutFileName $outFileName - ; rm $temp_dir -rf + #if $advancedOpt.plotTitle and str($advancedOpt.plotTitle.value) != "": + --plotTitle '$advancedOpt.plotTitle' + #end if + + #end if +]]> </command> <inputs> <expand macro="multiple_input_bams" /> - - - <param name="fragmentLength" type="integer" value="200" min="1" - label="Length of the average fragment size"/> - + <expand macro="fragmentLength" /> <expand macro="region_limit_operation" /> <conditional name="advancedOpt"> @@ -66,32 +65,19 @@ </param> <when value="no" /> <when value="yes"> - <param name="binSize" type="integer" value="10000" min="1" + <param name="binSize" type="integer" value="500" min="1" label="Bin size in bp" help="Length in base pairs for a window used to sample the genome."/> - <param name="numberOfSamples" type="integer" value="100000" min="1" label="Number of samples" - help="Number of samples taken from the genome to compute the scaling factors"/> - - <param name="doNotExtendPairedEnds" type="boolean" truevalue="--doNotExtendPairedEnds" falsevalue="" - label="Do not extend paired ends" - help="If set, reads are not extended to match the fragment length reported in the BAM file, instead they will be extended to match the fragment length. Default is to extend the reads if paired end information is available."/> - - <param name="ignoreDuplicates" type="boolean" truevalue="--ignoreDuplicates" falsevalue="" - label="Ignore duplicates" - help="If set, reads that have the same orientation and start position will be considered only once. If reads are paired, the mate position also has to coincide to ignore a read." /> - - <param name="minMappingQuality" type="integer" optional="true" value="1" min="1" - label="Minimum mapping quality" - help= "If set, only reads that have a mapping quality score higher than the given value are considered. *Note* Bowtie's Mapping quality is related to uniqueness: the higher the score, the more unique is a read. A mapping quality defined by Bowtie of 10 or less indicates that there is at least a 1 in 10 chance that the read truly originated elsewhere."/> - - <param name="skipZeros" type="boolean" truevalue="--skipZeros" falsevalue="" - label ="Include zeros" - help ="If set, then zero counts that happen for *all* BAM files given are ignored. This might have the effect that fewer regions are considered than indicated in the option where the number of samples is defined." /> + help="Number of samples taken from the genome to compute the scaling factors. (--numberOfSamples)"/> + <expand macro="doNotExtendPairedEnds" /> + <expand macro="ignoreDuplicates" /> + <expand macro="minMappingQuality" /> + <expand macro="skipZeros" /> + <expand macro="plotTitle" /> </when> </conditional> - <conditional name="output"> <param name="showOutputSettings" type="select" label="Show advanced output settings"> <option value="no" selected="true">no</option> @@ -100,10 +86,9 @@ <when value="no" /> <when value="yes"> <expand macro="input_image_file_format" /> - <param name="saveRawCounts" type="boolean" label="Save the bin counts"/> + <param name="saveRawCounts" type="boolean" label="Save the bin counts" help="(--outRawCounts)"/> </when> </conditional> - </inputs> <outputs> <expand macro="output_image_file_format" /> @@ -116,8 +101,22 @@ </filter> </data> </outputs> + <tests> + <test> + <repeat name="input_files"> + <param name="bamfile" value="bowtie2-test1.bam" ftype="bam" /> + </repeat> + <repeat name="input_files"> + <param name="bamfile" value="bowtie2-test1.bam" ftype="bam" /> + </repeat> + <param name="fragmentLength" value="200" /> + <param name="showAdvancedOpt" value="no" /> + <param name="showOutputSettings" value="no" /> + <output name="outFileName" file="bamFingerprint_result1.png" ftype="png" compare="sim_size" /> + </test> + </tests> <help> - +<![CDATA[ **What it does** This tool is useful to assess the strength of a ChIP (i.e. how clearly the enrichment signal can be separated from the background signal) @@ -146,7 +145,7 @@ ----- @REFERENCES@ - +]]> </help> <expand macro="citations" /> </tool>
--- a/bamPEFragmentSize.xml Tue Sep 16 13:46:05 2014 -0400 +++ b/bamPEFragmentSize.xml Tue Oct 20 14:43:12 2015 -0400 @@ -1,27 +1,22 @@ <tool id="deeptools_bamPEFragmentSize" name="bamPEFragmentSize" version="@WRAPPER_VERSION@.0"> - <description>Given a BAM file it samples several regions to estimate the paird-end fragment length</description> - <expand macro="requirements" /> - <expand macro="stdio" /> + <description>Given a BAM file it samples several regions to estimate the paired-end fragment length</description> <macros> <token name="@BINARY@">bamPEFragmentSize</token> <import>deepTools_macros.xml</import> </macros> + <expand macro="requirements" /> <command> <![CDATA[ bamPEFragmentSize - - @THREADS@ - - --bam '$bamInput' - --bamIndex ${bamInput.metadata.bam_index} - #if $histogram: - --histogram $histogram_outfile - #end if - > $outfile - + @THREADS@ + -bai ${bamInput.metadata.bam_index} + #if $histogram: + --histogram ./hist.png + #end if + '$bamInput' + > $outfile ]]> </command> - <inputs> <param name="bamInput" format="bam" type="data" label="BAM file" help="The BAM file must be sorted."/> @@ -30,13 +25,21 @@ help="(--histogram)"/> </inputs> <outputs> - <data format="txt" name="outfile" label="${tool.name} on ${on_string}" /> - <data name="histogram_outfile" format="tabular" from_work_dir="quant_bias_corrected.sf" label="${tool.name} on ${on_string} (Bias corrected Quantification)"> - <filter>histogram == '--histogram'</filter> + <data name="outfile" format="txt"/> + <data name="histogram_outfile" from_work_dir="hist.png" format="png"> + <filter>histogram is True</filter> </data> </outputs> + <tests> + <test> + <param name="bamInput" value="bowtie2-test1.bam" ftype="bam" /> + <param name="histogram" value="True" /> + <output name="outfile" file="bamPEFragmentSize_result1.txt" ftype="txt" /> + <output name="histogram_outfile" file="bamPEFragmentSize_histogram_result1.png" ftype="png" compare="sim_size" /> + </test> + </tests> <help> - +<![CDATA[ **What it does** Given a BAM file it samples several regions to estimate the paird-end fragment length. @@ -44,7 +47,7 @@ ----- @REFERENCES@ - +]]> </help> <expand macro="citations" /> </tool>
--- a/bigwigCompare.xml Tue Sep 16 13:46:05 2014 -0400 +++ b/bigwigCompare.xml Tue Oct 20 14:43:12 2015 -0400 @@ -1,12 +1,12 @@ <tool id="deeptools_bigwigCompare" name="bigwigCompare" version="@WRAPPER_VERSION@.0"> <description>normalizes and compares two bigWig files to obtain the ratio, log2ratio or difference</description> - <expand macro="requirements"/> - <expand macro="stdio" /> <macros> <token name="@BINARY@">bigwigCompare</token> <import>deepTools_macros.xml</import> </macros> + <expand macro="requirements"/> <command> +<![CDATA[ bigwigCompare @THREADS@ @@ -17,9 +17,9 @@ --outFileName '$outFileName' --outFileFormat '$outFileFormat' - --ratio $comparison.type + --ratio $comparison.comparison_select - #if $comparison.type in ['ratio','log2']: + #if $comparison.comparison_select in ['ratio','log2']: --pseudocount $comparison.pseudocount #end if @@ -33,21 +33,28 @@ --scaleFactors '$advancedOpt.scaleFactor1:$advancedOpt.scaleFactor2' --binSize $advancedOpt.binSize + #if $advancedOpt.plotTitle and str($advancedOpt.plotTitle.value) != "": + --plotTitle '$advancedOpt.plotTitle' + #end if + #end if +]]> </command> <inputs> <param name="bigwigFile1" format="bigwig" type="data" label="Treatment bigwig file" /> <param name="bigwigFile2" format="bigwig" type="data" label="bigWig file" /> - <conditional name="comparison"> - <param name="type" type="select" - label="How to compare the two files"> + <param name="comparison_select" type="select" + label="How to compare the two files" + help="The default is to output the log2ratio between the two samples. + The reciprocal ratio returns the negative of the inverse of the ratio if + the ratio is less than 0. The resulting values are interpreted as negative fold changes. (--ratio)"> <option value="log2" selected="true">compute log2 of the number of reads ratio</option> <option value="ratio">compute the ratio of the number of reads</option> <option value="subtract">compute difference (subtract input from treatment) of the number of reads</option> <option value="add">compute the sum over all reads</option> - <option value="reciprocal_ratio">compute the reciprocal ratio of the number of reads</option> + <option value="reciprocal_ratio">Computes the fold change. If the fold change is less than 1, the negative of the inverse is reported. E.g. A fold change of 10 to 5 would be reported not as 0.5 but as -2</option> </param> <when value="log2"> <expand macro="pseudocount" /> @@ -57,7 +64,9 @@ </when> <when value="subtract" /> <when value="add" /> - <when value="reciprocal_ratio" /> + <when value="reciprocal_ratio"> + <expand macro="pseudocount" /> + </when> </conditional> <param name="outFileFormat" type="select" label="Coverage file format"> @@ -75,29 +84,54 @@ <when value="no" /> <when value="yes"> <param name="binSize" type="integer" value="50" min="1" - label="Bin size in bp" - help="Size of the bins in bp for the output of the bigwig/bedgraph file "/> - + label="Length, in base pairs, of the non-overlapping bin for averaging the score over the regions length" + help="Size of the bins in bp for the output of the bigwig/bedgraph file. (--binSize)"/> <param name="missingDataAsZero" type="boolean" truevalue="yes" falsevalue="no" checked="True" label ="Treat missing data as zero" - help ="This parameter determines if missing data should be replaced with a zero. If set to "no", missing data will be ignored and will not be included in the output file at all. Missing data is defined as those regions for which no value exists in *any* of the bigwig files. The decision to include or exclude missing data depends on the interpretation of the data. Missing data in a bigwig file may mean that there is no information available for certain regions, for example a repetitive region that is not being considered. In the same file regions with low coverage may get zero read counts. If missing data is replaced by zero, this would convert the excluded repetitive regions into regions of low coverage." /> - - <param name="scaleFactor1" type="float" value="1" label="Scale factor for treatment"/> - <param name="scaleFactor2" type="float" value="1" label="Scale factor for input"/> + help ="This parameter determines if missing data should be replaced with a zero. + If set to "no", missing data will be ignored and will not be included in the + output file at all. Missing data is defined as those regions for which no value exists in + *any* of the bigwig files. The decision to include or exclude missing data depends on + the interpretation of the data. Missing data in a bigwig file may mean that there is no + information available for certain regions, for example a repetitive region that is not + being considered. In the same file regions with low coverage may get zero read counts. + If missing data is replaced by zero, this would convert the excluded repetitive regions + into regions of low coverage. (--missingDataAsZero)" /> + <expand macro="scaleFactor" /> + <expand macro="plotTitle" /> </when> </conditional> </inputs> <outputs> <data format="bigwig" name="outFileName"> - <change_format> - <when input="outFileFormat" value="bigwig" format="bigwig" /> - <when input="outFileFormat" value="bedgraph" format="bedgraph" /> - </change_format> + <change_format> + <when input="outFileFormat" value="bigwig" format="bigwig" /> + <when input="outFileFormat" value="bedgraph" format="bedgraph" /> + </change_format> </data> </outputs> - - <help> - + <tests> + <test> + <param name="bigwigFile1" value="test.bw" ftype="bigwig" /> + <param name="bigwigFile2" value="test.bw" ftype="bigwig" /> + <param name="showAdvancedOpt" value="no" /> + <param name="outFileFormat" value="bigwig" /> + <param name="binSize" value="5" /> + <param name="comparison_select" value="ratio" /> + <output name="outFileName" file="bigwigCompare_result1.bw" ftype="bigwig" /> + </test> + <test> + <param name="bigwigFile1" value="test.bw" ftype="bigwig" /> + <param name="bigwigFile2" value="test.bw" ftype="bigwig" /> + <param name="showAdvancedOpt" value="no" /> + <param name="outFileFormat" value="bedgraph" /> + <param name="binSize" value="10" /> + <param name="comparison_select" value="ratio" /> + <output name="outFileName" file="bigwigCompare_result2.bg" ftype="bedgraph" /> + </test> + </tests> + <help> +<![CDATA[ **What it does** This tool compares two bigwig files based on the number of mapped reads. To @@ -110,7 +144,7 @@ ----- @REFERENCES@ - +]]> </help> <expand macro="citations" /> </tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/bigwigCorrelate.xml Tue Oct 20 14:43:12 2015 -0400 @@ -0,0 +1,184 @@ +<tool id="deeptools_bigwigCorrelate" name="bigwigCorrelate" version="@WRAPPER_VERSION@.0"> + <description>correlates pairs of BigWig files</description> + <macros> + <token name="@BINARY@">bigwigCorrelate</token> + <import>deepTools_macros.xml</import> + </macros> + <expand macro="requirements" /> + <command> +<![CDATA[ + #set files=[] + #set labels=[] + + @multiple_input_bigwigs@ + + bigwigCorrelate + + $mode.modeOpt + + @THREADS@ + + --bwfiles '#echo "' '".join($files)#' + --labels '#echo "' '".join($labels)#' + #if $filterPercentile: + --filterPercentile $filterPercentile + #end if + --corMethod $corMethod + + --plotFile $outFileName + + #if $output.showOutputSettings == "yes" + --outRawCounts '$outFileRawCounts' + --outFileCorMatrix '$outFileCorMatrix' + --plotFileFormat '$output.outFileFormat' + #else: + --plotFileFormat 'png' + #end if + + #if $mode.modeOpt == "bins": + --binSize '$mode.binSize' + #else: + --BED $mode.region_file + #end if + + #### options available in both modes + #if str($region.value) != '': + --region '$region' + #end if + + #if $advancedOpt.showAdvancedOpt == "yes": + + $advancedOpt.includeZeros + + #if $advancedOpt.zMin: + --zMin $advancedOpt.zMin + #end if + #if $advancedOpt.zMax: + --zMax $advancedOpt.zMax + #end if + --colorMap '$advancedOpt.colorMap' + + #if $plotTitle and str($plotTitle).strip() != "": + --plotTitle '$plotTitle' + #end if + $plotNumbers + + #end if +]]> + </command> + + <inputs> + <expand macro="multiple_input_bigwigs" /> + + <param name="filterPercentile" type="float" optional="True" value="" min="0.0" max="100.0" + label="Percentile used to filter out extreme outliers" + help ="If not specified, it is automatically set to 99.9 in analyses + using Pearson correlation! This means that values + above that threshold, which consistently occur in all + datasets, will not be taken into account for the + correlation analysis. This behavior can be overridden + by a user specified value from within the 0.0 to 100.0 + range. (--filterPercentile)"/> + + <param name="corMethod" type="select" label="Correlation method" help="(--corMethod)"> + <option value="spearman" selected="True">Spearman</option> + <option value="pearson">Pearson</option> + </param> + + <conditional name="mode"> + <param name="modeOpt" type="select" label="Choose computation mode" + help="In the bins mode, the correlation is computed based on equal length bins. + In the BED file mode, as list of genomic regions in BED format has to be given. + For each region in the BED file the number of overlapping reads is counted in + each of the BAM files. Then the correlation is computed."> + <option value="bins" selected="true">Bins</option> + <option value="BED-file">Limit correlation to certain regions (BED file)</option> + </param> + <when value="bins"> + <param name="binSize" type="integer" value="10000" min="1" + label="Bin size in bp" + help="Length in base pairs for a window used to sample the genome. (--binSize)"/> + </when> + <when value="BED-file"> + <param name="region_file" type="data" format="bed" + label="Region file in BED format" + help="Correlation is computed for the number of reads that overlap such regions."/> + </when> + </conditional> + + <expand macro="bigwigCorrelate_mode_actions" /> + <conditional name="output"> + <param name="showOutputSettings" type="select" label="Show advanced output settings" > + <option value="no" selected="true">no</option> + <option value="yes">yes</option> + </param> + <when value="no" /> + <when value="yes"> + <expand macro="input_image_file_format"/> + <param name="saveRawCounts" type="boolean" label="Save the bin counts"/> + <param name="saveCorMatrix" type="boolean" label="Save the correlation matrix"/> + </when> + </conditional> + + </inputs> + <outputs> + <expand macro="output_image_file_format" /> + <data format="tabular" name="outFileRawCounts" label="${tool.name} on ${on_string}: bin counts"> + <filter> + (( + output['showOutputSettings'] == 'yes' and + output['saveRawCounts'] is True + )) + </filter> + </data> + <data format="tabular" name="outFileCorMatrix" label="${tool.name} on ${on_string}: correlation matrix"> + <filter> + (( + output['showOutputSettings'] == 'yes' and + output['saveCorMatrix'] is True + )) + </filter> + </data> + </outputs> + <tests> + <test> + <repeat name="input_files"> + <param name="bigwigfile" value="test.bw" ftype="bigwig" /> + <param name="label" value="first bigwig file" /> + </repeat> + <repeat name="input_files"> + <param name="bigwigfile" value="test.bw" ftype="bigwig" /> + <param name="label" value="second bigwig file" /> + </repeat> + <param name="modeOpt" value="bins" /> + <param name="binSize" value="10" /> + <param name="showOutputSettings" value="no" /> + <param name="corMethod" value="spearman" /> + <output name="outFileName" file="bigwigCorrelate_result1.png" ftype="png" compare="sim_size" /> + </test> + </tests> + <help> +<![CDATA[ +**What it does** + +bigwigCorrelate computes the overall similarity between two or more bigWig +files based on coverage means of genomic regions. The correlation analysis +is performed for the entire genome by running the program in 'bins' mode, +or for certain regions only in 'BED-file' mode. Pearson or Spearman analyses +are available to compute correlation coefficients. Results are saved to a +heat map file. Further output files are optional. + + +**Output files**: + +- **diagnostic plot**: clustered heatmap displaying the values for each pair-wise correlation +- data matrix (optional): if you want to plot the correlation values using a different program, e.g. R, this matrix can be used + + +----- + +@REFERENCES@ +]]> + </help> + <expand macro="citations" /> +</tool>
--- a/computeGCBias.xml Tue Sep 16 13:46:05 2014 -0400 +++ b/computeGCBias.xml Tue Oct 20 14:43:12 2015 -0400 @@ -1,12 +1,12 @@ <tool id="deeptools_computeGCBias" name="computeGCBias" version="@WRAPPER_VERSION@.0"> <description>to see whether your samples should be normalized for GC bias</description> - <expand macro="requirements" /> - <expand macro="stdio" /> <macros> <token name="@BINARY@">computeGCBias</token> <import>deepTools_macros.xml</import> </macros> + <expand macro="requirements" /> <command> +<![CDATA[ ln -s $bamInput local_bamInput.bam; ln -s $bamInput.metadata.bam_index local_bamInput.bam.bai; @@ -30,7 +30,6 @@ #end if #if $advancedOpt.showAdvancedOpt == "yes": - --sampleSize '$advancedOpt.sampleSize' --regionSize '$advancedOpt.regionSize' @@ -47,6 +46,7 @@ --biasPlot $outImageName --plotFileFormat $image_format #end if +]]> </command> <inputs> <param name="bamInput" format="bam" type="data" label="BAM file" @@ -54,11 +54,7 @@ <expand macro="reference_genome_source" /> <expand macro="effectiveGenomeSize" /> - - <param name="fragmentLength" type="integer" value="300" min="1" - label="Fragment length used for the sequencing" - help ="If paired-end reads are used, the fragment length is computed from the BAM file."/> - + <expand macro="fragmentLength" /> <expand macro="region_limit_operation" /> <conditional name="advancedOpt"> @@ -69,21 +65,28 @@ <when value="no" /> <when value="yes"> <param name="sampleSize" type="integer" value="50000000" min="1" - label="Number of sampling points to be considered" /> - + label="Number of sampling points to be considered" help="(--sampleSize)" /> <param name="regionSize" type="integer" value="300" min="1" label="Region size" - help ="To plot the reads per GC over a region, the size of the region is required (see below for more details of the mthod). By default, the bin size is set to 300 bp, which is close to the standard fragment size many sequencing applications. However, if the depth of sequencing is low, a larger bin size will be required, otherwise many bins will not overlap with any read."/> - + help ="To plot the reads per GC over a region, the size of the region is + required (see below for more details of the mthod). By default, the bin size + is set to 300 bp, which is close to the standard fragment size many sequencing + applications. However, if the depth of sequencing is low, a larger bin size will + be required, otherwise many bins will not overlap with any read. (--regionSize)"/> <param name="filterOut" type="data" format="bed" optional="true" label="BED file containing genomic regions to be excluded from the estimation of the correction" - help="Such regions usually contain repetitive regions and peaks that if included will bias the correction. It is recommended to filter out known repetitive regions if multi-reads (reads that map to more than one genomic position) were excluded. In the case of ChIP-seq data, it is recommended to first use a peak caller to identify and filter out the identified peaks." /> + help="Such regions usually contain repetitive regions and peaks that if included will + bias the correction. It is recommended to filter out known repetitive regions if multi-reads + (reads that map to more than one genomic position) were excluded. In the case of ChIP-seq data, + it is recommended to first use a peak caller to identify and filter out the identified peaks. (--filterOut)" /> <param name="extraSampling" type="data" format="bed" optional="true" label="BED file containing genomic regions for which extra sampling is required because they are underrepresented in the genome" - help="" /> + help="(--extraSampling)" /> </when> </conditional> - <param name="image_format" type="select" label="GC bias plot" help="If given, a diagnostic image summarizing the GC bias found on the sample will be created."> + <param name="image_format" type="select" + label="GC bias plot" + help="If given, a diagnostic image summarizing the GC bias found on the sample will be created. (--plotFileFormat)"> <option value="none">No image</option> <option value="png" selected="true">Image in png format</option> <option value="pdf">Image in pdf format</option> @@ -93,8 +96,8 @@ </param> </inputs> <outputs> - <data format="tabular" name="outFileName" /> - <data format="png" name="outImageName" label="${tool.name} GC-bias Plot"> + <data name="outFileName" format="tabular" /> + <data name="outImageName" format="png" label="${tool.name} GC-bias Plot"> <filter> (( image_format != 'none' @@ -108,8 +111,25 @@ </change_format> </data> </outputs> + <tests> + <test> + <param name="bamInput" value="paired_chr2L.bam" ftype="bam" /> + <param name="image_format" value="png" /> + <param name="showAdvancedOpt" value="yes" /> + <param name="regionSize" value="1" /> + <param name="fragmentLength" value="100" /> + <param name="ref_source" value="history" /> + <param name="input1" value="sequence.2bit" /> + <param name="sampleSize" value="10" /> + <param name="effectiveGenomeSize_opt" value="specific" /> + <param name="effectiveGenomeSize" value="23011544" /> + <param name="region" value="chr2L" /> + <param name="image_format" value="none" /> + <output name="outFileName" file="computeGCBias_result1.tabular" ftype="tabular" /> + </test> + </tests> <help> - +<![CDATA[ **What it does** This tool computes the GC bias using the method proposed by Benjamini and Speed (2012) Nucleic Acids Res. (see below for more explanations) @@ -150,7 +170,7 @@ ----- @REFERENCES@ - +]]> </help> <expand macro="citations" /> </tool>
--- a/computeMatrix.xml Tue Sep 16 13:46:05 2014 -0400 +++ b/computeMatrix.xml Tue Oct 20 14:43:12 2015 -0400 @@ -1,197 +1,262 @@ <tool id="deeptools_computeMatrix" name="computeMatrix" version="@WRAPPER_VERSION@.0"> - <description>summarizes and prepares an intermediary file containing scores associated with genomic regions that can be used afterwards to plot a heatmap or a profile</description> - <expand macro="requirements" /> - <expand macro="stdio" /> + <description>preparation step to plot a heatmap or a profile</description> <macros> <token name="@BINARY@">computeMatrix</token> <import>deepTools_macros.xml</import> </macros> + <expand macro="requirements" /> <command> +<![CDATA[ #import tempfile - #set $temp_input_handle = tempfile.NamedTemporaryFile() - #set $temp_input_path = $temp_input_handle.name - #silent $temp_input_handle.close() + #for $rf in $regionsFiles: + cat "$rf.regionsFile" >> ./temp_input_path; + #if str($rf.label.value).strip(): + echo "\#$rf.label.value" >> ./temp_input_path; + #else: + echo "\#$rf.regionsFile.name" >> ./temp_input_path; + #end if + #end for - #for $rf in $regionsFiles: - cat "$rf.regionsFile" >> $temp_input_path; - #if str($rf.label.value).strip(): - echo "\#$rf.label.value" >> $temp_input_path; - #else: - echo "\#$rf.regionsFile.name" >> $temp_input_path; - #end if - #end for + computeMatrix + $mode.mode_select + --regionsFileName ./temp_input_path + --scoreFileName '$scoreFile' + --outFileName '$outFileName' - computeMatrix + @THREADS@ - $mode.mode_select - --regionsFileName '$temp_input_path' - --scoreFileName '$scoreFile' - --outFileName '$outFileName' + #if $output.showOutputSettings == "yes" + #if $output.saveData: + --outFileNameData '$outFileNameData' + #end if + #if $output.saveMatrix: + --outFileNameMatrix '$outFileNameMatrix' + #end if - @THREADS@ + #if $output.saveSortedRegions: + --outFileSortedRegions '$outFileSortedRegions' + #end if + #end if - #if $output.showOutputSettings == "yes" - #if $output.saveData: - --outFileNameData '$outFileNameData' - #end if - #if $output.saveMatrix: - --outFileNameMatrix '$outFileNameMatrix' - #end if - - #if $output.saveSortedRegions: - --outFileSortedRegions '$outFileSortedRegions' - #end if - #end if + #if $mode.mode_select == "reference-point": + --referencePoint $mode.referencePoint + $mode.nanAfterEnd + --beforeRegionStartLength $mode.beforeRegionStartLength + --afterRegionStartLength $mode.afterRegionStartLength + #else + --regionBodyLength $mode.regionBodyLength + --startLabel "$mode.startLabel" + --endLabel "$mode.endLabel" + #if $mode.regionStartLength.regionStartLength_select == "yes": + --beforeRegionStartLength $mode.regionStartLength.beforeRegionStartLength + --afterRegionStartLength $mode.regionStartLength.afterRegionStartLength + #end if + #end if - #if $mode.mode_select == "reference-point": - --referencePoint $mode.referencePoint - $mode.nanAfterEnd - --beforeRegionStartLength $mode.beforeRegionStartLength - --afterRegionStartLength $mode.afterRegionStartLength - #else - --regionBodyLength $mode.regionBodyLength - --startLabel "$mode.startLabel" - --endLabel "$mode.endLabel" - #if $mode.regionStartLength.regionStartLength_select == "yes": - --beforeRegionStartLength $mode.regionStartLength.beforeRegionStartLength - --afterRegionStartLength $mode.regionStartLength.afterRegionStartLength - #end if - #end if + #if $advancedOpt.showAdvancedOpt == "yes": + --sortRegions '$advancedOpt.sortRegions' + --sortUsing '$advancedOpt.sortUsing' + --averageTypeBins '$advancedOpt.averageTypeBins' + $advancedOpt.missingDataAsZero + $advancedOpt.skipZeros + --binSize $advancedOpt.binSize - #if $advancedOpt.showAdvancedOpt == "yes": - --sortRegions '$advancedOpt.sortRegions' - --sortUsing '$advancedOpt.sortUsing' - --averageTypeBins '$advancedOpt.averageTypeBins' - $advancedOpt.missingDataAsZero - $advancedOpt.skipZeros - --binSize $advancedOpt.binSize + #if $advancedOpt.minThreshold is not None and str($advancedOpt.minThreshold) != '': + --minThreshold $advancedOpt.minThreshold + #end if + #if $advancedOpt.maxThreshold is not None and str($advancedOpt.maxThreshold) != '': + --maxThreshold $advancedOpt.maxThreshold + #end if + #if $advancedOpt.scale is not None and str($advancedOpt.scale) != '': + --scale $advancedOpt.scale + #end if + + #end if +]]> + </command> + <inputs> - #if $advancedOpt.minThreshold: - --minThreshold $advancedOpt.minThreshold - #end if - #if $advancedOpt.maxThreshold: - --maxThreshold $advancedOpt.maxThreshold - #end if - #if $advancedOpt.scale: - --scale $advancedOpt.scale - #end if + <repeat name="regionsFiles" title="regions to plot" min="1"> + <param name="regionsFile" format="bed" type="data" label="Regions to plot" + help="File, in BED format, containing the regions to plot."/> + <param name="label" type="text" size="30" optional="true" value="" label="Label" + help="Label to use in the output."/> + </repeat> - #end if - ; rm $temp_input_path - - </command> - <inputs> + <param name="scoreFile" format="bigwig" type="data" + label="Score file" + help="Should be a bigWig file (containing a score, usually covering + the whole genome). You can generate a bigWig file either from a + bedGraph or WIG file using UCSC tools or from a BAM file using the + deepTool bamCoverage. (-scoreFile)"/> - <repeat name="regionsFiles" title="regions to plot" min="1"> - <param name="regionsFile" format="bed" type="data" label="Regions to plot" help="File, in BED format, containing the regions to plot."/> - <param name="label" type="text" size="30" optional="true" value="" label="Label" help="Label to use in the output."/> - </repeat> - - <param name="scoreFile" format="bigwig" type="data" label="Score file" help="Should be a bigWig file (containing a score, usually covering the whole genome). You can generate a bigWig file either from a bedGraph or WIG file using UCSC tools or from a BAM file using the deepTool bamCoverage."/> + <conditional name="mode" > + <param name="mode_select" type="select" + label="computeMatrix has two main output options" + help="In the scale-regions mode, all regions in the BED file are + stretched or shrunk to the same length (bp) that is indicated + by the user. Reference-point refers to a position within the BED + regions (e.g start of region). In the reference-point mode only + those genomic positions before (downstream) and/or after (upstream) + the reference point will be plotted."> + <option value="scale-regions" selected="true">scale-regions</option> + <option value="reference-point">reference-point</option> + </param> - <conditional name="mode" > - <param name="mode_select" type="select" label="computeMatrix has two main output options" help="In the scale-regions mode, all regions in the BED file are stretched or shrunk to the same length (bp) that is indicated by the user. Reference-point refers to a position within the BED regions (e.g start of region). In the reference-point mode only those genomic positions before (downstream) and/or after (upstream) the reference point will be plotted."> - <option value="scale-regions" selected="true">scale-regions</option> - <option value="reference-point">reference-point</option> - </param> - - <when value="scale-regions" > - <param name="regionBodyLength" type="integer" value="500" label="Distance in bp to which all regions are going to be fitted"/> - <param name="startLabel" type="text" value="TSS" size="10" label="Label for the region start" help ="Label shown in the plot for the start of the region. Default is TSS (transcription start site), but could be changed to anything, e.g. "peak start"." /> - <param name="endLabel" type="text" value="TES" size="10" label="Label for the region end" help="Label shown in the plot for the region end. Default is TES (transcription end site)."/> - <conditional name="regionStartLength"> - <param name="regionStartLength_select" type="select" label="Set distance up- and downstream of the given regions"> - <option value="no" selected="true">no</option> - <option value="yes">yes</option> + <when value="scale-regions" > + <param name="regionBodyLength" type="integer" value="500" + label="Distance in bp to which all regions are going to be fitted" help="(--regionBodyLength)"/> + <param name="startLabel" type="text" value="TSS" size="10" + label="Label for the region start" + help ="Label shown in the plot for the start of the region. + Default is TSS (transcription start site), but could be changed to anything, + e.g. "peak start". (--startLabel)" /> + <param name="endLabel" type="text" value="TES" size="10" + label="Label for the region end" + help="Label shown in the plot for the region end. Default is TES (transcription end site). (--endLabel)"/> + <conditional name="regionStartLength"> + <param name="regionStartLength_select" type="select" label="Set distance up- and downstream of the given regions"> + <option value="no" selected="true">no</option> + <option value="yes">yes</option> + </param> + <when value="no" /> + <when value="yes"> + <param name="beforeRegionStartLength" type="integer" value="1000" min="1" + label="Distance upstream of the start site of the regions defined in the region file" + help="If the regions are genes, this would be the + distance upstream of the transcription start site. (--beforeRegionStartLength)"/> + <param name="afterRegionStartLength" type="integer" value="1000" min="1" + label="Distance downstream of the end site of the given regions" + help="If the regions are genes, this would be the + distance downstream of the transcription end site. (--afterRegionStartLength)"/> + </when> + </conditional> + </when> + <when value="reference-point"> + <param name="referencePoint" type="select" label="The reference point for the plotting"> + <option value="TSS" selected="true">beginning of region (e.g. TSS)</option> + <option value="TES">end of region (e.g. TES)</option> + <option value="center">center of region</option> </param> - <when value="no" /> - <when value="yes"> - <param name="beforeRegionStartLength" type="integer" value="1000" min="1" optional="true" label="Distance upstream of the start site of the regions defined in the region file" help="If the regions are genes, this would be the distance upstream of the transcription start site."/> - <param name="afterRegionStartLength" type="integer" value="1000" min="1" optional="true" label="Distance downstream of the end site of the given regions" help="If the regions are genes, this would be the distance downstream of the transcription end site."/> - </when> - </conditional> - </when> - - <when value="reference-point"> - <param name="referencePoint" type="select" label="The reference point for the plotting"> - <option value="TSS" selected="true">beginning of region (e.g. TSS)</option> - <option value="TES">end of region (e.g. TES)</option> - <option value="center">center of region</option> - </param> - <param name="nanAfterEnd" type="boolean" truevalue="--nanAfterEnd" falsevalue="" label="Discard any values after the region end" help="This is useful to visualize the region end when not using the scale-regions mode and when the reference-point is set to the TSS."/> - <param name="beforeRegionStartLength" type="integer" value="1000" min="1" label="Distance upstream of the start site of the regions defined in the region file" help="If the regions are genes, this would be the distance upstream of the transcription start site."/> - <param name="afterRegionStartLength" type="integer" value="1000" min="1" label="Distance downstream of the end site of the given regions" help="If the regions are genes, this would be the distance downstream of the transcription end site."/> - </when> - </conditional> + <param name="nanAfterEnd" type="boolean" truevalue="--nanAfterEnd" falsevalue="" + label="Discard any values after the region end" + help="This is useful to visualize the region end when not using the + scale-regions mode and when the reference-point is set to the TSS. (--nanAfterEnd)"/> + <param name="beforeRegionStartLength" type="integer" value="1000" min="1" + label="Distance upstream of the start site of the regions defined in the region file" + help="If the regions are genes, this would be the distance upstream of the transcription start site. (--beforeRegionStartLength)"/> + <param name="afterRegionStartLength" type="integer" value="1000" min="1" + label="Distance downstream of the end site of the given regions" + help="If the regions are genes, this would be the distance downstream of the transcription end site. (--afterRegionStartLength)"/> + </when> + </conditional> - <expand macro="input_graphic_output_settings"> - <expand macro="input_save_matrix_values" /> - </expand> + <expand macro="input_graphic_output_settings"> + <expand macro="input_save_matrix_values" /> + </expand> - <conditional name="advancedOpt" > - <param name="showAdvancedOpt" type="select" label="Show advanced options" > - <option value="no" selected="true">no</option> - <option value="yes">yes</option> - </param> - <when value="no" /> - <when value="yes"> - <param name="binSize" type="integer" value="100" min="1" optional="true" label="Length, in base pairs, of the non-overlapping bin for averaging the score over the regions length" /> - <param name="sortRegions" type="select" label="Sort regions" - help="Whether the output file should present the regions sorted."> - <option value="no" selected="true">no ordering</option> - <option value="descend">descending order</option> - <option value="ascend">ascending order</option> - </param> + <conditional name="advancedOpt" > + <param name="showAdvancedOpt" type="select" label="Show advanced options" > + <option value="no" selected="true">no</option> + <option value="yes">yes</option> + </param> + <when value="no" /> + <when value="yes"> + <param name="binSize" type="integer" value="10" min="1" + label="Length, in base pairs, of the non-overlapping bin for averaging the score over the regions length" + help="(--binSize)"/> + <param name="sortRegions" type="select" label="Sort regions" + help="Whether the output file should present the regions sorted."> + <option value="no" selected="true">no ordering</option> + <option value="descend">descending order</option> + <option value="ascend">ascending order</option> + </param> - <param name="sortUsing" type="select" label="Method used for sorting." help="The value is computed for each row." > - <option value="mean" selected="true">mean</option> - <option value="median">median</option> - <option value="min">min</option> - <option value="max">max</option> - <option value="sum">sum</option> - <option value="region_length">region length</option> - </param> + <param name="sortUsing" type="select" label="Method used for sorting" + help="The value is computed for each row. (--sortUsing)" > + <option value="mean" selected="true">mean</option> + <option value="median">median</option> + <option value="min">min</option> + <option value="max">max</option> + <option value="sum">sum</option> + <option value="region_length">region length</option> + </param> - <param name="averageTypeBins" type="select" label="Define the type of statistic that should be displayed." help="The value is computed for each bin."> - <option value="mean" selected="true">mean</option> - <option value="median">median</option> - <option value="min">min</option> - <option value="max">max</option> - <option value="sum">sum</option> - <option value="std">std</option> - </param> + <param name="averageTypeBins" type="select" + label="Define the type of statistic that should be displayed." + help="The value is computed for each bin. (--averageTypeBins)"> + <option value="mean" selected="true">mean</option> + <option value="median">median</option> + <option value="min">min</option> + <option value="max">max</option> + <option value="sum">sum</option> + <option value="std">std</option> + </param> - <param name="missingDataAsZero" type="boolean" truevalue="--missingDataAsZero" falsevalue="" label="Indicate missing data as zero" help="Set to "yes", if missing data should be indicated as zeros. Default is to ignore such cases which will be depicted as black areas in the heatmap. (see "Missing data color" options of the heatmapper for additional options)."/> - <param name="skipZeros" type="boolean" truevalue="--skipZeros" falsevalue="" label="Skip zeros" help="Whether regions with only scores of zero should be included or not. Default is to include them."/> - <param name="minThreshold" type="float" optional="true" label="Minimum threshold" help="Any region containing a value that is equal or less than this numeric value will be skipped. This is useful to skip, for example, genes where the read count is zero for any of the bins. This could be the result of unmappable areas and can bias the overall results."/> - <param name="maxThreshold" type="float" optional="true" label="Maximum threshold" help="Any region containing a value that is equal or higher that this numeric value will be skipped. The max threshold is useful to skip those few regions with very high read counts (e.g. major satellites) that may bias the average values."/> - <param name="scale" type="float" optional="true" label="Scale" help="If set, all values are multiplied by this number."/> - </when> - </conditional> - + <param name="missingDataAsZero" type="boolean" truevalue="--missingDataAsZero" falsevalue="" + label="Indicate missing data as zero" + help="Set to "yes", if missing data should be indicated as zeros. + Default is to ignore such cases which will be depicted as black areas in the + heatmap. (see "Missing data color" options of the heatmapper for additional options). + (--missingDataAsZero)"/> + <param name="skipZeros" type="boolean" truevalue="--skipZeros" falsevalue="" + label="Skip zeros" + help="Whether regions with only scores of zero should be included or not. + Default is to include them. (--skipZeros)"/> + <param name="minThreshold" type="float" optional="True" + label="Minimum threshold" + help="Any region containing a value that is equal or less than this numeric + value will be skipped. This is useful to skip, for example, genes where the + read count is zero for any of the bins. This could be the result of + unmappable areas and can bias the overall results. (--minThreshold)"/> + <param name="maxThreshold" type="float" optional="True" + label="Maximum threshold" + help="Any region containing a value that is equal or higher that this + numeric value will be skipped. The max threshold is useful to skip those + few regions with very high read counts (e.g. major satellites) that may + bias the average values. (--maxThreshold)"/> + <param name="scale" type="float" optional="True" label="Scaling factor" + help="If set, all values are multiplied by this number. (--scale)"/> + </when> + </conditional> </inputs> - <outputs> - <data format="bgzip" name="outFileName" label="${tool.name} on ${on_string}: Matrix" /> - <expand macro="output_graphic_outputs" /> - <expand macro="output_save_matrix_values" /> - </outputs> + <outputs> + <data format="deeptools_compute_matrix_archive" name="outFileName" label="${tool.name} on ${on_string}: Matrix" /> + <expand macro="output_graphic_outputs" /> + <expand macro="output_save_matrix_values" /> + </outputs> <!-- computeMatrix -S test.bw -R test2.bed -a 100 -b 100 -bs 1 --> <tests> <test> - <param name="regionsFile" value="test2.bed" ftype="bed" /> - <param name="scoreFile" value="test.bw" ftype="bigwig" /> - <param name="advancedOpt.binSize" value="1" /> - <param name="mode.beforeRegionStartLength" value="100" /> - <param name="mode.afterRegionStartLength" value="100" /> - <output name="outFileName" file="master.mat.gz" ftype="bgzip" compare="sim_size" delta="100" /> + <param name="regionsFile" value="computeMatrix1.bed" ftype="bed" /> + <param name="scoreFile" value="bamCoverage_result4.bw" ftype="bigwig" /> + <param name="showAdvancedOpt" value="yes" /> + <param name="mode_select" value="reference-point" /> + <param name="binSize" value="10" /> + <param name="sortUsing" value="sum" /> + <param name="averageTypeBins" value="sum" /> + <param name="missingDataAsZero" value="True" /> + <param name="beforeRegionStartLength" value="10" /> + <param name="afterRegionStartLength" value="10" /> + <output name="outFileName" file="computeMatrix_result1.gz" ftype="deeptools_compute_matrix_archive" compare="sim_size" /> + </test> + <test> + <param name="regionsFile" value="computeMatrix2.bed" ftype="bed" /> + <param name="scoreFile" value="computeMatrix2.bw" ftype="bigwig" /> + <param name="showAdvancedOpt" value="yes" /> + <param name="mode_select" value="reference-point" /> + <param name="binSize" value="10" /> + <param name="beforeRegionStartLength" value="10" /> + <param name="afterRegionStartLength" value="10" /> + <output name="outFileName" file="computeMatrix_result2.gz" ftype="deeptools_compute_matrix_archive" compare="sim_size" /> </test> </tests> <help> - +<![CDATA[ **What it does** This tool prepares an intermediary file (a gzipped table of values) @@ -217,7 +282,7 @@ ----- @REFERENCES@ - +]]> </help> <expand macro="citations" /> </tool>
--- a/correctGCBias.xml Tue Sep 16 13:46:05 2014 -0400 +++ b/correctGCBias.xml Tue Oct 20 14:43:12 2015 -0400 @@ -1,92 +1,60 @@ <tool id="deeptools_correctGCBias" name="correctGCBias" version="@WRAPPER_VERSION@.0"> <description>uses the output from computeGCBias to generate corrected BAM files</description> - <expand macro="requirements" /> - <expand macro="stdio" /> <macros> <token name="@BINARY@">correctGCBias</token> <import>deepTools_macros.xml</import> </macros> + <expand macro="requirements" /> <command> - #import tempfile - #set $temp_dir = os.path.abspath(tempfile.mkdtemp()) - - #set $temp_bam_handle = tempfile.NamedTemporaryFile( dir=$temp_dir ) - #set $temp_bam_path = $temp_bam_handle.name + '.bam' - #silent $temp_bam_handle.close() - #silent os.system("ln -s %s %s" % (str($bamInput), $temp_bam_path)) - #silent os.system("ln -s %s %s.bai" % (str($bamInput.metadata.bam_index), $temp_bam_path)) - +<![CDATA[ + ln -s $bamInput local_bamInput.bam; + ln -s $bamInput.metadata.bam_index local_bamInput.bam.bai; correctGCBias - - @THREADS@ - - --bamfile '$temp_bam_path' - --GCbiasFrequenciesFile $GCbiasFrequenciesFile + @THREADS@ + --bamfile local_bamInput.bam + --GCbiasFrequenciesFile $GCbiasFrequenciesFile - @reference_genome_source@ - - - #if $effectiveGenomeSize.effectiveGenomeSize_opt == "specific": - --effectiveGenomeSize $effectiveGenomeSize.effectiveGenomeSize - #else: - --effectiveGenomeSize $effectiveGenomeSize.effectiveGenomeSize_opt - #end if + @reference_genome_source@ - #if str($region).strip() != '': - --region '$region' - #end if + #if $effectiveGenomeSize.effectiveGenomeSize_opt == "specific": + --effectiveGenomeSize $effectiveGenomeSize.effectiveGenomeSize + #else: + --effectiveGenomeSize $effectiveGenomeSize.effectiveGenomeSize_opt + #end if - #if $advancedOpt.showAdvancedOpt == "yes": - --binSize '$advancedOpt.binSize' - #end if + #if str($region).strip() != '': + --region '$region' + #end if + --correctedFile corrected.bam; - ###set newoutFileName="corrected."+str($outFileFormat) - ##--correctedFile $newoutFileName; - --correctedFile "corrected.bam"; - - ##mv $newoutFileName $outFileName - mv "corrected.bam" $outFileName + mv corrected.bam $outFileName; +]]> </command> <inputs> <param name="GCbiasFrequenciesFile" type="data" format="tabular" label="Output of computeGCBias" /> - <param name="bamInput" format="bam" type="data" label="BAM file" help="This should be same file that was used for computeGCbias. The BAM file must be sorted."/> + <param name="bamInput" format="bam" type="data" + label="BAM file" help="This should be same file that was used for computeGCbias. The BAM file must be sorted. (--bamfile)" /> <expand macro="reference_genome_source" /> <expand macro="effectiveGenomeSize" /> - - <!-- - <param name="outFileFormat" type="select" label="File format of the output"> - <option value="bam">bam</option> - <option value="bw">bigwig</option> - <option value="bg">bedgraph</option> - </param> - --> <expand macro="region_limit_operation" /> - - <conditional name="advancedOpt"> - <param name="showAdvancedOpt" type="select" label="Show advanced options" > - <option value="no" selected="true">no</option> - <option value="yes">yes</option> - </param> - <when value="no" /> - <when value="yes"> - <param name="binSize" type="integer" value="50" min="1" - label="Bin size in bp" - help="Size of the bins in bp for the output of the bigwig/bedgraph file."/> - </when> - </conditional> </inputs> <outputs> - <data format="bam" name="outFileName"> - <!--<change_format> - <when input="outFileFormat" value="bw" format="bigwig" /> - <when input="outFileFormat" value="bam" format="bam" /> - <when input="outFileFormat" value="bg" format="bedgraph" /> - </change_format>--> - </data> + <data format="bam" name="outFileName" /> </outputs> + <tests> + <test> + <param name="GCbiasFrequenciesFile" value="computeGCBias_result1.tabular" ftype="tabular" /> + <param name="bamInput" value="paired_chr2L.bam" ftype="bam" /> + <param name="ref_source" value="history" /> + <param name="input1" value="sequence.2bit" /> + <param name="effectiveGenomeSize_opt" value="specific" /> + <param name="effectiveGenomeSize" value="23011544" /> + <output name="outFileName" file="correctGCBias_result1.bam" ftype="bam" /> + </test> + </tests> <help> - +<![CDATA[ **What it does** This tool requires the output from computeGCBias to correct a given BAM file according to the method proposed by @@ -103,7 +71,7 @@ ----- @REFERENCES@ - +]]> </help> <expand macro="citations" /> </tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/datatypes_conf.xml Tue Oct 20 14:43:12 2015 -0400 @@ -0,0 +1,6 @@ +<?xml version="1.0"?> +<datatypes> + <registration> + <datatype extension="deeptools_compute_matrix_archive" type="galaxy.datatypes.binary:CompressedArchive" subclass="True" display_in_upload="True"/> + </registration> +</datatypes>
--- a/deepTools_macros.xml Tue Sep 16 13:46:05 2014 -0400 +++ b/deepTools_macros.xml Tue Oct 20 14:43:12 2015 -0400 @@ -10,57 +10,67 @@ </param> <when value="no" /> <when value="yes"> - <param name="doNotExtendPairedEnds" type="boolean" truevalue="--doNotExtendPairedEnds" falsevalue="" - label="Do not extend paired ends" - help="If set, reads are not extended to match the fragment length reported in the BAM file, instead they will be extended to match the fragment length. Default is to extend the reads if paired end information is available."/> - - <param name="ignoreDuplicates" type="boolean" truevalue="--ignoreDuplicates" falsevalue="" - label="Ignore duplicates" - help="If set, reads that have the same orientation and start position will be considered only once. If reads are paired, the mate position also has to coincide to ignore a read." /> - - <param name="minMappingQuality" type="integer" optional="true" value="1" min="1" - label="Minimum mapping quality" - help= "If set, only reads that have a mapping quality score higher than the given value are considered. *Note* Bowtie's Mapping quality is related to uniqueness: the higher the score, the more unique is a read. A mapping quality defined by Bowtie of 10 or less indicates that there is at least a 1 in 10 chance that the read truly originated elsewhere."/> - - <param name="includeZeros" type="boolean" truevalue="--includeZeros" falsevalue="" - label ="Include zeros" - help ="If set, then regions with zero counts for *all* BAM files given are included. The default behavior is to ignore those cases." /> - - <param name="zMin" type="integer" value="" optional="true" label="Minimum value for the heatmap intensities" - help="If not specified the value is set automatically."/> - - <param name="zMax" type="integer" value="" optional="true" label="Maximum value for the heatmap intensities" - help="If not specified the value is set automatically."/> - + <expand macro="doNotExtendPairedEnds" /> + <expand macro="ignoreDuplicates" /> + <expand macro="minMappingQuality" /> + <expand macro="includeZeros" /> + <expand macro="zMin_zMax" /> <expand macro="colormap" /> </when> </conditional> </xml> + + <xml name="bigwigCorrelate_mode_actions"> + + <expand macro="region_limit_operation" /> + + <conditional name="advancedOpt"> + <param name="showAdvancedOpt" type="select" label="Show advanced options" > + <option value="no" selected="true">no</option> + <option value="yes">yes</option> + </param> + <when value="no" /> + <when value="yes"> + <expand macro="includeZeros" /> + <expand macro="zMin_zMax" /> + <expand macro="colormap" /> + <expand macro="plotTitle" /> + <expand macro="plotNumbers" /> + </when> + </conditional> + </xml> + + + <xml name="includeZeros"> + <param name="includeZeros" type="boolean" truevalue="--includeZeros" falsevalue="" + label="Include zeros" + help="If set, then regions with zero counts for *all* BAM files given are included. The default behavior is to ignore those cases. (--includeZeros)" /> + </xml> + <xml name="zMin_zMax"> + <param name="zMin" type="integer" value="" optional="true" label="Minimum value for the heatmap intensities" + help="If not specified the value is set automatically. (--zMin)"/> + <param name="zMax" type="integer" value="" optional="true" label="Maximum value for the heatmap intensities" + help="If not specified the value is set automatically. (--zMax)"/> + </xml> + <xml name="region_limit_operation"> <param name="region" type="text" value="" label="Region of the genome to limit the operation to" - help="This is useful when testing parameters to reduce the computing time. The format is chr:start:end, for example "chr10" or "chr10:456700:891000"" /> + help="This is useful when testing parameters to reduce the computing time. The format is chr:start:end, for example "chr10" or "chr10:456700:891000". (--region)" /> </xml> - + <token name="@THREADS@">--numberOfProcessors "\${GALAXY_SLOTS:-4}"</token> - <token name="@WRAPPER_VERSION@">1.5.9.1</token> + <token name="@WRAPPER_VERSION@">1.5.11</token> <xml name="requirements"> <requirements> + <requirement type="package" version="2.7">python</requirement> <requirement type="binary">@BINARY@</requirement> - <requirement type="package" >samtools</requirement> <requirement type="package" >deepTools</requirement> - <requirement type="package" >ucsc_tools</requirement> - <requirement type="package" version="1.5.9.1">deepTools</requirement> - <requirement type="package" version="0.1">ucsc_tools</requirement> - <requirement type="package" version="1.7.1">numpy</requirement> - <requirement type="package" version="0.7.7">pysam</requirement> - <requirement type="package" version="0.12.0">scipy</requirement> - <requirement type="package" version="1.2.1">matplotlib</requirement> - <requirement type="package" version="0.1.19">samtools</requirement> - <requirement type="package" version="12-2013">bx-python</requirement> + <requirement type="package" version="1.5.11">deepTools</requirement> <yield /> </requirements> + <expand macro="stdio" /> <version_command>@BINARY@ --version</version_command> </xml> @@ -70,7 +80,7 @@ label="Did you compute the matrix with more than one groups of regions?" help="Would you like to cluster the regions according to the similarity of the signal distribution? This is only possible if you used computeMatrix on only one group of regions."> <option value="yes">Yes, I used multiple groups of regions</option> - <option value="no">No, I used only one region.</option> + <option value="no">No, I used only one group</option> </param> <when value="no"> <conditional name="clustering"> @@ -87,9 +97,9 @@ </when> <when value="yes" /> </conditional> + </xml> - </xml> - <token name="@kmeans_clusterin@"> + <token name="@KMEANS_CLUSTERING@"> #if $advancedOpt.used_multiple_regions.used_multiple_regions_options == 'no': #if $advancedOpt.used_multiple_regions.clustering.clustering_options == 'kmeans': #if int($advancedOpt.used_multiple_regions.clustering.k_kmeans) > 0: @@ -99,6 +109,51 @@ #end if </token> + <xml name="samFlag"> + <param name="samFlag" type="integer" optional="true" value="" + label="Filter reads based on the SAM flag" + help= "For example to get only reads that are the first mate use a flag of 64. This is useful to count properly paired reads only once, otherwise the second mate will be also considered for the coverage. (--samFlag)"/> + </xml> + <xml name="plotNumbers"> + <param name="plotNumbers" type="boolean" truevalue="--plotNumbers" falsevalue="" + label="Plot the correlation value" + help="If set, then the correlation number is plotted on top of the heatmap. (--plotNumbers)"/> + </xml> + <xml name="doNotExtendPairedEnds"> + <param name="doNotExtendPairedEnds" type="boolean" truevalue="--doNotExtendPairedEnds" falsevalue="" + label="Do not extend paired ends" + help="If set, reads are not extended to match the fragment length reported in the BAM file, instead they will be extended to match the fragment length. Default is to extend the reads if paired end information is available. (--doNotExtendPairedEnds)"/> + </xml> + + <xml name="ignoreDuplicates"> + <param name="ignoreDuplicates" type="boolean" truevalue="--ignoreDuplicates" falsevalue="" + label="Ignore duplicates" + help="If set, reads that have the same orientation and start position will be considered only once. If reads are paired, the mate position also has to coincide to ignore a read. (--ignoreDuplicates)" /> + </xml> + + <xml name="minMappingQuality"> + <param name="minMappingQuality" type="integer" optional="true" value="1" min="1" + label="Minimum mapping quality" + help= "If set, only reads that have a mapping quality score higher than the given value are considered. *Note* Bowtie's Mapping quality is related to uniqueness: the higher the score, the more unique is a read. A mapping quality defined by Bowtie of 10 or less indicates that there is at least a 1 in 10 chance that the read truly originated elsewhere. (--minMappingQuality)"/> + </xml> + + <xml name="skipZeros"> + <param name="skipZeros" type="boolean" truevalue="--skipZeros" falsevalue="" + label ="Skip zeros" + help ="If set, then zero counts that happen for *all* BAM files given are ignored. This might have the effect that fewer regions are considered than indicated in the option where the number of samples is defined. (--skipZeros)" /> + </xml> + + <xml name="fragmentLength"> + <param name="fragmentLength" type="integer" value="300" min="1" + label="Fragment length used for the sequencing" + help ="If paired-end reads are used, the fragment length is computed from the BAM file. (--fragmentLength)"/> + </xml> + + <xml name="scaleFactor"> + <param name="scaleFactor1" type="float" value="1" label="Scale factor for treatment" help="(--scaleFactors)"/> + <param name="scaleFactor2" type="float" value="1" label="Scale factor for input" help="(--scaleFactors)"/> + </xml> + <xml name="stdio"> <stdio> <exit_code range="1:" /> @@ -109,9 +164,11 @@ <regex match="Traceback" /> </stdio> </xml> + <xml name="pseudocount"> <param name="pseudocount" type="float" value="1" label="Pseudocount" help="Small number to avoid dividing by zero."/> </xml> + <token name="@REFERENCES@"> .. class:: infomark @@ -126,11 +183,6 @@ .. _Max Planck Institute for Immunobiology and Epigenetics: http://www3.ie-freiburg.mpg.de .. _help site: https://github.com/fidelram/deepTools/wiki/ -**References** - -If you use this Galaxy tool in work leading to a scientific publication please -cite the following paper: - </token> <xml name="citations"> <citations> @@ -140,36 +192,46 @@ </xml> <xml name="multiple_input_bams"> - <repeat name="input_files" title="BAM files" min="2"> - <param name="bamfile" type="data" format="bam" - label="Bam file" - help="The BAM file must be sorted."/> - <param name="label" type="text" size="30" optional="true" value="" - label="Label" - help="Label to use in the output. If not given the dataset name will be used instead."/> - </repeat> + <param name="bamfiles" type="data" format="bam" + label="Bam file" multiple="true" + help="The BAM file must be sorted."/> + </xml> + + <xml name="multiple_input_bigwigs"> + <param name="bigwigfiles" type="data" format="bigwig" multiple="True" + label="Bigwig file" + help="The Bigwig file must be sorted."/> + </xml> + + <xml name="plotTitle"> + <param name="plotTitle" type="text" value="" size="30" optional="True" + label="Title of the plot" + help="Title of the plot, to be printed on top of the generated image. (--plotTitle)" /> </xml> <token name="@multiple_input_bams@"> - #import tempfile - #set $temp_dir = os.path.abspath(tempfile.mkdtemp()) +<![CDATA[ #set files=[] #set labels=[] - #for $i in $input_files: - #set $temp_input_handle = tempfile.NamedTemporaryFile( dir=$temp_dir ) - #set $temp_input_path = $temp_input_handle.name - #silent $temp_input_handle.close() - #silent os.system("ln -s %s %s.bam" % (str($i.bamfile), $temp_input_path)) - #silent os.system("ln -s %s %s.bam.bai" % (str($i.bamfile.metadata.bam_index), $temp_input_path)) - #silent $files.append('%s.bam' % $temp_input_path) + #for $counter, $bamfile in enumerate($bamfiles): + ln -s "${bamfile}" "./${counter}.bam" && + ln -s "${bamfile.metadata.bam_index}" "./${counter}.bam.bai" && + #silent $files.append('%s.bam' % $counter) + #silent $labels.append("'%s'" % ($bamfile.display_name)) + #end for +]]> + </token> - ##set $files += [str($i.bamfile)] - #if str($i.label.value) != "": - #set $labels += ["\"%s\"" % ($i.label.value)] - #else - #set $labels += ["\"%s\"" % ($i.bamfile.name)] - #end if + <token name="@multiple_input_bigwigs@"> +<![CDATA[ + #set files=[] + #set labels=[] + #for $counter, $bigwig in enumerate($bigwigfiles): + ln -s "${bigwig}" "${counter}.bw" && + #silent $files.append('%s.bw' % $counter) + #silent $labels.append("'%s'" % ($bigwig.display_name)) #end for +]]> </token> <xml name="reference_genome_source"> @@ -180,7 +242,7 @@ </param> <when value="cached"> <param name="input1_2bit" type="select" label="Using reference genome" help="If your genome of interest is not listed, contact the Galaxy team"> - <options from_data_table="deepTools_seqs"> + <options from_data_table="lastz_seqs"> <filter type="sort_by" column="1" /> <validator type="no_options" message="No indexes are available." /> </options>
--- a/heatmapper.xml Tue Sep 16 13:46:05 2014 -0400 +++ b/heatmapper.xml Tue Oct 20 14:43:12 2015 -0400 @@ -1,12 +1,12 @@ <tool id="deeptools_heatmapper" name="heatmapper" version="@WRAPPER_VERSION@.0"> <description>creates a heatmap for a score associated to genomic regions</description> - <expand macro="requirements"/> - <expand macro="stdio" /> <macros> <token name="@BINARY@">heatmapper</token> <import>deepTools_macros.xml</import> </macros> + <expand macro="requirements"/> <command> +<![CDATA[ heatmapper --matrixFile $matrixFile @@ -75,18 +75,19 @@ --refPointLabel '$advancedOpt.referencePointLabel' --regionsLabel '$advancedOpt.regionsLabel' - #if str($advancedOpt.plotTitle.value) != "None": + #if $advancedOpt.plotTitle and str($advancedOpt.plotTitle.value) != "": --plotTitle '$advancedOpt.plotTitle' #end if $advancedOpt.onePlotPerGroup - @kmeans_clusterin@ + @KMEANS_CLUSTERING@ #end if +]]> </command> <inputs> - <param name="matrixFile" format="bgzip" type="data" label="Matrix file from the computeMatrix tool"/> + <param name="matrixFile" format="deeptools_compute_matrix_archive" type="data" label="Matrix file from the computeMatrix tool"/> <expand macro="input_graphic_output_settings"> <expand macro="input_image_file_format" /> @@ -101,13 +102,14 @@ <when value="no" /> <when value="yes"> <param name="sortRegions" type="select" label="Sort regions" - help="Whether the heatmap should present the regions sorted. The default is to sort in descending order based on the mean value per region."> + help="Whether the heatmap should present the regions sorted. The default is to sort in descending order based on the mean value per region. (--sortRegions)"> <option value="no">no ordering</option> <option value="descend" selected="true">descending order</option> <option value="ascend">ascending order</option> </param> - <param name="sortUsing" type="select" label="Method used for sorting" help="For each row the method is computed." > + <param name="sortUsing" type="select" label="Method used for sorting" + help="For each row the method is computed. (--sortUsing)"> <option value="mean" selected="true">mean</option> <option value="median">median</option> <option value="min">min</option> @@ -116,7 +118,9 @@ <option value="region_length">region length</option> </param> - <param name="averageTypeSummaryPlot" type="select" label="Type of statistic that should be plotted in the summary image above the heatmap"> + <param name="averageTypeSummaryPlot" type="select" + label="Type of statistic that should be plotted in the summary image above the heatmap" + help="(--averageTypeSummaryPlot)"> <option value="mean" selected="true">mean</option> <option value="median">median</option> <option value="min">min</option> @@ -125,22 +129,34 @@ <option value="std">std</option> </param> - <param name="missingDataColor" type="text" label="Missing data color" value="black" optional="true" help="If 'Represent missing data as zero' is not set, such cases will be colored in black by default. By using this parameter a different color can be set. A value between 0 and 1 will be used for a gray scale (black is 0). Also color names can be used, see a list here: http://packages.python.org/ete2/reference/reference_svgcolors.html. Alternatively colors can be specified using the #rrggbb notation." /> + <param name="missingDataColor" type="text" value="black" optional="true" label="Missing data color" + help="If 'Represent missing data as zero' is not set, such cases will be colored in black by default. + By using this parameter a different color can be set. A value between 0 and 1 will be used for a gray scale (black is 0). + Also color names can be used, see a list here: http://packages.python.org/ete2/reference/reference_svgcolors.html. + Alternatively colors can be specified using the #rrggbb notation. (--missingDataColor)" /> <expand macro="colormap" /> - <param name="zMin" type="float" value="" size="3" label="Minimum value for the heatmap intensities. Leave empty for automatic values" optional="true"/> - <param name="zMax" type="float" value="" size="3" label="Maximum value for the heatmap intensities. Leave empty for automatic values" optional="true"/> - <param name="yMin" type="float" value="" size="3" label="Minimum value for the Y-axis of the summary plot. Leave empty for automatic values" optional="true"/> - <param name="yMax" type="float" value="" size="3" label="Maximum value for Y-axis of the summary plot. Leave empty for automatic values" optional="true"/> + <param name="zMin" type="float" value="" size="3" + label="Minimum value for the heatmap intensities. Leave empty for automatic values" help="(--zMin)"/> + <param name="zMax" type="float" value="" size="3" + label="Maximum value for the heatmap intensities. Leave empty for automatic values" help="(--zMax)"/> + <param name="yMin" type="float" value="" size="3" + label="Minimum value for the Y-axis of the summary plot. Leave empty for automatic values" help="(--yMin)"/> + <param name="yMax" type="float" value="" size="3" + label="Maximum value for Y-axis of the summary plot. Leave empty for automatic values" help="(--yMax)"/> + <param name="xAxisLabel" type="text" value="distance from TSS (bp)" size="200" + label="Description for the x-axis label" help="(--xAxisLabel)"/> + <param name="yAxisLabel" type="text" value="genes" size="30" + label="Description for the y-axis label for the top panel" help="(--yAxisLabel)"/> - <param name="xAxisLabel" type="text" value="distance from TSS (bp)" size="200" label="Description for the x-axis label" /> - <param name="yAxisLabel" type="text" value="genes" size="30" label="Description for the y-axis label for the top panel" /> + <param name="heatmapWidth" type="float" value="7.5" min="1" max="100" + label="Heatmap width in cm" help="The minimum value is 1 and the maximum is 100."/> + <param name="heatmapHeight" type="float" value="25" min="3" max="100" + label="Heatmap height in cm" help="The minimum value is 3 and the maximum is 100."/> - <param name="heatmapWidth" type="float" value="7.5" min="1" max="100" label="Heatmap width in cm" help="The minimum value is 1 and the maximum is 100."/> - <param name="heatmapHeight" type="float" value="25" min="3" max="100" label="Heatmap height in cm" help="The minimum value is 3 and the maximum is 100."/> - - <param name="whatToShow" type="select" label="What to show" help ="The default is to include a summary or profile plot on top of the heatmap and a heatmap colorbar."> + <param name="whatToShow" type="select" label="What to show" + help ="The default is to include a summary or profile plot on top of the heatmap and a heatmap colorbar. (--whatToShow)"> <option value="plot, heatmap and colorbar" selected="true">summary plot, heatmap and colorbar</option> <option value="plot and heatmap">summary plot and heatmap (no colorbar)</option> <option value="heatmap only">heatmap only</option> @@ -148,25 +164,31 @@ <option value="colorbar only">colorbar only</option> </param> - <param name="startLabel" type="text" value="TSS" size="10" label="Label for the region start" help ="[only for scale-regions mode] Label shown in the plot for the start of the region. Default is TSS (transcription start site), but could be changed to anything, e.g. "peak start"." /> - <param name="endLabel" type="text" value="TES" size="10" label="Label for the region end" help="[only for scale-regions mode] Label shown in the plot for the region end. Default is TES (transcription end site)."/> + <param name="startLabel" type="text" value="TSS" size="10" + label="Label for the region start" + help ="Only for scale-regions mode. Label shown in the plot for the start of the region. Default is TSS (transcription start site), but could be changed to anything, e.g. "peak start". (--startLabel)" /> + <param name="endLabel" type="text" value="TES" size="10" + label="Label for the region end" + help="Only for scale-regions mode. Label shown in the plot for the region end. Default is TES (transcription end site). (--endLabel)"/> - <param name="referencePointLabel" type="text" value="TSS" size="10" label="Reference point label" help ="[only for scale-regions mode] Label shown in the plot for the reference-point. Default is the same as the reference point selected (e.g. TSS), but could be anything, e.g. "peak start" etc." /> + <param name="referencePointLabel" type="text" value="TSS" size="10" + label="Reference point label" + help ="Label shown in the plot for the reference-point. Default is the same as the reference point selected (e.g. TSS), but could be anything, e.g. "peak start" etc. (--referencePointLabel)" /> <param name="regionsLabel" type="text" value="genes" size="30" label="Labels for the regions plotted in the heatmap" - help="If more than one region is being plotted a list of labels separated by comma and limited by quotes, is required. For example, label1, label2."> + help="If more than one region is being plotted a list of labels separated by comma and limited by quotes, is required. For example, label1, label2. (--regionsLabel)"> <sanitizer> <valid initial="string.printable"> </valid> </sanitizer> </param> - <param name="plotTitle" type="text" value="" size="30" label="Title of the plot" help="Title of the plot, to be printed on top of the generated image. Leave blank for no title." /> + <expand macro="plotTitle" /> <param name="onePlotPerGroup" type="boolean" truevalue="--onePlotPerGroup" falsevalue="" label="Do one plot per group" - help="When computeMatrix was used on more than one group of genes, the average plots for all the groups will be drawn in one panel by default. If this option is set, each group will get its own plot, stacked on top of each other."/> + help="When computeMatrix was used on more than one group of genes, the average plots for all the groups will be drawn in one panel by default. + If this option is set, each group will get its own plot, stacked on top of each other. (--onePlotPerGroup)"/> <expand macro="kmeans_clustering" /> - </when> </conditional> </inputs> @@ -177,12 +199,12 @@ </outputs> <tests> <test> - <param name="matrixFile" value="master.mat.gz" ftype="bgzip" /> - <output name="outFileName" file="master.png" ftype="png" compare="sim_size" delta="100" /> + <param name="matrixFile" value="computeMatrix_result1.gz" ftype="deeptools_compute_matrix_archive" /> + <output name="outFileName" file="heatmapper_result1.png" ftype="png" compare="sim_size" delta="100" /> </test> </tests> <help> - +<![CDATA[ **What it does** The heatmapper visualizes scores associated with genomic regions, for example ChIP enrichment values around the TSS of genes. @@ -205,7 +227,7 @@ ----- @REFERENCES@ - +]]> </help> <expand macro="citations" /> </tool>
--- a/profiler.xml Tue Sep 16 13:46:05 2014 -0400 +++ b/profiler.xml Tue Oct 20 14:43:12 2015 -0400 @@ -2,13 +2,13 @@ <description> creates a profile plot for a score associated to genomic regions </description> - <expand macro="requirements" /> - <expand macro="stdio" /> <macros> <token name="@BINARY@">profiler</token> <import>deepTools_macros.xml</import> </macros> + <expand macro="requirements" /> <command> +<![CDATA[ profiler --matrixFile $matrixFile @@ -29,8 +29,8 @@ #end if #if $scaleRegions.showScaleRegionsOpt == "yes": - --startLabel $scaleRegions.startLabel - --endLabel $scaleRegions.endLabel + --startLabel '$scaleRegions.startLabel' + --endLabel '$scaleRegions.endLabel' #end if #if $advancedOpt.showAdvancedOpt == "yes": @@ -43,7 +43,7 @@ --regionsLabel '$advancedOpt.regionsLabel' - #if str($advancedOpt.plotTitle).strip() != "": + #if $advancedOpt.plotTitle and str($advancedOpt.plotTitle).strip() != "": --plotTitle '$advancedOpt.plotTitle' #end if @@ -65,12 +65,13 @@ --yAxisLabel '$advancedOpt.yAxisLabel' #end if - @kmeans_clusterin@ + @KMEANS_CLUSTERING@ #end if +]]> </command> <inputs> - <param name="matrixFile" format="bgzip" type="data" label="Matrix file from the computeMatrix tool"/> + <param name="matrixFile" format="deeptools_compute_matrix_archive" type="data" label="Matrix file from the computeMatrix tool"/> <conditional name="scaleRegions"> <param name="showScaleRegionsOpt" type="select" label="The input matrix was computed in scale-regions mode"> <option value="no" selected="true">no</option> @@ -78,8 +79,14 @@ </param> <when value="no" /> <when value="yes"> - <param name="startLabel" type="text" value="TSS" size="10" label="Label for the region start" help ="[only for scale-regions mode] Label shown in the plot for the start of the region. Default is TSS (transcription start site), but could be changed to anything, e.g. "peak start"." /> - <param name="endLabel" type="text" value="TES" size="10" label="Label for the region end" help="[only for scale-regions mode] Label shown in the plot for the region end. Default is TES (transcription end site)."/> + <param name="startLabel" type="text" value="TSS" size="10" + label="Label for the region start" + help ="[only for scale-regions mode] Label shown in the plot + for the start of the region. Default is TSS (transcription start site), + but could be changed to anything, e.g. "peak start"." /> + <param name="endLabel" type="text" value="TES" size="10" + label="Label for the region end" + help="[only for scale-regions mode] Label shown in the plot for the region end. Default is TES (transcription end site)."/> </when> </conditional> @@ -109,23 +116,46 @@ label="Plot width" help="Width in cm. The default value is 8 centimeters. The minimum value is 1 cm." /> <param name="plotType" type="select" label="Plot type" - help="For the summary plot (profile) only. The "lines" option will plot the profile line based on the average type selected. The "fill" option fills the region between zero and the profile curve. The fill in color is semi transparent to distinguish different profiles. The "add standard error" option colors the region between the profile and the standard error of the data. As in the case of fill, a semi-transparent color is used. The option "overlapped_lines" plots each region values, one on top of the other; this option only works if "one plot per proup" is set."> + help="For the summary plot (profile) only. The "lines" option will + plot the profile line based on the average type selected. The "fill" + option fills the region between zero and the profile curve. The fill in color is + semi transparent to distinguish different profiles. The "add standard error" + option colors the region between the profile and the standard error of the data. + As in the case of fill, a semi-transparent color is used. + The option "overlapped_lines" plots each region values, one on top of + the other; this option only works if "one plot per proup" is set."> <option value="lines" selected="true">lines</option> <option value="fill">fill</option> <option value="se">add standard error</option> <option value="overlapped_lines">overlapped lines</option> </param> - <param name="regionsLabel" type="text" value="genes" size="30" label="Labels for the regions plotted in the heatmap" help="If more than one region is being plotted a list of labels separated by comma and limited by quotes, is required. For example, "label1, label2"."/> - <param name="plotTitle" type="text" value="" size="30" label="Title of the plot" help="Title of the plot, to be printed on top of the generated image. Leave blank for no title." /> - <param name="colors" type="text" value="" size="40" label="List of colors to use for the plotted lines" help="Color names and html hex strings (e.g. #eeff22) are accepted. The color names should be given separated by spaces. (--colors red blue green)"> - <validator type="expression" message="Only numbers, digits, '#' and spaces are allowed.">all(c in ' #abcdefghijklmnopqrstuvwxyz0123456789' for c in value)</validator> + <param name="regionsLabel" type="text" value="genes" size="30" + label="Labels for the regions plotted in the heatmap" + help="If more than one region is being plotted a list of labels separated + by comma and limited by quotes, is required. For example, "label1, label2"."/> + + <expand macro="plotTitle" /> + <param name="colors" type="text" value="" size="40" + label="List of colors to use for the plotted lines" + help="Color names and html hex strings (e.g. #eeff22) are accepted. + The color names should be given separated by spaces. (--colors red blue green)"> + <validator type="expression" + message="Only numbers, digits, '#' and spaces are allowed.">all(c in ' #abcdefghijklmnopqrstuvwxyz0123456789' for c in value)</validator> </param> - <param name="onePlotPerGroup" type="boolean" truevalue="--onePlotPerGroup" falsevalue="" label="Do one plot per group" help="When the region file contains groups separated by "#", the default is to plot the averages for the distinct plots in one plot. If this option is set, each group will get its own plot, stacked on top of each other."/> - <param name="yMin" type="float" value="" size="3" label="Minimum value for the Y-axis of the summary plot. Leave empty for automatic values" optional="true"/> - <param name="yMax" type="float" value="" size="3" label="Maximum value for Y-axis of the summary plot. Leave empty for automatic values" optional="true"/> - <param name="xAxisLabel" type="text" value="gene distance (bp)" size="50" label="Description for the x-axis label" /> - <param name="yAxisLabel" type="text" value="" size="50" label="Description for the y-axis label for the top panel" /> + <param name="onePlotPerGroup" type="boolean" truevalue="--onePlotPerGroup" falsevalue="" + label="Do one plot per group" + help="When the region file contains groups separated by "#", the default is + to plot the averages for the distinct plots in one plot. If this option is set, each group + will get its own plot, stacked on top of each other."/> + <param name="yMin" type="float" value="" size="3" optional="true" + label="Minimum value for the Y-axis of the summary plot. Leave empty for automatic values"/> + <param name="yMax" type="float" value="" size="3" optional="true" + label="Maximum value for Y-axis of the summary plot. Leave empty for automatic values" /> + <param name="xAxisLabel" type="text" value="gene distance (bp)" size="50" + label="Description for the x-axis label" /> + <param name="yAxisLabel" type="text" value="" size="50" + label="Description for the y-axis label for the top panel" /> <expand macro="kmeans_clustering" /> @@ -136,7 +166,14 @@ <expand macro="output_image_file_format" /> <expand macro="output_graphic_outputs" /> </outputs> + <tests> + <test> + <param name="matrixFile" value="computeMatrix_result1.gz" ftype="deeptools_compute_matrix_archive" /> + <output name="outFileName" file="profiler_result1.png" ftype="png" compare="sim_size" delta="100" /> + </test> + </tests> <help> +<![CDATA[ **What it does** @@ -158,7 +195,7 @@ ----- @REFERENCES@ - +]]> </help> <expand macro="citations" /> </tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/repository_dependencies.xml Tue Oct 20 14:43:12 2015 -0400 @@ -0,0 +1,4 @@ +<?xml version="1.0"?> +<repositories> + <repository changeset_revision="74b09c8e5f6e" name="data_manager_twobit_builder" owner="devteam" toolshed="https://toolshed.g2.bx.psu.edu" /> +</repositories>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/bamCompare_result1.bg Tue Oct 20 14:43:12 2015 -0400 @@ -0,0 +1,1 @@ +chrM 0 16569 1.0
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/bamCoverage_result3.bg Tue Oct 20 14:43:12 2015 -0400 @@ -0,0 +1,11 @@ +chrM 0 210 12259800.00 +chrM 210 220 11998953.19 +chrM 220 230 10694719.15 +chrM 230 240 8347097.87 +chrM 240 250 6260323.40 +chrM 250 260 3391008.51 +chrM 260 16310 2608468.09 +chrM 16310 16320 2347621.28 +chrM 16320 16330 1304234.04 +chrM 16330 16340 1043387.23 +chrM 16340 16350 521693.62
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/bamCoverage_result4.bg Tue Oct 20 14:43:12 2015 -0400 @@ -0,0 +1,460 @@ +phiX174 0 10 5613.46 +phiX174 10 20 16840.38 +phiX174 20 70 50521.15 +phiX174 70 90 67361.54 +phiX174 90 100 84201.92 +phiX174 100 120 89815.38 +phiX174 120 140 101042.31 +phiX174 140 160 112269.23 +phiX174 160 170 123496.15 +phiX174 170 180 145950.00 +phiX174 180 200 162790.38 +phiX174 200 210 168403.85 +phiX174 210 240 179630.77 +phiX174 240 250 190857.69 +phiX174 250 260 202084.62 +phiX174 260 270 235765.38 +phiX174 270 280 263832.69 +phiX174 280 290 286286.54 +phiX174 290 300 314353.85 +phiX174 300 310 297513.46 +phiX174 310 320 303126.92 +phiX174 320 330 342421.15 +phiX174 330 340 359261.54 +phiX174 340 360 387328.85 +phiX174 360 370 404169.23 +phiX174 370 390 421009.62 +phiX174 390 400 415396.15 +phiX174 400 410 426623.08 +phiX174 410 420 432236.54 +phiX174 420 460 449076.92 +phiX174 460 470 465917.31 +phiX174 470 480 443463.46 +phiX174 480 490 449076.92 +phiX174 490 500 471530.77 +phiX174 500 510 454690.38 +phiX174 510 520 465917.31 +phiX174 520 530 471530.77 +phiX174 530 540 449076.92 +phiX174 540 560 482757.69 +phiX174 560 570 499598.08 +phiX174 570 580 505211.54 +phiX174 580 590 499598.08 +phiX174 590 600 488371.15 +phiX174 600 610 471530.77 +phiX174 610 620 533278.85 +phiX174 620 630 572573.08 +phiX174 630 640 566959.62 +phiX174 640 660 544505.77 +phiX174 660 670 538892.31 +phiX174 670 680 499598.08 +phiX174 680 690 527665.38 +phiX174 690 700 533278.85 +phiX174 700 720 499598.08 +phiX174 720 730 510825.00 +phiX174 730 740 516438.46 +phiX174 740 750 505211.54 +phiX174 750 760 477144.23 +phiX174 760 770 471530.77 +phiX174 770 780 488371.15 +phiX174 780 800 533278.85 +phiX174 800 820 522051.92 +phiX174 820 830 499598.08 +phiX174 830 850 460303.85 +phiX174 850 860 454690.38 +phiX174 860 870 443463.46 +phiX174 870 880 471530.77 +phiX174 880 890 499598.08 +phiX174 890 900 505211.54 +phiX174 900 920 527665.38 +phiX174 920 930 544505.77 +phiX174 930 940 538892.31 +phiX174 940 960 527665.38 +phiX174 960 970 510825.00 +phiX174 970 980 488371.15 +phiX174 980 990 482757.69 +phiX174 990 1000 460303.85 +phiX174 1000 1010 454690.38 +phiX174 1010 1020 493984.62 +phiX174 1020 1030 471530.77 +phiX174 1030 1040 527665.38 +phiX174 1040 1060 538892.31 +phiX174 1060 1080 555732.69 +phiX174 1080 1090 578186.54 +phiX174 1090 1100 583800.00 +phiX174 1100 1110 572573.08 +phiX174 1110 1130 561346.15 +phiX174 1130 1140 527665.38 +phiX174 1140 1150 555732.69 +phiX174 1150 1160 544505.77 +phiX174 1160 1170 566959.62 +phiX174 1170 1180 606253.85 +phiX174 1180 1190 617480.77 +phiX174 1190 1200 583800.00 +phiX174 1200 1210 555732.69 +phiX174 1210 1220 583800.00 +phiX174 1220 1230 538892.31 +phiX174 1230 1240 527665.38 +phiX174 1240 1250 465917.31 +phiX174 1250 1260 471530.77 +phiX174 1260 1270 482757.69 +phiX174 1270 1280 460303.85 +phiX174 1280 1290 471530.77 +phiX174 1290 1320 437850.00 +phiX174 1320 1330 421009.62 +phiX174 1330 1340 454690.38 +phiX174 1340 1350 465917.31 +phiX174 1350 1360 460303.85 +phiX174 1360 1370 477144.23 +phiX174 1370 1380 505211.54 +phiX174 1380 1390 488371.15 +phiX174 1390 1400 522051.92 +phiX174 1400 1420 550119.23 +phiX174 1420 1430 522051.92 +phiX174 1430 1440 544505.77 +phiX174 1440 1450 561346.15 +phiX174 1450 1460 595026.92 +phiX174 1460 1470 589413.46 +phiX174 1470 1490 578186.54 +phiX174 1490 1500 566959.62 +phiX174 1500 1520 544505.77 +phiX174 1520 1530 516438.46 +phiX174 1530 1540 538892.31 +phiX174 1540 1550 527665.38 +phiX174 1550 1560 550119.23 +phiX174 1560 1570 544505.77 +phiX174 1570 1580 555732.69 +phiX174 1580 1590 488371.15 +phiX174 1590 1600 477144.23 +phiX174 1600 1610 460303.85 +phiX174 1610 1620 454690.38 +phiX174 1620 1630 443463.46 +phiX174 1630 1640 477144.23 +phiX174 1640 1650 482757.69 +phiX174 1650 1670 488371.15 +phiX174 1670 1680 482757.69 +phiX174 1680 1690 465917.31 +phiX174 1690 1700 477144.23 +phiX174 1700 1710 493984.62 +phiX174 1710 1730 505211.54 +phiX174 1730 1740 516438.46 +phiX174 1740 1750 493984.62 +phiX174 1750 1760 449076.92 +phiX174 1760 1780 415396.15 +phiX174 1780 1790 409782.69 +phiX174 1790 1800 415396.15 +phiX174 1800 1810 443463.46 +phiX174 1810 1820 421009.62 +phiX174 1820 1830 449076.92 +phiX174 1830 1840 544505.77 +phiX174 1840 1860 555732.69 +phiX174 1860 1870 595026.92 +phiX174 1870 1890 583800.00 +phiX174 1890 1900 589413.46 +phiX174 1900 1910 583800.00 +phiX174 1910 1920 578186.54 +phiX174 1920 1930 600640.38 +phiX174 1930 1940 623094.23 +phiX174 1940 1950 606253.85 +phiX174 1950 1960 628707.69 +phiX174 1960 1970 639934.62 +phiX174 1970 1990 662388.46 +phiX174 1990 2000 668001.92 +phiX174 2000 2010 690455.77 +phiX174 2010 2020 656775.00 +phiX174 2020 2030 662388.46 +phiX174 2030 2040 611867.31 +phiX174 2040 2050 555732.69 +phiX174 2050 2060 516438.46 +phiX174 2060 2070 522051.92 +phiX174 2070 2080 493984.62 +phiX174 2080 2100 538892.31 +phiX174 2100 2110 527665.38 +phiX174 2110 2120 499598.08 +phiX174 2120 2130 538892.31 +phiX174 2130 2140 505211.54 +phiX174 2140 2150 488371.15 +phiX174 2150 2160 499598.08 +phiX174 2160 2170 488371.15 +phiX174 2170 2180 505211.54 +phiX174 2180 2190 488371.15 +phiX174 2190 2200 505211.54 +phiX174 2200 2220 516438.46 +phiX174 2220 2230 527665.38 +phiX174 2230 2240 561346.15 +phiX174 2240 2250 555732.69 +phiX174 2250 2260 538892.31 +phiX174 2260 2270 499598.08 +phiX174 2270 2280 482757.69 +phiX174 2280 2290 493984.62 +phiX174 2290 2300 477144.23 +phiX174 2300 2310 566959.62 +phiX174 2310 2320 600640.38 +phiX174 2320 2330 611867.31 +phiX174 2330 2340 606253.85 +phiX174 2340 2350 617480.77 +phiX174 2350 2360 606253.85 +phiX174 2360 2370 623094.23 +phiX174 2370 2380 617480.77 +phiX174 2380 2390 606253.85 +phiX174 2390 2400 617480.77 +phiX174 2400 2410 578186.54 +phiX174 2410 2420 583800.00 +phiX174 2420 2430 555732.69 +phiX174 2430 2440 538892.31 +phiX174 2440 2450 522051.92 +phiX174 2450 2460 572573.08 +phiX174 2460 2470 606253.85 +phiX174 2470 2480 668001.92 +phiX174 2480 2490 639934.62 +phiX174 2490 2500 668001.92 +phiX174 2500 2510 645548.08 +phiX174 2510 2540 578186.54 +phiX174 2540 2550 544505.77 +phiX174 2550 2560 572573.08 +phiX174 2560 2570 589413.46 +phiX174 2570 2580 606253.85 +phiX174 2580 2590 611867.31 +phiX174 2590 2600 595026.92 +phiX174 2600 2610 561346.15 +phiX174 2610 2620 595026.92 +phiX174 2620 2630 606253.85 +phiX174 2630 2650 673615.38 +phiX174 2650 2660 668001.92 +phiX174 2660 2670 606253.85 +phiX174 2670 2680 617480.77 +phiX174 2680 2690 600640.38 +phiX174 2690 2700 589413.46 +phiX174 2700 2710 583800.00 +phiX174 2710 2720 595026.92 +phiX174 2720 2730 639934.62 +phiX174 2730 2740 662388.46 +phiX174 2740 2750 701682.69 +phiX174 2750 2760 696069.23 +phiX174 2760 2780 679228.85 +phiX174 2780 2790 673615.38 +phiX174 2790 2800 662388.46 +phiX174 2800 2810 690455.77 +phiX174 2810 2820 668001.92 +phiX174 2820 2830 645548.08 +phiX174 2830 2840 673615.38 +phiX174 2840 2850 617480.77 +phiX174 2850 2860 589413.46 +phiX174 2860 2870 600640.38 +phiX174 2870 2880 606253.85 +phiX174 2880 2890 595026.92 +phiX174 2890 2910 566959.62 +phiX174 2910 2920 572573.08 +phiX174 2920 2930 522051.92 +phiX174 2930 2940 488371.15 +phiX174 2940 2950 527665.38 +phiX174 2950 2960 505211.54 +phiX174 2960 2970 493984.62 +phiX174 2970 2980 510825.00 +phiX174 2980 2990 477144.23 +phiX174 2990 3000 482757.69 +phiX174 3000 3010 527665.38 +phiX174 3010 3020 510825.00 +phiX174 3020 3030 533278.85 +phiX174 3030 3040 550119.23 +phiX174 3040 3050 522051.92 +phiX174 3050 3060 566959.62 +phiX174 3060 3070 578186.54 +phiX174 3070 3080 572573.08 +phiX174 3080 3090 578186.54 +phiX174 3090 3100 555732.69 +phiX174 3100 3110 611867.31 +phiX174 3110 3120 606253.85 +phiX174 3120 3130 578186.54 +phiX174 3130 3140 583800.00 +phiX174 3140 3150 589413.46 +phiX174 3150 3160 561346.15 +phiX174 3160 3170 566959.62 +phiX174 3170 3180 561346.15 +phiX174 3180 3190 606253.85 +phiX174 3190 3200 600640.38 +phiX174 3200 3210 606253.85 +phiX174 3210 3230 583800.00 +phiX174 3230 3240 611867.31 +phiX174 3240 3250 595026.92 +phiX174 3250 3260 561346.15 +phiX174 3260 3270 572573.08 +phiX174 3270 3280 589413.46 +phiX174 3280 3290 572573.08 +phiX174 3290 3300 566959.62 +phiX174 3300 3310 589413.46 +phiX174 3310 3320 550119.23 +phiX174 3320 3330 589413.46 +phiX174 3330 3340 611867.31 +phiX174 3340 3350 628707.69 +phiX174 3350 3370 634321.15 +phiX174 3370 3380 628707.69 +phiX174 3380 3390 634321.15 +phiX174 3390 3400 572573.08 +phiX174 3400 3430 595026.92 +phiX174 3430 3440 611867.31 +phiX174 3440 3450 623094.23 +phiX174 3450 3460 600640.38 +phiX174 3460 3470 623094.23 +phiX174 3470 3480 578186.54 +phiX174 3480 3490 583800.00 +phiX174 3490 3500 634321.15 +phiX174 3500 3510 628707.69 +phiX174 3510 3520 639934.62 +phiX174 3520 3530 645548.08 +phiX174 3530 3540 578186.54 +phiX174 3540 3550 589413.46 +phiX174 3550 3560 572573.08 +phiX174 3560 3580 550119.23 +phiX174 3580 3590 522051.92 +phiX174 3590 3600 589413.46 +phiX174 3600 3620 617480.77 +phiX174 3620 3630 611867.31 +phiX174 3630 3640 589413.46 +phiX174 3640 3650 583800.00 +phiX174 3650 3670 572573.08 +phiX174 3670 3680 578186.54 +phiX174 3680 3690 589413.46 +phiX174 3690 3700 561346.15 +phiX174 3700 3710 544505.77 +phiX174 3710 3720 550119.23 +phiX174 3720 3730 572573.08 +phiX174 3730 3750 555732.69 +phiX174 3750 3760 533278.85 +phiX174 3760 3770 516438.46 +phiX174 3770 3790 522051.92 +phiX174 3790 3800 465917.31 +phiX174 3800 3820 432236.54 +phiX174 3820 3830 404169.23 +phiX174 3830 3840 443463.46 +phiX174 3840 3850 477144.23 +phiX174 3850 3860 493984.62 +phiX174 3860 3870 499598.08 +phiX174 3870 3880 488371.15 +phiX174 3880 3900 477144.23 +phiX174 3900 3910 454690.38 +phiX174 3910 3920 443463.46 +phiX174 3920 3930 415396.15 +phiX174 3930 3940 409782.69 +phiX174 3940 3960 421009.62 +phiX174 3960 3970 460303.85 +phiX174 3970 3980 471530.77 +phiX174 3980 3990 460303.85 +phiX174 3990 4000 471530.77 +phiX174 4000 4010 482757.69 +phiX174 4010 4020 460303.85 +phiX174 4020 4030 477144.23 +phiX174 4030 4040 482757.69 +phiX174 4040 4050 437850.00 +phiX174 4050 4060 404169.23 +phiX174 4060 4070 381715.38 +phiX174 4070 4080 353648.08 +phiX174 4080 4090 376101.92 +phiX174 4090 4100 381715.38 +phiX174 4100 4110 364875.00 +phiX174 4110 4130 359261.54 +phiX174 4130 4140 387328.85 +phiX174 4140 4150 409782.69 +phiX174 4150 4160 398555.77 +phiX174 4160 4170 437850.00 +phiX174 4170 4180 409782.69 +phiX174 4180 4190 437850.00 +phiX174 4190 4200 443463.46 +phiX174 4200 4210 454690.38 +phiX174 4210 4220 465917.31 +phiX174 4220 4230 454690.38 +phiX174 4230 4240 449076.92 +phiX174 4240 4250 471530.77 +phiX174 4250 4260 465917.31 +phiX174 4260 4290 510825.00 +phiX174 4290 4300 522051.92 +phiX174 4300 4310 533278.85 +phiX174 4310 4320 555732.69 +phiX174 4320 4330 561346.15 +phiX174 4330 4340 505211.54 +phiX174 4340 4350 477144.23 +phiX174 4350 4370 493984.62 +phiX174 4370 4380 505211.54 +phiX174 4380 4390 493984.62 +phiX174 4390 4400 477144.23 +phiX174 4400 4410 499598.08 +phiX174 4410 4420 510825.00 +phiX174 4420 4430 522051.92 +phiX174 4430 4440 533278.85 +phiX174 4440 4450 544505.77 +phiX174 4450 4460 533278.85 +phiX174 4460 4480 527665.38 +phiX174 4480 4490 538892.31 +phiX174 4490 4500 550119.23 +phiX174 4500 4510 527665.38 +phiX174 4510 4530 505211.54 +phiX174 4530 4540 516438.46 +phiX174 4540 4550 550119.23 +phiX174 4550 4560 555732.69 +phiX174 4560 4570 533278.85 +phiX174 4570 4580 522051.92 +phiX174 4580 4600 493984.62 +phiX174 4600 4610 505211.54 +phiX174 4610 4620 449076.92 +phiX174 4620 4630 482757.69 +phiX174 4630 4640 471530.77 +phiX174 4640 4650 488371.15 +phiX174 4650 4660 454690.38 +phiX174 4660 4670 465917.31 +phiX174 4670 4690 460303.85 +phiX174 4690 4700 488371.15 +phiX174 4700 4710 482757.69 +phiX174 4710 4720 471530.77 +phiX174 4720 4730 482757.69 +phiX174 4730 4740 510825.00 +phiX174 4740 4750 527665.38 +phiX174 4750 4760 538892.31 +phiX174 4760 4770 561346.15 +phiX174 4770 4790 611867.31 +phiX174 4790 4810 623094.23 +phiX174 4810 4830 606253.85 +phiX174 4830 4840 561346.15 +phiX174 4840 4850 617480.77 +phiX174 4850 4860 595026.92 +phiX174 4860 4870 606253.85 +phiX174 4870 4880 600640.38 +phiX174 4880 4900 589413.46 +phiX174 4900 4910 538892.31 +phiX174 4910 4920 533278.85 +phiX174 4920 4930 544505.77 +phiX174 4930 4940 516438.46 +phiX174 4940 4950 482757.69 +phiX174 4950 4960 454690.38 +phiX174 4960 4970 409782.69 +phiX174 4970 4980 381715.38 +phiX174 4980 4990 336807.69 +phiX174 4990 5000 359261.54 +phiX174 5000 5010 392942.31 +phiX174 5010 5020 415396.15 +phiX174 5020 5030 409782.69 +phiX174 5030 5040 415396.15 +phiX174 5040 5050 437850.00 +phiX174 5050 5060 381715.38 +phiX174 5060 5070 364875.00 +phiX174 5070 5080 359261.54 +phiX174 5080 5090 364875.00 +phiX174 5090 5100 370488.46 +phiX174 5100 5120 376101.92 +phiX174 5120 5140 364875.00 +phiX174 5140 5150 370488.46 +phiX174 5150 5160 359261.54 +phiX174 5160 5180 319967.31 +phiX174 5180 5190 325580.77 +phiX174 5190 5200 314353.85 +phiX174 5200 5210 269446.15 +phiX174 5210 5220 235765.38 +phiX174 5220 5230 202084.62 +phiX174 5230 5240 190857.69 +phiX174 5240 5250 162790.38 +phiX174 5250 5280 129109.62 +phiX174 5280 5290 106655.77 +phiX174 5290 5300 78588.46 +phiX174 5300 5310 61748.08 +phiX174 5310 5340 33680.77 +phiX174 5340 5350 22453.85 +phiX174 5350 5386 11226.9
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/bamPEFragmentSize_result1.txt Tue Oct 20 14:43:12 2015 -0400 @@ -0,0 +1,9 @@ +Sample size: 3 + +Min.: 241.0 +1st Qu.: 241.5 +Mean: 244.666666667 +Median: 242.0 +3rd Qu.: 246.5 +Max.: 251.0 +Std: 4.49691252108
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/bigwigCompare_result2.bg Tue Oct 20 14:43:12 2015 -0400 @@ -0,0 +1,3 @@ +ch1 0 400 1.0 +ch2 0 400 1.0 +ch3 0 400 1.0
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/computeGCBias_result1.tabular Tue Oct 20 14:43:12 2015 -0400 @@ -0,0 +1,101 @@ +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 1.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 1.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 1.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 1.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 1.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 2.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 2.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 1.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00 +0.000000000000000000e+00 0.000000000000000000e+00 1.000000000000000000e+00
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/computeMatrix1.bed Tue Oct 20 14:43:12 2015 -0400 @@ -0,0 +1,8 @@ +phiX174 1000 1500 CG11023 0 + +phiX174 150 1750 cda5 0 - +phiX174 150 177 cda8 0 - +phiX174 75 1500 cda9 0 + +phiX174 101 175 C11023 0 + +phiX174 125 150 ca5 0 - +phiX174 450 1750 ca8 0 + +phiX174 80 1500 cda9 0 +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/computeMatrix2.bed Tue Oct 20 14:43:12 2015 -0400 @@ -0,0 +1,6 @@ +ch1 100 150 CG11023 0 + +ch2 150 175 cda5 0 - +ch3 100 125 cda8 0 + +ch1 75 125 C11023 0 + +ch2 125 150 ca5 0 - +ch3 75 100 ca8 0 +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/phiX.fasta Tue Oct 20 14:43:12 2015 -0400 @@ -0,0 +1,79 @@ +>phiX174 +GAGTTTTATCGCTTCCATGACGCAGAAGTTAACACTTTCGGATATTTCTGATGAGTCGAAAAATTATCTT +GATAAAGCAGGAATTACTACTGCTTGTTTACGAATTAAATCGAAGTGGACTGCTGGCGGAAAATGAGAAA +ATTCGACCTATCCTTGCGCAGCTCGAGAAGCTCTTACTTTGCGACCTTTCGCCATCAACTAACGATTCTG +TCAAAAACTGACGCGTTGGATGAGGAGAAGTGGCTTAATATGCTTGGCACGTTCGTCAAGGACTGGTTTA +GATATGAGTCACATTTTGTTCATGGTAGAGATTCTCTTGTTGACATTTTAAAAGAGCGTGGATTACTATC +TGAGTCCGATGCTGTTCAACCACTAATAGGTAAGAAATCATGAGTCAAGTTACTGAACAATCCGTACGTT +TCCAGACCGCTTTGGCCTCTATTAAGCTCATTCAGGCTTCTGCCGTTTTGGATTTAACCGAAGATGATTT +CGATTTTCTGACGAGTAACAAAGTTTGGATTGCTACTGACCGCTCTCGTGCTCGTCGCTGCGTTGAGGCT +TGCGTTTATGGTACGCTGGACTTTGTGGGATACCCTCGCTTTCCTGCTCCTGTTGAGTTTATTGCTGCCG +TCATTGCTTATTATGTTCATCCCGTCAACATTCAAACGGCCTGTCTCATCATGGAAGGCGCTGAATTTAC +GGAAAACATTATTAATGGCGTCGAGCGTCCGGTTAAAGCCGCTGAATTGTTCGCGTTTACCTTGCGTGTA +CGCGCAGGAAACACTGACGTTCTTACTGACGCAGAAGAAAACGTGCGTCAAAAATTACGTGCAGAAGGAG +TGATGTAATGTCTAAAGGTAAAAAACGTTCTGGCGCTCGCCCTGGTCGTCCGCAGCCGTTGCGAGGTACT +AAAGGCAAGCGTAAAGGCGCTCGTCTTTGGTATGTAGGTGGTCAACAATTTTAATTGCAGGGGCTTCGGC +CCCTTACTTGAGGATAAATTATGTCTAATATTCAAACTGGCGCCGAGCGTATGCCGCATGACCTTTCCCA +TCTTGGCTTCCTTGCTGGTCAGATTGGTCGTCTTATTACCATTTCAACTACTCCGGTTATCGCTGGCGAC +TCCTTCGAGATGGACGCCGTTGGCGCTCTCCGTCTTTCTCCATTGCGTCGTGGCCTTGCTATTGACTCTA +CTGTAGACATTTTTACTTTTTATGTCCCTCATCGTCACGTTTATGGTGAACAGTGGATTAAGTTCATGAA +GGATGGTGTTAATGCCACTCCTCTCCCGACTGTTAACACTACTGGTTATATTGACCATGCCGCTTTTCTT +GGCACGATTAACCCTGATACCAATAAAATCCCTAAGCATTTGTTTCAGGGTTATTTGAATATCTATAACA +ACTATTTTAAAGCGCCGTGGATGCCTGACCGTACCGAGGCTAACCCTAATGAGCTTAATCAAGATGATGC +TCGTTATGGTTTCCGTTGCTGCCATCTCAAAAACATTTGGACTGCTCCGCTTCCTCCTGAGACTGAGCTT +TCTCGCCAAATGACGACTTCTACCACATCTATTGACATTATGGGTCTGCAAGCTGCTTATGCTAATTTGC +ATACTGACCAAGAACGTGATTACTTCATGCAGCGTTACCGTGATGTTATTTCTTCATTTGGAGGTAAAAC +CTCTTATGACGCTGACAACCGTCCTTTACTTGTCATGCGCTCTAATCTCTGGGCATCTGGCTATGATGTT +GATGGAACTGACCAAACGTCGTTAGGCCAGTTTTCTGGTCGTGTTCAACAGACCTATAAACATTCTGTGC +CGCGTTTCTTTGTTCCTGAGCATGGCACTATGTTTACTCTTGCGCTTGTTCGTTTTCCGCCTACTGCGAC +TAAAGAGATTCAGTACCTTAACGCTAAAGGTGCTTTGACTTATACCGATATTGCTGGCGACCCTGTTTTG +TATGGCAACTTGCCGCCGCGTGAAATTTCTATGAAGGATGTTTTCCGTTCTGGTGATTCGTCTAAGAAGT +TTAAGATTGCTGAGGGTCAGTGGTATCGTTATGCGCCTTCGTATGTTTCTCCTGCTTATCACCTTCTTGA +AGGCTTCCCATTCATTCAGGAACCGCCTTCTGGTGATTTGCAAGAACGCGTACTTATTCGCCACCATGAT +TATGACCAGTGTTTCCAGTCCGTTCAGTTGTTGCAGTGGAATAGTCAGGTTAAATTTAATGTGACCGTTT +ATCGCAATCTGCCGACCACTCGCGATTCAATCATGACTTCGTGATAAAAGATTGAGTGTGAGGTTATAAC +GCCGAAGCGGTAAAAATTTTAATTTTTGCCGCTGAGGGGTTGACCAAGCGAAGCGCGGTAGGTTTTCTGC +TTAGGAGTTTAATCATGTTTCAGACTTTTATTTCTCGCCATAATTCAAACTTTTTTTCTGATAAGCTGGT +TCTCACTTCTGTTACTCCAGCTTCTTCGGCACCTGTTTTACAGACACCTAAAGCTACATCGTCAACGTTA +TATTTTGATAGTTTGACGGTTAATGCTGGTAATGGTGGTTTTCTTCATTGCATTCAGATGGATACATCTG +TCAACGCCGCTAATCAGGTTGTTTCTGTTGGTGCTGATATTGCTTTTGATGCCGACCCTAAATTTTTTGC +CTGTTTGGTTCGCTTTGAGTCTTCTTCGGTTCCGACTACCCTCCCGACTGCCTATGATGTTTATCCTTTG +AATGGTCGCCATGATGGTGGTTATTATACCGTCAAGGACTGTGTGACTATTGACGTCCTTCCCCGTACGC +CGGGCAATAATGTTTATGTTGGTTTCATGGTTTGGTCTAACTTTACCGCTACTAAATGCCGCGGATTGGT +TTCGCTGAATCAGGTTATTAAAGAGATTATTTGTCTCCAGCCACTTAAGTGAGGTGATTTATGTTTGGTG +CTATTGCTGGCGGTATTGCTTCTGCTCTTGCTGGTGGCGCCATGTCTAAATTGTTTGGAGGCGGTCAAAA +AGCCGCCTCCGGTGGCATTCAAGGTGATGTGCTTGCTACCGATAACAATACTGTAGGCATGGGTGATGCT +GGTATTAAATCTGCCATTCAAGGCTCTAATGTTCCTAACCCTGATGAGGCCGCCCCTAGTTTTGTTTCTG +GTGCTATGGCTAAAGCTGGTAAAGGACTTCTTGAAGGTACGTTGCAGGCTGGCACTTCTGCCGTTTCTGA +TAAGTTGCTTGATTTGGTTGGACTTGGTGGCAAGTCTGCCGCTGATAAAGGAAAGGATACTCGTGATTAT +CTTGCTGCTGCATTTCCTGAGCTTAATGCTTGGGAGCGTGCTGGTGCTGATGCTTCCTCTGCTGGTATGG +TTGACGCCGGATTTGAGAATCAAAAAGAGCTTACTAAAATGCAACTGGACAATCAGAAAGAGATTGCCGA +GATGCAAAATGAGACTCAAAAAGAGATTGCTGGCATTCAGTCGGCGACTTCACGCCAGAATACGAAAGAC +CAGGTATATGCACAAAATGAGATGCTTGCTTATCAACAGAAGGAGTCTACTGCTCGCGTTGCGTCTATTA +TGGAAAACACCAATCTTTCCAAGCAACAGCAGGTTTCCGAGATTATGCGCCAAATGCTTACTCAAGCTCA +AACGGCTGGTCAGTATTTTACCAATGACCAAATCAAAGAAATGACTCGCAAGGTTAGTGCTGAGGTTGAC +TTAGTTCATCAGCAAACGCAGAATCAGCGGTATGGCTCTTCTCATATTGGCGCTACTGCAAAGGATATTT +CTAATGTCGTCACTGATGCTGCTTCTGGTGTGGTTGATATTTTTCATGGTATTGATAAAGCTGTTGCCGA +TACTTGGAACAATTTCTGGAAAGACGGTAAAGCTGATGGTATTGGCTCTAATTTGTCTAGGAAATAACCG +TCAGGATTGACACCCTCCCAATTGTATGTTTTCATGCCTCCAAATCTTGGAGGCTTTTTTATGGTTCGTT +CTTATTACCCTTCTGAATGTCACGCTGATTATTTTGACTTTGAGCGTATCGAGGCTCTTAAACCTGCTAT +TGAGGCTTGTGGCATTTCTACTCTTTCTCAATCCCCAATGCTTGGCTTCCATAAGCAGATGGATAACCGC +ATCAAGCTCTTGGAAGAGATTCTGTCTTTTCGTATGCAGGGCGTTGAGTTCGATAATGGTGATATGTATG +TTGACGGCCATAAGGCTGCTTCTGACGTTCGTGATGAGTTTGTATCTGTTACTGAGAAGTTAATGGATGA +ATTGGCACAATGCTACAATGTGCTCCCCCAACTTGATATTAATAACACTATAGACCACCGCCCCGAAGGG +GACGAAAAATGGTTTTTAGAGAACGAGAAGACGGTTACGCAGTTTTGCCGCAAGCTGGCTGCTGAACGCC +CTCTTAAGGATATTCGCGATGAGTATAATTACCCCAAAAAGAAAGGTATTAAGGATGAGTGTTCAAGATT +GCTGGAGGCCTCCACTATGAAATCGCGTAGAGGCTTTACTATTCAGCGTTTGATGAATGCAATGCGACAG +GCTCATGCTGATGGTTGGTTTATCGTTTTTGACACTCTCACGTTGGCTGACGACCGATTAGAGGCGTTTT +ATGATAATCCCAATGCTTTGCGTGACTATTTTCGTGATATTGGTCGTATGGTTCTTGCTGCCGAGGGTCG +CAAGGCTAATGATTCACACGCCGACTGCTATCAGTATTTTTGTGTGCCTGAGTATGGTACAGCTAATGGC +CGTCTTCATTTCCATGCGGTGCATTTTATGCGGACACTTCCTACAGGTAGCGTTGACCCTAATTTTGGTC +GTCGGGTACGCAATCGCCGCCAGTTAAATAGCTTGCAAAATACGTGGCCTTATGGTTACAGTATGCCCAT +CGCAGTTCGCTACACGCAGGACGCTTTTTCACGTTCTGGTTGGTTGTGGCCTGTTGATGCTAAAGGTGAG +CCGCTTAAAGCTACCAGTTATATGGCTGTTGGTTTCTATGTGGCTAAATACGTTAACAAAAAGTCAGATA +TGGACCTTGCTGCTAAAGGTCTAGGAGCTAAAGAATGGAACAACTCACTAAAAACCAAGCTGTCGCTACT +TCCCAAGAAGCTGTTCAGAATCAGAATGAGCCGCAACTTCGGGATGAAAATGCTCACAATGACAAATCTG +TCCACGGAGTGCTTAATCCAACTTACCAAGCTGGGTTACGACGCGACGCCGTTCAACCAGATATTGAAGC +AGAACGCAAAAAGAGAGATGAGATTGAGGCTGGGAAAAGTTACTGTAGCCGACGTTTTGGCGGCGCAACC +TGTGACGACAAATCTGCTCAAATTTATGCGCGCTTCGATAAAAATGATTGGCGTATCCAACCTGCA +
--- a/test-data/test2.bed Tue Sep 16 13:46:05 2014 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,8 +0,0 @@ -ch1 100 150 CG11023 0 + -ch2 150 175 cda5 0 - -ch3 100 125 cda8 0 + -#Group 1 -ch1 75 125 C11023 0 + -ch2 125 150 ca5 0 - -ch3 75 100 ca8 0 + -#Group 2
--- a/tool-data/deepTools_seqs.loc.sample Tue Sep 16 13:46:05 2014 -0400 +++ /dev/null Thu Jan 01 00:00:00 1970 +0000 @@ -1,27 +0,0 @@ -#This is a sample file distributed with Galaxy that enables tools -#to use a directory of 2bit genome files for use with deepTools. You will -#need to supply these files and then create a deepTools_seqs.loc file -#similar to this one (store it in this directory) that points to -#the directories in which those files are stored. The deepTools_seqs.loc -#file has this format: -# -#<unique_build_id> <display_name> <file_path> -# -#So, for example, if your deepTools_seqs.loc began like this: -# -#hg18 Human (Homo sapiens): hg18 /depot/data2/galaxy/twobit/hg18.2bit -#hg19 Human (Homo sapiens): hg19 /depot/data2/galaxy/twobit/hg19.2bit -#mm9 Mouse (Mus musculus): mm9 /depot/data2/galaxy/twobit/mm9.2bit -# -#then your /depot/data2/galaxy/twobit/ directory -#would need to contain the following 2bit files: -# -#-rw-r--r-- 1 james universe 830134 2005-09-13 10:12 hg18.2bit -#-rw-r--r-- 1 james universe 527388 2005-09-13 10:12 hg19.2bit -#-rw-r--r-- 1 james universe 269808 2005-09-13 10:12 mm9.2bit -# -#Your deepTools_seqs.loc file should include an entry per line for -#each file you have stored that you want to be available. Note that -#your files should all have the extension '2bit'. -# -#Please note that the <unique_build_id> is also used as "Species name abbreviation".
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool-data/lastz_seqs.loc.sample Tue Oct 20 14:43:12 2015 -0400 @@ -0,0 +1,29 @@ +#This is a sample file distributed with Galaxy that enables tools +#to use a directory of 2bit genome files for use with deepTools. +#This file is named lastz_seqs.loc file to make use of an already existing loc +#file from the lastz tool that is created by the twobit data-manager. +#You will need to supply these files and then create a lastz_seqs.loc file +#similar to this one (store it in this directory) that points to +#the directories in which those files are stored. The lastz_seqs.loc +#file has this format: +# +#<unique_build_id> <display_name> <file_path> +# +#So, for example, if your lastz_seqs.loc began like this: +# +#hg18 Human (Homo sapiens): hg18 /depot/data2/galaxy/twobit/hg18.2bit +#hg19 Human (Homo sapiens): hg19 /depot/data2/galaxy/twobit/hg19.2bit +#mm9 Mouse (Mus musculus): mm9 /depot/data2/galaxy/twobit/mm9.2bit +# +#then your /depot/data2/galaxy/twobit/ directory +#would need to contain the following 2bit files: +# +#-rw-r--r-- 1 james universe 830134 2005-09-13 10:12 hg18.2bit +#-rw-r--r-- 1 james universe 527388 2005-09-13 10:12 hg19.2bit +#-rw-r--r-- 1 james universe 269808 2005-09-13 10:12 mm9.2bit +# +#Your lastz_seqs.loc file should include an entry per line for +#each file you have stored that you want to be available. Note that +#your files should all have the extension '2bit'. +# +#Please note that the <unique_build_id> is also used as "Species name abbreviation".
--- a/tool_data_table_conf.xml.sample Tue Sep 16 13:46:05 2014 -0400 +++ b/tool_data_table_conf.xml.sample Tue Oct 20 14:43:12 2015 -0400 @@ -1,7 +1,8 @@ +<!-- Use the file tool_data_table_conf.xml.oldlocstyle if you don't want to update your loc files as changed in revision 4550:535d276c92bc--> <tables> - <!-- Locations of 2bit sequence files for use in deepTools --> - <table name="deepTools_seqs" comment_char="#"> + <!-- Locations of 2bit sequence files for use in Lastz --> + <table name="lastz_seqs" comment_char="#"> <columns>value, name, path</columns> - <file path="tool-data/deepTools_seqs.loc" /> + <file path="tool-data/lastz_seqs.loc" /> </table> </tables>
--- a/tool_dependencies.xml Tue Sep 16 13:46:05 2014 -0400 +++ b/tool_dependencies.xml Tue Oct 20 14:43:12 2015 -0400 @@ -1,101 +1,9 @@ <?xml version="1.0"?> <tool_dependency> - <package name="samtools" version="0.1.19"> - <repository changeset_revision="923adc89c666" name="package_samtools_0_1_19" owner="iuc" prior_installation_required="True" toolshed="https://toolshed.g2.bx.psu.edu" /> - </package> - <package name="numpy" version="1.7.1"> - <repository changeset_revision="ef12a3a11d5b" name="package_numpy_1_7" owner="iuc" prior_installation_required="True" toolshed="https://toolshed.g2.bx.psu.edu" /> - </package> - <package name="matplotlib" version="1.2.1"> - <repository changeset_revision="fe60617380df" name="package_matplotlib_1_2" owner="iuc" prior_installation_required="True" toolshed="https://toolshed.g2.bx.psu.edu" /> - </package> - <package name="scipy" version="0.12.0"> - <repository changeset_revision="984d208b0808" name="package_scipy_0_12" owner="iuc" prior_installation_required="True" toolshed="https://toolshed.g2.bx.psu.edu" /> - </package> - <package name="pysam" version="0.7.7"> - <repository changeset_revision="b62538c8c664" name="package_pysam_0_7_7" owner="iuc" prior_installation_required="True" toolshed="https://toolshed.g2.bx.psu.edu" /> - </package> - <package name="bx-python" version="12-2013"> - <repository changeset_revision="55bd96a1c3b3" name="package_bx_python_12_2013" owner="iuc" prior_installation_required="True" toolshed="https://toolshed.g2.bx.psu.edu" /> + <package name="python" version="2.7"> + <repository changeset_revision="eb37ce21eef1" name="package_python_2_7" owner="iuc" toolshed="https://toolshed.g2.bx.psu.edu" /> </package> - - <package name="ucsc_tools" version="0.1"> - <install version="1.0"> - <actions> - <action type="download_binary"> - <url_template architecture="x86_64" os="linux">http://hgdownload.cse.ucsc.edu/admin/exe/linux.x86_64/bedGraphToBigWig</url_template> - <url_template architecture="i686" os="darwin">http://hgdownload.cse.ucsc.edu/admin/exe/macOSX.i386/bedGraphToBigWig</url_template> - <url_template architecture="i386" os="darwin">http://hgdownload.cse.ucsc.edu/admin/exe/macOSX.i386/bedGraphToBigWig</url_template> - <url_template architecture="x86_64" os="darwin">http://hgdownload.cse.ucsc.edu/admin/exe/macOSX.x86_64/bedGraphToBigWig</url_template> - </action> - <action type="chmod"> - <file mode="755">$INSTALL_DIR/bedGraphToBigWig</file> - </action> - <action type="download_binary"> - <url_template architecture="x86_64" os="linux">http://hgdownload.cse.ucsc.edu/admin/exe/linux.x86_64/bigWigInfo</url_template> - <url_template architecture="i686" os="darwin">http://hgdownload.cse.ucsc.edu/admin/exe/macOSX.i386/bigWigInfo</url_template> - <url_template architecture="i386" os="darwin">http://hgdownload.cse.ucsc.edu/admin/exe/macOSX.i386/bigWigInfo</url_template> - <url_template architecture="x86_64" os="darwin">http://hgdownload.cse.ucsc.edu/admin/exe/macOSX.x86_64/bigWigInfo</url_template> - </action> - <action type="chmod"> - <file mode="755">$INSTALL_DIR/bigWigInfo</file> - </action> - <action type="download_binary"> - <url_template architecture="x86_64" os="linux">http://hgdownload.cse.ucsc.edu/admin/exe/linux.x86_64/bigWigToBedGraph</url_template> - <url_template architecture="i686" os="darwin">http://hgdownload.cse.ucsc.edu/admin/exe/macOSX.i386/bigWigToBedGraph</url_template> - <url_template architecture="i386" os="darwin">http://hgdownload.cse.ucsc.edu/admin/exe/macOSX.i386/bigWigToBedGraph</url_template> - <url_template architecture="x86_64" os="darwin">http://hgdownload.cse.ucsc.edu/admin/exe/macOSX.x86_64/bigWigToBedGraph</url_template> - </action> - <action type="chmod"> - <file mode="755">$INSTALL_DIR/bigWigToBedGraph</file> - </action> - <action type="set_environment"> - <environment_variable action="prepend_to" name="PATH">$INSTALL_DIR</environment_variable> - </action> - </actions> - </install> - <readme>The tools downloaded by this dependency definition are free for academic use. TODO: UCSC tools are only available with their latest version. That is not good for reproducibility.</readme> - </package> - - <package name="deepTools" version="1.5.9.1"> - <install version="1.0"> - <actions> - <action type="shell_command">git clone --recursive https://github.com/fidelram/deepTools.git</action> - <!-- populate the environment variables from the dependend repos --> - <action type="set_environment_for_install"> - <repository changeset_revision="b62538c8c664" name="package_pysam_0_7_7" owner="iuc" toolshed="https://toolshed.g2.bx.psu.edu"> - <package name="pysam" version="0.7.7" /> - </repository> - <repository changeset_revision="55bd96a1c3b3" name="package_bx_python_12_2013" owner="iuc" toolshed="https://toolshed.g2.bx.psu.edu"> - <package name="bx-python" version="12-2013" /> - </repository> - <repository changeset_revision="ef12a3a11d5b" name="package_numpy_1_7" owner="iuc" toolshed="https://toolshed.g2.bx.psu.edu"> - <package name="numpy" version="1.7.1" /> - </repository> - <repository changeset_revision="fe60617380df" name="package_matplotlib_1_2" owner="iuc" toolshed="https://toolshed.g2.bx.psu.edu"> - <package name="matplotlib" version="1.2.1" /> - </repository> - <repository changeset_revision="984d208b0808" name="package_scipy_0_12" owner="iuc" toolshed="https://toolshed.g2.bx.psu.edu"> - <package name="scipy" version="0.12.0" /> - </repository> - </action> - <action type="shell_command">git reset --hard 351890e3db9a443484c5c349791b7247163cc94f</action> - <action type="make_directory">$INSTALL_DIR/lib/python</action> - <action type="shell_command"> - export PYTHONPATH=$PYTHONPATH:$INSTALL_DIR/lib/python && - python setup.py install --install-lib $INSTALL_DIR/lib/python --install-scripts $INSTALL_DIR/bin - </action> - <action type="set_environment"> - <environment_variable action="prepend_to" name="PATH">$INSTALL_DIR/bin</environment_variable> - <environment_variable action="prepend_to" name="PYTHONPATH">$INSTALL_DIR/lib/python</environment_variable> - <!-- disable the config file of deepTools --> - <environment_variable action="set_to" name="DEEP_TOOLS_NO_CONFIG">TRUE</environment_variable> - </action> - </actions> - </install> - <readme> - Installation of deepTools from Fidel Ramirez. - https://github.com/fidelram/deepTools - </readme> - </package> + <package name="deepTools" version="1.5.11"> + <repository changeset_revision="01eb49da8dcf" name="package_python_2_7_deeptools_1_5_11" owner="iuc" toolshed="https://toolshed.g2.bx.psu.edu" /> + </package> </tool_dependency>