Mercurial > repos > devteam > convert_solid_color2nuc

diff convert_SOLiD_color2nuc.xml @ 0:ab28e7de2db3 draft default tip

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
Imported from capsule None
author devteam
date Mon, 19 May 2014 12:33:14 -0400
parents
children
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/convert_SOLiD_color2nuc.xml	Mon May 19 12:33:14 2014 -0400
@@ -0,0 +1,72 @@
+<tool id="color2nuc" name="Convert Color Space" version="1.0.0">
+<description> to Nucleotides </description>
+<command interpreter="python">convert_SOLiD_color2nuc.py $input1 $input2 $output1 </command>
+
+<inputs>
+    <param name="input1" type="data" format="txt" label="SOLiD color coding file" />
+    <param name="input2" type="select" label="Keep prefix nucleotide">
+    	<option value="yes">Yes</option>
+    	<option value="no">No</option>
+    </param>
+</inputs>
+<outputs>
+  	<data name="output1" format="fasta" />
+</outputs>
+<!-- 
+<tests>
+	<test>
+		<param name="input1" value="convert_SOLiD_color2nuc_test1.txt" ftype="txt" />
+		<param name="input2" value="no" />
+		<output name="output1" file="convert_SOLiD_color2nuc_test1.out" />
+	</test>
+</tests>
+-->
+<help>
+
+.. class:: warningmark
+
+The tool was designed for color space files generated from an ABI SOLiD sequencer. The file format must be fasta-like: the title starts with a ">" character, and each color space sequence starts with a leading nucleotide.
+ 
+-----
+
+**What it does**
+
+This tool converts a color space sequence to nucleotides. The leading character must be a nucleotide: A, C, G, or T. 
+ 
+-----
+
+**Example**
+
+- If the color space file looks like this::
+
+	&gt;seq1
+	A013
+	&gt;seq2
+	T011213122200221123032111221021210131332222101
+	
+- If you would like to **keep** the leading nucleotide::
+
+	&gt;seq1
+	AACG
+	&gt;seq2
+	TTGTCATGAGAAAGACAGCCGACACTCAAGTCAACGTATCTCTGGT
+	
+- If you **do not want to keep** the leading nucleotide (the length of nucleotide sequence will be one less than the color-space sequence)::
+ 
+ 	&gt;seq1
+ 	ACG
+ 	&gt;seq2
+	TGTCATGAGAAAGACAGCCGACACTCAAGTCAACGTATCTCTGGT 
+
+-----
+
+**ABI SOLiD Color Coding Alignment matrix**
+
+ Each di-nucleotide is represented by a single digit: 0 to 3. The matrix is symmetric, thus the leading nucleotide is necessary to determine the sequence (otherwise there are four possibilities).
+
+ 
+ .. image:: dualcolorcode.png
+
+
+</help>
+</tool>