annotate megablast_xml_parser.xml @ 1:fbff957a3655 draft default tip

"planemo upload for repository https://github.com/galaxyproject/tools-devteam/tree/master/tools/megablast_xml_parser commit 3ccddd4e2032535ead030efa401e690ffb80d145"

<tool id="megablast_xml_parser" name="Parse blast XML output" version="1.0.1">
    <description></description>
    <requirements>
        <requirement type="package" version="3.8">python</requirement>
    </requirements>
    <command><![CDATA[
        python '$__tool_directory__/megablast_xml_parser.py' '$input1' '$output1'
    ]]></command>
    <inputs>
        <param name="input1" type="data" format="blastxml" label="Megablast XML output" />
    </inputs>
    <outputs>
        <data name="output1" format="tabular"/>
    </outputs>
    <tests>
        <test>
            <param name="input1" value="megablast_xml_parser_test1.gz" ftype="blastxml" />
            <output name="output1" file="megablast_xml_parser_test1_out.tabular" ftype="tabular" />
        </test>
    </tests>
<help>

**What it does**

This tool processes the XML output of any NCBI blast tool (if you run your own blast jobs, the XML output can be generated with **-m 7** option).

-----

**Output fields**

This tools returns tab-delimited output with the following fields::

    Description                               Example
    ----------------------------------------- ----------------- 

    1. Name of the query sequence             Seq1
    2. Length of the query sequence           30
    3. Name of target sequence                gnl|BL_ORD_ID|0
    4. Length of target sequence              5528445
    5. Alignment bit score                    59.96
    6. E-value                                8.38112e-11
    7. Start of alignment within query        1
    8. End of alignment within query          30
    9. Start of alignment within target       5436010
   10. End of alignment within target         5436039
   11. Query frame                            1
   12. Target frame                           1
   13. Number of identical bases within       29 
       the alignment
   14. Alignment length                       30 
   15. Aligned portion (sequence) of query    CGGACAGCGCCGCCACCAACAAAGCCACCA
   16. Aligned portion (sequence) of target   CGGACAGCGCCGCCACCAACAAAGCCATCA
   17. Midline indicating positions of        ||||||||||||||||||||||||||| || 
       matches within the alignment

------
       
.. class:: infomark

Note that this form of output does not contain alignment identify value. However, it can be computed by dividing the number of identical bases within the alignment (Field 13) by the alignment length (Field 14) using *Text Manipulation->Compute* tool 

    </help>
</tool>