view test-data/TestSeqGroup-G4.fasta @ 0:269c627ae9f4 draft default tip

planemo upload for repository https://github.com/bernt-matthias/mb-galaxy-tools/tree/master/tools/fasta_regex_finder commit 8e118a4d24047e2c62912b962e854f789d6ff559
author mbernt
date Wed, 20 Jun 2018 11:06:57 -0400
parents
children
line wrap: on
line source

>PA#2/8
ATACCAGCTTATTCAATTAGCAACATGAGGGGGATAGAGGGGGTGGGTTCTCTCGGCTACAATCGTAATCAGTTAG
>PA#14/89
ATACCAGCTTATTCAATTGGGCACCACGGGAGTCGGCCACATTTGGAGTTGTTTTTGCACAATCGTAATCAGTTAG
>PA-C10
ATACCAGCTTATTCAATTGCGCACCACGGGAGTTGGCCACATTTGGAGTTGTTTTTGCACAATCGTAATCAGTTAG
>PA#4/22
ATACCAGCTTATTCAATTGCAGTACTGATGAGTGTAGCCGTATGATTATCGTTTGTGGACAATCGTAATCAGTTAG
>PA#4/34
ATACCAGCTTATTCAATTCCCCAACGAGTCGATATGTAGCCCACACTCTGATTCGTCCACAATCGTAATCAGTTAG
>PA#2/11
ATACCAGCTTATTCAATTGGAGACGACAAACTATTACGTACTACGGCATGCACTTGGTACAATCGTAATCAGTTAG
>PA-C8
ATACCAGCTTATTCAATTAGGCCAGATGAGGGGTGCCCATGGCGGGGTGGCTGCTCCAACAATCGTAATCAGTTAG
>PA#14/82
ATACCAGCTTATTCAATTCCACAACCGAACTCGTAAGACGTATGTAGCCGCCAACTGTACAATCGTAATCAGTTAG
>PA#2/3
ATACCAGCTTATTCAATTCGACAAGTGGGCATTACGATTCTAGCCCTGATTATGTTCCACAATCGTAATCAGTTAG
>PA-C9
ATACCAGCTTATTCAATTACCGAGGAGATAACGTTGTAGCCGTCCATCATCTGATTCGACAATCGTAATCAGTTAG
>PA#2/6
ATACCAGCTTATTCAATTACCGATCACTAGCCGACTAATTGGTTTCCGATCGCAGTCCACAATCGTAATCAGTTAG
>PA-C11
ATACCAGCTTATTCAATTCGATGGAGCTGATGATTGTTGCCGATCTGACTGTTGTTCCACAATCGTAATCAGTTAG
>PA-C13
ATACCAGCTTATTCAATTCCCCTAACGTTACTGGATGTAGTCCGACTAACTTATGCGTACAATCGTAATCAGTTAG
>PA-C42
ATACCAGCTTATTCAATTGCAGATTACGCCTTGTAGCCCGCACTGATCTCGATGTTTGGACAATCGTAATCAGTTAG
>PA-C16
ATACCAGCTTATTCAATTCCCACGAGTGTAGCCGATTCTTCTGTACTCTTGTCCTCGTACAATCGTAATCAGTTAG
>PA-C15
ATACCAGCTTATTCAATTACGTGTTGTAGCCGACCCCTGTTGATTGTTTTCCTGTACCACAATCGTAATCAGTTAG
>EA#14.3
ATACCAGCTTATTCAATTTGAGGCGGGTGGGTGGGTTGAATACGCTGATTACCCCATCGGAGAACGTTAAGGCGCTTCAGATAGTAAGTGCAATCT 
>EA#9.4
ATACCAGCTTATTCAATTGCTGCGAGGTGGGTGGGTGGGAGCAATTGATCCTCGCTTAGCTTCTACGGTGGGCTATCTAGATAGTAAGTGCAATCT
>EA#5.10
ATACCAGCTTATTCAATTCACCACACCTGCACCCCTGACTTCCCACTTATATCTACTACTCCGTCTCAAGCCCGTTTGAGATAGTAAGTGCAATCT
>EA#14.5
ATACCAGCTTATTCAATTCCGAGTTTGGGTGGGAGTGGTGGGTTCGGAATTGTTAGTTATTTGGGTTTATGCGAGGTGAGATAGTAAGTGCAATCT
>EA#14.8
ATACCAGCTTATTCAATTGACGGGGTGTTGTCGTATGCTGTAGAAGCCGTAATTTTTTTTGTTTTCCCTGCCCACCTAGATAGTAAGTGCAATCT
>EA#14.4
ATACCAGCTTATTCAATTCCACAGGTTGTATGGGGAATAAGGTGGGTGCGCGAGATAGTAAGTGCAATCT
>EA#11.5
ATACCAGCTTATTCAATTCCCACACCCTAACCGTAGAGCTAAGCTTTTCTTACTACTGACAGTGCTTTACCGTTTGCAAGATAGTAAGTGCAATCT
>HJ24-Shp2_oncogenicProtein
AGCGTCGAATACCACACGGGGGTTTTGGTGGGGGGGGCTGGGTTGTCTTGGGGGTGGGCTAATGGAGCTCGTGGTCAT
>HJ24-Shp2_oncogenicProtein2
AGCGTCGAATACCACACGGGGGTTTTGGTGGGGGGGGCTGGGTTGTCTTGGGGGTGGGCTAATGGAGCTCGTGGTCAT
>HJ24-Shp2_oncogenicProtein3
AGCGTCGAATACCACACGGGGGTTTTGGTGGGGGGGGCTGGGTTGTCTTGGGGGTGGGCTAATGGAGCTCGTGGTCAT
>RT6-HIVRT
ATCCGCCTGATTAGCGATACTCAGGCGTTAGGGAAGGGCGTCGAAAGCAGGGTGGGACTTGAGCAAAATCACCTGCAGGGG
>AptG4-HumanRNaseH1
CGGTCGCTCCGTGTGGCTTGGGTTGGGTGTGGCAGTGAC