changeset 4:e345aadf914f draft default tip

"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/stacks2 commit 75f83e7b16127aecc68a58df2cb75062f2a9296a"
author iuc
date Wed, 01 Sep 2021 11:28:07 +0000
parents 289b7d6b69a4
children
files macros.xml test-data/cstacks/catalog.alleles.tsv test-data/cstacks/catalog.snps.tsv test-data/cstacks/catalog.tags.tsv test-data/denovo_map/denovo_map.log test-data/gentest.sh test-data/gstacks/PopA_01.alns.bam test-data/gstacks/PopA_02.alns.bam test-data/gstacks/alignments.bam test-data/gstacks/catalog.calls.vcf test-data/gstacks/gstacks.log test-data/gstacks/gstacks.log.distribs test-data/populations/populations.log test-data/sstacks/PopA_01.matches.tsv test-data/sstacks/PopA_02.matches.tsv test-data/tsv2bam/tsv2bam.log test-data/ustacks/PopA_01.alleles.tsv test-data/ustacks/PopA_01.snps.tsv test-data/ustacks/PopA_01.tags.tsv test-data/ustacks/PopA_02.alleles.tsv test-data/ustacks/PopA_02.snps.tsv test-data/ustacks/PopA_02.tags.tsv
diffstat 22 files changed, 51 insertions(+), 54 deletions(-) [+]
line wrap: on
line diff
--- a/macros.xml	Tue Apr 27 09:27:26 2021 +0000
+++ b/macros.xml	Wed Sep 01 11:28:07 2021 +0000
@@ -10,8 +10,8 @@
     </xml>
 
     <token name="@STACKS_VERSION@">2.55</token>
-    <token name="@WRAPPER_VERSION@">0</token>
-    <token name="@PROFILE@">20.01</token>
+    <token name="@WRAPPER_VERSION@">1</token>
+    <token name="@PROFILE@">20.05</token>
 
     <xml name="citation">
         <citations>
@@ -424,11 +424,11 @@
             <filter>add_log_distribs</filter>
         </data>
         <collection name="gstacks_alns_out" type="list" label="${tool.name} @TOOLADD@ on ${on_string} Read alignments">
-            <discover_datasets pattern="(?P&lt;name&gt;.*).alns.bam$" ext="bam" directory="stacks_outputs"/>
-            <filter>mode_cond['mode_select'] == 'denovo' and mode_cond['advanced_cond']['advanced_select'] == "yes" and mode_cond['advanced_cond']['write_alignments'] != "" and popmap!=None</filter>
+            <discover_datasets pattern="(?P&lt;name&gt;.*).alns.bam$" format="bam" directory="stacks_outputs"/>
+            <filter>mode_cond['mode_select'] == 'denovo' and mode_cond['advanced_cond']['advanced_select'] == "yes" and mode_cond['advanced_cond']['write_alignments'] and popmap!=None</filter>
         </collection>
         <data name="gstacks_aln_out" format="bam" label="${tool.name} @TOOLADD@ on ${on_string} Read alignment" from_work_dir="stacks_outputs/alignments.bam">
-            <filter>mode_cond['mode_select'] == 'denovo' and mode_cond['advanced_cond']['advanced_select'] == "yes" and mode_cond['advanced_cond']['write_alignments'] != "" and popmap==None</filter>
+            <filter>mode_cond['mode_select'] == 'denovo' and mode_cond['advanced_cond']['advanced_select'] == "yes" and mode_cond['advanced_cond']['write_alignments'] and popmap==None</filter>
         </data>
     </xml>
     <xml name="gstacks_outputs_macro" token_tooladd="">
--- a/test-data/cstacks/catalog.alleles.tsv	Tue Apr 27 09:27:26 2021 +0000
+++ b/test-data/cstacks/catalog.alleles.tsv	Wed Sep 01 11:28:07 2021 +0000
@@ -1,4 +1,4 @@
-# cstacks version 2.52; catalog generated on 2020-03-16 15:39:40
+# cstacks version 2.55; catalog generated on 2021-08-24 13:29:01
 0	1	AC	0	0
 0	1	CA	0	0
-# cstacks completed on 2020-03-16 15:39:40
+# cstacks completed on 2021-08-24 13:29:01
--- a/test-data/cstacks/catalog.snps.tsv	Tue Apr 27 09:27:26 2021 +0000
+++ b/test-data/cstacks/catalog.snps.tsv	Wed Sep 01 11:28:07 2021 +0000
@@ -1,4 +1,4 @@
-# cstacks version 2.52; catalog generated on 2020-03-16 15:39:40
+# cstacks version 2.55; catalog generated on 2021-08-24 13:29:01
 0	1	33	E	0	A	C	-	-
 0	1	88	E	0	A	C	-	-
-# cstacks completed on 2020-03-16 15:39:40
+# cstacks completed on 2021-08-24 13:29:01
--- a/test-data/cstacks/catalog.tags.tsv	Tue Apr 27 09:27:26 2021 +0000
+++ b/test-data/cstacks/catalog.tags.tsv	Wed Sep 01 11:28:07 2021 +0000
@@ -1,5 +1,5 @@
-# cstacks version 2.52; catalog generated on 2020-03-16 15:39:40
+# cstacks version 2.55; catalog generated on 2021-08-24 13:29:01
 0	1	consensus	0	1_1,2_1	AATTCGTTTGCTGCTTCAGGAATCTCTCGTATAATCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGAGAGAC	0	0	0
 0	2	consensus	0	1_2,2_2	AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT	0	0	0
 0	3	consensus	0	1_3,2_3	AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTGACTGCCACGCCAGCTACCTCTAGA	0	0	0
-# cstacks completed on 2020-03-16 15:39:40
+# cstacks completed on 2021-08-24 13:29:01
--- a/test-data/denovo_map/denovo_map.log	Tue Apr 27 09:27:26 2021 +0000
+++ b/test-data/denovo_map/denovo_map.log	Wed Sep 01 11:28:07 2021 +0000
@@ -1,5 +1,5 @@
-denovo_map.pl version 2.52 started at 2020-03-16 15:39:40
-/home/berntm/miniconda3/envs/__stacks@2.52/bin/denovo_map.pl --samples demultiplexed --popmap denovo_map/popmap_cstacks.tsv -o stacks_outputs --paired
+denovo_map.pl version 2.55 started at 2021-08-24 13:29:01
+/home/berntm/miniconda3/envs/mulled-v1-4cbe4390dde1292aa8dbfc7f3537b788791787f5ad55cd86edeadacb1e3df63a/bin/denovo_map.pl --samples demultiplexed --popmap denovo_map/popmap_cstacks.tsv -o stacks_outputs --paired
 
 ustacks
 ==========
@@ -305,4 +305,4 @@
 Populations is done.
 denovo_map.pl is done.
 
-denovo_map.pl completed at 2020-03-16 15:39:40
+denovo_map.pl completed at 2021-08-24 13:29:01
--- a/test-data/gentest.sh	Tue Apr 27 09:27:26 2021 +0000
+++ b/test-data/gentest.sh	Wed Sep 01 11:28:07 2021 +0000
@@ -1,9 +1,6 @@
 #!/usr/bin/env bash
-eval "$(conda shell.bash hook)"
-conda activate __stacks@2.52
-
-
-
+#eval "$(conda shell.bash hook)"
+#conda activate __stacks@2.52
 
 mkdir stacks_outputs
 denovo_map.pl --samples demultiplexed --popmap denovo_map/popmap_cstacks.tsv -o stacks_outputs --paired  && 
Binary file test-data/gstacks/PopA_01.alns.bam has changed
Binary file test-data/gstacks/PopA_02.alns.bam has changed
Binary file test-data/gstacks/alignments.bam has changed
--- a/test-data/gstacks/catalog.calls.vcf	Tue Apr 27 09:27:26 2021 +0000
+++ b/test-data/gstacks/catalog.calls.vcf	Wed Sep 01 11:28:07 2021 +0000
@@ -1,6 +1,6 @@
 ##fileformat=VCFv4.2
-##fileDate=20200316
-##source="Stacks v2.52"
+##fileDate=20210824
+##source="Stacks v2.55"
 ##INFO=<ID=AD,Number=R,Type=Integer,Description="Total Depth for Each Allele">
 ##INFO=<ID=AF,Number=A,Type=Float,Description="Allele Frequency">
 ##INFO=<ID=DP,Number=1,Type=Integer,Description="Total Depth">
--- a/test-data/gstacks/gstacks.log	Tue Apr 27 09:27:26 2021 +0000
+++ b/test-data/gstacks/gstacks.log	Wed Sep 01 11:28:07 2021 +0000
@@ -1,4 +1,4 @@
-gstacks v2.52, executed 2020-03-16 15:39:40 (zlib-1.2.11)
+gstacks v2.55, executed 2021-08-24 13:29:01 (zlib-1.2.11)
 gstacks -P stacks_outputs -M denovo_map/popmap_cstacks.tsv
 Locus/sample distributions will be written to 'stacks_outputs/gstacks.log.distribs'.
 
--- a/test-data/gstacks/gstacks.log.distribs	Tue Apr 27 09:27:26 2021 +0000
+++ b/test-data/gstacks/gstacks.log.distribs	Wed Sep 01 11:28:07 2021 +0000
@@ -19,25 +19,25 @@
 Num. threads: 1
 Parallel time: 0.0
 Average thread time spent:
-     0.0  reading (3.0%)
-     0.0  processing (95.7%)
-             0.0 pre-alignments block (74.4%)
-             0.0  reformatting fw-reads (0.2%)
-             0.0  assembling (27.3%)
-             0.0  initializing alignments (8.7%)
-             0.0  aligning (36.6%)
+     0.0  reading (2.8%)
+     0.0  processing (95.9%)
+             0.0 pre-alignments block (76.1%)
+             0.0  reformatting fw-reads (0.1%)
+             0.0  assembling (17.5%)
+             0.0  initializing alignments (4.0%)
+             0.0  aligning (52.9%)
              0.0  merging read pairs (1.6%)
-             0.0 post-alignments block (19.8%)
+             0.0 post-alignments block (18.7%)
              0.0  filtering reads (0.0%)
-             0.0  counting nucleotides (3.2%)
-             0.0  genotyping (1.5%)
-             0.0  haplotyping (0.9%)
+             0.0  counting nucleotides (2.8%)
+             0.0  genotyping (1.2%)
+             0.0  haplotyping (1.0%)
              0.0  computing consensus (0.1%)
              0.0  building_fa (0.1%)
-             0.0  building_vcf (14.0%)
+             0.0  building_vcf (13.4%)
      0.0  writing_fa (0.0%)
      0.0  writing_vcf (0.9%)
-     0.0  clocking (0.1%)
-Total time spent writing vcf: 0.0 (0.8%)
+     0.0  clocking (0.2%)
+Total time spent writing vcf: 0.0 (0.9%)
 VCFwrite block size: mean=1.0(n=3); max=1
 END clockings
--- a/test-data/populations/populations.log	Tue Apr 27 09:27:26 2021 +0000
+++ b/test-data/populations/populations.log	Wed Sep 01 11:28:07 2021 +0000
@@ -1,4 +1,4 @@
-populations v2.52, executed 2020-03-16 15:39:40 (zlib-1.2.11)
+populations v2.55, executed 2021-08-24 13:29:01 (zlib-1.2.11)
 populations -P stacks_outputs -M denovo_map/popmap_cstacks.tsv
 Locus/sample distributions will be written to 'stacks_outputs/populations.log.distribs'.
 populations parameters selected:
--- a/test-data/sstacks/PopA_01.matches.tsv	Tue Apr 27 09:27:26 2021 +0000
+++ b/test-data/sstacks/PopA_01.matches.tsv	Wed Sep 01 11:28:07 2021 +0000
@@ -1,6 +1,6 @@
-# sstacks version 2.52; generated on 2020-03-16 15:39:40
+# sstacks version 2.55; generated on 2021-08-24 13:29:01
 1	1	1	AC	9	94M
 1	1	1	CA	9	94M
 2	1	2	consensus	28	94M
 3	1	3	consensus	20	94M
-# sstacks completed on 2020-03-16 15:39:40
+# sstacks completed on 2021-08-24 13:29:01
--- a/test-data/sstacks/PopA_02.matches.tsv	Tue Apr 27 09:27:26 2021 +0000
+++ b/test-data/sstacks/PopA_02.matches.tsv	Wed Sep 01 11:28:07 2021 +0000
@@ -1,6 +1,6 @@
-# sstacks version 2.52; generated on 2020-03-16 15:39:40
+# sstacks version 2.55; generated on 2021-08-24 13:29:01
 1	2	1	AC	6	94M
 1	2	1	CA	6	94M
 2	2	2	consensus	28	94M
 3	2	3	consensus	20	94M
-# sstacks completed on 2020-03-16 15:39:40
+# sstacks completed on 2021-08-24 13:29:01
--- a/test-data/tsv2bam/tsv2bam.log	Tue Apr 27 09:27:26 2021 +0000
+++ b/test-data/tsv2bam/tsv2bam.log	Wed Sep 01 11:28:07 2021 +0000
@@ -1,4 +1,4 @@
-tsv2bam v2.52, executed 2020-03-16 15:39:40 (zlib-1.2.11)
+tsv2bam v2.55, executed 2021-08-24 13:29:01 (zlib-1.2.11)
 tsv2bam -P stacks_outputs -M denovo_map/popmap_cstacks.tsv -R demultiplexed/
 Configuration for this run:
   Stacks directory: 'stacks_outputs/'
--- a/test-data/ustacks/PopA_01.alleles.tsv	Tue Apr 27 09:27:26 2021 +0000
+++ b/test-data/ustacks/PopA_01.alleles.tsv	Wed Sep 01 11:28:07 2021 +0000
@@ -1,4 +1,4 @@
-# ustacks version 2.52; generated on 2020-03-16 15:39:40
+# ustacks version 2.55; generated on 2021-08-24 13:29:01
 1	1	AC	50.00	9
 1	1	CA	50.00	9
-# ustacks completed on 2020-03-16 15:39:40
+# ustacks completed on 2021-08-24 13:29:01
--- a/test-data/ustacks/PopA_01.snps.tsv	Tue Apr 27 09:27:26 2021 +0000
+++ b/test-data/ustacks/PopA_01.snps.tsv	Wed Sep 01 11:28:07 2021 +0000
@@ -1,4 +1,4 @@
-# ustacks version 2.52; generated on 2020-03-16 15:39:40
+# ustacks version 2.55; generated on 2021-08-24 13:29:01
 1	1	0	O	24.95	A	-		
 1	1	1	O	24.95	A	-		
 1	1	2	O	24.95	T	-		
@@ -281,4 +281,4 @@
 1	3	91	O	27.73	A	-		
 1	3	92	O	27.73	G	-		
 1	3	93	O	27.73	A	-		
-# ustacks completed on 2020-03-16 15:39:40
+# ustacks completed on 2021-08-24 13:29:01
--- a/test-data/ustacks/PopA_01.tags.tsv	Tue Apr 27 09:27:26 2021 +0000
+++ b/test-data/ustacks/PopA_01.tags.tsv	Wed Sep 01 11:28:07 2021 +0000
@@ -1,4 +1,4 @@
-# ustacks version 2.52; generated on 2020-03-16 15:39:40
+# ustacks version 2.55; generated on 2021-08-24 13:29:01
 1	1	consensus			AATTCGTTTGCTGCTTCAGGAATCTCTCGTATAATCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGAGAGAC	0	0	0
 1	1	model			OOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOEOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOEOOOOO			
 1	1	primary	0	lane1_fakedata7_0 1:N:0:/1	AATTCGTTTGCTGCTTCAGGAATCTCTCGTATACTCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGAGAGAC			
@@ -71,4 +71,4 @@
 1	3	primary	0	lane1_fakedata2_19 1:N:0:/1	AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTGACTGCCACGCCAGCTACCTCTAGA			
 1	3	secondary		lane1_fakedata2_5 1:N:0:/1	AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTAAAACACTCTGACTGCCACGCCAGCTACCTCTAGA			
 1	3	secondary		lane1_fakedata2_17 1:N:0:/1	AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTGACTGCCACGCCAGCTACCTCCAGA			
-# ustacks completed on 2020-03-16 15:39:40
+# ustacks completed on 2021-08-24 13:29:01
--- a/test-data/ustacks/PopA_02.alleles.tsv	Tue Apr 27 09:27:26 2021 +0000
+++ b/test-data/ustacks/PopA_02.alleles.tsv	Wed Sep 01 11:28:07 2021 +0000
@@ -1,4 +1,4 @@
-# ustacks version 2.52; generated on 2020-03-16 15:39:40
+# ustacks version 2.55; generated on 2021-08-24 13:29:01
 2	1	AC	50.00	6
 2	1	CA	50.00	6
-# ustacks completed on 2020-03-16 15:39:40
+# ustacks completed on 2021-08-24 13:29:01
--- a/test-data/ustacks/PopA_02.snps.tsv	Tue Apr 27 09:27:26 2021 +0000
+++ b/test-data/ustacks/PopA_02.snps.tsv	Wed Sep 01 11:28:07 2021 +0000
@@ -1,4 +1,4 @@
-# ustacks version 2.52; generated on 2020-03-16 15:39:40
+# ustacks version 2.55; generated on 2021-08-24 13:29:01
 2	1	0	O	16.64	A	-		
 2	1	1	O	16.64	A	-		
 2	1	2	O	16.64	T	-		
@@ -281,4 +281,4 @@
 2	3	91	O	27.73	A	-		
 2	3	92	O	27.73	G	-		
 2	3	93	O	27.73	A	-		
-# ustacks completed on 2020-03-16 15:39:40
+# ustacks completed on 2021-08-24 13:29:01
--- a/test-data/ustacks/PopA_02.tags.tsv	Tue Apr 27 09:27:26 2021 +0000
+++ b/test-data/ustacks/PopA_02.tags.tsv	Wed Sep 01 11:28:07 2021 +0000
@@ -1,4 +1,4 @@
-# ustacks version 2.52; generated on 2020-03-16 15:39:40
+# ustacks version 2.55; generated on 2021-08-24 13:29:01
 2	1	consensus			AATTCGTTTGCTGCTTCAGGAATCTCTCGTATAATCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGAGAGAC	0	0	0
 2	1	model			OOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOEOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOOEOOOOO			
 2	1	primary	0	lane1_fakedata7_7 1:N:0:/1	AATTCGTTTGCTGCTTCAGGAATCTCTCGTATACTCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGAGAGAC			
@@ -65,4 +65,4 @@
 2	3	primary	0	lane1_fakedata2_18 1:N:0:/1	AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTGACTGCCACGCCAGCTACCTCTAGA			
 2	3	primary	0	lane1_fakedata2_19 1:N:0:/1	AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTGACTGCCACGCCAGCTACCTCTAGA			
 2	3	secondary		lane1_fakedata2_1 1:N:0:/1	AATTCTCTACACCACTGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTGACTGCCACGCCAGCTACCTCTAGA			
-# ustacks completed on 2020-03-16 15:39:40
+# ustacks completed on 2021-08-24 13:29:01