Mercurial > repos > drosofff > metavisitor_workflows
comparison Galaxy-Workflow-Metavisitor__Workflow_for_small_RNA_profiling_of_contigs.ga @ 3:ba15c770fd40 draft
planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/workflows commit 9e3f79e20670526453bbed9f5b028aabb1bb7ae4
author | drosofff |
---|---|
date | Thu, 17 Nov 2016 07:27:04 -0500 |
parents | |
children |
comparison
equal
deleted
inserted
replaced
2:48b020a0d2f7 | 3:ba15c770fd40 |
---|---|
1 { | |
2 "a_galaxy_workflow": "true", | |
3 "annotation": "", | |
4 "format-version": "0.1", | |
5 "name": "Metavisitor: Workflow for small RNA profiling of contigs", | |
6 "steps": { | |
7 "0": { | |
8 "annotation": "", | |
9 "content_id": null, | |
10 "id": 0, | |
11 "input_connections": {}, | |
12 "inputs": [ | |
13 { | |
14 "description": "", | |
15 "name": "Input Dataset Collection of fastq reads" | |
16 } | |
17 ], | |
18 "label": null, | |
19 "name": "Input dataset collection", | |
20 "outputs": [], | |
21 "position": { | |
22 "left": 136, | |
23 "top": 213 | |
24 }, | |
25 "tool_errors": null, | |
26 "tool_id": null, | |
27 "tool_state": "{\"collection_type\": \"list\", \"name\": \"Input Dataset Collection of fastq reads\"}", | |
28 "tool_version": null, | |
29 "type": "data_collection_input", | |
30 "uuid": "95c42be8-325b-48dc-b325-c8e8f9bf8720", | |
31 "workflow_outputs": [ | |
32 { | |
33 "label": null, | |
34 "output_name": "output", | |
35 "uuid": "b0b38a3f-6467-4a79-8e6c-616befcfae74" | |
36 } | |
37 ] | |
38 }, | |
39 "1": { | |
40 "annotation": "", | |
41 "content_id": null, | |
42 "id": 1, | |
43 "input_connections": {}, | |
44 "inputs": [ | |
45 { | |
46 "description": "", | |
47 "name": "de novo assembled Oases contigs" | |
48 } | |
49 ], | |
50 "label": null, | |
51 "name": "Input dataset", | |
52 "outputs": [], | |
53 "position": { | |
54 "left": 134.5, | |
55 "top": 401 | |
56 }, | |
57 "tool_errors": null, | |
58 "tool_id": null, | |
59 "tool_state": "{\"name\": \"de novo assembled Oases contigs\"}", | |
60 "tool_version": null, | |
61 "type": "data_input", | |
62 "uuid": "654820a8-188a-4b01-8e7f-4483c8df585f", | |
63 "workflow_outputs": [ | |
64 { | |
65 "label": null, | |
66 "output_name": "output", | |
67 "uuid": "4918a4f9-037a-41c8-9881-3f91784b7666" | |
68 } | |
69 ] | |
70 }, | |
71 "2": { | |
72 "annotation": "", | |
73 "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/yac_clipper/yac/1.3.6", | |
74 "id": 2, | |
75 "input_connections": { | |
76 "input": { | |
77 "id": 0, | |
78 "output_name": "output" | |
79 } | |
80 }, | |
81 "inputs": [ | |
82 { | |
83 "description": "runtime parameter for tool Clip adapter", | |
84 "name": "input" | |
85 } | |
86 ], | |
87 "label": null, | |
88 "name": "Clip adapter", | |
89 "outputs": [ | |
90 { | |
91 "name": "output", | |
92 "type": "fasta" | |
93 } | |
94 ], | |
95 "position": { | |
96 "left": 407.5, | |
97 "top": 239 | |
98 }, | |
99 "post_job_actions": { | |
100 "RenameDatasetActionoutput": { | |
101 "action_arguments": { | |
102 "newname": "Clipped reads" | |
103 }, | |
104 "action_type": "RenameDatasetAction", | |
105 "output_name": "output" | |
106 } | |
107 }, | |
108 "tool_errors": null, | |
109 "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/yac_clipper/yac/1.3.6", | |
110 "tool_shed_repository": { | |
111 "changeset_revision": "a18edcf9c7ed", | |
112 "name": "yac_clipper", | |
113 "owner": "drosofff", | |
114 "tool_shed": "toolshed.g2.bx.psu.edu" | |
115 }, | |
116 "tool_state": "{\"out_format\": \"\\\"fasta\\\"\", \"__page__\": 0, \"min\": \"\\\"18\\\"\", \"max\": \"\\\"30\\\"\", \"__rerun_remap_job_id__\": null, \"clip_source\": \"{\\\"clip_source_list\\\": \\\"prebuilt\\\", \\\"clip_sequence\\\": \\\"TGGAATTCTCGGGTGCCAAG\\\", \\\"__current_case__\\\": 0}\", \"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"Nmode\": \"\\\"reject\\\"\"}", | |
117 "tool_version": "1.3.6", | |
118 "type": "tool", | |
119 "uuid": "98bb84f7-1199-4755-80e8-47e4cd8d7229", | |
120 "workflow_outputs": [ | |
121 { | |
122 "label": null, | |
123 "output_name": "output", | |
124 "uuid": "69ef3522-aeb9-4145-a95b-74154c090d35" | |
125 } | |
126 ] | |
127 }, | |
128 "3": { | |
129 "annotation": "", | |
130 "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/fasta_filter_by_length/fasta_filter_by_length/1.1", | |
131 "id": 3, | |
132 "input_connections": { | |
133 "input": { | |
134 "id": 1, | |
135 "output_name": "output" | |
136 } | |
137 }, | |
138 "inputs": [ | |
139 { | |
140 "description": "runtime parameter for tool Filter sequences by length", | |
141 "name": "input" | |
142 } | |
143 ], | |
144 "label": null, | |
145 "name": "Filter sequences by length", | |
146 "outputs": [ | |
147 { | |
148 "name": "output", | |
149 "type": "fasta" | |
150 } | |
151 ], | |
152 "position": { | |
153 "left": 364, | |
154 "top": 387 | |
155 }, | |
156 "post_job_actions": { | |
157 "RenameDatasetActionoutput": { | |
158 "action_arguments": { | |
159 "newname": "Contig (>300 nt)" | |
160 }, | |
161 "action_type": "RenameDatasetAction", | |
162 "output_name": "output" | |
163 } | |
164 }, | |
165 "tool_errors": null, | |
166 "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/fasta_filter_by_length/fasta_filter_by_length/1.1", | |
167 "tool_shed_repository": { | |
168 "changeset_revision": "c8cd0a03db49", | |
169 "name": "fasta_filter_by_length", | |
170 "owner": "devteam", | |
171 "tool_shed": "toolshed.g2.bx.psu.edu" | |
172 }, | |
173 "tool_state": "{\"__page__\": 0, \"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"__rerun_remap_job_id__\": null, \"max_length\": \"\\\"0\\\"\", \"min_length\": \"\\\"300\\\"\"}", | |
174 "tool_version": "1.1", | |
175 "type": "tool", | |
176 "uuid": "a66d2ce5-bb0a-433c-b8ea-ea612128ee09", | |
177 "workflow_outputs": [ | |
178 { | |
179 "label": null, | |
180 "output_name": "output", | |
181 "uuid": "cfc01174-02dc-457e-a178-493cef1813ea" | |
182 } | |
183 ] | |
184 }, | |
185 "4": { | |
186 "annotation": "", | |
187 "content_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", | |
188 "id": 4, | |
189 "input_connections": { | |
190 "input": { | |
191 "id": 2, | |
192 "output_name": "output" | |
193 } | |
194 }, | |
195 "inputs": [ | |
196 { | |
197 "description": "runtime parameter for tool Concatenate multiple datasets", | |
198 "name": "input" | |
199 } | |
200 ], | |
201 "label": null, | |
202 "name": "Concatenate multiple datasets", | |
203 "outputs": [ | |
204 { | |
205 "name": "out_file1", | |
206 "type": "input" | |
207 } | |
208 ], | |
209 "position": { | |
210 "left": 627, | |
211 "top": 247 | |
212 }, | |
213 "post_job_actions": { | |
214 "RenameDatasetActionout_file1": { | |
215 "action_arguments": { | |
216 "newname": "Merged Clipped Reads" | |
217 }, | |
218 "action_type": "RenameDatasetAction", | |
219 "output_name": "out_file1" | |
220 } | |
221 }, | |
222 "tool_errors": null, | |
223 "tool_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", | |
224 "tool_shed_repository": { | |
225 "changeset_revision": "201c568972c3", | |
226 "name": "concatenate_multiple_datasets", | |
227 "owner": "mvdbeek", | |
228 "tool_shed": "toolshed.g2.bx.psu.edu" | |
229 }, | |
230 "tool_state": "{\"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"__rerun_remap_job_id__\": null, \"__page__\": 0}", | |
231 "tool_version": "0.2", | |
232 "type": "tool", | |
233 "uuid": "c54ed9da-2b31-413b-94fc-3ebf21295d50", | |
234 "workflow_outputs": [ | |
235 { | |
236 "label": null, | |
237 "output_name": "out_file1", | |
238 "uuid": "308b80b9-5d82-4d46-865b-233498602a8a" | |
239 } | |
240 ] | |
241 }, | |
242 "5": { | |
243 "annotation": "", | |
244 "content_id": "toolshed.g2.bx.psu.edu/repos/jjohnson/regex_find_replace/regex1/0.1.0", | |
245 "id": 5, | |
246 "input_connections": { | |
247 "input": { | |
248 "id": 3, | |
249 "output_name": "output" | |
250 } | |
251 }, | |
252 "inputs": [ | |
253 { | |
254 "description": "runtime parameter for tool Regex Find And Replace", | |
255 "name": "input" | |
256 } | |
257 ], | |
258 "label": null, | |
259 "name": "Regex Find And Replace", | |
260 "outputs": [ | |
261 { | |
262 "name": "out_file1", | |
263 "type": "input" | |
264 } | |
265 ], | |
266 "position": { | |
267 "left": 649, | |
268 "top": 381 | |
269 }, | |
270 "post_job_actions": { | |
271 "RenameDatasetActionout_file1": { | |
272 "action_arguments": { | |
273 "newname": "contig (>300t, simplified names)" | |
274 }, | |
275 "action_type": "RenameDatasetAction", | |
276 "output_name": "out_file1" | |
277 } | |
278 }, | |
279 "tool_errors": null, | |
280 "tool_id": "toolshed.g2.bx.psu.edu/repos/jjohnson/regex_find_replace/regex1/0.1.0", | |
281 "tool_shed_repository": { | |
282 "changeset_revision": "9ea374bb0350", | |
283 "name": "regex_find_replace", | |
284 "owner": "jjohnson", | |
285 "tool_shed": "toolshed.g2.bx.psu.edu" | |
286 }, | |
287 "tool_state": "{\"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"__rerun_remap_job_id__\": null, \"checks\": \"[{\\\"__index__\\\": 0, \\\"replacement\\\": \\\"\\\", \\\"pattern\\\": \\\"_Confidence_.+\\\"}]\", \"__page__\": 0}", | |
288 "tool_version": "0.1.0", | |
289 "type": "tool", | |
290 "uuid": "4fd98d0b-2ffc-4636-b0dc-c52882a0bb70", | |
291 "workflow_outputs": [ | |
292 { | |
293 "label": null, | |
294 "output_name": "out_file1", | |
295 "uuid": "1d62f8d5-96b9-437b-96ef-51c809eeec5c" | |
296 } | |
297 ] | |
298 }, | |
299 "6": { | |
300 "annotation": "", | |
301 "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_bowtie/bowtieForSmallRNA/1.1.2.1", | |
302 "id": 6, | |
303 "input_connections": { | |
304 "input": { | |
305 "id": 4, | |
306 "output_name": "out_file1" | |
307 }, | |
308 "refGenomeSource|ownFile": { | |
309 "id": 5, | |
310 "output_name": "out_file1" | |
311 } | |
312 }, | |
313 "inputs": [ | |
314 { | |
315 "description": "runtime parameter for tool sRbowtie", | |
316 "name": "input" | |
317 }, | |
318 { | |
319 "description": "runtime parameter for tool sRbowtie", | |
320 "name": "refGenomeSource" | |
321 } | |
322 ], | |
323 "label": null, | |
324 "name": "sRbowtie", | |
325 "outputs": [ | |
326 { | |
327 "name": "output", | |
328 "type": "tabular" | |
329 }, | |
330 { | |
331 "name": "aligned", | |
332 "type": "fasta" | |
333 }, | |
334 { | |
335 "name": "unaligned", | |
336 "type": "fasta" | |
337 } | |
338 ], | |
339 "position": { | |
340 "left": 942.5, | |
341 "top": 287 | |
342 }, | |
343 "post_job_actions": { | |
344 "HideDatasetActionaligned": { | |
345 "action_arguments": {}, | |
346 "action_type": "HideDatasetAction", | |
347 "output_name": "aligned" | |
348 }, | |
349 "HideDatasetActionunaligned": { | |
350 "action_arguments": {}, | |
351 "action_type": "HideDatasetAction", | |
352 "output_name": "unaligned" | |
353 } | |
354 }, | |
355 "tool_errors": null, | |
356 "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_bowtie/bowtieForSmallRNA/1.1.2.1", | |
357 "tool_shed_repository": { | |
358 "changeset_revision": "615d2550977f", | |
359 "name": "msp_sr_bowtie", | |
360 "owner": "drosofff", | |
361 "tool_shed": "toolshed.g2.bx.psu.edu" | |
362 }, | |
363 "tool_state": "{\"__page__\": 0, \"output_format\": \"\\\"tabular\\\"\", \"additional_fasta\": \"\\\"No\\\"\", \"v_mismatches\": \"\\\"0\\\"\", \"__rerun_remap_job_id__\": null, \"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"refGenomeSource\": \"{\\\"genomeSource\\\": \\\"history\\\", \\\"ownFile\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}, \\\"__current_case__\\\": 1}\", \"method\": \"\\\"a_option\\\"\"}", | |
364 "tool_version": "1.1.2.1", | |
365 "type": "tool", | |
366 "uuid": "b4d59da2-94c7-4607-8c51-6287b9dd6e6c", | |
367 "workflow_outputs": [ | |
368 { | |
369 "label": null, | |
370 "output_name": "output", | |
371 "uuid": "400d7592-b9b5-4c70-ba7f-058c656bd305" | |
372 } | |
373 ] | |
374 }, | |
375 "7": { | |
376 "annotation": "", | |
377 "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_readmap_and_size_histograms/Readmap/1.2.0", | |
378 "id": 7, | |
379 "input_connections": { | |
380 "refGenomeSource|ownFile": { | |
381 "id": 5, | |
382 "output_name": "out_file1" | |
383 }, | |
384 "refGenomeSource|series_0|input": { | |
385 "id": 6, | |
386 "output_name": "output" | |
387 } | |
388 }, | |
389 "inputs": [ | |
390 { | |
391 "description": "runtime parameter for tool Generate readmap and histograms from alignment files", | |
392 "name": "gff" | |
393 }, | |
394 { | |
395 "description": "runtime parameter for tool Generate readmap and histograms from alignment files", | |
396 "name": "refGenomeSource" | |
397 } | |
398 ], | |
399 "label": null, | |
400 "name": "Generate readmap and histograms from alignment files", | |
401 "outputs": [ | |
402 { | |
403 "name": "readmap_dataframe", | |
404 "type": "tabular" | |
405 }, | |
406 { | |
407 "name": "size_distribution_dataframe", | |
408 "type": "tabular" | |
409 }, | |
410 { | |
411 "name": "readmap_PDF", | |
412 "type": "pdf" | |
413 }, | |
414 { | |
415 "name": "size_PDF", | |
416 "type": "pdf" | |
417 }, | |
418 { | |
419 "name": "combi_PDF", | |
420 "type": "pdf" | |
421 } | |
422 ], | |
423 "position": { | |
424 "left": 1243.5, | |
425 "top": 273 | |
426 }, | |
427 "post_job_actions": { | |
428 "HideDatasetActionreadmap_dataframe": { | |
429 "action_arguments": {}, | |
430 "action_type": "HideDatasetAction", | |
431 "output_name": "readmap_dataframe" | |
432 }, | |
433 "HideDatasetActionsize_distribution_dataframe": { | |
434 "action_arguments": {}, | |
435 "action_type": "HideDatasetAction", | |
436 "output_name": "size_distribution_dataframe" | |
437 } | |
438 }, | |
439 "tool_errors": null, | |
440 "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_readmap_and_size_histograms/Readmap/1.2.0", | |
441 "tool_shed_repository": { | |
442 "changeset_revision": "92898cc3ea19", | |
443 "name": "msp_sr_readmap_and_size_histograms", | |
444 "owner": "drosofff", | |
445 "tool_shed": "toolshed.g2.bx.psu.edu" | |
446 }, | |
447 "tool_state": "{\"minquery\": \"\\\"18\\\"\", \"__page__\": 0, \"rows_per_page\": \"\\\"8\\\"\", \"yrange\": \"\\\"0\\\"\", \"title\": \"\\\"Readmaps and size distributions\\\"\", \"refGenomeSource\": \"{\\\"genomeSource\\\": \\\"history\\\", \\\"series\\\": [{\\\"__index__\\\": 0, \\\"norm\\\": \\\"1.0\\\", \\\"input\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}}], \\\"ownFile\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}, \\\"__current_case__\\\": 1}\", \"__rerun_remap_job_id__\": null, \"maxquery\": \"\\\"30\\\"\", \"xlabel\": \"\\\"Coordinates/read size\\\"\", \"ylabel\": \"\\\"Number of reads\\\"\", \"gff\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\"}", | |
448 "tool_version": "1.2.0", | |
449 "type": "tool", | |
450 "uuid": "87f9f9b5-5c71-465b-9422-c0696a3048a5", | |
451 "workflow_outputs": [ | |
452 { | |
453 "label": null, | |
454 "output_name": "size_PDF", | |
455 "uuid": "91fa9c78-72dd-41e8-9937-c4b44682f79b" | |
456 }, | |
457 { | |
458 "label": null, | |
459 "output_name": "combi_PDF", | |
460 "uuid": "68f021f3-087b-4f77-813f-74fa61877a0e" | |
461 }, | |
462 { | |
463 "label": null, | |
464 "output_name": "readmap_PDF", | |
465 "uuid": "70966192-62e8-4dff-99b1-3f5dc8de8c28" | |
466 } | |
467 ] | |
468 } | |
469 }, | |
470 "uuid": "c3853e65-8d66-47fc-aad9-6a40f5517622" | |
471 } |