Mercurial > repos > devteam > fasta_to_tabular
diff fasta_to_tabular.xml @ 2:091edad7622f draft
"planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/fasta_to_tabular commit cd1ed08574b749eee2a3f6e6151dbb0c8ca15bbf"
| author | devteam |
|---|---|
| date | Sun, 01 Mar 2020 07:25:01 -0500 |
| parents | 7e801ab2b70e |
| children | e7ed3c310b74 |
line wrap: on
line diff
--- a/fasta_to_tabular.xml Wed Nov 11 12:14:09 2015 -0500 +++ b/fasta_to_tabular.xml Sun Mar 01 07:25:01 2020 -0500 @@ -1,64 +1,67 @@ -<tool id="fasta2tab" name="FASTA-to-Tabular" version="1.1.0"> - <description>converter</description> - <command interpreter="python">fasta_to_tabular.py $input $output $keep_first $descr_columns</command> - <inputs> - <param name="input" type="data" format="fasta" label="Convert these sequences"/> - <param name="descr_columns" type="integer" value="1" label="How many columns to divide title string into?" help="Typically 2 to take the ID (first word) and decription (rest) as two columns, or 1 to give a single column"> - <validator type="in_range" min="1" /> - </param> - <param name="keep_first" type="integer" value="0" label="How many title characters to keep?" help="Applies only to the first column taken from the title string ('0' = keep the whole thing), useful when your sequence identifiers are all the same length."> - <validator type="in_range" min="0" /> - </param> - </inputs> - <outputs> - <data name="output" format="tabular"/> - </outputs> - <tests> - <test> - <param name="input" value="454.fasta" /> - <param name="descr_columns" value="1"/> - <param name="keep_first" value="0"/> - <output name="output" file="fasta_to_tabular_out1.tabular" /> - </test> - - <test> - <param name="input" value="4.fasta" /> - <param name="descr_columns" value="1"/> - <param name="keep_first" value="0"/> - <output name="output" file="fasta_to_tabular_out2.tabular" /> - </test> - - <test> - <param name="input" value="454.fasta" /> - <param name="descr_columns" value="1"/> - <param name="keep_first" value="14"/> - <output name="output" file="fasta_to_tabular_out3.tabular" /> - </test> +<tool id="fasta2tab" name="FASTA-to-Tabular" version="1.1.1" profile="16.04"> + <description>converter</description> + <requirements> + <requirement type="package" version="3.7">python</requirement> + </requirements> + <command> +python '$__tool_directory__/fasta_to_tabular.py' '$input' '$output' $keep_first $descr_columns + </command> + <inputs> + <param name="input" type="data" format="fasta" label="Convert these sequences"/> + <param name="descr_columns" type="integer" value="1" min="1" label="How many columns to divide title string into?" help="Typically 2 to take the ID (first word) and decription (rest) as two columns, or 1 to give a single column"> + </param> + <param name="keep_first" type="integer" value="0" min="0" label="How many title characters to keep?" help="Applies only to the first column taken from the title string ('0' = keep the whole thing), useful when your sequence identifiers are all the same length."> + </param> + </inputs> + <outputs> + <data name="output" format="tabular"/> + </outputs> + <tests> + <test> + <param name="input" value="454.fasta" /> + <param name="descr_columns" value="1"/> + <param name="keep_first" value="0"/> + <output name="output" file="fasta_to_tabular_out1.tabular" /> + </test> - <test> - <param name="input" value="454.fasta" /> - <param name="descr_columns" value="2"/> - <param name="keep_first" value="0"/> - <output name="output" file="fasta_to_tabular_out4.tabular" /> - </test> + <test> + <param name="input" value="4.fasta" /> + <param name="descr_columns" value="1"/> + <param name="keep_first" value="0"/> + <output name="output" file="fasta_to_tabular_out2.tabular" /> + </test> + + <test> + <param name="input" value="454.fasta" /> + <param name="descr_columns" value="1"/> + <param name="keep_first" value="14"/> + <output name="output" file="fasta_to_tabular_out3.tabular" /> + </test> - <test> - <param name="input" value="454.fasta" /> - <param name="descr_columns" value="5"/> - <param name="keep_first" value="0"/> - <output name="output" file="fasta_to_tabular_out5.tabular" /> - </test> + <test> + <param name="input" value="454.fasta" /> + <param name="descr_columns" value="2"/> + <param name="keep_first" value="0"/> + <output name="output" file="fasta_to_tabular_out4.tabular" /> + </test> - <test> - <param name="input" value="454.fasta" /> - <param name="descr_columns" value="5"/> - <param name="keep_first" value="10"/> - <output name="output" file="fasta_to_tabular_out6.tabular" /> - </test> + <test> + <param name="input" value="454.fasta" /> + <param name="descr_columns" value="5"/> + <param name="keep_first" value="0"/> + <output name="output" file="fasta_to_tabular_out5.tabular" /> + </test> - </tests> - <help> - + <test> + <param name="input" value="454.fasta" /> + <param name="descr_columns" value="5"/> + <param name="keep_first" value="10"/> + <output name="output" file="fasta_to_tabular_out6.tabular" /> + </test> + + </tests> + <help><![CDATA[ + **What it does** This tool converts FASTA formatted sequences to TAB-delimited format. @@ -70,16 +73,16 @@ The option *How many characters to keep?* allows to select a specified number of letters from the beginning of each FASTA entry. With the introduction of the **How many columns to divide title string into?** option this setting is of limited use, but does still allow you to truncate the identifier. ------ +----- **Example** Suppose you have the following FASTA formatted sequences from a Roche (454) FLX sequencing run:: - >EYKX4VC02EQLO5 length=108 xy=1826_0455 region=2 run=R_2007_11_07_16_15_57_ + >EYKX4VC02EQLO5 length=108 xy=1826_0455 region=2 run=R_2007_11_07_16_15_57_ TCCGCGCCGAGCATGCCCATCTTGGATTCCGGCGCGATGACCATCGCCCGCTCCACCACG TTCGGCCGGCCCTTCTCGTCGAGGAATGACACCAGCGCTTCGCCCACG - >EYKX4VC02D4GS2 length=60 xy=1573_3972 region=2 run=R_2007_11_07_16_15_57_ + >EYKX4VC02D4GS2 length=60 xy=1573_3972 region=2 run=R_2007_11_07_16_15_57_ AATAAAACTAAATCAGCAAAGACTGGCAAATACTCACAGGCTTATACAATACAAATGTAA Running this tool with the default settings will produce this (2 column output): @@ -124,5 +127,5 @@ Note the sequences have been truncated for display purposes in the above tables. - </help> + ]]></help> </tool>