annotate test-data/related_mitogenome.fasta @ 0:f6065bc6e428 draft default tip

"planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
author bgruening
date Sat, 29 May 2021 12:50:32 +0000
parents
children
Ignore whitespace changes - Everywhere: Within whitespace: At end of lines:
rev   line source
0
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
1 >MW539688.1 Theretra latreillii lucasii mitochondrion, complete genome
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
2 TTTGATTATTTTTAGTATATAAATTAATAGAATATTTATTCTTTCTTAAGTTTTCAAAACAAATGCTTTA
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
3 ACAAGCTCATTAATTAATTAAAGATTAATTTATCTCAGTATTTACTTAAAATAGGGTTTAATAAGAAATA
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
4 ACTAAAATATAAAATTGTTAAAATTTGTCCTGTAATAACATATGGGTTTTCTACAGGTCGAGCTCCAATT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
5 CAAGTTAATAAAATAATTATAATAATAAAAAATCAAAATAATAATTGATTTAATGGATAAAATTGTAATC
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
6 CTTGGATTTTTTTGTTGAATGTAAAAGGTAAGATAATTAAAATTAAAATTGATATGACTAAAGCAATTAC
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
7 TCCTCCTAATTTATTGGGAATTGATCGTAAAATTGCATAAGCAAATAAAAAATATCATTCAGGTTGAATG
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
8 TGAATTGGAGTTACTAATGGGTTTGCAGGAATGAAATTATCAGGGTCTCCTAATAAATATGGATTAATTA
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
9 AAGTTAATATAGTTAGTAAAAAAATTAAAATAATAAATCCGATTAAATCTTTGAAAGTAAAAAATGGGTG
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
10 AAATGGGATTTTATCTAAATTTCTGTTAATTCCTAAGGGATTGTTAGATCCAGTTTGATGAAGAAATAAT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
11 AAATGAATTATAGTTAATATTAAAATAATAAATGGTAGTAGAAAATGGAAAGTATAAAAACGAGTTAATG
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
12 TTGCATTATCTACTGCAAATCCTCCTCAGATTCAATTTACTAATATATTTCCTAAGTATGGAATTGCTGA
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
13 TAATAAATTAGTAATAACTGTTGCCCCTCAAAATGATATTTGTCCTCAAGGTAATACATATCCTATAAAT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
14 GCTGTTGCTATTAATATAAATAAAATAATAACTCCTACTAATCATGTATATATTAAATTAAATGATTCAT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
15 AATAAATACCTCGTCCAATATGAATGTAAATACAAATAAAAAAAAATGATGCTCCATTTGCGTGAAGAGT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
16 TCGAATTATTCAGCCATAATTTACATTTCGACAAATGTAATTTACTCTGTAAAAAGCTATTTCAATATTA
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
17 GCTGTATAATATATAGTTAAAAATAATCCTGTTAAAATTTGGATTATTAAACATAAAGCAAGGAGAGATC
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
18 CAAAATTTCATCAAATTGAAATGTTTGATGGGGTGGGTAAATCAATTAGGGATCCATTAATAATTTTTAA
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
19 AATTGGGTGAGTTTTTCGAATTGGTTTGAATATATTTATCATTAATTTCTAAAGATTCGTAATGGCCCAT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
20 AAAAAATATTAGTAATTTTAACAATTGCAATTAGTGTAATAAATAAATAAATAATTAATAGTAATATTAA
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
21 TATTGAAAAATTATTATTATATAATTTATTTAAATTAATTTTATTTTCATTATTAAAAAATATAAAATTT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
22 AATAAGTTGTTTATTTCTGAGTTATTAATTAAATTTATTCAATTTAGATTTTTATAAAATAAAAATTGAA
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
23 TTATAATTATTAAAATTAATAATGATATGAGAATAATTTTTATTTTATTTGATAAGGAAAATATTTCATT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
24 TGATGCAATACTTGAAACATAAATAAATAAAACTAATAATCCTCCTAAAAAAGTTAAAAAAAGAATATAA
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
25 GAGAATCAATAGGTTTTAATTAATATTCCTGATAATAAACATGTTATTAATGTTTGAATTAAAATTAATA
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
26 TTCCTATTGATAATGGGTGGTTTAAAAAATATATTATTATTGATATAAAAATAATGAGTATAGATAAATT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
27 TAATTTTATCATTTATAATCAAAAAATAGTTTATTAAAATAATAATTTTGGAGATTATAGATAAAGAATT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
28 TTCTTTTTTTTTGAGTTTTTAAAGATATTTCTTAATTTTGATTTACAAGACCAATGTTTTTTTTTAAACT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
29 ATAAAAACTAAATTAATGATAATTTTAAATATATGATTTATTTTTATTTTAATATTTTTTATTGGGAATT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
30 TGATTTTTGTTTCAAAAAATAAGCATTTATTAATTGTTTTATTAAGATTAGAATTTATTGTTTTAAGAAT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
31 TTTTTTTTTTTTTTTAGTATTTTTAATAATAATTGATTATGATATATATATATTAATGGTATTTTTAGTT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
32 TTTTCTGTTTGTGAAGGTTCATTAGGGTTATCTATTTTAGTTTCTATAATTCGAACTCATGGTAATGATT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
33 ATTTTCAAAGATTTAATTTAATTTAAAAATGATAAAAATTTTATTTTATATAATTTTTATAATTCCTTTA
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
34 TGTTTTATAAAGAAAATATTTTGAATGGTTCAAATATTATTATTAATATTAATATTTATTTATATAAATT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
35 TATCAGTAAGTTTGATTAGTTGTAATTTAAGTTATATATATTCTTGTGATTTAATTTCTTTTGGGTTGAT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
36 TTTATTAAGAATTTGGATTTGTTCTTTGATAATTATATCTAGAGAAAATTTATTTAAAATAAATTATTAT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
37 GTTAATTTTTTTTTATTAAATATTATAATTTTAATAATTTTATTATTTTTAACTTTTAGAGTAATAAATT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
38 TATTCATATTTTATTTATTTTTTGAGGGTAGATTAATTCCTACATTGTTATTAATTATTGGGTGGGGGTA
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
39 TCAACCTGAACGGATTCAAGCTGGAATATATTTAATATTTTATACTTTATTTGCTTCATTACCATTATTA
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
40 ATAGGGTTATTTTATATTTATATAGAAATTAATAGAATAGTATTTTATTTTTTAAAATTTTTTAATATAA
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
41 ATTTTATTTTATTATATATTAGAATAGTTTTAGCTTTTTTAGTAAAAATACCTATATATTTTGTTCATTT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
42 ATGGCTTCCTAAAGCTCATGTAGAAGCTCCTGTATCAGGGTCTATAATTTTAGCTGGGATTATATTAAAG
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
43 TTAGGAGGTTATGGGTTATTGCGAGTTTTAATTTTTTTACAAGAAATTAATTTAAAATTAAATTATATGT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
44 GAATTATTATTAGATTATTGGGGGGTTTTTATATTAGTCTAAAATGTTTTTGTCAAGTAGATATTAAATC
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
45 ATTAATTGCTTATTCTTCAGTTTCTCATATAAGAATTGTAATTAGAGGGATTATAGTAATAAATTATTGA
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
46 GGATATTTTGGTGCATATATTATAATAATTGGTCATGGGTTATGTTCTTCAGGGATATTTTGTCTCGCTA
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
47 ATATTAATTATGAACGATTACATAGACGAAGATTATTTATTAATAAGGGTATGATAAATTTTATACCTTC
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
48 AATAAGATTGTGATGATTTTTATTAATGTCTTCAAATATATCAGCTCCTCCATCTTTAAATTTATTAGGG
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
49 GAAATTAGTTTAATTAATAGAATAATAAGATGATCTTGAATATCAATAATAATATTAATATTAATTTCTT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
50 TTTTTAGAGCTGGGTATAGATTATATTTATATTCTTATATTCAACATGGTAAGATTTTTCAAGGGGTATA
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
51 TAGATTTTATTGTGGTGTTTCTCGTGAATATTTATTATTATTATTACATTGATTACCTTTAAATATTATA
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
52 ATTTTAAAAATTGAATATTTAATAATTTAATAAAATTTAAATAATTTAATTAAAATATTGATTTGTGGAA
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
53 TCAAATATATGATATAGTATCATTTTAAATTATTAATAAAAATAATTTTTGTTTTTTTGTTTTTTTGTTT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
54 TTGTTTTTTTTTAGAATAATAAATTTATTTTTGATAATTTATTTTATTATAAATAATATTGTATTTTTTT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
55 TTGAGTGGGAAATTATTTCTTTTAATTCTGTGAGAGTTGTTATATCTATTTTATTAGATTGAATATCTTT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
56 AATATTTATGATGTTTGTTTTAATAATTTCTTCTGTTGTTATTTATTATAGAAAAAGTTATATAAGATCA
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
57 GAGTTAAATTTATTTCGTTTTATTATTTTAGTTATATTATTTGTATTTTCTATAGTTTTATTAATTATTA
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
58 GACCTAATATTATTAGAATTTTATTAGGTTGAGATGGTTTGGGGTTAGTTTCATATTGTTTAGTTATTTA
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
59 TTATCAAAATTTAAAATCTTATAATGCTGGAATATTAACAGTTTTATCAAATCGAATTGGTGATGTAATA
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
60 ATTTTAATAGTTATTTCTTGAATATTAAATTATGGGGGTTGAAATTATATTTTTTATTTAGATTTTATAT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
61 TAAATGATATATTAATGGAAATTATTAGATTAATAATTATTTTTGCTGCTATAACAAAAAGAGCTCAAAT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
62 TCCTTTTAGTTCTTGATTACCTGCAGCTATAGCTGCTCCTACTCCAGTATCTGCTTTAGTTCATTCTTCT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
63 ACTTTAGTGACTGCTGGGGTTTATTTATTAATTCGGTTTAATTTAATAATTTTAAATACTTTTTTTATTA
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
64 AAATTTTATTGTTATTAGGTATAATGACTATGTTTATAGCTGGGATTTCTGCTAATTATGAGTTTGATTT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
65 AAAGAAAATTATTGCTTTATCTACTTTAAGACAATTAGGTTTAATAATAAGAATTTTAAGAATAGGTTTT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
66 CCTGATTTAGCATTTTTTCATTTGTTAACTCATGCTATATTTAAAGCTTTGTTATTTATATGTGCTGGGG
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
67 TTATTATTCATATAATAAATGATATTCAAGATATTCGTTATATAGGGGGTATAAGAATATATTTACCTTT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
68 AACTTCATTATGTTTAAATATTTCTAATTTAGCTTTATGTGGGATTCCTTTTTTAGCTGGGTTTTATTCT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
69 AAGGATTTAATTTTAGAGATAGTAAGTTTTAGAAATTTAAATATATTTGTTTTTTTTTTTTATTATGTTT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
70 CTACTGGTTTAACTATATATTATACTATTCGTTTATTAATGTATTTAATAATTAATGATTATAATTTATT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
71 ATGTGTTTATAATTTATATGATGAGGATTATGTAATATTAAATAGAATATTTTTATTATTATTTATAAGA
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
72 GTAATTAGAGGGAGTATGTTAAGATGATTTATTTTTTATTATCCATATATAATTTATTTACCTTATAATT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
73 TAAAAATAATAGTTATTTATGTAAGATTGTTTGGTGGTTTAATAGGGTTTTTAGTTAGAAATATAAATAT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
74 TTATAGATTAAATAAATTTTTAATATCTTATAGTTTAAGAAGATTTTTATGTTTAATGTGATTTATACCT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
75 AGTTTATCAACTTATGGTGTGAGATATTATTTTTTAAATTATGGTCAAAATTTATTAAAAATTGTAGATA
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
76 TAGGTTGAAGAGAAATATATAGTGGTCAGGGAATAGTAAAAATTATTAAAAAATATTCTATTTTTTATAG
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
77 AGTATTTCAAATAAATAATTTAAAAATTTATTTATTTAGATTTATTTTATGGATAATAATTTATATTTAT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
78 ATATTATTTATAAATATTTATTTAAATAGCTTATAATTAGAGTGTAATATTGAAGATATTAAGGAGATTG
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
79 ATTTAATCTTTAAATATTTATAAAAAAAAGTTTTTTATTTTTACAATGAAAATGTAATGTTTTATTAATA
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
80 AACTATATAAATATAAAAAAAAGAAATATTAATGGAATTAAACCACTAAAAATTAAGTTAGCAGCTTAAT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
81 TTTAATTATTATATTTCTTTAATTGGAATATAAAATTCAATTTTATCATTAACAGTGATATACCTCTATT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
82 TTGGTTTCAATTAAATAAATAAGGAGTAAAATAACTCTTATTTTTAAGTCGAAATTAAATGCAAAATTTT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
83 GCTTCTTATTTTAAGATAAATTAATAAAATTAATATTTTTTGATTGCAAATCAAATGTTTTAAATAAACT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
84 ATAATCCTAATTAGTTCAATTTAATATATTTTGGTTTCATTCATGATATAATCCTAATAATAAGATAATG
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
85 ATAAAAAAAAATCTAATTTTTATTCATCTAAAAAAATTTACTATTTTAAAAGTAAAAATAATAGGAAAAA
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
86 TTAAAGCAATTTCTACATCAAAGATTAAGAAGATTACTGTAATTAAAAAAAAATGTAATGAAAATGGGAT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
87 TCGTGCTGATGATTTAGGGTCAAATCCACATTCAAATGGTGAACATTTTTCTCGGTCTATAAAGGATTTT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
88 TTTGATAGAATAATTGATAAAAATATTATAATATTAGAAATTATAATGATTATAAGTGTAATAGTTAATG
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
89 TTAAAGTAATTATTTATATTAAATTTGAATTAAACTTTTTGATTGGAAATCAAATATACTAAATATATTA
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
90 TATAAATAATTAATTTCCTCATCAGTAAATTGAAATATATAGGAATAATCATACAACATCTACAAAGTGT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
91 CAGTATCAGGCTGCTGCTTCAAATCCGAAATGATGATTTCTTGAAAAATGTTTATTTAATTGTCGAATGA
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
92 AACAAATAATTAAAAAAAGAGTTCCAATAATTACATGGAGACCATGAAATCCTGTTGCTATAAAAAATGT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
93 AGATCCGTAAATTCTATCAGAAATAGAGAATGGAGCTTCAATATATTCATATGCTTGTAAAATAGTGAAG
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
94 TAAATTCCTAATGAAATTGTTAAAAATAAACTTTGAATAACTTGGGTATAATTATTTTCTATTAGTGAGT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
95 GATGAGCTCAAGTAACAGTTATTCCTGATCTAATTAAAATAATAGTATTTAATAGGGGAATTTGAAAAGG
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
96 ATTAAATGGAAAAATTCTTATTGGTGGTCAAATAGCACCAATTTCAATATTTGGTGATAAGCTTCTATGA
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
97 AAAAAAGCTCAAAAAAAAGAAATAAAAAATAAAATTTCTGAAACAATAAATAAAATTATACCTCATTGTA
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
98 ATCCTTTAGTTACTAAAATTGTGTGTTTACCTTGAAATGTTCCTTCTCGACAAACATCTCGTCATCATTG
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
99 ATAAAAAGTTAAAATTGTAATAATATATCCTAAAATTAATAGATTTATATTAAAGTTGTGAAATCATTTT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
100 ATTATTCCGGTTACTAATGTTAATACTCCAATTGATCCAGTTAAAGGTCAAGGGCTATAATCTACTAAAT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
101 GATATGGGTGATAGTTGAAATTATTTTTCATTAATTAACTTCTCTAGAATATAATGTTCTTAAAATAGCA
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
102 ATTACATAAGATTGAATTACTGCTACTGCAGATTCTAAAATTAAAAGAAGAATTTGAATTAAAATTAAAA
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
103 TTATAATAAAAATATAAGATAGATTATTTCCTGTTCTTCTTAGTAATGTTATTAATAGATGTCCTGCAAT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
104 TATATTAGCTGTTAATCGAACAGCTAAAGTTCCAGGACGAATAATATTACTAATAGTTTCAATTAATACT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
105 ATAAATGGTATTAATACTGTTGGTGTTCCTTGGGGGATTATATGTGAAAATATATGTTGATAATTATTAA
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
106 TTCAACCATATAATATAAATCTTAATCATAAAGGTAATGATATTGATAATGTTAGAGTTAAGTGTCTTGT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
107 TCTAGTAAAAATATATGGAAATAATCCTAAAAAATTATTAAATAAAATAAAAGAGAATAAGGAAATAAAA
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
108 ATAAAAGTTGATCCACTAAAATAGTTATTTTTTAATAAGGTTTTAAATTCATTGTGTAGTGTATTTAAAA
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
109 TGAAGTTTCAAATTATATAATGTCGATTAGGGATTAATCAAAATGAATAAGGAATAAATATTAATCCTAA
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
110 AAAAGTTCTAATTCAATTAATTGGTAAATTAAGTAGATTTGTTGAAGGGTCAAAAATTGAAAATAAGTTA
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
111 CTTATCATTTTCAAATTAAATTATTTTTAGGTTTTATATTAATTATGTTATTTTTTATATTATTTGAATT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
112 ATAATAAATATAATAATTTATAATATTAAAAATAATAAAAATAATAATAAAAAAAATTAAAGATAGAATT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
113 CAATTAATAGGTATTATTTGAGGGATAAAAGAATATTACTTATGTAATAATTTAAATTTGACATATTTAT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
114 GTTATAAATTAACTAATTCTTTTCATTAGAAGTAGTTGCTAATTTACTATTAAGTGGTTTAAGAGACCAA
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
115 TACTTGCTTTCAGTCATCTAATGAAGAATAATTATTAATTCAATTAATAAAATTTTTTATTGAAATTCTT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
116 TCGATAACAATTGGTATAAATCTATGATTTGCTCCACAAATTTCAGAACATTGTCCGTAATAAATTCCAG
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
117 GACGATTAATAAAAAAATTAGTTTGATTTAATCGTCCAGGATTAGCATCTACTTTTACTCCTAGAGAAGG
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
118 AATAGTTCATGAATGAATTACATCAGTTGCGGTTACTATAATTCGAATTTGATTATTTATTGGTAAAATA
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
119 ATTCGATTATCAACATCTAATAGTCGAAAATTATTTGAATTTAGTTCATTTGAAGGGATTATATAAGAAT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
120 CAAATTCAATATTATGGAAATCTGAGTATTCATATCTTCAATACCATTGATGACCAATAGATTTTAGTGT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
121 AATTAATGGGTTATTTAATTCATCTAATAAATATAATAATCGTAGTGAAGGTAATGCAATAAAAATTAAT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
122 GTAATAGCAGGTAAGATAGTTCAAATTATTTCAATTATTTGACCTTCTAATAAAAATCGATTAATATATT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
123 TATTAAAAAATAAATTTAATATTAAATATCCTACTAAAATAGTAATTATAATTAAAATAATTAAAGTATG
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
124 ATCGTGGAAAAAGATGATTTGTTCTATTAATGGTGATGTTCCATTTTGTAAATTTAAATTAGATCAGGTT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
125 GCCATTTCTAAAAAAAGGATAATCCTTTATAAATGGGGTTTAAATCCATTACATATAATCTGCCATATTA
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
126 GAAATTTCTTAAAATTGGGAGTTCATTATAAGAATGTTCGGCAGGTGGAAGATTTTGGTATCATTCAATT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
127 GATGAAGGTATGTTTAATGGAAATAGTGCAATTCGTTGATAAATTATTGATTCTCAAATAATAATTAATA
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
128 TTATTATTACAGCTAATAGTGAGATATAAGATCCTAAAGATGAAATTAAATTTCAAGAAGTGTAAGAATC
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
129 TGGATAATCTGAATATCGTCGAGGTATACCTGCTAACCCTAAAAAATGTTGGGGAAAGAAAGTTAAATTT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
130 ACTCCTAAGAATATAATAAAAAATTGAATTTTTAATAAATAAGGGTTTAAAGATAGACCTGAAAATAAAG
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
131 GATATCAGTGAATAAATCCTCCTATAATAGCAAATACAGCTCCTATAGATAAAACATAATGAAAATGTGC
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
132 AACGACATAATAAGTATCATGTAAAGTAATATCAATTGATGAGTTAGCTAAAATAACTCCTGTTAATCCT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
133 CCAACAGTAAATAAAAATACAAATCCTAATCTTCATAAAATTGAAGGTCTGTAATTAATTTGAGTTCCGT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
134 GAAGAGTTGCTATTCAACTAAAAATTTTAATTCCTGTTGGAACGGCAATAATTATAGTTGCTGAAGTAAA
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
135 GTAAGCTCGTGTATCAATATCTATTCCTACTGTAAATATATGATGAGCTCAAACAATAAATCCCAATAAA
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
136 CCAATTGCTATTATAGCATAAATTATTCCTAAACATCCGAATGTTTCTTTTTTAGTTCTTTCTTGTGAAA
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
137 TAATATGGGAAATTATACCAAATCCTGGTAAAATTAAAATATAAACTTCTGGATGACCGAAAAATCAAAA
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
138 TAAATGTTGATATAAAATAGGGTCTCCTCCTCCAGCAGGATCAAAAAATGATGTATTAAGATTTCGGTCA
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
139 GTTAATAATATTGTAATTGCTCCAGCTAATACTGGTAAAGATAGAAGTAATAAAAATGCTGTAATACCAA
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
140 CAGCTCACACAAATAATGGTATTTGATCAAATGATAAACTATTAATTTTTATATTAATAATTGTGGTAAT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
141 AAAATTAATAGCTCCTATAATTGAGGAAATTCCAGCTAAGTGAAGAGAAAAAATAGCTAGATCTACTGAA
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
142 CTTCCACTATGAGCAATATTAGAAGAAAGAGGGGGGTAAACTGTTCAACCAGTTCCTGCTCCGTTTTCAA
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
143 CAATACTTCTAGAAATTAGAAGAGTTAAAGATGGGGGGAGAAGTCAAAATCTTATATTATTTATTCGTGG
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
144 AAATGCTATATCAGGTGCTCCTAATATTAAAGGAACTAATCAATTACCAAATCCTCCAATTATGATTGGT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
145 ATTACTATAAAAAAAATTATAATAAATGCATGAGCTGTAACAATTGTATTATAAATTTGATCATCTCCAA
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
146 TTAAAGATCCGGGGGTTCCTAATTCTGCTCGAATTAATAATCTTAATGAAGTTCCTACTATTCCTGCTCA
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
147 AATTCCAAAAATAAAGTATAATGTTCCAATATCTTTATGATTTGTGGAGTAAAGTCATTTTCGCTTGAAA
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
148 ATAAAATGGCTGAGTTAAAAGCGATAAATTGTAAATTTATTTACGAGAAATATTCTCTTTTATTAAGTCT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
149 TATATTCAATAATGATATAAAATTGCAAATTTTAAGGGGTAAATTATTTACTAAGGCTTAAAGAATATTT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
150 CTTTATATATAATTTTGAAGATTATTAGTTTATTTAACTTAAAACCTTATATAAATAAAAAAGTTCTAAA
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
151 AATTATTCCTATAATGGAAATTATTGAAAAAAAATTAATTAAATTTATTAATTTATTTTTAAAATTAATT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
152 TTAAATCATTTTATTTTAAAGTAATTGAATATAAATGATGAATAAATAATTCGAATATAAAAATAAATAG
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
153 TAATTAATCTTCTTATAATTATAATAAATGTTAAAAAATAAAATTTATTTATTATTAAAAAATTAATAAT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
154 AATTCATTTTGGTAAAAATCCTAAAAAAGGTGGTAATCCACCTAATGATAAGAAATTAATTAATAAATTT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
155 AATTTAATTATAAAATTTATATTATTAATAAATAGTTGATTAATGAAAAATATATTTAAATTGTAAAATA
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
156 AAAAAAATATAATTCTAATTAAAAATGAGTATATTAAAAAATAAAATATTCATAAATTTTCTCTAATTAA
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
157 TAAGGTAAAAATTATTCAACCTAAATTATTAATTGAGGAAAATGCTATTAGTTTTCGTAAAGAAGTTTGA
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
158 TTTAATCCTCCAATAGCTCCGGTTATTACATTTATAATAATGATAAAATATAAAAAATTAAAATTTAAAT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
159 AATAAGAAAGTAAAATTAATGGGGTAATTTTTTGTCAAGTTATTAAAATAAAGTTATTAAATCATGATAA
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
160 TCCTTCTGAAATATTAGGGAATCAAAAATGGAATGGGGTTGAACCTATTTTTATTAATAATGATGAATTG
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
161 ATTATAATTGATATAAAATTATTTATTTCAAAATTTTTTATTAAAATTATTTTTAATAGAATTGAAAATA
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
162 AAAAATTTATTGATGCAATAGATTGGGTAAGAAAATATTTTAATGAAGCTTCAGAAGCTAATAAATTATT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
163 TGAATTAGAAATTAGGGGGATAAAACTTAATAAATTAATTTCTAAACCAATTCAACACCCAAATCAAGAA
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
164 TTTGAAGAAATTGAAATTATAGTTCTAAAAAATAAAATAAATAAAAAAAATATTTTATTTGAATTAAATA
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
165 AATAATAAATATTAAATAATTACTATATAGTAATATCAAAAATTTAAAAAATTTTTATATTAAATTATAT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
166 TTTAGTGTATGATGCACAATAGTTTTTGATACTATTAGGTATAGTTTAATTCTATAAAATATAATAAAGG
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
167 TAGAAAAACTACTTAATTTATCCTATCAGAATAATCCTTTAATCAGGCACTTTATTTTTAAAAAAAAGGG
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
168 TTATCCTTTATATTTGAGGTATGAGCCCAAAAGCTTATTTTAGCTTATTTTTAATAATTTTTTTTTTTAT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
169 TTATATGAATTTTTTTTACAAATGGTCTAAAAAAATTTTAAATTAATTTTATTTATAATTAATTTATTTG
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
170 TAAATATATGTATATTTATATATATATATATATGTATATTAAAAATTTAATTTATTAATCATTTTATAAT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
171 ATATTAATTTTTTAATTTATATATATATATATTAATATATTAAATTATTGTAAAAAAATAAATAATAATT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
172 ATATAAATTTAATATTATTTATTAAATTATAAAATTTTATATAGCAATTTTATATTTATATTTAATATTA
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
173 TTTAGAGAGAGAGAGAAAATATAAATTGTTTAATAATTTATATTAATTATTTTAATTAATTAATATAATT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
174 AATATATATATTAATTATTTATATATAAAAAAAAAAAAAAAAAAAATTCTATGTGAAAAATTTTACATAT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
175 AAATAAATTTTTTATGGTTTATAAATTTTATTTTAAATTTATTTTACATGTAAATTTTAGTGTTATATAT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
176 TAATTATTTAAATAATATTTAATTTTAATGCAGTAATTAATTTTAAAAATTTAAGAAATTAAGATTTAGT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
177 AATATTTAAATTAATAACTAATTTTGTGCCAGCAGTTGCGGTTATACAAAAATTAATTTAAAATTTTTTA
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
178 GTAATTAATAAGTAATGTTAATTAATAATTTAAATAAGAAATTATTAGGTGAAATTTTAATTTTTTAAAA
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
179 ATTATTTATATATTATGATTTAATAAATTTTGTAAAAAACTAGGATTAGATACCCTATTATTAAAAATTA
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
180 AATTTTTAATACTAAAATAGTAAATAATTTATTGAAACTTAAATAATTTGGCGGTATTTTAGTTTATTTA
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
181 GAGGAATCTGTTTAATAATTGATAATCCACGAATAAATTTACTTAATTTAAAATTTTGTATATCGTTGTT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
182 AAAAAAATATTTTATAATAATAATAATATTTAAAAATTTTTATATAAAATGAAATCAGATCAAGATGCAG
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
183 ATTATAATTAAGAATATAATGGATTACAATAAATTTATTTAAATTGGATTTTAATATGAAAAGATTAAAT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
184 GAAATTGGATTTAAATGTAATTTTATAAAATTTTATAAAATGATTAATAATTAAAATATGTACATATTGC
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
185 CCGTCGCTTTCATTTATAAATTGGAATAAGTCGTAACAAAGTAGAGGTACTGGAAAGTGTTTCTAGAAAG
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
186 ATCAAATTAGAGCTTGAATAAAGTATTTCATTTACATTGAAAAGATATTATATAAATTAATTAATTTGGG
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
187 GGGTAAAATTAATAATTTATATTTAATAAAAGAAATTTTAATATTAGAAATATTTAATGGGGGTTAAAGT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
188 ATTTTTAATTGAAAAAATTTAAAATTTTATAGTGAATTAGTATTGTGAAAGAATTTTGAAATAATAATTT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
189 AAATAATAATTAATTTGAAAGTAAATTTTATTTATTGTATCTTGTGTATCAGAGTTTATTAAAAATTTTT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
190 TATTTATATAAATTTCTCGAATTTAAAAGAGTTAATTAATTAAAAATTTTATTGTTTCATAAATATTTTA
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
191 AATAATTAATTAGAAATGAAATGTTAATCGTTTTTAAATATATCTAGTTATTTTAGAAAAAAATTTAATT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
192 TTTAATTTAAATTTAAAATTAATTAATTAATTAATTAATTTTAAATTTAAATTTAATATTTTAAGGGATA
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
193 AGCTTTAATTTAAATTTTTATAATAATTATTTTTAAATTTTTGAAAATTTTATAATTTATATTGTTAATA
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
194 AATTTTAATTTATTATAAATAATTTCAATAAAATTAAAAATTTAATTAAAATTTAATTTTTTATAAAAAA
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
195 ATTTTTTTTTATTATATAAAATTAATTATAATGATAAAATTAGTATATATATATATGTTATGTAATATAA
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
196 ATAATTATTTAATTGATTAATAAAATAAATTATAATTATAAAAAAGTTATTTTAAAGGAATTCGACAAAA
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
197 AGTTATATTCACCTGTTTATCAAAAACATGTCTTTTTGATTAATAATTTAAAGTCTAATCTGCCCACTGA
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
198 TTTAATAATTGAAGGGCTGCAGTATATTGACTGTACAAAGGTAGCATAATCATTAGTCTCTTAATTGGTG
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
199 ACTTGTATGAAAGATTGGATGAAATATAGATTGTCTCTAAAATATTTAATAGAAATTAATTTTTTAATTA
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
200 AAAAGTTAAAATAAATTAAAAAGACGAGAAGACCCTATAGAGTTTTATAATTAATTAATTTTTAAATTTT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
201 TAATTAATGGTTTATTTTAAAAATTAATAATTATTTTATTGGGGTGATAAAAAAATAAATTAAACTTTTT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
202 TTAATTAAAAACATAAATAAGTGGTTAATTGATCCAATATTTTTGATTAAAAGAAAAAATTACCTTAGGG
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
203 ATAACAGCGTTATTTTTTTTTTTAGCTCAAATAAGAAAAAAAGTTTGCGACCTCGATGTTGGATTAAGAT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
204 AAAATTTAAATGCAGAAGTTTAAAATTTTGATCTGTTCGATCATTAAAATCTTACATGATCTGAGTTCAA
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
205 ACCGGTGTAAGCCAGGTTGGTTTCTATCTTTTAAATATTTTTATATTTTAGTACGAAAGGATTAAATATT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
206 ATAATTAAATTAAATTAAGTTGAATTTTATTAATTTAATTAATAAATTTAACTATTTTGGCAGAGAAATG
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
207 TAATGATTTTAGAAGTCATCAACGTATAATTAATTATATATATAGTAAATGATAGTAATTGATTTTTTAA
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
208 TAATTTTAGTTGGTTTTTTAATTTTAGTTTTAGGGGTTTTGATTGGGGTTGCTTATTTAACTTTATTAGA
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
209 GCGAAAAGTTTTAGGTTATATTCAAATTCGAAAAGGTCCTAATAAAGTTGGTTTAATTGGGATTTTTCAA
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
210 CCATTTTCTGATGCAATTAAGTTATTTACTAAAGAAACTACTTATCCTAATTTTTCTAATTATTATTGTT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
211 ATTATTTTTCTCCTGTTGTTAGATTTGTTTTATCTTTAATTATTTGGGTATTAATTCCTTATTATTTTAA
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
212 CTTAATTAGATTTAGTTTAGGATTAATATTTTTTCTTTGTTGTACTAGAATAGGGGTTTATACAGTTATG
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
213 ATTGCTGGTTGATCTTCAAATTCTAATTATGCATTACTTGGGGGGTTACGAGCTGTTGCTCAAACAATTT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
214 CTTATGAAGTTAGAATGGCTTTAATTTTATTATCTAGAATTATTATAATTATAGATTTCAATTTATTAAG
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
215 TTTTTTTTATTATCAGAAAATAATTTGAATAATGTTTATGATAATTCCATTATCATTAATATGAGTTTCA
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
216 TCAATATTAGCTGAAACTAATCGTACTCCTTTTGATTTTGCTGAAGGTGAAAGAGAATTGGTTTCAGGAT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
217 TTAATATTGAATATAGAAGTGGGGGATTTGCTTTGATTTTTTTAGCTGAATATTCTAGAATTTTATTTAT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
218 AAGAATTTTATTTATTATTATTTATATAGGGGGTTATGATTTAAGAGTAATTTTTTATTTAAAATTAAGA
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
219 TTAATTTCTTTTTTATTTATTTGAGTTCGGGGTACTTTACCTCGTTATCGATATGATAAATTAATATATT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
220 TAGCTTGAAAAAGATATTTACCAGTTTCATTAAATTTTTTATTATTTTTTTTAGGGTTAAAAATTTTTTT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
221 TTAATTTGATTATTTTTAGTATAT
f6065bc6e428 "planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/mitohifi commit fb6bc2755715fee453208273dd26b69da97ca65c"
bgruening
parents:
diff changeset
222