Mercurial > repos > jankanis > blast2html
annotate test-data/blast xml example4b.html @ 118:7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
| author | Jan Kanis <jan.code@jankanis.nl> | 
|---|---|
| date | Thu, 31 Jul 2014 13:09:30 +0200 | 
| parents | 0c2a03f9740b | 
| children | 
| rev | line source | 
|---|---|
| 106 | 1 <!DOCTYPE html> | 
| 2 <html> | |
| 3 <head> | |
| 4 <meta charset="UTF-8"> | |
| 5 <meta name=generator content="blast2html; see https://github.com/thehyve/blast2html/"> | |
| 6 | |
| 7 <title>Blast output</title> | |
| 8 | |
| 9 <style> | |
| 10 body { | |
| 11 color: #333333; | |
| 12 font-family: Arial,Sans-Serif; | |
| 13 } | |
| 14 | |
| 15 :link { | |
| 16 color: #336699; | |
| 17 } | |
| 18 | |
| 19 .right { | |
| 20 float: right; | |
| 21 } | |
| 22 | |
| 23 /* Galaxy with html sanitization enabled strips the header of this html page. If so, show the user a warning.*/ | |
| 24 #strip_html_warning { | |
| 25 display: none; | |
| 26 } | |
| 27 | |
| 28 #content { | |
| 29 margin: 0 2em; | |
| 30 padding: 0.5em; | |
| 31 border: 1px solid #888888; | |
| 32 background-color: #d3dff5; | |
| 33 } | |
| 34 | |
| 35 h1, h2, h3, h4, h5, h6 { | |
| 36 color: #2A6979; | |
| 37 font-family: arial,verdana,sans-serif; | |
| 38 letter-spacing: -1px; | |
| 39 margin: 1.2em 0 0.3em; | |
| 40 } | |
| 41 | |
| 42 h1 { | |
| 114 | 43 font-size: 200%; | 
| 44 } | |
| 45 | |
| 46 h2 { | |
| 47 font-size: 150%; | |
| 48 } | |
| 49 | |
| 50 h1, h2 { | |
| 106 | 51 border-bottom: 1px solid #CCCCCC; | 
| 52 padding-bottom: 0.1em; | |
| 53 } | |
| 54 | |
| 114 | 55 h3 { | 
| 106 | 56 font-size: 120%; | 
| 57 font-weight: bold; | |
| 58 } | |
| 59 | |
| 114 | 60 h5.darkHeader { | 
| 106 | 61 color: #4D4D4D; | 
| 62 letter-spacing: 0; | |
| 63 font-weight: bold; | |
| 114 | 64 font-size: 108%; | 
| 106 | 65 } | 
| 66 | |
| 67 #nodata { | |
| 68 font-weight: bold; | |
| 69 } | |
| 70 | |
| 71 .index { | |
| 72 margin-bottom: 3em; | |
| 73 } | |
| 74 .index div.indexentry { | |
| 75 margin: 1.2em 1.6em; | |
| 76 font-weight: bold; | |
| 77 font-size: 100%; | |
| 78 } | |
| 79 | |
| 80 .headerdata { | |
| 81 font-size: 90%; | |
| 82 } | |
| 83 .headerdata .param { | |
| 84 font-weight: bold; | |
| 85 text-align: right; | |
| 86 padding: 0 1em; | |
| 87 } | |
| 88 | |
| 89 .grey { | |
| 90 background-color: #eeeeee; | |
| 91 border: 1px solid #cccccc; | |
| 92 padding: 1em; | |
| 93 } | |
| 94 | |
| 95 .white { | |
| 96 background-color: white; | |
| 97 border: 1px solid #cccccc; | |
| 98 padding: 1.5em 2%; | |
| 99 } | |
| 100 | |
| 101 .graphicrow { | |
| 102 clear: left; | |
| 103 width: 100%; | |
| 104 } | |
| 105 | |
| 106 .graphicitem { | |
| 107 float: left; | |
| 108 } | |
| 109 | |
| 110 | |
| 111 | |
| 112 .graphics .grey { | |
| 113 text-align: center; | |
| 114 } | |
| 115 | |
| 116 .graphic { | |
| 117 background-color: white; | |
| 118 border: 2px solid black; | |
| 119 padding: 1.5em; | |
| 120 margin: auto; | |
| 121 } | |
| 122 | |
| 123 .centered, .defline, div.legend, div.tablewrapper { | |
| 124 margin-left: auto; | |
| 125 margin-right: auto; | |
| 126 } | |
| 127 | |
| 128 .defline { | |
| 129 background-color: white; | |
| 130 border: 1px solid black; | |
| 131 margin: .5em auto; | |
| 132 padding-left: .2em; | |
| 133 padding-right: .2em; | |
| 134 max-width: 50em; | |
| 135 text-align: left; | |
| 136 height: 2.8em; | |
| 137 overflow: hidden; | |
| 138 } | |
| 139 | |
| 140 div.legend { | |
| 141 max-width: 40em; | |
| 142 } | |
| 143 div.legend div { | |
| 144 width: 100%; | |
| 145 color: white; | |
| 146 font-weight: bold; | |
| 147 border-spacing: 0; | |
| 148 } | |
| 149 div.legend div .graphicitem { | |
| 150 width: 20%; | |
| 151 padding: 0; | |
| 152 margin: 0; | |
| 153 border: none; | |
| 154 } | |
| 155 | |
| 156 div.tablewrapper { | |
| 157 width: 50%; | |
| 158 min-width: 60em; | |
| 159 } | |
| 160 | |
| 161 /* For small widths we give the graphic 100% */ | |
| 162 @media (max-width: 72.5em) { | |
| 163 div.tablewrapper { | |
| 164 width: 100%; | |
| 165 min-width: 0px; | |
| 166 } | |
| 167 } | |
| 168 | |
| 169 .scale { | |
| 170 width: 100%; | |
| 171 margin: .5em 0; | |
| 172 font-weight: bold; | |
| 173 } | |
| 174 .scale div { | |
| 175 color: red; | |
| 176 text-align: left; | |
| 177 } | |
| 178 .scale .graphicrow { | |
| 179 margin: .5em 0 .5em 0; | |
| 180 color: white; | |
| 181 } | |
| 182 .scale .graphicitem { | |
| 183 position: relative; | |
| 184 } | |
| 185 .scale .graphicitem div { | |
| 186 margin: 0 1px; | |
| 187 padding: 0 2px; | |
| 188 text-align: right; | |
| 189 background-color: red; | |
| 190 color: white; | |
| 191 } | |
| 192 .scale .graphicitem:first-child div { | |
| 193 margin-left: 0px; | |
| 194 } | |
| 195 .scale .graphicitem:last-child div { | |
| 196 margin-right: 0px; | |
| 197 } | |
| 198 .scale .graphicitem .lastlabel { | |
| 199 position: absolute; | |
| 200 top: 0px; | |
| 201 left: 100%; | |
| 202 background-color: transparent; | |
| 203 color: red; | |
| 204 } | |
| 205 | |
| 206 a.matchresult { | |
| 207 display: block; | |
| 208 margin: 0; | |
| 209 padding: 0; | |
| 210 } | |
| 211 div.matchrow { | |
| 212 margin-top: 4px; | |
| 213 } | |
| 214 div.matchrow, div.matchitem { | |
| 215 height: 4px; | |
| 216 } | |
| 217 | |
| 218 | |
| 219 table.descriptiontable { | |
| 220 font-size: 85%; | |
| 221 border: 1px solid #97b0c8; | |
| 222 border-spacing: 0; | |
| 223 color: #222222; | |
| 224 line-height: 1.3em; | |
| 225 background-color: white; | |
| 226 } | |
| 227 table.descriptiontable col:first-child { | |
| 228 width: 100%; | |
| 229 } | |
| 230 table.descriptiontable tr:hover { | |
| 231 background-color: #D5DEE3; | |
| 232 } | |
| 233 table.descriptiontable th { | |
| 234 color: #14376C; | |
| 235 font-weight: normal; | |
| 236 background-color: #F0F0F0; | |
| 237 background: linear-gradient(#FFFFFF, #F0F0F0); | |
| 238 border-bottom: 1px solid #D4DFE9; | |
| 239 border-right: 1px solid #CFCFCF; | |
| 240 border-left: 0px solid black; | |
| 241 border-top: 0px solid black; | |
| 242 } | |
| 243 table.descriptiontable td { | |
| 244 overflow: hidden; | |
| 245 text-align: center; | |
| 246 padding: .4em .8em; | |
| 247 } | |
| 248 table.descriptiontable td div { | |
| 249 width: 1em; | |
| 250 overflow: visible; | |
| 251 white-space: nowrap; | |
| 252 text-align: left; | |
| 253 } | |
| 254 | |
| 255 | |
| 256 | |
| 257 .alignments .white { | |
| 258 padding: 1.5em 1em; | |
| 259 } | |
| 260 | |
| 261 .alignment { | |
| 262 border-top: 1px solid black; | |
| 263 padding-left: 1em; | |
| 264 padding-right: 1em; | |
| 265 } | |
| 266 | |
| 267 div.linkheader { | |
| 268 padding-top: .2em; | |
| 269 font-size: 85%; | |
| 270 color: #14376C; | |
| 271 } | |
| 272 div.linkheader a.linkheader { | |
| 273 margin-right: 1em; | |
| 274 } | |
| 275 div.linkheader .right a { | |
| 276 text-decoration: none; | |
| 277 } | |
| 278 | |
| 279 .title .hittitle { | |
| 280 color: #222222; | |
| 281 margin-bottom: .3em; | |
| 282 } | |
| 283 .title .titleinfo { | |
| 284 font-size: 80%; | |
| 285 margin-top: 0; | |
| 286 margin-bottom: .3em; | |
| 287 } | |
| 288 .title .titleinfo .b { | |
| 289 color: #606060; | |
| 290 font-weight: bold; | |
| 291 font-size: 90%; | |
| 292 } | |
| 293 | |
| 294 .moretitles { | |
| 295 margin: 1.2em; | |
| 296 } | |
| 297 .moretitles .titleinfo { | |
| 298 margin: 0; | |
| 299 padding: 0; | |
| 300 } | |
| 301 .moretitles .hittitle { | |
| 302 margin: .4em 0 .2em 0; | |
| 303 padding: 0; | |
| 304 } | |
| 305 | |
| 306 a.showmoretitles { | |
| 307 font-size: 75%; | |
| 308 color: #336699; | |
| 309 font-weight: bold; | |
| 310 margin-top: 0; | |
| 311 } | |
| 312 a.showmoretitles:hover { | |
| 313 } | |
| 314 | |
| 315 .hotspot { | |
| 316 color: #606060; | |
| 317 font-family: verdana, arial, sans-serif; | |
| 318 margin-bottom: 2.5em; | |
| 319 } | |
| 320 | |
| 321 .hotspot p.range { | |
| 322 font-size: 70%; | |
| 323 margin-top: 0; | |
| 324 margin-top: 1em; | |
| 325 margin-bottom: .2em; | |
| 326 } | |
| 327 .hotspot p.range span.range { | |
| 328 font-weight: bold; | |
| 329 } | |
| 330 .hotspot p.range a.range { | |
| 331 margin-left: .5em; | |
| 332 } | |
| 333 | |
| 334 table.hotspotstable { | |
| 335 border-top: 1px solid; | |
| 336 border-bottom: 1px solid; | |
| 337 text-align: left; | |
| 338 border-collapse: collapse; | |
| 339 } | |
| 340 table.hotspotstable th, table.hotspotstable td { | |
| 341 padding: .1em 1em; | |
| 342 } | |
| 343 table.hotspotstable th { | |
| 344 font-size: 70%; | |
| 345 } | |
| 346 table.hotspotstable td { | |
| 347 min-width: 7em; | |
| 348 color: #222222; | |
| 349 font-size: 80%; | |
| 350 } | |
| 351 | |
| 352 pre.alignmentgraphic { | |
| 353 color: #222222; | |
| 354 } | |
| 355 | |
| 356 footer { | |
| 357 text-align: center; | |
| 358 color: #cccccc; | |
| 359 font-size: 70%; | |
| 360 margin-top: 1em; | |
| 361 } | |
| 362 footer :link { | |
| 363 color: #5588cc; | |
| 364 } | |
| 365 | |
| 366 </style> | |
| 367 | |
| 368 <script type="text/javascript"> | |
| 369 function toggle_visibility(id) { | |
| 370 var e = document.getElementById(id); | |
| 371 if(e.style.display != 'block') | |
| 372 e.style.display = 'block'; | |
| 373 else | |
| 374 e.style.display = 'none'; | |
| 375 } | |
| 376 </script> | |
| 377 | |
| 378 </head> | |
| 379 | |
| 380 | |
| 381 <body> | |
| 382 | |
| 383 <div id="strip_html_warning"> | |
| 384 <!-- This div should be hidden by the header css block. Galaxy | |
| 385 strips all css, breaking this page but making this warning | |
| 386 visible. This warning contains some ugly old skool tabular html | |
| 387 layout that is not stripped. --> | |
| 388 <table bgcolor="#FFE5C9"><tr><td><font color="red"><b> | |
| 389 <font size=5><center>This html page seems to have been stripped by Galaxy.</center></font> | |
| 390 Disable Galaxy's html sanitization feature to view the full page (see <font face=monospace>sanitize_all_html</font> in your galaxy's universe_wsgi.ini), or download this page instead of viewing it in Galaxy. | |
| 391 </b></font></td></tr></table> | |
| 392 </div> | |
| 393 | |
| 394 <div id=content> | |
| 395 | |
| 114 | 396 <section class=header> | 
| 397 | |
| 398 <h1>Nucleotide Blast results</h1> | |
| 399 | |
| 400 <table class=headerdata> | |
| 401 <tr><td class=param>Program:</td><td>BLASTN 2.2.29+</td></tr> | |
| 402 <tr><td class=param>Database:</td><td>/opt/galaxy/blastdbs/EUginius_plasmid_insert</td></tr> | |
| 403 </table> | |
| 404 | |
| 405 </section> | |
| 406 | |
| 106 | 407 | 
| 408 <section class=index> | |
| 114 | 409 <h2>Queries</h2> | 
| 106 | 410 | 
| 411 <div class=indexentry><a href="#match1"> | |
| 412 Query_1: Forward_Primer|NOST-Spec_(Genetic_ID) | |
| 413 (20 letters, 2 hits) | |
| 414 </a></div> | |
| 415 <div class=indexentry><a href="#match2"> | |
| 416 Query_2: Reverse_Primer|NOST-Spec_(Genetic_ID) | |
| 417 (20 letters, 0 hits) | |
| 418 </a></div> | |
| 419 <div class=indexentry><a href="#match3"> | |
| 420 Query_3: Probe|NOST-Spec_(Genetic_ID) | |
| 421 (20 letters, 3 hits) | |
| 422 </a></div> | |
| 423 <div class=indexentry><a href="#match4"> | |
| 424 Query_4: Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R | |
| 425 (24 letters, 0 hits) | |
| 426 </a></div> | |
| 427 <div class=indexentry><a href="#match5"> | |
| 428 Query_5: Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R | |
| 429 (20 letters, 0 hits) | |
| 430 </a></div> | |
| 431 <div class=indexentry><a href="#match6"> | |
| 432 Query_6: Probe|QL-ELE-Bt-F1(mod)/Bt-R | |
| 433 (25 letters, 2 hits) | |
| 434 </a></div> | |
| 435 <div class=indexentry><a href="#match7"> | |
| 436 Query_7: Amplicon|QL-ELE-Bt-F1(mod)/Bt-R | |
| 437 (74 letters, 2 hits) | |
| 438 </a></div> | |
| 439 | |
| 440 </section> | |
| 441 | |
| 442 | |
| 443 <section class=match id=match1> | |
| 444 | |
| 114 | 445 <h2>Nucleotide Sequence (20 letters)</h2> | 
| 106 | 446 | 
| 447 <section class=header> | |
| 448 | |
| 449 <table class=headerdata> | |
| 114 | 450 <tr><td class=param>Query number:</td><td>1</td></tr> | 
| 106 | 451 <tr><td class=param>Query ID:</td><td>Query_1</td></tr> | 
| 114 | 452 <tr><td class=param>Definition line:</td><td>Forward_Primer|NOST-Spec_(Genetic_ID)</td></tr> | 
| 453 <tr><td class=param>Length:</td><td>20</td></tr> | |
| 106 | 454 </table> | 
| 455 | |
| 456 </section> | |
| 457 | |
| 458 | |
| 459 <section class=graphics> | |
| 114 | 460 <h3>Graphic Summary</h3> | 
| 106 | 461 | 
| 462 <div class=grey> | |
| 114 | 463 <h4 class=centered>Distribution of 7 Blast Hits on the Query Sequence</h4> | 
| 106 | 464 | 
| 465 <div class=defline id=defline1> | |
| 466 Mouse-over to show defline and scores, click to show alignments | |
| 467 </div> | |
| 468 | |
| 469 <div class=graphic> | |
| 114 | 470 <h5 class=darkHeader>Color key for alignment scores</h5> | 
| 106 | 471 <div class=legend><div class=graphicrow> | 
| 472 <div class=graphicitem style="background-color: black"><40</div> | |
| 473 <div class=graphicitem style="background-color: blue">40–50</div> | |
| 474 <div class=graphicitem style="background-color: green">50–80</div> | |
| 475 <div class=graphicitem style="background-color: magenta">80–200</div> | |
| 118 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 Jan Kanis <jan.code@jankanis.nl> parents: 
115diff
changeset | 476 <div class=graphicitem style="background-color: red">≥200</div> | 
| 106 | 477 </div></div> | 
| 478 <div style="clear: left"></div> | |
| 479 | |
| 480 <div class=tablewrapper> | |
| 481 | |
| 482 <div class=scale> | |
| 483 <div>query:</div> | |
| 484 <div class=graphicrow> | |
| 485 <div> | |
| 486 <div class=graphicitem style="width: 10%"> | |
| 487 <div>2</div> | |
| 488 </div> | |
| 489 <div class=graphicitem style="width: 10%"> | |
| 490 <div>4</div> | |
| 491 </div> | |
| 492 <div class=graphicitem style="width: 10%"> | |
| 493 <div>6</div> | |
| 494 </div> | |
| 495 <div class=graphicitem style="width: 10%"> | |
| 496 <div>8</div> | |
| 497 </div> | |
| 498 <div class=graphicitem style="width: 10%"> | |
| 499 <div>10</div> | |
| 500 </div> | |
| 501 <div class=graphicitem style="width: 10%"> | |
| 502 <div>12</div> | |
| 503 </div> | |
| 504 <div class=graphicitem style="width: 10%"> | |
| 505 <div>14</div> | |
| 506 </div> | |
| 507 <div class=graphicitem style="width: 10%"> | |
| 508 <div>16</div> | |
| 509 </div> | |
| 510 <div class=graphicitem style="width: 10%"> | |
| 511 <div>18</div> | |
| 512 </div> | |
| 513 <div class=graphicitem style="width: 10%"> | |
| 514 <div>20</div> | |
| 515 </div> | |
| 516 </div> | |
| 517 </div> | |
| 518 <div style="clear: left"></div> | |
| 519 </div> | |
| 520 | |
| 521 <a class=matchresult | |
| 522 href="#hit1-1" | |
| 523 onmouseover='document.getElementById("defline1").innerHTML="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000"' | |
| 524 onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | |
| 525 title="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000"> | |
| 526 <div class="matchrow graphicrow"> | |
| 527 <div class="matchitem graphicitem" | |
| 528 style="background-color: black; width: 100%"></div> | |
| 529 </div> | |
| 530 </a> | |
| 531 | |
| 532 <a class=matchresult | |
| 533 href="#hit1-2" | |
| 534 onmouseover='document.getElementById("defline1").innerHTML="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000"' | |
| 535 onmouseout='document.getElementById("defline1").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | |
| 536 title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000"> | |
| 537 <div class="matchrow graphicrow"> | |
| 538 <div class="matchitem graphicitem" | |
| 539 style="background-color: black; width: 100%"></div> | |
| 540 </div> | |
| 541 </a> | |
| 542 | |
| 543 </div> | |
| 544 </div> | |
| 545 </div> | |
| 546 </section> | |
| 547 | |
| 548 | |
| 549 | |
| 550 <section class=descriptions> | |
| 114 | 551 <h3>Descriptions</h3> | 
| 106 | 552 | 
| 553 <div class=grey><div class=white> | |
| 114 | 554 <h5 class=darkHeader>Sequences producing significant alignments:</h5> | 
| 106 | 555 | 
| 556 <table class=descriptiontable> | |
| 557 <col/><col/><col/><col/><col/><col/><col/> | |
| 558 <tr> | |
| 559 <th>Description</th> | |
| 560 <th>Max score</th> | |
| 561 <th>Total score</th> | |
| 562 <th>Query cover</th> | |
| 563 <th>E value</th> | |
| 564 <th>Ident</th> | |
| 565 <th>Accession</th> | |
| 566 </tr> | |
| 567 <tr> | |
| 568 <td><div><a href="#hit1-1" | |
| 569 title="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000" | |
| 570 id="description1-1"> | |
| 571 AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000 | |
| 572 </a></div></td> | |
| 573 <td>40.1</td> | |
| 574 <td>40.1</td> | |
| 575 <td>100%</td> | |
| 576 <td>1.513e-07</td> | |
| 577 <td>100%</td> | |
| 118 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 Jan Kanis <jan.code@jankanis.nl> parents: 
115diff
changeset | 578 <td><a target="_top" href="http://example.com/example-genebank/AB209952.1/">5</a></td> | 
| 106 | 579 </tr> | 
| 580 <tr> | |
| 581 <td><div><a href="#hit1-2" | |
| 582 title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000" | |
| 583 id="description1-2"> | |
| 584 DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000 | |
| 585 </a></div></td> | |
| 586 <td>40.1</td> | |
| 587 <td>40.1</td> | |
| 588 <td>100%</td> | |
| 589 <td>1.513e-07</td> | |
| 590 <td>100%</td> | |
| 118 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 Jan Kanis <jan.code@jankanis.nl> parents: 
115diff
changeset | 591 <td><a target="_top" href="http://example.com/example-genebank/DJ437711/">2</a></td> | 
| 106 | 592 </tr> | 
| 593 </table> | |
| 594 | |
| 595 </div></div> | |
| 596 </section> | |
| 597 | |
| 598 | |
| 599 | |
| 600 <section class=alignments> | |
| 114 | 601 <h3>Alignments</h3> | 
| 106 | 602 | 
| 603 <div class=grey><div class=white> | |
| 604 <div class=alignment id=hit1-1> | |
| 605 | |
| 606 <div class=linkheader> | |
| 607 <div class=right><a href="#description1-1">Descriptions</a></div> | |
| 118 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 Jan Kanis <jan.code@jankanis.nl> parents: 
115diff
changeset | 608 <a class="linkheader" target="_top" href="http://example.com/example-genebank/AB209952.1/">Example Gene Bank</a> | 
| 106 | 609 </div> | 
| 610 | |
| 611 <div class=title> | |
| 612 <p class=hittitle>AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000</p> | |
| 613 <p class=titleinfo> | |
| 118 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 Jan Kanis <jan.code@jankanis.nl> parents: 
115diff
changeset | 614 <span class=b>Sequence ID:</span> <a target="_top" href="http://example.com/example-genebank/AB209952.1/">gnl|BL_ORD_ID|5</a> | 
| 106 | 615 <span class=b>Length:</span> 2457 | 
| 616 <span class=b>Number of Matches:</span> 1 | |
| 617 </p> | |
| 618 </div> | |
| 619 | |
| 620 | |
| 621 <div class=hotspot id=hotspot1-1-1> | |
| 622 <p class=range> | |
| 623 <span class=range>Range 1: 2119 to 2138</span> | |
| 624 </p> | |
| 625 | |
| 626 <table class=hotspotstable> | |
| 627 <tr> | |
| 628 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | |
| 629 </tr> | |
| 630 <tr> | |
| 118 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 Jan Kanis <jan.code@jankanis.nl> parents: 
115diff
changeset | 631 <td>40.14 bits (20)</td> | 
| 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 Jan Kanis <jan.code@jankanis.nl> parents: 
115diff
changeset | 632 <td>1.51296e-07</td> | 
| 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 Jan Kanis <jan.code@jankanis.nl> parents: 
115diff
changeset | 633 <td>20/20 (100%)</td> | 
| 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 Jan Kanis <jan.code@jankanis.nl> parents: 
115diff
changeset | 634 <td>0/20 (0%)</td> | 
| 106 | 635 <td>Plus/Plus</td> | 
| 636 </tr> | |
| 637 </table> | |
| 638 | |
| 639 <pre class=alignmentgraphic>Query 1 AGCGCGCAAACTAGGATAAA 20 | |
| 640 |||||||||||||||||||| | |
| 641 Subject 2119 AGCGCGCAAACTAGGATAAA 2138</pre> | |
| 642 </div> | |
| 643 | |
| 644 </div> | |
| 645 | |
| 646 <div class=alignment id=hit1-2> | |
| 647 | |
| 648 <div class=linkheader> | |
| 649 <div class=right><a href="#description1-2">Descriptions</a></div> | |
| 118 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 Jan Kanis <jan.code@jankanis.nl> parents: 
115diff
changeset | 650 <a class="linkheader" target="_top" href="http://example.com/example-genebank/DJ437711/">Example Gene Bank</a> | 
| 106 | 651 </div> | 
| 652 | |
| 653 <div class=title> | |
| 654 <p class=hittitle>DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000</p> | |
| 655 <p class=titleinfo> | |
| 118 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 Jan Kanis <jan.code@jankanis.nl> parents: 
115diff
changeset | 656 <span class=b>Sequence ID:</span> <a target="_top" href="http://example.com/example-genebank/DJ437711/">gnl|BL_ORD_ID|2</a> | 
| 106 | 657 <span class=b>Length:</span> 323 | 
| 658 <span class=b>Number of Matches:</span> 1 | |
| 659 </p> | |
| 660 </div> | |
| 661 | |
| 662 | |
| 663 <div class=hotspot id=hotspot1-2-1> | |
| 664 <p class=range> | |
| 665 <span class=range>Range 1: 200 to 219</span> | |
| 666 </p> | |
| 667 | |
| 668 <table class=hotspotstable> | |
| 669 <tr> | |
| 670 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | |
| 671 </tr> | |
| 672 <tr> | |
| 118 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 Jan Kanis <jan.code@jankanis.nl> parents: 
115diff
changeset | 673 <td>40.14 bits (20)</td> | 
| 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 Jan Kanis <jan.code@jankanis.nl> parents: 
115diff
changeset | 674 <td>1.51296e-07</td> | 
| 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 Jan Kanis <jan.code@jankanis.nl> parents: 
115diff
changeset | 675 <td>20/20 (100%)</td> | 
| 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 Jan Kanis <jan.code@jankanis.nl> parents: 
115diff
changeset | 676 <td>0/20 (0%)</td> | 
| 106 | 677 <td>Plus/Plus</td> | 
| 678 </tr> | |
| 679 </table> | |
| 680 | |
| 681 <pre class=alignmentgraphic>Query 1 AGCGCGCAAACTAGGATAAA 20 | |
| 682 |||||||||||||||||||| | |
| 683 Subject 200 AGCGCGCAAACTAGGATAAA 219</pre> | |
| 684 </div> | |
| 685 | |
| 686 </div> | |
| 687 | |
| 688 </div></div> | |
| 689 </section> | |
| 690 </section> | |
| 691 | |
| 692 <section class=match id=match2> | |
| 693 | |
| 114 | 694 <h2>Nucleotide Sequence (20 letters)</h2> | 
| 106 | 695 | 
| 696 <section class=header> | |
| 697 | |
| 698 <table class=headerdata> | |
| 114 | 699 <tr><td class=param>Query number:</td><td>2</td></tr> | 
| 700 <tr><td class=param>Query ID:</td><td>Query_2</td></tr> | |
| 701 <tr><td class=param>Definition line:</td><td>Reverse_Primer|NOST-Spec_(Genetic_ID)</td></tr> | |
| 702 <tr><td class=param>Length:</td><td>20</td></tr> | |
| 106 | 703 </table> | 
| 704 | |
| 705 </section> | |
| 706 | |
| 707 <section> | |
| 114 | 708 <h3>No Hits</h3> | 
| 106 | 709 <div class=grey> | 
| 710 <table class=headerdata> | |
| 711 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 712 </table> | |
| 713 </div> | |
| 714 </section> | |
| 715 </section> | |
| 716 | |
| 717 <section class=match id=match3> | |
| 718 | |
| 114 | 719 <h2>Nucleotide Sequence (20 letters)</h2> | 
| 106 | 720 | 
| 721 <section class=header> | |
| 722 | |
| 723 <table class=headerdata> | |
| 114 | 724 <tr><td class=param>Query number:</td><td>3</td></tr> | 
| 725 <tr><td class=param>Query ID:</td><td>Query_3</td></tr> | |
| 726 <tr><td class=param>Definition line:</td><td>Probe|NOST-Spec_(Genetic_ID)</td></tr> | |
| 727 <tr><td class=param>Length:</td><td>20</td></tr> | |
| 106 | 728 </table> | 
| 729 | |
| 730 </section> | |
| 731 | |
| 732 | |
| 733 <section class=graphics> | |
| 114 | 734 <h3>Graphic Summary</h3> | 
| 106 | 735 | 
| 736 <div class=grey> | |
| 114 | 737 <h4 class=centered>Distribution of 7 Blast Hits on the Query Sequence</h4> | 
| 106 | 738 | 
| 739 <div class=defline id=defline3> | |
| 740 Mouse-over to show defline and scores, click to show alignments | |
| 741 </div> | |
| 742 | |
| 743 <div class=graphic> | |
| 114 | 744 <h5 class=darkHeader>Color key for alignment scores</h5> | 
| 106 | 745 <div class=legend><div class=graphicrow> | 
| 746 <div class=graphicitem style="background-color: black"><40</div> | |
| 747 <div class=graphicitem style="background-color: blue">40–50</div> | |
| 748 <div class=graphicitem style="background-color: green">50–80</div> | |
| 749 <div class=graphicitem style="background-color: magenta">80–200</div> | |
| 118 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 Jan Kanis <jan.code@jankanis.nl> parents: 
115diff
changeset | 750 <div class=graphicitem style="background-color: red">≥200</div> | 
| 106 | 751 </div></div> | 
| 752 <div style="clear: left"></div> | |
| 753 | |
| 754 <div class=tablewrapper> | |
| 755 | |
| 756 <div class=scale> | |
| 757 <div>query:</div> | |
| 758 <div class=graphicrow> | |
| 759 <div> | |
| 760 <div class=graphicitem style="width: 10%"> | |
| 761 <div>2</div> | |
| 762 </div> | |
| 763 <div class=graphicitem style="width: 10%"> | |
| 764 <div>4</div> | |
| 765 </div> | |
| 766 <div class=graphicitem style="width: 10%"> | |
| 767 <div>6</div> | |
| 768 </div> | |
| 769 <div class=graphicitem style="width: 10%"> | |
| 770 <div>8</div> | |
| 771 </div> | |
| 772 <div class=graphicitem style="width: 10%"> | |
| 773 <div>10</div> | |
| 774 </div> | |
| 775 <div class=graphicitem style="width: 10%"> | |
| 776 <div>12</div> | |
| 777 </div> | |
| 778 <div class=graphicitem style="width: 10%"> | |
| 779 <div>14</div> | |
| 780 </div> | |
| 781 <div class=graphicitem style="width: 10%"> | |
| 782 <div>16</div> | |
| 783 </div> | |
| 784 <div class=graphicitem style="width: 10%"> | |
| 785 <div>18</div> | |
| 786 </div> | |
| 787 <div class=graphicitem style="width: 10%"> | |
| 788 <div>20</div> | |
| 789 </div> | |
| 790 </div> | |
| 791 </div> | |
| 792 <div style="clear: left"></div> | |
| 793 </div> | |
| 794 | |
| 795 <a class=matchresult | |
| 796 href="#hit3-1" | |
| 797 onmouseover='document.getElementById("defline3").innerHTML="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000"' | |
| 798 onmouseout='document.getElementById("defline3").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | |
| 799 title="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000"> | |
| 800 <div class="matchrow graphicrow"> | |
| 801 <div class="matchitem graphicitem" | |
| 802 style="background-color: black; width: 100%"></div> | |
| 803 </div> | |
| 804 </a> | |
| 805 | |
| 806 <a class=matchresult | |
| 807 href="#hit3-2" | |
| 808 onmouseover='document.getElementById("defline3").innerHTML="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000"' | |
| 809 onmouseout='document.getElementById("defline3").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | |
| 810 title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000"> | |
| 811 <div class="matchrow graphicrow"> | |
| 812 <div class="matchitem graphicitem" | |
| 813 style="background-color: black; width: 100%"></div> | |
| 814 </div> | |
| 815 </a> | |
| 816 | |
| 817 <a class=matchresult | |
| 818 href="#hit3-3" | |
| 819 onmouseover='document.getElementById("defline3").innerHTML="AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3\u0027UTR/plant_junction_region.|-9105899556052450000"' | |
| 820 onmouseout='document.getElementById("defline3").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | |
| 821 title="AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3'UTR/plant_junction_region.|-9105899556052450000"> | |
| 822 <div class="matchrow graphicrow"> | |
| 823 <div class="matchitem graphicitem" | |
| 824 style="background-color: transparent; width: 15%"></div> | |
| 825 <div class="matchitem graphicitem" | |
| 826 style="background-color: black; width: 85%"></div> | |
| 827 </div> | |
| 828 </a> | |
| 829 | |
| 830 </div> | |
| 831 </div> | |
| 832 </div> | |
| 833 </section> | |
| 834 | |
| 835 | |
| 836 | |
| 837 <section class=descriptions> | |
| 114 | 838 <h3>Descriptions</h3> | 
| 106 | 839 | 
| 840 <div class=grey><div class=white> | |
| 114 | 841 <h5 class=darkHeader>Sequences producing significant alignments:</h5> | 
| 106 | 842 | 
| 843 <table class=descriptiontable> | |
| 844 <col/><col/><col/><col/><col/><col/><col/> | |
| 845 <tr> | |
| 846 <th>Description</th> | |
| 847 <th>Max score</th> | |
| 848 <th>Total score</th> | |
| 849 <th>Query cover</th> | |
| 850 <th>E value</th> | |
| 851 <th>Ident</th> | |
| 852 <th>Accession</th> | |
| 853 </tr> | |
| 854 <tr> | |
| 855 <td><div><a href="#hit3-1" | |
| 856 title="AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000" | |
| 857 id="description3-1"> | |
| 858 AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000 | |
| 859 </a></div></td> | |
| 860 <td>40.1</td> | |
| 861 <td>40.1</td> | |
| 862 <td>100%</td> | |
| 863 <td>1.513e-07</td> | |
| 864 <td>100%</td> | |
| 118 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 Jan Kanis <jan.code@jankanis.nl> parents: 
115diff
changeset | 865 <td><a target="_top" href="http://example.com/example-genebank/AB209952.1/">5</a></td> | 
| 106 | 866 </tr> | 
| 867 <tr> | |
| 868 <td><div><a href="#hit3-2" | |
| 869 title="DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000" | |
| 870 id="description3-2"> | |
| 871 DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000 | |
| 872 </a></div></td> | |
| 873 <td>40.1</td> | |
| 874 <td>40.1</td> | |
| 875 <td>100%</td> | |
| 876 <td>1.513e-07</td> | |
| 877 <td>100%</td> | |
| 118 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 Jan Kanis <jan.code@jankanis.nl> parents: 
115diff
changeset | 878 <td><a target="_top" href="http://example.com/example-genebank/DJ437711/">2</a></td> | 
| 106 | 879 </tr> | 
| 880 <tr> | |
| 881 <td><div><a href="#hit3-3" | |
| 882 title="AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3'UTR/plant_junction_region.|-9105899556052450000" | |
| 883 id="description3-3"> | |
| 884 AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3'UTR/plant_junction_region.|-9105899556052450000 | |
| 885 </a></div></td> | |
| 886 <td>34.2</td> | |
| 887 <td>34.2</td> | |
| 888 <td>85%</td> | |
| 889 <td>9.334e-06</td> | |
| 890 <td>100%</td> | |
| 118 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 Jan Kanis <jan.code@jankanis.nl> parents: 
115diff
changeset | 891 <td><a target="_top" href="http://example.com/example-genebank/AJ308515.1/">1</a></td> | 
| 106 | 892 </tr> | 
| 893 </table> | |
| 894 | |
| 895 </div></div> | |
| 896 </section> | |
| 897 | |
| 898 | |
| 899 | |
| 900 <section class=alignments> | |
| 114 | 901 <h3>Alignments</h3> | 
| 106 | 902 | 
| 903 <div class=grey><div class=white> | |
| 904 <div class=alignment id=hit3-1> | |
| 905 | |
| 906 <div class=linkheader> | |
| 907 <div class=right><a href="#description3-1">Descriptions</a></div> | |
| 118 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 Jan Kanis <jan.code@jankanis.nl> parents: 
115diff
changeset | 908 <a class="linkheader" target="_top" href="http://example.com/example-genebank/AB209952.1/">Example Gene Bank</a> | 
| 106 | 909 </div> | 
| 910 | |
| 911 <div class=title> | |
| 912 <p class=hittitle>AB209952.1|GenBank|insert_GTS-40-3-2|Glycine_max_transgenic_cp4epsps_gene_for_5-enol-pyruvylshikimate-3-phospate_synthase_class_2_precursor,_complete_cds|-9105899556052450000</p> | |
| 913 <p class=titleinfo> | |
| 118 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 Jan Kanis <jan.code@jankanis.nl> parents: 
115diff
changeset | 914 <span class=b>Sequence ID:</span> <a target="_top" href="http://example.com/example-genebank/AB209952.1/">gnl|BL_ORD_ID|5</a> | 
| 106 | 915 <span class=b>Length:</span> 2457 | 
| 916 <span class=b>Number of Matches:</span> 1 | |
| 917 </p> | |
| 918 </div> | |
| 919 | |
| 920 | |
| 921 <div class=hotspot id=hotspot3-1-1> | |
| 922 <p class=range> | |
| 923 <span class=range>Range 1: 2143 to 2162</span> | |
| 924 </p> | |
| 925 | |
| 926 <table class=hotspotstable> | |
| 927 <tr> | |
| 928 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | |
| 929 </tr> | |
| 930 <tr> | |
| 118 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 Jan Kanis <jan.code@jankanis.nl> parents: 
115diff
changeset | 931 <td>40.14 bits (20)</td> | 
| 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 Jan Kanis <jan.code@jankanis.nl> parents: 
115diff
changeset | 932 <td>1.51296e-07</td> | 
| 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 Jan Kanis <jan.code@jankanis.nl> parents: 
115diff
changeset | 933 <td>20/20 (100%)</td> | 
| 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 Jan Kanis <jan.code@jankanis.nl> parents: 
115diff
changeset | 934 <td>0/20 (0%)</td> | 
| 106 | 935 <td>Plus/Plus</td> | 
| 936 </tr> | |
| 937 </table> | |
| 938 | |
| 939 <pre class=alignmentgraphic>Query 1 CGCGCGCGGTGTCATCTATG 20 | |
| 940 |||||||||||||||||||| | |
| 941 Subject 2143 CGCGCGCGGTGTCATCTATG 2162</pre> | |
| 942 </div> | |
| 943 | |
| 944 </div> | |
| 945 | |
| 946 <div class=alignment id=hit3-2> | |
| 947 | |
| 948 <div class=linkheader> | |
| 949 <div class=right><a href="#description3-2">Descriptions</a></div> | |
| 118 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 Jan Kanis <jan.code@jankanis.nl> parents: 
115diff
changeset | 950 <a class="linkheader" target="_top" href="http://example.com/example-genebank/DJ437711/">Example Gene Bank</a> | 
| 106 | 951 </div> | 
| 952 | |
| 953 <div class=title> | |
| 954 <p class=hittitle>DJ437711|GenBank|insert_MIR604|Corn_Event_MIR604,_Left_Border_region|-5751164067366620000</p> | |
| 955 <p class=titleinfo> | |
| 118 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 Jan Kanis <jan.code@jankanis.nl> parents: 
115diff
changeset | 956 <span class=b>Sequence ID:</span> <a target="_top" href="http://example.com/example-genebank/DJ437711/">gnl|BL_ORD_ID|2</a> | 
| 106 | 957 <span class=b>Length:</span> 323 | 
| 958 <span class=b>Number of Matches:</span> 1 | |
| 959 </p> | |
| 960 </div> | |
| 961 | |
| 962 | |
| 963 <div class=hotspot id=hotspot3-2-1> | |
| 964 <p class=range> | |
| 965 <span class=range>Range 1: 224 to 243</span> | |
| 966 </p> | |
| 967 | |
| 968 <table class=hotspotstable> | |
| 969 <tr> | |
| 970 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | |
| 971 </tr> | |
| 972 <tr> | |
| 118 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 Jan Kanis <jan.code@jankanis.nl> parents: 
115diff
changeset | 973 <td>40.14 bits (20)</td> | 
| 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 Jan Kanis <jan.code@jankanis.nl> parents: 
115diff
changeset | 974 <td>1.51296e-07</td> | 
| 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 Jan Kanis <jan.code@jankanis.nl> parents: 
115diff
changeset | 975 <td>20/20 (100%)</td> | 
| 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 Jan Kanis <jan.code@jankanis.nl> parents: 
115diff
changeset | 976 <td>0/20 (0%)</td> | 
| 106 | 977 <td>Plus/Plus</td> | 
| 978 </tr> | |
| 979 </table> | |
| 980 | |
| 981 <pre class=alignmentgraphic>Query 1 CGCGCGCGGTGTCATCTATG 20 | |
| 982 |||||||||||||||||||| | |
| 983 Subject 224 CGCGCGCGGTGTCATCTATG 243</pre> | |
| 984 </div> | |
| 985 | |
| 986 </div> | |
| 987 | |
| 988 <div class=alignment id=hit3-3> | |
| 989 | |
| 990 <div class=linkheader> | |
| 991 <div class=right><a href="#description3-3">Descriptions</a></div> | |
| 118 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 Jan Kanis <jan.code@jankanis.nl> parents: 
115diff
changeset | 992 <a class="linkheader" target="_top" href="http://example.com/example-genebank/AJ308515.1/">Example Gene Bank</a> | 
| 106 | 993 </div> | 
| 994 | |
| 995 <div class=title> | |
| 996 <p class=hittitle>AJ308515.1|GenBank|insert_GTS-40-3-2|Synthetic_construct_for_NOS_3'UTR/plant_junction_region.|-9105899556052450000</p> | |
| 997 <p class=titleinfo> | |
| 118 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 Jan Kanis <jan.code@jankanis.nl> parents: 
115diff
changeset | 998 <span class=b>Sequence ID:</span> <a target="_top" href="http://example.com/example-genebank/AJ308515.1/">gnl|BL_ORD_ID|1</a> | 
| 106 | 999 <span class=b>Length:</span> 1045 | 
| 1000 <span class=b>Number of Matches:</span> 1 | |
| 1001 </p> | |
| 1002 </div> | |
| 1003 | |
| 1004 | |
| 1005 <div class=hotspot id=hotspot3-3-1> | |
| 1006 <p class=range> | |
| 1007 <span class=range>Range 1: 2 to 18</span> | |
| 1008 </p> | |
| 1009 | |
| 1010 <table class=hotspotstable> | |
| 1011 <tr> | |
| 1012 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | |
| 1013 </tr> | |
| 1014 <tr> | |
| 118 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 Jan Kanis <jan.code@jankanis.nl> parents: 
115diff
changeset | 1015 <td>34.1929 bits (17)</td> | 
| 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 Jan Kanis <jan.code@jankanis.nl> parents: 
115diff
changeset | 1016 <td>9.33411e-06</td> | 
| 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 Jan Kanis <jan.code@jankanis.nl> parents: 
115diff
changeset | 1017 <td>17/17 (100%)</td> | 
| 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 Jan Kanis <jan.code@jankanis.nl> parents: 
115diff
changeset | 1018 <td>0/17 (0%)</td> | 
| 106 | 1019 <td>Plus/Plus</td> | 
| 1020 </tr> | |
| 1021 </table> | |
| 1022 | |
| 1023 <pre class=alignmentgraphic>Query 4 GCGCGGTGTCATCTATG 20 | |
| 1024 ||||||||||||||||| | |
| 1025 Subject 2 GCGCGGTGTCATCTATG 18</pre> | |
| 1026 </div> | |
| 1027 | |
| 1028 </div> | |
| 1029 | |
| 1030 </div></div> | |
| 1031 </section> | |
| 1032 </section> | |
| 1033 | |
| 1034 <section class=match id=match4> | |
| 1035 | |
| 114 | 1036 <h2>Nucleotide Sequence (24 letters)</h2> | 
| 106 | 1037 | 
| 1038 <section class=header> | |
| 1039 | |
| 1040 <table class=headerdata> | |
| 114 | 1041 <tr><td class=param>Query number:</td><td>4</td></tr> | 
| 1042 <tr><td class=param>Query ID:</td><td>Query_4</td></tr> | |
| 1043 <tr><td class=param>Definition line:</td><td>Forward_Primer|QL-ELE-Bt-F1(mod)/Bt-R</td></tr> | |
| 1044 <tr><td class=param>Length:</td><td>24</td></tr> | |
| 106 | 1045 </table> | 
| 1046 | |
| 1047 </section> | |
| 1048 | |
| 1049 <section> | |
| 114 | 1050 <h3>No Hits</h3> | 
| 106 | 1051 <div class=grey> | 
| 1052 <table class=headerdata> | |
| 1053 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 1054 </table> | |
| 1055 </div> | |
| 1056 </section> | |
| 1057 </section> | |
| 1058 | |
| 1059 <section class=match id=match5> | |
| 1060 | |
| 114 | 1061 <h2>Nucleotide Sequence (20 letters)</h2> | 
| 106 | 1062 | 
| 1063 <section class=header> | |
| 1064 | |
| 1065 <table class=headerdata> | |
| 114 | 1066 <tr><td class=param>Query number:</td><td>5</td></tr> | 
| 1067 <tr><td class=param>Query ID:</td><td>Query_5</td></tr> | |
| 1068 <tr><td class=param>Definition line:</td><td>Reverse_Primer|QL-ELE-Bt-F1(mod)/Bt-R</td></tr> | |
| 1069 <tr><td class=param>Length:</td><td>20</td></tr> | |
| 106 | 1070 </table> | 
| 1071 | |
| 1072 </section> | |
| 1073 | |
| 1074 <section> | |
| 114 | 1075 <h3>No Hits</h3> | 
| 106 | 1076 <div class=grey> | 
| 1077 <table class=headerdata> | |
| 1078 <tr><td class=param>Message:</td><td>No hits found</td></tr> | |
| 1079 </table> | |
| 1080 </div> | |
| 1081 </section> | |
| 1082 </section> | |
| 1083 | |
| 1084 <section class=match id=match6> | |
| 1085 | |
| 114 | 1086 <h2>Nucleotide Sequence (25 letters)</h2> | 
| 106 | 1087 | 
| 1088 <section class=header> | |
| 1089 | |
| 1090 <table class=headerdata> | |
| 114 | 1091 <tr><td class=param>Query number:</td><td>6</td></tr> | 
| 1092 <tr><td class=param>Query ID:</td><td>Query_6</td></tr> | |
| 1093 <tr><td class=param>Definition line:</td><td>Probe|QL-ELE-Bt-F1(mod)/Bt-R</td></tr> | |
| 1094 <tr><td class=param>Length:</td><td>25</td></tr> | |
| 106 | 1095 </table> | 
| 1096 | |
| 1097 </section> | |
| 1098 | |
| 1099 | |
| 1100 <section class=graphics> | |
| 114 | 1101 <h3>Graphic Summary</h3> | 
| 106 | 1102 | 
| 1103 <div class=grey> | |
| 114 | 1104 <h4 class=centered>Distribution of 7 Blast Hits on the Query Sequence</h4> | 
| 106 | 1105 | 
| 1106 <div class=defline id=defline6> | |
| 1107 Mouse-over to show defline and scores, click to show alignments | |
| 1108 </div> | |
| 1109 | |
| 1110 <div class=graphic> | |
| 114 | 1111 <h5 class=darkHeader>Color key for alignment scores</h5> | 
| 106 | 1112 <div class=legend><div class=graphicrow> | 
| 1113 <div class=graphicitem style="background-color: black"><40</div> | |
| 1114 <div class=graphicitem style="background-color: blue">40–50</div> | |
| 1115 <div class=graphicitem style="background-color: green">50–80</div> | |
| 1116 <div class=graphicitem style="background-color: magenta">80–200</div> | |
| 118 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 Jan Kanis <jan.code@jankanis.nl> parents: 
115diff
changeset | 1117 <div class=graphicitem style="background-color: red">≥200</div> | 
| 106 | 1118 </div></div> | 
| 1119 <div style="clear: left"></div> | |
| 1120 | |
| 1121 <div class=tablewrapper> | |
| 1122 | |
| 1123 <div class=scale> | |
| 1124 <div>query:</div> | |
| 1125 <div class=graphicrow> | |
| 1126 <div> | |
| 1127 <div class=graphicitem style="width: 12%"> | |
| 1128 <div>3</div> | |
| 1129 </div> | |
| 1130 <div class=graphicitem style="width: 12%"> | |
| 1131 <div>6</div> | |
| 1132 </div> | |
| 1133 <div class=graphicitem style="width: 12%"> | |
| 1134 <div>9</div> | |
| 1135 </div> | |
| 1136 <div class=graphicitem style="width: 12%"> | |
| 1137 <div>12</div> | |
| 1138 </div> | |
| 1139 <div class=graphicitem style="width: 12%"> | |
| 1140 <div>15</div> | |
| 1141 </div> | |
| 1142 <div class=graphicitem style="width: 12%"> | |
| 1143 <div>18</div> | |
| 1144 </div> | |
| 1145 <div class=graphicitem style="width: 12%"> | |
| 1146 <div>21</div> | |
| 1147 </div> | |
| 1148 <div class=graphicitem style="width: 12%"> | |
| 1149 <div>24</div> | |
| 1150 </div> | |
| 1151 <div class=graphicitem style="width: 4%"> | |
| 1152 <div>25</div> | |
| 1153 </div> | |
| 1154 </div> | |
| 1155 </div> | |
| 1156 <div style="clear: left"></div> | |
| 1157 </div> | |
| 1158 | |
| 1159 <a class=matchresult | |
| 1160 href="#hit6-1" | |
| 1161 onmouseover='document.getElementById("defline6").innerHTML="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000"' | |
| 1162 onmouseout='document.getElementById("defline6").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | |
| 1163 title="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000"> | |
| 1164 <div class="matchrow graphicrow"> | |
| 1165 <div class="matchitem graphicitem" | |
| 1166 style="background-color: black; width: 88%"></div> | |
| 1167 <div class="matchitem graphicitem" | |
| 1168 style="background-color: transparent; width: 12%"></div> | |
| 1169 </div> | |
| 1170 </a> | |
| 1171 | |
| 1172 <a class=matchresult | |
| 1173 href="#hit6-2" | |
| 1174 onmouseover='document.getElementById("defline6").innerHTML="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000"' | |
| 1175 onmouseout='document.getElementById("defline6").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | |
| 1176 title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000"> | |
| 1177 <div class="matchrow graphicrow"> | |
| 1178 <div class="matchitem graphicitem" | |
| 1179 style="background-color: black; width: 88%"></div> | |
| 1180 <div class="matchitem graphicitem" | |
| 1181 style="background-color: transparent; width: 12%"></div> | |
| 1182 </div> | |
| 1183 </a> | |
| 1184 | |
| 1185 </div> | |
| 1186 </div> | |
| 1187 </div> | |
| 1188 </section> | |
| 1189 | |
| 1190 | |
| 1191 | |
| 1192 <section class=descriptions> | |
| 114 | 1193 <h3>Descriptions</h3> | 
| 106 | 1194 | 
| 1195 <div class=grey><div class=white> | |
| 114 | 1196 <h5 class=darkHeader>Sequences producing significant alignments:</h5> | 
| 106 | 1197 | 
| 1198 <table class=descriptiontable> | |
| 1199 <col/><col/><col/><col/><col/><col/><col/> | |
| 1200 <tr> | |
| 1201 <th>Description</th> | |
| 1202 <th>Max score</th> | |
| 1203 <th>Total score</th> | |
| 1204 <th>Query cover</th> | |
| 1205 <th>E value</th> | |
| 1206 <th>Ident</th> | |
| 1207 <th>Accession</th> | |
| 1208 </tr> | |
| 1209 <tr> | |
| 1210 <td><div><a href="#hit6-1" | |
| 1211 title="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000" | |
| 1212 id="description6-1"> | |
| 1213 EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000 | |
| 1214 </a></div></td> | |
| 1215 <td>36.2</td> | |
| 1216 <td>36.2</td> | |
| 1217 <td>88%</td> | |
| 1218 <td>3.148e-06</td> | |
| 1219 <td>95%</td> | |
| 118 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 Jan Kanis <jan.code@jankanis.nl> parents: 
115diff
changeset | 1220 <td><a target="_top" href="http://example.com/example-genebank/EUG/">7</a></td> | 
| 106 | 1221 </tr> | 
| 1222 <tr> | |
| 1223 <td><div><a href="#hit6-2" | |
| 1224 title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000" | |
| 1225 id="description6-2"> | |
| 1226 AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000 | |
| 1227 </a></div></td> | |
| 1228 <td>36.2</td> | |
| 1229 <td>36.2</td> | |
| 1230 <td>88%</td> | |
| 1231 <td>3.148e-06</td> | |
| 1232 <td>95%</td> | |
| 118 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 Jan Kanis <jan.code@jankanis.nl> parents: 
115diff
changeset | 1233 <td><a target="_top" href="http://example.com/example-genebank/AY326434/">6</a></td> | 
| 106 | 1234 </tr> | 
| 1235 </table> | |
| 1236 | |
| 1237 </div></div> | |
| 1238 </section> | |
| 1239 | |
| 1240 | |
| 1241 | |
| 1242 <section class=alignments> | |
| 114 | 1243 <h3>Alignments</h3> | 
| 106 | 1244 | 
| 1245 <div class=grey><div class=white> | |
| 1246 <div class=alignment id=hit6-1> | |
| 1247 | |
| 1248 <div class=linkheader> | |
| 1249 <div class=right><a href="#description6-1">Descriptions</a></div> | |
| 118 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 Jan Kanis <jan.code@jankanis.nl> parents: 
115diff
changeset | 1250 <a class="linkheader" target="_top" href="http://example.com/example-genebank/EUG/">Example Gene Bank</a> | 
| 106 | 1251 </div> | 
| 1252 | |
| 1253 <div class=title> | |
| 1254 <p class=hittitle>EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000</p> | |
| 1255 <p class=titleinfo> | |
| 118 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 Jan Kanis <jan.code@jankanis.nl> parents: 
115diff
changeset | 1256 <span class=b>Sequence ID:</span> <a target="_top" href="http://example.com/example-genebank/EUG/">gnl|BL_ORD_ID|7</a> | 
| 106 | 1257 <span class=b>Length:</span> 4983 | 
| 1258 <span class=b>Number of Matches:</span> 1 | |
| 1259 </p> | |
| 1260 </div> | |
| 1261 | |
| 1262 | |
| 1263 <div class=hotspot id=hotspot6-1-1> | |
| 1264 <p class=range> | |
| 1265 <span class=range>Range 1: 2344 to 2365</span> | |
| 1266 </p> | |
| 1267 | |
| 1268 <table class=hotspotstable> | |
| 1269 <tr> | |
| 1270 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | |
| 1271 </tr> | |
| 1272 <tr> | |
| 118 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 Jan Kanis <jan.code@jankanis.nl> parents: 
115diff
changeset | 1273 <td>36.1753 bits (18)</td> | 
| 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 Jan Kanis <jan.code@jankanis.nl> parents: 
115diff
changeset | 1274 <td>3.14801e-06</td> | 
| 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 Jan Kanis <jan.code@jankanis.nl> parents: 
115diff
changeset | 1275 <td>21/22 (95%)</td> | 
| 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 Jan Kanis <jan.code@jankanis.nl> parents: 
115diff
changeset | 1276 <td>0/22 (0%)</td> | 
| 106 | 1277 <td>Plus/Plus</td> | 
| 1278 </tr> | |
| 1279 </table> | |
| 1280 | |
| 1281 <pre class=alignmentgraphic>Query 1 ACATGAACAGCGCCTTGACCAC 22 | |
| 1282 |||||||||||||| ||||||| | |
| 1283 Subject 2344 ACATGAACAGCGCCCTGACCAC 2365</pre> | |
| 1284 </div> | |
| 1285 | |
| 1286 </div> | |
| 1287 | |
| 1288 <div class=alignment id=hit6-2> | |
| 1289 | |
| 1290 <div class=linkheader> | |
| 1291 <div class=right><a href="#description6-2">Descriptions</a></div> | |
| 118 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 Jan Kanis <jan.code@jankanis.nl> parents: 
115diff
changeset | 1292 <a class="linkheader" target="_top" href="http://example.com/example-genebank/AY326434/">Example Gene Bank</a> | 
| 106 | 1293 </div> | 
| 1294 | |
| 1295 <div class=title> | |
| 1296 <p class=hittitle>AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000</p> | |
| 1297 <p class=titleinfo> | |
| 118 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 Jan Kanis <jan.code@jankanis.nl> parents: 
115diff
changeset | 1298 <span class=b>Sequence ID:</span> <a target="_top" href="http://example.com/example-genebank/AY326434/">gnl|BL_ORD_ID|6</a> | 
| 106 | 1299 <span class=b>Length:</span> 4180 | 
| 1300 <span class=b>Number of Matches:</span> 1 | |
| 1301 </p> | |
| 1302 </div> | |
| 1303 | |
| 1304 | |
| 1305 <div class=hotspot id=hotspot6-2-1> | |
| 1306 <p class=range> | |
| 1307 <span class=range>Range 1: 1541 to 1562</span> | |
| 1308 </p> | |
| 1309 | |
| 1310 <table class=hotspotstable> | |
| 1311 <tr> | |
| 1312 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | |
| 1313 </tr> | |
| 1314 <tr> | |
| 118 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 Jan Kanis <jan.code@jankanis.nl> parents: 
115diff
changeset | 1315 <td>36.1753 bits (18)</td> | 
| 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 Jan Kanis <jan.code@jankanis.nl> parents: 
115diff
changeset | 1316 <td>3.14801e-06</td> | 
| 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 Jan Kanis <jan.code@jankanis.nl> parents: 
115diff
changeset | 1317 <td>21/22 (95%)</td> | 
| 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 Jan Kanis <jan.code@jankanis.nl> parents: 
115diff
changeset | 1318 <td>0/22 (0%)</td> | 
| 106 | 1319 <td>Plus/Plus</td> | 
| 1320 </tr> | |
| 1321 </table> | |
| 1322 | |
| 1323 <pre class=alignmentgraphic>Query 1 ACATGAACAGCGCCTTGACCAC 22 | |
| 1324 |||||||||||||| ||||||| | |
| 1325 Subject 1541 ACATGAACAGCGCCCTGACCAC 1562</pre> | |
| 1326 </div> | |
| 1327 | |
| 1328 </div> | |
| 1329 | |
| 1330 </div></div> | |
| 1331 </section> | |
| 1332 </section> | |
| 1333 | |
| 1334 <section class=match id=match7> | |
| 1335 | |
| 114 | 1336 <h2>Nucleotide Sequence (74 letters)</h2> | 
| 106 | 1337 | 
| 1338 <section class=header> | |
| 1339 | |
| 1340 <table class=headerdata> | |
| 114 | 1341 <tr><td class=param>Query number:</td><td>7</td></tr> | 
| 1342 <tr><td class=param>Query ID:</td><td>Query_7</td></tr> | |
| 1343 <tr><td class=param>Definition line:</td><td>Amplicon|QL-ELE-Bt-F1(mod)/Bt-R</td></tr> | |
| 1344 <tr><td class=param>Length:</td><td>74</td></tr> | |
| 106 | 1345 </table> | 
| 1346 | |
| 1347 </section> | |
| 1348 | |
| 1349 | |
| 1350 <section class=graphics> | |
| 114 | 1351 <h3>Graphic Summary</h3> | 
| 106 | 1352 | 
| 1353 <div class=grey> | |
| 114 | 1354 <h4 class=centered>Distribution of 7 Blast Hits on the Query Sequence</h4> | 
| 106 | 1355 | 
| 1356 <div class=defline id=defline7> | |
| 1357 Mouse-over to show defline and scores, click to show alignments | |
| 1358 </div> | |
| 1359 | |
| 1360 <div class=graphic> | |
| 114 | 1361 <h5 class=darkHeader>Color key for alignment scores</h5> | 
| 106 | 1362 <div class=legend><div class=graphicrow> | 
| 1363 <div class=graphicitem style="background-color: black"><40</div> | |
| 1364 <div class=graphicitem style="background-color: blue">40–50</div> | |
| 1365 <div class=graphicitem style="background-color: green">50–80</div> | |
| 1366 <div class=graphicitem style="background-color: magenta">80–200</div> | |
| 118 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 Jan Kanis <jan.code@jankanis.nl> parents: 
115diff
changeset | 1367 <div class=graphicitem style="background-color: red">≥200</div> | 
| 106 | 1368 </div></div> | 
| 1369 <div style="clear: left"></div> | |
| 1370 | |
| 1371 <div class=tablewrapper> | |
| 1372 | |
| 1373 <div class=scale> | |
| 1374 <div>query:</div> | |
| 1375 <div class=graphicrow> | |
| 1376 <div> | |
| 1377 <div class=graphicitem style="width: 10.8108108108%"> | |
| 1378 <div>8</div> | |
| 1379 </div> | |
| 1380 <div class=graphicitem style="width: 10.8108108108%"> | |
| 1381 <div>16</div> | |
| 1382 </div> | |
| 1383 <div class=graphicitem style="width: 10.8108108108%"> | |
| 1384 <div>24</div> | |
| 1385 </div> | |
| 1386 <div class=graphicitem style="width: 10.8108108108%"> | |
| 1387 <div>32</div> | |
| 1388 </div> | |
| 1389 <div class=graphicitem style="width: 10.8108108108%"> | |
| 1390 <div>40</div> | |
| 1391 </div> | |
| 1392 <div class=graphicitem style="width: 10.8108108108%"> | |
| 1393 <div>48</div> | |
| 1394 </div> | |
| 1395 <div class=graphicitem style="width: 10.8108108108%"> | |
| 1396 <div>56</div> | |
| 1397 </div> | |
| 1398 <div class=graphicitem style="width: 10.8108108108%"> | |
| 1399 <div>64</div> | |
| 1400 </div> | |
| 1401 <div class=graphicitem style="width: 10.8108108108%"> | |
| 1402 <div>72</div> | |
| 1403 </div> | |
| 1404 <div class=graphicitem style="width: 2.7027027027%"> | |
| 1405 <div> </div> | |
| 1406 <div class=lastlabel>74</div> | |
| 1407 </div> | |
| 1408 </div> | |
| 1409 </div> | |
| 1410 <div style="clear: left"></div> | |
| 1411 </div> | |
| 1412 | |
| 1413 <a class=matchresult | |
| 1414 href="#hit7-1" | |
| 1415 onmouseover='document.getElementById("defline7").innerHTML="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000"' | |
| 1416 onmouseout='document.getElementById("defline7").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | |
| 1417 title="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000"> | |
| 1418 <div class="matchrow graphicrow"> | |
| 1419 <div class="matchitem graphicitem" | |
| 1420 style="background-color: green; width: 100%"></div> | |
| 1421 </div> | |
| 1422 </a> | |
| 1423 | |
| 1424 <a class=matchresult | |
| 1425 href="#hit7-2" | |
| 1426 onmouseover='document.getElementById("defline7").innerHTML="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000"' | |
| 1427 onmouseout='document.getElementById("defline7").innerHTML="Mouse-over to show defline and scores, click to show alignments"' | |
| 1428 title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000"> | |
| 1429 <div class="matchrow graphicrow"> | |
| 1430 <div class="matchitem graphicitem" | |
| 1431 style="background-color: green; width: 100%"></div> | |
| 1432 </div> | |
| 1433 </a> | |
| 1434 | |
| 1435 </div> | |
| 1436 </div> | |
| 1437 </div> | |
| 1438 </section> | |
| 1439 | |
| 1440 | |
| 1441 | |
| 1442 <section class=descriptions> | |
| 114 | 1443 <h3>Descriptions</h3> | 
| 106 | 1444 | 
| 1445 <div class=grey><div class=white> | |
| 114 | 1446 <h5 class=darkHeader>Sequences producing significant alignments:</h5> | 
| 106 | 1447 | 
| 1448 <table class=descriptiontable> | |
| 1449 <col/><col/><col/><col/><col/><col/><col/> | |
| 1450 <tr> | |
| 1451 <th>Description</th> | |
| 1452 <th>Max score</th> | |
| 1453 <th>Total score</th> | |
| 1454 <th>Query cover</th> | |
| 1455 <th>E value</th> | |
| 1456 <th>Ident</th> | |
| 1457 <th>Accession</th> | |
| 1458 </tr> | |
| 1459 <tr> | |
| 1460 <td><div><a href="#hit7-1" | |
| 1461 title="EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000" | |
| 1462 id="description7-1"> | |
| 1463 EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000 | |
| 1464 </a></div></td> | |
| 1465 <td>67.9</td> | |
| 1466 <td>67.9</td> | |
| 1467 <td>100%</td> | |
| 1468 <td>3.564e-15</td> | |
| 1469 <td>86%</td> | |
| 118 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 Jan Kanis <jan.code@jankanis.nl> parents: 
115diff
changeset | 1470 <td><a target="_top" href="http://example.com/example-genebank/EUG/">7</a></td> | 
| 106 | 1471 </tr> | 
| 1472 <tr> | |
| 1473 <td><div><a href="#hit7-2" | |
| 1474 title="AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000" | |
| 1475 id="description7-2"> | |
| 1476 AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000 | |
| 1477 </a></div></td> | |
| 1478 <td>67.9</td> | |
| 1479 <td>67.9</td> | |
| 1480 <td>100%</td> | |
| 1481 <td>3.564e-15</td> | |
| 1482 <td>86%</td> | |
| 118 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 Jan Kanis <jan.code@jankanis.nl> parents: 
115diff
changeset | 1483 <td><a target="_top" href="http://example.com/example-genebank/AY326434/">6</a></td> | 
| 106 | 1484 </tr> | 
| 1485 </table> | |
| 1486 | |
| 1487 </div></div> | |
| 1488 </section> | |
| 1489 | |
| 1490 | |
| 1491 | |
| 1492 <section class=alignments> | |
| 114 | 1493 <h3>Alignments</h3> | 
| 106 | 1494 | 
| 1495 <div class=grey><div class=white> | |
| 1496 <div class=alignment id=hit7-1> | |
| 1497 | |
| 1498 <div class=linkheader> | |
| 1499 <div class=right><a href="#description7-1">Descriptions</a></div> | |
| 118 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 Jan Kanis <jan.code@jankanis.nl> parents: 
115diff
changeset | 1500 <a class="linkheader" target="_top" href="http://example.com/example-genebank/EUG/">Example Gene Bank</a> | 
| 106 | 1501 </div> | 
| 1502 | |
| 1503 <div class=title> | |
| 1504 <p class=hittitle>EUG|RIKILT|plasmid_pV-ZMBK07|plasmid_pV-ZMBK07|-2635190737607180000</p> | |
| 1505 <p class=titleinfo> | |
| 118 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 Jan Kanis <jan.code@jankanis.nl> parents: 
115diff
changeset | 1506 <span class=b>Sequence ID:</span> <a target="_top" href="http://example.com/example-genebank/EUG/">gnl|BL_ORD_ID|7</a> | 
| 106 | 1507 <span class=b>Length:</span> 4983 | 
| 1508 <span class=b>Number of Matches:</span> 1 | |
| 1509 </p> | |
| 1510 </div> | |
| 1511 | |
| 1512 | |
| 1513 <div class=hotspot id=hotspot7-1-1> | |
| 1514 <p class=range> | |
| 1515 <span class=range>Range 1: 2319 to 2392</span> | |
| 1516 </p> | |
| 1517 | |
| 1518 <table class=hotspotstable> | |
| 1519 <tr> | |
| 1520 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | |
| 1521 </tr> | |
| 1522 <tr> | |
| 118 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 Jan Kanis <jan.code@jankanis.nl> parents: 
115diff
changeset | 1523 <td>67.8929 bits (34)</td> | 
| 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 Jan Kanis <jan.code@jankanis.nl> parents: 
115diff
changeset | 1524 <td>3.56369e-15</td> | 
| 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 Jan Kanis <jan.code@jankanis.nl> parents: 
115diff
changeset | 1525 <td>64/74 (86%)</td> | 
| 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 Jan Kanis <jan.code@jankanis.nl> parents: 
115diff
changeset | 1526 <td>0/74 (0%)</td> | 
| 106 | 1527 <td>Plus/Plus</td> | 
| 1528 </tr> | |
| 1529 </table> | |
| 1530 | |
| 1531 <pre class=alignmentgraphic>Query 1 GAGGAAATGCGTATTCAATTCAACGACATGAACAGCGCCTTGACCACAGCTATCCCATTG 60 | |
| 1532 ||||| ||||| || || ||||||||||||||||||||| ||||||| || |||||| | | |
| 1533 Subject 2319 GAGGAGATGCGCATCCAGTTCAACGACATGAACAGCGCCCTGACCACCGCCATCCCACTC 2378</pre> | |
| 1534 <pre class=alignmentgraphic>Query 61 TTCGCAGTCCAGAA 74 | |
| 1535 ||||| |||||||| | |
| 1536 Subject 2379 TTCGCCGTCCAGAA 2392</pre> | |
| 1537 </div> | |
| 1538 | |
| 1539 </div> | |
| 1540 | |
| 1541 <div class=alignment id=hit7-2> | |
| 1542 | |
| 1543 <div class=linkheader> | |
| 1544 <div class=right><a href="#description7-2">Descriptions</a></div> | |
| 118 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 Jan Kanis <jan.code@jankanis.nl> parents: 
115diff
changeset | 1545 <a class="linkheader" target="_top" href="http://example.com/example-genebank/AY326434/">Example Gene Bank</a> | 
| 106 | 1546 </div> | 
| 1547 | |
| 1548 <div class=title> | |
| 1549 <p class=hittitle>AY326434|GenBank|insert_MON810|Synthetic_construct_truncated_CRYIA(b)_(cryIA(b))_gene,_partial_CDS|-2635190737607180000</p> | |
| 1550 <p class=titleinfo> | |
| 118 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 Jan Kanis <jan.code@jankanis.nl> parents: 
115diff
changeset | 1551 <span class=b>Sequence ID:</span> <a target="_top" href="http://example.com/example-genebank/AY326434/">gnl|BL_ORD_ID|6</a> | 
| 106 | 1552 <span class=b>Length:</span> 4180 | 
| 1553 <span class=b>Number of Matches:</span> 1 | |
| 1554 </p> | |
| 1555 </div> | |
| 1556 | |
| 1557 | |
| 1558 <div class=hotspot id=hotspot7-2-1> | |
| 1559 <p class=range> | |
| 1560 <span class=range>Range 1: 1589 to 1516</span> | |
| 1561 </p> | |
| 1562 | |
| 1563 <table class=hotspotstable> | |
| 1564 <tr> | |
| 1565 <th>Score</th><th>Expect</th><th>Identities</th><th>Gaps</th><th>Strand</th> | |
| 1566 </tr> | |
| 1567 <tr> | |
| 118 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 Jan Kanis <jan.code@jankanis.nl> parents: 
115diff
changeset | 1568 <td>67.8929 bits (34)</td> | 
| 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 Jan Kanis <jan.code@jankanis.nl> parents: 
115diff
changeset | 1569 <td>3.56369e-15</td> | 
| 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 Jan Kanis <jan.code@jankanis.nl> parents: 
115diff
changeset | 1570 <td>64/74 (86%)</td> | 
| 
7f3f8c10f44b
fix for Rikilt issues 8, 11, 12, 14
 Jan Kanis <jan.code@jankanis.nl> parents: 
115diff
changeset | 1571 <td>0/74 (0%)</td> | 
| 106 | 1572 <td>Plus/Minus</td> | 
| 1573 </tr> | |
| 1574 </table> | |
| 1575 | |
| 1576 <pre class=alignmentgraphic>Query 1 GAGGAAATGCGTATTCAATTCAACGACATGAACAGCGCCTTGACCACAGCTATCCCATTG 60 | |
| 1577 ||||| ||||| || || ||||||||||||||||||||| ||||||| || |||||| | | |
| 1578 Subject 1589 GAGGAGATGCGCATCCAGTTCAACGACATGAACAGCGCCCTGACCACCGCCATCCCACTC 1530</pre> | |
| 1579 <pre class=alignmentgraphic>Query 61 TTCGCAGTCCAGAA 74 | |
| 1580 ||||| |||||||| | |
| 1581 Subject 1529 TTCGCCGTCCAGAA 1516</pre> | |
| 1582 </div> | |
| 1583 | |
| 1584 </div> | |
| 1585 | |
| 1586 </div></div> | |
| 1587 </section> | |
| 1588 </section> | |
| 1589 | |
| 1590 </div> | |
| 1591 | |
| 1592 <footer> | |
| 1593 This page was generated by <a href="https://github.com/thehyve/blast2html/">blast2html</a>. | |
| 1594 </footer> | |
| 1595 </body> | |
| 1596 </html> | |
| 1597 | 
