diff test-data/TestSeqGroup-G4.fasta @ 0:269c627ae9f4 draft default tip

planemo upload for repository https://github.com/bernt-matthias/mb-galaxy-tools/tree/master/tools/fasta_regex_finder commit 8e118a4d24047e2c62912b962e854f789d6ff559
author mbernt
date Wed, 20 Jun 2018 11:06:57 -0400
parents
children
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/TestSeqGroup-G4.fasta	Wed Jun 20 11:06:57 2018 -0400
@@ -0,0 +1,56 @@
+>PA#2/8
+ATACCAGCTTATTCAATTAGCAACATGAGGGGGATAGAGGGGGTGGGTTCTCTCGGCTACAATCGTAATCAGTTAG
+>PA#14/89
+ATACCAGCTTATTCAATTGGGCACCACGGGAGTCGGCCACATTTGGAGTTGTTTTTGCACAATCGTAATCAGTTAG
+>PA-C10
+ATACCAGCTTATTCAATTGCGCACCACGGGAGTTGGCCACATTTGGAGTTGTTTTTGCACAATCGTAATCAGTTAG
+>PA#4/22
+ATACCAGCTTATTCAATTGCAGTACTGATGAGTGTAGCCGTATGATTATCGTTTGTGGACAATCGTAATCAGTTAG
+>PA#4/34
+ATACCAGCTTATTCAATTCCCCAACGAGTCGATATGTAGCCCACACTCTGATTCGTCCACAATCGTAATCAGTTAG
+>PA#2/11
+ATACCAGCTTATTCAATTGGAGACGACAAACTATTACGTACTACGGCATGCACTTGGTACAATCGTAATCAGTTAG
+>PA-C8
+ATACCAGCTTATTCAATTAGGCCAGATGAGGGGTGCCCATGGCGGGGTGGCTGCTCCAACAATCGTAATCAGTTAG
+>PA#14/82
+ATACCAGCTTATTCAATTCCACAACCGAACTCGTAAGACGTATGTAGCCGCCAACTGTACAATCGTAATCAGTTAG
+>PA#2/3
+ATACCAGCTTATTCAATTCGACAAGTGGGCATTACGATTCTAGCCCTGATTATGTTCCACAATCGTAATCAGTTAG
+>PA-C9
+ATACCAGCTTATTCAATTACCGAGGAGATAACGTTGTAGCCGTCCATCATCTGATTCGACAATCGTAATCAGTTAG
+>PA#2/6
+ATACCAGCTTATTCAATTACCGATCACTAGCCGACTAATTGGTTTCCGATCGCAGTCCACAATCGTAATCAGTTAG
+>PA-C11
+ATACCAGCTTATTCAATTCGATGGAGCTGATGATTGTTGCCGATCTGACTGTTGTTCCACAATCGTAATCAGTTAG
+>PA-C13
+ATACCAGCTTATTCAATTCCCCTAACGTTACTGGATGTAGTCCGACTAACTTATGCGTACAATCGTAATCAGTTAG
+>PA-C42
+ATACCAGCTTATTCAATTGCAGATTACGCCTTGTAGCCCGCACTGATCTCGATGTTTGGACAATCGTAATCAGTTAG
+>PA-C16
+ATACCAGCTTATTCAATTCCCACGAGTGTAGCCGATTCTTCTGTACTCTTGTCCTCGTACAATCGTAATCAGTTAG
+>PA-C15
+ATACCAGCTTATTCAATTACGTGTTGTAGCCGACCCCTGTTGATTGTTTTCCTGTACCACAATCGTAATCAGTTAG
+>EA#14.3
+ATACCAGCTTATTCAATTTGAGGCGGGTGGGTGGGTTGAATACGCTGATTACCCCATCGGAGAACGTTAAGGCGCTTCAGATAGTAAGTGCAATCT 
+>EA#9.4
+ATACCAGCTTATTCAATTGCTGCGAGGTGGGTGGGTGGGAGCAATTGATCCTCGCTTAGCTTCTACGGTGGGCTATCTAGATAGTAAGTGCAATCT
+>EA#5.10
+ATACCAGCTTATTCAATTCACCACACCTGCACCCCTGACTTCCCACTTATATCTACTACTCCGTCTCAAGCCCGTTTGAGATAGTAAGTGCAATCT
+>EA#14.5
+ATACCAGCTTATTCAATTCCGAGTTTGGGTGGGAGTGGTGGGTTCGGAATTGTTAGTTATTTGGGTTTATGCGAGGTGAGATAGTAAGTGCAATCT
+>EA#14.8
+ATACCAGCTTATTCAATTGACGGGGTGTTGTCGTATGCTGTAGAAGCCGTAATTTTTTTTGTTTTCCCTGCCCACCTAGATAGTAAGTGCAATCT
+>EA#14.4
+ATACCAGCTTATTCAATTCCACAGGTTGTATGGGGAATAAGGTGGGTGCGCGAGATAGTAAGTGCAATCT
+>EA#11.5
+ATACCAGCTTATTCAATTCCCACACCCTAACCGTAGAGCTAAGCTTTTCTTACTACTGACAGTGCTTTACCGTTTGCAAGATAGTAAGTGCAATCT
+>HJ24-Shp2_oncogenicProtein
+AGCGTCGAATACCACACGGGGGTTTTGGTGGGGGGGGCTGGGTTGTCTTGGGGGTGGGCTAATGGAGCTCGTGGTCAT
+>HJ24-Shp2_oncogenicProtein2
+AGCGTCGAATACCACACGGGGGTTTTGGTGGGGGGGGCTGGGTTGTCTTGGGGGTGGGCTAATGGAGCTCGTGGTCAT
+>HJ24-Shp2_oncogenicProtein3
+AGCGTCGAATACCACACGGGGGTTTTGGTGGGGGGGGCTGGGTTGTCTTGGGGGTGGGCTAATGGAGCTCGTGGTCAT
+>RT6-HIVRT
+ATCCGCCTGATTAGCGATACTCAGGCGTTAGGGAAGGGCGTCGAAAGCAGGGTGGGACTTGAGCAAAATCACCTGCAGGGG
+>AptG4-HumanRNaseH1
+CGGTCGCTCCGTGTGGCTTGGGTTGGGTGTGGCAGTGAC