changeset 26:5f2ca10db92a draft

"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/hyphy/ commit 3908306ffa6f6cbc7b83303b2d4c581406d2fad9"
author iuc
date Tue, 27 Apr 2021 18:07:06 +0000
parents f04a1264e2a2
children 8633ea985719
files hyphy_absrel.xml macros.xml test-data/busted-in2.nex test-data/busted-out1.json test-data/busted-out2-1.json test-data/busted-out2-2.json test-data/gard-out1.json test-data/gard-out1.nex test-data/relax-in2.nex test-data/relax-out1.json test-data/relax-out2-1.json test-data/relax-out2-2.json
diffstat 12 files changed, 6909 insertions(+), 964 deletions(-) [+]
line wrap: on
line diff
--- a/hyphy_absrel.xml	Tue Apr 20 19:53:39 2021 +0000
+++ b/hyphy_absrel.xml	Tue Apr 27 18:07:06 2021 +0000
@@ -1,28 +1,21 @@
 <?xml version="1.0"?>
-<tool id="hyphy_absrel" name="HyPhy-aBSREL" version="@VERSION@+galaxy0" profile="19.09">
+<tool id="hyphy_absrel" name="HyPhy-aBSREL" version="@VERSION@+galaxy1" profile="19.09">
     <description>adaptive Branch Site Random Effects Likelihood</description>
     <macros>
         <import>macros.xml</import>
-        <token name="@OPERATION@">aBSREL</token>
-        <token name="@operation@">absrel</token>
     </macros>
     <expand macro="requirements"/>
     <command detect_errors="exit_code"><![CDATA[
         @SYMLINK_FILES@
+        ln -s '$absrel_output' ${input_file}.aBSREL.json &&
         @HYPHYMPI@ absrel
             --alignment ./$input_file
-            #if $input_nhx:
-                --tree ./input.nhx
-            #end if
+            @INPUT_TREE@
             --code '$gencodeid'
-            --branches '$branches'
+            @branch_options@
             --output '$absrel_output'
             --multiple-hits $multiple_hits
-            #if $log:
-                > '$absrel_log'
-            #end if
-            ;
-        @CATCH_ERROR@
+        @ERRORS@
         ]]></command>
     <inputs>
         <expand macro="inputs"/>
@@ -36,9 +29,6 @@
         <expand macro="branches"/>
     </inputs>
     <outputs>
-        <data name="absrel_log" format="txt">
-            <filter>log</filter>
-        </data>
         <data name="absrel_output" format="hyphy_results.json" />
     </outputs>
     <tests>
@@ -46,14 +36,12 @@
             <param name="input_file" ftype="fasta" value="absrel-in1.fa"/>
             <param name="input_nhx" ftype="nhx" value="absrel-in1.nhx"/>
             <param name="multiple_hits" value="None" />
-            <param name="log" value="false"/>
             <output name="absrel_output" file="absrel-out1.json" compare="sim_size"/>
         </test>
         <test>
             <param name="input_file" ftype="fasta" value="absrel-in1.fa"/>
             <param name="input_nhx" ftype="nhx" value="absrel-in1.nhx"/>
             <param name="multiple_hits" value="Double" />
-            <param name="log" value="false"/>
             <output name="absrel_output" file="absrel-out1.json" compare="sim_size"/>
         </test>
     </tests>
--- a/macros.xml	Tue Apr 20 19:53:39 2021 +0000
+++ b/macros.xml	Tue Apr 27 18:07:06 2021 +0000
@@ -93,13 +93,45 @@
         </param>
     </xml>
 
+    <xml name="srv">
+        <conditional name="advanced" label="Advanced options">
+            <param name="srv_options" type="select" label="Set advanced parameters" help="If these parameters are not set, RELAX will calculate appropriate values at runtime">
+                <option value="defaults">Calculate</option>
+                <option value="specify">Specify values</option>
+            </param>
+            <when value="defaults" />
+            <when value="specify">
+                <param argument="--grid-size" type="integer" value="250" label="Points in the initial distributional guess for likelihood fitting" />
+                <param argument="--starting-points" type="integer" value="1" label="Initial random guesses to seed rate values optimization" />
+                <param argument="--syn-rates" type="integer" min="1" max="10" value="3" label="Alpha rate classes to include in the model" />
+                <param argument="--rates" type="integer" min="2" max="10" value="3" label="Omega rate classes to include in the model" />
+                <param argument="--srv" type="boolean" truevalue="Yes" falsevalue="No" label="Include synonymous rate variation" />
+                <param name="save_alternative_model" type="boolean" label="Save alternative model fit" />
+            </when>
+        </conditional>
+    </xml>
+
     <xml name="branches">
-        <param name="branches" type="select" label="Set of branches to test">
-            <option value="All">All branches</option>
-            <option value="Internal">Internal branches</option>
-            <option value="Leaves">Leaf branches</option>
-            <option value="'Unlabeled-branches'">Unlabeled branches</option>
-        </param>
+        <conditional name="branch_cond">
+            <param name="branch_sel" type="select" label="Set of branches to test">
+                <option value="All">All branches</option>
+                <option value="Internal">Internal branches</option>
+                <option value="Leaves">Leaf branches</option>
+                <option value="'Unlabeled-branches'">Unlabeled branches</option>
+                <option value="specify">Enter a branch label</option>
+            </param>
+            <when value="specify">
+                <param name="branch_label" type="text" value="Test" optional="false" label="Branch label">
+                    <sanitizer invalid_char="">
+                        <valid initial="default" />
+                    </sanitizer>
+                </param>
+            </when>
+            <when value="All" />
+            <when value="Internal" />
+            <when value="Leaves" />
+            <when value="'Unlabeled-branches'" />
+        </conditional>
     </xml>
     <xml name="citations">
         <citations>
@@ -114,17 +146,40 @@
             <yield/>
         </requirements>
     </xml>
+    <xml name="alternative_model_output">
+        <data name="alternative_model" format="hyphy_results.json" from_work_dir="alternative_model.json">
+            <filter>advanced['save_alternative_model']</filter>
+        </data>
+    </xml>
+    <token name="@INPUT_TREE@"><![CDATA[
+            #if $input_nhx:
+                --tree input.nhx
+            #end if
+        ]]>
+    </token>
+    <token name="@branch_options@"><![CDATA[
+        #if $branch_cond.branch_sel == 'specify':
+            --branches '$branch_cond.branch_label'
+        #else:
+            --branches $branch_cond.branch_sel
+        #end if
+        ]]>
+    </token>
+    <token name="@advanced_options@"><![CDATA[
+        #if $advanced.srv_options == 'specify':
+            --grid-size $advanced.grid_size
+            --starting-points $advanced.starting_points
+            --syn-rates $advanced.syn_rates
+            --rates $advanced.rates
+            --srv $advanced.srv
+            #if $advanced.save_alternative_model:
+                --save-fit alternative_model.json
+            #end if
+        #end if
+    ]]></token>
     <token name="@HYPHYMPI@">\${GALAXY_MPIRUN:-mpirun -mca orte_tmpdir_base "\${TMPDIR:-.}" -np \${GALAXY_SLOTS:-1}} HYPHYMPI</token>
-    <token name="@CATCH_ERROR@"><![CDATA[
-        EC=\$? ;
-        if [ \$EC -ne 0 ] ; then
-            if [ -f errors.log.mpinode0 ] ; then
-                cat errors.log.mpinode0 >&2 ;
-            else 
-                cat errors.log >&2 ;
-            fi ;
-        fi ;
-        exit \$EC
+    <token name="@ERRORS@"><![CDATA[
+        ; EC=\$? ; [[ -f errors.* ]] && cat errors.* >&2 ; exit \$EC
     ]]></token>
     <token name="@HYPHY_ENVIRONMENT@"><![CDATA[
         export HYPHY=`which hyphy` &&
@@ -134,11 +189,10 @@
         @HYPHY_ENVIRONMENT@ hyphy LIBPATH=\$HYPHY_LIB
     ]]></token>
     <token name="@SYMLINK_FILES@"><![CDATA[
-        ln -s '$input_file' input.$input_file.extension &&
-        ln -s '$@operation@_output' input.${input_file.extension}.@OPERATION@.json &&
-        #set $input_file = 'input.%s' % $input_file.extension
-        #if $input_nhx:
+        #if $input_nhx is not None:
             ln -s '$input_nhx' input.nhx &&
         #end if
+        ln -s '$input_file' input.$input_file.extension &&
+        #set $input_file = 'input.%s' % $input_file.extension
     ]]></token>
 </macros>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/busted-in2.nex	Tue Apr 27 18:07:06 2021 +0000
@@ -0,0 +1,30 @@
+#NEXUS
+
+BEGIN TAXA;
+	DIMENSIONS NTAX = 8;
+	TAXLABELS
+		'B_FR_83_HXB2' 'B_US_83_RF' 'B_US_86_JRFL' 'B_US_90_WEAU160' 'D_CD_83_ELI' 'D_CD_83_NDK' 'D_CD_84_84ZR085' 'D_UG_94_94UG114' ;
+END;
+
+BEGIN CHARACTERS;
+	DIMENSIONS NCHAR = 1320;
+	FORMAT
+		DATATYPE = DNA
+		GAP=-
+		MISSING=?
+	;
+
+MATRIX
+	'B_FR_83_HXB2'     CCCATTAGCCCTATTGAGACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAAGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAGTAGAAATTTGTACAGAGATGGAAAAGGAAGGGAAAATTTCAAAAATTGGGCCTGAAAATCCATACAATACTCCAGTATTTGCCATAAAGAAAAAAGACAGTACTAAATGGAGAAAATTAGTAGATTTCAGAGAACTTAATAAGAGAACTCAAGACTTCTGGGAAGTTCAATTAGGAATACCACATCCCGCAGGGTTAAAAAAGAAAAAATCAGTAACAGTACTGGATGTGGGTGATGCATATTTTTCAGTTCCCTTAGATGAAGACTTCAGGAAGTATACTGCATTTACCATACCTAGTATAAACAATGAGACACCAGGGATTAGATATCAGTACAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAATATTCCAAAGTAGCATGACAAAAATCTTAGAGCCTTTTAGAAAACAAAATCCAGACATAGTTATCTATCAATACATGGATGATTTGTATGTAGGATCTGACTTAGAAATAGGGCAGCATAGAACAAAAATAGAGGAGCTGAGACAACATCTGTTGAGGTGGGGACTTACCACACCAGACAAAAAACATCAGAAAGAACCTCCATTCCTTTGGATGGGTTATGAACTCCATCCTGATAAATGGACAGTACAGCCTATAGTGCTGCCAGAAAAAGACAGCTGGACTGTCAATGACATACAGAAGTTAGTGGGGAAATTGAATTGGGCAAGTCAGATTTACCCAGGGATTAAAGTAAGGCAATTATGTAAACTCCTTAGAGGAACCAAAGCACTAACAGAAGTAATACCACTAACAGAAGAAGCAGAGCTAGAACTGGCAGAAAACAGAGAGATTCTAAAAGAACCAGTACATGGAGTGTATTATGACCCATCAAAAGACTTAATAGCAGAAATACAGAAGCAGGGGCAAGGCCAATGGACATATCAAATTTATCAAGAGCCATTTAAAAATCTGAAAACAGGAAAATATGCAAGAATGAGGGGTGCCCACACTAATGATGTAAAACAATTAACAGAGGCAGTGCAAAAAATAACCACAGAAAGCATAGTAATATGGGGAAAGACTCCTAAATTTAAACTGCCCATACAAAAGGAAACATGGGAAACATGGTGGACAGAGTATTGGCAAGCCACCTGGATTCCTGAGTGGGAGTTTGTTAATACCCCTCCCTTAGTGAAATTATGGTACCAGTTAGAGAAAGAACCCATAGTAGGAGCAGAAACCTTC
+	'B_US_83_RF'       CCCATTAGTCCTATTGAAACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAAGTTAAACAATGGCCATTGACAGAGGAAAAAATAAAAGCATTGGTAGAAATTTGTACAGAAATGGAAAAGGAAGGAAAAATTTCCAAAATTGGGCCTGAAAATCCATACAATACTCCAGTATTTGCCATAAAGAAAAAAGACAGTACTAAATGGAGAAAATTAGTAGATTTCAGAGAACTTAATAAGAGAACTCAAGACTTCTGGGAAGTTCAGTTAGGAATACCACATCCTGCAGGGTTAAAAAAGAAGAAATCAGTAACAGTATTGGATGTGGGTGATGCATATTTTTCAGTTCCCTTAGATAAAGAGTTCAGGAAGTATACTGCATTTACCATACCTAGTATAAACAATGAAACACCACGGATTAGATATCAGTACAATGTGCTTCCACAAGGGTGGAAAGGATCACCAGCAATATTCCAAAGTAGTATGACAAAAATCTTAGAGCCTTTTAAAAAACAAAATCCAGAAATAGTTATCTATCAATACATGGATGATTTGTATGTAGGATCTGATTTAGAAATAGGGCAGCATAGAATAAAAATAGAGGAACTGAGAGAACATCTGTTAAAGTGGGGGTTTACCACACCGGACAAGAAACATCAGAAAGAACCTCCATTTCTTTGGATGGGTTATGAACTCCATCCTGATAAATGGACAGTACAGCCTATAGTGCTGCCAGAAAAAGACAGCTGGACTGTCAATGACATACAGAAGTTAGTGGGAAAATTGAATTGGGCAAGTCAGATTTATGCAGGGATTAAAGTAAAGCAATTATGTAAACTCCTTAGGGGAACCAAAGCACTAACAGAAGTAGTACAACTAACAAAAGAAGCAGAGCTAGAACTGGCAGAAAATAGGGAGATTCTAAAAGAACCAGTACATGGAGTGTATTATGACCCATCAAAAGACTTAATAGCAGAAATACAGAAGCAGGGGCAAGGCCAATGGACATACCAAATTTATCAAGAGCCATTTAAAAACCTGAAAACAGGAAAGTATGCAAGAATGAGGGGTGCCCACACTAATGATGTAAAACAATTAACAGAGGCAGTACAAAAAGTAGCCACAGAAAGCATAGTAATATGGGGAAAGACTCCTAAATTTAAACTACCCATACAAAAAGAAACATGGGAGGCATGGTGGACAGAGTATTGGCAAGCCACCTGGATTCCTGAGTGGGAGTTTGTCAATACCCCTCCCTTAGTAAAATTGTGGTACCAGTTAGAAAAAGAACCCATAATAGGAGCAGAAACTTTC
+	'B_US_86_JRFL'     CCCATTAGTCCTATTGAAACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAAGTCAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAGTAGAAATTTGTACAGAAATGGAAAAGGAAGGGAAAATTTCAAAAATTGGGCCTGAAAATCCATACAATACTCCAGTATTTGCCATAAAGAAAAAGGACAGTACTAAATGGAGAAAATTAGTAGATTTCAGAGAACTTAATAAGAAAACTCAAGACTTCTGGGAAGTTCAATTAGGAATACCACATCCCGCAGGGTTAAAAAAGAGAAAATCAGTAACAGTACTGGATGTGGGTGATGCATATTTTTCAGTTCCCTTAGATAAAGACTTCAGGAAATATACTGCATTTACCATACCTAGTATAAACAATGAGACACCAGGGATTAGGTATCAGTACAATGTGCTTCCGCAGGGATGGAAAGGATCACCAGCAATATTCCAAAGTAGCATGACAAAAATCTTAGAGCCTTTTAGAAAACAAAATCCAGACATAATTATCTATCAATACATGGATGATTTGTATGTAGGATCTGACTTAGAGATAGGGCAGCATAGAGCAAAAATAGAGGAATTGAGACAACATCTGTTGAGGTGGGGGTTTACCACACCAGACAAAAAACATCAGAAAGAACCTCCATTCCTTTGGATGGGTTATGAACTCCATCCTGACAAATGGACAGTACAGCCTATAGTGCTGCCAGAAAAAGACAGCTGGACTGTCAATGACATACAGAAGTTAGTGGGAAAATTAAATTGGGCAAGTCAGATTTACGCAGGGATTAAAGTAAAGCAATTATGTAAACTCCTTAGGGGAACCAAAGCACTAACAGAAGTAATACCACTAACAGAAGAAGCAGAGCTAGAACTGGCAGAAAACAGGGAGATTCTAAAAGAGCCAGTACATGGAGTGTATTATGACCCATCAAAAGACTTAATAGCAGAACTACAGAAGCAGGGGCAAGGCCAATGGACATATCAAATTTATCAAGAGCCATTTAAAATTCTGAAAACAGGAAAATATGCAAGAACGAGGGGTGCCCACACTAATGATGTAAAACAATTAACAGAGGCAGTGCAAAAAATAGCCAATGAAAGCATAGTAATATGGGGAAAGATTCCTAAATTTAAATTACCCATACAAAAAGAAACATGGGAAACATGGTGGACAGAGTATTGGCAAGCCACCTGGATTCCTGAGTGGGAGTTTGTCAATACCCCTCCCTTAGTGAAATTATGGTACCAGTTAGAGAAAGAACCCATAGTAGGAGCAGAAACTTTC
+	'B_US_90_WEAU160'  CCCATTAGTCCTATTGAAACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAAGTTAAACAATGGCCATTGACAGAAGAGAAAATAAAAGCATTAGTAGAAATTTGTACAGAAATGGAAAAGGAAGGAAAAATTTCAAAAATTGGGCCTGAAAATCCATATAATACTCCAGTATTTGCCATAAAGAAAAAAGACAGTACTAAATGGAGAAAATTAGTAGATTTCAGAGAACTTAATAAGAGAACTCAAGACTTCTGGGAAGTTCAATTAGGAATACCACATCCTTCAGGGTTAAAAAAGAAAAAATCAGTAACAGTACTGGATGTGGGTGATGCATATTTTTCAGTACCCTTAGATGAAGACTTCAGGAAGTACACTGCATTTACCATACCTAGTATAAACAATGAAACACCAGGGATTAGATATCAGTACAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAATATTCCAAAGTAGCATGACAAAAATATTAGAGCCTTTTAGAAAACAAAATCCAGACATAGTTATCTATCAATACATGGATGATTTGTATGTAGGATCTGACTTAGAAATAGGGCAGCATAGAACAAAAATAGAGGAGCTGAGACAACATCTGTTGAGGTGGGGATTTACCACACCAGACAAAAAACATCAAAAAGACCCTCCATTCCTTTGGATGGGTTATGAACTCCATCCTGATAAATGGACAGTACAGCCTATAAAGCTGCCAGAAAAAGAAAGTTGGACTGTCAATGACATACAGAAGTTAGTGGGAAAATTGAATTGGGCAAGTCAGATTTACGCAGGGATTAAAGTAAAGCAACTATGTAAACTCCTTAGGGGGACCAAAGCACTAACAGAAATAATACCAATAACAGAAGAAGCAGAGCTAGAGCTGGCAGAAAACAGGGAAATTCTAAAAGAACCGGTACATGGAGTGTATTATGACCCATCAAAAGACTTAATAGCAGAGCTACAGAAGCAGGGGCAAGGCCAATGGACATATCAGATTTATCAAGAGCCATTTAAAAATCTGAAAACAGGAAAGTATGCAAGAGTGAGGGGTGCCCACACTAATGATGTAAAACAATTAACAGAGGCAGTGCAGAAAATAACCACAGAAAGCATAGTAATATGGGGAAAGACTCCTAAATTTAAACTACCCATACAAAAAGAAACATGGGAAACATGGTGGACAGAGTATTGGCAAGCCACCTGGATTCCTGAGTGGGAGTTTGTCAATACCCCTCCCTTAGTGAAATTATGGTATCAGTTAGAGAAAGAACCCATAGTAGGAGCAGAAACTTTC
+	'D_CD_83_ELI'      CCAATTAGTCCTATTGAAACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAAGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAACAGAAATTTGTACAGATATGGAAAAGGAAGGAAAAATTTCAAGAATTGGGCCTGAAAATCCATACAATACTCCAATATTTGCCATAAAGAAAAAAGACAGTACCAAGTGGAGAAAATTAGTAGATTTCAGAGAACTTAATAAGAGAACTCAAGATTTCTGGGAAGTTCAATTAGGAATACCGCATCCTGCAGGGCTGAAAAAGAAAAAATCAGTAACAGTACTGGATGTGGGTGATGCATATTTTTCAGTTCCCTTAGATGAAGATTTTAGGAAATATACCGCCTTTACCATATCTAGTATAAACAATGAGACACCAGGGATTAGATATCAGTACAATGTGCTTCCACAGGGATGGAAAGGATCACCGGCAATATTCCAAAGTAGCATGACAAAAATCTTAGAGCCCTTTAGAAAACAAAATCCAGAAATGGTTATCTATCAATACATGGATGATTTGTATGTAGGATCTGACTTAGAAATAGGGCAGCATAGGACAAAAATAGAGAAATTAAGAGAACATCTATTGAGGTGGGGATTTACCAGACCAGATAAAAAACATCAGAAAGAACCCCCATTTCTTTGGATGGGTTATGAACTCCATCCTGATAAATGGACAGTACAGTCTATAAAACTGCCAGAAAAGGAGAGCTGGACTGTCAATGATATACAGAACTTAGTGGAGAGATTAAACTGGGCAAGCCAGATTTATCCAGGAATTAAAGTAAGACAATTATGTAAACTCCTTAGGGGAACCAAAGCACTAACAGAAGTAATACCACTAACAGAAGAAGCAGAATTAGAACTGGCAGAAAACAGGGAAATTTTAAAAGAACCAGTACATGGAGTGTATTATGACCCATCAAAAGACTTAATAGCAGAAATACAGAAACAAGGGCACGGCCAATGGACATACCAAATTTATCAAGAACCATTTAAAAATCTGAAAACAGGAAAGTATGCAAGAATGAGGGGTGCCCACACTAATGATGTAAAGCAATTAGCAGAGGCAGTGCAAAGAATATCCACAGAAAGCATAGTGATATGGGGAAGGACTCCTAAATTTAGACTACCCATACAAAAGGAAACATGGGAAACATGGTGGGCAGAGTATTGGCAAGCCACTTGGATTCCTGAGTGGGAATTTGTCAATACCCCTCCTTTAGTAAAATTATGGTACCAGTTAGAGAAGGAACCCATAATAGGAGCAGAAACTTTC
+	'D_CD_83_NDK'      CCAATTAGTCCTATTGAAACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAAGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAACAGAAATTTGTACAGAAATGGAAAAGGAAGGAAAAATTTCAAGAATTGGGCCTGAAAATCCATATAATACTCCAATATTTGCCATAAAGAAAAAAGACAGTACCAAGTGGAGAAAATTAGTAGATTTCAGAGAACTTAATAAGAGAACTCAAGATTTCTGGGAGGTTCAATTAGGAATACCGCATCCTGCAGGGCTGAAAAAGAAAAAATCAGTAACAGTACTGGATGTGGGTGATGCATATTTCTCAGTTCCCTTAGATGAAGATTTTAGGAAATATACCGCATTTACCATACCTAGTATAAACAATGAGACACCAGGGATTAGATATCAGTACAATGTGCTCCCACAGGGATGGAAAGGATCACCGGCAATATTCCAAAGTAGCATGACAAAAATCTTAGAGCCCTTTAGAAAACAAAATCCAGAAATAGTTATCTATCAATACATGGATGATTTGTATGTAGGATCTGACTTAGAAATAGGGCAGCATAGAACAAAAATAGAGGAATTAAGAGAACATCTATTGAGGTGGGGATTTACCACACCAGATAAAAAACATCAGAAAGAACCTCCATTTCTTTGGATGGGTTATGAACTCCATCCTGATAAATGGACAGTACAGCCTATAAACCTGCCAGAAAAAGAAAGCTGGACTGTCAATGATATACAGAAGTTAGTGGGGAAATTAAACTGGGCAAGCCAGATTTATGCAGGAATTAAAGTAAAGCAATTATGTAAACTCCTTAGGGGAACCAAAGCACTAACAGAAGTAGTACCACTAACAGAAGAAGCAGAATTAGAACTGGCAGAAAACAGGGAAATTCTAAAAGAACCAGTACATGGAGTGTATTATGACCCATCAAAAGACTTAATAGCAGAACTACAGAAACAAGGGGACGGCCAATGGACATACCAAATTTATCAAGAACCATTTAAAAATCTAAAAACAGGAAAGTATGCAAGAACGAGGGGTGCCCACACTAATGATGTAAAACAATTAACAGAGGCAGTGCAAAAAATAGCCACAGAAAGCATAGTGATATGGGGAAAGACTCCTAAATTTAAACTACCCATACAAAAGGAAACATGGGAAACATGGTGGATAGAGTATTGGCAAGCCACCTGGATTCCTGAGTGGGAATTTGTCAATACCCCTCCTTTAGTAAAATTATGGTACCAGTTAGAGAAGGAACCCATAATAGGAGCAGAAACTTTC
+	'D_CD_84_84ZR085'  CCAATTAGTCCTATTGAAACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAAGTTAAACAATGGCCGTTGACAGAAGAAAAAATAAAAGCATTAACAGAAATTTGTACAGATATGGAAAAGGAAGGAAAAATTTCAAGAATTGGGCCTGAAAATCCATACAATACTCCAATATTTGCCATAAAGAAAAAAGACAGTACTAAGTGGAGAAAATTAGTAGATTTCAGAGAACTTAATAAGAGAACTCAAGACTTCTGGGAAGTTCAATTAGGGATACCACATCCTGCAGGATTAAAGAAGAAAAAGTCAATAACAGTACTGGATGTGGGCGATGCATATTTTTCAATTCCCTTATGTGAAGACTTTAGGAAGTACACTGCATTTACCATACCTAGTATAAACAATGAGACACCAGGGATTAGATATCAGTACAATGTACTTCCACAGGGATGGAAAGGATCACCAGCAATATTCCAAAGTAGCATGATAAAAATCTTAGAGCCCTTTAGAAAACAAAATCCAGAAGTAGTTATCTATCAATACATGGATGATTTGTATGTAGGATCTGATTTAGAAATAGGACAGCATAGAGCAAAAATAGAGAAATTAAGAGAACATCTGTTGAGGTGGGGGCTTACCACACCAGACAAAAAACATCAGAAAGAACCTCCATTTCTTTGGATGGGTTATGAACTCCATCCTGATAAGTGGACAGTACAGTCTATAACACTGCCAGAGAAAGAAAGCTGGACTGTCAATGATATACAGAAGTTAGTGGGAAAATTAAATTGGGCAAGCCAGATTTATCCAGGAATTAAAGTAAAGCAATTATGTAAACTCCTTAGGGGAACCAAGGCACTAACAGAGGTAATACCACTAACAGAAGAAGCAGAATTAGAACTGGCAGAAAACAGGGAGATTCTAAAGGAACCAATGCATGGAGTGTATTATGACCCATCAAAAGACTTAATAGCAGAATTACAGAAACAAGGGCAAGGTCAATGGACATATCAAATTTATCAAGAACCATTTAAAAATCTGAAAACAGGAAAGTATGCAAGAATGAGGGGTGCCCACACTAATGATGTAAAACAGTTAACAGAGGCAGTGCAAAAAATAGCCATAGAAAGCATAGTGATATGGGGAAAGACTCCTAAATTTAGACTACCCATACAAAAGGAAACATGGGAAACATGGTGGATAGACTATTGGCAAGCCACCTGGATTCCTGAGTGGGAATTTGTCAATACCCCTCCTTTAGTAAAATTATGGTACCAGTTAGAGAAGGAACCCATAATAGGAGCAGAAACTTTC
+	'D_UG_94_94UG114'  CCAATTAGTCCTATTGAAACTGTACCAGTAAAATTAAAGCCAGGGATGGATGGCCCAAAAGTTAAACAATGGCCGTTGACAGAAGAAAAAATAAAAGCACTAATAGAAATTTGTTCAGAACTAGAAAAGGAAGGAAAAATTTCAAAAATTGGGCCTGAAAACCCATACAATACTCCAATATTTGCCATAAAGAAAAAAGACAGTACTAAGTGGAGAAAATTAGTAGATTTCAGAGAACTTAATAAGAGAACTCAAGACTTTTGGGAAGTTCAACTAGGAATACCACATCCTGCAGGGCTAAAAAAGAAAAAATCAGTAACAGTACTGGATGTGGGTGACGCATATTTTTCAGTTCCCTTACATGAAGACTTTAGAAAATATACCGCATTCACCATACCTAGTACAAACAATGAGACACCAGGAATTAGATATCAGTACAATGTGCTTCCACAAGGATGGAAAGGATCACCAGCAATATTCCAAAGTAGCATGACAAAAATCTTAGAACCTTTTAGAAAACAAAATCCAGAAATGATTATCTATCAATACATGGATGATTTGTATGTAGGATCTGACTTAGAAATAGGGCAGCATAGAATAAAAATAGAGGAATTAAGGGGACACCTCTTGAAGTGGGGATTTACCACACCAGACAAAAAGTATCAGAAAGAACCCCCATTTCTTTGGATGGGTTATGAACTCCATCCTGATAAGTGGACAGTACAGCCTATACATCTGCCAGAAAAGGAAAGCTGGACTGTCAATGATATACAGAAGTTAGTGGGAAAATTAAATTGGGCAAGCCAGATTTATCCAGGAATTAAAGTAAGACAATTATGCAAATGCCTTAGGGGAGCCAAAGCACTGACAGAAGTAATACCACTGACAGCAGAAGCAGAATTAGAACTGGCAGAAAACAGGGAAATACTAAAAGAACCAGTACATGGAGCGTATTATGACCCATCAAAAGACTTAATAGCAGAAATACAGAAACAAGGGCAAGATCAATGGACATATCAAATATATCAAGAACAATATAAAAATCTGAAAACAGGAAAGTATGCGAAAATGAGGGGTACCCACACTAATGATGTAAAACAATTAACAGAGGCAGTGCAGAAAATAGCCCAAGAATGTATAGTAATATGGGGAAAGACTCCTAAATTTAGACTACCCATACAAAAGGAAACATGGGAAACATGGTGGACAGAGTATTGGCAGGCCACCTGGATTCCTGAGTGGGAGTATGTCAACACCCCTCCTTTAGTTAAATTATGGTATCAGTTAGAGAAGGAACCCATAGTAGGAGCAGAAACTTTC;
+END;
+
+BEGIN TREES;
+	TREE tree = ((((D_CD_83_ELI,D_CD_83_NDK),D_UG_94_94UG114),D_CD_84_84ZR085),B_US_83_RF,((B_FR_83_HXB2,B_US_86_JRFL),B_US_90_WEAU160));
+END;
--- a/test-data/busted-out1.json	Tue Apr 20 19:53:39 2021 +0000
+++ b/test-data/busted-out1.json	Tue Apr 27 18:07:06 2021 +0000
@@ -1,73 +1,73 @@
 {
  "Evidence Ratios":{
    "constrained":    [
-[1.766356514902524, 0.9484374805763239, 0.9571091930814299, 1.845676838710576, 1.513819401189324, 2.11256226458989, 7.366103227625151, 3.937756516229049, 2.586067836907899, 0.722379841928909, 0.3151239046214458, 1.502917468627881, 0.6499879033472316, 1.047489715978757, 1.060206108705189, 0.5038296392390414, 0.8532658611088545, 1.114374823999701, 0.5611409841208096, 0.6702870396165613, 0.4604115167079821, 0.3988433224622866, 2.47019807349414, 0.9858342091732886, 1.106653406611749, 1.067348070135177, 1.77412165088655, 1.321424873505688, 1.90457149631063, 0.7888758683589224, 0.7229203540914775, 0.8813401886687667, 0.6954297746421804, 4.613654710605887, 0.4975309466317643, 1.84565076502724, 0.6214894235132998, 0.9480915704528677, 0.9669462933548731, 1.488081789562878, 1.368539685217942, 1.726522735566884, 1.222915324989829, 0.7085094082639855, 0.3168181005885327, 2.290014391709923, 0.6343005734674315, 0.8841633809961478, 1.508078414734822, 2.666352901083321, 1.732923983135172, 3.102011384229053, 1.585109653073893, 3.345181824497555, 7.193115253213268, 3.850321954428519, 3.233128500312913, 1.977820966308441, 2.047653340750355, 0.6643430465826362, 3.624272911205855, 1.67814994913239, 1.752817561416471, 3.277248182160172, 0.3406457937754578, 0.4841828665456315, 1.399775481724447, 0.5510187898414104, 0.6276769404480749, 0.4535822272441153, 0.4226923979745105, 2.950051361271033, 0.9999999999999982, 1.027733519332009, 2.963278030618241, 2.8935730521221, 1.881916301985038, 0.4490192221083247, 3.102588216900087, 0.7028469232610687, 2.792137897266834, 0.3889955246330017, 0.9360790804326219, 0.4572233386404743, 2.908919410553763, 0.8995968442944373, 0.3261344314757346, 1.080257865601265, 1.399763176607792, 1.534646955858424, 0.4277164444783946, 2.361993404905034, 2.175584822495568, 3.122529901767528, 0.4453847841440882, 1.711825080925545, 0.8458710509917922, 2.741896592382772, 0.576439632416141, 1.142294357680513, 0.8086330800808955, 2.943414796294152, 0.833291758377592, 1.615921141634484, 0.7252129604805458, 2.833655116179036, 0.9138779988368123, 0.6174720822006171, 1.834532902825704, 0.2316812685220093, 2.479235579982967, 0.4643862206171616, 6.530720225707355, 0.4975309466317643, 1.158125132567293, 0.2987944638927862, 3.78696693228073, 0.7343025200073082, 1.93339742618843, 0.3642707474760721, 1.028034824972818, 1.511057897004292, 0.2969890376651506, 0.987605711796378, 0.3709886418939366, 4.185741574214752, 3.002372601666337, 0.424383367760914, 0.4658081554322532, 0.4024556436060775, 2.540164510486854, 0.5199349857684811, 0.4626485320487528, 0.9349816613814522, 0.5525607476128181, 0.5855612460554309, 1.85872747574379, 1.064964125964651, 3.177687923317396, 2.593304657270028, 5.234187858164534, 2.966427299030309, 1.920561682721974, 2.245869881969924, 3.811870935099101, 2.099654636695842, 3.369504334172069, 0.6379165155453101, 3.119867019567397, 0.9211859677702382, 2.195241379859611, 1.767535349740496, 1.225677095999665, 1.347676192394215, 1.671173168407676, 1.179430472478473, 1.873629958128968, 1.972321068578892, 1.863249013159319, 1.501711930393218, 2.85458165498371, 0.5332817404709185, 0.7514817421990073, 0.2887801591578705, 1.93925520496415, 0.2163710715496819, 2.457406602553581, 0.4895227461773333, 2.731573653164397, 0.8923840424261161, 0.6288736610053396, 3.562511382204229, 0.8043427141817341, 2.97831687935463, 3.021636055180988, 1.919432168129229, 1.231674183402057, 3.382911261347008, 1.455440822286478, 1.714894279904311, 0.4763853457361669, 0.907985271671091, 0.9191891327337078, 0.8704988461364657, 0.4660185191281315, 0.6176233729242167, 0.9987767701341157] 
+[1.751697313438667, 0.9490151622254345, 0.9575938099872893, 1.827482077500528, 1.505094606485015, 2.088346790071941, 7.070051504373732, 3.867967952992799, 2.545750919582881, 0.7247660693488289, 0.3196737937441124, 1.489449650902744, 0.6530151351740718, 1.04337285373284, 1.058333334239147, 0.5088801718500566, 0.8550055907613735, 1.110381942461004, 0.565683766000719, 0.6740763008813015, 0.4649952970969699, 0.4036426325687712, 2.442336342315371, 0.9859501295040206, 1.104892115806872, 1.062417300927637, 1.753888646580218, 1.31233150141181, 1.885518048500539, 0.7894296553774935, 0.723576644239061, 0.8827532839004689, 0.6984548336173313, 4.520258616283331, 0.501963856483453, 1.807812329244406, 0.6240669422720765, 0.9486848826066486, 0.9673516986934556, 1.479968294590536, 1.364799619489093, 1.709865961585205, 1.218557239747954, 0.7108467425303473, 0.3215450048962207, 2.271412336163041, 0.6355183534074139, 0.8839058954441763, 1.497501825835906, 2.637709102972778, 1.711470421506773, 3.027431470913309, 1.57278424917318, 3.277990564747366, 6.926286311855851, 3.784092751645639, 3.146955337815139, 1.955427417762355, 2.022694964562529, 0.666396825353515, 3.560060598929708, 1.666971860419219, 1.738637096007019, 3.220829375167113, 0.3447106216301303, 0.4881402535027675, 1.387141991322175, 0.5556476307196163, 0.6310295884570762, 0.4580705327203016, 0.4272583872429177, 2.901848650844198, 0.9999999999999991, 1.027519028508734, 2.915165037860989, 2.8354880840935, 1.858569677080054, 0.4521292148676688, 3.009136246768449, 0.705314987368983, 2.743480940643173, 0.3932432097494273, 0.9370673501878248, 0.4620247121091633, 2.83829096947346, 0.9007779218604833, 0.3302046680129435, 1.07627096358673, 1.391320542790854, 1.521972158264955, 0.4323783230969274, 2.334048026570822, 2.149795581008433, 3.074008352247498, 0.4499660997382409, 1.699461664815503, 0.8463586773204229, 2.696688856522739, 0.5804226171984278, 1.135876829610681, 0.8103519829402507, 2.896966803514224, 0.8351241901463535, 1.602690102144888, 0.7282588483860968, 2.78698806913424, 0.9149220061406503, 0.6214951247464974, 1.819052515045006, 0.2353728426618933, 2.441495991316177, 0.4689975029575301, 6.36479070098702, 0.501963856483453, 1.155173566804371, 0.3029791752249296, 3.710694239289469, 0.7371667962152887, 1.911346283016054, 0.3691203298834842, 1.027711744192628, 1.502724363578014, 0.3011502503588185, 0.9854850481813123, 0.3756291290353144, 4.112619261559145, 2.95680467264194, 0.4290868700547413, 0.4685206821924932, 0.4059560116267469, 2.50268310954176, 0.5227540827634783, 0.4671119113495291, 0.9338453011500626, 0.5571522059019809, 0.5886144003589358, 1.839204151926823, 1.060599026952742, 3.125234562282934, 2.54439731915596, 5.066889740057174, 2.915048895304102, 1.905524097635808, 2.212264991895895, 3.738815510070657, 2.074128973780481, 3.31083714843465, 0.6408491718084866, 3.068722634962862, 0.9229478196348808, 2.172843296216792, 1.750529904876356, 1.222415748191823, 1.340180507105605, 1.65676234501901, 1.177884311452671, 1.853985207061093, 1.949028686126, 1.848056555892881, 1.490331787720329, 2.808897643683787, 0.5370047325763545, 0.754447735175597, 0.292920631250886, 1.922199953975427, 0.2194780669088011, 2.411432550287456, 0.4936742969382611, 2.687417056073211, 0.8937719293629136, 0.630203462304753, 3.500554848762429, 0.8047116371904648, 2.9258711565943, 2.978602987543041, 1.892870394871532, 1.224886235480212, 3.334368853761007, 1.443700495825233, 1.7051887541283, 0.480593393899601, 0.907604501104216, 0.9198540076829841, 0.8702783448030316, 0.4699917745647508, 0.6213048344098008, 0.9960464828596589] 
     ],
    "optimized null":    [
-[1.118923161648219, 0.9980202548897937, 0.9997654691276022, 1.028326548692021, 0.7919741374095479, 0.6742163346738066, 0.9701775068012184, 1.781350909123149, 2.014615609490285, 0.9375026657270238, 0.6503469909372603, 1.467509823797021, 1.009616470968526, 1.168421464905222, 0.59794016479865, 0.8088642155191522, 0.9570182332372693, 1.200458035608254, 0.9382406902547993, 0.971502044629861, 0.9494035585701087, 0.8642047320556682, 0.7618657208728498, 0.9877802717728724, 1.196913567892764, 1.219008654454505, 1.195602379971315, 1.386927451387816, 0.9612092240804505, 0.7608092856171619, 0.7774974434748834, 0.882472157999228, 1.287408843481257, 0.77835738564002, 0.9105718870056999, 0.9901735448217958, 0.7939955331410506, 1.000490010159418, 1.004589199921733, 1.297516080632708, 1.03030381955465, 0.8106679119008423, 1.81201409338234, 0.7198749295257847, 0.6994440009800842, 0.8437894137548632, 1.143486692785445, 0.9393973334278157, 0.8256667500261211, 0.7815159607314222, 0.5985208951864024, 0.8535790889335229, 1.025460140178824, 3.820941298927726, 1.291930691854327, 0.9067539623849099, 1.157350624394714, 0.998318955418969, 0.9161866303121252, 0.8876780413980894, 1.109157480575484, 1.092621268372832, 0.8972624848442422, 0.9889106716665784, 0.8341566095527148, 1.038544978108518, 1.714787775296502, 0.9137222760182561, 1.034926570525361, 0.8813745500117369, 0.8349529524516258, 1.213599287773434, 1, 1.089476250837934, 0.8899148576721072, 2.300141517859181, 0.6825541016975851, 1.003665786880968, 1.237110533718188, 1.020075909706045, 1.638150182736532, 0.9011618842606461, 0.9230020461155208, 0.751689080395277, 0.5897676439072257, 0.6404917862661024, 0.7469389376638015, 1.083533646483151, 0.7344437672842805, 1.131725226416453, 0.9190373093865288, 1.470665196381038, 1.267251236251085, 1.076738563303299, 0.9719321192139432, 1.046564634995135, 1.040861206200881, 1.432126587856311, 0.9607511063877517, 1.317983216727182, 1.009193498305615, 1.490294304430241, 0.9453834990966208, 0.9949520064421568, 0.9321847062820814, 1.012192223349541, 1.006095335695502, 1.015717182050207, 1.155947081675256, 0.7426317882836824, 0.8600656083242881, 0.8659102843696671, 2.043199066063688, 0.9105718870056999, 0.7755680708217269, 0.8691797858502243, 1.408772939677855, 0.9935920773928444, 0.776611704010421, 0.7417817446846022, 1.113087499879386, 1.540328788060018, 0.7887000169650941, 0.7125843942768558, 0.803768142354686, 1.030948607017191, 1.106410103708125, 0.8462900614413438, 0.9257201660506196, 0.9862223424699452, 2.874290057428853, 0.9765125041895547, 0.9522206558439166, 0.979008503258283, 0.8163413206500215, 0.7929865064112649, 1.054431661259741, 1.391867727782659, 1.55344883290767, 0.9159617667614252, 1.37597067666192, 1.180188215894089, 0.8980539087871242, 0.8445482715276972, 1.439858975048729, 0.8167533472760263, 1.611375099688448, 0.9949969190225336, 1.453373381083946, 0.8294327035809631, 1.883890801528407, 1.621067636191696, 0.7786019875784795, 1.241031199394852, 0.8699818919359624, 0.8969821406492622, 0.8552871694200248, 1.476143154036665, 0.7328425886346202, 1.12339872066542, 1.055700479953033, 0.8643592588676906, 0.8828252272762036, 0.8310350398630689, 1.509625875333898, 0.8258835645292275, 1.192338427340326, 0.988317199275236, 0.7869748564877793, 1.092663634718098, 1.540873058588039, 1.27733975846824, 1.071338379207414, 1.598643725487392, 2.039697563641063, 1.125982095744282, 0.8865373778453701, 0.896677110067575, 1.480314453817297, 0.6279749170263321, 0.9454481522954102, 0.8270407761576262, 0.924976567928722, 0.9460839037512674, 1.00781396274934, 1.11935672287797, 1.612656256447746] 
+[1.115754847329475, 0.9981043798375602, 0.9996678649277134, 1.027524895296611, 0.7950614097315224, 0.6815044886735678, 0.9660630441693723, 1.768207537367336, 1.995453831253169, 0.9376497008654193, 0.6553491413144868, 1.461081981960806, 1.013114798606584, 1.166859848568389, 0.6014901871758097, 0.8123191197415052, 0.9580261569974873, 1.198185908129791, 0.9405425950826685, 0.971114257615956, 0.9488537673129271, 0.8646610989285944, 0.7646430387003397, 0.9893117681890439, 1.197283659537823, 1.211007891429009, 1.187153808700299, 1.379812109844639, 0.9624959240764994, 0.7612299911652801, 0.7835844165719837, 0.885684857590916, 1.279101118649989, 0.7844909969836256, 0.9105640059139158, 0.987661389211442, 0.7933470171962204, 1.000355360146534, 1.004491368971939, 1.287636006929032, 1.025334362891704, 0.8161200204209572, 1.800919746565827, 0.7201977656989363, 0.7006786063830531, 0.8445748286055409, 1.13557449720856, 0.9408284217407435, 0.8291599938547976, 0.7847367003613621, 0.6044458050342899, 0.8578237870323223, 1.028327328223754, 3.732522507488938, 1.284572434603426, 0.9117994273854937, 1.151534378021883, 1.002963004237252, 0.9184071418215726, 0.8891548248386872, 1.107752217118886, 1.08471556447794, 0.904519273163679, 0.9915866239749839, 0.8379284266222653, 1.039306992564055, 1.699720775349538, 0.9164148538876519, 1.031865543996781, 0.8814594623715953, 0.8357649706134436, 1.211073491981048, 0.9999999999999991, 1.09042273536382, 0.8969295321069349, 2.282699983096541, 0.6906271160345826, 1.004025552082599, 1.229544542202273, 1.020229958793708, 1.635583530470503, 0.9012757793992182, 0.9262513777205981, 0.755045001493049, 0.5956960416334989, 0.6446026033796701, 0.7494241039808305, 1.081919574928575, 0.736166264060359, 1.130809144056797, 0.9190054297705696, 1.465760638675436, 1.264811511728797, 1.077114430307984, 0.9731626619098518, 1.046507786460218, 1.038574549189271, 1.434108431082798, 0.9595323092739115, 1.311940940446743, 1.010601751735099, 1.484849122531978, 0.9467219554462175, 0.9999147957468079, 0.9337530742390975, 1.014803716779695, 1.007462002443472, 1.01533333078764, 1.148263019382676, 0.7422032808770405, 0.8639145321361502, 0.8673930454219201, 2.026916851640757, 0.9105640059139158, 0.7803929380437222, 0.8703888058550368, 1.410247919613535, 0.9914652054039267, 0.7814313499738406, 0.7431099613737392, 1.113679671632678, 1.531754344457596, 0.7916210828345887, 0.7180922698986317, 0.8040633094792566, 1.035367687704656, 1.108843159118376, 0.8485144325155356, 0.9245149419204511, 0.9856066046472061, 2.840752049492474, 0.9719349042983756, 0.9513072209812393, 0.9818577734913401, 0.8190574737799189, 0.7957337116895524, 1.058600036393583, 1.378130836062728, 1.543996499685658, 0.9157765463527018, 1.371864786157317, 1.179088778643788, 0.8990667969958885, 0.8491807688030968, 1.430795716876661, 0.8233279102457327, 1.602054722411324, 0.9947248981278961, 1.450547523094791, 0.8328149332184142, 1.865584692965049, 1.606267608729814, 0.7854775725228893, 1.235086019516011, 0.8715583188734622, 0.9003125968429074, 0.8577816502175432, 1.466928944424435, 0.7382231658168724, 1.118381528668526, 1.062150053798357, 0.8645443140611492, 0.8866230937072818, 0.8323827468669284, 1.495223917742498, 0.8220538187834464, 1.189868122430675, 0.9871334636897435, 0.7944859535178556, 1.0925978798477, 1.52803476753022, 1.276753099905758, 1.069980901551178, 1.586787129488837, 2.015280193477939, 1.124546923383764, 0.8906149060472343, 0.9027629088385779, 1.472050188194838, 0.6332413644351131, 0.9451405108005444, 0.8291877249363551, 0.9274410423803646, 0.9465758585718032, 1.007518685935051, 1.117050744578768, 1.604376953048971] 
     ]
   },
  "Site Log Likelihood":{
    "constrained":    [
-[-10.45729861177352, -3.484017570185021, -3.811593093827024, -18.53808870245015, -17.92309552060635, -29.83947832086448, -32.51456888432799, -26.14022567456645, -18.98957484098232, -10.33347856776535, -16.45292539731993, -23.86010381033633, -20.00687543711394, -16.65179796964098, -21.99232160499268, -12.26652073720412, -10.69225356932102, -15.60314346893525, -11.01132866125176, -8.521297155687831, -8.203139397826641, -11.43545706508415, -24.90046120971902, -13.6386798900763, -14.85763270108216, -14.7030317250254, -22.05138318385674, -15.98662844335023, -21.8003647511144, -18.57068156644835, -22.299055200187, -14.20074227547402, -10.45246619974257, -29.65657150543187, -5.937537382195638, -33.78920222670538, -15.44637827577353, -4.279026884494699, -4.808492102928678, -24.63079311886252, -19.95624962482634, -20.75045752192579, -12.74902310767432, -18.99427847476613, -14.28731466672857, -24.54528292419485, -16.76361995667699, -15.30372003397147, -21.15548703165981, -23.72245288385755, -28.94171761244187, -31.14183824690388, -20.64762811392306, -24.08520562625058, -32.41122173355103, -27.15825647361205, -28.5179867447387, -21.82691317662457, -23.87561847496401, -15.96134254249656, -22.91741429446779, -22.8344267349475, -18.86994129807232, -24.15268806222941, -13.09988257350861, -6.987933615627104, -20.27062516100397, -11.6267899578313, -10.76199226925333, -9.365202828107813, -8.830802980942332, -22.25274148442388, -5.072420031658066, -11.5940578599292, -24.90254274563229, -26.4504338975355, -29.4914117779418, -14.39917492841001, -30.20915692724294, -15.07835940842867, -24.47922859714559, -9.963108156848188, -12.02484522350882, -10.47082266101894, -32.61997541577167, -22.41917549927993, -15.45008408736274, -18.58952738985428, -24.90070817016433, -16.46583864612196, -9.349881275491541, -21.92481437356786, -23.89225210843373, -25.41089239829785, -13.11222485538043, -23.55550258653596, -13.5386142710809, -25.36851139033049, -12.93730850270479, -18.80108927581331, -14.23685164495206, -22.26383266334966, -10.55622492327747, -21.48906087213606, -10.38853588609826, -24.53689740053753, -11.36767104821917, -6.908653364620656, -21.84280151068446, -17.93716231251139, -24.46209768558333, -8.752467536320703, -25.50970610456629, -5.937537382195638, -26.74893035287963, -11.9403240118369, -26.13347920733979, -8.842765208651075, -22.25304376265024, -12.64504365092861, -11.95155411820952, -16.44565617489921, -12.21136817821285, -19.4495506152908, -12.03636955134022, -26.76158975846396, -24.28299039768532, -10.41253856833306, -18.04928878164386, -12.66411737564947, -24.89370230796465, -13.28589560426102, -12.14998856202217, -15.22485748978356, -11.10445442252986, -15.26584291199847, -21.18251113737594, -17.4492424252813, -22.91858352137089, -32.12984803882419, -34.72655653940613, -29.46637589613799, -23.83622026476351, -25.19174747094332, -26.15371116437007, -28.38602800921473, -24.3904479288928, -11.83470465315949, -22.99304711962677, -14.1052741197831, -27.4333232450484, -16.96102482386623, -16.48031664612245, -16.51933846935232, -17.67884199792057, -14.76033658655028, -19.64011886967656, -21.73563121093473, -27.07964360348662, -23.31227029359847, -30.36351219328728, -14.39405059091475, -9.0012985358923, -13.02696101249317, -22.60078004596954, -16.83684027122174, -27.58316083045541, -5.435892920303646, -29.48238449481695, -10.75922123674425, -14.39572297485616, -21.65465418121673, -13.81883365226544, -26.28515446199947, -25.94713203139664, -30.32048162447653, -18.74338069598867, -29.89507747948719, -18.59896471825973, -26.6197512688528, -7.057151084653121, -20.11123180495239, -13.68737039495877, -13.8591446292234, -7.100328940735415, -7.27389954199287, -20.4341543043075] 
+[-10.45090262193947, -3.483902519448886, -3.812918674840162, -18.52967367048658, -17.91293552421441, -29.82234031390563, -32.4682953322895, -26.13136592613271, -18.98353837196509, -10.33536376131518, -16.46521792962993, -23.85656647453301, -20.0097735066148, -16.65014379412616, -21.98016668059303, -12.27360074288172, -10.6941140816234, -15.60391557669279, -11.01584022727405, -8.52552567646616, -8.213958972448863, -11.44408858234599, -24.88483689931558, -13.63702466513553, -14.85783877857095, -14.70130071011686, -22.04314741356357, -15.9841391162467, -21.7894026756885, -18.56582389265503, -22.2970319079228, -14.20013718887272, -10.46062459593404, -29.63172583834114, -5.942895596547681, -33.7608698289049, -15.4453605547865, -4.280368277884408, -4.808122799169091, -24.62846286067449, -19.95038043810364, -20.73996670837995, -12.75582605885885, -18.99209486958509, -14.29899136245764, -24.5323131442472, -16.76719624729421, -15.30050374515202, -21.1470077553502, -23.70452335151525, -28.92097938243611, -31.11127051701743, -20.64056509230148, -24.08245503901272, -32.37575293948952, -27.1397706688597, -28.48714117432097, -21.8157658433444, -23.86066380099029, -15.96179451261716, -22.90078930509975, -22.82780054877238, -18.85863915537205, -24.13596526976866, -13.11062461592573, -6.997019061890909, -20.27078018556115, -11.63234308244865, -10.76772040073618, -9.375030039476741, -8.838080080197956, -22.23813284474415, -5.071925291421929, -11.59502858303457, -24.88722835704511, -26.44848697533541, -29.47226045522432, -14.40683310705516, -30.18120324933559, -15.08227050749874, -24.4722144291366, -9.970786483716564, -12.02451510684466, -10.47801146285196, -32.58390043458385, -22.41272747457295, -15.45732063757284, -18.58799241229831, -24.88853139164258, -16.45692685905665, -9.360428939345834, -21.91694140733639, -23.88498099910663, -25.3962161614738, -13.12135916900047, -23.54673109739056, -13.53887882815504, -25.35896009046736, -12.94299852184595, -18.79824781975578, -14.2386090251928, -22.25439432796464, -10.55845974254318, -21.47824043379306, -10.39206663293596, -24.52508757095106, -11.36803395343945, -6.913098566554392, -21.83429025783947, -17.94930007893821, -24.44667277945298, -8.760710459872854, -25.49076161826261, -5.942895596547681, -26.74335661856266, -11.95479247264214, -26.11935275663087, -8.84576691015538, -22.23961500868496, -12.65473600559412, -11.95172286310796, -16.44673955121138, -12.22327296206971, -19.44139078647339, -12.04821884318743, -26.74230137861179, -24.26902923541198, -10.42122278454815, -18.05639580573808, -12.67270476859209, -24.89079815344573, -13.28852575517897, -12.15758680881002, -15.22362700005587, -11.1087132369094, -15.26580355619412, -21.1714116232631, -17.44878592939348, -22.90508349789376, -32.10916540506811, -34.70167299760255, -29.45222601783585, -23.82489796368972, -25.17657127603625, -26.14089446397534, -28.36631233203936, -24.37577873996561, -11.83810875252699, -22.98051281763511, -14.10620053901725, -27.43594024958254, -16.95410198934557, -16.47464786440968, -16.5154876564325, -17.6698746836033, -14.75877758237345, -19.62594140417327, -21.72627428789965, -27.06861465296137, -23.30295590843949, -30.34866123718632, -14.39953916526644, -9.002852170879979, -13.04044047087386, -22.59571981707717, -16.84927191220984, -27.56793378022781, -5.44310980584226, -29.46507972190871, -10.76293375912305, -14.40381349426134, -21.63861962597842, -13.81954299123125, -26.27612327461895, -25.94071651096489, -30.30727965502338, -18.73706186163648, -29.88139839294296, -18.59623366674176, -26.60843026312014, -7.063609265673095, -20.10755427375394, -13.68702804353427, -13.85651640481543, -7.108876310942952, -7.279280331780171, -20.4371936150988] 
     ],
    "optimized null":    [
-[-10.000746412889, -3.534975268563031, -3.855196330132343, -17.9531754129423, -17.27523311609171, -28.69737251844359, -30.487403824811, -25.3469865397239, -18.73986474128691, -10.5941470716412, -17.17746554049388, -23.83626257910331, -20.44724749063709, -16.76105507711494, -21.41959368469256, -12.7399136042534, -10.80700483642069, -15.67755309754298, -11.52536299421752, -8.892434491135736, -8.926852661062641, -12.20869809997624, -23.72417791244537, -13.64065197048924, -14.93603840556554, -14.8358925422005, -21.65672787001029, -16.03500867314082, -21.11654452541332, -18.53445530201509, -22.37183650032519, -14.20202582413271, -11.06832299336804, -27.87698168792971, -6.541952472626266, -33.16649523981481, -15.69133721810966, -4.332820962725578, -4.846683129097396, -24.49375694739045, -19.67235910587276, -19.99445132707328, -13.14222447425636, -19.010192624522, -15.07927260784268, -23.54687249677092, -17.35293440007094, -15.36431670327766, -20.55308672706422, -22.49522159373395, -27.87861362498808, -29.85147043539681, -20.21211595634147, -24.21818138264384, -30.69423513967148, -25.71221557332896, -27.49066994877449, -21.14323500088168, -23.07138885914685, -16.25115300126723, -21.73336130310753, -22.40531441170235, -18.20030993527343, -22.95453268750557, -13.99546052997636, -7.751046909853225, -20.47360263421817, -12.13254771763505, -11.26205241801605, -10.02950893550899, -9.511533636871842, -21.36450946580444, -5.072420031658067, -11.65239902588355, -23.69961716091314, -26.2209124593937, -28.47720772549854, -15.20352359389407, -29.28969870111495, -15.45085261296868, -23.94598869120682, -10.80322523133013, -12.0107767142687, -10.96797346503774, -31.02416709659281, -22.07946508441355, -16.27875786287543, -18.59255520779903, -24.25576326194178, -16.16128150518837, -10.11474753171002, -21.45102326094385, -23.35180477003816, -24.34618548249837, -13.89257222918985, -23.06345551040454, -13.74605107743702, -24.71902198635289, -13.44815326344599, -18.94415314361011, -14.45841315258903, -21.58323588087952, -10.68243175660201, -21.00409493400298, -10.63960151353855, -23.50744845859135, -11.46380607942174, -7.40636973341585, -21.38093160255466, -19.10200007557443, -23.40340080290285, -9.37553226377444, -24.34770562165953, -6.541952472626266, -26.34796839682552, -13.00811807862387, -25.1446328603122, -9.145170849858582, -21.34095019187551, -13.35620130330373, -12.03104276076478, -16.46484206770943, -13.18805899222384, -19.12316542756082, -12.80950895147612, -25.36038522816893, -23.28470818774974, -11.10276351543467, -18.73608690839096, -13.56041431572836, -25.01727916833232, -13.9161793832148, -12.87181769553462, -15.27087090233286, -11.49472359736922, -15.56907833534053, -20.61562094868151, -17.71694784548008, -22.20290716981454, -31.08913439244855, -33.39050427276854, -28.54469152779638, -23.07607739799698, -24.21370116505611, -25.18013621147851, -27.44183700650422, -23.65277019084076, -12.27923687244804, -22.22914406475213, -14.0003541619513, -27.28037045002411, -16.87452367228698, -16.02656793234758, -16.4368993455096, -17.02603324065743, -14.48658558781633, -18.85592317056478, -21.445852863631, -26.14649750870843, -23.02202321164394, -29.3687914002132, -14.87698920390545, -9.162378872547357, -14.08396726867812, -22.35033791702401, -18.17629921418486, -26.85997070710383, -6.138465689345856, -28.23794764233195, -10.96169835180006, -15.29189705116706, -20.62896804216628, -14.10547218000938, -25.66295172482926, -25.55413515032033, -29.78710785677539, -18.41457433641119, -28.56728137258359, -18.61591042688218, -25.61514478015318, -7.742583058377544, -20.01785764703301, -13.69364689624316, -13.94240945383619, -7.871642437614435, -7.868530143948813, -20.91326095114609] 
+[-9.999848579629438, -3.534335603769343, -3.855918073448204, -17.9538874611, -17.2747438441717, -28.70251512907133, -30.47790138370519, -25.34860297645322, -18.73998421748136, -10.59289124751458, -17.18308498211639, -23.83733702940499, -20.44895802290328, -16.76200145058928, -21.41512627843794, -12.74128144037208, -10.80788115515916, -15.68002019797957, -11.52426196006769, -8.890626497321907, -8.927186376073541, -12.20589630571461, -23.72353563066267, -13.64042840813737, -14.93814645500984, -14.83220690675711, -21.65287069195306, -16.03428112649423, -21.11697461820088, -18.52944869764263, -22.37670423099836, -14.20345263011663, -11.06566694045806, -27.88043644714669, -6.538431672725973, -33.15633700907163, -15.68536363930423, -4.333402162466966, -4.845797260874019, -24.48925018012824, -19.66439158624725, -20.00035787499095, -13.14645599501158, -19.00516386388902, -15.07790314758396, -23.54298939203635, -17.34764924361699, -15.36291392817002, -20.55586733882526, -22.49220554409181, -27.88018322030692, -29.85019937935898, -20.21565116547379, -24.21230871760245, -30.69085508292206, -25.71662926722871, -27.4818010431507, -21.14811566898335, -23.0711185608064, -16.25018056217564, -21.73334467076629, -22.39810962558813, -18.20518596093719, -22.95787740520259, -13.99885201582488, -7.752725709331387, -20.4739986642663, -12.13267790621028, -11.25949129864883, -10.02958587932763, -9.509038565562101, -21.36429199478783, -5.071925291421929, -11.65444684825109, -23.70852394255006, -26.23163183473617, -28.48229802380226, -15.20463784468526, -29.28619398287981, -15.45140934453945, -23.95498653878558, -10.80016950117357, -12.01290561268065, -10.96917043588625, -31.02267359559108, -22.0781027350932, -16.27691301947574, -18.59322700501767, -24.25197878119941, -16.15985332581128, -10.11442001712052, -21.45171161176134, -23.35453134857961, -24.34751944095499, -13.89273816685505, -23.06187826758802, -13.74354001612338, -24.72747877321687, -13.44568802121267, -18.94235060457898, -14.45944155129241, -21.58604323426556, -10.68388474245953, -21.00647169464934, -10.64062211576559, -23.51482131466939, -11.46438470940085, -7.403942742248016, -21.37422487105309, -19.09775242663159, -23.40778038061878, -9.375605229265306, -24.34649611581681, -6.538431672725973, -26.35114829216582, -13.01006841322404, -25.15189928947141, -9.142136580235025, -21.34517917780335, -13.35445734769922, -12.03205769212679, -16.46587355698196, -13.18974649780325, -19.12485490220534, -12.80929455473056, -25.36299788062012, -23.2882373255091, -11.10305048579558, -18.73608477233943, -13.55971725450759, -25.01750357654675, -13.9087034380676, -12.86885500181513, -15.2737626703588, -11.49402903111002, -15.5672968520748, -20.61902598615607, -17.71068017555166, -22.19994834214875, -31.08728870377415, -33.39511680382837, -28.5470813431575, -23.07374293025032, -24.21907120646889, -25.18035634613069, -27.44237031336156, -23.64986467449063, -12.27778083932105, -22.23119250973097, -14.00343928803062, -27.28347817719133, -16.86809667669382, -16.0323554685095, -16.43382396383096, -17.02753688184933, -14.49004446342468, -18.85519821718548, -21.44211421111342, -26.15097096898469, -23.01583971345514, -29.37616433486512, -14.87573482137308, -9.16428613534381, -14.0848311489858, -22.34452545099508, -18.16982547353947, -26.86155526961141, -6.13603907590076, -28.24643921897574, -10.96379664456025, -15.28950849406241, -20.63001835633828, -14.10445507093618, -25.66424230560382, -25.5500203560601, -29.78656547037373, -18.41837074179778, -28.57481966126671, -18.61568017561408, -25.61785082518842, -7.739921293110954, -20.01719213846289, -13.69524229967891, -13.94055442162264, -7.871406957800698, -7.865905721003565, -20.91389045801702] 
     ],
    "unconstrained":    [
-[-9.888379652897939, -3.536956975958899, -3.855430888511407, -17.92524264198113, -17.50845965857853, -29.09157676668757, -30.51768005233528, -24.76961452555787, -18.03943632860708, -10.65868274934065, -17.60771476681289, -23.45269561216572, -20.4376769636146, -16.6054014145564, -21.93385827359542, -12.9520378226385, -10.85093767163684, -15.49484991723633, -11.58911175769067, -8.921346396691311, -8.978773985704009, -12.35464367982677, -23.99616287059628, -13.65294697344841, -14.75629218887099, -14.63785459209203, -21.4780777279763, -15.70791783931325, -21.15610770415758, -18.80782786477065, -22.62351142339454, -14.32705386381445, -10.81569144349841, -28.12755118363321, -6.63563490222878, -33.17637029323138, -15.92201466162742, -4.332331072581934, -4.842104427446767, -24.23330521785812, -19.64250537668504, -20.20434811557675, -12.547785488861, -19.33887041557516, -15.4367421517065, -23.71672482205896, -17.21885230292473, -15.42683344726171, -20.74465076426493, -22.74174129986231, -28.39190746698947, -30.00978751219203, -20.18697452723667, -22.87768457704827, -30.43809737982556, -25.8100997042818, -27.34453650032288, -21.14491746000365, -23.1589240493258, -16.37029916899328, -21.62976060249833, -22.31673476907595, -18.30871676975877, -22.9656839608183, -14.17679464299017, -7.713226235808525, -19.93431330744026, -12.22277632689638, -11.22772194016784, -10.15578153700462, -9.691913536959838, -21.17091890362336, -5.072420031658067, -11.56670194893985, -23.81624664728228, -25.38794180884747, -28.85912121067668, -15.19986450963457, -29.07692025541677, -15.43097556716119, -23.45242102332656, -10.90729559707754, -12.09090054194056, -11.25340596248809, -31.55219374013023, -22.52498406608164, -16.57052970348788, -18.51232761277223, -24.56440510741808, -16.03753828771942, -10.19917609135148, -21.06530844796211, -23.11495459612987, -24.27224885909952, -13.92104154234985, -23.01794248639294, -13.70600262406975, -24.35986152238043, -13.48819316139627, -18.66805044150527, -14.4492616572491, -21.18426226067477, -10.73859637126286, -21.00915571172136, -10.7098258147646, -23.49532996174187, -11.45772924514136, -7.390774787133855, -21.23601161044981, -19.39955500699172, -23.5541474067981, -9.519506237286315, -23.6331888724584, -6.63563490222878, -26.60212792035497, -13.14832336553394, -24.80191379036194, -9.151599391331736, -21.5937649828387, -13.65490152701742, -11.92390507531763, -16.03284617533124, -13.42542822929183, -19.46202235330671, -13.02795338302471, -25.32990587208053, -23.18358755436579, -11.26965663135059, -18.81327019488709, -13.57428776606662, -23.96147346112334, -13.93994710685256, -12.92077618523389, -15.29208585316513, -11.69764632373376, -15.80102740870741, -20.56261903661609, -17.38630131122748, -21.76242965716022, -31.17691504697109, -33.07134484404992, -28.37901759704339, -23.18360257842184, -24.38265454953325, -24.81559103668038, -27.64425513672643, -23.17568227719417, -12.28425251073614, -21.85525674064724, -14.18736746348983, -26.64703123652192, -16.39143870542445, -16.27682322339721, -16.22095669907547, -17.16531612207426, -14.59530491502789, -19.01224116633539, -21.05642015432602, -26.45732185834116, -22.90566454933433, -29.31458689156966, -15.02275599163344, -9.287006901120908, -14.26905058779356, -21.93847606157545, -18.36760069262192, -26.6840542632031, -6.150217270208246, -28.47750662196133, -10.87307993496604, -14.85954787421955, -20.38418844062237, -14.03656349147213, -25.19379612663061, -24.84133360657191, -29.66845222794427, -18.53500632737776, -28.67634082079026, -18.22365589287899, -26.08039983450566, -7.798679287046689, -20.20775892609134, -13.77163377000268, -13.9978334745163, -7.863858845763236, -7.755775978219822, -20.4353782829297] 
+[-9.890317410653219, -3.536233022893474, -3.85625026368956, -17.92673456500613, -17.50407976653743, -29.08596757047699, -30.51242756748906, -24.77863663373813, -18.04911270867274, -10.65727010047667, -17.60567212730394, -23.45815978461676, -20.43592847868088, -16.60768519998243, -21.9234713360606, -12.94914345179085, -10.85076135278797, -15.49921152824752, -11.5855603015069, -8.919937644887968, -8.979686959664745, -12.35131394768199, -23.99188180079542, -13.6511741693905, -14.75809108112158, -14.64075392575073, -21.48131200704493, -15.71233378888117, -21.15520006575576, -18.80226844212963, -22.62058071107572, -14.32484671297345, -10.81950936027501, -28.12315663014189, -6.63212275746709, -33.16875237251921, -15.91685819187105, -4.333046865445894, -4.841315948000512, -24.23644219570189, -19.63937281915182, -20.20355172597554, -12.55815849029599, -19.33339329399536, -15.43360912343386, -23.71191133170305, -17.22051055580043, -15.4239084202805, -20.74320948508744, -22.73461257510765, -28.38362648580198, -30.00355595636499, -20.18771763645436, -22.89522443705173, -30.44042915566087, -25.80896450643621, -27.34070574832697, -21.14515704579125, -23.1562330378798, -16.36766446463329, -21.63101173820942, -22.31679182551859, -18.30553762722511, -22.96632637345011, -14.17567460773119, -7.714171571593938, -19.94353467648899, -12.21996402578803, -11.22812292690234, -10.15576214462901, -9.688446406615418, -21.1727848450384, -5.071925291421929, -11.56788139658788, -23.8173019220834, -25.40627288927275, -28.85245325414149, -15.2006203734581, -29.07955017296254, -15.4313812928555, -23.46298689873945, -10.90411348791657, -12.08951522763595, -11.25014836276909, -31.54069833485993, -22.51722400594995, -16.56536324824294, -18.51449015736655, -24.55827806470882, -16.03691989264587, -10.19888326541777, -21.06933729674679, -23.11960824008805, -24.27323379929944, -13.91994220197101, -23.0164195642338, -13.70569086891633, -24.36693541947492, -13.48699731228228, -18.67084292997368, -14.44889560405677, -21.19073006816119, -10.73863457701958, -21.00655690253262, -10.70916536594832, -23.5001261033595, -11.45695040996968, -7.388725778950405, -21.2359744884371, -19.39588453652134, -23.5540618168286, -9.517868294607256, -23.63998026959247, -6.63212275746709, -26.59910601158946, -13.14888367710742, -24.80813377102439, -9.150708004758682, -21.59180715470589, -13.65136859644867, -11.92438813987756, -16.03945984809169, -13.42341893021988, -19.45601211078778, -13.02737182450041, -25.32824126316957, -23.18492005264431, -11.26731867080138, -18.81457083846118, -13.57421523958925, -23.97343475326927, -13.93716988571839, -12.91877321996798, -15.29207148498773, -11.69363005314582, -15.79578753423454, -20.56207867133534, -17.38995206112281, -21.76557415759171, -31.17527159287139, -33.07894583174475, -28.38233942448484, -23.18014087607957, -24.38255440213001, -24.8221256112489, -27.63677103815755, -23.17857766761929, -12.28306990366699, -21.85925142243789, -14.18638311853461, -26.65990366493676, -16.39418344445917, -16.27381884205222, -16.2226833447466, -17.16500938029794, -14.5950577095621, -19.00860391599289, -21.0589431491008, -26.45448007637202, -22.90395713694845, -29.31586912843093, -15.0212875367872, -9.284621444861237, -14.26829406063716, -21.94224947761382, -18.36577488663612, -26.68771279011595, -6.148989103020872, -28.47649919178767, -10.87523840804787, -14.86552604995768, -20.38569814182948, -14.03681427163925, -25.20253100696378, -24.84926211649333, -29.66918525060677, -18.53421389094812, -28.67711498073234, -18.22902406064756, -26.07475445227853, -7.796342966974589, -20.20450084049472, -13.77056835236659, -13.99545858676251, -7.86391639630019, -7.755213772603022, -20.44115496804752] 
     ]
   },
  "Synonymous site-posteriors":  [
-[0.08576487129701713, 0.2936722378990316, 0.2901632602723997, 0.01635516164580625, 0.0171445713661009, 0.000329807826277061, 2.384037236058195e-06, 0.003474937198538037, 0.1657001102485818, 0.4931122461392571, 0.6116781976326224, 0.1232572132258079, 0.3167287850643093, 0.3360418775747802, 0.09625774163526932, 0.7077210076579118, 0.8230716605433912, 0.4692840075680767, 0.8542599193835906, 0.8678806224860721, 0.7187694305926973, 0.8652759434333591, 0.006733209198735493, 0.5563418685268529, 0.548770039188077, 0.1117221464925625, 0.06375767530950946, 0.2544248885020188, 0.01241307080226442, 0.06415938924723534, 0.0664819611257975, 0.5678603832955883, 0.5701480360753304, 0.01716185680432071, 0.7450690448837864, 4.340363369344909e-06, 0.1054553312659123, 0.2962973099054295, 0.2887729969101556, 0.002139003370945352, 0.009013172357941268, 0.1358034694997206, 0.4571022356539327, 0.03050258030555141, 0.6104018187033817, 0.0009310184681936825, 0.05125568890333056, 0.2012729288816644, 0.02168623857883216, 0.005190644975220393, 0.0003844182663365903, 2.025101452550204e-05, 0.2653166678500586, 0.002736950624682267, 4.330160538654619e-05, 0.002447017669235062, 1.04185776899838e-05, 0.07686655084745994, 0.04255051609568109, 0.07964927182431392, 0.009868735494425898, 0.003987427214854124, 0.1864468621560382, 0.02614830208528422, 0.339871175815004, 0.9584270556742166, 0.1208451401789099, 0.8379535111570964, 0.4399112612280809, 0.6546600093353926, 0.6014957564153406, 0.03692874096493579, 0.2645541257391173, 0.877048492043487, 0.005212760236057918, 0.02626182426280086, 0.0003466347596566336, 0.2143323363123782, 3.94830951316172e-06, 0.4695770030113981, 0.141253166719253, 0.287277996900563, 0.529618089155993, 0.7751260138271018, 1.589794382004903e-06, 0.01061110460382564, 0.06904202423665572, 0.1222752760738798, 0.009436108368219053, 0.1756755023547773, 0.8674741705013883, 0.006953150480735887, 0.01485544007614186, 0.01061671400804696, 0.4622922362107368, 0.006976448397641074, 0.2288428608566239, 0.04492921236889752, 0.4792814192644717, 0.08021780746327278, 0.4272287756026639, 0.04187262145239815, 0.7448375318386113, 0.1041516052437809, 0.7758641911259492, 0.04153272254198651, 0.8730527081784645, 0.9061533002525032, 0.007394637725624075, 0.3286876779500328, 0.003007591552118394, 0.7696698519008212, 0.01472154002347215, 0.7450690448837864, 0.0002833970218347724, 0.4752847620805873, 0.06772419306275075, 0.7916442061973822, 0.04768815546756307, 0.633646799271313, 0.8506170933861232, 0.5333086229236574, 0.4601664067609844, 0.1298585434125494, 0.5258807564626594, 0.004910934759931754, 0.005326392789739794, 0.8568922356649976, 0.1781177185740091, 0.2618990376844352, 0.02043267281856545, 0.1513767944689721, 0.390161257271147, 0.2016761548930196, 0.862737391517766, 0.08518368394903716, 0.08643358463113204, 0.05626956022636653, 0.01204362533281676, 0.0001127787870965998, 9.187529415014566e-05, 0.0291337834475492, 0.00445510836740222, 0.000433375749053344, 0.01045459853680832, 0.02886192573391665, 0.01378875281992316, 0.419096617458437, 0.08903224698878176, 0.6525609111129962, 0.000772784141393912, 0.1484449334606463, 0.3645995750997711, 0.1075676751865187, 0.05248459777601974, 0.760566182374103, 0.09207060671403174, 0.05268528446916099, 0.0009595976424648991, 0.01801675181476272, 0.0003997370600438763, 0.4402401340454297, 0.7531135804916973, 0.4676233954749258, 0.006368990121970666, 0.1181278057317597, 0.0001342462574260838, 0.9089018067832817, 0.0004345263536072176, 0.8867574663987829, 0.3111239693194546, 0.02252285354211625, 0.2512560362419685, 0.02269736493711449, 0.006974745835283193, 0.001246559659240012, 0.1018711078071347, 0.001887551089155725, 0.1122951541441214, 0.003158025675593529, 0.9204927908967985, 0.262934005368038, 0.5690451557167514, 0.2158987219764257, 0.9551133675001365, 0.9600236276711078, 0.02872243122605889],
-  [0.6588352549067005, 0.6300104042707274, 0.6308571396167474, 0.7628498871463081, 0.8812042447619804, 0.6450891271407698, 0.05702739009473294, 0.9052573432113765, 0.8322529842816521, 0.50204312688312, 0.3866851002627893, 0.8747673220745895, 0.6811185218928401, 0.6610720252813483, 0.8929509703524842, 0.2915251071042961, 0.176811569233057, 0.5263591043980159, 0.1456890777980846, 0.1319463960095295, 0.2805572096643838, 0.1345797208549885, 0.9194135193694579, 0.4431254580098209, 0.4501541421700466, 0.8327692240155901, 0.9249414026465288, 0.7390951865327187, 0.8744353425012321, 0.9003053400605937, 0.8607595493014167, 0.4302521815275474, 0.4286513165586879, 0.9642067966077235, 0.2534046915188728, 0.08697751816092071, 0.8792501564264749, 0.629642009566426, 0.6314100395448802, 0.7743277052937813, 0.9104949339617914, 0.840440805697928, 0.5404779055776763, 0.9347773671807053, 0.38755746509272, 0.803369306230527, 0.8966425612886076, 0.7886475139801737, 0.8907941079713984, 0.9190014978832025, 0.3522378332471661, 0.1809014504433939, 0.7336944853537225, 0.679888350179917, 0.1899336275352233, 0.791565555728643, 0.1067866556887754, 0.8860612799729447, 0.9367096223134744, 0.8639495448862111, 0.8782437507986685, 0.8302753492657331, 0.809246382642996, 0.9489076442875167, 0.6454229523694828, 0.04155980960796609, 0.8665041382416315, 0.1619827626792043, 0.5565828858468974, 0.3438258751795431, 0.3942275346898335, 0.9283744290898972, 0.6325830460054775, 0.122929910215236, 0.7522797532502616, 0.8972993534299837, 0.4731648184244552, 0.7708474985702127, 0.1508465096375764, 0.5295553683583388, 0.8547957966471971, 0.7024691755465428, 0.4684299719444062, 0.2244610051764785, 0.06738333747301979, 0.9145680765086048, 0.8503190574296829, 0.8699211983668487, 0.9075726506652723, 0.8125612641935661, 0.1324109903321076, 0.8515026484303992, 0.8666935506701156, 0.9245019813561807, 0.5361574183136518, 0.8308943234035726, 0.7647222555512423, 0.9159763441092864, 0.5190913963288092, 0.8928229399251451, 0.5707529496400237, 0.9343160770300315, 0.2547839947945623, 0.8913151216228844, 0.223496387182918, 0.9013900066737581, 0.126912980063931, 0.0938116230998244, 0.8835051043478275, 0.6624762956118966, 0.6292629647931889, 0.2299240837554979, 0.9695268312861339, 0.2534046915188728, 0.5777582640025832, 0.5191726594909567, 0.9265362606441389, 0.2079933538642454, 0.9349466692539032, 0.3655144546780216, 0.1493401333693624, 0.4664213351146896, 0.5331210003016799, 0.8598519162876399, 0.4720884356129527, 0.8952518575745732, 0.7912019413079115, 0.1429432971101487, 0.7981491417404037, 0.7282408814095576, 0.9567712858079624, 0.8212946734056131, 0.6074315581830233, 0.7856999935768023, 0.1372238635707822, 0.8761504406261441, 0.9040762460981876, 0.9081517064494045, 0.9474670754436387, 0.281231292023929, 0.3390927372020315, 0.9480257660647574, 0.8311989201224447, 0.5366551813586112, 0.9375431236313668, 0.9623354548612517, 0.9580572325538602, 0.5752668110481099, 0.9087426219429084, 0.3468515258883331, 0.7120456179760087, 0.8415949727501237, 0.633421707019731, 0.8728889518506465, 0.8967713999817422, 0.2393218619503596, 0.8909502607437078, 0.9247399939031163, 0.7113741304335964, 0.9516574813231364, 0.6065518446899986, 0.5559651751026748, 0.2462092450152424, 0.5251860236577571, 0.8626393300473802, 0.8553625770855506, 0.4554509237222495, 0.09096122393915286, 0.529780817243299, 0.1132163886582516, 0.6816431744145428, 0.9362134283263105, 0.7412706566370515, 0.9244285156386869, 0.8902138302828968, 0.5906194062496973, 0.8830436003628626, 0.8234964935583747, 0.8823463108045396, 0.8452618508291229, 0.07941357187491897, 0.7357914877268877, 0.4290296557540788, 0.7740804045679049, 0.04487007138865241, 0.03997374347326944, 0.912296929053887],
-  [0.2553998737962824, 0.07631735783024095, 0.07897960011085291, 0.2207949512078856, 0.1016511838719186, 0.3545810650329531, 0.942970225868031, 0.09126771959008544, 0.002046905469766074, 0.004844626977622985, 0.001636702104588283, 0.001975464699602527, 0.002152693042850789, 0.002886097143871596, 0.01079128801224668, 0.0007538852377919047, 0.0001167702235517668, 0.00435688803390722, 5.1002818324778e-05, 0.0001729815043981829, 0.0006733597429191042, 0.0001443357116525265, 0.07385327143180669, 0.0005326734633262727, 0.001075818641876393, 0.05550862949184748, 0.01130092204396166, 0.006479924965262574, 0.1131515866965035, 0.03553527069217096, 0.07275848957278573, 0.001887435176864453, 0.001200647365981756, 0.01863134658795579, 0.001526263597340909, 0.9130181414757098, 0.01529451230761291, 0.07406068052814456, 0.07981696354496427, 0.2235332913352734, 0.08049189368026742, 0.02375572480235134, 0.002419858768391037, 0.03472005251374328, 0.002040716203898256, 0.1956996753012791, 0.05210174980806165, 0.01007955713816182, 0.08751965344976946, 0.07580785714157701, 0.6473777484864973, 0.8190782985420806, 0.0009888467962190556, 0.3173746991954007, 0.8100230708593901, 0.2059874266021218, 0.8932029257335347, 0.03707216917959535, 0.02073986159084442, 0.05640118328947497, 0.1118875137069056, 0.1657372235194127, 0.004306755200965905, 0.02494405362719899, 0.01470587181551327, 1.31347178174259e-05, 0.01265072157945855, 6.372616369940412e-05, 0.003505852925021835, 0.001514115485064287, 0.004276708894825967, 0.03469682994516703, 0.102862828255405, 2.159774127705953e-05, 0.2425074865136805, 0.07643882230721545, 0.5264885468158881, 0.01482016511740909, 0.8491495420529105, 0.0008676286302631026, 0.00395103663354991, 0.01025282755289429, 0.001951938899600739, 0.0004129809964198562, 0.9326150727325982, 0.07482081888756961, 0.08063891833366137, 0.007803525559271599, 0.08299124096650871, 0.01176323345165673, 0.0001148391665040469, 0.1415442010888649, 0.1184510092537426, 0.06488130463577248, 0.001550345475611415, 0.1621292281987863, 0.006434883592133867, 0.0390944435218161, 0.001627184406719129, 0.02695925261158226, 0.002018274757312532, 0.02381130151757035, 0.0003784733668262425, 0.004533273133334742, 0.0006394216911327579, 0.05707727078425542, 3.43117576046495e-05, 3.507664767224504e-05, 0.1091002579265486, 0.008836026438070649, 0.3677294436546928, 0.0004060643436808472, 0.01575162869039373, 0.001526263597340909, 0.4219583389755819, 0.005542578428455856, 0.005739546293110378, 0.0003624399383724484, 0.01736517527853375, 0.0008387460506655657, 4.277324451437318e-05, 0.0002700419616530316, 0.006712592937335689, 0.01028954029981052, 0.002030807924387894, 0.09983720766549499, 0.2034716659023486, 0.0001644672248535993, 0.02373313968558726, 0.009860080906007207, 0.0227960413734721, 0.02732853212541473, 0.002407184545829678, 0.01262385153017814, 3.874491145169847e-05, 0.0386658754248187, 0.009490169270680476, 0.03557873332422891, 0.04048929922354462, 0.7186559291889745, 0.6608153875038184, 0.02284045048769326, 0.1643459715101531, 0.4629114428923355, 0.0520022778318248, 0.00880261940483151, 0.02815401462621663, 0.005636571493453016, 0.002225131068309814, 0.0005875629986705686, 0.2871815978825973, 0.009960093789229935, 0.001978717880497971, 0.01954337296283469, 0.05074400224223814, 0.0001119556755373595, 0.01697913254226044, 0.02257472162772266, 0.2876662719239387, 0.03032576686210087, 0.3930484182499576, 0.003794690851895586, 0.0006771744930604194, 0.007190580867317107, 0.1309916798306492, 0.02650961718268966, 0.5444148300203245, 0.0001369692775655127, 0.4697846564030937, 2.614494296533173e-05, 0.007232856266002665, 0.0412637181315732, 0.007473307120980099, 0.05287411942419848, 0.10281142388182, 0.4081340340910627, 0.01508529183000272, 0.1746159553524696, 0.005358535051338847, 0.1515801234952836, 9.36372282825981e-05, 0.00127450690507435, 0.001925188529169687, 0.01002087345566931, 1.656111121114513e-05, 2.628855622720807e-06, 0.05898063972005398] 
+[0.6590420682141636, 0.6295262952117998, 0.6303856865370306, 0.7651708815907992, 0.8822084774809541, 0.6463878945255449, 0.05670925821127412, 0.9065880565181345, 0.8313877625727055, 0.5008097537233324, 0.3827028155918334, 0.8741668571674565, 0.6785611443171407, 0.6592269988543858, 0.8934109043144369, 0.2898485544301485, 0.1752690860478696, 0.5237553031185891, 0.1438583959125483, 0.1310481754808935, 0.2782000142626717, 0.1326603115533762, 0.9202844322281382, 0.4423979179896382, 0.4479578734222657, 0.8331602216928046, 0.925163725370258, 0.7381010022271582, 0.8760396800736433, 0.9007107726896093, 0.8616719133142033, 0.429318638666869, 0.427221193776739, 0.9646106201610571, 0.2521158347717649, 0.08679404343699054, 0.8791675458832844, 0.629151430043082, 0.6309399626011464, 0.7773892793695361, 0.911747762174925, 0.8406524716876108, 0.5384380892981991, 0.9355402336009301, 0.3834858892943144, 0.8056298368250397, 0.8976220110421324, 0.7877202353863311, 0.8919996668839869, 0.919705598959816, 0.3525779358136313, 0.1806859168593065, 0.7335566438646067, 0.6837189356889364, 0.1887528496215639, 0.7930815508520332, 0.1064227299060983, 0.8862924753363561, 0.9370309940701347, 0.8646550974880528, 0.8790909163593805, 0.8334691601726457, 0.8090002820495114, 0.9493479317981891, 0.643279137499093, 0.04082058885229868, 0.8658866867002749, 0.160001761068033, 0.5542784925796955, 0.3412581912517945, 0.3915136973392245, 0.9289484814870412, 0.6321791898264182, 0.1215195300290875, 0.7545656400684584, 0.8987389979543963, 0.4741316117530976, 0.7694841080735656, 0.1503068855058662, 0.527100842548382, 0.8538952483000255, 0.7010382439666797, 0.4675076722121743, 0.2219386697671104, 0.0673963342718981, 0.916001585621829, 0.851572145102629, 0.8697783185834219, 0.9093904942772238, 0.8122276217738864, 0.1302818240907984, 0.8532983433628731, 0.8681669010866113, 0.925606685349572, 0.5332251731370758, 0.8326655111978812, 0.7636853657679995, 0.9166475703028997, 0.5177756387836665, 0.8929964503319083, 0.5684339147070099, 0.9346722912515401, 0.253062138148439, 0.8907895575117083, 0.2217508534552121, 0.902154690335745, 0.1255139411661346, 0.09284933655314186, 0.8854084148486325, 0.6591556884674684, 0.6311072237304626, 0.2275766794873746, 0.9698271069023099, 0.2521158347717649, 0.5797595970139706, 0.5159911744822987, 0.9264165580831163, 0.2064195936853306, 0.9351559780006461, 0.3618435718977148, 0.1476766883148213, 0.4643540168121424, 0.5299736797978728, 0.859593764540069, 0.4684915458291029, 0.8960255042184201, 0.791713911497042, 0.1407003329894658, 0.7970189537714087, 0.7264738512114783, 0.9572821678630518, 0.8206779898514492, 0.6048512888727763, 0.7848399280841521, 0.1354695705305201, 0.876512495275497, 0.9037407480457214, 0.9086423009749222, 0.9481679440397182, 0.2817024062858178, 0.3391850707553216, 0.9483975919621521, 0.8327579573392221, 0.5363393536531582, 0.9386144376156097, 0.9625243792623214, 0.9585332162064392, 0.5728399516322858, 0.908818065422233, 0.3460193016854158, 0.7147896212869103, 0.8413769024552699, 0.6332901745005061, 0.8731249413033565, 0.897415228319015, 0.2375555670442387, 0.8911247286857046, 0.9250752271724603, 0.7129647593506242, 0.9522882419163263, 0.608915685087283, 0.5539252055276097, 0.244585468659001, 0.5218228361825763, 0.8651698499508601, 0.8546403232680236, 0.4567005108355059, 0.08986346650023433, 0.5309401738889369, 0.1119994110349295, 0.6793255623714524, 0.9367017183901303, 0.7398006182861786, 0.9254944521997526, 0.8914543038239114, 0.5915451341046691, 0.8828230293771862, 0.8253644148278831, 0.8818849284868315, 0.8469122381742665, 0.07842884343421058, 0.7347338880160806, 0.4273250135054775, 0.7729749543377356, 0.0441287679444981, 0.03939360753340206, 0.913447436171324],
+  [0.2548059128700653, 0.07575394180863826, 0.07841949610132874, 0.2183464962709025, 0.1006670759949091, 0.3532824486382332, 0.9432883712267999, 0.08992863388772611, 0.001974472834862997, 0.004693076713445249, 0.001541968400693699, 0.001906321637908711, 0.002067575829753574, 0.00277290738529337, 0.01061698837402555, 0.0007205145207030305, 0.0001106812552033643, 0.004194917695983845, 4.785648754161972e-05, 0.0001649795194617654, 0.0006385642594312933, 0.0001343596935877354, 0.07298534944525173, 0.0005142400827715665, 0.001033196057862116, 0.05443053130322333, 0.0110279017015023, 0.006295099828154693, 0.1114827388456945, 0.03464971093576047, 0.07148060525787228, 0.001826796216604849, 0.00115176751565306, 0.01826368404588752, 0.00146700810621202, 0.9132016262738031, 0.01487306905206791, 0.07350227892135838, 0.07924660568572314, 0.220448971120644, 0.07921591222230702, 0.02325115413105475, 0.002338365525084445, 0.03390933129962609, 0.001924569061516209, 0.1934359057193492, 0.05066433063901594, 0.009791168493266059, 0.0862360189071557, 0.07511822878668947, 0.647037069082898, 0.8192938839855993, 0.0009524952524965365, 0.3135108983306193, 0.8112041978408995, 0.2044657628960425, 0.893566918656112, 0.03661091936124507, 0.02018364167430978, 0.05510274371092211, 0.1110470336593714, 0.1625056864787209, 0.004220667036113341, 0.02449010906318826, 0.01420146105439874, 1.218239057009355e-05, 0.01217566565790062, 5.967256014800797e-05, 0.003377588823932065, 0.00144201790563899, 0.004106787320422196, 0.03409211571956682, 0.1023170939677617, 2.024940947348321e-05, 0.2401962030926485, 0.07465230914721981, 0.5255210916473219, 0.01430992878722106, 0.8496891988811796, 0.0008263657392074046, 0.003811994607524969, 0.009899762571679077, 0.001897163664766378, 0.0003895444412942559, 0.9326020754649009, 0.07332124086182071, 0.07876708381532721, 0.007593167507380162, 0.08109390902694207, 0.01150220284122374, 0.0001068954307611358, 0.1397126431020345, 0.116897243588615, 0.06373683228264838, 0.001477063473647544, 0.1603419073791432, 0.006252946692834623, 0.03822377101065472, 0.001564529597146644, 0.02630865621376109, 0.001937385068883362, 0.02344264926816365, 0.0003608048117606154, 0.00439652934760935, 0.0006132092840562507, 0.05609506471149763, 3.222975570899437e-05, 3.298447131704098e-05, 0.1071408275827107, 0.008389592920554495, 0.3658713419592576, 0.0003836644318942201, 0.0154418969896028, 0.00146700810621202, 0.4199566326828601, 0.005290779887023487, 0.005601165990336834, 0.0003465676054746508, 0.01695068770483135, 0.0007888334817280919, 4.019755297084685e-05, 0.000257233239696642, 0.00641016986370742, 0.01007947552395773, 0.001926194304301807, 0.0990579122227388, 0.2029715521525786, 0.0001534711152938896, 0.022853667173833, 0.009503019344917743, 0.02221715661078068, 0.02648623197833246, 0.002298513739015609, 0.0123015920280185, 3.62206489591339e-05, 0.03776177341422494, 0.009202034016170254, 0.03475226912293359, 0.03972671492314912, 0.7181840822596014, 0.6607229937135094, 0.02225500720744548, 0.1627674796251149, 0.4632296040490493, 0.05087234197325657, 0.008597944062751987, 0.02764264895090687, 0.005444288019734069, 0.002166915494793255, 0.0005652492294085686, 0.2844331023365414, 0.009716360525106502, 0.001933172785401054, 0.01916140342833262, 0.0498368157991825, 0.0001061400191817122, 0.01668105211625924, 0.02186219683342442, 0.286075737255138, 0.02957656482283962, 0.3906823731474425, 0.003646619369260028, 0.0006503201097074237, 0.006866695803878058, 0.128411385510635, 0.02529046263357605, 0.5431649595823219, 0.0001295968024717857, 0.4686242786669976, 2.457268967041805e-05, 0.006951097038262886, 0.040741109168412, 0.007231150071612593, 0.05161065858320939, 0.1015436964867685, 0.4072081440937386, 0.01471997957948087, 0.1727426049271184, 0.005170073067439303, 0.1499368842971476, 8.824447363230611e-05, 0.001225387797452016, 0.001859485148828998, 0.00973084716656689, 1.536928208044389e-05, 2.436480520943331e-06, 0.05762972409721398],
+  [0.08615201891577115, 0.294719762979562, 0.2911948173616405, 0.01648262213829845, 0.01712444652413669, 0.0003296568362220048, 2.370561926018262e-06, 0.003483309594139364, 0.1666377645924315, 0.4944971695632224, 0.615755216007473, 0.1239268211946347, 0.3193712798531057, 0.3380000937603209, 0.09597210731153759, 0.7094309310491486, 0.8246202326969269, 0.4720497791854272, 0.8560937475999101, 0.8687868449996448, 0.721161421477897, 0.8672053287530361, 0.006730218326610161, 0.5570878419275902, 0.5510089305198722, 0.1124092470039721, 0.06380837292823981, 0.255603897944687, 0.01247758108066221, 0.06463951637463027, 0.06684748142792442, 0.5688545651165263, 0.571627038707608, 0.01712569579305543, 0.7464171571220229, 4.330289206334114e-06, 0.1059593850646479, 0.2973462910355595, 0.2898134317131303, 0.002161749509819791, 0.009036325602767977, 0.1360963741813345, 0.4592235451767165, 0.0305504350994439, 0.6145895416441695, 0.000934257455611137, 0.0517136583188517, 0.2024885961204029, 0.02176431420885732, 0.00517617225349442, 0.0003849951034706128, 2.019915509414192e-05, 0.2654908608828966, 0.002770165980444209, 4.295253753668126e-05, 0.002452686251924292, 1.035143778976878e-05, 0.07709660530239872, 0.04278536425555551, 0.08024215880102509, 0.009862049981248162, 0.004025153348633382, 0.1867790509143752, 0.02616195913862262, 0.3425194014465082, 0.9591672287571313, 0.1219376476418244, 0.839938566371819, 0.4423439185963724, 0.6572997908425664, 0.6043795153403534, 0.03695940279339195, 0.2655037162058199, 0.878460220561439, 0.00523815683889315, 0.02660869289838387, 0.0003472965995805571, 0.2162059631392134, 3.915612954198521e-06, 0.4720727917124106, 0.1422927570924497, 0.2890619934616412, 0.5305951641230594, 0.7776717857915953, 1.590263200947959e-06, 0.01067717351635039, 0.06966077108204383, 0.122628513909198, 0.009515596695834129, 0.1762701753848898, 0.8696112804784405, 0.006989013535092396, 0.01493585532477367, 0.01065648236777971, 0.4652977633892768, 0.0069925814229755, 0.2300616875391659, 0.04512865868644578, 0.4806598316191869, 0.08069489345433063, 0.4296287002241067, 0.04188505948029637, 0.7465770570398003, 0.1048139131406824, 0.7776359372607317, 0.04175024495275743, 0.8744538290781564, 0.9071176789755411, 0.007450757568656826, 0.3324547186119771, 0.00302143431027981, 0.7720396560807312, 0.01473099610808742, 0.7464171571220229, 0.0002837703031692917, 0.4787180456306779, 0.06798227592654692, 0.7932338387091947, 0.04789333429452255, 0.6373675946205571, 0.8522831141322078, 0.5353887499481609, 0.4636161503384199, 0.1303267599359733, 0.5295822598665952, 0.004916583558841202, 0.00531453635037949, 0.8591461958952403, 0.1801273790547582, 0.2640231294436038, 0.02050067552616764, 0.1528357781702183, 0.3928501973882081, 0.2028584798878294, 0.8644942088205207, 0.08572573131027804, 0.08705721793810832, 0.05660542990214418, 0.01210534103713276, 0.0001135114545804652, 9.193553116902996e-05, 0.02934740083040224, 0.004474563035662842, 0.0004310422977926142, 0.01051322041113382, 0.0288776766749267, 0.01382413484265393, 0.4217157603479801, 0.08901501908297373, 0.6534154490851757, 0.0007772763765484529, 0.1489067370196236, 0.3647766527140929, 0.1077136552683109, 0.0527479558818025, 0.7623382929365795, 0.09219421919803619, 0.05306257599411537, 0.0009595033942378324, 0.01813519326083406, 0.0004019417652746559, 0.4424281751031302, 0.7547642112312916, 0.4713104680135458, 0.006418764538505052, 0.1200692140984003, 0.000134529582172131, 0.9100069366972939, 0.0004355474440655466, 0.8879760162754001, 0.3137233405902848, 0.0225571724414577, 0.2529682316422089, 0.0228948892170381, 0.007001999689320019, 0.001246721801592243, 0.1024569910433331, 0.001892980244998611, 0.112944998445729, 0.00315087752858573, 0.9214829120921572, 0.2640407241864675, 0.5708155013456935, 0.2172941984956976, 0.9558558627734214, 0.960603955986077, 0.02892283973146204] 
   ],
  "analysis":{
    "authors":"Sergei L Kosakovsky Pond",
    "citation":"*Gene-wide identification of episodic selection*, Mol Biol Evol. 32(5):1365-71",
    "contact":"spond@temple.edu",
-   "info":"BUSTED (branch-site unrestricted statistical test of episodic diversification) uses a random effects branch-site model fitted \njointly to all or a subset of tree branches in order to test for alignment-wide evidence of episodic diversifying selection. \nAssuming there is evidence of positive selection (i.e. there is an omega > 1),  BUSTED will also perform a quick evidence-ratio \nstyle analysis to explore which individual sites may have been subject to selection. v2.0 adds support for synonymous rate variation, \nand relaxes the test statistic to 0.5 (chi^2_0 + chi^2_2). Version 2.1 adds a grid search for the initial starting point.\nVersion 2.2 changes the grid search to LHC, and adds an initial search phase to use adaptive Nedler-Mead. Version 3.0 implements the option\nfor branch-site variation in synonymous substitution rates\n",
+   "info":"BUSTED (branch-site unrestricted statistical test of episodic diversification) uses a random effects branch-site model fitted \njointly to all or a subset of tree branches in order to test for alignment-wide evidence of episodic diversifying selection. \nAssuming there is evidence of positive selection (i.e. there is an omega > 1),  BUSTED will also perform a quick evidence-ratio \nstyle analysis to explore which individual sites may have been subject to selection. v2.0 adds support for synonymous rate variation, \nand relaxes the test statistic to 0.5 (chi^2_0 + chi^2_2). Version 2.1 adds a grid search for the initial starting point.\nVersion 2.2 changes the grid search to LHC, and adds an initial search phase to use adaptive Nedler-Mead. Version 3.0 implements the option\nfor branch-site variation in synonymous substitution rates. Version 3.1 adds HMM auto-correlation option for SRV, and binds SRV distributions for multiple branch sets\n",
    "requirements":"in-frame codon alignment and a phylogenetic tree (optionally annotated with {})",
-   "version":"3.0"
+   "version":"3.1"
   },
  "background":0,
  "branch attributes":{
    "0":{
      "Baboon":{
-       "MG94xREV with separate rates for branch sets":0.001771850913718116,
-       "Nucleotide GTR":0.00167976779100812,
-       "constrained":0.0005055252388761481,
+       "MG94xREV with separate rates for branch sets":0.001772434847524003,
+       "Nucleotide GTR":0.001680040630127455,
+       "constrained":0.001513413708231178,
        "original name":"Baboon",
-       "unconstrained":0.0005398732671668005
+       "unconstrained":0.00161713005248515
       },
      "Cat":{
-       "MG94xREV with separate rates for branch sets":0.2738959056554072,
-       "Nucleotide GTR":0.266075486389923,
-       "constrained":0.1152712488116292,
+       "MG94xREV with separate rates for branch sets":0.2735065373507703,
+       "Nucleotide GTR":0.2660909938917123,
+       "constrained":0.3466844629529476,
        "original name":"Cat",
-       "unconstrained":0.120218071527276
+       "unconstrained":0.3607268493024173
       },
      "Chimp":{
-       "MG94xREV with separate rates for branch sets":0.001827968855137289,
-       "Nucleotide GTR":0.001817801565830578,
-       "constrained":0.0006181497274348637,
+       "MG94xREV with separate rates for branch sets":0.001828401123834132,
+       "Nucleotide GTR":0.001818373670119325,
+       "constrained":0.001854421055569225,
        "original name":"Chimp",
-       "unconstrained":0.0006183542388399873
+       "unconstrained":0.001853794709397617
       },
      "Cow":{
-       "MG94xREV with separate rates for branch sets":0.2477119781238836,
-       "Nucleotide GTR":0.2480176045457076,
-       "constrained":0.1036665344622347,
+       "MG94xREV with separate rates for branch sets":0.2477981038577003,
+       "Nucleotide GTR":0.2481025999892287,
+       "constrained":0.3115800338446564,
        "original name":"Cow",
-       "unconstrained":0.1088268022245659
+       "unconstrained":0.3266266518611717
       },
      "Horse":{
-       "MG94xREV with separate rates for branch sets":0.211203801568566,
-       "Nucleotide GTR":0.2090856782081004,
-       "constrained":0.08236651201101133,
+       "MG94xREV with separate rates for branch sets":0.21116782461044,
+       "Nucleotide GTR":0.2090310577070883,
+       "constrained":0.2473423214593362,
        "original name":"Horse",
-       "unconstrained":0.08564084427400141
+       "unconstrained":0.2568895651944081
       },
      "Human":{
        "MG94xREV with separate rates for branch sets":0,
@@ -77,68 +77,68 @@
        "unconstrained":0
       },
      "Mouse":{
-       "MG94xREV with separate rates for branch sets":0.1200702443392807,
-       "Nucleotide GTR":0.1181301915748399,
-       "constrained":0.04601717170435755,
+       "MG94xREV with separate rates for branch sets":0.1200804161847832,
+       "Nucleotide GTR":0.1180171198334285,
+       "constrained":0.1381882260320684,
        "original name":"Mouse",
-       "unconstrained":0.04942545223877414
+       "unconstrained":0.1482500840848965
       },
      "Node1":{
-       "MG94xREV with separate rates for branch sets":0.2837967450491412,
-       "Nucleotide GTR":0.2767871391397028,
-       "constrained":0.1295742765519239,
-       "unconstrained":0.1515367890887531
+       "MG94xREV with separate rates for branch sets":0.2841417945012228,
+       "Nucleotide GTR":0.2767237570684924,
+       "constrained":0.3893703941610758,
+       "unconstrained":0.4535373691584812
       },
      "Node12":{
-       "MG94xREV with separate rates for branch sets":0.01788296579298991,
-       "Nucleotide GTR":0.01784443144961206,
-       "constrained":0.005338125135456628,
-       "unconstrained":0.00572208893382143
+       "MG94xREV with separate rates for branch sets":0.01789005959388253,
+       "Nucleotide GTR":0.01784803874223016,
+       "constrained":0.01603697675468384,
+       "unconstrained":0.01716581823757766
       },
      "Node2":{
-       "MG94xREV with separate rates for branch sets":0.06423714540466627,
-       "Nucleotide GTR":0.06616183769400197,
-       "constrained":0.02253286838656328,
-       "unconstrained":0.02248978054488407
+       "MG94xREV with separate rates for branch sets":0.06425321743363792,
+       "Nucleotide GTR":0.06613162123865737,
+       "constrained":0.06766882319669908,
+       "unconstrained":0.06748821329187271
       },
      "Node3":{
-       "MG94xREV with separate rates for branch sets":0.1017201477652066,
-       "Nucleotide GTR":0.09890202668045614,
-       "constrained":0.04280347934583096,
-       "unconstrained":0.04618990784049085
+       "MG94xREV with separate rates for branch sets":0.1017634409613201,
+       "Nucleotide GTR":0.09886326330774685,
+       "constrained":0.128627313187861,
+       "unconstrained":0.1385358286963005
       },
      "Node8":{
-       "MG94xREV with separate rates for branch sets":0.1096720572321177,
-       "Nucleotide GTR":0.10624077635158,
-       "constrained":0.04415239867414091,
-       "unconstrained":0.04768889036449767
+       "MG94xREV with separate rates for branch sets":0.1095532710088725,
+       "Nucleotide GTR":0.106239268140425,
+       "constrained":0.1326559254556453,
+       "unconstrained":0.1430782720540034
       },
      "Node9":{
-       "MG94xREV with separate rates for branch sets":0.02591275475412757,
-       "Nucleotide GTR":0.02566524291670843,
-       "constrained":0.00997308939110993,
-       "unconstrained":0.009841415288506062
+       "MG94xREV with separate rates for branch sets":0.02590764371262369,
+       "Nucleotide GTR":0.02566573875750134,
+       "constrained":0.02991066003065707,
+       "unconstrained":0.02952913741456189
       },
      "Pig":{
-       "MG94xREV with separate rates for branch sets":0.1928073761020463,
-       "Nucleotide GTR":0.1871746592118726,
-       "constrained":0.07816490289585476,
+       "MG94xREV with separate rates for branch sets":0.1925158663261413,
+       "Nucleotide GTR":0.1871893456388788,
+       "constrained":0.2351007649069627,
        "original name":"Pig",
-       "unconstrained":0.08275992348314189
+       "unconstrained":0.248176820169511
       },
      "Rat":{
-       "MG94xREV with separate rates for branch sets":0.06698958986289986,
-       "Nucleotide GTR":0.06656862018951525,
-       "constrained":0.02277034233250765,
+       "MG94xREV with separate rates for branch sets":0.06699144002108472,
+       "Nucleotide GTR":0.06661283005976348,
+       "constrained":0.06832918896283274,
        "original name":"Rat",
-       "unconstrained":0.02372534359054489
+       "unconstrained":0.07114161288708017
       },
      "RhMonkey":{
-       "MG94xREV with separate rates for branch sets":0.003717482368324115,
-       "Nucleotide GTR":0.003775504255522691,
-       "constrained":0.001359450941376631,
+       "MG94xREV with separate rates for branch sets":0.003716234330029482,
+       "Nucleotide GTR":0.003775170135617877,
+       "constrained":0.004078975866589158,
        "original name":"RhMonkey",
-       "unconstrained":0.00132482447204072
+       "unconstrained":0.003977618821878279
       }
     },
    "attributes":{
@@ -174,35 +174,35 @@
   },
  "fits":{
    "Constrained model":{
-     "AIC-c":6918.851822592964,
-     "Log Likelihood":-3419.573452280089,
+     "AIC-c":6918.865252134614,
+     "Log Likelihood":-3419.580167050914,
      "Rate Distributions":{
        "Synonymous site-to-site rates":{
          "0":{
-           "proportion":0.3289898788632067,
-           "rate":0.3124849036133048
+           "proportion":0.3286044813984554,
+           "rate":0.3114745230555425
           },
          "1":{
-           "proportion":0.5748197734913485,
-           "rate":1.039520868895482
+           "proportion":0.5759073485616787,
+           "rate":1.038727366194607
           },
          "2":{
-           "proportion":0.09619034764544485,
-           "rate":3.115265578623139
+           "proportion":0.09548817003986594,
+           "rate":3.135858111155513
           }
         },
        "Test":{
          "0":{
            "omega":0,
-           "proportion":0.02093092071081848
+           "proportion":0.1610337459523823
           },
          "1":{
-           "omega":0,
-           "proportion":0.1387433808480476
+           "omega":0.9239856235614761,
+           "proportion":0
           },
          "2":{
            "omega":1,
-           "proportion":0.8403256984411339
+           "proportion":0.8389662540476177
           }
         }
       },
@@ -210,129 +210,129 @@
      "estimated parameters":39
     },
    "MG94xREV with separate rates for branch sets":{
-     "AIC-c":6997.089050462658,
+     "AIC-c":6997.104847699299,
      "Equilibrium frequencies":      [
-[0.04875339327772683],
-      [0.03982858547830345],
-      [0.04946803524790992],
-      [0.04152216138298744],
-      [0.01811683453600613],
-      [0.01480036248560469],
-      [0.0183823965708893],
-      [0.01542969784826435],
-      [0.01894694796506697],
-      [0.01547851515238824],
-      [0.01922467805342367],
-      [0.01613668666381816],
-      [0.02832099415740372],
-      [0.02313654621336914],
-      [0.02873613184734657],
-      [0.02412034959764736],
-      [0.01662182431200483],
-      [0.01357902918971745],
-      [0.01686547203528639],
-      [0.01415643148428886],
-      [0.006176695005242439],
-      [0.005045987744654046],
-      [0.006267234867003878],
-      [0.005260551308914496],
-      [0.006459711194459957],
-      [0.005277194922783805],
-      [0.006554399593040238],
-      [0.005501589790395056],
-      [0.009655668202293983],
-      [0.007888099278638223],
-      [0.009797203904398108],
-      [0.008223514024394991],
-      [0.03326722643528176],
-      [0.02717732003095303],
-      [0.03375486749252685],
-      [0.02833294365668738],
-      [0.01236215156074466],
-      [0.01009913314808799],
-      [0.01254335971371867],
-      [0.01052856463184265],
-      [0.01292858539344675],
-      [0.0105618754683007],
-      [0.0131180965046964],
-      [0.01101098350431497],
-      [0.0193250328267319],
-      [0.01578738770911659],
-      [0.0196083049972345],
-      [0.01645869298147252],
-      [0.01962343746171723],
-      [0.02045785777700414],
-      [0.008926115885166477],
-      [0.007292098982657142],
-      [0.009056957588961733],
-      [0.007602170831388156],
-      [0.007626222986467745],
-      [0.009471947420992787],
-      [0.007950502328516303],
-      [0.01395367801862353],
-      [0.01139931439306339],
-      [0.01415821524731906],
-      [0.01188403168729233] 
+[0.04876086397632926],
+      [0.03982224127745371],
+      [0.0494959405650269],
+      [0.04152830682371345],
+      [0.01810345074594235],
+      [0.01478480742075003],
+      [0.01837636270304883],
+      [0.01541821854326533],
+      [0.01892910005547028],
+      [0.01545910240515689],
+      [0.01921445878706794],
+      [0.01612140169177368],
+      [0.02829747763884322],
+      [0.02311011106415996],
+      [0.02872406592369408],
+      [0.02410019507229243],
+      [0.01663805943190806],
+      [0.01358804506433061],
+      [0.01688888041768248],
+      [0.01417018446135155],
+      [0.006177213955434187],
+      [0.005044834822351987],
+      [0.006270336287397383],
+      [0.00526096577332031],
+      [0.006458939937330408],
+      [0.005274916061901906],
+      [0.006556309326397028],
+      [0.005500904159606446],
+      [0.009655594186286731],
+      [0.007885574003572761],
+      [0.009801153568494354],
+      [0.008223407979974132],
+      [0.03327785448210915],
+      [0.02717750758119989],
+      [0.03377952261833742],
+      [0.02834184710178207],
+      [0.01235507229404208],
+      [0.01009019590244688],
+      [0.01254132667213156],
+      [0.01052248035033209],
+      [0.01291855364640413],
+      [0.01055038238273567],
+      [0.01311330258173711],
+      [0.01100238215235291],
+      [0.01931219560697892],
+      [0.0157719705998612],
+      [0.01960332955558842],
+      [0.01644767379420349],
+      [0.01965132601881859],
+      [0.02049322866376102],
+      [0.008933621043463411],
+      [0.007295949736387736],
+      [0.009068296583349953],
+      [0.007608523013862737],
+      [0.007628698224327205],
+      [0.009481877006094248],
+      [0.00795552712159237],
+      [0.01396413011303752],
+      [0.01140428846505027],
+      [0.01417464125436193],
+      [0.01189287130232129] 
       ],
-     "Log Likelihood":-3467.004808147542,
+     "Log Likelihood":-3467.012706765863,
      "Rate Distributions":{
        "non-synonymous/synonymous rate ratio for *test*":        [
-[0.9950576192409499, 1] 
+[0.9959842858928788, 1] 
         ]
       },
      "display order":1,
      "estimated parameters":31
     },
    "Nucleotide GTR":{
-     "AIC-c":7112.85745601076,
+     "AIC-c":7112.857310169033,
      "Equilibrium frequencies":      [
 [0.3592490842490842],
       [0.181959706959707],
       [0.240018315018315],
       [0.2187728937728937] 
       ],
-     "Log Likelihood":-3532.321297387654,
+     "Log Likelihood":-3532.32122446679,
      "Rate Distributions":{
-       "Substitution rate from nucleotide A to nucleotide C":0.5497129763145497,
+       "Substitution rate from nucleotide A to nucleotide C":0.5501644800943087,
        "Substitution rate from nucleotide A to nucleotide G":1,
-       "Substitution rate from nucleotide A to nucleotide T":0.264666902964203,
-       "Substitution rate from nucleotide C to nucleotide G":0.4916303643305098,
-       "Substitution rate from nucleotide C to nucleotide T":1.027924764411573,
-       "Substitution rate from nucleotide G to nucleotide T":0.304615404570875
+       "Substitution rate from nucleotide A to nucleotide T":0.2647746107611847,
+       "Substitution rate from nucleotide C to nucleotide G":0.4917423221832032,
+       "Substitution rate from nucleotide C to nucleotide T":1.02837595903795,
+       "Substitution rate from nucleotide G to nucleotide T":0.304509117524575
       },
      "display order":0,
      "estimated parameters":24
     },
    "Unconstrained model":{
-     "AIC-c":6910.766610587704,
-     "Log Likelihood":-3414.486640449675,
+     "AIC-c":6910.776988890891,
+     "Log Likelihood":-3414.491829601268,
      "Rate Distributions":{
        "Synonymous site-to-site rates":{
          "0":{
-           "proportion":0.2645541257391169,
-           "rate":0.2747941124675511
+           "proportion":0.2655037162058198,
+           "rate":0.2749303122566129
           },
          "1":{
-           "proportion":0.6325830460054784,
-           "rate":0.9734675888351726
+           "proportion":0.6321791898264187,
+           "rate":0.9740711294478059
           },
          "2":{
-           "proportion":0.1028628282554047,
-           "rate":3.028333913894314
+           "proportion":0.1023170939677615,
+           "rate":3.041695877803997
           }
         },
        "Test":{
          "0":{
            "omega":0,
-           "proportion":0.04809457608200497
+           "proportion":0.386646389823596
           },
          "1":{
-           "omega":0,
-           "proportion":0.3410012743721951
+           "omega":0.9964438830494696,
+           "proportion":0
           },
          "2":{
-           "omega":1.89363684081788,
-           "proportion":0.6109041495458
+           "omega":1.876622752045829,
+           "proportion":0.613353610176404
           }
         }
       },
@@ -341,7 +341,7 @@
     }
   },
  "input":{
-   "file name":"/tmp/tmp7qHfo2/job_working_directory/000/3/working/./busted_input.fa",
+   "file name":"/tmp/tmpfqvtss8b/job_working_directory/000/3/working/./input.fasta",
    "number of sequences":10,
    "number of sites":187,
    "partition count":1,
@@ -350,8 +350,8 @@
     }
   },
  "test results":{
-   "LRT":10.17362366082671,
-   "p-value":0.003088842014430382
+   "LRT":10.17667489929045,
+   "p-value":0.003084133210483175
   },
  "tested":{
    "0":{
@@ -376,19 +376,19 @@
  "timers":{
    "Constrained BUSTED model fitting":{
      "order":3,
-     "timer":62
+     "timer":70
     },
    "Overall":{
      "order":0,
-     "timer":228
+     "timer":451
     },
    "Preliminary model fitting":{
      "order":1,
-     "timer":3
+     "timer":10
     },
    "Unconstrained BUSTED model fitting":{
      "order":2,
-     "timer":161
+     "timer":370
     }
   }
 }
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/busted-out2-1.json	Tue Apr 27 18:07:06 2021 +0000
@@ -0,0 +1,338 @@
+{
+ "Evidence Ratios":{
+   "constrained":    [
+[0.935557169656361, 0.9478485707814517, 0.9365713272643597, 0.9348516866501475, 0.9478485707814517, 0.9470782825238451, 0.9404255507056813, 0.9445269614625446, 0.9357171171944089, 0.9445269614625446, 0.951038343352286, 0.9642191069363555, 0.9509681609268663, 0.9357171171944089, 0.9365508162861411, 0.9330337048596494, 0.9453769311406178, 0.9354507653189286, 0.9357171171944089, 0.951038343352286, 0.944959794342383, 0.951038343352286, 0.9554450473318812, 0.957741198595587, 0.9357223141306646, 0.9635859922205572, 0.9400812190552175, 0.9471227276423632, 0.9471155585144405, 0.951038343352286, 0.9425085292914046, 0.951038343352286, 0.9382075921692818, 0.9681439336221066, 9.055411306947674, 0.9467899324264936, 0.9478485707814517, 0.9398061397692539, 1.097085569751409, 1.371682580705311, 1.704754646360477, 0.9467899324264936, 0.9509681609268663, 0.9467899324264936, 0.9364415899930733, 0.951038343352286, 0.9478485707814517, 0.9525827524658199, 1.146813959542357, 0.9478485707814517, 0.9362276370626634, 0.9348516866501475, 0.9467899324264936, 0.9486832156560699, 0.9357171171944089, 0.9541686971206805, 0.9484511531422709, 0.9404255507056813, 0.9357171171944089, 1.072863229391129, 0.947891315956519, 0.938167627826613, 0.9425085292914046, 0.9509681609268663, 0.951038343352286, 0.9514408733975561, 0.9395660064639854, 0.9365128450433999, 0.9404014893688138, 0.9514344449206511, 0.957741198595587, 0.9388792918800136, 0.951038343352286, 0.9642191069363555, 0.9445269614625446, 0.9453769311406178, 0.9418928080136506, 0.9388792918800136, 0.9467899324264936, 0.9399880829471382, 0.9484511531422709, 0.9509681609268663, 1.153990916133998, 0.9404255507056813, 0.9554450473318812, 0.9412338215355154, 0.942333955072914, 0.957741198595587, 0.9470815762343416, 0.9449667231570663, 0.9557119925844111, 0.9676532717080474, 0.9365050172103501, 0.9425085292914046, 0.9357012899378949, 0.9407207493748144, 0.9348483936808639, 1.953541836729934, 0.9362670029301522, 0.9644232801771531, 0.9515108647313498, 0.9509681609268663, 1.168382764503998, 0.9515108647313498, 0.949860271872106, 1.047791522454514, 0.9400812190552175, 0.9445269614625446, 0.9566068656126535, 0.9453769311406178, 0.9434809129833114, 0.936045980720387, 0.9455636023716772, 0.9382075921692818, 0.9549292932384192, 0.9479532753114727, 0.949860271872106, 1.071924199060109, 0.9347728559684337, 0.9642191069363555, 61.30480048708166, 1.392589724214399, 1.068829280572215, 0.9452448851782124, 0.9383322213205718, 0.9520356968106081, 0.9548771157697881, 0.9403109573428395, 0.9383425168225155, 0.9481200597562297, 0.9401597754529221, 0.9425085292914046, 1.081655864332756, 0.9365128450433999, 0.958884569235499, 0.9416389648192759, 0.9484511531422709, 0.9474364959906919, 0.9400812190552175, 0.9357171171944089, 1.013189964747481, 0.9478485707814517, 0.939061940389555, 0.9549292932384192, 0.9544426850176303, 0.9541087300514087, 0.9484511531422709, 0.9456450378925056, 0.9399863915898927, 0.9357147779844784, 0.9552428339477506, 0.9365032950653777, 0.957741198595587, 0.951038343352286, 0.9364880871021735, 0.949860271872106, 0.9357012899378949, 0.9382075921692818, 0.9425085292914046, 0.9418928080136506, 0.9554450473318812, 0.9365128450433999, 0.9333687495168144, 0.9330337048596494, 1.030183566875361, 0.951038343352286, 0.9530190340820841, 0.9642191069363555, 0.9471668565289959, 0.9348308160631009, 0.947891315956519, 1.060517303033454, 0.951038343352286, 0.9554450473318812, 0.9484511531422709, 0.9357171171944089, 1.428578774814407, 1.256482256153546, 1.21301128797193, 0.9447052888159178, 0.9549292932384192, 0.9554450473318812, 0.9541087300514087, 0.9330337048596494, 0.9453769311406178, 0.9453769311406178, 0.9635859922205572, 0.9549292932384192, 0.9445269614625446, 0.9364880871021735, 0.9422504512769631, 0.9408248422372665, 0.9642191069363555, 0.9471081975229871, 0.9425085292914046, 0.9362670029301522, 0.9544426850176303, 0.9407207493748144, 0.9390630876730207, 1.336418398085179, 0.951038343352286, 0.9425085292914046, 0.9467844257765329, 1.375432768466888, 0.966601236810864, 0.9390534846100443, 1.552280647800193, 0.9408957410356096, 0.9536556560670348, 0.9641542313118908, 1.085411864755457, 0.957741198595587, 0.9364795063904719, 1.403976530248877, 0.9401597754529221, 1.178460352324255, 0.9357183972203866, 0.9412338215355154, 0.9515037860691076, 0.9515592027087844, 0.9757029580834169, 0.9548474729472515, 0.951038343352286, 1.120717257841813, 0.9348416797855833, 0.9357171171944089, 0.9460027110778481, 0.9399880829471382, 0.957741198595587, 0.9330337048596494, 0.9360578204469717, 0.9549292932384192, 0.9467899324264936, 0.939567752746144, 0.9407207493748144, 0.9348516866501475, 0.9454621174927705, 0.9519506303305668, 0.957741198595587, 0.9400812190552175, 0.9445269614625446, 0.9544426850176303, 1.160520569309008, 0.9425085292914046, 24651.10860580233, 0.9525593197269102, 0.9357171171944089, 0.9471255536216724, 0.9519621873944049, 1.298616419958555, 0.9334311045279464, 0.957741198595587, 0.9404255507056813, 0.9446748706398018, 0.9484511531422709, 0.9428047361782207, 0.9425085292914046, 0.9544426850176303, 1.194094271560973, 0.9642191069363555, 0.9434809129833114, 1.109889104086316, 1.158445569836376, 0.9649921376660023, 0.9473330500556068, 0.957741198595587, 0.9382075921692818, 0.9351027446587376, 0.9544426850176303, 0.9478485707814517, 0.9547785980540749, 1.890778521121784, 0.9363802634765468, 0.9478485707814517, 0.951038343352286, 0.9445269614625446, 1.69690990639475, 0.9554450473318812, 0.9666698760779452, 0.9398210331454567, 0.951038343352286, 21.46682725210115, 0.9399880829471382, 0.9384119636645029, 0.9364934337286973, 0.9452576700652662, 0.9515108647313498, 0.9382075921692818, 0.9529097804092426, 0.9400812190552175, 0.9471255536216724, 1.102102122823052, 1.449398596239187, 1.134235832364208, 1.270033473513288, 0.9400812190552175, 1.201877776980139, 0.9467899324264936, 0.9382075921692818, 0.9471439004873634, 0.9620926359721628, 0.9471155585144405, 0.9525593197269102, 0.9382075921692818, 0.9467899324264936, 0.942428399952224, 0.9384119636645029, 0.9475851302911668, 0.9491202941771981, 0.9558561522488059, 0.9515108647313498, 0.9471081975229871, 0.9357154363609244, 2.029871201270302, 0.9407207493748144, 0.9364880871021735, 0.9500246405250976, 0.9549292932384192, 0.9549292932384192, 0.9395660064639854, 0.9357171171944089, 0.949860271872106, 0.951038343352286, 0.9395660064639854, 0.9642191069363555, 0.9425085292914046, 0.9382075921692818, 0.9471155585144405, 3.085379633887368, 0.9544426850176303, 0.9514963660950305, 0.9553922268090769, 0.9362276370626634, 1.847205271461428, 0.9485605224521065, 0.9554450473318812, 0.957741198595587, 0.9400812190552175, 0.9548050361533054, 0.9557492451122166, 0.9491202941771981, 0.9549292932384192, 0.9554450473318812, 0.9471439004873634, 1.009997401814939, 1.202147538035071, 0.951038343352286, 1.382904014704207, 0.9525968410582321, 0.951038343352286, 0.9400812190552175, 0.9364880871021735, 0.9512813137553707, 0.9549292932384192, 0.9386992697488452, 0.9679772177799391, 1.527130985302525, 0.9381512655446221, 0.9360578204469717, 0.9431964900632595, 0.9365382685680385, 0.9404255507056813, 0.9484511531422709, 0.9453769311406178, 0.9445269614625446, 0.9514527603750581, 0.9557079039560956, 0.9642191069363555, 1.093619843078549, 0.9467844257765329, 0.9382075921692818, 0.9456275587586859, 0.9558655222322769, 1.158445569836376, 1.050631449912667, 2.899714676148859, 97.74849833826984, 0.9467899324264936, 1.016665645928988, 0.9425085292914046, 0.9478179118501964, 0.9425085292914046, 0.957741198595587, 0.9364880871021735, 1.154063211079515, 1.150611148253592, 0.9348516866501475, 0.951038343352286, 0.947891315956519, 1.518568824527545, 0.9557792806720981, 0.9347728559684337, 0.9425085292914046, 0.9554450473318812, 0.9518888783051983, 0.9467899324264936, 0.9400812190552175, 0.957741198595587, 0.9471227276423632, 1.016687874823012, 0.957741198595587, 0.957741198595587, 2.335663554704318, 1.070178751964804, 0.9549292932384192, 0.957741198595587, 0.9555611962667599, 0.938167627826613, 0.9401707489078746, 0.957741198595587, 0.9478485707814517, 0.9348516866501475, 0.9467844257765329, 0.957741198595587, 0.9474549107167488, 1.202147538035071, 0.9446788817278071, 0.9486832156560699, 0.9401597754529221, 0.9348516866501475, 0.9348333689843173, 0.9642191069363555, 0.9465095493139997, 0.951038343352286, 0.9647078671851033, 0.957741198595587, 0.9543632602248244, 0.9544426850176303, 0.9642191069363555, 0.9471189077497137, 0.9514344449206511, 0.9467899324264936, 0.9347728559684337, 0.9425085292914046, 1.445700408816089, 0.9364880871021735, 0.9382075921692818, 0.9467899324264936, 0.9404231797495201, 0.9418928080136506] 
+    ],
+   "optimized null":    [
+[0.8499709171699702, 1.011776923707638, 0.9927743830999016, 1.028835441764808, 1.011776923707638, 0.9802335047148484, 1.027350388371072, 1.014097980971467, 1.019098179743033, 1.014097980971467, 1.005200281041841, 1.005680990891965, 1.01492407401182, 1.019098179743033, 1.012220395148955, 1.010068142014614, 1.005919978264423, 1.037632396702863, 1.019098179743033, 1.005200281041841, 1.00773926676038, 1.005200281041841, 1.001934147132853, 0.9978595338852748, 1.018269004513264, 1.017911911038762, 1.016374065517173, 1.033676849242881, 0.9945654945960093, 1.005200281041841, 1.011557364080184, 1.005200281041841, 1.017878463753268, 1.047515379035503, 1.758766008407053, 1.002436404889693, 1.011776923707638, 1.006619224358914, 0.9068358661477103, 0.7707114511428858, 0.8500624624354869, 1.002436404889693, 1.01492407401182, 1.002436404889693, 0.9413491898024052, 1.005200281041841, 1.011776923707638, 0.9039971077582617, 0.9222200776078122, 1.011776923707638, 1.030672370730277, 1.028835441764808, 1.002436404889693, 1.010356091036622, 1.019098179743033, 0.9129714414998431, 1.005076681967074, 1.027350388371072, 1.019098179743033, 0.931708039861126, 1.006101356167701, 1.038946235197214, 1.011557364080184, 1.01492407401182, 1.005200281041841, 0.9821016389543854, 1.010076132014948, 1.008315635400777, 1.113072967991096, 0.9755460884763789, 0.9978595338852748, 1.016856339685059, 1.005200281041841, 1.005680990891965, 1.014097980971467, 1.005919978264423, 1.010555674886431, 1.016856339685059, 1.002436404889693, 1.02474278129377, 1.005076681967074, 1.01492407401182, 0.9886535344313034, 1.027350388371072, 1.001934147132853, 1.095086417375053, 1.015764885518353, 0.9978595338852748, 0.9162372999242984, 1.025150025916969, 1.033085240245737, 1.01552960234397, 0.9949557238446267, 1.011557364080184, 1.07879878718362, 1.005815037698335, 0.9583115853410678, 0.5801843565753065, 1.012015073958904, 0.8540368645256587, 0.987117711097664, 1.01492407401182, 1.008958086021127, 0.987117711097664, 1.011183440934601, 0.9429802700867829, 1.016374065517173, 1.014097980971467, 1.072677546717868, 1.005919978264423, 1.026230458833122, 1.016936426594224, 1.011064023752203, 1.017878463753268, 1.001210519912436, 0.9211587074760641, 1.011183440934601, 0.8735680687531137, 1.039242435713766, 1.005680990891965, 3.770673711402697, 0.990855898467179, 1.133819299499706, 0.9767593042244443, 1.026244516181084, 0.815504379749153, 0.9885604008448508, 0.778875743591259, 0.8412006490036278, 1.01137959017672, 1.037538656459977, 1.011557364080184, 0.9526767555311906, 1.008315635400777, 1.004620814519893, 1.008644406509116, 1.005076681967074, 1.034035934155462, 1.016374065517173, 1.019098179743033, 1.043700379215956, 1.011776923707638, 0.9933551206187563, 1.001210519912436, 1.010710689846159, 1.002587788877136, 1.005076681967074, 1.010181981205338, 0.9382006706840663, 0.9953696410978593, 1.044654493584247, 1.044904484988723, 0.9978595338852748, 1.005200281041841, 1.01319132235117, 1.011183440934601, 1.07879878718362, 1.017878463753268, 1.011557364080184, 1.010555674886431, 1.001934147132853, 1.008315635400777, 1.055320832819593, 1.010068142014614, 0.9479897337126886, 1.005200281041841, 0.8857758518384506, 1.005680990891965, 1.010857681734536, 1.020919411522657, 1.006101356167701, 0.9952025252641359, 1.005200281041841, 1.001934147132853, 1.005076681967074, 1.019098179743033, 0.9163445013218963, 0.8599959980769317, 0.959680405688578, 1.038466466854073, 1.001210519912436, 1.001934147132853, 1.002587788877136, 1.010068142014614, 1.005919978264423, 1.005919978264423, 1.017911911038762, 1.001210519912436, 1.014097980971467, 1.01319132235117, 1.027461153440129, 1.036297193219955, 1.005680990891965, 0.9793168092976083, 1.011557364080184, 1.012015073958904, 1.010710689846159, 1.005815037698335, 0.9795712986013342, 0.8484903943923955, 1.005200281041841, 1.011557364080184, 1.012198851468811, 0.8730534279977735, 0.9339904118741775, 1.015316157374017, 1.164839073276146, 1.010775419534465, 1.008861084926344, 1.053551432072301, 0.9710892646128411, 0.9978595338852748, 0.9224559729572264, 0.9759540898105431, 1.037538656459977, 1.042300085919285, 1.05071461017114, 1.095086417375053, 1.036667899885859, 1.003935453313836, 0.9676796488649203, 1.00264549199916, 1.005200281041841, 0.8353498242009865, 0.9789801546220137, 1.019098179743033, 0.9437899974611375, 1.02474278129377, 0.9978595338852748, 1.010068142014614, 1.027813347000856, 1.001210519912436, 1.002436404889693, 1.034738358151723, 1.005815037698335, 1.028835441764808, 0.9890890104925459, 1.004513129006517, 0.9978595338852748, 1.016374065517173, 1.014097980971467, 1.010710689846159, 0.8753067355222519, 1.011557364080184, 36.20783258734031, 1.027231424936922, 1.019098179743033, 0.9842655475715875, 0.9390817541654697, 0.6521309697841343, 1.011698124609669, 0.9978595338852748, 1.027350388371072, 1.035289307075212, 1.005076681967074, 0.9765138298248422, 1.011557364080184, 1.010710689846159, 1.043556482155621, 1.005680990891965, 1.026230458833122, 0.9808051460523496, 0.9600570411902412, 0.9483478746034002, 1.087363289638714, 0.9978595338852748, 1.017878463753268, 0.9818256019752734, 1.010710689846159, 1.011776923707638, 0.9385481741597617, 1.086038552917779, 0.9796151332816158, 1.011776923707638, 1.005200281041841, 1.014097980971467, 0.9371935784977717, 1.001934147132853, 1.007259229298604, 1.011152536869284, 1.005200281041841, 1.632088886814739, 1.02474278129377, 1.005030435463644, 1.005248492101279, 1.02133721159787, 0.987117711097664, 1.017878463753268, 1.012871575914749, 1.016374065517173, 0.9842655475715875, 0.9703135720715155, 0.9672720127290062, 0.8951218581121033, 0.9188043695919911, 1.016374065517173, 0.8510282472218286, 1.002436404889693, 1.017878463753268, 0.9665731766181921, 0.9799451610613272, 0.9945654945960093, 1.027231424936922, 1.017878463753268, 1.002436404889693, 1.050781161409025, 1.005030435463644, 0.8267978525187876, 0.9280765588638297, 0.9845289318822147, 0.987117711097664, 0.9793168092976083, 1.010892185908564, 1.103648411910994, 1.005815037698335, 1.01319132235117, 0.9997511308005647, 1.001210519912436, 1.001210519912436, 1.010076132014948, 1.019098179743033, 1.011183440934601, 1.005200281041841, 1.010076132014948, 1.005680990891965, 1.011557364080184, 1.017878463753268, 0.9945654945960093, 0.6948528471367635, 1.010710689846159, 0.9693414392957522, 0.9656858415797084, 1.030672370730277, 1.071714823227563, 1.021086272899009, 1.001934147132853, 0.9978595338852748, 1.016374065517173, 1.107134541561859, 0.9940418804272027, 0.9280765588638297, 1.001210519912436, 1.001934147132853, 0.9665731766181921, 0.8415439793212199, 0.9446963650749101, 1.005200281041841, 1.068638324409973, 0.9314943570566576, 1.005200281041841, 1.016374065517173, 1.01319132235117, 0.9419405743425986, 1.001210519912436, 1.016944382912866, 0.9822169288786951, 0.8264523294355375, 1.027878810206537, 1.027813347000856, 1.022594863366278, 1.010945687151556, 1.027350388371072, 1.005076681967074, 1.005919978264423, 1.014097980971467, 0.9684727978280834, 0.9836955596871932, 1.005680990891965, 0.9387436134438922, 1.012198851468811, 1.017878463753268, 1.063937934929892, 0.992410209826215, 0.9600570411902412, 0.9837762611738523, 0.5355554352781753, 4.24528266177922, 1.002436404889693, 0.9102472519010668, 1.011557364080184, 0.996025368474675, 1.011557364080184, 0.9978595338852748, 1.01319132235117, 0.9671309886790472, 1.00246654017779, 1.028835441764808, 1.005200281041841, 1.006101356167701, 0.9307398082807791, 0.9765578776691304, 1.039242435713766, 1.011557364080184, 1.001934147132853, 0.9684150255367761, 1.002436404889693, 1.016374065517173, 0.9978595338852748, 1.033676849242881, 0.9713379121016896, 0.9978595338852748, 0.9978595338852748, 1.093515428279506, 1.000117183070866, 1.001210519912436, 0.9978595338852748, 1.00026904961545, 1.038946235197214, 1.004052699886934, 0.9978595338852748, 1.011776923707638, 1.028835441764808, 1.012198851468811, 0.9978595338852748, 1.000097439050484, 0.9446963650749101, 1.018727222717721, 1.010356091036622, 1.037538656459977, 1.028835441764808, 1.00012663706781, 1.005680990891965, 0.8652439084913337, 1.005200281041841, 1.03735640248577, 0.9978595338852748, 1.006816829319318, 1.010710689846159, 1.005680990891965, 1.047580504138917, 0.9755460884763789, 1.002436404889693, 1.039242435713766, 1.011557364080184, 1.042676666677476, 1.01319132235117, 1.017878463753268, 1.002436404889693, 1.011330770723848, 1.010555674886431] 
+    ]
+  },
+ "Site Log Likelihood":{
+   "constrained":    [
+[-10.38832784826655, -4.584785170539313, -9.558485562837681, -5.563599751186867, -4.584785170539313, -7.401014444268883, -4.905303241831343, -3.975705015812105, -4.724629251014554, -3.975705015812105, -3.084471241870007, -4.170460396722648, -4.58440342490372, -4.724629251014554, -6.988454014913949, -4.475036479538273, -4.136966246018949, -6.454360563510074, -4.724629251014554, -3.084471241870007, -8.955867363007998, -3.084471241870007, -3.648836688425441, -4.84807838928955, -10.09764358212543, -5.671539717170964, -4.066320443474286, -6.522314492701455, -6.795475845793286, -3.084471241870007, -3.484040386406434, -3.084471241870007, -4.289415609116501, -9.787592895437248, -16.87191519720355, -3.312692482160627, -4.584785170539313, -5.169399294814029, -10.41071786884339, -22.42385021291117, -12.48786124128794, -3.312692482160627, -4.58440342490372, -3.312692482160627, -10.15005541326126, -3.084471241870007, -4.584785170539313, -9.633221533545099, -11.76373216573094, -4.584785170539313, -5.953511813906633, -5.563599751186867, -3.312692482160627, -6.882589059757908, -4.724629251014554, -12.29801031928089, -3.913852771805472, -4.905303241831343, -4.724629251014554, -8.376289517394079, -4.702415765320392, -6.287320509869368, -3.484040386406434, -4.58440342490372, -3.084471241870007, -6.758254692392957, -5.119611605507852, -5.000956726091898, -9.443466977875234, -6.691559494159931, -4.84807838928955, -4.224042333065414, -3.084471241870007, -4.170460396722648, -3.975705015812105, -4.136966246018949, -5.685082726155364, -4.224042333065414, -3.312692482160627, -5.249932331837913, -3.913852771805472, -4.58440342490372, -8.838880408919691, -4.905303241831343, -3.648836688425441, -8.845380108513405, -7.873155898818536, -4.84807838928955, -7.575556637366918, -4.81468821300015, -6.858458848454655, -6.577902291746231, -7.638708210401736, -3.484040386406434, -8.755186073131492, -4.572208067993825, -11.91749660663666, -12.89390742056397, -8.131121425418213, -13.17812665767847, -6.269386997696881, -4.58440342490372, -11.92037035479962, -6.269386997696881, -4.204953975179577, -8.387428668346701, -4.066320443474286, -3.975705015812105, -9.033786098623084, -4.136966246018949, -5.472740284536493, -8.950134134928833, -7.105700635079896, -4.289415609116501, -4.080779461965061, -9.475753821039008, -4.204953975179577, -14.16856577422467, -6.72252713567341, -4.170460396722648, -22.78708500333403, -12.68251692702332, -14.90099634812842, -8.575164805570523, -7.184768821749435, -10.90059792125111, -11.66127596966844, -10.71891995814071, -10.13868631987535, -7.671155964401473, -6.064228627531294, -3.484040386406434, -10.40204261875176, -5.000956726091898, -7.573893718902371, -4.896510098517155, -3.913852771805472, -9.46950576441253, -4.066320443474286, -4.724629251014554, -13.59889204745414, -4.584785170539313, -7.898086430350959, -4.080779461965061, -5.148773066276751, -5.02568747793921, -3.913852771805472, -7.650482748812452, -10.02693832397291, -8.397865724372094, -8.806738141037286, -7.663444233988536, -4.84807838928955, -3.084471241870007, -4.454577044578758, -4.204953975179577, -8.755186073131492, -4.289415609116501, -3.484040386406434, -5.685082726155364, -3.648836688425441, -5.000956726091898, -8.908291456259354, -4.475036479538273, -8.530123675252453, -3.084471241870007, -9.691910357595329, -4.170460396722648, -6.267304197266073, -11.62964692453223, -4.702415765320392, -8.370156675247694, -3.084471241870007, -3.648836688425441, -3.913852771805472, -4.724629251014554, -12.28305301640865, -17.62089828870422, -13.46692314578272, -5.659090552903872, -4.080779461965061, -3.648836688425441, -5.02568747793921, -4.475036479538273, -4.136966246018949, -4.136966246018949, -5.671539717170964, -4.080779461965061, -3.975705015812105, -4.454577044578758, -5.087536669734146, -10.93534636449123, -4.170460396722648, -6.986475911596069, -3.484040386406434, -8.131121425418213, -5.148773066276751, -4.572208067993825, -7.834114028701332, -22.07262124526036, -3.084471241870007, -3.484040386406434, -4.812624802333026, -19.37340243258745, -14.11188632430341, -6.760230551786971, -15.72166667344122, -7.540935659220155, -13.33085396215619, -7.875458492565933, -13.29349559449303, -4.84807838928955, -14.07230627172383, -15.24110745865939, -6.064228627531294, -10.77606806150628, -7.933382533318876, -8.845380108513405, -6.294093316989382, -5.619830465111565, -8.265641656024117, -7.634412511958518, -3.084471241870007, -10.74356352507341, -12.58981907872725, -4.724629251014554, -9.963764950698033, -5.249932331837913, -4.84807838928955, -4.475036479538273, -5.295441328089962, -4.080779461965061, -3.312692482160627, -6.408873923431448, -4.572208067993825, -5.563599751186867, -8.272154110471117, -8.459968985714159, -4.84807838928955, -4.066320443474286, -3.975705015812105, -5.148773066276751, -14.79150606514784, -3.484040386406434, -55.52122355815657, -6.369498314443239, -4.724629251014554, -6.49760816594007, -9.150957310198649, -19.98383782971818, -9.184072938762881, -4.84807838928955, -4.905303241831343, -5.973613592795867, -3.913852771805472, -8.009708993801024, -3.484040386406434, -5.148773066276751, -11.73304004618883, -4.170460396722648, -5.472740284536493, -17.12719212233513, -8.660382651575667, -10.35425694075774, -8.426993569870021, -4.84807838928955, -4.289415609116501, -8.920900523478249, -5.148773066276751, -4.584785170539313, -9.332508945431275, -24.65558578475099, -7.959824033834592, -4.584785170539313, -3.084471241870007, -3.975705015812105, -24.689148599152, -3.648836688425441, -7.545609080591593, -8.135834190551272, -3.084471241870007, -17.82279639679183, -5.249932331837913, -8.850868661000968, -7.936783257041913, -10.00799080991019, -6.269386997696881, -4.289415609116501, -7.406049667350791, -4.066320443474286, -6.49760816594007, -8.687019720642594, -13.96764770160089, -10.41382824609126, -13.63267164685005, -4.066320443474286, -13.60662641678212, -3.312692482160627, -4.289415609116501, -6.819012272824779, -7.48249620126701, -6.795475845793286, -6.369498314443239, -4.289415609116501, -3.312692482160627, -7.821248150955675, -8.850868661000968, -10.92124385597605, -8.461508676524241, -7.957797255464, -6.269386997696881, -6.986475911596069, -8.206750210852839, -12.05804551392478, -4.572208067993825, -4.454577044578758, -9.530825408925748, -4.080779461965061, -4.080779461965061, -5.119611605507852, -4.724629251014554, -4.204953975179577, -3.084471241870007, -5.119611605507852, -4.170460396722648, -3.484040386406434, -4.289415609116501, -6.795475845793286, -31.26999734802813, -5.148773066276751, -6.590791029457344, -7.155157091785045, -5.953511813906633, -18.64964688684746, -14.82270358922278, -3.648836688425441, -4.84807838928955, -4.066320443474286, -12.17884783433282, -7.131620107399788, -8.461508676524241, -4.080779461965061, -3.648836688425441, -6.819012272824779, -9.671829498472997, -10.54471195864799, -3.084471241870007, -15.22620413255003, -9.716227565172344, -3.084471241870007, -4.066320443474286, -4.454577044578758, -9.171984292397884, -4.080779461965061, -6.823068092354585, -7.641640025848909, -20.63818883697314, -5.73095056507191, -5.295441328089962, -10.02230128246596, -5.554825802588971, -4.905303241831343, -3.913852771805472, -4.136966246018949, -3.975705015812105, -6.694258088768088, -6.833752546501066, -4.170460396722648, -9.143085473052057, -4.812624802333026, -4.289415609116501, -7.676227633448207, -9.666447762944738, -8.660382651575667, -8.160732457583689, -24.87099038230656, -31.89835933695807, -3.312692482160627, -14.52179387066504, -3.484040386406434, -8.935345803886934, -3.484040386406434, -4.84807838928955, -4.454577044578758, -10.16063015433809, -9.878106675818119, -5.563599751186867, -3.084471241870007, -4.702415765320392, -13.72020737010786, -12.10214998831333, -6.72252713567341, -3.484040386406434, -3.648836688425441, -10.51536105813687, -3.312692482160627, -4.066320443474286, -4.84807838928955, -6.522314492701455, -8.727358873612483, -4.84807838928955, -4.84807838928955, -19.22079537267623, -11.49564239420891, -4.080779461965061, -4.84807838928955, -6.184196988050227, -6.287320509869368, -9.403610059389601, -4.84807838928955, -4.584785170539313, -5.563599751186867, -4.812624802333026, -4.84807838928955, -8.929135365674885, -10.54471195864799, -9.799659797366882, -6.882589059757908, -6.064228627531294, -5.563599751186867, -9.507865419148743, -4.170460396722648, -13.44765597765531, -3.084471241870007, -7.380151100859329, -4.84807838928955, -10.42070003502221, -5.148773066276751, -4.170460396722648, -7.016613631408924, -6.691559494159931, -3.312692482160627, -6.72252713567341, -3.484040386406434, -13.89486678550077, -4.454577044578758, -4.289415609116501, -3.312692482160627, -9.466790819868764, -5.685082726155364] 
+    ],
+   "optimized null":    [
+[-10.29238772688685, -4.650053810935929, -9.616763311075404, -5.65939466088972, -4.650053810935929, -7.435423504199312, -4.99370908383831, -4.046775591186112, -4.809989423127248, -4.046775591186112, -3.139858946412362, -4.212562032486925, -4.649491927239646, -4.809989423127248, -7.066151840488147, -4.554368228992619, -4.199040332147493, -6.558028903692909, -4.809989423127248, -3.139858946412362, -9.02018973333262, -3.139858946412362, -3.696346996409642, -4.889113314214542, -10.18218423285278, -5.726386645429669, -4.144350903792923, -6.609763292981103, -6.844360687099358, -3.139858946412362, -3.554741784372315, -3.139858946412362, -4.370920173690687, -9.866388460801144, -15.2331651152694, -3.369803958489969, -4.650053810935929, -5.23807836757718, -10.22026687847639, -21.84737083734347, -11.79199459635582, -3.369803958489969, -4.649491927239646, -3.369803958489969, -10.15528241835229, -3.139858946412362, -4.650053810935929, -9.580870712093422, -11.54577315015199, -4.650053810935929, -6.04961982037545, -5.65939466088972, -3.369803958489969, -6.945572238537586, -4.809989423127248, -12.25387443236094, -3.971841600863002, -4.99370908383831, -4.809989423127248, -8.235222752163754, -4.762014012495499, -6.389354112203326, -3.554741784372315, -4.649491927239646, -3.139858946412362, -6.78997195298871, -5.191974517336082, -5.07483001826593, -9.612039986316633, -6.716586111310414, -4.889113314214542, -4.303826538926081, -3.139858946412362, -4.212562032486925, -4.046775591186112, -4.199040332147493, -5.755446881671785, -4.303826538926081, -3.369803958489969, -5.336262049371312, -3.971841600863002, -4.649491927239646, -8.684242784685033, -4.99370908383831, -3.696346996409642, -8.996777076936503, -7.948193359473136, -4.889113314214542, -7.542446798320236, -4.89613274732703, -6.9363072266732, -6.626193990126021, -7.69925156864622, -3.554741784372315, -8.897493249307617, -4.639115206490627, -11.94228520703959, -11.67985399920359, -8.208919475031413, -13.05657073186664, -6.306125186315331, -4.649491927239646, -11.77366801513379, -6.306125186315331, -4.267515731243013, -8.282034112129439, -4.144350903792923, -4.046775591186112, -9.148306772130345, -4.199040332147493, -5.55681176919834, -9.033019418327758, -7.172678024907503, -4.370920173690687, -4.128107229525207, -9.447080949875485, -4.267515731243013, -13.96394119791287, -6.828470870196397, -4.212562032486925, -19.99848054087063, -12.34216563692349, -14.96002427368295, -8.607961033479155, -7.274326072139637, -10.74580218319005, -11.69594305633304, -10.53056085745996, -10.02940149634478, -7.735745433521224, -6.162785303474359, -3.554741784372315, -10.27506992497726, -5.07483001826593, -7.620488467336987, -4.965250698471338, -3.971841600863002, -9.55697065943585, -4.144350903792923, -4.809989423127248, -13.62856076805264, -4.650053810935929, -7.954293213211729, -4.128107229525207, -5.206054487740894, -5.075249565484065, -3.971841600863002, -7.716501247406075, -10.02503678660235, -8.459669185468856, -8.896214038074566, -7.772971951917959, -4.889113314214542, -3.139858946412362, -4.533300596929925, -4.267515731243013, -8.897493249307617, -4.370920173690687, -3.554741784372315, -5.755446881671785, -3.696346996409642, -5.07483001826593, -9.031091210190251, -4.554368228992619, -8.446975062420163, -3.139858946412362, -9.618739411039053, -4.212562032486925, -6.332383364057885, -11.71774024112479, -4.762014012495499, -8.306590844881345, -3.139858946412362, -3.696346996409642, -3.971841600863002, -4.809989423127248, -11.83901003824592, -17.24175478930271, -13.23266224934558, -5.753717890549781, -4.128107229525207, -3.696346996409642, -5.075249565484065, -4.554368228992619, -4.199040332147493, -4.199040332147493, -5.726386645429669, -4.128107229525207, -4.046775591186112, -4.533300596929925, -5.174111697436301, -11.03199862997988, -4.212562032486925, -7.019917767192548, -3.554741784372315, -8.208919475031413, -5.206054487740894, -4.639115206490627, -7.876346391278166, -21.61833153189018, -3.139858946412362, -3.554741784372315, -4.879433698247528, -18.91887548572662, -14.0775664578623, -6.838313443156718, -15.43452438120906, -7.612576379082414, -13.38712863826962, -7.964129272009746, -13.18219919636114, -4.889113314214542, -14.05721828225551, -14.87745913673849, -6.162785303474359, -10.65328915336477, -8.049293752555199, -8.996777076936503, -6.379816557312877, -5.67341156856984, -8.257384553407931, -7.683258176251541, -3.139858946412362, -10.44968994522538, -12.63595326146302, -4.809989423127248, -9.961423196898384, -5.336262049371312, -4.889113314214542, -4.554368228992619, -5.388952940002633, -4.128107229525207, -3.369803958489969, -6.505357871114547, -4.639115206490627, -5.65939466088972, -8.317264617356445, -8.51371406552421, -4.889113314214542, -4.144350903792923, -4.046775591186112, -5.206054487740894, -14.50945649487755, -3.554741784372315, -48.99792187107399, -6.444968456733227, -4.809989423127248, -6.536072227223491, -9.137334535876892, -19.29502856102562, -9.26459129141084, -4.889113314214542, -4.99370908383831, -6.065208967118839, -3.971841600863002, -8.044838712091376, -3.554741784372315, -5.206054487740894, -11.59828665360407, -4.212562032486925, -5.55681176919834, -17.00355055120717, -8.472540992719322, -10.33685837822403, -8.564853893291128, -4.889113314214542, -4.370920173690687, -8.969657810743975, -5.206054487740894, -4.650053810935929, -9.315363652053167, -24.10113384536199, -8.004962148850282, -4.650053810935929, -3.139858946412362, -4.046775591186112, -24.0954742800688, -3.696346996409642, -7.586740320107306, -8.208990808544055, -3.139858946412362, -15.24614829170843, -5.336262049371312, -8.919452718817928, -8.00763079243667, -10.0854012922891, -6.306125186315331, -4.370920173690687, -7.467074157428048, -4.144350903792923, -6.536072227223491, -8.559664354218736, -13.56322346481482, -10.17707368169939, -13.30894633721099, -4.144350903792923, -13.26143131089947, -3.369803958489969, -4.370920173690687, -6.839318245916543, -7.500882072046247, -6.844360687099358, -6.444968456733227, -4.370920173690687, -3.369803958489969, -7.930077332534476, -8.919452718817928, -10.78488730624613, -8.439087355226501, -7.987353107127176, -6.306125186315331, -7.019917767192548, -8.284027373874828, -11.44869460019551, -4.639115206490627, -4.533300596929925, -9.581843866082314, -4.128107229525207, -4.128107229525207, -5.191974517336082, -4.809989423127248, -4.267515731243013, -3.139858946412362, -5.191974517336082, -4.212562032486925, -3.554741784372315, -4.370920173690687, -6.844360687099358, -29.77926745368168, -5.206054487740894, -6.609372074221332, -7.165873692483854, -6.04961982037545, -18.10523305818515, -14.89638030631547, -3.696346996409642, -4.889113314214542, -4.144350903792923, -12.32687112773499, -7.170903863657255, -8.439087355226501, -4.128107229525207, -3.696346996409642, -6.839318245916543, -9.48936473637464, -10.30371067636028, -3.139858946412362, -14.9684037299896, -9.693825925050334, -3.139858946412362, -4.144350903792923, -4.533300596929925, -9.162116653254344, -4.128107229525207, -6.903130638102583, -7.656243663330894, -20.02418499389312, -5.822291915321985, -5.388952940002633, -10.10312531407858, -5.631276913816123, -4.99370908383831, -3.971841600863002, -4.199040332147493, -4.046775591186112, -6.711988446337556, -6.862616678550661, -4.212562032486925, -8.990379442874961, -4.879433698247528, -4.370920173690687, -7.794111179385123, -9.703967066688788, -8.472540992719322, -8.094984308662299, -23.18192716383132, -28.761769905017, -3.369803958489969, -14.41122656172793, -3.554741784372315, -8.984956123804611, -3.554741784372315, -4.889113314214542, -4.533300596929925, -9.983919878237698, -9.740276944599941, -5.65939466088972, -3.139858946412362, -4.762014012495499, -13.23066352531273, -12.12365699896321, -6.828470870196397, -3.554741784372315, -3.696346996409642, -10.53257349540843, -3.369803958489969, -4.144350903792923, -4.889113314214542, -6.609763292981103, -8.681727844391151, -4.889113314214542, -4.889113314214542, -18.46189701443825, -11.42793387798215, -4.128107229525207, -4.889113314214542, -6.229922472502635, -6.389354112203326, -9.469348341648528, -4.889113314214542, -4.650053810935929, -5.65939466088972, -4.879433698247528, -4.889113314214542, -8.983208730770414, -10.30371067636028, -9.875124041552931, -6.945572238537586, -6.162785303474359, -5.65939466088972, -9.57537902876442, -4.212562032486925, -13.35788636029592, -3.139858946412362, -7.452756608940454, -4.889113314214542, -10.47420463890801, -5.206054487740894, -4.212562032486925, -7.117427485975914, -6.716586111310414, -3.369803958489969, -6.828470870196397, -3.554741784372315, -13.56806399416, -4.533300596929925, -4.370920173690687, -3.369803958489969, -9.539483192032602, -5.755446881671785] 
+    ],
+   "unconstrained":    [
+[-10.45494087206413, -4.638345695488099, -9.624015159179429, -5.630967137366005, -4.638345695488099, -7.455387969781455, -4.966726034476595, -4.032776062508333, -4.791071324417993, -4.032776062508333, -3.134672140137118, -4.206897117567485, -4.63467812147309, -4.791071324417993, -7.054005511566138, -4.544350433074068, -4.193137808102539, -6.521087327431951, -4.791071324417993, -3.134672140137118, -9.012480261070921, -3.134672140137118, -3.694414717331015, -4.891256074401035, -10.16408010158342, -5.708633262441503, -4.128109447674688, -6.576641090651126, -6.849810013147477, -3.134672140137118, -3.543250696461301, -3.134672140137118, -4.353199649965352, -9.819967406437957, -14.66855268371395, -3.367370516822572, -4.638345695488099, -5.23148095408936, -10.31806068717271, -22.10781206554527, -11.95444004333528, -3.367370516822572, -4.63467812147309, -3.367370516822572, -10.21572354284034, -3.134672140137118, -4.638345695488099, -9.681799830070954, -11.62674453817386, -4.638345695488099, -6.019408443989963, -5.630967137366005, -3.367370516822572, -6.935269404438195, -4.791071324417993, -12.34492511108416, -3.966777761797945, -4.966726034476595, -4.791071324417993, -8.305958527488656, -4.755931194235305, -6.351147148107322, -3.543250696461301, -4.63467812147309, -3.134672140137118, -6.808032426982133, -5.181948811091088, -5.066548767273918, -9.504915356431743, -6.741343985341978, -4.891256074401035, -4.28711069075105, -3.134672140137118, -4.206897117567485, -4.032776062508333, -4.193137808102539, -5.744946528953498, -4.28711069075105, -3.367370516822572, -5.311820413352174, -3.966777761797945, -4.63467812147309, -8.695654112499081, -4.966726034476595, -3.694414717331015, -8.90594379680484, -7.932551448988094, -4.891256074401035, -7.629926685126035, -4.871293778698964, -6.903757522761218, -6.610783738001538, -7.704308610108475, -3.543250696461301, -8.821645061252083, -4.633317010864029, -11.98486751527303, -12.22426336898651, -8.196976009060764, -13.2143516511, -6.319091171477947, -4.63467812147309, -11.76474981474294, -6.319091171477947, -4.256394362624669, -8.340744031192456, -4.128109447674688, -4.032776062508333, -9.078148869286041, -4.193137808102539, -5.530919428927043, -9.016224813938688, -7.161674759720734, -4.353199649965352, -4.126897441701255, -9.529203886626926, -4.256394362624669, -14.09911042390811, -6.789978849673416, -4.206897117567485, -18.6712268520864, -12.35135180237358, -14.83443242895847, -8.631476052874584, -7.248420033920122, -10.94975066949507, -11.70744859103574, -10.78046461087907, -10.20232655997748, -7.72443010383495, -6.125934071807219, -3.543250696461301, -10.32354954406306, -5.066548767273918, -7.615878296006299, -4.956643440910609, -3.966777761797945, -9.523501131385324, -4.128109447674688, -4.791071324417993, -13.58578831287076, -4.638345695488099, -7.960960268094246, -4.126897441701255, -5.195400751022618, -5.072665119167247, -3.966777761797945, -7.706370753372042, -10.08882820482782, -8.464310297690103, -8.852527835476375, -7.729046472603262, -4.891256074401035, -3.134672140137118, -4.520195522417379, -4.256394362624669, -8.821645061252083, -4.353199649965352, -3.543250696461301, -5.744946528953498, -3.694414717331015, -5.066548767273918, -8.977246382555361, -4.544350433074068, -8.500386668622912, -3.134672140137118, -9.740030760318852, -4.206897117567485, -6.321584203726238, -11.69703663598533, -4.755931194235305, -8.31139986443792, -3.134672140137118, -3.694414717331015, -3.966777761797945, -4.791071324417993, -11.92637293011305, -17.39258233244703, -13.27381721003399, -5.715972816718718, -4.126897441701255, -3.694414717331015, -5.072665119167247, -4.544350433074068, -4.193137808102539, -4.193137808102539, -5.708633262441503, -4.126897441701255, -4.032776062508333, -4.520195522417379, -5.147020837633666, -10.99634466123836, -4.206897117567485, -7.040817850990316, -3.543250696461301, -8.196976009060764, -5.195400751022618, -4.633317010864029, -7.89698664471183, -21.78262804695464, -3.134672140137118, -3.543250696461301, -4.867308653138327, -19.05463401028619, -14.14585556432763, -6.823113394066826, -15.28194143825976, -7.601858600679135, -13.37830658236611, -7.911962498747279, -13.21153608067707, -4.891256074401035, -14.1379339122535, -14.90179886954245, -6.125934071807219, -10.61185926116923, -7.999823238760697, -8.90594379680484, -6.343804930190044, -5.669483838895014, -8.290238741141881, -7.680616177406955, -3.134672140137118, -10.62959463595328, -12.65719716919057, -4.791071324417993, -10.01927479479958, -5.311820413352174, -4.891256074401035, -4.544350433074068, -5.361519358520633, -4.126897441701255, -3.367370516822572, -6.471209270411324, -4.633317010864029, -5.630967137366005, -8.328235568267647, -8.509211090146113, -4.891256074401035, -4.128109447674688, -4.032776062508333, -5.195400751022618, -14.6426373940495, -3.543250696461301, -45.40864640583081, -6.418101210435195, -4.791071324417993, -6.551931780142217, -9.20018727430177, -19.72253842435152, -9.252961060884868, -4.891256074401035, -4.966726034476595, -6.030528055716823, -3.966777761797945, -8.068605078210021, -3.543250696461301, -5.195400751022618, -11.55565207992898, -4.206897117567485, -5.530919428927043, -17.0229320182304, -8.51330357109825, -10.38989226593045, -8.48109812788972, -4.891256074401035, -4.353199649965352, -8.987999391873322, -5.195400751022618, -4.638345695488099, -9.378784745308804, -24.01859712455607, -8.025557654444153, -4.638345695488099, -3.134672140137118, -4.032776062508333, -24.16033970423572, -3.694414717331015, -7.579507312192153, -8.197900002666678, -3.134672140137118, -14.75628757168967, -5.311820413352174, -8.914434893722014, -8.002396025666146, -10.06428853182967, -6.319091171477947, -4.353199649965352, -7.454284716195544, -4.128109447674688, -6.551931780142217, -8.58980034376717, -13.59649899241998, -10.28786909735963, -13.39362838962982, -4.128109447674688, -13.42274126888399, -3.367370516822572, -4.353199649965352, -6.873316516112559, -7.521140739030166, -6.849810013147477, -6.418101210435195, -4.353199649965352, -3.367370516822572, -7.88054348172183, -8.914434893722014, -10.97508235476463, -8.513728406049596, -8.002945101075225, -6.319091171477947, -7.040817850990316, -8.27319408056305, -11.35007317053407, -4.633317010864029, -4.520195522417379, -9.582092766254828, -4.126897441701255, -4.126897441701255, -5.181948811091088, -4.791071324417993, -4.256394362624669, -3.134672140137118, -5.181948811091088, -4.206897117567485, -3.543250696461301, -4.353199649965352, -6.849810013147477, -30.14332264025561, -5.195400751022618, -6.640510440843485, -7.200790405903581, -6.019408443989963, -18.03597305403558, -14.87551327227079, -3.694414717331015, -4.891256074401035, -4.128109447674688, -12.22509594430061, -7.176879803643835, -8.513728406049596, -4.126897441701255, -3.694414717331015, -6.873316516112559, -9.661881740083594, -10.3606023862778, -3.134672140137118, -14.90201848596055, -9.764791071919367, -3.134672140137118, -4.128109447674688, -4.520195522417379, -9.22192974421203, -4.126897441701255, -6.886328209932882, -7.674186753182733, -20.21479803491155, -5.794794644142602, -5.361519358520633, -10.08078193353884, -5.620390697128324, -4.966726034476595, -3.966777761797945, -4.193137808102539, -4.032776062508333, -6.744023329776655, -6.879055498913474, -4.206897117567485, -9.053592322057403, -4.867308653138327, -4.353199649965352, -7.732134121999846, -9.711585805891071, -8.51330357109825, -8.111341093302061, -23.80637803768938, -27.31596150047894, -3.367370516822572, -14.50526557271861, -3.543250696461301, -8.988938675170415, -3.543250696461301, -4.891256074401035, -4.520195522417379, -10.01734121212015, -9.737813441339615, -5.630967137366005, -3.134672140137118, -4.755931194235305, -13.30243904160921, -12.14737825885854, -6.789978849673416, -3.543250696461301, -3.694414717331015, -10.5646680336098, -3.367370516822572, -4.128109447674688, -4.891256074401035, -6.576641090651126, -8.710808711397197, -4.891256074401035, -4.891256074401035, -18.37249934432261, -11.42781670177668, -4.126897441701255, -4.891256074401035, -6.229653459074543, -6.351147148107322, -9.465303831829313, -4.891256074401035, -4.638345695488099, -5.630967137366005, -4.867308653138327, -4.891256074401035, -8.983111296466806, -10.3606023862778, -9.856570014298436, -6.935269404438195, -6.125934071807219, -5.630967137366005, -9.575252399714406, -4.206897117567485, -13.5026301969592, -3.134672140137118, -7.416081052639536, -4.891256074401035, -10.46741093911581, -5.195400751022618, -4.206897117567485, -7.070944262521606, -6.741343985341978, -3.367370516822572, -6.789978849673416, -3.543250696461301, -13.52627286938783, -4.520195522417379, -4.353199649965352, -3.367370516822572, -9.528216133669623, -5.744946528953498] 
+    ]
+  },
+ "analysis":{
+   "authors":"Sergei L Kosakovsky Pond",
+   "citation":"*Gene-wide identification of episodic selection*, Mol Biol Evol. 32(5):1365-71",
+   "contact":"spond@temple.edu",
+   "info":"BUSTED (branch-site unrestricted statistical test of episodic diversification) uses a random effects branch-site model fitted \njointly to all or a subset of tree branches in order to test for alignment-wide evidence of episodic diversifying selection. \nAssuming there is evidence of positive selection (i.e. there is an omega > 1),  BUSTED will also perform a quick evidence-ratio \nstyle analysis to explore which individual sites may have been subject to selection. v2.0 adds support for synonymous rate variation, \nand relaxes the test statistic to 0.5 (chi^2_0 + chi^2_2). Version 2.1 adds a grid search for the initial starting point.\nVersion 2.2 changes the grid search to LHC, and adds an initial search phase to use adaptive Nedler-Mead. Version 3.0 implements the option\nfor branch-site variation in synonymous substitution rates. Version 3.1 adds HMM auto-correlation option for SRV, and binds SRV distributions for multiple branch sets\n",
+   "requirements":"in-frame codon alignment and a phylogenetic tree (optionally annotated with {})",
+   "version":"3.1"
+  },
+ "background":0,
+ "branch attributes":{
+   "0":{
+     "B_FR_83_HXB2":{
+       "MG94xREV with separate rates for branch sets":0.01243274064118979,
+       "Nucleotide GTR":0.01178680392701259,
+       "constrained":0.01256398347964253,
+       "original name":"B_FR_83_HXB2",
+       "unconstrained":0.01346367617740634
+      },
+     "B_US_83_RF":{
+       "MG94xREV with separate rates for branch sets":0.02861520854418918,
+       "Nucleotide GTR":0.02637179869727959,
+       "constrained":0.02907713203932123,
+       "original name":"B_US_83_RF",
+       "unconstrained":0.03296423032791345
+      },
+     "B_US_86_JRFL":{
+       "MG94xREV with separate rates for branch sets":0.01913497611653954,
+       "Nucleotide GTR":0.01766254318226218,
+       "constrained":0.01932498128977916,
+       "original name":"B_US_86_JRFL",
+       "unconstrained":0.02067264364489925
+      },
+     "B_US_90_WEAU160":{
+       "MG94xREV with separate rates for branch sets":0.02258152057123029,
+       "Nucleotide GTR":0.0208836028381146,
+       "constrained":0.02318748492797678,
+       "original name":"B_US_90_WEAU160",
+       "unconstrained":0.02519768979779986
+      },
+     "D_CD_83_ELI":{
+       "MG94xREV with separate rates for branch sets":0.02096470337130958,
+       "Nucleotide GTR":0.01905599613120992,
+       "constrained":0.02057807476219352,
+       "original name":"D_CD_83_ELI",
+       "unconstrained":0.02169258688744172
+      },
+     "D_CD_83_NDK":{
+       "MG94xREV with separate rates for branch sets":0.01034012674036274,
+       "Nucleotide GTR":0.009776698714183414,
+       "constrained":0.0105101167818647,
+       "original name":"D_CD_83_NDK",
+       "unconstrained":0.01040169158313715
+      },
+     "D_CD_84_84ZR085":{
+       "MG94xREV with separate rates for branch sets":0.03124894063248942,
+       "Nucleotide GTR":0.02822254903672137,
+       "constrained":0.03140845141419388,
+       "original name":"D_CD_84_84ZR085",
+       "unconstrained":0.03388014669054998
+      },
+     "D_UG_94_94UG114":{
+       "MG94xREV with separate rates for branch sets":0.0597102708893009,
+       "Nucleotide GTR":0.05323070232023583,
+       "constrained":0.06218362660429492,
+       "original name":"D_UG_94_94UG114",
+       "unconstrained":0.06804948826756697
+      },
+     "Node1":{
+       "MG94xREV with separate rates for branch sets":0.02639559777106507,
+       "Nucleotide GTR":0.02355240508560319,
+       "constrained":0.02779997592087442,
+       "unconstrained":0.02940126303315396
+      },
+     "Node10":{
+       "MG94xREV with separate rates for branch sets":0.00193736936681532,
+       "Nucleotide GTR":0.002230248981703367,
+       "constrained":0.001848018461605612,
+       "unconstrained":0.001859856019153286
+      },
+     "Node2":{
+       "MG94xREV with separate rates for branch sets":0.003944601108756816,
+       "Nucleotide GTR":0.003949360371801276,
+       "constrained":0.00346172246250584,
+       "unconstrained":0.002261770932022259
+      },
+     "Node3":{
+       "MG94xREV with separate rates for branch sets":0.01136485742287924,
+       "Nucleotide GTR":0.01048442975058683,
+       "constrained":0.01170820974676507,
+       "unconstrained":0.01401270546560647
+      },
+     "Node9":{
+       "MG94xREV with separate rates for branch sets":0.005522231785763113,
+       "Nucleotide GTR":0.004986123424162501,
+       "constrained":0.005522033787153708,
+       "unconstrained":0.005520113121560347
+      }
+    },
+   "attributes":{
+     "MG94xREV with separate rates for branch sets":{
+       "attribute type":"branch length",
+       "display order":1
+      },
+     "Nucleotide GTR":{
+       "attribute type":"branch length",
+       "display order":0
+      },
+     "constrained":{
+       "attribute type":"branch length",
+       "display order":1
+      },
+     "original name":{
+       "attribute type":"node label",
+       "display order":0
+      },
+     "unconstrained":{
+       "attribute type":"branch length",
+       "display order":0
+      }
+    }
+  },
+ "data partitions":{
+   "0":{
+     "coverage":      [
+[0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203, 204, 205, 206, 207, 208, 209, 210, 211, 212, 213, 214, 215, 216, 217, 218, 219, 220, 221, 222, 223, 224, 225, 226, 227, 228, 229, 230, 231, 232, 233, 234, 235, 236, 237, 238, 239, 240, 241, 242, 243, 244, 245, 246, 247, 248, 249, 250, 251, 252, 253, 254, 255, 256, 257, 258, 259, 260, 261, 262, 263, 264, 265, 266, 267, 268, 269, 270, 271, 272, 273, 274, 275, 276, 277, 278, 279, 280, 281, 282, 283, 284, 285, 286, 287, 288, 289, 290, 291, 292, 293, 294, 295, 296, 297, 298, 299, 300, 301, 302, 303, 304, 305, 306, 307, 308, 309, 310, 311, 312, 313, 314, 315, 316, 317, 318, 319, 320, 321, 322, 323, 324, 325, 326, 327, 328, 329, 330, 331, 332, 333, 334, 335, 336, 337, 338, 339, 340, 341, 342, 343, 344, 345, 346, 347, 348, 349, 350, 351, 352, 353, 354, 355, 356, 357, 358, 359, 360, 361, 362, 363, 364, 365, 366, 367, 368, 369, 370, 371, 372, 373, 374, 375, 376, 377, 378, 379, 380, 381, 382, 383, 384, 385, 386, 387, 388, 389, 390, 391, 392, 393, 394, 395, 396, 397, 398, 399, 400, 401, 402, 403, 404, 405, 406, 407, 408, 409, 410, 411, 412, 413, 414, 415, 416, 417, 418, 419, 420, 421, 422, 423, 424, 425, 426, 427, 428, 429, 430, 431, 432, 433, 434, 435, 436, 437, 438, 439] 
+      ],
+     "name":"busted.filter.default"
+    }
+  },
+ "fits":{
+   "Constrained model":{
+     "AIC-c":6398.612664722735,
+     "Log Likelihood":-3168.021928691643,
+     "Rate Distributions":{
+       "Test":{
+         "0":{
+           "omega":0,
+           "proportion":0.6914129319908371
+          },
+         "1":{
+           "omega":0,
+           "proportion":0.07568144722655729
+          },
+         "2":{
+           "omega":1,
+           "proportion":0.2329056207826056
+          }
+        }
+      },
+     "display order":3,
+     "estimated parameters":31
+    },
+   "MG94xREV with separate rates for branch sets":{
+     "AIC-c":6408.899382280021,
+     "Equilibrium frequencies":      [
+[0.07535940345366139],
+      [0.01443006409728228],
+      [0.02915821068672351],
+      [0.02954870567752823],
+      [0.03219408024958758],
+      [0.006164627375802654],
+      [0.01245659774045292],
+      [0.01262342001471309],
+      [0.0276793164843978],
+      [0.005300125700761717],
+      [0.01070973633984303],
+      [0.01085316415297191],
+      [0.0418125103783387],
+      [0.008006395714089126],
+      [0.01617817990958604],
+      [0.0163948426631036],
+      [0.0409913146415633],
+      [0.007849150478922548],
+      [0.01586044121725868],
+      [0.01607284872448998],
+      [0.01751178502783737],
+      [0.003353213651232053],
+      [0.006775694789785172],
+      [0.006866436807635995],
+      [0.01505600521072376],
+      [0.002882972930821469],
+      [0.005825499564956559],
+      [0.005903516300053625],
+      [0.02274367484777162],
+      [0.004355032959661065],
+      [0.008800028033786655],
+      [0.008917880494044083],
+      [0.06143704799998004],
+      [0.01176416611541591],
+      [0.0237713451467977],
+      [0.0240896977132239],
+      [0.0262463496652457],
+      [0.005025736545566795],
+      [0.01015528996016046],
+      [0.01029129247081581],
+      [0.02256567087217255],
+      [0.004320948178469224],
+      [0.008731154380523415],
+      [0.00884808446536876],
+      [0.034087812394816],
+      [0.006527245376826684],
+      [0.01318932435908579],
+      [0.01336595951511979],
+      [0.01178447449308153],
+      [0.02413128354890585],
+      [0.0262916585104385],
+      [0.005034412430862358],
+      [0.01017282094890981],
+      [0.01030905823951665],
+      [0.004328407393735399],
+      [0.008746226896405704],
+      [0.008863358836639712],
+      [0.03414665788893068],
+      [0.006538513303760755],
+      [0.0132120929750345],
+      [0.01338903305480236] 
+      ],
+     "Log Likelihood":-3176.217093030587,
+     "Rate Distributions":{
+       "non-synonymous/synonymous rate ratio for *test*":        [
+[0.231720664913378, 1] 
+        ]
+      },
+     "display order":1,
+     "estimated parameters":28
+    },
+   "Nucleotide GTR":{
+     "AIC-c":6683.094244259512,
+     "Equilibrium frequencies":      [
+[0.4044507575757576],
+      [0.1662878787878788],
+      [0.2095643939393939],
+      [0.2196969696969697] 
+      ],
+     "Log Likelihood":-3320.503280793639,
+     "Rate Distributions":{
+       "Substitution rate from nucleotide A to nucleotide C":0.1815218119292989,
+       "Substitution rate from nucleotide A to nucleotide G":1,
+       "Substitution rate from nucleotide A to nucleotide T":0.08433479296165451,
+       "Substitution rate from nucleotide C to nucleotide G":0.1775869374255926,
+       "Substitution rate from nucleotide C to nucleotide T":1.184827038118431,
+       "Substitution rate from nucleotide G to nucleotide T":0.04288318031815568
+      },
+     "display order":0,
+     "estimated parameters":21
+    },
+   "Unconstrained model":{
+     "AIC-c":6391.938375474656,
+     "Log Likelihood":-3163.666348620609,
+     "Rate Distributions":{
+       "Test":{
+         "0":{
+           "omega":0.1490485393860332,
+           "proportion":0.02658974082564446
+          },
+         "1":{
+           "omega":0.169565784922581,
+           "proportion":0.9641001770967245
+          },
+         "2":{
+           "omega":15.09387961636913,
+           "proportion":0.009310082077631076
+          }
+        }
+      },
+     "display order":2,
+     "estimated parameters":32
+    }
+  },
+ "input":{
+   "file name":"/tmp/tmpfqvtss8b/job_working_directory/000/5/working/./input.nex",
+   "number of sequences":8,
+   "number of sites":440,
+   "partition count":1,
+   "trees":{
+     "0":"((((D_CD_83_ELI,D_CD_83_NDK)Node3,D_UG_94_94UG114)Node2,D_CD_84_84ZR085)Node1,B_US_83_RF,((B_FR_83_HXB2,B_US_86_JRFL)Node10,B_US_90_WEAU160)Node9)"
+    }
+  },
+ "test results":{
+   "LRT":8.711160142067456,
+   "p-value":0.006417496108925114
+  },
+ "tested":{
+   "0":{
+     "B_FR_83_HXB2":"test",
+     "B_US_83_RF":"test",
+     "B_US_86_JRFL":"test",
+     "B_US_90_WEAU160":"test",
+     "D_CD_83_ELI":"test",
+     "D_CD_83_NDK":"test",
+     "D_CD_84_84ZR085":"test",
+     "D_UG_94_94UG114":"test",
+     "Node1":"test",
+     "Node10":"test",
+     "Node2":"test",
+     "Node3":"test",
+     "Node9":"test"
+    }
+  },
+ "timers":{
+   "Constrained BUSTED model fitting":{
+     "order":3,
+     "timer":23
+    },
+   "Overall":{
+     "order":0,
+     "timer":133
+    },
+   "Preliminary model fitting":{
+     "order":1,
+     "timer":4
+    },
+   "Unconstrained BUSTED model fitting":{
+     "order":2,
+     "timer":105
+    }
+  }
+}
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/busted-out2-2.json	Tue Apr 27 18:07:06 2021 +0000
@@ -0,0 +1,1730 @@
+#NEXUS
+
+BEGIN TAXA;
+	DIMENSIONS NTAX = 8;
+	TAXLABELS
+		'B_FR_83_HXB2' 'B_US_83_RF' 'B_US_86_JRFL' 'B_US_90_WEAU160' 'D_CD_83_ELI' 'D_CD_83_NDK' 'D_CD_84_84ZR085' 'D_UG_94_94UG114' ;
+END;
+
+BEGIN CHARACTERS;
+	DIMENSIONS NCHAR = 1320;
+	FORMAT
+		DATATYPE = DNA
+		GAP=-
+		MISSING=?
+	;
+
+MATRIX
+	'B_FR_83_HXB2'    CCCATTAGCCCTATTGAGACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAAGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAGTAGAAATTTGTACAGAGATGGAAAAGGAAGGGAAAATTTCAAAAATTGGGCCTGAAAATCCATACAATACTCCAGTATTTGCCATAAAGAAAAAAGACAGTACTAAATGGAGAAAATTAGTAGATTTCAGAGAACTTAATAAGAGAACTCAAGACTTCTGGGAAGTTCAATTAGGAATACCACATCCCGCAGGGTTAAAAAAGAAAAAATCAGTAACAGTACTGGATGTGGGTGATGCATATTTTTCAGTTCCCTTAGATGAAGACTTCAGGAAGTATACTGCATTTACCATACCTAGTATAAACAATGAGACACCAGGGATTAGATATCAGTACAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAATATTCCAAAGTAGCATGACAAAAATCTTAGAGCCTTTTAGAAAACAAAATCCAGACATAGTTATCTATCAATACATGGATGATTTGTATGTAGGATCTGACTTAGAAATAGGGCAGCATAGAACAAAAATAGAGGAGCTGAGACAACATCTGTTGAGGTGGGGACTTACCACACCAGACAAAAAACATCAGAAAGAACCTCCATTCCTTTGGATGGGTTATGAACTCCATCCTGATAAATGGACAGTACAGCCTATAGTGCTGCCAGAAAAAGACAGCTGGACTGTCAATGACATACAGAAGTTAGTGGGGAAATTGAATTGGGCAAGTCAGATTTACCCAGGGATTAAAGTAAGGCAATTATGTAAACTCCTTAGAGGAACCAAAGCACTAACAGAAGTAATACCACTAACAGAAGAAGCAGAGCTAGAACTGGCAGAAAACAGAGAGATTCTAAAAGAACCAGTACATGGAGTGTATTATGACCCATCAAAAGACTTAATAGCAGAAATACAGAAGCAGGGGCAAGGCCAATGGACATATCAAATTTATCAAGAGCCATTTAAAAATCTGAAAACAGGAAAATATGCAAGAATGAGGGGTGCCCACACTAATGATGTAAAACAATTAACAGAGGCAGTGCAAAAAATAACCACAGAAAGCATAGTAATATGGGGAAAGACTCCTAAATTTAAACTGCCCATACAAAAGGAAACATGGGAAACATGGTGGACAGAGTATTGGCAAGCCACCTGGATTCCTGAGTGGGAGTTTGTTAATACCCCTCCCTTAGTGAAATTATGGTACCAGTTAGAGAAAGAACCCATAGTAGGAGCAGAAACCTTC
+	'B_US_83_RF'      CCCATTAGTCCTATTGAAACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAAGTTAAACAATGGCCATTGACAGAGGAAAAAATAAAAGCATTGGTAGAAATTTGTACAGAAATGGAAAAGGAAGGAAAAATTTCCAAAATTGGGCCTGAAAATCCATACAATACTCCAGTATTTGCCATAAAGAAAAAAGACAGTACTAAATGGAGAAAATTAGTAGATTTCAGAGAACTTAATAAGAGAACTCAAGACTTCTGGGAAGTTCAGTTAGGAATACCACATCCTGCAGGGTTAAAAAAGAAGAAATCAGTAACAGTATTGGATGTGGGTGATGCATATTTTTCAGTTCCCTTAGATAAAGAGTTCAGGAAGTATACTGCATTTACCATACCTAGTATAAACAATGAAACACCACGGATTAGATATCAGTACAATGTGCTTCCACAAGGGTGGAAAGGATCACCAGCAATATTCCAAAGTAGTATGACAAAAATCTTAGAGCCTTTTAAAAAACAAAATCCAGAAATAGTTATCTATCAATACATGGATGATTTGTATGTAGGATCTGATTTAGAAATAGGGCAGCATAGAATAAAAATAGAGGAACTGAGAGAACATCTGTTAAAGTGGGGGTTTACCACACCGGACAAGAAACATCAGAAAGAACCTCCATTTCTTTGGATGGGTTATGAACTCCATCCTGATAAATGGACAGTACAGCCTATAGTGCTGCCAGAAAAAGACAGCTGGACTGTCAATGACATACAGAAGTTAGTGGGAAAATTGAATTGGGCAAGTCAGATTTATGCAGGGATTAAAGTAAAGCAATTATGTAAACTCCTTAGGGGAACCAAAGCACTAACAGAAGTAGTACAACTAACAAAAGAAGCAGAGCTAGAACTGGCAGAAAATAGGGAGATTCTAAAAGAACCAGTACATGGAGTGTATTATGACCCATCAAAAGACTTAATAGCAGAAATACAGAAGCAGGGGCAAGGCCAATGGACATACCAAATTTATCAAGAGCCATTTAAAAACCTGAAAACAGGAAAGTATGCAAGAATGAGGGGTGCCCACACTAATGATGTAAAACAATTAACAGAGGCAGTACAAAAAGTAGCCACAGAAAGCATAGTAATATGGGGAAAGACTCCTAAATTTAAACTACCCATACAAAAAGAAACATGGGAGGCATGGTGGACAGAGTATTGGCAAGCCACCTGGATTCCTGAGTGGGAGTTTGTCAATACCCCTCCCTTAGTAAAATTGTGGTACCAGTTAGAAAAAGAACCCATAATAGGAGCAGAAACTTTC
+	'B_US_86_JRFL'    CCCATTAGTCCTATTGAAACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAAGTCAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAGTAGAAATTTGTACAGAAATGGAAAAGGAAGGGAAAATTTCAAAAATTGGGCCTGAAAATCCATACAATACTCCAGTATTTGCCATAAAGAAAAAGGACAGTACTAAATGGAGAAAATTAGTAGATTTCAGAGAACTTAATAAGAAAACTCAAGACTTCTGGGAAGTTCAATTAGGAATACCACATCCCGCAGGGTTAAAAAAGAGAAAATCAGTAACAGTACTGGATGTGGGTGATGCATATTTTTCAGTTCCCTTAGATAAAGACTTCAGGAAATATACTGCATTTACCATACCTAGTATAAACAATGAGACACCAGGGATTAGGTATCAGTACAATGTGCTTCCGCAGGGATGGAAAGGATCACCAGCAATATTCCAAAGTAGCATGACAAAAATCTTAGAGCCTTTTAGAAAACAAAATCCAGACATAATTATCTATCAATACATGGATGATTTGTATGTAGGATCTGACTTAGAGATAGGGCAGCATAGAGCAAAAATAGAGGAATTGAGACAACATCTGTTGAGGTGGGGGTTTACCACACCAGACAAAAAACATCAGAAAGAACCTCCATTCCTTTGGATGGGTTATGAACTCCATCCTGACAAATGGACAGTACAGCCTATAGTGCTGCCAGAAAAAGACAGCTGGACTGTCAATGACATACAGAAGTTAGTGGGAAAATTAAATTGGGCAAGTCAGATTTACGCAGGGATTAAAGTAAAGCAATTATGTAAACTCCTTAGGGGAACCAAAGCACTAACAGAAGTAATACCACTAACAGAAGAAGCAGAGCTAGAACTGGCAGAAAACAGGGAGATTCTAAAAGAGCCAGTACATGGAGTGTATTATGACCCATCAAAAGACTTAATAGCAGAACTACAGAAGCAGGGGCAAGGCCAATGGACATATCAAATTTATCAAGAGCCATTTAAAATTCTGAAAACAGGAAAATATGCAAGAACGAGGGGTGCCCACACTAATGATGTAAAACAATTAACAGAGGCAGTGCAAAAAATAGCCAATGAAAGCATAGTAATATGGGGAAAGATTCCTAAATTTAAATTACCCATACAAAAAGAAACATGGGAAACATGGTGGACAGAGTATTGGCAAGCCACCTGGATTCCTGAGTGGGAGTTTGTCAATACCCCTCCCTTAGTGAAATTATGGTACCAGTTAGAGAAAGAACCCATAGTAGGAGCAGAAACTTTC
+	'B_US_90_WEAU160' CCCATTAGTCCTATTGAAACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAAGTTAAACAATGGCCATTGACAGAAGAGAAAATAAAAGCATTAGTAGAAATTTGTACAGAAATGGAAAAGGAAGGAAAAATTTCAAAAATTGGGCCTGAAAATCCATATAATACTCCAGTATTTGCCATAAAGAAAAAAGACAGTACTAAATGGAGAAAATTAGTAGATTTCAGAGAACTTAATAAGAGAACTCAAGACTTCTGGGAAGTTCAATTAGGAATACCACATCCTTCAGGGTTAAAAAAGAAAAAATCAGTAACAGTACTGGATGTGGGTGATGCATATTTTTCAGTACCCTTAGATGAAGACTTCAGGAAGTACACTGCATTTACCATACCTAGTATAAACAATGAAACACCAGGGATTAGATATCAGTACAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAATATTCCAAAGTAGCATGACAAAAATATTAGAGCCTTTTAGAAAACAAAATCCAGACATAGTTATCTATCAATACATGGATGATTTGTATGTAGGATCTGACTTAGAAATAGGGCAGCATAGAACAAAAATAGAGGAGCTGAGACAACATCTGTTGAGGTGGGGATTTACCACACCAGACAAAAAACATCAAAAAGACCCTCCATTCCTTTGGATGGGTTATGAACTCCATCCTGATAAATGGACAGTACAGCCTATAAAGCTGCCAGAAAAAGAAAGTTGGACTGTCAATGACATACAGAAGTTAGTGGGAAAATTGAATTGGGCAAGTCAGATTTACGCAGGGATTAAAGTAAAGCAACTATGTAAACTCCTTAGGGGGACCAAAGCACTAACAGAAATAATACCAATAACAGAAGAAGCAGAGCTAGAGCTGGCAGAAAACAGGGAAATTCTAAAAGAACCGGTACATGGAGTGTATTATGACCCATCAAAAGACTTAATAGCAGAGCTACAGAAGCAGGGGCAAGGCCAATGGACATATCAGATTTATCAAGAGCCATTTAAAAATCTGAAAACAGGAAAGTATGCAAGAGTGAGGGGTGCCCACACTAATGATGTAAAACAATTAACAGAGGCAGTGCAGAAAATAACCACAGAAAGCATAGTAATATGGGGAAAGACTCCTAAATTTAAACTACCCATACAAAAAGAAACATGGGAAACATGGTGGACAGAGTATTGGCAAGCCACCTGGATTCCTGAGTGGGAGTTTGTCAATACCCCTCCCTTAGTGAAATTATGGTATCAGTTAGAGAAAGAACCCATAGTAGGAGCAGAAACTTTC
+	'D_CD_83_ELI'     CCAATTAGTCCTATTGAAACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAAGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAACAGAAATTTGTACAGATATGGAAAAGGAAGGAAAAATTTCAAGAATTGGGCCTGAAAATCCATACAATACTCCAATATTTGCCATAAAGAAAAAAGACAGTACCAAGTGGAGAAAATTAGTAGATTTCAGAGAACTTAATAAGAGAACTCAAGATTTCTGGGAAGTTCAATTAGGAATACCGCATCCTGCAGGGCTGAAAAAGAAAAAATCAGTAACAGTACTGGATGTGGGTGATGCATATTTTTCAGTTCCCTTAGATGAAGATTTTAGGAAATATACCGCCTTTACCATATCTAGTATAAACAATGAGACACCAGGGATTAGATATCAGTACAATGTGCTTCCACAGGGATGGAAAGGATCACCGGCAATATTCCAAAGTAGCATGACAAAAATCTTAGAGCCCTTTAGAAAACAAAATCCAGAAATGGTTATCTATCAATACATGGATGATTTGTATGTAGGATCTGACTTAGAAATAGGGCAGCATAGGACAAAAATAGAGAAATTAAGAGAACATCTATTGAGGTGGGGATTTACCAGACCAGATAAAAAACATCAGAAAGAACCCCCATTTCTTTGGATGGGTTATGAACTCCATCCTGATAAATGGACAGTACAGTCTATAAAACTGCCAGAAAAGGAGAGCTGGACTGTCAATGATATACAGAACTTAGTGGAGAGATTAAACTGGGCAAGCCAGATTTATCCAGGAATTAAAGTAAGACAATTATGTAAACTCCTTAGGGGAACCAAAGCACTAACAGAAGTAATACCACTAACAGAAGAAGCAGAATTAGAACTGGCAGAAAACAGGGAAATTTTAAAAGAACCAGTACATGGAGTGTATTATGACCCATCAAAAGACTTAATAGCAGAAATACAGAAACAAGGGCACGGCCAATGGACATACCAAATTTATCAAGAACCATTTAAAAATCTGAAAACAGGAAAGTATGCAAGAATGAGGGGTGCCCACACTAATGATGTAAAGCAATTAGCAGAGGCAGTGCAAAGAATATCCACAGAAAGCATAGTGATATGGGGAAGGACTCCTAAATTTAGACTACCCATACAAAAGGAAACATGGGAAACATGGTGGGCAGAGTATTGGCAAGCCACTTGGATTCCTGAGTGGGAATTTGTCAATACCCCTCCTTTAGTAAAATTATGGTACCAGTTAGAGAAGGAACCCATAATAGGAGCAGAAACTTTC
+	'D_CD_83_NDK'     CCAATTAGTCCTATTGAAACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAAGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAACAGAAATTTGTACAGAAATGGAAAAGGAAGGAAAAATTTCAAGAATTGGGCCTGAAAATCCATATAATACTCCAATATTTGCCATAAAGAAAAAAGACAGTACCAAGTGGAGAAAATTAGTAGATTTCAGAGAACTTAATAAGAGAACTCAAGATTTCTGGGAGGTTCAATTAGGAATACCGCATCCTGCAGGGCTGAAAAAGAAAAAATCAGTAACAGTACTGGATGTGGGTGATGCATATTTCTCAGTTCCCTTAGATGAAGATTTTAGGAAATATACCGCATTTACCATACCTAGTATAAACAATGAGACACCAGGGATTAGATATCAGTACAATGTGCTCCCACAGGGATGGAAAGGATCACCGGCAATATTCCAAAGTAGCATGACAAAAATCTTAGAGCCCTTTAGAAAACAAAATCCAGAAATAGTTATCTATCAATACATGGATGATTTGTATGTAGGATCTGACTTAGAAATAGGGCAGCATAGAACAAAAATAGAGGAATTAAGAGAACATCTATTGAGGTGGGGATTTACCACACCAGATAAAAAACATCAGAAAGAACCTCCATTTCTTTGGATGGGTTATGAACTCCATCCTGATAAATGGACAGTACAGCCTATAAACCTGCCAGAAAAAGAAAGCTGGACTGTCAATGATATACAGAAGTTAGTGGGGAAATTAAACTGGGCAAGCCAGATTTATGCAGGAATTAAAGTAAAGCAATTATGTAAACTCCTTAGGGGAACCAAAGCACTAACAGAAGTAGTACCACTAACAGAAGAAGCAGAATTAGAACTGGCAGAAAACAGGGAAATTCTAAAAGAACCAGTACATGGAGTGTATTATGACCCATCAAAAGACTTAATAGCAGAACTACAGAAACAAGGGGACGGCCAATGGACATACCAAATTTATCAAGAACCATTTAAAAATCTAAAAACAGGAAAGTATGCAAGAACGAGGGGTGCCCACACTAATGATGTAAAACAATTAACAGAGGCAGTGCAAAAAATAGCCACAGAAAGCATAGTGATATGGGGAAAGACTCCTAAATTTAAACTACCCATACAAAAGGAAACATGGGAAACATGGTGGATAGAGTATTGGCAAGCCACCTGGATTCCTGAGTGGGAATTTGTCAATACCCCTCCTTTAGTAAAATTATGGTACCAGTTAGAGAAGGAACCCATAATAGGAGCAGAAACTTTC
+	'D_CD_84_84ZR085' CCAATTAGTCCTATTGAAACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAAGTTAAACAATGGCCGTTGACAGAAGAAAAAATAAAAGCATTAACAGAAATTTGTACAGATATGGAAAAGGAAGGAAAAATTTCAAGAATTGGGCCTGAAAATCCATACAATACTCCAATATTTGCCATAAAGAAAAAAGACAGTACTAAGTGGAGAAAATTAGTAGATTTCAGAGAACTTAATAAGAGAACTCAAGACTTCTGGGAAGTTCAATTAGGGATACCACATCCTGCAGGATTAAAGAAGAAAAAGTCAATAACAGTACTGGATGTGGGCGATGCATATTTTTCAATTCCCTTATGTGAAGACTTTAGGAAGTACACTGCATTTACCATACCTAGTATAAACAATGAGACACCAGGGATTAGATATCAGTACAATGTACTTCCACAGGGATGGAAAGGATCACCAGCAATATTCCAAAGTAGCATGATAAAAATCTTAGAGCCCTTTAGAAAACAAAATCCAGAAGTAGTTATCTATCAATACATGGATGATTTGTATGTAGGATCTGATTTAGAAATAGGACAGCATAGAGCAAAAATAGAGAAATTAAGAGAACATCTGTTGAGGTGGGGGCTTACCACACCAGACAAAAAACATCAGAAAGAACCTCCATTTCTTTGGATGGGTTATGAACTCCATCCTGATAAGTGGACAGTACAGTCTATAACACTGCCAGAGAAAGAAAGCTGGACTGTCAATGATATACAGAAGTTAGTGGGAAAATTAAATTGGGCAAGCCAGATTTATCCAGGAATTAAAGTAAAGCAATTATGTAAACTCCTTAGGGGAACCAAGGCACTAACAGAGGTAATACCACTAACAGAAGAAGCAGAATTAGAACTGGCAGAAAACAGGGAGATTCTAAAGGAACCAATGCATGGAGTGTATTATGACCCATCAAAAGACTTAATAGCAGAATTACAGAAACAAGGGCAAGGTCAATGGACATATCAAATTTATCAAGAACCATTTAAAAATCTGAAAACAGGAAAGTATGCAAGAATGAGGGGTGCCCACACTAATGATGTAAAACAGTTAACAGAGGCAGTGCAAAAAATAGCCATAGAAAGCATAGTGATATGGGGAAAGACTCCTAAATTTAGACTACCCATACAAAAGGAAACATGGGAAACATGGTGGATAGACTATTGGCAAGCCACCTGGATTCCTGAGTGGGAATTTGTCAATACCCCTCCTTTAGTAAAATTATGGTACCAGTTAGAGAAGGAACCCATAATAGGAGCAGAAACTTTC
+	'D_UG_94_94UG114' CCAATTAGTCCTATTGAAACTGTACCAGTAAAATTAAAGCCAGGGATGGATGGCCCAAAAGTTAAACAATGGCCGTTGACAGAAGAAAAAATAAAAGCACTAATAGAAATTTGTTCAGAACTAGAAAAGGAAGGAAAAATTTCAAAAATTGGGCCTGAAAACCCATACAATACTCCAATATTTGCCATAAAGAAAAAAGACAGTACTAAGTGGAGAAAATTAGTAGATTTCAGAGAACTTAATAAGAGAACTCAAGACTTTTGGGAAGTTCAACTAGGAATACCACATCCTGCAGGGCTAAAAAAGAAAAAATCAGTAACAGTACTGGATGTGGGTGACGCATATTTTTCAGTTCCCTTACATGAAGACTTTAGAAAATATACCGCATTCACCATACCTAGTACAAACAATGAGACACCAGGAATTAGATATCAGTACAATGTGCTTCCACAAGGATGGAAAGGATCACCAGCAATATTCCAAAGTAGCATGACAAAAATCTTAGAACCTTTTAGAAAACAAAATCCAGAAATGATTATCTATCAATACATGGATGATTTGTATGTAGGATCTGACTTAGAAATAGGGCAGCATAGAATAAAAATAGAGGAATTAAGGGGACACCTCTTGAAGTGGGGATTTACCACACCAGACAAAAAGTATCAGAAAGAACCCCCATTTCTTTGGATGGGTTATGAACTCCATCCTGATAAGTGGACAGTACAGCCTATACATCTGCCAGAAAAGGAAAGCTGGACTGTCAATGATATACAGAAGTTAGTGGGAAAATTAAATTGGGCAAGCCAGATTTATCCAGGAATTAAAGTAAGACAATTATGCAAATGCCTTAGGGGAGCCAAAGCACTGACAGAAGTAATACCACTGACAGCAGAAGCAGAATTAGAACTGGCAGAAAACAGGGAAATACTAAAAGAACCAGTACATGGAGCGTATTATGACCCATCAAAAGACTTAATAGCAGAAATACAGAAACAAGGGCAAGATCAATGGACATATCAAATATATCAAGAACAATATAAAAATCTGAAAACAGGAAAGTATGCGAAAATGAGGGGTACCCACACTAATGATGTAAAACAATTAACAGAGGCAGTGCAGAAAATAGCCCAAGAATGTATAGTAATATGGGGAAAGACTCCTAAATTTAGACTACCCATACAAAAGGAAACATGGGAAACATGGTGGACAGAGTATTGGCAGGCCACCTGGATTCCTGAGTGGGAGTATGTCAACACCCCTCCTTTAGTTAAATTATGGTATCAGTTAGAGAAGGAACCCATAGTAGGAGCAGAAACTTTC;
+END;
+
+BEGIN TREES;
+	TREE tree = ((((D_CD_83_ELI,D_CD_83_NDK),D_UG_94_94UG114),D_CD_84_84ZR085),B_US_83_RF,((B_FR_83_HXB2,B_US_86_JRFL),B_US_90_WEAU160));
+END;
+
+BEGIN HYPHY;
+
+
+global busted.test.bsrel_mixture_aux_0=0.9641001770967245;
+busted.test.bsrel_mixture_aux_0:<1;
+global busted.test.bsrel_mixture_aux_1=0.7406649580775059;
+busted.test.bsrel_mixture_aux_1:<1;
+global busted.test.omega1=0.169565784922581;
+busted.test.omega1:<1;
+global busted.test.omega2=0.1490485393860332;
+busted.test.omega2:<1;
+global busted.test.omega3=15.09387961636913;
+busted.test.omega3:>1;
+busted.test.omega3:<10000000000;
+global busted.test.theta_GT=0.02357543200455627;
+global busted.test.theta_CT=1.263698936859757;
+global busted.test.theta_AC=0.2111611676313184;
+global busted.test.theta_CG=0.3198378552689968;
+global busted.test.theta_AT=0.08720815485914278;
+global busted.test.theta_AG:=1;
+busted.test_Q_component_1={61,61};
+busted.test_Q_component_1[0][1]:=0.09717451507454297*t*busted.test.theta_AC*busted.test.omega1;
+busted.test_Q_component_1[0][2]:=0.1963563685387479*t*busted.test.theta_AG;
+busted.test_Q_component_1[0][3]:=0.1989860284705866*t*busted.test.omega1*busted.test.theta_AT;
+busted.test_Q_component_1[0][4]:=0.1818409092376876*t*busted.test.theta_AC*busted.test.omega1;
+busted.test_Q_component_1[0][8]:=0.1563402972714242*t*busted.test.omega1*busted.test.theta_AG;
+busted.test_Q_component_1[0][12]:=0.2361684149931496*t*busted.test.omega1*busted.test.theta_AT;
+busted.test_Q_component_1[0][16]:=0.1712746635706107*t*busted.test.theta_AC*busted.test.omega1;
+busted.test_Q_component_1[0][32]:=0.2567033972679326*t*busted.test.omega1*busted.test.theta_AG;
+busted.test_Q_component_1[1][0]:=0.5074830879161225*t*busted.test.theta_AC*busted.test.omega1;
+busted.test_Q_component_1[1][2]:=0.1963563685387479*t*busted.test.omega1*busted.test.theta_CG;
+busted.test_Q_component_1[1][3]:=0.1989860284705866*t*busted.test.theta_CT;
+busted.test_Q_component_1[1][5]:=0.1818409092376876*t*busted.test.theta_AC*busted.test.omega1;
+busted.test_Q_component_1[1][9]:=0.1563402972714242*t*busted.test.omega1*busted.test.theta_AG;
+busted.test_Q_component_1[1][13]:=0.2361684149931496*t*busted.test.omega1*busted.test.theta_AT;
+busted.test_Q_component_1[1][17]:=0.1712746635706107*t*busted.test.theta_AC*busted.test.omega1;
+busted.test_Q_component_1[1][33]:=0.2567033972679326*t*busted.test.omega1*busted.test.theta_AG;
+busted.test_Q_component_1[1][48]:=0.257146542110382*t*busted.test.omega1*busted.test.theta_AT;
+busted.test_Q_component_1[2][0]:=0.5074830879161225*t*busted.test.theta_AG;
+busted.test_Q_component_1[2][1]:=0.09717451507454297*t*busted.test.omega1*busted.test.theta_CG;
+busted.test_Q_component_1[2][3]:=0.1989860284705866*t*busted.test.omega1*busted.test.theta_GT;
+busted.test_Q_component_1[2][6]:=0.1818409092376876*t*busted.test.theta_AC*busted.test.omega1;
+busted.test_Q_component_1[2][10]:=0.1563402972714242*t*busted.test.omega1*busted.test.theta_AG;
+busted.test_Q_component_1[2][14]:=0.2361684149931496*t*busted.test.omega1*busted.test.theta_AT;
+busted.test_Q_component_1[2][18]:=0.1712746635706107*t*busted.test.theta_AC*busted.test.omega1;
+busted.test_Q_component_1[2][34]:=0.2567033972679326*t*busted.test.omega1*busted.test.theta_AG;
+busted.test_Q_component_1[3][0]:=0.5074830879161225*t*busted.test.omega1*busted.test.theta_AT;
+busted.test_Q_component_1[3][1]:=0.09717451507454297*t*busted.test.theta_CT;
+busted.test_Q_component_1[3][2]:=0.1963563685387479*t*busted.test.omega1*busted.test.theta_GT;
+busted.test_Q_component_1[3][7]:=0.1818409092376876*t*busted.test.theta_AC*busted.test.omega1;
+busted.test_Q_component_1[3][11]:=0.1563402972714242*t*busted.test.omega1*busted.test.theta_AG;
+busted.test_Q_component_1[3][15]:=0.2361684149931496*t*busted.test.omega1*busted.test.theta_AT;
+busted.test_Q_component_1[3][19]:=0.1712746635706107*t*busted.test.theta_AC*busted.test.omega1;
+busted.test_Q_component_1[3][35]:=0.2567033972679326*t*busted.test.omega1*busted.test.theta_AG;
+busted.test_Q_component_1[3][49]:=0.257146542110382*t*busted.test.omega1*busted.test.theta_AT;
+busted.test_Q_component_1[4][0]:=0.4256503784977386*t*busted.test.theta_AC*busted.test.omega1;
+busted.test_Q_component_1[4][5]:=0.09717451507454297*t*busted.test.theta_AC;
+busted.test_Q_component_1[4][6]:=0.1963563685387479*t*busted.test.theta_AG;
+busted.test_Q_component_1[4][7]:=0.1989860284705866*t*busted.test.theta_AT;
+busted.test_Q_component_1[4][8]:=0.1563402972714242*t*busted.test.omega1*busted.test.theta_CG;
+busted.test_Q_component_1[4][12]:=0.2361684149931496*t*busted.test.omega1*busted.test.theta_CT;
+busted.test_Q_component_1[4][20]:=0.1712746635706107*t*busted.test.theta_AC*busted.test.omega1;
+busted.test_Q_component_1[4][36]:=0.2567033972679326*t*busted.test.omega1*busted.test.theta_AG;
+busted.test_Q_component_1[4][50]:=0.257146542110382*t*busted.test.omega1*busted.test.theta_AT;
+busted.test_Q_component_1[5][1]:=0.4256503784977386*t*busted.test.theta_AC*busted.test.omega1;
+busted.test_Q_component_1[5][4]:=0.5074830879161225*t*busted.test.theta_AC;
+busted.test_Q_component_1[5][6]:=0.1963563685387479*t*busted.test.theta_CG;
+busted.test_Q_component_1[5][7]:=0.1989860284705866*t*busted.test.theta_CT;
+busted.test_Q_component_1[5][9]:=0.1563402972714242*t*busted.test.omega1*busted.test.theta_CG;
+busted.test_Q_component_1[5][13]:=0.2361684149931496*t*busted.test.omega1*busted.test.theta_CT;
+busted.test_Q_component_1[5][21]:=0.1712746635706107*t*busted.test.theta_AC*busted.test.omega1;
+busted.test_Q_component_1[5][37]:=0.2567033972679326*t*busted.test.omega1*busted.test.theta_AG;
+busted.test_Q_component_1[5][51]:=0.257146542110382*t*busted.test.omega1*busted.test.theta_AT;
+busted.test_Q_component_1[6][2]:=0.4256503784977386*t*busted.test.theta_AC*busted.test.omega1;
+busted.test_Q_component_1[6][4]:=0.5074830879161225*t*busted.test.theta_AG;
+busted.test_Q_component_1[6][5]:=0.09717451507454297*t*busted.test.theta_CG;
+busted.test_Q_component_1[6][7]:=0.1989860284705866*t*busted.test.theta_GT;
+busted.test_Q_component_1[6][10]:=0.1563402972714242*t*busted.test.omega1*busted.test.theta_CG;
+busted.test_Q_component_1[6][14]:=0.2361684149931496*t*busted.test.omega1*busted.test.theta_CT;
+busted.test_Q_component_1[6][22]:=0.1712746635706107*t*busted.test.theta_AC*busted.test.omega1;
+busted.test_Q_component_1[6][38]:=0.2567033972679326*t*busted.test.omega1*busted.test.theta_AG;
+busted.test_Q_component_1[6][52]:=0.257146542110382*t*busted.test.omega1*busted.test.theta_AT;
+busted.test_Q_component_1[7][3]:=0.4256503784977386*t*busted.test.theta_AC*busted.test.omega1;
+busted.test_Q_component_1[7][4]:=0.5074830879161225*t*busted.test.theta_AT;
+busted.test_Q_component_1[7][5]:=0.09717451507454297*t*busted.test.theta_CT;
+busted.test_Q_component_1[7][6]:=0.1963563685387479*t*busted.test.theta_GT;
+busted.test_Q_component_1[7][11]:=0.1563402972714242*t*busted.test.omega1*busted.test.theta_CG;
+busted.test_Q_component_1[7][15]:=0.2361684149931496*t*busted.test.omega1*busted.test.theta_CT;
+busted.test_Q_component_1[7][23]:=0.1712746635706107*t*busted.test.theta_AC*busted.test.omega1;
+busted.test_Q_component_1[7][39]:=0.2567033972679326*t*busted.test.omega1*busted.test.theta_AG;
+busted.test_Q_component_1[7][53]:=0.257146542110382*t*busted.test.omega1*busted.test.theta_AT;
+busted.test_Q_component_1[8][0]:=0.4256503784977386*t*busted.test.omega1*busted.test.theta_AG;
+busted.test_Q_component_1[8][4]:=0.1818409092376876*t*busted.test.omega1*busted.test.theta_CG;
+busted.test_Q_component_1[8][9]:=0.09717451507454297*t*busted.test.theta_AC*busted.test.omega1;
+busted.test_Q_component_1[8][10]:=0.1963563685387479*t*busted.test.theta_AG;
+busted.test_Q_component_1[8][11]:=0.1989860284705866*t*busted.test.omega1*busted.test.theta_AT;
+busted.test_Q_component_1[8][12]:=0.2361684149931496*t*busted.test.omega1*busted.test.theta_GT;
+busted.test_Q_component_1[8][24]:=0.1712746635706107*t*busted.test.theta_AC;
+busted.test_Q_component_1[8][40]:=0.2567033972679326*t*busted.test.omega1*busted.test.theta_AG;
+busted.test_Q_component_1[9][1]:=0.4256503784977386*t*busted.test.omega1*busted.test.theta_AG;
+busted.test_Q_component_1[9][5]:=0.1818409092376876*t*busted.test.omega1*busted.test.theta_CG;
+busted.test_Q_component_1[9][8]:=0.5074830879161225*t*busted.test.theta_AC*busted.test.omega1;
+busted.test_Q_component_1[9][10]:=0.1963563685387479*t*busted.test.omega1*busted.test.theta_CG;
+busted.test_Q_component_1[9][11]:=0.1989860284705866*t*busted.test.theta_CT;
+busted.test_Q_component_1[9][13]:=0.2361684149931496*t*busted.test.omega1*busted.test.theta_GT;
+busted.test_Q_component_1[9][25]:=0.1712746635706107*t*busted.test.theta_AC*busted.test.omega1;
+busted.test_Q_component_1[9][41]:=0.2567033972679326*t*busted.test.omega1*busted.test.theta_AG;
+busted.test_Q_component_1[9][54]:=0.257146542110382*t*busted.test.omega1*busted.test.theta_AT;
+busted.test_Q_component_1[10][2]:=0.4256503784977386*t*busted.test.omega1*busted.test.theta_AG;
+busted.test_Q_component_1[10][6]:=0.1818409092376876*t*busted.test.omega1*busted.test.theta_CG;
+busted.test_Q_component_1[10][8]:=0.5074830879161225*t*busted.test.theta_AG;
+busted.test_Q_component_1[10][9]:=0.09717451507454297*t*busted.test.omega1*busted.test.theta_CG;
+busted.test_Q_component_1[10][11]:=0.1989860284705866*t*busted.test.omega1*busted.test.theta_GT;
+busted.test_Q_component_1[10][14]:=0.2361684149931496*t*busted.test.omega1*busted.test.theta_GT;
+busted.test_Q_component_1[10][26]:=0.1712746635706107*t*busted.test.theta_AC;
+busted.test_Q_component_1[10][42]:=0.2567033972679326*t*busted.test.omega1*busted.test.theta_AG;
+busted.test_Q_component_1[10][55]:=0.257146542110382*t*busted.test.omega1*busted.test.theta_AT;
+busted.test_Q_component_1[11][3]:=0.4256503784977386*t*busted.test.omega1*busted.test.theta_AG;
+busted.test_Q_component_1[11][7]:=0.1818409092376876*t*busted.test.omega1*busted.test.theta_CG;
+busted.test_Q_component_1[11][8]:=0.5074830879161225*t*busted.test.omega1*busted.test.theta_AT;
+busted.test_Q_component_1[11][9]:=0.09717451507454297*t*busted.test.theta_CT;
+busted.test_Q_component_1[11][10]:=0.1963563685387479*t*busted.test.omega1*busted.test.theta_GT;
+busted.test_Q_component_1[11][15]:=0.2361684149931496*t*busted.test.omega1*busted.test.theta_GT;
+busted.test_Q_component_1[11][27]:=0.1712746635706107*t*busted.test.theta_AC*busted.test.omega1;
+busted.test_Q_component_1[11][43]:=0.2567033972679326*t*busted.test.omega1*busted.test.theta_AG;
+busted.test_Q_component_1[11][56]:=0.257146542110382*t*busted.test.omega1*busted.test.theta_AT;
+busted.test_Q_component_1[12][0]:=0.4256503784977386*t*busted.test.omega1*busted.test.theta_AT;
+busted.test_Q_component_1[12][4]:=0.1818409092376876*t*busted.test.omega1*busted.test.theta_CT;
+busted.test_Q_component_1[12][8]:=0.1563402972714242*t*busted.test.omega1*busted.test.theta_GT;
+busted.test_Q_component_1[12][13]:=0.09717451507454297*t*busted.test.theta_AC;
+busted.test_Q_component_1[12][14]:=0.1963563685387479*t*busted.test.omega1*busted.test.theta_AG;
+busted.test_Q_component_1[12][15]:=0.1989860284705866*t*busted.test.theta_AT;
+busted.test_Q_component_1[12][28]:=0.1712746635706107*t*busted.test.theta_AC*busted.test.omega1;
+busted.test_Q_component_1[12][44]:=0.2567033972679326*t*busted.test.omega1*busted.test.theta_AG;
+busted.test_Q_component_1[12][57]:=0.257146542110382*t*busted.test.omega1*busted.test.theta_AT;
+busted.test_Q_component_1[13][1]:=0.4256503784977386*t*busted.test.omega1*busted.test.theta_AT;
+busted.test_Q_component_1[13][5]:=0.1818409092376876*t*busted.test.omega1*busted.test.theta_CT;
+busted.test_Q_component_1[13][9]:=0.1563402972714242*t*busted.test.omega1*busted.test.theta_GT;
+busted.test_Q_component_1[13][12]:=0.5074830879161225*t*busted.test.theta_AC;
+busted.test_Q_component_1[13][14]:=0.1963563685387479*t*busted.test.omega1*busted.test.theta_CG;
+busted.test_Q_component_1[13][15]:=0.1989860284705866*t*busted.test.theta_CT;
+busted.test_Q_component_1[13][29]:=0.1712746635706107*t*busted.test.theta_AC*busted.test.omega1;
+busted.test_Q_component_1[13][45]:=0.2567033972679326*t*busted.test.omega1*busted.test.theta_AG;
+busted.test_Q_component_1[13][58]:=0.257146542110382*t*busted.test.omega1*busted.test.theta_AT;
+busted.test_Q_component_1[14][2]:=0.4256503784977386*t*busted.test.omega1*busted.test.theta_AT;
+busted.test_Q_component_1[14][6]:=0.1818409092376876*t*busted.test.omega1*busted.test.theta_CT;
+busted.test_Q_component_1[14][10]:=0.1563402972714242*t*busted.test.omega1*busted.test.theta_GT;
+busted.test_Q_component_1[14][12]:=0.5074830879161225*t*busted.test.omega1*busted.test.theta_AG;
+busted.test_Q_component_1[14][13]:=0.09717451507454297*t*busted.test.omega1*busted.test.theta_CG;
+busted.test_Q_component_1[14][15]:=0.1989860284705866*t*busted.test.omega1*busted.test.theta_GT;
+busted.test_Q_component_1[14][30]:=0.1712746635706107*t*busted.test.theta_AC*busted.test.omega1;
+busted.test_Q_component_1[14][46]:=0.2567033972679326*t*busted.test.omega1*busted.test.theta_AG;
+busted.test_Q_component_1[14][59]:=0.257146542110382*t*busted.test.omega1*busted.test.theta_AT;
+busted.test_Q_component_1[15][3]:=0.4256503784977386*t*busted.test.omega1*busted.test.theta_AT;
+busted.test_Q_component_1[15][7]:=0.1818409092376876*t*busted.test.omega1*busted.test.theta_CT;
+busted.test_Q_component_1[15][11]:=0.1563402972714242*t*busted.test.omega1*busted.test.theta_GT;
+busted.test_Q_component_1[15][12]:=0.5074830879161225*t*busted.test.theta_AT;
+busted.test_Q_component_1[15][13]:=0.09717451507454297*t*busted.test.theta_CT;
+busted.test_Q_component_1[15][14]:=0.1963563685387479*t*busted.test.omega1*busted.test.theta_GT;
+busted.test_Q_component_1[15][31]:=0.1712746635706107*t*busted.test.theta_AC*busted.test.omega1;
+busted.test_Q_component_1[15][47]:=0.2567033972679326*t*busted.test.omega1*busted.test.theta_AG;
+busted.test_Q_component_1[15][60]:=0.257146542110382*t*busted.test.omega1*busted.test.theta_AT;
+busted.test_Q_component_1[16][0]:=0.3148753970510747*t*busted.test.theta_AC*busted.test.omega1;
+busted.test_Q_component_1[16][17]:=0.09717451507454297*t*busted.test.theta_AC*busted.test.omega1;
+busted.test_Q_component_1[16][18]:=0.1963563685387479*t*busted.test.theta_AG;
+busted.test_Q_component_1[16][19]:=0.1989860284705866*t*busted.test.omega1*busted.test.theta_AT;
+busted.test_Q_component_1[16][20]:=0.1818409092376876*t*busted.test.theta_AC*busted.test.omega1;
+busted.test_Q_component_1[16][24]:=0.1563402972714242*t*busted.test.omega1*busted.test.theta_AG;
+busted.test_Q_component_1[16][28]:=0.2361684149931496*t*busted.test.omega1*busted.test.theta_AT;
+busted.test_Q_component_1[16][32]:=0.2567033972679326*t*busted.test.omega1*busted.test.theta_CG;
+busted.test_Q_component_1[17][1]:=0.3148753970510747*t*busted.test.theta_AC*busted.test.omega1;
+busted.test_Q_component_1[17][16]:=0.5074830879161225*t*busted.test.theta_AC*busted.test.omega1;
+busted.test_Q_component_1[17][18]:=0.1963563685387479*t*busted.test.omega1*busted.test.theta_CG;
+busted.test_Q_component_1[17][19]:=0.1989860284705866*t*busted.test.theta_CT;
+busted.test_Q_component_1[17][21]:=0.1818409092376876*t*busted.test.theta_AC*busted.test.omega1;
+busted.test_Q_component_1[17][25]:=0.1563402972714242*t*busted.test.omega1*busted.test.theta_AG;
+busted.test_Q_component_1[17][29]:=0.2361684149931496*t*busted.test.omega1*busted.test.theta_AT;
+busted.test_Q_component_1[17][33]:=0.2567033972679326*t*busted.test.omega1*busted.test.theta_CG;
+busted.test_Q_component_1[17][48]:=0.257146542110382*t*busted.test.omega1*busted.test.theta_CT;
+busted.test_Q_component_1[18][2]:=0.3148753970510747*t*busted.test.theta_AC*busted.test.omega1;
+busted.test_Q_component_1[18][16]:=0.5074830879161225*t*busted.test.theta_AG;
+busted.test_Q_component_1[18][17]:=0.09717451507454297*t*busted.test.omega1*busted.test.theta_CG;
+busted.test_Q_component_1[18][19]:=0.1989860284705866*t*busted.test.omega1*busted.test.theta_GT;
+busted.test_Q_component_1[18][22]:=0.1818409092376876*t*busted.test.theta_AC*busted.test.omega1;
+busted.test_Q_component_1[18][26]:=0.1563402972714242*t*busted.test.omega1*busted.test.theta_AG;
+busted.test_Q_component_1[18][30]:=0.2361684149931496*t*busted.test.omega1*busted.test.theta_AT;
+busted.test_Q_component_1[18][34]:=0.2567033972679326*t*busted.test.omega1*busted.test.theta_CG;
+busted.test_Q_component_1[19][3]:=0.3148753970510747*t*busted.test.theta_AC*busted.test.omega1;
+busted.test_Q_component_1[19][16]:=0.5074830879161225*t*busted.test.omega1*busted.test.theta_AT;
+busted.test_Q_component_1[19][17]:=0.09717451507454297*t*busted.test.theta_CT;
+busted.test_Q_component_1[19][18]:=0.1963563685387479*t*busted.test.omega1*busted.test.theta_GT;
+busted.test_Q_component_1[19][23]:=0.1818409092376876*t*busted.test.theta_AC*busted.test.omega1;
+busted.test_Q_component_1[19][27]:=0.1563402972714242*t*busted.test.omega1*busted.test.theta_AG;
+busted.test_Q_component_1[19][31]:=0.2361684149931496*t*busted.test.omega1*busted.test.theta_AT;
+busted.test_Q_component_1[19][35]:=0.2567033972679326*t*busted.test.omega1*busted.test.theta_CG;
+busted.test_Q_component_1[19][49]:=0.257146542110382*t*busted.test.omega1*busted.test.theta_CT;
+busted.test_Q_component_1[20][4]:=0.3148753970510747*t*busted.test.theta_AC*busted.test.omega1;
+busted.test_Q_component_1[20][16]:=0.4256503784977386*t*busted.test.theta_AC*busted.test.omega1;
+busted.test_Q_component_1[20][21]:=0.09717451507454297*t*busted.test.theta_AC;
+busted.test_Q_component_1[20][22]:=0.1963563685387479*t*busted.test.theta_AG;
+busted.test_Q_component_1[20][23]:=0.1989860284705866*t*busted.test.theta_AT;
+busted.test_Q_component_1[20][24]:=0.1563402972714242*t*busted.test.omega1*busted.test.theta_CG;
+busted.test_Q_component_1[20][28]:=0.2361684149931496*t*busted.test.omega1*busted.test.theta_CT;
+busted.test_Q_component_1[20][36]:=0.2567033972679326*t*busted.test.omega1*busted.test.theta_CG;
+busted.test_Q_component_1[20][50]:=0.257146542110382*t*busted.test.omega1*busted.test.theta_CT;
+busted.test_Q_component_1[21][5]:=0.3148753970510747*t*busted.test.theta_AC*busted.test.omega1;
+busted.test_Q_component_1[21][17]:=0.4256503784977386*t*busted.test.theta_AC*busted.test.omega1;
+busted.test_Q_component_1[21][20]:=0.5074830879161225*t*busted.test.theta_AC;
+busted.test_Q_component_1[21][22]:=0.1963563685387479*t*busted.test.theta_CG;
+busted.test_Q_component_1[21][23]:=0.1989860284705866*t*busted.test.theta_CT;
+busted.test_Q_component_1[21][25]:=0.1563402972714242*t*busted.test.omega1*busted.test.theta_CG;
+busted.test_Q_component_1[21][29]:=0.2361684149931496*t*busted.test.omega1*busted.test.theta_CT;
+busted.test_Q_component_1[21][37]:=0.2567033972679326*t*busted.test.omega1*busted.test.theta_CG;
+busted.test_Q_component_1[21][51]:=0.257146542110382*t*busted.test.omega1*busted.test.theta_CT;
+busted.test_Q_component_1[22][6]:=0.3148753970510747*t*busted.test.theta_AC*busted.test.omega1;
+busted.test_Q_component_1[22][18]:=0.4256503784977386*t*busted.test.theta_AC*busted.test.omega1;
+busted.test_Q_component_1[22][20]:=0.5074830879161225*t*busted.test.theta_AG;
+busted.test_Q_component_1[22][21]:=0.09717451507454297*t*busted.test.theta_CG;
+busted.test_Q_component_1[22][23]:=0.1989860284705866*t*busted.test.theta_GT;
+busted.test_Q_component_1[22][26]:=0.1563402972714242*t*busted.test.omega1*busted.test.theta_CG;
+busted.test_Q_component_1[22][30]:=0.2361684149931496*t*busted.test.omega1*busted.test.theta_CT;
+busted.test_Q_component_1[22][38]:=0.2567033972679326*t*busted.test.omega1*busted.test.theta_CG;
+busted.test_Q_component_1[22][52]:=0.257146542110382*t*busted.test.omega1*busted.test.theta_CT;
+busted.test_Q_component_1[23][7]:=0.3148753970510747*t*busted.test.theta_AC*busted.test.omega1;
+busted.test_Q_component_1[23][19]:=0.4256503784977386*t*busted.test.theta_AC*busted.test.omega1;
+busted.test_Q_component_1[23][20]:=0.5074830879161225*t*busted.test.theta_AT;
+busted.test_Q_component_1[23][21]:=0.09717451507454297*t*busted.test.theta_CT;
+busted.test_Q_component_1[23][22]:=0.1963563685387479*t*busted.test.theta_GT;
+busted.test_Q_component_1[23][27]:=0.1563402972714242*t*busted.test.omega1*busted.test.theta_CG;
+busted.test_Q_component_1[23][31]:=0.2361684149931496*t*busted.test.omega1*busted.test.theta_CT;
+busted.test_Q_component_1[23][39]:=0.2567033972679326*t*busted.test.omega1*busted.test.theta_CG;
+busted.test_Q_component_1[23][53]:=0.257146542110382*t*busted.test.omega1*busted.test.theta_CT;
+busted.test_Q_component_1[24][8]:=0.3148753970510747*t*busted.test.theta_AC;
+busted.test_Q_component_1[24][16]:=0.4256503784977386*t*busted.test.omega1*busted.test.theta_AG;
+busted.test_Q_component_1[24][20]:=0.1818409092376876*t*busted.test.omega1*busted.test.theta_CG;
+busted.test_Q_component_1[24][25]:=0.09717451507454297*t*busted.test.theta_AC;
+busted.test_Q_component_1[24][26]:=0.1963563685387479*t*busted.test.theta_AG;
+busted.test_Q_component_1[24][27]:=0.1989860284705866*t*busted.test.theta_AT;
+busted.test_Q_component_1[24][28]:=0.2361684149931496*t*busted.test.omega1*busted.test.theta_GT;
+busted.test_Q_component_1[24][40]:=0.2567033972679326*t*busted.test.omega1*busted.test.theta_CG;
+busted.test_Q_component_1[25][9]:=0.3148753970510747*t*busted.test.theta_AC*busted.test.omega1;
+busted.test_Q_component_1[25][17]:=0.4256503784977386*t*busted.test.omega1*busted.test.theta_AG;
+busted.test_Q_component_1[25][21]:=0.1818409092376876*t*busted.test.omega1*busted.test.theta_CG;
+busted.test_Q_component_1[25][24]:=0.5074830879161225*t*busted.test.theta_AC;
+busted.test_Q_component_1[25][26]:=0.1963563685387479*t*busted.test.theta_CG;
+busted.test_Q_component_1[25][27]:=0.1989860284705866*t*busted.test.theta_CT;
+busted.test_Q_component_1[25][29]:=0.2361684149931496*t*busted.test.omega1*busted.test.theta_GT;
+busted.test_Q_component_1[25][41]:=0.2567033972679326*t*busted.test.omega1*busted.test.theta_CG;
+busted.test_Q_component_1[25][54]:=0.257146542110382*t*busted.test.omega1*busted.test.theta_CT;
+busted.test_Q_component_1[26][10]:=0.3148753970510747*t*busted.test.theta_AC;
+busted.test_Q_component_1[26][18]:=0.4256503784977386*t*busted.test.omega1*busted.test.theta_AG;
+busted.test_Q_component_1[26][22]:=0.1818409092376876*t*busted.test.omega1*busted.test.theta_CG;
+busted.test_Q_component_1[26][24]:=0.5074830879161225*t*busted.test.theta_AG;
+busted.test_Q_component_1[26][25]:=0.09717451507454297*t*busted.test.theta_CG;
+busted.test_Q_component_1[26][27]:=0.1989860284705866*t*busted.test.theta_GT;
+busted.test_Q_component_1[26][30]:=0.2361684149931496*t*busted.test.omega1*busted.test.theta_GT;
+busted.test_Q_component_1[26][42]:=0.2567033972679326*t*busted.test.omega1*busted.test.theta_CG;
+busted.test_Q_component_1[26][55]:=0.257146542110382*t*busted.test.omega1*busted.test.theta_CT;
+busted.test_Q_component_1[27][11]:=0.3148753970510747*t*busted.test.theta_AC*busted.test.omega1;
+busted.test_Q_component_1[27][19]:=0.4256503784977386*t*busted.test.omega1*busted.test.theta_AG;
+busted.test_Q_component_1[27][23]:=0.1818409092376876*t*busted.test.omega1*busted.test.theta_CG;
+busted.test_Q_component_1[27][24]:=0.5074830879161225*t*busted.test.theta_AT;
+busted.test_Q_component_1[27][25]:=0.09717451507454297*t*busted.test.theta_CT;
+busted.test_Q_component_1[27][26]:=0.1963563685387479*t*busted.test.theta_GT;
+busted.test_Q_component_1[27][31]:=0.2361684149931496*t*busted.test.omega1*busted.test.theta_GT;
+busted.test_Q_component_1[27][43]:=0.2567033972679326*t*busted.test.omega1*busted.test.theta_CG;
+busted.test_Q_component_1[27][56]:=0.257146542110382*t*busted.test.omega1*busted.test.theta_CT;
+busted.test_Q_component_1[28][12]:=0.3148753970510747*t*busted.test.theta_AC*busted.test.omega1;
+busted.test_Q_component_1[28][16]:=0.4256503784977386*t*busted.test.omega1*busted.test.theta_AT;
+busted.test_Q_component_1[28][20]:=0.1818409092376876*t*busted.test.omega1*busted.test.theta_CT;
+busted.test_Q_component_1[28][24]:=0.1563402972714242*t*busted.test.omega1*busted.test.theta_GT;
+busted.test_Q_component_1[28][29]:=0.09717451507454297*t*busted.test.theta_AC;
+busted.test_Q_component_1[28][30]:=0.1963563685387479*t*busted.test.theta_AG;
+busted.test_Q_component_1[28][31]:=0.1989860284705866*t*busted.test.theta_AT;
+busted.test_Q_component_1[28][44]:=0.2567033972679326*t*busted.test.omega1*busted.test.theta_CG;
+busted.test_Q_component_1[28][57]:=0.257146542110382*t*busted.test.theta_CT;
+busted.test_Q_component_1[29][13]:=0.3148753970510747*t*busted.test.theta_AC*busted.test.omega1;
+busted.test_Q_component_1[29][17]:=0.4256503784977386*t*busted.test.omega1*busted.test.theta_AT;
+busted.test_Q_component_1[29][21]:=0.1818409092376876*t*busted.test.omega1*busted.test.theta_CT;
+busted.test_Q_component_1[29][25]:=0.1563402972714242*t*busted.test.omega1*busted.test.theta_GT;
+busted.test_Q_component_1[29][28]:=0.5074830879161225*t*busted.test.theta_AC;
+busted.test_Q_component_1[29][30]:=0.1963563685387479*t*busted.test.theta_CG;
+busted.test_Q_component_1[29][31]:=0.1989860284705866*t*busted.test.theta_CT;
+busted.test_Q_component_1[29][45]:=0.2567033972679326*t*busted.test.omega1*busted.test.theta_CG;
+busted.test_Q_component_1[29][58]:=0.257146542110382*t*busted.test.omega1*busted.test.theta_CT;
+busted.test_Q_component_1[30][14]:=0.3148753970510747*t*busted.test.theta_AC*busted.test.omega1;
+busted.test_Q_component_1[30][18]:=0.4256503784977386*t*busted.test.omega1*busted.test.theta_AT;
+busted.test_Q_component_1[30][22]:=0.1818409092376876*t*busted.test.omega1*busted.test.theta_CT;
+busted.test_Q_component_1[30][26]:=0.1563402972714242*t*busted.test.omega1*busted.test.theta_GT;
+busted.test_Q_component_1[30][28]:=0.5074830879161225*t*busted.test.theta_AG;
+busted.test_Q_component_1[30][29]:=0.09717451507454297*t*busted.test.theta_CG;
+busted.test_Q_component_1[30][31]:=0.1989860284705866*t*busted.test.theta_GT;
+busted.test_Q_component_1[30][46]:=0.2567033972679326*t*busted.test.omega1*busted.test.theta_CG;
+busted.test_Q_component_1[30][59]:=0.257146542110382*t*busted.test.theta_CT;
+busted.test_Q_component_1[31][15]:=0.3148753970510747*t*busted.test.theta_AC*busted.test.omega1;
+busted.test_Q_component_1[31][19]:=0.4256503784977386*t*busted.test.omega1*busted.test.theta_AT;
+busted.test_Q_component_1[31][23]:=0.1818409092376876*t*busted.test.omega1*busted.test.theta_CT;
+busted.test_Q_component_1[31][27]:=0.1563402972714242*t*busted.test.omega1*busted.test.theta_GT;
+busted.test_Q_component_1[31][28]:=0.5074830879161225*t*busted.test.theta_AT;
+busted.test_Q_component_1[31][29]:=0.09717451507454297*t*busted.test.theta_CT;
+busted.test_Q_component_1[31][30]:=0.1963563685387479*t*busted.test.theta_GT;
+busted.test_Q_component_1[31][47]:=0.2567033972679326*t*busted.test.omega1*busted.test.theta_CG;
+busted.test_Q_component_1[31][60]:=0.257146542110382*t*busted.test.omega1*busted.test.theta_CT;
+busted.test_Q_component_1[32][0]:=0.3148753970510747*t*busted.test.omega1*busted.test.theta_AG;
+busted.test_Q_component_1[32][16]:=0.1712746635706107*t*busted.test.omega1*busted.test.theta_CG;
+busted.test_Q_component_1[32][33]:=0.09717451507454297*t*busted.test.theta_AC*busted.test.omega1;
+busted.test_Q_component_1[32][34]:=0.1963563685387479*t*busted.test.theta_AG;
+busted.test_Q_component_1[32][35]:=0.1989860284705866*t*busted.test.omega1*busted.test.theta_AT;
+busted.test_Q_component_1[32][36]:=0.1818409092376876*t*busted.test.theta_AC*busted.test.omega1;
+busted.test_Q_component_1[32][40]:=0.1563402972714242*t*busted.test.omega1*busted.test.theta_AG;
+busted.test_Q_component_1[32][44]:=0.2361684149931496*t*busted.test.omega1*busted.test.theta_AT;
+busted.test_Q_component_1[33][1]:=0.3148753970510747*t*busted.test.omega1*busted.test.theta_AG;
+busted.test_Q_component_1[33][17]:=0.1712746635706107*t*busted.test.omega1*busted.test.theta_CG;
+busted.test_Q_component_1[33][32]:=0.5074830879161225*t*busted.test.theta_AC*busted.test.omega1;
+busted.test_Q_component_1[33][34]:=0.1963563685387479*t*busted.test.omega1*busted.test.theta_CG;
+busted.test_Q_component_1[33][35]:=0.1989860284705866*t*busted.test.theta_CT;
+busted.test_Q_component_1[33][37]:=0.1818409092376876*t*busted.test.theta_AC*busted.test.omega1;
+busted.test_Q_component_1[33][41]:=0.1563402972714242*t*busted.test.omega1*busted.test.theta_AG;
+busted.test_Q_component_1[33][45]:=0.2361684149931496*t*busted.test.omega1*busted.test.theta_AT;
+busted.test_Q_component_1[33][48]:=0.257146542110382*t*busted.test.omega1*busted.test.theta_GT;
+busted.test_Q_component_1[34][2]:=0.3148753970510747*t*busted.test.omega1*busted.test.theta_AG;
+busted.test_Q_component_1[34][18]:=0.1712746635706107*t*busted.test.omega1*busted.test.theta_CG;
+busted.test_Q_component_1[34][32]:=0.5074830879161225*t*busted.test.theta_AG;
+busted.test_Q_component_1[34][33]:=0.09717451507454297*t*busted.test.omega1*busted.test.theta_CG;
+busted.test_Q_component_1[34][35]:=0.1989860284705866*t*busted.test.omega1*busted.test.theta_GT;
+busted.test_Q_component_1[34][38]:=0.1818409092376876*t*busted.test.theta_AC*busted.test.omega1;
+busted.test_Q_component_1[34][42]:=0.1563402972714242*t*busted.test.omega1*busted.test.theta_AG;
+busted.test_Q_component_1[34][46]:=0.2361684149931496*t*busted.test.omega1*busted.test.theta_AT;
+busted.test_Q_component_1[35][3]:=0.3148753970510747*t*busted.test.omega1*busted.test.theta_AG;
+busted.test_Q_component_1[35][19]:=0.1712746635706107*t*busted.test.omega1*busted.test.theta_CG;
+busted.test_Q_component_1[35][32]:=0.5074830879161225*t*busted.test.omega1*busted.test.theta_AT;
+busted.test_Q_component_1[35][33]:=0.09717451507454297*t*busted.test.theta_CT;
+busted.test_Q_component_1[35][34]:=0.1963563685387479*t*busted.test.omega1*busted.test.theta_GT;
+busted.test_Q_component_1[35][39]:=0.1818409092376876*t*busted.test.theta_AC*busted.test.omega1;
+busted.test_Q_component_1[35][43]:=0.1563402972714242*t*busted.test.omega1*busted.test.theta_AG;
+busted.test_Q_component_1[35][47]:=0.2361684149931496*t*busted.test.omega1*busted.test.theta_AT;
+busted.test_Q_component_1[35][49]:=0.257146542110382*t*busted.test.omega1*busted.test.theta_GT;
+busted.test_Q_component_1[36][4]:=0.3148753970510747*t*busted.test.omega1*busted.test.theta_AG;
+busted.test_Q_component_1[36][20]:=0.1712746635706107*t*busted.test.omega1*busted.test.theta_CG;
+busted.test_Q_component_1[36][32]:=0.4256503784977386*t*busted.test.theta_AC*busted.test.omega1;
+busted.test_Q_component_1[36][37]:=0.09717451507454297*t*busted.test.theta_AC;
+busted.test_Q_component_1[36][38]:=0.1963563685387479*t*busted.test.theta_AG;
+busted.test_Q_component_1[36][39]:=0.1989860284705866*t*busted.test.theta_AT;
+busted.test_Q_component_1[36][40]:=0.1563402972714242*t*busted.test.omega1*busted.test.theta_CG;
+busted.test_Q_component_1[36][44]:=0.2361684149931496*t*busted.test.omega1*busted.test.theta_CT;
+busted.test_Q_component_1[36][50]:=0.257146542110382*t*busted.test.omega1*busted.test.theta_GT;
+busted.test_Q_component_1[37][5]:=0.3148753970510747*t*busted.test.omega1*busted.test.theta_AG;
+busted.test_Q_component_1[37][21]:=0.1712746635706107*t*busted.test.omega1*busted.test.theta_CG;
+busted.test_Q_component_1[37][33]:=0.4256503784977386*t*busted.test.theta_AC*busted.test.omega1;
+busted.test_Q_component_1[37][36]:=0.5074830879161225*t*busted.test.theta_AC;
+busted.test_Q_component_1[37][38]:=0.1963563685387479*t*busted.test.theta_CG;
+busted.test_Q_component_1[37][39]:=0.1989860284705866*t*busted.test.theta_CT;
+busted.test_Q_component_1[37][41]:=0.1563402972714242*t*busted.test.omega1*busted.test.theta_CG;
+busted.test_Q_component_1[37][45]:=0.2361684149931496*t*busted.test.omega1*busted.test.theta_CT;
+busted.test_Q_component_1[37][51]:=0.257146542110382*t*busted.test.omega1*busted.test.theta_GT;
+busted.test_Q_component_1[38][6]:=0.3148753970510747*t*busted.test.omega1*busted.test.theta_AG;
+busted.test_Q_component_1[38][22]:=0.1712746635706107*t*busted.test.omega1*busted.test.theta_CG;
+busted.test_Q_component_1[38][34]:=0.4256503784977386*t*busted.test.theta_AC*busted.test.omega1;
+busted.test_Q_component_1[38][36]:=0.5074830879161225*t*busted.test.theta_AG;
+busted.test_Q_component_1[38][37]:=0.09717451507454297*t*busted.test.theta_CG;
+busted.test_Q_component_1[38][39]:=0.1989860284705866*t*busted.test.theta_GT;
+busted.test_Q_component_1[38][42]:=0.1563402972714242*t*busted.test.omega1*busted.test.theta_CG;
+busted.test_Q_component_1[38][46]:=0.2361684149931496*t*busted.test.omega1*busted.test.theta_CT;
+busted.test_Q_component_1[38][52]:=0.257146542110382*t*busted.test.omega1*busted.test.theta_GT;
+busted.test_Q_component_1[39][7]:=0.3148753970510747*t*busted.test.omega1*busted.test.theta_AG;
+busted.test_Q_component_1[39][23]:=0.1712746635706107*t*busted.test.omega1*busted.test.theta_CG;
+busted.test_Q_component_1[39][35]:=0.4256503784977386*t*busted.test.theta_AC*busted.test.omega1;
+busted.test_Q_component_1[39][36]:=0.5074830879161225*t*busted.test.theta_AT;
+busted.test_Q_component_1[39][37]:=0.09717451507454297*t*busted.test.theta_CT;
+busted.test_Q_component_1[39][38]:=0.1963563685387479*t*busted.test.theta_GT;
+busted.test_Q_component_1[39][43]:=0.1563402972714242*t*busted.test.omega1*busted.test.theta_CG;
+busted.test_Q_component_1[39][47]:=0.2361684149931496*t*busted.test.omega1*busted.test.theta_CT;
+busted.test_Q_component_1[39][53]:=0.257146542110382*t*busted.test.omega1*busted.test.theta_GT;
+busted.test_Q_component_1[40][8]:=0.3148753970510747*t*busted.test.omega1*busted.test.theta_AG;
+busted.test_Q_component_1[40][24]:=0.1712746635706107*t*busted.test.omega1*busted.test.theta_CG;
+busted.test_Q_component_1[40][32]:=0.4256503784977386*t*busted.test.omega1*busted.test.theta_AG;
+busted.test_Q_component_1[40][36]:=0.1818409092376876*t*busted.test.omega1*busted.test.theta_CG;
+busted.test_Q_component_1[40][41]:=0.09717451507454297*t*busted.test.theta_AC;
+busted.test_Q_component_1[40][42]:=0.1963563685387479*t*busted.test.theta_AG;
+busted.test_Q_component_1[40][43]:=0.1989860284705866*t*busted.test.theta_AT;
+busted.test_Q_component_1[40][44]:=0.2361684149931496*t*busted.test.omega1*busted.test.theta_GT;
+busted.test_Q_component_1[41][9]:=0.3148753970510747*t*busted.test.omega1*busted.test.theta_AG;
+busted.test_Q_component_1[41][25]:=0.1712746635706107*t*busted.test.omega1*busted.test.theta_CG;
+busted.test_Q_component_1[41][33]:=0.4256503784977386*t*busted.test.omega1*busted.test.theta_AG;
+busted.test_Q_component_1[41][37]:=0.1818409092376876*t*busted.test.omega1*busted.test.theta_CG;
+busted.test_Q_component_1[41][40]:=0.5074830879161225*t*busted.test.theta_AC;
+busted.test_Q_component_1[41][42]:=0.1963563685387479*t*busted.test.theta_CG;
+busted.test_Q_component_1[41][43]:=0.1989860284705866*t*busted.test.theta_CT;
+busted.test_Q_component_1[41][45]:=0.2361684149931496*t*busted.test.omega1*busted.test.theta_GT;
+busted.test_Q_component_1[41][54]:=0.257146542110382*t*busted.test.omega1*busted.test.theta_GT;
+busted.test_Q_component_1[42][10]:=0.3148753970510747*t*busted.test.omega1*busted.test.theta_AG;
+busted.test_Q_component_1[42][26]:=0.1712746635706107*t*busted.test.omega1*busted.test.theta_CG;
+busted.test_Q_component_1[42][34]:=0.4256503784977386*t*busted.test.omega1*busted.test.theta_AG;
+busted.test_Q_component_1[42][38]:=0.1818409092376876*t*busted.test.omega1*busted.test.theta_CG;
+busted.test_Q_component_1[42][40]:=0.5074830879161225*t*busted.test.theta_AG;
+busted.test_Q_component_1[42][41]:=0.09717451507454297*t*busted.test.theta_CG;
+busted.test_Q_component_1[42][43]:=0.1989860284705866*t*busted.test.theta_GT;
+busted.test_Q_component_1[42][46]:=0.2361684149931496*t*busted.test.omega1*busted.test.theta_GT;
+busted.test_Q_component_1[42][55]:=0.257146542110382*t*busted.test.omega1*busted.test.theta_GT;
+busted.test_Q_component_1[43][11]:=0.3148753970510747*t*busted.test.omega1*busted.test.theta_AG;
+busted.test_Q_component_1[43][27]:=0.1712746635706107*t*busted.test.omega1*busted.test.theta_CG;
+busted.test_Q_component_1[43][35]:=0.4256503784977386*t*busted.test.omega1*busted.test.theta_AG;
+busted.test_Q_component_1[43][39]:=0.1818409092376876*t*busted.test.omega1*busted.test.theta_CG;
+busted.test_Q_component_1[43][40]:=0.5074830879161225*t*busted.test.theta_AT;
+busted.test_Q_component_1[43][41]:=0.09717451507454297*t*busted.test.theta_CT;
+busted.test_Q_component_1[43][42]:=0.1963563685387479*t*busted.test.theta_GT;
+busted.test_Q_component_1[43][47]:=0.2361684149931496*t*busted.test.omega1*busted.test.theta_GT;
+busted.test_Q_component_1[43][56]:=0.257146542110382*t*busted.test.omega1*busted.test.theta_GT;
+busted.test_Q_component_1[44][12]:=0.3148753970510747*t*busted.test.omega1*busted.test.theta_AG;
+busted.test_Q_component_1[44][28]:=0.1712746635706107*t*busted.test.omega1*busted.test.theta_CG;
+busted.test_Q_component_1[44][32]:=0.4256503784977386*t*busted.test.omega1*busted.test.theta_AT;
+busted.test_Q_component_1[44][36]:=0.1818409092376876*t*busted.test.omega1*busted.test.theta_CT;
+busted.test_Q_component_1[44][40]:=0.1563402972714242*t*busted.test.omega1*busted.test.theta_GT;
+busted.test_Q_component_1[44][45]:=0.09717451507454297*t*busted.test.theta_AC;
+busted.test_Q_component_1[44][46]:=0.1963563685387479*t*busted.test.theta_AG;
+busted.test_Q_component_1[44][47]:=0.1989860284705866*t*busted.test.theta_AT;
+busted.test_Q_component_1[44][57]:=0.257146542110382*t*busted.test.omega1*busted.test.theta_GT;
+busted.test_Q_component_1[45][13]:=0.3148753970510747*t*busted.test.omega1*busted.test.theta_AG;
+busted.test_Q_component_1[45][29]:=0.1712746635706107*t*busted.test.omega1*busted.test.theta_CG;
+busted.test_Q_component_1[45][33]:=0.4256503784977386*t*busted.test.omega1*busted.test.theta_AT;
+busted.test_Q_component_1[45][37]:=0.1818409092376876*t*busted.test.omega1*busted.test.theta_CT;
+busted.test_Q_component_1[45][41]:=0.1563402972714242*t*busted.test.omega1*busted.test.theta_GT;
+busted.test_Q_component_1[45][44]:=0.5074830879161225*t*busted.test.theta_AC;
+busted.test_Q_component_1[45][46]:=0.1963563685387479*t*busted.test.theta_CG;
+busted.test_Q_component_1[45][47]:=0.1989860284705866*t*busted.test.theta_CT;
+busted.test_Q_component_1[45][58]:=0.257146542110382*t*busted.test.omega1*busted.test.theta_GT;
+busted.test_Q_component_1[46][14]:=0.3148753970510747*t*busted.test.omega1*busted.test.theta_AG;
+busted.test_Q_component_1[46][30]:=0.1712746635706107*t*busted.test.omega1*busted.test.theta_CG;
+busted.test_Q_component_1[46][34]:=0.4256503784977386*t*busted.test.omega1*busted.test.theta_AT;
+busted.test_Q_component_1[46][38]:=0.1818409092376876*t*busted.test.omega1*busted.test.theta_CT;
+busted.test_Q_component_1[46][42]:=0.1563402972714242*t*busted.test.omega1*busted.test.theta_GT;
+busted.test_Q_component_1[46][44]:=0.5074830879161225*t*busted.test.theta_AG;
+busted.test_Q_component_1[46][45]:=0.09717451507454297*t*busted.test.theta_CG;
+busted.test_Q_component_1[46][47]:=0.1989860284705866*t*busted.test.theta_GT;
+busted.test_Q_component_1[46][59]:=0.257146542110382*t*busted.test.omega1*busted.test.theta_GT;
+busted.test_Q_component_1[47][15]:=0.3148753970510747*t*busted.test.omega1*busted.test.theta_AG;
+busted.test_Q_component_1[47][31]:=0.1712746635706107*t*busted.test.omega1*busted.test.theta_CG;
+busted.test_Q_component_1[47][35]:=0.4256503784977386*t*busted.test.omega1*busted.test.theta_AT;
+busted.test_Q_component_1[47][39]:=0.1818409092376876*t*busted.test.omega1*busted.test.theta_CT;
+busted.test_Q_component_1[47][43]:=0.1563402972714242*t*busted.test.omega1*busted.test.theta_GT;
+busted.test_Q_component_1[47][44]:=0.5074830879161225*t*busted.test.theta_AT;
+busted.test_Q_component_1[47][45]:=0.09717451507454297*t*busted.test.theta_CT;
+busted.test_Q_component_1[47][46]:=0.1963563685387479*t*busted.test.theta_GT;
+busted.test_Q_component_1[47][60]:=0.257146542110382*t*busted.test.omega1*busted.test.theta_GT;
+busted.test_Q_component_1[48][1]:=0.3148753970510747*t*busted.test.omega1*busted.test.theta_AT;
+busted.test_Q_component_1[48][17]:=0.1712746635706107*t*busted.test.omega1*busted.test.theta_CT;
+busted.test_Q_component_1[48][33]:=0.2567033972679326*t*busted.test.omega1*busted.test.theta_GT;
+busted.test_Q_component_1[48][49]:=0.1989860284705866*t*busted.test.theta_CT;
+busted.test_Q_component_1[48][51]:=0.1818409092376876*t*busted.test.theta_AC*busted.test.omega1;
+busted.test_Q_component_1[48][54]:=0.1563402972714242*t*busted.test.omega1*busted.test.theta_AG;
+busted.test_Q_component_1[48][58]:=0.2361684149931496*t*busted.test.omega1*busted.test.theta_AT;
+busted.test_Q_component_1[49][3]:=0.3148753970510747*t*busted.test.omega1*busted.test.theta_AT;
+busted.test_Q_component_1[49][19]:=0.1712746635706107*t*busted.test.omega1*busted.test.theta_CT;
+busted.test_Q_component_1[49][35]:=0.2567033972679326*t*busted.test.omega1*busted.test.theta_GT;
+busted.test_Q_component_1[49][48]:=0.09717451507454297*t*busted.test.theta_CT;
+busted.test_Q_component_1[49][53]:=0.1818409092376876*t*busted.test.theta_AC*busted.test.omega1;
+busted.test_Q_component_1[49][56]:=0.1563402972714242*t*busted.test.omega1*busted.test.theta_AG;
+busted.test_Q_component_1[49][60]:=0.2361684149931496*t*busted.test.omega1*busted.test.theta_AT;
+busted.test_Q_component_1[50][4]:=0.3148753970510747*t*busted.test.omega1*busted.test.theta_AT;
+busted.test_Q_component_1[50][20]:=0.1712746635706107*t*busted.test.omega1*busted.test.theta_CT;
+busted.test_Q_component_1[50][36]:=0.2567033972679326*t*busted.test.omega1*busted.test.theta_GT;
+busted.test_Q_component_1[50][51]:=0.09717451507454297*t*busted.test.theta_AC;
+busted.test_Q_component_1[50][52]:=0.1963563685387479*t*busted.test.theta_AG;
+busted.test_Q_component_1[50][53]:=0.1989860284705866*t*busted.test.theta_AT;
+busted.test_Q_component_1[50][57]:=0.2361684149931496*t*busted.test.omega1*busted.test.theta_CT;
+busted.test_Q_component_1[51][5]:=0.3148753970510747*t*busted.test.omega1*busted.test.theta_AT;
+busted.test_Q_component_1[51][21]:=0.1712746635706107*t*busted.test.omega1*busted.test.theta_CT;
+busted.test_Q_component_1[51][37]:=0.2567033972679326*t*busted.test.omega1*busted.test.theta_GT;
+busted.test_Q_component_1[51][48]:=0.4256503784977386*t*busted.test.theta_AC*busted.test.omega1;
+busted.test_Q_component_1[51][50]:=0.5074830879161225*t*busted.test.theta_AC;
+busted.test_Q_component_1[51][52]:=0.1963563685387479*t*busted.test.theta_CG;
+busted.test_Q_component_1[51][53]:=0.1989860284705866*t*busted.test.theta_CT;
+busted.test_Q_component_1[51][54]:=0.1563402972714242*t*busted.test.omega1*busted.test.theta_CG;
+busted.test_Q_component_1[51][58]:=0.2361684149931496*t*busted.test.omega1*busted.test.theta_CT;
+busted.test_Q_component_1[52][6]:=0.3148753970510747*t*busted.test.omega1*busted.test.theta_AT;
+busted.test_Q_component_1[52][22]:=0.1712746635706107*t*busted.test.omega1*busted.test.theta_CT;
+busted.test_Q_component_1[52][38]:=0.2567033972679326*t*busted.test.omega1*busted.test.theta_GT;
+busted.test_Q_component_1[52][50]:=0.5074830879161225*t*busted.test.theta_AG;
+busted.test_Q_component_1[52][51]:=0.09717451507454297*t*busted.test.theta_CG;
+busted.test_Q_component_1[52][53]:=0.1989860284705866*t*busted.test.theta_GT;
+busted.test_Q_component_1[52][55]:=0.1563402972714242*t*busted.test.omega1*busted.test.theta_CG;
+busted.test_Q_component_1[52][59]:=0.2361684149931496*t*busted.test.omega1*busted.test.theta_CT;
+busted.test_Q_component_1[53][7]:=0.3148753970510747*t*busted.test.omega1*busted.test.theta_AT;
+busted.test_Q_component_1[53][23]:=0.1712746635706107*t*busted.test.omega1*busted.test.theta_CT;
+busted.test_Q_component_1[53][39]:=0.2567033972679326*t*busted.test.omega1*busted.test.theta_GT;
+busted.test_Q_component_1[53][49]:=0.4256503784977386*t*busted.test.theta_AC*busted.test.omega1;
+busted.test_Q_component_1[53][50]:=0.5074830879161225*t*busted.test.theta_AT;
+busted.test_Q_component_1[53][51]:=0.09717451507454297*t*busted.test.theta_CT;
+busted.test_Q_component_1[53][52]:=0.1963563685387479*t*busted.test.theta_GT;
+busted.test_Q_component_1[53][56]:=0.1563402972714242*t*busted.test.omega1*busted.test.theta_CG;
+busted.test_Q_component_1[53][60]:=0.2361684149931496*t*busted.test.omega1*busted.test.theta_CT;
+busted.test_Q_component_1[54][9]:=0.3148753970510747*t*busted.test.omega1*busted.test.theta_AT;
+busted.test_Q_component_1[54][25]:=0.1712746635706107*t*busted.test.omega1*busted.test.theta_CT;
+busted.test_Q_component_1[54][41]:=0.2567033972679326*t*busted.test.omega1*busted.test.theta_GT;
+busted.test_Q_component_1[54][48]:=0.4256503784977386*t*busted.test.omega1*busted.test.theta_AG;
+busted.test_Q_component_1[54][51]:=0.1818409092376876*t*busted.test.omega1*busted.test.theta_CG;
+busted.test_Q_component_1[54][55]:=0.1963563685387479*t*busted.test.omega1*busted.test.theta_CG;
+busted.test_Q_component_1[54][56]:=0.1989860284705866*t*busted.test.theta_CT;
+busted.test_Q_component_1[54][58]:=0.2361684149931496*t*busted.test.omega1*busted.test.theta_GT;
+busted.test_Q_component_1[55][10]:=0.3148753970510747*t*busted.test.omega1*busted.test.theta_AT;
+busted.test_Q_component_1[55][26]:=0.1712746635706107*t*busted.test.omega1*busted.test.theta_CT;
+busted.test_Q_component_1[55][42]:=0.2567033972679326*t*busted.test.omega1*busted.test.theta_GT;
+busted.test_Q_component_1[55][52]:=0.1818409092376876*t*busted.test.omega1*busted.test.theta_CG;
+busted.test_Q_component_1[55][54]:=0.09717451507454297*t*busted.test.omega1*busted.test.theta_CG;
+busted.test_Q_component_1[55][56]:=0.1989860284705866*t*busted.test.omega1*busted.test.theta_GT;
+busted.test_Q_component_1[55][59]:=0.2361684149931496*t*busted.test.omega1*busted.test.theta_GT;
+busted.test_Q_component_1[56][11]:=0.3148753970510747*t*busted.test.omega1*busted.test.theta_AT;
+busted.test_Q_component_1[56][27]:=0.1712746635706107*t*busted.test.omega1*busted.test.theta_CT;
+busted.test_Q_component_1[56][43]:=0.2567033972679326*t*busted.test.omega1*busted.test.theta_GT;
+busted.test_Q_component_1[56][49]:=0.4256503784977386*t*busted.test.omega1*busted.test.theta_AG;
+busted.test_Q_component_1[56][53]:=0.1818409092376876*t*busted.test.omega1*busted.test.theta_CG;
+busted.test_Q_component_1[56][54]:=0.09717451507454297*t*busted.test.theta_CT;
+busted.test_Q_component_1[56][55]:=0.1963563685387479*t*busted.test.omega1*busted.test.theta_GT;
+busted.test_Q_component_1[56][60]:=0.2361684149931496*t*busted.test.omega1*busted.test.theta_GT;
+busted.test_Q_component_1[57][12]:=0.3148753970510747*t*busted.test.omega1*busted.test.theta_AT;
+busted.test_Q_component_1[57][28]:=0.1712746635706107*t*busted.test.theta_CT;
+busted.test_Q_component_1[57][44]:=0.2567033972679326*t*busted.test.omega1*busted.test.theta_GT;
+busted.test_Q_component_1[57][50]:=0.1818409092376876*t*busted.test.omega1*busted.test.theta_CT;
+busted.test_Q_component_1[57][58]:=0.09717451507454297*t*busted.test.theta_AC*busted.test.omega1;
+busted.test_Q_component_1[57][59]:=0.1963563685387479*t*busted.test.theta_AG;
+busted.test_Q_component_1[57][60]:=0.1989860284705866*t*busted.test.omega1*busted.test.theta_AT;
+busted.test_Q_component_1[58][13]:=0.3148753970510747*t*busted.test.omega1*busted.test.theta_AT;
+busted.test_Q_component_1[58][29]:=0.1712746635706107*t*busted.test.omega1*busted.test.theta_CT;
+busted.test_Q_component_1[58][45]:=0.2567033972679326*t*busted.test.omega1*busted.test.theta_GT;
+busted.test_Q_component_1[58][48]:=0.4256503784977386*t*busted.test.omega1*busted.test.theta_AT;
+busted.test_Q_component_1[58][51]:=0.1818409092376876*t*busted.test.omega1*busted.test.theta_CT;
+busted.test_Q_component_1[58][54]:=0.1563402972714242*t*busted.test.omega1*busted.test.theta_GT;
+busted.test_Q_component_1[58][57]:=0.5074830879161225*t*busted.test.theta_AC*busted.test.omega1;
+busted.test_Q_component_1[58][59]:=0.1963563685387479*t*busted.test.omega1*busted.test.theta_CG;
+busted.test_Q_component_1[58][60]:=0.1989860284705866*t*busted.test.theta_CT;
+busted.test_Q_component_1[59][14]:=0.3148753970510747*t*busted.test.omega1*busted.test.theta_AT;
+busted.test_Q_component_1[59][30]:=0.1712746635706107*t*busted.test.theta_CT;
+busted.test_Q_component_1[59][46]:=0.2567033972679326*t*busted.test.omega1*busted.test.theta_GT;
+busted.test_Q_component_1[59][52]:=0.1818409092376876*t*busted.test.omega1*busted.test.theta_CT;
+busted.test_Q_component_1[59][55]:=0.1563402972714242*t*busted.test.omega1*busted.test.theta_GT;
+busted.test_Q_component_1[59][57]:=0.5074830879161225*t*busted.test.theta_AG;
+busted.test_Q_component_1[59][58]:=0.09717451507454297*t*busted.test.omega1*busted.test.theta_CG;
+busted.test_Q_component_1[59][60]:=0.1989860284705866*t*busted.test.omega1*busted.test.theta_GT;
+busted.test_Q_component_1[60][15]:=0.3148753970510747*t*busted.test.omega1*busted.test.theta_AT;
+busted.test_Q_component_1[60][31]:=0.1712746635706107*t*busted.test.omega1*busted.test.theta_CT;
+busted.test_Q_component_1[60][47]:=0.2567033972679326*t*busted.test.omega1*busted.test.theta_GT;
+busted.test_Q_component_1[60][49]:=0.4256503784977386*t*busted.test.omega1*busted.test.theta_AT;
+busted.test_Q_component_1[60][53]:=0.1818409092376876*t*busted.test.omega1*busted.test.theta_CT;
+busted.test_Q_component_1[60][56]:=0.1563402972714242*t*busted.test.omega1*busted.test.theta_GT;
+busted.test_Q_component_1[60][57]:=0.5074830879161225*t*busted.test.omega1*busted.test.theta_AT;
+busted.test_Q_component_1[60][58]:=0.09717451507454297*t*busted.test.theta_CT;
+busted.test_Q_component_1[60][59]:=0.1963563685387479*t*busted.test.omega1*busted.test.theta_GT;
+
+
+busted.test_Q_component_2={61,61};
+busted.test_Q_component_2[0][1]:=0.09717451507454297*t*busted.test.theta_AC*busted.test.omega2;
+busted.test_Q_component_2[0][2]:=0.1963563685387479*t*busted.test.theta_AG;
+busted.test_Q_component_2[0][3]:=0.1989860284705866*t*busted.test.theta_AT*busted.test.omega2;
+busted.test_Q_component_2[0][4]:=0.1818409092376876*t*busted.test.theta_AC*busted.test.omega2;
+busted.test_Q_component_2[0][8]:=0.1563402972714242*t*busted.test.theta_AG*busted.test.omega2;
+busted.test_Q_component_2[0][12]:=0.2361684149931496*t*busted.test.theta_AT*busted.test.omega2;
+busted.test_Q_component_2[0][16]:=0.1712746635706107*t*busted.test.theta_AC*busted.test.omega2;
+busted.test_Q_component_2[0][32]:=0.2567033972679326*t*busted.test.theta_AG*busted.test.omega2;
+busted.test_Q_component_2[1][0]:=0.5074830879161225*t*busted.test.theta_AC*busted.test.omega2;
+busted.test_Q_component_2[1][2]:=0.1963563685387479*t*busted.test.theta_CG*busted.test.omega2;
+busted.test_Q_component_2[1][3]:=0.1989860284705866*t*busted.test.theta_CT;
+busted.test_Q_component_2[1][5]:=0.1818409092376876*t*busted.test.theta_AC*busted.test.omega2;
+busted.test_Q_component_2[1][9]:=0.1563402972714242*t*busted.test.theta_AG*busted.test.omega2;
+busted.test_Q_component_2[1][13]:=0.2361684149931496*t*busted.test.theta_AT*busted.test.omega2;
+busted.test_Q_component_2[1][17]:=0.1712746635706107*t*busted.test.theta_AC*busted.test.omega2;
+busted.test_Q_component_2[1][33]:=0.2567033972679326*t*busted.test.theta_AG*busted.test.omega2;
+busted.test_Q_component_2[1][48]:=0.257146542110382*t*busted.test.theta_AT*busted.test.omega2;
+busted.test_Q_component_2[2][0]:=0.5074830879161225*t*busted.test.theta_AG;
+busted.test_Q_component_2[2][1]:=0.09717451507454297*t*busted.test.theta_CG*busted.test.omega2;
+busted.test_Q_component_2[2][3]:=0.1989860284705866*t*busted.test.theta_GT*busted.test.omega2;
+busted.test_Q_component_2[2][6]:=0.1818409092376876*t*busted.test.theta_AC*busted.test.omega2;
+busted.test_Q_component_2[2][10]:=0.1563402972714242*t*busted.test.theta_AG*busted.test.omega2;
+busted.test_Q_component_2[2][14]:=0.2361684149931496*t*busted.test.theta_AT*busted.test.omega2;
+busted.test_Q_component_2[2][18]:=0.1712746635706107*t*busted.test.theta_AC*busted.test.omega2;
+busted.test_Q_component_2[2][34]:=0.2567033972679326*t*busted.test.theta_AG*busted.test.omega2;
+busted.test_Q_component_2[3][0]:=0.5074830879161225*t*busted.test.theta_AT*busted.test.omega2;
+busted.test_Q_component_2[3][1]:=0.09717451507454297*t*busted.test.theta_CT;
+busted.test_Q_component_2[3][2]:=0.1963563685387479*t*busted.test.theta_GT*busted.test.omega2;
+busted.test_Q_component_2[3][7]:=0.1818409092376876*t*busted.test.theta_AC*busted.test.omega2;
+busted.test_Q_component_2[3][11]:=0.1563402972714242*t*busted.test.theta_AG*busted.test.omega2;
+busted.test_Q_component_2[3][15]:=0.2361684149931496*t*busted.test.theta_AT*busted.test.omega2;
+busted.test_Q_component_2[3][19]:=0.1712746635706107*t*busted.test.theta_AC*busted.test.omega2;
+busted.test_Q_component_2[3][35]:=0.2567033972679326*t*busted.test.theta_AG*busted.test.omega2;
+busted.test_Q_component_2[3][49]:=0.257146542110382*t*busted.test.theta_AT*busted.test.omega2;
+busted.test_Q_component_2[4][0]:=0.4256503784977386*t*busted.test.theta_AC*busted.test.omega2;
+busted.test_Q_component_2[4][5]:=0.09717451507454297*t*busted.test.theta_AC;
+busted.test_Q_component_2[4][6]:=0.1963563685387479*t*busted.test.theta_AG;
+busted.test_Q_component_2[4][7]:=0.1989860284705866*t*busted.test.theta_AT;
+busted.test_Q_component_2[4][8]:=0.1563402972714242*t*busted.test.theta_CG*busted.test.omega2;
+busted.test_Q_component_2[4][12]:=0.2361684149931496*t*busted.test.theta_CT*busted.test.omega2;
+busted.test_Q_component_2[4][20]:=0.1712746635706107*t*busted.test.theta_AC*busted.test.omega2;
+busted.test_Q_component_2[4][36]:=0.2567033972679326*t*busted.test.theta_AG*busted.test.omega2;
+busted.test_Q_component_2[4][50]:=0.257146542110382*t*busted.test.theta_AT*busted.test.omega2;
+busted.test_Q_component_2[5][1]:=0.4256503784977386*t*busted.test.theta_AC*busted.test.omega2;
+busted.test_Q_component_2[5][4]:=0.5074830879161225*t*busted.test.theta_AC;
+busted.test_Q_component_2[5][6]:=0.1963563685387479*t*busted.test.theta_CG;
+busted.test_Q_component_2[5][7]:=0.1989860284705866*t*busted.test.theta_CT;
+busted.test_Q_component_2[5][9]:=0.1563402972714242*t*busted.test.theta_CG*busted.test.omega2;
+busted.test_Q_component_2[5][13]:=0.2361684149931496*t*busted.test.theta_CT*busted.test.omega2;
+busted.test_Q_component_2[5][21]:=0.1712746635706107*t*busted.test.theta_AC*busted.test.omega2;
+busted.test_Q_component_2[5][37]:=0.2567033972679326*t*busted.test.theta_AG*busted.test.omega2;
+busted.test_Q_component_2[5][51]:=0.257146542110382*t*busted.test.theta_AT*busted.test.omega2;
+busted.test_Q_component_2[6][2]:=0.4256503784977386*t*busted.test.theta_AC*busted.test.omega2;
+busted.test_Q_component_2[6][4]:=0.5074830879161225*t*busted.test.theta_AG;
+busted.test_Q_component_2[6][5]:=0.09717451507454297*t*busted.test.theta_CG;
+busted.test_Q_component_2[6][7]:=0.1989860284705866*t*busted.test.theta_GT;
+busted.test_Q_component_2[6][10]:=0.1563402972714242*t*busted.test.theta_CG*busted.test.omega2;
+busted.test_Q_component_2[6][14]:=0.2361684149931496*t*busted.test.theta_CT*busted.test.omega2;
+busted.test_Q_component_2[6][22]:=0.1712746635706107*t*busted.test.theta_AC*busted.test.omega2;
+busted.test_Q_component_2[6][38]:=0.2567033972679326*t*busted.test.theta_AG*busted.test.omega2;
+busted.test_Q_component_2[6][52]:=0.257146542110382*t*busted.test.theta_AT*busted.test.omega2;
+busted.test_Q_component_2[7][3]:=0.4256503784977386*t*busted.test.theta_AC*busted.test.omega2;
+busted.test_Q_component_2[7][4]:=0.5074830879161225*t*busted.test.theta_AT;
+busted.test_Q_component_2[7][5]:=0.09717451507454297*t*busted.test.theta_CT;
+busted.test_Q_component_2[7][6]:=0.1963563685387479*t*busted.test.theta_GT;
+busted.test_Q_component_2[7][11]:=0.1563402972714242*t*busted.test.theta_CG*busted.test.omega2;
+busted.test_Q_component_2[7][15]:=0.2361684149931496*t*busted.test.theta_CT*busted.test.omega2;
+busted.test_Q_component_2[7][23]:=0.1712746635706107*t*busted.test.theta_AC*busted.test.omega2;
+busted.test_Q_component_2[7][39]:=0.2567033972679326*t*busted.test.theta_AG*busted.test.omega2;
+busted.test_Q_component_2[7][53]:=0.257146542110382*t*busted.test.theta_AT*busted.test.omega2;
+busted.test_Q_component_2[8][0]:=0.4256503784977386*t*busted.test.theta_AG*busted.test.omega2;
+busted.test_Q_component_2[8][4]:=0.1818409092376876*t*busted.test.theta_CG*busted.test.omega2;
+busted.test_Q_component_2[8][9]:=0.09717451507454297*t*busted.test.theta_AC*busted.test.omega2;
+busted.test_Q_component_2[8][10]:=0.1963563685387479*t*busted.test.theta_AG;
+busted.test_Q_component_2[8][11]:=0.1989860284705866*t*busted.test.theta_AT*busted.test.omega2;
+busted.test_Q_component_2[8][12]:=0.2361684149931496*t*busted.test.theta_GT*busted.test.omega2;
+busted.test_Q_component_2[8][24]:=0.1712746635706107*t*busted.test.theta_AC;
+busted.test_Q_component_2[8][40]:=0.2567033972679326*t*busted.test.theta_AG*busted.test.omega2;
+busted.test_Q_component_2[9][1]:=0.4256503784977386*t*busted.test.theta_AG*busted.test.omega2;
+busted.test_Q_component_2[9][5]:=0.1818409092376876*t*busted.test.theta_CG*busted.test.omega2;
+busted.test_Q_component_2[9][8]:=0.5074830879161225*t*busted.test.theta_AC*busted.test.omega2;
+busted.test_Q_component_2[9][10]:=0.1963563685387479*t*busted.test.theta_CG*busted.test.omega2;
+busted.test_Q_component_2[9][11]:=0.1989860284705866*t*busted.test.theta_CT;
+busted.test_Q_component_2[9][13]:=0.2361684149931496*t*busted.test.theta_GT*busted.test.omega2;
+busted.test_Q_component_2[9][25]:=0.1712746635706107*t*busted.test.theta_AC*busted.test.omega2;
+busted.test_Q_component_2[9][41]:=0.2567033972679326*t*busted.test.theta_AG*busted.test.omega2;
+busted.test_Q_component_2[9][54]:=0.257146542110382*t*busted.test.theta_AT*busted.test.omega2;
+busted.test_Q_component_2[10][2]:=0.4256503784977386*t*busted.test.theta_AG*busted.test.omega2;
+busted.test_Q_component_2[10][6]:=0.1818409092376876*t*busted.test.theta_CG*busted.test.omega2;
+busted.test_Q_component_2[10][8]:=0.5074830879161225*t*busted.test.theta_AG;
+busted.test_Q_component_2[10][9]:=0.09717451507454297*t*busted.test.theta_CG*busted.test.omega2;
+busted.test_Q_component_2[10][11]:=0.1989860284705866*t*busted.test.theta_GT*busted.test.omega2;
+busted.test_Q_component_2[10][14]:=0.2361684149931496*t*busted.test.theta_GT*busted.test.omega2;
+busted.test_Q_component_2[10][26]:=0.1712746635706107*t*busted.test.theta_AC;
+busted.test_Q_component_2[10][42]:=0.2567033972679326*t*busted.test.theta_AG*busted.test.omega2;
+busted.test_Q_component_2[10][55]:=0.257146542110382*t*busted.test.theta_AT*busted.test.omega2;
+busted.test_Q_component_2[11][3]:=0.4256503784977386*t*busted.test.theta_AG*busted.test.omega2;
+busted.test_Q_component_2[11][7]:=0.1818409092376876*t*busted.test.theta_CG*busted.test.omega2;
+busted.test_Q_component_2[11][8]:=0.5074830879161225*t*busted.test.theta_AT*busted.test.omega2;
+busted.test_Q_component_2[11][9]:=0.09717451507454297*t*busted.test.theta_CT;
+busted.test_Q_component_2[11][10]:=0.1963563685387479*t*busted.test.theta_GT*busted.test.omega2;
+busted.test_Q_component_2[11][15]:=0.2361684149931496*t*busted.test.theta_GT*busted.test.omega2;
+busted.test_Q_component_2[11][27]:=0.1712746635706107*t*busted.test.theta_AC*busted.test.omega2;
+busted.test_Q_component_2[11][43]:=0.2567033972679326*t*busted.test.theta_AG*busted.test.omega2;
+busted.test_Q_component_2[11][56]:=0.257146542110382*t*busted.test.theta_AT*busted.test.omega2;
+busted.test_Q_component_2[12][0]:=0.4256503784977386*t*busted.test.theta_AT*busted.test.omega2;
+busted.test_Q_component_2[12][4]:=0.1818409092376876*t*busted.test.theta_CT*busted.test.omega2;
+busted.test_Q_component_2[12][8]:=0.1563402972714242*t*busted.test.theta_GT*busted.test.omega2;
+busted.test_Q_component_2[12][13]:=0.09717451507454297*t*busted.test.theta_AC;
+busted.test_Q_component_2[12][14]:=0.1963563685387479*t*busted.test.theta_AG*busted.test.omega2;
+busted.test_Q_component_2[12][15]:=0.1989860284705866*t*busted.test.theta_AT;
+busted.test_Q_component_2[12][28]:=0.1712746635706107*t*busted.test.theta_AC*busted.test.omega2;
+busted.test_Q_component_2[12][44]:=0.2567033972679326*t*busted.test.theta_AG*busted.test.omega2;
+busted.test_Q_component_2[12][57]:=0.257146542110382*t*busted.test.theta_AT*busted.test.omega2;
+busted.test_Q_component_2[13][1]:=0.4256503784977386*t*busted.test.theta_AT*busted.test.omega2;
+busted.test_Q_component_2[13][5]:=0.1818409092376876*t*busted.test.theta_CT*busted.test.omega2;
+busted.test_Q_component_2[13][9]:=0.1563402972714242*t*busted.test.theta_GT*busted.test.omega2;
+busted.test_Q_component_2[13][12]:=0.5074830879161225*t*busted.test.theta_AC;
+busted.test_Q_component_2[13][14]:=0.1963563685387479*t*busted.test.theta_CG*busted.test.omega2;
+busted.test_Q_component_2[13][15]:=0.1989860284705866*t*busted.test.theta_CT;
+busted.test_Q_component_2[13][29]:=0.1712746635706107*t*busted.test.theta_AC*busted.test.omega2;
+busted.test_Q_component_2[13][45]:=0.2567033972679326*t*busted.test.theta_AG*busted.test.omega2;
+busted.test_Q_component_2[13][58]:=0.257146542110382*t*busted.test.theta_AT*busted.test.omega2;
+busted.test_Q_component_2[14][2]:=0.4256503784977386*t*busted.test.theta_AT*busted.test.omega2;
+busted.test_Q_component_2[14][6]:=0.1818409092376876*t*busted.test.theta_CT*busted.test.omega2;
+busted.test_Q_component_2[14][10]:=0.1563402972714242*t*busted.test.theta_GT*busted.test.omega2;
+busted.test_Q_component_2[14][12]:=0.5074830879161225*t*busted.test.theta_AG*busted.test.omega2;
+busted.test_Q_component_2[14][13]:=0.09717451507454297*t*busted.test.theta_CG*busted.test.omega2;
+busted.test_Q_component_2[14][15]:=0.1989860284705866*t*busted.test.theta_GT*busted.test.omega2;
+busted.test_Q_component_2[14][30]:=0.1712746635706107*t*busted.test.theta_AC*busted.test.omega2;
+busted.test_Q_component_2[14][46]:=0.2567033972679326*t*busted.test.theta_AG*busted.test.omega2;
+busted.test_Q_component_2[14][59]:=0.257146542110382*t*busted.test.theta_AT*busted.test.omega2;
+busted.test_Q_component_2[15][3]:=0.4256503784977386*t*busted.test.theta_AT*busted.test.omega2;
+busted.test_Q_component_2[15][7]:=0.1818409092376876*t*busted.test.theta_CT*busted.test.omega2;
+busted.test_Q_component_2[15][11]:=0.1563402972714242*t*busted.test.theta_GT*busted.test.omega2;
+busted.test_Q_component_2[15][12]:=0.5074830879161225*t*busted.test.theta_AT;
+busted.test_Q_component_2[15][13]:=0.09717451507454297*t*busted.test.theta_CT;
+busted.test_Q_component_2[15][14]:=0.1963563685387479*t*busted.test.theta_GT*busted.test.omega2;
+busted.test_Q_component_2[15][31]:=0.1712746635706107*t*busted.test.theta_AC*busted.test.omega2;
+busted.test_Q_component_2[15][47]:=0.2567033972679326*t*busted.test.theta_AG*busted.test.omega2;
+busted.test_Q_component_2[15][60]:=0.257146542110382*t*busted.test.theta_AT*busted.test.omega2;
+busted.test_Q_component_2[16][0]:=0.3148753970510747*t*busted.test.theta_AC*busted.test.omega2;
+busted.test_Q_component_2[16][17]:=0.09717451507454297*t*busted.test.theta_AC*busted.test.omega2;
+busted.test_Q_component_2[16][18]:=0.1963563685387479*t*busted.test.theta_AG;
+busted.test_Q_component_2[16][19]:=0.1989860284705866*t*busted.test.theta_AT*busted.test.omega2;
+busted.test_Q_component_2[16][20]:=0.1818409092376876*t*busted.test.theta_AC*busted.test.omega2;
+busted.test_Q_component_2[16][24]:=0.1563402972714242*t*busted.test.theta_AG*busted.test.omega2;
+busted.test_Q_component_2[16][28]:=0.2361684149931496*t*busted.test.theta_AT*busted.test.omega2;
+busted.test_Q_component_2[16][32]:=0.2567033972679326*t*busted.test.theta_CG*busted.test.omega2;
+busted.test_Q_component_2[17][1]:=0.3148753970510747*t*busted.test.theta_AC*busted.test.omega2;
+busted.test_Q_component_2[17][16]:=0.5074830879161225*t*busted.test.theta_AC*busted.test.omega2;
+busted.test_Q_component_2[17][18]:=0.1963563685387479*t*busted.test.theta_CG*busted.test.omega2;
+busted.test_Q_component_2[17][19]:=0.1989860284705866*t*busted.test.theta_CT;
+busted.test_Q_component_2[17][21]:=0.1818409092376876*t*busted.test.theta_AC*busted.test.omega2;
+busted.test_Q_component_2[17][25]:=0.1563402972714242*t*busted.test.theta_AG*busted.test.omega2;
+busted.test_Q_component_2[17][29]:=0.2361684149931496*t*busted.test.theta_AT*busted.test.omega2;
+busted.test_Q_component_2[17][33]:=0.2567033972679326*t*busted.test.theta_CG*busted.test.omega2;
+busted.test_Q_component_2[17][48]:=0.257146542110382*t*busted.test.theta_CT*busted.test.omega2;
+busted.test_Q_component_2[18][2]:=0.3148753970510747*t*busted.test.theta_AC*busted.test.omega2;
+busted.test_Q_component_2[18][16]:=0.5074830879161225*t*busted.test.theta_AG;
+busted.test_Q_component_2[18][17]:=0.09717451507454297*t*busted.test.theta_CG*busted.test.omega2;
+busted.test_Q_component_2[18][19]:=0.1989860284705866*t*busted.test.theta_GT*busted.test.omega2;
+busted.test_Q_component_2[18][22]:=0.1818409092376876*t*busted.test.theta_AC*busted.test.omega2;
+busted.test_Q_component_2[18][26]:=0.1563402972714242*t*busted.test.theta_AG*busted.test.omega2;
+busted.test_Q_component_2[18][30]:=0.2361684149931496*t*busted.test.theta_AT*busted.test.omega2;
+busted.test_Q_component_2[18][34]:=0.2567033972679326*t*busted.test.theta_CG*busted.test.omega2;
+busted.test_Q_component_2[19][3]:=0.3148753970510747*t*busted.test.theta_AC*busted.test.omega2;
+busted.test_Q_component_2[19][16]:=0.5074830879161225*t*busted.test.theta_AT*busted.test.omega2;
+busted.test_Q_component_2[19][17]:=0.09717451507454297*t*busted.test.theta_CT;
+busted.test_Q_component_2[19][18]:=0.1963563685387479*t*busted.test.theta_GT*busted.test.omega2;
+busted.test_Q_component_2[19][23]:=0.1818409092376876*t*busted.test.theta_AC*busted.test.omega2;
+busted.test_Q_component_2[19][27]:=0.1563402972714242*t*busted.test.theta_AG*busted.test.omega2;
+busted.test_Q_component_2[19][31]:=0.2361684149931496*t*busted.test.theta_AT*busted.test.omega2;
+busted.test_Q_component_2[19][35]:=0.2567033972679326*t*busted.test.theta_CG*busted.test.omega2;
+busted.test_Q_component_2[19][49]:=0.257146542110382*t*busted.test.theta_CT*busted.test.omega2;
+busted.test_Q_component_2[20][4]:=0.3148753970510747*t*busted.test.theta_AC*busted.test.omega2;
+busted.test_Q_component_2[20][16]:=0.4256503784977386*t*busted.test.theta_AC*busted.test.omega2;
+busted.test_Q_component_2[20][21]:=0.09717451507454297*t*busted.test.theta_AC;
+busted.test_Q_component_2[20][22]:=0.1963563685387479*t*busted.test.theta_AG;
+busted.test_Q_component_2[20][23]:=0.1989860284705866*t*busted.test.theta_AT;
+busted.test_Q_component_2[20][24]:=0.1563402972714242*t*busted.test.theta_CG*busted.test.omega2;
+busted.test_Q_component_2[20][28]:=0.2361684149931496*t*busted.test.theta_CT*busted.test.omega2;
+busted.test_Q_component_2[20][36]:=0.2567033972679326*t*busted.test.theta_CG*busted.test.omega2;
+busted.test_Q_component_2[20][50]:=0.257146542110382*t*busted.test.theta_CT*busted.test.omega2;
+busted.test_Q_component_2[21][5]:=0.3148753970510747*t*busted.test.theta_AC*busted.test.omega2;
+busted.test_Q_component_2[21][17]:=0.4256503784977386*t*busted.test.theta_AC*busted.test.omega2;
+busted.test_Q_component_2[21][20]:=0.5074830879161225*t*busted.test.theta_AC;
+busted.test_Q_component_2[21][22]:=0.1963563685387479*t*busted.test.theta_CG;
+busted.test_Q_component_2[21][23]:=0.1989860284705866*t*busted.test.theta_CT;
+busted.test_Q_component_2[21][25]:=0.1563402972714242*t*busted.test.theta_CG*busted.test.omega2;
+busted.test_Q_component_2[21][29]:=0.2361684149931496*t*busted.test.theta_CT*busted.test.omega2;
+busted.test_Q_component_2[21][37]:=0.2567033972679326*t*busted.test.theta_CG*busted.test.omega2;
+busted.test_Q_component_2[21][51]:=0.257146542110382*t*busted.test.theta_CT*busted.test.omega2;
+busted.test_Q_component_2[22][6]:=0.3148753970510747*t*busted.test.theta_AC*busted.test.omega2;
+busted.test_Q_component_2[22][18]:=0.4256503784977386*t*busted.test.theta_AC*busted.test.omega2;
+busted.test_Q_component_2[22][20]:=0.5074830879161225*t*busted.test.theta_AG;
+busted.test_Q_component_2[22][21]:=0.09717451507454297*t*busted.test.theta_CG;
+busted.test_Q_component_2[22][23]:=0.1989860284705866*t*busted.test.theta_GT;
+busted.test_Q_component_2[22][26]:=0.1563402972714242*t*busted.test.theta_CG*busted.test.omega2;
+busted.test_Q_component_2[22][30]:=0.2361684149931496*t*busted.test.theta_CT*busted.test.omega2;
+busted.test_Q_component_2[22][38]:=0.2567033972679326*t*busted.test.theta_CG*busted.test.omega2;
+busted.test_Q_component_2[22][52]:=0.257146542110382*t*busted.test.theta_CT*busted.test.omega2;
+busted.test_Q_component_2[23][7]:=0.3148753970510747*t*busted.test.theta_AC*busted.test.omega2;
+busted.test_Q_component_2[23][19]:=0.4256503784977386*t*busted.test.theta_AC*busted.test.omega2;
+busted.test_Q_component_2[23][20]:=0.5074830879161225*t*busted.test.theta_AT;
+busted.test_Q_component_2[23][21]:=0.09717451507454297*t*busted.test.theta_CT;
+busted.test_Q_component_2[23][22]:=0.1963563685387479*t*busted.test.theta_GT;
+busted.test_Q_component_2[23][27]:=0.1563402972714242*t*busted.test.theta_CG*busted.test.omega2;
+busted.test_Q_component_2[23][31]:=0.2361684149931496*t*busted.test.theta_CT*busted.test.omega2;
+busted.test_Q_component_2[23][39]:=0.2567033972679326*t*busted.test.theta_CG*busted.test.omega2;
+busted.test_Q_component_2[23][53]:=0.257146542110382*t*busted.test.theta_CT*busted.test.omega2;
+busted.test_Q_component_2[24][8]:=0.3148753970510747*t*busted.test.theta_AC;
+busted.test_Q_component_2[24][16]:=0.4256503784977386*t*busted.test.theta_AG*busted.test.omega2;
+busted.test_Q_component_2[24][20]:=0.1818409092376876*t*busted.test.theta_CG*busted.test.omega2;
+busted.test_Q_component_2[24][25]:=0.09717451507454297*t*busted.test.theta_AC;
+busted.test_Q_component_2[24][26]:=0.1963563685387479*t*busted.test.theta_AG;
+busted.test_Q_component_2[24][27]:=0.1989860284705866*t*busted.test.theta_AT;
+busted.test_Q_component_2[24][28]:=0.2361684149931496*t*busted.test.theta_GT*busted.test.omega2;
+busted.test_Q_component_2[24][40]:=0.2567033972679326*t*busted.test.theta_CG*busted.test.omega2;
+busted.test_Q_component_2[25][9]:=0.3148753970510747*t*busted.test.theta_AC*busted.test.omega2;
+busted.test_Q_component_2[25][17]:=0.4256503784977386*t*busted.test.theta_AG*busted.test.omega2;
+busted.test_Q_component_2[25][21]:=0.1818409092376876*t*busted.test.theta_CG*busted.test.omega2;
+busted.test_Q_component_2[25][24]:=0.5074830879161225*t*busted.test.theta_AC;
+busted.test_Q_component_2[25][26]:=0.1963563685387479*t*busted.test.theta_CG;
+busted.test_Q_component_2[25][27]:=0.1989860284705866*t*busted.test.theta_CT;
+busted.test_Q_component_2[25][29]:=0.2361684149931496*t*busted.test.theta_GT*busted.test.omega2;
+busted.test_Q_component_2[25][41]:=0.2567033972679326*t*busted.test.theta_CG*busted.test.omega2;
+busted.test_Q_component_2[25][54]:=0.257146542110382*t*busted.test.theta_CT*busted.test.omega2;
+busted.test_Q_component_2[26][10]:=0.3148753970510747*t*busted.test.theta_AC;
+busted.test_Q_component_2[26][18]:=0.4256503784977386*t*busted.test.theta_AG*busted.test.omega2;
+busted.test_Q_component_2[26][22]:=0.1818409092376876*t*busted.test.theta_CG*busted.test.omega2;
+busted.test_Q_component_2[26][24]:=0.5074830879161225*t*busted.test.theta_AG;
+busted.test_Q_component_2[26][25]:=0.09717451507454297*t*busted.test.theta_CG;
+busted.test_Q_component_2[26][27]:=0.1989860284705866*t*busted.test.theta_GT;
+busted.test_Q_component_2[26][30]:=0.2361684149931496*t*busted.test.theta_GT*busted.test.omega2;
+busted.test_Q_component_2[26][42]:=0.2567033972679326*t*busted.test.theta_CG*busted.test.omega2;
+busted.test_Q_component_2[26][55]:=0.257146542110382*t*busted.test.theta_CT*busted.test.omega2;
+busted.test_Q_component_2[27][11]:=0.3148753970510747*t*busted.test.theta_AC*busted.test.omega2;
+busted.test_Q_component_2[27][19]:=0.4256503784977386*t*busted.test.theta_AG*busted.test.omega2;
+busted.test_Q_component_2[27][23]:=0.1818409092376876*t*busted.test.theta_CG*busted.test.omega2;
+busted.test_Q_component_2[27][24]:=0.5074830879161225*t*busted.test.theta_AT;
+busted.test_Q_component_2[27][25]:=0.09717451507454297*t*busted.test.theta_CT;
+busted.test_Q_component_2[27][26]:=0.1963563685387479*t*busted.test.theta_GT;
+busted.test_Q_component_2[27][31]:=0.2361684149931496*t*busted.test.theta_GT*busted.test.omega2;
+busted.test_Q_component_2[27][43]:=0.2567033972679326*t*busted.test.theta_CG*busted.test.omega2;
+busted.test_Q_component_2[27][56]:=0.257146542110382*t*busted.test.theta_CT*busted.test.omega2;
+busted.test_Q_component_2[28][12]:=0.3148753970510747*t*busted.test.theta_AC*busted.test.omega2;
+busted.test_Q_component_2[28][16]:=0.4256503784977386*t*busted.test.theta_AT*busted.test.omega2;
+busted.test_Q_component_2[28][20]:=0.1818409092376876*t*busted.test.theta_CT*busted.test.omega2;
+busted.test_Q_component_2[28][24]:=0.1563402972714242*t*busted.test.theta_GT*busted.test.omega2;
+busted.test_Q_component_2[28][29]:=0.09717451507454297*t*busted.test.theta_AC;
+busted.test_Q_component_2[28][30]:=0.1963563685387479*t*busted.test.theta_AG;
+busted.test_Q_component_2[28][31]:=0.1989860284705866*t*busted.test.theta_AT;
+busted.test_Q_component_2[28][44]:=0.2567033972679326*t*busted.test.theta_CG*busted.test.omega2;
+busted.test_Q_component_2[28][57]:=0.257146542110382*t*busted.test.theta_CT;
+busted.test_Q_component_2[29][13]:=0.3148753970510747*t*busted.test.theta_AC*busted.test.omega2;
+busted.test_Q_component_2[29][17]:=0.4256503784977386*t*busted.test.theta_AT*busted.test.omega2;
+busted.test_Q_component_2[29][21]:=0.1818409092376876*t*busted.test.theta_CT*busted.test.omega2;
+busted.test_Q_component_2[29][25]:=0.1563402972714242*t*busted.test.theta_GT*busted.test.omega2;
+busted.test_Q_component_2[29][28]:=0.5074830879161225*t*busted.test.theta_AC;
+busted.test_Q_component_2[29][30]:=0.1963563685387479*t*busted.test.theta_CG;
+busted.test_Q_component_2[29][31]:=0.1989860284705866*t*busted.test.theta_CT;
+busted.test_Q_component_2[29][45]:=0.2567033972679326*t*busted.test.theta_CG*busted.test.omega2;
+busted.test_Q_component_2[29][58]:=0.257146542110382*t*busted.test.theta_CT*busted.test.omega2;
+busted.test_Q_component_2[30][14]:=0.3148753970510747*t*busted.test.theta_AC*busted.test.omega2;
+busted.test_Q_component_2[30][18]:=0.4256503784977386*t*busted.test.theta_AT*busted.test.omega2;
+busted.test_Q_component_2[30][22]:=0.1818409092376876*t*busted.test.theta_CT*busted.test.omega2;
+busted.test_Q_component_2[30][26]:=0.1563402972714242*t*busted.test.theta_GT*busted.test.omega2;
+busted.test_Q_component_2[30][28]:=0.5074830879161225*t*busted.test.theta_AG;
+busted.test_Q_component_2[30][29]:=0.09717451507454297*t*busted.test.theta_CG;
+busted.test_Q_component_2[30][31]:=0.1989860284705866*t*busted.test.theta_GT;
+busted.test_Q_component_2[30][46]:=0.2567033972679326*t*busted.test.theta_CG*busted.test.omega2;
+busted.test_Q_component_2[30][59]:=0.257146542110382*t*busted.test.theta_CT;
+busted.test_Q_component_2[31][15]:=0.3148753970510747*t*busted.test.theta_AC*busted.test.omega2;
+busted.test_Q_component_2[31][19]:=0.4256503784977386*t*busted.test.theta_AT*busted.test.omega2;
+busted.test_Q_component_2[31][23]:=0.1818409092376876*t*busted.test.theta_CT*busted.test.omega2;
+busted.test_Q_component_2[31][27]:=0.1563402972714242*t*busted.test.theta_GT*busted.test.omega2;
+busted.test_Q_component_2[31][28]:=0.5074830879161225*t*busted.test.theta_AT;
+busted.test_Q_component_2[31][29]:=0.09717451507454297*t*busted.test.theta_CT;
+busted.test_Q_component_2[31][30]:=0.1963563685387479*t*busted.test.theta_GT;
+busted.test_Q_component_2[31][47]:=0.2567033972679326*t*busted.test.theta_CG*busted.test.omega2;
+busted.test_Q_component_2[31][60]:=0.257146542110382*t*busted.test.theta_CT*busted.test.omega2;
+busted.test_Q_component_2[32][0]:=0.3148753970510747*t*busted.test.theta_AG*busted.test.omega2;
+busted.test_Q_component_2[32][16]:=0.1712746635706107*t*busted.test.theta_CG*busted.test.omega2;
+busted.test_Q_component_2[32][33]:=0.09717451507454297*t*busted.test.theta_AC*busted.test.omega2;
+busted.test_Q_component_2[32][34]:=0.1963563685387479*t*busted.test.theta_AG;
+busted.test_Q_component_2[32][35]:=0.1989860284705866*t*busted.test.theta_AT*busted.test.omega2;
+busted.test_Q_component_2[32][36]:=0.1818409092376876*t*busted.test.theta_AC*busted.test.omega2;
+busted.test_Q_component_2[32][40]:=0.1563402972714242*t*busted.test.theta_AG*busted.test.omega2;
+busted.test_Q_component_2[32][44]:=0.2361684149931496*t*busted.test.theta_AT*busted.test.omega2;
+busted.test_Q_component_2[33][1]:=0.3148753970510747*t*busted.test.theta_AG*busted.test.omega2;
+busted.test_Q_component_2[33][17]:=0.1712746635706107*t*busted.test.theta_CG*busted.test.omega2;
+busted.test_Q_component_2[33][32]:=0.5074830879161225*t*busted.test.theta_AC*busted.test.omega2;
+busted.test_Q_component_2[33][34]:=0.1963563685387479*t*busted.test.theta_CG*busted.test.omega2;
+busted.test_Q_component_2[33][35]:=0.1989860284705866*t*busted.test.theta_CT;
+busted.test_Q_component_2[33][37]:=0.1818409092376876*t*busted.test.theta_AC*busted.test.omega2;
+busted.test_Q_component_2[33][41]:=0.1563402972714242*t*busted.test.theta_AG*busted.test.omega2;
+busted.test_Q_component_2[33][45]:=0.2361684149931496*t*busted.test.theta_AT*busted.test.omega2;
+busted.test_Q_component_2[33][48]:=0.257146542110382*t*busted.test.theta_GT*busted.test.omega2;
+busted.test_Q_component_2[34][2]:=0.3148753970510747*t*busted.test.theta_AG*busted.test.omega2;
+busted.test_Q_component_2[34][18]:=0.1712746635706107*t*busted.test.theta_CG*busted.test.omega2;
+busted.test_Q_component_2[34][32]:=0.5074830879161225*t*busted.test.theta_AG;
+busted.test_Q_component_2[34][33]:=0.09717451507454297*t*busted.test.theta_CG*busted.test.omega2;
+busted.test_Q_component_2[34][35]:=0.1989860284705866*t*busted.test.theta_GT*busted.test.omega2;
+busted.test_Q_component_2[34][38]:=0.1818409092376876*t*busted.test.theta_AC*busted.test.omega2;
+busted.test_Q_component_2[34][42]:=0.1563402972714242*t*busted.test.theta_AG*busted.test.omega2;
+busted.test_Q_component_2[34][46]:=0.2361684149931496*t*busted.test.theta_AT*busted.test.omega2;
+busted.test_Q_component_2[35][3]:=0.3148753970510747*t*busted.test.theta_AG*busted.test.omega2;
+busted.test_Q_component_2[35][19]:=0.1712746635706107*t*busted.test.theta_CG*busted.test.omega2;
+busted.test_Q_component_2[35][32]:=0.5074830879161225*t*busted.test.theta_AT*busted.test.omega2;
+busted.test_Q_component_2[35][33]:=0.09717451507454297*t*busted.test.theta_CT;
+busted.test_Q_component_2[35][34]:=0.1963563685387479*t*busted.test.theta_GT*busted.test.omega2;
+busted.test_Q_component_2[35][39]:=0.1818409092376876*t*busted.test.theta_AC*busted.test.omega2;
+busted.test_Q_component_2[35][43]:=0.1563402972714242*t*busted.test.theta_AG*busted.test.omega2;
+busted.test_Q_component_2[35][47]:=0.2361684149931496*t*busted.test.theta_AT*busted.test.omega2;
+busted.test_Q_component_2[35][49]:=0.257146542110382*t*busted.test.theta_GT*busted.test.omega2;
+busted.test_Q_component_2[36][4]:=0.3148753970510747*t*busted.test.theta_AG*busted.test.omega2;
+busted.test_Q_component_2[36][20]:=0.1712746635706107*t*busted.test.theta_CG*busted.test.omega2;
+busted.test_Q_component_2[36][32]:=0.4256503784977386*t*busted.test.theta_AC*busted.test.omega2;
+busted.test_Q_component_2[36][37]:=0.09717451507454297*t*busted.test.theta_AC;
+busted.test_Q_component_2[36][38]:=0.1963563685387479*t*busted.test.theta_AG;
+busted.test_Q_component_2[36][39]:=0.1989860284705866*t*busted.test.theta_AT;
+busted.test_Q_component_2[36][40]:=0.1563402972714242*t*busted.test.theta_CG*busted.test.omega2;
+busted.test_Q_component_2[36][44]:=0.2361684149931496*t*busted.test.theta_CT*busted.test.omega2;
+busted.test_Q_component_2[36][50]:=0.257146542110382*t*busted.test.theta_GT*busted.test.omega2;
+busted.test_Q_component_2[37][5]:=0.3148753970510747*t*busted.test.theta_AG*busted.test.omega2;
+busted.test_Q_component_2[37][21]:=0.1712746635706107*t*busted.test.theta_CG*busted.test.omega2;
+busted.test_Q_component_2[37][33]:=0.4256503784977386*t*busted.test.theta_AC*busted.test.omega2;
+busted.test_Q_component_2[37][36]:=0.5074830879161225*t*busted.test.theta_AC;
+busted.test_Q_component_2[37][38]:=0.1963563685387479*t*busted.test.theta_CG;
+busted.test_Q_component_2[37][39]:=0.1989860284705866*t*busted.test.theta_CT;
+busted.test_Q_component_2[37][41]:=0.1563402972714242*t*busted.test.theta_CG*busted.test.omega2;
+busted.test_Q_component_2[37][45]:=0.2361684149931496*t*busted.test.theta_CT*busted.test.omega2;
+busted.test_Q_component_2[37][51]:=0.257146542110382*t*busted.test.theta_GT*busted.test.omega2;
+busted.test_Q_component_2[38][6]:=0.3148753970510747*t*busted.test.theta_AG*busted.test.omega2;
+busted.test_Q_component_2[38][22]:=0.1712746635706107*t*busted.test.theta_CG*busted.test.omega2;
+busted.test_Q_component_2[38][34]:=0.4256503784977386*t*busted.test.theta_AC*busted.test.omega2;
+busted.test_Q_component_2[38][36]:=0.5074830879161225*t*busted.test.theta_AG;
+busted.test_Q_component_2[38][37]:=0.09717451507454297*t*busted.test.theta_CG;
+busted.test_Q_component_2[38][39]:=0.1989860284705866*t*busted.test.theta_GT;
+busted.test_Q_component_2[38][42]:=0.1563402972714242*t*busted.test.theta_CG*busted.test.omega2;
+busted.test_Q_component_2[38][46]:=0.2361684149931496*t*busted.test.theta_CT*busted.test.omega2;
+busted.test_Q_component_2[38][52]:=0.257146542110382*t*busted.test.theta_GT*busted.test.omega2;
+busted.test_Q_component_2[39][7]:=0.3148753970510747*t*busted.test.theta_AG*busted.test.omega2;
+busted.test_Q_component_2[39][23]:=0.1712746635706107*t*busted.test.theta_CG*busted.test.omega2;
+busted.test_Q_component_2[39][35]:=0.4256503784977386*t*busted.test.theta_AC*busted.test.omega2;
+busted.test_Q_component_2[39][36]:=0.5074830879161225*t*busted.test.theta_AT;
+busted.test_Q_component_2[39][37]:=0.09717451507454297*t*busted.test.theta_CT;
+busted.test_Q_component_2[39][38]:=0.1963563685387479*t*busted.test.theta_GT;
+busted.test_Q_component_2[39][43]:=0.1563402972714242*t*busted.test.theta_CG*busted.test.omega2;
+busted.test_Q_component_2[39][47]:=0.2361684149931496*t*busted.test.theta_CT*busted.test.omega2;
+busted.test_Q_component_2[39][53]:=0.257146542110382*t*busted.test.theta_GT*busted.test.omega2;
+busted.test_Q_component_2[40][8]:=0.3148753970510747*t*busted.test.theta_AG*busted.test.omega2;
+busted.test_Q_component_2[40][24]:=0.1712746635706107*t*busted.test.theta_CG*busted.test.omega2;
+busted.test_Q_component_2[40][32]:=0.4256503784977386*t*busted.test.theta_AG*busted.test.omega2;
+busted.test_Q_component_2[40][36]:=0.1818409092376876*t*busted.test.theta_CG*busted.test.omega2;
+busted.test_Q_component_2[40][41]:=0.09717451507454297*t*busted.test.theta_AC;
+busted.test_Q_component_2[40][42]:=0.1963563685387479*t*busted.test.theta_AG;
+busted.test_Q_component_2[40][43]:=0.1989860284705866*t*busted.test.theta_AT;
+busted.test_Q_component_2[40][44]:=0.2361684149931496*t*busted.test.theta_GT*busted.test.omega2;
+busted.test_Q_component_2[41][9]:=0.3148753970510747*t*busted.test.theta_AG*busted.test.omega2;
+busted.test_Q_component_2[41][25]:=0.1712746635706107*t*busted.test.theta_CG*busted.test.omega2;
+busted.test_Q_component_2[41][33]:=0.4256503784977386*t*busted.test.theta_AG*busted.test.omega2;
+busted.test_Q_component_2[41][37]:=0.1818409092376876*t*busted.test.theta_CG*busted.test.omega2;
+busted.test_Q_component_2[41][40]:=0.5074830879161225*t*busted.test.theta_AC;
+busted.test_Q_component_2[41][42]:=0.1963563685387479*t*busted.test.theta_CG;
+busted.test_Q_component_2[41][43]:=0.1989860284705866*t*busted.test.theta_CT;
+busted.test_Q_component_2[41][45]:=0.2361684149931496*t*busted.test.theta_GT*busted.test.omega2;
+busted.test_Q_component_2[41][54]:=0.257146542110382*t*busted.test.theta_GT*busted.test.omega2;
+busted.test_Q_component_2[42][10]:=0.3148753970510747*t*busted.test.theta_AG*busted.test.omega2;
+busted.test_Q_component_2[42][26]:=0.1712746635706107*t*busted.test.theta_CG*busted.test.omega2;
+busted.test_Q_component_2[42][34]:=0.4256503784977386*t*busted.test.theta_AG*busted.test.omega2;
+busted.test_Q_component_2[42][38]:=0.1818409092376876*t*busted.test.theta_CG*busted.test.omega2;
+busted.test_Q_component_2[42][40]:=0.5074830879161225*t*busted.test.theta_AG;
+busted.test_Q_component_2[42][41]:=0.09717451507454297*t*busted.test.theta_CG;
+busted.test_Q_component_2[42][43]:=0.1989860284705866*t*busted.test.theta_GT;
+busted.test_Q_component_2[42][46]:=0.2361684149931496*t*busted.test.theta_GT*busted.test.omega2;
+busted.test_Q_component_2[42][55]:=0.257146542110382*t*busted.test.theta_GT*busted.test.omega2;
+busted.test_Q_component_2[43][11]:=0.3148753970510747*t*busted.test.theta_AG*busted.test.omega2;
+busted.test_Q_component_2[43][27]:=0.1712746635706107*t*busted.test.theta_CG*busted.test.omega2;
+busted.test_Q_component_2[43][35]:=0.4256503784977386*t*busted.test.theta_AG*busted.test.omega2;
+busted.test_Q_component_2[43][39]:=0.1818409092376876*t*busted.test.theta_CG*busted.test.omega2;
+busted.test_Q_component_2[43][40]:=0.5074830879161225*t*busted.test.theta_AT;
+busted.test_Q_component_2[43][41]:=0.09717451507454297*t*busted.test.theta_CT;
+busted.test_Q_component_2[43][42]:=0.1963563685387479*t*busted.test.theta_GT;
+busted.test_Q_component_2[43][47]:=0.2361684149931496*t*busted.test.theta_GT*busted.test.omega2;
+busted.test_Q_component_2[43][56]:=0.257146542110382*t*busted.test.theta_GT*busted.test.omega2;
+busted.test_Q_component_2[44][12]:=0.3148753970510747*t*busted.test.theta_AG*busted.test.omega2;
+busted.test_Q_component_2[44][28]:=0.1712746635706107*t*busted.test.theta_CG*busted.test.omega2;
+busted.test_Q_component_2[44][32]:=0.4256503784977386*t*busted.test.theta_AT*busted.test.omega2;
+busted.test_Q_component_2[44][36]:=0.1818409092376876*t*busted.test.theta_CT*busted.test.omega2;
+busted.test_Q_component_2[44][40]:=0.1563402972714242*t*busted.test.theta_GT*busted.test.omega2;
+busted.test_Q_component_2[44][45]:=0.09717451507454297*t*busted.test.theta_AC;
+busted.test_Q_component_2[44][46]:=0.1963563685387479*t*busted.test.theta_AG;
+busted.test_Q_component_2[44][47]:=0.1989860284705866*t*busted.test.theta_AT;
+busted.test_Q_component_2[44][57]:=0.257146542110382*t*busted.test.theta_GT*busted.test.omega2;
+busted.test_Q_component_2[45][13]:=0.3148753970510747*t*busted.test.theta_AG*busted.test.omega2;
+busted.test_Q_component_2[45][29]:=0.1712746635706107*t*busted.test.theta_CG*busted.test.omega2;
+busted.test_Q_component_2[45][33]:=0.4256503784977386*t*busted.test.theta_AT*busted.test.omega2;
+busted.test_Q_component_2[45][37]:=0.1818409092376876*t*busted.test.theta_CT*busted.test.omega2;
+busted.test_Q_component_2[45][41]:=0.1563402972714242*t*busted.test.theta_GT*busted.test.omega2;
+busted.test_Q_component_2[45][44]:=0.5074830879161225*t*busted.test.theta_AC;
+busted.test_Q_component_2[45][46]:=0.1963563685387479*t*busted.test.theta_CG;
+busted.test_Q_component_2[45][47]:=0.1989860284705866*t*busted.test.theta_CT;
+busted.test_Q_component_2[45][58]:=0.257146542110382*t*busted.test.theta_GT*busted.test.omega2;
+busted.test_Q_component_2[46][14]:=0.3148753970510747*t*busted.test.theta_AG*busted.test.omega2;
+busted.test_Q_component_2[46][30]:=0.1712746635706107*t*busted.test.theta_CG*busted.test.omega2;
+busted.test_Q_component_2[46][34]:=0.4256503784977386*t*busted.test.theta_AT*busted.test.omega2;
+busted.test_Q_component_2[46][38]:=0.1818409092376876*t*busted.test.theta_CT*busted.test.omega2;
+busted.test_Q_component_2[46][42]:=0.1563402972714242*t*busted.test.theta_GT*busted.test.omega2;
+busted.test_Q_component_2[46][44]:=0.5074830879161225*t*busted.test.theta_AG;
+busted.test_Q_component_2[46][45]:=0.09717451507454297*t*busted.test.theta_CG;
+busted.test_Q_component_2[46][47]:=0.1989860284705866*t*busted.test.theta_GT;
+busted.test_Q_component_2[46][59]:=0.257146542110382*t*busted.test.theta_GT*busted.test.omega2;
+busted.test_Q_component_2[47][15]:=0.3148753970510747*t*busted.test.theta_AG*busted.test.omega2;
+busted.test_Q_component_2[47][31]:=0.1712746635706107*t*busted.test.theta_CG*busted.test.omega2;
+busted.test_Q_component_2[47][35]:=0.4256503784977386*t*busted.test.theta_AT*busted.test.omega2;
+busted.test_Q_component_2[47][39]:=0.1818409092376876*t*busted.test.theta_CT*busted.test.omega2;
+busted.test_Q_component_2[47][43]:=0.1563402972714242*t*busted.test.theta_GT*busted.test.omega2;
+busted.test_Q_component_2[47][44]:=0.5074830879161225*t*busted.test.theta_AT;
+busted.test_Q_component_2[47][45]:=0.09717451507454297*t*busted.test.theta_CT;
+busted.test_Q_component_2[47][46]:=0.1963563685387479*t*busted.test.theta_GT;
+busted.test_Q_component_2[47][60]:=0.257146542110382*t*busted.test.theta_GT*busted.test.omega2;
+busted.test_Q_component_2[48][1]:=0.3148753970510747*t*busted.test.theta_AT*busted.test.omega2;
+busted.test_Q_component_2[48][17]:=0.1712746635706107*t*busted.test.theta_CT*busted.test.omega2;
+busted.test_Q_component_2[48][33]:=0.2567033972679326*t*busted.test.theta_GT*busted.test.omega2;
+busted.test_Q_component_2[48][49]:=0.1989860284705866*t*busted.test.theta_CT;
+busted.test_Q_component_2[48][51]:=0.1818409092376876*t*busted.test.theta_AC*busted.test.omega2;
+busted.test_Q_component_2[48][54]:=0.1563402972714242*t*busted.test.theta_AG*busted.test.omega2;
+busted.test_Q_component_2[48][58]:=0.2361684149931496*t*busted.test.theta_AT*busted.test.omega2;
+busted.test_Q_component_2[49][3]:=0.3148753970510747*t*busted.test.theta_AT*busted.test.omega2;
+busted.test_Q_component_2[49][19]:=0.1712746635706107*t*busted.test.theta_CT*busted.test.omega2;
+busted.test_Q_component_2[49][35]:=0.2567033972679326*t*busted.test.theta_GT*busted.test.omega2;
+busted.test_Q_component_2[49][48]:=0.09717451507454297*t*busted.test.theta_CT;
+busted.test_Q_component_2[49][53]:=0.1818409092376876*t*busted.test.theta_AC*busted.test.omega2;
+busted.test_Q_component_2[49][56]:=0.1563402972714242*t*busted.test.theta_AG*busted.test.omega2;
+busted.test_Q_component_2[49][60]:=0.2361684149931496*t*busted.test.theta_AT*busted.test.omega2;
+busted.test_Q_component_2[50][4]:=0.3148753970510747*t*busted.test.theta_AT*busted.test.omega2;
+busted.test_Q_component_2[50][20]:=0.1712746635706107*t*busted.test.theta_CT*busted.test.omega2;
+busted.test_Q_component_2[50][36]:=0.2567033972679326*t*busted.test.theta_GT*busted.test.omega2;
+busted.test_Q_component_2[50][51]:=0.09717451507454297*t*busted.test.theta_AC;
+busted.test_Q_component_2[50][52]:=0.1963563685387479*t*busted.test.theta_AG;
+busted.test_Q_component_2[50][53]:=0.1989860284705866*t*busted.test.theta_AT;
+busted.test_Q_component_2[50][57]:=0.2361684149931496*t*busted.test.theta_CT*busted.test.omega2;
+busted.test_Q_component_2[51][5]:=0.3148753970510747*t*busted.test.theta_AT*busted.test.omega2;
+busted.test_Q_component_2[51][21]:=0.1712746635706107*t*busted.test.theta_CT*busted.test.omega2;
+busted.test_Q_component_2[51][37]:=0.2567033972679326*t*busted.test.theta_GT*busted.test.omega2;
+busted.test_Q_component_2[51][48]:=0.4256503784977386*t*busted.test.theta_AC*busted.test.omega2;
+busted.test_Q_component_2[51][50]:=0.5074830879161225*t*busted.test.theta_AC;
+busted.test_Q_component_2[51][52]:=0.1963563685387479*t*busted.test.theta_CG;
+busted.test_Q_component_2[51][53]:=0.1989860284705866*t*busted.test.theta_CT;
+busted.test_Q_component_2[51][54]:=0.1563402972714242*t*busted.test.theta_CG*busted.test.omega2;
+busted.test_Q_component_2[51][58]:=0.2361684149931496*t*busted.test.theta_CT*busted.test.omega2;
+busted.test_Q_component_2[52][6]:=0.3148753970510747*t*busted.test.theta_AT*busted.test.omega2;
+busted.test_Q_component_2[52][22]:=0.1712746635706107*t*busted.test.theta_CT*busted.test.omega2;
+busted.test_Q_component_2[52][38]:=0.2567033972679326*t*busted.test.theta_GT*busted.test.omega2;
+busted.test_Q_component_2[52][50]:=0.5074830879161225*t*busted.test.theta_AG;
+busted.test_Q_component_2[52][51]:=0.09717451507454297*t*busted.test.theta_CG;
+busted.test_Q_component_2[52][53]:=0.1989860284705866*t*busted.test.theta_GT;
+busted.test_Q_component_2[52][55]:=0.1563402972714242*t*busted.test.theta_CG*busted.test.omega2;
+busted.test_Q_component_2[52][59]:=0.2361684149931496*t*busted.test.theta_CT*busted.test.omega2;
+busted.test_Q_component_2[53][7]:=0.3148753970510747*t*busted.test.theta_AT*busted.test.omega2;
+busted.test_Q_component_2[53][23]:=0.1712746635706107*t*busted.test.theta_CT*busted.test.omega2;
+busted.test_Q_component_2[53][39]:=0.2567033972679326*t*busted.test.theta_GT*busted.test.omega2;
+busted.test_Q_component_2[53][49]:=0.4256503784977386*t*busted.test.theta_AC*busted.test.omega2;
+busted.test_Q_component_2[53][50]:=0.5074830879161225*t*busted.test.theta_AT;
+busted.test_Q_component_2[53][51]:=0.09717451507454297*t*busted.test.theta_CT;
+busted.test_Q_component_2[53][52]:=0.1963563685387479*t*busted.test.theta_GT;
+busted.test_Q_component_2[53][56]:=0.1563402972714242*t*busted.test.theta_CG*busted.test.omega2;
+busted.test_Q_component_2[53][60]:=0.2361684149931496*t*busted.test.theta_CT*busted.test.omega2;
+busted.test_Q_component_2[54][9]:=0.3148753970510747*t*busted.test.theta_AT*busted.test.omega2;
+busted.test_Q_component_2[54][25]:=0.1712746635706107*t*busted.test.theta_CT*busted.test.omega2;
+busted.test_Q_component_2[54][41]:=0.2567033972679326*t*busted.test.theta_GT*busted.test.omega2;
+busted.test_Q_component_2[54][48]:=0.4256503784977386*t*busted.test.theta_AG*busted.test.omega2;
+busted.test_Q_component_2[54][51]:=0.1818409092376876*t*busted.test.theta_CG*busted.test.omega2;
+busted.test_Q_component_2[54][55]:=0.1963563685387479*t*busted.test.theta_CG*busted.test.omega2;
+busted.test_Q_component_2[54][56]:=0.1989860284705866*t*busted.test.theta_CT;
+busted.test_Q_component_2[54][58]:=0.2361684149931496*t*busted.test.theta_GT*busted.test.omega2;
+busted.test_Q_component_2[55][10]:=0.3148753970510747*t*busted.test.theta_AT*busted.test.omega2;
+busted.test_Q_component_2[55][26]:=0.1712746635706107*t*busted.test.theta_CT*busted.test.omega2;
+busted.test_Q_component_2[55][42]:=0.2567033972679326*t*busted.test.theta_GT*busted.test.omega2;
+busted.test_Q_component_2[55][52]:=0.1818409092376876*t*busted.test.theta_CG*busted.test.omega2;
+busted.test_Q_component_2[55][54]:=0.09717451507454297*t*busted.test.theta_CG*busted.test.omega2;
+busted.test_Q_component_2[55][56]:=0.1989860284705866*t*busted.test.theta_GT*busted.test.omega2;
+busted.test_Q_component_2[55][59]:=0.2361684149931496*t*busted.test.theta_GT*busted.test.omega2;
+busted.test_Q_component_2[56][11]:=0.3148753970510747*t*busted.test.theta_AT*busted.test.omega2;
+busted.test_Q_component_2[56][27]:=0.1712746635706107*t*busted.test.theta_CT*busted.test.omega2;
+busted.test_Q_component_2[56][43]:=0.2567033972679326*t*busted.test.theta_GT*busted.test.omega2;
+busted.test_Q_component_2[56][49]:=0.4256503784977386*t*busted.test.theta_AG*busted.test.omega2;
+busted.test_Q_component_2[56][53]:=0.1818409092376876*t*busted.test.theta_CG*busted.test.omega2;
+busted.test_Q_component_2[56][54]:=0.09717451507454297*t*busted.test.theta_CT;
+busted.test_Q_component_2[56][55]:=0.1963563685387479*t*busted.test.theta_GT*busted.test.omega2;
+busted.test_Q_component_2[56][60]:=0.2361684149931496*t*busted.test.theta_GT*busted.test.omega2;
+busted.test_Q_component_2[57][12]:=0.3148753970510747*t*busted.test.theta_AT*busted.test.omega2;
+busted.test_Q_component_2[57][28]:=0.1712746635706107*t*busted.test.theta_CT;
+busted.test_Q_component_2[57][44]:=0.2567033972679326*t*busted.test.theta_GT*busted.test.omega2;
+busted.test_Q_component_2[57][50]:=0.1818409092376876*t*busted.test.theta_CT*busted.test.omega2;
+busted.test_Q_component_2[57][58]:=0.09717451507454297*t*busted.test.theta_AC*busted.test.omega2;
+busted.test_Q_component_2[57][59]:=0.1963563685387479*t*busted.test.theta_AG;
+busted.test_Q_component_2[57][60]:=0.1989860284705866*t*busted.test.theta_AT*busted.test.omega2;
+busted.test_Q_component_2[58][13]:=0.3148753970510747*t*busted.test.theta_AT*busted.test.omega2;
+busted.test_Q_component_2[58][29]:=0.1712746635706107*t*busted.test.theta_CT*busted.test.omega2;
+busted.test_Q_component_2[58][45]:=0.2567033972679326*t*busted.test.theta_GT*busted.test.omega2;
+busted.test_Q_component_2[58][48]:=0.4256503784977386*t*busted.test.theta_AT*busted.test.omega2;
+busted.test_Q_component_2[58][51]:=0.1818409092376876*t*busted.test.theta_CT*busted.test.omega2;
+busted.test_Q_component_2[58][54]:=0.1563402972714242*t*busted.test.theta_GT*busted.test.omega2;
+busted.test_Q_component_2[58][57]:=0.5074830879161225*t*busted.test.theta_AC*busted.test.omega2;
+busted.test_Q_component_2[58][59]:=0.1963563685387479*t*busted.test.theta_CG*busted.test.omega2;
+busted.test_Q_component_2[58][60]:=0.1989860284705866*t*busted.test.theta_CT;
+busted.test_Q_component_2[59][14]:=0.3148753970510747*t*busted.test.theta_AT*busted.test.omega2;
+busted.test_Q_component_2[59][30]:=0.1712746635706107*t*busted.test.theta_CT;
+busted.test_Q_component_2[59][46]:=0.2567033972679326*t*busted.test.theta_GT*busted.test.omega2;
+busted.test_Q_component_2[59][52]:=0.1818409092376876*t*busted.test.theta_CT*busted.test.omega2;
+busted.test_Q_component_2[59][55]:=0.1563402972714242*t*busted.test.theta_GT*busted.test.omega2;
+busted.test_Q_component_2[59][57]:=0.5074830879161225*t*busted.test.theta_AG;
+busted.test_Q_component_2[59][58]:=0.09717451507454297*t*busted.test.theta_CG*busted.test.omega2;
+busted.test_Q_component_2[59][60]:=0.1989860284705866*t*busted.test.theta_GT*busted.test.omega2;
+busted.test_Q_component_2[60][15]:=0.3148753970510747*t*busted.test.theta_AT*busted.test.omega2;
+busted.test_Q_component_2[60][31]:=0.1712746635706107*t*busted.test.theta_CT*busted.test.omega2;
+busted.test_Q_component_2[60][47]:=0.2567033972679326*t*busted.test.theta_GT*busted.test.omega2;
+busted.test_Q_component_2[60][49]:=0.4256503784977386*t*busted.test.theta_AT*busted.test.omega2;
+busted.test_Q_component_2[60][53]:=0.1818409092376876*t*busted.test.theta_CT*busted.test.omega2;
+busted.test_Q_component_2[60][56]:=0.1563402972714242*t*busted.test.theta_GT*busted.test.omega2;
+busted.test_Q_component_2[60][57]:=0.5074830879161225*t*busted.test.theta_AT*busted.test.omega2;
+busted.test_Q_component_2[60][58]:=0.09717451507454297*t*busted.test.theta_CT;
+busted.test_Q_component_2[60][59]:=0.1963563685387479*t*busted.test.theta_GT*busted.test.omega2;
+
+
+busted.test_Q_component_3={61,61};
+busted.test_Q_component_3[0][1]:=0.09717451507454297*t*busted.test.theta_AC*busted.test.omega3;
+busted.test_Q_component_3[0][2]:=0.1963563685387479*t*busted.test.theta_AG;
+busted.test_Q_component_3[0][3]:=0.1989860284705866*t*busted.test.theta_AT*busted.test.omega3;
+busted.test_Q_component_3[0][4]:=0.1818409092376876*t*busted.test.theta_AC*busted.test.omega3;
+busted.test_Q_component_3[0][8]:=0.1563402972714242*t*busted.test.theta_AG*busted.test.omega3;
+busted.test_Q_component_3[0][12]:=0.2361684149931496*t*busted.test.theta_AT*busted.test.omega3;
+busted.test_Q_component_3[0][16]:=0.1712746635706107*t*busted.test.theta_AC*busted.test.omega3;
+busted.test_Q_component_3[0][32]:=0.2567033972679326*t*busted.test.theta_AG*busted.test.omega3;
+busted.test_Q_component_3[1][0]:=0.5074830879161225*t*busted.test.theta_AC*busted.test.omega3;
+busted.test_Q_component_3[1][2]:=0.1963563685387479*t*busted.test.theta_CG*busted.test.omega3;
+busted.test_Q_component_3[1][3]:=0.1989860284705866*t*busted.test.theta_CT;
+busted.test_Q_component_3[1][5]:=0.1818409092376876*t*busted.test.theta_AC*busted.test.omega3;
+busted.test_Q_component_3[1][9]:=0.1563402972714242*t*busted.test.theta_AG*busted.test.omega3;
+busted.test_Q_component_3[1][13]:=0.2361684149931496*t*busted.test.theta_AT*busted.test.omega3;
+busted.test_Q_component_3[1][17]:=0.1712746635706107*t*busted.test.theta_AC*busted.test.omega3;
+busted.test_Q_component_3[1][33]:=0.2567033972679326*t*busted.test.theta_AG*busted.test.omega3;
+busted.test_Q_component_3[1][48]:=0.257146542110382*t*busted.test.theta_AT*busted.test.omega3;
+busted.test_Q_component_3[2][0]:=0.5074830879161225*t*busted.test.theta_AG;
+busted.test_Q_component_3[2][1]:=0.09717451507454297*t*busted.test.theta_CG*busted.test.omega3;
+busted.test_Q_component_3[2][3]:=0.1989860284705866*t*busted.test.theta_GT*busted.test.omega3;
+busted.test_Q_component_3[2][6]:=0.1818409092376876*t*busted.test.theta_AC*busted.test.omega3;
+busted.test_Q_component_3[2][10]:=0.1563402972714242*t*busted.test.theta_AG*busted.test.omega3;
+busted.test_Q_component_3[2][14]:=0.2361684149931496*t*busted.test.theta_AT*busted.test.omega3;
+busted.test_Q_component_3[2][18]:=0.1712746635706107*t*busted.test.theta_AC*busted.test.omega3;
+busted.test_Q_component_3[2][34]:=0.2567033972679326*t*busted.test.theta_AG*busted.test.omega3;
+busted.test_Q_component_3[3][0]:=0.5074830879161225*t*busted.test.theta_AT*busted.test.omega3;
+busted.test_Q_component_3[3][1]:=0.09717451507454297*t*busted.test.theta_CT;
+busted.test_Q_component_3[3][2]:=0.1963563685387479*t*busted.test.theta_GT*busted.test.omega3;
+busted.test_Q_component_3[3][7]:=0.1818409092376876*t*busted.test.theta_AC*busted.test.omega3;
+busted.test_Q_component_3[3][11]:=0.1563402972714242*t*busted.test.theta_AG*busted.test.omega3;
+busted.test_Q_component_3[3][15]:=0.2361684149931496*t*busted.test.theta_AT*busted.test.omega3;
+busted.test_Q_component_3[3][19]:=0.1712746635706107*t*busted.test.theta_AC*busted.test.omega3;
+busted.test_Q_component_3[3][35]:=0.2567033972679326*t*busted.test.theta_AG*busted.test.omega3;
+busted.test_Q_component_3[3][49]:=0.257146542110382*t*busted.test.theta_AT*busted.test.omega3;
+busted.test_Q_component_3[4][0]:=0.4256503784977386*t*busted.test.theta_AC*busted.test.omega3;
+busted.test_Q_component_3[4][5]:=0.09717451507454297*t*busted.test.theta_AC;
+busted.test_Q_component_3[4][6]:=0.1963563685387479*t*busted.test.theta_AG;
+busted.test_Q_component_3[4][7]:=0.1989860284705866*t*busted.test.theta_AT;
+busted.test_Q_component_3[4][8]:=0.1563402972714242*t*busted.test.theta_CG*busted.test.omega3;
+busted.test_Q_component_3[4][12]:=0.2361684149931496*t*busted.test.theta_CT*busted.test.omega3;
+busted.test_Q_component_3[4][20]:=0.1712746635706107*t*busted.test.theta_AC*busted.test.omega3;
+busted.test_Q_component_3[4][36]:=0.2567033972679326*t*busted.test.theta_AG*busted.test.omega3;
+busted.test_Q_component_3[4][50]:=0.257146542110382*t*busted.test.theta_AT*busted.test.omega3;
+busted.test_Q_component_3[5][1]:=0.4256503784977386*t*busted.test.theta_AC*busted.test.omega3;
+busted.test_Q_component_3[5][4]:=0.5074830879161225*t*busted.test.theta_AC;
+busted.test_Q_component_3[5][6]:=0.1963563685387479*t*busted.test.theta_CG;
+busted.test_Q_component_3[5][7]:=0.1989860284705866*t*busted.test.theta_CT;
+busted.test_Q_component_3[5][9]:=0.1563402972714242*t*busted.test.theta_CG*busted.test.omega3;
+busted.test_Q_component_3[5][13]:=0.2361684149931496*t*busted.test.theta_CT*busted.test.omega3;
+busted.test_Q_component_3[5][21]:=0.1712746635706107*t*busted.test.theta_AC*busted.test.omega3;
+busted.test_Q_component_3[5][37]:=0.2567033972679326*t*busted.test.theta_AG*busted.test.omega3;
+busted.test_Q_component_3[5][51]:=0.257146542110382*t*busted.test.theta_AT*busted.test.omega3;
+busted.test_Q_component_3[6][2]:=0.4256503784977386*t*busted.test.theta_AC*busted.test.omega3;
+busted.test_Q_component_3[6][4]:=0.5074830879161225*t*busted.test.theta_AG;
+busted.test_Q_component_3[6][5]:=0.09717451507454297*t*busted.test.theta_CG;
+busted.test_Q_component_3[6][7]:=0.1989860284705866*t*busted.test.theta_GT;
+busted.test_Q_component_3[6][10]:=0.1563402972714242*t*busted.test.theta_CG*busted.test.omega3;
+busted.test_Q_component_3[6][14]:=0.2361684149931496*t*busted.test.theta_CT*busted.test.omega3;
+busted.test_Q_component_3[6][22]:=0.1712746635706107*t*busted.test.theta_AC*busted.test.omega3;
+busted.test_Q_component_3[6][38]:=0.2567033972679326*t*busted.test.theta_AG*busted.test.omega3;
+busted.test_Q_component_3[6][52]:=0.257146542110382*t*busted.test.theta_AT*busted.test.omega3;
+busted.test_Q_component_3[7][3]:=0.4256503784977386*t*busted.test.theta_AC*busted.test.omega3;
+busted.test_Q_component_3[7][4]:=0.5074830879161225*t*busted.test.theta_AT;
+busted.test_Q_component_3[7][5]:=0.09717451507454297*t*busted.test.theta_CT;
+busted.test_Q_component_3[7][6]:=0.1963563685387479*t*busted.test.theta_GT;
+busted.test_Q_component_3[7][11]:=0.1563402972714242*t*busted.test.theta_CG*busted.test.omega3;
+busted.test_Q_component_3[7][15]:=0.2361684149931496*t*busted.test.theta_CT*busted.test.omega3;
+busted.test_Q_component_3[7][23]:=0.1712746635706107*t*busted.test.theta_AC*busted.test.omega3;
+busted.test_Q_component_3[7][39]:=0.2567033972679326*t*busted.test.theta_AG*busted.test.omega3;
+busted.test_Q_component_3[7][53]:=0.257146542110382*t*busted.test.theta_AT*busted.test.omega3;
+busted.test_Q_component_3[8][0]:=0.4256503784977386*t*busted.test.theta_AG*busted.test.omega3;
+busted.test_Q_component_3[8][4]:=0.1818409092376876*t*busted.test.theta_CG*busted.test.omega3;
+busted.test_Q_component_3[8][9]:=0.09717451507454297*t*busted.test.theta_AC*busted.test.omega3;
+busted.test_Q_component_3[8][10]:=0.1963563685387479*t*busted.test.theta_AG;
+busted.test_Q_component_3[8][11]:=0.1989860284705866*t*busted.test.theta_AT*busted.test.omega3;
+busted.test_Q_component_3[8][12]:=0.2361684149931496*t*busted.test.theta_GT*busted.test.omega3;
+busted.test_Q_component_3[8][24]:=0.1712746635706107*t*busted.test.theta_AC;
+busted.test_Q_component_3[8][40]:=0.2567033972679326*t*busted.test.theta_AG*busted.test.omega3;
+busted.test_Q_component_3[9][1]:=0.4256503784977386*t*busted.test.theta_AG*busted.test.omega3;
+busted.test_Q_component_3[9][5]:=0.1818409092376876*t*busted.test.theta_CG*busted.test.omega3;
+busted.test_Q_component_3[9][8]:=0.5074830879161225*t*busted.test.theta_AC*busted.test.omega3;
+busted.test_Q_component_3[9][10]:=0.1963563685387479*t*busted.test.theta_CG*busted.test.omega3;
+busted.test_Q_component_3[9][11]:=0.1989860284705866*t*busted.test.theta_CT;
+busted.test_Q_component_3[9][13]:=0.2361684149931496*t*busted.test.theta_GT*busted.test.omega3;
+busted.test_Q_component_3[9][25]:=0.1712746635706107*t*busted.test.theta_AC*busted.test.omega3;
+busted.test_Q_component_3[9][41]:=0.2567033972679326*t*busted.test.theta_AG*busted.test.omega3;
+busted.test_Q_component_3[9][54]:=0.257146542110382*t*busted.test.theta_AT*busted.test.omega3;
+busted.test_Q_component_3[10][2]:=0.4256503784977386*t*busted.test.theta_AG*busted.test.omega3;
+busted.test_Q_component_3[10][6]:=0.1818409092376876*t*busted.test.theta_CG*busted.test.omega3;
+busted.test_Q_component_3[10][8]:=0.5074830879161225*t*busted.test.theta_AG;
+busted.test_Q_component_3[10][9]:=0.09717451507454297*t*busted.test.theta_CG*busted.test.omega3;
+busted.test_Q_component_3[10][11]:=0.1989860284705866*t*busted.test.theta_GT*busted.test.omega3;
+busted.test_Q_component_3[10][14]:=0.2361684149931496*t*busted.test.theta_GT*busted.test.omega3;
+busted.test_Q_component_3[10][26]:=0.1712746635706107*t*busted.test.theta_AC;
+busted.test_Q_component_3[10][42]:=0.2567033972679326*t*busted.test.theta_AG*busted.test.omega3;
+busted.test_Q_component_3[10][55]:=0.257146542110382*t*busted.test.theta_AT*busted.test.omega3;
+busted.test_Q_component_3[11][3]:=0.4256503784977386*t*busted.test.theta_AG*busted.test.omega3;
+busted.test_Q_component_3[11][7]:=0.1818409092376876*t*busted.test.theta_CG*busted.test.omega3;
+busted.test_Q_component_3[11][8]:=0.5074830879161225*t*busted.test.theta_AT*busted.test.omega3;
+busted.test_Q_component_3[11][9]:=0.09717451507454297*t*busted.test.theta_CT;
+busted.test_Q_component_3[11][10]:=0.1963563685387479*t*busted.test.theta_GT*busted.test.omega3;
+busted.test_Q_component_3[11][15]:=0.2361684149931496*t*busted.test.theta_GT*busted.test.omega3;
+busted.test_Q_component_3[11][27]:=0.1712746635706107*t*busted.test.theta_AC*busted.test.omega3;
+busted.test_Q_component_3[11][43]:=0.2567033972679326*t*busted.test.theta_AG*busted.test.omega3;
+busted.test_Q_component_3[11][56]:=0.257146542110382*t*busted.test.theta_AT*busted.test.omega3;
+busted.test_Q_component_3[12][0]:=0.4256503784977386*t*busted.test.theta_AT*busted.test.omega3;
+busted.test_Q_component_3[12][4]:=0.1818409092376876*t*busted.test.theta_CT*busted.test.omega3;
+busted.test_Q_component_3[12][8]:=0.1563402972714242*t*busted.test.theta_GT*busted.test.omega3;
+busted.test_Q_component_3[12][13]:=0.09717451507454297*t*busted.test.theta_AC;
+busted.test_Q_component_3[12][14]:=0.1963563685387479*t*busted.test.theta_AG*busted.test.omega3;
+busted.test_Q_component_3[12][15]:=0.1989860284705866*t*busted.test.theta_AT;
+busted.test_Q_component_3[12][28]:=0.1712746635706107*t*busted.test.theta_AC*busted.test.omega3;
+busted.test_Q_component_3[12][44]:=0.2567033972679326*t*busted.test.theta_AG*busted.test.omega3;
+busted.test_Q_component_3[12][57]:=0.257146542110382*t*busted.test.theta_AT*busted.test.omega3;
+busted.test_Q_component_3[13][1]:=0.4256503784977386*t*busted.test.theta_AT*busted.test.omega3;
+busted.test_Q_component_3[13][5]:=0.1818409092376876*t*busted.test.theta_CT*busted.test.omega3;
+busted.test_Q_component_3[13][9]:=0.1563402972714242*t*busted.test.theta_GT*busted.test.omega3;
+busted.test_Q_component_3[13][12]:=0.5074830879161225*t*busted.test.theta_AC;
+busted.test_Q_component_3[13][14]:=0.1963563685387479*t*busted.test.theta_CG*busted.test.omega3;
+busted.test_Q_component_3[13][15]:=0.1989860284705866*t*busted.test.theta_CT;
+busted.test_Q_component_3[13][29]:=0.1712746635706107*t*busted.test.theta_AC*busted.test.omega3;
+busted.test_Q_component_3[13][45]:=0.2567033972679326*t*busted.test.theta_AG*busted.test.omega3;
+busted.test_Q_component_3[13][58]:=0.257146542110382*t*busted.test.theta_AT*busted.test.omega3;
+busted.test_Q_component_3[14][2]:=0.4256503784977386*t*busted.test.theta_AT*busted.test.omega3;
+busted.test_Q_component_3[14][6]:=0.1818409092376876*t*busted.test.theta_CT*busted.test.omega3;
+busted.test_Q_component_3[14][10]:=0.1563402972714242*t*busted.test.theta_GT*busted.test.omega3;
+busted.test_Q_component_3[14][12]:=0.5074830879161225*t*busted.test.theta_AG*busted.test.omega3;
+busted.test_Q_component_3[14][13]:=0.09717451507454297*t*busted.test.theta_CG*busted.test.omega3;
+busted.test_Q_component_3[14][15]:=0.1989860284705866*t*busted.test.theta_GT*busted.test.omega3;
+busted.test_Q_component_3[14][30]:=0.1712746635706107*t*busted.test.theta_AC*busted.test.omega3;
+busted.test_Q_component_3[14][46]:=0.2567033972679326*t*busted.test.theta_AG*busted.test.omega3;
+busted.test_Q_component_3[14][59]:=0.257146542110382*t*busted.test.theta_AT*busted.test.omega3;
+busted.test_Q_component_3[15][3]:=0.4256503784977386*t*busted.test.theta_AT*busted.test.omega3;
+busted.test_Q_component_3[15][7]:=0.1818409092376876*t*busted.test.theta_CT*busted.test.omega3;
+busted.test_Q_component_3[15][11]:=0.1563402972714242*t*busted.test.theta_GT*busted.test.omega3;
+busted.test_Q_component_3[15][12]:=0.5074830879161225*t*busted.test.theta_AT;
+busted.test_Q_component_3[15][13]:=0.09717451507454297*t*busted.test.theta_CT;
+busted.test_Q_component_3[15][14]:=0.1963563685387479*t*busted.test.theta_GT*busted.test.omega3;
+busted.test_Q_component_3[15][31]:=0.1712746635706107*t*busted.test.theta_AC*busted.test.omega3;
+busted.test_Q_component_3[15][47]:=0.2567033972679326*t*busted.test.theta_AG*busted.test.omega3;
+busted.test_Q_component_3[15][60]:=0.257146542110382*t*busted.test.theta_AT*busted.test.omega3;
+busted.test_Q_component_3[16][0]:=0.3148753970510747*t*busted.test.theta_AC*busted.test.omega3;
+busted.test_Q_component_3[16][17]:=0.09717451507454297*t*busted.test.theta_AC*busted.test.omega3;
+busted.test_Q_component_3[16][18]:=0.1963563685387479*t*busted.test.theta_AG;
+busted.test_Q_component_3[16][19]:=0.1989860284705866*t*busted.test.theta_AT*busted.test.omega3;
+busted.test_Q_component_3[16][20]:=0.1818409092376876*t*busted.test.theta_AC*busted.test.omega3;
+busted.test_Q_component_3[16][24]:=0.1563402972714242*t*busted.test.theta_AG*busted.test.omega3;
+busted.test_Q_component_3[16][28]:=0.2361684149931496*t*busted.test.theta_AT*busted.test.omega3;
+busted.test_Q_component_3[16][32]:=0.2567033972679326*t*busted.test.theta_CG*busted.test.omega3;
+busted.test_Q_component_3[17][1]:=0.3148753970510747*t*busted.test.theta_AC*busted.test.omega3;
+busted.test_Q_component_3[17][16]:=0.5074830879161225*t*busted.test.theta_AC*busted.test.omega3;
+busted.test_Q_component_3[17][18]:=0.1963563685387479*t*busted.test.theta_CG*busted.test.omega3;
+busted.test_Q_component_3[17][19]:=0.1989860284705866*t*busted.test.theta_CT;
+busted.test_Q_component_3[17][21]:=0.1818409092376876*t*busted.test.theta_AC*busted.test.omega3;
+busted.test_Q_component_3[17][25]:=0.1563402972714242*t*busted.test.theta_AG*busted.test.omega3;
+busted.test_Q_component_3[17][29]:=0.2361684149931496*t*busted.test.theta_AT*busted.test.omega3;
+busted.test_Q_component_3[17][33]:=0.2567033972679326*t*busted.test.theta_CG*busted.test.omega3;
+busted.test_Q_component_3[17][48]:=0.257146542110382*t*busted.test.theta_CT*busted.test.omega3;
+busted.test_Q_component_3[18][2]:=0.3148753970510747*t*busted.test.theta_AC*busted.test.omega3;
+busted.test_Q_component_3[18][16]:=0.5074830879161225*t*busted.test.theta_AG;
+busted.test_Q_component_3[18][17]:=0.09717451507454297*t*busted.test.theta_CG*busted.test.omega3;
+busted.test_Q_component_3[18][19]:=0.1989860284705866*t*busted.test.theta_GT*busted.test.omega3;
+busted.test_Q_component_3[18][22]:=0.1818409092376876*t*busted.test.theta_AC*busted.test.omega3;
+busted.test_Q_component_3[18][26]:=0.1563402972714242*t*busted.test.theta_AG*busted.test.omega3;
+busted.test_Q_component_3[18][30]:=0.2361684149931496*t*busted.test.theta_AT*busted.test.omega3;
+busted.test_Q_component_3[18][34]:=0.2567033972679326*t*busted.test.theta_CG*busted.test.omega3;
+busted.test_Q_component_3[19][3]:=0.3148753970510747*t*busted.test.theta_AC*busted.test.omega3;
+busted.test_Q_component_3[19][16]:=0.5074830879161225*t*busted.test.theta_AT*busted.test.omega3;
+busted.test_Q_component_3[19][17]:=0.09717451507454297*t*busted.test.theta_CT;
+busted.test_Q_component_3[19][18]:=0.1963563685387479*t*busted.test.theta_GT*busted.test.omega3;
+busted.test_Q_component_3[19][23]:=0.1818409092376876*t*busted.test.theta_AC*busted.test.omega3;
+busted.test_Q_component_3[19][27]:=0.1563402972714242*t*busted.test.theta_AG*busted.test.omega3;
+busted.test_Q_component_3[19][31]:=0.2361684149931496*t*busted.test.theta_AT*busted.test.omega3;
+busted.test_Q_component_3[19][35]:=0.2567033972679326*t*busted.test.theta_CG*busted.test.omega3;
+busted.test_Q_component_3[19][49]:=0.257146542110382*t*busted.test.theta_CT*busted.test.omega3;
+busted.test_Q_component_3[20][4]:=0.3148753970510747*t*busted.test.theta_AC*busted.test.omega3;
+busted.test_Q_component_3[20][16]:=0.4256503784977386*t*busted.test.theta_AC*busted.test.omega3;
+busted.test_Q_component_3[20][21]:=0.09717451507454297*t*busted.test.theta_AC;
+busted.test_Q_component_3[20][22]:=0.1963563685387479*t*busted.test.theta_AG;
+busted.test_Q_component_3[20][23]:=0.1989860284705866*t*busted.test.theta_AT;
+busted.test_Q_component_3[20][24]:=0.1563402972714242*t*busted.test.theta_CG*busted.test.omega3;
+busted.test_Q_component_3[20][28]:=0.2361684149931496*t*busted.test.theta_CT*busted.test.omega3;
+busted.test_Q_component_3[20][36]:=0.2567033972679326*t*busted.test.theta_CG*busted.test.omega3;
+busted.test_Q_component_3[20][50]:=0.257146542110382*t*busted.test.theta_CT*busted.test.omega3;
+busted.test_Q_component_3[21][5]:=0.3148753970510747*t*busted.test.theta_AC*busted.test.omega3;
+busted.test_Q_component_3[21][17]:=0.4256503784977386*t*busted.test.theta_AC*busted.test.omega3;
+busted.test_Q_component_3[21][20]:=0.5074830879161225*t*busted.test.theta_AC;
+busted.test_Q_component_3[21][22]:=0.1963563685387479*t*busted.test.theta_CG;
+busted.test_Q_component_3[21][23]:=0.1989860284705866*t*busted.test.theta_CT;
+busted.test_Q_component_3[21][25]:=0.1563402972714242*t*busted.test.theta_CG*busted.test.omega3;
+busted.test_Q_component_3[21][29]:=0.2361684149931496*t*busted.test.theta_CT*busted.test.omega3;
+busted.test_Q_component_3[21][37]:=0.2567033972679326*t*busted.test.theta_CG*busted.test.omega3;
+busted.test_Q_component_3[21][51]:=0.257146542110382*t*busted.test.theta_CT*busted.test.omega3;
+busted.test_Q_component_3[22][6]:=0.3148753970510747*t*busted.test.theta_AC*busted.test.omega3;
+busted.test_Q_component_3[22][18]:=0.4256503784977386*t*busted.test.theta_AC*busted.test.omega3;
+busted.test_Q_component_3[22][20]:=0.5074830879161225*t*busted.test.theta_AG;
+busted.test_Q_component_3[22][21]:=0.09717451507454297*t*busted.test.theta_CG;
+busted.test_Q_component_3[22][23]:=0.1989860284705866*t*busted.test.theta_GT;
+busted.test_Q_component_3[22][26]:=0.1563402972714242*t*busted.test.theta_CG*busted.test.omega3;
+busted.test_Q_component_3[22][30]:=0.2361684149931496*t*busted.test.theta_CT*busted.test.omega3;
+busted.test_Q_component_3[22][38]:=0.2567033972679326*t*busted.test.theta_CG*busted.test.omega3;
+busted.test_Q_component_3[22][52]:=0.257146542110382*t*busted.test.theta_CT*busted.test.omega3;
+busted.test_Q_component_3[23][7]:=0.3148753970510747*t*busted.test.theta_AC*busted.test.omega3;
+busted.test_Q_component_3[23][19]:=0.4256503784977386*t*busted.test.theta_AC*busted.test.omega3;
+busted.test_Q_component_3[23][20]:=0.5074830879161225*t*busted.test.theta_AT;
+busted.test_Q_component_3[23][21]:=0.09717451507454297*t*busted.test.theta_CT;
+busted.test_Q_component_3[23][22]:=0.1963563685387479*t*busted.test.theta_GT;
+busted.test_Q_component_3[23][27]:=0.1563402972714242*t*busted.test.theta_CG*busted.test.omega3;
+busted.test_Q_component_3[23][31]:=0.2361684149931496*t*busted.test.theta_CT*busted.test.omega3;
+busted.test_Q_component_3[23][39]:=0.2567033972679326*t*busted.test.theta_CG*busted.test.omega3;
+busted.test_Q_component_3[23][53]:=0.257146542110382*t*busted.test.theta_CT*busted.test.omega3;
+busted.test_Q_component_3[24][8]:=0.3148753970510747*t*busted.test.theta_AC;
+busted.test_Q_component_3[24][16]:=0.4256503784977386*t*busted.test.theta_AG*busted.test.omega3;
+busted.test_Q_component_3[24][20]:=0.1818409092376876*t*busted.test.theta_CG*busted.test.omega3;
+busted.test_Q_component_3[24][25]:=0.09717451507454297*t*busted.test.theta_AC;
+busted.test_Q_component_3[24][26]:=0.1963563685387479*t*busted.test.theta_AG;
+busted.test_Q_component_3[24][27]:=0.1989860284705866*t*busted.test.theta_AT;
+busted.test_Q_component_3[24][28]:=0.2361684149931496*t*busted.test.theta_GT*busted.test.omega3;
+busted.test_Q_component_3[24][40]:=0.2567033972679326*t*busted.test.theta_CG*busted.test.omega3;
+busted.test_Q_component_3[25][9]:=0.3148753970510747*t*busted.test.theta_AC*busted.test.omega3;
+busted.test_Q_component_3[25][17]:=0.4256503784977386*t*busted.test.theta_AG*busted.test.omega3;
+busted.test_Q_component_3[25][21]:=0.1818409092376876*t*busted.test.theta_CG*busted.test.omega3;
+busted.test_Q_component_3[25][24]:=0.5074830879161225*t*busted.test.theta_AC;
+busted.test_Q_component_3[25][26]:=0.1963563685387479*t*busted.test.theta_CG;
+busted.test_Q_component_3[25][27]:=0.1989860284705866*t*busted.test.theta_CT;
+busted.test_Q_component_3[25][29]:=0.2361684149931496*t*busted.test.theta_GT*busted.test.omega3;
+busted.test_Q_component_3[25][41]:=0.2567033972679326*t*busted.test.theta_CG*busted.test.omega3;
+busted.test_Q_component_3[25][54]:=0.257146542110382*t*busted.test.theta_CT*busted.test.omega3;
+busted.test_Q_component_3[26][10]:=0.3148753970510747*t*busted.test.theta_AC;
+busted.test_Q_component_3[26][18]:=0.4256503784977386*t*busted.test.theta_AG*busted.test.omega3;
+busted.test_Q_component_3[26][22]:=0.1818409092376876*t*busted.test.theta_CG*busted.test.omega3;
+busted.test_Q_component_3[26][24]:=0.5074830879161225*t*busted.test.theta_AG;
+busted.test_Q_component_3[26][25]:=0.09717451507454297*t*busted.test.theta_CG;
+busted.test_Q_component_3[26][27]:=0.1989860284705866*t*busted.test.theta_GT;
+busted.test_Q_component_3[26][30]:=0.2361684149931496*t*busted.test.theta_GT*busted.test.omega3;
+busted.test_Q_component_3[26][42]:=0.2567033972679326*t*busted.test.theta_CG*busted.test.omega3;
+busted.test_Q_component_3[26][55]:=0.257146542110382*t*busted.test.theta_CT*busted.test.omega3;
+busted.test_Q_component_3[27][11]:=0.3148753970510747*t*busted.test.theta_AC*busted.test.omega3;
+busted.test_Q_component_3[27][19]:=0.4256503784977386*t*busted.test.theta_AG*busted.test.omega3;
+busted.test_Q_component_3[27][23]:=0.1818409092376876*t*busted.test.theta_CG*busted.test.omega3;
+busted.test_Q_component_3[27][24]:=0.5074830879161225*t*busted.test.theta_AT;
+busted.test_Q_component_3[27][25]:=0.09717451507454297*t*busted.test.theta_CT;
+busted.test_Q_component_3[27][26]:=0.1963563685387479*t*busted.test.theta_GT;
+busted.test_Q_component_3[27][31]:=0.2361684149931496*t*busted.test.theta_GT*busted.test.omega3;
+busted.test_Q_component_3[27][43]:=0.2567033972679326*t*busted.test.theta_CG*busted.test.omega3;
+busted.test_Q_component_3[27][56]:=0.257146542110382*t*busted.test.theta_CT*busted.test.omega3;
+busted.test_Q_component_3[28][12]:=0.3148753970510747*t*busted.test.theta_AC*busted.test.omega3;
+busted.test_Q_component_3[28][16]:=0.4256503784977386*t*busted.test.theta_AT*busted.test.omega3;
+busted.test_Q_component_3[28][20]:=0.1818409092376876*t*busted.test.theta_CT*busted.test.omega3;
+busted.test_Q_component_3[28][24]:=0.1563402972714242*t*busted.test.theta_GT*busted.test.omega3;
+busted.test_Q_component_3[28][29]:=0.09717451507454297*t*busted.test.theta_AC;
+busted.test_Q_component_3[28][30]:=0.1963563685387479*t*busted.test.theta_AG;
+busted.test_Q_component_3[28][31]:=0.1989860284705866*t*busted.test.theta_AT;
+busted.test_Q_component_3[28][44]:=0.2567033972679326*t*busted.test.theta_CG*busted.test.omega3;
+busted.test_Q_component_3[28][57]:=0.257146542110382*t*busted.test.theta_CT;
+busted.test_Q_component_3[29][13]:=0.3148753970510747*t*busted.test.theta_AC*busted.test.omega3;
+busted.test_Q_component_3[29][17]:=0.4256503784977386*t*busted.test.theta_AT*busted.test.omega3;
+busted.test_Q_component_3[29][21]:=0.1818409092376876*t*busted.test.theta_CT*busted.test.omega3;
+busted.test_Q_component_3[29][25]:=0.1563402972714242*t*busted.test.theta_GT*busted.test.omega3;
+busted.test_Q_component_3[29][28]:=0.5074830879161225*t*busted.test.theta_AC;
+busted.test_Q_component_3[29][30]:=0.1963563685387479*t*busted.test.theta_CG;
+busted.test_Q_component_3[29][31]:=0.1989860284705866*t*busted.test.theta_CT;
+busted.test_Q_component_3[29][45]:=0.2567033972679326*t*busted.test.theta_CG*busted.test.omega3;
+busted.test_Q_component_3[29][58]:=0.257146542110382*t*busted.test.theta_CT*busted.test.omega3;
+busted.test_Q_component_3[30][14]:=0.3148753970510747*t*busted.test.theta_AC*busted.test.omega3;
+busted.test_Q_component_3[30][18]:=0.4256503784977386*t*busted.test.theta_AT*busted.test.omega3;
+busted.test_Q_component_3[30][22]:=0.1818409092376876*t*busted.test.theta_CT*busted.test.omega3;
+busted.test_Q_component_3[30][26]:=0.1563402972714242*t*busted.test.theta_GT*busted.test.omega3;
+busted.test_Q_component_3[30][28]:=0.5074830879161225*t*busted.test.theta_AG;
+busted.test_Q_component_3[30][29]:=0.09717451507454297*t*busted.test.theta_CG;
+busted.test_Q_component_3[30][31]:=0.1989860284705866*t*busted.test.theta_GT;
+busted.test_Q_component_3[30][46]:=0.2567033972679326*t*busted.test.theta_CG*busted.test.omega3;
+busted.test_Q_component_3[30][59]:=0.257146542110382*t*busted.test.theta_CT;
+busted.test_Q_component_3[31][15]:=0.3148753970510747*t*busted.test.theta_AC*busted.test.omega3;
+busted.test_Q_component_3[31][19]:=0.4256503784977386*t*busted.test.theta_AT*busted.test.omega3;
+busted.test_Q_component_3[31][23]:=0.1818409092376876*t*busted.test.theta_CT*busted.test.omega3;
+busted.test_Q_component_3[31][27]:=0.1563402972714242*t*busted.test.theta_GT*busted.test.omega3;
+busted.test_Q_component_3[31][28]:=0.5074830879161225*t*busted.test.theta_AT;
+busted.test_Q_component_3[31][29]:=0.09717451507454297*t*busted.test.theta_CT;
+busted.test_Q_component_3[31][30]:=0.1963563685387479*t*busted.test.theta_GT;
+busted.test_Q_component_3[31][47]:=0.2567033972679326*t*busted.test.theta_CG*busted.test.omega3;
+busted.test_Q_component_3[31][60]:=0.257146542110382*t*busted.test.theta_CT*busted.test.omega3;
+busted.test_Q_component_3[32][0]:=0.3148753970510747*t*busted.test.theta_AG*busted.test.omega3;
+busted.test_Q_component_3[32][16]:=0.1712746635706107*t*busted.test.theta_CG*busted.test.omega3;
+busted.test_Q_component_3[32][33]:=0.09717451507454297*t*busted.test.theta_AC*busted.test.omega3;
+busted.test_Q_component_3[32][34]:=0.1963563685387479*t*busted.test.theta_AG;
+busted.test_Q_component_3[32][35]:=0.1989860284705866*t*busted.test.theta_AT*busted.test.omega3;
+busted.test_Q_component_3[32][36]:=0.1818409092376876*t*busted.test.theta_AC*busted.test.omega3;
+busted.test_Q_component_3[32][40]:=0.1563402972714242*t*busted.test.theta_AG*busted.test.omega3;
+busted.test_Q_component_3[32][44]:=0.2361684149931496*t*busted.test.theta_AT*busted.test.omega3;
+busted.test_Q_component_3[33][1]:=0.3148753970510747*t*busted.test.theta_AG*busted.test.omega3;
+busted.test_Q_component_3[33][17]:=0.1712746635706107*t*busted.test.theta_CG*busted.test.omega3;
+busted.test_Q_component_3[33][32]:=0.5074830879161225*t*busted.test.theta_AC*busted.test.omega3;
+busted.test_Q_component_3[33][34]:=0.1963563685387479*t*busted.test.theta_CG*busted.test.omega3;
+busted.test_Q_component_3[33][35]:=0.1989860284705866*t*busted.test.theta_CT;
+busted.test_Q_component_3[33][37]:=0.1818409092376876*t*busted.test.theta_AC*busted.test.omega3;
+busted.test_Q_component_3[33][41]:=0.1563402972714242*t*busted.test.theta_AG*busted.test.omega3;
+busted.test_Q_component_3[33][45]:=0.2361684149931496*t*busted.test.theta_AT*busted.test.omega3;
+busted.test_Q_component_3[33][48]:=0.257146542110382*t*busted.test.theta_GT*busted.test.omega3;
+busted.test_Q_component_3[34][2]:=0.3148753970510747*t*busted.test.theta_AG*busted.test.omega3;
+busted.test_Q_component_3[34][18]:=0.1712746635706107*t*busted.test.theta_CG*busted.test.omega3;
+busted.test_Q_component_3[34][32]:=0.5074830879161225*t*busted.test.theta_AG;
+busted.test_Q_component_3[34][33]:=0.09717451507454297*t*busted.test.theta_CG*busted.test.omega3;
+busted.test_Q_component_3[34][35]:=0.1989860284705866*t*busted.test.theta_GT*busted.test.omega3;
+busted.test_Q_component_3[34][38]:=0.1818409092376876*t*busted.test.theta_AC*busted.test.omega3;
+busted.test_Q_component_3[34][42]:=0.1563402972714242*t*busted.test.theta_AG*busted.test.omega3;
+busted.test_Q_component_3[34][46]:=0.2361684149931496*t*busted.test.theta_AT*busted.test.omega3;
+busted.test_Q_component_3[35][3]:=0.3148753970510747*t*busted.test.theta_AG*busted.test.omega3;
+busted.test_Q_component_3[35][19]:=0.1712746635706107*t*busted.test.theta_CG*busted.test.omega3;
+busted.test_Q_component_3[35][32]:=0.5074830879161225*t*busted.test.theta_AT*busted.test.omega3;
+busted.test_Q_component_3[35][33]:=0.09717451507454297*t*busted.test.theta_CT;
+busted.test_Q_component_3[35][34]:=0.1963563685387479*t*busted.test.theta_GT*busted.test.omega3;
+busted.test_Q_component_3[35][39]:=0.1818409092376876*t*busted.test.theta_AC*busted.test.omega3;
+busted.test_Q_component_3[35][43]:=0.1563402972714242*t*busted.test.theta_AG*busted.test.omega3;
+busted.test_Q_component_3[35][47]:=0.2361684149931496*t*busted.test.theta_AT*busted.test.omega3;
+busted.test_Q_component_3[35][49]:=0.257146542110382*t*busted.test.theta_GT*busted.test.omega3;
+busted.test_Q_component_3[36][4]:=0.3148753970510747*t*busted.test.theta_AG*busted.test.omega3;
+busted.test_Q_component_3[36][20]:=0.1712746635706107*t*busted.test.theta_CG*busted.test.omega3;
+busted.test_Q_component_3[36][32]:=0.4256503784977386*t*busted.test.theta_AC*busted.test.omega3;
+busted.test_Q_component_3[36][37]:=0.09717451507454297*t*busted.test.theta_AC;
+busted.test_Q_component_3[36][38]:=0.1963563685387479*t*busted.test.theta_AG;
+busted.test_Q_component_3[36][39]:=0.1989860284705866*t*busted.test.theta_AT;
+busted.test_Q_component_3[36][40]:=0.1563402972714242*t*busted.test.theta_CG*busted.test.omega3;
+busted.test_Q_component_3[36][44]:=0.2361684149931496*t*busted.test.theta_CT*busted.test.omega3;
+busted.test_Q_component_3[36][50]:=0.257146542110382*t*busted.test.theta_GT*busted.test.omega3;
+busted.test_Q_component_3[37][5]:=0.3148753970510747*t*busted.test.theta_AG*busted.test.omega3;
+busted.test_Q_component_3[37][21]:=0.1712746635706107*t*busted.test.theta_CG*busted.test.omega3;
+busted.test_Q_component_3[37][33]:=0.4256503784977386*t*busted.test.theta_AC*busted.test.omega3;
+busted.test_Q_component_3[37][36]:=0.5074830879161225*t*busted.test.theta_AC;
+busted.test_Q_component_3[37][38]:=0.1963563685387479*t*busted.test.theta_CG;
+busted.test_Q_component_3[37][39]:=0.1989860284705866*t*busted.test.theta_CT;
+busted.test_Q_component_3[37][41]:=0.1563402972714242*t*busted.test.theta_CG*busted.test.omega3;
+busted.test_Q_component_3[37][45]:=0.2361684149931496*t*busted.test.theta_CT*busted.test.omega3;
+busted.test_Q_component_3[37][51]:=0.257146542110382*t*busted.test.theta_GT*busted.test.omega3;
+busted.test_Q_component_3[38][6]:=0.3148753970510747*t*busted.test.theta_AG*busted.test.omega3;
+busted.test_Q_component_3[38][22]:=0.1712746635706107*t*busted.test.theta_CG*busted.test.omega3;
+busted.test_Q_component_3[38][34]:=0.4256503784977386*t*busted.test.theta_AC*busted.test.omega3;
+busted.test_Q_component_3[38][36]:=0.5074830879161225*t*busted.test.theta_AG;
+busted.test_Q_component_3[38][37]:=0.09717451507454297*t*busted.test.theta_CG;
+busted.test_Q_component_3[38][39]:=0.1989860284705866*t*busted.test.theta_GT;
+busted.test_Q_component_3[38][42]:=0.1563402972714242*t*busted.test.theta_CG*busted.test.omega3;
+busted.test_Q_component_3[38][46]:=0.2361684149931496*t*busted.test.theta_CT*busted.test.omega3;
+busted.test_Q_component_3[38][52]:=0.257146542110382*t*busted.test.theta_GT*busted.test.omega3;
+busted.test_Q_component_3[39][7]:=0.3148753970510747*t*busted.test.theta_AG*busted.test.omega3;
+busted.test_Q_component_3[39][23]:=0.1712746635706107*t*busted.test.theta_CG*busted.test.omega3;
+busted.test_Q_component_3[39][35]:=0.4256503784977386*t*busted.test.theta_AC*busted.test.omega3;
+busted.test_Q_component_3[39][36]:=0.5074830879161225*t*busted.test.theta_AT;
+busted.test_Q_component_3[39][37]:=0.09717451507454297*t*busted.test.theta_CT;
+busted.test_Q_component_3[39][38]:=0.1963563685387479*t*busted.test.theta_GT;
+busted.test_Q_component_3[39][43]:=0.1563402972714242*t*busted.test.theta_CG*busted.test.omega3;
+busted.test_Q_component_3[39][47]:=0.2361684149931496*t*busted.test.theta_CT*busted.test.omega3;
+busted.test_Q_component_3[39][53]:=0.257146542110382*t*busted.test.theta_GT*busted.test.omega3;
+busted.test_Q_component_3[40][8]:=0.3148753970510747*t*busted.test.theta_AG*busted.test.omega3;
+busted.test_Q_component_3[40][24]:=0.1712746635706107*t*busted.test.theta_CG*busted.test.omega3;
+busted.test_Q_component_3[40][32]:=0.4256503784977386*t*busted.test.theta_AG*busted.test.omega3;
+busted.test_Q_component_3[40][36]:=0.1818409092376876*t*busted.test.theta_CG*busted.test.omega3;
+busted.test_Q_component_3[40][41]:=0.09717451507454297*t*busted.test.theta_AC;
+busted.test_Q_component_3[40][42]:=0.1963563685387479*t*busted.test.theta_AG;
+busted.test_Q_component_3[40][43]:=0.1989860284705866*t*busted.test.theta_AT;
+busted.test_Q_component_3[40][44]:=0.2361684149931496*t*busted.test.theta_GT*busted.test.omega3;
+busted.test_Q_component_3[41][9]:=0.3148753970510747*t*busted.test.theta_AG*busted.test.omega3;
+busted.test_Q_component_3[41][25]:=0.1712746635706107*t*busted.test.theta_CG*busted.test.omega3;
+busted.test_Q_component_3[41][33]:=0.4256503784977386*t*busted.test.theta_AG*busted.test.omega3;
+busted.test_Q_component_3[41][37]:=0.1818409092376876*t*busted.test.theta_CG*busted.test.omega3;
+busted.test_Q_component_3[41][40]:=0.5074830879161225*t*busted.test.theta_AC;
+busted.test_Q_component_3[41][42]:=0.1963563685387479*t*busted.test.theta_CG;
+busted.test_Q_component_3[41][43]:=0.1989860284705866*t*busted.test.theta_CT;
+busted.test_Q_component_3[41][45]:=0.2361684149931496*t*busted.test.theta_GT*busted.test.omega3;
+busted.test_Q_component_3[41][54]:=0.257146542110382*t*busted.test.theta_GT*busted.test.omega3;
+busted.test_Q_component_3[42][10]:=0.3148753970510747*t*busted.test.theta_AG*busted.test.omega3;
+busted.test_Q_component_3[42][26]:=0.1712746635706107*t*busted.test.theta_CG*busted.test.omega3;
+busted.test_Q_component_3[42][34]:=0.4256503784977386*t*busted.test.theta_AG*busted.test.omega3;
+busted.test_Q_component_3[42][38]:=0.1818409092376876*t*busted.test.theta_CG*busted.test.omega3;
+busted.test_Q_component_3[42][40]:=0.5074830879161225*t*busted.test.theta_AG;
+busted.test_Q_component_3[42][41]:=0.09717451507454297*t*busted.test.theta_CG;
+busted.test_Q_component_3[42][43]:=0.1989860284705866*t*busted.test.theta_GT;
+busted.test_Q_component_3[42][46]:=0.2361684149931496*t*busted.test.theta_GT*busted.test.omega3;
+busted.test_Q_component_3[42][55]:=0.257146542110382*t*busted.test.theta_GT*busted.test.omega3;
+busted.test_Q_component_3[43][11]:=0.3148753970510747*t*busted.test.theta_AG*busted.test.omega3;
+busted.test_Q_component_3[43][27]:=0.1712746635706107*t*busted.test.theta_CG*busted.test.omega3;
+busted.test_Q_component_3[43][35]:=0.4256503784977386*t*busted.test.theta_AG*busted.test.omega3;
+busted.test_Q_component_3[43][39]:=0.1818409092376876*t*busted.test.theta_CG*busted.test.omega3;
+busted.test_Q_component_3[43][40]:=0.5074830879161225*t*busted.test.theta_AT;
+busted.test_Q_component_3[43][41]:=0.09717451507454297*t*busted.test.theta_CT;
+busted.test_Q_component_3[43][42]:=0.1963563685387479*t*busted.test.theta_GT;
+busted.test_Q_component_3[43][47]:=0.2361684149931496*t*busted.test.theta_GT*busted.test.omega3;
+busted.test_Q_component_3[43][56]:=0.257146542110382*t*busted.test.theta_GT*busted.test.omega3;
+busted.test_Q_component_3[44][12]:=0.3148753970510747*t*busted.test.theta_AG*busted.test.omega3;
+busted.test_Q_component_3[44][28]:=0.1712746635706107*t*busted.test.theta_CG*busted.test.omega3;
+busted.test_Q_component_3[44][32]:=0.4256503784977386*t*busted.test.theta_AT*busted.test.omega3;
+busted.test_Q_component_3[44][36]:=0.1818409092376876*t*busted.test.theta_CT*busted.test.omega3;
+busted.test_Q_component_3[44][40]:=0.1563402972714242*t*busted.test.theta_GT*busted.test.omega3;
+busted.test_Q_component_3[44][45]:=0.09717451507454297*t*busted.test.theta_AC;
+busted.test_Q_component_3[44][46]:=0.1963563685387479*t*busted.test.theta_AG;
+busted.test_Q_component_3[44][47]:=0.1989860284705866*t*busted.test.theta_AT;
+busted.test_Q_component_3[44][57]:=0.257146542110382*t*busted.test.theta_GT*busted.test.omega3;
+busted.test_Q_component_3[45][13]:=0.3148753970510747*t*busted.test.theta_AG*busted.test.omega3;
+busted.test_Q_component_3[45][29]:=0.1712746635706107*t*busted.test.theta_CG*busted.test.omega3;
+busted.test_Q_component_3[45][33]:=0.4256503784977386*t*busted.test.theta_AT*busted.test.omega3;
+busted.test_Q_component_3[45][37]:=0.1818409092376876*t*busted.test.theta_CT*busted.test.omega3;
+busted.test_Q_component_3[45][41]:=0.1563402972714242*t*busted.test.theta_GT*busted.test.omega3;
+busted.test_Q_component_3[45][44]:=0.5074830879161225*t*busted.test.theta_AC;
+busted.test_Q_component_3[45][46]:=0.1963563685387479*t*busted.test.theta_CG;
+busted.test_Q_component_3[45][47]:=0.1989860284705866*t*busted.test.theta_CT;
+busted.test_Q_component_3[45][58]:=0.257146542110382*t*busted.test.theta_GT*busted.test.omega3;
+busted.test_Q_component_3[46][14]:=0.3148753970510747*t*busted.test.theta_AG*busted.test.omega3;
+busted.test_Q_component_3[46][30]:=0.1712746635706107*t*busted.test.theta_CG*busted.test.omega3;
+busted.test_Q_component_3[46][34]:=0.4256503784977386*t*busted.test.theta_AT*busted.test.omega3;
+busted.test_Q_component_3[46][38]:=0.1818409092376876*t*busted.test.theta_CT*busted.test.omega3;
+busted.test_Q_component_3[46][42]:=0.1563402972714242*t*busted.test.theta_GT*busted.test.omega3;
+busted.test_Q_component_3[46][44]:=0.5074830879161225*t*busted.test.theta_AG;
+busted.test_Q_component_3[46][45]:=0.09717451507454297*t*busted.test.theta_CG;
+busted.test_Q_component_3[46][47]:=0.1989860284705866*t*busted.test.theta_GT;
+busted.test_Q_component_3[46][59]:=0.257146542110382*t*busted.test.theta_GT*busted.test.omega3;
+busted.test_Q_component_3[47][15]:=0.3148753970510747*t*busted.test.theta_AG*busted.test.omega3;
+busted.test_Q_component_3[47][31]:=0.1712746635706107*t*busted.test.theta_CG*busted.test.omega3;
+busted.test_Q_component_3[47][35]:=0.4256503784977386*t*busted.test.theta_AT*busted.test.omega3;
+busted.test_Q_component_3[47][39]:=0.1818409092376876*t*busted.test.theta_CT*busted.test.omega3;
+busted.test_Q_component_3[47][43]:=0.1563402972714242*t*busted.test.theta_GT*busted.test.omega3;
+busted.test_Q_component_3[47][44]:=0.5074830879161225*t*busted.test.theta_AT;
+busted.test_Q_component_3[47][45]:=0.09717451507454297*t*busted.test.theta_CT;
+busted.test_Q_component_3[47][46]:=0.1963563685387479*t*busted.test.theta_GT;
+busted.test_Q_component_3[47][60]:=0.257146542110382*t*busted.test.theta_GT*busted.test.omega3;
+busted.test_Q_component_3[48][1]:=0.3148753970510747*t*busted.test.theta_AT*busted.test.omega3;
+busted.test_Q_component_3[48][17]:=0.1712746635706107*t*busted.test.theta_CT*busted.test.omega3;
+busted.test_Q_component_3[48][33]:=0.2567033972679326*t*busted.test.theta_GT*busted.test.omega3;
+busted.test_Q_component_3[48][49]:=0.1989860284705866*t*busted.test.theta_CT;
+busted.test_Q_component_3[48][51]:=0.1818409092376876*t*busted.test.theta_AC*busted.test.omega3;
+busted.test_Q_component_3[48][54]:=0.1563402972714242*t*busted.test.theta_AG*busted.test.omega3;
+busted.test_Q_component_3[48][58]:=0.2361684149931496*t*busted.test.theta_AT*busted.test.omega3;
+busted.test_Q_component_3[49][3]:=0.3148753970510747*t*busted.test.theta_AT*busted.test.omega3;
+busted.test_Q_component_3[49][19]:=0.1712746635706107*t*busted.test.theta_CT*busted.test.omega3;
+busted.test_Q_component_3[49][35]:=0.2567033972679326*t*busted.test.theta_GT*busted.test.omega3;
+busted.test_Q_component_3[49][48]:=0.09717451507454297*t*busted.test.theta_CT;
+busted.test_Q_component_3[49][53]:=0.1818409092376876*t*busted.test.theta_AC*busted.test.omega3;
+busted.test_Q_component_3[49][56]:=0.1563402972714242*t*busted.test.theta_AG*busted.test.omega3;
+busted.test_Q_component_3[49][60]:=0.2361684149931496*t*busted.test.theta_AT*busted.test.omega3;
+busted.test_Q_component_3[50][4]:=0.3148753970510747*t*busted.test.theta_AT*busted.test.omega3;
+busted.test_Q_component_3[50][20]:=0.1712746635706107*t*busted.test.theta_CT*busted.test.omega3;
+busted.test_Q_component_3[50][36]:=0.2567033972679326*t*busted.test.theta_GT*busted.test.omega3;
+busted.test_Q_component_3[50][51]:=0.09717451507454297*t*busted.test.theta_AC;
+busted.test_Q_component_3[50][52]:=0.1963563685387479*t*busted.test.theta_AG;
+busted.test_Q_component_3[50][53]:=0.1989860284705866*t*busted.test.theta_AT;
+busted.test_Q_component_3[50][57]:=0.2361684149931496*t*busted.test.theta_CT*busted.test.omega3;
+busted.test_Q_component_3[51][5]:=0.3148753970510747*t*busted.test.theta_AT*busted.test.omega3;
+busted.test_Q_component_3[51][21]:=0.1712746635706107*t*busted.test.theta_CT*busted.test.omega3;
+busted.test_Q_component_3[51][37]:=0.2567033972679326*t*busted.test.theta_GT*busted.test.omega3;
+busted.test_Q_component_3[51][48]:=0.4256503784977386*t*busted.test.theta_AC*busted.test.omega3;
+busted.test_Q_component_3[51][50]:=0.5074830879161225*t*busted.test.theta_AC;
+busted.test_Q_component_3[51][52]:=0.1963563685387479*t*busted.test.theta_CG;
+busted.test_Q_component_3[51][53]:=0.1989860284705866*t*busted.test.theta_CT;
+busted.test_Q_component_3[51][54]:=0.1563402972714242*t*busted.test.theta_CG*busted.test.omega3;
+busted.test_Q_component_3[51][58]:=0.2361684149931496*t*busted.test.theta_CT*busted.test.omega3;
+busted.test_Q_component_3[52][6]:=0.3148753970510747*t*busted.test.theta_AT*busted.test.omega3;
+busted.test_Q_component_3[52][22]:=0.1712746635706107*t*busted.test.theta_CT*busted.test.omega3;
+busted.test_Q_component_3[52][38]:=0.2567033972679326*t*busted.test.theta_GT*busted.test.omega3;
+busted.test_Q_component_3[52][50]:=0.5074830879161225*t*busted.test.theta_AG;
+busted.test_Q_component_3[52][51]:=0.09717451507454297*t*busted.test.theta_CG;
+busted.test_Q_component_3[52][53]:=0.1989860284705866*t*busted.test.theta_GT;
+busted.test_Q_component_3[52][55]:=0.1563402972714242*t*busted.test.theta_CG*busted.test.omega3;
+busted.test_Q_component_3[52][59]:=0.2361684149931496*t*busted.test.theta_CT*busted.test.omega3;
+busted.test_Q_component_3[53][7]:=0.3148753970510747*t*busted.test.theta_AT*busted.test.omega3;
+busted.test_Q_component_3[53][23]:=0.1712746635706107*t*busted.test.theta_CT*busted.test.omega3;
+busted.test_Q_component_3[53][39]:=0.2567033972679326*t*busted.test.theta_GT*busted.test.omega3;
+busted.test_Q_component_3[53][49]:=0.4256503784977386*t*busted.test.theta_AC*busted.test.omega3;
+busted.test_Q_component_3[53][50]:=0.5074830879161225*t*busted.test.theta_AT;
+busted.test_Q_component_3[53][51]:=0.09717451507454297*t*busted.test.theta_CT;
+busted.test_Q_component_3[53][52]:=0.1963563685387479*t*busted.test.theta_GT;
+busted.test_Q_component_3[53][56]:=0.1563402972714242*t*busted.test.theta_CG*busted.test.omega3;
+busted.test_Q_component_3[53][60]:=0.2361684149931496*t*busted.test.theta_CT*busted.test.omega3;
+busted.test_Q_component_3[54][9]:=0.3148753970510747*t*busted.test.theta_AT*busted.test.omega3;
+busted.test_Q_component_3[54][25]:=0.1712746635706107*t*busted.test.theta_CT*busted.test.omega3;
+busted.test_Q_component_3[54][41]:=0.2567033972679326*t*busted.test.theta_GT*busted.test.omega3;
+busted.test_Q_component_3[54][48]:=0.4256503784977386*t*busted.test.theta_AG*busted.test.omega3;
+busted.test_Q_component_3[54][51]:=0.1818409092376876*t*busted.test.theta_CG*busted.test.omega3;
+busted.test_Q_component_3[54][55]:=0.1963563685387479*t*busted.test.theta_CG*busted.test.omega3;
+busted.test_Q_component_3[54][56]:=0.1989860284705866*t*busted.test.theta_CT;
+busted.test_Q_component_3[54][58]:=0.2361684149931496*t*busted.test.theta_GT*busted.test.omega3;
+busted.test_Q_component_3[55][10]:=0.3148753970510747*t*busted.test.theta_AT*busted.test.omega3;
+busted.test_Q_component_3[55][26]:=0.1712746635706107*t*busted.test.theta_CT*busted.test.omega3;
+busted.test_Q_component_3[55][42]:=0.2567033972679326*t*busted.test.theta_GT*busted.test.omega3;
+busted.test_Q_component_3[55][52]:=0.1818409092376876*t*busted.test.theta_CG*busted.test.omega3;
+busted.test_Q_component_3[55][54]:=0.09717451507454297*t*busted.test.theta_CG*busted.test.omega3;
+busted.test_Q_component_3[55][56]:=0.1989860284705866*t*busted.test.theta_GT*busted.test.omega3;
+busted.test_Q_component_3[55][59]:=0.2361684149931496*t*busted.test.theta_GT*busted.test.omega3;
+busted.test_Q_component_3[56][11]:=0.3148753970510747*t*busted.test.theta_AT*busted.test.omega3;
+busted.test_Q_component_3[56][27]:=0.1712746635706107*t*busted.test.theta_CT*busted.test.omega3;
+busted.test_Q_component_3[56][43]:=0.2567033972679326*t*busted.test.theta_GT*busted.test.omega3;
+busted.test_Q_component_3[56][49]:=0.4256503784977386*t*busted.test.theta_AG*busted.test.omega3;
+busted.test_Q_component_3[56][53]:=0.1818409092376876*t*busted.test.theta_CG*busted.test.omega3;
+busted.test_Q_component_3[56][54]:=0.09717451507454297*t*busted.test.theta_CT;
+busted.test_Q_component_3[56][55]:=0.1963563685387479*t*busted.test.theta_GT*busted.test.omega3;
+busted.test_Q_component_3[56][60]:=0.2361684149931496*t*busted.test.theta_GT*busted.test.omega3;
+busted.test_Q_component_3[57][12]:=0.3148753970510747*t*busted.test.theta_AT*busted.test.omega3;
+busted.test_Q_component_3[57][28]:=0.1712746635706107*t*busted.test.theta_CT;
+busted.test_Q_component_3[57][44]:=0.2567033972679326*t*busted.test.theta_GT*busted.test.omega3;
+busted.test_Q_component_3[57][50]:=0.1818409092376876*t*busted.test.theta_CT*busted.test.omega3;
+busted.test_Q_component_3[57][58]:=0.09717451507454297*t*busted.test.theta_AC*busted.test.omega3;
+busted.test_Q_component_3[57][59]:=0.1963563685387479*t*busted.test.theta_AG;
+busted.test_Q_component_3[57][60]:=0.1989860284705866*t*busted.test.theta_AT*busted.test.omega3;
+busted.test_Q_component_3[58][13]:=0.3148753970510747*t*busted.test.theta_AT*busted.test.omega3;
+busted.test_Q_component_3[58][29]:=0.1712746635706107*t*busted.test.theta_CT*busted.test.omega3;
+busted.test_Q_component_3[58][45]:=0.2567033972679326*t*busted.test.theta_GT*busted.test.omega3;
+busted.test_Q_component_3[58][48]:=0.4256503784977386*t*busted.test.theta_AT*busted.test.omega3;
+busted.test_Q_component_3[58][51]:=0.1818409092376876*t*busted.test.theta_CT*busted.test.omega3;
+busted.test_Q_component_3[58][54]:=0.1563402972714242*t*busted.test.theta_GT*busted.test.omega3;
+busted.test_Q_component_3[58][57]:=0.5074830879161225*t*busted.test.theta_AC*busted.test.omega3;
+busted.test_Q_component_3[58][59]:=0.1963563685387479*t*busted.test.theta_CG*busted.test.omega3;
+busted.test_Q_component_3[58][60]:=0.1989860284705866*t*busted.test.theta_CT;
+busted.test_Q_component_3[59][14]:=0.3148753970510747*t*busted.test.theta_AT*busted.test.omega3;
+busted.test_Q_component_3[59][30]:=0.1712746635706107*t*busted.test.theta_CT;
+busted.test_Q_component_3[59][46]:=0.2567033972679326*t*busted.test.theta_GT*busted.test.omega3;
+busted.test_Q_component_3[59][52]:=0.1818409092376876*t*busted.test.theta_CT*busted.test.omega3;
+busted.test_Q_component_3[59][55]:=0.1563402972714242*t*busted.test.theta_GT*busted.test.omega3;
+busted.test_Q_component_3[59][57]:=0.5074830879161225*t*busted.test.theta_AG;
+busted.test_Q_component_3[59][58]:=0.09717451507454297*t*busted.test.theta_CG*busted.test.omega3;
+busted.test_Q_component_3[59][60]:=0.1989860284705866*t*busted.test.theta_GT*busted.test.omega3;
+busted.test_Q_component_3[60][15]:=0.3148753970510747*t*busted.test.theta_AT*busted.test.omega3;
+busted.test_Q_component_3[60][31]:=0.1712746635706107*t*busted.test.theta_CT*busted.test.omega3;
+busted.test_Q_component_3[60][47]:=0.2567033972679326*t*busted.test.theta_GT*busted.test.omega3;
+busted.test_Q_component_3[60][49]:=0.4256503784977386*t*busted.test.theta_AT*busted.test.omega3;
+busted.test_Q_component_3[60][53]:=0.1818409092376876*t*busted.test.theta_CT*busted.test.omega3;
+busted.test_Q_component_3[60][56]:=0.1563402972714242*t*busted.test.theta_GT*busted.test.omega3;
+busted.test_Q_component_3[60][57]:=0.5074830879161225*t*busted.test.theta_AT*busted.test.omega3;
+busted.test_Q_component_3[60][58]:=0.09717451507454297*t*busted.test.theta_CT;
+busted.test_Q_component_3[60][59]:=0.1963563685387479*t*busted.test.theta_GT*busted.test.omega3;
+
+
+busted.test_pi={
+{0.07535940345366139} 
+{0.01443006409728228} 
+{0.02915821068672351} 
+{0.02954870567752823} 
+{0.03219408024958758} 
+{0.006164627375802654} 
+{0.01245659774045292} 
+{0.01262342001471309} 
+{0.0276793164843978} 
+{0.005300125700761717} 
+{0.01070973633984303} 
+{0.01085316415297191} 
+{0.0418125103783387} 
+{0.008006395714089126} 
+{0.01617817990958604} 
+{0.0163948426631036} 
+{0.0409913146415633} 
+{0.007849150478922548} 
+{0.01586044121725868} 
+{0.01607284872448998} 
+{0.01751178502783737} 
+{0.003353213651232053} 
+{0.006775694789785172} 
+{0.006866436807635995} 
+{0.01505600521072376} 
+{0.002882972930821469} 
+{0.005825499564956559} 
+{0.005903516300053625} 
+{0.02274367484777162} 
+{0.004355032959661065} 
+{0.008800028033786655} 
+{0.008917880494044083} 
+{0.06143704799998004} 
+{0.01176416611541591} 
+{0.0237713451467977} 
+{0.0240896977132239} 
+{0.0262463496652457} 
+{0.005025736545566795} 
+{0.01015528996016046} 
+{0.01029129247081581} 
+{0.02256567087217255} 
+{0.004320948178469224} 
+{0.008731154380523415} 
+{0.00884808446536876} 
+{0.034087812394816} 
+{0.006527245376826684} 
+{0.01318932435908579} 
+{0.01336595951511979} 
+{0.01178447449308153} 
+{0.02413128354890585} 
+{0.0262916585104385} 
+{0.005034412430862358} 
+{0.01017282094890981} 
+{0.01030905823951665} 
+{0.004328407393735399} 
+{0.008746226896405704} 
+{0.008863358836639712} 
+{0.03414665788893068} 
+{0.006538513303760755} 
+{0.0132120929750345} 
+{0.01338903305480236} 
+};
+Model busted.test=('Exp(busted.test_Q_component_1)*1*busted.test.bsrel_mixture_aux_0+Exp(busted.test_Q_component_2)*1*(1-busted.test.bsrel_mixture_aux_0)*busted.test.bsrel_mixture_aux_1+Exp(busted.test_Q_component_3)*1*(1-busted.test.bsrel_mixture_aux_0)*(1-busted.test.bsrel_mixture_aux_1)',busted.test_pi,EXPLICIT_FORM_MATRIX_EXPONENTIAL);
+TRY_NUMERIC_SEQUENCE_MATCH=0;
+ACCEPT_ROOTED_TREES=0;
+
+UseModel (busted.test);
+Tree cuWdXMfP.tree_id_0=((((D_CD_83_ELI,D_CD_83_NDK)Node3,D_UG_94_94UG114)Node2,D_CD_84_84ZR085)Node1,B_US_83_RF,((B_FR_83_HXB2,B_US_86_JRFL)Node10,B_US_90_WEAU160)Node9);
+
+cuWdXMfP.tree_id_0.D_CD_83_ELI.t=0.1377903766097694;
+cuWdXMfP.tree_id_0.D_CD_83_NDK.t=0.06607109645594529;
+cuWdXMfP.tree_id_0.Node3.t=0.0890081009446355;
+cuWdXMfP.tree_id_0.D_UG_94_94UG114.t=0.4322474154485661;
+cuWdXMfP.tree_id_0.Node2.t=0.01436667144151429;
+cuWdXMfP.tree_id_0.D_CD_84_84ZR085.t=0.2152052309993384;
+cuWdXMfP.tree_id_0.Node1.t=0.1867555551194544;
+cuWdXMfP.tree_id_0.B_US_83_RF.t=0.2093873697545922;
+cuWdXMfP.tree_id_0.B_FR_83_HXB2.t=0.08552069057797769;
+cuWdXMfP.tree_id_0.B_US_86_JRFL.t=0.1313117411090917;
+cuWdXMfP.tree_id_0.Node10.t=0.01181372524396516;
+cuWdXMfP.tree_id_0.B_US_90_WEAU160.t=0.1600546391700751;
+cuWdXMfP.tree_id_0.Node9.t=0.03506352054252541;SetParameter (DEFER_CONSTRAINT_APPLICATION, 1, 0);
+SetParameter (DEFER_CONSTRAINT_APPLICATION, 0, 0);
+
+DataSet busted.codon_data = ReadDataFile(USE_NEXUS_FILE_DATA);
+DataSetFilter busted.filter.default = CreateFilter(busted.codon_data,3,"0-1319","4,5,7,6,1,0,2,3","TAA,TAG,TGA");
+ASSUME_REVERSIBLE_MODELS=1;
+USE_LAST_RESULTS=0;
+LikelihoodFunction cuWdXMfP.likelihoodFunction = (busted.filter.default,cuWdXMfP.tree_id_0);
+
+END;
\ No newline at end of file
--- a/test-data/gard-out1.json	Tue Apr 20 19:53:39 2021 +0000
+++ b/test-data/gard-out1.json	Tue Apr 27 18:07:06 2021 +0000
@@ -3,316 +3,53 @@
    "authors":"Sergei L Kosakovsky Pond",
    "citation":"**Automated Phylogenetic Detection of Recombination Using a Genetic Algorithm**, _Mol Biol Evol 23(10), 1891–1901",
    "contact":"spond@temple.edu",
-   "info":"GARD : Genetic Algorithms for Recombination Detection. Implements a heuristic\n    approach to screening alignments of sequences for recombination, by using the CHC genetic algorithm to search for phylogenetic\n    incongruence among different partitions of the data. The number of partitions is determined using a step-up procedure, while the\n    placement of breakpoints is searched for with the GA. The best fitting model (based on c-AIC) is returned; and additional post-hoc\n    tests run to distinguish topological incongruence from rate-variation.",
+   "info":"GARD : Genetic Algorithms for Recombination Detection. Implements a heuristic\n    approach to screening alignments of sequences for recombination, by using the CHC genetic algorithm to search for phylogenetic\n    incongruence among different partitions of the data. The number of partitions is determined using a step-up procedure, while the\n    placement of breakpoints is searched for with the GA. The best fitting model (based on c-AIC) is returned; and additional post-hoc\n    tests run to distinguish topological incongruence from rate-variation. v0.2 adds  and spooling results to JSON after each breakpoint search conclusion",
    "requirements":"A sequence alignment.",
-   "version":"0.1"
+   "version":"0.2"
   },
- "baselineScore":8884.998566352424,
+ "baselineScore":1450.968340148184,
+ "bestModelAICc":1450.968340148184,
  "breakpointData":{
-   "0":{
-     "bps":      [
-[1, 461] 
-      ],
-     "tree":"(((((((TREESPARROW_HENAN_1_2004:0.01973996359641645,TREESPARROW_HENAN_2_2004:0)Node6:0.006601594605919903,CHICKEN_HEBEI_326_2005:0.02877904543700591)Node5:0.002960697265622527,SWINE_ANHUI_2004:0.01220336915594569)Node4:0.004301817483024902,((DUCK_GUANGZHOU_20_2005:0.006496379151101181,(GOOSE_SHANTOU_2216_2005:0.008666763019733412,PEREGRINEFALCON_HK_D0028_2004:0.006494907750172948)Node14:0)Node12:0.006529386248252737,CK_HK_WF157_2003:0.008749819170042668)Node11:0.006517868346508392)Node3:0.004369843971142481,((TREESPARROW_HENAN_3_2004:0.004310725480928182,((CHICKEN_HONGKONG_915_97:0,(HONGKONG_97_98:0.007234718327388172,HONGKONG_538_97:0)Node24:0)Node22:0,(GOOSE_HONGKONG_W355_97:0,DUCK_HONGKONG_Y283_97:0)Node27:0.002160209380619512)Node21:0.02651640051975179)Node19:0.002209468499615626,TREESPARROW_HENAN_4_2004:0.008707376458939551)Node18:0)Node2:0.01527162191938894,MALLARD_VIETNAM_16_2003:0.00216300836609909)Node1:0,HUMAN_VIETNAM_CL105_2005:0.01089634139979296,(((DUCK_VIETNAM_376_2005:0.002165747961920766,CHICKEN_THAILAND_KANCHANABURI_CK_160_2005:0.01092964139649115)Node35:0.002165571630784742,VIETNAM_3062_2004:0)Node34:0.002160659783816526,DUCK_VIETNAM_272_2005:0.006501625005083654)Node33:0)"
-    },
-   "1":{
-     "bps":      [
-[462, 650] 
-      ],
-     "tree":"((((((TREESPARROW_HENAN_1_2004:0,TREESPARROW_HENAN_3_2004:0.01064277225673711)Node5:0.00531987705161906,TREESPARROW_HENAN_2_2004:0)Node4:0.005231591103466107,CHICKEN_HEBEI_326_2005:0.05043188754547531)Node3:0.005435427857192481,CK_HK_WF157_2003:0)Node2:0.005367407450692448,((TREESPARROW_HENAN_4_2004:0.005403333058615208,(((CHICKEN_HONGKONG_915_97:0,(GOOSE_HONGKONG_W355_97:0,DUCK_HONGKONG_Y283_97:0)Node18:0.005303893633648769)Node16:0,HONGKONG_97_98:0)Node15:0,HONGKONG_538_97:0)Node14:0.0160450339521957)Node12:0.01065583332597595,((DUCK_GUANGZHOU_20_2005:0.02156617952480121,GOOSE_SHANTOU_2216_2005:0.005315754078746889)Node24:0,PEREGRINEFALCON_HK_D0028_2004:0.005310132566451705)Node23:0)Node11:0.005324661683629481)Node1:0.01075596871747344,(SWINE_ANHUI_2004:0.01612941661930485,DUCK_VIETNAM_272_2005:0.005332918418299072)Node28:0.005343017103483476,((HUMAN_VIETNAM_CL105_2005:0.01615610619083483,DUCK_VIETNAM_376_2005:0.01622595235090508)Node32:0.005403715853761346,(VIETNAM_3062_2004:0,(MALLARD_VIETNAM_16_2003:0.01066500623689393,CHICKEN_THAILAND_KANCHANABURI_CK_160_2005:0)Node37:0.005316372444723995)Node35:0)Node31:0)"
-    },
-   "2":{
-     "bps":      [
-[651, 1166] 
-      ],
-     "tree":"(((((((TREESPARROW_HENAN_1_2004:0.001954008187578416,TREESPARROW_HENAN_3_2004:0.003896316686452931)Node6:0.001938506890703636,TREESPARROW_HENAN_4_2004:0)Node5:0.005890390504717593,((CHICKEN_HEBEI_326_2005:0.0118071209154035,(SWINE_ANHUI_2004:0,TREESPARROW_HENAN_2_2004:0.001939618450410721)Node13:0.01383276182388132)Node11:0.009974147725569997,((CHICKEN_HONGKONG_915_97:0,GOOSE_HONGKONG_W355_97:0)Node17:0.001941847153562197,((DUCK_HONGKONG_Y283_97:0,HONGKONG_538_97:0)Node21:0,HONGKONG_97_98:0.005840445012127324)Node20:0.001942715072940801)Node16:0.01987446960589405)Node10:0.005913850464875198)Node4:0.005886750382502456,(((DUCK_GUANGZHOU_20_2005:0.003893604042162395,GOOSE_SHANTOU_2216_2005:0.003905435534305824)Node27:0.001941929040845811,PEREGRINEFALCON_HK_D0028_2004:0.003899037680959845)Node26:0.001951590047476092,CK_HK_WF157_2003:0.005864286435734769)Node25:0.001925781157666145)Node3:0.009803928769016717,DUCK_VIETNAM_272_2005:0.01580156952635168)Node2:0,CHICKEN_THAILAND_KANCHANABURI_CK_160_2005:0.003890598353658968)Node1:0,((HUMAN_VIETNAM_CL105_2005:0.003905371265795895,DUCK_VIETNAM_376_2005:0.0137665342243657)Node35:0.001932867193851192,MALLARD_VIETNAM_16_2003:0.003887459835724038)Node34:0,VIETNAM_3062_2004:0.00194102772512571)"
-    },
-   "3":{
-     "bps":      [
-[1167, 1698] 
-      ],
-     "tree":"(TREESPARROW_HENAN_1_2004:0,((TREESPARROW_HENAN_3_2004:0.005713571370335148,TREESPARROW_HENAN_4_2004:0)Node3:0.00189607429178233,(CHICKEN_HEBEI_326_2005:0.005712316903324198,(SWINE_ANHUI_2004:0.005701998731046575,(((CHICKEN_HONGKONG_915_97:0,HONGKONG_97_98:0)Node12:0.001895621658683188,(GOOSE_HONGKONG_W355_97:0,HONGKONG_538_97:0)Node15:0)Node11:0.01534803500036186,((DUCK_HONGKONG_Y283_97:0.0001941011375241317,(((HUMAN_VIETNAM_CL105_2005:0.001928158212296621,DUCK_VIETNAM_376_2005:0.003824815472812549)Node23:0.001900556734363341,(VIETNAM_3062_2004:0.001945118440015516,MALLARD_VIETNAM_16_2003:0)Node26:0)Node22:0,(CHICKEN_THAILAND_KANCHANABURI_CK_160_2005:0.00380825293990655,DUCK_VIETNAM_272_2005:0.005749159769097136)Node29:0.001884324589239026)Node21:0.006136201619836659)Node19:0.006956231732180768,(((DUCK_GUANGZHOU_20_2005:0.003782134609270667,GOOSE_SHANTOU_2216_2005:0.005745814969410696)Node34:0.005728903718080784,PEREGRINEFALCON_HK_D0028_2004:0)Node33:0.001883474579815808,CK_HK_WF157_2003:0.005783922057126199)Node32:0.003686703559509533)Node18:0.002359028413665987)Node10:0.003781653021946557)Node8:0.003836413220384994)Node6:0.001894177236914572)Node2:0,TREESPARROW_HENAN_2_2004:0.00767492225272676)"
-    }
-  },
- "improvements":{
-   "0":{
-     "breakpoints":      [
-[696] 
-      ],
-     "deltaAICc":121.2176698921212
-    },
-   "1":{
-     "breakpoints":      [
-[692],
-      [1166] 
-      ],
-     "deltaAICc":51.31089620615057
-    },
-   "2":{
-     "breakpoints":      [
-[461],
-      [650],
-      [1166] 
-      ],
-     "deltaAICc":0.1679528998429305
-    }
+   "bps":    [
+[1, 428] 
+    ],
+   "tree":"((BRO1_1:0,BRO2:0.007408926175080497)Node1:0,(BRO3_1:0.002455524404855022,BRO4:0.002457415365886074)Node4:0,(((BRO5:0.002464479112430666,(BRO6:0.004940850926103086,BRO7_1:0)Node11:0)Node9:0.002460542727794925,(BRO9:0.004931390913247289,((BRO10:0.002933649980980302,BRO11_1:0.01453409151831228)Node17:0.002436921831192641,BRO12:0.006987081661112447)Node16:0.005417113782285573)Node14:0)Node8:0,BRO8:0.002462026756884335)Node7:0)"
   },
  "input":{
-   "file name":"/Users/ryanvelazquez/Documents/galaxy_items/tools-iuc/tools/hyphy/./test-data/gard-in1.fa",
-   "number of sequences":21,
-   "number of sites":1698,
+   "file name":"/tmp/tmpht3ax8lq/job_working_directory/000/2/working/./input.fasta",
+   "number of sequences":12,
+   "number of sites":428,
    "partition count":1
   },
- "potentialBreakpoints":244,
- "singleTreeAICc":8952.770360670584,
+ "potentialBreakpoints":21,
+ "singleTreeAICc":1450.968340686507,
  "siteBreakPointSupport":{
-   "1005":3.828454313051127e-38,
-   "1006":3.079286891225441e-38,
-   "101":1.367441431357884e-42,
-   "1013":1.999228647805731e-38,
-   "1015":5.581552407151915e-37,
-   "1016":6.637544467285419e-30,
-   "1020":8.283127276807708e-36,
-   "1021":5.149224738126319e-36,
-   "1023":2.572721275288951e-33,
-   "1031":1.729227457250037e-39,
-   "1041":4.668316272061274e-41,
-   "1052":7.068163653642667e-45,
-   "1058":4.410408926058965e-40,
-   "1061":3.620416399436108e-31,
-   "1070":1.30023862441172e-32,
-   "1073":2.392244771912456e-29,
-   "108":1.088323481504585e-09,
-   "1082":1.781042369034824e-32,
-   "1085":1.072215721126058e-30,
-   "1106":8.711808244586844e-32,
-   "1124":2.066632617058007e-32,
-   "1130":2.365201133574919e-32,
-   "1136":1.180024224431614e-32,
-   "1149":2.0594328664778e-30,
-   "116":3.062613098803733e-06,
-   "1166":1.382998480016903e-28,
-   "1206":4.271112529885021e-30,
-   "1223":2.439400027544238e-30,
-   "1250":2.1846050762587e-31,
-   "1271":1.963370249731928e-32,
-   "1286":1.143587697307953e-32,
-   "1292":1.940620880105886e-32,
-   "1298":1.19984441620646e-32,
-   "1319":5.201055420999954e-33,
-   "1322":1.490898155414118e-32,
-   "1334":6.386384600277327e-33,
-   "134":7.744769428033727e-17,
-   "1361":2.822486839844269e-33,
-   "1384":1.557822413676087e-33,
-   "1397":1.068642031138833e-35,
-   "1412":6.831611952947673e-38,
-   "1418":1.522690852126543e-39,
-   "1430":7.96352395927298e-40,
-   "1433":1.156793517215151e-37,
-   "1436":5.651778976453802e-38,
-   "144":8.552230281908163e-07,
-   "1442":2.016530452321108e-37,
-   "1454":2.386567702095966e-36,
-   "1463":9.043007916183422e-39,
-   "1465":7.669880260535686e-39,
-   "1473":3.675784601460829e-36,
-   "1481":2.661546849207671e-37,
-   "149":1.304259029589306e-05,
-   "1495":4.622941797307467e-44,
-   "1496":4.226996151791482e-44,
-   "1499":2.730615034063184e-44,
-   "151":1.790975065283929e-08,
-   "1515":4.749012537570416e-45,
-   "1516":1.058313486583168e-45,
-   "1519":3.729412022561233e-46,
-   "1520":2.407045351616036e-46,
-   "1521":1.689577693820857e-46,
-   "1523":5.07686612591507e-46,
-   "1524":1.741238756038766e-46,
-   "1526":3.855324589536673e-46,
-   "1537":2.062102436942228e-46,
-   "1538":3.417841619348906e-47,
-   "1539":3.047730711305713e-47,
-   "1544":1.7639941893744e-47,
-   "155":1.315748190900565e-29,
-   "1556":1.89572005098281e-47,
-   "1580":5.505818788734445e-49,
-   "1585":1.614020745294316e-49,
-   "159":2.814745521856487e-30,
-   "161":5.278607654454491e-08,
-   "1610":6.983674612335563e-50,
-   "1613":1.219959907173526e-49,
-   "1616":1.379005387331829e-49,
-   "1618":1.403866743396411e-51,
-   "1619":6.05913881499244e-52,
-   "1631":1.563107434100785e-52,
-   "1632":5.045949522041951e-52,
-   "1644":1.457045566204417e-52,
-   "1646":1.817307863422175e-52,
-   "1658":2.336582715408929e-53,
-   "173":3.057688318766887e-09,
-   "174":3.878560193985558e-09,
-   "176":8.37052095471109e-08,
-   "177":1.79882740520206e-07,
-   "178":4.189275930585918e-07,
-   "180":3.648108711445327e-07,
-   "185":8.602578155282706e-07,
-   "191":2.146033440200939e-05,
-   "197":1.254742955877914e-07,
-   "203":1.782085063210574e-09,
-   "205":3.9041258553037e-08,
-   "206":6.68882932678853e-21,
-   "209":6.086107365200133e-07,
-   "218":3.339578115382376e-06,
-   "230":4.417475117693213e-07,
-   "233":5.355261458449197e-05,
-   "236":0.007922604577960988,
-   "239":0.001674452816751232,
-   "242":0.003084865524315277,
-   "251":0.001911517032820398,
-   "257":0.001206425464437376,
-   "266":0.0006256067585931275,
-   "272":0.0004205386287599137,
-   "295":0.0006020604873750697,
-   "298":7.88207661427839e-10,
-   "303":1.196432870877656e-11,
-   "304":4.034129303399593e-10,
-   "310":1.00120863585874e-18,
-   "320":9.255079503229926e-08,
-   "326":1.316695923941227e-11,
-   "327":9.749462853855344e-30,
-   "328":5.468914334726157e-06,
-   "335":5.399829244004923e-09,
-   "336":1.259324706217958e-11,
-   "338":4.933684745749596e-07,
-   "348":4.415481383174255e-09,
-   "383":1.208370214471027e-18,
-   "391":4.182822911348255e-18,
-   "407":6.023041146737167e-09,
-   "414":5.844791249373782e-06,
-   "417":1.35252270798266e-09,
-   "418":0.0002946717374488142,
-   "419":2.325837885934838e-10,
-   "424":1.929854665115397e-05,
-   "425":8.20012614644675e-05,
-   "426":4.822853182787663e-05,
-   "433":0.001868063738600832,
-   "437":3.538850116792625e-27,
-   "440":0.08010977685280053,
-   "448":0.07606312788914485,
-   "45":5.811735655101648e-16,
-   "453":0.03671194147765044,
-   "455":0.02091509793683489,
-   "458":0.07150971750425916,
-   "460":0.7998321443046799,
-   "461":1,
-   "464":0.001724550519344097,
-   "466":0.0008356143264203861,
-   "467":1.657561796358788e-05,
-   "468":1.348444812921266e-23,
-   "498":1.148320825350936e-24,
-   "50":8.32428744865e-23,
-   "509":1.189408841111924e-08,
-   "511":2.022119078897978e-24,
-   "513":3.201599896136264e-07,
-   "518":2.988923843741992e-13,
-   "522":2.646016563727863e-07,
-   "524":2.999275395428511e-07,
-   "531":7.048583824652365e-06,
-   "532":8.871326441721272e-07,
-   "534":0.008873756999646102,
-   "535":0.004214591771216962,
-   "542":0.08914224508165824,
-   "553":7.90490584470731e-05,
-   "57":2.385720839099584e-24,
-   "570":9.913916137860915e-09,
-   "572":4.275862281976158e-10,
-   "584":3.314094298879245e-10,
-   "587":3.973343100406481e-07,
-   "590":4.873195666004712e-11,
-   "598":6.298174788936176e-09,
-   "60":1.133242133399893e-14,
-   "600":7.913894896186118e-20,
-   "61":2.995574404290199e-12,
-   "610":4.210551218094785e-06,
-   "615":9.779938062686411e-06,
-   "617":3.115657726300164e-05,
-   "626":1.626356028661979e-05,
-   "631":1.964642052027623e-05,
-   "635":2.944226387161727e-05,
-   "638":3.016399268517012e-06,
-   "639":2.178996517448726e-17,
-   "650":7.796278074051867e-11,
-   "662":8.522743624982774e-11,
-   "665":2.026783501294749e-13,
-   "671":1.546378067090648e-12,
-   "675":0.002961528524188881,
-   "677":2.552472267524399e-10,
-   "681":0.02600692507802804,
-   "682":0.005058690616537698,
-   "689":2.914183309131261e-06,
-   "692":0.3722918462191203,
-   "696":0.002394988564901264,
-   "702":0.1907562583825546,
-   "707":1.690629082138237e-08,
-   "710":7.270598199039235e-12,
-   "719":1.193577032271698e-24,
-   "722":6.242541477357492e-12,
-   "725":2.246819705265767e-24,
-   "749":1.075902126658883e-29,
-   "75":1.958058873662239e-39,
-   "758":1.862151711463288e-23,
-   "759":5.809642307223274e-30,
-   "761":7.82644516929739e-23,
-   "767":6.985390677891108e-34,
-   "773":1.159688507258433e-33,
-   "78":8.369563434460729e-21,
-   "794":2.615288564009047e-34,
-   "803":3.007434714722189e-27,
-   "810":6.65516462801252e-34,
-   "812":2.065239894547715e-33,
-   "83":1.903013516419069e-15,
-   "833":1.55354314155857e-30,
-   "834":5.458420523940027e-37,
-   "836":1.227693373364261e-29,
-   "845":2.516382791081784e-31,
-   "848":5.804977376214689e-37,
-   "863":2.868441667452538e-42,
-   "872":1.784676508419814e-43,
-   "878":2.0081213960433e-43,
-   "887":1.13493422288884e-43,
-   "891":1.700300743179312e-36,
-   "905":1.109981525417329e-42,
-   "911":2.50641030292061e-44,
-   "917":1.208124588626152e-44,
-   "926":5.840308910078806e-45,
-   "932":2.793211015138247e-45,
-   "935":4.67970437488018e-44,
-   "94":9.387247404190512e-24,
-   "942":6.30144926979359e-44,
-   "950":3.018547209001381e-44,
-   "978":2.723057526622017e-45,
-   "98":2.547710617920883e-27,
-   "983":2.72991889467319e-45,
-   "986":6.142043558494514e-45,
-   "992":1.349612353859241e-47,
-   "995":3.874956487042822e-49
+   "130":7.71938316947624e-08,
+   "150":7.49872016582054e-06,
+   "158":4.898720800158644e-06,
+   "175":0.0001152764571690805,
+   "176":0.000624401895637527,
+   "183":8.845949780426112e-06,
+   "196":5.17454230945286e-06,
+   "197":5.9168232845333e-06,
+   "198":4.436819044306368e-05,
+   "227":2.830236103715775e-06,
+   "233":9.74236872039044e-06,
+   "241":1.802640814372882e-05,
+   "245":1.305334911931824e-05,
+   "252":8.580180939514955e-06,
+   "253":2.317805781298633e-05,
+   "260":1.77855732841814e-06,
+   "287":4.449903505856628e-07,
+   "325":6.636014843884652e-09,
+   "326":2.134836027957093e-09,
+   "334":7.302354343864046e-09,
+   "341":1.678880851117679e-09,
+   "358":6.863087158511391e-14
   },
- "timeElapsed":1045,
- "totalModelCount":4369,
+ "timeElapsed":8,
+ "totalModelCount":209,
  "trees":{
-   "0":{
-     "newickString":"(((((((TREESPARROW_HENAN_1_2004:0.01973996359641645,TREESPARROW_HENAN_2_2004:0)Node6:0.006601594605919903,CHICKEN_HEBEI_326_2005:0.02877904543700591)Node5:0.002960697265622527,SWINE_ANHUI_2004:0.01220336915594569)Node4:0.004301817483024902,((DUCK_GUANGZHOU_20_2005:0.006496379151101181,(GOOSE_SHANTOU_2216_2005:0.008666763019733412,PEREGRINEFALCON_HK_D0028_2004:0.006494907750172948)Node14:0)Node12:0.006529386248252737,CK_HK_WF157_2003:0.008749819170042668)Node11:0.006517868346508392)Node3:0.004369843971142481,((TREESPARROW_HENAN_3_2004:0.004310725480928182,((CHICKEN_HONGKONG_915_97:0,(HONGKONG_97_98:0.007234718327388172,HONGKONG_538_97:0)Node24:0)Node22:0,(GOOSE_HONGKONG_W355_97:0,DUCK_HONGKONG_Y283_97:0)Node27:0.002160209380619512)Node21:0.02651640051975179)Node19:0.002209468499615626,TREESPARROW_HENAN_4_2004:0.008707376458939551)Node18:0)Node2:0.01527162191938894,MALLARD_VIETNAM_16_2003:0.00216300836609909)Node1:0,HUMAN_VIETNAM_CL105_2005:0.01089634139979296,(((DUCK_VIETNAM_376_2005:0.002165747961920766,CHICKEN_THAILAND_KANCHANABURI_CK_160_2005:0.01092964139649115)Node35:0.002165571630784742,VIETNAM_3062_2004:0)Node34:0.002160659783816526,DUCK_VIETNAM_272_2005:0.006501625005083654)Node33:0)"
-    },
-   "1":{
-     "newickString":"((((((TREESPARROW_HENAN_1_2004:0,TREESPARROW_HENAN_3_2004:0.01064277225673711)Node5:0.00531987705161906,TREESPARROW_HENAN_2_2004:0)Node4:0.005231591103466107,CHICKEN_HEBEI_326_2005:0.05043188754547531)Node3:0.005435427857192481,CK_HK_WF157_2003:0)Node2:0.005367407450692448,((TREESPARROW_HENAN_4_2004:0.005403333058615208,(((CHICKEN_HONGKONG_915_97:0,(GOOSE_HONGKONG_W355_97:0,DUCK_HONGKONG_Y283_97:0)Node18:0.005303893633648769)Node16:0,HONGKONG_97_98:0)Node15:0,HONGKONG_538_97:0)Node14:0.0160450339521957)Node12:0.01065583332597595,((DUCK_GUANGZHOU_20_2005:0.02156617952480121,GOOSE_SHANTOU_2216_2005:0.005315754078746889)Node24:0,PEREGRINEFALCON_HK_D0028_2004:0.005310132566451705)Node23:0)Node11:0.005324661683629481)Node1:0.01075596871747344,(SWINE_ANHUI_2004:0.01612941661930485,DUCK_VIETNAM_272_2005:0.005332918418299072)Node28:0.005343017103483476,((HUMAN_VIETNAM_CL105_2005:0.01615610619083483,DUCK_VIETNAM_376_2005:0.01622595235090508)Node32:0.005403715853761346,(VIETNAM_3062_2004:0,(MALLARD_VIETNAM_16_2003:0.01066500623689393,CHICKEN_THAILAND_KANCHANABURI_CK_160_2005:0)Node37:0.005316372444723995)Node35:0)Node31:0)"
-    },
-   "2":{
-     "newickString":"(((((((TREESPARROW_HENAN_1_2004:0.001954008187578416,TREESPARROW_HENAN_3_2004:0.003896316686452931)Node6:0.001938506890703636,TREESPARROW_HENAN_4_2004:0)Node5:0.005890390504717593,((CHICKEN_HEBEI_326_2005:0.0118071209154035,(SWINE_ANHUI_2004:0,TREESPARROW_HENAN_2_2004:0.001939618450410721)Node13:0.01383276182388132)Node11:0.009974147725569997,((CHICKEN_HONGKONG_915_97:0,GOOSE_HONGKONG_W355_97:0)Node17:0.001941847153562197,((DUCK_HONGKONG_Y283_97:0,HONGKONG_538_97:0)Node21:0,HONGKONG_97_98:0.005840445012127324)Node20:0.001942715072940801)Node16:0.01987446960589405)Node10:0.005913850464875198)Node4:0.005886750382502456,(((DUCK_GUANGZHOU_20_2005:0.003893604042162395,GOOSE_SHANTOU_2216_2005:0.003905435534305824)Node27:0.001941929040845811,PEREGRINEFALCON_HK_D0028_2004:0.003899037680959845)Node26:0.001951590047476092,CK_HK_WF157_2003:0.005864286435734769)Node25:0.001925781157666145)Node3:0.009803928769016717,DUCK_VIETNAM_272_2005:0.01580156952635168)Node2:0,CHICKEN_THAILAND_KANCHANABURI_CK_160_2005:0.003890598353658968)Node1:0,((HUMAN_VIETNAM_CL105_2005:0.003905371265795895,DUCK_VIETNAM_376_2005:0.0137665342243657)Node35:0.001932867193851192,MALLARD_VIETNAM_16_2003:0.003887459835724038)Node34:0,VIETNAM_3062_2004:0.00194102772512571)"
-    },
-   "3":{
-     "newickString":"(TREESPARROW_HENAN_1_2004:0,((TREESPARROW_HENAN_3_2004:0.005713571370335148,TREESPARROW_HENAN_4_2004:0)Node3:0.00189607429178233,(CHICKEN_HEBEI_326_2005:0.005712316903324198,(SWINE_ANHUI_2004:0.005701998731046575,(((CHICKEN_HONGKONG_915_97:0,HONGKONG_97_98:0)Node12:0.001895621658683188,(GOOSE_HONGKONG_W355_97:0,HONGKONG_538_97:0)Node15:0)Node11:0.01534803500036186,((DUCK_HONGKONG_Y283_97:0.0001941011375241317,(((HUMAN_VIETNAM_CL105_2005:0.001928158212296621,DUCK_VIETNAM_376_2005:0.003824815472812549)Node23:0.001900556734363341,(VIETNAM_3062_2004:0.001945118440015516,MALLARD_VIETNAM_16_2003:0)Node26:0)Node22:0,(CHICKEN_THAILAND_KANCHANABURI_CK_160_2005:0.00380825293990655,DUCK_VIETNAM_272_2005:0.005749159769097136)Node29:0.001884324589239026)Node21:0.006136201619836659)Node19:0.006956231732180768,(((DUCK_GUANGZHOU_20_2005:0.003782134609270667,GOOSE_SHANTOU_2216_2005:0.005745814969410696)Node34:0.005728903718080784,PEREGRINEFALCON_HK_D0028_2004:0)Node33:0.001883474579815808,CK_HK_WF157_2003:0.005783922057126199)Node32:0.003686703559509533)Node18:0.002359028413665987)Node10:0.003781653021946557)Node8:0.003836413220384994)Node6:0.001894177236914572)Node2:0,TREESPARROW_HENAN_2_2004:0.00767492225272676)"
-    }
+   "newickString":"((BRO1_1:0,BRO2:0.007408926175080497)Node1:0,(BRO3_1:0.002455524404855022,BRO4:0.002457415365886074)Node4:0,(((BRO5:0.002464479112430666,(BRO6:0.004940850926103086,BRO7_1:0)Node11:0)Node9:0.002460542727794925,(BRO9:0.004931390913247289,((BRO10:0.002933649980980302,BRO11_1:0.01453409151831228)Node17:0.002436921831192641,BRO12:0.006987081661112447)Node16:0.005417113782285573)Node14:0)Node8:0,BRO8:0.002462026756884335)Node7:0)"
   }
 }
\ No newline at end of file
--- a/test-data/gard-out1.nex	Tue Apr 20 19:53:39 2021 +0000
+++ b/test-data/gard-out1.nex	Tue Apr 27 18:07:06 2021 +0000
@@ -0,0 +1,37 @@
+#NEXUS
+
+BEGIN TAXA;
+	DIMENSIONS NTAX = 12;
+	TAXLABELS
+		'BRO1_1' 'BRO2' 'BRO3_1' 'BRO4' 'BRO5' 'BRO6' 'BRO7_1' 'BRO9' 'BRO10' 'BRO11_1' 'BRO12' 'BRO8' ;
+END;
+
+BEGIN CHARACTERS;
+	DIMENSIONS NCHAR = 428;
+	FORMAT
+		DATATYPE = DNA
+		GAP=-
+		MISSING=?
+	;
+
+MATRIX
+	'BRO1_1'  ATTCTAATTTAAACTATTCT-CTGTTCTTTCATGGGGAAGCAGATTTGGGTACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACATTAC-TGCCAGCCACCATGAATATTGTACGGTACCATAAA-TACTTGACCACCTGTAGTACATAAAAACCC-AATCC--ACATCAAAA----CCCCCCCCC-CATGCTTACAAGCAAGTACAGCAACCAACCCTCAA-CTATCACACATCAACTGCAACTCCAAAGCCAC-CCCTCACCCAC-TAGGATACCAACAAACCTACCCACCC-TTAACAGTACATAGTACATAAAGCCATTTACCGTACATAGCACATTACA-GTCAAATCCCTTCTCGTCCCC-ATGG-ATGACCCCCC-TCAGAT-AGGGGTCCCTTGACCACCATCC
+	'BRO2'    ATTCTAATTTAAACTATTCT-CTGTTCTTTCATGGGGAAGCAGATTTGGGTACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACATTAC-TGCCAGCCACCATGAATATTGTACGGTACCATAAA-TACTTGACCACCTGTAGTACATAAAAACCC-AATCC--ACATCAAAA----CCCCCCCCC-CATGCTTACAAGCAAGTACAGCAACCAACCCTCAA-CTATCACACATCAACTGCAACCCCAAAGCCAC-CCCTCACCCAC-TAGGATACCAACAAACCTACCCACCC-TTAACAGTACATAGTGCATAAAGCCATTTACCGTACATAGCACATTATA-GTCAAATCCCTTCTCGTCCCC-ATGG-ATGACCCCCC-TCAGAT-AGGGGTCCCTTGACCACCATCC
+	'BRO3_1'  ATTCTAATTTAAACTATTCT-CTGTTCTTTCATGGGGAAGCAGATTTGGGTACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACATTAC-TGCCAGCCACCATGAATATTGTACGGTACCATAAA-TACTTGACCACCTGTAGTACATAAAAACCC-AATCC--ACATCAAAA----CCCCCCCCC-CATGCTTACAAGCAAGTACAGCAACCAACCCTCAA-CTATCACACATCAGCTGCAACTCCAAAGCCAC-CCCTCACCCAC-TAGGATACCAACAAACCTACCCACCC-TTAACAGTACATAGTACATAAAGCCATTTACCGTACATAGCACATTACA-GTCAAATCCCTTCTCGTCCCC-ATGG-ATGACCCCCC-TCAGAT-AGGGGTCCCTTGACCACCATCC
+	'BRO4'    ATTCTAATTTAAACTATTCT-CTGTTCTTTCATGGGGAAGCAGATTTGGGTACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACATTAC-TGCCAGCCACCATGAATATTGTACGGTACCATAAA-TACTTGACCACCTGTAGTACATAAAAACCC-AATCC--ACATCAAAA----CCCCCCCCC-CATGCTTACAAGCAAGTACAGCAACCAACCCTCAA-CTATCATACATCAACTGCAACTCCAAAGCCAC-CCCTCACCCAC-TAGGATACCAACAAACCTACCCACCC-TTAACAGTACATAGTACATAAAGCCATTTACCGTACATAGCACATTACA-GTCAAATCCCTTCTCGTCCCC-ATGG-ATGACCCCCC-TCAGAT-AGGGGTCCCTTGACCACCATCC
+	'BRO5'    ATTCTAATTTAAACTATTCT-CTGTTCTTTCATGGGGAAGCAGATTTGGGTACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACATTAC-TGCCAGCCACCATGAATATTGTACAGTACCATAAA-TACTTGACCACCTGTAGTACATAAAAACCC-AATCC--ACACCAAAA----CCCCCCCCC-CATGCTTACAAGCAAGTACAGCAACCAACCCTCAA-CTATCACACATCAACTGCAACTCCAAAGCCAC-CCCTCACCCAC-TAGGATACCAACAAACCTACCCACCC-TTAACAGTACATAGTACATAAAGCCATTTACCGTACATAGCACATTACA-GTCAAATCCCTTCTCGTCCCC-ATGG-ATGACCCCCC-TCAGAT-AGGGGTCCCTTGACCACCATCC
+	'BRO6'    ATTCTAATTTAAACTATTCT-CTGTTCTTTCATGGGGAAGCAGATTTGGGTACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACATTAC-TGCCAGCCACCATGAATATTGTACGGTACCATAAA-TACTTGACCACCTGTAATACATAAAAACCC-AATTC--ACACCAAAA----CCCCCCCCC-CATGCTTACAAGCAAGTACAGCAACCAACCCTCAA-CTATCACACATCAACTGCAACTCCAAAGCCAC-CCCTCACCCAC-TAGGATACCAACAAACCTACCCACCC-TTAACAGTACATAGTACATAAAGCCATTTACCGTACATAGCACATTACA-GTCAAATCCCTTCTCGTCCCC-ATGG-ATGACCCCCC-TCAGAT-AGGGGTCCCTTGACCACCATCC
+	'BRO7_1'  ATTCTAATTTAAACTATTCT-CTGTTCTTTCATGGGGAAGCAGATTTGGGTACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACATTAC-TGCCAGCCACCATGAATATTGTACGGTACCATAAA-TACTTGACCACCTGTAGTACATAAAAACCC-AATCC--ACACCAAAA----CCCCCCCCC-CATGCTTACAAGCAAGTACAGCAACCAACCCTCAA-CTATCACACATCAACTGCAACTCCAAAGCCAC-CCCTCACCCAC-TAGGATACCAACAAACCTACCCACCC-TTAACAGTACATAGTACATAAAGCCATTTACCGTACATAGCACATTACA-GTCAAATCCCTTCTCGTCCCC-ATGG-ATGACCCCCC-TCAGAT-AGGGGTCCCTTGACCACCATCC
+	'BRO9'    ATTCTAATTTAAACTATTCT-CTGTTCTTTCATGGGGAAGCAGATTTGGGTACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACATTAC-TGCCAGCCACCATGAATATTGTACGGTACCATAAA-TACTTGACCACCTGTAGTACATAAAAACCC-AACCC--ACATCAAAA----CCCCCCCCC-CATGCTTACAAGCAAGTACAGCAACCAACCCTCAA-CTATCACACATCAATTGCAACTCCAAAGCCAC-CCCTCACCCAC-TAGGATACCAACAAACCTACCCACCC-TTAACAGTACATAGTACATAAAGCCATTTACCGTACATAGCACATTACA-GTCAAATCCCTTCTCGTCCCC-ATGG-ATGACCCCCC-TCAGAT-AGGGGTCCCTTGACCACCATCC
+	'BRO10'   ATTCTAATTTAAACTATTCT-CTGTTCTTTCATGGGGAAGCAGATTTGGGTACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACATTAC-TGCCAGCCACCATGAATATTGTACGGTACCATAAA-TACTTGACCACCTGTAGTACATAAAAACCC-AATCC--ACATCAAAA----CCCCCCCCC-CATGCTTACAAGCAAGTACAGCAATCAACCTTCAA-CTATCACACATCAACTGCAACTCCAAAGCCAC-CCCTCACCCAC-TAGGATACCAACAAACCTACCCACCC-TTAACAGTACATAGCACATAAAGCCATTTATCGTACATAGCACATTACA-GTCAAATCCCTTCTCGTCCCC-ATGG-ATGACCCCCC-TCAGAT-AGGGGTCCCTTGACCACCATCC
+	'BRO11_1' ATTCTAATTTAAACTATTCT-CTGTTCTTTCATGGGGAAGCAGATTTGGGTACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACATTAC-TGCCAGCCACCATGAATATTGTACGGTACCATAAA-TACTTGACTACCTGTAGTACATAAAAACCC-AACCC--ACATCAAAA----CCCTGCCCC-CATGCTTACAAGCAAGTACAGCAATCAACCTTCAA-CTGTCACACATCAACTGCAACTCCAAAGCCAC-CCCTCACCCAC-TAGGATACCAACAAACCTACCCACCC-TTAACAGTACATAGCACATAAAGTCATTTACCGTACATAGCACATTACA-GTCAAATCCCTTCTCGTCCCC-ATGG-ATGACCCCCC-TCAGAT-AGGGGTCCCTTGACCACCATCC
+	'BRO12'   ATTCTAATTTAAACTATTCT-CTGTTCTTTCATGGGGAAGCAGATTTGGGTACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACATTAC-TGCCAGCCACCATGAATATTGTACAGTACCATAAA-TACTTGACTACCTGTAGTACATAAAAACCC-AATCC--ACATCAAAA----CCCCCTCCC-CATGCTTACAAGCAAGTACAGCAATCAACCTTCAA-CTATCACACATCAACTGCAACTCCAAAGCCAC-CCCTCACCCAC-TAGGATACCAACAAACCTACCCACCC-TTAACAGTACATAGTACATAAAGCCATTTACCGTACATAGCACATTACA-GTCAAATCCCTTCTCGTCCCC-ATGG-ATGACCCCCC-TCAGAT-AGGGGTCCCTTGACCACCATCC
+	'BRO8'    ATTCTAATTTAAACTATTCT-CTGTTCTTTCATGGGGAAGCAGATTTGGGTACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACATTAC-TGCCAGCCACCATGAATATTGTACGGTACCATAAA-TACTTGACCACCTGTAGTACATAAAAACCC-AATCC--ACATCAAAA----CCCCCCCCC-CATGCTTACAAGCAAGTACAGCAACCAACCCTCAA-CTATCACACATCAACTGCAACTCCAAAGCCAC-CCCTCACCCAC-TAGAATACCAACAAACCTACCCACCC-TTAACAGTACATAGTACATAAAGCCATTTACCGTACATAGCACATTACA-GTCAAATCCCTTCTCGTCCCC-ATGG-ATGACCCCCC-TCAGAT-AGGGGTCCCTTGACCACCATCC;
+END;
+
+BEGIN ASSUMPTIONS;
+	CHARSET span_1 = 1-428;
+END;
+BEGIN TREES;
+	TREE tree_1 = (((BRO1_1:1e-10,BRO2:0.007446048662499141)Node2:1.699082282683926e-05,(((BRO5:0.002291051777868712,(BRO6:0.004965711012353363,BRO7_1:1e-10)Node9:0.0001955595843124865)Node7:0.002191267352110732,(BRO9:0.004469023573866088,((BRO10:0.002870586428367251,BRO11_1:0.01462820627459318)Node15:0.001454707803761366,BRO12:0.006027959855484483)Node14:0.005661145911839864)Node12:0.0003039715029625697)Node6:0.0002803682303139691,BRO8:0.002464847898104024)Node5:1.386828770154629e-05)Node1:3.347353150116037e-06,BRO3_1:0.002467834453766899,BRO4:0.002462875913900023);
+END;
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/relax-in2.nex	Tue Apr 27 18:07:06 2021 +0000
@@ -0,0 +1,86 @@
+#NEXUS
+
+[
+Generated by HYPHY 0.9920070619beta(MP) for MacOS(Carbon) on Thu Jun 21 16:59:04 2007
+
+]
+
+BEGIN TAXA;
+	DIMENSIONS NTAX = 10;
+	TAXLABELS
+		'Human' 'Chimp' 'Baboon' 'RhMonkey' 'Cow' 'Pig' 'Horse' 'Cat' 'Mouse' 'Rat' ;
+END;
+
+BEGIN CHARACTERS;
+	DIMENSIONS NCHAR = 561;
+	FORMAT
+		DATATYPE = DNA
+
+		GAP=-
+		MISSING=?
+	;
+
+MATRIX
+	'Human'     AAAGAGATTACGAATGCCTTGGAAACCTGGGGTGCCTTGGGTCAGGACATCAACTTGGACATTCCTAGTTTTCAAATGAGTGATGATATTGACGATATAAAATGGGAAAAAACTTCAGACAAGAAAAAGATTGCACAATTCAGAAAAGAGAAAGAGACTTTCAAGGAAAAAGATACATATAAGCTATTTAAAAATGGAACTCTGAAAATTAAGCAT---CTGAAGACCGATGATCAGGATATCTACAAGGTATCAATATATGATACAAAAGGAAAAAATGTGTTGGAAAAAATATTTGATTTGAAGATTCAAGAGAGGGTCTCAAAACCAAAGATCTCCTGGACTTGTATCAACACAACCCTGACCTGTGAGGTAATGAATGGAACTGACCCCGAATTAAACCTGTATCAAGATGGGAAACATCTAAAA---CTTTCTCAGAGGGTCATCACACACAAGTGGACCACCAGCCTGAGTGCAAAATTCAAGTGCACAGCAGGGAACAAAGTCAGCAAGGAATCCAGTGTCGAGCCTGTCAGCTGTCCAGAGAAAGGTCTGGAC
+	'Chimp'     GAAGAGATTACGAATGCCTTGGAAACCTGGGGTGCCTTGGGTCAGGACATCAACTTGGACATTCCTAGTTTTCAAATGAGTGATGATATTGACGATATAAAATGGGAAAAAACTTCAGACAAGAAAAAGATTGCACAATTCAGAAAAGAGAAAGAGACTTTCAAGGAAAAAGATACATATAAGCTATTTAAAAATGGAACTCTGAAAATTAAGCAT---CTGAAGACCGATGATCAGGATATCTACAAGGTATCAATATATGATACAAAAGGAAAAAATGTGTTGGAAAAAATATTTGATTTGAAGATTCAAGAGAGGGTCTCAAAACCAAAGATCTCCTGGACTTGTATCAACACAACCCTGACCTGTGAGGTAATGAATGGAACTGACCCCGAATTAAACCTGTATCAAGATGGGAAACATCTAAAA---CTTTCTCAGAGGGTCATCACACACAAGTGGACCACCAGCCTGAGTGCAAAATTCAAGTGCACAGCAGGGAACAAAGTCAGCAAGGAATCCAGTGTCGAGCCTGTCAGCTGTCCAGAGAAAGGTCTGGAC
+	'Baboon'    AAAGAGATTAGGAATGCTTTGGAAACCTGGGGAGCGCTGGGTCAGGACATCGACTTGGACATTCCTAGTTTTCAAATGAGTGATGATATTGATGATATAAAATGGGAGAAAACTTCAGACAAGAAAAAGATTGCACAATTCAGAAAAGAGAAGGAGACTTTCGAGGAAAAAGATGCATATAAGCTATTTAAAAACGGAACTCTGAAAATTAAGCAT---CTGAAGATCCATGATCAGGATAGCTACAAGGTATCAATATACGATACAAAAGGAAAAAATGTGTTGGAAAAAACATTTGATTTGAAGATTCAAGAGAGGGTCTCAGAACCAAAGATCTCCTGGACTTGTATCAACACAACCCTGACCTGTGAAGTAATGAATGGAACTGACCCCGAATTAAACCTGTATCAAGATGGGAAACATCTAAAA---CTTTCTCAGAGGGTCATCACACACAAGTGGACCACCAGCCTGAGTGCGAAATTCAAGTGCACAGCAGGGAACAAAGTCAGCAAGGAATCCAGGATGGAGACTGTCAGCTGTCCAGAGAAAGGTCTGGAC
+	'RhMonkey'  AAAGAGATTAGGAATGCTTTGGAAACCTGGGGAGCGCTGGGTCAGGACATCGACTTGGACATTCCTAGTTTTCAAATGAGTGATGATATTGATGATATAAGATGGGAAAAAACTTCAGACAAGAAAAAGATTGCACAATTCAGAAAAGAGAAGGAGACTTTCGAGGAAAAAGATGCATATAAGCTATTTAAAAACGGAACTCTGAAAAYTAAGCAT---CTGAAGATCCATGATCAGGATAGCTACAAGGTATCAATATACGATACAAAAGGAAAAAATGTGTTGGAAAAAACATTTGATTTGAAGATTCAAGAGAGGGTCTCAGAACCAAAGATCTCCTGGACTTGTATCAACACAACCCTGACCTGTGAAGTAATGAATGGAACTGRCCCCGAATTAAACCTGTATCAAGATGGGAAACATGTAAAA---CTTTCTCAGAGGGTCATCACACACAAGTGGACCACCAGCCTGAGTGCGAAATTCAAGTGCACAGCAGGGAACAAAGTCAGCAAGGAATCCAGGATGGAGACTGTCAGCTGTCCAGAGAAAGGTCTGGAC
+	'Cow'       ------------GAAAGCATTGTCGTCTGGGGTGCCCTGGATCATGACCTCAACCTGGACATTCCTGGTTTTCCAAGAAGTGATATAGTGGCAGATATAAAATGGAACAGA------AACAAAAACAAGATTGCACGAATAAAGAAAGATATGCCACTTCACAATGAAATGGACAAATATGATATGTTTACAAATGGAACTCTGAAAATTAAAACT---CTGATGAGAAACGATAGTGGTCTCTATGAGGTAGAGGTTTATGATTCAAATGGAGTAAACCTACTGAGCAAAAAATTTGATTTGAAGATTCAAGAGATGCTCTCAGGACCTGAAATTAACTGGATCTGTACCAACAGAACTGTGAGCTGCAAGGTAGAAAATGGAAGTAATCCTAAATTACAACTGTTTTTAAATACGACCCGTGTCAAACAAGATCATGGGAAGCTCATCACCTACACGTGGAACACCAGATGGAATAAAACATTCAAGTGCGTGGCGAGTAACCATGTCGATAGCAAAGTCAGCATAGAGATCGCCGTGTGTCCAGATGAAGGTCTGGAT
+	'Pig'       ---------------ACTGAGGTTGTCTGGGGCATCGTGGATCAAGACATCAACCTGGACATTCCTGAACTTTCAAAACATGATAACGTAGATCATATACGATGGCAGAAG------AATGAAAACAAGATCGCAGAATTTAAAAAAAACAAAGAAACTCACCCTGTGAAAGACACATACATGATGTTACCAAATGGAACTCTGAGAATTAAAGAT---CTGAAGAGAGATGATGAGGGTATCTACAAGGTAACTGTCTATGCTACGGATGGAAAACACATGCTGGAGAGAAAATTTGATTTGCCGATTCTAGATGGGGTCTCAAAACCTGTAATCTCCTGGAGCTGTGCCGACAAAACGGTGACCTGTGAGGTAGCAGAAGGAAGTGACCCTAAGTTAAAACTGTATGTAAATAAGTCCACTGCCAGAGAAGGTCGTCAGAAGGTCATCCTGTGGAAGTGGAACACCAAATGGAGCACATTATTCAAGTGTGTGGCCAGTAACAACGCCAGTGAGCAAATCAGCATGGTGACCATCAGTTGTACGGGGCAAGGTCTGGAT
+	'Horse'     ------------AAGAATATCACCATCTTGGGTGCCCTGGAACGTGATATCAACCTGGACATTCCTGCTTTTCAAATGAGTGAGCATGTAGAAGATATACAATGGAGCAAA------GGAAAAACCAAGATTGCAAAATTCAAAAATGGCAGTATGACTTTCCAGAAAGATAAAACATACGAGGTATTAAAAAATGGAACTCTGAAAATTAAACAT---CTGGAGAGAATTCATGAAGGTACCTACAAGGTAGACGCATATGATAGTGATGGAAAAAATGTGTTGGAGGAAACATTTCATTTGAGCCTTCTAGAGATGGTCTCAAAACCTAATATCTCCTGGAGCTGCACCAACACCACCCTGACCTGCGAGGTGACAAAAGGAACTGACTTTGAGTTAAAACTCTATCTAAATGGGAGAATGATCCAAAAAAGTCCTCGCAAAGTCATCGTATACAAGCGGGCCAGCAACCAAATTGCGTCCTTCAAGTGCACAGCCAATAACACAGTCAGCGAGGAAAGCAGCTCTGTGGTCATCAGGTGTACAGAGAAAGGTCTGGAT
+	'Cat'       ---------GCAAATGATGATATCGTCTGGGGTACCCTGGGTCAGGACATCAACCTGGACATTCCTGATTCTCAA---GGGATTAATATAGATGATATACACTGGGAAAAA------GGCAAGAAGAAGGTGGCGAGGTTCCAAATTAGCAACAAGCCTAAGAATCCAGATGAAAAATATAATGTGTCAATGAATGGAACTCTGAAAATTAAACAT---CTGATGCTAGAAGACTGCGATACCTACAAGGTTGTTATATACGATAAGGATGGAAAGAATGTGTTGGATAAAACATTTCAGCTGAAGATTCAAGAGAAGGTCTCAACGCCTAACATCGACTGGAATTGTATCAACAAAACCCTGGTCTGTAAGGTATCAAATGGAACAGACCCTGAATTAAAACTGTACGTAAATGGGACCAGTATCAAGCCCGTTTCTTCGAAGTTCAGCACATACAGGTTTATAAACAAGCAGAAGATATTAGTCAACTGCACGGCAGAAAACAAAGTCAGCAAGGAAAGCGACGTGAAGATGATCACTTGTTCAGAGAAGGGTCTGGAC
+	'Mouse'     ---------AGAGACAATGAGACCATCTGGGGTGTCTTGGGTCATGGCATCACCCTGAACATCCCCAACTTTCAAATGACTGATGATATTGATGAGGTGCGATGGGTAAGG------AGGGGCACCCTGGTCGCAGAGTTTAAAAGGAAGAAGCCACCTTTTTTGATATCAGAAACGTATGAGGTCTTAGCAAACGGATCCCTGAAGATAAAGAAGCCGATGATGAGAAACGACAGTGGCACCTATAATGTAATGGTGTATGGCACAAATGGGATGACTAGGCTGGAGAAGGACCTGGACGTGAGGATTCTGGAGAGGGTCTCAAAGCCCATGATCCACTGGGAATGCCCCAACACAACCCTGACCTGTGCGGTCTTGCAAGGGACAGATTTTGAACTGAAGCTGTATCAAGGGGAAACACTACTCAATAGTCTCCCCCAGAAGAACATGAGTTACCAGTGG---ACCAACCTGAACGCACCATTCAAGTGTGAGGCGATAAACCCGGTCAGCAAGGAGTCTAAGATGGAAGTTGTTAACTGTCCAGAGAAAGGTCTGTCC
+	'Rat'       ---------AGAGACAGTGGGACCGTCTGGGGTGCCCTGGGTCATGGCATCAACCTGAACATCCCTAACTTTCAAATGACTGATGATATTGATGAGGTGCGATGGGAGAGG------GGGAGCACCCTGGTTGCCGAGTTTAAAAGGAAGATGAAGCCTTTTTTGAAATCGGGAGCATTTGAGATCTTAGCAAATGGAGACTTGAAGATAAAGAAT---CTGACAAGAGATGACAGTGGCACCTATAATGTAACGGTATACAGCACAAATGGGACACGTATCCTGGACAAGGCACTGGACTTGAGGATTCTAGAGATGGTCTCAAAGCCGATGATCTACTGGGAGTGCAGCAACGCAACCCTGACCTGTGAGGTCTTGGAAGGAACAGATGTTGAACTAAAGCTGTACCAAGGAAAGGAGCATCTCAGGAGCCTCCGTCAGAAGACCATGAGTTACCAGTGG---ACCAACCTGAGAGCACCGTTTAAGTGCAAGGCGGTAAACAGGGTCAGCCAGGAGTCTGAGATGGAAGTTGTCAACTGTCCAGAGAAAGGTCTGCCC;
+END;
+
+BEGIN TREES;
+	TREE tree = ((((Pig:0.147969,Cow:0.213430):0.085099,Horse:0.165787,Cat:0.264806):0.058611,((RhMonkey{PR}:0.002015,Baboon{PR}:0.003108){PR}:0.022733,(Human{PR}:0.004349,Chimp{PR}:0.000799){PR}:0.011873){PR}:0.101856){PR}:0.340802,Rat:0.050958,Mouse:0.097950);
+END;
+
+BEGIN HYPHY;
+
+DATA_PANEL_SOURCE_PATH="";
+DataSet CD2 = ReadDataFile (USE_NEXUS_FILE_DATA);
+DataSetFilter CD2_part = CreateFilter (CD2,3,"0-560","(null)","TAA,TAG,TGA");
+Tree CD2_tree=((((Pig,Cow)Node3,Horse,Cat)Node2,((RhMonkey,Baboon)Node9,(Human,Chimp)Node12)Node8)Node1,Rat,Mouse);
+OpenDataPanel(CD2,"(null)","0,0,0,0,2,0,10","MG94xREV_3x4,6,0,14443523,CD2_tree",CD2_LF);
+
+global CD2_part_Shared_AC=0.5710714109234631;
+global CD2_part_Shared_AT=0.2756961373814887;
+global CD2_part_Shared_CG=0.4456308760366715;
+global CD2_part_Shared_CT=0.9454291760502562;
+global CD2_part_Shared_GT=0.3224080259059006;
+CD2_tree.Node12.synRate=0.08168540352543764;
+CD2_tree.Node8.nonSynRate=0.2938890030949185;
+CD2_tree.Human.synRate=1e-30;
+CD2_tree.Baboon.nonSynRate=0;
+CD2_tree.Baboon.synRate=0.01716650886630832;
+CD2_tree.Node12.nonSynRate=0.02962786133931161;
+CD2_tree.Chimp.synRate=1e-30;
+CD2_tree.Chimp.nonSynRate=0.005834136861061837;
+CD2_tree.Node9.nonSynRate=0.0433794394076959;
+CD2_tree.Human.nonSynRate=0;
+CD2_tree.Node9.synRate=0.1139808847086709;
+CD2_tree.Node8.synRate=0.1586154947684889;
+CD2_tree.Rat.synRate=0.1533251749656354;
+CD2_tree.Mouse.nonSynRate=0.2332402459120736;
+CD2_tree.Mouse.synRate=0.4604267094040578;
+CD2_tree.Rat.nonSynRate=0.1585006932449144;
+CD2_tree.Node1.nonSynRate=0.5097883291072822;
+CD2_tree.Node1.synRate=1.227004762734591;
+CD2_tree.RhMonkey.synRate=0;
+CD2_tree.Node3.synRate=0.1877287558837553;
+CD2_tree.Pig.nonSynRate=0.4826366809736332;
+CD2_tree.Horse.nonSynRate=0.518627673056701;
+CD2_tree.Cow.nonSynRate=0.681831503936737;
+CD2_tree.Cat.synRate=0.4672127128189641;
+CD2_tree.Node3.nonSynRate=0.2648957141533021;
+CD2_tree.Horse.synRate=0.430860769501357;
+CD2_tree.Pig.synRate=0.3721230153643161;
+CD2_tree.Node2.synRate=0.2137858662796737;
+CD2_tree.RhMonkey.nonSynRate=0.01161863878954486;
+CD2_tree.Cat.nonSynRate=0.7203773170684773;
+CD2_tree.Node2.nonSynRate=0.1379570235930709;
+CD2_tree.Cow.synRate=0.3646221318370894;
+
+END;
--- a/test-data/relax-out1.json	Tue Apr 20 19:53:39 2021 +0000
+++ b/test-data/relax-out1.json	Tue Apr 27 18:07:06 2021 +0000
@@ -1,486 +1,174 @@
 {
- "analysis":{
-   "info":"RELAX (a random effects test of selection relaxation) uses a random effects branch-site model framework to test whether a set of 'Test' branches evolves under relaxed selection relative to a set of 'Reference' branches (R), as measured by the relaxation parameter (K).\n                                                Version 2.1 adds a check for stability in K estimates to try to mitigate convergence problems",
-   "version":"2.1",
-   "citation":"RELAX: Detecting Relaxed Selection in a Phylogenetic Framework (2015). Mol Biol Evol 32 (3): 820-832",
-   "authors":"Sergei L Kosakovsky Pond, Ben Murrell, Steven Weaver and Temple iGEM / UCSD viral evolution group",
-   "contact":"spond@temple.edu",
-   "requirements":"in-frame codon alignment and a phylogenetic tree, with at least two groups of branches defined using the {} notation (one group can be defined as all unlabeled branches)"
-  },
- "input":{
-   "file name":"/home/galaxystaging/galaxy/database/jobs_directory/000/79/working/relax_input.fa",
-   "number of sequences":10,
-   "number of sites":187,
-   "partition count":1,
-   "trees":{
-     "0":"((((Pig:0.147969,Cow:0.21343)Node3:0.085099,Horse:0.165787,Cat:0.264806)Node2:0.058611,((RhMonkey:0.002015,Baboon:0.003108)Node9:0.022733,(Human:0.004349,Chimp:0.000799)Node12:0.011873)Node8:0.101856)Node1:0.340802,Rat:0.050958,Mouse:0.09795)"
-    }
-  },
- "fits":{
-   "Nucleotide GTR":{
-     "Log Likelihood":-3531.964032193222,
-     "estimated parameters":24,
-     "AIC-c":7112.142925621896,
-     "Equilibrium frequencies":[
-      [0.3563279857397504],
-      [0.1837789661319073],
-      [0.2402852049910873],
-      [0.2196078431372549]
-      ],
-     "Rate Distributions":{
-       "Substitution rate from nucleotide A to nucleotide C":0.5465757107930838,
-       "Substitution rate from nucleotide A to nucleotide G":1,
-       "Substitution rate from nucleotide A to nucleotide T":0.264131123736109,
-       "Substitution rate from nucleotide C to nucleotide G":0.4861812992450388,
-       "Substitution rate from nucleotide C to nucleotide T":1.017887589835735,
-       "Substitution rate from nucleotide G to nucleotide T":0.3021773696987065
-      },
-     "display order":0
-    },
-   "MG94xREV with separate rates for branch sets":{
-     "Log Likelihood":-3460.931903299487,
-     "estimated parameters":32,
-     "AIC-c":6987.013507197776,
-     "Equilibrium frequencies":[
-      [0.04785168648208005],
-      [0.03911346079312019],
-      [0.04842054060317301],
-      [0.04069665666515385],
-      [0.01817010744778396],
-      [0.01485205303123071],
-      [0.01838611113045968],
-      [0.01545321970309948],
-      [0.0190138898893362],
-      [0.01554175184587827],
-      [0.01923992433904378],
-      [0.01617083546230154],
-      [0.02796925133965702],
-      [0.02286176927319543],
-      [0.02830174586718859],
-      [0.02378714529482007],
-      [0.01687870337957799],
-      [0.01379647304851128],
-      [0.01707935503225849],
-      [0.01435491300079667],
-      [0.006409133648843443],
-      [0.005238757839512795],
-      [0.006485324528555602],
-      [0.005450807083377185],
-      [0.006706760641638982],
-      [0.005482034985409045],
-      [0.006786489669196017],
-      [0.005703931360295163],
-      [0.009865581170012171],
-      [0.008064021368173151],
-      [0.009982861811889655],
-      [0.008390428826966174],
-      [0.03287895020631181],
-      [0.02687490503171972],
-      [0.033269810543681],
-      [0.0279627207822247],
-      [0.01248470225271473],
-      [0.01020486315060615],
-      [0.01263311863778268],
-      [0.01061792547971484],
-      [0.01306446616325414],
-      [0.01067875601941112],
-      [0.01321977470017749],
-      [0.01111100011404158],
-      [0.01921770557551369],
-      [0.01570834862514353],
-      [0.01944616295744266],
-      [0.01634417558076203],
-      [0.01975257768318274],
-      [0.02055210293142003],
-      [0.009176034326710849],
-      [0.007500393094996483],
-      [0.00928511773266342],
-      [0.007803986567571961],
-      [0.00784869593340758],
-      [0.009716299514778986],
-      [0.008166387662818644],
-      [0.01412467213650941],
-      [0.01154535713247913],
-      [0.01429258425298098],
-      [0.01201267864744234]
-      ],
-     "Rate Distributions":{
-       "non-synonymous/synonymous rate ratio for *Reference*":[
-        [1.617765969026557, 1]
-        ],
-       "non-synonymous/synonymous rate ratio for *Test*":[
-        [0.7687683974183303, 1]
-        ]
-      },
-     "display order":1
-    },
-   "General descriptive":{
-     "Log Likelihood":-3420.975369746331,
-     "estimated parameters":51,
-     "AIC-c":6946.868231241836,
-     "Rate Distributions":{
-       "Shared":{
-         "0":{
-           "omega":1e-08,
-           "proportion":0.2345034364701236
-          },
-         "1":{
-           "omega":1e-08,
-           "proportion":0.3180344596999608
-          },
-         "2":{
-           "omega":6.64943557055033,
-           "proportion":0.4474621038299156
-          }
-        }
-      },
-     "display order":4
-    },
-   "RELAX alternative":{
-     "Log Likelihood":-3429.125323833579,
-     "estimated parameters":36,
-     "AIC-c":6931.704002822642,
-     "Rate Distributions":{
-       "Test":{
-         "0":{
-           "omega":0,
-           "proportion":0.1993913071931658
-          },
-         "1":{
-           "omega":0,
-           "proportion":0.3360341729181165
-          },
-         "2":{
-           "omega":2.153056268947235,
-           "proportion":0.4645745198887177
-          }
-        },
-       "Reference":{
-         "0":{
-           "omega":0,
-           "proportion":0.1993913071931658
-          },
-         "1":{
-           "omega":0,
-           "proportion":0.3360341729181165
-          },
-         "2":{
-           "omega":6.166712663934246,
-           "proportion":0.4645745198887177
-          }
-        }
-      },
-     "display order":2
-    },
-   "RELAX null":{
-     "Log Likelihood":-3437.187429488768,
-     "estimated parameters":35,
-     "AIC-c":6945.748904779063,
-     "Rate Distributions":{
-       "Test":{
-         "0":{
-           "omega":0.1177689533662908,
-           "proportion":0.4926494715348529
-          },
-         "1":{
-           "omega":0.3195682613972807,
-           "proportion":0.1517366025099117
-          },
-         "2":{
-           "omega":3.893733071412322,
-           "proportion":0.3556139259552353
-          }
-        },
-       "Reference":{
-         "0":{
-           "omega":0.1177689533662908,
-           "proportion":0.4926494715348529
-          },
-         "1":{
-           "omega":0.3195682613972807,
-           "proportion":0.1517366025099117
-          },
-         "2":{
-           "omega":3.893733071412322,
-           "proportion":0.3556139259552353
-          }
-        }
-      },
-     "display order":3
-    },
-   "RELAX partitioned descriptive":{
-     "Log Likelihood":-3427.515821600644,
-     "estimated parameters":40,
-     "AIC-c":6936.824972889643,
-     "Rate Distributions":{
-       "Test":{
-         "0":{
-           "omega":0.2264899618249929,
-           "proportion":0.1370778077745601
-          },
-         "1":{
-           "omega":0.2328054750512875,
-           "proportion":0.6322930022247097
-          },
-         "2":{
-           "omega":4.13407071706127,
-           "proportion":0.2306291900007301
-          }
-        },
-       "Reference":{
-         "0":{
-           "omega":0,
-           "proportion":0.09054841512283768
-          },
-         "1":{
-           "omega":0,
-           "proportion":0.4231976237742962
-          },
-         "2":{
-           "omega":5.975493863572218,
-           "proportion":0.4862539611028661
-          }
-        }
-      },
-     "display order":5
-    }
-  },
- "timers":{
-   "Overall":{
-     "timer":562,
-     "order":0
-    },
-   "Preliminary model fitting":{
-     "timer":33,
-     "order":1
-    },
-   "General descriptive model fitting":{
-     "timer":256,
-     "order":2
-    },
-   "RELAX alternative model fitting":{
-     "timer":78,
-     "order":3
-    },
-   "RELAX null model fitting":{
-     "timer":98,
-     "order":4
-    },
-   "RELAX partitioned descriptive":{
-     "timer":95,
-     "order":5
-    }
-  },
- "test results":{
-   "LRT":16.12421131037809,
-   "p-value":5.932080525117289e-05,
-   "relaxation or intensification parameter":0.4215604262166031
-  },
- "tested":{
-   "0":{
-     "Pig":"Test",
-     "Cow":"Reference",
-     "Node3":"Test",
-     "Horse":"Reference",
-     "Cat":"Reference",
-     "Node2":"Test",
-     "RhMonkey":"Test",
-     "Baboon":"Test",
-     "Node9":"Test",
-     "Human":"Test",
-     "Chimp":"Test",
-     "Node12":"Test",
-     "Node8":"Test",
-     "Node1":"Test",
-     "Rat":"Test",
-     "Mouse":"Test"
-    }
-  },
- "data partitions":{
-   "0":{
-     "name":"relax.filter.default",
-     "coverage":[
-      [0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186]
-      ]
-    }
-  },
+ "analysis":0,
  "branch attributes":{
    "0":{
-     "Human":{
-       "original name":"Human",
-       "Nucleotide GTR":0,
-       "MG94xREV with separate rates for branch sets":0,
-       "General descriptive":0,
-       "k (general descriptive)":0.7168352052656061,
-       "RELAX alternative":0,
-       "RELAX null":0,
-       "RELAX partitioned descriptive":0
-      },
-     "Chimp":{
-       "original name":"Chimp",
-       "Nucleotide GTR":0.001818722292071369,
-       "MG94xREV with separate rates for branch sets":0.001828056639868651,
-       "General descriptive":0.001850581335499795,
-       "k (general descriptive)":2.329184252362038,
-       "RELAX alternative":0.001831548027528597,
-       "RELAX null":0.001835680183060623,
-       "RELAX partitioned descriptive":0.00183255534978807
-      },
      "Baboon":{
-       "original name":"Baboon",
-       "Nucleotide GTR":0.001682319705247233,
-       "MG94xREV with separate rates for branch sets":0.001770013551346919,
-       "General descriptive":0.001869883333754939,
-       "k (general descriptive)":0.1228116964827354,
-       "RELAX alternative":0.001867314836287998,
-       "RELAX null":0.001853697678697539,
-       "RELAX partitioned descriptive":0.00189422569191071
-      },
-     "RhMonkey":{
-       "original name":"RhMonkey",
-       "Nucleotide GTR":0.003776495523121213,
-       "MG94xREV with separate rates for branch sets":0.003720554271464007,
-       "General descriptive":0.003663070393385353,
-       "k (general descriptive)":2.272939790126477,
-       "RELAX alternative":0.003641537789305734,
-       "RELAX null":0.003670955010908306,
-       "RELAX partitioned descriptive":0.003632158699516803
-      },
-     "Cow":{
-       "original name":"Cow",
-       "Nucleotide GTR":0.2483201583381086,
-       "MG94xREV with separate rates for branch sets":0.2522875145085426,
-       "General descriptive":0.3735091756053704,
-       "k (general descriptive)":1.19957642031092,
-       "RELAX alternative":0.3407703477665083,
-       "RELAX null":0.2958310860090909,
-       "RELAX partitioned descriptive":0.3460604457589064
-      },
-     "Pig":{
-       "original name":"Pig",
-       "Nucleotide GTR":0.1871417867164377,
-       "MG94xREV with separate rates for branch sets":0.1903173961963296,
-       "General descriptive":0.2109384940367451,
-       "k (general descriptive)":0.6656155688777629,
-       "RELAX alternative":0.197167672065417,
-       "RELAX null":0.2182629931612711,
-       "RELAX partitioned descriptive":0.2076369268997903
-      },
-     "Horse":{
-       "original name":"Horse",
-       "Nucleotide GTR":0.2091567334932583,
-       "MG94xREV with separate rates for branch sets":0.2159358728261337,
-       "General descriptive":0.2810540078141565,
-       "k (general descriptive)":0.8115699858212525,
-       "RELAX alternative":0.3032889682089364,
-       "RELAX null":0.2571098559672552,
-       "RELAX partitioned descriptive":0.3026705354406338
+       "General descriptive":0.001858767762813579,
+       "MG94xREV with separate rates for branch sets":0.001769472024099301,
+       "Nucleotide GTR":0.001680040630127455,
+       "RELAX alternative":0.001872256662230973,
+       "RELAX null":0.001855569334462731,
+       "RELAX partitioned descriptive":0.001898170574782418,
+       "k (general descriptive)":0.09971581394819819,
+       "original name":"Baboon"
       },
      "Cat":{
-       "original name":"Cat",
-       "Nucleotide GTR":0.2660040109418023,
-       "MG94xREV with separate rates for branch sets":0.2795692100037539,
-       "General descriptive":0.3635335087937213,
-       "k (general descriptive)":0.9728289997736356,
-       "RELAX alternative":0.3660889485578829,
-       "RELAX null":0.3281803512051322,
-       "RELAX partitioned descriptive":0.370631318143086
+       "General descriptive":0.3644803308678196,
+       "MG94xREV with separate rates for branch sets":0.2796030091674721,
+       "Nucleotide GTR":0.2660909938917123,
+       "RELAX alternative":0.3689219388980864,
+       "RELAX null":0.3256077554105627,
+       "RELAX partitioned descriptive":0.3717219559832593,
+       "k (general descriptive)":2.314507643873676,
+       "original name":"Cat"
+      },
+     "Chimp":{
+       "General descriptive":0.001848680051431209,
+       "MG94xREV with separate rates for branch sets":0.001825434296531533,
+       "Nucleotide GTR":0.001818373670119325,
+       "RELAX alternative":0.001831703934281931,
+       "RELAX null":0.00183525802483954,
+       "RELAX partitioned descriptive":0.001832717232153088,
+       "k (general descriptive)":5.261186652622472,
+       "original name":"Chimp"
+      },
+     "Cow":{
+       "General descriptive":0.3733627618450006,
+       "MG94xREV with separate rates for branch sets":0.2520490246808783,
+       "Nucleotide GTR":0.2481025999892287,
+       "RELAX alternative":0.342739998512865,
+       "RELAX null":0.2948256709356563,
+       "RELAX partitioned descriptive":0.3466331923230422,
+       "k (general descriptive)":2.846155982935764,
+       "original name":"Cow"
+      },
+     "Horse":{
+       "General descriptive":0.2802176313870697,
+       "MG94xREV with separate rates for branch sets":0.2158304510870495,
+       "Nucleotide GTR":0.2090310577070883,
+       "RELAX alternative":0.3058487498567987,
+       "RELAX null":0.2559911331878715,
+       "RELAX partitioned descriptive":0.3034694616209482,
+       "k (general descriptive)":1.926646959057857,
+       "original name":"Horse"
+      },
+     "Human":{
+       "General descriptive":0,
+       "MG94xREV with separate rates for branch sets":0,
+       "Nucleotide GTR":0,
+       "RELAX alternative":0,
+       "RELAX null":0,
+       "RELAX partitioned descriptive":0,
+       "k (general descriptive)":1.462532487172471,
+       "original name":"Human"
       },
      "Mouse":{
-       "original name":"Mouse",
-       "Nucleotide GTR":0.1182531454610134,
-       "MG94xREV with separate rates for branch sets":0.1199409901922202,
-       "General descriptive":0.1313354563273305,
-       "k (general descriptive)":0.2294495132372282,
-       "RELAX alternative":0.1341640738853253,
-       "RELAX null":0.1483938193994467,
-       "RELAX partitioned descriptive":0.1476318125310598
-      },
-     "Rat":{
-       "original name":"Rat",
-       "Nucleotide GTR":0.06669544716210057,
-       "MG94xREV with separate rates for branch sets":0.06725647453745125,
-       "General descriptive":0.07175915155128718,
-       "k (general descriptive)":0.5208088414555363,
-       "RELAX alternative":0.0724007498013708,
-       "RELAX null":0.07365614414375878,
-       "RELAX partitioned descriptive":0.07568744563050285
+       "General descriptive":0.1307950021191255,
+       "MG94xREV with separate rates for branch sets":0.1197727080219867,
+       "Nucleotide GTR":0.1180171198334285,
+       "RELAX alternative":0.1346501492117481,
+       "RELAX null":0.1468861666244963,
+       "RELAX partitioned descriptive":0.1475623398849678,
+       "k (general descriptive)":0.4639609139295889,
+       "original name":"Mouse"
       },
      "Node1":{
-       "Nucleotide GTR":0.2771601504028877,
-       "MG94xREV with separate rates for branch sets":0.286127507474972,
-       "General descriptive":0.3532216661512288,
-       "k (general descriptive)":0.2199586786715634,
-       "RELAX alternative":0.3833004811985787,
-       "RELAX null":0.4576044234710181,
-       "RELAX partitioned descriptive":0.4360897576025625
+       "General descriptive":0.350050900813081,
+       "MG94xREV with separate rates for branch sets":0.2857356440257563,
+       "Nucleotide GTR":0.2767237570684924,
+       "RELAX alternative":0.3856490868629754,
+       "RELAX null":0.4521046025119397,
+       "RELAX partitioned descriptive":0.4358952685746469,
+       "k (general descriptive)":0.458870761901378
       },
      "Node12":{
-       "Nucleotide GTR":0.01783222754921504,
-       "MG94xREV with separate rates for branch sets":0.01799298835381691,
-       "General descriptive":0.01771170858901891,
-       "k (general descriptive)":0.1560499010177516,
-       "RELAX alternative":0.01833338832069913,
-       "RELAX null":0.01828012634520382,
-       "RELAX partitioned descriptive":0.01877701767421286
+       "General descriptive":0.01766384491594095,
+       "MG94xREV with separate rates for branch sets":0.01800001211221997,
+       "Nucleotide GTR":0.01784803874223016,
+       "RELAX alternative":0.01835132674304535,
+       "RELAX null":0.0182458522959868,
+       "RELAX partitioned descriptive":0.01878351896299688,
+       "k (general descriptive)":0.1241597340554799
       },
      "Node2":{
-       "Nucleotide GTR":0.06619118337434968,
-       "MG94xREV with separate rates for branch sets":0.06192085035608558,
-       "General descriptive":0.05843310574046084,
-       "k (general descriptive)":0.2816499194095207,
-       "RELAX alternative":0.05469841675490748,
-       "RELAX null":0.06219694236954142,
-       "RELAX partitioned descriptive":0.06011281230238084
+       "General descriptive":0.05771641706257456,
+       "MG94xREV with separate rates for branch sets":0.06169547093990335,
+       "Nucleotide GTR":0.06613162123865737,
+       "RELAX alternative":0.05450381496370671,
+       "RELAX null":0.06144358908741494,
+       "RELAX partitioned descriptive":0.05974179966710006,
+       "k (general descriptive)":0.5400661932123572
       },
      "Node3":{
-       "Nucleotide GTR":0.09883746945145887,
-       "MG94xREV with separate rates for branch sets":0.09744342239018626,
-       "General descriptive":0.1340338084149808,
-       "k (general descriptive)":0.8358980179450297,
-       "RELAX alternative":0.1164056814082033,
-       "RELAX null":0.1282588343299434,
-       "RELAX partitioned descriptive":0.1194563668460339
+       "General descriptive":0.133048972566238,
+       "MG94xREV with separate rates for branch sets":0.09736816312927643,
+       "Nucleotide GTR":0.09886326330774685,
+       "RELAX alternative":0.1168284793254293,
+       "RELAX null":0.1276889506286756,
+       "RELAX partitioned descriptive":0.1195376339442456,
+       "k (general descriptive)":1.980345386854111
       },
      "Node8":{
-       "Nucleotide GTR":0.106110061225871,
-       "MG94xREV with separate rates for branch sets":0.1090208137603471,
-       "General descriptive":0.1401594332730181,
-       "k (general descriptive)":0.9135621448569878,
-       "RELAX alternative":0.1275155316795084,
-       "RELAX null":0.1346842719904758,
-       "RELAX partitioned descriptive":0.1358683972849559
+       "General descriptive":0.1404364853762839,
+       "MG94xREV with separate rates for branch sets":0.1092041281639667,
+       "Nucleotide GTR":0.106239268140425,
+       "RELAX alternative":0.1283918913740865,
+       "RELAX null":0.1343238120118072,
+       "RELAX partitioned descriptive":0.1363833239244288,
+       "k (general descriptive)":2.210166852936262
       },
      "Node9":{
-       "Nucleotide GTR":0.02567391471029082,
-       "MG94xREV with separate rates for branch sets":0.02582385148170195,
-       "General descriptive":0.02665352479510937,
-       "k (general descriptive)":0.1089752436854629,
-       "RELAX alternative":0.02681134359856903,
-       "RELAX null":0.02759760291393045,
-       "RELAX partitioned descriptive":0.02746061131173372
+       "General descriptive":0.02665050120918479,
+       "MG94xREV with separate rates for branch sets":0.02578196090462333,
+       "Nucleotide GTR":0.02566573875750134,
+       "RELAX alternative":0.02679622227446188,
+       "RELAX null":0.02754241929890747,
+       "RELAX partitioned descriptive":0.0274479920792393,
+       "k (general descriptive)":0.0733131770696667
+      },
+     "Pig":{
+       "General descriptive":0.2104601216238473,
+       "MG94xREV with separate rates for branch sets":0.1902977811335351,
+       "Nucleotide GTR":0.1871893456388788,
+       "RELAX alternative":0.19752905148822,
+       "RELAX null":0.2165309177979844,
+       "RELAX partitioned descriptive":0.2074828949843082,
+       "k (general descriptive)":1.577441472516679,
+       "original name":"Pig"
+      },
+     "Rat":{
+       "General descriptive":0.07164210204456434,
+       "MG94xREV with separate rates for branch sets":0.06709541225974219,
+       "Nucleotide GTR":0.06661283005976348,
+       "RELAX alternative":0.07247047023746757,
+       "RELAX null":0.07343093575256582,
+       "RELAX partitioned descriptive":0.07560655472076994,
+       "k (general descriptive)":1.318174884032695,
+       "original name":"Rat"
+      },
+     "RhMonkey":{
+       "General descriptive":0.003674505194636419,
+       "MG94xREV with separate rates for branch sets":0.003716165486244973,
+       "Nucleotide GTR":0.003775170135617877,
+       "RELAX alternative":0.003636176595806718,
+       "RELAX null":0.003665938723426083,
+       "RELAX partitioned descriptive":0.003624376345656283,
+       "k (general descriptive)":5.171610533872274,
+       "original name":"RhMonkey"
       }
     },
    "attributes":{
-     "original name":{
-       "attribute type":"node label",
-       "display order":-1
-      },
-     "Nucleotide GTR":{
+     "General descriptive":{
        "attribute type":"branch length",
-       "display order":0
+       "display order":4
       },
      "MG94xREV with separate rates for branch sets":{
        "attribute type":"branch length",
        "display order":1
       },
-     "General descriptive":{
+     "Nucleotide GTR":{
        "attribute type":"branch length",
-       "display order":4
-      },
-     "k (general descriptive)":{
-       "attribute type":"branch label",
-       "display order":4
+       "display order":0
       },
      "RELAX alternative":{
        "attribute type":"branch length",
@@ -493,7 +181,312 @@
      "RELAX partitioned descriptive":{
        "attribute type":"branch length",
        "display order":5
+      },
+     "k (general descriptive)":{
+       "attribute type":"branch label",
+       "display order":4
+      },
+     "original name":{
+       "attribute type":"node label",
+       "display order":-1
       }
     }
+  },
+ "data partitions":{
+   "0":{
+     "coverage":      [
+[0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186] 
+      ],
+     "name":"relax.filter.default"
+    }
+  },
+ "fits":{
+   "General descriptive":{
+     "AIC-c":6945.891353881681,
+     "Log Likelihood":-3420.486931066253,
+     "Rate Distributions":{
+       "Shared":{
+         "0":{
+           "omega":2.202835393423959e-18,
+           "proportion":0.4487473029633234
+          },
+         "1":{
+           "omega":2.202835393423959e-18,
+           "proportion":0.09729227592412616
+          },
+         "2":{
+           "omega":2.202835210940273,
+           "proportion":0.4539604211125504
+          }
+        }
+      },
+     "display order":4,
+     "estimated parameters":51
+    },
+   "MG94xREV with separate rates for branch sets":{
+     "AIC-c":6987.565999172035,
+     "Equilibrium frequencies":      [
+[0.04876086397632926],
+      [0.03982224127745371],
+      [0.0494959405650269],
+      [0.04152830682371345],
+      [0.01810345074594235],
+      [0.01478480742075003],
+      [0.01837636270304883],
+      [0.01541821854326533],
+      [0.01892910005547028],
+      [0.01545910240515689],
+      [0.01921445878706794],
+      [0.01612140169177368],
+      [0.02829747763884322],
+      [0.02311011106415996],
+      [0.02872406592369408],
+      [0.02410019507229243],
+      [0.01663805943190806],
+      [0.01358804506433061],
+      [0.01688888041768248],
+      [0.01417018446135155],
+      [0.006177213955434187],
+      [0.005044834822351987],
+      [0.006270336287397383],
+      [0.00526096577332031],
+      [0.006458939937330408],
+      [0.005274916061901906],
+      [0.006556309326397028],
+      [0.005500904159606446],
+      [0.009655594186286731],
+      [0.007885574003572761],
+      [0.009801153568494354],
+      [0.008223407979974132],
+      [0.03327785448210915],
+      [0.02717750758119989],
+      [0.03377952261833742],
+      [0.02834184710178207],
+      [0.01235507229404208],
+      [0.01009019590244688],
+      [0.01254132667213156],
+      [0.01052248035033209],
+      [0.01291855364640413],
+      [0.01055038238273567],
+      [0.01311330258173711],
+      [0.01100238215235291],
+      [0.01931219560697892],
+      [0.0157719705998612],
+      [0.01960332955558842],
+      [0.01644767379420349],
+      [0.01965132601881859],
+      [0.02049322866376102],
+      [0.008933621043463411],
+      [0.007295949736387736],
+      [0.009068296583349953],
+      [0.007608523013862737],
+      [0.007628698224327205],
+      [0.009481877006094248],
+      [0.00795552712159237],
+      [0.01396413011303752],
+      [0.01140428846505027],
+      [0.01417464125436193],
+      [0.01189287130232129] 
+      ],
+     "Log Likelihood":-3461.208149286616,
+     "Rate Distributions":{
+       "non-synonymous/synonymous rate ratio for *Reference*":        [
+[0.7682335289209781, 1] 
+        ],
+       "non-synonymous/synonymous rate ratio for *Test*":        [
+[1.605439824256426, 1] 
+        ]
+      },
+     "display order":1,
+     "estimated parameters":32
+    },
+   "Nucleotide GTR":{
+     "AIC-c":7112.857310169033,
+     "Equilibrium frequencies":      [
+[0.3592490842490842],
+      [0.181959706959707],
+      [0.240018315018315],
+      [0.2187728937728937] 
+      ],
+     "Log Likelihood":-3532.32122446679,
+     "Rate Distributions":{
+       "Substitution rate from nucleotide A to nucleotide C":0.5501644800943087,
+       "Substitution rate from nucleotide A to nucleotide G":1,
+       "Substitution rate from nucleotide A to nucleotide T":0.2647746107611847,
+       "Substitution rate from nucleotide C to nucleotide G":0.4917423221832032,
+       "Substitution rate from nucleotide C to nucleotide T":1.02837595903795,
+       "Substitution rate from nucleotide G to nucleotide T":0.304509117524575
+      },
+     "display order":0,
+     "estimated parameters":24
+    },
+   "RELAX alternative":{
+     "AIC-c":6931.922980697387,
+     "Log Likelihood":-3429.234812770952,
+     "Rate Distributions":{
+       "Reference":{
+         "0":{
+           "omega":1.762268314739328e-19,
+           "proportion":0.4504132080156107
+          },
+         "1":{
+           "omega":1.762268314739328e-19,
+           "proportion":0.08749553114962015
+          },
+         "2":{
+           "omega":2.19971015101232,
+           "proportion":0.4620912608347691
+          }
+        },
+       "Test":{
+         "0":{
+           "omega":1.054840660215593e-44,
+           "proportion":0.4504132080156107
+          },
+         "1":{
+           "omega":1.054840660215593e-44,
+           "proportion":0.08749553114962015
+          },
+         "2":{
+           "omega":6.350765030542244,
+           "proportion":0.4620912608347691
+          }
+        }
+      },
+     "display order":2,
+     "estimated parameters":36
+    },
+   "RELAX null":{
+     "AIC-c":6946.046672507471,
+     "Log Likelihood":-3437.336313352972,
+     "Rate Distributions":{
+       "Reference":{
+         "0":{
+           "omega":0.1150006822953211,
+           "proportion":0.542405144031307
+          },
+         "1":{
+           "omega":0.2401508033814633,
+           "proportion":0.08223353569636478
+          },
+         "2":{
+           "omega":3.69263720947284,
+           "proportion":0.3753613202723282
+          }
+        },
+       "Test":{
+         "0":{
+           "omega":0.1150006822953211,
+           "proportion":0.542405144031307
+          },
+         "1":{
+           "omega":0.2401508033814633,
+           "proportion":0.08223353569636478
+          },
+         "2":{
+           "omega":3.69263720947284,
+           "proportion":0.3753613202723282
+          }
+        }
+      },
+     "display order":3,
+     "estimated parameters":35
+    },
+   "RELAX partitioned descriptive":{
+     "AIC-c":6937.04707353565,
+     "Log Likelihood":-3427.626871923648,
+     "Rate Distributions":{
+       "Reference":{
+         "0":{
+           "omega":0.1943306885168281,
+           "proportion":0.3359458135547653
+          },
+         "1":{
+           "omega":0.2607558478587815,
+           "proportion":0.4332550437039296
+          },
+         "2":{
+           "omega":4.134271224300374,
+           "proportion":0.2307991427413052
+          }
+        },
+       "Test":{
+         "0":{
+           "omega":0,
+           "proportion":0.4753488415962343
+          },
+         "1":{
+           "omega":0,
+           "proportion":0.03858318603767072
+          },
+         "2":{
+           "omega":6.017221959238516,
+           "proportion":0.486067972366095
+          }
+        }
+      },
+     "display order":5,
+     "estimated parameters":40
+    }
+  },
+ "input":{
+   "file name":"/tmp/tmpbauyxvdv/job_working_directory/000/3/working/./input.fasta",
+   "number of sequences":10,
+   "number of sites":187,
+   "partition count":1,
+   "trees":{
+     "0":"((((Pig:0.147969,Cow:0.21343)Node3:0.08509899999999999,Horse:0.165787,Cat:0.264806)Node2:0.058611,((RhMonkey:0.002015,Baboon:0.003108)Node9:0.022733,(Human:0.004349,Chimp:0.000799)Node12:0.011873)Node8:0.101856)Node1:0.340802,Rat:0.050958,Mouse:0.09795)"
+    }
+  },
+ "test results":{
+   "LRT":16.20300116404087,
+   "p-value":5.690389451429301e-05,
+   "relaxation or intensification parameter":2.344938789085876
+  },
+ "tested":{
+   "0":{
+     "Baboon":"Reference",
+     "Cat":"Test",
+     "Chimp":"Reference",
+     "Cow":"Test",
+     "Horse":"Test",
+     "Human":"Reference",
+     "Mouse":"Reference",
+     "Node1":"Reference",
+     "Node12":"Reference",
+     "Node2":"Reference",
+     "Node3":"Reference",
+     "Node8":"Reference",
+     "Node9":"Reference",
+     "Pig":"Reference",
+     "Rat":"Reference",
+     "RhMonkey":"Reference"
+    }
+  },
+ "timers":{
+   "General descriptive model fitting":{
+     "order":2,
+     "timer":132
+    },
+   "Overall":{
+     "order":0,
+     "timer":324
+    },
+   "Preliminary model fitting":{
+     "order":1,
+     "timer":8
+    },
+   "RELAX alternative model fitting":{
+     "order":3,
+     "timer":65
+    },
+   "RELAX null model fitting":{
+     "order":4,
+     "timer":66
+    },
+   "RELAX partitioned descriptive":{
+     "order":5,
+     "timer":53
+    }
   }
 }
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/relax-out2-1.json	Tue Apr 27 18:07:06 2021 +0000
@@ -0,0 +1,525 @@
+{
+ "Synonymous site-posteriors":  [
+[0.2717348381268465, 0.5635158143073038, 0.5580958985234344, 0.4419267392327456, 0.1775513314393873, 0.01303903284026798, 0.00125071980641974, 0.2376006215377312, 0.8837687913991302, 0.697488732253998, 0.76440666757549, 0.1859131352278527, 0.4676839084660329, 0.5320161033357819, 0.4513687349306337, 0.8514990846254493, 0.9101555767748879, 0.9112112654445478, 0.9624478616388369, 0.9472735837633918, 0.8715894173292342, 0.9248557783401865, 0.3852870058193366, 0.7504386709677574, 0.7275694213063354, 0.1979029930878776, 0.2585255313006612, 0.426812371619399, 0.03564414482172501, 0.3292941826787388, 0.1427864928730872, 0.8324822227281018, 0.9311167984186458, 0.1209539167468769, 0.8726642109588801, 1.798577785061191e-05, 0.584102863529593, 0.5747348035616634, 0.5814406651776627, 0.02251840852563282, 0.1607002230623373, 0.499402751628698, 0.9327364905381349, 0.1164578922551683, 0.7414294602970922, 0.04004321943657974, 0.1252919499200681, 0.7016909689123084, 0.3099147090319344, 0.1594271385761372, 0.001721088532959928, 0.0002106542138058178, 0.7670245595319366, 0.01765606757145387, 0.08528617939935416, 0.01185048796937841, 0.008218049898468071, 0.294285815926654, 0.4088819101657737, 0.1819814701794264, 0.06741006997792491, 0.1648869485561294, 0.6641637464726119, 0.1696421815033135, 0.5337345685031449, 0.9785329157950278, 0.6089117121305408, 0.9214198863478258, 0.7040511824729966, 0.8748810706893103, 0.7603207301908244, 0.1587648197710778, 0.28009015626025, 0.9473769917649164, 0.03667497185975328, 0.6646432746680839, 0.005707942217110617, 0.4172795698582943, 0.002426641321239203, 0.9036479890682162, 0.8165937919459629, 0.5380686752231248, 0.8348947378138256, 0.8825623566861087, 0.003194607014896987, 0.1034323185116836, 0.1251183560640448, 0.6731739154042389, 0.02049494631105097, 0.7272701824195644, 0.9376578101739967, 0.03161216349993828, 0.08060038603464466, 0.05713766811791781, 0.7236799166647727, 0.03049686563145122, 0.4831167820690108, 0.3259152163804719, 0.9355990871535625, 0.2598255955335131, 0.649043721535527, 0.1395744847880144, 0.8655465087299661, 0.5535165112383126, 0.8759601400318501, 0.1331847979385494, 0.9385179832315519, 0.9590294197009215, 0.1177725177949566, 0.5310119897564728, 0.04436932195281112, 0.877273324169318, 0.07309972300058731, 0.8726642109588801, 0.0823189228969842, 0.674523501474146, 0.4093792912564727, 0.8837869026711356, 0.1208432028324516, 0.7875716367935024, 0.9342090047974666, 0.7281976470761374, 0.6335560301454017, 0.2642816632435872, 0.7601746562441594, 0.3971532429331721, 0.07967254820654134, 0.9205611063156326, 0.4126590346311199, 0.4718488374006657, 0.2324587146851173, 0.2530879180545083, 0.6735650752750825, 0.6778765556227805, 0.9393601651000962, 0.1757530496502532, 0.3931715696771638, 0.7913247469383754, 0.05849180455884406, 0.007027787474985664, 0.002980098295172601, 0.188566078048928, 0.02837364230845984, 0.008078062694748547, 0.4539148488391334, 0.2698860362225194, 0.03514662617223248, 0.8484422182215356, 0.5225500090930265, 0.8755046006217432, 0.01843684138990366, 0.6656855504934923, 0.7055653078864003, 0.236066638653311, 0.1567944657161159, 0.8781825877891227, 0.4362059051173987, 0.163327088806649, 0.004489982631214889, 0.03278376720971195, 0.03145887036879619, 0.6158371404365816, 0.8645373560796752, 0.6351698115277034, 0.04852978149651612, 0.2563374460202912, 0.07868312568368593, 0.9507071563814276, 0.007940480658871889, 0.9455733391892027, 0.4761025393051341, 0.06329409664274364, 0.486108446887078, 0.6554607928409875, 0.3294403859657761, 0.02718898835050054, 0.2632599441236705, 0.09462189267290307, 0.2747185708643275, 0.01971954733787938, 0.9591589529807978, 0.445066915720239, 0.7380186230528726, 0.3686112558749921, 0.9765948224615983, 0.9830372572797934, 0.3428744949444181],
+  [0.6626894690463668, 0.4168101145890417, 0.4227716136375318, 0.5460469376257381, 0.7920802349484392, 0.9148946082433389, 0.6025519507878634, 0.7576953307230244, 0.1161768196008485, 0.300870904847558, 0.2351081226775128, 0.8132535813497387, 0.5318877996344101, 0.4668967839553491, 0.5457786619820105, 0.1479110732581859, 0.08981215498205385, 0.08864753614086184, 0.03754663901787957, 0.05264738134386953, 0.1282694830193035, 0.07509403773664582, 0.6045747073099006, 0.2494182492383805, 0.2720633389832785, 0.7686452193266411, 0.7347907000739735, 0.5704008539033848, 0.8900810148388362, 0.6622067969268041, 0.8222772439705183, 0.1671173022573758, 0.06877381770722009, 0.8768213463619609, 0.1268874503761271, 0.1127865527442154, 0.4132113433068393, 0.4078574964781727, 0.4019815819137846, 0.8609057131470997, 0.8219904610542867, 0.497435507143602, 0.06718726850208989, 0.8529792964008307, 0.2575997459825998, 0.9202924086001865, 0.8495464183712909, 0.2964912971104518, 0.6713145926257978, 0.8291180520156611, 0.6114543507973933, 0.2852631377967785, 0.2328104534903255, 0.8072678280286864, 0.8704118647701751, 0.8427300705564067, 0.7172581750896507, 0.6964353697830554, 0.5892268563480649, 0.7827711632788862, 0.8763689637592522, 0.8149993211355185, 0.3354138449867816, 0.8200034180317622, 0.4608569377024781, 0.02146293171169837, 0.3894693088064173, 0.07856223214512185, 0.2951219222963878, 0.1248753788288069, 0.23850651390316, 0.822201023791224, 0.627275494762912, 0.05261813265775258, 0.8618949472054331, 0.3346412073253501, 0.8548149468968558, 0.5771185613312407, 0.7242200780105019, 0.09629867844856514, 0.1833251080952038, 0.4588348344430745, 0.1648017491057893, 0.1173023384873724, 0.7202020363335049, 0.841920226122869, 0.8253774540837836, 0.3259201372675988, 0.9264522698755596, 0.2718783364189744, 0.0623161368626097, 0.8817427136123017, 0.8412649479334562, 0.9101565666023068, 0.2759454352414827, 0.9059210056507722, 0.5150853978968362, 0.6682724435455734, 0.06435014148842051, 0.7307347025520569, 0.3503065425489416, 0.8426431543383731, 0.1343468579892265, 0.4453254501015221, 0.1238238880869908, 0.8434973789347984, 0.06147302641543798, 0.04096257607882416, 0.8697710797731286, 0.4656522682859228, 0.8377220353741578, 0.1225914426265887, 0.9157074633499515, 0.1268874503761271, 0.8810277708456211, 0.3236042343456706, 0.588466435226929, 0.1160918158368492, 0.868633806828536, 0.2120841007705051, 0.06578091460596601, 0.2717239680174366, 0.3631554309323438, 0.7318741011598721, 0.239303295331146, 0.5985069490535606, 0.8666265919603693, 0.07938077259629264, 0.5792577459252287, 0.5245227397084671, 0.7592533746052446, 0.7288592173620518, 0.3258846389358249, 0.3207495865537446, 0.06062952030075518, 0.8044647321952209, 0.6033218973236086, 0.2073209509499806, 0.9162118523056947, 0.7716338299835022, 0.5285881514017859, 0.8084325119883748, 0.9006732458311826, 0.7316022733524018, 0.539869789386791, 0.7265086919845559, 0.9506048395545971, 0.1507140050836589, 0.4768164423437415, 0.1243504919061002, 0.9208249402822801, 0.3328277190287885, 0.2938257782692427, 0.7556466811772135, 0.8229833832301169, 0.1217860716119049, 0.5579303813087731, 0.8256475188252808, 0.8404190118570157, 0.950929802178094, 0.913563134751453, 0.3826711465162441, 0.135233583856236, 0.3614714112014848, 0.9068087012645575, 0.7306455673064629, 0.8856728807826224, 0.04924521380966264, 0.7635888647846074, 0.05441972871740726, 0.5202968979030539, 0.9150032818678139, 0.5115466967684428, 0.3420818098691781, 0.6627903995193176, 0.9330488261015766, 0.7312957304732464, 0.9017792297379452, 0.722935810930791, 0.8786602595958583, 0.04081198111512852, 0.5544293545628831, 0.2612792602560225, 0.6262138192390445, 0.02340007387678394, 0.01696213795705415, 0.646589884642663],
+  [0.06557569282678667, 0.01967407110365451, 0.01913248783903384, 0.0120263231415164, 0.03036843361217343, 0.07206635891639328, 0.3961973294057168, 0.004704047739244364, 5.438900002120045e-05, 0.00164036289844408, 0.0004852097469972091, 0.0008332834224085657, 0.0004282918995570831, 0.001087112708869119, 0.002852603087355827, 0.0005898421163648459, 3.226824305841269e-05, 0.0001411984145905345, 5.499343283400918e-06, 7.90348927388237e-05, 0.0001410996514624031, 5.018392316756171e-05, 0.01013828687076274, 0.0001430797938620912, 0.0003672397103861051, 0.03345178758548123, 0.006683768625365442, 0.002786774477216176, 0.07427484033943885, 0.008499020394457128, 0.0349362631563945, 0.0004004750145224402, 0.0001093838741341128, 0.002224736891162243, 0.0004483386649928336, 0.887195461477934, 0.002685793163567702, 0.01740769996016384, 0.01657775290855277, 0.1165758783272675, 0.01730931588337583, 0.003161741227700084, 7.624095977511847e-05, 0.03056281134400099, 0.0009707937203079199, 0.0396643719632338, 0.02516163170864108, 0.001817733977239793, 0.01877069834226778, 0.01145480940820172, 0.3868245606696468, 0.7145262079894158, 0.0001649869777379475, 0.17507610439986, 0.04430195583047072, 0.1454194414742148, 0.2745237750118811, 0.009278814290290408, 0.001891233486161397, 0.03524736654168742, 0.05622096626282277, 0.02011373030835192, 0.0004224085406065104, 0.01035440046492424, 0.005408493794377071, 4.15249327386775e-06, 0.001618979063041763, 1.788150705243962e-05, 0.000826895230615602, 0.0002435504818827977, 0.001172755906015731, 0.01903415643769825, 0.09263434897683805, 4.8755773309914e-06, 0.1014300809348136, 0.0007155180065658238, 0.1394771108860336, 0.00560186881046495, 0.2733532806682589, 5.3332483218848e-05, 8.109995883345423e-05, 0.003096490333800809, 0.0003035130803851473, 0.0001353048265188285, 0.2766033566515981, 0.0546474553654474, 0.04950418985217168, 0.0009059473281622822, 0.05305278381338922, 0.0008514811614612199, 2.605296339365474e-05, 0.08664512288775998, 0.07813466603189904, 0.03270576527977536, 0.0003746480937446711, 0.06358212871777665, 0.001797820034153072, 0.005812340073954746, 5.077135801693337e-05, 0.009439701914429836, 0.0006497359155314646, 0.01778236087361252, 0.0001066332808073946, 0.001158038660165389, 0.0002159718811591629, 0.02331782312665233, 8.990353010030482e-06, 8.004220254467764e-06, 0.01245640243191475, 0.003335741957604481, 0.1179086426730309, 0.0001352332040930898, 0.01119281364946127, 0.0004483386649928336, 0.03665330625739472, 0.001872264180183387, 0.002154273516598294, 0.0001212814920152467, 0.01052299033901241, 0.0003442624359924907, 1.008059656744195e-05, 7.838490642616451e-05, 0.003288538922254504, 0.003844235596540642, 0.0005220484246945975, 0.004339808013267371, 0.05370085983308932, 5.81210880747816e-05, 0.008083219443651434, 0.003628422890867134, 0.008287910709638229, 0.01805286458343986, 0.0005502857890926899, 0.001373857823474923, 1.031459914862341e-05, 0.01978221815452602, 0.003506532999227595, 0.001354302111643929, 0.02529634313546128, 0.2213383825415122, 0.4684317503030413, 0.003001409962697131, 0.07095311186035747, 0.2603196639528496, 0.006215361774075545, 0.003605271792924552, 0.01424853427317049, 0.0008437766948056027, 0.0006335485632318505, 0.000144907472156624, 0.06073821832781605, 0.00148673047771923, 0.0006089138443571592, 0.008286680169475522, 0.0202221510537672, 3.134059897233663e-05, 0.005863713573828175, 0.01102539236807026, 0.1550910055117694, 0.01628643061219398, 0.05497799487975088, 0.00149171304717441, 0.0002290600640888508, 0.003358777270811912, 0.0446615172389264, 0.01301698667324574, 0.03564399353369165, 4.76298089098848e-05, 0.2284706545565208, 6.932093390199401e-06, 0.003600562791811967, 0.02170262148944251, 0.002344856344479302, 0.002457397289834446, 0.007769214514906187, 0.03976218554792285, 0.005444325403083032, 0.00359887758915189, 0.002345618204881661, 0.1016201930662625, 2.906590407364353e-05, 0.0005037297168778199, 0.0007021166911049794, 0.005174924885963465, 5.103661617929586e-06, 6.047631523361472e-07, 0.01053562041291899] 
+  ],
+ "analysis":0,
+ "branch attributes":{
+   "0":{
+     "BABOON":{
+       "General descriptive":0.001859093275691098,
+       "MG94xREV with separate rates for branch sets":0.001728762656048212,
+       "Nucleotide GTR":0.001680040630127455,
+       "RELAX alternative":0.001429829115377586,
+       "RELAX null":0.00162000085935921,
+       "RELAX partitioned descriptive":0.001425818785563505,
+       "k (general descriptive)":0.09975999558426636,
+       "original name":"BABOON"
+      },
+     "CAT":{
+       "General descriptive":0.3647017264253697,
+       "MG94xREV with separate rates for branch sets":0.276093367337407,
+       "Nucleotide GTR":0.2660909938917123,
+       "RELAX alternative":0.3756323856089179,
+       "RELAX null":0.3608767062015097,
+       "RELAX partitioned descriptive":0.3779196268605463,
+       "k (general descriptive)":2.315896411158361,
+       "original name":"CAT"
+      },
+     "CHIMP":{
+       "General descriptive":0.001848668319765628,
+       "MG94xREV with separate rates for branch sets":0.001822931846626064,
+       "Nucleotide GTR":0.001818373670119325,
+       "RELAX alternative":0.00185493617203229,
+       "RELAX null":0.001854095610530333,
+       "RELAX partitioned descriptive":0.00185387819029751,
+       "k (general descriptive)":5.254528914257314,
+       "original name":"CHIMP"
+      },
+     "COW":{
+       "General descriptive":0.3732204271616263,
+       "MG94xREV with separate rates for branch sets":0.2488439658756959,
+       "Nucleotide GTR":0.2481025999892287,
+       "RELAX alternative":0.3383682965197552,
+       "RELAX null":0.3267413510264365,
+       "RELAX partitioned descriptive":0.3368059806284254,
+       "k (general descriptive)":2.844135916463983,
+       "original name":"COW"
+      },
+     "HORSE":{
+       "General descriptive":0.2802894874897226,
+       "MG94xREV with separate rates for branch sets":0.2115283499416638,
+       "Nucleotide GTR":0.2090310577070883,
+       "RELAX alternative":0.263552542851074,
+       "RELAX null":0.2568271402938284,
+       "RELAX partitioned descriptive":0.262017696350779,
+       "k (general descriptive)":1.928668982186118,
+       "original name":"HORSE"
+      },
+     "HUMAN":{
+       "General descriptive":0,
+       "MG94xREV with separate rates for branch sets":0,
+       "Nucleotide GTR":0,
+       "RELAX alternative":0,
+       "RELAX null":0,
+       "RELAX partitioned descriptive":0,
+       "k (general descriptive)":1.458575021945062,
+       "original name":"HUMAN"
+      },
+     "MOUSE":{
+       "General descriptive":0.1308201891676921,
+       "MG94xREV with separate rates for branch sets":0.1193025698417779,
+       "Nucleotide GTR":0.1180171198334285,
+       "RELAX alternative":0.1517050531281043,
+       "RELAX null":0.1483289620283821,
+       "RELAX partitioned descriptive":0.1490164254890325,
+       "k (general descriptive)":0.4631708151770838,
+       "original name":"MOUSE"
+      },
+     "Node1":{
+       "General descriptive":0.3501050632149825,
+       "MG94xREV with separate rates for branch sets":0.2890877742792198,
+       "Nucleotide GTR":0.2767237570684924,
+       "RELAX alternative":0.4255409853463661,
+       "RELAX null":0.4550463522153177,
+       "RELAX partitioned descriptive":0.4344852084340091,
+       "k (general descriptive)":0.4579130056597299
+      },
+     "Node12":{
+       "General descriptive":0.01766689355384354,
+       "MG94xREV with separate rates for branch sets":0.01757408524377322,
+       "Nucleotide GTR":0.01784803874223016,
+       "RELAX alternative":0.01676792601958491,
+       "RELAX null":0.01717214969820526,
+       "RELAX partitioned descriptive":0.01691268333643598,
+       "k (general descriptive)":0.124164332983979
+      },
+     "Node2":{
+       "General descriptive":0.0577170117416439,
+       "MG94xREV with separate rates for branch sets":0.06231584601001511,
+       "Nucleotide GTR":0.06613162123865737,
+       "RELAX alternative":0.0656020383942497,
+       "RELAX null":0.06749468776339668,
+       "RELAX partitioned descriptive":0.063727560710161,
+       "k (general descriptive)":0.5375515816350908
+      },
+     "Node3":{
+       "General descriptive":0.1331109882486915,
+       "MG94xREV with separate rates for branch sets":0.1003158387194354,
+       "Nucleotide GTR":0.09886326330774685,
+       "RELAX alternative":0.1377575305960468,
+       "RELAX null":0.1387229575435225,
+       "RELAX partitioned descriptive":0.1370056132243871,
+       "k (general descriptive)":1.983651509686636
+      },
+     "Node8":{
+       "General descriptive":0.1404566834691408,
+       "MG94xREV with separate rates for branch sets":0.1126868091796008,
+       "Nucleotide GTR":0.106239268140425,
+       "RELAX alternative":0.1456361998411515,
+       "RELAX null":0.1432141493320635,
+       "RELAX partitioned descriptive":0.1499980670367906,
+       "k (general descriptive)":2.210307133212389
+      },
+     "Node9":{
+       "General descriptive":0.0266459915750866,
+       "MG94xREV with separate rates for branch sets":0.02627629459000785,
+       "Nucleotide GTR":0.02566573875750134,
+       "RELAX alternative":0.02987801750435297,
+       "RELAX null":0.02953491567444994,
+       "RELAX partitioned descriptive":0.02997035035825657,
+       "k (general descriptive)":0.07328040064262234
+      },
+     "PIG":{
+       "General descriptive":0.2103978170052953,
+       "MG94xREV with separate rates for branch sets":0.1921267861604921,
+       "Nucleotide GTR":0.1871893456388788,
+       "RELAX alternative":0.2514899807955971,
+       "RELAX null":0.2481060168445591,
+       "RELAX partitioned descriptive":0.251294309938668,
+       "k (general descriptive)":1.57905583202459,
+       "original name":"PIG"
+      },
+     "RAT":{
+       "General descriptive":0.07161013387643886,
+       "MG94xREV with separate rates for branch sets":0.06830746072347418,
+       "Nucleotide GTR":0.06661283005976348,
+       "RELAX alternative":0.07293805936494982,
+       "RELAX null":0.07115038941652747,
+       "RELAX partitioned descriptive":0.07467247582140474,
+       "k (general descriptive)":1.319839560623237,
+       "original name":"RAT"
+      },
+     "RHMONKEY":{
+       "General descriptive":0.003674114425886965,
+       "MG94xREV with separate rates for branch sets":0.003753885794232333,
+       "Nucleotide GTR":0.003775170135617877,
+       "RELAX alternative":0.004180662465434332,
+       "RELAX null":0.003978610819466039,
+       "RELAX partitioned descriptive":0.004190519057865823,
+       "k (general descriptive)":5.183560186695944,
+       "original name":"RHMONKEY"
+      }
+    },
+   "attributes":{
+     "General descriptive":{
+       "attribute type":"branch length",
+       "display order":4
+      },
+     "MG94xREV with separate rates for branch sets":{
+       "attribute type":"branch length",
+       "display order":1
+      },
+     "Nucleotide GTR":{
+       "attribute type":"branch length",
+       "display order":0
+      },
+     "RELAX alternative":{
+       "attribute type":"branch length",
+       "display order":2
+      },
+     "RELAX null":{
+       "attribute type":"branch length",
+       "display order":3
+      },
+     "RELAX partitioned descriptive":{
+       "attribute type":"branch length",
+       "display order":5
+      },
+     "k (general descriptive)":{
+       "attribute type":"branch label",
+       "display order":4
+      },
+     "original name":{
+       "attribute type":"node label",
+       "display order":-1
+      }
+    }
+  },
+ "data partitions":{
+   "0":{
+     "coverage":      [
+[0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186] 
+      ],
+     "name":"relax.filter.default"
+    }
+  },
+ "fits":{
+   "General descriptive":{
+     "AIC-c":6945.891070751259,
+     "Log Likelihood":-3420.486789501042,
+     "Rate Distributions":{
+       "Shared":{
+         "0":{
+           "omega":2.20271427504516e-18,
+           "proportion":0.00789425874100967
+          },
+         "1":{
+           "omega":2.20271427504516e-18,
+           "proportion":0.5381203586928067
+          },
+         "2":{
+           "omega":2.202714092571507,
+           "proportion":0.4539853825661836
+          }
+        }
+      },
+     "display order":4,
+     "estimated parameters":51
+    },
+   "MG94xREV with separate rates for branch sets":{
+     "AIC-c":6987.278662183248,
+     "Equilibrium frequencies":      [
+[0.04876086397632926],
+      [0.03982224127745371],
+      [0.0494959405650269],
+      [0.04152830682371345],
+      [0.01810345074594235],
+      [0.01478480742075003],
+      [0.01837636270304883],
+      [0.01541821854326533],
+      [0.01892910005547028],
+      [0.01545910240515689],
+      [0.01921445878706794],
+      [0.01612140169177368],
+      [0.02829747763884322],
+      [0.02311011106415996],
+      [0.02872406592369408],
+      [0.02410019507229243],
+      [0.01663805943190806],
+      [0.01358804506433061],
+      [0.01688888041768248],
+      [0.01417018446135155],
+      [0.006177213955434187],
+      [0.005044834822351987],
+      [0.006270336287397383],
+      [0.00526096577332031],
+      [0.006458939937330408],
+      [0.005274916061901906],
+      [0.006556309326397028],
+      [0.005500904159606446],
+      [0.009655594186286731],
+      [0.007885574003572761],
+      [0.009801153568494354],
+      [0.008223407979974132],
+      [0.03327785448210915],
+      [0.02717750758119989],
+      [0.03377952261833742],
+      [0.02834184710178207],
+      [0.01235507229404208],
+      [0.01009019590244688],
+      [0.01254132667213156],
+      [0.01052248035033209],
+      [0.01291855364640413],
+      [0.01055038238273567],
+      [0.01311330258173711],
+      [0.01100238215235291],
+      [0.01931219560697892],
+      [0.0157719705998612],
+      [0.01960332955558842],
+      [0.01644767379420349],
+      [0.01965132601881859],
+      [0.02049322866376102],
+      [0.008933621043463411],
+      [0.007295949736387736],
+      [0.009068296583349953],
+      [0.007608523013862737],
+      [0.007628698224327205],
+      [0.009481877006094248],
+      [0.00795552712159237],
+      [0.01396413011303752],
+      [0.01140428846505027],
+      [0.01417464125436193],
+      [0.01189287130232129] 
+      ],
+     "Log Likelihood":-3461.064480792223,
+     "Rate Distributions":{
+       "non-synonymous/synonymous rate ratio for *Reference*":        [
+[1.240656122625563, 1] 
+        ],
+       "non-synonymous/synonymous rate ratio for *Test*":        [
+[0.5611761689874598, 1] 
+        ]
+      },
+     "display order":1,
+     "estimated parameters":32
+    },
+   "Nucleotide GTR":{
+     "AIC-c":7112.857310169033,
+     "Equilibrium frequencies":      [
+[0.3592490842490842],
+      [0.181959706959707],
+      [0.240018315018315],
+      [0.2187728937728937] 
+      ],
+     "Log Likelihood":-3532.32122446679,
+     "Rate Distributions":{
+       "Substitution rate from nucleotide A to nucleotide C":0.5501644800943087,
+       "Substitution rate from nucleotide A to nucleotide G":1,
+       "Substitution rate from nucleotide A to nucleotide T":0.2647746107611847,
+       "Substitution rate from nucleotide C to nucleotide G":0.4917423221832032,
+       "Substitution rate from nucleotide C to nucleotide T":1.02837595903795,
+       "Substitution rate from nucleotide G to nucleotide T":0.304509117524575
+      },
+     "display order":0,
+     "estimated parameters":24
+    },
+   "RELAX alternative":{
+     "AIC-c":6901.392449196474,
+     "Log Likelihood":-3408.754211469135,
+     "Rate Distributions":{
+       "Reference":{
+         "0":{
+           "omega":0,
+           "proportion":0.3814061972635792
+          },
+         "1":{
+           "omega":0.4330262245823013,
+           "proportion":0
+          },
+         "2":{
+           "omega":2.405594515133199,
+           "proportion":0.6185938027364208
+          }
+        },
+       "Synonymous site-to-site rates":{
+         "0":{
+           "proportion":0.2800901562602482,
+           "rate":0.2837970682663188
+          },
+         "1":{
+           "proportion":0.6272754947629234,
+           "rate":0.9947075941569237
+          },
+         "2":{
+           "proportion":0.09263434897682828,
+           "rate":3.20135608237551
+          }
+        },
+       "Test":{
+         "0":{
+           "omega":0,
+           "proportion":0.3814061972635792
+          },
+         "1":{
+           "omega":0.9999750044281671,
+           "proportion":0
+          },
+         "2":{
+           "omega":1.00002621592498,
+           "proportion":0.6185938027364208
+          }
+        }
+      },
+     "display order":2,
+     "estimated parameters":41
+    },
+   "RELAX null":{
+     "AIC-c":6910.777215627525,
+     "Log Likelihood":-3414.491942969586,
+     "Rate Distributions":{
+       "Reference":{
+         "0":{
+           "omega":0,
+           "proportion":0.04600287725570656
+          },
+         "1":{
+           "omega":0,
+           "proportion":0.3432466763494891
+          },
+         "2":{
+           "omega":1.896477292815783,
+           "proportion":0.6107504463948045
+          }
+        },
+       "Synonymous site-to-site rates":{
+         "0":{
+           "proportion":0.2641095265325168,
+           "rate":0.2744837794048847
+          },
+         "1":{
+           "proportion":0.6330324513232739,
+           "rate":0.9729462345446451
+          },
+         "2":{
+           "proportion":0.1028580221442092,
+           "rate":3.029415427453047
+          }
+        },
+       "Test":{
+         "0":{
+           "omega":0,
+           "proportion":0.04600287725570656
+          },
+         "1":{
+           "omega":0,
+           "proportion":0.3432466763494891
+          },
+         "2":{
+           "omega":1.896477292815783,
+           "proportion":0.6107504463948045
+          }
+        }
+      },
+     "display order":3,
+     "estimated parameters":40
+    },
+   "RELAX partitioned descriptive":{
+     "AIC-c":6909.42794543134,
+     "Log Likelihood":-3408.579104294618,
+     "Rate Distributions":{
+       "Reference":{
+         "0":{
+           "omega":0.05035684771569529,
+           "proportion":0.3805224005150026
+          },
+         "1":{
+           "omega":0.07013486723985318,
+           "proportion":0.003462124163764896
+          },
+         "2":{
+           "omega":2.344944921144001,
+           "proportion":0.6160154753212325
+          }
+        },
+       "Test":{
+         "0":{
+           "omega":0,
+           "proportion":0.03160127773820932
+          },
+         "1":{
+           "omega":0,
+           "proportion":0.4079248249859382
+          },
+         "2":{
+           "omega":1.11269394570475,
+           "proportion":0.5604738972758525
+          }
+        }
+      },
+     "display order":5,
+     "estimated parameters":45
+    }
+  },
+ "input":{
+   "file name":"/tmp/tmpbauyxvdv/job_working_directory/000/5/working/./input.nex",
+   "number of sequences":10,
+   "number of sites":187,
+   "partition count":1,
+   "trees":{
+     "0":"((((PIG:0.147969,COW:0.21343)Node3:0.08509899999999999,HORSE:0.165787,CAT:0.264806)Node2:0.058611,((RHMONKEY:0.002015,BABOON:0.003108)Node9:0.022733,(HUMAN:0.004349,CHIMP:0.000799)Node12:0.011873)Node8:0.101856)Node1:0.340802,RAT:0.050958,MOUSE:0.09795)"
+    }
+  },
+ "test results":{
+   "LRT":11.47546300090198,
+   "p-value":0.0007052107640865835,
+   "relaxation or intensification parameter":2.986519568748539e-05
+  },
+ "tested":{
+   "0":{
+     "BABOON":"Test",
+     "CAT":"Reference",
+     "CHIMP":"Test",
+     "COW":"Reference",
+     "HORSE":"Reference",
+     "HUMAN":"Test",
+     "MOUSE":"Reference",
+     "Node1":"Test",
+     "Node12":"Test",
+     "Node2":"Reference",
+     "Node3":"Reference",
+     "Node8":"Test",
+     "Node9":"Test",
+     "PIG":"Reference",
+     "RAT":"Reference",
+     "RHMONKEY":"Test"
+    }
+  },
+ "timers":{
+   "General descriptive model fitting":{
+     "order":2,
+     "timer":127
+    },
+   "Overall":{
+     "order":0,
+     "timer":645
+    },
+   "Preliminary model fitting":{
+     "order":1,
+     "timer":8
+    },
+   "RELAX alternative model fitting":{
+     "order":3,
+     "timer":178
+    },
+   "RELAX null model fitting":{
+     "order":4,
+     "timer":115
+    },
+   "RELAX partitioned descriptive":{
+     "order":5,
+     "timer":216
+    }
+  }
+}
\ No newline at end of file
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/relax-out2-2.json	Tue Apr 27 18:07:06 2021 +0000
@@ -0,0 +1,3427 @@
+#NEXUS
+
+BEGIN TAXA;
+	DIMENSIONS NTAX = 10;
+	TAXLABELS
+		'HUMAN' 'CHIMP' 'BABOON' 'RHMONKEY' 'COW' 'PIG' 'HORSE' 'CAT' 'MOUSE' 'RAT' ;
+END;
+
+BEGIN CHARACTERS;
+	DIMENSIONS NCHAR = 561;
+	FORMAT
+		DATATYPE = DNA
+		GAP=-
+		MISSING=?
+	;
+
+MATRIX
+	'HUMAN'    AAAGAGATTACGAATGCCTTGGAAACCTGGGGTGCCTTGGGTCAGGACATCAACTTGGACATTCCTAGTTTTCAAATGAGTGATGATATTGACGATATAAAATGGGAAAAAACTTCAGACAAGAAAAAGATTGCACAATTCAGAAAAGAGAAAGAGACTTTCAAGGAAAAAGATACATATAAGCTATTTAAAAATGGAACTCTGAAAATTAAGCAT---CTGAAGACCGATGATCAGGATATCTACAAGGTATCAATATATGATACAAAAGGAAAAAATGTGTTGGAAAAAATATTTGATTTGAAGATTCAAGAGAGGGTCTCAAAACCAAAGATCTCCTGGACTTGTATCAACACAACCCTGACCTGTGAGGTAATGAATGGAACTGACCCCGAATTAAACCTGTATCAAGATGGGAAACATCTAAAA---CTTTCTCAGAGGGTCATCACACACAAGTGGACCACCAGCCTGAGTGCAAAATTCAAGTGCACAGCAGGGAACAAAGTCAGCAAGGAATCCAGTGTCGAGCCTGTCAGCTGTCCAGAGAAAGGTCTGGAC
+	'CHIMP'    GAAGAGATTACGAATGCCTTGGAAACCTGGGGTGCCTTGGGTCAGGACATCAACTTGGACATTCCTAGTTTTCAAATGAGTGATGATATTGACGATATAAAATGGGAAAAAACTTCAGACAAGAAAAAGATTGCACAATTCAGAAAAGAGAAAGAGACTTTCAAGGAAAAAGATACATATAAGCTATTTAAAAATGGAACTCTGAAAATTAAGCAT---CTGAAGACCGATGATCAGGATATCTACAAGGTATCAATATATGATACAAAAGGAAAAAATGTGTTGGAAAAAATATTTGATTTGAAGATTCAAGAGAGGGTCTCAAAACCAAAGATCTCCTGGACTTGTATCAACACAACCCTGACCTGTGAGGTAATGAATGGAACTGACCCCGAATTAAACCTGTATCAAGATGGGAAACATCTAAAA---CTTTCTCAGAGGGTCATCACACACAAGTGGACCACCAGCCTGAGTGCAAAATTCAAGTGCACAGCAGGGAACAAAGTCAGCAAGGAATCCAGTGTCGAGCCTGTCAGCTGTCCAGAGAAAGGTCTGGAC
+	'BABOON'   AAAGAGATTAGGAATGCTTTGGAAACCTGGGGAGCGCTGGGTCAGGACATCGACTTGGACATTCCTAGTTTTCAAATGAGTGATGATATTGATGATATAAAATGGGAGAAAACTTCAGACAAGAAAAAGATTGCACAATTCAGAAAAGAGAAGGAGACTTTCGAGGAAAAAGATGCATATAAGCTATTTAAAAACGGAACTCTGAAAATTAAGCAT---CTGAAGATCCATGATCAGGATAGCTACAAGGTATCAATATACGATACAAAAGGAAAAAATGTGTTGGAAAAAACATTTGATTTGAAGATTCAAGAGAGGGTCTCAGAACCAAAGATCTCCTGGACTTGTATCAACACAACCCTGACCTGTGAAGTAATGAATGGAACTGACCCCGAATTAAACCTGTATCAAGATGGGAAACATCTAAAA---CTTTCTCAGAGGGTCATCACACACAAGTGGACCACCAGCCTGAGTGCGAAATTCAAGTGCACAGCAGGGAACAAAGTCAGCAAGGAATCCAGGATGGAGACTGTCAGCTGTCCAGAGAAAGGTCTGGAC
+	'RHMONKEY' AAAGAGATTAGGAATGCTTTGGAAACCTGGGGAGCGCTGGGTCAGGACATCGACTTGGACATTCCTAGTTTTCAAATGAGTGATGATATTGATGATATAAGATGGGAAAAAACTTCAGACAAGAAAAAGATTGCACAATTCAGAAAAGAGAAGGAGACTTTCGAGGAAAAAGATGCATATAAGCTATTTAAAAACGGAACTCTGAAAAYTAAGCAT---CTGAAGATCCATGATCAGGATAGCTACAAGGTATCAATATACGATACAAAAGGAAAAAATGTGTTGGAAAAAACATTTGATTTGAAGATTCAAGAGAGGGTCTCAGAACCAAAGATCTCCTGGACTTGTATCAACACAACCCTGACCTGTGAAGTAATGAATGGAACTGRCCCCGAATTAAACCTGTATCAAGATGGGAAACATGTAAAA---CTTTCTCAGAGGGTCATCACACACAAGTGGACCACCAGCCTGAGTGCGAAATTCAAGTGCACAGCAGGGAACAAAGTCAGCAAGGAATCCAGGATGGAGACTGTCAGCTGTCCAGAGAAAGGTCTGGAC
+	'COW'      ------------GAAAGCATTGTCGTCTGGGGTGCCCTGGATCATGACCTCAACCTGGACATTCCTGGTTTTCCAAGAAGTGATATAGTGGCAGATATAAAATGGAACAGA------AACAAAAACAAGATTGCACGAATAAAGAAAGATATGCCACTTCACAATGAAATGGACAAATATGATATGTTTACAAATGGAACTCTGAAAATTAAAACT---CTGATGAGAAACGATAGTGGTCTCTATGAGGTAGAGGTTTATGATTCAAATGGAGTAAACCTACTGAGCAAAAAATTTGATTTGAAGATTCAAGAGATGCTCTCAGGACCTGAAATTAACTGGATCTGTACCAACAGAACTGTGAGCTGCAAGGTAGAAAATGGAAGTAATCCTAAATTACAACTGTTTTTAAATACGACCCGTGTCAAACAAGATCATGGGAAGCTCATCACCTACACGTGGAACACCAGATGGAATAAAACATTCAAGTGCGTGGCGAGTAACCATGTCGATAGCAAAGTCAGCATAGAGATCGCCGTGTGTCCAGATGAAGGTCTGGAT
+	'PIG'      ---------------ACTGAGGTTGTCTGGGGCATCGTGGATCAAGACATCAACCTGGACATTCCTGAACTTTCAAAACATGATAACGTAGATCATATACGATGGCAGAAG------AATGAAAACAAGATCGCAGAATTTAAAAAAAACAAAGAAACTCACCCTGTGAAAGACACATACATGATGTTACCAAATGGAACTCTGAGAATTAAAGAT---CTGAAGAGAGATGATGAGGGTATCTACAAGGTAACTGTCTATGCTACGGATGGAAAACACATGCTGGAGAGAAAATTTGATTTGCCGATTCTAGATGGGGTCTCAAAACCTGTAATCTCCTGGAGCTGTGCCGACAAAACGGTGACCTGTGAGGTAGCAGAAGGAAGTGACCCTAAGTTAAAACTGTATGTAAATAAGTCCACTGCCAGAGAAGGTCGTCAGAAGGTCATCCTGTGGAAGTGGAACACCAAATGGAGCACATTATTCAAGTGTGTGGCCAGTAACAACGCCAGTGAGCAAATCAGCATGGTGACCATCAGTTGTACGGGGCAAGGTCTGGAT
+	'HORSE'    ------------AAGAATATCACCATCTTGGGTGCCCTGGAACGTGATATCAACCTGGACATTCCTGCTTTTCAAATGAGTGAGCATGTAGAAGATATACAATGGAGCAAA------GGAAAAACCAAGATTGCAAAATTCAAAAATGGCAGTATGACTTTCCAGAAAGATAAAACATACGAGGTATTAAAAAATGGAACTCTGAAAATTAAACAT---CTGGAGAGAATTCATGAAGGTACCTACAAGGTAGACGCATATGATAGTGATGGAAAAAATGTGTTGGAGGAAACATTTCATTTGAGCCTTCTAGAGATGGTCTCAAAACCTAATATCTCCTGGAGCTGCACCAACACCACCCTGACCTGCGAGGTGACAAAAGGAACTGACTTTGAGTTAAAACTCTATCTAAATGGGAGAATGATCCAAAAAAGTCCTCGCAAAGTCATCGTATACAAGCGGGCCAGCAACCAAATTGCGTCCTTCAAGTGCACAGCCAATAACACAGTCAGCGAGGAAAGCAGCTCTGTGGTCATCAGGTGTACAGAGAAAGGTCTGGAT
+	'CAT'      ---------GCAAATGATGATATCGTCTGGGGTACCCTGGGTCAGGACATCAACCTGGACATTCCTGATTCTCAA---GGGATTAATATAGATGATATACACTGGGAAAAA------GGCAAGAAGAAGGTGGCGAGGTTCCAAATTAGCAACAAGCCTAAGAATCCAGATGAAAAATATAATGTGTCAATGAATGGAACTCTGAAAATTAAACAT---CTGATGCTAGAAGACTGCGATACCTACAAGGTTGTTATATACGATAAGGATGGAAAGAATGTGTTGGATAAAACATTTCAGCTGAAGATTCAAGAGAAGGTCTCAACGCCTAACATCGACTGGAATTGTATCAACAAAACCCTGGTCTGTAAGGTATCAAATGGAACAGACCCTGAATTAAAACTGTACGTAAATGGGACCAGTATCAAGCCCGTTTCTTCGAAGTTCAGCACATACAGGTTTATAAACAAGCAGAAGATATTAGTCAACTGCACGGCAGAAAACAAAGTCAGCAAGGAAAGCGACGTGAAGATGATCACTTGTTCAGAGAAGGGTCTGGAC
+	'MOUSE'    ---------AGAGACAATGAGACCATCTGGGGTGTCTTGGGTCATGGCATCACCCTGAACATCCCCAACTTTCAAATGACTGATGATATTGATGAGGTGCGATGGGTAAGG------AGGGGCACCCTGGTCGCAGAGTTTAAAAGGAAGAAGCCACCTTTTTTGATATCAGAAACGTATGAGGTCTTAGCAAACGGATCCCTGAAGATAAAGAAGCCGATGATGAGAAACGACAGTGGCACCTATAATGTAATGGTGTATGGCACAAATGGGATGACTAGGCTGGAGAAGGACCTGGACGTGAGGATTCTGGAGAGGGTCTCAAAGCCCATGATCCACTGGGAATGCCCCAACACAACCCTGACCTGTGCGGTCTTGCAAGGGACAGATTTTGAACTGAAGCTGTATCAAGGGGAAACACTACTCAATAGTCTCCCCCAGAAGAACATGAGTTACCAGTGG---ACCAACCTGAACGCACCATTCAAGTGTGAGGCGATAAACCCGGTCAGCAAGGAGTCTAAGATGGAAGTTGTTAACTGTCCAGAGAAAGGTCTGTCC
+	'RAT'      ---------AGAGACAGTGGGACCGTCTGGGGTGCCCTGGGTCATGGCATCAACCTGAACATCCCTAACTTTCAAATGACTGATGATATTGATGAGGTGCGATGGGAGAGG------GGGAGCACCCTGGTTGCCGAGTTTAAAAGGAAGATGAAGCCTTTTTTGAAATCGGGAGCATTTGAGATCTTAGCAAATGGAGACTTGAAGATAAAGAAT---CTGACAAGAGATGACAGTGGCACCTATAATGTAACGGTATACAGCACAAATGGGACACGTATCCTGGACAAGGCACTGGACTTGAGGATTCTAGAGATGGTCTCAAAGCCGATGATCTACTGGGAGTGCAGCAACGCAACCCTGACCTGTGAGGTCTTGGAAGGAACAGATGTTGAACTAAAGCTGTACCAAGGAAAGGAGCATCTCAGGAGCCTCCGTCAGAAGACCATGAGTTACCAGTGG---ACCAACCTGAGAGCACCGTTTAAGTGCAAGGCGGTAAACAGGGTCAGCCAGGAGTCTGAGATGGAAGTTGTCAACTGTCCAGAGAAAGGTCTGCCC;
+END;
+
+BEGIN TREES;
+	TREE tree = ((((PIG:0.147969,COW:0.213430):0.085099,HORSE:0.165787,CAT:0.264806):0.058611,((RHMONKEY{PR}:0.002015,BABOON{PR}:0.003108){PR}:0.022733,(HUMAN{PR}:0.004349,CHIMP{PR}:0.000799){PR}:0.011873){PR}:0.101856){PR}:0.340802,RAT:0.050958,MOUSE:0.097950);
+END;
+
+BEGIN HYPHY;
+
+
+global relax._shared_srv.rv_gdd_weights_0=0.2800901562602482;
+relax._shared_srv.rv_gdd_weights_0:<1;
+global relax._shared_srv.rv_gdd_weights_1=0.8713250696842594;
+relax._shared_srv.rv_gdd_weights_1:<1;
+global relax._shared_srv.rv_gdd_rates_0=0.3376189995051599;
+global relax._shared_srv.rv_gdd_rates_1=1.183353248823191;
+global relax._shared_srv.rv_gdd_rates_2=3.808491201808699;
+global relax.reference.omega1=0;
+relax.reference.omega1:<1;
+global relax.reference.theta_AC=0.5020727351677378;
+global relax.reference.theta_AT=0.2075009146597777;
+global relax.reference.bsrel_mixture_aux_1=0;
+relax.reference.bsrel_mixture_aux_1:<1;
+global relax.reference.omega2=0.4330262245823013;
+relax.reference.omega2:<1;
+global relax.reference.omega3=2.405594515133199;
+relax.reference.omega3:>1;
+relax.reference.omega3:<10000000000;
+global relax.reference.theta_GT=0.2806046300455884;
+global relax.reference.theta_CG=0.4897252395553077;
+global relax.reference.theta_CT=1.086984235984869;
+global relax.reference.bsrel_mixture_aux_0=0.3814061972635792;
+relax.reference.bsrel_mixture_aux_0:<1;
+global relax.K=4.975000000000001;
+relax.K:<50;
+global relax._shared_srv.rv_gdd_norm:=relax._shared_srv.rv_gdd_rates_0*relax._shared_srv.rv_gdd_weights_0+relax._shared_srv.rv_gdd_rates_1*(1-relax._shared_srv.rv_gdd_weights_0)*relax._shared_srv.rv_gdd_weights_1+relax._shared_srv.rv_gdd_rates_2*(1-relax._shared_srv.rv_gdd_weights_0)*(1-relax._shared_srv.rv_gdd_weights_1);
+global relax.reference.theta_AG:=1;
+global relax.test.bsrel_mixture_aux_0:=relax.reference.bsrel_mixture_aux_0;
+relax.test.bsrel_mixture_aux_0:<1;
+global relax.test.omega1:=relax.reference.omega1^relax.K;
+relax.test.omega1:<1;
+global relax.test.theta_AC:=relax.reference.theta_AC;
+global relax.test.theta_AG:=1;
+global relax.test.theta_AT:=relax.reference.theta_AT;
+global relax.test.theta_CG:=relax.reference.theta_CG;
+global relax.test.theta_CT:=relax.reference.theta_CT;
+global relax.test.theta_GT:=relax.reference.theta_GT;
+global relax.test.bsrel_mixture_aux_1:=relax.reference.bsrel_mixture_aux_1;
+relax.test.bsrel_mixture_aux_1:<1;
+global relax.test.omega2:=relax.reference.omega2^relax.K;
+relax.test.omega2:<1;
+global relax.test.omega3:=relax.reference.omega3^relax.K;
+relax.test.omega3:>1;
+relax.test.omega3:<10000000000;
+
+relax._shared_srv.rv_gdd.weights={1,3};
+relax._shared_srv.rv_gdd.weights[0][0]:=1*relax._shared_srv.rv_gdd_weights_0;
+relax._shared_srv.rv_gdd.weights[0][1]:=1*(1-relax._shared_srv.rv_gdd_weights_0)*relax._shared_srv.rv_gdd_weights_1;
+relax._shared_srv.rv_gdd.weights[0][2]:=1*(1-relax._shared_srv.rv_gdd_weights_0)*(1-relax._shared_srv.rv_gdd_weights_1);
+
+
+relax._shared_srv.rv_gdd.points={1,3};
+relax._shared_srv.rv_gdd.points[0][0]:=relax._shared_srv.rv_gdd_rates_0/relax._shared_srv.rv_gdd_norm;
+relax._shared_srv.rv_gdd.points[0][1]:=relax._shared_srv.rv_gdd_rates_1/relax._shared_srv.rv_gdd_norm;
+relax._shared_srv.rv_gdd.points[0][2]:=relax._shared_srv.rv_gdd_rates_2/relax._shared_srv.rv_gdd_norm;
+
+
+category relax._shared_srv.rv_gdd=(3,relax._shared_srv.rv_gdd.weights,MEAN,,relax._shared_srv.rv_gdd.points,0,1,);
+
+relax.reference_Q_component_1={61,61};
+relax.reference_Q_component_1[0][1]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
+relax.reference_Q_component_1[0][2]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
+relax.reference_Q_component_1[0][3]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
+relax.reference_Q_component_1[0][4]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
+relax.reference_Q_component_1[0][8]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
+relax.reference_Q_component_1[0][12]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
+relax.reference_Q_component_1[0][16]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
+relax.reference_Q_component_1[0][32]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
+relax.reference_Q_component_1[1][0]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
+relax.reference_Q_component_1[1][2]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
+relax.reference_Q_component_1[1][3]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_1[1][5]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
+relax.reference_Q_component_1[1][9]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
+relax.reference_Q_component_1[1][13]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
+relax.reference_Q_component_1[1][17]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
+relax.reference_Q_component_1[1][33]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
+relax.reference_Q_component_1[1][48]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
+relax.reference_Q_component_1[2][0]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
+relax.reference_Q_component_1[2][1]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
+relax.reference_Q_component_1[2][3]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
+relax.reference_Q_component_1[2][6]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
+relax.reference_Q_component_1[2][10]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
+relax.reference_Q_component_1[2][14]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
+relax.reference_Q_component_1[2][18]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
+relax.reference_Q_component_1[2][34]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
+relax.reference_Q_component_1[3][0]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
+relax.reference_Q_component_1[3][1]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_1[3][2]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
+relax.reference_Q_component_1[3][7]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
+relax.reference_Q_component_1[3][11]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
+relax.reference_Q_component_1[3][15]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
+relax.reference_Q_component_1[3][19]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
+relax.reference_Q_component_1[3][35]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
+relax.reference_Q_component_1[3][49]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
+relax.reference_Q_component_1[4][0]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
+relax.reference_Q_component_1[4][5]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
+relax.reference_Q_component_1[4][6]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
+relax.reference_Q_component_1[4][7]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
+relax.reference_Q_component_1[4][8]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
+relax.reference_Q_component_1[4][12]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
+relax.reference_Q_component_1[4][20]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
+relax.reference_Q_component_1[4][36]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
+relax.reference_Q_component_1[4][50]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
+relax.reference_Q_component_1[5][1]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
+relax.reference_Q_component_1[5][4]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
+relax.reference_Q_component_1[5][6]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
+relax.reference_Q_component_1[5][7]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_1[5][9]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
+relax.reference_Q_component_1[5][13]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
+relax.reference_Q_component_1[5][21]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
+relax.reference_Q_component_1[5][37]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
+relax.reference_Q_component_1[5][51]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
+relax.reference_Q_component_1[6][2]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
+relax.reference_Q_component_1[6][4]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
+relax.reference_Q_component_1[6][5]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
+relax.reference_Q_component_1[6][7]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
+relax.reference_Q_component_1[6][10]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
+relax.reference_Q_component_1[6][14]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
+relax.reference_Q_component_1[6][22]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
+relax.reference_Q_component_1[6][38]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
+relax.reference_Q_component_1[6][52]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
+relax.reference_Q_component_1[7][3]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
+relax.reference_Q_component_1[7][4]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
+relax.reference_Q_component_1[7][5]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_1[7][6]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
+relax.reference_Q_component_1[7][11]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
+relax.reference_Q_component_1[7][15]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
+relax.reference_Q_component_1[7][23]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
+relax.reference_Q_component_1[7][39]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
+relax.reference_Q_component_1[7][53]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
+relax.reference_Q_component_1[8][0]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
+relax.reference_Q_component_1[8][4]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
+relax.reference_Q_component_1[8][9]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
+relax.reference_Q_component_1[8][10]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
+relax.reference_Q_component_1[8][11]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
+relax.reference_Q_component_1[8][12]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
+relax.reference_Q_component_1[8][24]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
+relax.reference_Q_component_1[8][40]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
+relax.reference_Q_component_1[9][1]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
+relax.reference_Q_component_1[9][5]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
+relax.reference_Q_component_1[9][8]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
+relax.reference_Q_component_1[9][10]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
+relax.reference_Q_component_1[9][11]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_1[9][13]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
+relax.reference_Q_component_1[9][25]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
+relax.reference_Q_component_1[9][41]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
+relax.reference_Q_component_1[9][54]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
+relax.reference_Q_component_1[10][2]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
+relax.reference_Q_component_1[10][6]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
+relax.reference_Q_component_1[10][8]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
+relax.reference_Q_component_1[10][9]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
+relax.reference_Q_component_1[10][11]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
+relax.reference_Q_component_1[10][14]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
+relax.reference_Q_component_1[10][26]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
+relax.reference_Q_component_1[10][42]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
+relax.reference_Q_component_1[10][55]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
+relax.reference_Q_component_1[11][3]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
+relax.reference_Q_component_1[11][7]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
+relax.reference_Q_component_1[11][8]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
+relax.reference_Q_component_1[11][9]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_1[11][10]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
+relax.reference_Q_component_1[11][15]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
+relax.reference_Q_component_1[11][27]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
+relax.reference_Q_component_1[11][43]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
+relax.reference_Q_component_1[11][56]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
+relax.reference_Q_component_1[12][0]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
+relax.reference_Q_component_1[12][4]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
+relax.reference_Q_component_1[12][8]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
+relax.reference_Q_component_1[12][13]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
+relax.reference_Q_component_1[12][14]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
+relax.reference_Q_component_1[12][15]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
+relax.reference_Q_component_1[12][28]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
+relax.reference_Q_component_1[12][44]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
+relax.reference_Q_component_1[12][57]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
+relax.reference_Q_component_1[13][1]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
+relax.reference_Q_component_1[13][5]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
+relax.reference_Q_component_1[13][9]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
+relax.reference_Q_component_1[13][12]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
+relax.reference_Q_component_1[13][14]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
+relax.reference_Q_component_1[13][15]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_1[13][29]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
+relax.reference_Q_component_1[13][45]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
+relax.reference_Q_component_1[13][58]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
+relax.reference_Q_component_1[14][2]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
+relax.reference_Q_component_1[14][6]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
+relax.reference_Q_component_1[14][10]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
+relax.reference_Q_component_1[14][12]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
+relax.reference_Q_component_1[14][13]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
+relax.reference_Q_component_1[14][15]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
+relax.reference_Q_component_1[14][30]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
+relax.reference_Q_component_1[14][46]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
+relax.reference_Q_component_1[14][59]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
+relax.reference_Q_component_1[15][3]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
+relax.reference_Q_component_1[15][7]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
+relax.reference_Q_component_1[15][11]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
+relax.reference_Q_component_1[15][12]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
+relax.reference_Q_component_1[15][13]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_1[15][14]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
+relax.reference_Q_component_1[15][31]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
+relax.reference_Q_component_1[15][47]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
+relax.reference_Q_component_1[15][60]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
+relax.reference_Q_component_1[16][0]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
+relax.reference_Q_component_1[16][17]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
+relax.reference_Q_component_1[16][18]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
+relax.reference_Q_component_1[16][19]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
+relax.reference_Q_component_1[16][20]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
+relax.reference_Q_component_1[16][24]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
+relax.reference_Q_component_1[16][28]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
+relax.reference_Q_component_1[16][32]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
+relax.reference_Q_component_1[17][1]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
+relax.reference_Q_component_1[17][16]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
+relax.reference_Q_component_1[17][18]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
+relax.reference_Q_component_1[17][19]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_1[17][21]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
+relax.reference_Q_component_1[17][25]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
+relax.reference_Q_component_1[17][29]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
+relax.reference_Q_component_1[17][33]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
+relax.reference_Q_component_1[17][48]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
+relax.reference_Q_component_1[18][2]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
+relax.reference_Q_component_1[18][16]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
+relax.reference_Q_component_1[18][17]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
+relax.reference_Q_component_1[18][19]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
+relax.reference_Q_component_1[18][22]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
+relax.reference_Q_component_1[18][26]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
+relax.reference_Q_component_1[18][30]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
+relax.reference_Q_component_1[18][34]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
+relax.reference_Q_component_1[19][3]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
+relax.reference_Q_component_1[19][16]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
+relax.reference_Q_component_1[19][17]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_1[19][18]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
+relax.reference_Q_component_1[19][23]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
+relax.reference_Q_component_1[19][27]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
+relax.reference_Q_component_1[19][31]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
+relax.reference_Q_component_1[19][35]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
+relax.reference_Q_component_1[19][49]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
+relax.reference_Q_component_1[20][4]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
+relax.reference_Q_component_1[20][16]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
+relax.reference_Q_component_1[20][21]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
+relax.reference_Q_component_1[20][22]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
+relax.reference_Q_component_1[20][23]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
+relax.reference_Q_component_1[20][24]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
+relax.reference_Q_component_1[20][28]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
+relax.reference_Q_component_1[20][36]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
+relax.reference_Q_component_1[20][50]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
+relax.reference_Q_component_1[21][5]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
+relax.reference_Q_component_1[21][17]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
+relax.reference_Q_component_1[21][20]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
+relax.reference_Q_component_1[21][22]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
+relax.reference_Q_component_1[21][23]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_1[21][25]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
+relax.reference_Q_component_1[21][29]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
+relax.reference_Q_component_1[21][37]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
+relax.reference_Q_component_1[21][51]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
+relax.reference_Q_component_1[22][6]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
+relax.reference_Q_component_1[22][18]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
+relax.reference_Q_component_1[22][20]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
+relax.reference_Q_component_1[22][21]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
+relax.reference_Q_component_1[22][23]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
+relax.reference_Q_component_1[22][26]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
+relax.reference_Q_component_1[22][30]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
+relax.reference_Q_component_1[22][38]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
+relax.reference_Q_component_1[22][52]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
+relax.reference_Q_component_1[23][7]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
+relax.reference_Q_component_1[23][19]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
+relax.reference_Q_component_1[23][20]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
+relax.reference_Q_component_1[23][21]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_1[23][22]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
+relax.reference_Q_component_1[23][27]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
+relax.reference_Q_component_1[23][31]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
+relax.reference_Q_component_1[23][39]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
+relax.reference_Q_component_1[23][53]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
+relax.reference_Q_component_1[24][8]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
+relax.reference_Q_component_1[24][16]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
+relax.reference_Q_component_1[24][20]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
+relax.reference_Q_component_1[24][25]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
+relax.reference_Q_component_1[24][26]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
+relax.reference_Q_component_1[24][27]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
+relax.reference_Q_component_1[24][28]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
+relax.reference_Q_component_1[24][40]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
+relax.reference_Q_component_1[25][9]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
+relax.reference_Q_component_1[25][17]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
+relax.reference_Q_component_1[25][21]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
+relax.reference_Q_component_1[25][24]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
+relax.reference_Q_component_1[25][26]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
+relax.reference_Q_component_1[25][27]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_1[25][29]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
+relax.reference_Q_component_1[25][41]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
+relax.reference_Q_component_1[25][54]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
+relax.reference_Q_component_1[26][10]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
+relax.reference_Q_component_1[26][18]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
+relax.reference_Q_component_1[26][22]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
+relax.reference_Q_component_1[26][24]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
+relax.reference_Q_component_1[26][25]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
+relax.reference_Q_component_1[26][27]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
+relax.reference_Q_component_1[26][30]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
+relax.reference_Q_component_1[26][42]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
+relax.reference_Q_component_1[26][55]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
+relax.reference_Q_component_1[27][11]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
+relax.reference_Q_component_1[27][19]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
+relax.reference_Q_component_1[27][23]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
+relax.reference_Q_component_1[27][24]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
+relax.reference_Q_component_1[27][25]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_1[27][26]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
+relax.reference_Q_component_1[27][31]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
+relax.reference_Q_component_1[27][43]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
+relax.reference_Q_component_1[27][56]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
+relax.reference_Q_component_1[28][12]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
+relax.reference_Q_component_1[28][16]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
+relax.reference_Q_component_1[28][20]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
+relax.reference_Q_component_1[28][24]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
+relax.reference_Q_component_1[28][29]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
+relax.reference_Q_component_1[28][30]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
+relax.reference_Q_component_1[28][31]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
+relax.reference_Q_component_1[28][44]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
+relax.reference_Q_component_1[28][57]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_1[29][13]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
+relax.reference_Q_component_1[29][17]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
+relax.reference_Q_component_1[29][21]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
+relax.reference_Q_component_1[29][25]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
+relax.reference_Q_component_1[29][28]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
+relax.reference_Q_component_1[29][30]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
+relax.reference_Q_component_1[29][31]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_1[29][45]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
+relax.reference_Q_component_1[29][58]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
+relax.reference_Q_component_1[30][14]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
+relax.reference_Q_component_1[30][18]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
+relax.reference_Q_component_1[30][22]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
+relax.reference_Q_component_1[30][26]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
+relax.reference_Q_component_1[30][28]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
+relax.reference_Q_component_1[30][29]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
+relax.reference_Q_component_1[30][31]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
+relax.reference_Q_component_1[30][46]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
+relax.reference_Q_component_1[30][59]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_1[31][15]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
+relax.reference_Q_component_1[31][19]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
+relax.reference_Q_component_1[31][23]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
+relax.reference_Q_component_1[31][27]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
+relax.reference_Q_component_1[31][28]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
+relax.reference_Q_component_1[31][29]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_1[31][30]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
+relax.reference_Q_component_1[31][47]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
+relax.reference_Q_component_1[31][60]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
+relax.reference_Q_component_1[32][0]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
+relax.reference_Q_component_1[32][16]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
+relax.reference_Q_component_1[32][33]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
+relax.reference_Q_component_1[32][34]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
+relax.reference_Q_component_1[32][35]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
+relax.reference_Q_component_1[32][36]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
+relax.reference_Q_component_1[32][40]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
+relax.reference_Q_component_1[32][44]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
+relax.reference_Q_component_1[33][1]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
+relax.reference_Q_component_1[33][17]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
+relax.reference_Q_component_1[33][32]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
+relax.reference_Q_component_1[33][34]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
+relax.reference_Q_component_1[33][35]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_1[33][37]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
+relax.reference_Q_component_1[33][41]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
+relax.reference_Q_component_1[33][45]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
+relax.reference_Q_component_1[33][48]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
+relax.reference_Q_component_1[34][2]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
+relax.reference_Q_component_1[34][18]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
+relax.reference_Q_component_1[34][32]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
+relax.reference_Q_component_1[34][33]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
+relax.reference_Q_component_1[34][35]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
+relax.reference_Q_component_1[34][38]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
+relax.reference_Q_component_1[34][42]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
+relax.reference_Q_component_1[34][46]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
+relax.reference_Q_component_1[35][3]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
+relax.reference_Q_component_1[35][19]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
+relax.reference_Q_component_1[35][32]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
+relax.reference_Q_component_1[35][33]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_1[35][34]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
+relax.reference_Q_component_1[35][39]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
+relax.reference_Q_component_1[35][43]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
+relax.reference_Q_component_1[35][47]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
+relax.reference_Q_component_1[35][49]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
+relax.reference_Q_component_1[36][4]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
+relax.reference_Q_component_1[36][20]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
+relax.reference_Q_component_1[36][32]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
+relax.reference_Q_component_1[36][37]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
+relax.reference_Q_component_1[36][38]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
+relax.reference_Q_component_1[36][39]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
+relax.reference_Q_component_1[36][40]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
+relax.reference_Q_component_1[36][44]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
+relax.reference_Q_component_1[36][50]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
+relax.reference_Q_component_1[37][5]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
+relax.reference_Q_component_1[37][21]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
+relax.reference_Q_component_1[37][33]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
+relax.reference_Q_component_1[37][36]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
+relax.reference_Q_component_1[37][38]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
+relax.reference_Q_component_1[37][39]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_1[37][41]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
+relax.reference_Q_component_1[37][45]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
+relax.reference_Q_component_1[37][51]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
+relax.reference_Q_component_1[38][6]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
+relax.reference_Q_component_1[38][22]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
+relax.reference_Q_component_1[38][34]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
+relax.reference_Q_component_1[38][36]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
+relax.reference_Q_component_1[38][37]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
+relax.reference_Q_component_1[38][39]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
+relax.reference_Q_component_1[38][42]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
+relax.reference_Q_component_1[38][46]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
+relax.reference_Q_component_1[38][52]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
+relax.reference_Q_component_1[39][7]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
+relax.reference_Q_component_1[39][23]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
+relax.reference_Q_component_1[39][35]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
+relax.reference_Q_component_1[39][36]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
+relax.reference_Q_component_1[39][37]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_1[39][38]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
+relax.reference_Q_component_1[39][43]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
+relax.reference_Q_component_1[39][47]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
+relax.reference_Q_component_1[39][53]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
+relax.reference_Q_component_1[40][8]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
+relax.reference_Q_component_1[40][24]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
+relax.reference_Q_component_1[40][32]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
+relax.reference_Q_component_1[40][36]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
+relax.reference_Q_component_1[40][41]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
+relax.reference_Q_component_1[40][42]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
+relax.reference_Q_component_1[40][43]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
+relax.reference_Q_component_1[40][44]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
+relax.reference_Q_component_1[41][9]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
+relax.reference_Q_component_1[41][25]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
+relax.reference_Q_component_1[41][33]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
+relax.reference_Q_component_1[41][37]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
+relax.reference_Q_component_1[41][40]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
+relax.reference_Q_component_1[41][42]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
+relax.reference_Q_component_1[41][43]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_1[41][45]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
+relax.reference_Q_component_1[41][54]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
+relax.reference_Q_component_1[42][10]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
+relax.reference_Q_component_1[42][26]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
+relax.reference_Q_component_1[42][34]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
+relax.reference_Q_component_1[42][38]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
+relax.reference_Q_component_1[42][40]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
+relax.reference_Q_component_1[42][41]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
+relax.reference_Q_component_1[42][43]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
+relax.reference_Q_component_1[42][46]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
+relax.reference_Q_component_1[42][55]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
+relax.reference_Q_component_1[43][11]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
+relax.reference_Q_component_1[43][27]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
+relax.reference_Q_component_1[43][35]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
+relax.reference_Q_component_1[43][39]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
+relax.reference_Q_component_1[43][40]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
+relax.reference_Q_component_1[43][41]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_1[43][42]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
+relax.reference_Q_component_1[43][47]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
+relax.reference_Q_component_1[43][56]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
+relax.reference_Q_component_1[44][12]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
+relax.reference_Q_component_1[44][28]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
+relax.reference_Q_component_1[44][32]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
+relax.reference_Q_component_1[44][36]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
+relax.reference_Q_component_1[44][40]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
+relax.reference_Q_component_1[44][45]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
+relax.reference_Q_component_1[44][46]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
+relax.reference_Q_component_1[44][47]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
+relax.reference_Q_component_1[44][57]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
+relax.reference_Q_component_1[45][13]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
+relax.reference_Q_component_1[45][29]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
+relax.reference_Q_component_1[45][33]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
+relax.reference_Q_component_1[45][37]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
+relax.reference_Q_component_1[45][41]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
+relax.reference_Q_component_1[45][44]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
+relax.reference_Q_component_1[45][46]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
+relax.reference_Q_component_1[45][47]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_1[45][58]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
+relax.reference_Q_component_1[46][14]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
+relax.reference_Q_component_1[46][30]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
+relax.reference_Q_component_1[46][34]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
+relax.reference_Q_component_1[46][38]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
+relax.reference_Q_component_1[46][42]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
+relax.reference_Q_component_1[46][44]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
+relax.reference_Q_component_1[46][45]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
+relax.reference_Q_component_1[46][47]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
+relax.reference_Q_component_1[46][59]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
+relax.reference_Q_component_1[47][15]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
+relax.reference_Q_component_1[47][31]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
+relax.reference_Q_component_1[47][35]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
+relax.reference_Q_component_1[47][39]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
+relax.reference_Q_component_1[47][43]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
+relax.reference_Q_component_1[47][44]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
+relax.reference_Q_component_1[47][45]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_1[47][46]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
+relax.reference_Q_component_1[47][60]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
+relax.reference_Q_component_1[48][1]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
+relax.reference_Q_component_1[48][17]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
+relax.reference_Q_component_1[48][33]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
+relax.reference_Q_component_1[48][49]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_1[48][51]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
+relax.reference_Q_component_1[48][54]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
+relax.reference_Q_component_1[48][58]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
+relax.reference_Q_component_1[49][3]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
+relax.reference_Q_component_1[49][19]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
+relax.reference_Q_component_1[49][35]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
+relax.reference_Q_component_1[49][48]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_1[49][53]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
+relax.reference_Q_component_1[49][56]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
+relax.reference_Q_component_1[49][60]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
+relax.reference_Q_component_1[50][4]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
+relax.reference_Q_component_1[50][20]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
+relax.reference_Q_component_1[50][36]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
+relax.reference_Q_component_1[50][51]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
+relax.reference_Q_component_1[50][52]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
+relax.reference_Q_component_1[50][53]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
+relax.reference_Q_component_1[50][57]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
+relax.reference_Q_component_1[51][5]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
+relax.reference_Q_component_1[51][21]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
+relax.reference_Q_component_1[51][37]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
+relax.reference_Q_component_1[51][48]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
+relax.reference_Q_component_1[51][50]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
+relax.reference_Q_component_1[51][52]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
+relax.reference_Q_component_1[51][53]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_1[51][54]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
+relax.reference_Q_component_1[51][58]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
+relax.reference_Q_component_1[52][6]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
+relax.reference_Q_component_1[52][22]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
+relax.reference_Q_component_1[52][38]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
+relax.reference_Q_component_1[52][50]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
+relax.reference_Q_component_1[52][51]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
+relax.reference_Q_component_1[52][53]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
+relax.reference_Q_component_1[52][55]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
+relax.reference_Q_component_1[52][59]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
+relax.reference_Q_component_1[53][7]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
+relax.reference_Q_component_1[53][23]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
+relax.reference_Q_component_1[53][39]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
+relax.reference_Q_component_1[53][49]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
+relax.reference_Q_component_1[53][50]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
+relax.reference_Q_component_1[53][51]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_1[53][52]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
+relax.reference_Q_component_1[53][56]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
+relax.reference_Q_component_1[53][60]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
+relax.reference_Q_component_1[54][9]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
+relax.reference_Q_component_1[54][25]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
+relax.reference_Q_component_1[54][41]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
+relax.reference_Q_component_1[54][48]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
+relax.reference_Q_component_1[54][51]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
+relax.reference_Q_component_1[54][55]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
+relax.reference_Q_component_1[54][56]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_1[54][58]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
+relax.reference_Q_component_1[55][10]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
+relax.reference_Q_component_1[55][26]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
+relax.reference_Q_component_1[55][42]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
+relax.reference_Q_component_1[55][52]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
+relax.reference_Q_component_1[55][54]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
+relax.reference_Q_component_1[55][56]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
+relax.reference_Q_component_1[55][59]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
+relax.reference_Q_component_1[56][11]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
+relax.reference_Q_component_1[56][27]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
+relax.reference_Q_component_1[56][43]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
+relax.reference_Q_component_1[56][49]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AG;
+relax.reference_Q_component_1[56][53]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
+relax.reference_Q_component_1[56][54]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_1[56][55]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
+relax.reference_Q_component_1[56][60]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
+relax.reference_Q_component_1[57][12]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
+relax.reference_Q_component_1[57][28]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_1[57][44]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
+relax.reference_Q_component_1[57][50]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
+relax.reference_Q_component_1[57][58]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
+relax.reference_Q_component_1[57][59]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
+relax.reference_Q_component_1[57][60]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
+relax.reference_Q_component_1[58][13]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
+relax.reference_Q_component_1[58][29]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
+relax.reference_Q_component_1[58][45]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
+relax.reference_Q_component_1[58][48]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
+relax.reference_Q_component_1[58][51]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
+relax.reference_Q_component_1[58][54]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
+relax.reference_Q_component_1[58][57]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AC;
+relax.reference_Q_component_1[58][59]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
+relax.reference_Q_component_1[58][60]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_1[59][14]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
+relax.reference_Q_component_1[59][30]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_1[59][46]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
+relax.reference_Q_component_1[59][52]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
+relax.reference_Q_component_1[59][55]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
+relax.reference_Q_component_1[59][57]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
+relax.reference_Q_component_1[59][58]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CG;
+relax.reference_Q_component_1[59][60]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
+relax.reference_Q_component_1[60][15]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
+relax.reference_Q_component_1[60][31]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
+relax.reference_Q_component_1[60][47]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
+relax.reference_Q_component_1[60][49]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
+relax.reference_Q_component_1[60][53]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_CT;
+relax.reference_Q_component_1[60][56]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
+relax.reference_Q_component_1[60][57]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_AT;
+relax.reference_Q_component_1[60][58]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_1[60][59]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.omega1*relax.reference.theta_GT;
+
+
+relax.reference_Q_component_2={61,61};
+relax.reference_Q_component_2[0][1]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
+relax.reference_Q_component_2[0][2]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
+relax.reference_Q_component_2[0][3]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
+relax.reference_Q_component_2[0][4]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
+relax.reference_Q_component_2[0][8]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
+relax.reference_Q_component_2[0][12]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
+relax.reference_Q_component_2[0][16]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
+relax.reference_Q_component_2[0][32]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
+relax.reference_Q_component_2[1][0]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
+relax.reference_Q_component_2[1][2]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
+relax.reference_Q_component_2[1][3]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_2[1][5]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
+relax.reference_Q_component_2[1][9]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
+relax.reference_Q_component_2[1][13]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
+relax.reference_Q_component_2[1][17]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
+relax.reference_Q_component_2[1][33]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
+relax.reference_Q_component_2[1][48]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
+relax.reference_Q_component_2[2][0]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
+relax.reference_Q_component_2[2][1]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
+relax.reference_Q_component_2[2][3]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
+relax.reference_Q_component_2[2][6]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
+relax.reference_Q_component_2[2][10]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
+relax.reference_Q_component_2[2][14]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
+relax.reference_Q_component_2[2][18]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
+relax.reference_Q_component_2[2][34]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
+relax.reference_Q_component_2[3][0]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
+relax.reference_Q_component_2[3][1]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_2[3][2]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
+relax.reference_Q_component_2[3][7]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
+relax.reference_Q_component_2[3][11]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
+relax.reference_Q_component_2[3][15]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
+relax.reference_Q_component_2[3][19]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
+relax.reference_Q_component_2[3][35]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
+relax.reference_Q_component_2[3][49]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
+relax.reference_Q_component_2[4][0]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
+relax.reference_Q_component_2[4][5]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
+relax.reference_Q_component_2[4][6]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
+relax.reference_Q_component_2[4][7]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
+relax.reference_Q_component_2[4][8]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
+relax.reference_Q_component_2[4][12]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
+relax.reference_Q_component_2[4][20]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
+relax.reference_Q_component_2[4][36]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
+relax.reference_Q_component_2[4][50]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
+relax.reference_Q_component_2[5][1]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
+relax.reference_Q_component_2[5][4]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
+relax.reference_Q_component_2[5][6]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
+relax.reference_Q_component_2[5][7]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_2[5][9]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
+relax.reference_Q_component_2[5][13]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
+relax.reference_Q_component_2[5][21]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
+relax.reference_Q_component_2[5][37]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
+relax.reference_Q_component_2[5][51]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
+relax.reference_Q_component_2[6][2]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
+relax.reference_Q_component_2[6][4]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
+relax.reference_Q_component_2[6][5]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
+relax.reference_Q_component_2[6][7]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
+relax.reference_Q_component_2[6][10]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
+relax.reference_Q_component_2[6][14]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
+relax.reference_Q_component_2[6][22]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
+relax.reference_Q_component_2[6][38]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
+relax.reference_Q_component_2[6][52]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
+relax.reference_Q_component_2[7][3]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
+relax.reference_Q_component_2[7][4]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
+relax.reference_Q_component_2[7][5]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_2[7][6]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
+relax.reference_Q_component_2[7][11]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
+relax.reference_Q_component_2[7][15]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
+relax.reference_Q_component_2[7][23]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
+relax.reference_Q_component_2[7][39]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
+relax.reference_Q_component_2[7][53]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
+relax.reference_Q_component_2[8][0]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
+relax.reference_Q_component_2[8][4]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
+relax.reference_Q_component_2[8][9]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
+relax.reference_Q_component_2[8][10]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
+relax.reference_Q_component_2[8][11]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
+relax.reference_Q_component_2[8][12]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
+relax.reference_Q_component_2[8][24]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
+relax.reference_Q_component_2[8][40]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
+relax.reference_Q_component_2[9][1]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
+relax.reference_Q_component_2[9][5]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
+relax.reference_Q_component_2[9][8]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
+relax.reference_Q_component_2[9][10]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
+relax.reference_Q_component_2[9][11]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_2[9][13]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
+relax.reference_Q_component_2[9][25]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
+relax.reference_Q_component_2[9][41]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
+relax.reference_Q_component_2[9][54]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
+relax.reference_Q_component_2[10][2]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
+relax.reference_Q_component_2[10][6]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
+relax.reference_Q_component_2[10][8]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
+relax.reference_Q_component_2[10][9]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
+relax.reference_Q_component_2[10][11]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
+relax.reference_Q_component_2[10][14]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
+relax.reference_Q_component_2[10][26]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
+relax.reference_Q_component_2[10][42]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
+relax.reference_Q_component_2[10][55]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
+relax.reference_Q_component_2[11][3]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
+relax.reference_Q_component_2[11][7]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
+relax.reference_Q_component_2[11][8]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
+relax.reference_Q_component_2[11][9]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_2[11][10]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
+relax.reference_Q_component_2[11][15]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
+relax.reference_Q_component_2[11][27]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
+relax.reference_Q_component_2[11][43]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
+relax.reference_Q_component_2[11][56]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
+relax.reference_Q_component_2[12][0]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
+relax.reference_Q_component_2[12][4]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
+relax.reference_Q_component_2[12][8]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
+relax.reference_Q_component_2[12][13]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
+relax.reference_Q_component_2[12][14]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
+relax.reference_Q_component_2[12][15]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
+relax.reference_Q_component_2[12][28]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
+relax.reference_Q_component_2[12][44]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
+relax.reference_Q_component_2[12][57]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
+relax.reference_Q_component_2[13][1]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
+relax.reference_Q_component_2[13][5]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
+relax.reference_Q_component_2[13][9]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
+relax.reference_Q_component_2[13][12]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
+relax.reference_Q_component_2[13][14]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
+relax.reference_Q_component_2[13][15]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_2[13][29]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
+relax.reference_Q_component_2[13][45]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
+relax.reference_Q_component_2[13][58]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
+relax.reference_Q_component_2[14][2]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
+relax.reference_Q_component_2[14][6]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
+relax.reference_Q_component_2[14][10]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
+relax.reference_Q_component_2[14][12]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
+relax.reference_Q_component_2[14][13]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
+relax.reference_Q_component_2[14][15]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
+relax.reference_Q_component_2[14][30]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
+relax.reference_Q_component_2[14][46]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
+relax.reference_Q_component_2[14][59]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
+relax.reference_Q_component_2[15][3]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
+relax.reference_Q_component_2[15][7]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
+relax.reference_Q_component_2[15][11]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
+relax.reference_Q_component_2[15][12]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
+relax.reference_Q_component_2[15][13]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_2[15][14]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
+relax.reference_Q_component_2[15][31]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
+relax.reference_Q_component_2[15][47]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
+relax.reference_Q_component_2[15][60]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
+relax.reference_Q_component_2[16][0]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
+relax.reference_Q_component_2[16][17]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
+relax.reference_Q_component_2[16][18]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
+relax.reference_Q_component_2[16][19]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
+relax.reference_Q_component_2[16][20]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
+relax.reference_Q_component_2[16][24]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
+relax.reference_Q_component_2[16][28]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
+relax.reference_Q_component_2[16][32]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
+relax.reference_Q_component_2[17][1]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
+relax.reference_Q_component_2[17][16]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
+relax.reference_Q_component_2[17][18]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
+relax.reference_Q_component_2[17][19]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_2[17][21]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
+relax.reference_Q_component_2[17][25]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
+relax.reference_Q_component_2[17][29]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
+relax.reference_Q_component_2[17][33]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
+relax.reference_Q_component_2[17][48]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
+relax.reference_Q_component_2[18][2]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
+relax.reference_Q_component_2[18][16]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
+relax.reference_Q_component_2[18][17]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
+relax.reference_Q_component_2[18][19]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
+relax.reference_Q_component_2[18][22]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
+relax.reference_Q_component_2[18][26]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
+relax.reference_Q_component_2[18][30]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
+relax.reference_Q_component_2[18][34]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
+relax.reference_Q_component_2[19][3]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
+relax.reference_Q_component_2[19][16]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
+relax.reference_Q_component_2[19][17]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_2[19][18]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
+relax.reference_Q_component_2[19][23]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
+relax.reference_Q_component_2[19][27]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
+relax.reference_Q_component_2[19][31]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
+relax.reference_Q_component_2[19][35]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
+relax.reference_Q_component_2[19][49]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
+relax.reference_Q_component_2[20][4]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
+relax.reference_Q_component_2[20][16]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
+relax.reference_Q_component_2[20][21]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
+relax.reference_Q_component_2[20][22]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
+relax.reference_Q_component_2[20][23]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
+relax.reference_Q_component_2[20][24]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
+relax.reference_Q_component_2[20][28]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
+relax.reference_Q_component_2[20][36]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
+relax.reference_Q_component_2[20][50]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
+relax.reference_Q_component_2[21][5]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
+relax.reference_Q_component_2[21][17]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
+relax.reference_Q_component_2[21][20]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
+relax.reference_Q_component_2[21][22]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
+relax.reference_Q_component_2[21][23]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_2[21][25]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
+relax.reference_Q_component_2[21][29]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
+relax.reference_Q_component_2[21][37]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
+relax.reference_Q_component_2[21][51]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
+relax.reference_Q_component_2[22][6]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
+relax.reference_Q_component_2[22][18]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
+relax.reference_Q_component_2[22][20]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
+relax.reference_Q_component_2[22][21]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
+relax.reference_Q_component_2[22][23]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
+relax.reference_Q_component_2[22][26]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
+relax.reference_Q_component_2[22][30]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
+relax.reference_Q_component_2[22][38]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
+relax.reference_Q_component_2[22][52]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
+relax.reference_Q_component_2[23][7]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
+relax.reference_Q_component_2[23][19]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
+relax.reference_Q_component_2[23][20]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
+relax.reference_Q_component_2[23][21]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_2[23][22]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
+relax.reference_Q_component_2[23][27]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
+relax.reference_Q_component_2[23][31]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
+relax.reference_Q_component_2[23][39]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
+relax.reference_Q_component_2[23][53]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
+relax.reference_Q_component_2[24][8]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
+relax.reference_Q_component_2[24][16]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
+relax.reference_Q_component_2[24][20]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
+relax.reference_Q_component_2[24][25]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
+relax.reference_Q_component_2[24][26]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
+relax.reference_Q_component_2[24][27]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
+relax.reference_Q_component_2[24][28]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
+relax.reference_Q_component_2[24][40]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
+relax.reference_Q_component_2[25][9]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
+relax.reference_Q_component_2[25][17]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
+relax.reference_Q_component_2[25][21]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
+relax.reference_Q_component_2[25][24]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
+relax.reference_Q_component_2[25][26]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
+relax.reference_Q_component_2[25][27]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_2[25][29]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
+relax.reference_Q_component_2[25][41]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
+relax.reference_Q_component_2[25][54]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
+relax.reference_Q_component_2[26][10]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
+relax.reference_Q_component_2[26][18]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
+relax.reference_Q_component_2[26][22]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
+relax.reference_Q_component_2[26][24]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
+relax.reference_Q_component_2[26][25]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
+relax.reference_Q_component_2[26][27]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
+relax.reference_Q_component_2[26][30]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
+relax.reference_Q_component_2[26][42]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
+relax.reference_Q_component_2[26][55]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
+relax.reference_Q_component_2[27][11]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
+relax.reference_Q_component_2[27][19]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
+relax.reference_Q_component_2[27][23]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
+relax.reference_Q_component_2[27][24]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
+relax.reference_Q_component_2[27][25]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_2[27][26]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
+relax.reference_Q_component_2[27][31]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
+relax.reference_Q_component_2[27][43]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
+relax.reference_Q_component_2[27][56]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
+relax.reference_Q_component_2[28][12]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
+relax.reference_Q_component_2[28][16]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
+relax.reference_Q_component_2[28][20]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
+relax.reference_Q_component_2[28][24]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
+relax.reference_Q_component_2[28][29]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
+relax.reference_Q_component_2[28][30]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
+relax.reference_Q_component_2[28][31]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
+relax.reference_Q_component_2[28][44]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
+relax.reference_Q_component_2[28][57]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_2[29][13]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
+relax.reference_Q_component_2[29][17]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
+relax.reference_Q_component_2[29][21]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
+relax.reference_Q_component_2[29][25]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
+relax.reference_Q_component_2[29][28]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
+relax.reference_Q_component_2[29][30]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
+relax.reference_Q_component_2[29][31]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_2[29][45]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
+relax.reference_Q_component_2[29][58]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
+relax.reference_Q_component_2[30][14]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
+relax.reference_Q_component_2[30][18]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
+relax.reference_Q_component_2[30][22]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
+relax.reference_Q_component_2[30][26]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
+relax.reference_Q_component_2[30][28]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
+relax.reference_Q_component_2[30][29]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
+relax.reference_Q_component_2[30][31]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
+relax.reference_Q_component_2[30][46]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
+relax.reference_Q_component_2[30][59]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_2[31][15]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
+relax.reference_Q_component_2[31][19]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
+relax.reference_Q_component_2[31][23]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
+relax.reference_Q_component_2[31][27]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
+relax.reference_Q_component_2[31][28]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
+relax.reference_Q_component_2[31][29]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_2[31][30]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
+relax.reference_Q_component_2[31][47]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
+relax.reference_Q_component_2[31][60]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
+relax.reference_Q_component_2[32][0]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
+relax.reference_Q_component_2[32][16]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
+relax.reference_Q_component_2[32][33]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
+relax.reference_Q_component_2[32][34]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
+relax.reference_Q_component_2[32][35]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
+relax.reference_Q_component_2[32][36]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
+relax.reference_Q_component_2[32][40]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
+relax.reference_Q_component_2[32][44]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
+relax.reference_Q_component_2[33][1]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
+relax.reference_Q_component_2[33][17]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
+relax.reference_Q_component_2[33][32]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
+relax.reference_Q_component_2[33][34]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
+relax.reference_Q_component_2[33][35]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_2[33][37]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
+relax.reference_Q_component_2[33][41]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
+relax.reference_Q_component_2[33][45]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
+relax.reference_Q_component_2[33][48]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
+relax.reference_Q_component_2[34][2]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
+relax.reference_Q_component_2[34][18]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
+relax.reference_Q_component_2[34][32]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
+relax.reference_Q_component_2[34][33]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
+relax.reference_Q_component_2[34][35]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
+relax.reference_Q_component_2[34][38]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
+relax.reference_Q_component_2[34][42]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
+relax.reference_Q_component_2[34][46]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
+relax.reference_Q_component_2[35][3]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
+relax.reference_Q_component_2[35][19]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
+relax.reference_Q_component_2[35][32]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
+relax.reference_Q_component_2[35][33]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_2[35][34]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
+relax.reference_Q_component_2[35][39]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
+relax.reference_Q_component_2[35][43]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
+relax.reference_Q_component_2[35][47]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
+relax.reference_Q_component_2[35][49]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
+relax.reference_Q_component_2[36][4]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
+relax.reference_Q_component_2[36][20]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
+relax.reference_Q_component_2[36][32]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
+relax.reference_Q_component_2[36][37]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
+relax.reference_Q_component_2[36][38]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
+relax.reference_Q_component_2[36][39]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
+relax.reference_Q_component_2[36][40]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
+relax.reference_Q_component_2[36][44]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
+relax.reference_Q_component_2[36][50]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
+relax.reference_Q_component_2[37][5]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
+relax.reference_Q_component_2[37][21]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
+relax.reference_Q_component_2[37][33]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
+relax.reference_Q_component_2[37][36]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
+relax.reference_Q_component_2[37][38]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
+relax.reference_Q_component_2[37][39]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_2[37][41]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
+relax.reference_Q_component_2[37][45]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
+relax.reference_Q_component_2[37][51]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
+relax.reference_Q_component_2[38][6]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
+relax.reference_Q_component_2[38][22]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
+relax.reference_Q_component_2[38][34]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
+relax.reference_Q_component_2[38][36]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
+relax.reference_Q_component_2[38][37]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
+relax.reference_Q_component_2[38][39]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
+relax.reference_Q_component_2[38][42]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
+relax.reference_Q_component_2[38][46]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
+relax.reference_Q_component_2[38][52]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
+relax.reference_Q_component_2[39][7]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
+relax.reference_Q_component_2[39][23]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
+relax.reference_Q_component_2[39][35]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
+relax.reference_Q_component_2[39][36]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
+relax.reference_Q_component_2[39][37]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_2[39][38]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
+relax.reference_Q_component_2[39][43]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
+relax.reference_Q_component_2[39][47]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
+relax.reference_Q_component_2[39][53]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
+relax.reference_Q_component_2[40][8]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
+relax.reference_Q_component_2[40][24]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
+relax.reference_Q_component_2[40][32]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
+relax.reference_Q_component_2[40][36]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
+relax.reference_Q_component_2[40][41]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
+relax.reference_Q_component_2[40][42]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
+relax.reference_Q_component_2[40][43]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
+relax.reference_Q_component_2[40][44]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
+relax.reference_Q_component_2[41][9]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
+relax.reference_Q_component_2[41][25]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
+relax.reference_Q_component_2[41][33]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
+relax.reference_Q_component_2[41][37]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
+relax.reference_Q_component_2[41][40]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
+relax.reference_Q_component_2[41][42]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
+relax.reference_Q_component_2[41][43]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_2[41][45]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
+relax.reference_Q_component_2[41][54]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
+relax.reference_Q_component_2[42][10]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
+relax.reference_Q_component_2[42][26]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
+relax.reference_Q_component_2[42][34]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
+relax.reference_Q_component_2[42][38]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
+relax.reference_Q_component_2[42][40]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
+relax.reference_Q_component_2[42][41]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
+relax.reference_Q_component_2[42][43]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
+relax.reference_Q_component_2[42][46]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
+relax.reference_Q_component_2[42][55]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
+relax.reference_Q_component_2[43][11]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
+relax.reference_Q_component_2[43][27]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
+relax.reference_Q_component_2[43][35]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
+relax.reference_Q_component_2[43][39]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
+relax.reference_Q_component_2[43][40]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
+relax.reference_Q_component_2[43][41]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_2[43][42]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
+relax.reference_Q_component_2[43][47]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
+relax.reference_Q_component_2[43][56]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
+relax.reference_Q_component_2[44][12]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
+relax.reference_Q_component_2[44][28]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
+relax.reference_Q_component_2[44][32]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
+relax.reference_Q_component_2[44][36]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
+relax.reference_Q_component_2[44][40]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
+relax.reference_Q_component_2[44][45]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
+relax.reference_Q_component_2[44][46]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
+relax.reference_Q_component_2[44][47]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
+relax.reference_Q_component_2[44][57]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
+relax.reference_Q_component_2[45][13]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
+relax.reference_Q_component_2[45][29]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
+relax.reference_Q_component_2[45][33]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
+relax.reference_Q_component_2[45][37]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
+relax.reference_Q_component_2[45][41]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
+relax.reference_Q_component_2[45][44]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
+relax.reference_Q_component_2[45][46]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
+relax.reference_Q_component_2[45][47]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_2[45][58]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
+relax.reference_Q_component_2[46][14]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
+relax.reference_Q_component_2[46][30]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
+relax.reference_Q_component_2[46][34]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
+relax.reference_Q_component_2[46][38]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
+relax.reference_Q_component_2[46][42]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
+relax.reference_Q_component_2[46][44]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
+relax.reference_Q_component_2[46][45]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
+relax.reference_Q_component_2[46][47]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
+relax.reference_Q_component_2[46][59]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
+relax.reference_Q_component_2[47][15]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
+relax.reference_Q_component_2[47][31]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
+relax.reference_Q_component_2[47][35]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
+relax.reference_Q_component_2[47][39]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
+relax.reference_Q_component_2[47][43]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
+relax.reference_Q_component_2[47][44]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
+relax.reference_Q_component_2[47][45]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_2[47][46]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
+relax.reference_Q_component_2[47][60]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
+relax.reference_Q_component_2[48][1]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
+relax.reference_Q_component_2[48][17]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
+relax.reference_Q_component_2[48][33]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
+relax.reference_Q_component_2[48][49]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_2[48][51]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
+relax.reference_Q_component_2[48][54]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
+relax.reference_Q_component_2[48][58]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
+relax.reference_Q_component_2[49][3]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
+relax.reference_Q_component_2[49][19]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
+relax.reference_Q_component_2[49][35]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
+relax.reference_Q_component_2[49][48]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_2[49][53]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
+relax.reference_Q_component_2[49][56]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
+relax.reference_Q_component_2[49][60]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
+relax.reference_Q_component_2[50][4]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
+relax.reference_Q_component_2[50][20]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
+relax.reference_Q_component_2[50][36]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
+relax.reference_Q_component_2[50][51]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
+relax.reference_Q_component_2[50][52]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
+relax.reference_Q_component_2[50][53]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
+relax.reference_Q_component_2[50][57]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
+relax.reference_Q_component_2[51][5]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
+relax.reference_Q_component_2[51][21]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
+relax.reference_Q_component_2[51][37]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
+relax.reference_Q_component_2[51][48]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
+relax.reference_Q_component_2[51][50]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
+relax.reference_Q_component_2[51][52]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
+relax.reference_Q_component_2[51][53]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_2[51][54]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
+relax.reference_Q_component_2[51][58]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
+relax.reference_Q_component_2[52][6]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
+relax.reference_Q_component_2[52][22]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
+relax.reference_Q_component_2[52][38]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
+relax.reference_Q_component_2[52][50]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
+relax.reference_Q_component_2[52][51]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
+relax.reference_Q_component_2[52][53]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
+relax.reference_Q_component_2[52][55]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
+relax.reference_Q_component_2[52][59]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
+relax.reference_Q_component_2[53][7]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
+relax.reference_Q_component_2[53][23]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
+relax.reference_Q_component_2[53][39]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
+relax.reference_Q_component_2[53][49]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
+relax.reference_Q_component_2[53][50]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
+relax.reference_Q_component_2[53][51]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_2[53][52]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
+relax.reference_Q_component_2[53][56]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
+relax.reference_Q_component_2[53][60]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
+relax.reference_Q_component_2[54][9]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
+relax.reference_Q_component_2[54][25]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
+relax.reference_Q_component_2[54][41]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
+relax.reference_Q_component_2[54][48]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
+relax.reference_Q_component_2[54][51]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
+relax.reference_Q_component_2[54][55]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
+relax.reference_Q_component_2[54][56]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_2[54][58]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
+relax.reference_Q_component_2[55][10]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
+relax.reference_Q_component_2[55][26]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
+relax.reference_Q_component_2[55][42]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
+relax.reference_Q_component_2[55][52]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
+relax.reference_Q_component_2[55][54]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
+relax.reference_Q_component_2[55][56]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
+relax.reference_Q_component_2[55][59]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
+relax.reference_Q_component_2[56][11]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
+relax.reference_Q_component_2[56][27]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
+relax.reference_Q_component_2[56][43]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
+relax.reference_Q_component_2[56][49]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega2;
+relax.reference_Q_component_2[56][53]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
+relax.reference_Q_component_2[56][54]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_2[56][55]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
+relax.reference_Q_component_2[56][60]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
+relax.reference_Q_component_2[57][12]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
+relax.reference_Q_component_2[57][28]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_2[57][44]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
+relax.reference_Q_component_2[57][50]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
+relax.reference_Q_component_2[57][58]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
+relax.reference_Q_component_2[57][59]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
+relax.reference_Q_component_2[57][60]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
+relax.reference_Q_component_2[58][13]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
+relax.reference_Q_component_2[58][29]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
+relax.reference_Q_component_2[58][45]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
+relax.reference_Q_component_2[58][48]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
+relax.reference_Q_component_2[58][51]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
+relax.reference_Q_component_2[58][54]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
+relax.reference_Q_component_2[58][57]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega2;
+relax.reference_Q_component_2[58][59]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
+relax.reference_Q_component_2[58][60]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_2[59][14]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
+relax.reference_Q_component_2[59][30]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_2[59][46]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
+relax.reference_Q_component_2[59][52]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
+relax.reference_Q_component_2[59][55]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
+relax.reference_Q_component_2[59][57]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
+relax.reference_Q_component_2[59][58]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega2;
+relax.reference_Q_component_2[59][60]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
+relax.reference_Q_component_2[60][15]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
+relax.reference_Q_component_2[60][31]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
+relax.reference_Q_component_2[60][47]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
+relax.reference_Q_component_2[60][49]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
+relax.reference_Q_component_2[60][53]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega2;
+relax.reference_Q_component_2[60][56]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
+relax.reference_Q_component_2[60][57]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega2;
+relax.reference_Q_component_2[60][58]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_2[60][59]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega2;
+
+
+relax.reference_Q_component_3={61,61};
+relax.reference_Q_component_3[0][1]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
+relax.reference_Q_component_3[0][2]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
+relax.reference_Q_component_3[0][3]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
+relax.reference_Q_component_3[0][4]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
+relax.reference_Q_component_3[0][8]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
+relax.reference_Q_component_3[0][12]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
+relax.reference_Q_component_3[0][16]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
+relax.reference_Q_component_3[0][32]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
+relax.reference_Q_component_3[1][0]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
+relax.reference_Q_component_3[1][2]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
+relax.reference_Q_component_3[1][3]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_3[1][5]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
+relax.reference_Q_component_3[1][9]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
+relax.reference_Q_component_3[1][13]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
+relax.reference_Q_component_3[1][17]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
+relax.reference_Q_component_3[1][33]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
+relax.reference_Q_component_3[1][48]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
+relax.reference_Q_component_3[2][0]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
+relax.reference_Q_component_3[2][1]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
+relax.reference_Q_component_3[2][3]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
+relax.reference_Q_component_3[2][6]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
+relax.reference_Q_component_3[2][10]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
+relax.reference_Q_component_3[2][14]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
+relax.reference_Q_component_3[2][18]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
+relax.reference_Q_component_3[2][34]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
+relax.reference_Q_component_3[3][0]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
+relax.reference_Q_component_3[3][1]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_3[3][2]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
+relax.reference_Q_component_3[3][7]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
+relax.reference_Q_component_3[3][11]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
+relax.reference_Q_component_3[3][15]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
+relax.reference_Q_component_3[3][19]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
+relax.reference_Q_component_3[3][35]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
+relax.reference_Q_component_3[3][49]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
+relax.reference_Q_component_3[4][0]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
+relax.reference_Q_component_3[4][5]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
+relax.reference_Q_component_3[4][6]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
+relax.reference_Q_component_3[4][7]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
+relax.reference_Q_component_3[4][8]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
+relax.reference_Q_component_3[4][12]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
+relax.reference_Q_component_3[4][20]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
+relax.reference_Q_component_3[4][36]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
+relax.reference_Q_component_3[4][50]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
+relax.reference_Q_component_3[5][1]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
+relax.reference_Q_component_3[5][4]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
+relax.reference_Q_component_3[5][6]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
+relax.reference_Q_component_3[5][7]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_3[5][9]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
+relax.reference_Q_component_3[5][13]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
+relax.reference_Q_component_3[5][21]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
+relax.reference_Q_component_3[5][37]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
+relax.reference_Q_component_3[5][51]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
+relax.reference_Q_component_3[6][2]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
+relax.reference_Q_component_3[6][4]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
+relax.reference_Q_component_3[6][5]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
+relax.reference_Q_component_3[6][7]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
+relax.reference_Q_component_3[6][10]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
+relax.reference_Q_component_3[6][14]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
+relax.reference_Q_component_3[6][22]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
+relax.reference_Q_component_3[6][38]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
+relax.reference_Q_component_3[6][52]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
+relax.reference_Q_component_3[7][3]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
+relax.reference_Q_component_3[7][4]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
+relax.reference_Q_component_3[7][5]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_3[7][6]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
+relax.reference_Q_component_3[7][11]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
+relax.reference_Q_component_3[7][15]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
+relax.reference_Q_component_3[7][23]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
+relax.reference_Q_component_3[7][39]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
+relax.reference_Q_component_3[7][53]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
+relax.reference_Q_component_3[8][0]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
+relax.reference_Q_component_3[8][4]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
+relax.reference_Q_component_3[8][9]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
+relax.reference_Q_component_3[8][10]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
+relax.reference_Q_component_3[8][11]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
+relax.reference_Q_component_3[8][12]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
+relax.reference_Q_component_3[8][24]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
+relax.reference_Q_component_3[8][40]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
+relax.reference_Q_component_3[9][1]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
+relax.reference_Q_component_3[9][5]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
+relax.reference_Q_component_3[9][8]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
+relax.reference_Q_component_3[9][10]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
+relax.reference_Q_component_3[9][11]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_3[9][13]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
+relax.reference_Q_component_3[9][25]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
+relax.reference_Q_component_3[9][41]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
+relax.reference_Q_component_3[9][54]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
+relax.reference_Q_component_3[10][2]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
+relax.reference_Q_component_3[10][6]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
+relax.reference_Q_component_3[10][8]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
+relax.reference_Q_component_3[10][9]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
+relax.reference_Q_component_3[10][11]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
+relax.reference_Q_component_3[10][14]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
+relax.reference_Q_component_3[10][26]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
+relax.reference_Q_component_3[10][42]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
+relax.reference_Q_component_3[10][55]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
+relax.reference_Q_component_3[11][3]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
+relax.reference_Q_component_3[11][7]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
+relax.reference_Q_component_3[11][8]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
+relax.reference_Q_component_3[11][9]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_3[11][10]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
+relax.reference_Q_component_3[11][15]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
+relax.reference_Q_component_3[11][27]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
+relax.reference_Q_component_3[11][43]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
+relax.reference_Q_component_3[11][56]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
+relax.reference_Q_component_3[12][0]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
+relax.reference_Q_component_3[12][4]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
+relax.reference_Q_component_3[12][8]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
+relax.reference_Q_component_3[12][13]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
+relax.reference_Q_component_3[12][14]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
+relax.reference_Q_component_3[12][15]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
+relax.reference_Q_component_3[12][28]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
+relax.reference_Q_component_3[12][44]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
+relax.reference_Q_component_3[12][57]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
+relax.reference_Q_component_3[13][1]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
+relax.reference_Q_component_3[13][5]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
+relax.reference_Q_component_3[13][9]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
+relax.reference_Q_component_3[13][12]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
+relax.reference_Q_component_3[13][14]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
+relax.reference_Q_component_3[13][15]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_3[13][29]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
+relax.reference_Q_component_3[13][45]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
+relax.reference_Q_component_3[13][58]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
+relax.reference_Q_component_3[14][2]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
+relax.reference_Q_component_3[14][6]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
+relax.reference_Q_component_3[14][10]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
+relax.reference_Q_component_3[14][12]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
+relax.reference_Q_component_3[14][13]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
+relax.reference_Q_component_3[14][15]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
+relax.reference_Q_component_3[14][30]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
+relax.reference_Q_component_3[14][46]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
+relax.reference_Q_component_3[14][59]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
+relax.reference_Q_component_3[15][3]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
+relax.reference_Q_component_3[15][7]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
+relax.reference_Q_component_3[15][11]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
+relax.reference_Q_component_3[15][12]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
+relax.reference_Q_component_3[15][13]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_3[15][14]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
+relax.reference_Q_component_3[15][31]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
+relax.reference_Q_component_3[15][47]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
+relax.reference_Q_component_3[15][60]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
+relax.reference_Q_component_3[16][0]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
+relax.reference_Q_component_3[16][17]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
+relax.reference_Q_component_3[16][18]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
+relax.reference_Q_component_3[16][19]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
+relax.reference_Q_component_3[16][20]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
+relax.reference_Q_component_3[16][24]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
+relax.reference_Q_component_3[16][28]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
+relax.reference_Q_component_3[16][32]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
+relax.reference_Q_component_3[17][1]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
+relax.reference_Q_component_3[17][16]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
+relax.reference_Q_component_3[17][18]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
+relax.reference_Q_component_3[17][19]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_3[17][21]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
+relax.reference_Q_component_3[17][25]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
+relax.reference_Q_component_3[17][29]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
+relax.reference_Q_component_3[17][33]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
+relax.reference_Q_component_3[17][48]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
+relax.reference_Q_component_3[18][2]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
+relax.reference_Q_component_3[18][16]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
+relax.reference_Q_component_3[18][17]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
+relax.reference_Q_component_3[18][19]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
+relax.reference_Q_component_3[18][22]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
+relax.reference_Q_component_3[18][26]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
+relax.reference_Q_component_3[18][30]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
+relax.reference_Q_component_3[18][34]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
+relax.reference_Q_component_3[19][3]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
+relax.reference_Q_component_3[19][16]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
+relax.reference_Q_component_3[19][17]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_3[19][18]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
+relax.reference_Q_component_3[19][23]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
+relax.reference_Q_component_3[19][27]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
+relax.reference_Q_component_3[19][31]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
+relax.reference_Q_component_3[19][35]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
+relax.reference_Q_component_3[19][49]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
+relax.reference_Q_component_3[20][4]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
+relax.reference_Q_component_3[20][16]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
+relax.reference_Q_component_3[20][21]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
+relax.reference_Q_component_3[20][22]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
+relax.reference_Q_component_3[20][23]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
+relax.reference_Q_component_3[20][24]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
+relax.reference_Q_component_3[20][28]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
+relax.reference_Q_component_3[20][36]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
+relax.reference_Q_component_3[20][50]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
+relax.reference_Q_component_3[21][5]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
+relax.reference_Q_component_3[21][17]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
+relax.reference_Q_component_3[21][20]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
+relax.reference_Q_component_3[21][22]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
+relax.reference_Q_component_3[21][23]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_3[21][25]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
+relax.reference_Q_component_3[21][29]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
+relax.reference_Q_component_3[21][37]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
+relax.reference_Q_component_3[21][51]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
+relax.reference_Q_component_3[22][6]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
+relax.reference_Q_component_3[22][18]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
+relax.reference_Q_component_3[22][20]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
+relax.reference_Q_component_3[22][21]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
+relax.reference_Q_component_3[22][23]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
+relax.reference_Q_component_3[22][26]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
+relax.reference_Q_component_3[22][30]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
+relax.reference_Q_component_3[22][38]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
+relax.reference_Q_component_3[22][52]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
+relax.reference_Q_component_3[23][7]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
+relax.reference_Q_component_3[23][19]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
+relax.reference_Q_component_3[23][20]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
+relax.reference_Q_component_3[23][21]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_3[23][22]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
+relax.reference_Q_component_3[23][27]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
+relax.reference_Q_component_3[23][31]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
+relax.reference_Q_component_3[23][39]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
+relax.reference_Q_component_3[23][53]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
+relax.reference_Q_component_3[24][8]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
+relax.reference_Q_component_3[24][16]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
+relax.reference_Q_component_3[24][20]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
+relax.reference_Q_component_3[24][25]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
+relax.reference_Q_component_3[24][26]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
+relax.reference_Q_component_3[24][27]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
+relax.reference_Q_component_3[24][28]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
+relax.reference_Q_component_3[24][40]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
+relax.reference_Q_component_3[25][9]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
+relax.reference_Q_component_3[25][17]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
+relax.reference_Q_component_3[25][21]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
+relax.reference_Q_component_3[25][24]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
+relax.reference_Q_component_3[25][26]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
+relax.reference_Q_component_3[25][27]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_3[25][29]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
+relax.reference_Q_component_3[25][41]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
+relax.reference_Q_component_3[25][54]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
+relax.reference_Q_component_3[26][10]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
+relax.reference_Q_component_3[26][18]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
+relax.reference_Q_component_3[26][22]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
+relax.reference_Q_component_3[26][24]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
+relax.reference_Q_component_3[26][25]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
+relax.reference_Q_component_3[26][27]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
+relax.reference_Q_component_3[26][30]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
+relax.reference_Q_component_3[26][42]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
+relax.reference_Q_component_3[26][55]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
+relax.reference_Q_component_3[27][11]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
+relax.reference_Q_component_3[27][19]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
+relax.reference_Q_component_3[27][23]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
+relax.reference_Q_component_3[27][24]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
+relax.reference_Q_component_3[27][25]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_3[27][26]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
+relax.reference_Q_component_3[27][31]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
+relax.reference_Q_component_3[27][43]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
+relax.reference_Q_component_3[27][56]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
+relax.reference_Q_component_3[28][12]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
+relax.reference_Q_component_3[28][16]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
+relax.reference_Q_component_3[28][20]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
+relax.reference_Q_component_3[28][24]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
+relax.reference_Q_component_3[28][29]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
+relax.reference_Q_component_3[28][30]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
+relax.reference_Q_component_3[28][31]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
+relax.reference_Q_component_3[28][44]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
+relax.reference_Q_component_3[28][57]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_3[29][13]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
+relax.reference_Q_component_3[29][17]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
+relax.reference_Q_component_3[29][21]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
+relax.reference_Q_component_3[29][25]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
+relax.reference_Q_component_3[29][28]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
+relax.reference_Q_component_3[29][30]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
+relax.reference_Q_component_3[29][31]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_3[29][45]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
+relax.reference_Q_component_3[29][58]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
+relax.reference_Q_component_3[30][14]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
+relax.reference_Q_component_3[30][18]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
+relax.reference_Q_component_3[30][22]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
+relax.reference_Q_component_3[30][26]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
+relax.reference_Q_component_3[30][28]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
+relax.reference_Q_component_3[30][29]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
+relax.reference_Q_component_3[30][31]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
+relax.reference_Q_component_3[30][46]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
+relax.reference_Q_component_3[30][59]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_3[31][15]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
+relax.reference_Q_component_3[31][19]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
+relax.reference_Q_component_3[31][23]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
+relax.reference_Q_component_3[31][27]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
+relax.reference_Q_component_3[31][28]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
+relax.reference_Q_component_3[31][29]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_3[31][30]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
+relax.reference_Q_component_3[31][47]:=0.2711267576668541*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
+relax.reference_Q_component_3[31][60]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
+relax.reference_Q_component_3[32][0]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
+relax.reference_Q_component_3[32][16]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
+relax.reference_Q_component_3[32][33]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
+relax.reference_Q_component_3[32][34]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
+relax.reference_Q_component_3[32][35]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
+relax.reference_Q_component_3[32][36]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
+relax.reference_Q_component_3[32][40]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
+relax.reference_Q_component_3[32][44]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
+relax.reference_Q_component_3[33][1]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
+relax.reference_Q_component_3[33][17]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
+relax.reference_Q_component_3[33][32]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
+relax.reference_Q_component_3[33][34]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
+relax.reference_Q_component_3[33][35]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_3[33][37]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
+relax.reference_Q_component_3[33][41]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
+relax.reference_Q_component_3[33][45]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
+relax.reference_Q_component_3[33][48]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
+relax.reference_Q_component_3[34][2]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
+relax.reference_Q_component_3[34][18]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
+relax.reference_Q_component_3[34][32]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
+relax.reference_Q_component_3[34][33]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
+relax.reference_Q_component_3[34][35]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
+relax.reference_Q_component_3[34][38]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
+relax.reference_Q_component_3[34][42]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
+relax.reference_Q_component_3[34][46]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
+relax.reference_Q_component_3[35][3]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
+relax.reference_Q_component_3[35][19]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
+relax.reference_Q_component_3[35][32]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
+relax.reference_Q_component_3[35][33]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_3[35][34]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
+relax.reference_Q_component_3[35][39]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
+relax.reference_Q_component_3[35][43]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
+relax.reference_Q_component_3[35][47]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT*relax.reference.omega3;
+relax.reference_Q_component_3[35][49]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
+relax.reference_Q_component_3[36][4]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
+relax.reference_Q_component_3[36][20]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
+relax.reference_Q_component_3[36][32]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
+relax.reference_Q_component_3[36][37]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
+relax.reference_Q_component_3[36][38]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
+relax.reference_Q_component_3[36][39]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
+relax.reference_Q_component_3[36][40]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
+relax.reference_Q_component_3[36][44]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
+relax.reference_Q_component_3[36][50]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
+relax.reference_Q_component_3[37][5]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
+relax.reference_Q_component_3[37][21]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
+relax.reference_Q_component_3[37][33]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
+relax.reference_Q_component_3[37][36]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
+relax.reference_Q_component_3[37][38]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
+relax.reference_Q_component_3[37][39]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_3[37][41]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
+relax.reference_Q_component_3[37][45]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
+relax.reference_Q_component_3[37][51]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
+relax.reference_Q_component_3[38][6]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
+relax.reference_Q_component_3[38][22]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
+relax.reference_Q_component_3[38][34]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
+relax.reference_Q_component_3[38][36]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
+relax.reference_Q_component_3[38][37]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
+relax.reference_Q_component_3[38][39]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
+relax.reference_Q_component_3[38][42]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
+relax.reference_Q_component_3[38][46]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
+relax.reference_Q_component_3[38][52]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
+relax.reference_Q_component_3[39][7]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
+relax.reference_Q_component_3[39][23]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
+relax.reference_Q_component_3[39][35]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC*relax.reference.omega3;
+relax.reference_Q_component_3[39][36]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
+relax.reference_Q_component_3[39][37]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_3[39][38]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
+relax.reference_Q_component_3[39][43]:=0.1659124550130927*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
+relax.reference_Q_component_3[39][47]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT*relax.reference.omega3;
+relax.reference_Q_component_3[39][53]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
+relax.reference_Q_component_3[40][8]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
+relax.reference_Q_component_3[40][24]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
+relax.reference_Q_component_3[40][32]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
+relax.reference_Q_component_3[40][36]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
+relax.reference_Q_component_3[40][41]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
+relax.reference_Q_component_3[40][42]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
+relax.reference_Q_component_3[40][43]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_AT;
+relax.reference_Q_component_3[40][44]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
+relax.reference_Q_component_3[41][9]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
+relax.reference_Q_component_3[41][25]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
+relax.reference_Q_component_3[41][33]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
+relax.reference_Q_component_3[41][37]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
+relax.reference_Q_component_3[41][40]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AC;
+relax.reference_Q_component_3[41][42]:=0.2755785876068215*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
+relax.reference_Q_component_3[41][43]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_CT;
+relax.reference_Q_component_3[41][45]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
+relax.reference_Q_component_3[41][54]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
+relax.reference_Q_component_3[42][10]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
+relax.reference_Q_component_3[42][26]:=0.1355563084773651*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
+relax.reference_Q_component_3[42][34]:=0.4273861212189187*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG*relax.reference.omega3;
+relax.reference_Q_component_3[42][38]:=0.158675687099023*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG*relax.reference.omega3;
+relax.reference_Q_component_3[42][40]:=0.2714859010999351*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG;
+relax.reference_Q_component_3[42][41]:=0.2217183243979596*t*relax._shared_srv.rv_gdd*relax.reference.theta_CG;
+relax.reference_Q_component_3[42][43]:=0.2312171868952838*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT;
+relax.reference_Q_component_3[42][46]:=0.2480257366689655*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
+relax.reference_Q_component_3[42][55]:=0.1960444787447039*t*relax._shared_srv.rv_gdd*relax.reference.theta_GT*relax.reference.omega3;
+relax.reference_Q_component_3[43][11]:=0.3972724551110769*t*relax._shared_srv.rv_gdd*relax.reference.theta_AG