Mercurial > repos > iuc > bedtools
changeset 32:4f7a5ccd2ae9 draft
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/bedtools commit fc3616bd1463afef9681cd7c431ac29f79e37e74
line wrap: on
line diff
--- a/annotateBed.xml Tue Nov 20 10:34:42 2018 -0500 +++ b/annotateBed.xml Tue Dec 11 14:01:26 2018 -0500 @@ -1,4 +1,4 @@ -<tool id="bedtools_annotatebed" name="AnnotateBed" version="@WRAPPER_VERSION@.0"> +<tool id="bedtools_annotatebed" name="bedtools AnnotateBed" version="@WRAPPER_VERSION@"> <description>annotate coverage of features from multiple files</description> <macros> <import>macros.xml</import>
--- a/bamToBed.xml Tue Nov 20 10:34:42 2018 -0500 +++ b/bamToBed.xml Tue Dec 11 14:01:26 2018 -0500 @@ -1,4 +1,4 @@ -<tool id="bedtools_bamtobed" name="BAM to BED" version="@WRAPPER_VERSION@.0"> +<tool id="bedtools_bamtobed" name="bedtools BAM to BED" version="@WRAPPER_VERSION@"> <description>converter</description> <macros> <import>macros.xml</import>
--- a/bamToFastq.xml Tue Nov 20 10:34:42 2018 -0500 +++ b/bamToFastq.xml Tue Dec 11 14:01:26 2018 -0500 @@ -1,4 +1,4 @@ -<tool id="bedtools_bamtofastq" name="Convert from BAM to FastQ" version="@WRAPPER_VERSION@.0"> +<tool id="bedtools_bamtofastq" name="bedtools Convert from BAM to FastQ" version="@WRAPPER_VERSION@"> <description></description> <macros> <import>macros.xml</import> @@ -26,6 +26,12 @@ <filter>fq2 is True</filter> </data> </outputs> + <tests> + <test> + <param name="input" value="srma_in3.bam" ftype="bam" /> + <output name="output" file="bamToFastq_result1.fastq" ftype="fastq" /> + </test> + </tests> <help> **What it does**
--- a/bed12ToBed6.xml Tue Nov 20 10:34:42 2018 -0500 +++ b/bed12ToBed6.xml Tue Dec 11 14:01:26 2018 -0500 @@ -1,4 +1,4 @@ -<tool id="bedtools_bed12tobed6" name="BED12 to BED6" version="@WRAPPER_VERSION@.0"> +<tool id="bedtools_bed12tobed6" name="bedtools BED12 to BED6" version="@WRAPPER_VERSION@"> <description>converter</description> <macros> <import>macros.xml</import>
--- a/bedToBam.xml Tue Nov 20 10:34:42 2018 -0500 +++ b/bedToBam.xml Tue Dec 11 14:01:26 2018 -0500 @@ -1,4 +1,4 @@ -<tool id="bedtools_bedtobam" name="BED to BAM" version="@WRAPPER_VERSION@.0"> +<tool id="bedtools_bedtobam" name="bedtools BED to BAM" version="@WRAPPER_VERSION@"> <description>converter</description> <macros> <import>macros.xml</import>
--- a/bedToIgv.xml Tue Nov 20 10:34:42 2018 -0500 +++ b/bedToIgv.xml Tue Dec 11 14:01:26 2018 -0500 @@ -1,4 +1,4 @@ -<tool id="bedtools_bedtoigv" name="BED to IGV" version="@WRAPPER_VERSION@.0"> +<tool id="bedtools_bedtoigv" name="bedtools BED to IGV" version="@WRAPPER_VERSION@"> <description>create batch script for taking IGV screenshots</description> <macros> <import>macros.xml</import>
--- a/bedpeToBam.xml Tue Nov 20 10:34:42 2018 -0500 +++ b/bedpeToBam.xml Tue Dec 11 14:01:26 2018 -0500 @@ -1,4 +1,4 @@ -<tool id="bedtools_bedpetobam" name="BEDPE to BAM" version="@WRAPPER_VERSION@.0"> +<tool id="bedtools_bedpetobam" name="bedtools BEDPE to BAM" version="@WRAPPER_VERSION@"> <description>converter</description> <macros> <import>macros.xml</import>
--- a/closestBed.xml Tue Nov 20 10:34:42 2018 -0500 +++ b/closestBed.xml Tue Dec 11 14:01:26 2018 -0500 @@ -1,4 +1,4 @@ -<tool id="bedtools_closestbed" name="ClosestBed" version="@WRAPPER_VERSION@.0"> +<tool id="bedtools_closestbed" name="bedtools ClosestBed" version="@WRAPPER_VERSION@"> <description>find the closest, potentially non-overlapping interval</description> <macros> <import>macros.xml</import>
--- a/clusterBed.xml Tue Nov 20 10:34:42 2018 -0500 +++ b/clusterBed.xml Tue Dec 11 14:01:26 2018 -0500 @@ -1,4 +1,4 @@ -<tool id="bedtools_clusterbed" name="ClusterBed" version="@WRAPPER_VERSION@.0"> +<tool id="bedtools_clusterbed" name="bedtools ClusterBed" version="@WRAPPER_VERSION@"> <description>cluster overlapping/nearby intervals</description> <macros> <import>macros.xml</import>
--- a/complementBed.xml Tue Nov 20 10:34:42 2018 -0500 +++ b/complementBed.xml Tue Dec 11 14:01:26 2018 -0500 @@ -1,4 +1,4 @@ -<tool id="bedtools_complementbed" name="ComplementBed" version="@WRAPPER_VERSION@.0"> +<tool id="bedtools_complementbed" name="bedtools ComplementBed" version="@WRAPPER_VERSION@"> <description>Extract intervals not represented by an interval file</description> <macros> <import>macros.xml</import>
--- a/coverageBed.xml Tue Nov 20 10:34:42 2018 -0500 +++ b/coverageBed.xml Tue Dec 11 14:01:26 2018 -0500 @@ -1,4 +1,4 @@ -<tool id="bedtools_coveragebed" name="Compute both the depth and breadth of coverage" version="@WRAPPER_VERSION@.3"> +<tool id="bedtools_coveragebed" name="bedtools Compute both the depth and breadth of coverage" version="@WRAPPER_VERSION@"> <description>of features in file B on the features in file A (bedtools coverage)</description> <macros> <import>macros.xml</import>
--- a/expandBed.xml Tue Nov 20 10:34:42 2018 -0500 +++ b/expandBed.xml Tue Dec 11 14:01:26 2018 -0500 @@ -1,4 +1,4 @@ -<tool id="bedtools_expandbed" name="ExpandBed" version="@WRAPPER_VERSION@.0"> +<tool id="bedtools_expandbed" name="bedtools ExpandBed" version="@WRAPPER_VERSION@"> <description>replicate lines based on lists of values in columns</description> <macros> <import>macros.xml</import>
--- a/fisherBed.xml Tue Nov 20 10:34:42 2018 -0500 +++ b/fisherBed.xml Tue Dec 11 14:01:26 2018 -0500 @@ -1,4 +1,4 @@ -<tool id="bedtools_fisher" name="FisherBed" version="@WRAPPER_VERSION@.0"> +<tool id="bedtools_fisher" name="bedtools FisherBed" version="@WRAPPER_VERSION@"> <description>calculate Fisher statistic between two feature files</description> <macros> <import>macros.xml</import>
--- a/flankBed.xml Tue Nov 20 10:34:42 2018 -0500 +++ b/flankBed.xml Tue Dec 11 14:01:26 2018 -0500 @@ -1,4 +1,4 @@ -<tool id="bedtools_flankbed" name="FlankBed" version="@WRAPPER_VERSION@.0"> +<tool id="bedtools_flankbed" name="bedtools FlankBed" version="@WRAPPER_VERSION@"> <description>create new intervals from the flanks of existing intervals</description> <macros> <import>macros.xml</import>
--- a/genomeCoverageBed.xml Tue Nov 20 10:34:42 2018 -0500 +++ b/genomeCoverageBed.xml Tue Dec 11 14:01:26 2018 -0500 @@ -1,4 +1,4 @@ -<tool id="bedtools_genomecoveragebed" name="Genome Coverage" version="@WRAPPER_VERSION@.0"> +<tool id="bedtools_genomecoveragebed" name="bedtools Genome Coverage" version="@WRAPPER_VERSION@"> <description>compute the coverage over an entire genome</description> <macros> <import>macros.xml</import>
--- a/getfastaBed.xml Tue Nov 20 10:34:42 2018 -0500 +++ b/getfastaBed.xml Tue Dec 11 14:01:26 2018 -0500 @@ -1,4 +1,4 @@ -<tool id="bedtools_getfastabed" name="GetFastaBed" version="@WRAPPER_VERSION@.1"> +<tool id="bedtools_getfastabed" name="bedtools GetFastaBed" version="@WRAPPER_VERSION@"> <description>use intervals to extract sequences from a FASTA file</description> <macros> <import>macros.xml</import>
--- a/groupbyBed.xml Tue Nov 20 10:34:42 2018 -0500 +++ b/groupbyBed.xml Tue Dec 11 14:01:26 2018 -0500 @@ -1,4 +1,4 @@ -<tool id="bedtools_groupbybed" name="GroupByBed" version="@WRAPPER_VERSION@.0"> +<tool id="bedtools_groupbybed" name="bedtools GroupByBed" version="@WRAPPER_VERSION@"> <description>group by common cols and summarize other cols</description> <macros> <import>macros.xml</import>
--- a/intersectBed.xml Tue Nov 20 10:34:42 2018 -0500 +++ b/intersectBed.xml Tue Dec 11 14:01:26 2018 -0500 @@ -1,12 +1,14 @@ -<tool id="bedtools_intersectbed" name="Intersect intervals" version="@WRAPPER_VERSION@.2"> +<tool id="bedtools_intersectbed" name="bedtools Intersect intervals" version="@WRAPPER_VERSION@"> <description>find overlapping intervals in various ways</description> <macros> <import>macros.xml</import> </macros> - <expand macro="requirements" /> + <expand macro="requirements"> + <requirement type="package" version="@SAMTOOLS_VERSION@">samtools</requirement> + </expand> <expand macro="stdio" /> - <command> -<![CDATA[ + <command><![CDATA[ + #import re #set modes = ' '.join( str($overlap_mode).split(',') ) #if $modes == "None": @@ -14,30 +16,47 @@ #end if bedtools intersect - #if $inputA.is_of_type('bam'): - -abam '${inputA}' - #else: - -a '${inputA}' - #end if + #if $inputA.is_of_type('bam'): + -abam '${inputA}' + #else: + -a '${inputA}' + #end if - #if str($reduce_or_iterate.reduce_or_iterate_selector) == 'iterate': - -b '$reduce_or_iterate.inputB' - #else: - #set inputBs = "' '".join([str($file) for $file in $reduce_or_iterate.inputB]) - -b '$inputBs' + #if str($reduce_or_iterate.reduce_or_iterate_selector) == 'iterate': + -b '$reduce_or_iterate.inputB' + #else: + #set inputBs = "' '".join([str($file) for $file in $reduce_or_iterate.inputB]) + -b '$inputBs' + #if $reduce_or_iterate.names: + #set namesB = "' '".join([re.sub('[^\s\w\-]', '_', str($file.element_identifier)) for $file in $reduce_or_iterate.inputB]) + -names '$namesB' #end if - $split - $strand - #if str($fraction) != "None" and str($fraction): - -f '${fraction}' + #end if + $split + $strand + #if $fraction_cond.fraction_select == "specify": + -f '${fraction_cond.overlap}' + $fraction_cond.reciprocal_cond.reciprocal + #if str($fraction_cond.reciprocal_cond.reciprocal) == '': + -F '${fraction_cond.reciprocal_cond.overlapB}' + $fraction_cond.reciprocal_cond.disjoint #end if - $reciprocal - $invert - $once - $header - $modes - $count - > '${output}' + #end if + $invert + $once + $header + $modes + $sorted + #if str($sorted) != '': + #if str($reduce_or_iterate.reduce_or_iterate_selector) == 'iterate' and $reduce_or_iterate.inputB.is_of_type('bam'): + -g <(samtools view -H $reduce_or_iterate.inputB | tr ':' '\t' | grep SN | cut -f 3,5) + #else if str($reduce_or_iterate.reduce_or_iterate_selector) == 'reduce' and str($reduce_or_iterate.inputB) != 'None' and $reduce_or_iterate.inputB[0].is_of_type('bam'): + -g <(samtools view -H $reduce_or_iterate.inputB[0] | tr ':' '\t' | grep SN | cut -f 3,5) + #end if + #end if + $bed + $count + > '${output}' ]]> </command> <inputs> @@ -54,11 +73,12 @@ <when value='reduce'> <param format="bam,@STD_BEDTOOLS_INPUTS@" name="inputB" type="data" multiple="true" label="File(s) B to intersect with A" help="BAM/@STD_BEDTOOLS_INPUT_LABEL@ format"/> + <param argument="names" type="boolean" truevalue="yes" falsevalue="no" label="add data set names instead of indices" help=""/> </when> </conditional> <expand macro="strand2" /> <param name="overlap_mode" type="select" multiple="True" label="What should be written to the output file?"> - <option value="-wa" selected="True">Write the original entry in A for each overlap (-wa)</option> + <option value="-wa">Write the original entry in A for each overlap (-wa)</option> <option value="-wb">Write the original entry in B for each overlap. Useful for knowing what A overlaps. Restricted by the fraction- and reciprocal option (-wb)</option> <option value="-wo">Write the original A and B entries plus the number of base pairs of overlap between the two features. Only A features with overlap are reported. Restricted by the fraction- and reciprocal option (-wo)</option> <option value="-wao">Write the original A and B entries plus the number of base pairs of overlap between the two features. However, A features w/o overlap are also reported with a NULL B feature and overlap = 0. Restricted by the fraction- and reciprocal option (-wao)</option> @@ -66,12 +86,25 @@ </param> <expand macro="split" /> - <!-- -f --> - <param name="fraction" type="text" - label="Minimum overlap required as a fraction of the BAM alignment" - help="Alignments are only retained if the overlap with the an interval in the BED file comprises at least this fraction of the BAM alignment's length. For example, to require that the overlap affects 50% of the BAM alignment, use 0.50. (-f)"/> - <!-- -r --> - <expand macro="reciprocal" /> + <conditional name="fraction_cond"> + <param name='fraction_select' type='select' label='Required overlap'> + <option value='default' selected='true'>Default: 1bp</option> + <option value='specify'>Specify minimum overlap(s)</option> + </param> + <when value="default"/> + <when value='specify'> + <expand macro="overlap" /> + <conditional name="reciprocal_cond"> + <expand macro="reciprocal" /> + <when value="-r"/> + <when value=""> + <expand macro="overlapB" /> + <param name="disjoint" argument="-e" type="boolean" checked="false" truevalue="-e" falsevalue="" + label="Require that the fraction of overlap is fulfilled for A OR B." help="If enabled, then for -f 0.90 and -F 0.10 this requires that either 90% of A is covered OR 10% of B is covered, otherwise, both fractions would have to be satisfied."/> + </when> + </conditional> + </when> + </conditional> <!-- -v --> <param name="invert" type="boolean" checked="false" truevalue="-v" falsevalue="" label="Report only those alignments that **do not** overlap with file(s) B" @@ -84,12 +117,229 @@ <param name="count" type="boolean" checked="false" truevalue="-c" falsevalue="" label="For each entry in A, report the number of overlaps with B." help="Reports 0 for A entries that have no overlap with B. (-c)" /> + <!-- -bed --> + <param argument="-bed" type="boolean" checked="false" truevalue="-bed" falsevalue="" + label="When using BAM input (-abam), write output as BED instead of BAM." /> + <!-- -sorted -g --> + <param argument="-sorted" type="boolean" checked="false" truevalue="-sorted" falsevalue="" + label="For coordinate sorted input file the more efficient sweeping algorithm is enabled." /> <expand macro="print_header" /> </inputs> <outputs> - <data format_source="inputA" name="output" metadata_source="inputA"/> + <data format_source="inputA" name="output" metadata_source="inputA"> + <change_format> + <when input="bed" value="-bed" format="bed" /> + </change_format> + </data> </outputs> <tests> + <!-- test adapted from the tutorial https://bedtools.readthedocs.io/en/latest/content/tools/intersect.html --> + <test> + <param name="inputA" value="intersect-A.bed" ftype="bed" /> + <conditional name="reduce_or_iterate"> + <param name='reduce_or_iterate_selector' value="iterate" /> + <param name="inputB" value="intersect-B.bed" ftype="bed" /> + </conditional> + <output name="output" file="intersect-default.bed" ftype="bed" /> + </test> + <test> + <param name="inputA" value="intersect-query.bed" ftype="bed" /> + <conditional name="reduce_or_iterate"> + <param name='reduce_or_iterate_selector' value="reduce" /> + <param name="inputB" value="intersect-d1.bed,intersect-d2.bed,intersect-d3.bed" ftype="bed" /> + </conditional> + <output name="output" file="intersect-multiple.bed" ftype="bed" /> + </test> + <test> + <param name="inputA" value="intersect-query.bed" ftype="bed" /> + <conditional name="reduce_or_iterate"> + <param name='reduce_or_iterate_selector' value="reduce" /> + <param name="inputB" value="intersect-d1.bed,intersect-d2.bed,intersect-d3.bed" ftype="bed" /> + </conditional> + <param name="overlap_mode" value="-wa,-wb" /> + <param name="sorted" value="-sorted" /> + <output name="output" file="intersect-multiple-wa-wb.bed" ftype="bed" /> + </test> + <test> + <param name="inputB" value="intersect-d1.bed,intersect-d2.bed,intersect-d3.bed" ftype="bed" /> + <param name="inputA" value="intersect-query.bed" ftype="bed" /> + <conditional name="reduce_or_iterate"> + <param name='reduce_or_iterate_selector' value="reduce" /> + <param name="inputB" value="intersect-d1.bed,intersect-d2.bed,intersect-d3.bed" ftype="bed" /> + <param name="names" value="yes" /> + </conditional> + <param name="overlap_mode" value="-wa,-wb" /> + <param name="sorted" value="-sorted" /> + <output name="output" file="intersect-multiple-wa-wb-wnames.bed" ftype="bed" /> + </test> + <test> + <param name="inputA" value="intersect-query.bed" ftype="bed" /> + <conditional name="reduce_or_iterate"> + <param name='reduce_or_iterate_selector' value="reduce" /> + <param name="inputB" value="intersect-d1.bed,intersect-d2.bed,intersect-d3.bed" ftype="bed" /> + </conditional> + <param name="invert" value="-v" /> + <param name="sorted" value="-sorted" /> + <output name="output" file="intersect-multiple-invert.bed" ftype="bed" /> + </test> + <test> + <param name="inputA" value="intersect-query.bed" ftype="bed" /> + <conditional name="reduce_or_iterate"> + <param name='reduce_or_iterate_selector' value="reduce" /> + <param name="inputB" value="intersect-d1.bed,intersect-d2.bed,intersect-d3.bed" ftype="bed" /> + </conditional> + <param name="overlap_mode" value="-wa,-wb" /> + <conditional name="fraction_cond"> + <param name='fraction_select' value='specify'/> + <param name="overlap" value="1.0" /> + </conditional> + <param name="sorted" value="-sorted" /> + <output name="output" file="intersect-multiple-fracA.bed" ftype="bed" /> + </test> + <test> + <param name="inputA" value="intersect-A.bed" ftype="bed" /> + <conditional name="reduce_or_iterate"> + <param name='reduce_or_iterate_selector' value="iterate" /> + <param name="inputB" value="intersect-B.bed" ftype="bed" /> + </conditional> + <param name="overlap_mode" value="-wa" /> + <output name="output" file="intersect-wa.bed" ftype="bed" /> + </test> + <test> + <param name="inputA" value="intersect-A.bed" ftype="bed" /> + <conditional name="reduce_or_iterate"> + <param name='reduce_or_iterate_selector' value="iterate" /> + <param name="inputB" value="intersect-B.bed" ftype="bed" /> + </conditional> + <param name="overlap_mode" value="-wb" /> + <output name="output" file="intersect-wb.bed" ftype="bed" /> + </test> + <test> + <param name="inputA" value="intersect-A.bed" ftype="bed" /> + <conditional name="reduce_or_iterate"> + <param name='reduce_or_iterate_selector' value="iterate" /> + <param name="inputB" value="intersect-B.bed" ftype="bed" /> + </conditional> + <param name="overlap_mode" value="-wa,-wb" /> + <output name="output" file="intersect-wa-wb.bed" ftype="bed" /> + </test> + <test> + <param name="inputA" value="intersect-A.bed" ftype="bed" /> + <conditional name="reduce_or_iterate"> + <param name='reduce_or_iterate_selector' value="iterate" /> + <param name="inputB" value="intersect-B.bed" ftype="bed" /> + </conditional> + <param name="overlap_mode" value="-loj" /> + <output name="output" file="intersect-loj.bed" ftype="bed" /> + </test> + <test> + <param name="inputA" value="intersect-A.bed" ftype="bed" /> + <conditional name="reduce_or_iterate"> + <param name='reduce_or_iterate_selector' value="iterate" /> + <param name="inputB" value="intersect-B.bed" ftype="bed" /> + </conditional> + <param name="overlap_mode" value="-wo" /> + <output name="output" file="intersect-wo.bed" ftype="bed" /> + </test> + <test> + <param name="inputA" value="intersect-A.bed" ftype="bed" /> + <conditional name="reduce_or_iterate"> + <param name='reduce_or_iterate_selector' value="iterate" /> + <param name="inputB" value="intersect-B.bed" ftype="bed" /> + </conditional> + <param name="overlap_mode" value="-wao" /> + <output name="output" file="intersect-wao.bed" ftype="bed" /> + </test> + <test> + <param name="inputA" value="intersect-A.bed" ftype="bed" /> + <conditional name="reduce_or_iterate"> + <param name='reduce_or_iterate_selector' value="iterate" /> + <param name="inputB" value="intersect-B.bed" ftype="bed" /> + </conditional> + <param name="once" value="-u" /> + <output name="output" file="intersect-unique.bed" ftype="bed" /> + </test> + <test> + <param name="inputA" value="intersect-A.bed" ftype="bed" /> + <conditional name="reduce_or_iterate"> + <param name='reduce_or_iterate_selector' value="iterate" /> + <param name="inputB" value="intersect-B.bed" ftype="bed" /> + </conditional> + <param name="count" value="-c"/> + <output name="output" file="intersect-count.bed" ftype="bed" /> + </test> + <test> + <param name="inputA" value="intersect-A.bed" ftype="bed" /> + <conditional name="reduce_or_iterate"> + <param name='reduce_or_iterate_selector' value="iterate" /> + <param name="inputB" value="intersect-B.bed" ftype="bed" /> + </conditional> + <param name="invert" value="-v"/> + <output name="output" file="intersect-invert.bed" ftype="bed" /> + </test> + <test> + <param name="inputA" value="intersect-A2.bed" ftype="bed" /> + <conditional name="reduce_or_iterate"> + <param name='reduce_or_iterate_selector' value="iterate" /> + <param name="inputB" value="intersect-B2.bed" ftype="bed" /> + </conditional> + <param name="overlap_mode" value="-wa,-wb" /> + <conditional name="fraction_cond"> + <param name='fraction_select' value='specify'/> + <param name="overlap" value="0.5" /> + </conditional> + <output name="output" file="intersect-fracA.bed" ftype="bed" /> + </test> + <test> + <param name="inputA" value="intersect-A2.bed" ftype="bed" /> + <conditional name="reduce_or_iterate"> + <param name='reduce_or_iterate_selector' value="iterate" /> + <param name="inputB" value="intersect-B2.bed" ftype="bed" /> + </conditional> + <param name="overlap_mode" value="-wa,-wb" /> + <conditional name="fraction_cond"> + <param name='fraction_select' value='specify'/> + <param name="overlap" value="0.5" /> + <conditional name="reciprocal_cond"> + <param name="reciprocal" value="-r" /> + </conditional> + </conditional> + <output name="output" file="intersect-fracA-rec.bed" ftype="bed" /> + </test> + <test> + <param name="inputA" value="intersect-A2.bed" ftype="bed" /> + <conditional name="reduce_or_iterate"> + <param name='reduce_or_iterate_selector' value="iterate" /> + <param name="inputB" value="intersect-B2.bed" ftype="bed" /> + </conditional> + <param name="overlap_mode" value="-wa,-wb" /> + <conditional name="fraction_cond"> + <param name='fraction_select' value='specify'/> + <param name="overlap" value="0.5" /> + <conditional name="reciprocal_cond"> + <param name="overlapB" value="0.5" /> + </conditional> + </conditional> + <output name="output" file="intersect-fracA-rec.bed" ftype="bed" /> + </test> + <test> + <param name="inputA" value="intersect-A2.bed" ftype="bed" /> + <conditional name="reduce_or_iterate"> + <param name='reduce_or_iterate_selector' value="iterate" /> + <param name="inputB" value="intersect-B2.bed" ftype="bed" /> + </conditional> + <param name="overlap_mode" value="-wa,-wb" /> + <conditional name="fraction_cond"> + <param name='fraction_select' value='specify'/> + <param name="overlap" value="0.5" /> + <conditional name="reciprocal_cond"> + <param name="overlapB" value="0.5" /> + <param name="disjoint" value="-e" /> + </conditional> + </conditional> + <output name="output" file="intersect-fracA.bed" ftype="bed" /> + </test> + <!-- old tests --> <test> <param name="inputA" value="intersectBed1.bed" ftype="bed" /> <param name="inputB" value="intersectBed2.bed" ftype="bed" />
--- a/jaccardBed.xml Tue Nov 20 10:34:42 2018 -0500 +++ b/jaccardBed.xml Tue Dec 11 14:01:26 2018 -0500 @@ -1,4 +1,4 @@ -<tool id="bedtools_jaccard" name="JaccardBed" version="@WRAPPER_VERSION@.0"> +<tool id="bedtools_jaccard" name="bedtools JaccardBed" version="@WRAPPER_VERSION@"> <description>calculate the distribution of relative distances between two files</description> <macros> <import>macros.xml</import>
--- a/linksBed.xml Tue Nov 20 10:34:42 2018 -0500 +++ b/linksBed.xml Tue Dec 11 14:01:26 2018 -0500 @@ -1,4 +1,4 @@ -<tool id="bedtools_links" name="LinksBed" version="@WRAPPER_VERSION@.0"> +<tool id="bedtools_links" name="bedtools LinksBed" version="@WRAPPER_VERSION@"> <description>create a HTML page of links to UCSC locations</description> <macros> <import>macros.xml</import>
--- a/macros.xml Tue Nov 20 10:34:42 2018 -0500 +++ b/macros.xml Tue Dec 11 14:01:26 2018 -0500 @@ -1,12 +1,12 @@ <macros> <xml name="requirements"> <requirements> - <requirement type="package" version="2.27.0">bedtools</requirement> + <requirement type="package" version="@WRAPPER_VERSION@">bedtools</requirement> <yield/> </requirements> </xml> - <token name="@WRAPPER_VERSION@">2.27.0</token> - <token name="@SAMTOOLS_VERSION@">1.2</token> + <token name="@WRAPPER_VERSION@">2.27.1</token> + <token name="@SAMTOOLS_VERSION@">1.9</token> <token name="@STD_BEDTOOLS_INPUTS@">bed,bedgraph,gff,vcf</token> <token name="@STD_BEDTOOLS_INPUT_LABEL@">bed,bedgraph,gff,vcf</token> <xml name="stdio"> @@ -21,12 +21,16 @@ <version_command>bedtools --version</version_command> </xml> <xml name="reciprocal"> - <param name="reciprocal" type="boolean" checked="false" truevalue="-r" falsevalue="" - label="Require that the fraction of overlap be reciprocal for A and B" - help="In other words, if -f is 0.90 and -r is used, this requires that B overlap at least 90% of A and that A also overlaps at least 90% of B. (-r)" /> + <param name="reciprocal" argument="-r" type="select" label="Require that the fraction of overlap be reciprocal for A and B" help="In other words, if -f is 0.90 and -r is used, this requires that B overlap at least 90% of A and that A also overlaps at least 90% of B."> + <option value="" selected="True">No</option> + <option value="-r">Yes</option> + </param> </xml> <xml name="overlap"> - <param name="overlap" type="float" value="0.000000001" label="Minimum overlap required as a fraction of A" help="Default is 1E-9, i.e. 1bp. (-f)"/> + <param name="overlap" argument="-f" type="float" value="0.000000001" label="Minimum overlap required as a fraction of A" help="Default is 1E-9, i.e. 1bp."/> + </xml> + <xml name="overlapB"> + <param name="overlapB" argument="-F" type="float" value="0.000000001" label="Minimum overlap required as a fraction of A" help="Default is 1E-9, i.e. 1bp."/> </xml> <xml name="strand2"> <param name="strand" type="select" label="Calculation based on strandedness?">
--- a/makeWindowsBed.xml Tue Nov 20 10:34:42 2018 -0500 +++ b/makeWindowsBed.xml Tue Dec 11 14:01:26 2018 -0500 @@ -1,4 +1,4 @@ -<tool id="bedtools_makewindowsbed" name="MakeWindowsBed" version="@WRAPPER_VERSION@.0"> +<tool id="bedtools_makewindowsbed" name="bedtools MakeWindowsBed" version="@WRAPPER_VERSION@"> <description>make interval windows across a genome</description> <macros> <import>macros.xml</import>
--- a/mapBed.xml Tue Nov 20 10:34:42 2018 -0500 +++ b/mapBed.xml Tue Dec 11 14:01:26 2018 -0500 @@ -1,4 +1,4 @@ -<tool id="bedtools_map" name="MapBed" version="@WRAPPER_VERSION@.1"> +<tool id="bedtools_map" name="bedtools MapBed" version="@WRAPPER_VERSION@.2"> <description>apply a function to a column for each overlapping interval</description> <macros> <import>macros.xml</import>
--- a/maskFastaBed.xml Tue Nov 20 10:34:42 2018 -0500 +++ b/maskFastaBed.xml Tue Dec 11 14:01:26 2018 -0500 @@ -1,4 +1,4 @@ -<tool id="bedtools_maskfastabed" name="MaskFastaBed" version="@WRAPPER_VERSION@.0"> +<tool id="bedtools_maskfastabed" name="bedtools MaskFastaBed" version="@WRAPPER_VERSION@"> <description>use intervals to mask sequences from a FASTA file</description> <macros> <import>macros.xml</import>
--- a/mergeBed.xml Tue Nov 20 10:34:42 2018 -0500 +++ b/mergeBed.xml Tue Dec 11 14:01:26 2018 -0500 @@ -1,4 +1,4 @@ -<tool id="bedtools_mergebed" name="MergeBED" version="@WRAPPER_VERSION@.0"> +<tool id="bedtools_mergebed" name="bedtools MergeBED" version="@WRAPPER_VERSION@"> <description>combine overlapping/nearby intervals into a single interval</description> <macros> <import>macros.xml</import>
--- a/multiCov.xml Tue Nov 20 10:34:42 2018 -0500 +++ b/multiCov.xml Tue Dec 11 14:01:26 2018 -0500 @@ -1,4 +1,4 @@ -<tool id="bedtools_multicovtbed" name="MultiCovBed" version="@WRAPPER_VERSION@.0"> +<tool id="bedtools_multicovtbed" name="bedtools MultiCovBed" version="@WRAPPER_VERSION@"> <description>counts coverage from multiple BAMs at specific intervals</description> <macros> <import>macros.xml</import>
--- a/multiIntersectBed.xml Tue Nov 20 10:34:42 2018 -0500 +++ b/multiIntersectBed.xml Tue Dec 11 14:01:26 2018 -0500 @@ -1,4 +1,4 @@ -<tool id="bedtools_multiintersectbed" name="Multiple Intersect" version="@WRAPPER_VERSION@.0"> +<tool id="bedtools_multiintersectbed" name="bedtools Multiple Intersect" version="@WRAPPER_VERSION@"> <description>identifies common intervals among multiple interval files</description> <macros> <import>macros.xml</import>
--- a/nucBed.xml Tue Nov 20 10:34:42 2018 -0500 +++ b/nucBed.xml Tue Dec 11 14:01:26 2018 -0500 @@ -1,4 +1,4 @@ -<tool id="bedtools_nucbed" name="NucBed" version="@WRAPPER_VERSION@.1"> +<tool id="bedtools_nucbed" name="bedtools NucBed" version="@WRAPPER_VERSION@"> <description>profile the nucleotide content of intervals in a FASTA file</description> <macros> <import>macros.xml</import>
--- a/overlapBed.xml Tue Nov 20 10:34:42 2018 -0500 +++ b/overlapBed.xml Tue Dec 11 14:01:26 2018 -0500 @@ -1,4 +1,4 @@ -<tool id="bedtools_overlapbed" name="OverlapBed" version="@WRAPPER_VERSION@.0"> +<tool id="bedtools_overlapbed" name="bedtools OverlapBed" version="@WRAPPER_VERSION@"> <description>computes the amount of overlap from two intervals</description> <macros> <import>macros.xml</import>
--- a/randomBed.xml Tue Nov 20 10:34:42 2018 -0500 +++ b/randomBed.xml Tue Dec 11 14:01:26 2018 -0500 @@ -1,4 +1,4 @@ -<tool id="bedtools_randombed" name="RandomBed" version="@WRAPPER_VERSION@.0"> +<tool id="bedtools_randombed" name="bedtools RandomBed" version="@WRAPPER_VERSION@"> <description>generate random intervals in a genome</description> <macros> <import>macros.xml</import>
--- a/reldist.xml Tue Nov 20 10:34:42 2018 -0500 +++ b/reldist.xml Tue Dec 11 14:01:26 2018 -0500 @@ -1,4 +1,4 @@ -<tool id="bedtools_reldistbed" name="ReldistBed" version="@WRAPPER_VERSION@.0"> +<tool id="bedtools_reldistbed" name="bedtools ReldistBed" version="@WRAPPER_VERSION@"> <description>calculate the distribution of relative distances</description> <macros> <import>macros.xml</import>
--- a/shuffleBed.xml Tue Nov 20 10:34:42 2018 -0500 +++ b/shuffleBed.xml Tue Dec 11 14:01:26 2018 -0500 @@ -1,4 +1,4 @@ -<tool id="bedtools_shufflebed" name="ShuffleBed" version="@WRAPPER_VERSION@.0"> +<tool id="bedtools_shufflebed" name="bedtools ShuffleBed" version="@WRAPPER_VERSION@"> <description>randomly redistrubute intervals in a genome</description> <macros> <import>macros.xml</import>
--- a/slopBed.xml Tue Nov 20 10:34:42 2018 -0500 +++ b/slopBed.xml Tue Dec 11 14:01:26 2018 -0500 @@ -1,4 +1,4 @@ -<tool id="bedtools_slopbed" name="SlopBed" version="@WRAPPER_VERSION@.0"> +<tool id="bedtools_slopbed" name="bedtools SlopBed" version="@WRAPPER_VERSION@"> <description>adjust the size of intervals</description> <macros> <import>macros.xml</import>
--- a/sortBed.xml Tue Nov 20 10:34:42 2018 -0500 +++ b/sortBed.xml Tue Dec 11 14:01:26 2018 -0500 @@ -1,4 +1,4 @@ -<tool id="bedtools_sortbed" name="SortBED" version="@WRAPPER_VERSION@.0"> +<tool id="bedtools_sortbed" name="bedtools SortBED" version="@WRAPPER_VERSION@"> <description>order the intervals</description> <macros> <import>macros.xml</import>
--- a/spacingBed.xml Tue Nov 20 10:34:42 2018 -0500 +++ b/spacingBed.xml Tue Dec 11 14:01:26 2018 -0500 @@ -1,4 +1,4 @@ -<tool id="bedtools_spacingbed" name="SpacingBed" version="@WRAPPER_VERSION@.0"> +<tool id="bedtools_spacingbed" name="bedtools SpacingBed" version="@WRAPPER_VERSION@"> <description>reports the distances between features</description> <macros> <import>macros.xml</import>
--- a/subtractBed.xml Tue Nov 20 10:34:42 2018 -0500 +++ b/subtractBed.xml Tue Dec 11 14:01:26 2018 -0500 @@ -1,4 +1,4 @@ -<tool id="bedtools_subtractbed" name="SubtractBed" version="@WRAPPER_VERSION@.0"> +<tool id="bedtools_subtractbed" name="bedtools SubtractBed" version="@WRAPPER_VERSION@"> <description>remove intervals based on overlaps</description> <macros> <import>macros.xml</import>
--- a/tagBed.xml Tue Nov 20 10:34:42 2018 -0500 +++ b/tagBed.xml Tue Dec 11 14:01:26 2018 -0500 @@ -1,4 +1,4 @@ -<tool id="bedtools_tagbed" name="TagBed" version="@WRAPPER_VERSION@.0"> +<tool id="bedtools_tagbed" name="bedtools TagBed" version="@WRAPPER_VERSION@"> <description>tag BAM alignments based on overlaps with interval files</description> <macros> <import>macros.xml</import>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/bamToFastq_result1.fastq Tue Dec 11 14:01:26 2018 -0500 @@ -0,0 +1,32 @@ +@GA5:3:2:1710:1301#0 +GAACTCCTGACCTCAGGTGATCTGCCCGCCTTGGCCTCCCAAAGTGCTGGAATTACAGGCATGAGCCACCGTGCCC ++ +6->;B==?B?AAA??9B<AA?@A==AA9A?<A?<&:A?=<9<?>19;?A=9:?999;=4=6A9/8;4==;1';;3= +@GA5:3:24:462:583#0 +TAAAAAAAGGACAGTGACGCACCTTGTATAGCGATGTGTCATCTAAAACATCTATTCAAAGAACAGAAGACTCACC ++ +BBABBBB@BBBBBA?BBBBBBAA@AB?BBBA@B=>@?@;@?@?A>=1=?>??><???;;>?;;;?>8999;;9;;< +@GA5:3:29:1241:1653#0 +TCATGCACACACAGACAGCTGTCGGGGGATGCATGCCAACCAGAGGGGCCACACATATACCGTGTTGATGGGACAG ++ +BBBBBBACBCBBBBBBBBBBBABBABBB@AA>@?@?@>=????<???:?915399<=5=<==5=559545432353 +@GA5:3:33:1591:303#0 +CTCGCCTGGGCCCGGTAAAGCCCCCACGTAGCCCCAGCCAGCCTGGAACATGCTTCCTGAGCTCCCAGCTCTTGGT ++ +BBBBBBBBBBB@BBB?BBBA@A>B@B?AABB?@>?BA?>AB;??A?6;=AAAAA=>3=9;@;===6,=?;;5==;6 +@GA5:3:31:677:1537#0 +CTTCCGCCACTGGCCGGTGTCGGGGTCTGGGACACCCTGAGACCCTAAGCTCTCCTGGCTGCTCTCTCAAACCCTC ++ +BBBBBBBBBBBBBBBBA=B?AA?AA4A>??A>?AA??>>8>?>>????>?9=9==9>################### +@GA5:3:49:1480:1116#0 +TTTCCAGAGAGTTGGTGTGTAGGGGGCAGGGGAGGGAGGTGATGGCTGTGGGTCCCTGAAGTCCTGGCCTCCTCCC ++ +BBBAAABAA?A?ABA;A=A=??==>?=>???=;==449=4:44################################# +@GA5:3:61:213:1812#0 +TCCTGGCTTCAGTTTTTCAATTCGTAAAAAGAGCAAACAAAGCCCAACAGCTGGTCCAGTCCGACCCCGCCGGACC ++ +BCBBBBBBBB;B4B@ABA9AAABB>BBBB>5>=BAB@@A8C=BA@@;;=6:78:7;;1,),4=584=8495,18=/ +@GA5:3:116:1581:552#0 +AAGGCTCTGCCTTAGAAGCAGAGATGGGTACCTCACCAGACACCAAACCTGCTGGCACCCTGACCTTAGGCTTTCT ++ +B?BBCBBABBBBB@B???BBBAB@=@AB6AB@@A?B?@@>AA=<@@@89??@8?=<;@8<8<89;=3,92478884
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/intersect-A.bed Tue Dec 11 14:01:26 2018 -0500 @@ -0,0 +1,3 @@ +chr1 10 20 +chr1 30 40 +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/intersect-A2.bed Tue Dec 11 14:01:26 2018 -0500 @@ -0,0 +1,2 @@ +chr1 1 140 +chr1 100 200
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/intersect-B.bed Tue Dec 11 14:01:26 2018 -0500 @@ -0,0 +1,1 @@ +chr1 15 20
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/intersect-B2.bed Tue Dec 11 14:01:26 2018 -0500 @@ -0,0 +1,2 @@ +chr1 130 201 +chr1 130 200000
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/intersect-count.bed Tue Dec 11 14:01:26 2018 -0500 @@ -0,0 +1,2 @@ +chr1 10 20 1 +chr1 30 40 0
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/intersect-d1.bed Tue Dec 11 14:01:26 2018 -0500 @@ -0,0 +1,10 @@ +chr1 5 25 +chr1 65 75 +chr1 95 100 +chr2 5 25 +chr2 65 75 +chr2 95 100 +chr3 5 25 +chr3 65 75 +chr3 95 100 +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/intersect-d2.bed Tue Dec 11 14:01:26 2018 -0500 @@ -0,0 +1,6 @@ +chr1 40 50 +chr1 110 125 +chr2 40 50 +chr2 110 125 +chr3 40 50 +chr3 110 125
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/intersect-d3.bed Tue Dec 11 14:01:26 2018 -0500 @@ -0,0 +1,3 @@ +chr1 85 115 +chr2 85 115 +chr3 85 115
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/intersect-default.bed Tue Dec 11 14:01:26 2018 -0500 @@ -0,0 +1,1 @@ +chr1 15 20
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/intersect-fracA-rec.bed Tue Dec 11 14:01:26 2018 -0500 @@ -0,0 +1,1 @@ +chr1 100 200 chr1 130 201
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/intersect-fracA.bed Tue Dec 11 14:01:26 2018 -0500 @@ -0,0 +1,2 @@ +chr1 100 200 chr1 130 201 +chr1 100 200 chr1 130 200000
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/intersect-invert.bed Tue Dec 11 14:01:26 2018 -0500 @@ -0,0 +1,1 @@ +chr1 30 40
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/intersect-loj.bed Tue Dec 11 14:01:26 2018 -0500 @@ -0,0 +1,2 @@ +chr1 10 20 chr1 15 20 +chr1 30 40 . -1 -1
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/intersect-multiple-fracA.bed Tue Dec 11 14:01:26 2018 -0500 @@ -0,0 +1,3 @@ +chr1 40 45 2 chr1 40 50 +chr2 40 45 2 chr2 40 50 +chr3 40 45 2 chr3 40 50
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/intersect-multiple-invert.bed Tue Dec 11 14:01:26 2018 -0500 @@ -0,0 +1,2 @@ +chr3 150 200 +chr4 10 20
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/intersect-multiple-wa-wb-wnames.bed Tue Dec 11 14:01:26 2018 -0500 @@ -0,0 +1,18 @@ +chr1 1 20 intersect-d1_bed chr1 5 25 +chr1 40 45 intersect-d2_bed chr1 40 50 +chr1 70 90 intersect-d1_bed chr1 65 75 +chr1 70 90 intersect-d3_bed chr1 85 115 +chr1 105 120 intersect-d2_bed chr1 110 125 +chr1 105 120 intersect-d3_bed chr1 85 115 +chr2 1 20 intersect-d1_bed chr2 5 25 +chr2 40 45 intersect-d2_bed chr2 40 50 +chr2 70 90 intersect-d1_bed chr2 65 75 +chr2 70 90 intersect-d3_bed chr2 85 115 +chr2 105 120 intersect-d2_bed chr2 110 125 +chr2 105 120 intersect-d3_bed chr2 85 115 +chr3 1 20 intersect-d1_bed chr3 5 25 +chr3 40 45 intersect-d2_bed chr3 40 50 +chr3 70 90 intersect-d1_bed chr3 65 75 +chr3 70 90 intersect-d3_bed chr3 85 115 +chr3 105 120 intersect-d2_bed chr3 110 125 +chr3 105 120 intersect-d3_bed chr3 85 115
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/intersect-multiple-wa-wb.bed Tue Dec 11 14:01:26 2018 -0500 @@ -0,0 +1,18 @@ +chr1 1 20 1 chr1 5 25 +chr1 40 45 2 chr1 40 50 +chr1 70 90 1 chr1 65 75 +chr1 70 90 3 chr1 85 115 +chr1 105 120 2 chr1 110 125 +chr1 105 120 3 chr1 85 115 +chr2 1 20 1 chr2 5 25 +chr2 40 45 2 chr2 40 50 +chr2 70 90 1 chr2 65 75 +chr2 70 90 3 chr2 85 115 +chr2 105 120 2 chr2 110 125 +chr2 105 120 3 chr2 85 115 +chr3 1 20 1 chr3 5 25 +chr3 40 45 2 chr3 40 50 +chr3 70 90 1 chr3 65 75 +chr3 70 90 3 chr3 85 115 +chr3 105 120 2 chr3 110 125 +chr3 105 120 3 chr3 85 115
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/intersect-multiple.bed Tue Dec 11 14:01:26 2018 -0500 @@ -0,0 +1,18 @@ +chr1 5 20 +chr1 40 45 +chr1 70 75 +chr1 85 90 +chr1 110 120 +chr1 105 115 +chr2 5 20 +chr2 40 45 +chr2 70 75 +chr2 85 90 +chr2 110 120 +chr2 105 115 +chr3 5 20 +chr3 40 45 +chr3 70 75 +chr3 85 90 +chr3 110 120 +chr3 105 115
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/intersect-query.bed Tue Dec 11 14:01:26 2018 -0500 @@ -0,0 +1,14 @@ +chr1 1 20 +chr1 40 45 +chr1 70 90 +chr1 105 120 +chr2 1 20 +chr2 40 45 +chr2 70 90 +chr2 105 120 +chr3 1 20 +chr3 40 45 +chr3 70 90 +chr3 105 120 +chr3 150 200 +chr4 10 20
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/intersect-unique.bed Tue Dec 11 14:01:26 2018 -0500 @@ -0,0 +1,1 @@ +chr1 10 20
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/intersect-uniue.bed Tue Dec 11 14:01:26 2018 -0500 @@ -0,0 +1,1 @@ +chr1 10 20
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/intersect-wa-wb.bed Tue Dec 11 14:01:26 2018 -0500 @@ -0,0 +1,1 @@ +chr1 10 20 chr1 15 20
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/intersect-wa.bed Tue Dec 11 14:01:26 2018 -0500 @@ -0,0 +1,1 @@ +chr1 10 20
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/intersect-wao.bed Tue Dec 11 14:01:26 2018 -0500 @@ -0,0 +1,2 @@ +chr1 10 20 chr1 15 20 5 +chr1 30 40 . -1 -1 0
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/intersect-wb.bed Tue Dec 11 14:01:26 2018 -0500 @@ -0,0 +1,1 @@ +chr1 15 20 chr1 15 20
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/intersect-wo.bed Tue Dec 11 14:01:26 2018 -0500 @@ -0,0 +1,1 @@ +chr1 10 20 chr1 15 20 5
--- a/unionBedGraphs.xml Tue Nov 20 10:34:42 2018 -0500 +++ b/unionBedGraphs.xml Tue Dec 11 14:01:26 2018 -0500 @@ -1,4 +1,4 @@ -<tool id="bedtools_unionbedgraph" name="Merge BedGraph files" version="@WRAPPER_VERSION@.0"> +<tool id="bedtools_unionbedgraph" name="bedtools Merge BedGraph files" version="@WRAPPER_VERSION@"> <description>combines coverage intervals from multiple BEDGRAPH files</description> <macros> <import>macros.xml</import>
--- a/windowBed.xml Tue Nov 20 10:34:42 2018 -0500 +++ b/windowBed.xml Tue Dec 11 14:01:26 2018 -0500 @@ -1,4 +1,4 @@ -<tool id="bedtools_windowbed" name="WindowBed" version="@WRAPPER_VERSION@.0"> +<tool id="bedtools_windowbed" name="bedtools WindowBed" version="@WRAPPER_VERSION@"> <description>find overlapping intervals within a window around an interval</description> <macros> <import>macros.xml</import>