annotate glimmer_long_orfs.xml @ 1:b7b320f4c595 draft default tip

planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit a4b0969b33a68a0ea9ba12291f6694aec24f13ed
author iuc
date Tue, 30 Oct 2018 18:51:01 -0400
parents a4136c1534be
children
Ignore whitespace changes - Everywhere: Within whitespace: At end of lines:
rev   line source
0
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
1 <tool id="glimmer_long_orfs" name="Glimmer long ORFs" version="@WRAPPER_VERSION@">
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
2 <description>identify long, non-overlapping ORFs</description>
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
3 <macros>
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
4 <import>macros.xml</import>
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
5 </macros>
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
6 <expand macro="requirements"/>
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
7 <command><![CDATA[
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
8 long-orfs
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
9 -n -t
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
10 $cutoff
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
11 '$inputfile'
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
12 '$output'
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
13 2>&1
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
14 ]]></command>
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
15 <inputs>
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
16 <param name="inputfile" type="data" format="fasta" label="Genome Sequence" help="Dataset missing? See TIP below"/>
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
17 <param name='cutoff' type='float' label='cutoff' value='1.5'/>
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
18 </inputs>
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
19 <outputs>
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
20 <data format="tabular" name="output" />
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
21 </outputs>
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
22 <tests>
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
23 <test>
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
24 <param name="inputfile" value='streptomyces_Tu6071_genomic.fasta'/>
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
25 <param name='cutoff' value='1.5'/>
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
26 <output name="output" file='longORFSTestOutput.dat'/>
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
27 </test>
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
28 </tests>
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
29 <help><![CDATA[
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
30
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
31 **What it does**
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
32
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
33 This program identifies long, non-overlapping open reading frames (orfs) in a DNA sequence file.
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
34 These orfs are very likely to contain genes, and can be used as a set of training sequences
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
35 More specifically, among all orfs longer than a minimum length , those that do not overlap any others are output. The start codon used for
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
36 each orf is the first possible one. The program, by default, automatically determines the
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
37 value that maximizes the number of orfs that are output. With the -t option, the initial
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
38 set of candidate orfs also can be filtered using entropy distance, which generally produces
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
39 a larger, more accurate training set, particularly for high-GC-content genomes.
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
40
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
41
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
42
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
43 -----
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
44
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
45 **Glimmer Overview**
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
46
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
47 ::
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
48
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
49 ************** ************** ************** **************
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
50 * * * * * * * *
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
51 * long-orfs * ===> * Extract * ===> * build-icm * ===> * glimmer3 *
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
52 * * * * * * * *
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
53 ************** ************** ************** **************
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
54
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
55 -----
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
56
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
57 **Example**
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
58
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
59
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
60 * input::
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
61
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
62 -Genome Sequence
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
63
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
64 CELF22B7 C.aenorhabditis elegans (Bristol N2) cosmid F22B7
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
65 GATCCTTGTAGATTTTGAATTTGAAGTTTTTTCTCATTCCAAAACTCTGT
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
66 GATCTGAAATAAAATGTCTCAAAAAAATAGAAGAAAACATTGCTTTATAT
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
67 TTATCAGTTATGGTTTTCAAAATTTTCTGACATACCGTTTTGCTTCTTTT
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
68 TTTCTCATCTTCTTCAAATATCAATTGTGATAATCTGACTCCTAACAATC
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
69 GAATTTCTTTTCCTTTTTCTTTTTCCAACAACTCCAGTGAGAACTTTTGA
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
70 ATATCTTCAAGTGACTTCACCACATCAGAAGGTGTCAACGATCTTGTGAG
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
71 AACATCGAATGAAGATAATTTTAATTTTAGAGTTACAGTTTTTCCTCCGA
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
72 CAATTCCTGATTTACGAACATCTTCTTCAAGCATTCTACAGATTTCTTGA
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
73 TGCTCTTCTAGGAGGATGTTGAAATCCGAAGTTGGAGAAAAAGTTCTCTC
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
74 AACTGAAATGCTTTTTCTTCGTGGATCCGATTCAGATGGACGACCTGGCA
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
75 GTCCGAGAGCCGTTCGAAGGAAAGATTCTTGTGAGAGAGGCGTGAAACAC
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
76 AAAGGGTATAGGTTCTTCTTCAGATTCATATCACCAACAGTTTGAATATC
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
77 CATTGCTTTCAGTTGAGCTTCGCATACACGACCAATTCCTCCAACCTAAA
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
78 AAATTATCTAGGTAAAACTAGAAGGTTATGCTTTAATAGTCTCACCTTAC
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
79 GAATCGGTAAATCCTTCAAAAACTCCATAATCGCGTTTTTATCATTTTCT
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
80 .....
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
81
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
82 - Cutoff 1.5
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
83
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
84 * output::
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
85
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
86 Sequence file = /home/mohammed/galaxy-central/database/files/000/dataset_34.dat
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
87 Excluded regions file = none
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
88 Circular genome = true
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
89 Initial minimum gene length = 90 bp
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
90 Determine optimal min gene length to maximize number of genes
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
91 Maximum overlap bases = 30
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
92 Start codons = atg,gtg,ttg
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
93 Stop codons = taa,tag,tga
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
94 Sequence length = 40222
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
95 Final minimum gene length = 97
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
96
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
97 Putative Genes:
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
98 00001 40137 52 +2 0.892
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
99 00002 1319 1095 -3 0.654
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
100 00003 1555 1391 -2 0.793
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
101 00004 1953 2066 +3 1.078
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
102 00005 2045 2146 +2 0.919
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
103 00006 4463 4759 +2 0.985
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
104 00007 6785 6582 -3 1.033
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
105 00008 6862 7020 +1 0.915
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
106 00009 7300 7488 +1 0.900
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
107 00010 7463 7570 +2 0.912
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
108 00011 8399 8527 +2 1.044
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
109 00012 10652 10545 -3 0.895
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
110 00013 12170 12066 -3 1.108
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
111 00014 13891 13748 -2 0.998
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
112 00015 14157 14044 -1 1.026
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
113 00016 15285 15410 +3 0.928
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
114 00017 15829 15704 -2 0.949
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
115
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
116 ....
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
117 ]]></help>
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
118 <expand macro="citation" />
a4136c1534be planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/glimmer commit 37388949e348d221170659bbee547bf4ac67ef1a
bgruening
parents:
diff changeset
119 </tool>