changeset 0:419cd817299c draft

planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hyphy/ commit 538d41e9789e18c8edb3dc68a1aabbee9b9f8bea
author iuc
date Thu, 17 Jan 2019 04:22:13 -0500
parents
children 5c87e4907e08
files hyphy_absrel.xml macros.xml test-data/absrel-in1.fa test-data/absrel-in1.nhx test-data/absrel-out1.json test-data/busted-out1.json test-data/fel-out1.json test-data/fubar-in1.fa test-data/fubar-in1.nhx test-data/fubar-out1.json test-data/meme-in1.fa test-data/meme-in1.nhx test-data/meme-out1.json test-data/params.json test-data/slac-out1.json
diffstat 15 files changed, 17806 insertions(+), 14 deletions(-) [+]
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/hyphy_absrel.xml	Thu Jan 17 04:22:13 2019 -0500
@@ -0,0 +1,51 @@
+<?xml version="1.0"?>
+<tool id="hyphy_absrel" name="HyPhy-aBSREL" version="@VERSION@+galaxy0">
+    <description>adaptive Branch Site Random Effects Likelihood</description>
+    <macros>
+        <import>macros.xml</import>
+    </macros>
+    <expand macro="requirements" />
+    <expand macro="version_command" />
+    <command detect_errors="exit_code">
+    <![CDATA[
+    ln -s '$input_file' absrel_input.fa &&
+    ln -s '$input_nhx' absrel_input.nhx &&
+    echo $gencodeid > tool_params &&
+    echo `pwd`/absrel_input.fa >> tool_params &&
+    echo `pwd`/absrel_input.nhx >> tool_params &&
+    echo '$branches' >> tool_params &&
+    @HYPHY_INVOCATION@ \$HYPHY_LIB/TemplateBatchFiles/SelectionAnalyses/aBSREL.bf
+    #if $log:
+        > '$absrel_log'
+    #end if
+    ]]>
+    </command>
+    <inputs>
+        <expand macro="inputs" />
+        <param name="log" type="boolean" truevalue="" falsevalue="" label="Output aBSREL log to history" />
+        <expand macro="gencode" />
+        <expand macro="branches" />
+    </inputs>
+    <outputs>
+        <data name="absrel_log" format="txt">
+            <filter>log</filter>
+        </data>
+        <data name="absrel_output" format="json" from_work_dir="absrel_input.fa.ABSREL.json" />
+    </outputs>
+    <tests>
+        <test>
+            <param name="input_file" ftype="fasta" value="absrel-in1.fa" />
+            <param name="input_nhx" ftype="nhx" value="absrel-in1.nhx" />
+            <param name="log" value="false" />
+            <output name="absrel_output" file="absrel-out1.json" compare="sim_size" />
+        </test>
+    </tests>
+    <help>
+        <![CDATA[
+aBSREL (Adaptive branch-site random effects likelihood) uses an adaptive random effects branch-site model framework to test whether each branch has evolved under positive selection, using a procedure which infers an optimal number of rate categories per branch.
+        ]]>
+    </help>
+    <expand macro="citations">
+        <citation type="doi">10.1093/molbev/msv022</citation>
+    </expand>
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/macros.xml	Thu Jan 17 04:22:13 2019 -0500
@@ -0,0 +1,57 @@
+<?xml version="1.0"?>
+<macros>
+    <xml name="inputs">
+        <param name="input_file" type="data" format="fasta" label="Input FASTA file" />
+        <param name="input_nhx" type="data" format="nhx" label="Input newick file" />
+    </xml>
+    <xml name="gencode">
+        <param name="gencodeid" type="select" label="Genetic code">
+            <option value="1">Universal code</option>
+            <option value="2">Vertebrate mitochondrial DNA code</option>
+            <option value="3">Yeast mitochondrial DNA code</option>
+            <option value="4">Mold, Protozoan and Coelenterate mt; Mycloplasma/Spiroplasma</option>
+            <option value="5">Invertebrate mitochondrial DNA code</option>
+            <option value="6">Ciliate, Dasycladacean and Hexamita Nuclear code</option>
+            <option value="7">Echinoderm mitochondrial DNA code</option>
+            <option value="8">Euplotid Nuclear code</option>
+            <option value="9">Alternative Yeast Nuclear code</option>
+            <option value="10">Ascidian mitochondrial DNA code</option>
+            <option value="11">Flatworm mitochondrial DNA code</option>
+            <option value="12">Blepharisma Nuclear code</option>
+        </param>
+    </xml>
+    <xml name="branches">
+        <param name="branches" type="select" label="Set of branches to test">
+            <option value="1">All branches</option>
+            <option value="2">Internal branches</option>
+            <option value="3">Leaf branches</option>
+            <option value="4">Unlabeled branches</option>
+        </param>
+    </xml>
+    <xml name="version_command">
+        <version_command>HYPHYMP --version | tail -n 1 | awk '{print $1}'</version_command>
+    </xml>
+    <xml name="citations">
+        <citations>
+            <citation type="doi">10.1093/bioinformatics/bti079</citation>
+            <yield />
+        </citations>
+    </xml>
+    <token name="@VERSION@">2.3.14</token>
+    <xml name="requirements">
+        <requirements>
+            <requirement type="package" version="@VERSION@">hyphy</requirement>
+            <yield />
+        </requirements>
+    </xml>
+    <token name="@HYPHY_INVOCATION@"><![CDATA[export HYPHY=`which HYPHYMP` &&
+export HYPHY_PATH=`dirname \$HYPHY` &&
+export HYPHY_LIB=`readlink -f \$HYPHY_PATH/../lib/hyphy` &&
+cat tool_params | HYPHYMP LIBPATH=\$HYPHY_LIB ]]>
+    </token>
+    <token name="@HYPHYMPI_INVOCATION@"><![CDATA[export HYPHY=`which HYPHYMP` &&
+export HYPHY_PATH=`dirname \$HYPHY` &&
+export HYPHY_LIB=`readlink -f \$HYPHY_PATH/../lib/hyphy` &&
+cat tool_params | mpirun -np \${GALAXY_SLOTS:-1} HYPHYMPI LIBPATH=\$HYPHY_LIB ]]>
+    </token>
+</macros>
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/absrel-in1.fa	Thu Jan 17 04:22:13 2019 -0500
@@ -0,0 +1,20 @@
+>Human
+AAAGAGATTACGAATGCCTTGGAAACCTGGGGTGCCTTGGGTCAGGACATCAACTTGGACATTCCTAGTTTTCAAATGAGTGATGATATTGACGATATAAAATGGGAAAAAACTTCAGACAAGAAAAAGATTGCACAATTCAGAAAAGAGAAAGAGACTTTCAAGGAAAAAGATACATATAAGCTATTTAAAAATGGAACTCTGAAAATTAAGCAT---CTGAAGACCGATGATCAGGATATCTACAAGGTATCAATATATGATACAAAAGGAAAAAATGTGTTGGAAAAAATATTTGATTTGAAGATTCAAGAGAGGGTCTCAAAACCAAAGATCTCCTGGACTTGTATCAACACAACCCTGACCTGTGAGGTAATGAATGGAACTGACCCCGAATTAAACCTGTATCAAGATGGGAAACATCTAAAA---CTTTCTCAGAGGGTCATCACACACAAGTGGACCACCAGCCTGAGTGCAAAATTCAAGTGCACAGCAGGGAACAAAGTCAGCAAGGAATCCAGTGTCGAGCCTGTCAGCTGTCCAGAGAAAGGTCTGGAC
+>Chimp
+GAAGAGATTACGAATGCCTTGGAAACCTGGGGTGCCTTGGGTCAGGACATCAACTTGGACATTCCTAGTTTTCAAATGAGTGATGATATTGACGATATAAAATGGGAAAAAACTTCAGACAAGAAAAAGATTGCACAATTCAGAAAAGAGAAAGAGACTTTCAAGGAAAAAGATACATATAAGCTATTTAAAAATGGAACTCTGAAAATTAAGCAT---CTGAAGACCGATGATCAGGATATCTACAAGGTATCAATATATGATACAAAAGGAAAAAATGTGTTGGAAAAAATATTTGATTTGAAGATTCAAGAGAGGGTCTCAAAACCAAAGATCTCCTGGACTTGTATCAACACAACCCTGACCTGTGAGGTAATGAATGGAACTGACCCCGAATTAAACCTGTATCAAGATGGGAAACATCTAAAA---CTTTCTCAGAGGGTCATCACACACAAGTGGACCACCAGCCTGAGTGCAAAATTCAAGTGCACAGCAGGGAACAAAGTCAGCAAGGAATCCAGTGTCGAGCCTGTCAGCTGTCCAGAGAAAGGTCTGGAC
+>Baboon
+AAAGAGATTAGGAATGCTTTGGAAACCTGGGGAGCGCTGGGTCAGGACATCGACTTGGACATTCCTAGTTTTCAAATGAGTGATGATATTGATGATATAAAATGGGAGAAAACTTCAGACAAGAAAAAGATTGCACAATTCAGAAAAGAGAAGGAGACTTTCGAGGAAAAAGATGCATATAAGCTATTTAAAAACGGAACTCTGAAAATTAAGCAT---CTGAAGATCCATGATCAGGATAGCTACAAGGTATCAATATACGATACAAAAGGAAAAAATGTGTTGGAAAAAACATTTGATTTGAAGATTCAAGAGAGGGTCTCAGAACCAAAGATCTCCTGGACTTGTATCAACACAACCCTGACCTGTGAAGTAATGAATGGAACTGACCCCGAATTAAACCTGTATCAAGATGGGAAACATCTAAAA---CTTTCTCAGAGGGTCATCACACACAAGTGGACCACCAGCCTGAGTGCGAAATTCAAGTGCACAGCAGGGAACAAAGTCAGCAAGGAATCCAGGATGGAGACTGTCAGCTGTCCAGAGAAAGGTCTGGAC
+>RhMonkey
+AAAGAGATTAGGAATGCTTTGGAAACCTGGGGAGCGCTGGGTCAGGACATCGACTTGGACATTCCTAGTTTTCAAATGAGTGATGATATTGATGATATAAGATGGGAAAAAACTTCAGACAAGAAAAAGATTGCACAATTCAGAAAAGAGAAGGAGACTTTCGAGGAAAAAGATGCATATAAGCTATTTAAAAACGGAACTCTGAAAAYTAAGCAT---CTGAAGATCCATGATCAGGATAGCTACAAGGTATCAATATACGATACAAAAGGAAAAAATGTGTTGGAAAAAACATTTGATTTGAAGATTCAAGAGAGGGTCTCAGAACCAAAGATCTCCTGGACTTGTATCAACACAACCCTGACCTGTGAAGTAATGAATGGAACTGRCCCCGAATTAAACCTGTATCAAGATGGGAAACATGTAAAA---CTTTCTCAGAGGGTCATCACACACAAGTGGACCACCAGCCTGAGTGCGAAATTCAAGTGCACAGCAGGGAACAAAGTCAGCAAGGAATCCAGGATGGAGACTGTCAGCTGTCCAGAGAAAGGTCTGGAC
+>Cow
+------------GAAAGCATTGTCGTCTGGGGTGCCCTGGATCATGACCTCAACCTGGACATTCCTGGTTTTCCAAGAAGTGATATAGTGGCAGATATAAAATGGAACAGA------AACAAAAACAAGATTGCACGAATAAAGAAAGATATGCCACTTCACAATGAAATGGACAAATATGATATGTTTACAAATGGAACTCTGAAAATTAAAACT---CTGATGAGAAACGATAGTGGTCTCTATGAGGTAGAGGTTTATGATTCAAATGGAGTAAACCTACTGAGCAAAAAATTTGATTTGAAGATTCAAGAGATGCTCTCAGGACCTGAAATTAACTGGATCTGTACCAACAGAACTGTGAGCTGCAAGGTAGAAAATGGAAGTAATCCTAAATTACAACTGTTTTTAAATACGACCCGTGTCAAACAAGATCATGGGAAGCTCATCACCTACACGTGGAACACCAGATGGAATAAAACATTCAAGTGCGTGGCGAGTAACCATGTCGATAGCAAAGTCAGCATAGAGATCGCCGTGTGTCCAGATGAAGGTCTGGAT
+>Pig
+---------------ACTGAGGTTGTCTGGGGCATCGTGGATCAAGACATCAACCTGGACATTCCTGAACTTTCAAAACATGATAACGTAGATCATATACGATGGCAGAAG------AATGAAAACAAGATCGCAGAATTTAAAAAAAACAAAGAAACTCACCCTGTGAAAGACACATACATGATGTTACCAAATGGAACTCTGAGAATTAAAGAT---CTGAAGAGAGATGATGAGGGTATCTACAAGGTAACTGTCTATGCTACGGATGGAAAACACATGCTGGAGAGAAAATTTGATTTGCCGATTCTAGATGGGGTCTCAAAACCTGTAATCTCCTGGAGCTGTGCCGACAAAACGGTGACCTGTGAGGTAGCAGAAGGAAGTGACCCTAAGTTAAAACTGTATGTAAATAAGTCCACTGCCAGAGAAGGTCGTCAGAAGGTCATCCTGTGGAAGTGGAACACCAAATGGAGCACATTATTCAAGTGTGTGGCCAGTAACAACGCCAGTGAGCAAATCAGCATGGTGACCATCAGTTGTACGGGGCAAGGTCTGGAT
+>Horse
+------------AAGAATATCACCATCTTGGGTGCCCTGGAACGTGATATCAACCTGGACATTCCTGCTTTTCAAATGAGTGAGCATGTAGAAGATATACAATGGAGCAAA------GGAAAAACCAAGATTGCAAAATTCAAAAATGGCAGTATGACTTTCCAGAAAGATAAAACATACGAGGTATTAAAAAATGGAACTCTGAAAATTAAACAT---CTGGAGAGAATTCATGAAGGTACCTACAAGGTAGACGCATATGATAGTGATGGAAAAAATGTGTTGGAGGAAACATTTCATTTGAGCCTTCTAGAGATGGTCTCAAAACCTAATATCTCCTGGAGCTGCACCAACACCACCCTGACCTGCGAGGTGACAAAAGGAACTGACTTTGAGTTAAAACTCTATCTAAATGGGAGAATGATCCAAAAAAGTCCTCGCAAAGTCATCGTATACAAGCGGGCCAGCAACCAAATTGCGTCCTTCAAGTGCACAGCCAATAACACAGTCAGCGAGGAAAGCAGCTCTGTGGTCATCAGGTGTACAGAGAAAGGTCTGGAT
+>Cat
+---------GCAAATGATGATATCGTCTGGGGTACCCTGGGTCAGGACATCAACCTGGACATTCCTGATTCTCAA---GGGATTAATATAGATGATATACACTGGGAAAAA------GGCAAGAAGAAGGTGGCGAGGTTCCAAATTAGCAACAAGCCTAAGAATCCAGATGAAAAATATAATGTGTCAATGAATGGAACTCTGAAAATTAAACAT---CTGATGCTAGAAGACTGCGATACCTACAAGGTTGTTATATACGATAAGGATGGAAAGAATGTGTTGGATAAAACATTTCAGCTGAAGATTCAAGAGAAGGTCTCAACGCCTAACATCGACTGGAATTGTATCAACAAAACCCTGGTCTGTAAGGTATCAAATGGAACAGACCCTGAATTAAAACTGTACGTAAATGGGACCAGTATCAAGCCCGTTTCTTCGAAGTTCAGCACATACAGGTTTATAAACAAGCAGAAGATATTAGTCAACTGCACGGCAGAAAACAAAGTCAGCAAGGAAAGCGACGTGAAGATGATCACTTGTTCAGAGAAGGGTCTGGAC
+>Mouse
+---------AGAGACAATGAGACCATCTGGGGTGTCTTGGGTCATGGCATCACCCTGAACATCCCCAACTTTCAAATGACTGATGATATTGATGAGGTGCGATGGGTAAGG------AGGGGCACCCTGGTCGCAGAGTTTAAAAGGAAGAAGCCACCTTTTTTGATATCAGAAACGTATGAGGTCTTAGCAAACGGATCCCTGAAGATAAAGAAGCCGATGATGAGAAACGACAGTGGCACCTATAATGTAATGGTGTATGGCACAAATGGGATGACTAGGCTGGAGAAGGACCTGGACGTGAGGATTCTGGAGAGGGTCTCAAAGCCCATGATCCACTGGGAATGCCCCAACACAACCCTGACCTGTGCGGTCTTGCAAGGGACAGATTTTGAACTGAAGCTGTATCAAGGGGAAACACTACTCAATAGTCTCCCCCAGAAGAACATGAGTTACCAGTGG---ACCAACCTGAACGCACCATTCAAGTGTGAGGCGATAAACCCGGTCAGCAAGGAGTCTAAGATGGAAGTTGTTAACTGTCCAGAGAAAGGTCTGTCC
+>Rat
+---------AGAGACAGTGGGACCGTCTGGGGTGCCCTGGGTCATGGCATCAACCTGAACATCCCTAACTTTCAAATGACTGATGATATTGATGAGGTGCGATGGGAGAGG------GGGAGCACCCTGGTTGCCGAGTTTAAAAGGAAGATGAAGCCTTTTTTGAAATCGGGAGCATTTGAGATCTTAGCAAATGGAGACTTGAAGATAAAGAAT---CTGACAAGAGATGACAGTGGCACCTATAATGTAACGGTATACAGCACAAATGGGACACGTATCCTGGACAAGGCACTGGACTTGAGGATTCTAGAGATGGTCTCAAAGCCGATGATCTACTGGGAGTGCAGCAACGCAACCCTGACCTGTGAGGTCTTGGAAGGAACAGATGTTGAACTAAAGCTGTACCAAGGAAAGGAGCATCTCAGGAGCCTCCGTCAGAAGACCATGAGTTACCAGTGG---ACCAACCTGAGAGCACCGTTTAAGTGCAAGGCGGTAAACAGGGTCAGCCAGGAGTCTGAGATGGAAGTTGTCAACTGTCCAGAGAAAGGTCTGCCC
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/absrel-in1.nhx	Thu Jan 17 04:22:13 2019 -0500
@@ -0,0 +1,1 @@
+((((Pig:0.147969,Cow:0.213430):0.085099,Horse:0.165787,Cat:0.264806):0.058611,((RhMonkey:0.002015,Baboon:0.003108):0.022733,(Human:0.004349,Chimp:0.000799):0.011873):0.101856):0.340802,Rat:0.050958,Mouse:0.097950);
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/absrel-out1.json	Thu Jan 17 04:22:13 2019 -0500
@@ -0,0 +1,456 @@
+{
+ "analysis":{
+   "info":"aBSREL (Adaptive branch-site random effects likelihood)\n                            uses an adaptive random effects branch-site model framework\n                            to test whether each branch has evolved under positive selection,\n                            using a procedure which infers an optimal number of rate categories per branch.",
+   "version":"2.0",
+   "citation":"Less Is More: An Adaptive Branch-Site Random Effects Model for Efficient Detection of Episodic Diversifying Selection (2015). Mol Biol Evol 32 (5): 1342-1353",
+   "authors":"Sergei L Kosakovsky Pond, Ben Murrell, Steven Weaver and Temple iGEM / UCSD viral evolution group",
+   "contact":"spond@temple.edu",
+   "requirements":"in-frame codon alignment and a phylogenetic tree"
+  },
+ "input":{
+   "file name":"/tmp/tmpCAMqUO/job_working_directory/002/2602/working/absrel_input.fa",
+   "number of sequences":10,
+   "number of sites":187,
+   "partition count":1,
+   "trees":{
+     "0":"((((Pig:0.147969,Cow:0.21343)Node3:0.085099,Horse:0.165787,Cat:0.264806)Node2:0.058611,((RhMonkey:0.002015,Baboon:0.003108)Node9:0.022733,(Human:0.004349,Chimp:0.000799)Node12:0.011873)Node8:0.101856)Node1:0.340802,Rat:0.050958,Mouse:0.09795)"
+    }
+  },
+ "fits":{
+   "Nucleotide GTR":{
+     "Log Likelihood":-3531.96369518556,
+     "estimated parameters":24,
+     "AIC-c":7112.577796875186,
+     "Equilibrium frequencies":[
+      [0.3563279857397504],
+      [0.1837789661319073],
+      [0.2402852049910873],
+      [0.2196078431372549]
+      ],
+     "Rate Distributions":{
+       "Substitution rate from nucleotide A to nucleotide C":0.5474707834424497,
+       "Substitution rate from nucleotide A to nucleotide G":1,
+       "Substitution rate from nucleotide A to nucleotide T":0.2645731370379643,
+       "Substitution rate from nucleotide C to nucleotide G":0.4867482826410435,
+       "Substitution rate from nucleotide C to nucleotide T":1.018295973581558,
+       "Substitution rate from nucleotide G to nucleotide T":0.3026112531229544
+      },
+     "display order":0
+    },
+   "Baseline MG94xREV":{
+     "Log Likelihood":-3450.669934819203,
+     "estimated parameters":46,
+     "AIC-c":6995.711784065174,
+     "Equilibrium frequencies":[
+      [0.04787662253946073],
+      [0.03913388100305117],
+      [0.04844580322128512],
+      [0.0407178971288476],
+      [0.01817959331488358],
+      [0.01485982100934833],
+      [0.01839572120297191],
+      [0.01546129971531724],
+      [0.0190238172858878],
+      [0.01554988139098808],
+      [0.01924998172104109],
+      [0.01617929156565557],
+      [0.02798385246472159],
+      [0.02287372613761008],
+      [0.02831653817605838],
+      [0.02379958245776909],
+      [0.01680670574479072],
+      [0.01373763619452979],
+      [0.01700651207463693],
+      [0.01429369239710176],
+      [0.006381800954137531],
+      [0.005216421415661322],
+      [0.006457670922102578],
+      [0.00542756570877943],
+      [0.006678159032689796],
+      [0.005458661598138652],
+      [0.00675755225029668],
+      [0.00567961101013393],
+      [0.009823507779659469],
+      [0.008029638769211124],
+      [0.009940294440024354],
+      [0.008354653231583485],
+      [0.0329096029621651],
+      [0.02689998621179963],
+      [0.03330084840219455],
+      [0.02798881284619018],
+      [0.01249635346589736],
+      [0.01021439657952951],
+      [0.01264491622176376],
+      [0.01062784315018763],
+      [0.01307665913959002],
+      [0.01068873273724336],
+      [0.0132321208528494],
+      [0.01112137894012831],
+      [0.01923563996618058],
+      [0.01572302316926395],
+      [0.01946432265285621],
+      [0.01635944157725275],
+      [0.01977100255021048],
+      [0.02057127040149398],
+      [0.009184593415672956],
+      [0.007507396443725858],
+      [0.009293784349897772],
+      [0.007811272183233558],
+      [0.007856024926654371],
+      [0.009725369116048951],
+      [0.008174012048031599],
+      [0.01413784690564137],
+      [0.01155613719386138],
+      [0.01430592453757226],
+      [0.01202389319448819]
+      ],
+     "Rate Distributions":{
+       "Per-branch omega":{
+         "Mean":666666667.6064719,
+         "Median":1.103169534345197,
+         "2.5%":0,
+         "97.5%":10000000000
+        }
+      },
+     "display order":1
+    },
+   "Full adaptive model":{
+     "Log Likelihood":-3414.992415597899,
+     "estimated parameters":60,
+     "AIC-c":6954.031265689993,
+     "Rate Distributions":{
+      },
+     "display order":2
+    }
+  },
+ "timers":{
+   "Overall":{
+     "timer":98,
+     "order":0
+    },
+   "Preliminary model fitting":{
+     "timer":0,
+     "order":1
+    },
+   "Baseline model fitting":{
+     "timer":1,
+     "order":2
+    },
+   "Complexity analysis":{
+     "timer":36,
+     "order":3
+    },
+   "Full adaptive model fitting":{
+     "timer":8,
+     "order":4
+    },
+   "Testing for selection":{
+     "timer":53,
+     "order":5
+    }
+  },
+ "test results":{
+   "P-value threshold":0.05,
+   "tested":16,
+   "positive test results":3
+  },
+ "tested":{
+   "0":{
+     "Pig":"test",
+     "Cow":"test",
+     "Node3":"test",
+     "Horse":"test",
+     "Cat":"test",
+     "Node2":"test",
+     "RhMonkey":"test",
+     "Baboon":"test",
+     "Node9":"test",
+     "Human":"test",
+     "Chimp":"test",
+     "Node12":"test",
+     "Node8":"test",
+     "Node1":"test",
+     "Rat":"test",
+     "Mouse":"test"
+    }
+  },
+ "data partitions":{
+   "0":{
+     "name":"absrel.filter.default",
+     "coverage":[
+      [0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186]
+      ]
+    }
+  },
+ "branch attributes":{
+   "0":{
+     "Human":{
+       "original name":"Human",
+       "Nucleotide GTR":0,
+       "Baseline MG94xREV":0,
+       "Baseline MG94xREV omega ratio":1,
+       "Rate classes":1,
+       "Full adaptive model":0,
+       "Rate Distributions":[
+        [1, 1]
+        ],
+       "LRT":0,
+       "Uncorrected P-value":1,
+       "Corrected P-value":1
+      },
+     "Chimp":{
+       "original name":"Chimp",
+       "Nucleotide GTR":0.001818174796225333,
+       "Baseline MG94xREV":0.001839770270131542,
+       "Baseline MG94xREV omega ratio":10000000000,
+       "Rate classes":1,
+       "Full adaptive model":0.001845806111200226,
+       "Rate Distributions":[
+        [10000000000, 1]
+        ],
+       "LRT":0.6362875427803374,
+       "Uncorrected P-value":0.303261123771571,
+       "Corrected P-value":1
+      },
+     "Baboon":{
+       "original name":"Baboon",
+       "Nucleotide GTR":0.001682034724848474,
+       "Baseline MG94xREV":0.001821072110941238,
+       "Baseline MG94xREV omega ratio":0,
+       "Rate classes":1,
+       "Full adaptive model":0.001808294153407354,
+       "Rate Distributions":[
+        [0, 1]
+        ],
+       "LRT":0,
+       "Uncorrected P-value":1,
+       "Corrected P-value":1
+      },
+     "RhMonkey":{
+       "original name":"RhMonkey",
+       "Nucleotide GTR":0.003775509884015639,
+       "Baseline MG94xREV":0.003671340584166445,
+       "Baseline MG94xREV omega ratio":10000000000,
+       "Rate classes":1,
+       "Full adaptive model":0.003682180830540259,
+       "Rate Distributions":[
+        [10000000000, 1]
+        ],
+       "LRT":1.200615147074132,
+       "Uncorrected P-value":0.2192326116145807,
+       "Corrected P-value":1
+      },
+     "Cow":{
+       "original name":"Cow",
+       "Nucleotide GTR":0.248257545271419,
+       "Baseline MG94xREV":0.2535517510207829,
+       "Baseline MG94xREV omega ratio":1.957039676836281,
+       "Rate classes":2,
+       "Full adaptive model":0.3959632497370367,
+       "Rate Distributions":[
+        [0, 0.5384412409742189],
+        [10.58123012791267, 0.4615587590257811]
+        ],
+       "LRT":24.50128746473001,
+       "Uncorrected P-value":1.583131814197891e-06,
+       "Corrected P-value":2.533010902716626e-05
+      },
+     "Pig":{
+       "original name":"Pig",
+       "Nucleotide GTR":0.1872143003439852,
+       "Baseline MG94xREV":0.1913752025483544,
+       "Baseline MG94xREV omega ratio":1.354835319497051,
+       "Rate classes":1,
+       "Full adaptive model":0.1823079562415392,
+       "Rate Distributions":[
+        [1.270031670375847, 1]
+        ],
+       "LRT":0.5083013304356427,
+       "Uncorrected P-value":0.3278475069550038,
+       "Corrected P-value":1
+      },
+     "Horse":{
+       "original name":"Horse",
+       "Nucleotide GTR":0.2092211101976542,
+       "Baseline MG94xREV":0.2093433205074538,
+       "Baseline MG94xREV omega ratio":1.262933703792719,
+       "Rate classes":2,
+       "Full adaptive model":0.2696870893488891,
+       "Rate Distributions":[
+        [0, 0.5494326491453121],
+        [4.447670371762946, 0.4505673508546879]
+        ],
+       "LRT":9.839972152766677,
+       "Uncorrected P-value":0.002531289908698275,
+       "Corrected P-value":0.03543805872177586
+      },
+     "Cat":{
+       "original name":"Cat",
+       "Nucleotide GTR":0.2662269345134692,
+       "Baseline MG94xREV":0.2773733494290757,
+       "Baseline MG94xREV omega ratio":1.619113019542315,
+       "Rate classes":2,
+       "Full adaptive model":0.3637840333790108,
+       "Rate Distributions":[
+        [0.3427137549260186, 0.5775012741005606],
+        [6.025097508634321, 0.4224987258994394]
+        ],
+       "LRT":13.05292728184577,
+       "Uncorrected P-value":0.000499814517576469,
+       "Corrected P-value":0.007497217763647035
+      },
+     "Mouse":{
+       "original name":"Mouse",
+       "Nucleotide GTR":0.1181551390736968,
+       "Baseline MG94xREV":0.1220127721537473,
+       "Baseline MG94xREV omega ratio":0.5307054960008202,
+       "Rate classes":1,
+       "Full adaptive model":0.1200052061883895,
+       "Rate Distributions":[
+        [0.5418818043457002, 1]
+        ],
+       "LRT":0,
+       "Uncorrected P-value":1,
+       "Corrected P-value":1
+      },
+     "Rat":{
+       "original name":"Rat",
+       "Nucleotide GTR":0.06673994656462794,
+       "Baseline MG94xREV":0.06546903135094065,
+       "Baseline MG94xREV omega ratio":1.103169534345197,
+       "Rate classes":1,
+       "Full adaptive model":0.06894368446818594,
+       "Rate Distributions":[
+        [1.162844601638596, 1]
+        ],
+       "LRT":0.04180897168953379,
+       "Uncorrected P-value":0.4613906175252571,
+       "Corrected P-value":1
+      },
+     "Node1":{
+       "Nucleotide GTR":0.2772613398768408,
+       "Baseline MG94xREV":0.2903229694372956,
+       "Baseline MG94xREV omega ratio":0.4389914526526448,
+       "Rate classes":2,
+       "Full adaptive model":0.3664538683295676,
+       "Rate Distributions":[
+        [0.1934444279004118, 0.7920338324503209],
+        [2.595458156723663, 0.2079661675496791]
+        ],
+       "LRT":1.095302853601424,
+       "Uncorrected P-value":0.232551772988317,
+       "Corrected P-value":1
+      },
+     "Node12":{
+       "Nucleotide GTR":0.01783922546179193,
+       "Baseline MG94xREV":0.01797212760838867,
+       "Baseline MG94xREV omega ratio":0.3712490894908597,
+       "Rate classes":1,
+       "Full adaptive model":0.01648897148329989,
+       "Rate Distributions":[
+        [0.3341484726344874, 1]
+        ],
+       "LRT":0,
+       "Uncorrected P-value":1,
+       "Corrected P-value":1
+      },
+     "Node2":{
+       "Nucleotide GTR":0.06619058539001231,
+       "Baseline MG94xREV":0.06580724801157116,
+       "Baseline MG94xREV omega ratio":0.6811307469311604,
+       "Rate classes":2,
+       "Full adaptive model":0.1259563484776556,
+       "Rate Distributions":[
+        [0, 0.902872882268449],
+        [33.80023214939837, 0.09712711773155103]
+        ],
+       "LRT":7.670975764417562,
+       "Uncorrected P-value":0.007599562698001494,
+       "Corrected P-value":0.09119475237601793
+      },
+     "Node3":{
+       "Nucleotide GTR":0.09883236156840018,
+       "Baseline MG94xREV":0.102749851157051,
+       "Baseline MG94xREV omega ratio":1.47449378631578,
+       "Rate classes":2,
+       "Full adaptive model":0.1389308407753113,
+       "Rate Distributions":[
+        [0, 0.7024206790833775],
+        [8.065310624699681, 0.2975793209166225]
+        ],
+       "LRT":6.598417720076213,
+       "Uncorrected P-value":0.0131150962965953,
+       "Corrected P-value":0.1442660592625483
+      },
+     "Node8":{
+       "Nucleotide GTR":0.1061134663636472,
+       "Baseline MG94xREV":0.110140333084973,
+       "Baseline MG94xREV omega ratio":1.896243438714738,
+       "Rate classes":2,
+       "Full adaptive model":0.2165540926910564,
+       "Rate Distributions":[
+        [1, 0.9077840705139004],
+        [33.32075865076668, 0.09221592948609958]
+        ],
+       "LRT":7.97288393366216,
+       "Uncorrected P-value":0.006519360772582139,
+       "Corrected P-value":0.08475169004356781
+      },
+     "Node9":{
+       "Nucleotide GTR":0.02566719422260768,
+       "Baseline MG94xREV":0.02590165433349057,
+       "Baseline MG94xREV omega ratio":0.4071738826525522,
+       "Rate classes":1,
+       "Full adaptive model":0.02766629863085238,
+       "Rate Distributions":[
+        [0.4488424899910019, 1]
+        ],
+       "LRT":0,
+       "Uncorrected P-value":1,
+       "Corrected P-value":1
+      }
+    },
+   "attributes":{
+     "original name":{
+       "attribute type":"node label",
+       "display order":-1
+      },
+     "Nucleotide GTR":{
+       "attribute type":"branch length",
+       "display order":0
+      },
+     "Baseline MG94xREV":{
+       "attribute type":"branch length",
+       "display order":1
+      },
+     "Baseline MG94xREV omega ratio":{
+       "attribute type":"branch label",
+       "display order":1
+      },
+     "Rate classes":{
+       "attribute type":"branch label",
+       "display order":2
+      },
+     "Full adaptive model":{
+       "attribute type":"branch length",
+       "display order":2
+      },
+     "Rate Distributions":{
+       "attribute type":"branch label",
+       "display order":3
+      },
+     "LRT":{
+       "attribute type":"branch label",
+       "display order":4
+      },
+     "Uncorrected P-value":{
+       "attribute type":"branch label",
+       "display order":5
+      },
+     "Corrected P-value":{
+       "attribute type":"branch label",
+       "display order":6
+      }
+    }
+  }
+}
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/busted-out1.json	Thu Jan 17 04:22:13 2019 -0500
@@ -0,0 +1,361 @@
+{
+ "analysis":{
+   "info":"BUSTED (branch-site unrestricted statistical test of episodic diversification) uses a random effects branch-site model fitted jointly to all or a subset of tree branches in order to test for alignment-wide evidence of episodic diversifying selection. Assuming there is evidence of positive selection (i.e. there is an omega > 1), BUSTED will also perform a quick evidence-ratio style analysis to explore which individual sites may have been subject to selection.",
+   "version":"1.2",
+   "citation":"*Gene-wide identification of episodic selection*, Mol Biol Evol. 32(5):1365-71",
+   "authors":"Sergei L Kosakovsky Pond",
+   "contact":"spond@temple.edu",
+   "requirements":"in-frame codon alignment and a phylogenetic tree (optionally annotated with {})"
+  },
+ "input":{
+   "file name":"/Users/stephenshank/Documents/Galaxy/tools-iuc/tools/hyphy/test-data/absrel-in1.fa",
+   "number of sequences":10,
+   "number of sites":187,
+   "partition count":1,
+   "trees":{
+     "0":"((((Pig:0.147969,Cow:0.21343)Node3:0.085099,Horse:0.165787,Cat:0.264806)Node2:0.058611,((RhMonkey:0.002015,Baboon:0.003108)Node9:0.022733,(Human:0.004349,Chimp:0.000799)Node12:0.011873)Node8:0.101856)Node1:0.340802,Rat:0.050958,Mouse:0.09795)"
+    }
+  },
+ "background":0,
+ "fits":{
+   "Nucleotide GTR":{
+     "Log Likelihood":-3531.963798530155,
+     "estimated parameters":24,
+     "AIC-c":7112.142458295762,
+     "Equilibrium frequencies":[
+      [0.3563279857397504],
+      [0.1837789661319073],
+      [0.2402852049910873],
+      [0.2196078431372549]
+      ],
+     "Rate Distributions":{
+       "Substitution rate from nucleotide A to nucleotide C":0.5474490057204714,
+       "Substitution rate from nucleotide A to nucleotide G":1,
+       "Substitution rate from nucleotide A to nucleotide T":0.2645352969683238,
+       "Substitution rate from nucleotide C to nucleotide G":0.4863078374555331,
+       "Substitution rate from nucleotide C to nucleotide T":1.018028772244997,
+       "Substitution rate from nucleotide G to nucleotide T":0.3025951149895378
+      },
+     "display order":0
+    },
+   "MG94xREV with separate rates for branch sets":{
+     "Log Likelihood":-3466.725508616141,
+     "estimated parameters":31,
+     "AIC-c":6996.530451399855,
+     "Equilibrium frequencies":[
+      [0.04785168648208005],
+      [0.03911346079312019],
+      [0.04842054060317301],
+      [0.04069665666515385],
+      [0.01817010744778396],
+      [0.01485205303123071],
+      [0.01838611113045968],
+      [0.01545321970309948],
+      [0.0190138898893362],
+      [0.01554175184587827],
+      [0.01923992433904378],
+      [0.01617083546230154],
+      [0.02796925133965702],
+      [0.02286176927319543],
+      [0.02830174586718859],
+      [0.02378714529482007],
+      [0.01687870337957799],
+      [0.01379647304851128],
+      [0.01707935503225849],
+      [0.01435491300079667],
+      [0.006409133648843443],
+      [0.005238757839512795],
+      [0.006485324528555602],
+      [0.005450807083377185],
+      [0.006706760641638982],
+      [0.005482034985409045],
+      [0.006786489669196017],
+      [0.005703931360295163],
+      [0.009865581170012171],
+      [0.008064021368173151],
+      [0.009982861811889655],
+      [0.008390428826966174],
+      [0.03287895020631181],
+      [0.02687490503171972],
+      [0.033269810543681],
+      [0.0279627207822247],
+      [0.01248470225271473],
+      [0.01020486315060615],
+      [0.01263311863778268],
+      [0.01061792547971484],
+      [0.01306446616325414],
+      [0.01067875601941112],
+      [0.01321977470017749],
+      [0.01111100011404158],
+      [0.01921770557551369],
+      [0.01570834862514353],
+      [0.01944616295744266],
+      [0.01634417558076203],
+      [0.01975257768318274],
+      [0.02055210293142003],
+      [0.009176034326710849],
+      [0.007500393094996483],
+      [0.00928511773266342],
+      [0.007803986567571961],
+      [0.00784869593340758],
+      [0.009716299514778986],
+      [0.008166387662818644],
+      [0.01412467213650941],
+      [0.01154535713247913],
+      [0.01429258425298098],
+      [0.01201267864744234]
+      ],
+     "Rate Distributions":{
+       "non-synonymous/synonymous rate ratio for *test*":[
+        [0.9970623081401093, 1]
+        ]
+      },
+     "display order":1
+    },
+   "Unconstrained model":{
+     "Log Likelihood":-3437.188861487313,
+     "estimated parameters":35,
+     "AIC-c":6945.751768776152,
+     "Rate Distributions":{
+       "Test":{
+         "0":{
+           "omega":0.1052869846173941,
+           "proportion":0.2379046712842726
+          },
+         "1":{
+           "omega":0.2107329369900513,
+           "proportion":0.4121351840538361
+          },
+         "2":{
+           "omega":3.951290720456698,
+           "proportion":0.3499601446618912
+          }
+        }
+      },
+     "display order":2
+    },
+   "Constrained model":{
+     "Log Likelihood":-3459.576322342121,
+     "estimated parameters":34,
+     "AIC-c":6988.449647409037,
+     "Rate Distributions":{
+       "Test":{
+         "0":{
+           "omega":0,
+           "proportion":0.1368169359858254
+          },
+         "1":{
+           "omega":0,
+           "proportion":0.09947859848803366
+          },
+         "2":{
+           "omega":1,
+           "proportion":0.7637044655261409
+          }
+        }
+      },
+     "display order":3
+    }
+  },
+ "timers":{
+   "Overall":{
+     "timer":79,
+     "order":0
+    },
+   "Preliminary model fitting":{
+     "timer":22,
+     "order":1
+    },
+   "Unconstrained BUSTED model fitting":{
+     "timer":29,
+     "order":2
+    },
+   "Constrained BUSTED model fitting":{
+     "timer":18,
+     "order":3
+    }
+  },
+ "Site Log Likelihood":{
+   "unconstrained":[
+    [-9.761780003252589, -3.556981916965661, -3.871692954311539, -17.99295796244379, -17.6956827873063, -30.01736049845984, -32.80456708119989, -24.24615674389706, -17.22716501528761, -10.63078274532717, -17.5513791952437, -23.10676596882748, -20.1589722777239, -16.08007905666529, -22.07489132346995, -13.27698585999586, -11.57373969856821, -15.0218610811265, -12.31301984930962, -9.878172230255872, -9.283873417740052, -12.8230707251624, -24.29926852464868, -14.11614921655551, -14.80291769006257, -14.24359374301642, -21.23808978297999, -15.20669497937926, -21.11914571105627, -18.695897789747, -22.4289474056158, -14.71510620919697, -10.95989097579746, -28.25520114439835, -7.114758548777005, -35.1823654002276, -15.94120703275923, -4.330001696693314, -4.810804241726376, -24.36449596493429, -19.85422544995369, -20.21977077882305, -12.00277035613209, -19.6600724196642, -15.22159826235479, -24.22386090964918, -16.83876198375444, -15.39919245352698, -20.55491461157309, -23.30374279272433, -29.43636445622652, -31.41899626907746, -20.08375283223842, -21.69892250748334, -31.28859827841539, -26.08296126442238, -28.95584777914672, -20.97050845715194, -22.87836756552637, -16.10418205553547, -21.63783799404863, -22.29130394316017, -18.35819291264508, -23.0059705707678, -14.03484863809933, -9.416359563812415, -18.79111063130158, -12.78164205666208, -11.19294341786628, -10.24271903306927, -9.811969009737055, -20.99099337931294, -5.038213419512006, -12.36951590374203, -23.75822209792559, -24.38317903225788, -29.79314521637115, -15.03360351335341, -30.15269907145897, -15.40303952466706, -22.87293615165179, -10.81368963977958, -12.47042186757648, -11.73824102802078, -34.62663852693693, -22.96333978037858, -16.64020476652507, -18.34587549890907, -24.44431984136763, -15.73196577376136, -10.85174956948496, -20.76376393713096, -22.87186260864842, -24.188197096568, -13.78231255943875, -23.02551088711758, -13.64118597104227, -23.70873447722415, -13.43680638220221, -18.36670985939329, -14.24443250362629, -20.74306008601751, -11.19634482669214, -20.60160418194348, -11.398502668876, -23.3132179060432, -12.41458242767006, -8.59839648909502, -21.13421524691898, -18.70680195104232, -24.04441379518424, -9.992102259489076, -22.86252385976109, -7.114758548777005, -27.5565726745568, -12.87223741705519, -24.48854177549546, -9.791375505313344, -21.57931931289719, -13.73761157881194, -12.7003636235767, -15.92686724109126, -13.25111195536186, -19.5598880256505, -12.78420433838847, -25.3479232600814, -23.21813833324584, -11.87082416732899, -18.34124875195977, -13.39208375265505, -23.22887768380001, -13.67243009919361, -12.64371510970045, -15.23267340039615, -12.46602644865305, -15.78570032614895, -20.49430844113086, -16.74759955468868, -21.37629168953962, -31.91852172562975, -32.91408279059539, -28.11259733944721, -23.28467231775043, -25.08348256456863, -24.36722240264622, -27.85361506098191, -22.81200431380501, -12.06099437357067, -21.72512567277257, -14.75966862326406, -26.55673909887922, -15.9891326482062, -16.67305867563187, -15.89127092598368, -17.11654012165223, -15.14718002836891, -19.22179155508141, -20.14784462411578, -27.16144224004015, -22.80088235078308, -29.6346258900827, -14.87414990449581, -10.09001804965354, -14.06722825110506, -21.55226091029841, -17.89237433412178, -26.9887399484436, -7.247032599266484, -29.10107988545393, -11.92987823423617, -14.41471074589252, -20.22815853097579, -13.94727875575511, -24.40018676619344, -24.57667974105677, -29.23515533817404, -18.36670890820324, -29.22340700233682, -17.74018014861057, -26.54152667547728, -8.953815058919133, -20.2800904930613, -14.09345734559062, -14.03391364104814, -9.421270195111878, -9.469430414396884, -20.11488196129918]
+    ],
+   "constrained":[
+    [-10.85606152021318, -3.471229863506585, -3.800029997251122, -19.76181202731181, -18.99505347406228, -33.70672014040629, -40.08617973771972, -28.08241530494764, -19.10728836136312, -9.985069679724274, -15.75689438367687, -24.2738510731431, -19.60585366503884, -16.3091575384683, -22.29810643714523, -11.58047190013798, -10.65369978272362, -15.34194795652741, -10.92534862913859, -8.262063009605756, -7.795056828277495, -10.98823292846032, -26.45715781872953, -13.56039498470006, -14.80733027279041, -14.97339798653168, -22.83819293785454, -15.99960324964237, -23.05374383928736, -18.64540846688676, -22.52507508510511, -14.06096141784007, -9.950850202190837, -31.09994454740333, -5.657479911616817, -40.20764738574088, -15.24880713029523, -4.245259501823234, -4.75823140493186, -26.42921606238378, -21.05932496028346, -21.24380652339677, -12.51510927509652, -19.4431274563198, -13.45707855557425, -27.34067162541028, -16.92068505165836, -15.27874830129921, -21.78078086811648, -25.74988026772384, -32.3591534741427, -36.92136999297909, -20.86637747607929, -26.21690123953934, -38.38842669761863, -29.5707349344923, -34.78024872766768, -22.34647319638493, -24.42164357523894, -15.89813120477618, -24.88114938112022, -24.16882658381608, -19.15062432752575, -25.32782323726632, -12.54397568681377, -7.658560467541037, -20.06316291990198, -11.38834848993708, -10.34978442983486, -8.798066094581541, -8.365525022998657, -23.37022898655908, -5.038213419512005, -11.73698294324726, -26.59271763114307, -27.51600374427774, -33.19580365368542, -14.08391822294567, -37.61485496561196, -14.61037124768515, -24.95712121575756, -9.468302677820519, -11.80724915343188, -10.17626631190552, -39.82223560997122, -23.22993675058718, -15.29814440122603, -18.59041764178898, -25.85430435634182, -16.63728997890176, -9.088390872315317, -23.36486681955814, -25.10120831076364, -26.87850226687513, -12.5163839486935, -25.46276168897045, -13.30043078187602, -26.00037628519058, -12.36183639601969, -19.32639068670407, -13.90921600814463, -23.30517706031209, -10.38197265044853, -21.48132876823857, -10.34226801788524, -25.48737661714055, -11.54862505674196, -7.268129324767196, -23.12171070541123, -16.87868227611221, -26.86559749366134, -8.472693915554212, -26.90473561049812, -5.657479911616817, -30.14077517350693, -11.1338558936567, -26.90933331018406, -8.683054657060978, -22.93750465468248, -12.09242051639567, -12.24278260635322, -16.46214458935806, -11.52233069441597, -19.57563980700768, -11.24562305579595, -28.73517189370709, -26.5995022362575, -10.11077097725237, -17.64257519637804, -12.22627059873072, -25.794387889477, -13.00339712214579, -11.44442645621986, -15.23294312487709, -11.01984685521603, -15.23436625095256, -21.84913978769858, -17.43830973910884, -24.04200658810043, -36.02241585126664, -39.74114047148559, -30.51107839063483, -25.24778323303905, -29.10134605686299, -27.4051878646382, -29.40431078055861, -26.00565963206897, -11.37219430365775, -23.62588495555996, -13.84835203928034, -30.39496528205261, -17.46875631982503, -16.48393583594229, -16.95840797360417, -18.18414725855796, -14.60783644912805, -20.36574492127523, -22.08905835390395, -30.09377992258299, -24.20776345765027, -33.87407556904575, -13.85334118326135, -9.038547460214009, -12.31883826587824, -23.76076017501662, -16.13507283064812, -31.74425687978529, -5.621431190076298, -32.77926379309199, -10.93320737320503, -14.18712500350103, -23.00952178187488, -13.74809094768596, -27.13572996742387, -27.80389794085873, -33.12824566268318, -18.82222585779942, -32.59467769783617, -18.82117621115135, -28.87355399347379, -7.202495413751149, -20.10273643846979, -13.55384673130033, -13.92541401636034, -7.622924396558326, -8.028485273604586, -20.99338693632994]
+    ],
+   "optimized null":[
+    [-9.984891074365004, -3.552861592101205, -3.869898855143417, -18.01518487110813, -17.38504309777226, -29.7102253995114, -33.97262688823771, -25.58952900757811, -18.32327569996284, -10.43679078115309, -17.34797699860558, -23.44071853477707, -20.13369389964067, -16.23209205498968, -20.84681207056716, -13.14211233137375, -11.68410006052765, -15.49850331840433, -12.80349920668154, -9.951696917262908, -9.674794006047554, -13.35878598779897, -23.86875827725563, -13.92120845548608, -15.25915378398707, -14.40626012443236, -21.26593666732801, -15.47805189201786, -20.8967440084538, -17.92205772755303, -21.52612599164656, -14.37849206841925, -11.28236683284286, -27.85944578501297, -7.045007615754844, -35.50167243235479, -15.43207104477209, -4.330649700739783, -4.821509537453836, -24.61117309405466, -19.66210749973598, -19.61978108110112, -13.06931658869425, -18.90379736902437, -15.17248506099829, -24.20575482256608, -16.80670782290678, -15.1069403318206, -20.23445804273289, -22.93238636351499, -28.6422792678352, -31.91671871385733, -19.7070935797896, -24.16184701754757, -32.87373578813684, -25.97502236883938, -30.04305670719911, -20.66008132977401, -22.5476319199698, -15.71574496122768, -21.82260087605331, -22.33213004101708, -17.88649192977146, -22.85979453942399, -13.9142190617628, -10.20989813642594, -19.67318749886311, -13.22545647691756, -11.35738362057711, -10.37800058317319, -9.86308947602663, -20.98168478524144, -5.038213419512004, -12.8612703045419, -23.7103757747438, -25.78805046306136, -29.5117411496098, -15.02489637507387, -32.51478386333478, -15.48689562410333, -23.58179278538965, -10.7011656905293, -12.18338021676437, -11.80719456318334, -34.37559964635795, -21.96698531834351, -15.96606915985646, -18.18645503653203, -23.73685168133605, -15.7426553469114, -11.56446818066272, -21.42813665189797, -23.10666793730778, -24.26053675245742, -14.08444644301535, -23.12886976791419, -13.54997092114479, -24.18202649171034, -13.43311848775762, -18.68125871223531, -14.34963037446899, -21.30807004664649, -11.23675042114956, -20.25521737033718, -11.41928014036639, -23.0616314567799, -12.74836397165115, -8.946938971416877, -21.33592841357732, -18.29022453494306, -23.78096262851221, -10.26615870794974, -23.87195921412485, -7.045007615754844, -27.36975377176551, -13.02213773679562, -24.88461586299227, -9.937370797941819, -20.9215542254461, -13.7430158107626, -13.32781861737069, -16.57378722435969, -13.1562876406111, -18.65461183747465, -12.88434508060274, -25.53251613794421, -23.47076517726, -12.38103504563448, -18.08858152438308, -13.3986078002421, -24.83005553415067, -13.48186232123563, -12.76305322156708, -14.99349220446663, -12.68915386346622, -15.16813193431097, -20.38979714624436, -17.1398617656887, -21.99353054090562, -31.80290581785966, -34.17165493312128, -28.14103833717329, -23.01519425280903, -25.32718282655863, -24.9256764033518, -27.36738567584731, -23.63994953138027, -12.19474154438638, -21.8509764153975, -14.27265880961605, -27.81140090827595, -16.66595175805092, -15.90073698436111, -16.04898816099204, -16.77891193093655, -15.05041271240863, -18.6937096770671, -20.92753847593657, -26.68202074910777, -22.68645320525759, -30.02139727511975, -14.61774067439237, -10.02271219166692, -14.02556111130297, -22.35631047609814, -17.23179491687371, -27.80786897153735, -7.71222261637312, -29.01667081229076, -12.42383366521858, -14.96109424540947, -20.51828142366711, -13.95474218677742, -25.26930987352585, -25.30942633816443, -29.95264501627203, -17.87797633090322, -29.28864522431501, -18.28270560387423, -26.07314333903045, -9.265582530948477, -19.57038320696334, -13.84155482021799, -13.76410195180156, -10.09880900833976, -10.13770828948875, -20.68018631936204]
+    ]
+  },
+ "Evidence Ratios":{
+   "constrained":[
+    [2.987035777683669, 0.9178217737437788, 0.9308445775388399, 5.864129597495543, 3.666988257062931, 40.01921212564599, 1453.329858192022, 46.3517274521344, 6.554313261152158, 0.5242885566486172, 0.1662130613392027, 3.212614540819785, 0.5751533301022933, 1.257440721352396, 1.250089456152151, 0.1833214774704383, 0.3985031341778748, 1.377247408059552, 0.2496560220961017, 0.1986701791114262, 0.2256395217898774, 0.159639393704319, 8.652854738603175, 0.5736394408536711, 1.004422332506298, 2.074674436945399, 4.953543380186865, 2.209813825803168, 6.921262036590584, 0.9507640800590974, 1.100899617321825, 0.5198864839379664, 0.3645685156450084, 17.19714536690562, 0.2328691346279994, 152.2131719709853, 0.5003737786888893, 0.9187491121066572, 0.9487852120654622, 7.883091091521568, 3.337091136584989, 2.784409283932767, 1.669190734679053, 0.8049742711776068, 0.1712690260857312, 22.57426895337745, 1.085372306650974, 0.8865265964983139, 3.407116241547518, 11.54367277296439, 18.59307162257273, 245.2734532644677, 2.187205373636184, 91.65016109978839, 1211.759142055416, 32.71303656181449, 338.4583183795538, 3.958894181734716, 4.679896572127406, 0.8137916933052433, 25.61841393034561, 6.537289569530828, 2.208760315392158, 10.19454391110528, 0.2251760020370068, 0.1724239350018968, 3.568167963566551, 0.2482563079467741, 0.4303489068500915, 0.2358279091453541, 0.2354059080062318, 10.79664683030406, 0.9999999999999982, 0.5312444740983824, 17.02181119579284, 22.93868328909911, 30.04386370541763, 0.3868627537181412, 1740.897204618787, 0.4526354258455894, 8.038038325908458, 0.2604389084082438, 0.5152141115456746, 0.209721521558208, 180.4758697127573, 1.305514179179812, 0.2613067262507715, 1.277036479085304, 4.095891978587106, 2.472733466018775, 0.1714679865462201, 13.4785951464023, 9.293783187007939, 14.73617227655005, 0.2819773273497369, 11.44154239787743, 0.7112330044400204, 9.891163748924974, 0.341307999103254, 2.610863024250461, 0.715183235651846, 12.96323111519599, 0.4429173141007886, 2.410235803025134, 0.3477627964575015, 8.794783055600073, 0.4206486430093566, 0.2644066118480111, 7.29723462938499, 0.1607154811869344, 16.79672116274557, 0.2188413274550005, 56.95216760630651, 0.2328691346279994, 13.2527158196516, 0.1758047062874589, 11.25476432648051, 0.3301128054448652, 3.889129453787352, 0.1929756888698665, 0.6328125582337467, 1.707921865741156, 0.1775006051199708, 1.015876494623396, 0.2146854634782269, 29.58444254980177, 29.41085732710528, 0.1720357129869316, 0.4972444336487338, 0.3116691239926225, 13.00729307176291, 0.5122036510611201, 0.3014085415888103, 1.00026976085985, 0.2354681559800242, 0.5761806291357867, 3.876107182723861, 1.995131941849157, 14.37822484490952, 60.57571835920439, 922.4726067466381, 11.00644544990011, 7.121446858825492, 55.58222702294439, 20.86275396084217, 4.714749185132652, 24.37737183652841, 0.50217828651945, 6.690972854579194, 0.4019946158005773, 46.44301992158756, 4.391292801814232, 0.8276848279024352, 2.907044843855059, 2.908411735743323, 0.5831309060013494, 3.139154092062445, 6.967202141660374, 18.77146096245092, 4.083200457885609, 69.36966574602748, 0.3603034372761033, 0.3494235125609156, 0.1740539474113665, 9.102046375934606, 0.1725097532596096, 116.2237173206706, 0.1967932863167221, 39.57445790025699, 0.3691062038535791, 0.7964541286880364, 16.14101020285773, 0.8193959897025127, 15.41811630139388, 25.20943173776431, 49.06227082795505, 1.576988395869989, 29.11550049727357, 2.947614097314125, 10.29879932442459, 0.1735447747495909, 0.8374832172472122, 0.5829752104000613, 0.8971792315392203, 0.1655725521668218, 0.2367039343819634, 2.407298044116152]
+    ],
+   "optimized null":[
+    [1.249959400407102, 0.9958881520275259, 0.998207509265751, 1.022475766760606, 0.7329779279148643, 0.7355512219978014, 3.215747411518881, 3.831944066897763, 2.992504567232528, 0.8236645230667027, 0.8159500030737468, 1.396476901447714, 0.9750384449114691, 1.16417536866286, 0.2928545373193804, 0.8738264187311083, 1.116680407100678, 1.610657107893188, 1.633098870338358, 1.076295106848796, 1.478341111181925, 1.708669953055735, 0.6501772588199817, 0.8228834033449909, 1.578122886012883, 1.176644073870286, 1.028238233000157, 1.311743164559289, 0.8005936991596435, 0.4612384787800625, 0.4054241751261601, 0.7141843613652971, 1.380541560105011, 0.6731713608501634, 0.932626077339456, 1.376173789613603, 0.6010146384105997, 1.000648214046449, 1.010762802431324, 1.279765846941387, 0.8252095291075795, 0.5488172901332377, 2.905327825256244, 0.4694117092940189, 0.952073347603641, 0.9820568432858974, 0.9684541283622321, 0.7465802831481059, 0.725817575723242, 0.6897980335692911, 0.4519945356959116, 1.644970489890064, 0.6861498379435136, 11.73909248217663, 4.87996237464428, 0.8976824471171899, 2.965984233784409, 0.733133747843722, 0.7183950548657764, 0.6781158778869135, 1.202933169206003, 1.041670940984456, 0.6239400537888191, 0.864005597730941, 0.8863622283336499, 2.211207115702391, 2.415912028974954, 1.558641206543682, 1.178733082401182, 1.144859074170125, 1.052449670353621, 0.9907345967710618, 0.9999999999999973, 1.635182470378155, 0.9532802729006801, 4.075002787751862, 0.7547233152543775, 0.9913306590671749, 10.61305441401069, 1.087472394658304, 2.031666990662131, 0.8935759463782673, 0.7504804700650514, 1.07138642619565, 0.7779921221867564, 0.3692230071631759, 0.5095967222916621, 0.852637781481885, 0.492890538993211, 1.010746910759831, 2.039528413292879, 1.943271153632765, 1.264662551213628, 1.075020419076957, 1.352742324566819, 1.108889296748787, 0.9128213876445376, 1.605270076656883, 0.9963188974862515, 1.369641261789208, 1.110930409345364, 1.759465308015671, 1.041233006895448, 0.7072388659882123, 1.020994825899436, 0.7775662346759626, 1.396238093640341, 1.417000739126258, 1.223497018037751, 0.6592994704264704, 0.7683951448151665, 1.315289046185217, 2.744051160985256, 0.932626077339456, 0.8295939599329692, 1.161718436561281, 1.485979405967741, 1.157190740711233, 0.5180077437805523, 1.005418861153479, 1.872838124227439, 1.909650007781456, 0.9095327119137432, 0.4044301708455042, 1.105326473224138, 1.202728682967098, 1.287402785135559, 1.665642405761295, 0.7767263119192113, 1.006545375541812, 4.958869792471186, 0.8264897380438972, 1.126750821714303, 0.7872722189265667, 1.249979829536444, 0.5392540993266187, 0.900764623315236, 1.480325818230283, 1.853802344884983, 0.8908173136045756, 3.516872648338504, 1.028849304595149, 0.7637780328545294, 1.275961818909257, 1.7479680529214, 0.6149407328711725, 2.288611307253957, 1.143103773111974, 1.134112880938005, 0.6144610028110447, 3.50665225694476, 1.967609019313462, 0.4619393418252924, 1.170835076724906, 0.713460509830789, 0.907767204501339, 0.5897350692995594, 2.180804513956808, 0.6191414671741319, 0.8918751295230388, 1.472219881303941, 0.7738252314079443, 0.9349092081542767, 0.9591890032827355, 2.234571675884028, 0.5165519486568414, 2.268523145559755, 1.592316727559848, 0.9190552183615908, 1.63878552010542, 1.726996028513171, 1.33659173528842, 1.007491351842102, 2.384818706326968, 2.080787852232155, 2.049282389773126, 0.6134033430403113, 1.067413275400906, 1.720346037637947, 0.6260135038640929, 1.365837060781729, 0.4917881296168616, 0.7773205034026993, 0.7635232604405103, 1.969025623887814, 1.950874776061578, 1.759983366341118]
+    ]
+  },
+ "tested":{
+   "0":{
+     "Pig":"test",
+     "Cow":"test",
+     "Node3":"test",
+     "Horse":"test",
+     "Cat":"test",
+     "Node2":"test",
+     "RhMonkey":"test",
+     "Baboon":"test",
+     "Node9":"test",
+     "Human":"test",
+     "Chimp":"test",
+     "Node12":"test",
+     "Node8":"test",
+     "Node1":"test",
+     "Rat":"test",
+     "Mouse":"test"
+    }
+  },
+ "data partitions":{
+   "0":{
+     "name":"busted.filter.default",
+     "coverage":[
+      [0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186]
+      ]
+    }
+  },
+ "branch attributes":{
+   "0":{
+     "Human":{
+       "original name":"Human",
+       "Nucleotide GTR":0,
+       "MG94xREV with separate rates for branch sets":0,
+       "unconstrained":0,
+       "constrained":0
+      },
+     "Chimp":{
+       "original name":"Chimp",
+       "Nucleotide GTR":0.001818647577470898,
+       "MG94xREV with separate rates for branch sets":0.001828142895085465,
+       "unconstrained":0.001835079043904073,
+       "constrained":0.001827227299324197
+      },
+     "Baboon":{
+       "original name":"Baboon",
+       "Nucleotide GTR":0.001683434956773037,
+       "MG94xREV with separate rates for branch sets":0.001771624553208579,
+       "unconstrained":0.001852571561323465,
+       "constrained":0.001757260248005238
+      },
+     "RhMonkey":{
+       "original name":"RhMonkey",
+       "Nucleotide GTR":0.003773669075849421,
+       "MG94xREV with separate rates for branch sets":0.003717699096857038,
+       "unconstrained":0.003672835047422234,
+       "constrained":0.00373144096412681
+      },
+     "Cow":{
+       "original name":"Cow",
+       "Nucleotide GTR":0.2483322373763571,
+       "MG94xREV with separate rates for branch sets":0.2480141631033857,
+       "unconstrained":0.2960120156157274,
+       "constrained":0.2592686681333873
+      },
+     "Pig":{
+       "original name":"Pig",
+       "Nucleotide GTR":0.187244836750842,
+       "MG94xREV with separate rates for branch sets":0.1926081878751187,
+       "unconstrained":0.2187526946336905,
+       "constrained":0.1943776301130502
+      },
+     "Horse":{
+       "original name":"Horse",
+       "Nucleotide GTR":0.2091766851769093,
+       "MG94xREV with separate rates for branch sets":0.2111575880588217,
+       "unconstrained":0.2572135566477119,
+       "constrained":0.218486450878766
+      },
+     "Cat":{
+       "original name":"Cat",
+       "Nucleotide GTR":0.266381043956941,
+       "MG94xREV with separate rates for branch sets":0.273601177885004,
+       "unconstrained":0.3292215104251173,
+       "constrained":0.28483085314287
+      },
+     "Mouse":{
+       "original name":"Mouse",
+       "Nucleotide GTR":0.1181831744338598,
+       "MG94xREV with separate rates for branch sets":0.1201847378516324,
+       "unconstrained":0.1489713993010398,
+       "constrained":0.1233480139851019
+      },
+     "Rat":{
+       "original name":"Rat",
+       "Nucleotide GTR":0.06669700444436912,
+       "MG94xREV with separate rates for branch sets":0.0670850471739789,
+       "unconstrained":0.07366345007817726,
+       "constrained":0.06713082546371778
+      },
+     "Node1":{
+       "Nucleotide GTR":0.276880831396131,
+       "MG94xREV with separate rates for branch sets":0.2843521449765504,
+       "unconstrained":0.459085769955035,
+       "constrained":0.3115534692518958
+      },
+     "Node12":{
+       "Nucleotide GTR":0.01783434870161725,
+       "MG94xREV with separate rates for branch sets":0.01788794906051452,
+       "unconstrained":0.01828498503175797,
+       "constrained":0.01770410398930177
+      },
+     "Node2":{
+       "Nucleotide GTR":0.06617535490721377,
+       "MG94xREV with separate rates for branch sets":0.06447679597474805,
+       "unconstrained":0.0623969317369398,
+       "constrained":0.06097949807503514
+      },
+     "Node3":{
+       "Nucleotide GTR":0.09884524766349881,
+       "MG94xREV with separate rates for branch sets":0.1017497956116402,
+       "unconstrained":0.1285021744856729,
+       "constrained":0.1065011238088613
+      },
+     "Node8":{
+       "Nucleotide GTR":0.1061610073141143,
+       "MG94xREV with separate rates for branch sets":0.1093806684969149,
+       "unconstrained":0.1348034716617685,
+       "constrained":0.1118205234697939
+      },
+     "Node9":{
+       "Nucleotide GTR":0.02568007351415409,
+       "MG94xREV with separate rates for branch sets":0.02593963430985144,
+       "unconstrained":0.02761127562964508,
+       "constrained":0.02639493109700932
+      }
+    },
+   "attributes":{
+     "original name":{
+       "attribute type":"node label",
+       "display order":0
+      },
+     "Nucleotide GTR":{
+       "attribute type":"branch length",
+       "display order":0
+      },
+     "MG94xREV with separate rates for branch sets":{
+       "attribute type":"branch length",
+       "display order":1
+      },
+     "unconstrained":{
+       "attribute type":"branch length",
+       "display order":0
+      },
+     "constrained":{
+       "attribute type":"branch length",
+       "display order":1
+      }
+    }
+  },
+ "test results":{
+   "LRT":44.77492170961614,
+   "p-value":1.893429857346973e-10
+  }
+}
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/fel-out1.json	Thu Jan 17 04:22:13 2019 -0500
@@ -0,0 +1,450 @@
+{
+ "analysis":{
+   "info":"FEL (Fixed Effects Likelihood)\n    estimates site-wise synonymous (&alpha;) and non-synonymous (&beta;) rates, and\n    uses a likelihood ratio test to determine if beta &neq; alpha at a site.\n    The estimates aggregate information over all branches,\n    so the signal is derived from\n    pervasive diversification or conservation. A subset of branches can be selected\n    for testing as well, in which case an additional (nuisance) parameter will be\n    inferred -- the non-synonymous rate on branches NOT selected for testing.\n    Multiple partitions within a NEXUS file are also supported\n    for recombination - aware analysis.\n    ",
+   "version":"2.00",
+   "citation":"Not So Different After All: A Comparison of Methods for Detecting Amino Acid Sites Under Selection (2005). _Mol Biol Evol_ 22 (5): 1208-1222",
+   "authors":"Sergei L Kosakovsky Pond and Simon DW Frost",
+   "contact":"spond@temple.edu",
+   "requirements":"in-frame codon alignment and a phylogenetic tree"
+  },
+ "input":{
+   "file name":"/Users/stephenshank/Documents/Data/Datamonkey/CD2.fasta",
+   "number of sequences":10,
+   "number of sites":187,
+   "partition count":1,
+   "trees":{
+     "0":"((((Pig:0.147969,Cow:0.21343)Node3:0.085099,Horse:0.165787,Cat:0.264806)Node2:0.058611,((RhMonkey:0.002015,Baboon:0.003108)Node9:0.022733,(Human:0.004349,Chimp:0.000799)Node12:0.011873)Node8:0.101856)Node1:0.340802,Rat:0.050958,Mouse:0.09795)"
+    }
+  },
+ "fits":{
+   "Nucleotide GTR":{
+     "Log Likelihood":-3531.963798530155,
+     "estimated parameters":24,
+     "AIC-c":7112.142458295762,
+     "Equilibrium frequencies":[
+      [0.3563279857397504],
+      [0.1837789661319073],
+      [0.2402852049910873],
+      [0.2196078431372549]
+      ],
+     "Rate Distributions":{
+       "Substitution rate from nucleotide A to nucleotide C":0.5474490057204714,
+       "Substitution rate from nucleotide A to nucleotide G":1,
+       "Substitution rate from nucleotide A to nucleotide T":0.2645352969683238,
+       "Substitution rate from nucleotide C to nucleotide G":0.4863078374555331,
+       "Substitution rate from nucleotide C to nucleotide T":1.018028772244997,
+       "Substitution rate from nucleotide G to nucleotide T":0.3025951149895378
+      },
+     "display order":0
+    },
+   "Global MG94xREV":{
+     "Log Likelihood":-3466.725508616141,
+     "estimated parameters":31,
+     "AIC-c":6996.530451399855,
+     "Equilibrium frequencies":[
+      [0.04785168648208005],
+      [0.03911346079312019],
+      [0.04842054060317301],
+      [0.04069665666515385],
+      [0.01817010744778396],
+      [0.01485205303123071],
+      [0.01838611113045968],
+      [0.01545321970309948],
+      [0.0190138898893362],
+      [0.01554175184587827],
+      [0.01923992433904378],
+      [0.01617083546230154],
+      [0.02796925133965702],
+      [0.02286176927319543],
+      [0.02830174586718859],
+      [0.02378714529482007],
+      [0.01687870337957799],
+      [0.01379647304851128],
+      [0.01707935503225849],
+      [0.01435491300079667],
+      [0.006409133648843443],
+      [0.005238757839512795],
+      [0.006485324528555602],
+      [0.005450807083377185],
+      [0.006706760641638982],
+      [0.005482034985409045],
+      [0.006786489669196017],
+      [0.005703931360295163],
+      [0.009865581170012171],
+      [0.008064021368173151],
+      [0.009982861811889655],
+      [0.008390428826966174],
+      [0.03287895020631181],
+      [0.02687490503171972],
+      [0.033269810543681],
+      [0.0279627207822247],
+      [0.01248470225271473],
+      [0.01020486315060615],
+      [0.01263311863778268],
+      [0.01061792547971484],
+      [0.01306446616325414],
+      [0.01067875601941112],
+      [0.01321977470017749],
+      [0.01111100011404158],
+      [0.01921770557551369],
+      [0.01570834862514353],
+      [0.01944616295744266],
+      [0.01634417558076203],
+      [0.01975257768318274],
+      [0.02055210293142003],
+      [0.009176034326710849],
+      [0.007500393094996483],
+      [0.00928511773266342],
+      [0.007803986567571961],
+      [0.00784869593340758],
+      [0.009716299514778986],
+      [0.008166387662818644],
+      [0.01412467213650941],
+      [0.01154535713247913],
+      [0.01429258425298098],
+      [0.01201267864744234]
+      ],
+     "Rate Distributions":{
+       "non-synonymous/synonymous rate ratio for *test*":[
+        [0.9970623081401093, 1]
+        ]
+      },
+     "display order":1
+    }
+  },
+ "timers":{
+   "Total time":{
+     "timer":240,
+     "order":0
+    },
+   "Model fitting":{
+     "timer":21,
+     "order":1
+    },
+   "FEL analysis":{
+     "timer":208,
+     "order":2
+    }
+  },
+ "tested":{
+   "0":{
+     "Pig":"test",
+     "Cow":"test",
+     "Node3":"test",
+     "Horse":"test",
+     "Cat":"test",
+     "Node2":"test",
+     "RhMonkey":"test",
+     "Baboon":"test",
+     "Node9":"test",
+     "Human":"test",
+     "Chimp":"test",
+     "Node12":"test",
+     "Node8":"test",
+     "Node1":"test",
+     "Rat":"test",
+     "Mouse":"test"
+    }
+  },
+ "data partitions":{
+   "0":{
+     "name":"fel.filter.default",
+     "coverage":[
+      [0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186]
+      ]
+    }
+  },
+ "branch attributes":{
+   "0":{
+     "Human":{
+       "original name":"Human",
+       "Nucleotide GTR":0,
+       "Global MG94xREV":0
+      },
+     "Chimp":{
+       "original name":"Chimp",
+       "Nucleotide GTR":0.001818647577470898,
+       "Global MG94xREV":0.001828142895085465
+      },
+     "Baboon":{
+       "original name":"Baboon",
+       "Nucleotide GTR":0.001683434956773037,
+       "Global MG94xREV":0.001771624553208579
+      },
+     "RhMonkey":{
+       "original name":"RhMonkey",
+       "Nucleotide GTR":0.003773669075849421,
+       "Global MG94xREV":0.003717699096857038
+      },
+     "Cow":{
+       "original name":"Cow",
+       "Nucleotide GTR":0.2483322373763571,
+       "Global MG94xREV":0.2480141631033857
+      },
+     "Pig":{
+       "original name":"Pig",
+       "Nucleotide GTR":0.187244836750842,
+       "Global MG94xREV":0.1926081878751187
+      },
+     "Horse":{
+       "original name":"Horse",
+       "Nucleotide GTR":0.2091766851769093,
+       "Global MG94xREV":0.2111575880588217
+      },
+     "Cat":{
+       "original name":"Cat",
+       "Nucleotide GTR":0.266381043956941,
+       "Global MG94xREV":0.273601177885004
+      },
+     "Mouse":{
+       "original name":"Mouse",
+       "Nucleotide GTR":0.1181831744338598,
+       "Global MG94xREV":0.1201847378516324
+      },
+     "Rat":{
+       "original name":"Rat",
+       "Nucleotide GTR":0.06669700444436912,
+       "Global MG94xREV":0.0670850471739789
+      },
+     "Node1":{
+       "Nucleotide GTR":0.276880831396131,
+       "Global MG94xREV":0.2843521449765504
+      },
+     "Node12":{
+       "Nucleotide GTR":0.01783434870161725,
+       "Global MG94xREV":0.01788794906051452
+      },
+     "Node2":{
+       "Nucleotide GTR":0.06617535490721377,
+       "Global MG94xREV":0.06447679597474805
+      },
+     "Node3":{
+       "Nucleotide GTR":0.09884524766349881,
+       "Global MG94xREV":0.1017497956116402
+      },
+     "Node8":{
+       "Nucleotide GTR":0.1061610073141143,
+       "Global MG94xREV":0.1093806684969149
+      },
+     "Node9":{
+       "Nucleotide GTR":0.02568007351415409,
+       "Global MG94xREV":0.02593963430985144
+      }
+    },
+   "attributes":{
+     "original name":{
+       "attribute type":"node label",
+       "display order":-1
+      },
+     "Nucleotide GTR":{
+       "attribute type":"branch length",
+       "display order":0
+      },
+     "Global MG94xREV":{
+       "attribute type":"branch length",
+       "display order":1
+      }
+    }
+  },
+ "MLE":{
+   "headers":[
+    ["alpha", "Synonymous substitution rate at a site"],
+    ["beta", "Non-synonymous substitution rate at a site"],
+    ["alpha=beta", "The rate estimate under the neutral model"],
+    ["LRT", "Likelihood ration test statistic for beta = alpha, versus beta &neq; alpha"],
+    ["p-value", "Likelihood ration test statistic for beta = alpha, versus beta &neq; alpha"],
+    ["Total branch length", "The total length of branches contributing to inference at this site, and used to scale dN-dS"]
+    ],
+   "content":{
+     "0":[
+      [0, 14.33455339565208, 9.37022855225735, 0.6569588574406389, 0.4176356384633009, 18.37456124129265],
+      [0, 0, 0, 0, 1, 0],
+      [0, 0, 0, 0, 1, 0],
+      [2.315835044497769, 2.0838655960337, 2.154020315716453, 0.006512178791247436, 0.9356820703077827, 3.703306642750085],
+      [4.684867463043267, 1.485880867051272, 1.810965132247134, 0.6423258738872875, 0.4228698174598849, 3.992627467732306],
+      [2.793615407104073, 2.83663095770452, 2.827255675657259, 0.0001827272778811562, 0.9892147919393014, 4.881168204504374],
+      [5.731991535867913e-15, 9.748939806634132, 7.039642474362661, 1.427528676396967, 0.2321681836368463, 12.49655197273245],
+      [0.7788537818951048, 2.413601305596549, 1.870374017904286, 1.012495186540384, 0.3143058108249939, 3.440966161522967],
+      [0, 1.511625252846436, 0.8668881951204477, 4.177183465446262, 0.04097173701611923, 1.937657213006447],
+      [0, 0.3880224565060543, 0.3729943638639756, 0.07730942803087615, 0.7809772546973897, 0.4973815502497539],
+      [1.577203687361435, 0, 0.3449900275053522, 5.833451656260781, 0.01572424217308366, 0.7029344115548603],
+      [0.5125559497083479, 1.117288566899797, 0.9010663702823702, 0.5115768269648981, 0.4744570553751679, 1.660619823673803],
+      [0.9304995948415922, 0.386771771337713, 0.6270432747869809, 0.5094775093471853, 0.4753651258361511, 0.9104871355067861],
+      [5.581663259019708e-15, 0.8079243938193429, 0.6191526535464859, 0.5655881985330957, 0.4520173942053385, 1.035627399251282],
+      [8.536925457223173, 0.9472215369810161, 1.109469612724223, 0.8843467630612381, 0.347013893603772, 5.018954521601339],
+      [0.9603594732863039, 0.2254713007626843, 0.3658044973580593, 0.9086109520067573, 0.3404832428776179, 0.7170342899734619],
+      [0, 0.3051405707936804, 0.204237044484213, 0.789730708468479, 0.3741815658092563, 0.3911404806620709],
+      [0, 0.5447969517311114, 0.4279208110833637, 0.9146305415430938, 0.3388887777342053, 0.6983409023882939],
+      [0.4123794341678648, 0, 0.1924014971070516, 1.495789887224035, 0.2213202946819042, 0.1837909061568697],
+      [0, 0.2269021231479595, 0.1874185061159622, 0.3775309219959215, 0.5389276162432231, 0.2908515418991783],
+      [0.882612308101804, 0, 0.2232415747089635, 2.695388949547947, 0.1006389276748589, 0.393366163418335],
+      [0.7184639017239282, 0, 0.1671011265582182, 2.871309200056629, 0.09017149106384892, 0.3202078488838736],
+      [1.561831345388584, 1.9339134632446, 1.849674131339989, 0.02488471231975353, 0.8746546740719037, 3.175045080245763],
+      [0, 0.639194445826232, 0.4886568527367137, 1.062699500311762, 0.302600298167864, 0.81934310513578],
+      [0, 0.5878372043538705, 0.4215623108242222, 1.298559521851168, 0.2544765112788104, 0.7535114916511219],
+      [12.04614643837991, 0.5938079331691726, 0.9367258758555723, 2.232914907525011, 0.1350987622413532, 6.129939442272041],
+      [5.649814223788526e-15, 1.481934542034814, 1.153320695425915, 0.8357366911354092, 0.3606189329442049, 1.899598560668447],
+      [8.596130733365413e-15, 0.8511949854348752, 0.6924653127728191, 1.172451760379943, 0.2788980419691958, 1.091093245562736],
+      [2.81124549161132, 1.353430160820546, 1.623284940728783, 0.1851657485582905, 0.6669709546094937, 2.987803957664483],
+      [2.905879729902848, 0.6906324734528415, 1.051940400072587, 1.179049371414166, 0.2775496096806725, 2.180382307333637],
+      [65.47181052078814, 0.5110578353794843, 1.029782545383332, 7.986746689310593, 0.004712101176366223, 29.83482973298969],
+      [0, 0.5456318731177918, 0.4534806063591071, 0.7171551129122662, 0.3970786721567617, 0.6994111355324867],
+      [0.7813477666313862, 0.3471577977547635, 0.4305582374081846, 0.1132525736032157, 0.7364710840644024, 0.7932338976272654],
+      [0, 2.360975381119684, 1.534526086189543, 4.437454703212623, 0.03515862705412187, 3.026385652358472],
+      [0, 0, 0, 0, 1, 0],
+      [324.6040426847233, 3.200785226463758, 5.977958696622342, 6.782818549915596, 0.009203944080354076, 148.773705622229],
+      [2.676097154261365, 0.6042491668949727, 0.9839068080469696, 1.553136917802441, 0.212672943766802, 1.96724257477173],
+      [0, 0, 0, 0, 1, 0],
+      [0, 0, 0, 0, 1, 0],
+      [4.427468632363605, 1.460335581308809, 1.975788016219872, 0.8057041534260705, 0.3693933748160219, 3.845164040248806],
+      [3.502137580328263, 1.371972993199117, 1.734863650766703, 0.6497527304866821, 0.4202010987634041, 3.31949238032267],
+      [7.264739001321953e-17, 1.244824751600544, 0.9574725707735254, 1.914821362424917, 0.1664286760733102, 1.595662452929919],
+      [0, 0.6916294217698209, 0.474270833266139, 1.439156872787983, 0.2302758255402338, 0.8865561985659117],
+      [4.349358357744165, 0.6956855520454192, 1.350102084344427, 2.666188089123231, 0.1025012590151847, 2.830194825784936],
+      [1.495766190556612, 0, 0.3365966205349918, 5.525702837438427, 0.01873907339783776, 0.6666390241209356],
+      [2.667713653090058, 2.257124348821305, 2.357749681890959, 0.0191056101866991, 0.8900641425909473, 4.082222784134786],
+      [12.63676889063525, 0.3107240462581941, 1.040217166848159, 5.775381264052303, 0.01625219411665035, 6.030302998889976],
+      [1.031944402866202, 0.6596458045333128, 0.751100354894458, 0.1069560484958316, 0.7436366060301507, 1.305479499155606],
+      [3.037967203750928, 1.239420895600073, 1.512654311402329, 0.3506939468378363, 0.5537205662857543, 2.942708894900622],
+      [1.378841288179672, 2.101470060496124, 1.977767989534725, 0.0938406172275208, 0.7593502331134377, 3.308269593534809],
+      [39.84224846427071, 2.654708712072871, 5.20897562779685, 2.126439071174708, 0.144776747511165, 21.15995564956634],
+      [3.783073443564108, 5.187935122051553, 4.778680932509933, 0.05495013922987368, 0.8146632336209146, 8.33614252568616],
+      [0, 1.119414739831454, 0.7779307340055465, 2.753116170854653, 0.0970650856968297, 1.434907256871887],
+      [1.356080637366217, 2.198120243230343, 1.982794836192701, 0.1199481582600157, 0.729090722901631, 3.422015318611356],
+      [5.104151480610658e-15, 7.019659301970639, 5.564343389559671, 3.856601118995968, 0.04955061169203823, 8.99805917749708],
+      [0.4564146055361437, 4.500210920813928, 2.395834774882053, 1.606938970062878, 0.2049226229668698, 5.971953643099357],
+      [7.763840904893966, 4.345852349581978, 5.021681630139295, 0.2112350534486964, 0.645801099341806, 9.030893924808089],
+      [9.352600755798757e-15, 1.318383640631525, 1.098114659885675, 1.681379768505792, 0.1947412146576329, 1.689952960212221],
+      [0.6501323439977227, 1.428391017118687, 1.158158987626555, 0.5010673231593614, 0.4790315247610876, 2.120718056622007],
+      [5.018938396700425, 0.4190744958553445, 1.048927041643904, 3.188040810808147, 0.07417886443999655, 2.774045627697075],
+      [0, 2.3750388102547, 1.917520821915512, 2.295177085138221, 0.1297764089183852, 3.044412676484826],
+      [2.611677106918311, 1.505021058708564, 1.839944520367945, 0.2197690856582355, 0.6392159198801759, 3.093174351500537],
+      [0, 1.393154906198694, 0.9224561671635855, 2.547457432517987, 0.1104719078504168, 1.785797536623619],
+      [1.28311845337506e-15, 2.136784714652882, 1.371504798054949, 3.33953467220487, 0.06763373353493451, 2.739009756017681],
+      [58.19251448842859, 0, 0.4821742026766379, 11.08562275085137, 0.0008699960104938675, 25.93547127527559],
+      [0, 0, 0, 0, 1, 0],
+      [0.6737040467491827, 0.8867375158894348, 0.8202379290897212, 0.05464426811744971, 0.8151704236499944, 1.436912075686338],
+      [0.4252729176150747, 0, 0.1943546404932241, 1.534853212234193, 0.2153855230268952, 0.1895373251340021],
+      [1.01657829865623, 0.3027092871727687, 0.4684676655259576, 0.6258964430704275, 0.4288645330204052, 0.8410966301451366],
+      [1.162466227510242, 0, 0.2370440605262087, 3.106881562395861, 0.07796209784012031, 0.5180925711341264],
+      [1.796009703092238, 0, 0.2382249540515753, 3.627297170091266, 0.05683905352453789, 0.8004527467863131],
+      [2.518571259426529e-15, 1.650541067762303, 1.277861844304208, 2.27808393542032, 0.1312138891974876, 2.115724647554489],
+      [0, 0, 0, 0, 1, 0],
+      [0, 0.364901414513023, 0.1901102766296209, 1.298203715131748, 0.2545415965993969, 0.4677441426279503],
+      [0.803081130591792, 2.854186453967709, 2.082919584075368, 0.5415394943699852, 0.4617954095299299, 4.016522257313057],
+      [3.139457561788642e-14, 1.721592969948755, 1.127220212473595, 1.221937266969022, 0.2689807974717866, 2.206801606284957],
+      [7.322243123066693, 2.473088175353213, 3.325652498260978, 0.5236718284493023, 0.4692795735057982, 6.433502416628651],
+      [3.456742268891427, 0.2470048432614192, 0.6545184437248897, 3.966304898877862, 0.04641953050580028, 1.857234593848602],
+      [6.22815087953464, 4.040736709944703, 4.343678390518776, 0.05601869971347639, 0.8129029583463457, 7.955352964241708],
+      [0.7057533294554484, 0.4855828625120658, 0.5423585697280298, 0.08481521633217071, 0.7708750214205294, 0.9369810410713009],
+      [2.775557561562891e-17, 1.479511936473496, 0.8595616248049279, 4.054419816108123, 0.04405585547270052, 1.896493175169415],
+      [3.49440947480012, 0, 0.6025215940484411, 6.200396942910677, 0.01277216658085034, 1.55740231118129],
+      [4.124925780036896e-15, 0.6248424371737096, 0.4888801263789472, 0.9415507997913686, 0.33187933456673, 0.8009461690999984],
+      [0.6509363096937502, 0, 0.1997200604658759, 2.321317999376522, 0.1276118591659259, 0.2901118831263627],
+      [5.431668306696785, 6.679907090190379, 5.965742838746773, 0.01329688529737183, 0.9081977311257858, 10.98335974542242],
+      [3.384383423309802, 1.039829136062638, 1.526713624908984, 1.432449719700529, 0.2313650587411595, 2.841256946520647],
+      [58.19250739837972, 0, 1.044892046049787, 15.08022826829152, 0.0001030368673831106, 25.93546811535443],
+      [1.022439425154138, 0.8904736411762298, 0.9205811500807988, 0.01224690243991233, 0.9118814273757936, 1.597126949685936],
+      [2.6019265339958, 1.116024495005686, 1.500058683630922, 0.5702977048520026, 0.450140640705075, 2.590198480466305],
+      [0, 1.049982921354903, 0.828219059062532, 1.385610232514598, 0.2391478274189069, 1.345906981420078],
+      [0.5755752976697974, 0, 0.1650268132390316, 2.454828104720583, 0.1171639945386583, 0.2565246875943397],
+      [1.446002230485426, 1.972816015971729, 1.823414160073186, 0.03759736513952561, 0.8462538704617164, 3.173288632039586],
+      [1.618561295027515, 1.545862488963952, 1.562314731385132, 0.001231044607692411, 0.9720109693405958, 2.702910604413612],
+      [0.5086711647856239, 2.019833062120629, 1.616451219004798, 0.7936108681771543, 0.3730105067555013, 2.81580338556607],
+      [1.222667057061327, 0, 0.4753249121063238, 3.59403383968144, 0.05798732623758796, 0.5449231162531277],
+      [9.250177845120847, 1.540853981149182, 1.983970477246945, 1.265394101808411, 0.2606325249917434, 6.097779726876592],
+      [1.005286632759717, 0.6368889252806246, 0.7275865624569097, 0.111008327297764, 0.7389990769614455, 1.264427947823732],
+      [0, 1.898133045040706, 1.161863319053294, 2.830238808818102, 0.09250460314451325, 2.433097210464935],
+      [1.114421455762919, 0.3205483406471121, 0.4951502114339231, 0.672261234808655, 0.4122643468999723, 0.9075705166908481],
+      [1.688604795441202, 0.872115599385068, 0.9970309244905823, 0.2332631373879224, 0.6291147466886393, 1.870494163474329],
+      [0.6187906211957405, 0.4422174265377424, 0.5146673908782278, 0.05038259655150057, 0.8223988597098189, 0.8426357341017712],
+      [4.831079741237706e-15, 1.872227996629259, 1.338817825475637, 2.958050663671813, 0.08545090318855553, 2.399891160345569],
+      [0, 0.3155926018515626, 0.227927233616331, 0.6389465390328013, 0.424092528291347, 0.4045382810307382],
+      [0.5319815450678259, 1.26048510790621, 0.9545232457171584, 0.5399069382343029, 0.4624712968621087, 1.852832127998092],
+      [6.3200939411278e-17, 0.2612399935967081, 0.2085046557787528, 0.4469288682907759, 0.5037970055265162, 0.3348670955087856],
+      [0, 1.792585627497201, 1.24140678775204, 2.922536775372748, 0.08735044050618257, 2.297802623045026],
+      [4.064293333262663e-16, 0.3147353092435951, 0.1892496296493958, 1.005211237068874, 0.316052818172837, 0.403439371626865],
+      [0, 0, 0, 0, 1, 0],
+      [2.246206053032266, 1.591915623888851, 1.775412838865879, 0.0923677564662384, 0.761188351384973, 3.041674429499818],
+      [2.988677172803887, 0, 0.5129084658192933, 9.218878316202154, 0.00239532254487862, 1.332005527648067],
+      [3.14688653593607, 2.408204799858622, 2.523142702463685, 0.02891488270429932, 0.8649757167355235, 4.489442975612358],
+      [0.7165920486745879, 0, 0.2048702685153037, 2.456623291072189, 0.1170301268854591, 0.3193735939729202],
+      [0, 2.464619178171248, 1.526039405721914, 5.629273579185444, 0.01766294955641567, 3.159240108555322],
+      [0, 0, 0, 0, 1, 0],
+      [7.778148691157165, 1.860650391600178, 2.849277056181007, 1.654663703771426, 0.1983253629031985, 5.851646798149392],
+      [4.004792855928699, 0, 0.4174378489916441, 7.779020839900046, 0.00528564383067387, 1.784872006158475],
+      [0, 2.016148288511132, 1.098549455390976, 5.236802611121668, 0.02211388105507117, 2.584373518746095],
+      [0, 0.2530509150383448, 0.2049084061748014, 0.4160779571130853, 0.5189005836193002, 0.3243700314338041],
+      [0.5797899761297439, 1.474944531635711, 1.159041779234547, 0.5703019485217879, 0.4501389550799552, 2.149041608803478],
+      [1.197972684360613, 0, 0.3536531962660297, 4.702553000864214, 0.03011784771964165, 0.5339172300241064],
+      [0, 0.3755377622020815, 0.1969018090548866, 1.268650512454659, 0.2600199956233308, 0.4813782068782927],
+      [0, 0.8677533423472328, 0.5466918090596943, 2.650090259430357, 0.1035440169437677, 1.112318360482154],
+      [4.412600997707459, 0, 0.421575348895376, 7.962632163178473, 0.004775291927372693, 1.966625560544404],
+      [1.078267162112853, 0.9149708520935078, 0.9499562849760483, 0.0160840770459032, 0.8990804797670418, 1.653409909405499],
+      [1.317624653298892, 0, 0.3952825925786119, 4.517399135821599, 0.03355179943072295, 0.5872441953685233],
+      [0.1024634394887099, 3.043777852333105, 2.070933119269223, 2.274988304739196, 0.1314761168605523, 3.94729345209136],
+      [0, 2.55084829823597, 2.346639356392921, 1.184718987249028, 0.2763973932764573, 3.269771787058303],
+      [0.5960195632807068, 0, 0.1673684406463812, 2.484680005409146, 0.1149597275315544, 0.2656363691938911],
+      [2.564053744649438, 0.2562001845814909, 0.6569853667170422, 3.353736876731666, 0.0670526339286972, 1.471164551287289],
+      [3.523567377334621, 0.2335304901191692, 0.6177263077025978, 4.228898713425224, 0.03974121895028215, 1.869745549217599],
+      [0.7645794608779045, 1.39474105126367, 1.228914116705461, 0.3088122775455275, 0.5784099354163492, 2.128591530769163],
+      [3.872313743903038, 0.3001945145652326, 0.7495263599737007, 3.410817991154875, 0.064770332490796, 2.110628631346173],
+      [1.348224506553748, 0, 0.5197532181393312, 3.550798210218449, 0.05951681303729162, 0.6008820596556348],
+      [0.9301031033091141, 0.6898950508896032, 0.7441163723099865, 0.03346537313063536, 0.8548486794588563, 1.298865067647333],
+      [0.4170495109856097, 0, 0.1903511923228431, 1.542549071829892, 0.2142387794624119, 0.1858722845648098],
+      [10.44893217832021, 0.4022555569575727, 1.041704145874793, 3.861168293613087, 0.04941590760409564, 5.172547711553918],
+      [0.1034310192418253, 1.892263187474957, 1.008923952682121, 1.276547568016404, 0.2585419448894165, 2.471670557698045],
+      [3.046967974669369, 0.6875187041181363, 1.092784919273528, 1.091970757039448, 0.2960349650765434, 2.239271732523999],
+      [0.7198683789564165, 1.837488076930897, 1.491790432854377, 0.6896187712614505, 0.4062940810525876, 2.676194047005128],
+      [1.275233552258837, 7.58672612865101, 6.266836228563596, 0.3981887367271355, 0.5280261541769634, 10.29329759095573],
+      [2.30657897102124e-14, 5.489421798035384, 3.571070021097467, 2.41593347948983, 0.1201063553307153, 7.036544091975854],
+      [0.559822619953856, 1.71479035399741, 1.231770847462372, 1.082817939215943, 0.298068018090574, 2.4475857328549],
+      [2.771180756542641, 1.796618778766233, 2.013958967103253, 0.1158698946809622, 0.7335578241908924, 3.538043325574558],
+      [9999.999999998339, 2.432097169173615, 3.379276895409717, 1.893564869217649, 0.1688003871921624, 4459.957319862896],
+      [0.7334663459423096, 2.173937231643002, 1.596095254866347, 1.038255543178195, 0.3082275337920914, 3.113527425653173],
+      [0.7702349412390501, 1.481196992739451, 1.274842775270267, 0.364178186081979, 0.5461948850959417, 2.241934514332182],
+      [0.2845309341817402, 2.050029967655634, 1.519767324686734, 1.321472954404847, 0.2503278725067668, 2.754615187712004],
+      [1.015660937770507, 0.3073055670670273, 0.4720561681358559, 0.6035668020656821, 0.4372203565274085, 0.8465794588309661],
+      [0, 1.970159625312953, 1.120169836066133, 5.20928447384243, 0.0224665789722962, 2.525423547650627],
+      [0, 0.5753264155199298, 0.4410335164405367, 1.03114326249511, 0.3098902994492519, 0.7374746993450673],
+      [2.736823409609479, 2.348542840678407, 2.453487190154901, 0.01284864241647909, 0.9097516099259901, 4.230207502642916],
+      [9.149715301978405e-16, 1.29419197512056, 0.9620676066879801, 1.74012063932777, 0.1871235417342727, 1.658943187728135],
+      [0, 1.009408180447169, 0.7201317416266795, 1.906505699392216, 0.1673519284290025, 1.293896776352589],
+      [1.701545575395463e-14, 1.16201561388296, 1.114130105107937, 0.2442491813364853, 0.6211538364843379, 1.489514634415266],
+      [0.8883515458297054, 1.623622648529189, 1.334319744829745, 0.1803627821799836, 0.6710616565201941, 2.477143670911062],
+      [0, 0.5570419450087813, 0.3610157342941877, 1.689213063741757, 0.193704737236408, 0.7140369881099469],
+      [2.804120856177222e-15, 1.378683497609396, 1.139416739891161, 1.532228496397977, 0.215778295124767, 1.767247549328411],
+      [0.630106498235145, 1.530183136222741, 1.176306017317766, 0.5627230344194487, 0.4531651666494674, 2.242273764894695],
+      [4.996412325715582, 2.072849087019975, 2.501919619833955, 0.4374688424558926, 0.5083466741660978, 4.883875616363817],
+      [1.476720795366284, 1.192713829097381, 1.265398043718104, 0.04756528081958322, 0.827355357807033, 2.187015539850353],
+      [1.778599502537943, 2.833030015698272, 2.535624910277768, 0.2150914997093523, 0.642805674139892, 4.424176058896644],
+      [1.502754420888704, 0.2825342556426603, 0.4733601919284142, 1.180637234982843, 0.2772263054246996, 1.031916435368656],
+      [0, 0.2915937523113351, 0.2283654592452333, 0.4790160930559324, 0.4888683243803773, 0.3737756671964466],
+      [10.08767614696688, 0, 0.4133910037948654, 8.462162631979279, 0.003626104567950983, 4.495915621518065],
+      [1.984506219150062, 1.662771746660892, 1.756718773063347, 0.03121207319557584, 0.8597680862487451, 3.015865008244778],
+      [3.805655301370652, 0, 0.7005303037771143, 11.62838958327228, 0.0006495276635800629, 1.696119588919385],
+      [3.173406516538895, 2.860065663238961, 2.926441853316894, 0.003891888657044262, 0.9502562372040178, 5.080474489659786],
+      [0, 0, 0, 0, 1, 0],
+      [2.194271257132928, 4.019627316522699, 3.237226152191341, 0.09176983643381931, 0.7619391181878015, 6.130458650322728],
+      [0, 0.2994174888128062, 0.1834705090468997, 0.9675444779876443, 0.3252933434590788, 0.3838044222970849],
+      [1.737488918246139, 0.4263169813102716, 0.5705211950188817, 0.9504457433159637, 0.3296058631975952, 1.320839860569391],
+      [9.491047642026737e-16, 2.201411562959478, 1.602398780540194, 2.916382754860905, 0.08768422447478674, 2.82185084281439],
+      [1.033236674389839, 0.5673779129005597, 0.6682462878144323, 0.1916420169326862, 0.6615534805841186, 1.187783044398971],
+      [0.6633763440867723, 2.065196310532788, 1.40713862608088, 0.9931353495817845, 0.318977273245592, 2.942901296371888],
+      [3.88753619664278e-15, 1.779262169776622, 1.549159808629328, 1.288480285336618, 0.2563282037478503, 2.280724121673174],
+      [137.6200023666397, 1.712312972734741, 2.612335663828599, 4.571254357285468, 0.03251275075427451, 63.52993609974021],
+      [0.9069803858948896, 1.008331374883533, 0.9795641413367016, 0.006632998551161506, 0.9350894763840309, 1.696743112350582],
+      [1.250218074119796, 2.685270528336648, 2.279331033581541, 0.4656302199387952, 0.4950043706394306, 3.99928134132692],
+      [0.5981237480607854, 1.191515517605649, 0.9684057167421628, 0.3651500230254783, 0.5456598635374844, 1.793902873797072],
+      [5.567356236371868, 1.655977785625157, 2.134648959148231, 0.8514639837247273, 0.3561385136046764, 4.60397510129604],
+      [0, 0, 0, 0, 1, 0],
+      [0.5915176036957202, 0.7772525687759813, 0.7215979531128016, 0.05398776775817282, 0.8162640993312603, 1.259941036310695],
+      [0, 0.543676760549953, 0.4362855008937696, 0.8539326132569869, 0.3554421959431151, 0.6969049998601837],
+      [1.00226665989553, 0.6268338660673796, 0.7169253651929272, 0.1172739583266811, 0.7320101172431673, 1.250193047146509],
+      [0, 0, 0, 0, 1, 0],
+      [0, 0, 0, 0, 1, 0],
+      [2.797676857161142, 0.824684447244541, 1.167394064072366, 1.285234262338761, 0.2569280765461694, 2.303990803636788]
+      ]
+    }
+  }
+}
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/fubar-in1.fa	Thu Jan 17 04:22:13 2019 -0500
@@ -0,0 +1,326 @@
+>KF789585
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCCCAAAAACTTCCTGGAAATGACAATAGCACGGCAACGCTGTGCCTTGGACACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCGAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAATTCCTCAATAGGTGAAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAATTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTTCAAAATAAGAAATGGGACCTTTTTGTTGAACGAAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGGCTGGAGTCACTCAAAACGGAACAAGTTCTGCTTGCATAAGGGGATCTAATAGTAGTTTCTTTAGTAGATTAAATTGGTTGACCCACTTAAACTTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAACAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAAGGACCAAATCTTCCTGTATGCTCAATCATCAGGAAGAATCACAGTATCTACCAAAAGAAGCCAACAAGCTGTAATCCCGAATATCGGATCTAGACCCAGAATAAGGAATATCCCTAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAAGTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAGCACTCTGAAATTGGCAACAGGAATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATAGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAAGAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATCGATTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACAAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCACGATGTATACAGGGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGAGTTGAGCTGAAGTCAGGGTACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAGGGCAACATTAGGTGCAACATTTGCATT
+>CY025485
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCTGGAAATGACAACAGCACGGCAACGCTGTGCCTTGGGCATCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAGTGACCAAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAATTCCTCAATAGGTGGAATCTGCAACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTCCAAAATAAGAAATGGGACCTTTTTGTTGAACGCAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAATTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCACTCAAAATGGAACAAGCTCTGCTTGCAAAAGGAGATCTAATAACAGTTTCTTTAGTAGATTGAATTGGTTGACCCACTTAAAATTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAAGAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAATGACCAAATCAGCCTATATGCTCAAGCACCAGGAAGAATCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGATCTAGACCCCGAGTAAGGGATATCCCCAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTCGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGACAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATATGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATCGCGGGTTTCATAGAAAATGGCTGGGAGGGAATGGTGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAATAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGACCAAATCAATGGGAAGCTGAATAGGTTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTCGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGACCTAACTGACTCAGAAATGAACAAATTGTTTGAAAGAACAAAAAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGGTCAATCAGAAATGGAACTTATGACCATGATGTATACAGAGATGAAGCATTAAACAACCGGTTCCAGATCAAAGGTGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>KC535396
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCTGGAAATGACAACAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCAAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTGAAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTCCAAAATAAGAAATGGGACCTTTTTGTTGAACGAAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCACTCAAAACGGAACAAGCTCTGCTTGCATAAGGAGATCTAATAATAGTTTCTTTAGTAGATTGAATTGGTTGACCCACTTAAACTTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAACAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAAGGACCAAATCTTCCTGTATGCTCAAGCATCAGGAAGAATCACAGTATCTACCAAAAGAAGCCAACAAGCTGTAATCCCGAATATCGGATCTAGACCCAGAGTAAGGAATATCCCTAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAACCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGAATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATAGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAAGAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATAGATTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTCGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCACGATGTATACAGAGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGAGTTGAGCTGAAGTCAGGGTACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>CY039880
+ATGAAGACTATCATTGCTTTGAGCTACATTTTATGTCTGGTTTTCGCTCAAAAACTTCCCGGAAATGACAACAGCACGGCAACGCTGTGCCTGGGACACCATGCAGTGCCAAACGGAACGCTAGTGAAAACAATCACGAATGACCAAATTGAAGTGACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTAAAATATGCGACAGTCCTCACCGAATCCTTGATGGAAAAAACTGCACACTGATAGATGCTCTATTGGGAGACCCTCATTGTGATGGCTTCAAAAATAAGGAATGGGACCTTTTTGTTGAACGCAGCACAGCTTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACCCTGGAGTTTACCAATGAAGGCTTCAATTGGACTGGAGTCGCTCAGGATGGAACAAGCTATGCTTGCAAAAGGGGATCTGTTAAAAGTTTCTTTAGTAGATTGAATTGGTTGCACAAATTAGAATACAAATATCCAGCACTGAACGTGACTATGCCAAACAATGACAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGAGTACGGACAGTGACCAAACCAGCCTATATGTTCAAGCATCAGGGAGAGTCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGGTCTAGACCCTGGGTAAGGGGTATCTCCAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTCGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGGTCAGATGCACCCATTGACAACTGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCTTTTCAAAATGTAAACAGGATCACATATGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTAAAATTGGCAACAGGGATGCGGAATGTACCAGAGAAACAAACTAGAGGCATATTCGGCGCAATCGCAGGTTTCATAGAAAATGGTTGGGAGGGAATGGTAGACGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGCACAGGACAAGCAGCAGATCTTAAAAGCACTCAAGCAGCAATCAACCAAATCAACGGGAAACTGAATAGGTTAATCGAGAAAACGAACGAGAAATTCCATCAAATCGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTCGAGAAATATGTTGAAGACACTAAAATAGATCTCTGGTCTTACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAGAAAGCAACTGAGGGAAAATGTTGAGGACATGGGCAATGGTTGCTTCAAAATATATCACAAATGTGACAATGCCTGTATAGGGTCAATCAGAAATGGAACTTATGACCATGATGTATACAGAGACGAAGCATTAAACAACCGGTTCCAGATCAAAGGTGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGCTTTTTGCTTTGTGTTGTTTTGCTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>CY112957
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCCGGAAATGACAACAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCAAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTGGAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTCCAAAATAAGAAATGGGACCTTTTTGTTGAACGCAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAATTGCCTCATCCGGCACACTGGAGTTTACCAATGAAAGCTTCAATTGGACTGGAGTCACTCAGAATGGAACAAGCTCTGCTTGCAAAAGGAGATCTAATAAAAGTTTCTTTAGTAGATTGAATTGGTTGACCCATTTAAAATACAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAAAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAGTGACCAAATCAGCCTATATGCTCAAGCATCAGGAAGAATCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGATCTAGACCCAGGGTAAGGGATATCTCCAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTCGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTTCAAAATGTAAACAGGATCACATATGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATCGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGACGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGCACAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCAACCAAATCAATGGGAAACTGAATAAGTTAATCGGGAAAACAAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTCGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAGAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGGTCAATCAGAAATGGAACTTATGACCATGATGTATACAGAGATGAAGCATTAAACAACCGGTTCCAGATCAAAGGTGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGTTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>CY017283
+ATGAAGACTATCATTGCTTTGAGCTACATTTTATGTCTGGTTTTCGCTCAAAAACTTCCCGGAAATGACAACAGCACAGCAACGCTGTGCCTGGGACACCATGCAGTGCCAAACGGAACGCTAGTGAAAACAATCACGAATGATCAAATTGAAGTGACTAATGCTACTGAGCTGGTTCAGAGTTCCCCAACAGGTAGAATATGCGACAGTCCTCACCGAATCCTTGATGGAAAGAACTGCACACTGATAGATGCTCTATTGGGAGACCCTCATTGTGATGGCTTCCAAAATAAGGAATGGGACCTTTTTGTTGAACGCAGCAAAGCTTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCAGGCACCCTGGAGTTTACCAACGAAAACTTCAATTGGACTGGAGTCGCTCAGGATGGGAAAAGCTATGCTTGCAAAAGGGGATCTGTTAACAGTTTCTTTAGTAGATTGAATTGGTTGCACAAATTAGAATACAAATATCCAGCGCTGAACGTGACTATGCCAAACAATGGCAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGAGCACGGACAGTGACCAAACCAGCCTATATGTCCGAGCATCAGGGAAAGTCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGGATATCGGGTATAGACCATGGGTAAGGGGTCTGTCCAGTAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAATAGCACAGGGAATCTAATTGCTCCTCGGGGTTACTTCAAAATACGAAATGGGAAAAGCTCAATAATGAGGTCAGATGCACCCATTGGCAACTGCAGTTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCTTTTCAAAATGTAAACAGGATCACATATGGGGCCTGCCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGGAATGTACCAGAGAAACAAACTAGAGGCATATTCGGCGCAATCGCAGGTTTCATAGAAAATGGTTGGGAGGGAATGGTAGACGGTTGGTACGGTTTCAGGCATCAGAATTCTGAGGGCACAGGACAAGCTGCAGATCTTAAAAGCACTCAAGCAGCAATCGACCAAATCAACGGGAAACTGAATAGGTTAGTCGAGAAAACGAACGAGAAATTCCATCAAATCGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTCGAGAAATATGTTGAAGACACTAAAATAGATCTCTGGTCTTACAATGCGGAGCTTCTTGTTGCTCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTATTTGAAAGAACAAGGAAGCAACTGAGGGAAAATGCTGAGGACATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGGTCAATCAGAAATGGAACTTATGACCATGATGTATACAGAGACGAAGCATTAAACAACCGGTTCCAAATCAAAGGTGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGCTTTTTGCTTTGTGTTGTTTTGCTTGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>CY010628
+ATGAAGACTATCATTGCTTTGAGCTACATTTTATGTCTGGTTTTCGCTCAAAAACTTCCCGGAAATGACAACAGCACGGCAACGCTGTGCCTGGGACACCATGCAGTGCCAAACGGAACGCTAGTGAAAACAATCACGAATGACCAAATTGAAGTGACTAATGCTACTGAGATGGTTCAGAGTTCCTCAACAGGTAGAATATGCGACAGTCCTCACCGAATCCTTGATGGAAAAAACTGCACACTGATAGATGCTCTATTGGGAGACCCTCATTGTGATGGCTTCCAAAATAAGGAATGGGACCTTTTTGTTGAACGCAGCAAAGCTTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACCCTGGAGTTTACCAATGAAGGCTTCAATTGGACTGGAGTCGCTCAGGATGGAACAAGCTATGCTTGCAAAAGGGGATCTGTTAAAAGTTTCTTTAGTAGATTGAATTGGTTGCACAAATTAGAATACAAATATCCAGCACTGAACGTGACTATGCCAAACAATGACAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGAGTACGGACAGTGACCAAACCAGCCTATATGTTCAAGCATCAGGGAGAGTCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGGTCTAGACCCTGGGTAAGGGGTGTCTCCAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTCGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGGTCAGATGCACCCATTGGCAACTGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCTTTTCAAAATGTAAACAGGATCACATATGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGGAATGTACCAGAGAAACAAACTAGAGGCATATTCGGCGCAATCGCAGGTTTCATAGAAAATGGTTGGGAGGGAATGGTAGACGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGCACAGGACAAGCAGCAGATCTTAAAAGCACTCAAGCAGCAATCAACCAAATCAACGGGAAACTGAATAGGTTAATCGAGAAAACGAACGAGAAATTCCATCAAATCGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTCGAGAAATATGTTGAAGACACTAAAATAGATCTCTGGTCTTACAACGCGGAGCTTCTTATTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAGAACAAGGAAGCAACTGAGGGAAAATGCTGAGGACATGGGCAATGGTTGCTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGGTCAATCAGAAATGGAACTTATGACCATGATGTATACAGAGACGAAGCATTAAACAACCGGTTCCAGATCAAAGGTGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGCTTTTTGCTTTGTGTTGTTTTGCTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>KC882883
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAACCTTCCTGGAAATGACAACAGCGCGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCAAGTTGAAGTTACTAATGCTACTGAGCTGGTTCAGAATTCCTCAACAGGTGAAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTCCAAAATAAGAAATGGGACCTTTTTGTTGAACGAAGCAAAGCATACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCACTCAAAACGGAACAAGCTCTGCTTGCATAAGGAGATCTAATAATAGTTTCTTTAGTAGATTGAATTGGTTGACCCACTTAAACTTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAACAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAAGGACCAAATCTTCCTGTATGCTCAAGCATCAGGAAGAATCACAGTATCTACCAAAAGAAGCCAACAAGCTGTAATCCCGAATATCGGATCTAGACCCAGAGTAAGGAATATCCCTAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGAATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATAGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAAGAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATAGATTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTCGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCACGATGTATACAGAGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGAGTTGAGCTGAAGTCAGGGTACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>CY010716
+ATGAAGACTATCATTGCTTTGAGCTACATTTTATGTCTGGTTTTCGCTCAAAAACTTCCCGGAAATGACAACAGCACGGCAACGCTGTGCCTGGGACACCATGCAGTGCCAAACGGAACGCTAGTGAAAACAATCACGAATGACCAAATTGAAGTGACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTAGAATATGCGACAGTCCTCACCGAATCCTTGATGGGAAAAACTGCACACTGATAGATGCTCTATTGGGAGACCCTCATTGTGATGGCTTCCAAAATAAGGAATGGGACCTTTTTGTTGAACGCAGCAAAGCTTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACCCTTGAGTTTACCAATGAAGGCTTCAATTGGACTGGAGTCGCTCAGGATGGAACAAGCTATGCTTGCAAAAGGGGATCTGTTAAAAGTTTCTTTAGTAGATTGAATTGGTTGCACAAATTAGAATACAAATATCCAGCACTGAACGTGACTATGCCAAACAATGACAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGAGTACGGACAGTGACCAAACCAGCCTATATGTTCAAGCATCAGGGAGAGTCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGGTCTAGACCCTGGGTAAGGGGTGTCTCCAGCAGAATAAGCATCTATTGGACAATTGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTCGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGGTCAGATGCACCCATTGGCAACTGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCTTTTCAAAATGTAAACAGGATCACATATGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGGAATGTACCAGAGAAACAAACTAGAGGCATATTCGGCGCAATCGCAGGTTTCATAGAAAATGGTTGGGAGGGAATGGTAGACGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGCACAGGACAAGCAGCAGATCTTAAAAGCACTCAAGCAGCAATCAACCAAATCAACGGGAAACTGAATAGGTTAATCGAGAAAACGAACGAGAAATTCCATCAAATCGAAAAAGAATTTTCAGAAGTAGAAGGGAGAATTCAGGACCTCGAGAAATATGTTGAAGACACTAAAATAGATCTCTGGTCTTACAACGCGGAGCTTCTTATTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAGAACAAGGAAGCAACTGAGGGAAAATGCTGAGGACATGGGCAATGGTTGCTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGGTCAATCAGAAATGGAACTTATGACCATGATGTATACAGAGACGAAGCATTAAACAACCGGTTCCAGATCAAAGGTGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGCTTTTTGCTTTGTGTTGTTTTGCTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>CY001792
+ATGAAGACTATCATTGCTTTGAGCTACATTTTATGTCTGGTTTTCGCTCAAAAACTTCCCGGAAATGACAACAGCACGGCAACGCTGTGCCTGGGGCACCATGCAGTGCCAAACGGAACGCTAGTGAAAACAATCACGAATGACCAAATTGAAGTGACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTAGAATATGCGACAGTCCTCACCAAATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCATTGTGATGGCTTCCAAAATAAGGAATGGGACCTTTTTGTTGAACGCAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCGCTCAGAATGGAACAAGCTCTGCTTGCAAAAGGAGATCTAATAAAAGTTTCTTTAGTAGATTGAATTGGTTGCACCAATTAAAATACAAATATCCAGCACTGAACGTGACTATGCCAAACAATGAAAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGAGTACGGACAGTGACCAAATCAGCCTATATGCTCAAGCATCAGGGAGAGTCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGATCTAGACCCTGGGTAAGGGGTGTCTCCAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTCGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGGTCAGATGCACCCATTGGCAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTTCAAAATGTAAACAGGATCACATATGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGGAATGTACCAGAGAAACAAACTAGAGGCATATTCGGCGCAATCGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGACGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGCACAGGACAAGCAGCAGATCTTAAAAGCACTCAAGCAGCAATCAACCAAATCAACGGGAAACTGAATAGGTTAATCGAGAAAACAAACGAGAAATTCCATCAAATTGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTCGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCGTACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAGAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGGTCAATCAGAAATGGAACTTATGACCATGATGTATACAGAGACGAAGCATTAAACAACCGGTTCCAGATCAAAGGTGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGTTTTGCTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>CY172847
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCTGGAAATGACAACAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCAAGTTGAAGTTACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTGAAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTCCAAAATAAGAAATGGGACCTTTTTGTTGAACGCAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCACTCAAAACGGAACAAGCTCTGCTTGCATAAGGAGATCCAATAACAGTTTCTTTAGTAGATTGAATTGGTTGACCCACTTAAAATTCAAATATCCAGCATTGAACGTGACTATGCCAAACAATGAAAAATTTGACAAATTGTACATTTGGGGTGTTCACCACCCGGGTACGGACAATGACCAAATCTTCCTGTATGCTCAAGCATCAGGAAGAATCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGATCTAGACCCAGAGTAAGGAATATCCCCAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATCGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAATAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATAGGTTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTCGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACCAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCACGATGTATACAGAGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGCGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>CY001504
+ATGAAGACTATCATTGCTTTGAGCTACATTTTATGTCTGGTTTTCGCTCAAAAACTTCCCGGAAATGACAACAGCACGGCAACGCTGTGCCTGGGACACCATGCAGTGCCAAACGGAACGCTAGTGAAAACAATCACGAATGACCAAATTGAAGTGACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTAGAATATGCGACAGTCCTCACCGAATCCTTGATGGAGAAAACTGCACACTGATAGATGCTCTATTGGGAGACCCTCATTGTGATGGCTTCCAAAATAAGGAATGGGACCTTTTTGTTGAACGCAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACCCTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCGCTCAGAATGGAACAAGCTCTGCTTGCAAAAGGAGATCTATTAAAAGTTTCTTTAGTAGATTGAATTGGTTGCACCAATTAAAATACAAATATCCAGCACTGAACGTGACTATGCCAAACAATGACAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGAGTACGGACAGTGACCAAACCAGCCTATATGCTCAAGCATCAGGGAGAGTCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGATCTAGACCCTGGGTAAGGGGTGTCTCCAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTCGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGGTCAGATGCACCCATTGGCAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTTCAAAATGTAAACAGGATCACATATGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGGAATGTACCAGAGAAACAAACTAGAGGCATATTCGGTGCAATCGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGACGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGCACAGGACAAGCAGCAGATCTTAAAAGCACTCAAGCAGCAATCAACCAAATCAACGGGAAACTGAATAGGTTAATCGAGAAAACGAACGAGAAATTCCATCAAATTGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTCGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCGTACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAGAACAAGGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGGTCAATCAGAAATGGAACTTATGACCATGATGTATACAGAGACGAAGCATTAAACAACCGGTTCCAGATCAAAGGTGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGTTTTGCTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>CY134876
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCTGGAAATGACAATAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCGAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAATTCCTCAATAGGTGAAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTTCAAAATAAGAAATGGGACCTTTTTGTTGAACGAAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGGCTGGAGTCACTCAAAACGGAACAAGTTCTGCTTGCATAAGGGGATCTAATAGTAGTTTCTTTAGTAGATTAAATTGGTTGACCCACTTAAACTTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAACAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAAGGACCAAATCTTCCTGTATGCTCAATCATCAGGAAGAATCACAGTATCTACCAAAAGAAGCCAACAAGCTGTAATCCCGAATATCGGATCTAGACCCAGAATAAGGAATATCCCTAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAAGTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAGCACTCTGAAATTGGCAACAGGAATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATAGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAAGAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATCGATTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACAAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCACGATGTATACAGGGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGAGTTGAGTTGAAGTCAGGGTACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAGGGCAACATTAGGTGCAACATTTGCATT
+>CY039879
+ATGAAGACTATCATTGCTTTGAGCTACATTTTATGTCTGGTTTTCGCTCAAAAACTTCCCGGAAGTGACAACAGCACGGCAACGCTGTGCCTGGGACACCATGCAGTGCCAAACGGAACGCTAGTGAAAACAATCACGAATGACCAAATTGAAGTGACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTAAAATATGCGACAGTCCTCACCGAATCCTTGATGGAAAAAACTGCACACTGATAGATGCTCTATTGGGAGACCCTCATTGTGATGGCTTCAAAAATAAGGAATGGGACCTTTTTGTTGAACGCAGCACAGCTTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACCCTGGAGTTTACCAATGAAGGCTTCAATTGGACTGGAGTCGCTCAGGATGGAACAAGCTATGCTTGCAAAAGGGGATCTGTTAAAAGTTTCTTTAGTAGATTGAATTGGTTGCACAAATTAGAATACAAATATCCAGCACTGAACGTGACTATGCCAAACAATGACAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGAGTACGGACAGTGACCAAACCAGCCTATATGTTCAAGCATCAGGGAGAGTCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGGTCTAGACCCTGGGTAAGGGGTATCTCCAGCAGAATAAGCGTCTATTGGACAATAGTAAAACCGAGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTCGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGGTCAGATGCACCCATTGACAACTGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCTTTTCAAAATGTAAACAGGATCACATATGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTAAAATTGGCAACAGGGATGCGGAATGTACCAGAGAAACAAACTAGAGGCATATTCGGCGCAATCGCAGGTTTCATAGAAAATGGTTGGGAGGGAATGGTAGACGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGCACAGGACAAGCAGCAGATCTTAAAAGCACTCAAGCAGCAATCAACCGAATCAACGGGAAACTGAATAGGTTAATCGAGAAAACGAACGAGAAATTCCATCAAATCGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTCGAGAAATATGTTGAAGACACTAAAATAGATCTCTGGTCTTACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAGAAAGCAACTGAGGGAAAATGCTGAGGACATGGGCAATGGTTGCTTCAAAATATATCACAAATGTGACAATGCCTGTATAGGGTCAATCAGAAATGGAACTTATGACCATGATGTATACAGAGACGAAGCATTAAACAACCGGTTCCAGATCAAAGGTGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGCTTTTTGCTTTGTGTTGTTTTGCTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>KC892266
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCTGGAAATGACAACAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCAAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTGAAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTCCAAAATAAGAAGTGGGACCTTTTTGTTGAACGAAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCACTCAAAACGGAACAAGCTCTGCTTGCATAAGGAGATCTAATAGTAGTTTCTTTAGTAGATTGAATTGGTTGACCCACTTAAACTTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAAAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAAGGACCAAATCTTCCTGTATGCTCAATCATCAGGAAGAATCACAGTATCTACCAAAAGAAGCCAACAAGCTGTAATCCCGAATATCGGATCTAGACCCAGAATAAGGAATATCCCTAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAGCACTCTGAAATTGGCAACAGGAATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATAGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAAGAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATCGATTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTCGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATAACCACGATGTATACAGAGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGAGTTGAGCTGAAGTCAGGGTACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAGGGCAACATTAGGTGCAACATTTGCATT
+>CY011560
+ATGAAGACTATCATTGCTTTGAGCTACATTTTATGTCTGGTTTTCGCTCAAAAACTTCCCGAAAATGACAACAGCACAGCAACGCTGTGCCTGGGACACCATGCAGTGCCAAACGGAACGCTAGTTAAAACAATCACGAATGATCAAATTGAAGTGACTAATGCTACTGAGCTGGTTCAGAGTTCCCCAACAGGTAGAATATGCGACAGTCCTCACCGAATCCTTGATGGAAAGAACTGCACACTGATAGATGCTCTATTGGGAGACCCTCATTGTGATGGCTTCCAAAATAAGGAATGGGACCTTTTTGTTGAACGCAGCAAAGCTTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCAGGCACCCTGGAGTTTACCAACGAAAACTTCAATTGGACTGGAGTCGCTCAGGATGGGAAAAGCTATGCTTGCAAAAGGGGATCTGTTAACAGTTTCTTTAGTAGATTGAATTGGTTGCACAAATTAGAATACAAATATCCAGCGCTGAACGTGACTATGCCAAACAATGGCAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGAGCACGGACAGTGACCAAACCAGCCTATATGTCCGAGCATCAGGGAAAGTCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGGATATCGGGTATAGACCATGGGTAAGGGGTCTGTCCAGTAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAATAGCACAGGGAATCTAATTGCTCCTCGGGGTTACTTCAAAATACGAAATGGGAAAAGCTCAATAATGAGGTCAGATGCACCCATTGGCAACTGCAGTTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCTTTTCAAAATGTAAACAGGATCACATATGGGGCCTGCCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGGAATGTACCAGAGAAACAAACTAGAGGCATATTCGGCGCAATCGCAGGTTTCATAGAAAATGGTTGGGAGGGAATGGTAGACGGTTGGTACGGTTTCAGGCATCAGAATTCTGAGGGCACAGGACAAGCTGCAGATCTTAAAAGCACTCAAGCAGCAATCGACCAAATCAACGGGAAACTGAATAGGTTAGTCGAGAAAACGAACGAGAAATTCCATCAAATCGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTCGAGAAATATGTTGAAGACACTAAAATAGATCTCTGGTCTTACAATGCGGAGCTTCTTGTTGCTCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTATTTGAAAGAACAAGGAAGCAACTGAGGGAAAATGCTGAGGACATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGGTCAATCAGAAATGGAACTTATGACCATGATGTATACAGAGACGAAGCATTAAACAACCGGTTCCAGATCAAAGGTGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGCTTTTTGCTTTGTGTTGTTTTGCTTGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>KF789591
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCTGGAAATGACAATAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCGAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAATTCCTCAATAGGTGAAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTTCAAAATAAGAAATGGGATCTTTTTGTTGAACGAAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCACTCAAAACGGAACAAGTTCTGCTTGCATAAGGGGATCTAATAGTAGTTTCTTTAGTAGATTAAATTGGTTGACCCACTTAAACTTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAACAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAAGGACCAAATCTTCCTGTATGCTCAATCATCAGGAAGAATCACAGTATCTACCAAAAGAAGCCAACAAGCTGTAATCCCGAATATCGGATCTAGACCCAGAATAAGGAATATCCCTAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAAGTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAGCACTCTGAAATTGGCAACAGGAATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATAGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAAGAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATCGATTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACAAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCACGATGTATACAGGGATGAAGCATTAAACAACCGATTCCAGATCAAGGGAGTTGAGCTGAAGTCAGGGTACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTCTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAGGGCAACATTAGGTGCAACATTTGCATT
+>KC882867
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAACCTTCCTGGAAATGACAACAGCGCGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCAAGTTGAGGTTACTAATGCTACTGAGCTGGTTCAGAATTCCTCAACAGGTGAAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTCCAAAATAAGAAATGGGACCTTTTTGTTGAACGAAGCAAAGCATACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCACTCAAAACGGAACAAGCTCTGCTTGCATAAGGAGATCTAATAATAGTTTCTTTAGTAGATTGAATTGGTTGACCCACTTAAACTTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAACAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAAGGACCAAATCTTCCTGTATGCTCAAGCATCAGGAAGAATCACAGTATCTACCAAAAGAAGCCAACAAGCTGTAATCCCGAATATCGGATCTAGACCCAGAGTAAGGAATATCCCTAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGAATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATAGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAAGAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATAGATTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTCGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCACGATGTATACAGAGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGAGTTGAGCTGAAGTCAGGGTACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>CY012728
+ATGAAGACTATCATTGCTTTGAGCTACATTTTATGTCTGGTTTTCGCTCAAAAACTTCCCGGAAATGACAACAGCACAGCAACGCTGTGCCTGGGACACCATGCAGTGCCAAACGGAACGCTAGTGAAAACAATCACGAATGATCAAATTGAAGTGACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTAGAATATGCGACAGTCCTCACCGAATCCTTGATGGAAAAAACTGCACACTGATAGATGCTCTATTGGGAGACCCTCATTGTGATGGCTTCCAAAATAAGGAATGGGACCTTTTTGTTGAACGCAGCAAAGCTTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCAGGCACCCTGGAGTTTATCAATGAAGACTTCAATTGGACTGGAGTCGCTCAGGATGGGAAAAGCTATGCTTGCAAAAGGGGATCTGTTAACAGTTTCTTTAGTAGATTGAATTGGTTGCACAAATTAGAATACAAATATCCAGCGCTGAACGTGACTATGCCAAACAATGACAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGAGCACGGACAGTGACCAAACCAGCCTATATGTTCGAGCATCAGGGAGAGTCACAGTCTCTACCAAAAGAAGTCAACAAACTGTAATCCCGAATATCGGGTCTAGACCCTGGGTAAGGGGTCTGTCCAGTAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAATAGCACAGGGAATCTAATTGCTCCTCGGGGTTACTTCAAAATACGAAATGGGAAAAGCTCAATAATGAGGTCAGATGCACCCATTGGCAACTGCAGTTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCTTTTCAAAATGTAAACAGGATCACATATGGGGCCTGCCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGGAATGTACCAGAGAAACAAACTAGAGGCATATTCGGCGCAATCGCAGGTTTCATAGAGAATGGTTGGGAGGGAATGGTAGACGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGCACAGGACAAGCAGCAGATCTTAAAAGCACTCAAGCAGCAATCGACCAAATCAACGGGAAACTGAATAGGTTAATCGAGAAAACGAACGAGAAATTCCATCAAATCGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTCGAGAAATATGTTGAAGACACTAAAATAGATCTCTGGTCTTACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAGAACAAGGAAGCAACTGAGGGAAAATGCTGAGGACATGGGCAATGGTTGCTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGGTCAATCAGAAATGGAACTTATGACCATGATGTATACAGAGACGAAGCATTAAACAACCGGTTCCAGATCAAAGGTGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGCTTTTTGCTTTGTGTTGTTTTGCTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>CY013669
+ATGAAGACTATCATTGCTTTGAGCTACATTTTATGTCTGGTTTTCGCTCAAAAACTTCCCGGAAATGACAACAGCACAGCAACGCTGTGCCTGGGACACCATGCAGTGCCAAACGGAACGCTAGTGAAAACAATCACGAATGATCAAATTGAAGTGACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTAGAATATGCGACAGTCCTCACCGAATCCTTGATGGAAAAAACTGCACACTGATAGATGCTCTATTGGGAGACCCTCATTGTGATGGCTTCCAAAATAAGGAATGGGACCTTTTTGTTGAACGCAGCAAAGCTTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCAGGCACCCTAGAGTTTATCAATGAAGACTTCAATTGGACTGGAGTAGCTCAGGATGGGAAAAGCTATGCTTGCAAAAGGGGATCTGTTAACAGTTTCTTTAGTAGATTGAATTGGTTGCACAAATTAGAATACAAATATCCAGCGCTGAACGTGACTATGCCAAACAATGGCAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGAGCACGGACAGTGACCAAACCAGCCTATATGTTCAAGCATCAGGGAGAGTCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGGTCTAGACCCTGGGTAAGGGGTCTGTCCAGTAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAATAGCACAGGGAATCTAATTGCTCCTCGGGGTTACTTCAAAATACGAAATGGGAAAAGCTCAATAATGAGGTCAGATGCACCCATTGGCAACTGCAGTTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCTTTTCAAAATGTAAACAGGATCACATATGGGGCCTGCCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGGAATGTACCAGAGAAACAAACTAGAGGCATATTCGGCGCAATCGCAGGTTTCATAGAAAATGGTTGGGAGGGAATGGTAGACGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGCACAGGACAAGCAGCAGATCTTAAAAGCACTCAAGCAGCAATCGACCAAATCAACGGGAAACTGAATAGGTTAATCGAGAAAACGAACGAGAAATTCCATCAAATCGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTCGAGAAATATGTTGAAGACACTAAAATAGATCTCTGGTCTTACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAGAACAAGGAAGCAACTGAGGGAAAATGCTGAGGACATGGGCAATGGTTGCTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGGTCAATCAGAAATGGAACTTATGACCATGATGTATACAGAGACGAAGCGTTAAACAACCGGTTCCAGATCAAAGGTGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGCTTTTTGCTTTGTGTTGTTTTGCTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>CY002048
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTTACTCAAAAACTTCCCGGAAATGACAACAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCAAATTGAAGTCACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTGGAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAGAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTCCAAAATAAGAAATGGGACCTTTTTGTTGAACGCAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGATCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCACTCAAAATGGAACAAGCTCTGCTTGCAAAAGGAGATCTAATAACAGTTTCTTTAGTAGATTGAATTGGTTGACCCACTTAAAATTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAAAAATTTGACAAACTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAATGACCAAATCAGCCTATATGCTCAAGCATCAGGAAGAATCACAGTCTCCACCAAAAGAAGCCAACAAACTGTAATCCCGAGTATCGGGTCTAGACCCAGGATAAGGGATGTCCCCAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTCGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTTCAAAATGTAAACAGGATCACATATGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATCGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGACGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAACAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCAACCAAATCAATGGGAAGCTGAATAGGTTGATCGGGAAAACAAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTCGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTGGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAGAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGGTCAATCAGAAATGGAACTTATGACCATGATGTATACAGAGATGAAGCATTAAACAACCGGTTCCAGATCAAAGGTGTTGAGTTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>CY010516
+ATGAAGACTATCATTGCTTTGAGCTACATTTTATGTCTGGTTTTCGCTCAAAAACTTCCCGGAAATGACAACAGCACGGCAACGCTGTGCCTGGGACACCATGCAGTGCCAAACGGAACGCTAGTGAAAACAATCACGAATGACCAAATTGAAGTGACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTAGAATATGCGACAGTCCTCACCGAATCCTTGATGGAAAAAATTGCACACTGATAGATGCCCTATTGGGAGACCCTCATTGTGATGGCTTCCAAAATAAGGAATGGGACCTTTTTGTTGAACGCAGCAAAGCTTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACCCTGGAGTTTACCAATGAAGGCTTCAATTGGACTGGAGTCGCTCAGGATGGAACAAGCTATGCTTGCAAAAGGGGATCTGTTAAAAGTTTCTTTAGTAGATTGAATTGGTTGCACAAATTAGAATACAAATATCCAGCACTGAACGTGACTATGCCAAACAATGACAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGAGTACGGACAGTGACCAAACCAGCCTATATGTTCAAGCATCAGGGAGAGTCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGGTCTAGACCCTGGGTAAGGGGTGTCTCCAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTCGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGGTCAGATGCACCCATTGGCAACTGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCTTTTCAAAATGTAAACAGGATCACATATGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGGAATGTACCAGAGAAACAAACTAGAGGCATATTCGGCGCAATCGCAGGTTTCATAGAAAATGGTTGGGAGGGAATGGTAGACGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGCACAGGACAAGCAGCAGATCTTAAAAGCACTCAAGCAGCAATCAACCAAATCAACGGGAAACTGAATAGGTTAATCGAGAAAACGAACGAGAAATTCCATCAAATCGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTCGAGAAATATGTTGAAGACACTAAAATAGATCTCTGGTCTTACAACGCGGAGCTTCTTATTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAGAACAAGGAAGCAACTGAGGGAAAATGCTGAGGACATGGGCAATGGTTGCTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGGTCAATCAGAAATGGAACTTATGACCATGATGTATACAGAGACGAAGCATTAAACAACCGGTTCCAGATCAAAGGTGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGCTTTTTGCTTTGTGTTGTTTTGCTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>CY026019
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCCGGAAATGACAACAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCAAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTGAAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTCCAAAATAAGAAATGGGACCTTTTTGTTGAACGCAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCACTCAAAACGGAACAAGCTCTGCTTGCATAAGGAGATCTAATAACAGTTTCTTTAGTAGATTGAATTGGTTGACCCACTTAAAATTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAAAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGTACAATGACCAAATCTTCCTGTATGCTCAAGCATCAGGAAGAATCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGATCTAGACCCAGAGTAAGGAATATCCCCAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATCGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAATAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATAGGTTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTCGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACCAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCACGATGTATACAGAGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGCGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>CY002304
+ATGAAGACTATCATTGCTTTGAGCTACATTTTATGTCTAGTTTTCGCTCAAAAACTTCCCGGAAATGACAACAGCACGGCAACGCTGTGCCTGGGGCACCATGCAGTGCCAAACGGAACGCTAGTGAAAACAATCGCGAATGACCAAATTGAAGTGACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTAGAATATGCGACAGTCCTCACCAAATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCATTGTGATGGCTTCCAAAATAAGGAATGGGACCTTTTTGTTGAACGCAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCTTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCGCTCAGAATGGAACAAGCTCTGCTTGCAAAAGGAGATCTAATAAAAGTTTCTTTAGTAGATTGAATTGGTTGCACCAATTAAAATACAAATATCCAGCACAGAACGTGACTATGCCAAACAATGAAAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGAGTACGGACAGTGACCAAATCAGCCTATATGCTCAAGCATCAGGGAGAGTCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGATCTAGACCCTGGGTAAGGGGTGTCTCCAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTCGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGGTCAGATGCACCCATTGGCAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTTCAAAATGTAAACAGGATCACATATGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGGAATGTACCAGAGAAACAAACTAGAGGCATATTCGGCGCAATCGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGACGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGCACAGGACAAGCAGCAGATCTTAAAAGCACTCAAGCAGCAATCAACCAAATCAACGGGAAACTGAATAGGTTAATCGAGAAAACGAACGAGAAATTCCATCAAATTGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTCGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCGTACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAGAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGGTCAATCAGAAATGGAACTTATGACCATGATGTATACAGAGACGAAGCATTAAACAACCGGTTCCAGATCAAAGGTGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGCTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>CY173095
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCTGGAAATGACAACAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCAGATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTGAAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTCCAAAATAAGAAATGGGACCTTTTTGTTGAACGCAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCACTCAAAACGGAACAAGCTCTGCTTGCATAAGGAGATCTAATAACAGTTTCTTTAGTAGATTGAATTGGTTGACCCACTTAAAATTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAACAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAATGACCAAATCTTCCTGTATGCTCAAGCATCAGGAAGAATCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGATCTAGACCCAGAGTAAGGAATATCCCTAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAGTTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATCGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAAGAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATAGATTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTCGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACCAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCACGATGTATACAGAGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGAGTTGAGCTGAAGTCAGGGTACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>CY173255
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCTGGAAATGACAACAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCAAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTGAAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTCCAAAATAAGAAATGGGACCTTTTTGTTGAACGCAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCACTCAAAACGGAACAAGCTCTGCTTGCATAAGGAGATCTAATAACAGTTTCTTTAGTAGATTGAATTGGTTGACCCACTTAAAATTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAACAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAATGACCAAACCTTCCTGTATGCTCAAGCATCAGGAAGAATCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGATCTAGACCCAGAGTAAGGAATATCCCTAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATCGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAAGAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATAGATTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTCGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACCAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGGTCAATCAGAAATGGAACTTATGACCACGATGTATACAGAGATGAAGCATTAAACAACCGGTTCCAGATCAAAGGAGTTGAGCTGAAGTCAGGGTACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>CY171039
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCTGGAAATGACAATAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCGAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAATTCCTCAATAGGTGAAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTTCAGAATAAGAAATGGGACCTTTTTGTTGAACGAAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGGCTGGAGTCACTCAAAACGGAACAAGTTCTGCTTGCATAAGGGGATCTAATAGTAGTTTCTTTAGTAGATTAAATTGGTTGACCCACTTAAACTTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAACAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAAGGACCAAATCTTCCTGTATGCTCAATCATCAGGAAGAATCACAGTATCTACCAAAAGAAGCCAACAAGCTGTAATCCCGAATATCGGATCTAGACCCAGAATAAGGAATATCCCTAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATGCGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAAGTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAGCACTCTGAAATTGGCAACAGGAATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATAGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGATGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGGAGAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATCGATTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAGGTAGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACAAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCACGATGTATACAGGGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGAGTTGAGCTGAAGTCAGGGTACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAGGGCAACATTAGGTGCAACATTTGCATT
+>CY012456
+ATGAAGACTATCATTGCTTTGAGCTACATTTTATGCCTGGTTTTCGCTCAAAAACTTCCCGGAAATGACAACAGCACAGCAACGCTGTGCCTGGGACACCATGCAGTGCCAAACGGAACGCTAGTGAAAACAATCACGAATGATCAAATTGAAGTGACTAATGCTACTGAGCTGGTTCAGAGTTCCCCAACAGGTAGAATATGCGACAGTCCTCACCGAATCCTTGATGGAAAGAACTGCACACTGATAGATGCTCTATTGGGAGACCCTCATTGTGATGGCTTCCAAAATAAGGAATGGGACCTTTTTGTTGAACGCAGCAAAGCTTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCAGGCACCCTGGAGTTTACCAACGAAAACTTCAATTGGACTGGAGTCGCTCAGGATGGGAAAAGCTATGCTTGCAAAAGGGGATCTGTTAACAGTTTCTTTAGTAGATTGAATTGGTTGCACAAATTAGAATACAAATATCCAGCGCTGAACGTGACTATGCCAAACAATGGCAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGAGCACGGACAGTGACCAAACCAGCCTATATGTCCGAGCATCAGGGAAAGTCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGGATATCGGGTATAGACCATGGGTAAGGGGTCTGTCCAGTAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAATAGCACAGGGAATCTAATTGCTCCTCGGGGTTACTTCAAAATACGAAATGGGAAAAGCTCAATAATGAGGTCAGATGCACCCATTGGCAACTGCAGTTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCTTTTCAAAATGTAAACAGGATCACATATGGGGCCTGCCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGGAATGTACCAGAGAAACAAACTAGAGGCATATTCGGCGCAATCGCAGGTTTCATAGAAAATGGTTGGGAGGGAATGGTAGACGGTTGGTACGGTTTCAGGCATCAGAATTCTGAGGGCACAGGACAAGCTGCAGATCTTAAAAGCACTCAAGCAGCAATCGACCAAATCAACGGGAAACTGAATAGGTTAGTCGAGAAAACGAACGAGAAATTCCATCAAATCGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTCGAGAAATATGTTGAAGACACTAAAATAGATCTCTGGTCTTACAATGCGGAGCTTCTTGTTGCTCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTATTTGAAAGAACAAGGAAGCAACTGAGGGAAAATGCTGAGGACATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGGTCAATCAGAAATGGAACTTATGACCATGATGTATACAGAGACGAAGCATTAAACAACCGGTTCCAGATCAAAGGTGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGCTTTTTGCTTTGTGTTGTTTTGCTTGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>CY090885
+ATGAAGACTATCATTGCTTTGAGCTACATTTTATGTCTGGTTTTCGCTCAAAAACTTCCCGGAAATGACAACAGCACGGCAACGCTGTGCCTGGGGCACCATGCAGTGCCAAACGGAACGCTAGTGAAAACAATCACGAATGACCAAATTGAAGTGACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTAGAATATGCGACAGTCCTCACCAAATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCATTGTGATGGCTTCCAAAATAAGGAATGGGACCTTTTCGTTGAACGCAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCGCTCAGAATGGAACAAGCTCTGCTTGCAAAAGGAGGTCTAATAAAAGTTTCTTTAGTAGATTGAATTGGTTGCACCAATTGAAATACAAATACCCAGCACTGAACGTGACTATGCCAAACAATGAAAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGAGTACGGACAGTGACCAAATCAGCCTATATGCTCAAGCATCAGGGAGAGTCACAGTCTCTACCAAAAGAAGCCAACAGACTGTAATCCCGAATATCGGATCTAGACCCTGGGTAAGGGGTGTCTCCAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTCGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAGTAATGAGGTCAGATGCATCCATTGGCAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTTCAAAATGTAAACAGGATCACATATGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGGAATGTACCAGAGAAACAAACTAGAGGCATATTCGGTGCAATCGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGACGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGCACAGGACAAGCAGCAGATCTTAAAAGCACTCAAGCAGCAATCAACCAAATCAACGGGAAACTGAATAGGTTAATCGAGAAAACGAACGAGAAATTCCATCAAATTGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTCGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCGTACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAGAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGCTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGAGTCAATCAGAAATGGAACTTATGACCATGATGTATACAGAGACGAAGCATTAAACAACCGGTTCCAGATCAAAGGTGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGTTTTGCTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>KC892156
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTAGTTTTCGCTCAAAAACTTCCTGGAAATGACAACAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGGACGATAGTGAAAACAATCACGAATGACCAAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTGAAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTCCAAAATAAGAAATGGGACCTTTTTGTTGAACGAAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCCTCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCACTCAAAACGGAACAAGCTCTGCTTGCATAAGGAGATCTGATAGTAGTTTCTTTAGTAGATTGAATTGGTTGACCCACTTAAACTTCAAATATCCAGCATTGAACGTGACTATGCCAAACAATGAGCAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAAGGACCAAATCTTCCTGTATGCTCAAGCATCAGGAAGAATCACAGTATCTACCAAAAGAAGCCAACAAGCTGTGATCCCGAATATCGGATCTAGACCCAGAATAAGGAATATCCCTAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTCAAGCAAAACACTCTGAAATTGGCAACAGGAATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATAGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAAGAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATAGATTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTCGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAAAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGCTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATAACCACGATGTATACAGAGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGAGTTGAGCTGAAGTCAGGGTACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>CY012200
+ATGAAGACTATCATTGCTTTGAGCTACATTTTATGTCTGGTTTTCGCTCAAAAACTTCCCGGAAATGACAACAGCACGGCAACGCTGTGCCTGGGACACCATGCAGTGCCAAACGGAACGCTAGTGAAAACAATCACGAATGACCAAATTGAAGTGACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTAGAATATGCGACAGTCCTCACCGAATCCTTGATGGAAAAAACTGCACACTGATAGATGCTCTATTGGGAGACCCTCATTGTGATGGCTTCCAAAATAAGGAATGGGACCTTTTTGTTGAACGCAGCAAAGCTTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACCCTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCGCTCAGAATGGAACAAGCTATGCTTGCAAAAGGAGATCTGTTAAAAGTTTCTTTAGTAGATTGAATTGGTTGCACAAATTAGAATACAAATATCCAGCACAGAACGTGACTATGCCAAACAATGACAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGAGTACGGACAGTGACCAAACCAGCCTATATGTTCAAGCATCAGGGAGAGTCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGATCTAGACCCTGGGTAAGGGGTGTCTCCAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTCGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGGTCAGATGCACCCATTGGCAACTGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTTCAAAATGTAAACAGGATCACATATGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGGAATGTACCAGAGAAACAAACTAGAGGCATATTCGGCGCAATCGCAGGTTTCATAGAAAATGGTTGGGAGGGAATGGTAGACGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGCACAGGACAAGCAGCAGATCTTAAAAGCACTCAAGCAGCAATCAACCAAATCAACGGGAAACTGAATAGGTTAATCGAGAAAACGAACGAGAAATTCCATCAAATCGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTCGAGAAATATGTTGAAGACACTAAAATAGATCTCTGGTCGTACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAGAACAAGGAAGCAACTGAGGGAAAATGCTGAGGACATGGGCAATGGTTGCTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGGTCAATCAGAAATGGAACTTATGACCATGATGTATACAGAGACGAAGCATTAAACAACCGGTTCCAGATCAAAGGTGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGTTTTGCTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>CY011824
+ATGAAGACTATCATTGCTTTGAGCTACATTTTATGTCTGGTTTTCGCTCAAAAACTTCCCGGAAATGACAACAGCACAGCAACGCTGTGCCTGGGACACCATGCAGTGCCAAACGGAACGCTAGTGAAAACAATCACGAATGATCAAATTGAAGTGACTAATGCTACTGAGCTGGTTCAGAGTTCCCCAACAGGTAGAATATGCGACAGTCCTCACCGAATCCTTGATGGAAAGAACTGCACACTGATAGATGCTCTATTGGGAGACCCTCATTGTGATGGCTTCCAAAATAAGGAATGGGACCTTTTTGTTGAACGCAGCAAAGCTTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCAGGCACCCTGGAGTTTACCAACGAAAACTTCAATTGGACTGGAGTCGCTCAGGATGGGAAAAGCTATGCTTGCAAAAGGGGATCTGTTAACAGTTTCTTTAGTAGATTGAATTGGTTGCACAAATTAGAATACAAATATCCAGCGCTGAACGTGACTATGCCAAACAATGGCAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGAGCACGGACAGTGACCAAACCAGCCTATATGTCCGAGCATCAGGGAAAGTCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGGATATCGGGTATAGACCATGGGTAAGGGGTCTGTCCAGTAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAATAGCACAGGGAATCTAATTGCTCCTCGGGGTTACTTCAAAATACGAAATGGGAAAAGCTCAATAATGAGGTCAGATGCACCCATTGGCAACTGCAGTTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCTTTTCAAAATGTAAACAGGATAACATATGGGGCCTGCCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGGAATGTACCAGAGAAACAAACTAGAGGCATATTCGGCGCAATCGCAGGTTTCATAGAAAATGGTTGGGAGGGAATGGTAGACGGTTGGTACGGTTTCAGGCATCAGAATTCTGAGGGCACAGGACAAGCTGCAGATCTTAAAAGCACTCAAGCAGCAATCGACCAAATCAACGGGAAACTGAATAGGTTAGTCGAGAAAACGAACGAGAAATTCCATCAAATCGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTCGAGAAATATGTTGAAGACACTAAAATAGATCTCTGGTCTTACAATGCGGAGCTTCTTGTTGCTCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTATTTGAAAGAACAAGGAAGCAACTGAGGGAAAATGCTGAGGACATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGGTCAATCAGAAATGGAACTTATGACCATGATGTATACAGAGACGAAGCATTAAACAACCGGTTCCAGATCAAAGGTGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGCTTTTTGCTTTGTGTGGTTTTGCTTGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>CY172823
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCTGGAAATGACAACAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCAAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTGAAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTCCAAAATAAGAAATGGGACCTTTTTGTTGAACGCAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCACTCAAAACGGAACAAGCTCTGCTTGCATAAGGAGATCTAATAACAGTTTCTTTAGTAGATTGAATTGGTTGACCCACTTAAAATTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAAAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAATGACCAAGTCTTCCTGTATGCTCAAGCATCAGGAAGAATCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGATCTAGACCCAGAGTAAGGAATATCCCCAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTAAAATTGGCAACAGGGATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATCGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAATAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATAGGTTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTCGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACCAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCACGATGTATACAGAGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGCGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>GQ385889
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCTGGAAATGACAACAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCAAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTGAAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTCCAAAATAAGAAATGGGACCTTTTTGTTGAACGCAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCACTCAAAACGGAACAAGCTCTGCTTGCATAAGGAGATCTAATAACAGTTTCTTTAGTAGATTGAATTGGTTGACCCACTTAAAATTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAACAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGAACAATGACCAAATCTTCCTGTATGCTCAAGCATCAGGAAGAATCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGATCTAGGCCCAGAGTAAGGGAAATCCCTAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGGGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAGTAATGAGATCAGATGCACCCATTGGCAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCATGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATCGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGATGGTTGGTACGGTTTCAGGCATCAAAATTCCGAGGGAAGAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATAGATTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTCGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACACACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCACGATGTATACAGAGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGAGTTGAGCTGAAGTCAGGGTACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>CY007979
+ATGAAGACTATCATTGCTTTGAGCTACATTTTATGTCTGGTTTTCGCTCAAAAACTTCCCGGAAATGACAACAGCATGGCAACGCTGTGCCTGGGACACCATGCAGTGCCAAACGGAACGCTAGTGAAAACAATCACGAATGACCAAATTGAAGTGACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTAGAATATGCGACAGTCCTCACCGAATCCTTGATGGAGAAAACTGCACACTGATAGATGCTCTATTGGGAGACCCTCATTGTGATGGCTTCCAAAATAAGGAATGGGACCTTTTTGTTGAACGCAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACCCTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCGCTCAGAATGGAACAAGCTATGCTTGCAAAAGGAGATCTATTAAAAGTTTCTTTAGTAGATTGAATTGGTTGCACCAATTAAAATACAAATATCCAGCACTGAACGTGACTATGCCAAACAATGACGAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGAGTACGGACAGTGACCAAACCAGCCTATATGCTCAAGCATCAGGGAGAGTCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGATCTAGACCCTGGGTAAGGGGTGTCTCCAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTCGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGGTCAGATGCACCCATTGGCAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTTCAAAATGTAAACAGGATCACATATGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGGAATGTACCAGAGAAGCAAACTAGAGGCATATTCGGCGCAATCGCAGGTTTCATAGAAAATGGTTGGGAGGGAATGGTAGACGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGCACAGGACAAGCAGCAGATCTTAAAAGCACTCAAGCAGCAATCAACCAAATCAACGGGAAACTGAATAGGTTAATCGAGAAAACGAACGAGAAATTCCATCAAATTGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTCGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCGTACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAGAACAAGGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGGTCAATCAGAAATGGAACTTATGACCATGATGTATACAGAGACGAAGCATTAAACAACCGGTTCCAGATCAAAGGTGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGTTTTGCTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>KJ667974
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCTGGAAATGACAATAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCGAATTGAAGTTACTAATGCTACTGAGCTTGTTCAGAATTCCTCAATAGGTGAAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTTCAAAATAAGAAGTGGGACCTTTTTGTTGAACGAAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGGCTGGAGTCACTCAAAACGGAACAAGTTCTGCTTGCATAAGGGGATCTAATAGTAGTTTCTTTAGTAGATTAAATTGGTTGACCCACTTAAACTTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAACAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAAGGACCAAATCTTCCTGTATGCTCAATCATCAGGAAGAATCACAGTATCTACTAAAAGAAGCCAACAAGCTGTAATCCCGAATATCGGATCTAGACCCAGAATAAGGAATATCCCTAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAAGTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGACTGTCCCAGATATGTTAAGCAAAGCACTCTGAAATTGGCAACAGGAATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATAGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAAGAGGACAAGCAGCAGATCTAAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATCGATTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACAAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCACGATGTATACAGGGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGAGTTGAGTTGAAGTCAGGGTACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAGGGCAACATTAGGTGCAACATTTGCATT
+>CY006163
+ATGAAGACTATCATTGCTTTGAGCTACATTTTATGTCTGGTTTTCGCTCAAAAACTTCCCGGAAATGACAACAGCACGGCAACGCTGTGCCTGGGGCACCATGCAGTGCCAAACGGAACGCTAGTGAAAACAATCACGAATGACCAAATTGAAGTGACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTAGAATATGCGACAGTCCTCACCAAATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCATTGTGATGGCTTCCAAAATAAGGAATGGGACCTTTTTGTTGAACGCAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCGCTCAGAATGGAACAAGCTCTGCTTGCAAAAGGAGATCTAATAAAAGTTTCTTTAGTAGATTGAATTGGTTGCACCAATTAAAATACAAATATCCAGCACTGAACGTGACTATGCCAAACAATGAAAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGAGTACGGACAGTGACCAAATCAGCCTATATGCTCAAGCATCAGGGAGAGTCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGATCTAGACCCTGGGTAAGGGGTGTCTCCAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTCGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGGTCAGATGCACCCATTGGCAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTTCAAAATGTAAACAGGATCACATATGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGGAATGTACCAGAGAAACAAACTAGAGGCATATTCGGCGCAATCGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGACGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGCACAGGACAAGCAGCAGATCTTAAAAGCACTCAAGCAGCAATCAACCAAATCAACGGGAAACTGAATAGGTTAATCGAGAAAACGAACGAGAAATTCCATCAAATTGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTCGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCGTACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAGAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGGTCAATCAGAAATGGAACTTATGACCATGATGTATACAGAGACGAAGCATTAAACAACCGGTTCCAGATCAAAGGTGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTATTGCTTTGCTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACGTTTGCATT
+>KF790037
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCTGGAAATGACAATAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCGAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAATTCCTCAATAGGTGAAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTTCAAAATAAGAAATGGGACCTTTTTGTTGAACGAAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGGCTGGAGTCACTCAAAACGGAACAAGTTCTGCTTGCATAAGGGGATCTAATAGTAGTTTCTTTAGTAGATTAAATTGGTTGACCCACTTAAACTTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAACAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAAGGACCAAATCTTCCTGTATGCTCAATCATCAGGAAGAATCACAGTATCTACCAAAAGAAGCCAACAAGCTGTAATCCCGAATATCGGATCTAGACCCAGAATAAGGAATATCCCTAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAAGTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAGCACTCTGAAATTGGCAACAGGAATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATAGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGATGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAAGAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATCGATTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACAAAAATAGATCTCTGGTCATACAACGCAGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGCTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCACGATGTATACAGGGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGAGTTGAGCTGAAGTCAGGGTACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAGGGCAACATTAGGTGCAACATTTGCATT
+>CY112605
+ATGAAGACTATCATTGCTTTGAGCTACATTTTATGTCTGGTTTTCGCTCAAAAACTTCCCGGAAATGACAACAGCACAGCAACGCTGTGCCTGGGACACCATGCAGTGCCAAACGGAACGCTAGTGAAAACAATCACGAATGATCAAATTGAAGTGACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTAGAATATGCGACAGTCCTCACCGAATCCTTGATGGAAAAAACTGCACACTGATAGATGCTCTATTGGGAGACCCTCATTGTGATGGCTTCCAAAATAAGGAATGGGACCTTTTTGTTGAACGCAGCAAAGCTTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCAGGCACCCTGGAGTTTATCAATGAAGACTTCAATTGGACTGGAGTCGCTCAGGATGGGAAAAGCTATACTTGCAAAAGGGGATCTGTTAACAGTTTCTTTAGTAGATTGAATTGGTTGCACAAATTAGAATACAAATATCCAGCGCTGAACGTGACTATGCCAAACAATGGCAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGAGCACGGACAGTGACCAAACCAGCCTATATGTTCGAGCATCAGGGAGAGTCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGGTCTAGACCCTGGGTAAGGGGTCTGTCCAGTAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAATAGCACAGGGAATCTAATTGCTCCTCGGGGTTACTTCAAAATACGAAATGGGAAAAGCTCAATAATGAGGTCAGATGCACCCATTGGCAACTGCAGTTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCTTTTCAAAATGTAAACAGGATCACATATGGGGCCTGCCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGGAATGTACCAGAGAAACAAACTAGAGGCATATTCGGCGCAATCGCAGGTTTCATAGAAAATGGTTGGGAGGGAATGGTAGACGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGCACAGGACAAGCAGCAGATCTTAAAAGCACTCAAGCAGCAATCGACCAAATCAACGGGAAACTGAATAGGTTAATCGAGAAAACGAACGAGAAATTCCATCAAATCGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTCGAGAAATATGTTGAAGACACTAAAATAGATCTCTGGTCTTACAATGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAGAACAAGGAAGCAACTGAGGGAAAATGCTGAGGACATGGGCAATGGTTGCTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGGTCAATCAGAAATGGAACTTATGACCATGATGTATACAGAGACGAAGCATTAAACAACCGGTTCCAGATCAAAGGTGTTGAACTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGCTTTTTGCTTTGTGTTGTTTTGCTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>CY020069
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCCGGAAATGACAACAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCAAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTGGAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTCCAAAATAAGAGATGGGACCTTTTTGTTGAACGCAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCACTCAAAATGGAACAAGCTCTGCTTGCAAAAGGAGATCTAATAACAGTTTCTTTAGTAGATTGAATTGGTTGACCCACTTAAAATTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAAAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAATGACCAAATCTTCCTGTATGCTCAAGCATCAGGAAGAATCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGATCTAGACCCAGAGTAAGGAATATCCCCAGCAGAATAAGCATCTATTGGACAATAGTAAAACCAGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTTCAAAATGTAAACAGGATCACATATGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATCGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAATAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCAATCAAATCAATGGGAAGCTGAATAGGTTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTCGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAGAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCATGATGTATACAGAGATGAAGCATTAAACAACCGGTTCCAGATCAAAGGCGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>KF790414
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCTGGAAATGACAATAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCGAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAATTCCTCAATAGGTGAAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCACTATTGGGAGACCCTCAGTGTGATGGCTTTCAAAATAAGAAATGGGACCTTTTTGTTGAACGAAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGGCTGGAGTCACTCAAAACGGAACAAGTTCTGCTTGCATAAGGGGATCTAATAGTAGTTTCTTTAGTAGATTAAATTGGTTGACCCACTTAAACTTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAACAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAAGGACCAAATCTTCCTGTATGCTCAATCATCAGGAAGAATCACAGTATCTACCAAAAGAAGCCAACAAGCTGTAATCCCGAATATCGGATCTAGACCCAGAATAAGGAATATCCCTAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAAGTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAGCACTCTGAAATTGGCAACAGGAATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATAGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAAGAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATCGGTTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACAAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCACGATGTATACAGGGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGAGTTGAGCTGAAGTCAGGGTACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAGGGCAACATTAGGTGCAACATTTGCATT
+>CY172903
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCCGGAAATGACAACAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCAAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTGAAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTCCAAAATAAGAAATGGGACCTTTTTGTTGAACGCAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCACTCAAAACGGAACAAGCTCTGCTTGCATAAGGAGATCTAATAACAGTTTCTTTAGTAGATTGAATTGGTTGACCCACTTAAAATTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAAAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAATGACCAAATCTTCCTGTATGCTCAAGCATCAGGAAGAATCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGATCTAGACCCAGAGTAAGGAATATCCCCAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGAAATCTAATTGCTCCTAGGGGTTACTTCAAAATACAAAGTGGGAAAAGCTCAGTAATGAGATCAGATGCACCCATTGGCAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATCGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAATAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATAGGTTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAGTTCTCAGAAGTCGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACCAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCACGATGTATACAGAGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGCGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>CY183065
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCTGGAAATGACAATAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCGAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAATTCCTCAATAGGTGAAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTCCAAAATAAGAAATGGGACCTTTTTGTTGAACGAAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCACTCAAAACGGAACAAGTTCTGCTTGCATAAGGAGATCTAATAGTAGTTTCTTTAGTAGATTAAATTGGTTGACCCACTTAAACTTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAACAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAAGGACCAAATCTTCCTGTATGCTCAATCATCAGGAAGAATCACAGTATCTACCAAAAGAAGCCAACAAGCTGTAATCCCGAATATCGGATCTAGACCCAGAATAAGGAATATCCCTAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAGAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAAGTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAGCACTCTGAAATTGGCAACAGGAATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATAGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAAGGAAGAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATCGATTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCATACAACGCAGAGCTTCTTGTTGCCCTAGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCACGATGTATACAGAGATGAAGCACTAAACAACCGGTTCCAGATCAAGGGAGTTGAGCTGAAGTCAGGGTACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAGGGCAACATTAGGTGCAACATTTGCATT
+>CY172839
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCTGGAAATGACAACAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCAAGTTGAAGTTACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTGAAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAATGTGATGGCTTCCAAAATAAGAAATGGGACCTTTTTGTTGAACGCAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCACTCAAAACGGAACAAGCTCTGCTTGCATAAGGAGATCTAATAACAGTTTCTTTAGTAGATTGAATTGGTTGACCCACTTAAAATTCAAATATCCAGCATTGAACGTGACTATGCCAAACAATGAAAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAATGACCAAATCTTCCTGTATGCTCAAGCATCAGGAAGAATCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGATCTAGACCCAGAGTAAGGAATATCCCCAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATCGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAATAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATAGGTTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTCGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACCAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCACGATGTATACAGAGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGCGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>GQ385891
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCTGGAAATGACAACAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCAAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTGAAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTCCAAAATAAGAAATGGGACCTTTTTGTTGAACGAAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCACTCAAAACGGAACAAGCTCTGCTTGCATAAGGAGATCTAATAACAGTTTCTTTAGTAGATTGAATTGGTTGACCCACTTAAAATTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAACAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAATGACCAAATCTTCCTGTATGCTCAAGCATCAGGAAGAATCACAGTATCTACCAAAAGAAGCCAACAAACTGTCATCCCGAATATCGGATCTAGACCCAGAGTAAGGAATATCCCTAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAGTAATGAGATCAGATGCACCCATTGGCAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGAATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATAGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAAGAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATAGATTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTCGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCACGATGTATACAGAGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGAGTTGAGCTGAAGTCAGGGTACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>CY168407
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCTGGAAATGACAATAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCGAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAATTCCTCAATAGGTGAAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAATGTGATGGCTTCCAAAATAAGAAATGGGACCTTTTTGTTGAACGAAGCAAAGCCTACAGCAACTGTTACCCGTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACAGGAGTCACTCAAAACGGAACAAGTTCTGCTTGCATAAGGAGATCTAATAGTAGTTTCTTTAGTAGATTAAATTGGTTGACCCACTTAAACTTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAACAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAAGGACCAAATCTTCCTGTATGCTCAATCATCAGGAAGAATCACAGTATCTACCAAAAGAAGCCAACAAGCTGTAATCCCGAATATCGGATCTAGACCCAGAATAAGGAATATCCCTAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAAGTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAGCACTCTGAAATTGGCAACAGGAATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATAGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAAGAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGGAAGCTAAATCGATTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTAGAAGGAAGAATTCAGGACCTTGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTCGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCACAATGTATACAGAGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGAGTTGAGCTGAAGTCAGGGTACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAGGGCAACATTAGGTGCAACATTTGCATT
+>FJ179356
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCTGGAAATGACAACAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCAAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGGGTTCCTCAACAGGTGAAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTCCAAAATAAGAAATGGGACCTTTTTGTTGAACGCAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCACTCAAAACGGAACAAGCTCTGCTTGCATAAGGAGATATAATAACAGTTTCTTTAGTAGATTGAATTGGTTGACCCACTTAAAATTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAACAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAATGACCAAATCTTCCTGTATGCTCAAGCATCAGGGAGAATCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGATCTAGACCCAGAGTAAGGGATATCCCTAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATCGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAAGAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATAGATTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTCGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGGAATGGAACTTATGACCACGATGTATACAGAGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGAGTTGAGCTGAAGTCAGGGTACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTTTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>FJ179354
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCTGGAAATGACAACAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCAAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTGAAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTCCAAAATAAGAAATGGGACCTTTTTGTTGAACGCAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCACTCAAAACGGAACAAGCTCTTCTTGCATAAGGAGATCTAATAACAGTTTCTTTAGTAGATTGAATTGGTTGACCCACTTAAAATTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAACAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAATGACCAAATCTTCCTGTATGCTCAAGCATCAGGAAGAATCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGATCTAGACCCAAAGTAAGGAATATCCCTAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGAGCAATCGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAAGAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATAGATTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTCGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCATACAACGCGGAACTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCACGATGTATACAGAGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGAGTTGAGCTGAAGTCAGGGTACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCACGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>KF551075
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCTGGAAATGACAATAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCAAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAATTCCTCAATAGGTGAAATATGCAACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTCCAAAATAAGAAATGGGACCTTTTTGTTGAACGAAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCACTCAAAACGGAACAAGTTCTGCTTGCATAAGGAGATCTAATAATAGTTTCTTTAGTAGATTAAATTGGTTGACCCACTTAAACTTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAACAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAAGGACCAAATCTTCCTGTATGCTCAATCATCAGGAAGAATCACAGTATCTACCAAAAGAAGCCAACAAGCTGTAATCCCGAATATCGGATCTAGACCCAGAATAAGGAATATCCCTAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACAAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAAGTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAGCACTCTGAAATTGGCAACAGGAATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATAGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAAGAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATCGATTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCACGATGTATACAGAGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGAGTTGAGCTGAAGTCAGGGTACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAGGGCAACATTAGGTGCAACATTTGCATT
+>EU779522
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCTGGAAATGACAACAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCAAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTGAAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTCCAAAATAAGAAATGGGACCTTTTTGTTGAACGAAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCACTCAAAACGGAACAAGCTCTTCTTGCATAAGGAGATCTAATAACAGTTTCTTTAGTAGATTGAATTGGTTGACCCACTTAAAATTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAACAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAATGACCAAATCTTCCTGTATGCTCAAGCATCAGGAAGAATCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGATCTAGACCCAGAGTAAGGAATATCCCTAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGAGCAATCGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAAGAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGAGAAGCTGAATAGATTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTCGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCACGATGTATACAGAGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGAGTTGAGCTGAAGTCAGGGTACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>CY173191
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCTGGAAATGACAACAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCAAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTGAAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTCCAAAATAAGAAATGGGACCTTTTTGTTGAACGCAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCACTCAAAACGGAACAAGCTCTGCTTGCATAAGGAGATCTAATAACAGTTTCTTTAGTAGATTGAATTGGTTGACCCACTTAAAATTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAACAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAATGACCAAATCTTCCTGTATGCTCAAGCATCAGGAAGAATCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGATCTAGACCCAGAGTAAGGAATATCCCTAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATCGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAAGAGGGCAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATAGATTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTCGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACCAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCACGATGTATACAGAGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGAGTTGAGCTGAAGTCAGGGTACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>CY141224
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCTGGAAATGACAATAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCGAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAATTCCTCAATAGGTGAAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTTCAAAATAAGAAATGGGACCTTTTTGTTGAACGAAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGGCTGGAGTCACTCAAAACGGAACAAGTTCTGCTTGCATAAGGGGATCTAATAGTAGTTTCTTTAGTAGATTAAATTGGTTGACCCACTTAAACTTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAACAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAAGGACCAAATCTTCCTGTATGCTCAATCATCAGGAAGAATCACAGTATCTACCAAAAGAAGCCAACAAGCTGTAATCCCGAATATCGGATCTAGACCCAGAATAAGGAATATCCCTAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAAGTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATATGGGGCCTGTCCCAGATATGTTAAGCAAAGCACTCTGAAATTGGCAACAGGAATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATAGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGATGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAAGAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATCGATTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACAAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCACGATGTATACAGGGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGAGTTGAGCTGAAGTCAGGGTACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTCTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAGGGCAACATTAGGTGCAACATTTGCATT
+>KC892174
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCTGGAAATGACAATAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCGAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAATTCCTCAATAGGTGAAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTCCAAAATAAGAAATGGGACCTTTTTGTTGAACGAAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCACTCAAAACGGAACAAGTTCTGCTTGCATAAGGAGATCTAATAATAGTTTCTTTAGTAGATTAAATTGGTTGACCCACTTAAACTTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAACAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAAGGACCAAATCTTCCTGTATGCTCAATCATCAGGAAGAATCACAGTATCTACCAAAAGAAGCCAACAAGCTGTAATCCCGAATATCGGATCTAGACCCAGAATAAGGAATATCCCTAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAAGTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAGCACTCTGAAATTGGCAACAGGAATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATAGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGATGGTTGGTACGGTTTCAGGCACCAAAATTCTGAGGGAAGAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATCGATTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCACGATGTATACAGAGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGAGTTGAGCTGAAGTCAGGGTACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAGGGCAACATTAGGTGCAACATTTGCATT
+>CY001920
+ATGAAGACTATCATTGCTTTGAGCTACATTTTATGTCTGGTTTTCGCTCAAAAACTTCCCGGAAATGACAACAGCACGGCAACGCTGTGCCTGGGGCACCATGCAGTGCCAAACGGAACGCTAGTGAAAACAATCACGAATGACCAAATTGAAGTGACTAATGCTACCGAGCTGGTTCAGAGTTCCTCAACAGGTAGAATATGCGACAGTCCTCACCAAATCCTTGATGGAGGAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCATTGTGATGGCTTCCAAAATAAGGAATGGGACCTTTTTGTTGAACGCAGCAAAGTCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCGCTCAGAATGGAACAAGCTCTGCTTGCAAAAGGAGATCTATTAAAAGTTTCTTTAGTAGATTGAATTGGTTGCACCAATTAAAATACAAATATCCAGCACTGAACGTGACTATGCCAAACAATGAAAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGAGTACGGACAGTGACCAAATCAGCCTATATGCTCAAGCATCAGGGAGAGTCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGATCTAGACCCTGGGTAAGGGGTGTCTCCAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTCGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGGTCAGATGCACCCATTGGCAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTTCAAAATGTAAACAGGATCACATATGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGGAATGTACCAGAGAAACAAACTAGAGGCATATTCGGCGCAATCGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGACGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGCACAGGACAAGCAGCAGATCTTAAAAGCACTCAAGCAGCAATCAACCAAATCAACGGGAAACTGAATAGGTTAATCGAGAAAACGAACGAGAAATTCCATCAAATTGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGATCTCGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCGTACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAGAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTTAAAATATACCACAAATGTGACAATGCCTGCATAGGGTCAATCAGAAATGGAACTTATGACCATGATGTATACAGAGACGAAGCATTAAACAACCGGTTCCAGATCAAAGGTGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGTTTTGCTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>KF790408
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCTGGAAATGACAATAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCGAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAATTCCTCAATAGGTGAAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTTCAAAATAAGAAATGGGACCTTTTTGTTGAACGAAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGGCTGGAGTCACTCAAAACGGAACAAGTTCTTCTTGCATAAGGGGATCTAATAGTAGTTTCTTTAGTAGATTAAATTGGTTGACCCACTTAAACTTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAACAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAAGGACCAAATCTTCCTGTATGCTCAATCATCAGGAAGAATCACAGTATCTACCAAAAGAAGCCAACAAGCTGTAATCCCGAATATCGGATCTAGACCCAGAATAAGGAATATCCCTAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAAGTCTGAATGCATCACTCCAAATGGAAGCATTCCTAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAGCACTCTGAAATTGGCAACAGGAATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATAGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAAGAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATCGATTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACAAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCACGATGTATACAGGGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGAGTTGAGCTGAAGTCAGGGTACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAGGGCAACATTAGGTGCAACATTTGCATT
+>CY168471
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTAGTTTTCGCTCAAAAACTTCCTGGAAATGACAATAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCGAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAATTCCTCAATAGGTGAAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTCCAAAATAAGAAATGGGACCTTTTTGTTGAACGAAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCACTCAAAACGGAACAAGTTCTGCTTGCATAAGGAGATCTAATAATAGTTTCTTTAGTAGATTAAATTGGTTGACCCACTCAAACTTCAAATACCCAGCATTGAACATGACTATGCCAAACAATGAACAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAAGGACCAAATCTTCCTGTATGCTCAATCATCAGGAAGAATCACAGTATCTACCAAAAGAAGCCAACAAGCTGTAATCCCGAATATCGGATCTAGACCCAGAATAAGGAATATCCCTAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAAGTCTGAATGCATCACTCCAAACGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAGCACTCTGAAATTGGCAACAGGAATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGTGCAATAGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGATGGATGGTTGGTACGGTTTCAGGCACCAAAATTCTGAGGGAAGAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATCGATTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTTTCAGAAGTAGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCACGATGTATACAGAGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGAGTTGAGCTGAAGTCAGGGTACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAGGGCAACATTAGGTGCAACATTTGCATT
+>CY011328
+ATGAAGACTATCATTGCTTTGAGCTACATTTTATGTCTGGTTTTCGCTCAAAAACTTCCCGGAAATGACAACAGCACAGCAACGCTGTGCCTGGGACACCATGCAGTGCCAAACGGAACGCTAGTGAAAACAATCACGAATGATCAAATTGAAGTGACTAATGCTACTGAGCTGGTTCAGAGTTCCCCAACAGGTAGAATATGCGACAGTCCTCACCGAATCCTTGATGGAAAGAACTGCACACTGATAGATGCTCTATTGGGAGACCCTCATTGTGATGGCTTCCAAAATAAGGAATGGGACCTTTTTGTTGAACGCAGCAAAGCTTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCAGGCACCCTGGAGTTTACCAACGAAAACTTCAATTGGACTGGAGTCGCTCAGGATGGGAAAAGCTATGCTTGCAAAAGGGGATCTGTTAACAGTTTCTTTAGTAGATTGAATTGGTTGCACAAATTAGACTACAAATATCCAGCGCTGAACGTGACTATGCCAAACAATGGCAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGAGCACGGACAGTGACCAAACCAGCCTATATGTCCGAGCATCAGGGAAAGTCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGGATATCGGGTATAGACCATGGGTAAGGGGTCTGTCCAGTAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAATAGCACAGGGAATCTAATTGCTCCTCGGGGTTACTTCAAAATACGAAATGGGAAAAGCTCAATAATGAGGTCAGATGCACCCATTGGCAACTGCAGTTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCTTTTCAAAATGTAAACAGGATCACATATGGGGCCTGCCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGGAATGTACCAGAGAAACAAACTAGAGGCATATTCGGCGCAATCGCAGGTTTCATAGAAAATGGTTGGGAGGGAATGGTAGACGGTTGGTACGGTTTCAGGCATCAGAATTCTGAGGGCACAGGACAAGCTGCAGATCTTAAAAGCACTCAAGCAGCAATCGACCAAATCAACGGGAAACTGAATAGGTTAGTCGAGAAAACGAACGAGAAATTCCATCAAATCGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTCGAGAAATATGTTGAAGACACTAAAATAGATCTCTGGTCTTACAATGCGGAGCTTCTTGTTGCTCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTATTTGAAAGAACAAGGAAGCAACTGAGGGAAAATGCTGAGGACATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGGTCAATCAGAAATGGAACTTATGACCATGATGTATACAGAGACGAAGCATTAAACAACCGGTTCCAGATCAAAGGTGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGCTTTTTGCTTTGTTTTGTTTTGCTTGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>CY002080
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCCGGAAATGACAACAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCAAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTGGAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTCCAAAATAAGAAATGGGACCTTTTTGTTGAACGCAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCACTCAAAATGGAACAAGCTCTGCTTGCAAAAGGAGATCTAATAACAGTTTCTTTAGTAGATTGAATTGGTTGACCCACTTAAAATTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAAAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAATGACCAAATCAGCCTATATGCTCAAGCATCAGGAAGAATCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGATCTAGACCCAGGGTAAGGGATATCCCCAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTCGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTTCAAAATGTAAACAGGATCACATATGGGGCCTGTCCCAGATATGTTAAGCAAAACACCCTGAAATTGGCAACAGGGATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATCGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAATAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCAACCAAATCAATGGGAAGCTGAATAGGTTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTCGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAGAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGGTCAATCAGAAATGGAACTTATGACCATGATGTATACAGAGATGAAGCATTAAACAACCGGTTCCAGATCAAAGGTGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>CY036847
+ATGAAGACTATCATTGCTTTGAGCTACATTTTATGTATGGTTTTCGCTCAAAAACTTCCCGGAAATGACAACAGCACGGCAACGCTGTGCCTGGGACACCATGCAGTGCCAAACGGAACGCTAGTGAAAACAATCACGAATGACCAAATTGAAGTGACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTAGAATATGCGACAGTCCTCACCGAATCCTTGATGGAAAAAACTGCACACTGATAGATGCTCTATTGGGAGACCCTCATTGTGATGACTTCCAAAATAAGGAATGGGACCTTTTTGTTGAACGCAGCAAAGCTTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACCCTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCGCTCAGAATGGAACAAGCTATGCTTGCAAAAGGAGATCTGTTAAAAGTTTCTTTAGTAGATTGAATTGGTTGCACAAATTAGAATACAAATATCCAGCACTGAACGTGACTATGCCAAACAATGACAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGAGGACGGACAGTGACCAAACCAGCCTATATGTTCAAGCATCAGGGAGAGTCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGATCTAGCCCCTGGGTAAGGGGTGTCTCCAGCAGAATAAGCATCTATTGGACAATAGTAAAACCTGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTCGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGGTCAGATGCACCCATTGGCAACTGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTTCAAAATGTAAACAGGATCACATATGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGGAATGTACCAGAGAAACAAACTAGAGGCATATTCGGCGCAATCGCAGGTTTCATAGAAAATGGTTGGGAGGGAATGGTAGACGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGCACAGGACAAGCAGCAGATCTTAAAAGCACTCAAGCAGCAATCAACCAAATCAACGGGAAACTGAATAGGTTAATCGAGAAAACGAACGAGAAATTCCATCAAATCGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTCGAGAAATATGTTGAAGACACTAAAATAGATCTCTGGTCGTACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAGAACAAGGAAGCAACTGAGGGAAAATGCTGAGGACATGGGCAATGGTTGCTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGGTCAATCAGAAATGGAACTTATGACCATGATGTATACAGAGACGAAGCATTAAACAACCGGTTCCAGATCAAAGGTGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGTTTTGCTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>CY010036
+ATGAAGACTATCATTGCTTTGAGCTACATTTTATGTCTGGTTTTCGCTCAAAAACTTCCCGGAAATGACAACAGCACGGCAACGCTGTGCCTGGGACACCATGCAGTGCCAAACGGAACGCTAGTGAAAACAATCACGAATGACCAAATTGAAGTGACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTAGAATATGCGACAGTCCTCACCGAATCCTTGATGGAAAAAACTGCACACTGATAGATGCTCTATTGGGAGACCCTCATTGTGATGGCTTCAAAAATAAGGAATGGGACCTTTTTGTTGAACGCAGCACAGCTTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACCCTGGAGTTTACCAATGAAGGCTTCAATTGGACTGGAGTCGCTCAGGATGGAACAAGCTATGCTTGCAAAAGGGGATCTGTTAAAAGTTTCTTTAGTAGATTGAATTGGTTGCACAAATTAGAATACAAATATCCAGCACTGAACGTGACTATGCCAAACAATGACAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGAGTACGGACAGTGACCAAACCAGCCTATATGTTCAAGCATCAGGGAGAGTCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGGTCTAGACCCTGGGTAAGGGGTGTCTCCAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTCGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGGTCAGATGCACCCATTGACAACTGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCTTTTCAAAATGTAAACAGGATCACATATGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTAAAATTGGCAACAGGGATGCGGAATGTACCAGAGAAACAAACTAGAGGCATATTCGGCGCAATCGCAGGTTTCATAGAAAATGGTTGGGAGGGAATGGTAGACGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGCACAGGACAAGCAGCAGATCTTAAAAGCACTCAAGCAGCAATCAACCAAATCAACGGGAAACTGAATAGGTTAATCGAGAAAACGAACGAGAAATTCCATCAAATCGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTCGAGAAATATGTTGAAGACACTAAAATAGATCTCTGGTCTTACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAGAACAAGAAAGCAACTGAGGGAAAATGCTGAGGACATGGGCAATGGTTGCTTCAAAATATATCACAAATGTGACAATGCCTGCATAGGGTCAATCAGAAATGGAACTTATGACCATGATGTATACAGAGACGAAGCATTAAACAACCGGTTCCAGATCAAAGGTGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGCTTTTTGCTTTGTGTTGTTTTGCTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>KF790438
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCTGGAAATGACAATAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCAAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAATTCCTCAATAGGTGAAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTTCAAAATAAGAAATGGGACCTTTTTGTTGAACGAAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGGCTGGAGTCACTCAAAACGGAACAAGTTCTGCTTGCATAAGGGGATCTAATAGTAGTTTCTTTAGTAGATTAAATTGGTTGACCCACTTAAACTTCAAGTACCCAGCATTGAACGTGACTATGCCAAACAATGAACAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAAGGACCAAATCTTCCTGTATGCTCAATCATCAGGAAGAATCACAGTATCTACCAAAAGAAGCCAACAAGCTGTAATCCCGAATATCGGATCTAGACCCAGAATAAGGAATATCCCTAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAAGTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAGCACTCTGAAATTGGCAACAGGAATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATAGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAAGGAAGAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATCGATTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAGAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACAAAAATAGATCTCTGGTCATACAACGCAGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCACGATGTATACAGGGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGAGTTGAGCTGAAGTCAGGGTACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAGGGCAACATTAGGTGCAACATTTGCATT
+>CY147305
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCTGGAAATGACAATAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCGAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAATTCCTCAATAGGTGAAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTTCAAAATAAGAAATGGGACCTTTTTGTTGAACGAAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGGCTGGAGTCACTCAAAACGGAACAAGTTCTGCTTGCATAAGGGGATCTAATAGTAGTTTCTTTAGTAGATTAAATTGGTTGACCCACTTAAACTTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAACAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAAGGACCAAATCTTCCTGTATGCTCAATCATCAGGAAGAATCACAGTATCTACCAAAAGAAGCCAACAAGCTGTAATCCCGAATATCGGATCTAGACCCAGAATAAGGAATATCCCTAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAAGTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAGCACTCTGAAATTGGCAACAGGAATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATAGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGATGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAAGAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATCGATTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACAAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGCTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCACGATGTATACAGGGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGAGTTGAGCTGAAGTCAGGGTACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAGGGCAACATTAGGTGCAACATTTGCATT
+>CY147300
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCTGGAAATGACAATAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCGAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAATTCCTCAATAGGTGAAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTTCAAAATAAGAAATGGGACCTTTTTGTTGAACGAAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGGCTGGAGTCACTCAAAACGGAACAAGTTCTGCTTGCATAAGGGGATCTAATAGTAGTTTCTTTAGTAGATTAAATTGGTTGACCCACTTAAACTTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAACAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAAGGACCAAATCTTCCTGTATGCTCAATCATCAGGAAGAATCACAGTATCTACCAAAAGAAGCCAACAAGCTGTAATCCCGAATATCGGATCTAGACCCAGAATAAGGAATATCCCTAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAAGTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAGCACTCTGAAATTGGCAACAGGAATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATAGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGATGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAAGAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATCGATTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACAAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCACGATGTATACAGGGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGAGTTGAGCTGAAGTCAGGGTACAAAAATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAGGGCAACATTAGGTGCAACATTTGCATT
+>CY092217
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCCGGAAATGACAACAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCAAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTGGAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAATTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTCCAAAATAAGAAATGGGACCTTTTTGTTGAACGCAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAATTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCACTCAAAATGGAACAAGCTCTGCTTGCAAAAGGAGATCTAATAGCAGTTTCTTTAGTAGATTGAATTGGTTGACCCACTTAAAATTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAAGAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACATACAATGACCAAATCAGCCTATATGCTCAAGCATCAGGAAGAATCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGGTCTAGACCCAGGGTAAGGGATATCCCCAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTCGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTTCAAAATGTAAACAGGATCACATATGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATCGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAATAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGACCAAATCAATGGGAAGCTGAATAGGTTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTCGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAGAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGGTCAATCAGAAATGGAACTTATGACCATGATGTATACAGAGATGAAGCATTAAACAACCGGTTCCAGATCAAAGGTGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>CY012896
+ATGAAGACTATCATTGCTTTGAGCTACATTTTATGTCTGGTTTTCGCTCAAAAACTTCCCGGAAATGACAACAGCACAGCAACGCTGTGCCTGGGACACCATGCAGTGCCAAACGGAACGCTAGTGAAAACAATCACGAATGATCAAATTGAAGTGACTAATGCTACTGAGCTGGTTCAGAGTTCCCCAACAGGTAGAATATGCGACAGTCCTCACCGAATCCTTGATGGAAAGAACTGCACACTGATAGATGCTCTATTGGGAGACCCTCATTGTGATGGCTTCCAAAATAAGGAATGGGACCTTTTTGTTGAACGCAGCAAAGCTTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCAGGCACCCTGGAGTTTACCAACGAAAACTTCAATTGGACTGGAGTCGCTCAGGATGGGAAAAGCTATGCTTGCAAAAGGGGATCTGTTAACAGTTTCTTTAGTAGATTGAATTGGTTGCACAAATTAGAATACAAATATCCAGCGCTGAACGTGACTATGCCAAACAATGGCAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGAGCACGGACAGTGACCAAACCAGCCTATATGTCCGAGCATCAGGGAAAGTCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGGATATCGGGTATAGACCATGGGTAAGGGGTCTTTCCAGTAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAATAGCACAGGGAATCTAATTGCTCCTCGGGGTTACTTCAAAATACGAAATGGGGAAAGCTCAATAATGAGGTCAGATGCACCCATTGGCAACTGCAGTTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCTTTTCAAAATGTAAACAGGATCACATATGGGGCCTGCCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGGAATGTACCAGAGAAACAAACTAGAGGCATATTCGGCGCAATCGCAGGTTTCATAGAAAATGGTTGGGAGGGAATGGTAGACGGTTGGTACGGTTTCAGGCATCAGAATTCTGAGGGCACAGGACAAGCTGCAGATCTTAAAAGCACTCAAGCAGCAATCGACCAAATCAACGGGAAACTGAATAGGTTAGTCGAGAAAACGAACGAGAAATTCCATCAAATCGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTCGAGAAATATGTTGAAGACACTAAAATAGATCTCTGGTCTTACAATGCGGAGCTTCTTGTTGCTCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTATTTGAAAGAACAAGGAAGCAACTGAGGGAAAATGCTGAGGACATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGGTCAATCAGAAATGGAACTTATGACCATGATGTATACAGAGACGAAGCATTAAACAACCGGTTCCAGATCAAAGGTGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGCTTTTTGCTTTGTGTTGTTTTGCTTGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>CY134996
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCTGGAAATGACAATAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCAAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAATTCCTCAATGGGTGAAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTTCAAAATAAGAAATGGGACCTTTTTGTTGAACGAAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGGCTGGAGTCACTCAAAACGGAACAAGTTCTGCTTGCATAAGGGGATCTAATAGTAGTTTCTTTAGTAGATTAAATTGGTTGACCCACTTAAACTTCAAGTACCCAGCATTGAACGTGACTATGCCAAACAATGAACAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAAGGACCAAATCTTCCTGTATGCTCAATCATCAGGAAGAATCACAGTATCTACCAAAAGAAGCCAACAAGCTGTAATCCCGAATATCGGATCTAGACCCAGAATAAGGAATGTCCCTAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAAGTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAGCACTCTGAAATTGGCAACAGGAATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATAGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAAGAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATCGATTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAGAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACAAAAATAGATCTCTGGTCATACAACGCAGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCACGATGTATACAGGGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGAGTTGAGCTGAAGTCAGGTTACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAGGGCAACATTAGGTGCAACATTTGCATT
+>KF685747
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCTGGAAATGACAATAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCGAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAATTCCTCAATAGGTGAAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTCCAAAATAAGAAATGGGACCTTTTTGTTGAACGAAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCACTCAAAACGGAACAAGTTCTGCTTGCATAAGGAGATCTAATAATAGTTTCTTTAGTAGATTAAATTGGTTGACCCACTCAAACTTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAACAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAAGGACCAAATCTTCCTGTATGCTCAATCATCAGGAAGAATCACAGTATCTACCAAAAGAAGCCAACAAGCTGTAATCCCGAATATCGGATCTAGACCCAGAATAAGGAATATCCCTAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAAGTCTGAATGCATCACTCCAAACGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAGCACTCTGAAATTGGCAACAGGAATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGTGCAATAGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGATGGATGGTTGGTACGGTTTCAGGCACCAAAATTCTGAGGGAAGAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATCGATTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTTTCAGAAGTAGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCACGATGTATACAGAGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGAGTTGAGCTGAAGTCAGGGTACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAGGGCAACATTAGGTGCAACATTTGCATT
+>CY006060
+ATGAAGACTATCATTGCTTTGAGCTACATTTTATGTCTGGTTTTCGCTCAAAAACTTCCCGGAAATGACAACAGCACGGCAACGCTGTGCCTGGGACACCATGCAGTGCCAAACGGAACGCTAGTGAAAACAATCACGAATGACCAAATTGAAGTGACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTAGAATATGCGACAGTCCTCACCGAATCCTTGATGGAGAAAACTGCACACTGATAGATGCTCTATTGGGAGACCCTCATTGTGATGGCTTCCAAAATAAGGAATGGGACCTTTTTGTTGAACGCAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACCCTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCGCTCAGAATGGAACAAGCTCTGCTTGCAAAAGGAGATCTATTAAAAGTTTCTTTAGTAGATTGAATTGGTTGCACCAATTAAAATACAAATATCCAGCACTGAATGTGACTATGCCAAACAATGACAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGAGTACGGACAGTGACCAAACCAGCCTATATGCTCAAGCATCAGGGAGAGTCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGATCTAGACCCTGGGTAAGGGGTGTCTCCAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTCGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGGTCAGATGCACCCATTGGCAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTTCAAAATGTAAACAGGATCACATATGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGGAATGTACCAGAGAAACAAACTAGAGGCATATTCGGTGCAATCGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGACGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGCACAGGACAAGCAGCAGATCTTAAAAGCACTCAAGCAGCAATCAACCAAATCAACGGGAAACTGAATAGGTTAATCGAGAAAACGAACGAGAAATTCCATCAAATTGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTCGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCGTACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAGAACAAGGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGGTCAATCAGAAATGGAACTTATGACCATGATGTATACAGAGACGAAGCATTAAACAACCGGTTCCAGATCAAAGGTGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGTTTTGTGTTGTTTTGCTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>CY141202
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCTGGAAATGACAATAGCACGGCAACGCTGTGCCTTGGACACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCGAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAATTCCTCAATAGGTGAAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAATTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTTCAAAATAAGAAATGGGACCTTTTTGTTGAACGAAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGGCTGGAGTCACTCAAAACGGAACAAGTTCTGCTTGCATAAGGGGATCTAATAGTAGTTTCTTTAGTAGATTAAATTGGTTGACCCACTTAAACTTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAACAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAAGGACCAAATCTTCCTGTATGCTCAATCATCAGGAAGGATCACAGTATCTACCAAAAGAAGCCAACAAGCTGTAATCCCGAATATCGGATCTAGACCCAGAATAAGGAATATCCCTAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAAGTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAGCACTCTGAAATTGGCAACAGGAATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATAGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAAGAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATCGATTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACAAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCACGATGTATACAGGGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGAGTTGAGCTGAAGTCAGGGTACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAGGGCAACATTAGGTGCAACATTTGCATT
+>KC882488
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCTGGAAATGACAACAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCAAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAGCAGGTGAAATATGCAACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTCCAAAATAAGAAATGGGACCTTTTTGTTGAACGAAGCAGAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCACTCAAAACGGAACAAGCTCTGCTTGCATAAGGAGATCTAATAATAGTTTCTTTAGTAGATTGAATTGGTTGACCCACTCAAACTTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAACAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAAGGACCAAATCTTCCTGTATGCTCAAGCATCAGGAAGAATCACAGTATCTACCAAAAGAAGCCAACAAGCTGTAATCCCGAATATTGGATCTAGACCCAGAGTAAGGAATATCCCTAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAGCACTCTGAAATTGGCAACAGGAATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATAGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAAGAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGAAAGCTGAATAGATTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTCGAAGGGAGAATTCAGGATCTTGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCACGATGTATACAGAGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGAGTTGAGCTGAAGTCAGGGTACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>CY001600
+ATGAAGACTATCATTGCTTTGAGCTACATTTTATGTCTGGTTTTCGCTCAAAAACTTCCCGGAAATGACAACAGCACGGCAACGCTGTGCCTGGGGCACCATGCAGTGCCAAACGGAACGCTAGTGAAAACAATCACGAATGACCAAATTGAAGTGACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTAGAATATGCGACAGTCCTCACCAAATCCTTGATGGAGAAAACTGCACACTGATAGATGCTCTATTGGGAGACCCTCATTGTGATGGCTTCCAAAATAAGGAATGGGACCTTTTTGTTGAACGCAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCGCTCAGAATGGAACAAGCTCTGCTTGCAAAAGGAGATCTAATAAAAGTTTCTTTAGTAGATTGAATTGGTTGCACCAATTAAAATACAAATATCCAGCACTGAACGTGACTATGCCAAACAATGAAAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGAGTACGGACAGTGACCAAATCAGCCTATATGCTCAAGCATCAGGGAGAGTCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGATCTAGACCCTGGGTAAGGGGTGTCTCCAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTCGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGGTCAGATGCACCCATTGGCAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTTCAAAATGTAAACAGGATCACATATGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGGAATGTACCAGAGAAACAAACTAGAGGCATATTCGGCGCAATCGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGACGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGCACAGGACAAGCAGCAGATCTTAAAAGCACTCAAGCAGCAATCAACCAAATCAACGGGAAACTGAATAGGTTAATCGAGAAAACGAACGAGAAATTCCATCAAATTGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTCGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCGTACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAGAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGGTCAATCAGAAATGGAACTTATGACCATGATGTATACAGAGACGAAGCATTAAACAACCGGTTCCAGATCAAAGGTGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGTTTTGCTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>CY010028
+ATGAAGACTATTATTGCTTTGAGCTACATTTTATGTCTGGTTTTCGCTCAAAAACTTCCCGGAAATGACAACAGCACGGCAACGCTGTGCCTGGGACACCATGCAGTGCCAAACGGAACGCTAGTGAAAACAATCACGAATGACCAAATTGAAGTGACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTAGAATATGCGACAGTCCTCACCGAATCCTTGATGGAAAAAACTGCACACTGATAGATGCTCTATTGGGAGACCCTCATTGTGATGGCTTCCAAAATAAGGAATGGGACCTTTTTGTTGAACGCAGCAAAGCTTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACCCTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCGCCCAGAATGGAACAAGCTATGCTTGCAAAAGGAGATCTGTTAAAAGTTTCTTTAGTAGATTGAATTGGTTGCACAAATTAGAATACAAATATCCAGCACTGAACGTGACTATGCCAAACAATGACAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGAGTACGGACAGTGACCAAACCAGCCTATATGTTCAAGCATCAGGGAGAGTCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGATCTAGACCCTGGGTAAGGGGTGTCTCCAGCAGGATAAGCATATATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTCGGGGTTACTTCAAAATACGAAGTGGAAAAAGCTCAATAATGAGGTCAGATGCACCCATTGACAACTGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTTCAAAATGTAAACAGGATCACATATGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGGAATGTACCAGAGAAACAAACTAGAGGCATATTCGGCGCAATCGCAGGTTTCATAGAAAATGGTTGGGAGGGAATGGTAGACGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGCACAGGACAAGCAGCAGATCTTAAAAGCACTCAAGCAGCAATCAACCAAATCAACGGGAAACTGAATAGGTTAATCGAGAAAACGAACGAGAAATTCCATCAAATCGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTCGAGAAATATGTTGAAGACACTAAAATAGATCTCTGGTCGTACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAGAACAAGGAAGCAACTGAGGGAAAATGCTGAGGACATGGGCAATGGTTGCTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGGTCAATCAGAAATGGAACTTATGACCATGATGTATACAGAGACGAAGCATTAAACAACCGGTTCCAGATCAAAGGTGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGTTTTGCTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>CY013200
+ATGAAGACTATCATTGCTTTGAGCTACATTTTATGTCTGGTTTTCGCTCAAAAACTTCCCGGAAATGACAACAGCACAGCAACGCTGTGCCTGGGACACCATGCAGTGCCAAACGGAACGCTAGTGAAAACAATCACGAATGATCAAATTGAAGTGACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAGCAGGTAGAATATGCGACAGTCCTCACCGAATCCTTGATGGAAAAAACTGCACACTGATAGATGCTCTATTGGGAGACCCTCATTGTGATGGCTTCCAAAATAAGGAATGGGACCTTTTTGTTGAACGCAGCAAAGCTTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCAGGCACCCTGGAGTTTATCAATGAAGACTTCAATTGGACTGGAGTCGCTCAGGATGGGAAAAGCTATGCTTGCAAAAGGGGATCTGTTAACAGTTTCTTTAGTAGATTGAATTGGTTGCACAAATTAGAATACAAATATCCAGCGCTGAACGTGACTATGCCAAACAATGGCAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGAGCACGGACAGTGACCAAACCAGCCTATATGTTCGAGCATCAGGGAGAGTCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGGTCTAGACCCTGGGTAAGGGGTCTGTCCAGTAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAATAGCACAGGGAATCTAATTGCTCCTCGGGGTTACTTCAAAATACGAAATGGGAAAAGCTCAATAATGAGGTCAGATGCACCCATTGGCAACTGCAGTTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCTTTTCAAAATGTAAACAGGATCACATATGGGGCCTGCCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGGAATGTACCAGAGAAACAAACTAGAGGCATATTCGGCGCAATCGCAGGTTTCATAGAAAATGGTTGGGAGGGAATGGTAGACGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGCACAGGACAAGCAGCAGATCTTAAAAGCACTCAAGCAGCAACCGACCAAATCAACGGGAAACTGAATAGGTTAATCGAGAAAACGAACGAGAAATTCCATCAAATCGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTCGAGAAATATGTTGAAGACACTAAAATAGATCTCTGGTCTTACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAGAACAAGGAAGCAACTGAGGGAAAATGCTGAGGACATGGGCAATGGTTGCTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGGTCAATCAGAAATGGAACTTATGACCATGATGTATACAGAGACGAAGCATTAAACAACCGGTTCCAGATCAAAGGTGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGCTTTTTGCTTTGTGTTGTTTTGCTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>CY009732
+ATGAAGACTATTATTGCTTTGAGCTACATTTTATGTCTGGTTTTCGCTCAAAAACTTCCCGGAAATGACAACAGCACGGCAACGCTGTGCCTGGGACACCATGCAGTGCCAAACGGAACGCTAGTGAAAACAATCACGAATGACCAAATTGAAGTGACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTAGAATATGCGACAGTCCTCACCGAATCCTTGATGGAAAAAACTGCACACTGATAGATGCTCTATTGGGAGACCCTCATTGTGATGGCTTCCAAAATAAGGAATGGGACCTTTTTGTTGAACGCAGCAAAGCTTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACCCTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCGCCCAGAATGGAACAAGCTATGCTTGCAAAAGGAGATCTGTTAAAAGTTTCTTTAGTAGATTGAATTGGTTGCACAAATTAGAATACAAATATCCAGCACTGAACGTGACTATGCCAAACAATGACAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGAGTACGGACAGTGACCAAACCAGCCTATATGTTCAAGCATCAGGGAGAGTCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGATCTAGACCCTGGGTAAGGGGTATCTCCAGCAGAATAAGCATATATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTCGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGGTCAGATGCACCCATTGACAACTGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTTCAAAATGTAAACAGGATCACATATGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGGAATGTACCAGAGAAACAAACTAGAGGCATATTCGGCGCAATCGCAGGTTTCATAGAAAATGGTTGGGAGGGAATGGTAGACGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGCACAGGACAAGCAGCAGATCTTAAAAGCACTCAAGCAGCAATCAACCAAATCAGCGGGAAACTGAATAGGTTAATCGAGAAAACGAACGAGAAATTCCATCAAATCGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTCGAGAAATATGTTGAAGACACTAAAATAGATCTCTGGTCGTACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAGAACAAGGAAGCAACTGAGGGAAAATGCTGAGGACATGGGCAATGGTTGCTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGGTCAATCAGAAATGGAACTTATGACCATGATGTATACAGAGACGAAGCATTAAACAACCGGTTCCAGATCAAAGGTGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGTTTTGCTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>AB434109
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCCGGAAATGACAACAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACAAATGACCAAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTGGAATATGCGACAGTCCTCATCAGATCCTCGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTCCAAAATAAGAAATGGGACCTTTTTGTTGAACGCAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCACTCAGAATGGAACAAGCTCTGCTTGCAAAAGGAGATCTAATAACAGTTTCTTTAGTAGATTGAATTGGTTGACCCACTTAAAATTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAAAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAATGACCAAATCAGCCTATATGCTCAAGCATCAGGAAGAATCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGATCTAGACCCAGGGTAAGGGATATCTCCAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTCGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTTCAAAATGTAAACAGGATCACATATGGGGCCTGCCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGAAATGTACCAGAGACACAAACTAGAGGCATATTTGGCGCAATCGCAGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGACGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGCACAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCAACCAAATCAATGGGAAATTGAATAGGTTAATCGGGAAAACAAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTCGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAGAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGGTCAATCAGAAATGAAACTTATGACCATGATGTATACAGAGATGAAGCTTTAAACAACCGGTTCCAGATCAAAGGTGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>CY006899
+ATGAAGACTATCATTGCTTTGAGCTACATTTTATGTCTGGTTTTCGCTCAAAAACTTCCCGGAAATGACAACAGCACGGCAACGCTGTGCCTGGGACACCATGCAGTGCCAAACGGAACGCTAGTGAAAACAATCACGAATGACCAAATTGAAGTGACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTAGAATATGCGACAGTCCTCACCGAATCCTTGATGGAGAAAACTGCACACTGATAGATGCTCTATTGGGAGACCCTCATTGTGATGGCTTCCAAAATAAGGAATGGGACCTTTTTGTTGAACGCAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACCCTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCGCTCAGAATGGAACAAGCTCTGCTTGCAAAAGGAGATCCATTAAAAGTTTCTTTAGTAGATTGAATTGGTTGCACCAATTAAAATACAAATATCCAGCACTGAACGTGACTATGCCAAACAATGACAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGAGTACGGACAGTGACCAAACCAGCCTATATGCTCAAGCATCAGGGAGAGTCACAGTCTCTACCAGAAGAAGCCAACAAACTGTAATCCCGAACATCGGATCTAGACCCTGGGTAAGGGGTGTCTCCAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTCGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGGTCAGATGCACCCATTGGCAAATGCAATTCTGAATGCATTACTCCAAATGGAAGCATTCCCAATGACAAACCATTTCAAAGTGTAAACAGGATCACATATGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGGAATGTACCAGAGAAACAAACTAGAGGCATATTCGGCGCAATCGCTGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGACGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGCACAGGACAAGCAGCAGATCTTAAAAGCACTCAAGCAGCAATCAACCAAATCAACGGGAAACTGAATAGGTTAATCGAGAAAACGAACGAGAAATTCCATCAAATTGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAAGACCTCGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCGTACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAGAACAAGGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGGTCAATCAGAAATGGAACTTATGACCATGATGTATACAGAGACGAAGCATTAAACAACCGGTTCCAAATCAAAGGTGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGTTTTGCTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>KC535387
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCTGGAAATGACAACAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCAAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAGCAGGTGAAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTCCAAAATAAGAAATGGGACCTTTTTGTTGAACGAAGCAGAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACGATGAAAGCTTCAATTGGACTGGAGTCACTCAAAACGGAACAAGCTCTGCTTGCATAAGGAGATCTAATAATAGTTTCTTTAGTAGATTGAATTGGTTGACCCACTTAAACTTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAACAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAAGGACCAAATCTTCCTGTATGCTCAAGCATCAGGAAGAATCACAGTATCTACCAAAAGAAGCCAACAAGCTGTAATCCCGAATATCGGATCTAGACCCAGAGTAAGGAATATCCCTAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGACCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAGCACTCTGAAATTGGCAACAGGAATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATAGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAAGAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGAAAGCTGAATAGATTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTCGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCACGATGTATACAGAGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGAGTTGAGCTGAAGTCAGGGTACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>KC535363
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCTGGAAATGACAACAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCAAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTGAAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTCCAAAATAAGAAATGGGACCTTTTTGTTGAACGAAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCACTCAAAACGGAACAAGCTCTGCTTGCATAAGGAGATCTAATAATAGTTTCTTTAGTAGATTGAATTGGTTGACCCACTTAAACTTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAACAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAAGGACCAAATCTTCCTGTATGCTCAAGCATCAGGAAGAATCACAGTATCTACCAAAAGAAGCCAACAAGCTGTAATCCCGAATATCGGATCTAGACCCAGAGTAAGGAATATCCCTAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGGCAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGAATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATAGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAAGAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATAGATTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTCGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCACGATGTATACAGAGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGAGTTGAGCTGAAGTCAGGGTACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>KF790049
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCTGGAAATGACAATAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCGAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAATTCCTCAATAGGTGAAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTTCAAAATAAGAAATGGGACCTTTTTGTTGAACGAAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCACTCAAAACGGAACAAGTTCTTCTTGCATAAGGAGATCTAATAGTAGTTTCTTTAGTAGATTAAATTGGTTGACCCACTTAAACTTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAACAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAAGGACCAAATCTTCCTGTATGCTCAATCATCAGGAAGAATCACAGTATCTACCAAAAGAAGCCAACAAGCTGTAATCCCGAATATCGGATCTAGACCCAGAATAAGGAATATCCCTAGCAGAATAAGCATCTATTGGACAATAGTAAAACCAGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAAGTCTGAATGCATCACTCCAAATGGAAGCATTCCAAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAGCACTCTGAAATTGGCAACAGGAATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATAGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAAGAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATCGATTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCACGATGTATACAGGGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGAGTTGAGCTGAAGTCAGGGTACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>JX978746
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCTGGAAATGACAACAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCAAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAATTCCTCAACAGGTGAAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGACTTCCAAAATAAGAAATGGGACCTTTTTGTTGAACGAAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCACTCAAAACGGAACAAGCTCTGCTTGCATAAGGAGATCTGATAGTAGTTTCTTTAGTAGATTGAATTGGTTGACCCACTTAAACTTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAACAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAAGGACCAAATCTTCCTGTATGCTCAAGCATCAGGAAGAATCACAGTATCTACCAAAAGAAGCCAACAAGCTGTGATCCCGAATATCGGATCTAGACCCAGAATAAGGAATATCCCTAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGAAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGAATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATAGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAAGAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATGGATTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTCGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAAAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGCTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATAACCACGATGTATACAGAGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGAGTTGAGCTAAAGTCAGGGTACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>CY010012
+ATGAAGACTATTATTGCTTTGAGCTACATTTTATGTCTGGTTTTCGCTCAAAAACTTCCCGGAAATGACAACAGCACGGCAACGCTGTGCCTGGGACACCATGCAGTGCCAAACGGAACGCTAGTGAAAACAATCACGAATGACCAAATTGAAGTGACTAATGCTACTGAGCTGGTTCAGGGTTCCTCAACAGGTAGAATATGCGACAGTCCTCACCGAATCCTTGATGGAAAAAACTGCACACTGATAGATGCTCTATTGGGAGACCCTCATTGTGATGGCTTCCAAAATAAGGAATGGGACCTTTTTGTTGAACGCAGCAAAGCTTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCAGGCACCCTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCGCCCAGAATGGAACAAGCTATGCTTGCAAAAGGGGATCTGTTAAAAGTTTCTTTAGTAGATTGAATTGGTTGCACAAATTAGAATACAAATATCCAGCACTGAACGTGACTATGCCAAACAATGACAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGAGTACGGACAGTGACCAAACCAGCCTATATGTTCAAGCATCAGGGAGAGTCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGATCTAGACCCTGGGTAAGGGGTGTCTCCAGCAGAATAAGCATATATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTCGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGGTCAGATGCACCCATTGACAACTGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTTCAAAATGTAAACAGGATCACATATGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGGAATGTACCAGAGAAACAAACTAGAGGCATATTCGGCGCAATCGCAGGTTTCATAGAAAATGGTTGGGAGGGAATGGTAGACGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGCACAGGACAAGCAGCAGATCTTAAAAGCACTCAAGCAGCAATCAACCAAATCAACGGGAAACTGAATAGGTTAATCGAGAAAACGAACGAGAAATTCCATCAAATCGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTCGAGAAATATGTTGAAGACACTAAAATAGATCTCTGGTCGTACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAGAACAAGGAAGCAACTGAGGGAAAATGCTGAGGACATGGGCAATGGTTGCTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGGTCAATCAGAAATGGAACTTATGACCATGATGTATACAGAGACGAAGCATTAAACAACCGGTTCCAGATCAAAGGTGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGTTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>CY112556
+ATGAAGACTATCATTGCTTTGAGCTACATTTTATGTCTGGTTTTCGCTCAAAAACTTCCCGGAAATGACAACAGCACAGCAACGCTGTGCCTGGGACACCATGCAGTGCCAAACGGAACGCTAGTGAAAACAATCACGAATGATCAAATTGAAGTGACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTAGAATATGCGACAGTCCTCACCGAATCCTTGATGGAAAAAACTGCACACTGATAGATGCTCTATTGGGAGACCCTCATTGTGATGGCTTCCAAAATAAGGAATGGGACCTTTTTGTTGAACGCAGCAAAGCTTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCAGGCACCCTGGAGTTTATCAATGAAGACTTCAATTGGACTGGAGTTGCTCAGGATGGGAAAAGCTATACTTGCAAAAGGGGATCTGTTAACAGTTTCTTTAGTAGATTGAATTGGTTGCACAAATTAGAATACAAATATCCAGCGCTGAACGTGACTATGCCAAACAATGGCAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGAGCACGGACAGTGACCAAACCAGCCTATATGTTCGAGCATCAGGGAGAGTCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGGTTTAGACCCTGGGTAAGGGGTCTGTCCAGTAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAATAGCACAGGGAATCTAATTGCTCCTCGGGGTTACTTCAAAATACGAAATGGGAAAAGCTCAATAATGAGGTCAGATGCACCCATTGGCAACTGCAGTTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCTTTTCAAAATGTAAACAGGATCACATATGGGGCCTGCCCCAGATATGTTAAGCAAAACACTCTGAAGTTGGCAACAGGGATGCGGAATGTACCAGAGAAACAAACTAGAGGCATATTCGGCGCAATCGCAGGTTTCATAGAAAATGGTTGGGAGGGAATGGTAGACGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGCACAGGACAAGCAGCAGATCTTAAAAGCACTCAAGCAGCAATCGACCAAATCAACGGGAAACTGAATAGGTTAATCGAGAAAACGAACGAGAAATTCCATCAAATCGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTCGAGAAATATGTTGAAGACACTAAAATAGATCTCTGGTCTTACAACGCGGGGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTATTTGAAAGAACAAGGAAGCAACTGAGGGAAAATGCTGAGGACATGGGCAATGGTTGCTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGGTCAATCAGAAATGGAACTTATGACCATGATGTATACAGAGACGAAGCATTAAACAACCGGTTCCAGATCAAAGGTGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGCTTTTTGCTTTGTGTTGTTTTGCTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>KF886352
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCTGGAAATGACAATAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCAAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAATTCCTCAATAGGTGAAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTTCAAAATAAGAAATGGGACCTTTTTGTTGAACGAAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGGCTGGAGTCACTCAAAACGGAACAAGTTCTGCTTGCATAAGGGGATCTAATAGTAGTTTCTTTAGTAGATTAAATTGGTTGACCCACTTAAACTTCAAGTACCCAGCATTGAACGTGACTATGCCAAACAATGAACAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAAGGACCAAATCTTCCTGTATGCTCAATCATCAGGAAGAATCACAGTATCTACCAAAAGAAGCCAACAAGCTGTAATCCCGAATATCGGATCTAGACCCAGAATAAGGAATATCCCTAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAAGTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAGCACTCTGAAATTGGCAACAGGAATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATAGCAGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAAGAGGACAAGCAGCAGATCTCAAAAGCACCCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATCGATTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCATACAACGCAGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCACGATGTATACAGGGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGAGTTGAGCTGAAGTCAGGGTACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAGGGCAACATTAGGTGCAACATTTGCATT
+>CY003632
+ATGAAGACTATCATTGCTTTGAGCTACATTTTATGTCTGGTTTTCGCTCAAAAACTTCCCGGAAATGACAACAGCACGGCAACGCTGTGCCTGGGGCACCATGCAGTGCCAAACGGAACGCTAGTGAAAACAATCACGAATGACCAAATTGAAGTGACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTAGAATATGCGACAGTCCTCACCAAATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCATTGTGATGGCTTCCAAAATAAGGAATGGGACCTTTTTGTTGAACGCAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCGCTCAGAATGGAACAAGCTCTGCTTGCAAAAGGAGATCTAATAAAAGTTTCTTTAGTAGATTGAATTGGTTGCACCAATTAAAATACAAATATCCAGCACTGAACGTGACTATGCCAAACAATGAAAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGAGTACGGACAGTGACCAAATCAGCCTATATGCTCAAGCATCAGGGAGAGTCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGATCTAGACCCTGGGTAAGGGGTGTCTCCAGCGGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTCGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGGTCAGATGCACCCATTGGCAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTTCAAAATGTAAACAGGATCACATATGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGGAATGTACCAGAGAAACAAACTAGAGGCATATTCGGCGCAATCGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGACGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGCACAGGACAAGCAGCAGATCTTAAAAGCACTCAAGCAGCAATCAACCAAATCAACGGGAAACTGAATAGGTTAATCGAGAAAACGAACGAGAAATTCCATCAAATTGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTCGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCGTACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAGAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGGTCAATCAGAAATGGAACTTATGACCATGATGTATACAGAGACGAAGCATTAAACAACCGGTTCCAGATCAAAGGTGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGCTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>CY001744
+ATGAAGACTATCATTGCTTTGAGCTACATTTTATGTCTGGTTTTCGCTCAAAAACTTCCCGGAAATGACAACAGCACGGCAACGCTGTGCCTGGGACACCATGCAGTGCCAAACGGAACGCTAGTGAAAACAATCACGAATGACCAAATTGAAGTGACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTAGAATATGCGACAGTCCTCACCGAATCCTTGATGGAGAAAACTGCACACTGATAGATGCTCTATTGGGAGACCCTCATTGTGATGGCTTCCAAAATAAGGAATGGGACCTTTTTGTTGAACGCAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACCCTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCGCTCAGAATGGAACAAGCTCTGCTTGCAAAAGGAGATCTATTAAAAGTTTCTTTAGTAGATTGAATTGGTTGCACCAATTAAAATACAAATATCCAGCACTGAACGTGACTATGCCAAACAATGACAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGAGTACGGACAGTGACCAAACCAGCCTATATGCTCAAGCATCAGGGAGAGTCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGATCTAGACCCTGGGTAAGGGGTGTCTCCAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTCGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGGTCAGATGCACCCATTGGCAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTTCAAAATGTAAACAGGATCACATATGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAACTGGCAACAGGGATGCGGAATGTACCAGAGAAACAAACTAGAGGCATATTCGGCGCAATCGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGACGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGCACAGGACAAGCAGCAGATCTTAAAAGCACTCAAGCAGCAATCAACCAAATCAACGGGAAACTGAATAGGTTAATCGAGAAAACGAACGAGAAATTCCATCAAATTGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTCGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCGTACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAGAACAAGGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGGTCAATCAGAAATGGAACTTATGACCATGATGTATACAGAGACGAAGCATTAAACAACCGGTTCCAGATCAAAGGTGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGTTTTGCTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>KC535378
+ATGAAGACTATCATTGCTTTGAGCTGCATTCTATGTCTGGTTTTCGCTCAAAAACTTCCTGGAAATGACAACAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCAAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTGAAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTCCAAAATAAGAAATGGGACCTTTTTGTTGAACGAAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCACTCAAAACGGAACAAGCTCTGCTTGCATAAGGAGATCTAATAATAGTTTCTTTAGTAGATTGAATTGGTTGACCCACTTAAACTTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAACAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAAGGACCAAATCTTCCTGTATGCTCAAGCATCAGGAAGAATCACAGTATCTACCAAAAGAAGCCAACAAGCTGTAATCCCGAATATCGGATCTAGACCCAGAGTAAGGAATATCCCTAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACGTACGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGAATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATAGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAAGAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATAGATTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTCGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCACGATGTATACAGAGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGAGTTGAGCTGAAGTCAGGGTACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGCTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>KC892685
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCTGGAAATGACAATAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCGAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAATTCCTCAATAGGTGAAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTCCAAAATAAGAAATGGGACCTTTTTGTTGAACGAAGCAAAGCCTACAGCGACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCACTCAAAACGGAACAAGTTCTGCTTGCATAAGGAGATCTAATAATAGTTTCTTTAGTAGATTAAATTGGTTGACCCACTTAAACTTCAAATACCCAGCATTGAACGTAACTATGCCAAACAATGAACAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAAGGACCAACTCTTCCTGTATGCTCAATCATCAGGAAGAATCACAGTATCTACCAAAAGAAGCCAACAAGCTGTAATCCCGAATATCGGATCTAGACCCAGAATAAGGAATATCCCTAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAAGTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAGCACTCTGAAATTGGCAACAGGAATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATAGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAAGAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATCGATTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACCTATGACCACGATGTATACAGAGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGAGTTGAGCTGAAGTCAGGGTACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAGGGCAACATTAGGTGCAACATTTGCATT
+>KC535375
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCTGGAAATGACAACAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCAAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTGAAATATGCGACAGTCCTCATCAGATCCTTGATGGGGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCCTCCAAAATAAGAAATGGGACCTTTTTGTTGAACGAAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGTCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCACTCAAAACGGAACAAGCTCTGCTTGCATAAGGAGATCTAATAATAGTTTCTTTAGTAGATTGAATTGGTTGACCCACTTAAACTTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAACAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAAGGACCAAATCTTCCTGTATGCTCAAGCATCAGGAAGAATCACAGTATCTACCAAAAGAAGCCAACAAGCTGTAATCCCGAATATCGGATCTAGACCCAGAGTAAGGAATATCCCTAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGAATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATAGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAAGAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATAGATTGATCGGGAAAACCAATGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTCGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCACGATGTATACAGAGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGAGTTGAGCTGAAGTCAGGGTACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>KC892519
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCTGGAAATGACAACAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCAAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTGAAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTCCAAAATAAGAAGTGGGACCTTTTTGTTGAACGAAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCACTCAAAACGGAACAAGCTCTGCTTGCATAAGGAGATCTAATAGTAGTTTCTTTAGTAGATTGAATTGGTTGACCCACTTAAACTTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAACAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAAGGACCAAATCTTCCTGTATGCTCAATCATCAGGAAGAATTACAGTATCTACCAAAAGAAGCCAACAAGCTGTAATCCCGAATATCGGATCTAGACCCAGAATAAGGAATATCCCTAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAGCACTCTGAAATTGGCAACAGGAATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATAGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAAGAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATCGATTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTCGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCTCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGCTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATAACCACGATGTATACAGAGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGAGTTGAGCTGAAGTCAGGGTACAAAGACTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAGGGCAACATTAGGTGCAACATTTGCATT
+>CY006579
+ATGAAGACTATCATTGCTTTGAGCTACATTTTATGTCTGGTTTTCGCTCAAAAACTTCCCGGAAATGACAACAGCACGGCAACGCTGTGCCTGGGACACCATGCAGTGCCAAACGGAACGCTAGTGAAAACAATCACGAATGACCAAATTGAAGTGACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTAGAATATGCGACAGTCCTCACCGAATCCTTGATGGAGAAAACTGCACACTGATAGATGCTCTATTGGGAGACCCTCATTGTGATGGCTTCCAAAATAAGGAATGGGACCTTTTTGTTGAACGCAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACCCTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCGCTCAGAATGGAACAAGCTCTGCTTGCAAAAGGAGATCTATTAAAAGTTTCTTTAGTAGATTGAATTGGTTGCACCAATTAAAATACAAATATCCAGCACTGAACGTGACTATGCCAAACAATGACAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGAGTACGGACAGTGACCAAACCAGCCTATATGCTCAAGCATCAGGGAGAGTCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGATCTAGACCCTGGGTAAGGGGTGTCTCCAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTCGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGGTCAGATGCACCCATTGGCAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTTCAAAATGTAAACAGGATCACATATGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGGAATGTACCAGAGAAACAAACTAGAGGCATATTCGGCGCAATCGCAGGTTTCATAGAAAATGGTTGGGAGGGAATGGTAGACGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGCACAGGACAAGCAGCAGATCTTAAAAGCACTCAAGCAGCAATCAACCAAATCAACGGGAAACTGAATAGGTTAATCGAGAAAACGAACGAGAAATTCCATCAAATTGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTCGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCGTACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAGAACAAGGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGGTCAATCAGAAATGGAACTTATGACCATGATGTATACAGAGATGAAGCATTAAACAACCGGTTCCAGATCAAAGGTGTTGAGCTTAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGTTTTGCTGGGGCTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>CY114309
+ATGAAGACTATCATTGCTTTGAGCTACATTTTATGTCTGGTTTTCGCTCAAAAACTTCCCGGAAATGACAACAGCACGGCAACGCTGTGCCTGGGACACCATGCAGTGCCAAACGGAACGCTAGTGAAAACAATCACGAATGACCAAATTGAAGTGACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTAGAATATGCGACAGTCCTCACCGAATCCTTGATGGAGAAAACTGCACACTGATAGATGCTCTATTGGGAGACCCTCATTGTGATGGCTTCCAAAATAAGGAATGGGACCTTTTTGTTGAACGCAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTACCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACCCTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCGCTCAGAATGGAACAAGCTCTGCTTGCAAAAGGAGATCTATTAAAAGTTTCTTTAGTAGATTGAATTGGTTGCACCAATTAAAATACAAATATCCAGCACTGAACGTGACTATGCCAAACAATGACAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGAGTACGGACAGTGACCAAACCAGCCTATATGCTCAAGCACCAGGGAGAGTCACAGTCTCTACCAGAAGAAGCCAACAAACTGTAATCCCGAATATCGGATCTAGACCCTGGGTAAGGGGTGTCTCCAGCATAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTCGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGGTCAGATGCACCCATTAGCAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTTCAAAATGTAAACAGGATCACATATGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGGAATGTACCAGAGAAACAAACTAGAGGCATATTCGGCGCAATCGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGACGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGCACAGGACAAGCAGCAGATCTTAAAAGCACTCAAGCAGCAATCAACCAAATCAACGGGAAACTGAATAGGTTAATCGAGAAAACAAACGAGAAATTCCATCAAATTGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTCGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCGTACAACGCAGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAGAACAAGGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGGTCAATCAGAAATGGAACTTATGACCATGATGTATACAGAGACGAAGCATTAAACAACCGGTTCCAGATCAAAGGTGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGTTTTGCTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>KF598733
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCTGGAAATGACAATAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCGAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAATTCCTCAATAGGTGAAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTCCAAAATAAGAAATGGGACCTTTTTGTTGAACGAAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCTCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCACTCAAAACGGAACAAGTTCTGCTTGCATAAGGAGGTCTAATAATAGTTTCTTTAGTAGATTAAATTGGTTGACCCACTTAAACTTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAACAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAAGGACCAAATCTTCCTGTATGCTCAATCATCAGGAAGAATCACAGTATCTACCAAAAGAAGCCAACAAGCTGTAATCCCGAATATCGGATCTAGACCCAGAATAAGGAATATCCCTAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAAGTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAGCACTCTGAAATTGGCAACAGGAATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATAGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAAGGAAGAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATCGATTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCACGATGTATACAGAGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGAGTTGAACTGAAGTCAGGGTACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAGGGCAACATTAGGTGCAACATTTGCATT
+>CY006283
+ATGAAGACTATCATTGCTTTGAGCTACATTTTATGTCTGGTTTTCGCTCAAAAACTTCCCGGAAATGACAACAGCACGGCAACGCTGTGCCTGGGACACCATGCAGTGCCAAACGGAACGCTAGTGAAAACAATCACGAATGACCAAATTGAAGTGACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGATAGAATATGCGACAGTCCTCACCGAATCCTTGATGGAGAAAACTGCACACTGATAGATGCTCTATTGGGAGACCCTCATTGTGATGGCTTCCAAAATAAGGAATGGGACCTTTTTGTTGAACGCAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACCCTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCGCTCAGAATGGAACAAGCTATGCTTGCAAAAGGAGATCTATTAAAAGTTTCTTTAGTAGATTGAATTGGTTGCACCAATTAAAATACAAATATCCAGCACTGAACGTGACTATGCCAAACAATGACAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGAGTACGGACAGTGACCAAACCAGCCTATATGCTCAAGCATCAGGGAGAGTCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGATCTAGACCCTGGGTAAGGGGTGTCTCCAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTCGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGGTCAGATGCACCCATTGGCAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTTCAAAATGTAAACAGGATCACATATGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGGAATGTACCAGAGAAACAAACTAGAGGCATATTCGGCGCAATCGCAGGTTTCATAGAAAATGGTTGGGAGGGAATGGTAGACGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGCACAGGACAAGCAGCAGATCTTAAAAGCACTCAAGCAGCAATCAACCAAATCAACGGGAAACTGAATAGGTTAATCGAGAAAACGAACGAGAAATTCCATCAAATTGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTCGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCGTACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAGAACAAGGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGGTCAATCAGAAATGGAACTTATGACCATGATGTATACAGAGATGAAGCATTAAACAACCGGTTCCAGATCAAAGGTGTTGAGCTTAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGTTTTGCTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>CY002456
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTTGCTCAAAAACTTCCCGGAAATGACAACAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCAAATTGAAGTCACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTGGAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTCCAAAATAAGAAATGGGACCTTTTTGTTGAACGCAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGATCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCACTCAAAATGGAACAAGCTCAGCTTGCAAAAGGAGATCTAATAACAGTTTCTTTAGTAGATTGAATTGGTTGACCCACTTAAAATTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAAAAATTTGACAAACTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAATGACCAAATCAGCCTATATGCTCAAGCATCAGGAAGAATCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAGTATCGGATCTAGACCCAGGATAAGGGATGTCCCCAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTCGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTTCAAAATGTAAACAGGATCACATATGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATCGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGACGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAACAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCAACCAAATCAATGGGAAGCTGAATAGGTTGATCGGGAAAACAAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTCGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTGGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAGAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGGTCAATCAGAAATGGAACTTATGACCATGATGTATACAGAGATGAAGCATTAAACAACCGGTTCCAGATCAAAGGTGTTGAGTTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>KC893110
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCTGGAAATGACAATAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCGAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAATTCCTCAATAGGTGAAATATGCGACAGTCCTCATCAGATCATTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTCCAAAATAAGAAATGGGACCTTTTTGTTGAACGAAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCACTCAAAACGGAACAAGTTCTGCTTGCATAAGGAGATCTAATAATAGTTTCTTTAGTAGATTAAATTGGTTGACCCACTTAAACTTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAACAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAAGGACCAAATCTTCCTGTATGCTCAATCATCAGGAAAAATCACAGTATCTACCAAAAGAAGCCAACAAGCTGTAATCCCGAATATCGGATCTAGACCCAGAATAAGGAATATCCCTAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAAGTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAGCACTCTGAAATTGGCAACAGGAATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATAGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAAGAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATCGATTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCACGATGTATACAGAGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGAGTTGAGCTGAAGTCAGGGTACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAGGGCAACATTAGGTGCAACATTTGCATT
+>KC892407
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCTGGAAATGACAACAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCAAATTGAAGTTACTAATGCTACTGAGCTAGTTCAGAATTCCTCAACAGGTGAAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTCCAAAATAAGAAATGGGACCTTTTTGTTGAACGAAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCACTCAAAACGGAACAAGCTCTGCTTGCATAAGGAGATCTGATAGTAGTTTCTTTAGTAGATTGAATTGGTTGACCCACTTAAACTTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAACAATTCGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAAGGACCAAATCTTCCTGTATGCTCAAGCATCAGGAAGAATCACAGTATCTACCAAAAGAAGCCAACAAGCTGTGATCCCGAATATCGGATCTAGACCCAGAATAAGGAATATCCCTAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGGTCAGATGCACCCATTGGAAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGAATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATAGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAAGAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATAGATTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTCGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAAAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGCTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATAACCACGATGTATACAGAGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGAGTTGAGCTAAAGTCAGGGTACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>CY000721
+ATGAAGACTATCATTGCTTTGAGCTACATTTTATGTCTGGTTTTCGCTCAAAAACTTCCCGGAAATGACAACAGCACGGCAACGCTGTGCCTGGGGCACCATGCAGTGCCAAACGGAACGCTAGTGAAAACAATCACGAATGACCAAATTGAAGTGACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTAGAATATGCGACAGTCCTCACCAAATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCATTGTGATGGCTTCCAAAATAAGGAATGGGACCTTTTTGTTGAACGCAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCGCTCAGAATGGAACAAGCTCTGCTTGCAAAAGGAGATCTAATAAAAGTTTCTTTAGTAGATTGAATTGGTTGCACCAATTAAAATACAAATACCCAGCACTGAACGTGACTATGCCAAACAATGAAAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGAGTACGGACAGTGACCAAATCAGCCTATATGCTCAAGCATCAGGGAGAGTCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGATCTAGACCCTGGGTAAGGGGTGTCTCCAGTAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTCGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGGTCAGATGCATCCATTGGCAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTTCAAAATGTAAACAGGATCACATATGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGGAATGTACCAGAGAAACAAACTAGAGGCATATTCGGCGCAATCGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGACGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGCACAGGACAAGCAGCAGATCTTAAAAGCACTCAAGCAGCAATCAACCAAATCAACGGGAAACTGAATAGGTTAATCGAGAAAACGAACGAGAAATTCCATCAAATTGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTCGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCGTACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAGAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGGTCAATCAGAAATGGAACTTATGACCATGATGTATACAGAGACGAAGCATTAAACAACCGGTTCCAGATCAAAGGTGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGTTTTACTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>CY011848
+ATGAAGACTATCATTGCTTTGAGCTACATTTTATGTCTGGTTTTCGCTCAAAAACTTCCCGGAAATGACAACAGCACAGCAACGCTGTGCCTGGGACACCATGCAGTGCCAAACGGAACGCTAGTGAAAACAATCACGAATGATCAAATTGAAGTGACTAATGCTACTGAGCTGGTTCAGAGTTCCCCAACAGGTAGAATATGCGACAGTCCTCACCGAATCCTTGATGGAAAGAACTGCACACTGATAGATGCTCTATTGGGAGACCCTCATTGTGATGGCTTCCAAAATAAGGAATGGGACCTTTTTGTTGAACGCAGCAAAGCTTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCAGGCACCCTGGAGTTTACCAACGAAAACTTCAATTGGACTGGAGTCGCTCAGGATGGGAAAAGCTATGCTTGCAAAAGGGGATCTGTTAACAGTTTCTTTAGTAGATTGAATTGGTTGCACAAATTAGAATACAAATATCCAGCGCTGAACGTGACTATGCCAAACAATGGCAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGAGCACGGACAGTGACCAAACCAGCCTATATGTCCGAGCATCAGGGAAAGTCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGGATATCGGGTATAGACCATGGGTAAGGGGTCTGTCCAGTAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAATAGCACAGGGAATCTAATTGCTCCTCGGGGTTACTTCAAAATACGAAATGGGAAAAGCTCAATAATGAGGTCAGATGCACCCATTGGCAACTGCAGTTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCTTTTCAAAATGTAAACAGGATCACATATGGGGCCTGCCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGGAATGTACCAGAGAAACAAACTAGAGGCATATTCGGCGCAATCGCAGGTTTCATAGAAAATGGTTGGGAGGGAATGGTAGACGGTTGGTACGGTTTCAGGCATCAGAATTCTGAGGGCACAGGACAAGCTGCAGATCTTAAAAGCACTCAAGCAGCAATCGACCAAATCAACGGGAAACTGAATAGGTTAGTCGAGAAAACGAACGAGAAATTCCATCAAATCGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTCGAGAAATATGTTGAAGACACTAAAATAGATCTCTGGTCTTACAATGCGGAGCTTCTTGTTGCTCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTATTTGAAAGAACAAGGAAGCAACTGAGGGAAAATGCTGAGGACATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGGTCAATCAGAAATGGAACTTATGACCATGATGTATACAGAGACGAAGCATTAAACAACCGGTTCCAGATCAAAGGTGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGCTTTTTGCTTTGTGTTGTTTTGCTTGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>CY168239
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCTGGAAATGACGATAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCGAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAATTCCTCAATAGGTGAAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTTCAAAATAAGAAATGGGACCTTTTTGTTGAACGAAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGGCTGGAGTCACTCAAAACGGAACAAGTTCTGCTTGCATAAGGGGATCTAATAGTAGTTTCTTTAGTAGATTAAATTGGTTGACCCACTTAAACTTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAACAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAAGGACCAAATCTTCCTGTATGCTCAATCATCAGGAAGAATCACAGTATCTACCAAAAGAAGCCAACAAGCTGTAATCCCGAATATCGGATCTAGACCCAGAATAAGGAATATCCCTAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAAGTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAGAATGTAAACAGAATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAGCACTCTGAAATTGGCAACAGGAATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATAGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGATGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAAGAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATCGATTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACAAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCACGATGTATACAGGGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGAGTTGAGCTGAAGTCAGGGTACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAGGGCAACATTAGGTGCAACATTTGCATT
+>CY010004
+ATGAAGACTATCATTGCTTTGAGCTACATTTTATGTATGGTTTTCGCTCAAAAACTTCCCGGAAATGACAACAGCACGGCAACGCTGTGCCTGGGACACCATGCAGTGCCAAACGGAACGCTAGTGAAAACAATCACGAATGACCAAATTGAAGTGACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTAGAATATGCGACAGTCCTCACCGAATCCTTGATGGAAAAAACTGCACACTGATAGATGCTCTATTGGGAGACCCTCATTGTGATGGCTTCCAAAATAAGGAATGGGACCTTTTTGTTGAACGCAGCAAAGCTTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACCCTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCGCTCAGAATGGAACAAGCTATGCTTGCAAAAGGAGATCTGTTAAAAGTTTCTTCAGTAGATTGAATTGGTTGCACAAATTAGAATACAAATATCCAGCACTGAACGTGACTATGCCAAACAATGACAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGAGTACGGACAGTGACCAAACCAGCCTATATGTTCAAGCATCAGGGAGAGTCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGATCTAGACCCTGGGTAAGGGGTGTCTCCAGCATAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTCGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGGTCAGATGCACCCATTGGCAACTGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTTCAAAATGTAAACAGGATCACATATGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGGAATGTACCAGAGAAACAAACTAGAGGCATATTCGGCGCAATCGCAGGTTTCATAGAAAATGGTTGGGAGGGAATGGTAGACGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGCACAGGACAAGCAGCAGATCTTAAAAGCACTCAAGCAGCAATCAACCAAATCAACGGGAAACTGAATAGGTTAATCGAGAAAACGAACGAGAAATTCCATCAAATCGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTCGAGAAATATGTTGAAGACACTAAAATAGATCTCTGGTCGTACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAGAACAAGGAAGCAACTGAGGGAAAATGCTGAGGACATGGGCAATGGTTGCTTCAAAATATACCACAAATGTGACAATGCCTGTATAGGGTCAATCAGAAATGGAACTTATGACCATGATGTATACAGAGACGAAGCATTAAACAACCGGTTCCAGATCAAAGGTGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGTTTTGCTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>CY172191
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCCGGAAATGACAACAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCAAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTGGAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTCCAAAATAAGAAATGGGACCTTTTTGTTGAACGCAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCACCCAAAATGGAACAAGCTCTGCTTGCAAAAGGAGATCTAATAACAGTTTCTTTAGTAGATTGAATTGGTTGACCCACTTAAAATTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAAAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAATGACCAAATCTTTCTGTATGCTCAAGCATCAGGAAGAATCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGATCTAGACCCAGAGTAAGGAATATCCCCAGCAGAATAAGCATCTATTGGACAATAGTAAAACCAGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTTCAAAATGTAAACAGGATCACATATGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATCGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAATAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCAATCAAATCAATGGGAAGCTGAATAGGTTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTCGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAGAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCATGATGTATACAGAGATGAAGCATTAAACAACCGGTTCCAGATCAAAGGCGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>KC892889
+ATGAAGACTATCATTGCTTTGAGCTACATTCTACGTCTGGTTTTCGCTCAAAAACTTCCTGGAAATGACAACAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCAAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAATTCCTCAATAGGTGAAATATGCAACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTCCAAAATAAGAAATGGGACCTTTTTGTTGAACGAAGTAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCACTCAAAACGGAACAAGTTCTGCTTGCATAAGGAGGTCTAATAGTAGTTTCTTTAGTAGATTGAATTGGTTGACCCACTTAAACTTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAACAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAAGGACCAAATCTTCCTGTATGCTCAATCATCAGGAAGAATCACAGTATCTACCAAAAGAAGCCAACAAGCTGTAATCCCGAATATCGGATCTAGACCCAGAATAAGGGATATCCCTAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAGCACTCTGAAATTGGCAACAGGAATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATAGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGATGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAAGAGGACAAGCAGCAGATCTCAAAAGCACCCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATCGATTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAGGAATTCTCAGAAGTCGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACTAAAATAGATCTTTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCACGATGTATACAGAGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGAGTTGAGCTGAAGTCAGGGTACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGCTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAGGGCAACATTAGGTGCAACATTTGCATT
+>CY025341
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCCGGAAATGACAACAGCACGGCAACGCTGTGCCTTGGGCATCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCAAATTGAAGTTACTAATGCTACTGAGCTAGTTCAGAGTTCCTCAACAGGTGAAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTCCAAAATAAGAAATGGGACCTTTTTGTTGAACGCAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGAACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCACTCAAAACGGAACAAGCTCTGCTTGCATAAGGAGATCTAATAACAGTTTCTTTAGTAGATTGAATTGGTTGACCCACTTAAAATTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAAAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAATGACCAAATCTTCCTGTATGCTCAAGCATCAGGAAGAATCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGATCTAGACCCAGAGTAAGGAATATCCCCAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACAAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATCGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAATAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATAGGTTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTCGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACCAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCATGCATAGGATCAATCAGAAATGGAACTTATGACCACGATGTATACAGAGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGCGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>CY088198
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCCGGAAATGACAACAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCAAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTGGAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCATTGTGATGGCTTCCAAAATAAGAAATGGGACCTTTTTGTTGAACGCAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAACTGGACTGGAGTCACTCAGAATGGAACAAGCTCTGCTTGCAAAAGGAAATCTAATAAAAGTTTCTTTAGTAGATTGAATTGGTTGACCCACTTAAAATACAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAAAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAATGACCAAATCAGCCTATATGCTCAAGCATCAGGAAGAATCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGATCTAGACCCAGGGTAAGGGACATCTCCAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTCGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTTCAAAATGTAAACAGGATCACATATGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATCGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGACGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGCACAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCAACCAAATCAATGGGAAACTGAATAGGTTAATCGGGAAAACAAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTAGAGGGGAGAATTCAGGACCTCGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAGAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGGTCAATCAGAAATGGAACTTATGACCATGATGTATACAGAGATGAAGCATTAAACAACCGGTTCCAGATCAAAGGTGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>CY169303
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCTGGAAATGACAATAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCGAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAATTCCTCAATAGGTGAAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAATTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTTCAAAATAAGAAATGGGACCTTTTTGTTGAACGAAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGGCTGGAGTCACTCAAAACGGAACAAGTTCTGCTTGCATAAGGGGATCTAATAGTAGTTTCTTTAGTAGATTAAATTGGTTGACCCACTTAAACTTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAACAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAAGGACCAAATCTTCCTGTATGCTCAATCATCAGGAAGAATCACAGTATCTACCAAAAGAAGCCAACAAGCTGTAATCCCGAATATCGGATCTAGACCCAGAATAAGGAATATCCCTAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAAGTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAGCACTCTGAAATTGGCAACAGGAATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATAGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAAGAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATCGATTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACAAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCACGATGTATACAGGGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGAGTTGAGCTGAAGTCAGGGTACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAGGGCAACATTAGGTGCAACATTTGCATT
+>CY012512
+ATGAAGACTATCATTGCTTTGAGCTACATTTTATGTCTGGTTTTCGCTCAAAAACTTCCCGGAAATGACAACAGCACAGCAACGCTGTGCCTGGGACACCATGCAGTGCCAAACGGAACGCTAGTGAAAACAATCACGAATGATCAAATTGAAGTGACCAATGCTACTGAGCTGGTTCAGAGTTCCCCAACAGGTAGAATATGCGACAGTCCTCACCGAATCCTTGATGGAAAGAACTGCACACTGATAGATGCTCTATTGGGAGACCCTCATTGTGATGGCTTCCAAAATAAGGAATGGGACCTTTTTGTTGAACGCAGCAAAGCTTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCAGGCACCCTGGAGTTTACCAACGAAAACTTCAATTGGACTGGAGTCGCTCAGGATGGGAAAAGCTATGCTTGCAAAAGGGGATCTGTTAACAGTTTCTTTAGTAGATTGAATTGGTTGCACAAATTAGAATACAAATATCCAGCGCTGAACGTGACTATGCCAAACAATGGCAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGAGCACGGACAGTGACCAAACCAGCCTATATGTCCGAGCATCAGGGAAAGTCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGGATATCGGGTATAGACCATGGGTAAGGGGTCTGTCCAGTAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAATAGCACAGGGAATCTAATTGCTCCTCGGGGTTACTTCAAAATACGAAATGGGAAAAGCTCAATAATGAGGTCAGATGCACCCATTGGCAACTGCAGTTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCTTTTCAAAATGTAAACAGGATCACATATGGGGCCTGCCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGGAATGTACCAGAGAAACAAACTAGAGGCATATTCGGCGCAATCGCAGGTTTCATAGAAAATGGTTGGGAGGGAATGGTAGACGGTTGGTACGGTTTCAGGCATCAGAATTCTGAGGGCACAGGACAAGCTGCAGATCTTAAAAGCACTCAAGCAGCAATCGACCAAATCAACGGGAAACTGAATAGGTTAGTCGAGAAAACGAACGAGAAATTCCATCAAATCGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTCGAGAAATATGTTGAAGACACTAAAATAGATCTCTGGTCTTACAATGCGGAGCTTCTTGTTGCTCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTATTTGAAAGAACAAGGAAGCAACTGAGGGAAAATGCTGAGGACATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGGTCAATCAGAAATGGAACTTATGACCATGATGTATACAGAGACGAAGCATTAAACAACCGGTTCCAGATCAAAGGTGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGCTTTTTGCTTTGTGTTGTTTTGCTTGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>CY026251
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCCGGAAATGACAACAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCAAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTGAAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTCCAAAATAAGAAATGGGACCTTTTTGTTGAACGCAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTGAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCACTCAAAACGGAACAAGCTCTGCTTGCATAAGGAGATCTAATAACAGTTTCTTTAGTAGATTGAATTGGTTGACCCACTTAAAATTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAAAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAATGACCAAATCTTCCTGTATGCTCAAGCATCAGGAAGAATCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGATCTAGACCCAGAGTAAGGAATATCCCCAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAATTCTGAGTGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATCGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAATAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATAGGTTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTCGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACCAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCACGATGTGTACAGAGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGCGTTGAGCTGAAGTCAGGATACAAAGATTGGATCATATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAGGGCAACATTAGGTGCAACATTTGCATT
+>CY012184
+ATGAAGACTATCATTGCTTTGAGCTACATTTTATGTCTGGTTTTCGCTCAAAAACTTCCCGGAAATGACAACAGCACAGCAACGCTGTGCCTGGGACACCATGCAGTGCCAAACGGAACGCTAGTGAAAACAATCACGAATGATCAAATTGAAGTGACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTAGAATATGCGACAGTCCTCACCGAATCCTTGATGGAAAAAACTGCACACTGATAGATGCTCTATTGGGAGACCCTCATTGTGATGGCTTCCAAAATAAGGAATGGGACCTTTTTGTTGAACGCAGCAAAGCTTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCAGGCACCCTAGAGTTTATCAATGAAGACTTCAATTGGACTGGAGTGGCTCAGGATGGGAAAAGCTATGCTTGCAAAAGGGGATCTGTTAACAGTTTCTTTAGTAGATTGAATTGGTTGCACAAATTAGAATACAAATATCCAGCGCTGAACGTGACTATGCCAAACAATGGCAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGAGCACGGACAGTGACCAAACCAGCCTATATGTTCGAGCATCAGGGAGAGTCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGGTCTAGACCCTGGGTAAGGGGTCTGTCCAGTAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAATAGCACAGGGAATCTAATTGCTCCTCGGGGTTACTTCAAAATAAGAAATGGGAAAAGCTCAATAATGAGGTCAGATGCACCCATTGGCAACTGCAGTTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCTTTTCAAAATGTAAACAGGATCACATATGGGGCCTGCCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGGAATGTACCAGAGAAACAAACTAGAGGCATATTCGGCGCAATCGCAGGTTTCATAGAAAATGGTTGGGAGGGAATGGTAGACGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGCACAGGACAAGCAGCAGATCTTAAAAGCACTCAAGCAGCAATCGACCAAATCAACGGGAAACTGAATAGGTTAATCGAGAAAACGAACGAGAAATTCCATCAAATCGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTCGAGAAATATGTTGAAGACACTAAAATAGATCTCTGGTCTTACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAGAACAAGGAAGCAACTGAGGGAAAATGCTGAGGACATGGGCAATGGTTGCTTCAAAGTATACCACAAATGTGACAATGCCTGCATAGAGTCAATCAGAAATGGAACTTATGACCATGATGTATACAGAGACGAAGCATTAAACAACCGGTTCCAGATCAAAGGTGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGCTTTTTGCTTTGTGTTGTTTTGCTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>EU516019
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCTGGAAATGACAACAGCACGGCAACGCTGTGCCTTGGGCATCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCAAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAATTCCTCAACAGGTGGAATCTGCAACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTCCAAAATAAGAAATGGGACCTTTTTGTTGAACGCAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAATTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCACTCAAAATGGAACAAGCTCTGCTTGCAAAAGGGGATCTAATAACAGTTTCTTTAGTAGATTGAATTGGTTGACCCACTTAAAATTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAAGAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAATGACCAAATCAGCCTATATGCTCAAGCACCAGGAAGAATCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGATCTAGACCCCGAGTAAGGGATATCCCCAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTCGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGACAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATATGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATCGCGGGTTTCATAGAAAATGGCTGGGAGGGAATGGTGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAATAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGACCAAATCAATGGGAAGCTGAATAGGTTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTCGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGACCTAACTGACTCAGAAATGAACAAATTGTTTGAAAGAACAAAAAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGGTCAATCAGAAATGGAACTTATGACCATGATGTATACAGAGATGAAGCATTAAACAACCGGTTCCAGATCAAAGGTGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>CY002368
+ATGAAGACTATCATTGCTTTGAGCTACATTTTATGTCTGGTTTTCGCTCAAAAACTTCCCGGAAATGACAACAGCACGGCAACGCTGTGCCTGGGGCACCATGCAGTGCCAAACGGAACGCTAGTGAAAACAATCACGAATGACCAAATTGAAGTGACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTAGAATATGCGACAGTCCTCACCAAATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCATTGTGATGGCTTCCAAAATAAGGAATGGGACCTTTTTGTTGAACGCAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAAGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCGCTCAGAATGGAACAAGCTCTGCTTGCAAAAGGAGATCTAATAAAAGTTTCTTTAGTAGATTGAATTGGTTGCACCAATTAAAATACAAATATCCAGCACTGAACGTGACTATGCCAAACAATGAAAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGAGTACGGACAGTGACCAAATCAGCCTATATGCTCAAGCATCAGGGAGAGTCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGATCTAGACCCTGGGTAAGGGGTGTCTCCAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTCGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGGTCAAATGCACCCATTGGCAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTTCAAAATGTAAACAGGATCACATATGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGGAATGTACCAGAGAAACAAACTAGAGGCATATTCGGCGCAATCGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGACGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGCACAGGACAAGCAGCAGATCTTAAAAGCACTCAAGCAGCAATCAACCAAATCAACGGGAAACTGAATAGGTTAATCGAGAAAACGAACGAGAAATTCCATCAAATTGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTCGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAGAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGGTCAATCAGAAATGGAACTTATGACCATGATGTATACAGAGACGAAGCATTAAACAACCGGTTCCAGATCAAAGGTGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGTTTTGCTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>CY009484
+ATGAAGACTATCATTGCTTTGAGCTACATTTTATGTCTGGTTTTCGCTCAAAAACTTCCCGGAAATGACAACAGCACGGCAACGCTGTGCCTGGGACACCATGCAGTGCCAAACGGAACGCTAGTGAAAACAATCACGAATGACCAAATTGAAGTGACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTAGAATATGCGACGGTCCTCACCAAATCCTTGATGGAAAAAACTGCACACTGATAGATGCTCTATTGGGAGACCCTCATTGTGATGGCTTCCAAAATAAGGAATGGGACCTTTTTGTTGAACGCAGCAAAGCTTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACCCTGGAGTTTACCAATGAAAGCTTCAATTGGACTGGAGTCGCTCAGAATGGAACAAGCTATGCTTGCAAAAGGGGATCTGTTAAAAGTTTCTTTAGTAGATTGAATTGGTTGCACAAATTAGAATACAAATATCCAGCACTAAACGTGACTATGCCAAACAATGACAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGAGTACGGACAGTGACCAAACCAGCCTATATGTTCAATCATCAGGGAGAGTCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAACCCCGAATATCGGGTCTAGACCCTGGGTAAGGGGTGTCTCCAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATCAACAGCACAGGGAATCTAATTGCTCCTCGGGGTTACTTCAAAATACGAAGGGGGAAAAGCTCAATAATGAGGTCAGATGCACCCATTGACAACTGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCTTTTCAAAATGTAAACAGGATCACATATGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGGAATGTACCAGAGAAACAAACTAGAGGCATATTCGGCGCAATCGCAGGTTTCATAGAAAATGGTTGGGAGGGAATGGTAGACGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGCACAGGACAAGCAGCAGATCTTAAAAGCACTCAAGCAGCAATCAACCAAATCAACGGGAAACTGAATAGGTTAATCGAGAAAACGAACGAGAAATTTCATCAAATCGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTCGAGAAATATGTTGAAGACACTAAAATAGATCTCTGGTCTTACAACGCGGAGCTTCTTGTTGCCCTGGAGAATCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAGAACAAGGAAGCAACTGAGGGAAAATGCTGAGGACATGGGCAATGGTTGCTTCAAAATATACCACAAATGTGACAATGCATGCATAGGGTCAATCAGAAATGGAACTTATGACCATGATGTATACAGAGACGAAGCATTAAACAACCGGTTCCAGATCAAAGGTGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGCTTTTTGCTTTGTGTTGTTTTGCTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>CY035062
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCTGGAAATGACAACAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCAAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTGAAATATGCGACAGTCCTCACCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTCCAAAATAAGAAATGGGACCTTTTTGTTGAACGCAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGGCTGGAGTCACTCAAAACGGAACAAGCTCTGCTTGCATAAGGAAATCTAATAACAGTTTCTTTAGTAGATTGAATTGGTTGACCCACTTAAAATTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAACAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAATGACCAAATCTTCCTGTATGCTCAAGCATCAGGAAGAATCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGATCTAGACCCAGAGTAAGGAATATCCCTAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATCGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAAGAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATAGATTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTCGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACCAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCACGATGTATACAGAGATGAAGCATTAAACAACCGGTTCCAGATCAAAGGAGTTGAGCTGAAGTCAGGGTACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>KC893018
+ATGAAGACTATCATTGCTTTGAGCTACATTCTACGTCTGGTTTTCGCTCAAAAACTTCCTGGAAATGACAACAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCAAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAATTCCTCAATAGGTGAAATATGCAACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTCCAAAATAAGAAATGGGACCTTTTTGTTGAACGAAGTAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCACTCAAAACGGAACAAGTTCTGCTTGCATAAGGAGGTCTAATAGTAGTTTCTTTAGTAGATTGAATTGGTTGACCCACTTAAACTTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAACAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAAGGACCAAATCTTCCTGTATGCTCAATCATCAGGAAGAATCACAGTATCTACCAAAAGAAGCCAACAAGCTGTAATCCCGAATATCGGATCTAGACCCAGAATAAGGAATATCCCTAGCAGAATAAGCATCTATTGGACAATAGTAAAACCAGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAGCACTCTGAAATTGGCAACAGGAATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATAGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGATGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAAGAGGACAAGCAGCAGATCTCAAAAGCACCCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATCGATTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAGGAATTCTCAGAAGTCGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACTAAAATAGATCTTTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGCTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCACGATGCATACAGAGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGAGTTGAGCTGAAGTCAGGGTACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGCTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAGGGCAACATTAGGTGCAACATTTGCATT
+>KF790384
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCTGGAAATGACAATAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCGAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAATTCCTCAATAGGTGAAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTTCAAAATAAGAAATGGGACCTTTTTGTTGAACGAAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGGCTGGAGTCACTCAAAACGGAACAAGTTCTGCTTGCATAAGGGGATCTAATAGTAGTTTCTTTAGTAGATTAAATTGGTTGACCCACTTAAACTTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAACAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAAGGACCAAATCTTCCTGTATGCTCAATCATCAGGAAGAATCACAGTATCTACCAAAAGAAGCCAACAAGCTGTAATCCCGAATATCGGATCTAGACCCAGAATAAGGGATATCCCTAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAAGTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAGCACTCTGAAATTGGCAACAGGAATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATAGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAAGAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATCGATTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACAAAAATAGATCTCTGGTCATACAATGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCACGATGTATACAGGGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGAGTTGAGCTGAAGTCAGGGTACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAGGGCAACATTAGGTGCAACATTTGCATT
+>KF790389
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCTGGAAATGACAATAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCGAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAATTCCTCAATAGGTGAAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTTCAAAATAAGAAATGGGACCTTTTTGTTGAACGAAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGGCTGGAGTCACTCAAAACGGAACAAGTTCTGCTTGCATAAGGGGATCTAATAGTAGTTTCTTTAGTAGATTAAATTGGTTGACCCACTTAAACTTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAACAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAAGGACCAAATCTTCCTGTATGCTCAATCATCAGGAAGAATCACAGTATCTACCAAAAGAAGCCAACAAGCTGTAATCCCGAATATCGGATCTAGACCCAGAATAAGGAATATCCCTAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATGCGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAAGTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAGCACTCTGAAATTGGCAACAGGAATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATAGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGATGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAAGAGGACAAGCAGCGGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATCGATTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACAAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCACGATGTATACAGGGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGAGTTGAGCTGAAGTCAGGGTACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAGGGCAACATTAGGTGCAACATTTGCATT
+>EU199255
+ATGAGGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCCGGAAATGACAACAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCAAATTGAAGTTACTAATGCTACTGAGCTGGTACAGAGTTCCTCAACAGGTGGAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTCCAAAATAAGAAATGGGACCTTTTTGTTGAACGCAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCACTCAAAACGGAACAAGCTCTGCTTGCAAAAGGAGATCTAATAACAGTTTCTTTAGTAGATTGAATTGGTTGACCCACTTAAAATTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAAAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAATGACCAAATCTTCCTGTATGCTCAAGCATCAGGAAGAATCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGATCTAGACCCAGAGTAAGGAATATCCCCAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACAAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATCGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAATAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATAGGTTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTCGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTAGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCACGATGTATACAGAGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGCATTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>CY134956
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCTGGAAATGACAATAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCGAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAATTCCTCAATAGGTGAAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGTACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTTCAAAATAAGAAATGGGACCTTTTTGTTGAACGAAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCACTCAAAACGGAACAAGTTCTGCTTGCATAAGGAGATCCAATAGTAGTTTCTTTAGTAGATTAAATTGGTTGACCCACTTAAACTTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAACAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAAGGACCAAATCTTCCTGTATGCTCAATCATCAGGAAGAATCACAGTATCTACCAAAAGAAGCCAACAAGCTGTAATCCCGAATATCGGATCTAGACCCAGAATAAGGAATATCCCTAGCAGAATAAGCATCTATTGGACAATAGTAAAACCAGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAAGTCTGAATGCATCACTCCAAATGGAAGCATTCCAAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAGCACTCTGAAATTGGCAACAGGAATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATAGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAAGAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATCGATTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCACGATGTATACAGGGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGAGTTGAGCTGAAGTCAGGGTACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAGGGCAACATTAGGTGCAACATTTGCATT
+>KC535402
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCTGGAAATGACAACAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCAAATTGAAGTTACTACTGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTGAAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTCCAAAATAAGAAATGGGACCTTTTTGTTGAACGAAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCACTCAAAACGGAACAAGCTCTGCTTGCATAAGGAGATCTAATAATAGTTTCTTTAGTAGATTGAATTGGTTGACCCACTTAAACTTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAACAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAAGGACCAAATCTTCCTGTATGCTCAAGCATCAGGAAGAATCACAGTATCTACCAAAAGAAGCCAACAAGCTGTAATCCCGAATATCGGATCTAGACCCAGAGTAAGGAATATCCCTAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAGCACTCTGAAATTGGCAACAGGAATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATAGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAAGAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATAGATTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTCGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCACGATGTATACAGAGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGAGTTGAGCTGAAGTCAGGGTACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>KF790010
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCTGGAAATGACAATAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCGAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAATTCCTCAATAGGTGAAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTTCAAAATAAGAAATGGGACCTTTTTGTTGAACGAAGCAAAGCCCACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGGCTGGAGTCACTCAAAACGGAACAAGTTCTGCTTGCATAAGGGGATCTAATAGTAGTTTCTTTAGTAGATTAAATTGGTTGACCCACTTAAACTTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAACAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAAGGACCAAATCTTCCTGTATGCTCAATCATCAGGAAGAATCACAGTATCTACCAAAAGAAGCCAACAAGCTGTAATCCCGAATATCGGATCTAGACCCAGAATAAGGAATATCCCTAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAAGTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAGCACTCTGAAATTGGCAACAGGAATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATAGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGATGGATGGTTGGTACGGTTTCAGGCATCAAAACTCTGAGGGAAGAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATCGATTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACAAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCACGATGTATACAGGGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGAGTTGAGCTGAAGTCAGGGTACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAGGGCAACATTAGGTGCAACATTTGCATT
+>CY114493
+ATGAAGACTATCATTGCTTTGAGCTACATTTTATGTCTGGTTTTCGCTCAAAAACTTCCCGGAAATGACAACAGCACGGCAACGCTGTGCCTGGGGCACCATGCAGTGCCAAACGGAACGCTAGTGAAAACAATCACGAATGACCAAATTGAAGTGACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTAGAATATGCGACAGTCCTCACCAAATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCATTGTGATGGCTTCCAAAATAAGGAATGGGACCTTTTCGTTGAACGCAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCGCTCAGAATGGAACAAGCTCTGCTTGCAAAAGGAGGTCTAATAAAAGTTTCTTTAGTAGATTGAATTGGTTGCACCAATTAAAATACAAATACCCAGCACTGAACGTGACTATGCCAAACAATGAAAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGAGTACGGACAGTGACCAAATCAGCCTATATGCTCAAGCATCAGGGAGAGTCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGATCTAGACCCTGGGTAAGGGGTGTCTCCAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTCGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGGTCAGATGCATCCATTGGCAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTTCAAAATGTAAACAGGATCACATATGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGGAATGTACCAGAGAAACAAACTAGAGGCATATTCGGTGCAATCGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGACGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGCACAGGACAAGCAGCAGATCTTAAAAGCACTCAAGCAGCAATCAACCAAATCAACGGGAAACTGAATAGGTTAATCGAGAAAACGAACGAGAAATTCCATCAAATTGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTCGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCGTACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAGAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGCTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGGTCAATCAGAAATGGAACTTATGACCATGATGTATACAGAGACGAAGCATTAAACAACCGGTTCCAGATCAAAGGTGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGTTTTGCTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>CY037727
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCTGGAAATGACAACAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCAAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTGAAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTCCAAAATAAGAAATGGGACCTTTTTGTTGAACGAAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCACTCAAAACGGAACAAGCTCTGCTTGCATAAGGAGATCTAATAACAGTTTCTTTAGTAGATTGAATTGGTTGACCCACTTAAAATTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAACAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAATGACCAAATCTTCCTGTATGCTCAAGCATCAGGAAGAATCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGATCTAGACCCAGAGTAAGGAATATCCCTAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGAGCAATCGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAAGAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATAGATTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTCGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCACGATGTATACAGAGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGAGTTGAGCTGAAGTCAGGGTACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>KC892641
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCTGGAAATGACAATAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCGAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAATTCCTCAATAGGTGAAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTCCAAAATAAGAAATGGGACCTTTTTGTTGAACGAAGCAAAGCCTACAGCGACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCACTCAAAACGGAACAAGTTCTGCTTGCATAAGGAGATCTAATAATAGTTTCTTTAGTAGATTAAATTGGTTGACCCACTTAAACTTCAAATACCCAGCATTGAACGTAACTATGCCAAACAATGAACAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAAGGACCAACTCTTCCTGTATGCTCAATCATCAGGAAGAATCACAGTATCTACCAAAAGAAGCCAACAAGCTGTAATCCCGAATATCGGATCTAGACCCAGAATAAGGAATATCCCTAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAAGTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAGCACTCTGAAATTGGCAACAGGAATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATAGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAAGAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATCGATTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCACGATGTATACAGAGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGAGTTGAGCTGAAGTCAGGGTACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAGGGCAACATTAGGTGCAACATTTGCATT
+>CY114509
+ATGAAGACTATCATTGCTTTGAGCTACATTCTACGTCTGGTTTTCGCTCAAAAACTTCCTGGAAATGACAACAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCAAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAATTCCTCAATAGGTGAAATATGCAACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTCCAAAATAAGAAATGGGACCTTTTTGTTGAACGAAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCACTCAAAACGGAACAAGTTCTGCTTGCATAAGGAGATCTAATAATAGTTTCTTTAGTAGATTGAATTGGTTGACCCACTTAAACTTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAACAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAAGGACCAAATCTTCCTGTATGCTCAATCATCAGGAAGAATCACAGTATCTACCAAAAGAAGCCAACAAGCTGTAATCCCGAATATCGGATCTAGACCCAGAATAAGGGATATCCCTAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAGCACTCTGAAATTGGCAACAGGAATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATAGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAAGAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATCGATTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTCGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCACGATGTATACAGAGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGAGTTGAGCTGAAGTCAGGGTACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAGGGCAACATTAGGTGCAACATTTGCATT
+>CY011888
+ATGAAGACTATCATTGCTTTGAGCTACATTTTATGTCTGGTTTTCGCTCAAAAACTCCCCGGAAATGACAACAGCACAGCAACGCTGTGCCTGGGACACCATGCAGTGCCAAACGGAACGCTAGTGAAGACAATCACGAATGATCAAATTGAAGTGACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTAGAATATGCGACAGTCCTCACCGAATCCTTGATGGAAAAAACTGCACACTGATAGATGCTCTATTGGGAGACCCTCATTGTGATGGCTTCCAAAATAAGGAATGGGACCTTTTTGTTGAACGCAGCAAAGCTTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCAGGCACCCTGGAGTTTATCAATGAAGACTTCAATTGGACTGGAGTCGCTCAGGATGGGAAAAGCTATTCTTGCAAAAGGGGATCTGTTAACAGTTTCTTTAGTAGATTGAATTGGTTGCACAAATTAGAATACAAATATCCAGCGCTGAACGTGACTATGCCAAACAATGGCAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGAGCACGGACAGTGACCAAACCAGCCTATATGTTCGAGCATCAGGGGGAGTCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGGTCCAGACCCTGGGTAAGGGGTCTGTCCAGTAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAATAGCACAGGGAATCTAATTGCTCCTCGGGGTTACTTCAAAATGCGAAATGGGAAAAGCTCAATAATGAGGTCAGATGCACCCATTGGCAACTGCAGTTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCTTTTCAAAATGTAAACAGGATCACATATGGGGCCTGCCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGGAATGTACCAGAGAAACAAACTAGAGGCATATTCGGCGCAATCGCAGGTTTCATAGAAAATGGTTGGGAGGGAATGGTAGACGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGCACAGGACAAGCAGCAGATCTTAAAAGCACTCAAGCAGCAATCGACCAAATCAACGGGAAACTGAATAGGTTAATCGGTAAAACGAACGAGAAATTCCATCAAATCGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTCGAGAAATATGTTGAAGACACTAAAATAGATCTCTGGTCTTACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAGAACAAGGAAGCAACTGAGAGAAAATGCTGAGGACATGGGCAATGGTTGCTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGGTCAATCAGAAATGGAACTTATGACCATGATGTATACAGAGACGAAGCATTAAACAACCGGTTCCAGATCAAAGGTGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGCTTTTTGCTTTGTGTTGTTTTGCTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>CY092241
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCCGGAAATGACAACAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCAAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTGAAATATGCTACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTCCAAAATAAGAAATGGGACCTTTTTGTTGAACGCAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCACTCAAAACGGAACAAGCTCTGCTTGCATAAGGAGATCTAATAACAGTTTCTTTAGTAGATTGAATTGGTTGACCCACTTAAAATTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAAAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAATGACCAAATCTTCCTGTATGCTCAAGCATCAGGAAGAATCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGATCTAGACCCAGAGTAAGGAATATCCCCAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAATTCTGAGTGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATCGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAATAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATAGGTTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTCGAAGGGAGAATTCAAGACCTTGAGAAATATGTTGAGGACACCAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCACGATGTATACAGAGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGCGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>CY172223
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCCGGAGATGACAACAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGGTAGTGAAAACAATCACGAATGACCAAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTGGAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTCCAAAATAAGAAATGGGACCTTTTTGTTGAACGCAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCACTCAAAATGGAACAAGCTCTGCTTGCAAAAGAAGATCTAATAACAGTTTCTTTAGTAGATTGAATTGGTTGACCCACTTAAAATTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAAAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAATGACCAAATCTTCCTGTATGCTCAAGCATCAGGAAGAATCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATTGGATCTAGACCCAGAGTAAGGAATATCCCCAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAATTCTGAATGCATCACCCCAAATGGAAGCATTCCCAATGACAAACCATTTCAAAATGTAAACAGGATCACATATGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATCGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAATAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCAATCAAATCAATGGGAAGCTGAATAGGTTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTCGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAGAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCATGATGTATACAGAGATGAAGCATTAAACAACCGGTTCCAGATCAAAGGCGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>CY027075
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCTGGAAATGACAACAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCAAATTGAAGTTACTAATGCTACCGAGCTGGTTCAGAGTTCCTCAACAGGTGAAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTCCAAAATAAGAAATGGGACCTTTTTGTTGAACGCAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCACTCAAAACGGAACAAGCTCTGCTTGCATAAGGAGATCTAATAACAGTTTCTTTAGTAGATTGAATTGGTTGACCCACTTAAAATTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAAAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAATGACCAAGTCTTCCTGTATGCTCAAGCATCAGGAAGAATCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGATCTAGACCCAGAGTAAGGAATATCCCCAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATCGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAATAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATAGGTTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTCGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACCAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCACGATGTATACAGAGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGCGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>CY010020
+ATGAAGACTATCATTGCTTTGAGCTACATTTCATGTCTGGTTTTCGCTCAAAAACTTCCCGGAAATGACAACAGCACGGCAACGCTGTGCCTGGGACACCATGCAGTGCCAAACGGAACGCTAGTGAAAACAATCACGAATGACCAAATTGAAGTGACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTAGAATATGCGACGGTCCTCACCAAATCCTTGATGGAAAAAACTGCACACTGATAGATGCTCTATTAGGAGACCCTCATTGTGATGGCTTCCAAAATAAGGAATGGGACCTTTTTGTTGAACGCAGCAAAGCTTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCTTCCGGCACCCTGGAGTTTACCAATGAAAGCTTCAATTGGACTGGAGTCGCTCAGAATGGAACAAGCTATGCTTGCAAAAGGGGATCTGTTAAAAGTTTCTTTAGTAGATTGAATTGGTTGCACAAATTAGAATACAAATATCCAGCACTAAACGTGACTATGCCAAACAATGACAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGAGTACGGACAGTGACCAAACCAGCCTATATGTTCAATCATCAGGGAGAATCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAACCCCGAATATCGGGTCTAGACCCTGGGTAAGGGGTGTCTCCAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTACCAGCACAGGGAATCTAATTGCTCCTCGGGGTTACTTCAAAATACGAAGGGGGAAAAGCTCAATAATGAGGTCAGATGCACCCATTGACAACTGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCTTTTCAAAATGTAAACAGGATCACATATGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGGAATGTACCAGAGAAACAAACTAGAGGCATATTCGGCGCAATCGCAGGTTTCATAGAAAATGGTTGGGAGGGAATGGTAGACGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGCACAGGACAAGCAGCAGATCTTAAAAGCACTCAAGCAGCAATCAACCAAATCAACGGGAAACTGAATAGGTTAATCGAGAAAACGAACGAGAAATTTCATCAAATCGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTCGAGAAATATGTTGAAGACACTAAAATAGATCTCTGGTCTTACAACGCGGAGCTTCTTGTTGCCCTGGAGAATCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAGAACAAGGAAGCAACTGAGGGAAAATGCTGAGGACATGGGCAATGGTTGCTTCAAAATATACCACAAATGTGACAATGCATGCATAGGGTCAATCAGAAATGGAACTTATGACCATGATGTATACAGAGACGAAGCATTAAACAACCGGTTCCAGATCAAAGGTGTTGAGCTGAAATCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGCTTTTTGCTTTGTGTTGTTTTGCTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>KF761507
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCTGGAAATGACAATAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCGAATTGAAGTTACTAACGCTACTGAGCTGGTTCAGAATTCCTCAATAGGTGAAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTTCAAAATAAGAAATGGGACCTTTTTGTTGAACGAAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGGCTGGAGTCACTCAAAACGGAACAAGTTCTGCTTGCATAAGGGGATCTAATAGTAGTTTCTTTAGTAGATTAAATTGGTTGACCCACTTAAACTTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAACAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCAGGTACGGACAAGGACCAAATCTTCCTGTATGCTCAATCATCAGGAAGAATCACAGTATCTACCAAAAGAAGCCAACAAGCTGTAATCCCGAATATCGGATCTAGACCCAGAATAAGGAATATCCCTAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAAGTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAGCACTCTGAAATTGGCAACAGGAATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATAGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGATGGATGGTTGGTACGGTTTCAGGCATCTAAATTCTGAGGGAAGAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATCGATTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACAAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCACGATGTATACAGGGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGAGTTGAGCTGAAGTCAGGGTACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAGGGCAACATTAGGTGCAACATTTGCATT
+>CY006859
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCCGGAAATGACAACAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACAATAGTGAAAACAATCACGAATGACCAAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTGGAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTCCAAAATAAGAAATGGGACCTTTTTGTTGAACGCAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCACTCAGAATGGAACAAGCTCTGCTTGCAAAAGGAGATCTAATAAAAGTTTCTTTAGTAGATTGAATTGGTTGACCCATTTAAAATACAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAAAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAGTGACCAAATCAGCCTATATGCTCAAGCATCAGGAAGAATCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGATCTAGACCCAGGGTAAGGGATGTCTCCAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTCGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTTCAAAATGTAAACAGGATCACATATGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATCGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGACGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGCACAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCAACCAAATCAATGGGAAACTGAATAGGTTAATCGGGAAAACAAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTCGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAGGACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGGTCAATCAGAAATGGAACTTATGACCATGATGTATACAGAGATGAAGCATTAAACAACCGGTTCCAGATCAAAGGTGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>CY002136
+ATGAAGACTATCATTGCTTTGAGCTACATTTTATGTCTGGTTTTCGCTCAAAAACTTCCCGGAAATGACAACAGCACGGCAACGCTGTGCCTGGGACACCATGCAGTGCCAAACGGAACGCTAGTGAAAACAATCACGAATGACCAAATTGAAGTGACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTAGAATATGCGACAGTCCTCACCGAATCCTTGATGGAGAAAACTGCACACTGATAGATGCTCTATTGGGAGACCCTCATTGTGATGGCTTCCAAAATAAGGAATGGGACCTTTTTGTTGAACGCAGTAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACCCTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCGCTCAGAATGGAACAAGCTCTGCTTGCAAAAGGAGATCTATTAAAAGTTTCTTTAGTAGATTGAATTGGTTGCACCAATTAAAATACAAATATCCAGCACTGAACGTGACTATGCCAAACAATGACAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGAGTACGGACAGTGACCAAACCAGCCTATATGCTCAAGCATCAGGGAGAGTCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGATCTAGACCCTGGGTAAGGGGTGTCTCCAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTCGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGGTCAGATGCACCCATTGGCAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTTCAAAATGTAAACAGGATCACATATGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAACTGGCAACAGGGATGCGGAATGTACCAGAGAAACAAACTAGAGGCATATTCGGCGCAATCGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGACGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGCACAGGACAAGCAGCAGATCTTAAAAGCACCCAAGCAGCAATCAACCAAATCAACGGGAAACTGAATAGGTTAATCGAGAAAACGAACGAGAAATTCCATCAAATTGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTCGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCGTACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAGAACAAGGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGGTCAATCAGAAATGGAACTTATGACCATGATGTATACAGAGACGAAGCATTAAACAACCGGTTCCAGATCAAAGGTGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGTTTTGCTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>CY012760
+ATGAAGACTATCATTGCTTTGAGCTACATTTTATGTCTGGTTTTCGCTCAAAAACTTCCCGGAAATGACAACAGCACAGCAACGCTGTGCCTGGGACACCATGCAGTGCCAAACGGAACGCTAGTGAAAACAATCACGAATGATCAAATTGAAGTGACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTAGAATATGCGACAGTCCTCACCGAATCCTTGATGGAAAAAACTGCACACTGATAGATGCTCTATTGGGAGACCCTCATTGTGATGGCTTCCAAAATAAGGAATGGGACCTTTTTGTTGAACGCAGCAAAGCTTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCAGGCACCCTGGAGTTTATCAATGAAGACTTCAATTGGACTGGAGTCGCTCAGGATGGGAAAAGCTATGCTTGCAAAAGGGGATCTGTTAACAGTTTCTTTAGTAGATTGAATTGGTTGCACAAATTAGAATACAAATATCCAGCGCTGAACGTGACTATGCCAAACAATGGCAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGAGCACGGACAGTGACCAAACCAGCCTATATGTTCGAGCATCAGGGAGAGTCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGGTCTAGACCCTGGGTAAGGGGTCTGTCCAGTAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAATAGCACAGGGAATCTAATTGCTCCTCGGGGTTACTTCAAAATACGAAATGGGAAAAGCTCAATAATGAGGTCAGATGCACCCATTGGCAACTGCAGTTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCTTTTCAAAATGTAAACAGGATCACATATGGGGCCTGCCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGGAATGTACCAGAGAAACAAACTAGAGGCATATTCGGCGCAATCGCAGGTTTCATAGAAAATGGTTGGGAGGGAATGGTAGACGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGCACAGGACAAGCAGCAGATCTTAAAAGCACTCAAGCAGCAATCGACCAAATCAACGGGAAACTGAATAGGTTAATCGAGAAAACGAACGAGAAATTCCATCAAATCGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTCGAGAAATATGTTGAAGACACTAAAATAGATCTCTGGTCTTACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAGAACAAGGAAGCAACTGAGGGAAAATGCTGAGGACATGGGCAATGGTTGCTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGGTCAATCAGAAATGGAACTTATGACCATGATGTATACAGAGACGAAGCACTAAACAACCGGTTCCAGATCAAAGGTGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGCTTCTTGCTTTGTGTTGTTTTGCTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>CY011416
+ATGAAGACTATCATTGCTTTGAGCTACATTTCATGTCTGGTTTTCGCTCAAAAACTTCCCGGAAATGACAACAGCACGGCAACGCTGTGCCTGGGACACCATGCAGTGCCAAACGGGACGCTAGTGAAAACAATCACGAATGACCAAATTGAAGTGACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTAGAATATGCGACGGTCCTCACCAAATCCTTGATGGAAAAAACTGCACACTGATAGATGCTCTATTGGGAGACCCTCATTGTGATGGCTTCCAAAATAAGGAATGGGACCTTTTTGTTGAACGCAGCAAAGCTTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCTTCCGGCACCCTGGAGTTTACCAATGAAAGCTTCAATTGGACTGGAGTCGCTCAGAATGGAACAAGCTATGCTTGCAAAAGGGGATCTGTTAAAAGTTTCTTTAGTAGATTGAATTGGTTGCACAAATTAGAATACAAATATCCAGCACTAAACGTGACTATGCCAAACAATGACAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGAGTACGGACAGTGACCAAACCAGCCTATATGTTCAATCATCAGGGAGAGTCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAACCCCGAATATCGGGTCTAGACCCTGGGTAAGGGGTATCTCCAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTCGGGGTTACTTCAAAATACGAAGGGGGAAAAGCTCAATAATGAGGTCAGATGCACCCATTGACAACTGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCTTTTCAAAATGTAAACAGGATCACATATGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGGAATGTACCAGAGAAACAAACTAGAGGCATATTCGGCGCAATCGCAGGTTTCATAGAAAATGGTTGGGAGGGAATGGTAGACGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGCACAGGACAAGCAGCAGATCTTAAAAGCACTCAAGCAGCAATCAACCAAATCAACGGGAAACTGAATAGGTTAATCGAGAAAACGAACGAGAAATTTCATCAAATCGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTCGAGAAATATGTTGAAGACACTAAAATAGATCTCTGGTCTTACAACGCGGAGCTTCTTGTTGCCCTGGAGAATCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAGAACAAGGAAGCAACTGAGGGAAAATGCTGAGGACATGGGCAATGGTTGCTTCAAAATATACCACAAATGTGACAATGCATGCATAGGGTCAATCAGAAATGGAACTTATGACCATGATGTATACAGAGACGAAGCATTAAACAACCGGTTCCAGATCAAAGGTGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGCTTTTTGCTTTGTGTTGTTTTGCTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>KC892498
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCTGGAAATGACAACAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCAAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTGAAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTCCAAAATAAGAAGTGGGACCTTTTTGTTGAACGAAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCACTCAAAACGGAACAAGCTCTGCTTGCATAAGGAGATCTAATAGTAGTTTCTTTAGTAGATTGAATTGGTTGACCCACTTAAACTTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAACAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAAGGACCAAATCTTCCTGTATGCTCAATCATCAGGAAGAATTACAGTATCTACCAAAAGAAGCCAACAAGCTGTAATCCCGAATATCGGATCTAGACCCAGAATAAGGAATATCCCTAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAGCACTCTGAAATTGGCAACAGGAATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATAGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGATGGTTGGTACGGTTTCAGGCATCTAAATTCTGAGGGAAGAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATCGATTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTCGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCTCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGCTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATAACCACGATGTATACAGAGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGAGTTGAGCTGAAGTCAGGGTACAAAGACTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAGGGCAACATTAGGTGCAACATTTGCATT
+>JX913043
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCTGGAAATGACAATAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCAAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAATTCCTCAATAGGTGAAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTCCAAAATAAGAAATGGGACCTTTTTGTTGAACGAAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCACTCAAAACGGAACAAGTTCTGCTTGCATAAGGAGATCTAATAATAGTTTCTTTAGTAGATTAAATTGGTTGACCCACTTAAACTTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAACAATTTGACAAATTGTACGTTTGGGGGGTTCACCACCCGGGTACGGACAAGGACCAAATCTTCCTGTATGCTCAATCATCAGGAAGAATCACAGTATCTACCAAAAGAAGCCAACAAGCTGTAATCCCGAATATCGGATCTAGACCCAGAATAAGGAATATCCCTAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAAGTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAGCACTCTGAAATTGGCAACAGGAATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATAGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAAGAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATCGATTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCACGATGTATACAGAGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGAGTTGAGCTGAAGTCAGGGTACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAGGGCAACATTAGATGCAACATTTGCATT
+>CY172431
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCCGGAAATGACAACAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCAAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTGGAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTCCAAAATAAGAAATGGGACCTTTTTGTTGAACGCAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCACTCAAAACGGAACAAGCTCTGCTTGCAAAAGGAGATCTAATAACAGTTTCTTTAGTAGATTGAATTGGTTGACCCACTTAAAATTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAAAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAATGACCAAATCTTCCTGTATGCTCAAGCATCAGGAAGAATCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGGTCTAGACCCAGAGTAAGGAATATCCCCAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTTCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATCGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAATAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATAGGTTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTCGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCATGATGTATACAGAGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGCGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>CY011896
+ATGAAGACTATCATTGCTTTGAGCTACATTTTATGTCTGGTTTTCGCTCAAAAACTTCCCGGAAATGACAACAGCACAGCAACGCTGTGCCTGGGACATCATGCAGTGCCAAACGGAACGCTAGTGAAAACAATCACGAATGATCAAATTGAAGTGACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTAGAATATGCGACAGTCCTCACCGAATCCTTGATGGAAAAAACTGCACACTGATAGATGCTCTATTGGGAGACCCTCATTGTGATGGCTTCCAAAATAAGGAATGGGACCTTTTTGTTGAACGCAGCAAAGCTTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCAGGCACCCTGGAGTTTATCAATGAAGACTTCAATTGGACTGGAGTCGCTCAGGATGGGAAAAGCTATGCTTGCAAAAGGGGATCTGTTAACAGTTTCTTTAGTAGATTGAATTGGTTGCACAAATTAGAATACAAATATCCAGCGCTGAACGTGACTATGCCAAACAATGGCAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGAGCACGGACAGTGACCAAACCAGCCTATATGTTCGAGCATCAGGGAGAGTCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGGTTTAGACCCTGGGTAAGGGGTCTGTCCAGTAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAATAGCACAGGGAATCTAATTGCTCCTCGGGGTTACTTCAAAATACGAAATGGGAAAAGCTCAATAATGAGGTCAGATGCACCCATTGGCAACTGCAGTTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCTTTTCAAAATGTAAACAGGATCACATATGGGGCCTGCCCCAGATATGTTAAGCAAAACACTCTGAAGTTGGCAACAGGGATGCGGAATGTACCAGAGAAACAAACTAGAGGCATATTCGGCGCAATCGCAGGTTTCATAGAAAATGGTTGGGAGGGAATGGTAGACGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGCACAGGACAAGCAGCAGATCTTAAAAGCACTCAAGCAGCAATCGACCAAATCAACGGGAAACTGAATAGGTTAATCGAGAAAACGAACGAGAAATTCCATCAAATCGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTCGAGAAATATGTTGAAGACACTAAAATAGATCTCTGGTCTTACAACGCGGGGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAGAACAAGGAAGCAACTGAGGGAAAATGCTGAGGACATGGGCAATGGTTGCTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGGTCAATCAGAAATGGAACTTATGACCATGATGTATACAGAGACGAAGCATTAAACAACCGGTTCCAGATCAAAGGTGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGCTTTTTGCTTTGTGTTGTTTTGCTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>CY112669
+ATGAAGACTATCATTGCTTTGAGCTACATTTTATGTCTGGTGTTCGCTCAAAAACTTCCCGGAAATGACAACAGCACAGCAACGCTGTGCCTGGGACACCATGCAGTGCCAAACGGAACGCTAGTGAAAACAATCACGAATGATCAAATTGAAGTGACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTAGAATATGCGACAGTCCTCACCGAATCCTTGATGGAAAAAACTGCACACTGATAGATGCTCTATTGGGAGACCCTCATTGTGATGGCTTCCAAAATAAGGAATGGGACCTTTTTGTTGAACGCAGCAAAGCTTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCAGGCACCCTGGAGTTTATCAATGAAGACTTCAATTGGACTGGAGTCGCTCAGGATGGGAAAAGCTATGCTTGCAAAAGGGGATCTGTTAACAGTTTCTTTAGTAGATTGAATTGGTTGCACAAATTAGAATACAAATATCCAGCGCTGAACGTGACTATGCCAAACAATGGCAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGAGCACGGACAGTGACCAAACCAGCCTGTATGTTCGAGCATCAGGGAGAGTCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGGTCTAGACCCTGGGTAAGGGGCCTGTCCAGTAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAATAGCACAGGGAATCTAATTGCTCCTCGGGGTTACTTCAAAATACGAAATGGGAAAAGTTCAATAATGAGGTCAGATGCACCCATTGGCAACTGCAGTTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCTTTTCAAAATGTAAACAGGATCACATATGGGGCCTGCCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGGAATGTACCAGAGAAACAAACTAGAGGCATATTCGGCGCAATTGCAGGTTTCATAGAAAATGGTTGGGAGGGAATGGTAGACGGTTGGTACGGTTTCAGGCATCAGAATTCTGAGGGCACAGGACAAGCAGCAGATCTTAAAAGCACTCAAGCAGCAATCGACCAAATCAACGGGAAACTGAATAGGTTAATCGAGAAAACGAACGAGAAATTCCATCAAATCGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTCGAGAAATATGTTGAAGACACTAAAATAGATCTCTGGTCTTACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAGAACAAGGAAGCAACTGAGGGAAAATGCTGAGGACATGGGCAATGGTTGCTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCATGATGTATACAGAGACGAAGCATTAAACAACCGGTTCCAGATCAAAGGTGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGCTTTTTGCTTTGTGTTGTTTTGCTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>KJ938675
+ATGAAAACTGTCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCTGGAAATGACAATAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCGAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAATTCCTCAATAGGTGAAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTTCAAAATAAGAAATGGGACCTTTTTGTTGAAAGAAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGGCTGGAGTCACTCAAAACGGAACAAGTTCTGCTTGCATAAGGGGATCTAATAGTAGTTTCTTTAGTAGATTAAATTGGTTGACCCACTTAAACTTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAACAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAAGGACCAAATCTTCCTGTATGCTCAATCATCAGGAAGAATCACAGTATCTACCAAAAGAAGCCAACAAGCTGTAATCCCGAATATCGGATCTAGACCCAGAATAAGGAATATCCCTAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAAGTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAGCACTCTGAAATTGGCAACAGGAATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATAGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAAGAGGACAAGCAGCAGATCTAAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATCGATTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACAAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCACGATGTATACAGGGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGAGTTGAGTTGAAGTCAGGGTACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAGGGCAACATTAGGTGCAACATTTGCATT
+>CY114221
+ATGAAGACTATCATTGCTTTGAGCTACATTTTATGTCTGGTTTTCGCTCAAAAACTTCCCGGAAATGACAACAGCACAGCAACGCTGTGCCTGGGACACCATGCAGTGCCAAACGGAACGCTAGTGAAAACAATCACGAATGATCAAATTGAAGTGACTAATGCTACTGAGCTGGTTCAGAGTTCTCCAACAGGTAGAATATGCGACAGTCCTCACCGAATCCTTGATGGAAAGAACTGCACACTGATAGATGCTCTATTGGGAGACCCTCATTGTGATGGCTTCCAAAATAAGGAATGGGACCTTTTTGTTGAACGCAGCAAAGCTTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCAGGCACCCTGGAGTTTACCAACGAAAACTTCAATTGGACTGGAGTCGCTCAGGATGGGAAAAGCTATGCTTGCAAAAGGGGATCTGTTAACAGTTTCTTTAGTAGATTGAATTGGTTGCACAAATTAGACTACAAATATCCAGCGCTGAACGTGACTATGCCAAACAATGGCAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGAGCACGGACAGTGACCAAACCAGCCTATATGTCCGAGCATCAGGGAAAGTCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGGATATCGGGTATAGACCATGGGTAAGGGGTCTGTCCAGTAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAATAGCACAGGGAATCTAATTGCTCCTCGGGGTTACTTCAAAATACGAAATGGGAAAAGCTCAATAATGAGGTCAGATGCACCCATTGGCAACTGCAGTTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCTTTTCAAAATGTAAACAGGATCACATATGGGGCCTGCCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGGAATGTACCAGAGAAACAAACTAGAGGCATATTCGGCGCAATCGCAGGTTTCATAGAAAATGGTTGGGAGGGAATGGTAGACGGTTGGTACGGTTTCAGGCATCAGAATTCTGAGGGCACAGGACAAGCTGCAGATCTTAAAAGCACTCAAGCAGCAATCGACCAAATCAACGGGAAACTGAATAGGTTAGTCGAGAAAACGAACGAGAAATTCCATCAAATCGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTCGAGAAATATGTTGAAGACACTAAAATAGATCTCTGGTCTTACAATGCGGAGCTTCTTGTTGCTCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTATTTGAAAGAACAAGGAAGCAACTGAGGGAAAATGCTGAGGACATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGGTCAATCAGAAATGGAACTTATGACCATGATGTATACAGAGACGAAGCATTAAACAACCGGTTCCAGATCAAAGGTGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGCTTTTTGCTTTGTTTTGTTTTGCTTGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>CY088475
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCCGGAAATGACAACAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCAAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTGGAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTCCAAAATAAGAAATGGGACCTTTTTGTTGAACGCAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAACTGGACTGGAGTCACTCAGAATGGAACAAGCTCTGCTTGCAAAAGGAAATCTAATAAAAGTTTCTTTAGTAGATTGAATTGGTTGACCCACTTAAAATACAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAAAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAATGACCAAATCAGCCTATATGCTCAAGCATCAGGAAGAATCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGATCTAGACCCAGGGTAAGGGACGTCTCCAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTCGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTTCAAAATGTAAACAGGATCACATATGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATCGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGACGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGCACAGGACAAGCCGCAGATCTCAAAAGCACTCAAGCAGCAATCAACCAAATCAATGGGAAACTGAATAGGTTAATCGGGAAAACAAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTAGAGGGGAGAATTCAGGACCTCGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAGAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGGTCAATCAGAAATGGAACTTATGACCATGATGTATACAGAGATGAAGCATTAAACAACCGGTTCCAGATCAAAGGTGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>CY183153
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCTGGAAATGACAATAGCACGGCAACGCTGTGCCTTGGACACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCGAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAATTCCTCAATAGGTGAAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGTACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTTCAAAATAAGAAATGGGACCTTTTTGTTGAACGAAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCACTCAAAACGGAACAAGTTCTGCTTGCATAAGGAGATCTAATAGTAGTTTCTTTAGTAGATTAAATTGGTTGACCCACTTAAACTTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAACAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAAGGACCAAATCTTCCTGTATGCTCAATCATCAGGAAGAATCACAGTATCTACCAAAAGAAGCCAACAAGCTGTAATCCCGAATATCGGATCTAGACCCAGAATAAGGAATATCCCTAGCAGAATAAGCATCTATTGGACAATAGTAAAACCAGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAAGTCTGAATGCATCACTCCAAATGGAAGCATTCCAAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAGCACTCTGAAATTGGCAACAGGAATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATAGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAAGAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATCGATTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCACGATGTATACAGGGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGAGTTGAGCTGAAGTCAGGGTACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAGGGCAACATTAGGTGCAACATTTGCATT
+>CY112901
+ATGAAGACTATCATTGCTTTGAGCTACATTTTATGTCTGGTTTTCGCTCAAAAACTTCCCGGAAATGACAACAGCACGGCAACGCTGTGCCTGGGACACCATGCAGTGCCAAACGGAACGTTAGTGAAAACAATCACGAATGACCAAATTGAAGTGACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTAGAATATGCGACAGTCCTCACCGAATCCTTGATGGAGAAAACTGCACACTGATAGATGCTCTATTGGGAGACCCTCATTGTGATGGCTTCCAAAATAAGGAATGGGACCTTTTTGTTGAACGCAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACCCTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCGCTCAGAATGGAACAAGCTCTGCTTGCAAAAGGAGATCCATTAAAAGTTTCTTTAGTAGATTGAATTGGTTGCACCAATTAAAATACAAATATCCAGCACTGAACGTGACTATGCCAAACAATGACAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGAGTACGGACAGTGACCAAACCAGCCTATATGCTCAAGCATCAGGGAGAGTCACAGTCTCTACCAGAAGAAGCCAACAAACTGTAATCCCGAACATCGGATCTAGACCCTGGGTAAGGGGTGTCTCCAGCGGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTCGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGGTCAGATGCACCCATTGGCAAATGCAATTCTGAATGCATTACTCCAAATGGAAGCATTCCCAATGACAAACCATTTCAAAATGTAAACAGAATCACATATGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGGAATGTACCAGAGAAACAAACTAGAGGCATATTCGGCGCAATCGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGACGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGCACAGGACAAGCAGCAGATCTTAAAAGCACTCAAGCAGCAATCAACCAAATCAACGGGAAACTGAATAGGTTAATCGAGAAAACGAACGAGAAATTCCATCAAATTGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTCGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCGTACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAGAACAAGGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGGTCAATCAGAAATGGAACTTATGACCATGATGTATACAGAGACGAAGCATTAAACAACCGGTTCCAAATCAAAGGTGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGTTTTGCTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>CY000257
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCCGGAAATGACAACAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCAAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTGGAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTCCAAAATAAGAAATGGGACCTTTTTGTTGAACGCAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAACTGGACTGGAGTCACTCAGAATGGAACAAGCTCTGCTTGCAAAAGGAAATCTAATAAAAGTTTCTTTAGTAGATTGAATTGGTTGACCCACTTAAAATACAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAAAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAATGACCAAATCAGCCTATATGCTCAAGCATCAGGAAGAATCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGATCTAGACCCAGGGTAAGGGACGTCTCCAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTCGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTTCAAAATGTAAACAGGATCACATATGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGAAATGTACCAGAGAGACAAACTAGAGGCATATTTGGCGCAATCGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGACGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGCACAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCAACCAAATCAATGGGAAACTGAATAGGTTAATCGGGAAAACAAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTAGAGGGGAGAATTCAGGACCTCGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAGAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGGTCAATCAGAAATGGAACTTATGACCATGATGTATACAGAGATGAAGCATTAAACAACCGGTTCCAGATCAAAGGTGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>CY013701
+ATGAAGACTATCATTGCTTTGAGCTACATTTTATGTCTGGTTTTCGCTCAAAAACTTCCCGGAAATGACAACAGCACAGCAACGCTGTGCCTGGGACACCATGCAGTGCCAAACGGAACGCTAGTGAAAACAATCACGAATGATCAAATTGAAGTGACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTAGAATATGCGACAGTCCTCACCGAATCCTTGATGGAAAAAACTGCACACTGATAGATGCTCTATTGGGAGACCCTCATTGTGATGGCTTCCAAAATAAGGAATGGGACCTTTTTGTTGAACGCAGCAAAGCTTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCAGGCACCCTGGAGTTTATCAATGAAGACTTCAATTGGACTGGAGTCGCTCAGGATGGGAAAAGCTATTCTTGCAAAAGGGGATCTGTTAACAGTTTCTTTAGTAGATTGAATTGGTTGCACAAATTAGAATACAAATATCCAGCGCTGAACGTGACTATGCCAAACAATGACAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGAGCACGGACAGTGACCAAACCAGCCTATATGTTCGAGCATCAGGGAGAGTCACAGTCTCTACCAAAAGAAGTCAACAAACTGTAATCCCGAATATCGGGTCTAGACCCTGGGTAAGGGGTCTGTCCAGTAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAATAGCACAGGGAATCTAATTGCTCCTCGGGGTTACTTCAAAATACGAAATGGGAAAAGCTCAATAATGAGGTCAGATGCACCCATTGGCAACTGCAGTTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCTTTTCAAAATGTAAACAGGATCACATATGGGGCCTGCCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGGAATGTACCAGAGAAACAAACTAGAGGCATATTCGGCGCAATCGCAGGTTTCATAGAGAATGGTTGGGAGGGAATGGTAGACGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGCACAGGACAAGCAGCAGATCTTAAAAGCACTCAAGCAGCAATCGACCAAATCAACGGGAAACTGAATAGGTTAATCGAGAAAACGAACGAGAAATTCCATCAAATCGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTCGAGAAATATGTTGAAGACACTAAAATAGATCTCTGGTCTTACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAGAACAAGGAAGCAACTGAGGGAAAATGCTGAGGACATGGGCAATGGTTGCTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGGTCAATCAGAAATGGAACTTATGACCATGATGTATACAGAGACGAAGCATTAAACAACCGGTTCCAGATCAAAGGTGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGCTTTTTGCTTTGTGTTGTTTTGCTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>KC892480
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCTGGAAATGACAATAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCGAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAATTCCTCAATAGGTGAAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTCCAAAATAAGAAATGGGACCTTTTTGTTGAACGAAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCACTCAAAACGGAACAAGTTCTGCTTGCATAAGGAGATCTAATAATAGTTTCTTTAGTAGATTAAATTGGTTGACCCACTTAAACTTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAACAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAAGGACCAAATCTTCCTGTATGCTCAATCATCAGGAAGAATCACAGTATCTACCAAAAGAAGCCAACAAGCTGTAATCCCGAATATCGGATCTAGACCCAGAATAAGGAATATCCCTAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAAGTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAGCACTCTGAAATTGGCAACAGGAATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATAGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAAGAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATCGATTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCACGATGTATACAGAGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGAGTTGAGCTGAAGTCAGGGTACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAGGGCAACATTAGGTGCAACATTTGCATT
+>CY037703
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCTGGAAATGACAACAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCAAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTGAAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTCCAAAATAAGAAATGGGACCTTTTTGTTGAACGCAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCACTCAAAACGGAACAAGCTCTGCTTGCATAAGGAGATCTAATAACAGTTTCTTTAGTAGATTGAATTGGTTGACCCACTTAAAATTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAACAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCTGGTACGGACAATGACCAAATCTTCCTGTATGCTCAAGCATCAGGAAGAATCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGATCTAGACCCAGAGTAAGGAATATCCCTAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATCGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAAGAGGGCAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATAGATTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTCGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCACGATGTATACAGAGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGAGTTGAGCTGAAGTCAGGGTACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>CY172775
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCCGGAAATGACAACAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCAAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTGAAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTCCAAAATAAGAAATGGGACCTTTTTGTTGAACGCAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCACTCAAAACGGAACAAGCTCTGCTTGCATAAGGAGATCTAATAACAGTTTCTTTAGTAGATTGAATTGGTTGACCCACTTAAAATTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAAAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAATGACCAAACCTTCCTGTATGCTCAAGCATCAGGAAGAATCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGATCTAGACCCAGAGTAAGGAATATCCCCAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGAAATCTAATTGCTCCTAGGGGTTACTTCAAAATACAAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATCGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAATAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCGGCAATCGATCAAATCAATGGGAAGCTGAATAGGTTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAGTTCTCAGAAGTCGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACCAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCACGATGTATACAGAGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGCGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>FJ686933
+ATGAAGGCTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCTGGAAATGACAACAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCAAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTGAAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGATCCTCAGTGTGATGGCTTCCAAAATAAGAAATGGGACCTTTTTGTTGAACGCAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCACTCAAAACGGAACAAGCTCTGCTTGCATAAGGAGATCTAATAACAGTTTCTTTAGTAGATTGAATTGGTTGACCCACTTAAAATTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAACAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAATGACCAAATCTTCCTGTATGCTCAAGCATCAGGAAGAATCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGATCTAGACCCAGAGTAAGGGATATCCCTAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATCGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAAGAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATAGATTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTCGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCACGATGTATACAGAGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGAGTTGAGCTGAAGTCAGGGTACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>GQ385846
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCTGGAAATGACAACAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCAAATCGAAGTTACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTGAAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTCCAAAATAAGAAATGGGACCTTTTTGTTGAACGCAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCACTCAAAACGGAACAAGCTCTGCTTGCATAAGGAGATCTAATAACAGTTTCTTTAGTAGATTGAATTGGTTGACCCACTTAAAATTCAAATACCCAGCATTAAACGTGACTATGCCAAACAATGAACAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAATGACCAAATCTTCCTGTATGCTCAAGCATCAGGAAGAATCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGATCTAGACCCAGAGTAAGGAATATCCCTAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATCGCAGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAAGAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATAGATTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTCGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACCAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCACGATGTATACAGAGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGAGTTGAGCTGAAGTCAGGGTACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>CY006635
+ATGAAGACTATCATTGCTTTGAGCTACATTTTATGTCTGGTTTTCGCTCAAAAACTTCCCGGAAATGACAACAGCACGGCAACGCTGTGCCTGGGACACCATGCAGTGCCAAACGGAACGCTAGTGAAAACAATCACGAATGACCAAATTGAAGTGACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTAGAATATGCGACAGTCCTCACCGAATCCTTGATGGAGAAAACTGCACACTGATAGATGCTCTATTGGGAGACCCTCATTGTGATGGCTTCCAAAATAAGGAATGGGACCTTTTTGTTGAACGCAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACCCTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCGCTCAGAATGGAACAAGCTATGCTTGCAAAAGGAGATCTATTAAAAGTTTCTTTAGTAGATTGAATTGGTTGCACCAATTAAAATACAAATATCCAGCACTGAACGTGACTATGCCAAACAATGACAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGAGTACGGACAGTGACCAAGCCAGCCTATATGCTCAAGCATCAGGGAGAGTCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGATCTAGACCCTGGGTAAGGGGTGTCTCCAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTCGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGGTCAGATGCACCCATTGGCAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTTCAAAATGTAAACAGGATCACATATGGGGCCTGTCCCAGATATGTTAAGCAAAACACCCTGAAATTGGCAACAGGGATGCGGAATGTACCAGAGAAACAAACTAGAGGCATATTCGGCGCAATCGCAGGTTTCATAGAAAATGGTTGGGAGGGAATGGTAGACGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGCACAGGACAAGCAGCAGATCTTAAAAGCACTCAAGCAGCAATCAACCAAATCAACGGGAAACTGAATAGGTTAATCGAGAAAACGAACGAGAAATTCCATCAAATTGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTCGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCGTACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAGAACAAGGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGGTCAATCAGAAATGGAACTTATGACCATGATGTATACAGAGACGAAGCATTAAACAACCGGTTCCAGATCAAAGGTGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATGTCATGTTTTTTGCTTTGTGTTGTTTTGCTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>CY001912
+ATGAAGACTATCATTGCTTTGAGCTACATTTTATGTCTGGTTTTCGCTCAAAAACTTCCCGGAAATGACAACAGCACGGCAACGCTGTGCCTGGGACACCATGCAGTGCCAAACGGAACGCTAGTGAAAACAATCACGAATGACCAAATTGAAGTGACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTAGAATATGTGACAGTCCTCACCAAATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGATCCTCATTGTGATGGCTTCCAAAATAAGGAATGGGACCTTTTTGTTGAACGCAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCGCTCAGAATGGAACAAGCTCTGCTTGCAAAAGGAGATCTATTAAAAGTTTCTTTAGTAGATTGAATTGGTTGCACCAATTAAAATACAAATATCCAGCACTGAACGTGACTATGCCAAACAATGACAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGAGTACGGACAGTGACCAAACCAGCCTATATGCTCAAGCATCAGGGAGAGTCACAGTCTCTACCAAAAGAAGCCAACAAACAGTAATCCCGAATATCGGATCTAGACCCTGGGTAAGGGGTGTCTCCAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTCGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGGTCAGATGCACCCATTGGCAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTTCAAAATGTAAACAGGATCACATATGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGGAATGTACCAGAGAAACAAACTAGAGGCATATTCGGCGCAATCGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGACGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGCACAGGACAAGCAGCAGATCTTAAAAGCACTCAAGCAGCAATCAACCAAATCAACGGGAAACTGAATAGGTTAATCGAGAAAACGAATGAGAAATTCCATCAAATTGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTCGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCGTACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAGAACAAGGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGGTCAATCAGAAATGGAACTTATGACCATGATGTATACAGAGACGAAGCATTAAACAACCGGTTCCAGATCAAAGGTGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGTTTTGCTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>CY044748
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCTGGAAATGACAACAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCAAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTGAAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTCCAAAATAAGAAATGGGACCTTTTTGTTGAACGCAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCACTCAAAACGGAACAAGCTCTGCTTGCATAAGGAGATCTAATAACAGTTTCTTTAGTAGATTGAATTGGTTGACCCACTTAAAATTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAACAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAATGACCAAATCTTCCTGTATGCTCAAGCATCAGGAAGAATCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGATCTAGACCCAGAGTAAGGAATATCCCTAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATCGCAGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAAGAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATAGATTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTCGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACCAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCACGATGTATACAGAGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGAGTTGAGCTGAAGTCAGGGTACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>KF790403
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCTGGAAATGACAATAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCGAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAATTCCTCAATAGGTGAAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTTCAAAATAGGAAATGGGACCTTTTTGTTGAACGAAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGGCTGGAGTCACTCAAAACGGAACAAGTTCTGCTTGCATAAGGGGATCTAATAGTAGTTTCTTTAGTAGATTAAATTGGTTGACCCACTTAAACTTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAACAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAAGGACCAAATCTTCCTGTATGCTCAATCATCAGGAAGAATCACAGTATCTACCAAAAGAAGCCAACAAGCTGTAATCCCGAATATCGGATCTAGACCCAGAATAAGGAATATCCCTAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAAGTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAGCACTCTGAAATTGGCAACAGGAATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATAGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGATGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAAGAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATCGATTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACAAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCACGATGTATACAGGGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGAGTTGAGCTGAAGTCAGGGTACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAGGGCAACATTAGGTGCAACATTTGCATT
+>CY013693
+ATGAAGACTATCATTGCTTTGAGCTACATTTTATGTCTGGTTTTCGCTCAAAAACTTCCCGGAAATGACAACAGCACAGCAACGCTGTGCCTGGGACACCATGCAGTGCCAAACGGAACGCTAGTGAAAACAATCACGAATGATCAAATTGAAGTGACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTAGAATATGCGACAGTCCTCACCGAATCCTTGATGGAAAAAACTGCACACTGATAGATGCTCTATTGGGAGACCCTCATTGTGATGGCTTCCAAAATAAGGAATGGGACCTTTTTGTTGAACGCAGCAAAGCTTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCAGGCACCCTGGAGTTTATCAATGAAGACTTCAATTGGACTGGAGTCGCTCAGGATGGGAAAAGCTATGCTTGCAAAAGGGGATCTGTTAACAGTTTCTTTAGTAGATTGAATTGGTTGCACAAATTAGAATACAAATATCCAGCGCTGAACGTGACTATGCCAAACAATGGCAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGAGCACGGACAGTGACCAAACCAGCCTATATGTTCGAGCATCAGGGAGAGTCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGGTCTAGACCCTGGGTAAGGGGTCTGTCCAGTAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAATAGCACAGGGAATCTAATTGCTCCTCGGGGTTACTTCAAAATACGAAATGGGAAAAGCTCAATAATGAGGTCAGATGCACCCATTGGCAACTGCAGTTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCTTTTCAAAATGTAAACAGGATCACATATGGGGCCTGCCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGGAATGTACCAGAGAAACAAACTAGAGGCATATTCGGCGCAATCGCAGGTTTCATAGAAAATGGTTGGGAGGGAATGGTAGACGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGCACAGGACAAGCAGCAGATCTTAAAAGCACTCAAGCAGCAATCGACCAAATCAACGGGAAACTGAATAGGTTAATCGAGAAAACGAACGAGAAATTCCATCAAATCGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTCGAGAAATATGTTGAAGACACTAAAATAGATCTCTGGTCTTACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGGACAAACTGTTTGAAAGAACAAGGAAGCAACTGAGGGAAAATGCTGAGGACATGGGCAATGGTTGCTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGGTCAATCAGAAATGGAACTTATGACCATGATGTATACAGAGACGAAGCATTAAACAACCGGTTCCAGATCAAAGGTGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGCTTTTTGCTTTGTGTTGTTTTGCTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>CY002064
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCCGGAAATGACAACAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCAAATTGAAGTCACTAATGCTACTGAACTGGTTCAGAGTTCCTCAACAGGTGGAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTCCAAAATAAGAAATGGGACCTTTTTGTTGAACGCAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCACTCAAAATGGAACAAGCTCTGCTTGCAAAAGGAGATCTAATAACAGTTTCTTTAGTAGATTGAATTGGTTGACCCACTTAAAATTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAAAAATTTGACAAACTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAATGACCAAATCAGCCTATATGCTCAAGCATCAGGAAGAATCACAGTCTCTACCAAAAGAAGCCAACAAACCGTAATCCCGAGTATCGGATCTAGACCCAGGATAAGGGATGTCCCCAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTCGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTTCAAAATGTAAACAGGATCACATATGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATCGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTAGACGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAACAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCAACCAAATCAATGGGAAGCTGAATAGGTTGATCGGGAAAACAAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTCGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTGGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAGAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGGTCAATCAGAAATGGAACTTATGACCATGATGTATACAGAGATGAAGCATTAAACAACCGGTTCCAGATCAAAGGTGTTGAGTTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>CY006499
+ATGAAGACTATCATTGCTTTGAGCTACATTTTATGTCTGGTTTTCGCTCAAAAACTTCCCGGAAATGACAACAGCACGGCAACGCTGTGCCTGGGACACCATGCAGTGCCAAACGGAACGCTAGTGAAAACAATCACGAATGACCAAATTGAAGTGACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTAGAATATGCGACAGTCCTCACCGAATCCTTGATGGAGAAAACTGCACACTGATAGATGCTCTATTGGGAGACCCTCATTGTGATGGCTTCCAAAATAAGGAATGGGACCTTTTTGTTGAACGCAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACCCTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCGCTCAGAATGGAACAAGCTATGCTTGCAAAAGGAGATCTATTAAAAGTTTCTTTAGTAGATTGAATTGGTTGCACCAATTAAAATACAAATATCCAGCACTGAACGTGACTATGCCAAACAATGACAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGAGTACGGACAGTGACCAAACCAGCCTATATGCTCAAGCATCAGGGAGAGTCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGATCTAGACCCTGGGTAAGGGGTGTCTCCAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTCGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGGTCAGATGCACCCATTGGCAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTTCAAAATGTAAACAGGATCACATATGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGGAATGTACCAGAGAAACAAACTAGAGGCATATTCGGCGCAATCGCAGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGACGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGCACAGGACAAGCAGCAGATCTTAAAAGCACTCAAGCAGCAATCAACCAAATCAACGGGAAACTGAATAGGTTAATCGAGAAAACGAACGAGAAATTCCATCAAATTGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTCGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCGTACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAGAACAAGGAAGCAACTGAGGGAAAATGCTGAGGACATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGGTCAATCAGAAATGGAACTTATGACCATGATGTATACAGAGACGAAGCATTAAACAACCGGTTCCAGATCAAAGGTGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATGTCATGTTTTTTGCTTTGTGTTGTTTTGCTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>CY012224
+ATGAAGACTATCATTGCTTTGAGCTACATTTTATGTCTGGTTTTCGCTCAAAAACTTCCCGGAAATGACAACAGCACAGCAACGCTGTGCCTGGGACACCATGCAGTGCCAAACGGAACGCTAGTGAAAACAATCACGAATGATCAAATTGAAGTGACTAATGCTACTGAGCTGGTTCAGAGTTCCCCAACAGGTAGAATATGCAACAGTCCTCACCGGATCATTGATGGAAAGAACTGCACACTGATAGATGCTCTATTGGGAGACCCTCATTGTGATGGCTTCCAAAATAAGGAATGGGACCTTTTTGTTGAACGCAGCAAAGCTTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCAGGCACACTGGAGTTTATCAACGAAAACTTCAATTGGACTGGAGTCGCTCAGGATGGGAAAAGCTATGCTTGCAAAAGGGGATCTGTTAACAGTTTCTTTAGTAGATTGAATTGGTTGCACAAATTAGAATACAAATATCCAGCGCTGAACGTGACTATGCCAAACAATGGCAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGAGCACGGACAGTGACCAAACCAGCCTATATGTCCGAGCATCAGGGAGAGTCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCAGATATCGGGTATAGACCATGGGTAAGAGGTCTGTCCAGTAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAATAGCACAGGGAATCTAATTGCTCCTCGGGGTTACTTCAAACTACGAAATGGGAAAAGCTCAATAATGAGGTCAGATGCACCCATTGGCAACTGCAGTTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCTTTTCAAAATGTAAACAGGATCACTTATGGGGCCTGCCCCAGATATATTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGGAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATCGCAGGTTTCATAGAAAATGGTTGGGAGGGAATGGTAGACGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGCACAGGACAAGCTGCAGATCTTAAAAGCACTCAAGCAGCAATCGACCAAATCAACGGGAAACTGAATAGGTTAGTCGAGAAAACGAACGAGAAATTCCATCAAATCGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTCGAGAAATATGTTGAAGACACTAAAATAGATCTCTGGTCTTACAATGCGGAGCTTCTTGTTGCTCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAGAACAAAGAAGCAACTGAGGGAAAATGCTGAGGACATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGGTCAATCAGAAATGGAACTTATGACCATGATGTATACAGAGACGAAGCATTAAACAACCGGTTCCAGATCAAAGGTGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGCTTTTTGCTTTGTGTTGTTTTGCTTGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>CY006491
+ATGAAGACTATCATTGCTTTGAGCTACATTTTATGTCTGGTTTTCGCTCAAAAACTTCCCGGAAATGACAACAGCACGGCAACGCTGTGCCTGGGACACCATGCAGTGCCAAACGGAACGCTAGTGAAAACAATCACGAATGACCAAATTGAAGTGACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTAGAATATGCGACAGTCCTCACCGAATCCTTGATGGAGAAAACTGCACACTGATAGATGCTCTATTGGGAGACCCTCATTGTGATGACTTCCAAAATAAGGAATGGGACCTTTTTGTTGAACGCAGCAAAGCCTACAGCAACTGCTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACCCTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCGCTCAGAATGGAACAAGCTATGCTTGCAAAAGGAGATCTATTAAAAGTTTCTTTAGTAGATTGAATTGGTTGCACCAATTAAAATACAAATATCCAGCACTGAACGTGACTATGCCAAACAATGACAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGAGTACGGACAGTGACCAAACCAGCCTATATGCTCAAGCATCAGGGAGAGTCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGATCTAGACCCTGGGTAAGGGGTGTCTCCAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTCGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGGTCAGATGCACCCATTGGCAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTTCAAAATGTAAACAGGATCACATATGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGGAATGTACCAGAGAAACAAACTAGAGGCATATTCGGCGCAATCGCAGGTTTCATAGAAAATGGTTGGGAGGGAATGGTAGACGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGCACAGGACAAGCAGCAGATCTTAAAAGCACTCAAGCAGCAATCAACCAAATCAACGGGAAACTGAATAGGTTAATCGAGAAAACGAACGAGAAATTCCATCAAATTGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTCGAGAAATATGTTGAGGACACTAAAATAGATCTCTGGTCGTACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAGAACAAGGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGGTCAATCAGAAATGGGACTTATGACCATGATGTATACAGAGACGAAGCATTAAACAACCGGTTCCAGATCAAAGGTGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATGTCATGTTTTTTGCTTTGTGTTGTTTTGCTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>CY025643
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCTGGAAATGACAACAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCAAGTTGAAGTTACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTGAAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTCCAAAATAAGAAATGGGACCTTTTTGTTGAACGCAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCACTCAAAACGGAACAAGCTCTGCTTGCATAAGGAGATCCAATAACAGTTTCTTTAGTAGATTGAATTGGTTGACCCACTTAAAATTCAAATATCCAGCATTGAACGTGACTATGCCAAACAATGAAAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAATGACCAAATCTTCCTGTATGCTCAAGCATCAGGAAGAATCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGATCTAGACCCAGAGTAAGGAATATCCCCAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATCGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAATAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATAGGTTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTCGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACCAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCACGATGTATACAGAGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGCGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>KC526205
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCTGGAAATGACAATAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCGAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAATTCCTCAATAGGTGAAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTTCAAAATAAGAAATGGGACCTTTTTGTTGAACGAAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGATTCAATTGGGCTGGAGTCACTCAAAACGGAACAAGTTCTGCTTGCATAAGGGGATCTAATAGTAGTTTCTTTAGTAGATTAAATTGGTTGACCCACTTAAACTTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAACAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAAGGACCAAATCTTCCTGTATGCTCAATCATCAGGAAGAATCACAGTATCTACCAAAAGAAGCCAACAAGCTGTAATCCCGAATATCGGATCTAGACCCAGAATAAGGAATATCCCTAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAAGTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAGCACTCTGAAATTGGCAACAGGAATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATAGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGATGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAAGAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATCGATTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACAAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCACGATGTATACAGGGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGAGTTGAGCTGAAGTCAGGGTACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAGGGCAACATTAGGTGCAACATTTGCATT
+>CY012232
+ATGAAGACTATCATTGCTTTGAGCTACATTTTATGTCTGGTTTTCGCTCAAAAACTTCCCGGAAATGACAACAGCACAGCAACGCTGTGCCTGGGACACCATGCAGTGCCAAACGGAACGCTAGTGAAAACAATCACGAATGATCAAATTGAAGTGACTAATGCTACTGAGCTGGTTCAGAGTTCCCCAACAGGTAGAATATGCGACAGTCCTCACCGAATCCTTGATGGAAAGAACTGCACACTGATAGATGCTCTATTGGGAGACCCTCATTGTGATGGCTTCCAAAATAAGGAATGGGACCTTTTTGTTGAACGCAGCAAAGCTTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCAGGCACCCTGGAGTTTACCAACGAAAACTTCAATTGGACTGGAGTCGCTCAGGATGGGAAAAGCTATGCTTGCAAAAGGGGATCTGTTAACAGTTTCTTTAGTAGATTGAATTGGTTGCACAAATTAGAATACAAATATCCAGCGCTGAACGTGACTATGCCAAACAATGGCAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGAGCACGGACAGTGACCAAACCAGCCTATATGTCCGAGCATCAGGGAAAGTCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGGATATCGGGTATAGACCATGGGTAAGGGGTCTTTCCAGTAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAATAGCACAGGGAATCTAATTGCTCCTCGGGGTTACTTCAAAATACGAAATGGGAAAAGCTCAATAATGAGGTCAGATGCACCCATTGGCAACTGCAGTTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCTTTTCAAAATGTAAACAGGATCACATATGGGGCCTGCCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGGAATGTACCAGAGAAACAAACTAGAGGCATATTCGGCGCAATCGCAGGTTTCATAGAGAATGGTTGGGAGGGAATGGTAGACGGTTGGTACGGTTTCAGGCATCAGAATTCTGAGGGCACAGGACAAGCTGCAGATCTTAAAAGCACTCAAGCAGCAATCGACCAAATCAACGGGAAACTGAATAGGTTAGTCGAGAAAACGAACGAGAAATTCCATCAAATCGAAAAAGAATTCTCAGAAGTAGAAGGGAGAATTCAGGACCTCGAGAAATATGTTGAAGACACTAAAATAGATCTCTGGTCTTACAATGCGGAGCTTCTTGTTGCTCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTATTTGAAAGAACAAGGAAGCAACTGAGGGAAAATGCTGAGGACATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGGTCAATCAGAAATGGAACTTATGACCATGATGTATACAGAGACGAAGCATTAAACAACCGGTTCCAGATCAAAGGTGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGCTTTTTGCTTTGTGTTGTTTTGCTTGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
+>EU199367
+ATGAAGACTATCATTGCTTTGAGCTACATTCTATGTCTGGTTTTCGCTCAAAAACTTCCTGGAAATGACAACAGCACGGCAACGCTGTGCCTTGGGCACCATGCAGTACCAAACGGAACGATAGTGAAAACAATCACGAATGACCAAATTGAAGTTACTAATGCTACTGAGCTGGTTCAGAGTTCCTCAACAGGTGAAATATGCGACAGTCCTCATCAGATCCTTGATGGAGAAAACTGCACACTAATAGATGCTCTATTGGGAGACCCTCAGTGTGATGGCTTCCAAAATAAGAAATGGGACCTTTTTGTTGAACGCAGCAAAGCCTACAGCAACTGTTACCCTTATGATGTGCCGGATTATGCCTCCCTTAGGTCACTAGTTGCCTCATCCGGCACACTGGAGTTTAACAATGAAAGCTTCAATTGGACTGGAGTCACTCAAAACGGAACAAGCTCTGCTTGCATAAGGAGATCTAATAACAGTTTCTTTAGTAGATTGAATTGGTTGACCCACTTAAAATTCAAATACCCAGCATTGAACGTGACTATGCCAAACAATGAAAAATTTGACAAATTGTACATTTGGGGGGTTCACCACCCGGGTACGGACAATGACCAAGTCTTCCTGTATGCTCAAGCATCAGGAAGAATCACAGTCTCTACCAAAAGAAGCCAACAAACTGTAATCCCGAATATCGGATCTAGACCCAGAGTAAGGAATATCCCCAGCAGAATAAGCATCTATTGGACAATAGTAAAACCGGGAGACATACTTTTGATTAACAGCACAGGGAATCTAATTGCTCCTAGGGGTTACTTCAAAATACGAAGTGGGAAAAGCTCAATAATGAGATCAGATGCACCCATTGGCAAATGCAATTCTGAATGCATCACTCCAAATGGAAGCATTCCCAATGACAAACCATTCCAAAATGTAAACAGGATCACATACGGGGCCTGTCCCAGATATGTTAAGCAAAACACTCTGAAATTGGCAACAGGGATGCGAAATGTACCAGAGAAACAAACTAGAGGCATATTTGGCGCAATCGCGGGTTTCATAGAAAATGGTTGGGAGGGAATGGTGGATGGTTGGTACGGTTTCAGGCATCAAAATTCTGAGGGAATAGGACAAGCAGCAGATCTCAAAAGCACTCAAGCAGCAATCGATCAAATCAATGGGAAGCTGAATAGGTTGATCGGGAAAACCAACGAGAAATTCCATCAGATTGAAAAAGAATTCTCAGAAGTCGAAGGGAGAATTCAGGACCTTGAGAAATATGTTGAGGACACCAAAATAGATCTCTGGTCATACAACGCGGAGCTTCTTGTTGCCCTGGAGAACCAACATACAATTGATCTAACTGACTCAGAAATGAACAAACTGTTTGAAAAAACAAAGAAGCAACTGAGGGAAAATGCTGAGGATATGGGCAATGGTTGTTTCAAAATATACCACAAATGTGACAATGCCTGCATAGGATCAATCAGAAATGGAACTTATGACCACGATGTATACAGAGATGAAGCATTAAACAACCGGTTCCAGATCAAGGGCGTTGAGCTGAAGTCAGGATACAAAGATTGGATCCTATGGATTTCCTTTGCCATATCATGTTTTTTGCTTTGTGTTGCTTTGTTGGGGTTCATCATGTGGGCCTGCCAAAAAGGCAACATTAGGTGCAACATTTGCATT
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/fubar-in1.nhx	Thu Jan 17 04:22:13 2019 -0500
@@ -0,0 +1,1 @@
+((KF790010:0.001247,CY147300:0.000623):0.0,((CY168239:0.001872,(CY171039:0.001874,KF790389:0.000623):0.000624):0.0,((CY141224:0.001247,(CY147305:0.0,KF790037:0.000623):0.000623):0.0,(((KF790403:0.000623,KF761507:0.001876):0.0,KC526205:0.000623):0.0,((CY169303:0.0,(KF789585:0.000623,CY141202:0.000623):0.000623):0.000623,(((KJ667974:0.002501,KJ938675:0.001873):0.000623,CY134876:0.0):0.000623,((KF790414:0.001248,(KF790384:0.001245,KF790408:0.00125):0.0):0.0,((KF886352:0.001882,(KF790438:0.000623,CY134996:0.001873):0.000623):0.001875,(KF789591:0.001879,((KF790049:0.001255,(CY134956:0.000624,CY183153:0.000624):0.000626):0.001249,((CY168407:0.004394,CY183065:0.003128):0.0,(KF598733:0.002501,((KC892174:0.0,(KF685747:0.000624,CY168471:0.000625):0.00375):0.000624,(((KC892685:0.000624,KC892641:0.0):0.001874,KC893110:0.001249):0.0,(KC892480:0.0,(JX913043:0.001249,(KF551075:0.00125,((CY114509:0.0,(KC892889:0.0,KC893018:0.002498):0.005006):0.001877,(((KC892519:0.0,KC892498:0.000624):0.002497,KC892266:0.000623):0.001026,((KC892156:0.003756,(JX978746:0.001256,KC892407:0.001883):0.001875):0.00355,((KC535402:0.000623,(KC882488:0.002498,KC535387:0.001247):0.001872):0.0,(KC535363:0.000623,((KC535396:0.000623,(KC882883:0.0,KC882867:0.000623):0.003124):0.0,((KC535378:0.001872,KC535375:0.002498):0.0,(GQ385891:0.001248,((EU779522:0.001251,(CY037727:0.0,FJ179354:0.003124):0.0):0.000623,((GQ385889:0.005007,(FJ686933:0.001243,FJ179356:0.003117):0.0):0.000622,(CY173095:0.001245,(((CY173191:0.0,CY037703:0.001247):0.000622,CY035062:0.00249):0.0,((CY173255:0.001871,(CY044748:0.0,GQ385846:0.001247):0.000623):0.0,((CY027075:0.000623,(EU199367:0.0,CY172823:0.000623):0.0):0.000623,(((CY172847:0.000623,CY025643:0.0):0.000623,CY172839:0.000623):0.001247,(((CY026251:0.002497,CY092241:0.00125):0.000624,CY026019:0.000623):0.0,((CY025341:0.002502,(CY172775:0.001247,CY172903:0.000623):0.001248):0.000622,(EU199255:0.003134,(CY172431:0.000621,((CY172223:0.003127,(CY172191:0.001254,CY020069:0.000628):0.000621):0.0,((CY092217:0.003119,(CY025485:0.001283,EU516019:0.00059):0.008843):0.001868,(CY002080:0.000622,((CY002064:0.001873,(CY002456:0.000626,CY002048:0.002491):0.001243):0.003763,(AB434109:0.006307,(((CY088198:0.001245,CY088475:0.000621):0.0,CY000257:0.000621):0.002494,((CY112957:0.003135,CY006859:0.001253):0.000616,((CY000721:0.001243,(CY114493:0.0,CY090885:0.002483):0.002488):0.0,((CY001792:0.000621,(CY001600:0.00062,CY002368:0.001865):0.0):0.0,((CY002304:0.002489,(CY006163:0.001242,CY003632:0.00062):0.0):0.00062,(CY001920:0.003739,(CY001912:0.002498,((CY001504:0.0,CY006060:0.001241):0.00062,((CY001744:0.0,CY002136:0.00124):0.00062,((CY114309:0.003746,(CY006899:0.001874,CY112901:0.001863):0.002496):0.000618,(((CY006579:0.001245,CY006283:0.000621):0.001244,CY007979:0.001864):0.0,((CY006499:0.001241,(CY006491:0.001863,CY006635:0.00124):0.0):0.00062,(((CY036847:0.002495,CY010004:0.001867):0.000621,CY012200:0.000621):0.0,(((CY010028:0.001242,CY009732:0.001242):0.0,CY010012:0.002484):0.001875,(((CY010020:0.002497,CY011416:0.001237):0.001252,CY009484:0.00062):0.005658,((CY010036:0.0,(CY039879:0.002489,CY039880:0.000621):0.002487):0.003109,((CY010628:0.000619,(CY010716:0.002485,CY010516:0.001239):0.0):0.000619,((CY012728:0.0,CY013701:0.000621):0.001243,(((CY012760:0.001239,CY013200:0.001239):0.0,CY011888:0.005614):0.0,((CY013693:0.000619,(CY012184:0.002484,CY013669:0.00124):0.00124):0.0,((CY112669:0.004353,(CY112556:0.001861,CY011896:0.000619):0.00186):0.0,(CY112605:0.001243,(CY012224:0.006953,((CY012512:0.000619,(CY012896:0.00062,CY012232:0.00062):0.000621):0.0,(CY011848:0.0,(((CY011328:0.0,CY114221:0.000619):0.001241,CY011560:0.00124):0.0,((CY012456:0.000619,CY011824:0.00124):0.0,CY017283:0.000619):0.0):0.0):0.0):0.002439):0.008263):0.000618):0.0):0.0):0.000617):0.012609):0.000619):0.001215):0.003782):0.000613):0.006878):0.0):0.001862):0.0):0.0):0.001863):0.001862):0.001245):0.0):0.001241):0.021084):0.000623):0.00065):0.003713):0.002495):0.0):0.005637):0.00313):0.002515):0.001876):0.0):0.000623):0.0):0.003749):0.0):0.0):0.000623):0.000623):0.001872):0.002503):0.0):0.0):0.000623):0.001468):0.00189):0.002721):0.002524):0.0):0.000624):0.0):0.0):0.0):0.000623):0.001248):0.001255):0.000619):0.0):0.0):0.0):0.000623):0.0):0.0):0.0):0.0;
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/fubar-out1.json	Thu Jan 17 04:22:13 2019 -0500
@@ -0,0 +1,3909 @@
+{
+ "analysis":{
+   "info":"Perform a Fast Unbiased AppRoximate Bayesian (FUBAR)\n    analysis of a coding sequence alignment to determine whether some\n    sites have been subject to pervasive purifying or diversifying\n    selection.\n\n    Please note that a FUBAR analysis generates a cache and a results JSON file in the same directory as\n    directory as the original alignment. HyPhy needs to have write\n    privileges to this directory. For example if the original file is in\n    /home/sergei/FUBAR/data/pol.nex then at the end of a FUBAR run, there\n    will also exist FUBAR-generated files /home/sergei/FUBAR/data/pol.nex.FUBAR.json,\n    /home/sergei/FUBAR/data/pol.nex.fubrar.cache. They also\n    provide checkpointing so that a partially completed analysis can be\n    restarted.",
+   "version":"2.0",
+   "citation":"FUBAR: a fast, unconstrained bayesian approximation for inferring selection (2013), Mol Biol Evol. 30(5):1196-205",
+   "authors":"Sergei L Kosakovsky Pond",
+   "contact":"spond@temple.edu",
+   "requirements":"in-frame codon alignment (possibly partitioned) and a phylogenetic tree (one per partition)"
+  },
+ "input":{
+   "file name":"/tmp/tmpZU5xzE/job_working_directory/002/2526/working/fubar_input.fa",
+   "number of sequences":163,
+   "number of sites":566,
+   "partition count":1,
+   "trees":{
+     "0":"(KF790010:0.001247,CY147300:0.000623,((CY168239:0.001872,(CY171039:0.001874,KF790389:0.000623)Node7:0.000624)Node5:1e-10,((CY141224:0.001247,(CY147305:1e-10,KF790037:0.000623)Node13:0.000623)Node11:1e-10,(((KF790403:0.000623,KF761507:0.001876)Node18:1e-10,KC526205:0.000623)Node17:1e-10,((CY169303:1e-10,(KF789585:0.000623,CY141202:0.000623)Node25:0.000623)Node23:0.000623,(((KJ667974:0.002501,KJ938675:0.001873)Node30:0.000623,CY134876:1e-10)Node29:0.000623,((KF790414:0.001248,(KF790384:0.001245,KF790408:0.00125)Node37:1e-10)Node35:1e-10,((KF886352:0.001882,(KF790438:0.000623,CY134996:0.001873)Node43:0.000623)Node41:0.001875,(KF789591:0.001879,((KF790049:0.001255,(CY134956:0.000624,CY183153:0.000624)Node51:0.000626)Node49:0.001249,((CY168407:0.004394,CY183065:0.003128)Node55:1e-10,(KF598733:0.002501,((KC892174:1e-10,(KF685747:0.000624,CY168471:0.000625)Node63:0.00375)Node61:0.000624,(((KC892685:0.000624,KC892641:1e-10)Node68:0.001874,KC893110:0.001249)Node67:1e-10,(KC892480:1e-10,(JX913043:0.001249,(KF551075:0.00125,((CY114509:1e-10,(KC892889:1e-10,KC893018:0.002498)Node81:0.005006)Node79:0.001877,(((KC892519:1e-10,KC892498:0.000624)Node86:0.002497,KC892266:0.000623)Node85:0.001026,((KC892156:0.003756,(JX978746:0.001256,KC892407:0.001883)Node93:0.001875)Node91:0.00355,((KC535402:0.000623,(KC882488:0.002498,KC535387:0.001247)Node99:0.001872)Node97:1e-10,(KC535363:0.000623,((KC535396:0.000623,(KC882883:1e-10,KC882867:0.000623)Node107:0.003124)Node105:1e-10,((KC535378:0.001872,KC535375:0.002498)Node111:1e-10,(GQ385891:0.001248,((EU779522:0.001251,(CY037727:1e-10,FJ179354:0.003124)Node119:1e-10)Node117:0.000623,((GQ385889:0.005007,(FJ686933:0.001243,FJ179356:0.003117)Node125:1e-10)Node123:0.000622,(CY173095:0.001245,(((CY173191:1e-10,CY037703:0.001247)Node132:0.000622,CY035062:0.00249)Node131:1e-10,((CY173255:0.001871,(CY044748:1e-10,GQ385846:0.001247)Node139:0.000623)Node137:1e-10,((CY027075:0.000623,(EU199367:1e-10,CY172823:0.000623)Node145:1e-10)Node143:0.000623,(((CY172847:0.000623,CY025643:1e-10)Node150:0.000623,CY172839:0.000623)Node149:0.001247,(((CY026251:0.002497,CY092241:0.00125)Node156:0.000624,CY026019:0.000623)Node155:1e-10,((CY025341:0.002502,(CY172775:0.001247,CY172903:0.000623)Node163:0.001248)Node161:0.000622,(EU199255:0.003134,(CY172431:0.000621,((CY172223:0.003127,(CY172191:0.001254,CY020069:0.000628)Node173:0.000621)Node171:1e-10,((CY092217:0.003119,(CY025485:0.001283,EU516019:0.00059)Node179:0.008843)Node177:0.001868,(CY002080:0.000622,((CY002064:0.001873,(CY002456:0.000626,CY002048:0.002491)Node187:0.001243)Node185:0.003763,(AB434109:0.006307,(((CY088198:0.001245,CY088475:0.000621)Node194:1e-10,CY000257:0.000621)Node193:0.002494,((CY112957:0.003135,CY006859:0.001253)Node199:0.000616,((CY000721:0.001243,(CY114493:1e-10,CY090885:0.002483)Node205:0.002488)Node203:1e-10,((CY001792:0.000621,(CY001600:0.00062,CY002368:0.001865)Node211:1e-10)Node209:1e-10,((CY002304:0.002489,(CY006163:0.001242,CY003632:0.00062)Node217:1e-10)Node215:0.00062,(CY001920:0.003739,(CY001912:0.002498,((CY001504:1e-10,CY006060:0.001241)Node225:0.00062,((CY001744:1e-10,CY002136:0.00124)Node229:0.00062,((CY114309:0.003746,(CY006899:0.001874,CY112901:0.001863)Node235:0.002496)Node233:0.000618,(((CY006579:0.001245,CY006283:0.000621)Node240:0.001244,CY007979:0.001864)Node239:1e-10,((CY006499:0.001241,(CY006491:0.001863,CY006635:0.00124)Node247:1e-10)Node245:0.00062,(((CY036847:0.002495,CY010004:0.001867)Node252:0.000621,CY012200:0.000621)Node251:1e-10,(((CY010028:0.001242,CY009732:0.001242)Node258:1e-10,CY010012:0.002484)Node257:0.001875,(((CY010020:0.002497,CY011416:0.001237)Node264:0.001252,CY009484:0.00062)Node263:0.005658,((CY010036:1e-10,(CY039879:0.002489,CY039880:0.000621)Node271:0.002487)Node269:0.003109,((CY010628:0.000619,(CY010716:0.002485,CY010516:0.001239)Node277:1e-10)Node275:0.000619,((CY012728:1e-10,CY013701:0.000621)Node281:0.001243,(((CY012760:0.001239,CY013200:0.001239)Node286:1e-10,CY011888:0.005614)Node285:1e-10,((CY013693:0.000619,(CY012184:0.002484,CY013669:0.00124)Node293:0.00124)Node291:1e-10,((CY112669:0.004353,(CY112556:0.001861,CY011896:0.000619)Node299:0.00186)Node297:1e-10,(CY112605:0.001243,(CY012224:0.006953,((CY012512:0.000619,(CY012896:0.00062,CY012232:0.00062)Node309:0.000621)Node307:1e-10,(CY011848:1e-10,(((CY011328:1e-10,CY114221:0.000619)Node316:0.001241,CY011560:0.00124)Node315:1e-10,((CY012456:0.000619,CY011824:0.00124)Node321:1e-10,CY017283:0.000619)Node320:1e-10)Node314:1e-10)Node312:1e-10)Node306:0.002439)Node304:0.008263)Node302:0.000618)Node296:1e-10)Node290:1e-10)Node284:0.000617)Node280:0.012609)Node274:0.000619)Node268:0.001215)Node262:0.003782)Node256:0.000613)Node250:0.006878)Node244:1e-10)Node238:0.001862)Node232:1e-10)Node228:1e-10)Node224:0.001863)Node222:0.001862)Node220:0.001245)Node214:1e-10)Node208:0.001241)Node202:0.021084)Node198:0.000623)Node192:0.00065)Node190:0.003713)Node184:0.002495)Node182:1e-10)Node176:0.005637)Node170:0.00313)Node168:0.002515)Node166:0.001876)Node160:1e-10)Node154:0.000623)Node148:1e-10)Node142:0.003749)Node136:1e-10)Node130:1e-10)Node128:0.000623)Node122:0.000623)Node116:0.001872)Node114:0.002503)Node110:1e-10)Node104:1e-10)Node102:0.000623)Node96:0.001468)Node90:0.00189)Node84:0.002721)Node78:0.002524)Node76:1e-10)Node74:0.000624)Node72:1e-10)Node66:1e-10)Node60:1e-10)Node58:0.000623)Node54:0.001248)Node48:0.001255)Node46:0.000619)Node40:1e-10)Node34:1e-10)Node28:1e-10)Node22:0.000623)Node16:1e-10)Node10:1e-10)Node4:1e-10)"
+    }
+  },
+ "fits":{
+   "Nucleotide GTR":{
+     "Log Likelihood":-7506.062471677546,
+     "estimated parameters":331,
+     "AIC-c":15676.51582297566,
+     "Equilibrium frequencies":[
+      [0.3365814708028934],
+      [0.1992564330464567],
+      [0.2239119281435395],
+      [0.2402501680071105]
+      ],
+     "Rate Distributions":{
+       "Substitution rate from nucleotide A to nucleotide C":0.2325974237345469,
+       "Substitution rate from nucleotide A to nucleotide G":1,
+       "Substitution rate from nucleotide A to nucleotide T":0.06339329733594212,
+       "Substitution rate from nucleotide C to nucleotide G":0.007769088370903177,
+       "Substitution rate from nucleotide C to nucleotide T":0.9319459934505461,
+       "Substitution rate from nucleotide G to nucleotide T":0.1767739885280695
+      },
+     "display order":0
+    }
+  },
+ "timers":{
+   "Overall":{
+     "timer":187,
+     "order":0
+    },
+   "Nucleotide Fit":{
+     "timer":2,
+     "order":1
+    },
+   "Grid Calculations":{
+     "timer":28,
+     "order":2
+    },
+   "MCMC on grid weight allocations":{
+     "timer":156,
+     "order":3
+    }
+  },
+ "MLE":{
+   "headers":[
+    ["alpha", "Mean posterior synonymous substitution rate at a site"],
+    ["beta", "Mean posterior non-synonymous substitution rate at a site"],
+    ["beta-alpha", "Mean posterior beta-alpha"],
+    ["Prob[alpha>beta]", "Posterior probability of negative selection at a site"],
+    ["Prob[alpha<beta]", "Posterior probability of positive selection at a site"],
+    ["BayesFactor[alpha<beta]", "Empiricial Bayes Factor for positive selection at a site"],
+    ["PSRF", "Potential scale reduction factor - an MCMC mixing measure"],
+    ["Neff", "Estimated effective sample site for Prob [alpha<beta]"]
+    ],
+   "content":{
+     "0":[
+      [2.334928054729291, 0.2529817697151248, -2.081946285014166, 0.8188189448731039, 0.1429155155424426, 0.4126822464878207, 1.009264597631995, 177.9860265817098],
+      [1.330868651262584, 0.6698950759748372, -0.6609735752877464, 0.6727232693065792, 0.2604216688174373, 0.8714710774972212, 1.01552312750036, 124.8918140212773],
+      [0.7117548260646998, 0.6698836896886068, -0.04187113637609297, 0.4373663333548886, 0.4976550288082452, 2.451807543650687, 1.010670575721036, 162.3676049186483],
+      [1.364901417852806, 0.7059449976774221, -0.6589564201753839, 0.663065765102583, 0.2674153232324857, 0.9034174976034853, 1.014065756006747, 134.1438292250315],
+      [0.8789701966315052, 0.3275055332809348, -0.5514646633505704, 0.69266092973228, 0.2513023379988544, 0.8307112483915374, 1.002425828111919, 338.1641517723739],
+      [0.8437686548673489, 0.3038621440195365, -0.5399065108478124, 0.7015052801269281, 0.2415000393962996, 0.7879917713483965, 1.001784988231137, 369.6902442245855],
+      [0.6408805179020273, 0.4070759323743263, -0.2338045855277009, 0.5903493842543279, 0.3448417540889444, 1.302667784641027, 1.002621590350805, 329.5890265409098],
+      [0.9014924157857125, 0.2865136631226748, -0.6149787526630377, 0.7235258796884531, 0.2217291347545042, 0.7051021329532657, 1.002003492678128, 358.2938572170438],
+      [0.747375221662401, 0.7506326579210557, 0.003257436258654711, 0.4214520602107312, 0.5128670143554441, 2.605657134553097, 1.008380794056198, 189.4824140163673],
+      [0.8789701966315052, 0.3275055332809348, -0.5514646633505704, 0.69266092973228, 0.2513023379988544, 0.8307112483915374, 1.002425828111919, 338.1641517723739],
+      [1.146791153256969, 0.9292050882968201, -0.2175860649601489, 0.5556515010298497, 0.362847854199738, 1.409423304041523, 1.004609008811675, 262.286395076501],
+      [1.661806722745329, 0.6511350807557146, -1.010671641989614, 0.7244295992220325, 0.2151091001194141, 0.6782808076258131, 1.02086599883773, 99.88686762641869],
+      [2.275127276347966, 0.8967101316063741, -1.378417144741592, 0.7975819651104823, 0.1106507975429907, 0.3079230980667819, 1.021417611952663, 97.88110777894498],
+      [1.727784307866187, 0.2729525103443952, -1.454831797521792, 0.8939276251524977, 0.08102540293062209, 0.2182115488598922, 1.014703982336367, 129.9237467680591],
+      [1.845532345024739, 0.289034108065027, -1.556498236959712, 0.8930254022812326, 0.08166555024006614, 0.2200888570746531, 1.014445708235636, 131.5981580186659],
+      [1.46905222428635, 0.6300889727614578, -0.8389632515248917, 0.7111517487782333, 0.2278246311539174, 0.7302049465391781, 1.020261753737928, 102.1845037866413],
+      [0.9444540669483967, 0.3575106756104039, -0.5869433913379928, 0.6865353752944214, 0.2588678624946797, 0.8644552791274397, 1.003330330066721, 301.9094206827929],
+      [0.8054321836138222, 0.665914298173697, -0.1395178854401252, 0.4669576984485326, 0.4684481196298084, 2.181101518943698, 1.010916372347724, 159.9203070690993],
+      [1.716371884208716, 0.2895629757921966, -1.426808908416519, 0.8855199951889517, 0.08774910372601753, 0.2380610964542449, 1.013228744792253, 140.125952349898],
+      [2.599787403768866, 0.2328866814601011, -2.366900722308765, 0.965183198827288, 0.02390355482607629, 0.06060797863418626, 1.025869058489618, 84.317611943847],
+      [0.7254615271913989, 0.6219275206301165, -0.1035340065612824, 0.4625441775108931, 0.4730002875301002, 2.221319686019841, 1.012123409134349, 148.9213077321349],
+      [0.7582928661187955, 1.037410921737955, 0.2791180556191599, 0.3057753253171794, 0.6242023712526328, 4.110847989108807, 0.9994957386091985, 555.5057620025786],
+      [0.8970686266384508, 0.2962209913993141, -0.6008476352391366, 0.7161823508436315, 0.2287950897563492, 0.7342381610667212, 1.002105913598215, 353.1927933056136],
+      [1.610174543834446, 0.6506099557530386, -0.9595645880814075, 0.7190777760010177, 0.2198332398553266, 0.6973743292566328, 1.020444663772872, 101.4774770723108],
+      [0.9014924157857125, 0.2865136631226748, -0.6149787526630377, 0.7235258796884531, 0.2217291347545042, 0.7051021329532657, 1.002003492678128, 358.2938572170438],
+      [1.248690570078649, 1.040489369148725, -0.2082012009299234, 0.490333250559121, 0.4108269628407503, 1.725742975331943, 0.9989380874585089, 633.3876939733356],
+      [0.8606419912113049, 0.302976401582314, -0.5576655896289909, 0.7051893492617515, 0.2384306071191618, 0.7748409447762756, 1.001897755067703, 363.7187450907838],
+      [0.731068775704817, 0.3244176675508255, -0.4066511081539915, 0.6637258725613833, 0.2747326605184377, 0.9375020159960894, 1.001564425468852, 381.9619623667288],
+      [0.564806099957197, 0.4146369877854267, -0.1501691121717703, 0.5595327187522922, 0.3724462711940186, 1.46883412970608, 1.00277378579811, 323.220219714781],
+      [0.8882249441693671, 0.3172865720399499, -0.5709383721294172, 0.7007791696166791, 0.2436218023822329, 0.7971447477653065, 1.002348321846302, 341.6852605085693],
+      [1.398752516224379, 0.3266596896425376, -1.072092826581842, 0.8447394197459255, 0.1210989511988889, 0.3410047575674728, 1.007457693069664, 203.229920341033],
+      [3.330384550306216, 0.198220202360691, -3.132164347945525, 0.9914890212468939, 0.005017656612692305, 0.01248089132680519, 1.026424082240162, 82.89584090753532],
+      [4.34855081578978, 0.2385830331486189, -4.109967782641161, 0.993289379805681, 0.003578203287971071, 0.008887545360117457, 1.013634358567416, 137.1599563021884],
+      [0.9139051127103903, 0.3142478474187145, -0.5996572652916758, 0.7071646828556413, 0.2381072007503703, 0.7734614970219971, 1.002531005166252, 333.5016749599022],
+      [0.8606419912113049, 0.302976401582314, -0.5576655896289909, 0.7051893492617515, 0.2384306071191618, 0.7748409447762756, 1.001897755067703, 363.7187450907838],
+      [1.636311078229619, 0.277000203646784, -1.359310874582835, 0.886656708577761, 0.08685688326238888, 0.2354102835850044, 1.013074132255221, 141.2915578611352],
+      [0.8545532705256456, 0.3185574369063932, -0.5359958336192524, 0.6937654623349651, 0.2494780908946445, 0.8226764709239547, 1.002098052851177, 353.5790905851457],
+      [0.8910433359442418, 0.3103357814592619, -0.5807075544849798, 0.7057855884293825, 0.2388019956728835, 0.7764265002122339, 1.002266581537338, 345.479962660838],
+      [2.799988024778473, 0.211797179008831, -2.588190845769641, 0.9741711880280872, 0.01769751252159501, 0.04458892720248249, 1.030804724353583, 73.22092799037055],
+      [1.489047583366108, 0.2827713141364914, -1.206276269229617, 0.8741779596642395, 0.09689833617050196, 0.265545971017233, 1.010179602421502, 167.4931149984661],
+      [1.576208416040454, 1.150103037218979, -0.426105378821475, 0.5171082014344022, 0.3730987738161031, 1.472938932209509, 1.00214828330284, 351.1252429729947],
+      [1.48705709927087, 0.2847636257587705, -1.2022934735121, 0.8730080111884162, 0.09785598634712848, 0.2684550426678145, 1.010070445858612, 168.6779968419034],
+      [2.022714093883532, 0.2609373413010526, -1.76177675258248, 0.9133433718658122, 0.06559542378281648, 0.1737395228582566, 1.01870696647044, 108.6347891672316],
+      [0.8549361465828247, 0.3175902642751303, -0.5373458823076944, 0.6944796931021142, 0.2487874201581454, 0.8196446407715443, 1.002085383609697, 354.2034904382638],
+      [0.7871260302852221, 0.3391963520899104, -0.4479296781953117, 0.6670270080830214, 0.2736441503670521, 0.9323882015745496, 1.002009915419368, 357.9696003076922],
+      [1.234646771416405, 0.6627604065396102, -0.5718863648767947, 0.6592281327493912, 0.2731262632248376, 0.9299605477826837, 1.014268050303753, 132.7759721440429],
+      [0.7678559233220421, 0.6682649815070689, -0.09959094181497319, 0.4556699140063921, 0.4795209853671019, 2.280155330207295, 1.010715466007633, 161.9149407965095],
+      [1.864261753295295, 0.2487574053057675, -1.615504347989527, 0.9119661608583532, 0.06666766243254944, 0.1767823706353149, 1.01899313881809, 107.3848069936764],
+      [1.735060885435944, 1.442393200332108, -0.2926676851038366, 0.4760642704293227, 0.396581697916482, 1.626575506750737, 1.006575653204647, 218.4122426955813],
+      [1.579206772620022, 1.121741502434355, -0.4574652701856665, 0.5248733922751141, 0.3673327208439127, 1.436958682443888, 1.001973392101725, 359.8214523869966],
+      [2.031296663492567, 0.2517586171363031, -1.779538046356264, 0.9175811704276262, 0.06226910614303234, 0.1643442244825297, 1.02003551053371, 103.0733194258337],
+      [2.545547606025438, 0.2342407695111815, -2.311306836514257, 0.963480678639183, 0.02514163269096192, 0.06382811114293675, 1.025700635238408, 84.75921658842476],
+      [1.728532392870302, 0.2710492273305821, -1.45748316553972, 0.894864883312364, 0.08027457973179022, 0.2160130004877936, 1.014877438721895, 128.8236266839655],
+      [1.666253134882989, 0.6587471235345317, -1.007506011348457, 0.7216870830201858, 0.2171056389597238, 0.6863220905663464, 1.020385392689962, 101.7054700565073],
+      [0.8437686548673489, 0.3038621440195365, -0.5399065108478124, 0.7015052801269281, 0.2415000393962996, 0.7879917713483965, 1.001784988231137, 369.6902442245855],
+      [2.714414646718411, 0.2316840570636525, -2.482730589654758, 0.968045079382016, 0.02181279056304786, 0.05518858875084329, 1.025768777842703, 84.57996492368565],
+      [1.601047273625993, 0.2704462410455785, -1.330601032580415, 0.8877281886550547, 0.0859615698244004, 0.2327554834169463, 1.012887523508062, 142.7251987638037],
+      [2.258656520881252, 0.9024763792854682, -1.356180141595784, 0.7944942746781457, 0.1129005357805631, 0.3149805412738741, 1.021299071909176, 98.3050440035498],
+      [1.741694191338295, 0.2723882369393481, -1.469305954398947, 0.8949664538993078, 0.08019426954996199, 0.2157780500020973, 1.014935074367698, 128.4623168080227],
+      [0.7639024563024699, 0.3740784304625536, -0.3898240258399163, 0.6413181162421357, 0.2983788177879768, 1.052507831016882, 1.002420227588988, 338.4161220257555],
+      [0.7384128616769685, 4.353870625798552, 3.615457764121584, 0.01251358582918556, 0.9314626447575398, 33.63551952593989, 1.009828018605351, 171.3718626698946],
+      [1.609909789242531, 0.2955877315834022, -1.314322057659129, 0.8759740996191538, 0.09547988341540148, 0.26124842988823, 1.011529869354864, 154.1292811390007],
+      [0.7220371412127122, 0.7731395219740113, 0.05110238076129903, 0.4071255917167266, 0.5272447074249986, 2.760170235783571, 1.007993282291088, 195.0158593242769],
+      [0.7367458101123854, 3.920420752796247, 3.183674942683862, 0.02469551719022282, 0.9154688122513377, 26.80319841186859, 1.010010064114716, 169.3408310466002],
+      [0.7136955779011382, 0.6096842585413942, -0.1040113193597441, 0.464591565122131, 0.4709905181037303, 2.203478141843597, 1.012486768952336, 145.9073859931525],
+      [0.7627156139654115, 1.482603969298073, 0.7198883553326619, 0.1992242678619112, 0.7263427168048413, 6.56892969894005, 0.9973313817264072, 1064.983281197844],
+      [3.12685011917063, 0.2435196200425888, -2.883330499128042, 0.944508254322499, 0.04136529289635905, 0.1067930510428722, 1.02187306933283, 96.28703124301352],
+      [1.847884591630838, 0.2680777748608353, -1.579806816770003, 0.9024732220144125, 0.07420666688180004, 0.1983759022247646, 1.016548640172158, 119.1311998484602],
+      [0.7162392113455963, 4.432296029375165, 3.716056818029568, 0.01102616831313428, 0.9372992036526233, 36.99689102101689, 1.009537709256199, 174.7159164791054],
+      [0.7682687289762392, 0.6166623369271529, -0.1516063920490863, 0.4783519494847079, 0.4576268724420132, 2.088206263341982, 1.012477532947451, 145.9824436700914],
+      [0.8378709714781074, 0.3194529237979746, -0.5184180476801328, 0.6900328748850731, 0.2526202532655927, 0.836540324505715, 1.001993293243286, 358.8100050706929],
+      [2.996998872067214, 0.2310326086889255, -2.765966263378288, 0.9733224407204274, 0.01800487195069578, 0.04537751854136669, 1.024689362712507, 87.51610431578531],
+      [2.472624904784596, 1.500640589405435, -0.971984315379161, 0.5998757565120511, 0.2355220767176777, 0.7624769385044851, 1.017646314091325, 113.5430612618739],
+      [0.7871260302852221, 0.3391963520899104, -0.4479296781953117, 0.6670270080830214, 0.2736441503670521, 0.9323882015745496, 1.002009915419368, 357.9696003076922],
+      [1.464209212237155, 1.180146058253727, -0.2840631539834286, 0.4924969929574926, 0.3969744222575017, 1.629246628273571, 1.001410702451538, 391.0132208350053],
+      [0.9206027889504963, 0.2988138267809606, -0.6217889621695356, 0.7183615617347812, 0.2273629844284903, 0.7282899043609945, 1.002369001746807, 340.7385402048528],
+      [2.780882181569706, 0.2117607624941455, -2.569121419075561, 0.9738501722268774, 0.01793009923716021, 0.045185628937245, 1.030907914348205, 73.0214824913912],
+      [3.682661506056562, 1.021960779133022, -2.660700726923539, 0.8009224898166168, 0.1093331355382678, 0.303806139970764, 1.011900866738218, 150.8311552327723],
+      [4.335667378684154, 0.2374557231341473, -4.098211655550007, 0.9933209179682609, 0.003570388001828459, 0.008868064188244502, 1.013807735049472, 135.9311699430306],
+      [1.850240148619735, 0.267998817323069, -1.582241331296666, 0.9026244594958716, 0.07408629704100828, 0.198028371533122, 1.016579840229684, 118.9645177114621],
+      [0.8549361465828247, 0.3175902642751303, -0.5373458823076944, 0.6944796931021142, 0.2487874201581454, 0.8196446407715443, 1.002085383609697, 354.2034904382638],
+      [1.920102903591671, 0.3235149013231854, -1.596588002268486, 0.9098846565184038, 0.06445764644070756, 0.1705183138149675, 1.011541612852306, 154.0226169595155],
+      [1.265357149497031, 0.2842865437782062, -0.9810706057188253, 0.7690854950306439, 0.1853149385524942, 0.5629641195726505, 1.006033987260548, 228.9374825707941],
+      [0.9206027889504963, 0.2988138267809606, -0.6217889621695356, 0.7183615617347812, 0.2273629844284903, 0.7282899043609945, 1.002369001746807, 340.7385402048528],
+      [2.723619291224575, 0.2190288183039217, -2.504590472920654, 0.9711991949093111, 0.01974625922797105, 0.04985472956820568, 1.029035886497996, 76.8277641252977],
+      [0.6283723130404157, 0.4108805621366812, -0.2174917509037345, 0.5844466770929027, 0.3502757458708007, 1.33426172002277, 1.00266779096141, 327.6290230850982],
+      [1.274922858553647, 0.3688121780664225, -0.9061106804872249, 0.8125899392363098, 0.1480548353888764, 0.4301015349181124, 1.005360142238172, 243.5655346330683],
+      [0.8642106624037235, 0.2944364985785053, -0.5697741638252182, 0.7116338562842216, 0.2322009112194613, 0.7484733927102407, 1.001793245221228, 369.2462859577397],
+      [2.936066370792155, 0.2154293032534312, -2.720637067538723, 0.9756109707034988, 0.01661210866350218, 0.04180805327886308, 1.029043123856431, 76.81224283702576],
+      [0.8378709714781074, 0.3194529237979746, -0.5184180476801328, 0.6900328748850731, 0.2526202532655927, 0.836540324505715, 1.001993293243286, 358.8100050706929],
+      [2.747314258907458, 1.268732483232985, -1.478581775674472, 0.6771267786261704, 0.1831342066293048, 0.5548541008449196, 1.01584195438118, 123.040171785261],
+      [0.9156865095807959, 0.3099930453096433, -0.6056934642711526, 0.7102035250013152, 0.2351908633382191, 0.7610749324307075, 1.002485415633677, 335.5065881985654],
+      [0.9206027889504963, 0.2988138267809606, -0.6217889621695356, 0.7183615617347812, 0.2273629844284903, 0.7282899043609945, 1.002369001746807, 340.7385402048528],
+      [0.6701293208507468, 1.338096461698521, 0.6679671408477741, 0.194430362920736, 0.738748447779335, 6.998383555820617, 0.99785591324812, 870.9260304517827],
+      [1.605220991750736, 0.7223563142873984, -0.8828646774633374, 0.6894620497577028, 0.2421820072999593, 0.7909280921338736, 1.016067239709452, 121.7655638457308],
+      [1.820978780085182, 0.783520562567783, -1.037458217517399, 0.6912755763927005, 0.2368001490188235, 0.7678983483052884, 1.015107934570892, 127.3910952530708],
+      [0.9143263755260678, 0.3132893075830935, -0.6010370679429743, 0.7078649599298348, 0.2374352462676864, 0.770599103782582, 1.002520867280375, 333.9454156334616],
+      [0.6687544220430163, 0.6777588576173261, 0.009004435574309855, 0.4189933689535986, 0.5160179488219483, 2.638733868165263, 1.01070133229666, 162.0571831661988],
+      [3.823550312283484, 1.041598184210494, -2.78195212807299, 0.801851735324551, 0.1070254006444712, 0.2966250303772789, 1.012700633487718, 144.1912781663496],
+      [2.396009525246266, 0.3812314445698044, -2.014778080676462, 0.7485895024695801, 0.2072063773965674, 0.6468491459159433, 1.005927989361195, 231.1190861723064],
+      [1.858034160493613, 0.2484765811070608, -1.609557579386552, 0.9118083968245113, 0.06678804683064517, 0.1771244395726993, 1.018943275101948, 107.6004596910005],
+      [0.8315352531217016, 0.3380690963747991, -0.4934661567469025, 0.6770139950760986, 0.2652481983594149, 0.8934532276344349, 1.002244072343871, 346.5399389706319],
+      [1.890308567770103, 0.292449047930735, -1.597859519839369, 0.8938619191007178, 0.08094573214245933, 0.2179780877800734, 1.014418621799243, 131.7763406128415],
+      [0.8375068334189539, 0.3205251509418617, -0.5169816824770922, 0.6892827980623748, 0.2533478012570146, 0.8397670499373485, 1.00200771737243, 358.0805035752871],
+      [0.9668665416554862, 0.3009599098333312, -0.6659066318221551, 0.7241811011389289, 0.2229386169158468, 0.7100517706055723, 1.002874442834298, 319.14314136437],
+      [3.414008434733881, 0.2227013249558119, -3.191307109778069, 0.9894551791008457, 0.005908765932091905, 0.01471060658846941, 1.02016116903521, 102.5776865498482],
+      [2.927763078889942, 0.207075747412297, -2.720687331477645, 0.9771908150799288, 0.01558327084952765, 0.03917776642085485, 1.03160815577411, 71.69775899734555],
+      [0.7936769450572915, 1.036446566251155, 0.242769621193864, 0.3154257954174651, 0.6134507078947478, 3.9276685271033, 0.9991367995917748, 603.2347146106404],
+      [2.493626059866841, 0.6241464430475461, -1.869479616819295, 0.8654171079641317, 0.090725521620655, 0.2469417442369167, 1.031102338730139, 72.64879697155989],
+      [0.7473746000425087, 0.7506758352495575, 0.003301235207048836, 0.4214395317955772, 0.512879235093727, 2.605784594373179, 1.008379754769195, 189.4968261575133],
+      [0.9014924157857125, 0.2865136631226748, -0.6149787526630377, 0.7235258796884531, 0.2217291347545042, 0.7051021329532657, 1.002003492678128, 358.2938572170438],
+      [0.7492549703787427, 0.6575551912896022, -0.09169977908914051, 0.4544412456890339, 0.4808141618915383, 2.291999149968591, 1.01102610021664, 158.8520099329332],
+      [1.907264596522195, 0.2608086670657807, -1.646455929456415, 0.9085190041327204, 0.06941357918315068, 0.1846068307505739, 1.017926922137799, 112.2003582712533],
+      [0.8773937341354101, 0.3475099896630789, -0.5298837444723312, 0.680300917779261, 0.2633474859906303, 0.8847621604953562, 1.002697441028938, 326.3835308627669],
+      [1.728406780109023, 0.271946361440076, -1.456460418668947, 0.8944335496577261, 0.0806207165722527, 0.2170261066583621, 1.014795057657665, 129.3437131084458],
+      [0.9019329377820589, 0.3461953402214831, -0.5557375975605758, 0.6855612839555099, 0.258847144180966, 0.864361929839065, 1.002867784438382, 319.409620335311],
+      [0.9206027889504963, 0.2988138267809606, -0.6217889621695356, 0.7183615617347812, 0.2273629844284903, 0.7282899043609945, 1.002369001746807, 340.7385402048528],
+      [1.487796527802864, 0.2847223444583994, -1.203074183344464, 0.8730813859449927, 0.0977967217386584, 0.2682748342033368, 1.010086028996418, 168.507795301576],
+      [0.7307852752210421, 0.3253885211329999, -0.4053967540880422, 0.662990387749929, 0.2754579270887866, 0.9409178437993312, 1.001579276981165, 381.1098637905375],
+      [0.9206027889504963, 0.2988138267809606, -0.6217889621695356, 0.7183615617347812, 0.2273629844284903, 0.7282899043609945, 1.002369001746807, 340.7385402048528],
+      [0.9019329377820589, 0.3461953402214831, -0.5557375975605758, 0.6855612839555099, 0.258847144180966, 0.864361929839065, 1.002867784438382, 319.409620335311],
+      [1.359949559117068, 0.6306310200247041, -0.7293185390923635, 0.6953932697693225, 0.2417826018950543, 0.7892077480486273, 1.018529832664994, 109.4237265266105],
+      [1.610146473573674, 0.295575805724263, -1.314570667849411, 0.8759957754456643, 0.09546225877774206, 0.2611951166191015, 1.011533781033275, 154.0937352147774],
+      [1.715477390064347, 0.2897331427705149, -1.425744247293832, 0.8853860795433099, 0.0878567603546512, 0.2383812980352491, 1.013205444735225, 140.30034250061],
+      [1.266159159503171, 0.6233288375588091, -0.6428303219443623, 0.6837634613651764, 0.2524831593014745, 0.8359330066256319, 1.017317945685561, 115.1571511369828],
+      [0.8413075707773295, 0.358938194848529, -0.4823693759288006, 0.6666617693115888, 0.2757165802675116, 0.9421376917651514, 1.002604040127967, 330.3398048529531],
+      [0.6283723130404157, 0.4108805621366812, -0.2174917509037345, 0.5844466770929027, 0.3502757458708007, 1.33426172002277, 1.00266779096141, 327.6290230850982],
+      [0.7038499501214425, 1.074288126772684, 0.3704381766512416, 0.2825687248808252, 0.6494778602319168, 4.585734808291115, 0.9998098616599487, 519.5658801717312],
+      [0.7960903632099977, 0.3064198752854755, -0.4896704879245222, 0.690383633266426, 0.2507810120802267, 0.8284111092745902, 1.001528173472527, 384.0581547005908],
+      [2.804411240939125, 0.2680423306686855, -2.536368910270439, 0.9611271079938829, 0.02587871848045462, 0.06574909414640087, 1.018271871808257, 110.5941319715738],
+      [2.567344730406415, 0.2528409588533208, -2.314503771553095, 0.9591719746159073, 0.02785185699399782, 0.07090579728062343, 1.021646096753239, 97.07461345310836],
+      [1.64394880222889, 0.2474158943578399, -1.39653290787105, 0.9016897106208802, 0.07468226730538176, 0.1997499357767739, 1.015372110215367, 125.7890903745634],
+      [2.703099657975977, 0.2317365898198257, -2.471363068156152, 0.9677690748702972, 0.0220162473304901, 0.05571494351648003, 1.025797054566579, 84.50581478194019],
+      [1.769686219181997, 0.3334206885905361, -1.436265530591461, 0.8969452288515714, 0.07497282340944786, 0.2005900622412083, 1.009905308443527, 170.5035056748762],
+      [0.7801377751991305, 0.3148531020958606, -0.4652846731032699, 0.6812988595436617, 0.2591968735239502, 0.8659383846203885, 1.001584933802911, 380.7863151860167],
+      [0.9027386312484692, 0.3437531283845285, -0.5589855028639408, 0.6871058824340311, 0.2573635938383049, 0.8576911239257928, 1.002843519720821, 320.3845531958507],
+      [0.7203584342360817, 2.780967451558978, 2.060609017322896, 0.06828458396282047, 0.8653634206704666, 15.90726453193655, 1.006655729079581, 216.9391815722332],
+      [1.667362797041979, 0.6595757455025196, -1.007787051539459, 0.7214686868206905, 0.2172580836252957, 0.6869377641425238, 1.020344698517885, 101.8626220331466],
+      [0.9668665416554862, 0.3009599098333312, -0.6659066318221551, 0.7241811011389289, 0.2229386169158468, 0.7100517706055723, 1.002874442834298, 319.14314136437],
+      [0.7414361431873137, 2.13509308602599, 1.393656942838676, 0.1025383312212427, 0.8235938738305748, 11.55472153121103, 1.003880732926826, 283.4571077742588],
+      [0.879923297328947, 0.3398407921249819, -0.5400825052039652, 0.6852765479619829, 0.2585528188121205, 0.863036368798984, 1.002612170061262, 329.9915859770657],
+      [1.906211729257289, 0.2638275222323379, -1.642384207024951, 0.9071343505253283, 0.07050722394660786, 0.1877360326631682, 1.017560674458124, 113.9594944466066],
+      [2.396009525246266, 0.3812314445698044, -2.014778080676462, 0.7485895024695801, 0.2072063773965674, 0.6468491459159433, 1.005927989361195, 231.1190861723064],
+      [1.479325511679007, 1.040602416568799, -0.4387230951102086, 0.532265831024169, 0.3665650996390065, 1.432218122523272, 1.000984489350515, 418.5356338184803],
+      [0.8642106624037235, 0.2944364985785053, -0.5697741638252182, 0.7116338562842216, 0.2322009112194613, 0.7484733927102407, 1.001793245221228, 369.2462859577397],
+      [3.478865097976805, 0.2257794669822062, -3.253085630994599, 0.9896369706816557, 0.005750277629949551, 0.01431374823213959, 1.019219064691763, 106.4188355127118],
+      [2.699653627926303, 0.643497417662651, -2.056156210263652, 0.8699363132903544, 0.08569133454478364, 0.2319551982018839, 1.029161831766631, 76.55859953209715],
+      [1.767814982718923, 0.314441858204743, -1.45337312451418, 0.8774824826542279, 0.0940264962327293, 0.2568590048321259, 1.011840472883838, 151.3581542335933],
+      [1.637676135386198, 0.6546233729586473, -0.9830527624275505, 0.7203629740792601, 0.2184926138813386, 0.6919324720891085, 1.020416072167384, 101.5873252335378],
+      [1.738042910291656, 0.248668516027024, -1.489374394264632, 0.9059605146635317, 0.07136752836859506, 0.1902027666053491, 1.0171143939724, 116.1817622523754],
+      [0.7334822456382865, 0.6696964924776641, -0.0637857531606224, 0.444534184326135, 0.4905311606559503, 2.382917537018452, 1.010640451668288, 162.6728252999427],
+      [1.879607148501403, 0.2395611345752112, -1.640046013926191, 0.9167875842576594, 0.06283361296024792, 0.1659339945006168, 1.020398488454815, 101.655004151158],
+      [1.522394592337984, 1.217755436901254, -0.3046391554367298, 0.4927401735575349, 0.3937783010934641, 1.607608680750581, 1.002264530081191, 345.5762958229628],
+      [0.6301415346143076, 6.571874477089578, 5.94173294247527, 0.0008439715496452276, 0.9834107556555047, 146.7129294852706, 1.003184612129334, 307.2094991983309],
+      [0.8882249441693671, 0.3172865720399499, -0.5709383721294172, 0.7007791696166791, 0.2436218023822329, 0.7971447477653065, 1.002348321846302, 341.6852605085693],
+      [0.8810494327171735, 0.6523995328746233, -0.2286498998425502, 0.4905566131011911, 0.4456311591866989, 1.989467169109196, 1.011855130026002, 151.2299086489192],
+      [1.525898307252199, 0.2635750080531249, -1.262323299199074, 0.8866027382856295, 0.08676893495263785, 0.2351492670559268, 1.011729125376593, 152.3397445886934],
+      [5.775068104669175, 4.409950715762764, -1.365117388906411, 0.3602482299754761, 0.1949357832971252, 0.5992679933660293, 1.000546282699082, 451.2328285107557],
+      [4.462868102654793, 0.7274063702747744, -3.735461732380019, 0.9400294199786901, 0.0238912784459467, 0.06057608974126259, 1.022481593402194, 94.2396637117247],
+      [0.742080374721134, 1.733973904294707, 0.9918935295735729, 0.1677702526354386, 0.7597544628238622, 7.826687067863332, 0.9980985374792049, 803.298187198444],
+      [1.795406198961554, 5.933020625934442, 4.137614426972888, 0.02621929068213601, 0.8212338872902345, 11.36950885566044, 1.004497930557933, 265.3058436562201],
+      [0.9252102020674368, 0.2888873377081008, -0.6363228643593359, 0.7257666524345335, 0.2202590000617651, 0.6991064864165487, 1.002271929735664, 345.2290747749637],
+      [0.879923297328947, 0.3398407921249819, -0.5400825052039652, 0.6852765479619829, 0.2585528188121205, 0.863036368798984, 1.002612170061262, 329.9915859770657],
+      [1.891715267189642, 0.29243809857207, -1.599277168617572, 0.8939401124153402, 0.08088215372714161, 0.2177918115743911, 1.014427928156163, 131.7150646466589],
+      [0.9252102020674368, 0.2888873377081008, -0.6363228643593359, 0.7257666524345335, 0.2202590000617651, 0.6991064864165487, 1.002271929735664, 345.2290747749637],
+      [0.913770735907075, 0.2948542348044822, -0.6189165011025928, 0.7198478985031778, 0.225704156193793, 0.721427457110446, 1.002242743960764, 346.6026991447079],
+      [1.309954176376095, 0.3669811104538624, -0.9429730659222325, 0.817099310600047, 0.1442083147737543, 0.4170443847647913, 1.005696931577688, 236.024292522491],
+      [0.9143263755260678, 0.3132893075830935, -0.6010370679429743, 0.7078649599298348, 0.2374352462676864, 0.770599103782582, 1.002520867280375, 333.9454156334616],
+      [2.396009525246266, 0.3812314445698044, -2.014778080676462, 0.7485895024695801, 0.2072063773965674, 0.6468491459159433, 1.005927989361195, 231.1190861723064],
+      [0.6408805179020273, 0.4070759323743263, -0.2338045855277009, 0.5903493842543279, 0.3448417540889444, 1.302667784641027, 1.002621590350805, 329.5890265409098],
+      [0.6959869230101539, 1.035599471566705, 0.3396125485565509, 0.287228323037423, 0.6451969205089962, 4.500543298097986, 1.000518972585357, 453.4420916570001],
+      [1.760549844817363, 1.069378031086694, -0.6911718137306695, 0.563153417461169, 0.3331705620392045, 1.236550611189771, 1.002814286422756, 321.5671473160598],
+      [1.313113941750192, 1.974200423393304, 0.6610864816431117, 0.3445585042440665, 0.532827812644222, 2.822733942648999, 1.005479072616174, 240.847197187974],
+      [0.7827456776450943, 1.639948145571561, 0.8572024679264663, 0.1855376208569123, 0.7382412893892146, 6.980029010467486, 0.9980108766844121, 826.4799610519159],
+      [0.7475265399757427, 0.7405192687580572, -0.007007271217685518, 0.4244757374129121, 0.5099200074520227, 2.575106046562802, 1.008631981346187, 186.0635091497142],
+      [2.019720143681412, 0.2610282411190882, -1.758691902562323, 0.9131827581085833, 0.06572185632404896, 0.1740979556709481, 1.018676377569117, 108.7701863399542],
+      [4.671066256224689, 0.278012208346587, -4.393054047878103, 0.9912557369642002, 0.00415507811556568, 0.0103263661198179, 1.009881234528573, 170.7730114163066],
+      [0.8545532705256456, 0.3185574369063932, -0.5359958336192524, 0.6937654623349651, 0.2494780908946445, 0.8226764709239547, 1.002098052851177, 353.5790905851457],
+      [1.731570239654124, 0.2575704711400302, -1.473999768514094, 0.9013898871613548, 0.07503918036913537, 0.200782003655037, 1.016131529720268, 121.4068091044012],
+      [2.578884667921036, 1.901521417751211, -0.6773632501698248, 0.5667266764043289, 0.2172435865971075, 0.6868792051230065, 1.016248980992623, 120.7570038621054],
+      [1.848619459213316, 0.2616869682753533, -1.586932490937963, 0.9053900122144505, 0.07189187292628955, 0.1917084524324426, 1.017262798599901, 115.4328934691563],
+      [1.234258419898621, 0.6672710311569465, -0.5669873887416748, 0.6571063351693377, 0.2748771566961542, 0.9381820125169892, 1.014003913287307, 134.5678010510105],
+      [0.8382414921400769, 0.3184858895823133, -0.5197556025577637, 0.6907498060753554, 0.2519253815251415, 0.8334643803652261, 1.001980100570144, 359.4798607302892],
+      [2.334928054729291, 0.2529817697151248, -2.081946285014166, 0.8188189448731039, 0.1429155155424426, 0.4126822464878207, 1.009264597631995, 177.9860265817098],
+      [0.8545532705256456, 0.3185574369063932, -0.5359958336192524, 0.6937654623349651, 0.2494780908946445, 0.8226764709239547, 1.002098052851177, 353.5790905851457],
+      [0.8910433359442418, 0.3103357814592619, -0.5807075544849798, 0.7057855884293825, 0.2388019956728835, 0.7764265002122339, 1.002266581537338, 345.479962660838],
+      [0.9143263755260678, 0.3132893075830935, -0.6010370679429743, 0.7078649599298348, 0.2374352462676864, 0.770599103782582, 1.002520867280375, 333.9454156334616],
+      [1.690009131020467, 0.9790743560013061, -0.7109347750191607, 0.5812317826109584, 0.3232176019051868, 1.181968731908725, 1.002439684793724, 337.5423606294108],
+      [0.7925565899614575, 3.293751587163411, 2.501194997201953, 0.06035638292717715, 0.8678006798263211, 16.24616288522281, 1.009408481347121, 176.2477917889749],
+      [1.892730786476189, 0.2924123647643125, -1.600318421711876, 0.8940003734525247, 0.08083367316719411, 0.2176497873711138, 1.014435466841063, 131.6654705836744],
+      [0.8970686266384508, 0.2962209913993141, -0.6008476352391366, 0.7161823508436315, 0.2287950897563492, 0.7342381610667212, 1.002105913598215, 353.1927933056136],
+      [0.9624315338084155, 0.3106932502616423, -0.6517382835467732, 0.7172379818069443, 0.2295641327051292, 0.7374415107863223, 1.002954263939352, 315.9832585879507],
+      [1.271612960850018, 0.3691246406771051, -0.9024883201729126, 0.8120982521650746, 0.1484758551077651, 0.4315378637118099, 1.005328319814607, 244.3034891092874],
+      [0.8773937341354101, 0.3475099896630789, -0.5298837444723312, 0.680300917779261, 0.2633474859906303, 0.8847621604953562, 1.002697441028938, 326.3835308627669],
+      [0.7441461855709143, 0.6964235140118916, -0.04772267155902266, 0.4379452259617399, 0.4968586928677043, 2.444009883141286, 1.00984311198279, 171.2015774667771],
+      [2.396009525246266, 0.3812314445698044, -2.014778080676462, 0.7485895024695801, 0.2072063773965674, 0.6468491459159433, 1.005927989361195, 231.1190861723064],
+      [1.50850545059984, 0.2541903779900566, -1.254315072609784, 0.8904771789732951, 0.08355059178962776, 0.2256321980687831, 1.011732738617257, 152.3076869125847],
+      [0.8375068334189539, 0.3205251509418617, -0.5169816824770922, 0.6892827980623748, 0.2533478012570146, 0.8397670499373485, 1.00200771737243, 358.0805035752871],
+      [0.8906386807517885, 0.3112718557519627, -0.5793668249998258, 0.7050913587213025, 0.2394701733418628, 0.7792830257040086, 1.002277428101499, 344.9715261966949],
+      [0.8906386807517885, 0.3112718557519627, -0.5793668249998258, 0.7050913587213025, 0.2394701733418628, 0.7792830257040086, 1.002277428101499, 344.9715261966949],
+      [2.332053896177974, 0.2367426732975472, -2.095311222880427, 0.9567142424933796, 0.03020833854521137, 0.07709184386993789, 1.025305620001162, 85.81419645843198],
+      [1.519359284614239, 0.8952173787821639, -0.6241419058320746, 0.586032202603428, 0.3258447982604828, 1.196219675699878, 1.002535016589134, 333.3264220054586],
+      [1.493530385319895, 0.2825166148549371, -1.211013770464958, 0.8746218626547535, 0.09653966264818349, 0.2644580092772787, 1.010275358443884, 166.4676271941106],
+      [0.741159697654717, 1.454089274118492, 0.7129295764637746, 0.1978623947802414, 0.7294369468118643, 6.672357461631781, 0.9972577242482238, 1099.413971794294],
+      [0.7271279866356556, 0.9846466778112422, 0.2575186911755866, 0.3075751580418761, 0.6237725523761175, 4.103324123805218, 1.000803004177771, 431.4795309176896],
+      [0.8970686266384508, 0.2962209913993141, -0.6008476352391366, 0.7161823508436315, 0.2287950897563492, 0.7342381610667212, 1.002105913598215, 353.1927933056136],
+      [0.9444540669483967, 0.3575106756104039, -0.5869433913379928, 0.6865353752944214, 0.2588678624946797, 0.8644552791274397, 1.003330330066721, 301.9094206827929],
+      [0.6130957768264779, 5.881846752530935, 5.268750975704457, 0.00287383999324318, 0.9748947372417887, 96.10655141632175, 1.006956382060379, 211.5843621947304],
+      [1.591298878042951, 1.007445942569924, -0.5838529354730269, 0.5591223929861374, 0.3423405802213612, 1.288301096485379, 1.00179691230995, 369.0494607889909],
+      [1.888500041897305, 0.3254941431646804, -1.563005898732625, 0.9073033783500426, 0.06654602075914043, 0.1764368188028648, 1.011219152413088, 157.0075395902144],
+      [0.9019329377820589, 0.3461953402214831, -0.5557375975605758, 0.6855612839555099, 0.258847144180966, 0.864361929839065, 1.002867784438382, 319.409620335311],
+      [1.465053913198879, 0.6387155101974065, -0.8263384030014727, 0.7066006658958096, 0.2314469487768909, 0.7453112001812595, 1.019579173582477, 104.9158462254426],
+      [0.7686001142324604, 1.460380799545811, 0.6917806853133507, 0.2483038227637663, 0.6804903680942397, 5.271061295655111, 0.9961984792114865, 2057.740941741361],
+      [0.7146562136311874, 1.020154303502459, 0.3054980898712711, 0.2961573308729959, 0.6355160405519924, 4.315271603830602, 1.000405672074461, 462.8454431076583],
+      [0.71388375737254, 1.391299964567261, 0.6774162071947213, 0.2417631302309584, 0.6902891595255063, 5.51613244699229, 0.9969992720764596, 1240.169075077575],
+      [2.56342106522001, 0.2099176912615375, -2.353503373958473, 0.970042119164478, 0.02073427485786662, 0.05240205711120012, 1.032331343016355, 70.38278496346575],
+      [1.66821203046079, 1.471923066682951, -0.1962889637778389, 0.4139340732887646, 0.4424454492148319, 1.963958952457436, 1.009473160541246, 175.4776641211708],
+      [1.35097096667394, 1.117116392309033, -0.2338545743649065, 0.4891207793415898, 0.4058561781368372, 1.690599027700799, 0.9999554902366874, 504.4459452156173],
+      [0.8549361465828247, 0.3175902642751303, -0.5373458823076944, 0.6944796931021142, 0.2487874201581454, 0.8196446407715443, 1.002085383609697, 354.2034904382638],
+      [1.660141355013693, 0.2758753072592144, -1.384266047754479, 0.8886298065745603, 0.08527016812854245, 0.2307088824224967, 1.013512515563467, 138.0372677942331],
+      [1.716615580700416, 0.29073343585171, -1.425882144848706, 0.8849922896998443, 0.08816971907561147, 0.2393125560916739, 1.013142449065749, 140.7740772715756],
+      [1.623329837445012, 0.2757209373592142, -1.347608900085798, 0.88648829096835, 0.08698397459955258, 0.2357875592018877, 1.012943790487571, 142.2897838381164],
+      [0.8041802374486954, 0.668058796293116, -0.1361214411555793, 0.4657680340256792, 0.469593377298272, 2.191154819129745, 1.010836512060117, 160.707118315156],
+      [0.913770735907075, 0.2948542348044822, -0.6189165011025928, 0.7198478985031778, 0.225704156193793, 0.721427457110446, 1.002242743960764, 346.6026991447079],
+      [1.873849121467819, 0.2391534389021341, -1.634695682565685, 0.9167269397467347, 0.06287669351746519, 0.1660553970784088, 1.020379382911664, 101.7286467967916],
+      [0.9444540669483967, 0.3575106756104039, -0.5869433913379928, 0.6865353752944214, 0.2588678624946797, 0.8644552791274397, 1.003330330066721, 301.9094206827929],
+      [2.005600754999824, 0.3048130705628662, -1.700787684436958, 0.8942833446474164, 0.0803960412692149, 0.2163684187922571, 1.01373137885075, 136.4695345683766],
+      [2.742313411455258, 0.6491360912498629, -2.093177320205395, 0.8702114049070445, 0.08502350154565029, 0.2299794793733578, 1.028638335419033, 77.6906135960578],
+      [2.780319946277745, 0.2335757271334745, -2.546744219144271, 0.9689053444449656, 0.02114487524747814, 0.05346219028085474, 1.025051548325381, 86.50740724452611],
+      [0.6784616070761063, 0.713511575926475, 0.03504996885036871, 0.4100054445880845, 0.5248885371075992, 2.734208435103876, 1.009748163519957, 172.2785924173354],
+      [1.491686145398954, 0.2835147697108123, -1.208171375688142, 0.8739747142526177, 0.09706824859036567, 0.2660616668197592, 1.010202823704949, 167.2432438068394],
+      [1.671008127150179, 1.036281411462525, -0.6347267156876546, 0.5614040715173909, 0.337600548090048, 1.261372090972171, 1.002231778567236, 347.121644235821],
+      [2.542357115421884, 0.2482824911947817, -2.294074624227103, 0.959705164219832, 0.02759063511623376, 0.07022190452651665, 1.022617502471314, 93.79472245737696],
+      [5.429881265068088, 0.2441208641883399, -5.185760400879748, 0.9982994365575451, 0.00065754601901952, 0.001628440347643101, 1.00749957914869, 202.5621865099315],
+      [1.472560088806996, 1.19710960055941, -0.2754504882475863, 0.4898041868786904, 0.3985784218890496, 1.640192480076161, 1.00162129267826, 378.719897617771],
+      [1.640710046040149, 0.6183601466049665, -1.022349899435182, 0.7368326661958797, 0.2059390099918982, 0.641866631504468, 1.023191054939217, 91.9642596751586],
+      [1.631093943433543, 0.2762423927193976, -1.354851550714146, 0.8867037575951286, 0.08681408451360255, 0.2352832574578161, 1.013033474691419, 141.6013873325877],
+      [9.531036202854718, 1.256991086886166, -8.274045115968551, 0.9295303217343907, 0.01513042739808498, 0.03802178614176676, 1.024291536304827, 88.65280346623733],
+      [0.765333903125524, 1.034835322248289, 0.2695014191227652, 0.3081344813613646, 0.6216225086336902, 4.06594478930989, 0.9994452964394535, 561.7489995274832],
+      [1.530039940811492, 0.2633509474408867, -1.266688993370606, 0.8869764057138143, 0.08647127078450603, 0.2342662202751179, 1.011832880826264, 151.4246701969734],
+      [3.612604517607296, 5.370772523972851, 1.758168006365555, 0.1175966552733099, 0.5204917899202152, 2.686444513453702, 1.003889655830638, 283.1767618719285],
+      [2.229916711021344, 11.96812271534749, 9.738206004326143, 0.003908888234979252, 0.910091617874367, 25.05214811534502, 0.9989107032221679, 637.7825047947],
+      [1.393016603643891, 0.6867026615854317, -0.7063139420584594, 0.6751729374664863, 0.2572956409121323, 0.857386210889045, 1.015486108816937, 125.1105389660327],
+      [2.945858372814618, 0.2075688914822502, -2.738289481332368, 0.9773511755067584, 0.01546354692008213, 0.03887204194081084, 1.031352424912533, 72.17527681297959],
+      [1.701599041352019, 2.219161344835312, 0.5175623034832939, 0.2463705335989004, 0.5593283694433774, 3.141317212799754, 1.021208535081048, 98.63141417826455],
+      [1.265357149497031, 0.2842865437782062, -0.9810706057188253, 0.7690854950306439, 0.1853149385524942, 0.5629641195726505, 1.006033987260548, 228.9374825707941],
+      [0.9014924157857125, 0.2865136631226748, -0.6149787526630377, 0.7235258796884531, 0.2217291347545042, 0.7051021329532657, 1.002003492678128, 358.2938572170438],
+      [1.370257200993293, 0.7046284987465498, -0.6656287022467436, 0.6644369020843249, 0.2662195180047077, 0.8979120009800083, 1.014213415792204, 133.1425578207644],
+      [0.9019329377820589, 0.3461953402214831, -0.5557375975605758, 0.6855612839555099, 0.258847144180966, 0.864361929839065, 1.002867784438382, 319.409620335311],
+      [2.396009525246266, 0.3812314445698044, -2.014778080676462, 0.7485895024695801, 0.2072063773965674, 0.6468491459159433, 1.005927989361195, 231.1190861723064],
+      [0.8549361465828247, 0.3175902642751303, -0.5373458823076944, 0.6944796931021142, 0.2487874201581454, 0.8196446407715443, 1.002085383609697, 354.2034904382638],
+      [3.245868068630679, 0.2439759881202262, -3.001892080510453, 0.9455319328446625, 0.04060820015505345, 0.1047557276549988, 1.021739725840406, 96.74810609075362],
+      [0.854177814960061, 0.3196279605194496, -0.5345498544406113, 0.6930187209634154, 0.2502006402793262, 0.8258542165870953, 1.002111951149028, 352.8966713693397],
+      [0.9624315338084155, 0.3106932502616423, -0.6517382835467732, 0.7172379818069443, 0.2295641327051292, 0.7374415107863223, 1.002954263939352, 315.9832585879507],
+      [4.085618348549642, 0.2341568235572885, -3.851461524992353, 0.9959897316636652, 0.001534175455185821, 0.003802785811663016, 1.011599634868702, 153.4978262896],
+      [1.508833812438653, 0.6128140655512671, -0.8960197468873856, 0.7244338012831337, 0.2169367407004849, 0.6856402462890454, 1.02213301173062, 95.40122748935462],
+      [0.8970686266384508, 0.2962209913993141, -0.6008476352391366, 0.7161823508436315, 0.2287950897563492, 0.7342381610667212, 1.002105913598215, 353.1927933056136],
+      [1.265357149497031, 0.2842865437782062, -0.9810706057188253, 0.7690854950306439, 0.1853149385524942, 0.5629641195726505, 1.006033987260548, 228.9374825707941],
+      [0.8315352531217016, 0.3380690963747991, -0.4934661567469025, 0.6770139950760986, 0.2652481983594149, 0.8934532276344349, 1.002244072343871, 346.5399389706319],
+      [0.6408805179020273, 0.4070759323743263, -0.2338045855277009, 0.5903493842543279, 0.3448417540889444, 1.302667784641027, 1.002621590350805, 329.5890265409098],
+      [1.847218352778658, 0.2772577672009177, -1.56996058557774, 0.8983391252324235, 0.07747629749259254, 0.2078506388683279, 1.015596261359025, 124.4620123512379],
+      [1.604310329980551, 0.6508029601256018, -0.9535073698549494, 0.7183618815329906, 0.2204607716383328, 0.6999280320295665, 1.020385187747843, 101.7062602361514],
+      [0.9014924157857125, 0.2865136631226748, -0.6149787526630377, 0.7235258796884531, 0.2217291347545042, 0.7051021329532657, 1.002003492678128, 358.2938572170438],
+      [0.8549361465828247, 0.3175902642751303, -0.5373458823076944, 0.6944796931021142, 0.2487874201581454, 0.8196446407715443, 1.002085383609697, 354.2034904382638],
+      [1.511712215791997, 0.2540532364919731, -1.257658979300024, 0.8907434154153391, 0.08333995064089814, 0.2250116342450616, 1.011819371713822, 151.5431753825414],
+      [1.905569156328879, 0.2638708852958097, -1.641698271033069, 0.9070890328855306, 0.07054268726864568, 0.187837625710488, 1.017550371843159, 114.0098052236838],
+      [0.6283723130404157, 0.4108805621366812, -0.2174917509037345, 0.5844466770929027, 0.3502757458708007, 1.33426172002277, 1.00266779096141, 327.6290230850982],
+      [0.8789701966315052, 0.3275055332809348, -0.5514646633505704, 0.69266092973228, 0.2513023379988544, 0.8307112483915374, 1.002425828111919, 338.1641517723739],
+      [0.8437686548673489, 0.3038621440195365, -0.5399065108478124, 0.7015052801269281, 0.2415000393962996, 0.7879917713483965, 1.001784988231137, 369.6902442245855],
+      [0.8378709714781074, 0.3194529237979746, -0.5184180476801328, 0.6900328748850731, 0.2526202532655927, 0.836540324505715, 1.001993293243286, 358.8100050706929],
+      [1.410805045370672, 0.2790521178986206, -1.131752927472051, 0.8706246479087281, 0.09970888318504988, 0.2741011930681875, 1.008710471854306, 185.0208429537045],
+      [0.8500775547254543, 0.2885345530086024, -0.5615430017168519, 0.7131964507574368, 0.2301740793416509, 0.7399867163081146, 1.001594000240399, 380.2689052577834],
+      [0.8773937341354101, 0.3475099896630789, -0.5298837444723312, 0.680300917779261, 0.2633474859906303, 0.8847621604953562, 1.002697441028938, 326.3835308627669],
+      [0.879923297328947, 0.3398407921249819, -0.5400825052039652, 0.6852765479619829, 0.2585528188121205, 0.863036368798984, 1.002612170061262, 329.9915859770657],
+      [0.9624315338084155, 0.3106932502616423, -0.6517382835467732, 0.7172379818069443, 0.2295641327051292, 0.7374415107863223, 1.002954263939352, 315.9832585879507],
+      [1.083485539867942, 1.483745644337528, 0.4002601044695857, 0.2546981717257784, 0.656352022207438, 4.726972481208435, 0.9989207173873362, 636.168265153167],
+      [1.29529991548943, 2.822718070145566, 1.527418154656136, 0.1910104303900099, 0.6664520129065048, 4.945048995135743, 1.013824426520515, 135.8140647714187],
+      [0.7555272573508804, 0.9225620754844078, 0.1670348181335274, 0.3306131769153006, 0.6003737737012885, 3.718157390452658, 1.001630644263659, 378.1920674096726],
+      [1.508517048242234, 0.2541987789832431, -1.254318269258991, 0.8904731762478203, 0.08355390733454648, 0.2256419681806425, 1.011732567869391, 152.3092015236778],
+      [0.7956940972706756, 1.036443757580282, 0.2407496603096067, 0.3159449930059545, 0.612873324397869, 3.918119339511457, 0.9991188333436392, 605.8416778155473],
+      [1.863703414347923, 0.2394774345837624, -1.624225979764161, 0.9161384564607493, 0.06333764111722683, 0.1673550631751042, 1.020196582264912, 102.438899307548],
+      [0.8413075707773295, 0.358938194848529, -0.4823693759288006, 0.6666617693115888, 0.2757165802675116, 0.9421376917651514, 1.002604040127967, 330.3398048529531],
+      [1.104724679228379, 2.325051520691677, 1.220326841463298, 0.137047270649571, 0.758840865923011, 7.787660926625004, 1.010920529748643, 159.8795629163638],
+      [2.334928054729291, 0.2529817697151248, -2.081946285014166, 0.8188189448731039, 0.1429155155424426, 0.4126822464878207, 1.009264597631995, 177.9860265817098],
+      [2.678336087847395, 0.2148913949460606, -2.463444692901334, 0.9712539532528126, 0.01977223482696409, 0.04992163480343603, 1.030422720865049, 73.96937657173362],
+      [0.8413075707773295, 0.358938194848529, -0.4823693759288006, 0.6666617693115888, 0.2757165802675116, 0.9421376917651514, 1.002604040127967, 330.3398048529531],
+      [0.7688096794172018, 0.6360870334186972, -0.1327226459985046, 0.4694937797881616, 0.4661784379555606, 2.161305255733828, 1.01179563972464, 151.7518193955528],
+      [0.8606419912113049, 0.302976401582314, -0.5576655896289909, 0.7051893492617515, 0.2384306071191618, 0.7748409447762756, 1.001897755067703, 363.7187450907838],
+      [0.6780325855961704, 0.6768462507680475, -0.001186334828122915, 0.422677047975987, 0.5123109612588637, 2.599864371429787, 1.010638493925051, 162.6927020432936],
+      [0.8789701966315052, 0.3275055332809348, -0.5514646633505704, 0.69266092973228, 0.2513023379988544, 0.8307112483915374, 1.002425828111919, 338.1641517723739],
+      [1.401863747573949, 2.407570591512503, 1.005706843938554, 0.1753214109329192, 0.645456725179787, 4.505654821590383, 1.018352970205483, 110.2233913373961],
+      [0.7899647167025678, 0.6637292257315908, -0.1262354909709771, 0.4637016328220971, 0.4716600883965484, 2.209407113037269, 1.010930221313895, 159.7846643038265],
+      [0.8882249441693671, 0.3172865720399499, -0.5709383721294172, 0.7007791696166791, 0.2436218023822329, 0.7971447477653065, 1.002348321846302, 341.6852605085693],
+      [0.742639848271603, 1.654429772919499, 0.9117899246478958, 0.1754975715122595, 0.7517841622557231, 7.495898935013029, 0.9977751400410799, 896.0522021868536],
+      [0.8311283207090874, 0.3393477641780577, -0.4917805565310297, 0.6761495396287692, 0.2660870812457367, 0.8973033646181834, 1.002260961728588, 345.7439895312437],
+      [2.035958983360387, 0.2517008165729541, -1.784258166787433, 0.917784479164505, 0.06210941968733399, 0.1638948610561159, 1.020072119870347, 102.9284091060426],
+      [0.8882249441693671, 0.3172865720399499, -0.5709383721294172, 0.7007791696166791, 0.2436218023822329, 0.7971447477653065, 1.002348321846302, 341.6852605085693],
+      [1.620472337968729, 0.2925221834697467, -1.327950154498983, 0.8781457093895568, 0.09372314975753034, 0.2559446334841221, 1.011853428872825, 151.2447817927444],
+      [1.728249509522606, 0.2710608467111953, -1.457188662811411, 0.8948436423404061, 0.08029155809647635, 0.2160626765924995, 1.01487256430749, 128.8542797794858],
+      [0.8545532705256456, 0.3185574369063932, -0.5359958336192524, 0.6937654623349651, 0.2494780908946445, 0.8226764709239547, 1.002098052851177, 353.5790905851457],
+      [1.905170670811431, 0.2638625544115928, -1.641308116399839, 0.907073840589508, 0.07055522498704983, 0.1878735448158705, 1.017549339431699, 114.0148493334995],
+      [0.8642106624037235, 0.2944364985785053, -0.5697741638252182, 0.7116338562842216, 0.2322009112194613, 0.7484733927102407, 1.001793245221228, 369.2462859577397],
+      [0.9014924157857125, 0.2865136631226748, -0.6149787526630377, 0.7235258796884531, 0.2217291347545042, 0.7051021329532657, 1.002003492678128, 358.2938572170438],
+      [0.8789701966315052, 0.3275055332809348, -0.5514646633505704, 0.69266092973228, 0.2513023379988544, 0.8307112483915374, 1.002425828111919, 338.1641517723739],
+      [2.539045302140492, 0.2333525448274445, -2.305692757313048, 0.9635617075553675, 0.02510311858181477, 0.06372781604863012, 1.025920905311304, 84.1826381553355],
+      [0.9143263755260678, 0.3132893075830935, -0.6010370679429743, 0.7078649599298348, 0.2374352462676864, 0.770599103782582, 1.002520867280375, 333.9454156334616],
+      [0.750116065713855, 0.628517683236364, -0.121598382477491, 0.4673452490114015, 0.4682999757660557, 2.179804245979081, 1.011980471484952, 150.1422444810013],
+      [0.9624315338084155, 0.3106932502616423, -0.6517382835467732, 0.7172379818069443, 0.2295641327051292, 0.7374415107863223, 1.002954263939352, 315.9832585879507],
+      [1.775930132483501, 0.2701217479599464, -1.505808384523554, 0.8978434078526606, 0.07789788529477548, 0.2090772065700593, 1.015552333506666, 124.719806051139],
+      [3.025848459943688, 0.2570559053486796, -2.768792554595009, 0.9681448250852617, 0.02112322640473343, 0.0534062727118948, 1.019330674399576, 105.9482532939489],
+      [2.006080225434451, 0.3047982339724533, -1.701281991461998, 0.894311410724862, 0.08037333422097406, 0.2163019667498221, 1.013733808534342, 136.4523360370618],
+      [0.7678740434441601, 0.6675735994934731, -0.100300443950687, 0.4559513611919768, 0.4792493404578045, 2.2776748911725, 1.0107380737837, 161.6879457959351],
+      [0.854177814960061, 0.3196279605194496, -0.5345498544406113, 0.6930187209634154, 0.2502006402793262, 0.8258542165870953, 1.002111951149028, 352.8966713693397],
+      [0.8910433359442418, 0.3103357814592619, -0.5807075544849798, 0.7057855884293825, 0.2388019956728835, 0.7764265002122339, 1.002266581537338, 345.479962660838],
+      [2.379601361784658, 0.2188131138164611, -2.160788247968197, 0.9631755249228569, 0.02569956521645206, 0.06528191996183966, 1.029873339218828, 75.07451060422915],
+      [1.362193566713833, 0.7068501007972537, -0.6553434659165794, 0.6622814104459247, 0.2680958535906689, 0.9065586969953097, 1.013981790087488, 134.7201404122967],
+      [2.844256185328447, 0.2319572422015246, -2.612298943126923, 0.9705128859883427, 0.02000822424252217, 0.05052963417843329, 1.025163837561315, 86.19959678925436],
+      [3.015919636441286, 0.2611201331034195, -2.754799503337866, 0.9670552347492279, 0.02178729355623338, 0.05512264191549684, 1.018688033687453, 108.7185510640124],
+      [0.7401326238170173, 0.2943376857530516, -0.4457949380639656, 0.6867910948254169, 0.2519957086922944, 0.833775433192942, 1.001134236074647, 408.4309186452369],
+      [1.361963520943317, 0.6305755316201611, -0.7313879893231561, 0.6957267302679279, 0.2414876500656154, 0.787938475955888, 1.018567939964747, 109.2529993739562],
+      [3.038707021101613, 0.2299725014705032, -2.808734519631109, 0.9741555633362807, 0.017430824181918, 0.04390508533415103, 1.024742332296592, 87.36704914860918],
+      [0.7907722637152931, 0.3220392526705272, -0.4687330110447659, 0.6787762701622237, 0.2621124133344687, 0.8791387515670193, 1.001752997805738, 371.4205240112349],
+      [0.913770735907075, 0.2948542348044822, -0.6189165011025928, 0.7198478985031778, 0.225704156193793, 0.721427457110446, 1.002242743960764, 346.6026991447079],
+      [0.9019329377820589, 0.3461953402214831, -0.5557375975605758, 0.6855612839555099, 0.258847144180966, 0.864361929839065, 1.002867784438382, 319.409620335311],
+      [1.470880305206531, 0.6671425046761608, -0.8037378005303706, 0.6946699517333791, 0.2406592660842428, 0.784378948253018, 1.017738019735505, 113.10060790284],
+      [0.7769218462943511, 0.3249501839982318, -0.4519716622961193, 0.6738951028819534, 0.266442203362273, 0.8989358860431415, 1.001733410476876, 372.4880523976879],
+      [0.9444540669483967, 0.3575106756104039, -0.5869433913379928, 0.6865353752944214, 0.2588678624946797, 0.8644552791274397, 1.003330330066721, 301.9094206827929],
+      [0.7393036332288561, 0.9820217283337573, 0.2427180951049013, 0.3118340576605654, 0.6191252040015277, 4.02305795069448, 1.000666384696636, 441.7693255464455],
+      [2.714659094815133, 0.2317011201989317, -2.482957974616201, 0.9680361698580098, 0.0218196496099548, 0.05520632994699459, 1.025763006794038, 84.59511510903535],
+      [1.765090792758636, 0.3339606302662628, -1.431130162492373, 0.8964430256564759, 0.07537582063327604, 0.201756179854158, 1.009837668322859, 171.2629535476061],
+      [2.02328610129762, 0.2609319797687294, -1.762354121528891, 0.9133664075501778, 0.06557690380228479, 0.1736870273622287, 1.018708532906657, 108.627864973008],
+      [1.273021301772355, 0.3689382365451331, -0.9040830652272216, 0.8123283592161812, 0.1482775594182273, 0.4308611916340893, 1.005341579387387, 243.9954514779195],
+      [0.8606419912113049, 0.302976401582314, -0.5576655896289909, 0.7051893492617515, 0.2384306071191618, 0.7748409447762756, 1.001897755067703, 363.7187450907838],
+      [0.8549361465828247, 0.3175902642751303, -0.5373458823076944, 0.6944796931021142, 0.2487874201581454, 0.8196446407715443, 1.002085383609697, 354.2034904382638],
+      [1.578998245994376, 0.2522325854479978, -1.326765660546378, 0.8956435232634039, 0.07948044377060336, 0.213691527192086, 1.01354961981421, 137.7688847017918],
+      [2.334928054729291, 0.2529817697151248, -2.081946285014166, 0.8188189448731039, 0.1429155155424426, 0.4126822464878207, 1.009264597631995, 177.9860265817098],
+      [1.437744197201998, 0.3094041020473978, -1.1283400951546, 0.8566749938264305, 0.1112456001746353, 0.3097855232553244, 1.008454960038878, 188.4596729933195],
+      [0.9143263755260678, 0.3132893075830935, -0.6010370679429743, 0.7078649599298348, 0.2374352462676864, 0.770599103782582, 1.002520867280375, 333.9454156334616],
+      [0.854177814960061, 0.3196279605194496, -0.5345498544406113, 0.6930187209634154, 0.2502006402793262, 0.8258542165870953, 1.002111951149028, 352.8966713693397],
+      [0.8545532705256456, 0.3185574369063932, -0.5359958336192524, 0.6937654623349651, 0.2494780908946445, 0.8226764709239547, 1.002098052851177, 353.5790905851457],
+      [0.7801377751991305, 0.3148531020958606, -0.4652846731032699, 0.6812988595436617, 0.2591968735239502, 0.8659383846203885, 1.001584933802911, 380.7863151860167],
+      [1.820969570081533, 1.041991524106163, -0.7789780459753699, 0.5778873359901893, 0.321052229399054, 1.170305813546966, 1.002977403445043, 315.0790379176146],
+      [0.9444540669483967, 0.3575106756104039, -0.5869433913379928, 0.6865353752944214, 0.2588678624946797, 0.8644552791274397, 1.003330330066721, 301.9094206827929],
+      [0.8382414921400769, 0.3184858895823133, -0.5197556025577637, 0.6907498060753554, 0.2519253815251415, 0.8334643803652261, 1.001980100570144, 359.4798607302892],
+      [0.913770735907075, 0.2948542348044822, -0.6189165011025928, 0.7198478985031778, 0.225704156193793, 0.721427457110446, 1.002242743960764, 346.6026991447079],
+      [0.8017827875978873, 0.2910612307310945, -0.5107215568667929, 0.7022267674392259, 0.2392275136253522, 0.7782450512235876, 1.001321364323131, 396.4753389951715],
+      [1.265357149497031, 0.2842865437782062, -0.9810706057188253, 0.7690854950306439, 0.1853149385524942, 0.5629641195726505, 1.006033987260548, 228.9374825707941],
+      [3.017951216249195, 0.2570239847031878, -2.760927231546007, 0.9680445457812287, 0.02119365483386138, 0.05358819388207368, 1.019364609555701, 105.8060262201622],
+      [4.679232471428533, 0.2231835005386628, -4.456048970889871, 0.9979778443302875, 0.0008427687892309509, 0.002087539235757158, 1.010201784284691, 167.2544121169464],
+      [0.8606419912113049, 0.302976401582314, -0.5576655896289909, 0.7051893492617515, 0.2384306071191618, 0.7748409447762756, 1.001897755067703, 363.7187450907838],
+      [2.884610890339177, 0.2384316095816208, -2.646179280757556, 0.9698164358196457, 0.02037276752515077, 0.05146941344298502, 1.023514724359485, 90.96378017129393],
+      [6.007733506236209, 0.2727344730095016, -5.734999033226708, 0.9990539304942081, 0.0001860981828916972, 0.0004606626488816843, 1.005861545990285, 232.5082818898849],
+      [0.8500775547254543, 0.2885345530086024, -0.5615430017168519, 0.7131964507574368, 0.2301740793416509, 0.7399867163081146, 1.001594000240399, 380.2689052577834],
+      [0.879923297328947, 0.3398407921249819, -0.5400825052039652, 0.6852765479619829, 0.2585528188121205, 0.863036368798984, 1.002612170061262, 329.9915859770657],
+      [1.265357149497031, 0.2842865437782062, -0.9810706057188253, 0.7690854950306439, 0.1853149385524942, 0.5629641195726505, 1.006033987260548, 228.9374825707941],
+      [3.386573798617218, 0.2270497430797874, -3.15952405553743, 0.9788807047393349, 0.01415955368985554, 0.03554700141527971, 1.023862940746632, 89.91247458983985],
+      [0.9143263755260678, 0.3132893075830935, -0.6010370679429743, 0.7078649599298348, 0.2374352462676864, 0.770599103782582, 1.002520867280375, 333.9454156334616],
+      [1.747982188692916, 0.2429612522326796, -1.505020936460236, 0.909189543212182, 0.06877932466009581, 0.1827954310517377, 1.017903315860403, 112.3120468033435],
+      [2.396009525246266, 0.3812314445698044, -2.014778080676462, 0.7485895024695801, 0.2072063773965674, 0.6468491459159433, 1.005927989361195, 231.1190861723064],
+      [0.7801377751991305, 0.3148531020958606, -0.4652846731032699, 0.6812988595436617, 0.2591968735239502, 0.8659383846203885, 1.001584933802911, 380.7863151860167],
+      [0.8642106624037235, 0.2944364985785053, -0.5697741638252182, 0.7116338562842216, 0.2322009112194613, 0.7484733927102407, 1.001793245221228, 369.2462859577397],
+      [2.334928054729291, 0.2529817697151248, -2.081946285014166, 0.8188189448731039, 0.1429155155424426, 0.4126822464878207, 1.009264597631995, 177.9860265817098],
+      [4.012810906524066, 1.740008669293754, -2.272802237230312, 0.6803087637664978, 0.09961767676691284, 0.2738227249279784, 1.02812033479998, 78.84596344629516],
+      [1.893431573742368, 0.249104025998263, -1.644327547744105, 0.9131039964835928, 0.06577618147979301, 0.1742519958072535, 1.01927479388386, 106.1833227146556],
+      [0.8500775547254543, 0.2885345530086024, -0.5615430017168519, 0.7131964507574368, 0.2301740793416509, 0.7399867163081146, 1.001594000240399, 380.2689052577834],
+      [2.396009525246266, 0.3812314445698044, -2.014778080676462, 0.7485895024695801, 0.2072063773965674, 0.6468491459159433, 1.005927989361195, 231.1190861723064],
+      [0.8773937341354101, 0.3475099896630789, -0.5298837444723312, 0.680300917779261, 0.2633474859906303, 0.8847621604953562, 1.002697441028938, 326.3835308627669],
+      [0.8500775547254543, 0.2885345530086024, -0.5615430017168519, 0.7131964507574368, 0.2301740793416509, 0.7399867163081146, 1.001594000240399, 380.2689052577834],
+      [0.879923297328947, 0.3398407921249819, -0.5400825052039652, 0.6852765479619829, 0.2585528188121205, 0.863036368798984, 1.002612170061262, 329.9915859770657],
+      [0.7476415468821919, 0.3050688229513163, -0.4425727239308756, 0.6808592897393608, 0.2582847841992972, 0.8618301293912014, 1.001309292765077, 397.2252313488673],
+      [1.904393480036484, 0.2647501636620131, -1.639643316374471, 0.9066459155163752, 0.07089369348487556, 0.1888435840379475, 1.017432090530896, 114.5907180184054],
+      [4.059813130818677, 1.504484763319965, -2.555328367498712, 0.7138846251354523, 0.1381636611549297, 0.3967610857199549, 1.021707172754684, 96.86136707511619],
+      [1.905518538776071, 0.2638704414026535, -1.641648097373417, 0.9070866731084359, 0.07054467910903742, 0.1878433320368591, 1.017550293813628, 114.0101864407546],
+      [1.715765193114003, 0.2907674285480563, -1.424997764565947, 0.8849268720917056, 0.08822256507677341, 0.2394698707960595, 1.013131090379338, 140.8598459981256],
+      [3.391508830757959, 0.216421979148991, -3.175086851608968, 0.989984204162759, 0.005691987732051195, 0.01416782080811488, 1.021578014860261, 97.31347565728423],
+      [2.660356183495671, 0.2090031323858446, -2.451353051109826, 0.9722585501250844, 0.01912299497359507, 0.04825045315940388, 1.03229858317563, 70.44124967350001],
+      [0.7546747956064246, 0.9896341939414016, 0.234959398334977, 0.3145974918866866, 0.6158314680288743, 3.967346457417642, 1.000321113958472, 470.1236637467613],
+      [1.781050983847531, 0.2478735960713729, -1.533177387776158, 0.9084474420249427, 0.06941491996355192, 0.1846106625687735, 1.017910294904977, 112.2790028505335],
+      [0.9444540669483967, 0.3575106756104039, -0.5869433913379928, 0.6865353752944214, 0.2588678624946797, 0.8644552791274397, 1.003330330066721, 301.9094206827929],
+      [2.84915490144642, 0.2192640719452532, -2.629890829501166, 0.973424212206449, 0.01812840121497342, 0.04569459636069093, 1.028396449617761, 78.22565626807496],
+      [1.780620092798824, 0.2556931734938472, -1.524926919304977, 0.904773879819467, 0.07235980782563177, 0.193053591985182, 1.017054200514265, 116.4883778122144],
+      [0.9206027889504963, 0.2988138267809606, -0.6217889621695356, 0.7183615617347812, 0.2273629844284903, 0.7282899043609945, 1.002369001746807, 340.7385402048528],
+      [2.598293029507792, 0.2495774151293486, -2.348715614378444, 0.9608767304519933, 0.02666837695979273, 0.06781031950655803, 1.022208017193628, 95.14877758429073],
+      [0.9624315338084155, 0.3106932502616423, -0.6517382835467732, 0.7172379818069443, 0.2295641327051292, 0.7374415107863223, 1.002954263939352, 315.9832585879507],
+      [0.9014924157857125, 0.2865136631226748, -0.6149787526630377, 0.7235258796884531, 0.2217291347545042, 0.7051021329532657, 1.002003492678128, 358.2938572170438],
+      [3.811668627607542, 0.2312102647241832, -3.580458362883359, 0.9913816067556424, 0.004682105159044931, 0.01164231619859586, 1.01664878577733, 118.5978884213797],
+      [0.9444540669483967, 0.3575106756104039, -0.5869433913379928, 0.6865353752944214, 0.2588678624946797, 0.8644552791274397, 1.003330330066721, 301.9094206827929],
+      [1.777530825230482, 0.2558079156468711, -1.521722909583611, 0.9045651647702911, 0.07252496189729681, 0.1935286728485248, 1.016997577176945, 116.7783387628256],
+      [0.8606419912113049, 0.302976401582314, -0.5576655896289909, 0.7051893492617515, 0.2384306071191618, 0.7748409447762756, 1.001897755067703, 363.7187450907838],
+      [0.678471836720804, 0.7141577792230314, 0.03568594250222734, 0.4097986180900882, 0.5250941136273299, 2.736463351721737, 1.009733073766193, 172.4510351826778],
+      [1.648766207892558, 1.561734037305302, -0.08703217058725632, 0.3918919517990191, 0.4592050453328475, 2.101522571075977, 1.010917937690067, 159.9049636064798],
+      [0.8026994758561283, 0.793804226770857, -0.008895249085271284, 0.4250804735282473, 0.5085593573893024, 2.561124074116115, 1.007188543480821, 207.6299972091724],
+      [0.7871260302852221, 0.3391963520899104, -0.4479296781953117, 0.6670270080830214, 0.2736441503670521, 0.9323882015745496, 1.002009915419368, 357.9696003076922],
+      [1.634205768711575, 0.6548164661826361, -0.9793893025289384, 0.7200071971572966, 0.2188062643449885, 0.6932039655583935, 1.020403256875369, 101.6366414595231],
+      [1.240718497203804, 0.602033040085683, -0.6386854571181209, 0.6903879306308378, 0.2473047203396537, 0.8131548420299818, 1.018268749372701, 110.6084578033472],
+      [1.779441333776731, 0.2699135741187552, -1.509527759657976, 0.8981271134950435, 0.07767070531752543, 0.2084161097472951, 1.015621002536229, 124.3173002717004],
+      [1.764282835104488, 0.3340412215601419, -1.430241613544346, 0.8963625303803646, 0.07544340811606652, 0.2019518513501425, 1.009829437552272, 171.3558391989647],
+      [0.9143263755260678, 0.3132893075830935, -0.6010370679429743, 0.7078649599298348, 0.2374352462676864, 0.770599103782582, 1.002520867280375, 333.9454156334616],
+      [3.742558659647554, 1.031609995620649, -2.710948664026905, 0.8489086332491331, 0.0570329289723687, 0.1496887588806893, 1.015107286497166, 127.3950770129534],
+      [1.39746988983128, 0.3625091668631258, -1.034960722968154, 0.8277783697565937, 0.1351211916819625, 0.3866591125551553, 1.006568523502712, 218.5443870290024],
+      [0.6784394920768857, 0.7127260769352587, 0.03428658485837299, 0.4102517080027428, 0.5246437894238321, 2.731526403146054, 1.009766400372795, 172.070655201214],
+      [0.8931341938027326, 1.226929193037944, 0.3337949992352114, 0.3185090309527843, 0.6065279050882537, 3.815020606282528, 0.9977855766652421, 892.7240671936559],
+      [0.9624315338084155, 0.3106932502616423, -0.6517382835467732, 0.7172379818069443, 0.2295641327051292, 0.7374415107863223, 1.002954263939352, 315.9832585879507],
+      [4.469494099645859, 0.2441070202593358, -4.225387079386523, 0.9966380926568149, 0.001227560028664588, 0.003041839027505276, 1.009633036004173, 173.6032343848797],
+      [2.939396271734547, 0.2276946313206987, -2.711701640413849, 0.9730921780251865, 0.01822726870946815, 0.04594842925627046, 1.025767830823769, 84.58245065272946],
+      [0.7801377751991305, 0.3148531020958606, -0.4652846731032699, 0.6812988595436617, 0.2591968735239502, 0.8659383846203885, 1.001584933802911, 380.7863151860167],
+      [0.9624315338084155, 0.3106932502616423, -0.6517382835467732, 0.7172379818069443, 0.2295641327051292, 0.7374415107863223, 1.002954263939352, 315.9832585879507],
+      [1.834989212729688, 0.2894383370148303, -1.545550875714858, 0.8922843161668783, 0.08226324335795676, 0.2218440274966692, 1.014332885845862, 132.3436266103738],
+      [0.9139051127103903, 0.3142478474187145, -0.5996572652916758, 0.7071646828556413, 0.2381072007503703, 0.7734614970219971, 1.002531005166252, 333.5016749599022],
+      [1.715024659066031, 0.3171333269638615, -1.39789133210217, 0.8730104966215428, 0.0976869917995358, 0.2679412361113644, 1.011289628398322, 156.3450793652712],
+      [1.764742027537499, 0.2817367767573729, -1.483005250780127, 0.8919149158692393, 0.08262108186532277, 0.2228959414861747, 1.014387497033016, 131.9817029527854],
+      [2.050235694852525, 0.2514028638220026, -1.798832831030523, 0.9184631235103193, 0.06157623723284685, 0.1623955742537747, 1.02020362602822, 102.4113407295591],
+      [2.01963245169808, 0.2610208061297475, -1.758611645568332, 0.9131841665789479, 0.06572103150186677, 0.1740956170081388, 1.018678759339878, 108.7596312359858],
+      [2.033590767601274, 0.2517327146861076, -1.781858052915167, 0.9176810039491073, 0.06219072793991796, 0.1641236462790715, 1.020053771460824, 103.0009844881515],
+      [2.940100181966283, 0.2537295563135036, -2.68637062565278, 0.9673579610783642, 0.02177611220105564, 0.055093722938989, 1.020234273453945, 102.2916123497916],
+      [0.8413075707773295, 0.358938194848529, -0.4823693759288006, 0.6666617693115888, 0.2757165802675116, 0.9421376917651514, 1.002604040127967, 330.3398048529531],
+      [2.03108657552718, 0.2517690633248664, -1.779317512202314, 0.9175687393542246, 0.06227898473106254, 0.1643720282110906, 1.020033227438396, 103.0823706114945],
+      [2.719759032294967, 0.2335107491862068, -2.486248283108761, 0.967691305885789, 0.02203467253963299, 0.05576262144383996, 1.025307646300109, 85.80871459843078],
+      [2.028421455034558, 0.2518553712689094, -1.776566083765649, 0.9174235817894703, 0.06239321232782832, 0.1646935694545862, 1.020002010987899, 103.2062919961641],
+      [1.509350435191226, 0.2541755494920105, -1.255174885699216, 0.8905366460804409, 0.08350385893647684, 0.2254944951328877, 1.011754864381695, 152.11168233891],
+      [0.913770735907075, 0.2948542348044822, -0.6189165011025928, 0.7198478985031778, 0.225704156193793, 0.721427457110446, 1.002242743960764, 346.6026991447079],
+      [0.8789701966315052, 0.3275055332809348, -0.5514646633505704, 0.69266092973228, 0.2513023379988544, 0.8307112483915374, 1.002425828111919, 338.1641517723739],
+      [2.487314358465191, 0.2787058451412255, -2.208608513323965, 0.9496824517535731, 0.03412107498137948, 0.08742991457004654, 1.017434656017688, 114.5780532307779],
+      [2.934478535687643, 0.215425131410716, -2.719053404276928, 0.9755896325712901, 0.01662738523498272, 0.04184715023700355, 1.029052753767091, 76.79160069369321],
+      [1.656488735402689, 0.2921869177433767, -1.364301817659312, 0.8806118049208574, 0.0917206243520752, 0.2499237845013524, 1.012340265349199, 147.1073865524904],
+      [0.7801377751991305, 0.3148531020958606, -0.4652846731032699, 0.6812988595436617, 0.2591968735239502, 0.8659383846203885, 1.001584933802911, 380.7863151860167],
+      [0.9624315338084155, 0.3106932502616423, -0.6517382835467732, 0.7172379818069443, 0.2295641327051292, 0.7374415107863223, 1.002954263939352, 315.9832585879507],
+      [0.9019329377820589, 0.3461953402214831, -0.5557375975605758, 0.6855612839555099, 0.258847144180966, 0.864361929839065, 1.002867784438382, 319.409620335311],
+      [0.8375068334189539, 0.3205251509418617, -0.5169816824770922, 0.6892827980623748, 0.2533478012570146, 0.8397670499373485, 1.00200771737243, 358.0805035752871],
+      [1.688720633570221, 0.2653448899456691, -1.423375743624552, 0.8953484388586379, 0.07987045315315824, 0.2148311289167694, 1.014765590281752, 129.5307980796283],
+      [0.8970686266384508, 0.2962209913993141, -0.6008476352391366, 0.7161823508436315, 0.2287950897563492, 0.7342381610667212, 1.002105913598215, 353.1927933056136],
+      [8.134274805885381, 0.3236848898586997, -7.810589916026681, 0.999268786738394, 0.0001046780973969218, 0.0002590963666865543, 1.008319937512439, 190.330118572013],
+      [0.9624315338084155, 0.3106932502616423, -0.6517382835467732, 0.7172379818069443, 0.2295641327051292, 0.7374415107863223, 1.002954263939352, 315.9832585879507],
+      [1.265357149497031, 0.2842865437782062, -0.9810706057188253, 0.7690854950306439, 0.1853149385524942, 0.5629641195726505, 1.006033987260548, 228.9374825707941],
+      [0.9206027889504963, 0.2988138267809606, -0.6217889621695356, 0.7183615617347812, 0.2273629844284903, 0.7282899043609945, 1.002369001746807, 340.7385402048528],
+      [1.611739623079011, 0.29431667937043, -1.317422943708581, 0.8767068309514139, 0.0948878148131662, 0.25945860135172, 1.01162826073034, 153.2402627139267],
+      [2.396009525246266, 0.3812314445698044, -2.014778080676462, 0.7485895024695801, 0.2072063773965674, 0.6468491459159433, 1.005927989361195, 231.1190861723064],
+      [3.740408356297505, 0.2614944205792935, -3.478913935718212, 0.9874666675132306, 0.006302050180701209, 0.01569594622659093, 1.013170584069406, 140.5620930969249],
+      [0.8773937341354101, 0.3475099896630789, -0.5298837444723312, 0.680300917779261, 0.2633474859906303, 0.8847621604953562, 1.002697441028938, 326.3835308627669],
+      [3.000783135876334, 0.2283164596125082, -2.772466676263826, 0.9739412300744752, 0.01760817539912955, 0.04435980772228281, 1.02532282943649, 85.76766211710449],
+      [4.046159953919998, 0.2197941303886325, -3.826365823531366, 0.996698584324353, 0.001362922631622436, 0.003377719302119125, 1.013118698170337, 140.9535413735539],
+      [1.330677776874429, 0.6467093397532399, -0.6839684371211895, 0.6831838163610117, 0.2520283941838427, 0.8339200190649145, 1.016952414954008, 117.0106806268766],
+      [0.8315352531217016, 0.3380690963747991, -0.4934661567469025, 0.6770139950760986, 0.2652481983594149, 0.8934532276344349, 1.002244072343871, 346.5399389706319],
+      [0.8315352531217016, 0.3380690963747991, -0.4934661567469025, 0.6770139950760986, 0.2652481983594149, 0.8934532276344349, 1.002244072343871, 346.5399389706319],
+      [1.464950434323551, 0.6692063920018679, -0.7957440423216829, 0.692980259398094, 0.2420711584667045, 0.790450455290782, 1.017532676204988, 114.0963256906952],
+      [2.552746618639876, 0.2197637476151922, -2.332982871024683, 0.9673709181784778, 0.02254934021421641, 0.05709512577400028, 1.02942457062379, 76.00342524995638],
+      [1.763975838445919, 0.3340416460876607, -1.429934192358258, 0.8963398662314417, 0.07545998907983094, 0.2019998590169023, 1.009824574095602, 171.4107725781169],
+      [1.609494614479217, 0.2699398812618315, -1.339554733217385, 0.8884940346552783, 0.08534833518686101, 0.2309401076605741, 1.013074248458301, 141.2906743362518],
+      [1.851172647644643, 0.2616824983574773, -1.589490149287166, 0.9055139845135185, 0.07179442717831423, 0.1914285026171123, 1.017292918748209, 115.2821199568123],
+      [0.9444540669483967, 0.3575106756104039, -0.5869433913379928, 0.6865353752944214, 0.2588678624946797, 0.8644552791274397, 1.003330330066721, 301.9094206827929],
+      [1.904588503905696, 0.2647711630060389, -1.639817340899657, 0.9066450265459751, 0.07089515201464407, 0.1888477656640911, 1.017433779031084, 114.5823822390266],
+      [0.8549361465828247, 0.3175902642751303, -0.5373458823076944, 0.6944796931021142, 0.2487874201581454, 0.8196446407715443, 1.002085383609697, 354.2034904382638],
+      [0.8789701966315052, 0.3275055332809348, -0.5514646633505704, 0.69266092973228, 0.2513023379988544, 0.8307112483915374, 1.002425828111919, 338.1641517723739],
+      [1.914170600651981, 0.2502972731597808, -1.6638733274922, 0.9134799882528462, 0.06548715832293697, 0.1734326703104307, 1.019339675379801, 105.9104902720676],
+      [0.6283723130404157, 0.4108805621366812, -0.2174917509037345, 0.5844466770929027, 0.3502757458708007, 1.33426172002277, 1.00266779096141, 327.6290230850982],
+      [0.8382414921400769, 0.3184858895823133, -0.5197556025577637, 0.6907498060753554, 0.2519253815251415, 0.8334643803652261, 1.001980100570144, 359.4798607302892],
+      [0.8970686266384508, 0.2962209913993141, -0.6008476352391366, 0.7161823508436315, 0.2287950897563492, 0.7342381610667212, 1.002105913598215, 353.1927933056136],
+      [0.8413075707773295, 0.358938194848529, -0.4823693759288006, 0.6666617693115888, 0.2757165802675116, 0.9421376917651514, 1.002604040127967, 330.3398048529531],
+      [0.9668665416554862, 0.3009599098333312, -0.6659066318221551, 0.7241811011389289, 0.2229386169158468, 0.7100517706055723, 1.002874442834298, 319.14314136437],
+      [2.334928054729291, 0.2529817697151248, -2.081946285014166, 0.8188189448731039, 0.1429155155424426, 0.4126822464878207, 1.009264597631995, 177.9860265817098],
+      [0.7492523886195629, 0.6576482810600396, -0.09160410755952331, 0.4544022896891072, 0.4808519466127041, 2.292346096214887, 1.011023150552758, 158.8805362645371],
+      [0.9624315338084155, 0.3106932502616423, -0.6517382835467732, 0.7172379818069443, 0.2295641327051292, 0.7374415107863223, 1.002954263939352, 315.9832585879507],
+      [2.453499749534203, 0.2854573566883238, -2.168042392845879, 0.9589026499222643, 0.02450511964748176, 0.06217157533308705, 1.014160272400915, 133.5011430645463],
+      [1.889739353426534, 0.2924857043045225, -1.597253649122012, 0.8938187312628789, 0.08098070264167127, 0.2180805576262257, 1.014413479273869, 131.8102257961738],
+      [0.9668665416554862, 0.3009599098333312, -0.6659066318221551, 0.7241811011389289, 0.2229386169158468, 0.7100517706055723, 1.002874442834298, 319.14314136437],
+      [1.71352849088518, 0.9771477053842847, -0.736380785500895, 0.5847392449195513, 0.3200459536993177, 1.164911190604766, 1.002552621520318, 332.5594870922525],
+      [0.8549361465828247, 0.3175902642751303, -0.5373458823076944, 0.6944796931021142, 0.2487874201581454, 0.8196446407715443, 1.002085383609697, 354.2034904382638],
+      [2.336475131161129, 1.030735736097275, -1.305739395063853, 0.7063027053982162, 0.1832431616740689, 0.555258270676141, 1.009085942066246, 180.1937135205514],
+      [0.7769218462943511, 0.3249501839982318, -0.4519716622961193, 0.6738951028819534, 0.266442203362273, 0.8989358860431415, 1.001733410476876, 372.4880523976879],
+      [0.9444540669483967, 0.3575106756104039, -0.5869433913379928, 0.6865353752944214, 0.2588678624946797, 0.8644552791274397, 1.003330330066721, 301.9094206827929],
+      [0.564806099957197, 0.4146369877854267, -0.1501691121717703, 0.5595327187522922, 0.3724462711940186, 1.46883412970608, 1.00277378579811, 323.220219714781],
+      [1.526710078704711, 0.2635293776951256, -1.263180701009585, 0.8866772678781609, 0.08670972951174682, 0.2349735830800894, 1.011750141655602, 152.1534759146264],
+      [0.9668665416554862, 0.3009599098333312, -0.6659066318221551, 0.7241811011389289, 0.2229386169158468, 0.7100517706055723, 1.002874442834298, 319.14314136437],
+      [0.9143263755260678, 0.3132893075830935, -0.6010370679429743, 0.7078649599298348, 0.2374352462676864, 0.770599103782582, 1.002520867280375, 333.9454156334616],
+      [0.7125756983357391, 0.6401303654591134, -0.07244533287662569, 0.44997777248522, 0.4852964932605593, 2.333512141800834, 1.011540522419524, 154.0325147995647],
+      [0.7801377751991305, 0.3148531020958606, -0.4652846731032699, 0.6812988595436617, 0.2591968735239502, 0.8659383846203885, 1.001584933802911, 380.7863151860167],
+      [3.016712611794625, 0.2184270905007664, -2.798285521293858, 0.9761709333335634, 0.01617263043658954, 0.04068382722451139, 1.027787131935477, 79.60843169506757],
+      [2.334928054729291, 0.2529817697151248, -2.081946285014166, 0.8188189448731039, 0.1429155155424426, 0.4126822464878207, 1.009264597631995, 177.9860265817098],
+      [0.8017827875978873, 0.2910612307310945, -0.5107215568667929, 0.7022267674392259, 0.2392275136253522, 0.7782450512235876, 1.001321364323131, 396.4753389951715],
+      [0.9143263755260678, 0.3132893075830935, -0.6010370679429743, 0.7078649599298348, 0.2374352462676864, 0.770599103782582, 1.002520867280375, 333.9454156334616],
+      [7.792300472335936, 0.2878921619229802, -7.504408310412956, 0.9995703281756907, 8.600802741219532e-05, 0.0002128807446451239, 1.006148192280498, 226.6333409000423],
+      [3.036127809666008, 0.2303084964859248, -2.805819313180084, 0.9740455107461452, 0.01750349347529791, 0.04409138703749779, 1.024675658758851, 87.55475354197443],
+      [1.833385630465268, 0.2894079217127561, -1.543977708752512, 0.8922116320803809, 0.08232190332399049, 0.2220164100677903, 1.014321924437296, 132.4165173347197],
+      [0.9624315338084155, 0.3106932502616423, -0.6517382835467732, 0.7172379818069443, 0.2295641327051292, 0.7374415107863223, 1.002954263939352, 315.9832585879507],
+      [1.07651263206365, 0.6312887326486438, -0.445223899415006, 0.5322605998401823, 0.4061392271744343, 1.692584416177677, 1.014090805631111, 133.9728790499927],
+      [1.829969475321141, 0.2965860830115797, -1.533383392309561, 0.8888797669808787, 0.08494337823593963, 0.2297426361230873, 1.013665678154553, 136.9362938796037],
+      [0.8906386807517885, 0.3112718557519627, -0.5793668249998258, 0.7050913587213025, 0.2394701733418628, 0.7792830257040086, 1.002277428101499, 344.9715261966949],
+      [0.9624315338084155, 0.3106932502616423, -0.6517382835467732, 0.7172379818069443, 0.2295641327051292, 0.7374415107863223, 1.002954263939352, 315.9832585879507],
+      [0.9156865095807959, 0.3099930453096433, -0.6056934642711526, 0.7102035250013152, 0.2351908633382191, 0.7610749324307075, 1.002485415633677, 335.5065881985654],
+      [0.8970686266384508, 0.2962209913993141, -0.6008476352391366, 0.7161823508436315, 0.2287950897563492, 0.7342381610667212, 1.002105913598215, 353.1927933056136],
+      [0.9143263755260678, 0.3132893075830935, -0.6010370679429743, 0.7078649599298348, 0.2374352462676864, 0.770599103782582, 1.002520867280375, 333.9454156334616],
+      [2.54683347842543, 0.2198250328877518, -2.327008445537678, 0.967212460807873, 0.02266598857719968, 0.05739733020703332, 1.02942113986122, 76.01061993638093],
+      [2.940549556792525, 0.2336946734881631, -2.706854883304362, 0.9718248732265972, 0.01902767980815442, 0.04800529252389728, 1.024328145102968, 88.54691405675462],
+      [1.265357149497031, 0.2842865437782062, -0.9810706057188253, 0.7690854950306439, 0.1853149385524942, 0.5629641195726505, 1.006033987260548, 228.9374825707941],
+      [3.87217777307695, 0.9272071988017576, -2.944970574275192, 0.8832672642526476, 0.04672575763566923, 0.1213105390415442, 1.011747702303144, 152.1750720919439],
+      [0.8413075707773295, 0.358938194848529, -0.4823693759288006, 0.6666617693115888, 0.2757165802675116, 0.9421376917651514, 1.002604040127967, 330.3398048529531],
+      [0.7871260302852221, 0.3391963520899104, -0.4479296781953117, 0.6670270080830214, 0.2736441503670521, 0.9323882015745496, 1.002009915419368, 357.9696003076922],
+      [1.894907727153429, 0.2469128471108598, -1.64799488004257, 0.9141136978177385, 0.06497476661893217, 0.1719813825798932, 1.01956132055181, 104.9893216144414],
+      [0.9143263755260678, 0.3132893075830935, -0.6010370679429743, 0.7078649599298348, 0.2374352462676864, 0.770599103782582, 1.002520867280375, 333.9454156334616],
+      [1.511391875054376, 0.6129903057067593, -0.8984015693476172, 0.7246590567127789, 0.2167333743527181, 0.6848196441238223, 1.022152038272382, 95.33705684840299],
+      [1.728532135807204, 0.2710492376146671, -1.457482898192537, 0.894864864376412, 0.08027459485841856, 0.2160130447451841, 1.014877434418238, 128.82365374119],
+      [0.9019329377820589, 0.3461953402214831, -0.5557375975605758, 0.6855612839555099, 0.258847144180966, 0.864361929839065, 1.002867784438382, 319.409620335311],
+      [0.7391568230734554, 0.9415714782384356, 0.2024146551649801, 0.3210605998412318, 0.6101804993260873, 3.87395705592724, 1.001443306515297, 389.057466861088],
+      [1.88697930215683, 0.2636882247877085, -1.623291077369121, 0.9063101049944153, 0.07116254615639214, 0.1896146104725104, 1.017406751842688, 114.7159607498255],
+      [0.7688068083213828, 0.6361687183095418, -0.132638090011841, 0.4694559305089389, 0.4662149761096786, 2.161622609857363, 1.011792741272698, 151.7773420355772],
+      [1.508941951772613, 0.6659968244061185, -0.8429451273664947, 0.7000820666707988, 0.2358739495711217, 0.7639677263653059, 1.018272118001973, 110.5930025905576],
+      [0.8773937341354101, 0.3475099896630789, -0.5298837444723312, 0.680300917779261, 0.2633474859906303, 0.8847621604953562, 1.002697441028938, 326.3835308627669],
+      [1.854144473996553, 0.2482651931323251, -1.605879280864228, 0.911693355383927, 0.06687768686978803, 0.1773792065938124, 1.018900363058617, 107.7867676332771],
+      [2.995835661509661, 0.2177481459736557, -2.778087515536006, 0.9760370356447799, 0.01627606015247546, 0.0409483196443525, 1.028080471094038, 78.93637478717828],
+      [0.9668665416554862, 0.3009599098333312, -0.6659066318221551, 0.7241811011389289, 0.2229386169158468, 0.7100517706055723, 1.002874442834298, 319.14314136437],
+      [2.840422857790316, 0.2192612564237259, -2.62116160136659, 0.9732579953808159, 0.01824949051068622, 0.04600548865574921, 1.028438778026523, 78.13146865018253],
+      [2.455005917288323, 0.3057837283991338, -2.149222188889189, 0.9408513770576292, 0.03974851164728981, 0.1024462159425694, 1.013999387746001, 134.5989348783295],
+      [0.8910433359442418, 0.3103357814592619, -0.5807075544849798, 0.7057855884293825, 0.2388019956728835, 0.7764265002122339, 1.002266581537338, 345.479962660838],
+      [0.8910433359442418, 0.3103357814592619, -0.5807075544849798, 0.7057855884293825, 0.2388019956728835, 0.7764265002122339, 1.002266581537338, 345.479962660838],
+      [1.332105504292163, 0.2911527042999624, -1.0409527999922, 0.8580664866696359, 0.1099519966711528, 0.3057382173740006, 1.006919592646802, 212.2251145617833],
+      [0.879923297328947, 0.3398407921249819, -0.5400825052039652, 0.6852765479619829, 0.2585528188121205, 0.863036368798984, 1.002612170061262, 329.9915859770657],
+      [2.491162154708401, 0.2786074996896643, -2.212554655018737, 0.9498361142817293, 0.0340058323374775, 0.08712422821188849, 1.017442877786285, 114.5374851302631],
+      [0.7871260302852221, 0.3391963520899104, -0.4479296781953117, 0.6670270080830214, 0.2736441503670521, 0.9323882015745496, 1.002009915419368, 357.9696003076922],
+      [4.176822111673053, 0.2393194605017307, -3.937502651171322, 0.9924917191674293, 0.003990084113697441, 0.009914673748003902, 1.014148482349454, 133.5809661006575],
+      [2.720677787970423, 0.2079160295827146, -2.512761758387708, 0.9736541385090387, 0.0181208301669939, 0.04567516052169845, 1.032395404079509, 70.26875466305658],
+      [0.7117442853123787, 0.6750078834102817, -0.03673640190209693, 0.4353740231518176, 0.4996082788135175, 2.471038713266321, 1.010525437646852, 163.8490465249102],
+      [2.500523841033011, 0.2269268494417441, -2.273596991591267, 0.9642325385084416, 0.02474522610131521, 0.06279620239103423, 1.027610842816234, 80.0181358918106],
+      [2.978958836684555, 0.2680312662768128, -2.710927570407742, 0.9821665206412863, 0.007032970310477123, 0.01752927662434437, 1.011258902418437, 156.633191849101],
+      [1.592635024957624, 0.2801119876882321, -1.312523037269391, 0.8823976166017655, 0.09028267779042472, 0.2456167646981983, 1.012164518780813, 148.5739223895976],
+      [0.8413075707773295, 0.358938194848529, -0.4823693759288006, 0.6666617693115888, 0.2757165802675116, 0.9421376917651514, 1.002604040127967, 330.3398048529531],
+      [2.601420958867407, 0.2101101404899524, -2.391310818377455, 0.9707923028857582, 0.02018140596153751, 0.05097600312886122, 1.032154149997674, 70.70024102322525],
+      [0.8773937341354101, 0.3475099896630789, -0.5298837444723312, 0.680300917779261, 0.2633474859906303, 0.8847621604953562, 1.002697441028938, 326.3835308627669],
+      [0.9624315338084155, 0.3106932502616423, -0.6517382835467732, 0.7172379818069443, 0.2295641327051292, 0.7374415107863223, 1.002954263939352, 315.9832585879507],
+      [1.667319262539328, 0.6272923305929466, -1.040026931946381, 0.7356120595181982, 0.2065749504793381, 0.64436477134683, 1.022733121004735, 93.41964071503168],
+      [2.396009525246266, 0.3812314445698044, -2.014778080676462, 0.7485895024695801, 0.2072063773965674, 0.6468491459159433, 1.005927989361195, 231.1190861723064],
+      [0.7871260302852221, 0.3391963520899104, -0.4479296781953117, 0.6670270080830214, 0.2736441503670521, 0.9323882015745496, 1.002009915419368, 357.9696003076922],
+      [0.5722855475328105, 0.9362471643639783, 0.3639616168311678, 0.3174673733776016, 0.6211480790112477, 4.057753786980037, 1.00898686434514, 181.4423296529839],
+      [2.396009525246266, 0.3812314445698044, -2.014778080676462, 0.7485895024695801, 0.2072063773965674, 0.6468491459159433, 1.005927989361195, 231.1190861723064],
+      [0.8789701966315052, 0.3275055332809348, -0.5514646633505704, 0.69266092973228, 0.2513023379988544, 0.8307112483915374, 1.002425828111919, 338.1641517723739],
+      [0.7846952375911359, 0.3419695414072991, -0.4427256961838368, 0.66474930843101, 0.2758187037484801, 0.9426195616677815, 1.002042312464576, 356.3430111960679],
+      [0.9027386312484692, 0.3437531283845285, -0.5589855028639408, 0.6871058824340311, 0.2573635938383049, 0.8576911239257928, 1.002843519720821, 320.3845531958507],
+      [0.7960903632099977, 0.3064198752854755, -0.4896704879245222, 0.690383633266426, 0.2507810120802267, 0.8284111092745902, 1.001528173472527, 384.0581547005908],
+      [1.082459202612813, 0.6303250205192519, -0.4521341820935609, 0.5333985981074874, 0.4050806177920331, 1.685168701353431, 1.014168213543414, 133.4474338868085],
+      [0.8413075707773295, 0.358938194848529, -0.4823693759288006, 0.6666617693115888, 0.2757165802675116, 0.9421376917651514, 1.002604040127967, 330.3398048529531],
+      [4.538414837959855, 0.2434491174865033, -4.294965720473352, 0.9935909409228831, 0.003380031349888639, 0.008393656316472247, 1.012588069724019, 145.0893217258987],
+      [1.890043403434193, 0.2924876019425393, -1.597555801491653, 0.8938335591220085, 0.08096786618657266, 0.2180429436004691, 1.014413229399085, 131.8118727308687],
+      [1.273687850790189, 0.3689010401916521, -0.9047868105985366, 0.8124184203742892, 0.1482015260309627, 0.4306018158481385, 1.005348400421654, 243.8372968412305],
+      [1.466667961550674, 0.7089142997238984, -0.7577536618267757, 0.676859446275393, 0.2545004063749204, 0.8448918251794992, 1.015267057889396, 126.4211459557757],
+      [0.9156865095807959, 0.3099930453096433, -0.6056934642711526, 0.7102035250013152, 0.2351908633382191, 0.7610749324307075, 1.002485415633677, 335.5065881985654],
+      [1.481783647959608, 1.736451524245542, 0.254667876285934, 0.3344158997063016, 0.5147039257950496, 2.624887783562591, 1.011433528258836, 155.0100821043556],
+      [0.7037078232127147, 1.594878727728295, 0.8911709045155802, 0.1723966179978587, 0.7584787080362883, 7.772272335970688, 0.9974444145414667, 1016.161569101106],
+      [1.275118896745693, 0.368784791932814, -0.9063341048128792, 0.8126209139365349, 0.1480281360776774, 0.4300104968147133, 1.005361889457443, 243.5251481417109],
+      [2.648377596754611, 0.2770584485217114, -2.371319148232899, 0.9670923591199616, 0.01870636593777724, 0.04717919032569691, 1.014668969935728, 130.1481597762916],
+      [0.7401326238170173, 0.2943376857530516, -0.4457949380639656, 0.6867910948254169, 0.2519957086922944, 0.833775433192942, 1.001134236074647, 408.4309186452369],
+      [0.7475862077233261, 0.7289016926185065, -0.01868451510481961, 0.4280221324975716, 0.5064676994405842, 2.539780652051855, 1.008927429021141, 182.1998744948708],
+      [0.7871260302852221, 0.3391963520899104, -0.4479296781953117, 0.6670270080830214, 0.2736441503670521, 0.9323882015745496, 1.002009915419368, 357.9696003076922],
+      [2.411323584048575, 0.5805378369995056, -1.830785747049069, 0.6096380066591316, 0.3357362411583407, 1.250885920101035, 1.016516888473279, 119.301325105085],
+      [2.396009525246266, 0.3812314445698044, -2.014778080676462, 0.7485895024695801, 0.2072063773965674, 0.6468491459159433, 1.005927989361195, 231.1190861723064],
+      [0.7960903632099977, 0.3064198752854755, -0.4896704879245222, 0.690383633266426, 0.2507810120802267, 0.8284111092745902, 1.001528173472527, 384.0581547005908],
+      [0.8882249441693671, 0.3172865720399499, -0.5709383721294172, 0.7007791696166791, 0.2436218023822329, 0.7971447477653065, 1.002348321846302, 341.6852605085693],
+      [0.9444540669483967, 0.3575106756104039, -0.5869433913379928, 0.6865353752944214, 0.2588678624946797, 0.8644552791274397, 1.003330330066721, 301.9094206827929],
+      [4.733855670346002, 0.2493868935702829, -4.484468776775719, 0.9937487924115234, 0.003251041119604616, 0.008072289166132477, 1.01162389268238, 153.2795072790302],
+      [0.8017827875978873, 0.2910612307310945, -0.5107215568667929, 0.7022267674392259, 0.2392275136253522, 0.7782450512235876, 1.001321364323131, 396.4753389951715],
+      [0.8910433359442418, 0.3103357814592619, -0.5807075544849798, 0.7057855884293825, 0.2388019956728835, 0.7764265002122339, 1.002266581537338, 345.479962660838],
+      [0.8789701966315052, 0.3275055332809348, -0.5514646633505704, 0.69266092973228, 0.2513023379988544, 0.8307112483915374, 1.002425828111919, 338.1641517723739],
+      [1.525255200133543, 0.2636106099260035, -1.261644590207539, 0.8865445659921086, 0.08681512652097743, 0.2352863499806732, 1.011712761233763, 152.4851052444758],
+      [0.8882249441693671, 0.3172865720399499, -0.5709383721294172, 0.7007791696166791, 0.2436218023822329, 0.7971447477653065, 1.002348321846302, 341.6852605085693],
+      [0.8910433359442418, 0.3103357814592619, -0.5807075544849798, 0.7057855884293825, 0.2388019956728835, 0.7764265002122339, 1.002266581537338, 345.479962660838],
+      [0.7441463041072498, 0.6964220918130122, -0.04772421229423762, 0.4379455818218148, 0.4968583433131759, 2.444006465749883, 1.009843132299588, 171.2013484835587],
+      [0.8882249441693671, 0.3172865720399499, -0.5709383721294172, 0.7007791696166791, 0.2436218023822329, 0.7971447477653065, 1.002348321846302, 341.6852605085693],
+      [0.8789701966315052, 0.3275055332809348, -0.5514646633505704, 0.69266092973228, 0.2513023379988544, 0.8307112483915374, 1.002425828111919, 338.1641517723739]
+      ]
+    }
+  },
+ "settings":{
+   "grid size":20,
+   "chains":5,
+   "chain-length":2000000,
+   "burn-in":1000000,
+   "samples":100,
+   "concentration":0.5,
+   "posterior":0.9
+  },
+ "grid":[
+  [0, 0, 0.003566485105868109],
+  [0, 0.07142857142857142, 0.002826400980852295],
+  [0, 0.1428571428571428, 0.002208975005805559],
+  [0, 0.2142857142857143, 0.002289838507721244],
+  [0, 0.2857142857142857, 0.001783646295561258],
+  [0, 0.3571428571428571, 0.001682428079291638],
+  [0, 0.4285714285714285, 0.002766714646882475],
+  [0, 0.5, 0.001348475614247424],
+  [0, 0.5714285714285714, 0.001624594474256382],
+  [0, 0.6428571428571428, 0.001773448880425334],
+  [0, 0.7142857142857142, 0.001350933590560411],
+  [0, 0.7857142857142857, 0.001611523238364097],
+  [0, 0.8571428571428571, 0.001532150955904425],
+  [0, 1, 0.001370389320470131],
+  [0, 1.226851851851852, 0.001452940651691179],
+  [0, 2.814814814814814, 0.001492384497161619],
+  [0, 7.124999999999997, 0.000911053111213648],
+  [0, 15.51851851851851, 0.0008204393311313389],
+  [0, 29.35648148148148, 0.0006172699429229924],
+  [0, 49.99999999999997, 7.492152685461611e-05],
+  [0.07142857142857142, 0, 0.002460458469557386],
+  [0.07142857142857142, 0.07142857142857142, 0.00262839253562382],
+  [0.07142857142857142, 0.1428571428571428, 0.002246646200247642],
+  [0.07142857142857142, 0.2142857142857143, 0.002301238589697125],
+  [0.07142857142857142, 0.2857142857142857, 0.001943017923948005],
+  [0.07142857142857142, 0.3571428571428571, 0.001985764372906819],
+  [0.07142857142857142, 0.4285714285714285, 0.001517102522432792],
+  [0.07142857142857142, 0.5, 0.001745180911894929],
+  [0.07142857142857142, 0.5714285714285714, 0.001472114404040637],
+  [0.07142857142857142, 0.6428571428571428, 0.001897354313855837],
+  [0.07142857142857142, 0.7142857142857142, 0.001837519839811746],
+  [0.07142857142857142, 0.7857142857142857, 0.001667733627124252],
+  [0.07142857142857142, 0.8571428571428571, 0.001560644090949045],
+  [0.07142857142857142, 1, 0.001615669649678702],
+  [0.07142857142857142, 1.226851851851852, 0.001320998501434628],
+  [0.07142857142857142, 2.814814814814814, 0.001518127913462953],
+  [0.07142857142857142, 7.124999999999997, 0.001071621827169525],
+  [0.07142857142857142, 15.51851851851851, 0.0007056647373996531],
+  [0.07142857142857142, 29.35648148148148, 0.0006206957308863899],
+  [0.07142857142857142, 49.99999999999997, 2.834027170181406e-12],
+  [0.1428571428571428, 0, 0.003199373678685308],
+  [0.1428571428571428, 0.07142857142857142, 0.003083640864170892],
+  [0.1428571428571428, 0.1428571428571428, 0.002550563317149404],
+  [0.1428571428571428, 0.2142857142857143, 0.003070071388649915],
+  [0.1428571428571428, 0.2857142857142857, 0.002540205111958184],
+  [0.1428571428571428, 0.3571428571428571, 0.001904128130031458],
+  [0.1428571428571428, 0.4285714285714285, 0.002122713269999842],
+  [0.1428571428571428, 0.5, 0.00174955337462884],
+  [0.1428571428571428, 0.5714285714285714, 0.001742898904399907],
+  [0.1428571428571428, 0.6428571428571428, 0.001632368869041386],
+  [0.1428571428571428, 0.7142857142857142, 0.00167606910365811],
+  [0.1428571428571428, 0.7857142857142857, 0.001390780044626511],
+  [0.1428571428571428, 0.8571428571428571, 0.001502992472117009],
+  [0.1428571428571428, 1, 0.001744661755533303],
+  [0.1428571428571428, 1.226851851851852, 0.001715924371474862],
+  [0.1428571428571428, 2.814814814814814, 0.001096443518974232],
+  [0.1428571428571428, 7.124999999999997, 0.001011341949531368],
+  [0.1428571428571428, 15.51851851851851, 0.000596919106645181],
+  [0.1428571428571428, 29.35648148148148, 0.0005986777735393406],
+  [0.1428571428571428, 49.99999999999997, 5.394909713193237e-12],
+  [0.2142857142857143, 0, 0.003796797473995552],
+  [0.2142857142857143, 0.07142857142857142, 0.003433539578794974],
+  [0.2142857142857143, 0.1428571428571428, 0.00301939869903142],
+  [0.2142857142857143, 0.2142857142857143, 0.002187359854626631],
+  [0.2142857142857143, 0.2857142857142857, 0.002715365058624243],
+  [0.2142857142857143, 0.3571428571428571, 0.002372334802668396],
+  [0.2142857142857143, 0.4285714285714285, 0.002153488888048853],
+  [0.2142857142857143, 0.5, 0.001965723666608315],
+  [0.2142857142857143, 0.5714285714285714, 0.002192909876050419],
+  [0.2142857142857143, 0.6428571428571428, 0.00235025256331522],
+  [0.2142857142857143, 0.7142857142857142, 0.001749179128168067],
+  [0.2142857142857143, 0.7857142857142857, 0.001426008538060742],
+  [0.2142857142857143, 0.8571428571428571, 0.001818456704505477],
+  [0.2142857142857143, 1, 0.001674195986678133],
+  [0.2142857142857143, 1.226851851851852, 0.001727822131412832],
+  [0.2142857142857143, 2.814814814814814, 0.001634427072141269],
+  [0.2142857142857143, 7.124999999999997, 0.00125352126450876],
+  [0.2142857142857143, 15.51851851851851, 0.0005759273354706306],
+  [0.2142857142857143, 29.35648148148148, 0.0006159248597468593],
+  [0.2142857142857143, 49.99999999999997, 1.534567413897764e-05],
+  [0.2857142857142857, 0, 0.003671527830301379],
+  [0.2857142857142857, 0.07142857142857142, 0.002679378264525472],
+  [0.2857142857142857, 0.1428571428571428, 0.003016134447030957],
+  [0.2857142857142857, 0.2142857142857143, 0.00310306847311674],
+  [0.2857142857142857, 0.2857142857142857, 0.001826431868541163],
+  [0.2857142857142857, 0.3571428571428571, 0.002351495885884325],
+  [0.2857142857142857, 0.4285714285714285, 0.002227158317147043],
+  [0.2857142857142857, 0.5, 0.002234907321847176],
+  [0.2857142857142857, 0.5714285714285714, 0.002007583403665229],
+  [0.2857142857142857, 0.6428571428571428, 0.001945909001979804],
+  [0.2857142857142857, 0.7142857142857142, 0.001625471903098237],
+  [0.2857142857142857, 0.7857142857142857, 0.001666739480232462],
+  [0.2857142857142857, 0.8571428571428571, 0.002479904186938647],
+  [0.2857142857142857, 1, 0.002280938421655963],
+  [0.2857142857142857, 1.226851851851852, 0.002058496502887372],
+  [0.2857142857142857, 2.814814814814814, 0.001503579886306614],
+  [0.2857142857142857, 7.124999999999997, 0.0009144292946391937],
+  [0.2857142857142857, 15.51851851851851, 0.0006566114215945892],
+  [0.2857142857142857, 29.35648148148148, 0.0008803807370328192],
+  [0.2857142857142857, 49.99999999999997, 0.0001702530484939889],
+  [0.3571428571428571, 0, 0.004118199494559098],
+  [0.3571428571428571, 0.07142857142857142, 0.004151229886670712],
+  [0.3571428571428571, 0.1428571428571428, 0.003674043425014049],
+  [0.3571428571428571, 0.2142857142857143, 0.002683032458724193],
+  [0.3571428571428571, 0.2857142857142857, 0.002785827354168251],
+  [0.3571428571428571, 0.3571428571428571, 0.002159872728561493],
+  [0.3571428571428571, 0.4285714285714285, 0.002394272533350332],
+  [0.3571428571428571, 0.5, 0.002518245064642241],
+  [0.3571428571428571, 0.5714285714285714, 0.002094544785686356],
+  [0.3571428571428571, 0.6428571428571428, 0.002537889368802281],
+  [0.3571428571428571, 0.7142857142857142, 0.002229022400396113],
+  [0.3571428571428571, 0.7857142857142857, 0.00234596756199876],
+  [0.3571428571428571, 0.8571428571428571, 0.001818266937123089],
+  [0.3571428571428571, 1, 0.002169977995308523],
+  [0.3571428571428571, 1.226851851851852, 0.002221740898729235],
+  [0.3571428571428571, 2.814814814814814, 0.001827342908496349],
+  [0.3571428571428571, 7.124999999999997, 0.001084085913565364],
+  [0.3571428571428571, 15.51851851851851, 0.0007621074138405115],
+  [0.3571428571428571, 29.35648148148148, 0.0005906789240157908],
+  [0.3571428571428571, 49.99999999999997, 1.319060493947554e-11],
+  [0.4285714285714285, 0, 0.004377629604482557],
+  [0.4285714285714285, 0.07142857142857142, 0.003727730225676119],
+  [0.4285714285714285, 0.1428571428571428, 0.002804412221528817],
+  [0.4285714285714285, 0.2142857142857143, 0.002906405086520727],
+  [0.4285714285714285, 0.2857142857142857, 0.003528577225566362],
+  [0.4285714285714285, 0.3571428571428571, 0.003144800763981022],
+  [0.4285714285714285, 0.4285714285714285, 0.002331942279731347],
+  [0.4285714285714285, 0.5, 0.002790055765644821],
+  [0.4285714285714285, 0.5714285714285714, 0.002333947914938426],
+  [0.4285714285714285, 0.6428571428571428, 0.002179969541563648],
+  [0.4285714285714285, 0.7142857142857142, 0.001959126229259504],
+  [0.4285714285714285, 0.7857142857142857, 0.001821142356372389],
+  [0.4285714285714285, 0.8571428571428571, 0.001837143827628365],
+  [0.4285714285714285, 1, 0.002025959874000692],
+  [0.4285714285714285, 1.226851851851852, 0.001710022654364109],
+  [0.4285714285714285, 2.814814814814814, 0.00162354787914332],
+  [0.4285714285714285, 7.124999999999997, 0.000910183983527698],
+  [0.4285714285714285, 15.51851851851851, 0.0007118207583761478],
+  [0.4285714285714285, 29.35648148148148, 0.0006549760717555229],
+  [0.4285714285714285, 49.99999999999997, 0.0001341122792574428],
+  [0.5, 0, 0.004955538135638055],
+  [0.5, 0.07142857142857142, 0.002924178070872752],
+  [0.5, 0.1428571428571428, 0.003147273306496483],
+  [0.5, 0.2142857142857143, 0.002911531640439218],
+  [0.5, 0.2857142857142857, 0.003325303396919567],
+  [0.5, 0.3571428571428571, 0.0029056584857205],
+  [0.5, 0.4285714285714285, 0.002177842263620834],
+  [0.5, 0.5, 0.002663555391828788],
+  [0.5, 0.5714285714285714, 0.002065133900386383],
+  [0.5, 0.6428571428571428, 0.002248047348982078],
+  [0.5, 0.7142857142857142, 0.001733960673905844],
+  [0.5, 0.7857142857142857, 0.002294226326882008],
+  [0.5, 0.8571428571428571, 0.001674899245602686],
+  [0.5, 1, 0.002207709550312046],
+  [0.5, 1.226851851851852, 0.002008840722389587],
+  [0.5, 2.814814814814814, 0.001988815883082963],
+  [0.5, 7.124999999999997, 0.000920622247457354],
+  [0.5, 15.51851851851851, 0.000885154644084932],
+  [0.5, 29.35648148148148, 0.0005876770579685993],
+  [0.5, 49.99999999999997, 0.0004038677581444775],
+  [0.5714285714285714, 0, 0.004790929312101004],
+  [0.5714285714285714, 0.07142857142857142, 0.00462260586482703],
+  [0.5714285714285714, 0.1428571428571428, 0.003603829892718844],
+  [0.5714285714285714, 0.2142857142857143, 0.003511622621253757],
+  [0.5714285714285714, 0.2857142857142857, 0.002672617611336282],
+  [0.5714285714285714, 0.3571428571428571, 0.003071826477012179],
+  [0.5714285714285714, 0.4285714285714285, 0.003480256946505197],
+  [0.5714285714285714, 0.5, 0.002753792675331192],
+  [0.5714285714285714, 0.5714285714285714, 0.004280449767751163],
+  [0.5714285714285714, 0.6428571428571428, 0.002203272232350238],
+  [0.5714285714285714, 0.7142857142857142, 0.001600910968683837],
+  [0.5714285714285714, 0.7857142857142857, 0.002047560928751004],
+  [0.5714285714285714, 0.8571428571428571, 0.002161357037185646],
+  [0.5714285714285714, 1, 0.001774659435132773],
+  [0.5714285714285714, 1.226851851851852, 0.001802524119650845],
+  [0.5714285714285714, 2.814814814814814, 0.002312328014197016],
+  [0.5714285714285714, 7.124999999999997, 0.000959895409307253],
+  [0.5714285714285714, 15.51851851851851, 0.0006169988395988917],
+  [0.5714285714285714, 29.35648148148148, 0.0005296745836157754],
+  [0.5714285714285714, 49.99999999999997, 0.0004273732301919077],
+  [0.6428571428571428, 0, 0.003848889759341566],
+  [0.6428571428571428, 0.07142857142857142, 0.005263992662143216],
+  [0.6428571428571428, 0.1428571428571428, 0.003374439600405826],
+  [0.6428571428571428, 0.2142857142857143, 0.003525113051095404],
+  [0.6428571428571428, 0.2857142857142857, 0.00331074395992592],
+  [0.6428571428571428, 0.3571428571428571, 0.002847947348419937],
+  [0.6428571428571428, 0.4285714285714285, 0.002533924956667675],
+  [0.6428571428571428, 0.5, 0.003145327775958633],
+  [0.6428571428571428, 0.5714285714285714, 0.002170663467695599],
+  [0.6428571428571428, 0.6428571428571428, 0.002509692174109326],
+  [0.6428571428571428, 0.7142857142857142, 0.001850299264964193],
+  [0.6428571428571428, 0.7857142857142857, 0.002299156727927514],
+  [0.6428571428571428, 0.8571428571428571, 0.002402209983461819],
+  [0.6428571428571428, 1, 0.001998392492360502],
+  [0.6428571428571428, 1.226851851851852, 0.00282974736474546],
+  [0.6428571428571428, 2.814814814814814, 0.002294136532075434],
+  [0.6428571428571428, 7.124999999999997, 0.001135418233892558],
+  [0.6428571428571428, 15.51851851851851, 0.000733887069162004],
+  [0.6428571428571428, 29.35648148148148, 0.0006570587906052773],
+  [0.6428571428571428, 49.99999999999997, 0.0001455635578299942],
+  [0.7142857142857142, 0, 0.005281032499200192],
+  [0.7142857142857142, 0.07142857142857142, 0.002998631373914088],
+  [0.7142857142857142, 0.1428571428571428, 0.003890892428949155],
+  [0.7142857142857142, 0.2142857142857143, 0.003968478051307647],
+  [0.7142857142857142, 0.2857142857142857, 0.003452557568942735],
+  [0.7142857142857142, 0.3571428571428571, 0.002976539852448634],
+  [0.7142857142857142, 0.4285714285714285, 0.002782306568899104],
+  [0.7142857142857142, 0.5, 0.002343030804265045],
+  [0.7142857142857142, 0.5714285714285714, 0.002662932757366384],
+  [0.7142857142857142, 0.6428571428571428, 0.002372251015769065],
+  [0.7142857142857142, 0.7142857142857142, 0.002422655236227494],
+  [0.7142857142857142, 0.7857142857142857, 0.002540244852742098],
+  [0.7142857142857142, 0.8571428571428571, 0.002608550629555038],
+  [0.7142857142857142, 1, 0.001860280439381926],
+  [0.7142857142857142, 1.226851851851852, 0.002152567383887691],
+  [0.7142857142857142, 2.814814814814814, 0.001600405845247067],
+  [0.7142857142857142, 7.124999999999997, 0.0009888296769279608],
+  [0.7142857142857142, 15.51851851851851, 0.0007623595956351668],
+  [0.7142857142857142, 29.35648148148148, 0.0005744347348384921],
+  [0.7142857142857142, 49.99999999999997, 2.570444039427348e-11],
+  [0.7857142857142857, 0, 0.005185186965274221],
+  [0.7857142857142857, 0.07142857142857142, 0.004834076738514053],
+  [0.7857142857142857, 0.1428571428571428, 0.003929676322252884],
+  [0.7857142857142857, 0.2142857142857143, 0.003069784000348836],
+  [0.7857142857142857, 0.2857142857142857, 0.003625717465153146],
+  [0.7857142857142857, 0.3571428571428571, 0.002713188311368018],
+  [0.7857142857142857, 0.4285714285714285, 0.003172397669557559],
+  [0.7857142857142857, 0.5, 0.002545876123079843],
+  [0.7857142857142857, 0.5714285714285714, 0.002989406803733328],
+  [0.7857142857142857, 0.6428571428571428, 0.002781927384312028],
+  [0.7857142857142857, 0.7142857142857142, 0.00304272959446627],
+  [0.7857142857142857, 0.7857142857142857, 0.001939940670678482],
+  [0.7857142857142857, 0.8571428571428571, 0.002521015509439848],
+  [0.7857142857142857, 1, 0.002532995606127067],
+  [0.7857142857142857, 1.226851851851852, 0.002600073525154905],
+  [0.7857142857142857, 2.814814814814814, 0.001891335130397677],
+  [0.7857142857142857, 7.124999999999997, 0.001058126376238864],
+  [0.7857142857142857, 15.51851851851851, 0.0007000315590681962],
+  [0.7857142857142857, 29.35648148148148, 0.0008777810472400403],
+  [0.7857142857142857, 49.99999999999997, 0.0002126709629464618],
+  [0.8571428571428571, 0, 0.006143423338138224],
+  [0.8571428571428571, 0.07142857142857142, 0.00670187700279457],
+  [0.8571428571428571, 0.1428571428571428, 0.005030811804073232],
+  [0.8571428571428571, 0.2142857142857143, 0.003313264360380082],
+  [0.8571428571428571, 0.2857142857142857, 0.002916791956246419],
+  [0.8571428571428571, 0.3571428571428571, 0.002818662523207853],
+  [0.8571428571428571, 0.4285714285714285, 0.002534106240588181],
+  [0.8571428571428571, 0.5, 0.002381655629268263],
+  [0.8571428571428571, 0.5714285714285714, 0.00328769339080697],
+  [0.8571428571428571, 0.6428571428571428, 0.003945358065690954],
+  [0.8571428571428571, 0.7142857142857142, 0.003015620879562573],
+  [0.8571428571428571, 0.7857142857142857, 0.003298819368713533],
+  [0.8571428571428571, 0.8571428571428571, 0.002537380440763714],
+  [0.8571428571428571, 1, 0.001899585721869981],
+  [0.8571428571428571, 1.226851851851852, 0.003380666575548595],
+  [0.8571428571428571, 2.814814814814814, 0.002285328627911579],
+  [0.8571428571428571, 7.124999999999997, 0.001108411570936609],
+  [0.8571428571428571, 15.51851851851851, 0.0006689371641030385],
+  [0.8571428571428571, 29.35648148148148, 0.0007415798913210063],
+  [0.8571428571428571, 49.99999999999997, 0.0002175517838603884],
+  [1, 0, 0.00765806010035156],
+  [1, 0.07142857142857142, 0.007807457503843863],
+  [1, 0.1428571428571428, 0.004159725948417481],
+  [1, 0.2142857142857143, 0.003399148709293635],
+  [1, 0.2857142857142857, 0.004525235637734775],
+  [1, 0.3571428571428571, 0.003780851582847601],
+  [1, 0.4285714285714285, 0.004569693279325371],
+  [1, 0.5, 0.003857970129706884],
+  [1, 0.5714285714285714, 0.002933804772153088],
+  [1, 0.6428571428571428, 0.00303406089332697],
+  [1, 0.7142857142857142, 0.003114683839386268],
+  [1, 0.7857142857142857, 0.002429051754108082],
+  [1, 0.8571428571428571, 0.002268772043297931],
+  [1, 1, 0.002398083082148811],
+  [1, 1.226851851851852, 0.003035322698040208],
+  [1, 2.814814814814814, 0.003263060834764834],
+  [1, 7.124999999999997, 0.001231893732383622],
+  [1, 15.51851851851851, 0.0006343468731492734],
+  [1, 29.35648148148148, 0.0005628071276917429],
+  [1, 49.99999999999997, 0.0003375241235138881],
+  [1.226851851851852, 0, 0.005486093955090999],
+  [1.226851851851852, 0.07142857142857142, 0.009610940238548873],
+  [1.226851851851852, 0.1428571428571428, 0.005675448572148123],
+  [1.226851851851852, 0.2142857142857143, 0.006088386992338565],
+  [1.226851851851852, 0.2857142857142857, 0.004794302244730719],
+  [1.226851851851852, 0.3571428571428571, 0.004786336767940444],
+  [1.226851851851852, 0.4285714285714285, 0.003666024296536285],
+  [1.226851851851852, 0.5, 0.003737461270631796],
+  [1.226851851851852, 0.5714285714285714, 0.003182641251622425],
+  [1.226851851851852, 0.6428571428571428, 0.003141728458929417],
+  [1.226851851851852, 0.7142857142857142, 0.004095750239857854],
+  [1.226851851851852, 0.7857142857142857, 0.004026403158879832],
+  [1.226851851851852, 0.8571428571428571, 0.003778994964563776],
+  [1.226851851851852, 1, 0.003381423623646984],
+  [1.226851851851852, 1.226851851851852, 0.003554908137809505],
+  [1.226851851851852, 2.814814814814814, 0.003705378803974616],
+  [1.226851851851852, 7.124999999999997, 0.001107422604820455],
+  [1.226851851851852, 15.51851851851851, 0.0005915336097180631],
+  [1.226851851851852, 29.35648148148148, 0.0007027622148077111],
+  [1.226851851851852, 49.99999999999997, 7.898492615571901e-05],
+  [2.814814814814814, 0, 0.07470839861493363],
+  [2.814814814814814, 0.07142857142857142, 0.03629888527244875],
+  [2.814814814814814, 0.1428571428571428, 0.01042100873655743],
+  [2.814814814814814, 0.2142857142857143, 0.007201266334133851],
+  [2.814814814814814, 0.2857142857142857, 0.007271649971854223],
+  [2.814814814814814, 0.3571428571428571, 0.01307015620578551],
+  [2.814814814814814, 0.4285714285714285, 0.007460981919634715],
+  [2.814814814814814, 0.5, 0.008137207651782106],
+  [2.814814814814814, 0.5714285714285714, 0.006957570691579626],
+  [2.814814814814814, 0.6428571428571428, 0.004633754901357615],
+  [2.814814814814814, 0.7142857142857142, 0.006850686281752066],
+  [2.814814814814814, 0.7857142857142857, 0.007798865860822833],
+  [2.814814814814814, 0.8571428571428571, 0.005610725548643745],
+  [2.814814814814814, 1, 0.003256861800651695],
+  [2.814814814814814, 1.226851851851852, 0.005558217734956425],
+  [2.814814814814814, 2.814814814814814, 0.006897113354127229],
+  [2.814814814814814, 7.124999999999997, 0.00175029290499021],
+  [2.814814814814814, 15.51851851851851, 0.0007145857148101797],
+  [2.814814814814814, 29.35648148148148, 0.000900294594835348],
+  [2.814814814814814, 49.99999999999997, 0.0002720137221748741],
+  [7.124999999999997, 0, 0.00398417470554285],
+  [7.124999999999997, 0.07142857142857142, 0.002439413316640502],
+  [7.124999999999997, 0.1428571428571428, 0.00238415904086006],
+  [7.124999999999997, 0.2142857142857143, 0.002252829226358759],
+  [7.124999999999997, 0.2857142857142857, 0.001970530740482054],
+  [7.124999999999997, 0.3571428571428571, 0.002222741239949268],
+  [7.124999999999997, 0.4285714285714285, 0.001744210540259185],
+  [7.124999999999997, 0.5, 0.001993900770440676],
+  [7.124999999999997, 0.5714285714285714, 0.001764470862569359],
+  [7.124999999999997, 0.6428571428571428, 0.001705485823955997],
+  [7.124999999999997, 0.7142857142857142, 0.00191068869828945],
+  [7.124999999999997, 0.7857142857142857, 0.002435886622212691],
+  [7.124999999999997, 0.8571428571428571, 0.00172518884404653],
+  [7.124999999999997, 1, 0.002130831950329923],
+  [7.124999999999997, 1.226851851851852, 0.001834645818520661],
+  [7.124999999999997, 2.814814814814814, 0.002566227575409709],
+  [7.124999999999997, 7.124999999999997, 0.0017531864641651],
+  [7.124999999999997, 15.51851851851851, 0.0008489943724799491],
+  [7.124999999999997, 29.35648148148148, 0.0005978977445014268],
+  [7.124999999999997, 49.99999999999997, 6.300310911994327e-05],
+  [15.51851851851851, 0, 0.000953496201063784],
+  [15.51851851851851, 0.07142857142857142, 0.00106058286991154],
+  [15.51851851851851, 0.1428571428571428, 0.001005752149637742],
+  [15.51851851851851, 0.2142857142857143, 0.0006455641728210646],
+  [15.51851851851851, 0.2857142857142857, 0.0008751928354308413],
+  [15.51851851851851, 0.3571428571428571, 0.0008193578822576485],
+  [15.51851851851851, 0.4285714285714285, 0.0007796859096090168],
+  [15.51851851851851, 0.5, 0.0009747867573569269],
+  [15.51851851851851, 0.5714285714285714, 0.0007094395907142635],
+  [15.51851851851851, 0.6428571428571428, 0.0008424416905178129],
+  [15.51851851851851, 0.7142857142857142, 0.0007178246294540181],
+  [15.51851851851851, 0.7857142857142857, 0.0009301935919149497],
+  [15.51851851851851, 0.8571428571428571, 0.0005277994710603308],
+  [15.51851851851851, 1, 0.0006225448092072107],
+  [15.51851851851851, 1.226851851851852, 0.0007916286357155097],
+  [15.51851851851851, 2.814814814814814, 0.0009983292869775982],
+  [15.51851851851851, 7.124999999999997, 0.0007962185687239956],
+  [15.51851851851851, 15.51851851851851, 0.000505660706469485],
+  [15.51851851851851, 29.35648148148148, 0.0006014094573757414],
+  [15.51851851851851, 49.99999999999997, 1.146153717420187e-12],
+  [29.35648148148148, 0, 0.000730263611243498],
+  [29.35648148148148, 0.07142857142857142, 0.0005785791605808555],
+  [29.35648148148148, 0.1428571428571428, 0.0005721264349885725],
+  [29.35648148148148, 0.2142857142857143, 0.0005699724719162318],
+  [29.35648148148148, 0.2857142857142857, 0.0009090795788675955],
+  [29.35648148148148, 0.3571428571428571, 0.0005748822518164995],
+  [29.35648148148148, 0.4285714285714285, 0.0006198121254602603],
+  [29.35648148148148, 0.5, 0.000693896104581783],
+  [29.35648148148148, 0.5714285714285714, 0.0008289477822111757],
+  [29.35648148148148, 0.6428571428571428, 0.0006539207561656256],
+  [29.35648148148148, 0.7142857142857142, 0.0008837467855461176],
+  [29.35648148148148, 0.7857142857142857, 0.0007060147882856993],
+  [29.35648148148148, 0.8571428571428571, 0.0006641638869036757],
+  [29.35648148148148, 1, 0.0005722511029581886],
+  [29.35648148148148, 1.226851851851852, 0.0007172634236766243],
+  [29.35648148148148, 2.814814814814814, 0.0006248044974519586],
+  [29.35648148148148, 7.124999999999997, 0.0006326357864134605],
+  [29.35648148148148, 15.51851851851851, 0.0006359769193741896],
+  [29.35648148148148, 29.35648148148148, 0.0003993430391488372],
+  [29.35648148148148, 49.99999999999997, 4.823664865156492e-15],
+  [49.99999999999997, 0, 0.0006508525986467596],
+  [49.99999999999997, 0.07142857142857142, 0.0006165121778205312],
+  [49.99999999999997, 0.1428571428571428, 0.000610809109953181],
+  [49.99999999999997, 0.2142857142857143, 0.0005632680159270425],
+  [49.99999999999997, 0.2857142857142857, 0.0006660165786033839],
+  [49.99999999999997, 0.3571428571428571, 0.0006860563369544599],
+  [49.99999999999997, 0.4285714285714285, 0.0005009311302318973],
+  [49.99999999999997, 0.5, 0.0007478231977906841],
+  [49.99999999999997, 0.5714285714285714, 0.0005605236092755399],
+  [49.99999999999997, 0.6428571428571428, 0.000582374587267548],
+  [49.99999999999997, 0.7142857142857142, 0.0007538329956925178],
+  [49.99999999999997, 0.7857142857142857, 0.0005467902239469845],
+  [49.99999999999997, 0.8571428571428571, 0.0006106927854378733],
+  [49.99999999999997, 1, 0.0005650721240346655],
+  [49.99999999999997, 1.226851851851852, 0.0005648317033213288],
+  [49.99999999999997, 2.814814814814814, 0.0007262156150858342],
+  [49.99999999999997, 7.124999999999997, 0.0007359582247152655],
+  [49.99999999999997, 15.51851851851851, 0.0006385135639375781],
+  [49.99999999999997, 29.35648148148148, 2.395678478912494e-05],
+  [49.99999999999997, 49.99999999999997, 1.495694059053581e-15]
+  ],
+ "posterior":{
+   "0":{
+     "0":[
+      [0.006426034467615121, 0.004560507536317351, 0.003191967326466343, 0.002963276642400284, 0.002067222731853282, 0.001746375902851619, 0.002572170664688243, 0.001122856378488624, 0.001211667078544555, 0.001184747400606319, 0.0008083908400332366, 0.0008638051681039865, 0.0007356719242330692, 0.0005280415550863325, 0.0003948425215601896, 3.546629435146883e-05, 3.110079373412924e-08, 1.097696220690003e-13, 2.434074799923429e-22, 4.089882946168103e-35, 0.004433213783928813, 0.004241013221912346, 0.003246402135902347, 0.00297802938915201, 0.002251932254033792, 0.002061241621578459, 0.001410425963060444, 0.001453186992511445, 0.00109794304684484, 0.001267521750474189, 0.001099560895178063, 0.0008939346038227414, 0.0007493527488791782, 0.0006225531565780205, 0.000358986378613912, 3.60779081092926e-05, 3.658100980189566e-08, 9.439951983501362e-14, 2.446388910523995e-22, 1.545257996763269e-42, 0.005764579109046383, 0.004975574028278816, 0.003685562104870066, 0.003972974645026914, 0.00294406421642659, 0.001976502301010314, 0.001973452375089065, 0.0014568276592479, 0.001299901251335465, 0.001090498761562692, 0.001002949429749933, 0.0007454823262843625, 0.0007216706527762604, 0.0006722562534013445, 0.0004663085638735828, 2.605656404613056e-05, 3.452220578784581e-08, 7.984037910505568e-14, 2.358457388990187e-22, 2.938152493751929e-42, 0.006841007521468594, 0.005540149146209828, 0.004363028830951504, 0.002830658933120726, 0.003147072129228987, 0.002462504892260087, 0.002002063750279566, 0.00163682927172368, 0.001635531311078393, 0.001570078257919753, 0.001046697695644453, 0.0007643651272192714, 0.0008731422669099275, 0.0006451038645001129, 0.000469541394616606, 3.884135133160136e-05, 4.278766749503987e-08, 7.702125865547206e-14, 2.425219198200249e-22, 8.347755385457291e-36, 0.006615298728573275, 0.00432328063166103, 0.004358311935784346, 0.004015675899067248, 0.002116810234672671, 0.002440873721462304, 0.002070552796565561, 0.001860974273744077, 0.001497309536425876, 0.001299957588439082, 0.0009726717774126373, 0.0008934007238913586, 0.00119073948677698, 0.0008788942950559243, 0.0005594027424919863, 3.573166021004064e-05, 3.12121326018919e-08, 8.779852700083871e-14, 3.464833478906492e-22, 9.250658736075909e-35, 0.007420104419617497, 0.006698170224500686, 0.00530898983340676, 0.003472107875439255, 0.003228736679115986, 0.002241967001512212, 0.00222591591426561, 0.002096905106167183, 0.001562167359847731, 0.001695427545103641, 0.001333832045520447, 0.001257478065963192, 0.0008730503749393129, 0.0008361383680306237, 0.0006037643590229359, 4.342548189608326e-05, 3.700184970856239e-08, 1.018898514733231e-13, 2.32355035233543e-22, 7.158745530967592e-42, 0.007887541343877284, 0.006014837098358613, 0.004052373384875916, 0.003761173920606916, 0.004089573654877483, 0.00326433076614088, 0.00216796826017049, 0.002323237473621987, 0.001740720256275817, 0.001456320174754084, 0.001172327627901923, 0.0009761625667136071, 0.0008821138221677433, 0.0007806446725121096, 0.0004647030598975881, 3.858225470462223e-05, 3.106528613423771e-08, 9.515276339660903e-14, 2.575224116551198e-22, 7.270020442556966e-35, 0.008928807472880261, 0.004718274559667193, 0.004547807318842635, 0.003767808081615995, 0.003853981826411237, 0.003016098753626668, 0.002024703794555032, 0.002217902181842965, 0.001540231332479761, 0.001501798916171562, 0.001037589793694743, 0.001229742979908171, 0.0008042109168842943, 0.0008506761082258062, 0.0005459071440158673, 4.726231535590613e-05, 3.142057187800038e-08, 1.183057874822571e-13, 2.309497637975171e-22, 2.186762293510258e-34, 0.008632217989867352, 0.007458753556089351, 0.005207531143804732, 0.004544384661380441, 0.003097527644728138, 0.003188582328458024, 0.003235536745247901, 0.002293041055383599, 0.003192471711365726, 0.001471886715797819, 0.0009579734982623819, 0.001097525869379155, 0.001037785503508269, 0.0006838125392645343, 0.0004898396827884081, 5.495000901000496e-05, 3.275993258223698e-08, 8.245316585933939e-14, 2.080545958555861e-22, 2.311348540059672e-34, 0.006934866548267711, 0.008493655962957286, 0.004876062306090649, 0.004561842477556467, 0.003837107259851429, 0.002956193639764016, 0.002355747443578982, 0.00261906595465976, 0.001618937432912989, 0.001676588849018971, 0.001107205304794649, 0.001232384841948927, 0.00115343164248203, 0.0007700209946989275, 0.0007689890422675949, 5.451744616648913e-05, 3.874908295438488e-08, 9.805922156550059e-14, 2.579657263842274e-22, 7.863338010909279e-35, 0.009515277887637712, 0.004838407803128957, 0.005622336128398313, 0.005135600188225148, 0.004001467110234649, 0.003089673520014614, 0.002586663369466964, 0.001951005341483007, 0.001986084320861662, 0.00158477149360243, 0.001449698413501138, 0.001361611435394262, 0.001252506455266518, 0.0007168032005648406, 0.000584963609960279, 3.803157308437341e-05, 3.37453200153523e-08, 1.018486699432806e-13, 2.254178356928225e-22, 1.386944299319262e-41, 0.009342584973944652, 0.007799969927883758, 0.005678378750836972, 0.003972601751566312, 0.004202156862135171, 0.002816312180235251, 0.002949324145593176, 0.002119911169390918, 0.002229576697043581, 0.001858453467235322, 0.001820745623368049, 0.001039838510682977, 0.001210475569688351, 0.0009760132022908765, 0.0007065734771563689, 4.494491565954568e-05, 3.610905380447877e-08, 9.350814960513956e-14, 3.442895098593019e-22, 1.146188570080246e-34, 0.01106911958080873, 0.01081373791746134, 0.007269518443104041, 0.004287689114085886, 0.00338052174639666, 0.002925795072287852, 0.002355915204050762, 0.001983167040310068, 0.002452046048554391, 0.002635677194989013, 0.001804523429442536, 0.001768218071911969, 0.001218332720446627, 0.0007319474334865001, 0.0009186998592193062, 5.430735641734291e-05, 3.782388571567347e-08, 8.934157170675528e-14, 2.90727255225969e-22, 1.17113769247495e-34, 0.01379816729893477, 0.01259763476714885, 0.006010800034489832, 0.004398831646240398, 0.005244685333161758, 0.003924554698212956, 0.004248364707071382, 0.003212469858291855, 0.002188105988091783, 0.002026888567815304, 0.001863800777083478, 0.001302008252432589, 0.001089358436006331, 0.0009240270853637233, 0.000824850794267616, 7.754093339235021e-05, 4.203503648528608e-08, 8.469701589450445e-14, 2.204288461909291e-22, 1.812784875497821e-34, 0.009884754261271106, 0.01550762379048047, 0.008201017466888059, 0.007878968926386305, 0.005556528942410102, 0.004968255303148024, 0.003408238120696366, 0.003112122594075742, 0.002373693079146564, 0.002098813684123341, 0.00245086034656142, 0.002158210095243851, 0.001814494467332162, 0.001302924457056552, 0.0009660456975071174, 8.805051430262121e-05, 3.778408909020336e-08, 7.894409997593099e-14, 2.74823337599891e-22, 4.226638004021697e-35, 0.1346083693802609, 0.05856965140384631, 0.01505834312002356, 0.009319138190452504, 0.008427731186410487, 0.0135669026346733, 0.006936326666076496, 0.006775697019601237, 0.005189107321379611, 0.003095536693047497, 0.004099362142304505, 0.004180270731418113, 0.0026939789037414, 0.00125491209262334, 0.001510414982745818, 0.0001638782365839243, 5.967769932576327e-08, 9.506176269846615e-14, 3.483702020790349e-22, 1.419140777564252e-34, 0.007178620749233959, 0.003936086792921567, 0.00344510411567702, 0.002915375332655878, 0.002283808697418226, 0.002307209122989766, 0.001621547790858392, 0.001660268920902802, 0.001315966111127895, 0.001139317900330562, 0.001143311622700469, 0.00130563241511752, 0.0008283253761335928, 0.0008210099297669397, 0.0004985293347250326, 6.095806613066411e-05, 5.967120306146078e-08, 1.120067091058434e-13, 2.250642377225561e-22, 3.075396077949179e-35, 0.001717993842928035, 0.001711290544575616, 0.001453307663754103, 0.0008354191385412049, 0.001014327318894091, 0.0008504883026599221, 0.0007248459469459088, 0.0008116671298884502, 0.0005290991519614138, 0.0005627633523731489, 0.0004295162900782091, 0.0004985640713840502, 0.000253404292893394, 0.0002398521017244705, 0.0002150900674001791, 2.370281230158311e-05, 2.701516562966513e-08, 6.572889279129095e-14, 2.154518998390901e-22, 4.958978919896167e-43, 0.001315777017707065, 0.0009335589326843591, 0.0008267188612167447, 0.0007375936408111572, 0.001053593825612265, 0.0005967175849385413, 0.0005762079172669237, 0.0005777679217087441, 0.0006182107987123185, 0.0004368130394393137, 0.0005287738964579589, 0.0003783888108629661, 0.0003188546239125088, 0.0002204560497006972, 0.0001948592392898964, 1.482418183041815e-05, 2.13691783113808e-08, 8.093393224890923e-14, 1.331990140455025e-22, 1.748883864498203e-45, 0.001172695555453027, 0.0009947647280116002, 0.0008826131686187528, 0.0007289139665439004, 0.0007718850255958383, 0.0007121047324923186, 0.0004656812559167707, 0.0006226535221367299, 0.0004180116156417333, 0.000389003878989647, 0.0004510180209437442, 0.0002930332466250524, 0.000293161222468172, 0.0002176673721048936, 0.0001534236064018157, 1.721574602783699e-05, 2.472371916120738e-08, 7.917215323789291e-14, 7.313322904035405e-24, 4.336892806610163e-46]
+      ],
+     "1":[
+      [0, 1.532386012271214e-10, 8.89501054465857e-10, 2.889188153601208e-09, 4.952764741318089e-09, 8.471641051244828e-09, 2.235174504952994e-08, 1.606249756304011e-08, 2.682153237023087e-08, 3.870953063258998e-08, 3.755943101388633e-08, 5.537620452387882e-08, 6.347280024007569e-08, 7.774434398926485e-08, 1.203440778598703e-07, 2.902378514550234e-07, 3.575038845426512e-08, 8.272161578078569e-11, 9.472838136660212e-16, 9.06729034630404e-24, 0, 0.0001578639969566988, 0.0002505395957000646, 0.000357375206814003, 0.0003735245444259046, 0.0004430287384061818, 0.0003771057877968427, 0.0004699042273913144, 0.0004206174160046177, 0.000566294700783885, 0.000565835819211484, 0.000524560546423322, 0.0004972676717712069, 0.0005179363916847244, 0.0004107598344173646, 0.0002106420772957225, 4.707563037487989e-06, 1.726620308490907e-09, 7.078412589222725e-15, 1.086630030871516e-30, 0, 0.0003561197415880944, 0.0005469109462581436, 0.0009167462038570553, 0.0009389612625938745, 0.0008168366318297478, 0.001014547484355883, 0.0009057876944488922, 0.000957514538804212, 0.0009367779189907409, 0.0009923640375750079, 0.000841093202447627, 0.0009207793146365484, 0.00107531990555881, 0.001025811803294857, 0.000292327523265389, 8.505945002008941e-06, 2.752718190067744e-09, 1.227832821563203e-14, 3.373828189911146e-30, 0, 0.0005718454412380164, 0.0009336952012055536, 0.0009419432159665566, 0.001447473133974872, 0.001467634272374873, 0.001484314096880154, 0.001467651692106161, 0.001737378051158996, 0.001945056278708673, 0.001493521507361076, 0.001243668321567156, 0.001606560329886393, 0.001488074892088185, 0.00148954762423707, 0.0006282834192623415, 1.518221546239686e-05, 3.80434783669761e-09, 1.779677749844751e-14, 1.301417114092904e-23, 0, 0.0005720395613579704, 0.001195613175480829, 0.001712974968452454, 0.001248075080502916, 0.001864836458100912, 0.001967834547981736, 0.002139015608739511, 0.002038921809066101, 0.002064396211594445, 0.001779135191069095, 0.001863381562452189, 0.002808535213225982, 0.002598850569927377, 0.002274844021834393, 0.0007408375976328818, 1.418716271661114e-05, 5.541131691508871e-09, 3.222384494634116e-14, 1.792152111622281e-22, 0, 0.001065121404105035, 0.001750308145168264, 0.001779982449521791, 0.002287817800036833, 0.002058517277099677, 0.002542381333129408, 0.002896555103963124, 0.002556499469785778, 0.003235727724446148, 0.002932056340947582, 0.003151984472137588, 0.00247474337792963, 0.002971321507612443, 0.002950662839861169, 0.001081975400578124, 2.020463057081389e-05, 7.713406718775881e-09, 2.579636671742693e-14, 1.635849810880019e-29, 0, 0.001103498915437071, 0.001541406360655375, 0.00222459491086244, 0.003343272473078837, 0.003457994393848452, 0.002856863928682677, 0.003702552040910949, 0.003286635243786183, 0.003206666418689448, 0.002973200034035002, 0.002822991207971046, 0.002884821575508408, 0.003200573198932469, 0.002620169519357147, 0.001109041587344945, 1.956570629890933e-05, 8.30061601542036e-09, 3.284246775967474e-14, 1.893198781628396e-22, 0, 0.0009709692666500676, 0.001940367340526451, 0.002499714805400038, 0.003534089221689695, 0.003583849143548232, 0.002992761316195162, 0.003964822973873031, 0.003261986851365171, 0.003709217480370271, 0.002951713927062179, 0.003989100772275093, 0.002950104458500377, 0.003912112118073174, 0.003452586417106237, 0.001523833105834201, 2.219380667596965e-05, 1.156661837083979e-08, 3.293924053264143e-14, 6.332933403926976e-22, 0, 0.001686597702840576, 0.002441387565900962, 0.003312834166659461, 0.003121087317816327, 0.004163174614285096, 0.00525508429362663, 0.004504182045061766, 0.00742926613956657, 0.003994545824158378, 0.002994501065931077, 0.003911989743692593, 0.004183089796083816, 0.003455460921017431, 0.003404090234595017, 0.0019467248826361, 2.54231476463417e-05, 8.852656069930525e-09, 3.253638314732749e-14, 7.309501115938129e-22, 0, 0.00207743307487002, 0.002472641836125824, 0.003597095659151542, 0.004181977843933989, 0.004174907826839038, 0.0041385580717351, 0.005564644952194951, 0.004075076642046854, 0.004921600776139573, 0.003743569012666335, 0.004751337845078441, 0.005028841840408881, 0.004208795339277149, 0.005780337068983293, 0.002089070961091974, 3.2523359104133e-05, 1.138295848619331e-08, 4.356752170851862e-14, 2.677348838029952e-22, 0, 0.00126424290848711, 0.003045821452466362, 0.004326119972544775, 0.004658999530911357, 0.004661462571523685, 0.004854626251572483, 0.004428381255870336, 0.005340708482514029, 0.004969833975256166, 0.005236374653998916, 0.005608129744047192, 0.005833797049009235, 0.004185527959092444, 0.004697390168024876, 0.001556872428236158, 3.025618208119917e-05, 1.262642536423645e-08, 4.062386291972984e-14, 5.027247647197441e-29, 0, 0.002155536810853754, 0.003253467264211955, 0.003539295452642037, 0.005174639413974794, 0.0044939144262394, 0.005854270164166058, 0.005089071401771524, 0.00634100224401572, 0.006163979444390949, 0.006955631074854314, 0.004529652935162556, 0.005962954383402862, 0.006027538596791351, 0.006000934530018382, 0.001945899085284979, 3.423967530031902e-05, 1.225765869589544e-08, 6.556542555391342e-14, 4.382252158659828e-22, 0, 0.003134528881670649, 0.004368794728441225, 0.004006812111921938, 0.00436641944569241, 0.004896906115281261, 0.004905053594352523, 0.00499360287147219, 0.007314723409462211, 0.009169285082125772, 0.007230752935082348, 0.008079203569262984, 0.00629513463618704, 0.004741303624764928, 0.008184056291415269, 0.002466208306448465, 3.761817819308452e-05, 1.228205471772841e-08, 5.803500827308753e-14, 4.686932374066792e-22, 0, 0.003938526030285204, 0.003896157773317188, 0.004433648624457202, 0.00730649978481398, 0.007084618289793052, 0.00954012492946746, 0.008724527215409211, 0.007040212056151482, 0.007605384734455023, 0.008055054823971952, 0.006416444321312109, 0.00607096642564119, 0.006455804605363088, 0.007925340705698702, 0.003797931548225184, 4.508912278526769e-05, 1.25557413724023e-08, 4.742033974365371e-14, 7.803111892306419e-22, 0, 0.005251270766203268, 0.005757665434239416, 0.008601372086930618, 0.008384321404456068, 0.009714139866988087, 0.008289656878857346, 0.009154483962041856, 0.008272109120757751, 0.008529812404660869, 0.01147259928647139, 0.0115198978617898, 0.0109525907596416, 0.009859593768555257, 0.01005342852203954, 0.004671115198369318, 4.389691319935684e-05, 1.26743030487572e-08, 6.400567429876762e-14, 1.966526286547976e-22, 0, 0.01906529736170685, 0.01016266496593189, 0.009779706098666028, 0.01222437657889979, 0.02549957243021494, 0.0162176517905168, 0.01915945072742106, 0.01738346616081961, 0.01209354820968477, 0.01844641294959964, 0.02144924057945427, 0.01563177363609232, 0.00912864972493284, 0.01511010464426392, 0.008357610260071239, 6.667123306014354e-05, 1.469581825873586e-08, 7.840729735981037e-14, 6.413916198390963e-22, 0, 0.0003123027239935291, 0.0005667253781198961, 0.0007457345716815694, 0.0008074497639219425, 0.001057009816805179, 0.0009241198863679956, 0.001144321445682315, 0.001074557049336706, 0.001084936731668148, 0.001254015084779271, 0.001632946152379283, 0.001171546480248961, 0.001455756253530638, 0.001215665348456752, 0.000757911178362944, 1.627283294560529e-05, 4.25093010830273e-09, 1.264708173551954e-14, 3.588015562954029e-23, 0, 3.392385805772687e-06, 5.973060298970717e-06, 5.339027353045223e-06, 8.959855081703484e-06, 9.734796604858566e-06, 1.032072986694527e-05, 1.397698826378789e-05, 1.079413994462906e-05, 1.338911663450641e-05, 1.177023350930523e-05, 1.557902025309491e-05, 8.954512163282783e-06, 1.062566985489149e-05, 1.31045852993534e-05, 7.365275177598474e-06, 1.845413913118354e-07, 6.315554930799858e-11, 3.16580675498683e-16, 1.617466438460083e-32, 0, 2.884191361723171e-09, 5.295334648436887e-09, 7.346269671345138e-09, 1.450387900308455e-08, 1.064417331070332e-08, 1.27857238774922e-08, 1.550485382006846e-08, 1.965457895753339e-08, 1.619555465342574e-08, 2.25812440324449e-08, 1.842589261091021e-08, 1.755863715349932e-08, 1.521963042774031e-08, 1.850098874008344e-08, 7.180383562006978e-09, 2.282019227759646e-10, 1.233679727137777e-13, 3.251894811155867e-19, 1.046608750119746e-37, 0, 2.417426350738013e-13, 4.446775016617753e-13, 5.710238588270385e-13, 8.357596156608282e-13, 9.990673519318874e-13, 8.127052695803042e-13, 1.31416466901224e-12, 1.045191599214e-12, 1.134295808459089e-12, 1.514733123230755e-12, 1.12218425784476e-12, 1.269564399918769e-12, 1.18171593945265e-12, 1.145480526035731e-12, 6.557517347666662e-13, 2.081945028464492e-14, 9.673809925619595e-18, 1.512300988075462e-24, 2.488126189337054e-42]
+      ],
+     "2":[
+      [0, 0.001582722799384161, 0.002292025868841526, 0.003301873355891557, 0.003177214726726073, 0.003470849965163618, 0.006346063156217851, 0.003343469012874204, 0.004265465887305441, 0.004853734330426195, 0.003806624829400591, 0.004628439023276311, 0.004448312203484754, 0.003985865743216383, 0.004071192366012115, 0.001775337158693684, 2.946291199294081e-05, 1.024180743326208e-08, 1.634363274692037e-14, 1.469085128578498e-23, 0, 0.001423870512445633, 0.002255135212587642, 0.003210157888514225, 0.003348295858980698, 0.00396311099574674, 0.00336638776694423, 0.004186044578389066, 0.003739144538286315, 0.005023598898676824, 0.005008957002453389, 0.0046337633651822, 0.004383356254302898, 0.004546115466445622, 0.003580842930498194, 0.001747099838297536, 3.352610301817808e-05, 8.521959793031578e-09, 1.589891798912686e-14, 5.376137008531698e-31, 0, 0.001616055760680831, 0.002476773478508755, 0.004143100785856813, 0.004234752991607768, 0.003676351004528484, 0.004556725047832442, 0.004059783472507832, 0.004282675498331394, 0.004181163038292174, 0.004419971502039897, 0.003738332267651269, 0.004083870721886987, 0.004749101174032287, 0.004499801729534044, 0.001220697224827247, 3.060921473676176e-05, 6.973817318871127e-09, 1.483543832491575e-14, 9.901011536493988e-31, 0, 0.001740804404180215, 0.002836521060541975, 0.002855700323293961, 0.004379281807406077, 0.004431106119314099, 0.004472182265593047, 0.00441279256269148, 0.005212896797854498, 0.005823830226684937, 0.004462489511036832, 0.003708147051250768, 0.004780061897039735, 0.004408814777775239, 0.004383385313625893, 0.001760364756482607, 3.670300349892532e-05, 6.5093839805328e-09, 1.476578390885549e-14, 2.724667531966213e-24, 0, 0.00131419681241909, 0.002741162022966561, 0.003919243199747547, 0.002849683352625565, 0.004249118624053342, 0.004474519568096766, 0.004853656380440653, 0.004616899311877749, 0.004664822914991418, 0.004011814584902107, 0.004192962807685983, 0.006306434980435073, 0.005810955981669723, 0.005052184712892763, 0.0015666866475726, 2.59023313272967e-05, 7.179609687438909e-09, 2.041850426596311e-14, 2.924540856275756e-23, 0, 0.001969811714359274, 0.003230351987718206, 0.003278372767329689, 0.0042050278832388, 0.003775759694069124, 0.00465361508357731, 0.005290893912677203, 0.004660022479064233, 0.005885818639086271, 0.005322275781407818, 0.005709483819091129, 0.004473302003834185, 0.005348240318915639, 0.0052752623050818, 0.001842032527139517, 2.970806328812409e-05, 8.061797458942968e-09, 1.325356091333643e-14, 2.192127713945822e-30, 0, 0.001711264141395269, 0.002385459548291435, 0.003435683866215971, 0.005152748579541538, 0.005318558810294661, 0.004384896191958669, 0.005671116788739218, 0.00502358975938813, 0.004891130625772956, 0.004525535829292136, 0.004287887544239439, 0.004372586245990948, 0.004830711193964746, 0.00392805144853901, 0.001583313967031769, 2.413041744311027e-05, 7.284717777412743e-09, 1.421796165133815e-14, 2.156309610606323e-23, 0, 0.001298685901876024, 0.002589956076319251, 0.003329709153931978, 0.004697841252392049, 0.004754152778710358, 0.003961828553878519, 0.005237754963691603, 0.0043003020368061, 0.004879687700220406, 0.003875025552883339, 0.005225928819381167, 0.003856662665018682, 0.0050927213328201, 0.004464250467769141, 0.001876395198793422, 2.361267612445927e-05, 8.763764763574783e-09, 1.234197133974843e-14, 6.282410162735638e-23, 0, 0.001986177249640292, 0.002869148659146937, 0.003885290098058504, 0.003652874188502114, 0.004862460347568542, 0.006125074753162404, 0.005238965196396651, 0.008623250017616763, 0.00462685154119462, 0.003461252942391443, 0.004512268103587495, 0.004814822853080047, 0.003960534792067914, 0.003875386048368476, 0.002110620038659745, 2.38187436079513e-05, 5.910013536183121e-09, 1.076197340780289e-14, 6.431940816183531e-23, 0, 0.002188166330536013, 0.00259910811807706, 0.003773310828888423, 0.004377814986156972, 0.004361393471749173, 0.004314472980244514, 0.005789140685145469, 0.00423065870545524, 0.005098844670099943, 0.003870277066559344, 0.004901856153055109, 0.00517724467842509, 0.004314729021011468, 0.005885935252054347, 0.002025880629867358, 2.725744104867588e-05, 6.800941272547228e-09, 1.29159717504313e-14, 2.119522835142347e-23, 0, 0.001205938464774085, 0.002899405256623453, 0.004109703843331073, 0.004416820488152357, 0.004410034903730015, 0.004583275865661096, 0.004172181612732946, 0.005021259977740589, 0.004662823544363781, 0.004902625386437086, 0.005239677786374201, 0.00543906200077532, 0.003885869164087413, 0.00433173213870168, 0.001367293619915143, 2.296614399536646e-05, 6.834998327305761e-09, 1.092462949664712e-14, 3.621157360883678e-30, 0, 0.001880856710010405, 0.002833065278003003, 0.003075632672280323, 0.004487483681531233, 0.003889111252043553, 0.005055903122726351, 0.004385938921855972, 0.005453529062750438, 0.005290226117283663, 0.005957177772055584, 0.003871306498720233, 0.00508557853086827, 0.0051189902364841, 0.005062098376112559, 0.001563292726010945, 2.377631786787674e-05, 6.072087283790716e-09, 1.615096526998371e-14, 2.898707149596516e-23, 0, 0.002522794173897559, 0.003508981418765823, 0.003211633154186374, 0.003492670159309755, 0.003908919324105036, 0.003907321409622011, 0.003969606652130075, 0.005802659941026389, 0.007258686981204463, 0.005712117635387389, 0.006368994068528714, 0.004952148236162306, 0.003714086072467891, 0.006367815883188569, 0.001827526694999788, 2.40963724669685e-05, 5.613718716098292e-09, 1.320138754575094e-14, 2.868922296629522e-23, 0, 0.002751000470666436, 0.002715835032771785, 0.003084151323496024, 0.005072113802462306, 0.004907936404043134, 0.006595337758996769, 0.006018981972945598, 0.004846884781090293, 0.005225063974890999, 0.005522427806234447, 0.004389800207741123, 0.004144714210135, 0.004388872618598266, 0.005351662513312567, 0.00244250814951775, 2.506803300574126e-05, 4.983004480130747e-09, 9.378409787954955e-15, 4.166680698729812e-23, 0, 0.003049235165166622, 0.003336436526043573, 0.004974068605779134, 0.004838572011458937, 0.005594439214166044, 0.004764192933073179, 0.005250309379751667, 0.004734380806033446, 0.004871693776865083, 0.006538732359346125, 0.006551930251732743, 0.006216186913701204, 0.005572272707927803, 0.005643600611300503, 0.002497397361075819, 2.02910983489372e-05, 4.184016934677551e-09, 1.054487834924358e-14, 8.780656374662476e-24, 0, 0.005537327069988702, 0.002945603466063674, 0.002828786995202725, 0.003528634063508327, 0.007345408437050564, 0.004661995633318395, 0.005496237320365575, 0.004976397034230774, 0.003454826984108299, 0.005258672201885964, 0.006101904393167546, 0.004437605957750647, 0.002580560889863545, 0.004242731260343191, 0.002235143881131521, 1.542029909432581e-05, 2.430461846694638e-09, 6.497351973770837e-15, 1.455221364620119e-23, 0, 5.190530079446047e-05, 9.399812371926526e-05, 0.0001234352200767763, 0.0001333755847520902, 0.0001742382752405275, 0.0001520177462157305, 0.0001878508457966157, 0.0001760319312728603, 0.0001773621572348283, 0.0002045745474767512, 0.0002658341110609235, 0.0001903207278292536, 0.0002354961600597152, 0.000195335988559416, 0.0001159994832226985, 2.154523608016657e-06, 4.028680655217465e-10, 6.023762829162065e-16, 4.712310365613674e-25, 0, 5.245803633708027e-07, 9.217561482777071e-07, 8.222263218854483e-07, 1.377012985088618e-06, 1.49303327864331e-06, 1.579633402906614e-06, 2.134816381129982e-06, 1.645256958559524e-06, 2.036545515478762e-06, 1.786576090863785e-06, 2.359763955318121e-06, 1.353505655216033e-06, 1.599363319221306e-06, 1.959267842074834e-06, 1.049015974598214e-06, 2.274770567581491e-08, 5.580288827011818e-12, 1.410787689692348e-17, 2.001789781101558e-34, 0, 7.163759878399986e-10, 1.312586456215555e-09, 1.817258452781069e-09, 3.580528113305223e-09, 2.622320151375113e-09, 3.143458405851385e-09, 3.804139746357667e-09, 4.812344270478895e-09, 3.957224566221763e-09, 5.506078903684363e-09, 4.483535043227941e-09, 4.263615913349687e-09, 3.680231748279894e-09, 4.443893335611269e-09, 1.643512111479191e-09, 4.525150582928061e-11, 1.75815566430322e-14, 2.351055813114851e-20, 2.124213052995317e-39, 0, 1.605542856607866e-13, 2.94742961574072e-13, 3.777286968064948e-13, 5.517373095367543e-13, 6.58216536387055e-13, 5.343526347524068e-13, 8.623098190205972e-13, 6.844250990760452e-13, 7.412601032980504e-13, 9.878534290492149e-13, 7.303490389905003e-13, 8.24572292299616e-13, 7.643564819171577e-13, 7.360517127428882e-13, 4.01798844420381e-13, 1.107428121878913e-14, 3.716103337793219e-18, 2.976622092994258e-25, 1.399033754210731e-43]
+      ],
+     "3":[
+      [0, 1.252789093646027e-11, 7.336366137940812e-11, 2.403989839487671e-10, 4.157423818145837e-10, 7.17400163377238e-10, 1.909502410719069e-09, 1.384312778079459e-09, 2.331925344635243e-09, 3.39512986683659e-09, 3.32324565795841e-09, 4.942755287424901e-09, 5.715228389475976e-09, 7.123728021137594e-09, 1.133703998947016e-08, 3.314252409117909e-08, 6.785203067301326e-09, 3.982547567087616e-11, 1.801149081406862e-15, 9.57344611369556e-23, 0, 0.0001416815965476198, 0.0002268676642356778, 0.0003265001445118927, 0.0003443005245011363, 0.000412009159058452, 0.0003538273927252864, 0.0004448235168616719, 0.0004017099804045027, 0.0005456469126513327, 0.0005500476643830188, 0.0005144498513970482, 0.000492007851759832, 0.000521575945849501, 0.0004253690870597984, 0.0002647228999034308, 9.826619284385956e-06, 8.987815513014848e-09, 1.358747766693877e-13, 9.79725925497382e-29, 0, 0.0003201823826004214, 0.0004961173254057393, 0.0008390357914828007, 0.0008670413803507495, 0.0007610011818861941, 0.0009536250988467606, 0.000858982019910864, 0.0009161204752416672, 0.0009042543505982643, 0.0009664267025316829, 0.0008263864011879646, 0.0009127102365180784, 0.001084883960176077, 0.001064307443265248, 0.00036825883878731, 1.78566945086003e-05, 1.46178583147107e-08, 2.508228092447671e-13, 3.528550907323714e-28, 0, 0.000515051469173315, 0.0008484840101821587, 0.0008636288359299898, 0.001338980054954782, 0.001369745659924865, 0.001397666962957775, 0.001394292831322107, 0.001665235804828976, 0.001880880932236755, 0.00145708753446399, 0.001224111763217444, 0.001595339737421809, 0.001504014922873256, 0.001548250471158596, 0.0007930461863208514, 3.197075952256517e-05, 2.036312858720601e-08, 3.719977671770924e-13, 1.441261250017167e-21, 0, 0.0005161408723032859, 0.00108842757191728, 0.001573344695338551, 0.001156578091722733, 0.001743547371946987, 0.001856255259300623, 0.002035713002492347, 0.001957735489057031, 0.001999837491856022, 0.001738826209479078, 0.001837350286747319, 0.002793896705144438, 0.002631385544645242, 0.002368738449922101, 0.0009368727536838502, 2.99480536301187e-05, 2.980420523812947e-08, 6.820871638752607e-13, 2.047182318383872e-20, 0, 0.0009627447733845844, 0.001596221956433674, 0.001637791433644595, 0.002123859666590535, 0.001928047842840154, 0.002402482802204127, 0.002761563900344844, 0.002459065596144223, 0.003140110136970753, 0.002870721918619944, 0.003113480755639305, 0.002466226663073264, 0.003013880753271302, 0.00307793910392268, 0.001370792141687948, 4.27430223362957e-05, 4.163948467019307e-08, 5.506039823275173e-13, 1.90604183044633e-27, 0, 0.0009992024628419148, 0.00140820368662445, 0.002050517295978831, 0.003109179959311506, 0.003244571760431789, 0.002704450823196768, 0.003536263031795894, 0.003166986236844128, 0.003117433171953993, 0.002916175254983768, 0.002793460674221055, 0.002880003136761328, 0.003252190434144155, 0.002738058689681908, 0.001407633071287541, 4.147571628798134e-05, 4.494495392278605e-08, 7.05342450207091e-13, 2.237077022055344e-20, 0, 0.0008807573079448209, 0.001775830451408357, 0.002308193507222254, 0.003292463057116421, 0.003368621443333443, 0.002838122233901779, 0.00379347110226648, 0.003148810958036604, 0.003612397404064684, 0.002900238867320075, 0.003954378447177004, 0.00295040594317378, 0.003982266347554296, 0.0036143445062691, 0.001937586203847528, 4.713910801002516e-05, 6.279637251105591e-08, 7.109227208820976e-13, 7.563385489778281e-20, 0, 0.001532608119617728, 0.002238324956623585, 0.003064434530141027, 0.002912850953354938, 0.003920090694443756, 0.004992381556393012, 0.004317159205886464, 0.007184218677086322, 0.003897175668381491, 0.002947497502726718, 0.003884816692999611, 0.004190938733510549, 0.003523668668980427, 0.00356990563066282, 0.002479743141259345, 5.41015126044652e-05, 4.817955189955563e-08, 7.051536242184545e-13, 8.804243197783881e-20, 0, 0.001891102919361703, 0.00227099481779248, 0.003333275306985233, 0.003909873023684483, 0.003938102416767406, 0.003938635744327483, 0.00534303887762943, 0.0039476462310815, 0.004810141572623349, 0.003691337987848564, 0.004726697757942179, 0.005047209254463549, 0.004299484119482176, 0.006072657390060186, 0.002665823208597311, 6.934132083878627e-05, 6.209273468046282e-08, 9.476673615619447e-13, 3.247670590701535e-20, 0, 0.001152887193377047, 0.002802383386247369, 0.004015928350426599, 0.004363568720701736, 0.004404844481116593, 0.004628293285994713, 0.004259555066004978, 0.005182863083705305, 0.004865885016183979, 0.005172461180149017, 0.005588929291534158, 0.0058654776225197, 0.004283292416432645, 0.004943693895137115, 0.001990239740326722, 6.462754131585406e-05, 6.90267131499564e-08, 8.865297131847559e-13, 6.134998607581096e-27, 0, 0.001969153435374539, 0.002998730144593635, 0.003291334844092829, 0.004855088173573729, 0.004254035232792769, 0.005591209613222868, 0.004903721104700193, 0.006164485046753445, 0.006045736735960926, 0.006882896151960971, 0.004522136923609679, 0.006005951833474266, 0.00617925242230934, 0.006326778117521131, 0.002491985302747417, 7.327109671462559e-05, 6.715252679783744e-08, 1.435124233356655e-12, 5.376158992242868e-20, 0, 0.002868559572588161, 0.004033853084296913, 0.003732688382405026, 0.004104025111231257, 0.004643715606363883, 0.004692932997038924, 0.004820241944352761, 0.007123681026666251, 0.009009303791077431, 0.00716780130575467, 0.008080070425154785, 0.006351747969597215, 0.004869246054233121, 0.008643718331854495, 0.003163927812176985, 8.064822929097831e-05, 6.742469648763828e-08, 1.273853723804995e-12, 5.77706662141755e-20, 0, 0.003617089560932739, 0.003610180630659974, 0.004144937736258378, 0.00689172511864254, 0.006742086916180978, 0.009159858421522492, 0.008451443597687656, 0.006880603328637384, 0.007499136218477987, 0.008013187703664429, 0.006439846195472244, 0.006147246584264578, 0.006653484076589256, 0.008400113479469508, 0.004889725508179535, 9.701631500850838e-05, 6.920267441933018e-08, 1.046249908416293e-12, 9.697107995472908e-20, 0, 0.004849790624176497, 0.005365026542282997, 0.008086443464309406, 0.00795279165633775, 0.009296412899639334, 0.008003951905393084, 0.008917767482759603, 0.008129997083510709, 0.008457908280940804, 0.01147710012264254, 0.01162688362952487, 0.01115253018532253, 0.01021860849954729, 0.01071558477226433, 0.006047813388960128, 9.499202320309301e-05, 7.028464136333708e-08, 1.422707319638583e-12, 2.470464610986151e-20, 0, 0.01830778016278, 0.009846154193854153, 0.00955981018974645, 0.0120562473755088, 0.02537335032824745, 0.01628133073876158, 0.01940615581193653, 0.01776416879828239, 0.01246843175957955, 0.01918744374755964, 0.02250928688008005, 0.01655008463114855, 0.00983728749837218, 0.01674582314070225, 0.01125157066079272, 0.000150054828860462, 8.484990197050855e-08, 1.820826953672216e-12, 8.493237366346124e-20, 0, 0.0003326881933612805, 0.000609117567539859, 0.0008086807946281339, 0.0008834262335694434, 0.00116679153031088, 0.00102919950923794, 0.001285801234857474, 0.00121816850163769, 0.001240886122037748, 0.001447029687910553, 0.001901039979241259, 0.00137600862327045, 0.001740313169121081, 0.00149459500083369, 0.001131952928007475, 4.063671307880474e-05, 2.725081521787186e-08, 3.267871044782338e-13, 5.314002083791885e-21, 0, 4.382436884055891e-06, 7.785266301515337e-06, 7.021055669791212e-06, 1.188782791022001e-05, 1.303128418381011e-05, 1.393885534008507e-05, 1.904514232429334e-05, 1.483918825841482e-05, 1.857047700947147e-05, 1.647034908012062e-05, 2.199388821659957e-05, 1.275397333917479e-05, 1.540408709406648e-05, 1.953764268044956e-05, 1.333928088039217e-05, 5.588633403793656e-07, 4.912021223760689e-10, 9.940058862616303e-15, 2.92122126856574e-30, 0, 4.973585928567359e-09, 9.21302530082758e-09, 1.289545278860371e-08, 2.568693885327598e-08, 1.90193711595822e-08, 2.304958699792021e-08, 2.820049239838208e-08, 3.606629464192866e-08, 2.998333599488577e-08, 4.217702191938406e-08, 3.472146830067073e-08, 3.33810065556907e-08, 2.944988599233045e-08, 3.681591728923222e-08, 1.735531774822465e-08, 9.221227511920589e-10, 1.280417977249e-12, 1.364239365637387e-17, 2.534055827793792e-35, 0, 5.980683669811e-13, 1.109936041227588e-12, 1.438003269389848e-12, 2.123427457358404e-12, 2.560936721556488e-12, 2.101758418462221e-12, 3.428804724825646e-12, 2.751247913815176e-12, 3.012302620253186e-12, 4.058302885580193e-12, 3.033235808052989e-12, 3.462007556166715e-12, 3.279757493008706e-12, 3.269287429489523e-12, 2.272406750217177e-12, 1.205114895296548e-13, 1.436827392552079e-16, 9.079965793955126e-23, 8.645467425832821e-40]
+      ],
+     "4":[
+      [0.008849984830289589, 0.006543617056942272, 0.00477160822999116, 0.004615051967382193, 0.003354178182068483, 0.002952075376292025, 0.004529776070500563, 0.002060083292728435, 0.002315921652552699, 0.002359079976228878, 0.001676914727725447, 0.001866699582309726, 0.001656182473430324, 0.00129006563716287, 0.001098351157236827, 0.0002441640891475004, 2.448156637011505e-06, 8.917840944057276e-10, 2.908305557497415e-15, 1.121366855039252e-23, 0.005930571274920123, 0.005910887654407382, 0.004713972465910689, 0.004505176062175765, 0.00354921720662024, 0.003384519542504322, 0.002412713035452883, 0.002589765924326502, 0.002038444198548941, 0.002451606709494263, 0.002215579744888392, 0.001876475559893213, 0.001638660054465697, 0.001477402300302192, 0.0009700050948260415, 0.0002412613025353601, 2.797142259214753e-06, 7.450509330809994e-10, 2.840589497659918e-15, 4.119927068706988e-31, 0.007490776533792798, 0.006736086494794034, 0.005198401844489384, 0.005838213549593526, 0.004507190757740846, 0.003152440234534203, 0.003279166401466164, 0.002521904483200697, 0.0023442873297261, 0.002048811686551159, 0.001963037720807089, 0.001520043619497433, 0.001532932993197624, 0.00154966852470579, 0.001223914814526478, 0.0001692570690431299, 2.56419787175629e-06, 6.121817040361448e-10, 2.661280840184682e-15, 7.617582775374589e-31, 0.00863502685038941, 0.007285683608834466, 0.005977761575070157, 0.00404050943973508, 0.004680042151008505, 0.003815145084684121, 0.00323146264823485, 0.002752379328530602, 0.002865126551424005, 0.002865382836307149, 0.001990010604003653, 0.001513924104575832, 0.001801580646304894, 0.001444502305894573, 0.001197116578073812, 0.0002450814008345309, 3.087228259402662e-06, 5.737370525477277e-10, 2.65947674718599e-15, 2.104599754042193e-24, 0.0081111134344887, 0.005522677332164099, 0.005800376876714376, 0.00556794116779697, 0.003057823440807726, 0.003673387050558991, 0.00324634733076055, 0.003039714023242504, 0.00254790956570685, 0.00230450700541571, 0.001796337577497925, 0.001718846456288214, 0.002386563667422704, 0.001911669803868247, 0.001385399142857924, 0.0002190072926104777, 2.187629137910165e-06, 6.353850626247682e-10, 3.692435565055182e-15, 2.267942514627774e-23, 0.008837540664177423, 0.008311565240212147, 0.006863413978623142, 0.004676485578407775, 0.004530577055596533, 0.003277487329966927, 0.003390063785573446, 0.003327067346070594, 0.002582203432662704, 0.002919567910043399, 0.002392838066898143, 0.002350075147824641, 0.001699754304082235, 0.001766627678136865, 0.001452474659187629, 0.0002585487187387536, 2.519282180366164e-06, 7.163596865446291e-10, 2.406416720350007e-15, 1.7067052330669e-30, 0.009125495469314151, 0.007250098486654106, 0.0050889848541424, 0.004920884991432626, 0.00557432578278375, 0.004635529975218843, 0.003207343534728888, 0.003580716023648477, 0.00279502281883146, 0.002436069724126498, 0.002042935652526385, 0.001772135939465518, 0.001668265063937212, 0.001602189662910739, 0.001085951416936421, 0.0002231416878078493, 2.054635836612832e-06, 6.499426024228795e-10, 2.591939145975743e-15, 1.685474052791985e-23, 0.01003470625381172, 0.005524584842469682, 0.00554779195414567, 0.004788560569302163, 0.005102939234441876, 0.004160516286476683, 0.002909715343551441, 0.003320589025540422, 0.002402364006214214, 0.002440288314972187, 0.00175641811802972, 0.002168631651069912, 0.001477430218110243, 0.001695982677180011, 0.00123922571990045, 0.0002655256460986904, 2.018750759499072e-06, 7.850836529821139e-10, 2.259025568282879e-15, 4.930097311321513e-23, 0.009423950746445449, 0.008483637465326257, 0.006170912600272122, 0.005610359789687526, 0.003984055235402047, 0.004272663998075028, 0.004516840919165763, 0.003334909391826465, 0.004837036933882065, 0.002323289066271696, 0.001575270881640312, 0.001880120849941842, 0.001852013731687085, 0.001324322909749665, 0.0010801532748282, 0.0002998890601921639, 2.044672381781778e-06, 5.315897236935522e-10, 1.977778374315822e-15, 5.067449889885545e-23, 0.00735446563411738, 0.009384538437649815, 0.005612924214744719, 0.005470894401492061, 0.004794204198734633, 0.003848012066784965, 0.003194623206667016, 0.003700165206595376, 0.002382785242466633, 0.002570738779542068, 0.0017686115032174, 0.002050783958564957, 0.001999544422162376, 0.001448645285030274, 0.001647230433267797, 0.0002890232212851563, 2.349401655357319e-06, 6.142143146194433e-10, 2.383207395131468e-15, 1.676500580778663e-23, 0.009802568821881116, 0.005193093388003875, 0.006286981085323871, 0.005982940391290479, 0.004856655204472577, 0.003906803620499434, 0.003407503297328242, 0.002677556311878266, 0.002839605534686773, 0.002360497486767714, 0.002249507738914802, 0.002201062228786759, 0.00210923400790517, 0.00130998127961668, 0.001217219340772338, 0.0001958614229100657, 1.987593184924958e-06, 6.198006943885686e-10, 2.023906549933293e-15, 2.875617762273217e-30, 0.009349618545068846, 0.008132517471952131, 0.006168195397473167, 0.004495799400302223, 0.004954487254814731, 0.003459379687857695, 0.003774221110391236, 0.002826222152474548, 0.003096643750087395, 0.002689039010864113, 0.002744527877736455, 0.001632877479618478, 0.001980201663465152, 0.001732724484131764, 0.001428256199278096, 0.0002248513873853126, 2.06609914935994e-06, 5.528589150030498e-10, 3.004216000428896e-15, 2.311033381116298e-23, 0.01076096774353922, 0.0109526531125541, 0.007670979640171212, 0.004713750724952068, 0.003871877667815556, 0.00349118442649941, 0.002928707183168578, 0.002568380774487687, 0.003308330976295534, 0.003704666795365821, 0.002642362785148064, 0.002697336322919196, 0.001936113903974274, 0.001262308137690605, 0.001803990441390181, 0.0002639289644820121, 2.102448138643415e-06, 5.132034334284368e-10, 2.465477989721739e-15, 2.296353508569423e-23, 0.01265876953273418, 0.01204104965294428, 0.005985622424376523, 0.004563652095219911, 0.005668774925720738, 0.004419276573367124, 0.004983908116904277, 0.003926188506026741, 0.002785997322006475, 0.002688554605769383, 0.002575499743548103, 0.001874326175305238, 0.001633683839956731, 0.001503843145361502, 0.001528511042569404, 0.0003556273915975073, 2.205097327983752e-06, 4.592563346475803e-10, 1.765665142567361e-15, 3.361601611082815e-23, 0.008271695288642604, 0.01352007691716851, 0.00744909240385868, 0.007455953423641398, 0.005478125779943869, 0.005102974298948464, 0.003647009477187926, 0.003469345600949164, 0.002756739621022652, 0.00253934547747833, 0.003089154154947825, 0.002833898115162228, 0.002482058617883878, 0.001934178094261458, 0.00163286635484331, 0.0003683502119751071, 1.808106695517801e-06, 3.90619789415304e-10, 2.01082508177448e-15, 7.17363137424701e-24, 0.05928681756757356, 0.0268759636881494, 0.007198971329009975, 0.004641596291430962, 0.004373177902992267, 0.007334297587218179, 0.003906566204242551, 0.003975611460766301, 0.003171928428266594, 0.001971260000419168, 0.002719555422949213, 0.002889057268638958, 0.001939601341362831, 0.0009805143039234448, 0.001343740786680341, 0.0003608709932050489, 1.504056760772446e-06, 2.483172974348867e-10, 1.354963882943728e-15, 1.298144482552839e-23, 0.0005633787809508228, 0.0003218324757574631, 0.0002934742033811225, 0.0002587385175976296, 0.0002111650322101706, 0.0002222498834120019, 0.0001627321110127584, 0.0001735831166524118, 0.0001433362019862797, 0.0001292810435129678, 0.0001351543026177798, 0.0001607896503097672, 0.0001062690049452611, 0.0001143090720755083, 7.903320277316942e-05, 2.392532034382351e-05, 2.684325592670183e-07, 5.254839862826157e-11, 1.600917305048032e-16, 5.335261670187071e-25, 5.035008054925411e-06, 5.225279746593529e-06, 4.623251223233072e-06, 2.768824189328176e-06, 3.502410141403487e-06, 3.059511029969437e-06, 2.716571024677599e-06, 3.169143045263567e-06, 2.152218393107633e-06, 2.384829403096021e-06, 1.896226554954415e-06, 2.293018020321785e-06, 1.214152349488625e-06, 1.247207264813773e-06, 1.27355815024333e-06, 3.476120115963914e-07, 4.553017251733315e-09, 1.168370848495298e-12, 6.000319425509834e-18, 3.600218915829192e-34, 2.08784536406389e-08, 1.543367280003346e-08, 1.423948133698271e-08, 1.3236083957343e-08, 1.96978503228438e-08, 1.162291210103501e-08, 1.169292233700647e-08, 1.221496465065379e-08, 1.361656397432819e-08, 1.002341923546982e-08, 1.264086695122425e-08, 9.423861094856906e-09, 8.273022888485609e-09, 6.207930735618427e-09, 6.248558054873301e-09, 1.178262878347796e-09, 1.959856761957814e-11, 7.960053513449783e-15, 2.154073354656077e-20, 8.144048062699716e-39, 1.202341890164805e-11, 1.062634168920646e-11, 9.823182022720861e-12, 8.452285019629608e-12, 9.325330358468975e-12, 8.963278663287756e-12, 6.10690073490884e-12, 8.507173333917811e-12, 5.950199909959107e-12, 5.768981561451193e-12, 6.96849119668404e-12, 4.716925551748014e-12, 4.916358315436402e-12, 3.961985748545111e-12, 3.180502560456125e-12, 8.855572018385712e-13, 1.475605765709331e-14, 5.177143484589051e-18, 8.364976063809822e-25, 1.626121257968957e-42]
+      ],
+     "5":[
+      [0.01001139572161085, 0.007278667034219174, 0.005218919061893411, 0.004963341031247506, 0.003547033774049103, 0.003069645664214088, 0.004631472479272076, 0.002071136042523773, 0.002289439363762659, 0.002293133449419854, 0.001602798676834338, 0.001754380166217105, 0.001530518906057541, 0.001152669130028278, 0.0009302285991880483, 0.0001421721833644589, 5.157475765867825e-07, 2.606941166582696e-11, 3.380712402045328e-18, 1.190782965478532e-28, 0.006681584111486024, 0.006548132978954849, 0.005134919419862627, 0.00482547530968179, 0.003738028274817159, 0.003505004994496677, 0.002456851101703169, 0.00259307555655431, 0.002006942472296367, 0.00237338548418561, 0.002109046716687004, 0.001756398308623322, 0.001508169670379087, 0.001314687253248023, 0.0008181884157934023, 0.0001399108723748345, 5.868732130074561e-07, 2.169165155972531e-11, 3.288684701609785e-18, 4.357566188996028e-36, 0.008405056689154568, 0.007431959527983425, 0.005639587444138996, 0.006227865179557824, 0.004727666570698824, 0.003251392308489343, 0.003325580919377048, 0.002514862193476468, 0.00229867640181318, 0.001975378967242296, 0.001861051375091692, 0.001416990877040182, 0.001405126469161346, 0.001373388497471008, 0.001028161704291336, 9.775560084424151e-05, 5.358128007240273e-07, 1.775097532129704e-11, 3.068669298756178e-18, 8.024929833245804e-36, 0.009649581550274192, 0.008005656854083013, 0.006458728944041093, 0.004292658449420291, 0.004889018136782696, 0.003918903366634487, 0.003263880048907913, 0.002733536214345591, 0.002797961882443718, 0.002751452542329629, 0.001878953784499296, 0.001405549352070741, 0.001644663086465574, 0.001274981348253675, 0.001001561644210577, 0.0001409731189925477, 6.424838072594528e-07, 1.656876198294449e-11, 3.054226573424084e-18, 2.208326101344273e-29, 0.009027267959184673, 0.006043762695532204, 0.00624159740579478, 0.005891364821663129, 0.00318137863508011, 0.003757952259045762, 0.003265585846392287, 0.003006632478807829, 0.002478067134502735, 0.002203882718876019, 0.001689194814729023, 0.001589315640634744, 0.002169838160154864, 0.001680465331636893, 0.001154375889490544, 0.000125463019840076, 4.53418379444722e-07, 1.827466894793925e-11, 4.223414487787037e-18, 2.370256754429862e-28, 0.009795766904967451, 0.009058821664389328, 0.007355477863633214, 0.004928015179695934, 0.004694481525453942, 0.003339310078603289, 0.003396293005525189, 0.003277482412622658, 0.002501212982621996, 0.002780738764582511, 0.002240971111111305, 0.002164143177723725, 0.001539117000242807, 0.001546652967742286, 0.001205346960263346, 0.0001475131851580793, 5.200370563375705e-07, 2.052008151008364e-11, 2.741368359596348e-18, 1.776607792205047e-35, 0.01007383231565661, 0.007869806318770604, 0.005431666568760585, 0.005164483552067739, 0.005752514289054363, 0.004703773133364212, 0.003200177058214113, 0.003513014204480491, 0.002696353488475382, 0.002310801145700655, 0.001905499714671069, 0.001625296224500077, 0.001504463984500661, 0.001396989150374506, 0.0008975221512956814, 0.0001267945363070581, 4.22400545842361e-07, 1.854207976864927e-11, 2.940811536263129e-18, 1.747530794798705e-28, 0.0110325082924342, 0.005972430712897831, 0.005897303033431923, 0.005005183485200634, 0.005244656998864914, 0.004204608216236146, 0.002891414587464512, 0.003244565084403933, 0.002308137188847932, 0.002305394953739086, 0.00163159906602128, 0.001980854725821385, 0.001326951532438262, 0.001472759612796081, 0.001020038472299729, 0.0001502649742177521, 4.133372358952386e-07, 2.230668020973704e-11, 2.552756706973493e-18, 5.091292099432384e-28, 0.01031891487897755, 0.009134083914382286, 0.006533021637243586, 0.005840326864136472, 0.0040780586502293, 0.004300396231144262, 0.004470191025183496, 0.003245314760368902, 0.004628429303942191, 0.002185943197194987, 0.001457378009625494, 0.001710346204165521, 0.001656623109703607, 0.001145343564558432, 0.0008854885739443657, 0.0001690220856875105, 4.169441215117712e-07, 1.504288795639772e-11, 2.225931751899781e-18, 5.212328445887437e-28, 0.008020171550845426, 0.0100629965849876, 0.00591814213388133, 0.005672000810825438, 0.004887380547930735, 0.003857248938637169, 0.003148780892008945, 0.003586124920666939, 0.002270756918489542, 0.00240893502981761, 0.001629599668483809, 0.001858017032546187, 0.001781320590985256, 0.001247772663757862, 0.001344879771203921, 0.0001622359897535651, 4.771377431396208e-07, 1.731052684015241e-11, 2.671419268384497e-18, 1.717575517793074e-28, 0.01064643083324229, 0.00554590137070845, 0.006601915591029329, 0.006177663217705641, 0.004930926176871877, 0.003900267777136669, 0.003344958120591646, 0.002584487960496849, 0.002695102955699901, 0.002202938044856525, 0.002064275117694644, 0.00198606613159773, 0.001871403350471088, 0.001123751045773414, 0.0009897592403803272, 0.0001094952020064109, 4.020188890166854e-07, 1.739715327134322e-11, 2.259522771508504e-18, 2.934358316758637e-35, 0.01011322619228524, 0.008649733058610259, 0.00645086014835872, 0.004623258400797484, 0.005009814364775129, 0.003439559006218953, 0.003689890082843287, 0.002716901456203063, 0.002927118351507641, 0.002499352634952195, 0.002508299694342342, 0.001467393791913142, 0.001749781231024139, 0.001480356210576005, 0.001156640894855817, 0.0001251911302182587, 4.162005587635002e-07, 1.545525941267851e-11, 3.340438855874038e-18, 2.348865199202773e-28, 0.01159254896952727, 0.01160189186572774, 0.007989914162910025, 0.004827692879134487, 0.003899207296839551, 0.003457077406735911, 0.002851634244697865, 0.002459001424322322, 0.003114510279038973, 0.003429346482577326, 0.002405115872701608, 0.002414126155810861, 0.001703872213299496, 0.001074073216118483, 0.001454984782585529, 0.0001463514177289863, 4.21802756432558e-07, 1.428852692282921e-11, 2.730358424026104e-18, 2.324665881112632e-28, 0.01352642209660277, 0.01265137295341102, 0.006183928094916393, 0.004636063537959972, 0.005662493794589177, 0.004340615548320732, 0.004813397450631393, 0.003728501697400749, 0.002601509047042279, 0.002468566918749481, 0.002325245982292405, 0.001663925449175297, 0.001426060548262548, 0.001269214095720177, 0.001222803443292027, 0.0001956001251707829, 4.388108669834529e-07, 1.268309135034609e-11, 1.939632102942453e-18, 3.376043100527521e-28, 0.008725120093994084, 0.01402290246757825, 0.007597031227077061, 0.007476967124058559, 0.005401768366595229, 0.004947763723895104, 0.003476994623865361, 0.003252341891710185, 0.002541123809608684, 0.002301618110687614, 0.002753166059410603, 0.002483466825533177, 0.002138786458610818, 0.001611440423257646, 0.001289508405746014, 0.0001999956735372918, 3.551907710983229e-07, 1.064933690906192e-11, 2.18080068871327e-18, 7.113881637934453e-29, 0.05712937124431784, 0.02546520458556504, 0.006707108376762898, 0.004252202520417254, 0.003939357176586745, 0.006496333692983474, 0.003402408981967592, 0.003404683457721494, 0.002671022932574308, 0.001632223143930889, 0.002214189957253848, 0.00231288698693915, 0.00152683461580695, 0.0007462697994208251, 0.0009694227906387429, 0.0001789935401754278, 2.699242711643346e-07, 6.185645534114516e-12, 1.343385209013793e-18, 1.178261745240797e-28, 0.0004249597739671989, 0.0002387034541178649, 0.000214032743896445, 0.0001855465026926972, 0.0001489001187834474, 0.0001540976063199741, 0.0001109452917883226, 0.0001163655236180586, 9.448305548069383e-05, 8.379421582768522e-05, 8.613708898848596e-05, 0.0001007626306913142, 6.548307795130216e-05, 6.810283988762664e-05, 4.463231556514583e-05, 9.289343644974908e-06, 3.771218022407639e-08, 1.025109759588688e-12, 1.244611585031013e-19, 3.809091772587046e-30, 2.364119966576037e-06, 2.412453868491136e-06, 2.098829035035742e-06, 1.235961724338229e-06, 1.537293134582725e-06, 1.320449298379216e-06, 1.152844602548433e-06, 1.322426456632289e-06, 8.830717446787687e-07, 9.621591560290879e-07, 7.52245780600552e-07, 8.944517763532474e-07, 4.656960636321471e-07, 4.625171483534138e-07, 4.476720014698506e-07, 8.400509184047253e-08, 3.981369721488242e-10, 1.419369667988049e-14, 2.911090282190426e-21, 1.612875952368434e-39, 4.532533369415997e-09, 3.294488552913625e-09, 2.988745382174227e-09, 2.731682975617545e-09, 3.997289987337269e-09, 2.319197972535471e-09, 2.294150949740575e-09, 2.356498710448061e-09, 2.582965488546624e-09, 1.869575743907608e-09, 2.3183561021186e-09, 1.699449627859135e-09, 1.46696517845607e-09, 1.064277394569588e-09, 1.015379019132332e-09, 1.316097651708461e-10, 7.919062650471598e-13, 4.469264340618899e-17, 4.841286533525364e-24, 1.702684325008426e-44, 8.496616076709716e-13, 7.383612198404705e-13, 6.71126544038548e-13, 5.677975571103219e-13, 6.159575961117779e-13, 5.821310103960006e-13, 3.899796905823043e-13, 5.341629393153731e-13, 3.673562398070461e-13, 3.50205095480503e-13, 4.159389269542193e-13, 2.768327025384378e-13, 2.837066516332191e-13, 2.210417595223109e-13, 1.681786784788017e-13, 3.217462565040664e-14, 1.937706727211976e-16, 9.439169827780913e-21, 6.112876872837094e-29, 1.113553024109819e-48]
+      ],
+     "6":[
+      [0.01007075177105201, 0.007679435449384186, 0.005775144739795189, 0.005760444376530434, 0.004317590400199002, 0.003918801720051251, 0.006201085762872734, 0.002908275599702343, 0.003371545577595913, 0.003541578274181544, 0.002596024481134349, 0.002979960269943309, 0.002726321578408713, 0.0022580328117105, 0.002119014128015935, 0.0009278337356903415, 5.678435783492034e-05, 6.152396359040734e-07, 3.732128421201486e-10, 1.574361851266354e-15, 0.006565915854117833, 0.006749063922554306, 0.005550914711153134, 0.005471048685265374, 0.004444954396553465, 0.004371216303260162, 0.003213483700640497, 0.003557056151631997, 0.002887243630029917, 0.003580835895190997, 0.003337064737481146, 0.002914462031805713, 0.002624443423773176, 0.002515919119064662, 0.001820732490910733, 0.0008919814431613761, 6.312274000957182e-05, 5.001049978790554e-07, 3.546860435219956e-10, 5.629049699209795e-23, 0.008068771715578418, 0.007483078410431068, 0.00595564998331628, 0.006897958770511601, 0.005491898196932747, 0.003961265421061983, 0.004249283418699771, 0.003370083471716875, 0.003230555924662874, 0.002911504612669584, 0.002876654589503173, 0.002296959682365129, 0.002388654608493137, 0.002567547968433382, 0.002235142368136882, 0.0006088315278777145, 5.62998159759158e-05, 3.998053472518788e-07, 3.233313073142909e-10, 1.01287011659425e-22, 0.00904958099000706, 0.007874575298466639, 0.006663188500964038, 0.004644734959166266, 0.005548179441994429, 0.00466425554552883, 0.004074136571800831, 0.003578528779085291, 0.003841443400394788, 0.00396170656288166, 0.002837257010546445, 0.002225797470728009, 0.002731291903970338, 0.002328532103230273, 0.002127035331144743, 0.0008577193836265272, 6.594937990884162e-05, 3.64566320885728e-07, 3.143960124824683e-10, 2.723324681086104e-16, 0.008270501303158451, 0.0058075516812405, 0.006290516478383034, 0.006227389519519979, 0.003526953417088546, 0.004369427673383938, 0.00398215366604748, 0.00384516999849933, 0.003323695532852626, 0.003100018467557967, 0.002491826757860063, 0.002458698246968313, 0.003520254378932504, 0.00299821999152618, 0.002394968585037241, 0.0007457278932894816, 4.54678684665413e-05, 3.928243666497782e-07, 4.247368010520067e-10, 2.855995973600265e-15, 0.008767418855596183, 0.008503842387744183, 0.007242012298730964, 0.005088853699474475, 0.00508428413681364, 0.003793043833753429, 0.004045944110225868, 0.004094806567919777, 0.003277303507832303, 0.003821147642206201, 0.00322947697114394, 0.003270686330427579, 0.002439361555488249, 0.002695781325057107, 0.002442994606067773, 0.0008565516000721709, 5.094470087252076e-05, 4.309160832741246e-07, 2.693433719064391e-10, 2.091616323861933e-22, 0.00880821984650447, 0.007217181917938543, 0.005224462113173131, 0.005209966667404198, 0.006086393175469563, 0.00521960454936507, 0.003724336027659715, 0.004287785501816173, 0.003451460776955542, 0.0031021038360319, 0.00268265580373975, 0.002399637100834481, 0.002329412890333954, 0.002378728966744205, 0.001777115965579793, 0.0007192561334212733, 4.04250675084374e-05, 3.80398763903793e-07, 2.822871462889183e-10, 2.010230421076197e-15, 0.009423887879995572, 0.005350780657417396, 0.005541461846301217, 0.004932765512901106, 0.005421030012761664, 0.004558051137544545, 0.003287362867613224, 0.003868762458243791, 0.002886357791806807, 0.003023441213655293, 0.002244047013991696, 0.002857117541935941, 0.002007160875723606, 0.002449888086511225, 0.001973102338621528, 0.0008327285325311887, 3.864512175681854e-05, 4.470796807338302e-07, 2.393980743806982e-10, 5.722447846744619e-15, 0.008611020096466688, 0.007994581806533408, 0.005997216478328227, 0.005623055231602272, 0.004117967524569989, 0.00455435481010508, 0.004965101054483278, 0.003780394599597645, 0.005654405082184348, 0.00280065622126505, 0.001958192839958977, 0.002410040028792601, 0.002448023529114436, 0.00186129374260131, 0.001673326902666445, 0.0009150695376796711, 3.808326539140148e-05, 2.945458178874134e-07, 2.039448265349658e-10, 5.72427793493968e-15, 0.0065383966264727, 0.008604489535846286, 0.005307476169369638, 0.005335050239094654, 0.00482139419851879, 0.003990828766997559, 0.003416736521850526, 0.004081057971761245, 0.002710135301506905, 0.003015178750301484, 0.002139100667306713, 0.002557743392924308, 0.002571585787511028, 0.001980987197300931, 0.002482837938215657, 0.000858074724581941, 4.257636509567112e-05, 3.311356093499764e-07, 2.391304218469288e-10, 1.843071451980229e-15, 0.008479319098163777, 0.004632754281959055, 0.00578418225559193, 0.005676698109881401, 0.004752195821319839, 0.003942295689527979, 0.003545921195664039, 0.002873367744043781, 0.003142425850284462, 0.002693764430653066, 0.002647202903298447, 0.00267097821995187, 0.002639342163811151, 0.001742953028640425, 0.001785105402863016, 0.0005657734591964618, 3.504629115942573e-05, 3.251247734029286e-07, 1.976076404289253e-10, 3.076657513546872e-22, 0.007868977607707319, 0.007058972278863845, 0.005521553395713467, 0.004150413692232405, 0.004716926533836758, 0.003396480981735096, 0.003821408621038236, 0.002950952659920484, 0.003334276570625476, 0.002985771228525388, 0.003142467131439691, 0.001927946543415294, 0.0024109251084699, 0.00224312505278434, 0.002038001689691611, 0.0006319648540229275, 3.544633788533751e-05, 2.821803433190523e-07, 2.854217590507013e-10, 2.406390294931704e-15, 0.008812141932362757, 0.00924999592362412, 0.006681280740192525, 0.004234058093139497, 0.003586639799625327, 0.003335104826992427, 0.002885212702246787, 0.002609282508428206, 0.003465972209433617, 0.004002343249927425, 0.002943752536960888, 0.003098719400142185, 0.002293564561485211, 0.001589992713310502, 0.002504600451027895, 0.0007217561538117381, 3.509567091145855e-05, 2.548700568803688e-07, 2.279303010907167e-10, 2.327087787658216e-15, 0.009813870497310606, 0.009627316090915293, 0.004935565103168491, 0.003880801302077938, 0.00497134645949398, 0.003996746133949748, 0.004648261996574264, 0.003776169967368083, 0.002763220357301185, 0.002749810388085673, 0.002716370974699324, 0.002038501547096592, 0.001832174412583298, 0.001793292161660172, 0.002009053974108771, 0.0009206997355158446, 3.484811539278794e-05, 2.159360859630404e-07, 1.545633052113561e-10, 3.226677613116858e-15, 0.005878942979200086, 0.009910052070592708, 0.005631016758160458, 0.005812566817669467, 0.004404257615104983, 0.004230918557349961, 0.003118267536834961, 0.003059030937405465, 0.002506608460824422, 0.002381012176779293, 0.002986916646076151, 0.002825570018010371, 0.002551918593317788, 0.002114467369479283, 0.001967568000282812, 0.0008742602343434506, 2.619622723345308e-05, 1.683895894319963e-07, 1.614182045488214e-10, 6.317534781406597e-16, 0.02296868007524162, 0.01073826183958844, 0.002966381966393084, 0.001972446884107986, 0.001916509871129766, 0.003314690958822308, 0.00182072746306312, 0.001910792651464394, 0.00157212660524389, 0.001007528156400208, 0.001433358987852677, 0.001570187883288234, 0.001087028647686847, 0.0005842953455806759, 0.000882610382744977, 0.0004668875465416564, 1.187960046629219e-05, 5.838250227298793e-08, 5.940719764400224e-11, 6.265935124387599e-16, 4.263758000008484e-05, 2.511966780563177e-05, 2.362330130587278e-05, 2.147894964264881e-05, 1.807798076383155e-05, 1.962185608107217e-05, 1.481620892302492e-05, 1.629788580810414e-05, 1.387823692010848e-05, 1.290810621554953e-05, 1.391558584278589e-05, 1.707136729623588e-05, 1.163456326756446e-05, 1.330683144869819e-05, 1.014097240290093e-05, 6.047130247436536e-06, 4.142972267450699e-07, 2.416977521329715e-09, 1.378286157013269e-12, 5.103789028429522e-18, 1.683775374719994e-08, 1.802126043432125e-08, 1.644407530149264e-08, 1.015636744078967e-08, 1.324908233743947e-08, 1.193551892188661e-08, 1.092887711360029e-08, 1.314789500737686e-08, 9.207788595074168e-09, 1.052145115401988e-08, 8.62685667174905e-09, 1.075743092735584e-08, 5.873645473868881e-09, 6.41540659676287e-09, 7.220738581088132e-09, 3.882409401063403e-09, 3.106513341177179e-10, 2.38049044753018e-12, 2.30370625291619e-15, 1.561909764968668e-28, 4.89050629853306e-13, 3.728340576696139e-13, 3.547529650382275e-13, 3.400726685652022e-13, 5.219226920659189e-13, 3.175939398097638e-13, 3.294920963942757e-13, 3.549552541668708e-13, 4.080403940641875e-13, 3.097423076032436e-13, 4.028146660491916e-13, 3.09667653027605e-13, 2.803267336038917e-13, 2.236650440676185e-13, 2.481468758851778e-13, 9.218002766361514e-14, 9.371620112680589e-15, 1.139711583807941e-16, 5.866219703881099e-20, 2.567270020758567e-35, 2.632631504163212e-19, 2.399580012139762e-19, 2.287640940693205e-19, 2.02996643509426e-19, 2.309685506621168e-19, 2.28941363663738e-19, 1.608576851252776e-19, 2.310812272317223e-19, 1.666726010139388e-19, 1.666402546112234e-19, 2.075689938677209e-19, 1.44884038021167e-19, 1.55717593311157e-19, 1.334310342552543e-19, 1.180636329976038e-19, 6.476093872066329e-20, 6.598880672843824e-21, 6.951558929504106e-23, 2.158096533113038e-27, 4.991433027939574e-42]
+      ],
+     "7":[
+      [0.009906233305050815, 0.007124195981245325, 0.005052858816585362, 0.004753416086536389, 0.00336027382034604, 0.002876588491086253, 0.004293300080462555, 0.001899179295249243, 0.002076702038190362, 0.002057617266618413, 0.001422679209302554, 0.001540447787947973, 0.001329412502350759, 0.0009797806582136801, 0.0007640341356491938, 9.199070303514822e-05, 1.772193267458519e-07, 2.776897143552728e-12, 6.207303892702094e-20, 2.294060801769745e-31, 0.006641483888560588, 0.006438330330211664, 0.004994154732747198, 0.004642410833482347, 0.003557326141327724, 0.003299513339083892, 0.002287824714711645, 0.002388604594913192, 0.001828738956159658, 0.002139317749097024, 0.001880554622101272, 0.00154923758179119, 0.001315960938608214, 0.001122582786260205, 0.0006750689165390713, 9.093943816522602e-05, 2.025761254757216e-07, 2.321054178757541e-12, 6.065464561232199e-20, 8.431973213980336e-39, 0.008392628210404554, 0.007340586398213542, 0.005509946088512053, 0.006018861201757468, 0.004519595761985149, 0.003074696627751294, 0.003110878709642221, 0.002327099379987346, 0.002104099502888674, 0.001788665288030756, 0.001666977556472158, 0.001255549102794147, 0.001231628815288099, 0.001178042487147617, 0.0008521730868796769, 6.382838348480659e-05, 1.857920152450733e-07, 1.908002247992235e-12, 5.685110275518074e-20, 1.559693730832749e-38, 0.009679153269925226, 0.007943208060005149, 0.006338968908094557, 0.004167475047763197, 0.004695111909595278, 0.003722793931647017, 0.003067053078665428, 0.002540955806274255, 0.002572774774955308, 0.002502719723257066, 0.00169067068285963, 0.001251077682376388, 0.001448147828040547, 0.001098608354035423, 0.0008339030765030259, 9.246551561070346e-05, 2.237927615077177e-07, 1.78900120622998e-12, 5.683775984318864e-20, 4.310960940035536e-32, 0.009096130109257704, 0.006023900845591648, 0.006153734554023647, 0.005745582082019615, 0.003069100442438028, 0.003586139186755636, 0.003082617546988143, 0.002807527772344639, 0.002288993068746366, 0.002013771086399643, 0.001526841979078151, 0.001421084034453751, 0.001919263996835718, 0.00145458811965559, 0.0009655094661270246, 8.266666400732659e-05, 1.586546329281982e-07, 1.982138121291604e-12, 7.894892598881495e-20, 4.647495923372608e-31, 0.009915397080293707, 0.009070128918625936, 0.007284927562447459, 0.004827935853983543, 0.004549406178434528, 0.003201134833137765, 0.003220586930072938, 0.003074364939394109, 0.002320883890311206, 0.002552425883683386, 0.002034800964435749, 0.001943868642533504, 0.001367572397289358, 0.001344852539279367, 0.001012727630035575, 9.763748901293716e-05, 1.827921833415302e-07, 2.235770433055013e-12, 5.147503613479316e-20, 3.498870532900889e-38, 0.01024324641921599, 0.007915475857773881, 0.005404041574501682, 0.005082619364084378, 0.005600103038388581, 0.004529651793019921, 0.003048422181376206, 0.003310291073455803, 0.002513337394338635, 0.002130721786783349, 0.001738064084948578, 0.001466508781669709, 0.001342862977849452, 0.001220242162343876, 0.0007575249609359562, 8.430576719825962e-05, 1.491479855984807e-07, 2.029411948509222e-12, 5.546807892712974e-20, 3.456796206786966e-31, 0.01126907568633414, 0.006034415842932783, 0.005894000306175543, 0.004948252135920468, 0.00512892715838394, 0.004067383411650895, 0.002766830787798742, 0.003071240965083665, 0.00216125846144774, 0.002135406844468498, 0.00149500092853582, 0.001795460607527716, 0.001189805783582806, 0.001292278032846025, 0.0008648472532574048, 0.0001003657162274572, 1.466111319033193e-07, 2.452507026101088e-12, 4.836508427449085e-20, 1.011555058350511e-30, 0.01058812572154081, 0.009270862467964639, 0.006559063454994983, 0.005800160317845275, 0.00400621205446621, 0.004178968284832939, 0.004297039410995161, 0.003085924152820012, 0.004353612201233296, 0.002033972988023398, 0.001341439962491023, 0.00155732155177036, 0.001492161182016626, 0.001009557070799921, 0.0007541831124836883, 0.0001134075227065743, 1.485626602766198e-07, 1.661383914235362e-12, 4.236243187681284e-20, 1.040173542202405e-30, 0.008266842051419917, 0.01026014242745525, 0.005968759086228292, 0.005658613752190183, 0.004823114184996723, 0.00376538329608469, 0.003040581266209287, 0.003425506170652538, 0.002145644011029373, 0.002251657387721014, 0.001506783536011707, 0.00169947532787228, 0.00161177722447077, 0.00110484526314595, 0.001150663095069115, 0.000109349370919316, 1.707830965805138e-07, 1.920491716597827e-12, 5.106902116252699e-20, 3.442724980931459e-31, 0.0110237876346317, 0.005680270603145371, 0.006688665013439772, 0.006191114191555445, 0.004888219589212979, 0.003824694631483173, 0.003244708416020692, 0.00247995995710582, 0.002558192349807457, 0.002068475187662394, 0.00191738057887468, 0.001824860553391849, 0.001700987533268409, 0.0009995554554798236, 0.0008506777364003699, 7.413695653693441e-05, 1.445495596227496e-07, 1.938847385965613e-12, 4.338889282010189e-20, 5.907613038458139e-38, 0.0105193096249116, 0.008899596270074799, 0.006565349071569563, 0.004654397491469393, 0.004989012087477211, 0.003388252913915878, 0.003595581469765159, 0.00261887490330464, 0.002791057786432938, 0.002357470547321866, 0.002340404243942514, 0.001354419998948142, 0.001597674048341348, 0.001322737623048772, 0.0009986302603286294, 8.514981364860583e-05, 1.50328760984686e-07, 1.730234347803819e-12, 6.443349124181156e-20, 4.749734560565974e-31, 0.01211287038684974, 0.01199132096946374, 0.008168699554835712, 0.004882312237146484, 0.003900675840315915, 0.003420997624675172, 0.002791387549504721, 0.002381059550954802, 0.002983245005627263, 0.003249381564685098, 0.002254332952666883, 0.002238397654779086, 0.001562831098586255, 0.000964077512437639, 0.001261929824155172, 9.999480835023917e-05, 1.530445402928498e-07, 1.606864268829351e-12, 5.290223447670646e-20, 4.721544462776132e-31, 0.01426237943826655, 0.01319522481504683, 0.006379933644464397, 0.004731253486230879, 0.005716262910561962, 0.004334469080508555, 0.004754654408874229, 0.003643231228175114, 0.002514579694794173, 0.002360343208345481, 0.002199337394553212, 0.001556868888932972, 0.001319939052894426, 0.00114961872007878, 0.001070222930801053, 0.0001348621566847684, 1.606658332052641e-07, 1.439271760954395e-12, 3.791979053603889e-20, 6.917608084566596e-31, 0.009333352358278226, 0.01483796180887925, 0.007951569215380847, 0.007741221784880086, 0.005532196710990343, 0.005012457904712793, 0.00348440354610401, 0.003224079746443293, 0.00249185676864454, 0.002232650265954753, 0.002641876644762898, 0.002357402302331192, 0.00200835505500989, 0.001480779273241781, 0.00114498254245533, 0.0001398936655932645, 1.3193499683721e-07, 1.225952918191408e-12, 4.324566982473243e-20, 1.478179638770862e-31, 0.06759243024825944, 0.02980272027296012, 0.007764557004391508, 0.004869343631871397, 0.00446230725946258, 0.007279181840355428, 0.003771233270936838, 0.003733006647290517, 0.002896991943717105, 0.001751214550096109, 0.002349997302565824, 0.002428298487301591, 0.00158575953738465, 0.000758479914013982, 0.0009520500988162296, 0.000138478642065226, 1.108866554170725e-07, 7.873123906504672e-13, 2.942848279269024e-20, 2.699953055645118e-31, 0.0006606478983281986, 0.0003670720292354671, 0.0003255709481246489, 0.0002791859228974893, 0.000221622367361922, 0.0002268792218141979, 0.0001615810694643098, 0.0001676452239039346, 0.000134650672841029, 0.0001181296364075501, 0.00012012343195707, 0.000139005582121399, 8.936336598128677e-05, 9.094912067831657e-05, 5.759447707999901e-05, 9.442958709634985e-06, 2.035296063641803e-08, 1.712827335118428e-13, 3.571191187834057e-21, 1.138072093466648e-32, 6.243849713010698e-06, 6.302507355706794e-06, 5.42381995575259e-06, 3.159435723572424e-06, 3.887227309964772e-06, 3.302829631055792e-06, 2.852455326094477e-06, 3.236724206071322e-06, 2.138054093612409e-06, 2.304414494699199e-06, 1.782242812264589e-06, 2.096331315333972e-06, 1.079701954652517e-06, 1.049380938775457e-06, 9.814426712558467e-07, 1.450782127632109e-07, 3.649705229296893e-10, 4.023148353943999e-15, 1.411315384490529e-22, 8.07404799441636e-42, 2.859087710726333e-08, 2.055650372886117e-08, 1.844706720729644e-08, 1.667816459871904e-08, 2.414157209203478e-08, 1.385549457963094e-08, 1.355791492066778e-08, 1.377612933671125e-08, 1.493723063761988e-08, 1.069518778245161e-08, 1.31196348827122e-08, 9.513680104944269e-09, 8.123834856600898e-09, 5.767735787322708e-09, 5.317239004663911e-09, 5.429693767195457e-10, 1.733977400065792e-12, 3.021172710182701e-17, 5.566035068881794e-25, 1.996166092107583e-46, 1.959495250591664e-11, 1.684417982412812e-11, 1.514504183548433e-11, 1.26749703613985e-11, 1.360172284905445e-11, 1.271615509609392e-11, 8.42696809759825e-12, 1.14182538492911e-11, 7.768054207384392e-12, 7.325688998338041e-12, 8.607144199754259e-12, 5.666993381758128e-12, 5.74530301038877e-12, 4.38067350075454e-12, 3.220819244568327e-12, 4.855839077739034e-13, 1.552592716954381e-15, 2.331949385020566e-20, 2.55176821541983e-29, 4.664658921594601e-50]
+      ],
+     "8":[
+      [0, 0.001285363492447815, 0.00189563099167766, 0.002781035947380694, 0.002725231394811988, 0.003031810143444441, 0.005645190628716967, 0.003028853729621361, 0.003935074516319133, 0.004560019398453133, 0.003641947453322011, 0.0045095142604056, 0.004413577972641928, 0.004101237981100975, 0.004438006334067853, 0.002896633699207219, 0.0001425258053002563, 3.971583266788669e-07, 1.757180946811877e-11, 1.720018935033526e-18, 0, 0.00116161806651876, 0.001873607564513712, 0.002716091167949061, 0.002885043735794183, 0.003477556184623231, 0.003008223641978947, 0.003809400239357, 0.003465217491634191, 0.00474108128667802, 0.004814072854543577, 0.004535245742148204, 0.004368919730993502, 0.004698989969277355, 0.003921238995654125, 0.002863532736816944, 0.0001629191885942581, 3.319679976762422e-07, 1.717116052130169e-11, 6.322762571368004e-26, 0, 0.001324405139698273, 0.002067111900785799, 0.003521397907561577, 0.003665458546417038, 0.003240608314525022, 0.004090444050719453, 0.003711310402783007, 0.0039869892504983, 0.0039639776579284, 0.004267332406225167, 0.003675500793654669, 0.004088941810032282, 0.00493113762183914, 0.004949975633196098, 0.002009851516027374, 0.0001494213218643183, 2.72895812171699e-07, 1.609520615716544e-11, 1.169677899591915e-25, 0, 0.001433131497948284, 0.002378128182838575, 0.002438225015427338, 0.003807804737244212, 0.003923677200930976, 0.004032818482981732, 0.004052373501763872, 0.004875066777877635, 0.005546440352413213, 0.004327985103585253, 0.003662411283178347, 0.004807773588213221, 0.004598636642991176, 0.004843852021801322, 0.002911589630039649, 0.0001799836721957525, 2.558795959096038e-07, 1.609224538690546e-11, 3.233331982951852e-19, 0, 0.001086845765116099, 0.00230863564603262, 0.003361513104790769, 0.002489085558599792, 0.003779648543613997, 0.004053283992501406, 0.004477508537623852, 0.004337338189000358, 0.004462849512659859, 0.003908596522199663, 0.004160088920508371, 0.006371854452412412, 0.006088723645241819, 0.005608308180096004, 0.002603041056230573, 0.0001275972663185962, 2.835084165534797e-07, 2.23536236315436e-11, 3.486136842802471e-18, 0, 0.001636453098187849, 0.002733014124371734, 0.002824634551318518, 0.003689635275947753, 0.003373869237615379, 0.004234697744869866, 0.004903066529812947, 0.004397767146517777, 0.005656597695260617, 0.005208932112358592, 0.005690491561493913, 0.004540267872448067, 0.005629384608039593, 0.005882582619356985, 0.003074450061874712, 0.0001470102999923959, 3.197910138376562e-07, 1.457539569473868e-11, 2.624837603586093e-25, 0, 0.001428127990519331, 0.002027380756373897, 0.002973639815590381, 0.004541765885240982, 0.004774073483770889, 0.004008321132090291, 0.005279326915588261, 0.004762441094181134, 0.00472203181367542, 0.004449308923770656, 0.004293065881732286, 0.004458234104458893, 0.005107781460451053, 0.004400199481035765, 0.002654656657766169, 0.0001199524331209424, 2.902794229696931e-07, 1.570683839310696e-11, 2.593566850559346e-18, 0, 0.001088742903426919, 0.00221119372062131, 0.002895026860156048, 0.004159635330148745, 0.004286860949586683, 0.003638061181711617, 0.004898084465294556, 0.004095298269113162, 0.004732414779053698, 0.003827086247754539, 0.005256041449624407, 0.003950092476176509, 0.005409314948403573, 0.005023597879636692, 0.003160360995144566, 0.0001179125783424831, 3.508029806084896e-07, 1.369618227805693e-11, 7.590357824545857e-18, 0, 0.00167266989497416, 0.002460698874036832, 0.003393444686495388, 0.003249096880837197, 0.004404467002583562, 0.005650107862643896, 0.004921501598207544, 0.008249518094845865, 0.004507620667783073, 0.003433982193867609, 0.004558911993452003, 0.004953896659655852, 0.004225880444586057, 0.004380788645273455, 0.00357102916445833, 0.0001194825191153604, 2.376457094253479e-07, 1.199693652256906e-11, 7.805981735145878e-18, 0, 0.001851158012823244, 0.002239240228695997, 0.00331063138184361, 0.003911616524952386, 0.003968564824234394, 0.00399801132467839, 0.00546307473091451, 0.004065711075818311, 0.004990045410362079, 0.003857249006477927, 0.004975053925760098, 0.005351015838627034, 0.004624745233529575, 0.006683804213627762, 0.003443245973007439, 0.0001373539312688046, 2.747130954079976e-07, 1.446334952390148e-11, 2.583884002729807e-18, 0, 0.001024847218922635, 0.002509320202385576, 0.003622176352382334, 0.003964417968125813, 0.004031076633239775, 0.004266414849101904, 0.003955096275439601, 0.004847435573797458, 0.004584083422200393, 0.004908345712486986, 0.005342107522761499, 0.005647189594637907, 0.004184015382629062, 0.004941293373001023, 0.002334461610137293, 0.0001162557612913864, 2.773431749334389e-07, 1.228886454605671e-11, 4.434366935715741e-25, 0, 0.001605685206690931, 0.002463056978599735, 0.002723104111958809, 0.004046162167287939, 0.003571084359284478, 0.004727772199889922, 0.004176641009683778, 0.005288684788418451, 0.005224545066515296, 0.005991253651109511, 0.003964937188928756, 0.00530419442029896, 0.005536816209850843, 0.005800699004688145, 0.002681241335615079, 0.0001209041712798831, 2.475059852164409e-07, 1.825015953761955e-11, 3.565642369334223e-18, 0, 0.002163501138987182, 0.003064570092600253, 0.002856448022672178, 0.003163505465677305, 0.003605595992546495, 0.003670350572830324, 0.003797367726548623, 0.005652854173120064, 0.007201167670418974, 0.00577091793139904, 0.006552698832856285, 0.005188517822916276, 0.004035509515786601, 0.00733011601898489, 0.003148689787761489, 0.0001230887996875376, 2.298618377425811e-07, 1.498479484256832e-11, 3.544878308915278e-18, 0, 0.002380712176000402, 0.002393496495945099, 0.002768069504162909, 0.004635973267422613, 0.004568358728809602, 0.006251818609179209, 0.005810307784320844, 0.00476479557072882, 0.005230911586199851, 0.005630133772440836, 0.004557587629252691, 0.004382129162982503, 0.004812162571108119, 0.006216557621400344, 0.004246615637291465, 0.0001292192408274664, 2.058942656811011e-07, 1.074202591148689e-11, 5.194821890941194e-18, 0, 0.002677098469186413, 0.002983111416423056, 0.004529083002686337, 0.004486692837613203, 0.005282932073467928, 0.004581586189185363, 0.005141835549000388, 0.004721738733957283, 0.004947923039885395, 0.006763000389501506, 0.006901074565566768, 0.006667635148147057, 0.006198360747410312, 0.006650812053750252, 0.004405057370806887, 0.0001061129317688019, 1.753868306498119e-07, 1.225269723769673e-11, 1.110443023817911e-18, 0, 0.005377073467815788, 0.002912951503006424, 0.002848860054675874, 0.003618996018793627, 0.007671967632333349, 0.004958732920266064, 0.005953482569345249, 0.005489415404642958, 0.00388098129619023, 0.006015811584703766, 0.007108616871127798, 0.005264640636605048, 0.003174905339364599, 0.005530138626860587, 0.004360540294723388, 8.919045332449602e-05, 1.126726198240208e-07, 8.347000209842534e-12, 2.033254293579129e-18, 0, 6.62279209232585e-05, 0.0001221410825098784, 0.0001633403793735288, 0.000179738617570016, 0.0002391211168800436, 0.0002124597526679884, 0.000267363586596716, 0.0002551443666132546, 0.000261793959818947, 0.0003075056429764858, 0.000406924397095718, 0.0002966807301907308, 0.0003807006534143736, 0.0003345458369530131, 0.0002973517771638089, 1.637324335102452e-05, 2.45330102726188e-08, 1.015753607228956e-12, 8.625327475089328e-20, 0, 1.137109083488131e-06, 2.034788610997601e-06, 1.848444821763488e-06, 3.15256255925786e-06, 3.481003252421058e-06, 3.750586724237287e-06, 5.161905970813245e-06, 4.051246356178824e-06, 5.10684981306139e-06, 4.562293520171068e-06, 6.136654854744447e-06, 3.584456607724837e-06, 4.392448491244872e-06, 5.700677251486914e-06, 4.568249160972127e-06, 2.936518763498306e-07, 5.769861681445586e-10, 4.033283345304306e-14, 6.188377745674617e-29, 0, 3.708810547576423e-09, 6.920455503058581e-09, 9.757426351732634e-09, 1.957835426622158e-08, 1.460239201727794e-08, 1.782599949058404e-08, 2.196894477367202e-08, 2.830183970860561e-08, 2.370023198238382e-08, 3.35820288569044e-08, 2.784750835041786e-08, 2.696769306932683e-08, 2.413997402365043e-08, 3.088144557458901e-08, 1.709356143431494e-08, 1.394940637220113e-09, 4.338030209996696e-12, 1.600118346124024e-16, 1.553582972030811e-33, 0, 3.038976004264935e-12, 5.681485634608144e-12, 7.414984077685328e-12, 1.102993712704682e-11, 1.340042528871496e-11, 1.107861632460905e-11, 1.820653649278336e-11, 1.471617796814275e-11, 1.623093313170358e-11, 2.20276309324317e-11, 1.658466925235833e-11, 1.906798568775649e-11, 1.833021010036501e-11, 1.870041446906087e-11, 1.527794925096121e-11, 1.247816144961126e-12, 3.348372883249188e-15, 7.374034209594613e-21, 3.691666850741376e-37]
+      ],
+     "9":[
+      [0.008849984830289589, 0.006543617056942272, 0.00477160822999116, 0.004615051967382193, 0.003354178182068483, 0.002952075376292025, 0.004529776070500563, 0.002060083292728435, 0.002315921652552699, 0.002359079976228878, 0.001676914727725447, 0.001866699582309726, 0.001656182473430324, 0.00129006563716287, 0.001098351157236827, 0.0002441640891475004, 2.448156637011505e-06, 8.917840944057276e-10, 2.908305557497415e-15, 1.121366855039252e-23, 0.005930571274920123, 0.005910887654407382, 0.004713972465910689, 0.004505176062175765, 0.00354921720662024, 0.003384519542504322, 0.002412713035452883, 0.002589765924326502, 0.002038444198548941, 0.002451606709494263, 0.002215579744888392, 0.001876475559893213, 0.001638660054465697, 0.001477402300302192, 0.0009700050948260415, 0.0002412613025353601, 2.797142259214753e-06, 7.450509330809994e-10, 2.840589497659918e-15, 4.119927068706988e-31, 0.007490776533792798, 0.006736086494794034, 0.005198401844489384, 0.005838213549593526, 0.004507190757740846, 0.003152440234534203, 0.003279166401466164, 0.002521904483200697, 0.0023442873297261, 0.002048811686551159, 0.001963037720807089, 0.001520043619497433, 0.001532932993197624, 0.00154966852470579, 0.001223914814526478, 0.0001692570690431299, 2.56419787175629e-06, 6.121817040361448e-10, 2.661280840184682e-15, 7.617582775374589e-31, 0.00863502685038941, 0.007285683608834466, 0.005977761575070157, 0.00404050943973508, 0.004680042151008505, 0.003815145084684121, 0.00323146264823485, 0.002752379328530602, 0.002865126551424005, 0.002865382836307149, 0.001990010604003653, 0.001513924104575832, 0.001801580646304894, 0.001444502305894573, 0.001197116578073812, 0.0002450814008345309, 3.087228259402662e-06, 5.737370525477277e-10, 2.65947674718599e-15, 2.104599754042193e-24, 0.0081111134344887, 0.005522677332164099, 0.005800376876714376, 0.00556794116779697, 0.003057823440807726, 0.003673387050558991, 0.00324634733076055, 0.003039714023242504, 0.00254790956570685, 0.00230450700541571, 0.001796337577497925, 0.001718846456288214, 0.002386563667422704, 0.001911669803868247, 0.001385399142857924, 0.0002190072926104777, 2.187629137910165e-06, 6.353850626247682e-10, 3.692435565055182e-15, 2.267942514627774e-23, 0.008837540664177423, 0.008311565240212147, 0.006863413978623142, 0.004676485578407775, 0.004530577055596533, 0.003277487329966927, 0.003390063785573446, 0.003327067346070594, 0.002582203432662704, 0.002919567910043399, 0.002392838066898143, 0.002350075147824641, 0.001699754304082235, 0.001766627678136865, 0.001452474659187629, 0.0002585487187387536, 2.519282180366164e-06, 7.163596865446291e-10, 2.406416720350007e-15, 1.7067052330669e-30, 0.009125495469314151, 0.007250098486654106, 0.0050889848541424, 0.004920884991432626, 0.00557432578278375, 0.004635529975218843, 0.003207343534728888, 0.003580716023648477, 0.00279502281883146, 0.002436069724126498, 0.002042935652526385, 0.001772135939465518, 0.001668265063937212, 0.001602189662910739, 0.001085951416936421, 0.0002231416878078493, 2.054635836612832e-06, 6.499426024228795e-10, 2.591939145975743e-15, 1.685474052791985e-23, 0.01003470625381172, 0.005524584842469682, 0.00554779195414567, 0.004788560569302163, 0.005102939234441876, 0.004160516286476683, 0.002909715343551441, 0.003320589025540422, 0.002402364006214214, 0.002440288314972187, 0.00175641811802972, 0.002168631651069912, 0.001477430218110243, 0.001695982677180011, 0.00123922571990045, 0.0002655256460986904, 2.018750759499072e-06, 7.850836529821139e-10, 2.259025568282879e-15, 4.930097311321513e-23, 0.009423950746445449, 0.008483637465326257, 0.006170912600272122, 0.005610359789687526, 0.003984055235402047, 0.004272663998075028, 0.004516840919165763, 0.003334909391826465, 0.004837036933882065, 0.002323289066271696, 0.001575270881640312, 0.001880120849941842, 0.001852013731687085, 0.001324322909749665, 0.0010801532748282, 0.0002998890601921639, 2.044672381781778e-06, 5.315897236935522e-10, 1.977778374315822e-15, 5.067449889885545e-23, 0.00735446563411738, 0.009384538437649815, 0.005612924214744719, 0.005470894401492061, 0.004794204198734633, 0.003848012066784965, 0.003194623206667016, 0.003700165206595376, 0.002382785242466633, 0.002570738779542068, 0.0017686115032174, 0.002050783958564957, 0.001999544422162376, 0.001448645285030274, 0.001647230433267797, 0.0002890232212851563, 2.349401655357319e-06, 6.142143146194433e-10, 2.383207395131468e-15, 1.676500580778663e-23, 0.009802568821881116, 0.005193093388003875, 0.006286981085323871, 0.005982940391290479, 0.004856655204472577, 0.003906803620499434, 0.003407503297328242, 0.002677556311878266, 0.002839605534686773, 0.002360497486767714, 0.002249507738914802, 0.002201062228786759, 0.00210923400790517, 0.00130998127961668, 0.001217219340772338, 0.0001958614229100657, 1.987593184924958e-06, 6.198006943885686e-10, 2.023906549933293e-15, 2.875617762273217e-30, 0.009349618545068846, 0.008132517471952131, 0.006168195397473167, 0.004495799400302223, 0.004954487254814731, 0.003459379687857695, 0.003774221110391236, 0.002826222152474548, 0.003096643750087395, 0.002689039010864113, 0.002744527877736455, 0.001632877479618478, 0.001980201663465152, 0.001732724484131764, 0.001428256199278096, 0.0002248513873853126, 2.06609914935994e-06, 5.528589150030498e-10, 3.004216000428896e-15, 2.311033381116298e-23, 0.01076096774353922, 0.0109526531125541, 0.007670979640171212, 0.004713750724952068, 0.003871877667815556, 0.00349118442649941, 0.002928707183168578, 0.002568380774487687, 0.003308330976295534, 0.003704666795365821, 0.002642362785148064, 0.002697336322919196, 0.001936113903974274, 0.001262308137690605, 0.001803990441390181, 0.0002639289644820121, 2.102448138643415e-06, 5.132034334284368e-10, 2.465477989721739e-15, 2.296353508569423e-23, 0.01265876953273418, 0.01204104965294428, 0.005985622424376523, 0.004563652095219911, 0.005668774925720738, 0.004419276573367124, 0.004983908116904277, 0.003926188506026741, 0.002785997322006475, 0.002688554605769383, 0.002575499743548103, 0.001874326175305238, 0.001633683839956731, 0.001503843145361502, 0.001528511042569404, 0.0003556273915975073, 2.205097327983752e-06, 4.592563346475803e-10, 1.765665142567361e-15, 3.361601611082815e-23, 0.008271695288642604, 0.01352007691716851, 0.00744909240385868, 0.007455953423641398, 0.005478125779943869, 0.005102974298948464, 0.003647009477187926, 0.003469345600949164, 0.002756739621022652, 0.00253934547747833, 0.003089154154947825, 0.002833898115162228, 0.002482058617883878, 0.001934178094261458, 0.00163286635484331, 0.0003683502119751071, 1.808106695517801e-06, 3.90619789415304e-10, 2.01082508177448e-15, 7.17363137424701e-24, 0.05928681756757356, 0.0268759636881494, 0.007198971329009975, 0.004641596291430962, 0.004373177902992267, 0.007334297587218179, 0.003906566204242551, 0.003975611460766301, 0.003171928428266594, 0.001971260000419168, 0.002719555422949213, 0.002889057268638958, 0.001939601341362831, 0.0009805143039234448, 0.001343740786680341, 0.0003608709932050489, 1.504056760772446e-06, 2.483172974348867e-10, 1.354963882943728e-15, 1.298144482552839e-23, 0.0005633787809508228, 0.0003218324757574631, 0.0002934742033811225, 0.0002587385175976296, 0.0002111650322101706, 0.0002222498834120019, 0.0001627321110127584, 0.0001735831166524118, 0.0001433362019862797, 0.0001292810435129678, 0.0001351543026177798, 0.0001607896503097672, 0.0001062690049452611, 0.0001143090720755083, 7.903320277316942e-05, 2.392532034382351e-05, 2.684325592670183e-07, 5.254839862826157e-11, 1.600917305048032e-16, 5.335261670187071e-25, 5.035008054925411e-06, 5.225279746593529e-06, 4.623251223233072e-06, 2.768824189328176e-06, 3.502410141403487e-06, 3.059511029969437e-06, 2.716571024677599e-06, 3.169143045263567e-06, 2.152218393107633e-06, 2.384829403096021e-06, 1.896226554954415e-06, 2.293018020321785e-06, 1.214152349488625e-06, 1.247207264813773e-06, 1.27355815024333e-06, 3.476120115963914e-07, 4.553017251733315e-09, 1.168370848495298e-12, 6.000319425509834e-18, 3.600218915829192e-34, 2.08784536406389e-08, 1.543367280003346e-08, 1.423948133698271e-08, 1.3236083957343e-08, 1.96978503228438e-08, 1.162291210103501e-08, 1.169292233700647e-08, 1.221496465065379e-08, 1.361656397432819e-08, 1.002341923546982e-08, 1.264086695122425e-08, 9.423861094856906e-09, 8.273022888485609e-09, 6.207930735618427e-09, 6.248558054873301e-09, 1.178262878347796e-09, 1.959856761957814e-11, 7.960053513449783e-15, 2.154073354656077e-20, 8.144048062699716e-39, 1.202341890164805e-11, 1.062634168920646e-11, 9.823182022720861e-12, 8.452285019629608e-12, 9.325330358468975e-12, 8.963278663287756e-12, 6.10690073490884e-12, 8.507173333917811e-12, 5.950199909959107e-12, 5.768981561451193e-12, 6.96849119668404e-12, 4.716925551748014e-12, 4.916358315436402e-12, 3.961985748545111e-12, 3.180502560456125e-12, 8.855572018385712e-13, 1.475605765709331e-14, 5.177143484589051e-18, 8.364976063809822e-25, 1.626121257968957e-42]
+      ],
+     "10":[
+      [0, 2.579110030841742e-09, 1.573502792266655e-08, 5.370734802535023e-08, 9.673013581669395e-08, 1.738037255359053e-07, 4.816187629066818e-07, 3.634378534069256e-07, 6.371653149278524e-07, 9.653078048337989e-07, 9.830502784496669e-07, 1.52096646388944e-06, 1.829178843631179e-06, 2.465379982685949e-06, 4.437052027139727e-06, 2.96757493058156e-05, 4.717141012542945e-05, 9.583579289399784e-06, 7.314425054095748e-08, 2.745915075661573e-12, 0, 0.0001320163854108802, 0.0002174787801325181, 0.0003220089618210835, 0.0003493602731716987, 0.0004301356884378032, 0.0003800711508143795, 0.0004916416462600697, 0.0004568505885151905, 0.000638539288308929, 0.0006623764011117317, 0.0006375158095341944, 0.0006274493050701251, 0.0007045138968879358, 0.0006296833682880189, 0.0007544555204826506, 0.0001940778065534423, 1.069144267588191e-05, 7.481898074170121e-08, 1.005997846477591e-19, 0, 0.0002943985600396417, 0.0004692898451986101, 0.0008165038330502625, 0.0008680430993903586, 0.0007838149540886378, 0.001010499126122543, 0.0009364314310405373, 0.001027500397675645, 0.001043425993486766, 0.001147323820863462, 0.001009371359288092, 0.001146981504488839, 0.00144322507201151, 0.00155000109851414, 0.001016044788387379, 0.0003008560852105917, 1.089261880881251e-05, 7.309406957844194e-08, 1.854150590137049e-19, 0, 0.0004673230596556781, 0.0007919996106477612, 0.000829321612695951, 0.001322770517641664, 0.001392082826005334, 0.001461315419877738, 0.001499719205207019, 0.00184267244633437, 0.002141169677739716, 0.001706451392926463, 0.001474854411856699, 0.001977436508336129, 0.001973100715473177, 0.002222773624031219, 0.002145270458767497, 0.0005037578389213796, 1.209512767677376e-05, 7.587966398889209e-08, 5.104758712934762e-13, 0, 0.0004621317155227264, 0.001002558887240822, 0.001490889876768072, 0.001127474201986771, 0.001748534265896785, 0.001915074859076408, 0.002160584855552777, 0.002137542244114408, 0.002246263238460328, 0.002009217005296269, 0.002184072060840086, 0.00341656296544675, 0.003405426548582952, 0.003354149007619698, 0.002492793191534642, 0.0004528155088075548, 1.538881293591281e-05, 1.090727182520224e-07, 5.479972060016753e-12, 0, 0.0008506323016080452, 0.001450893991779938, 0.00153147672442397, 0.002043077504119487, 0.001908015847723498, 0.002445837760115639, 0.002892169844204276, 0.002649344365520868, 0.003480255713328284, 0.003273059195982303, 0.003651774702073087, 0.002975668437497302, 0.003848235880509938, 0.004299585763189797, 0.003592221100385914, 0.0006268970530253643, 1.949441299350576e-05, 7.33737941094201e-08, 4.106889329839916e-19, 0, 0.0008712032444937686, 0.001263113607333976, 0.001892119213462853, 0.002951455966873707, 0.003168477179907946, 0.002716892746784279, 0.00365456525043677, 0.003366919479054045, 0.003409391190498468, 0.003280833996034263, 0.003232972935525226, 0.003428777849430266, 0.00409723153988921, 0.003773607899688144, 0.003635385845482117, 0.0005933602834815134, 1.954158915655613e-05, 8.13556308562345e-08, 4.037912671359563e-12, 0, 0.0007578086986035421, 0.001571864995058959, 0.00210180861287308, 0.003084224254681427, 0.00324622253553943, 0.002813553996022331, 0.003868620545796785, 0.003303378470419883, 0.003898494581934516, 0.003219750388428025, 0.004515970769497011, 0.003466064450883283, 0.004950418886312877, 0.004914939529918202, 0.00493349886915681, 0.0006599427105186057, 2.573879520276485e-05, 7.281418136024325e-08, 1.175566732583741e-11, 0, 0.001301289189873858, 0.001955130945873152, 0.002753655369202145, 0.002692654364258977, 0.003727848238827152, 0.004883895519350967, 0.004344601401403041, 0.007437407173262871, 0.004150296000659384, 0.003228989339456545, 0.004377889979865643, 0.004858295312470485, 0.004322310151372482, 0.004790024356189096, 0.006226394506274665, 0.000742721688099425, 1.880346654527976e-05, 6.531932372281474e-08, 1.202316866360037e-11, 0, 0.001584525543738587, 0.001957536759580832, 0.002955772224818775, 0.003566685227652369, 0.003695625066812618, 0.003802261338421153, 0.005306110254013854, 0.004032873090770058, 0.005054977734921073, 0.003990496980133784, 0.005256293191006758, 0.005773623814730667, 0.005204214186848903, 0.008040158407001806, 0.006601864565828107, 0.000934762930336259, 2.323765323593394e-05, 8.048543699151381e-08, 3.956904424417999e-12, 0, 0.0009532663755747426, 0.002383770639279705, 0.003514215952425242, 0.003928131843351335, 0.00407917925635217, 0.004409175057343556, 0.004174373528586969, 0.005224970028864312, 0.005046140729727019, 0.005517911264004763, 0.006133136153459907, 0.006621105520696112, 0.005116125578370533, 0.006458796078313492, 0.004861778826187813, 0.0008563357430986033, 2.489866340510273e-05, 6.976437839809648e-08, 6.749845743547372e-19, 0, 0.001606765099583144, 0.002517210153306856, 0.00284223109266061, 0.004313061916503371, 0.003887648403432792, 0.005256360279043819, 0.004742362428372827, 0.006132698837748755, 0.006187086659611024, 0.007245805043664948, 0.004897043635549657, 0.006690265869693259, 0.007283321546582892, 0.008156505026449464, 0.006005181924510226, 0.0009549645761882224, 2.343736808997525e-05, 1.055173378328958e-07, 5.393513863034275e-12, 0, 0.002309851534532834, 0.00334156075237563, 0.003180943558218621, 0.003597866794793585, 0.004187911292322506, 0.004353805205002588, 0.004600259155330218, 0.006993632890756015, 0.009098517517053352, 0.007446335119460008, 0.008634659277676392, 0.006982211912451922, 0.00566356514085682, 0.01099637658020214, 0.007521871618249948, 0.001034457114208206, 2.283762046007298e-05, 8.809725675121649e-08, 5.327245254164569e-12, 0, 0.002836482602286315, 0.002912451005595809, 0.00343995059914577, 0.005883860177039632, 0.005921403958744408, 0.008275816143838771, 0.007854897530377984, 0.006578389210360837, 0.007375366505681889, 0.008106865045705382, 0.006701844826737642, 0.006580619410989587, 0.007536297199412296, 0.01040647544678961, 0.01131572481679736, 0.001206691731033311, 2.222257526297199e-05, 6.502244544400313e-08, 7.70027531108919e-12, 0, 0.003646696204759, 0.004150085338842409, 0.006434972846796867, 0.006510408934900199, 0.007828870105802768, 0.006933918381012535, 0.007947244176696379, 0.007453024979471437, 0.007975952940997417, 0.01113332504182525, 0.01160178638726433, 0.01144720640438779, 0.01109773543784731, 0.01272786917725086, 0.01341306782824736, 0.001127497992793048, 2.098834791239792e-05, 7.690649477785602e-08, 1.607628254107751e-12, 0, 0.01027201734687368, 0.005683222794301893, 0.005676494887842684, 0.007364461869405191, 0.01594408262292669, 0.01052445107021906, 0.0129042241500671, 0.01215108655200739, 0.008773137132941096, 0.01388762893466218, 0.01675852034974754, 0.01267453891358598, 0.00797092265989348, 0.01483906994765183, 0.01859672764264965, 0.001313223655121695, 1.744726175264807e-05, 5.476407812711655e-08, 2.379000421809726e-12, 0, 8.524862247812594e-05, 0.0001605681702022603, 0.0002192999457214781, 0.0002464503640738466, 0.0003348458639019742, 0.0003038354655788872, 0.0003904763100346698, 0.0003805440285676758, 0.0003987501958983183, 0.0004783134656421558, 0.0006463791717423661, 0.0004812524518695307, 0.000643983730984119, 0.0006048202635700837, 0.0008539983990984079, 0.0001615521086402755, 2.461317889102715e-06, 3.782152651710127e-09, 4.485017336945546e-14, 0, 2.549569561085654e-07, 4.659455771845948e-07, 4.322841523614325e-07, 7.529553746390748e-07, 8.4907964547735e-07, 9.342808966970159e-07, 1.313162236154669e-06, 1.052501622555835e-06, 1.354904923840302e-06, 1.236107852310269e-06, 1.697923207194687e-06, 1.012788304080187e-06, 1.29421803490857e-06, 1.795156552076441e-06, 2.284952425639372e-06, 5.038283856453651e-07, 9.952693865685186e-09, 2.453282762693012e-11, 4.631845404855628e-24, 0, 2.812090984984202e-11, 5.358941505798117e-11, 7.716582711107922e-11, 1.581273877100187e-10, 1.204458613324934e-10, 1.501600898804198e-10, 1.889898008416691e-10, 2.486383807698744e-10, 2.126308248276794e-10, 3.076780241563715e-10, 2.605479189230031e-10, 2.576633095621192e-10, 2.405182459430811e-10, 3.288358821642053e-10, 2.890868216874096e-10, 8.088339111329494e-11, 2.519981219543899e-12, 3.2204779790279e-15, 3.655875244218389e-30, 0, 1.308859813008482e-16, 2.499036587812692e-16, 3.330899943843973e-16, 5.060120851700022e-16, 6.278252077897596e-16, 5.300707412800729e-16, 8.896099264589757e-16, 7.343229827703862e-16, 8.270870425824843e-16, 1.146270178594262e-15, 8.813193961687414e-16, 1.034747724499068e-15, 1.037267872164617e-15, 1.130919447408641e-15, 1.467151482657452e-15, 4.106615064280042e-16, 1.10285225075023e-17, 8.377020562070061e-22, 4.834700471016747e-36]
+      ],
+     "11":[
+      [0, 3.5058768139894e-12, 2.025042531062177e-11, 6.545142299869089e-11, 1.11645939619426e-10, 1.900251697868764e-10, 4.98884204101326e-10, 3.567323681254627e-10, 5.927213130494166e-10, 8.511748300825074e-10, 8.217698039964393e-10, 1.205538453532619e-09, 1.374892208572474e-09, 1.667190540059791e-09, 2.539691225870702e-09, 5.462397434579807e-09, 4.833915908258299e-10, 5.435787807825716e-13, 1.565365816875653e-18, 1.366691623336439e-27, 0, 0.000128286191168761, 0.0002025985172862286, 0.0002875696398905189, 0.0002990832797559, 0.0003529839183600812, 0.0002989729576021814, 0.0003706972903496891, 0.0003301675018222674, 0.0004423054084376111, 0.0004397425973116143, 0.0004056278306612881, 0.0003825974256100761, 0.0003945069623618077, 0.0003078829768869995, 0.0001406915945839427, 2.244694678503225e-06, 3.885493803843114e-10, 3.652872283731362e-16, 4.146261914358324e-33, 0, 0.0002930848027601858, 0.0004478963133683702, 0.0007470843350346671, 0.0007614192318038481, 0.0006591178151356279, 0.000814606600901648, 0.0007236785365739786, 0.0007612098721507583, 0.0007410226321054104, 0.0007810838744513978, 0.0006587166537062362, 0.0007175199517767424, 0.0008295681367012196, 0.0007787887389127373, 0.0001978688031011177, 4.124765965933324e-06, 6.396558360290329e-10, 6.846532060582734e-16, 1.527635283454265e-32, 0, 0.0004766237076720079, 0.0007744010055409619, 0.0007774016286494815, 0.001188741208448072, 0.001199352590967931, 0.001206988737423238, 0.001187530922652797, 0.001398804215052292, 0.001558230147292572, 0.001190539744616544, 0.0009864296933453579, 0.00126789682506417, 0.001162654797660431, 0.001145312577694249, 0.0004307821556112272, 7.466524988017855e-06, 9.011883058616274e-10, 1.028013650951574e-15, 6.333265533921464e-26, 0, 0.0004828610270708883, 0.001004270431001528, 0.001431762864898961, 0.001038047161141387, 0.001543368473367169, 0.001620563907217882, 0.001752816501346189, 0.001662509753832523, 0.001674919857029426, 0.00143629448911612, 0.001496808104203675, 0.002244761565342738, 0.002056422578758224, 0.001771451794141252, 0.0005144837011596777, 7.071016881088673e-06, 1.333724603664474e-09, 1.906944022614243e-15, 9.112450013887369e-25, 0, 0.0009105288551241612, 0.001488925829487684, 0.001506726598881666, 0.001927066016556068, 0.001725370383975661, 0.002120398179140174, 0.002403829619019276, 0.002111100942683945, 0.002658721949365594, 0.002397216044994693, 0.002564183528333708, 0.002003187681975606, 0.002381128203102842, 0.002327025771103229, 0.0007610145228031346, 1.020277274720935e-05, 1.883974603427107e-09, 1.556862788333359e-15, 8.587264992333603e-32, 0, 0.000955354228224145, 0.001327925318140746, 0.001907074631329192, 0.002851970509679672, 0.002935285280715611, 0.00241304060590659, 0.003111870818501413, 0.002748612296130913, 0.00266841655392736, 0.002461830325013383, 0.002325808438419913, 0.002364885333540922, 0.002597533706152942, 0.002092726627286355, 0.0007900239810080025, 1.000881089583382e-05, 2.055953835375439e-09, 2.016788955850766e-15, 1.01969775083231e-24, 0, 0.0008513248848852966, 0.001692925363097962, 0.002170224222014728, 0.003053150568238444, 0.003080869377438288, 0.002560028410513839, 0.003374752531836822, 0.002762752978433925, 0.003125936568708603, 0.002475178014692009, 0.003328417474568744, 0.002449216037508481, 0.003215464685877045, 0.002792721032498494, 0.00109936201735294, 1.150013935280507e-05, 2.904150459439993e-09, 2.055397778301518e-15, 3.487177963552202e-24, 0, 0.001497607758585865, 0.002157184720059547, 0.002912799722831321, 0.002730696675347669, 0.003624474764095476, 0.004552493668120347, 0.003882675640516509, 0.006372398247540245, 0.003409278860241055, 0.002543044884241219, 0.003305658685103813, 0.003517098692972973, 0.002876314991964877, 0.00278857749681147, 0.001422377297255318, 1.334328263371802e-05, 2.252644981453576e-09, 2.061329706297271e-15, 4.10538720528558e-24, 0, 0.001868141452899578, 0.002212625809348153, 0.003203015900570416, 0.003705488630246505, 0.003680981254868869, 0.003630906236665801, 0.004857905011762895, 0.003539885654374383, 0.004254005492553299, 0.003219675035131073, 0.004066052338505443, 0.004282054713984477, 0.003548014611960726, 0.004795484116730872, 0.001545850488463491, 1.728923450614404e-05, 2.935024198821707e-09, 2.800880557932944e-15, 1.531426253391273e-24, 0, 0.001151353766252889, 0.002760239449599313, 0.003901227198709923, 0.004180729122957932, 0.004162311300294682, 0.004313377492709199, 0.003915185136923017, 0.004698379873666217, 0.004350402263316483, 0.004560924231763572, 0.004860390238756708, 0.005030737777348075, 0.003573338684780262, 0.003946686898573064, 0.001166726917292812, 1.62903638614091e-05, 3.298570387080164e-09, 2.649086552231747e-15, 2.92530389831908e-31, 0, 0.001988056177241452, 0.002985958157117996, 0.003232320957789978, 0.004702561181488865, 0.00406379867703282, 0.005267802633075393, 0.004556600507114797, 0.005649399954777131, 0.005464418276069275, 0.006135556593979818, 0.003975697815444129, 0.00520759595201341, 0.005211461547847452, 0.005106118205902142, 0.001476850926665123, 1.867130325805753e-05, 3.244189149326555e-09, 4.335594511027959e-15, 2.592026470299222e-24, 0, 0.00292778941432438, 0.004060628668681525, 0.003705877103876972, 0.004018594724496663, 0.004484598676334987, 0.004469870519929493, 0.004528046718074732, 0.006599892388481399, 0.008232141127520968, 0.006459450602479819, 0.00718144239825622, 0.005567696735221405, 0.004151568484584122, 0.007052380931607359, 0.001895591729970415, 2.077614548792627e-05, 3.293033804630072e-09, 3.89071188401037e-15, 2.816237401185063e-24, 0, 0.003773012028643535, 0.003714112853418617, 0.004205719006056604, 0.006896759975093794, 0.006654344516375463, 0.008916456940081341, 0.008113830421040318, 0.006514961899640885, 0.007003026829529151, 0.007380196312646712, 0.005849584359793139, 0.005507010828498603, 0.005797658061089604, 0.007004438341131119, 0.002994028736622255, 2.554287914365689e-05, 3.454320580071479e-09, 3.266124337651453e-15, 4.832348563677157e-24, 0, 0.005236736814707104, 0.005713561019045927, 0.008493537887804789, 0.008238451757359575, 0.009498065805427237, 0.00806523195965086, 0.008862576822119762, 0.00796864703443741, 0.008176103186061186, 0.01094217400876155, 0.01093255551746205, 0.01034231021370898, 0.009217308063274324, 0.009249386455228478, 0.003833354619377417, 2.588946046968806e-05, 3.631770586016589e-09, 4.597860740673142e-15, 1.274689388110105e-24, 0, 0.02517444603174554, 0.01335328623888407, 0.01278694889921172, 0.01590467466364287, 0.03301294605983092, 0.02089243419428047, 0.02456010332747531, 0.02217307645935774, 0.01534907269645361, 0.02329568788534761, 0.02695300115084882, 0.01954481007478601, 0.01129990777527556, 0.01840733498802422, 0.009082017652906935, 5.208080005788455e-05, 5.583519569424292e-09, 7.494230252658149e-15, 5.581943541195966e-24, 0, 0.0008802347879732497, 0.001589498836068252, 0.002081291956678466, 0.002242444984965365, 0.002921051717153948, 0.00254120012714954, 0.003131160328243312, 0.002925700426380088, 0.002939302568840386, 0.003380481346784013, 0.004380058890644056, 0.003126772733258701, 0.003846556296657554, 0.003161222096556125, 0.001758154214357408, 2.714124687921501e-05, 3.450878172152335e-09, 2.587880059345081e-15, 6.716063669244596e-25, 0, 4.112986452672334e-05, 7.206368922594614e-05, 6.409817651401931e-05, 0.000107039689033982, 0.0001157250696345826, 0.0001220855008064934, 0.000164519273966725, 0.0001264262141923139, 0.0001560426514286977, 0.0001364945112181674, 0.0001797650960365963, 0.0001028107887753817, 0.0001207828810873379, 0.0001466016819522662, 7.35135989584456e-05, 1.324932037394426e-06, 2.209122418287455e-10, 2.796404377774665e-16, 1.310719345989577e-33, 0, 3.650985532360937e-07, 6.670463333358073e-07, 9.208786336280789e-07, 1.809210213949329e-06, 1.321242481004259e-06, 1.579276016299325e-06, 1.905719261768873e-06, 2.403864173831623e-06, 1.971030505318441e-06, 2.734595742590784e-06, 2.220332248639187e-06, 2.105333071735888e-06, 1.806776891035078e-06, 2.161676749030169e-06, 7.488747336345693e-07, 1.714193527336673e-08, 4.526317053686155e-12, 3.024732191581848e-18, 8.972643552378447e-38, 0, 8.655833456706456e-10, 1.584524523698931e-09, 2.024895540589073e-09, 2.949311935369852e-09, 3.508499741610328e-09, 2.840164626511423e-09, 4.570254510596691e-09, 3.617121327139588e-09, 3.906307878838772e-09, 5.190935747052903e-09, 3.826832964346444e-09, 4.308164632335605e-09, 3.97067512349563e-09, 3.788812644682617e-09, 1.938216915966921e-09, 4.445476516217791e-11, 1.014726676486713e-14, 4.056880068434276e-22, 6.215809275933823e-41]
+      ],
+     "12":[
+      [0, 5.635906598737634e-36, 4.339774072718721e-33, 2.495989081088035e-31, 3.321891254085869e-30, 2.807807689178664e-29, 2.750833398513707e-28, 6.026568273291458e-28, 2.655541863072519e-27, 9.057667278180914e-27, 1.904028454601219e-26, 5.668553518548464e-26, 1.237926300025939e-25, 4.789130113731145e-25, 3.471265185214976e-24, 6.134158267316882e-21, 4.037581787039972e-18, 1.041400869130358e-16, 3.616639176752452e-17, 2.915746098326196e-20, 0, 6.227015779223109e-07, 1.024722264945528e-06, 1.515579524798928e-06, 1.642440120901661e-06, 2.019807462394624e-06, 1.782545101449403e-06, 2.302912940622384e-06, 2.137163962239668e-06, 2.983095087613386e-06, 3.090157598691672e-06, 2.969907997872678e-06, 2.918679218670361e-06, 3.266967889376711e-06, 2.904333864498331e-06, 3.294291854320421e-06, 6.052890110514067e-07, 1.102812573385243e-08, 1.656738782943111e-11, 5.756835360183751e-24, 0, 5.443169854490922e-06, 8.667740883057163e-06, 1.506481655360052e-05, 1.599851901326779e-05, 1.443034274024737e-05, 1.858296923374942e-05, 1.7201344327731e-05, 1.885239574682928e-05, 1.912207281812482e-05, 2.100092600400116e-05, 1.845323907833611e-05, 2.094291116367605e-05, 2.628458114156629e-05, 2.810861098539906e-05, 1.772664148004557e-05, 4.254404690497619e-06, 6.921899338357301e-08, 1.159510967782909e-10, 7.274411830633788e-23, 0, 1.905099804283426e-05, 3.225357249105783e-05, 3.373829507267963e-05, 5.375597128974499e-05, 5.65124217461533e-05, 5.925893435179817e-05, 6.074982832736147e-05, 7.455941537013637e-05, 8.654032470084424e-05, 6.889188868372832e-05, 5.947350307574648e-05, 7.964717915801844e-05, 7.928356999360666e-05, 8.896663138403364e-05, 8.305941708745019e-05, 1.65729629092944e-05, 2.096381041604546e-07, 3.716634994171111e-10, 6.249981360255287e-16, 0, 3.282049718688932e-05, 7.112847227291733e-05, 0.0001056646327386493, 7.982470635311349e-05, 0.0001236651982452547, 0.0001352999384250907, 0.0001524815801499925, 0.0001506921237747518, 0.0001581836990770016, 0.0001413345867783666, 0.0001534632052049489, 0.0002397935226988476, 0.0002384654676896106, 0.000233998538496866, 0.0001686874215488933, 2.668848130164503e-05, 5.272921157275522e-07, 1.167645759285364e-09, 1.500310434406181e-14, 0, 9.250019139160035e-05, 0.0001576129006450183, 0.0001661953542979074, 0.0002214841678803894, 0.0002066265113939837, 0.000264590758843122, 0.000312543454477269, 0.0002859967711885231, 0.0003752894707260621, 0.0003525639338548346, 0.0003929280006549069, 0.0003198266069549007, 0.0004126877764655789, 0.000459420795613858, 0.0003729315418227275, 5.755378251058048e-05, 1.112854970204686e-06, 1.421362363276104e-09, 2.089059502719712e-21, 0, 0.0001336854632263461, 0.0001936257719255874, 0.0002897496393336054, 0.0004515043032309308, 0.0004841999820208659, 0.0004147559333444288, 0.0005573127711042378, 0.0005129042604376127, 0.0005188212536067361, 0.0004987230964075379, 0.0004909174331370869, 0.0005200842024996734, 0.0006201126811143083, 0.000569105135698991, 0.0005332692598119178, 7.776799204965392e-05, 1.672444477146233e-06, 2.5322062492255e-09, 3.391052518080745e-14, 0, 0.0001551027382267364, 0.0003213894968259712, 0.0004293032291812165, 0.0006293169036765566, 0.0006616861244944998, 0.0005728976379521421, 0.0007869073762613686, 0.0006712265205037583, 0.0007913133727556414, 0.0006528478777682899, 0.0009146953736525989, 0.0007012854498316272, 0.0009994413004956496, 0.0009888072422146706, 0.0009661636635917678, 0.0001163376164127574, 3.075354986484949e-06, 3.356270978682487e-09, 1.501757428299239e-13, 0, 0.0003408940125218293, 0.0005116563097711255, 0.0007198918890603208, 0.0007032208204527594, 0.0009725700342040402, 0.00127285413515114, 0.001131122953904022, 0.001934313938629746, 0.001078270815137801, 0.0008380241720477198, 0.001134994202648018, 0.001258198652263391, 0.001116983829005004, 0.001233569559600164, 0.001561785130881519, 0.0001686446820241815, 2.980010820518632e-06, 4.201961018814279e-09, 2.200083989000768e-13, 0, 0.0005148157400126911, 0.0006353597740706419, 0.0009583771906325502, 0.001155272509919521, 0.001195804223041635, 0.001229037042390679, 0.001713358933304356, 0.001300869990365173, 0.001628860760481869, 0.001284503024063006, 0.001690165178906112, 0.001854545131873279, 0.001668077943833114, 0.00256822950074229, 0.002054916076161413, 0.0002645472375076716, 4.700256795711892e-06, 6.90798934607725e-09, 9.905317602452132e-14, 0, 0.0003747002749936135, 0.0009360340374404939, 0.001378515758426341, 0.001539302865554289, 0.001596849939460365, 0.001724250876129834, 0.001630739780524772, 0.002039040236339765, 0.00196719910341479, 0.002148863928045934, 0.002385944150406737, 0.002573059357154924, 0.001983983315510638, 0.002496128215236934, 0.001831590410236208, 0.0002943668048824608, 6.237943472909935e-06, 7.712194798470516e-09, 2.229084442436885e-20, 0, 0.0007488759764498643, 0.001172018848439981, 0.001321998434893702, 0.002004067984530444, 0.001804544753192211, 0.002437352732638321, 0.002196742725159845, 0.002837826564839819, 0.002860017402449367, 0.003345922238611402, 0.002258958750016502, 0.003082912409996213, 0.003349107727845903, 0.003737926623146847, 0.002683497569527645, 0.0003905140053950122, 7.100790624209356e-06, 1.460399490037444e-08, 2.281695804322291e-13, 0, 0.001255513312381718, 0.001814447341933537, 0.001725471002224242, 0.001949630771146979, 0.002267040084191564, 0.002354420075145742, 0.002485130728165833, 0.003774161311581193, 0.004904984092779152, 0.00401012115617509, 0.004645223673609896, 0.003752316594311531, 0.003037258433369514, 0.005877269107682371, 0.003921109565472503, 0.0004946812824996009, 8.205035656077751e-06, 1.491489290793308e-08, 2.817733199098468e-13, 0, 0.002015194169577709, 0.002067061316245481, 0.002438956346109032, 0.004167449503881068, 0.004189748201840592, 0.005849628783838312, 0.005546400208829714, 0.004640260664438461, 0.005197056491073051, 0.005706589554537054, 0.00471266672998942, 0.004622602657101003, 0.005282856277925153, 0.00727042300384872, 0.007713760307846, 0.000757486525893741, 1.07194162210922e-05, 1.558750545502457e-08, 6.00749665336581e-13, 0, 0.003656653801604978, 0.004157185852274247, 0.006439418182236655, 0.006508261384883607, 0.007818292043153421, 0.006917463115683359, 0.007920255964904126, 0.007420086112265336, 0.007932531414630762, 0.01106129724402563, 0.0115148177887462, 0.01134963226253135, 0.01098028914724497, 0.01255141203781539, 0.01291164644811679, 0.001003736161586041, 1.473337329834107e-05, 2.867531323935033e-08, 2.066638304048633e-13, 0, 0.03456789829078906, 0.01910601361005612, 0.01906398532648471, 0.02470770243015411, 0.0534378064829628, 0.03523758275857596, 0.04316144079713171, 0.04060096213994097, 0.02928418115916565, 0.0463087429206338, 0.055824781224184, 0.04217739307145658, 0.02647083937243146, 0.04911932336091685, 0.06015346240925478, 0.003970599280719045, 4.454780244979929e-05, 9.190631675443322e-08, 1.77415582229031e-12, 0, 0.0005427811644305363, 0.001021300257574161, 0.001393443053160898, 0.001564361099135341, 0.002123290636622383, 0.001924686702461512, 0.002471004005620875, 0.00240569711576785, 0.002518223741819553, 0.003017612467659445, 0.004073762843640195, 0.00302997430886969, 0.004046283209361002, 0.003787942533215158, 0.005228779567886645, 0.0009291634289301512, 1.237237029142727e-05, 1.42989438858795e-08, 9.67154608725442e-14, 0, 7.247508620203576e-07, 1.323153426813773e-06, 1.226302774756278e-06, 2.133787966435273e-06, 2.403722455284694e-06, 2.64221079037524e-06, 3.709904340523383e-06, 2.970446003310817e-06, 3.819992361576967e-06, 3.481489133666635e-06, 4.777293729277613e-06, 2.846675812385466e-06, 3.630264514143213e-06, 5.019077111660425e-06, 6.245689567112581e-06, 1.295677047104912e-06, 2.26534113274754e-08, 4.444194078325006e-11, 5.511110600542119e-24, 0, 6.133989778935572e-12, 1.167724267604241e-11, 1.679709721965235e-11, 3.438464674176805e-11, 2.616362518017887e-11, 3.258437813166569e-11, 4.096778428175279e-11, 5.384207356466838e-11, 4.599701377998568e-11, 6.648903036332668e-11, 5.624598654155858e-11, 5.55657546174397e-11, 5.176127410897359e-11, 7.05363494863163e-11, 6.061425937184813e-11, 1.596074054359416e-11, 4.423895878911742e-13, 4.617286302641443e-16, 3.710545901505635e-31, 0, 3.187210292888693e-19, 6.078963547006208e-19, 8.09390729239657e-19, 1.228280663262915e-18, 1.522354981689098e-18, 1.283961033166095e-18, 2.152577641069439e-18, 1.774957196315439e-18, 1.997072824289186e-18, 2.764852458033947e-18, 2.12354239451946e-18, 2.490606312784309e-18, 2.491429407216497e-18, 2.707338019998546e-18, 3.432031797480717e-18, 9.036737477260662e-19, 2.162971247279783e-20, 1.359655977700662e-24, 5.804421210913818e-39]
+      ],
+     "13":[
+      [0, 1.44018458912249e-11, 8.352839961967382e-11, 2.710807367745284e-10, 4.643047180994135e-10, 7.935109751631268e-10, 2.091819711206621e-09, 1.501933645673084e-09, 2.505783506449465e-09, 3.613246478175971e-09, 3.502804070804488e-09, 5.159820848607514e-09, 5.908961089517763e-09, 7.224514486125035e-09, 1.115062563458293e-08, 2.630590174546398e-08, 3.00868633823042e-09, 5.692340067367842e-12, 4.042547949560307e-17, 1.440339095233455e-25, 0.0005428262419522112, 0.000537928328516184, 0.0004265461665583367, 0.0004053199768501851, 0.0003174870909122138, 0.0003010217297686487, 0.0002133604697057782, 0.0002277070466649226, 0.0001782061642908425, 0.0002130997613675664, 0.0001914821119179365, 0.0001612474490166182, 0.0001400065795633546, 0.0001247899013961746, 8.045525423090534e-05, 1.76334345532514e-05, 1.476057763905997e-07, 2.421525121680819e-11, 6.362323524428327e-17, 5.95049108506142e-33, 0.00136571328022172, 0.001221090203395007, 0.0009369516809237412, 0.001046247574177006, 0.0008030960430297858, 0.0005584900227119683, 0.0005776157223038834, 0.000441683517214622, 0.0004082258058219377, 0.0003547307138855945, 0.0003379345863314131, 0.0002601761241709686, 0.0002608808064372196, 0.0002607195282718253, 0.0002021964610503166, 2.462327346093003e-05, 2.66406181762656e-07, 3.575706590449476e-11, 8.204145709087953e-17, 1.221041952236988e-32, 0.002351939417859065, 0.001973059330749148, 0.001609591497554453, 0.001081733586966345, 0.001245778837886773, 0.00100973904038627, 0.0008503624343081598, 0.000720145087889358, 0.0007453534882799093, 0.0007411530399134994, 0.0005117848292443048, 0.0003871176203629247, 0.0004580357995405147, 0.0003630596518610388, 0.0002954471282929314, 5.325163810498217e-05, 4.77299525253992e-07, 4.825569033752215e-11, 1.042253001942139e-16, 3.704675660590389e-26, 0.002933730637794687, 0.00198608041628994, 0.002074008866419381, 0.001979502827212429, 0.001080888406785158, 0.00129104683456435, 0.001134428291325384, 0.001056139954318422, 0.0008801959654085068, 0.0007915529478448699, 0.0006134743909020643, 0.0005836494753070257, 0.0008057393592284087, 0.0006380395348879143, 0.0004540369506272565, 6.31837766275562e-05, 4.482512179591879e-07, 6.963697730548526e-11, 1.753365539417804e-16, 4.346231996392713e-25, 0.003979420965814729, 0.003721162827882273, 0.003055225598372265, 0.002069806620078962, 0.001993749720929165, 0.001434052207730653, 0.001474818318152633, 0.001439126138280997, 0.001110540128378589, 0.001248443366810491, 0.001017349041440238, 0.0009934471869500643, 0.0007144231484666476, 0.0007340523467578606, 0.0005926126824470539, 9.285524171195274e-05, 6.418921406254841e-07, 9.662380828887873e-11, 1.340705551501907e-16, 3.534989451365029e-32, 0.004910943540645017, 0.003879357380118932, 0.002707411525728473, 0.002602995437877959, 0.002931767138617043, 0.002424059758794071, 0.001667616139469051, 0.001851087991893007, 0.001436643517266723, 0.001244972514600271, 0.001038080544452702, 0.0008953228088462269, 0.0008380190078373538, 0.0007956371011874308, 0.0005295306222912065, 9.577314403166235e-05, 6.251719947607388e-07, 1.039646968646916e-10, 1.655623412234376e-16, 3.749946109170662e-25, 0.006274784606345136, 0.003434798006032663, 0.003429485336326496, 0.002943207228033107, 0.003118481546792323, 0.002527998409323738, 0.001757869921171551, 0.001994609588595155, 0.001434788946875656, 0.001449094434038389, 0.001037026146400795, 0.001273074331963013, 0.0008623450027161409, 0.0009786052183960135, 0.0007021268057223743, 0.000132415925213438, 7.133292458944212e-07, 1.451099050079676e-10, 1.625865893143092e-16, 1.172012215555112e-24, 0.006707460034149548, 0.006003639174789985, 0.00434199285845596, 0.003924980394126504, 0.002771271327661899, 0.002955011780585453, 0.003106003320569633, 0.00228011987709545, 0.003288209286029887, 0.001570325186006523, 0.001058638770342632, 0.001256274164313398, 0.001230407296986309, 0.0008697820635378695, 0.0006965953059202469, 0.0001702213910250365, 8.220155734068665e-07, 1.113704743445288e-10, 1.582274027255379e-16, 1.281273613358144e-24, 0.005864997226997294, 0.00744109759115021, 0.004425073494541752, 0.004288414032190734, 0.003736472742120322, 0.00298186848804026, 0.002461378119124356, 0.002834564298224736, 0.001814915806018612, 0.00194686483407993, 0.001331730855697577, 0.001535359203005942, 0.001488425562839256, 0.001066031015127772, 0.001190256109889218, 0.0001838100362599635, 1.05794716362419e-06, 1.437099957968427e-10, 2.096460869535103e-16, 4.490347762769847e-25, 0.008650739973396453, 0.004556662730592147, 0.005484917902620466, 0.005189789202295409, 0.004188699690091943, 0.003350196630551509, 0.002905304283589791, 0.002269867172593949, 0.002393460201222877, 0.001978235477121373, 0.00187442501541129, 0.001823555280754512, 0.001737469992401651, 0.001066766198420766, 0.0009733096402131225, 0.0001378399789874637, 9.901892155441096e-07, 1.600587734773188e-10, 1.940293599843992e-16, 8.12985010148125e-32, 0.009039391881669728, 0.007817676957000801, 0.005895464969250359, 0.004272419886790715, 0.004681366312568272, 0.003249966612842416, 0.003525450521556475, 0.002624823230111561, 0.002859508299614305, 0.002468899704004199, 0.002505417486566672, 0.001482081412571552, 0.001787037981596364, 0.001545843036598593, 0.001251180066659146, 0.0001733597431338963, 1.127409998048403e-06, 1.560785284305637e-10, 3.115524248431571e-16, 6.874699853416117e-25, 0.0113038033013743, 0.01143931417304368, 0.007965970769601354, 0.004867002302439379, 0.00397487495981597, 0.003563537962853089, 0.002972289863128628, 0.002591678285108511, 0.003319227120816978, 0.003695586614817016, 0.002620793304080548, 0.002659998593748999, 0.001898379705553514, 0.001223570525848309, 0.001717020594068153, 0.0002210869290066626, 1.246256931018774e-06, 1.571341574562641e-10, 2.748451572802927e-16, 7.167154087446635e-25, 0.01538829857522091, 0.0145536138986642, 0.007193215005132075, 0.005452972545321155, 0.006734678935645846, 0.005220181603817806, 0.005853438463670766, 0.004584781419446478, 0.003234703692004845, 0.003103693748510485, 0.002956157542263145, 0.00213903149050559, 0.001853727316745241, 0.001686909214881313, 0.001683585341440059, 0.0003447385975061286, 1.512225408250697e-06, 1.622719384301819e-10, 2.239425080601282e-16, 1.146407938172788e-24, 0.01217854675755624, 0.0197919000863647, 0.01084223728629511, 0.01079010788616323, 0.007882454912885866, 0.007300617863233933, 0.005187758100026879, 0.004906782791116539, 0.003876602927837685, 0.003550451033086032, 0.004294448025782592, 0.003917039110126728, 0.003411076753062953, 0.002627768675440877, 0.002178303638137607, 0.0004324637467349809, 1.501355775466686e-06, 1.666462084641767e-10, 3.030293200643586e-16, 2.768986276175879e-25, 0.1830264790492846, 0.08249491391114225, 0.02197054095958209, 0.01408460553839974, 0.0131941473001114, 0.0220013542683635, 0.01165178938135125, 0.01178983617355417, 0.009352623826869976, 0.005779098576238298, 0.007927204624327187, 0.008373058523436212, 0.005589154751693489, 0.002793177613466305, 0.003758691142514472, 0.0008883385409239254, 2.616812889238418e-06, 2.20462006246865e-10, 4.078833148255351e-16, 8.691483748362695e-25, 0.003450096470278776, 0.001959600977497538, 0.001776702025997309, 0.001557444186060935, 0.00126380482504732, 0.001322531449027355, 0.000962817657887551, 0.00102113804077623, 0.0008383761528753997, 0.0007518371640178891, 0.0007814921162629557, 0.0009243968781005818, 0.0006074527726404948, 0.0006459475772187107, 0.0004385329873546115, 0.0001168294286589343, 9.262496820950873e-07, 9.228842054798032e-11, 9.363274030581841e-17, 6.437879754053322e-26, 4.190656406617384e-05, 4.324113617053749e-05, 3.804000818873309e-05, 2.265134218778263e-05, 2.848858698969181e-05, 2.474350242546282e-05, 2.184416031418531e-05, 2.533734894305939e-05, 1.710844775094671e-05, 1.884891807608331e-05, 1.490129717296998e-05, 1.791620261647606e-05, 9.432270189256014e-06, 9.578345541793689e-06, 9.603821738742059e-06, 2.306808755486244e-06, 2.135193642812428e-08, 2.788917502135504e-12, 4.755470124724374e-18, 5.764808800150338e-35, 1.526990516551827e-07, 1.122299788153971e-07, 1.029521196939939e-07, 9.514853688432304e-08, 1.40787100166472e-07, 8.259625664017641e-08, 8.261707409753625e-08, 8.581046331574138e-08, 9.510794661044636e-08, 6.96091559852626e-08, 8.728276347750408e-08, 6.469662377435458e-08, 5.64700327998749e-08, 4.188926162064548e-08, 4.139984883207029e-08, 6.869029416406579e-09, 8.073630462905892e-11, 1.670535666127651e-14, 1.505322332169939e-20, 1.15229024523439e-39, 4.915798378568306e-11, 4.319589826980176e-11, 3.970119605938076e-11, 3.396395182471321e-11, 3.725641057423076e-11, 3.560380433074419e-11, 2.411810107149544e-11, 3.340414012989621e-11, 2.322947318774347e-11, 2.239235483389852e-11, 2.689256399178097e-11, 1.80986150082458e-11, 1.875524496360947e-11, 1.494094256524452e-11, 1.177602858697521e-11, 2.884016221996035e-12, 3.393822324334879e-14, 6.068768404732842e-18, 3.280233353118995e-25, 1.306488534568946e-43]
+      ],
+     "14":[
+      [0, 4.885431204165379e-10, 1.435654291289741e-09, 3.14761001847365e-09, 4.097333086655403e-09, 5.676656143336863e-09, 1.263662170258314e-08, 7.880537832789073e-09, 1.165731999910916e-08, 1.514046042179592e-08, 1.338552875730407e-08, 1.816327432089516e-08, 1.932019222840922e-08, 2.07879376112165e-08, 2.726872041065891e-08, 3.749297269620362e-08, 3.660385731341982e-09, 1.320508668964049e-11, 4.183992173832524e-16, 1.339613168344616e-23, 0.0004581618707060008, 0.0004599686926162092, 0.0003694989549036518, 0.0003557017463591473, 0.0002822619366034433, 0.0002711188582170026, 0.0001946743742655687, 0.0002104754756623672, 0.0001668687992515068, 0.0002021435539957988, 0.0001840037699088875, 0.0001569675732653411, 0.0001380641915446089, 0.0001262797307623701, 8.482056949306869e-05, 2.470278894202371e-05, 4.332557934396199e-07, 2.436985983861459e-10, 2.717269269937052e-15, 1.391141038390556e-30, 0.001158469503696053, 0.001049345170526548, 0.0008157001521723433, 0.000922757721621138, 0.0007175591412880653, 0.0005055215919760533, 0.0005296566449796686, 0.0004102936172773362, 0.0003841573630695289, 0.0003381657312069087, 0.0003263491353107429, 0.0002545266018234161, 0.000258535774261739, 0.0002651356318315417, 0.0002142160650025583, 3.466685615581594e-05, 7.912495415304356e-07, 3.917678785784575e-10, 4.712610291542411e-15, 4.237281505652463e-30, 0.002005016750522814, 0.001704031044124294, 0.001408301236836376, 0.0009588259264681673, 0.001118657076359955, 0.0009185413888680643, 0.0007836536677171691, 0.0006723069060492806, 0.0007049109323122318, 0.000710069961590387, 0.0004967053333890956, 0.0003806005238586327, 0.000456181563752362, 0.0003710483011825901, 0.0003145671057148267, 7.534698045530285e-05, 1.42798554109627e-06, 5.470005446218754e-10, 6.878795215437049e-15, 1.631546061450795e-23, 0.002513499187139375, 0.00172385524396118, 0.0018237151764668, 0.001763363868302392, 0.0009754455491383205, 0.001180313754988923, 0.001050661308495994, 0.0009909101735790916, 0.0008365968042178282, 0.0007621451385758038, 0.0005983728680276034, 0.0005766896227759584, 0.0008064844948949157, 0.0006553333258821468, 0.0004858312990383326, 8.984702630981683e-05, 1.349337353242334e-06, 8.053047296611511e-10, 1.256808399129652e-14, 2.255690097769638e-22, 0.00342645373605799, 0.003246004353047922, 0.002699952291361867, 0.00185302762345275, 0.001808252181984165, 0.001317608732730096, 0.001372745610355205, 0.001356992106319942, 0.001060807311100098, 0.001208068993406122, 0.0009972644948922371, 0.0009865054214076238, 0.0007186564717930676, 0.0007577143517224918, 0.0006372769057303872, 0.0001326997534505411, 1.943244022111237e-06, 1.133309479369802e-09, 1.01609875251876e-14, 2.072549879781646e-29, 0.004249680141572196, 0.003400920792875115, 0.002404547420092768, 0.002342026123532316, 0.00267229226458002, 0.002238364685329257, 0.001559960246231422, 0.001754168421222867, 0.001379167075188851, 0.001210732244191555, 0.001022672814482738, 0.0008935100558171152, 0.0008471973965177406, 0.0008253878137017811, 0.0005722848900338492, 0.0001375539542891612, 1.902964292775729e-06, 1.233094261203126e-09, 1.307030836853759e-14, 2.417826288319371e-22, 0.005457029183360291, 0.003026244927759786, 0.003061076216770586, 0.002661369938162025, 0.002856693716845513, 0.002346012199459857, 0.00165260870974036, 0.001899625065383651, 0.001384272345155873, 0.001416284738271274, 0.00102674071846641, 0.001276846968610864, 0.0008761469516344499, 0.001020270768673426, 0.0007626077671356699, 0.0001911327795078654, 2.18287802945456e-06, 1.737402879022078e-09, 1.324783016911939e-14, 8.159561095373678e-22, 0.005862482205944331, 0.0053159812599163, 0.003894935458869882, 0.003566874540937013, 0.002551322993210687, 0.002755995638000122, 0.002934614057615598, 0.002182395074034179, 0.003188295711246862, 0.001542442630701302, 0.001053378183139511, 0.001266294922186192, 0.001256348285224836, 0.0009113462507235712, 0.0007603804531394182, 0.0002469304447446858, 2.528667597947312e-06, 1.34459361251895e-09, 1.32266522470899e-14, 9.506461725270675e-22, 0.005151777329714919, 0.006621733305845418, 0.003989307026354126, 0.003916632650257428, 0.003457116136291215, 0.002794946565529576, 0.002337184937620778, 0.002726638823303317, 0.001768565600554458, 0.001921855381758089, 0.001331736782520965, 0.001555341525421563, 0.001527402615477515, 0.001122555706336679, 0.001305736876008124, 0.0002679755490894009, 3.271325984913581e-06, 1.74825928297675e-09, 1.790353556718831e-14, 3.516145573871981e-22, 0.007636743399670321, 0.004075184127968349, 0.004969500764451761, 0.004763558333148162, 0.003894906060382307, 0.003155883048229332, 0.002772502253020616, 0.002194356779673843, 0.002343993197066317, 0.001962584126737628, 0.001883802372340466, 0.00185652148386415, 0.001791880055784199, 0.001128943983678422, 0.001073077676137378, 0.0002019605168845643, 3.077579263622434e-06, 1.960970759690691e-09, 1.687658428847543e-14, 6.668651121005401e-29, 0.008019728421431031, 0.007026573259537447, 0.005368169156260012, 0.003941133826322132, 0.004374776316036623, 0.003076769344232124, 0.003381117882626137, 0.002550188170659583, 0.002814406510512025, 0.002461608758407511, 0.002530536526431237, 0.001516415781957121, 0.001852211363425177, 0.001644120235951664, 0.00138632424924199, 0.0002552729088950593, 3.522019701534704e-06, 1.925054381876111e-09, 2.753777978967549e-14, 5.87267309666814e-22, 0.0100788361541897, 0.01033311333408841, 0.007289742351140749, 0.004512052408985076, 0.003733120517798042, 0.003390491976331639, 0.00286485149168886, 0.002530570788895045, 0.003283202251834267, 0.003703088838714548, 0.002660298701641432, 0.002735222919547909, 0.001977447153725351, 0.00130786266430758, 0.001911988706027228, 0.0003271783821284978, 3.913154656371639e-06, 1.95053930591617e-09, 2.464405739867956e-14, 6.346324608569681e-22, 0.01385819316270285, 0.01327798792308356, 0.006648546637909916, 0.00510594445051687, 0.006388451484205658, 0.005016456783675204, 0.005698389124756947, 0.004521536919786972, 0.003231656288161646, 0.003141156273607244, 0.00303078467217246, 0.002221561337745453, 0.001950281929718258, 0.001821186616799506, 0.001893539358684743, 0.0005152774525962599, 4.796615475080911e-06, 2.039056496361953e-09, 2.058543563794971e-14, 1.079023923453561e-21, 0.01114259591882734, 0.01834525800387736, 0.0101811654434945, 0.01026463367975887, 0.007596526689353988, 0.007127642580487504, 0.005130923664677424, 0.004916307288261912, 0.003934745643501797, 0.003650638509167677, 0.004473108289795673, 0.004133077233468616, 0.003646006565622267, 0.002882200055340494, 0.002489038511763291, 0.0006567122567678459, 4.838955323966036e-06, 2.132698607326377e-09, 2.877924102324131e-14, 2.813243309525058e-22, 0.1870617275297821, 0.08541687862806589, 0.02304621340672696, 0.01496727086367187, 0.01420414680554406, 0.02399473309256975, 0.01287326202187452, 0.01319562649530526, 0.01060422064822757, 0.006637816136368054, 0.00922362827601865, 0.009869138300930886, 0.006673465250510116, 0.00342227150463489, 0.004797644543608498, 0.001506886359429461, 9.425064571558624e-06, 3.17037895149387e-09, 4.514687499180501e-14, 1.170535442859262e-21, 0.00475812826017487, 0.002737905605514667, 0.002514826915913095, 0.002233291602423658, 0.001835900531169481, 0.001946292464214838, 0.001435409612526065, 0.001542207193604726, 0.001282686147850034, 0.001165266466824549, 0.001226994971124112, 0.001470246396649255, 0.0009787108272418788, 0.001067947318813404, 0.0007553186589694563, 0.0002674148688211263, 4.501795860605269e-06, 1.794178498790135e-09, 1.422765708231827e-14, 1.273865327917205e-22, 0.0001032649891609905, 0.0001079482157851783, 9.620618794376665e-05, 5.803594869834548e-05, 7.394545869393476e-05, 6.50632765492655e-05, 5.818901112461554e-05, 6.837453168704555e-05, 4.677007597196148e-05, 5.219932336256645e-05, 4.180422767361867e-05, 5.091625789402654e-05, 2.715425110340066e-05, 2.829595565607111e-05, 2.955666872635379e-05, 9.434763096919494e-06, 1.853970931867966e-07, 9.680204238951292e-11, 1.291453909537177e-15, 2.070995364226324e-31, 9.72900017418412e-07, 7.244226058889729e-07, 6.732343785166431e-07, 6.303439977357434e-07, 9.448862330269255e-07, 5.615841053939625e-07, 5.690608010318569e-07, 5.987701729461064e-07, 6.723019941809408e-07, 4.984691391160366e-07, 6.331714726798078e-07, 4.754359766047328e-07, 4.203806004968489e-07, 3.199967863716695e-07, 3.294793161444149e-07, 7.265665558749773e-08, 1.812764020565998e-09, 1.496884790408949e-12, 1.049668279256157e-17, 1.054177389654108e-35, 1.27785090677288e-09, 1.137597556117521e-09, 1.05926906668208e-09, 9.180662336125935e-10, 1.020249633970895e-09, 9.877522312479761e-10, 6.77855992166346e-10, 9.511168536892437e-10, 6.700523414280778e-10, 6.543369705436636e-10, 7.960910836261378e-10, 5.427518119586246e-10, 5.69771346304537e-10, 4.657890803983446e-10, 3.824898626628635e-10, 1.245389947120693e-10, 3.111866813637748e-12, 2.217110351602957e-15, 9.249284922109978e-22, 4.735249609365246e-39]
+      ],
+     "15":[
+      [0, 7.59546458223116e-22, 1.742892531034221e-20, 1.258803768794691e-19, 3.79123318231948e-19, 1.001361878136015e-18, 3.759808198079768e-18, 3.634349921336626e-18, 7.833296268951276e-18, 1.413985331688485e-17, 1.673861634620622e-17, 2.950973189815693e-17, 3.977961760058208e-17, 6.476428833606833e-17, 1.453116509539971e-16, 1.414644768932007e-15, 5.360430307085496e-16, 1.341467539510172e-18, 4.283843135159243e-24, 2.215246309345041e-33, 0, 0.0001547854280388907, 0.0002427723554362731, 0.0003422314946267235, 0.0003534957601486634, 0.0004143461349419614, 0.0003485441042626405, 0.0004292041068298482, 0.0003796632565076818, 0.0005051349818442351, 0.0004987763433854918, 0.0004569391107326067, 0.0004280525332608283, 0.0004353735810052738, 0.0003324742575553627, 0.0001305941048579314, 1.390997752935631e-06, 1.126637382156178e-10, 3.26316033264452e-17, 7.469772116283939e-35, 0, 0.0003513684271746196, 0.0005332854697297026, 0.0008834172905600831, 0.0008942012714971651, 0.000768760112284793, 0.000943611533535769, 0.0008325488134413739, 0.0008697377060620853, 0.0008408846130331112, 0.0008802880900339922, 0.0007373084185893526, 0.0007976439956193352, 0.0009096615583974219, 0.0008356279137302308, 0.0001824990358608513, 2.540048696102677e-06, 1.84399854066509e-10, 6.089940578742701e-17, 2.751383915590748e-34, 0, 0.0005677595501404939, 0.000916152039899176, 0.0009134002073612295, 0.001387133213200365, 0.001389933750389459, 0.001389210281359524, 0.001357464323509997, 0.001588035962938531, 0.001756936580043758, 0.001333185680865201, 0.001097074994295292, 0.001400485797289973, 0.001266771681883336, 0.001221060768638322, 0.00039478742605008, 4.568769236865555e-06, 2.581882598686496e-10, 9.092269298116098e-17, 1.13574586645451e-27, 0, 0.000571518687073142, 0.001180515791938567, 0.001671499468194391, 0.001203559143900599, 0.00177720022219503, 0.001853320197410269, 0.001990854364227121, 0.001875370853043346, 0.001876454735244401, 0.001598121654871532, 0.001654077784302525, 0.002463682059293448, 0.002226279188803118, 0.001876559743309585, 0.0004684878093828449, 4.299240214033833e-06, 3.797095363003969e-10, 1.676448810486989e-16, 1.6254322649835e-26, 0, 0.001070832566830676, 0.001739056815043573, 0.001747789764644988, 0.002220069344888634, 0.001974097860417369, 0.002409468947163219, 0.002712853528163316, 0.002366200803585303, 0.002959624634183773, 0.002650288694136073, 0.002815519830317305, 0.002184518780164921, 0.002561355014800418, 0.002449368082137994, 0.0006885575231050957, 6.163873421761584e-06, 5.329762999469712e-10, 1.360256522208657e-16, 1.522971796323051e-33, 0, 0.001116379789542375, 0.001541111427473137, 0.002198073012508241, 0.003264635302222513, 0.003337001158801642, 0.002724509025977802, 0.003489505945904675, 0.003061087972971943, 0.002951461192273993, 0.002704356083296761, 0.002537483271453964, 0.002562500765242404, 0.002776310223739573, 0.002188694839433163, 0.0007102446772062322, 6.008166396399638e-06, 5.779434184633717e-10, 1.751131160691258e-16, 1.797724717913843e-26, 0, 0.0009884680680770285, 0.001952171579479109, 0.002485414462368339, 0.003472623178733108, 0.00348015933114292, 0.002872024986875017, 0.003760140993169441, 0.003057202493320812, 0.003435448511060838, 0.002701668364372067, 0.003608169158074204, 0.002636943783232328, 0.003414840534961034, 0.002902152253597188, 0.0009820391727189148, 6.859391879753397e-06, 8.111952929627038e-10, 1.773472722593209e-16, 6.110685988041835e-26, 0, 0.001727767417280931, 0.002471652413764926, 0.003314551188900789, 0.003086048840998909, 0.004068092543833156, 0.005074727036077309, 0.00429846329956673, 0.007006562166961073, 0.003722937424326642, 0.002758033646160256, 0.003560631672161925, 0.003762515387837063, 0.003035170554651452, 0.002879355979174116, 0.001262476391726691, 7.908018885982477e-06, 6.252165428753262e-10, 1.767403424430392e-16, 7.149941461904413e-26, 0, 0.002141494386120656, 0.00251899916370655, 0.003621539223964922, 0.004160972216736471, 0.004105153037743196, 0.004021595426965827, 0.005343811672927447, 0.003867330814713352, 0.00461573942724727, 0.003469585609141353, 0.004351731039008094, 0.004551619924210155, 0.003720078630597511, 0.00492000101942521, 0.00136331541127693, 1.018129326724537e-05, 8.094291837458229e-10, 2.386356018804061e-16, 2.650671373783312e-26, 0, 0.001311402645934129, 0.003122388209442184, 0.004382838182581062, 0.004664675738375082, 0.004612330375482307, 0.004747018461082253, 0.004279317824672129, 0.005100236755800321, 0.004690215296593646, 0.004883582814734362, 0.005168688497048462, 0.005313315482942335, 0.003722725897685736, 0.004023329442736169, 0.001022394558955232, 9.531910006248767e-06, 9.039014068897635e-10, 2.242767251055077e-16, 5.03184777651043e-33, 0, 0.00224996680398314, 0.003356170761775962, 0.003608185586767022, 0.005213436455992322, 0.004474435364636264, 0.005760406837041761, 0.004948612043970776, 0.006093471032061051, 0.005853660392333891, 0.006527695631152577, 0.004200904638444335, 0.005465016107576912, 0.005394692237397264, 0.005172066089561534, 0.001285897916363419, 1.085539486009964e-05, 8.833415609724071e-10, 3.647375734633855e-16, 4.430797885019911e-26, 0, 0.003292362035815766, 0.004534964613790316, 0.004110415266749684, 0.004426741290256966, 0.004906253055548797, 0.004856673581853765, 0.004886227319913052, 0.007073259686267627, 0.008762271779473701, 0.006828445406504275, 0.007539828597594665, 0.005805639690434787, 0.004270116230511376, 0.007097891225804254, 0.001639967465359228, 1.200211396178083e-05, 8.90933295935514e-10, 3.252385442759303e-16, 4.783984451201188e-26, 0, 0.004188869453583437, 0.004095214133149327, 0.004605489968175641, 0.007500599062652367, 0.007187412287210083, 0.009564829061282691, 0.008644295961526592, 0.006893433180978954, 0.007359200807214196, 0.007702560798845032, 0.006063393742930767, 0.005669325851168885, 0.005887366761379586, 0.006959979119686716, 0.002557336175967727, 1.456820695715685e-05, 9.227057978880574e-10, 2.695765496566847e-16, 8.106205478365936e-26, 0, 0.005696951929828594, 0.006173075237743029, 0.009113756200132599, 0.008779497183267164, 0.01005253658828564, 0.008477640241739286, 0.009252028248201266, 0.00826193035158625, 0.008419077151619226, 0.01119036143077138, 0.01110416085767593, 0.01043293145597237, 0.009171617475301963, 0.009005771748761606, 0.003208372380621122, 1.446891203070163e-05, 9.506183050425677e-10, 3.718983106256372e-16, 2.095857532095432e-26, 0, 0.02375650410722591, 0.01251479395674855, 0.0119019082321728, 0.01470245190181141, 0.03030859165323813, 0.01904970264902262, 0.02224068805751186, 0.01994178557058275, 0.01371012694292022, 0.0206660418550858, 0.02374720576432215, 0.01710258065088193, 0.009753450118554888, 0.01554678902065323, 0.006593746519592337, 2.524915599140788e-05, 1.267941959652231e-09, 5.260652043631378e-16, 7.971275287383739e-26, 0, 0.0005649859426912644, 0.001013239647682971, 0.001317646782603292, 0.001409947780467505, 0.001824050678829876, 0.001575992468878876, 0.001928587655175608, 0.001789715218466474, 0.001785745488980959, 0.002039746492280168, 0.002624829971995652, 0.001860982591730691, 0.002258245738515776, 0.001816019363546332, 0.0008682074277578272, 8.95014672301284e-06, 5.331241269874541e-10, 1.236564023271872e-16, 6.538100349246434e-27, 0, 1.249254009460689e-05, 2.173811166265256e-05, 1.920277751986165e-05, 3.184765554062149e-05, 3.419601773563948e-05, 3.582851659098894e-05, 4.795118888568333e-05, 3.659643544106261e-05, 4.486061607306827e-05, 3.897252645918617e-05, 5.097666337720796e-05, 2.895533466370694e-05, 3.355417864013686e-05, 3.9851418582338e-05, 1.717737818587793e-05, 2.067253988980009e-07, 1.61497713635801e-11, 6.327783071674748e-18, 6.056824177415585e-36, 0, 3.250841622302294e-08, 5.898610832029056e-08, 8.087334362913371e-08, 1.577983688505009e-07, 1.144478663253829e-07, 1.358614111575929e-07, 1.628212673981403e-07, 2.039752505538047e-07, 1.661029921132737e-07, 2.28873240972909e-07, 1.845605373441558e-07, 1.738048541313652e-07, 1.47126087355294e-07, 1.72237658394692e-07, 5.128087888190684e-08, 7.835220340045789e-10, 9.689985512566329e-14, 2.005272202247761e-20, 1.218416999491421e-40, 0, 1.254143125593861e-11, 2.28000425058439e-11, 2.893603607663901e-11, 4.185603485551896e-11, 4.944940011860714e-11, 3.975452202607874e-11, 6.353135123448967e-11, 4.99363399280067e-11, 5.355835957309422e-11, 7.068298092184243e-11, 5.175095363068698e-11, 5.786047969685261e-11, 5.259925491510342e-11, 4.910675975678349e-11, 2.157999153534684e-11, 3.300167200292237e-13, 3.522828694875554e-17, 4.35842362902604e-25, 1.371657526790846e-44]
+      ],
+     "16":[
+      [0.00752398366115756, 0.005663729886829836, 0.004204613133948371, 0.004140108597342948, 0.003063320296169087, 0.002744745807494627, 0.00428762800758426, 0.001985126069107163, 0.002271890480237578, 0.002355937031100118, 0.001704852257107966, 0.001931978221277712, 0.001744959203042327, 0.001408572837594189, 0.00126906682410469, 0.0004184912528227176, 1.204899031386566e-05, 3.211354053236937e-08, 2.335641074355747e-12, 6.362652728800817e-19, 0.005072438548723502, 0.005146977966076384, 0.004178912246970956, 0.00406594828589012, 0.003261022543484138, 0.00316582319394723, 0.002297528867635803, 0.002510607157510653, 0.002011765197667405, 0.002463126672537637, 0.002266094851259913, 0.001953824865768575, 0.001736924255301557, 0.001622860473183231, 0.001127540590489211, 0.0004160130104057444, 1.38496578530391e-05, 2.699108700088593e-08, 2.29487247924834e-12, 2.351329853194715e-26, 0.006445589132429088, 0.005900961367464927, 0.00463619367067157, 0.005300850670679446, 0.004166224526038357, 0.002966552235424114, 0.003141479769207202, 0.002459588122506517, 0.002327581002988953, 0.002070873093653547, 0.002019923100998678, 0.00159226100815088, 0.001634672171457496, 0.001712524126891009, 0.001431280707002589, 0.0002936170531472766, 1.277290336420897e-05, 2.231111466388867e-08, 2.162844816213337e-12, 4.372957750628426e-26, 0.007475074864960216, 0.006420982713985104, 0.005363476561664198, 0.003690776907099034, 0.004352137128471018, 0.00361187131445214, 0.003114483413454396, 0.002700586601428303, 0.002861895935330796, 0.00291373572932358, 0.002060049423044722, 0.001595432251827666, 0.001932757000354341, 0.001605950539378139, 0.001408400242917859, 0.000427721019027442, 1.54710930362031e-05, 2.103589019310992e-08, 2.174282566284466e-12, 1.215240483496306e-19, 0.00706397202636737, 0.004896632427920534, 0.005235771094994654, 0.005116735249548234, 0.002860762801664993, 0.003498682539716641, 0.003147737442607743, 0.003000538337973761, 0.002560416792359072, 0.002357556788613952, 0.001870797695362114, 0.001822333943030893, 0.002575806208246433, 0.002138175801032099, 0.00163976323736465, 0.0003845255116291709, 1.102911553038284e-05, 2.343649364041099e-08, 3.036815490125785e-12, 1.317224846371113e-18, 0.007743140254483025, 0.007413919351906336, 0.00623278057453128, 0.004323496494332446, 0.00426422554654307, 0.003140480265203065, 0.003306957276402245, 0.003304039574924252, 0.002610563757084503, 0.003004829961802014, 0.002507086775980285, 0.002506627574747605, 0.001845625099599304, 0.001987891732467628, 0.001729545307647931, 0.0004566946027870532, 1.277788852394919e-05, 2.658244822666939e-08, 1.990960170685709e-12, 9.970618366529079e-26, 0.008043775162206434, 0.006506189575812719, 0.004649332098377647, 0.004576953426695916, 0.005278332668038075, 0.004468607439531803, 0.003147632021346934, 0.003577431173230095, 0.002842804301111597, 0.002522369964576026, 0.002153418766470478, 0.001901616080345814, 0.001822385006653754, 0.001813758050003662, 0.00130092268542238, 0.0003965351339628402, 1.048414443637428e-05, 2.426317383746209e-08, 2.157264273725502e-12, 9.904256732561677e-19, 0.008898697909574175, 0.004987705304028264, 0.00509915139757959, 0.004480810654154409, 0.00486119604523432, 0.004034951907792458, 0.002872812644021663, 0.00333760438101707, 0.002458208616909775, 0.002542017449774581, 0.001862601831304925, 0.002341153595359388, 0.001623679692627635, 0.001931546343289909, 0.001493515668372241, 0.0004747068142758155, 1.036328063256467e-05, 2.948477837754e-08, 1.891416054188403e-12, 2.914017107311865e-18, 0.008407632114254054, 0.007705523193622047, 0.005706187365635145, 0.005281547761930527, 0.00381827302838473, 0.004168777974402107, 0.00448652901136755, 0.003372272419782869, 0.004979413681449963, 0.002434778806438735, 0.00168060726266599, 0.002041967146062524, 0.002047653409736915, 0.001517387379277877, 0.001309675149866812, 0.0005393841858268778, 1.055978965923959e-05, 2.008484111434074e-08, 1.665833077907248e-12, 3.012752097874862e-18, 0.006601023367007274, 0.008575360813657505, 0.005221620015288271, 0.005181413866635395, 0.004622507324015432, 0.003777164497566024, 0.003192381421186701, 0.003764256176730527, 0.002467761294498533, 0.002710401641717045, 0.001898291359698937, 0.002240796034254953, 0.002224143119379951, 0.001669875331686207, 0.002009333177849941, 0.000522985296407926, 1.220692706047109e-05, 2.334652294830661e-08, 2.019315536912621e-12, 1.002571866670916e-18, 0.008851564996248574, 0.004774035374232271, 0.0058840757392217, 0.005700653448624133, 0.004711057058379051, 0.003858078550852683, 0.003425716547690667, 0.002740417143059892, 0.002958668196534599, 0.002503797749209117, 0.002429058157966545, 0.002419550708970177, 0.002360350103218698, 0.001519172389433165, 0.001493779174809604, 0.0003565540417332302, 1.038950081333042e-05, 2.370092777530048e-08, 1.725130104876243e-12, 1.729742174930762e-25, 0.008493655280910025, 0.007521510752241212, 0.005807842072595728, 0.004309604971113349, 0.004835043440334695, 0.00343691099996902, 0.003817359388373241, 0.002910079976407497, 0.003246011528708802, 0.002869547149201765, 0.002981526160241958, 0.001805828732834335, 0.002229367312068905, 0.002021585058936945, 0.001763373023517151, 0.0004118056558774219, 1.086518198799041e-05, 2.126861347810322e-08, 2.576037372146331e-12, 1.398283998478752e-18, 0.009834973722188762, 0.01019108782627421, 0.007266556262731305, 0.004545883321262783, 0.003801407476911891, 0.003489506224265586, 0.002980113400775527, 0.002660597415625084, 0.003488902934718492, 0.003977283374940816, 0.002887915874423095, 0.003001091054278805, 0.002192927225573185, 0.00148166146698143, 0.002240749898095488, 0.0004863003991316918, 1.112321575784065e-05, 1.986216328944549e-08, 2.126729705858742e-12, 1.397550168317371e-18, 0.01171001136421246, 0.0113399073716609, 0.005738931957426574, 0.004454594193885219, 0.005633210158191892, 0.00447081095718967, 0.005132994508597944, 0.004116563616719152, 0.002973750677498545, 0.002921461454634833, 0.00284903322817955, 0.002110732237656323, 0.001872859599385472, 0.001786611057655848, 0.001921637955355197, 0.0006632177290216102, 1.180790788842009e-05, 1.798945861548904e-08, 1.541350844795816e-12, 2.069929271695548e-18, 0.007799955676019271, 0.01297944448044938, 0.007280427814029202, 0.007418747355375242, 0.005549201721844981, 0.005262477753411061, 0.003828859452368023, 0.003708027964336743, 0.002999517157055775, 0.002812773889791811, 0.003483431743039242, 0.003253148684127437, 0.002900553868538323, 0.002342370548060549, 0.002092595219114848, 0.0007002492931569775, 9.869495578783582e-06, 1.559625656216531e-08, 1.788960822804846e-12, 4.500083266131473e-19, 0.0639638226338418, 0.02952022375892316, 0.008050124980347866, 0.005284128562457688, 0.00506843919335813, 0.008653742348342887, 0.004692520872494629, 0.004861584103877659, 0.003948729170149868, 0.002498246181190755, 0.003508680680993634, 0.003794494669329651, 0.002593339604926826, 0.001358597655628085, 0.00197027772609176, 0.0007849024652670911, 9.392284317930116e-06, 1.133839512237693e-08, 1.377029195027507e-12, 9.278136873160424e-19, 0.0008787014440968143, 0.0005110342551982999, 0.0004744239442371748, 0.0004258253420042812, 0.0003538045407172067, 0.0003790977027436261, 0.0002825844836244996, 0.0003068634820423663, 0.0002579606870788471, 0.0002368588512547737, 0.0002520803629975973, 0.0003052943964045362, 0.000205407450588384, 0.0002289705625252341, 0.000167526053036077, 7.52259163778087e-05, 2.42265076208854e-06, 3.464374643909125e-09, 2.341902789073667e-13, 5.449605884816568e-20, 1.629032564631023e-05, 1.721148330559252e-05, 1.550360128002289e-05, 9.452659377915023e-06, 1.217296428354135e-05, 1.082553266166586e-05, 9.785508733596315e-06, 1.162161458752646e-05, 8.034714234530417e-06, 9.063544538611198e-06, 7.336430848871052e-06, 9.031359087002456e-06, 4.868184792444653e-06, 5.182275905640899e-06, 5.599793478550518e-06, 2.267019373836137e-06, 8.519521410614421e-08, 1.593941922298806e-10, 1.805402318987226e-14, 7.456610062868727e-29, 2.315920448594648e-07, 1.742903582822727e-07, 1.637095929892727e-07, 1.549217784470161e-07, 2.347155782277435e-07, 1.409955076558919e-07, 1.444035090141615e-07, 1.535707039709876e-07, 1.742778888112685e-07, 1.306009613609963e-07, 1.676718585157189e-07, 1.272512784521845e-07, 1.137220252452147e-07, 8.843267238557505e-08, 9.419166774239003e-08, 2.634090059518933e-08, 1.256179072324529e-09, 3.708057354694693e-12, 2.191000130175278e-16, 5.566771973191736e-33, 8.812985640793491e-10, 7.929702651021953e-10, 7.462775536269868e-10, 6.53723960300527e-10, 7.342663027206502e-10, 7.18492754871736e-10, 4.983557790620958e-10, 7.06747179692675e-10, 5.032311834950625e-10, 4.966944939383801e-10, 6.107734903463717e-10, 4.208707027460569e-10, 4.465586161233949e-10, 3.729318416318938e-10, 3.167904360436992e-10, 1.307889759593946e-10, 6.241637975308292e-12, 1.584243481314122e-14, 5.507781746920897e-20, 6.943672454768831e-36]
+      ],
+     "17":[
+      [0, 0.00143399193051379, 0.00207458516470683, 0.002985689037823492, 0.002870156921821099, 0.003132364783772919, 0.005721643598408484, 0.003011592020727856, 0.003838400027400141, 0.004363622669662567, 0.003419016465177509, 0.004153250173645264, 0.003987895185221278, 0.003566715735403874, 0.003632565229171889, 0.001554885512083487, 2.488485330614778e-05, 8.540173262923573e-09, 1.557897944853043e-14, 2.32682295999187e-23, 0, 0.001303159995863369, 0.002061910137504256, 0.002932215935230124, 0.003055401552159798, 0.003612918139520752, 0.003065956192940528, 0.003808799193616329, 0.003398923619738426, 0.004562170736805066, 0.004544580583523189, 0.004200227211784917, 0.003969544082556084, 0.004109336212444193, 0.003227471704286137, 0.00154568348458814, 2.860401805167423e-05, 7.178124864404707e-09, 1.530841648582347e-14, 8.6008113219036e-31, 0, 0.001494064865741605, 0.002287543198792792, 0.003822794235624872, 0.003903538080647614, 0.003385514846047838, 0.004192185545559017, 0.003731409946306994, 0.003932513171252092, 0.003835655062656165, 0.004050902934095307, 0.003422966850278293, 0.00373586957115508, 0.004336391562695858, 0.004096909762346473, 0.001090929148124517, 2.638038859784847e-05, 5.933678818905638e-09, 1.442898799729462e-14, 1.599933312746207e-30, 0, 0.00162573377556297, 0.002646399273766183, 0.002661671140114601, 0.004077740367217147, 0.004121983454452193, 0.004156171949202582, 0.004097037557852823, 0.00483526724281501, 0.005396814432148576, 0.004131387317156118, 0.003429794319046903, 0.004417123815572439, 0.004066541904328806, 0.004031428765006292, 0.001589196040186983, 3.195332947290124e-05, 5.594686901251272e-09, 1.450658830347963e-14, 4.447229684246134e-24, 0, 0.001239785844401933, 0.002583395358512962, 0.003690037595647698, 0.002680402999372983, 0.003992820264876336, 0.00420056041404016, 0.004552104995080874, 0.004325920848998448, 0.004366673799089447, 0.003751857757600842, 0.003917589666564599, 0.005886766105974012, 0.00541424352435724, 0.004693700316602102, 0.001428708558556899, 2.277924666105507e-05, 6.233323196400298e-09, 2.026312800574574e-14, 4.82156438866451e-23, 0, 0.001877146909525598, 0.003075341145855521, 0.003117986242000525, 0.003995394371034527, 0.003584037416566816, 0.004413047124794478, 0.005012559951698646, 0.004410658761273307, 0.005565571230280287, 0.005027940922506847, 0.005388675856726493, 0.004218017282443002, 0.005033712272649321, 0.004950709724416045, 0.001696859827205018, 2.639133211877171e-05, 7.070238988368917e-09, 1.328585239193911e-14, 3.650487539474282e-30, 0, 0.001647321437188812, 0.002294052021130138, 0.003300781757124718, 0.004945582826606849, 0.005099761999443206, 0.00420044378136198, 0.005427338016921, 0.00480305286026696, 0.00467196824833382, 0.004318675271941187, 0.004088051424226372, 0.004164916201780273, 0.004592786872674415, 0.003723816821941655, 0.001473341282331521, 2.165403091402327e-05, 6.453552208811757e-09, 1.439689909310961e-14, 3.627031942085104e-23, 0, 0.001262855466449826, 0.002516006897631104, 0.003231455191537782, 0.004554755699971587, 0.004604869214763567, 0.00383371444366053, 0.005063510084919066, 0.004153272073752438, 0.004708373108275297, 0.003735453492018913, 0.005032973837744326, 0.003710801771334222, 0.004891064011002107, 0.004275116002764919, 0.001763797577323754, 2.140457208258328e-05, 7.842620103093607e-09, 1.262383845565327e-14, 1.067387951455079e-22, 0, 0.001950995269774055, 0.002815536559438569, 0.003808938682739944, 0.003577586619306811, 0.004757611015004526, 0.005987205555209053, 0.005116119821431809, 0.008413003920385994, 0.004509756548498405, 0.003370472519715032, 0.004389800337215337, 0.004679776392783249, 0.003842341408117144, 0.003748892615638589, 0.002004116995078437, 2.181062379993412e-05, 5.342490952871812e-09, 1.111922647697244e-14, 1.103809935730299e-22, 0, 0.002171239360108811, 0.002576449444244878, 0.00373673475832445, 0.004331137850594804, 0.004310694918524101, 0.004260197066560266, 0.005710819811783641, 0.00416943554212817, 0.005020286169992511, 0.003807050758601499, 0.004817254500283859, 0.005083146603485422, 0.004228485028712188, 0.005751652731033887, 0.001943192928575072, 2.521289361263117e-05, 6.210258534856529e-09, 1.347987943726691e-14, 3.674067333514675e-23, 0, 0.001208765748025779, 0.002903326161393056, 0.004111211723332966, 0.004414118407263004, 0.004403050559655062, 0.004571593018760072, 0.004157547173854917, 0.004998867290151606, 0.004637621479929448, 0.004871525115810974, 0.005201555469065422, 0.005394455043122054, 0.003846883784824593, 0.004275908319674621, 0.001324809341742101, 2.145925001814124e-05, 6.304706676760005e-09, 1.151708019693416e-14, 6.340356273227836e-30, 0, 0.001904420289847563, 0.002865718842754829, 0.003108020504137114, 0.004530302540222565, 0.003922402039925485, 0.005094251714158891, 0.004414958788317874, 0.005484368462610825, 0.005315090287733321, 0.005979527793335628, 0.003882185662129021, 0.005095115391490779, 0.005119119662647103, 0.005047629326850014, 0.001530107330098197, 2.24419388138807e-05, 5.657841513135107e-09, 1.719932493423287e-14, 5.126587320088358e-23, 0, 0.002580355034256044, 0.003585490895083996, 0.003278429888483819, 0.003561824001027911, 0.003982437838629171, 0.003976961190265856, 0.004036473527328507, 0.005894767384696071, 0.007366904472927071, 0.005791806305608689, 0.006451788863555774, 0.00501184754626433, 0.003751919386749733, 0.006414132406382989, 0.001806906915617548, 2.297509073244315e-05, 5.283846577389112e-09, 1.420071572703072e-14, 5.125084797813641e-23, 0, 0.002871248733016704, 0.002831740483684772, 0.003212611102926729, 0.005278206563497527, 0.005102391011715914, 0.006850018896826454, 0.006245398992804034, 0.005024406400106997, 0.005411293546098303, 0.005713858018505736, 0.004537708215264954, 0.004280370019959733, 0.004524150193103369, 0.005500708549373307, 0.002464281954962054, 2.438972045336815e-05, 4.785924285124059e-09, 1.029382539883741e-14, 7.594347927027847e-23, 0, 0.003286405638327506, 0.003592386286072844, 0.005350376586059682, 0.005199537408112925, 0.006005946740022965, 0.0051096855801272, 0.005625642770213101, 0.005067985467329808, 0.005210022183241398, 0.006986233021596718, 0.006993767395565519, 0.006629196512114401, 0.005931526841910124, 0.005990130364497981, 0.002601907508711881, 2.038636886979118e-05, 4.149600338176693e-09, 1.195085212360387e-14, 1.652247836258355e-23, 0, 0.007474972225755754, 0.003972406195699435, 0.003811115181318236, 0.004749341586573922, 0.0098768893162173, 0.00626261983819559, 0.007376190237687456, 0.006672162198653951, 0.004627701213022319, 0.007037283342981837, 0.008158057447020623, 0.005927410602700351, 0.003440548603227395, 0.005640335580500695, 0.00291667319895037, 1.940402780418179e-05, 3.018577673851534e-09, 9.217163872831834e-15, 3.424135260913417e-23, 0, 0.0001294181716559262, 0.0002341385878499468, 0.0003071607040676605, 0.0003315722149183701, 0.0004327360518914821, 0.0003771846506449593, 0.0004656456688339127, 0.0004359322935824129, 0.0004388096915690902, 0.0005056581258456083, 0.0006564606901044683, 0.0004695471571091255, 0.0005799287196178643, 0.0004796443733422572, 0.0002795865352573507, 5.007287184776765e-06, 9.237911617783254e-10, 1.575858611926976e-15, 2.039378752298612e-24, 0, 4.359338894675755e-06, 7.652373847909117e-06, 6.819389712434059e-06, 1.140955309873046e-05, 1.235887713476001e-05, 1.306312938358074e-05, 1.763742998422909e-05, 1.357984560107719e-05, 1.679360751602945e-05, 1.471846910787294e-05, 1.942242228871769e-05, 1.112989511050118e-05, 1.31273735779547e-05, 1.603518283205247e-05, 8.427543297685304e-06, 1.762131110357546e-07, 4.26276624235204e-11, 1.227010862294853e-16, 2.865980470300667e-33, 0, 4.413948110413319e-08, 8.079591673176339e-08, 1.117521568664304e-07, 2.199715206269927e-07, 1.6094877070128e-07, 1.927501310323473e-07, 2.330402124335474e-07, 2.945241854133731e-07, 2.419620575601136e-07, 3.363517784561888e-07, 2.736333443629029e-07, 2.599717173310241e-07, 2.239905162522391e-07, 2.696980866423104e-07, 9.792392968121071e-08, 2.600253842890877e-09, 9.958474977267241e-13, 1.512037745703638e-18, 2.231905635880152e-37, 0, 2.006425366025931e-10, 3.679833229619048e-10, 4.711407207259407e-10, 6.875295403297177e-10, 8.194425802709709e-10, 6.646160138744649e-10, 1.071523412184399e-09, 8.496931677467486e-10, 9.19405437654265e-10, 1.224141369143889e-09, 9.042208632187685e-10, 1.019953031252445e-09, 9.43776729197017e-10, 9.062865297731825e-10, 4.858723794373954e-10, 1.292383509026687e-11, 4.275457289820033e-15, 3.877459891835544e-22, 2.948057231062126e-40]
+      ],
+     "18":[
+      [0, 1.704130147649897e-17, 1.997928979366209e-16, 9.830229468578203e-16, 2.268983032342308e-15, 4.899052350717697e-15, 1.566326075981047e-14, 1.326079499346469e-14, 2.555435741566212e-14, 4.189659639546985e-14, 4.560980988446667e-14, 7.469130550943415e-14, 9.430440927964905e-14, 1.373914620531048e-13, 2.690277140712203e-13, 1.837022092516329e-12, 9.794802523962826e-13, 1.218801869530709e-14, 7.978720845919996e-19, 3.088062303379491e-26, 0.0005215926851666585, 0.0005223443353336918, 0.0004185591658488577, 0.0004019237068890363, 0.0003181433739227377, 0.0003048191079184371, 0.0002183243109985101, 0.0002354532091625297, 0.0001862031448946788, 0.000224998424047804, 0.0002042927523469442, 0.0001738368292752431, 0.0001525167213569707, 0.0001387957011567944, 9.248064261705584e-05, 2.544174570522384e-05, 3.799058062541715e-07, 1.521072529167696e-10, 8.983682405986073e-16, 1.547989647572266e-31, 0.001312232472054306, 0.001185661768446885, 0.0009193664281047207, 0.001037434795494575, 0.0008047207920559484, 0.0005655109311219176, 0.0005910291014240517, 0.0004566902289272985, 0.0004265284564406921, 0.0003745240459374723, 0.0003605314951821515, 0.0002804813084172603, 0.0002841847458955744, 0.0002899780072813408, 0.0002324218925135311, 3.555127907233164e-05, 6.936854726436011e-07, 2.48934489559841e-10, 1.675788485358591e-15, 5.680828859502484e-31, 0.002259737130209291, 0.001915727612676988, 0.001579311045212076, 0.00107257396494174, 0.001248243579021351, 0.001022387413916248, 0.0008700713048423893, 0.0007445805216944074, 0.0007787378421758736, 0.0007824752697797984, 0.0005459844321941199, 0.0004173133565904762, 0.0004989322872594338, 0.0004037892994601009, 0.0003396038597366486, 7.690051796118619e-05, 1.247645558169629e-06, 3.485213126124497e-10, 2.50146043973721e-15, 2.342064000834703e-24, 0.002818593995879924, 0.00192828374253082, 0.00203490020166602, 0.001962653270368505, 0.001082978418153363, 0.001307160598248405, 0.001160669339237856, 0.001091927830443091, 0.000919579553176333, 0.0008356488640157578, 0.0006544412353276021, 0.000629148403336619, 0.0008776447591612288, 0.0007095896808501277, 0.0005218779465847987, 9.125055448291715e-05, 1.173965220426748e-06, 5.125250398929166e-10, 4.611668641916735e-15, 3.349720552673264e-23, 0.003823073235553888, 0.003612711096950574, 0.002997479645190236, 0.002052096076468024, 0.001997515070852423, 0.001451885698744371, 0.001508865566538384, 0.001487825340663903, 0.001160178743804504, 0.001317933603909263, 0.001085238438784457, 0.001070845772008722, 0.0007781459339421266, 0.0008163353664098811, 0.0006811327749677534, 0.0001341061442154468, 1.683017986673438e-06, 7.193548035246993e-10, 3.741515491646182e-15, 3.137326968782711e-30, 0.004717784237463709, 0.003766125169248087, 0.002656119652859045, 0.002580606194368392, 0.002937171603319461, 0.002454094213157912, 0.001706037567479449, 0.001913641910614359, 0.001500791096728856, 0.001314211015675039, 0.001107304303216505, 0.0009650340868563674, 0.0009127259640325478, 0.0008847854267853415, 0.0006086029836577802, 0.0001383208445814676, 1.640395281335083e-06, 7.799965661628419e-10, 4.81626715001161e-15, 3.702306834654316e-23, 0.006027709427607982, 0.003334390920331237, 0.003364361596034705, 0.002917759753952315, 0.003124088985690322, 0.002559205084889649, 0.001798289640851942, 0.002061920665063537, 0.00149878635238058, 0.001529616508019236, 0.001106130184328156, 0.00137213692089263, 0.0009391789890242563, 0.001088206949080523, 0.0008069379852057582, 0.0001912403885902776, 1.87268040547601e-06, 1.094725293379347e-09, 4.877363390784759e-15, 1.258203282955665e-22, 0.006443055675423268, 0.005827874626700408, 0.004259348034098109, 0.003890867936071171, 0.002776128617391853, 0.002991354193590116, 0.00317727765867314, 0.002356959384766778, 0.003434721746623899, 0.001657509060345074, 0.001129132281050474, 0.001353968840129508, 0.001339975450303755, 0.0009671531042700862, 0.0008005461910353572, 0.0002458358396609553, 2.158823886990934e-06, 8.436895970534195e-10, 4.860346241725561e-15, 1.471952902248113e-22, 0.005633546174009823, 0.007222921170844876, 0.004340650010283922, 0.004250949721300876, 0.003742851701090658, 0.003018404111743545, 0.002517745787111694, 0.002929955595543425, 0.001895697001500019, 0.002054861137222946, 0.001420345152135811, 0.001654682553286852, 0.00162089756952582, 0.001185319083406757, 0.001367814678297193, 0.0002654540571818893, 2.779226236510185e-06, 1.092203788024992e-09, 6.562043878093873e-15, 5.45620308546005e-23, 0.008308976179566751, 0.004422857719407155, 0.005380029084611352, 0.005144215940617773, 0.004195659574620553, 0.003391090812993425, 0.002971702994490286, 0.002346148079128068, 0.002499878606263707, 0.00208787723218615, 0.001999059994699356, 0.001965187478848029, 0.001892021960783286, 0.001186083348373039, 0.001118455370506955, 0.0001990593625499569, 2.601790318377526e-06, 1.219603093097299e-09, 6.166823116793436e-15, 1.035652789171673e-29, 0.008681877051031095, 0.007587766637800805, 0.005782461067064154, 0.004234708931955027, 0.004688930681177123, 0.003289487165093806, 0.003605857700876338, 0.002712909030346384, 0.002986512120573941, 0.002605617432213081, 0.002671887188172782, 0.001597119467716038, 0.001945910979685932, 0.001718667155155352, 0.001437699396377115, 0.000250346539648751, 2.962847918566444e-06, 1.191787376284244e-09, 1.002840610832922e-14, 9.118577423015228e-23, 0.01085623213465282, 0.01110238660569016, 0.007812921789663547, 0.004823822342260213, 0.003981115497430124, 0.003606706566856383, 0.003039941679345476, 0.002678529300857816, 0.003466490747580639, 0.003900055261207837, 0.002794801558691668, 0.00286633514570451, 0.002067057311058114, 0.001360303200606332, 0.001972896440482795, 0.0003192576540656223, 3.275614788887894e-06, 1.201954368462741e-09, 8.941864405827594e-15, 9.844602476155251e-23, 0.01477764450757087, 0.01412366115886162, 0.007054364466660188, 0.005404097190650871, 0.00674463255166167, 0.005282933362582016, 0.005986117814426226, 0.004737989287322436, 0.003377907304112893, 0.00327511392773185, 0.003152143570104466, 0.002304745572076215, 0.002018252891493083, 0.001875248584632214, 0.001934303549356075, 0.0004977780850390516, 3.975426844026601e-06, 1.244661873661602e-09, 7.410689932414199e-15, 1.667872571888597e-22, 0.01169354774116784, 0.01920437363498806, 0.01063138825401526, 0.01069182518721897, 0.007892945819941677, 0.007387293858277809, 0.00530456982924052, 0.005070006789981442, 0.004047630265672409, 0.003745996777647508, 0.004578488466650666, 0.004219880208607287, 0.003713279867442863, 0.002920726309084149, 0.002502331370254093, 0.000624367243761044, 3.947499594591443e-06, 1.2820572656895e-09, 1.02217199303081e-14, 4.311463231043059e-23, 0.1755514834304278, 0.07996125489709516, 0.02152046294469178, 0.01394153391042152, 0.01319771629737209, 0.02223898889885779, 0.01190153519965019, 0.01216912732962015, 0.00975490408992368, 0.006090936550321927, 0.008442577176759091, 0.00901086854193095, 0.006077889142238255, 0.003101294986005553, 0.004313249836158733, 0.001281235995398975, 6.87833294074077e-06, 1.707595450137561e-09, 1.444163240158987e-14, 1.638315871404867e-22, 0.003298734901622277, 0.001893414810851635, 0.001734807318967767, 0.001536753615470069, 0.001260153472728212, 0.001332593510211955, 0.0009803486599215625, 0.001050660407089314, 0.0008716754118870576, 0.0007899038019362792, 0.0008296713962216067, 0.0009916710905216914, 0.0006584850667770695, 0.000714938731771364, 0.0005016464642733865, 0.0001679728211450277, 2.427792739835315e-06, 7.150892353179203e-10, 3.383186954889471e-15, 1.34098893297695e-23, 3.977021486066808e-05, 4.147012384223124e-05, 3.686699696049872e-05, 2.218434443797107e-05, 2.819522958352611e-05, 2.474654288105171e-05, 2.207668806201139e-05, 2.58762601267925e-05, 1.765587632657691e-05, 1.965621957760952e-05, 1.570251090960472e-05, 1.907739244862458e-05, 1.014878053815672e-05, 1.052269449356574e-05, 1.090449526721981e-05, 3.292092870450436e-06, 5.555718185157735e-08, 2.147276330320854e-11, 1.718542499989553e-16, 1.236662111861782e-32, 1.425381695797516e-07, 1.058686541510836e-07, 9.814180518115793e-08, 9.165953813986463e-08, 1.370540193477617e-07, 8.125296184452767e-08, 8.212873402342016e-08, 8.620026584544607e-08, 9.65438826326247e-08, 7.140201623225204e-08, 9.047014826837589e-08, 6.776223015416637e-08, 5.97654129545816e-08, 4.526639019569416e-08, 4.623818140770335e-08, 9.643202809001309e-09, 2.066793226227325e-10, 1.265898212316591e-13, 5.365194795967875e-19, 2.463486465683046e-37, 4.425662881165702e-11, 3.930012530386526e-11, 3.650217422542913e-11, 3.155684920814536e-11, 3.498108385338525e-11, 3.378174222713846e-11, 2.312483755361577e-11, 3.236550377213675e-11, 2.274387612577711e-11, 2.215462914867466e-11, 2.688642589512157e-11, 1.828432359415293e-11, 1.914632992950053e-11, 1.557359622511686e-11, 1.268672202915554e-11, 3.906129427921008e-12, 8.385543883920554e-14, 4.442218828039998e-17, 1.130984058538835e-23, 2.714130829199935e-41]
+      ],
+     "19":[
+      [0, 1.521186077000574e-36, 2.822252524984273e-34, 6.952821607745558e-33, 5.016496445597628e-32, 2.615402836959047e-31, 1.714948905493914e-30, 2.660379279444252e-30, 8.650175047232711e-30, 2.246814569877371e-29, 3.687189859182759e-29, 8.743738084098917e-29, 1.546438900557078e-28, 4.08307646842905e-28, 1.749100652407384e-27, 2.59184901729498e-25, 2.928481573801591e-24, 2.287798106474871e-25, 2.437189608542414e-29, 4.120285521924393e-37, 2.510302252978976e-05, 2.486141723228342e-05, 1.97015504898297e-05, 1.870948430824371e-05, 1.464589144467266e-05, 1.387745862770038e-05, 9.829801975603265e-06, 1.048388612709355e-05, 8.199357027069906e-06, 9.798226219212484e-06, 8.798248871105718e-06, 7.403898730162135e-06, 6.424090236585196e-06, 5.717701484273115e-06, 3.677692006532513e-06, 7.904183814478642e-07, 6.044281747456215e-09, 6.609891782491204e-13, 4.710086403012799e-19, 3.754668094060777e-36, 0.0001259425752702104, 0.0001125374510424509, 8.629774643705049e-05, 9.630443072129587e-05, 7.387634737182229e-05, 5.134238284375509e-05, 5.306629886481003e-05, 4.055147564234376e-05, 3.745484961159438e-05, 3.252482378754967e-05, 3.096376421127215e-05, 2.382263850393099e-05, 2.387053713415515e-05, 2.382197573332037e-05, 1.843184459892339e-05, 2.202584400286188e-06, 2.200891273668151e-08, 2.157262696819753e-12, 1.752491701483496e-18, 2.752574736630622e-35, 0.0003243756950457678, 0.0002719559792745801, 0.000221721128820693, 0.0001489159797291541, 0.0001713910447792919, 0.0001388286510859126, 0.00011684049036123, 9.888381305059439e-05, 0.0001022774558602358, 0.0001016329323046583, 7.013251127996556e-05, 5.301231969853714e-05, 6.2680380533061e-05, 4.961307056295788e-05, 4.028032479268883e-05, 7.125824485264906e-06, 5.920460923393271e-08, 4.517277198666571e-12, 3.912789707010945e-18, 1.698234028209487e-28, 0.0005378969058090203, 0.000363925034231227, 0.0003798032370170211, 0.0003622711691757388, 0.0001976900108123927, 0.0002359764671489269, 0.0002072159463703717, 0.0001927896011086788, 0.0001605661809741194, 0.0001442991578029456, 0.000111759877992512, 0.0001062536245577758, 0.0001465834400007733, 0.0001159110178949057, 8.229347740434961e-05, 1.124132329283142e-05, 7.4061978913993e-08, 8.831573981625914e-12, 9.590421962333093e-18, 3.229960845565783e-27, 0.0009093406892741892, 0.0008498097467527009, 0.0006972993689846731, 0.0004721014805870924, 0.0004544671211683246, 0.0003266778244398847, 0.0003357474240482552, 0.0003274078592077366, 0.0002524859141127784, 0.0002836488179831011, 0.0002309871963244832, 0.0002254057842587684, 0.0001619849522288677, 0.0001662009538545692, 0.0001338676730544057, 2.059102728285727e-05, 1.323353722229383e-07, 1.544943463305389e-11, 9.697917890034084e-18, 3.771012831196418e-34, 0.001342674887542353, 0.001059990587062194, 0.0007393148818154086, 0.0007103594966187723, 0.0007995773953028722, 0.0006606892497188625, 0.0004542234094013807, 0.0005038677970194634, 0.000390797047490004, 0.0003384319278993723, 0.0002819996078735162, 0.0002430522019579634, 0.0002273384001679561, 0.0002155369003170403, 0.0001431188310879022, 2.541181483957551e-05, 1.543313264002381e-07, 2.004377779450607e-11, 1.49369103046616e-17, 5.325073519638019e-27, 0.001995581624073244, 0.001091712214690973, 0.001089353606449931, 0.0009343086723237349, 0.000989324984927412, 0.0008014851731731166, 0.0005569612209772813, 0.0006315565916208759, 0.0004539992655711366, 0.0004582190883874835, 0.0003276967615060553, 0.0004020117478215867, 0.00027212293681567, 0.0003083752758497689, 0.0002207431532671675, 4.087069199343385e-05, 2.049525086007009e-07, 3.272464466849793e-11, 1.759617379215145e-17, 2.105279677189273e-26, 0.0024307410465886, 0.002174360137896367, 0.001571588921337354, 0.001419766622681086, 0.001001808668422593, 0.001067549107550918, 0.001121373022367403, 0.0008226631388090967, 0.001185595651434536, 0.0005658171964241658, 0.0003811889870422414, 0.0004520428226281785, 0.0004424286432362467, 0.0003123150382238794, 0.0002495531655214775, 5.986970523375158e-05, 2.692377804642257e-07, 2.873958581296308e-11, 1.998146256293241e-17, 2.806691325710563e-26, 0.002384069638070335, 0.003022904450538066, 0.00179655644884449, 0.001739989817364306, 0.001515088800648083, 0.001208335880554896, 0.0009967748624722733, 0.001147152725745082, 0.0007340137974134587, 0.0007868518521484995, 0.000537872913952172, 0.0006196919509321301, 0.0006003330083039237, 0.0004293615971735065, 0.0004782931902040331, 7.251727611839701e-05, 3.88805628075324e-07, 4.173400743436742e-11, 3.026118738183912e-17, 1.16704469266396e-26, 0.003895649709876093, 0.002050736302531786, 0.002466982260932473, 0.002332787793030209, 0.001881616078948312, 0.001503990217858788, 0.001303424570569024, 0.001017679260415395, 0.001072382012865465, 0.000885749163489671, 0.0008387005117633766, 0.0008153807478526981, 0.0007763510072540041, 0.0004759906514811508, 0.0004332922137469306, 6.024624103050024e-05, 4.032513448885646e-07, 5.162957100384983e-11, 3.15064566993224e-17, 2.454189389245396e-33, 0.004464538660579363, 0.003858792163117418, 0.002908202820702888, 0.002106251261511203, 0.002306402786333723, 0.001600163486345741, 0.001734681126991832, 0.001290688089953601, 0.001405158932553874, 0.001212403016705132, 0.001229503476371935, 0.0007268159184039081, 0.0008757607509184549, 0.000756494108271598, 0.0006108869800936803, 8.31035227735716e-05, 5.036664726861854e-07, 5.53359789104143e-11, 5.619479237569453e-17, 2.370009210404494e-26, 0.006072515007952413, 0.006141582452679001, 0.004274171741470188, 0.002609783224940472, 0.002130063915993242, 0.001908417921154938, 0.001590753311811469, 0.001386146034126476, 0.001774098485112712, 0.001973938554415853, 0.001398907926014396, 0.001418863135419106, 0.001011909177684531, 0.0006512923807169486, 0.0009118503469759209, 0.0001152777790297295, 6.056930645148567e-07, 6.070459016208509e-11, 5.450219039693627e-17, 2.783195787564138e-26, 0.009587770118372757, 0.009062210613515824, 0.004476301240335667, 0.003391245261877302, 0.004185709359599249, 0.00324235619587663, 0.003633337637424935, 0.002843999862592682, 0.002005202865589347, 0.001922702928834237, 0.001830067247858703, 0.001323303397719058, 0.001146007604578153, 0.001041410656402417, 0.001036971426998904, 0.0002084792422240116, 8.526398168884508e-07, 7.2912875465917e-11, 5.239105686522588e-17, 5.469133296195771e-26, 0.009222392623321985, 0.01497862414306212, 0.008200423904906081, 0.008155917212205281, 0.005954356106615266, 0.005511323085216067, 0.003913772438247549, 0.003699379932333968, 0.002920763003405783, 0.002673240713803482, 0.003231231475249418, 0.002945245113707139, 0.002563034651469054, 0.001971691220454127, 0.00163069159615161, 0.0003178716657726862, 1.029170844178766e-06, 9.129337893032898e-11, 8.783950246600944e-17, 1.718446009843249e-26, 0.2978044789437757, 0.1341469386889235, 0.03570485735478579, 0.02287498750081366, 0.02141528183377599, 0.03568739367227689, 0.01888763822949965, 0.01909893156748767, 0.01514076084055341, 0.009349403904917137, 0.0128159301269846, 0.01352748575566812, 0.009023575199098337, 0.004503188326791865, 0.006045893314701898, 0.001403034084718703, 3.85716040438319e-06, 2.615186992550241e-10, 2.668545054078855e-16, 1.403580301858501e-25, 0.01189508418948705, 0.006752121011759089, 0.006118149921821193, 0.005359788043826309, 0.004346517149100661, 0.004545590605224254, 0.003307104641126221, 0.003505133647634791, 0.002875887780522329, 0.002577308206901753, 0.002677154109227307, 0.003164536426367428, 0.002078086688408002, 0.002206670057873977, 0.001494667596448112, 0.0003909884855999914, 2.893718973955688e-06, 2.327238204563835e-10, 1.327611146660703e-16, 2.436688809493611e-26, 0.000223005226791356, 0.0002299674474126337, 0.0002021821420048972, 0.0001203166410811401, 0.0001512268398050892, 0.0001312628995774175, 0.000115807228875935, 0.0001342386648376312, 9.058156886201216e-05, 9.972982994851812e-05, 7.878958092141447e-05, 9.466586000603208e-05, 4.980385939933812e-05, 5.050401239890223e-05, 5.052205567781293e-05, 1.191545507421413e-05, 1.029520004024848e-07, 1.085927727622732e-11, 1.046535762559979e-17, 3.478000235459314e-35, 8.790392406460595e-07, 6.456796090999616e-07, 5.919382023306329e-07, 5.467297357640695e-07, 8.084619163505941e-07, 4.740016007601806e-07, 4.738147887641694e-07, 4.918073609112821e-07, 5.447336161939231e-07, 3.984216698013488e-07, 4.992417545764061e-07, 3.697996342232565e-07, 3.22553652922069e-07, 2.389321617265627e-07, 2.355976757751538e-07, 3.838088326747458e-08, 4.210162916025071e-10, 7.030272992500459e-14, 3.578755258087689e-20, 7.552920035023341e-40, 2.156430392282018e-10, 1.893739087037065e-10, 1.739458457931716e-10, 1.487161416659254e-10, 1.63029768721183e-10, 1.55698669268253e-10, 1.054024692159466e-10, 1.458893990939428e-10, 1.013853369847403e-10, 9.766624502201893e-11, 1.172148009034048e-10, 7.88311189030583e-11, 8.163450816985439e-11, 6.494058150966133e-11, 5.106646071075285e-11, 1.227896080881683e-11, 1.348125926005607e-13, 1.943028947899266e-17, 5.913615926138122e-25, 6.468334210980311e-44]
+      ],
+     "20":[
+      [0, 0.0017714384610406, 0.002524607879356142, 0.003579233191702939, 0.003389481532241145, 0.003644027359719746, 0.006557091190928351, 0.003399907844500674, 0.004268755603698418, 0.004780548868866149, 0.003689867305409109, 0.004415461492417647, 0.004176472930554335, 0.003624838920926883, 0.003519761544023242, 0.001078486219035211, 6.948700313783179e-06, 4.02733233004212e-10, 3.907091848282478e-17, 7.626699513154607e-28, 0, 0.001596088439619316, 0.002487781591009053, 0.003485147969636935, 0.00357746816833841, 0.004167228101771391, 0.003483663710931546, 0.004263231785393754, 0.003747764795529782, 0.004955437194011882, 0.004862764510658201, 0.004427317550478134, 0.004121795586884753, 0.004140681138887164, 0.003100574620429679, 0.001062960209470106, 7.91914098398793e-06, 3.356251128209191e-10, 3.806877335493858e-17, 2.795807053456106e-35, 0, 0.001814298654492936, 0.00273647782641417, 0.004504911967783304, 0.00453154209970468, 0.003871631292653022, 0.004722705832978635, 0.004140987849177034, 0.004299136496682497, 0.004130761459658728, 0.004297554584548138, 0.003577261774370798, 0.003846074316035377, 0.004332202633586475, 0.003902261114366574, 0.0007438296731048062, 7.241274259153423e-06, 2.750808426605523e-10, 3.557940367982962e-17, 5.157797417015209e-35, 0, 0.001957352884817618, 0.003138761914248138, 0.003109855133793925, 0.004693399763793337, 0.004673646845084145, 0.004642204708287495, 0.004507973154628596, 0.005240972952646129, 0.0057624669666911, 0.004345561219760751, 0.003553828830264406, 0.004508644006929115, 0.004027967355409735, 0.00380714450591324, 0.001074323797187498, 8.696268574086051e-06, 2.571610476055017e-10, 3.546928540951476e-17, 1.421826898674382e-28, 0, 0.001479949904252039, 0.003037907318966279, 0.004274616857512846, 0.003058783317373467, 0.004488591182148428, 0.004651774573369078, 0.004965972308036151, 0.004648904823696586, 0.004622770865241385, 0.003912703900011769, 0.004024649251007367, 0.005957496844881127, 0.005317152982787622, 0.004394772840874436, 0.0009575961497843529, 6.146663596265418e-06, 2.840811066358934e-10, 4.912676682656308e-17, 1.528762594131828e-27, 0, 0.002221669782415824, 0.003585567043663965, 0.003581141663519739, 0.004520528121817499, 0.003994695969070049, 0.004845414086878882, 0.005421662915323985, 0.004699551981066408, 0.005841740734774116, 0.005198783170277353, 0.00548873264249301, 0.004232298831081981, 0.004901293374370209, 0.004595888689159185, 0.001127628365306429, 7.060653578741624e-06, 3.194848906085405e-10, 3.193933297685916e-17, 1.147883999040693e-34, 0, 0.001933039655255179, 0.002651850141203853, 0.00375876595374516, 0.005547894187564646, 0.005635627423378374, 0.004572657565802933, 0.005820241100925493, 0.005074012585147168, 0.004861984768887528, 0.004427344028514029, 0.004128454978723061, 0.004143386327971742, 0.004433837845691263, 0.00342745351174591, 0.0009707444515673564, 5.743889702357301e-06, 2.891404152706466e-10, 3.431865716080161e-17, 1.13108100998635e-27, 0, 0.001469256072649641, 0.002883626282455733, 0.003648447017264014, 0.005065906962537724, 0.005045347664822632, 0.004137849569920559, 0.005383778951043492, 0.004350167645546751, 0.004858095225188696, 0.003796798058289919, 0.005039382511092502, 0.003660145664543125, 0.004681535537369291, 0.003901329691673932, 0.00115221120044753, 5.629345187382224e-06, 3.483895441499085e-10, 2.983855880480334e-17, 3.301109804165098e-27, 0, 0.002250514211801584, 0.003199410864489148, 0.004263787802974818, 0.003945154131472161, 0.005168260855854537, 0.006407089689666197, 0.00539334184130803, 0.008736719752754177, 0.00461349394655555, 0.003396617661931732, 0.004357918768878475, 0.004576541792818102, 0.003646386126245555, 0.003391950435011205, 0.001298041179044555, 5.687267450225603e-06, 2.353108271332089e-10, 2.606071116608142e-17, 3.385536196950152e-27, 0, 0.002483220068012554, 0.002902768695025023, 0.004147303651876139, 0.004735412157782481, 0.004642850965753892, 0.004520102526297168, 0.005968946157097267, 0.004292957050071861, 0.005091987151202378, 0.003803877402343306, 0.00474150190280224, 0.004928638268347075, 0.003978629427959826, 0.005159660933042345, 0.001247853571271256, 6.518425936571142e-06, 2.712078124215844e-10, 3.132731329642142e-17, 1.117573016109922e-27, 0, 0.001370666755798542, 0.003243163622406616, 0.004524031616856228, 0.004785000446196853, 0.004701899626459338, 0.004809150674319827, 0.004308425794107454, 0.005103088688214317, 0.004663761748664755, 0.004825974523232745, 0.005076119183448352, 0.00518589990085439, 0.003588723606528725, 0.003803112413394023, 0.0008434972086945112, 5.500717067905174e-06, 2.729933208069592e-10, 2.654025997357686e-17, 1.912662032200807e-34, 0, 0.002141090518497802, 0.003173869780807773, 0.003390956003148871, 0.004869088860477386, 0.004152926819524012, 0.005313292378557243, 0.004536183118485289, 0.005550992335374306, 0.005299491496931987, 0.0058731280078861, 0.003756274998568614, 0.004856384692560094, 0.004734877436114985, 0.004451237495125396, 0.0009659062681910049, 5.703613787263338e-06, 2.429029300815106e-10, 3.930067470387463e-17, 1.533729807981097e-27, 0, 0.00287630180596887, 0.003937194842464783, 0.003546393622395306, 0.003795558654003345, 0.004180554928780758, 0.004112609022206405, 0.004111959134867696, 0.005915526899312689, 0.007282682093770823, 0.005640263196131816, 0.006189335019563347, 0.004736305190272377, 0.003440723210162752, 0.005608077791179349, 0.001130920164579678, 5.789381714459091e-06, 2.24919565275372e-10, 3.217546604613239e-17, 1.520609239249307e-27, 0, 0.003146242011966228, 0.003056736828468863, 0.003416217443279865, 0.005529119092095323, 0.005265322478385823, 0.006963445010752667, 0.006254220389872075, 0.004956531091122218, 0.005258643431531298, 0.00546992165453971, 0.00427924090970349, 0.003976394579312932, 0.004078491873856799, 0.004727822101063144, 0.001516189546232062, 6.041613476152955e-06, 2.002781839137223e-10, 2.293210804625361e-17, 2.216152483839904e-27, 0, 0.003504614600012658, 0.003773856746173161, 0.005536935633089321, 0.00530068550583709, 0.006031571497029329, 0.005055036800586644, 0.005482553859869494, 0.004865485704364392, 0.004927310963086431, 0.006508673744823738, 0.006418582612519428, 0.005993311382495533, 0.005203875512373096, 0.005010448781402618, 0.001557950488497005, 4.914635366397663e-06, 1.690092027361004e-10, 2.591791911371082e-17, 4.696133463901107e-28, 0, 0.006591580080777452, 0.003450775953789975, 0.003261353113594371, 0.004003697596699229, 0.008202186456796892, 0.00512326204878114, 0.005944333705457036, 0.005296850377892208, 0.003619061348125597, 0.005421440361618931, 0.006191201105220948, 0.004431300105445323, 0.002496021578153706, 0.003901267186456074, 0.001444157267221232, 3.868573911072069e-06, 1.017240666249968e-10, 1.656495536584387e-17, 8.093772058248425e-28, 0, 6.823947225956343e-05, 0.0001216174030925242, 0.0001571702059516901, 0.0001671337058189702, 0.0002148769571249325, 0.0001845020281922234, 0.000224379193485772, 0.0002069309518706543, 0.0002051925275656696, 0.000232927496926843, 0.0002978862494860517, 0.0002098932322802489, 0.000251563368548813, 0.0001983677430371404, 8.277414573977702e-05, 5.970317716790137e-07, 1.863970189664742e-11, 1.702524243775139e-18, 2.925296598619273e-29, 0, 8.504438113184022e-07, 1.470617964152935e-06, 1.291003617591105e-06, 2.127788281260223e-06, 2.270472228222786e-06, 2.364075713244908e-06, 3.144314692443171e-06, 2.384853257516973e-06, 2.905270243037574e-06, 2.508305714292879e-06, 3.260589264921592e-06, 1.84059499090406e-06, 2.106651539782474e-06, 2.45334641989034e-06, 9.229294512429981e-07, 7.772474291386405e-09, 3.187289331590349e-13, 4.946432257055918e-20, 1.560760248322749e-38, 0, 1.709594538891932e-09, 3.082641628303659e-09, 4.200073857599196e-09, 8.143939161957868e-09, 5.869788361953841e-09, 6.924618370836682e-09, 8.247039637843546e-09, 1.026724447512893e-08, 8.308939732833375e-09, 1.137776988870474e-08, 9.1179497380668e-09, 8.533333490564529e-09, 7.134280551158628e-09, 8.189133031611618e-09, 2.127377413208811e-09, 2.273863857288836e-11, 1.478123562816128e-15, 1.220883257441089e-22, 2.497330980690016e-43, 0, 7.364718339829282e-13, 1.330467927683982e-12, 1.677914547131341e-12, 2.411866529804317e-12, 2.831541523947437e-12, 2.262129692766892e-12, 3.592447658948364e-12, 2.806033126059505e-12, 2.990745225288614e-12, 3.922341563230167e-12, 2.853840181916709e-12, 3.170855097824758e-12, 2.846735502200209e-12, 2.605615846724803e-12, 9.983695116076737e-13, 1.066606496063887e-14, 5.983843286438949e-19, 2.976710416388624e-27, 3.234677566692277e-47]
+      ],
+     "21":[
+      [0, 0.0001594662312154171, 0.0004614766830744562, 0.0009963700402613013, 0.001277281597015576, 0.001742727179414466, 0.003820542373310938, 0.00234645862909377, 0.003418413174240817, 0.004372597416509457, 0.003807293014888311, 0.005088163441781902, 0.005330528563136486, 0.005563798746741643, 0.006955253956430593, 0.006852403741867568, 0.0002797315700807612, 2.111473566411555e-07, 7.272380718534475e-13, 1.761781607880822e-21, 0, 0.000144407285112877, 0.0004570435337051597, 0.0009750825329897036, 0.001354935584126651, 0.002003016533827552, 0.002040043862368927, 0.002957155634127392, 0.003016373157869815, 0.004555469907557215, 0.005042875687391003, 0.005127611237468043, 0.005287331194533753, 0.006387691581157789, 0.00615788208116851, 0.006787885732972687, 0.0003204080275077386, 1.768487788199081e-07, 7.121076763250709e-13, 6.489574223066669e-29, 0, 0.0001649793461748007, 0.0005052727774001987, 0.00126676224398897, 0.001724954067736353, 0.001870337133034585, 0.002779603292355417, 0.00288687401826004, 0.003477623886753684, 0.003816541199746707, 0.00447924744186313, 0.004164029179181616, 0.004958568954183908, 0.006716909893038467, 0.007789222258852034, 0.004773966282064293, 0.0002944603938824045, 1.456755193781603e-07, 6.688495519011188e-13, 1.203001228743734e-28, 0, 0.0001788865699167674, 0.0005824788324508729, 0.0008788945395105935, 0.001795588715306227, 0.002269183411440146, 0.002746021987761003, 0.003158588099464886, 0.004260897525513779, 0.005351013899849831, 0.004552157852118406, 0.004157644310682667, 0.005842146055118091, 0.006276744799554972, 0.007637740183440628, 0.006929925056534196, 0.0003554107679944083, 1.368702957933e-07, 6.700919485406335e-13, 3.33227251753843e-22, 0, 0.0001359385355774582, 0.0005666087263282288, 0.001214173545245239, 0.001176129102421392, 0.002190335898218256, 0.002765574377190813, 0.003497058717176653, 0.003798628135395594, 0.004314365644725039, 0.004119413345302008, 0.004732229594308634, 0.007758490356511454, 0.008327499475791613, 0.008861124952981574, 0.006208152686564192, 0.0002524771013572998, 1.51957919586691e-07, 9.327205025763132e-13, 3.600186839941386e-21, 0, 0.0002050978961071922, 0.0006721291188439059, 0.001022330216859112, 0.001746954451787331, 0.001959162781680407, 0.002895234194808189, 0.003837224957804792, 0.003859390270584488, 0.005479525738334447, 0.005501057702828357, 0.006486283850163271, 0.005539567102692184, 0.007714934553695709, 0.009313394527301067, 0.007347368283869783, 0.0002914818619358169, 1.717542368388701e-07, 6.094102533723884e-13, 2.716272984552804e-28, 0, 0.000179352628497092, 0.0004996077036439697, 0.001078450620797786, 0.002154794503599575, 0.002777885533363866, 0.002746039381294738, 0.004140101620924975, 0.004187926539302208, 0.004583524517041555, 0.004708396572176655, 0.004903392866838544, 0.005450548293094897, 0.007014336622252568, 0.006980640994370171, 0.00635705130167206, 0.0002383175205831814, 1.562216648848103e-07, 6.580576937945558e-13, 2.689420783133087e-21, 0, 0.0001370089450793263, 0.0005460137367976712, 0.001052076861167297, 0.001977512981722784, 0.002499468183387176, 0.002497452405752599, 0.003848944816751217, 0.003608593354897141, 0.004602951735192436, 0.004058183614080158, 0.006015488325854707, 0.004839132954762519, 0.007443540136365284, 0.007985843163617492, 0.00758345366426671, 0.0002347416637128481, 1.891786316729923e-07, 5.749902677849074e-13, 7.887036738002584e-21, 0, 0.0002109195298070991, 0.0006088610826696225, 0.001235715841587024, 0.001547781723088539, 0.002573265185504924, 0.003886573886235789, 0.003875216870840617, 0.007283899648033971, 0.004393230070754425, 0.003648752866204261, 0.005228249231908776, 0.006081212802718059, 0.005826898318070308, 0.006978164077711405, 0.00858631317900008, 0.0002383513069321566, 1.284170130168768e-07, 5.046811412610544e-13, 8.127732791535274e-21, 0, 0.0002339015028691185, 0.0005551922554563206, 0.001208013070590516, 0.001867180446683634, 0.002323312493329982, 0.002755733239967468, 0.004310409071898793, 0.003597119385724982, 0.004873310112696771, 0.004106833071459327, 0.00571710055416981, 0.006582069433022922, 0.006389855120385119, 0.01066830837389735, 0.00829591618365876, 0.000274560071046605, 1.487495690624453e-07, 6.096791226867368e-13, 2.69590845441946e-21, 0, 0.0001297572440339257, 0.0006234214760645064, 0.001324382278133577, 0.001896236133345678, 0.002364711517972383, 0.002946722232946523, 0.003126953109815369, 0.00429747488282743, 0.004485956162304691, 0.005236576841693812, 0.006151395138004639, 0.006960517876447497, 0.005792678590049701, 0.007903062970468555, 0.005635935560750254, 0.0002328594560439981, 1.504795869041545e-07, 5.190747499478453e-13, 4.636112479407266e-28, 0, 0.0002037116444490208, 0.0006131731035840875, 0.0009976793361173265, 0.001939274237588047, 0.00209913409395697, 0.003272017519857737, 0.003308829716584791, 0.004698204800555141, 0.005123113196472346, 0.006404909570637929, 0.004574885938876902, 0.006551060007900839, 0.007681202698379661, 0.009296470430671222, 0.006486316842363338, 0.0002426631218964869, 1.34564205816027e-07, 7.724502050188205e-13, 3.735513373842238e-21, 0, 0.0002750397955615388, 0.0007644712482664946, 0.001048663171027099, 0.001519313827673662, 0.002123733868197708, 0.002545362156772613, 0.003014483291642126, 0.005031934734969946, 0.007075731611835894, 0.006181916717255756, 0.007576124842827255, 0.006421232744683873, 0.00560983966803276, 0.01177149344906783, 0.007632645544822924, 0.0002475506815058858, 1.252259822521078e-07, 6.355361916384752e-13, 3.721379747429486e-21, 0, 0.0003038863639531783, 0.000599501540243044, 0.001020358036459043, 0.002235556918599761, 0.002701774735741607, 0.004353257021754004, 0.004631218471150274, 0.004258703387775295, 0.005160736800050283, 0.006055679297823218, 0.005290879168979037, 0.005445354692590259, 0.006716735769273089, 0.01002389662178148, 0.01033603782465612, 0.0002609389658456699, 1.126261479419116e-07, 4.574534719993159e-13, 5.475874832261828e-21, 0, 0.0003439322015010471, 0.0007520230512742727, 0.001680312459060932, 0.002177585990143112, 0.003144619678888949, 0.003210908748760637, 0.00412494795020968, 0.004247557158926133, 0.004913165836261746, 0.007321291870505157, 0.008063316166868274, 0.008339057694730152, 0.008707610038532076, 0.01079357808344166, 0.01079112861221429, 0.0002156674443604212, 9.656025681852263e-08, 5.251760512084341e-13, 1.178163967393813e-21, 0, 0.0007227400968973689, 0.0007682854055337131, 0.001105804873646053, 0.001837657890498421, 0.004777793924035111, 0.003635886683148881, 0.00499687937462203, 0.005166433397253692, 0.004031878792196562, 0.006813494927759172, 0.008689793438830357, 0.006888762834114526, 0.004666381105422656, 0.009389749607127683, 0.01117590233816899, 0.0001896545332220118, 6.490230785952522e-08, 3.743550097876262e-13, 2.257757865051466e-21, 0, 1.006288824337267e-05, 3.641633233879382e-05, 7.167138839796837e-05, 0.000103172177223784, 0.0001683383210547638, 0.0001761004532266259, 0.0002536728521811335, 0.000271452879523171, 0.0003074461435289125, 0.0003937060533636579, 0.0005623169168606665, 0.0004388384803623006, 0.0006325217858665966, 0.000642118852079058, 0.0008614911663428244, 3.935622726112469e-05, 1.597507240911356e-08, 5.150830882841191e-14, 1.083510589412258e-22, 0, 2.192256341499069e-07, 7.697689002269161e-07, 1.029115982202317e-06, 2.296092826827931e-06, 3.109374127587969e-06, 3.944441057041373e-06, 6.214171716549265e-06, 5.468869066440498e-06, 7.609601214808309e-06, 7.411405843750436e-06, 1.075960876429163e-05, 6.727210985129188e-06, 9.259614569164238e-06, 1.38828134821881e-05, 1.679194121628963e-05, 8.95446312300422e-07, 4.765981646800152e-10, 2.59485448463584e-15, 9.870658077572726e-32, 0, 1.054988921365896e-09, 3.862749074162117e-09, 8.015130287446733e-09, 2.103856482946709e-08, 1.924436077033069e-08, 2.765972305786595e-08, 3.901995726171241e-08, 5.636697540920685e-08, 5.210259698884548e-08, 8.048575881525844e-08, 7.203484910171234e-08, 7.466960233713458e-08, 7.507666387508721e-08, 1.109482668634282e-07, 9.268030637036639e-08, 6.271952111337827e-09, 5.280655887039532e-12, 1.516546210786177e-17, 3.652304960299944e-36, 0, 1.5245013026857e-12, 5.592465528180104e-12, 1.074131448923847e-11, 2.090148776722754e-11, 3.114258410222689e-11, 3.031296312298175e-11, 5.7022496220157e-11, 5.168193553863333e-11, 6.291820515978495e-11, 9.308900051599705e-11, 7.564391512152083e-11, 9.309109935261508e-11, 1.005133606840509e-10, 1.184509120311207e-10, 1.459890360419727e-10, 9.878309760788717e-12, 7.165217492681173e-15, 1.226330853041066e-21, 1.521072567869897e-39]
+      ],
+     "22":[
+      [0.009617175507626141, 0.006966827776939382, 0.004977332602699834, 0.004716563303180371, 0.003358573793232198, 0.002896132369886574, 0.004354039931407735, 0.001940115896781781, 0.002136960474513663, 0.002132787256292065, 0.00148542460803774, 0.001620135529180798, 0.001408396380923414, 0.001053211736812667, 0.0008405015758241858, 0.0001189737195755269, 3.556150933493e-07, 1.308404860181646e-11, 1.178596157592215e-18, 3.304941484064114e-29, 0.006447689471919908, 0.006296112389788578, 0.0049195059833597, 0.004606418666242444, 0.003555526425686216, 0.003321930624673796, 0.002320191927574856, 0.002440090713615992, 0.001881802402755671, 0.00221747247785702, 0.001963494028745407, 0.001629380035235126, 0.001394145638836826, 0.001206716393750227, 0.0007426323950943176, 0.0001176141074239909, 4.064973171270739e-07, 1.09362686967809e-11, 1.151678471807863e-18, 1.214787445569784e-36, 0.008147736479067401, 0.007178438291135763, 0.005427587691737641, 0.005972197550245219, 0.004517309221854262, 0.003095586487380547, 0.003154890163474615, 0.002377259768569152, 0.002165152934935741, 0.001854009799525593, 0.001740497437819689, 0.001320498988016914, 0.001304803135653271, 0.001266332620652728, 0.0009374618477681683, 8.255075405773739e-05, 3.728179281352677e-07, 8.990095698877813e-12, 1.07947164084352e-18, 2.247101182135021e-36, 0.009396721528315229, 0.007767748488091463, 0.006244218923547116, 0.004135165017518415, 0.004692736578184364, 0.003748087049142361, 0.003110444513131974, 0.002595725857222483, 0.002647427496929238, 0.002594150481994972, 0.001765235531334404, 0.00131579627116422, 0.001534186130446106, 0.001180945195640293, 0.0009173633237783972, 0.0001195878459930749, 4.490721252426801e-07, 8.429418276494508e-12, 1.079231122374836e-18, 6.211115608820415e-30, 0.008830710625029554, 0.005890837346268903, 0.006061753310466203, 0.005701037144475283, 0.003067547739432013, 0.003610503861584996, 0.00312622918927282, 0.00286804376560561, 0.002355411471297823, 0.002087339311671638, 0.001594181385335265, 0.001494597110928173, 0.002033292580875015, 0.001563604417540042, 0.001062141412573303, 0.0001069147706294305, 3.183634054150212e-07, 9.339474126604444e-12, 1.499094109176638e-18, 6.696174524435536e-29, 0.009626071889541397, 0.008869776502412031, 0.007176038126600772, 0.004790505341200359, 0.004547104572155162, 0.003222883746297358, 0.003266150516433349, 0.003140632593239999, 0.002388227661431454, 0.002645672566137646, 0.002124543265021167, 0.002044425531282035, 0.001448823529369901, 0.001445644558952282, 0.001114085377603628, 0.000126276910267293, 3.667991520086877e-07, 1.053458072409074e-11, 9.774273645140982e-19, 5.041361491550255e-36, 0.009944354786317836, 0.007740628871269122, 0.005323266162208768, 0.00504321431825481, 0.005597269876654313, 0.004560426825768305, 0.00309155005704792, 0.003381644105191192, 0.002586265491336475, 0.002208562546634411, 0.001814719196918275, 0.001542371719603109, 0.001422646071827185, 0.001311695086026638, 0.0008333410434068658, 0.000109034686372411, 2.992873869791053e-07, 9.562287503590635e-12, 1.053261281231999e-18, 4.980878662784951e-29, 0.01094025098610798, 0.005901120076371914, 0.005805901373301273, 0.004909888829060054, 0.005126332376184303, 0.004095017741225846, 0.002805974826558816, 0.003137441303737264, 0.002223970492243928, 0.00221341877427294, 0.001560936059363904, 0.001888340338035833, 0.001260495351717895, 0.001389129814894347, 0.0009514045935633674, 0.0001298054211630477, 2.941970331380949e-07, 1.155588952851979e-11, 9.18396254070091e-19, 1.457585128061422e-28, 0.01027917072263485, 0.009066075998544459, 0.006461023677209673, 0.005755192255205881, 0.004004185271052454, 0.004207360743926395, 0.004357832253378634, 0.003152440997282007, 0.00447993855748727, 0.002108279289063209, 0.001400602490483764, 0.001637882289612429, 0.001580814515395115, 0.001085219906856573, 0.0008296647644864278, 0.0001466727230216881, 2.981132842963444e-07, 7.828249502763741e-12, 8.044224778601733e-19, 1.498864661756731e-28, 0.008025620682867777, 0.01003350349885886, 0.005879542720569847, 0.005614743089482183, 0.004820674127940643, 0.003790965811177041, 0.00308359823527791, 0.00349934269006903, 0.002207902986058426, 0.002333916277066367, 0.001573238346210535, 0.001787389740994788, 0.001707537288059032, 0.001187649638592931, 0.00126582607066861, 0.0001414242318935226, 3.427021781882335e-07, 9.049167612057944e-12, 9.697638842665945e-19, 4.961022104667413e-29, 0.01070212028894953, 0.005554797643221382, 0.006588688056105191, 0.00614311511045799, 0.00488574660026852, 0.003850680122486502, 0.003290613305524745, 0.002533415310127491, 0.002632422025566957, 0.002144041968035688, 0.002001944274188404, 0.001919261201615598, 0.001802047842085472, 0.001074468734758875, 0.0009358169943184349, 9.588316072589143e-05, 2.900608219458969e-07, 9.135690025851256e-12, 8.239335697159787e-19, 8.513204846409413e-36, 0.0102123626373967, 0.008703010797187188, 0.006467215346754887, 0.004618312422195544, 0.004986488112447318, 0.003411273167074006, 0.003646450385870617, 0.002675324566971482, 0.002872044404906292, 0.002443595094119418, 0.00244362489131921, 0.001424484611801547, 0.00169259623853373, 0.001421872325605885, 0.001098577226487381, 0.0001101263737164395, 3.01657896059143e-07, 8.15275130911995e-12, 1.223574590650792e-18, 6.844828849179684e-29, 0.011759424276033, 0.01172644159466568, 0.008046600197960238, 0.004844460171160943, 0.003898702466375859, 0.003444240355956767, 0.002830879043768062, 0.002432383129923568, 0.00306980823089738, 0.003368089966160033, 0.002353757548409697, 0.002354190756315686, 0.001655683190643761, 0.001036331869510825, 0.001388228907566912, 0.000129325789389514, 3.071077527687453e-07, 7.571466314929307e-12, 1.004611065400799e-18, 6.8043954599413e-29, 0.01384621197486162, 0.01290375210020395, 0.006284571370370638, 0.00469457256920909, 0.005713371033776059, 0.004363918078687862, 0.004821921483935912, 0.003721760858815646, 0.002587543932764033, 0.002446572743050877, 0.002296336511061257, 0.001637406294716311, 0.001398360289338766, 0.00123577879911963, 0.001177335255911801, 0.0001744206430522615, 3.224015400800968e-07, 6.781826496508104e-12, 7.201122167317931e-19, 9.969785816212809e-29, 0.009061010874669446, 0.01451020225730162, 0.007832715365087945, 0.007681204911651945, 0.005529397973743234, 0.005046513283487471, 0.003533699614846232, 0.003293574628261956, 0.002564161704267892, 0.002314214884338648, 0.002758393481854066, 0.002479351666389707, 0.00212767706260806, 0.001591758798763475, 0.001259577201782629, 0.0001809280852027827, 2.647491661317003e-07, 5.776736169647652e-12, 8.212837645061105e-19, 2.130570174001755e-29, 0.06562012468988121, 0.02914440037138076, 0.007648498514432308, 0.004831592193966764, 0.004460049890646874, 0.007328637962702738, 0.003824587517389178, 0.003813471716335633, 0.002981052778886183, 0.001815191279216227, 0.002453641532355185, 0.002553915824574857, 0.001679974339896861, 0.0008153257347996227, 0.001047335756197047, 0.0001790984424591516, 2.225158446157988e-07, 3.710135952978418e-12, 5.590269162117191e-19, 3.893997096563525e-29, 0.0006413705988256093, 0.0003589636829118741, 0.0003207045750843939, 0.0002770214383334862, 0.0002215102690600815, 0.0002284207056391306, 0.0001638670934361498, 0.0001712588569537895, 0.0001385578138644665, 0.0001224452817109034, 0.0001254214059985239, 0.0001461964988027219, 9.467277313268311e-05, 9.776556851394132e-05, 6.33588826284426e-05, 1.221293346162255e-05, 4.08439954584977e-08, 8.073235962216589e-13, 6.788679994148172e-20, 1.644142745941401e-30, 6.061658017144492e-06, 6.163289735386375e-06, 5.342749221037121e-06, 3.134941339314819e-06, 3.88526161460334e-06, 3.325270683354957e-06, 2.892812251644348e-06, 3.306493863797827e-06, 2.200094852707881e-06, 2.388603510666729e-06, 1.860849078837472e-06, 2.204779045785379e-06, 1.143852345675386e-06, 1.128031630621395e-06, 1.079673975246754e-06, 1.876374700264727e-07, 7.324776493720983e-10, 1.897026890553312e-14, 2.686470248612531e-21, 1.170200277513552e-39, 2.775661289113071e-08, 2.010242635877605e-08, 1.817133673920978e-08, 1.65488644376839e-08, 2.412936894955421e-08, 1.394963996050261e-08, 1.37497402816739e-08, 1.40730911609994e-08, 1.537068236618706e-08, 1.108593477961109e-08, 1.369829670165375e-08, 1.000585831161949e-08, 8.606527173581499e-09, 6.200040477639245e-09, 5.849455997438639e-09, 7.022653387512505e-10, 3.480455530620024e-12, 1.425456543675444e-16, 1.061757216942773e-23, 2.907961711694702e-44, 1.902318383889839e-11, 1.647210511089606e-11, 1.491866812191147e-11, 1.257670749902658e-11, 1.35948510496945e-11, 1.280256423764844e-11, 8.546202948654105e-12, 1.166439826254262e-11, 7.99347782020334e-12, 7.593342195939946e-12, 8.986790695609896e-12, 5.960180215964776e-12, 6.086685276955521e-12, 4.70903028524473e-12, 3.543217452956756e-12, 6.280607925388775e-13, 3.116921576038968e-15, 1.101195570570913e-19, 4.881793058951386e-28, 6.84382252360653e-48]
+      ],
+     "23":[
+      [0, 2.836418221982807e-10, 1.63787366337184e-09, 5.292267502938235e-09, 9.024972282518419e-09, 1.535670788549204e-08, 4.030645431955548e-08, 2.881436164827719e-08, 4.78643829642344e-08, 6.871948825639788e-08, 6.633066192078277e-08, 9.728637238564649e-08, 1.109302931818576e-07, 1.344618879253066e-07, 2.047197746163972e-07, 4.397151981708665e-07, 3.958504838631227e-08, 4.991209065584465e-11, 2.119868184952438e-16, 4.732513416445603e-25, 0, 0.0001328138858906674, 0.0002096821103834074, 0.0002975330110542077, 0.0003093547054666516, 0.0003650038429923132, 0.0003090706779561694, 0.0003831193961862074, 0.0003411483937244655, 0.0004569103341521415, 0.000454163714868966, 0.0004188439484038113, 0.0003949868001182291, 0.0004071398201434838, 0.0003175984536707662, 0.0001451810368012197, 2.389652570902175e-06, 4.946599367883831e-10, 8.295294844664705e-16, 3.515767501851328e-32, 0, 0.0003029767236090113, 0.0004628643793654827, 0.0007718107892184199, 0.0007863839346421719, 0.0006805312074175017, 0.0008408368786288108, 0.0007467805061175643, 0.0007853075383787611, 0.0007642923578720922, 0.0008054211327880223, 0.0006790877651869265, 0.0007395503811401328, 0.0008546980143796276, 0.0008019422788125469, 0.0002035773999517537, 4.343611863528044e-06, 7.792875398472552e-10, 1.361416240616142e-15, 9.792483664190655e-32, 0, 0.0004919764013262088, 0.0007990876841561985, 0.0008019332730812039, 0.001225882145611932, 0.001236463348737747, 0.00124398431874166, 0.001223596653971942, 0.001440908140173337, 0.001604727571817077, 0.001225768050384511, 0.00101538222529555, 0.001304820242700052, 0.001196016693351589, 0.001177496561456549, 0.0004423322418315176, 7.826278884424002e-06, 1.080398633153523e-09, 1.945412082260558e-15, 3.616741152115728e-25, 0, 0.0004976723541596865, 0.001034741183289496, 0.001474742075199201, 0.001068883071527864, 0.001588748270823431, 0.001667739415710911, 0.001803346817064817, 0.001709983760234014, 0.001722308707403891, 0.001476569322333001, 0.001538416927923609, 0.002306640492200595, 0.002112215190873961, 0.001818433755528965, 0.0005273613848564155, 7.389012704285247e-06, 1.584838775724325e-09, 3.514609073128158e-15, 4.881307712745961e-24, 0, 0.0009370609338666853, 0.001531816560228142, 0.001549643745512959, 0.001981353004104818, 0.001773452615168754, 0.002178867330078185, 0.002469433226805475, 0.002168138237592213, 0.00272985370564769, 0.002460742830658673, 0.002631509073602576, 0.00205531423305999, 0.002442043130932439, 0.002385118768994032, 0.0007787863753285167, 1.063565756613175e-05, 2.225434451465374e-09, 2.821716860493824e-15, 4.41516262115236e-31, 0, 0.00098172831547395, 0.001364143436646067, 0.001958473317572246, 0.002927943316463525, 0.003012587660686656, 0.002475881316403483, 0.003192027614527114, 0.002818658881143, 0.002735713924714725, 0.002523290501810156, 0.00238330276492961, 0.002422788795876954, 0.002659985068459684, 0.002141736599039081, 0.000807190076819934, 1.041135739815446e-05, 2.417764434394986e-09, 3.61244331348299e-15, 5.094223020503074e-24, 0, 0.0008735242971645125, 0.001736508517401658, 0.002225395484646549, 0.003129812710414748, 0.003157293697906648, 0.002622781350513404, 0.003456518376705939, 0.002828932981891668, 0.003199988771982713, 0.002533182296652472, 0.00340559915592922, 0.00250543174934401, 0.003287840575551509, 0.002853830529684311, 0.001121498410190594, 1.193947310221388e-05, 3.402891674104933e-09, 3.648928819861328e-15, 1.705191176218583e-23, 0, 0.001534371486186139, 0.002209424568838836, 0.002982399990273791, 0.002795092334945522, 0.003708849577673634, 0.004657136177727926, 0.003970819512547145, 0.006515314650747317, 0.003484836883690499, 0.00259875531897882, 0.00337726237291198, 0.003592450214670893, 0.002936658291374849, 0.00284532487341258, 0.001448781192177596, 1.3827733340929e-05, 2.631362248712974e-09, 3.6336024379135e-15, 1.974218557123913e-23, 0, 0.001911150874843028, 0.002262833326982735, 0.00327466633852964, 0.003787222350205512, 0.003761060052563805, 0.003708830809560213, 0.004960783936760559, 0.003613880673522042, 0.004341800610861726, 0.003285300448355075, 0.004147927980858209, 0.004367265627611837, 0.003617037203003094, 0.004885748245940872, 0.00157213788838374, 1.788558106496805e-05, 3.41910550182113e-09, 4.908370789607502e-15, 7.265721683876567e-24, 0, 0.001176106855348082, 0.00281866918416699, 0.003982556261217058, 0.004266581091710546, 0.004246526107932823, 0.004399384682154311, 0.00399214185493376, 0.004789442215696557, 0.00443356755123505, 0.004646948139577637, 0.004950865298944025, 0.005123191596632917, 0.00363741465273934, 0.004014962235621933, 0.001184761948026826, 1.682364010469553e-05, 3.833077026324114e-09, 4.619202520634608e-15, 1.372439861453845e-30, 0, 0.002027773425858005, 0.003044625134474581, 0.003294791095845527, 0.004791981256277545, 0.004139844646254663, 0.005364836697127088, 0.004639242394582667, 0.005750312853576241, 0.005560579669896862, 0.006241960493986148, 0.004043665905076138, 0.005295390099322133, 0.005296994840814984, 0.005186690218476731, 0.001497407041743263, 1.925051640553419e-05, 3.761210462494336e-09, 7.527001725978594e-15, 1.20458749468619e-23, 0, 0.002981833509663987, 0.004134244458935532, 0.003771873836162682, 0.004088910139361399, 0.004561714413477943, 0.004545425457718494, 0.004603302535668852, 0.006707774067837634, 0.008364524517826235, 0.006561676813567239, 0.007293326560169078, 0.005653119822034857, 0.004213411192562466, 0.007152967169531795, 0.001919072123952163, 2.138571636565041e-05, 3.809574187366707e-09, 6.728398059999755e-15, 1.298088682633436e-23, 0, 0.00383122188128161, 0.003770192386262011, 0.004267877036415356, 0.00699654947519187, 0.006748622770789489, 0.009040182088517127, 0.00822412481525572, 0.006601740690813354, 0.007094455916449634, 0.007474666929974834, 0.005923023659473426, 0.005574845225662553, 0.005866485631942634, 0.007083153004654718, 0.00302199117842659, 2.620822596839786e-05, 3.980038298745031e-09, 5.610207244468663e-15, 2.19725495462399e-23, 0, 0.005292420483970415, 0.005772444255020646, 0.008578368447160487, 0.008318188575899154, 0.009587145613380818, 0.008138528680007612, 0.008940623928043944, 0.008036650335477258, 0.008243723185998504, 0.01102988767452391, 0.01101751067168856, 0.01042023563783663, 0.009282652224534732, 0.009309101638923839, 0.003850742583312272, 2.643193047271467e-05, 4.159852734127149e-09, 7.827520601063968e-15, 5.700337368775811e-24, 0, 0.02461304793206688, 0.01305127479491729, 0.01249380888698156, 0.01553530278418986, 0.03223666191354466, 0.02039527279193588, 0.02396896043480582, 0.02163352717972213, 0.01497165205719966, 0.02271711387889114, 0.0262771709426193, 0.0190502471685598, 0.01100907635084974, 0.01792220648271563, 0.008825161063904775, 5.140943116757293e-05, 6.169492444323314e-09, 1.22164242730448e-14, 2.343991978899271e-23, 0, 0.0007866299201996719, 0.001420010693300262, 0.001858778786679973, 0.002002090152722994, 0.002607186124970259, 0.002267495528251238, 0.002793132110631653, 0.002609146377353925, 0.002620590212603274, 0.003013168408965013, 0.003903180714097513, 0.002785689305458878, 0.003425430443006351, 0.002813340391793461, 0.001561549460720363, 2.448387311464356e-05, 3.481686283146881e-09, 3.840341034781842e-15, 2.545471713765141e-24, 0, 3.087090392605688e-05, 5.407146932665425e-05, 4.807959507994458e-05, 8.026519110414857e-05, 8.675229303807952e-05, 9.14939827386012e-05, 0.0001232605159759279, 9.469496807206802e-05, 0.0001168475138277177, 0.0001021836804498154, 0.0001345444324042455, 7.693020013262049e-05, 9.033802255728686e-05, 0.0001095793924495649, 5.483946614903002e-05, 1.003885929681033e-06, 1.87216199503746e-10, 3.485134929608236e-16, 4.166127018815081e-33, 0, 2.061835959049928e-07, 3.765817374439604e-07, 5.197191916142168e-07, 1.020756931641998e-06, 7.452236456703096e-07, 8.905058293798885e-07, 1.074276596352612e-06, 1.354719592710754e-06, 1.110501007974337e-06, 1.540311982797786e-06, 1.25033762073221e-06, 1.185298497952964e-06, 1.016759103044151e-06, 1.21570584221191e-06, 4.203224652785042e-07, 9.773074428338973e-09, 2.887568084466446e-12, 2.841081844051706e-18, 2.153609265784437e-37, 0, 3.235322527653943e-10, 5.920594473402972e-10, 7.563634000796646e-10, 1.101321173437157e-09, 1.309736687227667e-09, 1.059934876451495e-09, 1.705112494775122e-09, 1.349138588227965e-09, 1.456614556546916e-09, 1.935139890958943e-09, 1.426259661600519e-09, 1.60526821336911e-09, 1.47884829236184e-09, 1.410206016720205e-09, 7.199388840092002e-10, 1.677285005980337e-11, 4.286176292357981e-15, 2.527915990646177e-22, 9.938597281664135e-41]
+      ],
+     "24":[
+      [0.009906233305050815, 0.007124195981245325, 0.005052858816585362, 0.004753416086536389, 0.00336027382034604, 0.002876588491086253, 0.004293300080462555, 0.001899179295249243, 0.002076702038190362, 0.002057617266618413, 0.001422679209302554, 0.001540447787947973, 0.001329412502350759, 0.0009797806582136801, 0.0007640341356491938, 9.199070303514822e-05, 1.772193267458519e-07, 2.776897143552728e-12, 6.207303892702094e-20, 2.294060801769745e-31, 0.006641483888560588, 0.006438330330211664, 0.004994154732747198, 0.004642410833482347, 0.003557326141327724, 0.003299513339083892, 0.002287824714711645, 0.002388604594913192, 0.001828738956159658, 0.002139317749097024, 0.001880554622101272, 0.00154923758179119, 0.001315960938608214, 0.001122582786260205, 0.0006750689165390713, 9.093943816522602e-05, 2.025761254757216e-07, 2.321054178757541e-12, 6.065464561232199e-20, 8.431973213980336e-39, 0.008392628210404554, 0.007340586398213542, 0.005509946088512053, 0.006018861201757468, 0.004519595761985149, 0.003074696627751294, 0.003110878709642221, 0.002327099379987346, 0.002104099502888674, 0.001788665288030756, 0.001666977556472158, 0.001255549102794147, 0.001231628815288099, 0.001178042487147617, 0.0008521730868796769, 6.382838348480659e-05, 1.857920152450733e-07, 1.908002247992235e-12, 5.685110275518074e-20, 1.559693730832749e-38, 0.009679153269925226, 0.007943208060005149, 0.006338968908094557, 0.004167475047763197, 0.004695111909595278, 0.003722793931647017, 0.003067053078665428, 0.002540955806274255, 0.002572774774955308, 0.002502719723257066, 0.00169067068285963, 0.001251077682376388, 0.001448147828040547, 0.001098608354035423, 0.0008339030765030259, 9.246551561070346e-05, 2.237927615077177e-07, 1.78900120622998e-12, 5.683775984318864e-20, 4.310960940035536e-32, 0.009096130109257704, 0.006023900845591648, 0.006153734554023647, 0.005745582082019615, 0.003069100442438028, 0.003586139186755636, 0.003082617546988143, 0.002807527772344639, 0.002288993068746366, 0.002013771086399643, 0.001526841979078151, 0.001421084034453751, 0.001919263996835718, 0.00145458811965559, 0.0009655094661270246, 8.266666400732659e-05, 1.586546329281982e-07, 1.982138121291604e-12, 7.894892598881495e-20, 4.647495923372608e-31, 0.009915397080293707, 0.009070128918625936, 0.007284927562447459, 0.004827935853983543, 0.004549406178434528, 0.003201134833137765, 0.003220586930072938, 0.003074364939394109, 0.002320883890311206, 0.002552425883683386, 0.002034800964435749, 0.001943868642533504, 0.001367572397289358, 0.001344852539279367, 0.001012727630035575, 9.763748901293716e-05, 1.827921833415302e-07, 2.235770433055013e-12, 5.147503613479316e-20, 3.498870532900889e-38, 0.01024324641921599, 0.007915475857773881, 0.005404041574501682, 0.005082619364084378, 0.005600103038388581, 0.004529651793019921, 0.003048422181376206, 0.003310291073455803, 0.002513337394338635, 0.002130721786783349, 0.001738064084948578, 0.001466508781669709, 0.001342862977849452, 0.001220242162343876, 0.0007575249609359562, 8.430576719825962e-05, 1.491479855984807e-07, 2.029411948509222e-12, 5.546807892712974e-20, 3.456796206786966e-31, 0.01126907568633414, 0.006034415842932783, 0.005894000306175543, 0.004948252135920468, 0.00512892715838394, 0.004067383411650895, 0.002766830787798742, 0.003071240965083665, 0.00216125846144774, 0.002135406844468498, 0.00149500092853582, 0.001795460607527716, 0.001189805783582806, 0.001292278032846025, 0.0008648472532574048, 0.0001003657162274572, 1.466111319033193e-07, 2.452507026101088e-12, 4.836508427449085e-20, 1.011555058350511e-30, 0.01058812572154081, 0.009270862467964639, 0.006559063454994983, 0.005800160317845275, 0.00400621205446621, 0.004178968284832939, 0.004297039410995161, 0.003085924152820012, 0.004353612201233296, 0.002033972988023398, 0.001341439962491023, 0.00155732155177036, 0.001492161182016626, 0.001009557070799921, 0.0007541831124836883, 0.0001134075227065743, 1.485626602766198e-07, 1.661383914235362e-12, 4.236243187681284e-20, 1.040173542202405e-30, 0.008266842051419917, 0.01026014242745525, 0.005968759086228292, 0.005658613752190183, 0.004823114184996723, 0.00376538329608469, 0.003040581266209287, 0.003425506170652538, 0.002145644011029373, 0.002251657387721014, 0.001506783536011707, 0.00169947532787228, 0.00161177722447077, 0.00110484526314595, 0.001150663095069115, 0.000109349370919316, 1.707830965805138e-07, 1.920491716597827e-12, 5.106902116252699e-20, 3.442724980931459e-31, 0.0110237876346317, 0.005680270603145371, 0.006688665013439772, 0.006191114191555445, 0.004888219589212979, 0.003824694631483173, 0.003244708416020692, 0.00247995995710582, 0.002558192349807457, 0.002068475187662394, 0.00191738057887468, 0.001824860553391849, 0.001700987533268409, 0.0009995554554798236, 0.0008506777364003699, 7.413695653693441e-05, 1.445495596227496e-07, 1.938847385965613e-12, 4.338889282010189e-20, 5.907613038458139e-38, 0.0105193096249116, 0.008899596270074799, 0.006565349071569563, 0.004654397491469393, 0.004989012087477211, 0.003388252913915878, 0.003595581469765159, 0.00261887490330464, 0.002791057786432938, 0.002357470547321866, 0.002340404243942514, 0.001354419998948142, 0.001597674048341348, 0.001322737623048772, 0.0009986302603286294, 8.514981364860583e-05, 1.50328760984686e-07, 1.730234347803819e-12, 6.443349124181156e-20, 4.749734560565974e-31, 0.01211287038684974, 0.01199132096946374, 0.008168699554835712, 0.004882312237146484, 0.003900675840315915, 0.003420997624675172, 0.002791387549504721, 0.002381059550954802, 0.002983245005627263, 0.003249381564685098, 0.002254332952666883, 0.002238397654779086, 0.001562831098586255, 0.000964077512437639, 0.001261929824155172, 9.999480835023917e-05, 1.530445402928498e-07, 1.606864268829351e-12, 5.290223447670646e-20, 4.721544462776132e-31, 0.01426237943826655, 0.01319522481504683, 0.006379933644464397, 0.004731253486230879, 0.005716262910561962, 0.004334469080508555, 0.004754654408874229, 0.003643231228175114, 0.002514579694794173, 0.002360343208345481, 0.002199337394553212, 0.001556868888932972, 0.001319939052894426, 0.00114961872007878, 0.001070222930801053, 0.0001348621566847684, 1.606658332052641e-07, 1.439271760954395e-12, 3.791979053603889e-20, 6.917608084566596e-31, 0.009333352358278226, 0.01483796180887925, 0.007951569215380847, 0.007741221784880086, 0.005532196710990343, 0.005012457904712793, 0.00348440354610401, 0.003224079746443293, 0.00249185676864454, 0.002232650265954753, 0.002641876644762898, 0.002357402302331192, 0.00200835505500989, 0.001480779273241781, 0.00114498254245533, 0.0001398936655932645, 1.3193499683721e-07, 1.225952918191408e-12, 4.324566982473243e-20, 1.478179638770862e-31, 0.06759243024825944, 0.02980272027296012, 0.007764557004391508, 0.004869343631871397, 0.00446230725946258, 0.007279181840355428, 0.003771233270936838, 0.003733006647290517, 0.002896991943717105, 0.001751214550096109, 0.002349997302565824, 0.002428298487301591, 0.00158575953738465, 0.000758479914013982, 0.0009520500988162296, 0.000138478642065226, 1.108866554170725e-07, 7.873123906504672e-13, 2.942848279269024e-20, 2.699953055645118e-31, 0.0006606478983281986, 0.0003670720292354671, 0.0003255709481246489, 0.0002791859228974893, 0.000221622367361922, 0.0002268792218141979, 0.0001615810694643098, 0.0001676452239039346, 0.000134650672841029, 0.0001181296364075501, 0.00012012343195707, 0.000139005582121399, 8.936336598128677e-05, 9.094912067831657e-05, 5.759447707999901e-05, 9.442958709634985e-06, 2.035296063641803e-08, 1.712827335118428e-13, 3.571191187834057e-21, 1.138072093466648e-32, 6.243849713010698e-06, 6.302507355706794e-06, 5.42381995575259e-06, 3.159435723572424e-06, 3.887227309964772e-06, 3.302829631055792e-06, 2.852455326094477e-06, 3.236724206071322e-06, 2.138054093612409e-06, 2.304414494699199e-06, 1.782242812264589e-06, 2.096331315333972e-06, 1.079701954652517e-06, 1.049380938775457e-06, 9.814426712558467e-07, 1.450782127632109e-07, 3.649705229296893e-10, 4.023148353943999e-15, 1.411315384490529e-22, 8.07404799441636e-42, 2.859087710726333e-08, 2.055650372886117e-08, 1.844706720729644e-08, 1.667816459871904e-08, 2.414157209203478e-08, 1.385549457963094e-08, 1.355791492066778e-08, 1.377612933671125e-08, 1.493723063761988e-08, 1.069518778245161e-08, 1.31196348827122e-08, 9.513680104944269e-09, 8.123834856600898e-09, 5.767735787322708e-09, 5.317239004663911e-09, 5.429693767195457e-10, 1.733977400065792e-12, 3.021172710182701e-17, 5.566035068881794e-25, 1.996166092107583e-46, 1.959495250591664e-11, 1.684417982412812e-11, 1.514504183548433e-11, 1.26749703613985e-11, 1.360172284905445e-11, 1.271615509609392e-11, 8.42696809759825e-12, 1.14182538492911e-11, 7.768054207384392e-12, 7.325688998338041e-12, 8.607144199754259e-12, 5.666993381758128e-12, 5.74530301038877e-12, 4.38067350075454e-12, 3.220819244568327e-12, 4.855839077739034e-13, 1.552592716954381e-15, 2.331949385020566e-20, 2.55176821541983e-29, 4.664658921594601e-50]
+      ],
+     "25":[
+      [0, 1.583156349435905e-12, 3.666724824745288e-11, 2.673029284444275e-10, 8.125757806942199e-10, 2.166266304846324e-09, 8.209630495880469e-09, 8.00979684176022e-09, 1.742512345001809e-08, 3.1747714758315e-08, 3.793351406984937e-08, 6.750010348596683e-08, 9.184068758922391e-08, 1.523280505896593e-07, 3.520112945055525e-07, 4.211995330651908e-06, 2.786648895158616e-06, 2.032110190794619e-08, 3.542733444224218e-13, 1.909415057843321e-21, 0, 1.844621159013563e-05, 5.84241539252369e-05, 0.0001247357384505752, 0.0001734526413444297, 0.0002566006933108139, 0.0002615304705982041, 0.0003793718872058206, 0.0003872425532434712, 0.0005852444481707967, 0.0006483175243265229, 0.000659674093530512, 0.0006806993739313874, 0.0008235150247314717, 0.0007956613640907813, 0.0008920790744415357, 4.590713947473757e-05, 3.985909669592628e-08, 4.174772671768261e-13, 7.287637053009547e-29, 0, 4.145624398944325e-05, 0.0001270582704049176, 0.0003187766473702609, 0.000434391236880581, 0.0004713390594254681, 0.0007009779334425021, 0.0007285434117504384, 0.0008782425314133013, 0.0009645046766219576, 0.001132766349674395, 0.001053776292250058, 0.001255708868437935, 0.001703311660691748, 0.001979473670616991, 0.001231376472197535, 8.01565264122052e-05, 5.102599523827074e-08, 4.561555669154218e-13, 1.396213318012448e-28, 0, 6.631964037290928e-05, 0.0002161032016199158, 0.0003263112642681724, 0.0006671355706804548, 0.0008436970101747861, 0.001021711816584091, 0.001176041853121676, 0.001587574799588017, 0.001995126891564642, 0.00169844375952614, 0.001552311042114623, 0.002182727851360489, 0.002348270203310205, 0.002863497255522404, 0.00263518244544337, 0.0001410567057529078, 6.446669921815499e-08, 5.189634703525689e-13, 3.987845234717394e-22, 0, 6.609354304264073e-05, 0.0002756870174158352, 0.0005911912772710244, 0.0005730784510346726, 0.001068019833424228, 0.001349463641118342, 0.001707590775700289, 0.001856139098045323, 0.002109606381749876, 0.002015665795434924, 0.002317104461407972, 0.003801471247424169, 0.004085758899974157, 0.00435671268890634, 0.0030947815404025, 0.0001306288329163272, 8.930425684691025e-08, 8.056233855395998e-13, 4.433245757737492e-21, 0, 0.0001226030964648542, 0.0004020772896932492, 0.0006120151826824687, 0.00104656053113908, 0.00117452620012607, 0.001736932685405832, 0.002303675871673556, 0.002318597687724193, 0.003294200749556607, 0.003309417215369235, 0.003904787303335132, 0.003337115899561258, 0.004653821088772271, 0.005629807881334015, 0.004502185920100835, 0.0001847511535822336, 1.203013166426309e-07, 5.788710215526749e-13, 3.435061211895324e-28, 0, 0.0001265445628665012, 0.0003527617297720599, 0.0007620206646888756, 0.001523646002067003, 0.001965630652174432, 0.001944470395878362, 0.002933663276874112, 0.002969618939695157, 0.003252380764511276, 0.003343280368076908, 0.003484112800558762, 0.003875513984827703, 0.004994092621549718, 0.004980476610931492, 0.004597020814599472, 0.000177861296358965, 1.264322743099788e-07, 6.797741777265502e-13, 3.486728800431126e-21, 0, 0.0001109292845493951, 0.0004424023727506575, 0.0008530519529150435, 0.00160457145684797, 0.002029535441235733, 0.002029332374556377, 0.003129696621246769, 0.002936302395265922, 0.003747997097051418, 0.003306680608826859, 0.004904863695843475, 0.003948361462103193, 0.006081475672979201, 0.006538137280264686, 0.00629219334157142, 0.0002006917858665849, 1.729935934986136e-07, 6.400518511368162e-13, 1.046565105930229e-20, 0, 0.0001919646577759186, 0.0005545481828323851, 0.001126299288941319, 0.001411746101832662, 0.002348771141991967, 0.00355001324006455, 0.0035421225205313, 0.006662446026927859, 0.004021180477473725, 0.003342040003169633, 0.004792021827602322, 0.005577579569613916, 0.005351462910241544, 0.006422124765776283, 0.008007807049639621, 0.0002287722432408831, 1.304612151186829e-07, 6.007809570136263e-13, 1.102206779515973e-20, 0, 0.000235562285961869, 0.0005595420531750899, 0.001218358462655785, 0.001884522881371258, 0.002346561829982096, 0.002785277029438465, 0.004359675644912369, 0.003640765052241643, 0.004935846261045351, 0.004162383438662092, 0.005798371410953415, 0.006680139813971994, 0.006493714065676742, 0.01086423520432681, 0.008560755881583006, 0.0002913099986037598, 1.656807754262302e-07, 7.711631469357959e-13, 3.731093636831866e-21, 0, 0.0001428164015624467, 0.0006866648496077882, 0.00145979049471829, 0.002091612608329862, 0.002610214698349459, 0.003254948211400552, 0.003456453180192625, 0.004753622719040088, 0.004965535464138715, 0.005800372822190993, 0.006818315667206907, 0.007720364180967637, 0.006433604613981988, 0.0087957120959248, 0.006355733716041552, 0.0002697969615125642, 1.818171178110331e-07, 6.937823584083828e-13, 6.539749322043012e-28, 0, 0.0002425893568893129, 0.000730727696546599, 0.001189809847892516, 0.002314394903157445, 0.002506961328083133, 0.003910478191953876, 0.003957246085697861, 0.005622799437505165, 0.006135560466732379, 0.007675922503871896, 0.005486467460492232, 0.00786170526457711, 0.009230236297078536, 0.01119442132575424, 0.007913880615516886, 0.0003039985498893281, 1.748377799243781e-07, 1.085763934432792e-12, 5.364270660629108e-21, 0, 0.0003514448728108895, 0.0009775509790311897, 0.001341925427341337, 0.001945590802627262, 0.002721531161455155, 0.003264146017704274, 0.003868452262586579, 0.00646191634081026, 0.009092792377362015, 0.007949618766594701, 0.009749114180695675, 0.008268543157803605, 0.007233345516832647, 0.01520966822318685, 0.009992116830869079, 0.0003325834330392808, 1.736913433307919e-07, 9.355354907878378e-13, 5.434120791884858e-21, 0, 0.0004382840044507323, 0.0008652693014546228, 0.001473763128464772, 0.003231264196092418, 0.00390791456322457, 0.006301108859764606, 0.006708142309052103, 0.00617285828295937, 0.007485488402367097, 0.008789586287095865, 0.007684722263465555, 0.00791441678272249, 0.009775271260281125, 0.01461859715124966, 0.01527201437955203, 0.0003953545008312131, 1.748989168311627e-07, 7.307162508060406e-13, 8.242626915295095e-21, 0, 0.0005774360364010623, 0.001263510294313775, 0.002825216825568582, 0.003663942785380448, 0.005294813530571716, 0.005410248694190619, 0.006955238446159249, 0.007166954391323828, 0.008295761824869597, 0.01237028228583144, 0.01363327587860362, 0.01410898510181804, 0.01475214560207278, 0.01832395904682529, 0.01855969384212154, 0.0003800225310750987, 1.729848528163016e-07, 9.331098387937438e-13, 1.847205272482125e-21, 0, 0.001928306174346683, 0.00205131835561864, 0.002954630251593413, 0.004913613398687031, 0.0127841818306645, 0.009735597291469607, 0.01338922376304471, 0.0138531705723552, 0.0108184532316354, 0.01829466867373191, 0.02334847535687775, 0.0185217632052681, 0.012563135314275, 0.02533189921898878, 0.0305418253171032, 0.0005298759847345508, 1.806788206494116e-07, 9.358976509204444e-13, 3.990860616530446e-21, 0, 2.51577000466913e-05, 9.110903222122071e-05, 0.0001794425932385271, 0.0002584963119016298, 0.000422069851797267, 0.0004418439869179221, 0.000636923325188024, 0.0006820400138651298, 0.0007730084586040174, 0.0009905687889012623, 0.001415756637677588, 0.001105616800337826, 0.001595706598347514, 0.001623267943779435, 0.002206089892174334, 0.000102963650960372, 4.129656887360572e-08, 1.139417105539398e-13, 1.468233243655373e-22, 0, 1.748560161579772e-07, 6.144233781964944e-07, 8.220295423092755e-07, 1.835379524893718e-06, 2.487255304534087e-06, 3.157485809637785e-06, 4.977890579232528e-06, 4.383927762291343e-06, 6.104205385591544e-06, 5.949313038058785e-06, 8.642896275891427e-06, 5.407444563601216e-06, 7.453001060711722e-06, 1.119745014448323e-05, 1.372124824356619e-05, 7.478161053090149e-07, 3.930492364944675e-10, 1.811187949891203e-15, 4.029905221118973e-32, 0, 7.034000034581462e-11, 2.577345083335134e-10, 5.351874943226071e-10, 1.405815957843792e-09, 1.286857703942177e-09, 1.850918235132934e-09, 2.612981031297252e-09, 3.777304114474325e-09, 3.493993033573338e-09, 5.401132639931761e-09, 4.837369681683022e-09, 5.01774961129131e-09, 5.051963809550828e-09, 7.481590080652894e-09, 6.333398691815406e-09, 4.385483808593349e-10, 3.658041453632017e-13, 8.939913527233721e-19, 1.262679318808947e-37, 0, 1.864455993117298e-15, 6.844743513056899e-15, 1.315644624740215e-14, 2.562025446355038e-14, 3.820179191290186e-14, 3.721157951822883e-14, 7.005099993843285e-14, 6.353646663198198e-14, 7.740598924235481e-14, 1.146062582819987e-13, 9.319518331622338e-14, 1.147717239624122e-13, 1.240961830106233e-13, 1.465615531679495e-13, 1.83148592728595e-13, 1.27041713463421e-14, 9.179521998477872e-18, 1.355040233832479e-24, 1.012554362822127e-42]
+      ],
+     "26":[
+      [0.009829313926254945, 0.007146286615225552, 0.005124000214112204, 0.004873070498376686, 0.003482522265073527, 0.003013816631609511, 0.004547237802820082, 0.002033467362079482, 0.002247800308469972, 0.002251427215347164, 0.001573647873431043, 0.001722472492112956, 0.001502682702733138, 0.001131705059507513, 0.0009133101780154473, 0.0001395865594603973, 5.063745254593415e-07, 2.559799193057283e-11, 3.319179054242035e-18, 1.162892210128761e-28, 0.006570037269565818, 0.006438814059770912, 0.005049193635252454, 0.004744915593742267, 0.003675623129912566, 0.003446490099331002, 0.002415834791247801, 0.002549785029098404, 0.001973437245277308, 0.002333762622394835, 0.002073836908951642, 0.00172707585302338, 0.001482991313900339, 0.001292739036559709, 0.0008045290911629345, 0.0001375752315569465, 5.770836598123385e-07, 2.133179164660656e-11, 3.233752852186857e-18, 4.262122484213153e-36, 0.008277317086336474, 0.007319009004022439, 0.005553877296056256, 0.006133214419856349, 0.004655815751433393, 0.003201977828186348, 0.003275038929297508, 0.002476641465428495, 0.002263741258603576, 0.0019453572850909, 0.001832767243869556, 0.001395455553836905, 0.001383771468677775, 0.001352515868923559, 0.001012535835343244, 9.627000446153184e-05, 5.276769800128764e-07, 1.748307077728539e-11, 3.022021430555516e-18, 7.861383378976889e-36, 0.009517408593601994, 0.007896001183613449, 0.006370261968887012, 0.004233860735085769, 0.004822051924006535, 0.003865225083853667, 0.003219173802907587, 0.00269609423638439, 0.002759637456126353, 0.002713765175923952, 0.001853217269948282, 0.001386297187177742, 0.001622135730166301, 0.001257517633505363, 0.0009878430573568814, 0.0001390422995311347, 6.336924889476332e-07, 1.634357545104664e-11, 3.012397645963199e-18, 2.166693343841254e-29, 0.008917201727655559, 0.00597007327081699, 0.00616549585448945, 0.005819533532239097, 0.003142589233191947, 0.003712132906751633, 0.003225769744419856, 0.002969973707242455, 0.002447852973688484, 0.00217701159521402, 0.001668599096661171, 0.001569937719935755, 0.002143382162542506, 0.001659976093740499, 0.001140301089229463, 0.000123933409037584, 4.478963656405275e-07, 1.805380653493516e-11, 4.171949872873943e-18, 2.329200418460425e-28, 0.00969110856506984, 0.008962036875274994, 0.007276891664428822, 0.004875364083894933, 0.004644325514879106, 0.003303632772279811, 0.003360006896713133, 0.003242465686942424, 0.002474489950838804, 0.002751029280839725, 0.002217028528275312, 0.002141021437357307, 0.001522673059069659, 0.001530128536502452, 0.001192469083326181, 0.0001459372846084709, 5.144882840656129e-07, 2.030305237542364e-11, 2.712113317524154e-18, 1.748561709096803e-35, 0.009981440621425669, 0.007797628748845424, 0.005381850287283598, 0.00511711772933525, 0.00569975537341713, 0.004660632703170286, 0.003170826792401949, 0.003480794775636258, 0.002671624028771224, 0.002289607766481092, 0.001888023542370478, 0.001610389929645578, 0.001490665903814747, 0.001384176789425353, 0.0008892906395244975, 0.0001256317636182368, 4.185324961060426e-07, 1.83740299607588e-11, 2.913891779959464e-18, 1.722633482324467e-28, 0.01094805574981858, 0.005926712464292404, 0.005852159879301279, 0.004966869402181784, 0.005204509778304345, 0.004172422449021587, 0.002869281163172501, 0.003219728343323811, 0.002290468693017558, 0.00228774745758428, 0.00161910939624094, 0.001965691561843278, 0.001316793913740979, 0.001461485878401639, 0.001012230281429216, 0.00014911485408977, 4.101790666196713e-07, 2.21383562480276e-11, 2.533274027231875e-18, 5.026612614764778e-28, 0.01025561547561304, 0.009078052629597128, 0.006492946070982417, 0.005804500503272307, 0.004053042587424966, 0.004274016286251454, 0.004442769514356676, 0.003225407020083909, 0.004600037134845257, 0.002172533976021847, 0.001448438029004791, 0.001699854452304619, 0.001646460921292672, 0.00113831772619807, 0.0008800567869235481, 0.0001679854112551981, 4.143924165313019e-07, 1.495225999184329e-11, 2.212339829966065e-18, 5.154175979364297e-28, 0.007983200770134381, 0.01001660894425472, 0.005890861130901204, 0.005645854453859689, 0.004864851077286686, 0.003839468093851781, 0.003134265893084325, 0.003569593896178353, 0.002260289376147989, 0.002397830534634695, 0.001622087691770765, 0.001849452128939121, 0.001773109246674206, 0.001242020833135635, 0.001338680358009496, 0.0001614882803988816, 4.74945122086253e-07, 1.723264043435563e-11, 2.659194023480853e-18, 1.701077439141951e-28, 0.01061362790092808, 0.005528813782636568, 0.006581574297656147, 0.006158629099474104, 0.004915733408167344, 0.003888250593900752, 0.003334651917312447, 0.00257652485975108, 0.002686799045612416, 0.002196150557510178, 0.002057914875147478, 0.001979946869970976, 0.001865637388304351, 0.001120288686399662, 0.0009867097567334449, 0.0001091579387276325, 4.007860224174377e-07, 1.734548246039617e-11, 2.252648348777621e-18, 2.910736370493218e-35, 0.01009756601325162, 0.008636339077172218, 0.006440871089874238, 0.004616099357838965, 0.005002056749957324, 0.003434232910084783, 0.003684176359866635, 0.002712694393520872, 0.002922585781404949, 0.002495482458959585, 0.00250441567581884, 0.001465121589779393, 0.001747071774640595, 0.001478063971528997, 0.001154849952599467, 0.0001249973940828873, 4.155621143193829e-07, 1.543305411506562e-11, 3.335413177424884e-18, 2.333619331212464e-28, 0.01159241207554037, 0.0116017548620334, 0.007989819813865488, 0.004827635873524844, 0.003899161258014836, 0.003457036592557989, 0.002851600583416838, 0.00245897240361457, 0.003114473531723155, 0.003429306033858067, 0.002405087516074865, 0.002414097706749967, 0.001703852145705424, 0.001074060584413052, 0.00145496772688645, 0.0001463498313219426, 4.218039223477964e-07, 1.428996464787017e-11, 2.730460750474856e-18, 2.31321160402998e-28, 0.01356799836827223, 0.01269025958029859, 0.00620293568596232, 0.004650313447240582, 0.005679898656477791, 0.004353957345964641, 0.004828192452089123, 0.003739962050091905, 0.002609505353480803, 0.002476154608366977, 0.00233239315449003, 0.001669039912125333, 0.001430443887866984, 0.001273115352261062, 0.001226562092534688, 0.0001962015351142692, 4.401661003456148e-07, 1.27235190152736e-11, 1.945710152363213e-18, 3.370006398113729e-28, 0.008794981225244863, 0.01413518239357387, 0.007657859870424564, 0.007536834430751092, 0.005445019775374991, 0.00498737997075328, 0.003504834577211826, 0.003278383081287353, 0.002561470352756166, 0.002320046963513885, 0.002775210430828339, 0.002503351752839455, 0.002155911572252321, 0.001624343143246299, 0.001299833484762805, 0.0002015972191888707, 3.580400535120196e-07, 1.073584066555583e-11, 2.19842964913127e-18, 7.13686351611369e-29, 0.05962692786442851, 0.0265784811563315, 0.007000326782851045, 0.004438098438969901, 0.004111576265951151, 0.006780337574106779, 0.003551154022612483, 0.003553527945441639, 0.002787793577138919, 0.001703579990298034, 0.002310988999383734, 0.002414000843359799, 0.001593584167133448, 0.0007788949440269111, 0.001011803702256378, 0.0001868189093402249, 2.817291726082732e-07, 6.45688230302678e-12, 1.402379563083793e-18, 1.224860643978308e-28, 0.0004894845078581977, 0.0002749475361164323, 0.0002465308927384258, 0.0002137193786541989, 0.0001715087080208688, 0.0001774953685927066, 0.0001277909243624656, 0.0001340341503071741, 0.0001088291081171196, 9.651730466848373e-05, 9.921591439309295e-05, 0.0001160621606010198, 7.542585537549192e-05, 7.844339751337741e-05, 5.140917337759717e-05, 1.069982753652611e-05, 4.343910076944699e-08, 1.180941807860918e-12, 1.434264135584775e-19, 4.378181726921404e-30, 3.353029524510833e-06, 3.421581462503154e-06, 2.976767608833039e-06, 1.752963570622075e-06, 2.180341690679519e-06, 1.872792254047301e-06, 1.635078652664671e-06, 1.875596490682094e-06, 1.252460034324661e-06, 1.364629673366342e-06, 1.066909693687993e-06, 1.268600386783624e-06, 6.604964451469965e-07, 6.55987823376825e-07, 6.349330221887376e-07, 1.191445905628801e-07, 5.646903491842891e-10, 2.013490351813821e-14, 4.132572116076861e-21, 2.289704094790844e-39, 9.440426393008637e-09, 6.861808658300766e-09, 6.225002356477889e-09, 5.68958906730595e-09, 8.325613838796546e-09, 4.830459383868951e-09, 4.778291139300424e-09, 4.908150041292062e-09, 5.379838461012256e-09, 3.893979902300187e-09, 4.828706357696251e-09, 3.539638898950032e-09, 3.055416929126113e-09, 2.216692966554837e-09, 2.114846986657404e-09, 2.741194449952578e-10, 1.64944008217153e-12, 9.310913387094232e-17, 1.009732181701235e-23, 3.561737779971237e-44, 3.389608417923523e-12, 2.945590793813123e-12, 2.677367288709383e-12, 2.265150483927195e-12, 2.457278377683838e-12, 2.322331880337305e-12, 1.555770549566177e-12, 2.130969906913603e-12, 1.465517450644085e-12, 1.397095342076081e-12, 1.659331521436447e-12, 1.104386279690992e-12, 1.131809001479228e-12, 8.818160316968181e-13, 6.709260703660815e-13, 1.2835664106563e-13, 7.730453462084307e-16, 3.766616667576479e-20, 2.442538745925169e-28, 4.47127131426589e-48]
+      ],
+     "27":[
+      [0.01093117945939385, 0.008025757520874683, 0.005811344157545473, 0.005581257588788837, 0.004027960926867855, 0.003520223214108345, 0.00536368327957629, 0.002422226733574256, 0.002703942703500976, 0.002735016055952684, 0.00193050874551734, 0.002133923203293362, 0.001879992348935149, 0.001443931944741605, 0.001202177900301179, 0.0002285316885334534, 1.497701713442648e-06, 2.373714906202024e-10, 1.926360425818214e-16, 8.864010178626532e-26, 0.007208887251352844, 0.007134574371156544, 0.005649969006438741, 0.005361847380942428, 0.004194487552718998, 0.003971796625958059, 0.002811507741176421, 0.002996661938745594, 0.002342176838456829, 0.002797146786982611, 0.002510125463161037, 0.002111030586056008, 0.001830560270361719, 0.001627350039332879, 0.00104483780264293, 0.0002222287213704617, 1.684039087505663e-06, 1.95173887096732e-10, 1.851907253095349e-16, 3.206201127267204e-33, 0.008960792163691746, 0.008001490235215963, 0.006131641194393262, 0.006838022415074211, 0.005242037663643596, 0.00364069844496129, 0.003760494374205765, 0.002871797106967208, 0.002650815990545681, 0.002300458447741561, 0.002188691696814774, 0.001682889402025807, 0.001685257459857737, 0.001679844043799964, 0.001297400437567026, 0.0001534291457292651, 1.519292105508525e-06, 1.578278505712878e-10, 1.707714707338115e-16, 5.836301421122658e-33, 0.01016557083744227, 0.008516909799548921, 0.006938953724398214, 0.004657310448352442, 0.005356640299191571, 0.004336081437953627, 0.003646944534675639, 0.003084479889754709, 0.003188314048335797, 0.00316623798555337, 0.002183533671591363, 0.001649499525357261, 0.001949150486133944, 0.001540979955526579, 0.001248843261063141, 0.0002186354541650178, 1.800160660163643e-06, 1.455741880484612e-10, 1.679713763720763e-16, 1.587486125070247e-26, 0.00939718391727821, 0.006353464144172402, 0.006626142765380626, 0.006316010980136354, 0.003444326429268597, 0.004108679311759912, 0.003605572134788608, 0.003352398017260361, 0.002790297381125319, 0.002506040805673736, 0.001939731737722568, 0.001843038455676434, 0.002541054151016848, 0.0020069700204516, 0.001422314708767144, 0.0001922731536602239, 1.255363950922551e-06, 1.586635978748699e-10, 2.295446094193351e-16, 1.684197245584672e-25, 0.01007624012822079, 0.009410085372443467, 0.007716042376647209, 0.005220566986958114, 0.005022214496361567, 0.003607666778070007, 0.003705415554373629, 0.003611056559836239, 0.002782958905301928, 0.003124485771461805, 0.002542827490646348, 0.002479870170415176, 0.001781053378612058, 0.001825252482738391, 0.001467504039846934, 0.0002233844596865802, 1.422744276354511e-06, 1.760519712606167e-10, 1.472450547904961e-16, 1.247787168365555e-32, 0.01023938870061686, 0.008078024088535299, 0.00563035866020147, 0.005406195956224776, 0.006081134099088181, 0.00502152108397529, 0.003450047188052742, 0.003824662250675338, 0.002964505182765205, 0.002565666525438464, 0.002136529079374231, 0.001840326028434998, 0.001720308721771754, 0.001629080010784587, 0.001079771229109729, 0.0001897328069503648, 1.14193036386734e-06, 1.572008377295265e-10, 1.561029143719332e-16, 1.213181416878925e-25, 0.01108085811797573, 0.00605775966984448, 0.006040546388907542, 0.005177316440442811, 0.005478526790446262, 0.004435415255355969, 0.003080216388154634, 0.003490515011222862, 0.002507591832639216, 0.002529314414619311, 0.00180772856990601, 0.002216331550149186, 0.001499337918932764, 0.001697075384474319, 0.00121261531205673, 0.0002221876942668043, 1.10418755560838e-06, 1.868815911921491e-10, 1.33913483467927e-16, 3.493666554961573e-25, 0.01024126386120414, 0.009154746248740969, 0.006612371895952083, 0.005969559129038868, 0.004209403582028943, 0.004482678855031412, 0.004705625365529233, 0.003449929781815787, 0.004968774402385488, 0.002369827720428061, 0.001595557333351437, 0.001890978393793002, 0.00184964602388927, 0.001304143885064035, 0.001040183480862538, 0.0002469600025781523, 1.100626369125058e-06, 1.245370418552736e-10, 1.153980203777885e-16, 3.535397960388901e-25, 0.007865460489898271, 0.009966200263739769, 0.005919016322944202, 0.005728782868542886, 0.004984989300512128, 0.003973084492740626, 0.003275327184647773, 0.003767036529286219, 0.002408836274325883, 0.002580619578301073, 0.001762958683389901, 0.002029893444651903, 0.001965296204655749, 0.001403932518908609, 0.001561102874249886, 0.0002342350418806755, 1.244601003354569e-06, 1.416165227768644e-10, 1.368676375484692e-16, 1.151532070878192e-25, 0.01031730051166329, 0.00542745178495511, 0.00652462660440537, 0.006165550466507058, 0.004969791032472875, 0.003969777024490934, 0.003438147410051076, 0.002682690031211577, 0.002825098315993367, 0.002331968927507126, 0.002206735929623039, 0.002144069429336103, 0.002040210258101872, 0.001249402844178287, 0.001135270297869168, 0.0001562146750630278, 1.036233734414794e-06, 1.406431941091902e-10, 1.144058450776269e-16, 1.944587885105623e-32, 0.009684426118581427, 0.008364667141162678, 0.00629978095878923, 0.00455950740121451, 0.004989458248188253, 0.003459366598111612, 0.003747739327222928, 0.002786711510640656, 0.003031940235995904, 0.002614388744772798, 0.002649624763251831, 0.001565359106266985, 0.001885009109536497, 0.00162637542945073, 0.001310963139985774, 0.000176491159342136, 1.06008184516954e-06, 1.234679667305087e-10, 1.671507632728136e-16, 1.538605674482483e-25, 0.01096947429001664, 0.01108657701813073, 0.007710324275216062, 0.004704701788881654, 0.003837344544839654, 0.003435782330442539, 0.002862018827949303, 0.002492296042736018, 0.003187813095110644, 0.00354467750871967, 0.002510520045622422, 0.002544778667116105, 0.001813800324508815, 0.0011660340543801, 0.001629570655242074, 0.00020387762429158, 1.061627600380045e-06, 1.12798544945441e-10, 1.350200981884669e-16, 1.505168620104068e-25, 0.01249789775524014, 0.0118046599371543, 0.005826961118540333, 0.0044115276789316, 0.005441384020320113, 0.004212258673342106, 0.004717127006977895, 0.003689966153965181, 0.00260001361674885, 0.002491480428760569, 0.002369975281142804, 0.001712660010258742, 0.001482305346098845, 0.001345425096815462, 0.001337268932707647, 0.000266066362491332, 1.078435069659979e-06, 9.777300904922344e-11, 9.368017337686458e-17, 2.135723724678393e-25, 0.007762298034376676, 0.01259849317089596, 0.006892653923615238, 0.006850621579196395, 0.004998071685895831, 0.004623145470940922, 0.00328091344044892, 0.003099196780054695, 0.002445350097074495, 0.002236715760039331, 0.002701918827736582, 0.002461277920745217, 0.002140583433483023, 0.001644765442553663, 0.001357848972463839, 0.0002619437196641951, 8.405310795010349e-07, 7.90551129851895e-11, 1.014545975233152e-16, 4.337403638979544e-26, 0.0390122142960325, 0.01756103568288353, 0.004670895732672887, 0.002990479107147681, 0.002797784507186732, 0.00465928609020186, 0.002464335304698734, 0.00249030377712577, 0.0019729477213187, 0.001217530733854578, 0.001667929847893705, 0.001759461942798915, 0.001172951561114535, 0.0005846679992631719, 0.0007835469100483454, 0.0001799528361477169, 4.903772004704474e-07, 3.527397141174329e-11, 4.809659455511122e-17, 5.551787031727354e-26, 0.0001420524993862079, 8.057894549243699e-05, 7.296339758618243e-05, 6.38762904257365e-05, 5.176594764823593e-05, 5.410125633438295e-05, 3.933532892039463e-05, 4.166398475061947e-05, 3.416277035607293e-05, 3.059679779379568e-05, 3.176252439600999e-05, 3.752211434627734e-05, 2.462521146046969e-05, 2.611815718193121e-05, 1.765903797707881e-05, 4.57190777719912e-06, 3.355270689252762e-08, 2.867543003673916e-12, 2.196655848157107e-18, 8.947858003090184e-28, 1.999914063977677e-07, 2.060927418916152e-07, 1.810684601684136e-07, 1.076795014212146e-07, 1.352530827330555e-07, 1.173207638862951e-07, 1.034395880473119e-07, 1.198258695695292e-07, 8.080500886840715e-08, 8.891041226673432e-08, 7.019869810623788e-08, 8.429270510721476e-08, 4.431998034858414e-08, 4.489036997044286e-08, 4.482592520924993e-08, 1.046444777392356e-08, 8.971915147031401e-11, 1.00872572144523e-14, 1.317561652622529e-20, 9.926939541059418e-38, 4.214025247222511e-11, 3.093185989179294e-11, 2.833799837145461e-11, 2.615610544408885e-11, 3.865193804985675e-11, 2.264678611931406e-11, 2.262320755314286e-11, 2.346729990016844e-11, 2.597637450285366e-11, 1.898747870737589e-11, 2.377765179156649e-11, 1.760199829702748e-11, 1.534400095038834e-11, 1.135284531593697e-11, 1.117447758941251e-11, 1.802164518151739e-12, 1.96364552790135e-14, 3.510670448567499e-18, 2.455857348570123e-24, 1.213838016880956e-43, 3.404258499713218e-16, 2.987496298478995e-16, 2.742238947989632e-16, 2.342918576445942e-16, 2.566715310010746e-16, 2.449690616375526e-16, 1.657282393157081e-16, 2.29241215365647e-16, 1.592103108890529e-16, 1.532750418112192e-16, 1.838417527685311e-16, 1.235657089373571e-16, 1.278840731734132e-16, 1.016143724941983e-16, 7.976387479701691e-17, 1.898998117069092e-17, 2.073245328440604e-19, 3.215211884182192e-23, 1.36676233147704e-30, 3.644294822490006e-49]
+      ],
+     "28":[
+      [0.01142326158066362, 0.008719743250467208, 0.00656422433323398, 0.006554244393794261, 0.004917610741109342, 0.004467988292586732, 0.007077379147337523, 0.003322662509567865, 0.003855898667947767, 0.004054518485404978, 0.002975068997992884, 0.003418570228676108, 0.003130810923135021, 0.002598371945276309, 0.002446357242688028, 0.00109583143570353, 7.130377319035703e-05, 8.672319400580412e-07, 6.258726270278663e-10, 3.245458506395641e-15, 0.007331997796274884, 0.007544261394867272, 0.006211319640935291, 0.006128243411211645, 0.004984008833106806, 0.004906364613680627, 0.003610601951450377, 0.004000738642079812, 0.003250714281132279, 0.004035762963558939, 0.003764884739127461, 0.003291480079499357, 0.002966987891598259, 0.002850142349635345, 0.002069335865667381, 0.00103711849279441, 7.803141916881787e-05, 6.939936159514583e-07, 5.855791662094922e-10, 1.142446812955982e-22, 0.008870197957312741, 0.00823478666532574, 0.006560657433580601, 0.007606500411929676, 0.006062236065869295, 0.004377138996968988, 0.004700218894994623, 0.003731547665500437, 0.003580729451846412, 0.003230409613226671, 0.003195020524246938, 0.002553789431312244, 0.002658464114774633, 0.002863435036021726, 0.002500857451345294, 0.0006968972343513279, 6.851577732250087e-05, 5.461931846841806e-07, 5.255348103824951e-10, 2.023877213440051e-22, 0.009793846986059788, 0.008530964926321298, 0.0072260215894408, 0.005042247927052467, 0.006029201873530345, 0.005073850811211719, 0.004436463690133518, 0.003900783205776092, 0.004191675452789975, 0.004327343636338679, 0.00310229849523285, 0.002436219021402786, 0.002992571514389301, 0.002556524616320366, 0.002342919906324635, 0.0009665313963684174, 7.901223791606506e-05, 4.903178430756039e-07, 5.03086944291678e-10, 5.357465860546442e-16, 0.008811619342240756, 0.006193885162922236, 0.006715873531343736, 0.006655310782080106, 0.003773185013827035, 0.004679279241799957, 0.00426892392550053, 0.004126310440393682, 0.003570372257066509, 0.003333515027087952, 0.002682265777144615, 0.00264932341594444, 0.003797078112346431, 0.003240636460696961, 0.002597057947070219, 0.0008272758567518298, 5.362759939407785e-05, 5.20119483387049e-07, 6.691111602684899e-10, 5.531555340439248e-15, 0.009195911628194964, 0.008928621415014699, 0.00761157626991975, 0.005354037581507634, 0.005354726970846076, 0.003998907990711105, 0.004269916899001784, 0.004325924037578337, 0.003465836525659656, 0.004045117133427687, 0.003422278151797306, 0.003469507205016979, 0.002590304457385016, 0.002868472153061257, 0.002607975438590894, 0.0009354547874683199, 5.915384472972983e-05, 5.616956190866395e-07, 4.177313944386809e-10, 3.988425350340324e-22, 0.009095161450805132, 0.007459953002694431, 0.005405752553255749, 0.005396294304795205, 0.006310543366100038, 0.005417393531891421, 0.003869435720588232, 0.004459413918992396, 0.003593300939741482, 0.003232904330832021, 0.002798641743813713, 0.002505957541574367, 0.00243511994180212, 0.002491782831675118, 0.001867652262265385, 0.0007733075373985785, 4.620989673846317e-05, 4.881475775227144e-07, 4.310170453935251e-10, 3.77394142949156e-15, 0.00957969547355718, 0.005444837379847134, 0.005644666020071217, 0.005029797251797226, 0.005533346786694958, 0.004657268791290829, 0.003362371925755445, 0.00396110292125468, 0.002958285898436541, 0.003101968492138946, 0.002304695944252054, 0.002937349222856748, 0.002065643653209058, 0.002526450630947123, 0.002041405184868386, 0.0008813970706351502, 4.348898720444281e-05, 5.648078994995186e-07, 3.598625003437843e-10, 1.057696636678451e-14, 0.008617387378235973, 0.008008716779750064, 0.00601399480694896, 0.005644581877514587, 0.004137980260965263, 0.004581190930487046, 0.004999489017188225, 0.003810488172703527, 0.005705271543519157, 0.002828753346304306, 0.001979869524345995, 0.002439221051566344, 0.0024802087654885, 0.001889639345294226, 0.00170435414380867, 0.000953502496252348, 4.219094465690443e-05, 3.663300630696073e-07, 3.018153415219178e-10, 1.041669754278112e-14, 0.006441570894005799, 0.008485780824697944, 0.005239633264165313, 0.00527226772722228, 0.004769552713238264, 0.003951974556015741, 0.003386948025301841, 0.004049633910308982, 0.002692029981412691, 0.002998112055894249, 0.002129177442038317, 0.002548492721641828, 0.002564916266172843, 0.00197990888229718, 0.002489585004272388, 0.0008802226039162672, 4.643593511714909e-05, 4.054427491741988e-07, 3.483984446944854e-10, 3.302035012234239e-15, 0.00822396247511036, 0.004497856306887398, 0.00562152850677783, 0.005522736867792778, 0.004628059680667597, 0.003843260760550516, 0.003460395458633392, 0.00280694449470606, 0.003072936395033496, 0.002636902218971191, 0.002593985115056013, 0.002619970435354164, 0.002591597130886998, 0.001714939656171199, 0.001762146797359996, 0.0005713598806050061, 3.762948825774584e-05, 3.919022435875396e-07, 2.834379191801757e-10, 5.42686370015204e-22, 0.007513428526674884, 0.006746950058964905, 0.005282912683295045, 0.003975114544740715, 0.004522342414173315, 0.003259714404322414, 0.003671299718840305, 0.002837948853362576, 0.003209887880754026, 0.00287733647745298, 0.00303145206722452, 0.001861747357719541, 0.002330532860204496, 0.002172783058174494, 0.001980534855689003, 0.0006282897230580788, 3.746781295268573e-05, 3.348563693916285e-07, 4.030456338530259e-10, 4.178940472350355e-15, 0.008283257089640065, 0.008703769217090448, 0.006293202160088857, 0.003992223791770308, 0.003385258982402584, 0.003151081667663777, 0.002728814434014546, 0.002470376977749964, 0.003284831721967416, 0.003797067025993114, 0.002795638872273902, 0.002945830951587413, 0.002182640924303444, 0.001516204677979446, 0.002396162302849758, 0.0007064110413166566, 3.652088839332679e-05, 2.977520958554212e-07, 3.168707956911649e-10, 3.978719683210397e-15, 0.008940460611109527, 0.008779523969551379, 0.004505559795803039, 0.003546331936037719, 0.004547556207891522, 0.003659794017582839, 0.00426075612174063, 0.003464922881786285, 0.002538069334722998, 0.002528346510935794, 0.002500165567260121, 0.00187817707307804, 0.001689810720427098, 0.001657347889942411, 0.001862813298367377, 0.0008733437128258228, 3.51454400330708e-05, 2.444949566833242e-07, 2.082633343262038e-10, 5.347457875002063e-15, 0.005095927296768119, 0.008598962884777744, 0.004891061121446189, 0.005053942879222272, 0.003833373643525961, 0.003686286942401559, 0.002719655181975574, 0.002670731953363763, 0.002190679575464906, 0.002083050794995843, 0.002615816007364076, 0.002477056818316805, 0.002239455689024912, 0.001859379501732668, 0.001735848916599733, 0.0007890649109367202, 2.513830214933992e-05, 1.81417056199124e-07, 2.0696888983783e-10, 9.964171828761346e-16, 0.01405795891073817, 0.006579097652763989, 0.001819304956279628, 0.001210960029646648, 0.0011778272177733, 0.002039198836371295, 0.001121262892305359, 0.001177936865166204, 0.0009701566870231154, 0.0006223825896052032, 0.000886341455535314, 0.000971949093961966, 0.0006735636776575785, 0.0003627951944192888, 0.0005498109072985762, 0.0002975422183938436, 8.049721347817274e-06, 4.442225181253352e-08, 5.381975048241005e-11, 6.98913508629558e-16, 1.015544121938987e-05, 5.98915975784164e-06, 5.63817228487653e-06, 5.131644108785462e-06, 4.323536543626722e-06, 4.697588940990714e-06, 3.550730541511633e-06, 3.909827294899629e-06, 3.332777073185229e-06, 3.102988344240705e-06, 3.348611275267915e-06, 4.112227687751274e-06, 2.805462810818309e-06, 3.215290251718825e-06, 2.458328658376995e-06, 1.499694812590727e-06, 1.092558021375948e-07, 7.160219242036361e-10, 4.867436309755876e-13, 2.224811978899637e-18, 6.4149925104926e-10, 6.87291965579412e-10, 6.277831961809467e-10, 3.881349765229574e-10, 5.068440357677003e-10, 4.570608571669538e-10, 4.18940615124829e-10, 5.045188125731251e-10, 3.536883093260773e-10, 4.045621503288162e-10, 3.320522593471081e-10, 4.144829632171939e-10, 2.265427232530479e-10, 2.47944873022587e-10, 2.799778015303998e-10, 1.539991491229359e-10, 1.310350564659836e-11, 1.128695356107969e-13, 1.304989835118775e-16, 1.097827846997751e-29, 9.290124926065923e-16, 7.089601925199719e-16, 6.75259840244287e-16, 6.479706024361201e-16, 9.954707621752118e-16, 6.063639323676712e-16, 6.297164624362106e-16, 6.790669780169116e-16, 7.814139905431968e-16, 5.937691619164608e-16, 7.729680247816077e-16, 5.948278622090425e-16, 5.39013002277556e-16, 4.30934772415499e-16, 4.796429007174503e-16, 1.822334942367155e-16, 1.9695522536474e-17, 2.693473640056465e-19, 1.661296226303082e-22, 9.100024486353078e-38, 6.1916576384488e-24, 5.649062913576698e-24, 5.390803359547473e-24, 4.788274933515642e-24, 5.453405584484505e-24, 5.410832336762011e-24, 3.805455267243524e-24, 5.472107224908487e-24, 3.950748674597808e-24, 3.953852795589e-24, 4.929791692956914e-24, 3.444389594480804e-24, 3.705571288563004e-24, 3.181458300403662e-24, 2.823834778512874e-24, 1.583225194132818e-24, 1.712668624749506e-25, 2.026536137632753e-27, 7.554939556422124e-32, 2.211715182454159e-46]
+      ],
+     "29":[
+      [0.00904316107218283, 0.006646057435772343, 0.004817016531366114, 0.004630797259996936, 0.00334525931063168, 0.002926403862202738, 0.004463190135172489, 0.002017501883959767, 0.002254302666654737, 0.002282384973181084, 0.001612552154159434, 0.001784154505047067, 0.001573331147759373, 0.001210675290854128, 0.001010965517296967, 0.0001960499278110864, 1.347254236970379e-06, 2.289687358883096e-10, 2.001354285714522e-16, 9.903899317771268e-26, 0.006062850198767093, 0.00600622347855295, 0.004761052464795711, 0.004522655499048047, 0.003541431165732948, 0.003356652735812314, 0.002378356179097748, 0.002537419364742898, 0.001985133681665426, 0.002373010204280816, 0.002131536367541818, 0.001794334937575482, 0.001557411561159399, 0.001387130160240869, 0.0008932473177361445, 0.0001938095498705525, 1.540024917782029e-06, 1.91384286490827e-10, 1.955687002358624e-16, 3.640506982081951e-33, 0.00766142754652644, 0.006847924865508117, 0.005252769249080219, 0.005863599045292361, 0.004499401146293123, 0.003127942767048925, 0.003233979244912195, 0.002472082274240783, 0.002284043234309399, 0.001984053582295329, 0.001889455010228051, 0.001454183464332541, 0.001457606342404858, 0.001455659528173591, 0.001127590609593759, 0.0001360306908374379, 1.412431941948007e-06, 1.5732743339344e-10, 1.833109590785963e-16, 6.734467302588262e-33, 0.008835865193852297, 0.007410101728204946, 0.006043097408718463, 0.004059971128384507, 0.004674133049306543, 0.003787263520274018, 0.003188419402466401, 0.002699262395141225, 0.002792799894527837, 0.002776109161002711, 0.001916310288760424, 0.001449004670922405, 0.001713852001949522, 0.00135750602562036, 0.001103415897259611, 0.0001970620517028287, 1.701325863120213e-06, 1.475165527596777e-10, 1.832739289811665e-16, 1.861526386207281e-26, 0.008303637434988459, 0.005619608310632354, 0.005866508864226385, 0.005597369407822577, 0.003055386980343464, 0.003648242254200808, 0.003204599778025897, 0.002982442334951357, 0.002484749035542392, 0.002233749292909602, 0.001730616766539233, 0.00164590693802496, 0.002271407965201514, 0.001797375917294878, 0.001277556802430913, 0.0001761788445483259, 1.206132991925732e-06, 1.634438377969108e-10, 2.545798988481224e-16, 2.006990084932709e-25, 0.009051526461226166, 0.008461389570457421, 0.00694490340177647, 0.004703394713925978, 0.004529078353506747, 0.003256570572595213, 0.003348028745980561, 0.003265903993112724, 0.002519367187213209, 0.00283124511372138, 0.002306368796960112, 0.002251398825774872, 0.001618492762711952, 0.001661780126896115, 0.00134003567722526, 0.0002080846683160996, 1.389635865726844e-06, 1.843598435553707e-10, 1.659925641489874e-16, 1.511071788630674e-32, 0.009350812202636196, 0.007384230738849618, 0.005151807797116349, 0.004951508408099948, 0.005575080432806835, 0.004608094147801569, 0.003169051261180465, 0.003516528792357728, 0.002728279426243573, 0.002363475353549336, 0.001970028944949748, 0.001698518154784008, 0.001589249712548545, 0.001507804134990879, 0.001002352937039261, 0.0001796722040670716, 1.133865987807727e-06, 1.673454043423014e-10, 1.788747884489719e-16, 1.493007299366045e-25, 0.01028726695889342, 0.005629417570965722, 0.005618897674539164, 0.004820607289416318, 0.00510600985670834, 0.00413782040402206, 0.002876317006393481, 0.003262585377100272, 0.002346090500939615, 0.002368672193830994, 0.001694526189232218, 0.002079511895132679, 0.001408109798319854, 0.001596815989013436, 0.001144361253784496, 0.0002138991816416047, 1.114582475631637e-06, 2.022359045373858e-10, 1.559739017671501e-16, 4.369266392869087e-25, 0.009665644186231332, 0.008648650891940708, 0.006252918957925509, 0.005650539664981343, 0.003988311295461877, 0.004251337624621205, 0.004467077465299467, 0.003278183339594413, 0.004725935546864744, 0.002256158005977249, 0.001520470725910978, 0.001803697995524755, 0.001765940980679737, 0.001247469083462596, 0.0009979310840424836, 0.0002416939155107731, 1.129420964994037e-06, 1.370005771735027e-10, 1.366201616062549e-16, 4.493198024718539e-25, 0.007546600400696008, 0.009571535554862174, 0.005690167038940748, 0.005512644394410603, 0.00480156326860498, 0.003830590342831793, 0.003160900017609712, 0.003638921962684845, 0.002329140669186974, 0.002497621573678611, 0.001707881316215352, 0.001968341242707075, 0.001907504022320409, 0.001365212883143214, 0.001522551324041221, 0.0002330452502943074, 1.298350534411676e-06, 1.583686437355662e-10, 1.647044424755074e-16, 1.487245829561201e-25, 0.01006334942209404, 0.005299040658672195, 0.006376471298107441, 0.00603140843311912, 0.004866377724371964, 0.003890928766515124, 0.003373104644066033, 0.002634466329239113, 0.002776970343787757, 0.002294429089999055, 0.002173277293315747, 0.002113563058767504, 0.00201308251828593, 0.001235110504656345, 0.001125612303339161, 0.0001580006335417199, 1.0989166054283e-06, 1.598838942549372e-10, 1.399394492105668e-16, 2.552249080710002e-32, 0.009602823634058434, 0.008302302060659343, 0.00625891109677368, 0.004534332785566645, 0.004966719807009895, 0.003446928933618535, 0.00373786203800314, 0.002782035916039252, 0.003029750523025028, 0.002614993389829219, 0.002652758354873904, 0.001568696329556211, 0.001890813197474062, 0.001634453719572172, 0.001321382320360274, 0.0001814712702159211, 1.142854421368167e-06, 1.426823731715677e-10, 2.078198432156188e-16, 2.05215829069137e-25, 0.01105754675683905, 0.01118652638060655, 0.007787425071334769, 0.004756368206528351, 0.003883246503567789, 0.00348024065696686, 0.002901845362390986, 0.002529404167717655, 0.003238373648459813, 0.003604333977284162, 0.002555199817217558, 0.002592523845118494, 0.001849577290152143, 0.001191271829461996, 0.001669778932729988, 0.0002131089682348664, 1.163503070484281e-06, 1.325100631250016e-10, 1.706330158601559e-16, 2.040121420957327e-25, 0.01301978164264235, 0.01230963041592468, 0.006082149814645274, 0.004609206068723903, 0.005690720864452849, 0.004409530998278059, 0.004942800362729656, 0.003870211446676211, 0.002729627740826987, 0.002618179719265247, 0.00249286437489904, 0.001803173610082009, 0.001562119682314022, 0.001420537607932159, 0.001416113371117522, 0.0002874183896156025, 1.221447757663337e-06, 1.186918570478252e-10, 1.223157032562512e-16, 2.989430484840382e-25, 0.008520191895370928, 0.01384211529508199, 0.007580428972525712, 0.007541528915792029, 0.005507476847014951, 0.005099260546300097, 0.003622284283567229, 0.003424945778285522, 0.002704961326268175, 0.00247653779652434, 0.002994465350194291, 0.002730355327504882, 0.002376845124999398, 0.001829739245677491, 0.001515034820768624, 0.000298141709373643, 1.003029991615393e-06, 1.011032426985871e-10, 1.395088337460282e-16, 6.389328304079741e-26, 0.06170349669471643, 0.02780251185230629, 0.007402142742453792, 0.004743731199943333, 0.00444236483771847, 0.0074052317038719, 0.003920460092879385, 0.003965575169434256, 0.003144739798851464, 0.001942508890649031, 0.00266362738951865, 0.002812463193439196, 0.001876709270001707, 0.0009372213662594358, 0.001259745221584851, 0.0002951260693781995, 8.430377435500046e-07, 6.494144793537263e-11, 9.499719138263979e-17, 1.16876801326321e-25, 0.0006030895066376917, 0.000342435546381729, 0.000310373953620808, 0.0002719828120583256, 0.0002206307762200979, 0.0002308064955781075, 0.0001679735186499441, 0.0001780880597297359, 0.0001461644163263112, 0.0001310321124024956, 0.000136153430057964, 0.0001609945996189606, 0.0001057579514117204, 0.000112380145804763, 7.620711003533083e-05, 2.01242313727299e-05, 1.547382713989432e-07, 1.413315264834391e-11, 1.154481854805498e-17, 4.943970118200189e-27, 5.699859565842185e-06, 5.879472029142525e-06, 5.17058583632845e-06, 3.077866636204762e-06, 3.869744230293572e-06, 3.359903547117682e-06, 2.96520050552592e-06, 3.438204834364125e-06, 2.320768580382398e-06, 2.555977935097653e-06, 2.019961006947614e-06, 2.427794392118336e-06, 1.277697344694091e-06, 1.296553019071226e-06, 1.298489816772605e-06, 3.091217807259002e-07, 2.77387390375823e-09, 3.31946059339568e-13, 4.569282555664945e-19, 3.524479900239917e-36, 2.609992102085271e-08, 1.917635572810366e-08, 1.758512956459797e-08, 1.624666471525908e-08, 2.403120411488597e-08, 1.409361294677604e-08, 1.409223363119115e-08, 1.463177665240498e-08, 1.621134906527118e-08, 1.186077314477537e-08, 1.486682207763089e-08, 1.10157239191201e-08, 9.611473682547728e-09, 7.124459431153367e-09, 7.032750288670703e-09, 1.156140367767214e-09, 1.315974189415057e-11, 2.487612553238609e-15, 1.800014257181438e-21, 8.734808525292473e-41, 1.78877587732998e-11, 1.571257718782261e-11, 1.443611159952519e-11, 1.234540270052144e-11, 1.353714685616934e-11, 1.2931839326247e-11, 8.756760088284613e-12, 1.212371630372318e-11, 8.427691687693545e-12, 8.120850944843017e-12, 9.749114238094492e-12, 6.558554800958133e-12, 6.793820948571523e-12, 5.407823417102115e-12, 4.256785651973316e-12, 1.032240052601783e-12, 1.173832075653638e-14, 1.907230615492413e-18, 8.182511090622342e-26, 2.02702400096224e-44]
+      ],
+     "30":[
+      [0, 1.402279452642656e-11, 8.310412352163838e-11, 2.755851273785756e-10, 4.823092850956182e-10, 8.42243309301903e-10, 2.268650967348607e-09, 1.664369218752818e-09, 2.837230771395017e-09, 4.180204971043969e-09, 4.140582047960902e-09, 6.231927822158188e-09, 7.291851990047058e-09, 9.306861621380126e-09, 1.537837197897649e-08, 5.834895843399805e-08, 2.376606550428589e-08, 4.890997446274965e-10, 1.358231043417816e-13, 5.970750726381676e-20, 0.000688424818473382, 0.0006972461785558037, 0.0005650535320969454, 0.0005487558288328058, 0.00043929932788616, 0.0004256781609808861, 0.0003083487862340318, 0.0003363141999584596, 0.0002689846983795992, 0.0003287150473366103, 0.0003018507301769136, 0.0002597645530424499, 0.0002304910614787394, 0.0002145403599260401, 0.0001481627144598947, 5.238358166199949e-05, 1.558866139919943e-06, 2.627898476214836e-09, 2.326952399169836e-13, 2.46574801805689e-27, 0.001704679599306355, 0.001557747148912843, 0.00122159765133029, 0.001394129168742041, 0.001093677707461869, 0.0007772958967171689, 0.0008215893332453832, 0.0006420480719947489, 0.0006064473504217506, 0.0005385468023996029, 0.0005243062296646322, 0.000412518307720616, 0.0004227046383278898, 0.0004411574876163742, 0.0003664811312712449, 7.200689940979913e-05, 2.777635583825083e-06, 3.910507677425207e-09, 3.079816395294984e-13, 5.040885156612102e-27, 0.002889337154927609, 0.002477297511225666, 0.002065453457775857, 0.001418657523334951, 0.001669750124933851, 0.001383148267862234, 0.001190442631120462, 0.001030303029276153, 0.001089791906267385, 0.001107442633168515, 0.000781499199833555, 0.0006040982502592704, 0.0007304378775989383, 0.0006046268288878594, 0.0005270454533108334, 0.0001532767526018477, 4.902977064354623e-06, 5.240530399554248e-09, 3.940564297948992e-13, 1.520127981667108e-20, 0.003547174071158919, 0.00245428485189525, 0.002619391497522293, 0.002555073430703141, 0.001425874671541295, 0.001740570041535745, 0.001563044475906157, 0.001487155228164511, 0.001266632134822107, 0.001164080857722068, 0.0009219925405832493, 0.0008964098049106516, 0.001264644145985056, 0.001045796147290842, 0.0007971680407026097, 0.0001789992071219195, 4.534233760463565e-06, 7.477969768344123e-09, 6.62018248683263e-13, 1.769472446307479e-19, 0.00473558498726363, 0.004525830045090888, 0.0037977332973923, 0.002629470788629464, 0.002588584838746926, 0.001902854972154096, 0.001999972327690437, 0.001994457695169411, 0.001572883258951641, 0.001807020598917219, 0.001504845838305898, 0.0015017247405165, 0.001103621950055858, 0.001184179566201482, 0.001024049276682841, 0.000258910599353367, 6.392468002298632e-06, 1.024155164254237e-08, 5.032442430982661e-13, 1.426105303769087e-26, 0.005751902189122741, 0.004643784953703921, 0.003312288356855389, 0.003254652436637498, 0.003746397151588826, 0.003165749716681826, 0.002225737962086895, 0.002524907469312499, 0.002002643508999701, 0.001773562024187471, 0.001511281663676414, 0.001332040732986992, 0.00127412186434074, 0.001263274791078971, 0.0009006028325236118, 0.0002628351965649732, 6.128946839995551e-06, 1.086683498531905e-08, 6.161460039718538e-13, 1.497550624212706e-19, 0.007233350109436664, 0.004046761111273645, 0.004129493761158133, 0.003621979565132034, 0.003922124818027183, 0.003249405333421248, 0.002309183610949059, 0.002677750114797744, 0.001968504211852714, 0.002031781309434814, 0.001485927723694635, 0.001864168664825565, 0.001290421844292344, 0.001529268859192099, 0.001175306880970018, 0.0003576646927943638, 6.883850513589868e-06, 1.494911410963818e-08, 5.988653402652118e-13, 4.629507164235441e-19, 0.007610166939473792, 0.006961716243966483, 0.005145792641445455, 0.004753986051677181, 0.003430460974550617, 0.003738362905496936, 0.004015769207103317, 0.003012762335857113, 0.004440202520130288, 0.002167029511767998, 0.001492968654648091, 0.001810550934916585, 0.001812151050637494, 0.001337770296422432, 0.001147654057350262, 0.0004525289495814965, 7.808389944420785e-06, 1.130424177655564e-08, 5.761485142016475e-13, 5.002788720421914e-19, 0.006549386806889652, 0.008492497306779468, 0.005161551809354132, 0.005112268910756203, 0.004552309368328649, 0.003712848164022702, 0.003132142946520781, 0.003686293107129074, 0.002412104506855553, 0.002644279103581005, 0.001848483486999701, 0.002177872702006396, 0.002157589174063865, 0.001613752801578585, 0.001930042441089695, 0.0004809483924159774, 9.891812858860729e-06, 1.436851144039723e-08, 7.540182199820265e-13, 1.732172003511468e-19, 0.009507889819072647, 0.00511850695776405, 0.006296915620325602, 0.006089260916344508, 0.005022812924596503, 0.0041056958680267, 0.003638753068337131, 0.002905371453590923, 0.003130858695808069, 0.002644521180193146, 0.002560735422729199, 0.002545885739370216, 0.002478885029814046, 0.001589402076599264, 0.001553369332992677, 0.0003549787241919788, 9.112850611645558e-06, 1.576114680889061e-08, 6.888667675702833e-13, 3.097041808636333e-26, 0.009778437471412382, 0.008643177720857681, 0.006661546414331762, 0.004933873269071581, 0.005525092404144505, 0.003920075800483331, 0.004345848856328269, 0.003306741635179437, 0.003681523260400009, 0.003248414139181395, 0.00336880268691292, 0.002036530048363503, 0.002509409844878421, 0.002266880276304586, 0.001965359794511174, 0.0004394143375072392, 1.021263585614266e-05, 1.513506095155052e-08, 1.091358262220394e-12, 2.585326832895457e-19, 0.01203526118342153, 0.01244790694374113, 0.008859235976739445, 0.00553192297145581, 0.004617329275740794, 0.004230555097537714, 0.00360621405031217, 0.003213524286534278, 0.004206040013810675, 0.004785766681692718, 0.003468393661000641, 0.003597495537971989, 0.002623740904630473, 0.001766005937090618, 0.002654590871786358, 0.0005515551409509414, 1.111170249422118e-05, 1.50039727695494e-08, 9.495860622276519e-13, 2.659952346150274e-19, 0.01587182371811793, 0.01534166093417483, 0.007749714011655339, 0.006004168128523136, 0.007578602379824243, 0.006003524931059379, 0.006879803442673876, 0.005507108820240384, 0.003970775699741262, 0.003893599852833106, 0.003789897000036984, 0.002802464731660452, 0.002481919771677759, 0.002358623962309413, 0.002521510668225656, 0.0008331419056518486, 1.306227034220874e-05, 1.502060886615277e-08, 7.520588573742864e-13, 4.140729202138729e-19, 0.0119436485814643, 0.01983782994486752, 0.01110673744553774, 0.01129666127241215, 0.008434091936192647, 0.007983342445778504, 0.005797609412418398, 0.005604100930531875, 0.004524765687256327, 0.00423506168749216, 0.005234928780808489, 0.004879601092625729, 0.004342468311905294, 0.003493470662902939, 0.00310203442948486, 0.0009937561158905512, 1.233142427647723e-05, 1.467832429812239e-08, 9.71359083790604e-13, 9.564980093421178e-20, 0.1262303261159798, 0.05814881059186595, 0.01582756484611126, 0.01036987525443791, 0.009927993061884448, 0.01691907603082379, 0.009157200856907563, 0.009469271407495665, 0.007676738211396869, 0.004847676426920708, 0.00679547208371161, 0.007335091163736211, 0.00500362931989023, 0.002611319951547196, 0.003764028608747561, 0.001435414615285099, 1.51148051212606e-05, 1.367916696572162e-08, 9.287864412804079e-13, 2.151724696312101e-19, 0.0009220612795743234, 0.0005352502125557178, 0.0004959755563615687, 0.0004443349344292458, 0.0003684903202088842, 0.0003940905334294194, 0.0002932066197085854, 0.0003177969449273407, 0.0002666462759270982, 0.0002443698049803877, 0.0002595800439383441, 0.0003137790304907475, 0.0002107135713557633, 0.0002339880767732638, 0.0001701547026453153, 7.313335371356074e-05, 2.072160338986333e-06, 2.219128951827382e-09, 8.300428873815378e-14, 6.259101060599442e-21, 1.824283868443568e-06, 1.923811017643838e-06, 1.729643921512276e-06, 1.052583792900521e-06, 1.352932475607673e-06, 1.200894065797556e-06, 1.08346036403203e-06, 1.284306932821202e-06, 8.862251579463058e-07, 9.977954854240203e-07, 8.061143479190997e-07, 9.904483491630266e-07, 5.328576606191986e-07, 5.650555780127876e-07, 6.068384456931891e-07, 2.350993231553141e-07, 7.772867921725552e-09, 1.091024682146733e-11, 6.874606279670792e-16, 9.209092047681646e-31, 3.648819193162212e-10, 2.740766087494597e-10, 2.569456990326557e-10, 2.426872843862784e-10, 3.669800843168185e-10, 2.20024274101881e-10, 2.249088339438914e-10, 2.387257643407325e-10, 2.703921386867497e-10, 2.022356425026808e-10, 2.591371978925671e-10, 1.962857121516963e-10, 1.750760622384596e-10, 1.356133119774201e-10, 1.435501036149621e-10, 3.840246651656419e-11, 1.611089937659347e-12, 3.580631745575276e-15, 1.194794920608184e-19, 1.019507286767879e-36, 1.895738540258186e-15, 1.702414338082524e-15, 1.599044895952956e-15, 1.39799466980081e-15, 1.567164066731879e-15, 1.530495069150474e-15, 1.059489440519749e-15, 1.499573395691603e-15, 1.065654963823975e-15, 1.049742430092892e-15, 1.2882994942109e-15, 8.85987338687549e-16, 9.382063483127196e-16, 7.804197162658562e-16, 6.587623212626855e-16, 2.60028604680638e-16, 1.091351332589435e-17, 2.095362024499525e-20, 4.2047223457349e-26, 1.886680254924297e-42]
+      ],
+     "31":[
+      [0, 1.314285567877707e-52, 3.828317628946084e-49, 4.68520063710585e-47, 1.048377778464421e-45, 1.309472716944579e-44, 1.747188723313048e-43, 4.927542805237163e-43, 2.68222907630008e-42, 1.095140655489685e-41, 2.688159434902216e-41, 9.159242857830552e-41, 2.251577493339928e-40, 1.060765957187799e-39, 9.699746400405889e-39, 2.634512744216031e-35, 4.104252813732407e-33, 9.818624593110899e-34, 7.241535400051096e-38, 2.924869144070644e-46, 8.872044857485624e-07, 8.612123887779366e-07, 6.689244434872809e-07, 6.226390471469146e-07, 4.777424434996305e-07, 4.437077797281174e-07, 3.080679838152104e-07, 3.220656432877416e-07, 2.46903825897083e-07, 2.892191318073133e-07, 2.545733568625478e-07, 2.100003152762599e-07, 1.786156468659148e-07, 1.527717310871494e-07, 9.225566826087e-08, 1.279506285976839e-08, 3.078673910889787e-11, 4.067706584035776e-16, 1.31781780136719e-23, 2.416301715919739e-42, 8.866784291273074e-06, 7.765641171848754e-06, 5.836761817415015e-06, 6.384349576894636e-06, 4.800420524850217e-06, 3.270084503282176e-06, 3.312961949053981e-06, 2.481559069312601e-06, 2.246735415203832e-06, 1.91245119009307e-06, 1.784704466481096e-06, 1.346000404179714e-06, 1.322104896325517e-06, 1.267929648361555e-06, 9.210482207648488e-07, 7.102544398871499e-08, 2.233134255966871e-10, 2.6446164862811e-15, 9.768274539274402e-23, 3.529768782787843e-41, 3.41192566753035e-05, 2.803732243229072e-05, 2.240460414856357e-05, 1.474923073327333e-05, 1.663871068331979e-05, 1.321051451246336e-05, 1.089804742215999e-05, 9.040674484360126e-06, 9.166033976263058e-06, 8.92827454788681e-06, 6.039341984400597e-06, 4.47496674760579e-06, 5.186722607926139e-06, 3.945219441216671e-06, 3.007213192955917e-06, 3.433004296945579e-07, 8.974924314250473e-10, 8.273736745474349e-15, 3.258644743694111e-22, 3.254279306427703e-34, 7.513737498065843e-05, 4.982594804707633e-05, 5.096764523076935e-05, 4.765050975299147e-05, 2.548719136019335e-05, 2.982050769989387e-05, 2.566753749149318e-05, 2.340803408005252e-05, 1.911002841943542e-05, 1.683459163424351e-05, 1.278091248546009e-05, 1.191139065942336e-05, 1.6108385664035e-05, 1.224067854424106e-05, 8.159102546798917e-06, 7.192212806640873e-07, 1.491000012983659e-09, 2.148207205944632e-14, 1.060773702638154e-21, 8.221345472780175e-33, 0.0001581470693881638, 0.0001448581374557544, 0.0001165018246704488, 7.731196065386016e-05, 7.294865168337078e-05, 5.139768251988776e-05, 5.177871458290446e-05, 4.949347876444708e-05, 3.741294997515048e-05, 4.120000909990967e-05, 3.288829767060122e-05, 3.14601882600107e-05, 2.216252960529281e-05, 2.185203240482938e-05, 1.652457316158077e-05, 1.640215104917734e-06, 3.316936619140689e-09, 4.678810986596901e-14, 1.335577331433934e-21, 1.195253179969912e-39, 0.0002790967206771238, 0.0002159596122770541, 0.000147635990886773, 0.0001390397102248009, 0.0001533997475882872, 0.0001242425795242317, 8.372543725449315e-05, 9.103844243593919e-05, 6.921263901943329e-05, 5.875394038063738e-05, 4.799006395140954e-05, 4.054573324877103e-05, 3.717635405830452e-05, 3.387109991459282e-05, 2.111546587194381e-05, 2.419401642431943e-06, 4.623448323001552e-09, 7.255362179721074e-14, 2.458828239284851e-21, 2.017686046814908e-32, 0.0004820241633673561, 0.0002584604784465599, 0.0002527825630067123, 0.000212503694204651, 0.0002205558362930608, 0.0001751395184907938, 0.0001192966665401931, 0.0001325976805150097, 9.343395320008927e-05, 9.243879740155356e-05, 6.480229905498652e-05, 7.792912227621012e-05, 5.171000601827047e-05, 5.631222203516736e-05, 3.784483222108032e-05, 4.521680588850863e-06, 7.134802462865841e-09, 1.376502963553798e-13, 3.366110860649274e-21, 9.271048400094449e-32, 0.0006683426413289553, 0.0005859743593064746, 0.0004151244901937863, 0.0003675819898077603, 0.000254229251944601, 0.0002655447239163927, 0.0002734101356055628, 0.0001966105640357456, 0.0002777456896955144, 0.0001299326838145365, 8.580641690105099e-05, 9.974744429396717e-05, 9.570041807631914e-05, 6.491980011855562e-05, 4.870164132591417e-05, 7.539739293250669e-06, 1.066908645283446e-08, 1.37610356673198e-13, 4.351367623138025e-21, 1.407180439927926e-31, 0.0007345167612151512, 0.0009128382950982216, 0.0005317439515313539, 0.0005047847921470463, 0.0004308252162655019, 0.0003367904580394296, 0.0002723227192699431, 0.0003072050451627214, 0.0001926802696893576, 0.0002024685303382861, 0.000135669239417823, 0.0001532217254951337, 0.0001455074126139541, 0.0001000068562858246, 0.0001045916516240072, 1.023323975309568e-05, 1.726423874025842e-08, 2.239186379519693e-13, 7.384716776442137e-21, 6.557516392043253e-32, 0.001328282645579592, 0.0006853415694143442, 0.0008080821999389418, 0.000748966876469006, 0.0005921365418979325, 0.000463921968605214, 0.0003940946339853497, 0.0003016100762265036, 0.0003115375235600335, 0.0002522337118417564, 0.0002341188841925102, 0.0002231170555341727, 0.0002082470418559465, 0.0001226966851772595, 0.0001048604087443408, 9.408699736859551e-06, 1.981617850126959e-08, 3.065728852891693e-13, 8.509465652624735e-21, 1.526377435415643e-38, 0.001667826109811264, 0.001412902593426768, 0.001043705045334489, 0.0007409026227142785, 0.0007952241809014003, 0.0005407890118207308, 0.0005746426375068382, 0.0004191020646931444, 0.0004472495031603746, 0.0003782709280943427, 0.0003760303303360322, 0.000217901553413785, 0.0002573770259565166, 0.000213650316915443, 0.0001619776613763193, 1.421945112460549e-05, 2.711765147606188e-08, 3.600092437150771e-13, 1.662988937100271e-20, 1.615256085818786e-31, 0.002464919805717947, 0.002443436948835733, 0.001666729317022511, 0.000997505737554088, 0.0007980076806536926, 0.0007008046921108085, 0.0005725864170685464, 0.0004890660284310747, 0.000613567229622177, 0.0006691902425121477, 0.0004648814967027934, 0.0004622068920134723, 0.0003231363784416184, 0.0001998637404129972, 0.0002627107560823195, 2.143231990459157e-05, 3.543423215858177e-08, 4.291359114727538e-13, 1.752646058361823e-20, 2.061431291122719e-31, 0.004504464784153517, 0.004172980777369905, 0.00202033687961554, 0.001500242780718404, 0.001814992699411767, 0.001378083759901216, 0.001513684415641937, 0.001161393679689861, 0.0008026646299154367, 0.0007544310218820683, 0.0007039009654286609, 0.0004989381642646873, 0.0004235680629664116, 0.0003698890105628388, 0.0003457900509102706, 4.486194799777735e-05, 5.773380605511229e-08, 5.966003091830292e-13, 1.950215851910909e-20, 4.690100073189038e-31, 0.005249027863346281, 0.008355911644184973, 0.004483843736016307, 0.00437104051148081, 0.003127881515482194, 0.002837791199786393, 0.001975308024920464, 0.001830157646176913, 0.001416386593985643, 0.001270735315620888, 0.001505643902633052, 0.001345297804645538, 0.00114762469081497, 0.0008483948573229706, 0.0006587600931132043, 8.286619001470802e-05, 8.442405001076898e-08, 9.050058158801303e-13, 3.961964627681994e-20, 1.786249706872514e-31, 0.3561284635479497, 0.1572326953462865, 0.04101867609231762, 0.02575805459976318, 0.02363629824718115, 0.03860820315246861, 0.02002890123818155, 0.01985221067647523, 0.01542671513764451, 0.009337729032747554, 0.01254713841333801, 0.01298238508148211, 0.008489156110564741, 0.004071175717594829, 0.005131647541583, 0.0007684905678974856, 6.648432942331349e-07, 5.449040194346694e-12, 2.532424635689892e-19, 3.076873798333361e-30, 0.02844944321919704, 0.01582826166488365, 0.01405741613084461, 0.01207065994926398, 0.009594634699174964, 0.009835278193142102, 0.007013893827229675, 0.007286792348959529, 0.005860436312747749, 0.005148209595298658, 0.005242044813601896, 0.00607408128885016, 0.003910055797927479, 0.003989984837938236, 0.002537326227271455, 0.0004283349543018493, 9.977966877086987e-07, 9.70877346073835e-12, 2.529468851708903e-19, 1.079260163698907e-30, 0.0007447650860237419, 0.0007527630331563283, 0.0006486762946485085, 0.0003783640918755509, 0.0004661414679772243, 0.000396589465949889, 0.0003429658204354563, 0.0003896856918540063, 0.0002577531703642083, 0.0002781776770213916, 0.0002154292597897513, 0.0002537310797556987, 0.0001308559126691161, 0.000127518571386845, 0.0001197652746022994, 1.823013016404584e-05, 4.960003188314639e-08, 6.341134817664201e-13, 2.806113220538515e-20, 2.194480970129222e-39, 2.781672120672063e-06, 2.00265255284585e-06, 1.799539922901282e-06, 1.629146393007648e-06, 2.361320863631171e-06, 1.35702857294952e-06, 1.329649787162425e-06, 1.3528476231513e-06, 1.46882132269208e-06, 1.05308738292893e-06, 1.293524805584829e-06, 9.392441056689036e-07, 8.030967089826378e-07, 5.716964351843432e-07, 5.292697066922929e-07, 5.566159300970694e-08, 1.924573099123642e-10, 3.907998751987314e-15, 9.217904626895796e-23, 4.667530154754421e-44, 4.535061363805683e-10, 3.903604793975186e-10, 3.51449985940055e-10, 2.945215951595975e-10, 3.164763863782759e-10, 2.962650792326425e-10, 1.965953839926247e-10, 2.66734406978702e-10, 1.817059025515672e-10, 1.715863627127997e-10, 2.018696059371981e-10, 1.330890086184161e-10, 1.351077042946445e-10, 1.032912745474677e-10, 7.62648894341425e-11, 1.184379040329676e-11, 4.105876017804337e-14, 7.233767770498227e-19, 1.03376132881028e-27, 2.787410205915229e-48]
+      ],
+     "32":[
+      [0, 3.167796053376087e-24, 1.464441445029717e-22, 1.598152431980944e-21, 6.464662684014419e-21, 2.14996739507005e-20, 9.7578054431619e-20, 1.108468493381859e-19, 2.750397306783479e-19, 5.626127732563338e-19, 7.454215898453417e-19, 1.456128006246901e-18, 2.156957584140123e-18, 4.156966703901251e-18, 1.170981251784519e-17, 3.07163581073343e-16, 4.529162057328191e-16, 5.545094243605528e-18, 1.165760341502566e-22, 5.39004524379437e-31, 4.622628376447986e-07, 4.561895441984243e-07, 3.602358242373425e-07, 3.408991609146119e-07, 2.659304835871769e-07, 2.511082783081982e-07, 1.772577436432449e-07, 1.88409452009505e-07, 1.468556700886265e-07, 1.749039040786481e-07, 1.565308683355671e-07, 1.312884511191779e-07, 1.13540442897521e-07, 1.004009924524326e-07, 6.392887562157726e-08, 1.288852037987525e-08, 8.79253796583413e-11, 9.592938636604706e-15, 1.040283902983006e-20, 2.451195495559624e-37, 4.675292808296091e-06, 4.162821640970836e-06, 3.180908934656873e-06, 3.537249319198335e-06, 2.703952214600713e-06, 1.872623144293809e-06, 1.928770293468445e-06, 1.468798748675264e-06, 1.351961079936113e-06, 1.169979264863244e-06, 1.110019548231279e-06, 8.511125258513945e-07, 8.499358414633997e-07, 8.425101648264264e-07, 6.450197599550265e-07, 7.188636857230325e-08, 6.1720518781262e-10, 5.230340827631153e-14, 4.762118462776622e-20, 1.494578431479251e-36, 1.820617907903343e-05, 1.520978013823941e-05, 1.235635736222602e-05, 8.269685109042069e-06, 9.484300897576193e-06, 7.65545605768697e-06, 6.420448121991148e-06, 5.41480002304623e-06, 5.581200478214152e-06, 5.526852756904139e-06, 3.800701875887373e-06, 2.863040193598585e-06, 3.373601094791277e-06, 2.652142707830984e-06, 2.130268871027514e-06, 3.507884384377359e-07, 2.472490078935392e-09, 1.548053704144952e-13, 1.320266564556105e-19, 9.406854922388269e-30, 4.057429669316592e-05, 2.735378165889824e-05, 2.844606276179016e-05, 2.703708715228664e-05, 1.470205520704322e-05, 1.748774393085296e-05, 1.530257800435966e-05, 1.418750225073035e-05, 1.17750266906779e-05, 1.054536646142503e-05, 8.13913837237685e-06, 7.711439848685004e-06, 1.060181975089715e-05, 8.326098216531135e-06, 5.847763495009744e-06, 7.428299342697123e-07, 4.125152043579788e-09, 3.928826634583555e-13, 3.908248463210851e-19, 1.91403408285511e-28, 8.642333458019509e-05, 8.047841154670261e-05, 6.580129195074849e-05, 4.439275924439659e-05, 4.258386181777388e-05, 3.050227249247733e-05, 3.123916153743266e-05, 3.035666713422024e-05, 2.332838228496049e-05, 2.611650758338388e-05, 2.119399642549083e-05, 2.061033289015759e-05, 1.476025285141455e-05, 1.504054293603545e-05, 1.198376896030363e-05, 1.713130385177904e-06, 9.244340092462844e-09, 8.478128908082293e-13, 4.655335511406704e-19, 2.422552057260557e-35, 0.0001543471618118371, 0.0001214179660576427, 8.43854278288558e-05, 8.079363790282896e-05, 9.062006027608494e-05, 7.461563645634741e-05, 5.111811041543706e-05, 5.650650634838183e-05, 4.36730584835955e-05, 3.76892977343447e-05, 3.129561649843011e-05, 2.687984512699171e-05, 2.5055097864198e-05, 2.359113641919915e-05, 1.549524600892492e-05, 2.556014873408191e-06, 1.299997968527988e-08, 1.311590871066875e-12, 8.280167549186845e-19, 3.717814521751942e-28, 0.0002697651982349755, 0.0001470542789998784, 0.0001462160855799542, 0.0001249617643510774, 0.0001318529792356428, 0.0001064423307540811, 7.370814232894547e-05, 8.328717223909032e-05, 5.966230738058104e-05, 6.000685080840918e-05, 4.276478423223043e-05, 5.228090200573689e-05, 3.526658304954455e-05, 3.968960203834416e-05, 2.810279006591935e-05, 4.832586440751064e-06, 2.025700718466508e-08, 2.492448119400275e-12, 1.108872915433934e-18, 1.595159666657446e-27, 0.0003785198283547519, 0.0003373917201986393, 0.0002429956343397421, 0.0002187442325155723, 0.0001538041798204832, 0.0001633196673113641, 0.0001709509697643765, 0.0001249734941253763, 0.0001794776813704683, 8.535550641593242e-05, 5.730346246339066e-05, 6.771872715676318e-05, 6.604876544798041e-05, 4.630305008447289e-05, 3.659634328109416e-05, 8.152610854117701e-06, 3.060371188997008e-08, 2.502096063406027e-12, 1.413525848277082e-18, 2.301292754036044e-27, 0.0004209811781880388, 0.0005318891281050975, 0.0003149879695489954, 0.000303990259179151, 0.0002637632991243405, 0.0002096190381226281, 0.0001723099513141581, 0.0001976096786163782, 0.0001259993600582279, 0.0001345977160969895, 9.168714629623838e-05, 0.0001052669783412606, 0.0001016247532818227, 7.218098715607927e-05, 7.953278710304969e-05, 1.119536045871226e-05, 5.00501891237996e-08, 4.095258194465715e-12, 2.378533909043413e-18, 1.032027234947865e-27, 0.0007704103784179839, 0.0004041149853575234, 0.0004844148389546249, 0.0004564427232828381, 0.0003668639840982261, 0.0002922035244637492, 0.0002523458025461218, 0.0001963334132035751, 0.0002061623200633765, 0.0001696877029388886, 0.0001601141611911665, 0.000155120742684702, 0.0001471829484162117, 8.961646766524985e-05, 8.068972788554613e-05, 1.041491136866362e-05, 5.807644237858421e-08, 5.646502578560444e-12, 2.728131189414713e-18, 2.332690501258394e-34, 0.0009789312762798169, 0.0008431015372134789, 0.0006331539996447663, 0.0004569348734873706, 0.0004985882476105301, 0.0003446968306117656, 0.000372359066218715, 0.0002760808104834951, 0.000299513430779411, 0.0002575236335427128, 0.00026024498517797, 0.0001533073089264533, 0.0001840827208514976, 0.0001579142136534386, 0.0001261307255801448, 1.592654606620257e-05, 8.035892353511503e-08, 6.683304893427215e-12, 5.322136825535906e-18, 2.413332635420992e-27, 0.001464108261538703, 0.001475494964359265, 0.001023211696428873, 0.0006225543574574133, 0.000506323429858368, 0.0004520376991257663, 0.0003754680776203066, 0.0003260253853230212, 0.0004158106764147017, 0.000461031135138024, 0.0003255874877464392, 0.0003290821040093008, 0.0002338803388696844, 0.0001494908880561205, 0.0002070158664082785, 2.429010333444741e-05, 1.061859184653239e-07, 8.035037850373626e-12, 5.61138480192694e-18, 3.026824815491826e-27, 0.002739989933034686, 0.002580585876608268, 0.001270162879832268, 0.000958867047116396, 0.001179316791910825, 0.0009103061839607299, 0.001016485109260137, 0.0007928599222586194, 0.0005570574413937462, 0.0005322697174289788, 0.0005048561657296332, 0.0003637845306276633, 0.0003139493743732639, 0.0002833206321572846, 0.0002790355780511098, 5.205936305936189e-05, 1.769805803465574e-07, 1.137932995148567e-11, 6.278658417832006e-18, 6.727773888901947e-27, 0.003315811636428032, 0.005366250432203101, 0.002927460980407253, 0.002901258659203936, 0.002110621239680805, 0.001946687587741568, 0.00137753892287457, 0.001297502475143288, 0.001020820913258835, 0.0009310399554585639, 0.001121446000717834, 0.001018626136125635, 0.0008833523234054111, 0.0006748382490601977, 0.000552031644457945, 9.984355574523802e-05, 2.684277279703694e-07, 1.782063105502281e-11, 1.297671828539259e-17, 2.521106663157385e-27, 0.2928953337436242, 0.1314663880719109, 0.03486717530230972, 0.02225915055754894, 0.02076502867932918, 0.03448159550980574, 0.01818514291470236, 0.01832387994922467, 0.014475318500551, 0.008907158404322492, 0.01216698494791499, 0.01279765129937086, 0.008506970725285433, 0.004215905898977091, 0.005598215312616812, 0.001204940120259823, 2.743456878877769e-06, 1.375894567316232e-10, 1.023428078265535e-16, 4.888448214192828e-26, 0.04764895452530479, 0.02695126494813145, 0.02433406998414952, 0.02124225295054367, 0.01716545429668258, 0.01788824722140657, 0.01296855513725388, 0.01369673476408789, 0.01119839619571323, 0.01000055955337425, 0.01035161205453666, 0.01219337718646086, 0.007979202455472234, 0.00841404674154103, 0.005636699016105771, 0.001367329942074719, 8.370117726659519e-06, 4.949652554270963e-10, 2.018632193899184e-16, 3.205770022197458e-26, 0.004876170643268785, 0.005010541034277663, 0.004389529814358397, 0.002602917518998604, 0.003260060261207451, 0.002819702794741632, 0.00247892933739436, 0.002863358882971027, 0.001925352387446009, 0.002112371228064143, 0.001662996278272817, 0.001991112228772697, 0.001043873248468114, 0.00105119459871334, 0.001040043660066234, 0.0002274538999671729, 1.624614937568658e-06, 1.256465301530948e-10, 8.575646605400117e-17, 2.409117554227478e-34, 0.0001615821838639395, 0.0001182661311418846, 0.0001080389300787851, 9.943508901113664e-05, 0.00014651837189318, 8.560129817526614e-05, 8.526674004280565e-05, 8.819400320627889e-05, 9.734276367548653e-05, 7.094803798112183e-05, 8.859082830652453e-05, 6.53923946097222e-05, 5.683922013206786e-05, 4.181180929672612e-05, 4.077718369353422e-05, 6.160478598832723e-06, 5.585704463786242e-08, 6.826790433381696e-12, 2.444450941693159e-18, 4.28678222755621e-38, 5.902171196287202e-07, 5.164910803046605e-07, 4.727433973366057e-07, 4.027547321283037e-07, 4.399699249442558e-07, 4.187134562680147e-07, 2.824627257261769e-07, 3.895963175700877e-07, 2.698046360927935e-07, 2.590027078754863e-07, 3.09763488873686e-07, 2.076040524120702e-07, 2.142420341771963e-07, 1.692543429952438e-07, 1.316448143668327e-07, 2.93642451709718e-08, 2.66593448848787e-10, 2.809728371852638e-14, 5.979588227733498e-22, 5.344798283218169e-41]
+      ],
+     "33":[
+      [0.008858203061948247, 0.006502807585406817, 0.00470789386429013, 0.004520810172383893, 0.00326213952247701, 0.00285048990262131, 0.004342535690687066, 0.001960762439545358, 0.002188449529242337, 0.002213231015174131, 0.001561943830520985, 0.0017262279827219, 0.001520548003583845, 0.001167446635009626, 0.0009714186227382522, 0.0001837932833613808, 1.182681720189424e-06, 1.774211017054725e-10, 1.264307365572302e-16, 4.568505361322986e-26, 0.005950934618055096, 0.005888725040061749, 0.004662667746696878, 0.004424222775251555, 0.003460465501902167, 0.003276231895703489, 0.00231877109106943, 0.002471076862866892, 0.001931065667269285, 0.002305793590008823, 0.00206884218016046, 0.001739611128889561, 0.001508225783366571, 0.001340323227913466, 0.0008600521202910158, 0.0001820627324503657, 1.354655266239914e-06, 1.485994519223265e-10, 1.237963162488261e-16, 1.682697692248403e-33, 0.007535308117677407, 0.00672762462037968, 0.005154692948300722, 0.005747655371914073, 0.004405481774295417, 0.003059214954676678, 0.003159375061954425, 0.002412347672024054, 0.002226355838006638, 0.001931777894304378, 0.001837613377385445, 0.001412702905518271, 0.00141444540073011, 0.001409402726661999, 0.001087896221938171, 0.0001280459132511872, 1.244948224431952e-06, 1.22404458844807e-10, 1.162723612763344e-16, 3.119060552195935e-33, 0.008708099299801278, 0.007294741551912414, 0.00594233384747157, 0.003987790869693546, 0.004585880561973725, 0.003711587426432168, 0.003121205582715558, 0.002639399056584539, 0.002727803306590142, 0.002708465499153739, 0.001867524863389904, 0.001410536712588804, 0.001666488136525005, 0.001317043248365897, 0.00106673912148714, 0.0001858723345303754, 1.502636671425239e-06, 1.150046473803498e-10, 1.164845840850993e-16, 8.63905220237497e-27, 0.008200222639287175, 0.00554338139646169, 0.005780430158134071, 0.005509045681843546, 0.003003798989611629, 0.003582620554369076, 0.00314342934997814, 0.002922233947975919, 0.002431860932877212, 0.002183756292569506, 0.001689991189393653, 0.001605472446694653, 0.00221313051294835, 0.001747351023774039, 0.001237605333612655, 0.0001665131154023149, 1.067442273358909e-06, 1.276806388510868e-10, 1.621330613868709e-16, 9.33294036104641e-26, 0.008956989485684833, 0.008363602393105619, 0.006856928325579499, 0.004638598721511049, 0.004461670055232295, 0.0032045024761962, 0.003290804304744891, 0.003206485739763567, 0.002470760481705056, 0.002773512856201382, 0.002256811358996947, 0.002200558848021176, 0.001580176555265562, 0.001618817053614156, 0.001300772305727879, 0.0001970687251214537, 1.232346790413408e-06, 1.443127461737913e-10, 1.059292329070547e-16, 7.041006419620399e-33, 0.009271981281534968, 0.00731374675719233, 0.005096898967081392, 0.00489323271262797, 0.005503281476947243, 0.004543645429016096, 0.003121225272988727, 0.003459577377088754, 0.002681087558256928, 0.002319993469898687, 0.001931621733367347, 0.001663541790449039, 0.001554783645167659, 0.001471811217347537, 0.0009749639426701243, 0.0001705067023796057, 1.00757266369056e-06, 1.312604894093553e-10, 1.143815707872063e-16, 6.970885831702454e-26, 0.01022130134217118, 0.005587031179555137, 0.00557032413269128, 0.004773567563571582, 0.0050505096905889, 0.004088252371438082, 0.002838674329906202, 0.003216279086510217, 0.002310201602001781, 0.002329826692006509, 0.001664871546251042, 0.002040835031023315, 0.001380375718903777, 0.001561870487749921, 0.00111535725721097, 0.0002034007816908017, 9.924521658643728e-07, 1.589499383128313e-10, 9.99398281764661e-17, 2.044141598154597e-25, 0.00962320982267139, 0.008601000383255959, 0.006211480317257892, 0.005606789070666712, 0.003952988746027051, 0.004208958331533659, 0.004417588660696295, 0.003238232665415841, 0.004663112389259481, 0.00222367408474202, 0.001496902373137228, 0.001773753567455514, 0.001734682284381639, 0.001222652115717856, 0.000974617863589867, 0.0002302990498939937, 1.00771087323164e-06, 1.07896256120984e-10, 8.771648185126511e-17, 2.106368932215226e-25, 0.007528760349365442, 0.009538172767576694, 0.005663961553770988, 0.005481093823612241, 0.004768723622063709, 0.003800123466838758, 0.003132243504323725, 0.003601890619667016, 0.002302855960394195, 0.002466670996602406, 0.001684829927038355, 0.001939602869608053, 0.001877552919384988, 0.001340776703736822, 0.001490008414024348, 0.0002225100432220654, 1.160793018155572e-06, 1.249784276134535e-10, 1.059623252028872e-16, 6.986152903476892e-26, 0.01005999203548448, 0.0052913170542839, 0.006360022558334838, 0.006009093515732707, 0.004842930967942545, 0.003867837712109789, 0.003349326909018459, 0.002612963817606046, 0.002751219639277261, 0.002270608167707501, 0.002148307714478011, 0.002086943059215419, 0.001985506282985949, 0.001215471712501336, 0.001103795380544908, 0.0001511649562324334, 9.844876880798367e-07, 1.264306761043697e-10, 9.021236985774833e-17, 1.201309314787366e-32, 0.009619156708929936, 0.008307072997776534, 0.006255470684011185, 0.004526750709166451, 0.004952848993838954, 0.003433446279500797, 0.003719066598923657, 0.002764944635981918, 0.003007764669609974, 0.002593111039069072, 0.002627616615164083, 0.001552091187364725, 0.001868707270626781, 0.001611738683599171, 0.001298408027318029, 0.0001739735014127215, 1.025933457894937e-06, 1.130576499098163e-10, 1.342433303632388e-16, 9.678746658159048e-26, 0.0110988962679286, 0.01121573420446696, 0.007798984413810302, 0.004758078644334679, 0.003880282524507242, 0.003473682851604152, 0.002893129771308025, 0.002518981037077783, 0.003221416674925016, 0.003581446807284679, 0.002536133651334076, 0.002570301516515235, 0.00183167363654624, 0.001177106702934443, 0.001644086391309431, 0.0002047198151956302, 1.046594724725597e-06, 1.052108138834772e-10, 1.104456341512824e-16, 9.641414949264353e-26, 0.01312171562269081, 0.01239205649468624, 0.00611599608259181, 0.004629650298050346, 0.005709546125604827, 0.004419154677654224, 0.004948033522146224, 0.003869967124951353, 0.002726398177768182, 0.002612154423344505, 0.002484344585256087, 0.001795001304240534, 0.001553301733447695, 0.00140936540637853, 0.001400005003437549, 0.0002772289365433177, 1.103192643868608e-06, 9.462289509050837e-11, 7.94927074670153e-17, 1.418489902283362e-25, 0.008642521607517282, 0.01402506915010165, 0.007671990333956129, 0.007624048369961406, 0.005561490025569788, 0.0051434933932098, 0.003649608469564334, 0.003446914126903324, 0.002719262293650824, 0.002486843950639667, 0.003003562367914332, 0.002735587273857171, 0.002378737860884693, 0.00182710813373107, 0.001507503573595012, 0.0002894348580226617, 9.117879465884341e-07, 8.112248364125855e-11, 9.125170701137391e-17, 3.051243463392983e-26, 0.06548300411225047, 0.02947231966173849, 0.00783789549080942, 0.005017346269939028, 0.004693323349962087, 0.007814791859865524, 0.004132649468141782, 0.004175521702410165, 0.003307520604097483, 0.002040771564295368, 0.002795237042688805, 0.002948126153157582, 0.001965036003393404, 0.0009791405540761221, 0.001311433438234646, 0.0002997526607222721, 8.017710703801721e-07, 5.451349899569871e-11, 6.499964706969194e-17, 5.837683084631026e-26, 0.0007235127372381959, 0.0004103503544444947, 0.0003715121867402552, 0.0003251931116588836, 0.0002634985988484141, 0.0002753422391696775, 0.000200160549022551, 0.0002119754525810801, 0.0001737823971895285, 0.0001556164413355984, 0.0001615177235247948, 0.0001907730474216259, 0.0001251794669821402, 0.0001327208394740326, 8.968211742644898e-05, 2.310584212328279e-05, 1.663570141026007e-07, 1.340975749988275e-11, 8.926410490273048e-18, 2.789350674543199e-27, 8.676354786206162e-06, 8.939711155666197e-06, 7.853028524517354e-06, 4.66938557439577e-06, 5.864148617773748e-06, 5.085838143557926e-06, 4.483354254696619e-06, 5.192712181717681e-06, 3.501128911251693e-06, 3.851654934989051e-06, 3.040517509049119e-06, 3.650319856296485e-06, 1.918941545984671e-06, 1.942916916870328e-06, 1.938940331061176e-06, 4.503536348170865e-07, 3.784017282276793e-09, 3.99597237496542e-13, 4.480632023322343e-19, 2.520236282925362e-36, 5.861917226409687e-08, 4.302095354760284e-08, 3.94069874158477e-08, 3.636686206138589e-08, 5.373179284539871e-08, 3.147694436307667e-08, 3.143871051792573e-08, 3.260594966818885e-08, 3.608561268780023e-08, 2.637201387594876e-08, 3.301900963756834e-08, 2.443851299640827e-08, 2.129942018131609e-08, 1.575297334432859e-08, 1.549536604691888e-08, 2.485482682027482e-09, 2.649305344443831e-11, 4.419183975307772e-15, 2.603622109575396e-21, 9.205415769449671e-41, 7.085188381648881e-11, 6.216699935577172e-11, 5.705319143340396e-11, 4.873628535530198e-11, 5.338164769599617e-11, 5.093813308347877e-11, 3.445436750750685e-11, 4.764912377520362e-11, 3.308615737326197e-11, 3.18462267899144e-11, 3.818920075997538e-11, 2.566272318645037e-11, 2.65538851969222e-11, 2.108996625147285e-11, 1.654289381592741e-11, 3.914717613237289e-12, 4.170070011690395e-14, 5.97999363869678e-18, 2.088025034303579e-25, 3.764372029484312e-44]
+      ],
+     "34":[
+      [0.009829313926254945, 0.007146286615225552, 0.005124000214112204, 0.004873070498376686, 0.003482522265073527, 0.003013816631609511, 0.004547237802820082, 0.002033467362079482, 0.002247800308469972, 0.002251427215347164, 0.001573647873431043, 0.001722472492112956, 0.001502682702733138, 0.001131705059507513, 0.0009133101780154473, 0.0001395865594603973, 5.063745254593415e-07, 2.559799193057283e-11, 3.319179054242035e-18, 1.162892210128761e-28, 0.006570037269565818, 0.006438814059770912, 0.005049193635252454, 0.004744915593742267, 0.003675623129912566, 0.003446490099331002, 0.002415834791247801, 0.002549785029098404, 0.001973437245277308, 0.002333762622394835, 0.002073836908951642, 0.00172707585302338, 0.001482991313900339, 0.001292739036559709, 0.0008045290911629345, 0.0001375752315569465, 5.770836598123385e-07, 2.133179164660656e-11, 3.233752852186857e-18, 4.262122484213153e-36, 0.008277317086336474, 0.007319009004022439, 0.005553877296056256, 0.006133214419856349, 0.004655815751433393, 0.003201977828186348, 0.003275038929297508, 0.002476641465428495, 0.002263741258603576, 0.0019453572850909, 0.001832767243869556, 0.001395455553836905, 0.001383771468677775, 0.001352515868923559, 0.001012535835343244, 9.627000446153184e-05, 5.276769800128764e-07, 1.748307077728539e-11, 3.022021430555516e-18, 7.861383378976889e-36, 0.009517408593601994, 0.007896001183613449, 0.006370261968887012, 0.004233860735085769, 0.004822051924006535, 0.003865225083853667, 0.003219173802907587, 0.00269609423638439, 0.002759637456126353, 0.002713765175923952, 0.001853217269948282, 0.001386297187177742, 0.001622135730166301, 0.001257517633505363, 0.0009878430573568814, 0.0001390422995311347, 6.336924889476332e-07, 1.634357545104664e-11, 3.012397645963199e-18, 2.166693343841254e-29, 0.008917201727655559, 0.00597007327081699, 0.00616549585448945, 0.005819533532239097, 0.003142589233191947, 0.003712132906751633, 0.003225769744419856, 0.002969973707242455, 0.002447852973688484, 0.00217701159521402, 0.001668599096661171, 0.001569937719935755, 0.002143382162542506, 0.001659976093740499, 0.001140301089229463, 0.000123933409037584, 4.478963656405275e-07, 1.805380653493516e-11, 4.171949872873943e-18, 2.329200418460425e-28, 0.00969110856506984, 0.008962036875274994, 0.007276891664428822, 0.004875364083894933, 0.004644325514879106, 0.003303632772279811, 0.003360006896713133, 0.003242465686942424, 0.002474489950838804, 0.002751029280839725, 0.002217028528275312, 0.002141021437357307, 0.001522673059069659, 0.001530128536502452, 0.001192469083326181, 0.0001459372846084709, 5.144882840656129e-07, 2.030305237542364e-11, 2.712113317524154e-18, 1.748561709096803e-35, 0.009981440621425669, 0.007797628748845424, 0.005381850287283598, 0.00511711772933525, 0.00569975537341713, 0.004660632703170286, 0.003170826792401949, 0.003480794775636258, 0.002671624028771224, 0.002289607766481092, 0.001888023542370478, 0.001610389929645578, 0.001490665903814747, 0.001384176789425353, 0.0008892906395244975, 0.0001256317636182368, 4.185324961060426e-07, 1.83740299607588e-11, 2.913891779959464e-18, 1.722633482324467e-28, 0.01094805574981858, 0.005926712464292404, 0.005852159879301279, 0.004966869402181784, 0.005204509778304345, 0.004172422449021587, 0.002869281163172501, 0.003219728343323811, 0.002290468693017558, 0.00228774745758428, 0.00161910939624094, 0.001965691561843278, 0.001316793913740979, 0.001461485878401639, 0.001012230281429216, 0.00014911485408977, 4.101790666196713e-07, 2.21383562480276e-11, 2.533274027231875e-18, 5.026612614764778e-28, 0.01025561547561304, 0.009078052629597128, 0.006492946070982417, 0.005804500503272307, 0.004053042587424966, 0.004274016286251454, 0.004442769514356676, 0.003225407020083909, 0.004600037134845257, 0.002172533976021847, 0.001448438029004791, 0.001699854452304619, 0.001646460921292672, 0.00113831772619807, 0.0008800567869235481, 0.0001679854112551981, 4.143924165313019e-07, 1.495225999184329e-11, 2.212339829966065e-18, 5.154175979364297e-28, 0.007983200770134381, 0.01001660894425472, 0.005890861130901204, 0.005645854453859689, 0.004864851077286686, 0.003839468093851781, 0.003134265893084325, 0.003569593896178353, 0.002260289376147989, 0.002397830534634695, 0.001622087691770765, 0.001849452128939121, 0.001773109246674206, 0.001242020833135635, 0.001338680358009496, 0.0001614882803988816, 4.74945122086253e-07, 1.723264043435563e-11, 2.659194023480853e-18, 1.701077439141951e-28, 0.01061362790092808, 0.005528813782636568, 0.006581574297656147, 0.006158629099474104, 0.004915733408167344, 0.003888250593900752, 0.003334651917312447, 0.00257652485975108, 0.002686799045612416, 0.002196150557510178, 0.002057914875147478, 0.001979946869970976, 0.001865637388304351, 0.001120288686399662, 0.0009867097567334449, 0.0001091579387276325, 4.007860224174377e-07, 1.734548246039617e-11, 2.252648348777621e-18, 2.910736370493218e-35, 0.01009756601325162, 0.008636339077172218, 0.006440871089874238, 0.004616099357838965, 0.005002056749957324, 0.003434232910084783, 0.003684176359866635, 0.002712694393520872, 0.002922585781404949, 0.002495482458959585, 0.00250441567581884, 0.001465121589779393, 0.001747071774640595, 0.001478063971528997, 0.001154849952599467, 0.0001249973940828873, 4.155621143193829e-07, 1.543305411506562e-11, 3.335413177424884e-18, 2.333619331212464e-28, 0.01159241207554037, 0.0116017548620334, 0.007989819813865488, 0.004827635873524844, 0.003899161258014836, 0.003457036592557989, 0.002851600583416838, 0.00245897240361457, 0.003114473531723155, 0.003429306033858067, 0.002405087516074865, 0.002414097706749967, 0.001703852145705424, 0.001074060584413052, 0.00145496772688645, 0.0001463498313219426, 4.218039223477964e-07, 1.428996464787017e-11, 2.730460750474856e-18, 2.31321160402998e-28, 0.01356799836827223, 0.01269025958029859, 0.00620293568596232, 0.004650313447240582, 0.005679898656477791, 0.004353957345964641, 0.004828192452089123, 0.003739962050091905, 0.002609505353480803, 0.002476154608366977, 0.00233239315449003, 0.001669039912125333, 0.001430443887866984, 0.001273115352261062, 0.001226562092534688, 0.0001962015351142692, 4.401661003456148e-07, 1.27235190152736e-11, 1.945710152363213e-18, 3.370006398113729e-28, 0.008794981225244863, 0.01413518239357387, 0.007657859870424564, 0.007536834430751092, 0.005445019775374991, 0.00498737997075328, 0.003504834577211826, 0.003278383081287353, 0.002561470352756166, 0.002320046963513885, 0.002775210430828339, 0.002503351752839455, 0.002155911572252321, 0.001624343143246299, 0.001299833484762805, 0.0002015972191888707, 3.580400535120196e-07, 1.073584066555583e-11, 2.19842964913127e-18, 7.13686351611369e-29, 0.05962692786442851, 0.0265784811563315, 0.007000326782851045, 0.004438098438969901, 0.004111576265951151, 0.006780337574106779, 0.003551154022612483, 0.003553527945441639, 0.002787793577138919, 0.001703579990298034, 0.002310988999383734, 0.002414000843359799, 0.001593584167133448, 0.0007788949440269111, 0.001011803702256378, 0.0001868189093402249, 2.817291726082732e-07, 6.45688230302678e-12, 1.402379563083793e-18, 1.224860643978308e-28, 0.0004894845078581977, 0.0002749475361164323, 0.0002465308927384258, 0.0002137193786541989, 0.0001715087080208688, 0.0001774953685927066, 0.0001277909243624656, 0.0001340341503071741, 0.0001088291081171196, 9.651730466848373e-05, 9.921591439309295e-05, 0.0001160621606010198, 7.542585537549192e-05, 7.844339751337741e-05, 5.140917337759717e-05, 1.069982753652611e-05, 4.343910076944699e-08, 1.180941807860918e-12, 1.434264135584775e-19, 4.378181726921404e-30, 3.353029524510833e-06, 3.421581462503154e-06, 2.976767608833039e-06, 1.752963570622075e-06, 2.180341690679519e-06, 1.872792254047301e-06, 1.635078652664671e-06, 1.875596490682094e-06, 1.252460034324661e-06, 1.364629673366342e-06, 1.066909693687993e-06, 1.268600386783624e-06, 6.604964451469965e-07, 6.55987823376825e-07, 6.349330221887376e-07, 1.191445905628801e-07, 5.646903491842891e-10, 2.013490351813821e-14, 4.132572116076861e-21, 2.289704094790844e-39, 9.440426393008637e-09, 6.861808658300766e-09, 6.225002356477889e-09, 5.68958906730595e-09, 8.325613838796546e-09, 4.830459383868951e-09, 4.778291139300424e-09, 4.908150041292062e-09, 5.379838461012256e-09, 3.893979902300187e-09, 4.828706357696251e-09, 3.539638898950032e-09, 3.055416929126113e-09, 2.216692966554837e-09, 2.114846986657404e-09, 2.741194449952578e-10, 1.64944008217153e-12, 9.310913387094232e-17, 1.009732181701235e-23, 3.561737779971237e-44, 3.389608417923523e-12, 2.945590793813123e-12, 2.677367288709383e-12, 2.265150483927195e-12, 2.457278377683838e-12, 2.322331880337305e-12, 1.555770549566177e-12, 2.130969906913603e-12, 1.465517450644085e-12, 1.397095342076081e-12, 1.659331521436447e-12, 1.104386279690992e-12, 1.131809001479228e-12, 8.818160316968181e-13, 6.709260703660815e-13, 1.2835664106563e-13, 7.730453462084307e-16, 3.766616667576479e-20, 2.442538745925169e-28, 4.47127131426589e-48]
+      ],
+     "35":[
+      [0, 3.33342221575457e-10, 1.932368933045085e-09, 6.268117808075903e-09, 1.073057716246901e-08, 1.83296131186391e-08, 4.829518887490042e-08, 3.465839935076306e-08, 5.779340967105127e-08, 8.329295158779867e-08, 8.07051553613343e-08, 1.188211350765192e-07, 1.360011928908223e-07, 1.661046883507708e-07, 2.559382998532504e-07, 5.962178333381293e-07, 6.544705337262657e-08, 1.109376460402673e-10, 6.026752059792964e-16, 1.208767436360894e-24, 0.0005950170158115554, 0.0005896481857718028, 0.0004675579330786863, 0.0004442938685905251, 0.0003480203524935698, 0.0003299797282732721, 0.0002338945159532212, 0.0002496354630057542, 0.000195382004480325, 0.0002336610686744364, 0.0002099828938922943, 0.0001768531708230682, 0.0001535839837509965, 0.0001369545031589066, 8.839137752119587e-05, 1.986966185197957e-05, 2.313719510806676e-07, 1.127022928844954e-10, 6.078510112749052e-16, 4.460348352110816e-32, 0.001490906260523224, 0.001333025473053121, 0.001022840699585764, 0.00114215805833476, 0.0008767214373723056, 0.0006096969662470093, 0.000630586684986246, 0.0004822003008271337, 0.0004456882346032967, 0.000387300884794261, 0.0003689831085215045, 0.0002840999817165124, 0.0002848932789495024, 0.0002847789221086012, 0.0002209666645136262, 2.724630477812075e-05, 3.533264984060192e-07, 1.087817267543047e-10, 5.871578744111841e-16, 8.281700525943143e-32, 0.002557050206930703, 0.002145127599024233, 0.001749961589078301, 0.001176070723556134, 0.001354425691477615, 0.001097806346294061, 0.0009245377945462342, 0.0007829728283409936, 0.0008103964759116797, 0.0008058507398895597, 0.0005564791318620241, 0.0004209426032817676, 0.0004980832639873175, 0.0003948568178098824, 0.0003214255371675335, 5.840610115902284e-05, 5.9265262456116e-07, 1.168626813794854e-10, 6.041096007023391e-16, 2.297392765276895e-25, 0.003176550350128766, 0.002150464018374878, 0.002245668774396241, 0.002143340480121477, 0.001170351634992575, 0.001397908679446895, 0.001228333477761812, 0.001143574849521902, 0.0009530773201850871, 0.000857109745667847, 0.0006642980393782924, 0.000632020807057531, 0.0008725485042059811, 0.0006910097644678146, 0.00049184329268498, 6.88525469495161e-05, 5.365359721932287e-07, 1.456609062712185e-10, 8.624065249485307e-16, 2.485437537077457e-24, 0.004291190928966767, 0.004012697878488145, 0.003294585181643148, 0.002231962943234856, 0.002149947877707438, 0.001546403832055716, 0.001590369243385727, 0.001551889769417831, 0.001197567905832644, 0.001346294859836716, 0.001097105975151609, 0.001071353264076988, 0.0007704687714232578, 0.0007916945142672535, 0.0006392585139399028, 0.0001006288061664164, 7.499220955507194e-07, 1.82230914386058e-10, 5.771829514723891e-16, 1.87748909249505e-31, 0.005274064148868504, 0.004166199708230079, 0.002907596838350198, 0.002795457812476581, 0.003148537255715157, 0.002603292264385304, 0.001790921527778081, 0.001987967210888646, 0.001542886171483998, 0.001337052874813607, 0.001114872638763384, 0.0009615699474303977, 0.0009000444810339037, 0.0008545730820411931, 0.0005688323113340211, 0.0001032684889419239, 7.175227397381506e-07, 1.813998287718794e-10, 6.376917222685331e-16, 1.860944266642923e-24, 0.006711226044177492, 0.003673703222271616, 0.003668017543515912, 0.00314791374317489, 0.00333537606336917, 0.002703823682168162, 0.001880133638807153, 0.002133344280504542, 0.001534592073959188, 0.001549902922236665, 0.001109178817743424, 0.001361667338370632, 0.000922370121315164, 0.001046768836467094, 0.0007511149421676099, 0.0001420989374984611, 8.073288715924192e-07, 2.381969994363426e-10, 5.69485325057549e-16, 5.462666976366022e-24, 0.007144696442811294, 0.00639499324663795, 0.004625025952329926, 0.004180825297750076, 0.002951909838695556, 0.00314762491826868, 0.003308458965180604, 0.002428746065653358, 0.003502556430368762, 0.001672697338970873, 0.001127661147546785, 0.001338195078131121, 0.001310657905158326, 0.0009265444101654922, 0.0007421221298820743, 0.0001818299261348821, 9.196212176957099e-07, 1.73987111785995e-10, 5.103590328907314e-16, 5.63408483560809e-24, 0.006221802329916458, 0.007893783580609621, 0.004694271951290926, 0.004549292616482837, 0.003963769475957867, 0.003163257895073942, 0.00261110459981375, 0.003006993415136374, 0.001925322224121055, 0.002065305021347575, 0.001412755932776751, 0.001628785535428238, 0.001579011688381465, 0.001130942430260796, 0.001262825915097227, 0.0001954656813444132, 1.171835218002402e-06, 2.154564931107775e-10, 6.289046574852797e-16, 1.870123226398164e-24, 0.009139542005958214, 0.00481413067756172, 0.005794829324495522, 0.005483017091559228, 0.004425358204121949, 0.003539475489552206, 0.003069444948231981, 0.002398107287661691, 0.002528685199241634, 0.002090005871757139, 0.001980337675064807, 0.0019266045662931, 0.001835669003755816, 0.001127084351843501, 0.001028407664592946, 0.0001459355928302256, 1.087158761318588e-06, 2.317264175920553e-10, 5.456956480430198e-16, 3.217950108344226e-31, 0.009511154453131157, 0.008225675138004124, 0.006203137553301213, 0.00449538203950703, 0.004925661463589855, 0.003419559209853016, 0.003709413911676853, 0.002761788637524802, 0.003008720298412759, 0.002597732704739253, 0.002636163069914813, 0.001559430716620123, 0.001880314418901626, 0.001626560808289557, 0.001316580749764797, 0.0001827444749576322, 1.227988800930123e-06, 2.192453262992833e-10, 8.269184988236356e-16, 2.594096493966319e-24, 0.01184517615869523, 0.01198717186815151, 0.008347471756678534, 0.005100081345140685, 0.004165222664471407, 0.003734180808060138, 0.003114615335059517, 0.002715775440697069, 0.00347815997543015, 0.003872542497479757, 0.002746289464147752, 0.002787380712736538, 0.001989298796519108, 0.001282190588209588, 0.001799360791261843, 0.0002320534322234722, 1.347515681894809e-06, 2.149659716447771e-10, 6.922436717084727e-16, 2.585244330493277e-24, 0.0159938701955328, 0.01512633179618772, 0.00747627564682662, 0.005667543118269439, 0.006999669452490813, 0.005425569159805113, 0.006083728660487519, 0.004765150465611437, 0.003361954999460466, 0.003225788971671302, 0.003072449429966757, 0.002223181332660519, 0.001926658083413727, 0.001753293738584776, 0.001749893556033262, 0.0003587677486359951, 1.613487678234181e-06, 2.123279425463072e-10, 5.147027370063403e-16, 3.805682681302956e-24, 0.01249440073928664, 0.02030519956507545, 0.01112341536660478, 0.01106991397375838, 0.008086842303238891, 0.007489899583311112, 0.005322246013053619, 0.005033973583900503, 0.003977080487748504, 0.003642467723490568, 0.004405740278921166, 0.004018547502124115, 0.00349947358635109, 0.002695875380425995, 0.002234798626516909, 0.0004440860112650867, 1.57221540477512e-06, 2.063532190828063e-10, 6.187610388201387e-16, 8.186530479429924e-25, 0.1714564699526266, 0.07727996866835646, 0.02058163947776563, 0.01319419897717892, 0.01236000071409725, 0.02061033926385946, 0.01091507372406749, 0.01104434415874155, 0.00876119937180557, 0.005413622719668884, 0.007425840574581294, 0.007843452286313607, 0.005235603957809663, 0.002616460524921298, 0.003520826606521746, 0.0008321826349333746, 2.466865176084663e-06, 2.224064180474864e-10, 5.360923486204503e-16, 1.528211276176003e-24, 0.002526596270953955, 0.00143506671104333, 0.001301123558728094, 0.001140553377288325, 0.0009255118916107767, 0.000968515499630895, 0.0007050873122283715, 0.0007477928673066936, 0.0006139507354284078, 0.0005505742383582977, 0.0005722870840758091, 0.0006769316599746952, 0.0004448316356213001, 0.0004730133289826104, 0.0003211187478682156, 8.552659265934763e-05, 6.783220215844873e-07, 6.876167934569017e-11, 7.637635058553093e-17, 5.9285356532764e-26, 1.906056407008378e-05, 1.966756821115295e-05, 1.730189989358551e-05, 1.030259229281576e-05, 1.295754186607829e-05, 1.125412636916869e-05, 9.935383571133003e-06, 1.152414985257164e-05, 7.781378652028141e-06, 8.572951466347914e-06, 6.77744177100242e-06, 8.148642290396215e-06, 4.289956439347326e-06, 4.356334964975749e-06, 4.367811818205525e-06, 1.048842942479834e-06, 9.698018502458774e-09, 1.26860078494716e-12, 2.207349077599426e-18, 2.703839223291594e-35, 3.217822762134575e-08, 2.365018827663916e-08, 2.169505927687357e-08, 2.005060012751848e-08, 2.966796282349794e-08, 1.740542842902206e-08, 1.740979046527103e-08, 1.808269904783817e-08, 2.004190412244204e-08, 1.466856418579803e-08, 1.839283543841089e-08, 1.363328998247969e-08, 1.189969561232077e-08, 8.827093727835654e-09, 8.723858070195389e-09, 1.44725694811711e-09, 1.699996617678565e-11, 3.515239899621205e-15, 3.174051653304769e-21, 2.371129892683142e-40, 3.50348439566566e-12, 3.078567390835624e-12, 2.829500891694255e-12, 2.420608810354011e-12, 2.655263427595371e-12, 2.5374837993595e-12, 1.718898822334346e-12, 2.380717651154124e-12, 1.655569469952976e-12, 1.595909760618552e-12, 1.916643547537757e-12, 1.289897265970624e-12, 1.336697770450938e-12, 1.064854016699373e-12, 8.392937414029221e-13, 2.055668163848735e-13, 2.420677890904892e-15, 4.342684079486253e-19, 2.366993703495958e-26, 9.339764005172389e-45]
+      ],
+     "36":[
+      [0.009392541871020847, 0.006900843533032646, 0.005000221842144824, 0.004805491125456755, 0.003470407769275644, 0.003034949851210244, 0.00462729320410346, 0.00209101807318573, 0.002335694860463211, 0.002364017347917311, 0.001669672318757732, 0.001846730385077102, 0.001627955658097315, 0.001251833095242638, 0.001044131362321124, 0.0002005765388285084, 1.327307585531085e-06, 1.997363395269797e-10, 1.263393672623243e-16, 3.085784872152415e-26, 0.006278093324879311, 0.006217669502493237, 0.004927222325724549, 0.004679113443227259, 0.003662836874692998, 0.003470657232243812, 0.002458366200329041, 0.002621948378917978, 0.002050603460045132, 0.002450470116761556, 0.002200382927514151, 0.001851665721665388, 0.001606622561968968, 0.001429960344951266, 0.0009197685048640431, 0.0001976862464716181, 1.512642716273373e-06, 1.66443927954666e-10, 1.230766318598292e-16, 1.130679236098452e-33, 0.007909509035566347, 0.007067633671145592, 0.005419714539007243, 0.006048159414409335, 0.004639619700686443, 0.003224430378117939, 0.003332696796652488, 0.002546734665555488, 0.002352258997114596, 0.002042641210822554, 0.001944603041379909, 0.001496122513031695, 0.00149913103871455, 0.001496082211508292, 0.001157569626401656, 0.0001383333416652371, 1.383131872317309e-06, 1.364104940694019e-10, 1.15007751562141e-16, 2.084970288250296e-33, 0.009094496257795249, 0.007624808737828902, 0.00621637812717648, 0.004175145820989055, 0.004805277555640851, 0.003892328335382674, 0.003275848094631898, 0.002772398261323703, 0.002867545843290957, 0.002849475730058317, 0.001966300837794383, 0.001486303383648097, 0.001757366667479148, 0.001391000008725345, 0.001129339739981126, 0.0001997940228094964, 1.661008517708349e-06, 1.275165605481513e-10, 1.146311637232997e-16, 5.744944593278235e-27, 0.008520959980291903, 0.005765027861646932, 0.006016558453515438, 0.005738828583016368, 0.003131657151695489, 0.003738162619746181, 0.003282560102817213, 0.003054028912795231, 0.002543569768401072, 0.002285879972074643, 0.001770417154046461, 0.001683191477149482, 0.002322067160356052, 0.001836178263180803, 0.001303635373957124, 0.0001780834741313741, 1.17400162876727e-06, 1.408567820141572e-10, 1.587414509258996e-16, 6.174230705774856e-26, 0.009260477756325788, 0.008654230846887804, 0.007101106708829349, 0.00480775280052221, 0.004628169328969809, 0.003326798016606426, 0.003419160469870332, 0.003334232791714218, 0.002571248235329495, 0.002888603122884848, 0.002352311683414288, 0.002295472477442613, 0.001649611966007531, 0.00169254756484514, 0.001363275607098581, 0.0002097013173643758, 1.348542112015402e-06, 1.584016794870673e-10, 1.031858130929559e-16, 4.633878615999489e-33, 0.009537908716032729, 0.007529814946971233, 0.00525184307676984, 0.00504615379797455, 0.005679927627046463, 0.004693313245508593, 0.003226649757785075, 0.003579306901484759, 0.002776090627273602, 0.002404106686522521, 0.00200323070663704, 0.001726561669773363, 0.001614936396542179, 0.001531103288951203, 0.001016670438039097, 0.000180523617692329, 1.097023854987407e-06, 1.433482332513415e-10, 1.108527590090855e-16, 4.563986664570316e-26, 0.01046157166287807, 0.005723156297411059, 0.005710791576727698, 0.004897989086107064, 0.005186404803951612, 0.004201679591605676, 0.002919795314484085, 0.003310851789333223, 0.002380031175186122, 0.002402153254376614, 0.001717907341988627, 0.002107494245267415, 0.001426569338210566, 0.00161661837041232, 0.001157219487840337, 0.0002142669334740379, 1.075123231853307e-06, 1.727121069845407e-10, 9.636431114481415e-17, 1.331419120756917e-25, 0.0097999004295192, 0.008766261964565768, 0.006336098538767506, 0.005724003933196441, 0.004038943201491543, 0.004303985756490863, 0.004520985100970824, 0.003316691104356758, 0.004779908796710295, 0.002281178082878199, 0.001536821546248058, 0.001822479853364123, 0.001783719138636069, 0.001259146737291173, 0.001006113667344833, 0.0002413823371429193, 1.086161539981134e-06, 1.166470460324148e-10, 8.414859802087977e-17, 1.364855276035838e-25, 0.007628461972098398, 0.009672583046502302, 0.005748557915726918, 0.005567557956769187, 0.004847927602962431, 0.003866390459320411, 0.003189445033518265, 0.003670618924069257, 0.002348671636010396, 0.00251774117761331, 0.001721067208954208, 0.00198286920736873, 0.001920925446972292, 0.001373857489442177, 0.001530428984426141, 0.0002320462776097956, 1.244869775100859e-06, 1.34433725685177e-10, 1.011360765093551e-16, 4.503389694314409e-26, 0.010142004336297, 0.005338923655048361, 0.006422585784021783, 0.006073221436966134, 0.00489863289105867, 0.003915514975976788, 0.003393358820573162, 0.002649444436369996, 0.002791858681764692, 0.002305975504946893, 0.002183488389618593, 0.002122777547551856, 0.002021167108009032, 0.001239203737427308, 0.001128042993461453, 0.0001568514715179713, 1.05048759652336e-06, 1.353107509598723e-10, 8.56664044014942e-17, 7.703826604275038e-33, 0.009648873999387911, 0.00833971929297034, 0.006285281476632493, 0.004552083426810671, 0.004984655899290428, 0.003458313682774044, 0.003749036614221952, 0.002789467710380443, 0.003036865095022504, 0.002620276274866757, 0.002657234444920381, 0.001570813380602774, 0.001892717087699895, 0.001634955569003531, 0.001320266882320584, 0.0001796114032341956, 1.089211409437233e-06, 1.203891420698279e-10, 1.268317175622358e-16, 6.174786120028676e-26, 0.01107729558975696, 0.01120328624719779, 0.007796812835077667, 0.00476068633998236, 0.003885597063618455, 0.003481277222955122, 0.002901803217212136, 0.00252856494912037, 0.003236255965767237, 0.003600798259227999, 0.002551845186431757, 0.002588247138144947, 0.001845894311333686, 0.001188068448987043, 0.001663372311112673, 0.0002102930155858451, 1.105566124190111e-06, 1.114695181497682e-10, 1.038186316525982e-16, 6.119214030024214e-26, 0.01296509540096604, 0.01225440566410924, 0.006053093751196078, 0.004585822977615997, 0.005660139641984497, 0.004384487052287805, 0.004913192960612593, 0.003845808313176763, 0.002711542310243788, 0.002599981579437209, 0.002474714803317889, 0.001789441772661868, 0.001549693076839554, 0.001408251938562092, 0.001402250243757988, 0.0002819255107596213, 1.153682898106751e-06, 9.92456078509969e-11, 7.39673168377287e-17, 8.910212252505394e-26, 0.008404170426615796, 0.01364970179147422, 0.007472871846173973, 0.007432313635770137, 0.00542607771830965, 0.005022351012775151, 0.003566537128109244, 0.003371165752725022, 0.00266162878748482, 0.002436067042670289, 0.002944552160651645, 0.002683939041889523, 0.002335638987268805, 0.001796760757666094, 0.001486016093937085, 0.000289677981445903, 9.384145802768059e-07, 8.373498858112902e-11, 8.35509268487846e-17, 1.885434564552086e-26, 0.05697736594932092, 0.02566562835795886, 0.006831222252699277, 0.004376550494953737, 0.004097272291255095, 0.006827878890980958, 0.003613670672274757, 0.003654095723672556, 0.002896799755224615, 0.001788770499272632, 0.002452001650157707, 0.002588139251906434, 0.001726430603619866, 0.0008615698048564383, 0.001156726584141306, 0.0002684384142730667, 7.383262587428021e-07, 5.033431394926131e-11, 5.319274971119859e-17, 3.217697882853341e-26, 0.0004677339405137753, 0.0002655043019772269, 0.000240575502901234, 0.0002107554474106, 0.0001709119626993134, 0.0001787397806921801, 0.0001300405043844459, 0.0001378272425182124, 0.0001130842625210374, 0.0001013435968867817, 0.0001052696133705661, 0.0001244341056885489, 8.171328061809947e-05, 8.676920970350313e-05, 5.877214598695273e-05, 1.537382363692414e-05, 1.138085102219276e-07, 9.19320764089314e-12, 5.412330456508789e-18, 1.133318699176382e-27, 3.204035443370604e-06, 3.304065078937878e-06, 2.904857942382869e-06, 1.728652114952134e-06, 2.172753703051839e-06, 1.885919965411725e-06, 1.663858930920984e-06, 1.928670115495927e-06, 1.301426329441209e-06, 1.43286139668144e-06, 1.132001961771281e-06, 1.360100475213094e-06, 7.155496274883509e-07, 7.256058316494027e-07, 7.258592624422063e-07, 1.711769855948155e-07, 1.478704586886439e-09, 1.563492267348905e-13, 1.545075315241194e-19, 5.772089656063724e-37, 9.020934812121501e-09, 6.626135006705149e-09, 6.074623422873034e-09, 5.610677743878073e-09, 8.296629455246596e-09, 4.864310541041547e-09, 4.862384686837286e-09, 5.047017487353068e-09, 5.590142881746916e-09, 4.088655274454995e-09, 5.123268604785666e-09, 3.794908006425186e-09, 3.310054627624748e-09, 2.451908569003679e-09, 2.417653339706008e-09, 3.937865472102668e-10, 4.315997904386904e-12, 7.203561982062516e-16, 3.724992398280147e-22, 8.645026709255532e-42, 3.238988929499133e-12, 2.844422142217564e-12, 2.612688500461697e-12, 2.233732305432665e-12, 2.448720130711618e-12, 2.338601072932823e-12, 1.583145448225533e-12, 2.191252069555992e-12, 1.522797345306187e-12, 1.466930702904574e-12, 1.760538378213879e-12, 1.184018419642668e-12, 1.226117428903117e-12, 9.753688366457036e-13, 7.669692102997509e-13, 1.843642749219434e-13, 2.020888419796771e-15, 2.900913910010629e-19, 8.864562394145898e-27, 1.036909648008852e-45]
+      ],
+     "37":[
+      [0.009225599406260339, 0.006749069670439923, 0.004869309204538543, 0.004659703443021865, 0.003350807564302705, 0.002917931161445085, 0.004430075633631627, 0.001993464749596768, 0.002217377212633352, 0.002234873163480281, 0.001571875902437902, 0.001731335878323902, 0.001519907871890617, 0.001159132077051761, 0.0009543181709540006, 0.0001680230684667207, 9.076617299848434e-07, 1.0510008298134e-10, 6.054423375955954e-17, 2.415216605769963e-26, 0.006185163213120775, 0.006099318448292732, 0.00481273760687442, 0.004550886652976738, 0.003547304790704701, 0.003346934369623532, 0.002360710055627223, 0.00250718779840512, 0.001952617236718099, 0.002323611908510946, 0.002077768899106724, 0.001741214965552322, 0.001504528883132588, 0.001328074615479272, 0.0008431961103437966, 0.0001661030149861572, 1.037535453402194e-06, 8.784891865445568e-11, 5.916411830527306e-17, 8.878414565056426e-34, 0.007815990543589859, 0.006954066001880748, 0.005309792390189283, 0.005900200605332579, 0.004506863629140615, 0.003118886595425364, 0.003209984887600239, 0.002442629182078163, 0.002246630690890596, 0.001942752124081624, 0.00184179402349754, 0.001411133464313641, 0.001408112642664109, 0.001393686476890965, 0.001064408538412293, 0.0001165841120964726, 9.51575985816534e-07, 7.221674322815785e-11, 5.545717758509805e-17, 1.642481772814577e-33, 0.009014121504143888, 0.007524956473770415, 0.006108700227578296, 0.004085314159218445, 0.004681885361599494, 0.003776298482493946, 0.003164763108967364, 0.002667102651639725, 0.002747053983578036, 0.00271831977269862, 0.001867971931884669, 0.001406108026658416, 0.001655657418633853, 0.001299711806390268, 0.001041588470032406, 0.000168890645099476, 1.146210033254875e-06, 6.771385254299476e-11, 5.544729447156824e-17, 4.540360546702132e-27, 0.008471156488152609, 0.005706710858064326, 0.005930194685766299, 0.005632309167990691, 0.003060454533414381, 0.003637679752317554, 0.00318082347613582, 0.002946908756737938, 0.002444049029637726, 0.002187250091182762, 0.001686962521271565, 0.001597181209665129, 0.00219428141242127, 0.001720854840483389, 0.001205971865409701, 0.0001509928859173598, 8.125922402910596e-07, 7.502546145645041e-11, 7.70218889642294e-17, 4.895423659999893e-26, 0.009234133560144728, 0.008592539042699339, 0.007020296115846267, 0.004732754155208225, 0.004536590155718228, 0.003247142087733776, 0.003323188332159335, 0.003226993240022617, 0.002478100194212872, 0.002772308118397396, 0.002248191464741318, 0.002184748085255063, 0.001563536268510583, 0.001591031960063592, 0.001264949976196714, 0.0001783376134276578, 9.362229302839421e-07, 8.462717407343213e-11, 5.022143596656963e-17, 3.685989892547709e-33, 0.009539457145140665, 0.007498684526694333, 0.005207734985978728, 0.004982416653945136, 0.005584327159285937, 0.004594752766332246, 0.003145538808124538, 0.00347463210801275, 0.002683590537945393, 0.002314275819161093, 0.001920335732444272, 0.001648235040611263, 0.001535286246673072, 0.001443611383313259, 0.0009461885587265185, 0.0001539869468588615, 7.639075222637014e-07, 7.68175957831171e-11, 5.412028967732958e-17, 3.642126591009482e-26, 0.01049480410560689, 0.005716672192621335, 0.005679895542765837, 0.004850698463606625, 0.005114478647839169, 0.004125840622416468, 0.002854976518521171, 0.003223714303445449, 0.002307661884833547, 0.002319364554394577, 0.001651782488974239, 0.002017949889180672, 0.001360297061719272, 0.001528833771981358, 0.001080239882181198, 0.0001833210289128867, 7.509172510305718e-07, 9.283433336404737e-11, 4.719255088772693e-17, 1.065922842935891e-25, 0.009860640604966619, 0.008782702928224089, 0.006320799696005014, 0.00568581148917039, 0.003994926329088622, 0.004239029257921889, 0.004433934612768889, 0.00323912651033294, 0.004648525560273554, 0.002209192604723857, 0.001482117561357223, 0.001750301284656869, 0.001705978083758098, 0.001194359904547051, 0.0009420146407536417, 0.0002071424155189, 7.609156956172972e-07, 6.288922277567247e-11, 4.133775609152119e-17, 1.096218229296522e-25, 0.007698846854570052, 0.009719892112490526, 0.005751938662914829, 0.005547055501909377, 0.004809527231609893, 0.003819500181431276, 0.003137448235312671, 0.003595567331178295, 0.002290989832762744, 0.00244562983034423, 0.00166480088069147, 0.001910070526538159, 0.001842734428045527, 0.001307091026996797, 0.001437239305090835, 0.0001997301995981345, 8.747289460516825e-07, 7.269868009680256e-11, 4.98365596918326e-17, 3.628678670687379e-26, 0.01026636921673798, 0.005381174564116261, 0.006445693384676027, 0.006069057841583305, 0.004874449262447868, 0.003879663991431012, 0.003348078525802592, 0.00260307900155447, 0.00273148424736097, 0.002246667195862756, 0.002118457582105787, 0.00205099331119308, 0.001944728108595199, 0.001182527648716708, 0.001062541790874252, 0.0001354136595388865, 7.403671252770157e-07, 7.339484752108199e-11, 4.234416656082917e-17, 6.227491968071601e-33, 0.009796552699841277, 0.008430985853460913, 0.006326857012970732, 0.004562637164016744, 0.004974957856311035, 0.003436949671671101, 0.003710129768173633, 0.002748890515388072, 0.002980124061641483, 0.00256055859423151, 0.002585844131551198, 0.001522256859686288, 0.001826610572826896, 0.00156486959038596, 0.001247342521587413, 0.0001555291139356251, 7.699706486171868e-07, 6.549900969805199e-11, 6.28855958023638e-17, 5.007551454480857e-26, 0.01128062366470341, 0.01135991503783127, 0.007871964397658296, 0.004786058642832746, 0.003889687517879879, 0.00347016503236585, 0.002880315821216052, 0.002499268727425546, 0.003185330127554643, 0.003529304820130549, 0.002490746583120834, 0.002515775280428915, 0.001786774954917295, 0.001140555523759835, 0.001576217926312453, 0.0001826441315316747, 7.838837678854806e-07, 6.082986516457218e-11, 5.163426772003477e-17, 4.978460894335674e-26, 0.01328244502483546, 0.01250042704284455, 0.006148176993797321, 0.004637978012329611, 0.005700160098439468, 0.004396765211078768, 0.004906128753894221, 0.003824101852107609, 0.002684917551999228, 0.002563678978956987, 0.00242998379646139, 0.001749793046512709, 0.001509078185400906, 0.001360060963769423, 0.001336766071825455, 0.0002463309145133426, 8.229260983744901e-07, 5.448741065116946e-11, 3.701509765325596e-17, 7.295865380369778e-26, 0.008692079756596086, 0.01405666533886151, 0.007662721572311783, 0.007588605630411235, 0.005516612530646579, 0.005084498433431515, 0.00359541025553349, 0.003384141532177942, 0.002660655592864041, 0.002424985965265017, 0.002918932895280903, 0.002649527414212543, 0.002296140385785442, 0.00175184220687701, 0.001430145397790497, 0.0002555216709945501, 6.757761036271927e-07, 4.641432942655476e-11, 4.222146579346106e-17, 1.559633016282219e-26, 0.06294831397198117, 0.02823345107890748, 0.007482503011809871, 0.004773346188296631, 0.004449737596165176, 0.007383802060749477, 0.003891379112634166, 0.003918336210497397, 0.003093236482166991, 0.001902077487079423, 0.002596446214904197, 0.00272921190589259, 0.001812991798323562, 0.0008973244684148994, 0.001189165456704718, 0.0002529406062969991, 5.680160029507408e-07, 2.981942567438707e-11, 2.876742418998088e-17, 2.856729181104092e-26, 0.0006152563412226748, 0.0003477437742429829, 0.0003137443429319438, 0.0002736819275102727, 0.0002209981752405113, 0.0002301401881325099, 0.0001667289453713801, 0.0001759683792863401, 0.0001437722389917519, 0.0001283064727844241, 0.0001327213371611511, 0.0001562315347783995, 0.0001021690930014502, 0.0001075984433783236, 7.19393350915783e-05, 1.724884939867949e-05, 1.042826547316862e-07, 6.49430401134684e-12, 3.502711386145463e-18, 1.213282773397396e-27, 5.814849542838912e-06, 5.970647776986652e-06, 5.226796645879872e-06, 3.09715047874796e-06, 3.876281899800888e-06, 3.350305489074488e-06, 2.943337689600452e-06, 3.397426878857062e-06, 2.282897796666993e-06, 2.5029484601811e-06, 1.969163948475828e-06, 2.356127481861312e-06, 1.234430855120262e-06, 1.24149378591269e-06, 1.225903763645991e-06, 2.65023909256917e-07, 1.870844727851827e-09, 1.528518287856076e-13, 1.393124170999836e-19, 8.732745086255123e-37, 2.662646545289273e-08, 1.947409897522033e-08, 1.777697218470833e-08, 1.634938106663388e-08, 2.407362322051324e-08, 1.405468263023929e-08, 1.398992089139853e-08, 1.446016174251829e-08, 1.594923465599663e-08, 1.16166854472281e-08, 1.449572189154546e-08, 1.069279282666375e-08, 9.288132974714529e-09, 6.823745219317198e-09, 6.641814696222847e-09, 9.919875341467964e-10, 8.894637465626029e-12, 1.151502781932815e-15, 5.549771240852257e-22, 2.209005074957171e-41, 1.824862958881801e-11, 1.595724939491902e-11, 1.459489946522191e-11, 1.242511423346171e-11, 1.356346037177481e-11, 1.289899498933694e-11, 8.695513074818381e-12, 1.198526624744256e-11, 8.294394546049238e-12, 7.9569327371751e-12, 9.510018643108433e-12, 6.36942727903901e-12, 6.568804102746984e-12, 5.182824987265857e-12, 4.023271006000122e-12, 8.872789972080405e-13, 7.971789696293442e-15, 8.926761285306454e-19, 2.579658069217454e-26, 5.329197495852818e-45]
+      ],
+     "38":[
+      [0, 6.871521155498474e-34, 1.255473544227933e-31, 3.045924136241096e-30, 2.164262612547767e-29, 1.111231756764647e-28, 7.175943294748502e-28, 1.096322388404893e-27, 3.510683607164475e-27, 8.980721973921381e-27, 1.451516250955579e-26, 3.390088851547036e-26, 5.905265169984389e-26, 1.512498746800153e-25, 6.174545566275515e-25, 6.552961564986402e-23, 3.08240798922802e-22, 4.946673264940106e-24, 5.472490405866027e-29, 6.471269611656837e-38, 2.216072214613481e-05, 2.158292572084289e-05, 1.681964816575056e-05, 1.570781984796845e-05, 1.209241453301214e-05, 1.126823268998246e-05, 7.849550960145637e-06, 8.233453721344577e-06, 6.33293151418192e-06, 7.442917901953799e-06, 6.573070860644507e-06, 5.440193917910653e-06, 4.642510737020002e-06, 3.997183769973191e-06, 2.439344328785795e-06, 3.64146516881317e-07, 1.06902468706746e-09, 2.070116320690159e-14, 1.232860953663761e-21, 5.313246540943116e-40, 0.0001117159287130202, 9.81671400466758e-05, 7.402877774599554e-05, 8.124281808193976e-05, 6.128966401426556e-05, 4.188962671872452e-05, 4.257978279011709e-05, 3.200007600042345e-05, 2.906816659923031e-05, 2.482534561899654e-05, 2.324397524410586e-05, 1.758848159774501e-05, 1.733357125784854e-05, 1.673381585003265e-05, 1.2284319911449e-05, 1.019615286335553e-06, 3.911354850394669e-09, 6.788694660786505e-14, 4.60784779219755e-21, 3.899603291394625e-39, 0.0002891186834303806, 0.0002383707645776896, 0.0001911144439635341, 0.0001262307937899977, 0.0001428746714313277, 0.0001138137832914693, 9.420268793091325e-05, 7.840699828421135e-05, 7.975809460541374e-05, 7.794712002127398e-05, 5.290068617327763e-05, 3.932788175420268e-05, 4.573437398398431e-05, 3.501858268261605e-05, 2.697494251690464e-05, 3.314547396510157e-06, 1.05723293198577e-08, 1.428401809328578e-13, 1.033696503355364e-20, 2.414845697993915e-32, 0.0004817402135928544, 0.0003205179116371803, 0.0003289509005865202, 0.000308562939724242, 0.0001655914151296585, 0.0001943884329732184, 0.0001678723072892534, 0.0001536028183233574, 0.0001258157130833746, 0.0001112027074384876, 8.470592260391913e-05, 7.920515353800447e-05, 0.0001074686912132536, 8.220781568518272e-05, 5.537565859789911e-05, 5.254030167109351e-06, 1.328916655611377e-08, 2.806109081466332e-13, 2.545868612656248e-20, 4.61297372501228e-31, 0.0008183275323248421, 0.000752053534292438, 0.0006068458108952206, 0.0004040471188440883, 0.0003825094914219567, 0.0002704008338294237, 0.0002733098081254767, 0.0002621146627656268, 0.0001987946037160687, 0.0002196439117282262, 0.0001759148037472286, 0.0001688345643922756, 0.0001193323897724029, 0.0001184427578164813, 9.051401069367585e-05, 9.670297289728141e-06, 2.385977468814837e-08, 4.932568873482388e-13, 2.586901063058057e-20, 5.410616325629254e-38, 0.001214112047583099, 0.0009425760768659082, 0.0006465109459022672, 0.0006108888284487357, 0.0006762193408805371, 0.0005495066331809369, 0.0003715346830810207, 0.0004053275598804259, 0.0003091761757391058, 0.0002633278691305041, 0.0002157994264270923, 0.0001829292535049416, 0.000168284361288014, 0.0001543419274703055, 9.723534447143591