diff test-data/E.coli_contigs.fasta @ 0:d0a712cf0518 draft default tip

planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/graphmap commit a1461f1e83079de821b269125c49eca2460e7693
author bgruening
date Thu, 27 Sep 2018 15:27:40 -0400
parents
children
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/E.coli_contigs.fasta	Thu Sep 27 15:27:40 2018 -0400
@@ -0,0 +1,376 @@
+>contig_1
+AAGAAACATAAACAGAACGTCAGTAATCCAGCAAACTGACGGTTACGAAATAGGCGCGGC
+GACAATAATCTCGTTCTTTCACCACCTCCGGCGTCAGATTCGGATTCACAGCACATCGGG
+ACCAACGCGTTGGTGCAAACGGATGCGTGGTCCAGTTGTTCCGGGAGTCAACATCTCTAC
+AGGCTTGAGGACCGCAAATCTCATGGAGCCCCAGTATCGCAGTTTTGTTGCACTATCCCG
+CGTGTTTCAGGCGAGTGTTCTACCTCGAGTAGCCCGTTACAGAAGTCAAATGCGGCTCTA
+GCACGAGTCGTAAAGAGGTGGCACCCCGCTAGGAGGGGCTAAGCATTGGCTCAGGAAACT
+GCTGTATTAAAGAATTCGGTTGTACGGTTCCGCAAGTGAGGTCGGCCTCTAGGTCAAAAG
+CGTCCAGTAAAGCTAATATTGTCACCGATAAGGTTGATTAACTGCTCGAAGGAAATTTAA
+AACCATTGAGGAGGATAAGAGCGATATCGCAGTGGACCCAATTAGTGGTTCATTCTATTG
+CCAGCGACCCATGTATATTCGGAACGTGAGGGTGAAACGTGCCTCCATGTAGAGCTTCAG
+AGCAGGCATTAGATGCTGGTACAGCCTTTTCGTCGTCATTAATCGGGGTAAGTTACTTAA
+TGCGACAACAGGATGCGCTTTTCGGGGCAAAATTGAAGAGCGTAGTCATGCGGGCGAACG
+CCAGTGCGTGCTCGCCAGTAGCGTCGCACTGCATTAAGAAGCCGTTTGCGCCAGCCGTTA
+AAGAGCGTTTCTGGTTCTACGGTGATAATATGATTTCTGGTGATCCGTGTTGCACCGGAC
+CCATAGTTCCAGCACTTTCTTCAGTTCTAGTGATAGCGCGCCTGATATGGCTTTCGGAGA
+TACACCCCAACCCAACGCTTTCATGATAACCGCGATCGGGTGGGAGCCGTTAGACACCAC
+CCGTTATCATAGGCCACTGGTCAGTTAATTAAATGCAGAGTGCCCCGGCAAACATTTCCT
+CGCCCCGATAATCGCTCCTGGGAAGAATCATGCTTCCCTGGATGTACGAACGAGAATTGA
+CCCGCGGCGCCCGCATGGGAGATCGTGCGATTCGTCTGCCAGTTGTGCTTCTTTCGCCGC
+CTGGTTGTACAACATGCCGTGCGGTTTGACATGACGCATTACGCGCTATCCAGCGCACGG
+GAAATTCCTTCAGGCGCCACCAATTTTAGATACAGCGTCTGGGCGTAAACGGGGTTTCTG
+GCGGCATCCAGCTGACGCGCTGCGAAATAAAATTTTCCCCTGTCGGGAAAACTCGGGTGA
+GCGCCAATCGCGACACCATTTTATTGCTTCCACGCACGCAGCCTGCATGATTTGCGCATC
+GCCTGCATGAAATCCACAGGCAATATTGTGCAGAGGAAACCAGCGTTAATAGCTCTGCGT
+TGCTGGCGCATCGCTTCGCCCAAGTTCGGCGTTCAGGTCAATTTTCATTGTGCAGCCGCC
+ACGCTAATTGTTCAAAAGTAACTGTTGCTGATTTGCCGTGCTTTTTAGTGCCTCTTCCAG
+TGAACACTGGACAAAATGAATCGGCTGACCGAGCGGCGAATTTGCGCCAGATGGTACATA
+TCAGCCTCTCAATGATACAGGCAATACGCGGGTAACCACCGGTGGTCTTGCCGTCGTTCA
+TCAACACAATACTGCTGCCCGTCCTCTTGGCACCTGCACCACGCCCGGTGACAAACCGTG
+AGATAACAGTTCGCGATCGGTGGTGCGTTTTAAATGTCCCCTGTAAGCGATAGCCATGCG
+GTTATTTGCGAGCCGGCTGCCAGGCGAACGCCAGAATGCATATCCTGCGAGGCGCGATTG
+AACTCATGATATTCCGAGTGGCGGCAAGGCGCGAATTGCGGTTGCCCCACAGCAGCTGTT
+TAACGCCCTGCGCTTCCATAGAATTGGTACGCTTCGATTTGCCAATCGGGAGTCGGTCAC
+CATCCTTCAGTAAACGGCCTTCCCAGCCCGCCAATCCCCATTTGCAATCACTGCGCGGTG
+CTGCATGAGCCCATTACCGGCGGAACATCAATACCACCCGCGACCGCCAGATAACTGCGC
+ATGTAGCGTCTTCGTGGAGGCATCCGTCAGCGTTAAACGCTGGCCTGCTGTTTTCATCGG
+CAATCGCCAGCCGGTCCAGACGCATTATCATCCAGCCGCGCTGTCGCAACCGGCACCCGT
+CAGAGCCGAAACCACCCATCAGTTTCGAACCTAACAGTTAACTGACCGAGCGCTGATCTC
+CATAGCGGGGGCATTGGCGTCATTACCACCAGTATAAGTGCAATGCGTAACGCGGGCATA
+TCAGTGCGCCGCAGTGGCTGATATCCGACTGGCGAAACCGTGACGACCGCCATCCTGCAC
+GCGCGTATACATGCCCGCACGAATAATCTTCAGCATACTCCCTCCTTCTGCGTACAAAGC
+CGCGGAACCTGTCTCCAGGGACGGTGTAATACAAGATGGGTTCGTCACGCGCGCCGGATT
+AATAAGGACGATGAGTGAGGTATGACCAATCAACTGCCAGCCACCCGGCGTTGCCATAGG
+GATAAACACCAGTGCGGCCCGCCGATCCCGACAGAACCTGCCGCTGAAAGCCACCGCGGT
+TCAGCGCCGTGGCGTGTGTAGTTGTTCCGGCAAACTCCCGAGATACGGGAAGCCCGGTTT
+GAAAACCTAAAAACCAGACCACGTATTCCACGCATAGAGTTATGCAATTCAACAACCTGT
+TCGCTCAACCCGCAATGCGCCGCGACCACCGCCAAATCCGGTCCGCCTGCCACCGTAAAC
+CAAGGGGATTTCAATCAAAGCGAGACTCGTGGGTGCCAGCGCCTCGCTCCTCTCCACCAG
+CGTTGCAAACGCTCTATGGCATCCAGCGCCAGCGACTCAGGATTACGCAAAATCACCGTG
+ATATTTGTTCCACCTGCCGGGAAACCTGTTCAACCACATTCGGCAATATATCCACCAGAC
+ACCCTGCGCCAGTCGCCAGGATCCCGGTTTCTGGCTAGCCAGTTCACCGGCGGTTCTCAG
+TTCCAGCACTACCGCCGTTTCCACCTATCAGATAACAACGCGCTCGTTGCACTTTCACGT
+GTGGGACTATTATTCGTTATGCAGGATTAGGAATATCAATACAAAGGTCACATCAAGATT
+TCGTATTTTCACTTCAGCCACTCGCTCAATGCGCGAATACCACCACGTTCAGAGTGGCAG
+ATGGTGACCTGCAGCATAAAATGCAATCCCTGCTCGCGGGCCTGAATGAATGGTCTTTCA
+GAAAACTTCGCCAGGACCAACAGGCATCCACGCCAAACGCGGCGGCTATCGATAAAACTT
+GCCCGCCGCCCGTGCACCAGGCGACGCGCTGGACCACCTCAGTCCGGTATCGCCACACCA
+TAACGGCTTACGTCCCAGACGCTTTCAATCCAGGAAGCCAGCTGGGCAGTCCCGGCACAG
+GCAATTGAGTTTCGCCCCACGGCACCAACGGCTCATTTCGCCCATGACCGTGATCCCCCA
+ATGCGCCGCCAGCTGTGCCATGTTATTGCCCAGCTCAGGATGTGCGTCAAGCGGCAAATG
+CCAGCCATATAAGGTTGATATCAGGTTTCGCCAGCAACGTTTTTAAACGGTTACGCTTCA
+TTCCGCGAATGACCGGAGACTCTCTCCTTCCAGAAGTAGCCATGATGCACATGACCGCAT
+CCGCGCCCAGACGCACTGCCTCATCGAGCAAAGCCTGGGTGCGTGGTGACACCGGTAACA
+CAATTTTGCACCGTCTCTTTGCCTTCCCACTGCAAACCATTCGGCGTGGTAATCACTAAT
+CGCCGCGCTGTTCAGCTTTTCGTTAATCAGTTGTTCCAGTTCGGTGTTTTTCATCTTCGC
+GCCTTCCGTATTCTGATAGCTACACGTTAACATAGCGTTACCTCGCCAGGTTCGTCGATA
+TTAATCTTTTTGACGACTTAAGAAACAAACCCGCAAAGCCCCAAAGACGCAAATTGTTTA
+TATCATCACAGCGCTTCAGGATCTCATATTTATGCAAATCAGACAGCATTGCATAAATAA
+GAGAGTCAATGTATCAAAGTTTTAACTTTAAGGAAACACAAGCACGCCGCGCAACTATTG
+ACAGCTGACGTTGCGTCAATTGTGGAATTATTATGAATAAACACGCATCTAAGCCGCGCG
+CTATTTACTGTCGTTGCGCTGCAAATCTGGGAATATTTGTGCTTTTACGGCATGCGTGCC
+CTGCTGATTCTCTATCTGACTCACCAATCAAAACTAAAATACAACGATACTCACGCCTAC
+GAGTTATTTAGCGCCTACTGTTCGCTGGTGGTTGTACGCCAATCCCCTGTAGCGTCGGCG
+GATAACAGTCCTCGGCAATCGCATGGCGGGTGATGCTGGGGGGCGTTGTTGATGGCGATC
+GGTTACGTGGTGCTGGGTGCCAGGCTGCAGATTACATCCGTCATTCCTCTATCTGTCCCT
+GGCGATTATCGTCTTGCGGCTATGGCCTGTTTAAATCTAACGTAAGCTGTGCTGCTCGGC
+GAGCTGTATGAGCCAACCGTCACCGCGTCGTGATGGCGTTTCTAGATGTATGCGGCATAA
+CGTGGGGTCTATTATCGCACCTATCGCCTGTGGTTACGCCCAGGAAGATTGAACGCGATG
+GGCTTGGCCTGGCGGCGGTTGGCATGATCGCGGTATTGAGTTTCTTATGTGGCAATCGTC
+ATTTCACTCAGCCGCGGCGTTAACAAAGTACTGCGTGCGACAAACTTTCTCGTAGCCGAA
+ATGGGGATGGCTGCTGGTTCTGCTGGTGGCAACGCCTGCACTGATTACCATACTGTTCTG
+GAAAGAGTGGTCGGTATACGCCTTAATTGCGACTATTATTGGCCTGGGTGTACTGGCAAA
+ATTTATCGCAAAGCAGAAAACCAGAAACAGCGGAAGGGAGCTGGGGTCGATTGTGACGCT
+CACCTTCTTCAGTATGTTGTTCTGCGTGTTCGCACAACAGGGCGGTAGCTCGATTAGCCT
+TTATATCGACCGCTTCGTTAACCGGGTGATGTTTGGTTATCACCGTTCCGACCGCGTATG
+TTCCCGGTACGATTAATGCCTTCGCAGTTATGCTGTGCGTGTGTTCCTGGCGTGGGTGGT
+AAAGAGAGTGTCGCGGGTAATCGTGATCCGTGCGCATATCTGGGGGAAATTTGCTCTTGG
+CCTTGGCCTGATGAGCCTCGGATTCTGCATTCGACCTTAAGCGCCCGCTGGTCCGCAATG
+TATGGTCACTCTTCTCTGCCACTGATGGTATTAGGCCTGGCGGTGATGCTTTGCGGAACT
+GTTTATCGACCCGGTTGCCATGTCGCAAATTACGCGCGAAGTTCAAATCCCCGGTGACCG
+GCGTGATGACCGGCATCTACATGCTGCTTTTCTGGCGCGAAATTGCGAACTATCTGAGGG
+CGTGATTGCCGATCAGACATCGCAGGCTTCGTTTGATGCCTTCTAGGCGATCAACTACTC
+CATCAATTATGCATATATTGAAGTATTTGATCAAATTACCTGGGGCGCACTCCGTGTGTA
+GGACTGGTACTGATGATTTGGCTGTATCAGGCGCTGAATTCTTTCAGAAACCGCGCTGGC
+GCTTGGGAGTCCTGGACCTCAGCACCCCCGATGCCTGATGCGACGCTTGACGCCTTTATC
+ATAGGCCTACGTATTTCCTGCAATTTATTGAATTTGCACAATTTGTAGGCTGGATAAGGC
+GTTCACGCCGGATCCGGCATCTGGGCTCGATTGCCTGACGCGTCTGTTATTTCCCTTCCG
+CGCCGCCTCTACGCTGCCAACGTTTGTACTCGCTTCTTCTGACTCGACTATCGGTTGCGG
+ATAATCCAGCGTCACACCTGCTTTCTGCGCCCATTCCAACGCTCATGCACCACTTTCCCT
+GGCACATCGCGCAGTTCCGTCTCACTGGCGGATAAACTCCTCATGATCAACGGTTCTCGC
+CCTGGGTTGTCGGGTTGAAATACGAAATACGGCTGCATCGGTTCCGGTTTGACCGCTCAT
+CACTGCCAGCCACCGTTATTGGCTGCCAAAGTCAGATGATCAGCTGCGGGTAAATGAAAT
+ATCGCTCGCCTTCGCGCCAGTCGATCAATAATTCTTCACCCATAAACTGGCTGTAATTAC
+TTATCGGCCTGAGCTCGTGCAGGCCAGCCATGTCCCTTTAGACCTGACGCATAGCGGCAT
+CAACAATCGGGTATCCCGTTTTGCCTTCCTGCCAGGCCTGTAAATGTGCCGGGATTGCTC
+TGCCACTGTACACGATTCCGTCCAGGCAATAAATGACGATGTTTACCACAACGAGGGTGA
+TACGTTATCAGGTGACGGTAAAACTCGCGCCATTACAGCTCATTAAGCCATAACTACCGC
+TCACAGGGCGTCCAGCGCCTGCGGCTGTTCAGCCAACAAGGCGATGCGACTACAAGCTGG
+CGAGGTAGGGACCCGCCCGTTGCCATAGGGGCTGGCGCGACAATAAAGCTGGTGCCTTCT
+TCATGCCGGAAACCTGCTCGCGTTGTTGCTCATATTCTCCGGCACCGTTCTGGCAAAAAC
+TGGCGTGACCGCGTAATCGCCGCTTTTTCTTTACACCGGAAAATGCGCAGTATCGAAAGA
+CTGACGAGGAGATTCAGGGCATCGATACTCGTGGCGAGGGCTCTATCGATCCGCTACTAC
+GAATTTTGGCGCAGCGACGCACTCCGGCATCCCTTCCCGCAGCCGTTTCAGCCCAGGCAT
+TCTTAAAGGCGTAAAGACTTTACATCTCGTGATTACCGGTCATCACCGCGCCAGGCGGCA
+GGATCACGCTGTCATCAAATCCTTCACACCACCGTTACGCAGCTCTTTCGGACTTCCAAC
+ATCCCGCGCCCGCTCATTCACTTCAGCCACTCTGATAGTTATAAACAGGTGGGTAACGCG
+TTTTCCCGCGCACACCTGTTTAACTATTTCGACACTGGCGACAAAGTCAGGCCGACTTCA
+CGGAACAATAAAACAGGAATACCTTTTCCGCAAGCGCTATTTGTAGCCCATTCAGTTGAG
+CATTAAGTCCCTCCTGACGCGGCGACATGTTATGCGGTCGCCCACCACTGGCGTGGTGTA
+GCGATATACAACGCCAGCACGCGTGTGCAGACGAATTGCGGCAGGCGGCAGCCAGTGCGA
+GATTATCGTGCAGACGTAATTGATCCTCGAAACCAGACCAGATGGGTAGTCATAAAACTC
+CTGAATAATGGCGCAATTAATCACACGCGGCCAAAGTTCGAAATAACGACTGCCCTGAAA
+GCAGGCGTCAGGATAAAGCGCCATATAGTGTTTGTGATACGCATCAGCGGCGCAAGAATC
+TATTGCCTCTCACCCACGGCGATAACTGTCTAAGCGCAGCCAGCTGCTGGCGTTCGTGGA
+ATCAATATGCGGCGAAAATAAGCCCTGAACGTGCATCACAAACATTGGTGTAATCCTGCG
+CGGGTTGGCGGGGTGAGAAAGCAACGCTCTACGCGTTAGCGGTAATCTGGTTGTAATCAT
+CCAGATTTGCCACTGGTGACAGTATCAGCCACGAATGGCGGGCACGTTGCGGTACCACTC
+CGGCTGAGAATGCGCAGAAAGGGGATGTCTATAGCGAAGCTGTGATAATCGGAGAAGCGC
+GTTATCTGGCGCCCTCCAGCACCCTCATGTTCTCTTTCGGTTACGATGGCTCACCTGGAG
+GGCAATGGAGCGGAATGAGATACGGATTAGGGTGCTGTCGACCAAAATCGTTGCGGATTT
+CATTGTTACCTGCTCCTGAGCGGTTTACGAGGAACAACCCGACTTATCAGGTGTCCAGCA
+ACGTTGAGAAGGTGATACTTTGTGAAGTCTCATCCACTCCTGTTACAGCAGGACAGACAA
+ATTTACGAAAGGCCACTGCTCAGACGATAGGACGTGACGTCAGGTAGTTTCGCGGCACAT
+AGCTGCCTTTCTACTTCAGCGTGAAATTGCTATCAATAAGCTCATTACTAGCACATCTGC
+AAAACAATATGAAGACGACGGTTTCTTCTCTTGCCGTGACTCTCCTTCACTAATTGCGTA
+ACTGTCATGCTGTGGGATTATATTTTAATTCTTTCAGCGGAAATCCCTCGAAGGCTTTAT
+TGGCGGCCGCCTGGTTTCCTTTTACAGCGAATAAATAATCACCTCCCTGTTTTTGTATCT
+TCTCTTGCAATATCTTTCTGGGCAACCCATTCGCATCGGTTTTGATGATTTTTCCTGTTA
+GATGAGCAGCATGGTTAAGAAGTTCAGGGCGACCCTAGTGATCTCCATTGGATTTCTTAT
+CCGCTTTGATTATGATCAGGTGACCAGACTGTGCATTGTTGAGAAACGCAGGGACTTGAC
+ATATGAAACGCTTCCCTTACGGCGACTCTGTGGTCATAAGAATGCCGCGTGCGAGTCTTT
+TCGACCAATTGCGATGACGTGCTGTACATCTGAAGAATGGTAGTCAAGCATCCAGTTAAT
+AAAGCTCCATGAAATTTCGCAGGACAGACACAGAGTACCAACTCTGGCAATGGTATCGTA
+GAAGAGGAACCACCATTTTGCAAAATCACCAGTATTGCTTTGCTAAAAATCGAGGTCGTT
+TCCCCGAAAAATCCTCTATATCTTCCCAGCCTTCTGCACCAGAAATAACGGCACAAATAG
+TCAACAGTAGTGAATATCCGATAATTTATGTTCTCACTTTTCCAGCGCTTGTCTGTACAA
+TCGGGGATAATAGAAATATGTTCCATCAATTTTTAGATGCGTCGCATTTTGTTCTCCTTA
+ATTATGTAAGAAAGTATTTGATTGAGTCAAGCTATAGAAACAAGGCTTTCAGGTAAGCAG
+GAATATCTCAATGTTTGGCAACCTAACATAAAAGCTTCGGCGAAGCTGTACTTTAGAGTA
+CAAACAGCAGGGAAAAGATTACGAAAGCCCGCTCCCCCGCACAGAGACGTGACGGAGATA
+GAGTATTCTATCCATGGCTGCTTTTCGCAGCTTACAGTCTTAACCCTGCCTTTGAATACC
+TTATCATTCGTTATAGTAATGCAGCGATGTGCCGTATGCGTATGAAAAGCTAATTCTGCG
+GCGTCTCCTCCTCTTATTTCGCAGTGGTCTTCACTTCATTACCACGTCCAGAGACGCCAG
+TGCATAGAGCTTATATTCGCACGTGCCAGTGGTTTCGGATTGCTGTGGGCGAAACTTTTC
+TGCGGTTAAAATCAGCAGAACTGATATAATATCATGACCGTCCACTTTCTGGCTCTTCTT
+TTGTTCTGCTATATTATTGACCGAAAGGAGACTATGCCACGCATAATTTCTTCAGTGCTT
+TCTACATTCAAACGTGAAATCAAGCAGTTCATCAGGGACATCGCAAACAATATGAAGACG
+GATTTCTTCTCTGCCGTGACTCTTTCACTCATTGCGTAACTGTCATGCCTCTGGATTGAC
+TTTAATTCTTTCAGCGGAAGTTTTTCCGCCAAAGGCTTTATTAAGCCGCCCCTGGTTTCC
+CTTTTACAGCGAATAAATAATCACCTCCCTGTTTTTGTATCTTCTCTGCAATATCTTTCG
+GCACGAGCATCGCATCAGTTGTGATGATGTTTTCCTCCTTTAAACTACTCCAGGTTGCAC
+AGGAGAAGTTTTGCAGGGGTAGCTGTAGTACTCGCATTGGGATTTTCTTGCGCGTCTTGA
+CCCTGCAGGATGACCAGACTGTGGCATTGTTGAGAACGGAGCACTAATGACATGAATCGC
+TCCCCCTGCGGCGACTCTTGTCAGATAGAGTCGCCGGATGCGCTTTTCCACATCAATTGG
+AACTTGACGTCGTTGTCATGATGAATGGACCACATCACAGCATCCAGTCAATAAAGCACT
+CGCGAAATTTTGCAGGACTGATACAGGACTACAACTGTGGCAAATAGTATCGTGAACAGG
+AATACCATTTTCGCAAAATCCACCATAGTGCTGCCAAGAAATCGGAGATGTGTTTCCCGC
+GAAATCCTGGTATCTTCCCAACGTCCTAGCACCGAGATAAACGACGGCAAACAGTAGTCA
+ACATTGTCGATGCCTGACAATTTATATGCTCTACTTTCCAGCGCTTATATCTGTCATCGG
+GAATAATAGAAATATGTTCTCGATCAATTTTTAAGTTCCGATTTGTTCACCTTATTTGAT
+GCTAAGGAGTATTTGATCAGTGTGTAAGGGTAGAAAGGCGCTTTAGGTAATAAGGAATAT
+CTCAACCGTGTAAACGTCAAAATGCGAATTATTTAGTACAAAAAGTAGCGTTACGTATCT
+TTCCCTGGGATACAACTCTGGCAATGGTATCGTGAACAGGGAGATGACGCCCAAACGTAC
+CATCGCATAGTGGGTTCAAAAAGTGCGAGATGTGTTTCCCCCGAAATCGCTCCTATCTTC
+CCAACCTTCTGCACCAGAAAATAACGGCACAAATAGTCCAACAGTGAGGATATCTGACAA
+TTATGCACCCGACTTTCCAGGCTTGTCTGTAATCGGGTGTAATAGAAAATATGTTCCATC
+AATTTTTAAGTTCCATTTGTTCACCTTATTTATGTAAGGAGTATTTGATCATGTATAAGC
+TGAAAAACAGCTTTAGACAAGATACAGTATCTCAATTGTTGAACTTAAAAATTCGAAGAT
+TATTAGTACAAAAGTAGCGTTACGTATCTTTCCCTGCAAATGTGGAACGCAAAATAAACA
+CCTAGGTTCGCATGAGTTATATAATTTTTCACCAATGATTAATTTGTTTCTCAGGAAGAG
+ATGTGCATCTCTCTTTGGTACTACGAATGAGTTCGATGCTGTATCTTTATTAAACATTCG
+TAAGACTCGATTTTGTTCGGGAGATGTGCTGTCATTCGAGCATAAGTTGGTTTCTCATCT
+TTAAAATATTTTACCATGATTGAATTATCAAGGACATGCCAACAACTGAACTGATCACTG
+CTCTTTTGATAGATACCCGCTCTTATATAACTTCTCTAAACCGATCGCCGAGAAACGCCC
+GTTTTTCTGGTGTATTTATCAACTCCTGCAACGTTCCTTTTGATGGCATGATTTTCATTA
+AGGCGTAGGCTGACCCGACGGAATTAAGAGTCTCGCGCTTGGTGTGAATTTATTATTTTT
+ACATGTACCCAGTTCTGTTTGCCAATAATACTACCGATGTCCTCGATTCGTGATACCATC
+TCCACATGGCTTTATTATTTAAGACAGGAAACGCGGAAAAAATAGTACCCTTAGCGAAAA
+TAGTAAAACAATCATGATGTTTTAGCTTGTATTTCGCAATCAGCTAACACCAAAAACTAA
+CAAATATCATCAGCAAAAAGAACAAAACTCTTTCATTTTCTTATTCCTCTCGATGTTCGT
+CTGTTTCATCTTAGCAAACTCTCACCACAAATCGATAGTATCCTGGCTGTTGCGCTCCAC
+CATCGGGTTTATTGATGTCTTGGGAATAAATAGGGTTCTGCACAAGTACCATCCTGGTGG
+TAATTGAGTTGTTGGCCAATTTGTCTGTGGCAGGTAATCACTTGCTGTCTTTGTATCCAT
+CCCTGGATACTCGGGGAATCATCATCCTGTGGCGTACAAGTCAGATTTGGTTTTACCCAC
+TTCCTGCAATACAGTGTAGTCGTAAGGGCTTAATGCTCTGAAGAATGTTTGAAAACATTA
+GGCGAGGACTACTGGCGCTGGCTCAATAGGATATGGCAGTCTTAATTGTTTCGCGATGTC
+CGGCAATTTACTTGGGATCGCGTAGGCGGTTTGTTGGGTCTCGCTCCATATCCGCCATTA
+TTTAAGTGTCGCGCATTTTGATCCGCCAGTCCCATTGAATCTATATACTCGAACCGGATT
+CAGCGGATACTGATAAAATTCCATCCCCCTTCAGCCCAATTCGATCGATCCTGAGTGATA
+TACCTCCCCCCTGCAGCGGGTCATAATAGCGGTGGCGGTTGTAATACAGGCCGGACTCCT
+CATCGACTACCATGCTGCTGCCCCGGCAGGCGGATCAGCTAAGCTGCAGCATGATGCGGG
+TTCTCTTCATTCAGCAGGTTGCCCCATTCATCGTATTCTGCGCACCATTCTGTGCCGCCT
+TCCGTGCTGACAAGCGCCAGCGGCAGGCCGCGCAGTGATCGCAGTGGTCACAGGTGGATT
+TTCGCGCCGGCGTGTACACCGGGTCCATCTGGTTTTTGCATCTGCTCCACCGTCAGGCCG
+CACCGATGCCAGCCAGCGGCGGCTTTCCTCACTCACCCGATGTCAGTCAGGATTTCACTT
+TTCCAGCCGGTCGAGCATCTGCACCAGCACCGGCGGAACACCACACTGCCACCGTCTTCG
+CCGCCGGACTGCTGAAGGGTATCCGCCAGAGCGCTGCGGCGCTGCGTTTTTCGCCAGCTC
+ACCGGTGGCGGTTCGGACCCTGATGAGTGGCGTGAAGCTCCCCGGCTGATAAATCGTCTG
+GATGCGGGTTCTGTCGTTCTGTATCGTGGTCAGGCGGTCGCCGTCCCAGCCGTACCAGGT
+CACTTGCGGTTTCTCGTGACAGCGACATCCAGCCCGTCAGGTCCCGTTCACGTCGCCACA
+CCCGTTTTGCCACCCTGCGGCCCAGCGGGTCGTAAAGATACGCGGCTTTCGACCAGCGGC
+TCTGCATATTGTGTTGCTCGCGTGTAGTGCACCAGCCGGTGCTGACTGTCGTAATGGTAC
+CGGTGGGTGCGCTCATCATCCGTGCGGATAACCCCTTCGCGCGGATGAGGTCGGTTTCTC
+CGTCAGCCTGCCGTGACGGTCATACCCGGTAAAGATAGCGCGTCACGGGCGATACGGTTA
+TCCGGCCACATGCTGCTGAGGGTGCTGTCCGGGTGCAGCGCTCCGGGTCGGGCAGGCGGT
+TACCTGCCGGGTCTGTGGCATACGGGATATCAATGCCCAGAGTTACATATAATAATAAGA
+GCAATTAACTTAATTTTATTTGTTTATAATGCGCTTACTTAATACAAACCATTGAATATA
+CCCTCCTGACAGAAAATAAAGCGATATTATTATCGCCATAATATACTTACTATCAATCCT
+TACGCCAATAATGTCTGATACAGTCCCTATAAATATTAGAGCAATAAAGAATACTATGCC
+CTGTTGGAAAACATATTACCATCATTCCATAAGACATGAGACTAATTAACTCGCTCACAT
+CACGCAAGTGGAGTCTAATAGTGAAAGTCTATGCATGGAAAAGAATAGTATTAAAAGCGA
+TAAAGCCAGCCATATAGCTCTGAATAAAAAAATAATATTTCATTACATCACTCCGGTGAA
+TACAAATCTAATAAAACGTCCAATGTTATTTTCCGGAGCACTTCATGCTTACATGTTTCT
+AAAGAATCATTAGACCACGTCTTGGCAGTTTTTAAATCTAGCCCTAAATTTACTAGGTGT
+GAATATATCAGGCAATACAGAATAACGCGGCCTTACCTCTTTAAACTTCCCTTTTACACA
+GTTCTCCACACTACTATTATCGGTTTCAACGAGGTCACAACGGCCAGCAGCTTCTTTTTG
+TATCATTACTTGCTTTACCTGGCCCCCATAGACCATCTCCTTTTGATTCTCCCCGTTGGT
+CTTGGCCACCCAAGTATAGTCCCCTTTACCATCTGGGACACAAAGATATTGATGATAGAA
+CGGATTCCCCCATATATCTGACCGCTTCTTTCACCAGTTCCGCCCATTGAATGCAGTGGC
+TTAATGCATTTTTAGTGTTTCTAATCCTAATGGATCTATATTTGAGATCTGGATTCAACG
+GATACTGATAAAAATTCCATCCCACGCTTTCAGCCCAATCCGGATCCTGAGTAGTATATC
+GCCCCTGCAGCGGGTCATAATAGCGGTGGCGGTTGTAATACAGGCCGGACTCCTCATCAT
+ACTGCTGCCCCGGCAGGCGGATAAGCTGCATGCAGCTGATGCGGGTTCTCTTCATTCAGC
+AGGTTACCCCATTCATCGTATTCTGCGTACCACGCTGTTGTCGCTTCCGTGCTGATAAGC
+GGCCAGCGGCAGGCCGCGATGGTCTGCAGTGGTACAGGTGAATTTTTCGCGCCGGCGTGT
+ATACCGGGTCCATCTGGCTTTTGCATCTGCGCCACCGTCAGGCCGCACGATGCCAGCCAG
+CGCGGCTTTCCTCACTCACCCGGTCAGCCAGGATTTCACTTTTCCAGCCGGTCGAGAGCA
+TCTGCACCAGCACCGGCGGGAAACACCAGACTGCCACCGTCTTCGCCACCGGACTGCTGA
+AGGGTATCCGCCAGGCTGCGGCGCTGCGTTTTTCGCCAGCTCACCGGTGGCGGTTTCAAC
+CCTGATGAGTGGCGTGAAGCTCCCCGGCTGATAAAAATCGTCTGGATGCGGGTTCTGTCG
+TTCTGTATCGTGGTCAGGCGGTCGCCGTCCCAGCCGTACCAGGTCACTTGCGGTTTCCGT
+GACAGCGACATCCCGAGCCCGTCATTGGGTCCCGTTCACGCCGCCATACCCGTTTTTGCC
+ACCCTGCGGCCCAGCGGGTCGTAAAGATAGCGACTTTCGACCAGCGGCTCTGCATATTGT
+GTCCGCGTGTAGTGCACCAGCCGGTGCTGACTGTCGTAATGGTACCGGTGGGTGCGCTCA
+TCATCCGTGCGGATAACCCCTTCCGGGATGAGGTCGGTTTTCTCTGTCAGCCTGCCGTGA
+CGGTCATACCGGTAAAGATAGTGCGCGTCACGGGCGATACGGTTATCCGGCCACATGCTG
+AGGCGCTGTGCGGGTGCAGCTCCGGGTCCGGGCAGGCGGTTACCTGCCGGGTCTGTGGTA
+TACGGGATGCGGATATCCAGATTCGCTGCGGTGGTGTGAACGCCGGTCAGCCTGCCGGTG
+GTGCTGTAGCTGTAACTCCGGGTCTGGCGCGGGCTGCTGATGCGCGATGAGTTCGCCGTT
+GTCGTTACCAGGTGTAATCGCGGTCAGACAGCAGGCTGTTCAGGTGCTGGCTCTGTAACT
+GCCCGGCAGGGGTATAAGCGGTGGTGAGTTCATAACGGCCGAAGCTGCGCAGCGTTTCCC
+GGTGCAGGCGGTCGCGGGTGTACTCCACCAGCGGTGTGTCGCCCGAGTTTCATGCCTGAC
+AGCCAGCCGCTGCCGTAGGTCAGCCATTCCACGGCGGGCAGGCTGTTCCGGTATACAGCG
+GTTCGCCAGTCCCTGTGCGTTGTACGCATGTCTGGTCTCATGCTGCCAGAGCAGTTCATT
+CGTCTGCGGATGATGCACCGTCAGGTGTTCACTGGCGAGGCGGCCTTTAGCTGTCATAAC
+CATAGTGCACCGTCACCCGGTGCCCTTCGCTGATATGGCTGATGTCTGTCAGCCAGCCGC
+GTTTCCGTCATACTGCCACCGCTCTGCGGTTTCGCCATTCACGGTGCGGTGCGTGAGGCG
+GTCTGCTTCGTCATAGTGCCAGTGGGTGACCAGCCCCTCATCCTCGCTGCGGATAAGTTT
+GCCGGTCAGGTCGTGGTGATAACGCTGTGTGCGGCCGTCAAAGCCGGTTTCCTGTATCAG
+CCGGTCGAGTACATCGTAACGCGAAGGTGGTGTGGCTGCCGTTTTTCACTGGTCAGGCGG
+ATGACCCGTCCGGCAGCATCGGTATTCCATACTGCGCGTCAGACGCCCTGCGTGGTACAG
+ATGGCTTTTCCCCACGCATCGTACTGTGTCCCGTTTCTGCTGCCGTCCGGGGCAATGACG
+GTGGTCAGGTCACCCGGCGGCGTTGTATTCATACCGCGTTTCATGGCCCTGCGTGTCTTT
+CACGGCAATTAACTGTCCACGGCTGTCGTATGCGCGGTACTGACTCAGCCCTTCCTCGCG
+GTGCACCGCCGTCACCTGACCAAAACGGTCACTGGTCATAGCGGGTTACATAACCGGAAC
+AGTCAGTGAAGCTCAGCAACTGACCGTAACGGCTCCACGTCATGGTTTTCCGGCTGCCGG
+TGGCATCTTTCCCGTTGCGCAGGGTAAGTCACTGTGTGGATTATCATAACGGTAGCGGGT
+GATATCGCCGTCAGGGGCAGTTTCCTGAATCAGACGGCCCCATTCATCATATTCCCGGCG
+TATTTCCAGCCCGTCAGGCCCGGTGGCTGACGTTAACTGGCTGTGGTGGTTATAGTAAAA
+CGCCGATGCCCTGCCATCCGGCGTGGTGATGCGCGTGATGAGGCCCGTCACCACATCCGA
+GACTCGTATTCTGTTGTCCTGCCTGCGGCATCCGTCTGTGCCCTGAGCCTGCCCACCGCG
+TCAAACTGACTCTGCGTGACGCTGCCGTCCGCGTGTTCCTTTTCACCACCCGCTTCAGCC
+CGCCTTCACCCTGCGTGTGCAGGACTTCACGGCGGTTCAGAGCTGTCGGTGATGGTGATG
+CGGTCCTTCTCATACTGATACGTGTAACTTAAGCCTGCCGGGTTTAGCTGTTCTGTCACC
+CGCCCGTCGCTGTCGTAACGGTAACAGATTTCCGGTCGGCCCGTGTGACGGTGCGCCACC
+ATCCGGCCCCGGTATTTATCATCGTAAGTAAAGCTGCGCACCTGTGTATTGCTGCGGTCA
+TACACGCCGCCAGTTCGCCGCGGGGCGTCGAGGCCCATAGCGCACCAGCGGCGCGGCAGG
+TAAATTCTCCGGGTATTCCGGGTCGTGCGTCAGCCACACGGCAGACAGACGGATGCCGTT
+GTAGCGAGCCATATTCGGTGTAACCCGGCAGGGTATCAGGAAAGACTGGACGGTTCCGTC
+CCGCCGGAAATGGCCTGCTGCCGGGCTTCTTCTGCCCGCTGCGCCTGCGTGGTCAGTACC
+AGCCGGAAGTGACGCCCGGCACCATCCCGTCACGCCGGTGATTTCGCCGCTGAATTCACC
+GGCGGCTTCGCGGTGGAACGTCTGTGTGCGCCCGAAGCGGTCCACCCGAGCCCGGTCAGT
+ACCCGGTACGGCGGCAGCGGCGCAGGCAGCACCTCATCCGCTTCCCGGCACCCGCTCACA
+CCAGCCGAGCAGCCACCACGGCCCCTGCGGACTGTTTGTCGCCAGATAACGATGCGGACT
+TAAGCGGAGTTCTTCCGGCAGCGCCTGCCAGAGTGCGGCCAGCCGGTAGATCACTTCATC
+CAGTTTCGCCACGCCGCCGCGCACCAGCCACAGTGACTCGCTGCGGCTGTAACCGTCCTC
+ACCGGGAAACAGGTGCTCAAAATACAGGCTTCTGCCGCCGTTATCACTGAGTATCAGTGT
+GTTATCGCGCAGCTGTAAGCGAGGATATCCGCAGGCATTTTCCAGCCGGGGCCGAGGCTC
+CCCACCGGCGCGGGCTTTTGTCCGGTAACTGCTGTAGGTGCGGGAGAGAATGAACGGCAG
+CGGGCCGGGCAGGGCGATGTCGGTTTCACCGGGAAGGACCTTTGCACCGAGCAGCGGACT
+TGACCGGATGGCCGGACGTCACGCCCGCCGGCGCACGACGAACAGGCCACAGCCAGTCGG
+GGGCAGCGAGTGCGTACCCCGGCTGAACCCTGGACAATGCTACCGCCATACTGCGTCATG
+TCGCCCTGACGCGCCGCCCGATTTTCCGCTCATCTGCTCATCCTTGTTTTTATCGGGTTA
+TTTGTCTGCTGACAGGCGAAACCCTACAGATTTATAAGAAAGCCTTAAGTGAGATATCTG
+TCAGATAAGAACAATTAGGAAAATATTTATATATTTCATGAATATATGTTTCGATTGGTA
+TAACGATGTCTAAATATTCCTCTGAACATCTTCCTGATACAAAAACCGCCAGCGTTTCCG
+CTGGCGTTTTCTCAATGTGATTCAAAACTCAGCAATCAATAAAAATCACCAGTTGCCTTT
+TCGGCCTGATCCATCACAGCACCGGTTTATCGCTGGTTTTCGACCAGACGCGATGCAGGT
+AGCTGTAAAAGCGGGCGCGGTCTTTCCAGAAAAGCATGAAAGGCAAGCGCCAGAAACGCC
+CGCTGCAACCGCGCATAAGTACGGCGTAAAAAGATACAGCCATGCAGGATATTCTCTGTA
+GAGTTCCATACTTTTCTCCCCCTTTTGTATCTACCCGGTGAATGGCACCGGAAAAATGAA
+TTTGTTTATCTGATGAAAAAGTAGTACCGCCTTTTTGTGTAATTTTACTACTCATCCGAC
+CACTTATTTGTGCTTATTGATGGTTTATTTACATTCATCCTGTACATTCAAGTTACACAA
+AAGTTAAATTAATACTACAACATGTAGTTAAAATCATGGCTTTTGCCATTTTTATACTTT
+TTACACCCCGCCCGCAGATTTTGCGAAATCTTTGCGCAGCCGAGAATTCTACGGCCTTCC
+GGTATCACTTTTAGGCCACTGGAGGTGCACTGTGAGTGCAGGCGTGCTAACCGGCGTATT
+GCTGGTGTTTTTATTACTGGGTTATCTGGTTTATGCCCTGATCAATGCGGAGGCGTTCTG
+ATGGCTCGCGCAAGGAGCTTCTTACTGATCGCCACGTTTTTACTGGTGTTAATGGTGCTG
+GCGCGTCCTTTAGGCAGCGGGCTGAGCGCGGCTGATTAATGACATTCCTCTTCCCGGTAC
+AACGGGCGTTGAGCGCGTACTTTTTCGCGGACTTGGCGTCTCTGACCGTGAGATGAACTG
+GAAGCAATATCTTTGTGCCATTCTCGGCCTGAACATGCTGGGGCTGGCGGTGCTGTTTTT
+ATGTTGCTCGGTTCACACTAGTCTGCCGCTGTAATCTGGACACCAGCAGTTGCCGAGGGC
+TGTCGTGCGATGATCTGGCGCTGAATACCGCCGTCAGCTTTGTCACCAATACCAACTGGC
+AATCTTGTAGCGTGAAACCACGTTGAGCTACTTTTCAGCCAGATGGCGGGCTTAACGGTG
+CAAAACTTTCTTTCTGCCGCCAGCGGGATTGCGGTGATTTTTGCCCTCATCCGTGCGTTT
+ACCCGCCAGAGCATAGCAGCACGCTGCGGGAATGCCTGCGTACATCCTGCTACGCATCAC
+GTTATGGGTGCTAGTCCCTCGTGGCGTTGTTGATTGCACGTTTGTATTCAACAAGGTGCG
+CTGCAAAACTTTCTGCCTTATCAGGCTGTGAATAGCCGTTGAAGGCGCGCAACAGCTGTT
+ACCCATGGGGCCTGTAGCTTCTCAGGAAGCGATCAAGATGCTCGGTACTAACGGCGGTGG
+CTTCTTTAATGCCAACTCGTCGCATCCGTTTGAAAACCCCAACCGCACTGACCAACTTCG
+TGCAGATGCTGGCGATCTTCTTGATCCCAACGGCGCTGCCTTTGCCTTTGGTGAAGTGAT
+GGGCGATCGCCGCCAGGGGCGCATGTTGCTGTGGGCGATGTCAGTGATTTGTCATCTGCG
+TAGGCGTGGTGCGTGGTAAGAAGTTCAGGGTAATCCTCATCTGCTGGCACTGGGCACGGA
+CAGCAGCATCAATATGGAAGGTAAAAGAGCCGTTTGCGTGCTGGTCAGTAGCCTGTTTCG
+CGTCGTGACGGGCGGCTTCCTGTGGCGCGGTGATTGCGATGCATGATTCGTTTACCGCTC
+TGCGTGGCATGGTGCCGATGTGGCTGATGCAAATTGGTGAAAGGGTGTTCGGCGGTGTCG
+GTTCTGAGTCTTTACGCATGATGCTGTTTGTCCTGCTGGCGGTGTTTATTGCCGGGCTGA
+TGATTGGTCGTACACCGGAATATCTGGGTACAAAATCGACGTACGCGAGATGAAACTGAC
+TGCACTGGCAATTCTGGTTACCCCGACGCTGGTGCTGATGGGCGCGGCGTTGGCGATGAT
+GACCGACGCCGGACGGTGAGCGCCATGCTCAACCCTGGCCCGCACTGGTTTTAGCGAAGT
+GCTGTACGCCGGTGTCATACCCGCCGCTAACAACAACGGCAGCGCTTTGCCGGATCCCAG
+CGCCAACTCTCCGTTCTGGAACTGTTTACTGGCGTTCTGCATGTTTGTCGGTTGCTTCGG
+GTGATTATCCCGGTGATGGCAATTGCCGGTTCGCTGGTGAGAGCCAAGCCGCCAGCTCCG
+GCACATGCTGCCAACGCACGGCCCGCTGTTTGTTGGCCTGTTAATCGGCACCGTGTTGCT
+GGTTGGCGCACTGACCTTTATCCCTGCCCTGGCGCTTGGTCCCGTGGCGGAATACCTCTC
+CTGATGATATTGAGTGAGCACTGAATATGAGTCGTAAACAACTGGCGCTATTCGAACCAA
+CACTTGTCGTTCAGGCAGCTGAAAGAAGCGGTGAAAATTAAACCCGCAGGGCGCAATGGC
+GCAATCCGGTAGATGTTTATCGTCTGTATCGGCAGTCTGCTGACCACCTGTATTAGCATC
+GCGATGGCAAGCGGTGCGCAGTGCCCGGCAATGCGCTGTTTAGCGCGGCCGTTGGCTGTG
+GGTCTGCGATACTGTTAGCTAAGTTTGCCACCGCCGAGTGAGCGTGGCAGAAGGCCGCAG
+TAAAGCGCAGGCCAACAGTCTGAAAAAGGGGTGACTGCCTTTGCCCGCAAGCTGCGTGAG
+ACACGAGATATGGCGCTGCGGCGGACAAAGTTCCTTGCCGACCAACTTCGTAAAGGCGAT
+ATCGTACTGGTAGAAGCTGGCGATATTATCCCCTGCGATGGTGAAGTTATTGAAGGGGGT
+GCATCGGTCGATGAAAGCGCCAGCCCACCGAAACGGCAACCGTGTGTATCCGTGAATCGC
+GGCGGCGATTTGCCGCGTCACCACGGCGGCACGTAGCGTGATTCTGGACGCGAGCTGCCC
+GGTCATTGTAGCGGTATAGACGGCGAGACATGTCTGCATCGCGATCGACTCGCCGATGGT
+GGAAGTGCGCAGCTGAGGGGACTGAGAACGAATCGCCCTGACCATTCTGGTGGTACATCG
+CCCGTGACTATCGTCTTTGCTGGCAGCGCCACAGCGCGTGACGGTTTTCACGCTGTGCTG
+CGCGCGGTACTGCTGCAGTCAGCGTAACGGGTCACTGGTGGCGCTGCTGGTCTGTCTGAG
+CAACCACAGCAGATGCGCGGCCTGTTGTCATGTCCGGCGTCGCCGGGATGAGCCGGATGA
+CTAGGCGCGAATGTGATTGCCACCAGCGGACGGGCAGATTCGAGAGCGGCACGGCAGGTG
+ACGTTGACGGTCCTGCTACTGGATAAAGACCCGGGCACCATCACACTCGGTATAACCGTC
+AGGCGTCGGAGTTTATCGCGCGCGCAGGCGTGGGATGAAAACAGCGCTGGCTCGACGCTC
+GGATGACTGGCTTCGCTGAGCGGCGATCCGAAACGCCGGAAGGCCGCAGTATTGTGTGAT
+CCTCGCCAAGCAGCGTTTTAACCTGCGCGAGCGCGATGTGCAGTCGCTGAGGTTGCCACC
+TTTGTACCGTTTGATCTGCGCAAAGCCGGTCGAGCGCCGTAATCGACAACCTGACAACGA
+TGATCGCGTAAAGGTTCTGTCGATGCCATTCGTCGCCATGTTGAGTAGACGCTATTTCAG
+GTTCAAAGTCGATCCGATGCGCGTCAGGGAGCCACGCCGCTGGTGGTGGAAGGTTCTCGT
+GTGCTGGGCGTTATCGTGATGAAAGATATCGTCAAAGGCGGTATTAAAGAGCGCTTCGCC
+CAGCTGCGCAAAATGGAATTAAACGGTGATGATTACCGGCGATAACCGTCCTGACTGCCG
+CCGCGATTGCGGGCGCGGAAGACCGGTGCGTCGATGATTTTCTCGCCGAAGCGACACCGG
+AGGCCAAGCTGGCATTGATCCGTCAGTATCAGCGGCGGAAGGTCGTTTGGTAGCGATGAC
+CGGCGACGGCACCAACGATGCTCCGGCTGGCGCAGGCAGATGTCGCGTGGCGATGAACTC
+CGGCACCCAGGCGGCGAAAGAGGCGGTAATATGGTCGATCTCGACTCTAACCCGACCAAG
+TCCGATTTCGAGGTGGTGCACATTGGCAAACAGATGCTGATGACCCGTGAGCTCGCTGAC
+CACCTTCAGCATTGCCAACGGATGGCGAAGTACTTCGCGATTATTCGTATCGCGGCAACG
+GTTACGCAAATGCGCTGAACATCATGTGCCTGCATTCGCCCGACTCGGAAGCAATCCTCA
+TGCGGTGATTTTCGAACTCTACCCTGATTATCGTCTTTTGATTCCCCCGGGCGTTATAAA
+CCGCTTAGGTTAACGAGGTTCTGCCATGTTGCGCCGGGTAACTTGGATTTACGGTCTGGG
+TGGGCTGCTGCTGTTTTATCGCACCAAAGTCATTAAGGTGGTTCGAATCGTTTGCGGTCT
+GGTGTGAGTTTACCATGAGTGGATTACGTTCATTATCAACATTTATCTTCTGTTATTGAT
+TACTGGCGGCGTTTACCCGCTTCACGGTCACTGGGGCAATGGTGGTTTCCCTGGCAGGCC
+AATGGTTTCGTTGATTCGTGAATGTAAGCGGCGGTTCGGCATTAATCGGCAGAATTTGTC
+ACCGGCAACGGCTTTCATGGTCGCCCGTCGGCAACGGCAGAAATGCCCCGACCAGGTCCA
+GCAACAGAAG