comparison test-data/related_mitogenome.fasta @ 0:f6065bc6e428 draft default tip

"planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
author bgruening
date Sat, 29 May 2021 12:50:32 +0000
parents
children
comparison
equal deleted inserted replaced
-1:000000000000 0:f6065bc6e428
1 >MW539688.1 Theretra latreillii lucasii mitochondrion, complete genome
2 TTTGATTATTTTTAGTATATAAATTAATAGAATATTTATTCTTTCTTAAGTTTTCAAAACAAATGCTTTA
3 ACAAGCTCATTAATTAATTAAAGATTAATTTATCTCAGTATTTACTTAAAATAGGGTTTAATAAGAAATA
4 ACTAAAATATAAAATTGTTAAAATTTGTCCTGTAATAACATATGGGTTTTCTACAGGTCGAGCTCCAATT
5 CAAGTTAATAAAATAATTATAATAATAAAAAATCAAAATAATAATTGATTTAATGGATAAAATTGTAATC
6 CTTGGATTTTTTTGTTGAATGTAAAAGGTAAGATAATTAAAATTAAAATTGATATGACTAAAGCAATTAC
7 TCCTCCTAATTTATTGGGAATTGATCGTAAAATTGCATAAGCAAATAAAAAATATCATTCAGGTTGAATG
8 TGAATTGGAGTTACTAATGGGTTTGCAGGAATGAAATTATCAGGGTCTCCTAATAAATATGGATTAATTA
9 AAGTTAATATAGTTAGTAAAAAAATTAAAATAATAAATCCGATTAAATCTTTGAAAGTAAAAAATGGGTG
10 AAATGGGATTTTATCTAAATTTCTGTTAATTCCTAAGGGATTGTTAGATCCAGTTTGATGAAGAAATAAT
11 AAATGAATTATAGTTAATATTAAAATAATAAATGGTAGTAGAAAATGGAAAGTATAAAAACGAGTTAATG
12 TTGCATTATCTACTGCAAATCCTCCTCAGATTCAATTTACTAATATATTTCCTAAGTATGGAATTGCTGA
13 TAATAAATTAGTAATAACTGTTGCCCCTCAAAATGATATTTGTCCTCAAGGTAATACATATCCTATAAAT
14 GCTGTTGCTATTAATATAAATAAAATAATAACTCCTACTAATCATGTATATATTAAATTAAATGATTCAT
15 AATAAATACCTCGTCCAATATGAATGTAAATACAAATAAAAAAAAATGATGCTCCATTTGCGTGAAGAGT
16 TCGAATTATTCAGCCATAATTTACATTTCGACAAATGTAATTTACTCTGTAAAAAGCTATTTCAATATTA
17 GCTGTATAATATATAGTTAAAAATAATCCTGTTAAAATTTGGATTATTAAACATAAAGCAAGGAGAGATC
18 CAAAATTTCATCAAATTGAAATGTTTGATGGGGTGGGTAAATCAATTAGGGATCCATTAATAATTTTTAA
19 AATTGGGTGAGTTTTTCGAATTGGTTTGAATATATTTATCATTAATTTCTAAAGATTCGTAATGGCCCAT
20 AAAAAATATTAGTAATTTTAACAATTGCAATTAGTGTAATAAATAAATAAATAATTAATAGTAATATTAA
21 TATTGAAAAATTATTATTATATAATTTATTTAAATTAATTTTATTTTCATTATTAAAAAATATAAAATTT
22 AATAAGTTGTTTATTTCTGAGTTATTAATTAAATTTATTCAATTTAGATTTTTATAAAATAAAAATTGAA
23 TTATAATTATTAAAATTAATAATGATATGAGAATAATTTTTATTTTATTTGATAAGGAAAATATTTCATT
24 TGATGCAATACTTGAAACATAAATAAATAAAACTAATAATCCTCCTAAAAAAGTTAAAAAAAGAATATAA
25 GAGAATCAATAGGTTTTAATTAATATTCCTGATAATAAACATGTTATTAATGTTTGAATTAAAATTAATA
26 TTCCTATTGATAATGGGTGGTTTAAAAAATATATTATTATTGATATAAAAATAATGAGTATAGATAAATT
27 TAATTTTATCATTTATAATCAAAAAATAGTTTATTAAAATAATAATTTTGGAGATTATAGATAAAGAATT
28 TTCTTTTTTTTTGAGTTTTTAAAGATATTTCTTAATTTTGATTTACAAGACCAATGTTTTTTTTTAAACT
29 ATAAAAACTAAATTAATGATAATTTTAAATATATGATTTATTTTTATTTTAATATTTTTTATTGGGAATT
30 TGATTTTTGTTTCAAAAAATAAGCATTTATTAATTGTTTTATTAAGATTAGAATTTATTGTTTTAAGAAT
31 TTTTTTTTTTTTTTTAGTATTTTTAATAATAATTGATTATGATATATATATATTAATGGTATTTTTAGTT
32 TTTTCTGTTTGTGAAGGTTCATTAGGGTTATCTATTTTAGTTTCTATAATTCGAACTCATGGTAATGATT
33 ATTTTCAAAGATTTAATTTAATTTAAAAATGATAAAAATTTTATTTTATATAATTTTTATAATTCCTTTA
34 TGTTTTATAAAGAAAATATTTTGAATGGTTCAAATATTATTATTAATATTAATATTTATTTATATAAATT
35 TATCAGTAAGTTTGATTAGTTGTAATTTAAGTTATATATATTCTTGTGATTTAATTTCTTTTGGGTTGAT
36 TTTATTAAGAATTTGGATTTGTTCTTTGATAATTATATCTAGAGAAAATTTATTTAAAATAAATTATTAT
37 GTTAATTTTTTTTTATTAAATATTATAATTTTAATAATTTTATTATTTTTAACTTTTAGAGTAATAAATT
38 TATTCATATTTTATTTATTTTTTGAGGGTAGATTAATTCCTACATTGTTATTAATTATTGGGTGGGGGTA
39 TCAACCTGAACGGATTCAAGCTGGAATATATTTAATATTTTATACTTTATTTGCTTCATTACCATTATTA
40 ATAGGGTTATTTTATATTTATATAGAAATTAATAGAATAGTATTTTATTTTTTAAAATTTTTTAATATAA
41 ATTTTATTTTATTATATATTAGAATAGTTTTAGCTTTTTTAGTAAAAATACCTATATATTTTGTTCATTT
42 ATGGCTTCCTAAAGCTCATGTAGAAGCTCCTGTATCAGGGTCTATAATTTTAGCTGGGATTATATTAAAG
43 TTAGGAGGTTATGGGTTATTGCGAGTTTTAATTTTTTTACAAGAAATTAATTTAAAATTAAATTATATGT
44 GAATTATTATTAGATTATTGGGGGGTTTTTATATTAGTCTAAAATGTTTTTGTCAAGTAGATATTAAATC
45 ATTAATTGCTTATTCTTCAGTTTCTCATATAAGAATTGTAATTAGAGGGATTATAGTAATAAATTATTGA
46 GGATATTTTGGTGCATATATTATAATAATTGGTCATGGGTTATGTTCTTCAGGGATATTTTGTCTCGCTA
47 ATATTAATTATGAACGATTACATAGACGAAGATTATTTATTAATAAGGGTATGATAAATTTTATACCTTC
48 AATAAGATTGTGATGATTTTTATTAATGTCTTCAAATATATCAGCTCCTCCATCTTTAAATTTATTAGGG
49 GAAATTAGTTTAATTAATAGAATAATAAGATGATCTTGAATATCAATAATAATATTAATATTAATTTCTT
50 TTTTTAGAGCTGGGTATAGATTATATTTATATTCTTATATTCAACATGGTAAGATTTTTCAAGGGGTATA
51 TAGATTTTATTGTGGTGTTTCTCGTGAATATTTATTATTATTATTACATTGATTACCTTTAAATATTATA
52 ATTTTAAAAATTGAATATTTAATAATTTAATAAAATTTAAATAATTTAATTAAAATATTGATTTGTGGAA
53 TCAAATATATGATATAGTATCATTTTAAATTATTAATAAAAATAATTTTTGTTTTTTTGTTTTTTTGTTT
54 TTGTTTTTTTTTAGAATAATAAATTTATTTTTGATAATTTATTTTATTATAAATAATATTGTATTTTTTT
55 TTGAGTGGGAAATTATTTCTTTTAATTCTGTGAGAGTTGTTATATCTATTTTATTAGATTGAATATCTTT
56 AATATTTATGATGTTTGTTTTAATAATTTCTTCTGTTGTTATTTATTATAGAAAAAGTTATATAAGATCA
57 GAGTTAAATTTATTTCGTTTTATTATTTTAGTTATATTATTTGTATTTTCTATAGTTTTATTAATTATTA
58 GACCTAATATTATTAGAATTTTATTAGGTTGAGATGGTTTGGGGTTAGTTTCATATTGTTTAGTTATTTA
59 TTATCAAAATTTAAAATCTTATAATGCTGGAATATTAACAGTTTTATCAAATCGAATTGGTGATGTAATA
60 ATTTTAATAGTTATTTCTTGAATATTAAATTATGGGGGTTGAAATTATATTTTTTATTTAGATTTTATAT
61 TAAATGATATATTAATGGAAATTATTAGATTAATAATTATTTTTGCTGCTATAACAAAAAGAGCTCAAAT
62 TCCTTTTAGTTCTTGATTACCTGCAGCTATAGCTGCTCCTACTCCAGTATCTGCTTTAGTTCATTCTTCT
63 ACTTTAGTGACTGCTGGGGTTTATTTATTAATTCGGTTTAATTTAATAATTTTAAATACTTTTTTTATTA
64 AAATTTTATTGTTATTAGGTATAATGACTATGTTTATAGCTGGGATTTCTGCTAATTATGAGTTTGATTT
65 AAAGAAAATTATTGCTTTATCTACTTTAAGACAATTAGGTTTAATAATAAGAATTTTAAGAATAGGTTTT
66 CCTGATTTAGCATTTTTTCATTTGTTAACTCATGCTATATTTAAAGCTTTGTTATTTATATGTGCTGGGG
67 TTATTATTCATATAATAAATGATATTCAAGATATTCGTTATATAGGGGGTATAAGAATATATTTACCTTT
68 AACTTCATTATGTTTAAATATTTCTAATTTAGCTTTATGTGGGATTCCTTTTTTAGCTGGGTTTTATTCT
69 AAGGATTTAATTTTAGAGATAGTAAGTTTTAGAAATTTAAATATATTTGTTTTTTTTTTTTATTATGTTT
70 CTACTGGTTTAACTATATATTATACTATTCGTTTATTAATGTATTTAATAATTAATGATTATAATTTATT
71 ATGTGTTTATAATTTATATGATGAGGATTATGTAATATTAAATAGAATATTTTTATTATTATTTATAAGA
72 GTAATTAGAGGGAGTATGTTAAGATGATTTATTTTTTATTATCCATATATAATTTATTTACCTTATAATT
73 TAAAAATAATAGTTATTTATGTAAGATTGTTTGGTGGTTTAATAGGGTTTTTAGTTAGAAATATAAATAT
74 TTATAGATTAAATAAATTTTTAATATCTTATAGTTTAAGAAGATTTTTATGTTTAATGTGATTTATACCT
75 AGTTTATCAACTTATGGTGTGAGATATTATTTTTTAAATTATGGTCAAAATTTATTAAAAATTGTAGATA
76 TAGGTTGAAGAGAAATATATAGTGGTCAGGGAATAGTAAAAATTATTAAAAAATATTCTATTTTTTATAG
77 AGTATTTCAAATAAATAATTTAAAAATTTATTTATTTAGATTTATTTTATGGATAATAATTTATATTTAT
78 ATATTATTTATAAATATTTATTTAAATAGCTTATAATTAGAGTGTAATATTGAAGATATTAAGGAGATTG
79 ATTTAATCTTTAAATATTTATAAAAAAAAGTTTTTTATTTTTACAATGAAAATGTAATGTTTTATTAATA
80 AACTATATAAATATAAAAAAAAGAAATATTAATGGAATTAAACCACTAAAAATTAAGTTAGCAGCTTAAT
81 TTTAATTATTATATTTCTTTAATTGGAATATAAAATTCAATTTTATCATTAACAGTGATATACCTCTATT
82 TTGGTTTCAATTAAATAAATAAGGAGTAAAATAACTCTTATTTTTAAGTCGAAATTAAATGCAAAATTTT
83 GCTTCTTATTTTAAGATAAATTAATAAAATTAATATTTTTTGATTGCAAATCAAATGTTTTAAATAAACT
84 ATAATCCTAATTAGTTCAATTTAATATATTTTGGTTTCATTCATGATATAATCCTAATAATAAGATAATG
85 ATAAAAAAAAATCTAATTTTTATTCATCTAAAAAAATTTACTATTTTAAAAGTAAAAATAATAGGAAAAA
86 TTAAAGCAATTTCTACATCAAAGATTAAGAAGATTACTGTAATTAAAAAAAAATGTAATGAAAATGGGAT
87 TCGTGCTGATGATTTAGGGTCAAATCCACATTCAAATGGTGAACATTTTTCTCGGTCTATAAAGGATTTT
88 TTTGATAGAATAATTGATAAAAATATTATAATATTAGAAATTATAATGATTATAAGTGTAATAGTTAATG
89 TTAAAGTAATTATTTATATTAAATTTGAATTAAACTTTTTGATTGGAAATCAAATATACTAAATATATTA
90 TATAAATAATTAATTTCCTCATCAGTAAATTGAAATATATAGGAATAATCATACAACATCTACAAAGTGT
91 CAGTATCAGGCTGCTGCTTCAAATCCGAAATGATGATTTCTTGAAAAATGTTTATTTAATTGTCGAATGA
92 AACAAATAATTAAAAAAAGAGTTCCAATAATTACATGGAGACCATGAAATCCTGTTGCTATAAAAAATGT
93 AGATCCGTAAATTCTATCAGAAATAGAGAATGGAGCTTCAATATATTCATATGCTTGTAAAATAGTGAAG
94 TAAATTCCTAATGAAATTGTTAAAAATAAACTTTGAATAACTTGGGTATAATTATTTTCTATTAGTGAGT
95 GATGAGCTCAAGTAACAGTTATTCCTGATCTAATTAAAATAATAGTATTTAATAGGGGAATTTGAAAAGG
96 ATTAAATGGAAAAATTCTTATTGGTGGTCAAATAGCACCAATTTCAATATTTGGTGATAAGCTTCTATGA
97 AAAAAAGCTCAAAAAAAAGAAATAAAAAATAAAATTTCTGAAACAATAAATAAAATTATACCTCATTGTA
98 ATCCTTTAGTTACTAAAATTGTGTGTTTACCTTGAAATGTTCCTTCTCGACAAACATCTCGTCATCATTG
99 ATAAAAAGTTAAAATTGTAATAATATATCCTAAAATTAATAGATTTATATTAAAGTTGTGAAATCATTTT
100 ATTATTCCGGTTACTAATGTTAATACTCCAATTGATCCAGTTAAAGGTCAAGGGCTATAATCTACTAAAT
101 GATATGGGTGATAGTTGAAATTATTTTTCATTAATTAACTTCTCTAGAATATAATGTTCTTAAAATAGCA
102 ATTACATAAGATTGAATTACTGCTACTGCAGATTCTAAAATTAAAAGAAGAATTTGAATTAAAATTAAAA
103 TTATAATAAAAATATAAGATAGATTATTTCCTGTTCTTCTTAGTAATGTTATTAATAGATGTCCTGCAAT
104 TATATTAGCTGTTAATCGAACAGCTAAAGTTCCAGGACGAATAATATTACTAATAGTTTCAATTAATACT
105 ATAAATGGTATTAATACTGTTGGTGTTCCTTGGGGGATTATATGTGAAAATATATGTTGATAATTATTAA
106 TTCAACCATATAATATAAATCTTAATCATAAAGGTAATGATATTGATAATGTTAGAGTTAAGTGTCTTGT
107 TCTAGTAAAAATATATGGAAATAATCCTAAAAAATTATTAAATAAAATAAAAGAGAATAAGGAAATAAAA
108 ATAAAAGTTGATCCACTAAAATAGTTATTTTTTAATAAGGTTTTAAATTCATTGTGTAGTGTATTTAAAA
109 TGAAGTTTCAAATTATATAATGTCGATTAGGGATTAATCAAAATGAATAAGGAATAAATATTAATCCTAA
110 AAAAGTTCTAATTCAATTAATTGGTAAATTAAGTAGATTTGTTGAAGGGTCAAAAATTGAAAATAAGTTA
111 CTTATCATTTTCAAATTAAATTATTTTTAGGTTTTATATTAATTATGTTATTTTTTATATTATTTGAATT
112 ATAATAAATATAATAATTTATAATATTAAAAATAATAAAAATAATAATAAAAAAAATTAAAGATAGAATT
113 CAATTAATAGGTATTATTTGAGGGATAAAAGAATATTACTTATGTAATAATTTAAATTTGACATATTTAT
114 GTTATAAATTAACTAATTCTTTTCATTAGAAGTAGTTGCTAATTTACTATTAAGTGGTTTAAGAGACCAA
115 TACTTGCTTTCAGTCATCTAATGAAGAATAATTATTAATTCAATTAATAAAATTTTTTATTGAAATTCTT
116 TCGATAACAATTGGTATAAATCTATGATTTGCTCCACAAATTTCAGAACATTGTCCGTAATAAATTCCAG
117 GACGATTAATAAAAAAATTAGTTTGATTTAATCGTCCAGGATTAGCATCTACTTTTACTCCTAGAGAAGG
118 AATAGTTCATGAATGAATTACATCAGTTGCGGTTACTATAATTCGAATTTGATTATTTATTGGTAAAATA
119 ATTCGATTATCAACATCTAATAGTCGAAAATTATTTGAATTTAGTTCATTTGAAGGGATTATATAAGAAT
120 CAAATTCAATATTATGGAAATCTGAGTATTCATATCTTCAATACCATTGATGACCAATAGATTTTAGTGT
121 AATTAATGGGTTATTTAATTCATCTAATAAATATAATAATCGTAGTGAAGGTAATGCAATAAAAATTAAT
122 GTAATAGCAGGTAAGATAGTTCAAATTATTTCAATTATTTGACCTTCTAATAAAAATCGATTAATATATT
123 TATTAAAAAATAAATTTAATATTAAATATCCTACTAAAATAGTAATTATAATTAAAATAATTAAAGTATG
124 ATCGTGGAAAAAGATGATTTGTTCTATTAATGGTGATGTTCCATTTTGTAAATTTAAATTAGATCAGGTT
125 GCCATTTCTAAAAAAAGGATAATCCTTTATAAATGGGGTTTAAATCCATTACATATAATCTGCCATATTA
126 GAAATTTCTTAAAATTGGGAGTTCATTATAAGAATGTTCGGCAGGTGGAAGATTTTGGTATCATTCAATT
127 GATGAAGGTATGTTTAATGGAAATAGTGCAATTCGTTGATAAATTATTGATTCTCAAATAATAATTAATA
128 TTATTATTACAGCTAATAGTGAGATATAAGATCCTAAAGATGAAATTAAATTTCAAGAAGTGTAAGAATC
129 TGGATAATCTGAATATCGTCGAGGTATACCTGCTAACCCTAAAAAATGTTGGGGAAAGAAAGTTAAATTT
130 ACTCCTAAGAATATAATAAAAAATTGAATTTTTAATAAATAAGGGTTTAAAGATAGACCTGAAAATAAAG
131 GATATCAGTGAATAAATCCTCCTATAATAGCAAATACAGCTCCTATAGATAAAACATAATGAAAATGTGC
132 AACGACATAATAAGTATCATGTAAAGTAATATCAATTGATGAGTTAGCTAAAATAACTCCTGTTAATCCT
133 CCAACAGTAAATAAAAATACAAATCCTAATCTTCATAAAATTGAAGGTCTGTAATTAATTTGAGTTCCGT
134 GAAGAGTTGCTATTCAACTAAAAATTTTAATTCCTGTTGGAACGGCAATAATTATAGTTGCTGAAGTAAA
135 GTAAGCTCGTGTATCAATATCTATTCCTACTGTAAATATATGATGAGCTCAAACAATAAATCCCAATAAA
136 CCAATTGCTATTATAGCATAAATTATTCCTAAACATCCGAATGTTTCTTTTTTAGTTCTTTCTTGTGAAA
137 TAATATGGGAAATTATACCAAATCCTGGTAAAATTAAAATATAAACTTCTGGATGACCGAAAAATCAAAA
138 TAAATGTTGATATAAAATAGGGTCTCCTCCTCCAGCAGGATCAAAAAATGATGTATTAAGATTTCGGTCA
139 GTTAATAATATTGTAATTGCTCCAGCTAATACTGGTAAAGATAGAAGTAATAAAAATGCTGTAATACCAA
140 CAGCTCACACAAATAATGGTATTTGATCAAATGATAAACTATTAATTTTTATATTAATAATTGTGGTAAT
141 AAAATTAATAGCTCCTATAATTGAGGAAATTCCAGCTAAGTGAAGAGAAAAAATAGCTAGATCTACTGAA
142 CTTCCACTATGAGCAATATTAGAAGAAAGAGGGGGGTAAACTGTTCAACCAGTTCCTGCTCCGTTTTCAA
143 CAATACTTCTAGAAATTAGAAGAGTTAAAGATGGGGGGAGAAGTCAAAATCTTATATTATTTATTCGTGG
144 AAATGCTATATCAGGTGCTCCTAATATTAAAGGAACTAATCAATTACCAAATCCTCCAATTATGATTGGT
145 ATTACTATAAAAAAAATTATAATAAATGCATGAGCTGTAACAATTGTATTATAAATTTGATCATCTCCAA
146 TTAAAGATCCGGGGGTTCCTAATTCTGCTCGAATTAATAATCTTAATGAAGTTCCTACTATTCCTGCTCA
147 AATTCCAAAAATAAAGTATAATGTTCCAATATCTTTATGATTTGTGGAGTAAAGTCATTTTCGCTTGAAA
148 ATAAAATGGCTGAGTTAAAAGCGATAAATTGTAAATTTATTTACGAGAAATATTCTCTTTTATTAAGTCT
149 TATATTCAATAATGATATAAAATTGCAAATTTTAAGGGGTAAATTATTTACTAAGGCTTAAAGAATATTT
150 CTTTATATATAATTTTGAAGATTATTAGTTTATTTAACTTAAAACCTTATATAAATAAAAAAGTTCTAAA
151 AATTATTCCTATAATGGAAATTATTGAAAAAAAATTAATTAAATTTATTAATTTATTTTTAAAATTAATT
152 TTAAATCATTTTATTTTAAAGTAATTGAATATAAATGATGAATAAATAATTCGAATATAAAAATAAATAG
153 TAATTAATCTTCTTATAATTATAATAAATGTTAAAAAATAAAATTTATTTATTATTAAAAAATTAATAAT
154 AATTCATTTTGGTAAAAATCCTAAAAAAGGTGGTAATCCACCTAATGATAAGAAATTAATTAATAAATTT
155 AATTTAATTATAAAATTTATATTATTAATAAATAGTTGATTAATGAAAAATATATTTAAATTGTAAAATA
156 AAAAAAATATAATTCTAATTAAAAATGAGTATATTAAAAAATAAAATATTCATAAATTTTCTCTAATTAA
157 TAAGGTAAAAATTATTCAACCTAAATTATTAATTGAGGAAAATGCTATTAGTTTTCGTAAAGAAGTTTGA
158 TTTAATCCTCCAATAGCTCCGGTTATTACATTTATAATAATGATAAAATATAAAAAATTAAAATTTAAAT
159 AATAAGAAAGTAAAATTAATGGGGTAATTTTTTGTCAAGTTATTAAAATAAAGTTATTAAATCATGATAA
160 TCCTTCTGAAATATTAGGGAATCAAAAATGGAATGGGGTTGAACCTATTTTTATTAATAATGATGAATTG
161 ATTATAATTGATATAAAATTATTTATTTCAAAATTTTTTATTAAAATTATTTTTAATAGAATTGAAAATA
162 AAAAATTTATTGATGCAATAGATTGGGTAAGAAAATATTTTAATGAAGCTTCAGAAGCTAATAAATTATT
163 TGAATTAGAAATTAGGGGGATAAAACTTAATAAATTAATTTCTAAACCAATTCAACACCCAAATCAAGAA
164 TTTGAAGAAATTGAAATTATAGTTCTAAAAAATAAAATAAATAAAAAAAATATTTTATTTGAATTAAATA
165 AATAATAAATATTAAATAATTACTATATAGTAATATCAAAAATTTAAAAAATTTTTATATTAAATTATAT
166 TTTAGTGTATGATGCACAATAGTTTTTGATACTATTAGGTATAGTTTAATTCTATAAAATATAATAAAGG
167 TAGAAAAACTACTTAATTTATCCTATCAGAATAATCCTTTAATCAGGCACTTTATTTTTAAAAAAAAGGG
168 TTATCCTTTATATTTGAGGTATGAGCCCAAAAGCTTATTTTAGCTTATTTTTAATAATTTTTTTTTTTAT
169 TTATATGAATTTTTTTTACAAATGGTCTAAAAAAATTTTAAATTAATTTTATTTATAATTAATTTATTTG
170 TAAATATATGTATATTTATATATATATATATATGTATATTAAAAATTTAATTTATTAATCATTTTATAAT
171 ATATTAATTTTTTAATTTATATATATATATATTAATATATTAAATTATTGTAAAAAAATAAATAATAATT
172 ATATAAATTTAATATTATTTATTAAATTATAAAATTTTATATAGCAATTTTATATTTATATTTAATATTA
173 TTTAGAGAGAGAGAGAAAATATAAATTGTTTAATAATTTATATTAATTATTTTAATTAATTAATATAATT
174 AATATATATATTAATTATTTATATATAAAAAAAAAAAAAAAAAAAATTCTATGTGAAAAATTTTACATAT
175 AAATAAATTTTTTATGGTTTATAAATTTTATTTTAAATTTATTTTACATGTAAATTTTAGTGTTATATAT
176 TAATTATTTAAATAATATTTAATTTTAATGCAGTAATTAATTTTAAAAATTTAAGAAATTAAGATTTAGT
177 AATATTTAAATTAATAACTAATTTTGTGCCAGCAGTTGCGGTTATACAAAAATTAATTTAAAATTTTTTA
178 GTAATTAATAAGTAATGTTAATTAATAATTTAAATAAGAAATTATTAGGTGAAATTTTAATTTTTTAAAA
179 ATTATTTATATATTATGATTTAATAAATTTTGTAAAAAACTAGGATTAGATACCCTATTATTAAAAATTA
180 AATTTTTAATACTAAAATAGTAAATAATTTATTGAAACTTAAATAATTTGGCGGTATTTTAGTTTATTTA
181 GAGGAATCTGTTTAATAATTGATAATCCACGAATAAATTTACTTAATTTAAAATTTTGTATATCGTTGTT
182 AAAAAAATATTTTATAATAATAATAATATTTAAAAATTTTTATATAAAATGAAATCAGATCAAGATGCAG
183 ATTATAATTAAGAATATAATGGATTACAATAAATTTATTTAAATTGGATTTTAATATGAAAAGATTAAAT
184 GAAATTGGATTTAAATGTAATTTTATAAAATTTTATAAAATGATTAATAATTAAAATATGTACATATTGC
185 CCGTCGCTTTCATTTATAAATTGGAATAAGTCGTAACAAAGTAGAGGTACTGGAAAGTGTTTCTAGAAAG
186 ATCAAATTAGAGCTTGAATAAAGTATTTCATTTACATTGAAAAGATATTATATAAATTAATTAATTTGGG
187 GGGTAAAATTAATAATTTATATTTAATAAAAGAAATTTTAATATTAGAAATATTTAATGGGGGTTAAAGT
188 ATTTTTAATTGAAAAAATTTAAAATTTTATAGTGAATTAGTATTGTGAAAGAATTTTGAAATAATAATTT
189 AAATAATAATTAATTTGAAAGTAAATTTTATTTATTGTATCTTGTGTATCAGAGTTTATTAAAAATTTTT
190 TATTTATATAAATTTCTCGAATTTAAAAGAGTTAATTAATTAAAAATTTTATTGTTTCATAAATATTTTA
191 AATAATTAATTAGAAATGAAATGTTAATCGTTTTTAAATATATCTAGTTATTTTAGAAAAAAATTTAATT
192 TTTAATTTAAATTTAAAATTAATTAATTAATTAATTAATTTTAAATTTAAATTTAATATTTTAAGGGATA
193 AGCTTTAATTTAAATTTTTATAATAATTATTTTTAAATTTTTGAAAATTTTATAATTTATATTGTTAATA
194 AATTTTAATTTATTATAAATAATTTCAATAAAATTAAAAATTTAATTAAAATTTAATTTTTTATAAAAAA
195 ATTTTTTTTTATTATATAAAATTAATTATAATGATAAAATTAGTATATATATATATGTTATGTAATATAA
196 ATAATTATTTAATTGATTAATAAAATAAATTATAATTATAAAAAAGTTATTTTAAAGGAATTCGACAAAA
197 AGTTATATTCACCTGTTTATCAAAAACATGTCTTTTTGATTAATAATTTAAAGTCTAATCTGCCCACTGA
198 TTTAATAATTGAAGGGCTGCAGTATATTGACTGTACAAAGGTAGCATAATCATTAGTCTCTTAATTGGTG
199 ACTTGTATGAAAGATTGGATGAAATATAGATTGTCTCTAAAATATTTAATAGAAATTAATTTTTTAATTA
200 AAAAGTTAAAATAAATTAAAAAGACGAGAAGACCCTATAGAGTTTTATAATTAATTAATTTTTAAATTTT
201 TAATTAATGGTTTATTTTAAAAATTAATAATTATTTTATTGGGGTGATAAAAAAATAAATTAAACTTTTT
202 TTAATTAAAAACATAAATAAGTGGTTAATTGATCCAATATTTTTGATTAAAAGAAAAAATTACCTTAGGG
203 ATAACAGCGTTATTTTTTTTTTTAGCTCAAATAAGAAAAAAAGTTTGCGACCTCGATGTTGGATTAAGAT
204 AAAATTTAAATGCAGAAGTTTAAAATTTTGATCTGTTCGATCATTAAAATCTTACATGATCTGAGTTCAA
205 ACCGGTGTAAGCCAGGTTGGTTTCTATCTTTTAAATATTTTTATATTTTAGTACGAAAGGATTAAATATT
206 ATAATTAAATTAAATTAAGTTGAATTTTATTAATTTAATTAATAAATTTAACTATTTTGGCAGAGAAATG
207 TAATGATTTTAGAAGTCATCAACGTATAATTAATTATATATATAGTAAATGATAGTAATTGATTTTTTAA
208 TAATTTTAGTTGGTTTTTTAATTTTAGTTTTAGGGGTTTTGATTGGGGTTGCTTATTTAACTTTATTAGA
209 GCGAAAAGTTTTAGGTTATATTCAAATTCGAAAAGGTCCTAATAAAGTTGGTTTAATTGGGATTTTTCAA
210 CCATTTTCTGATGCAATTAAGTTATTTACTAAAGAAACTACTTATCCTAATTTTTCTAATTATTATTGTT
211 ATTATTTTTCTCCTGTTGTTAGATTTGTTTTATCTTTAATTATTTGGGTATTAATTCCTTATTATTTTAA
212 CTTAATTAGATTTAGTTTAGGATTAATATTTTTTCTTTGTTGTACTAGAATAGGGGTTTATACAGTTATG
213 ATTGCTGGTTGATCTTCAAATTCTAATTATGCATTACTTGGGGGGTTACGAGCTGTTGCTCAAACAATTT
214 CTTATGAAGTTAGAATGGCTTTAATTTTATTATCTAGAATTATTATAATTATAGATTTCAATTTATTAAG
215 TTTTTTTTATTATCAGAAAATAATTTGAATAATGTTTATGATAATTCCATTATCATTAATATGAGTTTCA
216 TCAATATTAGCTGAAACTAATCGTACTCCTTTTGATTTTGCTGAAGGTGAAAGAGAATTGGTTTCAGGAT
217 TTAATATTGAATATAGAAGTGGGGGATTTGCTTTGATTTTTTTAGCTGAATATTCTAGAATTTTATTTAT
218 AAGAATTTTATTTATTATTATTTATATAGGGGGTTATGATTTAAGAGTAATTTTTTATTTAAAATTAAGA
219 TTAATTTCTTTTTTATTTATTTGAGTTCGGGGTACTTTACCTCGTTATCGATATGATAAATTAATATATT
220 TAGCTTGAAAAAGATATTTACCAGTTTCATTAAATTTTTTATTATTTTTTTTAGGGTTAAAAATTTTTTT
221 TTAATTTGATTATTTTTAGTATAT
222