Mercurial > repos > galaxyp > fasta_merge_files_and_filter_unique_sequences

changeset 1:74144834b0bd draft

Find changesets by keywords (author, files, the commit message), revision number or hash, or revset expression.
planemo upload for repository https://github.com/galaxyproteomics/tools-galaxyp/tree/master/tools/fasta_merge_files_and_filter_unique_sequences commit 9f9eba8df62b4db1ef35718d880a1bcda7457b99
author galaxyp
date Fri, 16 Dec 2016 05:19:27 -0500
parents 2904d46167da
children 379c41d859aa
files README.md fasta_merge_files_and_filter_unique_sequences.py fasta_merge_files_and_filter_unique_sequences.xml test-data/1.fa test-data/2.fa test-data/res.fa
diffstat 6 files changed, 67 insertions(+), 31 deletions(-) [+]
line wrap: on
line diff
--- a/README.md	Fri Sep 26 14:02:14 2014 -0400
+++ b/README.md	Fri Dec 16 05:19:27 2016 -0500
@@ -1,7 +1,7 @@
-GalaxyP - Protein Database Downloader
-=====================================
+GalaxyP - FASTA Merge Files and Filter Unique Sequences
+=======================================================
 
-* Home: <https://bitbucket.org/galaxyp/fasta_merge_files_and_filter_unique_sequences>
+* Home: <https://github.com/galaxyproteomics/tools-galaxyp/>
 * Galaxy Tool Shed: <http://toolshed.g2.bx.psu.edu/view/galaxyp/fasta_merge_files_and_filter_unique_sequences>
 * Tool ID: `fasta_merge_files_and_filter_unique_sequences`
 
@@ -15,9 +15,9 @@
 GalaxyP Community
 -----------------
 
-Current governing community policies for [GalaxyP](https://bitbucket.org/galaxyp/) and other information can be found at:
+Current governing community policies for [GalaxyP](https://github.com/galaxyproteomics/) and other information can be found at:
 
-<https://bitbucket.org/galaxyp/galaxyp>
+<https://github.com/galaxyproteomics>
 
 
 License
@@ -35,7 +35,7 @@
 Contributing
 ------------
 
-Contributions to this repository are reviewed through pull requests. If you would like your work acknowledged, please also add yourself to the Authors section. If your pull request is accepted, you will also be acknowledged in <https://bitbucket.org/galaxyp/galaxyp/CONTRIBUTORS.md> unless you opt-out.
+Contributions to this repository are reviewed through pull requests. If you would like your work acknowledged, please also add yourself to the Authors section. If your pull request is accepted, you will also be acknowledged in <https://github.com/galaxyproteomics/tools-galaxyp/>
 
 
 Authors
--- a/fasta_merge_files_and_filter_unique_sequences.py	Fri Sep 26 14:02:14 2014 -0400
+++ b/fasta_merge_files_and_filter_unique_sequences.py	Fri Dec 16 05:19:27 2016 -0500
@@ -1,7 +1,7 @@
 #!/usr/bin/env python
-import sys,os
+import os
+import sys
 
-#====================================================================== Classes
 class Sequence:
     ''' Holds protein sequence information '''
     def __init__(self):
@@ -56,7 +56,6 @@
                 pass
             else:
                 seen_sequences.add(protein.sequence)
-
                 out_file.write(protein.header)
                 out_file.write(os.linesep)
                 out_file.write(protein.sequence)
--- a/fasta_merge_files_and_filter_unique_sequences.xml	Fri Sep 26 14:02:14 2014 -0400
+++ b/fasta_merge_files_and_filter_unique_sequences.xml	Fri Dec 16 05:19:27 2016 -0500
@@ -1,23 +1,40 @@
-<tool id="fasta_merge_files_and_filter_unique_sequences" version="1.0" name="FASTA Merge Files and Filter Unique Sequences">
-  <description>
-    Concatenate FASTA database files together. Only first appearence
-    of each unique sequence will appear in output.
-  </description>
-  <command interpreter="python">
-    fasta_merge_files_and_filter_unique_sequences.py
-    $output
-    #for input in $inputs
-    $input.input
-    #end for
-  </command>
-  <inputs>
-    <repeat name="inputs" title="Input FASTA File(s)">
-      <param format="fasta" name="input" type="data" label="FASTA File"/>
-    </repeat>
-  </inputs>
-  <outputs>
-    <data format="fasta" name="output" label="Merged and Filtered FASTA from ${on_string}"/>
-  </outputs>
-  <help>
-  </help>
+<tool id="fasta_merge_files_and_filter_unique_sequences" name="FASTA Merge Files and Filter Unique Sequences" version="1.1">
+    <description>Concatenate FASTA database files together</description>
+    <requirements>
+        <requirement type="package" version="2.7.12">python</requirement>
+    </requirements>
+    <command>
+        python '$__tool_directory__/fasta_merge_files_and_filter_unique_sequences.py'
+        '$output'
+        #for $input in $inputs:
+            '$input'
+        #end for
+    </command>
+    <inputs>
+        <param name="inputs" format="fasta" multiple="True" type="data" label="Input FASTA files"/>
+    </inputs>
+    <outputs>
+        <data format="fasta" name="output" label="Merged and Filtered FASTA from ${on_string}"/>
+    </outputs>
+    <tests>
+        <test>
+          <param name="inputs" value="1.fa,2.fa" ftype="fasta" />
+          <output name="output" file="res.fa" ftype="fasta" />
+        </test>
+    </tests>
+    <help>
+<![CDATA[
+**What it does**
+
+Concatenate FASTA database files together.
+Only first appearence of each unique sequence will appear in output.
+
+------
+
+**Citation**
+
+If you use this tool in Galaxy, please the GalaxyP developers at: https://github.com/galaxyproteomics/
+
+]]>
+    </help>
 </tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/1.fa	Fri Dec 16 05:19:27 2016 -0500
@@ -0,0 +1,6 @@
+>one
+ACGTACGT
+>two
+GGTGTGTACGT
+>three
+ACGTACG
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/2.fa	Fri Dec 16 05:19:27 2016 -0500
@@ -0,0 +1,6 @@
+>one_2
+ACGTACGT
+>two_2
+GGTGTGTACGT
+>three_2
+ACGTACGACTTTGGTTGTGT
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/res.fa	Fri Dec 16 05:19:27 2016 -0500
@@ -0,0 +1,8 @@
+>one
+ACGTACGT
+>two
+GGTGTGTACGT
+>three
+ACGTACG
+>three_2
+ACGTACGACTTTGGTTGTGT