Mercurial > repos > drosofff > metavisitor_workflows
diff Galaxy-Workflow-Metavisitor__Workflow_for_small_RNA_profiling_of_contigs.ga @ 3:ba15c770fd40 draft
planemo upload for repository https://github.com/ARTbio/tools-artbio/tree/master/workflows commit 9e3f79e20670526453bbed9f5b028aabb1bb7ae4
author | drosofff |
---|---|
date | Thu, 17 Nov 2016 07:27:04 -0500 |
parents | |
children |
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/Galaxy-Workflow-Metavisitor__Workflow_for_small_RNA_profiling_of_contigs.ga Thu Nov 17 07:27:04 2016 -0500 @@ -0,0 +1,471 @@ +{ + "a_galaxy_workflow": "true", + "annotation": "", + "format-version": "0.1", + "name": "Metavisitor: Workflow for small RNA profiling of contigs", + "steps": { + "0": { + "annotation": "", + "content_id": null, + "id": 0, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "Input Dataset Collection of fastq reads" + } + ], + "label": null, + "name": "Input dataset collection", + "outputs": [], + "position": { + "left": 136, + "top": 213 + }, + "tool_errors": null, + "tool_id": null, + "tool_state": "{\"collection_type\": \"list\", \"name\": \"Input Dataset Collection of fastq reads\"}", + "tool_version": null, + "type": "data_collection_input", + "uuid": "95c42be8-325b-48dc-b325-c8e8f9bf8720", + "workflow_outputs": [ + { + "label": null, + "output_name": "output", + "uuid": "b0b38a3f-6467-4a79-8e6c-616befcfae74" + } + ] + }, + "1": { + "annotation": "", + "content_id": null, + "id": 1, + "input_connections": {}, + "inputs": [ + { + "description": "", + "name": "de novo assembled Oases contigs" + } + ], + "label": null, + "name": "Input dataset", + "outputs": [], + "position": { + "left": 134.5, + "top": 401 + }, + "tool_errors": null, + "tool_id": null, + "tool_state": "{\"name\": \"de novo assembled Oases contigs\"}", + "tool_version": null, + "type": "data_input", + "uuid": "654820a8-188a-4b01-8e7f-4483c8df585f", + "workflow_outputs": [ + { + "label": null, + "output_name": "output", + "uuid": "4918a4f9-037a-41c8-9881-3f91784b7666" + } + ] + }, + "2": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/yac_clipper/yac/1.3.6", + "id": 2, + "input_connections": { + "input": { + "id": 0, + "output_name": "output" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool Clip adapter", + "name": "input" + } + ], + "label": null, + "name": "Clip adapter", + "outputs": [ + { + "name": "output", + "type": "fasta" + } + ], + "position": { + "left": 407.5, + "top": 239 + }, + "post_job_actions": { + "RenameDatasetActionoutput": { + "action_arguments": { + "newname": "Clipped reads" + }, + "action_type": "RenameDatasetAction", + "output_name": "output" + } + }, + "tool_errors": null, + "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/yac_clipper/yac/1.3.6", + "tool_shed_repository": { + "changeset_revision": "a18edcf9c7ed", + "name": "yac_clipper", + "owner": "drosofff", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"out_format\": \"\\\"fasta\\\"\", \"__page__\": 0, \"min\": \"\\\"18\\\"\", \"max\": \"\\\"30\\\"\", \"__rerun_remap_job_id__\": null, \"clip_source\": \"{\\\"clip_source_list\\\": \\\"prebuilt\\\", \\\"clip_sequence\\\": \\\"TGGAATTCTCGGGTGCCAAG\\\", \\\"__current_case__\\\": 0}\", \"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"Nmode\": \"\\\"reject\\\"\"}", + "tool_version": "1.3.6", + "type": "tool", + "uuid": "98bb84f7-1199-4755-80e8-47e4cd8d7229", + "workflow_outputs": [ + { + "label": null, + "output_name": "output", + "uuid": "69ef3522-aeb9-4145-a95b-74154c090d35" + } + ] + }, + "3": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/devteam/fasta_filter_by_length/fasta_filter_by_length/1.1", + "id": 3, + "input_connections": { + "input": { + "id": 1, + "output_name": "output" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool Filter sequences by length", + "name": "input" + } + ], + "label": null, + "name": "Filter sequences by length", + "outputs": [ + { + "name": "output", + "type": "fasta" + } + ], + "position": { + "left": 364, + "top": 387 + }, + "post_job_actions": { + "RenameDatasetActionoutput": { + "action_arguments": { + "newname": "Contig (>300 nt)" + }, + "action_type": "RenameDatasetAction", + "output_name": "output" + } + }, + "tool_errors": null, + "tool_id": "toolshed.g2.bx.psu.edu/repos/devteam/fasta_filter_by_length/fasta_filter_by_length/1.1", + "tool_shed_repository": { + "changeset_revision": "c8cd0a03db49", + "name": "fasta_filter_by_length", + "owner": "devteam", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"__page__\": 0, \"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"__rerun_remap_job_id__\": null, \"max_length\": \"\\\"0\\\"\", \"min_length\": \"\\\"300\\\"\"}", + "tool_version": "1.1", + "type": "tool", + "uuid": "a66d2ce5-bb0a-433c-b8ea-ea612128ee09", + "workflow_outputs": [ + { + "label": null, + "output_name": "output", + "uuid": "cfc01174-02dc-457e-a178-493cef1813ea" + } + ] + }, + "4": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", + "id": 4, + "input_connections": { + "input": { + "id": 2, + "output_name": "output" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool Concatenate multiple datasets", + "name": "input" + } + ], + "label": null, + "name": "Concatenate multiple datasets", + "outputs": [ + { + "name": "out_file1", + "type": "input" + } + ], + "position": { + "left": 627, + "top": 247 + }, + "post_job_actions": { + "RenameDatasetActionout_file1": { + "action_arguments": { + "newname": "Merged Clipped Reads" + }, + "action_type": "RenameDatasetAction", + "output_name": "out_file1" + } + }, + "tool_errors": null, + "tool_id": "toolshed.g2.bx.psu.edu/repos/mvdbeek/concatenate_multiple_datasets/cat_multiple/0.2", + "tool_shed_repository": { + "changeset_revision": "201c568972c3", + "name": "concatenate_multiple_datasets", + "owner": "mvdbeek", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"__rerun_remap_job_id__\": null, \"__page__\": 0}", + "tool_version": "0.2", + "type": "tool", + "uuid": "c54ed9da-2b31-413b-94fc-3ebf21295d50", + "workflow_outputs": [ + { + "label": null, + "output_name": "out_file1", + "uuid": "308b80b9-5d82-4d46-865b-233498602a8a" + } + ] + }, + "5": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/jjohnson/regex_find_replace/regex1/0.1.0", + "id": 5, + "input_connections": { + "input": { + "id": 3, + "output_name": "output" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool Regex Find And Replace", + "name": "input" + } + ], + "label": null, + "name": "Regex Find And Replace", + "outputs": [ + { + "name": "out_file1", + "type": "input" + } + ], + "position": { + "left": 649, + "top": 381 + }, + "post_job_actions": { + "RenameDatasetActionout_file1": { + "action_arguments": { + "newname": "contig (>300t, simplified names)" + }, + "action_type": "RenameDatasetAction", + "output_name": "out_file1" + } + }, + "tool_errors": null, + "tool_id": "toolshed.g2.bx.psu.edu/repos/jjohnson/regex_find_replace/regex1/0.1.0", + "tool_shed_repository": { + "changeset_revision": "9ea374bb0350", + "name": "regex_find_replace", + "owner": "jjohnson", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"__rerun_remap_job_id__\": null, \"checks\": \"[{\\\"__index__\\\": 0, \\\"replacement\\\": \\\"\\\", \\\"pattern\\\": \\\"_Confidence_.+\\\"}]\", \"__page__\": 0}", + "tool_version": "0.1.0", + "type": "tool", + "uuid": "4fd98d0b-2ffc-4636-b0dc-c52882a0bb70", + "workflow_outputs": [ + { + "label": null, + "output_name": "out_file1", + "uuid": "1d62f8d5-96b9-437b-96ef-51c809eeec5c" + } + ] + }, + "6": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_bowtie/bowtieForSmallRNA/1.1.2.1", + "id": 6, + "input_connections": { + "input": { + "id": 4, + "output_name": "out_file1" + }, + "refGenomeSource|ownFile": { + "id": 5, + "output_name": "out_file1" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool sRbowtie", + "name": "input" + }, + { + "description": "runtime parameter for tool sRbowtie", + "name": "refGenomeSource" + } + ], + "label": null, + "name": "sRbowtie", + "outputs": [ + { + "name": "output", + "type": "tabular" + }, + { + "name": "aligned", + "type": "fasta" + }, + { + "name": "unaligned", + "type": "fasta" + } + ], + "position": { + "left": 942.5, + "top": 287 + }, + "post_job_actions": { + "HideDatasetActionaligned": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "aligned" + }, + "HideDatasetActionunaligned": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "unaligned" + } + }, + "tool_errors": null, + "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_bowtie/bowtieForSmallRNA/1.1.2.1", + "tool_shed_repository": { + "changeset_revision": "615d2550977f", + "name": "msp_sr_bowtie", + "owner": "drosofff", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"__page__\": 0, \"output_format\": \"\\\"tabular\\\"\", \"additional_fasta\": \"\\\"No\\\"\", \"v_mismatches\": \"\\\"0\\\"\", \"__rerun_remap_job_id__\": null, \"input\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\", \"refGenomeSource\": \"{\\\"genomeSource\\\": \\\"history\\\", \\\"ownFile\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}, \\\"__current_case__\\\": 1}\", \"method\": \"\\\"a_option\\\"\"}", + "tool_version": "1.1.2.1", + "type": "tool", + "uuid": "b4d59da2-94c7-4607-8c51-6287b9dd6e6c", + "workflow_outputs": [ + { + "label": null, + "output_name": "output", + "uuid": "400d7592-b9b5-4c70-ba7f-058c656bd305" + } + ] + }, + "7": { + "annotation": "", + "content_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_readmap_and_size_histograms/Readmap/1.2.0", + "id": 7, + "input_connections": { + "refGenomeSource|ownFile": { + "id": 5, + "output_name": "out_file1" + }, + "refGenomeSource|series_0|input": { + "id": 6, + "output_name": "output" + } + }, + "inputs": [ + { + "description": "runtime parameter for tool Generate readmap and histograms from alignment files", + "name": "gff" + }, + { + "description": "runtime parameter for tool Generate readmap and histograms from alignment files", + "name": "refGenomeSource" + } + ], + "label": null, + "name": "Generate readmap and histograms from alignment files", + "outputs": [ + { + "name": "readmap_dataframe", + "type": "tabular" + }, + { + "name": "size_distribution_dataframe", + "type": "tabular" + }, + { + "name": "readmap_PDF", + "type": "pdf" + }, + { + "name": "size_PDF", + "type": "pdf" + }, + { + "name": "combi_PDF", + "type": "pdf" + } + ], + "position": { + "left": 1243.5, + "top": 273 + }, + "post_job_actions": { + "HideDatasetActionreadmap_dataframe": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "readmap_dataframe" + }, + "HideDatasetActionsize_distribution_dataframe": { + "action_arguments": {}, + "action_type": "HideDatasetAction", + "output_name": "size_distribution_dataframe" + } + }, + "tool_errors": null, + "tool_id": "toolshed.g2.bx.psu.edu/repos/drosofff/msp_sr_readmap_and_size_histograms/Readmap/1.2.0", + "tool_shed_repository": { + "changeset_revision": "92898cc3ea19", + "name": "msp_sr_readmap_and_size_histograms", + "owner": "drosofff", + "tool_shed": "toolshed.g2.bx.psu.edu" + }, + "tool_state": "{\"minquery\": \"\\\"18\\\"\", \"__page__\": 0, \"rows_per_page\": \"\\\"8\\\"\", \"yrange\": \"\\\"0\\\"\", \"title\": \"\\\"Readmaps and size distributions\\\"\", \"refGenomeSource\": \"{\\\"genomeSource\\\": \\\"history\\\", \\\"series\\\": [{\\\"__index__\\\": 0, \\\"norm\\\": \\\"1.0\\\", \\\"input\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}}], \\\"ownFile\\\": {\\\"__class__\\\": \\\"RuntimeValue\\\"}, \\\"__current_case__\\\": 1}\", \"__rerun_remap_job_id__\": null, \"maxquery\": \"\\\"30\\\"\", \"xlabel\": \"\\\"Coordinates/read size\\\"\", \"ylabel\": \"\\\"Number of reads\\\"\", \"gff\": \"{\\\"__class__\\\": \\\"RuntimeValue\\\"}\"}", + "tool_version": "1.2.0", + "type": "tool", + "uuid": "87f9f9b5-5c71-465b-9422-c0696a3048a5", + "workflow_outputs": [ + { + "label": null, + "output_name": "size_PDF", + "uuid": "91fa9c78-72dd-41e8-9937-c4b44682f79b" + }, + { + "label": null, + "output_name": "combi_PDF", + "uuid": "68f021f3-087b-4f77-813f-74fa61877a0e" + }, + { + "label": null, + "output_name": "readmap_PDF", + "uuid": "70966192-62e8-4dff-99b1-3f5dc8de8c28" + } + ] + } + }, + "uuid": "c3853e65-8d66-47fc-aad9-6a40f5517622" +} \ No newline at end of file