annotate convert_SOLiD_color2nuc.xml @ 0:ab28e7de2db3 draft default tip

Imported from capsule None

<tool id="color2nuc" name="Convert Color Space" version="1.0.0">
<description> to Nucleotides </description>
<command interpreter="python">convert_SOLiD_color2nuc.py $input1 $input2 $output1 </command>

<inputs>
    <param name="input1" type="data" format="txt" label="SOLiD color coding file" />
    <param name="input2" type="select" label="Keep prefix nucleotide">
    	<option value="yes">Yes</option>
    	<option value="no">No</option>
    </param>
</inputs>
<outputs>
  	<data name="output1" format="fasta" />
</outputs>
<!-- 
<tests>
	<test>
		<param name="input1" value="convert_SOLiD_color2nuc_test1.txt" ftype="txt" />
		<param name="input2" value="no" />
		<output name="output1" file="convert_SOLiD_color2nuc_test1.out" />
	</test>
</tests>
-->
<help>

.. class:: warningmark

The tool was designed for color space files generated from an ABI SOLiD sequencer. The file format must be fasta-like: the title starts with a ">" character, and each color space sequence starts with a leading nucleotide.
 
-----

**What it does**

This tool converts a color space sequence to nucleotides. The leading character must be a nucleotide: A, C, G, or T. 
 
-----

**Example**

- If the color space file looks like this::

	&gt;seq1
	A013
	&gt;seq2
	T011213122200221123032111221021210131332222101
	
- If you would like to **keep** the leading nucleotide::

	&gt;seq1
	AACG
	&gt;seq2
	TTGTCATGAGAAAGACAGCCGACACTCAAGTCAACGTATCTCTGGT
	
- If you **do not want to keep** the leading nucleotide (the length of nucleotide sequence will be one less than the color-space sequence)::
 
 	&gt;seq1
 	ACG
 	&gt;seq2
	TGTCATGAGAAAGACAGCCGACACTCAAGTCAACGTATCTCTGGT 

-----

**ABI SOLiD Color Coding Alignment matrix**

 Each di-nucleotide is represented by a single digit: 0 to 3. The matrix is symmetric, thus the leading nucleotide is necessary to determine the sequence (otherwise there are four possibilities).

 
 .. image:: dualcolorcode.png


</help>
</tool>