Mercurial > repos > iuc > jellyfish
view jellyfish.xml @ 2:dcd30574a456 draft default tip
planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/jellyfish commit aa8360cb3ec9faf1488938a430855977632706ff
author | iuc |
---|---|
date | Sun, 07 Jan 2024 16:28:53 +0000 |
parents | 11658afb8c87 |
children |
line wrap: on
line source
<tool id="jellyfish" name="jellyfish" version="@WRAPPER_VERSION@+@VERSION_SUFFIX@" profile="20.01"> <macros> <token name="@WRAPPER_VERSION@">2.3.0</token> <token name="@VERSION_SUFFIX@">galaxy1</token> </macros> <xrefs> <xref type="bio.tools">Jellyfish</xref> </xrefs> <requirements> <requirement type="package" version="@WRAPPER_VERSION@">kmer-jellyfish</requirement> </requirements> <command detect_errors="exit_code"><![CDATA[ jellyfish #if $commands.command == "count": count --mer-len $commands.mer_len --size ${commands.size}M #if $commands.counter_len: --counter-len $commands.counter_len #end if $commands.canonical #if $commands.bloom.filters == "bc": --bc '$commands.bloom.bloom_file' #if $commands.bloom.bf_fp: --bf-fp $commands.bloom.bf_fp #end if #else if $commands.bloom.filters == "bf_size": --bf-size $commands.bloom.bf_size #if $commands.bloom.bf_fp: --bf-fp $commands.bloom.bf_fp #end if #end if #if $commands.if: --if '$commands.if' #end if #if $commands.reprobes: --reprobes $commands.reprobes #end if #if $commands.text == "text": --text #end if #if $commands.lower_count: --lower-count $commands.lower_count #end if #if $commands.upper_count: --upper-count $commands.upper_count #end if '$commands.input' #else if $commands.command == "histo": histo #if $commands.low: --low $commands.low #end if #if $commands.high: --high $commands.high #end if #if $commands.increment: --increment $commands.increment #end if $commands.full '$commands.input' -o jellyfish_histo.txt #else if $commands.command == "dump": dump #if $commands.lower_count: --lower-count $commands.lower_count #end if #if $commands.upper_count: --upper-count $commands.upper_count #end if #if $commands.format.format_select == "column": --column $commands.format.tab '$commands.input' #if $commands.format.tab == "--tab": -o jellyfish_dump.tsv #else: -o jellyfish_dump.txt #end if #else: '$commands.input' -o jellyfish_dump.fasta #end if ## #else if $commands.command == "bc": ## #else if $commands.command == "info": ## #else if $commands.command == "stats": ## #else if $commands.command == "merge": ## #else if $commands.command == "query": #end if ]]></command> <inputs> <conditional name="commands"> <param name="command" type="select" label="Jellyfish command: "> <option value="count"/> <option value="histo"/> <option value="dump"/> <!-- <option value="bc"/> <option value="info"/> <option value="stats"/> <option value="merge"/> <option value="query"/> --> </param> <when value="count"> <param name="input" type="data" format="fasta,fastq,fastqsanger" label="Input data file"/> <param argument="--mer-len" type="integer" value="20" min="1" label="Length of mer" /> <param argument="--size" type="integer" value="32" min="1" label="Initial hash size in Million (M)" /> <param argument="--counter-len" type="integer" min="1" optional="true" label="Counter Length in bits" /> <param argument="--canonical" type="boolean" truevalue="--canonical" falsevalue="" label="Count both strand and canonical representation" /> <conditional name="bloom"> <param name="filters" type="select" label="Use bloom filters"> <option value="default">Default</option> <option value="bc">Bloom counter to filter out singleton mers</option> <option value="bf_size">Use bloom filter to count high-frequency mers</option> </param> <when value="default"/> <when value="bc"> <param name="bloom_file" type="data" format="tabular,tsv" label="Bloom counter file"/> <param argument="--bf-fp" type="float" label="False positive rate of bloom filter" optional="true"/> </when> <when value="bf_size"> <param name="bf_size" argument="--bf-size" type="integer" label="Use bloom filter to count high-frequency mers" min="1" optional="true"/> <param argument="--bf-fp" type="float" label="False positive rate of bloom filter" optional="true"/> </when> </conditional> <param argument="--if" type="data" format="txt" label="Count only k-mers in this file" optional="true"/> <param argument="--reprobes" type="integer" label="Maximum number of repropbes" min="1" optional="true"/> <param argument="--text" type="boolean" label="Dump in text format" truevalue="text" falsevalue="jf"/> <param argument="--lower-count" type="integer" label="Lower count" min="1" optional="true" help="Don't output k-mer with count less than this value"/> <param argument="--upper-count" type="integer" label="upper count" min="1" optional="true" help="Don't output k-mer with count greater than this value"/> </when> <when value="histo"> <param name="input" type="data" format="jellyfish" label="Input data file"/> <param argument="--low" type="integer" min="1" label="Lower count value of histogram" optional="true"/> <param argument="--high" type="integer" min="1" label="Upper count value of histogram" optional="true"/> <param argument="--increment" type="integer" min="1" label="Increment value for buckets" optional="true"/> <param argument="--full" type="boolean" label="Full histogram. Don't skip count 0" truevalue="--full" falsevalue=""/> </when> <when value="dump"> <param name="input" type="data" format="jellyfish" label="Input data file"/> <conditional name="format"> <param name="format_select" type="select" label="Output format"> <option value="fasta"/> <option value="column"/> </param> <when value="fasta"/> <when value="column"> <param argument="--tab" type="boolean" label="Use tab separator" truevalue="--tab" falsevalue=""/> </when> </conditional> <param argument="--lower-count" type="integer" min="0" optional="true" label="Don't output k-mer with count less than lower-count" /> <param argument="--upper-count" type="integer" min="1" optional="true" label="Don't output k-mer with count greater than upper-count" /> </when> <!-- <when value="bc"> </when> <when value="info"> </when> <when value="stats"> </when> <when value="merge"> </when> <when value="query"> </when> --> </conditional> </inputs> <outputs> <data name="jellyfish_db" format="jellyfish" from_work_dir="mer_counts.jf" label="${tool.name} on ${on_string}: jellyfish db"> <filter>commands["command"] == "count" and not commands["text"]</filter> </data> <data name="jellyfish_db_txt" format="txt" from_work_dir="mer_counts.jf" label="${tool.name} on ${on_string}: jellyfish db text"> <filter>commands["command"] == "count" and commands["text"]</filter> </data> <data name="jellyfish_histo" format="txt" from_work_dir="jellyfish_histo.txt" label="${tool.name} on ${on_string}: histogram"> <filter>commands["command"] == "histo"</filter> </data> <data name="jellyfish_fasta" format="fasta" from_work_dir="jellyfish_dump.fasta" label="${tool.name} on ${on_string}: fasta dump"> <filter>commands["command"] == "dump" and commands["format"]["format_select"] == "fasta"</filter> </data> <data name="jellyfish_txt" format="txt" from_work_dir="jellyfish_dump.txt" label="${tool.name} on ${on_string}: txt dump"> <filter>commands["command"] == "dump" and commands["format"]["format_select"] == "column" and not commands["format"]["tab"]</filter> </data> <data name="jellyfish_tsv" format="tsv" from_work_dir="jellyfish_dump.tsv" label="${tool.name} on ${on_string}: tabular dump"> <filter>commands["command"] == "dump" and commands["format"]["format_select"] == "column" and commands["format"]["tab"]</filter> </data> </outputs> <tests> <test expect_num_outputs="1"> <conditional name="commands"> <param name="commands" value="count"/> <param name="input" value="test.fastq"/> <param name="mer_len" value="22"/> <param name="size" value="16"/> <param name="canonical" value="--canonical"/> </conditional> <output name="jellyfish_db" file="out.jf" compare="sim_size" delta="1000"/> </test> <test expect_num_outputs="1"> <conditional name="commands"> <param name="commands" value="count"/> <param name="input" value="test.fastq"/> <param name="mer_len" value="22"/> <param name="size" value="16"/> <param name="canonical" value="--canonical"/> <conditional name="bloom"> <param name="filters" value="bf_size"/> <param name="bf_size" value="2"/> <param name="bf_fp" value="0.01"/> </conditional> <param name="text" value="text"/> <param name="lower" value="1"/> <param name="upper" value="20"/> </conditional> <output name="jellyfish_db_txt"> <assert_contents> <has_line line="GTGATCGAGAGCCACAGCGTTA 1"/> <has_line line="GCCTAGTCGGGATCGTCACCTA 1"/> </assert_contents> </output> </test> <test expect_num_outputs="1"> <conditional name="commands"> <param name="command" value="histo"/> <param name="input" value="out.jf" ftype="jellyfish"/> <param name="low" value="1"/> <param name="high" value="10000"/> <param name="full" value="--full"/> <param name="increment" value="100"/> </conditional> <output name="jellyfish_histo" ftype="txt" file="histo.txt"/> </test> <test expect_num_outputs="1"> <conditional name="commands"> <param name="command" value="dump"/> <param name="input" value="out.jf" ftype="jellyfish"/> <param name="lower_count" value="3"/> </conditional> <output name="jellyfish_fasta" ftype="fasta" file="dump.fasta"/> </test> <test expect_num_outputs="1"> <conditional name="commands"> <param name="command" value="dump"/> <param name="input" value="out.jf" ftype="jellyfish"/> <conditional name="format"> <param name="format_select" value="column"/> <param name="tab" value="--tab"/> </conditional> <param name="upper_count" value="100"/> </conditional> <output name="jellyfish_tsv" ftype="tsv"> <assert_contents> <has_line line="GTGATCGAGAGCCACAGCGTTA	1"/> <has_line line="GCCTAGTCGGGATCGTCACCTA	1"/> </assert_contents> </output> </test> </tests> <help><![CDATA[ Jellyfish is a tool for fast, memory-efficient counting of k-mers in DNA. A k-mer is a substring of length k, and counting the occurrences of all such substrings is a central step in many analyses of DNA sequence. Jellyfish can count k-mers using an order of magnitude less memory and an order of magnitude faster than other k-mer counting packages by using an efficient encoding of a hash table and by exploiting the "compare-and-swap" CPU instruction to increase parallelism. JELLYFISH is a command-line program that reads FASTA and multi-FASTA files containing DNA sequences. It outputs its k-mer counts in a binary format, which can be translated into a human-readable text format using the "jellyfish dump" command, or queried for specific k-mers with "jellyfish query". See the documentation for details. ]]></help> <citations> <citation type="doi">10.1093/bioinformatics/btr011</citation> </citations> </tool>