Mercurial > repos > devteam > fasta_to_tabular

comparison fasta_to_tabular.xml @ 2:091edad7622f draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
"planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/fasta_to_tabular commit cd1ed08574b749eee2a3f6e6151dbb0c8ca15bbf"
author devteam
date Sun, 01 Mar 2020 07:25:01 -0500
parents 7e801ab2b70e
children e7ed3c310b74
comparison
equal deleted inserted replaced
1:7e801ab2b70e 2:091edad7622f
1 <tool id="fasta2tab" name="FASTA-to-Tabular" version="1.1.0"> 1 <tool id="fasta2tab" name="FASTA-to-Tabular" version="1.1.1" profile="16.04">
2 <description>converter</description> 2 <description>converter</description>
3 <command interpreter="python">fasta_to_tabular.py $input $output $keep_first $descr_columns</command> 3 <requirements>
4 <inputs> 4 <requirement type="package" version="3.7">python</requirement>
5 <param name="input" type="data" format="fasta" label="Convert these sequences"/> 5 </requirements>
6 <param name="descr_columns" type="integer" value="1" label="How many columns to divide title string into?" help="Typically 2 to take the ID (first word) and decription (rest) as two columns, or 1 to give a single column"> 6 <command>
7 <validator type="in_range" min="1" /> 7 python '$__tool_directory__/fasta_to_tabular.py' '$input' '$output' $keep_first $descr_columns
8 </param> 8 </command>
9 <param name="keep_first" type="integer" value="0" label="How many title characters to keep?" help="Applies only to the first column taken from the title string ('0' = keep the whole thing), useful when your sequence identifiers are all the same length."> 9 <inputs>
10 <validator type="in_range" min="0" /> 10 <param name="input" type="data" format="fasta" label="Convert these sequences"/>
11 </param> 11 <param name="descr_columns" type="integer" value="1" min="1" label="How many columns to divide title string into?" help="Typically 2 to take the ID (first word) and decription (rest) as two columns, or 1 to give a single column">
12 </inputs> 12 </param>
13 <outputs> 13 <param name="keep_first" type="integer" value="0" min="0" label="How many title characters to keep?" help="Applies only to the first column taken from the title string ('0' = keep the whole thing), useful when your sequence identifiers are all the same length.">
14 <data name="output" format="tabular"/> 14 </param>
15 </outputs> 15 </inputs>
16 <tests> 16 <outputs>
17 <test> 17 <data name="output" format="tabular"/>
18 <param name="input" value="454.fasta" /> 18 </outputs>
19 <param name="descr_columns" value="1"/> 19 <tests>
20 <param name="keep_first" value="0"/> 20 <test>
21 <output name="output" file="fasta_to_tabular_out1.tabular" /> 21 <param name="input" value="454.fasta" />
22 </test> 22 <param name="descr_columns" value="1"/>
23 23 <param name="keep_first" value="0"/>
24 <test> 24 <output name="output" file="fasta_to_tabular_out1.tabular" />
25 <param name="input" value="4.fasta" /> 25 </test>
26 <param name="descr_columns" value="1"/>
27 <param name="keep_first" value="0"/>
28 <output name="output" file="fasta_to_tabular_out2.tabular" />
29 </test>
30
31 <test>
32 <param name="input" value="454.fasta" />
33 <param name="descr_columns" value="1"/>
34 <param name="keep_first" value="14"/>
35 <output name="output" file="fasta_to_tabular_out3.tabular" />
36 </test>
37 26
38 <test> 27 <test>
39 <param name="input" value="454.fasta" /> 28 <param name="input" value="4.fasta" />
40 <param name="descr_columns" value="2"/> 29 <param name="descr_columns" value="1"/>
41 <param name="keep_first" value="0"/> 30 <param name="keep_first" value="0"/>
42 <output name="output" file="fasta_to_tabular_out4.tabular" /> 31 <output name="output" file="fasta_to_tabular_out2.tabular" />
43 </test> 32 </test>
44 33
45 <test> 34 <test>
46 <param name="input" value="454.fasta" /> 35 <param name="input" value="454.fasta" />
47 <param name="descr_columns" value="5"/> 36 <param name="descr_columns" value="1"/>
48 <param name="keep_first" value="0"/> 37 <param name="keep_first" value="14"/>
49 <output name="output" file="fasta_to_tabular_out5.tabular" /> 38 <output name="output" file="fasta_to_tabular_out3.tabular" />
50 </test> 39 </test>
51 40
52 <test> 41 <test>
53 <param name="input" value="454.fasta" /> 42 <param name="input" value="454.fasta" />
54 <param name="descr_columns" value="5"/> 43 <param name="descr_columns" value="2"/>
55 <param name="keep_first" value="10"/> 44 <param name="keep_first" value="0"/>
56 <output name="output" file="fasta_to_tabular_out6.tabular" /> 45 <output name="output" file="fasta_to_tabular_out4.tabular" />
57 </test> 46 </test>
58 47
59 </tests> 48 <test>
60 <help> 49 <param name="input" value="454.fasta" />
61 50 <param name="descr_columns" value="5"/>
51 <param name="keep_first" value="0"/>
52 <output name="output" file="fasta_to_tabular_out5.tabular" />
53 </test>
54
55 <test>
56 <param name="input" value="454.fasta" />
57 <param name="descr_columns" value="5"/>
58 <param name="keep_first" value="10"/>
59 <output name="output" file="fasta_to_tabular_out6.tabular" />
60 </test>
61
62 </tests>
63 <help><![CDATA[
64
62 **What it does** 65 **What it does**
63 66
64 This tool converts FASTA formatted sequences to TAB-delimited format. 67 This tool converts FASTA formatted sequences to TAB-delimited format.
65 68
66 Many tools consider the first word of the FASTA "&gt;" title line to be an identifier, and any remaining text to be a free form description. 69 Many tools consider the first word of the FASTA "&gt;" title line to be an identifier, and any remaining text to be a free form description.
68 In some cases the description can be usefully broken up into more columns -- see the examples . 71 In some cases the description can be usefully broken up into more columns -- see the examples .
69 72
70 The option *How many characters to keep?* allows to select a specified number of letters from the beginning of each FASTA entry. 73 The option *How many characters to keep?* allows to select a specified number of letters from the beginning of each FASTA entry.
71 With the introduction of the **How many columns to divide title string into?** option this setting is of limited use, but does still allow you to truncate the identifier. 74 With the introduction of the **How many columns to divide title string into?** option this setting is of limited use, but does still allow you to truncate the identifier.
72 75
73 ----- 76 -----
74 77
75 **Example** 78 **Example**
76 79
77 Suppose you have the following FASTA formatted sequences from a Roche (454) FLX sequencing run:: 80 Suppose you have the following FASTA formatted sequences from a Roche (454) FLX sequencing run::
78 81
79 &gt;EYKX4VC02EQLO5 length=108 xy=1826_0455 region=2 run=R_2007_11_07_16_15_57_ 82 >EYKX4VC02EQLO5 length=108 xy=1826_0455 region=2 run=R_2007_11_07_16_15_57_
80 TCCGCGCCGAGCATGCCCATCTTGGATTCCGGCGCGATGACCATCGCCCGCTCCACCACG 83 TCCGCGCCGAGCATGCCCATCTTGGATTCCGGCGCGATGACCATCGCCCGCTCCACCACG
81 TTCGGCCGGCCCTTCTCGTCGAGGAATGACACCAGCGCTTCGCCCACG 84 TTCGGCCGGCCCTTCTCGTCGAGGAATGACACCAGCGCTTCGCCCACG
82 &gt;EYKX4VC02D4GS2 length=60 xy=1573_3972 region=2 run=R_2007_11_07_16_15_57_ 85 >EYKX4VC02D4GS2 length=60 xy=1573_3972 region=2 run=R_2007_11_07_16_15_57_
83 AATAAAACTAAATCAGCAAAGACTGGCAAATACTCACAGGCTTATACAATACAAATGTAA 86 AATAAAACTAAATCAGCAAAGACTGGCAAATACTCACAGGCTTATACAATACAAATGTAA
84 87
85 Running this tool with the default settings will produce this (2 column output): 88 Running this tool with the default settings will produce this (2 column output):
86 89
87 ========================================================================== ======================================= 90 ========================================================================== =======================================
122 EYKX4VC02D length=60 xy=1573_3972 region=2 run=R_2007_11_07_16_15_57_ AATAAAACTAAATCAGCAAAGACTGGCAAATAC...TAA 125 EYKX4VC02D length=60 xy=1573_3972 region=2 run=R_2007_11_07_16_15_57_ AATAAAACTAAATCAGCAAAGACTGGCAAATAC...TAA
123 ========== ========== ============ ======== ========================== ======================================= 126 ========== ========== ============ ======== ========================== =======================================
124 127
125 Note the sequences have been truncated for display purposes in the above tables. 128 Note the sequences have been truncated for display purposes in the above tables.
126 129
127 </help> 130 ]]></help>
128 </tool> 131 </tool>