Mercurial > repos > devteam > convert_solid_color2nuc
comparison convert_SOLiD_color2nuc.xml @ 0:ab28e7de2db3 draft default tip
Imported from capsule None
| author | devteam |
|---|---|
| date | Mon, 19 May 2014 12:33:14 -0400 |
| parents | |
| children |
comparison
equal
deleted
inserted
replaced
| -1:000000000000 | 0:ab28e7de2db3 |
|---|---|
| 1 <tool id="color2nuc" name="Convert Color Space" version="1.0.0"> | |
| 2 <description> to Nucleotides </description> | |
| 3 <command interpreter="python">convert_SOLiD_color2nuc.py $input1 $input2 $output1 </command> | |
| 4 | |
| 5 <inputs> | |
| 6 <param name="input1" type="data" format="txt" label="SOLiD color coding file" /> | |
| 7 <param name="input2" type="select" label="Keep prefix nucleotide"> | |
| 8 <option value="yes">Yes</option> | |
| 9 <option value="no">No</option> | |
| 10 </param> | |
| 11 </inputs> | |
| 12 <outputs> | |
| 13 <data name="output1" format="fasta" /> | |
| 14 </outputs> | |
| 15 <!-- | |
| 16 <tests> | |
| 17 <test> | |
| 18 <param name="input1" value="convert_SOLiD_color2nuc_test1.txt" ftype="txt" /> | |
| 19 <param name="input2" value="no" /> | |
| 20 <output name="output1" file="convert_SOLiD_color2nuc_test1.out" /> | |
| 21 </test> | |
| 22 </tests> | |
| 23 --> | |
| 24 <help> | |
| 25 | |
| 26 .. class:: warningmark | |
| 27 | |
| 28 The tool was designed for color space files generated from an ABI SOLiD sequencer. The file format must be fasta-like: the title starts with a ">" character, and each color space sequence starts with a leading nucleotide. | |
| 29 | |
| 30 ----- | |
| 31 | |
| 32 **What it does** | |
| 33 | |
| 34 This tool converts a color space sequence to nucleotides. The leading character must be a nucleotide: A, C, G, or T. | |
| 35 | |
| 36 ----- | |
| 37 | |
| 38 **Example** | |
| 39 | |
| 40 - If the color space file looks like this:: | |
| 41 | |
| 42 >seq1 | |
| 43 A013 | |
| 44 >seq2 | |
| 45 T011213122200221123032111221021210131332222101 | |
| 46 | |
| 47 - If you would like to **keep** the leading nucleotide:: | |
| 48 | |
| 49 >seq1 | |
| 50 AACG | |
| 51 >seq2 | |
| 52 TTGTCATGAGAAAGACAGCCGACACTCAAGTCAACGTATCTCTGGT | |
| 53 | |
| 54 - If you **do not want to keep** the leading nucleotide (the length of nucleotide sequence will be one less than the color-space sequence):: | |
| 55 | |
| 56 >seq1 | |
| 57 ACG | |
| 58 >seq2 | |
| 59 TGTCATGAGAAAGACAGCCGACACTCAAGTCAACGTATCTCTGGT | |
| 60 | |
| 61 ----- | |
| 62 | |
| 63 **ABI SOLiD Color Coding Alignment matrix** | |
| 64 | |
| 65 Each di-nucleotide is represented by a single digit: 0 to 3. The matrix is symmetric, thus the leading nucleotide is necessary to determine the sequence (otherwise there are four possibilities). | |
| 66 | |
| 67 | |
| 68 .. image:: dualcolorcode.png | |
| 69 | |
| 70 | |
| 71 </help> | |
| 72 </tool> |