annotate cmbuild.xml @ 6:ee4be6eadd34 draft

planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit ca2d37289d712b69ac15611bbf4961d083991bba
author bgruening
date Fri, 10 Nov 2017 13:04:44 -0500
parents 6e18e0b098cd
children
Ignore whitespace changes - Everywhere: Within whitespace: At end of lines:
rev   line source
5
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
1 <tool id="infernal_cmbuild" name="cmbuild" version="@VERSION@.0">
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
2 <description>Build covariance models from sequence alignments</description>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
3 <macros>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
4 <import>macros.xml</import>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
5 </macros>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
6 <parallelism method="multi" split_inputs="alignment_infile" split_mode="to_size" split_size="10" merge_outputs="cmfile_outfile"></parallelism>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
7 <expand macro="requirements" />
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
8 <expand macro="stdio" />
0
652f9d550531 Uploaded
bgruening
parents:
diff changeset
9 <command>
2
fac157e22e1b Uploaded
bgruening
parents: 0
diff changeset
10 <![CDATA[
5
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
11 cmbuild
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
12 -F
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
13 #if $is_summery_output:
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
14 -o '$summary_outfile'
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
15 #end if
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
16 ## to many outputs, is that one really needed?
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
17 ##-O $annotated_source_alignment_outfile
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
18 $model_construction_opts.model_construction_opts_selector
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
19 #if $model_construction_opts.model_construction_opts_selector == '--fast':
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
20 --symfrac $model_construction_opts.symfrac
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
21 #end if
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
22 $noss
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
23 $relative_weights_opts.relative_weights_opts_selector
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
24 #if $relative_weights_opts.relative_weights_opts_selector == '--wblosum':
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
25 --wid $relative_weights_opts.wid
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
26 #end if
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
27 --p7ere $controlling_filter_p7_hmm.p7ere
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
28 $controlling_filter_p7_hmm.p7ml
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
29 --EmN $controlling_filter_p7_hmm.EmN
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
30 --EvN $controlling_filter_p7_hmm.EvN
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
31 --ElfN $controlling_filter_p7_hmm.ElfN
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
32 --EgfN $controlling_filter_p7_hmm.EgfN
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
33 $effective_opts.effective_opts_selector
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
34 #if str($effective_opts.effective_opts_selector) == '--eent':
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
35 #if $effective_opts.ere
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
36 --ere $effective_opts.ere
0
652f9d550531 Uploaded
bgruening
parents:
diff changeset
37 #end if
5
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
38 #if $effective_opts.eminseq
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
39 --eminseq $effective_opts.eminseq
0
652f9d550531 Uploaded
bgruening
parents:
diff changeset
40 #end if
5
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
41 #if $effective_opts.ehmmre
0
652f9d550531 Uploaded
bgruening
parents:
diff changeset
42 --ehmmre $effective_opts.ehmmre
5
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
43 #end if
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
44 #if $effective_opts.eset
0
652f9d550531 Uploaded
bgruening
parents:
diff changeset
45 --eset $effective_opts.eset
652f9d550531 Uploaded
bgruening
parents:
diff changeset
46 #end if
5
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
47 #end if
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
48 #if str($refining_opts.refining_opts_selector) == '--refine':
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
49 #if $refining_opts.refine_output:
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
50 --refine '$refined_multiple_alignment_output'
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
51 #else:
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
52 --refine /dev/null
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
53 #end if
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
54 $refining_opts.l
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
55 $refining_opts.gibbs_opts.gibbs_opts_selector
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
56 #if str($refining_opts.gibbs_opts.gibbs_opts_selector) == '--gibbs':
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
57 --seed $refining_opts.gibbs_opts.random_seed
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
58 #end if
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
59 $refining_opts.notrunc
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
60 $refining_opts.cyk
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
61 #end if
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
62 '$cmfile_outfile'
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
63 '$alignment_infile'
0
652f9d550531 Uploaded
bgruening
parents:
diff changeset
64
652f9d550531 Uploaded
bgruening
parents:
diff changeset
65
5
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
66 #if $Calibrate.selector=="true"
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
67 && cmcalibrate
6
ee4be6eadd34 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit ca2d37289d712b69ac15611bbf4961d083991bba
bgruening
parents: 5
diff changeset
68 -L $Calibrate.L
5
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
69 #if $Calibrate.output_options_cond.selector == "extra"
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
70 #if str($Calibrate.output_options_cond.output_options) != 'None'
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
71 #for j in $Calibrate.output_options_cond.output_options.value:
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
72 --$j $getVar($j)
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
73 #end for
0
652f9d550531 Uploaded
bgruening
parents:
diff changeset
74 #end if
652f9d550531 Uploaded
bgruening
parents:
diff changeset
75 #end if
5
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
76 #if $Calibrate.cont_exp_tails_fits.selector == "top_n"
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
77 --gtailn $Calibrate.cont_exp_tails_fits.gtailn
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
78 --ltailn $Calibrate.cont_exp_tails_fits.ltailn
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
79 #elif $Calibrate.cont_exp_tails_fits.selector == "frac"
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
80 --tailp $Calibrate.cont_exp_tails_fits.tailp
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
81 #end if
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
82 --seed $Calibrate.add_opts.seed
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
83 --beta $Calibrate.add_opts.beta
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
84 $Calibrate.add_opts.nonbanded
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
85 $Calibrate.add_opts.nonull3
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
86 $Calibrate.add_opts.random
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
87 #if str($Calibrate.add_opts.gc) != 'None'
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
88 --gc '$Calibrate.add_opts.gc'
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
89 #end if
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
90 --cpu "\${GALAXY_SLOTS:-2}"
4
c47a7c52ac4f planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 236abfe2af8034017994daea08079887e64b68c8
bgruening
parents: 3
diff changeset
91 '$cmfile_outfile'
5
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
92 #end if
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
93
2
fac157e22e1b Uploaded
bgruening
parents: 0
diff changeset
94 ]]>
0
652f9d550531 Uploaded
bgruening
parents:
diff changeset
95 </command>
652f9d550531 Uploaded
bgruening
parents:
diff changeset
96 <inputs>
6
ee4be6eadd34 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit ca2d37289d712b69ac15611bbf4961d083991bba
bgruening
parents: 5
diff changeset
97 <param name="alignment_infile" type="data" format="stockholm" label="Sequence database"/>
0
652f9d550531 Uploaded
bgruening
parents:
diff changeset
98
652f9d550531 Uploaded
bgruening
parents:
diff changeset
99 <conditional name="model_construction_opts">
652f9d550531 Uploaded
bgruening
parents:
diff changeset
100 <param name="model_construction_opts_selector" type="select" label="These options control how consensus columns are defined in an alignment" help="">
652f9d550531 Uploaded
bgruening
parents:
diff changeset
101 <option value="--fast" selected="true">automatic (--fast)</option>
652f9d550531 Uploaded
bgruening
parents:
diff changeset
102 <option value="--hand">user defined (--hand)</option>
652f9d550531 Uploaded
bgruening
parents:
diff changeset
103 </param>
652f9d550531 Uploaded
bgruening
parents:
diff changeset
104 <when value="--fast">
3
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty
bgruening
parents: 2
diff changeset
105 <param name="symfrac" type="float" value="0.5"
0
652f9d550531 Uploaded
bgruening
parents:
diff changeset
106 label="Define the residue fraction threshold necessary to define a consensus (--symfrac)" help=""/>
652f9d550531 Uploaded
bgruening
parents:
diff changeset
107 </when>
652f9d550531 Uploaded
bgruening
parents:
diff changeset
108 <when value="--hand"/>
652f9d550531 Uploaded
bgruening
parents:
diff changeset
109 </conditional>
652f9d550531 Uploaded
bgruening
parents:
diff changeset
110
2
fac157e22e1b Uploaded
bgruening
parents: 0
diff changeset
111 <param name="noss" truevalue="--noss" falsevalue="" checked="False" type="boolean"
0
652f9d550531 Uploaded
bgruening
parents:
diff changeset
112 label="Ignore the secondary structure annotation, if any, in your multiple alignment file (--noss)" help=""/>
652f9d550531 Uploaded
bgruening
parents:
diff changeset
113
652f9d550531 Uploaded
bgruening
parents:
diff changeset
114 <conditional name="relative_weights_opts">
652f9d550531 Uploaded
bgruening
parents:
diff changeset
115 <param name="relative_weights_opts_selector" type="select" label="Options controlling relative weights" help="">
652f9d550531 Uploaded
bgruening
parents:
diff changeset
116 <option value="--wpb" selected="true">Henikoff (--wgb)</option>
652f9d550531 Uploaded
bgruening
parents:
diff changeset
117 <option value="--wgsc">Gerstein/Sonnhammer/Chothia (--wgsc)</option>
652f9d550531 Uploaded
bgruening
parents:
diff changeset
118 <option value="--wnone">no sequence weighting (--wnone)</option>
652f9d550531 Uploaded
bgruening
parents:
diff changeset
119 <option value="--wgiven">Sequence weight from given in input file (--wgiven)</option>
652f9d550531 Uploaded
bgruening
parents:
diff changeset
120 <option value="--wblosum">BLOSUM filtering algorithm (--wblosum)</option>
652f9d550531 Uploaded
bgruening
parents:
diff changeset
121 </param>
652f9d550531 Uploaded
bgruening
parents:
diff changeset
122 <when value="--wpb"/>
652f9d550531 Uploaded
bgruening
parents:
diff changeset
123 <when value="--wgsc"/>
652f9d550531 Uploaded
bgruening
parents:
diff changeset
124 <when value="--wnone"/>
652f9d550531 Uploaded
bgruening
parents:
diff changeset
125 <when value="--wgiven"/>
652f9d550531 Uploaded
bgruening
parents:
diff changeset
126 <when value="--wblosum">
3
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty
bgruening
parents: 2
diff changeset
127 <param name="wid" type="float" value="0.5"
0
652f9d550531 Uploaded
bgruening
parents:
diff changeset
128 label="Percent identity for clustering the alignment (--wid)" help=""/>
652f9d550531 Uploaded
bgruening
parents:
diff changeset
129 </when>
652f9d550531 Uploaded
bgruening
parents:
diff changeset
130 </conditional>
652f9d550531 Uploaded
bgruening
parents:
diff changeset
131
5
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
132 <section name="controlling_filter_p7_hmm" title="Controlling Filter P7 HMM construction" >
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
133 <param argument="--p7ere" type="float" value="0.38" label="For the filter p7 HMM, set minimum rel entropy/posn to" help="Set the target mean match state relative entropy for the filter p7 HMM"/>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
134 <param argument="--p7ml" type="boolean" truevalue="--p7ml" falsevalue="" checked="false" label="Define the filter p7 HMM as the ML p7 HMM" help="Use a mzimum likelihood p7 HMM built from the CM as the filter HMM"/>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
135 <param argument="--EmN" type="integer" value="200" label="Number of sampled seqs to use for p7 local MSV calibration" help=""/>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
136 <param argument="--EvN" type="integer" value="200" label="Number of sampled seqs to use for p7 local Vit calibration" help=""/>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
137 <param argument="--ElfN" type="integer" value="200" label="Number of sampled seqs to use for p7 local Fwd calibration" help=""/>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
138 <param argument="--EgfN" type="integer" value="200" label="Number of sampled seqs to use for p7 glocal Fwd calibration" help=""/>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
139 </section>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
140
0
652f9d550531 Uploaded
bgruening
parents:
diff changeset
141 <conditional name="effective_opts">
652f9d550531 Uploaded
bgruening
parents:
diff changeset
142 <param name="effective_opts_selector" type="select" label="Options controlling effective sequence number" help="">
4
c47a7c52ac4f planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 236abfe2af8034017994daea08079887e64b68c8
bgruening
parents: 3
diff changeset
143 <option value="--eent" >entropy weighting strategy (--eent)</option>
c47a7c52ac4f planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 236abfe2af8034017994daea08079887e64b68c8
bgruening
parents: 3
diff changeset
144 <option value="--enone" selected="true">Turn off the entropy weighting strategy (--enone)</option>
0
652f9d550531 Uploaded
bgruening
parents:
diff changeset
145 </param>
652f9d550531 Uploaded
bgruening
parents:
diff changeset
146 <when value="--enone"/>
652f9d550531 Uploaded
bgruening
parents:
diff changeset
147 <when value="--eent">
5
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
148 <param name="ere" type="float" value=""
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
149 label="Set the target mean match state relative entropy" help="(--ere)" optional="true"/>
0
652f9d550531 Uploaded
bgruening
parents:
diff changeset
150
3
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty
bgruening
parents: 2
diff changeset
151 <param name="eminseq" type="integer" value=""
5
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
152 label="Define the minimum allowed effective sequence number" help="(--eminseq)" optional="true"/>
0
652f9d550531 Uploaded
bgruening
parents:
diff changeset
153
3
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty
bgruening
parents: 2
diff changeset
154 <param name="ehmmre" type="float" value=""
5
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
155 label="Set the target HMM mean match state relative entropy" help="(--ehmmre)" optional="true"/>
0
652f9d550531 Uploaded
bgruening
parents:
diff changeset
156
3
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty
bgruening
parents: 2
diff changeset
157 <param name="eset" type="integer" value=""
5
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
158 label="Set the effective sequence number for entropy weighting" help="(--eset)" optional="true"/>
0
652f9d550531 Uploaded
bgruening
parents:
diff changeset
159 </when>
652f9d550531 Uploaded
bgruening
parents:
diff changeset
160 </conditional>
652f9d550531 Uploaded
bgruening
parents:
diff changeset
161
652f9d550531 Uploaded
bgruening
parents:
diff changeset
162 <conditional name="refining_opts">
652f9d550531 Uploaded
bgruening
parents:
diff changeset
163 <param name="refining_opts_selector" type="select" label="Options for refining the input alignment" help="">
5
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
164 <option value="--refine">refine the input alignment</option>
0
652f9d550531 Uploaded
bgruening
parents:
diff changeset
165 <option value="" selected="true">No refinement</option>
652f9d550531 Uploaded
bgruening
parents:
diff changeset
166 </param>
652f9d550531 Uploaded
bgruening
parents:
diff changeset
167 <when value=""/>
652f9d550531 Uploaded
bgruening
parents:
diff changeset
168 <when value="--refine">
652f9d550531 Uploaded
bgruening
parents:
diff changeset
169
652f9d550531 Uploaded
bgruening
parents:
diff changeset
170 <conditional name="gibbs_opts">
652f9d550531 Uploaded
bgruening
parents:
diff changeset
171 <param name="gibbs_opts_selector" type="select" label="refinement mode" help="">
652f9d550531 Uploaded
bgruening
parents:
diff changeset
172 <option value="" selected="true">expectation-maximization (EM)</option>
652f9d550531 Uploaded
bgruening
parents:
diff changeset
173 <option value="--gibbs">Gibbs sampling</option>
652f9d550531 Uploaded
bgruening
parents:
diff changeset
174 </param>
652f9d550531 Uploaded
bgruening
parents:
diff changeset
175 <when value=""/>
652f9d550531 Uploaded
bgruening
parents:
diff changeset
176 <when value="--gibbs">
652f9d550531 Uploaded
bgruening
parents:
diff changeset
177 <param name="random_seed" type="integer" value="0" label="Randam Seed" help="" />
652f9d550531 Uploaded
bgruening
parents:
diff changeset
178 </when>
652f9d550531 Uploaded
bgruening
parents:
diff changeset
179 </conditional>
652f9d550531 Uploaded
bgruening
parents:
diff changeset
180
2
fac157e22e1b Uploaded
bgruening
parents: 0
diff changeset
181 <param name="l" truevalue="-l" falsevalue="" checked="False" type="boolean"
0
652f9d550531 Uploaded
bgruening
parents:
diff changeset
182 label="Turn on the local alignment algorithm" help="... which allows the alignment to span two or more subsequences if necessary"/>
652f9d550531 Uploaded
bgruening
parents:
diff changeset
183
2
fac157e22e1b Uploaded
bgruening
parents: 0
diff changeset
184 <param name="notrunc" truevalue="--notrunc" falsevalue="" checked="False" type="boolean"
0
652f9d550531 Uploaded
bgruening
parents:
diff changeset
185 label="Turn off the truncated alignment algorithm" help=""/>
652f9d550531 Uploaded
bgruening
parents:
diff changeset
186
652f9d550531 Uploaded
bgruening
parents:
diff changeset
187 <param name="cyk" type="select" label="Options for refining the input alignment" help="">
652f9d550531 Uploaded
bgruening
parents:
diff changeset
188 <option value="" selected="true">optimal accuracy algorithm</option>
652f9d550531 Uploaded
bgruening
parents:
diff changeset
189 <option value="--cyk">align with the CYK algorithm</option>
652f9d550531 Uploaded
bgruening
parents:
diff changeset
190 </param>
652f9d550531 Uploaded
bgruening
parents:
diff changeset
191
2
fac157e22e1b Uploaded
bgruening
parents: 0
diff changeset
192 <param name="refine_output" truevalue="" falsevalue="" checked="False" type="boolean"
0
652f9d550531 Uploaded
bgruening
parents:
diff changeset
193 label="Output the refined alignment file as it is used to build the covariance model" help=""/>
652f9d550531 Uploaded
bgruening
parents:
diff changeset
194
652f9d550531 Uploaded
bgruening
parents:
diff changeset
195 </when>
652f9d550531 Uploaded
bgruening
parents:
diff changeset
196 </conditional>
652f9d550531 Uploaded
bgruening
parents:
diff changeset
197
2
fac157e22e1b Uploaded
bgruening
parents: 0
diff changeset
198 <param name="is_summery_output" truevalue="" falsevalue="" checked="False" type="boolean"
0
652f9d550531 Uploaded
bgruening
parents:
diff changeset
199 label="Output a summery file?" help=""/>
652f9d550531 Uploaded
bgruening
parents:
diff changeset
200
5
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
201 <!-- calibrate options -->
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
202 <conditional name="Calibrate">
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
203 <param name="selector" type="boolean" checked="true" label="Calibrate the covariance model"
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
204 help="A CM file must be calibrated with cmcalibrate before it can be used in cmsearch or cmscan. cmcalibrate is very slow. It takes a couple of hours to calibrate a single average sized CM on a single CPU"/>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
205 <when value="false"/>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
206 <when value="true">
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
207 <param argument="-L" type="float" value="1.6" min="0.01" max="160" label="Total length of random sequences to search" help="Set random seq length to search in Mb (megabases)"/>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
208 <conditional name="cont_exp_tails_fits" >
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
209 <param name="selector" type="select" label="Options controlling exponential tail fits">
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
210 <option value="top_n">Fit the top 'n' hits/Mb in thehistogram</option>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
211 <option value="frac">Fit a fraction of the histogram</option>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
212 </param>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
213 <when value="top_n">
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
214 <param argument="--gtailn" type="integer" value="250" min="0" label=" Fit the top 'n' hits/Mb in histogram for glocal modes" help=""/>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
215 <param argument="--ltailn" type="integer" value="750" min="0" label=" Fit the top 'n' hits/Mb in histogram for local modes" help=""/>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
216 </when>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
217 <when value="frac">
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
218 <param argument="--tailp" type="float" min="0" max="0.6" optional="true" label="Set fraction of histogram tail to fit to exp tail" help=""/>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
219 </when>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
220 </conditional>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
221 <conditional name="output_options_cond">
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
222 <param name="selector" type="select" label="Output extra files">
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
223 <option value="extra">Output extra files</option>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
224 <option value="none" selected="true">Don't output extra files</option>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
225 </param>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
226 <when value="extra">
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
227 <param name="output_options" type="select" label="Optional output files" multiple="true" display="checkboxes">
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
228 <option value="hfile">save fitted score histogram(s)</option>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
229 <option value="sfile">save survival plot </option>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
230 <option value="qqfile">save Q-Q plot for score histograms </option>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
231 <option value="ffile">save lambdas for different tail fit probs</option>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
232 <option value="xfile">save scores in fit tail</option>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
233 </param>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
234 </when>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
235 <when value="none"/>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
236 </conditional>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
237 <section name="add_opts" title="Additional Options">
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
238 <param argument="--seed" type="integer" value="181"
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
239 label="RNG seed" help="If the seed is nonzero, stochas-tic simulations will be reproducible. If 0, the random number generator is seeded arbitrarily"/>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
240 <param argument="--beta" type="float" value="1e-15"
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
241 label="Tail loss prob. for query dependent banding (QDB)" help="The beta parameter is the amount of probability mass excluded during band calculation, higher values of beta give greater speedups but sacrifice more accuracy than lower values."/>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
242 <param argument="--nonbanded" truevalue="--nonbanded" falsevalue="" checked="false" type="boolean"
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
243 label="Turn off QDB during E-value calibration" help="This will slow down calibration"/>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
244 <param argument="--nonull3" truevalue="--nonull3" falsevalue="" checked="false" type="boolean"
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
245 label="Turn off the null3 post hoc additional null model" help="This is not recommended unless you plan on using the same option to cmsearch and/or cmscan"/>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
246 <param argument="--random" truevalue="--random" falsevalue="" checked="false" type="boolean"
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
247 label="use GC content of random null background model of CM" help="Use the background null model of the CM to generate the random sequences, instead of the more realistic HMM. Unless the CM was built using the --null option to cmbuild, the background null model will be 25% each A, C, G and U"/>
6
ee4be6eadd34 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit ca2d37289d712b69ac15611bbf4961d083991bba
bgruening
parents: 5
diff changeset
248 <param argument="--gc" type="data" format="txt" optional="true" label="Use GC content distribution from file" help="Generate the random sequences using the nucleotide distribution from the sequence file"/>
5
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
249 </section>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
250 </when>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
251 </conditional>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
252
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
253
0
652f9d550531 Uploaded
bgruening
parents:
diff changeset
254 </inputs>
652f9d550531 Uploaded
bgruening
parents:
diff changeset
255 <outputs>
652f9d550531 Uploaded
bgruening
parents:
diff changeset
256 <data format="text" name="summary_outfile" label="cmbuild summary on ${on_string}">
652f9d550531 Uploaded
bgruening
parents:
diff changeset
257 <filter>is_summery_output is True</filter>
652f9d550531 Uploaded
bgruening
parents:
diff changeset
258 </data>
652f9d550531 Uploaded
bgruening
parents:
diff changeset
259 <!--<data format="stockholm" name="annotated_source_alignment_outfile" label="Annotated alignment from ${on_string}"/>-->
652f9d550531 Uploaded
bgruening
parents:
diff changeset
260 <data format="cm" name="cmfile_outfile" label="Covariance models from ${on_string}"/>
652f9d550531 Uploaded
bgruening
parents:
diff changeset
261
652f9d550531 Uploaded
bgruening
parents:
diff changeset
262 <data format="stockholm" name="refined_multiple_alignment_output" label="refined alignment file of ${on_string}">
652f9d550531 Uploaded
bgruening
parents:
diff changeset
263 <filter>
652f9d550531 Uploaded
bgruening
parents:
diff changeset
264 ((
652f9d550531 Uploaded
bgruening
parents:
diff changeset
265 refining_opts['refining_opts_selector'] == "--refine" and
652f9d550531 Uploaded
bgruening
parents:
diff changeset
266 refining_opts['refine_output'] is True
652f9d550531 Uploaded
bgruening
parents:
diff changeset
267 ))
652f9d550531 Uploaded
bgruening
parents:
diff changeset
268 </filter>
652f9d550531 Uploaded
bgruening
parents:
diff changeset
269 </data>
652f9d550531 Uploaded
bgruening
parents:
diff changeset
270
5
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
271 <!-- cmcalibrate additional output files -->
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
272 <data name="hfile" format="txt" label="hfile, an cmcalibrate additional output file, on ${on_string}">
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
273 <filter>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
274 ((
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
275 Calibrate['selector'] is True and
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
276 Calibrate['output_options_cond']['selector'] == "extra" and
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
277 'hfile' in Calibrate['output_options_cond']['output_options']
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
278 ))
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
279 </filter>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
280 </data>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
281 <data name="sfile" format="txt" label="sfile, an cmcalibrate additional output file, on ${on_string}">
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
282 <filter>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
283 ((
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
284 Calibrate['selector'] is True and
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
285 Calibrate['output_options_cond']['selector'] == "extra" and
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
286 'sfile' in Calibrate['output_options_cond']['output_options']
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
287 ))
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
288 </filter>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
289 </data>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
290 <data name="qqfile" format="txt" label="qqfile, an cmcalibrate additional output file, on ${on_string}">
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
291 <filter>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
292 ((
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
293 Calibrate['selector'] is True and
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
294 Calibrate['output_options_cond']['selector'] == "extra" and
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
295 'qqfile' in Calibrate['output_options_cond']['output_options']
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
296 ))
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
297 </filter>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
298 </data>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
299 <data name="ffile" format="txt" label="ffile, an cmcalibrate additional output file, on ${on_string}">
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
300 <filter>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
301 ((
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
302 Calibrate['selector'] is True and
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
303 Calibrate['output_options_cond']['selector'] == "extra" and
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
304 'ffile' in Calibrate['output_options_cond']['output_options']
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
305 ))
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
306 </filter>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
307 </data>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
308 <data name="xfile" format="txt" label="xfile, an cmcalibrate additional output file, on ${on_string}">
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
309 <filter>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
310 ((
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
311 Calibrate['selector'] is True and
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
312 Calibrate['output_options_cond']['selector'] == "extra" and
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
313 'xfile' in Calibrate['output_options_cond']['output_options']
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
314 ))
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
315 </filter>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
316 </data>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
317
0
652f9d550531 Uploaded
bgruening
parents:
diff changeset
318 </outputs>
5
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
319
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
320 <tests>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
321 <test>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
322 <param name="alignment_infile" value="cmbuild_input_tRNA5.sto"/>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
323 <conditional name="Calibrate">
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
324 <param name="selector" value="true"/>
6
ee4be6eadd34 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit ca2d37289d712b69ac15611bbf4961d083991bba
bgruening
parents: 5
diff changeset
325 <param name="L" value="0.1"/>
5
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
326 </conditional>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
327 <output name="outfile">
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
328 <assert_contents>
6
ee4be6eadd34 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit ca2d37289d712b69ac15611bbf4961d083991bba
bgruening
parents: 5
diff changeset
329 <has_text text="S 0 -1 0 1 4 0 1 89 109 -7.220 -8.465 -0.063 -4.919"/>
5
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
330 </assert_contents>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
331 </output>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
332 </test>
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
333 </tests>
0
652f9d550531 Uploaded
bgruening
parents:
diff changeset
334 <help>
2
fac157e22e1b Uploaded
bgruening
parents: 0
diff changeset
335 <![CDATA[
0
652f9d550531 Uploaded
bgruening
parents:
diff changeset
336
652f9d550531 Uploaded
bgruening
parents:
diff changeset
337 **What it does**
652f9d550531 Uploaded
bgruening
parents:
diff changeset
338
3
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty
bgruening
parents: 2
diff changeset
339 cmbuild belongs to the INFERNAL software package that allows you to make consensus RNA secondary structure profiles, and use them to search nucleic acid sequence databases for homologous RNAs, or to create new structure-based multiple sequence alignments.
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty
bgruening
parents: 2
diff changeset
340
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty
bgruening
parents: 2
diff changeset
341 cm build builds a covariance model of an RNA multiple alignment. cmbuild uses the consensus structure to determine the architecture of the CM.
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty
bgruening
parents: 2
diff changeset
342
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty
bgruening
parents: 2
diff changeset
343 **Input**
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty
bgruening
parents: 2
diff changeset
344
6
ee4be6eadd34 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit ca2d37289d712b69ac15611bbf4961d083991bba
bgruening
parents: 5
diff changeset
345 Input file is a multiple sequence alignment file in Stockholm format, and must contain consensus secondary structure annotation.
0
652f9d550531 Uploaded
bgruening
parents:
diff changeset
346 cmbuild uses the consensus structure to determine the architecture of the CM.
652f9d550531 Uploaded
bgruening
parents:
diff changeset
347
3
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty
bgruening
parents: 2
diff changeset
348 Example: simple example of a multiple RNA sequence alignment with secondary structure annotation
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty
bgruening
parents: 2
diff changeset
349
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty
bgruening
parents: 2
diff changeset
350 # STOCKHOLM 1.0
4
c47a7c52ac4f planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 236abfe2af8034017994daea08079887e64b68c8
bgruening
parents: 3
diff changeset
351
3
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty
bgruening
parents: 2
diff changeset
352 tRNA1 GCGGAUUUAGCUCAGUUGGG.AGAGCGCCAGACUGAAGAUCUGGAGGUCC
4
c47a7c52ac4f planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 236abfe2af8034017994daea08079887e64b68c8
bgruening
parents: 3
diff changeset
353
3
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty
bgruening
parents: 2
diff changeset
354 tRNA2 UCCGAUAUAGUGUAAC.GGCUAUCACAUCACGCUUUCACCGUGGAGA.CC
4
c47a7c52ac4f planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 236abfe2af8034017994daea08079887e64b68c8
bgruening
parents: 3
diff changeset
355
3
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty
bgruening
parents: 2
diff changeset
356 tRNA3 UCCGUGAUAGUUUAAU.GGUCAGAAUGGGCGCUUGUCGCGUGCCAGA.UC
4
c47a7c52ac4f planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 236abfe2af8034017994daea08079887e64b68c8
bgruening
parents: 3
diff changeset
357
3
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty
bgruening
parents: 2
diff changeset
358 tRNA4 GCUCGUAUGGCGCAGU.GGU.AGCGCAGCAGAUUGCAAAUCUGUUGGUCC
4
c47a7c52ac4f planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 236abfe2af8034017994daea08079887e64b68c8
bgruening
parents: 3
diff changeset
359
3
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty
bgruening
parents: 2
diff changeset
360 tRNA5 GGGCACAUGGCGCAGUUGGU.AGCGCGCUUCCCUUGCAAGGAAGAGGUCA
4
c47a7c52ac4f planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 236abfe2af8034017994daea08079887e64b68c8
bgruening
parents: 3
diff changeset
361
3
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty
bgruening
parents: 2
diff changeset
362 #=GC SS_cons <<<<<<<..<<<<.........>>>>.<<<<<.......>>>>>.....<
0
652f9d550531 Uploaded
bgruening
parents:
diff changeset
363
652f9d550531 Uploaded
bgruening
parents:
diff changeset
364
3
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty
bgruening
parents: 2
diff changeset
365 **Output**
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty
bgruening
parents: 2
diff changeset
366
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty
bgruening
parents: 2
diff changeset
367 The output of cmbuild contains information about the size of your input alignment (in aligned columns
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty
bgruening
parents: 2
diff changeset
368 and # of sequences), and about the size of the resulting model.
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty
bgruening
parents: 2
diff changeset
369
4
c47a7c52ac4f planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 236abfe2af8034017994daea08079887e64b68c8
bgruening
parents: 3
diff changeset
370 In addition to writing CM(s) to the output file, cmbuild also outputs a single line for each model created to stdout.
c47a7c52ac4f planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 236abfe2af8034017994daea08079887e64b68c8
bgruening
parents: 3
diff changeset
371 Each line has the following fields:
c47a7c52ac4f planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 236abfe2af8034017994daea08079887e64b68c8
bgruening
parents: 3
diff changeset
372 - aln: the index of the alignment used to build the CM
3
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty
bgruening
parents: 2
diff changeset
373 - idx: the index of the CM in the output file
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty
bgruening
parents: 2
diff changeset
374 - name: the name of the CM
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty
bgruening
parents: 2
diff changeset
375 - nseq: the number of sequences in the alignment used to build the CM
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty
bgruening
parents: 2
diff changeset
376 - eff nseq: the effective number of sequences used to build the model
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty
bgruening
parents: 2
diff changeset
377 - alen: the length of the alignment used to build the CM
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty
bgruening
parents: 2
diff changeset
378 - clen: the number of columns from the alignment defined as consensus (match) columns
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty
bgruening
parents: 2
diff changeset
379 - bps: the number of basepairs in the CM
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty
bgruening
parents: 2
diff changeset
380 - bifs: the number of bifurcations in the CM
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty
bgruening
parents: 2
diff changeset
381 - rel entropy: CM: the total relative entropy of the model divided by the number of consensus columns
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty
bgruening
parents: 2
diff changeset
382 - rel entropy: HMM: the total relative entropy of the model ignoring secondary structure divided by the number of consensus columns
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty
bgruening
parents: 2
diff changeset
383 - description: description of the model/alignment.
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty
bgruening
parents: 2
diff changeset
384
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty
bgruening
parents: 2
diff changeset
385
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty
bgruening
parents: 2
diff changeset
386 **Options controlling model construction**
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty
bgruening
parents: 2
diff changeset
387
0
652f9d550531 Uploaded
bgruening
parents:
diff changeset
388 These options control how consensus columns are defined in an alignment.
652f9d550531 Uploaded
bgruening
parents:
diff changeset
389
3
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty
bgruening
parents: 2
diff changeset
390 - *--fast*: Define consensus columns automatically as those that have a fraction >= symfrac of residues as opposed to gaps. (See below for the --symfrac option.) This is the default.
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty
bgruening
parents: 2
diff changeset
391 - *--hand*: Use reference coordinate annotation (#=GC RF line, in Stockholm) to determine which columns are consensus, and which are inserts. Any non-gap character indicates a consensus column. (For example, mark consensus columns with ”x”, and insert columns with ”.”.)
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty
bgruening
parents: 2
diff changeset
392 - *--symfrac*: Define the residue fraction threshold necessary to define a consensus column when not using --hand. The default is 0.5. The symbol fraction in each column is calculated after taking relative sequence weighting into account. Setting this to 0.0 means that every alignment column will be assigned as consensus, which may be useful in some cases. Setting it to 1.0 means that only columns that include 0 gaps will be assigned as consensus.
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty
bgruening
parents: 2
diff changeset
393 - *--noss*: Ignore the secondary structure annotation, if any, in MSA-Infile and build a CM with zero basepairs. This model will be similar to a profile HMM and the cmsearch and cmscan programs will use HMM algorithms which are faster than CM ones for this model. Additionally, a zero basepair model need not be calibrated with cmcalibrate prior to running cmsearch with it. The --noss option must be used if there is no secondary structure annotation in MSA-Infile.
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty
bgruening
parents: 2
diff changeset
394
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty
bgruening
parents: 2
diff changeset
395
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty
bgruening
parents: 2
diff changeset
396 **Options controlling relative weights**
0
652f9d550531 Uploaded
bgruening
parents:
diff changeset
397
652f9d550531 Uploaded
bgruening
parents:
diff changeset
398
3
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty
bgruening
parents: 2
diff changeset
399 cmbuild uses an ad hoc sequence weighting algorithm to downweight closely related sequences and upweight distantly related ones. This has the effect of making models less biased by uneven phylogenetic representation. For example, two identical sequences would typically each receive half the weight that one sequence would. These options control which algorithm gets used.
0
652f9d550531 Uploaded
bgruening
parents:
diff changeset
400
6
ee4be6eadd34 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit ca2d37289d712b69ac15611bbf4961d083991bba
bgruening
parents: 5
diff changeset
401 - *--wgb*: Use the Henikoff position-based sequence weighting scheme [Henikoff
ee4be6eadd34 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit ca2d37289d712b69ac15611bbf4961d083991bba
bgruening
parents: 5
diff changeset
402 and Henikoff, J. Mol. Biol. 243:574, 1994]. This is the default.
ee4be6eadd34 planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit ca2d37289d712b69ac15611bbf4961d083991bba
bgruening
parents: 5
diff changeset
403 - *--wgsc*: Use the Gerstein/Sonnhammer/Chothia weighting algorithm [Gerstein et al, J. Mol. Biol. 235:1067, 1994].
3
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty
bgruening
parents: 2
diff changeset
404 - *--wnone*: Turn sequence weighting off; e.g. explicitly set all sequence weights to 1.0.
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty
bgruening
parents: 2
diff changeset
405 - *--wgiven*: Use sequence weights as given in annotation in the input alignment file. If no weights were given, assume they are all 1.0. The default is to determine new sequence weights by the Gerstein/Sonnhammer/Chothia algorithm, ignoring any annotated weights.
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty
bgruening
parents: 2
diff changeset
406 - *--wblosum*: Use the BLOSUM filtering algorithm to weight the sequences, instead of the default GSC weighting. Cluster the sequences at a given percentage identity (see --wid); assign each cluster a total weight of 1.0, distributed equally amongst the members of that cluster.
0
652f9d550531 Uploaded
bgruening
parents:
diff changeset
407
652f9d550531 Uploaded
bgruening
parents:
diff changeset
408
3
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty
bgruening
parents: 2
diff changeset
409 **Options controlling effective sequence number**
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty
bgruening
parents: 2
diff changeset
410
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty
bgruening
parents: 2
diff changeset
411
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty
bgruening
parents: 2
diff changeset
412 After relative weights are determined, they are normalized to sum to a total effective sequence number, eff nseq. This number may be the actual number of sequences in the alignment, but it is almost always smaller than that. The default entropy weighting method (--eent) reduces the effective sequence number to reduce the information content (relative entropy, or average expected score on true homologs) per consensus position. The target relative entropy is controlled by a two-parameter function, where the two parameters are settable with --ere and --esigma.
0
652f9d550531 Uploaded
bgruening
parents:
diff changeset
413
3
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty
bgruening
parents: 2
diff changeset
414 - *--eent*: Use the entropy weighting strategy to determine the effective sequence number that gives a target mean match state relative entropy. This option is the default, and can be turned off with --enone. The default target mean match state relative entropy is 0.59 bits for models with at least 1 basepair and 0.38 bits for models with zero basepairs, but changed with --ere. The default of 0.59 or 0.38 bits is automatically changed if the total relative entropy of the model (summed match state relative entropy) is less than a cutoff, which is is 6.0 bits by default, but can be changed with the expert, undocumented --eX option. If you really want to play with that option, consult the source code.
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty
bgruening
parents: 2
diff changeset
415 - *--enone*: Turn off the entropy weighting strategy. The effective sequence number is just the number of sequences in the alignment.
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty
bgruening
parents: 2
diff changeset
416 - *--ere*: Set the target mean match state relative entropy. By default the target relative entropy per match position is 0.59 bits for models with at least 1 basepair and 0.38 for models with zero basepairs.
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty
bgruening
parents: 2
diff changeset
417 - *--eminseq*: Define the minimum allowed effective sequence number.
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty
bgruening
parents: 2
diff changeset
418 - *--ehmmre*: Set the target HMM mean match state relative entropy. Entropy for basepairing match states is calculated using marginalized basepair emission probabilities.
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty
bgruening
parents: 2
diff changeset
419 - *--eset*: Set the effective sequence number for entropy weighting.
0
652f9d550531 Uploaded
bgruening
parents:
diff changeset
420
3
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty
bgruening
parents: 2
diff changeset
421 **Options for refining the input alignment**
0
652f9d550531 Uploaded
bgruening
parents:
diff changeset
422
3
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty
bgruening
parents: 2
diff changeset
423 - *--refine*: Attempt to refine the alignment before building the CM using expectation-maximization (EM). A CM is first built from the initial alignment as usual. Then, the sequences in the alignment are realigned optimally (with the HMM banded CYK algorithm, optimal means optimal given the bands) to the CM, and a new CM is built from the resulting alignment. The sequences are then realigned to the new CM, and a new CM is built from that alignment. This is continued until convergence, specifically when the alignments for two successive iterations are not significantly different (the summed bit scores of all the sequences in the alignment changes less than 1% between two successive iterations).
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty
bgruening
parents: 2
diff changeset
424 - *Turn on the local alignment algorithm*: allows the alignment to span two or more subsequences if necessary (e.g. if the structures of the query model and target sequence are only partially shared), allowing certain large insertions and deletions in the structure to be penalized differently than normal indels. The default is to globally align the query model to the target sequences.
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty
bgruening
parents: 2
diff changeset
425 - *--gibbs sampling*: Modifies the behavior of --refine so Gibbs sampling is used instead of EM. The difference is that during the alignment stage the alignment is not necessarily optimal, instead an alignment (parsetree) for each sequences is sampled from the posterior distribution of alignments as determined by the Inside algorithm. Due to this sampling step --gibbs is non- deterministic, so different runs with the same alignment may yield different results. This is not true when --refine is used without the --gibbs option, in which case the final alignment and CM will always be the same. When --gibbs is enabled, the --seed "number" option can be used to seed the random number generator predictably, making the results reproducible. The goal of the --gibbs option is to help expert RNA alignment curators refine structural alignments by allowing them to observe alternative high scoring alignments.
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty
bgruening
parents: 2
diff changeset
426 - *--Random seed*: Seed the random number generator with an integer >= 0. This option can only be used in combination with --gibbs. If the given number is nonzero, stochastic sampling of alignments will be reproducible; the same command will give the same results. If the given number is 0, the random number generator is seeded arbitrarily, and stochastic samplings may vary from run to run of the same command. The default seed is 0.
5
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
427 - *--Turn off the truncated alignment algorithm*: With --refine, turn off the truncated alignment algorithm. There is more information on this in the cmalign manual page.
3
2c2c5e5e495b planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 9eeedfaf35c069d75014c5fb2e42046106bf813c-dirty
bgruening
parents: 2
diff changeset
428 - *--cyk algorithm*: With --refine, align with the CYK algorithm. By default the optimal accuracy algorithm is used. There is more information on this in the cmalign manual page.
0
652f9d550531 Uploaded
bgruening
parents:
diff changeset
429
5
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
430
0
652f9d550531 Uploaded
bgruening
parents:
diff changeset
431 For further questions please refere to the Infernal Userguide_.
652f9d550531 Uploaded
bgruening
parents:
diff changeset
432
5
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
433 .. _Userguide: http://eddylab.org/infernal/Userguide.pdf
0
652f9d550531 Uploaded
bgruening
parents:
diff changeset
434
2
fac157e22e1b Uploaded
bgruening
parents: 0
diff changeset
435 ]]>
0
652f9d550531 Uploaded
bgruening
parents:
diff changeset
436 </help>
5
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
437
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
438 <expand macro="citations" />
6e18e0b098cd planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/infernal commit 80c721dcfe02a2b8baf8e2c64b76cbcd71b23d86
bgruening
parents: 4
diff changeset
439
0
652f9d550531 Uploaded
bgruening
parents:
diff changeset
440 </tool>