diff test-data/filtered/Trinity_filtered_exp.fasta @ 1:570f2b1f3cd9 draft

planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/trinity commit 7efdf3224552d113a01043ee5bf4517d770df933
author iuc
date Fri, 31 Mar 2017 11:37:12 -0400
parents 1e8a2c87461a
children
line wrap: on
line diff
--- a/test-data/filtered/Trinity_filtered_exp.fasta	Thu Mar 23 10:18:11 2017 -0400
+++ b/test-data/filtered/Trinity_filtered_exp.fasta	Fri Mar 31 11:37:12 2017 -0400
@@ -1,4 +1,4 @@
->TRINITY_DN1_c0_g1_i1 len=380 path=[358:0-379] [-1, 358, -2] top_iso:1 pct_iso_expr=100 pct_dom_iso_expr=100
+>TRINITY_DN1_c0_g1_i1 len=380 path=[358:0-379] [-1, 358, -2] top_iso:0 pct_iso_expr=NA pct_dom_iso_expr=NA
 CCAAGGTAGAAAACATCCCTGCTGACAAGACCTACCTGTGACATACTCACTCTCTTAGGG
 CTTTTAAAGACAAGCCATTAAAATAGATGACCTTTCACAGACTGAAACTTGAATCACTGC
 AAAATGAATCTAGGTTGCTGTCACTTTTTCTTTTGGGTGGCGGGGCTTGATGTAGATTTT
@@ -6,12 +6,12 @@
 GGAGGTTAGATTTACTGGAAATGTATTCATACTGTGAACTGTGCTCTGATGGTTAGAATG
 AAAAGCTTATCAAGCATTCCATATAACAGTGGATGTAGAAAATGTTTTCAGGTGGATATG
 TATATGGTACAGATGTAAAG
->TRINITY_DN0_c0_g1_i1 len=229 path=[207:0-228] [-1, 207, -2] top_iso:1 pct_iso_expr=100 pct_dom_iso_expr=100
+>TRINITY_DN0_c0_g1_i1 len=229 path=[207:0-228] [-1, 207, -2] top_iso:0 pct_iso_expr=NA pct_dom_iso_expr=NA
 AAATATCACAACCACCTGAACAGGAACTTGGGATAAACAGGCAATGATGAGAGCCGATGT
 TTTTCTGTTGGTGTTTACATTGCTCTGCTCTGTGAAAGGATCCTGCAGCAGAGGCTTCCT
 ACCTGAAAAATGTTTCTCTCAATTGTAGTGTGTGAGTTACTGGTAAGACGCTTACACCTA
 TAACTCAAGGTCGGAATAGTCCCTCCAGTCCCTTTAGTAACCCAGTGGC
->TRINITY_DN2_c1_g1_i1 len=541 path=[519:0-540] [-1, 519, -2] top_iso:1 pct_iso_expr=100 pct_dom_iso_expr=100
+>TRINITY_DN2_c1_g1_i1 len=541 path=[519:0-540] [-1, 519, -2] top_iso:0 pct_iso_expr=NA pct_dom_iso_expr=NA
 GTCTGAATTCGCATGTAATGCAGCTTTCCCAGACACAAGTATGGAAGCAATCCGACTTAT
 TCGCCATTGTGCAAAATATGTGTCTGATAGACCGCAGGCTTTCAAGGAGTACACAAGTGA
 TGACATGAGCGTGGCACCTGAAGACAGGGTGTGGGTGAGAGGGTGGTTCCCGATCCTCTT
@@ -22,12 +22,12 @@
 CCAGTATTTAGAAGTTCTCAGCGATGTACTTTTGGATGATATTTTTGCCCAGCTTTACTG
 GTGTGTACAACAAGACAATGAGCAGTTAGCACGATCTGGTACAAACTGCTTAGAAAACGT
 G
->TRINITY_DN2_c3_g1_i1 len=202 path=[180:0-201] [-1, 180, -2] top_iso:1 pct_iso_expr=100 pct_dom_iso_expr=100
+>TRINITY_DN2_c3_g1_i1 len=202 path=[180:0-201] [-1, 180, -2] top_iso:0 pct_iso_expr=NA pct_dom_iso_expr=NA
 GGTGAAAAGTTTACTCTTGAAATCTGGGATAAAACGTGTAACTGCACCCTGGATATCTTC
 AAAACCACAATTCCTCACGCGCTTCTGACTTGGCGTCCCACCTCTGGCGAGGCCGAACCC
 CCATCTCCATCAGCTGTGAGTGAAAAGCCGTTGGATGCAATATCACAAAAATCTGTAGAC
 ATACATGATTCTATTCAACCAA
->TRINITY_DN3_c0_g1_i1 len=216 path=[194:0-215] [-1, 194, -2] top_iso:1 pct_iso_expr=100 pct_dom_iso_expr=100
+>TRINITY_DN3_c0_g1_i1 len=216 path=[194:0-215] [-1, 194, -2] top_iso:0 pct_iso_expr=NA pct_dom_iso_expr=NA
 ATTGATTTATTTAATAAGAAACCAAAGAGAGGAATACAATACCTCCAAGAACAAGGGATG
 CTTGGCACCACACCCGAAGATATAGCTCAGTTCTTACATCAAGAAGAAAGATTAGACTCT
 ACTCAGGTGGGTGAGTTCCTGGGAGATAATGATAAATTCAATAAAGAAGTCATGTATGCA