comparison test-data/filtered/Trinity_filtered_exp.fasta @ 1:570f2b1f3cd9 draft

planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit 7efdf3224552d113a01043ee5bf4517d770df933
author iuc
date Fri, 31 Mar 2017 11:37:12 -0400
parents 1e8a2c87461a
children
comparison
equal deleted inserted replaced
0:1e8a2c87461a 1:570f2b1f3cd9
1 >TRINITY_DN1_c0_g1_i1 len=380 path=[358:0-379] [-1, 358, -2] top_iso:1 pct_iso_expr=100 pct_dom_iso_expr=100 1 >TRINITY_DN1_c0_g1_i1 len=380 path=[358:0-379] [-1, 358, -2] top_iso:0 pct_iso_expr=NA pct_dom_iso_expr=NA
2 CCAAGGTAGAAAACATCCCTGCTGACAAGACCTACCTGTGACATACTCACTCTCTTAGGG 2 CCAAGGTAGAAAACATCCCTGCTGACAAGACCTACCTGTGACATACTCACTCTCTTAGGG
3 CTTTTAAAGACAAGCCATTAAAATAGATGACCTTTCACAGACTGAAACTTGAATCACTGC 3 CTTTTAAAGACAAGCCATTAAAATAGATGACCTTTCACAGACTGAAACTTGAATCACTGC
4 AAAATGAATCTAGGTTGCTGTCACTTTTTCTTTTGGGTGGCGGGGCTTGATGTAGATTTT 4 AAAATGAATCTAGGTTGCTGTCACTTTTTCTTTTGGGTGGCGGGGCTTGATGTAGATTTT
5 ATTCTATGTACAGAATTTAATGTTGAATATATTAAAAATAACAAACCTGGCATGGTTTTG 5 ATTCTATGTACAGAATTTAATGTTGAATATATTAAAAATAACAAACCTGGCATGGTTTTG
6 GGAGGTTAGATTTACTGGAAATGTATTCATACTGTGAACTGTGCTCTGATGGTTAGAATG 6 GGAGGTTAGATTTACTGGAAATGTATTCATACTGTGAACTGTGCTCTGATGGTTAGAATG
7 AAAAGCTTATCAAGCATTCCATATAACAGTGGATGTAGAAAATGTTTTCAGGTGGATATG 7 AAAAGCTTATCAAGCATTCCATATAACAGTGGATGTAGAAAATGTTTTCAGGTGGATATG
8 TATATGGTACAGATGTAAAG 8 TATATGGTACAGATGTAAAG
9 >TRINITY_DN0_c0_g1_i1 len=229 path=[207:0-228] [-1, 207, -2] top_iso:1 pct_iso_expr=100 pct_dom_iso_expr=100 9 >TRINITY_DN0_c0_g1_i1 len=229 path=[207:0-228] [-1, 207, -2] top_iso:0 pct_iso_expr=NA pct_dom_iso_expr=NA
10 AAATATCACAACCACCTGAACAGGAACTTGGGATAAACAGGCAATGATGAGAGCCGATGT 10 AAATATCACAACCACCTGAACAGGAACTTGGGATAAACAGGCAATGATGAGAGCCGATGT
11 TTTTCTGTTGGTGTTTACATTGCTCTGCTCTGTGAAAGGATCCTGCAGCAGAGGCTTCCT 11 TTTTCTGTTGGTGTTTACATTGCTCTGCTCTGTGAAAGGATCCTGCAGCAGAGGCTTCCT
12 ACCTGAAAAATGTTTCTCTCAATTGTAGTGTGTGAGTTACTGGTAAGACGCTTACACCTA 12 ACCTGAAAAATGTTTCTCTCAATTGTAGTGTGTGAGTTACTGGTAAGACGCTTACACCTA
13 TAACTCAAGGTCGGAATAGTCCCTCCAGTCCCTTTAGTAACCCAGTGGC 13 TAACTCAAGGTCGGAATAGTCCCTCCAGTCCCTTTAGTAACCCAGTGGC
14 >TRINITY_DN2_c1_g1_i1 len=541 path=[519:0-540] [-1, 519, -2] top_iso:1 pct_iso_expr=100 pct_dom_iso_expr=100 14 >TRINITY_DN2_c1_g1_i1 len=541 path=[519:0-540] [-1, 519, -2] top_iso:0 pct_iso_expr=NA pct_dom_iso_expr=NA
15 GTCTGAATTCGCATGTAATGCAGCTTTCCCAGACACAAGTATGGAAGCAATCCGACTTAT 15 GTCTGAATTCGCATGTAATGCAGCTTTCCCAGACACAAGTATGGAAGCAATCCGACTTAT
16 TCGCCATTGTGCAAAATATGTGTCTGATAGACCGCAGGCTTTCAAGGAGTACACAAGTGA 16 TCGCCATTGTGCAAAATATGTGTCTGATAGACCGCAGGCTTTCAAGGAGTACACAAGTGA
17 TGACATGAGCGTGGCACCTGAAGACAGGGTGTGGGTGAGAGGGTGGTTCCCGATCCTCTT 17 TGACATGAGCGTGGCACCTGAAGACAGGGTGTGGGTGAGAGGGTGGTTCCCGATCCTCTT
18 TGAGTTGTCTTGTATCATCAATAGATGCAAATTAGATGTAAGAACCAGGGGCTTAACAGT 18 TGAGTTGTCTTGTATCATCAATAGATGCAAATTAGATGTAAGAACCAGGGGCTTAACAGT
19 AATGTTTGAAATAATGAAAACATATGGCCACACTTATGAAAAACATTGGTGGCAGGACTT 19 AATGTTTGAAATAATGAAAACATATGGCCACACTTATGAAAAACATTGGTGGCAGGACTT
20 ATTCAGAATTGTTTTCAGAATCTTTGACAACATGAAATTGCCAGAACAGCAGACAGAGAA 20 ATTCAGAATTGTTTTCAGAATCTTTGACAACATGAAATTGCCAGAACAGCAGACAGAGAA
21 AGCTGAATGGATGACAACAACTTGTAACCATGTCCTTTATGCAATATGTGATGTATTCAC 21 AGCTGAATGGATGACAACAACTTGTAACCATGTCCTTTATGCAATATGTGATGTATTCAC
22 CCAGTATTTAGAAGTTCTCAGCGATGTACTTTTGGATGATATTTTTGCCCAGCTTTACTG 22 CCAGTATTTAGAAGTTCTCAGCGATGTACTTTTGGATGATATTTTTGCCCAGCTTTACTG
23 GTGTGTACAACAAGACAATGAGCAGTTAGCACGATCTGGTACAAACTGCTTAGAAAACGT 23 GTGTGTACAACAAGACAATGAGCAGTTAGCACGATCTGGTACAAACTGCTTAGAAAACGT
24 G 24 G
25 >TRINITY_DN2_c3_g1_i1 len=202 path=[180:0-201] [-1, 180, -2] top_iso:1 pct_iso_expr=100 pct_dom_iso_expr=100 25 >TRINITY_DN2_c3_g1_i1 len=202 path=[180:0-201] [-1, 180, -2] top_iso:0 pct_iso_expr=NA pct_dom_iso_expr=NA
26 GGTGAAAAGTTTACTCTTGAAATCTGGGATAAAACGTGTAACTGCACCCTGGATATCTTC 26 GGTGAAAAGTTTACTCTTGAAATCTGGGATAAAACGTGTAACTGCACCCTGGATATCTTC
27 AAAACCACAATTCCTCACGCGCTTCTGACTTGGCGTCCCACCTCTGGCGAGGCCGAACCC 27 AAAACCACAATTCCTCACGCGCTTCTGACTTGGCGTCCCACCTCTGGCGAGGCCGAACCC
28 CCATCTCCATCAGCTGTGAGTGAAAAGCCGTTGGATGCAATATCACAAAAATCTGTAGAC 28 CCATCTCCATCAGCTGTGAGTGAAAAGCCGTTGGATGCAATATCACAAAAATCTGTAGAC
29 ATACATGATTCTATTCAACCAA 29 ATACATGATTCTATTCAACCAA
30 >TRINITY_DN3_c0_g1_i1 len=216 path=[194:0-215] [-1, 194, -2] top_iso:1 pct_iso_expr=100 pct_dom_iso_expr=100 30 >TRINITY_DN3_c0_g1_i1 len=216 path=[194:0-215] [-1, 194, -2] top_iso:0 pct_iso_expr=NA pct_dom_iso_expr=NA
31 ATTGATTTATTTAATAAGAAACCAAAGAGAGGAATACAATACCTCCAAGAACAAGGGATG 31 ATTGATTTATTTAATAAGAAACCAAAGAGAGGAATACAATACCTCCAAGAACAAGGGATG
32 CTTGGCACCACACCCGAAGATATAGCTCAGTTCTTACATCAAGAAGAAAGATTAGACTCT 32 CTTGGCACCACACCCGAAGATATAGCTCAGTTCTTACATCAAGAAGAAAGATTAGACTCT
33 ACTCAGGTGGGTGAGTTCCTGGGAGATAATGATAAATTCAATAAAGAAGTCATGTATGCA 33 ACTCAGGTGGGTGAGTTCCTGGGAGATAATGATAAATTCAATAAAGAAGTCATGTATGCA
34 TATGTAGACCAACATGACTTTTCAGGAAAAGACTTT 34 TATGTAGACCAACATGACTTTTCAGGAAAAGACTTT