annotate test-data/TestSeqGroup-G4.fasta @ 0:269c627ae9f4 draft default tip

planemo upload for repository https://github.com/bernt-matthias/mb-galaxy-tools/tree/master/tools/fasta_regex_finder commit 8e118a4d24047e2c62912b962e854f789d6ff559
author mbernt
date Wed, 20 Jun 2018 11:06:57 -0400
parents
children
Ignore whitespace changes - Everywhere: Within whitespace: At end of lines:
rev   line source
0
269c627ae9f4 planemo upload for repository https://github.com/bernt-matthias/mb-galaxy-tools/tree/master/tools/fasta_regex_finder commit 8e118a4d24047e2c62912b962e854f789d6ff559
mbernt
parents:
diff changeset
1 >PA#2/8
269c627ae9f4 planemo upload for repository https://github.com/bernt-matthias/mb-galaxy-tools/tree/master/tools/fasta_regex_finder commit 8e118a4d24047e2c62912b962e854f789d6ff559
mbernt
parents:
diff changeset
2 ATACCAGCTTATTCAATTAGCAACATGAGGGGGATAGAGGGGGTGGGTTCTCTCGGCTACAATCGTAATCAGTTAG
269c627ae9f4 planemo upload for repository https://github.com/bernt-matthias/mb-galaxy-tools/tree/master/tools/fasta_regex_finder commit 8e118a4d24047e2c62912b962e854f789d6ff559
mbernt
parents:
diff changeset
3 >PA#14/89
269c627ae9f4 planemo upload for repository https://github.com/bernt-matthias/mb-galaxy-tools/tree/master/tools/fasta_regex_finder commit 8e118a4d24047e2c62912b962e854f789d6ff559
mbernt
parents:
diff changeset
4 ATACCAGCTTATTCAATTGGGCACCACGGGAGTCGGCCACATTTGGAGTTGTTTTTGCACAATCGTAATCAGTTAG
269c627ae9f4 planemo upload for repository https://github.com/bernt-matthias/mb-galaxy-tools/tree/master/tools/fasta_regex_finder commit 8e118a4d24047e2c62912b962e854f789d6ff559
mbernt
parents:
diff changeset
5 >PA-C10
269c627ae9f4 planemo upload for repository https://github.com/bernt-matthias/mb-galaxy-tools/tree/master/tools/fasta_regex_finder commit 8e118a4d24047e2c62912b962e854f789d6ff559
mbernt
parents:
diff changeset
6 ATACCAGCTTATTCAATTGCGCACCACGGGAGTTGGCCACATTTGGAGTTGTTTTTGCACAATCGTAATCAGTTAG
269c627ae9f4 planemo upload for repository https://github.com/bernt-matthias/mb-galaxy-tools/tree/master/tools/fasta_regex_finder commit 8e118a4d24047e2c62912b962e854f789d6ff559
mbernt
parents:
diff changeset
7 >PA#4/22
269c627ae9f4 planemo upload for repository https://github.com/bernt-matthias/mb-galaxy-tools/tree/master/tools/fasta_regex_finder commit 8e118a4d24047e2c62912b962e854f789d6ff559
mbernt
parents:
diff changeset
8 ATACCAGCTTATTCAATTGCAGTACTGATGAGTGTAGCCGTATGATTATCGTTTGTGGACAATCGTAATCAGTTAG
269c627ae9f4 planemo upload for repository https://github.com/bernt-matthias/mb-galaxy-tools/tree/master/tools/fasta_regex_finder commit 8e118a4d24047e2c62912b962e854f789d6ff559
mbernt
parents:
diff changeset
9 >PA#4/34
269c627ae9f4 planemo upload for repository https://github.com/bernt-matthias/mb-galaxy-tools/tree/master/tools/fasta_regex_finder commit 8e118a4d24047e2c62912b962e854f789d6ff559
mbernt
parents:
diff changeset
10 ATACCAGCTTATTCAATTCCCCAACGAGTCGATATGTAGCCCACACTCTGATTCGTCCACAATCGTAATCAGTTAG
269c627ae9f4 planemo upload for repository https://github.com/bernt-matthias/mb-galaxy-tools/tree/master/tools/fasta_regex_finder commit 8e118a4d24047e2c62912b962e854f789d6ff559
mbernt
parents:
diff changeset
11 >PA#2/11
269c627ae9f4 planemo upload for repository https://github.com/bernt-matthias/mb-galaxy-tools/tree/master/tools/fasta_regex_finder commit 8e118a4d24047e2c62912b962e854f789d6ff559
mbernt
parents:
diff changeset
12 ATACCAGCTTATTCAATTGGAGACGACAAACTATTACGTACTACGGCATGCACTTGGTACAATCGTAATCAGTTAG
269c627ae9f4 planemo upload for repository https://github.com/bernt-matthias/mb-galaxy-tools/tree/master/tools/fasta_regex_finder commit 8e118a4d24047e2c62912b962e854f789d6ff559
mbernt
parents:
diff changeset
13 >PA-C8
269c627ae9f4 planemo upload for repository https://github.com/bernt-matthias/mb-galaxy-tools/tree/master/tools/fasta_regex_finder commit 8e118a4d24047e2c62912b962e854f789d6ff559
mbernt
parents:
diff changeset
14 ATACCAGCTTATTCAATTAGGCCAGATGAGGGGTGCCCATGGCGGGGTGGCTGCTCCAACAATCGTAATCAGTTAG
269c627ae9f4 planemo upload for repository https://github.com/bernt-matthias/mb-galaxy-tools/tree/master/tools/fasta_regex_finder commit 8e118a4d24047e2c62912b962e854f789d6ff559
mbernt
parents:
diff changeset
15 >PA#14/82
269c627ae9f4 planemo upload for repository https://github.com/bernt-matthias/mb-galaxy-tools/tree/master/tools/fasta_regex_finder commit 8e118a4d24047e2c62912b962e854f789d6ff559
mbernt
parents:
diff changeset
16 ATACCAGCTTATTCAATTCCACAACCGAACTCGTAAGACGTATGTAGCCGCCAACTGTACAATCGTAATCAGTTAG
269c627ae9f4 planemo upload for repository https://github.com/bernt-matthias/mb-galaxy-tools/tree/master/tools/fasta_regex_finder commit 8e118a4d24047e2c62912b962e854f789d6ff559
mbernt
parents:
diff changeset
17 >PA#2/3
269c627ae9f4 planemo upload for repository https://github.com/bernt-matthias/mb-galaxy-tools/tree/master/tools/fasta_regex_finder commit 8e118a4d24047e2c62912b962e854f789d6ff559
mbernt
parents:
diff changeset
18 ATACCAGCTTATTCAATTCGACAAGTGGGCATTACGATTCTAGCCCTGATTATGTTCCACAATCGTAATCAGTTAG
269c627ae9f4 planemo upload for repository https://github.com/bernt-matthias/mb-galaxy-tools/tree/master/tools/fasta_regex_finder commit 8e118a4d24047e2c62912b962e854f789d6ff559
mbernt
parents:
diff changeset
19 >PA-C9
269c627ae9f4 planemo upload for repository https://github.com/bernt-matthias/mb-galaxy-tools/tree/master/tools/fasta_regex_finder commit 8e118a4d24047e2c62912b962e854f789d6ff559
mbernt
parents:
diff changeset
20 ATACCAGCTTATTCAATTACCGAGGAGATAACGTTGTAGCCGTCCATCATCTGATTCGACAATCGTAATCAGTTAG
269c627ae9f4 planemo upload for repository https://github.com/bernt-matthias/mb-galaxy-tools/tree/master/tools/fasta_regex_finder commit 8e118a4d24047e2c62912b962e854f789d6ff559
mbernt
parents:
diff changeset
21 >PA#2/6
269c627ae9f4 planemo upload for repository https://github.com/bernt-matthias/mb-galaxy-tools/tree/master/tools/fasta_regex_finder commit 8e118a4d24047e2c62912b962e854f789d6ff559
mbernt
parents:
diff changeset
22 ATACCAGCTTATTCAATTACCGATCACTAGCCGACTAATTGGTTTCCGATCGCAGTCCACAATCGTAATCAGTTAG
269c627ae9f4 planemo upload for repository https://github.com/bernt-matthias/mb-galaxy-tools/tree/master/tools/fasta_regex_finder commit 8e118a4d24047e2c62912b962e854f789d6ff559
mbernt
parents:
diff changeset
23 >PA-C11
269c627ae9f4 planemo upload for repository https://github.com/bernt-matthias/mb-galaxy-tools/tree/master/tools/fasta_regex_finder commit 8e118a4d24047e2c62912b962e854f789d6ff559
mbernt
parents:
diff changeset
24 ATACCAGCTTATTCAATTCGATGGAGCTGATGATTGTTGCCGATCTGACTGTTGTTCCACAATCGTAATCAGTTAG
269c627ae9f4 planemo upload for repository https://github.com/bernt-matthias/mb-galaxy-tools/tree/master/tools/fasta_regex_finder commit 8e118a4d24047e2c62912b962e854f789d6ff559
mbernt
parents:
diff changeset
25 >PA-C13
269c627ae9f4 planemo upload for repository https://github.com/bernt-matthias/mb-galaxy-tools/tree/master/tools/fasta_regex_finder commit 8e118a4d24047e2c62912b962e854f789d6ff559
mbernt
parents:
diff changeset
26 ATACCAGCTTATTCAATTCCCCTAACGTTACTGGATGTAGTCCGACTAACTTATGCGTACAATCGTAATCAGTTAG
269c627ae9f4 planemo upload for repository https://github.com/bernt-matthias/mb-galaxy-tools/tree/master/tools/fasta_regex_finder commit 8e118a4d24047e2c62912b962e854f789d6ff559
mbernt
parents:
diff changeset
27 >PA-C42
269c627ae9f4 planemo upload for repository https://github.com/bernt-matthias/mb-galaxy-tools/tree/master/tools/fasta_regex_finder commit 8e118a4d24047e2c62912b962e854f789d6ff559
mbernt
parents:
diff changeset
28 ATACCAGCTTATTCAATTGCAGATTACGCCTTGTAGCCCGCACTGATCTCGATGTTTGGACAATCGTAATCAGTTAG
269c627ae9f4 planemo upload for repository https://github.com/bernt-matthias/mb-galaxy-tools/tree/master/tools/fasta_regex_finder commit 8e118a4d24047e2c62912b962e854f789d6ff559
mbernt
parents:
diff changeset
29 >PA-C16
269c627ae9f4 planemo upload for repository https://github.com/bernt-matthias/mb-galaxy-tools/tree/master/tools/fasta_regex_finder commit 8e118a4d24047e2c62912b962e854f789d6ff559
mbernt
parents:
diff changeset
30 ATACCAGCTTATTCAATTCCCACGAGTGTAGCCGATTCTTCTGTACTCTTGTCCTCGTACAATCGTAATCAGTTAG
269c627ae9f4 planemo upload for repository https://github.com/bernt-matthias/mb-galaxy-tools/tree/master/tools/fasta_regex_finder commit 8e118a4d24047e2c62912b962e854f789d6ff559
mbernt
parents:
diff changeset
31 >PA-C15
269c627ae9f4 planemo upload for repository https://github.com/bernt-matthias/mb-galaxy-tools/tree/master/tools/fasta_regex_finder commit 8e118a4d24047e2c62912b962e854f789d6ff559
mbernt
parents:
diff changeset
32 ATACCAGCTTATTCAATTACGTGTTGTAGCCGACCCCTGTTGATTGTTTTCCTGTACCACAATCGTAATCAGTTAG
269c627ae9f4 planemo upload for repository https://github.com/bernt-matthias/mb-galaxy-tools/tree/master/tools/fasta_regex_finder commit 8e118a4d24047e2c62912b962e854f789d6ff559
mbernt
parents:
diff changeset
33 >EA#14.3
269c627ae9f4 planemo upload for repository https://github.com/bernt-matthias/mb-galaxy-tools/tree/master/tools/fasta_regex_finder commit 8e118a4d24047e2c62912b962e854f789d6ff559
mbernt
parents:
diff changeset
34 ATACCAGCTTATTCAATTTGAGGCGGGTGGGTGGGTTGAATACGCTGATTACCCCATCGGAGAACGTTAAGGCGCTTCAGATAGTAAGTGCAATCT
269c627ae9f4 planemo upload for repository https://github.com/bernt-matthias/mb-galaxy-tools/tree/master/tools/fasta_regex_finder commit 8e118a4d24047e2c62912b962e854f789d6ff559
mbernt
parents:
diff changeset
35 >EA#9.4
269c627ae9f4 planemo upload for repository https://github.com/bernt-matthias/mb-galaxy-tools/tree/master/tools/fasta_regex_finder commit 8e118a4d24047e2c62912b962e854f789d6ff559
mbernt
parents:
diff changeset
36 ATACCAGCTTATTCAATTGCTGCGAGGTGGGTGGGTGGGAGCAATTGATCCTCGCTTAGCTTCTACGGTGGGCTATCTAGATAGTAAGTGCAATCT
269c627ae9f4 planemo upload for repository https://github.com/bernt-matthias/mb-galaxy-tools/tree/master/tools/fasta_regex_finder commit 8e118a4d24047e2c62912b962e854f789d6ff559
mbernt
parents:
diff changeset
37 >EA#5.10
269c627ae9f4 planemo upload for repository https://github.com/bernt-matthias/mb-galaxy-tools/tree/master/tools/fasta_regex_finder commit 8e118a4d24047e2c62912b962e854f789d6ff559
mbernt
parents:
diff changeset
38 ATACCAGCTTATTCAATTCACCACACCTGCACCCCTGACTTCCCACTTATATCTACTACTCCGTCTCAAGCCCGTTTGAGATAGTAAGTGCAATCT
269c627ae9f4 planemo upload for repository https://github.com/bernt-matthias/mb-galaxy-tools/tree/master/tools/fasta_regex_finder commit 8e118a4d24047e2c62912b962e854f789d6ff559
mbernt
parents:
diff changeset
39 >EA#14.5
269c627ae9f4 planemo upload for repository https://github.com/bernt-matthias/mb-galaxy-tools/tree/master/tools/fasta_regex_finder commit 8e118a4d24047e2c62912b962e854f789d6ff559
mbernt
parents:
diff changeset
40 ATACCAGCTTATTCAATTCCGAGTTTGGGTGGGAGTGGTGGGTTCGGAATTGTTAGTTATTTGGGTTTATGCGAGGTGAGATAGTAAGTGCAATCT
269c627ae9f4 planemo upload for repository https://github.com/bernt-matthias/mb-galaxy-tools/tree/master/tools/fasta_regex_finder commit 8e118a4d24047e2c62912b962e854f789d6ff559
mbernt
parents:
diff changeset
41 >EA#14.8
269c627ae9f4 planemo upload for repository https://github.com/bernt-matthias/mb-galaxy-tools/tree/master/tools/fasta_regex_finder commit 8e118a4d24047e2c62912b962e854f789d6ff559
mbernt
parents:
diff changeset
42 ATACCAGCTTATTCAATTGACGGGGTGTTGTCGTATGCTGTAGAAGCCGTAATTTTTTTTGTTTTCCCTGCCCACCTAGATAGTAAGTGCAATCT
269c627ae9f4 planemo upload for repository https://github.com/bernt-matthias/mb-galaxy-tools/tree/master/tools/fasta_regex_finder commit 8e118a4d24047e2c62912b962e854f789d6ff559
mbernt
parents:
diff changeset
43 >EA#14.4
269c627ae9f4 planemo upload for repository https://github.com/bernt-matthias/mb-galaxy-tools/tree/master/tools/fasta_regex_finder commit 8e118a4d24047e2c62912b962e854f789d6ff559
mbernt
parents:
diff changeset
44 ATACCAGCTTATTCAATTCCACAGGTTGTATGGGGAATAAGGTGGGTGCGCGAGATAGTAAGTGCAATCT
269c627ae9f4 planemo upload for repository https://github.com/bernt-matthias/mb-galaxy-tools/tree/master/tools/fasta_regex_finder commit 8e118a4d24047e2c62912b962e854f789d6ff559
mbernt
parents:
diff changeset
45 >EA#11.5
269c627ae9f4 planemo upload for repository https://github.com/bernt-matthias/mb-galaxy-tools/tree/master/tools/fasta_regex_finder commit 8e118a4d24047e2c62912b962e854f789d6ff559
mbernt
parents:
diff changeset
46 ATACCAGCTTATTCAATTCCCACACCCTAACCGTAGAGCTAAGCTTTTCTTACTACTGACAGTGCTTTACCGTTTGCAAGATAGTAAGTGCAATCT
269c627ae9f4 planemo upload for repository https://github.com/bernt-matthias/mb-galaxy-tools/tree/master/tools/fasta_regex_finder commit 8e118a4d24047e2c62912b962e854f789d6ff559
mbernt
parents:
diff changeset
47 >HJ24-Shp2_oncogenicProtein
269c627ae9f4 planemo upload for repository https://github.com/bernt-matthias/mb-galaxy-tools/tree/master/tools/fasta_regex_finder commit 8e118a4d24047e2c62912b962e854f789d6ff559
mbernt
parents:
diff changeset
48 AGCGTCGAATACCACACGGGGGTTTTGGTGGGGGGGGCTGGGTTGTCTTGGGGGTGGGCTAATGGAGCTCGTGGTCAT
269c627ae9f4 planemo upload for repository https://github.com/bernt-matthias/mb-galaxy-tools/tree/master/tools/fasta_regex_finder commit 8e118a4d24047e2c62912b962e854f789d6ff559
mbernt
parents:
diff changeset
49 >HJ24-Shp2_oncogenicProtein2
269c627ae9f4 planemo upload for repository https://github.com/bernt-matthias/mb-galaxy-tools/tree/master/tools/fasta_regex_finder commit 8e118a4d24047e2c62912b962e854f789d6ff559
mbernt
parents:
diff changeset
50 AGCGTCGAATACCACACGGGGGTTTTGGTGGGGGGGGCTGGGTTGTCTTGGGGGTGGGCTAATGGAGCTCGTGGTCAT
269c627ae9f4 planemo upload for repository https://github.com/bernt-matthias/mb-galaxy-tools/tree/master/tools/fasta_regex_finder commit 8e118a4d24047e2c62912b962e854f789d6ff559
mbernt
parents:
diff changeset
51 >HJ24-Shp2_oncogenicProtein3
269c627ae9f4 planemo upload for repository https://github.com/bernt-matthias/mb-galaxy-tools/tree/master/tools/fasta_regex_finder commit 8e118a4d24047e2c62912b962e854f789d6ff559
mbernt
parents:
diff changeset
52 AGCGTCGAATACCACACGGGGGTTTTGGTGGGGGGGGCTGGGTTGTCTTGGGGGTGGGCTAATGGAGCTCGTGGTCAT
269c627ae9f4 planemo upload for repository https://github.com/bernt-matthias/mb-galaxy-tools/tree/master/tools/fasta_regex_finder commit 8e118a4d24047e2c62912b962e854f789d6ff559
mbernt
parents:
diff changeset
53 >RT6-HIVRT
269c627ae9f4 planemo upload for repository https://github.com/bernt-matthias/mb-galaxy-tools/tree/master/tools/fasta_regex_finder commit 8e118a4d24047e2c62912b962e854f789d6ff559
mbernt
parents:
diff changeset
54 ATCCGCCTGATTAGCGATACTCAGGCGTTAGGGAAGGGCGTCGAAAGCAGGGTGGGACTTGAGCAAAATCACCTGCAGGGG
269c627ae9f4 planemo upload for repository https://github.com/bernt-matthias/mb-galaxy-tools/tree/master/tools/fasta_regex_finder commit 8e118a4d24047e2c62912b962e854f789d6ff559
mbernt
parents:
diff changeset
55 >AptG4-HumanRNaseH1
269c627ae9f4 planemo upload for repository https://github.com/bernt-matthias/mb-galaxy-tools/tree/master/tools/fasta_regex_finder commit 8e118a4d24047e2c62912b962e854f789d6ff559
mbernt
parents:
diff changeset
56 CGGTCGCTCCGTGTGGCTTGGGTTGGGTGTGGCAGTGAC