annotate test-data/E.coli_contigs.fasta @ 0:d0a712cf0518 draft default tip

planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
author bgruening
date Thu, 27 Sep 2018 15:27:40 -0400
parents
children
Ignore whitespace changes - Everywhere: Within whitespace: At end of lines:
rev   line source
0
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
1 >contig_1
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
2 AAGAAACATAAACAGAACGTCAGTAATCCAGCAAACTGACGGTTACGAAATAGGCGCGGC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
3 GACAATAATCTCGTTCTTTCACCACCTCCGGCGTCAGATTCGGATTCACAGCACATCGGG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
4 ACCAACGCGTTGGTGCAAACGGATGCGTGGTCCAGTTGTTCCGGGAGTCAACATCTCTAC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
5 AGGCTTGAGGACCGCAAATCTCATGGAGCCCCAGTATCGCAGTTTTGTTGCACTATCCCG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
6 CGTGTTTCAGGCGAGTGTTCTACCTCGAGTAGCCCGTTACAGAAGTCAAATGCGGCTCTA
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
7 GCACGAGTCGTAAAGAGGTGGCACCCCGCTAGGAGGGGCTAAGCATTGGCTCAGGAAACT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
8 GCTGTATTAAAGAATTCGGTTGTACGGTTCCGCAAGTGAGGTCGGCCTCTAGGTCAAAAG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
9 CGTCCAGTAAAGCTAATATTGTCACCGATAAGGTTGATTAACTGCTCGAAGGAAATTTAA
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
10 AACCATTGAGGAGGATAAGAGCGATATCGCAGTGGACCCAATTAGTGGTTCATTCTATTG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
11 CCAGCGACCCATGTATATTCGGAACGTGAGGGTGAAACGTGCCTCCATGTAGAGCTTCAG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
12 AGCAGGCATTAGATGCTGGTACAGCCTTTTCGTCGTCATTAATCGGGGTAAGTTACTTAA
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
13 TGCGACAACAGGATGCGCTTTTCGGGGCAAAATTGAAGAGCGTAGTCATGCGGGCGAACG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
14 CCAGTGCGTGCTCGCCAGTAGCGTCGCACTGCATTAAGAAGCCGTTTGCGCCAGCCGTTA
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
15 AAGAGCGTTTCTGGTTCTACGGTGATAATATGATTTCTGGTGATCCGTGTTGCACCGGAC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
16 CCATAGTTCCAGCACTTTCTTCAGTTCTAGTGATAGCGCGCCTGATATGGCTTTCGGAGA
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
17 TACACCCCAACCCAACGCTTTCATGATAACCGCGATCGGGTGGGAGCCGTTAGACACCAC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
18 CCGTTATCATAGGCCACTGGTCAGTTAATTAAATGCAGAGTGCCCCGGCAAACATTTCCT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
19 CGCCCCGATAATCGCTCCTGGGAAGAATCATGCTTCCCTGGATGTACGAACGAGAATTGA
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
20 CCCGCGGCGCCCGCATGGGAGATCGTGCGATTCGTCTGCCAGTTGTGCTTCTTTCGCCGC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
21 CTGGTTGTACAACATGCCGTGCGGTTTGACATGACGCATTACGCGCTATCCAGCGCACGG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
22 GAAATTCCTTCAGGCGCCACCAATTTTAGATACAGCGTCTGGGCGTAAACGGGGTTTCTG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
23 GCGGCATCCAGCTGACGCGCTGCGAAATAAAATTTTCCCCTGTCGGGAAAACTCGGGTGA
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
24 GCGCCAATCGCGACACCATTTTATTGCTTCCACGCACGCAGCCTGCATGATTTGCGCATC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
25 GCCTGCATGAAATCCACAGGCAATATTGTGCAGAGGAAACCAGCGTTAATAGCTCTGCGT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
26 TGCTGGCGCATCGCTTCGCCCAAGTTCGGCGTTCAGGTCAATTTTCATTGTGCAGCCGCC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
27 ACGCTAATTGTTCAAAAGTAACTGTTGCTGATTTGCCGTGCTTTTTAGTGCCTCTTCCAG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
28 TGAACACTGGACAAAATGAATCGGCTGACCGAGCGGCGAATTTGCGCCAGATGGTACATA
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
29 TCAGCCTCTCAATGATACAGGCAATACGCGGGTAACCACCGGTGGTCTTGCCGTCGTTCA
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
30 TCAACACAATACTGCTGCCCGTCCTCTTGGCACCTGCACCACGCCCGGTGACAAACCGTG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
31 AGATAACAGTTCGCGATCGGTGGTGCGTTTTAAATGTCCCCTGTAAGCGATAGCCATGCG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
32 GTTATTTGCGAGCCGGCTGCCAGGCGAACGCCAGAATGCATATCCTGCGAGGCGCGATTG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
33 AACTCATGATATTCCGAGTGGCGGCAAGGCGCGAATTGCGGTTGCCCCACAGCAGCTGTT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
34 TAACGCCCTGCGCTTCCATAGAATTGGTACGCTTCGATTTGCCAATCGGGAGTCGGTCAC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
35 CATCCTTCAGTAAACGGCCTTCCCAGCCCGCCAATCCCCATTTGCAATCACTGCGCGGTG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
36 CTGCATGAGCCCATTACCGGCGGAACATCAATACCACCCGCGACCGCCAGATAACTGCGC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
37 ATGTAGCGTCTTCGTGGAGGCATCCGTCAGCGTTAAACGCTGGCCTGCTGTTTTCATCGG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
38 CAATCGCCAGCCGGTCCAGACGCATTATCATCCAGCCGCGCTGTCGCAACCGGCACCCGT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
39 CAGAGCCGAAACCACCCATCAGTTTCGAACCTAACAGTTAACTGACCGAGCGCTGATCTC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
40 CATAGCGGGGGCATTGGCGTCATTACCACCAGTATAAGTGCAATGCGTAACGCGGGCATA
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
41 TCAGTGCGCCGCAGTGGCTGATATCCGACTGGCGAAACCGTGACGACCGCCATCCTGCAC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
42 GCGCGTATACATGCCCGCACGAATAATCTTCAGCATACTCCCTCCTTCTGCGTACAAAGC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
43 CGCGGAACCTGTCTCCAGGGACGGTGTAATACAAGATGGGTTCGTCACGCGCGCCGGATT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
44 AATAAGGACGATGAGTGAGGTATGACCAATCAACTGCCAGCCACCCGGCGTTGCCATAGG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
45 GATAAACACCAGTGCGGCCCGCCGATCCCGACAGAACCTGCCGCTGAAAGCCACCGCGGT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
46 TCAGCGCCGTGGCGTGTGTAGTTGTTCCGGCAAACTCCCGAGATACGGGAAGCCCGGTTT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
47 GAAAACCTAAAAACCAGACCACGTATTCCACGCATAGAGTTATGCAATTCAACAACCTGT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
48 TCGCTCAACCCGCAATGCGCCGCGACCACCGCCAAATCCGGTCCGCCTGCCACCGTAAAC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
49 CAAGGGGATTTCAATCAAAGCGAGACTCGTGGGTGCCAGCGCCTCGCTCCTCTCCACCAG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
50 CGTTGCAAACGCTCTATGGCATCCAGCGCCAGCGACTCAGGATTACGCAAAATCACCGTG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
51 ATATTTGTTCCACCTGCCGGGAAACCTGTTCAACCACATTCGGCAATATATCCACCAGAC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
52 ACCCTGCGCCAGTCGCCAGGATCCCGGTTTCTGGCTAGCCAGTTCACCGGCGGTTCTCAG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
53 TTCCAGCACTACCGCCGTTTCCACCTATCAGATAACAACGCGCTCGTTGCACTTTCACGT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
54 GTGGGACTATTATTCGTTATGCAGGATTAGGAATATCAATACAAAGGTCACATCAAGATT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
55 TCGTATTTTCACTTCAGCCACTCGCTCAATGCGCGAATACCACCACGTTCAGAGTGGCAG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
56 ATGGTGACCTGCAGCATAAAATGCAATCCCTGCTCGCGGGCCTGAATGAATGGTCTTTCA
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
57 GAAAACTTCGCCAGGACCAACAGGCATCCACGCCAAACGCGGCGGCTATCGATAAAACTT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
58 GCCCGCCGCCCGTGCACCAGGCGACGCGCTGGACCACCTCAGTCCGGTATCGCCACACCA
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
59 TAACGGCTTACGTCCCAGACGCTTTCAATCCAGGAAGCCAGCTGGGCAGTCCCGGCACAG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
60 GCAATTGAGTTTCGCCCCACGGCACCAACGGCTCATTTCGCCCATGACCGTGATCCCCCA
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
61 ATGCGCCGCCAGCTGTGCCATGTTATTGCCCAGCTCAGGATGTGCGTCAAGCGGCAAATG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
62 CCAGCCATATAAGGTTGATATCAGGTTTCGCCAGCAACGTTTTTAAACGGTTACGCTTCA
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
63 TTCCGCGAATGACCGGAGACTCTCTCCTTCCAGAAGTAGCCATGATGCACATGACCGCAT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
64 CCGCGCCCAGACGCACTGCCTCATCGAGCAAAGCCTGGGTGCGTGGTGACACCGGTAACA
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
65 CAATTTTGCACCGTCTCTTTGCCTTCCCACTGCAAACCATTCGGCGTGGTAATCACTAAT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
66 CGCCGCGCTGTTCAGCTTTTCGTTAATCAGTTGTTCCAGTTCGGTGTTTTTCATCTTCGC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
67 GCCTTCCGTATTCTGATAGCTACACGTTAACATAGCGTTACCTCGCCAGGTTCGTCGATA
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
68 TTAATCTTTTTGACGACTTAAGAAACAAACCCGCAAAGCCCCAAAGACGCAAATTGTTTA
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
69 TATCATCACAGCGCTTCAGGATCTCATATTTATGCAAATCAGACAGCATTGCATAAATAA
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
70 GAGAGTCAATGTATCAAAGTTTTAACTTTAAGGAAACACAAGCACGCCGCGCAACTATTG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
71 ACAGCTGACGTTGCGTCAATTGTGGAATTATTATGAATAAACACGCATCTAAGCCGCGCG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
72 CTATTTACTGTCGTTGCGCTGCAAATCTGGGAATATTTGTGCTTTTACGGCATGCGTGCC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
73 CTGCTGATTCTCTATCTGACTCACCAATCAAAACTAAAATACAACGATACTCACGCCTAC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
74 GAGTTATTTAGCGCCTACTGTTCGCTGGTGGTTGTACGCCAATCCCCTGTAGCGTCGGCG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
75 GATAACAGTCCTCGGCAATCGCATGGCGGGTGATGCTGGGGGGCGTTGTTGATGGCGATC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
76 GGTTACGTGGTGCTGGGTGCCAGGCTGCAGATTACATCCGTCATTCCTCTATCTGTCCCT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
77 GGCGATTATCGTCTTGCGGCTATGGCCTGTTTAAATCTAACGTAAGCTGTGCTGCTCGGC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
78 GAGCTGTATGAGCCAACCGTCACCGCGTCGTGATGGCGTTTCTAGATGTATGCGGCATAA
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
79 CGTGGGGTCTATTATCGCACCTATCGCCTGTGGTTACGCCCAGGAAGATTGAACGCGATG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
80 GGCTTGGCCTGGCGGCGGTTGGCATGATCGCGGTATTGAGTTTCTTATGTGGCAATCGTC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
81 ATTTCACTCAGCCGCGGCGTTAACAAAGTACTGCGTGCGACAAACTTTCTCGTAGCCGAA
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
82 ATGGGGATGGCTGCTGGTTCTGCTGGTGGCAACGCCTGCACTGATTACCATACTGTTCTG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
83 GAAAGAGTGGTCGGTATACGCCTTAATTGCGACTATTATTGGCCTGGGTGTACTGGCAAA
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
84 ATTTATCGCAAAGCAGAAAACCAGAAACAGCGGAAGGGAGCTGGGGTCGATTGTGACGCT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
85 CACCTTCTTCAGTATGTTGTTCTGCGTGTTCGCACAACAGGGCGGTAGCTCGATTAGCCT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
86 TTATATCGACCGCTTCGTTAACCGGGTGATGTTTGGTTATCACCGTTCCGACCGCGTATG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
87 TTCCCGGTACGATTAATGCCTTCGCAGTTATGCTGTGCGTGTGTTCCTGGCGTGGGTGGT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
88 AAAGAGAGTGTCGCGGGTAATCGTGATCCGTGCGCATATCTGGGGGAAATTTGCTCTTGG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
89 CCTTGGCCTGATGAGCCTCGGATTCTGCATTCGACCTTAAGCGCCCGCTGGTCCGCAATG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
90 TATGGTCACTCTTCTCTGCCACTGATGGTATTAGGCCTGGCGGTGATGCTTTGCGGAACT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
91 GTTTATCGACCCGGTTGCCATGTCGCAAATTACGCGCGAAGTTCAAATCCCCGGTGACCG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
92 GCGTGATGACCGGCATCTACATGCTGCTTTTCTGGCGCGAAATTGCGAACTATCTGAGGG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
93 CGTGATTGCCGATCAGACATCGCAGGCTTCGTTTGATGCCTTCTAGGCGATCAACTACTC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
94 CATCAATTATGCATATATTGAAGTATTTGATCAAATTACCTGGGGCGCACTCCGTGTGTA
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
95 GGACTGGTACTGATGATTTGGCTGTATCAGGCGCTGAATTCTTTCAGAAACCGCGCTGGC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
96 GCTTGGGAGTCCTGGACCTCAGCACCCCCGATGCCTGATGCGACGCTTGACGCCTTTATC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
97 ATAGGCCTACGTATTTCCTGCAATTTATTGAATTTGCACAATTTGTAGGCTGGATAAGGC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
98 GTTCACGCCGGATCCGGCATCTGGGCTCGATTGCCTGACGCGTCTGTTATTTCCCTTCCG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
99 CGCCGCCTCTACGCTGCCAACGTTTGTACTCGCTTCTTCTGACTCGACTATCGGTTGCGG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
100 ATAATCCAGCGTCACACCTGCTTTCTGCGCCCATTCCAACGCTCATGCACCACTTTCCCT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
101 GGCACATCGCGCAGTTCCGTCTCACTGGCGGATAAACTCCTCATGATCAACGGTTCTCGC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
102 CCTGGGTTGTCGGGTTGAAATACGAAATACGGCTGCATCGGTTCCGGTTTGACCGCTCAT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
103 CACTGCCAGCCACCGTTATTGGCTGCCAAAGTCAGATGATCAGCTGCGGGTAAATGAAAT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
104 ATCGCTCGCCTTCGCGCCAGTCGATCAATAATTCTTCACCCATAAACTGGCTGTAATTAC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
105 TTATCGGCCTGAGCTCGTGCAGGCCAGCCATGTCCCTTTAGACCTGACGCATAGCGGCAT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
106 CAACAATCGGGTATCCCGTTTTGCCTTCCTGCCAGGCCTGTAAATGTGCCGGGATTGCTC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
107 TGCCACTGTACACGATTCCGTCCAGGCAATAAATGACGATGTTTACCACAACGAGGGTGA
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
108 TACGTTATCAGGTGACGGTAAAACTCGCGCCATTACAGCTCATTAAGCCATAACTACCGC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
109 TCACAGGGCGTCCAGCGCCTGCGGCTGTTCAGCCAACAAGGCGATGCGACTACAAGCTGG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
110 CGAGGTAGGGACCCGCCCGTTGCCATAGGGGCTGGCGCGACAATAAAGCTGGTGCCTTCT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
111 TCATGCCGGAAACCTGCTCGCGTTGTTGCTCATATTCTCCGGCACCGTTCTGGCAAAAAC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
112 TGGCGTGACCGCGTAATCGCCGCTTTTTCTTTACACCGGAAAATGCGCAGTATCGAAAGA
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
113 CTGACGAGGAGATTCAGGGCATCGATACTCGTGGCGAGGGCTCTATCGATCCGCTACTAC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
114 GAATTTTGGCGCAGCGACGCACTCCGGCATCCCTTCCCGCAGCCGTTTCAGCCCAGGCAT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
115 TCTTAAAGGCGTAAAGACTTTACATCTCGTGATTACCGGTCATCACCGCGCCAGGCGGCA
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
116 GGATCACGCTGTCATCAAATCCTTCACACCACCGTTACGCAGCTCTTTCGGACTTCCAAC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
117 ATCCCGCGCCCGCTCATTCACTTCAGCCACTCTGATAGTTATAAACAGGTGGGTAACGCG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
118 TTTTCCCGCGCACACCTGTTTAACTATTTCGACACTGGCGACAAAGTCAGGCCGACTTCA
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
119 CGGAACAATAAAACAGGAATACCTTTTCCGCAAGCGCTATTTGTAGCCCATTCAGTTGAG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
120 CATTAAGTCCCTCCTGACGCGGCGACATGTTATGCGGTCGCCCACCACTGGCGTGGTGTA
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
121 GCGATATACAACGCCAGCACGCGTGTGCAGACGAATTGCGGCAGGCGGCAGCCAGTGCGA
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
122 GATTATCGTGCAGACGTAATTGATCCTCGAAACCAGACCAGATGGGTAGTCATAAAACTC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
123 CTGAATAATGGCGCAATTAATCACACGCGGCCAAAGTTCGAAATAACGACTGCCCTGAAA
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
124 GCAGGCGTCAGGATAAAGCGCCATATAGTGTTTGTGATACGCATCAGCGGCGCAAGAATC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
125 TATTGCCTCTCACCCACGGCGATAACTGTCTAAGCGCAGCCAGCTGCTGGCGTTCGTGGA
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
126 ATCAATATGCGGCGAAAATAAGCCCTGAACGTGCATCACAAACATTGGTGTAATCCTGCG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
127 CGGGTTGGCGGGGTGAGAAAGCAACGCTCTACGCGTTAGCGGTAATCTGGTTGTAATCAT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
128 CCAGATTTGCCACTGGTGACAGTATCAGCCACGAATGGCGGGCACGTTGCGGTACCACTC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
129 CGGCTGAGAATGCGCAGAAAGGGGATGTCTATAGCGAAGCTGTGATAATCGGAGAAGCGC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
130 GTTATCTGGCGCCCTCCAGCACCCTCATGTTCTCTTTCGGTTACGATGGCTCACCTGGAG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
131 GGCAATGGAGCGGAATGAGATACGGATTAGGGTGCTGTCGACCAAAATCGTTGCGGATTT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
132 CATTGTTACCTGCTCCTGAGCGGTTTACGAGGAACAACCCGACTTATCAGGTGTCCAGCA
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
133 ACGTTGAGAAGGTGATACTTTGTGAAGTCTCATCCACTCCTGTTACAGCAGGACAGACAA
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
134 ATTTACGAAAGGCCACTGCTCAGACGATAGGACGTGACGTCAGGTAGTTTCGCGGCACAT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
135 AGCTGCCTTTCTACTTCAGCGTGAAATTGCTATCAATAAGCTCATTACTAGCACATCTGC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
136 AAAACAATATGAAGACGACGGTTTCTTCTCTTGCCGTGACTCTCCTTCACTAATTGCGTA
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
137 ACTGTCATGCTGTGGGATTATATTTTAATTCTTTCAGCGGAAATCCCTCGAAGGCTTTAT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
138 TGGCGGCCGCCTGGTTTCCTTTTACAGCGAATAAATAATCACCTCCCTGTTTTTGTATCT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
139 TCTCTTGCAATATCTTTCTGGGCAACCCATTCGCATCGGTTTTGATGATTTTTCCTGTTA
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
140 GATGAGCAGCATGGTTAAGAAGTTCAGGGCGACCCTAGTGATCTCCATTGGATTTCTTAT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
141 CCGCTTTGATTATGATCAGGTGACCAGACTGTGCATTGTTGAGAAACGCAGGGACTTGAC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
142 ATATGAAACGCTTCCCTTACGGCGACTCTGTGGTCATAAGAATGCCGCGTGCGAGTCTTT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
143 TCGACCAATTGCGATGACGTGCTGTACATCTGAAGAATGGTAGTCAAGCATCCAGTTAAT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
144 AAAGCTCCATGAAATTTCGCAGGACAGACACAGAGTACCAACTCTGGCAATGGTATCGTA
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
145 GAAGAGGAACCACCATTTTGCAAAATCACCAGTATTGCTTTGCTAAAAATCGAGGTCGTT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
146 TCCCCGAAAAATCCTCTATATCTTCCCAGCCTTCTGCACCAGAAATAACGGCACAAATAG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
147 TCAACAGTAGTGAATATCCGATAATTTATGTTCTCACTTTTCCAGCGCTTGTCTGTACAA
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
148 TCGGGGATAATAGAAATATGTTCCATCAATTTTTAGATGCGTCGCATTTTGTTCTCCTTA
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
149 ATTATGTAAGAAAGTATTTGATTGAGTCAAGCTATAGAAACAAGGCTTTCAGGTAAGCAG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
150 GAATATCTCAATGTTTGGCAACCTAACATAAAAGCTTCGGCGAAGCTGTACTTTAGAGTA
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
151 CAAACAGCAGGGAAAAGATTACGAAAGCCCGCTCCCCCGCACAGAGACGTGACGGAGATA
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
152 GAGTATTCTATCCATGGCTGCTTTTCGCAGCTTACAGTCTTAACCCTGCCTTTGAATACC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
153 TTATCATTCGTTATAGTAATGCAGCGATGTGCCGTATGCGTATGAAAAGCTAATTCTGCG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
154 GCGTCTCCTCCTCTTATTTCGCAGTGGTCTTCACTTCATTACCACGTCCAGAGACGCCAG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
155 TGCATAGAGCTTATATTCGCACGTGCCAGTGGTTTCGGATTGCTGTGGGCGAAACTTTTC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
156 TGCGGTTAAAATCAGCAGAACTGATATAATATCATGACCGTCCACTTTCTGGCTCTTCTT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
157 TTGTTCTGCTATATTATTGACCGAAAGGAGACTATGCCACGCATAATTTCTTCAGTGCTT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
158 TCTACATTCAAACGTGAAATCAAGCAGTTCATCAGGGACATCGCAAACAATATGAAGACG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
159 GATTTCTTCTCTGCCGTGACTCTTTCACTCATTGCGTAACTGTCATGCCTCTGGATTGAC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
160 TTTAATTCTTTCAGCGGAAGTTTTTCCGCCAAAGGCTTTATTAAGCCGCCCCTGGTTTCC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
161 CTTTTACAGCGAATAAATAATCACCTCCCTGTTTTTGTATCTTCTCTGCAATATCTTTCG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
162 GCACGAGCATCGCATCAGTTGTGATGATGTTTTCCTCCTTTAAACTACTCCAGGTTGCAC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
163 AGGAGAAGTTTTGCAGGGGTAGCTGTAGTACTCGCATTGGGATTTTCTTGCGCGTCTTGA
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
164 CCCTGCAGGATGACCAGACTGTGGCATTGTTGAGAACGGAGCACTAATGACATGAATCGC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
165 TCCCCCTGCGGCGACTCTTGTCAGATAGAGTCGCCGGATGCGCTTTTCCACATCAATTGG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
166 AACTTGACGTCGTTGTCATGATGAATGGACCACATCACAGCATCCAGTCAATAAAGCACT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
167 CGCGAAATTTTGCAGGACTGATACAGGACTACAACTGTGGCAAATAGTATCGTGAACAGG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
168 AATACCATTTTCGCAAAATCCACCATAGTGCTGCCAAGAAATCGGAGATGTGTTTCCCGC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
169 GAAATCCTGGTATCTTCCCAACGTCCTAGCACCGAGATAAACGACGGCAAACAGTAGTCA
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
170 ACATTGTCGATGCCTGACAATTTATATGCTCTACTTTCCAGCGCTTATATCTGTCATCGG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
171 GAATAATAGAAATATGTTCTCGATCAATTTTTAAGTTCCGATTTGTTCACCTTATTTGAT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
172 GCTAAGGAGTATTTGATCAGTGTGTAAGGGTAGAAAGGCGCTTTAGGTAATAAGGAATAT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
173 CTCAACCGTGTAAACGTCAAAATGCGAATTATTTAGTACAAAAAGTAGCGTTACGTATCT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
174 TTCCCTGGGATACAACTCTGGCAATGGTATCGTGAACAGGGAGATGACGCCCAAACGTAC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
175 CATCGCATAGTGGGTTCAAAAAGTGCGAGATGTGTTTCCCCCGAAATCGCTCCTATCTTC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
176 CCAACCTTCTGCACCAGAAAATAACGGCACAAATAGTCCAACAGTGAGGATATCTGACAA
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
177 TTATGCACCCGACTTTCCAGGCTTGTCTGTAATCGGGTGTAATAGAAAATATGTTCCATC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
178 AATTTTTAAGTTCCATTTGTTCACCTTATTTATGTAAGGAGTATTTGATCATGTATAAGC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
179 TGAAAAACAGCTTTAGACAAGATACAGTATCTCAATTGTTGAACTTAAAAATTCGAAGAT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
180 TATTAGTACAAAAGTAGCGTTACGTATCTTTCCCTGCAAATGTGGAACGCAAAATAAACA
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
181 CCTAGGTTCGCATGAGTTATATAATTTTTCACCAATGATTAATTTGTTTCTCAGGAAGAG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
182 ATGTGCATCTCTCTTTGGTACTACGAATGAGTTCGATGCTGTATCTTTATTAAACATTCG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
183 TAAGACTCGATTTTGTTCGGGAGATGTGCTGTCATTCGAGCATAAGTTGGTTTCTCATCT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
184 TTAAAATATTTTACCATGATTGAATTATCAAGGACATGCCAACAACTGAACTGATCACTG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
185 CTCTTTTGATAGATACCCGCTCTTATATAACTTCTCTAAACCGATCGCCGAGAAACGCCC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
186 GTTTTTCTGGTGTATTTATCAACTCCTGCAACGTTCCTTTTGATGGCATGATTTTCATTA
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
187 AGGCGTAGGCTGACCCGACGGAATTAAGAGTCTCGCGCTTGGTGTGAATTTATTATTTTT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
188 ACATGTACCCAGTTCTGTTTGCCAATAATACTACCGATGTCCTCGATTCGTGATACCATC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
189 TCCACATGGCTTTATTATTTAAGACAGGAAACGCGGAAAAAATAGTACCCTTAGCGAAAA
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
190 TAGTAAAACAATCATGATGTTTTAGCTTGTATTTCGCAATCAGCTAACACCAAAAACTAA
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
191 CAAATATCATCAGCAAAAAGAACAAAACTCTTTCATTTTCTTATTCCTCTCGATGTTCGT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
192 CTGTTTCATCTTAGCAAACTCTCACCACAAATCGATAGTATCCTGGCTGTTGCGCTCCAC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
193 CATCGGGTTTATTGATGTCTTGGGAATAAATAGGGTTCTGCACAAGTACCATCCTGGTGG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
194 TAATTGAGTTGTTGGCCAATTTGTCTGTGGCAGGTAATCACTTGCTGTCTTTGTATCCAT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
195 CCCTGGATACTCGGGGAATCATCATCCTGTGGCGTACAAGTCAGATTTGGTTTTACCCAC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
196 TTCCTGCAATACAGTGTAGTCGTAAGGGCTTAATGCTCTGAAGAATGTTTGAAAACATTA
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
197 GGCGAGGACTACTGGCGCTGGCTCAATAGGATATGGCAGTCTTAATTGTTTCGCGATGTC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
198 CGGCAATTTACTTGGGATCGCGTAGGCGGTTTGTTGGGTCTCGCTCCATATCCGCCATTA
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
199 TTTAAGTGTCGCGCATTTTGATCCGCCAGTCCCATTGAATCTATATACTCGAACCGGATT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
200 CAGCGGATACTGATAAAATTCCATCCCCCTTCAGCCCAATTCGATCGATCCTGAGTGATA
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
201 TACCTCCCCCCTGCAGCGGGTCATAATAGCGGTGGCGGTTGTAATACAGGCCGGACTCCT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
202 CATCGACTACCATGCTGCTGCCCCGGCAGGCGGATCAGCTAAGCTGCAGCATGATGCGGG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
203 TTCTCTTCATTCAGCAGGTTGCCCCATTCATCGTATTCTGCGCACCATTCTGTGCCGCCT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
204 TCCGTGCTGACAAGCGCCAGCGGCAGGCCGCGCAGTGATCGCAGTGGTCACAGGTGGATT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
205 TTCGCGCCGGCGTGTACACCGGGTCCATCTGGTTTTTGCATCTGCTCCACCGTCAGGCCG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
206 CACCGATGCCAGCCAGCGGCGGCTTTCCTCACTCACCCGATGTCAGTCAGGATTTCACTT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
207 TTCCAGCCGGTCGAGCATCTGCACCAGCACCGGCGGAACACCACACTGCCACCGTCTTCG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
208 CCGCCGGACTGCTGAAGGGTATCCGCCAGAGCGCTGCGGCGCTGCGTTTTTCGCCAGCTC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
209 ACCGGTGGCGGTTCGGACCCTGATGAGTGGCGTGAAGCTCCCCGGCTGATAAATCGTCTG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
210 GATGCGGGTTCTGTCGTTCTGTATCGTGGTCAGGCGGTCGCCGTCCCAGCCGTACCAGGT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
211 CACTTGCGGTTTCTCGTGACAGCGACATCCAGCCCGTCAGGTCCCGTTCACGTCGCCACA
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
212 CCCGTTTTGCCACCCTGCGGCCCAGCGGGTCGTAAAGATACGCGGCTTTCGACCAGCGGC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
213 TCTGCATATTGTGTTGCTCGCGTGTAGTGCACCAGCCGGTGCTGACTGTCGTAATGGTAC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
214 CGGTGGGTGCGCTCATCATCCGTGCGGATAACCCCTTCGCGCGGATGAGGTCGGTTTCTC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
215 CGTCAGCCTGCCGTGACGGTCATACCCGGTAAAGATAGCGCGTCACGGGCGATACGGTTA
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
216 TCCGGCCACATGCTGCTGAGGGTGCTGTCCGGGTGCAGCGCTCCGGGTCGGGCAGGCGGT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
217 TACCTGCCGGGTCTGTGGCATACGGGATATCAATGCCCAGAGTTACATATAATAATAAGA
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
218 GCAATTAACTTAATTTTATTTGTTTATAATGCGCTTACTTAATACAAACCATTGAATATA
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
219 CCCTCCTGACAGAAAATAAAGCGATATTATTATCGCCATAATATACTTACTATCAATCCT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
220 TACGCCAATAATGTCTGATACAGTCCCTATAAATATTAGAGCAATAAAGAATACTATGCC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
221 CTGTTGGAAAACATATTACCATCATTCCATAAGACATGAGACTAATTAACTCGCTCACAT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
222 CACGCAAGTGGAGTCTAATAGTGAAAGTCTATGCATGGAAAAGAATAGTATTAAAAGCGA
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
223 TAAAGCCAGCCATATAGCTCTGAATAAAAAAATAATATTTCATTACATCACTCCGGTGAA
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
224 TACAAATCTAATAAAACGTCCAATGTTATTTTCCGGAGCACTTCATGCTTACATGTTTCT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
225 AAAGAATCATTAGACCACGTCTTGGCAGTTTTTAAATCTAGCCCTAAATTTACTAGGTGT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
226 GAATATATCAGGCAATACAGAATAACGCGGCCTTACCTCTTTAAACTTCCCTTTTACACA
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
227 GTTCTCCACACTACTATTATCGGTTTCAACGAGGTCACAACGGCCAGCAGCTTCTTTTTG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
228 TATCATTACTTGCTTTACCTGGCCCCCATAGACCATCTCCTTTTGATTCTCCCCGTTGGT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
229 CTTGGCCACCCAAGTATAGTCCCCTTTACCATCTGGGACACAAAGATATTGATGATAGAA
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
230 CGGATTCCCCCATATATCTGACCGCTTCTTTCACCAGTTCCGCCCATTGAATGCAGTGGC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
231 TTAATGCATTTTTAGTGTTTCTAATCCTAATGGATCTATATTTGAGATCTGGATTCAACG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
232 GATACTGATAAAAATTCCATCCCACGCTTTCAGCCCAATCCGGATCCTGAGTAGTATATC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
233 GCCCCTGCAGCGGGTCATAATAGCGGTGGCGGTTGTAATACAGGCCGGACTCCTCATCAT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
234 ACTGCTGCCCCGGCAGGCGGATAAGCTGCATGCAGCTGATGCGGGTTCTCTTCATTCAGC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
235 AGGTTACCCCATTCATCGTATTCTGCGTACCACGCTGTTGTCGCTTCCGTGCTGATAAGC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
236 GGCCAGCGGCAGGCCGCGATGGTCTGCAGTGGTACAGGTGAATTTTTCGCGCCGGCGTGT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
237 ATACCGGGTCCATCTGGCTTTTGCATCTGCGCCACCGTCAGGCCGCACGATGCCAGCCAG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
238 CGCGGCTTTCCTCACTCACCCGGTCAGCCAGGATTTCACTTTTCCAGCCGGTCGAGAGCA
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
239 TCTGCACCAGCACCGGCGGGAAACACCAGACTGCCACCGTCTTCGCCACCGGACTGCTGA
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
240 AGGGTATCCGCCAGGCTGCGGCGCTGCGTTTTTCGCCAGCTCACCGGTGGCGGTTTCAAC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
241 CCTGATGAGTGGCGTGAAGCTCCCCGGCTGATAAAAATCGTCTGGATGCGGGTTCTGTCG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
242 TTCTGTATCGTGGTCAGGCGGTCGCCGTCCCAGCCGTACCAGGTCACTTGCGGTTTCCGT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
243 GACAGCGACATCCCGAGCCCGTCATTGGGTCCCGTTCACGCCGCCATACCCGTTTTTGCC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
244 ACCCTGCGGCCCAGCGGGTCGTAAAGATAGCGACTTTCGACCAGCGGCTCTGCATATTGT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
245 GTCCGCGTGTAGTGCACCAGCCGGTGCTGACTGTCGTAATGGTACCGGTGGGTGCGCTCA
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
246 TCATCCGTGCGGATAACCCCTTCCGGGATGAGGTCGGTTTTCTCTGTCAGCCTGCCGTGA
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
247 CGGTCATACCGGTAAAGATAGTGCGCGTCACGGGCGATACGGTTATCCGGCCACATGCTG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
248 AGGCGCTGTGCGGGTGCAGCTCCGGGTCCGGGCAGGCGGTTACCTGCCGGGTCTGTGGTA
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
249 TACGGGATGCGGATATCCAGATTCGCTGCGGTGGTGTGAACGCCGGTCAGCCTGCCGGTG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
250 GTGCTGTAGCTGTAACTCCGGGTCTGGCGCGGGCTGCTGATGCGCGATGAGTTCGCCGTT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
251 GTCGTTACCAGGTGTAATCGCGGTCAGACAGCAGGCTGTTCAGGTGCTGGCTCTGTAACT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
252 GCCCGGCAGGGGTATAAGCGGTGGTGAGTTCATAACGGCCGAAGCTGCGCAGCGTTTCCC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
253 GGTGCAGGCGGTCGCGGGTGTACTCCACCAGCGGTGTGTCGCCCGAGTTTCATGCCTGAC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
254 AGCCAGCCGCTGCCGTAGGTCAGCCATTCCACGGCGGGCAGGCTGTTCCGGTATACAGCG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
255 GTTCGCCAGTCCCTGTGCGTTGTACGCATGTCTGGTCTCATGCTGCCAGAGCAGTTCATT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
256 CGTCTGCGGATGATGCACCGTCAGGTGTTCACTGGCGAGGCGGCCTTTAGCTGTCATAAC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
257 CATAGTGCACCGTCACCCGGTGCCCTTCGCTGATATGGCTGATGTCTGTCAGCCAGCCGC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
258 GTTTCCGTCATACTGCCACCGCTCTGCGGTTTCGCCATTCACGGTGCGGTGCGTGAGGCG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
259 GTCTGCTTCGTCATAGTGCCAGTGGGTGACCAGCCCCTCATCCTCGCTGCGGATAAGTTT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
260 GCCGGTCAGGTCGTGGTGATAACGCTGTGTGCGGCCGTCAAAGCCGGTTTCCTGTATCAG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
261 CCGGTCGAGTACATCGTAACGCGAAGGTGGTGTGGCTGCCGTTTTTCACTGGTCAGGCGG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
262 ATGACCCGTCCGGCAGCATCGGTATTCCATACTGCGCGTCAGACGCCCTGCGTGGTACAG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
263 ATGGCTTTTCCCCACGCATCGTACTGTGTCCCGTTTCTGCTGCCGTCCGGGGCAATGACG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
264 GTGGTCAGGTCACCCGGCGGCGTTGTATTCATACCGCGTTTCATGGCCCTGCGTGTCTTT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
265 CACGGCAATTAACTGTCCACGGCTGTCGTATGCGCGGTACTGACTCAGCCCTTCCTCGCG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
266 GTGCACCGCCGTCACCTGACCAAAACGGTCACTGGTCATAGCGGGTTACATAACCGGAAC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
267 AGTCAGTGAAGCTCAGCAACTGACCGTAACGGCTCCACGTCATGGTTTTCCGGCTGCCGG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
268 TGGCATCTTTCCCGTTGCGCAGGGTAAGTCACTGTGTGGATTATCATAACGGTAGCGGGT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
269 GATATCGCCGTCAGGGGCAGTTTCCTGAATCAGACGGCCCCATTCATCATATTCCCGGCG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
270 TATTTCCAGCCCGTCAGGCCCGGTGGCTGACGTTAACTGGCTGTGGTGGTTATAGTAAAA
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
271 CGCCGATGCCCTGCCATCCGGCGTGGTGATGCGCGTGATGAGGCCCGTCACCACATCCGA
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
272 GACTCGTATTCTGTTGTCCTGCCTGCGGCATCCGTCTGTGCCCTGAGCCTGCCCACCGCG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
273 TCAAACTGACTCTGCGTGACGCTGCCGTCCGCGTGTTCCTTTTCACCACCCGCTTCAGCC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
274 CGCCTTCACCCTGCGTGTGCAGGACTTCACGGCGGTTCAGAGCTGTCGGTGATGGTGATG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
275 CGGTCCTTCTCATACTGATACGTGTAACTTAAGCCTGCCGGGTTTAGCTGTTCTGTCACC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
276 CGCCCGTCGCTGTCGTAACGGTAACAGATTTCCGGTCGGCCCGTGTGACGGTGCGCCACC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
277 ATCCGGCCCCGGTATTTATCATCGTAAGTAAAGCTGCGCACCTGTGTATTGCTGCGGTCA
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
278 TACACGCCGCCAGTTCGCCGCGGGGCGTCGAGGCCCATAGCGCACCAGCGGCGCGGCAGG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
279 TAAATTCTCCGGGTATTCCGGGTCGTGCGTCAGCCACACGGCAGACAGACGGATGCCGTT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
280 GTAGCGAGCCATATTCGGTGTAACCCGGCAGGGTATCAGGAAAGACTGGACGGTTCCGTC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
281 CCGCCGGAAATGGCCTGCTGCCGGGCTTCTTCTGCCCGCTGCGCCTGCGTGGTCAGTACC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
282 AGCCGGAAGTGACGCCCGGCACCATCCCGTCACGCCGGTGATTTCGCCGCTGAATTCACC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
283 GGCGGCTTCGCGGTGGAACGTCTGTGTGCGCCCGAAGCGGTCCACCCGAGCCCGGTCAGT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
284 ACCCGGTACGGCGGCAGCGGCGCAGGCAGCACCTCATCCGCTTCCCGGCACCCGCTCACA
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
285 CCAGCCGAGCAGCCACCACGGCCCCTGCGGACTGTTTGTCGCCAGATAACGATGCGGACT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
286 TAAGCGGAGTTCTTCCGGCAGCGCCTGCCAGAGTGCGGCCAGCCGGTAGATCACTTCATC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
287 CAGTTTCGCCACGCCGCCGCGCACCAGCCACAGTGACTCGCTGCGGCTGTAACCGTCCTC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
288 ACCGGGAAACAGGTGCTCAAAATACAGGCTTCTGCCGCCGTTATCACTGAGTATCAGTGT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
289 GTTATCGCGCAGCTGTAAGCGAGGATATCCGCAGGCATTTTCCAGCCGGGGCCGAGGCTC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
290 CCCACCGGCGCGGGCTTTTGTCCGGTAACTGCTGTAGGTGCGGGAGAGAATGAACGGCAG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
291 CGGGCCGGGCAGGGCGATGTCGGTTTCACCGGGAAGGACCTTTGCACCGAGCAGCGGACT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
292 TGACCGGATGGCCGGACGTCACGCCCGCCGGCGCACGACGAACAGGCCACAGCCAGTCGG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
293 GGGCAGCGAGTGCGTACCCCGGCTGAACCCTGGACAATGCTACCGCCATACTGCGTCATG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
294 TCGCCCTGACGCGCCGCCCGATTTTCCGCTCATCTGCTCATCCTTGTTTTTATCGGGTTA
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
295 TTTGTCTGCTGACAGGCGAAACCCTACAGATTTATAAGAAAGCCTTAAGTGAGATATCTG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
296 TCAGATAAGAACAATTAGGAAAATATTTATATATTTCATGAATATATGTTTCGATTGGTA
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
297 TAACGATGTCTAAATATTCCTCTGAACATCTTCCTGATACAAAAACCGCCAGCGTTTCCG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
298 CTGGCGTTTTCTCAATGTGATTCAAAACTCAGCAATCAATAAAAATCACCAGTTGCCTTT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
299 TCGGCCTGATCCATCACAGCACCGGTTTATCGCTGGTTTTCGACCAGACGCGATGCAGGT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
300 AGCTGTAAAAGCGGGCGCGGTCTTTCCAGAAAAGCATGAAAGGCAAGCGCCAGAAACGCC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
301 CGCTGCAACCGCGCATAAGTACGGCGTAAAAAGATACAGCCATGCAGGATATTCTCTGTA
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
302 GAGTTCCATACTTTTCTCCCCCTTTTGTATCTACCCGGTGAATGGCACCGGAAAAATGAA
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
303 TTTGTTTATCTGATGAAAAAGTAGTACCGCCTTTTTGTGTAATTTTACTACTCATCCGAC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
304 CACTTATTTGTGCTTATTGATGGTTTATTTACATTCATCCTGTACATTCAAGTTACACAA
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
305 AAGTTAAATTAATACTACAACATGTAGTTAAAATCATGGCTTTTGCCATTTTTATACTTT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
306 TTACACCCCGCCCGCAGATTTTGCGAAATCTTTGCGCAGCCGAGAATTCTACGGCCTTCC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
307 GGTATCACTTTTAGGCCACTGGAGGTGCACTGTGAGTGCAGGCGTGCTAACCGGCGTATT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
308 GCTGGTGTTTTTATTACTGGGTTATCTGGTTTATGCCCTGATCAATGCGGAGGCGTTCTG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
309 ATGGCTCGCGCAAGGAGCTTCTTACTGATCGCCACGTTTTTACTGGTGTTAATGGTGCTG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
310 GCGCGTCCTTTAGGCAGCGGGCTGAGCGCGGCTGATTAATGACATTCCTCTTCCCGGTAC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
311 AACGGGCGTTGAGCGCGTACTTTTTCGCGGACTTGGCGTCTCTGACCGTGAGATGAACTG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
312 GAAGCAATATCTTTGTGCCATTCTCGGCCTGAACATGCTGGGGCTGGCGGTGCTGTTTTT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
313 ATGTTGCTCGGTTCACACTAGTCTGCCGCTGTAATCTGGACACCAGCAGTTGCCGAGGGC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
314 TGTCGTGCGATGATCTGGCGCTGAATACCGCCGTCAGCTTTGTCACCAATACCAACTGGC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
315 AATCTTGTAGCGTGAAACCACGTTGAGCTACTTTTCAGCCAGATGGCGGGCTTAACGGTG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
316 CAAAACTTTCTTTCTGCCGCCAGCGGGATTGCGGTGATTTTTGCCCTCATCCGTGCGTTT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
317 ACCCGCCAGAGCATAGCAGCACGCTGCGGGAATGCCTGCGTACATCCTGCTACGCATCAC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
318 GTTATGGGTGCTAGTCCCTCGTGGCGTTGTTGATTGCACGTTTGTATTCAACAAGGTGCG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
319 CTGCAAAACTTTCTGCCTTATCAGGCTGTGAATAGCCGTTGAAGGCGCGCAACAGCTGTT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
320 ACCCATGGGGCCTGTAGCTTCTCAGGAAGCGATCAAGATGCTCGGTACTAACGGCGGTGG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
321 CTTCTTTAATGCCAACTCGTCGCATCCGTTTGAAAACCCCAACCGCACTGACCAACTTCG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
322 TGCAGATGCTGGCGATCTTCTTGATCCCAACGGCGCTGCCTTTGCCTTTGGTGAAGTGAT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
323 GGGCGATCGCCGCCAGGGGCGCATGTTGCTGTGGGCGATGTCAGTGATTTGTCATCTGCG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
324 TAGGCGTGGTGCGTGGTAAGAAGTTCAGGGTAATCCTCATCTGCTGGCACTGGGCACGGA
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
325 CAGCAGCATCAATATGGAAGGTAAAAGAGCCGTTTGCGTGCTGGTCAGTAGCCTGTTTCG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
326 CGTCGTGACGGGCGGCTTCCTGTGGCGCGGTGATTGCGATGCATGATTCGTTTACCGCTC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
327 TGCGTGGCATGGTGCCGATGTGGCTGATGCAAATTGGTGAAAGGGTGTTCGGCGGTGTCG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
328 GTTCTGAGTCTTTACGCATGATGCTGTTTGTCCTGCTGGCGGTGTTTATTGCCGGGCTGA
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
329 TGATTGGTCGTACACCGGAATATCTGGGTACAAAATCGACGTACGCGAGATGAAACTGAC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
330 TGCACTGGCAATTCTGGTTACCCCGACGCTGGTGCTGATGGGCGCGGCGTTGGCGATGAT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
331 GACCGACGCCGGACGGTGAGCGCCATGCTCAACCCTGGCCCGCACTGGTTTTAGCGAAGT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
332 GCTGTACGCCGGTGTCATACCCGCCGCTAACAACAACGGCAGCGCTTTGCCGGATCCCAG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
333 CGCCAACTCTCCGTTCTGGAACTGTTTACTGGCGTTCTGCATGTTTGTCGGTTGCTTCGG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
334 GTGATTATCCCGGTGATGGCAATTGCCGGTTCGCTGGTGAGAGCCAAGCCGCCAGCTCCG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
335 GCACATGCTGCCAACGCACGGCCCGCTGTTTGTTGGCCTGTTAATCGGCACCGTGTTGCT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
336 GGTTGGCGCACTGACCTTTATCCCTGCCCTGGCGCTTGGTCCCGTGGCGGAATACCTCTC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
337 CTGATGATATTGAGTGAGCACTGAATATGAGTCGTAAACAACTGGCGCTATTCGAACCAA
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
338 CACTTGTCGTTCAGGCAGCTGAAAGAAGCGGTGAAAATTAAACCCGCAGGGCGCAATGGC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
339 GCAATCCGGTAGATGTTTATCGTCTGTATCGGCAGTCTGCTGACCACCTGTATTAGCATC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
340 GCGATGGCAAGCGGTGCGCAGTGCCCGGCAATGCGCTGTTTAGCGCGGCCGTTGGCTGTG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
341 GGTCTGCGATACTGTTAGCTAAGTTTGCCACCGCCGAGTGAGCGTGGCAGAAGGCCGCAG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
342 TAAAGCGCAGGCCAACAGTCTGAAAAAGGGGTGACTGCCTTTGCCCGCAAGCTGCGTGAG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
343 ACACGAGATATGGCGCTGCGGCGGACAAAGTTCCTTGCCGACCAACTTCGTAAAGGCGAT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
344 ATCGTACTGGTAGAAGCTGGCGATATTATCCCCTGCGATGGTGAAGTTATTGAAGGGGGT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
345 GCATCGGTCGATGAAAGCGCCAGCCCACCGAAACGGCAACCGTGTGTATCCGTGAATCGC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
346 GGCGGCGATTTGCCGCGTCACCACGGCGGCACGTAGCGTGATTCTGGACGCGAGCTGCCC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
347 GGTCATTGTAGCGGTATAGACGGCGAGACATGTCTGCATCGCGATCGACTCGCCGATGGT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
348 GGAAGTGCGCAGCTGAGGGGACTGAGAACGAATCGCCCTGACCATTCTGGTGGTACATCG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
349 CCCGTGACTATCGTCTTTGCTGGCAGCGCCACAGCGCGTGACGGTTTTCACGCTGTGCTG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
350 CGCGCGGTACTGCTGCAGTCAGCGTAACGGGTCACTGGTGGCGCTGCTGGTCTGTCTGAG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
351 CAACCACAGCAGATGCGCGGCCTGTTGTCATGTCCGGCGTCGCCGGGATGAGCCGGATGA
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
352 CTAGGCGCGAATGTGATTGCCACCAGCGGACGGGCAGATTCGAGAGCGGCACGGCAGGTG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
353 ACGTTGACGGTCCTGCTACTGGATAAAGACCCGGGCACCATCACACTCGGTATAACCGTC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
354 AGGCGTCGGAGTTTATCGCGCGCGCAGGCGTGGGATGAAAACAGCGCTGGCTCGACGCTC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
355 GGATGACTGGCTTCGCTGAGCGGCGATCCGAAACGCCGGAAGGCCGCAGTATTGTGTGAT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
356 CCTCGCCAAGCAGCGTTTTAACCTGCGCGAGCGCGATGTGCAGTCGCTGAGGTTGCCACC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
357 TTTGTACCGTTTGATCTGCGCAAAGCCGGTCGAGCGCCGTAATCGACAACCTGACAACGA
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
358 TGATCGCGTAAAGGTTCTGTCGATGCCATTCGTCGCCATGTTGAGTAGACGCTATTTCAG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
359 GTTCAAAGTCGATCCGATGCGCGTCAGGGAGCCACGCCGCTGGTGGTGGAAGGTTCTCGT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
360 GTGCTGGGCGTTATCGTGATGAAAGATATCGTCAAAGGCGGTATTAAAGAGCGCTTCGCC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
361 CAGCTGCGCAAAATGGAATTAAACGGTGATGATTACCGGCGATAACCGTCCTGACTGCCG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
362 CCGCGATTGCGGGCGCGGAAGACCGGTGCGTCGATGATTTTCTCGCCGAAGCGACACCGG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
363 AGGCCAAGCTGGCATTGATCCGTCAGTATCAGCGGCGGAAGGTCGTTTGGTAGCGATGAC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
364 CGGCGACGGCACCAACGATGCTCCGGCTGGCGCAGGCAGATGTCGCGTGGCGATGAACTC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
365 CGGCACCCAGGCGGCGAAAGAGGCGGTAATATGGTCGATCTCGACTCTAACCCGACCAAG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
366 TCCGATTTCGAGGTGGTGCACATTGGCAAACAGATGCTGATGACCCGTGAGCTCGCTGAC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
367 CACCTTCAGCATTGCCAACGGATGGCGAAGTACTTCGCGATTATTCGTATCGCGGCAACG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
368 GTTACGCAAATGCGCTGAACATCATGTGCCTGCATTCGCCCGACTCGGAAGCAATCCTCA
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
369 TGCGGTGATTTTCGAACTCTACCCTGATTATCGTCTTTTGATTCCCCCGGGCGTTATAAA
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
370 CCGCTTAGGTTAACGAGGTTCTGCCATGTTGCGCCGGGTAACTTGGATTTACGGTCTGGG
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
371 TGGGCTGCTGCTGTTTTATCGCACCAAAGTCATTAAGGTGGTTCGAATCGTTTGCGGTCT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
372 GGTGTGAGTTTACCATGAGTGGATTACGTTCATTATCAACATTTATCTTCTGTTATTGAT
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
373 TACTGGCGGCGTTTACCCGCTTCACGGTCACTGGGGCAATGGTGGTTTCCCTGGCAGGCC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
374 AATGGTTTCGTTGATTCGTGAATGTAAGCGGCGGTTCGGCATTAATCGGCAGAATTTGTC
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
375 ACCGGCAACGGCTTTCATGGTCGCCCGTCGGCAACGGCAGAAATGCCCCGACCAGGTCCA
d0a712cf0518 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
bgruening
parents:
diff changeset
376 GCAACAGAAG