changeset 2:156e0da5b917 draft

planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/flye commit a926a92aed3e22b14fb88af204c8450987c59743
author bgruening
date Thu, 29 Nov 2018 04:34:34 -0500
parents cd256484eb1a
children 1ce9b1d72ec3
files flye.xml macros.xml test-data/E.coli_PacBio_40x_first_1K_reads.fasta test-data/E.coli_PacBio_40x_first_200_reads.fasta test-data/Loman_E.coli_MAP006-1_2D_50x_first_500_reads.fasta test-data/nanopore.fasta test-data/result1_assembly_graph.dot test-data/result1_assembly_info.txt test-data/result1_contigs.fasta test-data/result1_scaffolds.fasta test-data/result2_assembly_graph.dot test-data/result2_assembly_info.txt test-data/result2_contigs.fasta test-data/result2_scaffolds.fasta test-data/result3_contigs.fasta test-data/result3_scaffolds.fasta
diffstat 16 files changed, 2444 insertions(+), 144143 deletions(-) [+]
line wrap: on
line diff
--- a/flye.xml	Fri Sep 28 19:18:54 2018 -0400
+++ b/flye.xml	Thu Nov 29 04:34:34 2018 -0500
@@ -1,4 +1,4 @@
-<tool id="flye" name="Assembly" version="2.3.5">
+<tool id="flye" name="Assembly" version="2.3.7">
     <description>of long and error-prone reads</description>
     <macros>
         <import>macros.xml</import>
@@ -25,7 +25,7 @@
     flye
     $mode
     #for $counter, $input in enumerate($inputs):
-        ./input_${counter}.${input.ext}
+        ./input_${counter}.$ext
     #end for
 
     -o out_dir 
@@ -61,30 +61,30 @@
     </outputs>
     <tests>
         <test>            
-            <param name="inputs" ftype="fasta" value="E.coli_PacBio_40x_first_200_reads.fasta"/>
+            <param name="inputs" ftype="fasta" value="nanopore.fasta"/>
             <param name="mode" value="--pacbio-raw"/>
-            <param name="g" value="1m"/>
-            <output name="contigs" file="result1_contigs.fasta" ftype="fasta"/>
-            <output name="scaffolds" file="result1_scaffolds.fasta" ftype="fasta"/>
-            <output name="assembly_info" file="result1_assembly_info.txt" ftype="tabular"/>
+            <param name="g" value="10000"/>
+            <output name="contigs" file="result1_contigs.fasta" ftype="fasta" compare="sim_size"/>
+            <output name="scaffolds" file="result1_scaffolds.fasta" ftype="fasta" compare="sim_size"/>
+            <output name="assembly_info" file="result1_assembly_info.txt" ftype="tabular" compare="sim_size"/>
             <output name="assembly_graph" file="result1_assembly_graph.dot" ftype="graph_dot" compare="sim_size"/>    
         </test>
         <test>            
-            <param name="inputs" ftype="fasta" value="Loman_E.coli_MAP006-1_2D_50x_first_500_reads.fasta"/>
+            <param name="inputs" ftype="fasta" value="nanopore.fasta"/>
             <param name="mode" value="--nano-raw"/>
-            <param name="g" value="100000"/>
-            <output name="contigs" file="result2_contigs.fasta" ftype="fasta"/>
-            <output name="scaffolds" file="result2_scaffolds.fasta" ftype="fasta"/>
-            <output name="assembly_info" file="result2_assembly_info.txt" ftype="tabular"/>
+            <param name="g" value="10000"/>
+            <output name="contigs" file="result2_contigs.fasta" ftype="fasta" compare="sim_size"/>
+            <output name="scaffolds" file="result2_scaffolds.fasta" ftype="fasta" compare="sim_size"/>
+            <output name="assembly_info" file="result2_assembly_info.txt" ftype="tabular" compare="sim_size"/>
             <output name="assembly_graph" file="result2_assembly_graph.dot" ftype="graph_dot" compare="sim_size"/>    
         </test>
         <test>            
-            <param name="inputs" ftype="fasta" value="E.coli_PacBio_40x_first_200_reads.fasta"/>
+            <param name="inputs" ftype="fasta" value="nanopore.fasta"/>
             <param name="mode" value="--pacbio-raw"/>
-            <param name="g" value="1.1m"/>
+            <param name="g" value="10000"/>
             <param name="i" value="2"/>
-            <output name="contigs" file="result3_contigs.fasta" ftype="fasta"/>
-            <output name="scaffolds" file="result3_scaffolds.fasta" ftype="fasta"/>
+            <output name="contigs" file="result3_contigs.fasta" ftype="fasta" compare="sim_size"/>
+            <output name="scaffolds" file="result3_scaffolds.fasta" ftype="fasta" compare="sim_size"/>
         </test>
     </tests>
     <help><![CDATA[
--- a/macros.xml	Fri Sep 28 19:18:54 2018 -0400
+++ b/macros.xml	Thu Nov 29 04:34:34 2018 -0500
@@ -1,7 +1,7 @@
 <macros>
     <xml name="requirements">
         <requirements>
-        <requirement type="package" version="2.3.5">flye</requirement>
+        <requirement type="package" version="2.3.7">flye</requirement>
             <yield/>
         </requirements>
     </xml>
@@ -20,4 +20,4 @@
             <yield />
         </citations>
     </xml>
-</macros>
\ No newline at end of file
+</macros>
--- a/test-data/E.coli_PacBio_40x_first_1K_reads.fasta	Fri Sep 28 19:18:54 2018 -0400
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,115822 +0,0 @@
->m141013_011508_sherri_c100709962550000001823135904221533_s1_p0/29/0_6709 RQ=0.843
-aaacccacccaacccaagggaaaaaaaaggaaggggaagaaaagattttaaataaatggggggggtttgcccccggttgg
-aagcgggggacccccaaaccggggagtgggaaaataccgggtttttatttgcgaaaaagctttgggcgaggatctccttt
-tcatcggggccccggggttaaggtccaacttttccaccgcttcgctttccacgccggcccctgggccgcaaagttttctt
-gtggaatgtaaaaaacacaaaatactggcctggtttgtgttttttttccagtttttttcgatcccaagaataccttcgcg
-gttgattttcgctttaatggtttaccggtcagcgggagccaggaagacgccgcatgccgacccgggcaggatgccgccgt
-gaaaccgtggcagacgggattaaacgcgaatggtcgttgcgcgaagtatttcccggccaaaactgcgcgccaagaccgag
-tttctggccctcttccagcagttcctgttcccgctggaaacatcgcggaacgcctgaccatgttttcgttcccttccgtc
-ggcagttcaatcgtaatagtggagcgcttgctaacttgacggtttttcaggttggttttttccgccagacgtatccgccc
-aatcacaaacgcgatatgggtagcggccgggcaggctgcagtaccgagggtcgcattttttctcgccgaggagtttttca
-gtttggccggggaagtccagcagcggctttggtttcctggtagagatacgttttgttggcagagccggccgcttttcgca
-acggcaaggaattgtagctcatcgccatctaccgcgtacaaggtcgatttgcgcagggcaggttagtggccggtgtttga
-cctctttgtacatgtccagcgccgcattctgtgaatagcgcaggtttatctatcttcgatataggtgttatagaacgcct
-ttcgacagcgtttctttgcttcatcaccttacccatccgctgcttggaatagtttcgaggccgccggtccacacgcgctg
-gcctttttaccgacgatgatcgcggtgcgggtatgctctggcaggtcggcagcacgccttttggcggcgatttcggagtt
-ttttaagattgcagcggccacgtacttgtcgtttgcttgggcttctggatcggtgaagggccgcaacctgttttctggtg
-tgccggccggaggcagtaaaagaagcgtcgtgacagggcttgctgcgcgccagcagggtcagggcttctggttccacgct
-ttcagggatggtttcgccgtcgaagtcggcaacgctaacgtaatcggaagtgagtagatagttattgcggtaatttggtc
-tttccccatcgggaaaggttgcctggtagataaagggttttgttttgacatagcttccagcctgttacctaatatagata
-tttgtgtttgtattcgaaaatggcgtgggccgcggtagtcacgggcgcacgcaaagtgcatttataagaacgcgtacatc
-gcggcgtaaagatccagcgaagacgcacgatacgctcacaccaatcaaaccccggcagaataaagctgtggttgatgacg
-agcctgactcggcatggggtggtggcccggaacggtcaaactgaatcgctgcgcagatcgctcgataagtccggcaggat
-gttaataatccgtagcaagccggtgctgacgccacgatggtatgccggactcaacgcgatcgccaagcggcgaaccggaa
-caatcgccgccaggcgcggccgcaagcctgagagtttaacaacttgagaaaccagcagcagaaacaaagtggccatagcc
-cacggaatactctttcaccattttcacccagtacgccctgaattccagacattgcgcgacgaaacatggtttctaggcgc
-caatccattcataccgtacaccgccacgatggcgatcataaccgggaacggaagacttcgtttttttgagatagacgcgg
-gattggttttggtcaggagataacttaatcagcgccccggtcagccagcataaacatcttgaactaactcagtaacatcc
-gacagcgttttggccgccggaagggatggacgcaggtcagaatcagcaccaggaagggcggactaacaggcggatttgcc
-ccgaggaaagggcccattgccagtccagttgcttttcggcagttttttatccagcataagcgtcgcggtatcaccgtaaa
-catactcacggttgtcccgttttccggtacggagagttgaatttctgggaactcttcgtctttaaaatccagatcttgta
-cgcgcggacgcagctgaacggataaccgatacggccaggataccggattaacgtcgatgggaatggtgatgtgccaagca
-gatcgaggaactcagatgggcgaccatcaaggtgacatttacccgccagcatcgcagccagagaacactgaccggcaacc
-cgacagcgcggatctggcgataatccgccgcatctgtgcaccgatagaacttgcgccagtcgacgttccggacggatgtt
-gttcttaatggcggacgtcgtagatgatcggcatgaatggttgtaaaccacatgacccgtaccacaaaagaatggtcagt
-gtaccaggtccacgaaaacggggcgcgacaatttgggaggaacatatttttcgtggttgcggcgcagcagccttcctcgc
-aatttgcagatgacatccaagaccgccgcgaaagcttgcaaggtcgccgatgccgccaccagcggcaatgataaccaggc
-atgaccctcaactggtggtttctggctgaaggtggaagacgaagaccagaatgaccagaccgataaccgcctaataaacc
-cagcgcgataccaccttttctggcacccataaaacagacatatcagtattagaaataagttggatagtaaataacatgtg
-gtgaatcgctcgcgataatcctccgtttaaattttttgctgatagatcacagtcacgttctgttttgtatgacatgtttt
-tcagagcgctgactaaataatccgttttggtcgttacgcggggctttagcaaaattaatccctcacagtggaatattggc
-tgattaaagcagcggcaaatttaatgcactgtagataagcggcttttttcagagagaaagactctctggcgatgggttta
-tagttttgtactgcgcagatgttaattggttttgtttggctggcttaatgttattgatatttatcggtctatattttttg
-ttctcacgggcagatgtcattaggttttatagattaatctgatctacccattttgtgggtaaaaaaattacacataatgc
-ggtgtggacataatagttaattaactttttgttagcgtttttgaaatttaaaacaacgggttcacctgaagaagatatta
-aatttttagcgctgatggagaggaaattatattggatctggacagagattttactgatgaaggatgtaacttgtgccagg
-ggtatttttgtcattacggtaataattatttactttacagctaacgcaagcgatccgttattggaatattgttttcagta
-gtggaagtagtggttctgcctgaataacggtaacgtaaactgacgggcccgtgacgcctaaatggatagctggtggaaca
-cgaatgtggagtttgaccagccagatgaaggtatttaggcaggtaaacacggcgaatgttaaactcgttgggctgcttcg
-tcgggttgaaaatttcacatagtccctgatgcgcgtccaatccactggcacagtggtgcgtaacgttgcggcgttaaggc
-ctttttggcaagcgacgaggatcctggttcgttggagctgctgcgtggattagctgatcaaggctcggacctggtcataa
-tactgatgtttttccaggtcgcgcatttttctttttgccgccagcccgggtgagcgcccctggcttcagagcgggaagcc
-tggaaggggtttgatgcaggttattcacgaccaccgggtaaatgccagcgaatctttaattggttggccgcatcgggctg
-cggaggagatgacaatcacatcacttttgcaaacgcggtgttatgcaaggacaggcagtaatccgagccgcgttctcttt
-tgatatagatatgcgagcaaataattttcaggtcgataggcgtatccgctaattgaagataatctctttggctttcctcc
-agcgtcgagctgtttccacaggcattgggcaagcctgggatttgtggctagcgtatcggcgattcagctcgcgaccattg
-gtcgtcatcggataattaatacattgggatcatctggttcgacctctccccgtcccagggtaatctggacaaaaaattgt
-gtgaaaatcccgggtttcgcgattccaccggcggaatgctgcgccgaggattttctactgttgtttgacaagtgctaaac
-cgacgctcgctcgcttcttttggtcgagacaacgctttggtcaaaaaatgtatcgattttatcggggtgcgatccccggt
-ccatcatgcattaacttcaccgtggcagccagccgtgacgtagtgcaatgttacgctagtatttcgcctccgggttccgg
-ccctaattgcctccagccgcgttttcctatcagctttcccaacgtggtaatgcagcgtcgcgaccttggtcctactgccg
-ctgtctggcagcctggctttcactgtttaaaatcagcgtatggctaatcggtcgcgcgtttaatcttgctgattaaaaaa
-cagccgataaccggagatttgatcttacccagcagaagagccaatctttcctgatagttattggctgttttgagaatgta
-atctttccaactgccttataactcttcagatgcaataatccgagaatgcacatgcaattttattcataacttcgtggatg
-cgttcacgaagtgggcgttcaagcatagtttgcaccagacggcgagtcgctgcatcagtttacccgtacttcagtttgtc
-cctgaaggttgaacatggcagccgatgataacgccattactgcggcaccggacgggtgttgatcagtaatagccggtctt
-taatcgtaatcctccttcgtcggcgggcgcggggtaccggtcgcgtaacacttccgagacacatctaccacctgtgacat
-gagttggcttagcggtcgacagtttctcatcgtctgcgacttacgggtcattcagcaattcttgtgcggggcagtcgttg
-atcagcagtgacctcgccgcgggatcgtcccacggcaacggacgccttctttggatagactgcaaacatggccttggcgt
-tttgctcaaacagcgttggagattttcgtagggttccaggccgaaaggattttttcagtaccttaaccagaaatgcaggt
-gccaatcagtccgaccagcatgccaaataaatacgcgaccagataatgctccaacgcgacttgtcattgatctgttgggg
-tcacagcggcttaactcaaggccgattcgccacgcagggccaatttgttcttattgatttccctcgtagatggggtaaca
-tacgccgtaaagccttagagaccagaaaaccggcggattgataggcgacatttttctttccgcgcattcagcgctttaag
-gatgtctcaccctttaaatggctgacaagtacgctgggctttcaggatgcgatgtagcgaaggactttgcaatatcgtaa
-cgacaataaacagcatagatgaacatcgttgcgtttttgcgtacggctttccgcgcatggcctggatgccactctcgctg
-cggtttttctggcaagccctgacgggatttccggcgagtcggcgaggggtacgcgccactgccagtgccttgttggctgc
-catctcgcgtcaataatccactgaattctctcgcgcacgccagtaaatcagatgcaccacaatagcaaccgagaacagta
-accgccctgaaccattaagatggcactgtggtactcatttctaaatgcggggaaacgtttggcgtaacatgccggtaggg
-caatgaatgtctcattcagacttccttgtgtgacaaatttcttaagacattaatctctgatgaggcggggtaatctcaca
-aggggagtaagaatgatgtggcttttataggggaagagactctggcacaacagaaactgccagtgcttgttaaatgagaa
-gattccggggcttatgccttatagcgataatcatactgatgagagagggaaggtgtcatggatcaggcgctactgggacg
-ggggttatcggctgttataacggcgaaaagatcgatgtctatttcaacactgcgatatgtcaagcatatctggcaattgc
-gtaacgtggcaacggcaagttatttaaatctcaaacgaaagcgcgtggaatcatgcaccggggaatgaagtcgacgtcgc
-cactggtggttaaagtgattgatacgtgccccgagggcgcgggtcataaataagcgagggtaaaaatggaaatacgcgaa
-ggccacaataaaatttgacattaatgaacagaagacaaggcaagcaaatcgctgaaattgtccttgtggccgaccgagag
-aatttagcgattatcgaacataccgatgtcgatgaatagcctgaaagggccaagggattgggtaaacag
->m141013_011508_sherri_c100709962550000001823135904221533_s1_p0/66/0_2820 RQ=0.800
-aaaaaccaccaaaaagaaaaaaggaaaaggaaaaacaaaaaaaagaaaaaaaaaatttttttttgggaaaaaaaaacagg
-ggtttgggggaaaccccctgggaaaaaaaaaaaaaaaaaatgagaacgcagaggggttttgccggtaaagaaatgggttt
-ctgggttggaaaccgccgggggggtttaaaatatggtgccctgccttggcccattctttcgtttgaatgttggtttttta
-aaggatggatgacggccttcccgttgggcggcaacggtccggggaaaaaatgatgcccggcagccctgggcgggaatacc
-ctgaatctggtcacacgggtcccctccggccctgggtggccccctgaacattgtggcaacagggaaaacccgccaaccag
-caatgaaagcggtcatacggaacaattaaacgacttcgcgcctcccggggctttggggcttggctgggctcacttgaaaa
-ccggtccctgccttcagtatccaactggacaacgctgatgctggagccacaactgcagtataccccctgggcagggactt
-tccctggatgaccgggtaaggacaacgccgggttatgtgagttcgggcatggccagtgcagcacatgtgcgtgcgcggct
-ttccgcgtctgggcaggcccacaacgaatcatgagcctttgcgaaggcacctcatcgccgtgccgcctgcgtgaacatgc
-aaaacaacaggtgtgggagtgaattaccgggtgaactggtgggtacagccttctgttatccgcacgctttgcagctccgg
-ggaagatatgcgtgtggggaccttccactgctcaaaggcagcgggggatgacgttcctctgccatcacagatggcacatt
-cactcatggacgctgcaggccggactggaagccgccgtgtcgcgggaaaatatcccctgggcgttcaggccgttatgccc
-acagccgtcagcgggcagcagcggctgaaggggtataaacggtcaggccacactgaattgaccttctgacagaaaccatc
-gccctctctgttggtcccggtcaatcatgacgcgggagcgcgcggaaccggggcgcaacggatcttcaaacgccacattc
-gctggcaaatttaacaataacatggatattcatcacggagtggactatgtttaggacagattagtcggcgcgctgtgcct
-gctgatcgcagattttgccattcttcgccttttgtttcagagcattaatcagcaaggccttctctgcgctggcagggctc
-atatttgctgtgtctgttcgggccacggccttactggctgggctatattcaccgaacgcataacccggttgtccatattc
-gcggctggcaggccgtatttccctgagcgcattgccggaatgaatcatcagcgttcatgtggggacttgaaatggtaacc
-atatcgcgcctggataggctcacgacctttttgaactctgtgaaatttttattctgaccacgcgctctcgccggtggtct
-gctggctgtttcccccctgcagaatgcaaaaaacattcagcagacgggatcacatccaggaagatatgcagcaaggaaat
-taaccgggggtattaacttgctttttttataactgcctttttccttatggcgtgttctgcatgccgcaccattgagtcgc
-gttacgtacgaatatttcaaccgtcactgatgtggtgggggcgggttgttgtagcctggctggctgcattagtgacgctg
-ctatggcggcgcagccagatcaggcgctggaaaaactgacctgtgcatgcagccagacactggaagaacaactataggtg
-ctcaacagtaaatccgtggctggaccaagtttcggcaaaacgattacagcttcctggactcactggacggaaagcgctaa
-tctggctgacgctccatttttttttttttttccccttttccctcaccggaaattttcccggggaagagctgagggaattt
-gaaactgggggcaagacggaactgggttactgaactacaatgcctggtatgaagacacaatggcagggttttaaacgaac
-agtttgaaagagaagcctgtcattcacacctgatgaactaaacgcttcttccggaacctgcctgggaaattatcagccgg
-aagcggaatgacggattttctgtctccgatgcgttgcctggacggcggtgactggtatcccttttccaagcaaggtcggc
-cgtttgtaaatcatcccatcaacgtggaatgagacttgcgtatctgttgcctcctgcgggctgagccagaagtacaaatc
-aatgctccggaaatcaataagccggattaccggaatggtacttgctctccttcttttgtcgcgcaaacagaaacactcgt
-gtccaggaaattttatgaaacgccttacaacagctttatttccgtatgcaaacgggcgaatggtctgattcctccatgaa
-acttgccggaacctggagtaccaagatgagaaaatgtttgcttccctggggagggcaggggacatggggtttgcccgctg
-aacgatgggaaacataattgcgacagagtccgtctgtgaaaaagacggccacggaattctcggtgataataatgccacga
-atggaggcagagaccagatactggtccagcggaagcagaaatcagacgaaatatttgttcaacttgcaagccgtacgtcg
-gtgcgcattcgacggacaaaacggacagtatccgttaacatgggaatatggcccgatgcaaactggaagtcccgtgaatc
-agtagccccggcgctgttga
->m141013_011508_sherri_c100709962550000001823135904221533_s1_p0/92/0_12187 RQ=0.859
-gggaaaagagggagaaaatggccccagaaaaaaaaggaaaaaatcatggacctttttaatttgcccggtttccaatcttt
-cacggtgggtttttttttttccctgtgggtttttcccgttccagtctggtgcccttgtttaaaaactattattcgtcccc
-agcaccgctggggtaaccaattaattcacagcagcagctgatttaaccgtggtctggaaaaacgttggccttgcaaaaat
-agcgcgagaaagaaaaaatccctgattcggtgagtttttttccgcttaaaattaagggcggtcagttgaccgcctttttt
-cttttcgtagggcggataaagcaccggcatccgccacaaaagcaacaggaaaccatcatgaggcgataatgacctatcgt
-agccaagcaaggccacgcctcccgggaaacgttggcggcgttggcaatcctgcggcatctccggctcaaagcccgttgaa
-gttttgccgaaaccgtgctggttcaactgcctaagccgcgcttccgccgattatcctttccgtttaagacccgacggcaa
-gcgtgctcgattcagggggattgcgctaatggttcctggcccgaactcgttacgaaacggcgaagatgtgctggaaactg
-caaggtcatgggcggttcggtgatctcgacctgctgtcaaaacgcattctgacattccggcctgcggattgcttcgccct
-ggtgagtttttccgaacgctggcgttttcttaacgataacttgactttaagcccaggcgaggcggattgccgattctatg
-acgccagttttcgggaacaggcggcccggttcggcacttaactcgctgcaaggcgcattctcgcacgggttaatcatggt
-agaaagccctcaacccacttgcgcatttttagtcgaagcgggcaattgattttccccgatgaagagatcgatttccttct
-ccgacggaaacattgaagcccagctcaatgacgtttattgccgatcttgatgcacgtgcgtgcttgaacacgtcagggtt
-agtttggttgcgcgaagggtataaagtgttgattgccgacgtcctaagcgccggtaaaaatcgaggcctgtttaaacgcg
-ctggcggggcgtgaagcggcaatcgtaaccgatatcgcggaactagcgtgacgtgctgcgtgagcatatcaacattgagg
-aatgcgctgcatatcatcgatacgcgttgctacgtgaaagccagtgacgaagttagaagtattggtattcgagcgcgcgt
-gggcaggaattgacaggcgaccgcgtggctgtttatggtcgatggcaacctaaagacgccgtgatccggcagagatctgg
-cggaatttaattgcccgtctgcctagcgaaactgcgatcaccgtgggtgcgcaataaagcgatatccaccgcgaaacgct
-tggaatgagtgaagtgaacggtcacgcgttttaattcgctctcggcaaggactgtgcaggcgtgacgtgctgcgtaacca
-ttcaaacagagcatgggctttgcaccaacatggaaggacggcttcctggcgcgtcggtcgccactacaggcgctggaaag
-gcagcggaacatctatcaacagggcaaagcgcaatgttggagccctggcaggtgaactggctggcggagaggttgcgtct
-ggcacagcagaacttaaagcgaaatcatccggggatttacttcagacgacctgctgggcggattttctccagcttctgta
-ttggtaagtaaccgcgcttacgaagcgcattctgactgtcagatgcggcttcgcttcattgtttaccatccgttattcct
-caaccttttttttaaacattaattcttacgtaatttattaatcttttaaaaaatagcatttaatattgctcccgcgaacg
-attgtgatttcgattcacatttaaacaatttcagaatagacaaaactctgagtgtaataatggtagcctcgtgtcttgcg
-aaggattaagtgattatgaatatcttacatatatgtggtgactcaaaaatggttcaagtattgacaacaaaattgttcga
-gttcaccgcctatgattttgcccttctgtagcatcaccagagcaaaccgattagattcatgtgatctattttgtttgcta
-tatcttaattttgctttttgcaaaggtcatctctccgtttatttacttgttttagtcaatgatggtgctttgcatatata
-tctgggaattaatcgtatgcagattgtaatattcacagttgatactgtaattaaaataaatgaaggattatgtacatgga
-aacctttaaccatctccctgaaccgttccgcattcgtgttatttgaggcgctagttaaagacgtaccactgcgcttattt
-cgtgaagaggcaattattaaatcgtatgaacccgttctgctggataagcgaagatgttttttatcgatttactgaccgac
-agcgcaccgggggcggtgaccgcagagcatgcgcttgcgatgatgcgcggcgaacgaagcctacagcggcaagtcgtagt
-actatgcgtttagccgagttcagtgaaaaatattttggttatcaatacaccattccgataccaggcgccgtggcgcaggt
-caatttataattccggtactgattaaaaacgcgagcaggaaaaaggcctggaatcgccagaaaatggtggcgtttcataa
-ctatttcttttgataccagccgggccatagcgatcaaacggctgtacctgcgtaacgtctatatcaaagaagccttcgat
-tagggcgtgcgtttagactttaaaggcaactttgaccttgagggatgagaacggggtattgaagaagttggtcgaataac
-gtgccgtatatcggtttgcaacatcacagtaactctgcaggtggtcagccggtttcactggcaaactttaaaagcgatgt
-aagcatcgcagaagaaataaccgatattccggtggtaatggactccgcgcgctttttgctgaaaacgcctatttcatcaa
-gcgcgtgaagcagatacaaagactggacccatcgagcagatcaccgcgaaacctacaatatgccgaatgcttggcgatgt
-ccgccaagaaagatgcgatggtgccgatgggcggcccttgctgtgcatgaaagacgacagctttttgaatgtgtacaccg
-agtgcagaaccctttgcgtggtgcaaggaaggcttatcccgacatatggcggctggaaggcggcgcgattggagcgtctg
-gcggtaggttgtatgacggcatgaatctcgactggctggcttatcgtatcgcgcaggtacagtatctggttcgatggtct
-ggaagagatttttggcgtttgttgcccgcaggcgggcgtcaacgcggcattcgttgatgccggtaaactgttgccgcata
-ttgccggcagaccagttcccggacatggcgtctggcctgcgagctgtataaagttcgccggtatccggtgccggtaggag
-attggctctttctgttaggcgcgatccgaaaccggtaaaccacttgcatgcggctgaatcgctgcgtttaacgcatttcc
-gcgcgcaacatatactcaacacattatggactttccttatatgaagcctttaaacatgtgaaagagaacgcggcgaatat
-taaaggattaactttacgtacgaaccgaaaggtattgcgtcacttcaccgcaacttaaagatttaataatctacaggagt
-ggctatacaggaatgttagccatctctaccctacatcctcaataacaaaatagccttcctcttaaggtggcatcatcgaa
-ctgatcaagctgaaaaaaagcactctgcatttttgggtgtttatggttatagcaggtacagtaattggttggaggtatgg
-ggttttttgcttttaactgttgacttgcggtgcctggtttttctggggtgcccttatccttatcaattgcctggtttttc
-aatgcttcattcgggttattgttattagaagcaaatttaaatttatcccgtcggctttccagtttttttaaccaccacac
-caaagattttaatcggtaacacctggaacattatcagcggtataccgttgcttcgttctctatatctcacttatgcctat
-atctctgctaatggtgcgattgcattagtgaaacgatatcaatgaattttggggtttattcacgctaatcacgtattgtc
-gggatctgcaacagccatttcgttgcagcgtattggtggctttaagttttcgttagccgccagtcgctattacctgcatt
-gttcctcgggctgaagattatctcctttgtgatcgtgttttggttcttttttcttccagtcgattacttcattctggcgg
-cgacgtcaccagctccactgcggaacgtttacttccgttatctttaatggcttttgcggtgtgtctggcgtcatttggtt
-ttccccggcaatatcccagcctgattatttgctactggaaaacgcaaaagataagttaatcaaaagcgtggtattttgtt
-tcgccttgctgcgcttggtgatttatctcttctgggctgctatttgcaaccatggggaatattcgcgagaaaagctttaa
-ggccgaatttatctcctcaggcggcaacgttgatttcgctggtgaaatcgttcctcgcaaccaatacagcacggcattat
-cgagtttttgcctgctggtgttctctaacttagctggttgccagtttctttcttttgggtgtcacgctgggggtttgttt
-cgattatcggcggactgtttaagattgataactcccacggcgggcgtgtttcaaaaccgtgctgttaccttctgccacct
-gcgttgttgtattctgaaaatcttccccgacggtcttttaattctaacggggatcgggcgttgcgggctgtgcgccacat
-cttgggcggtctttattcccgcagtggctgcaatcaaagctcgcaagaagtttcccatcagatgttcacggttgggcggc
-atctttattccggcgaattgtcaatctctttggtataaaagtgattttttgtgtgctggttcggcaacgtctttaacgtg
-ttcttaaattttggctaaattcttcaagaagccagccattcgttggcttcttgctctaggaattcacttatgtcagatgg
-caactcgcctgattcctccttcacacgtatgctttgcgtcacgcttactatcaggacgctttagccatgtccgctttttt
-tgatttgttagttttgcccttggttttactttatccgccggattgatatgtacctcgttggtttaccggcgcatttgccg
-ccgatctgcaatgccagcgaagcgcagttttgatattggcgttctcgcgtatatctggcggggctggcagctgcgatgtt
-tatttgccggtaaagtggccgatcgttcaggggaagccggtgcgccataccgcggggcggcgctatttattattgcctcg
-gtgttctgtttcacatggtgaaaccagcacgtttattcttgcaggccgattttctacagggggttgggcgcaggctgttg
-ttacgtatggcgttcgctattttgcgcgacacgctggatgatcgaacgtcgggctaaagtgctgtattactcaacggtat
-tactgcattcattcccggtgttagcgccagtgctcgacatctgattatggcttaaattccccgttggcagagtctgtttt
-tggcgatggcatgatgggcatcgcggtactgatgttgtcttttgtttattttaaaagaaaccgcagcggcccccgcagct
-ttcggataaaccagagaaaaataggcgagtcgctgcttaaaccgtttttttccctcagcccgtgtttgttatcacaccag
-cacgctcagcgttttcggtgatcctcactttcgtcaacacgttcaccggtattgctcggatggaaatcatgggtttgagc
-gcggtgatacgcaccattatggcgtgaccctggcgtcagcattgacgttttccattctccacgccatttgcgctgggaaa
-tttttaagccacgtacgttgatgaatcacatcgcaggtttgttatttcctggggcgggggatcaccttgccgttttcacc
-tcccatgcggttttctttctgtttggttttatcacgctgatttgcgccggttttctcggtaggtttttggtgtgggcgat
-gagtcaggcgttaggggccgtttttcattacgcgcgggccgctagccagctgacttaggtattgcgcagcgtttgcggtt
-cgtcctgtgggatttttggctgaagcggtggttgtatccgcggcatgaatacgctggaatcggattctgattgcctgtag
-catagtgagcgcctgttgctgattatgttttcgtcgcgcactggacgcccgcgttgccgcttcatgaagaaatccatcac
-cacgcttgatctcaatctgctgcttttgtctgcaactgctgatggccaggagcgcagcgtaacaaagcggcgaagcggat
-aaaagtgacacatttcggcggtgagtaagttcgctggcaaagttaaagagcgtggttttggacgacaccgctctttgtga
-actcaccggcttgggtctggtcgcccacaccgctgatggttcagcaatggagcaaaattctggcggtagtgggatgcaaa
-tgacacctgctgctggaataaaccgcaccacagacaacgcgcggcctgcagttttatgagctggcggcggaattacgctt
-gatgaatgattcatgcttaagcgctgtcgaaacagattaccaacgttaaccgcaggcgacgcatcaattacggttactgg
-gattacgatttctttagattgcaatagctcgtggtgaagtgatatcggtttttcgcgggtcgcggaaagccatcctcgct
-cgcgggagctgtaagctcgctatcgttagccttgattatgaagtggctgtttttagttgatgtgccctggtctggttagg
-caaagatcatccggcactgcatcaacgttggaatctggacaccttcttacggttatccgcatatcagcatttgctgggaa
-cagagcgatacctggcgctggagcatgtggttacaggagctgggacggcgaacgcacgatttgctatgaggctgccgaat
-tcgagcagtcactgtttatggcagcgcaaccgcgacaatctgctactgcgacgcgccgcgctaactgtcagtactaacaa
-tcaactccatcactgccgtggttgctcttcctctccgtttgacgaaagccagcaaaaaaaggcctgaaagttccttttac
-cccgctgctgtcggcataaacggcaagccataatccgaaatcgtctggttacggaaacgcaattaaaacctttacgcgtc
-gatggataacgaatcgtatgaacgcggacccaatttcacaataaaatgtaaaaaagtttgtaataagcttgttcttgaat
-caacttttagcgctttttagtctgttccatcattccacgtaatgaattactcttgttattcatactggaccattaagcat
-gggagcgaaacatggcggactcactttgcccgagattttaacggaaggtacatctgatttctgttcgtctccccttccag
-tggttcatcaagagcacgaaacattaacctctcatcgtcaaacgcgttttctggcgtccagaggtttactcgcagaactg
-atgttcatcgctgtaatggcattggcgaattgcgggaaatcgtcaccctgccgaaaaaaaaaagggggttaaaaaaaaac
-cccccggggtttttcagtgaataaacaatttgccttcggttttcccatttctatgcccgggaatatgtttggcgtggcgt
-taacaaccgaaggtgaattggttgggcctcatatggaactacagcgtgcgacgcggcgggttttcatagcccacacgcgc
-cgataacacacttttccagcatgaatcgctatggatcagtaacaaaacgatcctaacgaagcggcgggcgcaggctcata
-cgctgcgccgaagcgtgctaaaactaaccggtgatgttttgaattgacgatcctgcgcgatctgcagctgctgcccgcat
-tgccggacgcctgggaaatgtggctcatgtaaattcatgtagtaacgcgtttagcgacgccggaagccgttggatgggtg
-tggtcgtggcggtcacgccgcacgattgaaaagactcagtgtctggagttagaaatggccaacacggctggaaaaaagct
-gccggatattcacagccgcgcaacaatccttaccaagccggatgaatgcgttttgcccactctctacagtgaaggctttt
-tggccaatattgatagacaaccacaagggagtcatcatgttctgaaaattggcaggtggttacgttaactggggagcctg
-ccgcaaaggctcatttaatggcatggtttgcacgtaaccccgtgcgaaaattgctcccggcgatgcatggaagtcaatgc
-gttaccatccattgccgacattcccttgtatgacggctgacgtaacagccggaagaagtttccagcaacggttgaaggct
-ctggcggaacaattcgtcaggctgacggtgtggtgatcgtcacgccggaatatcactactcgtaccgggtgggctgaaaa
-tgccatcgactggctttcccgcactgcgatccacgctgggcaccggttaataccggtattgattcagacgcagcttcaat
-ggggcgtgattggcgggcgcggctgtcgtatcacctggcgccagatttcctggttttcctcgatgcaatggtgatgaaca
-aagccggaattttatgggcggcgtggattcagacaaagtttgaattgccgcaaaccggagaagttgattgatcagggtta
-gcttggaccacctgaccgggatttgaccgggcattttggtgagttttattcagcgcagttaagatctaaataaaaaaacg
-ccgcacagcgaatcaatgcatggccgggtttttaacgcgctatcgattttagtgagcgtcggataaagaacaatcttcag
-gataacagcagcgcaacgattgattacgcacgggcttagattcacgcagcgtcgtcgtaacgggatttttcatcaacgca
-gtaggagataaagcccagcgcgataactttcggtaatcgagaaggctgaaacggcaatcacacggaggtactaaacgacg
-gaacagattcagtagatcctgcagcttcaagcgtgcccagactgggaaagtcatcagcacgccaacgtaaatcagcgggc
-accagctgcagcgtagcctggcacgcaatctccgccagcgggcgacagaaagataaccagcaggaacagcagaccaacaa
-cactgccgtcagaccggtacgacgccaacggcgatacgccggaagaaggactcaatataagccgtacggaagaagtaccg
-ataacgaaccggtcacgagagatactggtcgcatacagcgcctgctttcatgcgcgggaattttcccgcttgcctcatcc
-gccagacctgcttttcggtcacgcaatccagcgtaccggaggagttcccaaacaagttgaccaacatgaagagaaaatta
-ccctgcagccaccgaggttaaacgacccggctaaatctaacatgaccacaactgtcattaacgctcgcggcgcagaacga
-ttgcattgtagtgcacatcacccagcattccagcccaggcaggcgtcgtcaccacgatagaaaccagcaccgctgcgtga
-atgttggccgcgaggcccagaataggcaatgatgaagaagccgaggataccccaggaagtacgctttgtgagaagtccag
-attaccgatgctcacacaagcgttttccggggttagcgacaattcacactgcgtttttttgttcagcccattctgcaatt
-gaacagaccgattacgggcggtgaataccacacgcagactcaccggaatgttggctatatccagtaagcgaacgcggcaa
-aatcgtcagtacagcgacctatcgcgccagaagatgcgccatcccgacctgccacgcaagcccacgctgtacaacgacaa
-aagcgaagacgcattcaggcccatagcgggtgcaagtgcaactggcaggtttagcaaacagtcccatcactatactgcga
-atgcagcgatgcagacaggtagtgacgaagacggcgctggtaaatccatggccacagccaagaatttttgcgggttaaca
-aaaaacgatgtaccaatcgtcaggaagggtggtaaaacccggcgatcactttcgttcgtgcgggtcgttgcatgttcgcg
-cagttttaaacacgcgtttcagcaatcccttgaccagaattctgggtggtaatgttgatgactcatttaatctatttccc
-gacaaggagggaaaatcgcgtcggctatcgtatacaaaatgcgacaataggcgcgttttgtgagagactttttttattgg
-ttaacttatacggcaacggattgcgttgcggcaattcggctctaacgaaacgttaaactgatttaaaaaggaaggcatgt
-tccgcggatagaagcggttaattttttcgatctgcgacggtacgctggtcgacagtgaagtcatttgctctcgcgcatat
-gtaacgattgttttcaggaatttggtatttacgtcgatcctgaagaggtattcaaagtttcaaaggtgtaaaactgtacg
-aaaattatcgatatttttcccttgaacatggtgttacgttagcgaaagaagctgaaacacgttttacacgtgcagaagtc
-gctcggctggtttcgattcagaactggaagccatcgaaggggcttggagcgctccttgtcagcgatcagtgcgccaatgt
-gtgtggtaatcggcccaaataacaaatgcagcattctatgggcaagctgaaatatgttgcactacttccggataaactgt
-tcagcggtacgatattcgcgttggacgccagaccggcgttaatgttcgcatgtcgcaaaagcgagaatgtaaatgtagaa
-aactgcatttctggtttgattgactgcaggtttgccggtgacaatctggtatcgacgcaggtatggcaagtgttctactt
-ctgcgccggccgcacaataagccgatcgttcacccgaaagtcacactttaccctctttcgcaggttacctgaactgtgga
-aagcgcgtgttggtattacggcatagttcttcacactcgcttcacttaccccgcttaaattggcgcttcaacaggtaagt
-aaagggagtttttgatatgtctgtttcacggtcgggtaatacatcacgggacttatttcttgcatttttaggaccgttta
-attgggttggttctgttttctttgtctcttacatattaatcgcaaagaaccgctggttctttttgggtgataatacatcc
-aatttttctctatttgtgataactacggagctcattccctgcgttgttaacggtgtaatggttttgctgttctgcggaaa
-agaatcgggtcacagaaacgtttatcgttgtctggctggtggcataggtggtcgctcgttatcaccggagaatctattgt
-ggcagtttattgtcatattaagggatggcttctcggagttgttttgaaaacattctttctggtgacagtcctcgttgtcc
-gcatcattcctgcccatttgctggcaggttgtggtgaatgagccagaatgcatttcccgtctaccggattttggatattt
-catgtcctgaaacagactctttaagttaagcagggatactttattctttggctactcaaaagcagacagggatgtttctt
-atgactcaaaattctaggccgttacccacattcaaatatcattcccagcaagccactggaaacagcccgtcatttgaaac
-caggataaataaccgtagagtgcgattggctgtgaacacaagacgttcagtttatcttacttcggtcctttttattgcgg
-tttgatgaagcttgaacatctctgtccgtggtgtaattgcgggacggttctgctgctggaaaagtttgcaggtaagtttt
-tcaggatgatgcagcatagaaggtgtt
->m141013_011508_sherri_c100709962550000001823135904221533_s1_p0/95/0_11468 RQ=0.866
-agaccaccaggggagaaggaaaaaaaatggcttaaaaaaaatttataaataaccttcccgccccccattttttaaaggtt
-atattttttttttacaaccacttctctgaaaaaaccccactaaaaatctttttttttcccggttggggtcccaatactaa
-tcccattcgtgtaaaatcacgagcggtttaatcgcaaatgccggtagcgggattcgcaagtttttagtcccatattaata
-ttaacgtggttccccaatctgtggtgttaagtgctgcgttgaaagtctatttgcctgaaatgactaccgaagttttaaca
-actgccgcgttgctttagtaattggaggtacaagcttgcagcttcccagaggtccacctttaaacgtccaattgatactc
-tatcagcggcttgcgctgacctggctaaacaaggcacttcggcaatgcagtaattttacattgttttcatgttttgcctc
-caccaggacccgggtcagatttgccttaatatctgtcaatgtcgttagttccccttcatgccttaaaagctggaagccat
-tgtcagtgtgaggctaacgttttttaccgctatcaatttaccacttcttgaccattttgcataaacaccagccaattaat
-tgggggaagtactaaggaaggtgcgaacaatccctgatatgagatcatgtttttgtcatctggagccatagaaacagggt
-tcattcagtgaagtcatcaacttactttcgccgacagtggaattcagcagtaagcgccgtgcagacgccagaaaagagat
-ttttcttgtcccgcatggagcagatctgtccatggcaaaacatggtggacagtccatcggaggccgtttttaccccaagg
-ctggttatggccgcgaccttatccgctggaaaccatgctacggcatgtcactgcatgcagcattggtaaacctgagcgat
-ggcgcgatggaagatgctctgtaaacgaaatcggcttccctgcgtctgtttgcccgttatcctgatcagcgccttgcgcg
-accgcacaccatcatgaattttccgccacctgctggagcaagcaatcactggcgcgcccaattgttcagaccatcaatcg
-ctgctggccgaaggcaggcgtcatgatgagctcaggcaccttggtcgatgccaccatcattgaggcacccagctgcgaca
-agaacaaagagcagcaacggcgtatccggagatgccatcagaccaagaaaggccagtcagtggccactttggcatgaggc
-ccaattggtgtcgatgccaggagtgggcctgacccacagcctggtcaccaccgcggcaacgagcatcgactcaatcagct
-gggtaatctgcttgcagtggagaggagcaatttgtctcagcgtatgccggctacgcaagggcgccacagcgcgaggagtg
-gcccgaggtggatgtggactggctgatcgttccgagcgccccggcaaggtaagaacccttggaaacagcatccacgcaag
-aaacaaaacggcatcaacatcggaatacatgaaagcagctccggggcccggtaagcacgccattttcgcatcatcaagcg
-acagttttcggctcgtgaaagccagatacaaggttgcttgaaaaacgataaccactggcgatgttattcacgctggccaa
-cctggcttcgggcgggaacaaatgaatacgtcagttggagagatctcactaaaaactggggataacgccttaatggcgaa
-gaacggtctaaaatagctgattcaaggcatgttaacgggagaaaaaatcggctcaaaatgagaaatgaaaatgactgagt
-caagtcgagaagaatttcccgctattcgcaccttcctaatttgatgctgtttctgtcggcccggattgtcatttttgcca
-ctggctaacgccaggtcgagattgttactacctgaaatgcatcgctggcgatcagattttaattgaaccatttcggccaa
-atccaaattccgttgttggaaatcttagccggtattcactgaaaacaacgatatgaagcgtcctgatcgcattgctatta
-ccagcgtgattgttcttgtctggtctaatgtgcttgttttaccccggtcaacttggcgcatgggcagcacttcgtttgcc
-atagtcgatattttggtatgctactggagataattacactctgctgagcggccatggcgaagttcgcagcaggcatcctg
-tattatccgtttcatttgcctctcctgttgatcgtctctagaacacaatcttttttggtgcatcttctgggaatgtaagg
-tgaatacggcaatgatttgctgctcatcttttatatctagcaccatgtccggtttgatgttattgagggaatacaacacc
-gtcatcactgatgttgtcagatattgccctttctatcttcaaatggcgcaacgcctctgggcagtttttttgccgtcgga
-aagtggtgatattgagtaatgcacggcgttggtgtttatcgcactgatccgactttcccctactgcaaaccacggccttg
-tttgaatcatttttgtgccgttacgatatcgaaccttttttgcaagctgcggtatcgaatgctcaactcctgatgttcgc
-cacggctggattgatgaatgacggcattaacccgaaaatctgtccatactgggctgccttgagatgtaattccctgacac
-ctgcaatattggtttatccatttttggcgatggcgaaagtgtcattgatagtcacggtgaaaaggtcactccctgattca
-tgtaacggcaataccactcactgacatcgtaccgttgtaagtacggctatcactgccggcttgctctgcggcaaggctga
-cttggggtgtaaatggagattggaactgatactggcgttcaagctcgtttccacgttcgtccgtgatctcgtttccaggc
-atcacaatagtaggacatgctcatctgagacgactccatgaaccagtaccatagtgggttttttatgatcgtcatggcgc
-cgtatacagtgtggcggtgtttgaatctgccaaatggaaatactgatggttgacgtagaacagatcaaccatcgtttcat
-tattttctggaagcactaagttgatgctgccagtttgacgaaacgtggcgtgtttgaacgctttgtttccagtaatatta
-aggttgctttgaggtcattgtcaccgtcgtaactataatgtttatagccatgatgttgaaacgcaacccagaaaggagtt
-taggaccagttttaaaccaagcgcatagtgctttttagttcgactgcggtatagatcatcatcattcgcttcagacagtt
-cgcgataatgggcgatcaggatgcgagtggggctggttgttaagccgcaaagtgaaaatgggagattgtagttcgcgtca
-agacgatatttctgtctttgcagtgatctttcgtatccatgcgatgtactaatttggctgctcactgtttaaatgcgggc
-aggggaaccagactcgaaccggattgatgccgcctgataattttcttgctacgataactagcccgcgttcttgcactccc
-agcgtgtcagtattccctccgctcgatgcactattaccaaggtggattcgtcatagtcattcgtctacccgcctatcgcg
-agcggataaccctggaagctttcttacatgctgattaaacagggtggagggaacaaatatgttgtgcgaactaagccgtc
-tgtttcgacaacggtgacatttaagatcaacttattaccattgcggaacaggtacaatagggatatgtgaatgcgcccgc
-aggaaacccagaatggaatgaattaaaactccttgttgacgaatctcgacacgagctgagaggtgtttggctataccagt
-aacttgcacaccactgcgcggttttgcaattgccgttgtccgtggcgatttcgatacgtaaatactggctccttccaaca
-cgctattattgagggttaacttcactgctcgcatgagtgttttaagatctgtaaaggtagttgaagtaatggttgacgag
-tttggttactgaatgtgccattttgttttgtgtaaaggaactgaggctgcgtaagcatccagtcattaatattaatccgc
-ctcaaggtggcagcctgggagtagtccgaacttcccattagaaacttctgccacggctgctcatcaggagagtagtttag
-cagcgcaagcttgttcgcaccagtttgctgcgttttgtgagatccaacccttatgggacctgatcggcctgtggtggaaa
-cgataatatcttagaagttcctggttaggtaatggtgtgattgtggtaccggggtaggacaatatatagtcgtaaacagc
-catttttttcttcagaaggcccatttttaaagacgcggctgttgcagaaatgccttgatcaagacaaattgtgccatttt
-tcatccaaagcgcgtagcaatgtttgccttttttttcgccattttctgatactatcagtgaattattcacctaggcaaaa
-aaacgggctgaacgggaaaaataatgcgatatattaggatctacacctagtgatttttaatgttttcccgatcaaatcaa
-cagcggcaattctctataccatctgcattgggctgggggagaaaaaggcaaaaccactggtgtaggccagtaacgttttt
-tttttaacatcttgtcgctcgcaggcaaagttatttagtagtgacatatttattaccggcgataactcatatcggctggc
-tgggtaaaaaactcgacttttgtatccgtagcgtttgttaatgcgtagttgttaactggtgtgttggtagaaaataggtc
-ttatttatagcccccgttttttctgagggagcgttttttaaatttgttaaggtcatacgaacgacataattactgggttg
-ctaatctcaattttttggtcggccattttttttacgccacttttccaggaattttccactccagtctctcgctctttccg
-gcaaagggaagccggtgggatcagtacaggtagaatctgaacgaattgttgaaacagtaactctgctttggtctggtcat
-ctttttggtggaatacctttcgaacgtttacgcgttttcagctcttctgatttgggcagaggaacagtcgccttgaagta
-aaaatcgaacctgttgtaacttgaccggccctttcaacacgcccataacaggggctgagtcggaataaacgaattgattt
-ttatgtgcttttcaggcaaattcaacaatggtggtgtaaagcatgaaggatgatcatctgtatttctatattaatactag
-cttcaccacgctttttcatcaacggcagcaatactgaatgttttcaggaaccatcccctgtggtaaggtattcattgatg
-tttgtttataatatcagtgaatgtaatgtgtctgaagcatttaaattaaaactcctgtaataatgataataacgcagaaa
-catattgttaattatgattatgcactgtttgcgatgagttgattaagacagaccatgtcatagggcaataatctgtccga
-gttatagctaactggttaatgcgtaaaaataaaaactgtattacaagtttctttataaatactgaagctgatagtgacgt
-tcccatccagtttgatcgtttcatcagaaacgcaagaatagttattgtcatttaccgcagccatcattcagtaacgggag
-gtgacccgctgtaatagccaaccggtgtcagttcccctgttttttgggcaacagaatagacgcgcgctcgattgctgagc
-aacttgtcagcgagcaagcattgcgccattaggatgaggccttccatgtgggggtcgctgctgaccagtggtctttggaa
-tcaggtcgacagggaatttcacctgtatcgtccgcccgcgtgaatcccaccattagacctgtcaataacgcaatggtgca
-agcggccaatttttttggtccatttaggccgccagaccttaaacaaggcggtttttttcgttcccttctatcttacgaga
-gtatcataagcctttttcaatataggatgtgtgcgtttaaacgctacacatggttcgactggatcggttatccttggagg
-tttagcagcaattagcgttggtgctggttggcaggttatatttaatgtgctgtttttgcggccgcagttgaaccagttta
-ttacttttaccgtgtcggatttcagcgcatggttatgatgtttcccatagtcaacatgccgggccgcccgtaacaactgg
-ggtacatgcaccagggggtatactcgcgcgatgatagtttaattctgtatcagttgaatctgtttcatggcactgaatgc
-tgcaacagaagtgctgcacaatagcagctgttgtgaggttctttttgaaaacatatgaaacataatcctttaataacaaa
-tttattttttttaaaataaaagggagctgaaagcaggttattatatctgtttgttgtttttgaatgtaaataaatacctc
-gttcagaataggccaacttcgcctgggatgtattttatttagatgaatttttatagttaccgatcatgtgaattaataag
-gtgctggtggaggtggtttgtgtgataattaatttcattactgaatgttttgcgctgaaaatagcaacatacttatagaa
-attaaggatatatattggttttttatattcatcatttttgtattattcaatatcgagacaatttacatggaatgaaaaga
-ctgaatagcttgcagaatcggtattgtcagaggtgttaacaagttaattgggagacggtttgattgtaaaatgcaagaaa
-ttgcttgatgtgcttcctcaatcagacttggtgaacaaagcacactttattgaaacttatcggcctattataggaaaggt
-caacgctcatggcagcatttgccccgaaaacaacgcgcacttcgtcagtaatttgattcgcccagctacagtctgggcga
-attcaattgttaacctcgcttaaacttccagcgccgtttcataataccgttgccgccttaacgacccttcggcaatagcg
-gtgcactcaccagatcggaaccacggacgatatcgccgccagcaaagattttcgggttggctggtcctggaaggcgttgt
-tcgctgcctgccggggcgactgatgcggcttgtgaattccagctcgacgctgtgtttttgccaggccattccatgttgtg
-gtggacggaaaccacaacgccatgatcaccgcattctgccgaacgattaatgttcggaacctgcaaaacgattcttccgc
-gcggcgacgggccttttggcgtccgttcggcccatttccggtacgcaccatttttacggcgctgactttgcgttcccgtt
-caacttaatacccagcgcttgggaccgtttgaatttgaactctagcgccttcccttccgcgcgttttttcagcttcgcgg
-cggaccggcatgttctcttcaaatcacgacgataggcacaggtaacgtgcttcgctccctggcgcactggacgtacgcac
-gcaagtccatcgcagtgtcgcgccaccgcaaggaccgacccacgcgtttgccttccatgctgacgacggttcgtcgcggg
-ttttcacgcaaagcccattaactgttttggtgttggcgataggaacggcagcgctgccgtacacagccatcggcgtcttc
-ggttttccagccgcggccgcgcaattgactgataagtcgccgacgccaaggaacaacggcatcgtaatcactcagcagat
-cgtccaggcctgtacgtcgcggccccttcggtattgagtttgaaattcaatacccgatgccggtgaagatttcacggcga
-cgcgtcattacccttttttttccagcttgaagggccggaataccgaggtccaagcagcgcgccaattttcctagacgggt
-cgaagacatacggcttttacgcgttatcgcgtcgcaggacatccgcacacgccagactggccgggcctttgttttgtccg
-ataatcgccacttttttttaacgcgtcctgttttcacaccaacatatccggacgccagcccattcgaacgctttatcggt
-tgaataataggcgctcaaatgttgcccgatggtcaccgcgcaaactcatcgttcgagtgggcaggaaccttcgcacagac
-ggtcttgaggcagacttggtcgtccgcaaacttccggcaagggtgttggtctggtgcgacagttcgccgcttcaaaatac
-ggcccctcgttggcgagctcagccagttcgggatgtaggtttgtgtaaccgggcattttccactcgcagtatgggttgcc
-gcacgaacaggcagcggtcagcctgccgcttttgggcctggccttccgaaaacggctcgttaaattttccaacaaacatc
-tattttgccggatcttcagcggttttctttggcggatcaaccgcgctgcaggtccggataaaattgataaaattctgact
-gcattgtttttgctactccttactggcgcctgcacacgcgcaactcagggctgcgaccctagactacggtgacctcgcag
-tgcttttacatgcactggacttcggtttaaccagcgcaaattttaggtggcgaaggttgactcagtttcgccagaaatct
-cttcaccggcgcctgagagcggtatctgcacatcgctcgtgataagaccacgcagatgctctttcatggatatcgccaga
-gcgtcaacgcttaagactcggacagtccgggtttacgcgtttgcggaaatcgccgcttttcatcgagaacgtaagcgaaa
-ccgcccggtcatgcccgcacgcgaagttacgccggttttttaccagaatgcagacgataccacccggtcatatattcaca
-accgtttgtcgccaatgccttctaccacggggtgatagaccgggagttacgcaccgcccgaacgttccagccgcgcgggc
-tgccgcatacaagacgacggcaccggtcgcggctacaggcaggtgttgccgataatgcttgcttatggcttgcgaaggcg
-gaaccaccgggaggacgaaatgggcgaatttaagccggccgccatgctttaccgacatagtcgttgcagtccaccgggtc
-aggttacagttccacgccgccgcgttcatcacgccgaagctcatggcctgcggtgccgttgaaaagtacgctttgtatta
-ggatggctgcagcccctgaatcgccgtgcgttctgggcgatatagcctgaaaggcgacgcgccgacagaacggtcggtgt
-tgcgaaatatcgaaccagaaggttttgctctggcgcttcagcgacaaacggttttcgcctgttgcagtcaactggcgcgt
-tcacgcaggccgttatcaaacggtcgggtttgtttcggtgcagtagagtgccttacctggattgcgggttcggcagtccc
-tccccagcagcttcggacagcgccagcttctgctgttttggcggtgaaaccgtccagctctttcagcaggtcggtgcgac
-catcagtccaccagacgtggttacgccaacctgtgccatcagctcgcgggtttcaacgggcgataaacttcaaagtaatt
-cggtcaccttgatggcaggccgtgatagtggttcttacgcaagtttgtcaaccccccccccccccccccccccctcctga
-agttgctacaccccgtgtgcgcagttgtttcagatggctaaatacgtagatatttacagccgagcgccaccatcgggcca
-agtgccgaagccgaagcttctgcgccgagaatcgccgcctttgatgatatcgacaccgcgtttttcaggcgccatcggac
-tgcaaacggatcttgtgaacgcaagccgtttagcaccagcgcctgctgggtttcaacaagccccagctcccacggacagc
-ctgcgtatttaccgatgaaagggacttgcgccggtgccgccgtcatagcctgcgattggtgatcaagttccgcataagct
-tttgccaacgccagtcgcgatggtgcctactcccggtttacggaaaccagcttcacggagatcatcgctttcgggtttaa
-cctgcttggaaggtcgaaaatgagtgcgctaagtccctcgatagagtagatatttcgtgggtgcggcggcggggagctca
-gcgtcactccgggcacgaaatagcgcagtttggcgatgtaaggcctgactttatccaacccggccaacctgaccgccttc
-cgcctggcttcgcgccctgggcgactttaatctgaatgacgtcggcattgacagatacgccggagtaacccccaaagcga
-acgcggaagccacctgccttgatgcgcgacactttgttggtgccgtagcgcgccggggtcttcgccgccttcacggagtt
-cgaattaccgccgatgctgtttcatgcttccgccagcgccttcgtgggcttccgggctttcaacgcgccgatagacatcg
-cggcggtaatcaaagcgtttaaacattttgagtttcgctttgccgttcacaacaatagcaatgttggacgcgttttttca
-cgccggcgtaattgccaagcagatcgcgcagcgtggttgccggacgcttccattaacgcagctccgcgtattcctgatag
-tgctgtacttcgccgcgctttgtaacggcttgttgcagcgtgcgcaaccacgtccgggttgtaggcgtggtattcgccgc
-cgtggaacgtatttcagcagaccgccctggctgatgggcttacgcgccagccaggcaacgttttcgacagattcagcaga
-tcctgctggaagtctttcaaagcttgcctccaccaatggcggcctgaccgcccctggaagcacaggccgccactaacata
-tcgtgtaagagcgaccgcttcaaacagttttcgagcagcggtaagagggcgaatggtggagatgtcccattttggacatg
-attttgtacaagcttttgtttgacatgccgttacggtagttgagcatcacgggtacgaataattctttggccatcgcatg
-ggtgtcctacaggcggcccagcgtttcaataggcaaggtatggataaatagccgtcgcgccgaaggcccagcacacggcg
-aagtgttgcggatcgtcgggcgctggcggtttccggaagacgatgatgttggcatgcgcaacggcaggctttgatcgacc
-agacgtctggatcggcgccaaccgcgcatcgggctggaaccgtgcaaggcgatctttagcgatattccggtcggaagagc
-accagcagcaagacggttgccgctacgtaccaattttttccggctttgtcgcacagcttcttttgactgtcgcttcgagc
-gtggtttagtggacgtcaaaggtgatat
->m141013_011508_sherri_c100709962550000001823135904221533_s1_p0/95/11514_13534 RQ=0.866
-atatcacctttgacttccagtcaaacctaacgctcgaagcggacagtccaaagagctgtgcgacaaaaagccgaaaaaaa
-tggtacgttagcggcaccgttgctgctggtgctctcgcgaccccggaatattcgctaaagatcgcctgccgtttccagcc
-cgcgatggcgtttggcgcgatccaagaccgcgtctggtcgatcaaagcctgcgttgcgatgccaacattcaatcgtcgaa
-accgcaagcgcccgcgatccgacacttcgccgtgttgctggggcttcggcgcgacggctattatccataccttgcctatg
-aaacgctggggccgcctggtagacacccatgcgatttgccaaagagttactcgtaccgtgatggctcaactaaccgttaa
-cggcatcaacaaaggcttgtacaaaatcatatgtccaaaatgggcatctcaccatcgcgctgctttacggcgctgcctcg
-aaaactgtttttgaagcggtcgagtctacacgatgatgtttagtgggcccttgtgcttcagtggggcggttcagccgcca
-ttggtggagcaagctttgaagaactttccagcaggatctgctgaattgtcgaaacgtgctggctggcgtgtaaggcccat
-caagccagggcggtctgctgcaaatacgtccaacgcggcgaataccacgcctacaacccggacgtggtgcgcacgctgcg
-caacaagcggtacaaagcgcgagtacagcggactatcaggaataacgccgaagctgttaatgacgtccggcaaccacgct
-gccgcgatctgctgctaattaccggggtgaaaacgcggtcaaccattgctgatgttggaactcggcataagcgactgttt
-taaacgccttttgataccgggccgcgatttgtctatcggcgcgtttaagcccggaagcccacgcggcggctgcggaagcg
-attgaacagcatcggcggtaattcggaactccggtaaggcggcgaagaccggccggcgctacgggcaccaacaaagtgtc
-gcgcatcaagcagtgctttcccggtagctttggggttctctcgcggcgtcttctggtcaatgcgcgccgtcattcagatt
-aaagtcgcccagggcgcgaagcccaggctgaaggcggtcaaagttttgccggtgataagtcacgccttacatgcgccaaa
-ctgcgctattcggttggcccggagtgacgctgtattctccccgccgccgcaccagcgatattacttctatccgagggata
-cttagcgcagctcaattttcgactcaagcaggtttaacccgaaaggcgatgatctcgtgagctggtttttccgaaccggg
-agtaggcaccaatcgcgaaatggcgtggcaaaagcttatgcgggactttgatcaccatcggcagctaatgaggcggcacc
-ggcgcaagttccgctttgtcattcggtgtaaatacgcaggctgtccgtgggagctgggctttgttgaaacccagcaggcg
-ctgggttgctaacgcttgccgtcacaagatccgttgcagggtccgatggcgctgaaaacgtgtcgatattatcaaggcgg
-cgattctcggcggtcgaagcttcgggcttcggcagctggccgcatggtgtggcgctcgcctgtaaatatctacgttattt
-tgcgcatcttttgaacaactggcgcacgggtgtagcaactcaggatgacaaactgcgtaagaaaccactatcacggctgc
-cattcaaggtgacgaattactttttgagttttcgccctgaaagcgcgcgcgagctgatggcacagcttggcgtaacaacg
-ttctggtggattgattggtcgcaccgacctgctgcaagcagctggacggttttcaccggccaaacagcagaagctggcgc
-tgttcgaagctgctggagaactggcgagcccgcattccaggtaaggcactctactgcagccgaaacaacccgccgtttga
-taacggcctgctgaacgcgc
->m141013_011508_sherri_c100709962550000001823135904221533_s1_p0/113/0_11466 RQ=0.837
-ggggggggggggggggggggggggggtggggggggggggggaaacacaattccccccgccccccgaaaaggcgggaaaga
-aatttaaaaaaaaaggcggcgggtttaaaaaaaaatccccgccgacaacctttgggggtccgtcaaagcatttacccttt
-ggaaagcgtttaccaataaggaaccaaagcggggcccaagccccgattatggtttttgctttggtggggttcccctggct
-ggcgggggtgggctttcatttatggggtttttaatggcgggaacccctggtgcccgtgaagttcccaggttatctcaatg
-aagtcccgacttaatgacgcgcctccaagcctttacggtagcggcccccaaatggtccaccacaccgcgttggatgtgaa
-aatcctcaaagatcttggatgaagaatatccgtgccaaggacccgtgcctggattgtttgaagatatcatcgaccccctc
-gggggaaatacacctgtccgaaagtgcgtgagaatcttaaaagccctgcgccggaaaccgaagtcccgctgggatttgta
-acgcctgctggaaaataacccgttccccgtccgtgcagtgaacgtccccccgtaaaaagaatttatggttttctcgatcc
-cggaatgaagttttgttgggtggtttacggccattgatttacgcagcagcgttacccgtcaatcttgccggtataatcgg
-caaaaggtgattcctgccctggaccgagtaaagtgtgaagttgccggatggttttgcatccggcatggcaattttttatt
-tgtggttggggcgtgtttttcagcttggaaggttggaatcccgtgacggtaacgttgctcaagggttttcgcggtttggt
-ggtggcggtaacatgcccgaatacgcagcaaagccgtcgtgaatggcccgtatgcccagcgcgtgaatggtaacttctgc
-ccgcgtttccacgctgattgcataatgggtgggagtggcccatgtttaatacacctgttccatgacgttcagtttcacac
-caagggtatcgcagacggaggcgctcttgcggcatttgtcgcccgagcaatgagcttatgtttggaacagatatcgcgga
-tatgcagcagctgcagtttgttttgataagccccagttccgggtttttcaatggcggcttgttacgccgccgccacgtag
-tggcacagaaataataatgtgttcaacttcgagtaaatcactgcatactgaaacacaggaaaggcagttgcaggttcatg
-tgtgaatgaccggttagcaaccattacgtgaacaaagagttcgcccggcctcagaccgggtttaaacgttctgcaggaac
-gcgactggtccggaacatccaattccatagaaacgcgcggtttttgcgcttggtgccaggttctcaaaaaaaccccggga
-tcctgtctccccagcatttttgactcatagtgcattgttgctgatgagtgttctatgtcctttcatcggaggttaacgac
-ctgtaaaacgcaaataattacgtttggctaatatagggcatacttctcggacgaatttaaacgcacagataaagtgtaag
-aacgtaagtaagtaaaattttatgaccattgcactggaataacttcaacagcttaaaaaaaacgctatccaggcgggcgt
-tcagggcgcttcggtgggatagatttttggcaggtccgaagcggtgattttttatgcgcttcatcgggcccgaacggggg
-cgggaaatcgaccactaatcggtattatcaagctctcttggtaaataaacctccgggcgggtcagcgtattggttacgat
-ctcgagataggtatgtccgtgaacgctaaacgtcagttgggactgggtgcccgcagtgaatttaactttcaactccgttt
-tgaaacgcggtgcagcacaattggtggtgaatcaggcatggaggggtactaccgggcgtggagcgcaaagaagcgtaaca
-ttccgcagcgaaaagtatcttaaccactcggatctatggggaaaacgcaaccgaacgtgcgccgtatcgttatctggcgg
-gaatgaaagcgcccgtttaaatggattggcccgtgcgtttaatggcatgaactaaatactgatgtctcgaccgaaatcga
-cgcaggcgtggatcattgaacttcgcgcggctcaatgtgggggctttttttgaagatttaaacgacaaagcaaccaccat
-cattctcaccacaccctacctggtaagacgcagaaatgctgtgcgagcaataatcgggcattattcaacacgggtgagct
-gggtgaaaatacctcgatgaaggcgctgcctggcgaagcctggaaaaatccgggaaacgctttttattctgattctcgca
-accgaaaaggcccgttaccgaagcttcgattggctatcagtatcgacttgggtcgatacgcgacgctgggaagtgaagtg
-ctgcgtgagcaggggatcaacagcgtaaatttacggcagttttaatgagcaagggcattcaggtattaagttatgcgtaa
-acaatagcctaaccgtctggaagagctgtttgttttcactggttaattgaaaaacaaggagatcgcgcatgatgcatctt
-tactgggtggcgctaaaaagcatctgggcgaaaagagatccatcgctttttgcgtatcttgggtgcagaacgcttgggtg
-cccgcagtccatcaccctgaccctttactttatttcatctttcggtaaaactgaaattggttcgcgtattgggcgatatg
-ccatgggcttcagcctatatgcagtttcaatcgtaaaccggggctgactcatgatgtcggtgatcactcatgcctacgcc
-caaccgttgcgtcatcattttttggtgcccaagttttccagcgtactatgaagagtgctggtagctggccggttttccga
-ctcacgtccaattattgcggatatgtcggcggtggcgtgggcgcgtgtctgtttgttgggctattctggtgaacggcaaa
-tttcattgtttttttgtgccatttccaggtgcaaattcgtgggtattccgttgcccttaacgcttggttgcttcacggcc
-gtgtttgttctcccttggccggttttgctgacggtgtgtttctgccaaaagttcgatgacatcagcctggtggcccaacc
-ctttgtgttcacgccactcacgtaaatttttgggcgggctccccttttactcactggactttggttgcgccgtttctggc
-aagggcctgtcgcacctgaaaaaacccaaatcgtttatatgaatcgtgtttccgctacggcttcctcggtatcatgattg
-tttccgctgggtcactaactttggcgtactgggtggtcctttatgtggcgttttatttgatctgtttggtcgcctgggat
-ccaacgtgggacgtgggtttgcgtagccttacaggctatttcctctcctctggattttggggggagaggagtttgaacgg
-cttatcaccctttaaatcaaccaatggtcaggtaagactgattttccgggcttaaggcaggaagggcgatgttaggtggg
-taattaacttgtcaacgatgaccgggcgcaaagagatactgatgcgctggagaaaaaaacatggggcacttctttcagtg
-ccgggccgtgaattctggcgcgggattaagctctgatatgcctcagccgcatgaaggggcatgaaagcggactctggtga
-gggtgtccatcttcttaaccgattatagccggagcgccacgtatcgcgtggcttcattattaaagccacaaacaactccc
-gttgcgaagttggatttctgcgttgtcacgttcacgttaatggaccagattgatcggcttgcgtgaaacccattggcacc
-agttttcagagtttttcgcagagcgtattggtcgaactgggttggccgcggaggtggacagtagtctttgcaaaccacca
-acaaaaaaatccgcctttcgtcctcaaacataatttgtatggagtattaacccgcgattctgatggcgactttttgctac
-aataaaagcgtgtttcaaccctcggttattttttcaatgtacaaacaagctgttatttcctctgctatgctgatgctggt
-tttaccgcaagtgggtcagtgccgcgttaactgcccgttatatgcaaaactcatcggaaaatgctgcgggtctgggcgca
-aaattggtgacaagatggtgaccgttggggaatcttccgggccgggacaaatgattgccgttgggagcccactgcccgcc
-aagttattacgcatttaatttttgtgctttggccaaaggttttatcgataaagttcatctcgagccggtcacagggggcg
-acaaaaagttgaaggacggttttggcacctcaaccaagccgctgagtaaaatcagtaaacttagttacctggaaagaata
-gcgccggtctataacgcgccgagtgcgggagtgcgccatttggggtcaactgggccggacaattttgcgctaacccgatt
-tttgtcataaactgaaagacaggttcaaatcaaacctggtatcagagtccgttattgggccggatcgctgtgcctctatc
-agcggcactggatgccaacccgataatggccctgtcggtgcctaaacctatcaccatattcttgcgcgacgaaagaaaac
-acccgtttttcgccataactttcgacgacacatcggtacgcgctttccaataccagatggctaggcttgcgtgaacaggg
-ggatacgcgacactgagcatggttgcacgctggaaggctacgtgaagataagatcaatctccccttgcgccgagcggtgg
-tggaaattaactttgatggatggcctgcaagtcggtgagccgctatgcgtatcctgtgttgaacaatatggccaattgaa
-aaggcgacggggcgtttaattgtttacctcacgcggtatgcaaacgttccaccgcagaaagtggaacgccaaaaaatcgg
-ctcgccaatttatgagcgtttttctggagctaacgcagaacattccgcgatgtatttgctttcagtcacctacccatttt
-gcatcggggtagaatggtttatgccgacgccccatattactgagagccgtagtgaggccacaataatttctggtttgatt
-ttgcaaccgttcacgccggcgctctggcgcaaatttaaatccgcatgtctggtcatctttccgtctccgtttggcggaat
-ttaaatgacagacgcgttgaaggcagcaacgatgccaggatttttcacctggcggtgacaacctatgaaaggccaagtaa
-aaaccggggggtaatccgttgttttactaaaacgacttttaatatcttaagaacgggatttcgctgtgagacgaatggtt
-cgcggctttggtgagtaaccagccgaagggataacaatccagcaacctgtaccccgggaaaaacaaaatcgctttcgcgg
-tcaacgttttcatttcattgtcggccttcaaatagcggcgacgttgggttccgcccaaggtgcgagcttcttcatctggc
-atggtaacgaagcctggcgatgatgaaccaatatgcgccgacaactggcgcaagtgggccgccgcacggttacagaataa
-ttcctcgaccggcggttctggccgcgatggcaatacaggttgggagaaacgcttggcgcgttggtgacattccagatatc
-aaaatggctttcgttttcgagaatacccggctgcggtcaagataatcctggtccatgggcgcaagaacctttccaatagt
-gccaggtccgcatgagtcactttcacgcggtggagtttgcccctgagcatcgtgcgaatcactgaacttctttacctttc
-ttaaccctgtccgttaacgaagcaggcgatgccctgctttgcggaaattctcacccgcagtaattgccccagaatttttt
-gtttaggtgttactcatctgacggcatctttgcgtcagcagtttgcgttaccgcgccgaagcgtggcccatgtatcgcct
-gtaaacgaattgatatttcttctggaacgctgctcggtaaacaataaagaggtggctgaacgatagcgcgcccgttgact
-ggattactgccctcaacgcaaagccacacggaagtaccgggaagaatggatcgccatcgagtacccacaccgcatgacgc
-gggtatttaaaacaaattttttaatggcatgcccggagacgggctcgcggactttctggagatcatttgccagtgggaca
-ttacgcgaacttttttgtgacctcacgcacgctttcattttaagagtcggggagttttcatgagagagcctgacaggaac
-acagcaagcggaccgtgctctattccgtgcaaaatgcagggccatcccgggttatctgcatgttgtgattgaacacaagc
-aaagcccggataagaaaatggcctttcgcctgattgcggttttattcctatatgccgccatgcaccggcaaatctggagg
-cttgggaccacgcatagctgccgcttggtggtgccgatactgttttaatgcagggcgaggccacaccttaatccgctatc
-aatgtgctggttttttgatatgttttacccttcgcctggagcttggcgcgacggcgtctataatacagtccctttcccgc
-tgggtggatatcacccatcacaccggatggacgaaatcattgcaacatcggcggattgcgattcctcgaactactgcaaa
-aacatatcgccagcgcgacttaatggttattgcttgaaagcaactgtcacgcgctgatcgacgaaagggtcactagcgga
-cgtcagtttcgtttgcatgcaaaactatattgctgcaacgcgtcatactgaacaagccggatttgtttttaggtgtgttg
-aagagacaggaaacgggaggggagtttccctatgatgaacgctggcgcagtggtttggaagagaaagggattgggagaag
-gggattcaagcaagggaagaagaagtaagtcaggaaattcgccccagcgtcttctgagtaaaggacatgtccgggaagaa
-acgttgcagagatggcaaatttacctcttgctttgagattgaaataaggtaattaaccttattttaagttaacctggtgt
-ttaatgacaagatgacggtgggggtaattaataactgcgcatcagccgtagcgccagttaagtattacgcccgctcgaca
-ttttgttgtcgatcaggcgagccatcgcccagccaggcggctaccatgaattactgccgcgtttgctggttttcagtaaa
-cttcccgcaatgtgtcggcacgggcgaatctgaatatcatcggcgcggaaagcctttttccattcagtttcttgcccgca
-atggtataatttcatcggagatcccgtttccccagcctgcaattttggtcagcaactccgaacttaaaaacttttgtaca
-cgactcaggcgcattttgcgttgtttttcgccgtcagaataaccgttacgggaacttagcgccagacccgtcttttggcg
-gcggcatattggcacaccccgacaattcaatatcgaagcccatatcgcccaccattttgcgcgatcagccggcccgttcg
-ctgaaaactcctttttcacgacagcaggcgattgtccggctggaccaggttgaaaacagcttttggctgacaatagtccg
-aaacgccgccgaaactcggtcccggacggctggcacctttcagcactggtcgaaaggccaggaacgtccaactggtaagt
-gtggggtttcaagtaaccgtttcgggtagacatctcttgttttaccgaaggggcgaaactaaatcactttacgtttgtct
-cttaagcttccctcgcagtcctccctgcaagggtccgtggataacgagccagaatcttccgggccggtcgaactgcaaat
-cgggttaaacgaaaatatgaccgacgaccaacatcggcgcgggcttttttggcttcgtcgaccagctttcaatatggcca
-gatcgtcgcaggtttacccctggtaggtccccacccagcgccacgcgcatttgctctccatacgcaggccggcgaaattc
-tgctggacgcagcagcggcagggtttccggctaattaacacacacgctgactccttaatggaaatgtgtcttcgcccgga
-taaaccgccgggactccccacttcagcgcatcactcatgccgcacagcgcgcgcggatgtcgcccgtcttccgggcgagg
-gaactttttaagcgaatctttagaaatgtgacccgccggttaataccaaaggcgtcgtgcatccagaggatctgcccccc
-gtcagtgaccgttgcctggcggccaatgccataccgggaatcgcgccagtgctttccggctaatcacgtctttgccagtt
-caaccgcgcacgcaattccacgcaccagcagcttgtgcgcccagcagcttctaaggctcatggcaatccgctgagcagtt
-gatcgccccgcttcacatcggcccggcgcccctcgacactttcgtagccaccgaaaatattcactgactgtgggtgttta
-acctaaagtgaccacatacaggaaacggcacgttcggtcagcatttgtaacggttttcctaccagccactcaccgcgcgt
-tcaattcttgaccattcgttttagcaccggcaacgcataaccgttgcgttagcgtttccgaaggcttgtttttccgggtg
-cgtggcatacgcccctaaacgcaggttcagccagcagcagaggcagttttggtgcgcccggcgaccgctaccggggcggc
-agtgtggtaaaggcgatatcggcaacggtaactgggcagggtggagtcgtgcctgaaccgttcatgccagcgaatcggcc
-caccagcatgacgttaagccctttcaatcagcacaaagagtttggcgacacagctatagtcatacgcggtggattgtcgc
-gaaacgttttttttcctgttttgtacttcctgacagtaaaggagatgcgtggtcggttttttcatcaacgtatccctgat
-aaattgatgttgtgctggtctggcaattttattcagtcacattggttgggggcaatgatttatccgtagcagcactgcag
-aaggtgaacaggtgctgctacgttatcagggataggttacctggaaagtactggtgggctttttaaattccggccggttc
-gatagcaatattcccaggtccttgctttaatgttgccgtggaaatgaagagctgttgatgttgccgttaccttgaattca
-gggtaacccatcgggaggtgtcccatcttcggtttcaataatctctataacagaattcgtatcatttaggtttttaatgc
-tcattagcgggatttttactggttgctaaacccttcaatgaaggtacgccagacgccttttggcggcagtgggcttcagt
-aagcgtattaaccagcagttgtgtggtttgaagtcctactttttcccagtgacgaagttttttgtttcaatattccacgc
-acacgaaataccaaatttctgaagtgcgagatatcaaagggaacaggttgaagccgccattttttaattgtccagagcta
-tattctttcccattctaaccgttgaatcctttgggactgatgggcccggtaagtatcggaggtaaaacatgcttggtaag
-gtttatttgtacattaattcagtgtgaaattggacataaatgttggttgctgtgatcttacaactctttgtaccagtgac
-cctgtaggccgcttaaacgaaataaacgtaaatttgatgactggcatacggactttgctgatttaagtgtatggatcgaa
-cactctaagtatctgtataaaattcaacagttatgtttgtgtatataatccaccatccagcccaaaacttatcgtagtcg
-tctgcctttggttgcaaccctttaaagttgtagactcgctgtctgtgacgaaaaggaaaaattcttgagtttggaaggat
-ctcgatatcagaaccttcctgggcgtcattgaaatgtcagtctcctacttgtatcggtacaatgcagacggcagacggct
-tgatattaacattggtgtacatacaggaccatggaaccgatgttctaaataagtttatgtccccgcccataaatctttac
-tgaaatcgaaccaatggcattttcaatagttattggaccaggattcgccttcttgccagatgctattgcagtagatccac
-caacacccgtaaaacctgtatccaggttatgaccacgtacattttttaccccagttcgggcgcgggcctgcgtgggtttt
-tataaaaaaccaagttgcttgctgttgaactgtgtaattaaaggtccatctgtgcggccagtggaggggcctcgatagtt
-atcaaactgcctgcattatttcccacataaaactttgttatatgcactggactgtattacaaaaagaatacagagtgcta
-aaaaaagaatgtacctgaagatagtgcctttcatttttttaactccaattgtttctttaaattgatttactggttttggc
-gcctgtttttgtttttgttattcgtagtaatatcactaacacaatggctcataagtttggaccagatgtacacactcata
-tgcaggatcgatttttgcatttcgggtgctacattttcaggatgaaccattcatgtcatccgcacattaactggatacag
-cggaacgagattcccgcctgaagcagtttaagaacattgaatgttattcccgccgaatcctgaaagtagaaaatatactt
-actcctacaattacttggctcctgacgaaaatttcccaaattttggcaaataaaaaaaaaaaaaaaaaaaaaatttaatt
-tgcctagagcccagcaagcgaatgacacgtaaggctctaaaatcaataaatatgtaactgattattagcacatgccagtt
-ttccctgtaatgcagcagtccggatacagtgcatagtgactcttttccacctggttgatcactttcaggagtaacattac
-gctgaaaaattatcccacccaagacgccaagatcaatattacctggttactgatttccgcttttgcaggtggctgttttt
-ttacattgggcaaacaaggtccaatatcccctgtccagcaatggctggaccagggggcgatgcaaaaaccgtaaatttgt
-aaacagaattattctcttttcattcagcttaacgtttgagtgggattgcattttatagttcctgaatctgttaagttctg
-gttagtttataggtttaactgtaaatgtggcttggtgcgaaaacttaccgcggcagtgacattgttttacggttttttat
-tttttctcacgaccaggcgtgggcac
->m141013_011508_sherri_c100709962550000001823135904221533_s1_p0/133/0_5390 RQ=0.875
-gaggaaaaaaaaagggagggaaaaaaaaaaaatttttgccccccaaaaaaaaacccagatttaaaatccccaatatcgtt
-cccggcccaataaagggggttagagttttggcgcgccggaataccactgcatttgggggccaaagaatacagacctggtg
-ggggttttagaaccacagcggaggaacaacccgtagcaggatcacctgaagctgggtccaagattgcgcaacgaaatgcc
-gtcatcgttggcgagggtggtaatcaaatcgccgccaatgcgcgcatcatccttttattgaagattatttagggttaagg
-ccatgggtaggatgaggcaatttcggcgttggaatccagtttcatctcttttgttgtagggggcaacagcgcctgaacga
-tttcactggcaaaaggccttcaactttggcaagattgatggcgcgaatctccggcaacacgatgagtaagaagacagcgg
-gcggcagcagcctgttctggtgataaattggcgtcaatctgatccttcactgcccgtgcacggctttctcattttcgaca
-acggcagcgtgatgctgcgataggtgacgggaaattgtgacattactgcgtgtctaaatacgcgtccgcagtttattgcc
-gtaccatcagaaatcataaaaaacgtggcgatcaaacagcatttatccattttgttctttccgtggatgcagaataattc
-tatgaaagcataaattaaaaacgcacagaagcgtagaacgtttatgtctggttttataaaatgaaccttcaaattttatt
-ttttatgaaaacagcctttattttttatggttttcgttttataccgatggtttaatgtggaaatttgtcgaagagagcag
-atttgcgcaacttgggatcagtcttaaaaagttaaaaaaaatatattgcttgaacgatcaccgtttttttttccatgccg
-gttaaatatgcaaagtaaatggcagaaatgtgtttcctcaaacccgttcatttatgcacaaaaggaattgttcgatgtcc
-aaccaatggcttcggtcaccggctgtgctttggtatagaccaactcggcatgaatgatgtagacagggtttgggggcaaa
-aatgcctcctgggtgaaattgaattactaatctttccggaatgggtgtttccgttccgggaatggtttccgccacaaccg
-ccgacgcgttttaaccagtttctggacccaagcggcgtaacccagcgcattttatgaagctgctgggataaaacggatta
-ttgacgatgttactcagcttgcgaaagcggcgcgcaaatccgccagtggattatcgacatgcccttcccagcctgagctg
-gaaaaacgccatccgcgaagccttaatgcacagctttccgccgatgacgaaaagcctcttttgcgtgggcgctcctccgc
-caccggcagaagcctatgccgggacgcttcttttgccggtcaggcaggaaccttcctcaacgttcagggttttgacgcgt
-tctcgtggcagtggaaacatgtatttgcttctctgtttaacgatcgcggccatctctatcgtgtgcacggcagggttgcg
-ataacgcgtggtgtggcgctctccgccggtgttcaacggatggtgcgctctgacctcgcatcaatctggcgtgatgttct
-ccatctgataccgaatccggctctttgaccaggtggtgttatcaacttccgcacctggggcctttggggtgagatggtcg
-tgccagggtgcggtttaacccggatgagttttacgtgcataaacgcgacactggcggcgaatcgcccgctatgtgcgccg
-ccaccatggggtgcgaaaaacaatccgcatggttgtacgccgcccgacgccaggagcaccggcaagcaggttaaaatcga
-agacgtaccgcgcaggaacagcgtgacatcttctcgctgaccaacgaagaagtgcaaggaacctgcaaaaacaggccgta
-caaattgagaaacactacggtcgccggcgatggatattagagtgggcgaaagatggccacacggtagaactgttcatagc
-tgtgcagcgcgtccggaaacgcgtgcgctcaccgcggtccaggtcatggagcgttatacgctgcaattcacagggtaacg
-ttatgcgccgacggcgcgtgctatcggtcatcgcatgcggtgcggtctgcgggtgacagtcatccatgacaataggcgaa
-tgaaccggcatcgaacctggcgacgtgctggttactgacatgacgacccggactgggaaccgatcatgaagaaagccatt
-cgctgccaatcgttaccaccgtggcgggtcgtagcctgtcacgcggcgatcatcgctcgtgaactgggcattccgggccg
-gtagtggctgtggagatgccaacagaacggatgaaaagacgtgagcacgtcactgttttttggtgccgaaggtgataccg
-gttttagcgtctatgccggagttgctggaatttagcgtgtaaaagctctcagcgtagaaacgatgccggatctgccgttg
-aaagtgatgatgaacgtcgtaacccggaccgtgctttcgtacttgcctgcctaccccgaaaacgaacggcgtgggccctt
-gcgcgtctggaatttatcatcaaaaccgtatgattggcgtccccacccacgcggcaactgcttcgaagttttgaaacgat
-caggacaccgcgttgcaaaacgaaatcgcggcgagatgaaatggaaaggtttttgattctccgcgtgattttacgttggt
-cgtctgatgaagggaatgcgcgaacggcttggtgccgcgtttttatccgaaagcgcgtcattgtccgctctctgatattt
-ttttttttttttttttttttttttttttttttttaaaatcgaacgaaatatgccaacctggtcggtggtgaagcgttaac
-gaagccggcagatgaaagagaaccgaatgctcggcttccgtggcgcggcgctatgtttccgaagcgcttccgcgactgtt
-tgccgctggagtgtgacagcagtgaaaagtggcgcaagcgacatgggactgaccaagcgttgaaagatcatgaatcccgt
-tcgtgcgtaccgtagatcaggcgaaagcggtgttgaagaacttggcgcgtcaggggctgaaacgtggcgagaacgggctg
-aaaatcatcatgatgtggtgaaatcccgtcccaacgcctttttgctggccgagcagttctcgaatatttccgaccggctt
-ctcaattttggctcaaacgataatgacggcagctggcgctcagggtcctggaccgtgactccggcgtggtgtctgaattg
-ttcgatgagcgcaacgattgcggtgaaagcactgcctgtcgatggcttatccgttgccgcgaagaaacagggctccaata
-tgtcggattgcggtccagggtccgtccgaccacggaagactttgccagcatggttgatggaaagaggggaatcgatagcc
-tgtctctgaacgtagggcggacaccgctggtgcaaacctggttaagcctggctgaaactgaagaatcaaaataaatcccg
-ggcggcgtttagggtccggccgggttatgctgatccctcgaagatgaaacttattcaatctcttcaacagacatcctgcg
-ttaaacgccgcataataatcttttctaaaaaacttttgtattttacctgaggtagtttcgcggtagttttttttcgcatt
-acaacgatatgttccaggataaatttaatattttgcgacccgtttacggctaaaaaagccactactcttccagcgataat
-gaaatgatgcggcgctttcagcacgacataagcgcaatgatcgttcacgctaaacgttcatacgagcatgtgcaaacgca
-cacaggcatcgtgaatttttagattgcattgcaataaaatatctttccacttcaacggcttgctaatattttgccgccgc
-ggaaataatatctttttgcgtccggtaaaatttttattatagcccagcctgcatccatacggcagagatcggccgctgta
-aagtaccagcctctatccagggcacgggcggtttaattcaggttcatcaaatacccataaacacatttggggccacgcga
-ggcttcttcaccttgcaacctggcgcggtaaggtcttgcgtgcggtcatcgacgcactttaatcctctgacacctgcggc
-aggccgtaacatcggtgtgcataaagcgcgacaaaggaatgcatgagattcaccacccgcatgcggcgaactttctgtgg
-aaccataaacacttaatcaatcttaatttgcgcggctgctggcattcacagagcgcgccactttttttggggattgtgtt
-cgccgcaaagaaaggaaacgcagcgtgaaggtccgcggtttgtttctctagtacattcaaaagatcatagacaaacggcg
-ttgcgccgagcatacaggtggcaacggccttgctgctcaagccagcgcgagacacgcatcagggagtgaaaatatttcta
-acaacacgctgcgagcgcaatttaagaatggtgccgttacggcatgagaaagcccgttggcgtgaccataggtggcggca
-ggcatcataaacgacatctgccaggtcagattcagtcgcgcgcaataagcccgctgcactggcgagaatattgtttatgc
-gttagcatcaacgccctttggcagagcgcgctcggtccggaggtaacagcacgcaagctaatcgatcgccgtgggtgcgt
-tatcgccgtggtcccagtgaggtattgtcggcgtatatctgacttaatgagagggaagaggtggcgggaaggcgcagttt
-tgttcacgccgacaatttgtttgtagttgtgaagctgaattttgcagcgggcaggattaaatctaccgtgacgcgtttgt
-tttaaacaacgttcggtggcaaagaacatttttgcctgaacttattgaggcacccagcaccagttctgttcccgccagga
-aggcaacagcgcacggaaacttgcaccgaattttcagggcaggcaagatagattaacggtaaattcacacgcagccaggc
-agttggaacctgcgatgcgaatcgcctgattcatatacctcgctaacatccagtttgccagacaagctcgcggcgtgatc
-gagcgcgtatacgtgtaagatgcaccatggattatcgacaggcaattttgtctggcaatcgcacgagcggtctgctgcag
-taatccggccagccgaagcatcgccccataaccttgcctgacgatacgcacgcacgcgcgttgttgttaaacgtgttatg
-tcactttcatgttggagctctcgaaacaga
->m141013_011508_sherri_c100709962550000001823135904221533_s1_p0/161/0_1549 RQ=0.800
-aataccacacgaccccaccgtccaaaggggaaagggggaaaagaggaaaaaatttggaaaaaggttttgtttttaagccc
-gcaggcccgaattttttttttccttgggaagattgggataaaggggttggggggggaccgccaacagaatgctttttcct
-ctggtttagatagaggctcagccgcggcggtttggttttccccttttgaagaaggcggcacgatttaactgaggcgttga
-tgtaatttccgtctgcacagaacttgccctttgtcggcaaggtaaactcgctgagcgggtgaaccaagttagtttttggt
-tcgctacgggtgtggaaaaaatggtttttcaaggaggagtcgacaagatcccttcaccttgttcagaatcggatttgatt
-tttgaataggtttaagtcgatgtgcacggcatacgggcagaagatgaacgttcgcattagcgcggtcgtattcaatcggt
-tcgcctgcacatgtccggaacaggcagggccaccagcgtgggcaatgaacggccgaagggtcgttcttttttacagcggg
-cctagaagggacataacacagcgtgaaatcggggtaattcacgggtattgacggagattagcgtaaggcgaagacagggg
-tttcgattacaaccgaaggaatttttacagccctggctctggccactaatggcatgcctgatgccttgggagggtggcgc
-agtggcagttctggtgattacgaacgaccgggcttccagcacgcgcgcttaggtttacgttttgcgggctgaagtagcgt
-ggggttagggcggacaaccagcttcaacgatttcaagaaaagcagtttcgtattaagccggtcatcattttttcaggatc
-tgacatcgacgcatgcgtaatcggtatttcccgtttttaaacctgcaaatcatagggtttactcattggtcgcaacttgc
-aaggttcgtctctttttgtttgctgatgaaactgactataaccgaaggtaatatctccagtgccgccagtaggtagatgg
-cacaaacctgacgatcattattaagactttctttagatgaaggaaccgtacggcagtgttgatgggcgtcaagaactctg
-actgatgcgttaaaaaattgtttcgccgtgggtaaggtaagtttgctttccctgacgaacacggctcaaaaagcgagcgc
-cagtcagctgctcagttcattcaatgtcttagagagcggcaggttgactcaaattaaaggtttcaggccggcgcgcccca
-aggttcttgttgtgcgacagctacgaatgtatgaaggtggcgcaaacggtgcgtgcgtaaacgactatttttttccataa
-gcgatgttctttaaaaacgaagcggtgtctggctgacaagttgaagttgttttgattatgataattgattgcaaaatatg
-tttgattaacaattaagcaatttatgttaagcaaatggataatattgatgttttcgcggcgagatcacgtttgtaaattc
-ttccgcggagccggtggaatgcggttata
->m141013_011508_sherri_c100709962550000001823135904221533_s1_p0/183/2813_4499 RQ=0.884
-cagggctgtaacccttcgaacccttgttcaaggtgaatgtgtgcgtcgcaagttttaaggctttctcggacggaccgagc
-atgccacgcaaccgcggagcgcgcacattcttgtgtatgaaatatgcggctcagggactggcccgcttgcgaaatctcag
-agaaattgttgtcttcacggtttactctaccacagtaaaccgaaaagttgtcatttcaaagttttgggttagttttttcg
-ggtgagcgacgcgtgttcaagtaacgcttgtttctactggtcctgctttgcatgcatcgcgaatacgctgtttcgcatac
-cttgccgcgtagttcacgatctttgctttttcttgcgctaactcatagctgatattccaatgcggcaatgaagaccaact
-gttcagtatttgtgactctagtggcgttctttcagaatcttgcaaccgttggttcagatcggtccgctgggccttgattc
-aaacgcaatccgctttggtcaggcgggcagttcaacgcaagctgaacggccaaaaatttgggatatggacgggttgtgca
-gacattgcgcaccttcctgcctgattgactgcgctgcttcgtctttaagacccatggtctgcgaaggggcgacactatag
-ctacccctgatgagaagagacaagcccttttcctggtccaccagggccaaagttggtagcatatcatgaatattcctcct
-ttgacgacgaatgctttatgttctatacagaacgaaaatgctgttacaacgaaatgaaccagtaatctgaacgcaacagg
-gacgggtctgacccagctgagatgcatggtttaatcagcgggatgatatgtggcggtaacacgatgacagctcatggcta
-ccggctacttcacgaccctgacggaaacgaaggcatgggctttcggtcatgagctggcacaggcactgcgttaaaatgca
-ctggctgccaccagcgagccctgcaggaatggaacggccttcctttttcagctttatcctgcctgatggcggattgatgt
-cagcgttttcgatcggctgaatgcaattggcaggtggtcaatcacttcctgcttggtctttggcgtttacgcaaccggaa
-gctggaaataaagtgacggcgaaccggtgaagctaatgcgacgatgctgcgtaaacatttgcgcaactggttacgaacga
-agccgaagatcaggaagagcttttgaaatgtcgcttgaagagatcatcgaatagttcgtgttgccgtcgctgttatgcca
-cgacacctttaactcatccgcaaccgacggcgcgccagaagtacaaaaaaccgactctaactaaaaaaaaaaaacgtaag
-gagagtgttatgagtgagattaatgccggcaagagtttcatcgtcgccgtcaggcgcctggtggagcaaaatgcaaaccc
-ggcagcgccgcgctgaattttttgctgcaccagaagtaacagcgtagcgccgacgcgaatacccctatctgtcgaacagt
-gacttctggtacttcaaccgctttacgaaccggaagcggtgctggtgctgattaacaagcgatgacactaataaccacag
-cgttctgttttaacgcggttccgcgaccctgacgggcggagattctggttggccgtcgcttaggcgcaggatgccggcgc
-cagaga
->m141013_011508_sherri_c100709962550000001823135904221533_s1_p0/272/5687_16279 RQ=0.849
-tagcgtgatatcggtaagcgcctgcctgcgcacatacctgggcctgcagattatcgacttgagcgccattcagggatgaa
-gtcgattcctggttgccgcctgacctgacgccgcctgtccgaaaccgcacaggctgaacctgaagaaggtgctgggttcc
-agtcccgacgtgcgggtggccgtactcgtcccaactctatcaatggcggcgtttctccgtggaactacctgctaatcgtg
-ggtacgcggtagcgtcacctctcaggtgaaaaatgacgactatctgattctggaatgccgtaaaataatccaggtttacg
-tcaatccgaacaacgaagtttattgcatcaaacatgcgcgcttgttcaggagcaagtggctttctgaaaaagcagagctt
-gctaaacctgaagatctgccagcttattacgctggacggtcaccaggtagaaagttatcgcgctaacattgcgtagcggt
-tttcgtgacgttgaaggtgcagagcgtgaaacggcgctgaaggcgttggtctgtaacgatcgtactgagttcctgtttca
-tggacgccgacgcactgcccactgagagaagcagtttttgctgcttacaaagcagtggctgaagcgctggtggctcgcac
-gcgtttatcgtttcgtacatggagcatcggcggcggacaaagacgctgccatactgaacttcccgaaagagagaacccgt
-ttcctcggctggcgcgctatccgtatgcgatggatcgtcagagagatccctgcgcgatcagctccgcgctagatccgctg
-cgtgcctcggcttttcggtaattggcggcattatgtttcccgatggagtcatatctggtttgaagaaagtggcggtgcac
-tgcgcaagagatcgaatctacaaacaggaactgcgcgacgaaaggtaaaggcgtttgaaccgagtcattgaaaatcgcgt
-aaatgggttggagaacacgcgcggctgccgcaacaattgcacaacgtcattgtagcacaagaagttttgatttcttttag
-tatcaggcaccaaatgatttaacgggcagtgacacctctcggcagtttttgacccgtggtaattgaattatgatttcaca
-ccttacccagccaaatgtcacgggtccgtgctgaacttgatccagcaagtttttattggatgcttcttcatgctgaaagg
-caaatggaactggcatgtgtggtgacttgctgcgcgatgaaacgtgctaccttctgttgcctggggatgggtgctggacg
-aattctctatgagcgccatgttctacttcccgcgcattaaggaagattatcccgtaacacgaacttcgaagaatgcgaag
-gtgttagcagagcaggcctcttgctccaaaccgacaacggcacgagttttaatgacgctggttaacaaggttcattgaag
-aaaaagaacaatctgctatcccacgcaaatgccggcccaaatttactgcttaggagaacgactcatctggtttgttccgg
-ataaactggaaatgctctggttttccggacggaacaagaaggataccggaactatctgagatcattgctcgcgctctttc
-tggcgagatttaggtcaatatcgaagacgtgccggatgtcgtttttagcggaaaaaaatcgttggttgatggtattgcta
-tgcaacgcaacggtaacaaatggtcgcgccagtagaccggcaccattggtaaaatctttgaaacgctcaccacgcatctc
-tctactcgatctggatagcggccgttggaactgtttcgtcacttcggtatcgaacccggttgaactgaaggcgaaggctt
-caagcgtattgctgcaagaaggtcagcgcgtgacaagttggcgatactgtcattggggaatttgatctgcgctgctggaa
-gagagaaacgcaagtctccctgactaggttgttaatctccaacatggacgaaaatcaaagtaatgaacctcaaactgtcc
-ggtagcggtaaccgtggggtgaaaccccggttatccgcatcaagaagtaaattcttgccggcagtgaaaataatggccgg
-cccatcgggcgccattttttttatgcttgccgccagcgcgggcaaaaatcaattcatcgcctcctcatgctgctgggtgt
-agcgcatcatttccagtaacgcgcaacgcccgctcggtggcaactggcagtcgtgttaacgccgcttcccttcagcaggc
-cactgatgagctgaggcacaaacaggtgcgcccagtgcctttcaggtcggtttttttagcccgtgaatgggaaagtgaca
-gttcaccgcttgtcggcagtgaccaccgacaacctgcattctgattttcttcattaccggaggcgctggtaaccacgcac
-ccatcttaaatgtgtcgacaaagcagaacttttgcggcagcaattggcaactgtcgagctcggcgggcaatttttaccgg
-tccggattttccaactccaaagatttataggggggtaattcctgcgccaggcggcagttaaatattgtggatacgcttcg
-ggggaagggtcaggtttgacatagagaattgccggactatcgaattatcgccaatccaccggatccgacgcatgagtcgc
-aataggtcaggatgtgtctttgcgtagcgcagtcaggccactcgccaggattttttgatttgcgatgcggttcccatata
-gcccgttggttacagcacgaagttggcgcagcgcatgcacgctcgctgaaggcgcacgcaaataggcgcgctaaactcat
-tctgtccggatcggcaccaccggtagaaagtgtcataatgccggcggtattgctcacaatacgtcggcaacggcaaaggg
-acatttcagggcgtttctgttgatagcaggcacggcaatgctgttgcccacgctggccgtaaaccacctggactggggca
-cggcgacgatatccgcctggcagtgcctactcttatcgttaaacaacccacaactgactcatttaattttttttctcctt
-gcgatgatcctcatcgtaatcctaaccgaaactttaccctgattctggcaagtcaatttcggctatcacaaaacaaggat
-aaggtaattcaatgaagaaaatcatttgtctggtccattacactactaatgacactccccgttacggcgagtaactggtc
-ccatggaagaagcgcgcatcaacgcccatgctggagggattagcacagaaaaaggattagatatttgtgcgcacggcgtg
-ctgaacatactgctatgaagcggtttctcatctgcgtctgaagctcgcataccgtgaaaccggcattggcacagctgggg
-gcgagcaagtttattgataaggttgcttcgtcgtcatcgaattactggaagccgtatattgtggaagatccccggtaaga
-gcgatgagaacgcacagcttttttacatgcgttaaattgcgcagacggataaaacggtgcctgtcgggaaggaaattaat
-agcgccgcttgtgggaaggcaatttttacaggaggtaacatgaaaaaacgctttatttatcacgatgaaaaaatcgaata
-aattttttggtggatagattacgaagcggggatagtttttaggctgtcaactatggaaggaataaaggtagtattggtag
-attccagacaaagcagttcgggataattgaagaaactacgtggttggaaaggaagcgcaggtaatttgggattgcccgca
-aaaatgaagaaagggctatcaagaaagatccaaagtttaactcattggaatcggctactattttgatgatgacagaaatt
-tggagccttcatgttaaaacgtcaacacaacttccagtgccatttttactgactccactttatatgtgttgctgggatga
-agaatctccttttttgggcaagcgattgaagggtggctgatgctcgtagaacgttcttgagaataagcctcgtaagagcg
-gatctggactgttgctgattttccctcaaaatgttaattgaaactatgtgggtatgaatacatcgctctgggacagtatt
-cttggaagaggatgttcgttgcgcaattactagtgcgatgaaatgagggcatatctcgcagagcaatatgattaccttac
-gcaactgccattcgtccagattaaagtcatgggtaaaatctccgcataaacttaaaaagtatgggactcaatcctagcgc
-gtccatcagcttacgcaaaaatttcaatggggtgacggttcaggaactgcaccatacttcaaaaaaattgattgatgacc
-ttaacgggcgtttccggtcacgaaaattaaatactgcattctgtcgcagccaacaactgttaaaaaagtgcgcctttgtt
-ttatgccggatgcggcgttaaacgcctgtatccgggccctacaaaatcgtggctaaattcaatttattattggcagaacc
-ttgtaggcctgataagcgtagcgcatcaggcagtttgcgtttttggtcattagcaagtctcgcgaatgctattaatctta
-atccccggcccctggctaaaatggctcttccgcaaacacacccggtaatagaaaggttgcgatcgccgagcgagtcgcag
-aatgatcgccaccaccaccgcgtcaggcgttagctttttgccaacccgcaggtgggctcggcggcaacgcgcgccgcgga
-gctgacgccacagtaatattcttccgcacgccgccagtttcgcgcatggtgttttcgcatgcgcgctggatgaataatcc
-agcacctcatcacatagagaagcgttgaaaatccccggcaggcatattccgtaggcctagcggccgaaatgccgggcatg
-ctgctgggccctcttcgcggttgcaaggccggacacatggcacgcggtttgaattttgtttcgcgggcattaaagcgtga
-gacgccggtgataggtgccggtcgtcccatgctggagcaaaatgagtgatgggcccgccggtttgctggccagatttccg
-gcagttggttggtgtaatgcgcataagggttatagggattattgaactggatcgaggcagctttccgctttcggccacga
-ttccgccatcttccagcggccagatcggcgcgcccttcatgccctggctcttttggtgacaagaatcagtttccggcacc
-ataagccacgcatcgccgacggcgttttcgctggctcatgtttgtcgggcatcagcaattatttcatgcgataccgcctt
-tcagcgcgtgcaatcaaattgccagccgcaatgccgggtgtggaccactgtgggcttccgattaagaccatcaccccggt
-tttatatttccccccgcgcttttccgcctcgacgatcatcgaaatggccggcacgatctttcaccgaacctggcgggtta
-attgccttccgtttttaacgcacacttcacttgcggttatccggccagcccattcgctgcaacttccatcgcagaggcgg
-tattggcctattggtttgttctaatgtactcacgatctctatccatacgtttggtgttgcctgatggcgaacgcttgcgc
-gttcttacaggttttacaggttacaaaccgcttgcattaaaaaagcccgggatcgcgggaagcgcctctgggcgttttaa
-cattcacgtcaactatcaggcgcttgtggcgagagggcaagttcctcatgcgcgggtttcgattacgctcgtccggccga
-gtgtttataaccagccggcgctatgttgcagacccaaacgacataaagctcgccacgctgcggggcatcgtcgccatgcg
-ggtcacgaccgtcacggattcgtttttaaccacacagcggctgacgcacttaattgggtgtcagtggacctttcgggctg
-gcttcgcagttaccctgtaccgggcaagcggcgggatatggagggctgggtacggcggctgagatattcactttccaagg
-ggcgcaggaagagatccccgcgccctgatacgcaggtgtgtacggcccagcgcgccgagcgatgcgcgccaacatggaga
-cgctgtcccgagcgaatggttccctgcaggcgttcactttcgcccaataaattcgagggcacaaaacgggtcggccggtt
-cgcgccatactgattcggcggcggcgtcagcctgtttcaatattgccctgggctcatcaaactaaacacgatccgtctac
-ttcaggggtcgcttctttcctgagtccgtgggtcacaaaaacgctgggtgaattttagtttcttcatggagttagcagcc
-agcgacgcagctgctctttttagcgcacctgcgattccagcgcgccaaacggttcatgcaagcagcagcatttgcggttt
-ccacagccagcgcgcgcgccagcgccacgcgctgtttctggccgccggtaaagctgcgcggataacgatccccagatggg
-caaggctgaacgcattttccagcaattttgtcactttcgctttttgatggctgcggcattcgggcgctcggccgacgcgg
-cagcaccgtcaggccaaaagcggatattgtcgaacaccgtcaataatggcggaacagcggcgtaaatgctggaacacgaa
-agccaactttaaacgagatcactgtgcgtgcggcgctcacgctggtgccgtggaagcgaataaggccgcgctggttgatg
-gctccagccctcggcgataatgcgcaggcagcgtggttttccccggggaaccggggaccggccgccagcaacgctgacca
-tctgactgaaggcaatatgctcagtgagatagtcgttcaagcacctggggtggcgaacaaacgattcttatattgggcaa
-tcctcacttgctcatcgatgttcctcctgctgtgcgcggtttttgcctgattctcaggcgccactggcaacatacttttt
-aaaaaacagggtgataatcgcatcagcgttacagcgcgcggcaggcggtaaaggcgccggacggtgttgtagtcgctggc
-tcgcgcagtcaatttcaatctgtaacggcagcgacaggtttttcgccgcgaatcgaccggaaccagacaccggcgccaaa
-ctgcggccaattgcgcggctgttgtcaacaccacgccataagcagccgcccagcggtatgttcggtaaattgtgacgggg
-cgacggaacatctggccagccggacgcccgccaagcaaatcgccgcttcgtcttccctggctgcccctggcttaaacatc
-accgcaaccgttcgcgcaccagcaaatcggacacgtcacgaagatggtgaccagcaccatttcccccggccaggagaaca
-taattttgcaggttatgctgtcgagccaaccgcggagcgggccgttagagcgtaggaacagcatacaccagacggccaac
-cactggcggatacgggcaaacggaatgttcagtagcgtagcagtaactggcgtccagggaagttaaagcgcgttcaccag
-cgcaggcagcagaatgccgaaacacacaggtttacgggtacggcaatcagcgcgagtcatcaccgtcagccagatggcgt
-gcaggcatgtccggatcggccagattctgtaagaatccggcatgcagccgccttgctgaatgcctgccgaagatgtaaat
-cgattcggcgcacgcgccggatgaacgccgaaaccagcatcccgctggccaatcagaaaccatttgccccagttaatcgg
-gcgcgcgtcataacgctttcaatttgggtaaacttcactgccagattaactgacctaagtcgcacacgcgaccaaagagg
-cgactgttgcatagtgttattgagaacgagcagcagcagagatgccgcgaggatcaccgaagcacatggggcgctcgctg
-ccggtaagtcaaatcctgttaaaggccgcacaaaaatcatcagcgaccgtcacttccgtcttccgacgcgatctttcccg
-gcggataaaaatcacccgcgccaaattcacgcaagactacgggtaaacgaaaggcgccacgtcccgccacctaggcgccg
-gagaaagctccggcgagcaccacttttgggggcagaaactcgctggcccagcgcgttgcaccaagcgtttcgccgctttc
-ttccatatttccgggcctaacctcttcaggcaccggctgcacggtacgcaccacaaacggaatgctggtaaagccctaag
-ccacgcaaatccccagccattgtataggtgactttgatatcaaccttcgccagccccatgtcaccgtaaaaaaccgttta
-cgggaaaaagggagcgagccagcggttaaaccggcgacagccgggttggcagcgataagggtaatatcatcagcgcatca
-aagcagcgtcgcggcctgggaagcgataggcgggttagggagtcccaccgcccatcagcagacccgaaaaggattgtcgt
-gtaaaaatcgatgccacaaacggccgacaggcagcgttactttgtaggccgcgacaacctgcgggttgtgatcaccgtcc
-cagtactgcgccacccactcatctggcaagttgcatccacagcgcgagagcgcgcagcagcaaaatcaggcaccccaaca
-gcagaactggtggccggacggcttaagggtaaagcccggcagcacgcgtctgggaggagaaaagcaaacatcgttaccgc
-cccgccgctaacaggcttgtctaactcgccgccgtggtgaagtggggtttttccatcactttcccggccaggagccaaag
-ttgtgtcttccacggatgcggaacagcttcgggtctgcgggaattgtctttcagtttgtcatcacgctccgggttattca
-tcgcggtagttatagtcgggtgatggatggtttgcgcctgggggctatagagcatagttcaagataggcttttggggcgg
-cttttttcgttaccgtttggcctgcacagttttttatcaaccctacgccaccgggaattccgccagaatgttgttgttcg
-gaatcacgcacttcataaagccctgcgctttcatatctgtttacggctgttggttcacttcgattcgaaggctaatcagc
-aacaatgcccagccgcgctcggcaaaagtggtgtccgcgccacgacctggccagtatgcgaacactttcaacgttttcag
-ggaactgggtcaggtaactttgttcggttttggcctttgtcaccaccgtcagtttattccgctgcggcacccatgccggc
-cgagataggttataacgggcgtttaagccgttcgacgtttcgggttcgggaaaagatcagcttacgtcggagcgcaccag
-gtcgttcgccaatcgtggatttctttcggggttactccttttacgcaccaggaagcccatgggggtgggagtagaacggc
-gagctacttattcggcaaggcgcgactggcagtcggccgggatcagcttgccttatcgtggcaaggatttgtacgtcggt
-tcaacctggttataagtgagcatacggtcggcttttaaagccctgtaaaatcgccagcgctgggttttgattgtaccgcg
-gcctgagattgttttttatgcgtcagtttgtcgcccgccgttatcttttgcccattgttttggctccaaacgcggcggat
-tcagggcgggaagcagcttcggcgggagcgtcataagaacttgtttcaggtgtgcagttgttccgtttgcctgtactggg
-ccgccagcaaggcagagataggcgacgagcgcgagtgagtgtcttttttcagaagttaacggggccattgcgcaccctta
-aaaatttaatgactttctacatagccatcgatattttctaacggacgtggaaaggagtaacggttttttaatataccgtt
-tggtgatttggaagttgaaaagggatataagaacttggttcatgcaggcgtaattggggttggcagtcagttttggaccg
-gggagggaggtctatggcgcggagaaacgcggggagcggttacacattagtacgtgaggattttcgagcactggccgggg
-ccaaaatgacaaataaaataggcctggtgaacttagttcaagagacgaaatcctccccacaaatgccagggcaggaaaca
-gaggtgaaatcagctacgcgacgctataccgtctccggcagttgttgctgccgcatcaaatacattctgtggctacggtt
-aaatcgctggattcatccgatgcgaggaaaggccgcagagtttcgcgacttccagcggacgttcggcgaggcgacgcatg
-gattgcttttcggccatttcagtcaggcacgactctggagtcttgtccgggttcgaacactgggggtgcaatgctttcgc
-gccattggtgtgcgcacgtatccgggcagacatgggcgttaacgcgaataccagactgcgcgtacttccttagcggccag
-cgattttggtcaaggcgccaacatcgcggctttcgttaaggcgttacgccgtttcgccagggatcgccaccattatcacc
-agtgatctgaagacatgcatcagcaatgcgac
->m141013_011508_sherri_c100709962550000001823135904221533_s1_p0/285/0_21870 RQ=0.859
-gttgggaggaccgaagaaaatttttggggggccccccaaatttctgttttttttccccttgtttttcccttttgcctggc
-ccccttgctgcactcgtgaactgctttttcggatgtggcgccatccacagctcggcccaattcggctgggtggacggttt
-ttcatacaataaagtttaaagtcaacgcgtttttgctgcgcccaggcatagttttgcactgagtttaatgagtttttttt
-tgcatgaaaatcaatccctgtttttaattgtggaaattaatccactattaaagcaagaatctacggtttaagtaactgga
-ggcaaaagtcgttactagtcctcagtttttttttgttaaaaagtgtgtaggattatattgttactattgttatcgctttt
-tttaacagggcaacggaacaccgcgcagagcaataacccaaacaggcagttaagtggagagaacaaatgtcaaacaaacc
-ctttcattatcaggctcttttccatcaaaaaagatgactactgagtattacctgcttaaccagcgccacgttagagtatc
-tgaaatttgaaggcaggagatttttgaaagtcgcacccgaagcgttaactctgtgggcccaggcgtttcatgatgcgtcg
-ttcatgcttgcgtccggcgcaccaacaacaggtgggccgaattctgcgtgacccgggaggccagcgaaaatgataaatat
-gtggcggctgcattctgcgtaactccgacatcgcgggaaaggcgtttctgcacctgtcaggatacgcaccgcgattattg
-tttggtaaaaagggcataagcgtgtatggacacggtggtggttgatgaagcggcgctggcgcggggtgtctataaacact
-tatatcgaagataattgcgctactcgcaaaaacgcgccgctggatatgtataaagaagtgaataccggcaccaatctgca
-ggcagatcgatctttatgccgttgatgggaacgaatacaaattcctcgtaatcgccaaagtggtggttcggcaaacaagc
-gttctctatcaggaaaccaaagcgttactgacgccggggaaactgcaaaattactggttgagaagatgctgcacctgggt
-acggcggctgtctccgtatcatattgcgttcgttatttgtggaacttctgcagaaacgacttaaaaacggtgaactgggc
-ttcccgcgaaatatactatgatgaactgcaccacggaagggaatgagcacggtcagcgttcgcggatgtggaagctgtga
-aaaagaattgctctgatcggagcgcaatcttggtctgggtgcgcagtttggtggtaaatacttcgctcactgacatccgc
-gtgattcgcctgccaacgtcacgggcatctgcggtcggtatgggcggtttcctgctctgctgaccggtaaatatcaagcg
-aagatcaactcgtcaggggattggatcgaaaactggaacataatccagggcaaatatatcccggaagagctgcgcaagcg
-ggagaaggcgaagcggtggccgcgttgacattaaccgtccgatgaaagagtcctcgcacaggtttgtcgagtaatcccgt
-tttctacacgcttatcgctaaaacggcacgattatcggcggtcgtgatattgtcacccaaactgaaaagagcggatggat
-aagggtgaagggctgcgcagtagatcaagatcatccggatttactacgcgggtccggcctaaacgccgggaaggttatgc
-ctccggttctcttggccaatgggggaagggaggggggggggaggagaaagggggcgaaccgccggacggaatggtatttt
-aatgtcgatcaactgcaagcgcagggcggaagtatgatcatgctggcgaaaggcaaccgcagccagccaggtgacggatg
-cctgtaaaaaacacggcggcttctacatttggagtatgcggtggtccggcccgctgtattggcgcagggcagtattaaga
-gcctggaaaatgtggttggaatatcggaactgggaatggaagccatctggaaaattgaaagtggaagatttccggcgttt
-atccttgtggatgataaaggaaaatgacttcttcaaagcagatacaactcacacaatgcacccgctgtgtgaaataaaca
-gagcgccttgcgggcggttttttacatggcacgaaagaacaacattttgttatcaaatggtaccataataagtgagctaa
-aagttgcttaacgaaagcaacagaaaagaaaaaatttaatcaggtgaggagcaggtcatgaatccgtacgcagcgaaaaa
-gattcgatgggggcgatttgatgtccggcagataagctgtggggcgcacaaatcaacgctgcgcatggagcatttccgca
-tttcgacggagaaaatgccacctcactgatttcatgccgttggcgctaaccacagcgttgcagcggcaaaagttaatgaa
-gaattttaggctttgttgtctgaagagaaagcgagcgccattcgtccaggcggcggatgaagtactggcagacagcaatg
-agacgaacttcccgtggctatctggcagaaccggctccggcccgcaaagtaaatgaacatgaacgaagtgctggctaacg
-ggccagtgaattactcggcggtgttgcgcgggatggaacgtaagttcacctaaacgacgacgtgaaaaaagcaaagttca
-acgatgttttcgacggcgatgcacgttgcggcgctgcctggcgctgccaagcaaactcattcctcagcttaaacctgaca
-cagaagcactgaatgagaaatccgtgcttttttgcccgatatcggtcaaattggtcgtactctactttgcagatgccacg
-ccgttaaacgctgggggcagcgatttccggctgggtagcgatgctcggcataatctcaaacatatcgaatacagcctgct
-cacgtaggaactggctctttggcggtacagcggtgggtactggactataataccgcattccggagtatgcgcgtcgcgta
-gcaaagatgactggcagtattacctgtgcaaccgtttgttaccggcgccgaacaaatttgaagcgctggcgacctgtgat
-gcctggttaggcgcacggcgcgttgacagggtttgctgcgtcactgatgaaaattcgccaattgatgtcgctgctggctc
-tgccgcgctggcggaattggtgaaatctcaatccgcggaaaatgagccgggagctcaaatcatgccggggaaagtgaacc
-aaacagtgtgaggcattaacatgctctgctgtcaggtgatggggaacgacgtgggcgatcaacatggggggcgcttccgg
-taatttgaactgaaacgtttccgtcaatggtgatcacaaatttcctgcaatcggtgcgcttgctggcagatggcatggaa
-agtttttaacaaacactgcgcagtgggtattgaaccgaatcgtgagcgaatcaatcaaattaactcaatgaatcgcttga
-tgctggtgactggcttaacacccaattggttatgacaagcgcgccgagatcgccaaaaaagcgcataaagagggctgact
-taaagctgcgggccttgcgctggggtatttagcgaagcgagtttgacagctgggtacgtgccagaacagatggtcggccg
-ttaatgaaagccgggcgttatgctgcaccatcaggtgcagcgtggaatgactcaacgaaggcggctgcgcctgaaggttt
-aataacggtgcttgcaattgcggcatcgtaatttaaacactcaccaacgtccggcacgaacgccgcgccattatcccgat
-taacagtgcaatcagtggtgtagggcaggcgtgttggacttgtttttgaatctctttgtaccaagagcgcgggaatcgct
-gggcaatccttcaccggacgtttttgatttttaacttcgcgttttgtgggcagggcagcgatatcctatagctctgctcc
-agtttttctttgccagctcctcgcgcgtccacggttgcgacactggtggtgatttcaggcttttttcatgctgtgccagg
-acttcatcacgatgtaaattcttaatgatattttattagcccaaccaaagcgtaaagtggcggggtcgtgcagaacggtg
-gacgtgcggtaagcattaaggtgatcagcccgggcaaatgagatgcaccattcaaacgtgccgcggtggggagttctgat
-tcaaccgtgaagatatgctcgaacgtggtcttgagtttattgattgtgctgaatatgactgaccacgctgcttgcgaggt
-tatcgacctggtacacaacacgccaggcagacggacagcggccttgctgctgcgattttcgtgactgtttttgaaataaa
-taaaatggccggaaaaatgacgaagcgcagcgactgcgcgtcgttgccgagatgttgttttactcaatacgattaagcgg
-atttgctatctctttttttttacctccggcaaagagaacacgcgggcaacaatagcttgtgttgctcagatgagcggcaa
-atatagccagcctttttgtttccatctggcgaaaggtagtgttgagtcgtctagagactgtaacgcgcataaatattaac
-cctttagttacaacatttattttatagcacgtcggggttgacttgaccattcggtgcgcgtagtgtcaggcagaggtaaa
-ttgggcggatgtttatgccataacggcagctcaacgagaagcgggcaccaccagtttagctggtgtcacaattacgcgta
-cgaccattgccagtgctatagagtggacaattgcagcccagcccgcagcccgccggttgagacgatccggctggatcgag
-ggaacaaaaggtttcaaagatatggttcgcgtttctggggcaatcctgggcatcatcctcaaaattaatgtcgctctatt
-ctccacagtagcaggctggtttttcgaacgcgttgaatggcagtacgcagggtcgttattgagcaaattatcagcacgcg
-ctccattaagcgcaatattcctaacggccgcataatgcctttgcacgagcgtttttattccgtacgtttttatcggcgtt
-actgctgaatatctgccagatgcgttgacatgcacaaggcaggtctgtgttcgctaagatgttgaagctcgttttggtgg
-gcgagatcgcgtcgggcataagtcagcagtcttcaattaaagcttcaagttacttgatatcacgaattcaacgcctggat
-tcggcggcgctcaggttatcgctcatctccagtcgataacgcaggcgcactaacggtgttcgcagttcgtgagcgatacg
-tcaatcgagctgttttttgctggcaattaaggcgttgctatttgtcgccatctggttaaatgcgacgccaagtcgttcaa
-agtcgaccctcatccaaagtggatacgttcattgagatgcccatcgccaaatcgttgcgggccgctgcttccagttttaa
-ctatctgccagtggagcggagcatccagataaacaccggaaaggcgagggaaatagcaataaaagcgatcagggcgatat
-ccagcaatccgcatctgattggagataataaagggataaggaacaggccaactgccacacgtagtggctgcgcgggatta
-cgctgcaaaaacgtgtactgatcgttccggcgacaatttcgcgccacgcagtcggtgcatggaaatatcaatcaagatgg
-tatttactcaagttggcttcgaacacgctagatcgaacgagagatttaaatttcatctctttcagagttttaccccagtc
-gtgtgcgggatctcacgggaattcgctgcgcattcagattacagcgaatgttttatcaaaatcatccagcgactgtttgc
-ccgcgcgttcgcgtaaatttgttacaccaagacaacagcatgagacattcacaaggaagcagacaaacaataacaggtaa
-aaactggataacagtttttttattctttcgctttattccatgcatgaggccaaaaagatagctcttttgtacgcacagtt
-ttttaatgcgaattaaaaggttctgcgggcgtttattcgaggcaagtttttttttttcttaccgcgaaattagccacgtc
-acgctacgatcagtccgtcataactgcgccgatcgtaaattttttcagcaatgcatcgcgtccatgattttgcccggcaa
-tggtagactttaattccacaataattcgaaatcagctttgtctttagagcgagatttcagtgttagacagggtgactacg
-cggtattaaaaaaatgatgggatcgaatgtcaacgtgccgaaaatggcgggcttttggtagggagtcagagacgtttccc
-ttgaaagacttttggtcagtgtgggcttgctcattcttgacgcaaatgcaacgtaaacgcgctagcaaaacagcaggggg
-cgtcgttttttgggagaaatctagtcgcaggcacccatttttccgtgcaggatgtgttcatatcgctaatcgagagaggt
-ttagaagaacaatcgtccagacactttgcgctaaatcacggacaaatggtcatgccgtcctttgcctggtagcatgatgt
-cgagtaacaccaaaatccggattttctcgcaaatggttcttcggcctggtcgcgcgcgttctctacggtaacctgcattc
-atgtttgccagtacgtcggaaatcagtggaaccgacttcgcatcatcttcacaaaacgatagtgttcataacattcacgg
-tagatataaaaaacgtcaaatacacgcgctgtttttacttactataatcgtttctaacaagtttttcatcagggtattct
-actggatgacttgttatgggaagtgttaaggtaaaagatggggcctggtaatcaagcgcgctcggcgctggtagtgcgtg
-ttgattggttgtttagcaaaaacgaaaaattattatatcgccgggctgatttccacttttcgccgcccctttgcgcttta
-tcgcgcattatattggttggccagcgacgcgcatgaagccttacgcgcaaaaccatcatttttagtatgactggtcgatt
-attccctttttgtttacgctggtgtcgctgttggtatttcaccggaatgatgcgcttgcccgccgcttttgttgggttct
-gttgcgtgtttgggggataagcgcatgggtgttgattatattgctggataaagctgcattacgcagatgaacgaaccgcc
-atcaaagtgggggaaactgcgtcggtgacaaagcaactggtagtaagtaatcgacaggtcgatcacttctttctcgccag
-ggcggttttcatcagtgatttatttcagcgcctgtttgtcgatattcgcatcatatagtcaattaaacaggatagcgatg
-gcgcaatagaattcactttcacttccggttgccagcttgtcggcaaacgagcgggtcatattattcgcagtggccgcttt
-gcttgccgcactacgcatatgttttgtcgctaccgcgctcacaccacataaatcggtaaagtgaaatgatatcgctggcg
-gcgtgtcgtgcccacgcagtaatctttccagcgcattggttgagcaggtatggggtattaacgtggaatgctgcatcatg
-caagagtacgtcggcagtgggcaccggtttttccgccatccacgcactggcgttatgcaacattagcacgcagacatggg
-tgcttttttagttacttgtcaatcggcaaacgccatcacaacctcgttggtcgaaaaaatcagcctgaatacactgcagc
-acctgccattaacagtcataatgtgctgatagtgtgtccgatagctgacaattcaaaccggttgccttttgattaatgaa
-aattgccatgcgagggcgaggccgatgcgacgacctccgccagtaatataatattggcaagggcctgggttttacccatc
-gttatctctttgcttatccaacgatgggattgacgttatccacagcatgccaggtcgccggaactgaaggcaatattaac
-aggcatgccaatcagcaccattttcctgacggttcagtacaattatcatggtatgtgcgcgcgtaaggaaaacctagtta
-acagcccggtgcctacagaacaacggataacagcagtgcatttgacagaggcgtacactaaccataagcccataaatggc
-aggcacggacacgtaccgctttatgcagtggacggtttgcgatttttcagcaacgaacgcgccgacaggaatagggcacc
-agaatcatttctgaggcgatggtcagcaaccgtgcttgttatgaaccggtcagccagatgagtacagacaaatttgcacg
-cagatgtttggtcaaccacagtgaggcggatggcgcaagcttgtggcttttctggcgcgcaaaaaaaatgcgcggaatgc
-tttatgagtggccggcaggaacgtacttctgctgccatgatggtctattgcttaagtagcggcgccgcaaacgacaacga
-tcaaaccggcaagcgtgatgattcgccccatggtcccatcatttctcaccatcagacggcattgaaacggttcacgaatt
-cagcagttttcaggacgtgccaacaaccatgcgaaagcagcgttactagcaagtaaacgcccagagcggagagaacggcc
-agcagtggtgctttgccatacatcacgttttattccgcgcacgcgcagaaacaaccagtgggcacctttccacacaatga
-aaaccacagggtgatcagcatggtgttttttccctgttcccaaacgggtccgcaagtgcaagtccggtgaagtcgagctt
-gaaggtatccagtttgaacatcatcatcgccagcacacaaaatcagacccagcggcaacaattttgcgcagtgtcgccac
-caggttaatgctggcaggcggtttggcacaccgcgaggatcaaaaagtgaacaatccacataaagccgatgcacgactat
-cattgccaggtattacatatcgccaaacaggcgcaattccggcggtgtccgtaaaaaaagctaaggcggaaaaaacgatc
-accagaaaggagaacgttggcgatgactgcgcacagccagttcccatgcggaaaaaagccgattacgtcgccaaaccttg
-cgcggaaataggtaaagataccgcgttcacgttcgggacgaatgcgcgtgaggatcagcctggcaaaggccagcaataaa
-atgccagcgccagtatcccgcgatgagcagtgctgcgggctggcaatgccgccatattttgcgggcagactgaaaacagc
-ccgcgccagcattgagctttaataccagcgcggtgagtggctcagtccagttttctttttccaatcgattatccagtgat
-taaaaagtgataacgaagaataaatatctagggcaaaacgctaaaaatggagtttgcatgaagccgctgggattttaacg
-aagagattgtgtctgcatgcaatggtcgcggggaaattttgtgactaaaaattgcgaagggcatagccgccttatatgag
-taactgaaatagtttatttatacagatctgcgctgacggtcaggttattaccacgttcctgccatgcgggtgatgtgtaa
-tactttagcacctttcttcgcggcacggtttcgcacctgataggagactttcggtcatgttgcgtagttgccagagaatt
-tgaatgctgtcgaacgggaccatatcgctgcggtcgctttttgttcagttcttcgactttagtgcatccgggagcgtgac
-gggtggtaacgcgccttttgatgactggggtttcaagaagcgaccgacttcagaatttggtgatgcgccgtagtcgaaca
-cccgggatctcaactttcttcgccggcttcgccccggcagccattttagctggcacgtcctgcttggaatctgcggatca
-agctccgggctctggagatcgtttcttagcatctttttttatagatgaatgcagtaatacgctggttgccgcctggttgg
-catcgattttgacgacgtatgtagaaagagtaggcactttcgcttttgcgcttttggtgatggcatattgattctggctg
-gctacggaatagaagcctggacggtgaccgggtgtctaaacggttcaatcagaacagctgtctttcggcgttcgacaaca
-ccgttaattacgcgatttattgctttcttctgcttttttcagcatgcgctttatagaggtcagcgaccacacgccagtta
-ccgctgttacaaaaatcagaagtgctcgacaacataaaaagggcggcaccttctttattggcgacgaatgaaacggcttt
-caccgctatcgcatagcattaaaacgacggtaaccatacacggtcacaaggttttaacgctgcgctttgctccggtgtca
-gttctgtttgctggcgttttaacggagaatgccatagcagaaaagcagtgcggacggccaggcgggtgttctttaagctt
-tcataaaaattatccttcgcctttgcgcaaccaggtactggtattgttattaacggagaaacgtggctgattttgcattt
-taaaacggtgtaactggttgcgtcattttttcatatcacattcttaagccaattttatctgctctaaattgacgcgtcta
-tgcttaaaaaacagcgtatcagacttcattactactgaagcaactgaattgtataagttaatttaatgttaagttagtga
-ttcgtgccggggccgatgtctcgttttaacccgaccgtcgaagacaattatcagtctttaatccggcgttctaaggtgtt
-tataccactatcacggctgaatcgttaatatctttgcgagttcacgcgaaatactgatttttggcgctaagaaatcacag
-ggcataatttttcaagtacgttataggggcgttttgttttttatactaatttattttaacggagtaacattagctcgtac
-atgagcagcttgtgtggctcctgacacaggcaaaccatcatcaataaaccgatggaagaatatcatgcgaattgggcata
-caagagaagggttcaccaatgaaacccgtgttgcaggcaacgccaaaaacagtgggaacagctgctgaaactggggtttt
-ttaaccgttcgcggttagagagcggcgcgggtcaaactggcaagttttgacgataaagcgtttgtgcagcgggcgtgaaa
-ttgtagagggaatagcgtctggcagtcagagatcattctgaagtcaatgcgcgttttagaatgatgaaattgcgttaact
-gcatcctgggacaaacgctggtgagtttttctatctggctgcgagaatccggattaattgcaaaacttgcggaagcgtta
-acgtgacgtgatggcgatgggactctgtgcgcgtatcttcacgcgccacaatcgctggacgcactaagctcgatggcgac
-catcgccggttatgcgccattgttgagcggcacatgaatttgggcgcttctttttaccgggcaaattactgggccgggaa
-agtgccacagcaaaagtgatggtgattggtcgcgggtgttgcaggtctggcgcctattggccgagcaaacatctcggcgc
-gattgtggcgtgcattcgacacccgcccggcagtgaaagaacagtatttcaaagtatgggcgggattcctcgagcttgga
-tttttaaagaggaaaagctggcaagcggcgatggctatgccaaagtggatgtcgacgcgttcatcaaagcggaaatggta
-actctttgccgcccaggcaaatagaggtcgatatattgtcacacgcgcttattcgcaggcaaacagcgccgaagctaatt
-acccgtgaaatggttgactccatgaaggcgggcagtgtgattgtccgacctggcagcccaaaacggcggcaaacttgtga
-atacacgtgccgggtgaaatcttcactacggcaattgtgtcaaagtgattggttatacgctcttccgggcgtctgccgaa
-cgcaatcctcagctttacgggcaaaactcggttaatctgctgaaactgtttgtgcaagagaaaagacgagcaatatactg
-ttgattttgatgatgtggtgattcgcggcgtgaccggtgatccgtgcgggcgaaatttacctggcccggcacgcgattcg
-gtatagctcagccgcaggcggcacaaagcggcaccggaaaagtgaaaactgaggaaaaatgtacctgctcacgtggcgta
-aatacgcttgatgggctggcattcattcttttggctggatggcaagcgttgcgccgaagaattcttggcaacttaccgtt
-ttcgcgctggcatgcgttgtcggttattacgtggtgtggatgtaatcgcacgcgctgcatacaccgttgatgtcggtcac
-caacgcgatttaggcggattattgttgttcggaggcatgttgcagatttggccaggggcggtggttagcttcttagtttt
-tttatcgggtgctttatagccagcattaatatttcggtggcttcacgtggatcagcgcatgctgaaatgttcgcacaaat
-taaggggtaacatatgtctggaggattagtttacgctgcataaatttgttgcgcgatcctgttttatcttcagtcctggc
-ggtctttcgaaaacattgaaaacgtctcgccagggtaaaattcggttatcgcggatggcgattgcgttaatgcaaccatt
-tttggacggatacgggtaatgttggctggtcttgctaggcgatggtcattggtggggcaatctgggtatccgttcggcga
-agaaagttgaaatgaccgaaaaaaaaaatgggggcagaactggtggcgaatccgcaatagctttcgtgggtctggcggca
-gtgctggttggctttaacagctatctgcaatcatgaggcgggaatggcaccgattctggtcaatattcacctgacgcgaa
-gtggttcctcgtatcattcatccggggcggtaacgtttcacgggttcggtggtggcgtttcggcaaacgtgtggcaagat
-ttttcgtctaaagcattggatgctgcaaaccgtacaaaatgaactggcgtctgggtcgttttcttcctgctgctgattgg
-tatttgttcgcaacggacagcgtcgctgcaagtgctgggcatttgctgataatgacgcaattgcgctggtttcgctggca
-tttagatcgcctcatcggtggtgcagatatgcgcagtgtggtgtcgtatgctgaactcgtactccggcttggcggctgcg
-gctgcgggctttatgctcagccaacgacctgctgattgtgacccgttgcgctggtgttcttcggggctatccttttcctt
-acattatgtgtaaggcgatgcacgttcctttatcagcgttattgcgggtggtttcggcagccgacggcttctttctactg
-gcgatgatcggaagtggggtgaagcactgcgaatcacgcagaagagacagcggaactgctgaataaactcccttcagtga
-tcattattcggtacggcatggcagtcgcgcaggcgcaatatcctgtcgctgaattactgagaaattgcgcgcgtcgtgta
-ttaatgtgcgtttcggtatccaaccggtcgcggggcgtttgcctggccatatgaacgtattgctggcttgaagcaaaagt
-acgtatggacatcgtgctggaaatggacgagatcaatgatactttttgctgatacgatacgtactggtgattggtgctaa
-cgattacggttaaccggcggcgcaggatgatccgaagagtcgattgctgggtttatgctgtgctgaagtgtggaaagcgc
-agaaacgtgattgtttttaaacgttcgattgaacactggctatgctggttgtgcaaaacccgctttcttcatggaaaaca
-cccatgctgtttggtgagccaagccgcgtggatgcatcctgaaagctctgtaaccctgacggcctgctgaggcgttccac
-ttttattgagattcgttaacagaacggcggatgctttgactcgcgctgtttgttcaagcgcaaattttgacataattgtc
-aacggcaacggaaaagcagcataccaccggtttctaacaacatccccaaaaaatcaacgacaaaataccaccaatgtgga
-aagccccagcccagcccatgatacgcggctccagattattgcccgaaagcagattaatcgcagatatccgccagcaccag
-caacgcttcgtacgaagccattaaaacccagtacctgaagcgatagggggaattgccgcgaggactgaacaataattcgg
-gatgtaattaagcgcaaaggacagcaatcccagacaaaagcgaagcgaacattcgagtgcggcgagcatcgccaggcgac
-caggccggtgatgaatgctgatggctgttttcagcaccagataatgaaaacactgtcatcgacgtttgaattcgccgcca
-tcccttcaaccggacgcgccatcattttgctgaaatttttccggcaattgtggcacttcgagcagcataaacagccaccg
-tcagcgcaataaaaatattgatgacatggcattagataacttgcgtcaataagttgtgaggcaacgtatcgccgcgttgg
-atcatataatgcgccagctggtcactgagacggtgaatccctacgcgttgcaacaacggttcaaggcgcttttttgcacg
-gcgtcataaagagttgcataattgcggtctacgtcgcgtcaactcgttgagcgcggaacccagataagctaatagcaaca
-ccatcgcatgcacgaatgatggtcaatcaaaatcgaacacgcagtacacgcggcaacgcagcggccatgtgttggcacca
-gcaggttaagaataaagcaataaataatgcgagaataaacggcacgatgatctcaggcgcaaacggataccgagagaata
-ctgaaccagcaattcccaacataatgagatttttaggccattgagcgtgatgatcggctttgccatgcttgttcacgttt
-tttcttctttgcttataataatgtctttttcgctccgtcacctaacgaatcaaagccgctcaggtcaagaagtgaaatat
-tttgagttaattttttaagcttatgatacaaatcaggcgtgtttcaactacgaggacaattatcatccgcgatgacgaga
-agcaacactgcggataatttgtaatattatgggaaaattttgtttcaggacgttattttctacatttaccatcatttttt
-ttttttttttttcgtacctcatccacttatcttgctcgtaatggtggcagcactggcgcaaacgcgctttagtctttctt
-tctgcaaagcttgcgctatgcgcggggcttgacactttactttggtttcgctgaattagcagaaaattaaaataattcct
-ctgcagaaaaggagcaatgtatatttattggtttttattaggtctggctattgctacagaaattaccggtacgctgtcac
-tgaaagatgggcgagcgtcagtgagggaaatgggcggctttattttaatgctggtgatgatttctctgtcgtatatattt
-ctctctttcgccgttataaaaaatcgccttaggctagcttatgcgctgtggggaaggtatcggtattttatttattaccc
-ttgttttagcgttttggtattcgagcgaagttttatcgctgatgaaaattccgggtttaaccaccctggtcgccgggatt
-gtggttttgataaaatcaggtaccgtaagcgcgtaacctgaactggaggtgaaccatggccagtttgaatgggttcacgc
-cgcctggtggcatggcaatgtgctggaaatttgcgttgctaacgtctttttgaaattttctgacggtttcgtcgcaaaat
-atttggcttgctccctggcgggggtgctggctgctttagtgcgctttcttcaagcgggtttaaaggggatcgacttgttg
-tgcttatgcattgtggggcgggtttggtattgccagccacgttagccgcaggttgaaattttgttttggtcaacggttaa
-attcggtaaaaggcttggattggcctgtcttgctgtttggctggaatgctgcatggtggaaaacttgcctgatgaagacg
-ctgcccgcgctgtcggcagcgtttgaacattatttttgcgacagtctgatccagcttgtacgcgaaaaccggtacagaaa
-tggccggtttatcgggcgcgccagcgatcttcgcgggcaggagccgaacttttgcaccaattaattgccagccgtcatcg
-tatgcaacatcagagggcgaaccgctgtgaccggcggtatcgcactggatgtgacataccgacgtttgcgcccagccagt
-caacttacagttttttgatgactgtacaacgtatgagatgatcttcagggtagcctgcctgagtcacttttagactgcgc
-ttttaatgcggcgtaaggcggcttttatctccctcaaataaggcaaggcgtaatgcagaagggggttacgtagcaacaat
-caatccgaagtccacggcgcggctgcgggaggtacaatccaaccatcccatctgctttttaaacggctttcccagtgtcc
-gtgataaacggcggcttctatgtcccgtgtgatctcatagcggccaaagacctttatttgaagcacaaacgcaggctgca
-gctgctttatcggcttttaacctttggaggtgtaataaaccagtgtcctgccggttaatgccagattgggtgcaatcagc
-gtccgcgtatcataattgcgctggccgtttccagttgcccaccgcacccaacggtgattgggtcgtttgtcattcacttg
-gcaacgattatcatgaaccaaaaaacagggtgctgacctgcatcgtttgccgatctggcaacgtctggtttaatctgcaa
-aacacagcagacgtcaaactaattgacccacatacagcaatgttgtagcatatcacactctggtgggtaatttatgattt
-attaaaagcaaagcctcataaatataatagacgggacgggctgaaagtgggagtaaaatcagataactacaatcaggaaa
-gattaaaaacgggcggtaaatcagtgcgcataaaataaggatgatcagaatgaactcaaagcgataacggcccaccatac
-taccctccgctaaaggcggtgctaaacgttacctcgcttaggcacgtattttcaggcgcgagggggcgcgccagcaatta
-ctgttgaaaacttacgctgcgggttggtgcagcaggttttgccggttgctggatggctgtgtttctttggcgtgttcttc
-gctgcctgcgctttttgtttcagggcttttactgttgcagctttcgttatttttatgatgctttttaagccgcctgcgtt
-ttctgggcaggtgctgctttaatgctgttcttttagatgtgtagttttcgccggcgcttgctttggtggtcgtcgcagtc
-ggagcggtgtggtcgtagtctcttgcagcaaaaaggccggaaagacagacccatagcagcggcaacaaccagagctaata
-cttttttttcattgtcattacccctcaatttgttttttcattaacccactgcggggccgttgaaataactaatatttccc
-tgggaatggcagacttccgtgagtggttggttttcagcgtgtacgatattgtaaataacgctgaataaattacagcgttg
-ataataacgtaattgtgacttaagggaaaaaatttagcttacgcataatagtagtctttgatcgggtaactatttttact
-tataatttaaaagcagtagaataaactgcgatacataataaatgacacacagcaaaatgaatccgtttatttgggtactt
-ataatccgatgacgctagacggctgcggggaaattgggcctggcgctttcgtctattttaggattgggcctattacgttg
-gtttgagctggcataagtccggacgggtatttacgcagtccggaactttatttttcaaggcgtgcagagacgatgccaaa
-cgcgtcccgacagcagagcaaatgaccaggcatcagagcaataaatgcgggccgacgccgttcagccatagttatgccag
-aaaacaccaccgcgttcccggcaatactgcgatccagatagtactgaagcagatacaggaggacgggcctggctttagcg
-cgttttgcgcgggggcggatccagctgctgtactgagtgggctgcgaagaatctgctagaagagtaaattccggcaaaga
-tcagccacaagcgagctgaataaggtcatcaggtaaaccaaaacattcataaacccgtgaaaacaacatcactggacacc
-gcccatagcgggtggtcatggttgggctttgggtggctccaatgtccgggtcaaataagccaagcgataataagccaaca
-cgggggcctgactgacatgcaggtgggagagcatcaacgatagccgatgtaattaacagcgtgacgaacggaccccatcc
-gcaaaaagccttctgcagacaataacggtaatctccggtcccgctagtgcagacgaaagttgagtaaacaacgtcttagg
-gcgcagcgaagtcgggcgaacatggcgtgattttcagggaggattttccaagaacgatcaacgccgaggccagcggcgaa
-acaaccgattgccgccagatgcaattcgccagttgaaaaaagtccgtgaagacaccgctaattaaggtcgctcatgccgc
-caatttgagttgccgcttgatatacaaccccattgaaaaggccacggcaaactggatggatttcctcgctaagaataagt
-catgccaacagctgcacgcgcacttaaacgaaagcaatcaaggcgcgcataatcaaaatgccgtgccagctggttcgatc
-attgtcgaaagtaaacggtacaaaatggaggcaacagtaggcgcacgtgacgcatcactgtttgcgaccaatggcaatcg
-gatagccgggcagtaaacagcaaaccaatagccaacatcgcgtggaaatggaagtgaaattactactgttcgcgggggtt
-taagcaaactcctgcgaagcacaggaagcgatagcctgcacacaatagagaagtgcaaatgtttgccagtccggcagaga
-acagcgccaggggtgagcgcataaattgcggcgtacgcgttaataatatttgattttggctgagaaatgcttttggcttg
-ttcagtgtcgcttgcgcggagcgcatcaacagttgtatacggctacgttgaaatcttgctaatatgcctgtagagtcagg
-ctttattacatagggtaggaaaatcgcattgttcctgttctatatattaataatctcaataagaatgttttaaatatgaa
-tatttgaacttcgtcatctgcgttacttttgttgctgttgcggaagagctgcaatttcggggcgccgctgcccgcttgaa
-tatttcgcaacgcgctaagtcagcagaattaggccgctggagcaacaaattggtgccggcgactgctgggcacgaaacaa
-tcgcagtgtattgctgacggcagcatggaaaacagtttcttgcagattagtcgaaatctgttctatgtggtgagctgctg
-cggcgttcgagctgaaggctgcatcaagggtgaagcgggggagttgcgcttggttttacttcggtcggtcctttttattc
-gggcggttgtccgatacgttatcgctgtttcgccgtgatttatcctgatgtccatttacaaaccgcgaaaatgaacactc
-gcgagcaaatcgctcgcttcattgaaggaacgcttggaatatggattgctgcgtgaacaacagcgttacgcggagttccg
-gcttgaacacgcagtcatcgtcatgaaaccgcttatggcgatgatctctccgacgatcatcccctggcaaataacccgaa
-tgtaacgctggctgaactggcgaaagaacctgttgttctttttttgatccgcaaacgttcgggagcagggctgtatgacg
-atattctcgggcctgaactgcgacgtttaccatttgacgcccgtcatcaactcaggaggtgggcgaggcaatgaccaatc
-atgcggtctgggttttccgccggtctgggtgtttcatttattttgcctgcgtcatttaaagtgttcaggctcaccagaaa
-tgcgctggctgccgattgctgacgaggatgcggtttctgccaaatggtggttggtctggccgaaacatcatgacaaagtc
-cggctgcgcgttaactttcgttattcatctgctgaatgctctcagttgagggacatttcaggaaaaagcccgaaaaatgt
-gctgttaatcacatgctaaggtaaaattttgacgacacgtattgaagtgcttcacattagccttcagattatttcggagc
-gcgagaatatagggagtatgggtgttgctgaaaacagcagcctgggccattgatcaattagcagaccaacgcgggcgcgg
-tttatcgctgattgatcaggttggttccagtctccgcgtatcggatctttccgtctggcgcactggctctgcgcagtaat
-cactaaaattgtccgtgagatgctcgaagcacactggtcgcaagagctggaatcaaagaagcggggaactgtggcgtccg
-gcggtgggggctggtggttgaaatgaagcctggcactatctttctctgcgccttagtcgcgggagatttttccttgctct
-gcgcgatctgagcgcaaactggtgtggaagagttcgcacggaactggcgttaaaagatgacttgccacttgctggatcgt
-attttatttccccatatcgatcagtttttttattccgccaccccgaaaaaacttgagcgtctaacttcgattgcataacc
-ttgccgggaattattgatacggaaaatggtattgtaacatcgcaatgcgttctaacgaggatgtaaagagatgccgctcg
-ggcgcaggcgtctggaggcagcataccggcgttccggtttctattcagcatgatatcagcgcaatggaacgatggcagag
-gccttgtttggtgcctagcgggggcgcggatgtgatttcaggtggttatcgatctcacatacgtgggggcgggcggtcat
-tccgatggtcatctgtaacacgaggcaggcagtagtctcgtgggaaatagggcacacaacaaggtcgacccgtatgggaa
-acgctgtttattgcgggaaatcactgggctgcctcgaacctcgcagcggtggacagtatttcttgaggctggcacagctg
-cgtcttaatcaatccatgagcctcgatgttacatggacaaccgttaaccgtggactcatttgtggtcaggcggcattgcg
-cggcgctctactcggcaaaagaccatcattacggggtgggcgcgcatgtcgggcgcattcttgccatcatggtggaattt
-atttaacccacaaaaaatactggattggcttccaccgtttagtaagcggcagatatcctcttcccgtcatctagacagat
-cgtcagcaggcccttcctggcgtatagtcagcacatcagcgttgagagtactcagtttttctaaccaggcaacgatggca
-ggcgctgcactggtaaaagacgcgatgtataacggttctttgtttgattcgtctgttgcagggtttaacaattttttaac
-tgttcttacaaaatttgcgctatctcaatt
->m141013_011508_sherri_c100709962550000001823135904221533_s1_p0/285/21916_24474 RQ=0.859
-attgagatagcgcaaattttggtagaaacagttaaaaaatgttaacctgcaaaagacgcataacaaagaaaccgttatac
-atcgcggtctttttaccagttgcaggcctgccatcggtggcctggttagaaaaactagtacttctcacgctgatgtggct
-gactatacgcaggaagggctgctgacggatgctgtctgagatgaccgggaagaggatatctgccgctttccttaacggtg
-agccaatcagtattttttttgtgggttaaataaattcacatgattggcaagaatgcgcgcgacatgcgcgcccacccggt
-atgatgttcttttgccagtagatcgccgcgcaatgcgtcctgacacaatgaggtccacggttaacggttgtccatgtaac
-atcgagctcatggttggtattaagagcagtgtgcagctcaagaataactgtccgcacgctggcgatggtttcggaggcag
-ccgtgcattcgcaataatcagcgttttccataccgggtcgacctgtgtgtggctatttccgacgagactactgctgctgc
-gtgttaggcagatgaccatcggtaatgacgcccgcccccacgtttgttgatcgataaccccccctgaatcacatcgcgcg
-cccgcgtgaggcaaccaaacaaggctctgccctcgtccatgcggctgatatcatgctggaattataaaccggaacgccgt
-tatgctgctccagccgcctcgccgagcggctatctcttttacctcctcgtagaacggctctgcgattgtccaatacattt
-tccgtatcaataattcccggcaaggttatggccaatcgaagttagacgctcaagttttttctggtggcggataaaaaact
-gatcgactatgggaaataatacgatccagcaatgcaagttcatctttttaacgccagttcctgcgaactcttcacaccag
-tttgctgggctcagatcgcgcagaggcaaggaaaatctgccccgcgactatgcgcagagaaagatagtgccatggggggg
-gggggcttcagtttcacacacctatcgccccgccgacggccacggttcccgttctttgatttccagctcttgcaccaggt
-gtgcttcgagcatctcacggaacatttttagtgtactgggcagggaagccagttggccagacgggaaaagatcgatagcg
-agactggacccaagcttgctcaataggcgataaaccgcgcgcctcatggcgttggtctgctttttttgactcatgtgcca
-ggctggttttcagcaacacgcgcatactccctatattttcggcgctccgaaattaatcttgtaggctatggtgaagcctt
-aatacgtgtcgtcactttttacttaggcatgtgaatttaaagcacattttcgggcttttcgctgaaatttgcctctacct
-gagagcattcagccagatgaatacgacagttacgcgcagcggactttgttctgatgtttcgagccaggaccaaccacatt
-tcagaaaccgatcctcttcaggaatcggcacgcagcgcattttcgttgagctgaacagtttaaatgacgcaggcaaaatt
-gaacaccagaccggcggaaaccagaccgatgattggtcattgcctcgcccacctcctgagtgatgacgggcgtcaaatgg
-taagtcgcactcagcccgagaatatcgtcatacagcctgtcccgacgtggcggtcaaaaaagacaaaggttcttttcgca
-gttcagccagcgttccattcggttatttgccaggggtatgatcgtgcgggaatcatcgggccataagcggtttcatggac
-gatgatgcgtgttcaagcgactccggtaacgctgtgttagcgccggcaatcccatatcgcaggttgccttcaatgagcgg
-agccgatttgctcggcgagtgttcctttcgcggggtttgtaaatgggatcatcaggataatcacggcgaaacagcgataa
-cgtatcggacaccgcccgataaaagggagtcgtgttacgaagtaaaacaaatgcgaactcccccgcttcaccctgatgca
-gctttcagcggagcggcagcgtcatcaccatagacaggattttggccgactatctgcaagaaactgttttttcctgctgc
-gtagcaatacactgcgattggttcgtgccagccagtcggcaccaatttgtttgctccagcgctgaatctgctgacttagc
-ggcgggttgccgaactttcagtgcgggcagcgggcgcgccgaatgcagcctcttccgcacagcacaaagtaacgcagatg
-aacgaaagttcaatattcatatttaacaacatttatttgagaattattatatattagacagaacaattcgattttttcct
-accctatgtaataagcctgatctacaggcatatttagcaaggatttcaagtgaggcgtaactacaactgttgatggcgct
-cgcaagcgacactgacaagcaaagcaatttctcagccaaatgcaaatttaattaaccgcggtatcgccgcaatttatg
->m141013_011508_sherri_c100709962550000001823135904221533_s1_p0/324/388_18213 RQ=0.872
-cgcgcggcagaatatttgcggtactttcaacagaaaaactcacgcagcataccgcgtcaacaggccctgacgcagaccat
-taacatggggtaccgccctgcatccggttgggattaaggttgacgtagctttccgtcagcagttcaccgccgttccggca
-ggccacagtagcgccagtcgacagcagcttcagtatcaccagccgaaattagctcggataaacggttttttttcggcagc
-gtcggcagacattttactgcttccttcaggtaagatgacaatttcaaggaacgtcccgtcgatgaccagcgtatgttttc
-ggtatgtgttgaatcttcatctttaaaagtgatctcaacgcaagggcacaataccgctttggtttcagcacatgagtcag
-gcgtgaaacaggaaaatcgcgggctgtcaaagaaggtttcatcccgcagaagtgcacactggtacagtaattcggcccgt
-ttttttaccgcaagtggcgacaacctgttaaaatcctgccttttcgccattttcaaaggcgatgttataaagaactggac
-catcgcggcgcacgttaacttctcacgcggcttgtcgacagggcgttttaacacatcgcgaaatcccccgccatgcaggc
-cgccagagaatggtaatttttgttagagcctttaccgctgcattgcagacgggcaaagagaatcagttcaaacgccgtac
-accctcttcccgggtgaatatccaccggcatccgcgccacatcgtcataattctaacgaatggtcaggcatgtaaatgaa
-cgtcacgcgttttgcgtgaccgcgcagtgcttcagtccacactgttatctaatgaccttctttgccccaaatggttaggg
-cgagtggtatcggtatacatcccggacggcggcgaaccggctcaagcccggtgagtaccttcaatggcatccagcgtata
-agtttgcgtcatggttttcagttagtaattcgagtttgaatcgtcagcgataggttcaggaccaagaaaatgagatcggt
-tagaaataatcttcgaagccgtgaatgcgtggttgccgggcctctatgacagtctggcggcaggaagcgtagtaaaacgc
-caccgcctggggtaaatcagcactcatctccgtctgtttgcagcagccagaagtcaaatccgcgcgcttccagcgggtca
-atctgcaatgacttaagatcgtaaatatggctgtgactctagcacatattgctgcccgtgtaggggttctcgttctgacg
-cgagattagtcgtcagcagttcaaacgggcgccaccgcggtttaccaccatggggcagcataaaacatgtggacaaccag
-gtggcgtaagatatccccctatgacgaacgcgcaatacccagcgaatgcacacagccatgttccaggacaatggattcca
-gcagctctgccgcgtcggaaaggcttacggcggcaaactgcggaatgatcatgtcaacgttcagggtgatgttccgcagc
-cagtttttgtaacaagctcgcttttggcagagcgccggcgagagctgcttgaaaccgtgtaaataaagaagcgtagcatc
-agtacaagctctctgacgcggtatcagtggaacgtgtggtccgcgcaggcgatgcagcctcggtggtcaggtcggtgcca
-tcagaaatgtactcgagagtacgtgccagccgggcgcggatggtatcgcacgcgtaaagttggaacaggtgcggcttaaa
-acttgcacacaagggtcgacggtgccagcaggcggccgaccattccagtcgatgatcctagctctgatgaatatgaacgc
-aacagcaagttttgaagtgcggaaactttcgcacatgcacggtatccagttcgctcgtccccgcccggggtttacgcaga
-cgtgttgtatcggcaacctacaacccgcgagggtagcggatgatgatggcatgagcagcaacggtaatggcgttcctttg
-gcgcatacggccagtttacgttttccagccactcaagctgaaactcgctagctcaccgtgcggcagcttccaaaacacct
-gggctattccaggcaacaggattggcattgctcacccaataaacccggcggcttacgcaccggggagatacccgcatcct
-ggtaaaacgcgctgtacatcgcgggcatggaaatcgtggttgcccggcagccagtacgcagggcgcacgaaacttgcgat
-tggcttcagcgacatgctgataggcgcagaggattgatcctgcgactaaatcacctgtcgcgacaatcaggttcgaattg
-tgctggttgtggccggaatcgcctccacaccgcctggtaactctcaggtgtttaccgccacacagggcttcgtgcttttt
-gtgcaaacaggtgagtgtcggtaatttgtaaaatctgatctggctcacagccagaggaaggttaacaggctttccaatgg
-tgtcttaggtttccgacgctaataaaccggaatcgccatcgctgccatgtgcttaaaacagtatcgaaccagtccgcgct
-aaaaactgattaatttgaaatgcttttcgtgcgcgttgaatgcaacttttttattaggataatcataccgcgctttgaag
-cgaaaaattctgcttggcttgaacacacttcagccaccatcgcgtcatgatagcagacgcaccgtcattgacggaaggct
-ccagtaactgatgcgcgggcgcagtgctgttctattgtcacagggtagtgtttcgggtcgattccaccaatcgtcagccg
-atattgttggcgtttgccaaccatgatagctttacagtttcgccgggtgcggtcattgccgcggtaacaaacggcgcaaa
-ttgtgaaagttcattctcgcaacgagcgcgcaaatcatttcaggaatcaggtggtggtaccgcttcaatttatgcccact
-cattttgttaagcttgatgatgcgcttgcaagcagattgcaagcgatgaccgacgctgcgttgtcgattttccctcttac
-tacccactggtatgcctgttcggctttacacatgaagccgaatatcttcgttttccatcacagaccgtgaataccggctt
-gcggtgcgtgggcgtccacttcgccaccataatttgacgaacgctcactggtgcccccggctttgccaggaaacttaaca
-ccgttttggtcacgttttgactatcagtcccgctcttccatcgcttcgcgacgggcaacatcttccacatttcaacctct
-tcatcaatgaccggccaaccatctcgccagtagccaagggggtttcgctggttgtcgttacgcggcaatccgaatctgct
-caatcagcacatacttcatcacgccactgggtcaaagggtagcaagactgcggcgtgaccgcgctcaaaaatttcccgcc
-gcagctcatgactttcctttgccccgttgatagacgattgacgacaatctagtaaagaatctaatgaaaaaaagccgcga
-taaagttgttttcgtgcaataatttctacaatcgtttttggcaaatgtaacgggcaggttgtctggcttaagcattgtta
-actggtctggcactaatagtgaaattaaattgtgaaatttcagcgacgtttgactgccggtttgcggccatgtctcagtg
-gtttaattgaggcacattaacgccctatggacgtaacggccaacccccccttttgcggtagggctttctgctagaaatcc
-gcataattttacagttttgatcgcgctaaaatactgcttcaccccaaggaatgcaaatggaagaatttgggctccccttc
-ttatcggcctgagcctttctgggttcagtttcgttgagccaggccgatgaacactgatgcaagtttatcagcaagcacgc
-ttagtaacccggacttgcgtaagtctggcggcgccgattcgtgatgctcgcctttgaaaaaattaatgaagcgcgcagtc
-cattactggccaccagctaggtttaaggttgcagattacacctatagcaacggctacctgcgacgcgaacggcatcaact
-taaccgcgacagtgcgctccttgcagttaacctcaatccattttttgatattcgaaattggccgtgcgttacgctgcaag
-tgaaaaagcagagggattacaggaacgtcacgttaatcaggacgcgatcagaagaaaccttgatgctcaacaccgcgagg
-gcttatttcaacgtgtgaatgctattgacgtttttcctatacacaggcaacaaaagaagcgatctaccgtcaattagact
-caaaccacccctccacgttttaaccgtgggctggtagcgatcaaaccgacgtgggcagaactgcccgcgcatatcgtaga
-tacgtgctggcgaaatcgaagtggcgcgcacgaagtataacacatctgataacgcggtagagcagctgcgccagatcaca
-cggtaaactactatcgcggaaactggctgcgctgaattcgtaacaactgttaaaaccgacaaaccacagccggttaacgc
-gctgctgaaagaagctcggaaaacgcaacctgctcagatgctgatgtactgcaggcacgcttgaggccaggactggcgcg
-cgagcaattcgccaggcgcaggatggtattaccgactctggattttaaacggcttctaccggggatttctgaacctctta
-tagcggttcgaaacccgtggtgccgctggtaaccagtatgacgaatagcaatagtgggccagaacaaagttggcctgagc
-ttctcgctgccgatttatcagggcggaaatggttaactcgcaggtgaaacaggcaccgtaaaactttgtcggtgccagac
-gagcaactggaaagtgcctatcgtagcgtcgtgctaagaccgtgcgttcactcttcaacaacattaatgcatctatcagt
-agcattaacgcctacaaactaagccgtagtttttccgctcaagctcaattagacgcgatggaaagcgggctactcgagtc
-ggtacggtaccatttgtttgatgtgttggatggcgaccaccaaagttgtagcaacgccaagcaagagctggccgaatgcg
-cgttataagctaccgtgattaattcagctgaatattaagtccgctctgggtaacgttgaacaaggcagatcttgctggac
-tgaacaatgcgcgctggcgcaaagccggtttcactaatccggaaaaacgttgcacgcaaacgccgaaccagaaatgctaa
-ttgctgatggttatgcgcctgattagccgcggcacagcgtttcagcaaacatccgcacgcactaccaccagtaacgtcat
-aacgctttcgtaactgatgacgacgaacggggcttgcggccaccgtctgaacgtcaggcaacgtaaagatacggttaatc
-tgcgcattcttccccttctcggttcaatttccgacgcgcatccctctcattcttgatgggtatttccgcccactggtccc
-gggaagacaaaaatgaaacgcggacaaaatccatacgccacgattttgttcccgcaaaaagcgtggatgcgcacgccaat
-ctgacacccatcgctttctcggcggttgcactgtttttatgctggctggctggtgaaaatagagtgatgaaacagtggtg
-ctctctatcagatgctgacgatctgttcagactgcaaacccaggcaaaaagcgccgaatgtgaccaccggcgtacacaat
-gcgctgaaagaagcgaacgtactgcgccgaatacgccacgtgagactgtgtttgcttgaaatttggtgaaggtcaagtgc
-cagcaggcaagccagctggatggcacatagaaaaccaggcgcaggcccagcaatccagcgggagtttctgggatgcgctg
-atggccgcggttacatgatggcgtctgatggggcggctggcggcggggatttgcaacagcagccgctgttctctgcctcg
-aaaaacgcagccagtccggcttacggtaaaatatacgacgcgacgggtaaaactatggcggcagccccagccaggcccgc
-aaccaatgaccgttacgcgaagaacgcaatggcaccaaaaccgcgacaccactaccgttaccgtggcggttttggtgaat
-ctgttgccgaaacacaagctatgcagcgtagtgcacggtaccattcttctgcgttgaatggtggcctgataaaccgatgg
-aaaagagtcagtaattaccggcgccctgcctggcgtgagaaagcccacgaatcggttttcaattttcacaccatgtacgg
-cgagccgtactggtgtgaagatgcttactaaagttgaccctcgcccaggttggaaaagctggaaagaagtcaccgccgaa
-ctgcacaatgtgcctgaaagtggtggaaaaagtgatcgccagcgatgagctgatgaccaaattccggcattccaaaacac
-acctggaagttttgtgtcgcagtcatggctgaacgcaatcagccatcgctttattcgcgtcttgattctgggcgtgggat
-ggcactgggtgaacctaaacttcttcggaaaataacgccgatacgccaacgtccactataagcgaggcggcgttctttgc
-agtggaatctggactggaagatcagctttaaacgccggtaacttgcggagggcagcggacgcagtttaacagtctgcaag
-aaaaactgatcgatcgctttcgttgagctgcgtgaactagtatggcttccagttgctgcatctcacctcttgtcgcgaca
-accggtggaagactgggaaccattcaggtatttgcaggactgcgcaacggaagctgagattgctactgagttcctctaca
-tcgatgatatcgggttaggtgaaaaggtcagtcacgaatttacagatcaggtaatttccaaagctgttcaaaccttgggg
-gggggtaatccgtgggaattttatgttggcgtgagatgttctcaaccaagctggaggatgcaggctacctggcttggaac
-cggcgtggaagaaggcattatctccaacggcacttctaaaccgctaactggtgggagatgttccgaaatcaccccgaacc
-ttgctgcccgcttattttgcggaagatgaaatcatccgcaatggaaaactatgttggtttaaaaccgatcttctcccgtg
-aaggcgcaaacagtgtcgatcattgagtaacggctaaaaaaccttgaatgcacggaaaggtccgtatgttgcgaagaagg
-ggaatgattgttcagcaattccaccgttaatacggcgtagataattcggcgacaatgcatgatgctgattgggtaagctg
-gctggtgaacgatcaacctgcggaattggcattgccggtgagagacggtgcaatgatgatcacgctcggatatagttcgg
-tttttatccacgatatttttggtttgaaataagacgataccggatggcactcgtcgatgcgcggttaattgttagcctat
-ctgcaccgacgaatactcaaggctgccatttctataccctcacgaatatggtaagttggctctcgccgcatcccacggca
-actaaacatacagtatagatacaggcaaattagggatgcctcgtggcgttttggggttttcgataacgtgccacgttcat
-ggtcgaaggtaattcaaccagaggatgttgttttgctggcccttgccacggtcagaattcgcttttttcacatagctctt
-aaacgacgtcggcccacgagatcacgggttgaactatcacgtgcactttcactgtgcgcaggttatgcaccacgttagct
-ggcgacgcaacattattccttcatctcggcaagcgctgccaagttgttgcgccaatttcgaaatggccaggcgcaggttt
-tgctactcgtccagatactacaacctgcaccatcgggatatcagcgtcaggatacatcttatatcagcacgccccacgag
-gccgtggtcaaagcccagcttctttatccagcgtcaccgggatcggcgctaaacagctcaaaaccagacgctgtgccagc
-cgccaggcgaaccggaggcaggataatgcgtatcgacagcgcctgcgggaagcaccaaagtccataaatccgtgggccgg
-cgactccatcgggttcaatcctgttttccacgggtaaaggccagtgagccgaaaccacacaatcgcttgcgggcgtggca
-atgtcatccccacttctgccagctgcgggtataggtacaaattatcttccagccgttcatgcggacaccgtgctaaaaac
-aatgctggcgataggtgttgaagactgatgatctccttaacaaagcgtgtccattttgattatcctcacaataggcttgt
-ttcggcggagtaagaccccggataacaatgatgatgatcatcattattttgaaacgatctgcctgaagtgaaggatttat
-aaggagttgtcgatgtcaagtacctctcattctgaccagtactggcgggggaagcgctacgatggtggtattggctgggt
-tttctcgcgtttctcggggacaaaatacctcgaaccgcttagcttagcgtttttcgactagggttttagcacggcgcggg
-ggatcttgtttggagctcagatgctcattaatggaaatgcttccttgccgctagcagctgaaggaaatgtcgcctgtgtt
-gggttatcggaatgttttattcttcggtctgcttggctattttggcctggacgcgcatgttgctactattgctcatcgca
-ggatttaaatgcaaaaactcggtgcagccgttgcaaaatcgatcaagcgcacagcccatttctgctcactgctcggcaat
-ccaggttctgtcataacttccccggaagtggattggccactttgtcacggcgagcagcaacctggagctgggattggcat
-cggcactgccgtcgcgttgcagcaaatatcctgaggtccctggcagtggcagggacgccggttatatgtcgggccagtag
-ggggtcctaaacgtaccgagtcgattctgtgggcggggatttctggacttagcgagaaattcttggtgggtggtgctggc
-gtggttaatcctcggttagcaatgatttcccggtggtttcatgggggcaatcatggcggggcggttgcaggaattatggt
-ggcgtctctcggttgaatgattaatgcgctcgccaaagaattgacctaataataaccccagctatggcgtacttagtgtg
-aagatgtcagtgatgggattcagtttttagtcgctgtacaacggcgggaatgattggtttaaacaactcagaagttgtcc
-agcgcatggacaactttctgccagctttcccgaaagccttattctaccttttttcgggctgtctctttcactcgtactgt
-ttaagtatttgttccgcgctttcaagcagtgcgtcctctgtcctggcgaaaacgcccgacaataagtttcaaatgcagga
-ataacccaccacaaccagagcaatcatacaatccagtacccaggcgataaacatccttttacttaatatttaacaatact
-aaacatttagcgtataaatttcacatatcctttttcggatctagtgtcatatggtgcaataataacgaacaattataatg
-attttttgatcataatgaaaagatagctgatattaatgaaatttttctcaaatagaaagagaagcggaattaagcatcgt
-tgcatagcaggaaaataaaaacgaagcctgctacacacttcgggtttcttgattgaaggcagtaattaaggcagcggttt
-tcagctgggctttacgctcatgtgcctgatcgtaatgccagggtcttcaatagtcgagcgccatattgtgttttatttgg
-caaacgtcaataccctctggtgcacgcgccatcgtgccatcgtcattagtcagctcacaacagtacacagccgtttaaag
-cctgcagcgtctcagaatcaaatagttgcttttcagtatgaaccgccacgcgtcagtacaccacctgcctgagcgcgagt
-ggaaaacgtggccaggacgattcagatgctgacggttttgcgcatcggcaatcgctgcgcgaacggtcgtaatacggtca
-gcgcagaaacaccggttagtcacaccttccgctgctcaatggtcacggtaaaacggttgcataggcgctggtgttatttt
-ctacatcattggcagatcgagttgtttacggcgatttcagtatgcacaggcaaacaatatcgctaccgtggcgaatggtc
-agcgccatctgccccctccttttttcaaaaaccagttcatgggggttttttctgcccgggaaaaaaaaaaggaaaaatca
-tatcaacttcgttttcacggcttccatcatcagcacattacaccagcgtccttcacgcagcgcagcgtgctttttcacac
-gttcgaaaggcgtacaaaaggaggaaagtagcgtctgattcatggtaaaaaaaaacctcactaaaaatttatggttacca
-aatcaggggcagtcttaggagtggcggcaaaatagtagccaaatacgatgaggggtccatgaccgacagaatcgttactc
-tctccatcggactctaccgtcgccggaattacccggagtctgctgtctttgaagttgcacgccaaagcgctcgcggcttc
-aactgagttgatttacgccggtgggaatttcgccccgcccctgagaataagcggattcactataacgctaatgattagcg
-cagcaacggcaatagcttcacataattctggtttatgccttaccttatcgcactagcaatggcaactcaagcacctatca
-gtacgggaaagctaaatgattgaccgaaaaaaattggcaacatcgctcgcaggttcacgaatcacatgctaaaggactca
-gggagcttttcgggaagatgtggagaaaaaatccgccaacctacaagcggcagctgacgcgctcgaccttcgtaagccgt
-gaagagttcgacgtcaaacgcaaatgtcctggttacggctcgtggaaacagctggcgctgcttgaacaaagaatcagcga
-actggaaaatcgcagtactggatgataaaaaggcagccagatccagagactctcacccaaagctgtaaacattcgtttta
-atggcactgtaaaatattgaattaatcctctaatttatagtgctttctattacttatcgcgtatcccattcgaaaaccat
-cgacaaaatgaaatgagtacaatgaaagtataattgcatgtattttttttaagttttacttcctgatatttcgataaact
-aattttataaaaaacacaaataaaatatcatatttcaatgattaagtagtgccttaaataaccgttactaatcattctct
-tattctactttctttatataaagggaatatgtatgtccgcttaaaaagtacttctttgttgctgcgtcgcaatgattctt
-tccaaataagtgtttgctgatgaaggtcacggtaattgttaaatttaaaggatgaagtttatctctgcttccatgttctt
-taaaccaggtgacgagatgttaaactgtaaatctggtgaagtagcaatacgtaatgaaaagcgatcagaaatcctttggc
-tgaacctttgcactattcacctgcaggactgcttgctgaggttcagggtggactgacttattcaaaagcgaaggtttact
-ttcactacaagcataccaatgacgggtcagtcctgatcttctgaaaatacaaagaactgaaatcgcggcgccactggcgt
-tggcgtacgtattctggacagccagaagcggcgaagtgaactttaggtactcgttagtaatttacgttcaacataccaac
-agctatcaggaactgaattttcaaagctcgttatggaatcccaagcataagaattgccaccccgggcaacgtttacgctc
-aggctgactacaagattgcttacgagtaatcgcatttggccgggttcgccgccacatcaattaacggattaatttttata
-gtggatcagatgtataaaaaattaaaattaaccacaatagcggaattgattaaaaattattttattgttcattatcccgt
-ttattagactggcccctgaatctcagacaaccaatatcaacttaaataagtgattagtccttaatactcagtttttagac
-tagtcattgagaacagatgcttgatgtctttaggcggagaaacgcagacgcgtaaccacacaggaaaagatcgcaattgt
-tcagcagagctttgaaccggggatgacggtcctcctcgttgccggcaaacatgggttgtagcagcagccagtttattttc
-tcgtggcgtgaaagcaataccaggaagcaagtgctatggtgtcgttgccgccggagaaagttgtttctgctctgaaactg
-ctgcgcctgaagcaagattaaagaactcagcgcctgctgggcagaacacgatggaaaatgaactctcaagagccgttgaa
-tatggacgggcaaaaaagtggatagcgcacgcgcccttattgccgggatggggagtaagcttagtcagccgttgtctccg
-ggtgtcgagtgccgagttggcacgtcattctcagaacgaaccgatgactggatggatggccgccgcagtcgtcacactga
-tgatagcggagtgcttctccgtatacaccatgttatcggagagctgccacgtatgcgttatcgtcggatgggcgctgctt
-cgcagacagcagagctttgatggtatgctgcgatcaatgccgaacgtgttttacccggatcatgcgccagaatgcgctgt
-tgcttgaggaaagcctgctgtacgccatcgaaacggggcagatacagggcagagtgcggtgaaagaaagcaaatcagcga
-tggtgctctgacggttcgagtttctgctgtgataacggaggagagactggcgtgtcacgttcgcgctggatgctgtgatc
-gtgagcacgtgcgactgggcggtactacggcgggcttcaacagtgaaacagtacagggaacgtcaatgctgggagcggtg
-aacgcgtcttcggcaacgatctttcgtcgtcctcattggcgtggctgacgataatggttcatgctacggggctaatgaaa
-cacgccagttcgcccggtgttgggactttgaacgaagaacacggcgtggcggaggtccggagagtaaggaatagtgcaag
-agagctgtcgtgaaaacgataagcgtgactacatcagtatcatgccaacagacgcggtgttaacggcagcaaagaacgct
-ttgcagagaggcccgttcgcgattaatagacgaatggcatccgcaatagtgcgctggtatcgctcgcccaccgggatagt
-gcggcaggggcatgtaatgggttttaagtgatgaacagatgtctggaaatatagggggtcaaatccagttatcacattgg
-ttgtgcgtcagttatgccgttgaattgcaccagatagatttaatcgaagccgagagatcgtggaaaacgtttaactttgc
-cgcaatttgaactgatggcgcaattacccgtcggcgaaatattcataagcaatcactgattaataataagcggaacgcca
-atccaccttgaacctgcaatgggtattaattgataagcaaactgcagtttgcgtgaaagagcaattaacattattaggat
-ttactgatgaatttattgaaaaatcagcaaaactgatcgatggttgttacctatgaaaaagaaaaacaattacaacttat
-tcgataaagggaaatgcaattatccatatctgcactcaggcatggttaaaatacaaagattgcaaactggacgctcctga
-ctttgaaatgcatggtattgctggggcatttcttgactacaattttatatgctctcattatgcaccactcaggggcgatt
-aattcgcaaatataagttctatggcagctggggttaatcttggggcctggcgcctgcggtatgattacaggtacgatcag
-tcattaaccaaatggcaaagccaggcgacgaacctggattttcgcgcgtatttatttgtttcgccaatccgtcaatgaat
-ggcaaaataactataggtcaatacgatactgaatcctctattttcgactcttttcattttctggcatttcgttgaaaagc
-gatgagaatatgtttaccgccagactaccgtggtttacgccaaccgcaaatacgggtgttcgcacaaacgaattgcaaag
-tcactgtctcacagacaacgtaattatttatcaagaaatgttctcccaggcatttgctattacaatttattcaatacatt
-acaggggcacttgacgtcaagggtgaagaaagaggacggacgcgttacgcaatgggcaagttgctctaatagtattccta
-ctgacgcgtaaaggcagattcgctacaccactgctatgggtaaccgaccagcgttggtggtgattccttaaacaaccctt
-ctttctggactggtgaaattctcatggggttggcttgacaatgtatccctgttggtggttcgttttaacaaaccgtggat
-tatcaatctctggcttgccggcgtttggttttaatttaactcattaggtttcattatcttttgatgtcacatgcgattga
-tgctcagttgcgagtaatcaggataaagaacgggttattagctccgcgctaactttcaaaacgttttgaatctacgtagc
-cagctcactttcgctggttaccgttattctctgataaaaactttgtgacaatgatgaatatatcaatgacactacccatt
-acaagcggaattatcagaatgaaaagagagttttatgtcacgtttaaaccagttcttgaatcattaggggttaaatacat
-acgtaagttggctcgtaatacttactgggagcagcagtaatgtgaatatattatttatcacttagcgcggattttgatat
-cgggccattaaaaaacgtctccacttcgtgctaacatttagccgaagtaactgggaagaagacaacaggatcaactgtac
-ctaaatattttcgattcctggggaactagtagaaattgagcttggtatgcaacgacatcagataatgagattttgcatac
-tggcttcgtggtatggactcttccgatcgaaataattcctggagcgttttctgccttcaggcgacaatgatgattcaaat
-gatatgaaagcgtcactacgcgccagttttatagcataataccgagaacggtcgactccctctcgcggtaacatcacagc
-gagacagcttatttcactttctcgaatgccaggttggaatggttcattcactgcgactcgccacggtgcgcgctttccac
-gactatacggtaggtgctgactggtcgcgttttatgatcgacgcagacgcactgacgattattccgtttgacaataaacg
-cgccgggtaacgtaatcggtatggcatctgagttatcatcagtcagcagtttacataaaacatcattaagtgttgatacc
-cgaaatctgccagaaaatgtggatatcggaaaactgtttatcaccacacctaacgaggtgctattgctacgccaaacttg
-ataccgcagggctaccaatcataggggttattcagctgggaaaaaaacaaaggcaaacaaaaagaaaaaaaaaaaaaaca
-gaacagatggttagtcatccaccactgggatttagcgtaaaagatgaaaccagcacaaagattaggactggtttcgctga
-tggcggctttgtataccttcaacgggcattcaaggaatgaattaaaaacttgcttttacgctggggtgaaatcttgtttt
-attcaaccacctcatacgagaacttaaccaccggcacggctattttacgtgtattaggccaaaaattaattcaggatgaa
-actaatgctctagctttaaatagcaaagaatatcattgcagcaggagtattactctcctgtatggaagcaagcattgcct
-ggggtgccatcaatgccggagtcggtactcgcgtatataatgatgagtcagataaaggcgaagcattaaaacttactaat
-caaaagtaaaaacctgcctatctggccaaacatggatagaagatacaaaggcaataatcggtgacttgttattgtcactg
-ttctgtcaatggtgcgtttaaataccagtgagcaaattcaagataagaatgataatcaggaaaaaattgctcaaactttc
-ctacgacagagaaacgctctttctattttaacgtgccgagaaataaccgcccaaaacagataaaaaaatgtgatgcaagt
-cactatgcagcacgcattgaaacctattctggcggcataaagcgctattgaatttaagaagacgatggggtaatgattac
-gaaaagttgaaatcattcgtagaaatgacggttgatccgcttaacaataagatgcttatcacgttacgcctggttattat
-ggaaaaatggggtaacgatgttacaaacgcaaagcttaatggtaacgaccttttagctaattgcaaattagcagtttaaa
-aatgttccgtcaacttttcaggtgggttatatcaattgactttgtgattaagtttttatggaaataaactagcctgtagt
-gaataacagttttgtaatatttctgttaccaccgagagtaataattgccgctagctgttaattggttattacttttttta
-tggttttagttcatttacctgcatgggaatgactgctatgctgaacatgaaggtggaaatacgttgtcattgggttacgt
-accaagaacttaatcccagcgatggtaaaaaggtgaataaaatctggcaagcagtggaatattttatgaatgttttttct
-gtaataatgcactaccagggccatctcaggagaagaatactccatctgcatggggtgaaatataatgatgttgtttagca
-ggtcaggtcagaacttttataataaaacttcttatactttcggtgtaacttaattaatggggttggattagttgattcta
-ctctcgcgcactacctattgcaaggcacctgtatgtaagatttgatgtataaagggaggccggaaccttcgggaatggta
-caaaaagccgcgcagtctgttagttggggtttgaacgcaattattcagtaacttttccagtacgagtgcagctctatatt
-aagctagctaaaaatgcaagtaaataaataaaacttgtattactgacgaatatatagcactttgaattttaagtatgagc
-ggagcaggtgctatagaagtgattaaaaaattgaccttcaggattcgcgattaaataacattcatgtcttggagctgctt
-tgtttaatgttgttctggaaccagctgatggcgtttgtcgactttggtaaaaataaattccccgaacaattaaataccag
-cgtgagtgagacgtttagcgtatttgtcatgcaccaaagtccggtgcggctgtatgaggcagtttaatattttagggttt
-ttttggcactagggatattttggagtgattatagccatctggattaggtaatgttgctattgaagatatatttcataacg
-atggaaagcaacagaaaaattgtacgcgcttctcccaatttgcttctttcatcgtctagtgcgcttcggtggcaccgcac
-atttcagggcagaaactgaagtggaagccgcggcagaaacggtttgtttggaggaccgtgtacag
->m141013_011508_sherri_c100709962550000001823135904221533_s1_p0/358/0_20672 RQ=0.837
-accaaaaaaagggggggaaagggaaaggaaaggggaaaaaaaataaagccccggccccaaaacccccaggcccgagtccc
-ccccccccggggggtgttttccgaaaaaccaaaacaaagaatccctgccagaaaaattaagtccccaaacaaaacccagc
-gttttacgcccgtaggcaacgaaactccgctaaccgcaaagtttgaaagaaacacgaccagcagccaagatccaagacta
-cggctggtttcaaagtacgccgctttaacgcctgtaaccagcacatcaatattacccgccctctctgcaataaacgcgat
-aaactccgacgcgggatgttaccgcatcggtcgccatcgcaaaaccagtggtatagccagcgccagcgccaatcaagcgt
-accgtagcaccgacatttcacgatggtttttcggaatctttgccgtaatacttcatcaggcttggctacgttaccggtga
-taaccaaacgatgccagacagaaggcagggtccatcaacagatacggtgcataagacgccatttgcttttcggccggacg
-ttgaacaatgtcgcaggctgcacatgccccagccccaaaaaaaaaggctaccaaggtgaggaagaaggtaattgactttc
-gcccagccacaatcgctgtccatgcactggacgggcttttagtgctcaaccacaaccacaaagcgctacagcaatttggc
-aaaaccaaaaccgccgcccgtgccggacgttttagtgaccatctctgcgaaaggtgtgatgcgatatcgaaccacttggc
-aaaagaaaatataggcatcggtcaggatatagagcaaacaaaggcaatggaaatgccgttgaacgtccacgttccagcct
-ttgcccagcagaatcttttggtgatggtgtcaaaacctcgaaccgatttctgtaaaattcctcaggtttagcttccagaa
-tcatccaagcggaatgccagcatacagaaccaggttaaagatcaagccgccgccaattgggaccagaaaaaaccacgccc
-gcgggaacatgacccacttggcagagaaaacaatcctgcgccaataaatggttgcctaccgcccgataatcaccacgccg
-ccaagcaaaagcgacggtgacgtttggggtggtggttagttgttgccatgagggcttcctctccagtgaaaaataagtgc
-gactagcgttgttatgcattgctactgtaaccagtacagagtacaaaagaaacagaaaaaaagccccgatggtaaaaatc
-gggctgtaaatatattattttatacagattgtgttcgctgtttcagcgatgattacgcatcaccacgaaacgacgacaga
-cgggtagaatcatgcacgaacgcgggagcgcgccccttcaacgacgtttccgccgctaaaacgacgaaccatcaccaggc
-caccctttcacggcggttcaacgcgcttttgaagttttttacggaacgccttcaatcacgacgtttttcgccaccgaaac
-ccacgaaccaccgccacggacgctgcaaaccgccagtatgcggcttgtgcatcgcccagtaactgcaaaatgttccatcg
-gctttggtttttgaagaatggcgagtgcgcgtaaagtgttttgcagcacttccacccggcatacactttttcgggagttt
-cgatggtggagtgagaaagcaacacagcttgatgttaccaatgtaacggctgctgatgttcccgcctcgttagcaaatcg
-cacaacgaatattgacgaacttcaacaccatcatccgcgggcccacttcaatgcggtaaacagctgcaaaatatcgccaa
-ccatccacgacccgttcacggacgcggaccgatccttttcacgggtcagccacgcgggccacggttccgttaacgcttcg
-cggcgtaccacgtccatcaacggttcacggaattcacgtttcggacgcatcgggcgcaatctggcggtttacgaatcaga
-gtaaacgttcaccctgtgccatttttcagcagtggggccgcgcccaagaggtttttccgagtccagctcttgcacgcttc
-cagcagtcggcttgaattttttgctccagcagtggcgcggttattggatccagaatcgcttgctttccagctgcttggct
-gtacttagcgggcgacccttttttccagacggccggttttgcctagcagtttcttgcgttcgggcagtttcctactttcc
-ggaatagtccagcttcatagtaaaacgttccatgtttggcagcagacgacgcctcgcggttctcaacccgaacagcagcg
-gcgcaggcccagcacgaaacccgcacgaccggtaaacgaaccgatacgtgaaacgtaagactcagaatccatgcgggata
-tcccggtaagtttacctaccaggctgaatttacgctcaacgtccaggccacgggcttgcaaacgtccgtcgcaatcagga
-tgtgccagacgaaccatgctttcaggcgttcccagtgtcctgttcaacggcaggcctggtttccatgtcaaccgttcagc
-gcgcgctgttgtagccgttagctcaagagctttccagcccacttccagagtcgcgtttttgtgggtacgaaacgaagata
-atcgccccgcattcaaaatcttccgcttccaggaaaccgtaccatgcttttcgttttttgcgcataccctcagacaggtc
-cagtagctctggctgatgtcagggacgggtagtcacgctggactgaatgcgcacttccttgcggtctttcataaaagcgg
-cgggtaatgcgacgaatccgcttcccggcaatggtttttgcagagaccaagcgcgggttcctgattgatccttccgggat
-ctggcgccagtaaaatggttttttttccaccgtccccttcgaatgaagcccaatgcgcagcattttcgtgcagctttcat
-ccagaaccagaaccgctcagtttagaaggaggtccagagtgccacgtttcaggttggtccgacagaccggcccggagtaa
-ccgacaacgatctgcggcccctgaccgcagggcgcgtaatttttggcacgtcataacgctggccgccgtcagagcaaacg
-cacatttaacgcgcgcatgttgtttgagaaatccgtccattgcttcagcaacctgtaaccgccagttcgcggtcggtggc
-cagcaacagaatctgtggttgctttcagctttcaggaatcaagattcctgcaacagaggtaaagagaatgctgcagtttt
-tttttttccgctcccgtctgggccatacccaaaaacgtttcgcggcccatcagccagattgtggaattttacactctgcc
-tgaaaattggagattggtttttccgttaaacccagaatcgttaaagggcttcaaaggataggagcctttcaggccccaga
-tctgcaaaagtggtttcgaatttcaaagcccatggtaagtacgtgttgcctcaaaattaatggcggccagtctaacataa
-ctcatcaaatgaaatattgaatcagataattttttcatttgaaaagttgttgaaccgggctcaaagtttaaggttggtaa
-ttaatacgaacaacaacgccctcacccgttcaaggttgaatggcaaaaatccaaaaaaattacgggctgatgtggtacgt
-cagctattgcttggtccgattcttgccaggtttttcatttctttgtcctggcccagagcagataaattccaacaatgcgt
-ttatcggtgcctccaacaaagtttatgaatcgtttggtttgggctaaccgccagttttgaacagtggcgtggcgctgtcc
-aaatcccccagacttaggtagttactgtactaaataagaaagtttttggtttcactgagatgcttcacgagcgaggtttt
-gttaatccgttggtccgcattgagcctttccattaacgtttgttcccgctaatgtttgggccccaggtaagaaaaactcg
-acaaatgttccccatccccactgttttctgtatccgattttttccgaagttgctgtttcaacacttcttttagccctgct
-tcttcatcgagcttctgctttgcggcgagataaagccacaggacctacggaaaggatcattgggatcgtcttgaataaaa
-cgccagcagaatcatcttggccgctaaacttgtcctaacgaaaccgcccgtaaatttaatgcgggattcccgcgattcaa
-agtgcgcgtaaaaagttgtaaagtttgattcaagctcaaagtacagaatcaaaacgctttcataggcagcatcaaaaatt
-tgcctgcctgcgttaaatatatgcctaagtaattgaatacttcaggcactatccctcggtcggattggccaagcgccttg
-cgacaaaatcgttacggcgctaatgcccctaccagacgagcctatcatacaacactgtccgcgctcataaaaaagcttgg
-tgcgcgttcgtcctcggttcaagccgacttggcaaggatttgttccatacgtgcgcagaatcactttcttgctgtaaagt
-cggtttgcaatggttaacccgccgaaggacctttcaacatttttcacgccaggaagttaaattactgcatccctgcaagc
-gtaaagtgctgtccgcaaacgaaaccaccacagcgcaaaaaaggctttcatttccccaactccacgaaagacacgggttg
-aaatgaaccgtccctgttcccggttgctaacaaggcgtcccctgcccggttaaaaaagccccccgccgcaaagttcgagg
-gccaataaatggcaacctttacttcgccctggtttcagcagccggagctttcgccgggtgccttgcagcaaaggttgaga
-accttgctcagtcgcttcttcttttaaatgcctcagacggatacggcccctgggcgatcaactttccccagaactttcac
-cggtacttcctgacgccatctgcaggtatacggtccactttcctcaacgaggcgttttgtcagcgattttgaggagatgt
-ggacccagaaccttctttaaccgccgccgatggcaacaaattgcgccaaagttccaacgatcggggtccaactttaccag
-tgtagagcgggcccacttcgaatttctgcaagtgatctctcttcgataacgaaccgaaatagcatgtttcgctttctcgc
-cgtcggtcgcctgcaatctttcaatcagtaaccgtcaatgcttttcgatttcgatggtggtgccagtttttctttgcggt
-cccagagcacggatttaatacagaaccgccttttcaccgataacatctttggattcttcgttccgggtttttgatcttga
-tggtatggatacgcggttggcgaacttcagagataccgcgccagcgcggcgcgttgatcgcccctgttccattaacgcca
-aggaatatgcagccacgcgcacactttagccctgggttttttcaaagcgcaaaacctggcatgatctccctttggtgata
-ccctttccaattttgatatccatctgccagtggcagtaggatacgcgtccgcgggaacgctgcaacttttggaagtccca
-tatcgccccaaggttggatatctttcgtcgccccaaaaatgtcagacagtacaacgtagtttggtcgcctttcttcaacc
-agacccattttgcgatacccgcaaaacggcagctttgatcggcaacacctgcgtccattcagcgccagagaccgcgcccg
-cacacggaagccatagaagaggaaaccgttgggattcagttgatttcccaagacacaacagtaacggtggtacgggaatt
-tgtccataatacgcaaatgacttgccagcacgccgccggcttccgccagacgaccgtgaccaatttcacgacgcttcgga
-gaaacgcgacctatgccggtgttttcgcctacggagttacggaagttgaagttgtatggaacaggcaagggtatcggttc
-aagcgtttggcccatcagtttcatcaagaacctgcgcgtccacgagcagtaccccagcgttttttgcggtaacagcgcct
-gcgtttcacacacgggtttgaaacaaggcggcagaaaaccgtggaagtaaccgccggcagcagcgccagttacgcacatc
-cagaaccacggatcatatcttttttcacgaccgtcgaatacgcggtttcgcccttgccagttacgcgtgcttaacgacaa
-cgttttttctcgatcgcgtggcagaattttcacccagtttcggtttttcgtccagggttttttcgtctttcaaagcaagc
-agcgtcgcgatggtttccagatttgattgacaatcacctgcgcataacgctctttgttttttttgttcggtgggatgcgg
-gggtaagcaaatcgccttcaggcgagcttcagccagtgcagcaaacgcgacgcgtttagcgcttcgttttttacccggct
-cccggctgccagtcccccccaacgcggtttacccggcttcttttcaaccagttttcatttggatagtttctgaataacaa
-acgctgccctgttgttcatgaccgaaccacttactgcggccagcaaatctggtcccttccgcttcagcaagtttgagctt
-cagattccaccatccagttacagcggctttcaagtaccggcaaacaccagatccccagtttgctctctttcagctcgtct
-ctgagtcgggttcagtaaacgtaactggtcattgatgtaacctacgcgggcagcaccaatcggccattggaacggaatac
-agacaagagacagcgctggcggaagcaaccaaatcatcgcgacgatatgccgggttaactttgcgggtttaacagaaacc
-acggtggcggataacctgaacttccgttgacgcaagcctttccccgggaacagcggggcgaatttcggtgcggtcaatca
-tgaccggcgcgatcagggtttttccggcctcccgccttgggcggcctttcacgacgggaagaagctacccgggatacgaa
-ccagcagcgtaaaaggtaaacgcctccctgaaatagttaacgtcagtgggaagaagtcccccctgaacctggtttggctt
-tttttcttggccaacaacgtttcaacgaatacgcggtgtccaatccatgctaacccataaccagcggcagtagcctgacg
-agcctatcaatggccggttttttccaagagtcccacggtggtgtttgggccgtactggaaaaaattgtacgaaacgattc
-ggaatttaagcaaaatgttaattatcctgttcccctcttttcttagacagtaccttaacgggcagctggttgttagtacc
-acgatcttctgccgcaatcatcgcggactacatgacaacccttaacccagctctatggttgggtaaaaaaaaaaaaaaaa
-aaagcctcctcattaagccgcgcgaaaccgtctgcacggaagatcattcataagaacaataccttagttttccagtgaat
-tgactgccgtcagcttgaaaaaaaggggccactcaggccccctttttcctttgaaaactccgcaaaaagaaattagccga
-acgcagacccaggcgctcgatgagctgggtgtaaaacgtgctacgtcttttacgttttcaggtagtcgagcagtttttta
-ccgacgcctgagaaacgcattgcgcagcacagaccaacgacggctggttgggtgatcttttttgtgctctgcaaaggtgg
-ccctggcaggttggtttgatctgttgcaggtcagcagtggctaccgtttgaatttttacggttagaaaccggttgtccgt
-tttttgcgtcacgaaccaaactcggaaacgattttagctgtttgctttcagtaacttagagacattttttaaaaactcca
-aagtatattagaatgggggggggaaaggaacggccccgatctctaattcagcgatccccaggtgtaaacgttttaatccg
-caacgtgttttaaaacaattttaccggcggacgttttaaagccggcaagtattctactcgtaagcgacctgtttttatcg
-caagagggttaacattaacgccgggttattccaccaccagggcgacgaggcgcacgcggccttccatcgtcaattttcgg
-ccccatacccgataattttgccgtttcttcaaacgcttcctgtaacgcgaaccagtccccttccagtgggcgcaccagat
-gtagcgaaccgggtttaccatttattgaagtaaaaaacagaatgacgttaacggaagattcaccacacgcgggatagtcc
-cgaaagctggaactgtccattggcaatccccaagttttttttttaatgggatcaagtaactcccgcggtcttgaatattc
-ctgctgttttttcagacctttgctcaacaagttcacgcaggttgctccaagggtttcaccatccgtttttcaaccggata
-atttactttacgcgcagacggcgcaggttaaataacaaatgcgcgccacaaaagcccaggagttttttcaaacccaggtc
-atacaatgaatggtgcggattaataagtgcctttttgacagtgaatttcccagcttcccagcttcattttgcccttcatg
-gcgaataaacagcaaattcataaacggtaaaaaatcggacgcttccttcacgcggaacttcaattttgccctgacgcgca
-tattttatcgtacagttttttttttgccctgatatttcaagttgctgaaatacaatcgaagggaatgcttttgtttcgaa
-ttttattcgcccaacggaaaagttaatccagtgcccgcgtgccagctgtctctgcgctaaagggttcaaaccggacggtt
-tctttcaaacgatctgtcccgtccggcccatcagaagtatcggtacgcttttgtccaagacgcagcaatgaccgatagcg
-tttgtcggagtccagcagatactgggagaactttcgttcgctttttcccgaggggcaaaatcacggcaacatgccccggt
-cgccagcggttccaggcaccggtaaatgccggccacggtttggcgtttatatatacggtttttcacttttttgcagcgca
-attcgttgctggaacataaccctgaggtttatccagcaaaaaaacgccgttaaatgtccgcgaccgcgacgggaacgagg
-acccggaacccctttttttcccccccccaaaattagtccttcctttggctgtccgtccgggttttaaacgaccgtctttc
-ccgtcaatgtttgaccagctggtcactcaggttttgacatgccgcatcccttcaaccagagagtttttgtcgtagaagaa
-cggtcagttttcggcagcgatacgcaggcgcaatcgctttccccagcaggctggcggatgaaacaagaaagctttctgca
-acgctttgattgccgcttttttaaccgcggttcctttccatcttttgtcgttggaggaacggtcacataatactttggca
-tacgccaggtcgcgaaaggagcattccgacagccggaaaacggttgggtcaatcattgcccaggcgaggaatcttttaca
-aattttcacgctgcaggatgagagcgatctcattttttgcatttttccttgcgcttacggcggctgcgggcgaccaaaaa
-ttctttcgccataataaaattctgcctggacaaaaaaggggctgttagccctttttaaaattaatttcagggttggaacg
-ggcttgttcacgttgacctgaataaagaaacgcggccagcgtcaacattcaaggcaagttccatgccgggaatgcaagcg
-taaacggccttatccgcatggaacgcctaaaaaccttaagcaaatggttaacgttggaattctcgaatgatttcgaatac
-ttcgatcacaatcggccagtggcggaacgttccgttgtagttcttaatacgcgataccacaattttccattaacgttacg
-ggacttttcgttaacgtcaaaatctttttttggaagcggcgcagggactcccagcttcgccttttcgtagataacccacg
-ttgtcacgccagaacgcggatgtttgcgggtttgtgacgtttttaaaaagccacaccttttcggttaaccatatcagcct
-gcgattggcaccaaattttcggcgatttttgaacacacgtcccccacgaaacttccgccagaccgataattctgctgttt
-tcagttttccggagaacaagcatacccgcttcatcgccgcttttcacttcgtccaatcaggtttatagactgacggagta
-gtaacgcagatccaggctttcccccgcttcaattccacctttacgtgcaaggcaatcagcacgtaacgtttttaaagcca
-accaggaatggcgtttggacgccgcagcagggtggcgttcggttttcggttggattaaccacctacgccagaaccgatga
-atcttcactttttaactttcgtcagtagacagttttcaagcaagagtcggagatcgcttcgacgaacgcctgtaacgttc
-tgccttcaggacgataaattcacttcgtgtgaaacctttttcgcctttttccggtcattgtttttttgggccggaacatg
-gtttctcgagttttagattttttttctgcctgacgcgccagtttaacttttcgcgaaattttacgctcctgacgatagag
-tgcaactttcaaacgcgcttttcttctcgtccaacgtacaaacggtttaactttcatcacccgcagcccggtaacgccgg
-aacaggccgaggatttttttcccaccggaatggacggaccccgccttttccagcacgtttcctgacccagttccgtttta
-cggcatcgcacgaacacgaccgtattcgaagccaacacacgaacgatatcgcctttttgtgcagagttaaaacttcacgt
-aggcgcaagaacggttagcaaccgggaccaagaccctttatccgaggaaggatttcgataaccgcagaccgcttcgccaa
-ttaacttttttacgtacgctttcagctccagaactcccgccttgcaagcaggattagcgtcagcaagtttcatcgataaa
-ccggttacccgctttcggcagataccgtgtacgaaactggctttttccatccaacgcgcccactcttcccggccacggat
-gccgtactgggagaagttcgttcttaacgcgaaatccggatcagctttggtttaaatcgatctttgttcacgtgcaacaa
-gaccaccggtacctgcggccgctttcggcgtgctggatttgctttcgatggtctgcggcaatcacagaccgttcgtcggc
-agcaacaacccaggactacgatgtccccgttgccttgcgcaccacgagcacgcaaaaattgaagtaaagcggcgtgcccg
-gggtgtccaggaaggttgattcatgccgttttcagttttcaacgttggtaaatgcaccaatgtgctgggtaatgcccgcc
-cgcttcgccagaggcactttcgttttgacgaattgtagtcccccagcagaagaggttttaaaaccgttggtcaaacgtga
-cccatgaatggtcacaaccggcggcggcgcgttttcagcccggcagcacccgttgtcacggttcgctcgcatctaccgca
-gcctcttacccagcttcgtttttccaactgaacgcaaggattaaacttttaatggccccatctcttcagcaaaccagctg
-tggcggtttcctgatcgataacctggttgatggttgccattgcgccccagtttcatcatcgctttttgatgaacctgaag
-aggccttttaaaccgccatctttgtttcgccagttttcgcccaaacggtgaatagtttcgcgccgatcacgaacgtccac
-ggtttttaacggccctgaaatgcaaggcttttccttggaaggcccttggctgcagcgaagaacgctttttaacgtttttt
-ccgcctttaccgccacggttaaaactgcttgccggcgggtggcttttctttcacgattcagcttttgattcagcgtgttt
-ttgtttgcctatttcttcggacgcgctgcttttcgcgttacgaaccacggccacgccgccttcgacttcattcgattccg
-ccatttcgtcttctgcctggcgagcatgttgagtaagtagtgaccgtgggataatcgctgggcatcttcagtcggttccg
-cgttatctagttcccaatttgttttctttcccgccataaccgaacccgtgcttcttcagcaaacgcggacgtggcttctt
-tctttcgaagttttacgacgcgctattttccttcctcttcagcttttacgcttgagctctgcagcttgctgctcccgcgt
-gcgggctttttttcactgggccgttttttaagtcccccatatcgtcttgttgattgctcactttggtctttttttcccgc
-aagcttttcacgtttccggcttgttcagacagcttccaacgcttaagctttgttcctgcggctcacgttcagcttttttg
-ttttgcgccttcgcgttttagccgactttttcccctttctgccctcaacgacgggcttgctctttcacctcgcttccaac
-gctttgcgcgttgctcttcgctgcaaagggcgttcagcctcttgcggaaatcgcgttttcacaaaggtggtttcttcttg
-cggacttcgaattttgtagccgattttgcttttttccaccgtaaccaggaatgttaacgggttgctgcgtgtttttttac
-ggttgcacgtccaattttgttccgggcctgaaattttttttctgattcaaggttgggtcccaatcaaagtctgtttctct
-ttgtgcagacacagaggtccgtgcacagcagactccttcccggagacctgcatcagccataaaattgcctggtaccaggc
-cgttcccacggaaggtcccctgtccgctctgcggccagcggtttttaaacatcgttacattcttgtcatggctgttttcc
-tttcctgcctatcaagtttttattacctttcccgtcaccgaaccagcaaatattacgggcaagccaataatcaggttgct
-ccggctttttttttcgcgtcaaccgcttcgatatcaaagccaagtcatcaatgccgctggttccggcgagatcttttcca
-gcggttaaacaaacgccacgggccggccagtttttgaatgccaaatcgacggaatcttaccctttcaaaggttcagcaga
-tttcggtccagccggttttggttaatcaccgaggcctttctttctgcggcctgtgcaatggtgggccaagtgcatttttg
-ttagcacctcgcgcaagtgctttcaaacaacggtccggctcattcaggcccctttcgatttccaacagcttctttcatcg
-ggctacattacggccaccattcttcagacgtcgagaaagcgactttcttctaccagaacagtcgcgaagtctttcgtcga
-tgtgagatattttggtgaaggtgtcgatcgctgcgtgctccgccttgatgcttagcctgcaggtcgtcaacggtcatcag
-tttgagttcccaaccgctcagctttgcgaagccagacgcacgttctgaccgtattacggcaattcgcctgcgctcaggtt
-aacgtttcacggcgatacatcatggtgtgtttatcttcatatccaccacgatagaaagcaaacgttctgccggtgcattg
-cgttaatcaacgaactgcgccgggtttatcatcccaacaggacgaataatcgatacgctttcgccaccagtttcagtaga
-cacccgctgaaacacgcgcgcccacgcataccttaacgcaagcacctaccggatcgatacgttttatcgtttggttttca
-cccgcgaattttcgcacgagaaacccggatcgcgaatgcccggctgcttttaaattttcactcactcttcgccgatttct
-ggcacttcaatacgggaaacagtttttttttccggatgcagcatttttcccggcccttggaacggagtgacgaacagttc
-tttgcggcggccacgcgcttccggcgaacaggaaatagtagcacgccaccgaaacgcggtcgccagggcggaagttttca
-cggcggcagcactattcttcgcgcaggatcacggctttaagcgttttgttgcccagatccagaagagatgttgtccggtt
-ttacttttttcaccacgccggatgatgatttcacctttcgtgttcacggaactgatcaaccaccaatcgcacgttccgga
-ccttcacgcactttctgcacgataacctgtttttgccgctggggtagtgataacggtgcaaaggtaaacagactcaatcc
-tgattcttcaacgtaatcgccccaggttccaggctttcaatcttcataaacgtgggcggcttcaagaggtgattttcctt
-ggtccggctgggtggacttccatcaaccactaaccagcggaacggaaagtgtcaaaatcaccgcttttttgcgatcgatc
-tgtacgcgaccgtcgatctccttgttccatattttttttctttgttgctttgtcgcccagccgcgctttccaatgcttcg
-aaaatcttctcagcgaaggtagcgcctttttccatgggatacggctttttcaactacagccaaaaattttcctttgttca
-taccgggggctttttttcacccctcatccagacttattaaaaaagtggggagccaggtttcgcgcttctgggatattact
-cagcgcgaacaccttcatcttttactttcagcggtaaactgtgaagtcatttccccacccgtcctaccgctttgggataa
-cggccctgccattttacgacggttttttttgtaccgccataccggaacgaaccagagtgccgccacctcttctccgacac
-aaacgggcgtagttgttcagccgttggaaacagtgggcgatcgagaccctcggtgaggagactttcccaaggttcataaa
-gcaacggtgaatgggatcttcaaacaatccagcacatggcactttaccctggtggctcacatcccgcacaatcatcaaac
-atttggattgccatctttcactaatcaattataagatgcgcaagtggtggatgtgcggaccgcgaaataaattcgatgcc
-aaccagttttcaaaaacccagggcctcactggcgcagttaaatgcatctctttgttaatttttgctctaatgttggacaa
-gcccacgcacccaagacaataaaaaaagggccctaaagcccagtttattctgttagtccccagataacaaaaaaccccga
-taaatcggggctttttttatataactgcaaccctatataccgtcaactgcggtcctggagcactttttcgcgaaaggatt
-tttttttcaaaatcccaatacgaaggccgaaagtccctttccaaaacagtaatatttttgaaaaaggactctaagggaaa
-gtggttggcgggggccggatttggaaccgacgatccttcgggttatgaggccccgaacgagctaccaggctttgcttcca
-ccgccgcgccctgaaacgtggggctaaaattcttactcgttttgggtaaaaaatgcaaatactgctggggatttggtgta
-ccgagacgggaaccgtaataaaaatctgcaggccttatagtgatcgcaacggccacattttgtcaacgttttttattgct
-aatcatgtgaatgaatatccagttcactttcatttgttgaatactttttgccttcttcctgcgcttctcccttaagcgca
-ttattttacaaaacaacacactaactctttccctgtctccgataaaagatgattaaatgaaaacctccatttattttggc
-ataaaaattcccagtgagagggaaatcccagggctcatcatcagttttaattaagcagggtttgtttttattttttataa
-tgacgacgattctcaaagcaatctcccaggttaaaaaggtcaacgtattggtaattcgcttttttctggcggtctggaca
-ccagtggccgcactgctttgtggatgcgaacaaaagggagcggttcttaaatgcaaaaatatactgcaaacctgggccag
-ccagaaacgaagaagattattgatgcgatccctcgtcgtcccatggaatacggcgcggagaaacgcacgtctgattcgac
-tgccggcaaacaaactggttggcgcgaaggtattgccggctattcagttgtggcgcaatttcaaaataacaccaccggcg
-gcctgacctaatttcaacacgacgtgccgctttgggccgcgccgtgaactggttccccgaaatgcttggttttgctggcg
-atgaaacgaagataggcgtgaaatatctgggtgacgggttagcacctacaaaggaaaacgattcgaacgttttctatcgt
-tttatggtttctgctgaccaatgctgaactgcaagatttaacaaaaacgcgtggcttgatacctgcacttttattgatga
-actgggcgggccgtcatttagatgtcttgacctttttaatgattgcctgcggtttttttcgactacaaaatgtctgtccc
-gaaaaagccctactccacagaaacccctcccagacatgcccttggttgcaacgcaaatgaagcgaaaggaaaattctgga
-aaatacctcaactccagcgtccacaatcgtcaacccgaattatgggcgtgaaaattctttgggattgagagcgtgaagat
-cccggcagagacacgaagtccaacagtaaccgctttttgaacaaggtcatccggttggcgctgccacggtacaaccttta
-gcgacgaaacgttagaaatgattgctggaagctaaaccgcaatcggcggtcgtcacggctgggcatggaagcgacagatt
-gacaaccggtatcatcgaagcggaaaagccgtgggtattttttacgaaagctcgggatggcactgctgcaccattgcggt
-aatgaaacgacctgtttgacccggttaaattcacaacgaaagacaaccatttgagcagtatcacgccgcatggtcgtcag
-ttggggccgtctgctgttaaaccaggggccgttttggtttgactccaggcgctgatgctgcgtgactcctgcaccacgcc
-tgggttttgcccagccaagaagttcactggtggaagttaccgctggagctgcgcccgtgggaaacgaatgtaattcaatc
-ctgaataccgttcctcagagaaccttgacctacaagccagagcgtctggacgaatggaaaaaggcgactcggtgtttcct
-gcgcccgatgatgtattggtccaattgacctcatgcgtacttggattaatcactgataacccgccgagaactttttcggt
-tatgcccaaaagctggcctgcttttcctccctgccgcttcacaggcgtgccgcagggtggaagaatctggaaaacaaagg
-gccagtaattcgacatcaaaccctgccttcaggggttggggttaccttgccttatgttacctctgtaaactccctttcct
-gaagcatcaattaatcgaaaacatcaatggtttgcaatccacaaccgtgagttctgccttttatagtgtgcaatttccac
-acttcctcaagcgttttgcggctgttccggccttttgggtttaccccatcacacggcattttaaataaggtaattaattt
-gtaagctgttacgtaaaaaatgttgtttttccgtttgtgcgatccactgccatccccagaaccggggcttaacagataaa
-catcgggaacatgatatgcctggctggctagccctccctgcctccatgaaaatagaacgtgtcttctttcgtagggtcca
-acgttcctaggcccgtttgtcccgggcagaaaatacaatgacccgggaggcgcgggcgattcttttaataattcaaaaac
-ctcgacctttaagcaaaaactatcttgtgtaatgaattggagtgtcatagcaggcatcctgaatcgtcctgcggtttgaa
-acacggcgctggagtttgcggataggcgcgtacaagccggttccatggcttccattttaaatgaagaacaaatcagtttc
-ccttttgctgcgtattttgctgtaatgccttgcgataaatgcggcaaacaacaattcatccaatcctctgagcataacct
-ggttcccatggcggcgcatggcgatactggtaactgctcggtacgctatttctggcgaaaagcgggattgcgagcttagc
-ccagaaaaagtctgaaaatcctgcttgatttaagccataattaaataatgtttgtcgggggtaattatgaatggtcatga
-ctcaaaacagaatcagcaagttaaagaaaggggaagcgcagcgcaggtgtaaaggtgcgccgcttattgctttgatttta
-aacagttttgattctgttttcttcttttgttgcttcaaaccttgcggtgtcgtagagcggtgtatatccatacaaagaac
-atatttgtcgacacgggtacagactcccccacactaaacacgtttaggttatcaaaattaccttgtaaatcacctgactg
-attaattgaaaatacggcacctgttgttgcaatttgagagtaatctttgatgcttctttcggctgcctaaaggaaaatag
-tttgagatttggaaaaacgggcgttataggtagcaaatgcgacgctaaagtatagttggacctgacgcttttttattttt
-tttggcatctttaattaagcaaattgacaagcggaaaattaaactgcccgaagatgacaatcagcaatacatattcctgg
-tgcactttttttttgttcggctaaggaaacatcatattttaattattactgccaaaaaagcaggataaaaaaagcaaagg
-cacatagataagggatatacatccccagcaatttttgaacaacttcatccggatcactctgggaagcacactaattcgca
-aatccagtcattgaaagtttgttaaccaaagggttacaccaatgaatagaggctaattagctcaatggttctgccgcagt
-tcagtaacacaaatggtgcggcaacaagcaggcgaaagcgaagggatggattatacgttttacaacccaggatggtcaga
-acgaagacagcaagcgcttgaaccattatgcgccttccggaagaagccgactaagtttccgtacataccaaaaacaatta
-acacaaagaatacaccaaccaaattggagatttaaaaaagtttctagcaaaatttgtttgaatactgtcaatccagaaat
-ccaagttccatcacaaccaatataaacaattatcaacaatgttaattttaataatcagacaatgttttttttcaatctga
-tccatatcagaacgaaacactgttaagtttttttctttttaaatgatgctgggccattggtttctcagtaattaaataac
-aattatgcatgcgtctctaaacattacgcagaacgtagcccatcagtcgttatactgacggagcaggatggtttatgcga
-gaaagtaaacatatccgtattcgtaccggaactggagttgacacaataaagtggccaatttatgtttcagtagaagggaa
-aaatttataactaaggccgtaccggctaccaaatcggtttcaaaggtaccagctacgagttaaaggcaactggacgagat
-aacagatacctgacaaccatttcctcagacaaggaaaaaccaaaacgaaaaaagacgctttttcaagcgtcctctttttt
-cctggaatttttggtaaaaccgagccacgggacttgaacccgtaaagccctattgggcaactaccaacctctaaggtagc
-ggtggtcgctcccaattccacaccctcggcacggataaactaaacttttttttagttcgggataatcgctggtcggctta
-gccggagcagagcttggcctgaagttttgtttcggggttttcgccgggtgcactcagatttttcccccattcgctacctt
-tatggttttgttgctattggattgttacccggcaccagactgatgaatcgagagaaataacgttgcccaagcagcgccgt
-catgcggggtcatgaagttaccaagaaccatctttgaaccaaacacagcgtaagcggaagcgcctgctccgaaggaaagg
-ctttcccccatatcagcgccttttaccttgctgcaagccaaatgatcagaccatacaaggccaattggcccacaataagg
-aaaactactaaaagagctttcatacataatcaagcctgtttccttgcgggttgcccgcgtaccaatgttcaaccaataaa
-gcgggagtttttaatcttccactgaagcggtgtgaatactaaccaaagcgaatgacccttcgcaagggcaaatttatcgc
-attgtatcaacttgcggaaaaaacagcaaaccgatgtgttgcgctgagaaacaggcgaccattcgcgcctttttagccat
-gtttatcttaacgctttaaaggctttcactgcatcggcgatgcggtgtgcaaattcagtcacctgcgctttcgtcttcgc
-cttccaccattccacgcgaattaacggttcgg
->m141013_011508_sherri_c100709962550000001823135904221533_s1_p0/363/0_15788 RQ=0.855
-gaaaagggaggaaagggggatttttttccccccccccaattttttttttaaaatcgataaaaaaacaaaaaaacccaagg
-ttttttaaaatctttgccccaggggggccttttttttaacggtagccagggggatttcccactcaagaaacaaggccatt
-tgggggcatacgggcaaactaaaatggttggcgggccgtaaacccccccaggttaaaggcgcaccacccacgctcggcct
-gcccggtgttcaacaccgtgcgtgaagccgtttgctgccaagctggccgctaccgcttcttctgtttatctacgtaccag
-cactcgttctgcaaagactccgcatttctggaaagccatcgacgcaggcatcaaaactgattatcaccatccactgaggc
-atcccgacgctttggataatgctgaccgtgaaaagtgaagctggaatgaaggcaggcgttcgtatggatcggcccgaatg
-cccaggcgttttatcacttgcgggtgaatggcaaaaatcggtatccagcctttgtccacaattcacaaaccgggtaaagt
-gggtatcgtttttccgttcccggtacactgacctatgaagcggttaaacagaccaacggatacggtttcggtcagtcgac
-ctgtgtcggtatcgcgtgacccgatcccgggcctctaactttatcgacattctcgaatgttttcgaaaaagatgccgcag
-accgaagcgaatcgtgattgatgcgggtgagatcgggcggtaggcgctgaagaaagaagcagcctgcgtacatcaaagag
-catcgtttttaccaagccagttgtggggttacatcgctggtgtgactgcgccgaaaggcaacacgtatggccacgcgggt
-gctcatcattgccggtgggaaagggactgcgggatgagaaattgctgctctggaagcgcaggcgtgaaaaccttcgcagg
-cctggcggatctcggtgaagcatgggaaaactgttctgaaaataaatatctgtaaatagaaaatagccctcgccgcttcc
-ctctacaggaatggcgaaggggctgtcggtttcgacatggttgcccatcgtctgatggcttttttgtggctttatcgcgg
-aatgatttttcgctgcgctatcagggtaaattatagtcatcggtattaaaagcgttgggctatattcaaaccaccgacat
-caactaaatatccacgcgaatactttttcaagaatcggctttgtctggctgatattaagcagacggctcatctctttcgt
-tggcatgcagaggaatgctttcctgttcgctacgatgcgataacgcatctttcttcacttcttccgataaagtgatattt
-gaattttcatgacctgccaggtgagatccgggaacaacgccaagcgggcatccaggtttcttcagcgccattggcttttg
-ctgcgaatagcgcaccgcgcttcagcatgccacacacgatcctgcgggtggattttgtagctgttgctggaagaaaatcg
-tcagccgggaatcacttcgaatatcagaacttcactgtggtgtatcgacgtgacggtccgacagttttttgcaacatcaa
-aactggttaagcctgaaaaatatcgtaaattgaacccgctcttctttgacgtaaggtccgcgctgccctgaatgctttcg
-aggatctgctggctcgactagcctggcgcaaagcctgagcgccccgtaacccggctgacgccaaactctgtttgtaggcg
-ctgattcagtgggggtaacgcatcgccaggtttttaaggctcgccacgcgcaatttgttttcacgatgcgcgatcggcaa
-tctgccggtatacagggcttgtgtcccatttttagtatctcattaatacggaatttaaaaccattatgcccgataattca
-tcctgtaaaataatacaaagatagcaattacacataatttcaatcaagtgattgatcacataaatggtattgttttatcg
-ggcacacatggcgcgactataaaaaacgggatcaagtgaggatcatgatgaatctgacgactctgacccaccgcgatgcg
-ggtttgtggtctgcatgcgcgctttaacagccgtgaagaggccatccactgcgttgactcaaaacgtcttgcctgctctg
-ggggaaaatttccagtacctgagcaatttctggaagaagtggtatcgcgcgtgaaagccttggcgccgacgcgccttagg
-tgaagggttggctgtgccgcatggcaaaaactgctgcggtaaaagaagcggcgttttgcggtcgccacactagcgagccc
-gcttcagtgggaaggcgtttgatggcccggaagcagttgatttagtggtgttctgctggcgattcccgccgcaatgaagc
-gggtacttacgccatatgcaactgctggacaagcgctgaaccagacgcgcctttgcggatggatgagatcgggcgcgtat
-acatggtcggtcgcgacgcgctgaatgagtgctctcgggcgctggatgaaccaaggaggcacgcaacttcctgctctttt
-caacgcggccaactatcgtctgcggtaacggcctgtctgcggcgggtattggctcacgacgctataggctgcaggaatat
-gctggaaaaagccggacgcaaactcggccgtaaatgtttacgttgaataaacaaggcgctaaccggattgaagggcgttt
-aacggcggatcaacactcaatagtgcaaccggccttgttatttttgcgctgaagtccgccaaatcaaggagaggtgagcg
-ttttaatggcattccgcgcttttcagtggcctgttgccgagccgaattcgccatgcagaagcgtgatcaaacaagcgctt
-accctcaagcgtagcgatgaagacgcgtaccgtacagcaaagatcacgcaaccccggtgaaaagtgtcaaacggagctga
-aacagcactgttgagggcggaattcttttgccgtaccgttttgagtttgtcgcggggggcacggtgctggcggtcgcggt
-atttactgtcgcaaatcttcgggctacaagatctgtttaaatgaaagaaaactcctggcttgtggatgtaccgccaagcc
-tgggccgggcgggctgctcaggaatttttgatggtaccccgtgggtgctcgcgctataccgcctattctctggcagataa
-accggcgttagacgccaggctttgccgggctgagcttgccgccaacatgatcgggctccggtttctcggacgcggtcgtt
-gggcgtattgatagccggttacttgatgcggcgctgggtgaaaaatcaacttgcgtctttagctagtaaattcaatgatt
-ctgactttttatctctaccccgtctcggtacgttgggagcgggcagttctgatgctgtttgtggtgggggtaagcctgtc
-gcctgatcaataactcgcttataccggcctggctgaacggtctgtcaggaagtaacgcgctgttgctggggtgccaattc
-tccggttttatgtgttcctttgaccgttggaggggcgcagtggaataaagccgcctttaatgcattctgcctggggcaat
-gggcgaacggcgtttacggcccgtatgcccatttttcgcctccgtcaaatggtttcggcatttaccgtaaccgcttccac
-gatgcctcgcaccggcgcctgttttaaaggagtttgaattgagagccgggaaatccacctggctgttagggctggcaggt
-tattgcgaaggggcgaatcggcgatggcgatgaagatccgctgcggggttattggttgcgtttgtgctgggctctatggt
-aacgggcgctattgtcggtgcgatgaatatcggcctttcgacacccggttgccggcatttttctcggctcttattttact
-tcatgataatggccgcgggcgggtgttatggcggctaattgctggtttggcgcctgcattggtgggggctgcaatcttcg
-atgcatatctccctgattgtggcggcgtcacgcggtaagcatggctaactatctgactgatggcgtaatgcgcaataaac
-aaacaaggaaacgacgatgaagccgtatctcgcgttcagcatcacgcccgcatatgcactgggatcgagagtggtatttc
-caccacgcggcagagtcacgacagtattctgctggtcaataatatggaagaggatcctgtgccgactggaaacaggcaca
-acgaatacaaatattacgtaactcgacgggcaaacgccgatcctcgaagattatttcgttcggtgaaacgggaaaacaaa
-gaccgtggttgaagaaacagggtagaaggccggcacgttgattatcggcccgcctggtatacccagacgcgataccacga
-tgtttctgcggaatccatcgtccgtaaatctgatgtacgaatggcgtgaactgcctcgcggtttggcgagccgaatttga
-aaattaggttatttaccaatttccttttggcatgttccgggcaactgccgcatatctacaatggattttggcattacccg
-caccatgttcttggcgcggatgttcggagcgccacggtactgataaaaccgagtttttgtgggcaaagcagtgaccggtt
-agcgaagtgacggcgcaggtgctgccgcttgggctacgccatcggtaagtaacttactctgccgacgaaaacggattacg
-taaacgcctcacagttattttgagcgtgctttggaaaaagcgtcctgtaacccaaagagattttgctgccgaatgggcat
-gacggcagatgccattgcagcaaatatcttcgaaagtgatggattaagctacgtgagatctaccctcacgtaaagtttgt
-gctgagccgctgacagaggtatttgagtagattagtatatgagcggcagcgagaatatatctggcaaccctgaaagggga
-atttaattgctgcaaatatatgcgcggtgcatcgcaccaatcgttctaacgcgtatggatatcaaaattgccacgcgcgt
-aatttgaaaataagattgttaattctgctggaagcgctggcaacactggcctggacgttgggttttgaataccgaactca
-cgggttctgagaaaatgtggaaagagaatcttaaaaaatcaatgcccacgacagtatccgggctgctgctgtagtgacaa
-agttcaatcgcgaaatcggtcgcccgcttcgaaactggctgaagaacatggcggataatctgattcgtttctacatgcgc
-aaaatggcgcgacaacatgccggcagaagcggacgccgacaaaactcgtcctgtttaacctgatttgccctggccggcgg
-tgaagaagttatcaacaccactggggtgcggctgcgcgcgcagccagttttaatttgcgggacgatgcgcggtcagctcc
-tgtacgtaattttattcgcgcaatgcccgtgagattcgatggcaggcataatcgagtcgggacaaataagtttcattagg
-taattacgattccctttatggagttttggatctacagataacgccagatgttcccttctatgggctatcgcacgctttat
-atcgaagcgaattcagccctggcaacggtaattgcggcaaaagagtgaacgctgaagggatactggaaaatgcttttctg
-ggcaaattgcgctcaatgaggatggttctctgcaagctggtagccataaagacagccggtgtgcgctatgacgcaggggt
-attgcaaattgaagaaaagctctggatgatggtgatgaatatgactattgccccgcgcaaaagaagagtgggtaattacc
-gaggcgaacgcgaaaaccgcaatgcgatattattcatgaagcctggcagagcagggctgtttatccgctatgacatggca
-gtgccggctcatttgtccagaacgcagcgcccggcaatccactggcgagaggtaggggtggtgttgggttgtcactctta
-gtcataacagggcaggcggtattggatgtggatatcaaatcttgataacgcaggctgacgatatcgccttcgtttgtctg
-gtccctacaacctttttaacaccgaccagtggtttttctggcacgatacgcagtttggttcgctaacgccgcccgcgtgt
-aacgacagtgcaaatgaacaactggcgcatagaaaggctggaaagaagcgcggttccgtatggaatatgctgcaactatg
-ttgcccttacaaggaagggcgtaacggcatggctgtctttaggcgaagggttactgtgaatttgaaagtcatcggtgaag
-agaaagaaaacctttgccattacgtgctgcgtggcgtgggcttactgggcaaagaagatctgcttttaaaggctgggccg
-gccttcgggaagttaaaatgccagtccgcgactcacaactactggtctctttttgtcggcctaagttttattgaagttat
-accgtgtacgccaaaccgccgctggtgtagctcagcaggcgcgagcatggctgactcccagtacagtggtttacaacaaa
-aatccaagcatgggatgtgatgaagctcaaacaaagccggattcaacgtggccggaaaagttataggtttgttttgaaaa
-tgccccagtgggatgcctgataagcgcacttagaaaagctgaagaaccgacaagaaagtgattttcctgctgtttaatcc
-ggctgaaatcagcaacctgtgatgcgactgttgcttttcagtcgcgaggttgattttcttgctcagaaacgatgatggat
-gaacacatttaccaccgagggaaaaatcaaggttcaaatcctatcggggcctttttttagcccggccagtcacggacgtt
-cagttacgcggcttgctgaatacgcaatcgaaacgcgaagcctacatatgcgcggcgcagattgttgacaaagggcggct
-ttgttcaatgccggatagcggcatgaaacgctttattcggttctacaaaaggcaggaccaaattcatatattgcagagat
-gatgtagaacactggcaagcgtagcgcatccagggtattttgcggttttatcttcaagctctcagccacgtaatatgtgg
-cttatttttaacaaaataataacgcctgggtgaggttaattataatataattatatagttaactaaatgtactattggcg
-gggtgggaatttatgcctttattagtaatcctgaaactctgcgtcgtattagccaaagtgacgcaaaaaaaaggaaaatt
-aatggtcaaccgtgctgttttgctcggtctctttttatctttaattgcaacggcgaactaatttcagccttataactcac
-actattttaaacataaatgtcacctaaaagttaccttacttgaaacaatgattaagcataatttgtaggaattgatattt
-tatcaatgtaataagtcttggaaatgggcatcaaaaaagagataaattgttctcgatcaaaattgggctgaaaggcggta
-atttagctataaattgatcacctgtctgaaaaaatgcaaattttgctttcaaaacaaaaaacctgtttattgtaaggatt
-tttgcggcgtaatatatacgtgggatcaatcttgaagtttttattaacatgtttgcaacctttctttacggccgttttgg
-tgtgcattcccatggtatgattgaaagtgttcaaaacacactttctttattggggcatgccgtgtgaccctttctaacgg
-ggtttcactctctggagtcttccaatgccgatggagcaaggagtcatgatgtttagatatagtcgaactgtcgcgcgctt
-acagtttgccttgaccggcgatgtacacttccttttgtgccactgacggctcggtatggcgttccttttgctggccaatt
-atggaaacggtctacgtctcttccggcaaacagatttataaagatatgccaagttctggggcaagttgttggtatcaact
-ttcgctctggttgtggctaacgcgtctgacgatggagttccagttcgggactaactggtctttactattccactatgtag
-gggatatgcttcgtgcgccgctggccatcgaaggtctgatggcccttcttcctcgaatccacctttgtaaaggtcttgtt
-tcttcttcggtttgggatgcggtctgggtaaagtttttcagcatatgtgtgtcacctggctggtggcgctcgttcaaaac
-ctgtccgcaaacatgtggattcctggttgcagaacggctggatgcaaaaacgccaatcagcgtccgatttcaactttgaa
-actatgcgtaatggagatggggtgagctttctccgagcttggtgcttacccccccccggttgctccaggtgaaattcgtt
-cacactgtagccgtctggttatgtgactggcgcgatgtttcatcctcggtatcagcgcatggtaatatgctgaaaaggtc
-gtgacttcgccttcgctaaacgctcctttgctatcgctgccgagcttcggtatggctggctgtttctgtctgttatttgt
-tctgggtgatgaatccggctacgaaatgggcgacgtgcgaaaacgcaaactggctgctattgaagccgcgtgggaaacgc
-aactgcgctgcctgcctttactgctgttcggcattcctgatcaggaagaggagacgaaacaaatttgcgattcagatgcc
-cttacgcactgggcatccattgcaacgcgttccgtggatacgccggttatcggcctgaaagagctgatggtgcagcatga
-agaacgcattcgtaacgggatgaaggcgtactcgctccctgctcgaacaactgccgtttctgggttctaccgaccaggcg
-gttcggtgaccagtttcaatagtccatgagaaagacctcggttttacggtctgctgctgaaacgtctatacgcaaacgtg
-ggctgatgcgactgaagcgcagattcaacagggcaaccaaaagactccatccgcgtgtagcgccgctgtactttgcgttt
-ccgtatcatggtggcgtggtgggcttttctgctttctggcaatcaatcgcgctctgtctttctggagtgtcatccgcaac
-cgccattggcgagaaaaatggctctttctgccgcgccgcgctggtacggtattcccgctgcgccgtggaattgctgtaga
-agcgggctggttcgtggctgaatatggcgccaaccggtggggctatcgtgaagtgctgccgacagctgtggcgaactcgt
-cactgaccgcaggcgatgctcattcttctcaatggtgctgaatttgcggcgctgtataccctgttcctggtggcagaatt
-gttcttatgggttccaaggttgcacgctcggccgcaagcagcctgaaaagcgcggtcgctatcactttgagcagtcttca
-cgactactcagccggcagcgcctgaagacaggcagtcgtcaaaatgatcggattatgaagtattgcgtttaatctggtgg
-ctgctggttggcgtttgcctgatttgggttttgcagtcactggaccggtttcgacatggggggtgggcatgctcagctcc
-cgtttcctcggtccgtaacgacaccgagcgtacgaattatgcattaactccattgcaccacactgggatccggtaaccag
-gtttgctgatacaaccgcgggcggcgcactctttgtgcctggcgatggtctatgccggctgcgttctccggcttctatgt
-ggcgatggatcgctcgtgctggcgtctttgttttaccgtccggtcggttttgggactaccgctcgcaagaattgggaaga
-aatcccgctggcgtaacatgtgggactgttgggcatgcttcattggttagcttcgtccgccgctggtaatttgggtgtca
-gcgttcggtaacctgttgcaggggtaccggttcaacgttgatgaatattctgcgtcctgtactagaccggtaattcttcc
-agttgctttaacccgtttcggcctgctgcaggcgtgtgagcggtagggatgatattactcaggggcaacgctatctgcaa
-tgcggtaccgtgggcgaaactgcacctgcgtacccgtgcaacggctttcaggtggcttgcgctggtgacactggtctgtt
-tcgacgtggctgcgtaatgggtgatgtacggtatcgatgttatgtcgtgaaatcgacaatggaccaattacgcagcctct
-aacccactgaataaagaagtggttcgtgaagctggcgcgcatggctggttcacttcaaacaacacgccaattctgtgggc
-tattcggccacctggtgtggttctgcgctgctgaccatcctgactgacgtaatggataagccgcgtgggcgtttggttgt
-ttctcctcgctgaacgctggcctgcagtcatcctgacagccggtatcgcaatgttcccgtttgtgatgcgcgtccaagca
-gccatgatgaacgcaaggtctgacaatgtgggatgcaaacttcagccagctgaacgcttacgtcatgacccttgggttgc
-ggtggttctggtaccgatcatttctgctgctacacaccgcctgggtgttactggaaaaatgtttcggtcgtatcaccaaa
-gaaatattgaaacgtaagcacgcacattcatgtactaagtaaggagcctaaaaatgtgggtaatttcgcatggatttctg
-ggaacgctttcttgcgctgttttcgtttggggtaatcaaccgcgctggcgcttgaaccacgtcgaatcaggcaaagccgg
-tcatgaagacatgcttgatgagtaagattatccgcgactgtgtatgcggtaatggaccagcgccgccctgcgggcgcttt
-ccttcgtgatggcgcttcctgttaggcaggatgtatggtttttgggacccatctcgttttgccgcgaagacgcaagttga
-actggaaatctgggcatggtttattgctgatgtgggccgtctgtgctggtgttgatttcacggcgtgggctttccgtccg
-cagaaaggttcctttgggcaagggattttttgcccattgcttgcgcgatatgttctcatgtgtcgggctgattttcttct
-cttttaatgcagaattctctttaccaaaattatgggccgctgccaggccataaatttttacgctccgttaacttgccctc
-attcaacactcaatcgcgcgcgtatagtagcagcgtttaaaagctctaccttttgttgggcattatccgggatgtaaagt
-gaaatacaacgctgttcgatggccggttcgcgtctactatgaagatacggcgatgccggtggtgtggtgtaccacgccag
-tttatcgtcgccttttttattgaaaagagcacgcacaggatgctgcgtccatcaatcactgtcagtcaggcatggcgctg
-atggctgaacgcgtttgctttgtggtacgtaaatgacggtggaatattacgcactgcgcgggctcgacgatatgctcgaa
-atacaggactgaaataacatcaatggtggcactctttggttttcacgcaacgttcttgtcaacgccgagaatacttttgc
-tgaatgaagcagaggttctggttgtttgcgtttggaccgcactcaaaatgaagccttcggtgcgctttcccaagtctatt
-gtccgcgagtttaaagcagtgactgtacatgaatatccttgattttgttcgctggaaggctagccttctggttaaactta
-tcatgttgatttttgattggtttttgcaatcgcatcttgggtgcgcattattatgccagcggacccgtttctaacgcagc
-ggggcgcgcgaagccgaagcgtttgaagataaattctgggtctggaatcgaactctctcgcctctatgcaagagagccag
-gggaaacgggataatctgaactggttcggacaaatccttttacagcgggtttcaaaagagttttgtgcgcgctgcatcgt
-gggccaatagcccctgcgcggaagccgtagtggaaggggcgtcgcggtgctatgcgtatctcccatgaatccccgtttaa
-ctgaaaatctgggaaacgcacattccgttcctcggtacggtggctccatcagccgtatattgggtctgtttggtacggtc
-tgggggatgcaatgcaacgggcctttatcgccctgcgggggcggtaacaaacaagcaaacagctgcaactggttgcgccc
-gtatcggcagaagcgttgattggcgactcaattggtgctgtttgccgctatccggcagtttggcctacaaacaccgcctc
-aaaccagcgcgtaaacaaactggaaagctgattacgacaactttatggaagagtttaccggcgattctgcacgcggctca
-ggcgttttacgcggttaagcgagagcaacagggtatgcatggccagaggcgcgtggacgaggtcgtcggcgatctcagtc
-gcgaaatcaaacattgtaccggtttgctggacgtactgctggtgctgttgctggatcttttggcgacagcggcccatcat
-caccagagcgtggaggttcgatctgcagacgctactgaatcagcaggcgggtgagcagtaacggataatccgcacgtgat
-tgttgtttaagtgtctggtattggtgccatacaacacccgtggtggttgagaaaagatcgcctggagcgtttaccacccg
-agcaggtgggtggcgcagtgtccagccgtttccaaggccaacccgaaaaccggtcttgtctgatcggtggcgcaaaagat
-gtgccttaacgatgaaataattaaagcactgaacttgttacatagtgcgggtgtgaaaattcggttggttaatgagcgca
-agcctacatctaaaatatctgcgttttcccttgcttgaaagagagcggggtaacaggcgaacagttttttgtggaaacgc
-gagcgtgtcaaaggcaaccgaacacaacgacaagctcaaggggcgataatatttcagcagtgctgcaatgtcatcttatt
-tggcggcggctgaatctggagttcgttcgatgagaatatagaagctcagccggaggcggcggtggttcgtcatccgacgc
-tgtcatggttgattcaggtggcggtagttgagcagtaacaaacgcatgcaaagccaggaatcaagcgcgaaagcgttctg
-aatgaacagcggcaagatgaaggaacagcaggcctgctgaagaactggccgtgaggaaacaagcggctgaacaggaacag
-cctgaaggcaacttgagaaagagcggttgcgggctgcaggagcagaaaaagcaggctgaagaagcgcgcaaaaaacaagg
-ccgagttaaagcagaagcaagctgaaagaggcggcagcgaaagcggcggcagatgctaaagcgaaggccgaagcagatgc
-ctaaagctgcggaaagaagcagcgaagaaagcgggctgcaagacgccaaagaaaaaagcagaagcagaagcgccaaaccg
-caagcccgaagcgcagaaaaagccgagggcagccgctgcggcaactgaagaaggaaagcggaagcgcagaagcaagctgc
-agctgaagcaagaaagaaagcggcactgaagctgctgaaaaaaagccaaagcagaagctgagaagaaaggcgctgctgaa
-aaggctgcagctgaataagaagagcggcagcagagaaagctgcagccgacaaaaaagcagcagaaaaaagcggctgctga
-aaaggcagcagctgataagaagcagcggcagaaaaagccgcgcagctcaaaaaagcgggcagcggcaaaagctgcagctg
-aaaaagccgctgcagccaaaagcggccgcagaggcagatgatatttttcggtgagctaagctctgggtaagaatgcagcc
-gaacagggggaggggcgaaaggaacaatgcttcgcactgcccgggagtggtaatactaaaaacaatggccgcatcagggg
-ccgatatcaataactatgcccgggcagcttaaattctgctatcgaaagtaagttctatgacgcatcgtccttatgcaggc
-aaaacctgtaccgctggcgcataaaactggcaccgatggtatgttaaatgggatatcaaacctgaagtgggggcgattcc
-cgcagtttgtcaggctgcgttggcagcagctaaacttgccgagatcccgaaagccaccagcccggcagtataatgaagtg
-ttgcaaaaaaaaacgcgccattggacttcaaacgcgttaatcggcgatgttgactgttccggacggtcaacatcaaggca
-ccggttgccacggggttctggtagttttttggttgtattttaagtttgtttaacattcttgctaaattatcgtgggccat
-cggtccagataagggcgatatgatgaagcaggcattacgagtagcattggtttctcatactgtgggcatcaagttctgca
-tgctgaagtccgcattgtgggatcgacagcgggtgtagattcggtcgtccttattggtggttgttccttcagtgggcggg
-gcctgggtgcggcaactgaagaattattggcggcatcgttgctgctgacttgcgtaaccagcggtaaatttaattgcgtt
-agatgcgctcggtctgccaccgcacagccgggtagtgcggcaaggaagtagcaaccaggccgcatggttccgcactggca
-ttgacgctgtagttgtcgtcaggtcactccgaatccggaatggttcttagcaatgtttgcttatcaactttgttgacact
-cgcggcgcaccgggtagctgtaacttgctcagaactcgtaccaaaagtgaacaaagcagtggcctgcgttatgcctggtt
-catacgccagtgatgaagtgttttgaaaaactgacggcattaaagtgcggttccgtactcgtaattgctccgttgttcag
-acaacggcggtcagtttcccgtatgaactgcgcggtatcctgactatgacggttacaacgcagtttgtgccgtttcactc
-gttcaccgcaggcccgctgatgtctcccggcgtggttcaccagacggttctataagctggctttatgtgaccttcgaagc
-ggtcgttcccgcgctggttattcagacgctggctaaatggcgctgtgcgttgcaggtggcttcattcccacgtcagcaaa
-cggtgcacctgcattctgcgccagacggcagcaaactggcattcgctgtcgaaaaccggtagtctgaacgtgtacgtaat
-ggattttggcttctggtcagatccgccacggtgactgatggtccgcattggtaacaataccgaaccgacctggtttccgc
-gggatagccagaacctggcatttacttctgaccagggccggtcgtccgcaggttttataaagtgaatatccaaaacgcgg
-tgcgccacaacgtattactgggaaggttcgcagaaccaggatggcggaatgtcagcagcgacgggtaaatttaatgggta
-atggtccagcttccaatggtgggcaagcccagcacattgcccaaacaaagatctggcaaaacgggagggcggtacgaagt
-tgctgtcgtccacgttctggatgaaacgccaagtctggcacctaaggcaactaatggtaatctacagctcttctcagggg
-aatgggatccgtgctaattttgttttctttacagatgggcgtttcaagcgcgtccttccgagcaactgatgacaggtcaa
-gattcgccctgcctggtcgccgtatctg
->m141013_011508_sherri_c100709962550000001823135904221533_s1_p0/400/0_21762 RQ=0.868
-aaaacggaaaaaaaagaggggaaagaaattgccctagtggggggggggtttaatcaatccagaagggctttttttttttt
-agaaaaaaataagggcggcccgcgaaacagggccaaattgaaagaaagggttttgccctgttcgatccctgaaaacaacg
-tgcttttagtgcccgccgcggcagaggaaagggttttttaaaaattttccgcgcccttgacccgcgacggtaaaccattt
-ttgaactggaagcagaacgtctggtttaggcgcctccttgttaattcagcatgagaatggaatcacctggtttcggcaaa
-ctgtttatggattatctggtcaccgctggaaaacaacaacgtaatttcgtcagaaagttgaaaaaaactggatcgtctga
-aagcgccgggcttaaggataagaaactaaacggtgtcagaatcactacgtattattttttggcgggtacacctggaaacc
-ttttgcaagcgggcgtcatctcggacgcgctgttgtcttctggtcataacgtcgttggcgtgttcaccgcagcccagacc
-gagccgggcaggacgcggtaaaaaactgatgcccagccggttaaagggtctggtgagggaaaaaaggtttgccgtttttt
-caacgctgttttccctgcgttccacaagaaaaccagcactggtcgccgaacttgcaggcttgatgtttatggtcgtcgtc
-gctatggtttaattctgccgaaagcagtgctggagatgcgcgtcttggctgttatcagacgttcatggttacgtgctgcc
-acgctggcgcggtgctgcacactgcccacgctcactatgggcggggtgatgcagaagaaactggtgtgacgcattattgc
-aaatggatgtcgggtttaacaccgggtgatatgcttctataagctctcctgcccgattaaactgcagaagataccagtgg
-tacgctgtagcgacaagctggcagagcttggcccccacaagggcttatcacccacgttgaacaactggcagacggcaacg
-gccgaaaccagaagttcaggacgcaaactcttgtcacttacgccgagaagttgagtaaagaagcagcgcgtatttgactg
-gtcacttttcgggcagcacagcttgaacgcctgattcgcgctttcaatcgcatggccatgagcctggctggaaattgaag
-gaacagccggtaaagtctggaaagcatcggtcattgatacggcaaccaaacgctgcaccaaggaacgatccttgaagcaa
-caaacacaagggcattcaggttgcgactggtgattggcatccctgacgctgctctcgttacaacctgcgggtaagaaagc
-gatgagcgcggcaagactctgaactctcgtcggaatggtttgttccgggcaacgtctggtctgaatagtcgcagctgctt
-ctacgcccggtcttgcgcgggcggtttatacttatgaaaaaaacaacgtaatttacgtagcatggcggcgccaggccgtt
-gaacaagtcgtcgatggcaaggcaatcattagcaacattctgccaccgtccagcaaaaggttttccgaataaagacaaag
-cacttcttcagagttgtgctttggcgtactgcgtacgctttcgcagttagaactggctgattataagttaatggcccgtc
-cgatgaccggcaacagcggaccgtgcattacctgattatggttggtttggtatgcaactgtttataccgcattccagcct
-caatgctgcgctggctgaaacggttgaaggcgctataggcaattaagcgtcgcaaacttcaaagggttgataaacggtgt
-attacgccagttcagcgcagcaagaagagttatttagccgagttttaatgcagtggatgcacgttaatctgcatccttct
-ggtttgctgaagcgtcctgcaacaaaagcgtatccagatgcagtggcaatccatgcgtcgaagccatacagcgtcgcggc
-caatgtggctgcgtattaatcgtagcgccattccccggcgaagctggcttgcattgctggatgaagcaggaaatgaaagg
-tttcccggcatgcggattaccctgatgctgtacgtctggaaacacctgcacgctgttcatgcgctaaacctggttttgag
-acggatgggttaccgtttcaggatgcatcagcacaaggttgcatgatcctggcttgcgcacaaaacggtgaacacatttt
-ggatctttgtgccgcgcccggcgtaaaaacaacggcatatccttgaggtggcaccaccgaagcgcaaggttgttgcggtt
-gatatcgacgaagcagcgccctctctcgggtttagcgaaatttaaaacgccttggtatgaaggcgaaccgtgaaacaagg
-tgatggccgttaccccttctcaaaatggtgtgcggaggcacagtttgatcgcattttattagatgcgccttgttcagcaa
-cgcggtgtgattcgtcgccaatccagatattaaatggttacgtcgcgatcgcgatagtccggaactcgcgcacattgcca
-gtctgaaattctgacgccatttggcgcatttaaaaaccggtggaactctggtctaatgcgcacctgttcgggtgttacct
-gggaagagaatgccctgcagattaaagccctttttggcaacgtaccgctgatgccgcactttgcgaaagcaggaacaacc
-agagcaacgggtaacaaatctacctggtgccgaagagggcgacggcttcttttacgctaagctaatcaaaaagtgatgag
-ataaacgggttgccgactgaatgaaaattatcattctgggtgcccggcctaggttggcggcagcagctggcggaaacgct
-ggttggcgagaaaacgatattacttgttttgtcgatcaacggtgagcgtgctgcggaccttagcaggataaatttgacct
-gcgggtcgtgcaggggcatggcttctcaatccacgcgtattgccgggaggcaggtgccgacgacgccgatatgctggttg
-ctgtaaccagttcagatgaaacaatatgggttgcctgccaggtagcctactcacttttcaacacccaatcgcatcgctcg
-taatccgctcaccagaactactgcgcgatgccgataagctatttcattcagattgctgtgggccgattgatatctgattc
-gacaccagagcagttggttatcgatatatttaaccgactgattgagtatcccggcgcattgcaggtgtgaacttcgctga
-gggtaaaggtcagcctgggctgtggtaaagctattatggcggcccgctgattggtaaatgcactttcgaccgatgcgcga
-acatatgcacatatgatactcgtgtggggcagcaattttccgcacgatcgccccattccgtccgcaaggttcgacggcat
-atgttttggaccgctggctgaatgaagtgttcttttattgccgctttcacactagcatatccgcgcggtgatgagtgaaa
-ttacagcgactggaaaaaccgtataagcggatcatgctggtgtggtggcggtaataatcgtgacagggccttggcggcgt
-cgtctgaaagaagattacagcgttaaactcatcgaacgtaaatcaggcagcgcgcttggccgaactggcggaaaagttac
-agaatacgatcgtcttttttggtgatgcgtcggatcaagaactactggcccgaagaacatatcgatcaagtttgatgctg
-tttattgcccgtaccaaacgatgacgaggccaatatcatgtcgcgccatgctttgcctaaacgtatgggtgcgaaaaagg
-tgatgggtaattggatcgcagcgtcgcgcttaattgtggatgctggtttcaggggagcgttatcgatattgcgattttca
-cccaaacaagcaactatttcgcgttgcttagccatgtgccgaaaaaggcagatcttgttggtgtttctcattggcgcccg
-cgcgtagagcagaagctattggaagccgttgtgccagcggtggatgaagcaccctgcacgggcgttgtcggccagagtca
-ttggacgaattcaagctaccgccaggaacgattccttttggagcggtggtacgtggaaacgacgtgatgattggccaatg
-acaatctgcgcattgagcaaggcgatcacgtaatttatgttcctcacagataaaagtttcattagccgacgtcgaaagac
-tgcttgcagccaagcactttctttcttgtaattagataaggcgggtccttaatgacgccttattgatttccctttgaatt
-atgcaaggatttaattaaaattcattgcctggaaggaaaaaatggggcttaaatttgttagactttatgggttgtcggct
-tcatagggagaataacatgagcattattaaaggaatttcgcccgaatttgcgatgcggcggaacgtggtggatttggcgg
-tgggtgtcattatcaggtgcgggattcgggaagattgtctcttcactggttgccatatcatcatgccctctctgggttat
-taattggcagggagtcgattttaaacagttttgctgtcacgctacgcgatgcgcagggggatatccctgctgttgtgatg
-gcattacggtgtcttcattccaaaacgtctttgaattttcttgcattgtggcctttgctatcttatggcgattaagctaa
-tctaagcaaaactgaatcggaaaaaagaagaaccagcagccgcaccctgcaccaactaaagaagaagtattactgacaga
-aattcgtgatttgctgaaagcgcagaataaccgctctacacaagcgctgaaagcagaaagaccagtggtaaaaaacgtga
-tttactttcttgccacttgggcctcccagtttgcctgagccgattggcaatgtttttcctttttcgcatgtaactgcctt
-tcccgttctttattttttctctcgcgctggtcggaataaggattcatgtagtaatgcttctatcggcattatcctttatc
-tgcccctttagtactgctgatatcgcctcataaaaaccgcagttgttatttaaacggtcgcgagtgtaatcgctgccagt
-gcaaaaaatcaacaacacactcttaacgcgcactcgcccccttgttcaagagcttccaagaatggaacgaataaacactg
-ctatgagcagtccacaacaggcatcgttaaggcgttgcaaggaacgctgcatactctgcaactcggctaatccggtgcct
-tcgttacttcctgcatctttcctgcaagcaatgcctttgactcctgacaggtatggtggttcaggattcgatgcggatcg
-acagcaactgcgcggatcgactccagactgaaacttagttgtctggcatggcggattaaatttcaatcgctggagaaatc
-gtttccggtaatatagggaacccaccttcaagtacgcattcacttggctccatcatgctggctgtttttccgtaaataac
-agaatcgtgtcggttgttacttccgccatttttgccagctcacaatgcgataatacatactccacctagttaatcggttg
-attttgtccaacaacttgttcagcataatcgccggcgtaaaaaaaatcgtactgcaaatccagctttgtcgcagctttca
-attccagtaatgacaatcggacggctaaaccctgctgatattggcggatcatcgtggacggatacctttgagaatatcca
-agaaggctggaattgtcttgcttcgcgttgctcacagttctggcggggtaagcaaccggcaattgcttcagcaagcgata
-ccccgcagcgtaattcggtggcaacgtgagaatcatcatccagtatgcaatggttgccgcttacgctgccaggttatcaa
-actcacctttcgcttgcgcttctgctatatggcgctcctgcccactgggtcaaggtaccacattaaattactccagggat
-gaacaaaaagagtacaggctattgtagataagtggggatctacgggtataaaaaaaacgccgcgcggggcgggttttttt
-acgtgctttcagattacttgctggcagcagcttctgctttctctgaagcgatgcccacctagctcgatgttaagccatcg
-gcgcgttggtcgctgcacgggaagcccacactttcagaatagcgagtgtatccaccgggcacggcctcgcaaacgcgtgg
-cccagttcgttttaaacagtttttttgccacgatctcgttatcacgagtacgggcgaatgcgccagacgagttagcaacg
-ctatcagttctttggcaaagagtaattcagcggggctcactacgcggcgtgcagcttttcgctttaggcagagtcgtctc
-gatgcatttcaatgaggacgaacagtgaacctgccatattgcgaacatagcctggcgatggctggctgttgcgggttcag
-ttgaacgaccactcttacgatggcgcatgaacttatccttctcagtaaaaccttaaacgctgtggatccggttactcgtc
-agcgaatgctttgtgccggtggccagtttttcgcaaggcgcatgcccagagacagtccacgggaagccagcacggtcttt
-aatctcagtaagcgaatttttttacctaaggttaggcgtttaaggaggccttcaaacctcgtacgctgtacgcagatcac
-cgggatatagtgggatagcttctgcttttaaggcagttagcagagcggacagtcaattccagatcgtcaacaggggcgca
-gcaggatcggaatcgaacctctggtttctcttctttttcaggctgacgtaacatcacgtacgtcaacgaaagcttccagt
-tttttcagcgccagaatggttgccggcagacacgaatcgcctcttcaggatcgattgtgccgtttggtattccatttccg
-atgaccagctttgtccaggtcggttaaacgcttgtttacacgcgcttgcttcaacattgtatggagcaatacgcttccac
-agggctgtagcatgcgtcgacgcagcagaccggccgattgggcgctcatcttcttccgaatgaaattccgggtagaagcg
-gccacataaccacgaccgcgctgaaactttggataacggcatgtaatagaccgcgttctcatcggtcaggtggggcagat
-cacgtgctgcggcttgacgatttcgggaccaatcaccgtcgtgggtgatatgccgctggcagtcacagggccaatgccag
-atttatttatcaaggtaagaaataacttcatcttgcccttgaactctcaccgccagccctttcaggttgaggcaggattt
-ccaggatatcttccttgaacgcgcttctttggtgcctgtactcattgtagttacaccatcaatctcaacctcggtcccgc
-gcaacccggcatcgatgagaagcaggtaatacggcgtcaagtgcgtttacccagagtatgggcaaagccacgctctaagg
-ctcaagggttcacgctggcgtgcgtcgaactcacttgctcgttatccactaaggcgcggttttagaaacctgtcacagaa
-cccgcaattgtgtcctctctttggtagctaagactttacttgagtaaagctcgacgatcaaggtgttcgttaatgtccgc
-agaacagatcagaacgcttccggcttacgcttaacgtacctttcatcttgcagcaatcaaacttccagccaaggtttggc
-ttttctacgctgctccagccagctccagagcggcttttcacgcgagactgcttcttcgcttttctcacgaatgcttacaa
-cgtcattcgactaacctgataagaagcgatgttaacaactacgaccgtttaccataattgctttatgggctaacgcagct
-gacgtgcttctgcacgagtgcaccgaagcccatacggtctacaacgttgtccagacgacctttccagcagagcgcaacag
-gttttcaccggtgttgcctttcagacgtgcttgccttctttgtagtagttacggaactgacgcttccagcacacatagaa
-tacgggcgaactttttgcttttcacgcaactgcacaccaatagtcagacagacgcggttagcgcgcaccgtgctggccca
-ggacttgttcaattttttacacttggtatcgatcgcagcgacacgccagaacttaaggaataagtcggtgcctctacgga
-cggctcagctttgagcttaaggacccaaatatcttgcattttcttttctcgcaacaaacctgggaaaacgaggcgttata
-cgcgacgttttttcggcggacgacaacggttatgagggatcgggaagtcacatcagtacatgttagtgatgcggaaacct
-gcggcgttcagagcaccgaatagtagatttcggcgcgctggacccggactttaagcgcataacttccagattcttgatgc
-cgtaattctttcacggcgtcacgcgcacccgctctgctgcagaccctgagctggcaaacggaagtggtttgcgagaaacc
-cacggaaaaccggaacctaccggctgttttgcccaagcccaacgcgttacccctgacgatcagtgatagtcacgatggtg
-ttgttgaaagaagcatggatatgaagccacgccgtccagagacttggtttttcttagcacgttaacgtgcagcgattggt
-gcctttgcattattccaatcaccccggatctattttcttgatgcggtttgcgcggacccttacgggtacgtgcgttgtcc
-ttggtacggctgaccgcgaaccgggagaacacacgacgaatgacggcacgcgatagcaaccaagaatccattcaggcgct
-tgatgctgcatgctgatttcacggcgcagaatcacttcaacggacaaattttggcaaccttcgtcacgcagcgtgtcgat
-tttgtccttcagacagctcactgatcttaacatcttcaatccgacgataccgctgcagtccagggatggctttagaacgg
-gttcttgccgagcgcataaatcgaagtttaatgcgattacggcatgcttatgatcaggaatgttaatgcatgctatacgg
-gcactatgcactcctactatttaatcatgtacgttccgcatgctgaaaacccgtttttcaggattactcaaatgggaaac
-gcacagacatacaaagagattggctgggctaatctagccagctcaaccaactttgcaagaaaaatatgcgaaaaaatcag
-ccttgcgctgtttatgcttcgctggcactgaaattcactacggatgacaccatcacgcttaaacgatttttgcagttacg
-ggcataatttcttgacggaagcacgaactttcatttttactgctccgtaacgttctcgggcgaccaattactcggccgta
-gcctttcaggttccgccttcttcaatgcagactcatactgactggaatcatttgcaagaaatttttttttttgggcactt
-ggcccataaagttcataatgcacgacaacaacgatcaaggcagtggaggtcccccgaagtagaacggtagcttttcattg
-catcacgcatgaacctcccgggaatcaggcagataaaggtaatataacagcgaccaacagctagggtcagggcgggggtg
-cattatttattcgatatacttcgccgttgctctcgcgcggacgattcctggtaagcaatgcaccggacttcttcaggtta
-tctgctgttttcaacgcgggttgaaaaccaacgccgtgtagaagaaacagaagaagatgattgcagacgcatagagtaac
-acataaagcggttgcccaggctgcaaatacagcgaaattgtttgtcagccagttccaaccaagtacgcgccgccgaagca
-tgaacgccgatggtcgccggggaacagaataatactggaagcgaaagattgccgggatacccccgtcccactattcactt
-cagcgggtaaatgtgtgcctgtggcagcatagaacacgacgaccttgccctgacgtttcgcgtagtttaccacaatgcgg
-cgttggacacactgctcaacaaatacaacaaagacgtcactgccaaatactaataactgcaaccaacagcaacacgagga
-agtgcaggtcgcccttgacgcgctttgcttcgatagtatgggcaatggctggcgggagttccccgcgacaataccggcga
-agataatgattaaataccgttgccgctactcggttcagtaatgctgttcgcccaacgcacctcaggaacatggttcctgt
-gacgcaagacttacaacagcggtgaagtagaatgcaaagcccgggttaatcaccaggccttgccatacgcaggcatattc
-ggcagaacgcgggtagcaataccgaatcgacctggaatattgccagcaccaagagtaccgtaagcgggtggtactggctg
-atcttacgaacgacgtcagacttccccttctttcttaattttctgccaacgttgggtggaaccaccggtcagcgaagctg
-gagtaatggaatcgacgccgaaatatacggtcatgatgccccagagcaaagatagaagcacgagctagagcaccccagag
-acatgtttaaacatctcaatgatgggtgcctgcgctgttgctcaaagcagttttggcaagtacagcggcatcaatacgcg
-ggatgcggaataaaagagccaataacgggacacaatcagcgcaccgataacaaacaggcagtcctgtcgtttcaagctcg
-cctaagccaccttttggcacttttgaaaatctaatgcccgttgtttagccatctgctacttattctcgatttttaccgcc
-agcaagcttcgataggcagcacgagcgcctttagtaacacgcaggcgcacgaacagttttttaccggagtcgttacttcc
-gcgcagcccaggatcgactttccgcgaacagtcgatgtctggatacgataatgttaagcagctttcaggcgtgttcagtc
-tactacagccgccttctactttcggccaggtccagacagaacgaatttcggctgttaaatcgctggctttacgagaagtg
-aagcgaattttcggcagacgacggtacagaggcatctgaccaccctcgaaaccgcgaacggtacgcaccggccagaacga
-gacttgctgacctttgtggacgcacgaagagtggatgagaaagtgggtggaagttgagggaagatgaagctcaccggttt
-accgaggccagaaccgatacccacgacgccaggcgttttacagcgctcttttggagccttggccggagacagagtattta
-aaacgcatctcttactcctcaactttaaccatgaaggaaacggcgcgttgatcataccgcggaataggcaggagtaatcc
-tcgcgctctaacggtgtgacgcaatacgaaggcagacggccaggccaagcagcgttgccttgtgtttcggcatgacgacc
-gattgcactgcgggtttgagtattttaaatagttcttgcatggtttatttccccacgaatttcttcaacggggatttacc
-acgcttttggccagcgaccatttctggagaattcatatttttcacaggccatcaatagttgcaggcgaaccaacgttgat
-cggcgttggtgggaacataggctttagccagaacgttatgaacccagcgacttccagaaggcgcgcattgcaccagcggg
-cgatgatacggcggtacctttcggaggccggctgcatgaataacgcgagaaccgcgtgtgaacacctttaacagggtgtt
-gcagagtgccggttattcagcgcgacgttaatcatattgcggacgggctttttccatcgctttctggatcgctgctggaa
-acttcagcgcgcttaataccgtaaccaaaaccaacgcgacccgttaccctcggccaacacagtcagagctgtgaaggaga
-aaatacgaaccaccttttaacggttttttagatacgcggttttacgcgcgatcagcttttccttgcaagttcgcggcagc
-ttgtttttcgatgtgagcctatctttacacctcttacctttagaactgaaggcgcagcttcacgggcagcatgctggcca
-gtgcctggacacgaacgcatgatattggaaccggaacggtcaaaaggatacatctttgatgccttttttccagagcgcgt
-tcaagcgaacagcttagcccacagctggccgccgcgtctttgttaccggtgtagcttcagttgtttcagcgattagcttt
-ttctacagtagaagcagctcccagaacttcaagttgaccgttcggtggcaattacctgtgcgtaaatggtgacgcggggt
-acgatgtcccacgcaggcgagttgcgcccagctcctggagcttgcggcgtgcgcgggtcgcacgacgaatacgagcagat
-ttcttatccgatagtgttttacgccttaactttcttctttagcctcttggtacgcacgacttcgtccggcgtaaacgaac
-acccttgcctttataaggctcaggacgacggtaggcgcgcagatccgcgctgcaacctggccgatcacctgcttatcagc
-gcctttctagcagcgatttcagtctgagtcggacattccaagcgtgaatacgccgcagggcagctgatggtcacaggaat
-gaggaagaaacccagagacaagtgtaatcacaattgcctttaaccgctgcacggtaacctaccaccaaccagctgcagct
-tctagtgaagcccttcggtaacaacgcgataaccattgagtttcagcagggcaacgcgcggtaccagcgctgtgccgcaa
-acgtcctgcgtaaccatcacgcggacgcgaagttcagggtattatctgcattttttaacttcacagcatgcgtttgagaa
-gtacgccgtcagccctcgccgttttttacctttgaatgcgtaaataagcctgacgttgatttttaacgtcaacgccggca
-ggaacaacgaccggtgctttaagcaaacacgaagacaaaattttttcctccgattaggctacgtagcagataatttcgcc
-atccaagaccagcctggcgcgctgcccgatcagtcaataacactttaagaggtagaaacgaaactgcgatacccagaccc
-gccatactttcggcagctcatctttacgtttatagatgcgcagacctgggcgctggacacggctgatgcctttctagcaa
-cagcttttggcctggaaatacttcagagtaaagttcgcagttcatggcttggtggtcgggcccttcaactttaaaaatct
-tcaatagaaacctttcttccttcagcacgtttggcgattgccaactttcagccttggaggaaggcatggtgacgcagctt
-tgttcgcggcttgaccgtgatacggatacgggtcagcatatccgcgatttcggatcttgcatgcttcatctgtctttact
-ccgtgattcatttggtgacaaattacgagctagccttgttcagaccccgggatttcaccgcgcataggcggcctttcacg
-gaccttaatacggctcaacccgaaacttccgcagaaaccattgcggacgaactgtttgacgggccagcggttacgctgac
-gagacgggctggaatcacgcgctagaggtctgcagcttgagaacagcggtttcctaacgatgcttcgtcgtaagcgtttt
-cacatcagagatgatcgctttcaggttcagacgcgttttcgcgaagtaatttatcagctaaagctacgcgttttacttcg
-cggtgctttttcattgattgcttaggccattttagtaaccctacgttacttgcggacggaacgtcaaggcagccagcaga
-gcgcggcctttctttcgtcagatttcgcagtagtggtaatggtaatatcaaacacgaacgcggtcgacctttatcgtagt
-ccatgatttctggaagatgatcctgctcagggacacccatgctgtaggttaccacgacgcgtcgaaagacttagcggaca
-ggcctagcggcagtcacggatacgaggtacagcaatagtgatcaaggcgcttcaaaagaatcctccacatgcgttcgcca
-cgcaagagttacttttaggcgccgatcggatagccctgacggattttgaaagcctgcaacagatttgcgtgctttggtga
-tcatgcgtttttgaccggaagattgctggccaggtctgctgcttgcgttatccagcatgtttttttgtcagcgatcgctt
-tcacgcaacatccatgttccagggtgatcttctcgacccgagggacttgccatgacagaattgtaagttaaactcagtca
-tttgagtttttctaactacttcgtctttgtagtaatcatgcagtttcgccatcgtactaattccaaattacttgatagtg
-ttcgctgttagacttgaagaaacggacttttttaaccgtcttgaatctaaagcctacacggtcagccttgccggttgccg
-gcttgaagattggctacgttggaaacgctgaattatgtgtatatgtatgtacccggtgttcagggccgggaacgcggctt
-gctgatgtttcttaaacgcaggttgataccttcacatgaccttgccggaagacagacaattcttaactttaccgggcgtt
-tacctttaatctttacggttaacacgaactaacttcgtcatcacgactgggaattttcgcatgcatgaattcggctcctt
-agagtacttctggtgcagagagatttaatttttcatgaacttctcactaacgagctcactgagttaccggcccaaaaata
-cgcgtacgcgaattaggctgcgctcgctgttgtttgttcgaagaacacaagcattaccatcgaagcgaatgacagaacgt
-ccgggcgacgaacacacttcttggttgcgcacggcactaccgccttcagcactcacctttttttgaccttacgacgcgga
-attgcttctttgatggtgatcttgatgatgtcgcctacgcctgcgtagcgacggtgcgagccacccagacctttgataca
-cattacgcgacgtgcaccggaagttgtcggcgtacgttcagcatagtctgtttcgttggatcattttagtggctcgcgac
-taatgtcaactccctactgagtaccccgaaaatcaggtcgttaaaaaaatccccatatcgagggcgcggcattataacac
-cgcttcaaggatatgggtagaaaaataaacggctcattttcctgagccgtttattcgtattgagagagtgtactggtata
-cagaaccgctttctctacaacgcgaacgcagcgtcccaggatttagtcttggacagcggacggcattcgcggatttcacc
-aaaagtcaccgataccgcattcgttgttctcgtcatgtacgtgcagtttgggcgccgtcgtacgcttgaatgaatttaac
-cgcgtagatcgggtgtttcaacaaaacgtttgtcgataggcaacaacaatggatttttctccattttgtcgcttaacaac
-gcgacgcttgcagagtacggattttatcgtcattaccgcacccgcctctcgttcagtaaagtctaacgcgtgcgacatgc
-gacgcccacttgcttcaaacaggtgagtactgtttgcagctggccactttggcacgcctgctatacgtccaggttgaact
-gcctcacgcagcaggttcagcagctcggtgttcaagctcttcaacgctctttctcacgcagctctttgcttgcattacat
-caccgtctttagttaacaaaaggtggttttaatcggcagtttcgctgctgccagcttgaatgcttcacgggcccagctct
-tcccggaacaccgtccatttcatacaggactttacccggcctgaatcaaagggcaacgcaattacttcacgtttatacct
-tttcctttaagcccataccggcactgcagcggcttttcagtgatcggtttgtccgggaactacacggatccagatcttac
-gcttgacgcttaacttgcacgggttcatagcacgacgtgctgcttcgatctgaacgggcagtcagacgaccacggcccaa
-cagcttttcagaaccgaaggctgccgaagctacatccgtaccctgcgccagaccgcggttacggccttttgtggcattta
-cggaattttgtaacgctttggttgtaaatacagccgacgctccttatttagcgggcctttacggctgctgctttttaggc
-tgaagggcagccgtttttttccggttgttcaacagcagcatacgcaccgcaggatctcgctttgaagatcgcacacttta
-acggccgattacacgtaaagtggtgtgcgcttccaggaggtgttgtagtcgatgtcagcacgcagagtgtgcagccggta
-cgcgacctttccgcgtacgcattcggtacggtgcgcatttcgcggccgcccaggacggccgctaacttcaactcaacttt
-aataccctttagcgcccgccagacgcattggcgttctgtacagcacgcttttcatagacgacggaacattaacgcgacgt
-tttccagctgaagaagtgatgtctgtgcagcgaacatcagtttttgcgttccagtttcaggctttacgaacttcggcgat
-gttgatctgtgcaggaacgccagcggctgtctcgctacgaccttaacgcagttttttacgtttcacctttttttaagccg
-ataacgatacccgggcgagcagtgtgaatggttacacggtgctgcttagcggcggaacgctcgataacgaataacgagat
-accggacgctttatgccagttccttagtcaaggtagctgacgtactttaaaatcgcctgtttccaggttgtcagcgattc
-tttggtgttcgcaaaccaggtagagttcatggttttaccaaataccatggcgaataccattaggaatgtactttctgacc
-ccattgctagtctcagagtctcagcggaaatcggacacaaccagcagtgatgtggctggtgcgcttcaggatgcgatgct
-gcacgacctttttgcacgcgcataatgcgacattcatgctcgggcgcttcgtctacgataaattttcgtaactttcagat
-gcgtcaatgttcagcgccatgccgttgtgttcagcgttaagcaatggcagattccagaactttcttgaccagtacagccg
-ctttcttgttggtgtaggtcaaaattatccagagcctgcgacaactttcttaaccgcggaaatcaggtgcagcacaaagg
-cgaaccttctgagcaagaagaacgagctatggcgatgtttagcgatagtttccatctcttcctctaccttatttctttct
-tcgctttttttatcaaggcagcggtggccgcgataagtagaagtcggtggggcgaattcacgaccagtttggtgaaccac
-catttcgtcccggttacacataccggaacgtgcctgaacgacgcattatggagcaggcgatggttcaaaccgaatcatgt
-taaggaaagatcgttgaacgaccgggggacgcaagtgcccgcaggggcttcttgtctccgctttcaccgtttctctactt
-ctttcttcatgcaagtgcaggtcaataaaaggacctttcttgaagaacacgtgctatggtcttatcctctaaaattattt
-gctacggcgacgtacgatgaatttatcagtacgcttgtttttgctgccggggtcttctacctttggtcttgaacgcccca
-cggagttacgcgggtgcttaccaaagttagcgacttcaaccagcaccatgtgggtggtctaaaccgggttcatcgcgtac
-gcgcgaaacggtcgacgaacacacgcagcgtgcagcacctgctttcccccagaacgcgcaggcaatatgcctgcaggcat
-tgcccaacttcgccagagttgcaacggcagtactgcttctactttacgcattttcaccagaaccgcagacggcagggtga
-cctaagcagccatcatcgagcaaacgatctgaacgtaaggtaagccagcggatacgtgccagctgacccgctttaccttg
-ggtttccattttctacgttttatgaaacagtagaacaccggggatgttgcgcatcggcagggtgttaccttggtttgatt
-gcagcatcaacgcaagactgaaatctggtcgccagctttcaaaggcctttaggggccaggatgtaacggcgttttcacgc
-gtctttgtacagaacgcagcgcgatgttcgcggaacgttcggatcgtactcaagacgttcaacaactgccggataaccgt
-ctttgttgcgtttgaaagtcaacaatacggtaagcctgcttgtggggccaccacccgatattgaacgagtggtgataacg
-gccattgtgttacgacggcaccggatttgctgtttttttttcggcagcaacgggcaaaaggtttggccttgtggtcagct
-gcagggttaaccacgctttaaaactacgtggcgacgacccggagatgtttcggttttacatttaacaactgccattgtaa
-ttagctcctccgacttactcagcgccgcgcaagaagtcccagttctggccttctttcagggtgacgtaaagctttttcca
-gttagcctacgacgaccgatacgctgtcccgtgacgttttaactttcgcctttaactaaccagggtgtttaacgacttcg
-acttcgactttcaacagttttctgcacacagcttgattttgctttggtcgcgtcttttagcactttgaagtacgatggtg
-ttggatttttcccatgcgagtagagcgctttttcagaaacgtgcgtgcacgcagcaccttcaggcaacgttcttcacgaa
-tcaaatgccagcatgctcctcaaacttggcttaacaagcatcagcagtcattacgacttttgtccgaaggcgatcgaggc
-taacgcgggtcgaatacacgtttatcgcgtacgtcaacctttgtggcaggtttgcgcggcagccaggaacagggtttttc
-gtcgcagctcacgtggatgatcagcacatccttccagaggccatgtctttcagtttctgtgccagcagctagttttcggc
-gcttctacaagaattcctctgacaacgatgcagcaccgatccggacgtacccagttcgaggacaggatgcttttcacgcg
-cgcgcggtacatttctttgtttaacttttttgactgtggtcctgccggacgagcagcaaaggtcagctgcaaacgcagaa
-acgccagatcggggctctgatagacacgccagaacgcgcacggccggttgcctttctggcgccacggttttttagcggaa
-ccagttacttcagcacgagtcttctgacacgagtaacctgacgagccaccagctgcatcaagcaacaacacctggtgaac
-cagcggcttcgttgcaaatcacgaccgaaggtagtttcggaacagtccagcgcgcctgcgcgtcttcaatataattccat
-tgctcacctactccttacgccttcacagctggtttaaaaacgattcaggtcgctacggtttgcacgccgggcagcacctt
-tcaccagcagcaggtttgcgctttcagcgtcaccggccgtactagtcaaggctctgaacggttacacgttcgttacccca
-tctgacctggccattttctttgccctttgaacacgtttgccgccggagtctggttctgacgcatagaagcgccggaatcg
-cggtggagacaaggagtttaccgtgagtagctgtcctggggtaacggaagtttccaccgcgcttaacgccgtaccccctg
-gacctttaccttctgggtgcagttaacgtcacttttttaacgtcagcaacagttcaagctaactgctcctgcactacagt
-gaactctttcgcctcagccagggccggaatacccacagaccacggcccagcttctagccagctttagcgaagtggccagc
-tttcaggcttggctcacccccggcttagcttttttagcaccggtggtcacctgaatagcacggtagccatcgttagcaca
-ggttcttttaactgaagtaacgcggttttgcttcacttcgattacgcgttctgggatgaacagccgtcttctgtgaagat
-gggtcataccccactttttgacttaaaccaatcatgtttcacctctcaatcgctgcaatgaccttgattcccagcggtgg
-gggggggcggggaatctgacacgtctcaccggcaggcccgatcagacgcatccagagcataacggtttttctcggcttgc
-ttgaacgatggtccagcgagtgagtacggtttcgtatgcattcggggccgtccttttgttgacgtgcgggagatcagaac
-agttgaagcgctcttttgccggtgtcggcagccgggatcgaaccaacggaacctgcgcaccagtgcgcttgtgcagtctc
-gacgatttccggcggttgcgtttgatcgatgcagacgatgatcaacgctttcaggcgaatacggattcttggttctggca
-tgagacagagctcgcattattttataaacgaaaaatgattactctcagacccaatttacgattgaatgggagagtggtaa
-gcgttcttacgtagctcccgatttgggagcatttgttttaggtagccaaattccggctaactgaggtttgcagattgaac
-gctgctgtcaacttacgacaagccgcgcattctacatacttaaccaccgaaggcaagcgtattgctagtaaagtaaacag
-ccttcggtaatcttcagttcgtttttcaaggtgcatttttttgacaccgctctcttaaacgacggcttttctcttcgctt
-tcttccacagtaatttttcttacgtcttcagaagaagagggttggcattctcaagcgcgcgacgcctgggtgcatctttc
-ctctcgacggatcgacgacggggagtggctgttttttgaagaaatagtgttgtgttgattgtttaaaagcgggcgttttt
-cagcctgcttacagtgacttcgctttttactatccaaagcacgccatagcttgcactgggcataccgcaccaccagcagc
-cattccgctgcaaccccacaggcaaatcagtaataaacaaattacaatatattatggtgctgtgttttttgtcgggagaa
-gatacaggggtgacctggttttctttgctgctcacggcggcgatatagaaattcaaaaacatgtcatttcccttcactgt
-tgtttccggggaaatattttgctttcatccgattaagtcggcacctccccctgccacctggccagagatgtactaacgtt
-gaaaaagccaacaaccccgtcagttttcaaagtggtggctttttttgaaattgcttttttgttctaccaacaaagggacg
-ccactccgccgaaggttctgtcgaaatatgcaatgcgcggtttaagcatgcggtttccagccaaagaatctcttcctcgc
-tgctatcacgcggtaatggtactctccccttccggcgacattttcaccaacagaagataaattcacccgtccataccgac
-tcaaccatttatgtgtccagcggtccacggtttttgctgacctacgaggacatcacgctagcctcacccgtacgcgaacg
-ga
->m141013_011508_sherri_c100709962550000001823135904221533_s1_p0/421/0_6731 RQ=0.823
-ccaacagaaaaggaaaagaagggaaaaagggatatttcataaaatgggactggattaaaattttccaaggcattaaaaac
-caggcccacccgaccccaaataaaacaccaagtgggggcggaaataacccccttttcaatggaatggtgcgggaagcccc
-ctaccccccataaccacaaaacaataaggaagccctcaaatgggatgttcagcatatttttttcctgtcctttccggccc
-aaagtaaaataaataaacttcctaagcttaggaaaaatattgcccataaattttggcgagaatgctgattacaaatccag
-aaaaaactgccattaggaacattgaaggttgctgttttttatacattagatacaaacgcatattttatgcggttggaatt
-atcacataataatgttttgtggcaaattgatggtggaattgatgcaattttgttaattgcaatggtgggttagctgcgcc
-tgttgcgctcacaaataatctaatatgagcataggtttgacgatatatattatattattcgttaagatggatttgttgta
-ttgttaaaaataaataatttttcttgattgcatttttttgtcatacaaaaaagacttggtttttttttttggatattcca
-tcggcagaaaacgagccatctcttatcgatgcgcggcatatttaacttgacaagcggaaataaatagagcagctattaag
-attattctttatgtttgggtctattaaggtttgttaaattgtagctttgcccctatgctgtagtagatttttgataaaat
-tgtttatggtcacaaatgagtgagtaaatatgtcgatatcttttcctttgtttttattcagttaatcacgttgtagagtt
-tttgctcgagatgagtggatgaaaacgttttagccggaaatattgcacaaactggcacagcctgaacattaatgatttat
-atattctgatcaccttgcatgcacgttttcgcttacgaaagaaaaaccgatccggctataacgagccgaccgtgggggtg
-gcggtttttggcctgtcggttgggatgaaaaaggaactggcatggcatgtatgcatgggcatttaaggactgtcgtggga
-catgggaacgattgcgaatacgggattggggaaagtactggcggacgctgggcggatgaattttcaatttaggtctggga
-ttcacgtgggcgtaacggcacgcgataatggaattacatcttcaggtttttctaactggcattgggcctccgtgggtttg
-gcccgtgacttttcagatgacgctacattccgggtacctacaacaatggatgtgtactttgctggatggcgctttcagtt
-ttgagacaaatgaagtttagttaactttttaaatcaatatgctaatataagtaacattcaaaaatacgcgaccttttaat
-actttttagtaaagtttcactggacaaagcggtacaaattggtgtaatggtacgacacgcatttgtgtctatttttcatg
-taaaggtaattttgatgtctagattaaaggtacgtaagtggtttatgagttcaaggatttcggtttcattactccggaag
-acggcgccagactgctcgtacactttctctgcaatcagataatggttttttaaaactcttgctgaagtaagcgggtagag
-gttttcgaattcatcttacgttgccagggcttcttgctgcaaacgtatcgctctgtaagatacgtcagcagattcaaaac
-gcttaataggggtttttttttgggtctttagtgtgcggttgaagggaaacagccagaatgcagtgcggtcaatggcaaag
-accagaaggttgacgaaaacgttcagtaatgcagcaaaggcctctgttccaaaacaccacttctgccgaaaatgttgaga
-aggttctgttagaccgcacagaaattcggtggtgatttatctttcaccactggatcaattgttgtctcatgcttgaacgc
-tgcgaatcctattcctatgatgaatgccccaatcaggtttgctgtcagcgtcccaagaatcgcctgatgcgtggggttaa
-atcgcatacttaaagcgatctcgccagcttcccgtacacagcaataaactgtaagaagttgtaacactgcaaaatctgct
-attgatttgttgagtgataaggtgtaagcgaatatcgttcgttggcgaatttttacgactctgaacaggaggtgaatgct
-ggttgccggaaggacagtttgctgtacttgtgtgggaaagaacgcttgagctttgtgctcgtgatggcaggcggcgaacg
-acgcatcgtgtttgccctgccgagcattgctgggcgcgagatgatattgatgcagactctataggttaaatcagcagcag
-ctgctggaaggcgaattctcgggacttttacgggcgtagaaagtaaacgtacatgatgacgaaattctggacgattatgt
-tcttcacgcggggcgcgctggaatatggctggtggcaattcaggcaggaacatcgtcgcccgttatgctcaaactgcatc
-tctatgatgcatttgccattcaggaaatacagcgtgttgatgctggttaatgaatcgcatccgttacttggagtggaagg
-atgaggtcggtctgatgacctgtatgattagctttccagagagggggggggggtggcgctggcagggcattaccgggagc
-tgaaatcctggtattttctgccgtgggttcgcggcgctcaaagagcacactggtcaacgttgcttgccgctcgtgcgctg
-gataactgtttatatgtggcggcgggggagtgcgggcaaaaaattcgtcaagcgggattaatagatcctttgagtcacca
-ttgggcagcgtcagatgctgcatcatttgggcggaagtgacgcccgacgtgtgcgtcagggtgcgcgcgcatgcgcggtc
-ttaaacacttccttcgtcgctttgcgcgccgcattattatgatgtttttttactcggcgcttgattcccttgttacagat
-tgctattgtgtgcgcgcgtgaatgaagttatattctttggttgtttaaggcgcttttctgtttggttattgtcaagaggt
-atctctatgggtgagattagtattacgcaaactgtggtagtatgcggcgctggtcgttctgctgtttggggaactaagaa
-ggttaccgtacgcttgggcggagacctttggagcggccattaaagggttaagagcgcgatgaatgattacgattgctgag
-gcgaaaaaggcggcagacgttgatcttcaggtgaaaagctctctcataaagagtgcgtggcgagcaggacgctactcaat
-atcttgttcgatacagaaacccgcttcaaaagcggggttttttttatgcagacagatgtagtaatattaacaggattact
-taacattccctcctttcgcttgcaatcggcgtggtacgaagaggacaaaggacgcatgcagcatgggtcagcatgccagc
-gcttgcggggcttctttcgtcgaactcatccggctacgtaacgttgacggccaggtgggaatggcggattggctgcaata
-ttggcccagcggttaacatcgtcaacatgaggcgggtgcgcattctcataattttttcattgggtttcacccgtccacat
-cagaccagattggtcgggatttccggatgcgctttctttaagcggttccagcagcttcagcgaccagttttaatctgcac
-cagggtactgacgtatacgcggatagtttccaggttatggttgaacacatctggtggcgttttgcagtcagaatatccag
-agcacgatcccatacgagggaaatcggccgcagagtttcatttttgattttgcgggctttttttcccgaatttgggcagt
-atgcaatccgcaaaagtgctggcaccgcatgcgggcaggtctcacggtcaaggaggtggaataaccaataacgcagcgct
-catatcggcaatggtctgcgcagttttcactggttcattgggcataggagctacgggccgacggtgggcacatacagaag
-gacaacggcggtacaatagcgccgaggatcataacgttgctgtggcgtggttgaaggcattcgccggttgggcaggaagc
-ttcctcgcagacaagaatgcaggccattttgcgcattgcggctttgatgccggatacgttgtagagtccgtggaagcttg
-attttttcatccattcggcttgcggcagcagggctcggcgctctggttgacgtttttaacccgggataagaggatgctta
-atcggcatgcggtattttaacacgcgtttatcaagggtttactcatagcgtgcgtggttccagttggattacgagaaagc
-gttttcaaattcccatagattgttgtaattatcaactatttttgaattacgactggagtatatcattgaaacggactgaa
-gcagcccgcggtcgccgggaaaatgtaaaaattgtttgttgattgtgcatttttatgtttctgcgctgtggatctggctt
-gtaaaaatacttttttcaaaatgcattaggagtacatcttactgacgtggaggatgggaatgcacgcaggtgatttgggt
-tgtagtggatagagaaatctatttagctccctcatttaaggacggagaaaggcagttttttccagcggcccagcagcggc
-taacaggttataaaacggctgggatcatcgctaacatgtcaacgttggaaccagtgcagggattgtcaaatgttgtagct
-ggtgaaattgattttgcccggtcggaacatttcttgactctctgcgggcgaccgctgaaatttttgctctcggtcagaag
-tcatgcgcagcgttggttcgatagtctctctgtcatcttcttaaagagagtatggatttcctgtcgccaattaacacata
-ttgtcggtgaacagaaatgatgttgcaccgtaagattggtgcaaacaaatgttatcgatgatgagatcggttttgaactg
-ctgagttggttttcgcgtcgcttgatgggcgggttgcgcagtaaaagctggcggatgtgagttttaatcgcccgatagtg
-aggaaggacagttgctacgacagagggagtggtcgctatagttatccgtttcgttgttatcatagattccttcgatatca
-gcgcgcaagatggacctcaggcctgactgatataactcatgtgtgcatcgcatgcgggtaggcagtgaacctggctttgc
-gaataaaaatgggtgcagggaatataaagcgccgtttctgaatcgactgactgattgccggggagggggtcagattaagc
-actttcgctgcattaaacgatcctttatgtacctaattacagctcaaaatagtagaaggtttagatgcaatatttgcgta
-aggtttgtaaatatttgtgtttacttctgacgctatttgcttaaacagggtcatttgtcattattatatccagccattac
-tccaattttattccatggaaaaataatatttaaaaaatgtacataattcttatgtctaatttggaacgggaacgcttttg
-ctcaccataatcaactatttcaatacggttaatcatggggtgagttacggagcagccgtgcagcgatttctgcaagtgat
-aaagaaaatataccaacggcgaaggagatgtaaaggcattagcagattattatgagtaatgacgccagttattgggggcc
-attgatgttttatggaattaagcggtaaatatattcgaagtccggaattgtttagttagcgctaaatattttaccagtta
-aacgtgagcatattattagtcgtcgcttcgggtttccattgtgatatttttagccattttcattccggcatacacaagat
-ctaatacgtaaaatggtgaaaagatcatattgagtttaatgccaagaacgtggaattgcacaacgcggtcgaatacggtc
-aacccagtggagcaaatttttctttttcccacatgcctggcgcgtcagccgaggatgcgctttctataaccgcagttagg
-cgcagggtattcccactgtttgctcaagcaaggtaccagttcacgcaccgagttttacggcgtttcaggttaagcaacca
-tcatcactgttgcccggcgtgataagtccctgcccacgcgatcgctctggattcacgaatatcacccggttaaaatgtgc
-tccgctttcatgctggaccttgggttgcatacggctagtgctcgaacagcagatttccatcaaggggtatatcaatgcgg
-gtatcggtgattcatgctagccgggagattggcttcgtaaaggctgaagaccgagctggggacaagaattttatcctgat
-acaaaaggcaatctccgtgagaatgaagtaaaagtgggggaaaagtatactcacaggcgaggaggggaagttaccgacca
-gggagccggttaaggagagcgagttaacagaacatgcggcaatatcgatttttgcgcagttttcataagtgtttcaacct
-gtcgatattgagtggcgttgaatagtgatagaatacgatggtgttgctttggctgttggtttttcccgttggggtgtagt
-actggcgcatggcgctgtttacacttcaacccgctgaatgcaaccagctcaggtaacgcctgccccataatttgtagtta
-aggatagggaa
->m141013_011508_sherri_c100709962550000001823135904221533_s1_p0/482/0_8711 RQ=0.828
-gggtggacaaaaagaaaatagaagaatggggtgggttttcccctcaataaatgccggcccccgtcggtgacaggttccat
-ggctgtcagccggccccagcccgagggaatttctcggtgcaaggggtacgcaatggttttgaaagtccaatttgcgaata
-gaagggataacacatattccggaagcgtcttcgtccgttaatcacgctggcctcgaaatatggatgaaacagcagcccgg
-aagagatttttcgaataatcgggcagtcggcgcctggtcatcgccaggcaggcatttcgccagtgccagcaagttgtcgc
-gcaaaaggatgcagctcctcaattgtgtcggtttcgatctctcgccaccttctccagcgtgcgcgtttgacgtcgggctg
-tgccgctgcggtcgttagaacagattcacagctcgccgctctcttcaggtaacgccacctgccgtgcctggcgcagtaag
-gtcagttcgtttgagatgctgctgcgtgtaggtgcgataaccgtttttcgctgcgcatgcggcggcgtcaccagccccct
-ttctctcatagagccgaatgggcttgtctgtggtcaggccggtaatttttgctacattcgctgatgttcatcttcgcgca
-acgcctcctgtgctttgttaaagggtttttcaacagattttcaagcacgtttttgcagtgcgaatatgaccgccacacaa
-aatacagaagtaacttgcgcacagagagatgttatacggtttttattgcgcttatgaccatatgccaaataaggctgagt
-aagagtgagccaataatcataatcacgcacggctacctgggaccaacagagtagataaaagccaaagatcaccaacaaca
-tccaccacgttacactccacgaaagaatcggcaagagggcgtgaatattagtacgcatggcggaatcgcacaaaacaccg
-caggtagctaaatcagaggtgggcgcaacgcttggcgagtgagctaaatcagtgccgcccgtcatcagataataacaccg
-gacccagacaataagttgcttccaggtactctgtcgcacagggattttattcattagcttcggcagtttcgcgttcgctg
-ccatttgttgtcctgatgttaaacacggcgaacaggttccgcgtaatggctggaatgcggtcgaagataaaggccgatga
-cgacgagtatcataacccagcatgccgacagcggagaaggagccttgcgctatcggcggtattggcaataattttctaac
-tctaatgcgatacaatcgctaagacaaaacaatgccagcgagatataaagcaacgtggtaacgcaatgcgccaccagaga
-acgcctggcataatgagatgcggagtttcactttatcgccgggtcgcgcacatgccaaagccgcataggcaaggaaaaag
-ttatccaatacaggagaagaacggcacgcggagctggggggcgcaagagacggaaatattgcgccggttgcagcgaccaa
-ccctggcaagtaacagcaataacaggatatcattttaggccgagaggatacttccagagcccttagcgctatggttgctt
-aggagtttgaaaatcgcatcgaacgcaagagttcacacgcgtagagctaaaataaaggtgtccactcctgggtgccttca
-tgcaaaatgcacggctaatagagcccaaaagcacggcgaccagtaggcgatgctcacgccagcggtcaacaggtacagta
-acgagagcgccagcgaaaagaccgtgcctaatccgcgacgaaagaagtcgatatcgcattgctgggatagctcgcccaga
-cgcgcataggcataaccggaaaacatcgcacaataccgcaaagagaggcgaacccatggtcgaggcttctagcaatgcaa
-gctgcccagcagcgcgaagactcccgctccgacagtgccaatgccgattgaaacgacgttatagacgagaggttttgtta
-cgttattactccgggttcgatgtcatgactcagcccttaaacacgtaagccggagttgcttagcgacgcgtgcaaccatt
-tttttgaaccgcgacactgttcgcgcattcgtccagcggtgggaaagcgcaattccatcactccagggacgaaccgccga
-ataatcgccatacaccgtttgccaggtaaactataacacgatacgccagtaccgagcgaccatacagaccttcataatca
-tttcggcagaattaaggcacgtttcgccccccctggaaaacgcgtttaatgcgtcaacggattcccccacaccgcctgcg
-cagcgcgcgccaaagcgttgcagttcaataggtattgaggaggtggagactgacgggtgaacagtcaaagtgctccatgc
-atacaatagagatacgcggatacagcagccaggctatggccggttatgggcaagttggttgttgttccgacgggacattc
-gtcagagagcgctaacgcttcgccagccagtttgtgatatgtaaaatttcgctgccagccggttgttcaacttcagcgtt
-aattcagagcttggtggtgtcaataggccagcattttacagtgcgaaagcggtttgccgccatgcaactctaagagcgat
-aatgagttaaagggcaatctcggtcgggtcagcgcaattttgtcctgtagaattcgctgcgggccgagcatttctaacga
-aagggtatacgtacgacttttcgagatggatccagtgcaaagcggagatcaacgtcacctcgcacatatgacgttgcatg
-gcggttcagataagccactgcgcagtttgaacctggtaacattcgccagaaagggaaatgtaatcggcatttgtcgccgt
-taagtgagtgaacttgggttagacctgagtcctgctctgtatatttggtgcatctaacatctttgttaacatccttatag
-atgcgggaggtaattcgctcacccggtccgattttctcgcatgcctgattacatagcacccgcaacttaacttacaagga
-agaaacaaagagataaatgtctaatctgatgcattaatcgaaggcagattttttaatctttacggactttaccgctggtt
-attaatttcttgaaccttgccccttggctggaagttaaacattatcacagcatcaaaagtgtctaaaggagtggttttag
-gtcaatgttaactatcgactacctggaggccctgtctgcggacttgcgttaacgacgtgaaagaaagtctgaacacgtcg
-aagttggcaggggatgtgtctatactgaagcgcaacgtaccgagtatgcccagtgagtacagacagctgaattcgaaaca
-taaaaatgcgggttatgacgcatttgtaagcaacccaatgaggctaaaacagcagctggcggagtccatcaatccgtgaa
-gcaacgaagcgggtttctgaggcgctccggcagcgaccgccgatgacgatgaactagccagtcagtacgtgctgacgcat
-gatggctgcgcccagctgtgtcactcccgcgtagcaaatgcgctgcaaagcgtaccgggcgtactctagcagggtaaacc
-tggcggagcgtactgcgctggtgatggcagtgctcccccaagatttagtgcggcggtggaaaaagcggctacgtggcgcg
-gaagcgattgagatgacgcagatacgagtccgcgagcgccagcaagaaacagcagtcgctacgaatgaggcgcttccgcg
-gaaggcaattggtcgcactgcgtgggtatacggtgatggtccctgggggatatcggcgataacatgactgggtcacgcgt
-gaaacgtagccttggttggtttatgggctgataaccctggaaggatggtgtttcgacggcggcattttttacgcatgcat
-gtggaaaagcgctgaacgggtgcggcggacgattggattacgcgtggtgcgcgggtacggctgcgggctcttattcgatg
-agggcccggtccactgtggccggcagtggttccgatggaagcgcgacatctttataagaagccggctatgattatggtcc
-gataatctcaggccattagcctgaagcggcgcgcacggtgtcagcgttcttgcctctaaggcgctggaaggtatccgatt
-agacccgccggacggcgactctggttactgacgaaggtgaacaaagcgtgctctggcagaagtgcagccgagtaattggt
-tgctgcggctgactggaccggcgattcgtgcgtgccggagatggcgagattacgccaggggcgaagccaggctgatgaag
-cgatcggacgggccggaaaccaaatcgcagcaaaaaggcgaaggcgatagcgtccatttcgggacagtggtacaggaacg
-gtcgagtgtgctgttcgtggccagttgcggattggaagccatactacgcgtacgaacatatcgcatggtgcgccaggccc
-aggagcaagtcaaagccataaatcggtagctgggcggataaatctcagccgtatttgtgccggtagattggtggttattg
-gcgttaagtcatgcggcaatcggtatttctttgtggcacggcagattgtctatacctggtgaatgcacaggacgatttat
-tgctgtcgtgtgcgctgggggcgacgccgaagtcgattattccggcgtcgggcggcggctgatttgggcgtgctggtgcg
-ggacgctgacggcgctgcaacgcgccagaatctcgacatgagtgttgataaaacgggaaggctgattgaagggaagccgc
-aagttgtcggcagtgaagaacattttgcctgatgttggatgaaggcgcaggcattgcgtctggcggtcggcactgggagc
-aaggttccagccatcgctgggcacgagcgattcctcgattaaaagcaggtgatatgccagctacgcaggtcaaacggttt
-ccgcacattgccgcgggctctgggcgtgaagcggtgaagctgaagtcagcgttcaattgctgggaatcaaggcgctggtt
-aatggagcaaaggttgggtaccaaagctgtaatcgaaagcggaggattactgctcagccatcgcaaagggaaacgcctgt
-ttgctggcggtttgacgaagcggtagcttctgctggcatacgcgatccgttgcgtagtgatagcgtggcgggctgcaacg
-cctggcataaagcgggatattgtctggtgaagtgacgggaaaccaacacgccatggagtgcaaagaagcagggatggatg
-aggtgaagtcgccgggtgcagccgtggacgtaaagccgaagcgatcaacattgcaaagtgaagagcaggtggaaataggt
-ggggaggcaagtatcgcgggcacagcgctgctcagcggtaatgtcggcatatgcgatggggggcggcagtgatgttgcca
-gttgaaaccttgcggcgaaccctgatgcgccatagccggatggcttgcgatggcgactcgctattccggcgaacggctgc
-aaaaacgtaagcagaacctgccggttgcgttatacaaaagtatcggtatcggcgccggccgtattttgtgggccgttcag
-atacactgtcttaaccggtgagttccgagcggcaatggcgctcgtcgtccgattacggtagtgagtaacgaaaccggttg
-ctgcgtttaaacgaaggaataagtacgatgccggatgcgctgatttagggggtggcgaattgttctatcgacgcattatt
-ccggtatgcggcgtaaacgcctatcggttacggtaggcacaggtttgtagggcctgatcgacgcgtaaggcgtgcatcga
-ggacaatggtgctcgatgcgcgatgcggcgtaacgcctatccggcctacggtttcaggacaaagtggtaggtcctgataa
-gacgggtaagcgtcgatcaggccatgtgccgatgccgatggcgggcggtgaacgcctatccgcctacgagatgaagcgat
-gtttggccttatacccgaaccatatttttgcagtcttcaggcgtgcccaatattcatcactgttgtcaatcgtcccattt
-tcctgggtgcgtcatgttgttcaaccttccaaagaattaaaccgcgactggaggttagcccaaaaatcgactgtggtatc
-aacaaattcccaaaccgaagtgatactgttcaatgagtttacgattgttattgatcagtgcacctgacggctaatacatg
-aaattgcagcaactcttgctaactcattgattcaaaatcgagcggttgccagatatgtcatagagaaagaaatattcctc
-cgggtgtcggtttttgttgcctgtttcaatgtttactgttgcgtcttgtgaatacgcgatgcaagaacatactgaactca
-tacaaaccgacattaaacagtcccaactccatttgcgggccatcctcaccggacgctaggtcatgatattcacaaaggag
-gttgtatggatctgttgtaaaatccggtaaaacgctttgggcgcgctgcgcggtaatcattacaacctggcctgcatgat
-aatcacctcacccaatcgccattttcatcgatggcaagtattcatatgggtagccacgatatggctctgccacgttttgc
-tcaaaaagctcaaaacgccgatgcctgatcgtcgaggcgggatgtttcaaggatacgcctttttgctactttgcctagcc
-tggaagcgctggaagaggcattagcgaggagcaatcaaacctgcagcacattgtagccaaggagatggggcattctccca
-tgcctttctacacaacgtttggcaaatgggatggttcttcaggcgacgcaggaaaaaactggggctgcgggcagaactac
-gtatcgattacaagctattgcaggcggcggaagcacaataaccgtgaatgaaactggaaaggggctgaaaaagatgtgcc
-atgttgctcctagctctgacaataggactgcgctgctgacgaacgctgaaccactggctgacaacgcgacggtgctgacc
-aaatgatgagggggctgaatgcacgccgcaaaaataatgatatatgaagctgcccaatagttcaggtcgtcgctgtacga
-tgtctgatgatcgacgaaatctcgcctgggggataattacgcgccagcgccgggtcgatatgtgttccgtcggtgcacta
-actgttatcggagaagggaatttgccgcaatggttgcgctaaaaatgccatatcgatattggcccgtcaaagaggaattt
-catttttattattatagtcattttaagcgacggtgaactcgattgtcgctcaatctcacattgccatacttcttaggcaa
-gatgactcttttttgaccgcatcagcgttgcttgcttcgttttttgtttaaggcaggaaaattcgcagaacgcagtaata
-ctcgaaaaaaacaagatttgtttcaaatcatactacgagcacgatccggcttgaatacaatgtggcgagaaagtcgtcaa
-aaaattaggttagaatccggatcagtgtctacaaaacgctgctggtggagtgaacgtgatatgaaacacttgccgtggcg
-ttttacgccggtcgcaggtaactgaattcttaaaagtagcaaaagcggctgtgcgatcaagaaagttgagatggccgaat
-ccgagtgggtgcgcgcagcgttcgatatacggatgactggttggcggggattagccgtcactgggggagaaaaaaagtct
-gccgaacgattatcgacgcccgacaagaatttgccaatattattgtttccggcggcaagagcgcggacctggtcgaggac
-tggcgggcagcgatctgggacgattctcgatgccaaatttgcttgatatcgcccgccgcgattagcaggtgccggatgca
-aaatccggacttcgattactgccagccatcacctcacctttcggtataaacactcaatcagcggcgagcgttttctggat
-aatctttacagactcggcatcaaataagcggattacacatagcgctggtttgttatgcaaagggcgcgatagccattacc
-tgcggtggcatatgaagtttatatgtcgcaataatggtagtttcgcgatgaaccggttcgcctttgattttaaggtgttc
-agttagcgtcttcgccacaaagcctaacgttggaaaattgggtaggcactgaattggcttcattctacgctacgcggtca
-ggtaatcaagcactgctttaaaggtcatagcggcataacacaccaattgcgaatgctgcactttcagcacgtttttatag
-tgatatcggcctgcttcgataggaacaggaaattccgcctcgccatcacagaaaagtcggccaaccagtggattccatct
-tggctgcagaatcaacgccataagggtctgtacaaaacgacgtttgtcacgatcgccttcaacaaacatttggtttgcct
-atttcacttccagctgcgctgtgcttgttggaaaggtgataacaggagatcatttgctggttttccagcgatttcaggag
-tgtataagcaacggcgctcgttcacctcttccaggtactttcttccttcagagttacggaatcagctgtatttaaccatt
-tcaaatttcgccattgcgaaactaaatcagcctgccgtcacacgtattgccccactcgagcgccgcacatt
->m141013_011508_sherri_c100709962550000001823135904221533_s1_p0/557/0_18319 RQ=0.862
-aaccgggggaaagggaggaataaaaacccaaacccgtaacatcgtaaggcggccagaaattttggggtcctgagggaata
-aaacggttcccgttttttagaacaattttaacccgcgacgacgatcaggcaagctatgaacgaaagcggcagtaagccga
-cgggcggacaaaaacggctgtaaatttaccagcgcggaacttggtcccaggacattttttttttttggctgttttcacct
-gatttcgtttcaattgtttttttatgtaaggaatttttcccatctaacggtaattttttgtcactgcacgaccggacatt
-ttccggctgttttcctaatgactcttttcggcagcacatattttttcggacaacggtaataagaaatgtttccacacaca
-ccgttgactttgctgaagccatcgctacaatacggcaattaatggagggtgttattgactggcatgaaatatatccttta
-atttaaatatcattaaaaatatttatttggtttcatatgtttttatgaagctaattcaggtccaatgtcacaattaacta
-tgtcaataaggttgaacggatattctgagcaacggacccacgtaatattcaaataacattaatttctatggccggttttt
-cgtgaatcaacgtaattatgttcaataattaattcagccagtttgcgtgttcttgccattggtaggatgtgatggttcgg
-ttaaatgaccctccggcaagctggtaaatgaactggcagcacgaatgcacagaacacttttatctcggtgcaattcgtcc
-ccgggcgattggcgaatggtatttcacagctcctgttattggcgcaccttttggcgttatcttgcgaagtaaagcggcaa
-atgtgcacgaaaagcctcacacggcctggcaatattctgcactggttatcttcttggcgttttcctgctgggggtacaag
-tttcggcgcaaaatgttgtgtaaagcagcaaggctttctgctcatcacgccgctaaacccggaggttgaagtggccgggg
-tttcgctttgattggccgtcgcattggcaaaaaccacgggcggtaacggttggataaaaattgttaaggcagcgcgaggc
-tgagctgtcaatggactggcatctttttgcccgtattgttgattgtatcttgggcattgatgaaacaacgcgttttgcgc
-gtactgacgaccactggcagcgttacaggaaaaatcgccgttacgcgcaactgacattcatggcgcaaagattccttgaa
-ctggatgggcgacaccgcgatcgaaattctgcaagcgtcactacgcgcaattcacgctcgcgctttcctgacacgcaaaa
-tggataggggatgatttaacgggaatggtgcactacaaactaaactgttaatagtaataccgggcgcagcccactactcg
-gggctgatttgcggtggtgggtgtgatggcacggtaaatcacactgaccaccgtacctgggtgaaatcgctgcaacaacc
-tggcaaaacgagcggcgctatctggtggcttgctctccggcgaagacggcgacaaatcaacgattgcgttggttgcgtct
-ggctggaccggcgactggcggcaaatctcgaaaacccaaagcatgaaacaaattcggcgctatggcggcggtgattatgt
-tgctttctcggcttgcgaaaagcggaatctacgcagtcagcgactggcgcaaagtgggcttcttggtggtcaggatcgct
-tccgcaggctgaaatttgggctttttatttatgggacgcggggattggcgtcgacgtgcgaccgggaaatcagcatgttt
-ctggccgcgcgcgacggcgtttataccacaattggcgcaataatcgcccggattaattatcgcctgggcattgatagttg
-agcctgccatctgcccccgcagcctgaacatgactatgcggctgggcaggacaaaatggtggtcatgtcgaagattggct
-ataacgggcacaaaaattcttgagattgattccagagcgggcctacagcgaagtgctggaacaggcacagaaggcgtttc
-tctggtttgccatcgtttctgaccgccgagtttatacttatgggggggcttggcgggaatacttttttttactatcaacg
-ataagtcaggctggaatttggcgggttttttaacatcacttgggtttgcagatggcgcgtttcgcacattattgcaatag
-gcgctggttaggctcagtaatgtcgtgagcgcctgctgggtctgttggcgctctcgggtgtgcggtaaagggatgacgtt
-ccccatgtttggcttactggtgttgtgcaatgtacgccaagtcgaaagcagtcattcgattttaattaagtttcagaatg
-gcaactggtgtttcagtacggaacacaagcattaaccacaataatccgcagctaattccgcaatggttcgtcttcatttt
-ccttttctcgctggatatcgtcagcggcgcggtggcggatttgtcggtggcattgccttcctgcattcctttcccattca
-ttaggtctggatactaaagtttttgggtggcagcgctctattgcaacgccagttccttcaatggcttctcacgccgaccg
-gattctgcgtgcggctagatcgcttgatttattgctgtacagcaggcgacgaaactttttctgcgcgcagcggggagcgg
-tccgtagcctggtatttttgggactttggtttttttgcggttttgttattgcctgtacgtgtgatctggtttgcggcaac
-catgtactggtgggtttgccgcgctggagcgaattacgccgccgaaataaatccataacgccttcaaattgaattgtttg
-agttcgtgctcttaaagcgcgtggagtttttgtctggtcaaccagacattgcccactcccatctggtccggcgcgtaact
-cgtgcggcacagttgttggtggggatcgtgttaggacccgtggccgccgggtttttttaacatcgcatgacattctcgac
-ggcgccggaacgccagcgggttttgcttgggtaaaagtttttacccaaggtgatgcgttttagatccgttcgaccaccag
-accgtggttgttaaggtgtgaagtccggttttacgcggggcggaatcggtattctggtggcgctgcggtgttatcgtcgc
-aagcgctcatgttcgcttggtgttttggcgttaagtatctcgaagcgtatgacctgattttagggacggtggcgaataaa
-gcggggaaattcttctcgggcctgactcagtccatttcatttcttcatgttttgagccgatttttttctccgtaaattgc
-cttgaatcagcctaatttagaaccgtttttcgcctttaggcgtttatcccagtttttagtgggagatctctctccacttg
-acgtatcatttttggtcgccgaaccaggttggccagcggtgaataaatcgccagttggttatcgttttttcagcaatcct
-tgtatctggctttacgaagccgaactgtcgttgatgatgcgaatgggtgtcaccctggctccgatgctggcttcatgtat
-tcgattgttgatggctgttttgtttcttgcgtggatgctggtttcaaggttcttaccttgccggggcgctcgcgatacca
-gtcacaatccactcggccagctctcgcgctgtggcgccccttggtagccggcatcggctgagcccaattgtcgcttccat
-tgcagtcagaattacccagctgattgaggtccatgctcgttggccgcggtggtgacgcaggctgttgggtcagggccact
-cttggcatcgacagccaatgtggggcttcatgccaagttgccactgattgctttcttgtctggatgcatctgtcggattc
-gcagttgctttgctctttgttctttttcggttcgaggctgggggtggcctgcaatgatggtgcatcgaccaggtgcttga
-gtcatcatgacgcctgcttcggcctaagccagcggattggatgtccttgaacaattggcggccagtttgatgctgctcag
-cggtggcggaattttcatgatgtggttgcggtttccggcaaggcgctatccagggataacgcgggcaaacagactgcatg
-gaggcgatttcgtagcgcgcatctttccatcggcatcgctcaggttgtagcaatgcctgcatgcagttggaatgcgttag
-catggttagggataagggtcgcccggccattaccagccttggggttaaaacggctcgatgacttccacatgttgcaaatg
-gcagaattgctcctgcgggaacaagaaatcttcttttttttggtctgacggcgcttactgctgaaattcactgtcggcga
-aggttaagttgaatgactcatgatgaaccctgtctatggctccgatgacaacatgatctcaatcagggacttgttcgcac
-cttccttaaataaaatgacttaggcatttatcgcttttcgtcatcactttaatcccgacgtatccaaactggatacccct
-ttatttcattgaacgccagagcattttgctcctgcgcaaaagcggggacggacatataatctgggcggcgtggtggcaaa
-aaaagcggggcagattgttgggcgtatacgcgcaaatagatacttgcaccggggcgagcgttacggggcaaagatacggg
-ggtcatttcgggcatgattgagggccatttgatgatccgcaggttttttgccgcgttgtttgcgcagcggaagcgtgttg
-aagtcaacaaggtgcaagtaagatcaagcggtcctttcagctgatatcaatcagtgaaagcggattactgattgaagggt
-ttttgaccacaaccctgtgcgctgatgccacacgggctaaaccgtggtatgccgcgcatattgaacaactgggttttatc
-caaaggcattgatttactggcgtggatggatgcagcgaccgatctcactttctctcggcgctaaaaactgatggatcagg
-tgcgcaaaaaggtgaccattcgctgcatcaatcgtccagcggtttgccgaagacgatgcagatgcctgcgtggtattttt
-tcaactctggcttggcagcacaactggggatttgttgccgttttaccgaacatgattcgcgacgcatggtggcgatcact
-aatattggtgccggacgatatgatgctatattgctgagattgattctgcacctgcgcgtttttgcggcttgcgatacatt
-caacgaggcgattgccggatctgaacggattcgggctcttttccttcggtgggcaaaattgcttgtggccgtttgaaagt
-cagcggttgtgcgactgcgcgagtacgctgattttgggccgtgcgcgaacgaagtatcagttcagcgcaatacggccggt
-gattgcgtctgttattgattgaagccttacgcgaattcgttttgcccgccggaagagatgattgcgtggagatgtcatgg
-atcctcgaacaatccaggctgataacatgcttggaacgcattgggggcggagccgtacaagcgttaccgattgttatgca
-aagcagattttaataccagctaacttcagttatctccagcggcaccgcggcgaataaatggtggcctttcgcactcatat
-cggtggagattctttttcacggtccgcacatgaccggcgtggggggcccccccccctgcgcgcgctggcgacgtgacggg
-ctagccggctgggcacagacggttgtagatccgcgcatgctggcgatcgagtctgctttttttggctgtggtcgatggta
-gaattattttacgctggcaacaactgaatttaaactcagatcggtccaactgatttatgcagcgtaaacacagcaacctg
-aattgtgagaagcctgaaaaatggcgaagatggaaaagcgtgatccactgcggcatgttcgatcattgcgcaatctcttt
-tggttgttctcagtggcggccgagcatttttttcattaacagcgggttatcacaacaaaatcagcctgcgttcagcggtt
-gccacgcagcctgccggattcgccctccagtaaaatgcgcgaactggtcgaggccgaatccgtacagcggttcgcggctg
-cgtactgagaaatgggatcagcgggctggtgctcctgcacgccgattaaggccgtggcgacacgagaatcgcgaccgcgc
-cgtttttcaataatccgcgccgcgcagcacggtcagccttcacgcagtggcgggagcgtgagaagccgagctttttcaca
-cagtcgacgtttccgaggcgaagcggctgaccgactttcagtatcgcgcgtcgataattaaccgtttcgatactcctctg
-caacacttcgcaaatagggcgacgttcatctttcattcgccggactcgggttgcacaggtaggacgcaatttttctgtct
-aactcgcaaaacgcacatacgtaggtttgattatgttacattcaattttacatttggggagttaacccaagacaaggtca
-cagaggctggaaaaaaaatggtctgaccggtagctaaagagatagagaaaacgaaaaagccggcttaataactggttcac
-agaagaagcgcgcaaaatcagctggccaacaacacaacaaaggaagctactcatgagcatcttgtagaagagcgtcttga
-tggcgctttacctcgattgtcgaccgacctcggttactgctgcactggcgtgagcatgttcctggacttgcgatcctgca
-tacgatgaggagatcttgcttcgagtttgacggtttgagcgcgtatcgaaacgcgtcccattactggttgttctgcctca
-gcaaatggaacaggtgacagcgatatctggctgtctgccatcgcgtgcgtgtaccggtggtgacccgctggtgcaggcac
-cgggctttctggtgggcgcgcctgcgatggaaaaggtgtgtttgttgtgatggcgcgctttaaagagatcctgacattaa
-ccgcgttggtcgccgcggcgcgtgcagctgcaggcgtgcgtactggcgatctcaccaggcctgttgcaacgcataatctc
-tactacgcaccggaccttccttcacaatcgctgttcattggcgatggtggctgaaaatgcggcggcgtccactgctgaat
-atggtctgacgcggtacataacgctgctgaaaattgaagtgcaaacgctggacggccgaggcactgacgcttggagtcgg
-acgcggctggattcaagctggtttgacctgctggcgctggtttcaccggatcggaaggtatgctcgcgtgaccaccgaag
-tgacggtaaaaactgctgccgaagctccgccgtggggcggttctgtttagccagctttgactcggttagaaaaagcgcgg
-acttggggttggtttgaatccatcggccaattggcatttcccgccgggcggggctggagatgatgggataactgttcgat
-ccgcgcgggaagaattttattcatgcggttatccgtcgaacgggccgaaagcggcattttgtttatgcgagctggacggc
-gtggagtctgacgtacaggaagactgcggagcgggttttaaaacgacaatcttgttgaaagcgggcgcgactgacgtccg
-tctggcacaggacgaagttcagagcgcgttacgtttctggccggtcgcaaaaatgcgttcccggcggtagacgtattgcc
-ctggaattctactgtggatggaccatcctgcgtcgcgcctgcctggcgtactggaaggcattggcccggtttatcgcagc
-aaatatgatttacgtgtttgcccacgtctttcatgccggagattggcaaacaatggcacgccgcgttaatccttttagat
-gccaacgaacccggtgaattgccgccgcggaagagctgggtcgggaaagatcctcgaactctgcgttgaagttggcggcc
-agcatcagtgggcgaacatggccatcgggcgagaaaaatcaatcaaatgttgcgccagttcaacagcgatgaaatcacga
-cctccatgcggtcaaggcggcgttttggaaccggcgatggtttgctgaacgctggaaaaacattccacgctacaccggct
-gtgctgatttgggtggcatgatgtgcatcaggtcatttaccttccctgaactggagcgtttctgatgctcgcgagtgtga
-ttaccaggcgctgctggagtcaggtgaataggcgattgcgatcaaacgccgctggtgattcagggcagcaatagaaaggc
-ttttaaggtcgccctgtcacggggcataacgctggatgtttgttgtcatcggggcattgttaattacgacccgaccgagc
-tggtgaataaccgggtgcgtgtcggacgggccgctgtgagcaattgcagcgggcgctggaaagcgcggggcaatgctcct
-gtgagcgccgattatggtgaagaagcaactggggggggatggtcgcctgcgggctggcgggggccgcgtcgcccgtggag
-gcggttttcggtctcgcgattttggtcctcgcagcgcgcatcattaccggcggctggaaacatctggcgttttggtggcg
-aagtgatgaaacgaacgttgccggatacgatctctccacggttaatgggtgcgaagctaacggttgtttggcgtgcttca
-ctgaaatccctcaatgaagtgttcggacgcgcgcctccctgagccctgcgtcgggataatcagcctgcaagaagccatgg
-agtgaaatcggccgagtggcaactcaagccattacccattagtggcttatgtacttcgacaatggcgttgttggatccgc
-ctttgaggtgcggcgaaggatcgtccaaagcagcgcgtgaatctggctgggtgggaagaggttgcccggtcagttcggca
-gcaattggcgtgaacaacaactgccggttctctcgttacccaggtacttatggcgcatttcatcccagtgatgcgccgat
-gatggtttacccggcgagcaactgatcgactggggcggggcgttaacggcctggctgaaatcgacggcccgggacaatca
-aatccatcgcatcgcctcgcaacgctgggcggtcatgcgactcgctttatgcggagattggtgcttgcccgctatcggct
-catttatttccgctattcacgcagcagcttaaagcagctcgaaacccattgcggcgtgtttttaaccccgtcgcatgtac
-ggcgggaaactttgaggagcaggctatgcaaccaattaactgagagatggcgcagaaacgcgcgccgcgctgggaagcga
-cagcatcctgcgcgcctgtgttcacatgcggatttggtaccgcaactgccgcaccttatgcagttcttgggcgatgaact
-tggacgggggccgcgcgggcgattatctgattaaacagggtgctggaaggcacgaagtcacgcttaaaacacaggagcat
-tcgatcgctttggctcattgccgtaatttgtgaaacacctgtccctctggtgtcgctatcagcaattttgctggatatcg
-gcgtgattattgtcgaggcagaaagtgggaaacgccactgcggagcgaatacttgcgcgaaggattgcgcaggtagttgg
-ccgcgtgccggcggtctttccgtgcgctgacggcaggtagggctggtgcgcgacgttttaccgggaacaggtcagagcaa
-aaactgctgctgaaacggtgcaagctaaaccgcgttcggccgctgcgcataaggtcgggttttaatgttgaaggcttgcg
-ccagctccgctttcgcacaccacgcggcaactggcgcgagtgtggatcgtcctggggatcagctcatgccagccttaacg
-aagcaggctgtttgtgggcgcggggactaatcatcttaattgcgcaggagagggtggcaacgggcgcgcaataatattga
-tgctgggtggccgcagcgatgaagcaggtgtgccgaggggcattttgcaaaccgccagcggctgcggcggtttgtcaaag
-agtatgggcgatgctgaaaaacgatgcgttatatatggccgataagcaacgttcaggtcagtggaactggcggttcgatt
-agtcgaaacttcgcgcgagaaccggctgaaaactggcaattcgcgggataaaagcctgggcctcaatgtcgtagtaccta
-caacatgcgcaaaagctgaacgggaagtgaaaagtgtttgcttcgttcttggatttaaccttgaacggacgtttccgaca
-gccatctgtgctgcgttttcagcgggaacagatatgcgttaacgcatccgaatctggcacgccagctggcggatacaaaa
-tgatgcgctggaagcggcaaaccggaatgattcgtcccgcaacattgggtttgccagacgccttctggcgagcgccggtc
-gtacctcttggtgggtcacatggattgaatttgtagaacaagcccttgaaaaggaataacaaatgaaacctaagtcattc
-ttagccagcaaatggcgagtgattattgccgcagtcaggaagagggcgccgaaaaaataactggtctgtttccattggct
-gttgccgatgacgggcggtcatcttctggcgtttaagtgcatggacggattggcgcgccgattgcgcttatatttctccc
-agagaaagcgcgtaccggccgcgctggggtcgtgactaaggggctatgaagagatggtgaacaaacaggacgtaccgcgt
-tccggtgacttgcgccgtttatttaacgtcgtggaaggcggcgtcaaccggttgtttggtggatgggcaaattattgggt
-tgccgtgggggctttcctggttttaaccggagcacaggatgcgcaggtcgcgagcgcagcagcggtgttggcgaataagg
-aaaaacgaggagataaacaatgagtccaacgctaccgcagagccgtttaacgcatttgacgccaattttaaacgttttgt
-gatgacgaagttttaccggaacagctgggacgctgcggcgttctgggcgcaatttttgatgagatcgggtttcatgatct
-ggcaccagaaaatcgtcagtttgctggcagaacgcgaatcgcatcaggcagcgcttgatgagttggcatcggcagcaatc
-cggggcggtaaaagataaagcggcctataaatctttctgcggtgaaactggggctaacctggtgcccgcacggagcgcgt
-gacggtggaaaccacggattgacagcgtaaatcaaccaagccaggcggggccgcagctggtggttcgggcaatggaacgc
-ccggctacgcgctgaacgcgggggcgaacgctcgctgggctcactggcgatgcgttatacgggcggacaatcatcccgca
-ggaaggggcgatggtccagcgctaacgatccgcaacgcgggtgagcaggttatcgctgggtttcggcgtttccacccgat
-gaatctctacggctggaaacgggcagctatcaggagtggtggcgttttaaggtgttgataaacaattaacgcatcagttg
-aaaaaatggtaaaagaaaccccgtttacgtacttcagcacagtttgtcgttacggtggcgatgccgcttgcgccgaccgc
-acttttgctgaaaaattaacggctgcatattgagctgcaaatgatgcaatgggcggattggcaaagacgatccggcgccc
-aatcaagatgttatcggtcggtaagctggcttgcagtaacatttcgactgcgaagattcggtcgcggcggttgaattgcg
-gaagaataaaatcctgctgtaccgcaacctgctggcctgatgcagggactctgcaagaagaaatggagaaaaacggttcg
-gcaatgtgcgtaactgaatacgaatcgtcattacaccggccgccgattggctctgaaatttcttgcacggacgctcgctg
-cctttaatccgcacgtggggttcatttgatgaccattcctggtgattttgggacagcgaaggcaatgaaatccggaggca
-ttcttgatgaggtcatgactggcgcggattgccctctatggcatttaaaagtgcaggaaaactcgcgcactggcgcaagc
-gtctatattgtgaacgaaatgcacggtccgcaggaagtggcgttcgccaacaaactgttttaccgccgcattgggggaga
-caatgctccggtatggcacgaatacctgaaaaatgggcattaatggcatgaagaacgtcggacgtcgctgaacttgcgta
-gctgtatcgctccaggcgcgcaaccgcgtggccgttcatcaatacgcggtttcctcgaccgtacacgggatgaaaatgca
-tttgggtgatggaagctggcccgatgcttgcgtaaaaatagatggaaatccgacgcttggatcaaggtacgagcgtaata
-acgtgcttttccgtggtctgttctgtgggctgcgcggtaaagcgcaatttgggttaagggcatgttgggcaatgccggag
-ctgatggcagacatgtacagccagaagggcacaactgcgtgcggggcaaacacagcctgggttccgggtcaccaacaccg
-ctgcttagcgctccaatgcgctgcactacaccaaccaacgtacagaggtagccgaacgattgccagacgagttcatgctg
-aatttggaagtctgctggacgatctgctgactattccggttgctgaaacgctaatggtcggcgcaagagattaatccaca
-agagctggataacacgtggggattcggggggtacgtggtgcgctggtggagcaggggattggggttggttcaaagtgcgg
-atattccaatgtgggcgtttgatgggaagaccgcgcaacgctgcgtattctccagccagcatattcgccaaatggtttac
-gtcacggtatttctgacaagaacaggttgcaggcggcgctgggaatatggcgaaagtgggttgatcaagcaacacgctgg
-cgatccggctatcgtcgatggcggggaatttcgcctaacgtcggtgtgctttttaaagctgccagcgattttaattcttt
-cctcggcgtgacagcgcaaaggataaccgaacgttattacaccctggcgtttacggcgaaaaagaaagtcattaatagcg
-tcaaaaaagccccggaagtttttattgtcgggctatgatgtaaatgcggtagtacattttatcccggaaataacggagcg
-attatcaggttttacaatattaataccgtagcgcatttactagcgggcctaaaacacaatatggacatttaacgatactc
-tgcgtcttgcgtgtgcggaacagaaacccttaaccgatatcttgtttatgcccagaggtagcaattgggcgtttagcggc
-ggtactggttgctgtaaagtataagctatatttttacagggttagtcctcttttgcttattacaacgcttaagtatatca
-gcaataaagataataagagactgaacatatggttactggaccaaatgtatatgcgatgggaggactggggctatccgctt
-cgggtcgcctgagtcgatatattcttccttcgttgcactcgcgggtattagtctgaacggactgtcgctggacgcaataa
-cccttatattatctatcctggattgcaatattcgctctttaaaaaatgccgattgatatggcatttgctgggctgcgggc
-tatggctttatttatgattatgggccaataagcggtggattattggtcgcggcggtgttcctgtataattaaaccgtttt
-gccagcgggcagttcgatattatccggcagctcggttttccatcaaccgacgatcagcgttttgcaggtgttactgattg
-ttttctcctttggtgcgttgcttgaaggagcggggcttgggctttggtgcgcgggtggcgataaccggtgcgcctgcttg
-gtgggcctgggcttcaaacgtttatcgcgcgggggctgtgtctgattgccaatattgcgccggtggcgtttggtggttgg
-gcgttgcgatttctggtcgcctggtcaggtacgggaacgatcgcggttcccttgccgcaatggcgggacgtcagttacgt
-tcctgtcggttcttgtgccgttctggcttggtagcaatgatggacggcttggaaggggtgaaagggacgtggccagcggc
-gctggttgtggcgggaagctcgctgtcactcagttctttacctcttaacttatatttggtccggaactgccggtattact
-tcggcggctggtgtgagtatcgtctcacttcgctatttattccttaaagtgctgggcggccgaaataccgaacgggcaat
-agatgggacaatgccgcaggtgcgatggtgtaaataagcatcttctggcggtcgtgctttcagaatatagtctggggcaa
-agtcattcgagcgtggtccaccgcgtttttaatcttaacggtgctggtcccatctggaccatgaagccgtttttaaagcg
-ttaatttgctccggcggcgcgttttattcactgtgattaattttcagatctcatttgcatcacaagtgttgaaaagccgg
-gcacatttgtcgccccaaccaacgccaatgatgcggtgttttaaactttcgacacctctcggctggcggcaccgcttttt
-tattgcggcgattattctattcttcatccctcggtgtgggagatcaagaaaggtattggcgtcttgccgaaacgctgaac
-attagcttgaagtggcgcgattactgtcgattgatggttgctggcgttcgcccttcgtcaccaactattcggcatgttcc
-ccccgctggcgtggtatggcagggtaaggcgtgatgttcccgtttcttctcaccgttttctcgcttgctgggtgtattcc
-ttacgcgtgtcggacaactgctctaacgcccttgttttggtttctgcaatcgacgcacggcgcagcaaatcaacagttcc
-tctgacacctgctggtggcagcaaacacacgcggcggcgtactggcaagatgaatctcctcgcaatctatcgccgtgggc
-ctgcgccgcgacggggcatggtgggcgcgagaattgaccctgtttccgctaccggtgaagcacagttgatttttttggcc
-agcgttatcggcattatcaccctgctgccggccgtaaatgtgtttaccgggatgttagtctgtaaataataaagccggat
-gaattttaatatcatccggctttcattaacattattctgtcttattaattgaaatcatttctcgctttattatcatgcag
-cataatgtttttgcgtttcagataactgctaaatattaagagcgtgagacatctattttttttttattcagcaaacaaag
-tctgtttaaattatgtttcgctgaatgaagcaaacactcgttctaatttctgttggcttttgccaatcttaaatcgttaa
-aactacaacaaatttatatagttacgtttgtgaatttggttgttaatttttttgtttggtttggaaatttcgtaaaaata
-gcagatagacatcgttgggggttatcttatagaaaatttcacgcttgtttttctatcatgatgtcgttttcttaagaatg
-gaggaagttatttagagaagataaaggcataaaactatttctcgcagttactgaattttttttaacattgttttgtcagc
-ttgcgttattatgaataagaaattaaatatagaaatgttttggcggctattttgagcgtcaaaccgctgttaagccggtt
-gttgatggcggtggtttccggattttctccgatacgccgcctgtagattctgggaacggtgcttgcggaagtgaaacctg
-tccacaacccggagccgacgctgagcaacgcggacccagagctacgccagaacggatactgctgctgaaccaaaccagaa
-cggagcgcagacctgttcgctacgaaacgggttatctgacactggcggaagcagcggtaactggtgctacctgtaatggg
-gaatcaggatggctttacatttaacctggcgaggacgttacttgcgtgcgggtaacacgacaattgccacttcaacactc
-agtagaagctgggcgcgtagcttgcggtgcgggttgaaaagtggtcgtttcgcctggaggaacgcggggggcgggcaaaa
-aaaagaaaaaaaaaaaaaaaaaaccctttttggggccccgggggcccttttttttcccgaaaagattgaaaaaaaaccaa
-aggggaaaaaaaaaggcatttggggggcggttttttttttccccgccttttttttgggtaacgtccagtaacagtgtccg
-gccgaatacgaagcaggttcttgtctgacgttctctgcggtgatgagagtaaacgcttcgactcgctgtataagcaaatc
-gatctggcaccgggaagagttgcaaaaaagctggttcaatgagaggtggaaaacatgctgcgacggataaacgccatcca
-catcattactttcaccggtcgtgccggtcaccacggcggggaaaaaaaccggatctgaacgcttcctttcgtgtcggcta
-cgcggaacagttttattcagtatcaacccactgaaatcattctgctctgaggtcgactggtcgatagccagggatatggt
-gtttggctgggcgtcactacacaccattcgggcgtgggcgttgacaggggaaaatgggtgaatttcctttttaagctggg
-gcaacgatctctttggtatcgatacctttgaacgggttcaggtgcgcggcaataatcgacattgcgctgactgaactggg
-catttgattgaagtttcgggcggtggcgaatttgatcagcttattcatcgctattcgacgacgggcaaaaaataaaccgt
-gttttgttccggacgatgtacgcaaggtgctttgccgaatatccaacgtgattcaacgaggattatcaatctctcgttat
-tcaacggtgcgacgctgggggaaggtgaggcaagtcgttaattgctaacgaatttattgagcagttttaatacgggtcag
-gcgcaaagagatcgataccgcgatttgtgcgaaaacgcgatggttgtacggaggctgctggttctcgctgacgagcgcaa
-tgttaatgaagccagattcagggcgttatcaacaagctgtgggcgtatacgaactacaattggtcagcaagtttccatgt
-attccatgatcccaacttctatggcagcacggtatgcgcgcggtcaggcgggtgtgatatctcaacgcggcttccgaatt
-ctgatggccgcgtaatgataaaaatatggcctggcatttcggcgaaaaaacgcgcctgggataaaaacggagctggccgt
-aaattaggagcgcctcttctcttgttgagccggaaaacgttacgcgcgatacgcacttttaacgactgccgtttattttc
-gctgggcaagttcggtgagggcaactgatgggttatcggtaacccaccactacaacagcatttttgcgttgcccgaaagg
-ttaagctggaaaggggcgttaatcaagatgggcagtgtcgctcacagcgacccgggctgacatgagaacttatggagaac
-gtgctgcgctatctgtttccgcgatatggaagccggacgcgaaagccagcatgcaccgtaggcacaataggatactgtct
-atttaaacgtcatgggtcaggttacagaacaggctgggcggttcgtctgtccatccgattttgcgggctctctgtttgag
-catttaagtagctatggcgatctcgaatcgcaggaaatgccggctgcctggatccttaacggctttgaatctgtgactca
-ggtgggtaatgatcctatgcaatccggctgcgtgcgatacagcaaccgaagcttgactcagcaggatgtgacgggatctg
-aatcgcctatcctgaacaaagtggatggtgctgattcatggaaacgtgatgagcaatcttaaggaagagagcgcgtcctt
-ggttttgtggcgtctgttggatgccggagtctgtcgatggcactgaacaagtcggtagtaaatacgatccgcaagggtat
-cgaaccgcgttcgtccagcaggcgcgcaacgggcaaatttgggttatgacgttatcctgccggtagattggtgggcgctg
-ccgtacaccatcgatagtcgacaggggaagttaagtggaaatctcaggtagaaaacacctgaatgacaaaacggaagct
->m141013_011508_sherri_c100709962550000001823135904221533_s1_p0/557/18360_26485 RQ=0.862
-tagcttcggtttgtcatcaggttttgttttctactgatatttccacttaacttccctgttcttactatcgatggtggtta
-cgggcagcgcaaccatctccgcaggataattcgtttcatagacgcaaaatgccgttgcggctgctgacgaacggcgttcg
-gatacgccttgcgatcgttatttaactacgacttgttcaggccatcgacagacctgcggcatccaaggacgcacaaacac
-agacgccgctctcttgcttaagattgctatcacgttttccatgatcagccgcgatccacctttgtttcagatagcgatca
-gatcggtcacatcctgctgagtcagcttcggtttgctggtatctgcacgcagcggattgcataaggatcgttaccacctg
-agtcacatattcaagccgttaaggatcagcagcggcatttctgcggtcgagatcgccatagctattccacacctgctcaa
-gcagagatgccgcaatccgcggagtcgaacgcgcgtgtttcctgtaacctgacaatgacgtttaaaatagacagtatcca
-gggttggttgctacggtcaatgctggcttcgcgtcggcttccattttcgtcggaacagattagcgcatgcacgttctcca
-tgaagttttcatgtctccgggtcgctgttgagcgtaacactgcctctttattaacgcccgtttcagcttgtaaccggttc
-gggctaacgcaaatgcctgttgtagtggtgggtttaccgaaaccatcagttttgccctcaccgacttgcgccgcggaata
-acggcagttaaaggtggcggtatgcgggtgttctcacagagaggcgcttccgtatgtacgcagctcgtttttatcccagg
-cgcgttttttcgccgaagggccagccagtagtttttatcattacgcgcatcagaatcgggaaggacgcgttgagatattc
-accaccgctgacgcgcgcattaccgtgctgccatagaagttggtggagtcatggaataacatgggacttgctgacagatt
-tttgtagtttgtatccacgcccgcacagcttgttgataaacgccctgatctggagccgtcattaacatatgcgcgtcgtc
-agcgagaaccagcgagcctcgtttaacaacgcatcggttttcggcacaaatcgcggtatcgatctctttggctgacccgt
-attaaactgctcaataattccgttaggcgattaacgacttgctcaccttccagcggtcgcacgttggcataacgagagat
-tgataatctcgtttgatcaacgttgggatattcggcaaagacttgcgtacatcgtccggaacaacacgggtattattttg
-ccggtcgtgcatagcgatgaataagctgatcaatattcgccccgcgacttcatcaccagtttcagtcagcgcatggtcga
-ctattgccgcgcacttgaacccagttcaaaggtatcggatacaaggagatgtttcccgcccagctaaaggacaattacca
-ttttccctgtccaagccaaacggctgaattggtgtagtaagtttgacgcagcaacaccaatacctggctattcagacagt
-cgaccttcagagagaatgatttagtgggttgatactgataaaatgtttcccgcgtttagccgcacgaaggaagcgttcag
-ctccggttttgttcccggcggtgtgacggcacgaccggtgagtatgagtggatggcgcttttatcgtcgcagcattgttt
-ttcacctcttcattgaccagcttttttttgaactcttccggtgccagaatcgtatttgcttatacagcgagtcgaagcgt
-ttactctcgatcacgcgaggagacgtcagacaacctggttctggttattcgcggacagctgttacggacgttaccagcga
-aaccggcattgctttcttgtcatcggagccgtccagttcttgcgcgtccttcaaggctaacgacacttttttcaaccgca
-cgcaagctacgccagcttctgactgagtgttgaagggtggcaattgtcgtgttacccgcacgcaagtaacgtcctcgcca
-ggtttaaaatttgtaaagccatgctgattcaccattacggtagcaccaattacgcgctggctccgcccagggtcagataa
-ccttttccgtaggaacaggtcttggctccggtctggtgtgttcaggatcaggtatcggttctggcgtaggcctctggggt
-ggcgttggctcagggcgtgccggctccgggtttggtgttggatcaggttttcacttcggcaaagaccctgttcagaatct
-acaggcggcgtatcgaggaaagatgcgaaccgccatcacaacgctaaccgggtttgcggcgtcaaatagccgctaaaagc
-gattttcttatatttaaatttcttattcattaataacagtgaaaaacaatgtaaaaaattcgtaactggagaaatagttt
-tatgctttatcttctctaatacttcctccattcttaagaaaacgaccatcatgataagaaacaggtgaattttataagat
-accctatacgatgtcttatgctggctttttttttacgaaatttcaacaacaaaaatttacacatttcacaacgtaactta
-tataaatttgttggtagtttaacgattaagattgcaaaagcaacagatagaaacggtggtttgctcatcaagcgaaataa
-ttattacagacttgtttgcgtgattaaaaaaatagatgttctcacgctccttaattatttacaggttatctgaagcaaaa
-cattattgctgcatggataataaagcgagaaatgattttcaattaataagacagaatatgtaaatgaaaggccggatgat
-attaacgatgcaccggctttatttgatttacgagactaacatccggtaacacatacgcctgcagcagggtgtaatgcgat
-aacgctggcaaacatccgactgtgctcacggtgggtagcggggaaccagttcagattctcgcccaccatgcccgtcgcgg
-ggcggcaggccacggcgataggattgcggggggagatcatctgcgcagttaacgccgccgcttggttgtttgctgccacc
-agcagggtgtcagatgacgttgatttgctgcgccgtggtcgattgcagtgacaaacagggcgttagaggaaggtgtccga
-gccggtaaggaatacccagcagccgagaaacgggtgagcagaacgggacatacgcctgtactgcagttaccagcggccag
-cgtggtggactgcagaatagttggtgcgaggcgaacgcagccacaatgcatcgactagtatcgccacttccaaggctaaa
-ttagcgtttcggcaagactgccaatactttcttgatccacagcgaggatgaagatagagataatcgccgcaataaaaata
-gcggtgccgccagccgagagggggtcgatttaaacaccgcatccattgggcgttgttggcgacaatgggtgccgcctttc
-aacccttgtttgggatgcaaatgagggactctggaaattaattcacagtgaataaacgcgcgcgagcaaataaggcttta
-acggcttcatggtccagatgggtgaccagcaccgttaagattcaacggtgaccacgctcgaatgatttgcccagactata
-ttctgaaggcacgggacgccagaagattggcttattaccaccatcgcactgcgattgtccatgctgattgcgttttttcg
-gtttatttttcggccgcagacttaggaataatgcggagtgagacacgatactcaccagcgccgaagtaatatccggcagt
-tcggacaataatagttagaggtaaagactgagtgacagcgaagcttccccagcaaccagcgccggctggacacgtctctt
-cagcctttccagcgtccatcattgtcgcagccagaacggcaccaagaacgcgacaggaacggtaatgacgtcccgcattg
-cgcaatgtggaacggatcgatttccgttacctgacgcgcggaccagactcggcacgcgcccacgcaaccaaacgccacgc
-gcagtattgggcactcagacacagcccgccgcgtataacggttttgaagccaggcccaccagcagcgcaccggggtaatc
-gccaccggcgcaccaagcagcgtccttccagcaacgcacaaaggaagaaagcaatcagtaacacctgcaaacgtgatcgt
-gtgatgggagataacggctgcggaatattcgactgcccggtggcaacggttaatttatacaggacacgccgcgacaataa
-tccacgctattgggcataactccataaataaagcatacccgcagcagcaaatgccatatcaatcgcattttaaagcgaat
-attgcatcaggatagataatattaagggtattgctcagcgacagtcctttcagacgtaatacgcgagtgcaacgaagaag
-aatattatcgggactcagggcgaccagagcggatagcccccgtctcccatcggcatatacattttgggtcaggtaaccat
-aatgttcgtctctattatctttatatgcttgaatatacttaaggtttgtaataagcaaagaaggactgaactgtaaatat
-aggcgttatactttaagcaacagtagccgcaacgcaatgctaccttgcataacaaagtatatcggggttaagggtttctg
-ttccgcacacgcagacgcagaagtatgtttaagatgtcatattgttctgttttaggcctgctagtaatgcgctacgggta
-atttaatatttgttaaacctgattaatcgctccggttattttcgggataaattgtactacgcgttttactatcatagccc
-cgacaataaaattgccggggctttttttgacgcttattaatgatttcttttttcgcgtaaacgcagcgtgtaataacggt
-tcggtatagcgtttggtgtttgcacgccgggatagagttaaatcgctggcagctttaacaaagcacacgagttttagccg
-aaattccgccgcatcgacgataaaggcgcggatcgccagcgtttttgtcttgatcaaccactttcgccatattctccagc
-gacgctgcacctgttcctttgtcagaataccgtgacgtaaccagtttggcgatatgactgctggagatacgcagcgttgc
-gcgtccttcatcaaccgcaacttgtgatatccggcactttttgaacaacaatcccctgctccaccgcgcacccgtaccca
-gaaatccctgcacgttggttatccagctcttgttgatgcttttgcgccggaccagtagcgttttcagcagcggaatttta
-gtcagcagatcgtccagcagcgttcaaaattcagcatttgaatcggtctgggcatgttttggctttggtacgctctgtac
-gtttggtttggtggtagtgagcgcatggaggcgtgcagccggtggtgacgggaacccaggctgtgtttgcccgcggcacg
-cagtttggtcgcccttctggtgtagatgtctgccatcaggtccggcattgccaatgcctttacccatttgcgctttacgc
-gcaagcccacagaacagacggaagcaacgttattacgctcgtaggcttttgatcccaggcgtcgatttcatcttgatttt
-tacgcagcatcgggccagcttccatcaccgaatgcatttcatcgcgggtacggtcgaggaaacgcggtaatttgaatgca
-cgccacgcggttgcgcgctgagcgatacagtctcgcaagttcagcgaggtcgacgttcttcatccataatgcccattttc
-cgggtattcggtgccataccgagcattgtcctcatgcggtaaacagtttgtttggcgagccattcctgcggacgtgcatt
-tttttcggtttcacaatatagacgctgccagtggcggcggagtttttctgcaacttttaaatcatgagggcaatcgcgcc
-agtcatgacgcctgcaagaatgccttccgattttcattggcctcgtgtccaaatcacaggatggtcatgcaaatgaccca
-cgttgcggattaacaggcagcgagcgtccgtggcaagaaatttccagagcccatcggcggcggtgttcatgacggatcgt
-cattcagtttacggccacgattttgccgactgcgtttttttctccatttttctcttgcagagtcctgcatcaggccagca
-ccaggttgcggtcaggcaggattttatcttccgcatcaaccgccgcgaccgactttcgcagtcgcgaatggttagctgat
-agcagcttcgacgataacatcgtttgatagtgcgcggagtgcgtctttgccaatcgcgcccattgcatcgattgtgcagt
-caatatgccaggcgttattttttttcagcaaaaatgcaggtcggcgcagcggatcgccacggtaccgacaactggtgctg
-gagtaagtaacgtggtttctttaccactttttcaactggatgcgtattgttctatcaccacttaaacgccacacatccct
-gatagctgccgtttctcagcggtagagattctcgaggaaacgccgaaccaggcgataacctgctcaccgcgttttgcgat
-cgtagccgctgacatcgccctttcctgcggatgatgtcggctgcgtataaccgcatcgttacagtgagccgccagcgagc
-ggttcgcgcgttcagcgcgtagccgggcgtttcattgccggaaccaccagtgcggccgtggctggtgatttcgctgtcaa
-ttggcccgtggtttcaccgtcacggctccggtttgcgggcaccaggtagccagttcacgcaggaagatttataggccgct
-ttatcttttttaccggcccggattgctgcgatgcacctcatcaacgctgcctggaatgcgaatcggcgttcctgccagca
-aatgacgacttttctggttggccacgatcatgaacgatctcatcaaaatttgcgcagaacgccgcagcgtccagcctgtt
-ctcgtaacacttctttcatcacaaacgttaaaattggcgtcaatgcgtaaacggctctgggggttattggtttttgactc
-acattgtttatctcctcgttttcgcttatttcgccacacgctgctgccgctttcgcgactgcgcatctgtgcttccggtt
-acacctagaaacgccgcacggcaaccaattaatttgccatcctaccaacaaccggttacgccggcttccaagcgacgtta
-ataacggcgcagtcccacgaacgcggtacgtccgttgtttcacaatgcttcttcatagccttagtttcacgacggcccca
-gcggcggtacgcgcttccctggagacttagccgcaatcggcgcgcaattcgtcatgcgactaacgctgcagatgaccggc
-gtcatccggcaacagcaatggaaacagaccagttattttttctgcgcctcttcctgacctgcggcataataattggcact
-cgcatttgctggctaagaatgactttagttttcattttgttattccttttcagggctggtttctagcaattttcatccag
-tgacgcacagaggtacgaccggcgcttcgcagatgcgtctggcaaccaattgttggcggtgacgatgcatttccgttgtt
-ttgccgcttttccagcgcattcatttttgttatcccgcagctggcgtgccagatcgggatgcgtttaacgcatatgttcc
-cgctgaccgcaagacgatggctgttcgggaacgttccgttaaggtaatccaagacgaagcaacacttttttccacttgcc
-gttcaggcttttgcggggcatgttttgtagggtacacggaagtggaaggccagctttttgtattcgccgcgaattgcagt
-tttttcgcagcggttcctcgggcatgaagttacgactaaatcggacgcagttccactgacgcttgacgtgctttatcggc
-attataagcatcgtttttcagcattgcccatactcttttgacaaacgcgccgcagccgctggcggtttgagcaaattggc
-ctcggcacctgcttcaatgcggtgccaccaggcatcaatattatt
->m141013_011508_sherri_c100709962550000001823135904221533_s1_p0/574/2071_8766 RQ=0.823
-taattcgagcatggtagcagatctgatttaacacatttctctgcagctccgtcgaggctatgaagggaatcatgctaaag
-gcagttgttcggatatgtgctgccggcgcggatatcgacagactgattttgcaaacgaagacattccggtgacccaagtg
-cagaagagtatcggtgatcgagctcgtgctagggcggcaaacggtattctagcagatccagtttcttttttgcgcactaa
-cgcattgaatcttcttcggcaagacctttatgcgaaccttccggccagtatcaggccaacagattaaggtattacttgtt
-cagctgtcgtttggtggattcgatgttgatggcacaacatgcgagcagatacagacacgggcagtcaaatccaagacgta
-tgtatttgtgttaatgactggattaacgcttgctggaactgcccagaacagtcgctgcgcggggccaggtcgacgttcag
-tagcgcagcagtgcggctgattcacggaatcggggctgcacggcgtatgccacaatgatagataacggtctgacgcaccg
-cgtcagtcatatactcccgttccgcacgcgcggagaaagcgtcggacggagctggcgttttacgtttgccctttcagttc
-gccaaacggtttttgtttatttggtcgacaaccggcgcgcatcccgtttccacagtagcgtcattgcatgccggggtgta
-cattttcttgatagaaattttattttttccgcttcaacgggttgtttagcggatcgggaggatcgtgacgctaacaaagg
-ttgcccttttcagacgaaaatagcgcacagcctctttagtaattcggcagccaggttgccaccgaatgtctgactttgcg
-gcgcggtgtttgatggtctctggtgtgatggtcaatttgcagtgattttgcagataagagcgctcttcaagcaatgttac
-ggttatttggcaaactcagattacagcgtggtgtataaggagacaattaccggggaatcgggcgtttagggtgcgtccct
-gtgcacaatacgcgccgtggctgcgttcaaggctacgttgcgttagcgcaatacgagggatggcgtgactgtaacgtctg
-ttgtgtactttcggcgagcgaacgggtattaacagcaggcgaatttcaacacgatgctgggacgctggggggtgtcacac
-ttgcacgtaaaccgttggaaagcgtccaccgttgccatgctggatgagggctggagcgcatctgcctgcacatagcagca
-gtggcatcatcaagcaaacagcccgctaaagtcgaatttttgtgccccgcatgtgaaccctgatcacttcctggttaaat
-aaaaaaactgcccgttgtcggtcagtctaaatgacgtaaaacacttgtgttagacgcaagaacatgaaatgtcaacgaag
-agtgaataaacctgactcaccaggtggtagttcaggcacaggggtcaattatggagcaaaaccgcccgtggaagggcagt
-ggcgggcataagggtgatgagattaggaagattaattcgtgcgttttggccatcggaggcacgattagagttcgccatcg
-tcagatttttttttggtggtccagttctttccaaccgcctaggcgaacgacaatgggtcggtacgggccgttccgaccgg
-ttagtcccagcgcacgagctttcgtgacataaaggccgagtttgattacagggatcagtgcagaccgctaaccagattgg
-cccacggagagagcgtgcggccagatgagatacatggagctaaaacaatgttagcgtgaaatggcctagcaaaggccttc
-ttgtagaagaaagcagcaatagattaaagcagcgtgaattatggtggtaggatatccaatctgactgttagtgcctaggg
-gatataaaacaccggggcgcgcgcattgtcagggtatgatcgatgtggcgcataaggtttaaacggagtaggcttgttga
-tcggtgaattgacagcccacaaacgatttacgtgcagaccgagtttctccatttgtgagaatacgcgcaataggcgcgac
-atcggaagatgaaggtcccagtacaaatcagcagttcttcagggatgtgggataaatttgaagatactgaacaaagagcg
-attgaagcccaataccagcacgaacaaacggataacaggtaaacctgttagaaagacagattaatcatctagcccgtagc
-cagttgcacgcagttgtgcggacgccgtttttacgcgatggtaaaacggctcattgccgccgaacgtggggcaccaataa
-ggtgccatgacgcatgatcatatttgagaatcgtggatgcggagagtgacgctgcgcgaatactcaatgtcgatggacgt
-gtgaaaatcataagtgcacgctttgctgctcaagacggcttgagacgcaaaaccaaacagtaaggcaaatcagcaagcac
-tggagaatgttaccacatgtgagctggcaattggccaattgagcgagtcgcggggatggacatcataaatgatggggaca
-atggcgcctgtctttcgcctgatcggcgtaagacgcggctacgccccaggcgttctcgcatgatgacagagcgttgcgga
-atcgacgttcatggagtgtccggcacaggctgcacgacttaacggatgataagacaaatatcaggcgatgggtacttgaa
-tttcaaagtaaaggcagtgcgaactgcgcggtaacggaacgagcggcttcatggcttttccaatagccaatggccgttac
-gacggtacaaagatgacagggaagggactcggagaggatcatcttaatgaagcttaacgaagcggtcgcaagcggttcat
-ttgctcgcctatttcaggatacgatggcaagggagaatacgaatggcttatcgctggtcagggacctgaaatgtaaaggc
-ttgttaaaacagagaggttttcatagggtgtccttttagtaaaacacaggttttgtaagggattatgggtacctgcggcc
-attaaaataacaacccgacaacatcaacagaatgtactggatctaaattgaaacaaaaggttaaaaagtttgagctggct
-cgcacaaacagcacttttttttaaagttttgtaatatttggggtagctaatcttttcttccaggataactctcttcgaag
-atttcaataagggagtgggcggagcaaaaggaagcctgggcaataccagaacgccgctttttgcccagccagtcgcgttg
-gtgcttcaggtcatccactgctttcgccaattcatttgtaagttcaggctcttgcgcagcatgataattgcgaatcatgc
-tggctatctccggcaaagccttcacaaacattttgtcgattttcagtagtcgcttggcaacgattcatatgacctgcagc
-tgagcagcgcctgcgtgccatgcgaatcatccgcgccacccgaactccggcattgcgcagggacggaggattgaacaccg
-acatgagggtcgtatacgtggcttttctgtcaattccagaatcagtggttccggtgaatgcgatgggtttacagtttcca
-gaaaatatccgccaccatcatcggggtcatcagttgccagcggcagagaaggttttaccgacaagggcagcaaattgcgc
-gctcatgcaggactgaaggcatcgacggatctttccagcacccagatggacgacgtaaacatcgcccacagcactctcga
-tcggatagccaccggaaggccaatgcatccggttgattggagtacgcagtaaacaacttcgcactgacagtttacgtggt
-catactcgagtgtggctgtccaaaaatagcaaactatgatgattttcagtgcattaaggatatcgctctcttccgtgtca
-atcccgttctgggcggcttccactggctggcggatcaaagaactgaattgaattctgctttatgggcgagcggtaaatgc
-gcagaaatagagcgactgtaaaggcatgttcgggcggttggagagtcggcgtagaacatcgccacgccaatgctacgtgc
-ggcgggagttgaacttcaatcggcaggcgctcgcttcatgatagtgagcattgctgacctaaggtgagtggcgtgccacg
-gttactgtatacggttgggcaatgaagctaaagagtcctaacgctaatctgcgcgagggatcatacgtggcgacagtact
-ggatttgagtttttccaccgtgcgtcagcagagaatttctcgattgcgccttttcaggcacgcccgagtatcagagggtt
-tcacagtgatgatcattgcagagcgggtggtttgtttttacgcgcgcgcaacagctgctccagatctcctcaggcagagg
-ctttgttcggcaaatcgacaccgggaagcgcatcgggcagttttcgtttgttcttcataatgcgcgcgcagcaattgctg
-gttgagggttgttggggcatccaaacctagcgattttcatcgtctgatgcagacgcgtaatagccagttggtgaccaaca
-agctccttggctgggaatgggttaagttcgcgagcaatattagcgtaacgtggcaaaatcagggttaatgcacccagctg
-atggcgaacgtcaggatatggcgaaagaagtaagtaaatgttaacggttgagagggtgctcatcacggacttaatacata
-cgagaaggaatccgcctgtagtaccagatagggaaattgggctgcgggtttgcggaacgttcgagcgagtgaacgcacag
-cgagatttgaaccggggtagctcaaatcagggagagtagaacgcattaccggcacagggcgctctgaataaagactttta
-cgcagcgcctggatatggttaggcagcactacatcggcacggcctgaacgccctgcggtttaatgctggcaagaatagct
-tccgttcgggaattcgctttgcaaatagctgaagataagggttcgcgaccagagcgagcaatgctttcagttggccgtag
-cggtgttataggattctgctggaacagattggaacgcaaaacggtgcaaaaaattaaaaacggaacccacagggacaacg
-gctgcaccatttgctctgcttgagttgttaacgggagcacttacggcgcaaattgtctccccccggaaatcgagattgcc
-ggccgagtataacccgatgcagcggcaattaagcgaggcgctatcgtgaaacttaccaagtcgccggcgtaggttagcgg
-ctgcggcggtaaatccatgtcaccctgcatccggcggcggaataacgtacgtagagcaggaatggctgggtgcgggtatc
-tctttcgcctgctggatatgaatgccggtgcaaaaacagttgaagtacacgtcgttcaaagtaatgcgcgcgtgtgccga
-agccggactgcctgcctgccatcggttgggatttggccgcgcaaagcttcttcctgcagtttcggtcgggaatcagattc
-catcacgataacgcggcataggtttttggtgcgtgaatgcgacagagccagacgcaccaggctttccacgatcagtttta
-ccgtgcgcgttgccccgccagtcatgcgacgcaggtatggggaaatgcgacagggtatattgcagcattgcgggacttgg
-tgagtaatctggcctgagaccgagttgagggtgtagcgcaatcagagtctttgggttagtaatgcaggaaggggtcatag
-tttgttcagcggtgcgatggtgtgacgcgccgattgtttgttatagacttattagtaataagcccgtggctcagcgcacg
-cgagcggcgagtagtagttatcgactaagtgttcagagaattcattgtgcttacaaggttaagctggtcgccactagccg
-atgcccgcagacgcgtttgctttacacctttatcggtagatgcgagactggtagcccccagacgtcgccgtacgcccccc
-cattttattcccggtataggctcggggagtcttttttgctcacgctaaaggcagcagaagctggagatggggcgaggtgg
-gcgttatacggggtgtacccagcgggcccgatatacgctgtgacgtggatgtgcgtagcgcgcgactatgaatcacacgt
-ttgagagacatcggcgtggtatcacatggatatacaagatcagacgtcatttgacagccgatcttccagacgctggcacg
-gtatctcgatggctgcggggttgcggcgtacaggtactgtagtgtgcaggtgcgggcagttggtcagtccatttgcatcg
-gcattaggtgagtaaatgcgacgttcgataagatattgggacggaaatcactgcgaagaactccgcgaagcagtagaata
-cgggcatccactgccaacatggtagtgtgcgcttttcagatcgggagtaacacggtgcagcttcgaaccccagtaatcta
-gctcaaagggtgaagttagagatccctgctggcgataaggagggtcccggccgaaatcgctgcggcacgccacgtttcag
-cagttcgctatcttttctcgtcgttacgggtagtcgggtaaaggtgtcgttatcctgcggaaccgcgtcgtagtccaacc
-ggatggaccgaggcgtcttgtagggttccagccgctgcgttggagtcgcccgcct
->m141013_011508_sherri_c100709962550000001823135904221533_s1_p0/578/0_5373 RQ=0.798
-ccacacaaaaaaagggaaaaagggggaggaaaaattttccggacccggaaaacattggggccggcccacgggggaccgcg
-acccttttaaaaaataatcttcttgccagaaaggcccatatttggcccttgaatgcagcgcgataacaatccccctgccc
-caggtaaacccgctttttttttttaaccctttaattgttccaatccttgagaaatccccaattcctttcctgggtttatt
-taccgtggtgggtttgtgatgtttgtttttttccagcacttttatttcgtttttatgcgcatgactacccgtgcttttta
-gcaaagcaaatactctggctaaaacataccgatttttagattttggaatagcttatttttgacagtttattaacaatctg
-cgtggggattggcgttttttttgcggaggggaaattgattattacagaggcccaaaaaaacacaaaaccccggactccat
-ccagggttttctcttgcttaataggcggaaatacgcttcactggctaaagcagcaaattttttttcatcggcgttttttc
-agctggcgtagcccgctcagcggaaaaccgccgtaacggttcagaccagttccctgcaaacgtggggacttgttgttctt
-cgtccaggccagcgcggcacgggatgatgtcctggcttgcgttttcgtccccagaccctgcaatcgcgtcggtcagacgg
-ttttttttgccgctgctcttcccagttatcatcttcaaatgcgcgtcgcaagtttagatgattttatcctgcagataggc
-accggagccatcggctgctgtcggaaattcgtcgtcggagaaggtcaaaggtcatgtcctgttgccgccatacgtgattc
-atctcacgtacgtcctcttgctgttacgcccagtttcacgggccacgcatttcgactttcatcctggtgtaaaccagccc
-agacgctgcttggttttacgcaggttgaagaacagtttgcgctgcgctttgggtggtcgcaaacccttttgacgatacgc
-cagttacgcagaacgtattcgtgactctggctttatccagtgaacggcgaaggagaccaggcgcacacccacttccgggt
-tggaaaacggcgcactggctttcactcaggccgatgttaccgtcctgaatcaaatccgctgtggcagccatagcccgcat
-aattacgagcaatatgaacaacaaacggcgcaggtgagacaggatccagccgttttaggctttgcttccagatcgcatgg
-taatgcagcttttcagccagcgcccgctcctcgtcagccgacaacatcgggcacgcgttactggcccggatgttggaatc
-caaggttgcaactggggctaagctaaactttgcattttggtcagtcattcagcaatcctctcaatcgatatcttctggcg
-cttcagtggttgcaacaactgtgccagagcttaagagcaagcgaggttatcattcactgttttttatgcagaccgttgat
-tttatccacaagttcaatgcaagcttgtgaataaattacgcacaataacatgtgactagagatgaaataccgggaagaga
-caacggggtcctctttccctgctacggaaccgcattgcaggaaagagtataacacgcttttaattatctcaggcgtaaag
-tggcgtatgttgtaccgtggcaaagccccgctgccaaccagcgcaatcatcggagcataccagcagcatagcaggcattc
-atcgaatgataaagccattgatatcaaacttcgttcgcgaaaagcctggtgcacttcccaaccgccgagacaattcgcag
-cacagaattttgacaaattaatgacaaccaattgcgcccagaaaatcccagcagtgcgcaccattacaggaaacgggcgc
-aggaatgaatccatctgtcgcaccaatcagtttctggtacgttaatggagttcacgggcgagcaaagatactcagacgca
-cactgttaccgatgacgaggaacacggcagccaccatgcaacacccgatcatcgccgaaccgcgcccgacgcagcccgtc
-aacgccgccagaccgggcaaaccagctgtcatccatacccgccacttcgtcaatgccgtttaatagttctgcgtgatacg
-atcacgcagcgtaattcagttgattcgcgtcccctggaaatcggagtttcgggataccaccggcactgccggaaagcggg
-tttttcttccagcatatccagcgcaccaccaaaacccagaccagtttacggaactcacccagtgcgtcttcacgagaaag
-actagttcactttctccgcacaggccttgcttcggcctgcaactgtgccaaccacgccccgcagcagcgtcatcgtccag
-cgtttttgcagataaacagtgtgatttgcggtgagataatactgcgtcgccgcctggttacacgttttttgtaaccataa
-taacagacgctgggcagcgtcagagaaatggcgataaccatcaccgttaaaaccgctccgccgcccacgtttgctttcat
-gatctgacaatggccgccgtgggaaggcatagacgccctgtcccgctcttgaaataagtctccccgctctttgcccgcat
-cctccctcaccggttttgggcgaggatttcgcgcgttttgagtgcgttacggaaccacgccgtacgctcctcggacaacc
-cggacccggggattctcaccgcgccgcccctcaagacgccccaccggcacccccgcacttgccccgaatatgattgaatt
-gcatcgccccccgttattcatggcccgctcatgcagtgaccatgcctcaggtgacgagcaatcgcagcatcaggaagccc
-cgcgagattcaggttgattcgtgccgttgccatcaaatacggttaccccccaacgcggttaaactcttcaaacagacgta
-aatgccttcgacaagcggcgtcgtccaggttaccagtcggttcgtccgccagcagtatccgcgggcttgttccaccacgc
-gcggggcatgcccaacacgactgttgttcccggcgaaaggctgaaatgaggggaagttcttccgggcttttgtccagtag
-ccccgatttctcagccgccggacacccggcgacgaatattcgtaccgctgcaccggcgataatcagcgggaatgggccac
-gttatcgtagacatacgtccatcagtagatggtgatctggaaaatcatgccaatctgggcggcgcagaaacggaacttca
-cggtttttcagacgcgtgatgtcatggccgctaaaccagattttcccggcgctgggccggctcaatccacagatcagctt
-caaggagggtacttttcctgcgcgggaatgactcggtcagaaacgccatctccccggctgcatatggaacgtaacgcccc
-tggtcagcgcctgttccccaccggagataagccttgctgacatgttcacagcggggaatcatgtttaatctctcgggcaa
-aaagtgcctcttataaatcgtccccgcctaaacggacgccaaaatctcaattacgttcgcccgacaaccaatgtagcgga
-tagggataccaaactggtccagcaccgcgaaaattccccccccgccttcgcgtgcctccagtttcgttaagcgggtgatg
-ccccggttaagccaacggcttcatgaacagtttttggcctgggtttaccggcgttctgcccgggtgctggccatcaatag
-tgcagcaaccttcatgccgggcggccctttcaacgtcgagtttttcatcaacgttcggacgatttcttcaagcctttcca
-tcaggttggatttgtttctgcagcgtcgctgtatcggcaatcaggacgtcgatattaccggcgctttagctgcctggaat
-gggcggtcgggaaaggataacagaggcggaatcccgccggtaatgtctgggaatcaccgggaatattgttggcgctggga
-cccccagacctgaagctgttcaaccgcagctgccacggaaagtatccaacccgccgcagcatcacggattccccctgctg
-cccaaacaccgcccagcttacccaatcgtggtggttttacccccacacgttggacccggcccaccatcaggatacaacgg
-cgcctttgggcccttcaacattcagcgggcttcatcgggactttcgccagaatctcgccccatctccttcttttcagcag
-gccatggagcgccctcggcgtcacgaagctgcttggcggggatgcgcctccgtcagatttttgggtgataatttacgtgt
-gggtttccaccacatcggccgggatcaaagctggcctctttccagctcctccaaaacagaatcatcggtgggattttttt
-ttaccgcgccgggaagcaggctgataaatccggaaccgagattttcttggttttttaacaggcctgcggtttcaggcgcg
-cggaaaaaccttcttctggttcggggtttttcctgctccctgagcgatttctttcttccgcacgggctgctcttgcttcc
-ttgcgggaggaaccaccatcacctcggcctcttctccgcttcggcagccaagcgccggtttcgcagctcttcgtcggtaa
-tttcttcctttagcccgcttcttcttccgccgcttcgacaaattctctacgtttccgcttcagctgcactcttctggccg
-aaccgcttcggcggttacggtcttccggaacggcagctccttacggttcgatagcccactggctccggggcgtttccttc
-tacgacggttccgggctggggtgcaacggacttacgcttcagaggggcctgcgcttttttttccactttcagcaacctgt
-tcagtgacattctcacaacgtcgggcagcaagtttccggctcggcttcatatgccggctgcggtcttggctcttcaaccg
-ggcttgttcaggaggcttcaccagggctctttgcgcctgaacgattttcttctacaccggttgttcattctgaacttctg
-tctcgtttttccggggtctgctctttttgaccacgcagcagaaaaagcccacgctgcttttcctttcggccatttgcgat
-acactcctcgttggttgcttcatgcacagccgttaacgcttatgtacagtagcagctgaaaaatgatgaaattagtctat
-caacttaactttacaaattacatcacccggctgcaagtatgttgttatctggcggattgagcactttatcatgaaaaaac
-gcgaatcattccggcgcggccaaatccgcattaattggcgggcagtggcgaggccgtaaactcccggttcctgctaagcc
-caggtctgcgccc
->m141013_011508_sherri_c100709962550000001823135904221533_s1_p0/587/0_1515 RQ=0.818
-aacacgcgcctccaaccccaacaccccggcccaatgaaggggggaaaagggggaaggaaatgtcaaatcgggcgccctat
-tttaaaggcgggcaaagcaaaaaaatatagcccggcaaataaccgcgagtttacacaaaacagcaaaaatcaaaaatcac
-gcttggaaaaataaaaggcctcttcctttattatattgctgcaaagcggaaccgatttaaaagagtcgctcagcccttcc
-cagcggccaatataatctttgcccaacatttattttttggactatttttggcttaatcggcttactgggcgagtttcgtc
-ggggggagatgttaaatttctttcagaaaatagatcggcgtggcgggaggaatcaaattaatatcgggtccaggtcacgg
-gagtggacaggggtgagtctggcgcgcggaaaaacggcactcagttcttttggggctcgctgggcctgggaggctggcat
-tgatgagggatcaagatgaaattggaggtgagcaaagagttgtcggttaattttcatttgcataaggagccgaaagtcgg
-cgcgaacaatcataggaatggcggacgatgcagtagcgcttattataaactgacggcgggatagggttcgcgattttggc
-aggcctcatgccatagttcagggtagaaatctgcaagcggctcaataatgcctggcaccgggcatcttcccagttggaca
-gctggcaaagtccgttatatggccgattggcaacgagcgaaaaagatactcagcaataaaccaataaggacggtcggtgg
-gcaggactttcaggaatcatcatgcgtcgcgcctaaggctgtagtttggtccaatggagttccgttatgggacaattaaa
-gggtcacactgttaaaattggggaggaaagtctcgccaatggcgcaatttctaactctgcaaaacgacgcatcggacgcc
-gcgttcagatctcgatgaaccgtttgcagtgcaatcgacctcagacttttttggttgcagggcgtggcggcgaacataac
-ggccaaaacgctaatttatcccggattattgccgcaggaaaacggtggcggaggttagctgttactggaagatataaaaa
-cagtatgccgcgctataagtcgtcgcccggttaagcgataggctcgggaacgggtcgaaacggccacgctgtcctcaatt
-tgcggtatgcggtggctgtccgcaacaacacggcagcgttggatttacagcagcgaagcaaaagtggcgggcacgtcgcc
-gcgattaaatgaaacacgatgtctgctgaagtgatcgcccgagtgttccggctggggtcatggccgtcgctgcgcgtgtt
-aagtctgaactaactttagccgaaaaacattggaacagcaacttccagatgggtgtgtttcgggggcaaagcgtcggggg
-ctccaggtgacattttgtcgacgtcaaacaatgccctagtttttagcgcccgcaaacttgaagcatttgcgtgcg
->m141013_011508_sherri_c100709962550000001823135904221533_s1_p0/590/0_5400 RQ=0.877
-taaaaaagaagggagaatcccccctcgaccgttaaacgggttttttttcctttgccgtttccccgcccgcggcctaaacg
-gtcccccatcaccaaagaaaaaataaagctccattcacctgcccccgcccttgcttgaagtccggtaaaatctggggatt
-tacagcctggaccgaaaagtgtccgaaaaaggcccgccggtcgggcaagcagggccggaaactgcaaaatggttttaatc
-gacacccgcaagtggcgtatctggcactcgggggcagaaaccgaatgaacgattcctgaaaagccggcaccatcccatta
-taaagagtggatggagaaaaacgttccgccgactgggtaccgtttttgaagatctgcccccgatgaagaagtggtagccg
-cgaactgggacgacgaccacgctttgccagcttacccagaaacagtttaaacttacagccgccggaagagctggactccg
-taaattcccgcgtactgggcgaaaaccgtcaggaaaggcggtcgttccgatgggcgatgatacccttcgccgtgctcttc
-cagttcagcccgcgcattatttttccgactacttccgccagcagttttgcccaggtgactaacgccggcaaatcgacccg
-cttgcgtgaagcgcaatgtttatgtcgctcgccaccagtatcgggtcggtgaaatgaacgtcctttttgcgaagcagagg
-gcccaggcgcaccgttttaagctttaaaatcgccgattctgctctactctccgatttcaaacagcttcacgacgatgaaa
-gaaaggagcaacttaaccgcgcaagatacgctggatatcacctttggacgtcaataaaaaccacgctcgaagaagaccag
-ttccaaagagcctgtgcgacaaaggccgaaaaaatggtagcgttagcggcaaccgtgctgctggtgctctccgaccggaa
-atatcgctaaagatcgggcctgccggtttccagccccgatggcggttttggcgcgatccagaccctcctggtcggatcaa
-aagcctgcgttgcgatgcaacattcaatcgtcgaaaccgccaagcgcccgcgattccgcaccacttcgccgtgtttgctg
-ggcttcgcgcgacggctatttatccataccttgcctatgaaacgctggccgcctggtagaccacccatgcgattgccaaa
-gattatctaccggatgctcaactaccgtcacggcaatcaacaaaggcttgtactaaaatcatgtccaaaatgggcatctt
-cctaccatcgcctcttaccgctgctcgaaactgtttgaagcggtcgtctacacgatgaatgtagtggcctgtgcttccca
-gggggcggtcaggccgcaattggtggagcaagctttgaagacttccagcaggaatcctgctgaatctgtcgaaacgtggc
-ctggctggcggtcgtaagccatcagcagggcggtccttgcctgaaatacgtccacaggggcgaataccagcgcctaccaa
-cccggacgtggtgcgcacttctgcaaaagccggtacaaagcggcgagtacagcgacctatcaggaatacgcgaagcaggt
-taaatgagcgtccggcaaccaggctgcgcgatctgctggcaattacgccggtgaaaacgcggcaacatttgctgatgttg
-aaccggcaagcgaactgttttaaacgctttgataccgccgcgaatgtcctatcaaggcgcgttaagccggataggcccac
-gaggcgctgggcggcaagcgatgaacagcatcggccggtaattcgaactccggtgaaggcgggcgaagacccggccgcgt
-ctacggccaccaacaaagtgtcgcgcaatcaagcaaggttggctttccggtcgctttggggttactccggcgtattgggt
-caatgccgacgtcattcagattaaagtcgccccgggcgcgaagccacaggcgaagcggtcagtttgcgcggtgataaagt
-cacgcctacactcgccaaactgcgctattggtgcccggaagtgacgcctgatgctccccggccgcccgcaccacgatatc
-tactctatcgaggacttagcgcagctcattttcgacctttcaaagcaggtttaacgccgaagcgaatgatgctccgtgaa
-gctggtttccggaaccggagtaggcaccatcggcgactggcgtggcaaaagcttatgcggacttgaaatcaccatcgtcg
-aaaggctatgacggcggcaccggccggcaacagtccgctttcatacggtgacaatacgcaggctgtccgtgggagctggg
-gcttgtttgaaacccagcagcgctggttgcctaacggacttgcgtcacaagatccgtttgcaggtcgatgggcggcctgc
-aaacgggtgtcgttatatcatcaagggcggcgattcttctcggcgcagaaagcttcggctcggcactggcccgatggtgg
-cgctcgcttgtaaatatctacgtattgccatctgaacaactgcgcagcgggtgtagcaactcaggatgacaaactgacgt
-aagaacgcactaatcacggcctgcccattcaaggtgacgaattaactttgagtttatcgcccgtgaaacccgcgagctga
-tggcacagcttggcgttaacacgtctggtgatctgattggtcgcacgacccctgctgaaagagctggacggttcaaccgc
-caaagcagcagaaagctggcgctgttcgaagctgctgagactgcgaaccgcatccaggtaaggcactgctactgcacccg
-aaaacaaaccgccgtttgataacggccctgctgaacgcgcagttggctgcaacaggccgaaaccggtttgtcgatgacgc
-ctgaagcaaaactctctggttcgaatattcgcacaccgaccgttctgtcggcgcgtcgctttcaggcatatatcgcccag
-accacggcggattcaggggctggcagccgatcctaatcaaagcgtacttcaacggcaaaccgcaggccagagcttcgcgt
-gtggaacgcggtgcggcgtggaacctgtaccctgaccggtgatgcccaaacgaccactaatgtcggtaaaaggcatggcg
-ggcggcttaatgcgccattcgtcctccggttggttccgccttcccgcgccatgaagcaagattatggcaacacctgcctg
-tatggcggcgaccggtgtcgtctgtaaatgccgcagagccgcgcgggtagaacgtttcggcgtgcgtaacttccggtgct
-atcaccgtggtaagaaggcattggcgacaacggtgtgaatatatgacgggtgggtatcgtctgcattctgggtaaaaccg
-gcgttttaactccggtgcgggcattgaccggcggtttcgcttacgttctcgatgaaaggcggcgatttccgcaaacgcgt
-taacccggcactggtcgaggtcttaagcgttgacgctctggcgatccatgaagagcatctgccgtggtcttatacgagca
-tgtggcagcatacggctctcagcgcggtgtgaagagattctggcgaactggtcccttcgccactaaatttgcgctggtta
-aaccgcgaagtccagtgatgtaaaagcactgctgggtcaccgtatgtcgtagcgcagctgagtttgcgcagtgcgaggcg
-cagtaaggggtagcaacaatgaagtgcagaatgtttatcaattatgcgacctgcaggcgcgttgatagccgccaaagaaa
-cgcgcttgaagatcgcgcaaaattgaagtttgttggaaatttacgagccgttttccgaaggccaggccaaagcgcaggct
-gaccgcgtgctgtcgtgcggcaacccatactgcgagtggaaatgcccggtacagcaactacatccgcgaactgggcttga
-agcttcgccaacgaggggcgtatttttgaaagcggcggaactgtccgcgcacagacaacaccgctgcggaagtttttggc
-ggacgagtctgcccgcaagaacgtctgtgcgaaggtcctgcactctgaaacgatgagtttggccgcggtgaccatgcggc
-aacattgagcgctatatcaacgataaaggcgtcgagatgggctggcgtccggatatgctggtgtgaaacagacgcggtaa
-aaacagtggcgattatcggcgcaggcccggcaaggtctggcgtgtgcggaattgtccctgacggcgtaacggcgtaaaag
-ccgttgtcttcggaacggtcaatccagaaattgggcgggctgctgaccttcggtaattttccggccttcaagctggaaaa
-agagtaatgacgcgtcgccgtgaaatctcaccggcatgggtattgaaattcaaactcaataccgcgaagtgggccgcgac
-gtacagctggacgatctgctgagtgattacgtatgccgtgttccttggcgtccggacttatcagtcattgcgcggccggg
-cctggaaaacgaagacgcccgatggcgtgtacgcagcgctgccgttttcctcatcgccaacagccaaacagtttaatggg
-cttttggtgaaaacccgcgacgaaccgttcgtgcagcatggaaggtcaacgcggtggtggttcgcttggcgggttggcga
-cactgcgatggaccatgcgtgcgtcacgtccgtgcgccagggagcgaagcacgttacctgtgcctatcgtcgtgatgaag
-agaaatgcacgggtttcccagccgcgaagtgaaaaacgcgcgggaagaaaggcgtagagttccaaattcaaacgtctagc
-cgctgggtatgaagtgaacggtaacggccaaagtccagcggcgtaaaaattggtgccgaccgaaatgggcgaccggacgc
-caaaggcccgtcgccgcgcggagatcgttgcagtccgaacatatcgttccggcagatgcggtgaatgcatggcgtttggt
-ttccgtccacacaacatgggaatggctggcaaaacacagcgtccgagctggatttcagcaaggcgcatcatcgcgcccgg
-aaggcaagcgcgtacaacgccttccagaccagcaacccgaaaatctttgctggcgggaataatcgtccccgtggtttccg
-atctggtggtgaccgtaaattgccgaaggtcgtaaggcggcagacggtaattatgaatggctggaagtttaagcgaggta
-acaatgaattcgccagactgtgtcctggaagaatcaaattactacgaagtgccggcgttgttttctggcaaatgccggca
-ttgagcgtttgacctttccctataatgagggataatttttcataaattgtgctttgtttcaccaagtctgatgagtgaag
-gcacatcaagcaatttctgcatttacaatccgtctcaata
->m141013_011508_sherri_c100709962550000001823135904221533_s1_p0/606/3703_11739 RQ=0.870
-caccagtacaaacagggtattgacagttaagcgaccaggttgaacgctctcagattcgcggcggttaaaaatggcgacga
-aggttacacgcacacccacggcggcacttccggaagagggcggagagaatagattttcgccaacaagacgttaaatcatc
-gcaaaaagagataatccagcagcgatgacacagccgacgcataaatcgcgacgtgcgggtaatgacttttgcgcgtaggt
-aaataaggccgaacgcgggcctccgaaacttggcgaaacgcagtttgccgtagcttgatagcggtagaacagcacaccgc
-gcgcagcgccagcaaataggacgccgggaacgtgaccgtcgctaatgccggagacaatacccaaagtaatcaaatacggt
-catccggcggtgagataggccagaccatcatcacgcactgcgcacaatttcagtgattttcgcagacggttttgccgggt
-tggcgcaaggcaatattcagtggtgaattaatagccataattgctgctcccctgcgtaataaggtttgcggtcgtgtcga
-cctgaaatcaaacctgttttagcaagggaagcaaagggggcggagtccagtcagtagcaggaggggccgcatacgcagcc
-tccctcgccatgcggggatttaatcatcggcatcatctcatttcctcgtcacatcccttaatcggttaacgggaagccct
-tgccgcccgcgctccataacgcgacatccgggaaaatgtctggattacagcaaatgtcaggctggcttccgctcaggccg
-atgaaacaaccgcaagggggtagtacgcgttttttttcaacattccaactcaattctggttctgtgatgagcgctcaaac
-tcgcaacgctgtcatcatttttacaggcgtgatagacatggcagaaggcgttcgcacttaagattagcgggcaggtgatc
-attctcgataaactcacccagggctaatcgctctggcgaatcggaaagggcgtaagccttcctgtttccagcccgttgcc
-ttcgactcttcctgcacgcaagctcgttatcaaggccatgcaaactttaaccggcaaaaatcgctgccatcaccagatat
-gggttggcatcggccaacgccgcgcacggcgattattccacgcggtgattaattgacggtcgccgcacggaacatacgca
-gggcgccggtgcggttgttattgccccaacgacgctgcgtcggcaatacattcgcgctggaagcggcgatatcgagttca
-cgtttggtgcctagcaaacgcgcatcgacgacggcatcaggtccaatcatcgccggcgagcatgctcagcagcggcgaat
-cttcgccttccgcgtcaagaaagcacgttctcgccacgattattttggcatacttgatatggatatgcccattccgctgc
-ccgcgtgctcttcatacggcttcgccataaaagtggcgtgcatcttatgcttttctgcatcagacgcaccaggcgtttta
-gtgcagcgcatgggtacatcatcggcaggcttccagcacgttatcagtattggtaaaggttgatttcaaactggacgccg
-gcgaggctcagcgggaccgcgccatctgccggaatcagctgtaactgcgccagtttcatcaatatcattgagcacgtttc
-ggcgaagtggttgaggttatcacggagtaaacctggctttgtgtattgcggtcatcggttgccaggcgcgcagggcggtt
-ggcagatacgccttgcagcgtcgcgctgggcgatccagtaaaactagaactcgacagctctagcgctacgaccgggaaac
-caatccgcgctggcgcagctgctgcacaagcgttaagaacgttccgcggctcaacgtcaaagggagcgccatcttcatcg
-accatcggtgcagggagcatctgaccgataaactctggatcggcgggcagaaggagttaggaaccgagaagcaggaacac
-aggtacgaatcggctcgccatttcctgcgccagacctgcttcttctaactactgttgcccagaatatccattgcaaatac
-cgaggccggggggaaataacacgcctttctcgagcttcttcaggctgaaaacaggaatacgcttttcacggaagcaacca
-tttaaaatcggtaaagtaaaacatcaacatattgcgtattcggtagcgctccaaggtaagcgtttcacttctgcgtaaag
-gcgctaaccgcaccgctctcttctgattctgctgaacaaagttctgctacttaacgaattggtttccatgattgcttcgc
-cctttggtttgttttccgctcgttatcaaagcgtaaaatataatgacgcaaccattccgatctgtatggccaaactaaat
-gttgttcaaaatgttaaattgagtttgccaaaatgaaaacccactgctagattgaaaaatattgaacataaagggtcatt
-taaagcgcagtaatggcgataatttagtccacttttgtgagatggaagcaatggaaaaatatatgaaacaatccggttta
-tcggtgtcgtaatggtggcaggaacaggcttacgggtcatgcgacggccagactctggcaaagaaaagtatacctgaatt
-gcatcatgcatgcaggcgcttgctattggcgctatccaacatgcgctgggcggaaccgtccattacttgaacaacttttg
-ccgaaatcgatggcatttaatcttcctggtagtgccggcgcaatgtgcagccgcacctatatggtgaaaacggcgatgag
-cctgacgccgatctcgggcgtgatcttctgagcatggcgataattatgccgcactcgaaaggcgcatcccattttcgcca
-tctgccggggtttacaagaagctggtggtggcaacgcggtgggttcgttgcatcgcaagctgtggcgatagcctgaattg
-ctggaacatcgggaagatcccgaactgccggtgaacagcatatgcaccggtcacggcattaagttccaggttgaagaggg
-gggattactgtctgcggttgttacgctgaagtgtagcaaccttttggtaaactctctaatggacaaggggcgaagtcgtt
-agcccacgggttgcgtgttgtaaggctcgcttgcgtgcggatggtctttagtttgaggcggttagcgtcaatcaatcatc
-ctttgcgctggcggtacagtggacgccggaatggaacagtagcgagtacgcgcctttcgcgtatattgttcgagggcttt
-atcatccgcttgtcaagccaccatatcgctgaaaacagcgactctgaccactacagtttaaggaaatgcaaatatgatga
-tgagggactggcgccatggaaaacgcttgtcggaaatccgcagcatcgcaggggctttcacaacgtcgtggccggccgaa
-ctctccgggctgactcacaggtgctatcagtacgaaatagaacaagataaaagtcatgccctgctatgcagtacgcggca
-aagctgggctgaggtgttatgggtctgtcactctcgaaattcttttccgagccggaaaaaactgatgagggccgcaggtc
-gtcattatcaggacggacttaattgagatggtagtcagggtgtgtttcaatgaaagctggttcataacggtaacccgaat
-cgtcaacgctggcgatgatcttttgaaagcgtaccagccggggcaaccactggggaaagaattaagcagtcagggtgagg
-aaataggcactgtactggaggtgaaatttgttctggacgattaatggtcaggattacgcacctcgtcgcggggtttcaaa
-gttatcctattaataccggcatccgcacagtttcagtaatacgtcggcaggtatttgccgaattatcagcgcatacgccc
-accaacgttttaatctttttttgttctgtaagccgggtacgcgcaatgcgcccggaatctatacacaaaatcattcaagt
-tgcatcaaggcggcaagtgagcgaatcccgatgagcttactcaggtaagtgattcgggggagcgcacgccagccaaggca
-gaaggcggcttgcaggtatgaagtgtatataaagaatgtcgcaaagaaataaacgggcatatcggccccgggatctctgg
-ccgccctgaacgttcacaaactgcatatatctgatagacgtgaaacaggagcataatgaattttccatcatctggcttat
-tactggcaggatatcaagcgttaagtctcgcattgaaaaaccgcttatttattaacgggtgaatatatctgctgcggcgg
-aaaacatgaaacctttgaaaccgttgatgccggtcacccccaggcaccggctggcgaaaattgccgcgcgcaaggagcgt
-cgatatcgcctgtgcgatgagcgcagcaacgcggcgtatttgaagcgcggcgactggtgctacttctcttctccggctaa
-acgtaaagcggtactgaataaactcgccgatttatggaagcaccacgccgagagctggcactggccttgacactcctcga
-caccggggcaaaccgattcgtcaacagtctgcgtgatgatattcccggcgcggggccgccgagccattgcgctggtacgc
-cgaagcgatcgacaaagtgtatggcgaagtgcgcgacgcaataccagttagccatgagctggcgatgatcgtggcgtgaa
-ccggtcggcgtgattgccgcccatcgtggccgtggaattcccgcttgttgctgacttgctggaaactggccctcgggctg
-gcggcgggggaaacacgcgtgaattctaaaaaccgtcctgaaaaaatcacgcgctcagtgcgattgtccctcgcggggct
-gtgtgtaaagaagcaggcttgccggatggtgtgttggaacgtggtgacggttttttggtcatgaaggccgggggcaggcg
-ctgtcgcgtcataacgatatcgacgcgcattgcctttaactcggtttcaacccgtacgcggggaaaccagtgctgaaaga
-gggggggggggcgggcggacagcaacatgaacagcgtctggcttggaagcgggcgcgcaagaaagcgcaacaggtgtcgt
-ttcgctgacttgcccggatttggcaagcaggcggcaagcgcacgcgcaagcaggcattttctacaaccagggacaggtgt
-ggcatcgcccggaacgcgcctgtttgctggaagagagcatcgcgatgaattcttaagccctgttaacacagcaaggccgc
-aaaactggcgtagccggtccatccacttgatcccgcacccaccatgggcaccttaatcgtttaactgcgcccacgccgac
-tcggtcgcatagctttattcggggaaggcgaaaagcaaaaagggcaactgttgttgatgtagtggcgtgtgcagatgaag
-acatgtccggagtgcctaatatggggctgcgagcgaaatgcgcgaccgatcgcatggagcttggtggaatagtgggatca
-gaccgaatgcgcgtccttaagttcgcgagagattttcggtccggtgctggtggtcacgcgtttcacatcagaagaagagg
-cgcacagcttgccaacgacagcagtacggcttggcgcggcggtaatggacgcgcgacctctcccgctgcgcaccgcaatg
-agccgacgccctgaaagccggttcgtctttcgtcaataactacaacgacggcgatatgactcgtgcccgttttggcggct
-ataaagcagagcggcaacggtcgcgacaaatcctcgtgcatgcccttgaaaaatttcactgaatgaaagcgcatctggat
-aagcctggaggctgaaatgaccgaacatacagcagttttactacgccgccagtgcgaataaatatgaaccattcgacagc
-tgaatgagtcaattcacctgcgacgtttgcgtggttggggcggctataaccgggcctctcctccggcgcttcatctggcg
-gaagcgggctttggacgtagtgggttctcgaagcctcacgcatcggctttggcggcaagcgggcgcaatggcggaaacgc
-ttgtgaactcctacagccggcgacatcgacgttgatcgaaaaaagctacggcatggacaccgcccgtatgctcgcagcat
-gatgttcgaaggtggtgagatcatccgcgaacgtatcaacgttatcagattgactgcgactgaccgccccggcggcctgt
-ttgtgcgatgaatgataaacagctcgcccacacttgaagagcagaaagagaactgggaacgctacggcataaacagcttg
-gaattgcttggacgcaacgcattcgccgtgaagtagccagcgatcgctatacgcgggtggccgctgctggaaatggcaac
-agcgggtgggcctattcatccgctagaaccttgctcattggcgaagcggacgccatccgcctcaaacggcgggcgcgtgt
-aatgaacttgtctgccgtggacgcaagatcagcacacacacgcagccgttgtgcgaactggccaaaggtcaggtgacggc
-gaagtatgtgattgtcgccgggaaatgcgtatctgggcgataaagtagaggccggcaactggcggaaaacgcagcaaatg
-cccgtgcggcacgcaggtgatcacgcacgaaacgctgtcggaagatttcgccggttgcgctgatcccgaaaaacctactg
-tgtggaagacctgtaacatatcctgcttgattattagtcttagcgccggacaaccgcctgctgtagcggcggcggcggtg
-gtcctacggtcgcgcgcgaacccggatgagttgagcgccttggtggtgcgaaacctgctgaaaaccttcccgcagcgaag
-ggcgtgaaaattgattaccgggctggacgcggcaagcttctgctgacgcctgtcgcgtatgccggagtttggtccgcctc
-gataccaacatctattacatgcagggctacagcggccaggcgtgactgtactcatgctagcccggacgtttgaattgccg
-aactgctgcgcggtcgacgcccgaacgtttcgatgcttcgccaatctgctgccgcattacccgttcgccggccgggcgca
-acgcttgggtgtgccgttttaccgcgaatgggcgccggcggtattagcagcctgcggcgatcggtctgggcgtttaattt
-cccgattaaccgtgaagagtcaaaaggttgaaacaaatgaggcaacaatgaaattcattcagcgtcgtctttctgcagtt
-tttctgtgaccgcgcggggtttggcgtgaatgtggtaacttcttcgcccagtcggctgaaaacgccacggctggaaggat
-gttgagggcaacgagtacattcgatttcgccggcaggcattgcggtgctgctacgggacatcgccaccgctgatctggtc
-gcgggcggttggaagcagcaactgcaaacagttttaacccacacgcgtatcagattgtgcccgtatgaaagctaacgtca
-ccctggcggaggaaaatcaacgccgcttgcccgcggtgagcgggcagcgccaaaaccgcggttcttcaccaccggtgcgg
-aagcggtggaaaacggcggggtttttttttttggggtttgggggaaaaaaaaactttggccttttttccccgccccgccc
-ccatacgcggacgcctggcgtgattgcgttttagcggtgggcgggctttcacggtcgtacgtatatgaaccatggcgctg
-tttaacgcgaaaagttttgccgccgtacaaaatgcggctcggcggttcctggttcggtgtatcacgtaaccttatccggt
-cagaattacacggtgccttgtcaacacagactcctcgaacgccatcgaacgcttgtttaacatcagacatcggaatcgga
-agcgaagcaggtggcggcgattattttcgaaccggtgcagggcggagggctggtttcagttgcggccaaaaagagctggt
-ttgcccgctattcgccgcctgtgcgaccagagcacg
->m141013_011508_sherri_c100709962550000001823135904221533_s1_p0/616/0_18313 RQ=0.877
-aaaaaacacccaaaaggaaaaaaaagagagggaaatttttcccccggcaaaaaaaaagggtttttgcccgccaatcccaa
-aaaacaacttttcctttcaggaatccccggccagtgattggtggctgactattgctgctgccggtgtcgtgttttgccat
-cccagttcactacaccaaagcagcgtgacaccgtttttttttgcagctcctttgcgtataacaatatgacgtccaaaagc
-ccacttttctagcctgacggcgactcattggccggagctgaaagcaatattgccgtacctcgtgcgacatcgcatgttga
-taaggcccggggataggcttcagcagtaatcaataccacatcaattacgtggaacgttgcgcgcgttgttctgcagcaac
-acacagccgggtttgtttcacgggtcccatattttcagcctgtaatgggctgtcacttcttttgagaaaatagcgacttc
-tccagacgcccgtgatcgcacaacataaccaagtaccggcttttttgcccatgcggtaatgcattcaacccgggcattcc
-ctgccagttgtatggcaagcacctgccagcgctttcccaggctccaacaggtttttgagtaaccgtcaatatgccgttgt
-gcacgcgacatagcgggtaagaatcgattggctgggatcgtattcagtaaaatcggcaagtatttcatctcaacgtctct
-ttatagcagtggccagcatggaagaccagttcaccaagcctctatggctggctcccgagcgttcgcccgtttgcgccgcc
-catgcgtacgtttgagaagctgaaccgaggatgaaatcgccacccatcgtcacaacatagcagccacaccatgcataccc
-ggcaataatacggcagcaaaaaataagggctaagccgagtgtgagcaggtttgtcgcccatgcaattttgccaatgaaca
-cattgccagcccttctcccgcgaataaacgatgacgataccatcaaataatgggcagtcccggcggctgaccgccatgcc
-tgcgccaagcgatgcaaggatgcgattcgccagcgagccaactcgcttaacacagaatctttgccaagtaaccaaaaaat
-caatgccagaccgcggttgggtgctaacggctatcacgcatgatttcctaacatgcgaatcgcggctacgtgcagaaata
-cgccatcacaggtatcagcgaggccgtccagatggaatccccggtcatcagcacagcaacaagtacgctaaacagtgcgc
-cagtggtgcgccagcacgcatgctgcgcagcaccatgaagacaggcccgctaatggcgcgcgcaagcaataatccatcaa
-aaggaaaagtaataatgacgcgcgagaatatgctcgaaatccagtccctgggacagcgacgcggtacaggcagaaacgcg
-gtaataaatgagagctatcgcccaaaaataatttactcatttgatttttacctccaatacccgaaccaccgagcgcatac
-ttcatttgccgcagcggccactgctgatttacccgcccgcggcaaatatcacgaaaagtggtgccagacgactctccggg
-ccacaatccgcattcccacttcgttagtcataatacaacctttgcggggaacgtttggcaggcagcaatcaacgactgaa
-tctcagcattaatcgcctgttccatcgcgtgataatcaccattcccatcagggtcttttatcggccgccttaatgcaaac
-acagattgtcaccattgtggtaaagcattcaaggcaacacaacctcatttcggttaatgtctgcatgaattaattcatca
-agatgtttgccagcgctccactgtgcgccagtgctccggggcgggcctttgccgatgatgttctaatccgtcagccatct
-catcatcaaaggattggaggtagcgatatagcaggaacgctgtgaaggagtcccaataagcgctctgcgtggcgactctt
-cgctccgtgcgcctcgtccgtcaccaaaatcatccataccgagtcctgattcaaatgtatgatggtttcccatttgaaaa
-aaaacagaacaatggaatgcgaccaccgttgcttgacgcgcaaaacatcttacgcgatttaatactgcgcgtaatataat
-taaaaatccagcattccaatccattacgaaataagctggcattacggaatagccagaaactttctcgtgttaacgtccga
-caaaatggcgtcattgacaagcggtttttctgtggattgacacatttatgtcagataatgaattaatgctactgcgaaac
-aacgcagcaacgggctatttgtgttttctgaatcaggctaattgattcaacgtcagcgacagatctgcgctgtacaagca
-ttgttaaaacaacgtaatagaattaatccggaatggtggcgacatgcactagggataggtgcgcataagtggggaaattc
-ttctcggtgactcagtccatttcatttcttcatgtttgagccgatttttcctcccgtaaatgccttgatcagctatttag
-accgtttcttcttcgcgcatttaggcgtttatcccagtttttagttgagaatctctccactgacgtcctgcatttgggtc
-cgcccgaacaggttggcagcgtggaataacatcgccagttggtattatcgttttcagcaacccttgtaaatctggctttc
-aagcgaagccgaactgtccgctttgatgatgcgaaatgggtggtcatccttggcgcccggatgctggctttcatgtattc
-gatgttgaatggccgttttgtttggcgtggatgctgtttcaggtttcttacttgcgggggcgctcggcgaatcagccagt
-ccacatccaccttcggccagcttctcgcgctgtggcggccccgcttggtaagccggctcggctgagaacaaattgctcct
-ctcgcatgcagcagattaaacccagtgattgaggtcaatgctcgttggccgcgtggttgactaggctgtgggtcaggccg
-tcttggcatccgacacccaatgtgggccttcatgccaaagtgccactgattgccttttcttggttctgattgcatctcgg
-atgcgcgttgctgctctttgttcttcttggtgcgagctgggtgcctcaatgatggtggctatgcgacaaggtgccttgag
-tcatcatgacgcctgcttcggccatgccagcgattgatggtcttgaacaatttggcgggcccagttgatgctgctcgcag
-caggtggcggaaattcatgatggtggtgcggtccggcaagggctatccagggataacgggcaaacgacgcatggaggcga
-ttgtcgtagcagagctcttccatcgcggcatcgctcaggttggtacaatgtgcaatgcagtgaatgcgtaagcatggttt
-ccagcggattaaggtcgccggccattaccagccttgggtaaaacggctcgatggacttccaccatgttttttgccatggc
-aagaatctgcttccatgcgggacaagaaaatcctctttctggtctgacggcgcttactgctgaattcactgtcggcgaag
-gtagttgatgacatcatgtatgaacgctgtttccatggctccagatgacaaacatgatctcattatcccgggattggttc
-gcaccttcgcctagaacaccacatttcgcttcttcggtaaggcactgtcagagcatcaacagaatgtgacttgcagattt
-attagcgccaccgaatgttttaaccgggtaaccgacgacccagttcggggaatatattcatcttctcgctgacatcatca
-agaattagaaaggtttatcacactccagagcaaacgttctttcagcaggcgggataattttcaacatttagaagatgtgg
-gttattaaggcataaaatggacgtaattgtattttgctttttgggtggttggacgcctaaggtagcagttttattcctga
-tggcggctgagattttgtaaatatctacgtcaaacattctcctcgaagtagaaaatgcagcccccggcagtgattcacat
-ttttttaagcaaaacgtttgttaagcgtgcccattttcagacaggctggttccagaaagcgaaattctttctcaaattct
-gcatttctcaagacacagctttctatcaatggtatggcccaaatcgaagttgctcaggatcattagtggtgctgagaagt
-taaataccgcatgcggagtatccactcgtcatcacgtatttatatatcatgaagctattgttgtgtttgtacatcagtag
-aatatcttctgatgtactccttttgctagacataacgcttttcacctcgcttgcaaagcttgctgtgtttctgaacattg
-cccaaattgttgcaattctgtatccaggcttcttcagtcatagctttcgggccgcgaaagactactgatctgaccctgat
-tcctcttgcagactttatagacaattaaaatgcagtttctgcaggtcacgtctgacgcatcattgtcatactctggccat
-tagagtaactcttctgcattttcgatgcctttggtaaaaaagtttatattagtatcagcaattaaacggacctgatactg
-atatgagtcttaccgcatatcggtcaactttcagcaatttaattacattaatccagcgcaaacgatttgttcatcacaaa
-tgatggtaccttgctttcagacacatttttttcccactccgttttcagcggacgcgcactcttatgtcagagtgcggtcc
-gcgtggatagcaaccagagacgcgatgacacgagtcagaggataacgacggattatgttcagtcagtaaataatcttatc
-aaaaaacatgattaaggtcaaaatgttttgatatttacaatttatgacgaatgaagcaataattatagatatatgagaac
-ataaatgaataattatcattacagtaatcattttgtactttgtattaatgagggactgaaatgttatatatatatacgct
-tgtcgaatttttatatccttatcgcactctgtcattatgcattttctgggataagtttctactgcaaccgcaacttcttc
-agaaaacaaaaatcagcaacgaagagacgctcgtcgtgaccacgaatcgttcggcaagcaactttggaaagcgcgcgact
-atacaggttattgacccaaccaaacattgcagaactccaccaatgctcatagccgtataatgttgcaggacatccccgga
-gtagagataacagacaactccttggcacggcccgtaaaaacaaatccgaattcgtggctgatttgccctatatttcagac
-atactgttatcacttaacaccattacaagccgctgccgcagattaattccgtggcgagcgtaaccccagcgcactatgcg
-gatgccattcgttataatgctcgaacgcctctgcaaggttctttgtgtccgttaacccgtctggttttgggcatgatact
-gattgtagtcagcgctttatcgttttcacgaagctcttctgctattcgcgttacttccggactgccgcacccgccggtgt
-tcttcggttgcaagtcccaaatccgcgactggcgtggtttttcattagggccggtagatgaaccattatccgtagcactc
-actggagacgacggaagatgcgttgccggaagcggcgttccaaccgcttcccagcaatgacgtcctgtagctgtttcagt
-gttgaagccgccggtagtggacgcgccagtggcagtgcctcacgatcacagcagtccagcagcgacgggtgacacgcatt
-ctgctctccgtttcacagcagacactcgaacccgtcaagcagccatcgctgattgctttcttcacggccacttctgctgt
-atgtgcccgtttcgatggcggtagcagcaggttttcgctcaagcaacagcggcattctggcgcattgatccggtataaca
-cgttttggcattgattcgcaggcataccaatgcaagttgctgccctgtccctgcgaagcagcgcccatacgccgacgata
-acatagtttggccagctctccgataacatggtgtatacggagaaggcacatcgcgtatccatcagtgtgacgactgcggg
-gcatccatcagtctcggtttccgtcttgagaatgacgtgcaatcgcgcacggcgcgacacccggagacaacggtgactaa
-gcttacttcccatcccgcgggcaataaggggcgtgcgctattccactttttgccgtccatatattcaacggcttctttga
-ggagttcattttccatcgttttcttgccgaggcaggcgctggagttctttatctggcttcatggcggcagcaagttcaga
-ggcaggaacaacctgttctctcggcggcgacagcagtaagactttcttcctggtcttgcttacgccagagaaatgaatgg
-ctggctgctacacatgttgccgggcaacgagggagaccgtcatccccgtttcaaagctctgctgaacaattgcgatcttt
-tgcctgtggtggtaacgccgtctgcgttttctgccggccctaagacatcaatcatctgttctgccaatgactagtctaaa
-aactagtattaagactatcacttatttaagtgatattggttgtctggagattcaggggccagtctagtggcgaagcatcc
-tgccgtgtttttattcctcattgatggtcaggaggtaacttatcagcgcgccggagatcaattatggtgtgggactgttg
-atagatgagtctgcgctggagcgtgttgaggtagtgaaaggtccatattcgcgtagctgtaaggcggttcaacaggcaat
-tggcggtatgtgttaacttcatccccaaaagggtgaatgctcggactgccctatatcacttaattgatacaactttttta
-gagtcgtcattagtggaacagataattgataactcagaccagtaaatgctaaaagaacgcacggcaccgctggaaatcgc
-tgctattcagagagttttgtatgctgaagaatggtggcaagccacttattgctcccccctttcccgcccgttttttaaaa
-aaagccgggtacccgttggaaaaaaacaaaaaattttctttttttggcgctgaacttgacctggtctgtggctgattaaa
-gcgatgaccgtgctgtctgtggatgagtaattttctggcgacacatctgcaagtgggcggacatcaagcaggtgctgttt
-tttgtggtgacggcagggcccgacaaaacggaagccctgcgcatgaagatgggatatggccggtattccagccttctcct
-tgcaaggcacagatattcgcgaaaaacggaggcgtaattccgtctgttccgagcccgtaaatccggtgtggccgtatgcg
-gcccgcagggggaggtggggtgggggggagatggggtggtggggtggtgtttggttgtgagggcggaggagggcctgggt
-gttgagggatggtgtgtgggggggctggtcggctggaactggatacgctggtgcagcttgcgctcatgacagcgcttccg
-acatgccgccagtcccctgatgaccgactgcaggaacggagctttgcgcacggaaatctgtccggtctcaggccgtgaac
-agttaacgtgcggtggacgcgatatttgacacgagcggagagcgtctgtattgcctctgttgcagcacgcgcacggttct
-gcgtgccgtccggtgacacgggtggtgctctgttgccgcgtgcggtatgggaactgattttctttctgaacctggtcgtg
-acttgatgccctcgcccatgactgctgagtctgccttcacaacaggcagctgttttcgttactgtctcttcttgtccggt
-gcaatagctcaataatagaatagaaacgaatcaatatctattttatcgatcgtttatatcggatcgataagctaataatt
-aacctttgttcagttccacatgcacagataacgtacagaaagaacatttcagggaagcaacagaaccacaattcagaaac
-tccaagccggacctcgcgcactgtaaccctttacctgccggttccacgtttggtgggtaccggctttttttattcaccct
-caatctttaaggaaaagctgatgaaacgagctctgaatacctgctacaggctggtatggaatcacatgacgggcgcttcc
-gtggttgagccctccgaactggcctgcgcacgggggtaaacgtggcggtgtggcggttgcactgtctcttgccgcagtca
-cgtccacttgcccggtgctgctgctgacatcgtttgtgcaccgggagaaaccgtggaacggcggcaacactggcaaatca
-tgacaaccagattggtcttcggtacgaccaacggaatgaccatcagtatcgcgggctggagttatgggccgataacgagg
-ccaatacgcggcgggcaatgggtacaggatggcggaacagccaacaaaacgactgtcacacaagtgggtggtcttcagaa
-gaggtgaacgcccggtggaagtgtctcagacacggttttatcagtggccggaggcggacagagccttcagggacgggctg
-tgaacacgcaacgctgaaatggtggcgaagcagttggagtgcatgagggggccgatagccacaggaaccgtcattaatga
-taagggctggcaggtcgtcaagcccggtaccgtgggcaacgataccgttgttatacggggcggaaagggggaccggatgc
-gaaaaaacggtggggatacgggccgttttgttcgcggggatgccgtacgccacaaacgcatcaataaaaacggtcgccag
-atagtgagagctgaaggcacggcaaattccactgtggtttatgcggcggcgacgcagactggtaacaatggtcacgcact
-ggataaccacgctgaaatgggggattaccagtatgtgcacaacggcggtacagcgtctgacactgttgtgaacagtgagg
-ctgggcagattgttcaaaaacgggggtgtgggcgcgggaaataccaccgttatcagaagggcagactgggcagcgtggac
-gcggtggtacagccacacgatgtcaccctgaagcagggcggcgcactggcttccagtacgcggctgcaaccgttaccggc
-aataaaccgctgcggagcatctctctgttgtggagggtaagctgataatgtgtaactggataaatggcggacggcctgga
-tgtgctgaaccggacaaacacaaagtccactaatagcgcgtggatgatggcggaacgctggatgtcgcgcacggtggcac
-cgccacaacggcccaccgtatccatgggaaatggcggtgtactgctggccgattcggtgccgctgtcagtggtaccgcgg
-cgggcgacggaaaggcattcagtatcggaggcggtcaggcggatgccctgatgctggtaaaaggcagttcattcacgctg
-aacgccggtggatacggccacggataccatacggctaaatggcggactggttcaccgcaggggcggcacatgggcggcac
-cacagcgctgaataacggcgccatacttacctttccgggaagaacggtgaacaacgataccctgaccatccgtgaaggcg
-atgcactcctgcagggaggctctctcaccggtaacggcagcgtggaaaaaattcaggaagtggcacacctcactgtcagc
-acaccagcaactcaccccgaaagccgtcaactctgaatgaaggcacgctgacggctgaacgacatgtaccgtcgaccacg
-atgtcattgctcagtcgcggtacgcccgctgaagctgacgcggcaggcactgtgctgaacggtgccgattgaccccacga
-atgtcactctcgcctccggtgccactggtatatcccccgcgataacgccacgtgcagtcggtggttggagtgacctcaag
-ccatgccggacagatttcatttcactctccaccgcgcacagggaagttcgtaccggcagacgcctaaaagtgaaaaacct
-gaacggacagaaatggcacgcatgccgcctggcgtgtcgcccggatatggcagcagaacaatgctggaacagactggtca
-ttgacgcggcagggcaaccggaaaaaccatcctgaacctggtgaacgccggctaacagtggcgtcggggctggcgacagc
-gggtaagggtattccggggtggtggaagccattaacgtgcaccacggaggaaggggcgctttgtccaggggaacaggctg
-caggctcggtgcctttaactactccctcaacggacagtgatgagagctggtatctgcgcaagtgaaaatggcttatcgtg
-gcagaagtccccctgtatgccttccatgctgacacaggcaaatggactatgacgtgattgtggcaggctcgccggcagcg
-ctaccagacgcggtgtaatggtgaaaacaacagcgtgccgtctcaagcattcagggcggtcatctcgttcaggataacaa
-tggcggtattgcccgtgggggccacgccggaagcagcggcagtatggattcgtccgtctggagggtgacctgatgagaac
-agaggttgccggtatggtctgtgacgcgcgggggtatatgggtgcttgctggccattcttcgttgatgttaagggatgat
-gacgggctcccgtgcggcacggtccgggaatggatgccggcagcctgggcgatacctgaatctggtcacacgtctccggc
-tgtgggctgagattgtgggcagcagggaaccgccacacgcatgaaagcgtgcatcgacaatagcgacttccgcgcccggg
-gctggggctggctgggcttcactgggaccgcggttctgcctcagttatcactgacacctgatgctggagcccacaactgc
-agtataactggcaggactttcgccttggatgaacggtaaggacaacgccggcttatgtggaagtttcggggcatggcagt
-ggcagcaacatgtgcgtggcggtttccgtctggcagccacaacgatatgacctttttggcgatggcactcatcccgtggc
-cccctgcgtgacagtgcaaacacagtgtgagttgaattagcgggtgaactggtggggtacagcgcttctgttatcccgca
-ccttcagtcccggggagatatgcgtgtggggacttccactggcaggcagcggatgacgttctctccctcacctagaatgg
-cacatcactggacctgcaggcggactggaagcgccgtgtccgggaaaatatcacctgggcgttcaaggcggttatggcgc
-agcgtcagcgcgagcgctgacagggtataatgcggtaggcctaacactgaatgtgaccttctgacagaagcatcgcctct
-ctgtggtcccggttcatcatgaccgggacgcggacgcggcggcaacggatcttcaacgccacattcgcctggcattaaac
-aataacatgaatattcatcacgagctgaaacttgttacagatagtcggcgcgctgatcctgctgatcgcagatttgccct
-tcttcgctttttgtttcagagcatttaaatcagcacgggctttctgcgctggcagggctcatattggctgtgtctgttcg
-gcccggctctggctggctatatcacgcgaacgataacccggttgttcgcatattcgctgctggcagggcgtatttcctga
-cgattgcgcggaatgatcatgcaagcttcatgtggggacttgatggtaaaacatatcgcgtctggtaggctcgcaacctt
-tgactctgtgaaattctattctgacgtcaccgctctcgccggtggtctgcttggcttgttccgcgctgctagatcaaaac
-attcagcagaacgggaatgcacaccagagatatcaagcagaggaaattaaccgggtattactgctgttttttatactgcc
-tttttcccttatggggtgggttctgcatgcgcaccattgatcgcgcgttacaagtacgatattttcaccgtcactgaatt
-gtggtggggcccgggtttgttttgtactggctggctttgcattatgtgagcgctgctatgggcggccagcagatccaggc
-gctgaaaaaactgaccgctgtgccatcagccagacactggaagaacaacgggtggctcaacagtaaatcgtggctgaccc
-agtttgcaaacgattacagcctcctgactcactgacggaagcgcatctgggcgctgacgctcatttctcacggatttccg
-ggagagctgagggaattttgaactggcagacgggaaactggttactgaacaatgctggtatgaaagaaagcatgggcagg
-gttttaacgaacagttgaaagagaactgtcattcagcacctgatgaatgaaaacgctgcttcgcggaacccgcctgaatt
-taatcaacgcggaagcgaatgacgattttctcgatcgttgctggaccggcggtgactggtatcccttttcagaagggtcg
-ccgtttgtatgcattccatcacgtggaatgagcttcgtattgtgcctcctgcgggccctgaaagaagtacatcattgccc
-ggaaaatcataagcgcggatccggaatggtactgctcctctctttgtcgcgaaacagaaacaccgtgtcaggaaatttat
-gcaacgccttaaacagcttatttccgatgcaacggcgaatggtctgatttctcatgaaaactgccggaaacctggagtac
-aaatgagaaaatgttttgcttcgcggagggcagggactggtttttgccggctgaacggggaaaccatatttgtgacagag
-tcccgtcctgaaaaaacgcaccggatcctcggtgatatatgcccagaaaatggagcagacagactggtcagcgaacagaa
-atccagacgcaattatttgttcaaactgcagcccgtagcgtcggtgcgcgcaattcgacggacaaaacggcagttatcgt
-tacatggaaataatggcccatgcaactgaagtccccgtgatcagtatgccggccggtttgctgttgaagacgcatgagga
-ataagatccgcgaaaggggggtaagtagagggagagatgacgcccggcgagcgcgcctcattcaacgggccccctgaaac
-cctggactcgccatcttcattgaaccgcgcgcgtggccttcacctccaccccgtgcagcacggtgaatggcctgatttct
-gaacatggcgggactggcgcgtgaagaattccgggtgctgtaattgaacaacgcagaatcagctgattgccggtgaaacc
-gctcttcaccggcacccatcaacgcgcacggaagtcatcgccgggaagtgaattaaacgcgcctgtaccacaaatggccg
-ctgccgtggttattgcacaccatcaccgtccggtgaagtcacacgccaggtaagcgcagaccggcttatcaccgaacgtc
-tggtacaggcagctgggcctggtggattattcgggtggcgcggaccatgctgatagtcggtggcaaccaggttttctcct
-tgccggaacaatggtctgctttaacccttcacaaccaatcacacctgttttcacttttatcttctgtcttcagaggtatc
-ccatatgaaaattatcacccgtggtgaagccatgcgtattcacaaaacaacaatccgacatcccgtctttttcgttgctg
-tacggtaactaccggctggcaggcagtgcttgaagcgtatacgtcccgtgaagtgcaggatattcggtgtgctggcgcgt
-tgtttgctgaacgccgtaaggacagttttggtgccgtatgtcgcggctgatgagcgtcacctgaactgagttggggaatt
-gctgaaaatgaggcagcaatatcgccactaccgggacattcttagccgattttctgtaaaggattttatcgtgtcagaca
-cactcccggggacctaacacttccccgacgacaatcacgaccggcccctggtggggctgccctgcacgtgatgcccctgt
-ttcggggcacgtctggtggcaggaggggtaaaccggtttgcattaaacctttgcggaccgcgcgcggtatcagaggctgt
-tattcaggcgatgcagatgcgtaccacctggaccagcgctttccgctggctgatgaaacaactgacctgcatgctcaacc
-agcggtgaatgtaaatccgcgcatcagcataaccggtcacgctgtatcgcaaaaaagggctgacctgcaaagccgataac
-ctcaggcagtctttgtgattacgtttatctggctgtttttatactcgatcgcccgcaatgaaaattaactctccagaaat
-agccttctgctacggcgctggtgttttcaccgacgtccctttttccattttatattggcatatcaggaaaaatcttcagt
-atgaaaacattacctgtattccgggcaggcggccagttctcgcccgtctctgttgaatctggagatactgctgtcgccga
-ctgctggacccgcagccactatggctcagcactgaatgacaaccttttgccgatgaaacgtgtgattaagcagcatattg
-aggcaggcaatttcactgtgtgatgcggtgacctttctcgtggaaaatacgcgctggtgccgtaccgactcaagcaaggg
-attccagcgcctgttaacctgcgctctcagttaataaacagcaatcgatatcctgccggctcgcaagggccgaccgggcc
-tgatgacgccgcgttcaattacagaacggtaaataacattacgctggtaagtatgcggaggcgaaatgatgacactggac
-agccgacagcgttaacgtaacagcgcgctggatatggggcacattgttcgtttgacgattgatggtgttaatatcaaact
-gaactgttataaggccgctgaaaacggttattactccggctggtggatgaccgtgactctaccgaaacaccggcaactta
-tgcagccctcaccagtgtgctgtaagacaatgcagtgatacagggtaatagtgtgccattttaacgcacaagaaacagca
-ctgtttgtcctgtattaagcaggccaagagaagaatgtccttaccgctgcgcgccatctgcagccttctgcacgcagacc
-ggtgaatctcactcaacaggctttcatttcctcctgacgccagcctgaatccagctggcgttttccatttataaacagaa
-aggaaccgataataatggaatggacgcccgcgagaccattgaagcaacggtaggatattactggattaaacgcttccagt
-ggagtgcgttaatggccgttttaacgattaggcattgacctgacaaaaaatgaattccaaatcacgggtcctgggtagga
-actagaaaaatctaagctcagaaaacggattaagtaaggcgtcaacggagcaaccgtatttgacgttatttattggtgag
-aactacgttccatggcaggagttcgtcacacggttggaagggcccattccggcagtatgctcagaaatatggcgcgatac
-gcttccggatgcgatacggcgttcagacggcaggtgccttgcttttctggcaacaagcaggaatctcatgcgctgaagca
-gcgaatagaggtaaaaacgccctaccggcaatgaatcacccgtcattggagtagtacgcaacagcagatttagcacagca
-atggaaaatatctttggtgaaaagttggtttagggaagctggagcgcagcaaacgtgttagtaccagtgcagttaataac
-aatggagttacagaacttttttggccttgtggcatagcagaaaaggctgttgttaatttcgattggttctcggatgagaa
-tgatgcacggtgaatacacagataagaatcaatgagcaatgagggttgccgggccacctcattgaataaaacgggaatta
-cttcgcttcgccggttttttcatttcgccatagctttcagcttttttggagatatcgggcggttctttggagagctcggc
-atttttttgatgactgtaatcgtcaaacggcgatctcatagtcacctttcatgctggcggaatgatgccctggatctgct
-tcaagctcatcgcgcggcttggatggtacatcgctcaggttgtccagcagcaaggacgcgcttctggttgtcacggatct
-ttttctcacgtcctgaatttcacgttgcaagtttgttcttacgacggaacagacgaacattccagtacgtcctggaatga
-aggcttgtaagtttccatttttataacccctgataatgtgagagtgcggtattcgtttaagcaaccgctattcgttaggg
-ccacaattactgccatagctgcgcagatgaaatgctttttatccctttttcactatcatatcctttttatcgcttgcttg
-aatcgaagcagcagcaagatgattcctgaagtttcaaggaattatttgcgcaaggcccggcaatcaagattcgataggca
-ctcaagcgttgattgcgctttcatgttcagcccacataaccatagattggtgttttcacaaccttcaggtcatggtggtt
-attgagcaactgacgcagctcttcacagcatcgttcaatttttccggtattggcaaaaaccggctgcggattaccttcgt
-acatggcggcatgaacaaggctcagcagtattttgctgcatcatgtgctggtatcaagaagtttttgcgcgttttcaata
-acacgaatggctggggcggcgtgcgccagtaagcattgatttgcaactccagcatacaaaccagatttgcggttaatggt
-ctggatcacgttcatattatcgattttggaataacgggttttcttgctggcggggcgtcaatcagtcgcacgcattttca
-cggcatcgtgcaggagtttttgtagatggctttccagacgtgggcgttgcgaagtaagttcggtgagaatgcagattgga
-tagacccgattcatactgcggtctagaccttttttcgccagttgaatggcagtgggatgaacgcccgttgtgggccagat
-accggtaaacaacattgccagtaaagagccgaggatcacatgccgctcgcccataacgccgtaatcaatttccacgctgt
-cggggaaacgccacaacaattgccagcgtcacccgaatcaattaaacttgatacggttcttgccagcgcgcagccaaccg
-caaaggaacctggagccgcgaccaagctacatcagcgtaaaacgagattaactcagtttgtgcagaggcgataagaccta
-aaatcgaacccaacacgtaccgccaatagctgcaaaggcgcgagggacaacgttaccccagaacgagattggccggcata
-tcacacacagtggtgacggcagcggcctaggtgctttcgggatagtaaacaggcgataatgagaaaagtgagcagggaat
-gccagcgcgaaccgagtaaccatgccaatgcggtaaatggcggtataacccggatttttcaaacgggcttaatgacttat
-ggcacgccacgcaagataaccccgttaatgagattaaaagcggctcataacttcatgctgtcggcagaaggcgcgcctct
-tgaattaatcgcgacggacaaacggacagtagtaattcccggcaggagggcgaaaaaattgaaaaggcgcatgcttactc
-ttttcgctttcaaaaaaaagagtggggtacatcgcgttaacacaccgccctgagatgaaatagtgatgttttggctgcac
-cgcacatacattttcgatatcccagtacccatcttccggccattgtcaaataacctcgaagcagggcttttggtaacatt
-tcataagcactgtcctgaagagatattaaagaactgattacagggtttagccaatcacaccgactacaacgagctacgcc
-gccaccgcatactgaccacgctggtatatttctgtcagaatgaccgcctcatgttttcgggttaagctgtaaagttaacg
-cggcaccgttcacgacggtggtcggcagcgtattttttcggcgggtgtttgtcatctggattgtcgtaatagacagcaaa
-cgccacctttcggcacaatatttttgctatctacccacatcatcactgctctaaaggccttttttaacgtctgttcccac
-gggccacgagatggaaaccttgcaacggttacgtttctctttctgctttaatctcgttagtttcatgacgcct
->m141013_011508_sherri_c100709962550000001823135904221533_s1_p0/662/1206_17024 RQ=0.845
-tgcgaggttgtgtaaattataaaaaactattccaagttacctgtggtgagtgaggtcccaaagtcgtggcaatgcaggga
-acgtctgtgtatgggtaagccagggtaactgttttggactattggcggggaatgtggtagtggtttttaaccagtgatgt
-gaagtatgtgattgacaacaattgtgggcagcgttggaatattgttgacggcaacgaccacctggttgccacctgagtag
-catgccgctgggtggttgctcgcctctgggaagcgccaggacgcctcaatgtttacgtaaggagtttaacggtgcgctat
-gatggcaaggatccattgtcagtgggttgaagtggctgttgacacaggggagaaatgatcaaacgtcgtttccgtgtctg
-gaggcagtgcaaactaggatggttacggatggatgttaaagtgctggccggtggtctgggtcaggaagcgccttctattg
-cacaagagataaagcgttcttattataaagatttgtaaatatagcgtctcggtatgttgctgaggcggtttttttgttta
-agtgcggaaaatttgttctcttcaatttttttgtaccaatcgatgcccgtggtagctcacaatatgagtggcgtgaattt
-tgcgcattgacggcgttaatgattcgggtattggggctttaactgtgattgacatttagtaatcactgttttctttccaa
-gataacagtatgagggaacgaggcatgatagaagacaaaaccgagatcgactggaacgggcacatcaagtgttataggcc
-cgggcatgccggaacgcctcaaagaaatggtgtgctatcagacgctgataaaggtaaatgctgggggtggtcgagacggc
-atggcggaagggtagtaatgggtgattcctgtctctttaaaagaaccttcgcattggcggaggttttcgcacttttgatt
-actctgttgaattataatcagaaggcagacgtattgcctggaaccgagacttttcaggtgttggcggttataggaatcga
-cgaccatcaccagcacttcgccatccgacaggccataatagacgacggttaacaatgcgtttaaagtgaataggtaggtc
-attttttgccccctgtcgcagttactgacgagtgaatttccttcgacacgcccagcgcgggctttaccttcgccgccagc
-cggaggtagagacctacagctgcaattgagttcaggccaggatcccggcataaccggatggccaataaagtgggcctccc
-gaagaaacagatccggattgaattcagttctgcttaaataccttgtcgagttaccaccgtttggtcatttgaccaaggtc
-tatcagatgttcggtgctggcagattgcgggcctttggcctaaacagttcaccgcgacaggggcaagaggtcttcttttg
-tataggtgattggcgtttatctacatgttctctgtaagcttattttaattgaagccgcaggatagctaacacgtgtaacg
-ctgaacaagtgatcagttcgaataaacagttcaccaacgtaatggcatggaaacaggtgacgtccttctgttgcgatgct
-tgcgcgatatcgtttggatgtttgcatcagcggtcgtttggcttcgctccacgtcagccagatttaatataaggcagtgc
-gtagtcctcgtctactgccagatggtgaatttgcttccttctaccggctttcagagttagctggtgaagactttaatggg
-cgaacgttagctgtggggataatgaccacttgtttccccggttaactcagttgctgcaaatagcaaagagcttcgatttt
-ctcaatttaaccgaccgaccggctggggcgaccgaactgaatgctgatgtgataggatactctgattcaccggccatcgg
-cgagggcgcctttatagggaagagttagccatcgaggcctatctcctcaaacttctgttactgctcaaatgtagcgatgc
-ctgagaaggggatcttgtttgccagctgtagttccgacatcaggaacgctttgcatgatataatcctttcgcatggatat
-tgcgcagcctcgctttgcgttcgatgtcggtgaattcacatgcaatatgccaaacgcagcctaatgcgagaaggttcgcc
-aaagcggcgtggatgaccggaattccaatgacgcgaaagggcgttaatttgccgatgcgttcgcttcgtttaatcaggat
-tttgctccttgaggattcatcctgcatacgttagcgaggaacttcggcattccaacgctgctagagcattaagtttagct
-gctcgccggagagtgtcgcatcacgggaggcgacctctttacactgggaggatcatgcgggctaagcggaagtggttttt
-tcttgtttcaaccgtgtagcgtgctgcttcgcggataagtatcgggcaggcgcatccgctcccggtgcaggtaagtgatc
-tatcgtctggcggtaaatgtaacccagcgaccactgggttctgatccgatcgacatctgcagagtatttcaaattcgcta
-tagatagccttgctctgaagctctggccttccatctccctggaatcagccaatgattcgcgttcgctgctacccagaaga
-ctttcagttcatggctcgaagcacagagaggggagagggcgcgactcatcaaacgcaacggcagtcacaaagctcgcggt
-taagatatttttttcagcgctcacagagaggtttgcgcaggtgtacgcaagagataatgagatccgccattgcctgaatg
-acgcagacagggtgcagggtatgtcgccattaaatggcgcaggccgcaagattgtcgcttctaccagtcggcagcgggac
-actttgcgttaaagtcgcaaattatcatatgcactcctgcgtgacgtaagggattggagtggccggaaacctcatagtga
-gcgcccacgcagttggctgccatgctttttgtagcgtacgcgcggcattggcaataagattcagattactcagactcttt
-cggggcttcgccagcataaagaggggatgcttcggttgcacaaatgtccgcgaatgcagcccgaggtttgagtatcactg
-ataaaggtaggtttttcgtcaataaaatgtggctgagaatatttctgaatagtatgtataggaacgaggtcacgccgcat
-gcaagtttcgttaatttggtcaaaggttgatgagtttttttagatctgttggtaaagcgcgatttataccgtaacgcact
-acgccagtagaaagcccgactactcctggcatggggttttaagctacaggatggagattcttttcttactggctaaagtg
-atattctgtaaagagttacggtaaattgagatgctatgaatataacaacttgaaaatttgaaagcgggttggaatggaag
-tatctgttaagaagcatcgcgaggggcgttatcaccgtttacatagaagcagtgccggccaggaagcgtagatgtgttgc
-tctcgctggaaaatgaacccgtgctgggtaatggtggattgacagcatatgaattcggaagctggttctcgcatgagcaa
-ccctttcggctagacgaaaagcggtggccattttaagcggaacaccagcatacgcgcaaaaaatgatgatctggaattta
-ttgttggaaacgttggctcgccgccttctatgcggcaggtcggggtaacgctttctgacgattgttcagctgatttgaaa
-ttgccggaaaacagaaaatcgcgaataaaatgtcttttgaagcaggatatgcaggccattgctggtggaattaatgacga
-agtcagttaatttactaaaggcacaaacccgcagcagcgggtttttctacctagacagaactttaaagctgcggctgagt
-tacaacgttttgatactttaacttcgactctctacgcgacgatcggagcaggcagtccgtcagtgccacgcttgtttcac
-gttggtcacggtgtttgcagtaaccgggttggattcgcccatacacggttgcggagaatcttgttgccgggataactttg
-gagataggtataacaaccagaactgagccgggctcggacagaccctggtttgtaagcgtcagaacgatgcggtcggttaa
-gcagaacaactaacggaacggtctttggatccggttgcttcagctggctgtacagctgatcccagagcagctggacttcc
-ggttttcagggtttgctttgttgaagttgaagcgaacgtcagccttcagagtgaagtgttggtctgtcttccggtgcgga
-gctggagcggagcaactatggagtggcttcgcctgagaaacggtggaacccccaggctagcatgcgcgtgtccggacgag
-tgcgatggtgtggtgcgtcacgatgttgttgtcacttgtattccagacgggtagcgatttcaaggagtgaaatcgcgtac
-tcacacgcgcggaagacggagaaacgccggtgtcgtgtttttacaataaacgttggatttagtgtctgcacgccatacat
-gccacccagagagtgtagatgtccaggtcgatcgtggattgggtaacccagtttagcggtcagtttgaacgccctgagct
-ttgtatgcacgttatcaccggctgcgctttggtacggcacgacctaaccagtgtaaccatttcagccaacatacgggtta
-acctggtaccacaaaagcaccaggccgcagttggttttcatagggtgcgggcattgggtttgttgatgaaacagtggtca
-tggtactgggaccagccagtttagcacagttgtacctggtgttatcttatcggaggcggcttgcgctaggtagcgaacca
-gccagtgccactgcaatcgcgatagtgtcttttttcattttttgcgcctgcgttatcatcaatacgccatgaatatctca
-acgagataaacggttaaatcttacgggggatctgtaatattaactctagccgttatatcttcggtcttatgcgagcacct
-ggcggatgtaaagtctaaacgttgtttgaaacattacaagtgtgaatccgtcggcatatgaaaacgtcttggtataaggt
-atgtttaatgcttttttgtaggacatttacagaagagaatcgcggaacccgcttcagaaagctccgcaggaattagtcac
-gatgcaagcattggctgggcgacaaaaagttccagatttaatctaatttacttaatgatacaattagagagtgattttag
-ccggaagttgtcctcgtggcgtgagaggggcgcttcggacgcctataacccatagcgttaccttcatattgcgcatcaac
-aagtttcagcaatgctttcttcagtcaatatctgcacaaccgatcagcaacactgtaattgcccgtgcgtaaagcgcgaa
-accattgactccacaaagtgtggcaaggggagagctgctaattgcttactttcgttaaggtttgtaagcagctctgaaca
-ttcccgactcgtttttgttgggcgagtgttacagagttgccagcggattgctgacgagagttctgtaacatggtaaacag
-tagaagttggtatcatggctgaaatcttcgcgatagacacttcagctgataagccgcggctgtagtgttttccgtagaga
-ccgcgattttacttggttctggggatgagaagccggaaaagaagatgtgcatagctgaatgtgtataatcatagccgctg
-tgagttactgtatggatgtccagtacatcagtgccaacaaagatcaaacctattttcggaagagctgcaaattttgtcgt
-tggtgagggaaaaacatacattaatcttgcccttaagaataagttgctattttcgtagttacggaatccgttaatgtgaa
-tcaattcttttatgttattgattttaataggaattttatgaagccctctctattaagcggatctataaatacaagaatac
-ctgggtcaacgttgggcaattgaataccgatcattgtttggcagttacagcctgacgttgacgacaggtgttttgccgat
-ggttttgatggtgattgtatcttcgggcttgtgagcaaagtgacagtaactgatgtaaaccatccgcctgttttcctggc
-tgacatataaaagtgtggcgattcgttacctaattctaattggttgattgaagtctatggcggaaattcactgaagctgg
-tgcgtctgtcgaatattcttcgatgcagcgctgaaagagaaaagcagcgcatttacccgggaaagactgaaagatttgcc
-caatatgtcttttcatctggaaggcgattctcggggaggtggatttaggatgtacgggcttaatatacgtatacttgggg
-aaaaatgtggttggttgcgatgcggcagcaaaacagtctggtgacagaaaaagattctgggtttatgcttgaaggtgcat
-tataggaattcatgcagctgcgctccggtggctacgcgcaggagctttgcagaatggggctgactctctacgccgaaaca
-ggagtttcctgcggacttgagtactgtggcgttgcagacgaccaatctgcaggcagtaatgcaatcataatccaacttgt
-tgtacgaccaagagttctttgctgttgccgtggttcagttggctggatcgctgtttcaggtagtcatgctcattgacggt
-tcttcataagaggtttgatgatgtagcgtcatcaacatgcaaactgcgtatcaagacgccaagatttaggattagtttaa
-ctgtccgtgagcgccggggtgagatatagctggtaaacgtatggttaaggcatagcagcaacgaaacgcgggcttcgcga
-atttgggggtaacgttcgctcgctggacatatttttgataccacgacgcagtcaggcatcacggtttgtgtggcatcggt
-ggggcggtcaatacgatagccagagcggtttcacgcccctgatggtattgctccagttggcccatgcgagatacacagtt
-gcctcttgtggcgcgttgagatgcgggcagatttggtagaaactgcccccgtcaggcagatgttagctcactgccgccgc
-cgcatggaaaccaatcagcgtatcgattcgcgagtaacgctacttcaaatttcacgccgtaagttaaaacacgtagcgac
-acaagtgtgatgaaatcgttgcatgagcgtattgacgttaggaaggcaaaagaagcacgcggtaataacgcagagcacag
-cctgccttccagtgatggcacaaaccagcagcaggaatggccaatggcgataccgtacagcgtacaatatccttaattag
-gcggtgggggggtggcgtttatagtttggcttggcagacaaacaaacttgttagccaagatcaataacgtgatgcattcg
-ggtttatatgaatgatggcgtagcgaagcacacaaggatcttccttatgatgacggtaaggggggatttcggggcgtgaa
-gtggacggctagattcagccagatatactagccgtgcggtgtcatagcgagtcattttcgtcattattatgggtagtgcc
-tggggctgttctgattcaattgttgccagttgggcataaatggcgcgtaatttgttcagcaaatcagtggttttgagtaa
-tcggcgggtgcgcgttaatcgcgcatcgtccaggcagctaaatatgcgtaaaagcgcgctcaaaatgcggatcatgttga
-taaggctgaagcaacaaaatacagcgtgacagttgctgcagagctggccctgcatcgactcagccgctgaaaacggaaag
-atcgtcgcttgtgggaaaatgttcagcaatgtttgatactgaatatgagaagagctggccacgctcggaaatctgtgcga
-caagtaatatgcgcgtggcgagccgttccccgttgacgcaatcgcacgttagggggtcagcagcgagagttttcgtctga
-tttcaatgtcgccatcagcagaccgttggcgagagccaaatcgtaagcggtgctggcttttgatcttcaatataaggata
-acatgcgcgacttgagcctcagataacgcgctcagttgttcatgcacgctgcaggttgtctgcgcgggcggacgggaaca
-gcagatgacataagtgtcaggagggtttggtcccagtacggcggccagagatcatggctgatgataccagtgctcataca
-gtgatgttcctcaaacatagtgtaaatggcgatcagcaatgcagccgaaggcaattgttgcatagcgttgccagacgcga
-gcaaatgaagcgctggtagagagcgttaagcaatcgcaaatagcgggagggaacagcattcatactgaggcgaggcggta
-aaaaagcagaacagcgtaattgatgaggttacgcacgtccgtagtcggtcatcgagattcggtcgcgcccggtgcacatc
-cccagcgttaagcggaattgtagttttacatcaccgcgccacgaaacgctgtggttcatgcaaagcgcaataaaaatacg
-cgcggtatacgccaggcgctgttcggtatagcgtttgagcaaaggattagcaataaaggctattagttggaattattcaa
-agagcgtgcattggcttcagcgcaagcttgcgctgtttctacgataccgagcgacgaaccaacggcatagtgctaatgcg
-ggcaattttaagttgcaattcgactggaatgccaatgattgaaataccattgtgcgagcccgttgcaatggcatcatggg
-ctcagcagccaaagaaatcagcagaaaatttgcataccggttacgccacgtttcagagccatttttgcagccggggttag
-ttcattcgacatgatgcttcattgcccataaggcccgaacagtttagtgctcttcccagcaggatcgtgtcaggggtagg
-taaaaatgcagcccaatactgaacagagtcgcacagccagccagagtggtggaatcgccaagcagaaagtttcagaatgt
-tcaaacggtacgcataaatcgcttttactgtggttttctagtatgggccggcattgtaacgtttttttggggctggagca
-cgttttctctgacggttcactggataagataatttcgtgttggatctacagagtcatggaactgaaagcgacaagattgg
-aaacgttgcaccagcccttaacgatcgggcggtgaatcctcatgcgggattaaagtctcgggcgatcggccacgaatact
-tcttcctttcaatgcaattactgggattccatgtaagcgcggttggtatgggggagctgaatttgtattgggacgaaaaa
-gtggttgcgtctgcaaggcaccgaatggggcggagccagcgtttttccatatcttgatggctctacatggggggtggagt
-ggcgagatgagcgaattgcgtctggttgtttacgccagcatggattgatttgccagcgcactggggaaaataaatggctg
-acgcgtgagcagcaacctctggcgttgcagcacaatcgccaggtttgtcgggttgccggttgcggttaccgactggaatg
-aattcgagtaactgcgtgagggtggcgtaaatgtcaggccctggtttgaaagatttgaaagcgctcgttgagcaaacagg
-cgttaccgaagccattgttaccgagttatgcggatttttttcgcaggtcgagtcttaacgctgaatcgcggccgcagtcg
-ggcagtcgttatggtggtcgagcattctctgttagtgctggaggtgcaggaagcggtttaaacgtcggtgctggtgggcg
-tgcaggctggttgctgcgcgtggtgaagcgtgcctcctgagcaatttttatttgctggcgttttgggtcgcagccgctga
-agagatggacgagcggatttcgcgaacgtacatacgaagacattacgcacgcagtttcatgcgcgtggccgctgcatatt
-attcgcagggcagcaaaaaagtttccgaatagtcgcaaactggaaatgaaaccgtgccgtcatgaacgtcttttattgct
-gagtggcgcaagatgcaggcgaaagagaagcgcaggcgaaggggctggcggcatgttctgtacggaagaactgagtggtc
-gtgcagaaggtactttgggatgtatgcaaaaattacaggcgtcgcttggcctctcgcctgcgtatcgctggggtaagtct
-gaatgcggatgcgcggtgtggcacaggaagaaatgattgccagtgcacccgaaagagattcgcgatctgtttcagtaaac
-gtatcaagttgatggccacgttattaaagctggaaaggtgcgctgaaaggcagaaacgctgtcgatttttcgggccttat
-tcatcaggcgattgtgattctgtcctgggagaaaggtcgctttatagccgtggaaagcatattctggttgaatgaatttc
-aggatttcgcgcagcgggcatgagttgttttaggcggcaattagcagcaaacagtacaagaacgacgtttgttcctgttt
-ggtgatgactgggcaaggcgtttaacccgattcgggtgcgcaaatgtcgctcaccaccgcttttgcccatgaaatttggt
-gcaggcgaacgctgtgattttagacacgacttacccgttttaaacagtcgtatcgggtgaggtggcaaccggtttttatc
-agcagaacccaggccagctgaaaagcgtaaacgcttaacaatggagaacaaaaaagcgtacgtattggaattgagagtca
-actttgcgctttgctggatagctctctggttatgcaaaccggaagagcgcttctgatctggggcgttacatcactgaggc
-tgcgagctggaaaagggaatcgctgggaagtttgaaatcgatttatgaattcatgcagcgcaagggcaagcagacaaggc
-ggatttacgtcatacatcgttggcttgcaggagggggaagtgatggtttttccggctgaggcgcgggagtgcgatttatg
-gaagaggcggcatactgcaccggtttgaggatttccggacgctgaaagaaggcggtttatgtagtggcgctgacccggga
-cgccatcgggttgggacgttaaacaagagactctcccctttgtggaaatactgaaaaatctgatgtgcggtgggagaaac
-cgtaagaacaggtggcgttgcacttgtggcataattacttcgacggtcgcgagataaacgctgataatcggggatcaaaa
-atatcgcggtgttgaaatgcgggactggattaatgaagtctgccgttgccacgttttgggtgggcgaccgatgttcatac
-gtcgccagagcagcaaggtttcatgtttggggcgtcaggatccgtggtggaacggccatttagtggagtccagaagaaat
-caataataattttccttctgagattcaatgcgccactgctggtccccccattgggccactcaactgggttgggagtttca
-tgcggtcgcgcgggaattaagtaccggtagtgcctgttgctaagtacgttgttgttcccagtaatcggttgatgcgtttc
-cacccgcctatgcagatttgtttggcagtgaatcgtgggtgccacaaggcaatattgtttgcggcaggtaaagtgcgagt
-cgtagttccataatgtacatccgtagttaactttcctagatttactgttaagcaactatatgcttgcaagataaagacga
-aaaagcctgcgcacggctaacaaaaatctcaggaaggattggttgttttttccgcccactgcaggaatgtatttcgcgtt
-tgtggggtcaggccagtttaaaaaccaatatttcgcgttgtttgttgagcacctgagactgcggtggaatagcatccagc
-tcggaaaccacgccgaaagcaggtagctgtcatctgccatatcgtggcaaattgcgtagtgaagcgcgtttgcggatttg
-tttattagcgttcaacctcgactcatatcaatcgtttttttgcgttgaggtatggcgagaatatcagctttaaccgggaa
-ttggggtcgctcgccccatccaacattcaaggcgcgggcgcggcatcaaatggtttagcttcgctcattctccaggcgag
-gcaggcgaaaatttgactggttgtgagctgggtattaaaactggaaccagcggtggggtaagatatacagcgttcttcag
-ctatttgtgaaagatgaatcgtctttctcaacggaaacaggctaactgatgcggtccattatcagttcatatgctgttcg
-caccgggcgcagcgagagctgaaacttttgcgtcgagtaccagaagatcgacatcggttgaaagcgcagcgtggtggcaa
-aaacggattacggcaaacataatttgaatcagggtggtcatggcgatgggcggttttctagggtagctctgtaaagacgc
-ggcccgataataatgtgtaaaatttttctttaattatactttactaaacatatagactatttccgtttttgctctcattc
-attccgtattagcttgctggttggatgtcgggctttgtcgtacacttttggttaaacagtctggaggaaataatgaaaga
-aaccgatattgcaggcattttaacgtcgctactcagaccaattgcgtggtggggaagcgacaaccgtcgtccgctatcgc
-gtgatgaaatactctactcgacagggtatcagtcttcggtttgccaaagttgccggcaaaacgcttgctgggccagaagg
-ggtatggccgctgggcagacgttttccggaaaaagtcgattatggtcgatgttttccgtattcagaagcggcgtggggcg
-tggcacaggagctcttgcattggcgcgaaaactctctggatgcactgggggtgattaatgagcagcgcagtatggcacgg
-gatgccgggtttaatgtggtgatggatgctgcccgctattgagatcctcgctgggcctggcaaatacaaaatccggaagg
-caaacttcgggattttgttttcagggaattagttaggcagacgcggggctggagtttgtttgcggatggtcctgcgccag
-cttcatcatggatggtgttcggattgttcatctgcaatttcgctacttagctgggcttcagccagggtaggtatgaacgg
-taggcgttatgtctccatcatacgtgatacacgagtgcgcgaagccgtcattccgagctcataggggacggttcagagag
-tcgaataacggggtcgatatccacgacgcatccgagataacctaaagggatggggactgctgggaataccgaatttgctg
-gcaatcatagtcacctcgggaaatctttacctttgatataagggtaaattccacatttcagttcatgacgcgacaggcac
-ctttcagatatagcccttcggataggtaggcgataccgggatgatcggctgctgacggaatgctctataaattgtaatca
-agaccggcatcaattgcggggcatccgcgatgatttttctgaatatcggctggtcatcagaccggaacaggagaaagtag
-gagaatacgcttcaattcagcactgaatgcagcatgttgatgttttatacatgacagcgccatgcaacttggctttattt
-tcccacaaacttcggcgggccaatcacgatagtccaattttttcacacgcgatcgcgataagtagcagcaatttaaagac
-atatcaacggcaacttcagcttgtgcagatccatttggttcgctcaacgttctgcgtgcaatatacagcgcttcctggga
-ggtataacgctgacaaccttggctgcaacgcatcagtgcgatacggcgaaacgcacggttagaagaaacagttcagccac
-gtttattttcaacagtagcggcgggtagcaaggcggtatcacgctggtcggtagtagcccgtttttgtgtcgcgtgctga
-aatatccaccagcagtttcttccgtgttcttcaatcgcagagggcaggtggaactcgccggttgacggggcctgggtcag
-ctccattccttctttttttaccgtaggcgagtcgcctgcgatcgtaatcgaacattccgggtacaggttgcagggcacta
-cttaatgccgggctgatttattctgccagcctcaagcagtttggccaggcaccagaaattaccgaaacgatcgatagtat
-acggcggccatgcagattctccggcgattaaaacggatagttgtccgaggccatctttttgcgccagcccagtcacgcca
-ttgttttgtggcttgttgcaaaaggcgggaaaaaaagaatgtcgatcgatcagacgggtcaacgtccaggacgcggcgcc
-ggatttgcgaagctggcggaataagcgccggtgctaccattttcctgatgatcaacaatatcggatggttttcaaccgag
-gtggctttacttcatgcgggcaacggccggaaaaatgacccacggatgggacgaagtaatgatttttcgcgcctttggtt
-aacactaacgtacacttcataatttaactttttgtcgatgcaagaaatgggcgtcttgtcgggagtttttcatggatttg
-caagcgcgtccattaaggataaggagaggcagcactgtcgaaggttggcatattgcctgggttttcggggagttcagggc
-gtaggaattttcgctaggcaccaacgtagaagcgaaaagactgggtttaaaaccgggttagcaaaatctttgagatggag
-cgtggagtggttgcttgcggtgaagaacgggcaggtggaaaatttatgcagtggttaaagagtggcggccgcgttctggc
-gtgtagaagcgggtgctcagcgggccgcatcatctcgggggaattaaccgattttcgtatccgttaatacattttccggt
-ttttggcaggcagcattcttgttggcttgcttagcggacttttcgaaacagtggtataaatagcggctgttacctttctt
-tcgcaaatttattcgccatcgcttttacccaagcatacgaatcgcgagagaaggttattgaatttccagatagaaatcag
-cacaaacgacgacttcccagtggttccggtgacaggaaaatcccttgtttctgcatcacagcagcggctcctcactgggc
-tgctttcttttggtagccttcggtatcgcgtttctattctttactcgaagatcatcgcctgcaatcattattactacgtt
-atagactggcggcagtggttaaaaaacaagcggcataaggaggctaatgaagtgttagcgggttgagattaaatcgcggc
-tagcgagcccagaatgctcagggcaggctgcgaagatgttgtagcagcgaaatacaggctaacgtggcagatatagtttc
-gtctcacgcatgaatgatgttgctggttttaaacaagatagcgcaagagagatcagaaatgaagacggctgatcgcagat
-gcagagcaggcagtgcaggaagatttcgacatacatcgcagccagcacaataccgccatcagcatacgcgaggaagaata
-tcttttgcgggtggtccagcaatatgcagagcatgcagtaagaactacggccgttcgccagtgccatagtgacgattacg
-taccattcggcagacagataggtgttcgaataggtcgaggatataaccagaaaaccggtaaggcgaatgcggagataatc
-cggtcgctattcgccgtttataaggtcaggaacataaaccatacatagacagcgtcag
->m141013_011508_sherri_c100709962550000001823135904221533_s1_p0/662/17065_31325 RQ=0.845
-cctgacgctggtgggtatgtatggtttgatgtttctgacctataaacggcgaataagcgccggattttatgctcgcattt
-cgcctttacggttttctgggtttatgcctcggactattctgaacacctatctgtctgccggaatgggtgaacgtaatgct
-atgggcactgggcggaacggcgtagtgttcttctgtgctctgcatatgtgctgacaacgcaaagatatgtcgttctcggg
-gtatgtgctggggggtttgtggtgtggtgattgtatcgttgcgatatcttctgcagctgctgctctgcatctgggatcag
-cgcggtcttattctgattgcctatggcgctatgttgtttgaaaccagcaacaatcattcatggcggtgagacgaactata
-tgtgcacggttagctgtatgtttcgtgtacaacatcttgtcagccttgctgagcattctgggcttcgctagcgcgattat
-ctcaccgctaacactttcataggcccgctttatgcggggctttgttttttgttcctgccgcagtactgtttaggtaagta
-aataattatgctgctccttcgaaggtaaagagattagaaacggatagccgaggctatctcaaagaaagcgcagtgggagt
-gagcgctggctgtggtgttattgcagagccgaagggatttcgtgtcacggaacctggaagtggttgcgttttgtggtgat
-ttctatctgaattcaatacttctccggcgattcgtatggctgtaaaagcgtatggcgaataaatttggcgagaaaggtaa
-cagccgctattatacgctgtttccggaaggtcggctcgcaagccaaattgtgctgctaaaccggttaaaatgttttaacg
-gctacgaaatggttaattccgagggatgatgcggtcgctgagcaccgttctaacgcgcagaagcggagccactctttaac
-catgattaatttttccactgccttcttcaccgaagcacattcagcctgccatcgtcagattttttggcgtacgttaaacc
-agtcttttcgtattttcgtactgtgtgggtgtagcgaatcctacgcctgactcgcggtaaacccaggcaattatgcagac
-ttttcgacattgctgctctccttatcttaatggacggttgcatccatggaaaactccggacaatgagccattctttgcat
-cgacagaaagtaattattgagtgtaaacgtttgtagtgttagccaaagggcgcgaaatattacttcgtcgcatccgtggg
-tcttttccgggggccgttgcccgcatgaaggtaagcagctcggtgaaacatcgatattgttgatcatcagggaaatggtt
-agcagcggcgcttattcgccagcttcgcaaatcggggcgcgtctggacgtttgacacgtctgagtcctatcgacattgct
-tttttttcccgccggtttgcacaagcacaaatggcgtgactggctggcgcaaaaagatggtctcgggacagctatcgttt
-atgcgccgagatctgatggcctgcgggtattactatcgatcgtttcggtaattttctgggtgctgcaactgctgagtgct
-gggcagaattgcagcgggcggcattaattagtgccctgccacgctgtacccggatgttcgatttacggatcgcagcgacg
-tcgcggttacgtaaaaaagaaggaatggagcttgacccaggggacgcgtcaccggcgagttgccacctgccctgctgccg
-attgaagaacacggatgaaactgctggggtggatattcagcacggacaaaacgggctactacctggacaggtgatagcgc
-ctgggctacccgccctacgtttgaaaataaacgtgtgctgaactgtttctcctatacggtggtttcgccgtatcggactg
-atgggcggttggcagcaggttgtcagcgttgatactctccaggaagcgctggaatattggcacggcagaacgttgagctg
-aaacaactggattctgagcaaggctgagtttgtccgtatgatgtcctttaaattgctggcgtacttatcggatcgggttg
-aaaaatttgacgttatcgtgaatggaccgccgaagtttgttggagaataaaagccagttgatgggcgcgttgtcgtggtt
-aataagacatacatgctgcgattgcagctgctgaatgaaggccggtattgctcctgactttctcctgttttccgggtctg
-attgaccaagcgatttatttccgaaaatcatcgcggatgccgcaattgatggccgggtcgtgattgtacatttataggag
-ttccgtaggcagcgatcatccggtgatgcgctacttgcggaaagggcttattgaaagggtttgcctgtcggtcatgtaat
-tgaaatgtggaattttacccttatatcaaggtaaagaaatttcccgggaggttgacttgattgccagcaattcggttatc
-ggccagcaggtccgcattcctgttaggttaattcggagtggtcgtgatatcgaccggttttattcgctctctgaacgcgt
-cgctgatgagctggcggtgaatgaacgagcttcgcgccgtcgttggtatcacgtagtgatggggagccgataacggctac
-ggtttttcatactactggtctgaagccagctaagtggcgaattggcaggatgaacatcctgaacgcatgaatggatgagc
-tggcgcagacatccgcaaaacaactcaggccgcgtctgcgtaactaatcctaacaatccggaaggttttttggcattcgg
-ggatttttttattttggccaggcaggcgagggatctaatagccgggccgcgatccatacaatttttacccggatcgcgtg
-cctagtaactgcgcttgctcattataccagttgatccgagagttttcgcgccaatggcaatagcttctgtggccacgccc
-tacgcgttctgaattacggaaacatcgaccatatgatttttccggaacgtctgccagcggtgcatacccttctggccagc
-agcgttttgccggcaactttggcgaaccggatgagtggatttaccctggtcgagtagatatttcatcacgcgatatgctg
-ggacgatgggttttgtgttgcacagcgatggtgtgagtggacgttaaaatgctgcattcggtttctttcattttatttcc
-tccagactgttttaacaaagtgtaggacaagccgactgcaacatgggcagcttaatacaatgatgagagataagcgggaa
-tatgtctatatgttatcagtatgattaagaaaaattttgacacattaatttattcggcggtcttttgaaggagtaccttt
-tgaaaacggcatcgtgaccacttgattgcattatgttttgcctgtatcgtttttgcaccacgctgggctttcaacgatgt
-cgatcttctggtaactcgacggcaagaaggtttcgcagctctatgctgcgcggatgcggaagcattgaactggataatgg
-gaccgattcagttatgtgtttcggcgttgagagacgatcatctttccattagtgaagaacggctgtatatctccccagcc
-gctggtgtcagttttaatacccgctcatcaaccaggtaattttttcgctgctgccttggagaatgaagcgggaagctaac
-attttgatgccgcgcgcgcgccctgaattgttggatggcgatgcgacgccgattcggtaaagctggattattctcgccat
-tttactcaacggcaaagaagattgaattatgaggtcgaggttgaacgctataaaatccgcgaaacgcgcttctacgaatt
-tgccaagatgatggctagattgacagtagctgctttcgggtgttttccgagcttggatgcattcaccgcagtcctgcagg
-tgctcacagaaaagctgaagtattggtttaaatggctgaccacaaacgcgaaatacttttctgcagtggggaaaacaacc
-atcttctgagattttttgtgctgtgcgcaggcttttcgtctttatcttggcagcgataagtgcttacgtaatctgtagga
-aagttaacttacggatgtacttatggaactgacgactgcacttactgcgcggaacaattgcgctgtggcaacgatcactg
-gccacaaatgctgatgagctgggtggaacggcattcacgttatggaacaaccgtactgtatgcaaaggcatgacgtaact
-tactttcccggcgagacggcatgcgtcaatgagatgttgagtggccaatggggggtgacagaggtttggcgcattggatt
-cagaagggaaaattgaatgttttgattttcttcctggatccactaaatgccgtgagcgcagatcctgacgtgaagccttg
-ctggcgtctgcgacggtatggaacattcccgggtcgctaccaacgtggcaacggagacttcataatccagtgccgctttc
-aacgacgcggttcgataattctgatcccgagttttatcagcgttatctcgcggcggtctgaagtaatattgcagcaggtg
-gcaacgccacctgtttcttacggttttctgcaccggcactccagatttttcagtatttcacaagggagagggattctctt
-tgttaaacagtgccatacccgatggcgtgccggggtcagcgccacgtacttaacgcgcgttcttcagcgtccgggaaatc
-ctcaacgtggcagtaggcctttccataatcgactcggcggccggacgccggaaaacccatcttctctgccaagccaaaga
-tgatgagtaatccgcctgttgcctttgctggcatgaatggtcataaagtccgatttgcaacttcggcagcgtggttgccc
-gctttttccaggcttggcaggcctatgtgatggtaagcccaggatagaatggtctccggttttggcatagcagagagctt
-atccagcaaagcgtcaagttgactctcatcataagtgaggctttttttctccattggttaagctgtttaggcggcttttt
-tcagctggcctggtttctgcctgaataaacggttgctcacctcaccgatacgactgttaaaacggtaagtgtgttaaatc
-acagcgttcgcgcttcaccaaagttttcatggaaaggcggtggttgagcgacatttgcgccgctgaatcggtaatcgctg
-cagttcatcacaacaggaacaacgttcgttgctgttttgcttgcgtaatgccgctaacaactgctgccgctgggcgagat
-atccgtggaaattccatcaaccagaatatgcttcacggggctgataaagcgacgtttctcagaatcaaatcgctgaatga
-taaggcccgaaaaatcgacgcgttttctgcttcaggcacctttcaggcttttaataacggggccatcaacttgatacgtt
-taatgaacagatcgcgaatctcttttcgggtggcactggcatcatttctggcctgtgcaccaccgtgatccgcacagagc
-ttaccagcgattcgaggcgagagcaaggcgacgctgtaattttttcatccatccagaagttaccttctggcactgaccat
-gatttctttcgtcagcattgcgccacccttgcctgcgctttcttttcgctgcattgcttgcgcactcagcaataagagtt
-catggaggcagcggtttcttttccagttttgctgacttcggaacttttttgctggcctgctgaataatatgcagcgcagc
-gcatgaaacgtgcgtggcggtaatgtcttcggtatgtaggccgttgcgatccgctcgtctctcttcagcggctttgcgac
-gcaaacgccagcaataaaatttgctaggggacgcttcacacgcgcagcaaccagcctgcacgggcacagacgagtttttc
-cgcttcctgcacgtgcagcataacagagaatgctcgccatttaacgctgcccgggctgcgccggattcagcggtgaagac
-tgcgactggggaaaaaaaatccgatactcggtagcatggctcggtatagcctgttatgctgcaacgagcgcttttcaata
-tctttcaacaggcctgacaatttacgccagcctcacggcaggttatcgaattcttcagtcggttaacgggcaacggcaac
-gccgacaaagcctggcggatttgttgctggcacgcagaggtttgctcacgcgtcagccatttatttcccagtgcgcgtgt
-gctaatccaatccatttttgcttggcgtaaaacacagacgcaattttcgctcattcgcactcaccgccgcagtgagcatc
-aagatgatggtaaacgctgcgttcgccgccaattcgtgcgtgcagacgcaccattttttcgtccggcagtacaaattcca
-gctcgccccatacagaccggcttacagtgaatcgccagtattgattgaaaggaataaggtatttcgtgggcggatcgccg
-agactttatccggcattgaggaatcaccgcccgatcgtaagggtgctgtgcagacgtttttccaaagcgttttcgctttc
-agttcatggctctgtagatacaccgaaattatttctatccgtgtaacgtcagagaaaacgtgctccagcccaaaaaacgt
-tacaattgcgccattacttgaaaccaaagtaaaggcgaggttttttatgcgtagttttgaacattctgaatttggtggct
-tggcggattttgccagcactctggggctggctgttggcgactctggtgcagtattgtgctgatttttaccttaccgctga
-cacatcctgctgggaatcactaaactgtctctggtgcttatggcatgaaagctattctgtccgatgaactgacgcgcggc
-tggcaaaaatgtgctgctgatctggggtacgggtattgaatattttcttgcttgattttctttggctggtggtttatgcc
-tgatgcacattgacgggcatcgcacaatgtaatttcatcattgattcctgtcggcattggaactttaaaaattggccgct
-attgcactatggccggttgtcgtcgcgtggtatcggtagaaacagcgcaagctgccgcgtgagccaatgcgtcgtcgttt
-tgaatatgcactaatattggctttatgctagtcctttggctcaacgctatactggaaagcgctggctgtattacgcgcgt
-atttttattgagctttgtggaaccaagcgtttccggtggtggtgggtgatgtaaaactggcgatttccgctaacgctggg
-gatggtggcagcggcgctgaccgatctcgatgaccgttactggcgggacgttttggtaactcatcattacgcctgttctg
-gtttttatctgctcggcctcagtagaattgctgtttccctggcctggctatttgcgattggtttaacgctctctacagcg
-cttcattttgctcggcggtctgggtcaacgcttatgcacaatttgccttcggtggcatttgctgatcgcatttacactat
-gttgggaacatcactgtatgagcactggtatcagcaagccgatgtaatctgctggccggtgcgtctggtacacgtctgaa
-cttattggtcatctgctgttccggtccgccgctgcagggacacctggcgcggttgcttatgaacatggcgcgtttattct
-tgagctcaagtcggcatgttttgatcgtgaatattgaattatcaacgcagggcaccgctgtaacgattttggctctcgca
-aacggtcttgctgatggcgacatgaatcagacgaaactctcgctgctgaccgctttacgtgggatcgtggtcaacgggga
-acgcgtcgcacgctgcattattattttgtcggcacaggaatattcacgagcgtggcagctctttctcatatcagtatcac
-attgcgtgacattttcgccacagcgacgtgctgtcgttttcagcggctgatgtccgatgcagggcaggcgtgcagcaact
-gtcacgctgtattttgttggcgttcagccttatcaacatgaactccgcatttttttgagcgcgctttacgcatattgatg
-ctgcgctggagggatgcgcgataacggcgcaccgccgatttactaaacactgggatttttgctgaacatttacgcgccat
-tgatgccaactggcacaattgaatcagaacaggccaggactaagcataattgacgaaaatgagctcgctgatgacagccg
-acgggtttgagtgattattctggctgctcttagcgtacttcacgcggatcgcctctttccggtcatgcggtagatgtgtg
-gtttgtggcttcgctacggccatcatttcagataacggaatgcatcacggtattggatctttgctgacagtttgtttgtc
-tgccgccaaatataacgccaagcgccaacgactgaagttagattattggtaggctggtaggttatgccatttggcattcc
-tgtgctgtggtttgtgcctaatcactggaagggcagctggtgcttgctggttatttacgcggtgctcttttttgccttcc
-gtcacgtgcaatacgctcatgcacgattttcatcacagcaatatattaattgtgccgttttttggtgctactgtgtttta
-acttactgggtgaaggttttgaagtagggcgtttactcggtaatgatacgctgattgtttgtcgcattgcgtgggcgggc
-agtgagctcattggctgactggcagtttcgcatctgcctggaatgagaggggtcttgcgcgcaatgctcgaacgcgccaa
-gaggcaaactgtcggtattcgatgcatactggagaatacataggggcgtgataaccgtctgcgtatgtattgccgcgcga
-tgcacacaaccgtggatgctgagctgcgtgtggtatcaaatatgtcagcgagccgaacgttacccgcaaatttcgcgaag
-gccgcgttttcggttgctgtgccttaacatacgtttaccagctatattagctgcggtgctcaccgggagcagttaaataa
-tctgaattctgggttcttgattgacgcagttttgctaggtgttgaaatgaagcgtacatcatcaacctgctgatgaagaa
-agcgtcaatgaggcattagcctagcctgaaagcggatgcagctaacttgaaccacggagaaagcaaagaacctctggtcg
-taaacaagttggatttattgattccttactgctgagatggtcgttgcaacgcagattactcaagttccgcaggaaactcc
-tgtttcggcgtaagagagtcagcccattctggcagctcctggcggcgtgcaccgggagcgcaggttcatgaatgcgataa
-tggcatcctcagcataaacaaatcttttctgtcacagactgttttgctgcgcagtgcaccaacaatttttttgcgccaag
-tatagcgtaagccttacatccttatccactcccgagaatcgcttcagatgaaaagacatattgggcaatctttcagtttt
-cccggtattgtcgcggtgtttctctttcagcgtgcatcgagagaatatttcgacagacgcaccagcttcaagttgatttg
-catagattttcataacccgatagtaattttgagggtaacggatcgcgacactttttatatgtcagcagacaggcgggatg
-ttttacaacagtctgtgcactttgctcacaagcgaaagatacaatcacatcagaacgcatcgaaacaccggtgtcgtcta
-acgtcaggctgtaactgccaacaatgaatcggttattcaattgtggccccaacgtttgccaggtattcttgtgattttat
-agatccgttataggagaggctttttcatatacacaaaaataaaaattcccttttaaaatcataacataaagaatgcttca
-cattaagatcgttactacgaaaatggcactattcttaaggggcaagattaattttatgttttccgtcacaacgacaaaat
-tgcggaggctctttcgaaatgggttgattttgttgtcactggatgtactgtagctccctcagtaaatcacaggggctgga
-ttgattatgtaacactttcaggctatgcacatcgttcttcgtcgttctcatacgcaagcaagtaaaattggcgcgtgttc
-tctacggaaaactacagccgggctttatagtgaagttgtctattcggaagatcagccatgatgacgcaacttctactgtt
-gccacattgttacagaactcggtcagcatcgcgctggaactctggttaacacgaccaaactggagtcgggaatgggttca
-ggcattgggctaccttaacgaaagtaatgcagattagcgcagctctcccttgcacactggtggagtcaatggttcgcgct
-ttagcacgggcaattaagtgtggtgaatcggttggttggcagatgatttgcctgagaagaggcatgctgaacttgtttga
-tgcggctaatgaagcgtaagctatgggggtttattatgcgtccgtaacgcatctcgtcgcagagacaactttcgcgggat
-aaaaattcactctatttgtatcattaagtaatttaggattaatcctggaacttttttttgtcgccagcaatgctttcagt
-ccgtgactaatttttctttggcggaggcttgttctgaagcggtttccggcgatttctctctgtaaattgtcgctgacaaa
-gattaacatagcttatacacgacttttttttcatttgcctgacggaagttaactttgtaagttttccactacgttgtaga
-ctttactgcaagggggtgctgcataagcgaagattgcggtagagttaatattgaagcagatccggtgaaggtttaaccgt
-gttatcttcgttggagatattcatgcgtattttggatgataacgaggcgcaaaaatgaaaaagacagcatggcgattgca
-tggcatggctggtttcgctcgtagcgcaggcgctccgaaagataacatggtaatggtgcttaaactgggctggtctagta
-cctgacctggttttcatacaacaatgggcgcgacccatggaaaaccaatgggcgtggtgcttttggtggttaaccaggtt
-taacacgtatgttgggctttggaaatgggttacgactggttaggtcgtatgcgtacaaaggcagcgtttgaaagggtgct
-acaaagctcagggcgttcaactgaccgtaacgggtttaccaattcatggacgactggacatcttacctgtctggtggatg
-gtatggcgtgcaagacactaaatccaacgtttatggtaaacccaaacagaacggcgtttctccggtttcgtggcggtgtt
-gagtacgccgatcactctgaatcgctaccgtctggaataccgttggacaacaacatcgtgagcacacacatggcctcgtc
-ggaaacggcattgctgagcctgggtggtttcctccgtttcggtcagggcgaagcagcttccagtagttgctccggctcca
-gctgcgagcggaagtacagacaagcacttactctgaagtcctgacgttctgttcaaactcaaaaagcaacctgaaaccgg
-aggtaggctgctctggatcagctgtacagcagctgagcaacctggattcgaagacggttcgtagttgttcggttacacga
-cgcatcggtttctgacgcttacaaacagggtcttgtccgaggccgtgctcagtctgttgttgaattacctgatctccaaa
-ggtatcccggcagacaagctctcgcaggtggtatggggcgaatccaaccacggttactgggcaacactggtgacaaacgt
-gaaacaggtagctgcactgattcgatgtggctccggatcgtcgcgtagagactcgaagttaaaggtatcaagacgttgta
-actcagccgcaggcttaagttctcgtctggtagaaaaaccgctgctgcgggtttttttggctttagtcattgaatgactt
-ttcgtcgttattcttacacagcaatgctgcgatctgcttcagagaagaaattttaattcgcgtatttctctttgttttcg
-cttttcaaatcaggctgaacaatcgtttcagaagcgttttacgcgacggctgcgcagaccagccagacgttgcaacataa
-attcgcagatcgatcgattttttgcgcgtatgctgggttgtttcacgcattaaaatggcggctttcgtttgccgaatggt
-ttgctcatggcgattgaccagttcggattctatgcttgtcatccagcccatttaccagcacgggtttcatttccaggtag
-agcaatcacatcgacgcttcctgggaggagctggcttcttgtaacgggtgattactcccttcgcgatgcttcttaaccag
-attacttcatttccacgcggtttcaagatttcaagttgttgatatttcatagcgatctcatgttacgcgtgtaactcttt
-acagaatatcagcttttttaggccagtgaagaagaatcttcatctgttgagctttagcccatgcagggtattgtggtgct
-ttctacgtgtgctgtagtgcggttacggtataatcggctttgacccagactaaaaaacatcaactttggaccattacgaa
-acttgcatggcgtgacctggttccttgataagatagctatcagaaatatttgctcagcacatttgattgagcgaaacgaa
-tcttttattagtgatactcaaccgcggcttgcaatttgcgctggaggcagtttgctggcattacgcgagcatcctcctct
-tttaatgctggcgggcccggaagagtctgagtatctgaaatcttattgcatgccgcgcgttacgctacaaagcgatggca
-ggccaactggtgggcgtcactatgaggtttcggccactccataccgcttacgtacgcaagtgagttgcatgatgataatt
-ttttggactttaacgcaagttgtcgctgcgactgggtagaagcggagcactctttggtgcctgcgcagtttatggaatta
-ccctgcagctggtcttggtgcatcggcaaatgcggtattgctcattattctttggcgtaactgtggcggcaacctctggg
-ctgtggatcggctgacaatatcgttaaccgcgagcgtttttggactgggttgcgttttgattgagtcgcgcgtctcccga
-tcttgtgcttcgatgcatttggaagctgaaagtcattctggtaggcgaacgcgaatcattgctgctttcaggagattgga
-gcgcagagctttcgaggcaggcttttaatagcgaatttgaagtaatctgcagattgtcgatgcggagtcagtaaccagtg
-tggtcgctgggtgaaatttacagcagacataatcacttactgcaccttggaagcggatgcctggcgatacttatccgcga
-aggcagcacgtcacggtgaacaagaaacacttcgttagccgcagtgatcctccgccagtgtaaagaggtcgcctcctgtg
-tgatggcgacaccttctccgcgagcagttaaattaatgctgcaggcatgcgttgaatggcgcgaggtttactcgctgaac
-gttatgcggatgagatcttcaggagcatcctgattgaaacgaggcgaaagcatcgggcaattacggcctttcggtcattg
-aatttcgcgggtcatcagcgctttggcgaacttctcgcattagctgcggttgtgcatattggcgatggtgaattcacgac
-tcgaaacgcaaagcgagcttggcgcaatatccatgcgaaagggatgaatgatcatgcaaggttcctgatgtcggaactac
-gcttgaagcaacagatcctttcagcatcggcgacattttgagcagtcatacagtgagttgattggagatagtgcctcgga
-tggctgattagcgctgataagcgcgctcgccgtgtggcgtgaatacgacgtatgcgctatcacaggttagtcgatagttc
-ggtcgcgcccagcggtcggtggtttaatgagaaaatcgaggcttctttgctatttgccattcaagtgagtttaacggcgg
-gaacaaggtgtctattataccacagctaaggttcgccatttgaaggttttcacagtgaactggtgaagcggtagaagaag
-gaaattcaacatctgggcagtagacgatgtgatgacgcactgcgttattattaaatctggtgtgggatggcgaaggcaaa
-cgacgctgatgcaaacatca
->m141013_011508_sherri_c100709962550000001823135904221533_s1_p0/685/0_8815 RQ=0.840
-aggggaaatctcaaggtatttcctcccccgcaaagccgcaaaaaagaaaaagaaaaggggacacacacaggaaaaccggt
-ggggggggaaaaaaattttgcccctttgggcccaggggaaaaacgaatttgggtcctgggggaaaaattaaaggggggaa
-agattccctttctaaacatggatttgttccggaaagtaaccgttttgatttggattgccaatttttttggtggttggcgg
-tttttttaaattgggctggtatttgcgggtggcaattctaaatctattaacccgacattcgtggttttttaattgggcgt
-tacagtcctgaaaaaacgtcaccgggctcaaatggcggcttttttccttttccactcggaggaaataaaccacgcatccg
-aactacgcaaacccgctgggcggatggttgtgaatgtccctcccccgcccgggtaatttaacttacgaaatcgttcgtga
-attagtcgatgacatcgcgtgctggcgtcagcgaagacgaaatctcagaaacaagtaaatgattgccttaattcaaggcg
-gcagataaagtcgtcaccgaagggccgcaggcgctctggcatgtgctgggcattatttaaggcgtgtcaaaattagacca
-attatattcaaaacagaaaagaccgtcagtaaaatgtatttccggcggcattccgacgaatgctttctcgcgtctctcaa
-atcaccggtttcgttgacgcttaattaattcgttgaggataggcatatgagtaatcttagatagcattgtatgttcggag
-tcgcagagcaaaacaatcgttccctggcgtaaatgcagataccgacatggatcgttaggcttgttttggtacggccaatc
-ggcgggccgtggggtgctgttccttcccctatccgcggcaaggtttttggcggactgatcccccgattcttctgatgttg
-gtattggcataccccatcgcgtttattgccaccggcgctggcgcgtctgtgtcttttctggctctaaccttccggaacca
-ttacggaaacggtggaagagcattttggtaaaacctggcggcgtggtttaatcacgtcctgtacttcttcgcgatttgcc
-actgctgtggatttaatggcgttactattaccaatacctttatgagttctgggaaaacctagctcggcttttgcaccgct
-gatcgcggctttgtggcgctgtttcctggttgctgctgatggcttttcgtcatctggtttgtaaggatctgatgggttaa
-agtgattgaggctacctggtatggccgtttatcgccagcctgtgctgatttcttttgtcgctgatcccttactggaactc
-tgcagttatcgacgcagttgacctcggttcggctgtcgttaaccgtctaatgaggtatcctgatcactgtctggctgggg
-atttcccatctggtttttcctcctttaacttctcgccaatcgtctcttcgctttcgtgtttcttaggcgtgaagagtatg
-aagaaagaccttcggtcgcgacttcaccgtacgtaaatgtttcccaaatcatttctgcgtgccagcatgcctgatggttg
-caagtggtgatgttctttgggctttagctgctgtttactctgtctcgcggccaacatggcggaaacaaagcgcagaatat
-tccaagtgcctttccttatctgggctaacgagcactttgcgtccatgaccggtacaaaacaacgttcgcgattacactgg
-aatatgccggcttccatcatcggcactccgtgctatttcaaatctttcttcgggtcactatctgggaacgctggaaggtc
-ctgaatggctggtcctgaagtttggttataaaggcgacaaaactaaagtgtcgctgggtaaactgaacactatcagcatg
-atctttcatcatggctccaacctgggttgttgcctacgccaaccgcgacatccttggacctgattgagccatgggcgcac
-cgattaatcgggcatcccctgctgtggccttggttgccgatgtatgcatccgtaaagcgcggtctgctgggaatacccgt
-ggtcgtctggataacgtgtgttgttacggggtgatttggtctgtctgaaccatcctgacatcgtatacaaactgttttaa
-tccgtagctcaggacatgagaaaagagatgacatgaatttccggttgttttggttattaactgtggttcgtcttcgataa
-gttttccgtgctcgatgccagcgactgtgaagtattaatgtcaggtttgccgacggtattacgtcgaaaatgcattcctt
-atccgtaaattggggagagcccagcaaccgctgggctgcaccacagctttacgaaggtgcattgaaggcaattgcatttg
-aactggaaaaacggaaatttaaatggacagtgtggcctctaattgcgccagccgcatcgctcacggccgcgcataactaa
-tcacactttacgagtcccgccattattaccggattgaagtcattgataaatatcgtcgcgttttctccactggcacctgc
-ataattacgccaatttaagtggtattgaatcggcgagcaatttatttcgggcgtaactcaggtggcggtatttgataaca
-gtttttccacctagacgatggctcgcggaagcttatttatacggcctgccgtgggaaatattatgaagagtttaggtgta
-cgcgttatggtttcccacggcaggtcggcaccgatcacatagcttcccagcgcgcacattcgctgctgaatctggcgaag
-gatgactccggccctggtttgtggcgcatcttggcaatggcgcgtcaatcctgcgcggttcgcacggtcagagtgttgat
-acctgcaatgggaatgacgccgctggaaggtctttgatgatgggttaacccggcagtggccgatgtcgactttggtggcg
-atgtcctgggtcgccagccgcaacgccaaccgcagagcctgggtgaacctggtaacgcgtagtgaataggagagtcggga
-tttattaggtatgttccggtctttcttcgggatttacgttgttctgggaaaaagctctggatgcagtcacgaaccgcgcg
-caactggcaattaaacctttgggttcaccgaatttggccgtcatattgccggatcacgcagcttcattacgtcgcctgga
-tggaattatattttcaccggcggaatacggacgagaatttcaagcttaattcgtcgtctggtcatggaacatttggctgt
-ataggcttagagattgatacagaaatgaataatcgcttctaactcctgtggtgaggcgaattgtttccagtgaaaatgcg
-cgtgtcatttgtgcgcgttattccactaacgaaagaaaaaatgattgctttggatcgccattcctttaggcaaagttacg
-cgcggccgcagaaattgcataattttagtttgaagtaattgtagagagtattatttttcatgacggtagatattgaatac
-cagcggataagctgtacgccgacgcatggcttggctttaaaggtagcggactggcaaacgaaattaatgtccgcgatttt
-aattcaacataactatacaccgtatgagtgcgatgaatgctttctgccggaagcgacgcctgttccacacacgggaatgt
-gggaaaagtaatggaaggcaatccgtatcggaaatgcaacccaatgcgccggttgatttcgatacgcaatattggccacc
-acaattacgctcatggaatgcgggatatattaacgcaccgcttggaaaaaattggtttggcctgcaacggatgcgccgtt
-tgaaacgtgcgctacacccgttcggtggcatattaaatatgattaaacaaagttcattccggcctatgccgagaaaatgg
-acagtgaatttgaatatctgtttacgcgtctgcgtaaaaccataaccaggggcgtaatttgattgtttactcaccggata
-tgctggcgctgcccgtaaatctggcgtgctgaccggttttcaccagatggcttatggccgcgtgggcgcaatatcgtgac
-tatcgcgcgcgtacgctgtatggcatcaagttaattctggtacgtgaacgggcggggaaaagaaactttttgccaatttt
-tgggccgtctgcacagtcttccggtcgtggaaaaaaggcgaggtagtctggaagccaccatccgtctgcgtgaggagctg
-gcagaggcatcgtcatgcccgctgttgcagattcaggaatggcggcgaaatatggcctttgatatctctcgccgcggcgc
-aagaatgcgcaggaagcgtgcagtggctctacttcggcttatctgggcggcatgaaatcggcaaaatggcggcgcgatgt
-cgctgggcgcacgcatcggttcctcgatatctacattgagcgcgacttttaaaagctggcgtactcaatgaggcagcagg
-caggaactgaatcgatccttcatccatgaagatcgcgtatggtacgcttccctgcgtacaccggaattttgattcgctgt
-tctcgcggcgacccaatctgggcgacgaagtgatcggcggatggggctggacggtcgtacgctggtgaccaaaaaactcc
-ttccgctatttggcacaccgctgcacactatggggccggcaacggaacttcaccgatgacctatgtcttttggtcggcaa
-gaatttaccgattgccttcaaaaaatatgccgcgcaggtgtgatcgtcacctactttcacttgcagtatgaaaatggacg
-attctgatgcgtactgacttcacagcgacgattacgcgattgcctgctgcgtcagcccaatgggtgcttggtatagcaaa
-tgcagtttctttggtgcagcgcgctaacctggcgaaaacgctgctctacgccaagtttacggcgggggtggacgagaagc
-tgaaaagattgcatggtcgggccgaaaacagcagccgctgctgacgacggtgctggattaacgacaaagtgaatggacag
-cctgcgatcattcatggactggcgtggcggtgcagtaacgcatccagcggcgctgaataatcattcacatacatgcacga
-caagtaacagctacgaagcttcgctgatggcgctgcacggatcgtgatgtctatcgccactatggcatgcgcagtgcgcg
-ggcccttcgtggcgacggactcctgtctgaatcaataatgcccgcgtgaaaaccgcaatccgtgaagaaaacgggcctgg
-cggtggactttgaaatcgacggtgaatatccgcagtacggcaacaacgcacgagcgcgtagcaggcaattgcctgcgacc
-tggttgaacgcttatgaagaaaaaattaaagcgctgccacctatcgcaacgccgtcctaccgcatcgatttctgactatc
-actttaagtggtgtaccgggccagaaaacggtaatgacgccggcggtcgtcgcgaccggagacaggacgttcggggcggg
-cgctaacacgtatgcatggtcgtgacgcgcacaaggtgccgtggctctcattgacgtcggtggcgaactgcgttcactcg
-tacgcctaaagatgggatcctcgtacaagacttctcataatcgtttcctgcgggcgctgggccaaaagaagaatttcagt
-acgtaaaaccaaccttgtcggcctgactggatgggtaaatgtttccagccacgagcggatgttcgaaggcgggtgcaacg
-cactctttgcacgtcaacgtaatggaatcggaaatgctgctggatgcctatcagagacccgaaaaataattcctaacctg
-acaatcgtgtctctggctacgccgtgcctttcaacgcactgacccgtgaaacagcaaacaggatgttattgtcacgtacc
-ttttaccgcaaggcgctctgacgccggaggcatgtatgaaaaagattatcgaaacgcacgtgccccaggcgcaattcggc
-gcttatgttcagggccgttggatttaggcagcaatggttcttccccctccgggcaaataccggtttgccacagaacggtg
-agatcggctgatgtggcaagatcaggcgcgttttaagctcgaaaaacgtcaaagcgcatcgtggttgctgccggctgagc
-gtgggcgatatccatcaaagatgaccgtgtttatcaccgggatctgaatgattttgccaccatcacgaagttctataagt
-cagttcttgatgagcatcaggcgaccctatcgacccggaagctgtgtgcaggtcgcgcgtttggccgaacagaatgtgga
-aagctggtagaattgaagggccatcgccagtacgtttagtgcgtaaagcctggtgagcgtgggacgcgtcgtaaggtcgt
-tccgctccacttcactgaacggcaatccgagggtgtggatatgattagtgccttcgatattttcgcaaaattgggatttg
-gtgccctccagtttttgcatacgtggggccatgaatgccgggaaaaagtttttaggttggatacggctggaaagtaggcg
-gcttattttaacgcgcgaacgagccatattgtgggtcgaaatctcggtagcggggtcgttgtcactgacgggcaaaggcc
-atgccacggatgtcgccatgcatcatgggactggcaggtaacagtccgcagagatgttgtcattgatgagatccctggca
-tttatcgagttagtaagcgcagcgggcggctgccagtggcattgtggcgatcattgttttggatttttcctgtagcaaag
-cccagttatcttccatccgaatgttttgccttctcggggagcctatgagaacggaactgcggatcactgtcctggaaggg
-acggaagagctattcagtaaactattatctgtcggcggcggtttatttgtcgaagaagaaaacttcgcctgtcgcacgga
-tgtcgaaacgtccgtaccttacgattttccactcaggtcaggtgaacctgctgaaatgttgtgattacaacggcctgtct
-atatctggtctgatgatgcacaacagctagcgctgcgcagggcacagcggaattgacgcgcggtttgccggtatcttggc
-aagtgatgcatgacgggtatttgaacgtggagatgaacatctgagtgcgtgctgctggttccgctgcgaagtgtgccgcg
-cgtgccgtagcgctgcgtcgtcagctggtttcagcgatacatctgctagacgatccgatgcatgtctatctgactgatca
-acatgtacgcgctggccgttagtgaagaaaacgcagctggcgggcgcgtgttacacggcacgactaacgtgccgtgcggc
-acttgattcccgggcagtactggcttattacgataagttcgcgtcgtccggtaaacgagcggtcaattgcccgctatttc
-ttgggccgcggggctattgggcgcgctgtataaaatgcacgcctccatctctggcgcggaagttcggctgtcagagggga
-gattggcgtgggcctgttagaatggcggcggcagggttaacttgaactctgggcggcagtccgggccgcaaggtatgcaa
-tgcggcgggaatcgcgatggagcataaccttgggctttgaaccctgcgatctccggttgccggacggtacaaatccggtg
-ccattgaacgtaatgcattcaatgccggtgaaagcagtaaacgccgcgcggtatggcgatgcgccgcacctcggcaccgc
-gtgtttcactcgataaagtgatcgaggatacgatgtatgaaaccggcaaagataatgaacgataaataccggcgaaacat
-cacgcggaggattggcatgtcaagtggtctgcggctggacatgctgtcagcttcatccttgggtgcaacaaatgtgcact
-tttttttgtgatctgcacgcaaataaagaatgaataatttcctgcgattaatttgtagaaaatctctttatccatctcgt
-tatttcaaagtcttgatgtggaagaatttttctctgacctcgcgcgtattcatttctttattctaataacgtcgcccctg
-caaaaacgtagacggcatatcgccctgatgcggctcggaaaaaaataactaagccccctacaaaatattgagcggaagaa
-attatggaaattgcatcgaataaaggcgtcattgcagacgcttcgaccccggcggggtcgtgctggaatgagtgatagcg
-cgagtggctgagaagcgatgcaaatcgacagtactagacacgctgggctgattatgagtatcgggataggcgattggcgc
-gggggattgagtttttctcccggtgccggttcggtttgatgggatgtgggtaaatttattgctctcatgcgtgattggtt
-acccggcaatgtatctgtttcaggcgggattgtttatttaatacggctgcagaatcaccagaatgtaaagattacccgag
-cgtcattagggcggttattaggtaaaaactggggcaatcctgttaggtgcgctgctattatcgctatgctggtgatttgg
-atgtttcgtctattccactcgccatcaccaacgatagtgcacttcctacctgcatccttcgcgtgacggaagggttgctg
-tcagacagtcccttttatggtctggtactgaatttgcattgctggtggggcgatctcctcagcgcgacgagaaattgttt
-agttcaaaattttcgagccggcatggtgcgacctaagctgctggtggtcgcgggcgctggcgtgttcgatggtgggagaa
-gtgtgcatcttgtat
->m141013_011508_sherri_c100709962550000001823135904221533_s1_p0/694/0_18593 RQ=0.838
-ccaccaaaaacaaaaaagaaaaaagggggggaaaaaaagggggggagaaattttttttgggaaaaaaaaaaaaatttaaa
-aacccccaggtactgaatttccaaaaatggaaaatccccccctccgaatttttttttttgggccccgggggttgaagcgg
-aattttttgtcccaactttatatctttatcaatcaaccccgtggccacaaagcgggcggcacccgataaaccgtttatac
-agggcctttttaatcaaacgtcaatgaacccgtgcgggcagattttgtgggcgaatgggcaaggccctgccgcccatttt
-aaaagagggcgaccgcgtgctgtggtatcacattttctggctgttggtttttgcccgaactgccgtcgcccggtttttcc
-tatttctttgtactgcgaaggaaaaaggcgcttacggctggcagcgtgacggcggtccccatgcccgaatactttgcttg
-gcgaagaaaaagatctgatccctcctgccggtgcgcctgagctaacgagatgggtgcgtttatcaagttgccggcgttgg
-tagcagcgtatgaaggaattttgccgcggcgaagtttttccggcagttgataacgtggctggtggtcggtctggggccag
-tcgggcatgatggcgatgatgctggtcgaaagggtcgcggtgcaaaacggatcatggcgttatatgctgcgggaccgtct
-gcgatggcaaaaccattaggggtgaatgggtcacggctattttagcaaccaccgaaggtctgccgcagatttatcgcgaa
-actcacccacgtggcggcggatgttgcgctcgattgttcgggtaatgcgcaaggtcgcttgctggcactggaatcccacc
-gctgacgtgggacgggtgggtttacattggtgaaaccgaaaagttggaattgagtcaggcgccgtatctgatgcactgca
-tccacggcgattatcggctcctggggtgacgcagtctgttcaaggaaaaaatgcgccatgatctgacggactggaagctg
-tggccggtacgccattacccatccgcttctcgctgaacaggcaggtgatgcctatgcgcctgatggcggagcggcaaaaa
-tgcgggaaagttgtgattaacttccggattaagggaagttagcggatggacggcatctgatacctatccgcacgggtcgc
-taaagctggacgtttctgaccaggggcggcgtaaatcgaaggcttctggcgcttatacgacgcgctcttacgtcctggta
-aaaaagcgggtgtggcaaccgatgcctcatgttttccggctggtgcctatttgcaaaaccggggtgagcggcaatgtttt
-tgtccttggcaggggccgtgagtatcaactgcaacgaaaaatgttgagtgggatcgcactatcttacacggcgattggct
-ggctgggcgatggcaatgtgtctcgcacagcgatgatagtttgtgtctggtgtactgaacatcgcagcggtgtcctatca
-ctatcggtacgtcaggcgtttcatttaacggcgggatacgcctgacggtgacgctctctgtcacaatcaggggcagagac
-gctgccatttttgtacggctggcatccttatttttccgttgtcgccggcaaacgcgggatcagggcacaggcgagcggtt
-actggctgagcgggaggcagtgctggcgggtgagttttgcgagcagctaccgcaggaactggattttaaccagcccgcgc
-cgtttgccgcgccatgggtgaaacaatggttttgccggatgaatggtagccgcattcgagcagccgcaggaaaggttaat
-gccatccatcatgaaacgaggccactgcacgtggtgtatttcatttttttgttttcgcgacccttgcgttaggggggggg
-tgataaaggatatgcgttttgattttcttctgttggaaccggatgagccatgcggccggaaattgatcatcatcgcccgg
-aaggggggtgatctcattggcgctagcaccaggggaatcaacaacttcagagatgtcgttggcgtagagtgctgtaattt
-attaaatgcccggataaggcgttcacgcgcatccggcattttcctcacgccgatcggagagaaattgcgccgcgcccggt
-aattgccaatagcaagaacgcgcgtcagcgataactgacattcttcagaaatttatcattatttggccgcaaccgcatcg
-gccggtcatatccagttgaatggtgacaatcaccgccgtacccagcgtggtagaaaataaaacagcaccggcagcggacg
-gtgaacaagcaagcacgattaatatcgcggcgggcacttccataataccgcaatatcggtctgcagcatcgcattggcgc
-gccgcaagcgaggccataaatattggacgtacgcgtcaaaggccctatcattttggggaaaacaaaaataatgaaaattt
-taagaccacgggcgatacgtggcaattaataacaaaacgggcgggcagcttcaaaatcaaaatacgtagtgtgttcataa
-ccatcctttgctaagataatggtgatttaaacgtaatacacactcttgcagcctcgccacgccgccaggcattggagata
-ttcgctaattatgcctggttacacgtgatttaagcggcgatgttctcatcgtatcagcagttttcgcatcaaaaacgttt
-tgggccgtctggatcatcttgcgaaattgggcgaatctcacgcccctggattcagcgtgacgcacgataagcacgccgtt
-ttgggcagattaaacccaattcgccttctgagtttttccgggttgccacgaccaaagacagtcatcgcccacgcatatcg
-ccaataaaaactgtaagtttatcaaaaaaaacgtgggtactgatcgcttccagaaaccacggcggcggcagtagcggtag
-cggtagccctaacattgcggctagcggcaattttgcgcctggttattggcgttttcccagctttcgcagcggtgtagtgc
-acattatccaagacgagtgattgccacatcgcccaccggcaaagatgcgcggggatgcaggtgcggcaagcctctcaatg
-acaatgccattggcagtattcaaggttggcctcgcgagcccagttgtcgtttgcgctgaatacaatacgtaaatccgcac
-atcagccctaagagtttccccactttgcagcgtcagttctatcttttcaccatcgaacgcacatgtttcaatggcctatt
-gagcagaaatgcgcacacagcctgctggtgcgtgtaaaagatagcgttgcacgggcggtggtggattacggccatgacgg
-ttgccgccagttcaatcactgtcaccttacatctgcgctgcgtgcggctggcagcctagttccagaccaatagtttgcgg
-ccgataatcacgactggaccgttttcgggctgcagaacttctcgcagtctggcggcatcacccggcatggcgtagggtaa
-agcagcgttcctccagttgcatcaagcaacgcagcggtccgagctgccgcgccggtttggctatacgaagcctgatccag
-tgccagctttcgccgttgtttaaaactaacttcgtgtggtcgcgaacccagcgttttgatggctttacaacggaatgcag
-atgaacattgttttttcctgcaccagttagcggtacaccctgctgtaaactggcgggggaatctttccagcaacatgatt
-tccgagagtggaggtcgttttcataaggaagatgtcgcctcatcggaaaaccgatgccagctcaccggttgaacccttgc
-tggcgtagcgagggccgcagcattgctggccgctttgcccgccaccgacaataatgatcgtttttttttctttcatcggt
-gcttccttaaagatcagccagccgctacgtgggaatgcccgcgaatcgctaaacccgcatcaaaaagcgtttgatcatca
-cacccgcttaatgcgcgattattgcgccgcgattgtcaacatcacatacggcccacgtaatccgccgggttgcgggaaaa
-attgggcagcggtaaaatggcggcaattttctccggcgtcagagactgcattatcgaggtttcagctttggccgagcgcc
-tgtgggccgcgcaggtcgctggccatacacaacgggccgaacgcattcacgcgcactttttcggtgcgagttcataagcc
-agttgcgaatacggtccggttgcggcatggtttttactgcggtgtacagcgggcccccgccgctcaggataccagcggca
-tttgacagtgggaaaaatcatgctgccttcactgcgattacgccgggcagcgcaggcttttgcgcccagcaggtaacgag
-aacatttgacgttaaacgcttcgtggaagccggttttgagcgtctctggcgggagtataacacagtgaggctattgtgat
-cgatgcctgcattgccgataaaacaatcagcttgccggaacgagtcagtttatctgatcgaccgcgcgttgataatcggc
-ataacaggtccttccttccaccgccagaatatgttcgccaaatcgtgacgcagactggcgacttttgccgccgacagttc
-cagcgtggcaaccttgcgcgccttcttcgataaatcgctcgaccagcgcagccctaatcccgatcccgccgtaataaaat
-ggaagactcgttctgcagatcgctcatcggcttgcgcctgccggtaagtcgattgaaaatgtcaccaccttcaacggttg
-tacttgatcagtggtgagcggattcggtggcgggcaggcataacgctttccccgttttcaggccaaaactggcggcgtgt
-agcggggcactccaccgtggcgtcaatcttccagatacccttgcttgacattggacgcatttaccatggctgcaacgatc
-cgttaattggcataaactcgccggccaacgtttgaacagggcgatgacggggaggtatcgatcgcggagagcctcacctc
-cggcacatccgctaacgggacacgccataaattcgatcagaatcagaacagtacacttcaggttatgggaaagtgattta
-ccgcttgatcggacgatatcccgttccagcaagcggccagtttgtcatctccagacggcgaactttgtttcgaaacgccg
-ttccaacatagaatgtttcatcgcgctcttttttgtgcccgataaagggcagatatttacccgcaagcaaaatacgtttg
-gggatgtcggttttcgcttaatctggcagttgctgattaagtgacgggtgcgtgacgggcggcttcttctgccaggccat
-gcccgttttccagacggggcgattcgccgctccagctggtgctttttggtgtcattaaaatctcaggttgttcggtggct
-ggaagcgcctttgcggcggtcgcgtgtttgcgcgtttaactgtggttgcgcatggtgtaacgaatctcttgtcgagctgc
-gccagccagtcacgaattttccagtgtccagtaagctggcttcgtgaaagagaaatggctaatgcggtgatgtaactcta
-gtgaaacttgcgcactcatttcatcacctccttgctggtaagcgcggtttttatgagcacttcctgccagcttttcggct
-actcgaaggaatcggccagcgttggtacaattccacgagcggcagtttctgaaaagattatagttagtaatgccatgggg
-ggggcaggggggggggggggaggggggggggaaaatgccgtccgtgcgggcgctttttctgaccaaggcccatttccaga
-cacagtttgcttttgcgggcgcgggtggcctttacgcaattctctggatttacacgcagttctccgaagtcatcctgctc
-gagaaaaccagcagacgcaaaagcaacgagtgggcgctgttttcaaaagcggctttaacttcatcggaggcggcttttgt
-cagtaataacagaacgcccacacttcaacttatcagggccgcgcgatgccagacgcggagtgtggcagtgcgtttagcgc
-atgaaagcgtggggaaaatatgttatgacccgccaggcggcaagggcgcgaactcacactaaacggttgtttctgcttcg
-cataggttttcgcggtaataagcttgaaactgcgcgcatcgacgccagacattagcaatccgggttttttcagtaagaag
-aaaccgctagcccgtgaccgtcctgaccaaattgcagccgcaatctttttggcggtttcccacaccggggcgggcggttt
-gggttcatcaccgaggcgctttatcgcttgccatccatctttcgccgctaatacctgacggcaagaaagcatggctgaac
-agagcatgataactggtcactggcgaagctgctctgccgggaatttcagttacagttgatcacccacgttttgtagcgcc
-gccgacaatttcgggtggccgcttcgcgacggagtccagcatgccatgccagaaataccaggcaatgtcacccaggtaat
-cacgccaggcccggtgcgctggtatcccagttggcccaaaaatagccgtttatcactctcacacaaggaattcggtttag
-tcccagtgggattttacacaacacgcttgtgggtaggcgcgaggtttccagcggtacatcgatcaactcgccgttaatgc
-ataacgagacagccgtgatacggggcaggtaaggggaggtgtttgcgcatcgcatctcacacgcatggcccgtggcggca
-ttggttgagaaacgcttgatgctgcgtctttctgagcgcaactaacgacaaccgattcttctccatgtaggtttaaagaa
-atcaccgggttttgggatctggctttcgtgggcgagaaatagccagcacgaccgaaaatacgctcaagctccagttggta
-aatatccggggtcggtataaatacgcgggagttgaccgaccatttttcggggttgtcaatcagttggtaaatgttaatct
-gagggtgtggtcaatcattttttaatcctgaaagatacgattgtattgaccttctattttttgtgccataaggaatgttg
-ctgttggttgctaatatgtgaaatagtttaatttctaccagctgaaagacgtttttcgataacaaggggaaggtgatgga
-actacgggcattctacgctatttcgtcgcagtggcgcaggcacttggaactttaccgcgtgcggcggaaaaactgcatac
-ctcacagccttcgttaagcaagccagatccgcgatctttgaagaactgtgtcggtgtttccgttactgggtgagggataa
-gcgcaaagtcgcgtgaacggcggcggggagaatgttttctcaggaacgccgctggcaatcctgcgaacagcggaaaatgc
-caaattaacggggcgcggaaaattgttcggaagacagacaattaaccattgggctttggtgccatcggcgaagtgcaatt
-tacggccaaaagtattaccgatgtttcggttcagacagcctcagacacttgattgagctggtgagtttaatcaccacgca
-acaggaggaaaaaattcggccgtggtgaactcgacgtcgcttaatgcccatcctgtttatagcccggagatgattatctg
-gagctttttggacgaaccattagtggttgtgttttaccggttgatcaccctttagcacatgaaacagaagataccgccgc
-gcaactgggattggcgtgaatttcgtcagtaccgatccggtgtattccggttcgcttgcgccgtcgttacaaggcgtggt
-ttgcgcaagaaacagccagccaaatatcggtccaggtggcaacgaataatttctggtggacggcatgaatctggtgggca
-taggtgctggcgtcacttttgataccgttatatgaataattttaatagcggacaggtttgtttttcgtcgcattggcgga
-aatgttgccttcattgcctttactgatggcgctggaagaaaggggagatgaagcggcattacgcgatttcatcgccattg
-tggcaggaaacgtttgaagcgtaacgcataattacgcattatttttgccaacatgcgtcgcgatctcagtttttttagtg
-cttgtggaaactggcgttacagaccatcggggaagcggcctcgaatttctatttttttcaacttgcaccaacatcgatta
-acccagactaaacgctctgacgggagggactcatggtttttgcaattccacgcgctggtttggcggctcgcattttacat
-accttttttagttacgcgcattttttctgtctaccgctttctggaggcgtctggcttaaagggattggttttaacgccag
-aaccatcggctgttattgggggcaggttctggttgcccgtatccctcgggagtttgctctcgcgccccgcgtcagcgatc
-ttccgctgatttccgcttggcgtgctgggcactgctgaacttctctttgctgtcggcttctgcgggggcggcacgtagcg
-tggctgatgctgggtgatgaattggctttaacgctctttttttctcaccactggtacgttgaccgatgcctggcgaatac
-gtggcaaaagcagttcccgctgattaacgggcaagtgcgaacctggtggggctcggtggcgtttgtcattggctcggcgc
-tggaggcaaactgtcactatgtttgaattatcgggtgatcctcgcgctgttgaacgttgggcgtggcatccatctgctcg
-gctttctcatggtcccgacgattcagccacaagggcgccaagtcgccagcaggagagcgcaccggttggtctgcgtggtt
-ggcgctggttggcccagaaatgcgctttcctggcctgcgtttgtttattgcagggggcacatgcggcctattacggtttt
-agcgccatttactggcagggcagctggctctcggccctcggcggtgggggtatttgtggtccgctgggcccgtgtggcgg
-aagtcattaatcttgccgctgagtaataaacttttcccgccgttgtagtgcacgcgatattgctgtttgaatctcggcga
-tttggcggcgtagtgcgctggggcattatggggagcaactacgggctacggcgttggccgtgggttgatagtggtgcaaa
-ttctgcattgcggcaaccttcacaggtctgccaccttggccgccatggcgttatatttgcgctgccagggtaggcgaagt
-atccgtttagcaggcgtttactctgcgtcggcgatggcggcagtatcgcttatcactgacgcgtttcttcgccggtttcc
-ctgtatcaatatcttgggccacgggtgttctgggtaatggcggcttggtgggcgcttccggcactgtttttgcgcccgaa
-agttgtttccctcaatgctgattcgagccatttgcggatgctgctcctgttatgtgttgtcagcgtcaggtccgtataga
-tcagcggtggtgaaaagagcggtaatggcatggtataaggcgcataatcagttgccgcgccaacgcggagcgccgtctgc
-aaaaatgctttccagacataatctttaatgttgagcggcagtaacgttttagtttcgcgtactgctgcttcaatctgcgc
-ttcctcgctcgcttatcattcccggtaagaagaataactgttttttcatggcagatcgttttttccttgcaattagccag
-gcacctgaaatcacggcgaacgctaagaccactttcctcatcaagaaagatggacgcgtattcactttttcaaatccggc
-cagcgccgcgcggggtgtggcgcacacaggcgtggggtacagtctggcgaactcttccgcgcagggtattatcaaatacg
-aggcaaaacaaactgcgctttaacgctgggcgaggtgggtataaagctgaatcccataacccgctgttcatcattaaaac
-cgaacatttctagctcacgaaatggtttttaccagacgtttgatagactgacgcaaattgtctggtcccgctgatgcgca
-tcccgcaatggatcgggaaccgcgcaacatggaaaaaagtagttggccagtacaacagtggctcatccaaggctggtaca
-gctggagcgccgacgctgcagtggcgtccaatcttctgcgctaccatggaaatcaaggcccggattcgaccagcgacgtt
-tggagcggatttacactgagggtaattccagcgtggtgctggcagcaaacaatattgcagatacagacacaggaaatgaa
-tatcggcgcgattcaaagcgttttttgccagccgttggcggaggagagattcactaacgctttgtagattggtatcgtcg
-tacaagttaggcgcattcccgcgccggcttcagttcactcttacagggcgggggtgaattgctggtaaataaatgacgga
-cacaagacggaaaccacgtcgtagcagtgaaataaacacaacaacgttggtttaagcagctgtaccttcaaccggtagct
-acgtcataaccagtcgtcagtgtgagttgatgtttatagcgcagattctctccgcgtcctgtttcgctgatatcaagact
-ggaatatgcatcatccacaccaattaagctcgctgaaggttgccatggtggcggtcaaccccggctgaaagaggcgtcag
-caagatctgggcagcgggcgcttggggagccgaaaggacagatgtggagcaagcgtaggcatcatctgtagatcttccat
-aagcaaattgataagaatagctaaaggttttgctttcaaggaactggcgaagggaatgctaatcatacagaaaatgttgg
-caagcgtcaagaaaacagaatttttttctcaatcttaaactgtttctgacgcagtggattagcatgtttataggtgggtt
-tgtgaatgattatcgtgctagcgatcaatgggttagtttctgcggattcaacgcgctaaggataaagtccaaccatctgt
-ttcgcgattaacatcgcccgtgacgatcggaaaaagggcatcaatgtgggttcgccatccgggattaggatcaccgtttg
-gctccttttgcataggctatacaacttttgcgctgtgctgccatggataacgtgatagctttacgtgaatgagtaaaagc
-gggatccggctgacgctggcgatataaattttcgcgctgtaactctccatcagtaagtagccactgccggggatcatttg
-gttgcgattggttgcataagagcaaagtggagtcgaggatcaccgcacgtatgcttcacgatcaccgcgcgaccaataaa
-tccagaatattccgccccgccatactctgcccgaaaagcaccagacgttgtgggtttacatcactgcgatggcgcaacca
-cattgatggcacattgccgtatcgtcagcaatccggctgggaacgggcgttgctttttttgatttagccaaaccgcgcga
-taatcaaccataaaaaacgttgcaaattacgctcggtaaccactgaccagcggccgtgggcggacattatttccggcatg
-gccgtgagctgaatgatgcgttgcgatggcgttgtcagcagggcccgtcgaagaaagggataaccagccttgcagacgag
-taccgtcctagcccggtaaattcgaccggatcccgccagaccagggatcttgggaccggtaaatttttatcgtcggataa
-tagaagaagtttgatggcaacgcgcgggcactaaataaacgcaggaaggcacaacaacaaaggagaataaacagaatttt
-ggcgaacggcgttttgttcacgtttggcagtggcataactttccttggcgactttcttttatcatcattaatcgggaaag
-attggtgggagagtgacgaaagaaagtaaaagcagtgaggaagtatttcggaatagcgccctgaaaggcgaggcgcgggt
-gagtgattatcacccgcctgagtcattaacgcttcagagcgtcgctaactcgtcacgcatgttcccatgcatgggcttta
-acacgcgcggttaccagcaacgatgttacggtcagcattgttagtttatgagcaccggtgaagtcgctgagatgcgcccg
-cttcacgaacgcaagcagctcgctgcggcgaagtcccacgggagcgaccgatttcaaagaaaccgtcaccgacccgcagc
-ggacgtaagccaatcagcgccgcagaacggtacgacggaaaggtctgcacttcggtttgaacagttttgcctgacgatgt
-tgatgtgggtagtggcgtactgttttgctttgacgggaagctcggtcgccagaatagtaccgtcgagattcgcgagcggt
-ggcttgcctgcgccagtcgtcagccgttcagagctgtggccctgacgcgagtggcggtgaaagtttcggttacgcatagg
-atcgtcatacacacagcaacttcggtgcggcctttgatacgaacagcgattagatcggaagtgcgggcagacgttttgga
-ataaacgttggtaagtgccatcgccagttggattgcgataacccattgaacatcctgatcagtacttcaagttccgcgct
-ttcttcggtgaattgatggtgtgctgtgggtaaagatttacgaatcgtgtcggataatcaccgctttgcagtttatctac
-gtttggtccacgaaatcgttactctgcctttctggctcgctcttacagcgtccgggtttcatagttttttgcattaaatt
-acccgccttgcgcgctgcgcgcacagcgatgttcagcaatcggatgcatcgggtctctctgcactgatgttaaaagaacg
-gaaaaaggagcagagtatagcagcggagatttcggcatcttgtctttcgtttttatgataagatgcgtgaataattcttt
-agatgaagaaagacaatgctgcaacaatattcgaattgtgctggtggagacgtcacacagccggcaatatgggttctgtt
-gcccgtggccaagaaacaatgggatttaaccaatcctgtggctggttatccactggggaaacgccgacttcccaggcgat
-tgcctggcagcagggccagcgatgttgattggctaatgctcacacatgcgtcgatacgctcgacgaaagcgttagccggt
-tgtagctggtggtgggcaccaggcacgtttcccgccacgcccctggagggccatggccgatgctcgaccgtcgcgggccg
-aatgcggctggaaaagcgtcgctgaagcgcaaatacagccgggtggcgcttggtggtttggtcgcgagcggcgtcggctt
-gaccaaatgagagttgcagaaatgccattatcatgtcgcgatgcggctaaccaggaataacaggctcgctgaacctggcg
-atggcggtttcagggttattgcctatgaagtggcatgggctggctggcaactcaggaaaacggcgagcaggtcgagcatg
-aagagacgccgtatccgctgcgtcgattgatcttggagcgtttttttatgggtcatctggaacaaacgctgctggcaacc
-ggtttttatcgtttgaaaccatccgggcaggtgatgaataatttgcgccgtctgttttacccgtgcgcgcccggaaagca
-ggagttctgaaatttatcctgcggcgggattctggcttttctatttgaggcagcagaataaaggtaaaacaaggccgaat
-aacagccgttgcctttgatgcgacgcgtttaatgcgtcttatcaggcctacagtgaacagaaccgtagttcggataaggc
-gttcaacgcgcaccgacagccgttggcctgaatgcgacgcgtaatgcgtctttatcaggcctacagtgaaggccagaacc
-gtaggtcgataaggcgttcacgccgcatccgacagccgttgccctgattgcgacgcgtaatgcgtcttatcaggctacag
-tggtaacgagaaccccagggcggaaatatgggcgttcacgccgcatccgacaacaggtacaaacgcacgataaaaaaatg
-gcactgaaggttaatacccgactaaacatcagtcaagtaaatagttgagaccattactcgggaatgttcagacttggccc
-tgctatgcaataccccacttttacaataaaaacccgggcagggggcggagtttgaggtgaagttaagacatgagactgac
-atctacagggcgctaattgcgtgaccgcaattgctttgacgttgcgctcaactctgaagcgggcccggtaccgttgcctt
-gatatttcgaacgtcagggaatttcttcttatctggaaaactgttttccgtctgcgtaaaaatggtctggtttccagcgt
-acgttggaccaggcggtggttatctgttaggcaaagattgccagcagcatcgcgttggcgaagtattagcggcgttgacg
-aatctgtagatgcgcacccgttgtcagggtaaaggcggctggccagggcggcgattaaatgctgaccgccgcgctgtggc
-ggcgtgaatttgagcgacagtctcaccggtttttctcaacaccattattttaggcgaactggttaataaccaggaagtgc
-tggatggtgttggtcgtcagcatactcacgacgcgccacgccacgccgcacaacaagaccgcgatcgacgtttttaagtt
-acgcgcttaataaaaagaattcagaatcaggccggagtgctaatactccgtaaacacggtcgtacatcccgccggtagcc
-tgaattcctggcattgaggatgtacggagttttatagagcaatgaaattaccgattatctccgacttactccgcaacccg
-ccggtggagcccgcgtgttgcccgagaaaatgatggcagtttatgacgaatgaggaacctttggtaacggctcccgttct
-tcaccgtttcggctgttcaggctgaagaagcggtagattatcgcccgtaatcagatttgcgatctggttcggcgctgtcc
-gcgtgaatcgtctttacgtctggttgcaaccgaatctgacaacgtgctggcgatcaaaggtggagccaacttttatcaga
-aaaaaggcaagcacatcataccagcaaaaccgaacacaaagcggtagctgggatacctgccgtcagatggagcgcgaagg
-ttttgaagtcacgctaactggcaccgcagcgtaacggcattatcgacctgaagaacttgaagcagcgatgcgtgacgaca
-ccatcctcgtgtcatcatgcacgtaaataacgaaatcggccgtttgtgcaggataatcggcgcttatcggcgagaatgtg
-ccgtgtcgtggcatatctatcacgttgatgcaacccagagcgtgggtaaactggctatcgacctggagccagtttgaaag
-ttgaacctgattctttctccgtcacaaaatcttatgggccgaaaggtatcggtgcgcgctggtatgttacggttccgtaa
-acgcgcgtacgcatcggaagcgcaaaatgcacggcgggcggtcacgtagcgcggtatgcgttccgggcactctggcctgt
-tcacacagattcgtgcggaatgggcgaagcctatcgcatcgcaaaagaagagatggcgaccgagatggaacgttctgcgc
-ggcctgcgtaacccgtctgttggaacggccatcaaagattatgcgatagaagttttactgaacgtgaccttggaacacgg
-gggggtttgggggggccccccccgcccccctcgggaaaaaaaacattttttccaacgtcagcttcaactacgtgaaggtg
-gagtcgctgattatggcgctgaaaacctcgcagtttcttcaggttccgcctgtaaacgtgcagcaagctcgaacgtccta
-cgtgctgcgcgcgctggggctgaacggacgagctggcacatagctctatccgttttctcttaggtttcggtttttactac
-ttgaaagaagagactcgactacacatcggagttagttcgtaatccatcgtcgtctggcggtgacctttctccgctgtgga
-aatgtagcaagcaagggcgtggatctgaaacagcatcgaatgggctcatcttaatgtatcggaaatcaggagaatttata
-atggctttacagcggaaaaagtttatcgaccatttacgagcaatccgcgtacgtgggttctttgacaacaagacgagaag
-tcggcagcggccatggtgggggcacggcctgtggcgacgtgatgaagtttgcagattaaagtcaaacgatggaaggtatc
-attggagacgcgcgtttttaaaactttacggctgcggttccgctatcgcttccagtccctggtcacgggatgggtgaaag
-ggaaagtcttctcggacgaagcgcaggcgctcaaaaacaccgatattgctgaagaacttgaactgccggcggtgacaaat
-tcacttggttctcttttctggcatgaagacgcgatcaaagcgcattgcgggactattaaaaaagcaaacgtgaagcaaat
-aagagttgaaggttttggttatgtcgattacactgaagcgacaagtgcagcagggcgagaaataccctttctggctaacg
-cgcggtaaaggtttggcctgcgtctgggcgtgagaacctccggtgttcaggtatggcttaatgttactggaatttgttga
-cgaaccgaccccagactcgtgtttgaagacaaaggcgtgaaagtcggtggtcgatgaagagctgcaatttctggacggta
-cgcagctggacttcggttaaaagaaggctgcacgagggtttaaattcaccaaccgaacgtcaaagatgagtgtggttgcg
-gcgaaaagcttccacgttttgatgcgcatacgataaccccacgtggtcgccttgcgcgtgtgggggtgtgggggttgtgg
-gggtgggttttgtggggtttgtttacctgattcgccgttatgcggcggatcgcagcctgagaatgttatggattactttc
-acccctttttggcttgctgccccgctatcaactcgataccaggcgctgagctgcgttttttcaggtgtacaacgtagtat
-catctgataaattttttttcccgggcaagcggaagccaggcggaacaactcgccgccgacagcaattgccaacatttacc
-caggcctggcaaagctgcgttcatccggttaatgccgcgcggaatatttgcttttcttgcacggctttgatcctcgcagc
-gagcagcattatctgttttgcgcgacaccgcgtttcctgatgaaacagttgagctgcgcgaaagactggacggagatcga
-acaggcgaaagatgaagcgcggtctggaaagctttatcacgtgtgaaaagatgtttttgatacccgccatcagtttgatg
-gttgaacagttagacaacgagacgtgggacgcggcgggcgggataccggtgcgtaagctgcgttttccttcgataaactg
-cgaagcagtgccgaacaacctcgaagaaaaactgctcgatttttaattttctggaagcttaacatggcttattacaaact
-taagtgaacctggtttgagtgctgcgccgattcagcgtcgtctggcggccggtattgacctgggcacacccaactcgctg
-ggtgggacagtggcgcagcggtcaggccgaaacgttagccgatcatgaggccggtcacctgctgccatctgtttgttcac
-tatcaacagcaagggcattcggtgggttatgacgcgcgtactaatgcagcgctcgaataccgccaaaacaattagttctg
-ttaacgcctgatgggaacgctcgctggctgatatccagcaacgctataccgcatcttggccttatcaattccaggccagc
-gaaacggctgcgatggattgcaacggcgcgggctgctgaacccggtggcgcgtttctggcggaacatctcaaagcactgg
-cgcgcgggcactgaagcctggcaggcgagctggatggtgtagttatcaccgttccggcgtactttgacgatgccagcgtc
-agggcaccaaagtacgcgggcgcgtgctggcgggccttcacgtcctgcgcttacttaacgaatcgaccgctgcggctatc
-gcctacgggctggattccggttcaggaatggcgtgatctcccgtttatgacctcggtgggcgggacgtttgctatttcca
-ttctgcgctttaagtgcggcgtgtttgaagtgctggcaaccggcgtgattccggcgctcggcggcgatgatttcgacatg
-ctggccggattacattcgcgagcaggcgggcattcctgatcgtgcgactaataccgcggttcagcgtgaactgctggatt
-gcgccattgcagccaaaatcgcgctgagccaagatgcggactccgtgaccgttaactgttgcgggctggcagggcggaaa
-tcagccgtgaaacaattcaatgaactgatcgcggccaatgtaaaacgcaccttactggcttgtcgcgcggcgctgcaaga
-cgccggtgttagaagctgatgagtgctggaagt
->m141013_011508_sherri_c100709962550000001823135904221533_s1_p0/694/18635_24422 RQ=0.838
-actccagccttcatcagctttctacacccgcgtctttcagcgcggcgaccgacaagccagtaaggtttcgttttaccacg
-tggcgcggatcagttcattgaattgttcactgctgattttcgctgccagccgcaacgtttaacggtccgagtcgtgcgct
-tcagcggcgatttttggctgcatatggcggcatccagcaagttcacgctgaacgcggttatcggctacgtcaggaatgcc
-cggcccgctcgcgaatgtaatccgccagcagatggtcgaaatcatcgccgccgagcggcgaatcaacgccggttgccagc
-attcaaacacgcgccgcgacttaagcgcagaatgggaaatatcaacgtcccgccaccgaggtcataaagcggcgatcacg
-cccttcctgaccggaatccagcccgtaggcgatagccagcggtcggttcgttaagtaagcgcaggacgtgaaggcccgca
-gacgcgccgcgtctttggtgccctgacgcgggggcatcgtcaaagtacgccggaacggtgataacacacgcatcagctcg
-cctgcagggcttccagttgcccgcgcggccagtgcttttgaggatgttccgcagaacacgcgcaccgggttcagcagccc
-cgccgccgtttcaatcatgcaggccgcttttgctggcctggaattgataaggcagatgcggatagcgttgctgatatcaa
-gccagcgagcggttccccatcaggcgtttaaccgacttaattgtgttgggcgtatcgagcgctgcattgtacgcgcgtca
-taaccaccgaatgcccttgctgttgatagtgaacaacagattggcaagcaagtgacggccttcatgatcggctaacgctt
-ttcggccttgacgctgcgccctggtcgcacgcagcgagtttggtttgtttggcccaggtcaattacgccgcagacggcgc
-tgatgcgcgcagcactcaaacgcaggttcactaatttgtaattaaggcatgtttagcttccagaaattaaaatgcgagca
-gtttttttctttttcgaagttgttcggccactgcttcgcagtttttatcgagaaaacgcagcttacgcacggtatcccgc
-cgccgcgtcccacgtctcgtttgtgctaactgtttcaaccatcaactgatggcgggtatcaaacatctttttcacacgtt
-tgataaaggtttcagccgcgctcatctttcgcctgttcggattcgtccagctcttcggcgcagctccaactgttccatca
-ggaacgcgtgtcgcgcacaggtagctgctcgctggcgagattcaaagccgtgcaaaggaaaggcaatattccgcgcgcat
-tgaacggatgacgcaggcgtttgccaggcctggttaatggttgcagattgctgtacggcggcgagtttgttccgctggct
-tccgctggcgaattttatcaggatgaactggacgttgtagatcctgaaacacatgcaggctcagcgccttgggtatcgag
-ttgatagcggcagggcaagcaaagagggtgcaagttaatccataaccattctcagggctgcgatccgccgcgataaccgg
-cgaatcaggtaaacaaaccccacgcgcaggccgacgcacggtgggggttatcgtatgcgcatcaaacgtggaagctttcg
-ccgcaacccactctctttgacgttcgggttggtgaatttaaaccttcgttcaggccttcttttagcgaagtccagcttgg
-cgtaccgtccagaaattgcaaggctctttgccatcgaccacgaagctttcacgcctttgtcttcacacgatgttcttccg
-gccgtcgggttcgtcaacaaattcagttacaataagcccatacctgaacacccggaggttctcacgcccagacgcaggca
-acctttacggcggttagccagttaaggtatttatcggctgctgcactggttcgccagtgtaatcgacataaccaaaacct
-caatcttattttgctcaccgttttgcttttatagtcgcaatgcggctttgatcgcgtctttcttgcagaatagaacagtg
-atttttcaccggcggcagttcaagttctttcagcaatatcgttgtttttgatcgcctgcgcttcgtcgagaagacttcct
-ttcaccattcggtgaccaggggagcttgaagcgatagcggaaccggcaagcctaagttttaaaaaaacgcgcgtcttatg
-ataccttcatcgttgactttaatctgcactttcatcacgtgcactaggccgggtgcccaccatgccgctgcgacgttctc
-gtcgtgttgtaaaggaacgcacgttccgcgggattctcgtatggtcgattaactttttcgctgtaagccattataaaatt
-ctctaattcgatacgataatgatgagcccattcgatgctgttcagatccagcgccctgcttgtcatttccccacagcgga
-gaaaggtacgcagacgacgatggatttacgaactaacttcgatggtgtagttccgatctctttcttcagtcagtaaacga
-cctaaagagaaacggatagagctatgtggccagctcgtcgttcagcccagcggcgcgcagcacgtaggacggttcgattg
-cttgctgacgttcaggcggaacctgataaactgcgaggggtcttttcagcgccataatcagcgactcaccttcaacgtag
-ttgatagctgacgttgagaatgtttcgcgcacgtgttcaaggtcacagttcaggtaaacttctcgattatctttgatggc
-gttccacagacggttacgcaggccgcgcagccgttccatctcggtcgcatctccttcttttgcgatgcgataggccctcg
-ccattccgacgatctggtgaacaggcagagtgccggaacgggcataccgcgcttcgtgacgcggccgcgtgccttgcgct
-tcgatgcgtacgcgcggtttatcgacgtactaacagcgcaccgatactttgggcatagatttttgtgaccggagaaagac
-cttcaggtaactttcacttggctcaggtcgataggcgtttaccgcagcgctctgggttgcatcaacgtgatagataatgc
-acgagcacggcacatttcgccgatagccgcggatatccctgcaccacgcgattcgttatttcgtgcactgaaggacaacg
-aggatggtgtcgtcacgcatcgctggcttcaagttctttcaggtcgataatgccgtacgctggcgtgccaggtaggtgac
-ttcaaaccttcgcgctcgcagcctgaggcaggtatcagtacgcttttgtgttcggtttttgctgtgatgatgtgacttgc
-ttttttctgactaaagttggcatgcactttgatcgccaggttgtcagatttcggttgcacagagggtaaagagattttca
-cgcgatgcagcgccgacaaacagatcggccaatctgtacaggcgattctaccgcttcttcagcctgcagccgaaacggtg
-agaacgggagccggttaccaaaggttcgtcccatcgtcctaaactgcatcattttctcggcaacacgcggtcaaccggcg
-tgttgcgagtagtcgagataaatcggttaattcattggctctataaactccgtacattttcactcaatgcaaggaattca
-ggctaccggctgggatgttacgaccgtgtttacggagtattttagcactccggctgatttctgaatttctttttattaag
-cggcgtaactttaacgtcggcgtcgcgtcttgtgtggcgggtgcgtggcgcgtcgtgagtatgctgacgaaccagacaca
-tccagcagtttttttcttctgttattaaccaagtttttcgcctaaagtaatgttgttgagaaaaccggtggagacggtcg
-ctcaaatcacgcacagcgcgtgggtcaggcattttatcgcgccctgggcagccgccctttaccctgacaacgtggcaatc
-tacagattcgtcaacggcgctaattacttcgccaagcgatgctgctggcatctttggcctaacagataaccaccgcctgg
-tcacgtacgctggaaacagaccattttttacgcagcgggaaaacagttgttccgataagaaagggaaattcctgacgttc
-ggaaatatcacgccaacggtccggccgcttcagagttgcgcggcacgttcaagcaattgcggtcacggcatagcggccct
-ttagatgtcagtcctcatgtctttacttcacctcaaactccgccctgaccccgggttttttattgtaaaagtgggggtat
-ttggcaaatagcagggtttcaagtctgacattcgagtaacttgtcaactctttacttggactgattttagtcgggtattt
-aaccttcagtgcatttttttatcgtggcgttcgtacctgtttgtcgatgcggcgtgaacgccatatccgcctggggttct
-tgtacactgtaaggcctgataagaacgcattacgcgtcgcatcaggcaacggctgtcgatgcggcgtgaacgccttatcc
-gacctaggtttgtcactgtaggctgataagacgcattaacgcgtcgcatgcagcaacggctgtcgatgcgggcgtgaacg
-cttatcgcgactacggttcttgttcacttgtaggcctgataagacgccattacgcgtcgcatcaggcaacggctgtttat
-tcgcttgttacttacttctgtgctcaatagaagccagaatcccgcgcaaggatattcaactcctggctttccgggcgcgc
-acgggtaaacagacggcgcaattttattcatcacctgccggatgttttcacggataaaccggttgcgcagcagcgtttgt
-tccagatgacgcataaaaacgctcccagatcatcgaccagcgaatacggcgtctcttatgctcgacctgcttcggccgtt
-tttcctgagttgcagccaggccatgcgcacttcataggcaataaccctgaaccgccatcgcccggttcagcgagcctgta
-ttcgcgggttagccgcaatcggatgataatggcatttctgcactttcattggtcaagccgacgcgctgcgcgacaaacac
-cagcgcaccggggtatttgccgttcagcgacgctttttcaggccggccattcgcgcggggtcgagcatcgggccctggca
-gcgtgcgggaacgtggcctggtgccaccaccaggctacaaccgctaacgcttcgtcgagcggtatcgggacgatgtgagc
-aattacaatcacatcgctggccctgctgcccgggcatcgcctggagtcggttcaccagtggattaaccagccacagaatt
-ggtttaatcgccatagatatttcatggcacgggcacagaacccataattgccggtgtgtgacgtctccaccagcacaatt
-cgaataattttgcaggagcattggtctttctcctctaaagattattcacgcatcttatgaataaaacgaagacagatcga
-tctgcgctgctatactctgcgcgttttcccgttctttaaaacatccagtgagagaggccagatgcatccttatgctgaac
-atcgccgtgggcgcagcggcgcaagcgggttaattttaatttgccaaaaactatgaaacgcccggacgctgtagaagcga
-gccagaaaggcgtaacgatttcgtgacaacgtagataaagctttgccggaagggcggtgattattcggacacgattcgta
-attaagcacagcacaccatcatcacgg
->m141013_011508_sherri_c100709962550000001823135904221533_s1_p0/730/0_1617 RQ=0.856
-ggggaaaaaaacaaaaaaaaaagggaaggaggggaaaaaaaaatcccccgaagaaaggggatgattaacccaaaagcaga
-taactgggcttgggcgccccaggcagccttccaggccgtttggcaaacatcaatcacacggctttggcgaagcttatccg
-cacctgccgacaaacggcccgcaaaaaagaagtaagcacctacaaacaccaattttgcaaaggatgggctgctccactcc
-ggatagaaactgcgctttcagtaacgcagagtggcaaaaacagtaaaaggggcattatcgctcaaacgcagagagcactg
-gcgccacataacgctttcatcccttcgaccaaacgaaagtgttagtgttgcacgactactcatcgtgtttgttccgttcg
-tctaccagcttctttcaaacgtgacaaagtcaggttttgcgctgccaaagtaatggcattcatgtttcagataagtcgaa
-tatcgcgcggtacagccaaagctcggcacggccgtgctcgcgggcatactgttgcaacttacgcgcgtcagtcgttatct
-gtggtgaaaagcaccatgtgcttcgcctttgcttggatcgctcttaatcgcagtggcataggactttaatctgcgaacaa
-aaccaagtgccagtttttcacccatttccagcgacagtcattttgccctgcaattttggcaaagcgttttgcgcggccac
-tgtctgccaaaagcctgctcgtcaaacgcacaatatcgccagtgccataaccgccgcgctccatttcgccgcgaacatct
-gcggcggtgggcacttcagtccacactggctctcccccgcagatagccgttcattatgttcggcctttcagttgcaggcg
-tccgcactcttcgataccagggaccgacaacaggcgcggcatccattcctggtagatatacgccctccgtaacccggttt
-tcgcgcgccatcggtacgttatagaaacgacaggcgcgcattcgtcacgccgtcaaagccttcaaggatgcgcagtgcaa
-atttatcgctgccaaagctgtttggttactttcttgtaattttctgcgcctgcaccacaagccgtagtctatagaatcat
-agcgggttggcgaaagcgcgtaagtgaccggagaagaatcgaggtgcccgaacaacacggttgcaactgcgtcataccca
-actccggcacaatcggtaatggcaggcgggcttgtaaaggaacacgttctgcacctggtaagcagtggcgtaacaggcct
-accgggtcagcccaaaggagttgaaacagcgtaacggccgaataaggcgatgttggtggtgaagtcgctcggtttttaat
-ctgctcgaattcggccagaatcttttatggctatggacgacgctttggatggccttcgaaacggaggtaacaaggattag
-cgctcctcttcctggcgctgtttaacctgtgccagacgcggcatcagcaaatgacgaagatcatactttgttcggcagtg
-tgacatcgtgctttaatattccagatagaccagcgctgagtaagttgctcggcagatgcagactgtttgcctttaaatcg
-agaatctggcggaattg
->m141013_011508_sherri_c100709962550000001823135904221533_s1_p0/745/402_3294 RQ=0.856
-ttggtgaatgcgcgaaaactgaagcgagcaaagtgatatctaccagacctttattgccttcactgtccttgatacacctg
-aaaaattcgaagggccaactcgcgcggatacttgccgagcgtgaatgggtcttgcgaatgaaagaacgaaaaagctgcgg
-caacgagctgggccgctcgctgccatatatctacggtacgatttgcgaatggattcatggcgaaaggcaagctatcctga
-gcagcacgtcagatgaaggtggctagcgaaagaataattcaatcctgggcatcgactgtccatataaggtatttgcccac
-cagttaccggatactgagtatgcggcttgccgtaagcagtttcgatgagctgcgcgccagtggctaatgacagtggtgag
-cacgctgttacgtgctagttgatattgaaaaggccaatttatgcgggcgaaaggcgatataaggaaggccgttctggttc
-tgcgtgtgctgcttcggaaagtgaaagtcgccttaacgttagacggcgactggctgcaaattgaaattatcgcggctgac
-ggaaaagcgcgcggagcgttcagcggtgtactcacgcgcaatgttcccaggtaaaacgcatctttgttgccgtcgattcg
-ttggtgatgggtgtcagtcagcagggtaaaataacgcgtggaagaaaaccaccgttcggcctagacaccataaccggcag
-tggagggctaagttgcaggcccacttgcgtggctggaaagaaaggcgaacatgtgttgaatcgattatcaaaccgagtct
-gggcttatgcggattcgtttgtaggcaacggcaacgctgtaagcagtgccacgcggcgtctactcggaaatcgccgctac
-tttgacgtctaacggttggatcggcacgcttcaacggcatgattggctttagccagtctggcgataaacgtgaagaaccg
-cactattggttgaaatatcttgcgcgcaaatcgaatgcgtctgacaccctggcaggtaaggctctacgggcggatataag
-aaggaagcccaaaataatggaacaataacgatctctttcaggcatcacgtcgggcgtttttggcagcaaactcggcgggc
-ttaactgcgtacgccgggatgctggggcctgtcaattgttaactgcccgcgacgtgcgatcctgccgggcgcaagcggcg
-actgacgctgtccatcgctttcgaaaagaggggtcattcttacgcgggtcgtcaactggggggtgctatccgcgcgacgg
-tgaagggatggtcgctttgtgggcgggcaaaactcgttcgaactggataaaatatccgtctgaaaatgattgccgtgatt
-tgccggagtcacgtaagcaacgcggcgccgtattcgttatccgtatggtacgcgtggacgcgtggctgtgcgtaagcgcc
-atctcagcgatacctcccaagcgcgtgataagcgcgttttgtgtgcgcgggtgagctgggatgaagcccgtcgaatgttt
-tctattgaagaactggaacgcgggtggcagaaaactcacgggccgagtgcttgcctgaccagcgcagtggttgcaatgcg
-agcggggatgtttccatagacgcttcggggatgctggcgaaaggctcttgcccgttgcatgggtaatagcgttggtttag
-cgtggcggagattgactcctaccggtgctgcagcaggtgcatgcctgccgcgcgtagtccggttcgatgggacgtgtaat
-gaacagcaaaactgcgctggccgctggtattggcagacagcaaaaccattgggtgctgtggggcctccgattgtttgctg
-aaaaccatagcaaggcggaacatggtggtgccggcggatcaacggatgtttattgaatattacggcgcagctaaaaaggc
-gaaagtaggccgcggtggaaaattgaggcgtcatcagcatccgatgccgttgtcacatccaccctgagtatctggggcgc
-gagcatgtgaagcacattgcggttaacccgctaaactgacgtgcccgctgccactggtcgctggcacatcgctgttacta
-gtgaaaacgctggtagcggacaaaaacttccttgctacttactgtgtgtgggtttttgagcagtttcctgccgtttatct
-ggctgggtgagaaaagacggtcagtgcccgaaaagatgccgcatggggctgaaaaactcgacccggcattgatggccgga
-aaaccattcgtggctggcgggcgggcgagatggcggcgacagaacggcaaattattggctggctgtgcgtgctagcgtat
-ggccagcacggtgtgacatgggcgtggaatgattgtggttctggccggcggatgctgggaccccccgtaaaaaaagtttt
-tgggggcctgggccccaaggggggggggttgggggtggtggtttggttttggcctggcactaccaacggcgcaggcagcg
-ccgggcgtaaatggcgttattctgagtgggtttcttcgcggctctacgtcgattccgccctggtttcactgacaacgtga
-ctacaaaggctacagcagcaactaatttccgattgcccgtgtttaatcgatgggcggaatctctcgcaccggggaaagtg
-atcaactgtggatacggtaaatcgttaaaactgcgccgctgtataaatgtgtattttttgccgggaactaacggttaact
-tccgattccatggcggcgcaatcagccgatcaaccgcattatttgaaggctggcggcaaggcctggaaaggggggggggg
-ggtggcggttatcgccatacgataagccagtggacctcaaactgcgcgctggttggccgatatcgtactgccgtgcgacc
-acgcagtttttg
->m141013_011508_sherri_c100709962550000001823135904221533_s1_p0/778/0_6385 RQ=0.825
-cacacacacccccaaaaaaaagaaaaaaaagaaaaagggaagatttgggtaaaaaaaaacccccactgaaacattttctg
-gcaaatcggtggcttggggtggttaaaacagcggctctcccactggcgaaggcattggggggttgctgacctttatttaa
-atgtgcaagggggaatggggcgctttgacctacacggcgctggggtccctggtggtttgcgcgcaggggttttccagttt
-ccaggggcggcgctacagcaaccataacgtgcttcattgcctcgcatcgtctttaacctttctggcgatgtcaatgtttc
-ttgcttggttttacccttgcaactccctcttcgcctgtaaaagtctcacgtttgctgagcaatccgccaaacaggagggc
-tcactggcggtgtgttttgtttatgggggcgattgccggacatgatctgttcaccatgcacaccgcatcgcttaagcgga
-tttcctgtgtatatgcccaaagcgggaacattggctggggcgggcacgcttttatcttctatgcgtttgggcatgggcct
-gcgctgatgcctcattttaccgtcttttggtaaccgttggctgccgaacagcgccggtggattggaacaagttccaaaaa
-gcgtttttggtttttgtgatcctcggccactgcggtcttcctgctggagcgagttgattggttgatgtatggggatttta
-gcttgtggtcggctgggtgtcggattcttttggctgggcctttatacagcctatcaggctaaacgcggctggatgggtat
-tgttgcaaattattctgctggcagcggattgttagcgtgcgccactttcaggattggggctttggtgcgacggcatacgc
-gcaaacgtcagacgatctaactttacacaatcaaacggtagatgagtttaatcaggcgctcgtgaagaaaaggcaaacgg
-tgatgttagatctttattccgactgttgcgtgctgtaaagagttgagaaatacaccttcatgcgacccgcagtgccaaaa
-gcgttgcagaacggtcttacttcaggcaacgtcacggcaacgagcacaagatgtggcgctgtttaaagctcttaatgtat
-tgcctaccgacattctctttttgaacggacattaggcaggagcatccacaagcacagagtcacgggctttatgatgcgaa
-accttcaggcacattatgcgcgattgcaaccgtgaacgacacttagcagtgggaagacggaggaaatagcgtgcaacgtg
-aagatgtactggggagaagcctgaattatagaattacaaggattgtccccccaacaccaacgctggagattggtttgtga
-acgtgtggatttatcctggacgactgcccgattctggccagacaaagaggcaatacctctacggatgcgctgcgttatct
-ttagcccaacagatagatgttggcgtcgtcagctgatgctggacgaaacgcaaacgccgaaaaaagtgctggcacgttat
-taggcgttatcggagtgcgttaaaaaacgctatcgggtgtcctatttatcgctgctgtactttatcccgatcctggcacc
-tattcctcaacattgggcgatcagcaaaaagcgcggccttaacgattttttacccaggaactggttttaacgacactgga
-cagttgacgatcggcgatggtaagaaaggcagatgggactggtgctggtaaggctgtttaagcgaatgctggtaatgtag
-caggcggaattgtcgaaatgccacatcgctggcggaagatatcctgcgcttcgcccgctgcgcagggtggtgcattggac
-tgacagaaacacagaaaagaagcgattttgccagcaatcttaagcagtttgaatgctttttactgaaattaggttgacga
-gaatgtgcagattacggtttaatggcaccgttcccgatagctcagtcggtagagcaggggattgaaaatcccgtgtcctt
-tgttcgatgcgagtccgggggacaattcatataaacgggacctccacgggaggtccgtttttcggtttcaggacgccacg
-attaagtcgttctgctccaaatcaattctagctaccgaactcacagattctcccaatcacagcattttggccgggcaata
-tccaattcgggaaaatttgtgtttccttgagctatagactaactgacgtgaatgtagtgcgcggccacgtgatgctgtga
-cgtcaaattggacgtcatcaggagcgtaacgcattcataaagcacaacaccggtctgaacggcgactgatgagatttttc
-tgatgagaaaaagagaaatgtatcagttcgcttgctcatgcaagactaacaatcattaaatagtaagtgctccggaacaa
-ttttcatggatttattttctgaacatttttctttggcaaagatgatgaattttgatggtaaggaatattacttctggttt
-cagtaaaatcctttcgtatactatgtaataagagtttatgctggtaaaaataacgtcttgcattaccaataatatggtaa
-ataaacccatctatagatggtaaaataggttgtggcaattatcattgcatcattccccttttcgaatggagtttctaatt
-atgcaacaactgtagttcgcgtttggagaattgctgttctccgtcgcaaaacaaattagccgcaatggggcgtcaacgtt
-accctttgggagcgagattatcgatctttctggttttcttttgcctcacacagtgcgaagtaattagcagggaatgaact
-gttatcgataatgttggaagagaagtattgtcaccaatcagttgtgccgcagagtatctagaactacgttaagtcttaaa
-aagataatgatgaaatagtctgtctatatcgctactgtaccaagcgggctataattatggtgccggttatctggtacagg
-ttgagaagagtggagaggaaataatgcctatcttcgctcccgatatccagaggggtttatggcacagatcttcctccaca
-gttcttaacattcaaaacacgcaaacgcactgaaacaatcccagttaaaagcaaacgattactaccttttgggtatggtt
-tttttttttctgttgtcgtttaggttaatctgtgtagcagtttttttctggtagcgtttttaagtcttttagtacacgtc
-ttccttgagccaaatcgcgtattttgctcaatccacgcggatattgcattaatatgagtaaataaaagttgtaacgctgg
-aggtttccccgtatcagctctcttacgcgatgcggtgggtgattgtgggacatcattaacaccttctccacttttaggtg
-catgacaaatcaactacaacattgaatgaccgagcagttcggtaaaacattatctattgcgtttttgtaatcagcgccaa
-taccgtgctcaacaaatgctttatgtcgataaatattgggtagacaatgcagatggttaacatgctggataaacgttatg
-tcatcactaacgtaatcatgctgggcggattcaaaatgattaactggagagtttataaagcgttaaaccaaccgtggcca
-caacgaatgcaggagacgctccagacaattttgccgcatcgtggtgcgttattaactattttatcggcacatgattattt
-acttggatggggatggataatcattgaaccgtgcagtgaattattaggtgagttgttaatcatcccagaatttacctccg
-cgagaggcagaaaaagcatttagttgatatcgtgcgcattctcgacatcgtttagatgaaaaacaatttgcagcatgaac
-acagaaatacgataatcattgttacactgccgaattgaaacaacctgtcattatatatcaaataaaagccggtcagtgct
-ctggtaaaaaggtaaaacagatgagtcttacagggcgataactactggcattgatcttgaaaatgtcctggctaaattat
-ggtgttgcttgggcaaggttttatgaaatgaagggggatgaacgggaagcaagacttgatgcatatctcacgcctttaat
-ttacgcctaggggcaaacacctttaaactggattcgaaatggtatatttccagacttcttgttcctatgttgtacttatc
-tcgacaaattctttgcttcagaataagtaactccgggttgatttatgctcgaaatatttgcttgttgagttttttgtatg
-ttctgttgtataatatgttgcggcaatttattttgccgcataattttttatttacataaatttaagccagagaatgtcag
-caatccattgtaaccattaaatgtttatcttttcatgatatcaacttgcgaatactgatggtgttaataaacaaacgcat
-caagttttctcatacagggggagaaacttttgtgttatttcacctaattttaggattaatcctttttttcgtgagtatct
-tatcgacagttttgtggttctggtcaggacatagttatacatcaatgaccggactcaaattcaaaatgaaattaggaaga
-agagcaatgagttctgccaagaagatcgggctattgcctgtaggtgttgttgcggtaatatgatggggagcgtaatttgc
-attattacctgcgaacctagcaagtatcgtggtcttgcttatctggggttggattatctctattattggtgcaatgtcgc
-tggcgtatgtatatgccgactggcaaaaaaaaaccgcaacaaggtggcccaattgcttatgcggaagaaatttcctgcat
-ttggttttcgacaggtgtttttattaccatgctaactggattggtaacctggcgattgtaattagctgtatcttatcttt
-cccaacttctttccccagtattaaatgatactgttttcggcgggatcgcctgtatgctaatgtctgggtatttaccttgt
-aaatatgctcggcggtacttggtaagcgtttttaaccactattggtctggtgctggttctttattcctgtgtgatgatgg
-ctattgtttggctctggcattaggtttggatgcggcacacgttatgcagctaactgggaatactcgcggatacgcacttg
-atggtcatgcgatcattaaaagtattctgctctgcctgtggccttcgtgggtgttgaaatccgcagctgtaaagtacttg
-gtatggttaaaaaccacgaaacgtccgtttccgctgggcaaccatgctggtactatggtttagcaggtattgtttacatc
-gcttgcgctgcaggtgctttccggtatgtatccgtccttctgtaatggcggctttccgttgctccgtttgcaatcagtgc
-ttcaactatcctcgtaagctgggctgcgcgctgtttctgcattcactcgcctttgcgtgccgaacttcctctgggtcctg
-atgatgtttggttagccagggcaggttgtactcgctaacggaggtaacttcacgaaagtttatggtgaagtcgacagcaa
-aggtatttcccgaaaaaaggttctgctgctggctgcagtggaaaatgactgcctgatgatccttatccactctgagactc
-tgcggtggtaagcaatctgactgttttcgtgactgaccgtatcgcagtactggcttcgatatgctgcgtatttctactct
-tgcgtgaccttggattcgttttgaggcgttaacatccgcaactttgtcagcctgatcttctctgtactgggttgcgtgtt
-tctgctttcatcggggcgctgattggcgcaagccttcgagctggggcaggtcttcatgctcagcctgattatctgatgtt
-cttcgctcgcaaaatgcacgacgcgccagagccatcatggtaaccaaccgcgtctaacggcacattaattcaaaaagtat
-ttttcgagctcctcctttcattttgtcccatgtgttgggagggccttttttttacgctggagaatatgactatgaacgtt
-attgcaatattgaatcaaggtggggttttattttaaagaagaacgcgcatccgtggaacttcatcgcgcgcttgaacgtc
-tgaaactttccaatttttaccgaacgacgtgagactttaaattacactgatcgaaaacaatgcgcgtctgtgcggcgtta
-atttttgactgggataaatataatctccgagctgtgcgaagaaattagcaaaatgaaccggagaactgcgttgtacgcgt
-tccgctaatacgtattccactctcgatgcttaagcctgaatgacctgcgtttaaagattagcttctttgcatatgcgtgg
-gtgctggctgaagatattgctaataagagtgcaagcagtaccactgactgaatatataacgacta
->m141013_011508_sherri_c100709962550000001823135904221533_s1_p0/779/404_15558 RQ=0.846
-ggcgctgattgttaccctgtgtttttgccttctggaaagtccaggcgaagagagctacggggcggaaaaattggacaagc
-gggcgatgtgaagaagtttttagttaagttctttagtatgtgcatttgacggctaatgaaaaaaaaagcgtattgccttt
-tgcccagacaagcgttatagctaatcgcggcaagggtatccaaagaaggccgagtaaaatcagtatagagtgtttatgcc
-cttgtaaaagcgacgcaacgaaccggactccagcaacttctttcactatggcatttccccgcaattcaacggagccttta
-tattcgtccatgcggctaatgcctgaacgtcaattaacgtaaatcacttaagctagcttattatcaagatgggccgttca
-ctcattaatgccggcagtgatccacgaatgattacgcattaggtagccaaccctgttcacgtcatcaataatgaaataaa
-aaggtgagaacaggcatcaacttaataataaaccgggccagcatactgattaaaaacaatgcgcgccgcagtgctgaaca
-cgatgattaatggcatatacaggaactaaacttgcaacgacaatcgcaccaagagagtaaaaacagatatattaaacgcc
-gggcgatggcggcattttaatttgttgctatccttacttaagccataccaattaacaaactaagggtttaaaaatataac
-ctgatggcgactacattgggtgggtgaatcatatttggttgcgcgtaatttcgatataccttagtcccggctagtcctgc
-ggttgccaccaaacctaaagccggtaatgagccatataccgtttatatctggcctcgtgctgaaaatctaatttattgct
-gtttttgcgagtatgattcattcttttagttatccttaagaaaaaatattaaatttcaccataaataaattttaaaacca
-cgcattacaaatacttttgcctttatggatacagaaaacggcttcggcgtcgtcaataaggcatatttttatactggtat
-tgtttgtgtcgtttttagtaaagaaaaatccagaccacatggccgggatagtgatggtgaaaaagaattacggcggtttg
-cgaagatccgaacaacatcaggaatcagagtttggatgaatttccagatacaaggttaacgcgccaagatgggaatattt
-gcgcaggttcgacgtgtcgcgggtatcaattctggctcacccatattttttcagtttctgcgtgtcatacgccgtaatcc
-cgacaaagacaatcacgcgatagtaggtacctgcccacaatatgcttcgctttgcaaccagaagttgaccagcgatgcca
-gcacaatgcgattaacgccataaacgcatattgcaagccacttaaatcgcgcttcgtggtgtaaccgtacaggctcattg
-cgccgaacatgcccggcagtaacgagaaagtactggcgattagaagcagcgtatcagacagtgaaatactactggagaag
-gccgtaagactcagcgcgaataaagctaaagagcatcgtcgttacactgcgctcagcttttgaatcatcgctgataacaa
-gataaccaatgctaattgcgcgattgcatcagaccgattaaaaagacacgggttagtgaacaacgctccaatcacggccg
-gcggaatttagagccgcctacaggcaacaaatggcggtcgtgatcaagcagctaacgtcatcagccatagacttgagcca
-tataagtttgcaagcccgctcggggttgtccgattgaatccgaacgtgggaatctgtccatgacgaaggtctcctgaaga
-tatacaggaatatcttaaggatactgcaaatgatgaggctgtgcatcgacgcagcggtaaacgctaatgtactcgagcgg
-tgaaattgccgggacgcagcggtgccctatccggataaacaaaaaactaccgagcgtttttgcgcgctgctgtcgctctc
-ccgagcttcaacccagcggtcgccttccggcgtggctttcgcgcttccaagaacggtgcggcggttttgagataaatcca
-taataaactgcccggcttccaaacgcaactgctgcgatcgccttggtgaacacctgacaaaaacgatttcatcgcccggc
-catgaattccgcgatgcggtgaatcacagtgagcgccccagcggcatgcggttagcgcgttcatcaacaatttctgcagt
-tgcttttttcagtctccccggatagtgttcgaggttaatgcgttgaccgctgtcggccagggttatggttggcaccttac
-ccgtaaggtgatacgcggcacgtcttcgtcagctcgccagccacgggtaactttcttcctctaagctgaacggtgcggac
-caacaacaattttggtttctgccatcttaacctccggttacgggcggaagaaagctacttgcgtcgcgtcagtcagcgga
-tggtgcaaaacatcactcagcgtctggttgacggcagcctagtaatttgccatcttcccagctgccagcgccgcagcgat
-cgcttctgcgcagcatgtgctggcgtaacgcttcaacagttgggaatccgcagccaccttcgtttgcatctgttgtccca
-gcaacttcgcgcacgagctgggcgaaaaaaacgaactttatcatcccgctgcaccttaagtcaacccgacttgccgccgc
-tctgttcgcagcaaacgtaccagggagcaatcaccatatcttttgggcacgctttgggcgcacatgtcatcaaatggtag
-gagttcgagtgcgccgcacggaaggccgcggttaatggctttccatttgacaccggtttttccgtcggtcgagcggcata
-aggtttctatacgcaccgattgtgctccggctcggcctgtaaattgactcactttgctgagatcagcggatgaccgagcg
-ggaatcagatgtatccaggtgcgtttttgcccgctgaatacgcggcaatacgcgcatggcaaatacggctccgcctttgt
-gggtggcgaccatcataatcagtccgccagcgtctcggctgcggcatggtgacaaaggcttcgccgcggcttcacgcacg
-gtttccgcttggtcggagacatccaccatgtgcgttcgccagcggcgttgatatgggttgcagtttgcgacaatacctta
-tttcttcacatgtggagtggaaattacacggacgcgtaaacgggcatccaggcctgcggcgcgatgatatttcccatgcg
-gtacggcaacgcttttggtcgaacgcggcatggcgaaatcagcggttttgttgggacggcccgctaactagcacgagatt
-ttgcaacgtggaagatgcgaaaatctcttcaaacgacaacatccggaacacttccacgaaaaaccttcaaccttcacggt
-cgaacaacggcagcagaatgcttcgggagtctgatcacttccgtgcaggccagtacacccgtaagtcaatacactttgta
-catcgtcgctggcgatccacgcaagatactgagcgcgaatagcgtagcgttttctttcacaatggctttatcgacaacgt
-gatggccgctttggcgaatcgcgcagatagtgaccggaggttcggtcttcttcaccgcgacgatttagaaacgcgtaaga
-aagcaatacggtcgggataaattcagtggcttacctgactctctgaatctctccttttgacgtttttagccgccaatgta
-cgataagttttgcgtaataccggtgttggttttgatcagggaaaaatgggtctgttttctatctcccgcagcgccgcttg
-aaatacgcgctttcaagcgcctgttgctgggtaaatcgtcttgccaggcagatcggcaggttaacgccgcttcacgcaaa
-cagggcagagatggagtttaactcaatggaggaacggcgcagggcggttttgcaagtggcgcagcattctttttcatacg
-ggcatgctaacggccaatctgctccggcgtaatctggatggcaaaagacttgcgcgggacgtcgtgcgttgacgtaattg
-tggatcagccgcgacgagtagctcgtcactgcagaaacctgaccacgatagtggatgcttaggcgggaagagcttcgctg
-cctcggccgcttttccatcagttcgatgaaacgcagctggatagggcgatgctggatccagttcagaaaggtgtgagctg
-gtgatgataacatcacacaaccgcatcagcagggtaattgactttgacgcttctgcgaaacccggcctcaatgcacatca
-atccctgcatgacctggttgaattttcctgcccggtttaatagcgtgaaactggccgatgcgtccgagactgtcgacact
-gatacgtgatgctccagtaagttctccccgctccctgcatcgcgcagctgcgccacatcgcgttccatagacggtaccat
-tgggtttgaacgaatctggcggatgcggtcgttttccgcacagcggcgtattgattatcggtaaagtcgcggcgtaaaga
-cggcttcctcctgtcggcgcactttttcggtgccgcagtctggcgaaggcgcgcgtaacccggcgaatttcatcgacgga
-agaaagcctttattggtgacggccggctcggtttgtagccatccggcaggcagtaaggtgcaaacgaaggttacacactc
-gggtaatcgacaggcgcaagtagtaaacttacgcgcaaatgcatcagtcagttgtgaaggctatgtacaccttttcagat
-acgggaggcgaaagtcattttcttcttcgccctggtgggctaatctttacgagcatttgtaggggccaaagcaccgtatc
-agtttgacgcaggtggcagaggctagagtgttttagtggtttatgccgatactaagcgttgtaaatgagatttttaacat
-ccacatttcgctatgtaatcatgttatatagcgtcatgatcgtgctatttcgctagcagaatacgggaaaatggcggttt
-tactttgatatacatcatcagggaaggcataggcgtgcatcgtccttagagtagaagaaaatagtttgtgatccgtcata
-ttggcaggttaattgctgttccccgcaatttgcgctactgtaagggcgcggatatctgactccaggaaactaatatgcgc
-aatcgtaacgctggcgatcttgatcgtgtcgttgctgctcggcggaggcatggactgggggacgccgttctctgtcatgc
-actgttcgtctttgggttctcgtttaaaacggtatcggtcaccaccaccgataatggctggctcgacggggcgtaattcg
-gccgttcagaaggcggcaattgctgggggcttttatatgcggcaactggcctcaaccaagctgataacggaacgagcgtc
-gcctccgcgatgttttgaatacgcgtttttggtggcaatggcgcaactttccggtataatctcggaaacttgatgttaaa
-ggcgctggatgcacctagcgtgcgggcctctggaagcccatcaatgttaattcgtaatcttgctgaaagtggatacggca
-tttggattccaatgtcagagcattcctgttgatctgaatggcgaattgacgatcaggggcatgaagtttacgcgggcgag
-ttcaatatcgacagttaactacgccgattcacagagtttattgttaagcctaattaccgcacacgcgtgaggcggctcac
-gctatcaatgaagcggagtctcatcattattgggcctggcatttttataccagcctgatgcaattcctgctggcttgaag
-gaactcgcccaggcattacgccgagccagcgcgcggatggtttatatcggcaatctgggggcgtgagtttgagttttacc
-tgcgctaatttgaagctggaaagcaagctggcaattttatggagggcagtaatgttggtaaaaaggttcattgatgcggt
-catgcgtcgggcgcaaaagtgattgtctcggcggtgaaaggcggattgtgatccaggaggttactggagccagcgatatt
-ccgtatcgtcatgacggcagttgttgttacaataacgctgctggaaaggcgttacaggctttaggtttaacggaaatcgc
-gaaggaaatttcgggacttcctattgaatgacaagtgggcgcgttgtttatgcggatggcggcgtgaacgcgcttactcc
-ggcctacaacggcgcaaattgcatatattgtgcgggagaaaatgtaggcctgataagcgtagcgcatcaggctggttttc
-cgtttgtcatcagtcttattcgggctatccctgtttacggatgccgcgaaaacagcttcacgagctgatgaactggtcat
-cgaatttgcgccgcttcttctttcgaacttccaattctgcgcgtgttgcatcatcaacttccagctcatggattttctgc
-tgcaacgctttaggcgcacatatccaatcgcacattatccggctcacatcgggcgcgattttctctggcccttagctttg
-gttttggcaatgtttctgccccagcgcaggatatcgacgcacttttcttgttcaagccttgccggcgtaatttcgtgttc
-ctcgttgtagcttctgctgtttctcacggcgacgttcggtttcgccatcgcttttcgccattgatggggtgatcttatgc
-cgtagtagaatcgctttacgttaacgttacgtgccgcacgacatggtctggatcaacgaacgttcgaacgcaggaggctt
-ctttgtcagcgtcgaggaatgcaccgagcgacacttccgggcataatccagacttcgccgcagtaagttgatcctaccag
-cacgtcgaactcacccagacgccaagttcgcggataatctccatacgtttccgcacccggttcgatatctgagtgacgca
-gtaacgcacgcgctcgcccatgtttttcgagatattcgtaagatgcttccgcatccgcttgggtcagtgtggtgaacgca
-gtacgcgttcgttaattgccgctcgctgacgaattccgcaagcagatcatcaacctgtgtcgcgcaccggccgcacttcg
-ataatcggtaagcaatccggttggacgcagctcacctgatccagccacagtcgccgcggatttttccagggctcgtaatt
-acccggcgtcgccgaaacgatagatggtttgcgcgctaatgcttcgaactcttcaaaactttaagcggacggttatcagc
-gctgatggcaggcgggaagccgtaaactccccagtgggtctcttttacgcgcccggtcccgataacgatgccgccaattt
-gtggaatggtggacgtgagattcatcgacgacagcaaggcccaatacggcaggcaggtaatcaaacagcgtcggcggtgg
-ctcacccggtcacgaccgggagaggaagcgcgaagtagttttcaatccccgaacagtagcccagctcgttcatcatctcg
-agtcaaaactgggtacgctgggtcagccgctgcttctcagcagtttgttgtttttccaacgcactttgcgtctggccggc
-cagcccttcttctttgatctctcatagtgtacgatgcgcaatcggcgcggtggtgacgtaagtgcgttttcgggtagatg
-taaaaggtggaatagtggaaacaatctgcccggtcagcgggtcaaataacgacatcgtttccacttctcgtcaaacagtt
-tcccgccacgcgaagtgcaatgtcaatccgattctgcgggaagatatctatcaccaatcgccacgacgcggggaaagtac
-gcaacgctggaatgcttgatcattcacgacgtatttgcagcttccgccagtcggccggcgaatgcgcgcgctgatgcgat
-atcataccgaccgtggaggatgggagcatcatcttgagatataaatcaggatcgcccagccccataaatggcgcggaaac
-agacgcatccacaaccacatcacgccgctccgcatcgctttggtggcggacaaagtcgcatctgcctcaatatgttcgtt
-aaccgaggcctcttttctcatgaaagtgtcgggaactgcgtcctaggcttccggctgatagtagtcgtagtaggaaacga
-aatattccccacgcggttttccggggaaaactctttcatttcgccatacagctggccgccagcgtttttgttgggcgaag
-taagcgatggttgggcgctgaaggtcagcatgaattggcaatggtgaaggtttttcctgagggccagtcacgccaagata
-acgtctggtgcgacaggccatcttccagccccttcttcgagacgtcgaatcgccttctggtgatcgccagaaggtttaaa
-gaagcggtaatttcgcagtttgaacggtttacccatgagtgctacctgaaggagttgggcggcaggtatgtaattttaga
-gaactcgtgcgtacttaatttatgcggcaacgaggacattatcactgggataaaaaacagttatgcatcctcatcatgga
-ttttctgataggcaagggtagcgtaaactacgcgctgttcatcgatgagcaaaaatttgactctgtggcggagataaaaa
-ctccggcttacgggtttaatcccaaagcaacaggctttttttaacatttgtcaagatgatgaaatgaacagttttatggc
-aagagatgcctgtttcagtgactgcccaattgcaattttatctctaaccagttaaaaataaaagatactttctttgagcg
-tctttaacgccaattcgcgtggcacgccgcggtattctatcgctgctcgtggttttctaaactctaatgacacatggtta
-ttccacaggaatagtggataactgtcctccagctcctatcccggcccgcctgggcaattccacattcgcccggcatgagg
-cggaagtaaattttttcgtgattattttagaatttaaattggttaaattggcagtcaatcgaagacggcgatctcgctcg
-gcaatttaaccaaatacagaaatggctacaacaaggcaaggtttatgtactttcgcggttgcgcatttgtctcggatttt
-tctgcaagccagggatctctcccagcacggcgcgggaatcatgcgggtgagcgtggtccatatattcaggcgtgaccgtt
-ttcccgcgaggcgtaacatgcgttcgccacgctcaaccgcccagagtcagtccggcggtgtgtattacctgtgcatcaac
-atcgcgtgattaataagcagcgagtttcacaacaacctacgcagtaattcaccggggcagtttgttttctggttacccat
-tgccaaaagtgaaagtgtccgaaaagcggcgtaaaccaagccgccagcaccttttccatctaacacccagtcaggcctgt
-tgtcaagcgcgcgtaatccgtgcgctgcattcgcatgattctatcggctgggccggctcattgcgcgctgatgatgtgcg
-cgaagtgggtctgcgaaggtgtaaggatttactgtttgcgtaatccaggctgcaggctgctgttgcgctgtaacgccagc
-cgcgtcgctatttgcgggtaaaccttccgggtatttttcgctcctggcagaggcgaccgtttataccgctgcgtccggtt
-agcctgctgccttttgcggcttgtaaaagtttacaactggcgacagttttccccacttcgggtatccgttccggtggaca
-gaaattcgttttctcacgagcaattcactccccaaaaaaagaatgaacgttcagagggatatcgcccctggctgttgcgg
-caggcccagtttgcaattcgctgcaaactgcgacgcgttaatattcgcgggtcgcgcctctatgaagatggccgtggcag
-cgcatgcctttcaggcgaacgcatgcactgagcgcatcatcaaccacagcgtgatgggctgaattatgatgttgataatg
-cacgccgtttcagcgactgttcgatttcatctggcggtaaaaagggcggattagcaatgcggacgcttcgtccacacgct
-gccacgcctgatgcagttcgggtaaacgaatccctgcacagcgtggtaaagcgcgaaccatacgctttgggcgcgacacc
-cgatacagccgcggagtggcgtggataaattaaaccgcaccactgcatgagcggattggcctccatgcaagatccgaacg
-tcgcagtcgcttaaaggcagggattcgctttccgcccagataatgggtctgcggcatccttctggcgtgcctgaaccaag
-cattggcggcgagagatctaaggccgtcactgcgcgtgacgttgcccagcccgtggggctcatccagcaggtccacaacc
-cgcgtcagtacgtgggtgtatttacgctgtggaagcattgcagtaaggcgtcagcagctgctggcggctgtagattgcac
-atgttgccatagtgtgcggcctgcccgacaaatgccgctggcaatggcttgtttttttaaccgttgccatgcagcacctc
-cagcagacggtcgatatctgcattttcatgcgcagcggttagcgttaagcgcagtgcgcgcagttacgcagcgggtagcg
-gttggcgggcgatcgcccgtgacccagcaccttgctgacgcagttttctgcgttgtaacgcacggctgttatacggtaca
-atcaatggctggatggcgctgcatggaatgcagcaagcgaaacggcaatcctgtactccggcacgaaaacgcgtaatgag
-tgccggccagtttttcgcgccgtgcatcacgtatgcactgcgaatgaccgccagcgacgcaacgtaaatgctggcgcctg
-gcgggcgggcatcctggtgctgtagataaggtggcgggcgaattgcgcagataatccgccggaccgtactggcgcaaagc
-accgctgccccgtgacgccgcatcctttgccaaaagtcactaccgagcaattctggttttacttttggcagccagcaggc
-tgcgcgccctctccgcgataacgcccgtgccgtgggcatcatcgtaccatcaaccagccattgtgcttgttgcgttacct
-gctggatttccgcagtgggcactaatcgcgtccatgctgaacacgcttctgtcaccacatgttgctgcgccggaacaggg
-gtaaagcagcaattcgcgccaaaatgagtgactcgttatgagcaaaacggcgtaagctgcgacgggcttaaaactggcag
-cttccagcatgaggcatggcttaagccggtcggcaggcaatacggtctctctttcgccatcatcggcggcaatactgcct
-gattaagcggcgaaaccaagaaaaaaaaagggaaataaaacagcagtgccggcgaatagcaagccactcggcagtcttct
-ttccagtgcctgatgcccacgcttataaaacgcgctgacgtgacggagcgccgcttacgatgccaaattgctcgcggccc
-cctgctggccaggcagcggataatttgcggatgaatggcttaaagcctaaataaatcgttactggaaagttcagataccg
-cgcgatcctccgccagcgcaggccagcgtgccggctccttgcgccaccggataccggcgacgcagggcatcggggcagca
-cgccgcgcatcggagccgccgcgttgatgtttctcctgccgcagcttccatatgctgccgcgttgtaatattcgtcggtg
-tccggggtcatcagcgccctgttcagacgtgctgttggttcgtttatcctgccagcacggcagttttttggcctggcgga
-tttagcccgcagtttgcggaacagttgcaggtctttgatcttcttccggattcggcgtggtcagcagtttggcaaccggg
-gtagaaactcgacggtttgcgcctgccataaaagccatcggcctgagtctgttcgttcatctgctcgcgtccggcgaaag
-gcgcacgtaagagggttgggatcatgatccgcgcgaccgcgcaatggggtgcgataaaatcaccgggcgatcgacatcat
-cgttaatcgcaagcggcgcggcctttcaccttcacagcaatatgtttggattggcacgctttccgggcggcgtcggcagg
-tttgccagtttgcgaggcaataatccggcgcgaatcttttaccgtttcgcctaagcctgcacaatgcgcgccattgaaga
-acagaactttgatccgcgcatcggggcgcactttttctcggcgtatcgaggcgttcctgataagtgcgtgtggtgatgat
-attgccgtaaaactcggcggaggtggtccagcgttgtcgggttgtgtaatccagcccggcgttcgcgaggcgctgcggcc
-tgagattccactcaacgtgcccacgtcatacaccagcctccagcccatcgctttccccctgcaaccattgtcgccaggta
-cggcatagtcgcgttcgtggggattcttccagcgccgggcgccctacgaagcgcgtcgatcctgccgtcttcggggcttt
-gcggcgggactccagccctgttcaaacttccattcagacgcgctcgggggcttcagccggtttgtagcggcgagctttgc
-gggcagtatttgcaatctcgcggacaagctccggtcttatcgacagcaacgtgctgacctgcacctgagaggatcggaaa
-tgctggcgatgcacctggctgcgctttcaaaccgcagaatcccagcaagcggttttcaaataattctgtgacttgcgacc
-aatgtggcagcgtgggcggtgagccatggggcttctccaaaacgtgttttttgtgtgttaattcggtgtagactttgtaa
-acctaaatctttttcaatttggtttacaagtgcattatgagcaacggacgatccttgctttgaaccaacgccatatctgg
-caccctacacatccattacctctctcctggccggttttaatccggtggtgagcgccggaaggtttgcgagctgatttttt
-tggtctgaacggcagacgcctggttgagacggtatgtcgtccgtggtggtggcggcgatccacggctccaatcacccgca
-gcttaattcgggcgatgaaggggtcgcaaattgatggcccatgtcgcatgtgatgtttggcggtatcaccactcgcgcca
-gcgcattgagctgtgccgcaaacctggtggcgatgacgccgcaaaacgctgggagtggtttttcttctcgcggactccgg
-gtttcggcggtagcggtggaagtggcgatgaaaatgggcgttgcagtactggcaagcgcaaagggaagcgcgggccagcg
-gttttctgaccttccgcaatggttatgcatggcgatactctttggcgcgatgtccgtgtgcgatccggataatcaatgca
-agcagtctgtggagagaggccttaacctgccaggaaacctgtttgcttccgtcccgccccgcataagccgcatgggatgg
-cgactgggatgagcgcgattatgggtgggctttgggcccgcactgatggcggccgcatcgtcatgaaatcgcgggcggtg
-atcattgagcgattggtcccagggcgcaggcgggatcgcgcatgtaccatgccggaaatggttaaaacgaatccgtcaat
-aggatctgggcgaagatgtgggatagttgctgattgccgacgagatggccactggatttggtcgtaaccgggaaaactgt
-tttgcctgtgaacatggcaagaaatcgcgccggacattttgttgcctcgtagccttacgcggcggcaacaatgacccttt
-ccgcaaatctcacgcagtgtgaggcgaggttgcagaaaccatcagtaacgggtgacaggcggttgctttatggcatgggc
-caactgttatgggcatccgctggcctcgcgcggcagcaaacgccagcctggcgattctcgaatctgggcgactggcagca
-acaggtggcgatattgaagtacacgctggcgcgagcaacttgcccccgcgcgtgctgcgaaatggtttgccgactgtgcg
-cgtactggggcgcattggcgtggtctgaaaccactcatccggtgaatatggcggcgctgggcaaaaattctttgtcgaca
-gggtgtctggatccggccttttggcaaaatgatttacctgatgccgcctatattattctcccgcatcaggttgcaagcgt
-ctgcccggcagcggtgtaaaccgcgcggtacaaggatgaaaatttttttggccaataacgagaagtccgcgcgtgagggt
-ttctggctacctttctggcatagacaagaagaaaggagggtttctgaaactcatcagtaaaagattgcgcgcatggcgaa
-gattaaattgccgaatgtagatgttttttaaaggcatgggttacgatgggataatatttcattccgggcatatgggcgtg
-gggaatgatgctctagccgggaagaaaagtttttgttgtcacctgctacgacccggatgcgccaaacccggggctccggg
-ctggtgactgggtagttgttaattacgcccgctgatacccgcgctgtatttacgcaagggtttgggactctgggtctggt
-agcatgccagacggcgtttttgcagacgcgtaccgctttggtaaaaccgggtatgcgatggcgcatgcaccgccgaaagg
-cgcaacacttcatcgctaacatttttaccgttcagcctatggcgcggatgatatgaccgtattgattgtcgatgagggtg
-ccagcggcggcgatggtcgggtttttaacgttcatttcactctctggcaagcgcctcgatactgcgatgttttagttaat
-catctgcagatggcgcaatgcatcctggtatcacttaccaggtattaaaacaacttttttgtcttttttaccttcacgtt
-tgcgctcaagttaagtatagaaaagcaggcttcaacggattcatttttctatttgcataggcgccggagcaacctgtgaa
-ggcacattttcagtttccgtctggcgctggtattgggctttggcgtgacgctgaccgggcctgtagctaccaccgcccga
-tcaacgtctttctgatcaaatcgcgagctggtac
->m141013_011508_sherri_c100709962550000001823135904221533_s1_p0/795/0_1137 RQ=0.844
-aaaacccacaaaaaacaaaaaagagaagagattccacaccagcggggacaaaaaaaagtgaatgttggtgggaagggcaa
-agcgaaggaaaacggaaataagaacggggcaataaaatgaggaagaaatggcccgcggcccctgcaggatccgaacctgc
-ggcccaccgaccttagaagttttctagaactgaccattttaagtcaacaactttacccgcgctctatcctctgcgctcac
-acggtctccgcaactacctcaaaaacaatgtagaaagcccttgcaagccattgcgaggcttatgtgtctcagtttttggt
-cgctctttttttgtacttaaaaaacatagtaattttgaggataaaccgtctaattgctattttgtcgcttatatgccctc
-taaaggcatggcacttaaaatagactaacagcacacaaaagcaataaaaaaccacaacaagtaaaacgcgaaatatgcaa
-cactaacagattaattaaaacgcaaaaacagatagcgcattgtgataatcatcaatactaaacaaaaatataaatcaagt
-ggagcaatatgtaattgaactcattaagttagatataaaaaatacatattccaagtcattaaatacgatgaatgagaact
-tatttatggcgggcgaacttctgggacatagtcgtctgacaacccctattgcgatcagctcttttggcattctacctgag
-actttaattcagttttacttctgaacaacataaatatgcgggacattagtcttggaactgtctagcggcaaaaacagaaa
-gaggcgtgtttatctagccgaagacaggaggccagaaaagtcagtccacctcgactaggaaaattcccataacgctgcaa
-ctattattaaaggtgtcaaattaattgggatttggatgccccagctatctattcgggctggctgagctggaacacctctc
-ggcagccgagtggcaatattggtcggatcaggactgatggattacagtaaccccgaaagccgtttgacggatgtgaaagt
-agaccccatgatacacaaacgtcatttatggctacgcaactgaattttggatctgaatatccaaggtgctgtgctcctca
-acgaacccaatttttac
->m141013_011508_sherri_c100709962550000001823135904221533_s1_p0/803/11267_16519 RQ=0.883
-tggagtctccagctatccggtataggtacgaacgctttcgcggtatcaacttctcgttcccattctgcagatggcgcgca
-ccgggcatgaccatgttcaagtgccagtatttacgctgggcatcactgtgcgcgaaacgtctgatattggcttccttcca
-attctgacggtttacccgtcgcgttggttgaccctggatcgctatctgggcacccctttcttttaacaacgatatgggtg
-gcaacatgatgatgtacatgcaacctgatttgggcctggggccacccggtaagttttacatcctgattgcctgctgtttt
-cggtgtgttttctcgcgaaattgcggcaaccttctcgcgtaaacgtccgtttggtttataccttcgctggtatggggcca
-acgcgtctgtatcaccgtgctgtcgtttcatcgtttgctgcaccacttcttgtacgatgggtgcggggcgcgaacgtaaa
-cgccttcttggtatcactacaatgattaatcgccatccccgaccggggtgaaagatcttcaagctgctgttcactcatcg
-tatcaggggccgcattcgtgttcgcattctgcgatggctgtggacatcgtttatcgtcaccttctcggtgggcggctgaa
-ctggcgtgtgctgctggcgcgtaccgggcgcggacttcgttctgcataacagcctgttcctggattgcggcacttcagat
-aacgtgatcatcgcggccgtggtcttcgctgcttcgaaaagtgccagtcattttcgacgtcattaggactggtggagcgg
-gactggggatttcggcggcttcctggcctggcaatgcctcaatgccgccgctattcttcgattattgtatcccatctggt
-ggaaccgttataacgtcgaacatttgggaatattcgcgtaaagatgccgtactttgccctccagcaggcagaaacgcttt
-tctatgccttgctgattaatttatggactgacgataaagacaatttgtggaccaatatcgtcgaacgccagagacaacgc
-gttaagcaggagaataggttatatacaccggcgcaggagagactgccgcgggtaatccccgcggttagtggtgcgttacc
-acacccacttggtccctgccccgaccgcatagcggccttttttcatgcagtagcccctgtcggccaacatttccgtataa
-ccgagatgtggtgagatttttgcccggcggcaatgcagatacttgccgctgtggatcaagcattgaagccgcgcggctgg
-gtttccgttggctggacgcttctttacttcaacacgctgccaatcttccgaaacgctgaaacggttaatacaggctgggc
-ggtccggtcgcaggcgtataaatggggcgaccataccggggtgattgaatattcagccgcccaacgggtgtcggagaagt
-ttttttcggctatcatatccagcgtctgacacaattcgatattaccggtgcggatctttcagttttccagacatccactg
-aggctgtttaactcattgacgcaatacgcatattgttcgtttggatggaaataccatatgacgcgggccggccccttcaa
-cgggtggtcacttccgcagggtcctgcgccacgagatgacatcatccgctgaccggtaacaggcaaatgcgatcctgctt
-tttatgccggaaccgcactagcgtacggttgccggtgagatattggcggaatggcaaccgtccagcccctcgacacacat
-cgacgaccggccgcactggcaggccccatcttccagacgcgtttcgctcacgttaccacgcattgggtaagaacctaaca
-aagacaaactgccctggtgatcggctggaaatatgcgtcggataaccgcggcagcgcagactctgtcggcaaaggtcagt
-gcgctcgtcccgggcgatacgatacgccaggacgcgaaactcagggcgaacaccaacatagagataacgtttggtcgcgg
-gcttggaaccaccgatcggctgcacctgccggcaatcgacaacctgttgtcagcgtcagtgcgccttatgattccattcc
-gacgtgaatttgctggctctcagggctggcgatataactgtttgcttcatggaatgctcctttgcatttagcaacgtgac
-tgtaacagctaaaattagtcgctttttggcggtgaatggctgaattaagaacgcagaatttttcgcgatagtggtatcgg
-tgtacgcattcgcgcagacgtaaattcttaaccttaagtctggaataacgccatgacacacgcgtgattttgctcgtcag
-acttagacggcaccttaattgaccccgaaaaagaccctgcttcctcatcgatagaagccctggccgcgctcgcggaaagc
-aggcctatattaatcatcgtcacaggtcgcatcacgtcgctatttcatccttttttattcaggagctggcgttgatacaa
-ctgctatttgctgtaatggcactatttgtatgatttatcaatgcaaaaccgtttgctggaagcgaccaatgcccgttaat
-taaagccctgcaaactcattgagaatgctgaaatgacccacatcacggtcctgatgtatcgtcgatgatgcaatggtcta
-tgagcacccgacgggcatgtcattcgcacatctaactgggcgcaaaaccctgcgcccgggaacagcgtccgactttcaca
-caagtcttcttctctgggctgaaacggccgcacaagttcaacgccgttggaagttcgccctgacgccacgattgacgctg
-ccgcaattgcagcattttggtagcaatcgtcgaacatgaaactggggactggagtgtgaagtggtcctggagtcgatcag
-gttgatattggcacgcggcggcaaaaccagtcaaaggtaaacgtttgacgccatgggttgaggcggcgcaaggttggtcg
-atggaaaacgtgtggcattccgcgataactttaatgatatcagtatgctgtgaaccgctggtacaggcgtggcgatgggc
-aacgccgatgacgcggtaaagcgcgcgccaacattggtgatttggtgataacaccacgacagcattgcccagttgccatt
-tataagcccaccgtgatttaatcggcggttatcgcacacactttatttgcggcgtagcagcacaggccaggtttgatcgc
-cagttttaaatccctggccacgggctgatacgcgccgcacagcgttttaaccgggccgcttccgttctctttcgcacctg
-cccgttgtcgtcataactattaacaaattttgccgcaatcgttagcgaatgctggtttgctggcgggccggttgtaaaac
-cagagaaacatcgggaagcctgaatgcgaatacgtagcgcagcttgcaggcggttcgtccaggctttattggactccaca
-aatgctgatcgccagcgccaagcggcgggtcatcgccgtaatgcgggattgatgctcaagcaccggtcacttttcagaaa
-tgctactttgttgcttctttcggcagccacggattcatcaaacgctactgcccttgccaacttcctccagcgcgccaaaa
-ggctttcacctgaccgttttccagtaccaaccctcactctgtctgccagatggaggatgctcatccagcgaatggctgaa
-tacaacatcgaatgttgatttcccgtgtcagcgttgcagataaggcaacagttcggcgttttacgcggaatatccagtga
-cgcaagccggtttcataccagcaacagcaattccggttgctgttcagcaagccgaaccaatcgccctacgcgctgttttt
-ttcgcctccgggacaggctgccctggtaacgtgcaagccaacggttcaatgcctaaagcggccaccagctttatcaactg
-atcgaccatacttttcgaacatggcccgtagcgcagattgccaacgcactttgtaatgcgggacagcagccgcggcatcc
-tgaaaaacatagccaaggtgacgctttttcgggcgtcagggcagatactttttcggcatcaatttcgtacccgccattga
-gacaatccgcctttttgcgggcgcgtcagtccactgatggcgttaaatcagcgaaagtttttttccggccccagagacgc
-gcaagaatagcagtgatgccattggcgggcagcgttttcattaatagtcaggcaatggtttgcccaacgtctgggaaaaa
-attccccgttcaagcatgattagcggccccgcccgttcacgctgattctggccagcgcattctgaaaaattcaacccccc
-caaagggaaaaaaaaagcaaattcaaaatcgcccccccagcgcaatagaaataatgcacagtcctcgccgctcccctttt
-ccccgccgggggtctggatcagggtactacatggcagaaaggcaatggttcgcgtttcacaacggcaggaatgtttcgac
-caaaagggatggtttgcaccaaatcaccgaagagaacgagcaaagcgcagtacccgtaaccaacaataattcccggtaag
-gtccgcggtaacgtgatagtaaagaaacgcgccagcgcccgcccccagtgtttcttagcggcgctgttccagttttgaca
-tcaaccctttccagcgccagacgaattgcccgcaccatcagccggaaacgacatgaacgggcgaggcagcgagaacggcg
-ccgcgccagctaaaggcgaaggtaatacgcaaactagtcatacagacgttcaccggataaatccgcgccggtccatcgga
-aactaataataagtaacgcgacgaccacgggcggtaaaccagcggtagattcagtaacgctgtcgagcagagctttgcgc
-ggaaacgtgcagcacgcagccagtaaccaggcaaaaaagatcccaaaacggcaggctaaacagcacaagcagggaagaaa
-ctttcaggcttaataaaacgcctgccattctggatcggtccagtatctattattgattgtaaatcgtaagcgttaaagat
-ttccgctgcccctgcggtccttcagataatcataaaatgctttcactgtcgcattgttatgccttccacaacagcaacgg
-atattcggcactttttttatgtgaatcttccgggattaggtggcaaccactttttacccgctttgctggcaaactggcgg
-tcagaaccgtagacaatgcccagaggcccggcttcgttacggttcggaccag
->m141013_011508_sherri_c100709962550000001823135904221533_s1_p0/806/0_37037 RQ=0.879
-cccacccaaaaaagggagaaggaaataaaaatatctttttggaaaattccttccccgtgggaggcaaaattttggcaacc
-ggaccagcccttcggtacaaacacgcttgtttgttggtttcaagattaaacaaaattctttgtcttaagggggcggggat
-aaagggtggaaatttagggggcaaaaaaatgaaagaatgaccttttataaccttggctcaccccagtgtttggtcaaaag
-ttcgtttttttgccttcttcgttggtgcccatgccctgtcagacaattcaaatgttttgcccgtcgggaagcaagttttt
-ccgggccgcggcgattcactgggatcagcaagaacagaatgtggccaatcctgcaccaatgataacgccatgcttccagc
-cacaatcgtggctctctctcaaattccccagcgccaattcagaatggcttttctttaccgggctttacggcgcaatttcg
-aaaagcgaggttgctgggcgtattcaattaatgcgcccgtcaaacatactgctcataatgcgggaggtggtttgtgatca
-agcacagaagacgctggcgaacaggaggtaaacgatgaattaatcactttattgatctactgggtactctcgacccagtt
-gaaatattctcaagcgcgtagtttgggcaggattagccatgcgaagaaattgaccatcatctctttcttgcaggcggctc
-cagtcatcttccgtatcctggctggtggttttccagtaatgctttaactttgcctacagggacgccattactttatccaa
-cgcttgatctcttcgatgcgttgttaatgtcttcttcatgcaaagagtgcggtgtccgccttcactgcgctgtggtttta
-aacaaacgtagcggcgttgcaggccacggagagttgacaggattaatcgcgcaacgttcagcaaccataccaaaatgctg
-taatatagccacacattcctccttgcggtcacaaatctccgtcgcctgtacccgactccaataatactttgtacaataat
-agctacacatggtacaaagtataaataagatttcagctaaaatggaatgaaacattatttttaaatgtggaattaaattt
-aaacgtaaagcgtatttcatttcaacgatgatttactgaaatcatcagtgaagaatgtgctgaaaattattttttctgcc
-ctggccacgtatgaagggaataccattcaatttagctttagcaaacagatctcctgaaacatctcaatcctgcggattca
-agccacatcgcactcttctggtgttgccacgcccatagcactgacttgaattttcaagtgatgtacagcattttatgatc
-gcctgaataattgcctgccgtgccccacttttaaattgaacattgtaaatcaaattccctgactgatttttaattctgtc
-caggctggaagcgtgacaggagtacaaacgcagcaaaaacctgcgccaaaatgatcaattggctacactgataccagagc
-ctttagcgattaatcgcttcggcaaactgcatcaaacgcgagatatgacttccctttcagtaaaattcaacgatgatttg
-tttcaggcaccagcagcatggctttatttcattaagtaaaaaaagaggctgcgttcccggtttcgttaaccagggtcata
-ggtaaatagattgattgaaattcaattttatcaccgagctcaaagtgcgtgtgccatcgtgaatgcaaagcgccttactt
-ttgagatgccgctgtgtagatttccccgtctttacggctgcccaaccgctatggctgactggctatcttcatttttttgc
-acaatggcttctaaaagcgattatccgcgcgataagggatcgacaataggatgaaaaggcaaaagtggtcgtttaaatag
-ttggtgaaagggcaacaggaatcaagcttctttatcagatccgtcagcgataaaaagccaggagtcttccggcaggaatc
-tcgaaaattagggttgattgttcttgttgcaaggaacaaaagtacgaaaaaaattgtaagcgctctgtcatcataagtta
-gctgaaattttgattgtgcctttgtcgaatacggcctgtaacgtcatgcctcgctcgtgcaggcgcaaatttcaaataat
-tccattcccgctttgccaacggccgagcaggcgccgtaatcgcaacagctagctcccacaatatttatctgccgtggatc
-ctggcatatagcccgatatatcatttttaaccttgtctcttgtgcgaccttcccagaagctggaaaaaatgagaaccatt
-aaacatagtaaagaatctgttacgtcagactgcatgtttcctgcgatttgctatcggaaaacgcatttcttcgatttttt
-gacaggtttcgtcgtgcaacgtatatttgggctacgataaataaagggtgggtaagcattacacaatccagggtaatggt
-gaggcgagagtaaaaacggtaacagacataaatgcttcttgtgtcctttccttttttaataaccaaaacataactcgttt
-ctttacatttgaataaaaaatggaaaaagtttgaacactagttttggcgcaaaaaactcttgtatagatttgtcagttaa
-atgatgcaatatgttttattcataacaatttgttttatatgcatcagcactaaattgcaaaaatatttaatttatcattt
-ctgtacagcatatttcgagcaagtttgctattgttattcactaacattgattaacatttttaaacagaggcgtaagcatg
-catcaaaattcagtgactttagattctgcggggagcaatcactcgttactttggaataagctaacttgcatactcactag
-gaaactctcggggaaattggtgactgagattttgaaccgatgacgtaatctgagtcgaacagtcgctttgtgccaaaact
-tctttgccgactggaacacgcgacgtggggaagaggaaacagaaacattataatgcactaattgggttgcttttttgaat
-ttaatggcaacagcctgattatttaaacaggttagctatgcatcgttatgaagacatctgataaatgaacgtataaatat
-gaaattacttggccaggcggtgctccagatactgcgcatgaaagataaattttttcattgcaagactccttattaagcaa
-ttactcgtaatgaatccggctgaggaagatgcttttccgacgcgattttaattgacagctaattcgtgattttagccata
-gtgattcaggagggccaaaccgaagaacagcgacagctacaaataacaagtatgttcaaatggtaagcaaaaaataaaca
-gaatacattaaaatttcataataagatgagaggttaccgatgctgaagatactacaattcataattgcaataaactgata
-aagcgattagcaagttacttttcgcagttcgggtaatttggttaagaagaagaatcagcagtgttagggccaggctgtgt
-caccaaaatttaatggctttcaggcgataatgttaataataaaaatattaacttaaagtctgatacaactccttggaaac
-aacaagtgatcatttcctccacagctgatgttgattagaaaaaccactggaaatcggtgttgcgatacacagctgatgat
-atgtaactttctaattattaagtataagtttatagaaaactccattcatcttattttttttgttctgtcgctttagacta
-tatcacagcataattttaattgggttaatatttctacgaggctgacatgaataattcaatccaccgagagatttattttt
-caactgtgctttggtttaaaaatctcggagagggaggtgttccatgacgcatggggtatgttgatagtcatattattgat
-ctaggtttacgcttgcgtttaaaagatgaaaccagtgtgattctttctgatctctatctgcaaatattgcagtacattga
-aatgcataaggactacactaacaggatatcattattaatgacagggaatcccgtgctctcttagaattgagtaggtttta
-gaataaacatcagctgtatcaccatgctcgatgcaaagtgagcatttcaggcgttatgctttcttattatgtccgcaata
-tcaggtgtcaagaatggagagtttctcgctctccattcttgacgcctggatatcccgcctaacttattttgtcctgccta
-aacattaatgtcactaattaatgggttagatcaaggatggagaaaaattttatcttcggcgtggatatttcttatgctct
-tctaccatgcctctgttagatgccagccgcgaagcgaatgaatggcattttcatgtattaaaccctttggccggacaacg
-caaatgccgcaatttacactcatacccatgcctcgttgcgatatgcttgtttatttaccggtgtcgctaatttttggaac
-atccagtctggtattccccgcgaaaaagcagagtacctggcgggaagcgagatatgccgccaacaatatcaatcatataa
-ctttgaagaagcgttccacaagcggaacttcaaacagcggttaacatttgcgggaaggaatgcaacctcgaggagcaata
-tcagcttgcacctgaagcagctctgaaacctcacctgcgcaacaatcattgcaattcctccaaacagggtaatagtctgg
-tgtagcattcccatggcctgggaatcggtctgttgtctcgtaattcctgttttcccggacatgtcatttactgttggctc
-cagcaaatcgacacggttaatagtttactatcctgctctatcagaacgcaatttgcagatacgcgcattttggtttacga
-taagcgatcagcatattcgtggggcacttaaatgtaccttggaaaggggtaaggtatgtttaacgcgtgcggatgacatt
-ttattgacgcaacggggtgattgtgatgacgcttaatggagcatttatcctataccgagaaggtttccactccacaaaat
-atcatttcactatttatctttcacgccgccgtccgccactctttagcttctacagacttatcgataaaggctttgggatt
-tttttaatatttatttctggttaatcgcctgcggccgctgccttcctgcttgatagatatttcaaataaaaagcgcaacg
-cctgaaagagatcctgcgacgggcataaatttaatggggagatcgtcctttttagccacgctgttgggtaatatggtcgg
-aaagggacattgcggggagttgaggttgttagtcccagctggaaacacgctccacggtggatatatatcacccgcggcat
-ttaattccacttgcttttgaaaaatccggatttttaattcgttcgcttacgcaaagcgctgatgaatcaggttgcccaga
-cacgatgaaacgctatcatgcgagtaaattgccggaaggtttttcatattggaaataatttttagcgcttcagcatatta
-tttcgccgacgtttgtcgactgagtggttttaaattttccgtgacagttttaccccgcgcgaatttaaaccttgttctgg
-aagtcaccggagcgtgagccattgaaatgttgatggaaagttctggtttcagcggttgaacatactggcatgaaaatggt
-tttttgtcatgcgccactggatgatttcgggttactgctactcagggctttcttatcttcattgacctgcatattgattt
-atactcataaaattgattcacagttgtcgtttggccgtgcgtaaagcgcagtccccagaatcaaccgaattctggattgt
-tgtattggatcctggcgcgtaaactttccgatcagtatcgtcgctgaaggtgtcgaacgaagaacaacttgactatctga
-acaaaattaatatcacatttcagcagggtttattatttctatacatctgttacatacatgcgacctggtccaaattatcc
-tttctaaaaccgaaggtgaaggttgttggttgagtgaaaattgatgcagtcaaggccatagtgcggtgtaaattatagac
-agcctaattagtcgttgcctgcttgttactatttgttcattatttttgtttgctatataattgttgaagtttgagcagga
-ttgcatttagtaagcatgaacaatagtaataatctgggatttattttcactctctatatatattttccattgcaaatttt
-atgatgattcacactcctggtcatgcttattgcaaaaccccagtacgggctcgggagaagtgctttgtgaccgataaatt
-tgcttaatgccttgttttggctggcgatcaatctggttaatccgattaagagaaagacttcgtcaagccacagggatcag
-cataatctttcagtttctcactgtcagtaatgcggcctggaaatggtttgctggcaaggtggaacgccttggatcattga
-aggaaaggcattattgccgcgcaatatagttgtcaccctggtggttatcaaggttgttttttatatatcaaccgaaaata
-atcctcatgcgcaactattaacgaattttgattgtcgaagaagttatttgtttaaacaaaatcgtcacctcaaagtgatc
-agatgtccaatgaaaatacggtgaaaaaatggataatgccgacttatttatcattttatatattgtcgctgtttatctat
-ttaaatttttttgtgcttttgtttttgtcttttaccctccgttttggttaatctgagctcataggtttttatttgacgca
-ggaatgttttgttaaatccaatgaatggatggttaaatctatggaaactgaaaaaactcccgggtttagtttgggactta
-ttggctctggcggtgggtaatgcatatgccaacacaattgttggatgatttaatagtaataatttgctatatgactgaat
-ggaagaatcgccgattttgaaatcaaaggataataatcggcgataagtatggaagagtatcttaaccactgaagacgaaa
-gcatgctggtgaagtggatgacggtgtaactggatattatagaataatgccagtgggatgactagtgtgatggatcctta
-tggtatttctgttgataagtcaaccacaaagtattatatataagcgatagcgatattaagacgctctggaaagccgtaat
-tgctgacaaagaaaaggagggataaacagccagcgcagtagtcagtgaattttgtggtcacccaaatctttatgaatggt
-gataattccaggtcgaagtcgggtggggcaataattcagcgggacttttaagcaaggtttaatgatttctgaaagatggt
-aaataacacgccgtcttgaaccacaagataaaacgaacattgtttacctctggggaacatgcagtagggggtgtttcttg
-catgttcaagtcctggagagtctcgaacatgtgtcgatgctgtagatgatgaagttagttgattctaaagttacgaagtt
-attagcccgttgcttgatttaaaaatgaatgtggttccatcacaactaatggcattatagctatggtgcttatgcttaat
-gggcaaagcataatattaatttaagattatgtgcacttgaaactgtggctgatggaagttatgcagttgctattcgacaa
-ggtaaacatgtgatataaaaaatagttctattacaacaacaggcactaaagcccccattggcataaaatatacaatggtg
-gagagttatttttttccaaatgtcaccggcggtatcaaaacaaagataaaggaatatcaattgaatgcatcaaatattcg
-attctcaagcgcaaaaatagcaactattaagtgttgaactttcaagtgcttttggatagtattgatgttgaacaaaaaac
-taaacggatgtaagtatccttaatgcgaagtattatcacaccatggtaataatgttctggtttaataatactggaggtga
-cttaatagcataatttcgtccgactctattctaaatggagcgactaaactgtcagcggcagcaaccacgctggaagcttt
-caagaaaatacaatctggaataatgaaagatgactttcgtccgttgttaccatctgactaattccgacagtcattaatca
-atctttcgtatgatgatggtcaacattacccaaggaaaaacattaaccgtaaaaggtaattatgtcggtaatatggtcag
-ctataatatccgcacgcgtattaggtggatgataaatcggctacggacagacttattgttgaaggggtatatacttcggg
-gttcaaaactacgcgtctatgtgaaaaaatgctggaaggaaagcggcgcggcccacgctaaacgggactcgacctcataa
-ctgtgaatggcgatgatctccagcagatgccttcagataaggtgatgcaaggattgcagctggagctttttcgtaatatc
-aactaaaacaacaaaggcaaaaactggtattgacaagtttatccagtcatgaatgaggaggataacagctcagagggaaa
-ttcagaatcaacagaaacgcctacccccgtcctgcgcccagaagcctggaagttacgtgctaaccttttggcaagctgct
-aacactctttttgttatgcgtgctgaaacgacgcgtgggggttgaaacgcgctaccatgatcctgtaactgaacaggagc
-gttcaagccgcctttttggctacgtcaaattggcgggctataatgcctggcgtgacagcaacggacagttgagaacgacc
-tcgcatatcgcacgtctcggcagtttagggggcgatctgtttaaccgagtggttttttaccgatagtgacagttggcgtt
-ttgggagtgatggctggttatgccgcgcgactacaacttactcatttcccagcgtgtcggattatcggtttcgaaaggga
-gtgtcagagggctatagcgcagggctgtatgccacctgggtttgccgatgaatccagtaaaaaggcgcatacattgactc
-ctgggcgcatatagctggtttaaaaaactcggtgaaaaggggatgaattagcctatgaatcctatagcgcgaaaggtgca
-accgtctcgctggaagcggttacggtttttgccctgcataaatcctttggtctggaagcggcgaatatacgtggatcttc
-cagccacaggcacaggctatctggatgggcgtcgatcataatgcgcacacggaagcccaccatggctcacgtatttgaga
-atgaccgcaaaataaccacatccagacccgactcggcttccgcacggctttattcgtactcaaggagaaaaacaggcggt
-ccgcacggtgacgacttgaaccttttgttgaaatgaactggatccattaaagtaacaaagattttgcgtctcaatgaacg
-gtgtgaaagtcgaacaagatggggcgagtaatttgggggaattaaacttggcgtaaatggcaacctgaattgccgcggcc
-agcgtctggggaatgtggcgtgcagctgggtgataatgggctacaatgaaaaccgcgcaagtgatggtgggcctgaaata
-ataagttctgatccgccgttagctaaaaaaccgcgtcgttattcatcgacgcggtacatattgaaatattattttttgcc
-gataagcacgcatgtgtcataattggccgtgatcaaacagcatttgcgggtctttagcgcaacctgatttcagttttcta
-ccactttgggctcagttccggagatgctcattttaaaattcaggctgcaaacgcttggcattacccaattttaacgcgca
-acaattttctgcaacctgtgcctgtcagtttttttggccatttcgttggcttctgcgcaagtaatatagggtttctgacg
-gcagaaacgtttttaatattgtagtcctgcccaggtccatttgtgcgaaaaacataaacaggcccgccagtaaagcaaaa
-tttttttatgcatcaattccttatttcattttaccctgagaattgcaccaaccgcgtaccgccaatgcacggcacctttt
-taatcgccgcttcgaggccattgccggtcagaaacgccagtgccagcaccaacggcggcacccacttttgcacctttacg
-cgcagattttaccgtcgcggcctttttctgtttctgcacgaacaccagcgccaacagctgcaacctttcagtacgcctat
-taacaccattggccagtaaaagtaaacaaacgctgcagacatacgaatgcacctttcggtggtggcggttgcatatccgc
-catcgcttggcgtggaagcagaacaatgctgagttagccccgaaggcaagtatttttttcttcacttagattgtccggtt
-tattaagtagttgcacacacaataaatttcgtctccaattaaagattctgcttactaaagaacgcctcgctattatttca
-gataattcaaaatttgggagcgtggctgtgaatgataggaaattaatgttttttattcttctttttttaacgtggggaaa
-aaaaatgaaaagaaaaaaaaaatacacttccttttttttaatgaggacataactcattgattgacaatattttttatttc
-aagaagtgtcattgactgttaacgcatgtttgtaaaggtaagataatctgatttatgcatattattgtgtctgaattttt
-atgtggagcagaagaatattcatcccagcaacgatttacatttagtcatttttattttggccggacggccatcattgtcg
-caacagactacagcgtacgacagttattatcagaaaagagtgatttttttatcagcaactacacttcagcgcactggtgt
-aaaaaatgcctctttcttatgcgggtatgcatcatttccatcaatgatgtctttggtgagcgtgaacacaatacacacct
-gccgctgttctcttcaggatgaaatccactcggtctgggtgcctgcgggctgatggttgcagcagagcttaggtcactta
-gacgctactaatcattttatcccaatggcatggatcgaaatcagtcgataccgcaagtatatatcgtgaactgggtgcaa
-cgctgagttacagacatgcgcctggggaacggtatggaaatgaacctggctgaaggcggctgtgcgcaaaagtaaatttg
-gtcgatgataaccgggtgaaggtgaattaatgacggtaattttgtcaatgatttgtcgggcagacgtggaatataccagg
-cgctattaaagcctcattcagcataacgtttagcgacatctcggggtggggttaatagccatggtgcggtgtggaatccc
-gtggaacgcgtgcttggtgtggaactcgttgctttatgaactcaacgattaaactgcgctttcggggcgccagttttccg
-gtttacagatgttgaatagggaaaatctgggcaaaaaaagcccgccagttttttacggcgggaaaacctcatcctatggg
-agaacaatgaataattgaaaatttgcggggtttatcatctcccagtatatccaatactaacaataaggttactcttctca
-acgcaggcataaacattttgttttggtggggcgtggggaacagccttaaggttaaagggggaggtggaatagcaaatgag
-gaggtattcagcaagaatactcggcccgctttaccacaacgtggatgagaggggatgaaaaactgcaagggcaagagata
-actctgcttgaagataaatgcgtgcttttatcagcggctttaattttcaggctcttctgcttccggtaagtcacgttcag
-ctcaagaatagaaatatcgccatctttttgctcaagctgtacggttttaccgatctcaggatcaatttgtacgtatttac
-aaatgacctcagaatatcttttacgcactgcggcagataatgccggtttgcaatcgctgcgacgggttcagcaagcaata
-atctgcagccgttctttgcaatgttggctgtgtttttcttgcgcgcgaggagaagaaatcgagtaatgccataacttatg
-cctctcgaacaagcgtttgaggaagactttcttctcctcttcaatgaccagccgtaaaggacgttcttctcccaacaaga
-cgttctactaacggtatctgcgtatggcttttacccgcatcgcgttaatgtcgagaatgaccggtttcacaccctggtta
-gaggcgcgcaatactgattgatcctctggatgcacgccgacgaagttttgaatgcgcaggattctcacagccacatgctt
-cgcatgctcagcatgtcacctctgcttacgcggcctgggttatagcggcgtttaacagcaggttgcatctttaataggct
-ctcgccattttctgcgcggccgtgatttcgacgccagaatgccctaaaaataacgtcagagtcccgcgtactgaggagac
-tccgggtttggtggtaataatggcttcgttctgcaaaatagagtggcgcatttaacgcaccggtttaaaaatcctgcggg
-gagtcacaaacgataaattcaaaatccatcgctttcaagatcatcaagaactttggcgacgccttcacgggtgaggttca
-tctttatgcgtgtttgcgatgccggcagaatatagagaaattttcagtacgctttaaatcttttttaattaacgtaacgc
-cctgatttaggcgttgcatgccctgaatgacgttgacgaaatcgtaaacgacccggcgtccacaacccataaatcaggtc
-gagattacgcaaaggccgatatcaaaatctatcacgacagttttgctttccttctgggccaaaccaagtggcgatggccg
-cgctgggaggttgtccttaccaaacccccttttgcccgaagtaacaacaataatgcggtgccataagaatttccttgtta
-aaaagggatcaattttaacggttgtaacggtcaataagcgttttcgactaaactgcagtcgcgccgctttgcccataaaa
-ttctgctgggatttgaatcactcagccagtattcacctgcgatggacaccagtttccgccatgcaggttcgtacaaaata
-tttgcgttttcccgggtcacgcaacttgcccctgccagcgcacgaccgcgcatacatgccatatgacatgaaaatgtttc
-ccatcggcatcaagttcggcccgcagcgcttaaccggtggcttgtaacaatcagatcacattgtggagcataaatacgct
-gaaccggaacgcaaccgcgggttgtatctatttaaacgcgtttttgtgaccggcgttgtatttttgcgctggagcctgcg
-gtgtgttggcctggcaacgtggcgctttttccccttttccttccgtcaggataggcagcccatcttttccaatttcggct
-ttaagttgcgcatctttgcagccacttacgccaaataaccccggcaaccgttgccgaaaccgcctttatgcatcgctgac
-caggttttaccggtcttccagtggcctgacgttgaagttacaacgggggcatgtttttaaaaatgggcgggggcgctgag
-ccgattttgtcttccagcgcctgatggataaccttaaggttctgcctcaatgcagatgaaaagcccacaagaataaagtg
-aagctactgcctttttcaagctgcgattggccgtgttttgacatcctggccttatctcaattagctattaatcatcgccc
-atgcgcgcgatgaatgttccgacgactataaggcatgttatagtctggattattttttgaggcaagtcaaccctcccatt
-tattcagagtaaaagtctatctgtgattaaattggcgctgattcatagcttaaaaaatccccttgtcaatcaaacccatt
-gccgtcgtacttttgattgttcttatttacgcttcctttttccgcaccctaaatcgtgccagcatctcccagacctgttt
-aaatatccagtattgaggcaagtgggttaatttttttcaccacgccaggctttccttactttccattttttgcgggcatg
-cattaaaagaacacgatacccttatcttaaatatccgccacagaaattgctctatcatagcaaaccgcagaagacgtccc
-tgatacttctgtcaggtcatcgtaactcgtcaggtcagcgggtttttgattacggatttgatgatgacatgagcataagt
-gttgtacggttggattatcaggatgtgctatgaataatgatgcgtaaatttttatatattcggtattgtcaggttgggat
-gccatgttctcatcaatggcgtctggaaaatgacgctggcggacttcaatctccggcgtgcggcgtttgttttgcgcgcc
-gtatattttgtgtgaactcagtatgtgcaatttccccagagttaacaaggaaatatctcggcgaaaaagccgctgaaaac
-cttacaatcattaccaggctacgatcccagcgaatttacattcgctacccggtgtatttgcgatgttaaagaaaaattat
-gtcgtgatgatcgtttattttgggtgtggattggtacgcggagtggaaaaaaatcaatcaaaccacgcacaaagatgtta
-tttattgtgtcgtgagtgatgtcttgttttacattatgtcttattcgtcattaacgggctcttggagcgacacagaagag
-gagttgggggcattaacgtttatgacggggaagagtcccgtcgttgacatttacttaatttgaatatcgacgtttatatt
-ttttagttttgtttttacgggcgtcgtttcgggtttgcaacaaactcgcagctcatatttgccagaagcagggagtgagt
-attgtcccgttgtgactatcgagtttggggaatatctggataaatcaactggggaatcatcgattctggcccgaagaagg
-taagtaatcagcgccttcattagagatactccacatgcactttctgactttttttggcatgagaaggtatatagtatctg
-taatcggtatccctttattttcgccgggagtactgagcgctgcttatggcttttctgaactcatgaacattgacattcct
-acccgcagtttcaaaagctcgtggaggttagcagtgcaagcagcaatacagcttacctgatgctcttgattttcattggt
-agtctcctgtttcagcatgagtacgatgaactgttataaatataacaatcggcctaaccagggagaattccaattttggc
-tttcctgcgtttttcgtaacatcacgttggcgtgggcattttttgccggggggattacttataaagggggcatggactca
-acaaaccgtagaaatctagcagctggctggcttgtggcgcgggttttcattgagttagcttatgccaaaacctggccatc
-ttaaagagtaaagtatgtttttgtgtgatttaatcgaagcagcaaagcgtgaccagactatttcatatgtcgaaaaaaaa
-agacgatttttcgcgtgttcctgaggaactgatgaaaggttttggtcagcctcagttagcgatgattcttgcgctggatt
-ggggcggaagaaactgtcaatgccgatattgaaaaggttaaacaggcattaaccgagctaaggttactaatttttggcag
-ttacgccaccaaacccgaagatttgctgaagaaacaatctttccgtcatggggcagaaaacagagcgacactaacaaata
-accgctatccggcggtgggcattatctttgtcggcgcgggttttttccaatatccgatacaggtgaggggaacgttatgt
-tatcaacatcacactggcaggtgcgctgctggattatccggtgagtaaagtagttctggtggttggcagtaaactatgca
-aacatattaaagagatggagcagcgcagtgcccgaagagccagtgctgtttattaaactagaaacggcactgtggcgatc
-tgcggcagccatttggcgatcccattccgcatttcgttccagttcaatcatgaagtcgaaacttggcggtgtttgattgg
-cgcgaacactgcgtcaggctacggaagagcatgtccgcaaagccattgccggtttatggcgtggcgctcgatctgacatt
-gcgtgatgttcagggaaaaatgaagaaagccgggcagccgtgggaaaaggctaaagccgttttgataaactcttgtcgcg
-tttccgggttttattccgcgcggcggaattttaccggcgactccgcaaaatacaacgctgagcctgagcgtaaaccggcg
-aagcaacgcccagccaaggtacgactgcggactgatccataaaatcgtttcgctgatccgcttatatgaagcaaagtttt
-tttttacccttcagcgccggtgacgttgtgttgacaggcacgcgctgatggcgtcgcgcccgttgcaaagcggtgattga
-gctgaccagtcagcttttcgatgggcattctttgacaactccgcgttttgtaatacttttttttgccgcctgaaagcggc
-ggcaaaacttgcaatcgctgtggccagactggttataaggtggcgtttttaacgtaatcggcggaacccctgattgagcg
-atgtacctttcttggcaaaaagtaaaaccctggacgaaattgagcgatgcggaatgggagtccgtttgtgtgatggttgc
-ggtcagtgtttgctgccataaactgatggatgaagaacacgacgaaatctaccttcactaacgtcgcctgtcgccagctc
-aatattaaaacctgtcaatgtcggaactaaacgaacgtcgtttcgagtttgaaacccgacttgcattaaattaacccgtg
-aaaatctgcaaccattcgacatggctgccaaatgacctgcgcttatcgttttgctggcggaagtacagatttaccctgcg
-tggcatcgcgctacttaactgtttcgaaagcggcaatgcatggtgaaagcgtatctctgtgcgtcaatatcgcagtgaaa
-gaatcagaagtgattgactggcaggatcatatttaaataaaccttactgggcgcagtgtattaaatttaatagaatgctg
-aggggctttcttaatatacgtctggattttgctcgccatttttcgtagccccctgttttttgaaacagcgctctgtcata
-atgagagtttacccgataccttattatcaacaggtaactctatctttaaaaaacgtctgtgttttttaaaatgtgataaa
-ccttataccttgagtaacaatggagagaataatcgcttatcagaacttcaggtacctcaagagtgtcctttttacgtgtc
-ttttctgatactcattacaggttgtttaatccatttttttggcccgattctttttagggcaaagaaaagcattaaatcaa
-tcataaatcaacgtagaatctgtgtttgtttcagtttccgtttttttatctcaccgatggcgggctattttcggtggtta
-atttcaaatttggcggcatcgatatcttttattcgctttgtttaaccgtgtttagacagggtggtaaagaaatttctgca
-cagattttaacttgtttctttcaattcttggagaaatcagtttttcccttcactacgcccggccagcaatagaataggaa
-tgattaatgccaaatggaccggcgacgacaccggcctgcggcaccggcatatgcctttccttctgattttaatcggtacc
-tgtgacgtggaaatcgctgcttttttctgaaaaacattggttaactgctatctaacgccagcagtttcccggaagcgttg
-ttgaaaacttttgtgagcttaccagcagggatttttgcgcttcattcagctcggtgatgccgtccatccagtacaccttt
-aaatgagaatgtctttcctgggcggatagctttcttctcattggtactcattcaaatagcaaaatatacgctgcgagaat
-tgcgtcggcaacacgacccattctatacactggtttgggttgcttcaaatacttatccctggctatccatacagtaaggt
-tttaattatcgccgactaaaacggaggctgcctgtgaatactcctgtttcaaagcgacttaactctttttatggtttcat
-caaaggtctgccaggggatgacctgatccggagatatttcattataaagatcttaatgctccatctgcggtttcgattgc
-gttttttaactaacttctaaccgttttatttgcaacgattttcagtgcaataatcaattcgcctcttttaaatatataaa
-ttagtaaatgaaactcgtctgtttttacaactattaataaaatttttacttcatctaattcatagttatgccgggcggga
-tgcgtcaaatgtccttttatttctattaatatgataaatatcaaacaatgttaatgtcaattatggcgaatgcttctatt
-ctattttttatagccggtgaatatttttttcatttctgctggatgagcgtccgtcgccagaaggccaccgtgacacaaga
-taagagaacgaaaaatcaggcagccctaatgcagcgaacaatattgatagcctgaatccataattgaattctgctggcaa
-gaagacagactactgtatataaaaacatgtataactttcaaaggcagattattaatgttgtttatcaagcctgcggatct
-ccgcgaaattgtgacttttccgctatttagcgatcttgttccagttgtgggcttttccttcaaccggcagccgattagcg
-tttgaacagcgcaatcgatcttgaatcaactgttgatccagcatccacagcgcgacttactttcgtcaaagcaagtgtgg
-attcctaattgattgatggtggaattagtgactgtgatttactgattgtcgatagcgcttattacgcgcctagccatggg
-tgaattgtcatcgctgctgttgaccggcggttttacggtgaaaaaattggcaactacggccgacggtacatgcctttatt
-ccatgaagcagcggcgtactcgccattaccatcagtaagtgagatacgctggatatgtctttggtgtgcgtgatgccacg
-cgtcgttaaggctggcatgcgctgatgtttgccctctgttgatgtaaacgccgttttaatgcaagctgttgagacggtgt
-ttcgccgctgatttatggggtaaaccggtggttgtgctctcgaataatgacggtttgcgttaatcggcccgaaacgctga
-ggcaaagggcgcttggcgttaaaattgggcgatcctggttcaaacaaaaagatcttgtttcgtcgctttgtggcgtggtt
-gcttttagcagcaaattatgagtttacggcagacatgagcaatcggtgatgtcgacgcctggaagagcatatcgccccgc
-gcgtcgagatttacagtatgagtttgaggcattctgcgatctgacagtgtgcgtaattgtccgcgatctgaactgaattt
-ggcagagaaattcgccgcaacggtgctaccactgatacgtacgccatctactgttggtgtggggatcgcccaagaaccaa
-aacgctggctaagcttgccaatcaatgcgcaaacaaaatggcaggcggcagacgggtggggtggtggattttatcaaaaa
-tctggaacgccagcgtaaattaatgttgctctcccggcgtggatgacgtccctgggggatttggacggcggatcagcaaa
-aaccaactggacgcgatggggatcaaaaccgttctcggattttggcggatacagatattccggttttatccgtaaacatt
-ttaatgtcgtgctcgaaagaaacggtgcggaactgcgcgcggaacacttttgcaacttggaagagttttgcacgcgacga
-agcaggaaattatctgtttcccggctcgtttgggtgacgcatcaggattatccgtcgatgcggcatgggggggggggggg
-gggccatttgtagttacgggctgccggcgggcggcggaaaaacttcgcagcgagcatcaatattgtgcggttatctccca
-tcgttttattaagacgtcacgcattttgcgctcatttgaaccttatttacggcaatagcgcgtcggtaaaaactgctgac
-gcccactcagggaacatgcagggatatcattacacggctgctaacgcgatctctggatggccattctggcagcggggcca
-tcgtttaccaaaaagcgggcgttgatgcctgggggatttctttcagtgcagggagtcgccgcagctcaaatttattcgat
-gaacaagcaacaccgcgccccgggagtgagcaattgatgacggtaatggatacactgaaatgctaaagagggccgaggaa
-acaacatctatttttgccgggcaggggatcgccagccaacaatcggcagatgaagcgagccaatgctttcacacgtgtat
-acaacgcgaagtttctgatttactgagggtcaaataactatagcgggcaggaaaaaaaagcgctcccagcaggagcgccg
-gaatggattagcgaacgcgaacagattcacgtttttttcggctttaaaacgggctgggaatcaccacacacaagcaacct
-ggcgacaatcaggtaagcgataaaaatagtcgagcaagtccactgcggcatttccagacctaaaaaattcccactgacgc
-ttcggcagcaaatccgccagaggcgacaaacactttgcggcacccacttatccagcggcagccattccggggaacgaaac
-ataaaaattcacaggggtttgcaaacggcggtaaggatagagctgaagcatggtgtgctcgtaacaagttaaactgcaca
-ccgcggaacgcactaataacaagccagataaccatcgctaaataacgcagcggagttttcggggcgatcgcgcgcatcag
-cgcagcatcccagaacgccgaataacgccggcagcgttcataaaatacaggagcacgcaggtttcagtaacatcacatgc
-tggaacacagcgctcgtcagttcagtgccagagcagtaaacgccattcaacagccacgccgccccggcccttgtgaacat
-tggttcaaaaatcgcaacataatgcaatttccccctgcaatagtgcatagagtgcgcagtttaaaccaattcattagctg
-cgccaccaggagggcagcaaaaataggacgcaattggacaattatcgggcgaaaaaggcaaaccgggcatttatatgccc
-gtaagttgttatcaaagcgtttggctatcagccatttgcataaacgattcggtttacagggcaagcgtaaactgcgacgc
-agagcaatgccgcgacgagtgtcaggacgagggtgtaaggcagggccatccacaccaaaaaatgcggccataagagaggc
-gaatcaatggcggcgagtgcagaaggtcagcaggaaacaggaacggcaagcctgaaccgtttgtcggcggtagcgacgga
-gggcagatttggtacccaggtattaattggcggaccgccagcagctcgtattgcttcaaacggtgatagcgccactttgc
-cattgccgctttcgcttccgttgatataaatcgtcccgcacgaagacgtttatccgaatggatgacagcagaccgtttga
-aattaataagaacagcgacaagctgagcatgttccgatggccctgcaaccacaaactttgaataattggccgaaaacagg
-ttgttggtcgatatcaccgcgactaccgagaaaaacaccgtcaacagtgggcggtgaatggcagagattcggtgaaggct
-ttaccgatagcatgcctgcatcgtgaacacggtcaatgatgtttgttccagaataacgactgaacaaaccaatgcaagcg
-caacttccgccagatgcaacgcgcagcgcagtcacgcagcagacgccaaataatcgcctggacaatcagacggattttat
-gcctgacgggtacggcctggtgcgggcttgatcgtcaaactgttgcaacacttcgcggacttttctccggcagcgtttca
-ccgttagccaaaccaacggtgcagcttcttctacgcagcaggcaggtaaacaggcaagcaaatcagaaccggaacggtcc
-acgcggcgacatggccgcaggaagaaatcgccaaaatgccagccagccgctttaagcgattgaatcaggttctgtggttc
-gcccaccacttggtcatgtacgccgcctaatgcggtgccgactccggcatgcatcatcaaggctacgcagaaagcccacg
-gaacctgttccagaaccacttttgtaatgcttgttcaatatgactatgcggtcttgccaaggtcggtgtcttcggtacgg
-gaagaggctacgcgtgataaataccataaaaaccgactgcaacgctgattcaccacggccacgacgttaggcatcgagga
-acgcgggagaggaacgccgcccgccacgcaaaagagagcgacagcagcatttttggagcgaatgctttaacaggtcaaac
-gggtaaataatgaaacagcaagcagctgtttcaataaaatagatacccgccaccataaacatcagtaacagcaaagactt
-caagatttgcggccaaccgatcttcacggacgtggttccgcgctggtcagcgatgaataacgcgcttcgactagccaaac
-agaccagccggggagcaaggcgggtagcatttcagggcatcgccaccgaagtgaaaataaattccgcttaccagcaacca
-gccgcgacgaaagggctgatgaggaaaattaacggtttacgatttaagaaaatgatgaggcgagttttgtaccagtcggg
-ggactggctccaaaaaattgcgcatagcgcgcgcccacggagattctccatgatggtttccttacttacaaataataatt
-gatgtttttatatgtttaaacgcaaagcttaacggttcagtgcaggagtgaggcaagtcttgatagtcaaggggacaaga
-gatgcggaaaatgaagccttgatcccttttttcttctttttgtctgctatcaagcgttagtttagccctctgtggtaatg
-atgagtccaactttgttttgctgttggttatggaaatctgcagctatggtcattaaggcggcaaagccccggcgggtttc
-gcggaagagtacattattgaaagtaatctggaataaaccgcttccctcccgggactattttggcccagcagaaacgtgaa
-aatttcagaattaattggcgtaaacgcgtacctagttacgtgaagtgttacagcgtctggcacgagatggctggtttgac
-gcattcaacatggcaagccgacgaaaggtgataattttctgggaaacttccggttttaaatatcttgaacactggcgcga
-cggatcacagaaaagtggtgcgcagctattgataattttgctgtcgggtgcgtaccacatgtaatttccactatttttat
-tcgcaaccgcggtttcgtcagctatcccgatttaagcgcaggcagtgctgcctaccgcttaatgaagtggccgatcaccg
-ccgatgctttggcgatgcctggatttacaacataattcgcggcctggcgtttgcttcgcggcaacccgatttacggatct
-gattcttaagcgggatgaaagggctgtaatacgcgtaaattggtcgtcactatttcgccaatccggaagcgcgcagtctg
-gcgctgggcttcttacgcacaaactgtcggcgttttgtgcagtgaaggcgcgcaacgatcaggttgtacgaaacagtggc
-gtcgctattttggcatgagaggtggcgagatttggcacaggattgcagaaaaatctgccgggtgattagcattcagggcg
-ataatgccttccgtttaaagaagcaaacccctcaaagcgaaggggttttttgttgtttttacagattttcgccattcttg
-cgggcaacgttccagcaacttcgatgctggcgtcttcgtttttttgcctgtttcgagcaatcacatcaaatgccccacag
-gcgatgcacatgcttcgaggaactttctttgggcccccgattccagcggtgcgcgattatgtggaatataacgcagcgtc
-agcgaaccggtcgccgcgcaaatccccacgttccagattctgaatattcggctccagaaatttacttagttatatgcgac
-gataaccggttacggatctcccgatcacctgtcttcattaatgaatagcggaaatctccagataaattatgccgatcgtc
-atgcccagcacggtgaagaagggaaatcacgcaattcactttcggtgacaggaactgctgataaaactctcatctatgaa
-atcacgcaatcgcgaaatgcaagcgtttcccagccagtcggaaccggacgatatccgggaaccaagtatttgtcttcttc
-cgttggccgactgacaaatccgtttttatatcgctggatagcatggcggaccccgagggcatagggttgatgcgctgtac
-cacgggctgttatagggggctggaagaccacaattggtgtggctgtgcaaaaactccagcataaaacgttcgcgttttac
-tttcccttcatcaatcatacagatggttaaggatggtgtagtggccagaaggttccgcccagaccttcgttcatcatcct
-gaagtcctgttttttgcgaataaaaatactggctcaaccttaacgctacaatacgccaggatttcacgctgccatgattc
-cagcagtggcgcatttttctccataaaatagagcagggttttctgtggtttcgacggatagcggcgcgcatttcagcaac
-cgtttttcctgcttcctcgcgcttgttcggcagggtaacgtccagagcatattgacctgaactttgcagattactcttcg
-gcgagcttttttctgccgggctttcttcttcttgcagcgagatttttttgcgggccgtttgttaccgtgccagcgccgtc
-agttcatcagcgcgtggcccgaaagtcagaaagcgcgtttctacttcatcaacgcaataacgctctttcgcactgcggtt
-aatatatttacgggcaaaaattcagataatcgacatcgaacttggcgtcggtccagctaacggaataagtaattgttttt
-gaaagaagagttatggccatagcagaggcatgagccatcaccagcgctttgcatgggtacatggtgttctcttcccatca
-ggtaagcgatacagcgggtttagagttatatgacgatttcataggccagtccttgctgatcggcgtgcttatacagcgtt
-cagtcctcgataaactttttaccgaattaccagtgcggataagttaattggctatgccgacgctggagtaaggctatcca
-ttctcttgttctgaggttatcaaacttcaatctggtgcgggtaggttaatccgcagccgtagaggtttcgcacacccggt
-ctatctctgcacagataaacatccagcaggtcgaacgtccagtccggtccatcgctccaacgttgtggtgtccttattca
-tagaatcgatcgtccgcctactacgcgcacgctcttgttgtcggcgctcttctgtgtggaggcaacctcatttcaaagca
-tagaacacctgtttaaaccgcgtcgccggagaattttttttgcttatgcgatttcttattatcagaagtggccactaatc
-cggctctgcacggaattttatgctgataaaagggcgttcagcaggagatactaaagacgccatattgtccggcagagtca
-gggaagatgtgagccagctcacgcataaacaagccgcatgttttgaataatattttttgccaactgagttatcaagatgt
-gatttagattattatttcttattttactgtatctaccgtttatccggagtggctatgcgagtttgtcatactggggaagt
-ggtgtggtaggcgttgccagcgcctggtaacttaattcaggcaggacatgaggcatctctctcagtgatcgggaagcggg
-ggccgcctggaaaccctagtgccgcgaatgccgggcaaatctgcacccggatatgctgcacgtgggcggcacaaggtttg
-tgcgctttaaaagcgttaacttatggatgttccagcgcccatggcgcccggctggcggtttcgtctcgaacggtagcagt
-ttcgcagttgaaatggatgtggcaaaaatgttacgtaactgcgacacaccagccactactatggaaacaaagggcggatg
-gttgcgtctggcggaatagcagccgtgattgccctgaaagcattgcgcgccgaaaccaatattcagtaatgaagggcgtc
-agggtgggacgcctgcaactgtttccgtaccgaacaacagtatgaaaatgcgacgccgcgatatcgccgtgctggaaaga
-tgccggcgtaccgtatcagcctgctggaaatccagcgcctggggccagtggagccccgcgctggcagaagtggcgcacaa
-actgacgggcggcctctgcagttaccgcaatgatgaaacgcggagactgtcaagctatttacccagaattctggcgcgga
-tggcggagcaaggcgggggttaaattccgctttaatacgcccgtttgaaaccaaactgcttttgcgaacggcgagcaatc
-ttacggcgtgaagtgtggcgatgaaggtgattaaggccgatgcgtatggtgatggcgtttggttcttactcgagcggcga
-atgctgcaaaggcattggttgatattccgggtgtatccgcttgaatagctactcgctgaccattccaattgcgcaggaaa
-gatggtgcgccggtatccaccattctgatgaaactaccaaaatcgtccattacccgttttcgataaccgcattcgtgttg
-gcggaaatggcgaggattgttggttttaataccgagctgttggcaaacagcgtcgtgaacgcttggagatggttggttcg
-ccgatctctatccacgcggcggtcatgtcgagcaggcgacctttctggatggtctgcgcccgatgacgccaaagatcggc
-acgccggttgtcggcgtacacgctttaaaatctgtggcttggaacctaccgggtccgcacggctcggctggagcgatggc
-ttgccggttcgcggtcagttgttaagcgaatgctgctttctctggtcgacgccagcgatcgccatatgaggatctaagcg
-tagcgcgctacagccgtggatttacgccatctacgattccgggccatttacatggcgcacacagctaaggaacacgagat
-gaccgtcgatacaggccagccctcgatctgcaaggcattaaaaacagaaatctgtcagcatttgtcccgccagggccgcg
-acgcacgcgcggcgtctggttcggtggtaaaagcgaaagcttacgggcatggtaattgagcgtatctgggagcggcgatc
-ggggccacgcgatggcttgcattgcttttaacactggaagaagggcatataacgttacgtgttagcgcggctggaaagga
-cggcgatcctgatgctggaaggaatttttccatgctcaggatctggagattttaatgaccagcaccgcctgaccacactt
-gccgtacacagcaactggcagctcaaaagcagctgcaaatgccgcggcttaaaagcaccgttggatatttatttaaagtg
-aacagtggggatgaaatcgttgggcttcagcccgtattcgcgtgcttaccgtctggcagcagttggggcaatggcgaatg
-tttggcgaaatgacccctgatgtcgcaatcttttgccgaagcggaacatctgaattgggaatttccggcgcgactggcgc
-gtattgagcaggcggcggaaggggctggagtgtcggcgttcgttgtccaattcggcggcgacctctggtggcacccggaa
-gcgcattttgactggggtttaggcctggccattattttgtaggcgattcgccgtccggtctagtggcgtgatatgcagcg
-caaataccggaattacgtccggtggatgaacgctaagcaagttgagattattggtgtccagacgcttaaagcgggcgagc
-gtgtgggctacggcggtcgctactactgcgcgcgaatgaacaagcgaatcggcatgtcgcgcagggtacgccgacggtta
-tccgctgccacgcgcctaccggtacccctgttttagttgggacggcgtgcgcaccatgacggtggggaaccgtcctcgat
-ggatgttttttttaatgctagcggtcgtcatttaacgctcttgcccgcaggccgggttattggtacgccggttgagctgt
-ggggcaagggagaatcaaaattgatgatgtcgccgccgctgccggaacggtgggctatgagtttgatgtgcgcgctggcg
-ctaacgcgtcccggttgtgacggtgtaaaacttgttgtaagccgggatcggaggcaagtcttctggtgcaaaaaaacatc
-atgccatccggctggtcagcaactgtaagtttgttttaaattgtggacagaagccattgccatttgatagtgtccattaa
-aagatggacaccttatttccccggaacctgaaaactcaccgcagcaggcgttcttaaccaatcaaaacgcttaacgcttc
-attgttgactcgaactcgacttcagattaaaatacgctttttatcccttgatggagctgtacatagattttgtgtaattg
-cctgatttttgatatgttctaattcaacatcaaaatgcaggttaaattaatggacgacaaacaattgcaggctcagtgct
-gcgttcagcaaagcaatcgccaaccggggcgattagatgcttcattaaatttagattcagcttcctctcagccacccgtt
-tacgccatcttcaaacacttcattattcttctcttctcggggccaccgtccagatcatccgcaaactctagcctggtcac
-cgcaaccggtgcccgcgcctaaacactgctggacaatttcacccagcgtttgctgctttatcacgattatctcgcccgtc
-tccaggccatataccagcgcaacatcagcatctttggcgctggctttcggagaaactgaagtccgcaaagacgcgttgat
-cacgcgaccggcgcgactggctgaagcagtttaccgagcgccggaagattcgcgtttttcccgccaaattacacagcaac
-acatcgcccttcgcgcagtcgggtgcttgccggtaggatgaagcaacatggttatcaacgaaacagtggccgcaatacgc
-gtctcttttggcatatgcaaatcggcggcagtggccgcgccctacgcaccattttatcgcactcaattgataaagcaaac
-ctgccttcccacggaattttcggatgcatatccaggcaacgcgtgacataccggacgttcccactggcggaaccatcact
-ttggctttttttagccgccacgaagtgatggttcccatggccagagcaagtgaaacccagaccccacaaagaaggcgaca
-ttaagaacagacgtgcattctccagccccgccatcatcgggaccacacggccaggatgttggcaaaccgcgcgcgtaatc
-ctaccccaggctgataaacacgcgcttcacgcaagattgaaaccgcggaaggggagggcaatgccagcaaatacgcgaag
-gggacgggcgaagaatatcatccatagcggacaaaattgagcgccggaatggcaataggcagcagatccgctttggttaa
-accaacagcccagcacacaggaaacatggcgatttgcgccaagcaggcgaggcctcgaaaattttttgcaggatgccgta
-gcggttgcgacctagggcgatttaccgcagcagaaacgcgcacagatacaccgccagaatataccgctaccttcagcggg
-cagtagtttaatgagaaaatcagaataccgcagctttaatgccagcaatggatataatgccggccgggcagggcgaatgc
-ggtttgatcattttgcagtagtaaataacgccgtcaagacctattacaatgcccagaccaaattgttgcagaatatgcga
-caatgaacatcgcagctaattattgctctcatgatgctggaatcatcgcacttagggtaatcgtcagaaagaacccgcca
-ttgattcattactggccggattccatttcgcagcgtccccgcaaccacgttcgttaagccccttacccacccattccacg
-cagagaaaagaccgctgcagcatcgtagaagccggacgatagcgccggatttaataagccttcaatgcaaatcaagaatt
-aataaaaaacatagccacgccgccatcatgccgttaaaaccagaggtgataagcacgccccagcggtcgccagcgacagt
-gccggtctaacgccagcacgaaaggaactggcgcttgaagtgcgcatcccgccgttcgagcaaaattccattcgcgcagt
-gcccaggtttacttcccatgtaaggggaaggggtaattatgcaaacgggataccgccgacgccatacgacatctgccagc
-atgccgatcgcgcagaaaaataaccagaataggaaatgccaagacgggaagaaaactgactaagtaatatactgcttggt
-gacaaggatggatccttaacgattgaaaaggctaattattgttgtggcatccaacggtcggttactcctgattacgctgt
-ctctttaatataaaccctaccatattagcggcagagacgcagcgttttacttagccctgaagcgtgatttttttaggcat
-tttaagaacaggatgaccgctaatcgtccactgagtgctttcccgggtgttattcagaattggaaatagtgcgcccaacg
-gctagcgtaaccgtgcgttgttcatgaccaaaatgaggcgtgtaatgagtggaatgcgacaggcgggaacgcaaaacgcg
-tacactgactccaaggttgtaacctgcgttaaaaaaaaaaaaaaaaaaaacccccacaaaaacccaccacccacaaaaaa
-aaaaaaaaaatcataatcattgggcgtggctgccgctacagctacagagaataattcgcctttctgaaccagtggcaaaa
-tttcccgcattgatagagctgacagcaatacgttcagacccggaaagggtgcgcgttaatatctttcagcaccgaaatac
-gcgttctcattttttggcatcgcacggtgtaccgatcagtgaaatcagcatcgcaagattgctccccacaaacgtgcctt
-cggcccgacattgtcggccttcccttgccattcaatggtgaaggtttcattgcgtaacgccagcagaaaagtggtgcttc
-ggtaaaggcgttcagttcatccgcgccctaagtttgctaccagatggggccgctaaaggtgatgacattgccatgcgcca
-gaagaccgcacttgaagtggcgggtaaaatcgctatgtccgcaaatgagcaacgggtccatagtgttggcgaagccagcc
-agtgcctgccagtcataatctgcagtaaacgagacctggcacccgtaacgcgcccgcgtacagccgcagcacgatggtgt
-tggggtagtcaggtctggcaagggaattgaaggatcttccagacgctctgtttcggcgtacccagcaaaacgctcacaac
-ggacgggcaataacctcgacgttattgacttgatgccccgcgtcggtaaggcgctggataccacgtcagcgcgggcgtgc
-tgttttaattgacatgtaacgcgcggatggggcaatttaagtgaacagagacatgggcaaattccttggctgacaacaag
-aaacgaaaattgtatatcatgcccgcttaggtgtgcccgtttgtcactcaaacggcgattccaggctataaggataagaa
-gagtgaaattgagatggtttgcctttttgattggtgttattaggcggttggttttcatgcaaagcatgactatacgaaac
-ccgccgtggaacgcgaaagttcggtgcaaacgtggcgaatgcagtggaatggcaataaggccccagaaagccgtgcagcc
-tggggcgtccgatccacaattgatcacggcgattttatcgctatcgaaatcgggtggtaatccgaaatccgcggtgagta
-aatcgaaatgccattggttttgaatttgcagttaaaagctttcaactatccggacgtgattgtttatcggccgtatgggc
-ttggagtggtgaggccgacgaccaggcgagctgaaacaatccagaggcgtaatattttcaatggggcggcattaacctga
-cacaatattctggaaaccggccgctgcaggcattgaagaatcgaaggtacttgcagatatgcgctggtggtgttccaata
-cgctaacggggcaataggtgcgctgctacggacttttctcgtcagatcggaaaaaggcgatcagcaataatcaacgattt
-ggatgctgacgagttctcgaacacgtagcgcgaaaatcacccccctgcgccggcaggctccgcgctatatctacaaactt
-gagcagcactggacgcgatgtaaatcagtcgcgcactttgtccgcttttttcccgggcttctcagctcgagagagaaaat
-aatccgactgttaatttgccagctccaccgtcgggctgacgttaagaaaacggaaaagctcagacggggagtggtgaatg
-gttttcattcttgccaatcatcactttgcgctcgcgaatggagattaactgggcgtcaaagatgaaaaacacccgcattg
-cccatgttggaactcaaatctgagcgacgccgcatgcttcttgtaattcggcaggctttggctgttttcagtatgcgccg
-ctgccgcctaacgatacaaatcatacaggcgaaacgtaacgtactgtatcgcgccagtttggtctggcaaaaataaggcg
-gatggagtgggttgcggagattgcggaaattcggcgtcgttgtacaaaccataaggtgggaaggcgtagggtaataaatg
-ccggaagctgcaagtattcactctgctgtagttgtttcaacagtaaactcgactttcgcaccctgaagtttcggcggtaa
-tggtaatgtgctgtggcctttagcacggggcggatgtgtcttcggcttgactgcccgaaaatcctagcacgcagttttat
-ccggttattgccagtaatttgctgatcccgctgcccgccattccaactgaagacgcaaaggaattgcggctttgtggcaa
-attcgcgtcacacgcccaggacggctaacgggatttttgtttcaaggaactgctcatgggtaatgcactgcacagcggat
-aaaacttcctgactggacaaactgtctttggttttttatcggtcacagttaaccaaaacttaatacaaatgcgtgaatat
-tgtttacatgttgttcttaaatcaagcacgacataacgcccagcaattcgatcccgacccttgcctatacttagagcgtt
-gatgtaagcatttcttgcggtccgattcatcgaaacgagggcctgaacatgggaattattgcctgattatttttgacctg
-atagccggcattatcgcaagctaatcatgccggggcgtgaatggtggtggaatttttcgacctgacctgtattctcggga
-tagtcgcggtggcggtggtcggcggctggctggcgaccattgtttggcattggcggctccccatcagtggttttaatctg
-gcacagcttcctggtggcgggtgggtggagctattctgttctgggcatattccggcctctgcgaagagaatagatttttt
-cataaggcgggaaatagcgatacagatgccggctatccggcctttccacatgcagaacgtatactcgacacctgctttac
-gggtgaaaaatcaatatagcactttcgatattcgcgataagtcggtttccggtaacaacacagaaatccttttttaattt
-ttaattgtttccgttgtttttgggtgattcagaaaaataaatattttagaacagtagcccagtcaggcgttaaaaatggg
-gcggatgttgagggcggtttttggctggcgcttattgaacatttagaattgcatcaatccttctggcagtattaagccaa
-aatactccgttcgggcaatgcttcagttacgcgaaagaggaaatggtctgacattgctttttttggtctgctaaattctt
-ctggagtttgttctggaattatgtgattaattaattttaactccagaaagcaaaaaaacgttgatgagtgaacaaccgta
-caatattcaggtaagcaattgatgctttatatagcaacgttcgggcgtaaatcgccggtgaatgataagtgaaacactac
-ccacgtatgaaatgacgctatctttcggcaaaccacgtatggccaaacatttgcgcaatacttaccgccaggacttgaaa
-aacgcgtctgtgtaagaaaaaaccatagcttatggtgttatctgccgaccacgccatcccggagaagccgaaatgacgtt
-tgtcgagtaagcgaactggttaaggtgtgggtttgtgcctctttggttgagggttgcgttgcgttggctgaacttttaac
-ggtcggaccgcgtcgccggaacattgtcacacggttgctctttcgggcagaagtcaaatcccagcattttcagcgtcacg
-ccattggtccaccaaacgccatcctgtaatggaatattccgccacccgccgcccccgttcccggtggtgctgacaatgca
-tatttttcaccaggcttttttctcaccggtcataggtgtgctgaacattttgtcaaggaagtgcgctaaagctaatgtcc
-gcatcgcacctcttttttttgcccgttagttttgtaatgccttttgtcccgtgagcgatcggccactgtaacggtgcgca
-gcccatttggcgcatgcccattgtttgccgcaacttttcaaccgacgttttggtgttcagggccgccggttgcagcagaa
-tggtgtttttcgtcgccgttcgcgcattttgtttggcgtgaaagttcttttcgctgccgcattgacggtaacagcgggaa
-cagggcggccgcggtttaactgatttgcgcaactttatgactttttcaggttcgtaatcggcaaataccagcctgttgat
-cgttccagcaggtattttcgatccctttttgggacgggcatttgccgagcgtttcgtactggtttgcatcgcgttatctg
-cgcggcgctttgctggcgcgggcgaaggaatttttttccgcattttaaacatcagggctgtttcagatcgacgcggtagc
-gatgcttggtggtgcgtaaggtattttaactgctgcgggtttgtccatgccactagccggagctgaatcccatccccccg
-ccaagacgcagcggcaggagcgcaggtcgcggtaaatttagtggcaggtcgattcgattgcttttggcggtgggcaaata
-tctttccacccatgactctggtcgtgcgtatgcggcgattcgtcccagtagcggttgagaaagggtacgcatcctgaagt
-ttgacaacgcgttttttcctgtttgtcacggcttgcagttttgcaacaccgtccatccaagtaagcatattcttttttgg
-cattttgcggcaggttattgcttcaacgcggcatcgccttcatgctgcgccagtaactctaccattcaggcaaagaaggg
-cggttgcgagcggcttaaaatagtaactgcggttccgttgggaatatgaccgtaagtgtctatttcaatgaggcaacatt
-gggccaccatatcgcgactttatccagtgacgcgctttcgcagtctaacatggtggaagtaactgtgcgccagtaatata
-cccttcgcgaaggtgccgccggcaacgacataaggtttccggcagcggtaacagagaatcccatttttcggtgtttcgta
-gaaacgcgttaataccggccgaaagtcccgtcaataatgttcgcgcagtgactgccgcctctggcggaacattatttctc
-gccttctttgcgggtgaaatgacgttaacgaaatggcgcagatcaaatcgcgctctggttttgctggcaatgccgataat
-cagcaaaggattcatcagcgaatcgctgttcggcaagcggcatcggcaaaggttttttggtcgcggaaaaagttttgggc
-gtttttgcatcatcattaaacagcggcctaataataatatcaggcggctgtgtgttttaccggtggtttcttctgctgca
-ccgactagcgcagcgaaacacaaaaagatacaggctgggaattaacggccatttttttgcgggcgagaaggtgcggggga
-tttcatcatcattctcctttgggcgaaaccgaataaaacggtattcaagtcatcagcaaacgcttagttcaggatcgcac
-ataagctgcattgatcgaaatctcattctgacgaactgtcaggcatttttagaaataagggattaaaagggataaataac
-ggcgacatagagtgatgcaaataacgtctgtttattagccagccacggcgttgggtttttcgtgattagcgacagaaaaa
-tgcaatcctaaattggtgaaaaatataacaggttagttaaaaaaccattagtgcgtggagtaaaattgccggatgaacaa
-tgcagaagatgccatcctaagacaagtggtcttaagcctggacggttgaacgtttgcgttttttaacgtcgcagcgttag
-ccggtttttttcttctggtggtatcgcatacagtttctcaccctgctggcaaatccagcgcatcccagttttcacgggcg
-attagggcgctgtgggataccggacttcgcggcgaataagggcagataccttttttacaaccggccggattccattt
->m141013_011508_sherri_c100709962550000001823135904221533_s1_p0/806/37082_38321 RQ=0.879
-ggatccggcggttgtaaaaggtttatctgccttagcgccggaagtccggttaatccacagcgccctaaatcgcccgtttg
-aactggggattgcttggatttgccagcagggtgagaaactgttctgcgataaacagaagaaagcgcctaacgcttggacg
-ttttaaaaccaacgttttcaaacgtcagggttaagccactgttcgatggcatcgtttgatgtcatccgcaatttatcagc
-ctacatgtttttaactacctgttatatttttcacaattttatgatgaattttttctttgcgctaatcaaaacgaacgcca
-cgccgctggctggttaataaacagacgttatttgaatcactcctagttttcgccgtttatttattcctttaattccgctt
-tctaaaatgcctgacagttcgcacgaatgagaatttcgatcatgcagctagtggcgatgcctgaaactaaggttttctga
-tacttgaataccgttttatttgcggtttcgccaaagggaatgattgatgaacatcccccgcactttctcgccccgcaaaa
-atggcgttaattcagccttgtaatctttttgtgtttcggctgcgctatcggtgaggcagcgaaacaccggtaaactgcac
-agccgcctgatatttttatagggccgctgttttaatgatgtgcaaaacgcaactttttcgcggacgctaaaaaacctttt
-ggccgatgccgtgccgaacagcggatccgctgatgatccttgctgattatcgatgcagcaaaccagagcgattttggatc
-tgcgccatttcgttaacgtcaatttcccctgccgaaagaaggcgagaaatatgtttccgcagagggggcagtcactgcgc
-gaaacatattgagcggactttggccggtattgaacgcgttctatcgcgaaaacacgaaaaaatggattctcttggttacg
-ccgctgccgttaacgcttatgtcgttgccgggcgaacgctttcgcgaggtaatattagctgggacagttacttcaccatg
-ttaggagcttgccgaaagcggtcactgggataaagtccgcggatatggtggccaacttttgcttgaaatagaacacttac
-ggtccataattccacggcaccgcagtttactatttaaagccgcctcgcaacgcgcccttctttgcgcctgatggtagagt
-tactggcggcagcatgaaggcgatgccgcgttggaaatt
->m141013_011508_sherri_c100709962550000001823135904221533_s1_p0/848/0_2138 RQ=0.816
-tctcggaaaaaaaaaaagggggaaatttttcccccgggcttttttcggggccccccttcccaaaaaaaaaaaattggaaa
-attatccttttttttatcaatgtgaaaatggatgccgccgaaaattttcgcgacgctgaatacgacaagggctgatgcgg
-cgaacttgcggcgagctttggaaaaaaaccatccagaactgattttacgcctgaattcgctcctaatctcaacggttggt
-aggcgccttggcgcgtgggcggccttttagcccagaaaataatatgtcatgagtacaattgctgtcactcggaaaattaa
-aacgttttttttgatgaagaaagcctttcttgctcctttcacaacgtggtgcaggacgttgaaaaacaaccggaagaaag
-tcactggtgctggtgagctgagatggatggtcttgccgtagtattcgtaatgaaaaatggcgtttttagttaagtgcccg
-tgaccaggtggcgatggcactgacgggaagatatcacgtcttaatggcgtactatcgcgcccattccgcttgaagcctgc
-acggagagaatactccggcgcgtctggaagtgcgtggtgaagtgtttctgcggcagcggggttgaaagataacgaagatg
-cgcgagccgggcgggaaagtgttttttgctacccacgaatgcggcagtggtttcctgcgtcagctttgattccgcgtatt
-acagcgaagcgaggacgctcacttttttctgcttatggcgttggtgttctggaagggtgtgctgagctgccggatactca
-tgctttggccggttacttgaatttaaaaagtgggggttgttcgtcagcgatcgggtaagctttgtgatggcggaagaagt
-gctgggcgttctatcacaaagtggaagcaagacgcgccgacgcttgggctttgatatcgacggcgtggtgattaaggtca
-actcactggcaagcaggagcagttggcttgtcgcgcgtgccgcgcttgggcggtagcgtttttaaattcctggcggcagg
-aggcagatgacctttggttggcgatgacgtcgagtttcagggttgggcgttatggcgatatacgcctgttgcgcttggaa
-agctgtccaatgttttgcaggcggtgtggtggagtaacggcaaccttacatcatgcgattgaaatcgaacgtcttgggtt
-tacgcattggcgataaagtggtgattcgcgccgctgggcgacgtgtattccgcaggttgttaacggtcgtgctttctgaa
-gcgcgaagataccgtgggtttgtgttgccgagcatttgtccggtatgtggtttgacgttgaggtgtggacgggtgaaggc
-ggtttgccgctgtcgccggtggcactgatttgtcgtggggcgcagcgtaagagtcgctgagaaactttgtttctccccgc
-gtgcgatggatgttgacttggaatggggccaaaatcgatcgatcagcttggttgaaaatgatatgttcatactcggcaga
-gttcttgttaaactcaccggcaaggcaatactgaccgggacttggagctgtatgggtgcctaaaatcggcctacagaaac
-gtggttgagacggcgctggaaaacggcgaaagatagcactttgctcgcttcctatgcactattggctatccgtgaagtcg
-gcggaggcacctggcagcaggtctggcggtatatattggctacgctgggaagcggcttggaagcgcttcgattgggaaga
-gaggtctgcaaaaggtgcctgattgttggcattgtcgttggcatcacgttcacgtaatttcttgcgaagaaagcaaccgc
-acatgtttcatagtcgaggctgtggcggaaggtggtttcactttggctgtcgccgatggtttaatcaaaggggagagatt
-tgacaggccgttttgctggtaaccgtggtgttacgggcagttaagccagatgtcgacgtgatgacgcttaaagctctcga
-ctggtcgaactgggcgcggaaaagtcgcgggcagcgtggtcgagaaacggatctggtgattgcgggttgaagctgcagga
-agtctaaagtggcgcaggcgcagggaactggtgctgtgaagtctcgacgttaacaaga
->m141013_011508_sherri_c100709962550000001823135904221533_s1_p0/881/0_529 RQ=0.772
-caaaaacccagaatcacctactgacagggggggagggaggggatttttttttaacgaaaatgccttgcccccattgactt
-tggaaaaaaataggttgggggagaaaggcaaatgatgtttgtaaagttttttttgtggggttcttgcttctacgagttcc
-cagtaggttaatggcggggtataggttgaggaaatagaaacgaaaaaaaaaaaaaaaaacaacccgcatcgcggaaagtt
-tctggttatacagtggggcgggtggggtaaacatctctttgtcgtttgcccgtttacggaccattttcgctgtccactgg
-caatcccagattaaacctccgctcatgtggtcaatcaagttctcttccgagaagcgaatatcagcgagaagtgacgcggc
-tgttgagctggtcaatagtcttttggactaaactcaacactgggaaggagttacgtacaagcgaacctttgcataagcag
-tgtcttttatccaggttttggtaatgcgatgctaacgatcaaaccggac
->m141013_011508_sherri_c100709962550000001823135904221533_s1_p0/930/0_2053 RQ=0.766
-acacaaacaccccacacaccacacacacaacaccaaagaaggggaaggggggaaagaaaaaaaatcgggcccggccttga
-aaaaatcaaaaaataaataggcgccgccgcttttttcggtaaaaattttccgccctaagccggcaacatccaccaggccc
-ctgtccgttggtgcaagggatcgcagccccatttcttcaggcagttttttgctgagaaatcggcttttttttgggcacct
-agaaactgaaatacaggcctgagaacggtctttcgcaagactaacaagccgagcctgtggcgtttgcggcccttgatcgt
-caagcaattctactcaactgtgttgtagtaagctgcgccgtggtggcgttccggcattgtgcgcagctgtaatcagtaac
-gtgtttttctgacttcgaagcgggccaaccaatggcggggtgtcccgggcggccaaagattcgcgaattgccttttccaa
-gtaatttttcctcaaagtaaattcgtggtccgttccggtgcgcctgataataggtattggatgtgaaatccaatttctcc
-ctgaaacgcaatttcatttaatcatcgacacgccagttgcccgcttccataatgcgtacttttatctttggcggatgctg
-cctgcatgaaaacgagatatgacagcctggcatcagacctgcggaaattactgggcccctcatgccggatattatctgcg
-gctggccagttggcccttgtcggctgggcgtgaatatttgcctcttggctgcgcgctaagctctcaaagaatttaagaac
-tggcgtgctgataaaaaacttttccacggcatgcaagtgtaacgtcacgcctttacttagcgggcgaataaaagaagttg
-gcgccgctaccgccttgcttctagctgggcctgaatagatttactcagtgccgggttgcgacatagttcaacattcggct
-cgctccgcgaatgctggcggctgacgacgcgcacttcctaaccaaagccgaattttgatgaatttttaccctgaaagcca
-tgacgccacgcgataaccgttatttatcagaccacaagaactggcatctactttaatgggcggggcaagatgattttgtg
-ttccaggtaatttagtgaacggttataaaactgtgaaaaatcatgttagtgataaagtaaaaactatcgctacgtgaacc
-gggtccaacactttttagctgatgacgggaaaggttatgggagtcttttgaatgcaatttgttaattcggctgccccaaa
-attatcgcactggcgacgtgatttttctggcactatgcagagtctggcttgggtggaattcgcgcactgtccgaaccacc
-ccagcagacacacacaccccttgttgcggaatgaattgcaatcgcagctggcttattttcacgtggcggcttggggtccg
-cgaaggtagttatgaaatgtagccggaggggattgacgcctgaatgcattcacgtcgtatctcttacaacgctgaatgtc
-gagcgcgctctgtcaactagggtgcgtctatgcacagatggttgcggcttttgcaggtggtttcaccatcgatctggtat
-gcgtcgccgtagccctggataccgtcgcccggtgccccgggtgatcggctttcgttggtctgatattggacgcgtctctg
-gatctcagtgaaagagcaggatgtcagccatcgttcgctatcccgaactggttttgcgtcatgtagacgccggaatgatg
-catttgcctgtgggtcattgatggacatatccgctcatttgggtcttggggctggcgttcatatccccttaagacagttc
-gagtccggactacataaatgggcgtcagtcaaatgatttttcagctgctagaggaatggtacggcgtgggcgtctgcgct
-cacgggccgatggtcgatgcaggtgtcgtagagttgttgcattattttatactggccgtgcactattgggcagctgcgta
-acgacttcgggcaccgtgcgctgtggcgggcagtgattaattttatggcaact
->m141013_011508_sherri_c100709962550000001823135904221533_s1_p0/972/0_15060 RQ=0.821
-aacaaaccaaaaaacacaaaaaaaaaaaaagggagggaaaaaagggagattaattccctcgattttatcatagaggaaaa
-atccctttttttttttcgataaaaataacgcttggttttttccatcttggttttttttttttttttcaaaaaatgtttta
-catccatccaatgctttcccttatattttccataatatttattttccatgaataaagttgggtaacgcttccttgttttg
-ctttttcgtatctttttttcgcttttcaatttcctttcaaaacaaatttgggaaattacttctctagaaatatctttttt
-tcgaacaagcatctaaatctaatttttaagtttcatttgttaaaaaagaattgtttttttgaataagattttttcttctt
-cctctatgagaaacaagggcattctcaatttgcctttttttcttcggatatttctttgtaaactatgtggaataatttaa
-atccctgaaactttatttataactctcttttttaataacagttggacctttttcgatttcacttctttgcgttttcggta
-tataaaaagcatatctttatcattaatatatcggtcatgtataattttcgaaacgacttcagagatgatggacctgtcca
-cttccttttttttgtaaaaatctttattttctttgtttttggttctatttgaataggaaataaataggagattgcctttg
-taatatgcttttttgtacttcttcattgtacaaatattcctaactcgattttcatcaatttctaagcccttttgggtaat
-cctgtttttattaggattacttgatcacactaattccgtatctcgccccttgcacctttatcatataaatattaatcgtt
-ctttcgatcgtttttgtactctattttttggtaatgaagccatactctactctctattattttaaacatagtcgaggaac
-atttttctttcaagaatatattaataatgaggaggaaatacttgtgaaaatgcatttctggtgtaaggctttatcggtaa
-atcccttctactttttataaaaaaggatatctgtttacattctcacacgaaaaaaaacactgaacttccgaacctaaagc
-ttcagtatgttcaatggacacagatttaccaacccttcctctcttctattgatgtaggttattaatatagcggagagtct
-attaatagtaagatggacaagcaacaaaagagcattttaacagagaattaaacaacaaaggactcattaaacaattgcag
-ggactccatacaaagcacacacatttattaacgcaagtgctattggatactacggaaatctgaaatagagtcttttacca
-gaaagatgagactgcctggaaaatgatttttagaaatacagtatattatgggaaagaaagcttaagcacgttctctcgga
-tacgaaacaattacgcagatttggagtcgtattagggcaaatggaggagcttttccaaaaatgcttacttcctaataatt
-cctatatcggcggcaccatttggttgggaagctggttgatggattcatatagatgcgtcgttcgtagatgatttgcatca
-tacacaaaaagaaattggaatgtcccctctttaatatgaagcaccacaccataagaagaaggaatttgagaaaaaccatt
-gcacttaatgaaaagctcattggtgcctgtaattcatttctcattcaactttattaggttgaaatgagcatactggtact
-agaagggcaggtgtattacccttaaggaattgaaaccatgatacatacactttcggcaatagacatgattacaaatttgc
-atacaatgtagtatttaaacacaatttttacatgggctctttcaaaatttccccatttttaggtccgagcattacaacaa
-attaacctttcagtttactttccaccattaacttcattagattataaaagtacagaaatgaggtacctatgaaaatattg
-ctcaaacaagccattgtatacctattacattcaaaagtttcaaggcgatgtactcgttacaggagagcgaattacacgag
-gtccaaaccttttattcaacctactcaagatttgaccgttatagaatgcacgagcatcatctcttaactggctttattga
-atgtcatctcttggttctagtgaaggactggtttgggctggaaatgatgcatgaaatctgaagtttaacacacatattgt
-ttttagatgggatgccacctttggattgctttcaagacgctgtacaaaggaattacaacgcgtccagttatgctggcaag
-tcaaaaatattatgggggactacttgtgtaataaaacagcttggaattgttattgatcattatgattattaagaactgtg
-tcttaaagattgcctttgggagaatcataaaagtccatagtaattggaaaaagaatccattaacgtatggggattatggg
-ttactttcggaatatctatgaagcacaaactaggcagaagctgatttgaatgctttcctatttaaagcattaagtcgtga
-atacccgtacgtatccacgctcaccgagcagatgatattaagttctggcttatcgctttggaaacggaattcactttcga
-tctacgtattggaacattgtacagaggaacttttctgttgaagagtcgaaacataatttgaagtttttcagtggcccact
-ctgaccagtcgttctaaaatcgaactaaaaacaagaacatggatatttaccatatattatctaaaaatggtgtggaagtt
-tcctatcacagatatccttatacacattcaatatttaaatatttgtgccgtgtgcagtaagagaagattagaacgatgaa
-aaagcactagaaggaattaccatatcctcgcggcgaaaatttgcgtttagaggatagaattggaagcatcgagttttgaa
-agagccgatctcgtgttatggatcatcatcttccatttttagcccccaagctgtactactatgattgatggaaaaataat
-ttacaaaaaaaaataaaaaaaactagtttatttttttgactaataagtattatacgattataaactgaatgaaacataat
-aatttgtgtcgtgattataattttcaaattgatgaatgggaaggcaatggtgcgcacagcgttaaaactggttctagtgg
-ttgatccacggcgaaattttttaacgattggatataaaaatttcgagggtgggggtgtttttttttcgtcatgctactgc
-tcgttgtgaggaggaggtttagtaatgttgaaaaaagcgacttacacgacagccacgttctatagagttaatggtggatt
-cagcttgtttccattttgtggcgtcaaaaggcttattcttatgaagaataatttattcttaaaaacaaacagcttggaag
-ctgaagagcgtggtgaattaatttcagcccaaaatttagatgaatgggtatacctatggaaaaattactttattgaatgt
-caagaacaagtggatttctcggggacatggattgcaaaccatatcatggaaaaggctataaaattggcaaaagaattcat
-tttttagtgaacttttcatgaattgatattgacacaattatgcgtattcgaaataaatattgttctattaaagctgcaga
-aaaactgcaatatgtgaatctaggcaaacgaaaaagaaagcgtatatgatgaaattaacgcaaacgaagaagtataataa
-ttatatgaaattccaaaagatatacacatgctacaatgccgagatacaacttccaagaatgctcatcaatttaaaagaag
-cataaattaaatttttgaatgataattaatcttaaattttccatatggtattatcctcttttttggaaacggataatagt
-aatttagacaccgaggtgaatttgtaatggataaaagaagtgataaagcaaaaaacaacatttaatctagtacacaagaa
-gtttctataaagcgaatttcaaaagcagatggtgcagcggaatcgctcgaaaagcatttaaagtgaaaatgatattagaa
-gtttcccctaattattcattttattaataattttctcgattgataaaagtaagcaaaaagcttatacataggggcttttt
-ttgctgtggacaactttatccacaaaccaacagaattgttaggtcatttttcaaaacatttaatatttttctatattaaa
-gcatataccgctgttttattgtgatatttttctaaaattgtggacatgtggaatagttttaatttccgactttaactgtt
-aatgaaaggcatccttttgtggataactgggctgaattttcttttgaataatagaacctttacatatacaaagggtttca
-tattaagtaaaagattgtgcaagagaggtgatttatagggtatatgacgggtttgcatgattttctgccaaaattgcatc
-acaatatgacagctggctctggaagaatagatgcttttcttcttctttttcatttgaagaagcttcacatatcttgtaat
-aatgcctctgttttttgcaaaactttcactatatcggaatgacaactgctggccctttctttcaaagtagatgcattttc
-attttctgtcctggaacaggcttatataaaatgacaggtacttgcaaaccgctgctgttcacttaatgttattccgcctg
-gcttcgtatctcagaagtaaaggaatattcatcaatatttaacgataccaacattttaatgcatcggaatttttgccttc
-tgtaacattaataaatctgtttttaagatttcattcttttccacaaacaacactacttgtaaattaggcacgaataagat
-tggcatagttcttttacatttctaataccatgagcactgctacaattagtaaagatcttttattctttactaactgatat
-ttagtaaattatatgatttctggatttacctttaactcaaactactccgattggaatttcctgttttcaacaagtttgtt
-cgcagggtacacggatataacatcattctttcacatgatccgttgcaacaaaataacgattctacttctcgatgaatcca
-tattttgtgcagcaaaatcgttaatacgttatagacaggaattggaaattacctgtttgtttcttcaattctggtacatg
-ataattggaaatgtttaattaaatatctggtttctccactgtaaatagtgtttcaacgttctttcaaagttcgcatacaa
-gatgtattttcttattcataaatttttctaccccgtaataacaaacgattaattccttttcctattgtataactttttta
-aattatgatattttgtaatgtcagttataaatggatggtgattctccaaacaagtcgctacataaatcttcaattctttt
-ggagaaattgtttgtttctaatgtttttgctactgttgcacatgaccattaacgtaatgtgcgttaatattaaaacttgg
-ggttttttatcaacaaattccactcctcgctttttgttttctccatattgcattatacgccaataggaaaaaattttctt
-taaaatttacataaacagatttctaataattcctttcagctatgtactgtcgtggatatgaaagcaatataagattgacg
-cttaatctatctgtgctcataattttttacattatactttcctataagagtcctttcgacataattacaaatgttctcta
-tttccatgatactcactcttttactttctttaattctttttactattgttgaatttcctttacaattaatgttaaatttc
-tcatttattccgtacaaaattatggaatatttctacttagtatactctttatcaaatatatacctagattttattgtaag
-aagcaaaaagcctaaatcattattatggttagacggttgtaaaatatatttagcatgttctagcatttttctcagtagtg
-gttctatcatttgggcgagttgatattgtgtccaagcgcctcatttaattttataacacaagcttatgatattggtaaca
-cttaattttttgaaaatttagaagctttgaataaagctagatagttttggtagatcctctcattatcgtacacaggaact
-aataagtggtcgtacccatggtttattctttatccgataaataacgagcaattgtataatatgttatttgtttccctgtt
-aatttacgatgctttttggaatcgatatgttttagatccaataaaataaatctgtataatcattaaaatattagcttatt
-tggaattatggtttctcagaataacaacacagaagaatcgattgttgtaatggattacagcgctttcatttttaacaact
-cattaaaaagtctagctgtatatggctccttccagctaatgtatacgctcggagctttaataaatggaaggtacatgtaa
-tctgcatcattcttcaactgttatttctttacttaccgggatttccgcagtatcagcattatgaaaatattgggcaacgt
-aataaaaccttgtgtaaatatgataacgaatccgggatcaacagtacacaagatctacagaatgtattcttccttttaca
-tgtttccttcctcttttattgacacagctcccttcgctatatattaaagagcgaaggacactttttcatttaatgcttca
-tgcattggtacgttatactaatttgttgttcaacagagtttaatttaattaaagtttacagcataacagatacagaattg
-ttaattggtggatactttaggatgtccattgcatccattaatgtttcacggttaaatagttaatatttaagtggtgcctt
-cttttactgcataggccatcagcattgatactaaattacgtacttgtactcattttctttcaagtgctttcggaataatt
-agaggatgtattagaaatagatcttggtgcatcttcattatggtaatttagcaaggataataagaagctaatgcactttt
-gtttggtccatgcttgggttgcacctgttgaaaatggttctccagtaacggcggcatcggaatattacgagttttcctta
-cccgtaaacaacgtttgatgtgatgttaagattgacattgtttatgaacagagttttgatgtttttgtttacgaagtttt
-attcataaattgtttttacaagatttaagcaatctcatctacaatcatcattgttactgtaatttagggattccttcaat
-tcgagtcaactggcaatcattttcatcagcgattgttttactttttgcgtattaattgcacttaatgaattgctactcaa
-tagaaggatactgttgcattgttaacgagaaagtttggtatcatgaagtgccatttcatacgttcatagtatatttatca
-tggcatgtaatggatacatttaatgtgtttaaataataacccgctaaattcattgtcaatatcaaacttatgcataatct
-tataatattaatcttcaagagtaattgggtgcgtactcaggacgcaacttgtgtcttttgactttttcattttgccaggt
-taatcgatataataatgtttggctaagttttgcacgcgctcggaagaatgcatttgtttttaccgttctcatttgcagat
-acgcaacatgcaataccgtaatcatcgcgtatttcaggaagatatggtcatcattctcatatttgattgctgatgtttta
-atagacatttgcaacagttaagtttttaaagtctctgggtaaatttgttagacgaaagacagtttaagtttggttctgga
-ctgggggggtctttcccccccccctaaatatctatgtatgcaagaaaggaaattgagttctttgttactccatggacgac
-atctaatgccatacagatagattcagttacgaagttggggtcaccagagaataattcattataatcaggtgtttttggga
-attttcacacgacgtaattttcataaatggaagtgatcgagcaatttcttgtacttttcttctgtttaaagtacatttgg
-ctaaatctctttcatgtaatattaagaatggtagaagtacgttcaagactcattgccagctcgttttgttttttttaatg
-ctgcaaggtatgcgaagtataacattggaatgttcttgtgctttgttgctggcttagaaatatcgaagccatgagaagca
-gcgcatttcttttaaactcttgaagtgcacgcatttgctcagatatctcgcgtaacgcaatttgtacttcgctcatttta
-cccgacgcagttaaatttcaaatcagctttttttcgggcttcaataatgatcaatacatatgcctactcggcgattagtc
-accgataaatgttccagtcgtatgcatcttggaagaccaagttaataacatgcttttacggtgcatttctcatttcttgg
-tgtgtatgcatcaaatacaccttggttatgagtttttctcactctctaaaaatacgactaagtttctttatcctttcgta
-tccataagattcacaagcttgttggccatacgaatacaccaatatggttgtataagaacgtttttaaatggttttatagt
-ttggaaacgactactttttcaaatatctttatttaagtatcacctgggtatgtgatgtaatagaagaaacaatttttgta
-tcccatatcaagaacgccaccgtttcacccgttctttcgttgtttaaaatcattaaacttgaatcccaagttgttttttc
-gttgtttcgttgtttctgctaagaagattcgtcccttgaaaacgttttacattatttaaaatgaaatcggcgaacatcaa
-tctctgctttttcccatttttcacttttaagttttcctgcgttttttaaacatttttctaatacttgagtcctctttaat
-ctcctcatttttgattagtacaggataagattttttatataaaggttacaccttagaatatattttttacgaaagtgaac
-gaaatagttgtgaatgtttgtgataatttgagcaactactatatatatagtgttactcatttaaaagtctttaaaataac
-ctttcttaattgtatttttttggtatccttatatagagttctattttgtaatataagacaatacattgtagaggtgtaat
-atcttattcctaatctgttatgttttttataacagaacaaaaaaagtgtacacatgttgtacactttttttggtttattc
-taataaacattctttttctattgcatcatagaatccgccacgcttgttgttaatgcagattatttgatctagtcttctat
-atgatcactataattcgaagtaagctggtggataactttttagcaaaatgttgactgggacgaatacggtttcatgatta
-tgcctcaacacgacttacacatgcaattaatcctgaaagaataagctttcaattggctagcacaacacgggccagtcaag
-atcgtataaccaatttcctttcaacaccccttacggctaacgcattcggtacagcgataagagagctcgccagattcttt
-tctattcaaagctaaatttaatgcatatttaaattgcgtacaagataagcggtactcttaaatctaaataatgatttaaa
-tcatttatgcaaacaatctggtttccatttgcaatagcttttcgcaaaaggggatatagctcatcgctggactaacaaat
-cggccatctataaataacaaatttctctttgccaaatacgttcaagttggaggcgcccacaatcaatttccgagtgctta
-tttatatacaattgtcgtgcctcttttgtctttttgcaattttttttcgttttatctgagaaccatttacgaaagataat
-tgaagggtttcatttttgcgaagggctcttctataacgtttcattgtttttcttctgcatcttgttacggaataaacgat
-gggttgctttcctttatagaaatcagatgtaacaccccttgataaaactcttcaactttaaagtatgatagacatagcct
-tttctatttatataaatcctcgcctcatgactggttaatatccgttctggctactgcttctatctgatcacctatcattc
-tttttttcagaattgggaaagattttgtccatatgcagcatgctggaatggaacgaaatttattcggcgtaataccgtca
-tagcaaaatgacgaactaattctccatttactttgaaactaggcgtaaatgagccacaataggattacaaaggcattcat
-atcgatgctttgaacgatttctttcgggtcagcgcatgaggtaatctaataagttcattttaattttagcttaacattgg
-ccatttatatttgcgccatactgtataaagtggttttttgcttttttaaaaataatgcagtccaaaattatttaaaacta
-cttgctgatgtataaaatcggattaagggataattttaaattttgaagttggaatggaaaataatctataaatagtaata
-catcagtatcgagtttttgggccgccgactgcagtcaacatcgttctagtagtctgtatgctgattctttttacaaccta
-aacgttctgcacatttctggttccatcattacaccgttttggctacttaccatgattttactggatttaatggttttacg
-atttgaataagttgaaattcgtatgacctatgtagctgcaggaataatacagatatgacttaccattgtttttgttcacg
-gaaaccattattgttttcttaatcgttttcccagtactttcgctgaattgaacaagctcttaattttgtttacatctggt
-ttctatttggtttttcaaaccatgaggatatacttcttccaaaaggccactttggacaatcttcgaagaagaattcgttt
-aattttttaattacttctgctacttctttttgtctcttttctttcagaactatattataatctaccattttacttctaat
-cattgccgatcgttgctctactgcatattacattacgtaaaaagtggtcttgtttccttctccctattacgagaatgtct
-tctcctgagtgcgcgcgataaatggggatttactctgcaattggacggatctttcgtttggaccataaatattaaagtat
-cgaaccaatcgttctggtaacttctaatgcgtacctaacataatgttctcttccaacgttttacaaactgaatatatcaa
-cgaaaattttagatgttgcccgtacaatggattccctttcagagaaggcggcttggccttaccatatactttctgaagta
-gagcaaaactatttcttctttcttttaacggtctggcttgtaaacattatggtccataaaattcgttttctatgagctta
-tattttttcattgttgtttaactaaaattggcctgctaaaatgaaacagaatcatgctgattcttactaattcataatag
-aattttttatctaaaacacttattgggaataaccacgatttttttcattaactctttaatggtactttatttttacttta
-taaaagttatcacaaagtgacctcataactcttcttatcactttcagctaaatgcgaccgataaatggccactgtaatta
-acatttcttcttcatttatcccacttcttaccaatccgcgtgtatctattactcggatccattctttaaaaacttccaat
-caatattagaatgatgttaaaaattaaataccatcgtttttttaacttttttcttgcatctcaagaaagatttggtaacc
-ttattccaatttctgcggaagaaatataaggtatgatattctctattcgtatccttgattttcttaataattgaataatc
-ggtaacgctggtgattatcatcaaatcatttacattttttatacggcatttaccctaccattaaacacaggttgcaggta
-ttgcacgcacactttttcattttcgggaattttttggatttcttattattatatgtgcagctcaattaattgactattgc
-ccattctttttattctcattgaaatataagggtctacgaataagtgtcctatctgggcctgccaatacggagttaaacca
-aatggttttgtgtatgcgcttcaatggctcataaaaatcatgcctaaactttcacatagtgtgtttagttcatttactaa
-agaaatgtttaactaagcgctgggaatattttcaaatagcttgcaattctgctatttcggagaggcttaacaggtacaaa
-cttagtcaaaaatggtactatattaaatctgtacccttttgtttaactttttctgtttgtccataataattttggaatag
-ttgaactgaatatgactatttgctggataatttctcagggaaatatgatatagaatcttccctactttttttacattttg
-aagaataataggtaggatgactttttcaagtgtgctggatattggaagctttcaaaagaagttgttccttttgaaggttt
-tgttgtatataatgcgaagcctgaatgaggcacttaagtctggttctctttggttattaattggagtccgggacagtgac
-ataaataacactatttttgaaatcagcatggctttgatccggtgtatttttatgtttaattttttttcgtataaactttg
-ataactcttagaagaacatcgggaatataacttttctcttttatattgagtctattttcttatatctttatcttaatcca
-aggtatgtatgcctctttctgcaaatgtcgctaaaaggaaggcaacatactagccaataatagtatttactactattcat
-ttgtattttcttcttcctcattttgttgaattaatctcctaattcttatctcccatgtgtaaacaccagttcgggtccgt
-acattgtataaatacgcaaacgttcaagttgatcaccggaaatatcgatcaaccgccctgaatagccatttaaaattcgt
-gttgctctggacgtatgcgatttgtttttataacattactaactctaactgttgtaatagagatccttctaaaatagctt
-ttcacttgtgctaatgcggaatgattaagggatcatatctattttctctattagcttcttatgctggatgtggtcaggca
-gttagtgagttattcataaattggtggttttcgctataattcacaaagtatttcccatacttaattggatctgctgatga
-aaatatctaataagcttgtaatcatttaacacagtatttcccatcttcccaacagcatgtaaaaaatagaagtgagtttt
-tttgctgaataacaagatcaatataagaataacaaaattcttgccgtagcatggcatggcactattgctcgtgctacatt
-atgttgagcgccttgtaaatttaacaacaataacattctctagctttgcctgtttaacagtctaaacttgtccattcgcg
-acaactataatttcatctaactgctttcttttcacttttttataacagatttatgggtttatttttctcttgatatgggg
-ataatgggcactatatttcgctttattctttttgtaataaactggtttattaacttctacaaactctctatctctattgt
-tctctgaaaaaaaaaaacaccagcgtttatatgtttcgatacgtattgtaagctgcaatgatacataatacgaactatcg
-ctttggataaggagagccaggttttgatgttcccagtatgcacaggtcgaactttatttgtgtagatgacatcaactgag
-ccatatcagatatctactccttagacatcggcccaaatcccggcttccttctttttgaaaataatgctggaatttgtaat
-tcagccacccagtttttcaatatttcgacttatcgcatgtggtattgcaaattaaagatctacaacaacctctttctttg
-ttcaataagattaacatatattttccaacgtcgtataatgcggttctaatcttcaaagtaaacggaccatggttaaattt
-atttaaacaatctcatgcccttgtgtatccttttaataaattgtagtaattcttcacttttcatgacgatataattaaaa
-acaaaacattactttttgcctttcttagcacaaattgccgttcccaaatcattaccaagaggaatctctataataaataa
-cggattatgctgtaatgctatttccttcgttccgcatctgtagatcattatctactatgataaattcatatggtttcgag
-ttttcttacctctactaacttttgataaagtaattgcttattagccactggaatacaatgacactctcataacttgtagt
-atcttattccaagcgaacatagcaataataggaatcgcacaacttacatttctgtggtccaatagaagggaagtacgaac
-aatttactgcctgatgaaaaaagaaccacgtcaagataaagaagctgcaatgatttttacagctgtcaacttgactagtt
-agctacatggttagtattcattcagtaaataacattatagtatctttttacggctttttaatttgatatatatacttata
-atggtaataaaactctgtttattctttttgcaatgttaccgaagtccatcacaactggtaaataaacctgttaatttgtc
-atgtcagtaattttctacgttttttactaaatatgggcttttgcaatttcttaaaggtgatgtattgcattcttttaaat
-gttacaaataatagattgaattccttgattcataacttcttttccgtagcttgcttagagttttctttgaataaatctcc
-gcgagttttgtgaaaataaaagttcttttcacagaggcaataacttattatctaaaaaataatataattgtctattaaca
-atcttgattatttatgcaatattttctgacagacacggatacatttctcctattattttttagattataaatttacatca
-ataaaatcttaatgtataaa
->m141013_011508_sherri_c100709962550000001823135904221533_s1_p0/972/15102_26089 RQ=0.821
-ttgtatgcttaagatgtatggatgttaaattttttataatctaaaattaatagaggaagtgtatgtgtctgttttcagaa
-atttgaataaattataagattgtttaatagacaattagattatttttttaggattaatagttattgctgctgtggaaaga
-cttttattttcaacaaaacttgcgcgatttatttcaagacaactctaagcaagcacggagaagttattgaatcaagtaga
-tttcaatctattatttgtaacattttaacagacatgcaatacattcaccttgtaaagaaattgcaagcagtatttaggtt
-aaaaacgtagaaattacgtgtgacagttggacaatttaacaggtgttattgtagcagttggtgatgactttcttaaacat
-tgcagaaggtaataggaacagaggttttattaaccatttaataagtatttataattaaagaagctaaagaaaggagattt
-atattgttatttactgatgattgtaaatgttggcgaactagtgcaagttgtgaaagctgtagaaatcattgcaggcgttc
-tttattgtgacgggatggggcagtattgttcgatattctcttcttatggacaagaagatgtagttgtgcgattctattat
-tgcgttatgttcgctgaagggtaagagtgatacaagtatgagagtgtaagttgttattcagtggcataatgaaggcaagt
-actttatcaaaagttttagtagagtagaaaatcggaacattatgaagttatatagtagataatgggatctaagatgggac
-gaaggaatagcattaacagcataattgtccgtgtgatttaattatgagattctttggtaatgagtggacggcattgggtg
-ctagagaagcaaaggtgagattgttttgttttttaagtggtgatatgttcatgaaaagtgaagaatttaatacaattttt
-attaaagggatacgacaatggcatgagattgtttaaataatttacatggtccgtttacttgaagatgtaccgcattatag
-acgggtgatatattgttaactcgcttttaatgaaacaagaagagtttgtttgctacgaacaaaaattttcccctttttaa
-tatagcaatacacaaactggcgataagtcgtaagtgattgaaactggggtggtggaatttaggcagattccagcattatt
-tcggatggcgatgtctagaggagtagattttgatatgggcttcagttgatgtatctacacaaataaagtttcgacctgtg
-catatgtacatcatggctttcttatcgaaagccggactagtcgtattatgtgatatattggtgtgggtatgaacatatgg
-aaacgcgtggtttttcagagatagagaatagagagtttcgataggaaagtataaaccagttttattaaaaagaataaggg
-gaaatatagtgcattatcacagtatagaagagaaaataaccataaggttgttatataagaagtgaaagagcaggtgtaga
-ctgaaattaaatgttgtcgcgaatggagcagatgttgagactgttaacaggcaagctagaggaatgtttattgttgttga
-tttacgaaggcgcttggacataatgtagcacggagaatagtggccatgcatgctacggcagatatttgggtttattcgtt
-ttgatagtgatcttggttattcagcaaaaaaactcactcctatttttacatgctgtgaagatggaatgacgtgggtgttt
-aaatgatttacatgcttattagattatgttttcatcagagatcaattagttgggaaaaatactttgtgaatttgatagcg
-aaacgaccagatttaatggaataactcactacctgctgtaccctgccatttcataagaaggtaatagagaaaataggata
-tgattcctttcattccgcattagcacaagttgaaagctattttagaaggattctctattacaacaagtaaagttagagat
-ggttatagaaaaacaaatcgaatacgtccagagcaacccagcgcatttgtacatgggcgtatttcagcgtttgatcgtct
-tttcggtgataacttgaagcgggttgcgtatttattacaatgtacggacgaagtgtggtttttacacgatggagtagagt
-attagagtgtattcataaattgagaagggaagcagagaattacataagaatagtagtaaagtagctattattgggctagg
-gtatgtttggccttcctttagcggtacattttgcagaaagaagggcatacgtacttggattagataaagaatattaggaa
-aatagactaattataaaaggagaaagtttatattcggatgttttttctaagagtttacaaagtttattggacgaaaaaaa
-aattaacagtaaataaccggaatcaaggcattgtctgattttaaatagtgattatgttattgtaaactgtccgactcaat
-taatggaacaaagagaaccagacttaagtggcctcatttcgcttcgcattatatacatacaaaattcaaaaaggaaaact
-tcattttttggaaaagctccacatatccaggcaacttgaagagtcatcctatctaatttatttctcataatagagataaa
-ggtagggaagaattctatatcgaaatattcctgagaggaattgatcagcaaatagtcaatatcagttttttcaagctatt
-caaaagtttatagtggacaaacagaaaagttgtaaacaaaaggatacaggatttatatagtacgccatttttgaacgaag
-ttgtacttgttagcttcgaagtagcagagatgtgcaagctattttgaaaatattcagccttaggttaacatttttagtaa
-atgaactaaacacactatgtgaaagttttaggcattgaattttatgaggcgattgaagcggcaattacaaaaccatttgg
-gttttactccgtttggcagggcagggatagggggacactgtttccgtagccctttatatttttaatggagaataaaaaag
-caaattggggcaattttagtcaattatttgaggcttgcatatattaaatgagaaatgcagagaaaatggttccgcaagta
-aataagtgtggtgcaattacctgcaacggtgtttaatttgtagggattgcgtaaaaaaaaaaaaaaaaaaaaaaaaaaaa
-aagatgtaaaatgattttgaggaatacagcgtttacgattattcaattattaagaaaataaggatagagatagaatatca
-tgatccttatattttttccggcagaaattggagataaggtttgtcgcaatttttttcttttaagatggaagaaagttaaa
-aaagcggatttggttttttaattttaaccggcatattctcatattgattggagctttttaaggaatggatggtaatgaat
-acacgcgggattgtaaaggaagggtgagtaaatgagtaagaattgtttattacggttggggcggatttaatcgggtcgat
-taggctgaagagttgataagaaagaggttttaggtactgttttgttggataacttttttataaagtaaaaataatacgct
-aaagagtaagaaagaaatgcgtgttatcaaatagatgatattagataaaatttatttaatgaattagtagatcagcatga
-tgtgtgtggtctattagcagcaattattaggtgtgaaaacaacaaatggacacaagttataagagctcatagaacgaatt
-tttgatgggcgacaagaaatgttttacagagcccgtaacgaaagaagaaagtgttttgctttacttcagaagtataatgg
-taaggccagccgcttttctctgaagagggagatcgattgttacgggggcaaccatctaaattcgttgagttatgggcagt
-ttgtaaaacgttggaagcgacattatgtttagggtagcattagagggtagtacgatttgtcgataaatttaatatttatg
-gtccaagagcggaagatggatcattgcaggagtaatccgcgatttatcgcgcgggtccaactgcaaggagaagacattct
-cgtatatggagatggaaagcagacacgttgttttacggtatgtaagtgatgctgtcgaggcaagcttcggcaatggatga
-gaaggtaatggtgagattattaatataggttttgagaatgaaaagagcataaagaagtagcagaagtaattaaaaaatta
-acgaatctttctcgaagattgtcaagtgcttttggaagaagtataatcctcatgggttttgaaagaaattcaatagaaga
-cagatgtaaacaaattaaaagagctttgttccaatttcagggaaaagtaacgtgggcaaaacggattgaaggaaaacaat
-taagtggtttcgtgaacaaaacaatggctaagtattatctgttattattcctgcatgtatgaggtcgctacgattttttc
-agacgttattcatcggtaagacattaaatccagtagtaaatcattttgtagtagcaaacggtttgtatgatggaacagag
-atgttgcagatcgtttagggtggtaagtaatcagcatacagagctactagggaacgatgttggacgtgcagtcgcgaaac
-atgcgataggtgctgtattactatttaatagatggttgattttgctattcaaattcaaaattaaattattccttaatcgc
-ggattttataccgataggcaggatgtagttttaaataaatttggatgcatttttaaaaaggcaaaaaccaattctattac
-agtatggcgcaaaatattaaatggtgtgtggcgtgaaagaatttcaaatgaatatctttattaagattgtactcatgcgc
-tggacagaaagaagtgtttcaagctggatatgaatgttttgttgatggtggtggctcatttacgctagtttcaaagtaaa
-tgagaattagtcgtcattgtgctattcgaacgtatattacgcgaataaatttcgtccattccagcatgctgaatatggga
-caatttttccaatgtgaaaaagaatgataggtgtcattatagaagcagtagccgaacggatattaagcagtgaatgcgcg
-cggaggaatatttgatggaataggaaaagggatagtgtctatcatactttaagttattgaagagttttatcaaggtgggg
-tgttacattgatttctataaggaaagcaactatcggtttgtttattcccgtacaagatgaagagaaacaatggaaacgtt
-gagggacagaagagcttacgcaaaattgaaaccttcgaattatcgttgtcgtaaatggttcgtcaataaaactgaaaaaa
-attgcaaaagatcaaaggggcagaacaaattgtatataaagaagcactcggaaatgatgtggggcgtcacatttggaacg
-tattttgcaaaagggagaaattggttatttatagatgggattttgttattccagcgagtgagctatatcttttgcgcaag
-ctattggcagatggaacagatgttgcattaaatgattacatcattatttagatttaaagagtacttatcttgtacctgca
-tttaaatatgcattaaatttagctttgtgaatagaaaagaattctaggcgtaggctctcttatggtgtacgtaatgcggt
-tttgccgtaagtgtttgaaagaaattggtgttatagatctttatggcgccgtgtgtagcccaagtggaaagctatttttc
-aggatttgaagttgcatgtgtaagtcgtgttgaggtcgataagatgaggtattcgtcagtgaaatttttgctaaaatagg
-tcatcaccagctgtacttcgattataggtgatcatatagggaaggactaggatcaaataattgattaacaagacaatcgt
-ggcggattctatgatggcatagaaaaagaagatgttttatagaagttaaaaaaaaagtgtacaactgtgtacactttttt
-tgttctgtttataaaaactataacagattaggagataagagtattaagctctacaatgggtattgttcttatttacaaaa
-taggactcgtatataaggatacaaaaaaataattaaggaaagggttaattttacagacttttaaattgagttaaactata
-tatattagtagtttgctcaacatttcacaaacatgtcacaaactatttcgttcatttgtaaaaaaagtagttattcctaa
-gtgtttgtagctgtttatataaacaaatctttagtcgctgtataataaaaatgaggagattaggatgactcaagtattag
-aaaatggttaaaaacgcatggggaaaactttaaaggtgaaaaatggaaagcagagattgatgttcgggatttcattttaa
-ataagttaagttttcggaaggggaggaatttcttagcagaagcaactggaagcaacgaaacaccctttgggatccagtaa
-tggatttaacacgaaagaacgttgaaaacggtggggttcttgatatgatacaaaattgtttcttctattacatgacatga
-ccaggatacttaaataaagatattggaaaaagttagtcggtttccaactgataaagcgcatttaaacgttctttacaacc
-atatggtggtatgtatggcagaacaagctttgtgaatcttaggaatagaaatggataaagaaattagtcgtattttttta
-gaggagggagaaaaactcataacgcaaggtgtatttgatgccatttacacacagaaatgagaatatgcacgtaaatcagg
-tgttatttggtcttcagatggcattacggacgtgggaggtattatcggtgactatggccgatagcgtttatatgggtatt
-gatcatttttaattgaagcggaaaaaagtgatttgaatttttaactggtggtgtaatgaggcgagatacaatgcgttttt
-agcgaagagttatctgagcaaatgcggtgacttcaagagttaaaaaggaatggctgcttctcatggcttcggattatttc
-taagcaggcacaaatgcacagaagcattcaatggtttatactacgcatacttgcagcgattaaagaacaaaaggagctgc
-aatgagttcttggaacgtacttcttcattttcttagatatttacattgaaagagatttttacaaaaattggtcactttaa
-caagaagaagaagtttagaagaattggtcgatcactcattatgaaattagttcttgtgaaattcgtccaagaaactgtta
-taatgaattaattcctggtggactgggccaacttgggtaactgatatatcggtggtatggcattagatggtcgtccatta
-gtaaaaagactcattccgtttctttgcatacattagattaatgtagagaccagtcagaacaaaacttaactgtttctttg
-gtctaaaaattaacagagaacttttttcaaaaaatactgtgcgaaatgtcttttaaacatcagccttgcaatattgagaa
-tgatgacattatggcgtccctgaatacggcgatgattacgggttattgctggttgcgtatctgcaaatgagaatcgtaaa
-caaaatgcagttcttgcggagcttcgtgcaagacttagccaaaggcattattatatgccgattagagcggtaggaaagga
-tgaaaagtctaaaaagcacgagagttggtcctgaggttagcaccaatttacttctgaagtatttaaattagtgaagaagt
-tttgcatagagtttgatatgacaatggaatggttaggcggttatatatgtttaaaaacacattaaatgttttatccatta
-catgcaatgataaattgctatgaagcatattgaaatggcattcatgatacaaacgttcttcgtaaatggtaaacaggtaa
-tttggaggcatggtcctatttgtagtaggcagattcattagtggcaaattaggtacggcaaagtaaaacaattcgtgatg
-aaaattggtattgcagttgactgtcgagattgaaggagatttccctaaatacggtaaaaatagattgatcgtgatagatg
-tagctttgtgttctgtaaatctggtaaaaacattttgaataaacttcgtaaacataaaacaataggccagaaactctgtt
-catagcaaggttgtcaatcttaaaatcacatttaacgttgttagcggtagaaaatggataatatccatgggcgtacgtga
-ggaggaacgtgcattgttgcacatagggttgcgggaacccaatgcatggacggatacaaaaggtgcatagcttgttcatt
-attatctgtgctaaataaccatattgaagatgcacaagattggtatgtattttaatacatctctattatttccttgagaa
-agcctttggtaagaagatgatgtacacgtacgttaatggttaagtataatgcttgatggctatgcagtaaaagaagggca
-catttaaatattaacgtatttaacgtgaacatataatgatgataatggaaactgcgtgagaagtaatcacaattacactt
-cgtgtattgttatgctgtaaatttattaaattaactcgtgaaccacaaattgattgtaattactgtacatgcatgaaagc
-atgtaaatgaaaaaagaaaggtagtgcctcttcggaatctttaatatatagctggagtggagtgatggctgtttgcaata
-aaggaggaagtaacatgggtaaaggagagtaatacattctggtagagtcgttgtggtactgtttgatggccgggttcgtt
-atgtcatatttacacaagggtgtctttattaagttggtcaatgattgtcataatgctgaatacgtggaaatcggtaaaag
-gtaaagaaataacagttgaagaagtgatgcaggatgtgacatgttacattttcattattgaagcttccggaaggcgtgag
-tagacagttagcgggtggagagcattattacagctagactttttaattgagttgttttaaaagatgtaaaggcaggctgg
-tttcatacaaaattgattcttctgttggttgttatatgctgaggaaccagaaaattccaatggatataaagctagatatt
-ttaatggattatacagatttttagttttattgatctgaaacatatcgattcaaaaagcatcgtaacttaacagggaaacc
-aaatgaactattttactaattttgagtgcgattatttatgattagaataaacgatttgggtagacagtttagtctggtgt
-taggataatggaagaggattacaaactatcttagcttattaagtctgtataatgtttcaaaaagttttgaagtgttaact
-atcataagcttgggtatataaaatggggaggcgcttggaccaagtatgctcgaaaatgtgaaggcacctactgagaaaaa
-tgtagaacagctaaatatattttacaagcggtctaatcaatattggattaggcttttttgctttctttttacaataaaat
-tagatgtatatattgatcaagagtatactggaaaagtaagaatatcataattttgtaacggaataaatggagaaatttac
-atattgtaaaggaaacaaaatagtaaaaagaattagagtaaaagagtgagtaatcatggaatagagaaatttggtaagtt
-attgcggaaaggctctataggaaagtaaatgtaaagataaatgagcacaataggattaaggggtaatcttatatgctttt
-gcatatcagacaggtacatagctgaaagggaattattagaatcttgtttttgtattttttaaggaaatgttttttctatt
-gcgtattgcatatggagaaacaaagctaggaagtggaatttgttttgataaaaaccgccaaggttttaatattactgcaa
-ttaggtaaatggtatgtgggcgagcaaaacattagaacaaaatttcggcaaaaggaattgaagatgttattgtatgcgaa
-cttgtttggagatcatccatttataactgaattacaaatatctataatttaaaagttataacaataggaaaagaattata
-tcgtttgttttattaggggtagaaaaatttatgataagcaaatagctcttggtatgcgactttgtaagaaacggtttgaa
-aaatattagcaggtggagaaacagatattgtaattaatacatttcgcaattatgctgtaccagaatgtggaagaaacaac
-aggtatttattcctgtctataacgtattaagatttttggcgtgacaactatggattcatcggagagtagatgttattttg
-ttggcaaacggatcatttgaaagaatttgggatgggttgatatcggtgtactggcggaaaaattgttgaacaggatcaat
-tccggagtagttttgagtttaaggttaatccagaattcatatatactaatatcagttaatgtaagaataaaagattttta
-ctcatttgtagcggtgctgcatggggttattaggaaatgtaaaagactatggcaatatttatgtcagtggctatttacaa
-gtagttgttttgtttgttgggaaaaatgaacgctttaaacagatttattagtttacagaagcaaaattccgatgcattaa
-aagtgtttgggtatgttgaaaatattgatgattattcagtgttacttcttgtattgattacgaagccaggcggtaataac
-attaaggtggaaggctagcaggttgcaagtactgtcatttaatataagcctgtccaggacaagaaaatgaaatgcgatgt
-ttactttgaaagaaagggagcagcagtttgtcaattcgcgattgatagtgaggtttttttgcaaaacagagcattaatta
-caagctgatgtgaagcttcttcaaattttgaaggaagcaatgaaaagcatctatcttcccagagcagctggtcatattgt
-cgatgcattttgcgaaatcatgcagaa
->m141013_011508_sherri_c100709962550000001823135904221533_s1_p0/1024/0_2553 RQ=0.752
-agaaaaacaccacacaaaacccaaccaagggaaaaaaaaagaaaagggaaaaaaaaaagaatccggcccccggcccaaag
-ggtgtttcgaaatgtttttttttttttttttttttcaacgctggctgttccccgatggggcaaagcgtaaacgtcccact
-ggttgaggtgggcagcgtgggtgaaacgaaaacacgcagtggggtaaaccgcggtttttaattggctttttagccggacc
-aatccccggcaaaattcggtttgcaccaataaatcaaggcccgcgaacttttcttcgttttttccttaattcccgctacc
-gggcatctttcagtggcctggattggattttatcagcatcttcaatggttctgtatcaacatcataattttgcaccgacc
-gaaccaatgccgcggaacaaagtttagcaaaggtgttatcgaaagaccacggatgatgtgatacgccccggtatcctgtc
-ccgtagcgcccacggagcgaatcgacatccgttgccactgtggcgcggtccaacggccgaatagtcaaccaaaatcatcc
-agtgttcatggccgttttcaaactgaataaaatttaaccccggtgatgaatattcttttcaccatggcgttttggcgaaa
-caaacgagatagccagaactaatgcccggcacctgccgcaatggcgcgatattgacgcgatttcgcgacaacacaatcat
-gatgagtgatggtactgaattaatgcaccgcaagcgcgttagcgaaacagcgtaagcaggcgtacgcgtgcgggcgtggg
-tagcgggcggcatgaatatcgaagcagccggttttttcggatcaaactggcgacggcacgcgttttaccagccaacgcgc
-cgagaagaaaagatgagtgcgatatgcggatcaggatatctagcggtttttctggcccgcgcgcggccgttttgcagcca
-gtttcagaatcgaacaatgcccgatgcgcctcaacagcaacattaccggcacgcagacttgtcagaatacgccgggccgt
-ttgagcgcgccgacagctcagccatttcaagaccgtttttttttggcagctccggatagttttttacgggctgagtatgt
-ggcgagagagtgatggtttttcgccagcgcagcgggataaacatacggaaacaaacgctgcgattaccaataatgccagg
-gctgcgcaccgttgcaagcccatgcaataatattttcagtgctgttgcccggatagcgaaggcaacgaaaagaaaaaaca
-gcacgataaaataggcgcttgcagccagtgccacacctagtcgcaaaggcgcgcggaataaacaggctgaaaaaggccag
-cgatgctccggcgaagtttgagcaaatgctgggtaatgctctttttttatttatcgaaagatcaggttacatacgccaga
-cggtcattgcacagcataatgatggacgttcgcgtgcagcgcacctatctgtacatatcacctgattattttagataatc
-ggtgcacggcgcacaaaatcaggccataatgacctatcaaacctgcttaaccagcttcaggcgacgactcagtcacgggc
-gctttcccgctcacgcctcctgactgtgctccccagcaccgcgccgcgccccgatccccgctccgctacacgcccggtgc
-tcaatcccccccgccggcccccgttctcagaaacgaccacgagacccctgctgcagagatgacgccctctcctccccccc
-atcatcccgcccccccagctcccctcccctaccgtccagcccccatcccgtgccggaccccccccgcatcttctcgtcgc
-cgaccagttagtcacccgatatcgctcagccacgcccgctcccccccgcccccggtccgcgcctctctccctcaccccgg
-ccagtcccgcccacacccctgcgagcgacgtccctcgcgagcccccccgcgcactccacccgccgctccgcggcgcagcc
-tgacatcgggcagaggggagccccgctcaagtgcgcccgctcctccagccctccccccccgcgcgtccgtccccctcgcc
-cccccccggtcccccaccaaggagcacctccccccagccgctgtccccgctccctccccaccgctcgtccatgccccctt
-tcacagcggccccccccttcctcgcactcccggccacggccccagccgcccccccgccccggcgtctctactcccccccg
-gatccgacagcggcctcccgccgggctctcgatcatccccccgccccccctcgctcttttgctcgaaccgccccggcccc
-gccacacgtccccccctgtcctatcgctccctcgctcccgccgcgatgctaccgccacgtgactgctccccgccgcggcc
-cctccctcccgaactgcgtccaccgagccgggctccgacgccctcccaccttcatcttcccccccacggctccgccctct
-acttcccactgcacccgagccgccgtccgcctcccctccgcctcagccccacccgcagcgccccgcctcgtcc
->m141013_011508_sherri_c100709962550000001823135904221533_s1_p0/1060/1495_20545 RQ=0.841
-cttagttgcccgtggttgtgatggaagttgggctgggagctttactggttacgctgtttgctgtgttccacgaatatatg
-gcccggtagaaagtggagtggtcaagtcggtttccttttattggcaactgtcatatccgctctgttcatttgatagcgat
-ggactcacaggccgctgattagtgcagagtggaactggcgggtacaactgcttatcctgcatattgtcgcttatgctacg
-gcgctggcctggcgctactcttctgaacatcccgctgccctggctggactcgcgcggaggtatcaggaagccgagaaagt
-acatgcggagtatagaaaaaggtcgtcatatcgccagccgggggtaaacctttgcgcctgtggttacttgctgatgaggt
-aagcgccacagcggatggcggaggaattcagaccttacttgacaggagtattactcgacacggcgtgatatagtctttgt
-gtgctgattggccatgaacgttgtgacagtacactcactaatatttaacatggtgccaacaatattcgagccagggtgag
-attaatttaataagactcgattgttttaaataccctgagtaatgtttggcgcgccatttggtatttttattggcatgctg
-gtgatgtgatgaaaattcgcgtaaacacatgggtgtggggctattactcctgattgcggtgctcggatatatctattact
-gcacaccagtagtctcataattgaattggttcttcctgttactttcgtctatatgtacgtttgctatctcgcagtgtatg
-tccgacactggcgaccgaggcaactccgtggctcggtctggcgaatgcggtagggcggaatcagtggtattgccgcactt
-aatgccgtttgcagtgcgctcagttagttatggcgtttacgggagtcttaattcttctgggggcggttttcaattatttg
-tcgcaattgctatcgccaagattcgatcgaaaccacaaaaggtggtccgttgaaagtttaagtattgatgcagtacgccc
-ataataatttagggggaattcaaaatgaaaattcaaaatagcgatattgccaggtgccgcggcacaatgaaaattatttc
-tagcagaataccagttgctaaaggaagatgaagttttgcttaaagtagaatatgtgtatttgtggttcagatgtaatggt
-tttgaaatcaggccgtttatttcgctaaagacccaaatccatagaaattggcctggtcagatgcgcgggcggttgtggct
-gtgggaagccgcggtgcgcaaatttaaaaccgggggatcgggtaatatcgacctgggcggttcttgcggtactgtcgtta
-ctgtctggaaggcaaaattaacattgcccgcgttattttatggcgacacaaccataccgggcgcataacgcactatctgt
-gtcaatccgaaagctttacttacaaactggccagactcaatatggaacacatggaaggggcgctgtgagctgcgcaattc
-gggatgcatgccgcgatgctggcaagagttaaaacgggtagagataattattctgggagcaaggttgtattggtttgatg
-acgttgcaagcggtgcaaatgctgggaagcacggaattgcgtgtcgtttgtgtgacttgaaaaacgtctggaatggcgga
-acagcttggtgcgacagtggttattaacggcgcaaagagacactattgcagctgtcaagcaatttccgaagacatgggcg
-cagatattggttttcgaaacagcgggtttcttgcggtcaccgttaaacggcaccttatctggtcatgctcgcggcggtaa
-aattatgattgttggtactgtacccgggattggcaatcaatttcctcaacaatcattcgcgaagtcactatccagaacgt
-attcgcgtgccaatccgttaatctgcggtgcacgattgaagctatttcttcaggcgattcgatgtgaaatcggaggtgac
-attttacgattatggatgttacaacaggcatttgaagagtcagttcacaacaaacggcgcagtggcctggtcgacattta
-aagcacgctctattgtaaaattaggcggattaattaatacgggaaacagaacatgctcgagatatcagatattgggaaac
-gatgcacagaataacattatgcattgcccattttaacgtatggaatgcagaatgtgatgcgttatgacgcagcgaagaag
-cggaaatcacggtttattattttcttttgtacaggttttgtcggtaacactattgaagatttctctcaatgatggtcatc
-atggcaacaaaaagcaacgtgccggtaatactcattgggatcatggtcggagtatggagattattccaataacgctggac
-tcatggtatgcattcattaatcgcgtgatgcttcgcgtttgatttcgaagaaaatattcgtttaaccaaagaggctgtcg
-attttcatcgcctgggtattctggtagaggcggaattaggtcattgcggtaatgagtgaatacgttatgaggatgcgcat
-ggggctatcactataccgatcctgacagggcggccattggaatatttggttgaacgtacgggctggagatatcattggcg
-tcgcatcagcaaccgcagcatggggtttatagctcagacacattgaactttgaggtcgtcataagacgcggccatatacg
-cgatgcgtttctgttcgctggttttgcacggtgctcggggattcagtgatgccgacattaaactgcaatttcgttgggtt
-cggaaataacattcataggagctctgtaggccgcaatggtgcagtgaaaagaaaaaaccaggatcagcctttctgcattt
-agaacgtaagtacgtaaagctgtaaaagaacgggcattggaaaaaattaaactgttcggttctatggcaaacgatagata
-atggataatctcgacgtatttgtataggtgccgctattgttgatattccattgcaaccaggtcgtaaatattttgatgtg
-gattcttatcctcttgaaagaatcgcaatgacaccggggtgatgcataaatggaagcaacaatatttctcacgtctgggt
-acgcaacagcattaattgatcatattggtaaagatgccggcagggcacatttcattctcgacatttgcggcaaagagaat
-attgattattcaagcctgaagcaggacgtcagcaagaataccttctattaagtttggatggtgacggagatgggagcgga
-ctttgtcgcacaaagccgctatggcagtcagttggacattgaatttgacgatgttgattttgcgcggttttctcaggtgg
-aaattagtcacaggacagtattatcaacagtcaccaactatgtggagcatttggtaaagcgctaattcagtttttacgca
-agctaaagcccgagatcgcttatctgtgtggatatgactcaaacgcgggttgaatgaaagctgatgatatttggcgaaga
-tctcgagttatgtgattatgctttctaaattttggcgagcaaatacttcccgggaagagaactggatgaaattgtgactg
-ctttcttgcgatgcggcggtaaaaacggtggatcgattaaacgggtaaagacggccttgcttcttggcgtggtgaatgag
-atgaggtcggcggtcgcaggaatatactctgccatcgacaggcaattgtgcgcggcggataacttttgtcttcaggtttt
-attgcggcaaatcctgtgttagaataggtcaaaatctgcgtgaatgccaagcctggcaccccgcttatccgttgttttcc
-ttacaatattcaagaattaacgcttacggattaaccaatcgccttctgcgccttatacccctatttcgcactcaacagga
-ccccgctagcccgtattgttatttataccgtgatgggaagcgatctcgccaatgaaggcttaccgtgctgcggctttatt
-ttacaactctgttggcggctctggcgctgtttattctcgtccagctcgcaacctctacgggggccgaacaccaaatcatc
-gttggacactctgttcgtgctccgccctgccgcagcccactttactcaccctctgagcattcgcccaaaaatgaaaggat
-agaaccgactgttgcaacataatattcaggtgtcactggaaggacttggctgcactctgttttctggctgttgctgggct
-tagcgggctgcgatcaacaaggaaattgcgggcggcaaaagtggaatacgacggactttcgaacagcaaccgctgcgtgt
-cgagccaataacgcatacggtaacatggctggtgcaaattaaatggtcgtttcctcaccgacgaactcggtcagtgacgg
-tattcgtgttaaagatggctccaacggaactataaatcgctgtttatcgggtttgcgaccctccgccgaaagccattttt
-atggaagccctgaaaagaggcaggtggtacgccgggcgaaaacatgacgatggataataaagaaagaaacgactccactg
-tacaggcagcaaactggatatttcggtcaactggcaaggggcggcaaaacagccgtattccttcgatgaagtgattgttg
-acaagtaatggcaagaaactggacatgcgctttggcggtccatttaacggcagcaagaagagaacgaaaacgggttgcct
-ggtgtgtctggatagctgcccggtcggccaaatcgtcagcaatggcaacatacagcttatggtgcggttgaaaaacgtgg
-tgaagttaaattcaaaggcaatgcctcagttctcccggcgataacacgctggcaacggtttacctttaaaaatcgccgaa
-taaagcaggataaaaggattgatgatgtgcatcgcgaaaaatctggtactaccgtataacctcatcatcctgttgtttcg
-ctatgctgctggcatgggcgctgcttcccggcgtccatgagtttattcaatcgcagcgttgcgggcgtttgccgccgtgg
-accaacagggtaatagaacgctttattcaggtcttacgccggcgcgtcactggcggcagttggtctcgttttgttgatcg
-gattttgcaggcccattgctgcaactcgccggctacctgcgtttttgaatcacccaggccccttttggccaaattttgcc
-cgtttcgctgtttggtcggcggtcgtctggggcggcctttgccctgtcggtggaccagtttcgatggccggcgcgcgcgc
-ttgttgcttttttatcgccagatgtgatggggccgcgaagtggtggaaaaattgaaccgggcataaaccgttgcttgaaa
-cagtaatggacggctttctttcactcgctacggcaacatgcaccattctggtctgtcggttattgctttgtccctttcga
-tccaatccgctatggctgccggggttttgattcaatatcgttttcgctcgttattttatcgccaccaccgggcttggtca
-gtttcccggcaacgtattgttaatttcctaggcgggcagcatgtatacaggcggtacttttctggtttgtcacccggact
-gtttaattctgttttttgccctgacgtggtagaatttttatggcgagagaaaatattggcttggaacgccagaagaggaa
-tgcctgatgggtctttaaccgccgcttgcaaaaatttcctattaattttagtccacaaggcgtggctgcatcgtgcggcc
-atattacggcgaaggtggccttaagcccagcattcgctaggtgggtggcggatcccgtttatcttttatctgtgtgtcga
-tgtttgttggctggctggagcgcaaacctcaccggctcgctccggtagtagaattcgcttgtcaaagcgcgcgggccatt
-gcgcaaatgtgcctgtgtgaagtttttgtgtgattatcagcagtctgaaaagtcgccgagcgcaccgatgcagcagcgat
-ataactgctggcagtggctgactggcggcaacagcccgccttctttagcgatggaacgaaccgctgcgctggataacgcc
-gaagccgcaagcgtaacgccgccaacggtcgatgatgccccctgcgtacgccgatctggctgcgcattttgacgactcag
-atgcgctcaccgaaactgacgggcattgaatgcggacctgcaaaatctgtcagcgcccgttttaatttctgctaatggac
-attcccgctcaggggccttgtgcgtattcctgaaaaaacgttcttaaggagagatgatgcgcgcattgtggtggttgctg
-ggttgtttatcgctgttttctctggcaacacaatgccagtgactggcaagaaattaaaaatgaggcaacgggccaaccgt
-ctgggtttaccgcctggggcggccccgataccgcaattaccgctatcttcgactgggctgagcggcgagatgaacaaagc
-ccattacgctataaacctgaagattgtcccgtctggcggatgcccgcagacagcgggttgaagcgcaattcagaccggaa
-gcgcaagccggacgtaaacgggcggctcggtggaaatctgctctgggtgacccgcgaaaacttccggccttaaaagggcc
-aatttattaacaaaacgggcttgggcggtagactcgccgcaactggcgctatgtgccgacacacagctgccggtgcggga
-gatttctttctgtgcgacacaaggtggcggaatcgccactggggcggcgcacaactgacgtttatcgcccgccgcgctgt
-ttacgccacagccaccacaaacgccgcaaagcttcactaggagtttgcctaaaggccacccggcacccggttacctagtc
-cgcgcccccaccggactttactccggcacgggcgtttcttgaagcagtttgctgaattatgctgacggcccgatcccgcc
-cgcattaaagagaagcgccggacgatgcgactttcgccgtgtcaactgctgcccttgttggcaatatctttgatgtgcct
-ggacgatccgtatgtttggtggcggcgaaggaaaggatttccgccttccactcctgatgtataggcgcggatggatgctc
-tgctcgaaagcgcggcaccattggcgggcctgtcgctgaccctttaatcggcgcgcatgcgccggcaaataaaaatgcgc
-cacgcggcgatttgcctgcaagcagttaagttttggctttcgcagaggggatgattggcaacgtgcattttcgtggcacg
-ctttctgcgccaaccgcgaatggcagttgtgccggcgaaggtcgttgccaatttcctgctctgcacgccgatgcgcaact
-gcgctacagcgagaatccctgctgtcctggggcgattccttactgttctcgatccgcaacactgcctgacgggcagcgcg
-gaatcattgcaatcagaattagccgcaggatctgtgccgcggtaactggcttgaaccgcacgccaggtttgggtcaatgc
-gcctggaacaaagaatggcttacaccgttacggtacgcatttaaatcctttttgctgtgggcgaatggtggcggtgattt
-taatgcaccgctgatcccggcagctctcaagactgatatatcgcctgctttgtcgttgactacactgcagcgtttttgcg
-atgccacagttcccgcaggcatttacctcggcaacgtggtgtcgactaccatcggcggcggtccgggggcattgttgatt
-gcctgctggttgattgtggcgctttgttggcctgggccgaaatggcacgtatgtgccgcccgtctgccgtggctgctcgc
-aattcccccatgtggcttttggcacgcagcggccgctctgctctttgtgctgacggaaagggctgctttatgactctttt
-cccgcgtatttgcactccgccaatggacccgatttggcgatcggtctgggcctgcaacccttgcagtgaaagaaagcgca
-tttttttgctgtggatcttagcagcagtattgagccgaaaatggctgtttggcagcaggtcattggtggctggattcgct
-gggctaacagccgctggcaatgctggaactggctgctgttgccctccgtcgcgccttgcgcttggaaattggcgatgctg
-gcgatttgtttgccgtggtcgcttgtcggtgtggatgtggcaattattctcgggccaggtaacccccgacgcggcgggta
-attagctggccgtagcggttaacccaggcgacattgaccaacaaacaaaaggcgcgcttgccagcctgctgttgatgcct
-ttactcgcgcctacgttttgggctgagtctatctgcttatggcgcagctggcggcgcatattcccgcgtagatggcgtgt
-ctgcaagctgccacgcctttattggccgggcaataacgctggcgatttttttacccttaaccggtgtgctgtgtgtggtc
-tgctggcgatcctcgggcgatcagttcgacgagtcatagtgaagcgctcatcaacagcctgacaatggggctgtgcgccg
-acattcatcgctttgctccctgtgtttactggctgggttgggctggaatgggggccacagcgtcgccagttgtggctatg
-ggttgccccatttattacctgctctggccactggtgggcgggctcaggtacacgctggcgctattggcttgaaactggaa
-tggaagctggccggcggtggtctgggggcatctgctgtgggtgaattgcgtggatgctgttttatcctgcaacgccgcct
-ggagcgcattgattcaccgggttaaattttgatgcgcaaacactgggctggtcgcggccaaaatcttcttttacgtgaaa
-tgcctcactcatgttgcgcctgttgctgattgccttcgcggtggggatttgcagtcggtatttggcagtatactgccacg
-gctgtggctgggcgcggggcgttttcccgacgctcaccatgaggcggtggcattaagcagcggcggccagaacggtattc
-tcgccgccaggctttcaattggcacctggctattaccgccttattaatttttgcctgaccctgcggttagtcgcaaaatg
-gtagggttaatgtcaagacaaggaactccgctaatgctctgcgtgaaaaatgtttcgctacgtttttaccagaaagccgc
-ttgctgacaaacgttaagctttacggtggataaaggtgacattgtcacgttaatggggccggtctggctgtggaaaaatc
-actcctgttttcaatggatgattggtggcactggccgaacagttttcttgtacaggtggagctatgggctcatgagccaa
-cggattgacatcggctaagtgccccaccgcacagcgtcagatttggcattctttttttcgaggatgcactgttatttgac
-cagttcatggtcgggcaaaatttactggctgggctgctgaccgggctgacacttaaagggaatgcccgaacgtaatgccg
-gtgaaatgagtgccacttggagggcgttcatggccttgagggagctttccatcaggatcctggccactttgtctggcggt
-cagcgagcgcgcgttgctctaactacgcgcgccttttctcgccgcaaccaaaagcgttactcctgggatgaccattcacc
-gtcttgatgtgggctctgcgccgataattttcgcgcagtgggtgttcagcgaaagtttccgcgcctggcgatccccgtcg
-cttccagtaacgcaaaacgatctccaggatgttcctgctgataccgttttctgttctggatatggcggcagtggtccaga
-aacaattacaacaaactgcgataacgcaaagtttttctgcaatgcgtcagttcagcatggcgcactcaaaacttacaatg
-tcgggattttcggatgaaacagtgtttctctcaaatgaccgcgtctggcaaatggcttaggctggcttgcgcttcttcag
-tggccgctgaactggcgaagcctctacactgaccagcttcaccaacaaaatggcaaagcgatagatactcgccccagcgc
-gttttattaacgctggcccaacaaaaaccttaaatggcctttcggtcatcagcgaaaactttgccccttcaacctctctg
-cccagctggcttggacaaaatgagcaccgaacagctcaatcgcgtggtgcaagcaacataacctgaaaaccgagtgctcc
-ggtggcccgctgtagcggtaatgacagagtgatcgaacgcaccgtgcaaaacggcgactgcaaaaagcaggtttaacgca
-taatctccatcctgattgacgcgctaagcgaaaccttcccgtctgcaaaaactgccgcaattgttgaagcagcttggttt
-tatccgcatggctgcacgacctgcaacaaggtaaagaggttacggcgaaacctgccggtgactgggaaagtacattgaag
-cggcccctggggcgctcctaagctttaccttatcaggccatatttacccgcggcgctgactacatcgaataccaacgaag
-tggaaagtgaaaccgctgtggaagcaaagttttctgatgaacaactaaaagcgatgctggcaacacacggcattccgcca
-tgacagaccggtcattctggtatgggcgtgaacgtcatacgctgcagcgcgtgtggcggcagattaacatggcttttatg
-ctggcgtgaaagatgtgcgcctggctggatgggcggctggcaaacctggtccgaacgcgggactgcctgttggagccgcg
-gaatcgccacgaaagtgaaagggttaaccggatttcgcgtgaagactccggcacaaccgcagtttgatgctcgatatggg
-aagcaaggccgcgtggactgctgcatcgccaggatgccatcgcttggtgagcattgtttttcgttggccagaatttttaa
-tcggtatcggaccagcgttacaggctatattaaacaaaaggtgaaatagccgcgcacgttgggggaacgcttggtaaggc
-gactcggacgcatatggaagattttcaataacccggatggccatgcgcagcgccgatcgatattaccgctatgtgggaag
-agcgtggaatatcaaacagagcagcaagtttcattctagctgcgggcaccggctggcgccgcgtccgaaacctttatgta
-cgcacgcgcatgggtttggaagcatgtttccgggtgtatgacggcgcctggtacgactggagcagcgatccaaaaaatcg
-cggtagcaacccggtgaacgcgggccccggacagtagcaaataaccttgcaattaactgacgctggagcgacttcagcgg
-tcagatcccactccacaccctgcgtaaaggtcgtcatcgcagcacaacgcaccgaagatcaacgcaacgcacgcaaacgc
-aatgccagggaataaacatcccagcacaaacagtaagatcgtttctgtgcccttcggtttaatccccgatagtaaaaccg
-acttatgtgcataactcggggttatcaatctgctgtttgctggggccagtgcagcaaaaggcgagacactgcctgccgcg
-tgccgataaacgcaaacaacaacgcagaccgactgccagcgcatttttggcttaccggtgcagcaagaataaagccaaac
-ggcacagcgcgtaaaagatcagaaaatcgagcagaaatcatcaagaaagccgcccgcgtggtagctctctgcgccgcgcc
-agcgcaccggtccagaccatcaagcagccgtttcaacaaaaatggacgactctagcgccgcgcagataccaagcccagcg
-ggccagaaacggccagagccagaacgcgatggcaaatcccactaatgttaaagccatctggcgtatgcgcggtttatcaa
-gaacccgcaacgcactgatggcagccaacggtttaatccgggggatgaagatggcagcggtctagcacaggcactcctta
-aaatataaacgctttctgattgagcaacaagtgcggatattatggcagtttttcgcttatctgccgtgtgtaatttatga
-aaatggatttgagttgttgccaacatccgccatcattgaaacgttgatggcaaaaattttactcgcgcaacgccgcggca
-gagcagatcaggcggggattatgggagtttgccggtggtaaagtcgatgccggatgaaagtcgcagcgcgcagcgctggt
-gcggtgagttacgcgaagaagctgggcaatcgagagcaactgtgggtgaatatgttgcgcagccatccgcgatgaagttc
-ggggcggattatccatcttccatgcctggcaacgtttaaccctgacttcacgggacgttacaggaacatgaaccatcagg
-ccgctggtgctggtctcacctgaagagggcgcttgcaatatcacgctggccccgtgctggacattccattattagaggcg
-tttatggctttacggccgcgagaagcggattagtgctagaggtttttgtcatcacgcctgggcattgcaggcagtcttcc
-ttcggctttaaattaccgcccttcagaataattttgatctgataaacgcagcactgagtacagggctgcgctgactggcc
-cgctgaaactgaacacttctggcggtacgttgtaactctccggacgcgtcctggaacgcataatgcgggttagccagtgc
-aattaatggaaatgctaaactacggcgaacaactgcctcgactcacagggaaactccttaagttattgtctctgctactg
-ataaggtagccgggtggcaaaactttagcgtcctgagttatcgcatattgggttatgaagattactctcgttattaattt
-tgctttcctgggtcatttttttttcttgcttaccgtcaattcttgatggtatagtccgaaaactgcaaaccgcacatgac
-agtaaacaacataagcacaatcgtattaatatatagggttttatatctatggatcagacatattctctggagttcattct
-tcaaccatgtcccaaaaacgcgcgaaccggcgaatcaaccgagtttcgcgcagccgttttcgttcgaaagtaatgacccc
-agctctggcctttttctttgaacaaaaatccaaaattaatcgcgccagatgttcaattactggtgagcgtctgttgaacc
-ggagcgcggtgatcatttcgcgtgtatggttgatgatcgcaagcagatagcatggtcaaccgtgcatggcgtgtgcaagt
-tcagctctgccatcgcccgtaacaaaggcggtatgcgcttccatgccgtcagtttaacctttccattccttcaatgtcct
-cggtctttgaacagacttcaaaatgcctgatattctgccgatgggcggtggtaaaggcggcagcgatttcgacgatccga
-aaggaaaaaagcgcaggtgaagtgatgccgtttttgccaggcgctgatgactgaacgtagtcgccacctggggcgcggat
-accgacgttcgggcaggtgaatatcgggttggtggggtcggtgaacgtcggctttacaatgggcggggatgaaatgaaaa
-gctctccaacaataccggccctgcggtcttcaccggtaagggctttcatttggcggcagtcttattcgccggaagctacc
-gggtacggtctggtttaatttgcacgaagcaatgcctgaaaacgcctacggtatgggtttttgaagggatgcgcgtttcc
-gttttctggagactccggcaacgtcgcccaagtacgctaatcgaaacagcgcatggaatttggtgtctctgtgatcactc
-gcggtcagcctccagcggcaactgtagttgatgaaagcggattcacgaaagaggacactggcacgatataatcgaaatca
-aagccagccgcgatggggtccgagtggcagattacgccaaagaaatttggtcttggtctatctcgaaggccaaacagccg
-tggttctacgttgaatattcgccctgccttgccgccaacgccagaatgaactggatgattgcgcccgcgcatcagcttat
-cgctagatggcgttaagccggtcgccgaaggggcataattatgccgacaccatcgagcgactgaactgttccagcaggca
-ggcgtactattttgcccgggtaaagcggcttaatgctggtgggggggggggggggtgccgctacatcgggcctggaaatg
-ccacaaaaagctggcgcgccctgggctggaaagccgagaaagtagaacggcacgttttgcatcacatcatgctggaatta
-tcccccatgctgtgttgaagcatggtggtgaaggtgagcaaaccaactacgtggcagggcgcgaacattgccggttttgt
-gagggttctagccggatcgccgattggctggccgcagggtgtgctttaagatgtataatggcctgatggcgctacgctta
-tcaggccttacaatgggacacaattcattgcagttacgctctaatgtaggcgcgggcaaagcgcagcgccccggcaataa
-attttcaggcagttttatgagtatttaacggatgatgctcccacggaaacatttcttatgggcacgggcatttgctactg
-tagtgctcccgaaaactcttgtcgtaacggataacacgcttcaagttcaggcatccgttaaactttctggcgatagcagc
-agatatgccagtaaagaaatcccatttgactatttttttgataatcttcttcgctttcgaacctcgtgcgcctttcgaga
-atcaaagcattaatataatgccaggccagttcttcttcaattggtcccgttttgacacagctgtgcttgatatcgagata
-tccatgctaattccgcgcccatattagcttcgccgaggatttaccgggctatgattagcgggaaaaaaaaaaacaatcga
-gatatagttctgaagggaaaacaagcaacatttattcaacaagcgcgatgaacctgctctgggagcttccttccatgttt
-gctttaaaggtaattggctccagtggtcccgccagaaagaaaatgcccattaaggcaacaataactttcgctatcttcga
-taccgctcattgaagtcctctaaggcactcgcgtcttttacttatgatatcgaatcgagtcaaacaggaagcagaatgat
-tattgggaaggtatcttgccaggttccggctttcgcgccggacgcacactggaccagcgtttcagaaccatttagctcta
-ttgatagaatcgtaaggtgcgaagtcaattgtaagcgctgtaacttctcgattactgagcggctcaatacctttagccct
-gataataatgcagttggtttcttttttgctttaaaaaccgcccgcaataagcctccgatcataattaatagcataaagaa
-aagagcatgcccgcggtaatcaggcctcttcattcaaaacggcgttggatgttatcgctgcgaacacaaacattacagcg
-acaacacatttaaataaaacgcccactacaaagcagcatggccttattgttctttaatgcatccgttcaaaattacctat
-taaaatattatcccagccattaaaagaatattccttcgctcccaggatggttttgtaatcaaaacttttttcatcacatt
-cctgttattacaatactttacgaggcgataattttagtccattgcaaaaaaaatatccaagaattttcttgtattgccgc
-ctgatatttcagaatagtgtactcgaaatagcacgagaagattcactcgcttgtacgctatcgcccgctttccgacttca
-tctgctggcggacttttttttcgcactacgttttaacgccggtgcagcctttttcttatcagcactggcacctactgccc
-gggagccaatgcgcgaactgtccgcaccggcgtactgtttggcttgaatcaataagctgatatagcgtcccaccagcggc
-tgcataaaagtcctgatagcgacactgcttttcgctgaaattttgcgtcagcatccgattcccagtgcgcggtcatgtcc
-ggtcgcgttcgccatctccggcaggcgaatggaaatagcgcttttccggcgtcggtggaggtgggatatagcgccctttt
-ttggtcaggaaacgcacgcttgaacaacagttcaaataatccggcacgcggttgcctctgtccccagaccgatcggtcgc
-acggaaggagtctttttcagatcttgatcgctggcacaaagccgcgcgatccgccggtcatcgccgaaagagtgttgcag
-tcggtaaaatggcgcgggcggctgggttttggccgctctaccactcacttcacctttttcacacagcaaactcagtcgcc
-ctttgccaccacaggcagtggcgtgccgtcgttttctatcttcatcgcgctcttttgctgcctaacagcgtgcgccagcg
-ctgctatcagcaagaaacgcgctttagcgagcaaatttgcctttggcaatgtccagtttcgataacacacttgcggaagc
-accgcatccggcagaataatcagatactgacggcaatcaggtttagaccttcgcattcgttctcgtcaggttgatcgcag
-aaactccgtgcggtcgttaatgatggcgtggtggcgcaatcggaccttttgtcatcaacagcggttgcgtaatatctgga
-tctaccactggcttgcggccaacagatccggtggcatgaacactgatggcattcatgcaccgcgtggcgtccggcaaaat
-gttcttcttggcaaaatagcgacaatcagaacgagcggataagtgattagcttgtgcgttttcgtacagtttctggcaga
-tatcaagcacgttctctgcgcactcagagacccaaacgttttgccgcttcaatgctgcaacggctgaaagcgaacaaagg
-cagcggcgcgggattctgattcccgtttatcgttatagctggtgacaatagccggttgaccaacttaatgcggcttaacc
-acatctccgccagtgacgatgtaacaagcgcccttcttcatcctggtacggttcactacgccttcgctcggttgccagat
-agcggtaaaccgctcatcggcaaggtgtcacgatatgtgcctttgactttcaaaagtcttttcgtccacgaagttttcaa
-tctctcatcgcggcgcaccaccagcccaagcacgggcgtctgcacgcgtccacggaaagtacgcccttgataagcgcggc
-attggcgacgaggaatggtaaagcgcacgggtcatacttgatgcgtacaggccagtccggtcacgcgctcagcgccagcg
-cagaaacgcacagcggtacaaactactgtggaacgaagaggtcgaaatcgcgccgctcaaccgctgcgggttaggtcgtt
-tatcaaagcaacgcttgtacctgctggcgcttttcggtgcagttggcagatagttcccgcacttcatccaccagcaattg
-cccttcacgaatccgggtccccggcgtgacgattttcgctggcatttcatgcaggaaccgtttgatgacgttaaagttgt
-ttggtcacggagggtcgggctgtacattgccactttccggggacctgaatcgggcaaatgccgcaagattccgggcgcgc
-atagcggctgtccgtaggccgtctggctgcgcctgctcaaagcaggtgactcgatacacgcaggtcaccacctgaccatt
-accgcactcgataaagcatcggcctttccggtgcggggttttgggcaggacatcagcaatggcgcgcggccagactcggt
-ttttcggcaataaacaacgcattgaattaacgaatctcaacctggcacgaccgccgcgcgctggcaccagtttcgccaaa
-ttgccgtcagtttcaatgccaaaacttcggccggctgtagcttttgacctcatttctgcttccggccatgaccgccagca
-gcaaagcccgccagaagtttgcgatcacacagcagaatcgcgcacttccaccgcggcatttccacccattcagatgacgc
-gtagctggcaaagttacgttcagtgccgccagggtactgcgccaacttaatgtctccttcaacacaccggggagtttgcg
-ggatcgctttcatagtaccgaacgcgtggcgcctgcaacaccagccccgctgacacattttcgctcaagtggcccagcag
-acgcaaagccgtaaccgtcggtcatcgcttttaccgccttcggatgttggcaaaggacgcgcctgcatgttcatccggca
-atcacttccgtcgccagtccctgatgttctgggtttcaacagtgatttttttctccagcgcgtggtaagaaacggccgat
-ccccagcggtttgtcaggaacagttttgctccggcttgtgcggtactgtttttttcttcacccgcttcggtcggtacgaa
-tccacgtttaccgccagaccaaaaatcggctcggcgcatcgatggagtgaccgcccgccagcgcaatacccgcctgacga
-catgcataaggtccaccttcggtcacttcgcgggcaatttgctgggaaaagtttgttaaatcgccagccgaagggatcgc
-aatcgccataatcgtgtttgccccatcggcgaagatacgctgatgcgttagtcgccgcaatgcggccaaaaatcgaaaag
-attatcaacggatcggcataagaagtcggtggtactgataacgctggtgccattgccccaatgtaccaaccgcgcatcgt
-cgcgggttttcaaaattaccacaagcaaattcggatcaacaaacttcgcctgctcactaatgcaggatggtttccaacac
-ttttgggaaattttacagccgcaaccagctccgtggctgtattgggtcaaacgaatcgagttctcggtcatgacatctcc
-tgtcaatgcaatcgggtatggtcgcctcattccgtgaagtgataagtgagagtgtctgaattcctgcgctttgctcacaa
-tccagacatt
->m141013_011508_sherri_c100709962550000001823135904221533_s1_p0/1113/484_7425 RQ=0.805
-ccagcggatgggtcgtacccgcaaagattccgtcgaaaaatatacggttccgggggcctggttgacagggggcaaaaaat
-atattgctttcttctggagcggttggaacgggcaccaatgaaagccttcatccgaaaaagatcagatatgttccacgcgt
-gagcgttgatacggtgtgtaaatcttgctttgcgctgtttccataacacagcaaagcaattcctcgttatggaaccgctg
-cccgacatttaatgtctaatgacgtgataaaaatgcccctgatgtttccgccgctatactgaaagaatatcgccacaggc
-aataaccttgtggaaatttttggttactagagctcaggcttttagaaggaggttaaaccgattgtttatcgtaattcgct
-agaaattccgagctcgtcctcggtcaagggaatcatcaaccgtcaggccggtattggatcagtttggctaaacttcgttt
-ctaaccgtaactggaaagaagaaggttggcacgagcttatgagctcaaatggttggattgcggcagctgagacgttgaag
-tttccagtctatagagcacgatttctaaaatcgtgatgattgagcagtgggaagcatcgcgcatcttgaagcgtcatttt
-cttgcaaaccgccccgcacatggaaggcgtatagtcggaagccgtaaaaggtttgacggtgctggcgatgatatccgtca
-ttctgcaggcctagggaggtaatcctgtccttgttggcctcggaactcatcctgccggacaatgttcttttcgtttacaa
-cctcaatcttccgccatgtcgccctttctcttgcaaccagttgcggcgatcttccgagcggtttcttcgcgtcagcgagc
-aatatcctcatcgcgtcagtacgctgacctcgtcttcatcatcgatagttcaactgcaccacgacggcgagttgtttcgg
-agtacaagcgtggtttcggcattgcagtctgggtttcatatccccctcagaggaataactcgaatcctttaaaacgctgg
-acgcttcggggcttgcggcctcttcttgcgtttaatatggctcaagtcgccatactatttctctttcttccgttcagcgc
-gtaataaacctctttcccgagacctagcaataagcggtagaagcgggtgggcggagtgcggtacgtaaacgtgacccgtg
-tttcaccaacgcgagcgaaatgtttttactaacattaaagcgcagaggcagcgtggcaatgtgcagacccatgcaagtcg
-catccgcgagaatacagattttgcataaacgaagctggctgcagatcgtcgctgtcaggaatcgataccggaggtcgcta
-cgaaatatcgtggcacggttcaacttgcgaagccagctcacttttcgtcggaagagacttccaggtgtttaaggatcttt
-acctttcaagtggccatgatcgccgtgatattcgcacagaatcgcgcgcctgccttggcagattccgcctgcggaggtcc
-accttccacaaggaacatgcgtcgtacggttaaggtcctgcgcggctacaaatcatgcgccagagtttgccaggcaaacg
-ccgggcgctggtccagctttttaagcgcaaccacttttttggccgcacgcatacggcgctggtcacgcgtggaaatcgcc
-atctccgccagcagttcagctgccgccgacgttctggttcacgggccacaggataaaggcatctttcaaccacgcagaaa
-acgaatgccgcgcattgacgcgaagagagacgctcttgtcgtctggcccggcaaactgcggcatcctgcattttactgac
-aagcaacataggcgcagcgatcccagatatcttccgcgacagcttttacacaccgcgcggcagaatatggcggtattcac
-agaactcacgcatcgcgtacaacaggctgacccggcacgaccattaacaatggtactgccctgtgcatcgattttgggag
-aataataggttgacgttaagcttttcggtcagacagttcaccgccttccggcagcacagtagcggcccagtcccacagct
-tcagttatcaccagcgaaattaccgataaacggtttttttttccggcagcgtcggcagaaccatttaccgcttttccgcc
-aaggtaaatcattccgaccgtcctgatagcatccagcgttgtttcggtattgttggatctcgcatctttaaaaagtgaat
-ctcgaacgcgcaagaaggacaattaccgctttggctttagcacatgcgtcaggcgtgaaacagaaaatcgcgggctgtca
-aagaagagtttcatccggttcgcagaagtgcacactggtaaccagtatgccgcgtttagctccgcaagtgcgcgacaacc
-tggtaaactcctgcaccttttcgcctcattttcgaaaaggcgatgttataaaacgctgaccatcggcggcgcaggcgtta
-aaccttctacgcgcgtccgacagggcgttaaccacgcgaaatcgcccacgtggtggcggtctctgcgtcggacagtcgac
-tccgaaaaagtcgctcggacgtcgtcactgcccgctcgccatgcaggcgcgcagagaactggtaacttttttgtttagag
-aattttacagcctgcatgcagacggcagaatcagttcaaccgccggtaaccctcttcgcgggtgaatatcaccgcatccg
-cgcgcccacgtcaataacttctacgactggtcagcatgtaaaaataacgtccacagcgttgttgcgtgacccgcccagtg
-ctttcatcaccactgttactcgatatgacttcttgccccaatggtttagggcgaggtggtaaattcggtatacatcccgc
-gacggcggggcgaaccggctcaagcgccggtgagacctctgcaatggcatgcagcgtttaataaagttttgcgtcatggt
-ttaagttatgtaattcagagttgatgcgtcagagagtggtgcagaccaagaaaatcgacgatcggcttgaaaataactct
-tcgaagcccgtgaatgccgtgttgccgccttctatgacagtctggcggccaggcacaaagcgtagtaacgccaccgcctg
-gcgtaatccagcacttcatctcccgtcttgttgcaagctagccagaatcaaatccggcgctttccagcggggtcaatctg
-catgactttaaagatcgtaaatattgcgcgtgactctaagcagcatattgctgcccggtgttagggttctcgttctgacc
-gagatagtccgtcagcagttccaacgggcgcaccgccgggttacccagccactgcgggcaaagcataaaacattgtgaca
-accaggtggcgtaatatccccccagtgactagtggacacctgacaataccccagcgaatcacgcgccatgttccaggaca
-atggattccagcagctctgcgcgtcgaaggatacggcggcaactggcggaatgcatcatctcaatcgtcagggtgatgtt
-ccgccagccgcagtttttttaacaagctcgctttttgcgcagaaggcgggcgagctgttgaaaccgtgtaaaataaaaga
-gagaagccgtagacgatcgagtagccttcttgaagcggttatcaggttggaaacgtgttgtccgccagggcgatgcacct
-cggtggtcagcgtgccatcagcaatgtacactcgagagtacgccaaccggcgcgatggtatcccagcgtcacaagttgga
-acagtgcggcttaactgcacacaagggcaccgctcgccccccccctgttttattattttttttcggaagaaaaaaaaacc
-gggccccccccccgcgccccccggttttgccagccaaggcggcgaccatattccagtcgagatccagctctctgatgaac
-cactatgaccgcacagcaagtaatttgacgtgaggaaacttcgccagcacggtatacagttcgcccgcgttacggaccag
-actgtgtttgatcgatgccactaacaaccccgcaggtagcggcatgaatgattgcaaaggcagcagcaatcgtatatggc
-gttctggcgcatgcggacgtttaacgttcagccactcaagctgaaaaacgtcgctcagctcaccgtgcggcacgccaaac
-acctggacttatgaccagcaatacaggatttggcacacattgcttacacactcaataaacagcgcgtcttccggccgggt
-ggagatacccgcgagtccgtacggcgctgtacatcgcgtggctgctggaaatcgttggtgtgcaccttcgcagtccagac
-gcaggcgcccacgaaaaacttgcgatgccttcagcgaaatgctgataggccgcagaggattgatcctgcgctaacatcac
-cttgtcggcgacaattgcaggtcgaatgtcgtgctaggtgtggcccgaatcgcctccacgcccggctggtatctcccagg
-tgttttgagacgccataaggaggtttacggcgtttttgtgcaaaccaggttgagtggtggtaataccgttttgtactaaa
-tcctgactcctggcctcaccagccagaggcagggttaacaggctttccataaatggttgtccggaggtttttcacgacgc
-ttaataaaccggttaatcgcgatcgctccatgtgctaaacagtatcgcaaccagtccgctaaaaactgatttaatttgaa
-tgctttttcgtcgcgctctcgcatgcactttttttattaggatattactcaataccgtcgcgggaagcgaaaatctggct
-ggcttgaacacacctgtcagcccacccaagcctggaggcgttcatggagtttggaggcctttcagtcatcttgagaattc
-ccaatcatgtgtctgcgccataccagagcacgaaacgggacactcacagagcactcacatccactttatttcggatcgga
-gagtcatagcacgacccagcagttatgcgaaatcttcattatcctgatttcgtgctacccacactcacacacacgctcaa
-tgttctactattcccgcagggaacgaaatatttaggtacagtttgatccttcgctctgtcttctttcccagtttatccat
-ggcacgcatatgagagaagtggagacgttttttttaatggccgcgatatcaaaatcgcggctaagtgaataatataattc
-acattactgctggcgtccagttaaataatttacgacagcccaaactacgtattgtatttcattaacctgccggaaggtct
-acagtaatacgagattccgcaaggatgactgggttaaacgtgtacagatcctagccagttctcttctttgtttcacattc
-tgataattcgtgttagttcgcccgcctctaccgcctcccgctccctcccctgcccctcccccataaataaccttgcatct
-cattgtcacacaagttaggttttataagtagagatgaacgggtattcggaacgtcgattcaacaatgccgaatcagtgga
-gcctcggtcagctacgactagggttatggatcgttttcatgcaaacgtctttaccgtgaagatagtagcttactaagtta
-tcggcgcgggtcacggcgttgactgatcacttccggtgcgtcggttctttctaatctaattaatcaaaccgtgacgccaa
-ttattggtgaaccaaagtaaactttgcatagcaatcagaagctcgctcacaagtcgcgcagttcatgtttcaggaaagtg
-tcatgagtcgtggtaaatcgctttcacaaatagtaaatgttatgaaccctatcacgagttctacgatataacaaaccaac
-gcctgcaggcgcagagttatttttaatgaatatcacatttcacggttttgttaaaactgaaccaccctcgataccagggg
-atagccagtatgcttgaatgagtttggcatcaggctgcagcattggcaaaagcgatgaccgcacgcgaccatcgagaact
-tgcgttgctccacgtccagattgatagtacagcgccgttttcgttttgtaggactatcatccacaccactaacgctggtc
-accggtgtttggctcctgtctcaatcccgcttacctaacagtcgaaacgtggctgtaaagcggaaataatcttcgttgtc
-gcttctcttcatcagctcatacgaccgtcggaccagttcagatcatggcaataggcttgcgagtctgagatgggcgcaac
-ttgcctacttgcgttaacaccgcgtttgttccgtcgtcctcttctcacccaccttgacgtccaagttgccctgtaatgta
-ttggaataattggtaatagccacatgggccggaagggaacattttccttgataaattatacggttgttctataattgacg
-ccgaatcgtgagcggtacacggtgcacctacttgcatttggtgccgtttggattgcgacaaccactcgggattgccagga
-aaccttaacacacacacggtttgggtccgtttgactatcagtcaaaccgcggcctctttcagaattcggctgcttcgccg
-gtgacgcggcaacgatcttcgtccaaatcacacctttcaaccatctctgctgttagtcaatctggttcgtctgtctgtgg
-cggcttagctcggattgattccctcgatagccggcttttttcacacgaacatggccatgcccgaaaaatggaaagagtgc
-agacgcatcgctcctagtagccaaggggttttcgcctggtggtcggataacgcaaggtcaagaggtaggattccgtatcg
-tcgaatgatcttgcatccctaaattatcaggtcgacactttcaccactagttcattttggcattcaaattggctgggatt
-tgcgagacaataaatttaccgtcgctgggaaatatctccaggttgggtcggcgctggctgt
->m141013_011508_sherri_c100709962550000001823135904221533_s1_p0/1174/0_19079 RQ=0.831
-cacaaccaaacaaaaaaaaaagggaggaagaatttttaacaaaaaaccctgggcggggggtcccactttttccaaaaaaa
-aaacggtggccccgttttggggcgaaggttgggtagtggggaaaattttttttcgaacgtttggtttttccccgaaacgc
-tcacaacagagtggggcttttattggcggggccgtaactgatttttgagatgtgggagcgaaacggcggggaaaagaccg
-gcggcaaagttgggcggaaagccgcgtggaaaattgggtgaaagcgcgcatggcgaagcgggcatggtggggagggggca
-tatgaaaagctaaacgagcaggtaattttgaaggccaaatggagctgccgcgctacgggcctggtggacctttaacctgg
-ggcccggtcagcgcttatcgaccgcgaacgcgctggtgggtgcagcccaggggcgttgcctacgaaccatgaaagcggcg
-atatggtggtggttgtctgagccggcaaggtggtggaaaggggagtatgcccactttcgacactgcgacgcatctcgaac
-tctacgtcgttaccgtccgcttttggtgcattggtcataccactcactcatgcaccgcatggggcaggcgggggctggcg
-actccggcgttagggcacacgcacgccgctattcttttggcgacattccgtgtagccgcggggtttaagcgaagaagagg
-tgcaggggagtaagaaactgaacaccggcaaagtgattatagaacgctgggcacgccgagccgctgctacgccgggattg
-tggtgtctcgagggccgtcgctggggaaagatgctcacgatgcggtgcataacgcggtggtgatggaagaagtggcgaaa
-atgggtggattgcccgcgggcattaacacactcactcacatcgacagcttctgatgaataacattcatggtaacacggtc
-tacgcttattacggcagaagtagacacacgcgctgcggaaatttcgacttcctcggagataactggtctaattccgccgt
-ttttccaaaaaagcccctgcgaagggggcaaagcaaactatgcaatgtttcgttgggtttataacctggtgctaggataa
-tctcgcgctggcgtgcatattgcgttacttccccggttacccgcatcagaattacgtggtagtagcgttgcgccttgcgc
-attgttttcttatttaatgctgacgtgcttcggctttcagtggcgaaattatgattgatataaatcagcgctaagcttgc
-actcgtcctatttctggctggtggtgtattaatttcaagggctgccatgtatttgcacttagcaaaagcacagcagaagg
-gtaaaaacgacttgaaatagatacctcctgcgcggctgacttgtgtgcttcctctgtgatgatcttcttgatttaatttt
-aatcaatgataaagaagttgaatggtgaccatgttctgagcagttgttcaaaaaacacgatgaatgaagtgtgatgaaac
-cttcaaatcagcgtgttagagttaattgcgaaaggggagatttatttcggcttggccttgagtttagcgaggcatacaag
-tacctataaagcgtcatttttcagccgactttaacacgttccttgctcggattcggctgaccagaaggaggctgactaat
-ccgtaggagcattcgatgcggtccattacgaaatcggtttttatggtccatcctgacagagcgggaacaggttcgggcat
-gatcgggcgctacagctgctgcatactggtggcagaaggcaagatccaccgtctggaagactgggcgcgtcagctggctt
-acccgataacaactggcacaaagcaacacgtttgatgaatgttgaagctcgcaggaagtgatcgcatgagctggaactct
-tccgttcaaacgatgcgtttttccgcaggcatggtatgcgtaccaagcacgctggttacggaagcatcctcgatggttaa
-agcgaaagacgagcgccgtgagcgttcgcgatgatttcgcaacgaaacgctgatgatgctgaagctgggattcgaagaga
-atttcctgatgacaccgtctgtggtggttgtctcggcacgtgtgcagggctcccctttcgaaggtcgtcccatcaggact
-tctgcatgcagttgtgctttgagcatcggttctgtgcaggaggaagccggctttcacgcggcaggcgtggtggtcaaatg
-ccgttattgttagcggaaacgaaaacgcaggccattacttcacagtataaacggtcggcgtcgcataaccgttcaggggt
-tcatttcatgcacaaggcaagacggactgaggcaaatggtttttgcatgccgagagattgaattgatagattggagatag
-gccatatggcacgttatttcggtgtcgcaagttctgccgtttaccgggaaggcgttcaagagatgactataaagattcgc
-tacgctgaaaaactacatcaccgaaagcggtaagattgtcccaagccgtataacgacgtgcaaaatacagcgtcagcctg
-ctcgcgctatatcaaacgcgccgctacatgtctgctgccgacactgatcgccatcagtaatggtcacggtccaattaata
-cgactttgagaggataaggtaatgcaagttaattctgcttgataaagtagcaaactgggtagctgggtgatcagtaaacg
-taaaggcgggctaatgctcgtaacttctggtacgcagggtaaagctctgttccagctaccaagaaaaaattgaattctcg
-aactcgtcggcgctgaactggcgctaaactggctgaaagttcttggcagctgcctaatgctcgcggctgagaaatcatat
-gcactggaaacactgttacatcgcgtctaaagctggcgacgaaggtaaactgttcggttccatcgtactcggacatcgct
-gacgctgtaactgcagctggggtttgaattggcttaagagcgaagttccgtctgccgaacggcgttctgcgtacgcactg
-gcgaacacgaagtgagctttccaggttacgcgaagtatttcgcgaaagtgatcgtaacgtagtagctgaataatctcgtt
-ttcaacgagactaaaaacgccgaccatttgtcgcgtttggcttctattttttgtcaggtttagttttcgagtagatcttt
-caccattctcttgtgtccataagtcaggatggtttgctggcgtttagatacatacaggcaactgatgttctcgctcctgg
-cggccactcgctcgaaaccaaacgcgagtagattgcggctgaacttttgataaggaacggcagaccaattttcaaatcat
-gggtaaaatcagatacgcgttagtcaatgcagcaatgatgaatccgagggaattagaagctgtaagtgcgaagttggtcg
-atataaagatcgattgtttggtagtttcagatgacggcagcaattaggcatttgggggaggaagggttacaagttcctat
-cgttggccggttatagttggagtaccataacaggtccgcaaaccacttcgtgtattgtgttatttactgttgggttcgga
-aaggattcgacatcttgcaataatattttcagttcgcggtttaacctcgcaccgcgttaagctttattgtatttctggcg
-cgtgatattatctaatgtagcttcatggttccatcgaaagaattatcacattcattgtgattccatgtaggcattcaact
-cgtcgctacttattggaatgcttgccagtctgagagatctagttgtgggatctcacagtacgttgccatcgcatttgatc
-ttcttcacgatttgaagtaatgtagcgcgtggcggtattgatgaaattttaattttactgtttgtcgtgggacgaaaaga
-gatcatatgcggaaatgataaatgtcgttgttaatgtcattgtaatgttaatgttaatgtttttattaaatatcgcagct
-gtatcgttcacagaaaaaaatcgatattaataaaattaagttttgttttctgaagtggtgaatagcggatgggtgaaaga
-tattaatatcaaatttcgctcattatggtatacatgccccgggagaaaatgacttcacgccttacaccgtacattttgtt
-gtgcaggtatgtaatttctaacgctgtcggtatcgggtggtattcgttaatcagcaggttagcccaagccacaaaaaggc
-attgagaaattattgattttacatggattattatatgtgctaatccttggtttttaaaaattgtgcatagtgaaaatcaa
-agtaaggtgtgcatttatgcaacatacagcgtctgcttagaaattaaacctgcgcacttggcagttaatggaatcttttg
-atgaagggaagaacgacaatattttttaagccaggatatcgacgcattgcaaggtgaatattaatattgtttgcgcttgg
-cggatattatttgatcaacacagcatacgctttgctggtttttcaatcagtatggtttcacccccggcatgggaagccag
-acgtaaggtcatcaaaagagcaattcttagttggcttttgtgaccttcatctacggcacgaataaacgccatccggctgg
-cgggtgaacacggactgtttgattattccggtatcaatggttaagccgtccacgcgctggcgtttctggcggattttcac
-gcatctgcccgtttttgcaaattactcagcggcttcccgggccttcaccttgcgccattgctatttagacatcggtagcg
-ggcagtcgtgtttcgcggacagctggcgcaatgttttacgcggttcgaacggtaagagcgccatttgattatcaatcgct
-attcttggctgggaatggtttcgtttgggtagtttgcggctgcctctctggctggcgcttcctgtataggttctgagcga
-cgggagcactgatcaggatcatttgtggggtaactaattggcgccgcagctgttcttactgtcggcggttgtgattgggc
-gactgaatatctaactgcgctcacgcgtcaccaccgcgcgttgggcgtaaatcacagatggaagcagaaatccgagcacc
-aatacaatggcggcataaatgatccccgacgatgctatcggcgggcagcgggtccatgaagcgaagaaaattgtccggcg
-cgtgcagacttttctcagggttggtttttagttaaagcgctccgggcatggtttcctcctgctccgcgtttgttcgctca
-atcatcgcctatgaataagctaacgcttgatgtccgtggtcaacgctttattattcatacgggtattgctattgttcttt
-ttctctgggatttgttcatcattccgcgacaaagtttaacgccaagaagtgtggctgatatgcgccgctactttaatacc
-taagaaaggaaaacgatgaccaccccaactttttgacacatcgaagcgcaagccaagcacggcattggttttgcaggtag
-ggcaacaactgagtaattggcctggaagggggctgctgcagaagcatggttgcaggtattgcgatgcgctggaaaggcaa
-acatcggctgttccggttgatgtggtgcatcgcggcgctgcgtgaaatccacgggcggccgatgcgttcgtcgtcagcgt
-ttccaggcgatggctgctgaaggtggtgaaataactggaagaaaacgcaaaaagaaggtgtgatagcagaaatctggcct
-gcaattccgcgtgatcaaccagggtgaaggcgcaattccggcacgtaaccggaccgcgttcgtgttcattacacggtaaa
-ctggatcgacggaccgtgttttgaacagtccgttgctcgtggtgacgctggacattcccgtaatggcgtgatccctggct
-ggattgaagcatgactctgaaatgcggtaggttctaatgggaactacttcgcaggaactggaatatgggcgagcgcgcgc
-aggcgctcatctcgttcagccctgttttgttttggttggggggtgggggggttttttatttgtgtttcgtgggtttggtt
-gttttgaagtcgaactggctggaaatcctctaagcagcgcaattctgttccctcgaacgagaggggagcaggcattcagc
-aataaaccttcagtttgcaacggcgctattttgtgtttgcaaagacccgtaagcgtgtattttgtgagctgttttccgcg
-taatcaccgtgatatgaactcactttaaacataaattacattagagatctaatcttagtatcatcccgcgtattgttact
-aatatggatgagttcccgataagattcgtcgtatcatagactgactaaaggcgtagagctgaacaacacgacaggtaagg
-aagaacaaacatggtagatcaggtaaagtcgttgcgatgatcaggccccggctgaaagttcgctacgtgcgggcatctca
-caaacgacatattcaggttattgcattgcggtgccattggtacggggttgtttatggggtctggcaaaacgattagcttg
-ccggcgtcgatcatttcgttttatgatcattggttttatgctcttttcgtgatgcgggcaaatggggaattgctgctttc
-gaattctggaatacaatctttttagtggacttcgcttccggatttactcgggcgtggcaggataatttcactcgactgga
-ttactctggttctgatggttaaccggtatgggcagacgtgtggcgctcacggcttatgctcagttctgggttcccgatct
-cttccgagactgggtcgcctcgctggcggtgaaatagtgcatgctgctgacgctgtcatctcgacgtgaaatgttcggtg
-agatgggttctggggttttgggcgatgatcaaaatcgtcgccatttgtgtcgctattgtcgtcggctggtcatggtggcg
-atggcactttcagtcacgactggtgtggagcgcattcgcgcattgtggaatgaaggcggcttgttccgaaggtttaaggg
-cttctttgccggattcagatagcggttttcgctttcgtgggattgagctggtaggtacaacagctgcgggaacgcaaaga
-tcagagaaatcactggcacggcgcgataactccttccgatccgtatcattatgttctacgtcttcgcgctgattgttgat
-tatgtccgtgacgccgtgaagtcggctagtcggagaaaagcccgtttgttggaactgttcggtgtttggtagggctgctg
-ctgcggcaagcgtgatcaactttgtggtgctgaacctctggcggcgtcttccgctaacagcggcgtctttctcgtacagc
-cgtatgctgtttatgggtcggcgcaggaaggtgtggcacgaaaggcgttcgctaaactttcttctaagcgcgcagtaacc
-gcgaagggctgacgttatcgtgatctgttctgctcggcggcgtggtgatgttgtatgtgaatcctagtgtgattggcgcg
-ttcacgatgattaaaccgtttttccgcgatctgtttatgttgtctggagattatcctttgctcgtacgcttgtgtatcgc
-aaacagcgtcctcatctacatgagaagtcgaattacaagatgcgcttgcaagctgatgtgcgggtatgtatggcgttctt
-tgtgtttcgtggtcgtgttgctgcactggaagattgggacactcgccaggcgctgctggttaccccgctttgtggtttat
-cgcgctgggttgggctggtgttttaattggtaagcaagcgggctgctggaactggcggaaataacccgattatcatggct
-ggatgggagcatgccaccgcttttagatggactcacgcgcagcggcgcgttgggacagtacattgtttttcaggaaatga
-atggtgatcctcaggtcatcaatcagttattcatgcgttactcgctttcgcagtggtgcaggctttcttggcggcggtgt
-gacgttattggtggtgtggtttatcactttcgcagttcgcgcttcatcgtggctcggcctttccattaacgctgattggc
-attgctggctgccgcatgccttgtttatcatcgggaaaggaatctgctctttttcatcatgtggctggaaagctttcata
-ttgcagcatggtcaggtattttgtcagcactttttggcacgctcggtttttgtcggcgtgcacgcgcttcgacttagtcc
-ttgcagaatcagtcggcagttgctcgcggttgacgatcgtgggtagcgcatcgatgattggtcgtgattttctgcccagc
-gggggcgctcgccagtcttttcaatgttgttcagcgaggctttgccagttcagctcaatgactcaacaccgtttttacgt
-gcgcgcgcgcgcagcgtctgcttacgggcacaagcaagtatctatcatatttacgaaacagagctgaagcgcgaggaata
-gagagcgcccagtttcaccctaaaggttggtcgctgataaagcatagtgatactcattttaataagatagatgtatttta
-atggcatctttaaggcaaaagctataacctcttacgtagcagaaggcttattaactcatgccagggtcacttttctgaga
-cagattcagttaaaaggtttttctgagtttggctctgcgcgatgacagccaattcaactaacagcgcgatacgctcagcg
-tcattagcgggcggcattttggctggcggagtaaaaaggtgtacagcaaactgccaggcgtttcgaaacatcagcggcca
-gagaatcactgtggtaattagctggctgcgacgtgtccagagagttgcgctcacatgagcaaagcacggggctatccgca
-ccatcagactaataaacgtcaagcggacggggggccaaagggtcgggagaagtcgggcggtttgcgtattccagcagtaa
-cagcgacggagattagccgataagtgaaccgcagtggtgacagcgcctgcgctggttgcccacatcatcggatgtttgtc
-gggattttcgaagcagcggggcgttggcgcagggataccacgccagcaagaccagcggactaacgcagcacgatgcacag
-aggtatacgtcccagtcaaaatcggggctccgtggtttttaactcagcatattacaccgcccaggcccgaatgcatacaa
-atagtggtgggggcgagttttccccgcgagtttgcgtgcgctggctataagagattggaaagacaggaatgacacgcggc
-agggtggcagatatcatcgtggataacagggcgcgcagtatgttgaatggcaactggcaaggcagaagtaatagatgagg
-ttgcccatcatagtgagcataggcggtaagcaggtggaagcgcaactgaccagacgcacgcgtccagccaggcaatgggc
-agcgcattaacctaagccagaataacgccatgacttgcaacatcccggtttccggcacgatcacggcccgacaaaaataa
-agcccacaagtacctgctaaagggcggtacagcagccgtaattgattactggcatccattggatctgtcagaagaaagtt
-cggaagcagacatgattgctcggcagtccgtcattatcaagagaaggatgcgggaggaatgcatttaattctagttatta
-cattaaaaagatggcttacgctttcggctaacgttgcgttgggtggcccatcatttgctagtgttttttgtgtatcacag
-accgctttcgatggcgccaacgtcagaatccgccagcatatccgcagtcgtcggcgtcgcgacgctttttcagtggcgcg
-gcgaaatcgcttcggctccgattttgaatatgtaaccttgtttgccgctctgtttggtcagctctgcgctaactgtgtcc
-aacgtcaggcacatcgcgccagtttcgtaaacgcttgcttgtgaggcttcgctaattacgcggtgcgcagctgccgcata
-atctgccgcgttgctgaggcgatttttgacatcgcccgacgcacagaaatacgccgtgttccagtgctgcgggggcgctg
-gcgagcgtagtttcgctgtaccagccggttgggcagcagggggtgtaaacgatgcccatcagccagctttttccgtctcg
-gatgtgctcatccggcgaggccgagcggggagggtatctgcatgtagcaggctggtatagagcgataaattttcacgcag
-ccggctttgcggcattaatactattacgatgctgcggggcagttgacccttcgctgaagagatagcagtagtttttttcc
-atactctgaagtgcagatgtcagtgcggcttccttcgccgtagtgcagctgacgcagcggtaatgcttgtgctgcagggc
-tttgggctttgccgattagcgacgattagccctattctggctggcaggaaccgttttcatcaggattcaataacatagga
-ccaggttggccagtgggcacgcagtaatgcgatcatggaagtctccatcgttttgtctgtgtttaaatacgctaacacct
-aaactacttttagtaatacgtacaaaggtaagtatgaaatgagtcaggttagcctgtcgcaacaaatgaaagagggtatc
-tctttggcgggaacagtgccgtcgcgcgaggtgtttgaacacgtcaccagcccgttttttttggggggtttgtgttgatt
-ctgggttggcgctacgcgaggtctcatagctttttagcggactgcggcgcaaaatcggtggggtgagtgaaagatggctt
-gcgcagtcggttccacaaggcgttagaaaacaggatgtttctttaaccggtatgtcgtatcgggtgtggccgtcgcatgt
-ggaatggtagcctcacgccgggctgggcggtcaggtgcgagaaagcgttggcatggcggggcgcttttgatgcttggaag
-ctgtgttacatttgcccggtttaaagatgttggacgtggatcgggatgacgtgcggcaatactgctgatgcgctgaggct
-tatctggtctacggtggatggctttgtagggggataagaatgcgccagcatcgcatccgccaataaattgccggatgcgg
-tgatgatttataggcgaaaaagaagtggttttacttactcaaatccactataaatcgcaaccgatatcatcggtcgcgac
-tttattcatcgcgatactgcccttttctctttaaataacgctgcggttttaatctgaggagaggtttcgaacggaatcca
-gttttcttaatcgccagctatcggtgctaacgccagttgttatctgccgccggtggaatttcccccgcactttcgactca
-tcagcaaatccacgctgcagcacgggagcggtctcatccggtgaagcaaaggcgatatggctgtcgcgtacggcaaattg
-cgctaagcggcgatagttattggtggcaaccaggaaatggcggttcgatcaatcgctttgccattaaagtcaggttctta
-tctttccgcttgggattatatctggcactcgcccgtcataacgggcgggctgggtagcatcaatctgatatccaccatca
-ataacatcaagttataagtgcggaaacgcatccagttgatgatgacttgtggtttcgtgctgttgggaatcaatctggtt
-aaactgtccgggagcactcgcagcctctttcacctttacgcttggctttcacacaatcagcggtattgggatagagataa
-gatcgggcattacgggaggtcaactgggccttttttccactccacatagcttgccgggtcatttttgcggaccaccgact
-ttaaacggtgcggcagctgaagcaccggcagttcttttgcagatccggatcgccgctgattgtatgctcgacatagcttt
-ttgcgcgttgttcaccacctgcacggtcgatcgtcctgggcaccagccgccagatagctataatattgtcggcagatttt
-accgattggcttgctgacggactggcgtgtgcaattgtgatcggctttgagtgtttctaccagcttgctgtcttccgcgc
-ggagggatttttattagcgatgtcgtaaatcggtcgtgccttcccgcttcgctgcgtcagctgccatttacgctgtcatt
-actgagttgtacgtcgaccacaaagatgatcgccacacatgcctggcattaccgccgaacaccattcagcgtgcctttgg
-cgatatagcccttcgattccgcaatctttactgggaaaacgggcgtgagcatggcccaaacataatggcgttaacgcgaa
-tttcacttggaggtaataaactggagtttccgcatgacttataggatcggcagatagccggatgtgccagaacgacaaca
-acatcgggggcacctttctcgcgctttcaggcccgtatttgggcgacggtttcgtaatatcattcaccgtcagtttcccg
-ataaattagctttatccgcagcccatgattttgtggtggcagcgacgccaatatagccaatctttcagcgtctgtttttt
-tccgttttatgaccacttcgtggtctttaattaaatagggtgtaaacattggctgtttggttggcgtcaatgagttggca
-ttttacataagggaatttcgctcctgcagcgcatttttcaggtatccagacggtagtttaactcgtggttgccaggcgtt
-ccgacggtataagtcagcgtatttaatgcctttagaccggtgaaatatgagtgcttttaatctttcgggcgacatgtaat
-cggcaagcgactcctgcatcaaatcggccgtatcaaccagtacgctgttttttcacttcattgcggcatgttaatgcagg
-cttgccgtaggctaccagtcgaatttttccgtggcggtgtcctttgtataatcgaaatcatcatgttgctatgcagatca
-gtggtttgccatgatacgcagatcgaccgtcgctgcattcatggcggcaatcagcgtgggccggagcgttgccgctaaac
-ttaatcatcagacatcctttatatcgggaatactaagaaaagggagaataaacgtcttacttatagaacagtgaagaatg
-caaattttacgcttgaaaatgatgatactatgcacagtggcgattcattaacggataggggtataagtaaaacactagtt
-aacaccgctcacagagacgaggtggagaaatgttagatcaagtatgccagcttgcacggaatgcagggcgtgccatatgc
-aggtctacgacgggacgaaaccgatggacgtcgtcagcaaagcggacaatttccgtacggttcaggatattgcgcttcac
-accgttatcatgggacggtttacgtcgtgacccgggatgttccggtactttctgaaagatgatgcgctccggttgggatg
-tccgtcagcactggcagcgttctggctggtagacccgtggatggttaactaaagagttattaacgtaatggcggaattca
-acgttaaattgcgctccttgaccatggcaaccgatttttggcgtgtgtatgccgccggtatgaagtaatgtaacagcgcg
-gcagaaggcaaagcgtggaaaagaagagtgcggtgtgcgcaagcagaattcggtccgcgatgcgcgccgccgctgtgtga
-tgcagccgttttcgcatgcggatgcggagctgaaagagtatctgcaacagcttggcgaactcagcaggttcatcggctct
-tcgctgaaattctgtcttggtggcggaaggaaggcgcagctgtaccgcgcttcggacgcaacgaatatttgggaacacgc
-cgtggctgctgtgctgcagtgcgagcgcgttcaagactgcagggtaaaccggctggattacactccgcgtgagtcgttct
-gatcggggttcagaagtgttctacattactaaatttcaagatggcagaaacagtgtatttctgggattctgccatcctgc
-tttcttccaataaaaagttataataaaaagagatttgtttttaaagagtgcaaaaaaattcatttgctaatagtacattt
-taataatgagcgttttttgatagtttacttctatagtgagatatttaatggcgacattaaagtaccaatcaataaggttt
-gtcatatgtttacccaggttgagacacaataattttattggtgcggtggagtttatttgtaaagctcttcgtatacaaaa
-acacattcaaacatttttttacacatcctatcatgcatttaagaaaaagattgattttcggaatttatgatagcctgctt
-attttgaggagtcttcttttcgttgcgcaactcagattgataaaaatggtttatcaggtgctttatcaaaaaatgaactg
-ttcacgccatggataagtttcttatcgttttgcagcctaaagataaacggtgcgaattacatgggaattgcgaggtgtga
-tttgaatacgaagcaataccataaaataaatgaatataactcattcatgatttcaaaaccgtggaatttccggttccccg
-cacaaaaccgacgattgtaatgctgggatattctacagaaaaacagtctgaccataccgaaaggattaaaggttatattc
-acaggcgattgggtggacgtgtctttaggttatgcttattgaggatatagtaagcaaataaaaggggtaaatttgaactc
-caaatacaggaggtggatttaaagatcgatggatgggtatatgtggatgatcatttgcatagtcatagaatctttgggct
-ttggggcgcttaaaatctatggaggggatgaacgttttcgtcatgttctctgttgttttggagatggaagattactctct
-tatttataattttctggttaatgcaggttttgccacacagtcggaattagcgaacaggtggatgcgatagtaagtgcgaa
-tctggccggcagataggcgatattacgcaagaaagatttgcgagaagtataaatcgacattgaggcgtttttaaaaaaga
-gcaactagcgtacagtattagtttccggcgtaaaatcagagacttattcctatccttagataacgataggggaaaattat
-tttttgcagatttatgttattgccatctatttgagcaacttttggcagcaggtcctcacttgctggccctcttcggtgtg
-agcgcccgtcatttggcgctattggcacgcgacatcttaatccagccacactccagcggaactttcttcatcagctgcca
-ggcccgagcgcgacccattgctatcgacaataaactgcgacaggatagccttttttatttactctccagactgcttgcgc
-caaacatctgaacccggaatcgcgtctttcggtgttaacaatggtggtggtctggtaacgatcgtgcggtcacttcggtg
-atttaatcgctcaatcagcgtcgcgttttctcttttggcaggagtgcggacagcatatgttgcagttactcgcactttcc
-cactaatgcgtcgctgtttccaggttttgtgctaatgatctttatagcacatactcgccgatcgtaaatgcgcatcgggc
-ggcaactcgctgacgcggttcgaactgatgtggcggaagcatcatcggcaacagcaggcaggtgagtgccgaatcttgcg
-tagggtcatggtgtttcccttcttatgatatgcaggtgatccgaccacttgggtctgagttttaatcataatggctattt
-tatcgaatttcccgtagtgtgatgcatttgcgtcaacgcacaaatatattgaaaaatgaatgcttatactggagacgcgc
-ttcggtaaaaagataattctgaataattgtaacctttaggtaaataaagttatacgcggtggaaaacattggccggatag
-tctatcgtcactaagcattaaaatttttgcggcctcaaatagtttgggccgattgtgagcgcacaggcgtaatactccag
-caggagataacaatgaaaattttccacgtagcaacgccacttcaggtggcgaagtacgtaaagatctgttccgtggacgg
-ttatacatcaaggacgttggcttttgaattcgataagggttaaagattcctatcccaaagtgaggataagctgcattggt
-caattcgggaatgtcgaagttaaccgtcaggttatgcgtctgcaaacagagatggctacaaagtgctattgcagtttaaa
-aagtgctatgcagtaataagacggctcctgattcaggagccgttgatgtttctggggggttacgcggacgcttttctttt
-atctttagcgtcagcagttttgcgaaaggcggtggccttgcttgttcgatcgtttgttcaccagcagctggtcgatgcgg
-tagtttatcgatatccaccacttcaaatttgtagccggcgaatttccgaaatcggtgcgtttgggattcttagcagcata
-aacatcataaatgccgcgatggtttgtagtgcccgactggcgggaactcgtcaattatccacggatgacgtcggtcaatt
-ggggtgccgcgtcatcagcatgagttcatcacgggcgacaatcttgctttcagcctgacgacagatcgcccatcagcgtg
-gtcatcacgtcattgaggtgatgatccaccaccagcgcgtctgcgttcatgatcaccggaagtccttcactgcgttttaa
-aactttccacgcctctgaaagggttaacgttccggcacaatagcgtgttgcgaatttgtacgcgcttgttcagtgcaggc
-tttggttagccagcacgcggttcagcaggttttagaatcgacataacgcgatgatgtggtatatctttcattacagacga
-gggaattagagtgaggaatgtttcgcaccttattcttcaggctttgctatctcgtgagatcaaacgcaaaatcacgtttt
-tcagcggtgtattgaagacggaaaggtaagggaattcgcaggctgcaaagacgttttcatcagctcggttcctgtttacg
-taaagccgccagcgccgcggcttccactacgcggcgtagatgtcatagaagtgagtcaatttacgtacattgggcagttt
-tgaaatcggaagatatgtttcgcgcaggccgttgaagaaccccacggggtggcaaacgtcaggcagaagcgcatcgggtg
-gatgatcgcaaagcacagctttctggcgcaatcataccgatgcgtttcggggttttaaatccgcaaccaggataaccatg
-cagtactaacgagaagagagaataaaagctcaggtggctcagagagctctgccgacatatgcggagaacaggctgtgaaa
-agctggagaaaatgcgcatcaccgatgataccgcgagaatcgccaactgcgtcagacggatttgggaccacggtaaagaa
-ccatgccgggattttcctgcatcttcagacggttgggcaatttatattgcttcatcagccaaccccccgctctaagtttt
-gattttggtgagcggcaagacgagcttctcggacatcgagcagaacgcacttaaagcgatcaagcagaggtaaggggggg
-gtgactaaaaatactgtttaacatatcttattccgacctttcaggcccaagatcctcggaaggggatagttgattaattt
-gtgtgaaatacacattgaaagcgggattccgaagaaagtgaacaggcattttcagtggctagtatgcggtaaggtactgt
-aagccgccagagggttaaaatcgacagctgaaaaatgcaaactggcctgatacgcttgccgatcgagcctacgcaggtct
-tgcaatatagtttgaattttggacgatttttgtaggcctggtagtcgtttagcgcatcaggcatgaacaaagagcacttt
-atcaacaaactatcatttgtaccgttacgctatgcttccggcggcagacagacgccatgtcgccaattcccagtaacata
-cgggtttttatgcagatattgctggtggtcatctttcgcaatagataaaacggtgtggcgtttgcgatttccgtggtgat
-gtgacgatcgtatcggcggccaggcatcgccgctgaaacgttccagactggcgcgagctcggcatcctgttctgggttca
-gcgataaatcgctgaacgatatctgcgtgcgtgggtcatttgccgctgacgcaattctgggcgggattcgttgattctcc
-aaatactgtgcagatgctcatagctgatgacggaaggatgtaaccatgcgtacgttcggcagaccgtatcacgggaggca
-cacttcccgataagtggattttggcgtatcgccgcggtatagcctgcggggtgggctggtaaacgcagggtaactgccag
-aacagacgctcacacccagaaacaacccatcgaaaatgggcaatctccttccggtcaggtacttggtcttgagtgaccgt
-tgacgcatgcgcgtgctacggcatcggggtgttacgtccaggcagggcatcggggggaaaacagatgctttttatcaaat
-aaactcatggtgtcgctctcccgaaaatcggtcattggggttaaggttgtaacaagcgggtattttgcacacaaataccc
-accgtgatagtctcaagttaaacataagaattttgggggtttagtctgctttttaattcatatttactgggatttttgtt
-ttaaggcgttttacggcggttccaggggcaggaaaggatattccaggagaaaatgtgcgctatatccgacagttatgctg
-gtgtaaagcttaatctgcttaagcggatctgccgtcgcgcgcgacgtcgtcttttaacaggtcgaggggtttatcgggac
-agctggaaaagaagttcgtggcgcagctttctacgattgaaagtgatgaagtgagccagcgtcgctttcgcgcacgcgtc
-gatgatgccatccgcgaaggtctgaagcgctggtttaccagccgatccattgaatttgatctccgtcacgccaaagaaag
-ggcgcaggtattgatcgccaagtcacgcaggcgtgccgg
->m141013_011508_sherri_c100709962550000001823135904221533_s1_p0/1174/19119_30903 RQ=0.831
-gccgcacgcctggcgtgactttgggatcaatactgccgcctttttggggtggcggagatcaatcatgtcgctggtaatat
-acccagccgctttcagaggaccttcgcggatggcatcatgcggacgcgtggcggcgaagcgacggtctggcgtccttcaa
-tcacttttcatcgtagaaagctgcgcacgaacgttcttttccagctgtcccgataacccctcgaactgtagacgggacgt
-tgcggcgacggcagagatccgcttaagcagagtaagcttacacgcataactgtcgatatccgcgacatttttttctcctg
-aatatccttttttcctgcccctggaacgccgtttaaacgcttaacaaaaatcagtaaatatggattaaaaggcagactaa
-accaaatatttcttatgttttactttagactattcacggtggttattggtgtggcaaatacgccttttgttacaatctta
-acccatgaccgattcttcggggagagcgacacatgagtttattttgataaaacgcatctggtttccccgcgatgcctgcc
-tggacgtacacaccagccgatgccgtagccaagctgcatgcggtcaacggtcactcaatgacgcaatgtacctgacggaa
-atggcgattgcccatttttggggcgatgggtttgttttctgggtgtggagcgtctgtttctggcagttcccggcgtttac
-agcacgcgcaggcttataccggcggtataggccaaatccgcttatcgggaagtgtgctcgtgaatacgggtcatgacgaa
-gcgggtacgcattgttacgatgccttcgtcatcagctatggcagttattgcctacatggtcttttgggagaatcacgatc
-cggccagggaatgcgtcagtggcatgaccaggcatgcagtatcgttcagcgatttaatccgctgacccgcagaaaggatg
-ccgcagctcgcgcagtctggaacgtttttccagcggcgatgccttgaccgccgcatttacgatcgtacatcacacgggga
-aatcgctagcacacggggttttttatttatgcgaagatgacaccagcaatttgcataagaaacgccgtcatggttactgt
-gggaattggcggaattggcgtctggtctgccgcggaagcatagcgttaacgggtagcaaatgtagtttgttgataaagtg
-ctcttgctatgccttgatgcggcgtaaacgacttaccaggcctacaaaaatcgtccaaattccatatattgcaaggactg
-cgtaggcctgatcggcatagcgtataggcagttttgcattttcagctgtctgaattttaacctctggctggctttcatgt
-actagtttactagccaatgaaatgccgggttcatttctcgaaatcggctttcaatgttgtatttacacaaattaatacaa
-cttcccttccgaggattggcctgaaaggtcggataagatagttaaacagtatttagtcatactctgcttggaatctgctg
-ggtagttgcgttttcttgctcgatgtccgagagtcttcgcttgccgccttcagcaaatcaaacttaaactggctggctga
-tgaaggcaatataaaatgcccaacgcgttctgatatgcgcaggaaaatccggcatgtctttaacggtggtccaaatcggt
-ctgaacgcagtggcgattctcggcgtatcgtcggtgatcgcggcatttctccagcttttcaaagcctgttttctcccgct
-atatgtcggcaggtctctgagcaatgacgctttattctcctctttctcgttggtgactggccatgtttatgctgttttgc
-ggatttaaccccgaaacgcgggcattcggtatgattgcgcatagaagctggtggctttgcgtaatgcatcacgccgatgc
-gcttctgctgtagttgcacctggtgtggtatcttccacgggctgggacataatttcgtattttccaaacgtgcaatggta
-acgtaaagatgacatcactttctgtgacatttacgcggtagtgaagccggtgcgctggcgggcgtgttacgtaacaggaa
-cacgagctgattgaaaacgtctttgagctggaatccgtaccgggttccgtcttcaatgaaccgcgtgaaaacgtgatttg
-gttttgattctgcgtgcacgaagatgagcaaagcctgaagaaataaggtggcggaacatcgcactcttaagttctcgtct
-tgtaaatgaagatattgacccatcatcggtttatcgtcggattctaagactgctgaaccggtgctggctaaccaaagcct
-ggctgacagcggcgtacattcgcaacacgctgattgtgcggtagttaactttcagaggcgttgaaagttttaaaacgcag
-gtgaagacttcgcggtgatcatgaacgagtaccgtgtggtggggatcatcactcatgacgtgatgaccacgctgatgggc
-gaatctggttcggtcgggctggaaggagatgtcggcccgtggatgagaactcatggctgattgacggcggcaccaatgac
-gacgtcatgcgcgtgctggatattgaaaggagttccgcagtcgggcaactacgaaacatgggcgggcttttaatgatgtt
-tatgctgcgtaagatcccgagcgcacgatttcggtgcattcggcggctacaatttgaagtggttgattcgataactaacg
-atcgaccagtgcggtgacccggaatcgagcaggccaccgctttccgcaaaactgctgacgctaaagattaaagagaaagc
-gtcgcgtacccccagaaaaaacatcaacggcttctgaaatcaggaagcgtttattactgcaatgccttttactgcatagc
-aatttggttaagccatcttgttgcgacgcatactgacggttaattcggacattcactggacaaatgcaggcttaatcctt
-cacttttgggataagaatcttacccctttgaattaaaagcgcaagtccgttgatgttaataacgttccggaacaggatct
-ttacgtacttcgccacctgaagtgggttgtacgttggacaaattttcaattgttatctctgctgaggtatttagggggcg
-cgctgtgcggtgccacaatcgcactattaatgaggcggcaatttttaatgcttagtgatctagactatccgggcaaatgt
-ttctcaccggtataatttttttatcctaaggttacatttattcagaattaatctttttaccgagcgcggtcttcagtata
-agccattctttttcatatgatttgtgcgttgagcaaactggcatcacactttgcgggaaattccgataaatagcactatg
-attaaaactcagacaagtggtcgatcactttgcatatcataagaggaaaacacatgaccctacgcaagattctggcctca
-ccctgctgctgttgcgatgatggctttccgcacatcagttgaaaccgtcagcgcgtgccgcgaattgggcattaaccgat
-cggggcgagtttggtgcttgataaagaatccgtttagtacaaatacctggaaagcgcgcgttagtgggaaaagtgagtac
-tgcaacatattgctggtcgactctgcaaagagaaaaacgcgacgctgattgaagcgattaatacgcgaagtccgcacgat
-cgttgacagacccacccattgttaaaggtcggacgacgcgattccgggttcaggggatgtttgtgcgcagcagtctggag
-agtaataacagctttatcctggttgcaagttttattgtcgatagcaatggcggtcgcgctcgggtgcctgggcgctggat
-gaagaagttcgctgtagtggtgctgataaggatggttgcggtggaatgggcgaaagacgggcgctcacacgaagaggtgc
-agccaggtgatggactgcttgcaaagttgcttcaaatctggaatacaaaatttgcaaacataattttccctatcgtttat
-cttgggatggggaattaagttctgagttcttacgcgaactaatactggtaacgctagttgctcttttttaaacgctcaat
-ggtcgattttatatttctcgcaatctttttctttggtaatatccgctatctgaaggcagattcgcacttactatcgcatc
-cacttttcggctattcgacttgtgggcaacggctgcttaactcagaaaattataaataagagagtaatcttccctccaaa
-caacagaggggaaccattcacgaaaacgttcatccctccatagatttttaagcgaaagcccaaagattgttatgatatgg
-gcaaaattatcatcattatttttttggtaaatatacatcgcatcgattcttaatttcaacctctggtatttggagttcaa
-aattttaccccgttttaattttttgcttactaatatctccataaggcataacttaaagacacgtacaatcgcctggtgaa
-taatacctttaattcttttttcggtaatgtttagactgttttttttctgtagaatatccaggcatacaatcgtctgtttt
-ttgttctaaaggaaattcagcggttttttggaaatccatgaaatgagttatattctttattgttatgggtattttcttcg
-tattcaaatccactactcgcactgtcattgtatagttccggcacgtttctttaaggctgaaactgataagcaacttatcg
-catggcgtgaacagtttattttttgtgaaagcacctataagcacttttatcaattgagttgcgggcaacgaaagaactct
-caagttaagcctatcataattcgaatccatctttttcttaaatgcatgatggatgtttggttaaaaattgtttttgaatg
-tgttttttgtatacgaagactttacacataatccaccgccaaaacaattattgtggtctgatgctgtaagatatgatcaa
-cttattttattggtttatttatgtcgccattcaattctctcactatagaagtaaacttcaaaaacgctcattattaaaat
-gtaccttattacaattgattttgcagctttaaatacaagctttttttatttataactttttagttgggagaaataggatg
-gcagaacaaggaaatacctgtttctgcatctgacttagttaaatagacactctgtgaaccggattaggaacgcctcagcg
-ggagtgtaattgcagggtttaccctgcagtctgaacgtgcgctccggcaggcttgcgctacagcattgtccagcggcggt
-ggctccaaatattcgttggtcgaagcgcgggtacagcttgcgcctgtttccttccgcttcacaggcagaatcttcagcga
-agagccgatggacgtggtcctgatgttgcgcagcttgttgcagatactctttcagctcgtcatcgcatgggaacgctgct
-ccacgcagcggcgggcgcgcatcgcgaccctggcaattctgcctttgcgcacaccgcctttctttccacgcttgcctctg
-cgcgctgtacaatacgtttcatttaccggcgaaacacgcctaaaatcggttgccatggtcaatgagcgcaatgttttaac
-gtgattcgccaattagtttaataaacttctttagtaccacatccagcgggtctacagcagcgcagtaacgctgcaggtgt
-gacgacttcccaccgggaggatttcttcagaaggaccggaactcggtgtcagcgtacgtaaacgtccatgataagggtgt
-gagcggcaatatccgctgccgttacggcggagattgtcgcgctttgctgacgacgtctggtttcgtccgtcgtagacctg
-cataatgggcatcgcttgcattccgtgcaagctgcatccttgatctaaacatttctccactcgtctctggtgacggtgtt
-aacttattgttttacttatcctatcgtttatgaatgcgccaatgtgatagtgtcctcatttttcaagcgtaaattgtggg
-catctatgtttctatagtaagacgtttattctcttttctttcgtattacgatgataaaaggatgtccctgatgattagtt
-tagcgcaacgtcctggcacgctgattgccgccagtgtgaatgcagcgacggtcgatctgcgtatcaatggaaaccactgg
-atgctgcatagcaaatgatggatttcgatattacaagacacgcgccacgggaaaaatttcggatggtacgtacggcaagc
-cctgattagatgccgaatgagtgaaaaacagcgtactggttgataacggggatttgatttcaggggagtcgctggccgat
-tttacatgtcggcgaaaggattaaaagcaggtgatattcacccggtctaataaggcatttaatacgtggactatactcgg
-aacgcttggccaaccagagtttaactacgtctggattacctgaaaaaatgcgctggcagggcgaaattcgtcttaattgt
-aaatgcaccgcattgacgccagaaccaaagcagcgcatgtttacacgcgtatttaattaacgaacgaagtggtcgataaa
-gacggaaaaaaacagacgctgagattggcatcttgggtcgtgccacacaatcatgggtctgggataaagtaatttatccg
-gaaagtgcggtgaagatattaccgaaacgtgcgcaaatacgtgcctgaaatgcgcgagaaaggtgcgatggttgttgtcg
-ttctggcagcattcgggctatctgccgtcgtatcagtgatggcggaaaactcagttttattacctcagtgaaattccggg
-cgttaacgccaattatgtttggcagcttcacgcgacgccgtttttccaggtcagattttgctgatatcgaaggggctgat
-atcgccaaaggcaacgctgaatggtgttcggcggtatgccaggcctgtgggggcgatatcttggtgtgggtcgacttaaa
-ctcagtaatgacagggtatggcaggtgacgcaggcgaagcggaagcacgaaccgcatttacgacatcgctaataaacaat
-tccctcggaggaagaagcaagctgggtagaaacactcaagccgatcacgatgcacacgccagttcgtcagcagcaatcgg
-tcatcttgcgacaatatgtatagcttctgggctgggtgcaggagatcgacgtgccaggtggtggacacgcgcaaaacagc
-gtatgttcgagcatttacattcggcgatccggatctggcaaaatggccggtgcttttagctgcgcaggaccgtttaaagt
-cgtggtcgcaaaaatgaccggcaaaggctatgtgggaggtggaaaaaggcagttgaccttgccgtaatgcgccgatcttt
-atctctataccaatacgctgattgtggtgaaagcagcggtaaagaggtgcaagaggtggctggagtgctccgcggacagt
-ttaaccagattgatcccaaagcagaaaccacagtctcatcaactggatggttttccgcacttataatttgatgttattgg
-gatggtgtgaattatcaagattgaatgtttcaccagccgcatttgagcgatgccagatgatttgccactgcggaaagatt
-aagaacctgacctttaatggcaagcgattgatccgaacgccatgtttcttggttgccaccataaactatcggctacggcg
-gcaaatttgccggtacgggcgacgcatatcgctttgctcaccgggatgagaacgctcggtgctggcagcgtggattgctg
-atgagtcgacaacgtgcgggggaatcccggcggcagataaaactgcggtttagcaacgcgatagctggcgacagaaactg
-gattatccgtttccgaaactctccgtcagataaagccgcgcgttataaagagaaagggcagtatccgatgaaataaagtc
-ggcgccggcggatgatatcgggtttgcgattgtatcaggtggatttttggaagtaagtaaacagttctttttggcctata
-aatttcatcaacgcaatccggcatttattgcggatgcgatgctgggcatcttatccgcctacaagccagcagcgtagacc
-agatactccgcgcatcggcgttatgccggcacgttcataccgcacgccaacacctcgggcaattcaactcaatccagtcc
-gccagtgcagcaacctttttttcggctcacgctgctcggccatcggcgtgaggctataattccacatcggcgggcaccac
-ggatcacgcgatacggtcaagaaaacatcctgttttaagcgctgtaaagactgcgcggatcttttcactcaccacgcttt
-tgcgccgggtcgctaaaggatgagtaccttgcgcgtagcgccagccagaatcacaaccccagacggctggtgacggtgtt
-tcaacaccttcgcgcgacgggactgttcgcaaagagattaccctctttcagttttgttgcgacaggccttaccgactcat
-tcatacttacttctttgttacgtacttacttaaaagtaagtttttagttgttagcgtatttaaacacaacaaacgatgga
-gactcccatgattggtattactggtgccactggccaacttggtcactatgttattgaatccttgatgaaacggttcctgc
-gaagccaaatagtggctatcgttgtaatccggcaaagcaaccctggcagcacaaggcattacgtgcgtcaggctgactag
-gcgatgaagccgcctgacatctgcatcttagggagtggaaaaactactgctgatctcttccaggcgaagtgggtgcaacg
-ttgacccgcaggcatcgtaagttttattaatgccggcaaaggcggctggctgaatttatgcttataccagccctgctact
-gcagcatactcccgctggcctcgccggatgaggcatcgagacggagaaaatgctgtgattctggcatcggttttacctgc
-tgcgaatggctgggtacagggcggaaaactacgttcgccagcggcccgcagcactgggaacacggcgtatttattcggtg
-cggcggcgatttggcaaaatcgccttcagaacgcgggcagattatgcggcagctgcggcacgcggtgattagcgaagccg
-gtcacgaaaggcaggttttcgaactggcgggcgatagtgctggacgttgacaacagttttgcggcagagtgacaacagag
-cggcaaacggttacctaatcaaactgaggcgaagcgatttcgcgcggatgaaaagcgtcggactggccgacggaactggc
-ggatatgtggcggatttctgagtgtgggcatcgaacggcgttgtttgatgacagcaaaccactttgcaaattgattggcc
-acaacgacaacggttagccgaagcgtaagcatctttttaatgttaataactagttaattaagtggcatccttcccgcatc
-cctctgataatgacgggatggccggaggcaatcatgtcgctttcctgaacttttcttctgaagatcaatggatgcagttt
-aaaaatgattagcggcgttgctgtaacgccctgttagcaaggggttgaatgtgggggcttttttttggtcgggccgttga
-tcgtgccggatacggcgatgttgcagtccgatggggcgttattggcgttagggttaattgggccgctgccattgctgctg
-ggagcgtggtcttgcgtcagttggcgcgtcgcgacggcttaccgcttgatgctcactatgattgggcaacctcatcttat
-tacttcttgctttggccgtgcatttgcaagtacttggcgcgcctgtttcaacgatgattatcggcaccctgcgggtggtc
-attcctgtctttgcatctgctttatagccagcgggacggcaaactcgcgtgggggaaaactgcccagcactgattttgta
-ttggcatcggctgggcggtgtgtgaataattgctgagttaaaccacggatcccgattttgactgggcacgttataactct
-ggatcgtgctggcgtttagttttcgtggtctgtgggcgtggtatgctggcaacgcgcgctggcttgcgggaaatccgaca
-aacatccgatgatgtgggccaacagcgcaggcgtggtcacaagctgcgttttaacttatcgtattgtcgcttgttactgg
-ctgaatacgcaaacgcaggattctcctaccctttggcccgtccgctggtgtttattacgtctgatgttggcgatagccgt
-gctttgctcatgggttggcagcactgctgctgggaacgtcgccagccagctattacgacagttgattctcgggccgctga
-ttgtttttcgaacgctggcggtttgctgtaaccttttactccggcagcaaatgccgccgctaatgcgctgagcggtatcg
-cgctgttagtgattggcgtggtccgcggttcagagaaaccagaaaacttaatgaatctgtctcagagttgacacgctggc
-agtgagtaaataaagcctctgctacgttaagggggtttgcttttgcctaagatgcatttaaaatacattcttaacttatt
-agaatgaggtttatcagctatggcttatggaccacctttagtgaactggccgtctctatctcgcgcttcagctctgtttt
-cgtacatatggatatggttatgggctgtggcgtaagcagacgctggcgcgcgcggcggcacgtaaagaatggatgttgag
-gtcattgaagctgactggcagagctcgctgacaaccgattgagaaaactggcgtagccgcccgctggcagaaataatcga
-ccatatcatcgtggcgctaccacgatcgcaacgcgcgcaactgcgcggagctggattctgcaagcgactaaagtgagcgg
-cgttcacgccgacaaacgagcgtggccaaaagggctgacaaatacctgacatgctgcatgaagagctttccagccacaat
-gaatgaaagaagagcagatcctttcggatgaatacaaggcatggcagcagggcaatgggcaatcagcggtatggaaagcg
-agcacgatgaaggcgggcgacctgcggaagtgattaacacaccaccaataacgtcacacgcgccagaagcctgcaccacc
-gtggaaagcgatgtataacggcataatgaactgattggatgacgctgatggagtcacatcagtctggaaaaccaatgtac
-ttgttcacacgcgcgctggcgggtgagtgatctaaaagctggatggcatttgcgcatgccgcatgataatggcggttatt
-tccgcagtttcgcagcccgctttcttacaattaaacagccagccaacccagcgcgataaccagcggggtaccagcagcgc
-ctgcgagtgtcatctttcagtgtcagcacgacacgaccaaagacgcatcatacccagcactcagctttgccgagcgcatg
-cttgtcgatgcgactttcatgtagatgaggagctgtttgcgattacacaagggtacgagaaggataatgtcagacgacaa
-taacacagaatgcgggaaacggttgtaatattcgtgaagcggccaatcacaggatacgatacaacatgcacacgccgccg
-agcagacagatacacgagaaggtcagcccttccgcggtagctgccgcttagaaagtttagcgacgctttcggtgcacacc
-tttcctgcgccagcccaaaagcatacgctggtagagaagacgccgtgttttagcggaagaacgcgcagaggtcagcacac
-aaagtgatcagcttgcggcagcag
->m141013_011508_sherri_c100709962550000001823135904221533_s1_p0/1231/0_1049 RQ=0.846
-ccaaaagggaaaaaaagggagaaaaaaagattttttttccccctcggggtttgggcccggcggaaaaaaaaataaattag
-gggaatactatttcccccggcgggctttttaatgcccccgccggaacataatcgaaaatgaatggctcttaaatctttgg
-ttttttgccgcgtatcgctaaaagctgaagcggtaaaagaactggagcgccgtcgcgaagagccctcgtcggcggttttt
-tccatcaatcgtggaataatgcaaaaaagggcgtgcagcgtggctgggtaagagtttaaatcacagggcttggcctggat
-cgcgccgctaaacgtttggtaaaggcagacggctgttcatcccagcagcgatcgactccgccccggcaataaaacagggc
-ccggaaccttcgcgagtgagatcaattattaaacagaccagttaatcaccggcgactcgcggtccgcgtcgttgctttaa
-atatgctcttccgtacatctagcaaatcctgtttgcggtttaaagccatcccagacacccccaacagacgacgagttcac
-ggaatcccggtacatccgtaagcataccacagcaaaacgcccgcaactttaccgcaatcgatctgttttatcacgacaaa
-gccacaacgcaactggcgagcgccagcattggcaacttgcgaatcaccgcaaaagcaattgccggggacatatttgaatt
-tgataatccctccgcctgctggtggaaataacaacagcaggccacaatttctctatctgtgcggaaaacgcgctcaggtg
-aaaggtgtaatcaataccaatccaccgtacattggctgtagcttgcagcaggcgcatgatgcgatctcgtgggctatcga
-gattgccgagaataaaaccgcctcctatggcacataaatagcgtcgcatgggctatctggctgcggaacaaaggagacgt
-gttttccacctgcatattttgttggaaccatgtaagcctctggttgccatttctggagcgcccgcatatccagaatcggc
-gctctagcg
->m141013_011508_sherri_c100709962550000001823135904221533_s1_p0/1232/0_20441 RQ=0.872
-aaaaaacaaaagaaggaaagatttttttttggggaaaaaaaagggcatccccttcccccccttttttgggaagtccaaaa
-gcacagtttgggtcattccttggaaaaaagatggggcggagctggccctggtcgaaacttcaataacttgccaaacaatg
-acggaaattttgaaaggtttttctttttttttaatggagcttacgatttggcgtggcgtgggagcagcccctggggccag
-taaacgtcctggcgattcctcgaaaaccaacgggcaaattcagtgtcccttatttcctttggaaggatgacaagggtgaa
-accgggttttacttattttagcccagtgattgtacgcagcgttaaaagtgggtttgccggagtcggcgggactatgctgt
-attcgttgtagtgaaatcatttcaatatgaaaaagcgggggacaaaacaattatgtccgcgctgtgcaaatccagaatgg
-acgaaggcagtcgggccaaaacgggtgacctgacagtaaaaacatcggctttttgctaataatccggaggattctttttg
-tgtgaatgcaagcaacatttttttggccctcacggtttttactcatttgcgatgtgtggtcactgatgattaccgatagc
-cacaggaacataatgtattacctgtggtgccgcaatcgattgaccgcgggttgaataagcaacgcacgtggtgaggggaa
-atggctcaaatcttcaattttagtttctggtccggcaatgcttagctacgcagaaggtgcttaaacaggctcaaacaagg
-actgcgcgactggaacggtcttggtagcgtcggtgatgaagtgagtccaccgtggcaaaggttcattcaggttgcagcag
-gaagccgagaaggattttcgcgatcttcttaatgtcccctcaactacaagtattattctgccatggcggtggtcgccggt
-cagtttgctggcggtaccgctgaatattctcggtggataccaccgcaaccgcagattatgttgatgccgttactggcgca
-agtgccattaaagaagcgaaaaaatactgcacgctaatgtctttgacgccaaaagtgactgttgatgtcctgcgcgcggt
-taagcaattgcgtgaatggcaactctctgataatgctgccttatatgcattatttgcccgaatgaaaccaatcgatggta
-ttcgcacatcgacgaaacgcagacttcggcgcagatgtggtgggggtccgccgctgacttctcttcaaaccattcttttc
-cgtccgattgacgtcagccgtttatggtgtaattttacgctggcgcgcagaaaaatatcggcccccggctggcctgacca
-tcgttcatcgcttcgtgaagatttgcttgggcaaacagcgacatatcggccgtgtccgtcgattctggattactttccat
-cctcaacgataacgctcatgtttaacacggccgccgacatttgcctggtatctatctggtcctggtctttacaaatggct
-gaaaagcgaacgggcggtgtagctgaattggataaaaatcaatgcagcaaaaaggcagaactgctatatatggggtgatt
-gatacacagccggattttaccgcaatgacgtggcgaaagctcacgcgttcgcggatgaacggtgccgttccagttggcga
-cagtgcgctgacaaattgttccttgaagagtcgttttgctgctggcttcaatgcatgaaaggtccaccgtgtggtcggcg
-gaatgcgcgcttctatttaataacgccatggccgctggaaggcgttaaaggctgacagacttaaagtggttgagttcgaa
-cgccgtcacggttaatgccgaaattttgctttaatccgcgcacagccagcgctgtgggggtttttaaatttctgttgtag
-agagttgaagtttctggaatcctggaccgtttacaactcaatcgctcgtgttcgatggccagctattaatctgccggcgg
-ttcgcaagagcgtttctaaccgcgcttttatttgctggcggcattagcacacggcaaaaagtattaacgcaatctggctg
-gatagcgatgacgtgcgctcatatgctgaacatgccattaacagcgttaggggtaatgctatacgcctttccagccgatc
-gtacgcgttgcgaaatatcgtaaacggcggtccattacacgcagaaggtggccctggagttgttcctccggtaacgccgg
-aaacggcaaatgcgtccccggctggcggcagctcttttctgggtagcaatgatttgtgctgacaggtgagcccgcgttta
-tgaaagaacgcccgatgggtctctggtggatgcgctgcgcctgggcggggcgagatcacttactggaagcagcaaaatta
-aatgccgccgttgcgtttacagggcggctttactggcggcaacgttgacgttgatggcttccgtttccagccatattcct
-cacgcactggttaatgactgcgcctctgcgccggaagatacggtgattcgtattaaaggcgatctggtttctaaacctta
-tattcgaacatcacactcaatctgatgaagacgtttggtgttgataattgaaaatcagcactaatcaaatttgtcgtaaa
-agggcggggcaagtcttatctagtcgtccgggtactttttggtcgaaggcgatgcatcttcgcttcttactttctgcagc
-aggcagcaatcaaagggcggcactgtcaaaagtgacgcggtattggacgtacagtatgcagggtgaattattcgtctttg
-gctgatgtctggaaaaaatggggcgcgaccattttgctggggcgatgattatatttcctgcacgcgtgtgaactgaaacg
-ctattgatatggatatggaaaaccatattctgcatgggccgatggaccattgccacggcggcgttatttgcaaaaggcac
-caccacgctgcgcatatctataactggcgtgttaaagagaccgcgatcgcctgttttgcgatggcaacagaactgcgtaa
-aagtcggcgcggaaagttggcagagggggcacgattacattcgtatgcactcctccggaaactgaactttgccgagatcg
-cgacatacaatgatcaccgatggcgatgtgtttctcgctgtcggcgttttcagatacaccagtggacggattcttgatcc
-caatgcaatcggcccaaaacatttccggattatttcgaagcaggctgggcgcggattagccaggcagcctgaaatgacaa
-cgggcaataaatagcgcaaatcttttctttatcaaaacgtcgggcacattgtcggcgtttttttcggacttggtgagtca
-tttttgaattaatggtagcttttcgcttgttcatgtagagttgttgatacataatatttatatatgattaatcaacgatg
-attcacatgaagaatactaaattactgcctggcgtattgcgacctctgcggcattacttggacagggtgtcaaaataccc
-acggtattgatagccaatatggctatcagcttccggtttaactgcctataaagcagcaacattaagcggatggccgatgc
-caaagcgattgttctcaatgcagggctgtgggccgaaatggagacagccggcaatgcaagtcgcaagtaaatccagcaag
-tacggtaaacgtctgcaaaaaatcgccaaagcattggtaacacatattaatggcacgccggtcaactataaggttttata
-tgaccagcgacgtcaacgcatgggcgatggcgaacggctgtgttcgtgtcctacagtggcctgatggacatgatgaatga
-aacgtaaattggaaggcgttctggccatgaactgggccacacgtcgcgtgggttcactcgctgggcctgaatgaaagctt
-cttatgcgatcgttggccgcaacgcgatgcattttcagctaccagcggtgtggttcccagcatttcgccgctcacaatta
-ggtgatatcggcagaaggccgctatccatgctaaatactcgccgtgataaagagttcgaagcagatgatttctgcttttt
-gatctgttgagaaaacgtggcatcagcacccaggggctggttggcagctttgaaacactgctagcctggatggcggtcgc
-aacccagtccatgtttgaactctccacccacatcaactacgagcgtggcccacacacatccgtgatcgtatcgcctctgg
-taagtaaaatattggtcatctttcgggctgggtctttctgccagccgcgctataattgcgcaatagaatccccatctgaa
-tacagacaaaactggtttttgcacacaacgtttaacgattttgtggcgtcggcgcgtataatggcgcggttatgttaacg
-gttaacgctgttttaaggagataaagaatgacgggcaattgcccggttttaaaccattgatggcccaagcggtgcaggga
-aaggcacctttgtgtaaggctagtggcgggaagcgttgcaatggcatctgctggactcgggtgcaatttaatcgcgtatg
-gcattggcggcaattaacatcaccatgttgatgttgcgtcggagatgcgctggtacgcgctggcaatcccatctgggatg
-tacgttttgtgtcgaccaatgcatgctggaagtgatcctcgaagggaagatggtcaggcggcgaaattcgtactcaggaa
-gtgggcgaatgcagctttcacaagttcgcggcatttcccacggcgttcgtgaagcattattgcgtcgccaacggcgcgtt
-ttcgcgaattacgccaggtctgaattgccgatggccgcgacatgggaacgggtgggtatttccctgatgcaccagtgaac
-attttccttgacgctcctcgaagaacgtgcgcatcgccgcatgctacagtttgcaaggagaagggctttagtgttaactt
-tgagcgcttttgggcgagatcaaagaacgcgacgaccgcgatcgtaccgagcgtagcgccactgggtttccggcagccga
-tgcctttagtgtttggattccaccacttaaggcattgagcaagtgattgaaaaagcgctacaatacgcgcgccagaaatt
-ggtcttctcgcataagcgaccgaatttgcagtacccccgttgcaatgggaatgacagcgggtatgttaaacaacccgcat
-ccggcatggagccaggtggacgtttaaaatataaacctgaagattaaagcaatgactggaaaatcttttgctcaactctt
-tgtaagagtccttaaagaaaatcgaaaacccgccgggttctatcgttcgtggcgttgtttgttgctatcgacaaagacgt
-agtactggttgacagctggtctgaaattgagtccgccatcccggctgagcacgtttcaaaacgaccgcgcagggtcgagc
-tggaaatccaggtaggtgcgcagttgcacgtttgctctggacgcagtagaagacgcgcttcgtgaaactctgcatgtcgc
-cgtgagaaagctaaacgttcagcgaaggcctggtatcgctggaaaaagccttacgaagaatgctgaactggttaccccgg
-gtgttatcacggcaaagttaaggggcggcttcactgttgaggcctgaacggtattcgtgcgttcctgccagtttctctgg
-tagacgttcgtccgtgcgtgacaactctgaacctggaaggcaaaggagcttgaatttaacagtaatgcaagctggatcag
-aagccgcaacaacgttgttgctttctcgtcgtgccgttatcgaatccgaaaacagcgcagagcggatcagctgcttggaa
-acctgcaggaagggcatggaagttaaagtatcgttaagaacctcatgactaccggtgcattcgttgaatctgggcggcgt
-tgacggcctgctgcagcatcactgacaggcctgggaccccacgcgtttaagcatcccgagcgaaatcgtcaacgtgggcg
-acgaaatcactgttaaagtgctgaagttcgacccgcgaacgtaccgttgtatcctgggcctgaaacagctgggcgaagat
-ttcgcgtgggtaagctatcgctaaacgttatccggaagtaccaacctgactgtcgcggttgaccaaacctgaccggacta
-cggctgcttcgtttgaaatcgaagaaggcgttgaagggcctggtacacgttttccgaaaatggactggacaaaaaacatc
-ccccgtccaaagttgttaacgttggcgatgtaagtggaagttatggttgctggatatcgacgaagaacgtcgtcgtatct
-ccctgggtctgaaacagtgcaaagcttaaccgcgtggcagggcagttcgcggaaaccacaacaagggcgaccgtgttgaa
-agtaaattcaagtctatactggacttcgtactcttcatcggcttggacggcggcatcgacggcctggttcaaccttgtcc
-ctgacatctcctggaacgtttgcaggcgaaagaagcgagttcgtgaatcaaaaaggcgacgaaatcgctgggcagttgtt
-ctgcaggtttgacgcagaacgtgatacgtatctccctggggcggttaaagcagctcgcagaagaattcggtttaacactg
-ggtttgctctgaaacaagaaaggcgctatcgcgtaaagccggtaagtcaactggcagttgacgctaaaggcgcacccgta
-gaactggctgacggcgttgaaggttacctggcgtgcttctggaagcatccgtgaccgcgttgaagacgctactggttctg
-agcgttggcgacgaagttgaaggctaaattttcaccggcgttgaactcgtaaaagccgcggcaatcagccctgttctgtt
-cgtgcgaagacgaagctgacgagaaagatgcaatcgcaactgtaacaaacaggaagatgcaaactgtttccaacaacgca
-tggtctgaagcttttccaaagcagctaaaaggcgagtattctctgctcttcgcggatttttttattccgaagttgttgag
-tttacttgacagaattgcagcttcgtcctggtaatcagcactaagggcggctaacggccgccctaatgcaatgcaggcaa
-cagcagccgcttaatttgcctttaaggaaccgaggaatcatgaccaggtgcagaattgatagaaaagacttgcccctctg
-caatcgacattccctgccaagacggttgaagatgcaagtcaaagaggagatgctggagcatatggcctccgactcttgcg
-cagggcgagcgtattgaaatccgcgtttcggcagtttcctctttgcactacgcgcaccacgtaccgggacgtaatccgaa
-gactggcgataaagtagaactggaaggaaaatacgttcctcactttaaacctggtaaagaaactgcgcgaatcggcgcaa
-tattttacggttaagtttttttctcaaacattgaacgagagaaaagcacctgttcggtgtgctttttcgattttctgcta
-tctggaagctggaagactggcctcgcagagttttgaaagcagttttcacctttcgttaaattccttctgaatatggcctc
-ggggaacgcaaattcccatcagacaaccgctgcaacaaagtttggcaactttaccaaaaacagggaggggtgcgatgaaa
-ataacgacagtcggtgtagtggcataattagcggaattttttccgttgctgatttttgcccgcaattggcctgggacatt
-aacccttgcgttttcctgactctgcttcgcctgcgtactggcattttatccctgttaaaatccgtccggtttatatcgcg
-tgacgtttgctgttttttcgtttgggcatattatgcagcaaagcaaattttgtgggccaggagaaaccttaactggcgcg
-acggcaggaatggcaattgttgagatactgctaacttgacggcatgacactcattaggtcaaattactcatctacaaggt
-cgaacgtatattctcctttgcgtcatagtctcgtggatgtatggcgaatatctccgcgaaggcggtttggtgctggattg
-tcaacatggtcaatgaacctcaagtttcgtgccagtcatggccaacttaagtgatggcggctttgatagggccagcgtta
-tgttcattgcccagcatcagccgctcacagcggccgttttctgcagtgccaagtgttattgaaccgaattgtggcctgcc
-gtgcagcagtatctgcgtgcactacaaacaacgctgcaaccctatccgtgcgatgcggttattcttggttaggtattggg
-ggaacggttatccgtccagcaaagaaatcaaaatatcatgcgcgatactgggaaccgtgcgcatttaatggcgatatcgg
-gattgcacatcgctttttgcggcgttgctggctgccggacctcattcgcagtaggactaaatttttcatgcctgggcgct
-ggattccactggcaaatacattaattggcggaatctgctgtgctgcctttttttatggcctggttgacgggaatgcaacg
-ctcctgcattgctaccatggtgtgcgcttgcctacgtggggaatgcttaagttaagtgggcgacagtggagtggctggat
-gtatgggatatgttgtctggcgggcaatttgctgatggatgcctgttgccattctctcgcaaagtttatggctctctgcg
-ctgcggtcgcggcattgatattttggtatcagtggttttcctgtcctgagtggcactgccgccggtattgcgtgggcagt
-tttgtttcgctcatccgcatctgcaactgggtaatcacacttctgcttatgccgcgtgccaaatcgtcatatttcatggg
-catttagtctgagccgtcgtttattgcaaatctattgcaattgccttggtgacattttcaaggttccgttgatcctcgcc
-gcgatggttgtgcattttaacgcgggccgtttaatcctggagcaagggttatggtttcttgccgaccggtctttggcttt
-acttttctgggggttaaagagtttgccggaaggtgatcaaattgctgaattttggcaatggctaatcattttcccatggt
-tcttactggtgtatggcgattaaacgcctggcgaacgttgcctagcaatgtgtgtgggctgggagcttgctgatgtctgg
-ccgctgtggcaaaaacctcgacgctgacgagttgggcagctggtcccatgcttgatgttcgggcaagggctggcaatggt
-gatagccagaaacggcaaaaggcgattctctatgacagccaggactggcctggcctgaaggggatagtggcaacaactga
-ttatcccctggctcccactggcataatcttgacgaaggcgttattctgaggcatgaacatgctggatcaccggggagggc
-tggattcatattgcatatatggccgatgttatggagtgcagaaagtgccgtttaaactgggacatcaatgcagccgtctg
-tgtgcgtggcgaagcgtggcaatggcaaggattgcgttttcagcgcgcactggcctttacaaggtagcaacgataaagga
-aataaccattcctgtgtggttaaggttgatgacgggacgaatagcaattcttctaaccggtgatattgaaggcgcccagc
-tgaacaaaagatgctagcccgttactggcagcaagttgcaggacatgcttcaggtacctcaccatgggctagtaaatacc
-tcatcatcgttgccattaattcagcgagtgaattggaaaagtggcactcgcatcggcatcggcgctataacgcaatggcg
-acctgccctctaacaaagttaagcatctgctatcacgtgcaaggatatcaatggattgatactccacatcaggtcaaaca
-acggtcaatttttcaggcgggcaaggctggcggttagcagcctgcagggagctaaattttaccggtcggttggtaatcat
-cagttggtttggcgtgcagtggataagcgggtagaatatgcggtattttcaacaaatgctggttttttgaatgcataacg
-acaagatctctctacgtggcaagacattccgccgactgtggtccaaccgttttttttttttttttattgcgtcgctttcc
-aagcgtggtcctgatcgtggcgggcgtagcgtaatcctccacgcagcgcgataccttcagtgttatcggctcctttaaag
-ccacttccttgctgatggctttggtaaaacagatccgtccgtgctggtgtggatgcgcgctggtgtgtgatcgtggctga
-tgatttttacgtggtatcaccagctatgtctcgcagctactgtatctcctgggtatccaggaaaggtgtgtaatgaccta
-tgcgtcgcgcctgtttggtcacctgatggggaatgccagttttcattctttgacaaacagtcaacgggtacgctgttgtc
-acgtattacctacgattcgcgaacaggttgcttcgttcttcttcccggcgccctgattctgttgtgcgtgaaggtgcgtc
-gattcacttcgcctgttcatgcatgaattgtttgctatttacagttggcactgtcgatcatttttgattgtgctggctag
-accggattgtttgcgattggcgattcgccgttgtatcggatgcgttttttcgcacatcaagtaaaaacatgcagaacaca
-gcatggggtcaggttgaacacagcgcagaacaaatgctgaagggccacaaagaagtattgattttcggtggtcaggaagg
-tggaaacggaagcgctttgataaagtcagcaaccggaactgcgtctgtcaatggggatgagaaaatggtttccggcctct
-tctatctctgattcgatcattcagctgatgcgcctctttggcggctggcgtttgttctgtatgcggcgagctttcccaag
-tgtgcatggatagccatgatctgcgtagcgattaccgttgttttctcttcaatgattggcctgatggcgtcggctgaaat
-cgctgccacgtaacgcccagttccagcgcgtatggcggttgtcagacggctgtttaccattctggacagtgagccagaga
-atagatgaaggtaagcgcgtgattcgagcgtgcgactgggacggtggtaattccgcatgtcacctttacttatccgggac
-gtgacagtacctgcatgtgcgtaacgatcaacctgaaaatttcggcaggggaagacggttgctctgggttggacgctcgt
-ggttcggggtaatcaaccatcgccagcctgatcagctgcgtttttaacgaatattgatgaaagcgaaatcctgatggatg
-gtccacgattctgcgtcgagtaataccctggcgtcggttacgtaaccagggttgctctggtgtcgcagatgtccatctgt
-ttaagcgatacggttgctaactaacattgcttacgcacggactgaacagtaacgccgtgagcaaattgaagaagcgcgcg
-gcgtaatggcctacgccatgggagcttttcatcaataagatgggataacggtcctcgataccgtggttggtgaaaacggc
-gtgctgctctctgggcggtcaggcgtcatagcgtattgtctatcgctgcgaggccttgttggcgttgatagccgcgattc
-tgattctggacgaagctacctaggctctggataccgaatccgaacgtgcgattcagggccgcactggatgagttgcagaa
-aaaccgtacgctctctgggttgattggccaccgcttgtctaccattgaaaaggcagacgaaatcgtggtcgtcgaggatg
-gtgtcattgttggaacgcggtacgcataacgatttgcttgagcaccgcggtcgggttttacgcgcaacttcacaaaatgc
-agtttgggccaatgatcgaaaaaaattctggtctgggtgaaatcccctttgtggcggctatttgctgtccccccacccca
-ctctcctggttgtaatggcctggtgagtgcggcgaatccgtctttgctataaacctaaaaactggaaagcgcgcctggcg
-tgcccgcgtaaccggttgtcgtggttggggtaatctcaccggcaggcggcaacggaaaaacccccggtcgttgtctggct
-gtggaacagtttgcaacagcgtcggtcttcgcgtgggggtgtatcgcggggatatgggtggtaaggctgaattcttatcc
-gctctgttattgtcgggcagatactggcacaacagcacaaggcgggtgatgaaccttgtgttgatttatcacaagcgcac
-tgatgcgcctgttgcggtttttctcccgttcgttctgatgggcggtaataagccattctggcgcacaccctggatgtgca
-gatctatcgtaaccgacgacggtttacagcattacgtctggcgcgtgatgtggaaattttgtcgttcttgatggtggtgt
-cgtcgctgttgcaatggctggtgttggccggcggggccaatgcgtgagcgagcggggcgcttaagtgcggtttgatgcgg
-taatcgtcaacggcggtgtcctcggcaggcgggaaatccccatggcatctgcctggccgcggtcaggcggtgaattttac
-gtaccggtaacgcgttgtgacgtggctcagcttgaacatgttagtgggcgatggcggggattgggcatcgccgccgcgct
-tttttgccaacgctgagaatgtgttggcgtacaaccggaaaaatgtgtagccgctggccgaatgcatcagtctttgaacc
-atgcggatgtcagtgcgtttggtaagcggccggggcaaagcgctggtaatgcctgaaaccgatgcggtgaaaatggccgg
-gcgctttgcagaagaaaattggtggtatttgcctgtagacgcagcagctttgcaggtgatgaaccaggcggaaactgctt
-acggcaactaaccttgctgcttctggctactagttacgggccgcgggcagcgttcgattgatcggagtccatgaatgtcg
-ctgcggcacctctccttgctgattgcgcgtaatcttcaccttggccgccaaggcctgttaacaaaccccggcgtcgagcg
-tcgttggaggatattccggcaacgatctccctgcatgtccttgctggcaaatcgataccatcaatattgttgcccgtagt
-ccatatctggtgcttttgcagtcgtctgggaaattaatcgctgcgcagtggctggatgagtctctgcgcgtggcggaatt
-taattggaatactgggcggcatgaagcctgctttatgggccgcggtagcggacctttcgtcttattcgccaccgcatgct
-ggcagcctgaaaaatgggctggaaatacaaagacgcctggatgcaggacacatgaggcggaaattgcagcagttaattca
-gcattattcatgataagggcggtacgtttcagccgattttgagggcatcctcgtaaaggtggcaagcggctggtggaatg
-gaagcccgcataaacggcatctggaaggtttatttactggccggaaaggtgatggtgattgaacggcgcaactttcagcg
-cggtttatgatttaacccaccgtgttcatgcctggactgggatgatgagccggcgatctcccgtttcgcaaacagaagca
-gaaatgcatcaatgctggataacagtgggcgcgtaggcctgggaatattccgcgaacagtgggctggcagattactatcg
-gctgaaacggtcgactggcggcgtgcgcgcggaagcgagggctgacaggcagcaaatcattgctgtggcatgttgaaaat
-tgggcaatctttggctgcatggacctgattttgctgccgcgctacttcgagcgaagcggctggccggaaagctcactgca
-acgccagcgcggtactttcgccttttgatcctgttgtctgggctcgcaaccgcagagggcagctttttgattttagctac
-gcgctggagtgctattagcccagcgccgaaacgccagtatggctattttgtttctgccgttaattacaatcgtgggcaat
-tagttgggcgaatggatgccaatgccaattgcgcagcagacaggcatcctttgaagcttactcgtctctgtggttacaga
-caggtattaaaccgcaagcaacgcctgcaaaaagggctacgtgcagggcgatttactgatttcgctactgggcagcaggc
-aacgcgggtagacattaggatgctgcccgcaaggcctctttactgattgccggcaccggctgggaaatagacgccgtccg
-cataaaatgattatgataagattttatgcattcataacgccgatcggcatctggagaactatggatcatcgttctgcttg
-aaatcattgcctgcccggtttgcaatcggataaactttggtcataaccaggacaacaagaggcttatttgcaaactggac
-aaccgtcgctttccgcgctggcgtgaaatgggcattccagtggttgctggaaaggaagcccgcgtgctgactgctgatga
-gagtaaatgcaatgagttttgtggtcatttattcccagcgcgctacgccgtccacgcgtctgcccggtaaaccattggtt
-gatattacggcaaaccccaatgattgttcatagttcttgaacgcggcgcgtgaatcaggcaggtgggccgaggcgcatca
-tcgtgggcaacgcgatcatgaccggatgttgcccgcgccgttgaaccgccgctggcggttgagtatgtatgacgtcgcgc
-tcgatcatcagtcaggaacgaaacgtctggcggaccgttgtcgaaaaatgccgggcattcagcgacgacagacggtgatg
-cgttaatgtggcagggtgatgaagccgatgatgcctgcgacaatgcattcgtcccggttgctgataacctcgctcagcgt
-cagggttttggtatggcgactctggcggtgccgaatcagcaatgcggaagaaagcgtttaagcaccgaatgcggtgaaag
-tggttctcgacgctggaagggtatgcactgtacttcttctcgcgccaccaattcttgggatcgggtgatcgtttttgcaa
-gaaaggcgcttgaaacgcgttggcgattaacttcctgcgtcatcttggtatttatggctaccgtcggctttatatccgtc
-gttaacgtcaatggcaagcaaagtgccgttagaacacatcgaaatgtttagaagcaagcttcgtgttctgtggtacggcg
-aaaaaatcctgtttgcctgttggctcaggaagttcctgcagggcaggtgtgggaataacccgctgaagatcttgaggcgc
-gtttcgcgctgcgaaatggcgcttaatttcactttcacgacacttcaggccaatttttgggaggagtgtcgtacgtttta
-cgattttcctgcaattttttcttttcaacattgatctcattcaggtgacatctttataattggcgctcattatgaaagca
-gtagcttttatgagggtaatctgaatggaacagctgcgtgccggattaagccatttatgggcgaaaactcagtcgtattg
-aagtgcgtcaaatgaataaagcggatacggcgttgtgggctttgtatgacgcgcagggaaacccaatgccgttaatttgg
-caagaagctttagtacgcccggaaaagcccgacaactggcatggaaaagccaccatgctggcaagaagtgggactgtccc
-gtatgccgacctatttatggtgtgatgacgcaatgaaaagaacaccccggccccgatgtcgctgctactgggaggcggat
-ggcggtgtgttttcggtggaggcaagccagcccgaacaccaagaacgctggaacaactcaaagaccaatcgttgaagccc
-ttactggcgctggcaccggtcaggagcagtcgcggttgcgtcgcgcggtcgacaatacctcaggatttctggccctcatg
-gtacgcggcgcaacatgttgaagtgctatggaccatcgctcaatcagttttcaatacacaccggtctgacgatgcaggat
-aagcggattcctgtttttcgcacatcgcgaatgtccccggcatttatttgaaggctttaacgacatttgtgtgctgattc
-acggtaacttctctgtttacggggcagcatgttggaaaaagattcgcgcagcgatcagttactggcgaaatggtcgggcc
-gggacctaatgctttgggcaccggggcgagaatacgaactgttccgactaatggataattcttctggtcgggaagatttg
-ctctgagttaacgctgcaacgcgcgccagttggcggagtcgtttcatctgcggcgggttggttgttaatgtgttatggga
-tgaagttgcgcactggttaataccggacgatttagtcggggcggccaacttcgatctgggcatcaaaaaatcactgcttg
-ccgtgttcgcctgacgaagcctttttagccactggggccagatacggcgcaagcgtttgcatgaagccaacacgattcgc
-tatgcatcaaccagaccggagaagggattgccgttcccacgggttaagcggcgagtcgatggccaactgattcgcgcggg
-gctggtagcggatttaacccttcctgctgaaaaagatcatccccgcgctagatgtgatgcggaggtcaccagcaggaaag
-gggcgtcaccaatcgcctgtttcaactgcttgcagcttcttcttcggtaatcttttggcaaatccagggtgataatttgc
-tgcgcgggcggcacgccagcgattgcgcaactctgggcacctacttccggctgtactcacgtattggggtttttgctacg
-ctccgtgaagatcaggttttgatgcgccggattttcgcgcctataagcgaataccttcattcaggcgtggcagactgttt
-attgattaaattagagctcgtgcgccacgtgcggggttccaggtataaccactccgagcaccatcgatatagtccagctt
-tttgcgatttattccatgtcggataggtgctttcgatggacgcagcaggcggtcggccctataccggttgcaactcaaat
-aactaagccgcgccagccacgcccaatgctaattaaaaatcttccgtttttgaaaacgcctaacacagcagcgccaggca
-gcgccatatgaatcaacaacatcagcgaagtggcagcaacatattgccaatacttttttcagtgtaaaaaggcatcctct
-ggttccttttttaacgatattagcaagggatgcgcccagcgatattacaccagacgggttcattctcgccgtgctgtgac
-aaaataggtcttttactaggaaaacgtcttagccaaccggtggagaaagcaatgcaaggatcgcaattttgatggatatt
-gcggaaaagtttttccccgtaacatttacggccccaccaaaagggcagctccgacaggctattctgtggcaggatcttcg
-attcgcggtgctggcgggaatgggcccgcaaaactgcgtgtgctggatgctggcgggtgttgttagaaggggcagcccgc
-aatcaaaatggccgagcgtggccatcaggctcattttatgcgattttctggcgcagatgatcgacccgcgcaaaaacagg
-cggcagaagcaaaaggtgtgagcgacaacaatgcaatttatacattgcgccgctcaggaatgtgtttgcttcgctttgga
-aacgcccgttgatctgatattgtttccatgcggtggctcggagtgggtggctgatcccgcgcaagcgtattgcagaccgc
-tctggtcagtggttgcgtccaggcgggcgtgttgtcgttaatgttctagcaatgcgcatggtcttgtttgatgcataaca
-tggtcgccggggaatttttttgattacgtggcaggcggaatgcgcgaaaaaagaaaaaacggggacgctttcgccagatt
-atccacgcgcaccgcggcgcaggtttatctggtggctggatagaaagctggttggcaaaattatgggtaagacaggcgtt
-ccgcggtgtttttcatgattatctgcgcgagaaacaccagcagcggcgactgctatgtaagctattacttgaaattaaga
-aaacgcgttattggccgtcaggaacgcgtatattacctgggcggttatattcattttgttcacctgtcgcgcaaaccgca
-ggcaaggataaagtatgagtgaattttttcgccagaacagtccccggaactggttgcctgggccagaaaaaatgattctc
-gcagcattctcgctgcgcggttagcgccgttgactctcttttctgctggcggttgcccaagctgaacggcgagcgtctgg
-atggtgagatgagtgaaggcgagctgggtggaatgcattccgccattgtgagtgatgcgttttggcgcaagaccatagcg
-aaaccatcggcgtgctgcgccaataacggcgatcaacgacatggtgcgtcaacgtctgctgaaagcgcgctttaccagcg
-agcaggcgaagggaacgcccatttaccgtctgacgccgctcgctaatcggcattactgactactacaatccgtcagcgcg
-agttttctacgctgcgtctttcctatgcagttgtcgacttgtggcgggtgaggctgcaaacgcgcaggcagatgccgccc
-gaagagggcggtgatgaatttcactgggcaccgtaaatgtcctatgcgcgcagctgaatattcgtagcagcaattttcga
-cagtaaatctgacgctgacggcaaacggtcctgatggacgaacagcagcagcaggtgaggacgattcgcccggggtgggg
-gagttgctgaaagcaaagacctggcgggcggcgatttcgcaagctgtgaatttgttgctttggaactttccgaacggctg
-cgtgaaattgccaggatacgctggaagcggcaggcgaaaattgggcaggctaatcactgttgcgcattcaggatgcgacg
-agcgccatgacgatcgtgcaatttcgtcgatcgtcctggtttggtcggatctgcagagctaaactcgatcgtattatcag
-ttggggccagcaatccatcgacttgtggattggctacgacgcgccacggttacacaatttaattcgtaccgcgatcgata
-atgggataaaaaccgcgtctttgctcaggcggttttacgtcagtcggtacaaacctattttgattgagaccgtgggcgct
-aacttatggccaatgccgatcgggtctgcctggatatgcgtgacgaagagatggcttactgccgcgatgaagaagtgact
-ggggaattccctgaggatctggaatgcgaagagtttaacgagtatcgcgaagcagctggcggcgatcaatcgaagaacaa
-cttgccgtgtacaaaaaccagacaagtgccgctggatctggtctggtggtacgcgaatattctggtcacaagtatccgca
-gtgcaacgtcactttgagcgttgcgcgtattgttattgatcaggcggtagcgtccttggcgtagcgcaagcagatttttt
-caccgggacctgccagcggaactggcagccgattaatgattacggagcaaggtagcaggcgcatgtcatcgacaaatatt
-gaaggcaagtgatgccggttaagctgcggcggcgctggcgaatccgttatttccggcgctggacaagcgccttccgttgc
-agggacgccatattggctcgacgagactggataatacatgcattcctgatggatttttcgtcaggaatatctggaagagt
-tttacgcgcgttaataacgttgagcgcttattcgcgcacacagaagggttcttctttttagcggccctcgttcacaacgc
-tgatccctcgttccgtctgtcgggaactgtatgatggtcgggaaaatcctctgttatctctatctcaggcccggaacggc
-tggcgatgaaggggattttcacgccagcaggaccctgtacgaacgaactgctcaccctggccgtatgaaggcaaaatctg
-ctgaactggtaacaaaccgttcaacgcggtttcagaccgttgaccgtcagaagtttgcaggaagaaatgtacgttcttca
-gctcaaccgtctgcgtcgttaggcatggtgtggtttagtggtccacgacagcagcaatagtttcgcattctcgtaatcgg
-tgttcgcgcttcgagcgcgaatgtgggccgtgctggcggacgatccccgtgaagcacagtcggttccgctgattcgtgat
-ggcgagcaatggccgatgaaaatcatctcacaactcaaacgatgaaaccgaagagaatcagccctagatagcggagagga
-agataatgattgaacgcgtaattcgctcactgacgcctgat
->m141013_011508_sherri_c100709962550000001823135904221533_s1_p0/1233/0_7136 RQ=0.844
-aaccccaccaaaaaccccggaaaagaaagaaaaagatgtttccccttttttcgccacccttttttttttcccccctttca
-acgggtaaaaaaaaacctggggttttttttcacttatcggtcccccaagttcaggaagtttaattttttagcttgggagg
-attgggggtccccccataaatttccagaacaggataccaacgtgttccgcctaacttctactcgagcttcacagcaatgg
-ttcattttttttgttgtaacggggcttgttcccacctgtatcgcgcggcctttcccagacgctttccactaacatcacac
-actggattttcaggcttctgggctgctccccgtttcgcttcgccgtactgggggaatctcggttgatttcctttttcctt
-cgggtactttagaatgtttttcagttcccccggttcgcctcttaaacctaatggattccagtttaatgatagtgtgttcc
-gaaacacaactggtttccccattcggaaatcgccggtttataacgggttcaatatcaccttaccgacggcttatcgcaga
-ttagcacgtccttcatccgccttctgactgccaggccaatccaccgtgtagcttagtgcgcttaacctcacaaccgaagc
-tgtttcttacgattcatcatcgtgttgcgaaaatttgagagactcacgaacaactttcgtttttgttttcagtgtttcaa
-ttttcagcttgatccagatttttaaagagcaaatatatcaaacatcacccgaagaatgagtttttgagatattaaggcag
-gtgactttcactcacaaaccagcaagtggcgttcgccctaggggatttcgaaccgccctgttaccgccgtgaaggcgttg
-tcctgggcctctagaccgaaggggacgtatcagtctggcttcgcagacgccttgcttttcacttttctatcagacaattc
-tgtgtgagcactgcaaaaagaacgcttctttaagggtaaggaggtggatccaatccgcaagggttccgcctacggtttac
-ttgttacgactatcacccagtcatgaatcacaagtggtaagcgctctcgaatgttaagctacctacttctttgcaaaccc
-actccatggtgtgacgggcgtgtgtacaaggcccgggaacgtattaccgtggcattctgatccacgattactgcggattc
-cgacttcatggagtgcgagttgcagactcaatccggacttacgacgcactttatgaggttccggcttgcttcgcgaggtc
-gcttctctttgttatgcgccatttagcacgtgtgtagcctggtccgtaagggccccctgatgacttgacgttcatccccc
-cttcctccagtttatcactgcagtctccctttgagttcccggcggaccgctggcaacaaaggataagggtttgcgctcgt
-tgggcgggattaacccaacattttcacacacaacagctgacgacagccatcagcacctgtctcacggttccgaaggcaat
-tctcatctctgaaaacttccgtggatgtcaagacgcaggtttaaggttctttcgcgttgcaatgaattaaaccacatgct
-tccacgcttgtgcgggccccgtcaattcatcttgagttttaacgcttggcggccgtactcccaggcggtccgacttaacg
-cgttagctcggagcagccttcaagggcatacaacctccaagtcgacatcgtttacgggcgtggactaccagggtatctaa
-tctgtttgctcccgcccacgctttcggcaactacagaacacccacccgcctaggcagtcatgctgtggtataaaaatggt
-ggagatcttcgcagagaatgaggggcaggtccaagccgcagcagtacgacggagcagcgggagagaccagcaacgcctga
-gcgtcagtctttcgtccagggggccgctcgccacggttaattcctccagattctacgcattttcacgcgctacctgaatt
-ctacccccttctacgaagactcaagctttgcagtattagattgcatgttccaggttgagccggggatttcacatctgcac
-tttaacaaacgcctgcgtgcgcctttaaccgcccagtaatccgataacgctttggcacctccgtattaccggcgggctgc
-tggcacggagttaggccggtgcttcttctgcgggtacgtcaatgagcaaaggtattaacttttactcctcctccccgctg
-aacagtactttacaaccgccgaaggccttcttcatacacgcggcatggctgctcaggcttgcgcccaatctgtgcaatat
-tccccactgctgctcccgtaggagtctggaccgggttcctcagtttcccagtgtggctggtccatccctctcagaccagc
-tagggatcgtcgcctaggtgagccgttacccacctactagcttaatcccattgggcacagtccgatggcaagaggccgaa
-ggtccctcttggtctttgcgacgttttaatgcggtattagctaccgtttccagtagtttatgcccctccatcaggcagtt
-tccgcagaccttactcacttgccgtccgcactgtcagcaaagaagcaagctttcttcctgtttaccgttcgactttgcat
-tgtgttaggcctgccgccagcgttcatctgatcatgatcaaactcttcaatttaaaagtttgatgctcacagaattaaac
-ttcgtaatgaaattacgttgttcactcttttgagactttggttatctcaataattttcgtccttgcgacgttaagaatcc
-gtatcttcgagttgcgcacacagattgtctcgataaattgttaaagagcagttgcgacgcgctttagcgccctgtcggtc
-gaggtgggcgtatattttaaacgcttttctcttcgagagtcaaccctgaatttcaggatttttctctcaccgacggctgt
-ttgtgtgcagttgaaattcactatcccgccgtgtccgatgaggcgcattatagggagttctccgaggccgcaatagaaaa
-attgcagaaacatgactttgactgctgcatttcccacagcaaaagccgccgcttttataagccttttacgcacagaagtt
-atcacatcatcaattgttaattttctgtattttgcccacgtaaccacagttcaaaatttggtgatcaccattgaaaagaa
-gaataaattcgcgagcgttgcgcatgacgttttcgttcaaatgcgggcgaaaaataaggtatgcccccgttaaggggcgt
-tagcttgagtttttcgcgaaaattcagcttaacgctctctggtaatagtcaaatccaggggatttttaccatgcaacaac
-gtcgtccagtccgcggcgctctgctcagtgtttctgacaaaagcggtatcgtcgaattccgcaggccactttccgcagcg
-gtgtggagctgctgtctaacagggggcactgcccgtccctgtttagcagaaaaaagggtcttgcccggtaaccgaagttc
-cgaattacacgttttccccggagatgaatggatggacggcgtgaaacgacctgcatcgaaagtacatggtggcattctgg
-gccgtcgcggccaggacgatgccatttatggaagaacatcaatccagccctatcgatatggtggttcgtttaacctgtat
-ccgttcgctcagaaccgtggcccgtgaaggttgctcgctggaagattgcggttgagacatcgatattcgcggcccaacga
-tggtgcgtccgccgccaagaacgcattaaagaatgttcgcaatcgtggtgaagagcagcgactatgaacgcaattattaa
-agagatggatgccaagaaaggatcgcgctgacgcttgcaacccgtttccgacgcttcgccattcaaaagcttcgaacaca
-ctgccgcctagacagcatgattggccatacttcggcagcatggttccggcttaccacggtgaaagcaaaagaagccgccg
-gtccgcttccacgcacgcttgacctgaacttttcattaagaagctgataatgcgttacggcgagaacaggccagccaagc
-aggcttgccttctttagaagagatgtgaaagaagcctccgtttggctaacgcaacccaggttcagggtaaagtccctctc
-ttataacaacatcgccgatactgatgcggcgcttggagtggccgtgaaagagttcgccgagccggcatgtgtgaattggt
-gaagcaacgccaacccttgcggcggggctatcggcaattccattctttgattgcttacgatcgcgcgtacaaaccgaccc
-aacctccgcattcggccggcatattggcctttaacctgcggagctggatgcggaaaccgcacagggcatcatttctcgtc
-agtttgtcgaagtgattattgcgcgtccgccagcgagaagccctgaaatcacgcgcgccaaacagaagcgtacgcgttct
-gacgctgcggtccagttgggtgcgagcgtgttccgggcctcgatttcaaacgcgtgaacggcggtctgctggttcaggac
-tgtgacctggggaatggtcggtgcgggaagaactgcgcgtggtgacgcaacacgtcagccgagcgaacaggaactgcgtg
-atgcgcttgttctgctgcgataggtggcgaagtttgtgaaatccaacgctattcgtctaatgccaaaaaacaatatgact
-atcgccattggccgcggccagatttgaagccgcgtgctactcgcaaaaatcgccgggtattaaagcggccgtaatgaaag
-gcctggaagtgaaaggtttctcgatggcttctgcgcgttctttccccgtttccgcgaacggtattgatgccgccgccgct
-gcggcgtgacctggtaatccagcctggcgggtttctatccgtgatgacgaagtgattgccgcctcgcggacgagcacggt
-aattgcgatgctcttcaccgaacatgcgccacttccgccattaatggagcaattagattgaaagtattagtgattggtaa
-caggcggtgcgcgagcacgcgctggcctggaaagcggccgcagtcgccgctggttgagactgttttttgttgctccggta
-tgcaggcagctgcaactggaacccgcgtctgcaaaacgttgctattggcgtgaccgatatcccggcgtgttggatttgcg
-gcacaaacgaaaagattgatctgacatcgtcggcccggaagcgccgactggtggaaaggcgtggtcgattacttccgcgc
-cgccgggctgaaaatctttcggccaacgcaggtgcggccaaactggaagtgctcaaaagcgtttaccaaagatttcctgg
-ccgccataagtatcctacggcggaataccagaacttcacagcgaggtagaacctgcgctggcgtatctgcgtgagaacgg
-cgcgccaatcgtcattaaagcggacgggtctggctgccgggaaaggcgttaatcgtgggcgatgacgctggagaagcgaa
-gcggctgttcacgatatgcctttcgcgggcaacgcttttggacgcgggtcatcgcatcgttatcgaagagttccttcgat
-ggcgaagaaagcgagctttatggtgtggtggacggcgagcatgtgctgcgatggcttaacagccaggatcacaaacgcgt
-aagcgataaacgataccggaccaaacacgcggcgggcatgggcgtttttactcccccgcgccggtagtaaaaccgatgac
-gttcatcagcgcaccatggaacgtattatctggcaccgtgaacaggcatgggcggcggaaggcaacactacaccgttttc
-ctctacgcgggctgatgatccgacaaacagggcaattccgaaggttaattgaatttaactgccgcttttgcgattccgga
-aacccagcgattatgctgcgcaatgaaagtccgatctggttttgagccttctgctggcggctgtgaaagcacactggacg
-agaaaaccgtacgagtgggttgaacgcgctttctcggcgtggtgatggctgcgggtggatatccgggtgattaccgcacc
-ggttgacgtgaatccacggcctgccgctggaaagaagtggcaggccggcaaagtggttcccacgcgggcacaaaacttgg
-cgggaactgaacgagcacggtagtgaactcaacggcgggcgcgtaatgtggcgtacccggcgctggggtcctaccgtgca
-gaagcgcagaaagcgcctatgccttatgaccggataatccactgggacgactgcttctactttattgctttttgcttttt
-ttttgctttctgcttgctttttctttttcttgcttcttcttgttgctttgcttgctttttattgcttgcttttctttatt
-cttctgcttgctttgcttgctttattcgtctttttatggttctttctgccggaaagatatggctggcgcgctatcgaacg
-gagcagaactaaagcgcgacagtttttccaatagcgttttgcgcgtgatcctaactgacgggcggctttcggttttgttg
-gccgcctccgttttcttcgccacggccgccagaaatttcacctctttttttcccacttccaccaacggctgagatatcct
-gactttgtccagcgggatgtcggcgtactggcaaatcgccagcggccagctcgacgttcggaaatatattccgcggtcag
-cagcaccgactgcccgtttccacggttttccagctcacggaaatatttcccaggccagtcgtaatgaatcaacagatcca
-atcgccgagtggggcggtaataaacctttttaatacccaaaaagaaaaaaaaataaacaaaactgtggtcggccattggg
-cgaattacggccctccggcaaagcgtgggcagaaactggccccaccagcagagggatctttcccggccgttgcccgcagc
-agatggttacttcaatcgcgcaccagcattcaggcgatagtagagatcctggcgaaacgacccctcgccacggcactttc
-actctgcggcaaagatcgcgatgtccgccgcatcagccggatcatcaaccgagataattggttgctaccatgacacgctg
-aattcgcgatcgctga
->m141013_011508_sherri_c100709962550000001823135904221533_s1_p0/1299/0_6265 RQ=0.823
-aaaaacaacaaaaaaaaaggagaaaaaaaaaaggaggggatttttttaattaacatttaaagggcaaaacgatgttgagg
-ggatttggccgcattttttggacccattttgggtgattttttatctcctggtttttttattgcgctgcagtgatttggtt
-tgggtgatgaatgtataccggggcaccgtggtttttggcagttttgggttttgagattgccttttaagcccttagaggcc
-aatttccgaagggtagatagcccttaagttgtggcatggaaaaccgctggcgatctgggatttttgggtatcgggtttgc
-agctgggttgactggcaaacatatttctggaaggacaaacaaattctacgcatgatcgcgaacgttcttgataggatatt
-taagaaacgctttgtataaaacgaccgtgggtacagggaagaattacgggtctacatccggaagcgcctattatatttat
-ttgtatgatataaaaccataatcccttgcccattagtcattggttttttttaatccattcaccgattttgattctcaatc
-aaacggttcaataaaccagcgtatagttcaatgaacattaagattgataaccatggaggttattatgaaaaactgcaact
-tattttgtttattgggacgcttttgtttccttttattccgatgcccgggcgcaaaactgttttggttgaaatggggggat
-ttcacactgtacggcccggcgaatttggttgtaatgatggttatattagtgcatggaaaaaaacatgcccactactgaag
-tgtaaaggggtgcatgagaaatgaatctgctagtccaaatgcgcggtggaaaatccggcgcttgcttactggagcgtgca
-ggccatgaggcagcaatcttatcaccgtccggacgcagttcgagagcgtttgttgggtcaggagtggtgaattcagaatc
-gtaatgcagatatgagcagaccccacaggtcaagagggtttgcttcctagctttctcccttgggcggattggcgggtaag
-aggtaagaatctgaattgctttaggttcattcgggttggcctccgtttgatagaattcggtcggggcttcgtctttctgt
-tctccgggtttagctgaaacagaagtctaggcagaggcatctatgagggtttcctttgggagaatatcttcacggaattg
-ccgtgctgttttccgaattttttccgtccttagggttaggccagtttagccattaggttctcctcttcaattcaatagat
-ttattttctatggtcaataattgttgtacaaatgtgagcaagagggtttttgttgtcataagttattacgtcaagtggcc
-gatgctttctatagcgagtaagctgacagagagaacgggtatgatacactctcacaggatttaggtttttttgggcataa
-ttcaggttggttgttatttgcttgcatttatggcggtatattgtttatttgcattaagttcagccctggtggcttttcta
-ctggcaggcgagtcgcgatcagcagtgatgttactggcgagatttggagattcggagcgggtttagcggaacagtttcag
-atttttttgcgtttcagacggattcaatatgattgggggtgcgagtcgattgcggaatggaagaatgaagcgaaatattg
-ccgcccagcgaatcggagtattaagtcggcagcaaaggttatcgtgcttatcagaattcgaccggtgaaaacatctgctg
-atgaagctcgacactgaattaataagttcagggcttatatcacggggttatcaacctatgttgaaatatgacaaattggc
-atgtttgaagcgatttatcattgaaagtgagcagatcgacgctggattaatgcttataccgggatattttgaacaaagcc
-tgggcacaaataactgtccgcatcgccgccgtagatacgtagcagagagccaaccacttggcggatggccatagcgcagc
-agcctgggtgggatgttcatcgattggcgcgtttgtggaattgggcctggtcatgagatgatacatttatggtgctcgtc
-ggatgtattggtccctgcaacatgcgcacaaccgggattgaaaaatcgccagtggcgatcttgagatgaatgatgaaccg
-gcgggtgtaatgacatcggtcgcttaagttccgtcatttttacagcatgcagcattcacttgggatgaagtaagggctgt
-ttcgacagggcgcggagagattttatcgtggcaagcgaaatttcagctggcaatgcggactgtcatcatcgcaccgagaa
-acaagcggcggctattcgaaaactgcgcagcaatggagcacctcactttgcgacggtggaaacagaatgcggataacgcc
-gccatcatgcagcaaactggcgcaagaggcttctaattaaagcagcgatggggcagacggtttccggtgttatgtaacaa
-gatgggcgctatctcacgagttcgaagaaatttttctgagatcacctggtcatcaaccagtattgcttttccagagaata
-ttctggcactggaatgctgccgttgagcgggaggggtggaaggggtggatttgcagtttgtcgcagcagtaggacactcg
-caaagtcgagcgggcttcaggcgggaagagattgaaggcttgatcagtgatcagtcaggttaattgctggggttcggtgg
-aggtggcaacgggcgggaaaaattgagcgatattgattgaatgcgtcgcgagtgtacaccatatatggcaggaaataagc
-cgccgctcggatgaacaaagtagagggcataacggcagttagccaggcgattctgaaatggataagggtgacgcccacag
-atgctttctctgtagatagaggctcagcggggcgcgggttgttccttggaagacaggcgggcacgattactgaggcggtg
-gatgtttcgtctgcacaaaattctgtgtcgcagaacctcgcggagcggtgatccagttagtttcgctaggcggtgttgaa
-aatggttcaaggaggggtgagattccttacctttcgaacgggcaattgatttttcgcatagcgttaatcatcactggaac
-atgaagagaggttccatctacgcgggtagtatccaatggtttcgcacttgacatgtccggaaccaggcagggcgcaccag
-cgtggctatgaccgcaggtcgtctttacagcggccagaagggaccaaccacacgtatcgtattcaaccgtaagttgacga
-gatatgcgagcagcgcgtttcgatcaacgcgcgaaaggaatttttagcagctggttctgcactaatgcaatctgatgctt
-ggcgtggcgcagtgccttctggtgatacaacgacggcattcccgcacacgggctttagcgttttacgttctctgaagtag
-gcgggtgattagggcggacaacagattaggattcaagaaaccaggagtattcgtaattagcggtcatagttcaggaatct
-gactccgaccaatgccgatatagatttttcccggtttttataaccgggcagaatctagggttactcattgtcgcaacttg
-caaggtcgtcctcttttgttttgctgatgaaaactgactagtaacgaaggtaatatcagtgccgcagtaggtagtgccaa
-cctggacatattattaaagacgtttctttacgatgaagcgacgtcccgagcagtggttgatggcgtaagaatctgactgc
-tgcgttaaaaattgttcgccgggtaagggtaagttgcgcccctgagcactgctcaaaacaggagcgccagtcagcttgct
-ccagttattcaattgtcttggagaggggttgatcataattagggttttcgccggcgcccaaagttccttgtttgtggaca
-gctcgaatgtatgaaggtgggcgcaaacgattgcgctgactaaacagctatttttttccatagcgatgttaaaacgaagc
-ggtggtgctgacaagtggaagtttgttttgatttatgataaacttgattgcaaaatattattaacattaaagcatttgtt
-acagcaaatggataatattggattgttttgcggagatcacggtttgtaaatttccttcccgcagagtgatgcggttctac
-actcgaattactgacatggaaggcagcctaatgggcgaacagcatcaggcggatgagattgggacagtttttcgcaggca
-ttagccatgtaccagcaagaaggttccgcatatggacgctgcttggaactggtaaaagctgatgtgaatctgggtgtgct
-ggaaaacaatctcactgcacgaaaatggtaatgccagacgagtgcgcgtacatgaatgttgaacgtatggggcggattag
-cgttgggatgcacaagagcttgctactcttcggcggatgtttgccattatggggatgtaccggttgagctattacggaat
-tctcgaggccaggggtgcggtcttcgacagcatttcggcattgatgattgttcttgggctatcttccgcgttttttacct
-cttactctaccgcttgagacttataggagaatgaattttgcgcagaagcgggcggagattctgcgtccggatatcttcac
-cctagttgttcgttaaatgttagaggaatatgaagcagaaagggcggttttaacgaaacacagagcggaagtttgtgcag
-gaagctttggaaacgtttcgctggcacagtagccaacggtagatgaagaaactatgcgcattgccaacgaattcggtttt
-gattgggctgatgtggtctgttttttcgctggatgccatataacacctgagccacgtaagctggatatttgacggtgcag
-gtcgatgatgactgaatgcggaaattgaccaaatttcatcgaggggccgccgcgggcagcggagtaacgatttttactac
-gcccagacagctttaaagcactggaagagacggtggttgtttgcggggcagaaaacaagggcaacagtacgcgcgctttg
-gtgaaatttgagcagcgtgggcgtggcattaaacgccgcaaggcggacactgtatgaatgattttggtaacgctgaacgg
-caggaataatatcactcaccaaattgcttttaaggacttcgcgcactttccctgagtgaagtgttttaatggcgttacca
-gcaggggttggcgatggttcggtacgttctgacggcttcgggtgagggcgcatcgttcaggcgattctctggagacgata
-accagcttattggacggtggttgggtagtggcgcaacccatatatgaagatttttggcaccgttgcgcggcggggatctt
-cccagcaaattgggtatggaaagcagacacgagttcaggtaaatgagtcgcggaagctttgagcaggcgttgggttgtcg
-gttttggatgagttagctttttacaggaagcggaagaagcagtaaacgtcgctgtggtttgcttttaaaatctggacatc
-cgctttgcaaatttgctctgattttttccaacgatcaggatatgcacatgcataaaaaatgccgattttttatgcatatt
-ctcgccgcttcgttaaccaatggattattaataaatattgtctagagtggagcggtcatattaagcacttcttgccgctg
-aaagacctagcgagggaaccattcacacaccagaaggactgcactttcaggtatgggactcgtagacgatttattaaaag
-gttttcaaatggctatgggcgccgtgtgcggtaccagcggattgttctcttttttctcaggcggattcggagcagaattc
-tgatattgcgagggcaacgcgcgttttgacttctccatttctagtcatgggccgagcttaggcaacaggtggcgtggtgg
-cctgcgtcgtttactgaagcggctggccgacaatgacgcgcaaggcttataacagtattcaattacgacgccgaaaaagc
-tctggctacagttgagaacgtaatggaacggctcagtttctttcatatggaatgggattccgatgccgagttcgtcatgt
-ttatctgtagatcggcacactttggcgcgtggcattccactttcgccggagttgttcaaatacaacgtgctaggtttgtt
-gatacaaacaagttaaagtaagggcaaagcgatctggctttggccggtttttcccgccgtgtttaaagcccgcgaatggg
-gcgccgtgatgtagtatcaatttct
->m141013_011508_sherri_c100709962550000001823135904221533_s1_p0/1357/0_20183 RQ=0.853
-gtcgccaaacaaagggggaagaaatggcccccccaaagaatgggcgggggaaaggttttaaaatccccacccagtttttt
-tttcccccttccccggtttggcgcaatcaaaacttgttggggggttttggtgctttacgtccgcgtgccccgcaagtttt
-tttttggcccctgaaaaccagaaggtttccatccgggtccggctgccatttacggccccctggcgctcgtttaataacga
-agatagccgcgacgcgacggtagaaaggaaggcgtaaaatggcggcgttgaacagccagaaacgggtatggagctgtatt
-tccgtgggctactgctccgagtctgcccccgaaaaacacgtcgagatccggctggcgcccattcagcagggcaaaggtag
-aaagtttccgcaagatttctatcgcgacccctgcaaccacgctaaggagtgtcaacatgacgactaaacgtaaaccgtat
-gtacggccaatgacgtccacctgtggaaaaaattgccgttttatcgtttttacatgctgagcgaaggcacggcgggttcc
-ggcttgtgtggttcagcatttggaactgatttcgggctgtttggccctgaaaatggcccggaagcctgggcgggattcgt
-cgacttttttacaaaacccgtttatcgtggatcattaacctgattcactctggcggcagcctctgctgcacgcaaaacct
-ggttttgaactggacgcagcggcaattatcatttgtaaaagacgaaaaaatgggagcagagccaattatcaagtctctgg
-gcggtaactgtgttgcacgatcgtaatccctgttttgttgccctgtatggtaaggagcctggagatgattaatccaaatc
-caaaggttctgacaccggtattctgggcgctcttcggggccggtgggtatgtggaggcggcatcattgcgccggtgatga
-tgccttgctggtgggtattctgctgccactggggttgtttccggtgattgccgctgaagctacgagcgcgttctggcgtt
-cgcgcagagctttcatggtcgagtattcctgtctgatgatcgttctggcgctgtggtgtggtttaaaccgtaatgcacac
-gcgatgcaacgattgaaaatccacgtactgcgggcaaatcggggttttctacggtctgggctgctatctctgaagttgtc
-agcgctgatggtggtcgttttacaatctaacgaatcgccaatgtaaatccggcccgccctatggcgggccgttttggtat
-ggaagcgcagacctatgtttcataaatacgacgctctgcgccttattacattaccggccttcttgctccacatttgcctg
-cccctcaacaatcacgatatttgtggcatcgcaacaattaccccgcttatagagcaacaaaagatcccgggtatggcggt
-ggcgggtaatttatcagggtaaacctctttactttaccttggggctatgcggacatcgccaaaaagcagcccgtcacaca
-gcaacgttgtttgagttaggttcggtcccgcaaacatttagctggcgtgctttggtgggagacgcttatgctcgagggaa
-atcagttaagcgatccacaacaaaaatactggctgaacttacgctaaacagtggaatgggatcacactattactctcgca
-acctaactggctggcggcctgccattgcaggtgcggctgaggtgaatctcagcgacttgctgcgcttgcctatcaaaact
-ggcagcctgcatgggctccaggaacacaacgtctgtatgccaactcgtatgtttgttcggcgcactggctgtgaagccgt
-ctggttgtaagtttttgagcaggcgatgaaactcgtgtcttcagcactcaaactcacctacgtggattaatgtacgcgcc
-cgcagaagaaagaattagcctggggatatcgcgaaggtaaggcagtgcatgttcgcctggggcgttagatgctgaagctt
-atggtgtggtgagcgatttgaagaatatgggccgctgggtgcaaagcaattttaaaacgccttgtatcatgagaaaaagc
-ttcaagacaagggatacaactgtttgcagcaatgctcgctactggcaaaccggcgattatgtatcagggcgctgggctgg
-gaaatgctggactggccgtaaatcctgaccgccatattacggcagtgcaataaaattgcactggcagcacgccccgtaaa
-gattacgcccaactcctggcagctcacgcgcgatcatgggtgaataaaacaggggcgaccggcgatttggtagctatgtc
-ggtttattccagtgaaaaagaacgctggtatgtgatgcggcaaaacaaaactatcccaatcagcgagagtcgacgccgct
-ggcagattccttaacgctctaaacataaaaattccatcgggtcgatttttcggaccttttcctacgcttttccttgctgt
-catctacacttagaaaaaaaaccagtaaggaaacattatggcgcctgctcccttctctgtgcccgagcgacagctgcatt
-tcttggtcgttgccctgcagtttctcctaacgccgtccgcgtgggcgtgacggtagtaaaatattttgacgccaacgttt
-atctttcggtaactgggtatgagattgcccgttttgatcacgcttgaacgtggaactgtaaaaagtcacgcaaatacagc
-ctgcgtggatgaggcggggctgaatgtattaataaaggctataaccctcgacaagaggaatgtgcagcagagtgaaggga
-aagcgactttttacggcgcaccaatcgcctgcgctgacaagtgtattcttttggtctttctatggcggttataacgttat
-tgcactcgaatcgggaatacgcgccatgcgctggtttgcggcccgggaccgcgcctacctgtgggatactctccgcagcc
-aaccatttctgacgaagtggaaacaggagaatgcttggcagtcgcgaccgggaagggtttgatgtcagtaaatttttatt
-tgggtacagcagcctgggtagttagtggagtgctgagtttcagaccaataatcccaatacgattaacgccagactcgcca
-ggcgctcgggttagcggtactcaccgagcagcaaatgcggtatggccggcccgcctgcggccaatacccgtccacaggca
-ataagccgtctactggtaaccgatttcaccaatcgccaggcaaagtagccgccatactgacaatcatcgcgcgtcacagt
-aataacactcggcgtcaaacgctaaagcgtgggtatatttcaggccaacggcccataaccacttcagcagaccagcaaat
-aaactaagataatccaggacatatcaggggctccggagaattggggccgtccccggtgaaaagaggcgtttgcaggtcgt
-ctgcaaagctgatgttgaacggattttgccaggtgggcaggggaatttcaactattacctttgtgactatcgcagaaaaa
-acaaacgggcacgacacagctgttgtgcgtaccgttattgcttatttgctgccgctttcgttgctgcgccagaaatcgcg
-ttttaccgccatcagaaatgtcttcaccaaccgccacgcggtgtgttgcaggcagtcttaatactgttgaaagcaccaaa
-cagaaagatccgctttgcaattgtcttcttcaccataagtcttccttttaggtatgttattatgtttggcctatagcaaa
-ttataaatagacacatcgcaaaaatgatggaatctgatgatgttttcggaagagacgaaaattagctggagcgcgagaga
-tgggagttgccgagatgttttgatgtttcgccgaaaccgcgcggtgttacgcgccgtgagcagcgtgctggcaagcaaac
-aagaacgattaagggcgtttcaatcatctctgacctgaataagtgatggttgcagcctcaggccgcaccacaaccacagg
-atacttcacgcgagagacgtattcacgcagagcgggtatccactttgatgacttcgccgatttgtacaaagcagcgaact
-taaccacagcggccagtagacagggtagccggttttgcctacagtactctgcgatcacctttcagggcggatggtatcac
-gattttccagttttcaacggaagttcggggagtaacggagatgcggattgaccatttcacaagagttacgatccctctgc
-tgatccagcgccatttagcgttgtcacgcaattgttttggcatcagcagacagctgctcgaaagttttgttgtttcatga
-gagccagaactcaccgtgttgtacaggtaagtcaggttcatatcgacacatcaagcgcttcagcggatcagtagatttga
-aggtttttttctacgcggtaccgggtcaggcagacgacggcagtttaacgcgagcaaatgcctggctttaccggttttta
-cgaattcacgtcgcttcacaggtaggtttcgccgtctaacatgattttaagacggcgcaacgaaaatcggttgctatagt
-acgttgccataaggacctctgaaatttgtttaattggtagctaaggccacaaatggcgcatattgttaacctaaataccg
-catccagagaagattggttaacgcaacttggcgatgttgtgacgcgatcctgtgaacttctgcgtcttttgaatatagac
-ggcgggggaaaactggttagccggagcaagacgccaacaaagcttttgcctgcgtgtgccccgctcatttatcgatgcat
-ggagaggatccggagatcctctttttgcgtcaggtacgcttacctcgcagatgagttttgtgcatcgcgccgatttctca
-accgacccactggaagacagcacagcgtagtgctggttttgttgcataaataccacaacgggcgcttattgctggtccaa
-aggcggctgcgcggtaaattggcgctattgcttccgtcgtccacttccatatgccgaaaatcagggcaaaaagcgtaact
-gccaactgcacttgagttatgtttgctcgcttgcgcaatccggaactggacgagatgattttctccggcggcgactcgct
-gatggcgaagatcacgagctggactggttgctcacacaatggaagccatccgcgcatataaaagtctgcgattccacagc
-gttctgcgattggtgatccggcacgtatcacgaggcgctggttgaatgctttggccgtttctacgctgcaaatcttgctg
-gtgaatgcaacataaccatggccaatgaggtagatgaaacattccgtcaggcgatggctaagttgcgccgggtaaggcgt
-tacttttgctgaaccagagcgttctgttacggtgatgtgaacgataacgcacaaacgctggcaacgctgagtaatggccg
-ttgttcgattgcgcgtatgccgtattactgcaagtgctcgataaagtacagggcgcgggcgcatttttatggtgagtgat
-gacgaagcaacggagattatgcgtgagttgctgacaatgcgtgtcgggatattggtgcgaaactggcgcgagaaattgcg
-gcgaacccaagcaaaacgccagctggatctccagctccgccagcagtaactgattaacagggaagttaaacattaaaatt
-gcttgattcgctacgctttatcaggcctacatcgtgcattgaaattgaatggatttgcaatgaacgtagccggataaggc
-ggtttacgctgcattccggcaagagcaacaaacgcaggtacagcaacgctgtcattaactgggaagtttaagtctttgcc
-cgttgcacaataacctttaattattcattatgcattgtgttgttactttttatataagtaaacacaataattaactttct
-ttctgtttatatagaagtgagtaggctatttatgttattttaacaactattactacaagccatttatctgggctttataa
-ttatcacaaattaattatttaattgagaatggtagggaggaacctacatgcgctaagcaatcaagggtgttaatacggtg
-ttattgcgcaagagtaataatttattgcaactggcgctgaaataaagaaaccatcgcaataagatgttgttctttaatgt
-ctgtcatggaactgcggcgacctggctgattgcgctggaaagttctctgcatcaaaagcataactggaatgctgctgcac
-acttcagtaatgagcagctcgcgataaagtccattaagaaaatggcagaaaacatcgcagaaattctggtttttgatgag
-cttacaaatgccgaatattaatcgtccgggttaagcgctggaacttaccgataatcaaggcgaaaatcttacctttcgta
-taaagctacaatgacgcgtaagcaaatgtgagttagtcgtcaatgagttgcagattgaaaatgctggcgcgagcaatcaa
-tttcatacaattaataatgcggaatgcgtgctggcattacgtattacctgcactgttagatttcctgccgttatagcgac
-gttgactgccagacaatggcaatctggtaatagatgacactattcccaaccggaatggaacataactttgttcgaccatt
-tatctggcggtgcttttacgcttttaaagattgaaaagtggcaaagaacaatttagcggcgcagtggtgaaaacgcgtga
-agcaacgcgggtaaagaatagaagcgatcactgcgccgaatgcttgatttcagccacgactgaaaaactcgcgtgtggcc
-atgtccaggtctatgttcgcacgtagcggcgaataacgccgcaccgctaccaggatcaatgctttacgcgcgctgcatca
-cttacgtgtttcaatccaccagcaaaactgcaccaaggcgaataatctcatctttgctaatgcgagctggagccatccgc
-ctgaaatgactgataacgtgatcgttggtcatgcggatgcgcgttaaacgcttatccggcctacaaattctcaagcattc
-atagttgcaatgccttattgtaggcgctgataagcgcgaagcgcatcaggcaatttttaaataacgggtttttttttttg
-gttcctaaacccgcctctgaatcacatcagtttcgggcactttaaactgacgtaattggctatcgtcggggacaataact
-ggacaacattcctgaagacgggctactgatcataaatcacgttaccgattgcgcgccccctttgggggggggtttttgcc
-ccggcagattcgtttgctgcgccgcgcatagaaccgccttcttctcgttgtttgcccgaaagccagtgctttgctttacg
-ctgtccgcagtaccaatcagctggctactctgcgcctggctgctcgtccacaatgcgtacactctgaccggcatgcactc
-attcgttgctggagtacaacccgcatcagtagcgcggcaacagacaatcctgctaagtattttaacgtgcatgttattcc
-cataatgcaatgagctggacgcgcaactcgcgtcgtcgtgtctgaatcttatactagaagatgacaaaagaaaacccaga
-atttctgccggggtttgtttattttttctgcgaggtgcaggggcaattacatcatgcgccacatgcaccatgcgcccata
-ctgccaagcaagcgctaagtcagctgatcgtttttttcggcaggtcggtaaccatgcattcggtggtgatcatcaggcca
-gccacagaagctgcgtactggcagagcagaacgagttactttggttggatgcaggataccaatgtcgatcatgtttgccg
-tattcttcggttgctgcgttgtaacgttagttgcgtcgccagccttttaacgtgttagcaacaacagaggttcttcgccg
-cagttataagattgacgcagggagcttccattgcacgcagtgccactttgatacccacgttctggtcttcgttctgaaca
-gcaggtcagccagtttagaacgctaacgcggatcagcgcacacaacacccgcaaacgcttttctaacgcagcacgggtcg
-agtgcagggcatcttcaacgcgtgcttttttcttttatttcaacttcggtagcagcacactttgataactgcaacggcgc
-tgcaagtttcgctacgcgtttctgcgttttcaggtcgtagtcaagaaagtttgcttcttaatctgctgaggtctgagcaa
-cacggcctggaatgctagcttcttcaccgcccgcatcgtgatagtggtggtgttcttgttgatacacaacatgttttagc
-ctgacccaggtcttccagggtttgctttttccagctccatacgcgatctctcagagatcaggtaccgcagtcagggttgc
-cggatatcctgccagcaatagcttttaagcgacgaatcgcgaagcgccggtgctttaacgccagcgactttcacgatgcc
-acgcatggtgtaaaacagagttgccagcgctatttcgccttcctacatcttcactatgataggcagcggtttggcctgct
-ttgcacagctttcagaaccgccgcattttcgcgaggaatgttggagattttccttgtcaccagcaggatgaacgggcttt
-ccgtttatgcgcagtttccggcttggtttgatgagtaagggagacaggtgccacggtcgaactgcattaccttcaacacg
-tccagttcgtcctgcatgaccggtacgcgtcttcaaacggtgataacgccttctttaacgactttgtccatcgcttcagc
-gatcagttttaccgtacggtttcgtcggaagttagcggagatggatacaacctgagcaatcgctttagagtcagagcatg
-ggtaccgggacagcgctttccgtttcttcaactgcagcggtaaccgctttgtcgataaccacgtttcaggtccatcgggt
-tcatgcccgcagcaacagcttttccaagaccttcagttgatgctagctgagccagtaacggttgcagtggtggtacgtcc
-gcctgcagcgtcgtttgctttagagggcaacttctttcagcgcatctgcgcacccatatttttgaacttgtcttcagttc
-gatttcacgagcaacggaaacaccatctttggtgatggtcggtgcaccgaaagatttatccagatacgtacggcgctttt
-tgggagagggtactttcactgcatctgccagtagtttaacggcggagccgcgcaggcaatttttcacagagcggtcgttt
-accagaattttaccgtcttttagcttgccttatctttattcttaaattcgtatgttcagtgcggtgcggcgattacgctt
-tcaacaattgccaaatgtccgcttcggaacatgaatcaacacttcttcattgtcgaatttctcagatttcacgaccgtag
-ccatcgttgtaaataacgatgtcgcaactttcacatctcagcggcttcattcgcatttcaaggatacggcattgcgacag
-catgcacttttgccgcgggagtggatttaggcgcgctgcagagcgtcagaagaatgccgcagcagatttagtttaacttc
-ttacgcttgaagatcacgcgatcctgcaatggacgaatattcattgataatctcttgagaaagtccgtatctgtttatgg
-gtgacgccggagcttacgttgtttcccggctggtgacaagagaaatggggatgaggcttcgcccttcaagggggaaaaag
-aaaaaaaattctgagatcgcacaaatcgggtgaaaacctgatcacctacatttttcatcgcaatttcttcatcgccgtca
-tagcgaatctgagttggtgctacatcgaaaatctacgtcagtgcccaaaatttttggggcgcaatcggacatcaacccat
-gaagtgggactcaaacaagaactggggctggccagggcattggcccctgctatcgacgtcattattagggcatttggcgt
-gtttgccgttcttgcgttagtcgcttggtagcgggcaataaagcaatgtggggcgtggccgtttttgattatcttagtgt
-ttcgattgcgattggtgttttgcgatttctgggtcgccaactatccagcgcggcgggcgtcgcgcacttcgtcggtatgg
-cgttttggttcgcggcttgaggcggtcaccggctggctgttttttatcggtcattccgtgggtttgcctgcgcacctaca
-aattgacgcgggtttcgccagggcgatgtttggctggcatagctggcaactgttgttggcaaagaactcggtacgctggc
-gctggtgtggtatatcgtatcgggtgccagttcagtgctatcttacaaacgttatttgccgacttatcgtcgcgctgatt
-tgtcgctatctggtgggcggggcgaatcaaactgcgaataatcccctttcggcacctggtaatatcgaaacttaccgggt
-tatttgctgcgttatcagtgatgttctggtgttttgtcgtctggaggcatttgccctctcgcttcggattaaaatccaga
-gcgtgatttctcgtgctttgatgattggttggtcttgctggcaggattagttactggggggcttgtacggtagtcgtctt
-acaacttcggaacgcctatggtggaaaaatggcggcggcagcatcgctttccaaattggtagtgcagtttgttcggtgta
-ggagcgttatggattgcctgcgtgattggtatctggctgctttgccagtctcacattttaatatacagagcttgtcgcgc
-cgacctggtctggtcgcaaggccgcaacataattcctgaccaccttacctggcacggtgatcctctgcttctcgccataa
-tccgaataatgccctcaatgcggtgctcggctgctgctgtggtgagtcacttggtgattcatgctttagagaatatctgg
-acgctttattatttatgcaatgggcatctttattatgatttatctgttatgcatgctggccggctgtaaattttgaagga
-cgttatcggactactggcggtggtttggcgggctgttatgcgtttctgttactggcaatggtcgctgaaaagtctttatg
-cgcttgattcatgcttggcggggttatggctgttgctgccaaaacgaaaaacgggcacgttgaaaaatggcataaccaca
-taatccggcgttttcgacattaatcctggcggatcgtcttaatgatcaaggcggtcggcgctcatcatctttcgctggta
-tcaccatcaaaagtattaccgccacgtcgccggcgcttaaaaccgccggccaggcaatgcgagaaagcgcaaatgcggca
-tcaacttcactgtcagatgctttgcaacgcggcataaaagtagaagacgaggagtcggtaaaaagcacggtaataaaagc
-aggcaaaccagcaatgatcagcgaaacacttttaatcatctccgccgtgggtttcaccgccgcatttttttgctgctcag
-ccacgaaatcttaaagccctggttacgtccagtgaataaacgataactgacgtgatataaccagcagagggtagcaatac
-ccgcaatacatgggggcaactgaataaagatttgaaattcatatagacataaggaaaatggcaataaaaggtaaccagcg
-caaaggtttctcctgtaatagcaagccgttaagcaccggctacgtgaatgggtttgcgatcgcgtttagcttatattgtg
-gtcattaacaaaatttcaagatgtttgcgcaacttatttttggtagtatccaaagcggtgatctatttcacaaattaaaa
-ttagggtaaaacagaccttaaagtgatcagattaacggtaggaaatcctcaagcagcatatgatctcggggtattcgtcg
-atgcaggggataatcgtcggtcgaaaaacattcgaaccacatatattctgtgtgtttaaagcaatcataggcagcttgaa
-aagaaggttcacatgtcacacaacaattcgtatcgaaagaagatctgtttgggtagcagggaaagttttccagctgatgc
-tactgatgggttcaactctgagagcgattcgaaaaacttctaatatcagcaacaaacaaaatccgtgattattcctgtaa
-tttgttcgcggtatggtaatggttaaaaagcgcagctatggcaaacaaagagctggaaaccattctaaaagctgtcgcga
-attggcatcattgccgcatgtgatgagtcctgaacaacggaaatgcatggatcagttccggtagacgtctaccagggcgg
-gcgcagggtacttcgtaaacatgaacaccacacgaagtgctggcaatatcggtctggaacttgatgggtcacaaaaaggt
-gaatatcaagtcctgcacccgaacgacgatgttaacaaatgtcagtccactaacgaacgctacccgaccggtttccgtta
-tcgcagtttactcttctgatttaatggtagatgcgataacacttgcgtgaaggctttgacgtaaagctgtcgaattccag
-gacatcctgaataatgggtcgtaccgcagctgcaggaacgcagtacgcggatgaccctcggtcaggaattcgcgctttcc
-aagcatctgctgaaagaagaagtgaaaaacatccaacgtaacgcgctgactgctgctgaagtgtaaccttggtggcacag
-caatcgtactggtctgaacacgccgaaagagtactctccgctggcaagtgaaaaaactggctgaaagttactggcttcca
-tgcgtaccggcttgaagactgatcgagcgactctggactgcggcgctatgttaatggttcagcggcgcgctgaagcctgg
-ctgtgaagatgtcccaacaatctgtaacgacctgcgcttgctctctcaggccacgtgcggcctgaacgagatcaacctgc
-cggaaactgcaggcggtctttccatcatgcagctaaagtaaacccgtgttccggaagtggttaaccaggtatgcttcaca
-gtcatcggtacgacacactgtttaccatggcagcagaagcatggttagcctgcagttgaaaacgttttatgggcgtcatt
-ggccaggcaatgttcgaatccgttcactatctgacaagcttggctaacaacctgggaaaatgcattaacggcatcaatgg
-ctaacacgaagcgtgcgaaggttcgtttccaacttctatgtatcgttattacttgaaaaccttcatcggtcacccaacac
-ggtgacatcgtgggtaaatctgtgccgaaaaccggtaagagtgtacgtgaagtcgttctggaacgcggtctgttgactga
-agcggaacttgacgctcttcttctccgagcagaatctgatcacgccggcttacaaagcaaaacgctatacttgatgaaag
-cgaacagtaaatcgtacagggtaagtaaaataaaaaaggccacgtcagatgccgtggcttttttttctgtgagcagtaac
-ttaaaaataacaatctaaatatcaacttgttaaaaaacaaggaagctaatatgctagttgtagaaactgatcatagtttt
-tgctggcgaatcttcttgggcgccagattgggggtgaataggtattgggttttgcaggcggattgggggtgtcggttctt
-gccgctattggcgttaaaccgcggtaaaatcccgttcgaatgtcatctccattatcatggggttttatcgccgctatttc
-tgccatgcaggttgctggggtctgatatctggttcatcagacagaagctgctggcgccgtaacccgaaatacatcacgat
-cctcgcacgatcgttgacctatttcctgatatcttgctggtactggcaacatctctctggcgacactgccagtttatcgc
-tgaagtgcgaaggaacaaggcgttaacttgccgtccgctggtctactgcagtgggtatccgcgcagattgcgatacgatc
-gctaatcttcagcggcagtggtttacaatgtccttccgtgatggaaggttcatggataagctacctcccatctgctttct
-ccgtggtcatcccgtccacgtctgctggccggcttctggtgatgtcttccctggtcactaatgctgttcaactccaaaac
-tctctgacgtatccgatttatcgcaagcgtcctggaagagggcctgttgaactggcgcgtgaaaagcagattgaaatcaa
-atccggtggcaaaacaacgtccgtctggcttgttcctgctggggcgttagttggcgtggttatctatgcaatcataaaca
-gccaagcatgggtctgggtttgaaaaaccgctgatgacaccaccaacagcaatcctgattcatcatgctcagcgttgcaa
-ctctgaccacgttatctgtaaagtcgaatacgacaacatctcaactcagcactttcaaagcaggtatgagcgcctgtatt
-ttgtatcctgggtgtttgcgtggctgggcgatattttcgttttcaacaactcgactggatcaaagattacgctggtgaag
-tgattcagggtcatccgtggctgctggccgtcatcttttctttgcttctgctctgctgtaacctctcaggctgcaaccgc
-aaaagcactgatggccgatggtctggcactgacgtttcacgctgacggctgttgccttctttgctgcggtgtctggtctg
-ttcattctgcgactacccgacgcttggttgctgcggtacagatggatgaaacgggtgactacccgtatcggtaaattcgg
-tctcaaaccatccgttttcttcatccgggtactctgggtgttgccctggccgttttgttcggcttcgtgctgggtagctt
-catgctgtaatgatcaatcgcgggcgttcacgcccgattttctttccgccgactaacatccttcacgtccgttgtatagt
-gaccatctctcttgcggttccatctgttctttgcgaggttgtttttgctttgatgaaaaagttcgaatacggtctgtccg
-tggtggcttatgtcggccagatgaagcgaacaagccaggattttagccgccaaagtgctggcggaaaaactggcggcctg
-cgcgaccttgaatccccgggcgctacctctctctatactgggaagggtaagctggagcaagaataacgaagtgcagatga
-ttttttaaaaactacgcgtatctcaccagcaggcactgctggatggcctgaagtctcatcatccatataaacccgcggac
-ttcttggttttctgttacacaggagacacagattactctcatggctcaacgcattttacgctgatctgctctttgcagca
-cttcccgtttttgccggtattcgacgcgcgggacgtttcacaattgtccccgcggatcaagcatttgcttttgatttttc
-agcaaaaccaacatgaccttaatctgactggagtatcaagacggtttactacctctccgtaaacagatcgcattacgccg
-gacacgcgaaaattgcgactgttgcaagcgccgcaagggtctggcatggaaagatgagttttaacggcaaaagcgagatt
-taacgcgatcggctgacgcttccgtcacatcaaccaggcgaagtgcgggagcgacgttaactgtcactaccagggctggg
-tgctgatgcggtttctgtttatccgccagataaccaaaaccgttccgttaagcgaagtggttcgccaacacgcagcgcac
-agcgctgtgtctgttccgcaggaagagcagccaaccgcgcaattgcccttttccggcgcttctgggcgttgttttgatcg
-gtaatggctatcgcctttacgcatgcgtgctggccaatgtcccactgatttctggcagatcgtgtgggtggtaaacaagc
-ggctctccactgcagagcattgttgctgacctttatttatgtgaggggattggcgctgacctacacggcgctgggtctgg
-tggttgccgccgcaggttacagttccagggcggcgcttacagcacccatacgtgcttcattggcctcgccatacgtctta
-ccttgctggcgatgtcaatgtttggcttcgtttaaccctgcaactggccctctcgctgcaacacggtctcacgttgatga
-gcaatgccaaacagggcggctcacctggcggtgtgtttgttatgggggcgattgcggactgatctgttcagcatgcacca
-ccgcacgcttagcgcgatttctgctgtttcgccaaagcggggaacatgtgcgctggggtcggcacgctttattctatgcg
-ttgggctgggcctgccgtctgatgctaattaaacgtctttgtaaccgctttgctgcgcgaaaaaagcggcccgtggatgg
-caacaagtcaaaactgcgtttggtttttgttgatcctcgcactgcgtcttcctgctggagcgagtgattgttgatgtatg
-gggattacgcttgtggtcggcgctgggtggtcgcattccttgctggccttttatcaccagctacaggctaaacgcggact
-ggatgcgtattggtggcaaattattctgctggcagcggcattggttagcgtgcgcccacttttttcaggattgggcattt
-tggtgcgacgcatacgcgccaactcagacgcatctaactttatacacaaatcacggtaagatgagttaaatgcaggcgct
-cgttgagcctaaaggcaaaccggtgatgttagatttttatggccggactggtgcgtcgcctgtaaagagtttgagaaata
-acctcagcgaccgcaggtgcaaaaagcgtttgcagacacggtcttacttcaggcaacgtcacggcaacgacgcaccagat
-gtggcgctgttaagcatcttaatgtcctttgggccctaccgacaaattctctttttgaacgacaaggcaggagcatccac
-aagcacgcgtcacggctttatggatgctgaaacctttcagcgcacatttgcgcgatcgccaaccgtggaacgacacttgc
-aagtgggaaagacggaggaaaataagcggtgcaacgtgaagatggtactgggagaagcactgaaattattagaaattagc
-gggattggccaacacacgctggagatggttgcttgaacgtggtggattatccactggacgagttacgccgctttggccag
-acaagaggcaatctctcgatgcgctgcgttatctagcccaacagattagatgttctggggtcgtagctgatgctggacga
-aacgcaacgcagaacaaaagctgctggcacgtttcaaggcggttatcgagtgcgttaaaaaaaccgctatcgggctgtta
-tttatcgctgcctgtaacgttttatccgatcctggcaccctattcatcaactggcgaatcacaaaaaagcgcggcctacg
-atttcacccacgaaactgtaacgcacactgggaagttgacgattccggcgatgggtagcaaagcagatggaggtggctgg
-aaggctgtttttaagccgaatgctggtgaattcgtagccggcggatgtcgactgatgcacatcggctggcgggaagtatc
-ctgcgcttttcgccacggctgccgcgcagggtggtgcattgaccctgacagaaaacacaaggaaaagaagcgattttgcc
-gcaatctaaagcagttgaatcgctttacttgaattaggttgacgagattgcagattaggtttaatgcgccccgttgcccg
-atagctcagtcggtagagcagggatttgaaaatcccgtgtcctttggttcgattcggtcccggtgcacaattcctataaa
-cggactccagcggaaggtcgttttttcgtttcaggagcacgattagcgttcctgctccaatcaattctaccgaactcaac
-cagattctcccacatcaccacagcattttgcgggcatatccattcgggagaaatttgttcctgagctatacactaactga
-cgtgaaatgtcgtggcggccgtgatgctgtttgaacgtcaaatgacgtcatcaggagcgtaacgccatccataaagccac
-aacacgtctgaaggcgatgatgagatttttctgaatgagaaaaagagaaatgtatcagttcgcttgctcatgcaaagact
-ataacatcattaaaatgtagtgctcggaaattttccatggattattttctgaacatttggcaaagagatatgtatgatgg
-taggatattacttctggttctcagtaaaaattcctttcgtaatactatgtaatcaagaagtttatcgggctggtaaaaaa
-ataacgtccttgcacttcacaataatatgtaaataaacgccatcatactagaaaactaaaaaaaagataaatagatggta
-agaaataggttggttgtggcaattatctcaattgcatcattcccttttttcgaatgagtttctctattatgcaacaaccg
-tgtaagttcgcgtttggcgacagcgaagcgtggcttttgttgaatataacacttaccgtccataaaccaaattagccgca
-atgggcgtaaacttacccttgagcgagataaatcgatcttctggttttcttctttgtgcttcaacacgtggcgaatactt
-agcagggatgaactatcgataatgtcttgggaagagaagtatgtcaccaatcacgttgtggacgggcaaagagtatctca
-gctacggtaaagtatttaaaagataatgatgaagatgtccctgtctcatattcgctactgtccaaagcgcggctataaat
-taatggtgcggtttatctggtacgcgagaaaaaagagggagaggaatattgctatctctttcgcctcccctataccagag
-gcggttcctgcagattctcccctccccagttcttaaacattgcaaaacaccgcaacgccactgaacaatcccagtttaaa
-agcaacgattcactattttggggtaatcggtttttttttcacctgttgtcgttaggttctgtgtagcctggtagcgtttt
-caagtcttgatacacgtcttttcctaatgagcaacatcgcgtatcttgcttcatccacgcaatattggacattaatatgg
-taataaagttggtaacagctggagttccgtatttcaaagctctcttacgcgatcaggcgtgggtgtttggtgtgcgacat
-tcactaaaacaccttctccacctttatgggtgcatgacaaaatcaatcacaacattgtaaccgagcatgttccggtaaaa
-cattatctattgcgttgttatcagcgctaatacgtgctaacatgctttatgtcgataaaattggtagacaatgggcagca
-tggttcattttacatgcttggataaacgttatgtccatcactaacggtaatcagctgcgatttcaaaatgatttactgga
-gagtttatcaaacagcgttaaaacaaccgtggcacaacgcatgcaggaggacgctccagaaaattttgccgcatcgtgtg
-cgttattaactatttttttatcaggcaatgattatttacatgcatggcggatgataaatcattggaaccgtgcaagtgaa
-attattaggtgaagattgttcaatcatccgccagaattttacctacgcggggggaaagcgcagaaaagcatttaaagttg
-atatcgtgcgccattctcaacatcctttagatgaaaaacaattagcagaactgaacacagaaatagataaattgttacac
-tgcggaattgaacaacctgtccattatatatcaaaataaagcggtcgtgctctggtagaaaggtaaaacagctgaagtcc
-ttaccaaggcgataaatactgggcatttggggatcttgaaatgtctggctaaattatgtgttgggctttggcaggttatg
-aatgaaggggatcgaaccgggaagcagcttgatgcagttctccgaccgccttaaatttacgcccagggcaaaacaccctt
-tactggatttgaaaatggtaaatattcagactttttctgttcttctgtttggtcctaatctcgacaaatttctttggctt
-agaataagttaactccgggttgatttatgctcggaaatattctgttgttgagtttttgtatgttctgttggtataatatg
-tttgcggcaatttatttgccgcc
->m141013_011508_sherri_c100709962550000001823135904221533_s1_p0/1357/20228_22051 RQ=0.853
-gcgggcaaataacttggccgcacatattatacaatcaggaactacaaaaactcaacaacaaatatttcggagcataaatc
-aacggagttacttattctgcagcaagaaatttgtcgagataaggtaacataaaggacagaagtctggaatataccatttt
-caatccagtaaagggtgtttgtcctgggcgtaaaattaaaggcgggtgagatatgcatcagctgcttcccggttcatccc
-cttcatttcataaaaccttgccaagcaacacataattagccaggacatttcatagacttcaattgccagtatttatcgcc
-tggtaagactcatctgttttaaaccttttaccagagcactgaccgcttttattttgatatataatggacaggttgttcaa
-ttccggcagtagtaaatgttaatctatttctgtgttcagtgctgctactgtgtttttcatctaaaggctgttgattttaa
-tggcgcacgatatcatactaatgcttttttctgctcttcgcgtaggtaaattctggggatgattgaaacaatctcactaa
-taattcactggcacggttcaatgaattaatcatcggccatgcagtaaataatcatagtgcctgataaaattagttaataa
-cgcaccacgatgcggcaaatttttctggagcgtctctgcattgtttgtgggcaacggttggtttttaacgcttttttgaa
-taaactcccgcagtaaatcatttttgaattcgccagctgatttaccgtagtgatgacataagcgttttatcatgttggtg
-acgcatctgcattgtctaccaattttatcgaacataaagcatttgttgagccacgggtattggcgctgaattaaaacaaa
-gcgcaatagataatgttttcggcgaactgctcggttcatcatgtttgtagtttgattttgtcatgcaccataaaggtggg
-aaggtgtttaagtgatgtcgcagccaaatacccacgcctatcggttaagagagctgatacggggaaagtcttccagctgt
-tacaacttttatttaccatataatagtcaatatcgcgtggaattgagcaaatacgcgatttgctcataggaagacgtgta
-tcaagacttgaaaacgctacagtgctacagcagatactaaagacacaggaaaaaaaccaataccaaaaggtagtgaatgt
-ttgctttaactggggattggtttcaggttggcgttgcggtgttttgatgtagactgttgggaagggagaatctgtggcag
-gaccgcctctggtatagggggaggcgaagatagcattatttcctctccctcttcttcgctgtccagaatacccggcccat
-taatttatagccgcgcttgtagagtaagcggatatagacaggctaaatcttcatcatatcttttaatgacttccgtagtt
-ctgagatactctgcgtcacaacgtgattggtgacaatacctttctttccagacattatcgataagttcatcctgctaaga
-tcgtcgccactgtgttgagcaagaaaaaccagaagattcgattaatctggcttcaagggtaagtttgacgcccattgcgt
-gctatttggtttttatggacggcgtaacaggcaattcgccaacgcgaactacaggttgtttgccatatagaatcattcga
-aaagggaatgatgcaattgataattgcccacaacctatttttttaccatttagatggggttttatttttatcatgagcga
-aaatatttttaatttgggggggggtttggatgcaaggacggttattttttttaccagccaaaa
->m141013_011508_sherri_c100709962550000001823135904221533_s1_p0/1375/0_18353 RQ=0.832
-cccacaaaagggggaaaccggccgagggataaatccggccccgctttttttttttaattgccctgaatggccgaaacggc
-cagcttcggtggcctttaccagcggtggaaatccctgctaatcctcatcgagcgaaaggaaatggaaccccttgggaaaa
-aattaatttcatgaagttaaagtttttcccatttcctggctgcgaacgcgcttttcaagcgtcgcttccagtttcgcgtt
-tctttgccagcaagaattcccattaattttcggccgccgagtttcttccagagcatttcagatatgccaaccagtgcaaa
-tctggctgtttaccagcggatttttttcctttcatcgctaataatgcatgctccgtcaataacggcgcaagaattcgcag
-ctcttcggaaacatttattgccagttttttgcctgagggccgatttttttcaatagcttgtaactctgaggatttgcgaa
-ttgaagtatttttttcaccggaagtagggagatgccggtgagccttctgaggcatcgggtggtacattcgcataagcgat
-acgttcggcgttgacattacgcaaatttttttcgattttttgatagcttgcaagcgcatggcgacatcgtactgccaaac
-tggtgtttcgaacccatttcgttcgccgttggccatgagcggccagcggttaatgagtttcaggcggggagagatgggca
-aaaaaatggtctgtttctagtgaccttagttatgatgcatcatcaggtcattgtgggggataacgctgcggatgcatctc
-ccggagtgaaattaagattaacagctgaattgaatacagaaggaaacggcgacatttgggctcaaagaacgctgatatat
-cgacacgcggtagcgtgacatgcggaagtgatcggccacggaagtttgaatgcgtcttgcacaacagaacttttttcctg
-caacaggaaatccaacaccatttttctgatcgtcgtgaatgttaaagcgttttggcgtcgattttcgggaacattacagc
-gcaccagaggtttcacgcaggaaaagacggaatatcgttgatcagttccagcgcggttacgctgctcaataaagaacgcc
-aggggtaataaattcactgatgtctgataaacgcactaggcgtcctgaatggcggttgcgcaggaacgttagcaccgcag
-gcgacattgaagccagatttccagacttcggatgtagccttgggcgtgtttttttcggcccgttcaacaccatccaccct
-gacggaagcctgcaacgaggtacgttttcgacagtccgttaagtaatggtcgcaggtcagggtcagggcgcattgagtga
-ttgctcagcgtcgtccgtagagaattttgtcataaatttcaatcgggcgaagattatgagattatgctgaggtgcaatct
-ccacactccattaaaaagctctttggaatatacgcgccgttgggtttttgggttgattaataagatcccgctagaggcgt
-aatttttagcggcgaatatatcgaggtccgggaccagtcagaggattgcatcgaaagataatgcacgctttccgctggaa
-agcgaaacgccgcgtccagagtgggtaatctggtgcgaaccaacattttcgtccgtgttccggcaatgctgcaattgcct
-gacgataagctccgatcacattggcgatgtaaatatcttccaacggtaagatcacgcatgcacgagcctggtaggtggct
-gcatgatggctttagcgggagtacagacctttggaatgcatacttggagacggtaggaggttgcggtatcagtaagggat
-ttctctggcgttaaaatcggaacgggctgggttgccgagttcagtttcagtattgtacttcttcttcccaggcgttttgc
-ttctttcagaggaccacggatgtcataaagacaattctctatttgctggatttttcaatgggggacatgaatcttgacct
-tttttgctgttatcgcactcctgcagtggaatcctcagcttagaaaatgtactccccaggacggtgttccttgaaaggtc
-tgcagaatagattttgcagaggggaggctcgatttgtgctgtataattaataatgacaaataatgaggtgtatatgcttt
-atctgcaatgtttatatagtgaatgtttctgacttttaattgtaagttggtttttttttatctgttaagataattgtgtg
-aaatgcctcatttaaagaattactatgaacgcgatgatgatatttcctcattacgagagtttaatgcgtgatgatttccg
-aggtgtgaatggggaaaggtgtgaaactatttgttagcggaattaatgaatgatgatgatgctaattatattatttttaa
-tattcaaaaggtttgatgtgcttattaatctagaagattaactttgcctaaatacataactttgctataataattccgat
-gacccttataattaaaggttttggggtaaaagtgctcgataatgacgatcactgctcttgatggcctcacattgctgttg
-gtacgtgttcggtatgaccaggcgatgctgcgagagtgaacaaggaccctttacatttatcaaaaggcgcatgtcataat
-acgaaaagagtgagtacttaatagatatgcgattccctgaagagtatattctgtgatctacttcggcattatagaggaac
-aatgtgaggtcgccttttttttagtgcaactcatatgcatttttatttgtccggggttcggatgaatgcagggggcacat
-tacaaatggaatgcttgtttgtgtgtgccaagcattaccagctcagtatgagcgccagtaagtataatataatgataagt
-gaaatttctccgataattaacctcgactcgattgctgagataatttctgttgcctggttgccgatctgaactttgctgcc
-gcagctgccgctgtgtgtgtactcagtgtcgcgtaagtcagcaaatgcagcgtcctggaacaatgtttagaactgttgct
-cggtcacggtcgcacaaactgtttaactggaaatggccattcacttcttggtttatgcaggaaatctgcgttttaatgaa
-tgaggctgctccatcattaatgttcagtaatttcaggggtattactatcggtgcttcagatgaattgccgatcgatctta
-cctttcctgttaaaatgcggtgagttggtttatcgaaattagcgctggtgtccgagttaacgtaatgcctatacttggca
-gaaatgctggaatcccaggaagtgggatttgatggtaactcacccatcgtcctttcaagcgtttaaggcattgaatgcgt
-acctgcacacaattggtactgcgcagggaatacatattgcaaaaaggcgagcgagtcctttgtattgctggatgatcagc
-cgtttcgcgatatggtgctgggcgacgcttataaagcagatattcatggcgctggcttatgtgcctggagcttcggcgtt
-cgtgcggcagtgaaagaggtttggcgtgacggcaaggccggttgatgatgatgagccggacctgcgtgtgctgatgggag
-tagatggattacggtacctgatacgaatattttgcgtgctatgatcgtccagtaatatgagctggcccggtgattatcag
-gcgatggagagtaccataatagtggcaatacagccaatgtctgttcggaaggggatgattcattgttgattgaaagggaa
-tatagagtaatcgaggaatagataaattctgagcaatagtgtaacaacgagccgcttggggggtgttttaacccagcggc
-tttttttttagtaaaatcccttctcgatagtgcagaacgtaacaaaactgtttcatttttttcacccagagtacgtcgaa
-ggccaaataatgctgaaaaaatcaccttgctaaatgatgttaaaaatacgtaaatttgttgctgcgttttttgtatggaa
-tgacaaaagcgtgtacagaataagaaaatactctctttttggggggaggaatgacacaaattccctgtcaaaatagacct
-gtatttatttcattgcttacacggacacgattcaacaacattattatcctggagtcgtcaggattggggtgaaagggatt
-aaatgctaatggtgttgatatttgtaaactaatgtgaagaaacttttgttaaagttgcaaaggttatagaaaggagtaaa
-aaacaatcaattagctgtataaaagaatttcctacagtgattgtaaaggttttttttatctcccatgaatgatgtgggtc
-atcgccgtgaagagcagtgaatctggcggctacttttgatgagtaagcatgaagtatgttcaacatccatgaagtcatcg
-ctcatcatggattcgtatctttcttatcgttgcattgctgtgttgtgatgctggtagggcggttggtttttaggcggtcg
-cgcacaggcgaggttgaaaaacgttgccgtttgaatgcggtatcgactgtcggctcgcgttacgctgtcgccagttttat
-ctggtggacatgtttcgttatttcgacgttgatgcgctgtatcgtgttcgctatggtcactatatcgcgaaagcgggctg
-gtaggtttgtggaagctgcatttttatttttgtgttactggcaaggtctggtttatctggtgcgtattggcggctggatg
-gagcctcgcggttagcgcgagcgtatgaaccggaacgaacagttcgctaatcgtaacgtaccgcgaggcattaagatgat
-tatacgcctcacggacgatagatcaaggtgagacgacgttacactgcaaaagcaggagatcgtaaccgaccttctggagc
-aagaaggttaacaaaaacggtgtttatgggcaagcaatgtggttactggggtcgtaaaaataatttgggcgtaaattcgg
-ttttcctgctgttaacgttgaagatggtgattgtttttaccgagcggtgcatgaacgtggcgcgtttggcgcagaagtat
-tgcgttgcttcgcgcgtcaaggctgacctgatggttggttgcagggaacctgcttaccaaaaatggttcaccggtttatt
-cagcgtctgtataacgaagatgctggaacaaatgggttatctcatgggtgcctgtggccaactctggtgggttatgtacg
-atattattccgttgtgcagggcgtcgataaaattcatcccgttgatgtttatccgcgggctgccgccgcgtcctgaagcg
-tacatgcaggctgatgctgttgcaggaatcttatcggccagaagtcgtccgctctcctgggtggttggagatcagggtta
-tattacgcgccatatgcaatcagagcgcgaacgcaagcgcgtgaacgcattgcgtactaacttgcttcactgacgagatt
-tatttgcgcctgtcgcaaagggatttttcttcgcttattctaaattatttcgcgaagctttactgcgccgacattcacag
-gacaatttgcaattggtgaacattgacgacttaaccgcgcagaacccgcctgcagaccgcgatcatttgatgatcggtga
-ttggcgaactgcgcaacgttttggccggatgcctttatgttcagggcattcgcacggggttcgttgtgtggataagcgtg
-actatactggaagttggcgattcttaaagaaactgccgaaacttacgtatgctgtttgaattacacgcatgggacgacgt
-ctgcgcacaaccgcgaagggttactgcgggattttttccgtttttctacatctgatttctagtgttgtaacggcgacatc
-atgtggaaggtgcgctggcagaaaacgacctgacgtacgacacttcagccaatgttccgaagctaactggtatgagcgtg
-aacctgggaattggtttgcattacttttgccggtcacccgaactgcgacgccatcatgatgccgcaaacctggaaggtaa
-cccgctggcgtaagattatcgggcgcgctagaatttgcgtttgagtggacaaagcgcaaacggtctggagatgaagcctg
-attcaaaccggaaagtgggggatgaagggcgcaccgaaaacgaggattcatgtcctcaactcggtcgaacacccgtcggc
-gcggggcttttcgtatcgttttgcaactctcgatggcgaagagattgtcgactgcgaccagaaatcggttaccacaccgt
-gatgcggagaactggcgaacgagttctggaagctcattcgtatactgaccgtatgaatctcggcgctgcgttcacggaaa
-tgctacgtgctggcgggagagaaatggcgggacacgtgcggatcgcgttaacgtcattcgcgtttatgctttacgaactg
-ttccgcattcacagtcctgatgtaatattcgactttattcaggagtggcgcaatggcagtgtttttcgcctttaccgatc
-gtcagaaaattacgatctggtggaagaaatcactggtttcccgttgcaccgggtggttccgtattggggcccggggggta
-aaaaaggcgcacgacctgcgcggtggggatgctgctgcggtgagttctcgatggatgcgaacgtctggcggtcttaacga
-gaaagcggctgcaaaacaccttctgaaaggtgtttcgggcgttgccgctatgcgcgaaagagggctggagtggggcacca
-tgcgcgggcctgcgtgctacgggatcgacttggacgttgcgtaagcgcgtcccttattctggctatgaaaaattcgactt
-ttgaaatcggtgggtggtggctttctggactgctaaacccgcggtaatgcttaaaggtggaagagctgcgcagagtctgc
-gcattcttgagcagtgcctcacaacatgctgtgggaaaaaaaaaaaaaggccgttcaatagggaataccgtgaacagcgg
-gcgcgaaagagcgcacgctgcaacatatcgaacctgatcaccttcctgcaagttgtcgtgggtggttgatgctgccaatg
-atttccagatgattgagggcgacaaagggtcaacagttactactgatccagcgacggcagcactgagttaccgcacgtgt
-tcgtaccgagcttgtgcgcatttgcagcaaattcggcgggcgaatccgggagcctggtgtctgacctgaattgttttatc
-tgggcagtatcgtttgtttatgtcagatgtggacggctaattatgccgagaatcaacaacacaaaaccgaggcttttgag
-ctgagtgcgcagagcgtgagcgatcgagcacgagaatgcaccactcgaagacccgcggggcggcgtcattgaaggcgctg
-aaatcgttcagaagcaggtggctggtgtgccggatggtgcggatccttaatttcgatcgccgatggtgctgtattcgcaa
-gcgcgtgaaggtgtggaatcgtctaacagtcgatcttcgagccgttggtcgcatgtgatctcgttattgtgaagcgtggt
-tctgtctatcaggttatcagggtatttcagcggggctcggataaaaagctgaagcatcaaccagggcaaacgaatttgct
-ggccagctttacgctgtgcaattgctgcctggggaactgtgataaagggccaaacatgatgatcgatgaggaactcatcg
-cgcatctgacccggaagcggatactgaactgctggagggtataactgaaaaacattatgtatcccaacgcatcgctgact
-ggcgtctggcgcgatgacaaacagccagtgtggctggacgaatacgccgcaaaaacggttacgaaaggcgcgcgtaaggc
-gctgacgggctgtctccggacgaaatgtttaattcagggtaaagacgctgtctgaaagggggcggcggcggcgggcttct
-cgactgctgaaatggagctgatgcgaaagagaatcatgaacatcgttacctctgtgtaaatgcgatgaaaatggagcggg
-caccttataaagaaccgctgttgaatggagcaaatgcgcactgctggtggaaggtaagctcatctgcgtttttgcgctga
-aagcttacgtgcttacattctgcgtggcgatatatgagcggcagttaatctgcgccgtgcattgcggagccaccgaagcg
-gggtctgcttggcaaaacattatgggaacaggtttcgattttcgaactggttcgtcctaccggggcagggcctacatctg
-cggggagaaacagcgttaatcaactccctggaaggcgtcgtggctaccccacgctcgaagcagctttccgcactcggcgc
-atggggtaacgacctgtgtcaacaacgtcgaaaccctgttgtaccgttctggcgatctcgctaggcgtggatgtaatcag
-aacattcgaaaagtaagatgctggcaccaagctgatggttctcggtcgggtgaaaaatcgggactgtgggaactgccgtt
-cggcccactgcgacggcgagatctgaagattacgccggtggtatgcgtgatggtctgaaatttaaagcctggcagcaggc
-ggcgggggactgaaattcctgaccgaagcgacttgatctgccgatggaattccgaagtatcggtaagcgggcagccgtct
-gggtacggcggcttgggatggcgttgaacatgagatcaacatggtgtcgctgggtgcgtaacctggaagagttttcgccc
-gtgaagttcctgcggctggtgtacgccgtgcgcgacggtctgccgtggagcgtgaaaattctgcgtgcgctggagcgtgg
-tgaaggtcagccgggcgataatcgaaacacttgagcactgtgtcgattccttaggcccgggtaaaactttctgtgcccag
-cacctggtgcggtggagccgttaacagagagcgccatcaaatatttccgcgaagaatttgaggcgggaattaacagccgt
-tcagcaataccatttgattaatgggattcagccgaactgctgaaagagcgctggtaaccgaattcgattaacgctcagtc
-tctggactgagaaactggaagcatgcaatggctacaattcatgttagacggcaagaatacgagtcaacggagcggacaaa
-cctgctgaagcttgtctgttctggcttgatattccttactttgctggcatccggcgctgggaattcggtgctttgccgcc
-agtgtgcggtgaagcaataccaaaacgcggaagaagcgtggtcgcctggtgatgtctggtcatgaaacggcttcgatgca
-tcctttaatttccatttgacgaacgagaagcggaaacagttccgtgaagcgtggtcgagtggtttgatgacaacaccgac
-gaactgtcgtaatgtgaagagggaggtaaactgcatcttcaggattgatgtgaatgacggacacgctttcgtcgtaaaac
-gtttcaaccaaacgtaccacgaatcaggatttggggccattcatctctcacgaaatgaagctgcatcgctgctcgctgtg
-tgcgttataaaagattacctgagccggtacagatctgggcgttttaacggtgcttcacgaaacgttacttcggtgccgaa
-gaggcagctgaaaggcgattttccgtaatggtcgaaaattgccgacaggcgtaatttccgacaaaacgcactccgaggcg
-ttacaacggtaaatgggatatgcagtttgcggccgagcatctgtcccagcaatgtttcatcggctgtaacatcagccccc
-ggtgaacgttaacggcgaactggtcgtatcgaaaaccgattacaacggtacggtcaacatacttctctgcgaccgtgtcg
-tttggtacggttacgtcaacctgaaggatcgtccgcgtcagccagtacagcgtcgtgggatgatttttctagccctcacg
-ccgaacaggcaatggcaggggcggcaagatattctgcgtcagtcgaagaaagtgatcggtattgggttctccggtgcagc
-gtggaaagcaactttgcgctgcgtgaatggtgggcgaagaaaattctacacggtatcgctcacggttgagcaggaacgtg
-aactttgcgcttgaaagtgctgcgtgaaggcggcattatactggctctgcgcgaaatgaatctttacgactgcggtactg
-tgctgggggcgaagacgttaccagacggcgcgcgcgtgtcgcgctggagtgcgtcaggctggaaagtaaagcgcgcgaaa
-atggcggagcacagaagtggcgactggtcagattgcggcaatcctcaacatcggtcaagtgcgaaagcaatccgctgttt
-gttaccaacgttgtttatgacaccgtctggatgatatcggcggcgtgggacttaccggcaaccggttgaagatcaggcgc
-gtttaggttttgcatcggccatagcgctggataatctgcaacgcagcggttgacggtatgaaacctgagctgcaaagcaa
-tgacgtcatcgtgcaggcatggcaggtgcgaagaaccgttgattatctccgggacgaagcggtagcttaagaggtgattc
-aggcggcgtaagtcgcgaaagcctgaaggtcgcgggccgctgacgtcgtatcaccaatgattgcccgttcgtcacagcat
-ggggctgggcattatgggtgggcggttcgcttgaagaagcgttaaacgaactggaaacgcgacgcgcgagcggtggtggt
-gttgggaaaagatatgcatcgtcaggctttctgctatcgcgcggtgaatgctgcgtggctaaggcatcgctggtgatggt
-ggttgatatcagacagcgaattatggaaaaacgccattggtacttttctgctgccagctttgctgaaagcgacggtaggg
-gtggatcagacaacgaaggccggccaagtttttccagtttacgatcctgcttatacgacagaaaactggtccatgctgga
-aagtggcgcctgggttaactcgctgcacagtacctgctgagccgtgaagtggacttggacgcagctcgaccatgtgattg
-acctgttgtgggaaaatccggaactggcaggtatcaaagatgctgcgccggatgccgaattcgtattcgtgggcagaaac
-tggacgtggaaccgacgttacagcggtcgtacgcatgcgcgccaataatcaagcgtttcatgagcggtcaccgaggatat
-tgacacatgttcgttttctcgatggaagtaacaaccagccgactgcgcaccgttcgcagtggcgttgcctgggcgccggg
-gggcccccccttgggaaaaaacttttcccccgaggcgtggcacaaattccaggacaagtgggcggcatgcagcttttggg
-atccgggccgtgcgtctgtttgaaaccagcgaaaatggtctggattaattaccagcggtaccggccgcttccgcgaggag
-ggaaatggcgtatcggccgtattacactgttttggcagcgagaattttcaagcgtgtccggtcttccagagccgtatgcc
-gcagccgtacatcaaactcacagcggatgccgcgaagttgggtgtgaagcaggtacaagggtctcctttagttacgatgg
-caacacggtcagctcggttgaaatcgcgaggactgacgggcagggcaggtgggcttgcgatggtatgtcggcattgctcc
-ggtgtgtgggcgcatttgaggatctcaaaagggggggaggggggggggcaaaaaaacaacatgagttggaaatatcacgg
-aaactgattgagatctgctgaccatcctcaaacggtggtgatcctgctgggttgtccactgcgggggcaattcatgagct
-ttgggcgacgtggctgctggggttgttccagaaccgtttacggactatcagtgttggctggggcggttcgctctcgctgg
-ttgcggacatgatcaaaatgttctttaaagaagactggatccgaaattctcgggatcgcgtatctttaaccctggcagcg
-atgattgctttacctgctgctgctggctttatggcgattgtgcagtcaagtccgggttgggtggttgcgacctgaaacat
-cgggattttgtttcttcctggatgaatgcaggtccttggcggttttacgcggtgctgttttggcggcttggtcagtaaca
-acaaatatcgttgcctgtgcgatgcgtgcttctgcgcagaccctgagctacgagtgttcctcgggctttcttgatgggcg