changeset 5:42201b90e3f4 draft

"planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/stacks2 commit 16654f3b3faaba994cea5fda8d4907ea4f059605"
author iuc
date Thu, 14 Apr 2022 09:26:53 +0000
parents e345aadf914f
children cd5f98911089
files macros.xml macros_process.xml stacks_clonefilter.xml test-data/demultiplexed/PopA_01.fq test-data/procrad/R1.fa.discards test-data/procrad/R1.fq test-data/procrad/R1.fq.discards test-data/procrad/R1_01.fq test-data/procrad/R1_02.fq test-data/procrad/R1_03.fq test-data/procrad/R1_04.fq test-data/procrad/R2.fq test-data/procrad/R2.fq.discards test-data/procrad/R2_01.fq test-data/procrad/R2_02.fq test-data/procrad/R2_03.fq test-data/procrad/R2_04.fq test-data/procrad/process_radtags.out test-data/procrad/process_radtags2.out test-data/procrad/process_radtags_paired.out test-data/procrad/process_radtags_paired_no_barcode.out test-data/shortreads/PopA_01.fq test-data/shortreads/process_shortreads.out
diffstat 23 files changed, 56035 insertions(+), 113564 deletions(-) [+]
line wrap: on
line diff
--- a/macros.xml	Wed Sep 01 11:28:07 2021 +0000
+++ b/macros.xml	Thu Apr 14 09:26:53 2022 +0000
@@ -2,15 +2,15 @@
 <macros>
     <xml name="requirements">
         <requirements>
-            <requirement type="package" version="@STACKS_VERSION@">stacks</requirement>
+            <requirement type="package" version="@TOOL_VERSION@">stacks</requirement>
             <requirement type="package" version="3.7">python</requirement>
             <requirement type="package" version="4.6.0">findutils</requirement>
             <yield/>
         </requirements>
     </xml>
 
-    <token name="@STACKS_VERSION@">2.55</token>
-    <token name="@WRAPPER_VERSION@">1</token>
+    <token name="@TOOL_VERSION@">2.55</token>
+    <token name="@VERSION_SUFFIX@">2</token>
     <token name="@PROFILE@">20.05</token>
 
     <xml name="citation">
@@ -217,22 +217,32 @@
         </expand>
     </xml>
 
+
+    <xml name="barcode_selector">
+        <param name="barcode_encoding" type="select" label="Barcode location">
+            <option value="">Disabled</option>
+            <yield/>
+        </param>
+        <param name="barcode" argument="-b" type="data" format="tabular,txt" optional="true" label="Barcode file" help="The barcode file is only used if barcode_input"/>
+    </xml>
+
+
     <!-- fastq input (used in denovomap, tsv2bam, ustacks)
          - fastq_optional: makes fastq input optional (true/false)
          - se_option: wording for "single end" option (for tsv2bam this is the
               reverse reads for the others its the forward reads)
          - help: help text -->
-    <xml name="fastq_input" token_fastq_optional="false" token_se_option="single end or forward reads" token_help="">
+    <xml name="fastq_input" token_fastq_optional="false" token_se_option="single end or forward reads" token_help="" token_multiple="false" token_listtype="paired">
         <conditional name="input_type">
             <param name="input_type_select" type="select" label="Short read data from individuals" help="@HELP@">
                 <option value="single" selected="true">@SE_OPTION@</option>
                 <option value="paired">(paired) dataset list</option>
             </param>
             <when value="single">
-                <param name="fqinputs" argument="-f" format="fastqsanger,fastqsanger.gz,fasta,fasta.gz" type="data" label="Reads" multiple="true" optional="@FASTQ_OPTIONAL@"/>
+                <param name="fqinputs" argument="-f" format="fastqsanger,fastqsanger.gz,fasta,fasta.gz" type="data" label="Reads" multiple="@MULTIPLE@" optional="@FASTQ_OPTIONAL@"/>
             </when>
             <when value="paired">
-                <param name="fqinputs" argument="-f" type="data_collection" collection_type="list:paired" format="fastqsanger,fastqsanger.gz,fasta,fasta.gz" label="List for forward reads or read pairs" optional="@FASTQ_OPTIONAL@"/>
+                <param name="fqinputs" argument="-f" type="data_collection" collection_type="@LISTTYPE@" format="fastqsanger,fastqsanger.gz,fasta,fasta.gz" label="List for forward reads or read pairs" optional="@FASTQ_OPTIONAL@"/>
             </when>
         </conditional>
     </xml>
--- a/macros_process.xml	Wed Sep 01 11:28:07 2021 +0000
+++ b/macros_process.xml	Thu Apr 14 09:26:53 2022 +0000
@@ -4,14 +4,17 @@
 
 <macros>
 
+  
     <token name="@PROCESS_IOOPTIONS@"><![CDATA[
     -p stacks_inputs/
     #if $input_type.input_type_select == "paired"
         --paired
     #end if
     -i $inputype
-    -b '$barcode'
     $input_type.barcode_encoding
+    #if $input_type.barcode_encoding != ''
+        -b '$input_type.barcode'
+    #end if
     #if str( $outype ) != "auto"
         -y $outype
     #end if
@@ -38,20 +41,11 @@
     </xml>
 
     <xml name="process_outputs">
-        <collection name="demultiplexed" type="list" label="${tool.name} on ${on_string} Demultiplexed reads">
-            <filter>input_type['input_type_select'] == "single"</filter>
-            <expand macro="discover_faqgz_output_macro" pattern="(?P&lt;name&gt;.+)" dir="stacks_outputs"/>
-        </collection>
-        <collection name="demultiplexed_paired" type="list:paired" label="${tool.name} on ${on_string} Demultiplexed reads">
-            <filter>input_type['input_type_select'] == "paired"</filter>
-            <expand macro="discover_faqgz_output_macro" pattern="(?P&lt;identifier_0&gt;.+)\.(?P&lt;identifier_1&gt;[^.]+)" dir="stacks_outputs"/>
-        </collection>
-
+        <yield/>
         <collection name="remaining" type="list:paired" label="${tool.name} on ${on_string} Remaining orphan reads">
             <filter>input_type['input_type_select'] == "paired"</filter>
             <expand macro="discover_faqgz_output_macro" pattern="(?P&lt;identifier_0&gt;.+)\.rem\.(?P&lt;identifier_1&gt;[^.]+)" dir="stacks_outputs/remaining"/>
         </collection>
-
         <!-- note irrespective of -y output is always named fastq and are never zipped -->
         <collection name="discarded" type="list" label="${tool.name} on ${on_string} Discarded reads">
             <filter>capture is True and input_type['input_type_select'] == "single"</filter>
@@ -78,7 +72,7 @@
                 <param argument="--filter-illumina" name="filter_illumina" type="boolean" checked="false" truevalue="--filter-illumina" falsevalue="" label="Discard reads that have been marked by Illumina's chastity/purity filter as failing"/>
             </when>
             <when value="no">
-                <param argument="--len_limit" type="integer" value="" optional="true" label="Minimum sequence length" help="useful if your data has already been trimmed"/>
+                <param argument="--len_limit" type="integer" value="" optional="true" label="Minimum sequence length" help="Useful if your data has already been trimmed"/>
             </when>
         </conditional>
         <param name="capture" type="boolean" checked="false" truevalue="-D" falsevalue="" argument="-D" label="Capture discarded reads to a file"/>
--- a/stacks_clonefilter.xml	Wed Sep 01 11:28:07 2021 +0000
+++ b/stacks_clonefilter.xml	Thu Apr 14 09:26:53 2022 +0000
@@ -1,4 +1,4 @@
-<tool id="stacks2_clonefilter" name="Stacks2: clone filter" profile="@PROFILE@" version="@STACKS_VERSION@+galaxy@WRAPPER_VERSION@">
+<tool id="stacks2_clonefilter" name="Stacks2: clone filter" profile="@PROFILE@" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@">
 <description>Identify PCR clones</description>
     <macros>
         <import>macros.xml</import>
--- a/test-data/demultiplexed/PopA_01.fq	Wed Sep 01 11:28:07 2021 +0000
+++ b/test-data/demultiplexed/PopA_01.fq	Thu Apr 14 09:26:53 2022 +0000
@@ -1,147 +1,3 @@
-@lane1_fakedata0_0 1:N:0:/1
-AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
-+
-BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
-@lane1_fakedata0_1 1:N:0:/1
-AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
-+
-BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
-@lane1_fakedata0_2 1:N:0:/1
-AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
-+
-BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
-@lane1_fakedata0_3 1:N:0:/1
-AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
-+
-BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
-@lane1_fakedata0_4 1:N:0:/1
-AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
-+
-BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
-@lane1_fakedata0_5 1:N:0:/1
-AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
-+
-BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
-@lane1_fakedata0_6 1:N:0:/1
-AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
-+
-BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
-@lane1_fakedata0_7 1:N:0:/1
-AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
-+
-BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
-@lane1_fakedata0_8 1:N:0:/1
-AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
-+
-BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
-@lane1_fakedata0_9 1:N:0:/1
-AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
-+
-BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
-@lane1_fakedata0_10 1:N:0:/1
-AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
-+
-BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
-@lane1_fakedata0_11 1:N:0:/1
-AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
-+
-BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
-@lane1_fakedata0_12 1:N:0:/1
-AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
-+
-BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
-@lane1_fakedata0_13 1:N:0:/1
-AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
-+
-BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
-@lane1_fakedata0_14 1:N:0:/1
-AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
-+
-BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
-@lane1_fakedata0_15 1:N:0:/1
-AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAGTCTGGGAATGGGATTTCATAATTAAGGACTAT
-+
-BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
-@lane1_fakedata0_16 1:N:0:/1
-AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
-+
-BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
-@lane1_fakedata0_17 1:N:0:/1
-AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
-+
-BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
-@lane1_fakedata0_18 1:N:0:/1
-AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
-+
-BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
-@lane1_fakedata0_19 1:N:0:/1
-AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
-+
-BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
-@lane1_fakedata0_20 1:N:0:/1
-AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
-+
-BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
-@lane1_fakedata0_21 1:N:0:/1
-AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
-+
-BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
-@lane1_fakedata0_22 1:N:0:/1
-AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
-+
-BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
-@lane1_fakedata0_23 1:N:0:/1
-AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
-+
-BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
-@lane1_fakedata0_24 1:N:0:/1
-AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
-+
-BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
-@lane1_fakedata0_25 1:N:0:/1
-AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
-+
-BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
-@lane1_fakedata0_26 1:N:0:/1
-AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
-+
-BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
-@lane1_fakedata0_27 1:N:0:/1
-AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
-+
-BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
-@lane1_fakedata2_0 1:N:0:/1
-AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTGACTGCCACGCCAGCTACCTCTAGA
-+
-BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
-@lane1_fakedata2_1 1:N:0:/1
-AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTGACTGCCACGCCAGCTACCTCTAGA
-+
-BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
-@lane1_fakedata2_2 1:N:0:/1
-AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTGACTGCCACGCCAGCTACCTCTAGA
-+
-BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
-@lane1_fakedata2_3 1:N:0:/1
-AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTGACTGCCACGCCAGCTACCTCTAGA
-+
-BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
-@lane1_fakedata2_4 1:N:0:/1
-AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTGACTGCCACGCCAGCTACCTCTAGA
-+
-BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
-@lane1_fakedata2_5 1:N:0:/1
-AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTAAAACACTCTGACTGCCACGCCAGCTACCTCTAGA
-+
-BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
-@lane1_fakedata2_6 1:N:0:/1
-AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTGACTGCCACGCCAGCTACCTCTAGA
-+
-BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
-@lane1_fakedata2_7 1:N:0:/1
-AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTGACTGCCACGCCAGCTACCTCTAGA
-+
-BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
 @lane1_fakedata2_8 1:N:0:/1
 AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTGACTGCCACGCCAGCTACCTCTAGA
 +
@@ -190,75 +46,3 @@
 AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTGACTGCCACGCCAGCTACCTCTAGA
 +
 BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
-@lane1_fakedata7_0 1:N:0:/1
-AATTCGTTTGCTGCTTCAGGAATCTCTCGTATACTCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGAGAGAC
-+
-BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
-@lane1_fakedata7_1 1:N:0:/1
-AATTCGTTTGCTGCTTCAGGAATCTCTCGTATACTCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGAGAGAC
-+
-BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
-@lane1_fakedata7_2 1:N:0:/1
-AATTCGTTTGCTGCTTCAGGAATCTCTCGTATACTCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGAGAGAC
-+
-BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
-@lane1_fakedata7_3 1:N:0:/1
-AATTCGTTTGCTGCTTCAGGAATCTCTCGTATACTCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGAGAGAC
-+
-BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
-@lane1_fakedata7_4 1:N:0:/1
-AATTCGTTTGCTGCTTCAGGAATCTCTCGTATACTCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGAGAGAC
-+
-BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
-@lane1_fakedata7_5 1:N:0:/1
-AATTCGTTTGCTGCTTCAGGAATCTCTCGTATACTCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGAGAGAC
-+
-BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
-@lane1_fakedata7_6 1:N:0:/1
-AATTCGTTTGCTGCTTCAGGAATCTCTCGTATACTCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGAGAGAC
-+
-BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
-@lane1_fakedata7_7 1:N:0:/1
-AATTCGTTTGCTGCTTCAGGAATCTCTCGTATACTCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGAGAGAC
-+
-BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
-@lane1_fakedata7_8 1:N:0:/1
-AATTCGTTTGCTGCTTCAGGAATCTCTCGTATACTCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGAGAGAC
-+
-BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
-@lane1_fakedata7_9 1:N:0:/1
-AATTCGTTTGCTGCTTCAGGAATCTCTCGTATAATCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGCGAGAC
-+
-BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
-@lane1_fakedata7_10 1:N:0:/1
-AATTCGTTTGCTGCTTCAGGAATCTCTCGTATAATCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGCGAGAC
-+
-BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
-@lane1_fakedata7_11 1:N:0:/1
-AATTCGTTTGCTGCTTCAGGAATCTCTCGTATAATCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGCGAGAC
-+
-BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
-@lane1_fakedata7_12 1:N:0:/1
-AATTCGTTTGCTGCTTCAGGAATCTCTCGTATAATCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGCGAGAC
-+
-BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
-@lane1_fakedata7_13 1:N:0:/1
-AATTCGTTTGCTGCTTCAGGAATCTCTCGTATAATCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGCGAGAC
-+
-BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
-@lane1_fakedata7_14 1:N:0:/1
-AATTCGTTTGCTGCTTCAGGAATCTCTCGTATAATCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGCGAGAC
-+
-BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
-@lane1_fakedata7_15 1:N:0:/1
-AATTCGTTTGCTGCTTCAGGAATCTCTCGTATAATCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGCGAGAC
-+
-BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
-@lane1_fakedata7_16 1:N:0:/1
-AATTCGTTTGCTGCTTCAGGAATCTCTCGTATAATCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGCGAGAC
-+
-BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
-@lane1_fakedata7_17 1:N:0:/1
-AATTCGTTTGCTGCTTCAGGAATCTCTCGTATAATCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGCGAGAC
-+
-BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
--- a/test-data/procrad/R1.fa.discards	Wed Sep 01 11:28:07 2021 +0000
+++ /dev/null	Thu Jan 01 00:00:00 1970 +0000
@@ -1,9556 +0,0 @@
->lane1_fakedata0_11 1:N:0:
-GGTTGTAATTTGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
->lane1_fakedata1_0 1:N:0:
-GGTGTGAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGCTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_1 1:N:0:
-GGTGTGAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_2 1:N:0:
-GGTGTGAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_3 1:N:0:
-GGTGTGAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_4 1:N:0:
-GGTGTGAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_5 1:N:0:
-GGTGTGAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_6 1:N:0:
-GGTGTGAATTACGTCCGCGGTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_7 1:N:0:
-GGTGTGAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_8 1:N:0:
-GGTGTGAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_9 1:N:0:
-GGTGTGAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_0 1:N:0:
-TTTAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
->lane1_fakedata1_1 1:N:0:
-TTTAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
->lane1_fakedata1_2 1:N:0:
-TTTAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
->lane1_fakedata1_3 1:N:0:
-TTTAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
->lane1_fakedata1_4 1:N:0:
-TTTAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
->lane1_fakedata1_5 1:N:0:
-TTTAAGAATTACGTCCGCGTTTAGATTTGGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
->lane1_fakedata1_6 1:N:0:
-TTTAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
->lane1_fakedata1_7 1:N:0:
-TTTAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
->lane1_fakedata1_8 1:N:0:
-TTTAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
->lane1_fakedata1_9 1:N:0:
-TTTAAGAATTACGTCCGCGTTGAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
->lane1_fakedata1_10 1:N:0:
-TTTAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
->lane1_fakedata1_11 1:N:0:
-TTTAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
->lane1_fakedata1_12 1:N:0:
-TTTAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_13 1:N:0:
-TTTAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_14 1:N:0:
-TTTAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_15 1:N:0:
-TTTAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
->lane1_fakedata1_16 1:N:0:
-TTTAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_17 1:N:0:
-TTTAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_18 1:N:0:
-TTTAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_19 1:N:0:
-TTTAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_20 1:N:0:
-TTTAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_21 1:N:0:
-TTTAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_22 1:N:0:
-TTTAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_23 1:N:0:
-TTTAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_0 1:N:0:
-GGTTGTAATTACGTCCGCGTTTAAATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_1 1:N:0:
-GGTTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_2 1:N:0:
-GGTTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_3 1:N:0:
-GGTTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_4 1:N:0:
-GGTTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_5 1:N:0:
-GGTTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_6 1:N:0:
-GGTTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_7 1:N:0:
-GGTTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_8 1:N:0:
-GGTTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_9 1:N:0:
-GGTTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_10 1:N:0:
-GGTTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_11 1:N:0:
-GGTTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_12 1:N:0:
-GGTTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAGAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_13 1:N:0:
-GGTTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_14 1:N:0:
-GGTTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_15 1:N:0:
-GGTTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_16 1:N:0:
-GGTTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_17 1:N:0:
-GGTTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_18 1:N:0:
-GGTTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_19 1:N:0:
-GGTTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_20 1:N:0:
-GGTTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTCGCT
->lane1_fakedata1_21 1:N:0:
-GGTTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_22 1:N:0:
-GGTTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAATTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_23 1:N:0:
-GGTTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_24 1:N:0:
-GGTTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_25 1:N:0:
-GGTTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_26 1:N:0:
-GGTTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCACGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_27 1:N:0:
-GGTTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_28 1:N:0:
-GGTTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_29 1:N:0:
-GGTTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_0 1:N:0:
-TGATGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_1 1:N:0:
-TGATGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_2 1:N:0:
-TGATGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_3 1:N:0:
-TGATGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_4 1:N:0:
-TGATGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_5 1:N:0:
-TGATGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCATTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_6 1:N:0:
-TGATGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_7 1:N:0:
-TGATGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_8 1:N:0:
-TGATGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_9 1:N:0:
-TGATGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_10 1:N:0:
-TGATGTAATTACGTCCGCGATTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_11 1:N:0:
-TGATGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_12 1:N:0:
-TGATGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_13 1:N:0:
-TGATGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTTAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_14 1:N:0:
-TGATGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_15 1:N:0:
-TGATGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_16 1:N:0:
-TGATGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
->lane1_fakedata1_17 1:N:0:
-TGATGTAATTACGTCCGCGTTTAGATTTTGGAATCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTTTTTTTTAGGGTAGCT
->lane1_fakedata1_18 1:N:0:
-TGATGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
->lane1_fakedata1_19 1:N:0:
-TGATGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
->lane1_fakedata1_20 1:N:0:
-TGATGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
->lane1_fakedata1_21 1:N:0:
-TGATGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
->lane1_fakedata1_22 1:N:0:
-TGATGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
->lane1_fakedata1_23 1:N:0:
-TGATGTAATTACGTCCGCGTTTAGAGTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
->lane1_fakedata1_24 1:N:0:
-TGATGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
->lane1_fakedata1_25 1:N:0:
-TGATGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
->lane1_fakedata1_26 1:N:0:
-TGATGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
->lane1_fakedata1_27 1:N:0:
-TGATGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
->lane1_fakedata1_28 1:N:0:
-TGATGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
->lane1_fakedata1_29 1:N:0:
-TGATGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
->lane1_fakedata1_30 1:N:0:
-TGATGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
->lane1_fakedata1_31 1:N:0:
-TGATGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
->lane1_fakedata1_0 1:N:0:
-CATCATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_1 1:N:0:
-CATCATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_2 1:N:0:
-CATCATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_3 1:N:0:
-CATCATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_4 1:N:0:
-CATCATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_5 1:N:0:
-CATCATAATTACGTCCGCGTTTCGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_6 1:N:0:
-CATCATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_7 1:N:0:
-CATCATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_8 1:N:0:
-CATCATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_9 1:N:0:
-CATCATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_10 1:N:0:
-CATCATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_11 1:N:0:
-CATCATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_12 1:N:0:
-CATCATAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_13 1:N:0:
-CATCATAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_14 1:N:0:
-CATCATAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_15 1:N:0:
-CATCATAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_16 1:N:0:
-CATCATAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_17 1:N:0:
-CATCATAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_18 1:N:0:
-CATCATAATTACGTCGGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_19 1:N:0:
-CATCATAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_20 1:N:0:
-CATCATAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_21 1:N:0:
-CATCATAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_22 1:N:0:
-CATCATAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_23 1:N:0:
-CATCATAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_0 1:N:0:
-AGGAAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_1 1:N:0:
-AGGAAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGCAAGCTGAAAGTATTCCTTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_2 1:N:0:
-AGGAAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_3 1:N:0:
-AGGAAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_4 1:N:0:
-AGGAAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_5 1:N:0:
-AGGAAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_6 1:N:0:
-AGGAAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_7 1:N:0:
-AGGAAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_8 1:N:0:
-AGGAAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_9 1:N:0:
-AGGAAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_10 1:N:0:
-AGGAAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_11 1:N:0:
-AGGAAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_12 1:N:0:
-AGGAAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_13 1:N:0:
-AGGAAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_14 1:N:0:
-AGGAAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_15 1:N:0:
-AGGAAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_16 1:N:0:
-AGGAAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_17 1:N:0:
-AGGAAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_18 1:N:0:
-AGGAAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_19 1:N:0:
-AGGAAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_20 1:N:0:
-AGGAAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_21 1:N:0:
-AGGAAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGAGTAGCT
->lane1_fakedata1_0 1:N:0:
-GGGTAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_1 1:N:0:
-GGGTAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_2 1:N:0:
-GGGTAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_3 1:N:0:
-GGGTAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_4 1:N:0:
-GGGTAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_5 1:N:0:
-GGGTAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_6 1:N:0:
-GGGTAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_7 1:N:0:
-GGGTAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_8 1:N:0:
-GGGTAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_9 1:N:0:
-GGGTAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_10 1:N:0:
-GGGTAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_11 1:N:0:
-GGGTAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_12 1:N:0:
-GGGTAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_13 1:N:0:
-GGGTAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_0 1:N:0:
-AAGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTTCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_1 1:N:0:
-AAGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_2 1:N:0:
-AAGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_3 1:N:0:
-AAGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_4 1:N:0:
-AAGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_5 1:N:0:
-AAGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_6 1:N:0:
-AAGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_7 1:N:0:
-AAGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_8 1:N:0:
-AAGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_9 1:N:0:
-AAGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_10 1:N:0:
-AAGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_11 1:N:0:
-AAGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_12 1:N:0:
-AAGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_13 1:N:0:
-AAGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_14 1:N:0:
-AAGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_15 1:N:0:
-AAGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_16 1:N:0:
-AAGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_17 1:N:0:
-AAGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_18 1:N:0:
-AAGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_19 1:N:0:
-AAGATAAATTACGTCCGCGTATAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGATAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_20 1:N:0:
-AAGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_21 1:N:0:
-AAGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_22 1:N:0:
-AAGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_23 1:N:0:
-AAGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_24 1:N:0:
-AAGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_25 1:N:0:
-AAGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_0 1:N:0:
-ATAAGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
->lane1_fakedata1_1 1:N:0:
-ATAAGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
->lane1_fakedata1_2 1:N:0:
-ATAAGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
->lane1_fakedata1_3 1:N:0:
-ATAAGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
->lane1_fakedata1_4 1:N:0:
-ATAAGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
->lane1_fakedata1_5 1:N:0:
-ATAAGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
->lane1_fakedata1_6 1:N:0:
-ATAAGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_7 1:N:0:
-ATAAGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_8 1:N:0:
-ATAAGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_9 1:N:0:
-ATAAGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_10 1:N:0:
-ATAAGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_11 1:N:0:
-ATAAGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_0 1:N:0:
-ATGTAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_1 1:N:0:
-ATGTAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_2 1:N:0:
-ATGTAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_3 1:N:0:
-ATGTAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_4 1:N:0:
-ATGTAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTTCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_5 1:N:0:
-ATGTAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_6 1:N:0:
-ATGTAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_7 1:N:0:
-ATGTAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_8 1:N:0:
-ATGTAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_9 1:N:0:
-ATGTAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_10 1:N:0:
-ATGTAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_11 1:N:0:
-ATGTAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_12 1:N:0:
-ATGTAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_13 1:N:0:
-ATGTAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCTGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_14 1:N:0:
-ATGTAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_15 1:N:0:
-ATGTAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_0 1:N:0:
-AAGGATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_1 1:N:0:
-AAGGATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_2 1:N:0:
-AAGGATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_3 1:N:0:
-AAGGATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_4 1:N:0:
-AAGGATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_5 1:N:0:
-AAGGATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_6 1:N:0:
-AAGGATAATTACGTCCGCGTTTAGTTTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_7 1:N:0:
-AAGGATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_8 1:N:0:
-AAGGATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_9 1:N:0:
-AAGGATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_10 1:N:0:
-AAGGATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_11 1:N:0:
-AAGGATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_12 1:N:0:
-AAGGATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_13 1:N:0:
-AAGGATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_14 1:N:0:
-AAGGATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_15 1:N:0:
-AAGGATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_16 1:N:0:
-AAGGATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_17 1:N:0:
-AAGGATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTATTAGGGTAGCT
->lane1_fakedata1_18 1:N:0:
-AAGGATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_19 1:N:0:
-AAGGATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_20 1:N:0:
-AAGGATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_21 1:N:0:
-AAGGATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_22 1:N:0:
-AAGGATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_23 1:N:0:
-AAGGATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_0 1:N:0:
-GGAGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_1 1:N:0:
-GGAGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_2 1:N:0:
-GGAGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_3 1:N:0:
-GGAGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_4 1:N:0:
-GGAGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_5 1:N:0:
-GGAGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_6 1:N:0:
-GGAGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_7 1:N:0:
-GGAGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_0 1:N:0:
-GTTTTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
->lane1_fakedata1_1 1:N:0:
-GTTTTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_0 1:N:0:
-TGATAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_1 1:N:0:
-TGATAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_2 1:N:0:
-TGATAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_3 1:N:0:
-TGATAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_4 1:N:0:
-TGATAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_5 1:N:0:
-TGATAAAATTACGTCCGCGCTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_6 1:N:0:
-TGATAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_7 1:N:0:
-TGATAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_8 1:N:0:
-TGATAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_9 1:N:0:
-TGATAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_10 1:N:0:
-TGATAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_11 1:N:0:
-TGATAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_12 1:N:0:
-TGATAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_13 1:N:0:
-TGATAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_14 1:N:0:
-TGATAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_15 1:N:0:
-TGATAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_16 1:N:0:
-TGATAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_17 1:N:0:
-TGATAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_18 1:N:0:
-TGATAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_19 1:N:0:
-TGATAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_20 1:N:0:
-TGATAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_21 1:N:0:
-TGATAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCGTTTTTAGGGTAGCT
->lane1_fakedata1_22 1:N:0:
-TGATAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_23 1:N:0:
-TGATAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_24 1:N:0:
-TGATAAAATTACGTCCGCTTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_25 1:N:0:
-TGATAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_0 1:N:0:
-GTTGATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_1 1:N:0:
-GTTGATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_2 1:N:0:
-GTTGATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_3 1:N:0:
-GTTGATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_4 1:N:0:
-GTTGATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_5 1:N:0:
-GTTGATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_6 1:N:0:
-GTTGATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_7 1:N:0:
-GTTGATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_8 1:N:0:
-GTTGATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_9 1:N:0:
-GTTGATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_10 1:N:0:
-GTTGATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_11 1:N:0:
-GTTGATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_12 1:N:0:
-GTTGATAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_13 1:N:0:
-GTTGATAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_14 1:N:0:
-GTTGATAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_15 1:N:0:
-GTTGATAATTACGTCCGCGTTTGGATTTAGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_16 1:N:0:
-GTTGATAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGTTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_17 1:N:0:
-GTTGATAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_18 1:N:0:
-GTTGATAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_19 1:N:0:
-GTTGATAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_20 1:N:0:
-GTTGATAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_21 1:N:0:
-GTTGATAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_22 1:N:0:
-GTTGATAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_23 1:N:0:
-GTTGATAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_0 1:N:0:
-AGATTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTATAGGGTAGCT
->lane1_fakedata1_1 1:N:0:
-AGATTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_2 1:N:0:
-AGATTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_3 1:N:0:
-AGATTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_4 1:N:0:
-AGATTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_5 1:N:0:
-AGATTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_6 1:N:0:
-AGATTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_7 1:N:0:
-AGATTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_8 1:N:0:
-AGATTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_9 1:N:0:
-AGATTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_10 1:N:0:
-AGATTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_11 1:N:0:
-AGATTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_12 1:N:0:
-AGATTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_13 1:N:0:
-AGATTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_14 1:N:0:
-AGATTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_15 1:N:0:
-AGATTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_16 1:N:0:
-AGATTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_17 1:N:0:
-AGATTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_18 1:N:0:
-AGATTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_19 1:N:0:
-AGATTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_20 1:N:0:
-AGATTAAATTACGTCCGCGTTTAGATTTTGGACTCTGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_21 1:N:0:
-AGATTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_22 1:N:0:
-AGATTAAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_23 1:N:0:
-AGATTAAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_24 1:N:0:
-AGATTAAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_25 1:N:0:
-AGATTAAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_26 1:N:0:
-AGATTAAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_27 1:N:0:
-AGATTAAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_28 1:N:0:
-AGATTAAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_29 1:N:0:
-AGATTAAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTGTTTAGGGTAGCT
->lane1_fakedata1_30 1:N:0:
-AGATTAAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_31 1:N:0:
-AGATTAAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGTCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_32 1:N:0:
-AGATTAAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_33 1:N:0:
-AGATTAAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_34 1:N:0:
-AGATTAAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_35 1:N:0:
-AGATTAAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_36 1:N:0:
-AGATTAAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_37 1:N:0:
-AGATTAAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_38 1:N:0:
-AGATTAAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_39 1:N:0:
-AGATTAAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_40 1:N:0:
-AGATTAAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_41 1:N:0:
-AGATTAAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_42 1:N:0:
-AGATTAAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_43 1:N:0:
-AGATTAAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGTACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_0 1:N:0:
-GTATAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_1 1:N:0:
-GTATAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_2 1:N:0:
-GTATAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_3 1:N:0:
-GTATAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_4 1:N:0:
-GTATAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_5 1:N:0:
-GTATAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_6 1:N:0:
-GTATAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_7 1:N:0:
-GTATAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_8 1:N:0:
-GTATAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_9 1:N:0:
-GTATAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_10 1:N:0:
-GTATAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_11 1:N:0:
-GTATAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGAT
->lane1_fakedata1_0 1:N:0:
-TTGGGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_1 1:N:0:
-TTGGGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_2 1:N:0:
-TTGGGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_3 1:N:0:
-TTGGGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_4 1:N:0:
-TTGGGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_5 1:N:0:
-TTGGGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_6 1:N:0:
-TTGGGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_7 1:N:0:
-TTGGGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_8 1:N:0:
-TTGGGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_9 1:N:0:
-TTGGGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_10 1:N:0:
-TTGGGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_11 1:N:0:
-TTGGGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_12 1:N:0:
-TTGGGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_13 1:N:0:
-TTGGGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_14 1:N:0:
-TTGGGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_15 1:N:0:
-TTGGGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_16 1:N:0:
-TTGGGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_17 1:N:0:
-TTGGGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_18 1:N:0:
-TTGGGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_19 1:N:0:
-TTGGGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_20 1:N:0:
-TTGGGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_21 1:N:0:
-TTGGGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_22 1:N:0:
-TTGGGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_23 1:N:0:
-TTGGGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_24 1:N:0:
-TTGGGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_25 1:N:0:
-TTGGGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_0 1:N:0:
-ATATATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_1 1:N:0:
-ATATATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_2 1:N:0:
-ATATATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_3 1:N:0:
-ATATATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_4 1:N:0:
-ATATATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_5 1:N:0:
-ATATATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_6 1:N:0:
-ATATATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_7 1:N:0:
-ATATATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_8 1:N:0:
-ATATATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_9 1:N:0:
-ATATATAATTACGTCCGCGTTTAGATTTGGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_10 1:N:0:
-ATATATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_11 1:N:0:
-ATATATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_12 1:N:0:
-ATATATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_13 1:N:0:
-ATATATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_14 1:N:0:
-ATATATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_15 1:N:0:
-ATATATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_16 1:N:0:
-ATATATAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_17 1:N:0:
-ATATATAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_18 1:N:0:
-ATATATAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_19 1:N:0:
-ATATATAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_20 1:N:0:
-ATATATAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_21 1:N:0:
-ATATATAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_22 1:N:0:
-ATATATAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_23 1:N:0:
-ATATATAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_24 1:N:0:
-ATATATAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_25 1:N:0:
-ATATATAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_26 1:N:0:
-ATATATAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_27 1:N:0:
-ATATATAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_28 1:N:0:
-ATATATAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_29 1:N:0:
-ATATATAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_30 1:N:0:
-ATATATAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_31 1:N:0:
-ATATATAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGAAAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_0 1:N:0:
-GATGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_1 1:N:0:
-GATGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_2 1:N:0:
-GATGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAACT
->lane1_fakedata1_3 1:N:0:
-GATGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_4 1:N:0:
-GATGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_5 1:N:0:
-GATGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_6 1:N:0:
-GATGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_7 1:N:0:
-GATGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_8 1:N:0:
-GATGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_9 1:N:0:
-GATGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_10 1:N:0:
-GATGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGCTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_11 1:N:0:
-GATGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTCTTAGGGTAGCT
->lane1_fakedata1_12 1:N:0:
-GATGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_13 1:N:0:
-GATGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_14 1:N:0:
-GATGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_15 1:N:0:
-GATGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_16 1:N:0:
-GATGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_17 1:N:0:
-GATGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_18 1:N:0:
-GATGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_19 1:N:0:
-GATGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_20 1:N:0:
-GATGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_21 1:N:0:
-GATGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_22 1:N:0:
-GATGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_23 1:N:0:
-GATGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_24 1:N:0:
-GATGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_25 1:N:0:
-GATGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_26 1:N:0:
-GATGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_27 1:N:0:
-GATGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_28 1:N:0:
-GATGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGAACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_29 1:N:0:
-GATGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_0 1:N:0:
-GGGAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_1 1:N:0:
-GGGAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_2 1:N:0:
-GGGAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_3 1:N:0:
-GGGAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_4 1:N:0:
-GGGAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCATCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_5 1:N:0:
-GGGAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_6 1:N:0:
-GGGAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTGCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_7 1:N:0:
-GGGAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_8 1:N:0:
-GGGAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_9 1:N:0:
-GGGAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_10 1:N:0:
-GGGAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_11 1:N:0:
-GGGAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_12 1:N:0:
-GGGAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_13 1:N:0:
-GGGAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_14 1:N:0:
-GGGAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_15 1:N:0:
-GGGAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_16 1:N:0:
-GGGAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_17 1:N:0:
-GGGAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_18 1:N:0:
-GGGAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_19 1:N:0:
-GGGAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_20 1:N:0:
-GGGAATAATTACGTCCCCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_21 1:N:0:
-GGGAATAATTACGTCCGCGTTTAGATCTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_22 1:N:0:
-GGGAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_23 1:N:0:
-GGGAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_24 1:N:0:
-GGGAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_25 1:N:0:
-GGGAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_26 1:N:0:
-GGGAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_27 1:N:0:
-GGGAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCTAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_28 1:N:0:
-GGGAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_29 1:N:0:
-GGGAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_30 1:N:0:
-GGGAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_31 1:N:0:
-GGGAATAATTACGTCCACGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_32 1:N:0:
-GGGAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_33 1:N:0:
-GGGAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_34 1:N:0:
-GGGAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_35 1:N:0:
-GGGAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCATGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_36 1:N:0:
-GGGAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_37 1:N:0:
-GGGAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_38 1:N:0:
-GGGAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_39 1:N:0:
-GGGAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_40 1:N:0:
-GGGAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_41 1:N:0:
-GGGAATAATTACGTCCGCGTTTAGATTTTGTACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_0 1:N:0:
-AGGGTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_1 1:N:0:
-AGGGTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_2 1:N:0:
-AGGGTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_3 1:N:0:
-AGGGTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_4 1:N:0:
-AGGGTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_5 1:N:0:
-AGGGTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_6 1:N:0:
-AGGGTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_7 1:N:0:
-AGGGTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_8 1:N:0:
-AGGGTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_9 1:N:0:
-AGGGTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_10 1:N:0:
-AGGGTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_11 1:N:0:
-AGGGTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_12 1:N:0:
-AGGGTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_13 1:N:0:
-AGGGTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_0 1:N:0:
-GAGTTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_1 1:N:0:
-GAGTTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_2 1:N:0:
-GAGTTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_3 1:N:0:
-GAGTTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_4 1:N:0:
-GAGTTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_5 1:N:0:
-GAGTTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_6 1:N:0:
-GAGTTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_7 1:N:0:
-GAGTTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_8 1:N:0:
-GAGTTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_9 1:N:0:
-GAGTTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAACT
->lane1_fakedata1_10 1:N:0:
-GAGTTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_11 1:N:0:
-GAGTTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_12 1:N:0:
-GAGTTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_13 1:N:0:
-GAGTTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_14 1:N:0:
-GAGTTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_15 1:N:0:
-GAGTTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_16 1:N:0:
-GAGTTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_17 1:N:0:
-GAGTTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_18 1:N:0:
-GAGTTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_19 1:N:0:
-GAGTTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTGGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_20 1:N:0:
-GAGTTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_21 1:N:0:
-GAGTTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_22 1:N:0:
-GAGTTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_23 1:N:0:
-GAGTTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_24 1:N:0:
-GAGTTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_25 1:N:0:
-GAGTTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_0 1:N:0:
-ATAGTTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_1 1:N:0:
-ATAGTTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_2 1:N:0:
-ATAGTTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_3 1:N:0:
-ATAGTTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_4 1:N:0:
-ATAGTTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_5 1:N:0:
-ATAGTTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_6 1:N:0:
-ATAGTTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_7 1:N:0:
-ATAGTTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_8 1:N:0:
-ATAGTTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_9 1:N:0:
-ATAGTTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_10 1:N:0:
-ATAGTTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGGATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_11 1:N:0:
-ATAGTTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_0 1:N:0:
-TGTGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_1 1:N:0:
-TGTGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_2 1:N:0:
-TGTGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGCTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_3 1:N:0:
-TGTGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_4 1:N:0:
-TGTGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_5 1:N:0:
-TGTGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_6 1:N:0:
-TGTGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_7 1:N:0:
-TGTGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_8 1:N:0:
-TGTGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_9 1:N:0:
-TGTGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_10 1:N:0:
-TGTGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGAAAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_11 1:N:0:
-TGTGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_12 1:N:0:
-TGTGAGAATTACGTCCGCGTTTAGATTTTGGCCTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_13 1:N:0:
-TGTGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_14 1:N:0:
-TGTGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_15 1:N:0:
-TGTGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_0 1:N:0:
-TTTGTGAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_1 1:N:0:
-TTTGTGAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_2 1:N:0:
-TTTGTGAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_3 1:N:0:
-TTTGTGAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_4 1:N:0:
-TTTGTGAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_5 1:N:0:
-TTTGTGAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_6 1:N:0:
-TTTGTGAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_7 1:N:0:
-TTTGTGAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_8 1:N:0:
-TTTGTGAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_9 1:N:0:
-TTTGTGAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_10 1:N:0:
-TTTGTGAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_11 1:N:0:
-TTTGTGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_12 1:N:0:
-TTTGTGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_13 1:N:0:
-TTTGTGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_14 1:N:0:
-TTTGTGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_15 1:N:0:
-TTTGTGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_16 1:N:0:
-TTTGTGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_17 1:N:0:
-TTTGTGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_18 1:N:0:
-TTTGTGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_19 1:N:0:
-TTTGTGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_20 1:N:0:
-TTTGTGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_21 1:N:0:
-TTTGTGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_0 1:N:0:
-GGAAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_1 1:N:0:
-GGAAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_2 1:N:0:
-GGAAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_3 1:N:0:
-GGAAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_4 1:N:0:
-GGAAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_5 1:N:0:
-GGAAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_6 1:N:0:
-GGAAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_7 1:N:0:
-GGAAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_8 1:N:0:
-GGAAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_9 1:N:0:
-GGAAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_10 1:N:0:
-GGAAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_11 1:N:0:
-GGAAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_12 1:N:0:
-GGAAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_13 1:N:0:
-GGAAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_14 1:N:0:
-GGAAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_15 1:N:0:
-GGAAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_16 1:N:0:
-GGAAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_17 1:N:0:
-GGAAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGGCAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_18 1:N:0:
-GGAAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_19 1:N:0:
-GGAAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_20 1:N:0:
-GGAAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_21 1:N:0:
-GGAAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_22 1:N:0:
-GGAAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_23 1:N:0:
-GGAAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_0 1:N:0:
-AATAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_1 1:N:0:
-AATAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_2 1:N:0:
-AATAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_3 1:N:0:
-AATAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_4 1:N:0:
-AATAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_5 1:N:0:
-AATAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_6 1:N:0:
-AATAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_7 1:N:0:
-AATAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_8 1:N:0:
-AATAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_9 1:N:0:
-AATAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_10 1:N:0:
-AATAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_11 1:N:0:
-AATAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_12 1:N:0:
-AATAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_13 1:N:0:
-AATAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_0 1:N:0:
-TTAAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
->lane1_fakedata1_1 1:N:0:
-TTAAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
->lane1_fakedata1_2 1:N:0:
-TTAAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
->lane1_fakedata1_3 1:N:0:
-TTAAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
->lane1_fakedata1_4 1:N:0:
-TTAAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
->lane1_fakedata1_5 1:N:0:
-TTAAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
->lane1_fakedata1_6 1:N:0:
-TTAAATAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_7 1:N:0:
-TTAAATAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTCTTAGGGTAGCT
->lane1_fakedata1_8 1:N:0:
-TTAAATAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_9 1:N:0:
-TTAAATAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_10 1:N:0:
-TTAAATAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_11 1:N:0:
-TTAAATAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTATGTCCGTTGCCAGGAAAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_0 1:N:0:
-TAGTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
->lane1_fakedata1_1 1:N:0:
-TAGTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
->lane1_fakedata1_2 1:N:0:
-TAGTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
->lane1_fakedata1_3 1:N:0:
-TAGTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
->lane1_fakedata1_4 1:N:0:
-TAGTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
->lane1_fakedata1_5 1:N:0:
-TAGTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
->lane1_fakedata1_6 1:N:0:
-TAGTGTAATTACGTCCGCGTTTAGATTTTGGACTCAGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
->lane1_fakedata1_7 1:N:0:
-TAGTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
->lane1_fakedata1_8 1:N:0:
-TAGTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
->lane1_fakedata1_9 1:N:0:
-TAGTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
->lane1_fakedata1_10 1:N:0:
-TAGTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_11 1:N:0:
-TAGTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_12 1:N:0:
-TAGTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_13 1:N:0:
-TAGTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_14 1:N:0:
-TAGTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_15 1:N:0:
-TAGTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_16 1:N:0:
-TAGTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_17 1:N:0:
-TAGTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_18 1:N:0:
-TAGTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_19 1:N:0:
-TAGTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_0 1:N:0:
-AAGAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_1 1:N:0:
-AAGAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_2 1:N:0:
-AAGAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_3 1:N:0:
-AAGAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGTT
->lane1_fakedata1_4 1:N:0:
-AAGAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_5 1:N:0:
-AAGAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_6 1:N:0:
-AAGAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_7 1:N:0:
-AAGAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAATAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_8 1:N:0:
-AAGAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_9 1:N:0:
-AAGAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAACTAAGCTGAAAGTATTCCCTTCTCCTTTATAGGGTAGCT
->lane1_fakedata1_10 1:N:0:
-AAGAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_11 1:N:0:
-AAGAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCATGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_12 1:N:0:
-AAGAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_13 1:N:0:
-AAGAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_14 1:N:0:
-AAGAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_15 1:N:0:
-AAGAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_16 1:N:0:
-AAGAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_17 1:N:0:
-AAGAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_18 1:N:0:
-AAGAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_19 1:N:0:
-AAGAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_0 1:N:0:
-GGGTTGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_1 1:N:0:
-GGGTTGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_2 1:N:0:
-GGGTTGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_3 1:N:0:
-GGGTTGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_0 1:N:0:
-TGGAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_1 1:N:0:
-TGGAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_2 1:N:0:
-TGGAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_3 1:N:0:
-TGGAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGCCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_4 1:N:0:
-TGGAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_5 1:N:0:
-TGGAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_6 1:N:0:
-TGGAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_7 1:N:0:
-TGGAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_8 1:N:0:
-TGGAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_9 1:N:0:
-TGGAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGGAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_10 1:N:0:
-TGGAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_11 1:N:0:
-TGGAAGAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_12 1:N:0:
-TGGAAGAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_13 1:N:0:
-TGGAAGAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_14 1:N:0:
-TGGAAGAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_15 1:N:0:
-TGGAAGAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_16 1:N:0:
-TGGAAGAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_17 1:N:0:
-TGGAAGAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_18 1:N:0:
-TGGAAGAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_19 1:N:0:
-TGGAAGAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_20 1:N:0:
-TGGAAGAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_21 1:N:0:
-TGGAAGAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGTTAGCT
->lane1_fakedata1_0 1:N:0:
-GAGAAGAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_1 1:N:0:
-GAGAAGAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_2 1:N:0:
-GAGAAGAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_3 1:N:0:
-GAGAAGAATTACGTCCGCGTTTGGAGTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_4 1:N:0:
-GAGAAGAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_5 1:N:0:
-GAGAAGAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_6 1:N:0:
-GAGAAGAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_7 1:N:0:
-GAGAAGAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_8 1:N:0:
-GAGAAGAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_9 1:N:0:
-GAGAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_10 1:N:0:
-GAGAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCAGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_11 1:N:0:
-GAGAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_12 1:N:0:
-GAGAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_13 1:N:0:
-GAGAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCATGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_14 1:N:0:
-GAGAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_15 1:N:0:
-GAGAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTACTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGTT
->lane1_fakedata1_16 1:N:0:
-GAGAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_17 1:N:0:
-GAGAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_0 1:N:0:
-AGTAGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_1 1:N:0:
-AGTAGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_2 1:N:0:
-AGTAGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_3 1:N:0:
-AGTAGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_4 1:N:0:
-AGTAGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_5 1:N:0:
-AGTAGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_6 1:N:0:
-AGTAGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_7 1:N:0:
-AGTAGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_8 1:N:0:
-AGTAGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_9 1:N:0:
-AGTAGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_10 1:N:0:
-AGTAGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_11 1:N:0:
-AGTAGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_12 1:N:0:
-AGTAGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_13 1:N:0:
-AGTAGAAATTACGTCCGCGTGTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_14 1:N:0:
-AGTAGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_15 1:N:0:
-AGTAGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_16 1:N:0:
-AGTAGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_17 1:N:0:
-AGTAGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_18 1:N:0:
-AGTAGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_19 1:N:0:
-AGTAGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTCTTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_20 1:N:0:
-AGTAGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_21 1:N:0:
-AGTAGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGTGTAGCT
->lane1_fakedata1_22 1:N:0:
-AGTAGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_23 1:N:0:
-AGTAGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_0 1:N:0:
-AGTAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_1 1:N:0:
-AGTAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_2 1:N:0:
-AGTAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_3 1:N:0:
-AGTAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_4 1:N:0:
-AGTAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACATGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_5 1:N:0:
-AGTAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_6 1:N:0:
-AGTAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_7 1:N:0:
-AGTAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_8 1:N:0:
-AGTAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_9 1:N:0:
-AGTAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_10 1:N:0:
-AGTAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_11 1:N:0:
-AGTAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_12 1:N:0:
-AGTAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_13 1:N:0:
-AGTAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_14 1:N:0:
-AGTAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_15 1:N:0:
-AGTAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_0 1:N:0:
-GGGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_1 1:N:0:
-GGGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_2 1:N:0:
-GGGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_3 1:N:0:
-GGGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_4 1:N:0:
-GGGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_5 1:N:0:
-GGGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_6 1:N:0:
-GGGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_7 1:N:0:
-GGGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_8 1:N:0:
-GGGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_9 1:N:0:
-GGGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTAGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_10 1:N:0:
-GGGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_11 1:N:0:
-GGGATAAATTACGTCCGCGTTTAGCTTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_12 1:N:0:
-GGGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_13 1:N:0:
-GGGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_14 1:N:0:
-GGGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_15 1:N:0:
-GGGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_16 1:N:0:
-GGGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_17 1:N:0:
-GGGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_0 1:N:0:
-TGTTTTAATTACGTCCGCGTTTGGATTTTGGTCTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_1 1:N:0:
-TGTTTTAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_2 1:N:0:
-TGTTTTAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_3 1:N:0:
-TGTTTTAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_4 1:N:0:
-TGTTTTAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_5 1:N:0:
-TGTTTTAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_6 1:N:0:
-TGTTTTAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_7 1:N:0:
-TGTTTTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_8 1:N:0:
-TGTTTTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_9 1:N:0:
-TGTTTTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_10 1:N:0:
-TGTTTTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_11 1:N:0:
-TGTTTTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_12 1:N:0:
-TGTTTTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_13 1:N:0:
-TGTTTTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_0 1:N:0:
-ATGATGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
->lane1_fakedata1_1 1:N:0:
-ATGATGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
->lane1_fakedata1_2 1:N:0:
-ATGATGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
->lane1_fakedata1_3 1:N:0:
-ATGATGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
->lane1_fakedata1_4 1:N:0:
-ATGATGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
->lane1_fakedata1_5 1:N:0:
-ATGATGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
->lane1_fakedata1_6 1:N:0:
-ATGATGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
->lane1_fakedata1_7 1:N:0:
-ATGATGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
->lane1_fakedata1_8 1:N:0:
-ATGATGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
->lane1_fakedata1_9 1:N:0:
-ATGATGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
->lane1_fakedata1_10 1:N:0:
-ATGATGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
->lane1_fakedata1_11 1:N:0:
-ATGATGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
->lane1_fakedata1_12 1:N:0:
-ATGATGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_13 1:N:0:
-ATGATGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCATGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_14 1:N:0:
-ATGATGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_15 1:N:0:
-ATGATGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_16 1:N:0:
-ATGATGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_17 1:N:0:
-ATGATGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_18 1:N:0:
-ATGATGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_19 1:N:0:
-ATGATGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_20 1:N:0:
-ATGATGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_21 1:N:0:
-ATGATGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_22 1:N:0:
-ATGATGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata1_23 1:N:0:
-ATGATGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
->lane1_fakedata3_0 1:N:0:
-GGTGTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_1 1:N:0:
-GGTGTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_2 1:N:0:
-GGTGTGAATTATTATTAGGCGAATCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_3 1:N:0:
-GGTGTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_4 1:N:0:
-GGTGTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_5 1:N:0:
-GGTGTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_6 1:N:0:
-GGTGTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_7 1:N:0:
-GGTGTGAATTACTATTAGGCGAAGCTGACCGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_8 1:N:0:
-GGTGTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_9 1:N:0:
-GGTGTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_10 1:N:0:
-GGTGTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_11 1:N:0:
-GGTGTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
->lane1_fakedata3_12 1:N:0:
-GGTGTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
->lane1_fakedata3_13 1:N:0:
-GGTGTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAGAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
->lane1_fakedata3_14 1:N:0:
-GGTGTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
->lane1_fakedata3_15 1:N:0:
-GGTGTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
->lane1_fakedata3_16 1:N:0:
-GGTGTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
->lane1_fakedata3_17 1:N:0:
-GGTGTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
->lane1_fakedata3_18 1:N:0:
-GGTGTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
->lane1_fakedata3_19 1:N:0:
-GGTGTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
->lane1_fakedata3_20 1:N:0:
-GGTGTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
->lane1_fakedata3_21 1:N:0:
-GGTGTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
->lane1_fakedata3_0 1:N:0:
-TTTAAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_1 1:N:0:
-TTTAAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_2 1:N:0:
-TTTAAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_3 1:N:0:
-TTTAAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_4 1:N:0:
-TTTAAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_5 1:N:0:
-TTTAAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_6 1:N:0:
-TTTAAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_7 1:N:0:
-TTTAAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_8 1:N:0:
-TTTAAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_9 1:N:0:
-TTTAAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_10 1:N:0:
-TTTAAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_11 1:N:0:
-TTTAAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_12 1:N:0:
-TTTAAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_13 1:N:0:
-TTTAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_14 1:N:0:
-TTTAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_15 1:N:0:
-TTTAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_16 1:N:0:
-TTTAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_17 1:N:0:
-TTTAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_18 1:N:0:
-TTTAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_19 1:N:0:
-TTTAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_20 1:N:0:
-TTTAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_21 1:N:0:
-TTTAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_22 1:N:0:
-TTTAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_23 1:N:0:
-TTTAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_24 1:N:0:
-TTTAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_25 1:N:0:
-TTTAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_0 1:N:0:
-GGTTGTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_1 1:N:0:
-GGTTGTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_2 1:N:0:
-GGTTGTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_3 1:N:0:
-GGTTGTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_4 1:N:0:
-GGTTGTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_5 1:N:0:
-GGTTGTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_6 1:N:0:
-GGTTGTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_7 1:N:0:
-GGTTGTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_8 1:N:0:
-GGTTGTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_9 1:N:0:
-GGTTGTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_10 1:N:0:
-GGTTGTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_11 1:N:0:
-GGTTGTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_12 1:N:0:
-GGTTGTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_13 1:N:0:
-GGTTGTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_14 1:N:0:
-GGTTGTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_15 1:N:0:
-GGTTGTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_16 1:N:0:
-GGTTGTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_17 1:N:0:
-GGTTGTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_18 1:N:0:
-GGTTGTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_19 1:N:0:
-GGTTGTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_20 1:N:0:
-GGTTGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_21 1:N:0:
-GGTTGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_22 1:N:0:
-GGTTGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_23 1:N:0:
-GGTTGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_24 1:N:0:
-GGTTGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTTGTAA
->lane1_fakedata3_25 1:N:0:
-GGTTGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_26 1:N:0:
-GGTTGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_27 1:N:0:
-GGTTGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_28 1:N:0:
-GGTTGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_29 1:N:0:
-GGTTGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_30 1:N:0:
-GGTTGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_31 1:N:0:
-GGTTGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_32 1:N:0:
-GGTTGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_33 1:N:0:
-GGTTGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_34 1:N:0:
-GGTTGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_35 1:N:0:
-GGTTGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_36 1:N:0:
-GGTTGTAATTACTATTAGGCGAAGCTAACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_37 1:N:0:
-GGTTGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_38 1:N:0:
-GGTTGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_39 1:N:0:
-GGTTGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_0 1:N:0:
-TGATGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_1 1:N:0:
-TGATGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAATCCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_2 1:N:0:
-TGATGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_3 1:N:0:
-TGATGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_4 1:N:0:
-TGATGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_5 1:N:0:
-TGATGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_6 1:N:0:
-TGATGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_7 1:N:0:
-TGATGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_8 1:N:0:
-TGATGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_9 1:N:0:
-TGATGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_10 1:N:0:
-TGATGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_11 1:N:0:
-TGATGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_12 1:N:0:
-TGATGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_13 1:N:0:
-TGATGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_14 1:N:0:
-TGATGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_15 1:N:0:
-TGATGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_0 1:N:0:
-ATGGGGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_1 1:N:0:
-ATGGGGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_2 1:N:0:
-ATGGGGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_3 1:N:0:
-ATGGGGAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
->lane1_fakedata3_4 1:N:0:
-ATGGGGAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
->lane1_fakedata3_5 1:N:0:
-ATGGGGAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
->lane1_fakedata3_0 1:N:0:
-CATCATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
->lane1_fakedata3_1 1:N:0:
-CATCATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
->lane1_fakedata3_2 1:N:0:
-CATCATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
->lane1_fakedata3_3 1:N:0:
-CATCATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTACACCTGAGTGCTCAAATGTCGTAA
->lane1_fakedata3_4 1:N:0:
-CATCATAATTACTATTAGGCGAAGCTGACAAACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
->lane1_fakedata3_5 1:N:0:
-CATCATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
->lane1_fakedata3_6 1:N:0:
-CATCATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
->lane1_fakedata3_7 1:N:0:
-CATCATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
->lane1_fakedata3_8 1:N:0:
-CATCATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
->lane1_fakedata3_9 1:N:0:
-CATCATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
->lane1_fakedata3_10 1:N:0:
-CATCATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_11 1:N:0:
-CATCATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_12 1:N:0:
-CATCATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCGAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_13 1:N:0:
-CATCATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_14 1:N:0:
-CATCATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_15 1:N:0:
-CATCATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_16 1:N:0:
-CATCATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_17 1:N:0:
-CATCATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_18 1:N:0:
-CATCATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_19 1:N:0:
-CATCATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_0 1:N:0:
-AGGAAAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAATGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_1 1:N:0:
-AGGAAAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAATGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_2 1:N:0:
-AGGAAAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAATGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_3 1:N:0:
-AGGAAAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAATGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_4 1:N:0:
-AGGAAAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAATGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_5 1:N:0:
-AGGAAAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAATGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_6 1:N:0:
-AGGAAAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAATGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_7 1:N:0:
-AGGAAAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAATGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_8 1:N:0:
-AGGAAAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAATGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_9 1:N:0:
-AGGAAAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAATGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_10 1:N:0:
-AGGAAAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_11 1:N:0:
-AGGAAAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_12 1:N:0:
-AGGAAAAATTACTATTAGGCGAAGCTGACAGACTGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_13 1:N:0:
-AGGAAAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_14 1:N:0:
-AGGAAAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_15 1:N:0:
-AGGAAAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_16 1:N:0:
-AGGAAAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_17 1:N:0:
-AGGAAAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_18 1:N:0:
-AGGAAAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_19 1:N:0:
-AGGAAAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_0 1:N:0:
-GGGTAAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_1 1:N:0:
-GGGTAAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_2 1:N:0:
-GGGTAAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_3 1:N:0:
-GGGTAAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_4 1:N:0:
-GGGTAAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_5 1:N:0:
-GGGTAAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_6 1:N:0:
-GGGTAAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_7 1:N:0:
-GGGTAAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_8 1:N:0:
-GGGTAAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_9 1:N:0:
-GGGTAAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_10 1:N:0:
-GGGTAAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_11 1:N:0:
-GGGTAAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_0 1:N:0:
-AAGATAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_1 1:N:0:
-AAGATAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_2 1:N:0:
-AAGATAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_3 1:N:0:
-AAGATAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_4 1:N:0:
-AAGATAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_5 1:N:0:
-AAGATAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_6 1:N:0:
-AAGATAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_7 1:N:0:
-AAGATAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_8 1:N:0:
-AAGATAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_9 1:N:0:
-AAGATAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_10 1:N:0:
-AAGATAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAACACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_11 1:N:0:
-AAGATAAATTACTATTAGGCGAAGCTTACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_12 1:N:0:
-AAGATAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_13 1:N:0:
-AAGATAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATAAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_14 1:N:0:
-AAGATAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_15 1:N:0:
-AAGATAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_0 1:N:0:
-ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_1 1:N:0:
-ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_2 1:N:0:
-ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_3 1:N:0:
-ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_4 1:N:0:
-ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_5 1:N:0:
-ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_6 1:N:0:
-ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_7 1:N:0:
-ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_8 1:N:0:
-ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_9 1:N:0:
-ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_10 1:N:0:
-ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_11 1:N:0:
-ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_12 1:N:0:
-ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_13 1:N:0:
-ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_14 1:N:0:
-ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_15 1:N:0:
-ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_16 1:N:0:
-ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_17 1:N:0:
-ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_18 1:N:0:
-ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_19 1:N:0:
-ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_20 1:N:0:
-ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_21 1:N:0:
-ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_22 1:N:0:
-ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_23 1:N:0:
-ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_24 1:N:0:
-ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_25 1:N:0:
-ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_26 1:N:0:
-ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_27 1:N:0:
-ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_28 1:N:0:
-ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_29 1:N:0:
-ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_30 1:N:0:
-ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_31 1:N:0:
-ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_32 1:N:0:
-ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_33 1:N:0:
-ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_34 1:N:0:
-ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_35 1:N:0:
-ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_36 1:N:0:
-ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_37 1:N:0:
-ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_38 1:N:0:
-ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_39 1:N:0:
-ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_40 1:N:0:
-ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_41 1:N:0:
-ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_42 1:N:0:
-ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_43 1:N:0:
-ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_44 1:N:0:
-ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_45 1:N:0:
-ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_46 1:N:0:
-ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAATAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_47 1:N:0:
-ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_0 1:N:0:
-ATGTAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_1 1:N:0:
-ATGTAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_2 1:N:0:
-ATGTAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_3 1:N:0:
-ATGTAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_4 1:N:0:
-ATGTAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_5 1:N:0:
-ATGTAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_6 1:N:0:
-ATGTAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_7 1:N:0:
-ATGTAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_8 1:N:0:
-ATGTAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_9 1:N:0:
-ATGTAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_10 1:N:0:
-ATGTAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_11 1:N:0:
-ATGTAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_12 1:N:0:
-ATGTAGAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
->lane1_fakedata3_13 1:N:0:
-ATGTAGAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
->lane1_fakedata3_14 1:N:0:
-ATGTAGAATTACTAGTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAACG
->lane1_fakedata3_15 1:N:0:
-ATGTAGAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
->lane1_fakedata3_16 1:N:0:
-ATGTAGAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTATACCTGAGTGCTCAAACGTCGTAATG
->lane1_fakedata3_17 1:N:0:
-ATGTAGAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
->lane1_fakedata3_18 1:N:0:
-ATGTAGAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
->lane1_fakedata3_19 1:N:0:
-ATGTAGAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
->lane1_fakedata3_20 1:N:0:
-ATGTAGAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
->lane1_fakedata3_21 1:N:0:
-ATGTAGAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
->lane1_fakedata3_22 1:N:0:
-ATGTAGAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
->lane1_fakedata3_23 1:N:0:
-ATGTAGAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
->lane1_fakedata3_0 1:N:0:
-AAGGATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_1 1:N:0:
-AAGGATAATTACTATTAGGCGAAGCTGACAGACGGTGCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_2 1:N:0:
-AAGGATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_3 1:N:0:
-AAGGATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_4 1:N:0:
-AAGGATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_5 1:N:0:
-AAGGATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_6 1:N:0:
-AAGGATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_7 1:N:0:
-AAGGATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_8 1:N:0:
-AAGGATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_9 1:N:0:
-AAGGATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_10 1:N:0:
-AAGGATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_11 1:N:0:
-AAGGATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_12 1:N:0:
-AAGGATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_13 1:N:0:
-AAGGATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_14 1:N:0:
-AAGGATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_15 1:N:0:
-AAGGATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_16 1:N:0:
-AAGGATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_17 1:N:0:
-AAGGATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_18 1:N:0:
-AAGGATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_19 1:N:0:
-AAGGATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_20 1:N:0:
-AAGGATAATTACTATTAGGCGATGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_21 1:N:0:
-AAGGATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_22 1:N:0:
-AAGGATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_23 1:N:0:
-AAGGATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTCAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_24 1:N:0:
-AAGGATAATTACTATTAGGCGAAGCTGACAGACGGCTCATATGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_25 1:N:0:
-AAGGATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_26 1:N:0:
-AAGGATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_27 1:N:0:
-AAGGATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_28 1:N:0:
-AAGGATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_29 1:N:0:
-AAGGATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_30 1:N:0:
-AAGGATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_31 1:N:0:
-AAGGATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_32 1:N:0:
-AAGGATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_33 1:N:0:
-AAGGATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_0 1:N:0:
-GGAGAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
->lane1_fakedata3_1 1:N:0:
-GGAGAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
->lane1_fakedata3_2 1:N:0:
-GGAGAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
->lane1_fakedata3_3 1:N:0:
-GGAGAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
->lane1_fakedata3_4 1:N:0:
-GGAGAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
->lane1_fakedata3_5 1:N:0:
-GGAGAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
->lane1_fakedata3_6 1:N:0:
-GGAGAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
->lane1_fakedata3_7 1:N:0:
-GGAGAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
->lane1_fakedata3_8 1:N:0:
-GGAGAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
->lane1_fakedata3_9 1:N:0:
-GGAGAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
->lane1_fakedata3_10 1:N:0:
-GGAGAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
->lane1_fakedata3_11 1:N:0:
-GGAGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_12 1:N:0:
-GGAGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_13 1:N:0:
-GGAGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_14 1:N:0:
-GGAGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_15 1:N:0:
-GGAGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_16 1:N:0:
-GGAGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCCAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_17 1:N:0:
-GGAGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_18 1:N:0:
-GGAGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_19 1:N:0:
-GGAGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_20 1:N:0:
-GGAGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_21 1:N:0:
-GGAGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_0 1:N:0:
-GTTTTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_1 1:N:0:
-GTTTTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_2 1:N:0:
-GTTTTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_3 1:N:0:
-GTTTTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_4 1:N:0:
-GTTTTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_5 1:N:0:
-GTTTTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_6 1:N:0:
-GTTTTAAATTACTATTGGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_7 1:N:0:
-GTTTTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_8 1:N:0:
-GTTTTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_9 1:N:0:
-GTTTTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_10 1:N:0:
-GTTTTAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_11 1:N:0:
-GTTTTAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_12 1:N:0:
-GTTTTAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCTAACGTCGTAA
->lane1_fakedata3_13 1:N:0:
-GTTTTAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_14 1:N:0:
-GTTTTAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_15 1:N:0:
-GTTTTAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_16 1:N:0:
-GTTTTAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_17 1:N:0:
-GTTTTAAATTACTATTAGGCGAAGCTGACAGACGGCTCATAGGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_18 1:N:0:
-GTTTTAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_19 1:N:0:
-GTTTTAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_0 1:N:0:
-TGATAAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_1 1:N:0:
-TGATAAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_2 1:N:0:
-TGATAAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_3 1:N:0:
-TGATAAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_4 1:N:0:
-TGATAAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_5 1:N:0:
-TGATAAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_6 1:N:0:
-TGATAAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_7 1:N:0:
-TGATAAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_8 1:N:0:
-TGATAAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_9 1:N:0:
-TGATAAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_10 1:N:0:
-TGATAAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_11 1:N:0:
-TGATAAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_12 1:N:0:
-TGATAAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_13 1:N:0:
-TGATAAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_14 1:N:0:
-TGATAAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_15 1:N:0:
-TGATAAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_16 1:N:0:
-TGATAAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_17 1:N:0:
-TGATAAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_18 1:N:0:
-TGATAAAATTACTATAAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_19 1:N:0:
-TGATAAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATAAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_0 1:N:0:
-GTTGATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCATCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_1 1:N:0:
-GTTGATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_0 1:N:0:
-AGATTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_1 1:N:0:
-AGATTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_2 1:N:0:
-AGATTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_3 1:N:0:
-AGATTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_4 1:N:0:
-AGATTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_5 1:N:0:
-AGATTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_6 1:N:0:
-AGATTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_7 1:N:0:
-AGATTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_8 1:N:0:
-AGATTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_9 1:N:0:
-AGATTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_10 1:N:0:
-AGATTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_11 1:N:0:
-AGATTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_12 1:N:0:
-AGATTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_13 1:N:0:
-AGATTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_14 1:N:0:
-AGATTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_15 1:N:0:
-AGATTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_16 1:N:0:
-AGATTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACATCGTAA
->lane1_fakedata3_17 1:N:0:
-AGATTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_18 1:N:0:
-AGATTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_19 1:N:0:
-AGATTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_20 1:N:0:
-AGATTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_21 1:N:0:
-AGATTAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_22 1:N:0:
-AGATTAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_23 1:N:0:
-AGATTAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_24 1:N:0:
-AGATTAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACAATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_25 1:N:0:
-AGATTAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_26 1:N:0:
-AGATTAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_27 1:N:0:
-AGATTAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_28 1:N:0:
-AGATTAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_29 1:N:0:
-AGATTAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_30 1:N:0:
-AGATTAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTGCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_31 1:N:0:
-AGATTAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_32 1:N:0:
-AGATTAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_33 1:N:0:
-AGATTAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_34 1:N:0:
-AGATTAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_35 1:N:0:
-AGATTAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_36 1:N:0:
-AGATTAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_37 1:N:0:
-AGATTAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_38 1:N:0:
-AGATTAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_39 1:N:0:
-AGATTAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_40 1:N:0:
-AGATTAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_41 1:N:0:
-AGATTAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_0 1:N:0:
-GTATAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_1 1:N:0:
-GTATAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_2 1:N:0:
-GTATAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_3 1:N:0:
-GTATAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_4 1:N:0:
-GTATAGAATTACTATTAGGGGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_5 1:N:0:
-GTATAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_6 1:N:0:
-GTATAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_7 1:N:0:
-GTATAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_8 1:N:0:
-GTATAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_9 1:N:0:
-GTATAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_10 1:N:0:
-GTATAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_11 1:N:0:
-GTATAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_12 1:N:0:
-GTATAGAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
->lane1_fakedata3_13 1:N:0:
-GTATAGAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
->lane1_fakedata3_14 1:N:0:
-GTATAGAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
->lane1_fakedata3_15 1:N:0:
-GTATAGAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
->lane1_fakedata3_16 1:N:0:
-GTATAGAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
->lane1_fakedata3_17 1:N:0:
-GTATAGAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
->lane1_fakedata3_18 1:N:0:
-GTATAGAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACTTGAGTGCTCAAACGTCGTAATG
->lane1_fakedata3_19 1:N:0:
-GTATAGAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
->lane1_fakedata3_20 1:N:0:
-GTATAGAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
->lane1_fakedata3_21 1:N:0:
-GTATAGAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
->lane1_fakedata3_22 1:N:0:
-GTATAGAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
->lane1_fakedata3_23 1:N:0:
-GTATAGAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
->lane1_fakedata3_0 1:N:0:
-TTGGGAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_1 1:N:0:
-TTGGGAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_2 1:N:0:
-TTGGGAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_3 1:N:0:
-TTGGGAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_4 1:N:0:
-TTGGGAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_5 1:N:0:
-TTGGGAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTATACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_6 1:N:0:
-TTGGGAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_7 1:N:0:
-TTGGGAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_8 1:N:0:
-TTGGGAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_9 1:N:0:
-TTGGGAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_10 1:N:0:
-TTGGGAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_11 1:N:0:
-TTGGGAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_12 1:N:0:
-TTGGGAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCACCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_13 1:N:0:
-TTGGGAAATTACTATTAGGCGAAGCTGACTGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGAAA
->lane1_fakedata3_14 1:N:0:
-TTGGGAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_15 1:N:0:
-TTGGGAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_16 1:N:0:
-TTGGGAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_17 1:N:0:
-TTGGGAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_18 1:N:0:
-TTGGGAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_19 1:N:0:
-TTGGGAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_20 1:N:0:
-TTGGGAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_21 1:N:0:
-TTGGGAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_22 1:N:0:
-TTGGGAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_23 1:N:0:
-TTGGGAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_0 1:N:0:
-ATATATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_1 1:N:0:
-ATATATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_2 1:N:0:
-ATATATAATTACTATTAGGCGAAGCTGGCAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_3 1:N:0:
-ATATATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_4 1:N:0:
-ATATATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_5 1:N:0:
-ATATATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_6 1:N:0:
-ATATATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_7 1:N:0:
-ATATATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_8 1:N:0:
-ATATATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_9 1:N:0:
-ATATATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_10 1:N:0:
-ATATATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_11 1:N:0:
-ATATATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_12 1:N:0:
-ATATATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_13 1:N:0:
-ATATATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_14 1:N:0:
-ATATATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_15 1:N:0:
-ATATATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_0 1:N:0:
-GATGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAAGGTCGTAA
->lane1_fakedata3_1 1:N:0:
-GATGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_2 1:N:0:
-GATGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_3 1:N:0:
-GATGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_4 1:N:0:
-GATGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_5 1:N:0:
-GATGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_6 1:N:0:
-GATGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_7 1:N:0:
-GATGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCAAACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_8 1:N:0:
-GATGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_9 1:N:0:
-GATGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_10 1:N:0:
-GATGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_11 1:N:0:
-GATGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_12 1:N:0:
-GATGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_13 1:N:0:
-GATGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_14 1:N:0:
-GATGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_15 1:N:0:
-GATGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_16 1:N:0:
-GATGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_17 1:N:0:
-GATGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_18 1:N:0:
-GATGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_19 1:N:0:
-GATGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_20 1:N:0:
-GATGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_21 1:N:0:
-GATGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_22 1:N:0:
-GATGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_23 1:N:0:
-GATGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_24 1:N:0:
-GATGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_25 1:N:0:
-GATGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_26 1:N:0:
-GATGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_27 1:N:0:
-GATGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_28 1:N:0:
-GATGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_29 1:N:0:
-GATGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCTAACGTCGTAA
->lane1_fakedata3_30 1:N:0:
-GATGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_31 1:N:0:
-GATGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_32 1:N:0:
-GATGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_33 1:N:0:
-GATGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_0 1:N:0:
-GGGAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_1 1:N:0:
-GGGAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_2 1:N:0:
-GGGAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_3 1:N:0:
-GGGAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_4 1:N:0:
-GGGAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_5 1:N:0:
-GGGAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_6 1:N:0:
-GGGAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_7 1:N:0:
-GGGAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_8 1:N:0:
-GGGAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_9 1:N:0:
-GGGAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_10 1:N:0:
-GGGAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_11 1:N:0:
-GGGAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_12 1:N:0:
-GGGAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_13 1:N:0:
-GGGAATAATTTCTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_14 1:N:0:
-GGGAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_15 1:N:0:
-GGGAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_16 1:N:0:
-GGGAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_17 1:N:0:
-GGGAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_18 1:N:0:
-GGGAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_19 1:N:0:
-GGGAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_20 1:N:0:
-GGGAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_21 1:N:0:
-GGGAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_0 1:N:0:
-AGGGTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_1 1:N:0:
-AGGGTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_2 1:N:0:
-AGGGTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_3 1:N:0:
-AGGGTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_4 1:N:0:
-AGGGTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_5 1:N:0:
-AGGGTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_6 1:N:0:
-AGGGTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_7 1:N:0:
-AGGGTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_8 1:N:0:
-AGGGTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_9 1:N:0:
-AGGGTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_10 1:N:0:
-AGGGTAAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
->lane1_fakedata3_11 1:N:0:
-AGGGTAAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
->lane1_fakedata3_12 1:N:0:
-AGGGTAAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
->lane1_fakedata3_13 1:N:0:
-AGGGTAAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCACCTAAACCTGAGTGCTCAAACGTCGTAATG
->lane1_fakedata3_14 1:N:0:
-AGGGTAAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
->lane1_fakedata3_15 1:N:0:
-AGGGTAAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
->lane1_fakedata3_16 1:N:0:
-AGGGTAAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
->lane1_fakedata3_17 1:N:0:
-AGGGTAAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
->lane1_fakedata3_18 1:N:0:
-AGGGTAAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
->lane1_fakedata3_19 1:N:0:
-AGGGTAAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
->lane1_fakedata3_0 1:N:0:
-GAGTTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_1 1:N:0:
-GAGTTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_2 1:N:0:
-GAGTTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_3 1:N:0:
-GAGTTAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_4 1:N:0:
-GAGTTAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_5 1:N:0:
-GAGTTAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_0 1:N:0:
-ATAGTTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_1 1:N:0:
-ATAGTTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_2 1:N:0:
-ATAGTTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_3 1:N:0:
-ATAGTTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_4 1:N:0:
-ATAGTTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_5 1:N:0:
-ATAGTTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACTTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_6 1:N:0:
-ATAGTTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_7 1:N:0:
-ATAGTTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_8 1:N:0:
-ATAGTTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_9 1:N:0:
-ATAGTTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_10 1:N:0:
-ATAGTTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_11 1:N:0:
-ATAGTTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_12 1:N:0:
-ATAGTTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_13 1:N:0:
-ATAGTTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_14 1:N:0:
-ATAGTTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_15 1:N:0:
-ATAGTTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_16 1:N:0:
-ATAGTTAATTACTATTAGGCGAAGCTGACAGACGGTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAAT
->lane1_fakedata3_17 1:N:0:
-ATAGTTAATTACTATTAGGCGAAGCTGACAGACGGTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAAT
->lane1_fakedata3_18 1:N:0:
-ATAGTTAATTACTATTAGGCGAAGCTGACAGACGGTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAAT
->lane1_fakedata3_19 1:N:0:
-ATAGTTAATTACTATTAGGCGAAGCTGACAGACGGTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAAT
->lane1_fakedata3_20 1:N:0:
-ATAGTTAATTACTATTAGGCGAAGCTGACAGACGGTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAAT
->lane1_fakedata3_21 1:N:0:
-ATAGTTAATTACTATTAGGCGAAGCTGACAGACGGTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAAT
->lane1_fakedata3_22 1:N:0:
-ATAGTTAATTACTATTAGGCGAAGCTGACAGACGGTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAAT
->lane1_fakedata3_23 1:N:0:
-ATAGTTAATTACTATTAGGCGAAGCTGACAGACGGTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAAT
->lane1_fakedata3_24 1:N:0:
-ATAGTTAATTACTATTAGGCGAAGCTGACAGACGGTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAAT
->lane1_fakedata3_25 1:N:0:
-ATAGTTAATTACTATTAGGCGAAGCTGACAGACGGTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAAT
->lane1_fakedata3_26 1:N:0:
-ATAGTTAATTACTATTAGGCGAAGCTGACAGACGGTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAAT
->lane1_fakedata3_27 1:N:0:
-ATAGTTAATTACTATTAGGCGAAGCTGACAGACGGTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAAT
->lane1_fakedata3_28 1:N:0:
-ATAGTTAATTACTATTAGGCGAAGCGGACAGACGGTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAAT
->lane1_fakedata3_29 1:N:0:
-ATAGTTAATTACTATTAGGCGAAGCTGACAGACGGTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAAT
->lane1_fakedata3_30 1:N:0:
-ATAGTTAATTACTATTAGGCGAAGCTGACAGACGGTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAAT
->lane1_fakedata3_31 1:N:0:
-ATAGTTAATTACTATTAGGCGAAGCTGACAGACGGTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAAT
->lane1_fakedata3_0 1:N:0:
-TGTGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_1 1:N:0:
-TGTGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_2 1:N:0:
-TGTGAGAATTACTATTAGGCGAAGCTGACAGACAGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_3 1:N:0:
-TGTGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_4 1:N:0:
-TGTGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_5 1:N:0:
-TGTGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_6 1:N:0:
-TGTGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_7 1:N:0:
-TGTGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_8 1:N:0:
-TGTGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_9 1:N:0:
-TGTGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_10 1:N:0:
-TGTGAGAATTACTATTAGGCGAAGCTGACAGACGGCCCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_11 1:N:0:
-TGTGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_12 1:N:0:
-TGTGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_13 1:N:0:
-TGTGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACGTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_14 1:N:0:
-TGTGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_15 1:N:0:
-TGTGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_0 1:N:0:
-TTTGTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_1 1:N:0:
-TTTGTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_2 1:N:0:
-TTTGTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_3 1:N:0:
-TTTGTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_4 1:N:0:
-TTTGTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_5 1:N:0:
-TTTGTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_6 1:N:0:
-TTTGTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_7 1:N:0:
-TTTGTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_8 1:N:0:
-TTTGTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_9 1:N:0:
-TTTGTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_10 1:N:0:
-TTTGTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_11 1:N:0:
-TTTGTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_12 1:N:0:
-TTTGTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_13 1:N:0:
-TTTGTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_14 1:N:0:
-TTTGTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_15 1:N:0:
-TTTGTGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_16 1:N:0:
-TTTGTGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_17 1:N:0:
-TTTGTGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_18 1:N:0:
-TTTGTGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_19 1:N:0:
-TTTGTGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_20 1:N:0:
-TTTGTGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_21 1:N:0:
-TTTGTGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_22 1:N:0:
-TTTGTGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_23 1:N:0:
-TTTGTGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_24 1:N:0:
-TTTGTGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_25 1:N:0:
-TTTGTGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_26 1:N:0:
-TTTGTGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_27 1:N:0:
-TTTGTGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_28 1:N:0:
-TTTGTGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_29 1:N:0:
-TTTGTGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_0 1:N:0:
-GGAAGGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAATGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_1 1:N:0:
-GGAAGGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAATGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_2 1:N:0:
-GGAAGGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAATGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_3 1:N:0:
-GGAAGGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAATGACTCTTGGCTTCCCTCCTAAACCTGAGTGCGCAAACGTCGTAA
->lane1_fakedata3_4 1:N:0:
-GGAAGGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAATGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_5 1:N:0:
-GGAAGGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAATGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_6 1:N:0:
-GGAAGGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAATGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_7 1:N:0:
-GGAAGGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAATGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_8 1:N:0:
-GGAAGGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAATGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_9 1:N:0:
-GGAAGGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAATGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_10 1:N:0:
-GGAAGGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAATGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_11 1:N:0:
-GGAAGGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAATGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_12 1:N:0:
-GGAAGGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAATGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_13 1:N:0:
-GGAAGGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAATGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_14 1:N:0:
-GGAAGGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAATGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_15 1:N:0:
-GGAAGGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAATGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_16 1:N:0:
-GGAAGGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_17 1:N:0:
-GGAAGGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_18 1:N:0:
-GGAAGGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_19 1:N:0:
-GGAAGGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_20 1:N:0:
-GGAAGGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_21 1:N:0:
-GGAAGGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_22 1:N:0:
-GGAAGGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_23 1:N:0:
-GGAAGGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_24 1:N:0:
-GGAAGGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_25 1:N:0:
-GGAAGGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_26 1:N:0:
-GGAAGGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_27 1:N:0:
-GGAAGGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_28 1:N:0:
-GGAAGGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_29 1:N:0:
-GGAAGGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_30 1:N:0:
-GGAAGGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_31 1:N:0:
-GGAAGGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_0 1:N:0:
-AATAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_1 1:N:0:
-AATAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_2 1:N:0:
-AATAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_3 1:N:0:
-AATAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_4 1:N:0:
-AATAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAATCTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_5 1:N:0:
-AATAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_6 1:N:0:
-AATAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_7 1:N:0:
-AATAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_8 1:N:0:
-AATAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_9 1:N:0:
-AATAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_10 1:N:0:
-AATAAGAATTACTATTAGTCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_11 1:N:0:
-AATAAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTACTCAAACGTCGTAA
->lane1_fakedata3_12 1:N:0:
-AATAAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_13 1:N:0:
-AATAAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_14 1:N:0:
-AATAAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_15 1:N:0:
-AATAAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_16 1:N:0:
-AATAAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_17 1:N:0:
-AATAAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_18 1:N:0:
-AATAAGAATTACCATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_19 1:N:0:
-AATAAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_20 1:N:0:
-AATAAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACAATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_21 1:N:0:
-AATAAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_0 1:N:0:
-TTAAATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_1 1:N:0:
-TTAAATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_2 1:N:0:
-TTAAATAATTACTATTAGGCGAACCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_3 1:N:0:
-TTAAATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_4 1:N:0:
-TTAAATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_5 1:N:0:
-TTAAATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_6 1:N:0:
-TTAAATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_7 1:N:0:
-TTAAATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_8 1:N:0:
-TTAAATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_9 1:N:0:
-TTAAATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_10 1:N:0:
-TTAAATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_11 1:N:0:
-TTAAATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_12 1:N:0:
-TTAAATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_13 1:N:0:
-TTAAATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAATAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_14 1:N:0:
-TTAAATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_15 1:N:0:
-TTAAATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGCAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_0 1:N:0:
-TAGTGTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
->lane1_fakedata3_1 1:N:0:
-TAGTGTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
->lane1_fakedata3_2 1:N:0:
-TAGTGTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
->lane1_fakedata3_3 1:N:0:
-TAGTGTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
->lane1_fakedata3_4 1:N:0:
-TAGTGTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
->lane1_fakedata3_5 1:N:0:
-TAGTGTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
->lane1_fakedata3_6 1:N:0:
-TAGTGTAATTACTATTAGGCAAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
->lane1_fakedata3_7 1:N:0:
-TAGTGTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
->lane1_fakedata3_8 1:N:0:
-TAGTGTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
->lane1_fakedata3_9 1:N:0:
-TAGTGTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
->lane1_fakedata3_10 1:N:0:
-TAGTGTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
->lane1_fakedata3_11 1:N:0:
-TAGTGTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
->lane1_fakedata3_12 1:N:0:
-TAGTGTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
->lane1_fakedata3_13 1:N:0:
-TAGTGTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
->lane1_fakedata3_14 1:N:0:
-TAGTGTAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
->lane1_fakedata3_15 1:N:0:
-TAGTGTAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAAGTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
->lane1_fakedata3_16 1:N:0:
-TAGTGTAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
->lane1_fakedata3_17 1:N:0:
-TAGTGTAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
->lane1_fakedata3_18 1:N:0:
-TAGTGTAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
->lane1_fakedata3_19 1:N:0:
-TAGTGTAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
->lane1_fakedata3_20 1:N:0:
-TAGTGTAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
->lane1_fakedata3_21 1:N:0:
-TAGTGTAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
->lane1_fakedata3_22 1:N:0:
-TAGTGTAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
->lane1_fakedata3_23 1:N:0:
-TAGTGTAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
->lane1_fakedata3_24 1:N:0:
-TAGTGTAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
->lane1_fakedata3_25 1:N:0:
-TAGTGTAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
->lane1_fakedata3_26 1:N:0:
-TAGTGTAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
->lane1_fakedata3_27 1:N:0:
-TAGTGTAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
->lane1_fakedata3_0 1:N:0:
-AAGAGGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_1 1:N:0:
-AAGAGGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_2 1:N:0:
-AAGAGGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_3 1:N:0:
-AAGAGGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_4 1:N:0:
-AAGAGGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_5 1:N:0:
-AAGAGGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_6 1:N:0:
-AAGAGGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTTCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_7 1:N:0:
-AAGAGGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAACCTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_8 1:N:0:
-AAGAGGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_9 1:N:0:
-AAGAGGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_10 1:N:0:
-AAGAGGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_11 1:N:0:
-AAGAGGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_0 1:N:0:
-GGGTTGAATTACTATTAGGCGAAGCTGACAGACGGTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAAT
->lane1_fakedata3_1 1:N:0:
-GGGTTGAATTACTATTAGGCGAAGCTGACAGACGGTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAAT
->lane1_fakedata3_2 1:N:0:
-GGGTTGAATTACTATTAGGCGAAGCTGACAGACGGTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAAT
->lane1_fakedata3_3 1:N:0:
-GGGTTGAATTACTATTAGGCGAAGCTGACAGACGGTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAAT
->lane1_fakedata3_4 1:N:0:
-GGGTTGAATTACTATTAGGCGAAGCTGACAGACGGTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAAT
->lane1_fakedata3_5 1:N:0:
-GGGTTGAATTACTATTAGGCGAAGCTGACAGACGGTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAAT
->lane1_fakedata3_6 1:N:0:
-GGGTTGAATTACTATTAGGCGAAGCTGACAGACGGTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAAT
->lane1_fakedata3_7 1:N:0:
-GGGTTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_8 1:N:0:
-GGGTTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_9 1:N:0:
-GGGTTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_10 1:N:0:
-GGGTTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_11 1:N:0:
-GGGTTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTAAAACGTCGTAA
->lane1_fakedata3_12 1:N:0:
-GGGTTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_13 1:N:0:
-GGGTTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_0 1:N:0:
-TGGAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACCCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
->lane1_fakedata3_1 1:N:0:
-TGGAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
->lane1_fakedata3_2 1:N:0:
-TGGAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
->lane1_fakedata3_3 1:N:0:
-TGGAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
->lane1_fakedata3_4 1:N:0:
-TGGAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAAATATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
->lane1_fakedata3_5 1:N:0:
-TGGAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
->lane1_fakedata3_6 1:N:0:
-TGGAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
->lane1_fakedata3_7 1:N:0:
-TGGAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
->lane1_fakedata3_8 1:N:0:
-TGGAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
->lane1_fakedata3_9 1:N:0:
-TGGAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
->lane1_fakedata3_10 1:N:0:
-TGGAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
->lane1_fakedata3_11 1:N:0:
-TGGAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
->lane1_fakedata3_0 1:N:0:
-GAGAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_1 1:N:0:
-GAGAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_2 1:N:0:
-GAGAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACCGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_3 1:N:0:
-GAGAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_4 1:N:0:
-GAGAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_5 1:N:0:
-GAGAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_6 1:N:0:
-GAGAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_7 1:N:0:
-GAGAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_8 1:N:0:
-GAGAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_9 1:N:0:
-GAGAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_10 1:N:0:
-GAGAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_11 1:N:0:
-GAGAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_0 1:N:0:
-AGTAGAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_1 1:N:0:
-AGTAGAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_2 1:N:0:
-AGTAGAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_3 1:N:0:
-AGTAGAAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
->lane1_fakedata3_4 1:N:0:
-AGTAGAAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
->lane1_fakedata3_5 1:N:0:
-AGTAGAAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
->lane1_fakedata3_0 1:N:0:
-AGTAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_1 1:N:0:
-AGTAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_2 1:N:0:
-AGTAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_3 1:N:0:
-AGTAATAATTACTATTAGGCTAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_4 1:N:0:
-AGTAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_5 1:N:0:
-AGTAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_6 1:N:0:
-AGTAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_7 1:N:0:
-AGTAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_8 1:N:0:
-AGTAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_9 1:N:0:
-AGTAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_10 1:N:0:
-AGTAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCACACGTCGTAA
->lane1_fakedata3_11 1:N:0:
-AGTAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_12 1:N:0:
-AGTAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_13 1:N:0:
-AGTAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACAGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_14 1:N:0:
-AGTAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_15 1:N:0:
-AGTAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_16 1:N:0:
-AGTAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_17 1:N:0:
-AGTAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_18 1:N:0:
-AGTAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_19 1:N:0:
-AGTAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_20 1:N:0:
-AGTAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_21 1:N:0:
-AGTAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_22 1:N:0:
-AGTAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_23 1:N:0:
-AGTAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_24 1:N:0:
-AGTAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_25 1:N:0:
-AGTAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_26 1:N:0:
-AGTAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_27 1:N:0:
-AGTAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_28 1:N:0:
-AGTAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_29 1:N:0:
-AGTAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_30 1:N:0:
-AGTAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_31 1:N:0:
-AGTAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_32 1:N:0:
-AGTAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_33 1:N:0:
-AGTAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_34 1:N:0:
-AGTAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_35 1:N:0:
-AGTAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_36 1:N:0:
-AGTAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_37 1:N:0:
-AGTAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_0 1:N:0:
-TGTTTTAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
->lane1_fakedata3_1 1:N:0:
-TGTTTTAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
->lane1_fakedata3_2 1:N:0:
-TGTTTTAATTACTATTAGGCGAAGATGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
->lane1_fakedata3_3 1:N:0:
-TGTTTTAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
->lane1_fakedata3_4 1:N:0:
-TGTTTTAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
->lane1_fakedata3_5 1:N:0:
-TGTTTTAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
->lane1_fakedata3_6 1:N:0:
-TGTTTTAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
->lane1_fakedata3_7 1:N:0:
-TGTTTTAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
->lane1_fakedata3_8 1:N:0:
-TGTTTTAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTATACCTGAGTGCTCAAACGTCGTAATG
->lane1_fakedata3_9 1:N:0:
-TGTTTTAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTCCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
->lane1_fakedata3_10 1:N:0:
-TGTTTTAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
->lane1_fakedata3_11 1:N:0:
-TGTTTTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_12 1:N:0:
-TGTTTTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_13 1:N:0:
-TGTTTTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_14 1:N:0:
-TGTTTTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_15 1:N:0:
-TGTTTTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_16 1:N:0:
-TGTTTTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_17 1:N:0:
-TGTTTTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_18 1:N:0:
-TGTTTTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_19 1:N:0:
-TGTTTTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_20 1:N:0:
-TGTTTTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTACTTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_21 1:N:0:
-TGTTTTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_0 1:N:0:
-ATGATGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_1 1:N:0:
-ATGATGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_2 1:N:0:
-ATGATGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_3 1:N:0:
-ATGATGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_4 1:N:0:
-ATGATGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_5 1:N:0:
-ATGATGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_6 1:N:0:
-ATGATGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_7 1:N:0:
-ATGATGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_8 1:N:0:
-ATGATGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_9 1:N:0:
-ATGATGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_10 1:N:0:
-ATGATGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata3_11 1:N:0:
-ATGATGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
->lane1_fakedata4_0 1:N:0:
-GGTGTGAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_1 1:N:0:
-GGTGTGAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_2 1:N:0:
-GGTGTGAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_3 1:N:0:
-GGTGTGAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTTGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_4 1:N:0:
-GGTGTGAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_5 1:N:0:
-GGTGTGAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAATTCG
->lane1_fakedata4_6 1:N:0:
-GGTGTGAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_7 1:N:0:
-GGTGTGAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_8 1:N:0:
-GGTGTGAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_9 1:N:0:
-GGTGTGAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_10 1:N:0:
-GGTGTGAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_11 1:N:0:
-GGTGTGAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_12 1:N:0:
-GGTGTGAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_13 1:N:0:
-GGTGTGAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_14 1:N:0:
-GGTGTGAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_15 1:N:0:
-GGTGTGAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_16 1:N:0:
-GGTGTGAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_17 1:N:0:
-GGTGTGAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_18 1:N:0:
-GGTGTGAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_19 1:N:0:
-GGTGTGAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_20 1:N:0:
-GGTGTGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_21 1:N:0:
-GGTGTGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_22 1:N:0:
-GGTGTGAATTATCGTCTTGCACAAATCGTCTACGCAGATTCGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_23 1:N:0:
-GGTGTGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_24 1:N:0:
-GGTGTGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_25 1:N:0:
-GGTGTGAATTATCGTCTTGCACAAATCGTCTACACAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_26 1:N:0:
-GGTGTGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_27 1:N:0:
-GGTGTGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_28 1:N:0:
-GGTGTGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_29 1:N:0:
-GGTGTGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_30 1:N:0:
-GGTGTGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_31 1:N:0:
-GGTGTGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_32 1:N:0:
-GGTGTGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_33 1:N:0:
-GGTGTGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_34 1:N:0:
-GGTGTGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_35 1:N:0:
-GGTGTGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_36 1:N:0:
-GGTGTGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_37 1:N:0:
-GGTGTGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_38 1:N:0:
-GGTGTGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_39 1:N:0:
-GGTGTGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_0 1:N:0:
-TTTAAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_1 1:N:0:
-TTTAAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_2 1:N:0:
-TTTAAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_3 1:N:0:
-TTTAAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_4 1:N:0:
-TTTAAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_5 1:N:0:
-TTTAAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_6 1:N:0:
-TTTAAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_7 1:N:0:
-TTTAAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_8 1:N:0:
-TTTAAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_9 1:N:0:
-TTTAAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_10 1:N:0:
-TTTAAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_11 1:N:0:
-TTTAAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_12 1:N:0:
-TTTAAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_13 1:N:0:
-TTTAAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_0 1:N:0:
-GGTTGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_1 1:N:0:
-GGTTGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_2 1:N:0:
-GGTTGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_3 1:N:0:
-GGTTGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_4 1:N:0:
-GGTTGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_5 1:N:0:
-GGTTGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_6 1:N:0:
-GGTTGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_7 1:N:0:
-GGTTGTAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_8 1:N:0:
-GGTTGTAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_9 1:N:0:
-GGTTGTAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_10 1:N:0:
-GGTTGTAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_11 1:N:0:
-GGTTGTAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_12 1:N:0:
-GGTTGTAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_13 1:N:0:
-GGTTGTAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_0 1:N:0:
-TGATGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_1 1:N:0:
-TGATGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_2 1:N:0:
-TGATGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_3 1:N:0:
-TGATGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_4 1:N:0:
-TGATGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_5 1:N:0:
-TGATGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_6 1:N:0:
-TGATGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_7 1:N:0:
-TGATGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_8 1:N:0:
-TGATGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_9 1:N:0:
-TGATGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_10 1:N:0:
-TGATGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_11 1:N:0:
-TGATGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_12 1:N:0:
-TGATGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_13 1:N:0:
-TGATGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_14 1:N:0:
-TGATGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACCCGTGT
->lane1_fakedata4_15 1:N:0:
-TGATGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_16 1:N:0:
-TGATGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTCAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_17 1:N:0:
-TGATGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_0 1:N:0:
-ATGGGGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCGACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_1 1:N:0:
-ATGGGGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_2 1:N:0:
-ATGGGGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_3 1:N:0:
-ATGGGGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_4 1:N:0:
-ATGGGGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_5 1:N:0:
-ATGGGGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_6 1:N:0:
-ATGGGGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_7 1:N:0:
-ATGGGGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_8 1:N:0:
-ATGGGGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_9 1:N:0:
-ATGGGGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_10 1:N:0:
-ATGGGGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_11 1:N:0:
-ATGGGGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_12 1:N:0:
-ATGGGGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_13 1:N:0:
-ATGGGGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_14 1:N:0:
-ATGGGGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_15 1:N:0:
-ATGGGGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_16 1:N:0:
-ATGGGGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_17 1:N:0:
-ATGGGGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_18 1:N:0:
-ATGGGGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_19 1:N:0:
-ATGGGGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_20 1:N:0:
-ATGGGGAATTATCGTCTTGCACAAATCGTCGACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_21 1:N:0:
-ATGGGGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_22 1:N:0:
-ATGGGGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_23 1:N:0:
-ATGGGGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_24 1:N:0:
-ATGGGGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_25 1:N:0:
-ATGGGGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_26 1:N:0:
-ATGGGGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTGTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_27 1:N:0:
-ATGGGGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_28 1:N:0:
-ATGGGGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_29 1:N:0:
-ATGGGGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_30 1:N:0:
-ATGGGGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTCCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_31 1:N:0:
-ATGGGGAATTATTGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGGGT
->lane1_fakedata4_32 1:N:0:
-ATGGGGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_33 1:N:0:
-ATGGGGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_0 1:N:0:
-CATCATAATTATCGTCTTGCACGAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_1 1:N:0:
-CATCATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGTACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_2 1:N:0:
-CATCATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGAAGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_3 1:N:0:
-CATCATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_4 1:N:0:
-CATCATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_5 1:N:0:
-CATCATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_6 1:N:0:
-CATCATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_7 1:N:0:
-CATCATAATTATCGTCTTGTACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_8 1:N:0:
-CATCATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_9 1:N:0:
-CATCATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_10 1:N:0:
-CATCATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_11 1:N:0:
-CATCATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_12 1:N:0:
-CATCATAATTATCGTCTTGCACAAAGCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_13 1:N:0:
-CATCATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_0 1:N:0:
-AGGAAAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_1 1:N:0:
-AGGAAAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_2 1:N:0:
-AGGAAAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_3 1:N:0:
-AGGAAAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_4 1:N:0:
-AGGAAAAATTATCGTCTTCCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_5 1:N:0:
-AGGAAAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_6 1:N:0:
-AGGAAAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_7 1:N:0:
-AGGAAAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_8 1:N:0:
-AGGAAAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_9 1:N:0:
-AGGAAAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_10 1:N:0:
-AGGAAAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_11 1:N:0:
-AGGAAAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_12 1:N:0:
-AGGAAAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_13 1:N:0:
-AGGAAAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_14 1:N:0:
-AGGAAAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_15 1:N:0:
-AGGAAAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_16 1:N:0:
-AGGAAAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_17 1:N:0:
-AGGAAAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_18 1:N:0:
-AGGAAAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_19 1:N:0:
-AGGAAAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_20 1:N:0:
-AGGAAAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_21 1:N:0:
-AGGAAAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_22 1:N:0:
-AGGAAAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_23 1:N:0:
-AGGAAAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_24 1:N:0:
-AGGAAAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_25 1:N:0:
-AGGAAAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_26 1:N:0:
-AGGAAAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_27 1:N:0:
-AGGAAAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_0 1:N:0:
-GGGTAAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_1 1:N:0:
-GGGTAAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_2 1:N:0:
-GGGTAAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_3 1:N:0:
-GGGTAAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_4 1:N:0:
-GGGTAAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_5 1:N:0:
-GGGTAAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_6 1:N:0:
-GGGTAAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_7 1:N:0:
-GGGTAAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_8 1:N:0:
-GGGTAAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_9 1:N:0:
-GGGTAAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_10 1:N:0:
-GGGTAAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_11 1:N:0:
-GGGTAAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_12 1:N:0:
-GGGTAAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_13 1:N:0:
-GGGTAAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_14 1:N:0:
-GGGTAAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_15 1:N:0:
-GGGTAAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_16 1:N:0:
-GGGTAAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_17 1:N:0:
-GGGTAAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_18 1:N:0:
-GGGTAAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_19 1:N:0:
-GGGTAAAATTATCGTCTTGCACAAATCGTCTACGCACATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_20 1:N:0:
-GGGTAAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_21 1:N:0:
-GGGTAAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_0 1:N:0:
-AAGATAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_1 1:N:0:
-AAGATAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_2 1:N:0:
-AAGATAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGATGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_3 1:N:0:
-AAGATAAATTATCGTCTTGCACAAATCGTCCACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_4 1:N:0:
-AAGATAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_5 1:N:0:
-AAGATAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_6 1:N:0:
-AAGATAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_7 1:N:0:
-AAGATAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_8 1:N:0:
-AAGATAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_9 1:N:0:
-AAGATAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_10 1:N:0:
-AAGATAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_11 1:N:0:
-AAGATAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_12 1:N:0:
-AAGATAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_13 1:N:0:
-AAGATAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_14 1:N:0:
-AAGATAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_15 1:N:0:
-AAGATAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_16 1:N:0:
-AAGATAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_17 1:N:0:
-AAGATAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_18 1:N:0:
-AAGATAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_19 1:N:0:
-AAGATAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_20 1:N:0:
-AAGATAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_21 1:N:0:
-AAGATAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_22 1:N:0:
-AAGATAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_23 1:N:0:
-AAGATAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_24 1:N:0:
-AAGATAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_25 1:N:0:
-AAGATAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_0 1:N:0:
-ATAAGTAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_1 1:N:0:
-ATAAGTAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_2 1:N:0:
-ATAAGTAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_3 1:N:0:
-ATAAGTAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_4 1:N:0:
-ATAAGTAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_5 1:N:0:
-ATAAGTAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_6 1:N:0:
-ATAAGTAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_7 1:N:0:
-ATAAGTAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_8 1:N:0:
-ATAAGTAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_9 1:N:0:
-ATAAGTAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_10 1:N:0:
-ATAAGTAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_11 1:N:0:
-ATAAGTAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_12 1:N:0:
-ATAAGTAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_13 1:N:0:
-ATAAGTAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_14 1:N:0:
-ATAAGTAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_15 1:N:0:
-ATAAGTAATTATCCTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_16 1:N:0:
-ATAAGTAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_17 1:N:0:
-ATAAGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_18 1:N:0:
-ATAAGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_19 1:N:0:
-ATAAGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_20 1:N:0:
-ATAAGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_21 1:N:0:
-ATAAGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_22 1:N:0:
-ATAAGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_23 1:N:0:
-ATAAGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_24 1:N:0:
-ATAAGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_25 1:N:0:
-ATAAGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_26 1:N:0:
-ATAAGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_27 1:N:0:
-ATAAGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_28 1:N:0:
-ATAAGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_29 1:N:0:
-ATAAGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_30 1:N:0:
-ATAAGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_31 1:N:0:
-ATAAGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_32 1:N:0:
-ATAAGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_33 1:N:0:
-ATAAGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_0 1:N:0:
-ATGTAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_1 1:N:0:
-ATGTAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_2 1:N:0:
-ATGTAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_3 1:N:0:
-ATGTAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_4 1:N:0:
-ATGTAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCTTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_5 1:N:0:
-ATGTAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_6 1:N:0:
-ATGTAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_7 1:N:0:
-ATGTAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_8 1:N:0:
-ATGTAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_9 1:N:0:
-ATGTAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_10 1:N:0:
-ATGTAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_11 1:N:0:
-ATGTAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_12 1:N:0:
-ATGTAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_13 1:N:0:
-ATGTAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_14 1:N:0:
-ATGTAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_15 1:N:0:
-ATGTAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_16 1:N:0:
-ATGTAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_17 1:N:0:
-ATGTAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_18 1:N:0:
-ATGTAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_19 1:N:0:
-ATGTAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_20 1:N:0:
-ATGTAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_21 1:N:0:
-ATGTAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_22 1:N:0:
-ATGTAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_23 1:N:0:
-ATGTAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_24 1:N:0:
-ATGTAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_25 1:N:0:
-ATGTAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_26 1:N:0:
-ATGTAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_27 1:N:0:
-ATGTAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_28 1:N:0:
-ATGTAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_29 1:N:0:
-ATGTAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGA
->lane1_fakedata4_0 1:N:0:
-AAGGATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGGTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_1 1:N:0:
-AAGGATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_2 1:N:0:
-AAGGATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_3 1:N:0:
-AAGGATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_4 1:N:0:
-AAGGATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_5 1:N:0:
-AAGGATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_6 1:N:0:
-AAGGATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_7 1:N:0:
-AAGGATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACACGTGT
->lane1_fakedata4_8 1:N:0:
-AAGGATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_9 1:N:0:
-AAGGATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_10 1:N:0:
-AAGGATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_11 1:N:0:
-AAGGATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_12 1:N:0:
-AAGGATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_13 1:N:0:
-AAGGATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_14 1:N:0:
-AAGGATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_15 1:N:0:
-AAGGATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_16 1:N:0:
-AAGGATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_17 1:N:0:
-AAGGATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGGGTCAATCAACTCGTGT
->lane1_fakedata4_18 1:N:0:
-AAGGATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_19 1:N:0:
-AAGGATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_20 1:N:0:
-AAGGATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_21 1:N:0:
-AAGGATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_22 1:N:0:
-AAGGATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_23 1:N:0:
-AAGGATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_24 1:N:0:
-AAGGATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_25 1:N:0:
-AAGGATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_26 1:N:0:
-AAGGATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_27 1:N:0:
-AAGGATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_28 1:N:0:
-AAGGATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_29 1:N:0:
-AAGGATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_30 1:N:0:
-AAGGATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_31 1:N:0:
-AAGGATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_0 1:N:0:
-GGAGAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_1 1:N:0:
-GGAGAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_2 1:N:0:
-GGAGAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_3 1:N:0:
-GGAGAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_4 1:N:0:
-GGAGAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_5 1:N:0:
-GGAGAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_6 1:N:0:
-GGAGAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_7 1:N:0:
-GGAGAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_8 1:N:0:
-GGAGAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_9 1:N:0:
-GGAGAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_10 1:N:0:
-GGAGAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_11 1:N:0:
-GGAGAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_12 1:N:0:
-GGAGAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_13 1:N:0:
-GGAGAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_14 1:N:0:
-GGAGAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCCTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_15 1:N:0:
-GGAGAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGAGT
->lane1_fakedata4_16 1:N:0:
-GGAGAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTGAATCAACTCGTGT
->lane1_fakedata4_17 1:N:0:
-GGAGAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_18 1:N:0:
-GGAGAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_19 1:N:0:
-GGAGAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_20 1:N:0:
-GGAGAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_21 1:N:0:
-GGAGAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_22 1:N:0:
-GGAGAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_23 1:N:0:
-GGAGAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_24 1:N:0:
-GGAGAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_25 1:N:0:
-GGAGAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_26 1:N:0:
-GGAGAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_27 1:N:0:
-GGAGAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_28 1:N:0:
-GGAGAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_29 1:N:0:
-GGAGAGAATTATCGTCTTGCACTAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_30 1:N:0:
-GGAGAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_31 1:N:0:
-GGAGAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_32 1:N:0:
-GGAGAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_33 1:N:0:
-GGAGAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_34 1:N:0:
-GGAGAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_35 1:N:0:
-GGAGAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_36 1:N:0:
-GGAGAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_37 1:N:0:
-GGAGAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_38 1:N:0:
-GGAGAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_39 1:N:0:
-GGAGAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_0 1:N:0:
-GTTTTAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_1 1:N:0:
-GTTTTAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_2 1:N:0:
-GTTTTAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_3 1:N:0:
-GTTTTAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_0 1:N:0:
-TGATAAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_1 1:N:0:
-TGATAAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_2 1:N:0:
-TGATAAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_3 1:N:0:
-TGATAAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCGACTCGTGT
->lane1_fakedata4_4 1:N:0:
-TGATAAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_5 1:N:0:
-TGATAAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTGTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_6 1:N:0:
-TGATAAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_7 1:N:0:
-TGATAAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_8 1:N:0:
-TGATAAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_9 1:N:0:
-TGATAAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_10 1:N:0:
-TGATAAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_11 1:N:0:
-TGATAAAATTATCGTCTTGGACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTAATGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_12 1:N:0:
-TGATAAAATTATCGTCTTGGACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTAATGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_13 1:N:0:
-TGATAAAATTATCGTCTTGGACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTAATGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_14 1:N:0:
-TGATAAAATTATCGTCTTGGACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTAATGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_15 1:N:0:
-TGATAAAATTATCGTCTTGGACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTAATGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_16 1:N:0:
-TGATAAAATTATCGTCTTGGACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTAATGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_17 1:N:0:
-TGATAAAATTATCGTCTTGGACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTAATGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_18 1:N:0:
-TGATAAAATTATCGTCTTGGACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTAATGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_19 1:N:0:
-TGATAAAATTATCGTCTTGGACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTAATGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_20 1:N:0:
-TGATAAAATTATCGTCTTGGACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTAATGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_21 1:N:0:
-TGATAAAATTATCGTCTTGGACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTAATGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_0 1:N:0:
-GTTGATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_1 1:N:0:
-GTTGATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_2 1:N:0:
-GTTGATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_3 1:N:0:
-GTTGATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_4 1:N:0:
-GTTGATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_5 1:N:0:
-GTTGATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGGCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_6 1:N:0:
-GTTGATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_7 1:N:0:
-GTTGATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_8 1:N:0:
-GTTGATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_9 1:N:0:
-GTTGATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_10 1:N:0:
-GTTGATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_11 1:N:0:
-GTTGATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_12 1:N:0:
-GTTGATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_13 1:N:0:
-GTTGATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_14 1:N:0:
-GTTGATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_15 1:N:0:
-GTTGATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_16 1:N:0:
-GTTGATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_17 1:N:0:
-GTTGATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_18 1:N:0:
-GTTGATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_19 1:N:0:
-GTTGATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_20 1:N:0:
-GTTGATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_21 1:N:0:
-GTTGATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_22 1:N:0:
-GTTGATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_23 1:N:0:
-GTTGATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_0 1:N:0:
-AGATTAAATTATCGTCTTGCACAAATCTTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACCCGTGT
->lane1_fakedata4_1 1:N:0:
-AGATTAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_2 1:N:0:
-AGATTAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_3 1:N:0:
-AGATTAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_4 1:N:0:
-AGATTAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_5 1:N:0:
-AGATTAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_6 1:N:0:
-AGATTAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_7 1:N:0:
-AGATTAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_8 1:N:0:
-AGATTAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACACGTGT
->lane1_fakedata4_9 1:N:0:
-AGATTAAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_10 1:N:0:
-AGATTAAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_11 1:N:0:
-AGATTAAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_12 1:N:0:
-AGATTAAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_13 1:N:0:
-AGATTAAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_14 1:N:0:
-AGATTAAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_15 1:N:0:
-AGATTAAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_16 1:N:0:
-AGATTAAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_17 1:N:0:
-AGATTAAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_0 1:N:0:
-GTATAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_1 1:N:0:
-GTATAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_2 1:N:0:
-GTATAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCTTGT
->lane1_fakedata4_3 1:N:0:
-GTATAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_4 1:N:0:
-GTATAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGGGTCAATCAACTCGTGT
->lane1_fakedata4_5 1:N:0:
-GTATAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_0 1:N:0:
-TTGGGAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTTGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_1 1:N:0:
-TTGGGAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_2 1:N:0:
-TTGGGAAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_3 1:N:0:
-TTGGGAAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_0 1:N:0:
-GATGAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_1 1:N:0:
-GATGAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_2 1:N:0:
-GATGAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_3 1:N:0:
-GATGAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_4 1:N:0:
-GATGAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_5 1:N:0:
-GATGAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_6 1:N:0:
-GATGAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_7 1:N:0:
-GATGAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_0 1:N:0:
-GGGAATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_1 1:N:0:
-GGGAATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_2 1:N:0:
-GGGAATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_3 1:N:0:
-GGGAATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_4 1:N:0:
-GGGAATAATTATCGTCTTGCACAAATCGTCTACGCATATTGGAATCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_5 1:N:0:
-GGGAATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_6 1:N:0:
-GGGAATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_7 1:N:0:
-GGGAATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_8 1:N:0:
-GGGAATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_9 1:N:0:
-GGGAATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_10 1:N:0:
-GGGAATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_11 1:N:0:
-GGGAATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_12 1:N:0:
-GGGAATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCCACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_13 1:N:0:
-GGGAATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_14 1:N:0:
-GGGAATAATTATCGTCTTGGACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTAATGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_15 1:N:0:
-GGGAATAATTATCGTCTTGGACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTAATGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_16 1:N:0:
-GGGAATAATTATCGTCTTGGACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTAATGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_17 1:N:0:
-GGGAATAATTATCGTCTTGGACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTAATGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_18 1:N:0:
-GGGAATAATTATCGTCTTGGACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTAATGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_19 1:N:0:
-GGGAATAATTATCGTCTTGGACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTAATGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_20 1:N:0:
-GGGAATAATTATCGTCTTGGACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTAATGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_21 1:N:0:
-GGGAATAATTATCGTCTTGGACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTAATGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_22 1:N:0:
-GGGAATAATTATCGTCTTGGACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTAATGAAGGAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_23 1:N:0:
-GGGAATAATTATCGTCTTGGACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTAATGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_24 1:N:0:
-GGGAATAATTATCGTCTTGGACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTAATGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_25 1:N:0:
-GGGAATAATTATCGTCTTGGACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTAATGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_26 1:N:0:
-GGGAATAATTATCGTCTTGGACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTAATGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_27 1:N:0:
-GGGAATAATTATCGTCTTGGACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTAATGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_0 1:N:0:
-AGGGTAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGAAGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_1 1:N:0:
-AGGGTAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_2 1:N:0:
-AGGGTAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_3 1:N:0:
-AGGGTAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_4 1:N:0:
-AGGGTAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_5 1:N:0:
-AGGGTAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_6 1:N:0:
-AGGGTAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_7 1:N:0:
-AGGGTAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_8 1:N:0:
-AGGGTAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTCGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_9 1:N:0:
-AGGGTAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_10 1:N:0:
-AGGGTAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_11 1:N:0:
-AGGGTAAATTATCGTCTTGCACAAATCGTCTATGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_12 1:N:0:
-AGGGTAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_13 1:N:0:
-AGGGTAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_14 1:N:0:
-AGGGTAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_15 1:N:0:
-AGGGTAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_16 1:N:0:
-AGGGTAAATTATCGTCTTGCACAGATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_17 1:N:0:
-AGGGTAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_0 1:N:0:
-GAGTTAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_1 1:N:0:
-GAGTTAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTGGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_2 1:N:0:
-GAGTTAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_3 1:N:0:
-GAGTTAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_4 1:N:0:
-GAGTTAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_5 1:N:0:
-GAGTTAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_6 1:N:0:
-GAGTTAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_7 1:N:0:
-GAGTTAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_8 1:N:0:
-GAGTTAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_9 1:N:0:
-GAGTTAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_10 1:N:0:
-GAGTTAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_11 1:N:0:
-GAGTTAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_12 1:N:0:
-GAGTTAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_13 1:N:0:
-GAGTTAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_0 1:N:0:
-TGTGAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_1 1:N:0:
-TGTGAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_2 1:N:0:
-TGTGAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_3 1:N:0:
-TGTGAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_4 1:N:0:
-TGTGAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_5 1:N:0:
-TGTGAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_6 1:N:0:
-TGTGAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_7 1:N:0:
-TGTGAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_8 1:N:0:
-TGTGAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_9 1:N:0:
-TGTGAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_10 1:N:0:
-TGTGAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_11 1:N:0:
-TGTGAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_12 1:N:0:
-TGTGAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_13 1:N:0:
-TGTGAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_14 1:N:0:
-TGTGAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_15 1:N:0:
-TGTGAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_16 1:N:0:
-TGTGAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_17 1:N:0:
-TGTGAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_18 1:N:0:
-TGTGAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_19 1:N:0:
-TGTGAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_20 1:N:0:
-TGTGAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_21 1:N:0:
-TGTGAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_22 1:N:0:
-TGTGAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCATTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_23 1:N:0:
-TGTGAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_0 1:N:0:
-TTTGTGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_1 1:N:0:
-TTTGTGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_2 1:N:0:
-TTTGTGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_3 1:N:0:
-TTTGTGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_4 1:N:0:
-TTTGTGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_5 1:N:0:
-TTTGTGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_6 1:N:0:
-TTTGTGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_7 1:N:0:
-TTTGTGAATTATCGTCTTGCACAAATCGTCTACGCAGATTCGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_8 1:N:0:
-TTTGTGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_9 1:N:0:
-TTTGTGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_0 1:N:0:
-GGAAGGAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_1 1:N:0:
-GGAAGGAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_2 1:N:0:
-GGAAGGAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_3 1:N:0:
-GGAAGGAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_4 1:N:0:
-GGAAGGAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGGTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_5 1:N:0:
-GGAAGGAATTATCGTCTTACACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_6 1:N:0:
-GGAAGGAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_7 1:N:0:
-GGAAGGAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_8 1:N:0:
-GGAAGGAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_9 1:N:0:
-GGAAGGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_10 1:N:0:
-GGAAGGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_11 1:N:0:
-GGAAGGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTCTCAATCAACTCGTGT
->lane1_fakedata4_12 1:N:0:
-GGAAGGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_13 1:N:0:
-GGAAGGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_14 1:N:0:
-GGAAGGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTTGCTACTGAAGTAGCTTGCACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_15 1:N:0:
-GGAAGGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_16 1:N:0:
-GGAAGGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_17 1:N:0:
-GGAAGGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_0 1:N:0:
-AATAAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_1 1:N:0:
-AATAAGAATTATCGTCTTGAACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_2 1:N:0:
-AATAAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_3 1:N:0:
-AATAAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_4 1:N:0:
-AATAAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_5 1:N:0:
-AATAAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_6 1:N:0:
-AATAAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_7 1:N:0:
-AATAAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_8 1:N:0:
-AATAAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_9 1:N:0:
-AATAAGAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_10 1:N:0:
-AATAAGAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_11 1:N:0:
-AATAAGAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_12 1:N:0:
-AATAAGAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_13 1:N:0:
-AATAAGAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_14 1:N:0:
-AATAAGAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_15 1:N:0:
-AATAAGAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_16 1:N:0:
-AATAAGAATTATCCTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_17 1:N:0:
-AATAAGAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_0 1:N:0:
-TTAAATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_1 1:N:0:
-TTAAATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_2 1:N:0:
-TTAAATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_3 1:N:0:
-TTAAATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_4 1:N:0:
-TTAAATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_5 1:N:0:
-TTAAATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_6 1:N:0:
-TTAAATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_7 1:N:0:
-TTAAATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_8 1:N:0:
-TTAAATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_9 1:N:0:
-TTAAATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_10 1:N:0:
-TTAAATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_11 1:N:0:
-TTAAATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_12 1:N:0:
-TTAAATAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_13 1:N:0:
-TTAAATAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_14 1:N:0:
-TTAAATAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_15 1:N:0:
-TTAAATAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_16 1:N:0:
-TTAAATAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_17 1:N:0:
-TTAAATAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_18 1:N:0:
-TTAAATAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_19 1:N:0:
-TTAAATAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_20 1:N:0:
-TTAAATAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_21 1:N:0:
-TTAAATAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_22 1:N:0:
-TTAAATAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_23 1:N:0:
-TTAAATAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_0 1:N:0:
-TAGTGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_1 1:N:0:
-TAGTGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_2 1:N:0:
-TAGTGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_3 1:N:0:
-TAGTGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_4 1:N:0:
-TAGTGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_5 1:N:0:
-TAGTGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_6 1:N:0:
-TAGTGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_7 1:N:0:
-TAGTGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_8 1:N:0:
-TAGTGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_9 1:N:0:
-TAGTGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_10 1:N:0:
-TAGTGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_11 1:N:0:
-TAGTGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_12 1:N:0:
-TAGTGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_13 1:N:0:
-TAGTGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_14 1:N:0:
-TAGTGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_15 1:N:0:
-TAGTGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_16 1:N:0:
-TAGTGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_17 1:N:0:
-TAGTGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_0 1:N:0:
-AAGAGGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_1 1:N:0:
-AAGAGGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_2 1:N:0:
-AAGAGGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_3 1:N:0:
-AAGAGGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_4 1:N:0:
-AAGAGGAATTATCGTCTTGCAAAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_5 1:N:0:
-AAGAGGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTTGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_6 1:N:0:
-AAGAGGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_7 1:N:0:
-AAGAGGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_8 1:N:0:
-AAGAGGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_9 1:N:0:
-AAGAGGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_10 1:N:0:
-AAGAGGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAATAGCTTGGACGGATTCTTTAGTGTTAATCAACTCGTGT
->lane1_fakedata4_11 1:N:0:
-AAGAGGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_12 1:N:0:
-AAGAGGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_13 1:N:0:
-AAGAGGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_14 1:N:0:
-AAGAGGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_15 1:N:0:
-AAGAGGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_16 1:N:0:
-AAGAGGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_17 1:N:0:
-AAGAGGAATTATCGTATTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_18 1:N:0:
-AAGAGGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_19 1:N:0:
-AAGAGGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_0 1:N:0:
-TGGAAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_1 1:N:0:
-TGGAAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_2 1:N:0:
-TGGAAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_3 1:N:0:
-TGGAAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_4 1:N:0:
-TGGAAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_5 1:N:0:
-TGGAAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_6 1:N:0:
-TGGAAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_7 1:N:0:
-TGGAAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_8 1:N:0:
-TGGAAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTCCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_9 1:N:0:
-TGGAAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_10 1:N:0:
-TGGAAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_11 1:N:0:
-TGGAAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_12 1:N:0:
-TGGAAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_13 1:N:0:
-TGGAAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_14 1:N:0:
-TGGAAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_15 1:N:0:
-TGGAAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_16 1:N:0:
-TGGAAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_17 1:N:0:
-TGGAAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_18 1:N:0:
-TGGAAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_19 1:N:0:
-TGGAAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_0 1:N:0:
-GAGAAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_1 1:N:0:
-GAGAAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_2 1:N:0:
-GAGAAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_3 1:N:0:
-GAGAAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_4 1:N:0:
-GAGAAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_5 1:N:0:
-GAGAAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_6 1:N:0:
-GAGAAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_7 1:N:0:
-GAGAAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_8 1:N:0:
-GAGAAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_9 1:N:0:
-GAGAAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_10 1:N:0:
-GAGAAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTTAATCAACTCGTGT
->lane1_fakedata4_11 1:N:0:
-GAGAAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_12 1:N:0:
-GAGAAGAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_13 1:N:0:
-GAGAAGAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_14 1:N:0:
-GAGAAGAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_15 1:N:0:
-GAGAAGAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_16 1:N:0:
-GAGAAGAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTTACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_17 1:N:0:
-GAGAAGAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_18 1:N:0:
-GAGAAGAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_19 1:N:0:
-GAGAAGAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_20 1:N:0:
-GAGAAGAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_21 1:N:0:
-GAGAAGAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_22 1:N:0:
-GAGAAGAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_23 1:N:0:
-GAGAAGAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGATACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_0 1:N:0:
-AGTAGAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_1 1:N:0:
-AGTAGAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_2 1:N:0:
-AGTAGAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_3 1:N:0:
-AGTAGAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_4 1:N:0:
-AGTAGAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_5 1:N:0:
-AGTAGAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_6 1:N:0:
-AGTAGAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_7 1:N:0:
-AGTAGAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_8 1:N:0:
-AGTAGAAATTATCTTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_9 1:N:0:
-AGTAGAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_10 1:N:0:
-AGTAGAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_11 1:N:0:
-AGTAGAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_12 1:N:0:
-AGTAGAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGCCGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_13 1:N:0:
-AGTAGAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_14 1:N:0:
-AGTAGAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_15 1:N:0:
-AGTAGAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_16 1:N:0:
-AGTAGAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_17 1:N:0:
-AGTAGAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_18 1:N:0:
-AGTAGAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_19 1:N:0:
-AGTAGAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_20 1:N:0:
-AGTAGAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_21 1:N:0:
-AGTAGAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_22 1:N:0:
-AGTAGAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_23 1:N:0:
-AGTAGAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_24 1:N:0:
-AGTAGAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_25 1:N:0:
-AGTAGAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_26 1:N:0:
-AGTAGAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_27 1:N:0:
-AGTAGAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_28 1:N:0:
-AGTAGAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_29 1:N:0:
-AGTAGAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_30 1:N:0:
-AGTAGAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_31 1:N:0:
-AGTAGAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_32 1:N:0:
-AGTAGAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_33 1:N:0:
-AGTAGAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_34 1:N:0:
-AGTAGAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_35 1:N:0:
-AGTAGAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_36 1:N:0:
-AGTAGAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_37 1:N:0:
-AGTAGAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_0 1:N:0:
-AGTAATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_1 1:N:0:
-AGTAATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_2 1:N:0:
-AGTAATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_3 1:N:0:
-AGTAATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_4 1:N:0:
-AGTAATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_5 1:N:0:
-AGTAATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_6 1:N:0:
-AGTAATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_7 1:N:0:
-AGTAATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_8 1:N:0:
-AGTAATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_9 1:N:0:
-AGTAATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_10 1:N:0:
-AGTAATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_11 1:N:0:
-AGTAATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_12 1:N:0:
-AGTAATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_13 1:N:0:
-AGTAATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_14 1:N:0:
-AGTAATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_15 1:N:0:
-AGTAATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_16 1:N:0:
-AGTAATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_17 1:N:0:
-AGTAATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_18 1:N:0:
-AGTAATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_19 1:N:0:
-AGTAATAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_0 1:N:0:
-GGGATAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_1 1:N:0:
-GGGATAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_2 1:N:0:
-GGGATAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCGACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_3 1:N:0:
-GGGATAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_4 1:N:0:
-GGGATAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_5 1:N:0:
-GGGATAAATTACCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_6 1:N:0:
-GGGATAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_7 1:N:0:
-GGGATAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_8 1:N:0:
-GGGATAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_9 1:N:0:
-GGGATAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_10 1:N:0:
-GGGATAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_11 1:N:0:
-GGGATAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_12 1:N:0:
-GGGATAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_13 1:N:0:
-GGGATAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_14 1:N:0:
-GGGATAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_15 1:N:0:
-GGGATAAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_0 1:N:0:
-TGTTTTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_1 1:N:0:
-TGTTTTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_2 1:N:0:
-TGTTTTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_3 1:N:0:
-TGTTTTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_4 1:N:0:
-TGTTTTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_5 1:N:0:
-TGTTTTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_6 1:N:0:
-TGTTTTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_7 1:N:0:
-TGTTTTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_8 1:N:0:
-TGTTTTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_9 1:N:0:
-TGTTTTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_10 1:N:0:
-TGTTTTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_11 1:N:0:
-TGTTTTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_12 1:N:0:
-TGTTTTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_13 1:N:0:
-TGTTTTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_0 1:N:0:
-ATGATGAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTGGTGTCAATCCAACTCG
->lane1_fakedata4_1 1:N:0:
-ATGATGAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_2 1:N:0:
-ATGATGAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_3 1:N:0:
-ATGATGAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_4 1:N:0:
-ATGATGAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_5 1:N:0:
-ATGATGAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_6 1:N:0:
-ATGATGAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_7 1:N:0:
-ATGATGAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_8 1:N:0:
-ATGATGAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_9 1:N:0:
-ATGATGAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTCGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_10 1:N:0:
-ATGATGAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_11 1:N:0:
-ATGATGAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_12 1:N:0:
-ATGATGAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_13 1:N:0:
-ATGATGAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
->lane1_fakedata4_14 1:N:0:
-ATGATGAATTATCGTCTTGCACAAATCGTCTGCGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_15 1:N:0:
-ATGATGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_16 1:N:0:
-ATGATGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_17 1:N:0:
-ATGATGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_18 1:N:0:
-ATGATGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_19 1:N:0:
-ATGATGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_20 1:N:0:
-ATGATGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_21 1:N:0:
-ATGATGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_22 1:N:0:
-ATGATGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_23 1:N:0:
-ATGATGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_24 1:N:0:
-ATGATGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_25 1:N:0:
-ATGATGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_26 1:N:0:
-ATGATGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata4_27 1:N:0:
-ATGATGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
->lane1_fakedata5_0 1:N:0:
-GGTGTGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_1 1:N:0:
-GGTGTGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_2 1:N:0:
-GGTGTGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_3 1:N:0:
-GGTGTGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_4 1:N:0:
-GGTGTGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_5 1:N:0:
-GGTGTGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_6 1:N:0:
-GGTGTGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_7 1:N:0:
-GGTGTGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_0 1:N:0:
-TTTAAGAATTTATCGGTCAGCTTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_1 1:N:0:
-TTTAAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_2 1:N:0:
-TTTAAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_3 1:N:0:
-TTTAAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_4 1:N:0:
-TTTAAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_5 1:N:0:
-TTTAAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_6 1:N:0:
-TTTAAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_7 1:N:0:
-TTTAAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_8 1:N:0:
-TTTAAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_9 1:N:0:
-TTTAAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_10 1:N:0:
-TTTAAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCCCCA
->lane1_fakedata5_11 1:N:0:
-TTTAAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGCCGCCAATTAGCCACTCACCA
->lane1_fakedata5_12 1:N:0:
-TTTAAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_13 1:N:0:
-TTTAAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_14 1:N:0:
-TTTAAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_15 1:N:0:
-TTTAAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_0 1:N:0:
-TGATGTAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_1 1:N:0:
-TGATGTAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCTCATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_2 1:N:0:
-TGATGTAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_3 1:N:0:
-TGATGTAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_4 1:N:0:
-TGATGTAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_5 1:N:0:
-TGATGTAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_6 1:N:0:
-TGATGTAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_7 1:N:0:
-TGATGTAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_8 1:N:0:
-TGATGTAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_9 1:N:0:
-TGATGTAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_10 1:N:0:
-TGATGTAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_11 1:N:0:
-TGATGTAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTACCAA
->lane1_fakedata5_12 1:N:0:
-TGATGTAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTACCAA
->lane1_fakedata5_13 1:N:0:
-TGATGTAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTACCAA
->lane1_fakedata5_14 1:N:0:
-TGATGTAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTACCAA
->lane1_fakedata5_15 1:N:0:
-TGATGTAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTACCAA
->lane1_fakedata5_16 1:N:0:
-TGATGTAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTACCAA
->lane1_fakedata5_17 1:N:0:
-TGATGTAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTAAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTACCAA
->lane1_fakedata5_18 1:N:0:
-TGATGTAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTACCAA
->lane1_fakedata5_19 1:N:0:
-TGATGTAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTACCAA
->lane1_fakedata5_20 1:N:0:
-TGATGTAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTACCAA
->lane1_fakedata5_21 1:N:0:
-TGATGTAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTACCAA
->lane1_fakedata5_0 1:N:0:
-CATCATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_1 1:N:0:
-CATCATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_2 1:N:0:
-CATCATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_3 1:N:0:
-CATCATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCAATCACCA
->lane1_fakedata5_4 1:N:0:
-CATCATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_5 1:N:0:
-CATCATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_6 1:N:0:
-CATCATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_7 1:N:0:
-CATCATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_8 1:N:0:
-CATCATAATTTATCGGTCAGCGTGGCTCCCCTCTAACTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCAACA
->lane1_fakedata5_9 1:N:0:
-CATCATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_10 1:N:0:
-CATCATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_11 1:N:0:
-CATCATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_12 1:N:0:
-CATCATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_13 1:N:0:
-CATCATAATTTATAGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_14 1:N:0:
-CATCATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_15 1:N:0:
-CATCATAATTTATAGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_16 1:N:0:
-CATCATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_17 1:N:0:
-CATCATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_18 1:N:0:
-CATCATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_19 1:N:0:
-CATCATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_20 1:N:0:
-CATCATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACTTTGAGTCCAAGGGCGCCAATTAGCCACTCACCC
->lane1_fakedata5_21 1:N:0:
-CATCATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_22 1:N:0:
-CATCATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_23 1:N:0:
-CATCATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_24 1:N:0:
-CATCATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_25 1:N:0:
-CATCATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_26 1:N:0:
-CATCATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_27 1:N:0:
-CATCATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_0 1:N:0:
-AGGAAAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_1 1:N:0:
-AGGAAAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_2 1:N:0:
-AGGAAAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_3 1:N:0:
-AGGAAAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_0 1:N:0:
-AAGATAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_1 1:N:0:
-AAGATAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_2 1:N:0:
-AAGATAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_3 1:N:0:
-AAGATAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_4 1:N:0:
-AAGATAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_5 1:N:0:
-AAGATAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_6 1:N:0:
-AAGATAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_7 1:N:0:
-AAGATAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGGGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_8 1:N:0:
-AAGATAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_9 1:N:0:
-AAGATAAATTTATCGGTCAGCGTGGCTCCCGTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_10 1:N:0:
-AAGATAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_11 1:N:0:
-AAGATAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_12 1:N:0:
-AAGATAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_13 1:N:0:
-AAGATAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_14 1:N:0:
-AAGATAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_15 1:N:0:
-AAGATAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_16 1:N:0:
-AAGATAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_17 1:N:0:
-AAGATAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_18 1:N:0:
-AAGATAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_19 1:N:0:
-AAGATAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_0 1:N:0:
-ATAAGTAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_1 1:N:0:
-ATAAGTAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_2 1:N:0:
-ATAAGTAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_3 1:N:0:
-ATAAGTAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_4 1:N:0:
-ATAAGTAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_5 1:N:0:
-ATAAGTAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_6 1:N:0:
-ATAAGTAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_7 1:N:0:
-ATAAGTAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_0 1:N:0:
-ATGTAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_1 1:N:0:
-ATGTAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_2 1:N:0:
-ATGTAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_3 1:N:0:
-ATGTAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAACTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_4 1:N:0:
-ATGTAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_5 1:N:0:
-ATGTAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_6 1:N:0:
-ATGTAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_7 1:N:0:
-ATGTAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_8 1:N:0:
-ATGTAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTCTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_9 1:N:0:
-ATGTAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_10 1:N:0:
-ATGTAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_11 1:N:0:
-ATGTAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_12 1:N:0:
-ATGTAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_13 1:N:0:
-ATGTAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_14 1:N:0:
-ATGTAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_15 1:N:0:
-ATGTAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_0 1:N:0:
-AAGGATAATTTATCTGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_1 1:N:0:
-AAGGATAATTTATCTGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_2 1:N:0:
-AAGGATAATTTATCTGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_3 1:N:0:
-AAGGATAATTTATCTGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_4 1:N:0:
-AAGGATAATTTATCTGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_5 1:N:0:
-AAGGATAATTTATCTGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_6 1:N:0:
-AAGGATAATTTATCTGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_7 1:N:0:
-AAGGATAATTTATCTGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_8 1:N:0:
-AAGGATAATTTATCTGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_9 1:N:0:
-AAGGATAATTTATCTGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_10 1:N:0:
-AAGGATAATTTATCTGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_11 1:N:0:
-AAGGATAATTTATCTGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_12 1:N:0:
-AAGGATAATTTATCTGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_13 1:N:0:
-AAGGATAATTTATCTGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_14 1:N:0:
-AAGGATAATTTATCTGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_15 1:N:0:
-AAGGATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_16 1:N:0:
-AAGGATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_17 1:N:0:
-AAGGATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_18 1:N:0:
-AAGGATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCT
->lane1_fakedata5_19 1:N:0:
-AAGGATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_20 1:N:0:
-AAGGATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_21 1:N:0:
-AAGGATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_22 1:N:0:
-AAGGATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_23 1:N:0:
-AAGGATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_24 1:N:0:
-AAGGATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_25 1:N:0:
-AAGGATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_26 1:N:0:
-AAGGATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_27 1:N:0:
-AAGGATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_28 1:N:0:
-AAGGATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_29 1:N:0:
-AAGGATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_0 1:N:0:
-GGAGAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_1 1:N:0:
-GGAGAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_2 1:N:0:
-GGAGAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_3 1:N:0:
-GGAGAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_4 1:N:0:
-GGAGAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_5 1:N:0:
-GGAGAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_6 1:N:0:
-GGAGAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_7 1:N:0:
-GGAGAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_8 1:N:0:
-GGAGAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_9 1:N:0:
-GGAGAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_10 1:N:0:
-GGAGAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACAGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_11 1:N:0:
-GGAGAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_12 1:N:0:
-GGAGAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_13 1:N:0:
-GGAGAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_14 1:N:0:
-GGAGAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_15 1:N:0:
-GGAGAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCACCAATTAGCCACTCACCA
->lane1_fakedata5_16 1:N:0:
-GGAGAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_17 1:N:0:
-GGAGAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_18 1:N:0:
-GGAGAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_19 1:N:0:
-GGAGAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCTAATTAGCCACTCACCA
->lane1_fakedata5_0 1:N:0:
-GTTTTAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_1 1:N:0:
-GTTTTAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_2 1:N:0:
-GTTTTAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_3 1:N:0:
-GTTTTAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_4 1:N:0:
-GTTTTAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_5 1:N:0:
-GTTTTAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_6 1:N:0:
-GTTTTAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_7 1:N:0:
-GTTTTAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_8 1:N:0:
-GTTTTAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_9 1:N:0:
-GTTTTAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_10 1:N:0:
-GTTTTAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_11 1:N:0:
-GTTTTAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_12 1:N:0:
-GTTTTAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_13 1:N:0:
-GTTTTAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_14 1:N:0:
-GTTTTAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_15 1:N:0:
-GTTTTAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_16 1:N:0:
-GTTTTAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_17 1:N:0:
-GTTTTAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_18 1:N:0:
-GTTTTAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_19 1:N:0:
-GTTTTAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_20 1:N:0:
-GTTTTAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_21 1:N:0:
-GTTTTAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_22 1:N:0:
-GTTTTAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_23 1:N:0:
-GTTTTAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_24 1:N:0:
-GTTTTAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_25 1:N:0:
-GTTTTAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_26 1:N:0:
-GTTTTAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_27 1:N:0:
-GTTTTAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_0 1:N:0:
-TGATAAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_1 1:N:0:
-TGATAAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGTCGCCAATTAGCCACTCACCA
->lane1_fakedata5_2 1:N:0:
-TGATAAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_3 1:N:0:
-TGATAAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_4 1:N:0:
-TGATAAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_5 1:N:0:
-TGATAAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_6 1:N:0:
-TGATAAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_7 1:N:0:
-TGATAAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_8 1:N:0:
-TGATAAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_9 1:N:0:
-TGATAAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_10 1:N:0:
-TGATAAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_11 1:N:0:
-TGATAAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_12 1:N:0:
-TGATAAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_13 1:N:0:
-TGATAAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_14 1:N:0:
-TGATAAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_15 1:N:0:
-TGATAAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_16 1:N:0:
-TGATAAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_17 1:N:0:
-TGATAAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_18 1:N:0:
-TGATAAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_19 1:N:0:
-TGATAAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_20 1:N:0:
-TGATAAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_21 1:N:0:
-TGATAAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_22 1:N:0:
-TGATAAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_23 1:N:0:
-TGATAAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_0 1:N:0:
-GTTGATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCT
->lane1_fakedata5_1 1:N:0:
-GTTGATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_2 1:N:0:
-GTTGATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_3 1:N:0:
-GTTGATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_4 1:N:0:
-GTTGATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_5 1:N:0:
-GTTGATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_6 1:N:0:
-GTTGATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_7 1:N:0:
-GTTGATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_8 1:N:0:
-GTTGATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACGTTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_9 1:N:0:
-GTTGATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_10 1:N:0:
-GTTGATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_11 1:N:0:
-GTTGATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_12 1:N:0:
-GTTGATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_13 1:N:0:
-GTTGATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_14 1:N:0:
-GTTGATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_15 1:N:0:
-GTTGATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_16 1:N:0:
-GTTGATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_17 1:N:0:
-GTTGATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATTATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_18 1:N:0:
-GTTGATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_19 1:N:0:
-GTTGATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_20 1:N:0:
-GTTGATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_21 1:N:0:
-GTTGATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_22 1:N:0:
-GTTGATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_23 1:N:0:
-GTTGATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_0 1:N:0:
-AGATTAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_1 1:N:0:
-AGATTAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTGGCCACTCACCA
->lane1_fakedata5_2 1:N:0:
-AGATTAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_3 1:N:0:
-AGATTAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_4 1:N:0:
-AGATTAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_5 1:N:0:
-AGATTAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_6 1:N:0:
-AGATTAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_7 1:N:0:
-AGATTAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_8 1:N:0:
-AGATTAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_9 1:N:0:
-AGATTAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_0 1:N:0:
-GTATAGAATTTATCAGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTACCAA
->lane1_fakedata5_1 1:N:0:
-GTATAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTACCAA
->lane1_fakedata5_2 1:N:0:
-GTATAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTACCAA
->lane1_fakedata5_3 1:N:0:
-GTATAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTACCAA
->lane1_fakedata5_4 1:N:0:
-GTATAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTACCAA
->lane1_fakedata5_5 1:N:0:
-GTATAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTACCAA
->lane1_fakedata5_6 1:N:0:
-GTATAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTACCAA
->lane1_fakedata5_7 1:N:0:
-GTATAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTACCAA
->lane1_fakedata5_8 1:N:0:
-GTATAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTACCAA
->lane1_fakedata5_9 1:N:0:
-GTATAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTACCAA
->lane1_fakedata5_10 1:N:0:
-GTATAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGTGTCCAAGGGCGCCAATTAGCCACTACCAA
->lane1_fakedata5_11 1:N:0:
-GTATAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTACCAA
->lane1_fakedata5_12 1:N:0:
-GTATAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTACCAA
->lane1_fakedata5_13 1:N:0:
-GTATAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTACCAA
->lane1_fakedata5_14 1:N:0:
-GTATAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTACCAA
->lane1_fakedata5_15 1:N:0:
-GTATAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTACCAA
->lane1_fakedata5_16 1:N:0:
-GTATAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCATGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_17 1:N:0:
-GTATAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACACACCA
->lane1_fakedata5_18 1:N:0:
-GTATAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_19 1:N:0:
-GTATAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_20 1:N:0:
-GTATAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCCCCA
->lane1_fakedata5_21 1:N:0:
-GTATAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_22 1:N:0:
-GTATAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_23 1:N:0:
-GTATAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_24 1:N:0:
-GTATAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_25 1:N:0:
-GTATAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_26 1:N:0:
-GTATAGAATTTATCGGTCAGCGTGGCTCCCATCTATCTTTTTGTTTGGGATCATGACAGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_27 1:N:0:
-GTATAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_28 1:N:0:
-GTATAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGACACTCACCA
->lane1_fakedata5_29 1:N:0:
-GTATAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_30 1:N:0:
-GTATAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_31 1:N:0:
-GTATAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_0 1:N:0:
-TTGGGAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_1 1:N:0:
-TTGGGAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_2 1:N:0:
-TTGGGAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_3 1:N:0:
-TTGGGAAATTTATCGGTCAGCGTGGCTCCCCACTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_4 1:N:0:
-TTGGGAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_5 1:N:0:
-TTGGGAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACTA
->lane1_fakedata5_6 1:N:0:
-TTGGGAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_7 1:N:0:
-TTGGGAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_8 1:N:0:
-TTGGGAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_9 1:N:0:
-TTGGGAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_10 1:N:0:
-TTGGGAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_11 1:N:0:
-TTGGGAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_12 1:N:0:
-TTGGGAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_13 1:N:0:
-TTGGGAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_14 1:N:0:
-TTGGGAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_15 1:N:0:
-TTGGGAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_16 1:N:0:
-TTGGGAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCAGCA
->lane1_fakedata5_17 1:N:0:
-TTGGGAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_18 1:N:0:
-TTGGGAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCAAATTAGCCACTCACCA
->lane1_fakedata5_19 1:N:0:
-TTGGGAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_0 1:N:0:
-ATATATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_1 1:N:0:
-ATATATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_2 1:N:0:
-ATATATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_3 1:N:0:
-ATATATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_4 1:N:0:
-ATATATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_5 1:N:0:
-ATATATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_6 1:N:0:
-ATATATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_7 1:N:0:
-ATATATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_8 1:N:0:
-ATATATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_9 1:N:0:
-ATATATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_10 1:N:0:
-ATATATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_11 1:N:0:
-ATATATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_12 1:N:0:
-ATATATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_13 1:N:0:
-ATATATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_14 1:N:0:
-ATATATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_15 1:N:0:
-ATATATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_16 1:N:0:
-ATATATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_17 1:N:0:
-ATATATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_18 1:N:0:
-ATATATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_19 1:N:0:
-ATATATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_20 1:N:0:
-ATATATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_21 1:N:0:
-ATATATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_22 1:N:0:
-ATATATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_23 1:N:0:
-ATATATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_24 1:N:0:
-ATATATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_25 1:N:0:
-ATATATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_26 1:N:0:
-ATATATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGGCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_27 1:N:0:
-ATATATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_28 1:N:0:
-ATATATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_29 1:N:0:
-ATATATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_30 1:N:0:
-ATATATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_31 1:N:0:
-ATATATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_32 1:N:0:
-ATATATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_33 1:N:0:
-ATATATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_34 1:N:0:
-ATATATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_35 1:N:0:
-ATATATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_36 1:N:0:
-ATATATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_37 1:N:0:
-ATATATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_0 1:N:0:
-GATGAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_1 1:N:0:
-GATGAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_2 1:N:0:
-GATGAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_3 1:N:0:
-GATGAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_4 1:N:0:
-GATGAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_5 1:N:0:
-GATGAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_6 1:N:0:
-GATGAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_7 1:N:0:
-GATGAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_8 1:N:0:
-GATGAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_9 1:N:0:
-GATGAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_10 1:N:0:
-GATGAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_11 1:N:0:
-GATGAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_12 1:N:0:
-GATGAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_13 1:N:0:
-GATGAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATGATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_14 1:N:0:
-GATGAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_15 1:N:0:
-GATGAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTGTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_16 1:N:0:
-GATGAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_17 1:N:0:
-GATGAGAATTTATCGGTCAGCGTGGCTCCCCTCTATTTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_18 1:N:0:
-GATGAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATGATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_19 1:N:0:
-GATGAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_20 1:N:0:
-GATGAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_21 1:N:0:
-GATGAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_22 1:N:0:
-GATGAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_23 1:N:0:
-GATGAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_24 1:N:0:
-GATGAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_25 1:N:0:
-GATGAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_26 1:N:0:
-GATGAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_27 1:N:0:
-GATGAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_28 1:N:0:
-GATGAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_29 1:N:0:
-GATGAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_0 1:N:0:
-GGGAATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_1 1:N:0:
-GGGAATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_2 1:N:0:
-GGGAATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_3 1:N:0:
-GGGAATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_4 1:N:0:
-GGGAATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_5 1:N:0:
-GGGAATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_6 1:N:0:
-GGGAATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_7 1:N:0:
-GGGAATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_8 1:N:0:
-GGGAATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_9 1:N:0:
-GGGAATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_10 1:N:0:
-GGGAATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_11 1:N:0:
-GGGAATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_12 1:N:0:
-GGGAATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_13 1:N:0:
-GGGAATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_14 1:N:0:
-GGGAATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_15 1:N:0:
-GGGAATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_16 1:N:0:
-GGGAATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_17 1:N:0:
-GGGAATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_0 1:N:0:
-GAGTTAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_1 1:N:0:
-GAGTTAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_2 1:N:0:
-GAGTTAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_3 1:N:0:
-GAGTTAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_4 1:N:0:
-GAGTTAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_5 1:N:0:
-GAGTTAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_6 1:N:0:
-GAGTTAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_7 1:N:0:
-GAGTTAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_8 1:N:0:
-GAGTTAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_9 1:N:0:
-GAGTTAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_0 1:N:0:
-ATAGTTAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_1 1:N:0:
-ATAGTTAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_2 1:N:0:
-ATAGTTAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_3 1:N:0:
-ATAGTTAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_4 1:N:0:
-ATAGTTAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_5 1:N:0:
-ATAGTTAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_6 1:N:0:
-ATAGTTAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_7 1:N:0:
-ATAGTTAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_8 1:N:0:
-ATAGTTAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_9 1:N:0:
-ATAGTTAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_10 1:N:0:
-ATAGTTAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_11 1:N:0:
-ATAGTTAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_12 1:N:0:
-ATAGTTAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_13 1:N:0:
-ATAGTTAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_14 1:N:0:
-ATAGTTAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_15 1:N:0:
-ATAGTTAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_16 1:N:0:
-ATAGTTAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_17 1:N:0:
-ATAGTTAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_18 1:N:0:
-ATAGTTAATTTATCTGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_19 1:N:0:
-ATAGTTAATTTATCTGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_20 1:N:0:
-ATAGTTAATTTATCTGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_21 1:N:0:
-ATAGTTAATTTATCTGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_22 1:N:0:
-ATAGTTAATTTATCTGCCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_23 1:N:0:
-ATAGTTAATTTATCTGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_24 1:N:0:
-ATAGTTAATTTATCTGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_25 1:N:0:
-ATAGTTAATTTATCTGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCATCA
->lane1_fakedata5_26 1:N:0:
-ATAGTTAATTTATCTGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_27 1:N:0:
-ATAGTTAATTTATCTGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_28 1:N:0:
-ATAGTTAATTTATCTGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_29 1:N:0:
-ATAGTTAATTTATCTGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_30 1:N:0:
-ATAGTTAATTTATCTGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_31 1:N:0:
-ATAGTTAATTTATCTGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_32 1:N:0:
-ATAGTTAATTTATCTGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_33 1:N:0:
-ATAGTTAATTTATCTGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_34 1:N:0:
-ATAGTTAATTTATCTGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_35 1:N:0:
-ATAGTTAATTTATCTGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCT
->lane1_fakedata5_0 1:N:0:
-TGTGAGAATTTATCGGGCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_1 1:N:0:
-TGTGAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_0 1:N:0:
-TTTGTGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_1 1:N:0:
-TTTGTGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_2 1:N:0:
-TTTGTGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCTCCAATTAGCCACTCACCA
->lane1_fakedata5_3 1:N:0:
-TTTGTGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_4 1:N:0:
-TTTGTGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_5 1:N:0:
-TTTGTGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_6 1:N:0:
-TTTGTGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_7 1:N:0:
-TTTGTGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_8 1:N:0:
-TTTGTGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_9 1:N:0:
-TTTGTGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_10 1:N:0:
-TTTGTGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_11 1:N:0:
-TTTGTGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_12 1:N:0:
-TTTGTGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_13 1:N:0:
-TTTGTGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_14 1:N:0:
-TTTGTGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_15 1:N:0:
-TTTGTGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_16 1:N:0:
-TTTGTGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_17 1:N:0:
-TTTGTGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_18 1:N:0:
-TTTGTGAATTTATCGGTCAGCGTGGCTCGCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_19 1:N:0:
-TTTGTGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGTGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_20 1:N:0:
-TTTGTGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_21 1:N:0:
-TTTGTGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_22 1:N:0:
-TTTGTGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_23 1:N:0:
-TTTGTGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_24 1:N:0:
-TTTGTGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_25 1:N:0:
-TTTGTGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_26 1:N:0:
-TTTGTGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_27 1:N:0:
-TTTGTGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_28 1:N:0:
-TTTGTGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTTGGATCGTGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_29 1:N:0:
-TTTGTGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_30 1:N:0:
-TTTGTGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_31 1:N:0:
-TTTGTGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_32 1:N:0:
-TTTGTGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_33 1:N:0:
-TTTGTGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_34 1:N:0:
-TTTGTGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_35 1:N:0:
-TTTGTGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_0 1:N:0:
-GGAAGGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATGAGCCACTCACCA
->lane1_fakedata5_1 1:N:0:
-GGAAGGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_2 1:N:0:
-GGAAGGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCTTGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_3 1:N:0:
-GGAAGGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_4 1:N:0:
-GGAAGGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_5 1:N:0:
-GGAAGGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_6 1:N:0:
-GGAAGGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_7 1:N:0:
-GGAAGGAATTTATCTGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTAGTCCAAGGCGCCAATTAGCCACTCCCAAAT
->lane1_fakedata5_8 1:N:0:
-GGAAGGAATTTATCTGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTAGTCCAAGGCGCCAATTAGCCACTCCCAAAT
->lane1_fakedata5_9 1:N:0:
-GGAAGGAATTTATCTGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTAGTCCAAGGCGCCAATTAGCCACTCCCAAAT
->lane1_fakedata5_10 1:N:0:
-GGAAGGAATTTATCCGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTAGTCCAAGGCGCCAATTAGCCACTCCCAAAT
->lane1_fakedata5_11 1:N:0:
-GGAAGGAATTTATCTGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTAGTCCAAGGCGCCAATTAGCCACTCCCAAAT
->lane1_fakedata5_12 1:N:0:
-GGAAGGAATTTATCTGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTAGTCCAAGGCGCCAATTAGCCACTCCCAAAT
->lane1_fakedata5_13 1:N:0:
-GGAAGGAATTTATCTGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTAGTCCAAGGCGCCAATTAGCCACTCCCAAAT
->lane1_fakedata5_0 1:N:0:
-TTAAATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_1 1:N:0:
-TTAAATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_2 1:N:0:
-TTAAATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_3 1:N:0:
-TTAAATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_4 1:N:0:
-TTAAATAATTTATCGGTCAGCGTGGCTCCCCTCTGTCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_5 1:N:0:
-TTAAATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_6 1:N:0:
-TTAAATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_7 1:N:0:
-TTAAATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_8 1:N:0:
-TTAAATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_9 1:N:0:
-TTAAATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_10 1:N:0:
-TTAAATAATTTATCTGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_11 1:N:0:
-TTAAATAATTTATCTGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_12 1:N:0:
-TTAAATAATTTATCTGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_13 1:N:0:
-TTAAATAATTTATCTGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_14 1:N:0:
-TTAAATAATTTATCTGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_15 1:N:0:
-TTAAATAATTTATCTGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_16 1:N:0:
-TTAAATAATTTATCTGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_17 1:N:0:
-TTAAATAATTTATCTGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_18 1:N:0:
-TTAAATAATTTATCTGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_19 1:N:0:
-TTAAATAATTTATCTGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_0 1:N:0:
-TAGTGTAATTTATCTGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACTA
->lane1_fakedata5_1 1:N:0:
-TAGTGTAATTTATCTGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_2 1:N:0:
-TAGTGTAATTTATCTGTCAGCGTGGCTCCCCTCTATCTTTATGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_3 1:N:0:
-TAGTGTAATTTATCTGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCCCCAATTAGCCACTCACCA
->lane1_fakedata5_4 1:N:0:
-TAGTGTAATTTATCTGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_5 1:N:0:
-TAGTGTAATTTATCTGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_6 1:N:0:
-TAGTGTAATTTATCTGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_7 1:N:0:
-TAGTGTAATTTATCTGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_8 1:N:0:
-TAGTGTAATTTATCTGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_9 1:N:0:
-TAGTGTAATTTATCTGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_10 1:N:0:
-TAGTGTAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_11 1:N:0:
-TAGTGTAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_12 1:N:0:
-TAGTGTAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_13 1:N:0:
-TAGTGTAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_14 1:N:0:
-TAGTGTAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_15 1:N:0:
-TAGTGTAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_16 1:N:0:
-TAGTGTAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_17 1:N:0:
-TAGTGTAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTTACCA
->lane1_fakedata5_18 1:N:0:
-TAGTGTAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_19 1:N:0:
-TAGTGTAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_0 1:N:0:
-AAGAGGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_1 1:N:0:
-AAGAGGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_2 1:N:0:
-AAGAGGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_3 1:N:0:
-AAGAGGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATTATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_4 1:N:0:
-AAGAGGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_5 1:N:0:
-AAGAGGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_6 1:N:0:
-AAGAGGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_7 1:N:0:
-AAGAGGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_8 1:N:0:
-AAGAGGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_9 1:N:0:
-AAGAGGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_10 1:N:0:
-AAGAGGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_11 1:N:0:
-AAGAGGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_12 1:N:0:
-AAGAGGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_13 1:N:0:
-AAGAGGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_14 1:N:0:
-AAGAGGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_15 1:N:0:
-AAGAGGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_16 1:N:0:
-AAGAGGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTCTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_17 1:N:0:
-AAGAGGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_18 1:N:0:
-AAGAGGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_19 1:N:0:
-AAGAGGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGCTCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_20 1:N:0:
-AAGAGGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_21 1:N:0:
-AAGAGGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_22 1:N:0:
-AAGAGGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_23 1:N:0:
-AAGAGGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATGATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_24 1:N:0:
-AAGAGGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_25 1:N:0:
-AAGAGGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_26 1:N:0:
-AAGAGGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_27 1:N:0:
-AAGAGGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_0 1:N:0:
-GGGTTGAATTTATCGGTCAGCGTGGCTACCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_1 1:N:0:
-GGGTTGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_2 1:N:0:
-GGGTTGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_3 1:N:0:
-GGGTTGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_4 1:N:0:
-GGGTTGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_5 1:N:0:
-GGGTTGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_6 1:N:0:
-GGGTTGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_7 1:N:0:
-GGGTTGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTCTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_0 1:N:0:
-TGGAAGAATTTATCTGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTAGTCCAAGGCGCCAATTAGCCACTCCCAAAT
->lane1_fakedata5_1 1:N:0:
-TGGAAGAATTTATCTGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTAGTCCAAGGCGCCAATTAGCCACTCCCAAAT
->lane1_fakedata5_2 1:N:0:
-TGGAAGAATTTATCTGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTAGTCCAAGGCGCCAATTAGCCACTCCCAAAT
->lane1_fakedata5_3 1:N:0:
-TGGAAGAATTTATCTGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTAGTCCAAGGCGCCAATTAGCCACTCCCAAAT
->lane1_fakedata5_4 1:N:0:
-TGGAAGAATTTATCTGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCATATTAGTCCAAGGCGCCAATTAGCCACTCCCAAAT
->lane1_fakedata5_5 1:N:0:
-TGGAAGAATTTATCTGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTAGTCCAAGGCGCCAATTAGCCACTCCCAAAT
->lane1_fakedata5_6 1:N:0:
-TGGAAGAATTTATCTGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTAGTCCAAGGCGCCAATTAGCCACTCCCAAAT
->lane1_fakedata5_7 1:N:0:
-TGGAAGAATTTATCTGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTAGTCCAAGGCGCCAATTAGCCACTCCCAAAT
->lane1_fakedata5_8 1:N:0:
-TGGAAGAATTTATCTGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTAGTCCAAGGCGCCAATTAGCCACTCCCAAAT
->lane1_fakedata5_9 1:N:0:
-TGGAAGAATTTATCTGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTAGTCCAAGGCGCCAATTAGCCACTCCCAAAT
->lane1_fakedata5_10 1:N:0:
-TGGAAGAATTTATCTGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTAGTCCAAGGCGCCAATTAGCCACTCCCAAAT
->lane1_fakedata5_11 1:N:0:
-TGGAAGAATTTATCTGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTAGTCCAAGGCGCCAATTAGCCACTCCCAAAT
->lane1_fakedata5_12 1:N:0:
-TGGAAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_13 1:N:0:
-TGGAAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGATTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_14 1:N:0:
-TGGAAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_15 1:N:0:
-TGGAAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_16 1:N:0:
-TGGAAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_17 1:N:0:
-TGGAAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_18 1:N:0:
-TGGAAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_19 1:N:0:
-TGGAAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_20 1:N:0:
-TGGAAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_21 1:N:0:
-TGGAAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_22 1:N:0:
-TGGAAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_23 1:N:0:
-TGGAAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_0 1:N:0:
-GAGAAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_1 1:N:0:
-GAGAAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_2 1:N:0:
-GAGAAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_3 1:N:0:
-GAGAAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_4 1:N:0:
-GAGAAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_5 1:N:0:
-GAGAAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_6 1:N:0:
-GAGAAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_7 1:N:0:
-GAGAAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_8 1:N:0:
-GAGAAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_9 1:N:0:
-GAGAAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_10 1:N:0:
-GAGAAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_11 1:N:0:
-GAGAAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCTTGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_12 1:N:0:
-GAGAAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_13 1:N:0:
-GAGAAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_14 1:N:0:
-GAGAAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_15 1:N:0:
-GAGAAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGACGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_16 1:N:0:
-GAGAAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_17 1:N:0:
-GAGAAGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_0 1:N:0:
-AGTAGAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_1 1:N:0:
-AGTAGAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_2 1:N:0:
-AGTAGAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_3 1:N:0:
-AGTAGAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_4 1:N:0:
-AGTAGAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_5 1:N:0:
-AGTAGAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_6 1:N:0:
-AGTAGAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_7 1:N:0:
-AGTAGAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_8 1:N:0:
-AGTAGAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_9 1:N:0:
-AGTAGAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_10 1:N:0:
-AGTAGAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_11 1:N:0:
-AGTAGAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_12 1:N:0:
-AGTAGAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_13 1:N:0:
-AGTAGAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_14 1:N:0:
-AGTAGAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_15 1:N:0:
-AGTAGAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_16 1:N:0:
-AGTAGAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_17 1:N:0:
-AGTAGAAATTTAACGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_18 1:N:0:
-AGTAGAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_19 1:N:0:
-AGTAGAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_20 1:N:0:
-AGTAGAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_21 1:N:0:
-AGTAGAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_22 1:N:0:
-AGTAGAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_23 1:N:0:
-AGTAGAAATTTATCGGTCAGCGTGGCTCCCCTCTAGCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_24 1:N:0:
-AGTAGAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_25 1:N:0:
-AGTAGAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_26 1:N:0:
-AGTAGAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_27 1:N:0:
-AGTAGAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_28 1:N:0:
-AGTAGAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_29 1:N:0:
-AGTAGAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_30 1:N:0:
-AGTAGAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_31 1:N:0:
-AGTAGAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_32 1:N:0:
-AGTAGAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_33 1:N:0:
-AGTAGAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_34 1:N:0:
-AGTAGAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_35 1:N:0:
-AGTAGAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_36 1:N:0:
-AGTAGAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_37 1:N:0:
-AGTAGAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_0 1:N:0:
-AGTAATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_1 1:N:0:
-AGTAATAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_0 1:N:0:
-GGGATAAATTTATCGGTCAGGGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTACCAA
->lane1_fakedata5_1 1:N:0:
-GGGATAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTACCAA
->lane1_fakedata5_2 1:N:0:
-GGGATAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTACCAA
->lane1_fakedata5_3 1:N:0:
-GGGATAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTACCAA
->lane1_fakedata5_4 1:N:0:
-GGGATAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTACCAA
->lane1_fakedata5_5 1:N:0:
-GGGATAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTACCAA
->lane1_fakedata5_6 1:N:0:
-GGGATAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTACCAA
->lane1_fakedata5_7 1:N:0:
-GGGATAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTACCAA
->lane1_fakedata5_8 1:N:0:
-GGGATAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTACCAA
->lane1_fakedata5_9 1:N:0:
-GGGATAAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTACCAA
->lane1_fakedata5_10 1:N:0:
-GGGATAAATTTATCTGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_11 1:N:0:
-GGGATAAATTTATCTGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_12 1:N:0:
-GGGATAAATTTATCTGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_13 1:N:0:
-GGGATAAATTTATCTGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_14 1:N:0:
-GGGATAAATTTATCTGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_15 1:N:0:
-GGGATAAATTTATCTGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_16 1:N:0:
-GGGATAAATTTATCTGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_17 1:N:0:
-GGGATAAATTTATCTGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_18 1:N:0:
-GGGATAAATTTATCTGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_19 1:N:0:
-GGGATAAATTTATCTGTCAGCGTGGCTCCCCTCTATCTTTTTGTGTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_0 1:N:0:
-TGTTTTAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_1 1:N:0:
-TGTTTTAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_2 1:N:0:
-TGTTTTAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_3 1:N:0:
-TGTTTTAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_4 1:N:0:
-TGTTTTAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_5 1:N:0:
-TGTTTTAATTTATCGGTCAGCGTGGCTCCGCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_6 1:N:0:
-TGTTTTAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_7 1:N:0:
-TGTTTTAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_8 1:N:0:
-TGTTTTAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_9 1:N:0:
-TGTTTTAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_10 1:N:0:
-TGTTTTAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_11 1:N:0:
-TGTTTTAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_12 1:N:0:
-TGTTTTAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_13 1:N:0:
-TGTTTTAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCAAATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_0 1:N:0:
-ATGATGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_1 1:N:0:
-ATGATGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_2 1:N:0:
-ATGATGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_3 1:N:0:
-ATGATGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_4 1:N:0:
-ATGATGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_5 1:N:0:
-ATGATGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_6 1:N:0:
-ATGATGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_7 1:N:0:
-ATGATGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_8 1:N:0:
-ATGATGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata5_9 1:N:0:
-ATGATGAATTTATCGGTCAGCGTGGCTCCCCTCTATCTTTTTGTTTGGGATCATGACTGAAGTCACATTGAGTCCAAGGGCGCCAATTAGCCACTCACCA
->lane1_fakedata6_0 1:N:0:
-GGTGTGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_1 1:N:0:
-GGTGTGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_2 1:N:0:
-GGTGTGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_3 1:N:0:
-GGTGTGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_4 1:N:0:
-GGTGTGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_5 1:N:0:
-GGTGTGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_6 1:N:0:
-GGTGTGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_7 1:N:0:
-GGTGTGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_8 1:N:0:
-GGTGTGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGAATGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_9 1:N:0:
-GGTGTGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_10 1:N:0:
-GGTGTGAATTGACCATAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_11 1:N:0:
-GGTGTGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_12 1:N:0:
-GGTGTGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATAAGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_13 1:N:0:
-GGTGTGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATAAGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_14 1:N:0:
-GGTGTGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATAAGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_15 1:N:0:
-GGTGTGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATAAGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_16 1:N:0:
-GGTGTGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATAAGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_17 1:N:0:
-GGTGTGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATAAGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_18 1:N:0:
-GGTGTGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATAAGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_19 1:N:0:
-GGTGTGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATAAGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_20 1:N:0:
-GGTGTGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATAAGACTGAGAAACCGGTGCGGACATATAGGCCGGAG
->lane1_fakedata6_21 1:N:0:
-GGTGTGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAGGCTTATAAGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_22 1:N:0:
-GGTGTGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATAAGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_23 1:N:0:
-GGTGTGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATAAGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_0 1:N:0:
-TTTAAGAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_1 1:N:0:
-TTTAAGAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_2 1:N:0:
-TTTAAGAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_3 1:N:0:
-TTTAAGAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_4 1:N:0:
-TTTAAGAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGAGATATAGGCCGGAG
->lane1_fakedata6_5 1:N:0:
-TTTAAGAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_6 1:N:0:
-TTTAAGAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_7 1:N:0:
-TTTAAGAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_8 1:N:0:
-TTTAAGAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_9 1:N:0:
-TTTAAGAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_10 1:N:0:
-TTTAAGAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATGGGCCGGAG
->lane1_fakedata6_11 1:N:0:
-TTTAAGAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATGGGCCGGAG
->lane1_fakedata6_12 1:N:0:
-TTTAAGAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATGGGCCGGAG
->lane1_fakedata6_13 1:N:0:
-TTTAAGAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATGGGCCGGAG
->lane1_fakedata6_14 1:N:0:
-TTTAAGAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATGGGCCGGAG
->lane1_fakedata6_15 1:N:0:
-TTTAAGAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATGGGCCGGAG
->lane1_fakedata6_16 1:N:0:
-TTTAAGAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATGGGCCGGAG
->lane1_fakedata6_17 1:N:0:
-TTTAAGAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATGGGCCGGAG
->lane1_fakedata6_18 1:N:0:
-TTTAAGAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATGGGCCGGAG
->lane1_fakedata6_19 1:N:0:
-TTTAAGAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATGGGCCGGAG
->lane1_fakedata6_0 1:N:0:
-GGTTGTAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_1 1:N:0:
-GGTTGTAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_2 1:N:0:
-GGTTGTAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_3 1:N:0:
-GGTTGTAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_4 1:N:0:
-GGTTGTAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_5 1:N:0:
-GGTTGTAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_6 1:N:0:
-GGTTGTAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_7 1:N:0:
-GGTTGTAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_8 1:N:0:
-GGTTGTAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_9 1:N:0:
-GGTTGTAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_10 1:N:0:
-GGTTGTAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATAAGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_11 1:N:0:
-GGTTGTAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATAAGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_12 1:N:0:
-GGTTGTAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATAAGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_13 1:N:0:
-GGTTGTAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATAAGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_14 1:N:0:
-GGTTGTAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATAAGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_15 1:N:0:
-GGTTGTAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATAAGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_16 1:N:0:
-GGTTGTAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATAAGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_17 1:N:0:
-GGTTGTAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATAAGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_18 1:N:0:
-GGTTGTAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATAAGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_19 1:N:0:
-GGTTGTAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATAAGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_0 1:N:0:
-TGATGTAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_1 1:N:0:
-TGATGTAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_2 1:N:0:
-TGATGTAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_3 1:N:0:
-TGATGTAATTGACCGCAGCAACCTCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_4 1:N:0:
-TGATGTAATTGACCGCAGAAACCGCTCGTGGCGTTACTTCTCTTGGCCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_5 1:N:0:
-TGATGTAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_6 1:N:0:
-TGATGTAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_7 1:N:0:
-TGATGTAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_8 1:N:0:
-TGATGTAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_9 1:N:0:
-TGATGTAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_10 1:N:0:
-TGATGTAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_11 1:N:0:
-TGATGTAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_12 1:N:0:
-TGATGTAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_13 1:N:0:
-TGATGTAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_15 1:N:0:
-TGATGTAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_16 1:N:0:
-TGATGTAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_17 1:N:0:
-TGATGTAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_18 1:N:0:
-TGATGTAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_19 1:N:0:
-TGATGTAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_20 1:N:0:
-TGATGTAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_21 1:N:0:
-TGATGTAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_0 1:N:0:
-ATGGGGAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_1 1:N:0:
-ATGGGGAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_2 1:N:0:
-ATGGGGAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_3 1:N:0:
-ATGGGGAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_4 1:N:0:
-ATGGGGAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_5 1:N:0:
-ATGGGGAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_6 1:N:0:
-ATGGGGAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_7 1:N:0:
-ATGGGGAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_8 1:N:0:
-ATGGGGAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_9 1:N:0:
-ATGGGGAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_10 1:N:0:
-ATGGGGAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_11 1:N:0:
-ATGGGGAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_12 1:N:0:
-ATGGGGAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_13 1:N:0:
-ATGGGGAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTTGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_14 1:N:0:
-ATGGGGAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_15 1:N:0:
-ATGGGGAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_16 1:N:0:
-ATGGGGAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_17 1:N:0:
-ATGGGGAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_18 1:N:0:
-ATGGGGAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_19 1:N:0:
-ATGGGGAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_20 1:N:0:
-ATGGGGAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_21 1:N:0:
-ATGGGGAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_22 1:N:0:
-ATGGGGAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_23 1:N:0:
-ATGGGGAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_0 1:N:0:
-CATCATAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_1 1:N:0:
-CATCATAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_2 1:N:0:
-CATCATAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_3 1:N:0:
-CATCATAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_4 1:N:0:
-CATCATAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_5 1:N:0:
-CATCATAATTGACCACAGCAACCGCTCGTGGCGTTTCTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_6 1:N:0:
-CATCATAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_7 1:N:0:
-CATCATAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_8 1:N:0:
-CATCATAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_9 1:N:0:
-CATCATAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_10 1:N:0:
-CATCATAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_11 1:N:0:
-CATCATAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_12 1:N:0:
-CATCATAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_13 1:N:0:
-CATCATAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_14 1:N:0:
-CATCATAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_15 1:N:0:
-CATCATAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_16 1:N:0:
-CATCATAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTTGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_17 1:N:0:
-CATCATAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_18 1:N:0:
-CATCATAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTACGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_19 1:N:0:
-CATCATAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_20 1:N:0:
-CATCATAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_21 1:N:0:
-CATCATAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_22 1:N:0:
-CATCATAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_23 1:N:0:
-CATCATAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_24 1:N:0:
-CATCATAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_25 1:N:0:
-CATCATAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_26 1:N:0:
-CATCATAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_27 1:N:0:
-CATCATAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_28 1:N:0:
-CATCATAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_29 1:N:0:
-CATCATAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_0 1:N:0:
-AGGAAAAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_1 1:N:0:
-AGGAAAAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_2 1:N:0:
-AGGAAAAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_3 1:N:0:
-AGGAAAAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_4 1:N:0:
-AGGAAAAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_5 1:N:0:
-AGGAAAAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACAAATAGGCCGGAG
->lane1_fakedata6_6 1:N:0:
-AGGAAAAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_7 1:N:0:
-AGGAAAAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_8 1:N:0:
-AGGAAAAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_9 1:N:0:
-AGGAAAAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_10 1:N:0:
-AGGAAAAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_11 1:N:0:
-AGGAAAAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_12 1:N:0:
-AGGAAAAATTGACCACAGCAACCGCTCGTGGCGTTCCTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_13 1:N:0:
-AGGAAAAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_14 1:N:0:
-AGGAAAAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_15 1:N:0:
-AGGAAAAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_16 1:N:0:
-AGGAAAAATTGACAACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_17 1:N:0:
-AGGAAAAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_0 1:N:0:
-GGGTAAAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATAAAGGCCGGAG
->lane1_fakedata6_1 1:N:0:
-GGGTAAAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_2 1:N:0:
-GGGTAAAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_3 1:N:0:
-GGGTAAAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_4 1:N:0:
-GGGTAAAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_5 1:N:0:
-GGGTAAAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATGGGCCGGAG
->lane1_fakedata6_6 1:N:0:
-GGGTAAAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCAGACATATGGGCCGGAG
->lane1_fakedata6_7 1:N:0:
-GGGTAAAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATGGGCCGGAG
->lane1_fakedata6_8 1:N:0:
-GGGTAAAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATGGGCCGGAG
->lane1_fakedata6_9 1:N:0:
-GGGTAAAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATGGGCCGGAG
->lane1_fakedata6_0 1:N:0:
-AAGATAAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_1 1:N:0:
-AAGATAAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_2 1:N:0:
-AAGATAAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_3 1:N:0:
-AAGATAAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_4 1:N:0:
-AAGATAAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_5 1:N:0:
-AAGATAAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_6 1:N:0:
-AAGATAAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_7 1:N:0:
-AAGATAAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_8 1:N:0:
-AAGATAAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_9 1:N:0:
-AAGATAAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_10 1:N:0:
-AAGATAAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_11 1:N:0:
-AAGATAAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_12 1:N:0:
-AAGATAAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_13 1:N:0:
-AAGATAAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_14 1:N:0:
-AAGATAAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_15 1:N:0:
-AAGATAAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_0 1:N:0:
-ATAAGTAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_1 1:N:0:
-ATAAGTAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_2 1:N:0:
-ATAAGTAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_3 1:N:0:
-ATAAGTAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_4 1:N:0:
-ATAAGTAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_5 1:N:0:
-ATAAGTAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_6 1:N:0:
-ATAAGTAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_7 1:N:0:
-ATAAGTAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_8 1:N:0:
-ATAAGTAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_9 1:N:0:
-ATAAGTAATTGACCGCAGAAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_10 1:N:0:
-ATAAGTAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_11 1:N:0:
-ATAAGTAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_12 1:N:0:
-ATAAGTAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_13 1:N:0:
-ATAAGTAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_14 1:N:0:
-ATAAGTAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_15 1:N:0:
-ATAAGTAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_16 1:N:0:
-ATAAGTAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_17 1:N:0:
-ATAAGTAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_18 1:N:0:
-ATAAGTAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_19 1:N:0:
-ATAAGTAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_20 1:N:0:
-ATAAGTAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_21 1:N:0:
-ATAAGTAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_22 1:N:0:
-ATAAGTAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_23 1:N:0:
-ATAAGTAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_0 1:N:0:
-ATGTAGAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_1 1:N:0:
-ATGTAGAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_2 1:N:0:
-ATGTAGAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_3 1:N:0:
-ATGTAGAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_4 1:N:0:
-ATGTAGAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_5 1:N:0:
-ATGTAGAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_6 1:N:0:
-ATGTAGAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_7 1:N:0:
-ATGTAGAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_8 1:N:0:
-ATGTAGAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_9 1:N:0:
-ATGTAGAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_10 1:N:0:
-ATGTAGAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_11 1:N:0:
-ATGTAGAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGTAG
->lane1_fakedata6_12 1:N:0:
-ATGTAGAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_13 1:N:0:
-ATGTAGAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_14 1:N:0:
-ATGTAGAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_15 1:N:0:
-ATGTAGAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTTCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_16 1:N:0:
-ATGTAGAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_17 1:N:0:
-ATGTAGAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_0 1:N:0:
-GGAGAGAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_1 1:N:0:
-GGAGAGAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_2 1:N:0:
-GGAGAGAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_3 1:N:0:
-GGAGAGAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_4 1:N:0:
-GGAGAGAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_5 1:N:0:
-GGAGAGAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_6 1:N:0:
-GGAGAGAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_7 1:N:0:
-GGAGAGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_8 1:N:0:
-GGAGAGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAT
->lane1_fakedata6_9 1:N:0:
-GGAGAGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_10 1:N:0:
-GGAGAGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_11 1:N:0:
-GGAGAGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_12 1:N:0:
-GGAGAGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_13 1:N:0:
-GGAGAGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_0 1:N:0:
-GTTTTAAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_1 1:N:0:
-GTTTTAAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_2 1:N:0:
-GTTTTAAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_3 1:N:0:
-GTTTTAAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_4 1:N:0:
-GTTTTAAATTGACCCCAGCAACCGCTCGTGGCGTTAATTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_5 1:N:0:
-GTTTTAAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_6 1:N:0:
-GTTTTAAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_7 1:N:0:
-GTTTTAAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_0 1:N:0:
-TGATAAAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_1 1:N:0:
-TGATAAAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_2 1:N:0:
-TGATAAAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_3 1:N:0:
-TGATAAAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_4 1:N:0:
-TGATAAAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_5 1:N:0:
-TGATAAAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_6 1:N:0:
-TGATAAAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_7 1:N:0:
-TGATAAAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_8 1:N:0:
-TGATAAAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_9 1:N:0:
-TGATAAAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_10 1:N:0:
-TGATAAAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_11 1:N:0:
-TGATAAAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_0 1:N:0:
-AGATTAAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_1 1:N:0:
-AGATTAAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_2 1:N:0:
-AGATTAAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_3 1:N:0:
-AGATTAAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_4 1:N:0:
-AGATTAAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_5 1:N:0:
-AGATTAAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_6 1:N:0:
-AGATTAAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_7 1:N:0:
-AGATTAAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_8 1:N:0:
-AGATTAAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAGAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_9 1:N:0:
-AGATTAAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_10 1:N:0:
-AGATTAAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_11 1:N:0:
-AGATTAAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_12 1:N:0:
-AGATTAAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_13 1:N:0:
-AGATTAAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATGGGCCGGAG
->lane1_fakedata6_14 1:N:0:
-AGATTAAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATGGGCCGGAG
->lane1_fakedata6_15 1:N:0:
-AGATTAAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATGGGCCGGAG
->lane1_fakedata6_16 1:N:0:
-AGATTAAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATGGGCCGGAG
->lane1_fakedata6_17 1:N:0:
-AGATTAAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATGGGCCGGAG
->lane1_fakedata6_18 1:N:0:
-AGATTAAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATGGGCCGGAG
->lane1_fakedata6_19 1:N:0:
-AGATTAAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATGGGCCGGAG
->lane1_fakedata6_20 1:N:0:
-AGATTAAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATGGGCCGGAG
->lane1_fakedata6_21 1:N:0:
-AGATTAAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATGGGCCGGAG
->lane1_fakedata6_22 1:N:0:
-AGATTAAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATGGGCCGGAG
->lane1_fakedata6_23 1:N:0:
-AGATTAAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATGGGCCGGAG
->lane1_fakedata6_24 1:N:0:
-AGATTAAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATGGGCCGGAG
->lane1_fakedata6_25 1:N:0:
-AGATTAAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATGGGCCGGAG
->lane1_fakedata6_0 1:N:0:
-GTATAGAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_1 1:N:0:
-GTATAGAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_2 1:N:0:
-GTATAGAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_3 1:N:0:
-GTATAGAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_4 1:N:0:
-GTATAGAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_5 1:N:0:
-GTATAGAATTGACCGCAGCAACAGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_6 1:N:0:
-GTATAGAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_7 1:N:0:
-GTATAGAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_8 1:N:0:
-GTATAGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATAAGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_9 1:N:0:
-GTATAGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATAAGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_10 1:N:0:
-GTATAGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATAAGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_11 1:N:0:
-GTATAGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATAAGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_12 1:N:0:
-GTATAGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATAAGACTGAGAAACCGTTTCGGACATATAGGCCGGAG
->lane1_fakedata6_13 1:N:0:
-GTATAGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATAAGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_14 1:N:0:
-GTATAGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATAAGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_15 1:N:0:
-GTATAGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATAAGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_0 1:N:0:
-TTGGGAAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_1 1:N:0:
-TTGGGAAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_2 1:N:0:
-TTGGGAAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_3 1:N:0:
-TTGGGAAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_4 1:N:0:
-TTGGGAAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_5 1:N:0:
-TTGGGAAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_6 1:N:0:
-TTGGGAAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_7 1:N:0:
-TTGGGAAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_8 1:N:0:
-TTGGGAAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_9 1:N:0:
-TTGGGAAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_10 1:N:0:
-TTGGGAAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_11 1:N:0:
-TTGGGAAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_12 1:N:0:
-TTGGGAAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_13 1:N:0:
-TTGGGAAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_14 1:N:0:
-TTGGGAAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_15 1:N:0:
-TTGGGAAATTGAGCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_16 1:N:0:
-TTGGGAAATTTACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_17 1:N:0:
-TTGGGAAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_18 1:N:0:
-TTGGGAAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_19 1:N:0:
-TTGGGAAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_20 1:N:0:
-TTGGGAAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_21 1:N:0:
-TTGGGAAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_22 1:N:0:
-TTGGGAAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_23 1:N:0:
-TTGGGAAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_0 1:N:0:
-ATATATAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_1 1:N:0:
-ATATATAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_2 1:N:0:
-ATATATAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_3 1:N:0:
-ATATATAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_4 1:N:0:
-ATATATAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAAGCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_5 1:N:0:
-ATATATAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_6 1:N:0:
-ATATATAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_7 1:N:0:
-ATATATAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_8 1:N:0:
-ATATATAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_9 1:N:0:
-ATATATAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_10 1:N:0:
-ATATATAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_11 1:N:0:
-ATATATAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_12 1:N:0:
-ATATATAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_13 1:N:0:
-ATATATAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_14 1:N:0:
-ATATATAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_15 1:N:0:
-ATATATAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_16 1:N:0:
-ATATATAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_17 1:N:0:
-ATATATAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_18 1:N:0:
-ATATATAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_19 1:N:0:
-ATATATAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_20 1:N:0:
-ATATATAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_21 1:N:0:
-ATATATAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_22 1:N:0:
-ATATATAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_23 1:N:0:
-ATATATAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_24 1:N:0:
-ATATATAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_25 1:N:0:
-ATATATAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_26 1:N:0:
-ATATATAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_27 1:N:0:
-ATATATAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_28 1:N:0:
-ATATATAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_29 1:N:0:
-ATATATAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_30 1:N:0:
-ATATATAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_31 1:N:0:
-ATATATAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_32 1:N:0:
-ATATATAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_33 1:N:0:
-ATATATAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_34 1:N:0:
-ATATATAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_35 1:N:0:
-ATATATAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_36 1:N:0:
-ATATATAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_37 1:N:0:
-ATATATAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTTGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_0 1:N:0:
-GATGAGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATAAGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_1 1:N:0:
-GATGAGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATAAGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_2 1:N:0:
-GATGAGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATAAGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_3 1:N:0:
-GATGAGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATAAGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_4 1:N:0:
-GATGAGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATAAGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_5 1:N:0:
-GATGAGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATAAGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_6 1:N:0:
-GATGAGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATAAGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_7 1:N:0:
-GATGAGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATAAGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_8 1:N:0:
-GATGAGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_9 1:N:0:
-GATGAGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_10 1:N:0:
-GATGAGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_11 1:N:0:
-GATGAGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_12 1:N:0:
-GATGAGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_13 1:N:0:
-GATGAGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_14 1:N:0:
-GATGAGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_15 1:N:0:
-GATGAGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_0 1:N:0:
-AGGGTAAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATAAGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_1 1:N:0:
-AGGGTAAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATAAGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_2 1:N:0:
-AGGGTAAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATAAGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_3 1:N:0:
-AGGGTAAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATAAGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_4 1:N:0:
-AGGGTAAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATAAGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_5 1:N:0:
-AGGGTAAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATGGGCCGGAG
->lane1_fakedata6_6 1:N:0:
-AGGGTAAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATGGGCCGGAG
->lane1_fakedata6_7 1:N:0:
-AGGGTAAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATGGGCCGGAG
->lane1_fakedata6_8 1:N:0:
-AGGGTAAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATGGGCCGGAG
->lane1_fakedata6_9 1:N:0:
-AGGGTAAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATGGGCCGGAG
->lane1_fakedata6_0 1:N:0:
-GAGTTAAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_1 1:N:0:
-GAGTTAAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_2 1:N:0:
-GAGTTAAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_3 1:N:0:
-GAGTTAAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_4 1:N:0:
-GAGTTAAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_5 1:N:0:
-GAGTTAAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_6 1:N:0:
-GAGTTAAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_7 1:N:0:
-GAGTTAAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_8 1:N:0:
-GAGTTAAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_9 1:N:0:
-GAGTTAAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_10 1:N:0:
-GAGTTAAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_11 1:N:0:
-GAGTTAAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_12 1:N:0:
-GAGTTAAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_13 1:N:0:
-GAGTTAAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_14 1:N:0:
-GAGTTAAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_15 1:N:0:
-GAGTTAAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_16 1:N:0:
-GAGTTAAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_17 1:N:0:
-GAGTTAAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_18 1:N:0:
-GAGTTAAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_19 1:N:0:
-GAGTTAAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_20 1:N:0:
-GAGTTAAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_21 1:N:0:
-GAGTTAAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_22 1:N:0:
-GAGTTAAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_23 1:N:0:
-GAGTTAAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_0 1:N:0:
-ATAGTTAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_1 1:N:0:
-ATAGTTAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_2 1:N:0:
-ATAGTTAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_3 1:N:0:
-ATAGTTAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_4 1:N:0:
-ATAGTTAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_5 1:N:0:
-ATAGTTAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_6 1:N:0:
-ATAGTTAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_7 1:N:0:
-ATAGTTAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_8 1:N:0:
-ATAGTTAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_9 1:N:0:
-ATAGTTAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_10 1:N:0:
-ATAGTTAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_11 1:N:0:
-ATAGTTAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_12 1:N:0:
-ATAGTTAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_13 1:N:0:
-ATAGTTAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_14 1:N:0:
-ATAGTTAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_15 1:N:0:
-ATAGTTAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_16 1:N:0:
-ATAGTTAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_17 1:N:0:
-ATAGTTAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGCAG
->lane1_fakedata6_18 1:N:0:
-ATAGTTAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_19 1:N:0:
-ATAGTTAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_20 1:N:0:
-ATAGTTAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_21 1:N:0:
-ATAGTTAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_22 1:N:0:
-ATAGTTAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_23 1:N:0:
-ATAGTTAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_24 1:N:0:
-ATAGTTAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_25 1:N:0:
-ATAGTTAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_26 1:N:0:
-ATAGTTAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_27 1:N:0:
-ATAGTTAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_28 1:N:0:
-ATAGTTAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_29 1:N:0:
-ATAGTTAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_30 1:N:0:
-ATAGTTAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_31 1:N:0:
-ATAGTTAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_32 1:N:0:
-ATAGTTAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATAGGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_33 1:N:0:
-ATAGTTAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_34 1:N:0:
-ATAGTTAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_35 1:N:0:
-ATAGTTAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_36 1:N:0:
-ATAGTTAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_37 1:N:0:
-ATAGTTAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_38 1:N:0:
-ATAGTTAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_39 1:N:0:
-ATAGTTAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_0 1:N:0:
-TGTGAGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_1 1:N:0:
-TGTGAGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_2 1:N:0:
-TGTGAGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_3 1:N:0:
-TGTGAGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_4 1:N:0:
-TGTGAGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTAGGACATATAGGCCGGAG
->lane1_fakedata6_5 1:N:0:
-TGTGAGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTACGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_6 1:N:0:
-TGTGAGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_7 1:N:0:
-TGTGAGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_8 1:N:0:
-TGTGAGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_9 1:N:0:
-TGTGAGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_10 1:N:0:
-TGTGAGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_11 1:N:0:
-TGTGAGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_12 1:N:0:
-TGTGAGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_13 1:N:0:
-TGTGAGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_14 1:N:0:
-TGTGAGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_15 1:N:0:
-TGTGAGAATTGACCACAGCGACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGTCGGAG
->lane1_fakedata6_16 1:N:0:
-TGTGAGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_17 1:N:0:
-TGTGAGAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_18 1:N:0:
-TGTGAGAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_19 1:N:0:
-TGTGAGAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_20 1:N:0:
-TGTGAGAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_21 1:N:0:
-TGTGAGAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_22 1:N:0:
-TGTGAGAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCATATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_23 1:N:0:
-TGTGAGAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_24 1:N:0:
-TGTGAGAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_25 1:N:0:
-TGTGAGAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_26 1:N:0:
-TGTGAGAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_27 1:N:0:
-TGTGAGAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_28 1:N:0:
-TGTGAGAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_29 1:N:0:
-TGTGAGAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_30 1:N:0:
-TGTGAGAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_31 1:N:0:
-TGTGAGAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_32 1:N:0:
-TGTGAGAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_33 1:N:0:
-TGTGAGAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_0 1:N:0:
-TTTGTGAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_1 1:N:0:
-TTTGTGAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_2 1:N:0:
-TTTGTGAATTGTCCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_3 1:N:0:
-TTTGTGAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_4 1:N:0:
-TTTGTGAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_5 1:N:0:
-TTTGTGAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_6 1:N:0:
-TTTGTGAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_7 1:N:0:
-TTTGTGAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_8 1:N:0:
-TTTGTGAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_9 1:N:0:
-TTTGTGAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_10 1:N:0:
-TTTGTGAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_11 1:N:0:
-TTTGTGAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_12 1:N:0:
-TTTGTGAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_13 1:N:0:
-TTTGTGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_14 1:N:0:
-TTTGTGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_15 1:N:0:
-TTTGTGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_16 1:N:0:
-TTTGTGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_17 1:N:0:
-TTTGTGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTAGGACATATAGGCCGGAG
->lane1_fakedata6_18 1:N:0:
-TTTGTGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_19 1:N:0:
-TTTGTGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_20 1:N:0:
-TTTGTGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_21 1:N:0:
-TTTGTGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_22 1:N:0:
-TTTGTGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_23 1:N:0:
-TTTGTGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_24 1:N:0:
-TTTGTGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_25 1:N:0:
-TTTGTGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_0 1:N:0:
-GGAAGGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_1 1:N:0:
-GGAAGGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_2 1:N:0:
-GGAAGGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_3 1:N:0:
-GGAAGGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_4 1:N:0:
-GGAAGGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_5 1:N:0:
-GGAAGGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_6 1:N:0:
-GGAAGGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_7 1:N:0:
-GGAAGGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_8 1:N:0:
-GGAAGGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_9 1:N:0:
-GGAAGGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_10 1:N:0:
-GGAAGGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_11 1:N:0:
-GGAAGGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_12 1:N:0:
-GGAAGGAATTGACCACAGCAACCGCTCATGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_13 1:N:0:
-GGAAGGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_14 1:N:0:
-GGAAGGAATTGACCACAGCAACCGCGCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_15 1:N:0:
-GGAAGGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_16 1:N:0:
-GGAAGGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_17 1:N:0:
-GGAAGGAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_18 1:N:0:
-GGAAGGAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTCCGGACATATAGGCCGGAG
->lane1_fakedata6_19 1:N:0:
-GGAAGGAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_20 1:N:0:
-GGAAGGAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_21 1:N:0:
-GGAAGGAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_22 1:N:0:
-GGAAGGAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_23 1:N:0:
-GGAAGGAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_24 1:N:0:
-GGAAGGAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_25 1:N:0:
-GGAAGGAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_26 1:N:0:
-GGAAGGAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_27 1:N:0:
-GGAAGGAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_28 1:N:0:
-GGAAGGAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_29 1:N:0:
-GGAAGGAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_30 1:N:0:
-GGAAGGAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_31 1:N:0:
-GGAAGGAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_32 1:N:0:
-GGAAGGAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_33 1:N:0:
-GGAAGGAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_34 1:N:0:
-GGAAGGAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_35 1:N:0:
-GGAAGGAATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_0 1:N:0:
-AATAAGAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_1 1:N:0:
-AATAAGAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTAATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_2 1:N:0:
-AATAAGAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_3 1:N:0:
-AATAAGAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_4 1:N:0:
-AATAAGAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_5 1:N:0:
-AATAAGAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_6 1:N:0:
-AATAAGAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_7 1:N:0:
-AATAAGAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_8 1:N:0:
-AATAAGAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_9 1:N:0:
-AATAAGAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_0 1:N:0:
-TTAAATAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_1 1:N:0:
-TTAAATAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_2 1:N:0:
-TTAAATAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_3 1:N:0:
-TTAAATAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_4 1:N:0:
-TTAAATAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_5 1:N:0:
-TTAAATAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_6 1:N:0:
-TTAAATAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_7 1:N:0:
-TTAAATAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_8 1:N:0:
-TTAAATAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_9 1:N:0:
-TTAAATAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_10 1:N:0:
-TTAAATAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_11 1:N:0:
-TTAAATAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_12 1:N:0:
-TTAAATAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_13 1:N:0:
-TTAAATAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_14 1:N:0:
-TTAAATAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_15 1:N:0:
-TTAAATAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_16 1:N:0:
-TTAAATAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_17 1:N:0:
-TTAAATAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_18 1:N:0:
-TTAAATAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_19 1:N:0:
-TTAAATAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_20 1:N:0:
-TTAAATAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_21 1:N:0:
-TTAAATAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_22 1:N:0:
-TTAAATAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_23 1:N:0:
-TTAAATAATTGACCACAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_0 1:N:0:
-TAGTGTAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAGGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_1 1:N:0:
-TAGTGTAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_2 1:N:0:
-TAGTGTAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_3 1:N:0:
-TAGTGTAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_4 1:N:0:
-TAGTGTAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_5 1:N:0:
-TAGTGTAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_6 1:N:0:
-TAGTGTAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_7 1:N:0:
-TAGTGTAATTGACCCCAGCAACCGGTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_8 1:N:0:
-TAGTGTAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_9 1:N:0:
-TAGTGTAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_10 1:N:0:
-TAGTGTAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_11 1:N:0:
-TAGTGTAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_12 1:N:0:
-TAGTGTAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_13 1:N:0:
-TAGTGTAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_14 1:N:0:
-TAGTGTAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_15 1:N:0:
-TAGTGTAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGTAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_16 1:N:0:
-TAGTGTAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATCTAGGCCGGAG
->lane1_fakedata6_17 1:N:0:
-TAGTGTAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGCACATATAGGCCGGAG
->lane1_fakedata6_18 1:N:0:
-TAGTGTAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_19 1:N:0:
-TAGTGTAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_20 1:N:0:
-TAGTGTAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_21 1:N:0:
-TAGTGTAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_22 1:N:0:
-TAGTGTAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_23 1:N:0:
-TAGTGTAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_24 1:N:0:
-TAGTGTAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
->lane1_fakedata6_25 1:N:0:
-TAGTGTAATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAACCGGTTCGGACATATAGGCCGGAG
-&