annotate test-data/filtered/Trinity_filtered_exp.fasta @ 1:570f2b1f3cd9 draft

planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit 7efdf3224552d113a01043ee5bf4517d770df933
author iuc
date Fri, 31 Mar 2017 11:37:12 -0400
parents 1e8a2c87461a
children
Ignore whitespace changes - Everywhere: Within whitespace: At end of lines:
rev   line source
1
570f2b1f3cd9 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit 7efdf3224552d113a01043ee5bf4517d770df933
iuc
parents: 0
diff changeset
1 >TRINITY_DN1_c0_g1_i1 len=380 path=[358:0-379] [-1, 358, -2] top_iso:0 pct_iso_expr=NA pct_dom_iso_expr=NA
0
1e8a2c87461a planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit ed037d83415937b11a45a4611584e71e99ad1da0
iuc
parents:
diff changeset
2 CCAAGGTAGAAAACATCCCTGCTGACAAGACCTACCTGTGACATACTCACTCTCTTAGGG
1e8a2c87461a planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit ed037d83415937b11a45a4611584e71e99ad1da0
iuc
parents:
diff changeset
3 CTTTTAAAGACAAGCCATTAAAATAGATGACCTTTCACAGACTGAAACTTGAATCACTGC
1e8a2c87461a planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit ed037d83415937b11a45a4611584e71e99ad1da0
iuc
parents:
diff changeset
4 AAAATGAATCTAGGTTGCTGTCACTTTTTCTTTTGGGTGGCGGGGCTTGATGTAGATTTT
1e8a2c87461a planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit ed037d83415937b11a45a4611584e71e99ad1da0
iuc
parents:
diff changeset
5 ATTCTATGTACAGAATTTAATGTTGAATATATTAAAAATAACAAACCTGGCATGGTTTTG
1e8a2c87461a planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit ed037d83415937b11a45a4611584e71e99ad1da0
iuc
parents:
diff changeset
6 GGAGGTTAGATTTACTGGAAATGTATTCATACTGTGAACTGTGCTCTGATGGTTAGAATG
1e8a2c87461a planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit ed037d83415937b11a45a4611584e71e99ad1da0
iuc
parents:
diff changeset
7 AAAAGCTTATCAAGCATTCCATATAACAGTGGATGTAGAAAATGTTTTCAGGTGGATATG
1e8a2c87461a planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit ed037d83415937b11a45a4611584e71e99ad1da0
iuc
parents:
diff changeset
8 TATATGGTACAGATGTAAAG
1
570f2b1f3cd9 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit 7efdf3224552d113a01043ee5bf4517d770df933
iuc
parents: 0
diff changeset
9 >TRINITY_DN0_c0_g1_i1 len=229 path=[207:0-228] [-1, 207, -2] top_iso:0 pct_iso_expr=NA pct_dom_iso_expr=NA
0
1e8a2c87461a planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit ed037d83415937b11a45a4611584e71e99ad1da0
iuc
parents:
diff changeset
10 AAATATCACAACCACCTGAACAGGAACTTGGGATAAACAGGCAATGATGAGAGCCGATGT
1e8a2c87461a planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit ed037d83415937b11a45a4611584e71e99ad1da0
iuc
parents:
diff changeset
11 TTTTCTGTTGGTGTTTACATTGCTCTGCTCTGTGAAAGGATCCTGCAGCAGAGGCTTCCT
1e8a2c87461a planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit ed037d83415937b11a45a4611584e71e99ad1da0
iuc
parents:
diff changeset
12 ACCTGAAAAATGTTTCTCTCAATTGTAGTGTGTGAGTTACTGGTAAGACGCTTACACCTA
1e8a2c87461a planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit ed037d83415937b11a45a4611584e71e99ad1da0
iuc
parents:
diff changeset
13 TAACTCAAGGTCGGAATAGTCCCTCCAGTCCCTTTAGTAACCCAGTGGC
1
570f2b1f3cd9 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit 7efdf3224552d113a01043ee5bf4517d770df933
iuc
parents: 0
diff changeset
14 >TRINITY_DN2_c1_g1_i1 len=541 path=[519:0-540] [-1, 519, -2] top_iso:0 pct_iso_expr=NA pct_dom_iso_expr=NA
0
1e8a2c87461a planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit ed037d83415937b11a45a4611584e71e99ad1da0
iuc
parents:
diff changeset
15 GTCTGAATTCGCATGTAATGCAGCTTTCCCAGACACAAGTATGGAAGCAATCCGACTTAT
1e8a2c87461a planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit ed037d83415937b11a45a4611584e71e99ad1da0
iuc
parents:
diff changeset
16 TCGCCATTGTGCAAAATATGTGTCTGATAGACCGCAGGCTTTCAAGGAGTACACAAGTGA
1e8a2c87461a planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit ed037d83415937b11a45a4611584e71e99ad1da0
iuc
parents:
diff changeset
17 TGACATGAGCGTGGCACCTGAAGACAGGGTGTGGGTGAGAGGGTGGTTCCCGATCCTCTT
1e8a2c87461a planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit ed037d83415937b11a45a4611584e71e99ad1da0
iuc
parents:
diff changeset
18 TGAGTTGTCTTGTATCATCAATAGATGCAAATTAGATGTAAGAACCAGGGGCTTAACAGT
1e8a2c87461a planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit ed037d83415937b11a45a4611584e71e99ad1da0
iuc
parents:
diff changeset
19 AATGTTTGAAATAATGAAAACATATGGCCACACTTATGAAAAACATTGGTGGCAGGACTT
1e8a2c87461a planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit ed037d83415937b11a45a4611584e71e99ad1da0
iuc
parents:
diff changeset
20 ATTCAGAATTGTTTTCAGAATCTTTGACAACATGAAATTGCCAGAACAGCAGACAGAGAA
1e8a2c87461a planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit ed037d83415937b11a45a4611584e71e99ad1da0
iuc
parents:
diff changeset
21 AGCTGAATGGATGACAACAACTTGTAACCATGTCCTTTATGCAATATGTGATGTATTCAC
1e8a2c87461a planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit ed037d83415937b11a45a4611584e71e99ad1da0
iuc
parents:
diff changeset
22 CCAGTATTTAGAAGTTCTCAGCGATGTACTTTTGGATGATATTTTTGCCCAGCTTTACTG
1e8a2c87461a planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit ed037d83415937b11a45a4611584e71e99ad1da0
iuc
parents:
diff changeset
23 GTGTGTACAACAAGACAATGAGCAGTTAGCACGATCTGGTACAAACTGCTTAGAAAACGT
1e8a2c87461a planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit ed037d83415937b11a45a4611584e71e99ad1da0
iuc
parents:
diff changeset
24 G
1
570f2b1f3cd9 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit 7efdf3224552d113a01043ee5bf4517d770df933
iuc
parents: 0
diff changeset
25 >TRINITY_DN2_c3_g1_i1 len=202 path=[180:0-201] [-1, 180, -2] top_iso:0 pct_iso_expr=NA pct_dom_iso_expr=NA
0
1e8a2c87461a planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit ed037d83415937b11a45a4611584e71e99ad1da0
iuc
parents:
diff changeset
26 GGTGAAAAGTTTACTCTTGAAATCTGGGATAAAACGTGTAACTGCACCCTGGATATCTTC
1e8a2c87461a planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit ed037d83415937b11a45a4611584e71e99ad1da0
iuc
parents:
diff changeset
27 AAAACCACAATTCCTCACGCGCTTCTGACTTGGCGTCCCACCTCTGGCGAGGCCGAACCC
1e8a2c87461a planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit ed037d83415937b11a45a4611584e71e99ad1da0
iuc
parents:
diff changeset
28 CCATCTCCATCAGCTGTGAGTGAAAAGCCGTTGGATGCAATATCACAAAAATCTGTAGAC
1e8a2c87461a planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit ed037d83415937b11a45a4611584e71e99ad1da0
iuc
parents:
diff changeset
29 ATACATGATTCTATTCAACCAA
1
570f2b1f3cd9 planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit 7efdf3224552d113a01043ee5bf4517d770df933
iuc
parents: 0
diff changeset
30 >TRINITY_DN3_c0_g1_i1 len=216 path=[194:0-215] [-1, 194, -2] top_iso:0 pct_iso_expr=NA pct_dom_iso_expr=NA
0
1e8a2c87461a planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit ed037d83415937b11a45a4611584e71e99ad1da0
iuc
parents:
diff changeset
31 ATTGATTTATTTAATAAGAAACCAAAGAGAGGAATACAATACCTCCAAGAACAAGGGATG
1e8a2c87461a planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit ed037d83415937b11a45a4611584e71e99ad1da0
iuc
parents:
diff changeset
32 CTTGGCACCACACCCGAAGATATAGCTCAGTTCTTACATCAAGAAGAAAGATTAGACTCT
1e8a2c87461a planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit ed037d83415937b11a45a4611584e71e99ad1da0
iuc
parents:
diff changeset
33 ACTCAGGTGGGTGAGTTCCTGGGAGATAATGATAAATTCAATAAAGAAGTCATGTATGCA
1e8a2c87461a planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit ed037d83415937b11a45a4611584e71e99ad1da0
iuc
parents:
diff changeset
34 TATGTAGACCAACATGACTTTTCAGGAAAAGACTTT