annotate test-data/MADE1.nhmmscan_out @ 7:6e27bb3f0fa6 draft default tip

"planemo upload for repository commit 0bccf5220ed6549db7e053f85bbe917326b0a0be"
author iuc
date Wed, 21 Jul 2021 14:16:41 +0000
parents 5113c71c7031
Ignore whitespace changes - Everywhere: Within whitespace: At end of lines:
rev   line source
036df14999e8 planemo upload for repository commit fa7dec5f222510d58f566f4799a04e3731fa03f6
diff changeset
1 # nhmmscan :: search DNA sequence(s) against a DNA profile database
6e27bb3f0fa6 "planemo upload for repository commit 0bccf5220ed6549db7e053f85bbe917326b0a0be"
parents: 5
diff changeset
2 # HMMER 3.3.2 (Nov 2020);
6e27bb3f0fa6 "planemo upload for repository commit 0bccf5220ed6549db7e053f85bbe917326b0a0be"
parents: 5
diff changeset
3 # Copyright (C) 2020 Howard Hughes Medical Institute.
793967b6ae8a planemo upload for repository commit 7c3ac4ad5a64b737e1b8f73c522e006097596f1d
parents: 3
diff changeset
4 # Freely distributed under the BSD open source license.
036df14999e8 planemo upload for repository commit fa7dec5f222510d58f566f4799a04e3731fa03f6
diff changeset
5 # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
6e27bb3f0fa6 "planemo upload for repository commit 0bccf5220ed6549db7e053f85bbe917326b0a0be"
parents: 5
diff changeset
6 # query sequence file: /tmp/tmp2vk0_a8v/files/7/d/6/dataset_7d62e9c6-1db3-4a28-9770-d56c56ccfb17.dat
793967b6ae8a planemo upload for repository commit 7c3ac4ad5a64b737e1b8f73c522e006097596f1d
parents: 3
diff changeset
7 # target HMM database: localref.hmm
6e27bb3f0fa6 "planemo upload for repository commit 0bccf5220ed6549db7e053f85bbe917326b0a0be"
parents: 5
diff changeset
8 # per-seq hits tabular output: /tmp/tmp2vk0_a8v/files/7/0/4/dataset_70487df9-4948-42c0-a250-638bcc64487a.dat
6e27bb3f0fa6 "planemo upload for repository commit 0bccf5220ed6549db7e053f85bbe917326b0a0be"
parents: 5
diff changeset
9 # hits output in Dfam format: /tmp/tmp2vk0_a8v/files/8/0/f/dataset_80fdcb47-0041-4a2c-bc0a-4820ac3c27d0.dat
036df14999e8 planemo upload for repository commit fa7dec5f222510d58f566f4799a04e3731fa03f6
diff changeset
10 # max ASCII text line length: unlimited
036df14999e8 planemo upload for repository commit fa7dec5f222510d58f566f4799a04e3731fa03f6
diff changeset
11 # Vit filter P threshold: <= 0.001
036df14999e8 planemo upload for repository commit fa7dec5f222510d58f566f4799a04e3731fa03f6
diff changeset
12 # Fwd filter P threshold: <= 1e-05
036df14999e8 planemo upload for repository commit fa7dec5f222510d58f566f4799a04e3731fa03f6
diff changeset
13 # random number seed set to: 4
6e27bb3f0fa6 "planemo upload for repository commit 0bccf5220ed6549db7e053f85bbe917326b0a0be"
parents: 5
diff changeset
14 # number of worker threads: 0
036df14999e8 planemo upload for repository commit fa7dec5f222510d58f566f4799a04e3731fa03f6
diff changeset
15 # - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - -
036df14999e8 planemo upload for repository commit fa7dec5f222510d58f566f4799a04e3731fa03f6
diff changeset
036df14999e8 planemo upload for repository commit fa7dec5f222510d58f566f4799a04e3731fa03f6
diff changeset
17 Query: humanchr1/239220001-239550000 [L=330000]
036df14999e8 planemo upload for repository commit fa7dec5f222510d58f566f4799a04e3731fa03f6
diff changeset
18 Scores for complete hit:
036df14999e8 planemo upload for repository commit fa7dec5f222510d58f566f4799a04e3731fa03f6
diff changeset
19 E-value score bias Model start end Description
036df14999e8 planemo upload for repository commit fa7dec5f222510d58f566f4799a04e3731fa03f6
diff changeset
20 ------- ------ ----- -------- ----- ----- -----------
5113c71c7031 "planemo upload for repository commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
parents: 4
diff changeset
21 4e-11 41.3 7.5 MADE1 302390 302466 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
5113c71c7031 "planemo upload for repository commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
parents: 4
diff changeset
22 1.9e-08 32.8 8.3 MADE1 174456 174498 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
5113c71c7031 "planemo upload for repository commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
parents: 4
diff changeset
23 6.3e-08 31.0 6.7 MADE1 302466 302389 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
5113c71c7031 "planemo upload for repository commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
parents: 4
diff changeset
24 4.9e-06 25.0 7.0 MADE1 174493 174456 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
036df14999e8 planemo upload for repository commit fa7dec5f222510d58f566f4799a04e3731fa03f6
diff changeset
25 ------ inclusion threshold ------
5113c71c7031 "planemo upload for repository commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
parents: 4
diff changeset
26 2.2 6.9 7.2 MADE1 304073 304103 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
036df14999e8 planemo upload for repository commit fa7dec5f222510d58f566f4799a04e3731fa03f6
diff changeset
036df14999e8 planemo upload for repository commit fa7dec5f222510d58f566f4799a04e3731fa03f6
diff changeset
036df14999e8 planemo upload for repository commit fa7dec5f222510d58f566f4799a04e3731fa03f6
diff changeset
29 Annotation for each hit (and alignments):
036df14999e8 planemo upload for repository commit fa7dec5f222510d58f566f4799a04e3731fa03f6
diff changeset
30 >> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
036df14999e8 planemo upload for repository commit fa7dec5f222510d58f566f4799a04e3731fa03f6
diff changeset
31 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to mod len acc
036df14999e8 planemo upload for repository commit fa7dec5f222510d58f566f4799a04e3731fa03f6
diff changeset
32 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ----
5113c71c7031 "planemo upload for repository commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
parents: 4
diff changeset
33 ! 41.3 7.5 4e-11 4 80 .] 302390 302466 .. 302387 302466 .. 80 0.88
036df14999e8 planemo upload for repository commit fa7dec5f222510d58f566f4799a04e3731fa03f6
diff changeset
036df14999e8 planemo upload for repository commit fa7dec5f222510d58f566f4799a04e3731fa03f6
diff changeset
35 Alignment:
5113c71c7031 "planemo upload for repository commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
parents: 4
diff changeset
36 score: 41.3 bits
036df14999e8 planemo upload for repository commit fa7dec5f222510d58f566f4799a04e3731fa03f6
diff changeset
37 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx....xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
036df14999e8 planemo upload for repository commit fa7dec5f222510d58f566f4799a04e3731fa03f6
diff changeset
38 MADE1 4 ggttggtgcaaaagtaattgcggtttttgccattacttttaatggc....aaaaaccgcaattacttttgcaccaacctaa 80
5113c71c7031 "planemo upload for repository commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
parents: 4
diff changeset
39 ggt ggtgcaaaa aattg ggtttttgccatt cttttaat gc aaaa g a t ctttt caccaa ctaa
5113c71c7031 "planemo upload for repository commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
parents: 4
diff changeset
5113c71c7031 "planemo upload for repository commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
parents: 4
diff changeset
41 89*******************************************966644554...34.4578**************997 PP
036df14999e8 planemo upload for repository commit fa7dec5f222510d58f566f4799a04e3731fa03f6
diff changeset
036df14999e8 planemo upload for repository commit fa7dec5f222510d58f566f4799a04e3731fa03f6
diff changeset
43 >> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
036df14999e8 planemo upload for repository commit fa7dec5f222510d58f566f4799a04e3731fa03f6
diff changeset
44 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to mod len acc
036df14999e8 planemo upload for repository commit fa7dec5f222510d58f566f4799a04e3731fa03f6
diff changeset
45 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ----
5113c71c7031 "planemo upload for repository commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
parents: 4
diff changeset
46 ! 32.8 8.3 1.9e-08 1 43 [. 174456 174498 .. 174456 174518 .. 80 0.91
036df14999e8 planemo upload for repository commit fa7dec5f222510d58f566f4799a04e3731fa03f6
diff changeset
036df14999e8 planemo upload for repository commit fa7dec5f222510d58f566f4799a04e3731fa03f6
diff changeset
48 Alignment:
5113c71c7031 "planemo upload for repository commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
parents: 4
diff changeset
49 score: 32.8 bits
036df14999e8 planemo upload for repository commit fa7dec5f222510d58f566f4799a04e3731fa03f6
diff changeset
50 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
036df14999e8 planemo upload for repository commit fa7dec5f222510d58f566f4799a04e3731fa03f6
diff changeset
51 MADE1 1 ttaggttggtgcaaaagtaattgcggtttttgccattactttt 43
036df14999e8 planemo upload for repository commit fa7dec5f222510d58f566f4799a04e3731fa03f6
diff changeset
52 ttaggtt gtgcaaaagtaattg ggtttttg cattactttt
036df14999e8 planemo upload for repository commit fa7dec5f222510d58f566f4799a04e3731fa03f6
diff changeset
53 humanchr1/239220001-239550000 174456 TTAGGTTAGTGCAAAAGTAATTGTGGTTTTTGTCATTACTTTT 174498
5113c71c7031 "planemo upload for repository commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
parents: 4
diff changeset
54 589************************************9986 PP
036df14999e8 planemo upload for repository commit fa7dec5f222510d58f566f4799a04e3731fa03f6
diff changeset
036df14999e8 planemo upload for repository commit fa7dec5f222510d58f566f4799a04e3731fa03f6
diff changeset
56 >> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
036df14999e8 planemo upload for repository commit fa7dec5f222510d58f566f4799a04e3731fa03f6
diff changeset
57 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to mod len acc
036df14999e8 planemo upload for repository commit fa7dec5f222510d58f566f4799a04e3731fa03f6
diff changeset
58 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ----
5113c71c7031 "planemo upload for repository commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
parents: 4
diff changeset
59 ! 31.0 6.7 6.3e-08 1 78 [. 302466 302389 .. 302466 302387 .. 80 0.80
036df14999e8 planemo upload for repository commit fa7dec5f222510d58f566f4799a04e3731fa03f6
diff changeset
036df14999e8 planemo upload for repository commit fa7dec5f222510d58f566f4799a04e3731fa03f6
diff changeset
61 Alignment:
5113c71c7031 "planemo upload for repository commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
parents: 4
diff changeset
62 score: 31.0 bits
5113c71c7031 "planemo upload for repository commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
parents: 4
diff changeset
63 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx....xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
5113c71c7031 "planemo upload for repository commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
parents: 4
diff changeset
64 MADE1 1 ttaggttggtgcaaaagtaattgcggttttt....gccattacttttaatggcaaaaaccgcaattacttttgcaccaacct 78
5113c71c7031 "planemo upload for repository commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
parents: 4
diff changeset
65 ttag ttggtg aaaag a t tttt gc atta +aatggcaaaaacc caatt ttttgcacc acc
5113c71c7031 "planemo upload for repository commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
parents: 4
diff changeset
5113c71c7031 "planemo upload for repository commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
parents: 4
diff changeset
67 6899************97543.2...23333455566666666666799*****************************9985 PP
036df14999e8 planemo upload for repository commit fa7dec5f222510d58f566f4799a04e3731fa03f6
diff changeset
036df14999e8 planemo upload for repository commit fa7dec5f222510d58f566f4799a04e3731fa03f6
diff changeset
69 >> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
036df14999e8 planemo upload for repository commit fa7dec5f222510d58f566f4799a04e3731fa03f6
diff changeset
70 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to mod len acc
036df14999e8 planemo upload for repository commit fa7dec5f222510d58f566f4799a04e3731fa03f6
diff changeset
71 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ----
5113c71c7031 "planemo upload for repository commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
parents: 4
diff changeset
72 ! 25.0 7.0 4.9e-06 43 80 .] 174493 174456 .. 174513 174456 .. 80 0.94
036df14999e8 planemo upload for repository commit fa7dec5f222510d58f566f4799a04e3731fa03f6
diff changeset
036df14999e8 planemo upload for repository commit fa7dec5f222510d58f566f4799a04e3731fa03f6
diff changeset
74 Alignment:
5113c71c7031 "planemo upload for repository commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
parents: 4
diff changeset
75 score: 25.0 bits
036df14999e8 planemo upload for repository commit fa7dec5f222510d58f566f4799a04e3731fa03f6
diff changeset
76 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
036df14999e8 planemo upload for repository commit fa7dec5f222510d58f566f4799a04e3731fa03f6
diff changeset
77 MADE1 43 taatggcaaaaaccgcaattacttttgcaccaacctaa 80
036df14999e8 planemo upload for repository commit fa7dec5f222510d58f566f4799a04e3731fa03f6
diff changeset
78 taatg caaaaacc caattacttttgcac aacctaa
036df14999e8 planemo upload for repository commit fa7dec5f222510d58f566f4799a04e3731fa03f6
diff changeset
79 humanchr1/239220001-239550000 174493 TAATGACAAAAACCACAATTACTTTTGCACTAACCTAA 174456
5113c71c7031 "planemo upload for repository commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
parents: 4
diff changeset
80 5899*******************************986 PP
036df14999e8 planemo upload for repository commit fa7dec5f222510d58f566f4799a04e3731fa03f6
diff changeset
036df14999e8 planemo upload for repository commit fa7dec5f222510d58f566f4799a04e3731fa03f6
diff changeset
82 >> MADE1 MADE1 (MAriner Derived Element 1), a TcMar-Mariner DNA transposon
036df14999e8 planemo upload for repository commit fa7dec5f222510d58f566f4799a04e3731fa03f6
diff changeset
83 score bias Evalue hmmfrom hmm to alifrom ali to envfrom env to mod len acc
036df14999e8 planemo upload for repository commit fa7dec5f222510d58f566f4799a04e3731fa03f6
diff changeset
84 ------ ----- --------- ------- ------- --------- --------- --------- --------- --------- ----
5113c71c7031 "planemo upload for repository commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
parents: 4
diff changeset
85 ? 6.9 7.2 2.2 41 71 .. 304073 304103 .. 304053 304109 .. 80 0.85
036df14999e8 planemo upload for repository commit fa7dec5f222510d58f566f4799a04e3731fa03f6
diff changeset
036df14999e8 planemo upload for repository commit fa7dec5f222510d58f566f4799a04e3731fa03f6
diff changeset
87 Alignment:
5113c71c7031 "planemo upload for repository commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
parents: 4
diff changeset
88 score: 6.9 bits
5113c71c7031 "planemo upload for repository commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
parents: 4
diff changeset
89 xxxxxxxxxxxxxxxxxxxxxxxxxxxxxxx RF
5113c71c7031 "planemo upload for repository commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
parents: 4
diff changeset
90 MADE1 41 tttaatggcaaaaaccgcaattacttttgca 71
5113c71c7031 "planemo upload for repository commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
parents: 4
diff changeset
91 tt a tgg aaaaa ca tta ttttgca
5113c71c7031 "planemo upload for repository commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
parents: 4
diff changeset
92 humanchr1/239220001-239550000 304073 TTAAGTGGGAAAAAATACACTTATTTTTGCA 304103
5113c71c7031 "planemo upload for repository commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
parents: 4
diff changeset
93 456789************************8 PP
036df14999e8 planemo upload for repository commit fa7dec5f222510d58f566f4799a04e3731fa03f6
diff changeset
036df14999e8 planemo upload for repository commit fa7dec5f222510d58f566f4799a04e3731fa03f6
diff changeset
036df14999e8 planemo upload for repository commit fa7dec5f222510d58f566f4799a04e3731fa03f6
diff changeset
036df14999e8 planemo upload for repository commit fa7dec5f222510d58f566f4799a04e3731fa03f6
diff changeset
97 Internal pipeline statistics summary:
036df14999e8 planemo upload for repository commit fa7dec5f222510d58f566f4799a04e3731fa03f6
diff changeset
98 -------------------------------------
036df14999e8 planemo upload for repository commit fa7dec5f222510d58f566f4799a04e3731fa03f6
diff changeset
99 Query sequence(s): 1 (660000 residues searched)
036df14999e8 planemo upload for repository commit fa7dec5f222510d58f566f4799a04e3731fa03f6
diff changeset
100 Target model(s): 1 (80 nodes)
5113c71c7031 "planemo upload for repository commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
parents: 4
diff changeset
101 Residues passing SSV filter: 60770 (0.0921); expected (0.02)
5113c71c7031 "planemo upload for repository commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
parents: 4
diff changeset
102 Residues passing bias filter: 35792 (0.0542); expected (0.02)
5113c71c7031 "planemo upload for repository commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
parents: 4
diff changeset
103 Residues passing Vit filter: 1612 (0.00244); expected (0.001)
5113c71c7031 "planemo upload for repository commit 7d31599a80c15f11ed00b2b3cbfb77ed6dfc8f3d"
parents: 4
diff changeset
104 Residues passing Fwd filter: 1194 (0.00181); expected (1e-05)
793967b6ae8a planemo upload for repository commit 7c3ac4ad5a64b737e1b8f73c522e006097596f1d
parents: 3
diff changeset
105 Total number of hits: 5 (0.000405)
6e27bb3f0fa6 "planemo upload for repository commit 0bccf5220ed6549db7e053f85bbe917326b0a0be"
parents: 5
diff changeset
106 # CPU time: 0.02u 0.00s 00:00:00.02 Elapsed: 00:00:00.01
6e27bb3f0fa6 "planemo upload for repository commit 0bccf5220ed6549db7e053f85bbe917326b0a0be"
parents: 5
diff changeset
107 # Mc/sec: 2765.21
036df14999e8 planemo upload for repository commit fa7dec5f222510d58f566f4799a04e3731fa03f6
diff changeset
108 //
036df14999e8 planemo upload for repository commit fa7dec5f222510d58f566f4799a04e3731fa03f6
diff changeset
109 [ok]