changeset 0:90957420cc07 draft

planemo upload for repository https://github.com/phac-nml/galaxy_tools/ commit 8ea19b9db8a5d861466adf3bf4e01928d3d1ca38
author nml
date Thu, 12 Oct 2017 15:04:45 -0400
parents
children 0e3d2c8b1b23
files filter_spades_repeats.pl filter_spades_repeats.xml test-data/Discarded_sequences.fasta test-data/Filtered_sequences_(no_repeats).fasta test-data/Filtered_sequences_(with_repeats).fasta test-data/Repeat_sequences.fasta test-data/Results_summary.txt test-data/SPAdes_scaffold_stats.tabular test-data/SPAdes_scaffolds_(fasta).fasta
diffstat 9 files changed, 236791 insertions(+), 0 deletions(-) [+]
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/filter_spades_repeats.pl	Thu Oct 12 15:04:45 2017 -0400
@@ -0,0 +1,313 @@
+#!/usr/bin/env perl
+
+use strict;
+use Getopt::Long;
+use Bio::SeqIO;
+use Pod::Usage;
+
+my ($fasta_file, $tab_file, $coverage_co, $length_co, $repeat_co, $out_filtered, $out_repeats, $out_norepeats,$coverage_length_co, $summary_out, $filtered_repeats, $help);
+
+GetOptions(
+	'c|coverage-cutoff=s'	       => \$coverage_co,
+	'l|length-cutoff=s'	       => \$length_co,
+        'e|coverage-length-cutoff=s'   => \$coverage_length_co,
+	'r|repeat_cutoff=s'	       => \$repeat_co, 
+	'i|input=s'		       => \$fasta_file,
+	't|tab=s'		       => \$tab_file,
+	'f|filtered-out=s'	       => \$out_filtered,
+	'o|output-repeats=s'	       => \$out_repeats,
+	'u|output-norepeats=s'	       => \$out_norepeats,
+        'n|filtered-repeats=s'         => \$filtered_repeats,
+        's|summary=s'                  => \$summary_out,
+	'h|help'		       => \$help
+);
+
+pod2usage(-verbose => 2) if ($help);
+print "A fasta file is required. Please enter a fasta file using the -i flag.\n" if (!$fasta_file);
+print "A spades tabs file is required. Please enter a tabs file using the -t flag\n" if (!$tab_file);
+pod2usage(1) unless $fasta_file && $tab_file;
+
+if (!$coverage_co)
+{
+   $coverage_co = 0.33;
+}
+if (!$length_co)
+{
+   $length_co = 1000;
+}
+if (!$coverage_length_co)
+{
+   $coverage_length_co = 5000;
+}
+if (!$repeat_co)
+{
+   $repeat_co = 1.75;
+}
+if (!$out_filtered)
+{
+   $out_filtered = "Discarded_sequences.fasta";
+   print "Discarded sequences will be printed out to $out_filtered\n";
+}
+if (!$out_repeats)
+{
+   $out_repeats = "Filtered_sequences_with_repeats.fasta";
+   print "Filtered sequences with repeats will be printed out to $out_repeats\n";
+}
+if (!$out_norepeats)
+{
+   $out_norepeats = "Filtered_sequences_no_repeats.fasta";
+   print "Filtered sequences without repeats will be printed out to $out_norepeats\n";
+}
+if (!$filtered_repeats)
+{
+   $filtered_repeats = "Repeat_sequences.fasta";
+   print "Repeat sequences will be printed out to $filtered_repeats\n";
+}
+
+die ("No tab file specified") unless ($tab_file);
+die ("No fasta file specified") unless ($fasta_file);
+
+##Read tab file and discard rows with comments
+open TAB, '<', $tab_file or die "Could not open tab file: $?";
+open SEQIN, '<', $fasta_file or die "Could not open tab file: $?";
+open SEQOUT_REP, '>', $out_repeats or die "Could not open file for writing: $?";
+open SEQOUT_NOREP, '>', $out_norepeats or die "Could not open file for writing: $?";
+open SEQOUT_FILT, '>', $out_filtered if ($out_filtered);
+open SEQOUT_FILT_REP, '>', $filtered_repeats or die "Could not open file for writing: $?";
+open SUMMARY, '>', $summary_out if ($summary_out);
+
+
+my $avg_coverage = 0;
+my $num_contigs = 0;
+my $cutoff_coverage;
+my $cutoff_repeats;
+my @stats;
+
+
+while (<TAB>)
+{
+	chomp;
+	push @stats, $_ unless (/^#/);
+}
+
+#Calculate average coverage.
+foreach my $stat(@stats)
+{
+	my ($length, $coverage);
+	(undef,$length, $coverage) = split(/\t+/, $stat);
+        die "length or coverage not defined at $stat\n" unless ($length && ($coverage ne '' && $coverage >= 0));
+	if ($length >= $coverage_length_co)
+	{
+		$avg_coverage = $avg_coverage + $coverage;
+		$num_contigs++;
+	}
+}
+
+$avg_coverage = $avg_coverage / $num_contigs;
+$cutoff_coverage = $avg_coverage * $coverage_co;
+$cutoff_repeats = $avg_coverage * $repeat_co;
+
+print SUMMARY "Filter SPAdes repeats Results Summary\n======================================\n\n" if ($summary_out);
+print SUMMARY "Paramaters used:\nLength cutoff for calcularing average cutoff: $coverage_length_co\nCoverage cutoff ratio: $coverage_co\nRepeat cutoff ratio: $repeat_co\nLength cutoff: $length_co\n\n" if ($summary_out);
+
+print SUMMARY "Calculations:\nAverage coverage: $avg_coverage\nCoverage cutoff: $cutoff_coverage\nRepeat cutoff: $cutoff_repeats\n\nFile headers:\n" if ($summary_out);
+
+my ($header, $seq_id, $seq); 
+my $repeated = 0;
+my $valid = 0;
+
+#Summary strings:
+my $discarded = "";
+my $repeats = "";
+my $filtered_rep = "";
+my $filtered_norep = "";
+
+while (my $line = <SEQIN>)
+{
+	if ($line =~ />/)
+	{
+		chomp $line;
+                #Get the sequence name to compare against tab file
+		$header = $line;
+		$seq_id = $line =~ /(\w+)_length/;
+		$seq = "";
+	
+		my $stat = shift @stats;
+		die "Less rows in tab than sequences in seq file" unless $stat;
+		my($name, $length, $coverage) = split(/\t+/, $stat);
+		die "name or length not defined at $stat\n" unless ($name && $length);
+                die "coverage is not defined at $stat\n" unless ($coverage ne '' && $coverage >= 0);
+		die "Unmatched names $header and $name\n" unless ($header =~ /$name/i);
+
+               #Entry passes the length and coverage cutoffs?
+		if ($length >= $length_co && $coverage >= $cutoff_coverage)
+		{
+			$valid = 1;
+			#Repeats
+			if ($coverage >= $cutoff_repeats)
+			{
+				my $num_repeats = int($coverage/$avg_coverage);
+				$header = $header."(".$num_repeats." copies)";
+				print SEQOUT_REP $header,"\n";
+                                $filtered_rep = $filtered_rep.$header."\n";
+                                print SEQOUT_FILT_REP $header, "\n";
+                                $repeats = $repeats.$header."\n";
+				$repeated = 1;
+			}
+			else
+			{
+				print SEQOUT_REP $header, "\n";
+                                $filtered_rep = $filtered_rep.$header."\n";
+				print SEQOUT_NOREP $header, "\n";
+                                $filtered_norep = $filtered_norep.$header."\n";
+				$repeated = 0;
+			}
+		}
+		elsif ($out_filtered)
+		{
+			$valid = 0;
+			print SEQOUT_FILT $header,"\n";
+                        $discarded = $discarded.$header."\n";
+		}
+	}
+	else
+	{
+		if ($valid)
+		{
+			print SEQOUT_REP $line;
+			if (!$repeated)
+			{
+				print SEQOUT_NOREP $line;
+			}
+                        else
+                        {
+                              print SEQOUT_FILT_REP $line;
+                        }
+		}
+		elsif ($out_filtered)
+		{
+			print SEQOUT_FILT $line;
+		}
+	}
+	
+}
+
+close TAB;
+close SEQIN;
+close SEQOUT_REP;
+close SEQOUT_NOREP;
+close SEQOUT_FILT;
+close SEQOUT_FILT_REP;
+
+
+#Get summary info:
+if ($summary_out)
+{
+   print SUMMARY "Filtered sequences (with repeats):\n$filtered_rep\n";
+   print SUMMARY "Filtered sequences (no repeats):\n$filtered_norep\n";
+   print SUMMARY "Repeat sequences:\n$repeats\n";
+   if ($out_filtered)
+   {
+      print SUMMARY "Discarded sequences:\n$discarded\n"; 
+   }
+
+   close SUMMARY;
+}
+
+die "More rows in stats file than sequences in the fasta file\n" if (scalar(@stats) > 0);
+exit 0;
+
+
+__END__
+
+
+
+=head1 NAME
+
+	filter_spades_repeats.pl - Filters contigs or scaffolds based on contig length and detects contigs/scaffolds with very high coverage.
+
+
+
+=head1 USAGE
+
+	filter_spades_output.pl -i <contigs/scaffolds input>
+                                -t <stats input>
+                                -o <output fasta with repeats>
+                                -u <output fasta without repeats>
+                                
+                                Optional:
+                                -c <coverage cutoff ratio> (default 0.33) 
+				-l <length cutoff> (default: 1000)
+                                -e <length cutoff for average coverage calculation> (default: 5000)
+				-r <repeat cutoff ratio> (default (1.75)
+                                -n <filtered repeated sequences>
+                                -f <discarded sequences>
+                                -s <output summary file>
+
+                                For more information:
+                                -h
+
+
+=head1 INPUT
+
+=over 8
+
+=item B<-i>B<--input>
+
+Contigs/Scaffolds fasta file.
+
+=item B<-t>B<--tab>
+
+The tabular output file from SPAdes. This file should have the following format:
+
+      #name length   coverage
+
+      NODE_1   31438 24.5116
+      
+      NODE_2   31354 2316.96
+
+      NODE_3   26948 82.3294
+
+=item B<-o>B<--output-repeats>
+
+Output fasta file including the contigs marked as repeated.
+
+=item B<-u>B<--output-norepeats>
+
+Output fasta file excluding the contigs marked as repeated.
+
+=item B<-c>B<--coverage-cutoff>
+
+Mininum coverage ratio. 
+
+	coverage_theshold = average_coverage * minimum_coverage_ratio.
+
+Any contigs/scaffolds with coverage below the coverage_theshold will be eliminated.
+
+=item B<-l>B<--length-cutoff>
+
+Mininum length. Contigs below this length will be eliminated.
+
+=item B<-e>B<--coverage-length-cutoff>
+
+Minimum length to use for average coverage calculations.
+
+=item B<-r>B<--repeat-cutoff>
+
+Minimum repeats ratio. 
+
+	repeat_threshold = average_coverage * repeat_ratio. 
+
+Any contigs with coverage below this threshold will be considered to be repeated
+
+
+=item B<-f>B<--filtered-out>
+
+If specified, filtered out sequences will be written to this file.
+
+=item B<-s>B<--summary>
+
+A summary of results
+
+=back
+=cut
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/filter_spades_repeats.xml	Thu Oct 12 15:04:45 2017 -0400
@@ -0,0 +1,179 @@
+<tool id="filter_spades_repeat" name="Filter SPAdes repeats" version="1.0.0">
+	<description>Remove short and repeat contigs/scaffolds</description>
+	<requirements>
+		<requirement type="package" version="1.6.924">perl-bioperl</requirement>
+	</requirements>
+	<command detect_errors="exit_code"><![CDATA[
+
+		perl $__tool_directory__/filter_spades_repeats.pl 
+
+		-i '$fasta_input' 
+		-t '$tab_input' 
+		-c '$cov_cutoff' 
+		-r '$rep_cutoff' 
+		-l '$len_cutoff' 
+		-o '$output_with_repeats' 
+		-u '$output_without_repeats' 
+		-n '$repeat_sequences_only'
+		-e '$cov_len_cutoff' 
+		-f '$discarded_sequences' 
+		-s '$summary'
+
+	]]></command>
+
+	<inputs>
+		<param name="fasta_input" type="data" format="fasta" label="Contigs or scaffolds file" help="Contigs/Scaffolds output file from Spades" />
+		<param name="tab_input" type="data" format="tabular" label="Stats file" help="Enter the corresponding stats file of the fasta file input above" />
+		<param name="cov_cutoff" type="float" value="0.33" min="0" label="Coverage cut-off ratio" help="This is the average coverage ratio cutoff. For example: if the average coverage is 100 and a coverage cut-off ratio of 0.5 is used, then any contigs with coverage lower than 50 will be eliminated." />
+		<param name="rep_cutoff" type="float" value="1.75" min="0" label="Repeat cut-off ratio" help="This is the coverage ratio cutoff to determine repeats in contigs. For exmaple: if the average coverage is 100 and a repeat cut-off ratio of 1.75 is used, then any contigs with coverage more than or equal to 175 will be marked as repeats." />
+		<param name="len_cutoff" type="integer" value="1000" min="0" label="Length cut-off" help="Contigs with length under the chosen cut-off will be eliminated." />
+		<param name="cov_len_cutoff" type="integer" value="5000" min="0" label="Length for average coverage calculation" help="Only contigs above this length will be used to calculate the average coverage." />
+		<param name="keep_leftover" type="select" label="Print out a fasta file containing the discarded sequences?">
+			<option value="yes">Yes</option>
+			<option value="no">No</option>
+		</param>
+		<param name="print_summary" type="select" label="Print out a summary of all the results?">
+			<option value="yes">Yes</option>
+			<option value="no">No</option>
+		</param>
+	</inputs>
+	<outputs>
+		<data format="fasta" name="output_with_repeats" label="Filtered sequences (with repeats)" />
+		<data format="fasta" name="output_without_repeats" label="Filtered sequences (no repeats)" />
+		<data format="fasta" name="repeat_sequences_only" label="Repeat sequences" />
+		<data format="fasta" name="discarded_sequences" label="Discarded sequences">
+			<filter>keep_leftover == "yes"</filter>
+		</data>
+		<data format="txt" name="summary" label="Results summary">
+			<filter>print_summary == "yes"</filter>
+		</data>
+	</outputs>
+	 <tests>
+        <test>
+            <param name="fasta_input" value="SPAdes_scaffolds_(fasta).fasta"/>
+            <param name="tab_input" value="SPAdes_scaffold_stats.tabular"/>
+            <output name="output_with_repeats" value="Filtered_sequences_(with_repeats).fasta"/>
+            <output name="output_without_repeats" value="Filtered_sequences_(no_repeats).fasta"/>
+            <output name="repeat_sequences_only" value="Repeat_sequences.fasta"/>
+            <output name="discarded_sequences" value="Discarded_sequences.fasta"/>
+            <output name="summary" value="Results_summary.txt"/>
+        </test>
+    </tests>
+	<help><![CDATA[
+********************
+  What does it do?
+********************
+Using the output of SPAdes (a fasta and a stats file, either from contigs or scaffolds), it filters the fasta files, discarding all sequences that are under a given length or under a calculated coverage. Repeated contigs are detected based on coverage.
+
+**********
+  Output
+**********
+
+ - **Filtered sequences (with repeats)** 
+ - Will contain the filtered contigs/scaffolds including the repeats. These are the sequences that passed the length and minumum coverage cutoffs.
+ - For workflows, this output is named **output_with_repeats**
+ - **Filtered sequences (no repeats)**   
+ -  Will contain the filtered contigs/scaffolds excluding the repeats. These are the sequences that passed the length, minimum coverage and repeat cutoffs.
+ - For workflows, this output is named **output_without_repeats**
+ - **Repeat sequences**                  
+ - Will contain the repeated contigs/scaffolds only. These are the sequences that were exluded for having high coverage (determined by the repeat cutoff).
+ - For workflows, this output is named **repeat_sequences_only**
+ - **Discarded sequences**               
+ - If selected, will contain the discarded sequences. These are the sequences that fell below the length and minumum coverage cutoffs, and got discarded.
+ - For workflows, this output is named **discarded_sequences**
+ - **Results summary**  : If selected, will contain a summary of all the results.
+
+************
+  Example
+************
+
+Stats file input:
+------------------
+
++------------+------------+------------+
+|#name       |length      |coverage    |
++============+============+============+
+|NODE_1      |2500        |15.5        |
++------------+------------+------------+
+|NODE_2      |102         |3.0         |
++------------+------------+------------+
+|NODE_3      |1300        |50.0        |
++------------+------------+------------+
+|NODE_4      |1000        |2.3         |
++------------+------------+------------+
+|NODE_5      |5000        |14.3        |
++------------+------------+------------+
+|NODE_6      |450         |25.2        |
++------------+------------+------------+
+
+User Inputs:
+------------
+
+- Coverage cut-off ratio = 0.33 
+- Repeat cut-off ratio = 1.75  
+- Length cut-off = 500
+- Length for average coverage calculation = 1000
+
+Calculations:
+-------------
+
+**Average coverage will be calculatd based on contigs with length >= 1000bp**
+
+
+- Average coverage = 15.5 + 50.0 + 2.3 + 14.3 / 4 = 20.5
+
+**Contigs that have coverage in the lower 1/3 of the average coverage will be eliminated.**
+
+- Coverage cut-off = 20.5 * 0.33 = 6.8
+
+**Contigs with high coverage (larger than 1.75 times the average coverage) are considered to be repeated contigs.**
+
+- Repeat cut-off = 20.5 * 1.75 = 35.9
+
+**Number of copies are calculated by dividing the sequence coverage by the average coverage.**
+
+- Number of repeats for NODE_3  = 50 / 20.5 = 2 copies
+
+
+Output (in fasta format):
+--------------------------
+
+**Filtered sequences (with repeats)**
+
+::
+
+>NODE_1
+>NODE_3 (2 copies)
+>NODE_5
+
+**Filtered sequences (no repeats)**
+
+::
+
+>NODE_1
+>NODE_5
+
+**Repeat sequences**
+
+::
+
+>NODE_3 (2 copies)
+
+**Discarded sequences**
+
+::
+
+>NODE_2
+>NODE_4
+>NODE_6
+
+	]]></help>
+    <citations>
+        <citation type="bibtex">@ARTICLE{a1,
+            title = {Filter SPAdes repeats Remove short and repeat contigs/scaffolds},
+            author = {Mariam Iskander},
+            url = {https://github.com/phac-nml/galaxy_tools/}
+            }
+        }</citation>
+    </citations>
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/Discarded_sequences.fasta	Thu Oct 12 15:04:45 2017 -0400
@@ -0,0 +1,1034 @@
+>SRR6126859_31 length_7815_cov_9.7826
+ATATAGAATATCCAATAATCAAATTATATCATATTACGAATTAGGTTTCCCAAAAGATGC
+CGTTTCAGAATTGATATTAGGTCCAAACAATAAATTTAAAGAAAGCGATATTGTTAACTT
+TTTGCAGTATAATGGTTTTGAACACAGCATAAAAATATTGAAATCAAAGGCCAGTTATGG
+AGCTTAAATAAAAATGTATTTTCTATTTTGCTATTCATTATAATTATTATTACGATATGC
+CAGTGGTCTCAACTTTGAAACATGGGACTTTCCTGAATACTCTGAGGGGCTTGATGGTAT
+GAGATCTATGTATTTATCAATCTCTGTTTGTACATCTTTCGGACGACTTGGAAAACGAAC
+GGTTTTGTCATGGTCTGATTCATTGCCATAGATGCTTGCTTCTGGTGATGTCTGGTCATT
+GTTAAATTTAGCGCGTTTTTCAAACTCCGAGCGTGGAACATTGATACCCAGCACTTCATC
+ATAGACATAGTTCTCTGCGATACGCTTATCATGGTCAGCATCAGTGGTATCGGGTTTCCT
+TCTGGCCCATATAAATTTCTCTCTTATATATCCTACTATCAGTAGCGTGAAACGTTTAAA
+CAAACCATTCTGGCGGGGCTTGGTCTGTTTCCTACTCCTCATCGGAGCGCGGTTCTTCGC
+TCTGGTGTTTTGAATAGATGGGGTTTTCAATTTAGTGGATGCAGTTGGTTCAGGAACAAT
+CAGAACGGGAGATTTCTTCCCTGATACATTTACTTTACTGACCTTATTGGGATTACGGTA
+AGATTTTGTTGCTGGTCTTCTGCTTGTGGCGTGTGTCGTCATAACAGGTTGCTGTTTAGT
+TGTAGCCGGGAAGTCAGGGATAACGATTTCTTCGGGTTCAGCAAGATGTGTAATCGTAAA
+GCTTCTGACATCAACCACGATCTCCAGTGGTAGCTCACTGAATGTGTTGTAGACCTTCTT
+CGCTTCCTCTATTTGCTGATCACGTAAAGCTTGTTCTGTAGCTCGCTGTTCCTGTGACTC
+GGTGTTATTCCACTTGGCACGATGAACTCGTTGCATTGCTGGACGGTTTGTTTCGGTTGC
+TTTGGCAAGCCAGAAGGCTTTTTCTTCAGCGCTGAATGCTTCTTCTGCTTGGGCAAGGGC
+ATCAGCACATTGAGTTCTGAGAGAACGGTGATCGATACGTTCTTCACGGCCTGCGGTCTC
+AAGGTAGCTGTTTGACATCGTGGCCCACGACTCACGCCACTGAACAACCATCTTCTTATC
+ATTCCAGCTTCTGTCTTTTTTGCCGAAGCCTTCTGGACCAATGGTTTTCAGGGTTAACAT
+GACGTGAGCATGTGGGTTTTTACTGTCCAGATCATGAAATGCGATATCAGCAATCATCCC
+CTTATCGACAAAGTTTTTCTGGCAGTATTCGGCAACTAATTTTTTCTTGTCATCATTGCT
+GAGTTCTACGGGGATAGCGACATCAAAATAACGCGCTGTTTGTCCGTTGTTCTGGCGTTC
+CACTCTTTCAACTTCATTCCACAATGCTGAGGAGCTTTCAACAATATGAGCAGGTGCGGA
+AACAGGTGCCAATATAATATGACCATGTAGATCTGTTCTGTGGCTGAAATCGTATGTTTC
+ACCGATGCGATCATCTGTAATACGTGTACGGGTATGGTAGGCAGCCTTCGCAACGGAAGT
+CATGCCTTCGCTTCGTTTCACAATTTTAAAATCCAGATGAAAAATCGCCATTAATAAATT
+AACCTCAAATATAAATGCTGCCGTTAGTTTTACGTAAGAAAAACTTCGGGGTTGACGTTG
+GTTTTGCTTTTAGCCTGCGGCAGGCAACCGTCGGTAGACCCCACACACTGCGTAGCAGTG
+TATAGGTGGGCATTGTCTTTAAAAAATAAGCCAATGTAAAAACTCCCCCTTAGTTAATTA
+ATACGAAATATACTGATAGTTGTAAAATGATGCGTTAAATTAAACGACACGAACTGGATT
+AAAGGTGTAGGTTTCACGTCCGAAGGGAAAAAATAAAGAAAAGGCCCGTAATGGCAAAAG
+AAGTATTAATTGTTCCCGCCGAAAGGCGGGATAGCTAAAATTGAAGAAAAAAGCTAATAA
+AACGGAGAGTGTTATGTGTTGCACAATTCACAGGTTGAGGTTGAAAAATAGAGTTTAAAG
+CTGATAGGTGAAAATAAAATAACAAAAGTACAAAAATAAGTAACGCGGAGAGTGCCAGAT
+GTTTTGTGTTAGTGATTACTATCGCATGTATTGCACTATTTTATTTATGGATGCTCCAGA
+ACTATTCCTTCTGACAAAACGGTGTAAATTTGACGTTATTTACCTTTGTGATAATTAAAT
+ACGTATAAACAATAAGAGGTAATAATCATGGATAATGAAACTAAAAGATCAAGAACAGAA
+AAAACATTAAAACAAAAGGTGGCATTTGCTCAACTTGAACTTAACCGTTTAAAGTCAATG
+GAGAAATCAGAACAAAAGAAAGTTGAAACAAGGCTTAAGATTATTCTTGGGGCAGAAGTA
+GCCAAGGCTATGAATTGTGGTATCGAACAGGTGGATAAGGAACTTGTTATGGGGATTTTA
+CTTTCAGCATCTGAGTTGAATGATATTGAAAGAGTCAAATATATAAAAGCAGGGAGATGG
+TTTCTTGCTCAAATGGATGGCAGACAAAAATAAAAAATATTAAATAAATTTCATGACAGG
+GGTTGATATCTAATTAATATCTGTTATCTATATAAAAGAACAGAGCGCAGGATAATACTT
+TATTAATACATATTTTTTCCTTTTCAATCAATCATGCGTTCTGTTCGACCAGTAATCTGT
+TAATTTTTATCTTTATGTAGTAAACGTCATTATTACTTTTTCATCGGATATGATTATATA
+TCTCATGGGAAGGTGATAATGACAAACGCTGTGATAATAAATGTTGTATTTAAATCTCCC
+AAAAGGCAAAGAGCGATCTTTGCCTTTTTCAATTCATCCGTCTATCAGATAGAGTTAAAT
+ATATCTTACGCCATCTATTGCCAGAAATGAGAGAAGCGTTATAACAGGAGATATCATTAA
+AATAAATAAAGGAGATAATAATGGTTTTATTAAATAGTAAAAGAAAAAGCAAAAAAGGTT
+TCTCATTACTCGAATTATTACTTGTTCTGGGGATTATTGCCGCATTAGTAGTAGCGGCTT
+TTATTGTGTATCCCAAGGTTCAGGCTTCACAAAGAGCGCAAGCGGAAAGTAATAATATTG
+CCACCATACAGGCAGGTGTCAAAGCACTCTATACATCAGCATCCAGCTTTACTGGGCTAA
+CGAATACCGTAGCTGTTCAGGCAAAAATCTTCCCTGATAATATGTTAAGTGGAACAGGCA
+ATGCAGCTAAACCAATTAACGCATTCAAAGGGAACGTGACGCTGGCTGCGGCAGCTACAG
+GTCCGTCATCTGCGGCAGGTTCTTCTTTCACTATCACATATGACAACGTGCCAGCAGCAG
+AATGTGTGAAAATAACCACAGCGGCGGCAGGCAATTTTTACACTGCTAAAGTGGGTTCTA
+AAGTAGTAAAAGCTGCAGATGGTACCCTTGATGTAGCAGCTACCGCCGCAGCATGTAATA
+ACGCTACAAGTAATACATTAGTATTCACGTCTATTTAATTAAAGGGGCACTTTATGCCCC
+TTTTTGGATCATATTTTCAGATGGGAGATATAATTATGATAAAGAAAAGAGGATTTACTC
+TATTAGAGATCACCATCGTTTTAGGTATAGGTTCTCTTATTGGTTTTATGAAGTTTCAGG
+ACATGAGGAAAGAACAGGAAGCAGTAATGGCACAGGCGGTAGGCTTTCAAATGAAACAGG
+TTGGCGAAGCAGTTAACCGTTATATTAGCATTCGCTATAATAAGCTTTCCACACTGTCAT
+CTTCACGCAGTCAAAGTAGCGATCCGGGACCAAGAACCTGTACGGCTAATGGCTGTGAAA
+TCACTTACCAGACGCTGGTGAATGAAAGTCTCTTGCCCTCTACATATGCGGGAGTTAATG
+CCCAAAAGTCTTCTTATAAAATCCTGTTAAAACGATCAGGCGTATCACCAAACTATGTTA
+TCAATGGTTTGATTGCTACGACGATACCTTGGGTCGAAGGTGGAAAAACGCGATACGACC
+TGTTAGGAAAATCGATGCAATCAGCAGGTATTGATAGCGGTATGACGAAATCGCCTGCTC
+AGGCATCAGGATATAATGGAGTGTGGACAGAAAAGTCTACTGATTACCCGGCAATTAATA
+AAGCAGGATTACTGGTTTACCGTGTGGGCTATGATAGTTCTATGTATTCTGTTTACTTGC
+GTCGCGATGGAACATTGCCTATGACTGGAAATCTCAATATGGGCACTAACGATATTAATA
+ATGCCAAGAACATTACCGCATCGGGAACGGGGATCTTTGGTGGGGATGTTTCTTCCGCAG
+GGAAAATAATCGCAGCACAAGAAATAATAGCGCATAATGGTTATGGTGATGCCATACATT
+TTGGCGGCGATGCTGTTAATAACGACTATGAAATAACCATGTCTAAGGATAAGACCTTAT
+CTATTCATATGGCAAGCAATCGAACAGATCTCACTACGCTGAAAATTAGTGGAGGGCTGT
+CTACGATTGGTAATGGAACGATTAGTGGAACATTAGATACAGGTAAAAGTATCACATCCG
+GTGGACAATTTAATGGTCATAACGGTGGTGGTGATAGTTTCAGTATTGGTGGTGGAGATG
+CTAACGATTATGAGTTCAGATTAGATACTGTTAAGCCGCTAACCATCTGGCGAAATGGTG
+GCACCAGTACTGAAACAAGGCTTCAGGTTTTTGGGAAACAAACCAACCAAGGTGATTTTG
+CTATTACTCCGGGGACAGGAAGCACTGGTAGTATTGCAGCATCTGGAAATATTCAGGGAC
+ATACTCTACAACCTACATCGACGAATACAACTGGTGGGACATGTCCAAGTATAGGCCTGA
+TATCTAAAGACAACATGGGAAATATATTATCCTGCGTTAATGGAAAATGGTCTGTTGTCA
+GTAACCTGCCAGTTGGTTCACCTGTTCCTTGGCCTTCAAATACAGCGCCTGTAGGTTGGT
+TAATATGCAGGGGACAATCTTTTAATACTGCCCTATATCCTCAGTTAGCAAAAGCCTATC
+CAAGAGGAAGACTTCCTGATTTAAGAGGAGTATTTATTCGAGGGCTGGATTCGGGAAGAG
+GACTTGACTCAGGAAGAGTTATTAATTCTTATCAGGATGATCAGATTCAAAATATTACAG
+GTCATATGGCGGCTGATGTATCACAGAGTGGAAACATCGGTAAATATGTGAGTGGCGCTT
+TCGCGGATAGTGGTGCGTTAGGTGAAGGTGATGAAGGTCATAAAAGCAATGAAGTAAGGA
+AATATACGTTTGATGCTTCGAGAGTCGTTCGGGCAGGTAATGAAACAAGACCTAAGAATG
+TTGCCATGAATTATATCGTTCAGGCACAATGACTATTTTAATGATCAGGCGACTTTAAAT
+GCGAAATGTACGCCTAATGGTCTGGTGGGCCGAGACAGTATGGGTAAGGTTTTATCCTGC
+GTCAGTGGTAAGTGGCAAACAGTAAGTGGTGATAGATTAAAAGGTATTTATATCACGATC
+ACAGACCAAGTATCGGGCTATAAGTGTGTAATACCAAACAGCGATACAAGGGGATGTTCT
+TGTCCGGGATCGGCATATAGCTCAAAATACAGCTATTTATCAGGAACGTTAATTGCTCAA
+TATGATGATCAACGTTGTGGTGGTGGAAAGAATGATCACTTTTATAGTAATTACAGAAGA
+TTATATGCATGCCAATAATGTTAACTGTTGAGGAATTAATGTTTGTGTTTAAACATTATA
+ATAAAATTTAACTTTTAATAAATAACATATTATTTAATAAGTGTCTTTTAAAGATATTCA
+CTTTTATAATATATCTGATTGTCTAATATATAGGGAGTAGTTTACAGCTCAATGAGTTGA
+TTCAGTTTTCCCAAGTGATATGTATTCTCTCCAATGGAGAGTTCCCTTTCGCTTAAATAT
+TTATTTCATTTCAATAATGATTCAAGCTGTTCAGCAATTTCATCAATGGTATTTATCGAT
+GTATTTAATGCCATTTTATCTACTAGTGTAGGGCTGAATTTTAAAATATCAGATTTAGAT
+ACTTCGTGCCAGATAGGCAGTATTACTTGGTTTTCACCGCTCATCTCTCTAGCAGTCAAA
+CCATTTAATTCATACTCTGTCCAGTCCTTTTTGATAAAGGATTTAGATAAAACAACAACT
+CCAAACCGAGAATTTGCTAATCCATAATCGATTGTCTTACGTAGACTTTTACCCCAGCCT
+AAAGAGAATTCGTCATACCATACATTTATCCCTTTTGCTCTTAACAACTCAGCAAGGGGA
+CGGACAAAACTATCTTTATCTTCTGTTGCATGAGAGATAAAAACATCATAACTCTCTGTA
+ATATCTTCTGTCTCATCAGATTTGTTGATGACTGGACGATTGAATTTATGGCTTGGAGAT
+ATTGCCCTTTTCTGCGATTTCAATTCTCGTGTGATTTTCTTCTGGTAATCTAATTGTTCT
+TTTTCAAGTTTCTTCTGTGCAGCAATTCTTTTTTTCTGGTCATTCTCTTGCTCTTTAATG
+AGTTGTAATTGATAACGGTGTAAGTCTCCAGTTTTTGCTGTTATTTTTTTATTAATATCT
+GCTTTTTTAGAGTTACATCTTGAAATATCATTTTTATGACGAGAGATCTCTGACATTTTG
+GAATTCAATGTGCTTAAAGACGTTGACTTAGTGACGCTACGCTTTATTTGATTGATTTTT
+CCTGAAAGTTGGGCCTCTTTACGCTGCTCATCAGAAAGTTGTTTTTGTAGACTAGCAATG
+TCTTTTTGTATTCTGTTGATATTTGACATTGTGGTGCTTATAGACATCAGATTAACTCCC
+TGAGATATTTACATATGGTGTATACTACACTATCTATGTACTTGTAGGCGATTGATTTTA
+CCTAATAATATATCGATAAAAGAGGACTTTCTTATCAGGCCGTTCTAACTCTATACTTCA
+ACACCTGAACATGATCTCCATCATTGAAGTATTTAGCTCCGCTGGTAAAGGTGCTTAGTC
+TTTTGGCGTGCCCGGAATGACCACTGTTGCTTGGCGCGTGGACAATAAATTTACGCGTTT
+AGTTGGTCATTTTTGCTCCAATATTCTTAATGGATACATTCCCCTTCATTATGAAATTTG
+CATTAATATCATTAAAATGAATGTCATTTGATATTTATTATTAGGTATAGAAATGTGTAT
+AATCGATTATTGTTTTATGTATACGATATGGTGGGAAATGAGTAATACTACAGATTGGAT
+TAATACTATATCTAATGTGATGATCGCCGGTTCTGCGATTTATGGCGCTTTTAAGGCTAA
+GAGCTATTTCAAAAGTAAAAATGATGAGGAAGCATATAATGATGCAAAAAAATTGATATT
+TGAACTGTATCCTCAATATAGAATTGATTTGCATAAATTGGTTATCGTTTTGTTATCAAT
+GACATCCAATAGAATTCCAAATGATATATTGGAAACTCGGTTGGAGAAAATTACCAATAG
+ACTGTCTAATACACAAATTGAAATTGTAACTATCAGTTCCAATATTATTGAACGCCATAG
+ATGGAAGATCAGAGATGATTTTAAAGAGTCTTTTGAAATAATTAAAAATATCTATAGGAA
+TAAATTAAGTTTTCCATTGATTAATGTAGTGGATGAAGTAAGTCAAAGCACAGAAACTGA
+AAGGCAAAATATACT
+>SRR6126859_40 length_966_cov_206.632
+TCCTTACCTTAAAGAAGCGTACTTTGCAGTGCTCACACAGATTGTCTGATGAAAAGTAAA
+TAGCAAGGCGTCTTGCGAAGCAGACTGATACGTCCCCTTCGTCTAGAGGCCCAGGACACC
+GCCCTTTCACGGCGGTAACAGGGGTTCGAATCCCCTAGGGGACGCCACTTGCTGGTTTGT
+GAGTGAAAGTCACCTGCCTTAATATCTCAAAACTGACTTACGAGTCACGTTTGAGATATT
+TGCTCTTTAAAAATCTGGATCAAGCTGAAAATTGAAACACAGAACAACGAAAATTGTTCG
+TGAGTCTCTCAAATTTTCGCAACACGATGATGAATCGTAAGAAACATCTTCGGGTTGTGA
+GGTTAAGCGACTAAGCGTACACGGTGGATGCCCTGGCAGTCAGAGGCGATGAAGGGCGTG
+CTAATCTGCGATAAGCGCCGGTAAGGTGATATGAACCGTTATAACCGGCGATACCCGAAT
+GGGGAAACCCAGTGTGATTCGTCACACTATCATTAACTGAATCCATAGGTTAATGAGGCG
+AACCGGGGGAACTGAAACATCTAAGTACCCCGAGGAAAAGAAATCAACCGAGATTCCCCC
+AGTAGCGGCGAGCGAACGGGGAGGAGCCCAGAGCCTGAATCAGCATGTGTGTTAGTGGAA
+GCGTCTGGAAAGGCGCGCGATACAGGGTGACAGCCCCGTACACAAAAGCGCATGTGCTGT
+GAGCTCGATGAGTAGGGCGGGACACGTGGTATCCTGTCTGAATATGGGGGGACCATCCTC
+CAAGGCTAAATACTCCTGACTGACCGATAGTGAACCAGTACCGTGAGGGAAAGGCGAAAA
+GAACCCCGGCGAGGGGAGTGAAAAAGAACCTGAAACCGTGTACGTACAAGCAGTGGGAGC
+ACCCTTTGGGTGTGACTGCGTACCTTTTGTATAATGGGTCAGCGACTTATATTCTGTAGC
+AAGGTT
+>SRR6126859_41 length_667_cov_1.27941
+ATAGTGTGTGTTACGCACAAGTAAGTCGACGTAGTCGGTGTACGTGTGGTCAAGGTGTGT
+GACGTCTGGGATAAATCATTATTAAAGCTGGATAAGCGGTGGATATAGCTTAAGCAACAA
+GCGTAAGTGTGGGGCGGTAACGGGATAAATGGAGTAGCATAGACAGTGATGCATTAGTAT
+TTTTTTTTTCAAGCAGAAGACGGCATACGAGATTCGCCTTAGTCTCGTGGGCTCGGCATG
+ACAGGGGGTTACGGAGCGGAACGCGTATTTGATTGCTCAGGCGCAGTACCAGCTGTAAAT
+CAAGGATTACCTCTAACGAAGAAAAAAGGCGATTTTGTTCAAGTAGGACTTTTTGCCGAA
+AAGAAAAATGCGATTGATGAAGAATCTATTATCCAACGTGAAATTGCTTATATTGGCAGC
+CGTTCTCAAAAACCATCTTCTTGGATTTTAGCACTCGACTTACTTGCTAATGGCAAAATC
+GATACAGATAAAATGATTACCAAAGTATATGGTTTAGATGACTGGCGCGAGGCTTTCGAG
+GCAGTTATGGCAGGAAATGAAATTAAAGTATTAGTGAAATCTTAATAATGGAGGATGGGC
+TGTATGAAAAAACATCAAAAAAAGGATAACCGTGCAAACGAATCCAAAGCTTCTCGGGCT
+CAGATGT
+>SRR6126859_42 length_665_cov_1.22951
+ATGTATAACCGCATAAGAAAACCAGATGAAGGTTTTGTTCATCTGGCGCTTGCAACTAAT
+TTAATAGCCCGAGATTCTGTTGGCGAAAATAAAAAAACCGATTCAGCGAGCGAGAGCTGA
+ATCGGTTTTCTTTATTTGGTATTTAAAACAGCGACATCTTTTTGCAAAAATGTTAAAACA
+GCTGCAAATAATTTGTCCGCTTGTTCATCTTGACAAATCACGTGTTTCGAACCTTCTAAA
+ATAAATAATTCTTTTGGACCAGTAATGCTTTCCATTAAGAAATTAACACTTTTTTCAGCA
+GGAACTACTTGGTCGGCACTGCCTTGTGCTATAAAAGTTGGAATTTCAATATGTTCAAAA
+ACTGGCTTTGCTAAAGCTACCATTTTTTTGAATTGTAGCGTGGAAGTCCAAGGCGTTTCC
+GTTACTTTCTTTTGGTACCGTTTGAACATCGGGCTGTTTTTGAGCGTGACTTCTTTCGCT
+TCCGTTAATACTTGCTTGGAATTTTCGACAAGTTGTGGCCATTCCATTGCATTTACGGCT
+GTGCTTAGAAGTACTAGTTTTTTCACTTCCGGATAATGTCTCGCAAGCCAGCCTGCGAGC
+AGTCCACCCATAGAAAAACCAATAATATATACTTCATCGTCTTCTTTTAGCATTTGGCTT
+AAAAT
+>SRR6126859_43 length_602_cov_1.38757
+ACTATGCTGAATAAGTTGATTTTGGGGCATACGATTGTTCTTGAACCCTTAATTAATACA
+CCAGTTGAAGGCAAGGCCTCCAAACAAGAGTTAGAAAAACTGTCTATTGAGATAACTAAG
+ATTGATGAAAAGTTAGAAGTGCTGGCAAGTTTGAATGCATCTGGTGTCGTTTCCACAAAA
+ACCGCTCTTGAAGAACAAGGCAGACTACAGATGGAATTGAACAAGCTTCAAGAAAAGCAG
+CATAAGATAATGGAATCGGTGAATGGGACATCCACACAGCGAATTCAATTAGAGCAACTG
+CATCAGTTCACAAAGCGGAGTGAGATGTTGACGGAGTGGGACGAAGATTTGTTTTTACGA
+TTTGCAGAACGGATTGTTGTATATAGCCGTCAAGAAGTCAGTTTTGAACTCAAGTGTGGA
+TTACTTTTGAAAGAGAGGTTAGAAGCATGAACAATACAATCCCCTTTGGATATGTCATCA
+AAGATGGCTTGATTCGTTCCGATGAACTTAAGTCGAAGCAAGTTCAGGACTTTTTCAAGA
+TTTACCTTGAGGGTGTTGGTTTGCTTGAAGCCGGAAAACGCTCAGGCATCAACAAACAAC
+AT
+>SRR6126859_44 length_574_cov_2.62428
+AAACTAGTTGGTGGAAATTATCAAATACTTGTGCCGTTTTCGATATTATTTGGGGCTTTA
+TTGCTACTTTTCGCGGATACGATAGGCAGAACGTTATTTCAACAAATGGAAATCCCTGCG
+TCTGTGATTATGCTTATTATTGGTGGTCCGTTCTTAATCTTTTTAATGCGAAAGGGTGAT
+TTTTATGGAAGTAAGGGACGTTAATTTTAGTTATAATGGAACCGATGCAATTTTGAAAAA
+TGTCTCATTTACTATCCAGAAAAATAAAATCAATACGATTGTTGGGCCAAATGGTAGTGG
+GAAATCTACTTTATTAGAAATTTTGGCTAGACTCCTTTCACCTAATTCTGGGGATGTTTT
+ACTGGGAGGAAAATCGATTTTTGAATGGAAAGCAAAAGAATTTGCGCAAAATGTGGCGAT
+TGTTCATCAAAGTAACGTTCTTCCGAATGAACTAATGGTGAAGGAATTGCTTTACTTTGG
+TCGTCTACCTTATAAAAATTGGCGAATGACTCGGACAAAGGAGGATGATCTAGCTGTTGA
+GCGGGCTTTGATGCAAACGGAGCTAACTGAAAAA
+>SRR6126859_45 length_573_cov_1.12934
+AAACCACGATAACCGACAAGATAACAGAAGCAAACGAGATTAAGAGCATCTTCATCCCAG
+TGCTCCAAATGTAGTCTGTATCGCCTGTTACGACTCCTTTGTCGATAATGTTCGACATAA
+GCGTCGGCAAATAAAGCTGTCCAATGACTTGCCCGAAAGTAAGGACTAATACGGCCGTAA
+TGCTCAGCCAATAAGGTTTTAATCTTTTCATCAATTTCATCATTTGTGGTTTATGCCTCC
+TTATTTTCGGATTTTGTGTTTAAGTAATCTGTCAGTTTTTCTAGGAGTGTAATCAATTTT
+TTCATATCGTCTTCGCCTAAAAACTCCTGCATATCTTCAAAACTAGCTTGAAATTCATCG
+AGCATTTTTTCTGACACGCCTGCTCCGACTTCTGTTAATTCTACATACATCGAGCGCTTA
+TCTTCTGGGTTTTGAACTCGTTTAATGAGTCCTTTTCCTTCCAAAGATTGAATCATTTGC
+GTGACGCTTGGTTTTGAAATTCTGAGCATATGACCAAGATCGGAAACACGAATTTTTGGC
+CCTCTGCTTTTAAGCCCACGAGACCGTACTAGA
+>SRR6126859_46 length_519_cov_1.5625
+AAGTAGGCTTGGACGATAGGAGTACATGATATTCCATACGAGCGAAGCGACAAAGATACC
+AATAATCGCTGCAAAATTGCCACTCGGGAACATCATTACCATACATAATAACGCTGCAAA
+AACATTCGAGAACCAAGGATTAAAATAATGGTTTAAACGTTTTAATACGAAGCCGCGCCA
+GAAAATTTCTTCTCCCGGGATGATGGCAACGATAAGTAGTAGCCAAATTATCAAAGAATG
+CGTCGAATACTTATTAAAAGCAGCTTCTACAGAATGTTCTAGACCGCCTGGCATTACTTT
+AATAATAAAGGCGCCTATGTAAAAAATAATATAAAGGACAATTCCGGAAAAAATACCTGG
+CAAAATACCTTTAACGAACGAAAACTCTTTTTTTAAATCATCATTAAAAATCACAAAACT
+AAGTAAAAATAACATCCCAGCTCCATATAAATACCAAAAAACACGTGGGAACTGATATGT
+TAATATAACGAGTAGGGCGCATAAAACAAGGCCCAGTAC
+>SRR6126859_47 length_512_cov_1.28009
+ATACGAGATTCGCCTTAGTCTCGTGGGCTCGGTTTAGACGTATTTGTGTTAGAAGTAGAT
+CCAGCACTTACTTTAAGTTTTTGCCCTGGATAAATGAAATCGGATTTCAGGTTGTTCCAA
+GCTTTTAGGTTCGCGATAGTTACTTTGTTGTTATTAGCGATTCTCCAAAGCGAGTCCCCT
+TTTACAACTGTATAAACTTTAGCGTTTGTGCTAGTGCCTGTACTTGGTTTGGACGTGCTT
+GTTCCTGTGCTCGGTTTCGATGTATTCGTATCCGATGTAGTGGAACCAGCACTTACTTTA
+AGTTTTTGCCCTGGGTAAATGAAATCAGATTTAAGATTATTCCAAGCTTTTAGGTTCGCG
+ACGGTTACTTTATGGTTATTAGCGATTCTCCAAAGTGAGTCCCCTTTTACAACTGTGTAA
+ATTTTAGCGTTGGAGGTATTTGTGTTTCCAGTGTTGCTAGAATTACCAGTGCTTCCGGAA
+TTTCCGCCAGTTGTTTTGCCACTGTCATACTG
+>SRR6126859_48 length_502_cov_1.30649
+GTAATGCACCGAACCTAGTAAAGAATTCGTTTGTGTAATAGATGTTTCTGAAAGTGCCAT
+TGCAATACCAAAATCTGTAATCTTCACGACTCCATCATGATCAATTAAAATATTTTGCGG
+TTTTAAGTCACGGTGGATAATGTTATGTTGATGGGCGATTGCTACCGCAGAAACGATTTG
+CAGCATAATATCTACTGCTTTTTCATAACTGATTGGATGATTTTCGTGAATGTACTGTTT
+TAAATCCATCCCATCTACATGTTCCATTACAATATAGTGTAAATCATTTTCTTCACCAAC
+ATCGTACACACTAACAATATTAGGGTGAACAAGACTCGTTGCTGATTGAGCTTCCCGTTG
+GAATCGACGAATAAGGTTGCTTTCATCTGCCAAATCGATTCGTAAAATTTTCACTGCAAC
+ATCTCTATCAAGAATAATATCATGCGCCAAGTACACATTGGCCATTCCGCCGCCGCCTAT
+TGCATGTAAAATCTTATATCGA
+>SRR6126859_49 length_491_cov_1.52294
+GAAATACACTTTGGTATCAGTTTAACGTAGATGGAAAACTTGTTGGATGGGCTAGCGAAA
+AAGACTTAAATGTATTTTATACTCCCGCTAAAGAAGAACCAGTAAAACAAGTTGCTTACG
+AGAAAGACCCGACTGTAAAACTTTACAATAAACCAGTAGAATCAACAAGTACTAATCCAA
+AAGCAGTGGGCTTTTATTATGGAAAATTATTAGCAGTGGATAAAACAGCCACAATTCTTG
+GTGAAGATTGGTTGCATCTTAAAGACAGTCAAAATTCACTAGGATGGATTAAAGCTATCG
+ACATCAATAGTTAAATAAAAAAAGGTTCTGCATTTACGCAGAACCTTTTTTTCGCTTATA
+CATTCAGTTTGCGACTAGCCATCCATTTCACCATTTCTGGATCCGCATGTGAGAAGAACT
+GGCTTTCCCCTTGATTTAGGCCGGCAATTTCTTCCTTATCTGCTTCCGTCAATTCAAAAT
+CAAATATAGCC
+>SRR6126859_50 length_487_cov_1.23611
+GAAGTAACCTTCACAGGGTCCCGGGATTGGGGCATAGACATATCTTTGGGAGCCACTGTC
+AGCCTGTCCTAACACATGTAAGATTCATCTCTGATAAAGGCATTCAACCACAAGTGCAGT
+GTGGTTTGGTCTTTTAATAAAATCCTTTAAGTAATACTGTAATGAATTCGGAGCTCCATC
+CGGAGATGCCAGGAGGTGTCCTCATTTGAATGTAAAGCTCCTCCCCATAGCATCAGTTGT
+CGCCCCTCCTTTTGGCTTTTCCCATTTCCTCTGCAGATACGGACAAAATCTGTCACCCAG
+GCTGGAGTGCAGTAGTGCGACCTTGGCTCACTGCAACCTCCACTTCCTGGGTTCAAGCAA
+TTCTCCTGCCTCAGCCTCCCGAGTATCTGGGATTATAGGCACCCGCCACCACACCCGGCT
+AATTTTTGTATTTTCAGTAGAGACGGGATTTCACCATTTTGGCCAGGCTGGTCTCAAACT
+CCTGACC
+>SRR6126859_51 length_474_cov_1.86158
+GATTTAACAGCAAACGCAGCGATTTCCAGAATGATAGCATCAGAAGGAATGGTTTTGTTG
+AAAAATGACCATGCTTTACCATTAGCAAAATCAAGTACGATTGCCTTATTTGGTAACGCT
+TCTTATGACATTATTGCAGGAGGAACAGGCAGTGGCGATGTAGTAAAGAAATATACGATT
+TCTCTTGATGAAGGTTTAGTAAATTCAGGATTCAAACTGCAACAAAACAACAAATCTGTT
+TATGAAGATTACGTAAAATCAGAAAATGCAAAAAAACCGACTCCTTCATTTATGGATGTT
+TTTAATCCGTTTTACATTAAGGAAATGGAAGTTAAAAATGAACTGATTGTAGAATCGGTA
+GCCAATTCTGATGTTGCTATTATCACAATCGGCAGAATCTCCGGCGAATCTAAAGATCGT
+AAAGTAGAAAATGATTTCAATTTAACCGATGCGGAAAAACAAACGCTTCAGTCA
+>SRR6126859_52 length_466_cov_0.944039
+AGCCTAGGGTTACTATTTGTAGGGCCTCAGGAAGCTGGAAACTTTGGAGCGGAGCAGCTT
+GATGAAGGATTTTGGCAGCATCTCCTTGTGTTTCTCTGTGTACTTGAAGTAGTTCTGGGG
+GTGGGCTAGCACCTCAAAGAAGGCCTTGATGAGCTTCTTGTCCTGCAAAGGATGGCAGGG
+AGCAATGTCAGCCTCACCATCGGGGGTGGGAAAGAGAAACACCATGACTCAGCAGCCCTT
+CTTGATGTCTACTAGGCATCCTATACTGAATATATCCAGAGGGCAACTCTGGATTCCCAT
+TCCCACCATCTGCCCTTATTCTGGAATTCCACAACTGAATCAGTGGCAGCTCCATCCTTC
+TGTTGCTTAGGCCCCAATCCTTGGAGCCATCCTTGAATCCTCTTTCTTGCTTACAAGTAT
+AGCAAATCCTATTGACTCTACCTTCAAAATATGTCTGGGTCTGACC
+>SRR6126859_53 length_462_cov_0.958231
+TTTCCAGCCAAAATCGCCCCAGCAATCCCGCCAATCCCTTTATAAAACGACACATACACA
+CTATCAAACAGCGCACAAATTTCTTCCGCTGACTTCTGATAAAACGGCGTGATTTCCCAT
+AACCGCGCCCCGTCCAGATGCAATGAAATACCCTGTTCATGACAATATTCCGAAATCTCC
+TCAAGCTCTTCAAAAGAAGGCAGCTGTCCACCAATTTCTCGTTGCGGAAGTTCGATAAGC
+ACACTAGAAACTGGCTCACGAAGGCTTTTAATATCATCAATCGTCACAAGTCGATTCGCC
+GTTCCAAGCAATATTGGCGTGATTTGCTGCAACTCTTTTAGCCCGTCTTGCTCATGAATC
+TCCAAATGCGAAAGCGGGTGATATGCCACGCGCCGATTCTCTTTCCGGTCAGCCCAAATT
+CTCAACGCAATTTGCTGAGCCATCGTCCCACTTGGAAAGAAT
+>SRR6126859_54 length_454_cov_75.198
+CTATCGCTGACCTGAGTTTCAATTTTCAGCTTGATCCAGATTTTTAAAGAGCAAAACTTC
+GCAGTGAACCCTTTCAGGTACACTCTGAAGTATTTTTTCGTAAACACTCACGAGATGGTG
+GAGCTATGCGGGATCGAACCGCAGACCTCCTGCGTGCAAAGCAGGCGCTCTCCCAGCTGA
+GCTATAGCCCCATCGTGTAGTCAGAACCTCTTTACCGATAATTTTTCCTGAGACAAGGCG
+TGGAATAACGAAGCATACATCAGTATGTGAGTTATTTCACAACGCAGTATTCAGGGAAAA
+TTTGGTAGGCCTGAGTGGACTTGAACCACCGACCTCACCCTTATCAGGGGTGCGCTCTAA
+CCACCTGAGCTACAAGCCTGTAGAGGTTTTACTGCTCGTTTTTCATCAGACAATCTGTGT
+GAGCACTGCAAAGTACGCTTCTTTAAGGTAAGGA
+>SRR6126859_55 length_453_cov_0.974874
+TCCCAGGCCCGCATCGAGGTGCAGCAGCCGGTGGCCGACGCCGCCGAACTGCGTCGCCGC
+GCCACGACGCGGCTCGATCTGGCCGCCGGCTATTTCGAGAACGGTCAGACCACGGTCGCA
+CAGGAAGAGGTGCGGCGCGCCCTGGCCATCGATCCCCGGTTTCCCGAGGCGCACAACCTG
+AGCGGCTTGATCGCGATGCGCCTGGGCGACATGCCGTCCGCCGAACAGAGCTTTGGCCAG
+GCCCTGGCACTGGCTCCGGACAATGCCGACCTGCTGCACAACTACGGCTGGCTGCTGTGC
+CAGCAGAAGAACTATGCGCAGGCGCAGGCCATGTTCGCCCGTGCCTTGGCGCGACCGGTC
+TACGGAGGCAAGGCCAAGACCCTGATGGCCCAGGGCCTGTGCCAGGTGCGCGCCGGAGAT
+CCGGTGTCCGGCGAGGCATCGCTCAGGCAGTCC
+>SRR6126859_56 length_450_cov_0.98481
+CATATATATATGTCTCCATACTCAAAGCAATCTTCAGATTCAATGGCAACTCTATCAAAT
+TCCCAGTGGCAATTTTTACTGAAATGGAAAAAAAATTCCAAAATTTATAGGTAACCCCAA
+AGACAATGAATAGCCAAATCAATCTGAGAAAGAAGAGACCTGGAGGCATCACACAGCCTG
+ATTTTAAAATATATTGCAAGGCAACGGTAAACAAAACAGTATGGTACCGGCATAAAGACA
+GGCAAATAGACAAATGGAACATAATAGCCCAGAAATAAATTCATGCAGATAGAGTCAATT
+GATCTTTGATGAGGGTGCCAAGAATACATAATGGGGAAAAGGATAGTCTCCAATAAGTGA
+GGCTTGGAGAACTGAATATCCACATGCAAAAGAATGAAATCGAACCCTTATCTTACATCA
+CACATGAAAATCAACTCCAAACAGATTAAG
+>SRR6126859_57 length_444_cov_1.49357
+GTGTACCTTTTAAATAAGGAGGTGAAGGAATGCATCAAGCAATTGGAATTATTGAAATTA
+AAGGACTTGCTTCAGCGATAGCCGTAGCGGATACAATGGCAAAAGTAGCAAATATCCAAC
+TTGTAGACACGGAAAAAGCAAAAGGTTTTGGCTGGATTACCGTGAAAGTGGAAGGTGATG
+TTGCTGCTGTGAACGCGGCACTGGAAGCAGGTGAACAAACCGCAATAGCCTCAGACAGTT
+TTATTGCGAAAAAAGTCATTCCTCGACCAGGGGAAGAGATTTTTACAGTATTTTGGCCGA
+AAGAAGAAATAGAGCCAGAAAAGCCGGAAGTGATGGTTGAAACAGAAAAAGTTGAGGAAA
+CCGAAGCGCCGACAGAAGCGACTTGTAATCTATGTCATGATCCTCTAAGCCCACGAGACT
+AAGGCGAATCTCGTATGCCGTCTT
+>SRR6126859_58 length_443_cov_1
+CAGCATCTATTTCATCAATAAAGATTATGCATGGAGAAACCTTCTTAGCTTGTTCAAAAA
+GATCTCTCACACGAGATGCACCCACACCTGCAAACATTTCAATGAAATCAGAACCTGATA
+AACTAAAGAAAGGAACACCAGCTTCGCCAGCAATAGCTTTAGCTAACAAAGTTTTACCTG
+TTCCAGGAGGTCCAGACATAATTACACCTTTAGGTATTTTAGCACCTATTTTTAAGAATC
+TGTCGGGAGTTTTCAGGAAATCAACGATCTCCGCAACTTCAAGCTTAGCCTCATCACAAC
+CAGCAACATCAGAAAATCTTACTTTATTATCTTCTGGATTACTCAATGTTGCTTTAGTTT
+TTCCAAAATTATTCATACTGTTTGAAGGGGAACCCGGATTATTTCTTCTTACCATAAAAA
+CATAAAAGGCGATAAGTAATAAT
+>SRR6126859_59 length_441_cov_0.914508
+ACCCTCGAAGTACGGCTGGAGCACGAGACCGCGCGCTCCGGCCGGGGCCTCGAGCGCGAG
+TCGACCGAGTTCCGCGTGGTCGACGCCGAGTAGCGCGGCCACCGCGTCGAGGATCCGGGC
+GGCGTTGAGCGTCGCGATGAGCGGCAGGAACGCGCCGTCGGCGGAGGCGAACCCGGCGAC
+GGTGCCCGAGCTGTCGCGGACCACGGCCGGCGTCACGGCGAACACCGTCCCGCTCGTCCC
+GATCGACACGGCGACGTCGCCGGCCGTCGCCCCGAGCCCGAGGGCGGCTCCCGCGTTGTC
+ACCGGCGCCCGCCCCGATGACGGTGTCCGGCCCGATGATGCCACCGTCGACACCGGTGCC
+GGCCGACTCCTCCGGCGCGAGCACACGCGGGAGGATCGCATCATGGCCGAGCGCTGCGAC
+GAGTAACTCGCGGTCGTACTC
+>SRR6126859_60 length_437_cov_1.01832
+GGCCACAGTTGGTCTGGCATTACTGCATCATATTCGATTGCATAGCCAACTCGCATCATT
+TCCACATTTTCAAGACCTGGAATAGTTCTTAACATTTCACGTTGCACTTCTTCTGGCAAA
+CTGGTGGAAAGACCTTGGACATATACTTCTTCGGTATTTTTGCCTTCTGGTTCAAGGAAG
+ATTTGGTGTCTTGGTTTGTCGCTGAAACGAACAATTTTATCTTCAATGGATGGGCAATAT
+CTTGCGCCAGTGCCTTTTTTCGTTGCTGTAAACATTGGTGAACGGTGTAAATTCGCTTGG
+ATTATTTCGTGGGTTGTTTCGTTGGTATAAGTTAACCAACACGGTAGTTGGTCAAGCAAC
+ATTTCCACCGTATCAAAGCTAAATGCGCGCGGATGATCGTCCCCTGGTTGTTCTTCTGTT
+TTTGAGTAGTCAATTGT
+>SRR6126859_61 length_435_cov_1.02632
+CTCATCTCTTTAAACAAAATATAATTTTTATGTACACATCCCTTTAAGTTTATCAGCTAT
+ATCTGTTTACTTTGCCCTAGCAATCCCCATTACTAAAGCAAACCAGATGGAATCTTTGCA
+TGACCTCGTGAAATTTTGGGAGTCCTCCTCTCCGCTTCATGATAAGGCTTACATTTAGAT
+TCACTTTAATCTATTGCAATTTCCGTGCCAAGTACTAAATTTGGAAAAAATATACGTTAA
+TCTCTTGAAAACGTTGTCTTTCTTACCTTTGAAATCGGATTACACACATACAGAAAAAAA
+CTGTGTAAGTAAGCGTTAACATTACACAGTGTTACTAATTTATCTGTTTTCCTTTCTGTG
+TTATAATGAGCATAAGCTAAGTAATACCAACAATTCGAGGTGATAAATATGGCAGTAAAA
+CGAGATATGCCGGAA
+>SRR6126859_62 length_434_cov_1.02639
+GGCTATCATTTGCCTGCTGCACCCAGCAGCTTCTCTATTTTCATCGTTCACTGCACTGAA
+GTCAGAGGTGCCAGTCAGAAGTAAAGGTTCTTGGGGAAGAAGGAAACAAGGAGGGATCTC
+ATTGCACTGAGCATGCTGCAGCTGTATCACTTTGAAAAGAGTCCCTGCTCCAGAACAGTA
+CTGGTGCTTACAACCTTGGCAAGATGAGCAACGAGCTAGTTAATTCAGTATGTTGGAGTT
+ACAGATGTTCCCCATCCCTTTTTCCTCCAGCTCAAACCTTCAGGAAACAGAAAACCCTCT
+GGAGCAAAACTGAAATTCTGCAAATGACATCTCCATCCATAGACAAGATGAGTCTAGGCA
+GTACTCATTTTTGTTTGACTCCTGTTCAAAGCCTGGACTGGACCAGAATCATGGGAAATA
+CATGTGAGCAGTCC
+>SRR6126859_63 length_428_cov_1.0429
+GATGCAAAACGGCTCCTTATTCTATGTATTACTAATTACATTAACACTCGGCATGGTTTC
+TCTAGCGCTAGGAATTTTACTTTCTACTTTTGCAAATAATGAATTTCAAATCGTTCAATT
+TATTCCTATCGTTATCGTGCCACAAGTGTTATTTTGTGGGATTTTCCCGCTCGATGGGAT
+GGCAGATTGGCTTGTGTGGATTGCCCATATTATGCCGCTTTACTACGGCGCAAATGCACT
+AACATCTATCATGGTAAAAGGAGAAGGATTCGCTTCGTTTGCAACTGATTTCTACATTTT
+ACTAGGATTTGTGCTCGTATTTGTTATATTAAATATTTTTGCTTTGAAAAAATACCGCAA
+AGTTTAAATGAAACAGGAGGAGATAAGACGTGGATGCAGAAGGAGACATTATCCGTCAAA
+TGCTTGAT
+>SRR6126859_64 length_426_cov_40.0108
+CCAACGTCGCCACCAGCGCTTCGGTGGCCGGGTGGCCGTAGGTGGCGCTCATGGAGGAAA
+TCGCCGTGTCCACGCCGTCGACGCCCGCCTCGATGGCCTTCAGCAGCGCCATCTCCGCCA
+TCCCGGTGGTGGCATGGCAGTGCAGGTGCAGGCGCACGTCATAGCGTTTTTTGATTTCGC
+TCACCAGCTCATACGCCGCCATCGGCGTGAGAATGCCGGACATATCCTTGATGGCGATGG
+AATCGACGCCGGTCTCTAACAACTGTTCGGTTAAATCCAGCCAGGTCTGCAGGGTGTGCG
+CCGGGCTGGTGGTATAGCTCAGCGTGCCCTGGGCGTGCGCGCCGTGGCTGCGCACCGCCT
+GCAGGGCGGCCTTCATATTGCGCGGGTCGTTCATGGCATCGAAGACGCGGAACACGTCCA
+TGCCGT
+>SRR6126859_65 length_416_cov_1.07756
+ACTTTTCGATCGATTTTTTGAATAAATCCATAATAAATATCACCAACTTGAACTTTTTCA
+GAAGGTCGTACAATTTCGATATCTATTAACAAATCATCTTCCATTGCCACTACTCGTTTT
+TCTATAGGAGCCGCGCTTACTATTAGCTTTTTCATCCAATCACCTTTTATAAAGACCCTT
+CATCTCAAAGATAAAGGGTCTAATTTTTATTTTCCACTAAAAAGTTGCTTTAAGCGAGCG
+AAAAATCCCGCTTTTTTTGTTTCAATCGACATTAACGGGATAGATTCTCCAAGAATACGT
+CGAGCAATATTACGATAACCTTGTGAAGCACGGTTATTTGGCAGCATAGCAACAGGATCC
+CCACTGTTTGAAGAGCGAATAACTTCATCATCATCAATGATAATACCAAGTAATTC
+>SRR6126859_66 length_416_cov_1.07756
+ATACCATACGGGCTAGAAAGTAAAATATTTTTATCCGCCGTTTTTAGCTTGACTCGAAAT
+ATACGCGTGTTCTGGGTTATTTTTTTCAAGCAGAAGACGGCATACGAGATTTTGTCATAA
+ACAAAAAAGCAGCTGGTTGCAACACTGGCTGTTTTCTTTTGCTGTTTTATGGGTATTTAA
+TGATGTTAGGCCCAGGGAAAAGGGAGGGGAAGGTATGCAAAGAAAATTAATAGGTAGTTT
+TTTCATTCTAATGGTGTTGCTTATTATTGGAAGTACTTCTGAAAAAGTGCAAGCTTCTCC
+AACATCTTCAAATGGCTGGCAGTTAAAATGGGCTATTAAAAATAATGATTTTGAAGATGT
+TGATATCACAGATTACGGTCAAAATGCTGGTACAACAAATGTATGGATGGTTAATC
+>SRR6126859_67 length_415_cov_1.08333
+AAACCAGATATGCGTTTACACATCGTTGACCAAGAAACTGGTGAGGTTCTTCCAGAAGGC
+GAAAAAGGAGAAATTGTCCTAATTGGTGCTAGCGTTTCTAAAGGTTACTTAAATGAACCT
+GAAAAAACAGACCAAGTATTCTTCGATTATAAAGGTTATCAAGCCTATCGCACAGGAGAC
+TCTGGTATTATCAAAGACGGTTATCTGTTCTTCCAAGGACGTCTTGACTTCCAAATTAAA
+CTTCATGGTTACCGCATCGCATTAGAAGATATCGAAAACAACCTAAAAAAAGTAAGTTAC
+ATTCAAAACTGCGCTATTATTCCGAAAATGAAAGATGAAAAGGTAGATATGTTAGTCGCT
+CAGGTCATCCCAACTACCCATGATTTCGAAAAAGAATACCAGCTAAGTGCAGCAA
+>SRR6126859_68 length_411_cov_1.64326
+GCATATTTCATTGTATTTACAAAAACAGAATAATTTGGGTCTTTCGTAAAATATTCATCT
+TCAGCAGCAATTTTGTTTGCTGGTAACCAACCACTAATTTTGGCAAATTCTACGCCATTT
+TCTGGTTTCGTTGTCCACCACTTCATAAAGTCCCATGCGCCATCTTTATGTTCGGCTTGT
+TTAGGCATTACTAATCCAAATCCGCCCATGATAGCGCCTTTATCGCCATTTGGTCCTTTA
+GGTGGTTCTACTACACCATAATCAAGGTCTTCTACTTTATTATAATCTGCTAAAGCCCAC
+GAGACTAAGGCGAATCTCGTATGCCGTCTTCTGCTTGAAAAAAAATTTTTCTCCATTTTC
+TTTTGAGCTTTTCGTTGCCATACTTTTTCTACTTCTGCTTTTTGCCCGATT
+>SRR6126859_69 length_411_cov_1.09551
+GCCTCGCTAACAGCACTCTTGAAAGAAATTGGCTTTAGGGAGGTAGTGGAGAAGGAGAAA
+GGGAATTGGATTTTGTATACGGTCAGAAAATAATTGCGAGCTATGGAAAATTTGTTATAA
+TAAATAAAATGCTCTAATACAGAGCCCAATTATATACATCATGAGGTGAAAACATGTTAA
+AGCTATACAAAAAAGAACAAAATCAAATCTTGTATGCTGAGTACTGGATTAATAATGATA
+AGGCAATCGTGCATTACGGTAAAGTTGGTAAGGTAGGAGAGAAAGAAGAAACCAGCAACT
+ATCTGGAAAAATACGAGAACAAAGCTGCATTTCATGAGGCGTTTATTAACCGATTTGTCC
+CACAAGGTTATAGCGAATATCCTCCAAACGAAAATTTCTGGATATTAATTC
+>SRR6126859_70 length_410_cov_1.09014
+AGTGCCTGTTATGGGGATGCAAGAAATTCCGGTGCCGAATTCGCTTCCTATGTGCATTCG
+CTTCATGGTATTCACAGATTTACATAAGCCACTTGGAGCGATTAACCATGTTTACTTACG
+CGGAGCAAAAGTATTGCGCCCAGATTTAGTGAAAGAGGGGGATGCGTAATGAAATGGAAA
+AAATCTCTTGCAGGTCTATCTTCTTATAAGCCTGGGAAACGCGAAGAAGAAGTGATGGCA
+GAACTTGGCTTAACGAAAATTACCAAACTATCATCTAACGAAAACCCGCTAGGAACTTCT
+CCAAAAGTGGCGGCACTTCAAGCAAATTCTAGCGTGGAAACAGAAATTTATCCAGATGGT
+TGGGCTTCTAGTTTACGCAAAGAAGTGGCTAACTTTTATCAATTGGAAGA
+>SRR6126859_71 length_410_cov_1.04225
+AAATTCAGTTGAACGATATCGTCTTTCCCGCGCAAACCAAGTGGTACAGCAAGACTCTTA
+TAGGTTTCATTTTTCGCCCAGCGTCCAGCAATGTTTAACTCTTCGACGCGCTCTACACCG
+TACATTTCAAGGAAAGTAACGGATTCTGGGATCGAGTTTTTCAAGTTTTGAAGATGGTTT
+AGCGGCGCAAGAGCTCGGCTGATTACTTCTTTATCAAAATCTGCTGGCAAATGATCCGGC
+ACGAACGCTCGGTTTACAAGGTCGCCTTGTTCCAAAATAATGTTCCCGCTCTTCGCATCA
+CGAATATCTACGACCGTTTTCACGTGTTCTGGCAAGCTCTCCATTACGTCCTGTACGAAC
+ACTAAAGAAACACCTAGTTCGCTTGGATCTTCATTGAAGAATTCCATAAC
+>SRR6126859_72 length_409_cov_0.977401
+ATCGCCTACAATATCTTGATACTCTATGCGAATGAACAACTCTAAATTTTGTTGTTTTAA
+AAACGTGAGCGCCAAATCCGCGTTAGCGTATGGCGAAGATGTCGGTACTAGCTCGTCCGT
+TTCCGTTTCAGGCAAGAACGTCGAACCCCTAAACAAGTGACGAATACCAATATAATTAAT
+CCCAATTTCATCGCGTGTCGTTTTAATCTGCTTTTGCACGTTGGCTTTAAGCACTTCTTT
+AAGCTCACCAATTGTTAAAATATTCATATTCTCACTAAGACAACGGGCAGTCTTTTCCGT
+AATATCAATTTTCTTTTTCTCAAATGGCGCTTTATTTAATTCCTTGCCCGGCTCCACATC
+ATGATAAAGTCGCGACAAATTCACTAAAATCTCCGGAGATGGCACAATT
+>SRR6126859_73 length_407_cov_1.03693
+CCCTCGCGCATGGCGTCGATCACGGCGCGCTCGTTGCATTCGGAGCGGATCGCGTCGCTG
+GACTGGCCCTTGAACTCCTGCGCTGAATAGCCGGTGGTGACGGTAAAGGCGGGGTTCACG
+TCGATCACGTGCCCGTCGAGGGACGTCACCATCATCGCCTCGCTGCTCGACGCATAGACC
+ATGGAGGCCAGGCGCAGATCTTCGATATGCCGCTTGCGCTCTGCACCCCGGCGACGCAGC
+GTGAAATACAGCAGCGCGAGGAGCAAGGTGGAGGCGGCCGCCTCCACCAGCGCGGTGCGC
+CGATAGCTTTCGTAAGGCGCCAGCACCGAGGCCACCGACTCGCCCACCAGAAAGTAGAGC
+CCGATCTCCGGCACATGGTGATAGCCGATGATGCGCTCCACGCCGTC
+>SRR6126859_74 length_406_cov_1.11111
+GACTGGGCCGAAACCTGGGCGCACTACCTGCACATGGTCGACGCGCTGGACACCGCCGTG
+TCATACGGCCTGGCATTGCTGCCCGACCATCCACAAGAGCCCGAACTGACCGACCAGACC
+CCAGTGGAAGAAGCCAGCTTCAACAACCTGATGAGCCGCTGGTTTCCGCTCACCTACGTG
+CTCAACAGCCTCAACCGCAGCTTGGGTCAGCCCGATGGCTACCCGTTCACGCTGGCATCC
+CCCGTGATCGACAAGCTGCGTTTCGTGCACCGCGTCATCGCTGCCTCCGCCCAGAAACCC
+CGTTGATCGCACCAATGTTGTGCGGCACAGGCGCCAGTTTGGATCGATGGAATATTTCGG
+GCGGCCGCGCGGTTTACCATCCGTAAGGTCAATCCCAGCATCCCCC
+>SRR6126859_75 length_406_cov_1.10826
+CGAAGAAATTTTAGTTATGCGAGAGGGACGCCTTGAAAAACGAAAAAGTTAATGTCGGCA
+TTGTATTAGCCGGTGGTCGCTCAAGCCGTTTTGGGGAACCAAAAGCGTTTTTTCAGGATG
+AGGCAACTGGAAAAACGTGGGTCGAGCTAACGGTTAGTAAGTTGCTACCGCTTTGCGATA
+TAGTATTTGTATCGGCAAATCATGAAAATCATTCAAAACTCGCGGCTCTTTTTGATGCAG
+AACCAAGCATTGAAATCATTCCAGATCAAACTGCATTCAGGGAATTTGGACCGCTCGGAG
+GCATTTATGCGGTGATGGTAGAAGCAGCGACTTATCAGAAAGCTAATTTCCTAGTACTTC
+CTGTTGATATGCCTTTTTTGACTCCAAAAGAAATTGGACGACTGGC
+>SRR6126859_76 length_404_cov_1.0659
+TCTTCCATCAGCGATTCGAACAGCGTGCGCGCGTGCTCTTCGCTCTCCAGGTCGGACAAT
+TCCAACAGCACGAATTGCGGATACGCCTGCGTGAACGGCACGCGCAACTGCGGGTAATGC
+TTGCGCACCAGTTCCAGGCAAAACGCCGACATCAGCTCGAAGCCCGTCAGCAACGTGCCT
+GCGTGGCCCTGCGCCAGCGATAGAAATACCAACGCCTGCCGCGGCGATTGCAGCGCCGCC
+AGTGCCGTCACCTTGGCGCGAGGCGGCGGAAACAGTTTCAGCATCGCCCCGGTGATGATG
+CCGAGCGTGCCTTCCGCGCCGATCAGCAGGTCACGCAGGTCGTAGCCGGTGTTGTCCTTG
+CGAAGGCCGCGCAGGCCGTTCCACAGTTCGCCGTTGGGCAGCAC
+>SRR6126859_77 length_400_cov_1.12464
+TCGTATGTGTTTGGTCCGCAAAAAGGGCTAGCCACAACAGATTTAGCTATGGCAGATGAA
+GCAATGCGCCATTTTTATCAATTAGCAAATCCTGCCATGATTACAATGCCGCGAGCAGGT
+GCTGGGGGTGGAATTGGTGCCGGACTTGTGACATTTGCAAAAGCTAATCTTTTATCGGGA
+ATTGATTTTATTATTGAAGCACTTCAAATCAAAACTGTTTGTGAGGACGCAGATTTGGTC
+ATTGTAGGCGAGGGGAAAATGGACGGGCAAACCGCACAAGGGAAAGCTCCTGTTGGCGTT
+GCGAAAGTAGTGCCGAAAGAAACACCAGTTTTTGCAATTTGTGGAAGTGTTGGTGAGGGA
+CTAGAAGCAGTATATGAAGTAGGTATCAGCGCAGTATTTC
+>SRR6126859_78 length_399_cov_0.918605
+GTCGATAATTTTAGTGATTTTAGTTAAGGCCCCTTGAACTTCGCCAGTCGCAATCGTAAG
+AACATAGCTAGTCGTTTTCACATTCCAGCCATCTTGGAGCAAACCAAGTAATTTTCCGTG
+TGTTAAAATTCCATAAAAGTTACCTTGCTCATTTAAAACCGCAATATATGGAAGCTCTTT
+GATTGTAAAAAAGACTTCAAAGAAAGATGCATTGACGCAAATATGCTTCTTTGCATTTTT
+AATTAACCTCTTTACTGGGTCATTAAGACTACCGCCGTTAGCTGCGTGTTTGTAAATATG
+CATTTTATAAATATTACCTAAGAATTTTTCACCTTTTTCGTCTAATACAGGAACACAGCG
+ATAACCAGATTCTTCAAGTAAATGGATAGCCTCTTGTAA
+>SRR6126859_79 length_398_cov_1.13703
+TCGGCAAACTGGCCATCGGCGACTTTCGCTCGGCCATCGCCAAGGTGCAGAGCTTGCCTC
+CAGAGCAACGGCCGGATCCGCCTTACCTGGGGTTCTTCGATGAAGCAGGCTCATACGTGA
+CGCCAGCATGGAGCCGCATGTTTGAGCAATCCCGATCCGCGCGGCTTGTCATGATGCCGG
+CAATCCAGACCATCGCCAACTTGGACGCGGTGAGTTCGGAATTGCGCGAAATGGTGCTCG
+GAAACACCGTGGTCAAGGTGTCCTTCCGCATCGGCACCGAAGACACTGCAGAACATGTGA
+CCAACTTTTTCGGGACCGAGCAGGTGGCGTCTGTCTCGGTATCGATGGGACGCGGTGGCG
+GCATCAGCGCGAGCGCAGGTACGGGGCAAAAGCAAAAC
+>SRR6126859_80 length_395_cov_0.979412
+AAATGAGATAGTGCACAGAAAGCTCTTGGTACGGTGTCAGGCACATGGGAAGATCACAGT
+AAATGTTAGCCTCTACATGGATCAGGAATGAAGGAATCCCGAGGAAGACACCATCAAGGT
+TGAAGCTGCTGGAACTCCAAGATGAGGTTACATTCAAATGTGTTTTCTCAACCAGGAAAG
+CCTCTGGAAGCATGGGGGCTGTTAAGAGCAGATTGCACATTGCTTGGTCCCCTTGCCCTG
+GGCTCCCGGGTAGGCAGCCAGAAACCCCTGAGCAAACTGGTATTAGCTCAACTGTTTGAA
+CCCTGACAATTCAGCCCGCTGCTCCCCCTGCCCCTTGGCCTGGAGCTTCCATGCAGGGAG
+AGGCTGCCACCCACCAGATAGCGTTCCCACCAGGC
+>SRR6126859_81 length_392_cov_1.09199
+AATTATGGCAAAAGATACATCGGCAAAAGTAATTATGTGTTCGGCGATGGGTCAACAAGG
+TATGGTTGTAGACGCCATTAAAAAAGGTGCGAAAGATTTTATCGTAAAACCTTTCCAAGC
+GGACCGAGTTTTAGAGGCGTTAGAAAAAGCAGCTAAGGAGAGAAATGGAGGTGGATAGCA
+TGACTACAAATATGTTAGACCTGTTTATAGAAGAAGCTTCAGAACATTTACAGGCGCTAA
+ATGATAATCTGTTACAGCTTGAGAAAGACCCGACGAACGGTCAGTTAGTAAGTGAAATTT
+TCCGTTCAGCACATACGTTTAAAGGGATGTCCGCAACGATGGGCTTCCAGCAGGTGGCTG
+ATTTAACGCATGCAATGGAAAATGTACTAGAT
+>SRR6126859_82 length_392_cov_1.04154
+GCATTGTCATAATATTTATAGTCTTCGGTAAGCTCTGCCGCTTTCAAAGTAGACTTAAAT
+TTGCCATAAGTTCCCACCCACTCCAGCATGTTACGGGCGTTAAAATTTTTGTACTTGCTT
+CGTGAAGGCGCCGCTATCGTTCCTGAGAAATTCCGGCTGTCATCATATAGGTAACTGTAT
+AGCTTAAGGGTGTTTCTATCGTTCAGCCTGTAGCCAAACACTCCGTTAAAACTGGTATTG
+TAGTACTGCCCGTTCTCATTTTTCATCTCATAGCCGTGATACTCATAATCATTATCAGAG
+CTGTTTCTGTTCAGGTTTATATTGAGACTAAATTTACGATAGGCAGCTACCATACGGTAA
+CTGGCTCCCAGTGTATTAAAACTGCCGTAGTC
+>SRR6126859_83 length_391_cov_1.16071
+GCACTCATATCATAGTTGTTATTGTTGGTATTATTATCATAAGTGGGAAACCCCATCCAT
+CCTGGTCCCTTTTGGTTACGAACCTAGGGGTCTCCAGAGGGGCCTCAGCTTTAAGCTCTT
+ACCAATCCTCCCATTGAAGGAAAGGAGGTGGGAGGCTGGATACACAATAGATGTATCCTT
+GGTTGAGTGGTAATATGATTTAAGAGAGAACATATCCTGTGCCACCTTCCAGCCACTTCC
+CCCTGGGGGAAAAAAAAAGCAACCTATAAAACACTCCTATAGCTGCCTAGATGCAATCAG
+TGAAATATATTTGGATTCGGTGGTAAAATCCTTAGAGGGAGAGCCACTAGTTAGTCACTC
+CATGTTGTAATTTATATAATACTGTATATAT
+>SRR6126859_84 length_391_cov_1.14286
+GCGCTAGCTGTTTTCACCTTTGTACCAGCTTTATTATAGAAAGCTGCTGTACCATTTGCT
+ACTGTACTTTCTGCACTTGAAACTTTATAGGTTGATATGCCAGATACTTTCGTATTGGAC
+TCATCATCCGCGTCCCATATTGCGCCTTCATATTGGACAGATGTAACGCCTGGCTTGATT
+TTACCGTATGAAGCAGTAGAGTTCCAACGATAAGTAGCCGAAGCTTCTGTGCTCTGATAT
+CCAGGCGCAAAATCTCCCACATTTGCTTTTACTTCTGTGAAATATTCCCCTTCTTCAAGC
+CCAACTGCTTTTGCATCTAGTCGATACATTTGGTTATTATTTTTAATAAGCGCTCCATCA
+AATGTTCGAAAAGTGTCGTTTAAATTTGTTT
+>SRR6126859_85 length_390_cov_1.0806
+TGATCGTAACGATTTCGCTATCGTCATCAAGTAGTTTTTCTAGTGTTTCGTAAGCGGCTT
+CTTCTAATGTTGCACAGCTAACTTTGATTTTACCTTCGACCATACCGATGAAGCTGTCTT
+TTTTGATTTCTACACCTTCTACCGTTGTATCACGAACGGCTGTCGTTGCTTGGCCACTTG
+CTACGTCTTCAATTGCTGCTTTCATTGCTTCTGCATTAGCTAAGAAATCTTGATCTGCTT
+GGAATGAAAGAACAGCAGTAAGTCCTTGTGGAATTGTTTTTGTAGGGATGATTTGCACTT
+TATCATCTCCTAGAATTTGCGCTGCTTGTTCCGCAGCCATTTGGATATGTTTATTATTTG
+GAAGAACAAAAACTTGTTCTGCATTGGCTG
+>SRR6126859_86 length_389_cov_1.16168
+TGTCCATCTCGGCGTCGTCGCCCATGACTTCGAAGAGCTTTTCGTTGAGCACGACGATCA
+GCGAATCGACGTTGCCTTCGAGGTCGTTCGCGCCATGCTCGCCAACCTTCGAACGGCGTG
+CGCCTTCGAAGTCGAACGGCTTGGAGACAACGCCCACGGTCAGGATGCCCATTTCCTTGG
+CGACCTGTGCAACCACCGGTGCTGCACCGGTGCCCGTGCCACCGCCCATGCCGGCGGTAA
+TGAAGACCATGTGCGCGCCACGCAGTGCGTCGGCGATCTGCTCACGGGCTTCCTCTGCGC
+AGTGCTTGCCGACTTCCGGCTTGGCGCCAGCGCCCAGCCCCGTGCTGCCGAGCTGCAGCA
+CGCGCGATGCGGTGGAGCGCTTGAGCGCC
+>SRR6126859_87 length_386_cov_1.17523
+GGCTTAAAATTACTCGGTTATTTTCCGGTTCAAATTCTACTACTTTGAAAGTAAGAGTAG
+TTCCTTTGTAATCTGCGAAATCTTCCACAAAATGGTCTTCTACTAAAGAAGCTGGAACAA
+ACGCACGAACACCAAGGTCAACAACTAATCCACCTTTAACAACATCACTGACTACCGCTT
+CAAAAACTTCACCAGATTCGAATTTAGCTTTAATATCATCAGATGCTTTTTCTGCATCCA
+CTTTTCGTTTAGATAAAACAAGTATATCGTCTTCTACTTTTGTGACAATCAAATCAAGTG
+TGTCGCCAACGCTCACAACGTCAGAAGCTGTCTCCACATGTATATTGGAAAGTTCACTTA
+TTGGAACGACACCATCAAGTTTGCTA
+>SRR6126859_88 length_385_cov_1.18182
+TTATAAAGTAGTCGATCAAACACCACCAGTTTTGAAAGAGATTGATAAAGATGCTTCTTT
+TGAAAAAGGAAAAACGTTGACTCCTGCTGATCTTGCAACAGCTACTGATAATTCTGGAAA
+AGTAACACTGGCTTTCAAAGCTGGACATGAAGCTGATACTTCTACAGCTGGAAAACATGA
+AGCGATTATTGTAGCAACAGATGAAGCTGGAAACACAGCTGAACTAACTGTCACTTACAA
+TGTTGTTAATAAAGCAGTAACTATTAAAACACCTACTATTAACGAAACTACTAGCACAGC
+ATCAACAGTTTATGGTAATACTTCACCAAATGTAACGGTTGAAATGTTTAATGAAGCTGG
+CGATGTTATAGCAACTACTACATCT
+>SRR6126859_89 length_383_cov_1.1311
+GGCCTTTGTTGTTTTGGTACAACGCGCGTATCCACATAACGGAAATTCCCGGTCATTTTC
+ACTGCATAAAAAACATTCGGTCCTTGTACTAATTCTGCGATTTTTTCTTCCACCGCTTGT
+TTTGATGTCGGTTCGGAGACAGAAAAAGAAGTATCGGCATCAAAAAAAGTAGTGCTCGCA
+TAAGGTGTCGTATCTTCCGGTTTTACTTTATAAGCTTGCCCATCTGACCGAATTTGAAAA
+GCTTCCCCGTCTAAAATAATTAATTCACCATCAAATTGGTCAAGTGTTCCTATACCAAGG
+TCACCGTGCTGTAATAATTCTTTGAAACTCGTTGTTCCGCTGAAAAGCCCACCAACAAGT
+GCTGCCATTGTAGAATGCTGAAA
+>SRR6126859_90 length_383_cov_1.01829
+GTTACAAGTGAAGCAAAACAAAAAGATTTTGTTACAGCACACGCAGCCTATAGCTACTGG
+GAAACAGAATACGGCTTGCACCAAATTCCTATTGCCGGTGTATCAACAAGTGATGAACCT
+TCTCAAAAGAAATTAAAATCTATCGTTGAAAAAATCGACGCTGAGAAGATCCCATATATT
+ATGTTGGAACAAAATACTAATTCAAAAATAGCAGATGTTAGTCAACAAGAAACCAATACA
+AAAACACTGACACTCCACAATCTAGAAACACTTACACAAAAAGACATAGAGCAAAAACGT
+GATTATTTTTCCATTATGAATGATAATTTAAAAGCTTTAAAAGAAGGTCTTAATTATTAA
+AAAAGAAAGGCGCTCTATTTACT
+>SRR6126859_91 length_379_cov_1.20062
+TTACTGTACTGCTATTTGTGTCAAAAAGATACCGAATAAAAATCGTGTTCACAATTTAGA
+CATGAAAAAGTCACTTTTTAGCAACAATTTTAGTGATTTTATCAATAAAAACTTACTTTT
+TCTTCCCTGGAGAGATATCCAACCAAAAAAAGACCCTCCGTAGATAGGAGAGTCTTTCAA
+AACTTCTTGTAAACATCAATGGAATTGCCAAAATTAATGAAATATCCACCATAATCATAC
+ATTGGACCATATTTTTCCGCGTAATGAGAAACTGTATGGCGCAAAAATTCTTCTGTTACC
+TCTAAAAACTCCGCTACTTCAAAATATTCTCGTAAGCCTAGATAAAAACAAGCAATGATG
+TCATCAAGCGGTATTAGTT
+>SRR6126859_92 length_379_cov_1.2037
+GGGTCATGGGTGGGAGAAAGAGAAGCTCACAAAAGAGCTATCAGAGAGATGAGAGGAAAC
+CCAGGAGACTGTGAGGTCATGGAAACCAAGAGGGCTAAGAAGACTTTTAAGAAGGTGGAG
+GTGACTTGTATTGTATGTCCCCAGTAGATATCAGTTTGAGCAAAACCTCAGAAAAGGCCT
+GCCTTGCTTGCAGAAGGAAGGACTGGAGACTTTTAACAATTAATATGTATCTCTGGGAAC
+TGCCAGTCAACTGATCATGATTCCACCTAACTGTTTTAGGTCTAGCTCATGTTTGTGTAT
+CATTCCAACAGCTATTGTTAGAGACCTTGTGTAATATAAAGTACACATGCAATCATTTTC
+TGAAACATTGGTAAAGAGA
+>SRR6126859_93 length_375_cov_1.2125
+AATAAAAACATTCGTTGTAATGCAATTGCGCCAGGAGCTGTAAATACAAACATTGGAACA
+ACGATTTATGCGCCGGATGAATTCGGCCAAGAACGTGCCATGATTGGAATGGGGATTAAC
+CCCCGAGCTGGCGATGCTTCTGAAATTGCCAAAGTCGCGCTATTTTTAGCTTCGGATGAC
+TCTAGTTTTGTTAATGGTACAGTTATCACAGCCGATGCAGGTTGGACAGCTTACTAATAA
+AATTTCGTCCACAAAGGAAATCATTTTCTTTTGTGGACTTTTTTTGAGAAAATAGAAGAA
+TAAAGCTTTGGGACAGCGTCTATTTTTGCAGAGGTTGTTTCTTTATGCGTATGAATAGTT
+GTGAGCATATTGGGG
+>SRR6126859_94 length_375_cov_0.95625
+GTTAACTCCCATGAAATCTGGTTTTCCTTTTTTCAGAAGTTCCGTATCTCCTGGTAAGAT
+TTGCGGTGCAAGACCGTGCTCTTCCAGCCAGTTCCAAGTAGCTGTAGGATATTCACCCCA
+TGTGTAAACATCCATCCAGAAATGGGCGTTGAATTCTTCGGAGTTTGCAGAAGCTAACAC
+GTTCGCTGGGGTGGCATCAATGGAGTAACTTGGTCCGTAAGCAAAACTTGGTCCAAGTTT
+TCCAGATGTTCCTAGCTCGCGGAATTTAGCAATTGCAGAAGCATTCGCCAAGTTCGCATT
+GTGATTTGCCGCAAACATACGCTTGTCGTCAGAAACGCCAGGTGGGTGATACGCTAATTT
+GTAACCGTGTGAGAT
+>SRR6126859_95 length_371_cov_1.23101
+GGCTATGAGTTGGACGCAACACCGGTTACCTTTACCATCGAATTTAACCAAGCAACTGCA
+GTAAATGTAACTAAAGAAAATGTTGCGAAAACTGGTAGTGTGGTCTTAACTAAGCTAGAT
+AGTAAATCAAGAAGTAATTTAGCTGGTGCAGAATTTGAACTACAAACAAAACTTGGGGTA
+AGTTTGAAAGACAAAGTAGTGACAGAAGCAAATGGTCAACTGCAAATTGATAACTTGGCA
+CCAGGTGATTATCAATTAGTAGAAACGAAAGCTCCAACAGGTTATGATTTAGATGCTACA
+CCAGTTGAATTCACCATCGAGTTCAACCAAAAAGCACCAATTCAAGTGACAAAAACAAAC
+ACGATGTCTAC
+>SRR6126859_96 length_368_cov_1.17252
+CGTCAAAATCATGTGAATCCGTGTTAAAAACGATAATTTCGTTCGCCGCAAGTGACAAAT
+CATCGGCAATCTTCTTCACAATCGTGTTTTCAATACTATCACACAGTTCATCAGCTTCTT
+TCATCCGGTGCAAAATATCTTCGGCAACTGGATCAGAAACGCAGCCCGCCAAGCTATCGT
+GCGCTTGACCTTCAAGCAATTTTTTCCACGTATGCATTAGTAACCGCTCGCTAATAGAAA
+TTCCGGATGCTTTAGCAATAACAAGAAGTGGCTCAATACGTGTTAGCAATTTTTGCTCGA
+GTGACGCGCTTTTCAGCTTAATATTCATTCGGCTAGATCCAATAGTTTTATGCACTCGCG
+CAAGAACC
+>SRR6126859_97 length_366_cov_1.2508
+CGTATTATTGAGCTAGGTGGAACGCAAATGGAAGCTAGTTTGGCTGTTGGGCTATTCTCC
+ATCGTAGCGCTATTAATGCGGGCGATTGCTGGGAGTTGGAATGACAAATTCGGACCGAAA
+GTACTTATTATCGTGGGCTTTTTGATTTTAATTTTAACTACAGTGAACTTTTATTGGTCA
+ACTGTGGTGGCTGCCCTTCTTATATTGCGGCTTTTTCACGGAGCTGGTTGGGGAATTGGA
+ACGACATCGATTGCGACGGGGGTATCTAAACTAGTACCCCCAAGCAGAACTGGGGAAGGA
+ATTGGTTTTTACGGACTTACGACTGCGCTTGGAATGTCACTTGCGCCGATTATCGCTATT
+TTAATT
+>SRR6126859_98 length_365_cov_1.25484
+ATGATTGGATTTGACCTTGGTGGACCTGTAAATAAAGCCGCTTGGATGGCTGGGAATGCG
+CTATTTATGAGTGGGATTTATCTACCTTCGATCATGATTAATGTCGCAATTTGTATTCCG
+CCACTAGGCTACGGAATCGCAACACTTTTACGCAAAAAGAATTATTCTACTACCTTTAAA
+GAAGCTGGAAATGGTGCGCTAATTATGGGGCTGATTGGTGTCACAGAAGGTGCGATTCCA
+TTTACACTACGTAGCCCGGGTAAATTAATCCCGCTAAATGTTATTGCCTGTGCGATTGGT
+AGCGCCGTAACAATGGGACTTGGCGCTTATGTGAAAATGCCGCCAATCGGTGGGATGTAT
+GGTTT
+>SRR6126859_99 length_362_cov_1.26384
+GCTCTATTCGCGATAATAATTTGCAAGTCAACGGTTAATTCTTCTGGTGGGTTTTCCAGT
+AATTCGTTTTTTTTATCCGCTTCAATATGCCAACCAAGTGGCGTCATTTCAAGAAAATCT
+GCAAATAATTCTTTGGCAATCGGCGCTTTGTAGGTGACTCGTTCGACATGTTCTACGCTT
+AACTTTTCTGCTAACCGTGATGTAACCGACTCATTCGAATAACTACTTTTCTCATCAACA
+TAAATAAATTCGCGTAATTCGCGTAAATAATTCGCTTCTGGCACTACTTTTAACAAAAAT
+CCATCCTTCTTTAAAAGCCGTTTGAACTCCACGAGACTAAGGCGAATCTCGTATGCCGTC
+TT
+>SRR6126859_100 length_357_cov_1.25828
+ATTTTACTTTTTATTAGTGTGGGCTTTACTTTAATCGTCCCATTTTGTCGCTTTACTCGG
+TATATTTCACGAACTTCATTGTATGTAGATTCAATGTTGATTCCAAATTGATCCGCAGAA
+ATGGATTCCACTTTTACTCGACCATTCGTAGCGACCAATGTGGCTGTATTTTTGTCTGAA
+AGTATATTTATTAACAGTGATGCAAGCTCATCATCTTCATTGAATAAAAAGGCTGTTTCT
+CTGTCGCTTAAAAAGCCTTCAATGCTTTCATCACGCTTGGCAACAACTGGTAAAGAAGCG
+GCCATTGCTTCTGCATAAGTCAAACCTTGTGTTTCTGTCGTTGAAGCACTCACAAAC
+>SRR6126859_101 length_357_cov_1.28808
+AATTGTCTATGTCAGCCACATCTTGCTCGGTGTGTGGCATTTGTTCTATTTTTAAGGTTG
+GGTAGCTTGTTCCGAAATATTTTGCCATTCGGTCGACAGCTCCGCAATAAAAATCCATAC
+CCCATTGTGTTTCCCCAGTGCCAAAAATGGCTACATTCTTGGGCTTTACGGCTAGTTCCG
+CGATAAAATCTTTCATATCTGGCGGTGTTCTTCCGTAGTCGACTGTCCATGCCCCCAACA
+CGTACAAGTCAAAATCCTCATCAAGCGGATACTCGGCTAAAGGAGATACGCGAAAGGACA
+CAACTTCATGCCCTTCGCTTATTAGTATCTCTTCAATTTCATCAGCTACCATTTTTG
+>SRR6126859_102 length_354_cov_1.30435
+ACCTAGGCCTTGCGTATCTGCTGTTAAGTCTGCCGTTTCTTTGATTACCTCTCCCATTTG
+GCGGACAGCATCCATATTGATTCCCGTTCGCGTCGAGCCAACATTGACCGATGAGCATAC
+GCGTTCCGTTTGTGCGAGTGCTTGCGGAATCGAGCGAATCAGGATTTCGTCACCTTTCGT
+GTAGCCTTTTTGAACGAGTGCGGAATAGCCCCCAATAAAATTCACGCCAACTTCTTTTGC
+AGCAGCATCAAGTGTTTTCGCAAATTCTACGTAGTCAGTATCTGCGCTTGATCCAGCGAT
+AATCGCAATCGGAGTGACAGAAATTCGTTTATTAATAATTGGAATGCCAAACTC
+>SRR6126859_103 length_354_cov_39.5084
+GCCCGCTGCTGGCCAACCCGCGCACCCTGCTGCTGGGGGCGGCGGCGCAGTTCGGCATCT
+TCGCCACCGTGCTGGGGGCGCTGACGCTGAACTACTTCGGCCTGATTTCCTTCACCCTGC
+CGCAGGCGGCGGCAATCGGCATTATCGGCGGCGCGGACGGCCCGACGGCGATTTATCTGT
+CGGGCAAGCTGGCCCCGGAGCTGCTGGGGGCCATCGCGGTGGCGGCGTACTCGTATATGG
+CGCTGGTGCCGTTAATCCAGCCGCCGATTATGCGCGCGCTGACCAGCGAGAAAGAGCGCA
+AAATCCGCATGGTGCAGCTGCGCACGGTGAGTAAGCGGGAAAAAATCCTCTTCC
+>SRR6126859_104 length_349_cov_1.31633
+CTTATTTCCTCGCTGTATTTAATGAATTAAAACGACTAGGGGAATGGGACGCGCCGAACC
+CTTTAGAGAACGTTCGTCAGTTCAGAACAGAAGAAAGTGAGATGGCTTATCTTACTGGAG
+AGCAGATTGACCGGCTCTTAGAGGAAAGCCGCCATAGCTCTGCTAAAGATTTAGAGCTCA
+TTGTTAGAATTTGCCTGTCTACTGGCGCTCGCTGGGGAGAGGCTGAGAAATTGAAGCGCA
+GCCAAATCACTGCTGGAAAGGTCACATTTATAAAAACGAAAGGTAAGCGCAACCGAACTA
+TCCCTCTTGACCCTAAAATCATAGCTGAACTTCCTAAAAAGAACGGCAC
+>SRR6126859_105 length_348_cov_1.33106
+ATTTCAAGAACAGCTAAATCGTTCCATTCATCTGTTCCAAGTAATTTTGCTTCGGATTTT
+TTACCGTTTGTAAAAGTTACTTCTAATTTATTTGCATCCGCAACAACGTGATTATTTGTT
+ACGATGTAGGCTTTTCCATTTGCCTTTTTATAAATAACACCAGATCCTGAGGAAGCTTCT
+TGTTCAGAAGTCGTTGTTCCATCAAGGGATGAAGATGATTGGTAATTTAGTACACTGACT
+ACCGCATCTTGCACTTTGTCTACTGCTTTTGTTACATCTGATGTTGTATCTACCGAAACT
+TTTTCTACTTTGGTAGCTTTATTATTTGAGTTTGAAGTTGTATCTGCG
+>SRR6126859_106 length_348_cov_1.06485
+CCGTTTAGGAATAGATGCAAAAACGTGTAAAATTCAAAAAATCACAACGACTGGATTAAA
+ACAACATACGAGAGATAAAGGATATAGCGAAGGCTCAGCATCAAATGAGAACACAGCGTA
+CACAATTACTTTTGATCGTGATGTAGAATTCTTCGTGGATGTTATGGATGTGGACGAAAC
+CGGACAAGCTTTAACAGCGGCTAATGTTACGAAAGAGTTTAATTCGCGCCACTCTGCACC
+AGAGGTTGACGCATACAGATTTTCAAAGTTAGCTACAGAAGCTAAAAAGAATGGTTATTC
+TACTGCGGAAACCATTACAGAAGAAAATGTATTTCGCACACTTAAAGC
+>SRR6126859_107 length_348_cov_0.849829
+TGACGAACACCTCTTGAAAAACTAACAGGTGAAGGCCGGGCGCAGTGGCTCACGCCTGTA
+ATCCCAGCACTTTGGGAGGCTGAGGCGGGGGGGTTGCTTTAGTCCAGTAATTCCAGATCA
+GCCTGGGGAACAAAGAGAAGGCCTGTCTCTTCAAAAATTAGCTAAGCCTGGGGGGGAACG
+CTTTTTGTTTCAGCTTCTTTGGAGGGCGTGGGGGGAGGGTTGCTGGAGTCTGGGAGGTGG
+AGGTTGCAGTGAGTCGAGATCATACCACTGCACTCCAGCCTGAGCAACAGAGCCAGACCT
+TGTCTCAAAAACAACAACAAAAAACTTGCATTAAAGTTCACAAAACAT
+>SRR6126859_108 length_346_cov_1.20619
+GAAGTAATTGACTTCGGAAAAATAATCGTATTGCGGTTCAAGTGCCATTGTAAAATCACT
+TGATCTACAGATGCTTGATGTTTTTTCGCAATTTCTGTAATAACTGGATTTTGCATTAAG
+ATCCCTTTTGCAAGCGGCGACCATGCAGCATGCGCAATATTCTGTTCCGCCAAATACTTA
+CGAAGATCATTTTGCGGTAACAGTGGATGCGCAATTTTTCGTCATGAAGCCGCTCCATCG
+CTCGCCATGAATCGCGATATTTCCCGGCAACGGGCCAATGAATTAAATACAAATCCAAAT
+AATCCAACTTCAAATTCCGAAGTGTCCGCTCAAACGCAAATAACGT
+>SRR6126859_109 length_344_cov_1.34256
+GTCAATTTTAGTAAGTTTACATGAATTTGGGCATTATATTACCGCAAAGTGGTTCAAAAT
+GCGTGTTGATAAATTCTATCTTTTCTTCGACTTTTTGTTTCCAGTACCTACTGTTTTAAA
+CTTCGCTTTATTCAAAAAGAAAATCGGTGATACAGAATATGGTTTAGGGTGGTTTCCATT
+AGGTGGTTATGTTTCTATTGCCGGAATGATTGACGAAACACAAGATGCTTCAAAATTATC
+TGCCATTCCTGAACCTTGGGAATTCCGTGGAAAACCAGCTTGGCAACGTTTAATTGTAAT
+GCTTGGTGGAATTATTGTCAACGTAATTTTGGGAGTTGCTATCT
+>SRR6126859_110 length_344_cov_1.29758
+GGCCATATGCAGGGCTCCAAGAATAATCAGTTGAAGTCATGCTTGGTAAGCTTTTTTCTG
+TCTTAATTGTCTCTGAATAATACACTTTGTCTTTTTCGCCATTACCATCTAACAAATCAT
+ATTTTCCTTCTACTTTAACAACATAATCGGTGTCTGGTGAAAGCTCTGTAACTGAAACAT
+CACGCGTCGGTAATCCATCAACTCGAATTGAGTTAACAAGTGTTGTTCCATCTGCTTTAT
+AAACATTTACAAATAACTCATTCTTGTTGGCTTTCTTAACTGTTGTATTATCTTTATCTT
+CACCAATAACGTCTAATTTGACGCGTTTATCATAAACACTAATG
+>SRR6126859_111 length_344_cov_1.31142
+ACGTAAGTCGCAATTATTGGTTTTTTTCCTGAGCGATTTTAATCTGCATGATCGTAGCGA
+TGCTCACAGCATTCGTCTTGATTTGTTCGGCTTTACTGCCCGCAAAAAGTTCGTCAACGG
+TAGAATAGAAATGGTCGTGCCAAATCTTAAACAATTCCGGCGATAAAGGTTCTTTCCGAT
+GGATATCAAGATGGATTTCGGTAAGATTACGCGTATAACCACCCGTGCCTAAAATCGCCT
+GCGACCAGAACAGCACCAATATCGGCAAATGCGCTTCGATATTGATTTTGACCACATCGG
+TGAAAATATAACTGATGCGCTGGTCGGTCAACAATTTCTTGTAG
+>SRR6126859_112 length_342_cov_1.35889
+CATTAGATGATTCCATTTGATTCCATTTGAAAATGATTCTACTAGAGTCCATTCAATGAC
+TCCATTCGAGTCCATTCAACAATTCCATTCGACTCCATTCGATGATTCCATTCGATTCCA
+TTTGATGGTTCCATTCGAGTCCATTTAATCATTACAGTCGAGTCCATTTGGTGATTCCAC
+TGGATTTCTTTTGATAATGATACCATTCAATTACATTTGATGATGATCCCATTCAATTTC
+ATTTGATGATGATTCCATTAGAGTCCATTCGATGATTTCATTCGAGTCCCTTCATTGATT
+CCATCCGATTTCATTGGATGATGACTCCATTCGAGTCCATTC
+>SRR6126859_113 length_342_cov_1.19164
+ATATATCCATATTCCGTTTTGCGAACATATTTGCTATCACTGCGATTTTAATAAAGTATT
+CTTAGAAGGACAACCGGTCGACGAATACGTAGATTTACTGATTAAAGAAATGGAATTAAC
+AGTCGCAAAAGGACCAATAGCGCCAGTCGACACGGTATTTGTCGGTGGAGGCACACCTAC
+AACCTTAAACGAAGCGCAAATTGCGAGACTCTGCACCGCCATTCATAACACTCTGCCGCT
+CAAAAAAGATATCGAATTTTCGTTTGAAGCCAACCCAGGAGATCTTTCGCTATCTAAACT
+ACAAGCAATGCAAGATCACGGAGTTAATCGTATTAGCATGGG
+>SRR6126859_114 length_342_cov_0.923345
+CTATAAAAATAAGCCATATCGGTATAACCAGATTTTCCAGCGATGATGGTTAAGTTATCT
+TTCGTTTGCAGTAATTCTTCTTTTGCGTAGTTTACTCGGTAGCGATTTAAATAATCTGTA
+AAGTGTTCTCCCATTTCTTTTTGAAAAAGTTGACCGAGATAAACTGCGTTAATATGGAAG
+TCGTTGCCGAACGTTTTCAAAGACATTCCTTCAGCGAAATGTTCCGTGATGTAGGAAAGC
+TCATTTTGAATAATGGGGCTTTTTGATACATCTGTGTGGTTTTTTCGGTTATAGTAACGA
+ATAGCATAGGCTAGCGTCGCCGCTTCCAATCCCTCAATACTC
+>SRR6126859_115 length_342_cov_31.9024
+AAATCACCATTGATGTTATTGAACTGGTTAATGATAACGGTATTCCCGGCGACAATATGA
+CTAACGACGCCCATCCGCAGTTCCGCGTGACGGTACCGGGGGACGTTAACGAAGTTAGTC
+TGAGCATTGACGGTGGCGTGACCTGGGTTAAGGCGACACAGAGCGCGACGCCGGGCGTCT
+GGAATTATACCTGGCCGGGCACCGTGCCGGATGGCGACTATACGCTGAATGTGAAAGCGA
+CTGACAATGCGGGTAATACGGTGACGGAGACACTCCACTTCACTATTGATACCACGCTGT
+CAGTGCCGGTCATCGTACTGAATAGCGCGGACGATACCGGTG
+>SRR6126859_116 length_341_cov_1.36364
+ATATAAAGGTAAGCAGAAGGGCCTATGGATGAACAGTTTTGGAGAGATCTGCAAGACTTC
+CCAGAAGAGATGATCATCCAAGATGAAACCTAAAGGAGAAACAGAAATTACTCAAGCAAA
+GCAGAAATAAGAATGTTTTAGGCTAAAGAAAAAGTGTAAGAAGGCATAAAAAGAAAAAAT
+AAGGTTTGTTTCATGAACTGCATGAAACAAACTCCTCTCACTGTGTGAGAGGAGTAGTAA
+GGAGAAATCATCATGAAAAGATTAGAAGATCATGGAAAACCTTACATGACAGGTGAGAGA
+ATTTGAAATTCATCAAGAGGCATTGAAAGACCCATTTTAAG
+>SRR6126859_117 length_341_cov_1.36364
+GTCGTGCTCTGTCGTTACATCTTTTTGAATGCCGACAAAATACAAATGATTATGATCATC
+GTAAATCGGTTCAATCGTAAGTTCATTCATAAAAGAAGTTCCATCTTTTCGGTAATTTTT
+TAGTAAAACATTCGCAGTTGATTTTTCGTTAATGGCATGACGGATTTTTGCAACTTCTTC
+TTTGTCAGTATCGTCTCCTTGTAAAAAGTGACAATTGGAGCCAAGTGCTTCTTCTTTAGC
+ATAGCCGGTAATATTTTCAAAACCAGTGTTAACAAAAATAATTGGATTATCTTTTTGCTC
+AGGATCCGTGATAATTACTCCTACACTAGACAAATTTAATG
+>SRR6126859_118 length_341_cov_1.36014
+GATCTCAGGTGGTCCACCTGCCTCAGCCTCCCAGAGTGCTGGGTTCTTTACCAAAGTTGA
+GCTCTCCTAGGTCCTTTGCGTGTCTGTATAAATTTTGGAATCCAGTTAGCAATTTCTCCA
+AAAGAGCCTCCTGGGATTTTGACTGGGATTGCTTTGAATCTGTAGAACCATCTGGGGAAG
+AACTCTAATGTTCATGATAGTCCATGAACATGGTCTAGCTTTTGTTGATTTGGGTTTTCT
+TTTGTTTCTCTCTTCAGCCTTTTGCAATTTTCAACACCTTGCTCATCTTTGGTCAGATTT
+ATCCCTGAGCATCTTATCTTTTTGTTTTTAGAGAGAGAATC
+>SRR6126859_119 length_340_cov_1.32632
+ACCGATAACATAGGTTTCAGGTACGATTTTCTTAATAGTTTCTTCTAGTGGATTATAAGC
+TCTTGATCCCATTGCTAGAACCACAGAGTCAAATCCGTCAATTCGGTGTTCTTTGTTATC
+CGCTAGGGAATAGGTTACCCCGTCTTCAAAGAAACTTGTTACTTTTGCATTCGTAACACT
+TTTGATTTTATATTCATCGAAATCACGCATCAGGAATTTACGGTGTTCAGAAATAACGTC
+TGCTCCGACTTCATCGCGAAGTTCTACAACTGTGACATCATGACCAGCTTCACCTAAAAA
+TGCAGCTGTTTCACTACCAACCATACCGCCGCCAACTACG
+>SRR6126859_120 length_332_cov_1.27437
+GGCAATCAACAACTTAACTGTTCTTGGACATGATCCAATTTTAGCAATGACATTTGGTGC
+ATCTTTTGCTCAAATCGGTGCAGTATTGGCAGTATTCTTTAAATCTAGAAACAAAAAACT
+CAAATCTCTTAGTATCCCAGCATTTATTTCCGGTATCTTTGGTGTAACTGAACCAGCGAT
+TTACGGTGTTACTTTACCTCTGAAAAAACCATTTATCATGAGCTGTATCGCTGGTGGTAT
+TGGTGGCGGAATCATTGGTTTTGCAGGATCTCAAACATATATCATGGGTGGACTTGGAAT
+CTTCGGTGTTCCTAACTTCTTCAAACCAGGTA
+>SRR6126859_121 length_330_cov_1.41818
+GAGCAGACAGTGGGAGAGAATGAGGGGGATGAGGGCAGAAGAGGACAGTGTCATGTTGGC
+CAGTTAGGCCAGTTAGGACCTGGAGGCTGGAGGCAGCCAGTGCTGCAAAGAAGACCTCAA
+GAATTTCAGTGCAGCAGTAGGGAAAGAGTTGGGCAGTGCAAGAGAGGATGGTGGGATGTG
+GCTGAGGCATTTGGCTGAAACCAGAGTACAATGTCCAGAGCCGCTGGCCCATCCCAGGCA
+GGGCCACCATCCCCAGCATTCCCACGGCATGTTCCCTCTCTTGCAGCCCAAAGTGAAGCT
+TCCCCAACACTTTTCTGCCTCAAACAGGCT
+>SRR6126859_122 length_327_cov_1.43382
+ATTTTAGATAGAGAAATTTTTGCTAGAGCTAGAAGTATTTTGAAACAAGAATTAATCAAA
+GAACAACGAAAAAATAGTAGTTTAAATTAAATTGATTATAAGGAGAACAGCAGAATGAAC
+AAAAAATTAATTGGTGTAGATTTAGGCGGGACAACAGCAAAATTAGCTATTTTAACAAAA
+GAAGGCGACATTGAGGAAAAATGGACTATTGATACAAATATTGAAGATAAAGGCGCCCAC
+ATTGTTAAAAACATTGGGGATTCTATCAATCAAAAATTAACAGACTTACAACTAGATAAT
+GATATTTTTTACGGTATTGGTATGGGA
+>SRR6126859_123 length_327_cov_1.34926
+GACGACATGGATTAATTCTGGTATGAGTGAGTTTGACAGCCGGTTGTTTGCAGCCATTAA
+CGATATGCTGCTGGATATGCTGGCCGCAGTTGCCAGAAGGGACTATGAACAACGTCGGGA
+ACGCCAGAAACAAGGGATAGAGAAAGCAAAGAAAGACGGCAAATATAAAGGGCGTAAACC
+TAATCAAGCCAGACATGATGCAATTATCAGGTTGATAGAAAGCGGTAGCTCCTGGACACA
+GGTACAGAAAGTGCTAGGGTGCAGCCGTGGCACAATCAGTAATGCGCTAAAACGTAAAAC
+CGGGCAGAAATCCAGTAAGTAGAGGAG
+>SRR6126859_124 length_324_cov_1.44981
+GTTTTTGAACCGTTTAAAGGTGGTAATAGTGCTGTTACGGCTGAATCTGGTCAAAAATTG
+GTAGATAAAGTTACACCAAAAGAAATTGAATTTGACGGCGCGAGTTTTGACTTTAATTTA
+TTTTTGAGTTTGCTTTCACCAGGGATGGTTTCCAGAGAAAAAATAACCAAAGAAGTGCGT
+CAAACTATTTTAAAATTGAATGGGATTTATCAAGTTTCTGAAAAAGATATGCCGAGTTAT
+TTGTACCGAGCACTTGATGCAAATGGCGAGATTGATCTCGTTTATTTACGTAAAATCGTT
+CGCGAAGGCTACACTATAGAACAC
+>SRR6126859_125 length_324_cov_1.44981
+ATGCAATGAAATTCAAGATAACGCAGAGAAGGAATTCAAAATGCTATCAGAAAAAATTTA
+ACAAAGAGATTGAAATAATTAAAAAGAATCAAGCAGAAATTCTGGAGCTGAAAAGTGCAA
+TTGACATACTGAAGGATGCATCACAGTCTTTTAATAACAGAAATGATCAAGCAGAAGAAT
+GAATTAGTGAGCTTGAAGACAGGCTATTTGAAAATACATAGAAGAGACAAAAGAAAACAG
+AATTTTTTTAAAAAAATGAAGCACACCTGCGATATCTAGAAAATAGCTTCAAGAGGGCAA
+ATCTAATAGTTATTGGCTTTAAAG
+>SRR6126859_126 length_321_cov_1.46241
+TCTTAGAACCTGGCCACCAATTTTTTTGAAATTCTTGAACATGAATGGGCTTGCCACTGC
+TTTGACCCATATACAACTGCAGAAATGACTTCTAAGCCTAAAAGGTAATGCAGATTTGAC
+ATTTATTTTGCCAAAACATTGAGCTATCATGAAAGAAGTTCAAATACCATGACACTGCCA
+TTCTGAAGAACTCATAGGTCAGCTCTCTGCCAGCTAATTCCAGCCTTCCATCCAACTCAA
+CCAATATGCCAAACATCATGGTAAAGAAACTGCCTTGGAAGTGGATACTCCAGCACTATT
+CCTCCAAGTTCCATGCAAACC
+>SRR6126859_127 length_321_cov_55.8346
+TGCGAAGGTGGCGGAATTGGTAGACGCGCTAGCTTCAGGTGTTAGTGTCCTTACGGACGT
+GGGGGTTCAAGTCCCCCCCCTCGCACCAAAACCACGTTGATATTGCTCGCACTGGGCGAA
+GGTGGCGGAATTGGTAGACGCGCTAGCTTCAGGTGTTAGTGTTCTTACGGACGTGGGGGT
+TCAAGTCCCCCCCCTCGCACCAACGAGGCGATATCAAAAAGTAAGATAACTGTGCGAAGG
+TGGCGGAATTGGTAGACGCGCTAGCTTCAGGTGTTAGTGTCCTTACGGACGTGGGGGTTC
+AAGTCCCCCCCCTCGCACCAA
+>SRR6126859_128 length_321_cov_1.46241
+AGAATGTATCGATCGTGGTTTAAGTTGTTTGTTCATTACGAGCACTGAATTAGTGAATCG
+TTTGATCCGCGCTCACAAGCGCGGAACTAGCGAAACGATGCTAAAAAAATATTCGGGTTA
+TTCGGTGTTGATTATCGACGAAGTCGGCTATTTACCTTTCTCCAAAGAAGGTTCCAACTT
+ACTTTTTCAGCTGATTAATATGCGGTATGAAAGAAAATCTACGATTGTTACAACCAATAT
+CCCACTATCCCAGTGGTCCGAAATATTTGGAAACAAGAAGCTTACCAACGCGCTACTGGA
+CCGGTTGGTCCATCACTCTAA
+>SRR6126859_129 length_321_cov_1.46241
+CATTGTATTTTTAACCCATAACATAAAAGGAAAATTTTCATGATTTTCAAATAGGTACGC
+AAAATGATCTAGCGTATATTCTTTCGGAAAGATATACGAAACAAATTGTCCACTTTCCGC
+TCTAAAAGCTGTCAAAACAATCCAGATAATCGGGAATATCCAGATACATCCGAGCACTAT
+CAACAATAGGTTAGGCCATACTGTAGCTCTTTTCATTTTAGTTGCTCCCTTCTTTATAAG
+AATTTGTGCGTGTGTAGGCAAATAACGAGAATGCTGCACTAAGAATGAATGTCACAATCC
+CAATAACCGAAGCTAAATTAT
+>SRR6126859_130 length_321_cov_1.21805
+GCTAACAGAGGTGGATCTTTCTTTTGATAGAGCAGTTCTGAAAAACACTTTTTGTTGAAT
+CTGCAAGTGGACATTTGGATAGATTTGAAGATTTCGTTGGAAACGGGAATATCTTCATAT
+CAAATCTAGACAGAAGCATTCTCAGAACCTTGATTGTGATGTGTGTTCTCCACTAACAGA
+GTTGAACCTTTCTTTTGACAGAACTGTTCTGAAACATTCTTTTTATAGAATCTGGAAGTG
+GATATTTGGAAAGCTTTGAGGATTTCGTTGGAAACGGGAATATCTTCAAATAAAATCTAG
+CCAGAAGCATTCTAAGAAACA
+>SRR6126859_131 length_316_cov_1.49042
+CTACCGTGCTCTGTTGTTACAACTTTTTTATCATGATCTACATGTGTCACGCTATCAGTT
+ACAAGATTAACTTTTGTTCTATTAAACAAACGACGTAAATCATATTGAATTGCAGTTGGT
+TCAACACGACCACCAGCAACCTCATGTAGTTCAGTCATCATTGTATGGTACGAATGACGA
+TCGATTAATGTAATATTAACGTCTTTGTCTTTCTTGTATTTCTTAGCTAATTTCTTAGCA
+GCGTGTACACCTGCATATCCTGCCCCAATTAAAACGATATTCTTTTCAGGCATATGCTTC
+CTCAACTCCTTGTAAG
+>SRR6126859_132 length_315_cov_1.49615
+ACATGACTGCTTGGAATGAAGGACTAAAAACAACTTACTATGTCCGCTCCAACGATATCG
+ATGTAGAAGAGTGCGAATGGTGCTCAAGCTGATAAATCTCTAAAACATTTTATCAATAAC
+ACAATAAGAAAGGGAGGGCTTGCCTAGATGGCTAACCAAAAAGAACAACTGACACGTATT
+AAAATTTTAGAACCTTTATTTCCTAATCGTTCTACTTCAATCATAAACGGAGAAACTAGT
+GGGATTTTAAATTGGAACGACATCCCGTATCCTTCTTTCTACCGTGCGTATAAAGAACTT
+TCTACTAACTACTGG
+>SRR6126859_133 length_314_cov_1.37452
+GCCCGTGAGCAGACCGACGGCGGTCGCCCTGTTGGAGGGCGCCCTTCTCGTCACGACCGC
+CCGCGTGCCGGGTGAGGAGCTCGCGGGCAGGATCCTCGCCGTGGACGTCGGGCGCAGCGC
+CGCGCCCACTCCCGCTTTCGCGGCGACGATCGCCGGCGGCGCCGGCGTTGAAGGGACGAA
+CACGTGACCACGACAATCCGTTCCGTCGAGACATTCCGCTTGCGGGTGCCACGCGACGAC
+GGCGCGCCGACGGAACGCTTTCGAGCTGCGCCCCGTGTGCGCAGCATCTATCCCACCGCA
+GACGAACTCCTGCT
+>SRR6126859_134 length_307_cov_1.54365
+GTCCTTGTCTAAAAGTTCTACTGTGTTTAAAAACTGAGAACCATAACTCGTTGCTGCTTT
+CACAACTGTCGTTTGGAAGATTGTGCTAGCAACGATTAAAATACTTAAGAAAGCTAACCC
+AACTTTTTTTAAAAAGTTTCCGTTTTTACTCATTACAAATTCATCCTTTACTAATGAAGT
+TTTGTTATTATCACATATCATATGACAATTGAGTAACTCCAAGCTATATCATTTTTCGGA
+AGTACTGCTCCTAAAACGCCATCTTTATGAACTTTTAGTGACTATTTTAAAGGACTATAT
+ATTATAA
+>SRR6126859_135 length_307_cov_2.25
+CGTACTGTAGATTCTTTTTGACCGATAGCGACATAAATACAAATCATGTCTTGGTCAGCT
+TGGTTTAAAATAGTATCAATCGCTACAGATGTTTTACCAGTTTGGCGGTCACCAATGATT
+AACTCACGTTGACCACGACCAATAGGAACAAGTGCATCAATCGCTTTAATACCTGTTTGT
+AATGGTTCGTTTACCGATTGACGTTGCATAACACCAGGTGCTACAGCTTCAATCGGACGA
+GTTCCAGTTGTTTCAATTAGGCCTAAACCATCAACTGGTTGACCTAATGAGTTAACTACA
+CGCCCAA
+>SRR6126859_136 length_306_cov_1.17131
+AGGGTCTTTTTTTGTTGGATAGGTTCCAATAACAAATGTACGAACTTGAATAAGGAGGCA
+ACAAAATGCCAACTCGCTTAAAAGAAGATATTGCAACAATTATAAAGAATGACCCTGCGA
+CGAAGAGCTTTTTTGATGCTTTTTTAACAAATCCGGGATTGCATGCGCTTTGGTGGCATC
+GTGTGGCGAACTTTTTTTATCGTCACAAAATGGTTTTGTTTGGAAAAGTATTATCGCAGA
+ACGCTCGTTTCTGGACTAATATAGAGATTCATCCAGGCGCAACTATTGGTAGAAGGCTTT
+TTATTG
+>SRR6126859_137 length_273_cov_33.555
+CGACGTTTTTACTGGGCAATATTGACGCAGACGCGCGGTATGTCACGGTTGAGGTACAGC
+ATGGCGGCACGAAAGAGGTGCTGACGGCCACCAAAGACGCGACCGGCAACTGGAGCGTAA
+CACCGACCGGCACATGGGCAGATGGCGACTATACGCTGACAGTGAGGGTGGAAGATGAGG
+CGGGGAACGAAAAACACTCAGCGTCGCTAACGGTCACTGTTGATACCCAAATCACCATTG
+ATGTTATTGAACTGGTTAATGATAACGGTATTC
+>SRR6126859_138 length_261_cov_25.1408
+CACCTTGCTACAGAATATAAGTCGCTGACCCATTATACAAAAGGTACGCAGTCACCCCAC
+CCCAAAGCATTCGCTTTCGCTACGCGAAACCGCCTGCCTTTGCGCTGTCGCGCAAAGCGC
+CCTGCGGCTCACTTTACACTGCTGTTTTATCGGTTTGACGTCGCTTCGCTCCGTCAACGC
+GGTACAGCAAATGCTTTGGTGGTGGGGCTCCCACTGCTTGTACGTACACGGTTTCAGGTT
+CTTTTTCACTCCCCTCGCCGG
+>SRR6126859_139 length_246_cov_73.3194
+GCAGTTGACTTTTAATCAATTGGTCGCAGGTTCGAATCCTGCACGACCCACCAATTTAAC
+ATCAAACTCAGATGTTGAACGTGAAGGATAACGTTGCGTCAGCAACCTGTAGGGCGAGGC
+GAAGCCGAGTCATCCTGCACGACCCACCATCTTTAGATGGTCCGAGTAAAATCTTTCAGG
+CAGCACCCGTATGGGTCGTTAGCTCAGTTGGTAGAGCAGTTGACTTTTAATCAATTGGTC
+GCAGGT
+>SRR6126859_140 length_242_cov_34.2941
+GCAGTTGACTTTTAATCAATTGGTCGCAGGTTCGAATCCTGCACGACCCACCAATATACA
+AGGTGGTAACTGGTAGAGAACGTGAAGGATAATGTTGCTTTAGCAACGGCCCGAAGGGCG
+AGGCAAAGCCGAGTCATCCTGCACGACCCACCATCCTGAATGATTGAAGCAGTAACCCTT
+ATCCAAGGGGTCGTTAGCTCAGTTGGTAGAGCAGTTGACTTTTAATCAATTGGTCGCAGG
+TT
+>SRR6126859_141 length_241_cov_84.7527
+GCAGTTGACTTTTAATCAATTGGTCGCAGGTTCGAATCCTGCACGACCCACCAATTTAAC
+ATCAAACTCAGATGTTGAACGTGAAGGATAACGTTGCGTCAGCAACCTGTAGGGCGAGGC
+GAAGCCGAGTCATCCTGCACGACCCACCACTAACTTCGGTTAGTCAGTAATATCCAGCGT
+AGTATCGGGTGATTAGCTCAGCTGGGAGAGCACCTCCCTTACAAGGAGGGGGTCGGCGGT
+T
+>SRR6126859_142 length_232_cov_26.5876
+GATGGTAGTGTGGGGTCTCCCCATGCGAGAGTAGGGAACTGCCAGGCATCAAATTTAGTG
+TGCTGATATGGCTCAGTTGGTAGAGCGCACCCTTGGTAAGGGTGAGGTCCCCAGTTCGAC
+TCTGGGTATCAGCACCACTTAATACGGTTAAAGTTCGGTATTTGAAAAAGAATTTGTCTG
+GCGGCAGTAGCGCGGTGGTCCCACCTGACCCCATGCCGAACTCAGAAGTGAA
+>SRR6126859_143 length_225_cov_41.1235
+CCTTTGACGCCTGTATCCGCTTTCTCGGCGAAGACCCGTGGCTGCGCCTGCGCGAGCTTA
+AAAAGGCCATGCCGAAGACTCCCCTGCAGATGCTGCTGCGCGGCCAGAACCTGCTCGGCT
+ACCGCCATTACGCCGATGATGTGGTGGAACGCTTCGTTGAGCGGGCGGTGAAAAACGGCA
+TGGACGTGTTCCGCGTCTTCGATGCCATGAACGACCCGCGCAATA
+>SRR6126859_144 length_170_cov_188.53
+TATCCCATTAGGGCTATTTTACTTGCCATTTTGGACCTGGGCAGTGCTCGCCAAAACGCG
+TTAGCGTTTTGAACGCCGCTTGCGGCGGCCCGAAGGGCGAGCGTAGCGAGTCAAACCTCA
+CGTACTACGTGTACGCTCCGGTTTTTGCGCGCTGTCCGTGTCCAAACTGG
+>SRR6126859_145 length_123_cov_63.4853
+TCCTGAAATTCAGGGTTGACTCTGAAAGAGGAAAGCGTAATATACGCCACCTCGCGACGG
+TGAGCTGAAAGCCGCGTCGCACCTGCTCTTTAACAATTTATCAGACAATCTGTGTGGGCA
+CTC
+>SRR6126859_146 length_117_cov_29.2742
+CGGTAGCGCCGCAGCCGCAGTATCAGCAGCCGCAGCAGCCGGTAGCGCCGCAGCCGCAGT
+ATCAGCAGCCGCAACAGCCGGTAGCGCCGCAGCCGCAGTATCAGCAGCCGCAGCAGC
+>SRR6126859_147 length_112_cov_2.45614
+CGTGAGGAGCAAATGAGATGAAAACACTCTGCAGTGAGTCCCTGCCTGAGGGGAGGCCGT
+GAGGAGCAAATGAGATGAAAACACTCTGCAGTGAGTCCCTGCCTGAGGGGAG
+>SRR6126859_148 length_100_cov_163.6
+TTGTTCGTGAGTCTCTCAAATTTTCGCAACACGATGATGAATCGTAAGAAACATCTTCGG
+GTTGTGAGGTTAAGCGACTAAGCGTACACGGTGGATGCCC
+>SRR6126859_149 length_99_cov_124.886
+CGATTCATCATCGTGTTGCGAAAATTTGAGAGACTCACGAACAACTTTCGTTGTTCTGTG
+TTTCAATTTTCAGCTTGATCCAGATTTTTAAAGAGCAAA
+>SRR6126859_150 length_88_cov_1.72727
+GATATGACCCCGCCCGACGATAGCGGCCCCGACGATAGCGGCGATGACGATGTGACCCCG
+CCCGACGATAGCGGCGATGACGATGTGA
+>SRR6126859_151 length_87_cov_112.25
+TGGTGCGAGGGGGGGGACTTGAACCCCCACGTCCGTAAGGACACTAACACCTGAAGCTAG
+CGCGTCTACCAATTCCGCCACCTTCGC
+>SRR6126859_152 length_80_cov_191
+ATGGTGCATCCGGGAGGATTCGAACCTCCGACCGCTCGGTTCGTAGCCGAGTACTCTATC
+CAGCTGAGCTACGGATGCAT
+>SRR6126859_153 length_79_cov_61.4583
+ATGGTGGCTACGACGGGATTCGAACCTGTGACCCCATCATTATGAGTGATGTGCTCTAAC
+CAACTGAGCTACGTAGCCA
+>SRR6126859_154 length_79_cov_146.917
+GGGTGATTAGCTCAGCTGGGAGAGCACCTCCCTTACAAGGAGGGGGTCGGCGGTTCGATC
+CCGTCATCACCCACCACTT
+>SRR6126859_155 length_78_cov_233.957
+GGGTCGTTAGCTCAGTTGGTAGAGCAGTTGACTTTTAATCAATTGGTCGCAGGTTCGAAT
+CCTGCACGACCCACCAAT
+>SRR6126859_156 length_77_cov_146.636
+TGGAGCGGGAAACGAGACTCGAACTCGCGACCCCGACCTTGGCAAGGTCGTGCTCTACCA
+ACTGAGCTATTCCCGCA
+>SRR6126859_157 length_77_cov_101.818
+TGGTTGCGGGGGCCGGATTTGAACCGACGACCTTCGGGTTATGAGCCCGACGAGCTACCA
+GGCTGCTCCACCCCGCG
+>SRR6126859_158 length_71_cov_47.75
+GGCTGCGGCGCTACCGGCTGCTGCGGCTGCTGATACTGCGGCTGCGGCGCTACCGGCTGT
+TGCGGCTGCTG
+>SRR6126859_159 length_68_cov_268.077
+CCTCACGTACTACGTGTACGCTCCGGTTTTTGCGCGCTGTCCGTGTCCAAACTGGCTGCG
+CCAATAAC
+>SRR6126859_160 length_66_cov_48.3636
+GATGTTTCTTACGATTCATCATCGTGTTGCGAAAATTTGAGAGACTCACGAACAACTTTC
+GTTGTT
+>SRR6126859_161 length_66_cov_93.9091
+AACAACGAAAGTTGTTCGTGAGTCTCTCAAATTTTCGCAACACGATGATGAATCGAAAGA
+AACATC
+>SRR6126859_162 length_66_cov_118.909
+GATGTTTCTTACGATTCATCATCGTGTTGCGAAAATTTGAGAGACTCACGAACAATTTTC
+GTTGTT
+>SRR6126859_163 length_59_cov_247.5
+AGGCGTTATTGGCGCAGCCAGTTTGGACACGGACAGCGCGCAAAAACCGGAGCGTACAC
+>SRR6126859_164 length_56_cov_222
+AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
+>SRR6126859_165 length_56_cov_35
+ATTTGCTCTTTAAAAATCTGGATCAAGCTGAAAATTGAAACACAGAACAACGAAAG
+>SRR6126859_166 length_56_cov_194
+TGGGTCGTTAGCTCAGTTGGTAGAGCAGTTGACTTTTAATCAATTGGTCGCAGGTT
+>SRR6126859_167 length_56_cov_801
+CCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCCC
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/Filtered_sequences_(no_repeats).fasta	Thu Oct 12 15:04:45 2017 -0400
@@ -0,0 +1,77751 @@
+>SRR6126859_1 length_852517_cov_27.8446
+GAGCACGACGTTGCCAAGGTCGGGGTCGCGAGTTCGAGTCTCGTTTCCCGCTCCAGTTTA
+AAAGCATTGGCGTAAAGCGGATGTTGGCTGAAAAGCCAAAAAATTTGGCGCGTTAACAAA
+GCGGTTATGTAGCGGATTGCAAATCCGTCTAGTCCGGTTCGACTCCGGAACGCGCCTCCA
+ATTTTTCCCGAGCCCGGATGGTGGAATCGGTAGACACAAGGGATTTAAAATCCCTCGGCG
+TTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGGAAAGACAAGAATAATCAA
+AGCAATAAGCAGTGTCGTGAAACCACCTACGGGTGGTTTTTTTGTGCCTTCAATTTGTAT
+GCCGACCGCGAGCGTGAACTCTCCAGTGCGATACACAGTAAAAAACACCGGTAGCGGCAT
+TTCTGCCAGTACAACAGTTATGTGCTACCGACCCGCAAGAACTTATGCCCGGTAAATACT
+AAACGTCGGGTAAATCAGCCGATAAAATCCATTAATCTGTATAAAAATGCTGATATGTTT
+TATGCCTGCTTTATTAAAGAGAGTAGGTCTGCCAGTGAAATATACCGATAATGCAAAATT
+ATTTATTAGCTTCATTAATATTGGGATTGTAGGTTGCGCTTTTTTACTTTTTTTATTTTG
+TATGAGCCTGAGAGTGCAATCGTAACCTACTCTCTTCCAGGAGAGCCTTCCTCTTCAACA
+TGTGATGCGCGTAATTTTATTGGCTACGTCGATGAAAACGACTTTGCAGAGTATATAAAA
+AAAGTAGAACTGACGCGCTACAGTATGTATTGTCTGAAAAAAACAGGGGCGGGTCAGTGG
+AGTATTTATGCAAATTAAACGAATATATAACTGTTCAGGGGTGTTTTCTGCACAATTTAA
+TTAAAGGTAGATAGCGAACTAATATTCATCATAAGGTAATGTGATCCGCATCATGCTTTA
+ATCACGTTTTGCAATATTGTCTTAATAACAGGTCAACTACAGATAATTTCGGGTTTTCGT
+GAATGGCGGTTTTGGTCAGTCTCTATATTATGCTTTCCCCGCTTTACGGAGATGATGATG
+CAAAAGAAAACCTGGGCCGTTTTATTGATACCATTGTGCCTCACCGCTTGCCACCAGACG
+ACCTACCGATCAACAGCCAAAGATGAAATTCTCACAGGGAGCTATATTGACCCGACCAAA
+ACACGCTTTCCGTTAGCGGATTATTCACAGTCGGTTGATAAATGGATACCTCCGGACTCG
+GCTGATTACACTATTCCGGTTATTGATAGTGCTACCCAACAACGCTACTTTAACGCACTA
+AAATCTCATTATTTCGGAATGGACAGTGAAGCGCACTCGCCGTGGAATGGTTTTTATATT
+ACCGCATTGCTGAAAAAAAACGCAGCACAGGCCCGGGATGCCAGTATTAAGCAGTTTCTT
+AGCGACGGCAGTGCTTATTGGGGGGAAAACTTCAGACTTTATACCTCTCGCTGGAAAGAG
+GAGGTTAGAGGGAATACGGATACGCAGATTGACAATATCTATAATGCCTCCCGGCGAGGC
+ATTATGGTCAGAGAAAGTTTAGTCAGAGCGCTGCCAACGGACGACCCGCTCTTTAACGAT
+CCCCGTCAGGCGGGCGAGGGGTATCCGTTTGATAATTTACAAATGTCTTCGCTGCGTCCC
+GGTACGCCGGTCTATACGCTGACGAAGAGCAAAGACCAACGCTGGCAATATGTCGTTTCA
+CCAGCGGTAACTGGCTGGGTTCATAGTGAAGATATTGCCAGTACGGATCAGAAATTTATA
+ACACAGTGGGTTTTGCTCGCTCACAAGCAACTGGGGGCATTTATCAACGCGCCGGTTTCT
+GTCCATGCCGCAGGCGTCTATTATTTCACCGGGCGGCCGGGCACTATTTTACCGTTCCGG
+CATCAACGGGCGGGCCAGTTCCTCATTGCGGCGCCAGTTCGCGACAGCAACGGTCGCGCG
+TTTATCCATTGGGTCTGGCTAAGCGGTAACGAGTTTACGGCTATGCCGTGGAAAATGACG
+CCGGAAAATATCGCCGTGCTAATGAAAGCAATGCACGGCGCCCCCTACGGTTGGGGAAAT
+TTTAACTTTTATAATGATTGTTCAGCCGAAGTCCGCAGCCTGTTAATGCCGTTTGGCATA
+TTCCTGCCCAGACATTCATCCGCGCAGGTAGAGGCGGCTGGACGGGTGGTCGATCTTAGT
+CATAAAAATCCCCAAATGCGGATCGATTATCTCACCAGATACGGAAAGCCGTTTACTACG
+CTGGTCTATATTCCAGGGCATATTATGCTGTATATCGGTAACACAACCATGAATGGGCAG
+GTTATGCCGATGACTTATCAGAATATCTGGGGATTGCGCCCAAACCATGCTAATAGCCGG
+AGCATTATCGGTGAGGCAGTATTTTTGCCGTTACTGCGTTTTTATCCTGAAAATCCTGAG
+CTGATATCGCTGGCTGGTAAGGTTCTGTTTAAGCTTGGTTATATAGAATAGGTTGACAAA
+CTGTGTTATCGCGGAAGATATGATTAAGGCAACCGTGCGCGTGGATATAAAGAGAGTATC
+CCTGTAAACTGTGTCTGAAAAAAGTATGCGCTATAGTGCGGGCTGTTTATTTGAAATACT
+ATCTGGAGCTGATTCTGGATGTGATTATGTGCCTCACACATTGAAGTGAGAGTTATTGCT
+GGTGGTATCTGGCTGGAGGCTGGGTGGTAAAAAGACGTAATTTATTGCATTTTAATAACG
+GTGCCCGATCAGAGCGCGATCTTGGGGATCTGGTCACTAAAGTTTTTGAGAAAGCGGCGA
+AAAAAGAACCGCAACCGCTATACACATTTAGCCTGCCGTTGCTGAGTGTGCAGGATGAGA
+TCCGTGTTTACTGTAAGAAAAAAAATATCAAAATAGGGTACGATACGCTGTTTATGGAAA
+TAACCTTTTCTGCTGACAGAGAAGCGGTAGACGAACTCATTAAACACTTTTTTACTGAAA
+ATAAGCTCTATTTGAGAGGGCGGTTTTATCTGTCCGCGGCGGTGGTATAAGTTAGCATGA
+GTATAATATAGCGAGAAACCCATCTCTCGCTTTTGTGTGGGGCGAGCGTTTCCTGGCGGA
+AAATCTGCGCCCTGATCCTCCTTTTGTGCGTTAACTTCCGGAATCCTCCTCATTTCGTGT
+TAATCTGGCCCCTGATGGTTGCCATCCAAACTGCCTGCAAAAAAATTATTTTTATCCGCT
+GCAATGTAAGAGGCCTACAGGCGGAAGTCATCACTGAGGAAAAGCGTTATGAAAATGGAA
+CCATTAAACGAGAACGAGCTGGAATGGCTGGATGATGTGCTGACGAAATACAATACCGAT
+CAGGCCATTTTGGATGTCGCGGAGCTGGACGGTCTGATTACTGCGGTACTAAGTTCTCCG
+CGTCCCATCGAGCCGGAACAGTGGCTGGTCGCGATATGGGGGGGACCCGCGTACGTACCG
+CGCTGGACATCTGAAAAAGAAATGACGCGATTTATGGATCTGGTGTTCCAGCACATGGCG
+GACACAGCCGCCCGGCTTGAAGATTATCCAGAACAGTTCGAGCCGCTGTTTGGCCTGCGA
+GAAGTTGATGGCCATGAATTAACGATTGTTGAAGAATGGTGCTTTGGTTACATGCGCGGA
+GTGTCGCTGTCCGACTGGTCTGACTTGCCGGATACGCTAAAACCGGCGCTGGAAGCGATT
+GCCTTACACGGCACTGAAGAAAACTTTGCGCTGTTGGATAAAATGAGCCCGGAAGCGTTC
+GATAAAAGCGTTGACGCTATCCGTATCGCGGCGCTTGAGCTTCATGCCTGGGGGATGGCG
+CATCCGCACACGACGCCGCTACAGATGCCGATAAAAGCAGAGGTGAAAGTGGGGCGTAAC
+GATCCTTGTCCATGCGGGAGCGGCAAAAAATTTAAGCAGTGCTGCCTGCATTAATGGCTC
+GTAAACGGCCATAGCGTGACGATTATCGAGCCTGGACGGCGTCCAGGCCCGGTAATCTTT
+GCCTGGCATTAACCTGGATCGGGCAGAAACCCCAGTGCGATCGAAAACTGGACGCCAATC
+ACGACAATGCCGCAGATAAACACCAGCGCCAGCGCTGGCGTGCCGCCTGCCACACGATAT
+CCCGCCTGAGGGCTCTGTTTACGGCACTGCCAGACCAGCATAGCAGGGATGAGCAGTGCC
+AGCACTGCCAGCGCTACGCCGGCATAGCCTAATGCCATCACAAATCCACGTGGGTAGAAA
+AGTGCAAACGCCAGCGGCGGCAGAAAGGTAATCAGCCCGGTTTGCAGACGTCCGGACACC
+GTACTGCGGCGCTGGAATAGATCGGCCAGGTAATCAAATAATCCTAGCGCTACGCCCAGA
+AAAGAGGTCGCCAACGCCAGATCGGCGAACAGGTGGACCGCCAGTTCGACATGTGGCGAA
+GCGACCACTTCTCTGAGCGCCTGCAGCAGGCCATTTAACCCGGCATGGCTGGCCAGTAGC
+CCTCTGAATGTCGGCGAGTCGATACTTCCCAGCGTGGCGAGCTGCCAAAAAATATAGGCC
+ACTAGCGGAATGGCGCTACCCGTCATAAAGACCCAACGCAGCCGGCGAATGTTGCCGTTC
+ATATAACTCACAATACTCGGTACGCTTCCGTGAAAACCAAACGAGGTGAAAATGACCGGT
+ATGGCGGATAACGCCAGCCCCTGCTGTAAAGGAAGCGTAAGAAGATTTACTTTATGAATA
+TGTGGCGTGAGCAACGCAAGCATGATGACCAGAAAAATGATCTTTGCGCTAAACAGGAAG
+CGGTTAAAAAGGTCGACCAGCGAGGTGCCCACACACACCACCCCACCGGCAACAAAGGTG
+AACAGCAGCACCCCGGCAGCGGGCGAGAGCGTGGCGCCAAGCCAGTTATTAATACTGGAT
+GCCAGTAATTCTCCGGCTCCGGAAATGTAGGCGGCGGTGAGCGCATACATTAAGAACATC
+ATACTGAATCCCGTAAGCCACTGTCCGTAACGTCCAAGATAGCGTTTTGCCAACGAGCCC
+AGTCCGGTATCCGCCGGAACGTGTTGATATACCTCCAGTAATAGTAGCGCGGTATAACAC
+ATCAGCGCCCACAGGCCAATCAACAATCCCAGCGTGACGCTGAAACCAACGCCAGCCGCT
+GCCAGCGGCATTGCCAGCATCCCGGCGCCGATAGTGGTGCCTGCCACGATAAAAATACTG
+CCCAGAGTTCTGTTTTTCACGCTTTCTACTACCCCGGTAACAAAGAACGGTGATATCCGC
+GGCGCAGGGTAAGGCATTACGCTATTTTTGTCAAATGGTCGTTACAATGGGTGTACTGTA
+AAATTTACAGTTCCGGGCATAAAAGCGAATATGGGAGGAGACGCGGGCAACCGCCGCAAA
+CCTGCGCTAGCGCAAAGTCGCTCGCACACGGACACATTAGGCTACGAGTTTTATTCAGGA
+GGGGTTATGGATTCCATTCACGGTCACGAAGTACTCAACATGATGATTGAGTCTGGCGAG
+CAGTACACGCATACCTCGCTGGAGGCGGCAATAAAAGCGCGCTTTGGCGAGCGGGCACGA
+TTTCACACCTGTTCAGCGTCAGATATGACGGCGGCGGAACTGGTCGCGTTTCTGGCGGCG
+AAAGGAAAGTTTATTGCGGTGGAGGACGGTTTTTCAACGCATGAGAGTAAAATCTGCCGC
+CATTAATACGCCACGGTGAGAGCGCGTCTCACCGTGTAAGGACGTGCTGGATTAATTTTG
+CGTATCCAGGGTGGAGAGTTCTTTATCAATGAAATAAAGCCCTTCGCCGCTTTTTCCCGC
+CAGCGTTAATTTATCAATAATAGATTTGAACAGTTTTTCTTCTTCATGCTGTTCTGCCAC
+ATACCACTGCAAGAAATTAAATGTCGGATAATCCTGGCTGGTCATTGCGGCATGAGCCAG
+TTCATTAATTTTTTGCGTAATAAGCTGCTCATGCTCATAGGTCGCGCGGAACAGCTCATC
+CAGCGAGGCGTACTCAGCGAAGGGCGAAGAAACGGTATGAATGCGCGGCAGGCTTCCGGT
+ATCGGTAAGGTAGTCAAACAGGCGCTGCATATGCGTCATCTCTTCTTGCGCATGGCGACG
+AAGAAATGCGGCCGCGCCTTCAAAACTGTGATAGCTACACCACGCGCTCATTTGTTGATA
+GAGCAGGGAGGAGTACAACTCCAGATTCATTTGCTCATTCAGTTTGTCGATCATTTCTGT
+TTTCAGCATGGTTCCGCTCCACAAATAGCAAAAGATATACGGTAATGTGGCGCCACTATA
+ATTTGTTATTTTATTATTTGCAAAAGGTAAAATATTAAATTTAATTATTAAAAATACGAA
+TGGGAATAAAACGCATTAACGCCAGTGTATAGCGTATAAAAATAAAGAAAAGCCAGCACC
+TTCATGCTGGCAATAGCGACCCTGCACTCTCCTCCATTGTACATGGTGTCGGCGTTAAGC
+CAGCCGCCTTAATAATAAAGCGGCATGATTTGCGGGACGGCAACGCCCCGGCACTGCCAG
+GAGAGGGTAAATCGGGTGTTCAGACACAACGAGCCCGCATAAATGCTACAGGTTCCTACC
+GGCTGACCAAACGAAACGGCATCGGCATAGCCCATCTGCTGGCATTCGCGTGTTGCGGTC
+CCGTGAGATACATAGTCATCTGTCCGTGAAGTAAAAAATAGCGGCTGGTTATACGTCAGG
+CGCACGATGCCGCTTATCGGGCTGGCTTCGCTGACCTGCGCTTGTCGAGTAATGGTGCAT
+CCCGTCAGGGCTAGCAGTGAAAGAGTAAAAATAAGAGGCTTCATAAAATCGCTCCGACAG
+TTCGGTATCAGACCATGCTACCTCGTGTCTTGCACCGTCAATGGCTGGAATAACTTACGG
+ATTCGCCTTGATTAAAGGTAACGGCAGGGGATTTACAGCGGGAACAGAAAATGTGTGAGC
+GTCTTTTCATTTAATGAAACTTCGTTTCATTAAATTTGAATGTGTGTTCGCAAATGTGTA
+ATGTGGGCAAAACGTCATGATTTACGCAGGCGCGACCGTCTGCATTCAGGAGGAACACGA
+TGAAAATTGCACTGATGATGGAAAATAGCCAGGCCAGCAAAAATGCCATCATTTATAACG
+AACTTAGCGCCGTCGCCAATGAAAAGGGATTTCCCGTTTTTAACGTCGGCATGTGCGACG
+AAAATGACCATCACCTGACGTACATTCATTTAGGCATCATGGCGAGTATTCTGCTTAATG
+CAAACGCGGTTGATTTTGTGGTTACTGGCTGTGGCACTGGTCAGGGCGCGCTGATGTCGT
+TAAATATTCATCCAGGTGTCATTTGTGGCTATTGCATCGATCCGGCAGATGCTTTTCTGT
+TTGCGCAGATCAACAACGGCAATGCGTTGTCCCTGCCATTTGCGAAAGGCTTTGGCTGGG
+GCGCTGAGCTGAACGTGCGTTTCATCTTTGAAAAAGCGTTTACCGGGCGTAAAGGTGAGG
+GGTATCCGCCTGAGCGCAAAGCGCCGCAGGTACGCAATGCGGGCATTTTGAATCAGGTTA
+AGGCCGCGGTCGTCAAAGAGAATTATCTGGATACACTGCGGGCTATCGATCCTGAACTGG
+TTAAAACGGCGGTTTCAGGGCCGCGTTTCCAGCAATGTTTGTTTGAAAACGGCCAGAATA
+AAGAAATAGAAGCGTTTGTACGTGAGATGCTGGGGTAATGCCCGGACAAGACAGAGACGT
+TTCGCGCCTGTCGGCTGGCATGATGTGCCGATAATACGCCAGTAGCGACAGGCGCCACCT
+CTGGCAAACAGACCAGAAACGGTGTAGGCCGGATAAGCTGCTTCGCGTTGCTATCCGGCT
+AATAACGTCTCAATATTGTCGCTCGGGGAGCCGCTATCAGTGATGCTGATAGGTCACGAC
+GTTAAGGAGATGCTGATCGGTTTGCGCCAGACATAACCCTGCTCGTTTAGCGCTGCGAAC
+TTCTTCGAGAATAGTTTGTAAAAGTACGCCATCCTGCTGCTGCTCTTTTTCCAGGGTATG
+GAGAAAATCGAGCGTTGAGGCATCATTCAGCGCTTTCGCTTCATCTGCCAGACGCGACAG
+CGTGCTGGCGCGTTGCTGATAATCCTCCAGGGTTTTCTGGAACAATTCTTCCAGAGAGCA
+GAGCTCTTCACCCGGAACGTCAATGGCTTTAACGATAGGGGTGGCGCCGGCGTTTTTCAT
+AAAATTAAACATGCGCATCATTTGCGTCACGTTGCCTTGCGCCTGGGTACGAAGAAAGGT
+GGCGGTGCCTGTTAAACTGTGTTCAGAACACCATTCGCTTAGATGGAGGTAAAGATTTGA
+TGCGTAAAACTCAAGGTTCATTGGCGTGTTGAGCTTTTGAACCATTCCTACAGCTGCCAT
+AACAATATCCTTATTTCCAGAAAGTGTTGATGTGCATGACAGACGAGAATGCAACGGGCC
+GTTGTCACATTCTTACCTCTATGCACAATAAATACTCTTAGCAGAAGAACTCCGTTCCGC
+CAGTCCCTTATGCGATCTCATTTCCTGTTTATCGATCGGTAATGAGAATAGCGCGTCAAT
+AAAAATAAGAAAATCCTTAAATGCAATTGTTTATCTTTTTTTACATTTTCAGCGGTGTGA
+TTTTTTCAGGTGTAATGATTTTTGGTATGTCATTCTTGTAACTATTTGAAAGATAAAAGA
+TATTCTATTTTTTCTGTTTTATGAAACATTGTTTCAGATCATGGGTTAAGCCTTTTAAGT
+ATGTTAATTTCAATAAAATAAACATTAGTCAGTCTGGATATCACACGCATAAACGGTTGA
+GAGCAAATATGCCTGTTTTTATAAACTAGCCGATTTTGCGGTAGATCATTTTTAATGTCA
+TTAATCATACGAGCACGTTATTCGGTTAAGCGCAGTTTTGCTGGGTGACTCGTTAACAAG
+GAGCAGTCAATGAAAAAGGTCGCGGTGCTGTTGGCGCCAGGATTTGAAGAAGCAGAGGCC
+ATTGTTACTCTTGATATTCTGCGACGTTTGCATATCGACGTCGAAACGCTGGCGTGTGCT
+GAATCACGGGCGGTGGTGAGTTACCATGATATTCCTATGGTTGCGGACAGCACGCTGAGT
+GAACGCCAGCAGGCGCTTTTTGATGCGGTAGTGCTGCCGGGCGGTCCGCAGGGGAGCGCT
+AATCTGGCGGCTAATCCGGCGGTGATCGCTTTCGTTGCGCGTCATGATGCGGCAGGCAAA
+TTTATTTGTCCTATCTGTTCCGCGGCGGCAAGGGTGCTGGGTGCTCACGGATTGCTGAAG
+GGGCGTCGTTATGTCTGTTCCGGCGACCTGTGGAAAGCGGTTCCGGAAGGTGTCTATGTG
+GATGCGCCCGTTGTTGAAGATGGTAATTTAATTAGCGGCAAAGGCTTGGGTCATGTCTTT
+GATTTCGCGCTAACCCTTTCCGCCAGACTGCTGGGAGACGATGCGCCGGTTCGCGAACAG
+GCTGAACATATCTATTATCCCTGGTAATCGTTATTCACCCAGGGCCATAAGGATTAGCTG
+GCTGATGTTATGGATTAATGGGCTGGCTTTCCTGCCTTTTGGCTGATGAATTCGCTCTGG
+GTTATGTCATTTTCCGCTAAAACTATTCCCGCCATCAGCATTTATCTAATGAATGAAAGA
+CAGTGCACCGTTTTACGTCTTCTCTAACAAAAATCGTTTGATTTTACCCTACATAAAAAA
+CGCTAAAGCAGGTCAATGACTTCCCTGGGTTATGAGTTAATCGTTATTTCTGCGTGCGTA
+TTAGGGGGCGTTTTCCTGAGAGGCGGCCTCGGAAAAATCTCATATGTGGTGGCGAGCGTA
+CTGATATCAGGAACGGTGGAGAACGCGATGAACCTGCTCAACATTTCACCTTTTGCACAG
+TACGTGGTTCGCGGCTGAATCCTTCTGGCAGCAGTTATCTTCGACCATTATAAGCAAAAA
+GCGAAGCGTACGATTTGATGAATTAACACTCAACTAAACAGTATAGCTTCACGTCATCGC
+CAGCCGCTACCCCGGCTGGCGATGGTCTTTCTAAATGGCGAGCAGCGTCACACTGTCTAT
+ACTTACATGACTAATGAGACCGTTTGTGAGTCTCAATATGATGATAAGGAGGAGACCAGG
+GTGGCAGAACCGTTAACCGTATCCCCCGAACTCACTGCGAACTATGCGTATTTTTTTGAC
+CTTGATGGCACATTGGCAGAGATAAAGCCTCATCCCGATCAGGTAGTGGTACCGCATAAA
+ATCCTTCAGTTGTTAGACCGTCTCGCGGCGCACAACGCAGGGGCACTGGCATTGATTTCA
+GGGCGTTCAATGACTGAGCTGGATGCTTTGGCGAAGCCTTTTCGCTTTCCGCTCGCTGGC
+GTTCACGGGGCAGAGCGTCGTGACATCAATGGTAAAACCCATATCGTGCGCCTTCCTGAA
+GCGGTAGTCCGTGAGGTGGAGGCGTTATTACGTTCGACGCTTGTAGCGCTGCCCGGAACG
+GAGCTGGAGACGAAGGGGATGGCGTTTGCGCTGCACTACCGTCAGGCTCCGGAACATGAA
+GCGGCGCTGTTGGCACTTGCGCAACACGTTACGCAGCACTGGCCGCAACTGGCGTTGCAG
+CCTGGTAAATGTGTTGTGGAAATCAAACCTAAGGGAACCAATAAAGGCGAAGCCATTGCT
+GCCTTTATGCAGGAGGCGCCCTTTGCGGGACGGATTCCCGTTTTTGTGGGCGACGATTTG
+ACCGATGAGGCTGGCTTTGGCGTGGTGAATCACGCTGGCGGAATTTCCGTAAAAGTGGGC
+GTCGGGGCAACCCAGGCGGCATGGCGGCTGGAAAGCGTACCCGATGTCTGGCGCTGGCTG
+GAACAAATCAATTATCCACAACAAGAACAACAAGTAATGAATAACAGGAGAGATGGCTAT
+GAGTCGTTTAGTCGTAGTATCTAATCGAATTGCCCCCCCGGATAATAAAGGCGGCGCCGG
+CGGCCTCGCCGTTGGCGTGCTTGGCGCGCTAAAAGCGGCTGGCGGGTTGTGGTTCGGCTG
+GAGTGGCGAGACAGGTAACGAGGATGAGCCATTAAAAAAGGTGACAAAAGGTAATATTAC
+CTGGGCATCGTTTAACCTGAGCGAACAAGATTACGAAGATTATTACTGTCAATTTTCCAA
+TGCGGTTCTCTGGCCTGCGTTCCACTATCGTCTGGACCTGGTACAGTTTCAGCGTCCTGC
+ATGGGAAGGCTATATGCGGGTGAATGCGCTATTAGCGGATAAGTTATTGCCCCTCATTAA
+AGAGAACGACATCATTTGGGTGCATGACTACCACCTGTTACCGTTTGCCAGCGAGCTGCG
+TAAACGCGGCGTGAACAACCGAATTGGTTTTTTCCTGCATATTCCATTCCCGACCCCGGA
+GATTTTTAACGCTTTACCGCCGCATGATGAACTGCTGGAGCAGTTGTGTGACTTTGATCT
+GCTAGGGTTCCAGACCGAAAATGATCGCCTGGCTTTTCTGGATAGCCTTTCGAGTCAAAC
+GCGAGTCACGACTCGCAGCGGCAAGCAGCATATCGCGTGGGGTAAAGACTTCCAGACAGA
+AGTGTATCCTATCGGTATTGAGCCCGATGAGATTGCTCTGCAGGCTGCCGGGCCGTTGCC
+GCCTAAACTGGCGCAGCTCAAGGCGGAACTGAAAAATGTGAAGAATATTTTTTCCGTCGA
+GCGGCTGGATTATTCGAAAGGGCTGCCGGAACGTTTTCTGGCGTATGAAGCGCTACTGGA
+AAACTACCCGCAGCATCGGGGAAAAATTCGTTATACCCAAATTGCGCCTACGTCACGCGG
+CGAAGTACAGGCATATCAGGATATTCGCCACCAGCTTGAGACGGAAGCAGGCCGGATTAA
+TGGGAAATATGGACAATTGGGCTGGACGCCGCTCTATTATCTGAATCAGCATTTCGACCG
+TAAACTGTTAATGAAGATATTCCGTTATTCAGACGTCGGGCTCGTCACCCCGTTGCGTGA
+CGGGATGAACCTGGTGGCGAAAGAGTTTGTCGCCGCGCAGGACCCCGCTAATCCTGGCGT
+ACTGGTACTGTCACAGTTTGCCGGCGCGGCGAATGAACTGACGTCGGCGTTAATCGTCAA
+TCCTTACGATCGGGATGACGTGGCGGCGGCGCTCAATCGTGCGTTAACGATGCCCCTTGC
+CGAGCGTATTTCGCGCCATGCGGAAATGCTGGACGTGATCGTTAAAAATGACATTAACCG
+CTGGCAGGAGCGTTTTATTCATGACCTAAAGGAGGTCACGCCGCGTAGCCCTGAGCGCCA
+GCAGCAGAACAACGTGGCGACGTTCCCTAAGCTGGCCTGAAATATCGCGAGCGGCGACTA
+GTCGCCCGCTAACGGTACCAGCAACACATCTACCTGGCTGGCGCTGACGACACTTTTTGC
+CGAGCAGGATGCGCGCGAAAAGAAACTATGGTTATGGTTGCCGCAAATGACCAGATCAAC
+ATGGTGTTTGCGGCACACAGCCAAAATATGCTGGCTTAACTCACCTGATGCGATGAAAGT
+TTGTTCAATCGGATAATCCGCCTTTTCCCCCAGCATCTTAAGAAAATTCTCGGTCTCCTC
+ATGCATAACCGCGCGTAAATCCTCCATCATGGGCGCGGCGAACTGGTTATACAGTTCAGG
+ATCGGAAGCGAGAGTAATCAGGCTTACTTTCGCCTGGACAGGGCGGGCGATAGAGACAGC
+TTTAGCCAGTAGCTGGTGACTTTCCGGGGTGACGGCAACGGCGACAAGAATATGGGTGTA
+GCTCATAACTCGCTCCTTGATTGCAAGAATATGAGATCGTGCTTTAGCTTTACTCTGTTT
+ATCGCATTTCTGCAATGCGCTAATGCCACATTAATGTGAAGGACATCATAATTAATCATT
+AATTATTCTTATGTAAAGAATCGTGGCATAAGACACTTTTTACACACCACCAGGATGCTT
+CATTTAAATGGGTGAACAATGAAAGCTAAAAGTTAAATCAAATGAGCTTATTTTTAACAG
+CGGAGGGCGTATGCTGTGACGAGATTAATTAATAACGTTTAATATTTAAGCTACTGTTTA
+CTAAAGGTAAAATAAAAGCGTTTCTAAAATAGAAATAATAGCCTGTTATCTATTATCCTG
+GCGTTATTTTAACAGAGAGAAACAAAAAAGAATTTGGTGTTGACGTACCCCTATTCAGCA
+GTGTGGAATAGAAAAAGTGAACATTAGGTTATTAATTAAACAAAGTAAAAGCCATGCTGA
+TGGTTTTATCGTAAGTATTCCGGTAGATTATGTGATCTACATCACATATTTTCTAAAATC
+GCCGTCCCGCTCCGTTGTATGTCACGAAGCTGACGAGTAGAGTTGCGTCGAATTAGGAAA
+AATCTTAGGCGTTTGTAAAAATTGATGTAAACGTGTAAGGCGAATCTCAGTGGGAGGCTG
+CGTTATACGTCACAATGTCCATAATGTCTGAGCGCTGCTATGCATTTGACCTTTTTGCTT
+CTTTTACCGGGCCTTCCCGGCGACATCACGGGGTGCGGCTACGTCGCACAAAAATAAAGT
+TGGTTATTCTGGATGGGAACAATGCATACATCCGAGTTGCTAAAACACATTTATGACATC
+AATTTGTCATATTTACTCCTTGCACAGCGTTTGATCGTCCAGGACAAAGCATCTGCGATG
+TTCCGCCTCGGTATCAACGAAGAGATGGCAAACACACTGGGCGCGTTGACCCTGCCGCAG
+ATGGTCAAACTGGCGGAGACGAACCAGTTAGTTTGTCATTTCCGGTTTGACGATCATCAG
+ACGATCACCCGTTTGACTCAGGATTCGCGCGTCGATGATTTACAGCAGATTCACACAGGT
+ATCATGCTTTCAACGCGTTTGCTCAATGAAGTGGACGATACGGCGCGTAAGAAAAGGGCA
+TGATAATGAGTGAAAAAAGCATTGTTCAGGAAGCTCGCGATATCCAGTTGGCGATGGAGT
+TGATTAATCTTGGCGCTCGTCTACAAATGCTGGAAAGCGAAACACAGCTCAGCCGTGGTC
+GCCTCATCAGGCTGTACAAAGAATTACGCGGTAGCCCGCCGCCTAAAGGGATGCTGCCAT
+TTTCGACAGACTGGTTTATGACCTGGGAGCAAAATATTCATGCCTCCATGTTCTGCAACG
+CCTGGCAATTTTTACTGAAAACCGGCTTATGCAGCGGTGTGGATGCGGTGATTAAAGCTT
+ATCGGCTTTATCTTGAGCAGTGTCCGCAACCGCCTGAAGGGCCGTTGTTGGCGCTGACTC
+GCGCATGGACGTTGGTGCGTTTTGTTGAAAGTGGGTTGCTTGAATTGTCGAGCTGTAACT
+GCTGCGGTGGGAACTTTATTACCCATGCGCATCAGCCCGTAGGCAGCTTTGCGTGTAGTT
+TATGCCAGCCGCCATCCCGCGCAGTAAAAAGACGTAAACTTTCCCGAGATGCTGCCGATA
+TTATTCCACAACTGCTGGATGAACAGATCGAACAGGCTATTTAACCGAAACGGTGTGGAC
+AAACACTCCAGCAGCGGTAAGTCATTACCGCTGCTTTTTTTTGCCTTGCCTTCGCGTTAA
+TCGCCCGACTGCGCATCCTGTCATAGTCAACAGCGGAAGGATGATGTCGTGCTTATCTTA
+TTAGGTTACCTGGTGGTTATCGGTACAGTTTTCGGCGGTTATGTCATGACCGGCGGACAC
+CTTGGGGCACTCTATCAACCTGCTGAACTGGTCATCATTGGCGGCGCGGGGATAGGGGCG
+TTCATTGTCGGCAACAACGGGAAGGCCATCAAAGGCACGATGAAAGCGATCCCGTTGTTA
+TTTCGTCGTTCGAAATACACAAAATCTATGTACATGGATTTGCTGGCGTTGCTCTATCGC
+CTGATGGCCAAATCACGCCAGCAGGGGATGTTCTCCCTTGAACGCGATATTGAAAATCCG
+AAAGAGAGTGAAATCTTCGCCAGTTATCCGCGTATTCTGGCCGATGCGGTAATGCTTGAT
+TTTATTGTCGATTATCTGCGCCTGATCATCAGCGGCAACATGAATACGTTCGAAATTGAA
+GCGTTGATGGATGAAGAGATTGAAACCCATGAAAGCGAGGCGGAAGTCCCGGCCAACAGC
+CTGGCGATGGTGGGGGATTCGCTGCCTGCCTTTGGTATTGTCGCGGCGGTAATGGGGGTG
+GTTCACGCTCTGGCTTCAGCCGATCGTCCGGCAGCGGAGTTGGGGGCGCTGATTGCCCAT
+GCCATGGTAGGTACGTTCCTCGGTATTTTACTGGCTTATGGATTCATTTCACCGTTAGCG
+ACCGTTTTGCGCCAGAAGAGCGCCGAAACCACCAAGATGATGCAGTGCGTAAAAATTACA
+CTGCTGTCTAATCTGAACGGCTATGCGCCGCCGATTGCCGTGGAATTTGGTCGTAAAACG
+CTTTATTCCAGTGAGCGTCCATCGTTTATTGAGTTGGAAGAACACGTTCGTGCAGTAAGA
+AACCCAAACCAGCAGCAGACGACTGAGGAAGCATGAAAAATCAGGCTCATCCCATTGTCG
+TCGTAAAACGCCGCAGGCACAAACCGCACGGCGGCGGGGCGCACGGTTCCTGGAAAATTG
+CCTACGCCGATTTTATGACGGCGATGATGGCTTTTTTTCTGGTGATGTGGCTGATTTCCA
+TCTCCAGCCCTAAAGAATTAATTCAGATTGCCGAATATTTTCGTACGCCGTTGGCCACCG
+CGGTAACGGGGGGGAATCGGATTGCCAATAGCGAGAGCCCGATACCAGGCGGCGGCGATG
+ATTACACCCAACAGCAGGGTGAAGTGGAAAAGCAGCCGAATATCGACGAGCTGAAAAAAC
+GGATGGAGCAGAGTCGCTTAAACAAACTGCGCGGCGATCTGGATCAACTGATCGAATCCG
+ATCCCAAACTGCGCGCGTTACGTCCGCATCTGAAAATTGATTTAGTTCAGGAGGGGTTGC
+GCATCCAGATTATCGACAGCCAGAACCGCCCGATGTTTAAAACCGGCAGCGCCGAAGTTG
+AGCCGTATATGCGCGATATCCTGCGTGCGATTGCGCCAGTGTTAAACGGTATACCTAATC
+GCATTAGCCTGGCCGGCCATACCGATGACTTTCCCTACGCGAACGGCGAAAAAGGCTATA
+GCAACTGGGAATTATCCGCCGATCGCGCCAATGCCTCGCGTCGCGAACTGGTCGCTGGGG
+GGCTGGATAACGGGAAAGTATTACGGGTGGTTGGCATGGCCGCCACGATGCGGCTGAGCG
+ATCGCGGTCCTGATGACGCCATCAACCGCCGTATAAGCCTGCTGGTGTTAAACAAACAGG
+CGGAACAGGCCATTTTGCATGAAAACGCTGAAAGCCAGAATGAGCCGGTAAGTGTATTAC
+AACAGCCTGCGGCAGCCCCGCCGGCAAGCGTACCCACATCGCCAAAAGCGGAACCGAGGT
+GATAGCGTGAGCATGGATATTAGCGATTTTTATCAGACATTTTTTGATGAAGCTGACGAG
+CTGTTGGCTGATATGGAGCAGCATCTGCTGGATTTGGTGCCGGAATCCCCGGACGCTGAA
+CAACTGAACGCCATTTTTCGCGCGGCGCACTCCATTAAAGGCGGCGCGGGCACATTCGGC
+TTCACTATTCTGCAGGAAACCACGCATTTAATGGAAAACCTGCTGGATGAAGCCCGACGC
+GGTGAAATGCAGCTCAATACCGACATTATCAACCTGTTTTTGGAAACGAAAGATATTATG
+CAGGAACAGCTCGACGCCTATAAAAACTCCGAAGAGCCGGATGCCGCAAGCTTCGAATAT
+ATCTGCAATGCGCTACGCCAGTTGGCGCTGGAGGCGAAAGGCGAAACCACGCCGGCGGTC
+GTAGAAACCGCGGCACTAAGCGCGGCGATCCAGGAAGAGAGCGTAGCCGAAACCGAATCG
+CCTCGTGACGAGAGTAAACTGCGCATTGTACTTTCACGGTTGAAAGCCAGTGAGGTCGAT
+CTGCTTGAAGAAGAGTTGAGTAATCTGGCTACTCTGACGGATGTCGTTAAGGGGGCAGAT
+TCACTGTCGGCAACTCTGGATGGCAGCGTCGCGGAAGATGACATTGTCGCGGTGCTCTGT
+TTTGTCATCGAGGCCGATCAGATCGCTTTTGAAAAAGTGGTCGCCGCGCCCGTGGAAAAA
+GCGCAAGAGAAAACCGAGGTAGCGCCGGTAGCGCCTCCGGCAGTCGTTGCGCCAGCCGCC
+AAAAGCGCGGCCCATGAACATCATGCGGGGCGTGAAAAACCTGCGCGTGAACGCGAGTCC
+ACCAGCATTCGCGTGGCGGTAGAGAAAGTGGATCAGCTCATAAACCTGGTCGGCGAGTTA
+GTGATTACCCAGTCAATGTTGGCCCAGCGTTCTAACGAGCTGGACCCGGTAAACCACGGC
+GATCTCATTACCAGTATGGGGCAGTTACAACGTAACGCCCGCGACTTACAAGAGTCGGTG
+ATGTCGATTCGTATGATGCCTATGGAGTACGTCTTCAGCCGTTTCCCGCGTCTGGTACGC
+GATTTAGCGGGCAAACTGGGCAAGCAGGTAGAGCTGACGCTGGTGGGGAGCTCCACTGAA
+CTTGATAAAAGCCTGATCGAACGCATTATCGACCCGCTGACGCACCTGGTGCGCAACAGT
+CTCGACCACGGGATTGAAATGCCGGAAAAACGCCTTGAGGCGGGGAAAAATGTTGTCGGC
+AATCTGATTCTTTCCGCAGAACATCAGGGCGGGAATATTTGTATTGAAGTGACCGATGAC
+GGCGCGGGGCTTAACCGTGAGCGTATCCTGGCGAAGGCCATGTCGCAGGGGATGGCGGTG
+AATGAAAACATGACCGACGATGAAGTAGGCATGTTGATCTTCGCGCCGGGATTCTCAACT
+GCGGAACAGGTCACGGATGTCTCCGGTCGCGGCGTTGGCATGGATGTGGTGAAACGTAAC
+ATTCAGGAGATGGGCGGTCACGTTGAGATCCAGTCAAAACAAGGCTCCGGCACCACGATT
+CGTATTCTGCTGCCGCTGACGCTGGCCATCCTCGATGGGATGTCGGTTCGCGTGGCGGGG
+GAAGTTTTTATCCTGCCGTTAAATGCGGTGATGGAGTCGCTGCAACCGCGTGAAGAGGAT
+CTTCATCCGCTGGCGGGCGGCGAACGGGTTCTGGAAGTTCGCGGCGAGTATTTGCCGCTG
+GTCGAATTGTGGAAAGTGTTTGACGTGGACGGGGCGAAAACCGAAGCCACGCAGGGCATT
+GTTGTGATCCTGCAAAGCGCGGGACGCCGTTACGCGCTGCTGGTCGATCAGCTCATCGGT
+CAGCACCAGGTGGTGGTCAAAAATCTGGAAAGCAATTATCGCAAGGTACCGGGGATTTCC
+GCCGCGACGATCCTGGGCGACGGCAGCGTCGCGCTGATTGTTGATGTTACCGCATTGCAG
+GGTTTAAACCGCGAACAACGTATGGCGATCACAGCCGCCTGATTGAGTGAGAAGGGAATA
+ATATGACCGGTATGAGTAATGTAAGCAAACTGGCCGGCGAGCCGTCAGGTCAGGAATTCC
+TGGTGTTTACACTGGGAAATGAAGAGTACGGCATCGATATCCTGAAAGTGCAGGAGATCC
+GTGGCTATGACCAGGTGACGCGCATCGCCAATACACCGGCCTTTATAAAAGGGGTGACTA
+ACCTGCGCGGCGTGATTGTCCCCATTGTCGATCTGCGCGTGAAATTCTGCGAAGGCGACG
+TTGAGTATGATGACAATACGGTAGTGATCGTACTGAATCTGGGGCAACGTGTCGTCGGGA
+TAGTGGTAGACGGCGTGTCTGACGTACTGTCGTTAACGGCGGAACAGATCCGTCCGGCGC
+CAGAATTTGCCGTGACCTTGTCAACAGAATATTTGACGGGATTGGGCGCGCTCGGCGAGC
+GTATGCTGATTCTGGTGAATATCGAAAAACTGCTTAACAGCGAAGAGATGGCGCTGCTGG
+ATATCGCAGCATCACACGTCGCGTAATAACGTTGCCGGATGGCGTCGCGCCATCCGGCAA
+TATTCACCGTTATGCTTCCGCCAGCGGTGAGAGTTCCTCTTCATCGCCCGCGCCCAGCCC
+CTGCATTTTGTGCCGACATCGCCGCTGCGACGCTGTTATTGTCAATATCGTCTTCCGGAA
+CAACGTATTTCCTTTTTGCAAAAGTAAAGTTATCACCGCAGGTGCCGATAACGTTGATAA
+CTCGTTATCAGGAAGGTGCCTTATGTTTAACCGTATCCGCGTTGTCACAATGCTGATGAT
+GGTGCTGGGGGTTTTCGCACTGCTACAGCTTGTTTCCGGTGGTTTGCTGTTTTCTTCATT
+GCAGCATAACCAGCAAGGTTTTGTTATTTCTAACGAATTACGCCAGCAACAAAGCGAACT
+CACGTCGACATGGGACTTAATGCTGCAAACGCGCATTAACCTGAGCCGCTCCGCCGCACG
+CATGATGATGGACGCTTCTAACCAGCAGAGCAGCGCCAAAACGGATTTACTCCAGAATGC
+AAAAACGACCCTCGCACAGGCGGCGGCGCACTACGCCAGTTTCAAAAACATGACGCCATT
+GCCAGCGATGGCGGAGGCCAGCGCGAACGTCGATGAAAAATATCAGCGCTATCAGGCCGC
+ATTAGCCGAACTTATTCAGTTTCTGGACAATGGCAATATGGATGCCTACTTCGCCCAGCC
+AACCCAGGGAATGCAAAACGCGTTGGGCGAGGCGCTGGGCAATTACGCCCGGGTGAGCGA
+AAACCTGTACCGCCAGACATTTGATCAAAGCGCTCATGACTACCGTTTTGCGCAATGGCA
+ACTGGGGGGGCTTGCGGTCGTGCTGGTGCTGATTTTGATGGTGGTTTGGTTCGGCATTCG
+TCATGCCCTGCTTAACCCATTAGCGCGAGTGATTACTCATATCCGTGAAATTGCCAGCGG
+CGATCTGACGAAAACGCTCACCGTCTCAGGACGTAATGAAATTGGCGAACTGGCGGGAAC
+GGTTGAACATATGCAACGCTCGCTGATTGACACCGTGACGCAGGTTCGTGAAGGTTCGGA
+TGCGATTTATTCCGGCACCAGTGAAATTGCCGCCGGTAATACCGACCTCTCTTCCCGTAC
+CGAACAACAAGCCTCCGCTCTGGAGGAGACGGCGGCCAGCATGGAACAACTGACGGCCAC
+CGTGAAGCAAAACGCCGATAACGCCCGTCAGGCTTCGCAACTGGCGCAAAGCGCCTCCGA
+GACCGCGCGTCATGGCGGCAAAGTGGTCGACGGCGTGGTAAACACCATGCACGAAATTGC
+CGACAGTTCGAAAAAAATCGCTGACATTATCAGCGTTATCGACGGTATTGCCTTCCAGAC
+TAACATTCTGGCGCTGAACGCGGCGGTAGAAGCGGCGCGCGCGGGAGAGCAGGGGCGCGG
+TTTTGCGGTCGTGGCAGGCGAGGTGCGTAATCTGGCCAGCCGCAGCGCCCAGGCGGCGAA
+AGAAATAAAAGCGTTGATTGAAGATTCCGTCTCGCGTGTCGATACCGGTTCTGTGCTGGT
+GGAAAGCGCCGGGGAAACCATGACTGACATCGTCAATGCCGTTACGCGCGTCACGGATAT
+CATGGGCGAAATCGCCTCCGCCTCGGATGAGCAAAGCCGGGGTATCGATCAGGTCGCTTT
+GGCCGTTTCCGAAATGGATCGCGTAACGCAACAGAACGCCTCGCTGGTTCAGGAATCCGC
+AGCGGCCGCCGCCGCGCTGGAAGAGCAGGCCAGCCGTCTGACCCAGGCGGTATCTGCTTT
+CCGCCTGGCATCGCGACCGCTGGTGGCAAATAAACCTGAGATGCGTTTGTCAGTGGACGC
+TCAGTCCGGCAATACGCCGCGGTCAGTAGCCGCCGGGGATGATGCGAACTGGGAAACCTT
+CTGATCGACGTGCGCTGTCGGTTCTCGATTAATTTGCGAACCCGCCGATACATTTCGTCT
+GGTTCGCATAGATAAAAGCAAAAAATGTGTAATACGGGAAGCATGGCGCTGCCGCAGGGC
+GCGCCCGTTGTACTTTGAATGTGATTAAGAAGGCGCTATGACATCATCTCTGCCCTCCGG
+GCAAACGTCAGTATTGTTACAGATGACACAGCGCCTCGCGCTGTCCGACGCGCATTTTCG
+TCGGATATGTCAATTAATCTACCAGCGCGCAGGGATCGTGCTGGCCGACCATAAGCGGGA
+TATGGTTTATAACCGCCTGGTCCGTCGGCTGCGTGCCCTGGGACTGGATGATTTTGGCCG
+TTATCTCAGTATGCTGGAGGCTAATCAAAACAGCGCTGAGTGGCAGGCTTTTATCAACGC
+TCTGACTACCAACCTGACCGCTTTTTTTCGCGAGGCGCACCATTTTCCCATCCTTGCGGA
+ACATGCGCGTCGCCGCCACGGCGAGTACCGCGTCTGGAGTGCGGCGGCATCGACAGGAGA
+AGAACCTTACAGTATCGCCATTACGCTGGCGGATGCGTTAGGGATGGCCCCCGGTCGCTG
+GAAAGTATTCGCCAGCGATATTGATACTGAAGTGCTGGAAAAAGCGAGAAGCGGTATTTA
+TCGCCTCAGCGAACTGAAAACGTTATCGCCGCAGCAGCTACAACGTTACTTCATGCGCGG
+TACGGGGCCGCATGAAGGACTGGTGCGCGTGCGTCAGGAACTGGCCAATTATGTTGAATT
+TTCCTCCGTTAATTTATTGGAAAAGCAGTACAACGTACCCGGTCCCTTTGACGCGATTTT
+TTGCCGTAACGTCATGATCTATTTTGATAAAACGACTCAGGAGGACATTCTGCGCCGTTT
+TGTTCCACTCCTTAAACCTGACGGACTGTTGTTTGCCGGTCACTCAGAAAACTTTAGCAA
+CCTCGTGCGCGAGTTTAGCCTGCGCGGACAGACGGTGTATGCGCTAAGTAAGGATAAAGC
+ATGAGTAAAATCAGGGTATTGTCAGTTGATGATTCCGCGCTAATGCGCCAAATCATGACT
+GAAATTATTAATAGCCATAGCGATATGGAGATGGTGGCGACTGCGCCGGACCCGTTGGTC
+GCCAGGGATCTCATCAAAAAATTTAATCCGGACGTATTGACCCTGGACGTTGAGATGCCG
+CGTATGGACGGCCTCGATTTTCTGGAAAAACTGATGCGCCTGCGACCGATGCCGGTGGTG
+ATGGTCTCTTCGCTGACCGGGAAAGGTTCTGAAGTGACGCTACGGGCGCTGGAGTTGGGG
+GCCATCGATTTTGTCACCAAACCGCAGCTTGGCATTCGTGAAGGTATGCTGGCGTATAGC
+GAGATGATCGCCGAAAAAGTGCGTACCGCCGCGCGGGCCCGCATCGCCGCACATAAACCG
+ATGGCGGCCCCGGCAACCTTAAAAGCCGGTCCGCTGCTCAGTTCCGAAAAACTGATTGCT
+ATCGGCGCTTCAACGGGCGGTACTGAAGCTATCCGACATGTGCTGCAACCGCTGCCGCTT
+TCCAGTCCGGCAGTGATTATTACGCAGCATATGCCGCCTGGCTTTACCCGCTCGTTTGCC
+GAGCGTCTGAATAAACTCTGTCAAATCAGCGTGAAGGAGGCGGAGGACGGCGAACGCGTA
+TTGCCAGGTCATGCCTACATTGCGCCCGGCGACAAGCATATGGAGCTGGCGCGTAGCGGG
+GCGAATTATCAAATCAAAATTCATGATGGCCCGCCGGTAAACCGGCATCGGCCTTCCGTG
+GATGTGCTGTTTCATTCGGTGGCGAAACACGCGGGGCGCAACGCCGTAGGCGTCATTCTT
+ACGGGGATGGGCAACGATGGCGCCGCTGGAATGTTAGCGATGTACCAGGCTGGCGCCTGG
+ACCATTGCGCAAAACGAAGCAAGTTGTGTGGTGTTCGGCATGCCGCGCGAGGCCATCAAT
+ATGGGTGGCGTAAGCGAAGTGGTCGATCTTAGCCAGGTAAGCCAGCAGATGCTGGCGAAA
+ATCAGTGCCGGACAGGCGATACGTATTTGAACCAGGAGTAGTATTTTATGGCGGATAAAG
+AGCTTAAATTTTTGGTTGTGGATGACTTTTCGACCATGCGTCGTATCGTGCGCAACCTCT
+TAAAAGAGCTTGGATTTAACAATGTGGAAGAGGCCGAAGACGGCGTCGATGCGCTGAACA
+AGCTCCAGGCGGGCGGCTTTGGTTTTATTATCTCCGACTGGAACATGCCGAACATGGATG
+GCCTGGAGCTGCTGAAAACCATTCGCGCCGATAGCGCCATGTCGGCGTTACCCGTGTTGA
+TGGTCACGGCGGAAGCCAAAAAAGAGAATATTATCGCCGCCGCACAGGCTGGCGCCAGCG
+GTTATGTCGTAAAACCGTTCACCGCAGCGACTCTGGAAGAGAAGCTCAACAAAATCTTTG
+AGAAACTGGGCATGTGAGGATGCGATGATGATGCAACCATCTATCAAGCCTGCTGATGAA
+GGTTCAGCAGGAGACATCATTGCGCGCATCGGTAGTCTGACCCGAATGCTGCGCGACAGC
+CTGCGTGAGCTGGGGCTGGACCAGGCGATTGCCGAAGCGGCGGAGGCGATCCCTGATGCG
+CGCGACCGTCTGGATTACGTCGTCCAGATGACGGCGCAGGCGGCGGAACGCGCGCTAAAC
+AGTGTCGAAGCCTCGCAGCCGCATCAGGATGCGATGGAGAAAGAGGCGAAAGCGCTAACC
+CAACGTTGGGACGAGTGGTTTGACAATCCGATCGAGCTTGCCGACGCCCGTGAACTGGTG
+ACGGATACGCGCCAGTTTCTCAGGGATGTCCCGGGCCATACCAGCTTTACTAACGCGCAA
+CTGCTGGACATCATGATGGCGCAGGATTTCCAGGATCTGACGGGTCAGGTGATCAAACGC
+ATGATGGACGTGATTCAGGAGATTGAGCGCCAGTTATTAATGGTACTGCTGGAAAACATC
+CCGGAACAGAGCGCACGACCAAAACGCGAGAACGAAAGCTTACTCAACGGCCCGCAGGTG
+GATACCTCGAAAGCTGGCGTCGTCGCCAGTCAGGATCAGGTGGACGACCTGCTGGACAGT
+CTTGGGTTTTAAGCTTTTTTGACCTGATGGCGCTGCGCTTATCGGGTTCGAATCCGTCAA
+CCCGGCCGGATACGAGACTTTCTTATCGTATCCGGCTATCTCTATTAACGCCATAAACCC
+CGCCTTTTTTACCGCTTACTCTGCCCATTGGCGTAAAGCGGTTCTGGCATCATTCTCGCT
+TATCAATCTATCCAGGGTTTGCTGCGTGGCAGAAGAGAGCGACGACGACAAAACAGAAGC
+CCCCACACCCCACCGACTTGAAAAAGCGCGGGAAGAAGGGCAGATCCCCCGTTCCAGAGA
+ACTGACCTCACTGCTGATATTGCTGGTGGGCGTTTGTATTATTTGGTTCGGCGGCGAGTC
+GTTAGCGCGGCAACTGGCGGGAATGCTCTCAGCAGGCCTGCACTTCGATCACCGTATGGT
+GAACGATCCTAACCTGATCCTGGGGCAGATAATTTTGCTGATTAAAGCGGCGATGATGGC
+ACTGCTACCGCTCATCGCGGGCGTGGTACTGGTGGCGCTTATCTCGCCGGTTATGCTTGG
+CGGCCTGATTTTTAGCGGTAAGTCGCTACAGCCAAAATTTTCTAAATTAAACCCGCTGCC
+GGGAATTAAGCGCATGTTTTCGGCGCAGACCGGCGCGGAACTGCTAAAAGCGGTGTTGAA
+ATCCACGCTGGTCGGCTGCGTTACCGGCTTTTATCTCTGGTATCACTGGCCACAAATGAT
+GCGCCTGATGGCGGAGTCGCCGATCGTCGCAATGGGGAATGCGCTGGATCTGGTTGGACT
+CTGCGCGTTACTGGTGGTACTGGGCGTGATTCCGATGGTGGGATTTGACGTGTTTTTCCA
+GATCTTTAGCCACCTGAAAAAATTACGCATGTCGCGGCAGGACATTCGCGACGAATTTAA
+AGAGAGCGAAGGCGATCCGCATGTTAAGGGCAAAATTCGCCAGATGCAACGCGCCGCCGC
+GCAGCGCCGCATGATGGAAGATGTGCCGAAAGCGGACGTCATTGTCACTAACCCGACGCA
+CTATTCCGTGGCGCTGCAGTATGACGAAAACAAAATGAGCGCGCCGAAAGTGGTCGCGAA
+GGGGGCTGGATTAATAGCGCTGCGCATTCGCGAGATCGGCGCTGAACATCGGGTTCCCAC
+TTTAGAAGCGCCGCCGCTGGCGCGGGCATTATATCGCCACGCCGAAATCGGTCAGCAAAT
+TCCCGGGCAGTTATATGCTGCCGTTGCGGAAGTGTTGGCCTGGGTCTGGCAGCTTAAACG
+CTGGCGGCTTGCGGGCGGGCAACGTCCTCCACAACCTGAGAACCTTCCGGTGCCAGAAGC
+GCTGGATTTTATGAACGAGAAGAATACTGATGGCTAATCTGGTCGCGATGCTGCGCCTAC
+CCAGCAACCTGAAATCGACGCAATGGCAAATTCTTGCCGGGCCGATCCTCATTCTGCTGA
+TTTTGTCGATGATGGTGCTGCCGCTGCCTGCTTTTATCCTCGACTTATTGTTTACCTTTA
+ATATTGCGCTATCGATCATGGTGCTGCTGGTGGCGATGTTTACCCAGCGTACTCTGGATT
+TTGCCGCGTTTCCGACCATCCTGCTGTTTACCACGCTACTGCGTCTGGCGCTTAACGTAG
+CCTCAACGCGCATTATTTTGATGGAAGGGCATACCGGCGCGGCGGCGGCGGGAAAGGTAG
+TGGAGGCGTTCGGTCATTTCCTGGTCGGCGGTAACTTCGCGATCGGGATTGTGGTTTTTA
+TCATCCTCGTCATTATCAACTTCATGGTCATCACCAAAGGCGCCGGACGTATTGCCGAAG
+TCGGCGCGCGCTTTGTGCTGGATGGTATGCCCGGTAAGCAAATGGCGATTGACGCCGATC
+TTAATGCCGGTCTGATTGGTGAAGACGAGGCCAAAAAACGGCGTTCGGAAGTCACTCAGG
+AAGCCGACTTCTACGGCTCGATGGACGGGGCAAGTAAATTTGTACGCGGCGACGCCATCG
+CCGGTATTCTCATCATGGTCATTAACGTGGTCGGCGGGCTGCTGGTCGGCGTATTGCAGC
+ACGGAATGAGCATAGGCAGCGCGGCGGAAAGCTACACCCTGCTGACCATTGGCGACGGCC
+TGGTCGCCCAGATCCCGGCGCTGGTTATCTCCACGGCGGCGGGCGTCATTGTGACCCGCG
+TTAGTACCGATCAGGATGTTGGCGAGCAGATGGTTGGCCAACTGTTCAGTAATCCAAGGG
+TGATGCTGCTGGCGGCGGCGGTGCTGGGGCTGCTTGGCATGGTGCCTGGAATGCCTAACA
+TGGTATTTTTACTCTTTACCGCCGCTTTGCTCGGCCTGGCATGGTGGCTGCGCGGGCGCG
+AAGAAAAAGCGCCGGAGGAGCCGCAGCCGGTAAAAATGCCGGAAAATAACTCGGTGGTCG
+AAGCTACCTGGAATGACGTACAGCTTGAGGATTCACTGGGAATGGAAGTGGGCTACCGCC
+TGATCCCGATGGTGGATTTTCAACAGGATGGCGAATTGCTCGGACGTATTCGCAGCATTC
+GTAAAAAATTCGCGCAGGATATGGGGTTCCTGCCGCCGGTTGTCCACATTCGCGACAATA
+TGGATTTACAGCCTGCGCGCTACCGTATTTTGATGAAAGGGGTAGAGATCGGCAGCGGGG
+ACGCCTATCCGGGACGCTGGCTGGCTATTAACCCCGGCACGGCGGCGGGAACGCTACCGG
+GCGAGAAAACCGTCGATCCAGCTTTTGGCCTTGATGCCATCTGGATTGAAAGCGCCCTGA
+AAGAGCAGGCGCAAATTCAGGGCTTTACCGTCGTGGAAGCCAGTACCGTTGTGGCGACGC
+ACCTTAACCACTTGATTGGCCAATTCTCCGCCGAACTGTTTGGCCGCCAGGAAGCGCAGC
+AACTGTTGGATCGTGTCTCTCAGGAGATGCCTAAACTCACGGAAGATCTGGTCCCCGGCG
+TCGTGACCCTCACAACTTTACACAAAGTCCTGCAAAACTTACTGGCGGAAAAAGTCCCGA
+TTCGCGATATGCGCACCATTCTGGAAACGCTGGCGGAACATGCGCCGTTACAAAGCGATC
+CGCATGAATTAACCGCCGTGGTACGCGTGGCATTAGGACGAGCGATTACGCAACAGTGGT
+TCCCCGGTAATGAAGAAGTGCAGGTGATTGGCCTGGATACCGCGCTGGAGCGTTTGCTGC
+TTCAGGCATTGCAGGGCGGCGGCGGTCTTGAGCCTGGGTTGGCGGATCGCCTGCTGGCGC
+AGACGCAAGAGGCGCTTTCTCGCCAGGAAATGCTTGGTGCGCCGCCGGTATTACTGGTTA
+ACCATGCGCTACGTCCATTATTGTCCCGCTTTTTGCGGCGCAGTTTACCGCAGCTGGTGG
+TGTTGTCGAACCTTGAGCTTTCCGATAACCGTCATATCCGCATGACGGCGACCATTGGAG
+GAAAATAATGCGTAAATGGCTGGCGTTGTTGCTCTTTCCCCTGACGGTTCAGGCCGCAGG
+CGAAGGCGCGTGGCAGGATAGCGGTATGGGTGTAACCTTAAATTACCGGGGTGTTTCCGC
+ATCGTCTTCGCCATTGTCGGCGCGCCAGCCGGTTTCCGGTGTGATGACGCTGGTCGCCTG
+GCGTTATGAACTGAATGGCCCGACTCCCGCGGGCTTACGGGTACGTTTATGTTCCCAGTC
+CCGTTGCGTAGAACTTGATGGTCAGAGTGGCACGACCCACGGTTTTGCTCATGTTCCCGC
+AGTCGAGCCGCTCCGCTTTGTCTGGGAAGTCCCCGGCGGCGGCCGACTTATCCCGGCGTT
+AAAAGTGCGGAGCAATCAGGTGATTGTGAACTACCGCTAACCGCCCCTTTCTTTGCCAGG
+TAGCAGACCTGACTCTCTTTTTGAATAAATAGAAACGCTGTTTTATAAAATGGTGAGGTA
+GGTTGCCGGACTCTTTGCGTTTTTGCCATTTACGCTCTGGCAATGGCAGAAACAAAAAGG
+TTTCCGCCCAGCTTAGCTTTTACTGTAGCGAATCGACTGCGTCGGCGGTAAAACTGCACG
+CAGCACTGAATTCGACATTACACAGAGGTTAAGCAAATGATGGTTTATCCAGTCAAACAC
+AGTCCGCTATTGCGTCAGCCTGAGCATTTTATCGCCAGAGATGAACTAAAAGCCCTGGTG
+CAAAAGGTGACGCATAACCTGGTCAATATTAAAGATGAGACAGGCGAATTTTTATTGCGA
+CTGGACGATGGACGCGTGATCGATACTAAAGGCTGGGCCGGATGGGAGTGGACGCACGGC
+GTGGGCCTGTACGGAATGTATCACTATTACCAACAGACCGGCGACCAGACGATGCGTAAG
+ATCATTGATGACTGGTTTGCCGATCGTTTTGCGGAAGGCGCGACGACGAAAAACGTTAAT
+ACGATGGCGCCATTTTTAACGCTGGCGTATCGCTATGAAGAGACGCGTAATCCAGCGTAT
+TTACCGTGGCTGGAAACGTGGGCCGAATGGGCGATGAATGAAATGCCCCGTACCGATCAC
+GGCGGAATGCAGCACATCACGCTGGCGGAGGAAAATCATCAGCAGATGTGGGACGACACG
+CTAATGATGACGGTGCTGCCGCTGGCGAAAATCGGTAAACTGTTGAACCGGCCGGAATAT
+GTGGAAGAGGCAACCTATCAGTTCCTGCTGCACGTGCAGAATTTGATGGATAAAGAGACG
+GGGCTGTGGTTCCACGGCTGGAGCTATGACGGTCATCATAACTTCGCTAACGCTCGCTGG
+GCGCGCGGCAACAGTTGGCTGACCATTGTGATCCCGGATTTTCTTGAACTGCTGGACTTG
+CCGGAAAATAATGCCGTGCGCCGTTACCTGGTCCAGGTACTGAATGCGCAGATCGCCGCG
+CTGGCGAAATGTCAGGATGAAAGTGGTTTGTGGCATACGCTGCTTGACGATCCGCACTCT
+TATCTTGAGGCGTCGGCGACGGCGGGTTTTGCCTACGGTATTCTTAAAGCGGTGCGCAAA
+CGCTATGTCGGGCGGCACTATGCGCAGGTGGCGGAAAAAGCCATTCGGGGGATAGTGAAA
+CATATCTCGCCGGAAGGCGAACTGCTGCAAACGTCATTTGGCACTGGCATGGGCCACGAT
+CTCGATTTTTACCGTCATATTCCGTTGACCTCTATGCCTTACGGGCAGGCGATGGCAATG
+CTGTGTTTGACGGAATATCTGCGTAACTATTTCTGATGTATGCAGATATTCCGGCCGTAT
+CCTTGTCTGATGGCGCTTTGCTTATTTGACTATGGCGCCTGACCCGACTGTGTGGTATCA
+GCCTGTGGATCAAACAGGTGGTCAAGGATTTTTCGCATGATGGGCGCGGCGGTAACGCCG
+TCGCTTCCGCCGTTTTCCAGAATCAAGGCAATAGCGACCTTAGGGTTTTTATACGGTGCA
+AAAGCGGTATAAAACACATGATCGCGCAGGCGAATGGGGATCATTTTCGCGTTGTAGGTC
+TGATTTTCTTTCAGGCTAAACACCTGCGACGTGCCGCTTTTGGCCGCAATGCCGTAGGGC
+GCTGTGTGAAAGAACTTATAGCCCGTTCCGTTGGGTGCATTCGCCATGCCATACATCGCC
+TGACGCACCAGTCCCCAGTATGGCGACGCCGGATCGGCTATCTGTGCCGGTGTTCCTGAA
+GGGCGATACGGAACCACCGTTTTGCCGCTCTCTTCATTGAGTAACAGGTGAGGGGCAATC
+ACCTTACCGTTGTTGATGAGCGCCACCATCGCTTTTACCATCTGGATGGGGGTGGCAATC
+CAGTAACCCTGGCCGATGCCGACAGAAATGGTATCGCCCTGATACCAGGCTTTTTTATGG
+ACCCGCTGTTTCCATGCGCGGCTGGGAAGCAGCCCGTCATACTCTTCATTAAGGTCGATG
+CCCGTCGGTTTGCCATAGCCGAACTGAGACAACATCGTGTCGATACGGTCAATACCCATC
+ATATAAGCGACCTGATAGAAAAAGGTATCCGCAGATTCCTCAATCGCTTTAGTGACATCC
+AGCATACCGTGTCCGGTTTTTTTCCAGTCCCGGTAATGCCGCTGCGTGCCGGGAAGCGTC
+CAGGTTGGCGCGCCAAAGAAGGTGGTTTGCGGCGTAATAATCCCGCATAACAGCGCGGAC
+ATTGCCATATAGGGTTTAACCGTTGACGCCGGAGGATAAAGCCCTTGCGTCACGCGGTTG
+ATCAGCGGCAGATTTTTATCGTGCAGCAGTTTGCCGTAATCCTGATAGCTAATGCCTTTT
+ACAAAGGGGTTCGGGTCGTAGCTGGGCATAGATACCATCGCCAGCACTGAACCATCGTGC
+GGATCTTCAACCAGTACGGCAGCACGCTGCCCGGCCAGCAAACTTTCAATGTACTCTTGT
+AAATGGAGATCCAGCGTCAGGTGAATGTTCTTACCCGCGATGGGAGGAACGTCTTTCAGC
+AGGCGGACAATACGCCCGTGATTATCCACCTCGACCTCCTGATAACCGGTTTTGCCATGA
+AGATCGTTTTCGTAGTAACGCTCAATCCCCTGTTTACCGATGTTATGGTCCGCCGCGTAA
+TTCTCTGCCAGCCCTTTTTTATCCAGCGCTTTAAGGTCGTTATCGTTTATCTTTGACACG
+TAACCGAGAACATGCGCCAGCTCCGCGCCGTAAGGATACTGCCGATCCTGATAGCTATTG
+ATCGTGACGCCGTTGAAATGAAACTGATTGACCGCAAAGCGTGCGATTTCAACATCCGTT
+AGCGCGTTTTTGAGCACCACCGGACGATAGCGGCTACTGGATTTTAGCGCGCGGCGAAAG
+TCGGCGATATCATCGGGGGAGAGATCAACAATAGGGGTGAGCTGTTTTAGCAGCGCATCC
+ATATCGGCAATTTTATAGGGCGTAACCGCGATATCATACCAGGTTACGTTACGCACCAGC
+GGAATGCCGTTGCGATCGTAAATGATGCCGCGCGTGGGCGCGACGGGTAGCATCTTGATA
+TCGTTCTCATTCGAACGGGTGGTGTAGTAGTGGTGCTGACGGATTTGCAAGTTATAGAGG
+TTGAAGATCAGGATACCAAAGCAGACAACCACTACACCAAACGCCACAATCACACGTCTC
+AGGAAGAGTTTCTCTTCCGCATCAAAGTCTTTAAAAGTCATTACCTGTACCTGAACAATC
+CGCCGCCTAATGATACGGGGCGGTCAGCGCCAGCACAGGTAAAAGATGTTCCATCTCTCT
+ATAGAAATGTGTCATTCCTTGTGATTTGTTACAGATATACCGCTGTGGCAATAAAAAGGC
+CTGAGTCCGTTATCCGGAGTCAGGCCTGATGATGTTAACGACGGCGCGTTTACATGCGTT
+CTACGGTTTCGATACCCAACGTATCCAGACCCAGTTTCAGCGTCTTCGCCGTCAGTTGCG
+CCAGTTTTAGGCGGCTATTGCGAACCGCGTCATTCTCGGCGCTGAGAATAGGGCAGTGCT
+CGTAGAAGCCGGAGAACAGCCCGGCGACGTCATACAGATACGCGCACATGACGTGCGGCG
+TACCTTCACGCGCGACCACCGTCAGGGTTTCTTCAAACTGCAGCAGACGGGCAGCGAGTT
+GCGCTTCGCGATCTTCGCTAATGATAACCGGCGCGCTCGCCAGCGCCTGCTCGTCGATGT
+CCGCTTTACGGAAAACAGACAGCACACGCGTATAGGCATACTGCATATAAGGAGCGGTAT
+TGCCTTCGAAAGCCAACATATTATCCCAGTCGAAGATATAGTCAGTGGTGCGGTTTTTTG
+ACAGATCGGCGTATTTCACCGCGCCAATACCGACGGCGTTAGCCAGTTTTTCCAGCTCGT
+CAGCCGACATATCCGGGTTCTTCTCCGCCACCAGACGACGCGCGCGCTCCAGCGCCTCAT
+CCAGCAGGTCCGCCAGTTTCACCGTACCGCCCGCGCGAGTTTTAAACGGTTTACCGTCTT
+TACCCAACATCATGCCGAACATGTGGTGTTCCAGCGGAACGGAATCCGGCACATAACCGG
+CTTTACGCACAATGGTCCAGGCCTGCATCAGGTGCTGGTGCTGACGGGAGTCAATGTAGT
+AGAGCACGCGGTCGGCGTGCAGCGTTTCGTAACGGTATTTGGCGCAGGCGATATCGGTAG
+TGGTATACAGATAACCGCCATCTTTCTTCTGAATAATGACGCCCATCGGGTCGCCTTCCT
+TGTTTTTAAACTCATCAAGGAAAACCACCGTTGCGCCTTCGCTTTCAACCGCCAGGCCTT
+TGGCTTTCAGATCGGCGACGATGCCCGGCAGCATCGGATTATACAGACTTTCGCCCATCA
+CATCGTCACGCGTCAGAGTGACGTTCAGACGATCATAGGTGATCTGGTTTTGCGTCATCG
+TGATATCAACCAGCTTACGCCACATCTCACGGAAATAGGTATCACCGCTCTGCAATTTGA
+CGACGTAGTTACGCGCGCGCTCGGCAAACGCTTCATCTTCGTCATAATGCTTTTTCGCAT
+CGCGGTAGAATCCTTCGAGATCCGCCAGCGCCATGTCGCCCGCGTTTTCCTGCTGCTGTT
+TTTCCAGCCAGGCGATAAGCATACCGAACTGGGTGCCCCAGTCGCCGACGTGGTTAGCGC
+GAATAACATGATGGCCCAGAAACTCCAGCGTGCGCACTGCCGCATCGCCGATAATCGTGG
+AGCGTAGATGACCGACGTGCATCTCTTTCGCGACGTTGGGCGCGGAGTAGTCGACGACAA
+TCGTCTGACGAGTCGGCTGAGAAACGCCCAGACGATCGGAGGTCAGCGCCTGTTGCACCT
+GTTCAGCGAGAAAAGCCGGTTCGAGGAAAATATTGATAAAGCCAGGGCCGGCGATTTCAA
+CCTTGCTGGCGATGCCGCTGAGATCCAGATGAGTCAGCACCTGCTCTGCAAGTTGTCGGG
+GGGCCATACCCAGTTTTTTCGCAACTGCCATCATGCCGTTGGCCTGATAGTCGCCGAACT
+GAACTTTGGCTGACTGACGAACCTGGGGCTCGCAATCTGCAGGCGCGCCTGCAGCAATCA
+TGGCCTGACTAACTTTTTCTGAGAGAAGAGCCTGAATATTCACCGGAATACCTTACGTTT
+ATGAAGCGGACTGTATTGCCCGCGCCAGTTTAAGAATTAGGGCGGGAGTATACTGCAAAT
+GCCCGTTGGCGTCAGCATTGCGCGCGCGGCGCGTCGCCTGAAATATACGCAACAATAATC
+TGCATAAGCATTCAATAAACGCCCAATCAAATCAAAGGTTGGTTGCCGGGGCGCAACAGC
+GTAAATTAGCGGTTTTCACAGCAAGAAGAGCGTCCTGATATGGCGAACTGGCAACACATT
+GATGAACTGCATGATATTTCCGCAGATTTACCGCGATTCACTCTGGCGTTCAGAGAACTT
+TCCACTCGCCTTGGTCTGCAGATTAGCGCCCTTGAGGCCGATCACATTTCATTGCGCTGT
+CACCAGAATACGACGGCGGAGCGTTGGCGTCGCGGTTTTGAACAATGCGGTGAGCTACTG
+TCGGAAAATATCATCAACGGCAGGCCGATTTGTCTGTTTAAACTGCATGAACCGGTATGT
+GTGGAACACTGGCGGTTTTCTGTTATCGAATTACCGTGGCCGGGAGAAAAACGCTATCCA
+CACGAGGGGTGGGAGCATATTGAAATCGTGCTGCCCGGCGAGCCGGAGACCTTGAACGCG
+AGGGCGCTGGCGTTGTTGTCGGATGAGGGGCTTAGTCAGCCGGGGATAGTGGTTAAAACC
+AGTTCGCCACAGGGCGAGCATGAACGTTTGCCAAACCCTACGCTGGCCGTGACCGATGGC
+CGCATCACGGTAAAATTTCATCCATGGTCGATTGAAGCGATTGTCGCCAGCGAACAGGCG
+GCCCATTAACCTGCCGAGCGGAGTGAATATGGCGTTACTTGAGATCTGTTGTTACAGCAT
+GGAATGCGCGCTCACCGCGCAGCGAAACGGCGCGGATCGTATCGAACTGTGCGCCGCGCC
+GAAAGAAGGCGGGCTTACGCCTTCGCTGGGCGTCTTACGCAGCGTGCGCGAGCATATTAC
+GATTCCCGTACATCCGATTATTCGTCCTCGCGGCGGGGATTTTTACTACACTGACGGCGA
+ATTTGCCGCCATGCTGGAAGATATTCGCCTCGTCAGAGAGTTGGGTTTTCCCGGGCTGGT
+GACTGGCGTGTTGACCGTTGATGGGGATGTCGATATGTCGCGAATGGAAAAAATAATGGC
+GGCGGCCGGACCGCTGGCGGTGACATTCCACCGCGCCTTCGATATGTGTGCTAATCCCTT
+CAATGCGCTAAAGAATCTGGCTGACGCAGGCGTAGCAAGAGTACTGACTTCCGGACAAAA
+AGCCGATGCGGCGCAAGGTTTATCAATAATTATGGAACTTATTGCCCAGGGGGATGCTCC
+AACCATTATGGCTGGTGCGGGGGTTCGTGCAAATAACCTGCAGAATTTCCTCGATGCCGG
+AGTACGGGAAGTACACAGTTCCGCCGGAGTCTTACTGCCTTCGCCGATGCGCTATCGCAA
+TCAGGGGTTATCGATGTCTGCCGATATACAGGCGGACGAGTATTCTCGCTATAGGGTAGA
+GGGTGCGGCGGTCGCTGAAATGAAAGGAATCATTGTTCGCCATCAGGCCAAATGATTTTT
+ACCGTTGCATCATGTCGCCCAATATGATGCTTGCTCGTACCAGGCCCCTGCCAATTCAAC
+AGGGGCCTTTTTTTCTCCTTCATATTTCAAGCCGCAGCAGCGTTGGCCGCCTCGCGCACC
+CCGGTCACGTAGCTACCTACGTTCCCGGGGATTTGCTGCGTTGCCGCCTTGCTGCAACTT
+GAACTATTTTGGAGAAACGGTGCTATACGTAACGGTCATTCGGCAATCCATCACGGTTTA
+CGCGCAATCAGCACCGCGCGCTGCGGGGCGGGGTAGCCTTCCACCGTCTTGCTGCGATCG
+TTCGGGTCAAGAAAATCGGCCAGCGACTCGGTAACCATCCATTCGGTACGGCGCTGCTCT
+TCGGTGGTGGTGACGCAAACGTCAGCGATACGCACATCAATAAAGCCGCATTTTTCCAGC
+CATTTTTTTAATGCCGGCGCGGAAGGAATAAAATAGACGTTACGCATCTGCGCGTAGCGG
+TCACCCGGCACCAGTACGGTATTTTCGTCGCCGTCGACGACCAGCGTTTCCAGTACCAGT
+TCACCCTCGTTGACCAACTGATCTTTTAACTGCCACAGATGCTCCAGCGGCGAGCGACGG
+TGATAAAGCACCCCCATCGAGAAGACGGTATCAAATGCTTTCAGCGCCGGGAGTTGTTCA
+ATGCCCAACGGCAGCAGATGCGCGCGCTGATCGTTACCCAACAGTTTACGCACCGCCTCA
+AACTGGCAGAGGAAAAGCTGTGTAGGATCGATGCCGACCGCCAGATGTGCGCCCGCGCCA
+ATCATCCGCCACAGGTGATAGCCGCTGCCGCAGCCGACATCAAGGATCGTCCGGCCGGTT
+AAATCTGACAGATGCGGCAGTACGCGATCCCACTTCCAGTCGGAGCGCCATTCGGTATCA
+ATATCTACGCCATAAAGCGAGAACGGGCCTTTACGCCACGGCATCAGATTACGCAGCAAT
+GTATCAATACGCTTTAGCTGACCTTCGCTGAGCGGCGTTTCGCTTTCAGCCGTGACGCTG
+TGCAGTAAATCCAGCCGCCAGGGCGTCATTTCCGGTAAAAATTCTACCGCGTTCGACCAC
+TGTTTAAACAAGCCATGCTGCTGCTCGCGTTGCCAGGCGGCAATCTGCGCGGGCAATGTT
+TCCAGCCAGTGGGAGAGATGATTTTTAGCAATGAGCTGATAAAAGTTACCAAACTCGATC
+ATGCGGCAACTCCGGCTTTTAACGCGACAAGCGACCCGAAGTTAAAGCACTGGAACCACA
+GTTCACTATGTTCGAAACCCGCCTTACGCAGGCGCGCTTTATGTGTTTCCACCGAGTCGG
+TGAGCATCACGTTTTCCAGCATACTGCGCTTCTGGCTGATCTCCAGTTCGCTGTACCCAT
+TCGCGCGTTTAAAATCGTGGTGCATGTTGAATAACAGCTCACCCACTTTCGCGTCTTCAA
+AGCTAAATTTTTCCGACAGTACCAGCGCGCCGCCGGGATTCAACCCCAGGTAAATCTTAT
+CCAGCAATGCCTGGCGTTCGGCAGGTTCAAGGAATTGCAGGGTAAAATTCAGCACCACCA
+TCGAGGCGTTTTCAATAGTGATATCGCGGATATCGCCTTCAACGACTTCAACCGGCGTAG
+GCGCTTTATACGCATCAATATGGCGGCGGCAGCGTTCAATCATGGCCGGGGAGTTATCGA
+CGGCGATAATGCGACAATGCTCATGGCGGATATTACGCCGAACAGACAGCGTCGCGGCGC
+CCAGCGAGCAGCCCAGATCGTAGACCTGCGTGTTCGGCTGCACAAAGCGTTCAGCTAACA
+TGCCGATCATGGAGATGATGTTGGAGTAGCCTGGTACCGAACGCTGAATCATGTCGGGGA
+AAACTTCGGCTACTCGTTCATCAAAAGTCCAGTCGCCGAGACGGGCGATAGGCGCAGAAA
+AAAGCGTGTCGCGGTGAGACATAACGTATACATCCGGGAAAAATAAAGGCGCATATTGTG
+CGCTAATACAGGGAGAAAACCAACTCCCAGGGCATATACCACAGGTTTGCCAGCACCATC
+AGCAACAATGCGCACCAGGTAGCGCTCATCCCCGCCCGCCGCCAGCGGAACAGGCGGTGG
+TGAAAACCGTAATAATGCATCAGCCGACCGGCGATTAAAATGATGCCGCAGATATGCACC
+ATCCACGTTTCGGCGCCGTTCATTTCCATAAACAGCAGCAGCACCAGCGCGACAGGAATA
+TATTCCACCGCGTTGCCATGAATACGGATGGCGCTTTGTAATTCGCTAAAACCGCCGTCG
+CCATAGGCGACACGGTACTGCATTCGCAAGCGAACGACATTAAAAGAGAACTTCATTAAT
+AATAACGCACCCAAAACGGCATACAGCGCGCTTACCATACAAACTCCCTTTTAAAATGGC
+TGATGGCACTGTCTATGATAGGGGGCATTTTCAGAAAAGAGAAGATTGCTGTGGAATGGA
+CGGAGCAGTGCCGATTTCCGGTAAGACGCTGCGTAAATCATGCCAAAGTGTATTCACCAG
+TTCCGGCGCCTGCGCGATATCCGGAGTATGTAAAAACAGAAAAGGCGTGGTGGTCTGCCG
+CCACTGCGGGAGTTTCTGCAACCAGGCGGCGAAAAACTCACGGTTTTGCGCCATATTATC
+GCTACCGATAAAACGCACCATCGGATGGCTAGCCGTCACGACAGCATGTACCGGAACTTT
+GGGTTTTTTTCGCTGCGCGTCGCGGACGGCCTCGCTGTGGGGATGGGCGGCATGTACCGG
+ACGACTATCCAGGATCACGCGGTTTACGCCGCGCGCGTGTAACCCGCGATTGAGCCGCTG
+TTCATCCTCACCTTTGTCAAAAAAACACGGATGACGAACTTCTACGCCATAGGTAAACGT
+GGCGGGGAGCGCATCAAGAAACTGCCATAAGGCGGGGAGATCGCGCGGTCCAAAGGCGGC
+GGGCAACTGCAGCCAGTATTGGCCAATACGCGTTTCCAGCGGCGCCAGGCGGGTAAAAAA
+CGCCTGTACCAGATCGTCGCAATGGCGCAGCGCGGCCTGGTGAGAAATGGTCGCGGGAAA
+TTTAAAGCAAAAACGGAAATCGTCCGTAGTTTGCGCATACCAGCGATCGACAATTTCCGC
+TTTCGGCAGCGCGTAAAGCGTGGTGTTGCCCTCCACGCAGTTAAAGTGGCGGGCATACTC
+TTCCAGACTGGTGATGCCGAGCCGCGCCCATTTCGGGTGCGACCATTGCGGCAAGCCAAT
+GTAGATCATAAGGCGTTTAAAATATCCTCTACGCTGCGTACCCGGCCAATGCGCGGGAAA
+ATATGCGTCATACTGCTCTGATGCTGCTCACTGCTGGCGGCGCTACAGGCATCTTCGGCA
+ATAATAAGGTTAAATCCCAACTCCCAGGCGTTACGCGCTGTGGATTCGACGCCGATATTG
+GTTGAGATCCCGCACAATATGATGGTGTCGATACCCCGGCGGCGAAGCTGTAATTCCAGA
+TCGGTGCCGTAAAACGCGCCCCACTGGCGTTTAGTCACTTCCAGATCGCTGTCCTTTTTA
+CCCAATGCCGTAGGCCAGGTCCACCAGTTTTCCGGCAACGCGTGCGCAGGCGTTGCGGCA
+TCCACGGGTTGTTTTAACGCTTCGGCATAATCATCAGACCATCCGACGCGTACCATAACC
+ACGGGCGAGCCGTTGGCACGACACTTTTCCGCCAGCCGCGCGGCGCGGGCGACCACCTCA
+TTTGCCGTATACGGGCCGCCGGCAAACGGAAGAATTCCTTCCTGTAAATCAATAACCACC
+AGGGCGGTTGTGGTCGCGTTGAGTTTCAGCATGATAATCACTCTCCTAAAAATAGCGTAT
+TTCACTACACCTTAAGCGCGATTAAAGAGGAAAGCGGTGACAAATATTGTTAATTTTTGT
+GAGCATACGCAATACCCGCGTGAAAAACCCGGGTACAGTCAGTATGAACCAAGTGTCGAT
+ACCGCATGAAACGGGCAAGTTATCGCTCCCATGCTGGATTGACTCTTATCGTGCGGCAGA
+ATTTCCAGTATAATAGCCGCCTTTTTTCATCCAGTTGTGACATACAGCTAAAGCTGCGAC
+TTCGTCGCCTGCATGGCAGGCAACAATCCGCCTGCGGCTAAGTTAAGGGATATCTCATGC
+GTACAGAATATTGCGGACAGCTACGTCTGTCCCACGTGGGGCAGCAGGTGACTCTGTGTG
+GTTGGGTCAACCGTCGTCGTGATCTTGGCAGCCTGATCTTTATCGATATGCGCGACCGCG
+AAGGTATTGTGCAGGTGTTCTTCGATCCGGATCGTGCGGACGCGTTAAAGCTGGCCTCTG
+AACTGCGTAATGAGTTCTGCATTCAAGTTACGGGCACCGTGCGTGCGCGTGACGCGAAAA
+ACGTCAATGCGGATATGGCGACCGGCGAAATTGAAGTGCTGGCGTCCTCTCTCACTATCA
+TCAACCGCGCAGACTCACTGCCGCTTGACGCTAACCACGTTAATACCGAAGAGGCGCGTC
+TCAAGTACCGCTATCTGGATTTGCGTCGTCCGGAAATGGCGCAGCGCCTGAAAACTCGCG
+CCAAAATTACCAGCCTGGTGCGTCGTTTTATGGACGATCACGGTTTCCTTGATATTGAAA
+CGCCGATGCTGACCAAAGCCACGCCGGAAGGCGCGCGCGACTATCTGGTGCCTTCGCGCG
+TGCACAAAGGTAAATTCTACGCGCTGCCGCAGTCGCCGCAGCTGTTCAAACAGCTCCTGA
+TGATGTCCGGTTTCGACCGTTACTATCAGATAGTCAAATGCTTCCGTGATGAAGACTTAC
+GTGCTGACCGTCAGCCGGAGTTTACTCAGATCGACGTCGAGACCTCCTTCATGACCGCGC
+CACAGGTGCGCGAAGTGATGGAAGCGCTGGTGCGCCATTTATGGCTGGAAGTGAAAGGCG
+TGGATCTGGGGGATTTCCCGGTCATGACGTTTGCCGAAGCGGAACGTCGTTACGGTTCCG
+ACAAACCAGACCTGCGTAACCCGATGGAACTGGTAGATGTCGCTGACCTGCTGAAATCGG
+TAGAGTTCGCGGTCTTCGCGGGCCCGGCTAACGATCCGAAAGGCCGCGTGGCAGCGCTGC
+GTGTGCCTGGCGGGGCGCAGCTTAGCCGTAAGCAGATCGACGATTACGGTAACTTTGTTA
+AGATCTACGGCGCGAAAGGCCTGGCGTATATCAAAGTTAACGAGCGCGCGAAAGGTCTGG
+ACGGGATTAACAGTCCGGTGGCCAAGTTCCTGACCGCCGACATCGTCGACGCTATCCTTG
+AACGTACCGGCGCGCAGGACGGCGACATGATCTTCTTCGGCGCAGATAACAAAAAAGTGG
+TTGCCGATGCGCTGGGCGCGCTGCGTCTGAAACTGGGCAAAGACCTGAGCCTGACCGACG
+AAGACAAATGGGCGCCGCTGTGGGTGATTGACTTCCCGATGTTTGAAGACGACGGCGAAG
+GCGGTCTGACCGCGATGCACCATCCGTTCACCGCCCCGCGTGACATGACGGCGTCTGAAC
+TGAAAACTGCGCCGGAAGAAGCCGTCGCTAACGCTTACGATATGGTGATTAACGGCTATG
+AAGTGGGCGGCGGTTCGGTGCGTATTCACAACGGTGAAATGCAGCAAACCGTATTTGGTA
+TTCTCGGTATCAATGAGCAGGAGCAGCGCGAGAAGTTCGGCTTCCTGTTGGATGCGTTGA
+AATACGGTACGCCGCCGCATGCGGGCCTGGCGTTTGGTCTGGACCGTCTGACCATGCTGT
+TGACCGGCACCGACAATATTCGTGATGTTATCGCCTTCCCGAAAACGACCGCCGCCGCGT
+GTCTGATGACCGAAGCGCCGAGTTTCGCCAACCAGGCAGCGTTGACGGAGTTGGGGATTC
+AGGTTGTGAAGAAAGCCGAGAATAACTGATATGAACAATGTACACGACATCATTCGCGTG
+ATATCGCGGCGGCCCGCAAGGGCGAGTCTCATCAATGCACGGCGTCACTCAACAGCCAAC
+AACGAGGTCGCGTGAAGGATAAAGTGTACAAGCGCCCCGTTTCGGTCCTGGTGGTTATTT
+TCGCGCAGGATACGAAACGGGTGCTAATGTTGCAGCGACGCGACGACCCGGATTTTTGGC
+AGTCAGTGACTGGCAGCATAGAAGAAGGGGAGACCGCGTTGCAGGCCGCCGTGCGTGAAG
+TCAAAGAGGAGGTCACGATTGATGTTGCGGCAGAGCAACTGACCTTAATCGACTGCCAAC
+GTACGGTGGAGTTTGAAATTTTTTCACATTTACGTCATCGCTATGCGCCGGGCGTTATGC
+ACAATACAGAATTCTGGTTCTGCCTTGCGTTACCGCATGAGCGGCAGGTGATATTCACTG
+AACATCTGACGTACCAGTGGCTTGATGCGCCTGACGCGGCGGCGCTTACCAAGTCCTGGA
+GTAACCGGCAAGCGATTGAAGAGTTTGTCATTAACGTCGCCTGAAAAGGCGCGCTTTTTT
+TGAGGAAATATTTATGGCAGGTCATAGTAAATGGGCCAACACCAGACATCGTAAAGCTGC
+GCAGGATGCCAAGCGCGGTAAAATCTTCACTAAAATTATTCGTGAACTGGTAACGGCAGC
+TAAATTGGGCGGCGGCGATCCGGATGCCAACCCGCGTCTGCGCGCGGCCGTAGATAAAGC
+GCTGGCCAACAACATGACCCGCGACACTCTGAACCGTGCCATCGCTCGCGGTGTGGGTGG
+TGATGAAGACTCGAACATGGAAACCATCATCTATGAAGGTTATGGTCCTGGCGGCACGGC
+CATTATGATTGAGTGTCTGAGTGACAACCGTAACCGTACCGTAGCGGAAGTGCGTCATGC
+TTTCAGCAAGTGCGGCGGTAATCTGGGTACCGATGGCTCAGTGGCGTACCTGTTCAGTAA
+GAAAGGGGTCATCTCCTTTGAGAAAGGCGATGAAGACACCATCATGGAAGCCGCTCTGGA
+AGCTGGCGCGGAAGATGTTGTGACCTATGATGATGGCGCGATTGATGTTTACACTGCCTG
+GGAAGAGATGGGCAAAGTGCGTGACGCGCTGGAAGCGGCGGGTCTGAAAGCGGACAGCGC
+CGAAGTGTCCATGATCCCGTCAACCAAAGCGGATATGGATGCGGAAACCGCGCCGAAACT
+GCTACGTCTGATCGATATGCTGGAAGACTGTGACGATGTCCAGGAAGTCTACCATAACGG
+TGAGATCTCTGATGAGGTGGCGGCGACCCTGTAATGGTGCTGTTAAACGCCGGCGGGCAG
+GGGGGATAGCGTGTCGATTATTCTCGGTATTGACCCCGGCTCGCGCATTACCGGTTATGG
+CGTTATCCGCCAGGTAGGCAGACAACTGACCTATCTGGGCAGCGGATGTATTCGCACCAA
+AGTCGATGATTTGCCGTCTCGTTTGAAGCTCATATACGCAGGCGTGACGGAAATCATCAC
+GCAGTTCCAGCCGGACTATTTTGCTATCGAACAGGTGTTTATGGCGAAGAACGCCGATTC
+AGCCCTCAAGCTGGGACAGGCGCGCGGCGTCGCGATTGTCGCCGCGGTCAATCAGGAACT
+GCCCGTGTTTGAATACGCGGCGCGTCAGGTGAAGCAAACCGTCGTCGGTATTGGTAGCGC
+GGAAAAAAGCCAGGTACAGCATATGGTGCGCACGTTGCTCAAACTGCCCGCTAACCCGCA
+GGCAGACGCCGCAGATGCGCTGGCTATCGCCATTACGCATTGCCATGTTAGCCAGAACGC
+GATGCAAATGAGCGAGAGCCGACTCAATCTGGCGCGGGGAAGGTTGCGCTAAATCATTCT
+CCCTCAGCCTCGCGTTGAGGGGTTTCAATTCCACAGGCGCTAATTAATTCTAAATTGGGA
+TGATGCCACAGGCTGGCGGGCGTCACCGTCTTACGATCCCACGGGATTGAACCTAAAAAC
+CAGAATTTCCAGAAGGTGAGTTTCGCATCAGGATTGCTGTGAAGTAATTCTTCGAATGTC
+TCAATATCGCCTACCGGAATACACAATGCTTCTTTATAGATATCAAACACAAATTTCGAG
+CAGAACTGGCGCGATGACTCGTATTTAAACCCCGTGTGATAAAACTTATTCAGCCGGGCG
+GGAACCTGCTCCATGATGGCGAGTTTCTGCTCGACCGTCAGGCCGCCGCGCAGACGGCGA
+ACGGCGTAACGTTGTCCGGCTGAACGTTGTATAAACAGTGACAGCGTGGTGACGGTTGAG
+AGGGGGACGCGACTTTCCGCCACCAGATAGTCATCACCATTATGACCAATAATAATCCCA
+ACATGGTTGCTCCAGCACTGTGAAGCGGTGGATATCTGGCCGAAAAGCGCGGCACCTATA
+CAGGTAAAGACGGTATCCCCGGTTTCATATTGGACAGAATAATGTTTTTTCATCTCTGCA
+TTCCATTATTTGAAATAAATTCCTTTTATTTATTCTACAGGGTAGTTAGCATTATACCAG
+ATAAATGACAAGCCTTAGTGTCATCGAAATATGTATGGTGAATATTTCATTTATTGGAAT
+TAATGTCGCAAATATATTTGGGGGGGATTAAGGTGGTAAATTTCTCATCATCTGATCTCT
+CATATTGACAGGGAGTATGACGTGGTTGATGATAAACCAATGAGAATAGGTTGGGTATTT
+TATTTTTCTTATATTTTTGTTGCTATTATCTTTCATCTGTTTATTAGTTTTTGTTATTGT
+TTGAGTATTGATATGGCAGAGGCTAATACTGTTGTTTTTTTATTAAAGCCAGGGACGATT
+TCATTATTATTTTTGCTTCTCCCTGCCAGGCGGTTCAGGACCAGACTGTTGGCAACATTG
+AGTTCAGTTTTCATTACCTTAGTATTTAACCAGTGGCATTTGGTTGCCGGGAATAAAGAA
+CTGGTTTTGTGCCTGCAGGCAGCGTGCTTTATGGCTTTCCTGGCTATGACATCGGTAAAA
+AAATCCGGGTGGATGATTAGCGCATCATTATTTTTGGTTTGTGCGGCCGGAACGATTCGC
+CAGTGCTGGCTGGAACAGCTGTTTAACGCTGCCGATATATATATTGTTGATGATGGGCGG
+AGCAGTGGCGCCAGCGGCCACTGCTTCCAGTATATTGCAGCAAAAGGCCGTGGGTTAGCA
+GCAAAACGACAGGCACTTTTTAGTAGCGAAGAGTATGTGAATATTTATTATAGTTATTCA
+GAAGGGATGCCAGCCGTGAATTTCGATGGCATGAAAAATGAGTTTGTACAATATTTATTG
+TGTCATGGCGAATTAAAATCTGTTGCGCGCGACGATAAAATAACATGCGATTAAATTCAG
+CGCTAGTGGTTAATATTATTAAATCTATTCTCGGGTCTGTTTTTTTGGAGGCCCGATGTT
+CCGCTGTTGGCATTCGTACTGGATACATTATTAGTGTTATCAGGATACTCATTATTGAAG
+ACTACCGAACGTGCGCCACGGCATGTTGGCAAAAAGTTGTTCGCGTAGGACGCAAAAAGT
+TGTCAATGAGTGTACGACTTATTTTGTACGCAGCGGGGAGCGTACCCGTCGTTAACCATC
+GCGGGTTGTCGGAGTAGAGAAATATCGGGATACGTGTTTTTCATCTGGATAAACATCCAG
+TCTTTTTTTATGATAGTGCATTATCTTTTCAGCCCTTTACGCAGGAGCGTCATGTGATAG
+GCAGACTCAGAGGCATTATTCTCGAAAAACAACCCCCGATCGTGCTGCTGGAGACAGGGG
+GAGTAGGCTATGAAGTACATATGCCTATGACCTGCTTTTACGAGCTGCCGGAGGCCGGGC
+AGGAGGCAATCGTCTTCACCCACTTCGTGGTGCGTGAAGATGCGCAGTTGCTGTACGGAT
+TTAACAATAAGCAAGAGCGCACGCTATTTAAAGAGCTAATTAAAACGAATGGCGTCGGGC
+CTAAGCTGGCGCTGGCGATCCTCTCCGGCATGTCGGCGCAACAGTTCGTCAATGCGGTTG
+AGCGCGAAGAGCTGGGTGCGCTGGTGAAGCTGCCGGGTATCGGCAAGAAAACCGCCGAAA
+GGCTGATTGTCGAAATGAAAGACCGCTTTAAAGGGCTACATGGCGATCTCTTTACGCCAG
+CGGTCGATCTGGTATTGACGTCGCCGGCCAGCCCAACCTCGGAAGATGCAGAACAAGAAG
+CAGTTGCTGCGCTGGTGGCGCTGGGTTATAAACCGCAAGAAGCCAGTCGGATGGTAAGCA
+AGATCGCCCGTCCGGATGCAAGCAGTGAAACACTGATTCGCGACGCGTTACGCGCCGCGT
+TATGAGGTAAAGGATGATAGAAGCAGATCGCCTGATTTCAGCAGGCGCCACGATCGCAGA
+AGACGTCGCCGATCGCGCCATTCGCCCGAAGTTATTGGCGGAATATGTCGGCCAACCGCA
+GGTGCGCTCCCAGATGGAGATCTTTATTCAGGCGGCAAAACGGCGTGGCGACGCATTAGA
+TCACTTGCTGATTTTCGGCCCGCCAGGGTTAGGTAAGACGACTCTGGCGAATATCGTTGC
+CAATGAAATGGGCGTCAATCTCCGAACCACGTCCGGCCCGGTGCTGGAAAAAGCAGGCGA
+TCTGGCGGCTATGCTCACCAATCTTGAACCGCATGATGTGCTGTTTATTGATGAGATTCA
+CCGGCTTTCACCGGTGGTGGAAGAGGTACTCTATCCGGCGATGGAAGATTACCAGTTGGA
+TATTATGATTGGCGAAGGGCCTGCCGCACGTTCAATTAAGATCGATCTGCCGCCGTTTAC
+GCTCATTGGCGCGACGACGCGCGCCGGGTCGTTAACGTCCCCGCTACGTGACCGTTTTGG
+TATTGTGCAGCGCCTGGAGTTTTACCAGGTGCCCGATCTGCAGCACATCGTCGGGCGCAG
+CGCAAGGCACATGGGGCTTGAGATGAGCGATGACGGCGCGCTGGAAGTGGCGCGTCGGGC
+GCGCGGTACGCCGCGTATAGCCAACCGTCTGCTCAGACGTGTGCGTGATTTCGCCGAGGT
+GAAGCATGACGGGGCTATTTCAGCGGAAATTGCCGCGCAGGCGCTGGATATGCTGAACGT
+CGATGCGGAAGGGTTTGATTATATGGATCGCAAGCTACTGCTGGCGGTTATTGATAAATT
+CTTCGGTGGTCCGGTGGGACTGGATAACCTGGCGGCGGCGATTGGCGAAGAGCGTGAAAC
+CATTGAGGATGTGCTGGAGCCGTATCTGATTCAGCAAGGCTTTTTGCAGCGCACGCCGCG
+TGGGCGTATGGCAACGGTGCGCGCCTGGAACCATTTCGGGATCACGCCGCCAGAGATGCC
+TTAGCGCCTGAAGTCGCTGCGCTCATCAGACCTGGGCGATTTTGTAGGCCCGGTAAGCGC
+AGCGCCACCGGGCAACACACGCTTAGCTTGCCTGCTTTTTCATCATACTGAAGATAAACA
+GCAGCGCGGCACACAGCACTACGGATGGCCCTGCCGGGGTATCATAAAAGGCTGAGAAGG
+TCAGTCCACCTGTAACCGCTATCATACCTACACCAACGGCGACGCCCGCCATCTGCTCCG
+GCGTACGGGCAAAGCGACGCGCGGTTGCGGCGGGGATAATCAGCAGCGACGTAATGATCA
+GCGCTCCGACAAACTTCATCGCCACGCCAATAGTTAACGCCGTTACCAGCATCAATAGCA
+GCTTCACGCGCTGTAACTTCACGCCATCGACAAAGGCAAGATCCGGACTGATAGTCATTG
+ACAGCAAGTTGCGCCACTGCCAGAAGAGAATGGCCAGCACAATAACGACCCCAATAGCGA
+TCGAGATAAGATCTTCCGGCGTGACGGCCAGCAAATCGCCAAACAGATAAGCCATTAAAT
+CAACGCGGACGTTGGACATCAGGCTGACCACGACCAGTCCTAAAGATAAGGCGCTGTGCG
+CCATAATGCCCAGTAAGGTATCAATCGCGAGGTGAGGGCGTTTCTCCAGCCATACCAGAC
+CGGCGGCCAGCAGCAGCGTAACGGCGATTACCGCATAAAAGGGGTTAACGTCCAGCAACA
+GGCCAAACGACACGCCCAGAAGCGACGCGTGAGCCAGCGTATCGCCAAAATAGGACATCC
+GACGCCAGACCACAAATGAGCCCAATGGACCAGCGGCGCAGGCCAGCATCATCCCGGCCA
+GCCAGCCGGGCAGTAATAATTCAATCATGAGTGACCATTTCCCCGGCGCAGTACAATACG
+GCCCTGTAAATCGTGGCGATGATTATGATGATGGCGATAAATCCCTAATTGCTCCGCGCC
+TCGCGGGCCAAACATAGAGATAAATTCCGGATGCATAGACACCACTTCCGGCGCGCCGGA
+ACAGCAAATATGATGGTTCAGGCATAACACTTCATCCGTCTTTGCCATGACCAGATGTAG
+ATCATGCGACACCATCAGCACGGCGCAATCGAGTTCACGGCGCAGCTGATCGATAAGGTC
+GTATAACGCGACCTGGCCGTTGACATCCACGCCTTGCGTCGGCTCATCAAGTACCAGCAA
+CTGAGGCCTGTTAAGCAGAGCACGCGCCAGCAGTACACGCTGTGTCTCACCGCCAGAGAG
+TTTTTGCATGGGCGCGTCAATCAAATGTCCGGCCTGAACGCGTTTAAGCGCCGGGAGAAT
+ATCCGTTTTTTGTGTGCCGGGACGTAAACGTAAAAATCGGTTTACCGTCAGCGGAAGCGT
+GGTATCGAGATAGAGCTTTTGCGGGACATAGCCGATACGGAGTTGCCCGTTGCGCTTGAT
+CACCCCTTCATCAGGGGCTACCAGTCCTAAAACCACGCGTACAAGCGTTGACTTCCCCGC
+GCCGTTAGGGCCGAGAAGCGTTAAAATTTTTCCGGGGCTCAATTCAAGCGACACGTCAGA
+GAGGACGCGGCGTTGACCAAATGAGACCGAGACGTTTTCCAGTGAAACTAAACTTGTCAT
+GTTAATTTTAGGCTTGCAGAAGTGATAGAATGTTATAATATCACATTTCACACATTCATT
+ACGATGATTAGTCGCATTATGTTACAGAAAAATACGCTTCTTTTCGCAGCATTATCCGCC
+GCGCTTTGGGGGAGTGCAACCCAGGCTGCCGACGCCGCCGTTGTCGCTTCGCTTAAACCG
+CTTGGGTTTATCGCTTCCGCCATTGCTGATGGCGTTACGGATACACAAGTATTACTTCCG
+GATGGGGCTTCCGAGCATGATTATTCATTGCGTCCATCAGACGTAAAACGCTTACAGGGC
+GCGGACTTAGTCGTCTGGGTTGGCCCGGAAATGGAAGCCTTTATGGAGAAGTCGGTCAGG
+AATATTCCTGATAATAAGCAGGTTACCATTGCGCAACTTGCCGATGTAAAACCGTTACTC
+ATGAAGGGCGCGGATGATGATGAGGATGAACATGCGCATACGGGCGCCGATGAGGAAAAA
+GGTGACGTACATCACCATCACGGCGAATATAACATGCATCTTTGGCTCTCCCCAGAGATA
+GCGCGGGCTACAGCGGTTGCAATCCATGAAAAATTAGTGGAACTTATGCCGCAAAGTCGA
+GCCAAACTCGACGCCAACCTGAAGGATTTTGAGGCACAATTAGCCGCAACCGATAAACAG
+GTCGGTAACGAGCTCGCGCCGCTCAAGGGGAAAGGGTATTTCGTTTTTCATGACGCCTAC
+GGTTACTACGAAAAACACTACGGACTCACCCCGCTCGGTCACTTTACCGTGAACCCTGAG
+ATACAACCTGGCGCGCAGCGTTTACATGAAATAAGAACACAGTTGGTTGAGCAAAAAGCA
+ACCTGCGTTTTTGCTGAGCCACAATTCAGGCCAGCGGTCGTGGAAGCCGTGGCGAGAGGG
+ACATCCGTTCGAATGGGAACACTGGACCCCCTCGGGACGAACATTAAACTGGGTAAAACA
+AGCTATTCAGCGTTTTTAAGCCAATTAGCCAACCAGTATGCGAGCTGCCTGAAAGGAGAT
+TAACGAGGAAGTGAATACGTGCAACAGATAGCCCGCTCTGTCGCCCTGGCATTTAATAAT
+CTGCCCCGACCCCACCGCGTTATGCTGGGGTCACTTACCGTTCTGACACTGGCCGTCGCC
+GTATGGCGGCCCTATGTTTACCACCCAGAATCCGCACCAATCGTTAAAACTATTGAACTG
+GAGAAAAGCGAGATTCGTTCCCTCTTACCGGAGGCCAGCGAACCCATCGATCAGGCCGCG
+CAGGAAGATGAAGCTATTCCTCAGGATGAGCTGGACGATAAAACCGCAGGCGAAGTCGGC
+GTCCATGAATACGTCGTCTCCACAGGCGATACGTTAAGCAGCATTCTGAATCAGTACGGC
+ATCGATATGAGCGATATTAGCCGACTTGCCGCTTCTGATAAGGAGCTGCGCAATCTGAAA
+ATTGGCCAACAGCTTTCCTGGACACTGACTGCCGATGGCGATTTACAGCGTCTGACATGG
+GAAGTCTCCCGCCGTGAAACGCGTACCTACGATCGCACTGCCAACGGTTTTAAAATGAGC
+AGTGAAATGCAGCAGGGGGACTGGGTTAACAGTCTGCTGAAAGGCACGGTAGGGGGGAGC
+TTTGTCGCCAGCGCGAAAGAGGCAGGTTTAACCAGCAGCGAAATCAGCGCAGTGATAAAA
+GCCATGCAGTGGCAGATGGATTTTCGCAAGCTGAAAAAGGGCGATGAATTTTCGGTTCTG
+ATGTCGCGCGAGATGCTGGATGGCAAGCGTGAACAGAGTCAGTTGTTGGGCGTGCGGATG
+CGTTCCGATGGTAAAGATTACTACGCCATTCGCGCCGCTGACGGTAAATTCTATGACCGT
+AACGGTGTTGGCCTGGCGAAAGGCTTTTTACGCTTCCCGACCGCCAAACAGTTCCGCATC
+TCCTCCAATTTCAATCCGCGCCGTCTGAACCCGGTTACTGGACGCGTTGCGCCGCATCGT
+GGCGTTGACTTTGCGATGCCGCAGGGTACGCCGGTGCTGTCGGTGGGGGATGGCGAGGTC
+GTGGTCGCTAAACGTAGCGGCGCTGCCGGTTACTACATTGCGATTCGTCATGGACGCACC
+TACACCACACGTTATATGCACTTGCGTAAGCTGCTGGTGAAACCGGGGCAAAAAGTGAAA
+CGTGGCGATCGTATTGCGCTTTCTGGTAACACCGGGCGCTCCACAGGGCCGCATCTGCAT
+TATGAGGTATGGATCAACCAGCAAGCCGTTAACCCTCTAACAGCAAAATTGCCGCGCACG
+GAAGGTCTGACGGGGTCAGATCGTCGTGAATACCTGGCACAGGTGAAAGAGGTTCTGCCA
+CAACTGCGCTTCGATTAACAAATGCGCTGACAGAGCCGGTACGCGATGTGTGCCGGCTTT
+TTTGTTTTGTGTGCGGCGCAGACGTCGCTACACTATTCACAATTCCTTTTCGCGTCAGCA
+GACCCTGGAAAAGCATGGAAACCAAAAAAAATAATAGTGAGTATATCCCTGAATTCGAAA
+AATCCTTTCGCTATCCGCAGTATTGGGGCGCCTGGTTGGGCGCGGCGGCAATGGCGGGGA
+TTGCATTAACACCGGCATCATTCCGTGACCCTTTGCTGGCGACGCTGGGGCGCTTTGCCG
+GACGGCTGGGGAAGAGTTCTCGTCGCCGGGCGCTAATTAATCTGTCTTTGTGCTTTCCGC
+AGCGTAGCGAAGCTGAGCGCGAAGCGATTGTCGATGAGATGTTCGCCACCGCGCCACAGG
+CAATGGCGATGATGGCTGAGTTGGCGATGCGCGGTCCGAAAAAAATTCAACAGCGTGTTG
+ACTGGGAAGGTCTGGAAATCATTGAGGAGATGCGTCGTAACGACGAAAAAGTCATTTTTC
+TCGTACCGCATGGCTGGGGCGTCGACATTCCAGCTATGCTGATGGCCTCTCAGGGGCAAA
+AAATGGCGGCGATGTTTCATAATCAGGGTAATCCGGTTTTTGACTATATCTGGAACACCG
+TGCGTCGGCGTTTTGGCGGACGTTTGCATGCGCGCAATGACGGGATTAAACCCTTTATTC
+AGTCTGTTCGTCAGGGCTACTGGGGTTACTACCTGCCGGACCAGGATCATGGCCCGGAGC
+ATAGTGAATTCGTTGATTTCTTTGCGACATACAAAGCGACGCTGCCCGCGATTGGTCGGC
+TGATGAAAGTGTGCCGCGCACGCGTGATACCGCTTTTCCCGGTGTATAATGGTAAAACGC
+ATCGCCTGACTATCCAGATTCGCCCGCCAATGGACGATCTGCTCACGGCTGACGACCACA
+CTATCGCCAGACGGATGAACGAAGAGGTCGAAATTTTTGTCGGCCCGCATCCGGAACAGT
+ACACCTGGATCCTGAAGCTGCTCAAAACCCGCAAGCCAGGCGAGATTCAGCCGTATAAGC
+GTAAAGATCTTTATCCCATCAAATAAATAAAGCCTCTCGTAAGAGAGGCTTTATGCTGAC
+AAACCCTGTACTACCTGATGAACAGGCGTGGGGGAGTTTTACTCCACGGTCAAGATACGC
+GTGGTATTGGTTGAACCGACGGTGCTCATGACATCGCCCTGGGTCACGATAACCAGGTCG
+CCGGAAACCAGATACCCTTTATCGCGCAGCAGATTAACAGCTTCATGTGCCGCGACAACG
+CCATCAGCCGCGCTGTCAAAATGCACCGGCGTTACTCCGCGGTAGAGCGCGGTCAGGTTC
+AGCGTGCGTTCATGGCGCGACATGGCGAAAATCGGCAGGCCGGAGCTGATACGGGAAGTC
+ATTAGCGCGGTACGACCGGATTCCGTCATGGTGATGATCGCGGTAACGCCTTTCAGATGG
+TTTGCCGCATACATCGCAGACATGGCAATAGCTTCTTCAACGTTGTCGAACTGCACGTCG
+AGACGGTGTTTAGACACATTGATGCTGGGGATTTTTTCTGCGCCCAGGCAGACGCGCGCC
+ATTGCGGCAACGGTTTCAGAAGGATACTGACCGGCTGCGGTTTCGGCAGACAGCATAACT
+GCATCCGTGCCATCCAGGACGGCGTTCGCCACGTCCATCACTTCCGCGCGGGTCGGCATC
+GGGTTGGTGATCATCGACTCCATCATCTGCGTTGCGGTGATGACTGCACGGTTTAGCTGA
+CGCGCACGGCGAATCAGCGCCTTCTGGATACCAACCAGCTCCGGATCGCCGATTTCAACG
+CCCAGGTCGCCACGTGCGACCATCACAACGTCAGAGGCCAGAATGATATCGTCCATGGCG
+TTTTGGTCGCATACCGCTTCGGCGCGTTCGACTTTAGCCACAATTTTCGCGTCGCAGCCG
+GCGTCGCGTGCCAGGCGGCGTGCGTAGTTCAGATCTTCGCCGCAGCGCGGGAAGGAGACG
+GCCAGATAGTCAACGCCTATCAGCGCAGCGGTTTGAATATCGGCTTTGTCTTTTTCGGTC
+AGCGCTTCAGCAGAAAGCCCGCCGCCGAGCTTGTTAATGCCTTTATTGTTAGACAGCGGG
+CCGCCGACGGTGACCTCGGTAAAGACTTTCATGCCCTGGACTTCAAGCACTTTCAACTGC
+ACTCGACCATCGTCAAGCAGCAGGATATCGCCAGGAACGACGTCTGCCGGCAACCCTTTG
+TAATCAATGCCGACTTTTTCTTTGTCGCCTTCGCCTTTACCCAGGTTAGCGTCTAACAGA
+AATTTGTCCCCGATGTTGAGGAACACTTTGCCTTCTTTAAAAGTGGAAACGCGAATTTTT
+GGCCCTTGCAGGTCGCCTAAAATAGCCACATGACGCCCCAGTTTGGCGGCAATCTCACGG
+ACTTTATCAGCACGCATTTTATGATCTTCCGGCGAGCCGTGAGAGAAGTTCATACGTACT
+ACGTTTGCGCCCGCGGCGATAACCTTCTCAAGGTTGTTATCGCGGTCAGTTGCCGGGCCT
+AACGTGGTAACGATTTTGGTTCTGCGAAGCCTTCTGGACATGTAATACTCCGTTGACTAA
+AACAACTTGGTGTTGCGTGAACATTGATCCGGTCGTTCTGAAACCTTAACGGTATAAAAT
+GAACGTCCCCGGATGACGAAAAGGGTAGAACATTGTTATTGCTTTTAGCGGTCATCACTC
+TTGATGAGTAATTCTTTATCAAAACGCGATTCCTTGAGCGCTTCCTTGACACGCTTCAAG
+TTATCTCTGAATTTTGCCCCGCGACGCAAAGTAAATCCCGTTGCCAGCACATCTATCACG
+GTCAGCTGAGCAAGTCGAGAGACCATGGGCATATAAATGTCTGTATCTTCCGGTACGTCG
+AGGGTAATGGCCAGCGTGGCTTCGCGCGCCAGCGGCGTTCCAGCGGAGGTCAGGGCGATC
+ACCATCGCATCGTTTTCCCGCGCCAACTGCGCCAGTTCCACCAGGCTCTTGGTTCTGCCA
+GTATGCGAAATGAGCACGACGACGTCATCATCGCTACAATTCATACAGCTCATCCGTTGC
+AGCACGATATCGTCGGAGTAAATCACCGGCACATTGAAGCGAAAAAACTTATTCATGGCG
+TCATGCGCGACCGCGGCGGAGGAACCAAGACCAAAAAAGGCGATTTTTTTTGCCTGGGTC
+AGTAAATCGACCGCGCGGTTGACGGCCGATTTATCCAGCGACTGGCGAACATGGTCGAGA
+CTGGCCATAGCGGACTCGAAGATTTTTCCTGTATAGGCCTCGACGCTGTCATCTTCATCC
+ACATTGCGATTAACATAGGGGGTGCCATTTGCCAGACTTTGCGCCAGATGCAGTTTAAAA
+TCAGGAAAGCCGCGGGTATTCATGCTGCGACAGAAACGGTTCACCGTTGGCTCGCTAACG
+TTAGCTTCCTGGGCCAGCATGGCAATGCTTAAGTGAATCGATCTGCCTGGGGCGGCCAGA
+ATAACATCGGCGACTTTTCGTTCAGATTTGCTTAAATGTTCCAGTTGAGACTGGACTTTT
+TCCAGCATATTCATGATTAGCAAGGCTCATGGGTATTAGCGATTTCAATGATGCGCGAAA
+CCGAGCGCGTTTTGTTAGATATTACTCCTGGCGGCTGTCAAAGGGGGCAAAATGGCTAAA
+AAAGGTGTCGTTTTTTTTCATTACATGACCGACGTCGGATTTTAAGTTCCAGCTTGTGTG
+GAAAAGCGACAATTTTATTAGGCGTTTTGCCGATTATATTGCCAATCAAACGCCGGTTCA
+CCCATGAAAAGGCGTTTACGGTTTCCGTAATCTCGTAAAAGCAGTACAGTGCTGTGTAAT
+AAAATTACAACGATATCCTGGCTAAAGTACCAGGAGATTAACTGAGGAGAATGACATGGC
+GGTAACGCAAACAGCCCAGGCATGTGACCTGGTCATTTTCGGCGCGAAAGGCGACCTGGC
+GCGCCGGAAACTGCTGCCTTCCCTGTATCAGCTTGAGAAAGCCGGCCAGATCCATCCGGA
+TACCCGTATCATTGGGGTGGGGCGCGCGGACTGGGATAAAGAAGCTTATACCCACGTCGT
+GCGTGAGGCGCTGGAAACCTTCATGAAGGAAAAAATTGATGAAGGCTTGTGGGATACGCT
+GAGCGGCCGTCTGGATTTTTGTAATCTTGACGTTAACGATACGCCTGCGTTTAGTCGCCT
+GGGCGATATGCTGGATCAAAAAAACCGCACCACCATTAACTATTTTGCGATGCCGCCCAG
+CACCTTTGGCGCTATTTGCAAAGGGTTAGGAGAGGCTAAACTCAACGCCAAACCGGCGCG
+CGTCGTGATGGAAAAACCGTTGGGTACTTCGCTGGCGACCTCGCGTGAGATTAACGATCG
+GGTCGGCGAATACTTTGAAGAGTGCCAGGTGTATCGTATCGACCACTATCTGGGCAAAGA
+AACGGTTCTCAACCTGCTGGCGCTGCGTTTTGCCAACTCGTTATTCGTTAATAACTGGGA
+TAACCGCACTATCGATCACGTTGAGATTACCGTAGCGGAAGAGGTGGGGATTGAAGGGCG
+CTGGGGATATTTTGACCAGGCCGGTCAGATGCGCGATATGATCCAGAACCACTTGCTGCA
+AATTCTCTGCATGATTGCCATGTCACCGCCGTCTGACCTGAGCGCCGACAGTATTCGCGA
+TGAAAAAGTCAAAGTGTTGAAATCGTTGCGCCGTATTGATCGCTCCAACGTGCGTGAAAA
+AACGGTTCGTGGTCAATACACCGCGGGCTTTGCGCAGGGTCAAAAGGTGCCGGGCTATCT
+GGAAGAAGAGGGCGCGAATAAAAGCAGCAACACCGAAACTTTCGTCGCGATCCGCGTCGA
+CATCGATAACTGGCGTTGGGCGGGCGTGCCATTCTATCTGCGCACCGGCAAGCGTCTGCC
+AACCAAGTGCTCTGAAGTCGTGGTTTATTTCAAGACGCCTGAACTGAATCTCTTTAAAGA
+GTCCTGGCAAGACCTGCCGCAGAACAAATTGACGATTCGCCTGCAGCCGGATGAAGGCGT
+AGATATTCAGGTGCTTAACAAAGTACCGGGGCTGGATCATAAGCATAATCTGCAGATCAC
+GAAGCTTGATCTGAGCTACTCCGAGACCTTTAATCAGACGCACCTGGCGGATGCATATGA
+GCGCCTGCTGCTGGAAACGATGCGTGGCATTCAGGCGCTGTTTGTCCGCCGTGACGAAGT
+GGAAGAAGCCTGGAAGTGGGTGGACTCCATTACCGAAGCATGGGCGATGGACAACGACGC
+GCCGAAGCCGTATCAGGCGGGCACCTGGGGACCGGTAGCGTCCGTGGCGATGATTACCCG
+TGACGGTCGTTCGTGGAATGAGTTTGAGTAAATTTGCCACTCACTCTTAGGTGGTATTTT
+ACCGGTAACATGATCTAACACAGATTGTAGAATCATTTTTGCACTTTTAAGCCTCGTGTG
+GATTCACCTGCGAGGCTTTTTTTATTACACTGCCTGAAACGATTTTGCCCCATTATCCCC
+GGACATCATGTATTTCACTGTCTTTCCACATTGATGAAACGCATGGTAAACCCGGTAGCC
+GGACAGATAAATTTCAGGAGCCTCTATGAATCCTAATTTGTTACGCGTAACACAGCGTAT
+TGTCGAACGCTCGCAGCAGACCCGAGAAGCCTATCTTGCCCGCATTGAGCAGGCGAAAAC
+CGCCACGGTCCACCGATCTCAACTGGCCTGCGGCAACCTGGCGCATGGCTTCGCCGCCTG
+TCAGCCAGAGGACAAAGCCTCGCTGAAAAGTATGTTGCGCAATAATATCGCCATTATTAC
+CTCCTACAATGACATGCTCTCTGCGCATCAACCGTATGAACATTATCCGCAGATTATTCG
+TCAGGCCCTGCATTCCGTGAATGCGGTAGGTCAGGTCGCAGGCGGCGTACCGGCAATGTG
+CGATGGCGTTACGCAAGGGCAGGATGGCATGGAGTTGTCATTACTCAGCCGCGAAGTGAT
+AGCGATGTCGGCAGCAGTAGGCCTCTCTCACAATATGTTTGACGGCGCGTTATTCCTCGG
+CGTATGCGACAAAATCGTTCCGGGGCTGGCGATGGCCGCGCTCTCTTTTGGTCATTTACC
+CGCGATTTTTGTTCCGTCAGGCCCGATGGCGAGCGGCCTGCCGAATAAAGAAAAAGTCCG
+TATTCGTCAGCTATATGCGGAAGGAAAAGTAGACAGAATGGCGCTGCTGGAGTCGGAAGC
+CGCCTCTTACCATGCGCCGGGCACCTGTACATTTTACGGCACCGCCAACACCAACCAGAT
+GGTGGTGGAGTTTATGGGAATGCAGTTGCCGGGTTCTTCGTTTGTGCATCCGGATGCGCC
+GCTGCGCGAGGCATTGACTGCCGCTGCCGCACGTCAGGTAACACGTCTTACCGGCAACGG
+CAATACGTGGATGCCGCTCGGTAAAATGATCGACGAAAAAGTCGTGGTGAACGGCATTGT
+CGCGCTGCTGGCTACCGGCGGCTCCACCAACCACACCATGCATCTGGTTGCAATGGCGCG
+CGCGGCGGGCATTCTGATCAACTGGGATGACTTCTCGGATTTGTCGGAAGTGGTTCCGTT
+GATGGCGCGTCTGTACCCGAACGGTCCGGCGGACATTAACCACTTCCAGGCGGCGGGCGG
+CGTACCGGTATTGATGCGTGAGCTGCTCAATGCCGGATTGCTGCACGAAGACGTTAACAC
+TGTCGCAGGCTTCGGCCTGAAACGCTATACGCTGGAGCCCTGGCTCAACAACGGCGAGCT
+GGACTGGCGTGAAGGCGCGGAAAGGTCACTGGATAACGATGTCATTGCCTCTTTTGATAA
+GCCGTTCTCTCCTCACGGCGGCACTAAGGTGCTAAGCGGTAATCTGGGGCGCGCAGTAAT
+GAAGACGTCTGCGGTACCGGTTGAAAACCAGATCATTGAAGCGCCTGCCATGGTATTTGA
+AAGTCAGCATGATGTGCTGCCTGCGTTTGACGCGGGTCTGCTTGATCGGGATTGTGTCGT
+TGTCGTGCGTCATCAGGGACCAAAAGCGAATGGAATGCCAGAATTACATAAACTCATGCC
+GCCACTTGGTGTATTATTGGACCGCCGTTTCAAAATCGCGTTAGTTACTGATGGACGACT
+TTCAGGCGCTTCGGGTAAAGTGCCTTCAGCTATCCACGTAACGCCGGAAGCCTACGATGG
+CGGCTTACTGGCAAAAGTGCGCGATGGCGACATCATTCGCGTGAATGGGCAGACAGGTGA
+GTTAACTCTGCTGGTCGACGAGGCGGAACTTGCCGCTCGTCAGCCTCATATTCCGGACCT
+GAGCGCGTCGCGCGTCGGAACGGGGCGTGAGTTGTTTGGCGCGCTGCGCGAAAAGCTGTC
+GGGTGCGGAGCAGGGCGCAACCTGTATCACTTTTTAAGATGACACACTAGTAATCAGGCG
+AGAGAAGAATTCCGATGAAAAACTGGAAAACAAGTGCAGAAGCAATCCTGACCACCGGCC
+CGGTTGTCCCGGTCATTGTAGTCAATAAACTGGAGCACGCGGTGCCGATGGCTAAAGCGC
+TGGTGGCCGGGGGCGTTCGCGTTCTGGAAGTGACTTTACGTACGGCCTGCGCGATGGATG
+CTATTCGCGCTATCGCTAAAGACGTGCCGGAAGCGATTGTCGGCGCCGGAACCGTTCTCA
+ATCCGCAGCAGTTGGCGGAGGTGACGGAAGCGGGCGCGCAGTTTGCGATTAGCCCGGGAC
+TGACTGAGCCACTGCTGAAAGCCGCGACGGCAGGCACTATCCCATTGATTCCCGGTATTA
+GCACCGTTTCTGAACTGATGTTGGGCATGGACTATGGTCTGAAAGAGTTCAAATTCTTCC
+CGGCGGAAGCGAATGGCGGCACTAAAGCGTTGCAGGCGATTGCCGGTCCGTTCTCTCAGG
+TACGTTTCTGCCCAACCGGCGGCATCTCTCCGGCAAACTATCGTGACTATCTGGCGCTGA
+AAAGCGTGTTGTGCATCGGCGGTTCCTGGCTGGTGCCGGCCGACGCGCTGGAAGCGGGTG
+ATTACGATCGCATCACCAAACTGGCGCGCGAAGCGGTAGAAGGCGCGAAACAGTAAGCCG
+TTAAATGCCCGATGGCGCTTGCTTATCGGGCTTACGAGTGGCGATCAGGCAGGTCTGATA
+AAAATGCGCTAACGTCGCCATCAGGCGATGGCGCATTAGCCTTTTACCGTCACGCGGCTG
+GCGGCCTTTTTCGCTCTTATCACCGCTTCTTCAACGTTTTCACCTGTCGCTAACGCTACA
+CCAAGACGACGGCTGCCGTCGATCTCAGGCTTACCAAACAGCCGTACCTGCACTCCGGCC
+CCTACCGCCGTGTGTACATTATCAAACGTCACATTTTGACTGGTAAGCTGCGGCAGAATC
+ACGGCCGAGGCAGCGGGACCATACTGGCGAATAGCGCCTATGGGCATTCCCAGAAAGGCG
+CGCACATGCAGCGCAAACTCAGAAAGATCCTGAGAAATCAACGTCACCATTCCGGTATCG
+TGCGGGCGAGGGGAGACTTCGCTGAAAATGACTTCATCGCCACAGACGAAGAGTTCAACG
+CCGAACAGGCCATGCCCGCCTAACGCCAGTACCACATGACGCGCAATCTCTTGCGCCCGC
+TTCAGCGCCAGTTCGCTCATCTGCTGTGGCTGCCAGGATTCGCGATAGTCGCCATCTTGC
+TGACGATGACCGACTGGCGCGCAGAAATGCACGCCATCGACGGCGCTAACGGTGAGCAGC
+GTAATTTCAAAATCAAATTTAACCACGCCTTCCACAATCACGCGACCCGCGCCAGCGCGT
+CCGCCCTGTTGAGCATACTCCCATGCCTGCGCGAGCTGTTCGGCCGAGCGGATAAAGCTC
+TGGCCTTTGCCGGAAGAGCTCATGACCGGTTTGACGATGCAAGGAAAACCCACTGCGGCT
+ACCGCATCATGAAAACTGGCCTCACTGTCGGCAAAGCGATACGTCGATGTCGGCAGACCT
+AATTCTTCTGCGGCCAGGCGACGGATCCCTTCGCGGTTCATCGTGAGCTGCGTTGCACGG
+GCGCAAGGCACGACATTCAGCCCTTCGTCCTCCAGCTCACGCAGCGTATCGGTGGCGATC
+GCTTCTATTTCCGGCACGATATAATGCGGTTTTTCCTCTGTAATCACATGACGTAGCGCC
+TCGCCGTCCAGCATATTAATGACGTGTGAACGGTGAGCCACATGCATGGCGGGAGCATCA
+GGATAGCGATCGACGGCGATAACCTCGATCCCCAGGCGTTGGCATTCAATCGCCACTTCT
+TTTCCCAATTCACCTGCCCCTAATAACATCACCCGCGTTGCTGCCGGACGCAGCGCAGTG
+CCTAATAGCGTCATATTTCTGTCCCCTTATTTACCTGCGCGCAGTATATACGAAAACGTT
+TGCGTATGTCTTTTCGAATAGATTGCTTTTCTTGCTGTCTTGCAATATACTGTATATAAA
+CACAGGTAAATAAGGGGCTGCAAAATGGCGGTTGAAGTTAAATACGTAGTCATTCGCGAG
+GGTGAGGAGAAGATGTCATTTACCAGTAAAAAGGAAGCCGACGCCTGGGACAAAATGCTC
+GATACTGCCGATCTTCTTGATACCTGGCTTGAGCAGTCGCCAGTCGTGCTGGAAGATGGG
+CAGCGCGAAGCGTTGTCGCTGTGGCTGGCGGAACATAAAGAGGTGTTAAGCACTATCCTC
+AAAACCGGTAAGTTGCCTTCTCCGCAGGCGGTTGAAAAGGACGCCGCGAGTAAAACGAAA
+AAGCAAGCCGCCTGAACCCGTACTTGCGCTCCCGGCGTTTTGTACCATGCTTTTCCTGAA
+TCATTGTGCTAAGGAGAAAAGTATGAATAAAAGAGGAGCGTTGTTGAGCCTGCTGCTGTT
+ATCCGCCAGCGTATCGGCATTTGCGGCATCCACCGAGAGTAAATCGGTTAAGTTTCCGCA
+GTGTGAAGGGCTGGATGCCGCCGGGATTGCGGCAAGCGTGAAGCGCGACTACCAGCAAAA
+TCGTATCGTGCGGTGGGCCGACGACCAAAAAAAGGTCGGGCAGGCTGACCCGGTCGCGTG
+GGTTAATGTGCAGGACGTTGTAGGTCAAAATGATAAATGGACAGTTCCGCTAACTGTTCG
+CGGTAAAAGTGCCGATATTCATTATCAGGTCATCGTTGATTGCAAAGCCGGCAAGGCGGA
+ATATAAGCCCCGCTAGCAGCGTAATTTGCGCTTCTTTTGCCGGAACAGACAATTCCTGAC
+ATCCCCTCAGGTACGCTTGACCATTATTGGTCTGTATTTGAGGGGTACTATGGCTAACTG
+GTTGAACCAATTACAATCACTTCTTGGGCAAAAAGGCGCTTCCGCATCGTCTTCCGGTGA
+ACAGGGGTTAAATAAACTGCTGGTTCCCGGCGCGCTGGGCGGTCTGGCTGGACTGTTGGT
+CGCCAATAAGTCTTCGCGCAAATTATTAACTAAATACGGTACTGGCGCTTTGCTGGTGGG
+CGGCGGCGCGGTGGCGGGTTCCGTATTGTGGAATAAGTACAAAGATAAAGTACGCGCTGC
+GCATCAGGGGGAGCCGCAATTCGGCAGCCAAAGTACGCCGCTGGATGTTCGCACTGAGCG
+ACTGATCCTGGCGCTGGTTTTTGCTGCAAAAAGCGATGGGCATATTGATGCCAAAGAACG
+CGCGGCGATTGAGCACCAACTGCGAGAATCAGGTGTGGAAGAGCAAGGGCGTGTGTTTAT
+CGAGAAAGCTATTGAGCAGCCGCTTGATCCACAACGTCTGGCACAGGGCGTTCGTAATGA
+AGAAGAAGCCCTGGAAATCTACTTCCTGAGCTGCGCCGCCATTGATATTGACCACTTTAT
+GGAACGTAGCTATCTGAATGCGTTAGGAGACGCACTAAAAATTCCTCAGGAGGTTCGGGA
+CGGTATCGAGCAGGACTTGCAGCAGCAAAAACAGGCGCTACCAGGCTGATAACCTGCCAT
+TAAGTAACATGTTTCGCTTGCATCATGCGTGTCTTTTGCCACCCTTATAGGATGGATAGT
+TTACGTCATTCATGTTGCAAGATAGCGGCGAAGCAGTGACATCTCAGGCGCTTACCGAGG
+TGAGCGACCGGGACTACCATGCTACGCCGCTGTGTTTGCCGCGTGATATATAACAAATAT
+TAACGCAAAAGAAAAAACGACATGTTGCCAAAAGCCAATCGAATTCCCTATGCCATGACC
+GTACATGGCGATACGCGCATTGATAATTATTACTGGCTGCGAGATGACACTCGCTCGCAG
+CCGGAAGTCCTTGATTACCTGCATCAGGAAAATGAGTATGGCCGGAAGGTCATGTCCTCT
+CAGCAGGCGTTACAGGACCGCATTCTAAAAGAAATTATCGATCGCATCCCGCCCAGAGAA
+GTTTCCGCTCCGTATGTGAAAAATGGCTATCGCTACCGTTATATCTATGAACCCGGCTGC
+GAATATGCCATCTATCAACGACAATCGGCGTTAAGCGAAGAGTGGGATGTGTGGGAAACC
+TTGCTCGATGCGAACCAGCGGGCCGCGCACAGCGAATTTTATACGCTCGGCGGGCTTGCC
+ATTACGCCGGATAATACCATCATGGCGCTGGCAGAAGATTATTTATCCCGTCGTCAGTAT
+GGGTTGCGTTTTCGTAACCTCGAAAGCGGTAACTGGTATCCGGAACTGCTGGATAACGTT
+GCGCCTGAGTTTGTCTGGGCCAATGATTCCCTGACCCTTTACTATGTGCGTAAGCATAAG
+AAGACGCTGCTGCCCTATCAGGTTTGGCGGCACACGATTGGCACTCCGTCATCGCAAGAT
+GAACTGGTATATGAAGAAAAAGACGATACCTTTTATGTCAGCCTGCATAAAACCACTTCG
+CAGCATTATGTGGTGATTCATCTTGCCAGCGCCACCACTAGCGAAGTGCTATTACTTGAC
+GCGGAACTGGCCGATGCCGAGCCGTTTTCATTCTTACCGCGTCGCAAAGACCATGAATAT
+AGTCTCGATCACTATCAACATAAGTTTTACCTGCGTTCTAACCGGAACGGTAAAAACTTT
+GGGTTGTACCGTACCCGCGTGCGCAATGAAAACGCCTGGGAAGAGCTGATCCCTCCGCGC
+GAGCATATTATGCTGGAAGGGTTTACCCTGTTTACCGACTGGTTAGTGGTCGAAGAGCGT
+CAACGGGGGCTTACCAGCCTGCGGCAAATTAACCGTAAAACCCGTGAAGTGATAGGCATC
+GCCTTTGACGATCCGGCTTACGTGACGTGGCTTGCCTATAATCCCGAACCTGAGACCTCC
+CGGCTGCGTTACGGCTATTCTTCAATGACGACGCCAGATACCTTGTTTGAACTGGATATG
+GATACCGGAGAACGACGGGTACTTAAACAGACGGAAGTGCCTGGGTTTGATTCTGGCTGT
+TATCAGAGCGAACACCTGTGGATCACCGCGCGCGACGGCGTCGAAGTGCCGGTATCGCTG
+GTTTATCATCAGAAGTATTTTCGTAAAGGGCAAAATCCGCTTCTGGTTTACGGCTACGGA
+TCTTACGGTTCCAGTATTGACGCCGACTTCAGCAGCAGCCGACTGAGCTTGCTGGATCGT
+GGCTTTGTTTACGCAATCGTACACGTTCGCGGCGGCGGTGAGCTGGGGCAGCAGTGGTAT
+GAAGATGGCAAATTCCTCAAAAAGCGGAATACTTTTAATGACTATCTTGATGCCTGCGAT
+GCCTTATTAAAACTGGGTTACGGTTCGCCGTCGCTGTGTTACGGGATGGGCGGGAGCGCG
+GGCGGAATGCTAATGGGCGTCGCTATCAACGAACGCCCCGAGCTTTTCCACGGCGTTATT
+GCCCAGGTACCCTTTGTTGATGTATTAACCACGATGCTGGATGAGTCGATCCCACTAACG
+ACAGGAGAGTTTGAAGAGTGGGGGAACCCGCAGGATATTGAGTATTATGACTATATGAAA
+AGCTATAGTCCTTATGACAATGTCAAAGCGCAGGACTATCCGCACCTGCTGGTGACGACA
+GGATTGCACGATTCCCAGGTGCAATACTGGGAACCGGCGAAGTGGGTGGCAAAATTACGC
+GAGCTAAAAACGGACCAACGTCTGCTGCTGCTATGTACGGATATGGACTCCGGGCACGGT
+GGTAAGTCGGGGCGGTTTAAATCCTACGAAGGCGTCGCGCTGGAGTTCGCCTTTTTAATC
+GGCCTGGCGCAGGGAACCTTACATAGCGCATAGACGCGCGCGCCCGCAACGGCTTGTGAG
+CGTCGCGGGTTATTGTGGTGTTCCATTGCTGCGTTGCTCGCCAGCCTGAACATCTTCCAG
+GTAGTGTTTAAGCGTCAGGCGAAGTTCCGGGCTCATATTATCAAGGTTATTAAAAAGCCA
+GCGTAAATAGCCCGGATCGCGTTTTGCGACTTCAGATACCGCCTTACCGCGGTATTTACC
+GAACGGGAAAGTGGTTAACAGCGCAGGACGGCCCGTGATATTGACCATTTCTTCCGCGGT
+CCAGCCGGTGGTTCGCATAATATCAATCAGCAAGGCGGCGGTGATATAGCAATCATAAAG
+CGCCCGGTGATGATGCAGCCCCGGTGGCGTTTGTACGCTTAGTTTGCGCGATTTATAGAG
+CGACATATTGCTGTATTTTATTCCCGGCCACAGGCGTCGCGACAACTTCATGGTACAGAT
+CCACTCACCCGGCAATTCAGGTAATACGCGTCTGTCGAAACTGGCATTGTGAGCGACATA
+CCACTCACTACCGTAATAAAGCGGTATGACATCTTCAATCCACGGCTTATCGGCGACCAT
+GGCTTCGGTAATACGGTGTATCGCCATCGCCTGCGGCGTAATAGGGCGATCGGGGCGTAT
+CAGGTGACTCATGGGATTGACAATGTTGCCATCAATGACATCAACAGAGGCTATCTCTAC
+GATCCCGCCCTGCAGCCCGCAGGTTTCCGTGTCTATAATCCGCAACATGATTCATTCCTC
+ACCGAAAGACCTTAGCGTAATGGAATGATATCGCCTTGCCAACCCTCCGTTGTGCGCAGG
+CCCGTCAGTAATAGCGAACCGCAATCGGCACGAACAATAAGTTGCCCGCTTTCATCCCAC
+AGCGCGCTACTTCCACAGGCATTGGCCATCAGTACGGCCAGCGCATATTTATGCGAAAAA
+CGTTGTAAGCGTGAGGTAGAAGCATGGAGTTCAGGTTCGTTAAGACATTGACTGGTTGTG
+AATAACGTAAATGAGGGATCTATATCACCACCTTCTGGCTGCTCATCCACCACGTTGATA
+GCGCTTCGCTGCCTGGCAATACAGGCGCCATGACTTTTGTGAAACATGAGCGGCGACGTT
+AGCCATGGGGCAAAAATAGCGATGCCTTTTACGAAGCGGCAGTTATGCTCAACAGGCATA
+CCCACAATGATAGTCATATGGTGGGTATCGGCCGCATGAGTGAGCGGCTGTAAAAGCGCC
+TCGTCAGGCGGGGCGGGCAACGATTTATTCCTTTCGTCGCAGCCTAATAGCGACAGTGAC
+GGAAAGACCAGCAGTTCGCACTGTTGACGAGCCGCAAGCTCAATATATTCCAGATGATGG
+GCGACATGCTCCGCCGGCGAGGCGTTCAGGGGCGCATACTGCGCAGCAGCAATTTTCCAG
+GAGGACATAATGACTTCCTTTTCATAGTCTCTACAGCCATTCTAAAAAGCATAGGTTAAG
+AATCACCTTATAATGTAGTCGTCTGCATGTAAGGAAGTGTAACGTTATATAATTTTTATT
+TAACTTTGGGTTCGTAAGGGAGTCGGGATAGTGATACGGAAGCCAGACGATGGGCAATCA
+GCCGCTCGCGAAACCAGGCGCGTAGGTGCTCTGGCTGCTCACGTTCGACCGCCTCCGCGA
+CAACTGGCATATTGTAGCGCTCTTTAAATGCCACCCCGGCTGCCGCCAGGTCCACATTGA
+CTTTATCCATTTCCGCTTGTTCAAGCTGAGCCAGATTCGTTTTCATACGCGTCTCCTTTT
+TTGTTGCCGCCAGAAGGTACTAAGAGTCCGCGGTAATGGCAAGATGGAAATGATGATCCT
+CGACTCATTGATTGTTGAAGGTTATTCTTTGTAACGTAGGTATAACAAAAAGGAATAGTG
+AATATGGCTTCTTCTGCACCATCGCGACGTTTAGCTTTACTGCTGCTGGCATCGACATTT
+GCGACGCCAGCGGCCTGGGCACATGCGCACCTGACGCATCAGTATCCAGCGGCGAATGCT
+GCCGTTACGGCCTCGCCACAGGCGCTGACCCTGAACTTTTCTGAAGGGATTGAGCCAGGG
+TTCAGCGGCGCAACCATTACTGGCCCTCAGCAAGAGCTCATCAAAACGCGCCCGGCAAAG
+CGAAATGAACAGGATAAAACGCAGTTGATTATCCCGCTTGAGCAGCCGTTAAAATCTGGC
+GCTTACACGGTAGACTGGCACGTTGTGTCGGTGGATGGACATAAAACAAAAGGGAAATAC
+ACCTTCAGCGTGAAATAAATGATGCTGACATTCGTCTGGATAACTCTCCGATTTATTCAT
+TTTGCTAGTTTGATGCTGGTCTACGGCTGCGCGCTTTACGGCGCCTGGCTGGCACCCGCA
+TCAATTCGTCGTTTAATGACGCGTCGATTTTTACATCTGCAACGACATGCCGCCGCCTGG
+AGCGTTATCAGCGCGGCTTTTATGCTGGCGATTCAGGGCGGACTGATGGGCGGCGGCTGG
+CCCGATGTTTTTTCCGTCTCGGTGTGGGGCGCGGTACTGCAAACCCGCTTTGGCGCGGTC
+TGGATATGGCAAATTATCCTCGCGCTGGTCACGCTGGCGGTGGTAGTCATTGCGCCGGTA
+AAAATGCAACGACGGCTTCTTATTCTCACCGTTGCTCAGTTTATCCTGCTGGCAGGCGTT
+GGACATGCGACGATGCGCGACGGTGTAGTGGGAACATTACAGCAGATTAACCATGCTCTG
+CATTTACTCTGTGCCGCAGCCTGGTTTGGTGGGCTGTTGCCAGTGGTTTATTGTATGCGC
+ATGGCTCAGGGACGCTGGCGTCAACATGCTATTAGCGCCATGATGCGTTTTTCTCGTTAT
+GGTCACTTTTTTGTGGCGGGCGTATTGCTCACAGGCATTGGCAACACGCTATTTATCACG
+GGATTTACCGCTATCTGGCAGACCACCTATGGACAGTTGCTTTTGTTAAAATGTGCGCTG
+GTCGTGCTTATGGTAGCAATTGCGCTGACGAATCGGTATGTTCTCGTACCACGTATGCGA
+CAGGAAAATCCCCGGACTGACCTATGGTTTGTCAGGATGACGCAAATTGAATGGGGAGTT
+GGAGGCATAGTTCTGGCGATCGTCAGCCTGTTTGCAACCCTCGAACCTTTTTGATGGACT
+GGCATAACGAATGAAAAAAATACTCCTTCCGGCGCTTCTGCTGGCCACTTCGGGCGTAGC
+GTTGGCGGCGCCGCAGGTGATTACCGTAAGTCGTTTTGAAGTAGGAAAAGACAAGTGGGC
+GTTTAATCGGGAAGAGGTCATGTTGACCTGTCGGCCTGGCCAGGCGCTCTATGTGATCAA
+CCCCAGTACGCTGGTGCAGTATCCCTTGAATGCCATTGCCGAACAGCAAGTAGCGGAGGG
+TAAAACGCGTGCTCAGCCTATTGCCGTCATTCGAATCGATAACCCGGCGAAGCCCGGTGA
+GAAAATGAGTCTGGCGCCGTTTATCGAACGTGCGCAAAAGCTTTGTGATCCATCCAATAG
+CTGACTGATTTTTAATAAAAAACCGTAAACCTTCACGAAAAGGCTTACGGTTTTTTTATC
+TCTGATAACAGACAAAACGCCAGGTTTTTTCAATCACCTTCGTCGCAAACTGGAAAACCT
+GGCGTCGTCATCTATTCTTAAAGGGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTA
+GCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACAGGAATCGTATTCGGTC
+TCTTTTTATTTTTCTTATAAAACAGTTGCTTATGATCAATGATCCGAAATTTTCCGAAAT
+TTTTCCGAATTTCTGTATTCCGGTCTTTTTGGTTATATCACAATCAAATTAAATTTAACA
+TTTATTTCACAACGAAAATTGGAGTATTAGAGCATCATATAAGCTTTATCATCACGCTCA
+TCGAGATAGAGTTTCGTGGTGTTCGCTGATGTGTGGCCCAGGAGTTTTTGGGCGAACACC
+TCGCCGTGCTCGTTTTTGTACAGCCGCCCGGCCAGACTTCGGATCTCGTGAAATGTCGGT
+GGATTATTGCTGAAGTTAACACCGGAGGCTTTTCTTGCTTTTACAAATGTCTTTGTCAAT
+CCATCCGGATGAATATTCCCGGTTGGGCTATTTTTCCTGATTCCGGCACTGATCATGAAA
+TCAGTGCGGCTTACCAGTCGGCAGCGATCGATTACCGTTCCCAGACGTAACCCCGTCGCC
+CGAAGTGTCAGGGAGAGGGGAATGGCTATTTTCATTCCGGTTTTAATCTGAGTTACGTAT
+AAGCGGTTGTCAAAAACATCACTAAATTTCATATTTACGATATCCTCCCTACGTTGACCA
+GTAACGAGCGCTAAATCCATCGCGAGAGGGAACCATGCAGGCATATGCTCTGCTGCCGCT
+CGTGTGGCGTTATACGTTTCCAGTTGCAGGCGTTCCCTGGCCACCTTAATCTCTGGTATC
+CGGGTTGCTTCCACCGGGTTTTTCACAATATGCCCTTCGACAATAGCCTCTCTGAACATG
+TCAGATAGAACTGATCTCATTGCTCCCGCCATAGTGTTTTTTCCCTCGGTTATCCACGAC
+TCAAGAAACTTGGCAATGTGCCTGGTTGTTACTTCTGCCAGTATTATTTCCCCCATTTTT
+TCGCGTACGGTCGCTAATTGATTACCGCGAATCTTGTAGGTATTAACCGACAGACTCCGG
+CGCTGTAATAAAACCTCATAGCGATCAATCCATGCGGACACAGTGAATGAGTCAGTTCCT
+TTTAGCTTTTCAATAAGCGCCACTGGTGTGTGGTTTTGCGCTATGAAGTTGTTTGCCTCT
+ATGGCCTGTGTGATAGCGTCCCTGCGGGCGATCTGACCGAGCGGAAATTCCTTGTCAGTT
+AGCGGGTTACGCCAGAAAAAAGATTTACTGGCCTTACGGTAGGTGAGGTTCCTCGGAAGG
+TTAGCATCGTACTTTTTTCGACTCACTGATCAACTTCTCCAGCAATGCACTCGGTTTTCC
+GGTGCGCCCGTTTGGGTGGTGCTGTTCAAGCACAAGTCCCACTTTATTCGGCTTGATATA
+AAACGCGTCCGGATCAACCCGATACGTCCTGCCATGTAATACTGGAGTCGGGTAAATATT
+TCCGTTTCGCGCCCATCGTCTTAGTGTTGTGAGAGGTGGTGGATCATCGGGATAATTTAA
+TTCACCCCAGGTTTCAAGTCTCACAAAGCTCATAGTCATGTCTCTTTACTTCATGACCGC
+CGCCAACTATACGGTGTGGCGGTCGGTCAGGGTTGAACATCAATGATCAGGGTAAAATTT
+AAAGGACTGCTGACCGCCGCCCGGTAAAACTTTTACATCTCCGGCGCGCCGTCCTGTAAA
+TCCTGCCCAATGCGCGGCGCGTATCCTGTCAGCCTGCTCTTCAGTCAGGCAGGGTCCCGG
+AAACGGGAAGCGAGCTTACCCCACTTACTAAAAGAGGATGGAACTGGCTGACGTAAAACA
+CGATTTATTTGTATCCATAAATAGCGAAATGTAACGTTTTGGTTATATTTAAAAGAGAGA
+AAATGGTCAGCAATAACTTTAATTGTTTGAATTAACAGATAATTAATCTACCAGACTGAG
+TGATACAGAATATTTTTACATGAGGGGTACAAATGAGACTTAAGTTGATCGTTAAAAGTT
+TTGCGCTGGCGGGGCTACTCTCTTCCACTGCGCTGACACCTTTATTTGCACAGGAAGCCC
+CAAAAGGTGCCACTGCTTCAACCAAGCAAGCTAACGATGCGCTTTATAACCAACTTCCTT
+TCTCTGATAACACCGATTTCACGAATGCCCATAAAGGCTTTATCGCTGGTTTACCTGAAG
+AGGTGATTAAGGGAGAGCAAGGGAATGTCATCTGGAATCCACAGCAGTACGCTTTCATAA
+AAGAAGGGGAAAAATCTCCTGACACTGTTAACCCTAGTCTGTGGCGTCAGTCCCAGCTAA
+TCAATATCAGTGGCTTGTTTGAAGTCACAGACGGCGTCTACCAGATTCGTAACCTTGATT
+TATCCAACATGACGATTATCGAAGGTAAAGAGGGGATTACGGTTGTCGATCCGCTGGTTT
+CTGCGGAAACAGCCAAAGCCGGTATGGATTTGTATTTCAAAAACCGTGGCAATAAGCCTG
+TTGTCGCCATCATTTATACTCATAGCCATGTTGACCACTATGGCGGTGTGCGTGGCGTTG
+TCGATGAAGCGGACGTGAAATCCGGCAAGGTGAAAGTGTATGCGCCTGCTGGCTTTATGG
+AGGCAGCAGTAGCCGAGAATATTATGGCCGGCAACGTGATGAGCCGCCGTGCCAGCTATA
+TGTATGGCAACCTCCTGAAACCAGATGCCTCCGGCCAGGTTGGCGCCGGACTGGGGACGA
+CCACCTCTGCGGGGACGGTGACACTGATTGCGCCCACTAATATCATCGATAAAGACGGCC
+AGAAAGAAGTGATTGATGGCCTGACTTACGACTTTATGCTGGCCCCTGGTTCGGAAGCCC
+CTTCGGAAATGCTGTGGTTCATCGAAGAGAAGAAACTCATCGAAGCCGCAGAGGACGTCA
+CTCACACCCTGCATAACACTTACTCGCTACGTGGCGCAAAAATTCGTGAGCCGTTGCCGT
+GGTCGAAATATATCAACGAAGCTATAGTGCGTTGGGGTGACAAAGCTGAAATTATTATGG
+CCCAGCACCACTGGCCGACCTGGGGTAACGAGAATGTTGTTGGTCTGCTGAAAAGCCAGC
+GAGACCTGTATCGTTATATCAATGACCAGACTCTGCGCATGGCCAATGAAGGTCTGACTC
+GCGACGAAATAGCGGCCAACTTTAAACTACCGGATAGCCTGGCAAAAACCTGGGCCAACC
+GCGGCTATTACGGCTCCATCAGCCATGACGTAAAAGCAACGTATGTGCTGTATCTCGGTT
+GGTTCGATGGCAATCCGGCAACCCTTGATGAGCTGCCACCCGAAGAAGCGGCCAAGAAAT
+TTGTTGAATACATGGGCGGTGCCGATGCGATTCTTCAGAAAGCTAAAGCAGACTTTGACC
+AGGGGAACTACCGTTGGGTTGCTCAGGTGGTGAGTAAGGTCGTGTTTGCCGATCCAAATA
+ACCAGAATGCACGTAACCTTGAAGCCGATGCGCTGGAGCAATTGGGGTATCAGGCTGAAT
+CTGGTCCATGGCGTAACTTCTACCTGACCGGTGCGCAGGAGCTGCGTAACGGTGTGGTTA
+AAGGTCCGACGCCAAATACAGCAAGTCCGGATACCGTTCGGGCGATGACCCCTGAAATGT
+TCTTCGACTTTCTGGCTGTACATATCAACGGTGAAAAAGCGGGTAATGCCCGGGCGGTAT
+TTAATATTGACCTTGGCAGCGACGGCGGAAAGTACAAGCTTGAGCTGGAAAATGGCGTGC
+TGAACCACACGGCTAATGCTGAAGCGAAAGATGCTGATGCCACGATTACTCTGAACCGTG
+ACACGCTGAATAAAATTATCCTGAAGGAAGAAACTCTGAAGCAGGCTCAAGATAAAGGAG
+AAGTCAACGTTACCGGTAATGCTGCGAAACTGGATGAGATGCTGGGCTATATGGACAAGT
+TTGAGTTCTGGTTCAATATAGTTACACCATAAATAGATTCCCTGCGGCGTCAATGCTGCA
+GGGAAGTTACTTCAGACAATTCTGTACGTTTTTTATACTCTATTTTCCCTTCATTCTTTA
+TATCTTGCTTCATCTTATGTATTTGCTGCTGAAGAACATGGCCCTGATACCAGTCAGTTC
+TGATTCTGTTATGCACAGCCTTTTTCATCAGATGACAGTAACTGGTTGTTGCGTGATTCA
+ATGGCCTGCGAGTCTGGCCAACATGCTTTTCGATGCCGGTTGGCCATGATGCCAGTATGG
+TTAACTGGCATCATGGCAGCATAATTTTGCCGGATAAGTCAACCGCAGCGATGTTAATCG
+TCCTGATTATCATCTGCATCACTGTCACAGTGACTGCACCAGTAACGAGGAGAGACTGCG
+ATCGAACCGGCCAGACAGAGAGGAGGTAGTTGTCTTCATTGCTAAGTAAGAGACCTTGGG
+GGATGAATCTCCATCACCTGTGATGTGTCAGACAACCTCAATGTACCCGCACTTAATACC
+TGCGCCGGCGGTTTTTTTAATGTCCGGGAAATGAGCATGTCAAAAAATAACCAGTTATAA
+GATTATAAATAGAACACAGAGAAAATGTCATTGCATATGGTCAAAAAATAGATATATTTA
+TTGATGATGATAATTAATAGTCTCCTATATATTCATGTTGAGAATGAAGATGCTTTAAAA
+ATGCTCAAGTTCGTTATCTATGGAGACACCGTGAAAAATTTAAATAAAACATTCACTTGT
+AAATATGCTGTTATTCGCCGTGATGACATGACAGTAATTGCTGAAATGGATTTTTTTCCT
+GACTGCAACAGGTCATTGATGTATCGGGATGGCCGCTATGTCCGGTTTCTGCCGTTGTTG
+CAAAATGACATCATGGGGAGCGATACCCTGATTAATGAGCTGACTATCAGGGCCGGTTAT
+CATGAATAATCATCCTTTGTTATACTCGTCTGCGGGCTGAACTCCCAATCTACTGCGCCA
+ACGGAGAGAACGATGGCGCATTTACAACTGGTCAAGCAAACCTCATCAGGGCTTCTGCTC
+CCGGCGACGCCGGAGAGTGGGGATTTCCTGCGCTCAGTAAAAATCGGTGAGTGGATACAC
+GCCGATTTTAAACGTGTCCGCAACTACGCCTTTCATAAACGATTTTTTAAACTCCTTCAG
+CTTGGTTTCGACTACTGGATGCCAACGGGCGGCACGGTCACATCGCGGGAACAGAAACTT
+ATCTCCGGGTTCGTTAATTTTCTTTGCGACTCCGCAGGCCAGGAATATACCCCGGCCCTT
+AACGAGGCGGCGGAACAGTACCTCCATAACGTAGCTACCCTGCGAACCGGGGACGTCGCC
+CTTCTTAAGTCTTTCGATGCCTTCCGGGAATGGGTAACCGTTCAGGCCGGGTTTTATACC
+GAGCATTTTTATCCGGATGGCAGTCGCGGGCGCCGGGCGAAATCCATAGCATTCGCCAGT
+ATGGACGAAACCGAGTTTCAACAGGTCTATAAAGCTGTGCTGAACGTCCTGTGGAACTGG
+ATTCTGTTTCGTAAATTTTCCTCTCTGGAAGAAGTTGAAAATGTGGCCGCGCATCTGCTG
+GAGTTCGCATGAAAATGACATGGTTTCAGCATCCGGTGTGTACCACCGAAGAGGCGGATG
+AGCTGGTGGCGGGATACCGGCGCCGTGGCGTGAAGGTTGAGCGTTACGGTGAGGCGGAGG
+TGCTGGAACTTGAGAGCAATAATACTCCGCAACGTTGGACGGTTGAGGAGCTGAAAGAAA
+TCAGGATCGCTGCACTGGCGGATCTGCGTGCGCTAAAAAAGCTGGAGGCGGCATGACATT
+CGAATCCTACTTTGCCGATCATCTCCGTGCTCGCTGGTAGCAGTTGTGCTTATACCATTT
+CCGGGTTCCATCCTGATCGATTACCGGATTTTGAAAAACTACGTGAAGATAACGGGCGGT
+ACCGTATGAATACACAATATCTGGAATATGTGCGACAGCAGCTCATCGTGGCGACTGCAG
+ATCTGAGTGGCGCCACGAAAGGTCAGTTGCAGGCATGGCTGGAGAACGCCCAGCTCTATA
+CGAAAAACTATCCCCGAAAAAAACAGCGTATCAGGGATGAAGTGACCGGAAAAATGATAA
+CGCTGAATAATCCACCGATTGCTGGTAAGCAATCACTGGCGAAAGGAAGCGCAATTCCGC
+TTGTGCAGCCCGTAGAATACTCCACTTCCTCATGGCGCCGTGCGCTTTTGTCACTCGAAG
+AACATAATAAGGCCTGGCTATTGTGGAATTACAGTGAAAACACCTGCTGGGAATATCAGG
+TCACTGTAACTCGATGGGCTTGGGAAAAATTCAGCCAGCAGTTGGAAGGGAAGCGAGTTG
+CGAAGAAGACTTTAGCACGGTTGCGCCAGCTCATCTGGCTTGCTGCGCAGGATGTGAAGG
+CGGAACTGGCCAGACGTGAGACGTATGAGTACCAAACGTTGGCGGAACTGATGGGCGTGG
+CAAAATCTACCTGGACAGAGACGTACATGTCTCATTGGTTAGTAATGCGTAACAGCTTTA
+AACGGCTTGATAGTGATGCGCTTATCTCCGTAACACGATCGCGTTCACAACAAAAGGCGA
+CAAATTTGGATATAAGTCTTGCAAAACCGAACTGAAATACATATATTTCATGTAAATTTG
+ATATCATGCCTAAAATATGCAAGCCTGCTGAGGAACGGGATTTTTGTATTAATCAGCAAT
+AGGAATTGATGATGTTTTATCGTGATTTATTTCAAGTTTTTGGTCCCGACCCGTTGTATA
+AGGAAGAAGAAGGAATTGCCATCCTTCGTGAGCAATATGGGATCGAAGCTCCAGAACAAA
+TTTTTAAGCAAATTTATTGTGGGTTATCTAATAATTCTGAATTTCAAACCTTGTATGGGC
+ATCTAAATCTTAAATCACTGAAGTGGGATTTGGTCAGATTGAAAACAGCAGAGTTTACAA
+AGTTTGGCAGAAATGCCACATATCCTGATTACATGCTCGAGATTTCAGAAGACTTTAATG
+CCTGCGGCAGCAAGTTTTGCATTGATGCCCGTGAAGAGGTTGCAAACCATTGGCTTAAAT
+TCGGTACATGGGCTGAACCACCGATGTTTATTGAGCGTTCGCTTATTATTCCTGGAGAGA
+GCGGCTTACACCTTATGGAGGGTCATACAAGATTAGGTACTTTATTGGGGGCTATTAAGT
+ACAAATTTGTGCAGTTAGCTGATACTCATGAACTTTATATAGCCTCGCAGAAATAGTTTA
+GAGAGGATTGCTCAACACCCTCGGTAAGAATTGCCACACATCAAACTAATGTTAGGGTAT
+CTTCGTCCACAGAGTCGAAATGGCCTTATTTACATCTTCCTGGCTTTTCGCCGGTTTTTT
+TATTCAGCCCTCGGAAATCATCATCTACACGCTTCGTTGTTAAAACCCCGCCCGAGGGCC
+TCTCACCCTTACAAATACAGCGCCATCCAAGCTATCGGGGGCGAGGCTTATGAAAATGCA
+CAACGATCCCCATTCAATGGACTCACAATCTATTTTTGCGCTGATTGCGAGTCTGACTTT
+TTTCGATTGTGAGTCGTTACAGATAGCCGCCGGGCCAGACACCACAACGGTACCAGGTGG
+CGTTATGTGCTAGAAACCGAAATTCTTGAACATCTCATTACTACTCATATCGTTGGCTGG
+CGCACGGTTCATCGACTCCATCTGCTTGATCAACCCTATGCTAGCACCAACAGGCCCCCC
+GACGCTGAAACCGACGCTGCTGGAGCGGGTTTTGCTGGTGCTACTGCTGTGGGTTTGACT
+ACGGGTGTTACAGTTGCTTTGGTGTGTCCGTGTGAGACTATTTTCGCTGAGCTGGCTATC
+TTCACTTTGGGTGCAGTTTCCCTGTGACTGGCTGTGACTGTCTCCTGTGGTGTGGTTGCG
+GCTATCCGTGTGCCACTCGCTATAGCCTCCCGCTGGCGCAATGATTCCGACCGATGTACC
+GTGGGTGGCATAGGGAGGCATGACCATGCCACTACAGCCACCGAGCAGTAACGCGGTGCC
+GACGATAAAAATGAACTTACCCAGAGCGGTGTTTTTCATTAGTTCCTACCTATTTCTTCT
+CGTTGGTTATTTCTATGCCCTGCCTTGGCAGGGCTCGCTATTATTCATTCTTCAACTGTG
+AGATCAAGTTATTTTAATTAAATCGGTATTATTCTTAATTGTGTTCTTTATGAATAAATA
+TCCTCCGGCTATGCCGGAGGATATTTATTATTTCCCCTCATAACTGAGAGGCCCCACACA
+ACCAGAGGGGGATGAATGTCCGAATCGATTTCTGGTACTGGGTTAGCAGGTGGCATCCTG
+ACAGGAGCCAGTGTCTATGGACTGCTGACCTGTATTAGCTCAGACCTGAACTGGTTACTG
+TGTTGTAGCATCGTGGGATTTTGCATTTTTTGATGAGTGTCAATTACTAAATTCGTAGGC
+GATTCTTGGTGGTGATGTGTGACCCATCTCTTTTAAAATGATATTGGTATACTCGACTAC
+CGGGCCTCTTGGATTACTGTCTTCTTTGTCCTGAAGGTGAGTCAACGCGTGTACAACTTC
+GTGAATAAATGAGCGTGTTGTATCAAATTGTTGTGGGCCATCATTACTTTCATAGTACTC
+TGGTATTGAATCATCGTCTGTATCATCCAGGTTGAGGGCAATCACTTTTCTGCCTTCTGA
+ACTCTCCAGGTCCTCATCAGTTACGGTAGTACCAAAGTTTTCTCCGGCTCCCAGCAACCA
+GCGTTGTTCTACATCACGCAATTCCTGATCGTAGGCATAATTCATCAGTCTGCGGAATGT
+CCCGCTTTGAGTGTATGCATCTTCAAGTATGCGTGATAGCACCTCACGGCATTCATCATA
+GGTATCATCATCAATTTCGATATCAGGATCCATTCCTCCTGGTCCAGAGATAAGGTATTC
+AGCAAGACACATTGGTTCCAGCCTGGCTTTATCATCGGTAGCAAGACCATCATGTTGGAG
+GCGTAATTGCGAAGGATTATCTTGGTGTTCTGGAAGGTCTGGAAATACCTTGCTGTCATG
+AGGATGGGATAATCCATATGTTGACATCATATTATTGATAAATATTGGTTTAATTCCCGT
+TGGCATGATGAGTTACACATCCTTTTTATTACATGGAATTAACATTCTATAAATAGCATG
+TTTTTGTCAAACAGAATTCACTCAGCACGCAATCAATTAAACTAAAAGCTAAATTTGCAG
+TATTTGTGCCTCACCTCCATTAAAATTGTACTCTGCGTGATTTTACTTTCAGATTCTGCA
+ACCACAGGCAATCCTGTTTTACAAGATATTAAACCCTGCAACCCAACCATTTCACTCACT
+CTAGTTACCATCCGAAATCATCGGAGGTGAGGCTTATGAAAATGAATGACAAGACTCCTG
+AATTCTGGGCTGCGGTTTTGACCGGACTCAAAAATGCGTGGCCCCAGATACTTGGGGCGT
+TAATGGCCGGACTCATTGCCTACGGCCGACTGATATACGACGGCGCCACCCGTAAAAATA
+AATGGCTTGAGGGCGTCCTGTGTGGCGCTCTTTCCTTATGTGTCACCAGTGCGCTTGATG
+TGGTAGGCCTGCCGGTTTCCATTTCGCCTTTCGTTGGCGGAATTATTGGCTTTGTCGGTG
+TGGACAAGCTGCGCGAAATCGCAATTAGCGCACTCAAAAAACGTGCAGGGGTTAATGATG
+AGAATCAGTGAAAAAGGCATTACCCTAATCAAAGAGTTTGAAGGTTGTAGCCTGACAGCT
+TATCCGGACCCGGGAACGGGGGGAGATCCCTGGACGATTGGTTATGGCTGGACCCACTCT
+GTTGACGGTAAGCCAGTTAAGCCCGGAATGATGATTGACGAGGCTACTGCCGAGCGCTTG
+CTTAACACTGGTTTAGTCGGTTATGAAAATGATGTGTCCAGACTGGTTAAGGTCAAGTTG
+ACGCAAGGCCAGTTTGATGCGCTGGTGTCGTTCGCGTACAACCTCGGCGCCCGGACATTA
+TCCTCATCAACTCTGCTGCGGAAGCTAAACGCTGGTGATTACGCTGGCGCCGCTGATGAG
+TTCCTGCGCTGGAATAAGGCTGGTGGCAAAGTACTGAACGGGCTTACCCGTCGGCGTGAG
+GCGGAGCGTGCTCTGTTCCTGTCATGATGTTCAACTGGAAAACGATGTTTGTTGGCCTGT
+TGCTTGTCTCGCTAATTGTTGCCGGTCGGCTGGCAAATCACTACCGAAATAACGCCATCA
+CCTACAAAGAGCAGCGCGATACCGTTACTCATAGGCTGACGCTGGCGAACGCGACAATTA
+CCGACATGACTAAGCGCCAGCGTGACGTTGCCGCCCTCGATGAAAAATACACGAAGGAAT
+TAGCCGATGCGAAAGCTGAGAATGATGCTTTGCGCGATGATGTTGCCGCTGGCCGCCGTC
+GCCTGTACGTCAACGCAACATGCCCCGCAGTGCCGACAGGTAAATCCACCTCCACCGCCC
+GCATGGATAATGCAGCCAGCCCCAGACTGGCAGACTCCGCTCAACGGGATTATTTCGCCC
+TCAAAGAGCGAGTGAAGACGATGCAAAAGCAACTGGAAGGGGCGCAGGCGTACATTCGCA
+CCCAATGCCACGGTAATGCAGGAAAAACTAGTAACCAATGGTGACTGTATTAAAAAGGTA
+CTCCCGGGCAGGGGGCGCCACGGGTGGCTTCGGGCTCGCGGGAATCGGCTGATTTTTGAT
+TTTTTAGTCTCTGTCAGCACTGAAAAATAACCTTAAAAATCAATACATTTACTGTTTTCA
+GTGTCGAGGTGGTACGTTTTTTGTTCGACACTGAACGCCATTTTCACCGTATACAGGAAA
+AGAGCACGACTGTGGATCAGGAAATTAAAAGCCTCGAATTAAACATCACACAGCTTTCGG
+CCATCACTGGTGCACACCGACAGACCATCGCCAGCAGGCTGAAGGGCGTAAAAACCTCAG
+GTGGGAACGGTAGTAACCTGAAAATCTACCGGCTGGTGGATATTCTGACCGCCATGATGA
+CGATGCCGGCTGTTACCGGGGAGAATGACCCCAATAAGATGAAACCCTCAGATCGACGGG
+CATGGTTTCAGTCGGAAATGACGCGTATTGAGCTGGAAAAGGAGATGAGAACTCTGATCC
+CGGCCAGCGAGGTGCTGAGCGTTTAAGGTAGGTGATGCTGATTATACCTCCCTTCTTGTT
+GGTCCTTCATACCGTTTTAACGACTATCTGAATGCTTACGTGATGATTGGTGCAGCAAAC
+GGACATATTAAGGATAACTGGGGAAATTCTGACAATAAAACCGCCTTTGCTTATGGGGCA
+GGTATTCAGCTTAACCCGGTTGAAAATATTGCCGTTAATGCGTCTTATGAGCATACAAGT
+TTTTCCACTGATGCTGACAGTGACGTCAAAGCTGGAACCTAGGTGCTTGGCGTAGGTTAC
+AGCTTCTGACCTTTAACATCGATACAGATTTAATGCCCTCCAGTGAGAGGGCTTTTTTAT
+GGGTAAAACGAAATTATGACGATATGGCTATGTTGCTGTTATTTCTCAATGACACCACAG
+GCAAAACGTGCACCGCCACCACCCAGTGGAGCAGGTTTATCGGAGTAATTGTCACCGCCT
+TTATGGATCATCAATGAGTGACCTTTCAGTTCTGACAGTGATTTAAGGCGTGGTGCCAGT
+AACGGATACGTGGCTGTACCATCTGCATTGACAACCAGTCCAGGCAGATCCCCCAAATGC
+CCTTTGTCATTATATGGGCCAAGATGTTTCCCGGTTTTTTCGGGGTCAAGATGTCCTCCG
+GCCATGAGCGCCGGAACCTCTTTACCGTCTTTCATTCCCGGCATACAACTTGGGTTTGTG
+TGGACATGGAAGCCGTGAATTCCTGGCGTAAGACCATTTAGGTGAGGAGTGAAAAGCAGA
+CCGTAAGGTGTCTCTGAAACTGTGATTTCACCTATGTTTTCTCCTGTTCCGCTGGACAGG
+GCATCGTTCATCTTTACAGTCAGGGTATTCTCTGCCATTGCTGAACAACTGATGAGCGCA
+CCAGCTACCAGCGACAATATTGTGTATTTCATTAGTTACCTCGTTTTTTGGTTGTATCGT
+AAATACCATTAATAAAAGCAGGTATATTTTTGCAAGATAAATAATAAAGGATCTCTCATA
+TATGCAGGATATACCACAGGAAACCTTGAGCGAGACCACCAAAGCGGAGCAGTCCGCGAA
+GGTGGATTTGTGGGAATTTGATTTAACCGCGATTGGCGGTGAGCGCTTTTTCTTCTGTAA
+CGAACCGAACGAAAAAGGCGAGCCGTTAACCTGGCAGGGGAGGCAGTACGAACCGTACCC
+GATACAGGTACAGGATTTTGAGATGAACGGGAAAGGCGCATCTCCCCGCCCGAACCTCGT
+TGTTGCCAATCTCTTTGGTCTGGTCACGGGGATGGCGGAGGATTTGCAAAGTCTCGTCGG
+CGCGTCAGTGGTAAGGCATCAGGTTTACAGCAAGTTTCTTGATGCGGTGAATTTCAGTAA
+CGGCAATCCGGGCGCTGACCCGGAGCAGGAGGCGGTAGCGCGCTATAACGTGGAGCAGTT
+GTCAGAACTGGATTCATCAACTGCTACCATTATTCTGGCATCACCGGCAGAAACCGACGG
+TTCTGTGGTGCCGGGGCGTACCATGCTGGCGGACTCCTGTCCGTGGGATTACCGGGATGA
+AAACTGCGGATACGACGGCCCGCCCGTGGCCGATGAGTTCGATAAGCCCACCTCAGACCC
+GAAAAAGGATAAATGCAGCCACTGCATGAAAGGCTGTGAAATGCGTAACAATCTGGTGAA
+TGCCGGATTTTTCGCTTCCATCAACAAACTGTCTTAACAGGTTCCCATGATTAACGATGA
+CATTCTGGCACATGCCCGACAGTGTGCGCCTGCGGAATCGTGCGGTTATGTGGTCAGAAC
+AGCACAGGGAGAGCGGTATTTTCCGTGTGAAAATCTGTCTGCTGAACCCACGATGTATTT
+TCGTATATCCCCGGAGGATTACCTGAATGCCCGGAACCGCGGCGACATCGTGGCGCTGGT
+ACACAGCCATCCTGACGGTAAGCCCTGTCTCAGCAGTGCGGATCGTACCCTCCAGATACA
+AAGCGGAACGGTCTGCAGAGCGTGCTGATTAATAACACGCCGGTGGTGGACGCGGACGGT
+AACAGTAATATTCACGGCGTGACCGTGGTATATCAGGTGGGGGAGACACCACAGGCACCG
+CTGGAAGGTTTTGAGGCTTCCGGCGCGGAAACGGTGCTGGGTGTGGAAGTGAAACACGAT
+AATCCCGTTACCCGTACTGTTGTCTCAGAGAATGTCGACCGGCTACGCTTCACCTTTGGT
+GTACAGATGCTGCAGGAGACCATGGACAAGGGGGACCGTAACCCGTCCTCCGTGAATCTG
+CTGATACAGTTTCAGCGTAGCGGGATCTGGAACACAGAATTTGATATCACTATTAACGGC
+AAGATCACAACACAATATCTGGCATCGGTAGTGGCTGATAATTTACCGCCGCGCCCGTTC
+AGTGTCCGCATGGTCAGGGTGACACCGGACAGCACCACCGACAGGCTTCAGAACAAAACG
+CTGTGGTCGTCGTATACGGAAATCATCGATATCCGGCAGGGTTATCCTGGCACAGCGGTT
+GCCGGTCTGCTGGTGGATGCGGAACAGTTCGGCAGCCAGCAGGTCACGCGTAACTACCAC
+CTGCGCGGACGTATTTTTCAGGTCCCCTCAAACTATGACCCGGATACCCGCACATATACC
+GGCCTGTGGGACGGGGCGTTTAAACCGGCGTACACGAATAACCCGGCGTGGTGCACGATG
+GATAAACTGACCCACCCCCGTTACGGGCTGGGCAGGCGTATCGGGGGGGCGGATGTGGAT
+AAATGGGCGCTGTACGCCATCGCGCAGTACTGCGATCAACCGGTGCCGGACGGATTTGGC
+GGCACGGAACCCCGCATGACGCTTAATGCGTATATTACCACCCAGCGTAAGGCGTATGAC
+GTTCTGGCGGATTTCTGCTCGGTGATGCGTTGTATGCCGGTATGGAATGGCCGCAAAATG
+ACCTTCATCTAGGACCGCCCCTCCGATAAAGCATGGACCTACACCAACGGTAACGTGGTG
+GGCGGGCGCTTTAAATACAGCTTCAGTGCCCTGAAAGACCGCCATAACGCGATAGAAGTG
+AGATACACCGATCCGCTGAATGGCTGGCAAACCTCCACGGAGCTGGTGGAAGACCATGCC
+TCACAGGCCCGTTATGGACGCAATCTGCTGAAAATGGACGCGTTCGGCTGTACCTCACGT
+GGACAGGCGCACCGGACGGGGTTGTGGGTGATGATGACGGAGCTGCTGGAAACGCAGACC
+GTGGATTTTTCTGTCGGTGCGGAAGGTCTGCGTCATACACCGGGCGATATTATTGAGGTC
+TGCGACAACGATTACGCCGGGGCGTCGGTCGGTGGGCGTATCACTGACCTGGATATTTCC
+ACCCGCACGCTGACGCTTGACCGGGAAATAACACTACCGGAAAGCGGCGCCACCACGCTG
+AATATTGTCGGGCCTGACGGTAAGCCGTTCAGTACGGAGATTCAGTCGCAGCCCGCACCG
+GATCGGGTGGTAACGAAAGTCCTGCCGGAAACCGTGCAGCCATACAGTATCTGGGGGCTG
+AAACTGCCCTCCCTGAAGCGCCGCCTTTTCCGTTGCGTGCGTATTAAGGAGAATGACGAC
+GGCACATACGCCATCACTGCCTTGCAGCACGTTCCGGAAAAAGAGTCCATCGTGGACAAC
+GGGGCGCACTTTGACCCGTTACCGGGGACCACCAACAGCATTATTCCGCCCGCTGTGCAG
+CATCTGACAGTCAGCACGGATAACGACAGTACCCTGTATCAGGCCAAAGCGAAGTGGGGC
+ACGCCGCGGGTGGTAAAAGATGTGCGTTTTGTGGTGAGGCTGACCACAGGCAGTGGGAAC
+GAGGGCGATCCGGTTCGTCTGGTGACAACGGCGACGACCAGCGAAACGGAGTACGCCTTC
+CACGAACTGCCACTGGGTGACTACACGCTGACAGTCAGGGCAATAAACGGTTACGGGCAG
+CAGGGTGAACCGGCGTCCGTGGCATTCAGTATTCAGGCACCGGAAGCGCCATCCACGATT
+GAGATGACGCCGGGTTATTTTCAGATAACGGTGACGCCGCACCAGACTGTCTACGATGCC
+AGTGTGCAGTATGAGTTCTGGTACTCCGCCACGCAACTGGCGACTGCCGCCGATATTCAG
+TCAAAAGCACAGTATCTGGGCGTCGGGTCATTCTGGATAAAGGATGGACTGAAACCACTG
+CATGATGCCTGGTTTTACGTGCGCAGTGTAAATCTGGCTGGAAAATCAGTATTTGCGGAA
+GCATCCGGACGTCCGGGGGATGACGCGAAAGGGTATCTGGATTTTTTTAAGGGACTGATT
+ACGGAGACGTATCTTGGTACGGAGTTGCTGAAAAAAAATTGACCTGACGGAGGATAACGC
+CAGCAAACTGCAACAATTTTCGAAGGAGTGGCAGGACGCTAACGATAAATGGAGCGCCAC
+GTGGGGCGTCAAAATAGAGCAGACCAAAGACGGCAAATATTATGTGGCCGGACTTGGACT
+GAGCATGGAAGACACGCCTGACGGGAAGATAAGCCAGTTCCTGGTGGCGGCGGATCGCAT
+TGCTTATATTAACCCGGCAAACGGAAACGAGACGCCCGGATTCGTCATGCAGGGCGACCA
+GATAATCATGAATGAGGCGTTCCTGAAATACCTGAGCGCGCCGACCATTACCAGTGGCGG
+GAATCCTCCGGCATTTTCCCTGACGCCGGATGGAAAGCTGACTGCGAAAAATGCGGATAT
+CAGCGGCCATATCAACGCTGTATCTGGCTCGTTTACGGGAGAAATCAATGCCACCTCCGG
+TAAGTTTTCTGGCGTGATAGAAGCAAGAGAGTTTGTCGGTGATATCTGCGGCTCAAAAGT
+CATGCAGGGCGTGAGCATCAGGGCGACGAACGACGAACGCAGCACCTCAACACGGTATAC
+CGACAGCGCCACCTATCAGATAGGGAAAACCATCACGGTGATGGCTAACTGTGAGCGTAA
+CGGTGGCACCGGTGCCATCACCGTCACGATAAATATTAACGGCCAGGTGAAAACGGCGGA
+GGTTATGCCGTATACCGCAGGGATTCCGGCCATGTATCAGACCGTCGTCTTTTCGGTCTA
+CACCACTTCACCTGTCGTGGATATCAGCGTCTCTCTGAGGGTCCGTGGGCAGTACACCAC
+GTCTGCTTCCGTCTGGCCGCTGGTGATGGTTTCCCGGTCGGGGAGCAACTTCACAAACTG
+ACCGGATTTACGACACAACAACCGGCAATCAGGTTTATATCTCCGAACTCGGCCCGTTGC
+CCGAAAACGTCACATCAGTTTCACCAGACGGTGAATACCAGAAATGGGATGGTAAGGCGT
+GGGTGAAGGATGAAGCGGCTGAAAAAGCAGCGCAGCTTCGTCAGGCGGAAGAAACCAAAA
+GCAGGCTCCTGCAAATGGCATCTGAAAAAATCGCGCCGCTTCAGGATGCGGTTGATCTTG
+GACTCGCAACAGATGATGAGAAAGCGCAGCTCGACGAATGGAAAAAATACAGGGTGCTGG
+TAAACCGGGTGGATACCTTAAATCCTGACTGGCCGGAGAAACCATCTTAGTTATAAAAAT
+ATAGCTATGTAGTAGAGATTGCTGCTATATGTTATATAGCAGCAATGGCTATTATTTTGA
+TGGTTGAGTGTATAATTTTAGCACTGGTAAATGACGGTTTAGCTCCAGAGTTAGTTCCTG
+GGAAAAATTATGGATACTATTGGTTCATATTAATCAGGAAGAGGCTCGCATATTTTTTGG
+TGTTTCTGTGTTCAGGGAGTGTTTTGGATATATTTATTAGCAATGTTTTCTAGTATTTGT
+TGGAATTGCTGTGGAGTCGGCATAGCACACTCATTAAACAGCGGTACAACTTCTGTCATA
+ATGATCTTCTCCGCATAGATGTTAAAGGATGCCTTCTGATGTTGACTGGTAAACATATGT
+GGATACTTACTGTATGCTGATGTAATCAACGGAGTTATAAAAGGATTGGCTCCTGCGCCG
+CTTGGCGTAAAAACGTCATTCTTGGTTGCTCCGGGCAGACCTGCATTTTGCGCAGCCTCG
+CCAATTTCCTTAAGAAAAGGCGCTATGTCGATTCCTTTGCTGATGAGCAAGTTACAATAC
+TGATCTTTATACTTGCTGTAAACTGCCGATAGTATAGCTTCACGGGTCTGGCTGGCGTAT
+GCGGGGTCTTTACTCGCGCTACCTCTAATATCTATATCATGGAGCGTTTGAAGCATAAAG
+TTTTTAACGACTTTATTTGTCAACACTGCCCGGCCCTCAGATGCGCTTCCTCGGTGAAAG
+TGTGTTGCAGAAGATTCAGTGTTCTTATGCGAAATAAAACGTTCCGATAATTTTGAATTT
+AATTTGATGAAGTGATTTTTTACTGCGAGAATACTTTTTGCTAAAGAATTTTTCTCGGTT
+GATTTTTCTTTTAGTGGTGTGGTTTCCTGTTTTTGGATTCTAAAGTTATGGGGAAATAAA
+GTTATTTTTGTCACGGTAATGCTCCTTTTATATGTACATAACTCATTTATATATAGATAG
+CAGGAATACTTTTATTTTTTATAGCAAATGCTATGTCCATCTGATTGATGAATTAGAAAA
+AATCGGCTGATTAGATTAATGCTCAAATAGTACTATTTTTATTTTCCAGAAACTTTCAAA
+AAATGTCCTTTTCGCTCAGGAGGAGCCTTGCTGTTCTGGCATTGAAATGGAGCGTGAGCT
+GATCGTTGAGCGTACCAGCGCCGGGCTGGCAGCGGCAAGGGAGCAGGGGCAAATTGGTGG
+CCGACGACCGAAACTAACAACGGAACAATGGGCGCAGCCGGGCGCCTCATTAGGGCCGGA
+GTACCGTGACAGCAGGTAGCGATTATTTATGATGTTGGCGTTTCGACGTTGTACAGAAAA
+TTTCCGGCGAGTAACATGCCTTTGATGCCATTCATGGGAAAATAACACTCCTTTAATCAG
+CCATAAGAGTTAATTATATAAACTTAAATGGATTTGTTAATTGAATTTCATCAAGATTAA
+CTCTATATAAAAGATTTATTGTCTTTGTTATGGCGTCTATATATTCTGCGCTATTCATTA
+TAGCAGTGTATTTATCGTATGCTTCGAAGCAATGATTTTCATTGATATATTCACTGCTAT
+TGTTTTTATAAATTTCATATGACTCTTCCTTTTTGAAAATGCGCGCATCCAGCCAAGGGT
+CAAGTATATATTCCGATATTCCTTTTGAATCAGTAAAAGTCAAAAAAACGACCACATGAT
+TCCCTCCTGACGCGCTATTATACATAAGGGATGTGCTTATTCTGGCATCAAATACATTAT
+TTTTCGAAAATCCTATTCCGGTTAGTCTTTGTGGTATATATTTTGCAATAATCGCACCTA
+AAATTAGCGACATATCAGCACAGTTCCCTGTGTTATATTTTATTGAATCAATGGAAGAAT
+ATATTAGACTCAGAGATATTGGGTTTTCTGGTCTTTCAGCCATAGCTCTGTCAAAAGAGT
+TTGCTTTTATAGTTTGCAGAAATTTCTTGTGATGTTCTCTTTGTAAATTAAGAGCGTCGT
+ATTTTTCCTGCGTATCAATTTTAAGCCTGTCAATTTGCATAGCATCATAACTGTCCGATT
+TCTTTATTATTGTTCTGACAAAAACGGTACATTCTGAAGCAGCATTAATAATACAGGAGG
+ATAAATCAACTGAAGTACTCTGTTGGTTGTTACAGGCGCTCACTCCAGTTGTGTCGAATT
+TTTCTGTAGCTACATGTCCAACATTTATAATCAATTACATTTCCCTGTATTCAAAATTAA
+GCGATATTCTTATGTCACGACAACCTAACAGGGACTGACTACAAAGATCTTTAAAGAAAC
+GTTCATTATTGTATCTATTGATGAACTCCCTTCAGATTTAGAGGTTGTGCCCATGGTCGA
+AAAGCTCCTCTACGCTCATATACTTAACTTATCGGGGACATGGTAGGTTAGGATGTGAAA
+ACACAGGGACAGTTACTGTCACTGCGAAGGCAGCAATAAGGAGGCCTATCCTGTACGAAC
+TGTGGAAAACTATATCTTGTTCACGATCACCTGCATCGTTGACGATGCGCGATCCTGGAG
+GTTTGACGACTGCCCGGTATGATCGGTGCCGCAGCCACGTCGTATGCAGGAACGGCCTGC
+GGCAAACTGGCGATCGTTCGATAGTGCGAATATTGAATGGTTGCCAGTCGCGGCGGATTC
+TACTGGTTAAGAATGGCTAATCAATGTGTTTAATCTGAAACCAGGCATCTGTTCAACTTT
+TCGTGATCGCTTTTGTTGGCATCACTATTAAGCCTTCGTCTACATGGGCATTTGGCATCG
+GGAGGCCACCAGTGGAAGAGGTCGAGTGATATATTGGGCAGTGAGTTTGATTGGTCGGGG
+GATTTATACGCAAAATGGTTCGAAATATGTCAGAATTAAAACGTAAAAAGTGATAACTAA
+TTGAATCTATTAGAATCAAAAATAACGTATTCTAATCGTTAAAATCACTTAATTAATATG
+TAACATTGTGAATTTAAAGAGAAAGATCAATTGTTGCCGTAAACAGGAATCGTATTCTGT
+CCCTTTTTTTCTTATAAATCAGTTGCTTATGATCAATAATCCAAAGTTTCCGAAATTTTC
+CAGAATTTCTGTATTCCGGGCTTTTTCGTTATATCAGATCCAAATCCAGTTTAACATTTC
+TTTTACAGCAAAAGCAGAGCATCACGTAAGCTTTATTATCGCGTTCATCGAGATAGAGTT
+TCGTGGTGTTCTCGGAAGTATGTCCCAGGAGTTTCTGAGCAAACCCTTCCCCGTAAGCAT
+CTTTATATAGTCGTCCGGATAAGCTGCGGATCTCGTGAAATGTCGGTGGGTTATCACTAA
+ATTTATTCCGGTAAATTTTCGTGCCGCAACAAATTTTTTAGTCAGGCTGTCAGGATGAAT
+ACTCCCATTCGGGCGGTTTTTGCGTATGCCAGCGCTGATAAGGTATTCGCTACGGCTTAC
+CAGGCGGCAACGATCAATCACCGTACTGAGGCGTAAACCCATGGAAGGAGGGGTGAGCGA
+AAGTGGCAGAGCGATTTTCATCTCGGTCTTGATTTGCTTAACGTACAGTCGCTCATCAAT
+AATGTGGCTGAACTGAGACTGTAATTAAAATTGTGTAATTGCCTGTTTTTGATATGTTCA
+CTCCAGTAACGGAGACAGGCAATTATGGACGAAAAGAAACTCAAAGCCCTTGCGGTTGAA
+CTGGCTAAAGGCCTTAATACCGAAGCCGACCTCAATCCGTTTTCCCGTATGCTGACGAAA
+TTAACCGTCGAAACGGCGCTCAATGCGGAGCTGGCTGACCACCCCGGGTATGAGAAAAAT
+GCGCCCAAAACAGGCTCAAACACCCGCAATGGCTACTCGTCCAAAACGGTGTTGTGCGAT
+GACGGCGAGATAGAACTGAACACGCCGCGTGACCGTGAAAATACCTTCGAACCGCAGCTG
+ATTAAGAAGCACCAGACGCGCATTACGCAGATGGACAGCCAAATTTTATCCCTCTACGCC
+AAAGGCATGACTACCCGCGAAATCGTCGCCACCTTCAAAGAGATGTACGACGCCAATGTG
+TCACCCTCGCTGATATCTAAAGTCACCGACGCCGTAAAAGAGCAGGTCACTGAGAGGCAA
+AACCGGCAACCGGATGCGCTGTACCCCATTGTTTATATGGACTGCATTGTCGTCAAAGTC
+CGTCAGAATGGCAGCGTAATCAACAAAGCCGTCTTCCTGGCACTGGGTATCAACACCGAA
+GGCCAGAAAGAGTTACTGGGTATATGGCTGGCCGAAAATGAAGGCGAAAAGTTCTGGCTA
+AGCGTGCTGACGGAGCTGAAAACCCGGGGCGTTCAGGACATCCTGATTGCCTGTGTGGAT
+GGTCTGAAGGGCTTCCCGGATGCGATAAACAGCGTCTTCCCGCAAACCCATATCCAGCTG
+TGCATTATCCATATGGTGCGTAACAGCCTGAAATACGTAGCCTGGAAAGACTACAAAGCC
+GTCACCAGCGGCCGGAAGATGGTCTATCAGGCCCCGACCGAAGAGGCGGCACTGATGGCG
+ATGGATGCGTTCGCGAAAGCCCGGGACGATAAATATCCGCAAATCAGCAAAAGCTGGCGT
+GCGCACTGGGAAAACCTCAATACGCTCTTCAGTTATCCGCCGGATATCCGCAAGGCCATC
+TACACGACAAACACAATCGAATCCTTGAACAGCGTGATCCGTGCCGCGATTAAGAAACGC
+AAGGTGTTCCCGACGGATGACTCAGTACGAAAAGTTATTTATCTGGCAATCAAGGATGCG
+TCAAAAAATGGAGTATGCCGATCCAGAACTGGTGGCTGGCGATGAGCCGTTTTATTATCG
+AGTTCGGTGACCGCCTGAGCGATCACCTTTAATAACTGGGCAGTTACACAGAATTACTGA
+CAGGCTCATTCTTTTGTGTTGCGCATCTCTGTTTCTATTGTTTTAGATAGCCATGAGAGC
+TCTGTTGCTGAGAGTTTTAGTCGTGGGGTTCTTTCTTCTGTACCGGGTGGTCGCATTTCA
+AAACTGCAGGAACATCTGCTGAATACTGTATACTCCTGTATTTTGCATGTTGTTGAGATC
+AGTGTGCAATTCCTCGGTACTGGCTTGTTCTGTATAGGTCTGGAGATTTCTGGGTAGTGT
+CCTTGTGGACCTGAACATATGTTTTTGATTGAAAATGGCATCGTGTTTTATCCTTTACGC
+TGTGAAATGTTGTTTTGTGCTCTTCTGTTGTGATTGGTGATGTGACGGGATCGTCCATGC
+ACCCTTCCTTTTATTGACGGCGTATCAGTCCATTGATGCCATGCTCGCTTAATTTGTCCA
+GCATCAGCAAGCCGTCGTTTTCTTTCTGCTGCAATTCAAGCAACTTAAACCGTATTTCGT
+TAAGTAAAGGTTTAATAACTCCGCGCTTGCGAACCACCTTTCTGATAACGTCTTTTTCGA
+AGTATAAACGGCAGAAGTGATTTTCATAATTCGCCTACACTCTTCACCCTGCGCTGGCAA
+ATCTTCAACGCTGAAAGGCTGGGGAGAAGGGCGTCCAGTTGCTGAACGGAGAGCGAACCA
+TACGCCCTGATTCCACGTGTTATCAAACTTCATACCGTGGTTATCATCCAGACAAGGCGC
+TTGAGGTTGCTCATGTCTTTTGGGGAAAGAGGTTCGGTGGTGGGTACTGGATATCCTGGA
+TCGGGAAGTGGGTTCCACTGGTGCCAAATACAGGGGGCTGGTAAACCGGGTGGATACCTC
+AAATCCTGACAGGCCAGAGCACCAGCCTGATAAAATCGTATTACTGATTTCTAACCAGTG
+GCACATTAATTGTACCGGCTCAGACTCCAGCTGACAGTCTGCTTTAAGCTGTGAGTAGCG
+GACGTGGCCTGCCCCCAGGAGTAAAAACAAACTTTCTATTGATACATTTAATTAACTTAT
+TTATAACGTTATATTCCAAATGCAAACTTGTTCAATTGGATATGTATGAACATTCAAATC
+ACACATCAAGTTACTGAATTTGATAAAGAAGAACTATTAGCCGGATTAAGAAGCTACAAT
+GCTCAGTTCGTCGATTTTAGTAAAAATGGGCAGCTTGGGGTCTACTGCAGAAACGAAAGC
+GGCGAAATGGTAGGCGGATTAATTGCTGACAGAAAAGGTCCGTGGCTCTGCATCGACTAT
+CTTTGGGTAAGTGAATCTGCAAGGAACTGCGGTCTGGGGAGCAAACTTATGGCGATGGCC
+GAAAAAGAAGGTTTGCGGAAAGGCTGTGTTCATGGACTTGTAGATACCTTTAGCTTCCAG
+GCTCTCCCTTTTTATGAAAAACAGGGTTATATACTTCAAATGTCGCTACCGGACTTTCCT
+AAAGTAGGTTCGCAAAGGCATTATTTAATTAAGCTCGGTTTATAGCTTTGCTGCATTTGA
+ATACCCATAGCTTTATGAAAGCTGTAATCAGGTAGCTTTAAAATATATCGTACCGTTGGC
+CTGTACACACCATGATCAGCGTCCGCTTCTGGCACAGGGCGGACAGTCAGATTAGGTTTG
+GCTGTCAGCTCACATTTGAGCTAATACCCCCTGGCACGGCTAGAGATACTCAGACAGCCG
+CTTGTAGGCGGCATGGTACGGATACAAAAACATATTGCGCTGTTATATAAACTGTAAACT
+GGGCTGTGCGTATAATACGAATCTTTCACTCAGAGAAACCTGCTGACAGCGTTAGTACTC
+CATTAATTAATTTTGTACTAAATCTCTGTGGTATGGCACAGGCGTTTAGAAGACAGGTCA
+ATTGCGATCTGCTAGCTGGGATTTCGTCGCGCCGCTCAAAAATGCACAGAGTTTTTCACC
+CGCCGTCAATGGCTCAATGGGCGTTTTTCCGAGGGCGGTCTCAGTCATGACGATGGCAGG
+ACCAATAAGCATGGACCATACTTCACTCGCGTCTTGCTCAAGCGATGTGAAGGCAAGGAA
+CAGTGTTTTATCTGAAGGAAAGCGGTGCTGAGTATTAAAAAGTTTCAGCCAGGCGCGGGA
+CTGCCGGTCGGCCTGTGCTGATCGCGTGCCGAAGCGGAGTACTCTTTTTAGTATGGCGAT
+ACCCACAATGCCTGGCCCCAGAATAAAGGGACTCCCGACGTTTATGGTGACGCCGACCCC
+GAGAAAAACGAGGGCGAATGACAGCACGTTATCTACTCTTCTGGCAAGAGTACTGTATAG
+CTTTTCCAGAGAGTACCGGTAAAGAATTTGATAACTGATTTCATCCTTGCTCATACATCT
+CCAGATGTTTTTTCGATTACGCTCCGGTATGCTCCCGGAATCCTGACAGATTCTGCAATT
+ATGCCACACTTCCTGGAGGGTATTAATTAGATAGAATATAAATAGAAGGCAAATATTTTG
+AGCTTTTAGTCGATATCGCTTTGAATATCATTTCTCCTGCACCAGGAGATGCTGTTGTCG
+AGAATCGTGTCAAACGTTGCTGCGTCGGTCGGACTGCACAGGGTAACTCTCGCAGTCAGA
+CTCTCATTATGGTCTCTAAATTGGATAACCCGCAGTCGTAACACGCCGGATGTCACGACT
+GACGCTATTATTACCCTGGCTTGTTAAAGCGGCATGACCACATTTTCTATATATAATAAT
+TGGTTGTCTTTCGACCAGTATTGTCGAGTTTTTTGGTTTAATTCAACAATCCATTTAAAA
+ACGCCTGCCGTTGCCAGATCAGTACAGTATTTTTCATAGGAATGCTCCCCCGAAAAGTGT
+TTAGCTGAAATCAATTTTATTAATTGCGTATTCGGTGTTGAATTGACTTTAATCAGCTTT
+CTATTGCTTTTAATAGAAATGAAGTGGCCTGCATGAGTGATAATTTTCACATTGCCGGTA
+GCAACAAAATAGATGTAATAAGCGATATTATTATATTCCAGATCGATTAGAAATGCGTTG
+AAATTTGCATCCTTTCTGACGCGCTCGAAAAAGTGGTTAAGCATAAGCTGTAATTCCATT
+TGTTAACCTATTGTAAGTTATAATGTTATATGTTGTGTTAGAGTATTGTTGCTTAAAAGC
+AGCCATACAGATATGTTACCTAAAAGCAATAATAATCACCTGGTATCATATAGTTTACGT
+TATGATTGGAATAGTGTTGCAATTGTTACTGATTATTTCTCGTAGCGCGTTTTTTTGACC
+ACTAATAGATGCGTCAATCCATTTCATTTGTAGTTTTTCTGAACGTCATGAAAAGTCATA
+ATATATAAAAATCAGTTAATTAATTGATGTTTAGATAAGGATTACAGTGACGGAGAGATT
+TGGCGTGGCGACTTTATAGGTTTTGAAAAAGCGGCTAACTCGCTGGCAGGATAATTGGTA
+GCCAGCCTGCGAATGGGGGCAAAATCGTAACAACATCAGCATAAATAATAATATTCATGA
+ATGTTTTATGTGACGCAGTAGTTGAATTGAAGTGATGTTTTACCTGTTCAGGATTGTCCC
+GATAAAAATGTTCCTCGATAAAAGTCGATCACCTTGCGCCGAAAAAAAACAGGCTAAGTG
+ACAGAAGAACAAAATCCATCAGGAAAATAAAATTTATAAATATCAATGAGTAAAAATGGT
+TGTGGAGAAGGTGGCTATTTTTTGAAAGCAAGAAATATAAACAAAGTGTAGCTATGCATA
+GTTATCTAAAAGGAGAACTACCGTGACTAACATAACACTATCCACCCAGCACTACAGAAT
+CCATAGAAGTGACGTTGAACCAGTAAAAGAAAAAACAACGGAGAAGGACATTTTTGCAAA
+AAGTATTACTGCCGTTAGAAATAGCTTTATCAGCCTGTCGACGAGTCTGTCAGATCGTTT
+TAGCCTGCATCAACAAACAGACATACCGACTACCCATTTTCATCGTGGGAACGCTTCTGA
+GGGTAGGGCGGTATTAACCAGTAAAACTGTTAAAGATTTTATGCTGCAAAAGCTCAATAG
+TCTGGATATCAAAGGTAATGCGAGTAAAGATCCGGCCTATGCTCGTCAGACATGCGAAGC
+CATATTATCAGCCGTGTACAGTAATAATAAAGATCAATGTTGTAAATTACTCATCAGTAA
+AGGGGTCAGTATTACCCCCTTTTTGAAAGAGATAGGAGAGGCTGCGCAGAATGCGGAGCT
+ACCTGGGGAGATAAAAAATGGCGTATTTACTCCAGGTGGGGCAGGGGCGAATCCTTTTGT
+CGTCCCCCTCATTGCTTCCGCGAGTATTAAATATCCGCATATGTTTATAAATCATAATCA
+GCAGGTATCTTTTAAAGCGTATGCTGAGAAAATCGTTATGAAAGAGGTTACGCCGCTGTT
+TAATAAGGGGACGATGCCAACGCCACAACAATTTCAGTTAACTATAGAAAATATTGCGAA
+TAAGTATCTTCAGAATGCCTCCTGATGGTAGTAAATACAATACTGCTATTAACCATATGA
+ATTAATAGCAGATTTTCTGAAACTATATATTCGTTTTTATGGCGACGCTTTTAACAAAAC
+GTCGTCATCTTTATTTTAATATAAAAATCAAATGGATAACCTTAAAACTTAAAATAATTG
+TTATTACTCTAAATACCTGCACAACCAGACAGCTTTTTTTGTAACGCTGCGTGTTGTTAA
+GTCTATGATACCCGCGCACGGATGATGTCTCGATAAGGATTAATGGTCTGTTAACTGTCA
+GGAGAGGTTATGCCGCCTTTAAAAAAAATTGTGCTGCGCCTGTTTGTGGGGGCGATGGTC
+GCCACGGTAACGACACCTGCATTGGCGCTGGTTTGCCTTGAGGATCACTCCGCTAAAGAG
+TGTGCTATATCGTGTGCTGAGGCGATGTGGTTTATGTTTCCGATATGTTTTTAAGGAGGA
+AGAGTATTGAAGGTGAACAGGCGATAGTGAGTAGCTCGCTGCGCCAGGGGATAACCCTCC
+CCTGGCGCAGCCAGTTATATTTTATTGCGATGATAACAAAGCATTTACTCGCTAATGGTG
+AAATTCGCTATTTACAACAGCGCACGCTTACTAAGCAAAAAAATCTGCACACGCTATCTT
+TTTATATCTGTCCTGGATAATGAACGACAGGAAAAACATGATGCGGCCTGAAGAGATTTA
+TCAGCGAATAGAGGCAAAGAATTGGCGGCATGTCTGGGTGGTTGGCGATATTCACGGCTG
+TTTTTCAATGTTAATGAAAAGGTTACGTGAGTGTCGATTTGATCCGCAACAAGACTTGTT
+AGTTTCTGTGGGCGATCTCATTGATAGAGGCCCGGACAGCTTGGGTTGCCTGGCTTTACT
+GCGTGAGTCCTGGATGATGGCGGTTCGCGGCAATCATGAACAAATGGCGCTGGATGCGCG
+GGCCTCATTGCAGTCGACGCTGTGGTTGATGAATGGTGGCGACTGGTTTACCCGCCTGAC
+CGCTGAACACGCTGCGCAAGCTGAAGCGCTTTTTATCCTTTGTCAGCGGCTGCCCTGGAT
+ACTGGAAGTTCGCTGCCGCCATAGCACGCATGTGATCGCTCATGCTGATTACCCCGCGTC
+AACCTATCAATGGCAAAGAAAAGTCGATTTACATCAGGTTCTCTGGAGTCGCGAACGGCT
+CATAAATAAGCGCGGCGGGATTAGCGGAGCCGATCATTTTTGGTTTGGCCATACGCCGTT
+GCGCCGGCGCATGGATTTTGCCAACGTACACTATATTGATACGGGCGCGGTATTTGGCGG
+GCAATTGACGTTAGCGCGGATACAATAGCGGTATCAGCGCCCAGGGTTAAAAATCGCTAT
+ATTGCTGCGCAGGCCGCCAGAAGCCATCGATAAAATCCTCTACCGGAAAACAGCCGCCAT
+GGCGAATCCGTTGATCGTCCATCGAATAAAGACATTGCTGCTCGGTATCGTAGATGTCCA
+CGACAATATCCTCGCATCCTCCATCCAGGTAACATACAAAAAGTACCAGCGCGAACATTA
+CATCCTCAATGTTAACTACTTTACACGATAGTGTAGGAGAGGTTAGCGCAGGGGGGAAAT
+GAGAAAAGGAAGAATAAATAACCCGCCTGGCGACGGGTTCTTTTTGAGTCAGGCAAGACG
+CATGACCCAGGCATCAGATTTAGGATCGTAATGAGTACGGAACAAAACGGAATGTTCCCC
+GTTGAGAATGGCGGGAACGCTGGTTTCGGCATCCCAGGCGTCCAGTTGCATACATAAATC
+CGGATCGGATTTACAGGGGATTGTTAACGTTCGCTCCCCCGGCGATTCGCCATGTAATTC
+GGCATCGTCGATTTCAAAAGCGCCAATGCGCACACTGGTTTTCATCATCGTGCTCTCCGT
+TAATACGCTAATTGTGGTACGACCAGTTTAGCCGTCCATTTTTCAGCGTAGTCAACGTAC
+GCAAAAGCGCCAGTCAAAAAGTGCGGTTTTTTTGTGCGCCTTTTAACTATTACCAGTAAA
+GAGTTTGCCATCACGTACCAGTTCACGCGGGTAACTGTTCTTTATTCTGGCGCCGATACG
+TTTTGCCAGACCAAGTGGCTGATGCTGGAACGTCACCAGGACATCATCAGCGGCAGGGGG
+TGTTTGCGGATAAATATCCCGACCGCGATACCACTCCTCCGCCTCTTGCACAGAAAGTTC
+GAACGCGTGAGCATGAGTCGGGCAGGCAAGGGCTATCGTCGCCTCATGTTGCCAGCGATA
+GCCTTTATTATGACTTTCGGCCAGCTTAATGCCGAGCCGGGAAAAACGGACTTTTCCGAT
+CAGTGATTCAATTTCTGCCGGGAACAGCCAGACCTCTTTTTCACGCTGCCAAAGATGGAG
+ATTTTCATCCCATAACAGTCCGACGGCGTTGGCCGCCTGGGTAACGTGTAATGCTTCGCG
+GCCTTTGAGGGGGGTAAAAGGAAACGCCCCCACTTTATACCCCGGCGCGGGCATGGCTGG
+AAGGGATGACATTTTACGCAGACGTGCGACGAAGAATCCTTCGCAGTCGTAAATTTGCGG
+GAAGACGTGCAGGAAGCCTTCCGGGGTGAGGGCACGGTCAGCGTCAGGAAACAGATCACC
+CAGCGGCAAAAATTCAACGGCGTCGGCGTAGGTCTCTTTCAGCCAGAGGCAGACCTCTTC
+GTTTTCCTGGCGATTTAACGTGCAGGTGGAGTAGACCAGCGTGCCGCCGGGTCGTAAAGC
+ATGAAAAGCGCTGTTGAGCAGTTCCCGCTGTGTCGCCGCGATATCCAGATTGCTTTCTGG
+CGACCAGTTTTTTAGCGCATCAGGATCTTTACGTACTACGCCTTCGCCAGAGCAGGGCGC
+ATCCAGCAGGATAGCGTCAAACATCTCCGGTAACGCAGCGCCAAATACGCGGCCATCGAA
+ATGCGTCAGTGCGGTATTGGCGATTCCACATCGGCTGATATTAGCGTGCAGAACTTTGAC
+GCGGCTGGCCGAAAATTCGTTGGCCAGAATGGCGCCGCGGTTCCCCATGCGGGCAGCGAT
+CTGCGTGGTTTTGGAGCCAGGCGCCGCTGCCATATCCATGACCCGCTGCGGATGATTATC
+ATCGGCGAACAGGGCCGCGACCGGCAGCATCGAACTGGCCTCCTGAATGTAAAACAGGCC
+GCTTAAATGCTCAGCGGTACTGCCAAGCGGCAATGCCTCTTCATCATCGCGCTCGATCCA
+GAATCCTTCATGACACCACGGAATTGGCGTGAGCGACCAGCCGTAGGGCGCGATTAGGGC
+AAGGAAATCAGCCACGGATATTTTAAGCGTATTGATGCGTATACTGCGGCGCAACGGGCG
+TTGGCAGGCCGAAATAAATTCATCAAAAGAGAGCGTGGAAGGCATTGCTTCACGCATTTG
+CGTCAGAAAAGCGTCAGGAAAATAGACAGCGTGTTGAGCCACAGGTGTATCGCCGGCAAA
+AAAACAGGCGCGCAGTGTAGCATAAAACGCTCCGGCGCGAGTACGCCGGAGCCGGGTGTT
+TAACGTGGCAGAGCGGTACCCCATTCACGCCACTCTTTCGGTTCGCTCTCTTGTAACAGG
+AAATGCTTACCGGCTTGCGCTTTTGGCGCCAGCGGCGTACCTGGTGGAGTAGCGAAGGCG
+ATACCGCCACGGATGAACTGATTAAATGTCCCCGTTTTCACCACGCCGCCTGTCAGACCA
+AAGTCGAGACTATAGCCGGAGGCAAGCCAGAATACGGAGTTATTACGCACCAGATATTGG
+TAACGCTTACTGATGCGCAAGGTGATCATCACGCGATCGGAGAGCGACCCCAGGGACATT
+CCGGTGACGGTTCCCACTTCGATACCGCGAAACAGGACGGGGGTACCAATATTAAGCGAG
+CCTGCTTCTGGCGCCTCCACGACGATGCTTAACCCATCCAGATAGCGTGAGTCGGTAATC
+GTGGCTTCCTGCAGTTCAAAGTCGCGCCGTGCCGCGCCGCGTCCTGGCTCAACGTTAATA
+TAGGGCTGGAGAATCGTATCCAGATGCTCGACGCCCGCCGCGGAAATTTGTGGCGTGATA
+ACGGAAAAACGTGTCCCGGCGCGGGCAAATGTCTGTACATACTCCGGATAAAGTACGGCT
+TTTGCCTGCACTTCATTACGTGCGGTGATCAATTCCAGCGTCTGGATCTGGCCGATATCA
+ATACCGAGGTAACGAATGGGCATCCCTTCCGCCAATTTTCCAGCGTCGAACGCGTGCAGC
+GTAATTTGTCCGCCTACCGCGCGGGCGGAAGTTTCTGAAGCATAAAGAATGCGTTTATCG
+CCTTTGCGCCGACTGGCGCTGGCGCCGCTCAGGTTATCAAAACTAATGGCCCCTTTCAGC
+GCGCGGGAGAGTGGCGAGGCCTGTACCGTTAGGCCGCTGCCGTTAAGTTGCACCTTCGCG
+CCGCCTTCCGCCCAGAACACGCTATTGCTGGTTAACAGGTGGCGATATTCCGGCTTAATA
+TGCAGGTCGATGTCAAAGGTATTGGCGCGTGGGCGAACGGTGATGACTTCGCCTACTTCA
+AATTTTCGATACAGCACGACGGAACCTGCCTGGACATCCGGCAACGTTTCGGCTGTCAGC
+GTCAGGGTGGTAGTCGGTAAGTCACTGAGACTATTTTCCAGCGCTTTTTCCAGGTTAGCA
+TAGAGCGGGTAGGTGGATTTCATCTTCCCGCTCGTACCGGGTAAAATACGAATTCCGCCG
+TCAATCCACTCGCTGGCGCTGGCGCCGAGGAACTCTACGCCGTCAAGGCCGACTTTGACA
+TCCACCCGGCTGTTGACCACGAATTTACTGTCGCCCTGTACCAAATCCCGGTGCTGCGGT
+TCAATCGCGACGGTGAATGACACGCCTTTACTGGATAAGTTGCGCTCAATGACCTGGCCA
+ATTTTTACGCCATGTAAAATTAACGGCTGGCCCGGTTCGATGCCGTAACTTTCCGGGGCC
+GTCAGCGTCAGGGTTAAGGCATTCGCCTCATGCAGCAGGGCCTTTTCACCCGGCACCACC
+ACAAATTCACTGCGCGGTTCGCCGTCGCCCGGCACCAGCTCGAAGGTTTTTCCGGTTAAC
+AACGAACTGATATTCGCGTCGCTCAGCGACAGTTTGGGATTGCGTAACTCAATACGCGTA
+TTTTCCCGCATCAGCGGAACAACGCTGGGATCGACGGTCATCTCTCCGGTGACTTTACCG
+CCAGGGTTGAGCGTCAGTTTAGAAAGCTCACCCACCTCCAGTCCCTGGTACATGAGCGGC
+GTAGATTCCGCTTTCAGACCGTCTCCGCTGGGCAGCTCAAGTTTAACGATTACCCCTCGT
+TGGCTGTGGGCTAAATCTTTATATAAGCCGAACGTGTCATCCTGGGCGGCGGGTTTGGAA
+TTGTCCGGTGAGTCAAACGCAATCGCGCCATTGACCAGGGCCGCGAGGCTCTCCAGTTTC
+ACCTTCGCGCCGCTCAGGCTTAGATCGGCGTCAATGCCGGAGACATTCCAAAAACGGCTG
+CCTTTTTTCACCAGATCGGTAAACCGTCGCTCAATCAGAACGTCAATCGTCACGCCCTGT
+TTGTTAGGGTTAATCGAATAGTCATACACCCGTCCGACAGGGATTTTACGGAAATAGACC
+AGTGAACCGCTATTAAGCGAACCGAGATCCGGCGCATTGAGATGAATCATCAGATCGCCG
+TTGCTAAGCCGGTATTTAGGCTGTGTATCCAGGGCGACGAAATGATCTCTGGGCTTGCCT
+TTACCTGGCATCATACCGATGTAATTCCCGCCGACCAACGCATCCAGGCCGGAAACGCCC
+GCCAGCGAGGCTTTGGGCGTCACCAGCCAGAATTGCGTCTCTTCGCGCAACGCATCTTCC
+ATATCTGATTTGATACTGACGCGAACTTCAATTTTGCGCAGATCTTTGCTCAGACTGACA
+TCTTCCACGGTGCCGACTTCTACTCCCTGATAACGCACGGGAGTACGGCCCGGTACGATA
+CCGTCCGCCGACATAAAATCGATAGTCACGCTATTGCCGCGATCCTGGTAGCTATCCCAT
+ACCAGCCACCCCGCGATCATTAGCGCGATAAGCGGTAGCAGCCAGAAAGGTGAAATACGG
+CGTTTGGTTTTAATTTGCGCTTCAGTCTTCGAAGCGGGCGTTTCCTGACTCATGTGCATC
+CCAAAGTAAGCGGCTATCCAGCCATTCCACTGCAAGAATAGTCAAAATTACCGCTGCGCC
+GAAATAAAACGCAGCCGGTCCCATAGTAAAAGCCAGAATCTGATCGCGATTAATCAGAGA
+CATGGTTAACGAGATAACGAAAAGATCCAGCATCGACCAACGGCCTATCCATGTCACCAG
+ACGCAGCAACAGAATTCGCGTCCGCAGTCCCTGTTGGCATTTAAAATGGATACTCAACAG
+TAGCGTAAACATCACGATGACTTTGGTAAACGGCACCAAAATACTGGCGATAAAAACGAC
+GGCGGCGACGGCGATATTGCTGCTGGCAAGCGACATAATGCCCGACAGGATAGTATCTTC
+CTGACGCCCGCCATTAATGTAGATTACCGAGATAGGCAGCAGGTTTGCCGGCAGCAAAAA
+GACAATAGACGCCAGCAAGGCCGCCCAACACTTCTGTATGCTCTGTTTTCTGCGTAACCG
+TAGCGGAATATGACAACGCGGGCAGCGTCCTTTCGCATCCGGATAGCCGCTAAAGTGGCA
+GCCAAGACAGACGCGCAATCTTTCGTCCGCACGTTGAGCAGGGCGCTGCGGATAAAATCG
+TTCCCATAGTTGCTCCACATTCAGATGAATCATAGTCAGAATGCTAAGAACCACCAACGA
+GACGAACGCTAAAAGCCCGATGCCCGGCTGCAGAAAGGCATAGTCCTGCACTTTGATAGA
+GGCAACGCCAATACCGACCAGATAGATGTCCAGCATCACCCACTCTTTCAGTTTTTCCAG
+CATCAGCAGGACTGGACGCAGATTCATGCCGAGGAGGCTGCCAAACCACAGGTAAGCAAT
+TGAAAAAACCAGAATAAGCGGCGCGCCCACCACGCAAAAGAGCACCATTGCGGCGGTTAA
+CGGATCGCCCTGCTGCGTCATTTGCCAGATGCCGTGCATCACATTGGCATCAATGCGTAC
+GCCCAACAGGTAGATATGGAGTAACGGTTCGCTCCAGGCAAACGGCATCAATAGCAGCAT
+GGTTACCGCCATCGCGGTCAGCCGCGTCAGCGACCAGTCGCGCCCATCGCGAATTTTGGC
+CTGGCAACGAGGACAATAAGCGCTTTGATGAGCGCTCATCTCCGGCAAGCTGAACAGCAT
+GTCGCATTCAGGGCAGCGCTGGTAGTGGCTGCGCGGCAGCGCTTCGCTAATTGACCTGAT
+CGTTAGCTTTTTTGTTGGCGTGACGTGTGAGGTGTTCAGAGCCATGTATCGTGAATCAAA
+GTGTTAGAATAATGTAATCTTAACTCATGACAGGAATAATCTTGAGCAAGAACGCATTTA
+ATGCTTATTTTAATAGCCTGTGTTTAGGAGTAAGACCACGAAGTGATTATATAATGAGCA
+AAACAGAACTATACGCGGCGTTAAACCGCGATTTTCAGTCGTTAATGGCAGGTGAAACCA
+GCTTTCTGGCCACGCTGGCGAATACCAGCGCGCTACTGTTCGAACGCCTTACCGAGGTGA
+ACTGGGCGGGATTTTATCTCCTCGAAGGCGATACGCTGGTGTTGGGGCCGTTTCAGGGGC
+GAATCGCCTGTGTGCGGATTCCGGTTGGTCGCGGCGTGTGTGGCGCAGCGGTAGCGCAGA
+ATAAGGTTCAACGTATTGATGATGTTCATGCGTTTGACGGCCATATTGCCTGTGATGCCG
+CCAGCAACGCCGAAATTGTGCTGCCTGTCACGGTTGGCGAACGGATTATCGGCGTGCTGG
+ATATAGATAGCACAGCGTTTGGCCGTTTTACCGAAGAAGATGAACACGGCCTGCGTACGC
+TGGTCGCACAGCTTGAAACCGTGCTTGCAACGACGGATTACAAAAAATTCTTTGCGAGCG
+TTGCAGGATAATCAACGGATAACGTAGCAATTACTGATGGCGTCATTATAATGACGCCTG
+TTCATGCCTGCTGCTTGTTGGCTACGTCCGTTGTAATCAGGAAATTTCATGGAAAATCAA
+CCTAAGTTGAATAGCAGTAAAGAAGTTATCGCGTTTCTGGCCGAGCGTTTTCCTCACTGT
+TTTAGTGCGGAAGGCGAAGCTCGCCCGCTGAAAATTGGTATTTTTCAGGATCTGGTAGAG
+CGAGTTGGGGGCGAAATGAACCTCAGCAAAACGCAACTTCGTTCCGCTTTACGTCTTTAT
+ACTTCAAGCTGGCGTTACCTGTACGGCGTTAAGCCGGGCGCAACGCGCGTCGACCTTGAT
+GGCAATCCGTGCGGCGAGCTGGAAGAACAGCATGTCGAACATGCGCGTAAGCAGCTTGAA
+GAAGCCAAAGCCCGTGTTCAGGCGCAGCGCGCAGAGCAGCAAGCGAAAAAACGCGAAGCT
+GCCGCGGCGGCTGGCGAAAAAGAAGACGCGCCGCGACGCGAGCGTAAACCTCGCCCGGTA
+GCGCGTCGTAAAGAAGGCGCTGAACGTAAACCTCGCGCTGATAAACCGACGACGAAAGCG
+CCGCGTGCGCCTCGCGAAGAGAAGCACACGCCGGTTTCTGATATTTCAGTATTGACCGTA
+GGGCAGTCCCTCAAGGTGAAAGCGGGTAATAATGCGATGGATGCCACCGTATTAGAAATC
+ACCAAAGATGGTGTCCGTGTACAGCTGAATTCGGGTATGTCTTTGATTGTACGCGCAGAA
+CACCTGGTGTTCTGAAACGGAGGCCAGGCCTGGCATGAACACTTTTTTTAGGCTTACCGC
+GTTAGCTGGCCTGCTTGCATTAGCAGGCCAGTCCTTCGCCGTGGAAGATATTACGCGTGC
+CGATCAAATTCCCGTACTAAAGGAAGAGACGCAACATGCGACGGTGAGCGAGCGCGTAAC
+GTCGCGTTTTACCCGCTCCCACTATCGCCAGTTCGATCTGGATGAGGCATTTTCGGCAAA
+GATCTTTGATCGCTATCTGAATCTTCTCGACTATAGCCACAACGTTTTGTTGGCGAGCGA
+TGTCGAGCAGTTTGCGAAAAAGAAAACCGTGTTGGGCGATGAGCTGCGCACGGGTAAGCT
+GGATGTTTTTTACGATCTTTATAACCTGGCGCAAAAGCGCCGGTTTGAACGTTACCAGTA
+CGCGCTAAAAGTGCTGGAACGGCCAATGGATTTCACCGGAAACGATACGTTTAACCTGGA
+CCGCAGTAAAGCGCCCTGGCCGAAAGATGAGGCTGAGCTAAATGCGCTGTGGGATGGTAA
+AGTGAAATTCGATGAGCTCAGTCTGAAACTCACCGGCAAGAGCGACAAAGAAATTCGCGA
+AACGCTGACGCGTCGCTACAAATTCGCTATTCGCCGCCTGGCGCAGACCAACAGTGAAGA
+TGTGTTCTCGCTGGCGATGACCGCTTTTGCGCGTGAAATCGACCCGCATACGAATTATCT
+TTCTCCCCGCAATACCGAGCAGTTTAATACCGAAATGAGCCTGTCTCTGGAAGGTATCGG
+CGCGGTGCTGCAAATGGATGACGATTACACTGTCATTAACTCATTGGTCGCCGGCGGCCC
+AGCAGCGAAGAGCAAGTCGATTAGCGTCGGCGATCGTATCGTCGGCGTAGGGCAGGCCGG
+AAAACCGATGGTCGACGTCATTGGCTGGCGTCTTGACGATGTGGTGGCGCTGATCAAAGG
+GCCAAAAGGCAGCAAGGTCCGACTGGAAATACTGCCGGCTGGTAAAGGGACGAAAACGCG
+TATCATCACGCTGACGCGTGAACGGATTCGTCTTGAAGATCGCGCGGTTAAAATGTCGGT
+GAAAACCGTCGGCAAGGAAAAAGTTGGCGTACTGGATATTCCAGGCTTCTATGTTGGCTT
+GACCGATGATGTCAAAGTTCAGCTTCAGAAGCTGGAAAAACAGAATGTTAACAGCATCGT
+TATCGATCTGCGTTCAAACGGCGGTGGGGCGCTGACGGAAGCCGTTTCGCTTTCCGGTCT
+GTTTATCCCTTCTGGTCCGATAGTTCAGGTGCGCGACAATAACGGCAAAGTGCGTGAGGA
+TAGCGACACCGACGGCGTGGTCTACTACAAAGGCCCGCTGGTGGTGCTGGTCGATCGTTT
+CAGTGCCTCGGCATCGGAAATCTTCGCTGCCGCGATGCAGGATTATGGTCGCGCGCTGAT
+TGTCGGTGAGCCGACCTTCGGTAAAGGGACGGTACAGCAATATCGTTCGCTAAACCGAAT
+TTACGATCAGATGCTTCGCCCGGAATGGCCTGCGCTGGGTTCGGTGCAGTACACCATTCA
+GAAGTTTTACCGTGTCAACGGCGGTAGTACGCAGCGTAAAGGGGTCACGCCGGATATCAT
+CATGCCGACTGGCAATGAAGAGACGGAAACCGGAGAAAAATTTGAAGATAACGCCTTGCC
+GTGGGATAGCATTGATGCGGCGAAATACGTGAAATCGGACGATTTGGCCCCGTTTGGCCC
+GGAATTATTGAAAGAACACAACGCGCGTATCGCCAAAGATCCTGAGTTTCAGTACATCAT
+GAAGGATATTGCACGTTTCAATGCCATGAAGGATAAGCGCAACATCGTCTCTCTGAATTA
+TGCGCAGCGTGAGAAAGAGAACAATGAAGAAGACGCTCTGCGTCTGGCGCGTATTAACGA
+TCGGTTTAAACGTGAGGGTAAACCGTTGCTGAAGAAACTGGACGATCTGCCAAAGGATTA
+CCAGGAGCCGGACCCGTACCTTGATGAAACGGTGAAGATTGCTCTGGACCTGGCGCATCT
+TGAAAAAGAAAAACCAGCGGAGCAGGCGGCAGCCAATAAGTAACGCTAAACAGGCACAAA
+AAATTGTGCCTGTTTTTTTTTAACAAGCGCAGAAGTCGTCAGGATAATGCTACAAAATGT
+AAAGTTGTGTTTTTCTCGTGACTTACCGCCTGGTGATGCTTGAAAATAGCCATAAGACCC
+ATACGATGTGGGTAATCGCATAGTGCGCTTTGTTAAATTGAGGTTAAAAGAAAATTATGA
+TGCGAATCGCGCTCTTCCTGCTGACGAACCTGGCCGTGATGGTCGTTTTCGGGCTGGTTC
+TGAGCCTGACAGGGATACAGTCGAGCAGCGTGCAAGGCTTGCTGATCATGGCGCTGCTGT
+TTGGTTTTGGCGGTTCTTTTATTTCATTGCTGATGTCCAAATGGATGGCGTTAAAATCCG
+TAGGAGGGGAAGTTATTGAACAGCCTCGCAATGAAAGAGAACGCTGGTTGATGAACACCG
+TAGCAACGCAAGCGCGCCAGGCCGGTATCGCCATGCCGCAGGTTGCTATCTACCATGCGC
+CGGACATTAACGCGTTTGCGACGGGCGCACGCCGTGACGCCTCATTGGTCGCTGTGAGCA
+CCGGTTTGTTGCAAAACATGAGCCCTGACGAAGCGGAAGCCGTCATTGCGCATGAAATCA
+GCCATATTGCCAATGGCGATATGGTGACGATGACGTTGATTCAGGGGGTGGTTAACACCT
+TCGTTATCTTTATTTCGCGCATTATCGCGCAAATTGCTGCTGGTTTTCTGGGCGGCAACC
+GCGATGAAGGCGAAGGAAGTAACGGTAATCCGCTAATCTATTTCGCCGTTGCGACGGTGC
+TGGAACTGGTCTTCGGTATTCTGGCGAGCATCATCACCATGTGGTTCTCCCGTTACCGTG
+AGTTTCATGCCGATGCGGGATCGGCGAAGCTGGTTGGCCGTGAAAAAATGATTGCCGCGT
+TGCAGCGCCTGAAAACCAGCTACGAGCCGCAAGAAGCGACCAGCATGATGGCGTTTTGTA
+TTAACGGTAAATCGAAATCGTTAAGCGAGCTGTTTATGACGCACCCACCGCTGGATAAAC
+GCATTGAAGCGCTGCGTAGCGGTGAGTACCTGAAATAATAAGCCCACTGGCAAGTATGAA
+AAGCGCGTCGAATGACGCGCTTTTTTTACGCCTGAACGCGTGGTTGCGTAATACGTAAAC
+CGCTCACCACCGCCGCGAGAGTCGCCAGGATCGCCGCTGCGAGCAGAGAAAGATGCGTAC
+CGCTATCGCCAAACTGGTTCAACATCAGCGCTACCAGCGCGGCGCCAGTACTTTGGCCTA
+ACAGTCGCGCCGTGCCCAGCATCCCGCTGGCGCCACCGCTGCGCTCACGCGGCGCGGAAG
+TGATAATGGTGTGATTATTCGGCGACTGGAACAGGCCAAACCCTGCGCCACAAAGGATCA
+TCGGCCAGATAATATTCAGATCGGAGGGGGAGGCTGGCAACATGACCAGCGCAAACAACC
+CGGCTGCCATTATCACCATTCCCAGCGCCCCCAGCAAACCGGCATGAAGACGTTCTATCA
+GGTATCCCGCCAGCGGCGCCATTACCATCGTTGCCAGCGGCCAGGGCGTCAATAACAGGC
+CGGTTTCTACTTCGCTACGGCCCAGCACGGTTTGCAGATAAAAAGGTAGCGAGACCATGG
+CTAACATTTGCGCGCAGAACGAGCAAATTGACGTGCCGATCGAGAGTGAAAAAAGCGGAA
+TGCGTAACAAGTCGATGGGTAACAAAGGGACGGGCAAAGAAAGCTGGCGGCGCACGAAGA
+AAAACCCGACCACGACCAGAACGAGCAGCTCTGCGCCAATCAACGTTAGCGACTGTCCCT
+GGGCAAATCCGCTCAATGCGGTAATCAGCAGGCCAAATGTGAGCGCATTCATTACCGCGC
+TCGGTAAGTCAAAGCGCGGCTTAGTGTCATGGGCGATGTTTGCTGGTAAAAAGCGTATGG
+CCAGAATTAACGCGATGATACCTAACGGGACATTAATCAGAAACAGCCATTTCCATGATG
+AGATGGACAAAATCGCTGCGGCGATCGTCGGACCCGCGGCGGAAGAGACTGCGACGATAA
+AAGAGTTAATTCCCATGCCTCGTCCCAGATGACGCTGGGGGTAGATAAGACGAATCAGCG
+CCGTGTTTACGCTCATTAGCGCCGCGCCGCCAAATCCCTGCGCGATGCGCGCCAGCGTCA
+GCATCTGCAGCGAGTCTGAAAGCGCGCAAAACAATGATGAAAGCAGAAATACCACTAAAC
+CACATTTGTAGATCCGGCGATAACCAAACATGTCGCCTAAAAAAGACAGGGAAAGCAGTG
+AGACGACAATGGCGATTTGGTATGCATTGACAATCCAGATAGAGCTGGCAGGGGAGGCAT
+GTAAATCAGTCGCAATGGTTGGCAGCGCGACATTAGCGATTGCGCCATCCAGAACCGCCA
+TCGAAATACCGATAATAATCGTCAGGATAGCGCCGTATCTCTGCGGGAGGGGCAGGCCAT
+CGGCCCGTGTTTTTTCCATAAGTATTTTGTAATAAGGGGAGTTATGAGCTGAATAATAAT
+GTTAGCATTAATACTGAGTTGTTATGTCGCAGATTTGTAACGAAGTAAGCAAAGATGGAT
+TGCGGGCGACCTGGCGTGAAATTATAATAAAAACTCGTTCTGAATTTTATAAAACGCTCG
+TAATGAGGTGATAAATGGCAAACGCAGATCTGGATAAGCAGCCTGATTCTGTATCTTCTG
+TGCTGAAAGTTTTCGGCATTCTGCAGGCGCTGGGTGAAGAGCGTGAAATAGGGATTACCG
+AGCTATCGCAGCGCGTCATGATGTCGAAAAGCACCGTTTATCGCTTTTTGCAAACCATGA
+AAACGCTGGGCTACGTGGCTCAGGAGGGGGAGTCTGAAAAATACTCTCTGACGCTAAAGC
+TGTTTGAGCTGGGCGCGCGAGCTTTGCAAAATGTTGATCTCATCCGCAGTGCGGACATTC
+AGATGCGCGAACTGTCTCGTCTGACAAAAGAAACTATCCATCTTGGCGCGCTGGATGAAG
+ACAGCATTGTCTATATCCATAAAATTGACTCTATGTACAATCTGCGGATGTACTCACGTA
+TTGGGCGTCGTAATCCGCTGTACAGTACGGCCATCGGTAAAGTGCTTCTGGCCTGGCGCG
+ACCGTGATGAGGTTAAGCAGATTCTCGACGGCGTAGAGTATAAGCAAAGCACGGGACGCA
+CGATTACCAGCACTGAAGCGTTGCTGCCGCTGTTGGATGAAGTGCGTGCGCAAGGATACG
+GTGAAGATAACGAAGAACAGGAAGAAGGATTACGTTGTATCGGCGTACCGGTATTTGACC
+GTTTTGGCGTAGTCATCGCAGGGTTAAGCATTTCGTTCCCGACGCTGCGTTTTTCAGAAG
+AACGCCTACAGGAATATGTGGCTATGTTACACGCCGCCGCGCGTAAAATTTCTGAACAAA
+TGGGTTACAACGATTATCCCTTCTAAGCAACGTTATTAGCATGACGTTAAAAAAAAGCAG
+CTACGAAAAATGTAGCTGCTTTTTTTATAACATCGGGTGGGATGAAATCGTAAAAGTAGA
+TAATATCTGTCGGCTTATTTAACGGTTATTAAAATATTATTTAACAGTACTTATGAACAA
+CAGCCAATATAGGGGAATTATTGGTGATAGTTTCACTGTGAAATTATTTATTGCCGCTTA
+GCCATTATCCACCACGGTGGCGATTTTTCTGAAAATGGGACAGTCGGAAAAGCCAATAAT
+GCCGCTGTTGGTATGGAGATATTGCGCCGTGCTGGTGCCGCGTGCGGTCAGGTAATGGCA
+CTGTAAACCCAGCCCCGCAGCGTTCACTTTACTTCCCACCAGGATGCCATAGCCGCTCAT
+CAGCAGGCCTATCCACACCAGGGCAAACAATACAATTGCGCGAATGATCAAACGCATTAC
+TACCTCTTTTCTTTTTTAGTTAGAATAAGAGTAGCGTGTACATTGATTGAAACAAGTGAA
+TCATTCCTAAAAACATATAATGCCGCTACAGTTACTCCTGGTTTAAGTAACTCATGATAA
+TTTAGCGACATAAGATGTAAGATCGGAGAGTGGAGTGAAAAAATTTCGATGGGTCGTTCT
+CGGCATCGTGGTGGTAGTATGCCTGTTGCTGTGGGCGCAGGTGTTTAATATCATGTGCGA
+TCAGGATGTACAATTTTTCAGCGGTATTTGCGCCATCAATAAATTTATTCCCTGGTAAAC
+GTTTTACACCAGAGATTTCCTTCCCGTGTAGCAGTGGTAGAATGACGTCTCTACATTGAG
+GTGGTGAAATGAACGACGTTTTAAACTCTGGTGCGTTTTCTCTTGCATCTTTAATAGTAT
+CAATGGTGGTTCTGGTGGTGGGGCTGGCGCTCTGGTTCTTTGTCAACCGGGCAAGTTCCC
+GTGCCAACGAGCAGATAGAACTGCTCGAAGCGTTGTTGGATCAACAGAAGCGGCAAAACG
+CGTTGTTACGCCGCCTTTGCGAAGCAAACGAACCAGAAAAAGAAGCGGAACCCGCAACAG
+CGGCAAGCGAACCGAAAGAGGATGAGGACATCATTCGTCTGGTTGCTGAACGATAATGCT
+TACCGGGGCGCAAATGGCGCCAGTGCCATACGCCCCATTTCCCCGTCGGATCTCTCCGCG
+TTGCCGTTTGCAACTGATACTACAGCATCAACACCTTACCTAATATATGGCTTTATATGC
+AACATAGTTTTATATGTATAACAAATGGGCATATGGCATTTTTGTGATACCGCTCATTCT
+CTATTAAAAGCGAAACGTTTCTCTCTCTTTATGGATTGTCATTGTTTGTTCATTATTTTA
+AGGCATTCTGTAAAGACGCAGAACATCACAAAAAGCGGTGTCGAAAATCGCTTTTCTTTT
+CTATTATTTTGATTAAAAGGTGTTTTTTATCATTGTGACAATTTATGCATAACTCAGCAT
+AAAAAGTGATATGAAAAATACAGCTTTTAAATGTGATTTGATGCACTGGAAGAAGCGAAG
+TTATTGAGCTATGGTAGAAAAATGGCTTTTCAGCAGTGACGTTGTCAGGAGTCCGTCAGC
+GCGTGAGGATATATCTTTCGCAATTTTGTTGCATAAACGTGCTGTCAATTTGTGAAGGTT
+CTCGTAATTTGTGCGACGGATCGAGACACGTTTAAAAATGGCTTGCCATAATTAACGTTG
+TATGTGATAACAGGCTTTGGGTTAAACGAGGTACAGTTCTGTTTATGTGTGGCATTTTCA
+GTAAAGAAGTCCTGAGTAAACACGTTGACGTTGAATACCGCTTCTCTGCCGAACCTTATA
+TTAGTGCCTCAAGCAGTAATGTCTCAGTTTTATCTATGTTATGCCTACGGGCAAAGAAAA
+CACTCTAAGGAATTTTGCAAATGGCAAAGATTAAAGGTCAAGTTAAGTGGTTCAACGAAT
+CCAAAGGTTTTGGCTTCATTACTCCGGCTGACGGCAGCAAAGATGTGTTCGTACACTTCT
+CCGCTATCCAGGGCAATGGTTTCAAAACTCTGGCTGAAGGCCAGAACGTTGAGTTCGAAA
+TTCAGGACGGCCAGAAAGGTCCGGCTGCTGTTAACGTAACAGCTATCTGATCGACACCAC
+TGATTTGATGCGTTTGTCGCGTCAGCCTCAGATATAAAGCCTCGCTAAAAGCGGGGCTTT
+TTAATTCAATATCCTTCAAAATGTGTCTGGATGCGCTCTCGTTAGCGATTTGTTGCAAAG
+GCGCGATGTTATTAGCATTGTTTTTTCTGGTTTTTCCGGCCGTTTCCCGTTAAATCAATC
+ACCTGAAAAATGATTCGGCTGGAGATCAGGTGAAAAAGAAAAGCGACGGCGATACCCGTA
+ATTTTACGCCCATACGTTTTGCACTACTTTGCACTGCCATTCTGCTCAGTATGGCATTGT
+TGTTAGGGCGGGTGGCATGGCTGCAAATTGTTACGCCGTCGAAACTGGTGAAACAAGAAG
+ATATGCGCTCGCTTCGTGAAGTGACCACGGCCTCTCCACGCGGCATGATCACCGACAGAG
+AAGGGCGGCCCTTAGCGGTGAGCGTTCCGGTTAATGCTGTCTGGGCCGATCCGAAGACTA
+TCATAAGCAAAGGCGGCGTTGGCTACAATGAGCGCTGGCAGGCGCTGGCCAGCGCCCTGC
+ATCTGTCGCTCAGTACGCTTGCGGAACGGGTAAACAGTAACCCGGCAGGTCGTTTTATCT
+ACCTCGCGCGCCAGGTTTCACCCCAGCAAGCCGAATGGATAGATAAACTGAATCTACCGG
+GTATTAACCTGCGGGAAGAGTCGCGCCGTTTTTACCCTGCCGGACACGTAGCGGCCAATT
+TGATCGGCTTTACCAATATCGACGGGCAGGGAATAGAAGGTATTGAAAAGAGCTTTAACG
+CGCAACTGACGGGAAAACCGGGCTCCCGACTGGTGCGTAAAGATAAATTTGGTCACGTTA
+TTGAGAACATTACGGAAGTGAATCCGGTTCCTGCTCATGAACTTCAGCTTAGCATTGATG
+AACGTCTGCAAACGGTTACCGAAGATGCGCTGGATAACGCCGTCATTTGGAACAAAGCGG
+AATCCGGCGCTGCCGTATTGATTAACATCCCAACGGGTGAAATTCTCTCGATGGCGAGCT
+ACCCGGATTTCAACCCGAACAACCGTGAAGGCGCGCAGTTGGACGATTTTCGTAACCGCG
+CGATTAGCGATACTTTCGAACCCGGTTCTACTGTGAAGCCATTGGTCATTATGACTGCGT
+TACAGCAGGGCATCGTGCAGCCGGACAGCGTTATCGATACCCATCCTTTTACTCTCGATG
+GACACCGTATCCGCGACGTCGGTTACTATCCGGAACTGACATTAACCGGCATTTTGCAAA
+AATCCAGCGATACCGGCGTTTCTCACCTTTCTCTGGCGATGCCGGTGCAGAAATTAATGG
+ATACTTATAAAAGCTTTGGTTTCGGCGTGCCTACCGGACTGGGTCTCACCGGAGAGAGCA
+GCGGGTTATTACCGAAACGCCGTTACTGGAGTGATTTAGATCGCGCTACCTTCGCTTTTG
+GCTATGGATTAATGGTGACGCCGCTGCAACTGGCGCATGTTTATGCCACGATTGGCAGCT
+TTGGTATCTACCGTCCGTTATCGATCACCAAAGTTGATCCGCCCGTGATCGGCACGCGGG
+TAATGCCGGAAGAACTGGTGCACGAGGTGGAACATATGATGGAGAGCGTCGCGTTGCCTG
+GCGGCGGCGGAACAAAAGCCGCAGTAAGAGACTACCGTATTGCGGTCAAAACCGGGACGG
+CGAAAAAAATTGGCGATGATGGTAAATACGTCGATAAATATGTGGCATATACCGCAGGCG
+TCGCGCCGGCAAGTAACCCCAGATTTGCGCTGGTGGTGGTGATTAATAATCCGCAAAACG
+GGGCTTATTATGGCGGCGCGGTATCTGCGCCCGTATTCAGCCAGATCATGGGCGATGTGC
+TGCGGCTGGAAAATGTTGAGCCAGACGGTATGCCAGCCGATTCAGATCACCTTCTGGTGA
+TGCATGGCAGCCACGTTGCGGTTCCGGGCTCGTAAAGGATTTTCCCGGGGCGCAATTCGC
+GTTACACTTGCGCCCTTTAGCGCCCCAGTCCGGAGTTGTCATGTCGTTTACCTGTCCGCT
+TTGCCATCAGCCGCTTACGCAGATTAATAACAGCGTTATATGTCCACAGCGCCATCAGTT
+TGATGTGGCGAAAGAGGGCTACATCAATCTGCTGCCGGTACAGCATAAACGTTCGCGCGA
+TCCGGGCGACAGCGCCGAAATGATGCAGGCGAGGAGAGCGTTTCTTGATGCGGGCCATTA
+TCAGCCGCTGCGCGATGCGGTGATTAACCTGTTGCGCGAGCGGCTGGATCAGTCGGCCAC
+GGCGATTCTGGATATCGGCTGCGGCGAGGGGTATTACACTCATGCTTTTGCCGAGGCGTT
+GCCGGGAGTCACCACGTTTGGACTGGACGTTGCTAAAACGGCGATCAAAGCGGCGGCGAA
+GCGCTATTCGCAGGTGAAGTTTTGTGTGGCGTCAAGCCATCGACTGCCCTTTGCCGATGC
+GTCAATGGATGCGGTGATCAGAATCTACGCCCCGTGTAAGGCGCAGGAATTGGCGCGTGT
+GGTGAAACCTGGTGGTTGGGTCGTTACCGCCACGCCAGGGCCGCATCATCTGATGGAACT
+AAAAGGGCTCATTTATGATGAGGTGCGTTTACATGCGCCGTATACCGAGCAGCTCGACGG
+ATTCACATTGCAGCAGAGTACCCGCCTTGCTTATCACATGCAGCTCACCGCCGAAGCGGC
+TGTAGCACTGTTGCAAATGACGCCATTTGCCTGGCGCGCCAGGCCAGACGTGTGGGAACA
+ACTGGCCGCCAGCGCCGGACTTAGCTGCCAGACGGATTTCAACCTTCATCTCTGGCAGCG
+TAACCGTTAACCGTGAAAATGCGTCCAGAGGATCTGGACGCCAATTCCTATCAGTACGAC
+CCCGCCGAGAATTTCAGCACGCTTACCCAGCATTGGGCCGATAAAGCGACCGATCATCAT
+TCCGAGGGTGGACATGATAAGCGTGGCGCAACCGATAGCTAATGCGGTAGCGATGATGTT
+TACCTGCAAAAACGCCAGACCGACGCCAACCGCCATCGCATCGAGGCTGGTCGCGATAGC
+CGTCGTGACTAATAGCCAAAAGCTGTGGCGGCGTAACGGTGTTTCATCTTCATCACTACC
+GCCGCGGATACCTTCGATGATCATGCGTCCGCCCAGAAAGATCAGCAGAACAAAGGCTAT
+CCAGTGGTTCCATTCCAGAACGAATTTACTCGCCAATATCCCCAGCCCCCAGCCGATTAA
+CGGGGTCAGCGTTTCAACCGCGCCAAAGATAAGGCCGGTACGCAACGCTTCTGAGAATTT
+GGGTTTATGTAGGGTGGCGCCTTTGCCAATTGATGCCGCGAAAGCATCCATCGACATACC
+GAAAGCGAGAAGAACAGTAGCAGTAAAGTGCATGACAACGTCCTGACCGGGGTATCCATT
+AAACACATCACTGCCCCCAGCAAACATGCATGTCGCCATTCTGTGACGAAATACACAGCA
+GTTGATGCGCCTATGGTCTCGCCTGACCAGCGGCGGCTGGTCCGTACGCGCCACGTTTTG
+CAACGAGTATGTTGACGCGTACATTTCCGGAGTCTGGAAATCGGCTACTCCCCAATTGAC
+GGCGCAACATTAACATATTTTTAGAATATAAAACAACAGCGATAAAATATTATTTGCCTT
+CTAATTGAAAACGATTTTCATTTAGATTTATTCATCAATAAAACGTTAAATTAAATAACA
+ATTGGTCAATAGAAAATATAGCCTTAGCTATATTATGATTCGAAATAAAATTCGAAAAAC
+ATAGTTGAGGCTATATCTTAAGCTATTGATTTTCAATAAGAAGTTTATATATTTTTTCCA
+GATTGTCGATATTGCGTACACGGATAAGCAAGCGTCGTTGTTCTAATTGCATCACCAGTA
+CGCCGTCTTCCGATAAATTCATCTCTTTAATACGGTTATATTCTATCCAGACATTGGCGA
+AGAAAAAGCCACGTTGTTTAAAGATGATCCGTGGCGTGCGGATCCAGAATATATAAAACC
+CCATTAACGCCAGCGCGCTTAATAACCATGTGGTCATCTGCGCTCCGTGGCTGGTTACGT
+TGTTATAAATAAGGATGGCGACCAGCCCAACGAAGATAACGCTGTCTACGCGACCGCGGC
+GGAGCAGGGCTATAGAAAGCAGAGTGGGGCCATTGCGACGGGGCATGATGAACTGATCGT
+AGAGAGCGTAAGCCAATAATGCGGCAATAAAGAGAATCAGCACCAGGTCCGTGATAGTCA
+TTTATCCTCCAGAGAAATAAAAAAACGGGGCCGTTTGGCCCCGGTAGTGTACAACAGCCT
+TACTGACCCAGCAGTCCTACGGAGTAGCCGGCGATACCGATGACGAAGAAGCCCACGATA
+ATCCACAGCGGGTTAACTTTCTTACGCAGCAGCCACATACAGGCAAAGGTCAACAGTAGC
+GGAACCAGACCCGGCATCAGCTGGTCGAGAATGGTTTGCACGGTGGTAACGCGTGTCTGA
+CCATCCTGACCGGTGATGGTGGAGACCACCAGCGGGATATTCACATGCGTCCACTTGTTA
+ACCAATGCCCCCATGACAAACAGGCCGAGGATTGACGCCCCCTCAGTCAGTTTTTGCAGG
+AAGCCGCCGCCCATATCTTTAACGATATCGACGCCTTTGCGGTAGCCATAAGCCACGCCA
+TAATAACGGGTCGCCAGACGCACCAGGTTAAACAGGATGAAAAACAGCAGCGGACCAAGC
+AGGCTGCCGCTCATTGCAATACCTGCGCCCAGCGCCGCGAATACTGGACGGACGGTACCC
+CAGAAGATAGGGTCGCCGACGCCTGCCAGCGGTCCCATCAGACCGACTTTGATACCGTTG
+ATAGCGCCATCGTCAATCTCTGCGCCATTCGCACGCTTTTCTTCCATTGCCAGCGTTACG
+CCCAGTACCGGCGCCGCAACGTAAGGATGGGTGTTAAAGAACTCCAGGTGACGTTTAATC
+GCCTGTTTACGCGCGTCATTATTCTCCGGATACAGGCGACGAATCGCTGGCACCATAGAG
+AAGCAGAAGCCCAGCGCTTGCATACGTTCGAAGTTCCATGACCCCTGGAACAGGTTAGAA
+CGAAGAAATACGCCGCGAATATCGCTCGGAGTGAGTTTTTTCTCGGTGGTAGTTTTAGTC
+ATATCAACCATTTCGCTCACCTGTTAGTCCAGTTCGTTGTCGAGATCGTTATTGCCAGCA
+GCCGTTGCAGGCGCGCCCGCTACACGGTTGTATTTCGGGCTCAGCTGGATGTAAAGAATA
+GCCATCACTGCGCCGATGACACCCAGTGCGACCAGGTTGAAGTTTGTGAAAGCCGCGGTG
+ACGAAACCGAGGTAGAAGAACGGCATCAGGTAGCCTGCGCGCATCATGTTGATAACCATC
+GCATAACCAACCACGACGATCATGCCGCCGGCGATGTTCAGACCGCCCGTGACGACTTCA
+GGAATCGCATTCAGCATTCCCTGTACTTCGCTGGTGCCTACGGAGATGGCAACGATAACC
+GCCGGGATAGCGATACGCATTGCCTGCAGGAACAGAGAAGAAACGTGCAGCCAGGAGAGC
+GCCGTCAGGTTGCCGTTTTCAGCCGCCTTGTCCGCCGCGTGCTGGAATGCCACGGTGATG
+GTACGAACGATAATGGTCAGTACCTGGCCTGCCGCCGCCAGCGGAATCGCCAGCGCGATA
+CCGGCGCCAATGCTTTGATGCCCGGCGATGACCAGAACGGTAGAGATGATGGACGCCAGT
+GCGGCATCAGGCGCAACGGCAGCACCGATGTTCATCCAGCCCAGAGCGATCATTTCCAGA
+GTACCGCCGATGATAATACCGGTTTTCATGTCCCCCAGAACGGCGCCGATTAAGGTACAG
+GCGATCAGCGGACGGTGGAACTGAAATTCATCAAGTACCGACTCCATACCCGCGATACAT
+GCGACGATGAACACCAGCACAATCTGAAGAGTGGTAATCTCCATTGTACTTCTCCTATTG
+CTATCTTAAGTGTGAAAGCTAATTAAATGCCGGCGGTTATTTCGCCACTTTGGCAATTAA
+ATCCATCATTTTCAGTTTCGGATCGGTGGAAACTTTACGCACCTCAAGCTCGATGCCGCG
+CTCGTTGAGCTTTTTAAAGGCTTCGATATCCTTTTCATCGACGGAAACGGCGTTGTTCAC
+CTGCGTTTTACCTTGACGATAGGCCATACCGCCAATGTTCACGGAGGTGACTTTCACGCC
+GCCCTCAACGATGCGCTCGACGTCGGTAGGATTGGTAAACAGAAGCATCACGCGTTCGCC
+GGCGTATTTCGGGTTATTGTAGACGCGAATCATCTTCGCGACGTCAACCACATGCGCCGT
+AACGCCCGGCGGCGCAACTTGCGTCAGCAGCGTTTTACGTACGGTATCCGCCGCGACTTC
+ATCGCTCACAACAATAATACGGCTGACATTGGTCTCTTTGGTCCAGCGGGTAGCGACCTG
+ACCGTGAATGAGACGGTCATCAATACGGGCAAGCCCGATAACCATATAATCATTCGGGCC
+CATCGGTTTTGCCGGCGTGGCCGCTTTTGGCGCGGCGGCGCCTGGCGCTGGCGCGGCTTT
+TTCTACCGGTTTCGCTTTCAGCGCTTTTCCGCCTTCACGACCGGTTTCTACCGCCAGTGC
+GACCAGCTCGTCAAAGCTTGGATCGTCGTCACGAGCCATAAACGTTTCGACCAGCATCGG
+GATGTTGACGCCGGCAATAACTTCATAGCGCTCTTTATCGACGACAATGCGGCTGGCAGC
+ATTAAACGGACTGCCTCCCCATGTATCAACGAGAAATAGCACGCCTTTACTGGTATCGAG
+TTTAGCCAACTGAGCGTTGTACTTTTCGATCAGCGTTTCGGCATTTTCGCCTGGAACGAA
+ATCGATCCAGCCGACGTTTTCCTGCTCGCCTAACAGCATTTCGGCTGTTTTAAGTAACTG
+CTCTGCAGCCCAACCATGTGTGCCTATAACAATAGCAATGGTCACTTGCTACCTCCTTTA
+TTATTGTCAACACATCAACTTGACAGATGTATTTTTTGAATCGCCGTCCGCAAGCGAATC
+GATTCAGATGAGGGTTACAACGAAAAACGCATGATTTTCGTGAATTATTTTAGATATCGA
+AAAAAATATTTTGTGTGATGGAGATCCGTAATTTTGTTTTCGATAATGAGAAATTTCGAA
+GTGTAAAATATCCCGGTTACATCTCTTTGCAAAGGAAGGTAAATCTTTGCCAAAAACCAG
+TTGTCTCTGTTATGTTTAGCTTCCGTTTAATTAGAATGGGGTATAGGGCAGCAGCCCGTT
+GTATGGATCGTCACCGACGTCATTTCACTCTTTGGCCGTTTTGCGCCTGTCAATCTGGCA
+TATCTTGCCATAGCCTTACTTTGTTTATTGCGTTACCGCCTGCATCCTTTGAGATGTTGT
+GGGCGCCGTTTAGTCATTCCTTAAGCAGGAGCTTGTCATGGAATTATTAATGGATCCCTC
+AATTTGGGTGGGTTTACTCACGCTCGTCGTCCTGGAAATTGTTCTGGGTATCGATAACCT
+GGTCTTTATCGCGATCCTCGCCGATAAATTGCCGCCAAAGCAGCGTGACAAAGCGCGTCT
+TATCGGGCTCTCGCTGGCGCTGATTATGCGTCTGGCGCTGCTGTCCATTATTTCGTGGCT
+GGTGACCTTAACAAAGCCGCTCTTTACCGTCTGGGATTTTACCTTCTCCGGCCGCGATTT
+AATTATGCTGCTGGGCGGTATATTCCTGCTGTTTAAAGCGACCACCGAGCTGCATGAACG
+TCTGGAAAACCGCGAGCATGACACCGGACACGGTAAAGGCTATGCGAGCTTCTGGGTGGT
+AGTCACGCAGATTGTCATCCTGGATGCGGTCTTCTCGCTGGACGCCGTGATTACGGCGGT
+AGGTATGGTAAACCATCTGCCGGTTATGATGGCGGCGGTGGTGATTGCGATGGCGGTGAT
+GCTACTGGCGTCAAAACCGCTGACCCGTTTTGTCAACCAGCATCCGACGGTGGTGGTGCT
+CTGTCTGAGTTTCCTGCTGATGATCGGCTTGAGCCTGGTGGCGGAAGGGTTCGGTTTCCA
+TATTCCGAAAGGCTACCTGTACGCGGCAATTGGTTTCTCGATCGTTATCGAGGTGTTTAA
+CCAGATTGCGCGCCGCAACTTTATTCGTCATCAGTCCACGTTGCCGCTGCGCGCGCGTAC
+TGCGGACGCTATCCTGCGTCTGATGGGCGGTAAACGCCAGGCGAGTACGCAACATGAAAC
+GGATAGCCCGGCCGCGATATCGGTGTCGGAAGGCGCCTTCGCCGAAGAAGAACGCTACAT
+GATTAACGGCGTACTGACTCTGGCGTCGCGCTCCCTGCGCGGCATTATGACGCCGCGAGG
+CGAAATTAGTTGGGTGGATGCGAATCTCAGCGTAGCTGAAATCCGTCAGCAGTTACTCTC
+TTCTCCGCATAGCCTGTTCCCGGTATGTCGGGGCGAGCTGGATGAAATTATCGGTATCGT
+TCGGGCGAAAGAGTTGCTGGTGGCGCTGGAAGAGGGCGCGGACGTTGCGGCTATCGCCGC
+GTCTTCCCCGGCGATAGTGGTGCCGGAAACGCTTGATCCTATCAATCTGTTAGGCGTTTT
+GCGCCGCGCGCGCGGCAGTTTCGTTATCGTCACTAACGAGTTCGGCGTGGTGCAGGGGCT
+GGTTACGCCGCTGGATGTGCTGGAAGCGATTGCCGGTGAGTTCCCGGATGCCGATGAAAC
+GCCGGAAATCGTTGCCGATGCCGAGGGCTGGATAGTGAAGGGCGGCACCGATCTCCATGC
+GCTACAGCAGGCGCTGGAAGTTGATCATCTGGTGAACGAAGAGGGCGATATTGCGACGGT
+CGCGGGGTTAGTGATCGCCGCTAATGGCCATATTCCTCGTGTAGGCGATGTCATTGATGT
+TCCGCCCCTGCGGATCACCATTGTCGAGGCCAACGACTATCGTGTCGATCTGGTTCGAAT
+TGTTAAAGAACAGCCTGCCCACGACGAAGAGGAATGACGTCACACGCAGGAATCAAGTCT
+ATAGATGCGGCATCGCGGACATAATCTGTCCGTTATGCCGGGCGGGCGGCGGCGCGCTGC
+CCGCCAGCCACTGTGGAAATTCGCTAATGGGCATCGGCTTCGCATAGAGATAGCCCTGTA
+ACATTTGCACGCCATGCTGGCGCAAATGCTGTGCCTGCGTCTGGTTTTCGACCCCTTCCG
+CCACCAGTTCAATATTCAGTCTTTGCCCCAGAGCGATAATAATATCGGTCACCGTTGAAT
+TGACCGCATCGGTACCGATGGCGGCGGTGAAGGATTTATCGATTTTCAAAATATCCGGCC
+GCAGTTTTTCCAGCCAGGAGAGCGAGCTGTTTCCTGTGCCAAAATCATCGATGGCTAACT
+TCACGCCTTTACGATGCAGCTCGCGCATCAGGCGGTAATCAACGTCAAGCAACGCGTCGC
+GTTCCGTGAGCTCCAGCACCAGTTGCTGAACAGGTTCCGCACTAAACCAGTACTGATTAA
+GATCCTTGAGAAGCACGCCGTGTCGGAAATGGCTTGCCGCCACATTGATGCCGATATGAA
+ACTGATGGTTGATGGGGAAGTAGTGCCGCTGCCGAATGGTTTCCGCAATCACATAGCGGG
+TCAGCGGCGCTATCAGGTTATGTTCCTCGGCGATAGGAATAAAAACATCCGGTGAGATCC
+AGCCCTGGCGCGGGTTGTTCCAGCGTAACAGGATCTCAACGCCGGTACACTGCTGCGTGC
+GGGCATTAAGCAACGGCTGACAAAATAGCTCAAACTCCCGTTCGGCAAGGGCCAGATTAA
+TTTCCCAGGAAAAGCTCATTCTGCTGGCCGTTGCCAGCCAGGCGATATAACCGATCAACA
+GGCTAAGCAATACGGCCAGCGGTAACTGCGTCGGGAGATGTTTGAACGCCAGTACGCCTG
+CCGACGGCCCGCTGACGCTGATAGTAAAAGGGAAATGTCGCGATGAAAGCTGGTAACGCT
+CTTCATCTTTTTTTAATTCCGGAAGAGTATCGACCACGCCCCGACCATATAACAGGTGCC
+GTTTGCCGACCGTCAGGCTGGCGCTGGTAATTTGCGGCTGCTGCGGCTCAAGTAGCATAG
+TCGTCAGCAAGTCAATATTCACAATTTCCATCACGCCATCCTGGCCATCGGCAGAGGCGG
+GATACCACTGAATGAGGATCGGGCTTCCCTTGAGTAACGATTGGTCTGTGGAAAGTAGCA
+GCAGATCGCCGACTGCGGGAAGATCGGGCTGAAGCTGGCGTATGGGAGTATTACGGGCGC
+CAAAAATGCTTGAGCAATAGAGAATTCCCTCTTTCACCAGCCCGATAGAACGAACGGTTT
+GCAGACGGGCGGCTTGCTTACGCAACGGCAGATGCGCGGTCGCGCACGGAAGCTCAAGCA
+AGGGGAGCAGTACGTTTCGTCCGACCTGGAGAGGATGCAAAACATTATCCAGCGCATCAA
+CGGCATGATTCGCGAATGCAACCGTGCGATGGTGATTTAAGTTCCGCTCCGAAATAAATC
+GGATGCTCAGCGTAAGAATGAGCGTGACCAGTGCACAAATCGTGCAAACAATGAAACGAT
+TACGGCGATAATGATTGATGATCCGTTGTGCTGTTTGCATGCGGGCCGCCCAATAAGCGT
+TGGCGACAAAAGCCAACCGCGACACAGCAAGTGTAGTGGGGAAACGTGGAGTCGACGAGG
+AAGAGATAAAAATTTCGCCCATCCGTAGCAGATGGGCGAAGGGAGGGGAAACGGCGTTTA
+ATCACACTGGACTTTAATAGCCAGCCCGCCGCGCGACGTTTCGCGGTATTTTGCGTTCAT
+GTCTTTTCCGGTCTCGTACATCGTTTCGATGACTTTATCCAACGAGACGCGCGGCGCGCT
+GGTTCGACGCATGGCCATACGCGCAGCGTTGATCGCTTTAACCGAAGCAATGGCGTTACG
+CTCGATACACGGCACCTGCACCTGACCGGCAACCGGGTCGCAGGTCAGCCCCAGGTTATG
+CTCCATGCCGATTTCAGCGGCAACGCAAACCTGCTCCGGGCTGGCGCCCAACAGTTCAGC
+AAGGCCTGCCGCCGCCATCGAACAGGCGACCCCGACTTCGCCCTGACAGCCGACTTCCGC
+GCCGGAAATAGACGCGTTCATCTTATACAGCGCGCCAATAGCGCCTGCCGCCAGGAAGTA
+GCGGGTGTAAATATCCGGGCTGACTGATTCAATAAAATGGTCGTAGTAAGCCAGTACCGC
+AGGAACGATACCGCACGCGCCGTTGGTTGGCGCCGTCACGACGCGGCCGCCTGCGGCGTT
+CTCTTCGTTCACCGCCAGAGCAAACATGTTCACCCAGTCAATGACGTTCATCGGATCGTT
+GGAAAGCTTATCGCTGGAAACCAGCATACGACGCAGCGCAGAGGCGCGACGCGGTACGCG
+CAGCGGCCCCGGCAGCACGCCTTCGGTATTCATACCACGATCAATACAGGCCTGCATGGT
+CTGCCAGACGTGACCGAAATACTCTTCAATCTCTTTCTTGCTATGCAGCGCCAGTTCGTT
+TTGCATCACCATGCCGGAGAGTGAAAGGCCGGTACTGTTGCAATACTCCAGCATTTCTTT
+CGCCGATTTAAACGGATAAGGTACAGTAACCTCATTCGTCGCTTCCTGGCCGAAATGCGC
+TTCATCAACGATAAAGCCGCCGCCGATGGAATAGTACGTCTTGCTATAAATGACCGTGTC
+GTCATGCCAGGCGTGGATCTGCATCCCGTTTTCATGCAGCGGCAAATTGCCGTTGTGAAA
+ACGCATTCCGTCATCTTTCGGGAAGTCGACTTCGTGACGTCCCTGGGCCAGTAACAGACG
+CTCGCGCGTTTCGACGTCGCGAATAAAACCGGGGATACTATCAATATCCACGGTAGCGGG
+TTCATTACCCGCCAGACCCATAATAATGGCGATATCGGTATGGTGACCTTTCCCCGTCAG
+CGACAGCGAGCCGTAGACATCGACAGCGACGCGGGTAACGTTATCCAGTAATCCTTTTTC
+GACCAGGTCATCGACGAACTGTTTACCGGCCTTCATCGGGCCAACAGTGTGGGAAGAGGA
+GGGACCAATCCCTACCTTAAACATGTCGAATAGGCTAATCACGATAATACTCCTGACAGG
+GCAACCGGGGCTTCCGGTTACGATGTTATAACTGCGCATAGTGTAAGAGGGAACGCTGGC
+ATCAGCTTAACTATTCACATGAATTAAACTAATGAATAACCGCGTTTTTACTAATATTGC
+GACAGTAATCTCAAGTCGTGTCTTGCGCGCGTAAAGTTAAGTATATACACGTTGCCCTTC
+AGGCTGCCTCTTTGGGGGAGGCGATTGTTACCACCTTGAGGCAACGTGAATGGCGTTGTG
+TACAGTCAGGGCTTTACGCCGATTTGCAGCGCCAGCTCACGAAGAATGTTTGCGGTCATG
+CCCCAGACGAAATAATGCTCATACCAGGAGAGCCATACGCGGTGCGAATTGCCGCGACGG
+TAAACATCAAGCGGGTGATATCGACCCAGTTGCAACGCTTGCGCCAGCGGCATTTCAAAC
+ACCGCAGACACTTCATCTTCACTGGCGCGCCAGGGGAGATTTGGCGGAATAATGCCGACC
+ACCGGGGTGACCTGAAAACCGGTCACGCTGTCTACCGGCGGTAAAACGCCAATCACTTCC
+ACGGCTTGCGGCGGGATGGCGACTTCCTCCTGCGCTTCGCGAAGCGCTGCGGCGATAAGC
+GAAGCATCGGTACTGTCCACGGCCCCGCCGGGAAAGGCGACCTGTCCGGCGTGTTTGCGC
+AAATGAATAGCCCGCTGGGTCAACAGCAGCCCCGGCTGGGGGCGGCGAACCACAGGGATC
+AGTACGGCGGCCTGACGTTGATTTAACGTTTCATGAGTCATCTGCGGGCGCAAAAGCTGA
+AAGCGCGATAAGAAATGATCGAGCGTCAGACGGCTGGTATCCACGTATTAGTTCTCCAGT
+GGGTGCAGGATACGATTAACTTTATCAAAAGTTTCCTGATATTCCGCTTCTTCCTTGCTA
+TCGGCCACGATACCGCCGCCGGCTGAGCAATAGAGTTGGCCCTGCGTTGCCGTGACGGTG
+CGGATAGTAATACTGGTATCCATCTTGCCGCAGAAACTCAGATAACCGATGCTACCGCAC
+CAGGCGTTGCGTCGCTGCGGCTCCAGTTCGTCGATAATTTCCATCGCCCGCACTTTAGGC
+GCGCCGGTAATGGAGCCGCCGGGGAAAGCCGCGCGCAGCAGGTCGGTAGCATGAAGCGAG
+TCCGGTAAACGGGCGGTAATGGTGCTAACCAGATGGTGAACGGCAGGAAATGGTTCGACG
+ACGAACAGTTCCGGCACTTTCACCGAACCCGGCACGGCGACCCGGCCAATGTCGTTACGC
+ATCAAATCGACGATCATCAAATTTTCAGCGCGATCTTTCATTGAGTTGGCCAGTTTCTGC
+GCCTGCTGACGATCCGCCTGCGGATCGTTAAGCCGTGGGAGCGTACCTTTGATCGGGCGC
+GTCTGAATATGACCATTCTCCAGTTGGATAAAACGCTCGGGAGAAAGGCTCAATATGGCG
+CCGTCATGTAAACGAAGAAAGGCGCTGAACGGGGCGCGATTGGCGCGGTTAAGGTGTTCG
+AAAGCCTGCCACTCATCACCCTCGTAGCTCGCCTGAAAACGCTGGGAAAGATTGACCTGA
+TAGCAGTCCCCGCTGTGCAGCCAGGCCTGCACCTGACGAAACTTTTCGCCATACTCGCAA
+CGCGTCATATTGGATTGCCAGGCCGAGGTAAGCCTGAAGGGCGTGCGGGTCGGCGCGTGC
+TGGCTGGTGAGCCAGCGATATCGGGCGTCTGCATCGTGATAGCTTATCAGCGACACCACC
+TGTTTTTGGTGATCGACAATCAGCGCCCAGTCGTAAAGGCCAATCGCCATATCGGGTAAA
+GCGATATCGCGCGCAGCAGTATCGGGCAGAATTTCGAAACGCCGCCCTAAATCATAACCA
+AACAGACCCAGCGCGCCGCCCTGAAAGGGTAAGTCAGGGTCAGGCTGAGGATGAAAAGGC
+AGCGCCTCCAGTTGAGTCTGCAAAACGTGTAACGGATCGTCGAAAGTGACGGTAGTCGTG
+CGCGCAGTACATACCGTGGTTTCCTGCGCGCGCGTGGTCAGTGTGGTGACAGGATCGGCG
+ACCAGAATATCAAAACGGTTATAGGGATGAATAGCATCACCTGAATGCAGCAGCATCGCC
+CAGGGCAAATGATTTACGGGCGCAAAATAGTGTTCAGCGGCGTCCGGACGCCAGGGTAAG
+GTGATAACAGTGGGAGATAACGTCTTCATCATTCCTGACTCGTTACAACACTACTGGCTT
+ACCGCCGGGTAGCGTGAAATAATTAGCGCTAACAATTTAGCAGGAGTTAATCATGTTTGC
+AGGTTTACCTTCACTCAGTCATGAACAACAGCAAAAAGCCGTAGAACGTATCCAGGAATT
+GATGTCGCAAGGTATGAGCAGCGGAGAAGCGATTGCCCAGGTGGCGGGCGAACTTCGCGC
+CAACCATACCGGCGAACGGATAGTGGCGCGTTTTGAGGATGAAGACGAATAACCGGCTTA
+TACCGCCGCGACAATCTTAATCTCAACTTTATATTTCGGGTTCATCAACCCGGCCTGTAC
+GGTACAGCGTACCGGCGCATGGCCTGCGACGACCCACGCATCCCACGCCTTATTCATGGC
+GGCAAAATCCGCTTTATCGCTCAGGAAAATAGTGGCATCCAGAATACGTGACTTACTGGA
+GCCCTGTTTTTCCAGCACCGCATCAATTTGCGCCAGAGTATTCGCCGTTTGCTCAAAAGC
+ATCGGCGTCCAGGTTTTCCGGCACGCCGGTATACCACAGCGTATTATTGTAGATCACCAC
+GTCTGACCAACGATCTTCGGCATCAATACGCACGATAGACATTACTTATTCCTCATTTGC
+TTTTCATTTGAATGGTTCAAGACTGCCACAATGTGGCGTCGCCGTCACCTCTGTAACTGG
+CGTAAGCCTTTCTACCCTGACATAATCCCTGTGCAAATTAACAGGGGGCAGTGTGACGGA
+CGATTTTGCAGCAGATGGCCAACTGGCCAAAGCGATAACCGGCTTTAAACCGCGCGAACC
+ACAGCGACAAATGGCGGTTGCCGTAACACAAGCGATTGAAAATGCGCAGCCTTTGGTTGT
+TGAAGCCGGCACCGGAACCGGGAAGACCTATGCTTACCTCGCTCCGGCGTTGCGCGCCGG
+GAAAAAAGTCATTATTTCGACCGGGTCGAAAGCGTTGCAGGATCAACTCTACAGCCGCGA
+TCTGCCGACGGTAGCAAAAGCGTTGGCGTTTACCGGTAAGACGGCCCTGTTGAAAGGACG
+TTCAAACTACCTCTGCCTGGAGCGTCTGGAACAACAAGCGCTGGCGGGCGGCGATTTACC
+GGTACAAACGTTAAGCGACGTGATATTGCTGCGCTCCTGGTCAAATCAGACGCGGGATGG
+CGATATCAGCACCTGCGTCAGCGTGGCGGAGGATTCCCAGGCCTGGCCGCTGGTCACCAG
+TACCAACGACAACTGCCTTGGCAGCGATTGCCCGCTCTACAAAGAGTGCTTTGTGGTGAA
+AGCGCGTAAAAAGGCGATGGACGCGGATGTGGTGATTGTAAACCACCACCTTTTTCTTGC
+GGATATGGTGGTTAAAGAGAGCGGGTTTGGCGAACTTATCCCTCAGGCTGAAGTAATGAT
+CTTCGATGAAGCCCACCAACTGCCTGACATCGCCAGCCAGTATTTCGGACAATCGCTCTC
+CAGCCGTCAGTTACTGGATTTAGCAAAAGACATCACCATCGCCTACCGGACGGAACTGAA
+AGACACTCAACAGTTGCAAAAATGCGCCGATCGCCTTGCCCAGAGCGCCCAGGATTTTCG
+TCTGCAACTGGGGGAGCCCGGCTACCGGGGAAATTTGCGTGAACTGTTAGCCGACTCGCG
+TATCCAACGGGCATTTTTACTGCTGGATGATACGCTGGAGCTTTGTTACGACGTGGCGAA
+GCTGTCGCTGGGCCGTTCGGCGCTGCTGGATGCGGCTTTTGAACGCGCCACGCTATACCG
+TTCACGGCTGAAACGCTTAAAAGAGATCAATCAGCCGGGATACAGCTACTGGTATGAGTG
+CACCTCGCGCCATTTCACCCTGGCGCTGACGCCGCTCACAGTGGCGGACAAATTCAAAGA
+GGTGATGGAACAGAAACCCGGTAGCTGGATTTTTACCTCAGCCACGTTATCGGTAAATGA
+TGATCTTCACCACTTTACCGCCCGTCTGGGAATTGAACAGGCAGAATCCATGCTGCTGCC
+CAGCCCATTCGACTATACGCGCCAGGCGTTACTCTGCGTACCGCGTAACCTACCGCAAAC
+CAACCAGCCCGGCGCGGCGCGACAGTTGGCGGCTATGCTCAGGCCGATTATTGAAGCCAA
+TAACGGGCGATGTTTTATGCTGTGCACCTCACACGCCATGATGCGCGATCTGGCGGAGCA
+GTTTCGCGCCACCATGACGCTGCCGGTATTGTTGCAAGGGGAAACCAGTAAAGGCCAACT
+GTTACAGCAATTTGTTAGCGCCGGCAACGCGCTGCTCGTCGCCACCAGCAGCTTCTGGGA
+AGGGGTGGACGTGCGCGGCGATACGTTATCTTTGGTGATTATCGACAAATTGCCGTTTAC
+TTCCCCGGACGACCCGTTGTTAAAAGCGCGAATGGAAGACTGTCGTTTGCGCGGTGGCGA
+TCCGTTTGATGAGGTTCAACTGCCCGATGCGGTGATTACGCTGAAGCAGGGGGTGGGGCG
+GCTAATTCGCGATGCGGACGATCGCGGGGTGTTAGTGATTTGTGATAACCGGCTGGTGAT
+GCGGCCCTATGGCGCCACGTTTCTCGCCAGCCTGCCTCCTGCGCCGCGCACGCGTGATAT
+CGCCCGTGCCGTTCGCTTTCTTGCGATTCCATCCGCCGAGTAATTTGTTACGGAGTATGG
+TAAGATGCGCGCTATTTTATTGATCTAAGCACGAAACCTCATGCGAATTCTGGCTATCGA
+TACCGCCACAGAGGCCTGTTCTGTCGCCCTGTGGAACAACGGTACTATCAATGCTCACTT
+TGAGCTTTGTCCACGAGAACACACTCAACGTATCCTGCCCATGGTGCAGGAGATTCTGGC
+CGCCAGCGGCGTCTCGCTCAATGAGATAGATGCGCTGGCGTTTGGGCGCGGTCCGGGCAG
+CTTTACCGGCGTGCGTATCGGCATTGGGATTGCGCAAGGGCTGGCGTTAGGGGCAAATCT
+GCCGATGATCGGTGTTTCGACGCTTGCCACGATGGCGCAGGGCGCGTGGCGTAAAACCGG
+CGCGACCCGCGTACTCGCCGCGATTGACGCGCGGATGGGCGAAGTGTACTGGGCGGAATA
+CCAGCGTGATGCGCAGGGCGTCTGGCAGGGCGAAGAGACGGAAGCGGTGCTGAAACCGGA
+ACGGGTCGGTGAGCGGTTGAAACAGCTTTCCGGCGAGTGGGCGACGGTAGGAACGGGTTG
+GTCCGCATGGCCCGATCTGGCGAAGGAGTGCGGCCTGACGCTTCATGATGGGGAGGTGTC
+GCTCCCGGCAGCGGAAGATATGTTGCCCATCGCCAGTCAAAAGCTGGCGGCAGGAGAGAC
+CGTTGCCGTGGAACATGCCGAGCCGGTTTATTTGCGTAACGAAGTGGCGTGGAAGAAACT
+TCCCGGCAAAGAATGACTCTCACTACTATTACCCCCCATACTTTATGCTGTGGGGTGGAA
+TAGAGGTCGAGAAAAAGGAGTCGCATCATGGCGGTTCAAAAACGGTTAATAAAAGGGGCG
+CTGGCGTGCGCTTTTGCGCTTATGCTGAGCGGTTGCGTGACTATCCCGGATGCCATTAAA
+GGTTCGAGTCCGACGCCGCAGCAGGATTTGGTGCGGGTGATGAATGCGCCGCAGCTCTAT
+ATCGGGCAAGAGGCGCGTTTTGGCGGCAAAGTTGTGGCGGTACAAAATCAGCAGGGAAAA
+ACCCGGCTTGAAATCGCGACCGTACCGCTCGACAGCGGCGCGCGTCCTGTTCTGGGCGAA
+GCCTCGCGCGGCAGAATTTTTGCCGATGTGAACGGTTTTCTGGACCCGGTGGACTTCCGT
+GGCCAGTTAGTTACCGTTGTCGGCCCGATAACCGGCACGGTTGACGGTAAAATCGGCAAT
+ACGCCGTATAAATTTATGCTGATGCAGGCTACCGGCTATAAACGCTGGCATCTTGTTCAG
+CAGGTCGTCATGCCTCCACAGCCGATCGATCCGTGGTTTTACGGCGGACGCGCCTGGCCT
+TATGGCTATGGCGGTTGGGGATGGTATAACCCTGGACCCGCAGAGGTTCAGACGATAGTA
+ACAGAGTAACCCTTTGTTTTATCAATAAAAGAAACAGCGGCTGGTCCGCTGTTTCTGCAT
+TCATAGAGACATAATAAAAATAAATAGTGACGCGCTTCGCAACCTTTCAGTTGCGTAATT
+AATAAACTGGTACGCTGAGTTAATATAATGTTAACGACTTGTTTATTAACTGGGGTTGTG
+ATGACGACGAACACTCATTTTAGAGGTGATGCATTGAAGAAGGTTTGGCTTAACCGTTAT
+CCTGCTGATGTTCCGGCGGAGATCAACCCTGACCGTTATCAATCCCTGGTTGAACTGTTT
+GAACATGCGGCGACGCGCTATGCCGATCAGCCTGCGTTCGTCAATATGGGGGAGGTAATG
+ACCTTCCGTAAATTAGAAGAACGTAGTCGGGCATTTGCGGCTTATTTACAACAAGGGCTG
+GGACTCAAAAAAGGCGACCGTGTGGCGCTGATGATGCCAAACCTGTTGCAGTATCCTGTC
+GCGCTATTTGGTATTTTACGCGCTGGCATGATTGTGGTGAACGTTAACCCGCTGTACACG
+CCGCGCGAACTTGAGCATCAGCTTAACGATAGCGGCGCGGCGGCAATCATTATTGTTTCT
+AACTTTGCCCATACGCTGGAAAAAGTAGTCGAGAAAACGTCGGTACAGCACGTTATTCTG
+ACGCGGATGGGCGACCAGCTTTCTACCGCCAAAGGTACGGTTGTTAACTTTGTCGTGAAA
+TACATCAAGCGTCTGGTGCCAAAATACCACTTGCCAGATGCGATCTCGTTTCGCAGCGCG
+CTACAGCATGGCTACCGTATGCAGTATGTCAAACCCGAGGTTGTCGCTGAAGATCTGGCT
+TTCCTGCAATATACCGGCGGTACGACGGGCGTGGCGAAAGGCGCGATGTTGACCCACCGC
+AATATGCTGGCGAATCTGGAGCAGGTGAAAGCGACCTATGGGCCGCTGCTGCACCCGGGG
+AAAGAGCTGGTAGTGACCGCGCTGCCGCTGTATCACATTTTTGCCTTAACCATGAACTGT
+CTGCTTTTTATCGAGCTGGGTGGGCAAAACCTGCTGATTACCAATCCGCGTGATATCCCC
+GGCCTGGTCAAGGAGCTGGCGAAATATCCATTTACGGCGATGACTGGCGTTAATACGCTA
+TTCAACGCCCTGCTCAATAATAAAGAGTTTCAACAGCTGGATTTTTCTTCGCTGCATCTG
+TCAGCCGGCGGCGGGATGCCGGTGCAAAACGTCGTTGCGGAACGTTGGGTAAAGCTGACC
+GGGCAATACCTGCTGGAAGGCTACGGGCTGACCGAGTGCGCCCCGCTGGTGAGCGTCAAC
+CCGCATGATATTGATTATCACAGCGGCAGTATCGGCCTGCCTGTACCGTCAACAGAAGCC
+AAACTGGTGGATGACGATGATAACGAAGTCGCGCCGGGTGAGGCCGGAGAGCTTTGCGTG
+AAAGGCCCTCAGGTTATGCTGGGATACTGGCAGCGTCCTGACGCGACGGATGAAATCATT
+AAAGATGGTTGGCTGCATACGGGCGATATTGCGGTTATGGATGAAGATGGCTTTCTGCGG
+ATTGTCGATCGTAAGAAAGATATGATTCTGGTTTCTGGTTTCAACGTTTATCCAAACGAA
+ATTGAAGATGTGGTGATGCAGCATTCTGGCGTGCAGGAAGTCGCGGCGGTTGGCGTGCCT
+TCCGGTAGTAGCGGCGAAGCGGTGAAGCTTTTTGTGGTTAAGAAAGATCCGGCATTGACT
+GACGATGCGTTGATCACCTTCTGCCGTCGCCATCTGACCGGATATAAGGTGCCCAAACAG
+GTAGAGTTTCGCGAGGAATTACCAAAATCTAACGTTGGGAAAATTTTACGACGAGAACTG
+CGTGACGAAGCCCGTGGCAAAGTAGACAATAAAGCCTGAGCGTTAAGTCAGCTAACGAGA
+GACGCCGGTTAAGCCGGCGTTTTTTTTGGCGCGAACCAAAGAGAACACGATTTGAATTAC
+CAAATGATTGAAACGGACGATGCGCTGGCGAGCCTGTGTGAGGCTGTCCGCGCATGTCCG
+GCTATTGCTTTAGATACGGAATTTGTCCGTACCCGCACCTATTACCCGCAGTTAGGATTG
+ATCCAGTTATTTGACGGGGCAAATGTCGCCCTGATCGATCCGCTCGGCATCAGCGACTGG
+TCGCCGTTAAAAGCGGTGTTGCGCGATACGGGAATCACCAAATTTCTGCACGCGGGTAGC
+GAAGATCTGGAAGTATTTCTGAATGCGTTTGGCGAACTGCCGGAGCCCCTGATTGATACG
+CAAATTCTGGCGGCGTTTTGCGGGCGTCCGCTGTCGTGGGGGTTTGCGGCGATGGTAGAA
+GAGTATACGGGCGTGGCGCTGGATAAAAGCGAGTCTCGTACCGACTGGTTAGCCCGGCCT
+TTAAGCGAACGTCAGTGTGAATACGCGGCGGCGGATGTCTGGTATCTGTTACCGATCGCC
+AAAAAGCTGATGATTGAAACTGAAGCCGCAGGATGGCTGCCTGCCGCGCTTGATGAATGC
+CGATTGATGCAGCAGCGTCGTCAGGAGATTCAGGCGCCGGAAGAAGCATGGCGGGATATC
+ACCAATGCCTGGCAACTGCGTACTCGCCAGTTAGCCTGTCTGCAACTTTTAGCTGACTGG
+CGGATACGTAAGGCGCGTGAGCGCGATATGGCGGTGAACTTTGTTGTGCGTGAAGAAAAC
+CTGTGGGCGGTCGCGCGTTATATGCCGGGCAGTCTCGGTGAGCTGGATAGCCTGGGGCTT
+TCCGGCAGCGAGATTCGTTTTCACGGCAAGACGTTGATATCGCTGGTGGCGAAAGCACAG
+GCGTTACCGGAAGAGGCATTGCCGGAACCCCTGTTGAATCTGATGGACATGCCGGGCTAT
+CGCAAAGCGTTTAAGGCCATCAAAGCGCTGGTGGCGGAGGTGAGCGCGTCGCATCACGTC
+AGCGGCGAGCTACTGGCATCGCGTCGGCAGATTAATCAGTTGCTTAACTGGCACTGGAAA
+TTAAAACCGCAAAATGGGCAACCGGAATTGATTTCCGGCTGGCGCGCCGAACTGATGGCG
+GAGAAGTTAACTCTTCTGTTGCAGGAGTATCCGCGTTAACGGCGGTAATTGCCGGGAAAA
+CGGCCAGTGAAATAAATGTCCGTATTCGGAATAATGTAAAAAAATAAAAAAGGCAGATTC
+TTCTGCCTTTTTTAATCCAGGAATTTTCCCATAAAAGAGCTTATTTTGACTCTTCGGCTT
+CCGGCAGCGTTACGTTAAGTTCAAGGATGGAGATATCACCATCTTTTTGCTCAAGCTGGA
+CGGTAACCATTTCCGGATCGATTTGTACGTATTTACAAATGACCTCAAGAATATCTTTAC
+GTAACTGCGGTAAATAATGCGGTTCGGCATCGCTACGGCGACGTTCCGCGACAATGATTT
+GCAACCGCTCTTTTGCAATATTAGCGGTACTCTTTTTCCGCGAGAGAAAAAAATCCAGTA
+ATGCCATAATTTATCCTCCGAACAGGCGTTTGAGGAAACCTTTCTTCTCTTCTTCAATGA
+AGCGGAAAGGACGTTCTTCTCCCAACAGACGATCTACGGTATCTGCATAGGCTTTACCCG
+CATCCGCAGTGGCGTCAAGAATCACCGGTTCACCCTGGTTAGATGCGCGCAGTACGGATT
+GATCTTCCGGGATCACCCCGACGAGTTTAATACGCAGAATCTCCAGTACATCTTCCATGC
+TGAGCATGTCGCCTTTATTGACGCGGCCTGGATTGTAGCGCGTCAACAGGAGATGTTCTT
+TAATCGGTTCTTCGCCATTTTCTGCGCGACGAGATTTCGATGCCAGAATACCCAGAATAC
+GGTCCGAGTCACGGACAGAAGAGACTTCCGGGTTAGTCGTGATGATCGCTTCATCGGCAA
+AATAGAGCGCCATCAGCGCCCCGGTTTCGATACCCGCCGGCGAGTCGCAAACGATGAACT
+CAAAGTCCATCGCTTTCAGTGAGTCCAGTACCTTAGCGACGCCTTCGCGCGTTAGCGCGT
+CTTTATCCCGGGTCTGCGACGCCGGAAGAATGAAGAGATTTTCAGTACGCTTATCTTTGA
+TCAGCGCCTGATTCAGTGTCGCATCGCCCTGAATGACGTTTACAAAATCGTAAACGACAC
+GACGTTCGCACCCCATAATCAGATCGAGGTTACGCAGTCCGATATCAAAATCAATGACGA
+CAGTTTTCTTTCCCTTCTGGGCCAAACCTGTAGCGATGGCCGCGCTGGAGGTGGTCTTGC
+CAACGCCCCCTTTACCCGAAGTAACAACAATAATGCGTGCCATAAAAATTCCTTGTTAAA
+AAGGGATCAATTCAACGGTTGAACTGTCAAAGCGTTGTCTGCTAAACGCAGGCGCGCCGC
+TTTGCCATAAAATTCTGCCGGGATTTTATCACTCAGCCAGTAAACACCTGCGATAGAGAC
+CAGTTCTGCCGTCAGATGGGTACAAAAAATTTGCGCTTCCCGATCGCCGCTCGCTCCTGC
+CAGCGCGCGACCTCTCATCATGCCATAGACATGGATATTGCCGTCAGCGATAAGCTCTGC
+GCCAGCGCTGACGTGACTTGTAACAATCAGATCACATTGTGGAGCATAAATGCGCTGACC
+GGAACGAACCGGAACATCAATTAATCGCGTTTTTGTGATGGGATTGGCGTTTTGCGGCGG
+TTCGCTGGGCGTTGCCGGCTCAACGGGCGCAGGCCGAACCGCTTTCTCTTTACCTTCAGT
+CAGTAAAGGAAGACCCATCCGATCGATTTCTACTTTCAGGCTGGTGTCTTTACAGCCGCT
+CACGCCGATAATGCGTAAGCCGGTTGAGGTCACGATCTTATGCAGTTCCGGCCAGTTTAC
+CGGGCTTTCAAGACCGCTAACGTTAATAACGACAGGGGCGTGTTTTAAAAACGCAGGAGC
+CTGCGCTATTTTGTCTTCTAACGCCTGACGAATAACCTCTGGTTCCGCTTCATGCAAATG
+AACCACTGATAAGGTGAAGCTACTGCCTTTAAGCTCGATTGGCGTGTTTGACATCCTGGC
+CTTACTCAATTTGCTATTTATCATCTCCGATACGGAGTGATATTCCGAAGTCCAGAAGGC
+ATGTTATAGTCAGTATTATATTGAGGCAAGTCACCATCCCGTTAATTCAGAGTAAAAGTA
+TGTTTTGTGTGATCTATAGAAGTAGCAAGCGCGATCAAACCTATTTGTATGTCGAAAAAA
+AAGACGATTTTTCGCGGGTGCCTGAAGCATTGATGAAAGGATTCGGTCAGCCGCAGTTAG
+CGATGATGCTGCCGCTTGATGGACGTAAAAAATTAGTCAATGCCGAGCTCGAAAAAGTAA
+AACAGGCGTTAAGCGAGCAGGGCTATTATTTACAATTGCCGCCGCCGCCGGAAGATTTGC
+TGAAACAACATCTTTCTTCGGTAGGACAAAATACGTCGCCCGCTGACCGTTAAACGGTAT
+TCGGCGCCGCGCCTGAATTCCATCATGATCTTAGGGGAAAATATGTATCAACATCGTAAC
+TGGCAAGGCGCCTTGCTTGATTACCCGGTAAGTAAAGTGGTCTGCGTGGGCAGTAATTAC
+GCAAATCACATCAAGGAGATGGGCAGCGCGACGCCGGAAGAACCCGTGCTTTTTATCAAG
+CCGGAAACCGCATTGTGTGATATTCGCCAGCCGCTGGCGATTCCGGCGGATATGGGGGCT
+GTTCATCATGAAGTTGAGCTTGCTGTGCTGATTGGCGCAACGCTCCGCCAGGCGACCGAA
+GATCATGTACGTAAAGCGATAGCCGGTTATGGCGTGGCGCTTGATTTAACCCTGCGCGAT
+ATTCAAGGGAAAATGAAAAAGGCCGGACAGCCCTGGGAAAAAGCCAAAGGTTTTGATAAC
+GCATGTCCGATTTCAGGCTTCATCCCTGTCGCGGCCTTCTGCGGCGATCCGCAAAATACG
+GTTATCGGACTTAACGTTAATGGCGAGGTTCGCCAGCAAGGGTCGACCGCGGATATGATT
+CATCCTATTGTGCCCCTTATCGCCTATATGAGCCGCTATTTTACGCTCAAAGCCGGGGAC
+GTGGTGCTAACCGGCACGCCGGCAGGCGTGGGGCCATTATTAAGCGGCGATGAGCTGGAC
+ATTCGTTTTAATGGCGAAACGTTGTCTACCCGCGTTCTGTAAAATCTGCTTGCCGCCTTC
+AGCGGCGGTAAAACTTGCATCTGCAGGCCAGACTGGTTATAAGGTGCAGCTTTAGTGCAA
+TGGCGGATACTTTAATGAGCGATACACCTTTCTGGCAACGTAAAACCCTGGATGAAATGA
+CCGATGCCGAGTGGGAGTCGCTGTGCGATGGCTGCGGTCAATGCTGCCTGCATAAGCTGA
+TGGATGAAGATACAGATGAAATCTACTTCACCAACGTGGCGTGCAGGCAATTAAATATCA
+AAACGTGCCAGTGCCGTCATTATGAGCGCCGTTTTGAATTTGAACCCGACTGTATCAAAC
+TCACTCGCGAAAACTTGCCAGACTTTGAATGGTTGCCGATGACCTGCGCCTACCGTTTGT
+TGGCGGAAGGTAAGCCCTTGCCGACGTGGCATCCGCTGCTGACTGGATCGAAAGCTGCTA
+TGCATGGCGAGCGAATTTCTGTCCGTCATATCGCGGTTAAAGAATCTGAAGTACGGGACT
+GGCAGGATCATATTTTAAATAAACCGTCGTGGGCAGAATAAGTCTTCGGCAAAACGGCTG
+ATTGTTTACAATTCTTTAATTTACGCTGGGCGGCCCCTGAAGCCAGGAATTGCGTGCAAA
+TTCCGTCACCTGGCGTTATCACTGCCTTCTCTTCTTCCCTGACGCGCCTTGTCGCTGCGC
+TCGCGCACGTATGGCGGCGACTCTATACTTTCAAAGCAGTATATCGCTGCCTATCCTGAG
+GAGTTACCCCATGAATAACCAACCGTTGCGCGTTTCAAAGGATCAGCCCAGGAAGCCTGA
+TAAGACACCCGAAGACGAAGGAAAAAATCCAAAGAAAAACCAAAAGTAGTGCTGTAGGGT
+ATCTTTAATAACTATGGTTCGTTGGAGGCTTTATGTCTGAACGTCCTGATTTAGTCGATC
+CATTACCAGAGGATGAGCCGCTTCCTGGTGAAAATATTCCGGATACACCAGAGGGAGACG
+ATCCTCTCGACCCGGATACCCAGAATGAGGTTGAAGATCCTCGTAGATAGCGTCTTGTGC
+TATTAACCAACCGCCTGATGCACCGTCTGTGCCAGGCGGTTTTTTACATCTTCTAAAGCG
+AAACATCCTGATAATCCTCAGAAAGATAGCCTATAATTTTTTGTACGTTAAAATAGTAGC
+GCGTCCATGACGACACTGTCTTATTGCGCTTAGCCGTTTGCGAGTTCAAAGGAGGAAATC
+AATGAACAGCGAAGAGTTGACACATAAAGCAGAAGAGGAAATCGCGGCACTCATTAGCAA
+AAAGGTCGCCGAACTACGGAAGAAAACCGGGCAAGAGGTTTCCGAAATAGAGTTCGCGCC
+GCGAGAAACGATGAAAGGGCTTGAGGGATACCACGTTAAAATTAAACTACTCTAGCGTTT
+AATTAGCGCCATTAATCACCTGGCTACTGGGCGGGACGCCGCCCAGTGGTGACTGGTTTA
+CCGATGTCAGGCTTTTTTCTGTTGATACATTTCCTCGCCCTGATGGTCTTCCTCTACCCA
+AAAATGAATGTTGAACCGCGCATCATCGCTCAGCTCTACCCGATGCCAGTATTGCGGCGG
+ACTGGTGGCGAATTGCCCGGCATTAATCACCACTTTCACTTCGGGTTCTGTCGCGGTTTC
+ATTCGCAAAGCCATAGTAGGTCACGGTGCCTTCCATCACGCAGAGTTGTCCGAAAACGCC
+TGCCGCTGTGTTGTGATGAGAGAGCAGTGCCGCCGGAACATTCTCTTTGGTGAAAAAGGG
+GGTAGAGCGTTTAACTTTCCAGTTTGCCGGGATGCGTAAGTGGGACATAAGACATCTCCC
+TGATGTGGTAATTAAAAGATGTATTTAATATACACCTTTTAATTACTGGCAAACAACGCT
+TCGGGCAAAAAAAACGCTCCCGAAGGAGCGTGTGTATCAACGACCGAACAGGTCGCGTTT
+TTTAGGCTTAAATGCCTGGGCTATGACGACGGCTATCGCCACCACAAGGTAAGCGGCAAA
+GATCCCCAACAGCCATTGCGGCATCTCCAGCGTTAAAAACGACCACTGGCGTTCGGCGCA
+ATCACCGGATGCCACAAACACCTGCGGCAGCCATTTACCCAACGGCAACCAGTCTGGAAA
+GCGCGCCATAAAGTCACAGGTCATGAACGGCGAGGGATGCAACTGAATCATCGTATGTTC
+ATACGCCAGTTGTAGACCCCGCCATGCGCTGTAAATCCAGATAACCATGGCCACGTATCG
+CAGCGGTGTTTTCGGCGCTATAGCGCCGACCAGACCCGCGCCCATCACGCCAAACAGGGC
+GCAACGTTCGTAAATACATAGCACGCAAGGTTTAAGTAACATGACGTGCTGGAACCACAG
+CGCCACCATTTCCAGCGCCAGGGCGGTAAACGCCATCAGTAACCATGCGCCCCGACCCCG
+TGAGCACTGGTTTAAAAATCGCAACATAATAATTTCCCTGCAACATGCGTAGAGACCGCA
+GTGTAAACCAATTCAATTCGTGCGCCACTAGCGGGAAATGAAATAATGTGTAATTGGATA
+ATTATCAGGCAAAAATCGGAGCCGGGCGGTGTATTGCCCGGCCAAACGTTACGAAAGCGT
+TGCTAACCATCCTGCCTGAGTCATCCATTCGGTGGCCGGCGCAAGAGTGAATTCGACGCA
+CAGTAGCCCTATCAGGGTCAGTACGATAGTGTACGGTAACGCCATCCAGACCATACGGCC
+ATAGGAGAGACGGATTAACGGCGCCAGCGCGGAGGTCAGCAGGAATAAGAATGCCGCCTG
+ACCATTTGGCGTCGCTACCGATGGCAGGTTAGTACCGGTATTGATGGCCACGGCTAGCAG
+CTCAAACTGTTTTAAGCTGATTGCGCCGTTTTCCATTGCCGCCTTCGCTTCGTTGATATA
+AATGGTGCCGACAAAGACGTTATCTGAGATGGAAGACAACAGGCCGTTAAAGAGATAGAA
+CAGCGTTAGCTGCGCGTGTTCAGAGGCTTGCAAGACGAACTGAATAATCGGCGCGAAAAG
+ATGTTGATCGATAATAACCGCCACAATGGAGAAGAAAACGGTTAACAGCGCAGTAAACGG
+CAGCGACTCGGTAAACGCTTTGCCGATGGCGTGTTCATCGGTTACACCCGTTAACGCGGT
+GGCCAGAATAATGACCGACAGACCAATCAGTCCCACCTCCGCGAGATGGAGGGCGAGGGC
+GGTAACCAGCCAGACGCCAATAACCGCCTGGACTATTAGTTTAATTTTATCCTGGCGGGT
+GCGCTTCTTACGGCTTTGATCGTCGAATTGCTGTAAAACATCGCGGACTTTTTCGGGCAA
+CGTTTCGCCATAGCCAAACCAGCGCATTTTCTCGACCAGCATACAGGTTAACAGTCCACA
+TACCAGTACCGGGACGGTGACAGGCGACATCCGCAAAAAGAAGTCGCCGAAATGCCAGCC
+AGCCGCTTTAGCGATGATCAGGTTTTGCGGCTCCCCGACCATGGTCATGACGCCGCCCAG
+CGCCGTCCCCACGCCTGCATGCATCATCAGACTACGCAAGAATCCGCGGAATTGCTCCAG
+CACCGTTTTGTAATGCGGATCGATATGGCTGTCGTCCAGCATATCGTTCTCTTCGCCGCG
+CGATGAGGCCACACGATGGTAAATCCCGTAAAAACCGACGGCGACGCTGATCACCACCGC
+AACGACGGTAAGCGCGTCAAGGAAAGCCGACAAGAACGCGGCGGCGACGCAAAAGGCCAG
+CGACAGAACCATCTTCGAGCGGATACTGAGTAACAGACGGGTAAAAATAAACAGCAATAA
+CTGCTTCATAAAGTAGATGCCTGCCACCATAAACATCAGCAGCAGCAAGACTTCCAGGTT
+GGCGGCAACCTCTTCACGTACATGGGCGGCGCTGGTCATACCGATGATAACGGCTTCAAT
+GGCCAGTAACCCGCCGGGCAGCAGGGGGTAACACTTTAACGCCATCGCCAGAGTGAAGAT
+AAACTCTGCCACCAGCAGCCAACCGGCAATAAAGGGATTAGCTAAGAAAATGAATGGGTT
+AACAATTAAAAAGACAAGTAGTGCCAGTTTGTACCAGTCGGGCGACTGGCCTAAAAAGTT
+GCGCCACATGGCGCGACCCCATGAGATCTCCATGAAATTTTTCCTTACCTAGAAAAATGA
+AATAGCGTTTTTATGTTTAAACACAGAGAGTAGCGAGCGCGACGAATGCAAGCAAGTCCT
+TAACGATATTGGCAGGCGATATCAGAAATGGTGCCTTGATCCCCTTTTTCTTCATTGCGT
+CCGCTATCAGGTGTTACGCCCGTCTGGTATGATGAGTGCAACTATGTTTTGCTGTGTAAT
+GGAAATCTCACTATGGTCATTAAGGCGCAGAGCCCGGCGGGTTTCGCGGAAGAGTATATT
+ATTGAAAGTATCTGGAATAACCGCTTTCCTCCTGGCACGATCTTACCGGCAGAACGAGAA
+CTCTCCGAACTGATCGGCGTGACGCGCACGACATTACGCGAGGTGTTACAGCGGCTGGCG
+CGAGATGGCTGGCTGACCATTCAGCATGGCAAACCGACAAAGGTTAATAATTTTTGGGAA
+ACGTCAGGGCTGAATATCCTTGAAACGCTGGCCCGCCTTGATCATGAAAGCGTTCCGCAA
+CTGATCGACAATTTGTTGTCGGTGCGTACCAATATTTCTACTATCTTTATTCGTACCGCG
+TTGCGTCAACACCCGGATAAGGCGCAGGAAGTGCTGGCCACTGCCCACGAAGTGGCCGAC
+CATGCCGATGCATTCGCCGATCTGGACTATAACATCTTTCGTGGTCTGGCATTCGCCTCC
+GGCAATCCTATTTACGGCTTGATCCTGAACGGCATGAAAGGGTTATACACCCGCATTGGT
+CGCCACTATTTCGCCAATCCGGAAGCGCGCAGTCTGGCACTGGGTTTCTATCATAAATTA
+TCGTCGTTATGCGAGCAGGGCGCGCACGACCAGGTGTATGAAACGGTGCGACGTTACGGG
+CATGACAGCGGCGAGATTTGGCATCGGATGCAGAAAAATCTGCCCGGCGATTTAGCGATT
+CAGGGACGATAATCCCGCGATGCCCGGTAGGCGCAAACACTACCGGGCAGCATCTCGATT
+ACAGCGTGTTCATGCGCGGCGGACAACGCTCCAGCAGTTCTACGCTGCCATCCTCATTTT
+GTTGCTCCAGCATCACATCAAAGCCCCATAACCGATGCACATGTTTCAGCACCTCTTTGC
+GGCCTTTATCCAGCGGTGCGCGGTTATGCGGGATATAACGCAACGTCAGCGATCTGTCGC
+CGCGTAAATCCACATTCCAGACCTGAATATTCGGCTCCAGGTTGCTCAGGTTATACTGTG
+ACGACAGTTTTGATCGAATCTCCCGATAACCTTCTTCGTTATGAATGGCGGAGATCTCCA
+GATAATTATGCCTGTCATCATCAAGTACCGTGAAGAAACGGAAATCACGCATCACTTTTG
+GCGACAGGAACTGGCTGATAAAGCTTTCATCTTTAAAATCGCGCATGGCGAAGTGCAGCG
+TTTCCAGCCAGTCGGAACCGGCAATATCCGGAAACCAGTATTTATCTTCATCCGTGGGCG
+ACTGACAAATACGTTTGATATCCTGGAACATGGCAAAGCCGAGCGCATAGGGGTTAATTC
+CGCTATACCAGGGGCTATTATAGGGCGGCTGAAATACGACATTGGTATGGCTGTGTAAAA
+ACTCCAGCATAAAGCGTTCCGTCACTTTGCCTTCATCATACAGATGGTTCAGGATGGTGT
+AGTGCCAGAAGGTCGCCCAGCCCTCGTTCATGACCTGCGTCTGTTTCTGCGGATAAAAAT
+ACTGGCTGACTTTACGCACGATGCGCAGAATTTCGCGCTGCCACGGCTCGAGCAACGGGG
+CGTTTTTCTCCATAAAATAGAGCAGGTTTTCCTGCGGTTCAGCGGGAAAGCGGCGTGCTT
+CGGCGACAGTTTTTTCTTCCTCGCGTTTTGGCAGCGTGCGCCACAGCATATTCACCTGGC
+TTTGTAGATACTCTTCCCGGCTTTTTTGTCGCGCTTTCTCTTCCTGCAACGAGATTTTCT
+GCGGGCGCTTATAGCGATCGACGCCGTAATTCATCAGCGCGTGGCAGGAGTCGAGCAGTT
+TTTCTACTTCATCCACTCCGTAGCGTTCTTCACAGCGGGTAATGTAATTCCGGGCGAAAA
+TCAGGTAGTCGACGATAGAGCTGGCATCCGTCCAGCTCCGGAAGAGATAATTATTTTTAA
+AAAAGGAGTTGTGGCCGTAACAGGCGTGCGCCATGACCAGCGCTTGCATGGTGATGGTGT
+TCTCTTCCATCAGGTAGGCAATGCAGGGATTAGAGTTGATCACAATTTCATAAGCCAGTC
+CTTGTTGACCATGCTTATACAGACGTTCCGTCTCAATGAACTTTTTGCCAAACGACCAGT
+GCGGATAGTTGATCGGCATCCCGACGCTGGAGTAGGCGTCCATCATCTGTTCGGAAGTGA
+TGACTTCAATTTGGTGCGGGTAAGTATCCAGTTGGTAGAGCTTCGCCACGCGGTCTATCT
+CTGCCAGATAGACATCCAGCAGATCAAATGTCCAGTCGGGTCCATCGCTCAAACGTGTGG
+TGTCCTTGTTCATGGAATCAATCATTGCCATTCGCGCACCCTCATTGTTGGCGACGCTCT
+CTGTATGGAGCGCCTCCTTTCAAGCATAGAACACCATGTTAAAAAACGACTTGATCGTGA
+AAACTTTTCTTTGCGATTTCCTCCACATTGAACGGCAAAAAATCGGGTATTGGCATCATT
+TTATGCTGTATAGCCATGCCGCGTAGCAGGAGATCCCAAACCAGTGGGATCGCTTGTCTT
+TAGGGTATATGTGAAGCACGTCACCATAAAAAAGTCATATGTTGAATAATATTTTCATCT
+GGGTTATCAAGATGTAATCAGAAGATTGTTCTTTTACTATTAACGGAGTGGCTATGCGAG
+TTGTCATCCTGGGGAGTGGCGTAGTTGGCGTGACCAGCGCCTGGTACTTGAGTCAGGCGG
+GGCATGATGTCACCGTCATCGATCGCGAATCCGGCCCGGCGCAAGAAACCAGCGCGGCGA
+ATGCCGGACAAATTTCACCGGGATATGCGGCGCCCTGGGCGGCCCCTGGCGTACCGCTGA
+AGGCGATAAAATGGATGTTCCAGCGCCATGCGCCGCTGGCGGTGCGTCTGGATGGCACCC
+CATTTCAACTGAAGTGGATGTGGCAAATGCTGCGTAACTGCGATACCCGGCATTATATGG
+AAAATAAAGGCCGCATGGTGCGCCTGGCGGAATATAGTCGCGACTGTCTGAAAACGCTAC
+GCGCCGCGACCGGTATCGAATATGAAGGCCGCCAGGGGGGAACGCTACAACTCTTCCGCA
+CCGCGCAACAGTATGAGAACGCCACCCGTGATATCGCCGTGCTGGAAGATGCCGGGGTGC
+CGTATCAGCTCCTGGAATCCAGCCGACTGGCGGAAGTTGAACCCGCTCTGGCTGAGGTTG
+CGCATAAATTAACCGGCGGACTGCGCTTACCGAATGATGAAACCGGGGACTGTCAGCTCT
+TTACCCAGCGTCTGGCGCGCATGGCGGAGCAGGCGGGCGTAACCTTTCGCTTTAATACTC
+CCGTGGAAAAATTACTGTACGAAAATGATCAGATTTACGGCGTGAAATGCGCCGATGAGA
+TCATTAAAGCAGATGCGTATGTTATGGCGTTTGGATCGTATTCGACGGCGATGCTTAAAG
+GCATTGTTGATATCCCGGTGTATCCGCTGAAAGGCTATTCATTAACCATCCCAATCGTCG
+AGCCAGACGGCGCGCCGGTATCGACGATTCTTGATGAAACCTACAAAATCGCTATTACGC
+GTTTTGATAAGCGTATTCGCGTGGGGGGAATGGCGGAAATCGTGGGCTTTAATACCGACT
+TACTGCAACCGCGCCGCGAGACGCTGGAGATGGTTGTGCGCGATCTCTTTCCGCGCGGCG
+GTCATATTGAGCAGGCCACATTCTGGACCGGCCTGCGCCCCATGACGCCGGACGGCACGC
+CGGTAGTAGGACGCACCCGTTATAAAAATCTGTGGCTTAATACTGGACACGGCACCTTAG
+GCTGGACGATGGCCTGCGGTTCAGGCCAGTTGTTAAGCGATATCTTGTCGGGTCGCACGC
+CAGCGATACCCTACGACGATCTGAGCGTGGCGCGATACCGTTCCGATTTTACGCCCACCC
+CCCCGCAACGTTTGCATAGCGCGCATAACTGATAAAGGAAGTGAAATGACCCGCCCTATA
+CAGGCCAGCCTTGATTTACAGGTAATGAAACAAAATTTGGCTATTGTGCGCCGGGCGGCC
+CCAGAGGCGCGCGTCTGGTCGGTAGTGAAAGCCAACGCCTACGGCCACGGTATTGAACGC
+GTCTGGAGCGCGCTGGGCGCCACAGATGGTTTCGCTATGCTCAACCTTGAAGAGGCGATT
+ACCCTGCGTGAGCGCGGGTGGAAAGGGCCGATATTGATGCTGGAGGGGTTTTTCCATGCG
+CAAGACCTGGAGGCGTATGACACTTATCGGCTGACCACCTGCATCCACAGTAACTGGCAG
+TTGAAAGCGCTGCAAAATGCGCGGCTTAACGCGCCGCTGGATATCTATGTCAAAGTCAAC
+AGCGGCATGAACCGACTCGGTTTTCAGCCTGAGCGGGCGCAGACCGTCTGGCAGCAATTG
+CGGGCAATGCGCAATGTCGGTGAAATGACCCTGATGTCACATTTTGCTCAGGCCGATCAT
+CCGGAAGGTATCGGGGAGGCGATGAGGCGTATTGCGCTGGCGACAGAAGGCCTTCAATGT
+TCATACTCGTTATCAAATTCGGCAGCGACGCTGTGGCATCCCCAGGCGCATTATGACTGG
+GTCAGGCCGGGCATTATTTTGTACGGCGCGTCGCCGTCAGGACAGTGGCGGGATATTGCC
+GATACCGGACTAAAACCCGTGATGACGCTGAGTAGCGAAATTATTGGCGTGCAGACGCTG
+AACGCGGGTGAAAGGGTAGGCTATGGCGGAGGGTATTCTGTGACTCAGGAACAACGCATT
+GGCATCGTCGCGGCGGGTTATGCCGATGGCTATCCACGCCATGCACCGACCGGGACGCCT
+GTGCTGGTGGACGGTATCCGTACCAGAACAGTAGGCACCGTTTCAATGGATATGCTGGCG
+GTGGATTTGACGCCGTGTCCGCAGGCGGGAATCGGCACGCCGGTTGAATTATGGGGCAAA
+GAAATTAAGGTCGATGATGTCGCCTCTGCGGCAGGCACGCTGGGCTATGAGCTACTGTGC
+GCCGTAGCGCCGCGCGTGCCATTTGTGACAACGTAACCTAACTCAGACTAAGGCGTCGAC
+CGGTCCACCTGGGGGCGGGTCGACGTTGCCAGGCGACCTTATTCTGCTTCGTCTTCGGCG
+ACGCGTACCCCAATCTTGCGTACCACGTTATCTTCTTTTTCAGCTACCGTCCAAATCATG
+CCGCCAAACTCCACCTGATCGCCGACGACCGGCGCAGCGCCCAGCAGCTGCTGTATGATT
+TCACCCAGAGTTTGTTGTTTATCCCGGTATTCCGTTCCTTCTTCCAGCCCGTAGATAAGC
+GCCACGTCGGCGAATTTCGCATTCGCTTCGAGGATAAAATCGCCAAAGAAACGCTGATCT
+AACGAAACCGGCGGCGACTGGCTAAACAATTTGCCCAGCGCTGGCAGATCGCGCTCCCGG
+CCAATCACGCAGAGTACGTCGCCTTCCTGCAGGCGAGTGCTACCCGTGGGGTGAAACAGT
+TCATTATTGCGAAATAGCGCGGCAATGCGGGTTTCGTTCGGCATATGCAGGTCGCGCAAC
+GCCGCGCCGACGCACCATTTGTCGGCGCTCAACTGATAAATGAATTGCTCCCACGGATTA
+TCAGGATGGATGTCAAGCCCCACGCGCGATACTGGCCAGCCAACCGGAGGCACGACCACT
+TTAGCTCTCTTCGCCGCCCATGACAGCGATGTTCCCTGCAGGAGCAGCGACACCAGTACC
+ACAAAGAAAGCGACATTAAAGAACAGGCGAGCGTTTTCAAGCCCGGCCATCATCGGGAAA
+ACGGCGAGAATAATCGGCACCGCGCCGCGCAGTCCAACCCAACTGATGAAAATGCGCTCC
+CGAAGATTGAAGCCGCGAAATGGCAGCAGGCCGGTAAACACCGACAGTGGGCGGGCGAAG
+AAAATCATCCAGATGGAGAGAATAAGCGCAGGGACGGCAATCGGCCACAGATCGGAAGGC
+GTCACCAACAGCCCCAGGACCAGGAACATCGCGATCTGCGCCAGCCAGGCCAGTCCGTCA
+AAGTTTTGCAGGATGCCGTAACGGTTGCGAATCGGGCGGTTTCCTAACAGGAATCCGCAC
+AAATAGACCGCGAGAATGCCGCTGCCTTCAAGCGCGGTCGTCAAAGCAAAAATCAGAATA
+CCGCCGCTGAGCGCCAGCATCGGATACAAGCCGCTGGGCAGAGAAATACGGTTGATCATC
+TGCTGTAGCAGGTAACCGCCGCCCAGGCCAAAAACAATACCGAGACCGAACTGTTGGATA
+ATATGGACGGCAAACATCCAGTCCAGGCCGGTTTCATGCTTCTGGATCATCTCAATTAAT
+GTAATGGTCAGAAAAACGGCCATCGGGTCGTTACTTCCCGATTCGATCTCCAGCGTGGAG
+CCTACACGTTCGTTTAGCCCTTTGCCGCCAAGCAGAGAAAAGACCGCTGCGGCGTCAGTG
+GAACCGACTATCGCGCCGATAAGCAGACCTTCGATAAGATCCAGATGAAACAGCCAGGCG
+GCCATCATACCTGTTAACCCCGACGTGATTAGTACGCCGAGCGTCGCCAGCGACAGCGCG
+GGGCCCAGCGCTACCCGGAAAGAGCTGGCCTGGGTGCGCATGCCGCCATCGAGTAAAATA
+ATCGCCAGCGCCAGGTTACTGACCATATAAGCGAAAGGATAATTATCGAAAGGAATACCG
+CCAATGCCATCCACACCCGCTAACATCCCAATGGCGAGAAAAATGACCAGAATCGGGATA
+CCCAGTCGCGATGAGAATGAACTTAACAGGATACTGCTGGTTACAAGGATGGAACCTAAA
+ATAAATAGACTAATAATTGTTGCAGCATCCAACGTTTTATATCTCCTGACTCACACGACT
+TCGTATTATTTAACATTAACATAATAACGGCCAGGGCAGCGTTTTACTTAGCCTGTCGGG
+GACTTTTTTTACAATTGCAGCGTAGGATGACCAGATAAAGTGAGTTGAGTCCCCTGGCGC
+GTATTTTTAAGCGTCGCGTTTGCCCCGATAGGGAGCGTTACCGTACGCTGTTCATGCCCG
+AAGTCGAGACCGGTAATCAGCGGAACGGACAGACGGGAACGTAAAAACGCGTAGACGCTC
+TCCAGAGAATAGCCGGCGTCATACTCGTTGGGCGCCGCGCCGCTAAAGCTGCCGAGAACG
+ATGGCGCTCTGGCGGTTTAAAATTCCGGCGTACTCCAGTTGCAAAAGCATACGCTCCACC
+CGGAAAGGATGCTCATTGACATCTTCCAGCACTAAAATTCCTTTATCGATAGTCGGCATC
+CAGGGCGTACCGATAAGGGAAATCAACATCGCCAGATTTCCGCCCCATAAGGTGCCCTGT
+ACGTCGCACTGAGGGCCGTCGCCTTGCCACTCTACGGTAAATTGCGCCTTGCGTAGCGCC
+AGCCAGAAATGTTGCTCGGTGAACGTATTCAGCGTTTCGGCGCCAAAATTTGCCGCCAGC
+ATAGGACCGCTAAAGGTGATGACATTGGCCTGCGCCAGGAGTCCAGCCTGAATCGCCGTA
+AAATCGCTATGACCGCAAATCAGTAAGGGATCGCGCTGTTGCCGGGAGGCGAGCGCCTGC
+CAGTCGATACGATCCAACAAGCGGCTGGCGCCATAGCCGCCGCGAACCGGCATGACGATT
+GTATCCGGCGACGTTAGCGAGGCCAGCGAATTAACATCGGCCAGCCGTTCCGCGTCCGTA
+CCGGCAAAACGCTGAAAGCGGCGACGAATCACCTCGTCATTCTCCACCTGATGACCCGCG
+TCAGTCAGGCGCTGAACGCCGCGTAACGCGGCCTGTTGGTTAATACAGTAGCCCGACGGG
+GCGATTAAATGAAACAGAGACATGGTAATTCCTTGCTGACAATAGAATGCAAATGTATAT
+CATGCCGCATATATTAGGCGATGTCCCTCGTTGTGCGACGTTTCTGGATGCGCACCAGGG
+AGGCAACCTAAGTGCCTGGCCGGGGCGGTATGACCTCTTCGGCAGATAAGTTACGGCTAT
+AAGGATAGATGACGTGAAATTAAGATGGTTTGCTTTTTTGGTAGTAATACTCGCTGGCTG
+TAGCTCAAAACAGGATTACAGGAATCCGCCGTGGAATGCCGAAGTGCCTGTAAAGCGTGC
+GATGCAGTGGATGCCCATCAGTGAAAAAGCCGGGGCGGCATGGGGGGTTGATCCGCATTT
+AATCACCGCGATTATCGCCATTGAATCCGGCGGCAACCCTAACGCGGTTAGTAAGTCCAA
+TGCGATTGGCCTGATGCAGTTAAAGGCGTCGACCTCCGGGCGCGACGTTTACCGTCGTAT
+GGGCTGGCGTGGCGAACCGACCACCAGCGAGCTGAAAAACCCTGAGCGTAACATCTCAAT
+GGGCGCGGCGTATTTGAGCATTCTGGAAAATGGGCCGCTGGCCGGCATCAAAGATCCGCA
+GGTGATGCAATATGCGCTGGTCGTCTCTTATGCTAACGGCGCAGGCGCGTTATTGCGTAC
+TTTTTCATCCGACAGGAAGAAGGCGATAGAAAAAATTAACGATCTGGATGCGGACGAGTT
+TTTTGAACATGTTGTTGATAATCATCCCGCGCCGCAGGCGCCGCGCTATATCTGGAAGCT
+TCAGCAGGCGCTGGACGCCATGTAGTTTAGCGTGAAGATTATTCTCGCACTTTATTCGCT
+CTTTCTCGGGCCTCGCGCTCAAGCGAAAAAATAATCCGCTGCAACTCCCGCTCTACCGCC
+GGGCTGACGTTAAGGAAACGAAAGCTCAGGCGGGGAGTGGTGATCGTTTCATTTTTCCCA
+TCAATCACCTTACGCTCGCTGATGGCGATAAGCTGGGCGTCAACGTGAAAAATACCCCAT
+GGCCCCATGTTCAGTTCAACCTGCGAAAAGCGCGCGCCTTCGATTAGTCCGTCGGGGATG
+GCGGATTCCAGTAGCGCGCCCATGCCGCCCAGGGAAAGATCAAACAGGCGAAAACGTAAC
+GTACGGGTGTCCGGTAGCGTGGTGACGCCGTAATAAGGCGGATACAGCGGCGCGCCAATA
+CGAAAATACTCCCGGCGCTGGACAAACCACAGTGACGACGGCAGGGGCGTGATAAAGGCC
+GGCAGCCGCTGATATTCGCCTGTAACGAGTTGCGGCAACGTGAACTCGACTTTTGCGCCC
+TGTGTTTCTGCGATAATGGCTACCTGCCCGGCACGTAATACGGCGCTATTTTCATATTCC
+TGGCTGCCGTAATCCACGATGAGTTTTTCCGGGTCTACCGCCAAAATTTTACTAATGAAT
+TGACCATGCGCCCATGAAATACGCAGTGGAACCTGATTTTTATTTAAATCCCGTAGCACG
+CCTAATATCGCTAATGGATTTTTTTTCAGGAACTGCTCATTGTAACCACTCACACGAAAT
+AACCCCTGATACGCAGACTATCGTTGGGTTATCGGCATCGGTAGAAAGAACTTAATAGCG
+ATAAATAAATTTTTATGTCCGCGAGATAAATCAGTGTTCAGAAATGCGACGCTCGACTTT
+GCCTATACTTAAAACGTTTTTACTGGAAAGAGGGTTCGCAAATGGGAATTATCGCCTGGA
+TTGTTTTTGGTTTGATTGCCGGCGTTATCGCCAAATTGCTTATGCCGGGGCGCGATGGCG
+GGGGATTTATCCTGACCTGTATTCTCGGTATTGTCGGGGCGGTCGTTGGCGGATGGCTGG
+CGACGATGTTTGGTATTGGCGGCAGTATCAGCGGCTTTAATCTGCACAGTTTCCTGGTCG
+CCGTGGTGGGCGCGATTATGGTGCTGGTGATTTTCCGCCTTCTGCGACGCGGCTAACCGC
+TGCAGAACGTGTAAGCGTTGACCCGGTCAGCGCCGGGTCAACCTACTATAAACACGCGTT
+ACTGCGTCGCTGCAGACGGCGTTTTTGTCGGCGTTGCGCTTAACGATGCCGGACGAGTAG
+ACGGTACGCTATCGCACGGTTTTTCCTGCGGACAAATCAGATCGAGCATTTTCAGCGTCA
+CGCCGTTGGTCCAGCCAAAGCCGTCCTGAAGTGGATATTCGCCGCCGCCACCGCCGGCTC
+CGGTGCTGCTGACGTCATATTTTTCGACCAGTTTTTTCTCGCGATCGTAGGTGTGCTGCA
+CATTGGTTAAAAAGCGCCAGGTGACTTCCATTGCCACGTCATCCTGCCCATAATTTTGCA
+ATCCTTCGGCAGCGACCCATTGTAACGGCGCCCAGCCGTTTGGCGCATCCCATTGCTGTC
+CGCTTTTAACCGAGGTGGTAGCCAGCCCGCCAGGCTGTAGCAGATGCGCCTGGGCCGCCG
+CCGCCACTTTCGCGGCGCGATCTTTCGCGGCGGCGTTTACATAGAGCGGGAACAGCGCGG
+CAGCGGTGAGTTGGTCACGGATTTTATTGTTCTTCAGATCGTAGTCGGCATACCAACCCT
+CTTTGTTATTCCACAGATGCATTTCAATGGCTTTTTGCCGCGCGTTGGCCAGCGCGTCAT
+AGTGCGAGGCTTTGGCCCGATCGCCCGCCGCAGCGCTGGCGCGGGCGAGGGTTTTCTCCA
+GCTGATACAGCAGAGCGTTAAGATCGACAGGGACAATAGTGGTGGTACGAATGGTACTGA
+GCTGCTGCGGATTATCCATCCAGCGGGAGCTGAAATCCCAGCCGGAGGCGGCAGCAGAAC
+GGAGGTCCCGATAGATCTCCGTTGCCGGGCGGTTGGGGTTGCTTTTGACGGTAGCGATAT
+CTTCAACCCAGGATTCAGGGCGGGGCGTATCCCGATCGTCCCAGTAGCGGTTGAGAACGC
+TACCGTCTTCCAGTTTGACGACGCGTTGGTTTTGTTGCCCTGGCTGCAATGTCTCAACGC
+CCTCCATCCAGTAGGCGTACTCTTTTTGCAGTTGCGGCAGGTATTCTTTCAGCGCATCGT
+CACCTTCATGTTGCGCCAGTAACTCAACCATAAACGCAAAGAAAGGCGGCTGCGAACGAC
+TCAGGTAGTAGGTACGGTTGCCGTTAGGAATATGCCCCCAGGCGTCAATTTCGTAACCAA
+AGTTCGCTACCATATCCGCCACCTTATCCCAGTGCCCGCTTTCCGCCAGCCCCAGCATCG
+TAAAATAGCTGTCCCAGTAGTAAATCTCTCTGAATCGCCCACCCGGTACGACATAGGATT
+CAGGCAACGGCAAGAGCGAGTCCCACTTTTCGACGTTTTTAGTTGAACGGGTCAGCACCG
+GCCACAGGCCATCAATATGTTCACGCAATGACTGCCCGGCAGGCGGGACATATTTTTCAC
+CCGCTTTCGGCAGGGTGAAGTTAACATCAACAAAATGACGCAAATCGAAGCCGGACTGGT
+TCCGCTGCATACGATAATCCGCAAGAATCATGAGCGGATCGCTATTAGGTATGGCGTCAG
+CAAAGGTTTTCTGATCGGGGAAGAGTTTTGCATTCTGGACATCATTAAAGAGCGGGCCAA
+GCAAAATATCCGGCGGCTGCGGAGTTTCAGTGTCGGAAGACGGGTCTGCGGCAGTCGCCG
+AAAACGATGCAAACGTCAGCAGCGTCCCTGCCAGCGCCAGTTTTATGGCTTTCTGTAGTA
+GAACAGAACGGCGAATCTCTGGGGGTATCATCAAGTTATCTCCTTAGCGGTGAGCCAAAG
+CCAACGGCATTTACCATGACAAAACCTTAGTCTACGATGACCAGATACGCGTGATTGAAC
+CGCTATTTTGCGAACAAACAGACATTTTATTGAGACAGAATTTATCGGCGCGCGCGTGGA
+AAACGGGGGATACAGACAAAAAATCCACGCCGGGACGTGGATTTTAGCGCAATAACTTGT
+AGCCTTAACCCGGATAGATACCGCGATCTTTACGGGCCAACAGAATGCGCTCACAGGCGA
+CAATATAGGCTGCGGTGCGCAGAGAACAGGATTTCTCAGCCGCTTTCTCCCAGACATGGA
+CGATCGCGTCGGTCATGATTTTGTCCATGCGCGCGTTGATCTCTTCTTCGCTCCAGAAGA
+AGCTGGCCATATCTTGTACCCATTCGAAGTAGCTGACGGTTACGCCGCCTGCGTTACAGA
+CCACGTCAGGCACCACAAGGATACCACGGCTGGCCAGAACATCATCAGCATCCGGATAGG
+TCGGGCCGTTAGCCCCTTCCAGCACCAGCTTACACGTCAGGGCTTCCGCGCGCTGACGAG
+TTATCTGACCTTCAAGCGCCGCCGGGATCAGAATATCCATCTCCAGACGCCAGAACGCAT
+CGCTGGCGATAGTTTCCGCGCCCGGGAAACCGGCTATCTGTTTGTGTTCTGTCTGCCATG
+CCGTGAGCGCCTTCATGTCAATACCGGTGGCGTTAAACAGGGTCGCGGTATGATCCTGAA
+TCGCCACGACACGGGCGCCAGCGCCTGCAAACAGACGCGCGGCTTCGCTGCCGACGTTAC
+CAAAACCCTGAACCGCAACGCGAGCGCCTTCAACAGCAATATTCGCCCGACGTGCGGCTT
+CCAGCCCGCTGACAAAAACGCCGCGCCCCGTCGCTTTTTCACGGCCCAGCGAACCGCCAA
+GATGGATAGGCTTACCGGTGACGACGCCAGTGACCGTCGTGCCATGATTCATGGAATACG
+TATCCATCATCCAGGCCATCACTTTACCGTTGGTGCCGACATCCGGCGCAGGAATATCTT
+TCTGCGGCCCGATGATAATGCCGATCTCGCTGGTATAGCGGCGGGTCAAACGCTCCAGTT
+CACCTTCCGACAGCGAGAACGGATCGACGCGGATACCGCCTTTAGCGCCGCCGTATGGCA
+GGTTCAGCGCGGCACATTTGATGGTCATCCATGCTGACAGGGCCATCACTTCATTGAGAT
+CAACGTCAGGATGGTAGCGAACACCGCCTTTACCCGGACCTCGGGAGAGGTTGTGCTGCA
+CGCGATATCCTTCGAAATGACGAATAGTGCCATCATCCATTTGTACCGGAATATCGACGA
+TCAGAGCGCGTTTTGGGTGGCGCAGAGTATCCACCCAGGGGGATAACTCGCCCAGATAAG
+GGGCCACACGCTCGATTTGTTGCAGGTAGGTATTCCAGGCAGATGTGCTGCTATCTGAAG
+CGTAAGATAACTTATCCATGATAAACCTTAGTGATAAAAGTAATATGTTCTTTAATTGAC
+CGTGGTACATAGTAGATCACACCATGTAGCGATAAATTTAACACTTTTTTAAACAATTAA
+CTCAGATCAAAAATGGCAGGCAGTTGGATTTTCGTTATGATTTTGGATGGGAAGTGGTTA
+ACTATCCGCTATAAGAGGTGATATATTGCTAATTATGCAATTAATTGCTTAAATATGCGA
+AATATGTGCAAGGTGGCTATTTGTCATAATTATGACGCACCTCTAAAAGTAAACATTATG
+ATAACGACATGTATCAATGTTATGTCGTCCTGTCGGCGGGGAAACGTCTTCGCCAGGCGC
+GTATAAAGATAAAAATAACCGGAGTCAGACGGCGCTGGCCCCGGTTTACCTCTTTATTGT
+TGACGCGACTCAAGCCATACCAGCGCCAGTGTCGACAGTGAGCACATCAGCAGAATGCCG
+ACAAACCACAGTAAATACCACATCGCTCCCGCTCCCTAATAAAGTTCATGATCGTTGCGG
+CGGAGGGTCTCCAGGTTGATACGCCCCAACATTTTGTAATAGCTCCACAGCGTATAGAGC
+AGTACGATTGGCAGAAAAATCAGCACAATCACCAGCATGATTTCGAGCGTCATCTGGCTG
+GAGGTGCTGTCCCACACCGTCAGGCTGGAGAGAGGACTAACACTCGACGGCATCACAAAA
+GGAAATAGCGTTATGCCGGCGGTAAAGATGACGCAGGCCTGGGTCAGGGAAGCGAACAGA
+AATCCACGAATAGTCTGACCGCGAAGGCAGGCATAGAAAGCCAGAATCGGCAGGATCATA
+CCGAGCAACGGGATGATGAGCAGTAGCGGCGAGCGTATAAAGTGGTTCATCCATGCGCCA
+GGGAGTATCGCCACGCCTTTTAAGAGCGGATTGGAAGGGCCGTTGGCATCCTGCGTGAGC
+AAGACAAAGCCATCAACGCCGGCCCACAGCCAGTAACCGGCCAGCAGGAAGCAGATCACG
+ATCAGCAGCGCGCTGTGGCGGGTGGCCGACAGAGCCCGTTGACGAATAACGCCCTCCGTT
+TTCAACTGTAACCAGACGCCTCCTTGCATAATCACCAACGACAGGCTCAATAATCCACAC
+AGTAGGGCAAAGGGCGAGAGTAACTGCCAGAAGGTGCCAAAATAGTCAACATGAAGCTGC
+GGCGTGAAGGCAAACGGCACGCCTAAAAACAGGTTGCCGAACGCGATGCCGAATACGACT
+GGGGGAACCAGGCTGCCGATAACCAGACCGGTATCCCACAGCGCGCGCCAGCGGGCATTG
+GCGATTTTACCCCGATAATCAAAGGCCAGCGGGCGAAAGAAGAGGGCACACAGCACCAGG
+ATCATCGCCACATAAAAACCGGAAAACGCGGCGGCATAGACCCGTGGCCAGGCGGCGAAT
+AATGCCCCGCCCGCGAGAATCAACCATACCTGGTTTCCTTCCCAGTGGGCGCCCACGCTA
+TTGATCAATACCCGGCGTTCGTCATCGTTGCGCGCTATCAGCGGGAGCAGGCAACCGACA
+CCCATATCAAACCCGTCAGTTACCATAAATGCCACCAGGATGACGCCGATCAGCAGCCAC
+CAAATGAACCGCAACGTTTCATAATCCAACATGATTGTCTCCTTTATCCCTGTTGTTGCG
+CTTGTTGTTGATGTTGCATGGCGCTCGGCCCAAGACGCGCGTACTTCTGCATCAGATAGA
+CTTCCGCGATTAAAAACAGGGTGTAAAGTCCGAGGATAAGCCCCATTGAGAAGGCCAACT
+GGCCCGGCGTCAGCGCGGAGTGAGCGTACCAGGTCGGCAGAATGTCCTGAATCGCCCAGG
+GCTGACGGCCAAACTCCGTCATAAACCAACCGGCTTCAATGGCAATCCACGGTAACGGCA
+GGCTCCACAGCGTCATACGCAATACCCAGCGATGCTGGTCGATACGCATTCGCAGCGTCT
+GTATCAACGCAATCAACATCACCACTAACAGCAGCGAACCGCAGCCGACCATAATACGGA
+AACTCCAGAACACCGGCGCCACCTGAGGAATAGCGCCACGCTGGGCCGCACGATACTGCT
+CCGGCGTCACATGGTTCATATCCGGGGCATATTTCGCCAGCAGAATGCCGTACCCCAGAT
+CGCCCTCAACGGCGTGAAACGCATTCAGTACCTGTGGCGAGCGATTGCCTTGCGCTATCT
+CCTGCATGAGCAGCCAGGCCTCCCGGCCACGCTTCAGGCGCGGCAGAGCGTCGTCCATCA
+GGTTTTTTAACCCCGGAACTGGCGTATCCAGCGAATGGGTGGCCAGAATACCCAGCAGAG
+CAGGGATCTTCACGGCAAATGCATTACGCTCCTGTTCCTGCTGCGGCCAGGCAATCAGAT
+GAAACGGCGCGGGCGCGGGTTCGGTTTGCCATTCGCCTTCCATCGCCGCCAGTTTCACCG
+GCTGAATTTGGGCGACCTCGTAGGCCGAACTGTCGCCCAGTTGCAGGGTTCCCAGAATGG
+CCAGGGTGCCGAATACTGAGCCGATAGCAAACGAGCGCAAGGCCACCTCACGCTCGCGGC
+CACGTAGCAGATACCAGGCGCTGATAGACATAATAAACATGGCGCCGGTGACATAACCGG
+ACATGACGGTATGGACGAATTTCACCTGGCTCACCGGGTTAAAGACCAGATCGCTGAAGC
+TGCTCATTTCCATCCGTAACGTATCGATGTTGAAATGAGCGCCGGTAGGATACTGCATCC
+AGCCATTGGCATTCAGAATCCATAATGCTGAAATATTGGAGCCGAAGGCCACCAGCCAGG
+TGACCAGCAGGTGTTGGTATTTATTCAGCCGCTGCCAGCCGAAAAAGAACAGGCCGACAA
+AAGTGGATTCGAGAAAGAAGGCCAGTAACGCTTCCATCGCCAGCGGCGCGCCGAAAATAT
+CGCCCACATAGTTCGAATAGAGCGACCAGTTAGTCCCGAACTGAAACTCCATGGTCAGGC
+CGGTAGCCACACCGAGAGCAAAATTGATCCCGAAGAGCTTGCCCCAGAAACGCGTCATAT
+CGCGGTAGACGGTTTTCCCCGTCACCACATAGATCGTCTCCATGACGGCCAGCAAAAAAA
+TCAGCCCAAGCGTAAGAGGAACAAATAAAAAGTGATACAGCGCGGTCAGCGCAAACTGCC
+AGCGCGATAAGTCAATGACATCCCACATGCTAACTCCTGTAGGCAGAAAGAGAGTAAAAA
+GCTAATCAGTACCGGACACCGGTGACGTTCCTGTTGAGAGCGTTAGCGCGTCTCCAGCCA
+TCGGCAGACTTCATCCAGGCGCTGGCGCGAATCGGCCAGATCTTCCGGGGCCGCCAGTAC
+CAGCTCCGGCAAAAGACAAATCTCATAGCTATCGAGCAATGGCCCTTTAAGGGCGTCCAG
+ACAGCGCACATGCCAGAGATGGCGCAATGCTGTGGCGTTGATTTGGCTTTCGCCATACCC
+GGAGATGCGAATCTGGATGTTCCCGTGTCCGCATAAACGCGCCAGAAAAAGGCGATCGGC
+CTCGCTGAGCGGCAGTTGGGTCAAATTGATGCTGTGAGGTTGCAACGCCGGATCGCGTAC
+GTGCGCCAATAATTCATGGGCCAGCGGCAGTCCATTCATCAGGCCAGCGACAGGCGGAGG
+CAGTAGAGAGTCGTCAGGCAGCGTATCGGCGGTAGCCGCTTGCCATAATGTCAGGGGCGC
+GCTACCCGCTTCCAGACGATCCGTCAGCAGACGTCGGTTATGCAGATGGCGTACCCGCCA
+CAGGCCGCAGAAGATGGTCTCCTGGATCTCGCTTTCACTCCCGTCCGGATGCTGAATGCG
+TACCGAGACTTCGCCTTCGCCCAATAGCGTATTGAGGAATGAGAGATCATCGGCATTCAG
+GGGAGATAACTCCCATCCCAGCACGTCGCCGACTTCCGGGATGCGCCGGGCAAGCTGACC
+TCGCAGATCGGTCAACAATGCCATCACCGCCGGGCTGTGAGCGCAGCGCTCCAGCGCCGC
+CATACTTGGGTCGCCATTGACCTGACAGGTGAGCGGTAAGGGATTCATCGAGAAACTAGC
+GTCATCAGGCTGCGTACCTGGCCCCAGCAGATGAAAAAAGGCGTTGCTCATTGTACTGTC
+TCCTGCGCTGCGGGAGTGTCAACCATCGAACGCATCAGCGTGAGCAGTTCAGCCCAGGGA
+TGAATGCCGCTGAGCGCGCCGCGTAGCTCGCCGTCTGTAAAAACCAACGTCGCCGGAAAC
+CGACGTACATTAAAGCGATCGCCGATAGCTTCGCTTTGTTCAAGGTCGGCCACCGCCACC
+TGCCAGTCAAACTGCGGGAACTCACGCAGGAGTTCGGCAATCATCACCGGGTTATCGCTG
+ACTTCCGGCGTACGCCGCGGATCGCTACTTAACAGGATGACGCCATCTCCAACCCGTTTG
+ATCCAGTCGTCTACCGTAGAAGCCTCTACCGGTTGCCATCCACGGGTTAACAGGCGTTGC
+CATAGCGCAGAGAACGGGGTGTCATTCGCCACTTCTTTTGCCCTCCAGACGTGTCTGATA
+CTGACGTATGCGCACTCCCTCATAATTTTCCATCGACAGGCATTTATAGTTCAGGCAGCG
+TGCGACCTCGTTTGCCTGCGGTACGATCCCCCAGGCGGCCAGTTGCGCCAGGGCGGCCTG
+TTCCGCCGCCGGTAGCTGGCCGCGAGCTATTTCGCTCAGGCTACCGCCGTAGTCGTCCAG
+GTGCGCCGGTTGCAGACCGACCAGCGCAATGTGACAGGGCAGATGCCCGCGGATGTCGGC
+CAGCGCCAGAACTTCGGAAAAACTGTTTTGATGCAGGCTCATTTTTTTGGCGCTGAGATA
+CGCGGGGATTTTCTCGCCGGCATAGGTTCGCAGGCTGCCCGGCGCCAGGCCGTAATCGAT
+CGCGTCAAGGAGCAGGAGATGGCTGGCTTGCTCAACATAACCTAACAGGTTTAGCCCTTG
+CGTACCGCCGTCCACAATTTCTACCTCTTCAGGCCAGTGATATCGGGCATACAAACGCTC
+CGCGACCCGGATACCGAATCCTTCATCGGCCCACAGCAGGTTTCCTAACCCCATCACCAC
+TACGCGTTGCGCATTCATGAGGGCTCCTTGTCGTGCGGTTTGGGGAATTTGTGGCTGCGA
+TAGCCATTGATCATGGTGGAGATCACCGTATCGTCGGACATAATGTCTTCCCGGATAGCG
+AGGTAAACGTGCCCGACGATGAAGGCGGCGATCAGCCACATACCCAGTCGGTGCCAGCTG
+TGAATATCGATGGAGTTGCCGCCGGTCCAGTAGAAAAATTCAACCACATAGCGGAACGGC
+GCAAAGATGGCGTACTGGCTATGCTCGCCAAACAGAGCGAAACCGGTGAGGATCATAAAT
+ACCGACAACAGGAAATAGCCGAACATCGCGGCCTGCGCGACAGGGTTATGTCCGATGTCG
+CTCCCCGGTTTTTTCTCCAGAAACAGATACCAGCGGACCACGGAGAAAGCGCCTTGCCAC
+CAACTGCGACGCCAGACCGGGACGATAAACAGCTCTCGCGAATAGCGGTTGCCGACACAG
+GCCCAATAAATTCGCCCCAGCAGTAACACGGTAAAGATCATCGCGGCGGCAAAGTGGATC
+AGCCGGATATAGCCCATGTAAAACAGATAGGTCGCCTCGCCACTCACCGACGGCAAGGGC
+CGGCCAATGAAGTAGCCTGTTACCATCAGTACCAACATGCAGGCCACCGTTAGCCAGTGC
+CACAGGCGTACCGGCGCTTCAAACACATAGTGGTTGACGGCAGTATCACGCGCCTCCCCG
+ACGCGTGGAGATAGCTTTCCAGTCATCGTTCTTTTCCTTAACGCTTAGCGTACCTGGACG
+GCAATCAGTTCGCTGCCGTCGTCGCCGAGCACGTGGGTTGAACAGGCGAGGCAGGGGTCG
+AAGCTGTGCAGCGTCCTCAGGATTTCTAACGGTTGGTCGGGAATCGCCATTTGCGTTCCC
+ATCAATGCCGCTTCATAGGCGCCGATCTGTTTTTTAGGATCGCGCGGGCTGGCGTTCCAG
+GTGGTGGGGACCACGCACTGATAGAGTTCAATCTTCTGATCGCGTATTGACGCCCAGTGT
+CCCAACGCTCCACGAGGCGCTTCGGTAAAACCGATGCCGCGGCAGTGCTGCGGCCAACTG
+GCCGGTTCCCATTTCTCGGTATTGGCGGTGGCCAGGTCGCCGTTTTTCAGGTTGGTCATA
+AGCCTGTCGAAAAAATACTGCAGCTTACCGACGGCCCATTGCGCTTCGTGCGCGCGGCAT
+AAAATACGGCCAAGCGTAGACTGGATACCGGAGAGCGGCAGTTTAAGGGCAGACATCATG
+CGATCTACCGACTCTATGGTGGCGGCATCCCCTTTGTGGTACGCGATAAGCGTTCGGGCA
+AGCGGGCCGACTTCCATGGCATGACCCCGCCAGCGCGGCGCTTTAATCCAGGAGTAACGT
+TCCTGCTCGTTGAGCTGCTGGATATGCGTATCGCTGCCTTTGACATCACCCGGGTTGTAC
+CAGGGATCGGTAATGCCGTCAAAAGGATGACGCCCCAGCCGATCGTCCGGATAGCGGTAC
+CAGGCGTGATCCACAAACTCCTGTATCTGCTGCGGATCGGCCAAATCTACCGGCATGACA
+TTTTTAAAATCGCCATTGACCACCGCGCCGCCCGGCATTAACAGGCTTTGCTGGCTGAAG
+TCGTTGGCAATGTCCGGAAATGCGCCGTAGCTCAGCACGCATTTATCCGACAGACCGGTG
+CCAATTTGACTCCATGCTTTATTGAACTGGCCGATAGCCAGCGCGTCCGGAACCATCACG
+TTGTTAATGAAGTCGGCGGTGCGGGTGATGATCGACTGCACCAGGTTGAGGCGCTCCATA
+TTGATAGCCCCGACCGCGCCGCTTTGATCGAGATTGATCGCGCACGGCATTCCGCCGACG
+ATCCAGTTAGGATGGGGGTTCTTACCGCCAAATATGGTATGGATTTTGACGATCTCGCGC
+TGGAAGTCGAGGGCTTCAAGATAGTGGGCAAAGCCCATCAGATTAGCCTCTGGCGACAGT
+TTGTACTGTGGATGTCCCCAATAGCCGTTACGGAATATCCCAAGCTGGCCGCCATCGACA
+AATTTCTTTAATCGATTTTGTACGTCAAAGAAGTAGCCCGGCGATGACATCGGCCAGGCG
+GAAAGGCTTTGCGCCAACTGCGAGGTGGCGCGCGGATCGGCTTTCAGCGCATTCAGAACA
+TCAATCCAGTCCATACCGGCTAACTGATAAAAATGGACCAGATGATCGTGACACCACAAC
+GTAGCCAGCATGATGTTACGTATAATATTGGCGTTATCCGGCACCTGGATACCAATCGCA
+TCTTCGATAGCGTACACCGATGCCAGAGCATGTACCCCGGTACATACACCACAAATACGT
+TCAACAAACGCCCAGGCGTCACGCGGGTCACGGCCTTGCAGAATGATCTCCAGCCCGCGG
+AACATTGTGCCGCAGGAAACGGCATTGGTAATGACGTTTTGCTCATCAATGTTCACTTCG
+CAGCGCATATGCCCTTCGATGCGGGTAATCGGGTCCACGATCAGACGACGGCCGGCGTCG
+TTAACGGTATAACCCTGGGTTTGATACTGGTTACTCATGCCTGTTTATCCTCATTGTCCG
+GCTGTTGTTCGGCTTGCGCTAACTGTTGTTTGTGGCGTTTACGTTGGTTGAGCGCGCTGG
+CGACAGCGTGACCGCCAACGCCCGCCGCGACCACGCCCAGCGCGGTCAGCCCCACCGTAT
+CGGCGGTTGAATGGGTACCCATCTGGGGAATATCCACCACGCGGCTATAAAACGAGCCGC
+GATCCCAGAAACCATTTTCTGAACATCCCAGACATCCGTGACCGGACTGGATAGGAAAGG
+AGACGCCGTCATTCCAGCGTGTGGAGGAGCAGGCGTTATAGGTGGTTGGCCCTTTACAGC
+CCATCTTGTACAGACAGTATCCCTTGCGGGCGGCGGCGTCATCCCAGCTCTCGACAAATT
+CACCGGCGTCAAAATGGGCGCGGCGGTAGCATTTATCGTGGATACGCTGACCGTAGAACA
+TCAGTGGACGGCCCATGCGATCGAGTTCCGGCAGACGATCAAACGTCACCATATAGGTGA
+TAATGGCGCTCATGACATCCGGGATTGGCGGACATCCAGGGACTTTCACGATCGGCTTGT
+CGGTGATCACTTTATCGATAGGCGTTGCCTGGGTCGGATTGGGGCGGGCGGCCTGGACGC
+AACCCCAGGAGGCGCAGTTTCCCCAGGCGATAATAGCGCTGGCGCCCGCGGCGGCTTTCT
+TCAGTTTTTCAATAAACGGGCGGCCGCCGCTGATACAGAACATTCCTTGCTCTCCTAACG
+GCGGATTGCCTTCCACCGCCAGAATGTATTTCCCGGCGTAGCGAGTGGTAATATCGTCAA
+AGACTTCTTCGGCCTGTGCGCCGGCGGCGGCCATCAGGGTGTCGTCATAATCGAGGGAAA
+TCAGCGAGAGGATCACATCTTTGGCTAGCGGGTGCGAGGAACGGATAAAGGATTCGGTAC
+AGCAGGTGCATTCCAGTCCATGAATCCAGACCACCGGAATCCGCGGTTTATTCTCCAGCG
+CCCAGGCGATCTTTGGCGTCATTCCGGCGCCCAGCCCCAGCGATGTGGCAGCAAGGCTAC
+AGAATTTGAGAAAGCTGCGTCGGGTCACTCCCTTACGACGCATGGCTTGATAAAAGGTCT
+CCTCGTTATTCATAACGCGTATTTTTTCTCCTTTTTGCACCACGCTCCGCCAGGGGCATA
+AGGCGCTTTTGCGGGTCCGTTGACGTTCCGCCAGCAAGGTAAATCATTGGGTTACGCGCG
+AGCGCGGAAACGAGCCCGATTCACTTTGCACCGGCGTATATCGCCAGAAATAATGTAAAA
+AAAGCGTATCGGATTAACGATAAGAAACAATGTGAAGTGTGTGGGTATAGCTTATAGCGG
+TATATTTATACCCATTATCGGTTTTTCGGCGAAAGGGCCGCGGCGGGGAAGGACGGTTGA
+GCTTGTTCCGGGATGAGGTTTTTAGCGAGTGACCCTGGCCTAATATCAGAGCCAGGCTTA
+AGAGTTTGCGGGTATGTTGCGTGATCACGATGCAGTCACGCATCCCCCGGATCTTGACGG
+GCGTAAAGTGAATAAACCTGGCCTGTTGTCAGTTTTACGTTCTTCGTGGTGTGCTCTGAC
+GATAATGTAGTCCACCGACCATATAAATTCTCCTCGCTCACCGCCTGGCCCGATCTCTGA
+CGAAAACTCTGAATCTTCGATGTTTCCAATTATGAATTTCTACACCAGTCTTTAAGCATC
+AATGCATTGTACCTGGTGCGCTGCTATAACTGTGTAAGAGGGATTGACGCTTAGAGCCTA
+TCCCATTAGGGCTATTTTACTTGCCATTTTGGTCCTGGGCAGTGCTCGCCAAAACGCGTT
+AGCGTTTTGAACGCCGCTTGCGGCGGCCCGAAGGGCGAGCGTAGCGAGTCAAACCTCACG
+TACAACGTGTACGCTCCGGTTTTTGCGCGCTGTCCGTGTCCAAACAGGCTGCGCCAATAA
+CGCCTGGTGGGATAGGCTCTTAGTGTTAATGTACACCAAAGGTCGATGTGTTTACCGCAC
+TTGTGGCTTGGTATGCAGTATGTATAATTATTGCGTGAATGTTTTCATAAATTGATTTGT
+CTCTTCTTTGGCCTTTTCTATTGATTTATGTTTATATATTTTTGATTGGTATGTGTATTT
+TTCTAACGCAGGTAAGTACTTAGAGACGTCGTTACCTTTTTTGAAATCTATAGGCATATG
+AATACTCGCATATAATATATTTATCCTCTGCGATGGCGTTAGCTCAGAATAATTTATACC
+TTGTTCATAATAAGAAAGCATCACATCATTGCAGATCCTGTCTTTATACGACTGCCCTAT
+GTATGCGATGATAAGTCCATATATAAGTAGCAATCCAAAAGCGACACCTGCTTTGTGGCT
+ATGAAGAAAATTATATTGTAGCCCAACAAAAAACACTTTTCTAATTAAAACAAGAATAAA
+TGGTAAGGAAAATAAAAAACAACCGAAGTACATAATCACTTCGCCTGAATTCTGAAACAT
+TTTATACCTTCCTGATAAATACTGGGTTAATTATCTGGTTAATATTCGTTGTCTATTATT
+TCTTTTATAAAAATAGACGATTCATTGAAATTTTTTTTGAAACTGGAGTAATTGCTAAGT
+GTTTTCGGTATGCAAAAGATGACTCGCCCATTTTTTACTATGGCATAATATCTTGGATAC
+ATTAGTGCTTCTTCTTTTGTGTTTGGAACACCGTCATAGTCTATTTTTTCATCAATAGAG
+TCAAGTTGGCTAAATAAAAAGACTCTTTTCCTTAGCAAAGTATTATGAACAATAGCATTT
+TCATATATATCAAGTGACATTGTAAGACTCAATGCAGCAAATGAAAGTAATGCTATGATG
+GAAATTGTTAATATTGCTAATGACAAGCCTTCCTGGCAATATAAAACAAGAAAAAAGAGT
+GGGATTGCAGGGAGGTAAGTGACCAACGGGTAAAAACGATCGATTTTTAAATGTGATATG
+ATATTCTGAGGAGATGTGACATGGTCCTGAACGCCCTTGTTAAAGATAATGCTGTAAAGC
+GTCAAACTATTGTCAATTTTATCTATTGCTTTAGCTTTTATCCTTTGTGTGAATATAAAA
+AACGTTATCAAAAAGGCAATAAATAAGAAAATGATTAAATTATAAATAAAACTATCCACG
+GCATCATCCTGTATATTTACCGAAATTTCTATGGTCACTATTCTACTATTATTAATGAAT
+GTCAATCTAAAATTGATGATGGTGCGTCCAGCCGGTTGGATTTGATCTAAAATAAAACTT
+TCGGTATTTCTCTATAGTCACAGAGCAAACAGGGTTGATTCTTTGTTAAAAAAACATCTC
+AATATTTTAATATGAATTCCTTCACGCGATTCTGGAGTATTACAGTCTACGATTTTAATG
+ATTTTTTATTCATTCATTATGCGTATTAAATTAATGGCAGTGCAATCGCAAATTATAATT
+AGTTTCAGAATTGCAAAATGATTATAATTTTGTAGTTCATGCCGTTGCCCTAAGAGCCCC
+GGTGGTGAGTGTAGGGGGGAACACCTGAACAAGATCTGAGGCTATGTACGATACTGTGAT
+ATGAGTTAACCCAAACAGGCTATACGGTATCTATACCTTTCTAAAAAGCTTTTCGCTGGT
+ATAGAGTCAAAACCTTAGACGAAACAACATTCACACTATGGCCCTGGCAGTGCGGCATTG
+CGTATCGGTGAGCATAACGGGGCCTTGTTTATTTATTATACCGTTCTTGTACTTACTTAA
+AATGAAGATGGAAGAATGTTGTACTCATTTTTGACAGCATTGTTACGAGATGAGTTGAGA
+CATTATGAAATGAAAAATCCACGCCATTGCGTGGATTTTATAGAGTTTTACCGCTGTCAT
+GAGGTTCAATGAAACCTCATAAGACAACAAATGTTATTTAGACGTTGAACAGGAAGTTCA
+TTATATCGCCATCTTTAACGATGTAATCTTTGCCTTCCGCTCGCATCTTACCGGCTTCTT
+TCGCGCCTTGTTCACCTTTATAGGTAATAAAGTCGTCAAAGGCGATAGTTTGGGCGCGGA
+TAAAGCCTTTTTCGAAGTCGGTATGGATTTTACCTGCTGCCTGCGGCGCGGTTGCGCCAA
+CCGGAATGGTCCATGCGCGAACTTCTTTCACTCCGGCGGTAAAGTAGGTCTGGAGGTTCA
+GCAGGCGATAACCTGCGCGAATAACGCGGTTCAGCCCCGGCTCTTCCAGACCCAGTTCAG
+CCATAAATTCGTCGCGCTCGTCATCATCCAGCTCAGCAATATCAGCTTCGACGGCGGCAC
+ACACCGGAACCACGACCGAACCTTCTTTCGCGGCGATTTCGCGAACCTGGTCCAGATACG
+GGTTATTTTCAAAACCGTCTTCATTGACGTTAGCGATATACATTGTCGGCTTCAGCGTCA
+GGAAGCTTAAATAACGGATAGCCGCTTTATCTTCGTCCGTCAGGTCCAGCGAACGCAGCA
+TCCCCGCTTCGGCCAGGTGCGGCAGGCATTTTTCCAGCGCGGCCAGTTCCGCTTTGGCGT
+CTTTATCGCCGCCTTTGGCTTTCTTCTGTACGCGATGGATAGCGCGCTCGCAGGTATCGA
+GGTCAGCCAGCGCCAGTTCGGTATTGATAACATCAATATCTTCTGCCGGGTTTACTTTAC
+CCGCCACATGGATGATATTGTCGTTCTCAAAGCAGCGAACCACGTGACCGATAGCTTCAG
+TTTCACGGATATTGGTCAGGAACTGGTTACCCAACCCTTCGCCTTTGGACGCGCCTTTTA
+CCAGACCGGCGATATCCACGAACTCCATCGTGGTTGGTAGAATGCGTTGCGGTTTAACAA
+TCTCAGCCAACTGGTCCAGACGCGGATCGGGCATCGGCACGACACCGGTATTCGGTTCGA
+TAGTGCAGAACGGAAAGTTTGCCGCTTCAATACCGGCTTTTGTCAGCGCGTTGAACAGGG
+TGGATTTCCCGACGTTGGGCAGACCGACGATACCGCATTTGAATCCCATGATTTAACTCA
+CCTTAATATCTTAATAATCAACCTGTTATAGAAAACAGATTGCAGAAATGGAAATAACTT
+CGCCTATTATACACGGCGTGCGGCAAAAATGCCGCACATCACTGGTTATTGCGCCTTAAA
+GGTATGCAAACGGCTTGTTGCTTTGGCCAGACCCTCTTTGAACCACAATTCCGTACAGCG
+TGCCGCTTCGTCAATGGCCTCATCAATTAATTTTTGTTCAGAAACAGGGGGTTTACCCAG
+CACGAAACCAACAACTTTATTTTTATCGCCTGGATGACCAATTCCAACGCGTAAGCGGTG
+AAAGTTGGGATTATTGCCCAGCTTGCTGATGATGTCTTTCAGACCATTGTGGCCGCCGTG
+GCCGCCGCCAAGTTTAAATTTCGCGACGCCCGGCGGGAGATCCAGCTCGTCGTGAGCGAC
+CAGAATTTCGTCCGGCTGAATACGGTAAAAACTGGCCATTGCGCCAACTGCTTTACCACT
+GAGGTTCATGAACGTGGTGGGTACCAGCAGGCGAACATCTTCCCCTTCCAGCGTGATGCG
+TGAGGTATAGCCAAAGAATTTAGGCTCTTCACGCAACGGCGCGCGCAGGCGCTCCGCCAG
+TAAATCGACGTACCATGCGCCTGCATTGTGTCGCGTCGCGGCATATTCCGCGCCGGGATT
+CGCCAGACCAACAATCAATTTAATTGCCACGTTTTTTGTCCTGAGTAGATCCATAACTGG
+CGCGTAGTTTACTGTCTGTCTGCCCGCTTGACAAAACACAGCGGCACTCTGAAGTAAATT
+AAATAATTGCCAGCATTGATTATTAAAAATGTAAACTGTTCAGAGTGTTATTTGTAAAGT
+TTTGTTAAATGAAACTTTACATTTGTGATCGCACCCGCACTTACAAACGAAAGTGTTGTC
+TATACTTTACACATAAAGTTTAGGGGGATTTCCTAAAAACAACCCAAAAGTTCCGGAGGT
+GACATATGAAACGCAAAAACGCTTCGTTATTCGGTAACGTGCTGATGGGGTTGGGGCTGG
+TCGTGATGGTTGTCGGCGTGGGTTACTCTATTTTAAACCAACTGCCGCAGTTTAATTTGC
+CGCAATTTTTTGCGCATGGCGCAATACTGAGTATTTTTGTCGGGGCGGTTCTTTGGCTGG
+CAGGGGCTCGTGTAGGGGGGCATGAGCAGGTGAGCGACAAATATTGGTGGGTACGTCACT
+ATGACAAACGTTGCCGCCGTAACGACAATCGTCGTCATAGCTAACCGGTTCAGGCCCGGT
+AAGCGTTATCGCCACCGGGCATTGTCCATTAACTTAGTAAATCCGCTAACGCCTCCGTCC
+TGTTTGGGAAGAAGGTCAGACGCCCAGGAATAGGTTTGATACCGGCACGCGCCATTGTGC
+GCAGCGGTTGGAACTCCAGATTACTGATACGCAATTCGCACCCCTCCGGCAGACGCTTCA
+CAAAACGCTGAAAAGCATCAAGCCCGCCTGCATCCAGCACTGGTACTGCGTCCCATTTCA
+GAACGACGATACGTTTGCCCTTAATACGTGACTCAAGGTCGGTAAACAGCCCTTCCGCCG
+CGGCGAAAAAGAGCGGACCGATAACACGCAGCACCAGCACATCTTCAGGTACATCAACAT
+TGACCGGCGCAAGTCGAGTCATTCGCGCAATACGGCGCATAAACAGCAGGGAAGCAAGGA
+CAATCCCCACGCTGATGGCGATGACCATATCAAACAGAACCGTTAATGACATGCACAGCA
+GCATAACGATAATGTCGTCTTTCGGCGCATGGCGTAACAGATCCACCACTTTATGGGCTT
+CACTCATATTCCATGCCACCATCAGCAGTAGCGCCGCCATCGCGGAAAGCGGCAGCCAGG
+AGAGTAGCGGGGCCAAGACCAGTAGCGCCAGAATGACCAGGATAGCGTGAATTACCGCCG
+AGATGGGAGAGGTCGCGCCAGCGCGGACGTTGGCGGCAGAGCGGGCAATCGCGGCGGTGG
+CGGTGATGCCGCCAAAGAACGGCGCGACCATATTCCCCAGCCCCTGGCCGATAAGTTCGC
+TGTTAGCTTTATGTTTGGTGCCGGTCATGCCGTCCAGCACGACGGCGCAGAGCAATGATT
+CGATTGCCCCCAGCATTGCCATCGAGAAGGCCGCTGGCAGCAGCGCGCGCAGTGAATCCC
+AGCTTAGCGTGAAATCGGAGCCAGGAAGACTCCACGGCAGCATCAGTTGCGGCAGGAGCT
+GCGGGATGCCGTTGCCCTGAGTGCCGTCAGCCAGAACGTAATGGAACTGTGAGCCGATAG
+TCGCCACATTGCCGCCCAGCAGATTAACAATCCCCATTACGGCGCAACCGGCCAGCAGCG
+CGGGAAGATGTCCTGGCAGACGAATACCGAGACGCGGCCAGAAAATCAACGTTCCCAGCG
+TTACCACGCCAATGGCGGCATCGCCAATATTGACGGTGGGCAACGCCATAAACAGCGCGC
+CGACTTTCTGCAAATAGTGCTCTGGCACATGGGCCATCTGCAGACCAAGAAAATCTTTAA
+TCTGCATGGTACCGATGGTAATACCAATCCCTGAGGTAAAACCCAACGTGACCGACACCG
+GGATATATTCAATCAATCGCCCCAGTCTCGCCAGGCCGAAAAGGATCAGGAAGAAGCCCG
+ACATCAGCGTGGCGACCAGTAGGCCCGCCAGACCAAACTGTTGCGATACCGGATACAAAA
+TCACCACAAACGCGGCGGTAGGGCCGGAAACGCTAAAGCGCGAGCCGCCGGTTAGCGCGA
+TCACGATCCCGGCGACAGCGGAGGTATAGAGGCCATACTGCGGCGCAACGCCACTGCCAA
+TTGCCAGCGCCATCGCCAGCGGGATAGCAATAATCCCGACGGTGATCCCGGCTATCACAT
+CGCGGGTGAACCGGGAGGCGGTATATTTTTCTTTCCAGCAAGCATCGATGAGAGCGCGGA
+AAGGCATCACATGTGAGGAAAATAATTTGTTCACAATAATGTTTCATCCATGAGCGCATC
+ATCTGTCAACTAAATGGCAGGTGAAGGAGGCATAAGTCATACAAAAGGGTGTTACAGACA
+AAAAAACCCGCCGCAGCGGGTTTCAGATCCGGGTTCGATCAATGCTCGAACATGGCGGAA
+ATCGATTCTTCGTTGCTGATACGGCGAATCGCTTCGGCCAGCATACCTGACAGGGTCAAG
+GTACGCACGTTCGGCAGCGCTTTGATTTCGTCGGTCAGCGGAATGGTGTCGCAGACAACG
+ACTTCATCAATGACGGAGTTGCGCAGGTTGTTTGCCGCATTGCCTGAGAAGATCGGGTGC
+GTCGCGTAGGCAAACACGCGTTTAGCGCCACGTTCTTTCAATGCTTCTGCTGCTTTGCAC
+AGAGTACCGCCGGTATCGATCATATCATCAACCAGCACGCAGTCACGGCCAGCGACGTCG
+CCGATGATGTGCATCACCTGAGAAACGTTCGCGCGCGGACGACGTTTATCAATGATAGCC
+ATATCGGTATCGTTCAGCAGCTTAGCGATAGCGCGGGCACGAACCACGCCGCCAATATCC
+GGGGAAACCACGATCGGGTTATCCAGATTCAGTTGCAGCATATCTTCGAGCAGGATTGGG
+CTACCGAACACGTTATCAACCGGAACGTCAAAGAAGCCCTGGATCTGTTCAGCATGCAGA
+TCTACGGTGAGAACGCGGTCAACGCCGACGCTGGACAGGAAGTCAGCGACAACTTTTGCG
+GTAATCGGCACACGGGCGGAACGTACGCGACGGTCCTGACGTGCATAGCCAAAGTAGGGG
+ATAACGGCGGTGATACGACCTGCGGAAGCACGACGCAGGGCATCAACCATAACGACCAAT
+TCCATCAGGTTGTCGTTGGTTGGGGCACAAGTGGACTGGATGATGAAAATATCACCACCG
+CGTACATTTTCGTTGATTTGTACGCTGACTTCGCCGTCGCTAAAGCGACCTACGGCGGCG
+TCGCCGAGAGAAGTGTACAGGCGGTTGGCAATACGTTGTGCTAGTTCCGGGGTGGCGTTA
+CCAGCAAAAAGCTTCATATCAGGCACGAGAAGAACCTCAGGCATGCGTCCATTGGTGGAA
+AGAATCTGCCGAAAACTGTGCGGGCCAGGCAAAATCCTATCCAGGCGGTGTATTAAAGAG
+CGCGATGCAACGTCTGGAACAAGGTGACGTTGTCACCGAAGCTCAGCTTGCCCGGCTTAC
+TCGTCTTCATTCACGTTTCATGTGCGCTGGTATCAATGCCTCACACCGGTCAAATACGGC
+ATATATGACCGGCGACTCGTCATTTCGCCATCTTCCTGAAACCCGAATGCGTTAGAGTAA
+CTCTCGATGCAATGGGGAAAGGTTGACACCCTTCGCCACAAAAGCATTGAGCCATTCCGG
+GGCTTGCTCAAGCACCTGGCGAGCACAAGACTCTGTATCGAATTCAGCAAAGACACAGGC
+CCCTGTCCCAGTCAGGCGCGACGGCGCGTATTCTAACAGCCAGGAAAGCGCCGCATCAAC
+CTCGCGAAAACGTTTTCTTGCGATAACCTCGCAATCATTGCTGAATTCACATTTTAGTAA
+CGTATCTATTGACCTTTTTGGCGTATTACGCGGCAATTGAGGATCTTTAAAGATAACCGG
+CGTCGGAATGCTTACGCCAGGGTGCGCGACCAGATACCATTTTTCCGGCGGATTCACCGG
+CGTTAATATTTCGCCTACGCCTTCGGCAAACGCGGCGTGGCCACGAACAAAGACCGGGAC
+GTCGGCGCCGAGCGTCAGGCCGAGCGTCGCCAGTTCATCAATGGAAAGCCCGCATTGCCA
+AAGATGATTGAGCGCCACCAGAACGGTCGCGGCGTTAGACGAGCCGCCGCCCAGACCGCC
+GCCCATGGGAAGGCGCTTCTCAATGCTGATATCCGCGCCGCTTCCGGCGGGCAGGCGTCC
+ACTCTCCGAGGCGACTTTCATCAACAGCCGCGCGGCGCGGACGATCAGGTTGTCTTCATT
+TTCAACGCCGGTTACCGGCGTTAATAAATGGATTTCGCCATCGCGACGCGGTTCGATGTG
+GAGTGTGTCGCCATAATCCAGAAACTGAAACAGCGTCTGCAGCGTGTGGTAGCCGTCTGC
+ACGCTGTCCGGTGATATATAAAAACAGATTTAATTTTGCCGGAGAAGGCCAATGGGTCAT
+CATTTCACAATCCAGTTATCCATTTTCAGCTTAATGCGCTGACTGCCGTCGGAAAGCTCC
+ATATTGGCAGGCATGGCAGGCTGCGTTTTGCTGTCATAGCCACCGTAAACCACTTTCCAG
+TTTTTACCATCCTGGCGATAGTTCACTTCGCTCAGGCGGTACTGGTCGTCCAGTTTGTAG
+TCAGTGGCATCGCCAGGCAGACCGAGGATCCACTGCCGCAGGCTGTTTAACGGAATCGGC
+ATCCCGGTGAGTTTGCCGATCATCTCTTCGGCGTCATCGGCGGTATAACGCTGGCCTTTG
+TTATCCACCAACTGGACGTTGCCCGGCTGGGCGTTAAGCTCCAGCTCGGTGCTGCCCAGC
+GGGTTGGTAAGCAGCAGGCGGTAGCGATCCTGTCCGGTCTGTTGCCAGAAGAAGCGCGCA
+TAGACTTTCTGATCATCTGAGATGTAAGCAAAGGCGCCGCGCGTCTGGTATTGATTCAGA
+TGACGCACCTCTTGCTGATGCTGGCGCCACTGAGGGGAATCCGGGCTCTTGCCCGGGCCT
+TTATGCCCAGGAAGCGTACAGGCGGTGAGAACCAGGCTTGCTAACGGCCGTAGACGAATC
+AGGCGAAAATCGGGCAGGGGCATAGTGATGACGAATCCTTGTGATACGGTGCAATAATTG
+CCTGATGGCGTTACGCTTATCAGGCCTGAAAACTGAACCTGCAGGCTGTAAAAACGTTCG
+CGCCGCGATTCGGCAAATTTTTGCTATCGGTTACAGTTATAGCCTTTAATGCTAGCGCCG
+CCTGGTGACATCGTCTACTTTCAAGTTGTCTTAAATCATCAAATTAGCGAGCGCTGCCAA
+TTACTCCAAAAGGGGGCTCTCTCTTTTATTGACCACGCGCATCCTGTATGATGCAAGCAG
+ACTAACCATATCAACGCTGGTACTACTCCCGCAGACATGACCCTTTTAGCGCTCGGTATT
+AACCATAAAACGGCACCTGTATCGCTGCGAGAACGCGTAACGTTTTCGCCGGACACGCTT
+GATCAGGCGCTGGACAGCCTGCTTGCGCAGCCAATGGTGCAGGGCGGGGTCGTGCTGTCA
+ACCTGTAACCGTACAGAGCTGTATCTGAGCGTGGAAGAGCAGGATAACCTGCAAGAAGCG
+CTGATCCGCTGGTTATGCGATTACCATAACCTGAACGAGGACGATCTGCGCAACAGTCTG
+TACTGGCATCAGGACAATGACGCCGTCAGCCACCTGATGCGCGTCGCCAGCGGTCTGGAT
+TCACTGGTGCTGGGCGAACCGCAAATCCTCGGTCAGGTGAAAAAAGCGTTTGCGGATTCG
+CAAAAAGGCCACCTTAACGCCAGCGCGCTGGAGCGAATGTTTCAGAAGTCTTTTTCCGTC
+GCCAAGCGAGTGCGGACTGAAACCGATATCGGCGCCAGCGCCGTCTCCGTCGCGTTTGCC
+GCCTGTACGCTCGCCCGCCAAATCTTTGAATCGCTGTCGACGGTCACCGTACTGTTAGTT
+GGCGCGGGCGAAACCATTGAACTGGTGGCGCGTCACCTGCGCGAGCATAAAGTACAAAAG
+ATGATTATCGCCAACCGAACCCGCGAGCGCGCGCAAGCCCTGGCGGATGAGGTAGGCGCT
+GAGGTTATCTCGCTCAGCGATATCGACGCCCGCTTGCAGGATGCCGATATTATCATCAGT
+TCGACCGCCAGCCCGCTGCCGATTATCGGTAAAGGCATGGTGGAGCGCGCATTAAAAAGC
+CGTCGCAACCAGCCGATGCTGCTGGTGGATATCGCCGTACCGCGCGACGTTGAGCCGGAA
+GTCGGCAAACTGGCGAACGCTTATCTTTATAGCGTCGATGATTTACAGAGCATCATTTCG
+CATAATCTGGCGCAGCGTCAGGCTGCGGCGGTGGAAGCGGAAACGATTGTTGAGCAGGAA
+GCCAGCGAGTTTATGGCCTGGCTACGCGCCCAAGGGGCCAGCGAGACCATTCGGGAATAC
+CGTAGTCAGTCGGAGCAGATTCGTGACGAACTGACTACCAAAGCGCTGTCGGCCCTTCAA
+CAGGGCGGTGATGCGCAAGCCATCTTGCAGGATCTGGCATGGAAACTGACCAACCGCCTG
+ATTCATGCGCCAACGAAATCACTTCAACAGGCTGCCCGTGACGGGGATGACGAACGCCTG
+AATATTCTGCGCGACAGCCTCGGGCTGGAGTAGCAGCACACACCACACTTTTTTACAGGG
+TGAATTTACGCCTATGAAGCCTTCTATCGTTGCCAAACTGGAAGCCCTGCACGAACGCCA
+TGAGGAAGTTCAGGCGTTGCTGGGCGATGCGGGAATTATTGCCGACCAGGACCGCTTTCG
+CGCATTGTCGCGCGAATATGCGCAATTAAGCGACGTTTCTCGCTGTTTTACGGACTGGCA
+ACAGGTTCAGGACGATATCGAGACGGCTCAGATGATGCTCGACGATCCTGAAATGCGAGA
+AATGGCGCAGGAAGAACTGCGCGAAGCGAAAGAAAAAAGCGAACAACTGGAGCAACAGTT
+ACAGGTACTGCTGCTGCCGAAAGATCCGGACGATGAACGAAACGCGTTCCTTGAGGTTCG
+CGCCGGTACCGGCGGCGACGAAGCCGCGCTGTTTGCCGGCGATCTGTTCCGCATGTACAG
+CCGTTATGCCGAAGCGCGCCGCTGGCGCGTGGAGATCATGAGCATGAGCGAAGGCGAGCA
+TGGCGGTTATAAAGAGATCATCGCCAAAATCAGCGGCGACGGGGTGTATGGCCGACTGAA
+GTTTGAGTCCGGCGGACACCGCGTACAGCGTGTTCCGGCGACCGAGTCGCAGGGGCGTAT
+CCATACCTCCGCCTGTACCGTCGCCGTGATGCCGGAGCTGCCGGAAGCCGAGCTGCCGGA
+TATTAACCCGGCGGATCTGCGCATTGATACGTTTCGTTCTTCCGGCGCGGGCGGTCAGCA
+CGTTAACACCACCGACTCCGCTATCCGTATTACCCACTTGCCGACCGGCATCGTGGTGGA
+ATGCCAGGACGAGCGTTCGCAGCATAAAAACAAAGCGAAAGCGCTCTCGGTGCTCGGGGC
+GCGCATTCACGCCGCCGAAACGGCAAAACGCCAGCAGGCCGAGGCGTCAACGCGCCGCAA
+CCTGCTTGGCAGCGGCGATCGCAGCGATCGTAACCGGACCTATAATTTCCCGCAGGGGCG
+CGTGACCGATCATCGTATTAATCTGACGTTATATCGCCTTGATGAAACGATGGAAGGTAA
+GCTGGATATGCTGATTGAGCCGATTGTTCAGGAACACCAGGCTGACCTGTTAGCCGCCTT
+ATCCGAGCAGGAATAATGGATTTTCAGCACTGGCTGCATGAGGCGGTAAACCAGCTCCGG
+GACAGCGACAGCCCCCGGCGCGACGCCGAGATCCTGCTAGAGTACGTTACGGGCAAGGGG
+CGGACGTATATCATGGCCTTTGGCGAAACGCCGCTTACCGACGTCCAGCAACAACAGCTC
+GCGGACCTGCTGCAGCGGCGTAAACAGGGCGAACCTATTGCGTACCTGACGGGCTTACGC
+GAATTCTGGTCGCTGCCGCTCTTCGTTTCTCCCGCCACGCTAATCCCGCGCCCGGATACC
+GAATGTCTGGTTGAACAGGCGTTGGCGCGATTGCCGGTAAAAACCTGTCGTATTCTGGAT
+TTAGGCACCGGAACCGGCGCGATTGCGCTGGCGCTGGCCTGCGAGCGACCGGATTGCGAG
+GTGACTGCGGTCGATCGTATGCCTGATGCGGTTGCGCTGGCGATACGCAACGCGGAACAT
+TTGGCTATCCGGAATGTGCGTATACTGCAAAGTTGTTGGTTCAGCGCGCTATCGGGGCAG
+CAGTTCGACATGATTGTCAGCAATCCGCCCTACATTGACGCGCAGGACCCGCACCTTAGC
+GAAGGCGATGTACGCTTTGAACCGCGCTCGGCGTTGGTGGCGGACGAAAACGGTATGGCG
+GATCTTACGCATATTATCGATAACGCCCGCCAGATGTTAACGCCCGGCGGCTTCCTGCTG
+CTGGAACACGGTTGGCAGCAGGGCGAAGCGGTAAGAGCGGTTTTCAGGCGGTCTGGTTAC
+TCGGATGTAGAAACGTGTCGTGATTATGGCGGTAATGAACGCGTGACCTGCGGACGTTTT
+ACGCCATGACAATTGCAATGTTGCTCACGCTTCATCTTATCTGTGTTGCGCTCTCCGTCA
+GTTTGTTTGTCGCTCGTTACTGGTGGCGCTATTGCGGCCATGCGTTGGCCGCCGCGCGCT
+GGACACGAATCGTGCCTCCCGTCATAGATACCCTGTTACTGCTTAGCGGTATTGGGTTAA
+TCGTTAAAACGCACATCCTGCCATTCACGGAGTCGGGCTCATGGCTGACTGGAAAACTGT
+TTGGCGTTATCATCTACATCGTTTTGGGTTTTATTGCGCTTGATTATCGTCAGGCGCGCA
+GCCAGCAGGCGCGTTTTATCGCTTTCCCGCTGGCGCTGGTGGTGCTGTACATCATCATTA
+AACTCGCCACCACAAAAATACCGTTACTGGGGTAAGTCATGAGGTCGTTAGCTGATTTCG
+AATTTAACAATGCGCCGCTGTGTGATGGCATGATCCTGGCATCAGAGATGATTCGCCTGG
+ATTTTCCCACGCAGTTTGTCTACGACGAACTGGAACGTCTGGTCAGTCTGGCGCAGGAAG
+AAATTAGCCAGCTCCTGTCTCAGGATGAGCAACTGGAAAAATTGCTGGCACTTTTTTACG
+GCGAGTGGGGGTTCACGGACTCCCGCGGCGTCTACCGTCTTTCTGATGCTTTATGGCTCG
+ATAAAGTCCTGAAAAAACGCCAGGGTAGCGCGGTATCGTTGGGCGCTATTTTATTATGGA
+TAGCAAACCGTCTTGATTTGCCGTTGGTGCCCGTTATCTTCCCAACGCAGTTGATTTTGC
+GTATTGAATCGCTGGAAGGGGAAATGTGGCTGATTAACCCGTTCAACGGTGAAACGCTTG
+ATGAACATACCCTCGAAGTCTGGTTAAAAGGCAATATTAGTCCGGTCGCCGAGTTGTTTA
+ACGAAGATTTGGACGAGGCGGATAACGCCGAAGTGATTCGTAAGCTACTGGATACGCTGA
+AATCCTCGCTGATGGAGGAACGGCAAATGGAGCTGGCGCTACGCGTTAGCGAAGCATTGT
+TGCAATTTAACCCGGAAGATCCTTACGAAATCCGTGACCGCGGGTTGATCTACGCGCAGC
+TTGAGTGTGAACACGTTGCGCTGACTGATTTAAGCTACTTCGTTGAACAGTGTCCGGAAG
+ACCCGATCAGCGAAATGATTCGTGCGCAGATCAACACCATTGCGCACAAGCAAATTGTTC
+TACATTAATTAACCGACATTTTACCTATAAGTGTAAGGCGATCCTATGAAACAAAAAGTG
+GTTAACATTGGTGACATTAAGGTGGCAAATGACCTGCCGTTTGTGCTGTTTGGCGGTATG
+AACGTGCTGGAGTCACGCGATCTGGCAATGCGCATTTGTGAGCACTACGTAACCGTTACC
+CAGAAGCTGGGTATTCCTTACGTGTTCAAGGCCTCTTTTGATAAAGCCAACCGTTCCTCT
+ATTCACTCTTACCGTGGGCCGGGCCTGGAAGAAGGGATGAAAATCTTCCAGGAACTCAAA
+CAGACATTTGGCGTAAAAGTGATCACTGACGTCCATGAAGCCAGCCAGGCGCAGCCTGTG
+GCTGATGTGGTTGACGTGATTCAGCTCCCGGCGTTTCTGGCGCGCCAGACCGACCTGGTG
+GAAGCGATGGCGAAAACCGGCGCTGTGATTAACGTGAAAAAGCCGCAGTTCGTAAGCCCG
+GGTCAGATGGGCAATATCGTGGATAAGTTCCATGAGGGCGGTAACGATAAGGTGATTCTG
+TGCGACCGCGGCGCGAACTTCGGTTATGACAACCTGGTGGTGGATATGCTGGGCTTTAGC
+GTGATGAAAAAGGTCTCCGGCAACTCGCCGGTGATTTTCGACGTTACCCATGCGCTGCAA
+TGCCGCGACCCATTTGGCGCTGCCTCGGGCGGTCGTCGTGGTCAGGTGACCGAGCTGGCG
+CGCGCCGGTATGGCTGTCGGTCTGGCGGGCCTGTTCCTGGAGTCGCATCCGGACCCGGCT
+AACGCGAAGTGCGACGGTCCTTCCGCGCTGCCGCTGGCGAAACTGGAGCAGTTCCTGACC
+CAGATAAAAGCGATTGATGATTTGGTGAAAAGCTTCGACGAGCTGGATACCGAGAACTGA
+TTGCGGTTTTTAGCTTGTGTAGGCCGGATAAGATACTATCCGGCTTTTTTATATCAGGCA
+AAAATCGTCATCAGATAGGCGGCAAATAAAGCCAGATGCGCCGCGCCGTTTAGCACGTTG
+GTGCGTCCGGTAGAGAACGAAATATGGCACAGCACTAACGAGGCCACCATCACTACCATT
+TCCGGCGCGCCTAAACCAAACACCAGATCATTACCTGTCGCCCAGGCGATGAGCGTGACG
+ACCGGCACGGTTAATGAAATCGTCGCCAACACCGATCCGAAGAACAGATTCATTGCCCGC
+TGAACCTGATTATTCAGTACCGCCTTCAGCGCGCCCAGTCCTTCCGGCGAGAGAATTAAC
+AGCGCGACCAGGAAACCGGTAAAGGCGACCGGGGCGTTCATGCTGGTCAGCAACGCCTCC
+AGCGGGCTGGCATTCATTTTGGTAACGGCAATGACCGCAATTAAATGAATGAGTAACCAG
+ACCGTATGCCAGCCGCTACTGTGCGCGGAGGGTTTACCGTGGTGTGGATTGTCATCATCG
+CCTTCATCTTCATGTTCATAGATAAATAAGCTCTGGTGCGTTTTGGTTTGAATCAACAAA
+AATACGCCGTACATCGCGGCGGAAATTAACGCGACCAATAATGCCTGACTGGTAGAGAAA
+TTGGCTTGCGGCAATGCCATGGGAAAAACCAGCACAATAATCGCCAGCGGAAATAGCGCA
+ATAAGATACTGCTTAATCCCAAATAAATTCATATATTGCGTTGCGAATTTACGCCCGCCC
+AACAACAACGAGAAACCGACCAGTCCCCCGGTGACAATCATAATAATAGAGTAGAGCGTA
+TCGCGCATAAGCGTTGGCGCAGCATCGCCGGTAGCCATCAGCGCGGAAATTAAACTCACC
+TCAAGAATAACGACGGACAAGCTTAAAATAAGCGATCCATAGGGTTCGCCGAGTCGGTGC
+GCTAATACATCGGCATGACGGACCACGCTAAATGCGCTGCTTAAAATACCAATAAGTGCA
+AGGATATTGATGCCAATAACCACTGGTAGTGACTGGCTGCTTCCCCAAAGGAACAGCACT
+ACCAGCGCAAGAACCGGGAAAATAAGCGAAGTCTCCTTATGGCGGGTTTTCACCGCCTCA
+CAGGCATGTGTCATGAGGGTCTCCCTTGTGCAGGTGTTAATATTTTGGAAAGAGTAAAGA
+AGGTAAAAATAGCAGAAATTTGTATTTTTTTAGTGGTTTTTTACGTAGTTTTACGGCGTA
+GACGATTTTTTTCTTTCAAGGTCAGTAAAACAACGATCTTGTTTTAACAGTGTTTAAATA
+ACAAAAAGTTAATTTCCGTAAAAAGCAAAAATCCTCCTCGACTGGCGTAATAACGCATTG
+TTTACCACACTTAATGTTTTCCCTGAAGACGGAGGCGCTGATGCCGTATAAAGCCAAAAG
+TGATTTACCCGATAATGTGCGGAATGTTCTTCCAACCCATGCCCAGGACATTTACAAAGA
+AGCCTTTAATAGCGCCTGGGAGCAATATAAAGATAAAGCCGATCGTCGTGATGACGCCAG
+CCGCGAGGAAACCGCACACAAAGTCGCCTGGGCGGCGGTTAAAAACGATTATGAAAAAGG
+CGAGAATGATAAATGGCATAAGAAAAAATAAACGCGGTATTACTCACGTGTTAGCCTGAT
+TTTCTTGCCGGAAGTCTATCCTGACGCGGGAGCTTTTCCCGCGTACAGATTCAAAATGTC
+AGCACTTTGTCCGCCGCCAGCGTCCATTGCGCCAGCTCGACCAGCGTTCCGATTTCCACA
+CCGTCAATCAGCGGCAGGGGAGTGATACCACGTCCGTCCGCACAGGTTTTGCATAATTTT
+ACCGGTACGTTTTGCGCGGTCAGAATTTCCAGCATTTGCTGAATATTGTAGCCTTCGGCT
+GGTTTTTGACCGCGTAACCCTGCGGTTACGGCATCTGACATCAAAAACAGGCGTAAATCG
+AGATGGCTTTCCTGCTCGCGCAGCGCAATGGCCAGACGCAGGCTATTAAATAATGATTCG
+CTGCCGTAGGCGGCGCCGTTAGCGATAATGACGATATTTTGCATGGATAACCCTTCTCCT
+TGAGAAATTTTGTCGGCAATGGCGTTATGTTACCTCGGGAACCGGGTACCGCCAAATGCG
+TGGATAAAATCCCGGGACGCTCTGCGGAAAAAATAAGGATATTCCTGGAAGCACGAGAAA
+AGGCTGCAAAACCTGTCCGGACACGTTATGGTTTACTCTGATGCCATTCCTCTTATCTTT
+TGTTGTAGAAGTTGCCGACACGTTGAGCCGTATTGTTTTTCGTTCATTCTCACTCTCGCT
+TCTCTTGCTGGCTGCCAGCGGTACGATCCGTGCGCAGGCGCAAGACCCTTTCACGCAAAA
+CCGTCTGCCGGATTTAGGCATGATGCCGGAATCCCACGAAGGGGAAAAGCATTTTGCCGA
+GATGGCCAAAGCGTTTGGCGAAGCCAGCATGAAAAATAACGATCTGGATACTGGTGAACA
+GGCGCGGCAATTCGCTTTCGGACAGGTACGCGATGTGGTCAGCGAGCAGGTTAACCAGCA
+GCTTGAAAGCTGGCTATCAGCCTGGGGCAGCGCCAGCGTGGATATTAACGTCGATAACGA
+AGGTCATTTTAACGGCAGTCACGGAAGCTGGTTTATCCCTTTACAGGATAAACAGCGCTA
+TCTGACCTGGAGCCAGCTTGGTCTTACGCAACAGACTGATGGACTGGTAAGCAACGTTGG
+CATAGGACAGCGCTGGGCGCAGGATGGCTGGCTTCTTGGCTATAATACCTTTTACGATAA
+TCTGCTGGATGAAAATCTGCAGCGCGCCGGCTTTGGCGCGGAGGCGTGGGGAGAATATTT
+GCGTTTATCCGCCAACTATTATCAGCCTTTTGCCGACTGGCAGACGCATACGGCGACCTT
+AGAACAGCGAATGGCGCGCGGGTATGATATCAACGCGCAAATGCGGCTGCCGTTTTACCA
+GCATATCAATACCAGCGTTAGTCTGGAGCAGTACTTTGGCGATAGCGTGGATCTGTTTGA
+CTCCGGAACGGGGTATCACAATCCTGTCGCGTTAAAACTGGGTCTCAACTATACGCCAGT
+ACCTTTGCTTACCATGACCGCCCAGCACAAACAGGGCGAGAGCGGGGTCAGTCAAAATAA
+CCTGGGGCTGACGCTTAACTACCGCTTCGGCGTGCCGCTCAAAAAGCAGCTTGCCGCCAG
+TGAAGTGGCGCAAAGCCAGTCATTACGCGGTAGCCGCTATGATACGCCGCAACGTAACTC
+GCTGCCGACAATGGAGTATCGGCAGCGTAAAACGTTAACGGTTTTTCTGGCGACGCCGCC
+CTGGGATCTTACGCCTGGTGAGACGGTTGCGTTAAAATTGCAGGTGCGCAGCGTGCACGG
+TATTCGTCATTTGAGCTGGCAGGGCGATACACAGGCATTAAGTTTGACGGCAGGAACGGA
+CACCCGCAGTACCGAGGGCTGGACAATCATTATGCCGGCCTGGGATCACCGCGAAGGCGC
+GGCAAATCGCTGGCGTTTATCGGTGGTGGTTGAGGATGAAAAAGATCAGCGTGTCTCTTC
+CAATGAGATCACGCTCGCGCTGACTGAACCGTTTATCACGATGCCGGACGATAATCCGCA
+TTGGCAACCGTTCCAGGAGCAATAATTAAAAGATGCGTTCCTGATGTACCCAGACGGCGG
+CCTCCACGCGCGATTTCAGCTTCATTTTCTTGAGCATATGTTTCACGTGCACTTTGACCG
+TACTTTCGGTGATATCCAGACGCCGGGCAATCATCTTATTCGGCAATCCCTGCGCGATGA
+GCTTCAGAATATCGCGCTCACGCGGGGTGAGTTGCGTTACATCGCGATCGGTGGTGGCGC
+GGTTGGCCCGCAGGCTGGCCGCCAGTACCGGCGTTAACGCTTCACTTAATACCATTTCGC
+CGGCGGCGGCCTGTTGTAACGCTTTGAGCAAGTCCTCCGGCTCCATGTCTTTCAACAGGT
+AACCGTCCGCGCCGCGCTTTAGCGCCGTGACGACATCTTCTTCATGGTTGGATACGCTGA
+AAACGACAATACGTCCTGACAGCGCTTTTTCGCGTAATTTATCCAGCGTTTCGAGGCCAT
+TCATTCCCGGCATATTCAAATCAAGGAGGATCAGATCGGGATCGAGCGATTCCGCCAGGT
+CAATACCCTGCTCACCGTTGCTGGCTTCTCCGACCACGCTGATATCGGGCGCCATACTCA
+CAAGCTGCTTTACACCCGTGCGTAGCATCGGATGGTCGTCGATTAACAGGATGGTTGCCG
+GTTCCTGATTATTCATGGGTATCTCCCTGGGTTTCTGTGAAGTTTGTTTCTGGAATAAAA
+GTAACAGTGACCTCTGTTCCGCCAGTCTCGCGTCGGCGTACCTGGCAATCGCCGCGCAAA
+CTTTGCGCCCGATCGCGCATGATAATCATGCCGTAGTGATTACTGCGTTCGGCGTTTTCC
+GGGACGCCGCAGCCATTATCCTGTACTTTTAGTTTGACCTGTTTGCCACATTGCGTCACT
+GTCACCACCACATCGTCGGCATGAGAGTGTTTAAGGGCGTTGCTGAGGGCTTCCCTGGCA
+ATTTGCAACAGGTGTATCGCCTGGTGTGAAGGCACCAGGCGGGGGGGAAGCTGATAATCC
+AGTTTTACCGTAAAGCCAAACCGGGCGCTGAACTCCTGGCAGCTTGCTTCCAGCGCCGGA
+CGTAGCCCGGGTTCCGTCAACTGTAAGCGGAAAGTGGTTAACAGTTCGCGCAGTTGCGCC
+CAGGAGCAGTTCAGCTCATTGCGAATTTGGCTGAGTAACTCACGGCTGCTTTCCGGTAAC
+ACGTCGCCCTGCATTTGCAGGCAGCTCACCTGCATCTTCATACAAGAGAGCGACTGGGCA
+ATAGAATCATGCAGTTCGCGGGCAATGGTGGCACGCTCTTCCATGACAATCAACTGCTGC
+TGGCGCTCCTGATGCCTGTCGAGCGCCAGAGTCGCGGTAAGCTGTTCAACCAGCGTGTCC
+ACCAACTGTTGCTGATCGTGGCTGAGATGGCGTCCATAGGGCAGCGTCGCCAGCAAAATA
+CCGTATTGGGTGTGAGAGTCGGTGAGCCGCCATTTTAAGGTGGTGCCGCCGTTAATCATC
+GGCAGGGCGCTACGTGGGCAAAGGTGGCAGCCTTTATCATCGCAACTGATGTCCGACTGA
+CAGGTAAATTCCTGGTGATTATCTTCATCTTCCAGGTCATAGACTCGCAGCTCAATATCA
+TGCAACTGGGTTAAATTTTGCAGGCCATTCAGTACCGGAGAAAGACGCTCACATAGCGGA
+GCCTGTGAATGCAGTCGGCGGTTGGCTTGCCACAAAAACGAGAGAATCTGGTTTTTATGT
+TCCAGACCGGCTGTTTTTTCCTGTACGCGCTGTTCCAGTACCGCATAACTTTCGGCCAGT
+TCTTCAGACATATTATTGAGCGCAGAACCCAACGCGGCCATCTCATTGCGTCCACTGATA
+TTGGCACGTTGGGTAAAGTCGCGCTGACTGACGGCGCGCGCCATTGATAACAACTGTTTC
+CAGGGCTGCAAAAGGCGAACACGTAGCCAGATAATCGTAAATACCAGCAATAGCGCCATA
+AAGATCGCCATTACCCGGTGAACTAATACCACGCGTTCGATACGCAATTCAGTAGTATGG
+TCGAACGACGTCACCAGGCGATCCAGGCCCGCCACAAAGCGCGTGACATCTTCTGCGACC
+GCGTGCGCGTTTTGCGCGTGCTGTAGCCCTGGCGAGAGTTCGTTATGCCAGTAATCCTGC
+AACGCTTTAAGCTGCTTTTGCTGCCCGTCTCGCTCAGCGGCGCGGGTCAGTTCCGGGCTG
+AATGCCGTTTGCTCCATCTCATCCAGCAGCTTTTGATCTTTAGCATCCAGCGGGACAGCG
+GCCAGTAGTCGATAGCTTTGCATACGCAATGAGCCCGCTTTATTAATCGCATGAGCGCTA
+CCCTGCACGCCCTGAACCAGCCAGCCGGAAACCACCACCCCCGCCACGCCGATAGCGGTA
+GAGAGCATGACAATCAGCGCCAGTTGGTTAACCAGCGTAAGAGGAGAGAAACACCGTTTA
+AACATGTTACCTTCTTTCTTCGGGGTAATGTCGCCGAAAAAACGTAGCAAAAAAGAGGGG
+CGTCAATCGGCTGTGCCGCTATTCTCAACGATACAGCGGAGTATACCCATACCTATAACG
+AGTTACTCCTTAATTGCCGCCGTAGAGAGGTATCTGCGACGGGAAGGAGTAGACAGACAC
+AGCATGGTGAAAAACCACAGCTTTTTTACCAAAATAGCCTACTCATTAAGGGTAATAACG
+CTTTTTAGTCGACGGTGATGACGACTTTTCCTTTGATTTATATCAACTTACCTTCGGCAG
+TAAACCCTAATGTGGCAGACATCAAATCAAGAATCAGAGGTGTCTATGAGTCACTCATCC
+GCCCCGGAAAGGGCAACTGGCGCTGTTATCACGGAATGGCGTCCGGAAGATCCGGCATTC
+TGGCAGCAGCACGGCCATCGTGTCGCCAGCCGTAATTTGTGGATTTCTGTCCCGTGTTTA
+CTGCTGGCGTTTTGCGTCTGGATGCTATTCAGCGCAGTGGCGGTGAACCTGCCGAAAGTG
+GGATTTAATTTTACGACCGATCAGCTCTTTATGTTGACTGCGCTGCCATCTGTTTCCGGC
+GCGCTGCTACGGGTGCCTTACTCCTTTATGGTGCCGCTATTTGGCGGACGTCGCTGGACA
+GCGTTCAGTACCGGTATCCTCATCGTGCCCTGCGTATGGTTAGGCTTTGCCGTTCAGGAT
+ACCAGTACGCCATTTAGCACTTTCATTATTATTTCCTTGCTGTGTGGTTTTGCCGGCGCG
+AACTTTGCCTCCAGTATGGCGAACATCAGCTTTTTCTTTCCTAAACAAAAGCAGGGCGGC
+GCGCTGGGTCTGAACGGTGGTCTGGGCAATATGGGCGTGAGTGTGATGCAGCTGGTTGCG
+CCGCTGGTGGTTTCGCTCTCTATCTTTGCCGCCTTTGGCAGCCACGGTGTAGAGCAGCCG
+GACGGTTCTCAGCTCTATCTGGCGAACGCAGCCTGGATTTGGGTGCCTTTCCTGGCCATT
+TTTACGCTGGCGGCGTGGTTCGGCATGAACGAACTGGCGACGTCTAAGGCCTCGCTAAAA
+GAGCAACTGCCGGTGCTCAAACGTGGTCATCTGTGGATCATGAGTCTGCTGTATCTGGCG
+ACCTTCGGATCGTTTATCGGTTTCTCCGCGGGGTTCGCTATGCTGTCTAAAACACAATTC
+CCGGATGTGCAGATCCTGCATTATGCGTTTTTCGGTCCGTTTATCGGCGCGCTGGCGCGT
+TCGGCAGGCGGCGCAATTTCTGACCGTCTGGGGGGGACTCGCGTCACGCTTATCAACTTT
+GTCCTGATGGCGATTTTCAGCGGTCTGCTGTTCCTGACATTACCTACTGGCGGCGTTGGA
+GGTAGCTTTATCGCGTTCTACGGGGTATTTCTGGCGCTATTTCTGACGGCGGGGTTGGGG
+AGTGGTTCTACCTTCCAGATGATCTCCGTTATCTTCCGTAAACTGACGATGGACCGGGTT
+AAAGCGGAAGGCGGGTCGGACGAAAGAGCCATGCGTGAAGCGGCGACCGATACGGCGGCG
+GCGCTGGGCTTTATTTCCGCGATTGGCGCGATTGGCGGCTTTTTTATTCCGAAAGCGTTT
+GGTTCATCTTTAGCATTAACTGGTTCTCCAGTCGGCGCGATGAAAGTCTTTCTTATTTTC
+TATATCGCCTGCGTCGTTATTACCTGGGCGGTATATGGACGTCATTCTAAAAATAAAAAG
+TAATTTTTGATTATCCTTTGCGCGGCGTTAGACCGCGCTTTTTTTTACCTGTATTTAGTT
+ACAACATACTTATAGTCAAGAAGAGAGGCGCGACAGGGCTGACCACGCACATTTTTATCG
+GTCATCCAGGGGGATACCCCTTAATACCCACTTGTTGAAAATTTAACATTCAATTTGTGC
+GTAAATTTAATTTTATGTAATTAAATCAGTAATATATATAAATAAAACTCCTCCTCCAAA
+AGGAGTATGCAGGAGGTTTGCGCGCCATTTGCATCCCTGTCCGCCTTGATCGTTATCAAT
+TCTCACGCCCATTCAGCGCGTTACCTTCGCCCTTAGTTAAGCAATGTCGATTTATCAGAG
+AGCCGTAAGGTTCCACACAGGAGAAACCCGATGAGTAAATTCCTGGACCGGTTTCGCTAC
+TTCAAGCAGAAGGGCGAAACCTTTGCCGATGGGCACGGCCAGCTTCTCGAAACAAACCGG
+GACTGGGAGGACGGATACCGCCAACGTTGGCAGCATGACAAAATTGTGCGCTCAACCCAT
+GGGGTGAACTGCACCGGTTCTTGTAGCTGGAAAATTTATGTCAAAAATGGTCTGGTGACC
+TGGGAAACACAGCAAACCGATTACCCACGCACCCGTCCCGATATGCCAAACCATGAACCT
+CGCGGCTGCCCGCGCGGCGCAAGCTACTCCTGGTATCTCTACAGCGCTAACCGACTGAAA
+TATCCGCTGATGCGCAAACGTCTGATGAAGATGTGGCGCGAGGCGAAAAAACTGCATCGC
+GATCCGGTAGAGGCATGGGCCTCCATCATTGAAGATGCCGATAAAGCCAAAAGCTTCAAA
+CAGGCGCGTGGTCGTGGCGGCTTTGTTCGCTCCTCATGGCAGGAAGTGAACGAACTGATC
+GCCGCTTCCAACGTGTACACCGTGAAAACCTATGGCCCTGACCGCGTCGCGGGCTTCTCA
+CCCATCCCGGCGATGTCGATGGTTTCCTACGCTTCCGGCGCACGTTATCTTTCACTGATT
+GGCGGTACCTGCCTGAGCTTCTACGACTGGTACTGCGATCTGCCGCCAGCCTCCCCGCAA
+ACCTGGGGCGAGCAGACCGACGTGCCGGAATCCGCTGACTGGTACAACTCCAGCTATATT
+ATCGCCTGGGGCTCTAACGTGCCGCAAACCCGTACGCCGGATGCCCACTTCTTTACCGAA
+GTACGTTACAAAGGCACTAAAACCGTCGCGGTGACGCCGGACTATGCTGAAATCGCCAAA
+CTGTGCGATCTGTGGCTGGCGCCGAAGCAGGGGACCGATGCGGCGATGGCGCTGGCGATG
+GGCCACGTCATGCTGCGCGAGTTCCACCTCGACAACCCGCGCCAGTACTTCACCGATTAT
+GTCCGTCGCTATACCGACATGCCAATGCTGGTGATGCTTGAAGAGCGTGATGGTTATTAT
+GCCGCAGGTCGTATGCTGCGCGCTGCCGATCTCGTTGATTCGCTGGGGCAGGAAAATAAC
+CCGGAATGGAAAACCGTCGCTATCAACAGCAACGGTGAAATGGTGGCGCCAAACGGTTCA
+ATTGGTTTCCGCTGGGGCGAAAAAGGCAAATGGAACCTCGAACAGCGCGACGGGACTACC
+GGTGCAGAAACTGAATTGCAGCTCAGCTTGCTGGGCAGCCAGGATGAGATTGCTGACGTG
+GGCTTCCCGTATTTCGGCGGCGAGGGTTCAGAGTACTTTAATCATGTGGCGCTGGATAAC
+GTCCTGCTGCATAAACTGCCGGCAAAACGTCTGCAACTGGCCGATGGTTCTTCAGCGTTA
+GTCACCACCGTGTATGACCTGACCATGGCGAACTATGGTCTGGAACGCGGCCTGAACGAT
+GAAAATTGTGCCGCCAGTTATGATGATACCAAAGCGTATACGCCAGCATGGGCCGAGCAG
+ATCACCGGCGTGCCGCGGGCGCAGATCATCCGTATCGCACGGGAGTTCGCCGATAACGCG
+GACAAAACGCACGGGCGTTCAATGATTATCGTTGGCGCCGGTCTGAACCACTGGTATCAC
+CTCGATATGAACTATCGCGGGCTGATCAATATGTTGGTGTTCTGTGGTTGCGTTGGTCAG
+AGCGGCGGCGGTTGGGCGCACTACGTCGGCCAGGAAAAACTGCGTCCGCAGACCGGCTGG
+CAGCCGCTGGCGTTTGCCCTTGACTGGCAGCGTCCGGCGCGTCACATGAATAGCACCTCT
+TACTTCTATAACCACTCCAGCCAGTGGCGCTACGAGACGGTGACCGCCGAGGAATTACTG
+TCGCCGATGGCGGACAAATCCCGCTATAGCGGCCATCTGATTGACTTCAATGTGCGCGCC
+GAGCGTATGGGCTGGTTGCCGTCGGCACCGCAGTTAGGTACCAACCCGCTGTATATTGCG
+CGTGAAGCGGAAAAAGCCGGTATGACGCCGGTAGATTATACCGTCAAATCCCTGAAAGAG
+GGTTCGATTCGCTTTGCCGCCGAGCAGCCGGAAAACGATAAAAACCACCCGCGTAACCTG
+TTCATCTGGCGTTCAAACCTGCTTGGGTCTTCCGGTAAAGGTCACGAGTATATGCTGAAA
+TATCTGCTGGGTACTGAGCATGGTATTCAGGGGCTGGATCTGGGTAAACAGGGCGGTGTG
+AAGCCGGAAGAAGTGGAGTGGCGTGACAATGGCCTGGACGGCAAACTGGATCTGGTGGTG
+ACGCTGGACTTCCGCCTGTCGAGCACCTGCCTGTACTCCGATATCGTACTGCCGACCGCC
+ACCTGGTATGAAAAAGACGATATGAATACCTCGGATATGCATCCGTTTATTCATCCGCTG
+TCTGCCGCCGTAGATCCGGCCTGGGAATCGAAAAGCGACTGGGAAATCTACAAAGGCATT
+GCGAAGAAATTCTCCGAAGTCTGTGTAGGTCACCTGGGTAAAGAGACTGACGTCGTGACG
+CTGCCGATCCAGCACGATTCTGCCGCTGAACTGGCGCAGCCGCTGGACGTGAAAGACTGG
+AAAAAAGGCGAATGCGATCTGATTCCAGGGAAAACCGCGCCGCACATCATGACCGTTGAG
+CGCGATTACCCGGCGACTTACGAACGCTTTACCTCTATCGGCCCGCTGATGGAGAAAATC
+GGCAACGGCGGGAAAGGGATTGCCTGGAACACGCAGAGCGAAATGGACTTGCTGCGTAAG
+CTCAATTACACCAAAGCGGACGGTCCGGCGAAAGGCCAGCCGATGCTCAACACGGCGATT
+GACGCGGCAGAGATGATCCTGACGTTAGCGCCGGAAACCAACGGTCAGGTGGCGGTGAAA
+GCCTGGGCGGCGCTGAGCGAGTTTACCGGTCGCGACCATACGCATCTGGCAACCAATAAA
+GAAGAAGAGAAAATCCGCTTCCGCGATATTCAGGCCCAGCCGCGCAAAATTATCTCCAGC
+CCGACCTGGTCTGGTCTGGAAGATGAGCATGTTTCTTATAACGCCGGTTATACCAACGTT
+CACGAGCTGATCCCGTGGCGTACGCTGTCTGGTCGTCAACAGTTGTATCAGGATCACCAG
+TGGATGCGCGACTTCGGCGAAAGTCTGCTGGTGTATCGCCCACCGATCGACACCCGCTCG
+GTGAAAGCGGTGATGGGGCGTAAATCCAACGGTAATCCGGAGAAGGCGCTCAACTTCCTG
+ACGCCGCACCAGAAATGGGGTATCCACTCGACCTACAGCGATAACCTGTTGATGCTGACC
+TTGTCGCGTGGCGGCCCGATTGTATGGATGAGCGAAACCGACGCCAAAGATCTGGGCATT
+GAAGATAACGACTGGATCGAAGTCTTCAACAGCAACGGCGCATTGACCGCACGCGCAGTG
+GTCAGCCAGCGTGTACCGACGGGCATGACCATGATGTACCACGCGCAGGAACGTATCGTA
+AACCTGCCGGGGTCGGAAATTACCCAGCAGCGCGGCGGTATTCATAACTCGGTGACGCGC
+ATTACGCCGAAACCGACCCATATGATCGGCGGCTATGCGCAGTTAGCCTACGGCTTTAAC
+TACTACGGTACCGTCGGCTCCAACCGCGATGAGTTTGTGGTGGTACGTAAGATGAAGAAC
+ATTAACTGGTTGGATGGCGAAGGCAATGACCAGGTACAGGAGAGCGTAAAATGAAAATTC
+GTTCACAAGTCGGCATGGTGCTGAATCTCGATAAGTGCATCGGCTGTCATACCTGTTCAG
+TCACCTGTAAAAACGTCTGGACCAGTCGCGAAGGTATGGAATACGCGTGGTTCAACAACG
+TAGAAAGTAAGCCTGGCGTTGGTTTTCCGAATGACTGGGAAAATCAGGAAAAATGGAAAG
+GCGGCTGGATCCGCAAAATCAACGGCAAACTACAGCCGCGCATGGGCAACCGGGCGCTGC
+TGCTGGGTAAAATCTTCGCTAACCCGCATCTGCCGGGCATCGACGACTACTACGAGCCGT
+TTGATTACGACTACCAGAACCTGCATACCGCGCCGGAAGGCAGCAAACATCAGCCGATCG
+CGCGTCCGCGCTCGCTGATTACCGGCCAGCGGATGGACAAAATTACTAGCGGGCCAAACT
+GGGAAGAGATTCTGGGCGGCGAGTTCGAAAAACGCGCCAAAGACCAGAACTTCGAAAACA
+TGCAGAAGGCGATGTACGGCCAGTTCGAAAACACCTTCATGATGTACTTGCCGCGCCTGT
+GCGAGCACTGCCTCAATCCGGCGTGCGTGGCGACCTGCCCAAGCGGTGCCATCTACAAGC
+GTGAAGAAGACGGCATTGTGCTGATCGACCAGGACAAGTGCCGCGGCTGGCGGATGTGTA
+TTACCGGCTGCCCGTACAAGAAGATCTACTTCAACTGGAAGAGCGGCAAATCTGAAAAAT
+GCATCTTCTGCTATCCGCGTATTGAAGCGGGTCAGCCGACTGTTTGCTCGGAAACCTGCG
+TGGGCCGTATCCGTTATCTTGGCGTACTGCTGTATGACGCCGATGCCATTGAAAGCGCCG
+CCAGTACGGAAAACGAAAAAGATCTGTACCAGCGTCAACTGGACGTGTTCCTCGATCCGA
+ACGATCCGGCTGTCATTGAGCAGGCGTTGAAGGACGGCGTGCCGCAGAGCGTGATCGATG
+CGGCGCAGCAATCGCCAGTATACAAAATGGCGATGGACTGGAAGCTGGCGCTGCCGCTGC
+ATCCGGAATACCGCACGCTGCCGATGGTCTGGTACGTGCCGCCTTTGTCACCGATTCAGT
+CTGCCGCCGACGCGGGTGAACTGGGCAGCAACGGTATTCTGCCGGATGTAGACAGTCTGC
+GTATCCCGGTGCAGTACCTGGCGAATTTGTTGACCGCTGGCGACACTCAGCCGGTACTGT
+TGGCGCTGAAACGGATGCTGGCGATGCGTCACTACAAACGTGCGGAAACCGTAGACGGTA
+AAGTGGATACCCGCGCGCTGGAAGAGGTGGGTTTAAGCGAAGCCCAGGCGCAGGAAATGT
+ATCGTTACCTGGCAATTGCTAATTATGAAGATCGCTTTGTGGTGCCGAGCAGCCATCGTG
+AACTGGCGCGTGACGCATTCCCGGAGAAAAGCGGTTGTGGCTTTACCTTCGGCGATGGTT
+GCCACGGGTCTGATACCAAATTCAATCTGTTCAACAGCCGCCGCATCGACGCTGTTGATG
+TGACCAGCAAAACGGAGCCGCACGCATGATTGAACTCGTCATTGTTTCGCGTCTGCTCGA
+GTACCCGGATGCTGCCCTGTGGCAGCATCAGCAGGAGTTGTTCGATGCGCTCGCGTCATC
+TGAGAACCTGGAGAAAGAGGATGCCCAGACTCTGGGCGTTTTCCTGCGCGATTTAACCGC
+GCAGGACCTGCTGGATGTACAGGCCGCTTATAGCGAACTGTTTGACCGTGGTCGCGCCAC
+ATCGCTGCTGCTGTTTGAACATGTACACGGGGAATCCCGCGATCGCGGTCAGGCGATGGT
+TGACCTGATGGCACAGTATGAGCAGCACGGTTTGCAGCTCGACAGTCGCGAACTTCCCGA
+TCATCTGCCGCTGTATCTGGAATACCTTGCGCAATTGCCGAAAAGCGAAGCGTTAGGGGG
+TTTACAGGATATCGCGCCGATTCTGGCGCTGCTCAGCGCACGTTTGCAACAGCGTGACAG
+CCGTTATGCGGTGCTGTTCGATCTGCTGTTAAAACTGGCGAATACCGTTATCGACAGCGA
+TAAAGTGGCTGAAAAAATTGCGAATGAAGCACGTGATGATACCCCGCAGGCGTTGGATGC
+GGTCTGGGAAGAAGAGCAGGTGAAATTCTTCGCCGATCAAGGGTGTGGTGAGTCGGAAAT
+CTCCGCTCACCAGCGTCGTTTTGCCGGGGCCGTGGCACCGCAATATCTGAATATCACCAC
+CGGAGGACAGCACTAATGCACTTCCTGAATATGTTCTTCTTTGATATCTACCCGTACATT
+GCCGGATCGGTATTTCTGATCGGTAGCTGGTTACGTTACGACTACGGCCAGTACACCTGG
+CGGGCGGCTTCCAGTCAGATGCTGGATCGCAAAGGAATGAACCTGGCGTCAAACCTGTTC
+CACATTGGGATTCTGGGTATTTTCGCCGGTCACTTCCTGGGCATGTTAACGCCGCACTGG
+ATGTATGAAGCTTTTCTGCCGGTCGACGTGAAGCAGAAGATGGCGATGATTGCCGGCGGC
+GCCTGCGGCGTGCTGACACTGGTTGGCGGTATTTTACTGCTCAAGCGTCGTCTGTTTAGC
+CCACGTGTCCGCGCCACCACTACCGGCGCAGATATTTTGATTCTCTCGCTGCTGGTGATT
+CAGTGCGCGCTGGGCCTGCTGACCATTCCGTTTTCCGCCCAGCATATGGACGGGAGTGAA
+ATGATGAAGCTGGTCGGGTGGGCGCAGTCAGTTGTGACCTTCCACGGTGGCGCATCCGCA
+CATCTGGACGGTGTGGCCTTTATCTTCCGTATGCACCTGGTACTGGGGATGACGCTGTTC
+CTGTTATTCCCATTCTCGCGCCTGGTGCATATCTGGAGCGTGCCGGTCGAGTACCTGACC
+CGCAAATACCAGATTGTTCGTGCACGTCACTGATTTTCTCTCGATGCCCTAAACTCCGCT
+TCGGCGGAGTTTTTTTATGGCTGTTTGCCGGAGTGCGGCATAAATGCCTTATCGACCGCC
+GCCTTGTTTCGTTTACAGCGGATCTGCCATGTCTGGCATCTGAATCCGGACTCTTTGTTT
+CTGAGTTTATTCAGCATCTGTGCGAGTTTTTTGTAAGCAGAAAAAGGATGATGCAGCATA
+TAATCACGCCATAAACGACAATAAGGATAGTTGTATGCGTTTTTCATCAATTTTCAAAAT
+AATAATATTAAATATATTTATTTCAAAAATGGCTCACTCTGCTGTCTGCGAGGAGCGCTA
+TCCCCCCGACTCAGAAGAATGCCAGTACGTTCAGGAATTAGAGCAAAAAGCGGAACAAGG
+AGATGAAAGCGCGCAGTTCGCGCTTGGAAGCTGGTATGCGGAGGGGCGATATGTTAAGCC
+TGATTATAAACTAGCCATAAAATGGCTGGAGAAAGCGGGTAAACAAGGTTCTGATTTTTC
+CTATTTCATCCTTGGCTATCATTACAACTATGGTGAAAATTTTCCACTTAGTCGACAAAA
+AGCGCTGGAGTGGTATCGCAAGGCGGCAGAGCTAGGGGATAGTAGTACGCAAGAAATCCT
+CGGTGACGCCTATATGTATGGCGATGGGTTTCCCCAAAATACCCAGCTAGCGCTGGAGTG
+GTATCGAAAAGCCGCCTCTCCAACCAATGATGCGGGCGTTGTCCGCGGCCAGGGTTCAGC
+TTCGTCAGCACAATTTAAGCTTGGAGTAATGTACGCCCACGGTCAGGGCGTCCCTCAGGA
+TTATCAGCAAACGGCGATCTTGATGCGTAAAGCGGCGGAAAATATGTACTACCCCGCGCA
+ACTTTATCTCGGTGTTGCCTATTTTTATGGTGAAGGCGTGCCTCAGGATTATCGTCAGGC
+AGTTTACTGGCTTAATGAAGGTATACCAAGCAGCTATACGCCAGGCCACATTCCGCTGAA
+TGCGCTCTATGATAAAGCGCATCCCGCTGACCAGGTTCACTCTCAGACGTGGTATCGAAA
+AACAGCGCAACGCGTGATGGCAAAGGTACAGTACAATTTTGGCGTATGGTATTACAACGG
+TTATCACTTATTGAAAGATCACAACCTGGCGCTGGAGTGGTATCGCAGAGCCGCAGCGCA
+AGGATTGGCCGAGGCGCAGGATGCGATCGGCGTGATGTTTATGCAGGGTGAGGGCGTATC
+TCAGGACTACCAACAGGCGCTGGCGTGGTATCGCAAAGCCGCACGCCAGGGACTGCCTGC
+TGCGCAAACGCATCTGGGCATCATGTCTGCTTTTGGTCGCGGCGTCGCGCAAAGCGACAG
+ACAGGCTATCGCATGGTATCGAAAAGCAGCAAAACAGGATTTTGCGAAAGCGCAATATCA
+GCTTGGCGTAGCATATAGCACGGGAAGAGGCGTGCCTGAAAATAGCCGGAATGCGCTGAA
+GTGGTACCTTAAAGCGGCAGAGCAGGGGTTTACTCCGGCACAATTAGCGCTTGGGGAAAT
+TTATGCTCATGGGCGCCAGGGGGTGCCTAAAGATAATAAGCAGGCCTATATTTGGTATTA
+CATGGCAAGTATATATACGGAAAAATCTAAGGATGATTGTTCAGCGCTCATTGCCGAAAG
+AAACCGACTCAAGGGAACGCTTACCCCAGATCAACTTAGCGAGACATATGCCGCCTTTGA
+TCTCATCAGGCGAAAAATCAACCAGTCAAAGGAGGCGAAAAAGATTGCCAGGAAGAAGTA
+TTGATAAGATAGCCAATAAGCTATGGCGCCATGGTGTGAAGTCTGCCTGTGGGGTAAGGA
+TACGGGGCAGTGCTGATTGATTTGAAATTGGTGCCTTATGAAGTCATGGTGGTGGGGGAA
+GGATGACTCAGCGCTGCGCGTTTCGCCCTTCGGGTCGTTGCCTGCGGCAACGCTTTCTCG
+CTTTCGCTCGAATCGAACCTTAGTCGAAGCTTCTCATCCTTCCCGTACAGAGAGATATGA
+GACACTATGCTTAACGGGGATAAGATACGCGACGGGAGTGATGGTGGTGGGGGAAGGATG
+ACTCAGCGCTGCGCGCTTCGCCCTTCGGGTCGTTGCCTGCGGCAACGCTTTCTCGCTGCG
+CTCGAATCGAACCTTAATCGAAGCTTCTCATCCTTCCCGTACGGAGAGATATGAGACACT
+GTGCTTAACGGGGATAAGATACGCGACGGAAGTGATGGTGGTGGGGGAAGGATGACTCAG
+CGCTGCGCGCTTCGCCCTTCGGGTCGTTGCCTGCGGCAACGCTTTCTCGCTGACGCTCGA
+ATCGAACCTTAGTCGAAGCTTCTCATCCTTCCCGTACAGAGAGATATAAGGCACTGTGCT
+TAGCGGGGATAAGATACGCGACGGGAGTGATGGTGGTGGGGGAAGGATTCGAACCTTCGA
+AGTCGATGACGGCAGATTTACAGTCTGCTCCCTTTGGCCGCTCGGGAACCCCACCAGGGG
+TAATTCAAATTGTAGGTAAAGCTTGAAGATGGTGGTGGGGGAAGGATTATTCGTCGCTTC
+GCTCCTCACCCTACGGGCCGTTGCCGTTGGCAACGTTCTCTCGCTTTCGCTCGAGTCGAA
+CCTTAATCGAGGGTTCTCACCCTTCCCCGACAAGTGCAGACTTCTGCATTGCTCATCGAG
+TTAACTACATCGCTGTAGTGAATAATGGTGGTGGGGGAAGGATTCGAACCTTCGAAGTCG
+ATGACGGCAGATTTACAGTCTGCTCCCTTTGGCCGCTCGGGAACCCCACCACGGGATAAA
+TTCATTATGCTGCTTGCATTCTATAGCGGGAAGGATTATTCGGAGCTAAAGCTCCTCACC
+CTTCGGGCCGTTGCCTGCGGCAACGTTCTCTCACTATTGCTCGAGTCGAACCTTGAAGTC
+GATGACGGCAGATTTGCAGTCAGCTCCCTTATGATCGCTCGGGAACCCCACCACGGGGTA
+ATGCTTAATACTGGCCCGCTTCCTTTTGGGAAGCGGGGCGCATCATATCAAATGACACGC
+CGCTGTAAAGCATTCCTTTGCCTGAAATGAACTGTTTGCGTACTTTTCATCCGTAACGGA
+TTAAAGCTAATCAATTCATATTACTGACGATTAAAGAATAATCGTCCGATTGCCGTAAAC
+AAAGACTCGCTGTGCCAGAACCTGATACAGCGCGCGGCTTAATACGTTTTTCTCAACGTC
+GCGCCCGGCACGCATCATATCTTCTGCGGTGTAGGTGTGATCGACGTGAATCACGTCCTG
+CATAATGATTGGGCCTTCATCCAGATTATCATTCACATAGTGCGCGGTAGCGCCGATGAT
+TTTCACGCCGCGCTCATAGGCCTGATGATAAGGACGCGCGCCGATAAACGCCGGCAGGAA
+TGAGTGGTGGATATTGATAATTTTGTTCGGGAAGCGCGCCACAAAACCTGGCGTCAAAAC
+ACGCATATACTTGGCCAGCACTACATAGTCCGGTTGATGGGCATCAATGGCGTCCGCCAT
+CTTCGTGTCATGCTCTTCACGCGTTAATCCCTCATGGCTGACCAGTTCGAAAGGGATCTC
+AAAACGTTCAACCAGCGAGCGTAACGTTTCATGGTTGCCAATGACCGCGGCGATTTCAAC
+ATCCAGCCCGCCATAGTTGGCTTTCATCAGCAGGTCGCCCAGACAATGCGCCTCTTTGGT
+AACCAGAATCACTACCCGACGGCGTCCGGCGGGATTGAGTTCACGAACAGAGCCTTCCGG
+TAAGGCGCTATCCAGATCGGCCAGGAGAGTGGAATCATTGAAGATGCCTTCCAGCTCGGT
+CCGCATAAAAAAGCGTCCGGTGCGATGGTCCACAAATTCATTGTTTTGCACAATATTAAG
+CTCGTGCTTATAGCAAATGTTGGTAATCCGCGCGATAAGGCCTTTTTGATCGGGACAAAT
+AGTACGCAGAACTTTACGTTGTAGTGATTGCATTGCCGGAAAAATCCTGTTGAGAGTGTT
+TGCTGTATCGATACTGTCAGGCGTCACTGGCCGCAGCACTTTTTAAATTTTTTGCCTGAA
+CCGCACGGGCAGGGATCATTTCGACCCAACTGCGGGCGGGTACCGTCAATATAATACCAC
+TGACCGTTTTCTTTGATAAAACGAGAACGTTCGATAATCGCCCCGGTTTTCCCTTGTTCG
+GAAAAACGCGCGATAAAACTAACATATCCTGTATTTTCTGCTTCTGACCAGGTATGTTCA
+AAAATAGTCAGGCCGAGCCACCTGGTATTGGCAAATCCGGCGATGATATCATCACGAAAC
+GCGGCCGCATTGCAGGTTGGATGCCAGCTCTTAATTAAGTAATCTGCGTCTTTCATCACA
+AAAGCGCAGTAACGAGAGCGCATGAGATGTGACGGATCGGGTGCTACTCGTTCTCCGGAC
+ACAATACGACCACAACATAGGCTATACTCGTCAGCGCTACCACAGGGACAAGGCTGAGAC
+ACAATAATCTCCCTGAATATAAAAAACGGCGTTGAACGCCAGGGTGGCATTATGTTAACT
+GAGCAGTGGCGATGTTGCTACGTCTTGAAGCCAGGGGAAGTCGTTAAGTACGATGAGAAA
+AATGAAAATAGGGCTGGCGCTGGGATCTGGCGCAGCGAGAGGATGGTCTCATATTGGGGT
+CATCAAAGCCCTCAAGCAAACAGGCATTGATATTGATATCGTTGCAGGATGCTCAATAGG
+TTCGCTGGTCGGCGCCGCGTATGCCTGTAATAAATTATCGGCGCTTGAACAGTGGGTATG
+TTCATTCCGCTACTGGGATGTTTTACGCCTGATGGATGTATCCTGGGGCAGAGGAGGGTT
+GCTTCGCGGCGAACGCGTATTTAATCACTATCGGGATATTATGCCCGTCACGGATTTTGA
+CCACTGTTCAAGACGTTTTGGCGCGGTCGCGACGAATCTTAGCACGGGACGAGAGCTATG
+GTTTACTGAAGGCGATCTACACCTTGCTGTACGCGCGTCGTGCAGTATGCCAGGGCTGAT
+GTCTCCGGTTGAGCATAACGGTTACTGGCTGGTAGATGGCGCAGTCGTTAATCCGGTACC
+TGTTTCGTTAACCAGGGCGCTGGGGGCTGATATCGTTATTGCGGTAGACCTGCAACATGA
+TGCCCACCTCATGCAGCAAGATTTGCTCTCTGTAAATGTCGGGAATATCAATGAAGAGAG
+CGATGATGCGCTGCCCTGGCATAAGCGTTTAAAAGAACGTTTCAGTAGCCTGACTTCACG
+CCGTGGCGTGAGTTCGCCTGGGGCAATGGAAATCATGACAACCTCCATCCAGGTGTTGGA
+AAATCGTCTTAAACGTAACCGTATGGCTGGCGATCCGCCTGATATTCTCATTCAACCATT
+CTGTCCGCAAATCTCAACGCTGGATTTTCATCGCGCCCATGCCGCTATTGCGGCGGGTCA
+GTTAGCCGTAGAGAAAAAGATGGACGAACTTATACCCTTGGTGCGTACCGACGTTTAATG
+TACCTTTTACGATCACTTAAGCAAATTCTGACAGGCGCAAGCGGCAATACCATGCCACTA
+TTGATTAAAGCCAGTCAGGGGAGAGAACATGACGCAGCCATTGGTCGGAAAACAGATTCT
+TATTGTTGAAGACGAGCCTGTATTTCGCTCGCTTCTGGATTCGTGGTTTTCCTCTTTGGG
+AGCGACAACGGCATTGGCAGGCGACGGGGTAGATGCCCTGGAGTTGATGGGGCGTTTTAC
+CCCTGATCTCATGATATGTGATATCGCTATGCCGAGAATGAACGGTCTCAAACTGGTAGA
+AAACTTACGTAATCGCGGAGACCAGACGCCTATTCTGGTTATTTCCGCAACAGAAAATAT
+GGCGGATATCGCCAAAGCGTTACGCCTTGGGGTTGAAGATGTCTTGCTGAAGCCGGTAAA
+AGATCTCAACCGCTTGCGGGAAACCGTATTCGCTTGCTTGTACCCTAATATGTTTAACTC
+GCGGGTTGAAGAAGAAGAACGCCTGTTTCGTGACTGGGATGCAATGGTGAGTAATCCGAC
+CGCCGCAGCGCAATTGTTGCAGGAATTGCAGCCCCCGGTACAGCAGGTGATTTCTCATTG
+CCGCATTAATTACCGGCAGCTCGTCTCCGCCGATCAGCCTGGACTGGTGCTGGATATTGC
+GCCGCTATCTGATAACGAACTGGCATTTTATTGCCTGGATGTCACCCGGGCGGGCGATAA
+CGGCGTGTTAGCCGCATTGTTGCTGCGGGCGCTATTTAACGGCTTATTGCAGGATCAGCT
+CGGCCAACAAAAGCACCGTTTACCGGAGTTAGGCGCGCTATTAAAACAGGTAAATCATCT
+GCTCAGACAAGCCAATTTACCTGGGCAATTCCCGCTATTTGTCGGCTACTATCACAGTGA
+GCTCAAAAATTTGATTCTCGTCTCCGCCGGATTGAACGCCACCTTAAATACGGGCGCTCA
+TCAGGTTCAAATTAGCAGCGGCGTGCCGCTAGGAACATTGGGTAACGCCTACCTTAACCA
+ATTAAGCCAGCGTTGCGACTCGTGGCAGTGTCAAATATGGGGCGCAGGAGGGCGTCTGCG
+ATTGATGTTGTCTGCGGAATGACCAAACGGAAGAGTGAGCGGAAATTGCTTTACCGGCCT
+TTCCCGACGAGTGTTACTATCTGCGGCAGATTTATAAGTATTTGTCTTAATTATACCAAT
+ATAAGTCCTTTTTGGACCTGAGGCTTGTTCTGGTACTGATATACTGGAACACGATACAGA
+TTAATGAACACGTTCAATACATGAACAGTCCAGGAGAATTTTAAATGGCTGCCCTTAATT
+CGAAAGTCAAAAAAGCCGTTATCCCGGTCGCGGGATTGGGAACCAGGATGCTGCCAGCGA
+CCAAAGCTATCCCGAAAGAGATGCTGCCGCTGGTTGATAAGCCATTAATTCAGTACGTCG
+TGAACGAATGTATCGCTGCTGGCATTACTGAAATCGTGCTTGTTACGCACTCGTCTAAAA
+ACTCTATTGAAAACCACTTTGATACCAGTTTTGAGCTGGAAGCGATGCTGGAAAAACGCG
+TTAAGCGTCAGCTTCTGGAGGAGGTTCAGTCTATTTGCCCTCCGCATGTCACTATTATGC
+AGGTACGTCAAGGGCTGGCAAAAGGCCTGGGCCATGCCGTATTGTGCGCGCATCCCGTTG
+TCGGAAACGAACCTGTCGCTGTTATTCTGCCAGACGTTATTCTTGACGAATATGAGTCCG
+ACCTGTCTCAGGATAACCTGGCTGAAATGATCCGCCGTTTCGATGAAACCGGCAATAGCC
+AGATTATGGTTGAGCCAGTAGAAGATGTGACTGCATACGGCGTGGTCGATTGTAAAGGCG
+TTGAGCTGGCACCGGGCGAAAGTGTGCCGATGGTTGGCGTGGTTGAAAAACCAAAAGCGG
+ATGTCGCGCCGTCTAACCTTGCGATTGTCGGGCGTTATGTGTTGAGCGCGGATATCTGGG
+CGTTGCTGGCGAAAACCCCTCCGGGCGCCGGGGATGAAATTCAGTTGACCGATGCTATCG
+ATATGCTGATCGAAAAAGAAACGGTTGAAGCCTACCACATGAAGGGTAAAAGCCATGACT
+GTGGTAATAAGTTAGGATATATGCAGGCATTCGTTGAATATGGCATCCGTCATAATTCGC
+TGGGTGCTGAATTTAAAGCCTGGCTTGAAGAAGAAATGGGTATTAAGAAGTAACGATACG
+TTATAAATTTTTTAACAGAAGCGCTGGTAAATCCGGCGCTTTTTTTATGCCTGGGGTCGT
+CAGCGGAGAACTCAGGCAAAAAAAATCCCGCCAGCGGCGGGATTTTAAGCATCCAGGAAG
+TAAATTATTCCTTGATCAGGAAATCTTCCAGTTGCTTACCTTGTTCTTCCATTGCTTTTT
+TGATTACAGCCGGTGTACGACCCTGGCCAGTCCAGGTTTTAGTTTCACCGTTTTCGTCAA
+CATAGCTATATTTAGCCGGACGAGCTGCGCGTTTAGCTTTGGTACCGGATTTAGCGGCAG
+CCATGCTATTCAGCAGTTCATTCGGGTCAATGCCGTCGGCAATTAACATTTCACGATACT
+GTTGCAGTTTACGAGTGCGTTCTTCCACTTCAGCAGCAGCAGCGCTTTCTTCTTCACGAC
+GCTCATTAACGACAACTTCTAATTTTTCCAGCATTTCTTCAAGCGTTTCCAGAGTACATT
+CTCTTGCCTGCGCACGAAGAGTACGGATGTTGTTCAGAATTTTAAGTGCTTCGCTCATTG
+TAGTAATCTCAAACTTATATTGGGGTGGTTTGTTGAGCTAATAATAGAGCGATAAATTCA
+GTTGTGCAATAGCCAGGAATGTAAGGAATTCAAAATTACGCTTTATTAAGCACACGTTTT
+AATTATCTCAACTTAAATTTTCCTTGAGGCGCCGCACAAAAAAGAGCTTATTGGCAGGGG
+GGATACTCACCGTCTGTCGCTAAAAATTTAGGAGTCAGGTCACATTTTATCATGATGAAA
+TACGATCTCATTGCTGAGATATCAATCTCTTGTATTAGATTTCCTTACAAGAAAACCCTA
+TTACTTTGCACCGGGTATGAGTAACGGTAACAATAAGTACAAGGTTTTCATATTGGCGGG
+TGATGATAAGCATTGTTGATGAATTTTAACGGCATAATTTGTGAAGGAATGTGTATATAC
+CCTTCATACTTCAAGTTGCTTATGCGTTGGCTACGCTCGCTCACTCCAGTCACATAGTTA
+TCTATGCTCCTAGGGACTCACTCCCTTGCCGCCTTTAAGCAACGCGAATTATTTTGGGTA
+TAGTGAGCGATGTTTGTACAATTCTTAATACTCACCGGAGCGCGAGCCGCGCCGTCGCGT
+CGGTAAATTATGGTACAATCCCGCCAATCTTTATTTCACTCAGGTGAGGTCCTGCGACCA
+ATGGCACAGCTATATTTCTACTATTCGGCAATGAATGCGGGTAAGTCGACTGCACTGCTG
+CAATCTTCATACAATTATCAGGAACGCGGGATGCGTACCGTCGTATATACGGCGGAAATC
+GACGATCGTTTCGGCGCAGGCAAAGTCAGCTCTCGTATCGGTTTGTCGTCGCCGGCAAAA
+TTGTTTAACCAAAATACATCCTTGTTTGAAGAGATTCGTGCCGAGAGCGCGCGGCAGACA
+ATACATTGCGTGTTAGTCGACGAAAGCCAGTTTTTGACTCGCCAGCAGGTTTATCAATTA
+TCCGAGGTTGTCGACAAATTAGATATTCCAGTACTTTGCTATGGGCTACGAACAGACTTT
+CGTGGGGAGCTCTTTGTCGGCAGCCAATACTTGCTGGCATGGTCAGATAAGCTGGTGGAA
+TTAAAAACTATCTGTTTCTGCGGTCGTAAAGCCAGTATGGTTCTGCGCCTTGATCAGGAC
+GGCAGGCCTTATAACGAAGGCGAACAGGTGGTTATTGGCGGGAATGAACGCTACGTTTCA
+GTTTGCCGTAAGCATTATAAGGACGCGCTGGAGGAGGACTCACTGACGGCGATTCAGGAG
+CGTCATCGGCACATATGATACCTGAGGTAAAGATCGGCTTATAAAACGCCCTGTAGCGCT
+TTGGAGGTCATTATTCAGGCCTCCTGACGAAGGGCGTGCCGTGAGCACGTAGGCCAGATG
+ATCAGCATAGCGCCTTCAGGCATCAGATAAACAGGTAAAACAAAAAAACGGCCTCAATTG
+AGGCCGTTATTGTCATGCTAAAACAGATAACGAATTAAGCGGATTTTTTCGCTTTTTTCT
+CTGCTTTCGGTGCGGCAACGACGTCTTTCTTCGCTGCAACTTCACCTTCGGTGAAATCAC
+GACCGTAGTAGGTATCCAGCAGAATCTGTTTCAGTTCGGAGATCAGTGGATAACGCGGGT
+TAGCGCCGGTGCACTGGTCATCGAAGGCATCTTCAGACAGTTTGTCAACGTGTGCCAGGA
+AGTCAGCTTCCTGCACGCCTGCTTCACGGATAGACTTAGGAATACCCAGCTCAGCTTTAA
+TGCTTTCCAGCCATGCCAGCAGTTTTTCAATCTTAGCGGCGGTACGGTCGCCCGGCGCGC
+TCAGGCCCAGGTGGTCAGCAATTTCAGCGTAACGACGGCGTGCCTGCGGACGATCGTACT
+GGCTGAAAGCGGTCTGCTTGGTCGGGTTGTCATTCGCGTTGTAGCGGATAACGTTACAAA
+TCAGCAGGGCGTTCGCCAGACCGTGCGGAATGTGGAACTGAGAGCCCAGTTTGTGCGCCA
+TGGAGTGACATACACCGAGGAAGGCGTTGGCAAACGCGATACCGGCGATAGTCGCTGCAC
+TGTGAACACGTTCACGCGCAACCGGGTTTTTAGACCCTTCGTGGTAAGACGCCGGCAGGT
+TTTCTTTCAGCAGTTTCAGAGCCTGAAGAGCCTGACCGTCAGAGAACTCAGAAGCCAGTA
+CGGAAACGTAAGCTTCCAGGGCGTGAGTTACCGCATCCAGACCACCGAACGCACACAGGG
+ACTTCGGCATATCCATCACCAGGTTGGCGTCGACAATCGCCATATCCGGGGTCAGGGCGT
+AGTCAGCCAGCGGATATTTCTGACCGGTTGCATCGTCGGTCACAACCGCAAACGGTGTGA
+CTTCAGAACCGGTACCGGAAGTGGTGGTGACGGCGATCATTTTCGCTTTCACGCCCATTT
+TCGGGAACTTGTAGATACGTTTACGGATGTCCATAAAGCGCAGCGCCAGCTCTTCGAAGT
+GAGTTTCCGGATGTTCGTACATGACCCACATGATTTTCGCGGCGTCCATCGGGGAACCGC
+CGCCCAGCGCGATGATCACGTCTGGTTTGAAGGAGTTCGCCAGCTCAGCGCCTTTGCGCA
+CAACGCTCAGAGTCGGGTCGGCTTCAACTTCGAAGAAGACTTCGGTTTCAACGCCAGCCG
+CTTTCAGCACAGAGGTGATCTGGTCTGCATAGCCGTTGTTGAACAGGAAGCGGTCAGTCA
+CGATGAGCGCACGTTTGTGGCCATCAGTAATCACTTCATCCAGCGCGATGGGCAGAGAGC
+CACGGCGGAAGTAGATAGATTTCGGAAGTTTGTGCCACAACATGTTTTCAGCTCGCTTAG
+CAACGGTTTTCTTGTTGATCAGGTGTTTCGGACCAACGTTTTCAGAGATGGAGTTACCAC
+CCCAGGAACCACAACCCAACGTCAGGGAAGGTGCGAGTTTGAAGTTGTACAGGTCACCGA
+TACCACCCTGAGAGGCCGGGGTGTTGATCAGGATACGCGCGGTTTTCATCATCTGACCGA
+AGTAAGCAACGCGTTCTGGCTGGTTATCCTGGTCAGTGTACAGGCAGGAGGTGTGACCGA
+TACCGCCCATAGCGACCAGTTTTTCTGCTTTTTCTACCGCTTCTTCGAAATCTTTCGCAC
+GGTACATCGCCAGAGTCGGAGACAGTTTTTCGTGTGCGAACGGTTCGCTTTCATCAACGA
+CCGTAACTTCACCGATCAGAATCTTGGTGGTTTCTGGTACGGAGAAGCCTGCCAGTTCAG
+CAATTTTGTAGGCTGGCTGACCGACGATAGCGGCGTTCAGAGCGCCATTTTTCAGGATAA
+CGTTTTGAACCGCTTTCAGCTCCTGGCCCTGCAGCATGTAGCCGCCGTGGCTGGCGAAAC
+GTTCGCGAACGGCATCATAGACGGAATCAACAACGACAACAGACTGTTCAGAAGCACAGA
+TTACGCCGTTATCAAAGGTTTTAGACATCAGAACAGACGCCACAGCGCGTTTGATATCCG
+CAGTTTCATCAATGACAACCGGAGTGTTGCCTGCGCCTACGCCGATAGCCGGTTTACCGG
+AGCTGTATGCAGCTTTAACCATGCCTGGACCGCCAGTGGCGAGGATCAGGTTAATATCCG
+GGTGGTGCATCAACGCGTTAGACAGTTCTACGGAAGGTTGATCGATCCAGCCAATCAGAT
+CTTTCGGCGCGCCGGCAGCGATAGCCGCTTGCAGAACGATGTCTGCCGCTTTGTTGGTTG
+CTTCTTTAGCACGCGGATGCGGAGAAAAGATGATGGCGTTACGGGTCTTCAGGCTAATCA
+GCGATTTGAAGATCGCGGTAGAGGTCGGGTTAGTGGTTGGAACGATACCGCAAATAATGC
+CGATAGGTTCGGCAATGGTGATGGTCCCGAAGGTGTCGTCTTCAGACAGCACACCGCAGG
+TTTTTTCATCTTTATAAGCATTGTAAATATATTCAGAAGCGAAGTGGTTTTTAATCACTT
+TGTCTTCCACGATGCCCATACCGGATTCGGCGACGGCCATTTTGGCCAGCGGAATGCGGG
+CATCAGCGGCTGCCAGAGCGGCGGCGCGGAAGATTTTGTCGACCTGTTCTTGAGTGAAAC
+TGGCATATTCACGCTGGGCTTTTTTTACACGCTCTACGAGTGCGTTAAGTTCAGCGACAT
+TAGTAACAGCCATAATGCTCTCCTGATAATGTTAAACTTTTTTAGTAAATCATCTGCGCG
+ATACGTGAGTATAGACAGATCGACGATACTTTGTATAAATGCCTGAAATTCAGGTGGTTA
+CTTAACGTCCGTTTCGCTCTGATTTACTAAAAGAGCTTCTGCGTTAGTATCATTTAACTC
+TAACGCGTTACGTCCAGGTGGCGTAAGCAAGATTACTCACTTCTGAGTAGCGATTGTGTG
+ATCTAAATCAAGATTACGCAAAGCTGACACCTTTCAGCAGGCCATTTTAGCCTTTTATGT
+AAATTGTTAAGAAATCGTTGTCATGAAGAGTAAGTGGATTAGCATAACGAGTACATATAA
+ATAACAGCGATGAATGGATGAAATTAGGTGTAGATAAGAGGTGAACTATGCGAATAAAAG
+GCGTATCTTCTGCGCGTTTTGATCATTAACGAACATTGACTTCATCCGGCTAACGCTTCG
+GAGCTAACCGTGATTCAACCGCTTTTTGATTTTCCTGTTTACTTTAAGTTCTTTATCGGG
+CTCTTTGCGCTGGTTAACCCGGTGGGGATTATCCCCGTTTTCATCAGCATGACCAGCTAC
+CAGACGGCCACGGCGCGTAATAAAACTAACCTCACCGCGAATCTGTCGGTTGCGATTATC
+TTGTGGAGTTCCTTATTCCTCGGCGATGGCATCCTGCAGCTGTTTGGTATTTCTATTGAC
+TCGTTCAGAATTGCGGGCGGTATCCTGGTTGTCACCATTGCAATGTCGATGATCAGCGGG
+AAGCTGGGGGAAGATAAACAAAACAAGCAAGAAAAGTCAGAGACGGCCATACGCGAGAGC
+ATTGGCGTTGTGCCGTTAGCGCTGCCGTTAATGGCGGGGGCAGGGGCGATCAGCTCCACT
+ATCGTCTGGGGGGCGCGGTATCACAGCATCGCGCATTTGCTTGGTTTTTCAGTTGCCATT
+GCGCTTTTTGCGCTTTGCTGCTGGGGCGTGTTCCGTATGGCGCCGTGGCTGGTTCGTTTG
+CTGGGGCAAACCGGTATCAACGTTATTACCCGAATCATGGGGTTGTTGTTAATGGCGCTC
+GGCATCGAATTTATTGTCACAGGAATAAAAGGCATTTTCCCCGGCTTGCTCAACTAAACT
+CCCACCTGCTGATTTACAGGCGGCGCCCTAAGGGGCCGCCTTGTGACATTCCCACGTAAC
+ACTTCTTACTTTGATAAGCATTCAGCGTTTAAATGATAAAAATACTAATATAATCTAACG
+CTATTTATTTTTATTAATCAAACTATTATCAACATTACTGAGACCGTGAGAAGCGGTAGG
+TCTGTTATTTTATTCACACCATACTCTGGGGCTTGATGAAGGATTATTGAAATGTTATTA
+GTTGTTTCAGCTCCATCGTAGATGAATGTGCTAAATAATGAGCATTTGTTAAATTTGTGT
+GTGTTTTCTGGCGCAGGCATAACCTACGATGCGACAGAGAGATATTTTTCTTTCAACTTA
+TTGATTATAAAGAATAAATCAAAGATTTTTAACATTGTTTAACTGTTTTTTTGGGCAGGG
+ATTTTTCCATAAAAGAGAATTGGTTAACAAAATTGTAAAATGAATTGGCGGTTCAGAAAC
+GCATTTGATACTTTTCGGCCAAACATTTTTGTAGAAGATTTCACATTGTTGATAACTATT
+TTCATTTAGATGGTTGTCAGAAATAACGTGCGACGTGGGCAGGTACGTCGTATACCGAAT
+CGACGAAAGGCGATCGAACGAATCGTCAGAATAAATAAAGTCGGTGATAGCAAAAGCAGT
+GACAGACCTGGCAGTACACCACCAGTGCTGTACAGGAACCCTGACGGGATTAAACAGGCT
+GGTAAAAACCAGTAATTATAATGAGTGGAGTACAAACACAATGTCTAACATCACGAAAAA
+AAGTTTAATTGCAGTGGGAATACTCACTGCGCTCATCGCCGCCAGCGCCGCGACTGCGGC
+AGACGTGCCCGCCGGTGTTCAGTTAGCCGACAAGCAAACGTTGGTACGTAATAATGGATC
+AGAAGTGCAGTCTCTCGACCCGCATAAAATTGAAGGCGTGCCGGAATCGAACGTTAGCCG
+TGATCTCTTTGAAGGCTTATTAATTAGTGATGTCGAGGGGCATCCTTCACCGGGCGTCGC
+GGAAAAATGGGAGAATAAAGATTTTAAAGTCTGGACATTCCATCTACGTGAAAATGCGAA
+ATGGTCAGATGGTACGCCCGTCACTGCCCATGATTTCGTTTATAGCTGGCAACGCCTGGC
+CGATCCTAATACGGCATCGCCGTACGCCAGCTATCTGCAATACGGTCATATCGCTAATAT
+CGATGACATTATCGCCGGTAAAAAACCCGCCACCGATCTGGGGGTAAAAGCGCTTGATGA
+TCACACCTTTGAAGTGACCTTAAGTGAGCCGGTGCCTTATTTCTACAAATTGTTGGTCCA
+CCCTTCAGTGTCTCCTGTACCGAAATCAGCGGTCGAAAAATTTGGCGATAAGTGGACACA
+ACCGGCCAATATTGTCACTAACGGCGCTTATAAGTTAAAAAACTGGGTGGTGAACGAACG
+TATCGTGCTGGAGCGTAACCCGCAATACTGGGATAACGACAAAACCGTCATCAATCAGGT
+AACTTATTTGCCTATCTCTTCGGAGGTGACGGATGTCAACCGCTACCGCAGCGGCGAGAT
+CGATATGACTTATAACAATATGCCGATCGAATTATTCCAGAAACTGAAAAAAGAGATCCC
+GAATGAAGTCCGCGTAGACCCTTATTTGTGTACCTATTATTACGAAATTAATAATCAAAA
+AGCGCCGTTTAACGATGTCCGCGTGCGTACCGCGCTGAAACTGGCGTTAGATCGCGACAT
+TATTGTTAATAAGGTTAAAAATCAGGGCGATTTACCCGCTTATAGCTACACGCCGCCGTA
+TACCGATGGCGCAAAACTGGTAGAGCCTGAGTGGTTCAAATGGTCCCAGCAAAAGCGTAA
+TGAAGAAGCGAAGAAATTGTTGGCTGAAGCCGGCTTTACGGCGGATAAGCCCTTAACATT
+CGACCTGCTGTATAACACCTCCGATCTGCATAAAAAACTGGCCATTGCCGTGGCGTCTAT
+CTGGAAGAAAAATCTGGGCGTCAATGTGAATCTGGAGAATCAGGAATGGAAAACCTTCCT
+GGATACCCGTCATCAGGGCACCTTTGATGTTGCCAGAGCCGGGTGGTGCGCAGATTATAA
+TGAACCGACCTCATTCCTGAATACTATGTTGTCCGACAGTTCAAATAACACCGCGCATTA
+TAATAGCCCGGCGTTTGATAAGCTGATTGCTGACACGCTGAAAGTGGCGGACGATACGCA
+GCGCAGCGAACTCTACGCTAAAGCGGAGCAGCAGTTAGATAAAGACTCGGCTATTGTGCC
+GGTGTATTACTACGTTAACGCGCGCCTGGTGAAACCTTGGGTGGGCGGGTATACCGGTAA
+AGACCCGCTGGATAATATTTATGTGAAAAACTTATATATTATCAAACATTAATGGCAAGA
+CATGGGACAACTGCGGTTGTCCCATGGTGTCTTTTTTCATCGCACTATAACTTTCCCTGG
+CGGATCTTTTGTCACGTCCGGGAAGTAAAGGCACAGGCCAGAAGGTACGGGCAATGTTGA
+AATTTATTTTACGCCGCTGTCTGGAAGCGATTCCGACGCTGTTTATTCTTATTACCATCT
+CTTTCTTTATGATGCGCCTCGCGCCGGGTAGCCCTTTTACTGGCGAGCGCGCATTGCCGC
+CGGAAGTGCTGGCCAATATTGAAGCAAAATATCATCTGAACGATCCCATCATGACGCAGT
+ACTTCAGCTACCTGAAGCAGCTGGCGCATGGCGATTTTGGACCATCGTTTAAATACAAAG
+ATTACACGGTCAACGATCTGGTTGCCGCCAGCTTCCCCGTTTCGGCGAAACTTGGCGCTG
+CCGCTTTTTTGCTGGCGGTCATTATTGGTGTCAGTGCTGGCGTGATTGCCGCGCTAAAGC
+AAAATACGCGATGGGATTATACGGTGATGGGATTTGCCATGACCGGCGTCGTTATCCCCA
+GTTTTGTGGTAGCGCCGCTACTGGTGATGGTCTTTGCAATAACCTTGCAATGGCTGCCTG
+GCGGCGGCTGGAACGGCGGGGCGTTAAAATTTATGATCCTGCCGATGGTCGCGCTTTCAC
+TGGCCTATATTGCCAGCATCGCTCGTATTACGCGCGGCTCAATGATTGAAGTTCTGCATT
+CGAACTTTATTCGTACCGCGCGGGCAAAAGGATTACCGATGCGCAGAATCATCTTCCGCC
+ATGCGTTAAAACCTGCGCTGCTGCCGGTTTTATCCTATATGGGGCCAGCCTTTGTCGGCA
+TTATTACCGGCTCAATGGTGATTGAAACTATTTATGGCTTACCGGGCATTGGGCAGCTTT
+TCGTTAATGGCGCGCTCAACCGCGATTACTCGCTGGTGTTAAGTTTGACCATTCTGGTCG
+GGGCGCTGACCATATTATTTAACGCCATTGTCGATGTGCTCTATGCCGTTATCGACCCGA
+AAATTCGCTATTGATACTGGAGCTCGCGATGATGTTAAGTAAGAAAAACAGCGAGACGCT
+GGAAAATTTCAGTGAAAAGCTGGAGGTGGAAGGTCGCAGCCTTTGGCAAGATGCCCGTCG
+GCGCTTTATGCATAACCGTGCGGCGGTGGCCAGTCTTATTGTCCTGTTTCTGATAGCCCT
+GTTCGTGACAGTGGCGCCTATGCTGTCGCAATTTACCTATTTCGATACCGACTGGGGCAT
+GATGTCCAGTGCGCCGGATATGGCGTCCGGTCACTATTTCGGCACTGACTCTTCCGGGCG
+CGATCTGTTGGTGCGCGTTGCCATCGGCGGGCGTATCTCATTAATGGTCGGGATTGCCGC
+CGCGCTGGTGGCGGTCATTGTCGGAACGCTGTATGGCTCGCTGTCCGGCTATCTGGGCGG
+CAAAATTGATTCTGTGATGATGCGTTTGTTGGAGATCCTCAACTCGTTCCCGTTTATGTT
+CTTTGTGATTTTGCTGGTGACGTTTTTTGGGCAGAACATTCTGTTGATTTTCGTCGCCAT
+CGGCATGGTCTCCTGGCTTGATATGGCGCGTATCGTGCGTGGCCAAACCCTAAGTCTTAA
+ACGTAAAGAATTCATCGAAGCCGCGCAGGTGGGTGGTGTGTCGACTGCCAGCATTGTGAT
+CCGCCATATTGTGCCTAACGTCCTGGGCGTAGTGGTAGTGTATGCATCGTTGCTGGTGCC
+CAGCATGATTCTGTTTGAGTCTTTCCTCAGTTTCCTGGGGCTTGGGACGCAGGAACCGTT
+AAGCAGTTGGGGAGCGTTATTGAGCGATGGCGCAAATTCAATGGAAGTCTCACCGTGGCT
+GCTGCTGTTTCCGGCTGGCTTTCTCGTGGTGACGTTATTCTGTTTTAACTTTATTGGCGA
+TGGCCTGCGTGATGCCCTCGACCCGAAAGATCGTTAAGGAGTACAGCCATGAGCTTATCA
+GAAACCGCAACTCAGGCGCCGCAACCGGCGAATGTACTGCTGGAGGTAAACGATCTTCGT
+GTTACGTTCGCTACGCCTGATGGCGATGTGACGGCGGTCAACGATCTGAACTTTACGCTT
+CGCGCTGGAGAAACGTTAGGTATTGTTGGCGAGTCTGGATCGGGGAAATCGCAAACGGCG
+TTCGCATTAATGGGACTGCTGGCGACGAATGGTCGAATCGGCGGTTCTGCGACCTTCAAC
+GGACGTGAAATTCTTAATCTACCTGAGCGCGAACTGAATACGCTGCGCGCAGAACAGATT
+TCGATGATTTTTCAGGACCCGATGACCTCGCTAAATCCTTATATGCGCGTTGGGGAGCAG
+TTAATGGAAGTCCTGATGCTGCATAAAGGGATGAGCAAAGCGGAAGCTTTTGAAGAGTCC
+GTCAGAATGCTGGATGCCGTAAAAATGCCGGAAGCGCGCAAACGGATGAAAATGTACCCG
+CACGAATTTTCCGGCGGAATGCGTCAACGTGTGATGATTGCGATGGCGCTGTTGTGCAGG
+CCGAAACTGCTTATTGCCGATGAGCCTCCCCCCGCGCTTGATGTTACCGTGCGGGCGCAG
+ATTATGACCTTGTTTAATGAGCAAAAGCGCAATTTTAATACCGCCATTATCATGATTACC
+CACGATCTGGGCGTGGTCGCGGGTATTTGCGATAAGGTCCTGGTAATGTATGCCGGGCGT
+ACCATGGAATACGGTAAGGCGCGCGATGTCTTTTATCAGCCCGTTCATCCGTATTCGATA
+GGCTTGCTTAATGCGGTGCCGCGTCTGGATAGCGAGGGGGCGGAAATGTTGACGATTCCG
+GGCAATCCTCCCAATTTATTGCGTTTGCCTAAAGGTTGTCCGTTCCAGCCGCGTTGTCCT
+CATGCGATGGAGATCTGCAATAATGCGCCGCCACTTGAAGCGTTTAGTCCTGGTCGCTTG
+CGCGCCTGTTTTAAACCGGTGGAGGAACTGCTATGAATGCTGTGATTGAACAACGTAAAG
+TTCTCCTCGAAATCGCCGATCTGAAAGTACATTTTGATATCAAAGAAGGGAAGCAGTGGT
+TCTGGCAACCGCCGAAAACTCTGAAAGCGGTGGACGGCGTTACGCTACGCCTGTATGAAG
+GCGAAACGCTTGGCGTGGTGGGTGAATCCGGCTGCGGCAAGTCGACGTTTGCGCGCGCCA
+TTATTGGTCTGGTGAAGGCGACAGACGGTAAAGTCGCCTGGCTGGGAAAAGATCTGTTGG
+GCATGAAAGCGGATGAGTGGCGCGAAGTGCGCAGCGATATCCAGATGATTTTCCAGGACC
+CGCTGGCGTCACTCAACCCGCGAATGACGATTGGCGAAATTATCGCGGAACCGCTGCGCA
+CTTATCATCCTAAACTTTCGCGCCAGGACGTGCGTGACCGCGTGAAAGCCATGATGCTGA
+AAGTGGGGCTGCTGCCGAATCTCATCAACCGTTATCCTCATGAATTTTCCGGGGGGCAGT
+GCCAGCGCATCGGTATCGCCCGGGCGTTGATCCTGGAACCTAAGCTCATTATTTGCGATG
+AGCCGGTGTCGGCGCTGGACGTTTCTATTCAGGCGCAGGTGGTGAATTTGCTCCAGCAGT
+TACAGCGAGAGATGGGGCTGTCGTTGATTTTTATTGCGCACGACCTGGCGGTCGTAAAGC
+ACATATCCGATCGTGTCCTGGTGATGTATCTCGGTCATGCAGTAGAATTGGGCACCTATG
+ATGAGGTGTACCATAATCCACTGCATCCTTATACCAAAGCGCTGATGTCGGCGGTACCGA
+TTCCCGATCCCGATCTGGAGCGAAATAAGAAGATACAATTGCTGGAGGGCGAATTACCTT
+CGCCCATTAACCCGCCTTCCGGCTGCGTGTTCCGTACACGCTGTCCGCTAGCCGGGCCAG
+AATGCGCGCAAACGCGACCGGTGCTGGAAGGAAGTTTTCGCCATGCCGTTTCCTGCCTTA
+AAGTAGACCCGTTATAATCGCAAGGGCTGACAATTTGTCAGCCCTTCTTTTAGGTGAGGT
+TACCGTGTCACTTTCTTTGTCGTCGGTTCGCCGTCGTCTTTATCATAATCTGTTCGATTT
+GACTACGCGCTCAGGTCGCCGTTTTGAAGGGTTATGCGCGCTGTTTGCGCTGCTTAGCGT
+ACTGGTCATTTTTGTTGAATCAGGCGTGGGAACGGAATATCACCTGACATTTGATGAATG
+GCATATTTTTGTCTGGCTGGAGCTCTGCGTTACCCTGATATTTACCGGTGAATACTTGCT
+CAGACTGTTTAGCTGGCCCGAACCGGCAAAATACGTTTTTAGTTTCTGGGGATTTATTGA
+TCTGGTGACGATTTTGCCGCTGTACGTCATGTGGCTGTGGCCGGAAATTAGCCTGAACTA
+TATGTTTGCCTGGCGTGCTATGCGAGCGATTCGCGTGCTGCGTATTCTTAAACTGCTACG
+CTTTATGCCATCCCTGCGCGTATTCTGGAGCGCCATTATTAGCGCGCGTCATCAGCTTAT
+TCTGTTCTATTCATTTATTGCGATCGTGATGATTATTTTCGGTGCCCTGATGTATCTTAT
+TGAAGGACCGAAATATGGCTTCACGACGCTTAATGCCTCGGTGTATTGGGCGATAGTGAC
+AGTCACAACCGTGGGGTATGGTGATATTACGCCGCATACGCCGCTGGGACGTATTGTCGC
+GTCGGTGCTTATTTTGATTGGTTATTCGGTGATTGCGATTCCTACAGGACTGATTACCAC
+GCACATGAGCAGCGCGTTTCAAAAACGTCACTGGCAGCGAAAATGTCCGCAGTGCCAGCA
+AAGCCAGCATGAACATAGCGCGCAATATTGTAACCGATGCGGCAGTAAGCTACCGGATTA
+AACAGGCTTGCCGGAGGGCGCAATCAGACGCCATCCGGCCTGAACCGCTTATTCGCGCCA
+GAGAATATGGCACAGCTTGTGGTCCTTTTCCCGGCACAGCAGAACGCGGGCGAAAATGTC
+GTTAATTTCGCCGTCTTCGGTATCCGCTAGGCCAATCACTACCTCGGCAAAAAAGTCTGG
+ATTCAGGTCAAAATCGACGTGCTCTTGCCAGTCTTCAGCGGGATCAAACAACTCCGCGCC
+GCCGCGCTCCTCGAATTGCAAATTGAACAGAATGATATCAGCCGGATCAAGATTATCCGC
+CGCCAGCTCAAGAAAAATATCGTAAGCCTGCTCAAGCGTTTCGTCTTCAGTCAGGCGATT
+GTTCAGATCCATTTCCATAGTGACTACCTGTTTACTCATGTTGGTCACGTTTTACAGCAA
+TGGACTAAAGAAGTAAAACAATCGCTCGGTAATACGCTGCCATAACGGACGTTTTACCCA
+CAAACGCGCATCTAAGAGACGGGAGCGCGAAATATAATCGTCCTGTACCGCAGCCAGATC
+GGCGCCGAAACCCGTATCATCAATGACCAGCGTAATCTCGAAATTAAGCCACAGGCTACG
+CATGTCGAGATTCACGGTACCGACCAGGCTCAGTTCGCCATCGACCAGCACGCTTTTAGT
+ATGCAACAGCCCGCCTTCGAACTGATAGATTTTCACGCCCGCCGCCAGTAACTCGCTGAA
+AAAGGCGCGACTGGCCCAGCCGACGAGCAGTGAATCATTTTTACGGGGCAGGATAATACT
+GACATCCACGCCGCGCTGCGCAGCGGTACAAATGGCGTGCAGCAGATCGTCGCTGGGGAC
+GAAATATGGCGTGGTCATAATTAAATATTCGCGCGCAGCATAGGTGGCGGTTAATAGTGC
+CTGGTGAATGAGATCTTCCGGAAAACCAGGACCGGAAGCAATGGTATGAATGGTATGCCC
+GCTGGCCTGCTCAAACGGCATAATATTCACATCCGGCGGGGGAGGCAGAATGCGTTTACC
+CGTCTCGATTTCCCAATCGCAGGAGTAAACAATCCCCATTGCTGTCGCCACGGGGCCTTC
+CATCCGCGCCATCAAATCGACCCATTGTCCAACGCCGGCATCCTGTTTGAAAAAACGCGG
+GTCCACCATATTCATACTGCCGGTATAGGCGATGTAATTGTCAATCATCACCATTTTACG
+GTGCTGGCGAAGATCCATACGGCGTAAAAAGACGCGCATCAGATTCACCTTCAGCGCCTC
+TACGACTTCAATGCCAGCGTTACGCATCATGGCCGCCCAGGGGCTGCGGAAGAAAGCGAC
+GCTACCCGCGGAATCCAGCATAAGCCGGCAATGGATGCCGCGGCGGGCGGCGGCCATTAG
+CGATTCAGCGACCTGATCCGCCATGCCGCCTGGCTGCCAGATGTAAAACACCATTTCGAT
+ATTATGCCGCGCCAGTTGGATATCGCGAATAAGCGCCTGCATGACATCATCGGAGTCGGT
+AAGTAATTGCAACTGGTTGCCTTTGACGCCCGCAATCCCCTGACGTCGTTCGCACAGCTT
+AAACAAGGACGATGCGACGCTACTGTTTTCTTGCGCGAAAATGTGTTTGCAGGCTTTGAG
+GTCATTCAACCATTTGGCAGTAGATGGCCACATGGCGCGGGCACGCTCGGCGCGACGTTT
+GCCTAAATGCAATTCGCCCACGGACAAATAGGCGATGATCCCGACCAGCGGAAGGATATA
+GATGATTAACAACCAGGCCATTGCGGAGGGAACTGCGCGCCGTTTCATTAGAATACGTAA
+TGTGACGCCGGCAATGAGAACCCAGTATCCCAAAATGACCAGCCAACTCACCACGGTGTA
+GAAGGTTGTCATAACTTTAAAAATCCTTTAGAAAGCGTGTTGTTAAGAGTTTACGCGTCA
+GGATTCACATGGCAAATAAAAACACGGGAAAAGCGCTGGTCTGCATCCGGCGAGGGGGTA
+TAATGGCGCTTCTGTTACAGTGAGGGTCGTAAACATGAAGCGTAGTAGAACGGAAGTGGG
+GCGCTGGCGAATGCTACGTCAGGCGAGCCGCCGTAAAGCGCGTTGGCTTGAAGGGCAATC
+ACGCCGTAATATGCGTATCCATACTATCAGGAAATGCATCTTTAATCGTCAGCGTAATTC
+ATTACTCTTTGCGATTCACGGTGTGTGAGCCAGAAAGGGCACCGTATGCGGTGCCCAACA
+GGCCATCCTTTTCAAAAGATCTTCTTATACGGTTTGACCGAAACCTGCGCATAGACGCCC
+GCTGCGACGTAGGGATCCGCATCAGCCCAGGATTGCGCTGCTTCTAAAGATTCAAATTCA
+GCAATCACCGTTGACCCGGTAAATCCGGCTACCCCAGGATCGTTACTGTCCACTGCGGGC
+ATCGGCCCGGCAGTTAATAATCGCCCTTCATCATGCAGAAGTTGCAGGCGCGCCAGATGC
+GCGGGCCGTACCGAGAGGCGTTTTTCAAGCGAGTTGGCATTATCCTGAGCGTAAATAACA
+TACAGCACGGGTAGAGCTCCTTAATCGGTAAAAGTTGCTGATTACGTTATTGGAAAGGGC
+ATTTAACTGCAATGTAAAGATACCGACTTTGTTAAACATGCACATTTTGTGTGGTGTTTT
+TGCGCGATATCATCTTTTAAATGCCGCTATCGGCAATGCCTTATTGAATATGATTGCTAT
+TTGCATTTAAAATTCAGCTCTGGTTTTTCAACTGAAACGATTATGACTTCAATGACCCTT
+GATTTACCTCGTCGCTTTCCCTGGCCGACACTCCTTTCCGTAGGCATTCATGGTGCTGTA
+GTGGCAGGTTTGCTCTATACCTCGGTACATCAGGTTATTGAATTGCCTGCGCCAGCGCAG
+CCTATCACGGTGACAATGGTTTCACCCGCTGACCTGGAGCCGCCCCAGGCGGTTCAGCCG
+CCGCCGGAGCCAGTGGTTGAACCCGAACCGGAGCCAGAGCCGATCCCTGAACCGCCTAAA
+GAAGCGCCCGTGGTGATTGAGAAACCCAAACCTAAGCCAAAACCCAAGCCAAAACCGAAA
+CCGGAACCGGTGAAAAAGGTTGAAGAGCAGCCGAAGCGCGAAGTCAAACCAGCCGCGCCT
+CGTCCTGCCTCACCGTTTGAAAATAGCGCCCCGGCGCGGCCAACAAGCAGCACCGCCTCG
+GCGACCAGCAAGCCGGCGGTGAGCGTACCCACTGGACCTCGCGCTCTGAGCCGTAACCAG
+CCGCAGTATCCGGCGCGAGCACAGGCGTTACGTATTGAAGGCCGCGTAAAGGTTAAGTTT
+GATGTGACCTCTGCTGGGCGAGTGGAAAATGTACAGATTCTGTCCGCGCAGCCAGCCAAT
+ATGTTTGAGCGTGAAGTTAAGAATGCGATGCGTAAATGGCGCTATGAAGCAGGCAAGCCG
+GGTTCCGGGCTGGTGGTCAATATTATCTTCCGTCTGAACGGTACGGCGCAGATTGAGTAA
+TCTCTGGCGCCGCCAGTAGGAATATACCATCACCTGCTGGCGGCGTAAGCGGGCATACTT
+AACCCTGAACCGGGAGCGGGCGAGGTTTACCGTCCGGATCGACGGCAACATAAATAAACA
+GCGCCTCGGTGGCCTTGTAGCGCTGTCCAATCGGTTCTGACGCGACTTTTTTCACCCAGA
+CTTCAATATTGATGCTAATAGACGTCGTACCGCGTTTAACGCAGCGCGCGTAGCAGCATA
+CGACATCGCCAACCGCGACGGGGCGCAGAAATGTCATTCCTTCCACGCGTACGGTTACAA
+CCCGACCGTGCGCGATCTCTTTGGCCAGTATCGCGCCGCCAATATCCATTTGCGACATCA
+GCCAGCCGCCAAAAATATCGCCGTTCGCATTGGTATCGGCAGGCATGGCCAATGTACGTA
+AAACCAGCTCGCCCTGAGGAGTATTATCCATTGTTGTCATTGTAAAACCGACTATCAGAA
+AAAATTACAGCCGCGATGCTACTATGAATTTTGTGTGGAGAATAGTGGGAATAAAGGTAC
+TGACGGGAAAGCGCAGGGCGTAAAGGCGAAGAAAATATCGCCAGGCGTTCGCAGTCTGGC
+GATGATAAGTCACGGGAGGGTTATGATTTATCTTCCTGTGGCAGATGCCGGTAGATATAG
+ACGCCGCTCAGCAGGGTAAAAATGAGCGTCAGCGCCGTGAGTCCAAAGACCTTAAAGTTG
+ACCCAGATATTTTGCGGCAACCAGAAGGCGATATAAATGTTAGCCAGACCGCACGCAATA
+AAAAACAGCGCCCACGCCAGGTTCAGCTTTGACCAGACCTGCTGCGGCAACGCCAGTTCT
+TTACCTAACATACGTTGGATTAACGGTTTTTTCATCACCCACTGGCTTATTAACAGCGCG
+CCGGCGAACAGCGCATAAATAACCGTCACCTTCCATTTAATAAATTCATCGTTATGGAAG
+AAGAGCGTCAGACCGCCGAAGACGGCAACCAGAACAAAGGTAATCAGCGCCATCTTCTCT
+ATTTTCCGATAGCGCACCCAGCTATAAATCAGCACGATTGCCGTCGCGACAATCAGTGCG
+GAGGTCGCCGCATAGATGTCATAAAGTTTATAAAACGCAAAAAAGACAACCAGCGGTAAA
+AAATCCAGAAACTGCTTCATTCTTCGATTCCATCATCAACGAGCGTCGAATGCGCCGCGT
+AACGGCGCATTGCGGATTATTGGCGAATCAACATATACAGGCGGAATAAGTAGATAAGCA
+ATACTGCGGAAATCAGATTGCTCAACGTATTCGCCAGTACAGCGCCTACATTTGGGGTCA
+GTACAGCGAAGCTGGGCGCGAACAGCAATAGCAATGTTTTAGCCAGTAACCAGCCTATCA
+CCGCAGGCGCGACCAGTCTCATGTTAGCCCAGGCTAAACGCATACTGCTGCGCATTGCGG
+CAAACACGCCCATTTTCTCTTCAACCAACATCACTGGCGCAAGCGCCAGCACAATGGCCA
+TAATAATCCCCGGAACGACAATCAGCATTATACCGATTTGCACTAACAGGGTAGTCAGAA
+AAATGAGAATAAACAGTTTAGGCAATGCAGGGGCGCTGGCGCCGATAGCGCGCAGCGCGC
+TAACCCGATGTCCCGCTGAAACTAACTGAATCATCAGGATGATACCGCCGGCCAGAATAG
+CGTTGCCGATAAGCCCGGAAAACGTCGAGGCGGCAGAGGCGCGCAACAGGATCTGCTGCT
+GCTCCGGCGTCATATTTTGTACCAGCTCAAACAGGCCAGCGCTGCCTGCCAGATGTTCTC
+CTTCACTGAGTTGCGCGATTTGCGCATCGCTGGGTGAAAAGGCATGACCTAAGACCACCG
+TGATAAATGCGCACAGCAACGAAACCAGCAAGATAGTAATAAATTGATTTCGGAAAAAAT
+TTCCGGCGTCACGGTAAACGGACTTCGCCGTGATAGACATGCACTCTCCTTGAGTTTTGC
+AGGTGTTAATTTGCGGGCAATTGTACCCTGGATAACTCTACAGTGGCAGCATCAGCAGTT
+GTATGGAAAAGCATATCTTTGTAAAGCGGCGGTAATCCGTATCGCGCGCGGGCGCGATTA
+CACGCCTCATTCACTTCGCCTCCTTCGCCCGATATCGAAAATTCGCGACAGGTTGAAGGG
+CGGTTTTCATAAATAGCGCAACTGACGTTTTCACCCGGCGTGCCAATTAGCGCTTTACAG
+TGCGGCTGTTTTTGGTTGGTACCGGCCATACAACGTAAAAAAGGGGTAACAGGCTCGGTT
+AATGACGCCGGAACGCGTCCGCTGGCATCGTCGCCTTCAGCCCAATAAAAGGAGACACGA
+AAATAGGCACAACAGGCACCGCATGTCATGCATGGGTTAAGAACGCTCATGATTCACCTG
+CAAAAAACTCACGTATCAATAGATTACAACGGAAATTAATCTGTCCCGCAGTGTTCGCGA
+ATCTTACCGCCACGCGCCATTGCGGGACATTGATTACCTTAGCCAGCCTTTATCGCCAGG
+GCAACAGGAGCAGACAAATATTTGCATAGCGTGAATATGTCAAAATTGATCTGAACTCCT
+ATAACCAGGATTTTCAATACAAGTTCTAAATTAATCTGGATCAATAAATGTTAAATTATA
+AGAACAAATGTGATCTGTGTTAGATCACTTATTACTTCATTGTGGGTATATTCATCACGC
+GTTTATAACCATAACGATGGAGCGGGTATGAAAAAATTTACAGTGGCGGCACTGGCGTTA
+ACAACTCTTCTCTCAGGCAGCGCTTTCGCGCACGAAGCCGGAGAATTCTTTATGCGTGCA
+GGTCCGGCAACCGTCAGACCTACAGAAGGGGCGGGTGGTACGCTGGGGCATTTAAACGGG
+TTTGATGTGAGTAATAACACGCAACTCGGCCTGACATTCACTTACATGGCGACGGACAAT
+ATCGGGGTTGAATTGCTGGCGGCCACGCCGTTCCGCCATAAGGTGGGTACGGGCGCGACG
+GGAGATATCGCCACGGTTCACCTGTTACCGCCAACGTTAATGGCGCAGTGGTACTTCGGC
+GATTCCAGCAGCAAAGTGCGTCCTTATGTCGGCGTGGGGGTGAACTACACCACCTTCTTC
+GATAACGACTTTAACGATAATGGTAAAAATGCCGGGCTGTCCGATCTGAGCTTTAAGGAT
+TCCTGGGGCGCGGCAGGGCAAGTTGGGGTAGATTACCTGATTAACCGCGACTGGTTAATT
+GGCGCCTCTGTCTGGTACATGGATATTGATACTACCGCCAATTATAAAATGGGCGGCGTT
+CAGCATCATGACAGCGTGCGTCTGGACCCATGGGTATTTATGTTCTCGGCAGGCTATCGT
+TTCTAATCGCGTGATGTTGTGACGAAAAAAGACCCCGCCAGGCGGGGTCAAAAAAGGACA
+TGACACACGGATTTTACTTGTCGGAACTCACTTGTCTTCTTTCGGTTCGCCGCAGCCTAG
+TTCTGCGCCAGTGAGAGGATCAACGGTGGGGTCCGATTTCGTTCTTTCTGCCATCGCTTT
+GAGCAGCGCCATCTGCTCGCGCGGCAATTTCACTGTCGCCAGGCCATCGCCGCCATCAAC
+AGCAGGCATCGGTTCTGCGACATAGTTGAAGTTCTCATCGCTATTCCAGCTACCTCGCGG
+ATCGTCGCCTTGCGACATGTTGTAGTACACGTCGGTATACTGTTCTACCGGCGGTAATTT
+ACCCGGCGGGAAGTTGTTACGAATCGAATACAGCGCCTTTTCAAAAGAGAGCTGGTGCGC
+GACTTCACGGGTCATTAAGAAACTGAGCGTGTCTTTTACGCCGGGATCGTCGGTCAGATT
+AATCAGGCGTTCATAAATGATCTTCGCTCGCGCCTCTGCCGCGATGTTTGAGCGTAGATC
+GGCTGTGACTTCGCCGATAGTATCAATATAAGCCGCGGTCCACGGTACGCCGCCGGAGTT
+CGTCAACGCCGGGCCGCCGCCATACAGCAGAGAGGTGATATGGCTGTCATTACCATTCTG
+CGTCAGCGAGCGATAAAGTTCCGCTTCGTTTTCGGTACCTTCCGCCAGCTCGCCTTTAGC
+GCCTTTATTAAGCATTCCTACCAGTGAGCCGATAATTTCCAGATGACTCAGCTCCTCGGT
+GGCGATGTCCATTAACATTTCTCTACGACCGGCATCATCATCGCTTAAACCTTGCGTGAA
+GTAGCGGCAGGCGGCCGCCAGTTCGCCCTGCGGGCCGCCAAACTGTTCCAGCAGCAGGTT
+CGCTAATCCAGGATTAGGTTCGCTCACTCGCACAGTATATTGAAGTTGTTTTACGTGTCG
+AAACATATTGCCTCCTGCTTATTATTTATTTTTTGGCTTCAACGCCATCTGCTTCAGATC
+GCAGTAAAAATTGTTCCGTTGTCTGCGGAATATGTTTGATCAGCCAGTCAGCCATTTGCA
+TTTCTTCTTTCAGAATGGCTTCAATCGTCGGAATTGAGGCAGTGTCGCCAGCTTTTTTTG
+CCGCCGCCAGCAGGGAGGTATAACAAGCAATTTCGAACTGCTCGAAAACATAACCGCTAA
+TTGAGCCTTTGACAATTTCATCGGAAGGGAACATGCCACCGATAGATTGCCCCATTGCTG
+CCATTTTACTCATGGAGTCTTTCAACACCGAACGAGAAATGCCATTACGGTCCAATACTT
+CTTCGAGCATGGTAATTTGATGTTTGGTTTCACTAATATGTTGTTCAATTCTGGCTTTTA
+TATCAGGATAATTTTCAATACGGCTGGCCATAGATTCAAGCATCGATTCTGCCTGTTTTT
+CCATGGCATGGGCGTCACGAAGCCAGTCATGATAATGTTCAGTATAATTCATTTTACATT
+CCTCAATGCGTGATAATCTGCTCCGATAATAAAATCGGAATCATGCAAGCTGATAATTAA
+AAATATTATTTCGATTTGCGTTCAGCACTTTTATTAACATTGCTGACTGCTAAATCGGTA
+AGTTTTAAATCAGTTTGTTTTTCCTCGTCGAGGGTTTCTTTGAGCAGTTTTAATGCCTTG
+CTATAGCCGAGCTGCTCGGCCAGGGTGGCTAGCGTGCCGTAGCTGGCGATTTCGTAATGC
+TCGACTTTTTGCGCCGCGGCGATAAGCGCTGCATCGCGTACTTCGTTTTTCTCCGTACTT
+TCGATGACTTCATTGGCTTCTTCGATCAGCCCTTCCATAGCGACGCATTTCATTCTTTTC
+AGTTTAATGCCAGATTCAGATTCGACGATCTGATCAATACGTTCAATCTGACCCTGGGTT
+TCTTCAAGATGAGATTGAAAGGCCTGGCTTAATTTTTCATTGGACGTGGCTCTGGCTAGT
+TTAGAAAGAGCCTTGGTTAATTGTTTTTCTGCACTATAGGTATCTGAAAGTAGATGGATA
+AAAAGGTCTTCAACGGTTTTGATATTCATAAATCTAATTCTCCTGGGCAAAATACTGCGA
+GCCAGAAGACTCGCAGATTGCTTGATAAAAGCATGTGTTGTATTTACATTACAGTAAATC
+AGGAATTATCGGATTTACGTCCGCCGTGACTATTCTGACCACCTTTTTTACCGGCTTCAG
+AAGCTCGTTGCGGATCGTTTTTGAAATTCCCGCCGCTATGCTGACCGCCTTTGCGGCCCG
+CTTCAGATGCTTTTTCACGATTCTCGGCGAAATTTCCTGAACCACCACGATGTTCGGCCA
+TATTATTTCTCCTGTCTCGTTGCTTGCTGAAAAAATCGGTTTTAACCGTGTCGACACCCT
+ATTAAAATTAGTTGGTTAAACCGATTAGTCAAATTGACGGAAATAGTTGTGATTTACCGC
+GTAAATAACGCACAAAAAATGGTTTAGAGATAATATATTCTATATTTTCTTTTAGAATAA
+GCGATTTAACAGAAAATGCTTTGCATTGTTATTAATAACAAGCGTCACTATCTGCAGCCA
+TAGAAACGTTAATGCATTGTTTGTTGACATTTCTTTACATAAAGGCGGGGGAAATTGACG
+TGAAAACGCTAAATTTTTCGGCGTGATTAGGAGTTTTCTTAGCAAAAATTGACTTCAGAC
+TTTTTGAAAGCTGGACGGGGAATAACACCAAAAAGATTGATGATGTACATCTGAATCGTG
+ATTCTGGTTCGGCGCCAGCCACTCATTAAGCCGCCAGCGTTATGCTGACGGCTTAACTCG
+TTATGCGCGGCTGGCGGCTTTCATGGCTGAGACAAAGGACCTGAGCTCCGCCAACATCTG
+TTCGGGAGACGCGAGGTTTTTCTCGATAATCTTGACAATGGCTGAGCCGGAGATAGCGCC
+AGCCGCCCCGGCACGCACGGCCGCAGACACCTGTTCCGGCGAGGAGATACCGAAGCCCTG
+TAACGCAGGCGCGGCATGGTACTCTTTAAGCTTCTCAATGAGATGATGCAACGGCAATGC
+GCCACGGTTTTCCGCGCCGGTGACGCCCGAACGCGAAAGCAGGTAGGTGTAACCGCGGCC
+GTAAGATGCGACCTGGCGCAGAAGATCGTCATCCGCATTTGGCGGGCAGATGAAGATCGG
+CGCGATATTATGCCGTAACGCCGCCTGGCGGAAGGGGGCCGACTCTTCAACCGGGACATC
+TGCGACCAGCACGGAATCTACGCCAACCTGTTCACAACGGGCATAGAACGCATCTATGCC
+GTTATTGAACACCAGATTCGCGTACATTAGCAGGCCAATCGGAATGGTCGGGTGTTTTTC
+ACGAATCAGCGCCAGCATTTCAAAACACTGAGCCGGCGTGACGCCAGCGGCGAAGGCGCG
+TAAGTTCGCATTCTGGATGGTAGGGCCATCGGCCAGCGGATCGGAGAAGGGAACCCCCAG
+TTCCAGAGCGTCGGCGCCAGCGTCAATCAGTGTGTCGATAATTTTCAGTGACTGTTCAAT
+GCCAGGGTCGCCCAGGGTCACGAAGGGGACAAAAGCGCCTTCCCGGCGATCGTTGAGCTG
+TGCAAATAAATTTTCGTAGCGTTCCATCAGATTTCCCCTCGCGCTTTCAGGATATCGTGT
+ACGGTAAAGATGTCTTTATCTCCGCGGCCAGAGAGATTGACCACCAGCAGTTGCTCTTTT
+TCCGGCTGCTCGCGCATCATTTTCAGAGCGTGCGCCAACGCGTGGGAGGATTCCAGCGCC
+GGGATAATTCCCTCATGGCGGCACAACGTTTTGAAGGCTTCCAGCGCCTCATCATCGGTA
+ATGGAGACATAATCCGCGCGTCCGATGCTGTTCAGGTACGCATGTTGCGGCCCAACGGAT
+GGGAAATCGAGCCCGGCGGAAATGGAATAGGACTCTTCAATTTGCCCGTCCGCTGTTTGC
+ATCATCGGCGCTTTCATCCCGAAATAGATGCCAACGCGACCATGTTTAAGCGGCGCGCCA
+TGCTCGCCGGTTTCAATACCGTGACCGCCAGGTTCAACGCCTATTAGCCCGACGCTGGTA
+TCATTAATAAAATCCGCAAACATCCCGATAGCGTTTGAGCCGCCGCCGACGCAAGCGATA
+ACGGCATCTGGCAGACGGCCCTCTTTGTCGAGGATTTGCGCTTTCGTCTCTTCGCCAATC
+ATGCGTTGGAACTCGCGAACGATGGTGGGATAGGGATGCGGTCCTGCCGCCGTGCCGAGC
+ATATAGTGCGCGGTTTCGTAACTACCGGACCAGTCGCGCAGCGCCTCGTTACAGGCATCT
+TTTAGCGTAGCGGAGCCGCTATGAACCGGGATAACCTCAGCGCCCATCAGACGCATACGG
+AAGACGTTCGGCGACTGGCGCTCAACGTCTTTGGCACCCATATAGATACGGCATTTCAGA
+CCCAGCAGGGCGCTGGCGAGCGCAGAGGCGACGCCGTGCTGACCGGCGCCGGTTTCAGCG
+ATAATCTCGCTTTTACCCATCCGTTTGGCCAGCAGCGCCTGACCCAGTACCTGATTGGTT
+TTGTGTGCGCCGCCGTGCAGTAAATCTTCGCGCTTTAAATACAACGTGGTACGCGTACCG
+GCGGTAATGTTCTGGCATTTCGTCAGCGCGGTGGGGCGTCCCGCGTAGTTTTTTAGCAGA
+TCGGCGAATTGCGCCTGAAATTCAGGATCTTTTTGCGCGCTGACGAAGGCCTCTTCAAGC
+TGGTTCAGCGCAGGCATCAGGATCTGCGGCACATACATGCCGCCGAATTCACCAAAGTAG
+GGGTTGAGAAGTGTTGTCATGTTTTTTCCTTAATATGCGCGCAGTGTCTGAAAAACCGAG
+GCCAGAAGACGAGCATCTTTGATGCCCGGCTGTGACTCCACACCTGAATTAAAATCGAGA
+CCGGCACAGCCGACTTGCGCCGCCTGGACGCAGTTATCGGCCGCCAGCCCGCCCGCCAGT
+AACACATCATCCAGCGGTTGCCCCTGTAGCAGTGACCAGTCGAAGCGCTGCCCGCTGCCG
+CCTTGCCCATTGTCGAAAATGTATTTATCGACATGGTGATAATAGCGTGCGGGAAGGGCA
+TTGCTAACGCTCAGCGCCTTCCAGATTTGCACATTGCGCGGCAACGCCTCGCGCAGCGCG
+TTGACATACGCCTGGTCTTCGCTGCCATGTAGCTGTACGGCAGAAAGCGACAGGACGGCG
+GCTTTCTGGCAAACATCGGCGATATCAGCGTTCTGGAAAACGCCGACATACTGCAATGGC
+GCGCCGCTTATCACTTCTCGCGCCTGCTCAACGCTCACCGCGCGTGGAGATGAGGGCACA
+AAAATCAACCCGCCATATATTGCGCCAGCGTCACAGGCCGCTTTAGCGTCCTGGGCGCGG
+GTCAGGCCGCAGACTTTATTTTCGCCAAGCAGCACGCGACGGACGGCGGCGTTAAGATCG
+TCATGCGCCATTAACGCCGAGCCAATTAAAAAACCGTTGGCGAAGTGGCTCAGTTCGCGT
+ACCTGACCATAGGTGTTAATCCCGGACTCGCTGATGACAGTCACGCCGTGGCCCAGTTTT
+GGCGCCAGCTGGCGGGTGCGATTCAAATCAATCGACAGATCGCGCAGATCGCGATTGTTG
+ATACCTACCACTTTTGCGCCTAACGCTATCGCGCGCTCCCGTTCTTCGTCATTACTGACT
+TCCGTGAGCACGCCCATTTTCAGACTGTGCGCGACGGCGGAGAGTTGGCGATACTGTTCG
+TCATCCAGAACCGAGAGCATCAGTAAACAGGCATCGGCCTGATAGTAACGGGCAAGGTAG
+ATCTGATAGGGATCGATAATAAAATCCTTACACAGAATCGGCTGCGGTGCGCTTTGGCTA
+ACGACCGGCAGAAAATCGAAGCTACCCTGAAAATATTTTTCGTCGGTGAGCACCGAGATT
+GCCGAGGCGTAATGTTGATAAATATTGGCAATACGCGCCGGATCGAAATCATCGCGAATC
+ACGCCTTTTGATGGCGATGCTTTCTTACACTCCAGAATAAAGGCGGTACGCGCGCCCTGG
+AGCGCATCATAAAAATGGCGTGTACTTGGCTGGATCTCATTTTGAAAGCTGGCCAGCGGC
+TGTTGCTGTTTGCGGGCTTCTACCCAAATCGCCTTGTCTGCGACGATTTTCGCTAAAACG
+GTTTGCATTATTTACCCTCTTGCCGCCAGTGCGGTGACTCTGTCATATGCGGTGCCGTTG
+CGCAGAACATCAAGCACGGTTTGCGCGTTGGCTTTGAGATCTTCCTGACCATGCAGACGC
+ATCAGCATCGCCACGTTGGCGGCGACGGCGGCCTCATGCGCGGCATCGCCTTTACCTTGT
+AATAACCGCGTCAGAATGTCACGGTTTTCTTCCGGCGTGCCGCCAGCCAACTGATCCTGA
+TGGTAAGGCGTCAGGCCAAAATCCTCCGCCGTAAGTTGATAGCTTTTAATTTCGCCGTCA
+TGCAGCTCCGCGACAATCGTCGGCGCATGGAGCGAAACCTCATCCATGCCGCCGCTATGT
+ACCACCGCCGCGCGCTGATAGCCCAGTACCCGTAAGGTTTCCGCAATCGGCAGCACCAGT
+TCCGGGCTATAGACGCCAATCAATGCCAGCGGCGGATGCGCCGGGTTGATCAGCGGGCCG
+AGTACGTTGAACAGGGTTCGCGTTTTTAACTGTTGGCGAACCGGCATCGCGTGACGGAAT
+CCGGCGTGATATTTCGGCGCGAACAGGAAACAGACGCCCAGTTCATCTAACGCCTGACGT
+GATTTATCGGCGTTCATATCCAGATTAATACCGAACGCCGCCAGCAGATCGGATGACCCC
+GATTTGCTGGACACGCTACGGTTGCCGTGTTTCGCCACTTTCAGTCCACAGGCCGCTGCG
+ACAAAGGCGCTGGCGGTAGAGATATTGATACTGTTACTGCCATCGCCGCCGGTACCAACG
+ATATCCGCAAACAGGTAGTCCGGGCGCGGGAACGGGGCGGCATTTTCCAGCAACGCAGTG
+GCGGCGCCGGCAATTTCATTGGGATGCTCGCCGCGAATTTTCATGCTCACCAGCGCGGCG
+GCGAGCTGTTCAGGTTTAAGTTCGCCGCGGACGACCGCCGAAAACAACTGATGGCTCTCT
+TGTTGCGTCAGAGTTTGCGCCTGATAGAGTTTCTCCAGAATTGGCTGTAGGGTGTTGGTC
+GGTTCCAGCTTTTGCTGCGCCCAGGCTAATGTTTGCTCCAGTAGACGCGCACCCTGTGTC
+GTCAGGATGGACTCAGGATGAAATTGAAAACCGCAAACGCGATCCGCATCATGACGTACC
+GCCATCACCATGCCGTTGAAATGGGCGTTAATGGTTAGCCCGGCAGGAACATTACTGCCG
+ACCAGCGAATGATAACGCGCGACCGGTAGCGGATTCGCCAGCCCGGCGAACATCGCCTGA
+CCGTCATGCTCAATGCTGGAGGCTTTGCCATGCAGGATTTCTCCCGCCTGACCGACATAA
+CCGCCGTAAGCTTCGACAATCGCCTGATGCCCCAGACAAATGCCGATGATCGGTAACTTG
+CCGCGTAGTCGGGTCAGCAGCTCCGGCATACAGCCTGCCTCGCTGGGAACGCCCGGACCG
+GGGGAGAGCATTAGCACCGGATTTTTCATTGTTGCCAGGCGATCGATAAGCGTCTGCGCC
+GGAATATGGTTACGGTAAATCACCACGTTATGACCGTTGGTCCGTAGCTGATCTGCCAGG
+TTCCAGGTAAACGAGTCGATGTTATCGAGCAGCAGAATATCAGCCATCAGAAGGTCTCCT
+GTGCATGATGCGCGGTGGCGATAGCACGCAATACGGCGCGCGCTTTATTACGGGTTTCAT
+CGGCTTCAGACTGCGGAACAGAGTCCAGCACGATTCCGGCGCCCGCCTGTACGGTGGCGA
+TACCGTTCTCCACCAGCGCGGAGCGGATAACAATACAGGTGTCCAGATCGCCGTGGGCGG
+TGAAGTAACCGACCGCGCCGCCATAGCTGCCGCGGCGCTGTCCTTCCGCATCGGCAATCA
+ACTGCATGGCGCGTACTTTCGGCGCGCCGCTCAGGGTGCCCATGTTCATGCAGGCGCGAT
+AGGCGTGCAGCGCGTCGAGATCGTGACGCAGTTCGCCCACTACCCGGGAAACCAGATGCA
+TCACGTACGAATAGCGGTCAACTTTGGTCAGATCGGCAACGTAGCGACTGCCCGGCGTAC
+AGATGCGCGCCAGGTCATTGCGCGCCAGATCGACCAGCATCAGATGTTCGGAAAGCTCTT
+TATGGTCGGTACGCATGTCCAGCTCAATACGGCTGTCGAGATCTCTGTCCAGCGTACCAT
+CGGCGCGGCGACCGCGTGGACGGGTACCCGCGATGGGGTAAATCTCAATCTGACGACTGG
+CGGCGTCATATTTCAGCGAGCTTTCCGGCGACGCGCCGAAAAGCGTGAAATCATTATCCT
+GCATAAAGAACATATACGGGCTGGGGTTGCTCTTTTTCAGCACGTAGTAGGCAGCCAACG
+GCGACGGGCAGGGCAGTGAAAAGCGGCGCGACGGCACCACCTGAAATATCTCCCCCGCGC
+GGATGGCTTTTTGCAACTGGCGTACCACCGCGCCGAACGCGTCATCGCTCTGATTGCATT
+CGCAGCGCATGTCCGGCACCGGCGTGACCGGCAACGGCGGCGCAGGCTGGGTTAACTGTT
+GGCTAAGGTAAGCCAGGCGGGCGTTCAGGCGCTGTTTTTCCCGGTCGCTTGCGGTGAACA
+GACTGGCCTGAATACGGGTGCTTTTTTTCTGATGATCTATGACCATCAGCGTTTCCGCTA
+AATAAAAGCAGTAGTCCGGGCAGTTATTGCCAGCCTCAAGGTGTGGCAGCGCTTCAAAGC
+CAGCGACCAGGTCGTAGGCAAACAGACCGCCGAAAAACATAGCCTCCCGCTCTTGCGTCG
+GTATGTTCACCACTCCCTGTAACAGACGGAACGCATCAAATACCGACAGAGAGCATAAAC
+GGGCGTCTTCATCTAATAATGGGCTGACGGGCGGGAAGCGTAGAACGCGACCGGCAGGCA
+GGACTTCGTTCTCCACGCCAGCGGGCAGGGCGGTATCCAGTAGCGGCAATAACGAGGCGC
+CATTATCAGATAACGCCTGAATGGTGACAGTGTCACCTAAAGCGGTAATGCGCAGCGCGC
+TATCTACCAGCAGCAGGCTTTTTAAATCATCTTTACTGTCGATATCCGCGGATTCCAGCA
+GCAGCGTTGCCGGGCGATCGCCGCAGACCTGGTGAAAAAGCGCCGTTGGGTTTTCCCGAT
+AGGCGGCATCGCAGGTCAACAGTTCGAGCGTGGGTTTTGGTGTTTGCATGGTTATTCTCA
+TTATTTTGTTCAAAAAAAAGCCCGCTTAACAGGCGGGCCGGGTATCGTTTGGCTGATTAC
+AGCTGTTCATACACCGCCCGCTATCAGGAAGTGCGCCACCAACCGTGTAATGCAAATGTC
+GCTGCCATTTTAGATACCCTCTTCATGTGAACTTTCGTACTAGTTAACTAGTTCGATGGA
+ATAATGTCAACACCTATTTCAGTATATTTGCCGGAACCGTTATGATGTACATGACATAAC
+TTTATCTCTATGGGAGCCGCCTTGAGCGACACGAATTACGCAGTGATTTACGATCTGCAC
+AGTCATACCACGGCGTCCGATGGACTGTTGACGCCAGAAACATTAGTACACCGTGCGGTA
+GAGATGCGAGTCGGCACGCTGGCGATTACCGATCATGACACCACAGCCGCGATTCCTGCG
+GCAAGAGAAGAAATTTCACGTTCCGGGCTGGCCCTGAATCTTATTCCCGGCGTGGAGATT
+TCAACGGTCTGGGAGAATCATGAGATTCACATTGTGGGTCTGAATATTGATATTGCGCAT
+CCGGCAATGCGCGATTTTCTGGCGCAGCAGACACAGCGGCGTCAGGCGCGTGGTCGGCTC
+ATTGCGGAGCGTCTGGAAAAAGCCCATATTCCCGGCGCGTGGGAAGGGGCATTGAGACTG
+GCCAATGGCGGCGCGGTGACGCGCGGCCACTTCGCCCGCTTTCTGGTGGAGTGCGGCAAA
+GCCGCGACCATGGCGGATGTTTTTAAAAAATATCTCGCGCGTGGGAAAACCGGTTACGTT
+CCGCCGCAGTGGTGTACAATAGAACAAGCTATTGATGTCATTCATCATTCTGGCGGTAAG
+GCGGTGTTGGCCCACCCGGGACGCTACGACCTTAGCGCTAAGTGGCTGAAAAGATTAGTG
+GCGCATTTTGCCGACCATCACGGCGACGCGATGGAAGTGGCGCAGTGCCAACAATCACCC
+AATGAACGCACCCAACTGGCGACGCTTGCGTGTCAGCATCATTTATGGGCATCGCTTGGA
+TCTGATTTCCATCAGCCCTGCCCGTGGATTGAGTTGGGGCGTAAACTCTGGCTGCCCGCT
+GGCGTTGAAGGCGTATGGCAGGCATGGGAACAGCCGCAAATATCACAGTGAGGGAAGTAT
+GAGCCAGTTTTTTTATATCCATCCGGATAACCCACAGCAACGGCTGATTAATCAGGCCGT
+CGACATTGTGCGTAAAGGCGGTGTTATTGTTTATCCAACCGATTCCGGCTATGCCCTTGG
+TTGTAAAATTGAAGACAAAGGCGCAATGGAGCGCATTTGCCGCATCCGTCATCTGCCGGA
+CGGCCACAACTTCACGCTGATGTGCCGCGATTTGTCCGAGTTGTCGACCTACTCCTACGT
+CGACAACGTGGCATTTCGTCTGATGAAAAACAATACGCCGGGTAATTACACCTTTATCCT
+GAAGGGGACAAAAGAGGTGCCGCGCCGTCTGTTGCAGGAAAAGCGTAAAACTATCGGCCT
+GCGCGTACCGTCAAACCCGATTGCGCTGGCGTTATTGGATACGCTGGGCGAACCGATGCT
+CTCGACGTCGTTGATGCTGCCTGGCAGCGATTTTACCGAGTCGGACCCGGAGGAGATTAA
+AGATCGGCTGGAGAAGCAGGTGGATCTGATCATCCACGGTGGTTACCTCGGTCAACAGCC
+TACCACGGTAATCGATTTGACCAATGACTCCCCGGTGGTGCTGCGCGAAGGCGTCGGCGA
+CGTTACACCTTTCTTATAAGGGCGTAAGCCTGTATACTACGCGGCCTTAAAATGGCGCGG
+CAACGCGCCGTTCATTCTCCTGTTCGACGCCTGTGAAGGCGACACCTGAAGGAAGCTCTA
+TGAGCGAAAAGTTACAAAAAGTGCTGGCGCGCGCTGGCCACGGCTCTCGCCGTGAAATCG
+AATCCATTATTGAAGCGGGACGTGTCAGCGTTGACGGTAAAATCGCCACGCTTGGCGATC
+GTGTTGAAGTCACTCCCGGTTTGAAAATCCGTATCGACGGTCACCTGATTTCGGTGAAAG
+AGTCGGCGGAACAAATTTGCCGCGTTCTGGCCTATTACAAACCAGAAGGTGAACTGTGTA
+CCCGCAATGACCCTGAAGGGCGGCCAACCGTTTTTGATCGCTTACCGAAATTGCGCGGCG
+CGCGGTGGATTGCGGTAGGACGTCTGGATGTCAACACCTGCGGGCTATTGTTGTTTACCA
+CCGACGGTGAACTGGCGAACCGCCTGATGCACCCTAGTCGTGAAGTTGAACGTGAATATG
+CCGTGCGCGTGTTCGGTCAGGTGGATGAATCGAAACTGCGTGATTTAAGCCGTGGCGTAC
+AGTTGGAAGATGGTCCGGCGGCATTTAAGACCATTAAATTCAGCGGCGGCGAAGGCATTA
+ACCAGTGGTACAACGTGACGCTGACGGAAGGGCGCAACCGCGAAGTTCGCCGACTGTGGG
+AAGCGGTAGGCGTTCAGGTCAGCCGTCTGATCCGCGTTCGTTACGGCGATATCCCGCTGC
+CGAAAGGCCTGCCGCGCGGCGGCTGGACTGAGCTCGACCTCGCGCAAACGAACTATCTGC
+GTGGTCTGGTAGAGCTCCCGCCGGAAACCTCGTCGAAGGTTGCCGTCGAAAAAGACCGCC
+GTCGTATGAAAGCGAACCAGATCCGTCGGGCGGTAAAACGCCACAGCCAGATCGCTGGCG
+GACGCCGCTCCGGTGGGCGTAATAACAACGGGTAATCTCTACCGCGGTCTATAGGCCGAG
+AATCATCAGACAAGAGGGTTTGTGCCGGATGGCGGCGCAAACGCCTTAATCCGGCCTACG
+GTTAATAATCAATTCCCATCTGGGCTTTTACGCCCGCGTCAAAAGCATGTTTAACCGGAC
+GCAGTTCGCTGACGGTATCCGCAAGATCAAGAATATCCCGGTGACAGCCGCGACCTGTAA
+TAATCACCGTCTGGTGACCAGGGCGCGCGTTTAGCGCGCTTATGACCTCTTCCAGCGGCA
+AATAGTCATACGCCACCATATAGGTCAGCTCATCCAGGACCACCATATCAAGCAGCGGAT
+CGGCCAGCATCCGTTTCCCATGCTGCCAAACGGCCATACATGCTGCGGTGTCTGCCTCGC
+GATTTTGCGTCTCCCAGGTAAATCCCGTTGCCATCACCTGAAATTCGACGCCATGCGGTT
+CCAGCAGATTACGCTCGCCGTTGGGCCAGGTGCCTTTAATAAATTGCACCACGCCTACGT
+TTTTACCGTGTCCTACGGCGCGGGCGGCAGTTCCGAAAGCCGCCGTGGTTTTGCCCTTAC
+CATTGCCAGTAAACACGATAATAATACCGCGCTCTTCCTGTGCCTGGGCGACACGGGCGT
+CAACCCGATCTTTTACCTTCTGCTGGCGCTGCTGATAACGTTCATCACTCATTGGGCGAT
+TCCTGGTTTACGGCCCGGTTGGGCGTCAAAGGTCATACCGGTTTTACGGCGACTGTCGTC
+GCCCATAAGCCACAGGTAAAGCGGCATAATATCGGCAGGCGTTTTTAATTTCTGTGGATC
+TTCCGTCGGAAAGGCGCTGGCGCGCATACTGGTGCGCGTGCCGCCCGGGTTAATGCAGTT
+AACACGCAGAGAACGATTCTGGTATTCGTCCGCCAGCACCTGCATCATTCCTTCAGTAGC
+AAACTTCGAGGTGGCATAGGCGCCCCAGTTGGCGCGTCCCTGACGGCCAACGCTTGATGA
+CGTAAAGACCAGCGAGCCGGCATCGGACTTCAGCAATAACGGTAACAGCGCCTGGGTGAG
+CATAAAGGTGGCGTTAACGTTTACCTGCATGACATCCTGCCAGATCTGCGGATCTTGTTC
+GCTCATTGGACCGATTTCCCCCAGTAACCCGGCATTGTGCAGGACGCCATCCAGGCGGGG
+ATAGTGCGCGGCGATGCGGTCGGCCACTTGCCGGCACTCTTCAGCGGTGCAGGTCAGCAG
+ATCGAGCGTAAACCACTGTGGTTGAACATGTTGCTCGTCAGCAATGTGCTGCGCGACCCG
+ACGCAGTTTCTCTTCGTTGCGTCCCAGCAGAATCACCGTTGCGCCGTAACGCGCATACGT
+AAGCGCGGCTTCCCGCCCAATGCCATCGCTGGCGCCAGTGACCAGAATAATGCGGTTTTG
+CAATAGATCTTGTTTCGGTTGGTAATGCATGGCTACTCCTCAACGGTGTGGTGCACCGTC
+CTGCCAGGTTGTCTTATCTTCGCGTTAACTTTTCGGGTTTATGCCTGAAAGCGCCTTTTT
+TTTCAATCAGACAGGGGCGATAACGCCGTAAAATGAACGTCTTGTCATACTTTTTCTTCC
+TCAACAGGCATACGGATGAAGAGAGACTGACTTCGATGCCTGTTGTACACTGAGCGCAAG
+TCGCGTTATTTAATCAAGGTGGGAGTCGTGGAATTGTTGTCTGAATATGGCTTATTTTTG
+GCAAAAATCGTCACCGTTGTGGTGGCCATTGCCGTCATTGTGCTGCTGATCGTGAATGCT
+ACGCAACGCAAACGTCAGCGCGGCGAGCTGCGCGTGACCAATTTGAGCGAGCAGTATCAG
+GAGATGAAGGATGACCTTGCTGCGGCGTTGATGGATGGCCATCAGCAAAAACTGTGGCAT
+AAAGCGCAGAAAAAAAAGCATAAGCAGGAGGCGAAAGCCGCCAAAGCGAAAGCGAAGCTG
+GGGGACATTGCGACATCGGACAAACCGCGCGTATGGGTGATAGATTTCAAAGGCAGTATG
+GACGCTCACGAAGTTAATGCGTTACGCGAAGAGGTCACGGCGGTGCTGGCAGTGGCGAAA
+CCCGGCGATCGGGCGGTTGTGCGTCTGGAAAGCCCCGGTGGCGTTGTGCACGGCTATGGC
+CTGGCGGCATCGCAATTGCAGCGCCTGCGCGATAAAAATATTCCGCTGACCGTGACGGTG
+GATAAAGTCGCGGCAAGCGGAGGCTACATGATGGCCTGCGTGGCGGAAAAAATTATCGCG
+GCGCCGTTCGCTATTGTGGGGTCAATTGGTGTTGTCGCGCAAATCCCGAACTTTAACCGC
+TTTCTCAAAAGTAAAGACATTGATATTGAACTGCATACCGCAGGGCAGTACAAACGTACC
+CTGACTTTGTTAGGCGAGAATACGGAAGAAGGGCGGCAGAAGTTTCGTGAAGATCTCAAC
+GAAACGCACCATCTGTTCAAAGAGTTTGTGCAGCGGATGCGTCCGGCTCTGGACATTGAA
+CAGGTCGCCACGGGCGAACACTGGTACGGTCAGCAGGCGCTGGAGAAGGGACTGGTTGAT
+GAGATTAACACCAGCGATGAGGTTATCCTCGGCCTGATGGAAGGGCGCGAGGTGCTGAAT
+GTGCGCTATATGCAGCGTAAAAAACTGATCGATCGTGTTACCGGCAGCGCGGCGGAAAGC
+GCGGATCGGCTGCTGCTGCGCTGGTGGCAGCGTGGACAAAAGCCGTTGATGTAAACCGCT
+ATTGCCGGATGGCATTCAGCGCCATCCGGCATGGATTAATCAACCAGGTGATACTTCTCA
+GACAGCACATGCGCCAGGTGTTTAAACATGTTAAACACCGCGGTGCTTTTAGGGGTCGGT
+AACCCTTGCTCGTCTAAAAAGTAATCGCCGCTGAAAACCAGCACGCCATTTCTCTGCGTT
+ACGCCGGTGGCGACAATACCTGCCATCGTGTCTTCATGTTCCCGAATAATTTTGTTGGCT
+TCAAGCAACAGTGTTTCGCGATCGATAGGTTGCGTCTCTTTATGCATTTTTTACTCCTTA
+AACAAGGAGATTAGTCTACGCTGAGCACTTCTGATGGGCAAATATTCTCACAGGAAATTG
+ATGGATTTGTCATGTTGCGTTCACTGGCAAGATTTGTTTTTGCATGCTAATAAAGTTGCG
+TATCGAATTTTATCAGGTACAGTGTGACGCTTTCGTCAATCTGGCAACAGAATTGCTTGA
+CATTCGACCAAAATTCCGTCGTGCTATAGCGCGTGTGTGCAAAAAAGCCTGTTAACTCAG
+TCACCTGAGGGTTACATTTCGTACACAAAGCCAGTACAAGGGGTTGATATCCGCAGACGC
+AGAGACCATATATCGTTGTCTCGTCGCCAGTGGAAGGTGAATCAACGTGCGACGCATTCC
+TGGAAGAATCAACTTAGGTAAAGGTGAATATGGGTAAAGCTCTTGTCATCGTTGAGTCCC
+CGGCAAAAGCCAAAACGATCAACAAGTATCTGGGTAATGACTACGTGGTGAAATCCAGCG
+TGGGTCATATCCGTGATTTGCCGACCAGTGGCTCAGCAGCTAAAAAGAGCGCCGACTCTA
+CCTCCACCAAAACGGCTAAAAAGCCCAAAAAGGATGAACGTGGCGCTCTCGTCAACCGTA
+TGGGGGTTGACCCGTGGCACAACTGGGATGCGCACTATGAAGTGCTGCCCGGTAAAGAGA
+AGGTCGTCTCTGAACTGAAACAGTTGGCGGAAAAAGCCGACCACATCTATCTCGCAACCG
+ACCTTGACCGCGAAGGGGAAGCCATTGCATGGCACCTGCGGGAAGTGATCGGCGGCGATG
+ACGCGCGCTACAGTCGCGTAGTCTTTAACGAAATAACCAAAAATGCCATTCGCCAGGCGT
+TTGAACAGCCGGGCGAGCTGAACATTAACAGGGTCAACGCCCAGCAAGCGCGCCGCTTTA
+TGGATCGCGTGGTAGGCTATATGGTCTCGCCGCTGCTGTGGAAAAAGATCGCCCGTGGTT
+TGTCGGCAGGTCGCGTTCAGTCTGTCGCGGTCCGTCTGGTCGTTGAACGCGAGCGCGAGA
+TTAAAGCGTTTGTTCCGGAAGAGTTCTGGGAAATTGACGCTAATACGACGACGCCGTCTG
+GCGAGGCGCTACCGCTACAGGTCACGCATCAGAACGACAAGCCATTCCGGCCGGTAAATC
+GCGAGCAGACGCTTGCTGCGGTGAGCCTGCTGGAAAAAGCCAGCTATAGCGTGCTGGAGC
+GAGAAGACAAGCCGACCAGCAGCAAGCCAGGCGCGCCGTTTATCACCTCCACGCTACAAC
+AGGCGGCCAGCACCCGGCTGGGCTTTGGCGTGAAGAAAACCATGATGATGGCGCAGCGTC
+TGTATGAGGCGGGCTACATCACCTATATGCGTACAGACTCCACCAACCTGAGTCAGGATG
+CGGTCAACATGGTGCGCGGCTATATTGGCGATAATTTCGGCAAGAAATACCTGCCGGATA
+ACCCGAACCAGTACGCCAGCAAAGAAAACTCTCAGGAAGCGCACGAAGCGATCCGTCCTT
+CCGACGTTGCGGTCATGGCGGAGTCGCTGAAAGACATGGAGGCTGACGCGCAGAAGTTGT
+ATCAGCTAATTTGGCGTCAGTTTGTCGCCTGTCAGATGACGCCAGCACAATATGACTCCA
+CTACGCTTACCGTTGGTGCAGGCGAGTTCCGTCTGAAAGCGCGTGGGCGTATTTTGCGCT
+TTGACGGCTGGACAAAAGTGATGCCGGCGCTGCGTAAAGGCGATGAAGATCGCACATTGC
+CTGCCGTGAATAAGGGCGATGCGCTGACGCTACTTGAATTGACGCCTGCTCAGCACTTTA
+CTAAACCGCCAGCCCGTTTCAGCGAGGCTTCTCTGGTTAAAGAGCTTGAGAAGCGCGGTA
+TTGGTCGTCCGTCTACCTATGCGTCGATTATCTCGACCATTCAGGATCGCGGCTATGTTC
+GCGTTGAAAACCGTCGCTTCTATGCGGAAAAAATGGGTGAAATCGTCACCGATCGGCTGG
+AAGAAAACTTCCGCGAATTGATGAACTACGATTTTACTGCGCAGATGGAAGATAGTCTGG
+ATCAGGTTGCGAATCACCAGGCCGAGTGGAAAGCGGTACTGGATAACTTCTTCAGCGATT
+TTACTCAGCAGCTCGATAAAGCCGAGAAAGATCCGGAAGAAGGGGGGATGCGTCCTAACC
+AGATGGTGCTGACCAGCATCGACTGTCCAACCTGTGGCCGTAAAATGGGAATTCGTACTG
+CCAGTACGGGCGTTTTCCTTGGATGTTCAGGTTATGCGCTTTCGCCGAAAGAGCGTTGTA
+AAACGACCATTAACCTGGTGCCGGAAAATGAAGTTCTGAACGTGCTGGAAGGCGACGACG
+CCGAAACCAACGCCCTGCGCGCCAAGCGTCGCTGCCAGAAGTGCGGTACGGCGATGGACA
+GCTATCTGATCGATCCGAAGCGTAAATTGCATGTGTGTGGTAATAACCCGACCTGTGACG
+GCTACGAGATTGAAGAAGGCGAGTTCCGCATCAAAGGGTATGACGGCCCGATCGTTGAGT
+GTGAGAAATGTGGTTCCGAAATGCACCTTAAAATGGGGCGTTTTGGTAAGTACATGGCCT
+GTACTAACGACGAATGTAAAAATACCCGTAAGATCTTGCGTAACGGCGAAGTTGCGCCGC
+CGAAGGAAGATCCTGTTCCATTACCGGAACTGCCGTGTGAAAAATCGGACGCGTACTTTG
+TGCTGCGCGATGGCGCCGCAGGGATATTCCTGGCGGCCAATACGTTCCCGAAATCACGCG
+AAACGCGCGCGCCATTAGTCGAGGAGCTTTACCGGTTCCGCGATCGCCTGCCGGAAAAAC
+TGCGGTATCTGGCGGATGCGCCGCAGCAGGATCCGGAAGGTAATAAAACCGTTGTTCGCT
+TTAGCCGCAAAACAAAACAGCAGTACGTTGCGGCGGAAAAAGACGGGAAGGCGACGGGAT
+GGTCAGCGTTCTTCGTCGACGGCAAGTGGGTTGAAGGTAAGAAATAACCCCGGCCTGTCG
+CCACTGTAGTCAAGCGGGCCGCGTAAGCGGCCCTTTTTTATATCCCCTTCATACTTCAAG
+TGGCTTATGTGTTGGCTACGGATTACTCGGCCCATCTATGGCCTCGCCCTGACGGGCCGT
+CGCACGCGACGTTCAAATCTGCTCCCGGCAGATTTGTCGCTCACCCCAGTCATATAGTTA
+TCTATGCTCCTGGGAACTCACTCCCTTGCCGCCTTTAAGCAACTCGAATTATTTTAGGTA
+TAGCGGTCTTATTATTTTATCGCGCTGGCTATACAGTTCAGATATAAATGATATAGTGGT
+TATAGTTAACACCTTTTTTATTATTAAATCGTATTAGCAGCCCGATTAAGTCTGCAGATA
+AACGATGGCCTGATGGCGCTAATCTGGATGATGTATTATGAAATTGCAGCAGCTTCGTTA
+CATTGTTGAAGTGGTTAATCATAACCTTAACGTCTCCTCTACCGCTGAGGGGTTGTATAC
+TTCCCAGCCGGGGATCAGCAAGCAGGTTAGGATGCTGGAAGATGAGCTTGGCATCCAGAT
+TTTCGCCCGCAGTGGTAAGCATCTGACTCAGGTGACGCCCGCAGGTCAGGAGATTATTCG
+TATTGCGCGTGAGGTGCTTTCCAAAGTCGATGCCATTAAGTCGGTCGCCGGCGAGCACAC
+CTGGCCGGATAAAGGCTCGCTCTATATTGCCACTACCCATACTCAGGCGCGTTACGCATT
+GCCAGGCGTGATTAAAGGCTTCATCGAGCGTTACCCGCGCGTTTCGCTGCATATGCACCA
+GGGGTCGCCAACGCAGATTGCGGAAGCGGTATCGAAAGGGAACGCCGATTTCGCGATTGC
+CACGGAAGCGCTGCATTTATATGACGATCTGGTGATGTTGCCATGCTATCACTGGAACCG
+TTCGATAGTGGTGACGCCGGATCATCCATTGGCGGCAACGTCTTCCGTAACGATCGAAGC
+GCTGGCGCAGTATCCGCTGGTGACGTATACCTTCGGCTTTACCGGGCGTTCCGAACTGGA
+TACCGCTTTTAATCGCGCAGGATTAACGCCGCGGATCGTCTTTACTGCAACCGATGCGGA
+TGTGATTAAAACGTATGTCAGGTTGGGACTGGGCGTTGGCGTCATTGCCAGCATGGCGGT
+CGATCCGCTTGCCGATCCTGATTTAGTGCGGATTGACGCGCACGATATTTTTAGCCACAG
+CACCACAAAAATTGGTTTTCGCCGTAGTACTTTTTTACGCAGCTATATGTATGATTTTAT
+CCAGCGTTTTGCGCCACATCTGACGCGTGATGTGGTGGATACGGCGGTGGCGTTGCGTTC
+TAATGAAGAAATTGAAGCGATGTTTCAGGATATAAAGCTGCCTGAAAAGTAATATCACCG
+TCGGTTTGTGTCGTAGTGGCATGGCAGACAAAGCCGCCTTTTGCAATATCCCTCGAAGTA
+TTACGGGTAATGATCAGCAAAATAGTGTTGAATTACCCGTCCCGCCAGTTTCTTTTTCCA
+AATAGTTATCTTGAGTCAAAAGATTGATTTATTCACTGGCAACGATTCGTAAATTGACTG
+GATTTTTGACTAAAGTTTATTTAGGATTTGTCTCATCTGATGATTAATTGTACCGATTGT
+TTGGTGCTGAAATGATAAGTGATACCGATAGCATGAGGTTAGTAATGCCTTCTGAAAACC
+AGGAACCGCGCCGCGACCCTGAGCTCAAACGTAAAGCATGGCTGGCGGTTTTTGTGAGTT
+CTGCGTTGTTCTGGGTAGTGGTAGCGCTTGTTATCTGGCATTGGTGGGGCTAAGTGAGCA
+TTACGTCGGAACGCGAGCGCGTGGTCGCGCCCCCGATTCAATCTGGTGACGATGATAACA
+CCCCGGATACGACCGTTTTTCGGTCTGTTCCGCAACACTGGACGCTCACACCGCAGCAGC
+GGGCATTTATTGATGCTTTTGCTGACGAGGTGTCACAAAAATAATATTCGTCTTTTTATT
+GGCGTTACTGTTTTATTAACGCTGTCTTATTACACCGCAGCAACCGTGTGCTGAGCGCTT
+CTCAGTATTGATTAAACACAGTTGGTGTCGCCTATGTTAACGTCAAATATAAAGTATTGG
+TCATGGACTGGCGCGTTTATATTATCGCTACTGTTCTGGGCCGAGTTAATCTGGATTGCC
+GTCTAATCTCGTCAAAGCCCGATAATGCGTTATTTATCGGGCTTTTTCATCTTCGTTCCT
+CGCCTGTTAGGTTTCTCCTCTTTTAGCAATTTGGGTTGTTATCAAAACGTTACATTTTGT
+TTGTGTTATCTTTAATACAACCCTGTGGAGAATCAGGGTAACGCAACCCTGTCATTTAAG
+GAGGAGCTATGTCGTCAACCCTACGAGAAGCCAGTAAGGATACATTGCAGGCCAAAGATA
+AAACGTATCATTACTACAGTCTGCCGCTGGCTGCCAAATCCCTGGGCGATATCGCCCGTT
+TGCCCAAATCACTTAAAGTGTTACTGGAAAACCTGTTGCGCTGGCAGGACGGCGAATCTG
+TGACTGATGAAGATATTCAGGCGCTGGCCGGTTGGCTTAAAAATGCCCATGCCGATCGTG
+AAATTGCCTGGCGGCCCGCCCGTGTCCTGATGCAGGACTTTACCGGCGTGCCTGCCGTTG
+TCGACCTGGCGGCGATGCGTGAAGCCGTTAAACGCCTCGGCGGCGATACGTCGAAAGTGA
+ACCCGTTATCGCCGGTTGATCTGGTTATTGACCACTCTGTGACGGTCGATCATTTCGGCG
+ATGACGATGCGTTTGAAGAAAACGTGCGGCTGGAAATGGAACGTAACCATGAGCGTTATA
+TGTTCCTGAAATGGGGAAAGCAGGCATTCAGCCGTTTCAGCGTGGTGCCGCCCGGCACCG
+GCATTTGCCATCAGGTTAACCTGGAATACCTGGGTAAAGCCGTCTGGAGCGAATTACAGG
+ACGGGGAGTGGATTGCTTACCCGGACTCGCTGGTGGGGACTGACTCCCATACGACCATGA
+TTAATGGTCTGGGCGTATTGGGGTGGGGCGTGGGCGGTATCGAAGCGGAAGCGGCGATGC
+TTGGTCAGCCCGTGTCGATGCTTATCCCGGATGTTGTCGGCTTTAAGTTAACCGGTAAGC
+TTCGGGAGGGGATCACCGCTACTGACCTGGTGCTAACCGTCACGCAAATGCTGCGTAAGC
+ATGGCGTCGTGGGTAAATTTGTTGAATTTTATGGTGATGGTCTGGATTCGCTGCCGTTGG
+CGGATCGCGCGACCATCGCTAATATGTCGCCGGAATATGGCGCCACCTGTGGTTTCTTCC
+CTATTGACGCCATCACCCTGGAATATATGCGATTAAGCGGACGTAGCGACGATCTGGTCG
+AGCTGGTTGAAGCCTACGCGAAGGCGCAGGGAATGTGGCGTAATCCCGGAGACGAACCGG
+TATTTACCAGTACGCTGGAACTGGATATGGGCGATGTCGAGGCCAGCCTGGCCGGGCCGA
+AACGCCCGCAGGATCGCGTGGCGTTAGGCGATGTGCCGAAAGCCTTTGCCGCCATCACCT
+CCTGCACGAATACCTCGAATCCCAGCGTGCTGATGGCGGCGGGATTACTGGCGAAAAAAG
+CAGTAACGCTGGGGTTGAAGCGTCAACCGTGGGTCAAGGCTTCTCTGGCGCCGGGGTCAA
+AAGTGGTATCTGACTATCTGGCGCAGGCCAAACTTACGCCTTATCTGGATGAGCTCGGTT
+TTAACCTGGTCGGTTATGGCTGTACGACCTGTATCGGGAACTCTGGTCCGTTGCCGGAGC
+CTATTGAGACCGCGATTAAAAAAGGCGATCTGACGGTAGGGGCCGTGCTTTCCGGTAACC
+GAAATTTTGAAGGGCGTATCCATCCGCTGGTGAAAACGAACTGGCTGGCGTCGCCGCCGC
+TGGTGGTCGCGTATGCGTTGGCCGGAAACATGAATATTAACCTCGCGACAGACCCGCTGG
+GGTACGATCGTAAAGGCGATCCGGTATACCTGAAGGATATCTGGCCTTCGGCGCAGGAAA
+TTGCCCGCGCCGTTGAACTGGTATCATCAGATATGTTCCGTAAAGAGTATGCGGAAGTGT
+TTGAGGGCACGGAAGAATGGAAATCGATTCAGGTTGAATCGTCCGATACCTACGGCTGGC
+AGTCGGATTCAACCTATATTCGCCTGTCGCCTTTCTTTGATGAAATGCAGGCCCAGCCTG
+CGCCAGTCAAAGATATCCACGGCGCGCGTATCCTGGCGATGCTGGGGGATTCGGTAACGA
+CCGACCATATTTCTCCGGCCGGCAGTATCAAGCCGGACAGTCCCGCCGGACGCTATCTGC
+AAAACCACGGCGTTGAGCGGAAGGATTTTAACTCCTATGGATCACGGCGCGGCAACCATG
+AAGTGATGATGCGCGGTACGTTCGCCAATATTCGTATTCGCAACGAAATGCTGCCCGGCG
+TCGAAGGTGGGATGACGCGGCATTTGCCGGGTACGGAAGCGATGTCGATTTATGATGCTG
+CGATGCTCTACCAGCAGGAAAAAACGCCGCTGGCGGTAATTGCCGGGAAAGAGTATGGGT
+CGGGATCGAGCCGTGACTGGGCGGCAAAAGGTCCGCGGCTGTTAGGTATCCGCGTGGTGA
+TCGCCGAGTCGTTCGAACGTATCCACCGCTCAAACCTGATTGGGATGGGGATCCTGCCGC
+TGGAGTTTCCACAGGGCGTAACGCGTAAAACGCTGGGACTGACCGGGGAAGAGGTGATTG
+ATATCGCGGATCTGCAAAACCTGCGCCCTGGCGCGACCATTCCGGTGACGTTAACGAGAT
+CGGACGGCAGCAAAGAAACGGTGCCTTGCCGCTGTCGCATTGATACCGCCACCGAGCTGA
+CTTACTACCAGAATGACGGCATATTGCACTATGTCATTAGAAATATGCTGAACTAAAGCC
+GTTTATCGGGCCTGCCGTAAACAGGCAGGCCCGCGCTTTAATACCGGTGGCTTACTTGCT
+TAGTAGGTGGCCCATTTTGGCCGCTTTAGTATCGAGATAATGCTCATTATTTGGATTACG
+ACCCACAATGAGCGGAACGCGTTCGACGATATTAATTCCCGCCTCGGTCAGTATTTCGAC
+TTTCTTCGGATTATTGGTCAGCAGGCGAACTTCATCTACGCCCAGTAATTTGAACATATC
+CGCGCACAGGGTGAAATCACGCTCATCGGCGGCAAAGCCGAGCTGATGATTGGCCTCCAC
+CGTGTCATAGCCTTGATCCTGTAACGCATAAGCGCGAATTTTATTAAGCAGGCCGATATT
+GCGGCCTTCCTGACGGTGGTAAATCAGAATACCGCGTCCTTCTTCCGCAATATGCGTCAG
+CGCGGCTTCCAGTTGAAAACCACAATCACAGCGCAGACTAAAAAGCGCGTCCCCGGTAAG
+ACATTCGGAATGAACGCGAGCCAAGACCGGCGTTTTACCTGAAATATCGCCAAAAACCAG
+CGCGGCATGGTCGTGTCCGGTTGCCAGTTCTTCAAATCCCACCATCAGAAAGTCACCCAA
+TGGGGTTGGCAGTTTGGCTTCTGCCACACGTTTAAGCTGCATGTATTTCTCCAGATTATG
+CTGACGCCTGCGGTGTCGTCGCCTGTTGGATTGTATCCCGCTATTTTGCCATAAGGCGGC
+GGTCATCACCTAATCACTACCACGTAATTGCTCAGGAATGGCACAAATTTGTCAATTTTC
+CAGTCCGGCGAGAATTTTCAGTTATGATTGTGATACTTACTTATAAAAGGAGCATCCATG
+CTTTCAATTGCGAGGCGCACCGCGGCAGGCGCCGCCCTGTTGCTTATCATGCCGCTTGCC
+GTATGGGTATCAGGCTGGCAGTGGCAGCCAGGACATCAGGTCTGGTGGCTAAAAACGCTA
+TTCTGGATAACGGAAACCGTGACCAAACCCTGGGGCGTTATCACGCATGTGATTCTTTGT
+GGATGGTTCTTATGGTGCCTGCGATTTCGCCTGCGCGCCGCCATTATGCTGTTTGCGATC
+CTCGGCGGGGCGATTATCGTCGGGCAGGGTGTGAAGTCATGGGTAAAGGAGCGCGTACAG
+GAGCCGCGGCCATTTGTGGTCTGGCTTGAAAAAACGCACCATATTCCCGTCGATGAGTTC
+TACACTTTAAAGCGTACAGAACGCGGACATTTAGTGAAAGAGCAGTTGGCCGGGCAACAG
+AACATCCCCGTTTTCCTGCGTCAGCACTGGCAAAAAGAGACGGGCTTTGCGTTTCCCTCC
+GGACACACCATGTTTGCAGCGAGCTGGGCGCTTTTGGCCGTGGGTCTGTTATGGCCGCGC
+AGACGGACTTTCACCATCGCGTTTTTGTTAGTCTGGGCGACCGGCGTAATGGGCAGCCGT
+TTGCTTCTGGGAATGCACTGGCCGCGAGATTTAGTGGTCGCCACGCTCATCTCCTGGCTA
+TTAGTTACCCTGGCGACCTGGCTGGCGCAGCGAATTTGCGGGCCGCTTATGCCGCCTCGC
+GAAGAAGCGCAAGAAATTGCTGAACGCGAGCAGGAAAGCTGACAACGGTTGATTTTCTGA
+CTATTGCCCTTAAATCATCTGATGGTGGGCGCATTTCCATTTCGCGCGAGGCGGGAAAAT
+GGTAATTTAGAAGGCTGGATGCGGTAAGTTGGACACGATTTATTCGCGCAAACCACATAA
+CGGGAAGTAATGTGAAATATTTACTCATTTTCTTACTGGTATTGGCGATTTTTGTTATTT
+CGGTGACGCTGGGCGCGCAGAATGATCAACAGGTGACGTTTAACTACCTGCTGGCGCAAG
+GGGAGTATCGTATCTCCACGTTGCTTGCTGTGTTGTTCGCCGTCGGTTTTGCGATTGGCT
+GGCTGATTTGCGGCCTGTTCTGGCTGCGGGTCCGCGTTTCCCTTGCCCGTGCTGAACGTA
+AAATTAAACGACTGGAAAACAAGCTCTCGCCAGCAACCGACGTTGCGGTCCCTGCCGACT
+CGTCGGTTGTAAAGGAATAATCATTTATGTTGGAGTTGTTATTTCTGCTGTTGCCTGTAG
+CCGCTGCCTATGGGTGGTATATGGGTCGCAGAAGTGCGCAACAAACAAAACAGGATGAAG
+CTAACCGCCTGTCGCGCGATTATGTCGCAGGGGTTAACTTCCTGCTGAGTAACCAACAAG
+ATAAAGCGGTGGATCTGTTCCTCGATATGCTTAAAGAGGATACGGGCACCGTTGAGGCTC
+ATCTCACTCTCGGTAATCTGTTTCGCTCTCGCGGCGAAGTCGATCGCGCCATTCGTATTC
+ATCAAACGCTCATGGAAAGCGCTTCATTGACCTATGAACAGCGTTTACTGGCTGTTCAGC
+AACTGGGGCGCGACTATATGGCCGCCGGTTTATATGACCGCGCGGAAGATATGTTTAACC
+AACTTACCGACGAAACGGAATTTCGCGTAGGCGCGTTACAGCAGCTCTTGCAAATCTATC
+AGCTAACCAGCGACTGGCAAAAGGCGATCGAAGTAGCAGAACGGCTGGTGAAGCTGGGCA
+AAGATAAACAACGTATCGAAATCGCCCATTTTTACTGTGAGTTAGCGTTACAGCAGATGG
+GCAACGACGACATGGATCGCGCGATGGCGTTGCTGAAAAAAGGTGCCGCCGCAGATAAAA
+ATAGCGCCCGGGTGTCTATCATGATGGGGCGCGTTTATATGGCGAGAGGGGATTACGCCA
+AAGCGGTCGAAAGCCTGCAACGTGTGATCGTTCAGGATAAAGAGCTGGTCAGCGAAACGC
+TGGAGATGCTGCAAACCTGTTATCAACAGCTCGGTAAAAATGCCGAGTGGGCGGAGTTTT
+TACGTCGCGCCGTTGAGGAGAATACCGGTGCTGGCGCTGAGTTAATGCTTGCCGATATTC
+TGGAAGCGCGTGAAGGTAGTGACGCAGCTCAAGTCTATATCACGCGTCAGCTACAGCGAC
+ATCCTACCATGCGGGTGTTCCATAAGCTGATGGATTACCATCTCAACGAGGCGGAAGAAG
+GGCGAGCGAAAGAAAGCCTGATGGTACTGCGTGATATGGTTGGCGAGCAGGTGCGCAGTA
+AACCGCGGTATCGTTGTCAGAAATGCGGTTTTACCGCCTATACCTTGTACTGGCACTGTC
+CGTCCTGCCGGGCATGGTCGACCATTAAACCTATTCGCGGACTTGATGGGCAGTAGTATA
+TAAAAAAAGCTTCAATTTAGTTACAACATACTTGATGACGTAAAGCTAGAAACGACGCTG
+GCATCGGCGGCCAGGGCTTATCAGGTTGTCAATCGAACCTGTTAATTTCCCTGCGCCGCA
+GGTAGAATGCACGCCGTTTATCCAATTTGCGCCACTTCCGGTGCCCATCATCAAGAAGGT
+CTGGTCATGACGTTTACTGCTTCATCTTCTTCCTGCGCTATTACTGAATCGCCTGTCGTT
+GTGGCGTTGGATTACCATGAACGCGATAAAGCCCTGGCGTTTGTCGACAAAATCGATCCT
+CGCGATTGTCGCTTAAAAGTGGGCAAAGAGATGTTCACGCTGTTTGGTCCACAACTCGTT
+CGGGATCTCCAGCAACGTGGGTTTGATGTCTTTCTTGATCTAAAATTTCATGATATTCCC
+AACACCACGGCCCGGGCAGTCGCCGCAGCGGCAGACCTGGGCGTCTGGATGGTAAACGTT
+CACGCGTCTGGTGGGGCGAGAATGATGGCCGCAGCGCGCGACGCGCTGGCGCCATTCGGT
+AAAGATGCGCCGTTGCTCATTGCCGTGACCGTGTTGACCAGTATGGAAACCAGCGATCTA
+CACGATCTGGGCGTGACGTTGTCACCGGCGGAACATGCGGAGCGGCTGGCGCGCCTGACG
+CAGCAATGCGGGCTGGATGGCGTGGTCTGTTCCGCTCAGGAAGCTGTCAGATTTAAACAG
+GCCTTTGGCGCTGCATTTAAGCTGGTGACGCCGGGCATTCGGCCCGCAGGCAGCGAGGCA
+GGCGACCAGCGACGCATTATGACGCCCGAACAGGCATTATCCGCTGGCGTCGACTATATG
+GTGATTGGCCGCCCGGTTACGCAATCGGTAGATCCGGCGCAAACGCTGAAGGATATTAAC
+GCGTCACTGAAACGGGAGGCATAATGAGCGATTCCAATAGTCGTCTGGTTTATTCAACAC
+AGACGGGGCGCATTGAAGAACCTAAAACGGCGCCGGTTCGTCCCAAAGGGGATGGTATCG
+TTCGCATTCAGCGTCAAACCAGTGGCCGTAAGGGTAAAGGCGTATGTTTGATTACCGGTA
+TCGAGATGAATGATGCGGAATTAACCAAACTGGCGGCTGAACTGAAGAAAAAATGCGGCT
+GTGGCGGGGCAGTAAAAGAAGGGATTATTGAAATTCAGGGTGATAAACGCGACTTGATAA
+AATCATTGCTGGAAGCTAAAGGAATGAAAGTAAAATTAGCTGGCGGCTAATGAAAACGCC
+ACGGTTGTAAATTACCGTGGCGTAAAAGTCAACTTTGTCTATTTTTGTAATCCAGACCTG
+AAAAGAATAAACGTATTATTTTGAGCCGTTCAATATTTAAACGTCTGGATTATTTTCCAA
+CCTGGTGACCAATCACGCCGCCGACCGCCGCGCCGCCCAGGGTGCCTAATGTACTGCCGT
+CCGTTAACACTGCGCCGCCTAACGCCCCCGCACCTGCGCCAATAGCCGTGTTGCGATCGC
+GCTTGGACCAGTTTGAGCAGGCGCTCAGAGACATTGCTACGGTGATTGCCAGCACAGCAG
+CGGCCATTTTTTTGCTCGTCATAAACATAATACTCTCTCCTGAATTAACGATTCACGGAA
+TTAAGCTCACTATAACTATAGTTAAAATAAAACCTGTTAAGAGATTTTCCGTAAAACCTG
+ATTGCGCAGGGGTATATCACGCAGGTGATAGTCACTTCCTGTTATTTCGCTAATATTAAT
+TTTACGACGTTACGCTCGTTACAACAGGTAAATAGTCTTAATTGGGATGTCAGAAAAGTC
+TTAGAGAGAGGATGATTTGCCATAGGGCAAACCATCGGGAAATATTTTAAACGGATGAGC
+CAATAACATTGACTAGCAGCCCCGCATGTTCTAACTGCATTTGATCGCTGGCGGAAATTT
+TGGAATCCGTAATGACACGATGGAAGCGAGAGAGCGGGCCCAGGGGATAGGGATGCACAC
+AGCCAAATTTGGAGCTGTCGGTGAGGACAATCGCTTCTGAGCCTTTTTCCAGAACAGCGT
+TAACCACATCCGATCGCATCATGTCGCGTCCGGTAAAACCGGTATCAGCCTGCCAGCCAT
+CAATACCGATAAATGCTTTGCTGAAATGCACTTGATGGATAAACTGTCGCGTCAACGGCC
+CTACCATGCTTTCACTTTTTTTCTGATAGATTCCACCGAGGAGAATGACTTCGCAAGGGG
+TCTCTTTGAGCAGGTGCGCGATATAACTGCTCACGGTGATGATCGTGACATCTTTTTGTT
+CCGCCAGCGTCCGGGCCAATAGCGCATTGCTGCTGCCATTTTCAATAAAAACGGATTCCC
+CTGGACTGACCAGCGAGGCGGCGAACTCCGCCAGTCGGCGTTTTAGCGTGTAGTTCGTCA
+TCATGCGAGTCTCTACGTCATCGCTCTCAAGCGAAACGGCGAAACCGTGCGCACGGCGTA
+AATAGCTCTGCTTTTCCAGGGTATTCAGATCCTGACGAATCGTGACTTCAGATACGCCGG
+TAATTTTCGCCAGTTCAGCAACGCTCATCTGGCCTTTATCAACCACCATTTGCAAAATTG
+ATTGTTGTCGGGAGTTCATAGTATTAATTTTATTCGTTAAGAGGAGTCAACAGACAGTCA
+GAGAGCCGGGAAGGGCTAACGGCCATCCCGGACAAATAATCGCTATCAGATTTCCCAGGG
+CGACCCGGGAGCCTGGGATGGCGAGATACCGTCTTTAACCTGATCTAACAGCTCTGCTCT
+CAATATTTCAAGGTTATTGATGGCCGAGTGGTAATCGCCAGCAACAAGGATATCCAGCAC
+GGTATCAATGCGTGCGGCAATTCGTTGTGCTTCGATATCAGACATGTTTGTCATCCTTAA
+TGTCAGAAAAGGTTTCAATTCATGATGCAGAAATTAATCTGAAAAGAGAAGGGAAAAATA
+GGGCTATGCCTGTCTGCACAGGCTGTTCTCCCTATTATCGCCGCCATTAACGCATTTTTT
+TCGTCTGATAACGTTTGTACCAGCGTTCAAAAGAAACGGCGGGCATAGGTTTGGCGAATA
+AAAAGCCCTGTCGTTCATTGACGCCGTTTTTTGTCAGGAAGGCATCTTCTTTAGCATTTT
+CTACGCCTTCGGCAATCACTTGTAAATTTAGCGCCTGAGCCACCGCGACAATCGCCCGAA
+CCAGAGATTGCGACAGCGGTTGCTTATGGATATCTCTGACGAAAGCCTGATCCAGTTTAA
+CGGCATCAATAGGGAACCGGGCGAGTTGAGAAAGCGAAGAATACCCGGTGCCAAAATCAT
+CCAGATGAATCTGGGCGCCGAGCTGACTAAATTGCTGGATAACCGATAGCGCCAGCGTGT
+CGTTTTCGATCAGGCAGCTTTCCGTTAGCTCGACATCGATCGGGCAATACTCAAAATTCA
+GATCGTACAAAGCCTGTTTAAGCGCAGTAAAAAGCGTCTGGTCGGCCAGTTGTCGCGCCG
+AAAAGTTAACGGCTACGCGCAAGTTAATCCCCTTATCGCGCCATCTCGCAATCTGGCGAA
+CCACATCCAGAATCACCCAGCGGCCCAGCGGGACGATGAGTCCTGACTCTTCGGCGTATG
+AGATGAACTCCAGCGGCGGAATTAATCCGCGTTCCGGCGATTGCCAGCGTACCAGCGCTT
+CCAGGCTACGTACTTCGCCGCGCCAGGTAATTTTGGGCTGATAGTGAATAAGTAACTGGT
+CGTTTTCCAGCGCTTTTCGCAGGTTTGTATCCAGCCAGTGATAGTCAAATACGCGCTGAT
+TCATTTCCGGCGAAAAAACGCAGAACTGACCGCGGCCGCCTTCTTTGGCGTTATACATTG
+CGGTGTCGGCAGTGCGAATGAGACTGTCGCTGTCCTGTCCGTGCCGGGGGGCCAACGAAA
+TGCCAATGGCGCATCCCGTGTAAACTTCAATGAGTCCAATACGAAACGGTTGCCGCAGAC
+GGGTAAGGATTCGTGAGGCTACTGCTTCCAGCGCGGCCTGAGACGTATGGGCAGCGAGGA
+CAATGAATTCATCTCCCCCCAGTCTGGCCAGCAATTGATCTTCCTCCAGACAACTCAACA
+GCGCCAGCGAAACGGCCTGTAAGAGCTGATCGCCAAACATATGCCCATAGGCGTCATTAA
+TTTTCTTGAAGTTATCCAGATCGAGATAAACGATACCCACTTGCGACTCGCCAGCCGAGG
+CAATAGCATGATTAATAAATTCATGGATAGCATTGCGATTGGGCAGGCCGGTGACGGTGT
+CTGTATTCGCCAGTATGCGTAAACGCTCCTGAGCCCGCCTTTCTTCGGTGATATCCGTGC
+CTGCGCAGATCAGGAAAATTTCGTTTTTTCCGCTACCGTTATGGACAAATTTATTACGAA
+ATAAGAACAGGCGTTGGCCTTTACGGGTCTTTATCCAGCGTTCGATTTCATAGGCATTGC
+CATTGCGAAAAAAATTCTCAATGTAGTGCCGGGAGGCAACCGCCTCCCGGCGACTCATAA
+ATAATTTAAAGACGCTTTGACCAATTACATCTCGCTCTTTTAAGCCCGTGTACTCTTCGC
+ATAACCGATTAAATCGACAGATTTTTCCCCGACTATCCAGTATCGCAATGACTGAGTTGG
+CTTCTGATACGATTTGCTCGGCAAAAGAGAGCTCCTGCGCCTGCGTTGGCGCGACGGCAG
+GCGTATCAGGCCAGGTTGCCAGGCTGCCAGCCCATTCACGGTTATTAATCTTACGGCCTA
+CCAGGTGCACAGCGGTAACCTGTTTTTCTATCAACAACGTTATCAGCAGACTGGACGTAA
+TCGCCGTTATTTCCCGGATACGCCCGGCTTGCTCCGGCGATAGCTCGACCGTTTTTTCTG
+TATCCGTTTCACCTGTCGGGGAGAGATACAGCACGTTGCGGTCATCAGCCAGACGCCAGT
+GAGAGTGAAGGGGATTTAGCGCCGTTTGTTCCTGAATCTGTTTCATCATGCGTACCATCC
+CATTTAAGCGCCAGGTGCCCGAAAAGAAAGGTTAGCCATGTTATACATAAGGGTAATTAT
+GGCTGAACGTATTGTTTTATCTATGTATTCATATGTAATCCAGATTCTGGAAAAAGCATA
+GTCGCCAGCTAAAAATAACAAGAAATGGGGCGCTTGAATAAGATTAAACTTAGAGCATGA
+CGGAAGGGAGAAGAAGAAAAGAAACGGCCTTTGCCTTCTCAGCAAAGGCCGTTGAGCGAG
+CTAAGCGTGGTTACGCTGCCGGTCGGGCAATAATGCTGCGGGTTTCCATGCGAACTTCCG
+CAATAGTGACATCAATGACATCCGTCACTTTATAAACCGTCTCACCTTTAATCTGTACCG
+TACCGTTTTCCTGGCTGCATACCAGTTCATCGCGAACGGCGTGCAGGAACGGGGCAGGGA
+TAAAGGCGATAGCGCCGTTATCGACCAGTCGCACACGCATACCACCGCGGCTGACGTCAA
+TAATTTCTGCCGCGAAACGGGTATTTGTCCCCGCCTTATCGTTAAGGAAGCGTGCATATA
+ACCAGTCGCCGACATCGCGCTCCGCCATGCGGTTCAGGCGACGGCGTTCCGCCATTTGCT
+GGGTGATATCTTCCTGCGGACGCGCAATAGCCTCCCCCTTGATGACCGCTTTCAGCAGGC
+GATGGTTAATCATATCGCCATACTTACGGATAGGAGAGGTCCAGGTGGCGTAAGCCTCAA
+GACCAAGACCGAAATGCGGCCCCGGCTCGGTGCTGATTTCCGCAAAAGACTGGAAGCGAC
+GAATGCGGCTGTCAAGGAAACCGGAGGGCTGCGCATCCAGTTCGCGACGCAGTTTACAGA
+AGCCTTCCAGCGTCAGCACCTCTTCGGCATCGACATGCAGACCATGCGTTTTCAGCAGCG
+CGGCCAGCGCGTCGGCATTCGCGGGATCGAAGCCCGTATGTACGTTGTAAATACCGAAAC
+CGAGCTTATCGCGCAGTACGCGCGCGGCGCAAAGGTTAGCGGCGATCATCGACTCTTCTA
+CGATACGGTTAGCGATACGGCGCGGTTCCGCCACAATATCCAGTACTTCGCCTTTTTCGC
+CAAGCACAAAGCGGTAATCCGGGCGGTCTTTAAAGACTAACGCATGATGATGACGCCACT
+CACTGCGGCTTAGGCAAATACGGTGCAACAGACGAATCTGCTGGGCAATGCCTTCGTTAT
+CCGGCTGCCAGGTGCCGTTATTTTCCAGCCAGTCGGAGACATTGTCGTACGCCAGCTTGG
+CCTTCGATTCGATGGTGGCCGCAAAAAAGGCGATATCATCGTCAATGGTGCCGTCCGCGG
+AGATTATCATGCGACAGGCGAGCGCCGGACGCACTTCGTTGGCGCGCAGTGAGCACAGAT
+CGTCAGACAGCTCACGTGGCAGCATAGGAATATTGAAGCCCGGCAGGTAGTTGGTGAAGG
+CGCGAATTTTCGCGGCGTTATCCAGCTTACTGCCTTCGGCAATCCAGGCGGTAGGATCGG
+CGATAGCCACCGTAAGCTGGAGTCTGCCGTCCGCTAATTCCTCAGCATATAGCGCGTCAT
+CCATATCTTCAGTGCTGGCGCTATCGATAGTGACGAAATTCAGCGCGGTCAGATCCTGAC
+GCTCCAGCCCTTCGTCCAGCATCTCCGTCGCTACGCCGTTCGGCGCTTCTTTTTCCAGGT
+TATGGCGGGCAAGCGTAACCCACCAGGGAACAAAGTGATCGTCGGCAAAGGTGATGTACT
+GCGTTAAATCGGCGTAAAACGAACGGTCGCCTTTAAGCGGATGGCGGCGCATTTCGGCAA
+CCGCCCAGTCACCTTCTTTGAACTCATGCTGAACGCCGCGCGCGGCGCGGCAGGGAATCG
+CGTCTTTCAGCAACGGATGATCCGGCACGATGGACAGGCGGTCATTTTTACCCTGAACTT
+TTCCCACAAAACGCGTCAGGAACGGTTCGATCAGTTCTTCCGGCTCGGCAGACTCACGTT
+CTTTTTCCGTGTGGATGACCGCGACGATACGATCGCCATGCATCACTTTTTTCATCTGCG
+GCGGAGGAATGAAATAGCTTTTTTGCGCGTCAACCTCAAGGAAGCCAAAGCCTTTTTCCG
+TGGCTTTTACGACCCCTTCAGCGCGCGGCGTCTGGGAATGCAGTTGCTGTTTAAGCTGCG
+CTAGCAGCGGGTTGTCCTGAAACATATTCGTCTATTTTCGTAGCCAAAAGAGCGGCTGAC
+AGTTTTACGCGATTCTGCCTGGCGCAGCAAGCGCTCTTTCAGTAATGGATGAGTTAATAG
+GTTTCGCCCAACGCGATTTTTAAACGATTTAACCATCCGCACACGCCGCACCAGCCTAAC
+ATATTAATGGCCTGCTCCGATGAAACTCCCCTGGTGAGTAGCGGGAAAAAGTGCGCGGCG
+CTAAAGCGATCGGGCGCTCTGGTGAGCCATTGTATCGCCTGTGTCAGCGCAGGCTCAAGT
+TCCCAACGAGCGATGTCGTCGTCTTCCTGGCGTAACGTGATGACAGCGCGACGCCACGCG
+CCAGGTTGGGTTGCCTGTTCGTTAAAGCAGGCGGCGCTGCCGTTGATACGTGATGTGAGG
+AGCGTGATAAGTGGAAGTAAAGAAGGGGGCGATGCAGTGTGTAATGTGCTGGTCAGTATG
+CGTTCGAGTAACGCGAATGAAGACGGATCGCGCATGAGTACCGGCGCCATCATTTGGCAT
+TGTGAAGACGAATATTGCCGCCGAACTTTGGTATGGGCTGGAGGATATTCTACCAGACTG
+GCGGCGGGCCGCCATATCGTCTGGGGGGTTTGAAACCGCGCGGCCCTGGCAAAGCGCTGC
+ATCTCCTGGCCGGGCAGTTCGCGCACGGGCAGACGGCAAAACGCCTGAAATATCGCCGCT
+ACCCGCGCCTGAAAACCGATAAACCCAATGATCTGATTGATGAGTACGGTATCCCGGGCG
+GTTAATCCCACCTCTGCAAGCTGTTCGCGGGCTCGCGTATTGATAACGGAGGGGGAGCCG
+GCAAGCTGACGAGCGTATTGCGTAATTTGCGCCAGCCGTTGATTGCTCTCTCTTGAGGCA
+TCAGGGCCAGGTAGCGGCGCCAGACGCGCGGCATAATAGCGGCACAAACGCTGAACCCCA
+AATACCTGAGCGGCGGTCAGCGCGGTGCTCATACGTTCATAGGTGCTAAACGTATGAAGC
+CGGTCGTTGAGAACCGTGCGGGGAAATAAGACATCCGCCAACTGGTGAGCGGGCTTTAAC
+CATGACTCAAAAGGCGTCAACGCGGTTTCTGATACCGTTAAATCCAGTAAAAAACGATCG
+TTAACATACGCGGCTTCCGGCATCAGCGAAAGCGGGGGTTGTGACGACATAGTGGATTGT
+GTTTCATGATACCAGTGGCTTTTACCCGCTTTTCGGCATTGTTCCATAGGGTTTCCCGAG
+GATGAAATGGCGATCGATAATGATTCGGCGTCGGATCGTTTATGCTGGATTATCCTGGCG
+TATGCGGGAAAGGGATGAAAGATTGTTAGGTGATAACAAATATCAGAACGCTATATAACG
+AGATGAGCGGTGAGTGAGGGGAATGGGGCAGCACAGCCGTGCCGCCCGCTAATAAACTTA
+ATGCGCTTACTTCAGTTCCAGTTCATTCATTGCCGCAATGCTGAACCCGCCGTCAACATG
+GACGACTTCGCCAGAAATGCCTGCCGAGAGATCGGAACACAGAAACGCCGCTGAGTTACC
+CACATCTTCAATGGTCACGGTGCGACGAATTGGCGTAACGGCTTCACAATGCGCCAGCAT
+TTTACGGAAGTCTTTAATACCGGACGCCGCCAGCGTGCGGATTGGACCCGCAGAGATGGC
+GTTGACGCGAACGCCTTCCGGCCCCATTGCATTTGCCATATAACGCACGTTGGCTTCCAG
+AGAGGCTTTCGCCAGACCCATGACATTGTAGTTCGGGATGGCGCGCTCCGCTCCCAGATA
+AGACAAGGTCAACAGCGCAGAACCCGGATTCAGCATGGTGCGGCAGGCTTTCGCCATGGC
+AACAAAGCTGTAAGAGCTAATATCGTGAGCGATTTTAAAGCCTTCGCGGGTAACCGCATT
+AACATAATCGCCGTCCAGCTGATCGCCAGGCGCGAAACCGATCGAGTGTACAAAACCGTC
+AAATTTCGGCCAAACGTTACCCAGCTCCGCAAACATAGCGTCAATGCTGGCATCTTCAGC
+GACATCACACGGTAAAACGATGCTGGAACCCAGCTGGGCAGCAAATTCTTCTACGCGGCC
+TTTCAGTTTGTCGTTCTGGTAGGTGAACGCCAGTTCAGCTCCTTCGCGGTGCATCGCCTG
+TGCGATACCGTAGGCGATGGACAGTTTACTGGCCACGCCAGTGACCAGAATGCGTTTACC
+GGAAAGAAAACCCATAGCTTTAATCCTTATAGTCATTGCTTATTTTTTGCTTTTACGAAC
+AATGGTTAACAGCAACTTTTCAACATTATTCGAAATTAGTCTGAAATTATATCCCACTCC
+TGGCCCCGTGTGTCACGCTATTTTTCCGCCGCTATCTCCGGCAGGTGACGTTCTAAAACC
+ACACGGTAACGAAGCCCCTGAGGATTTTGAGCACTCCCAGGGCCAAACTGGCAAATCAAA
+GAGTCTAATGGGACAGGCCCTAGGGTGCAGTATACCAGCTGGTGTAAGGTTCGCCTCATC
+CAACCAGAGACACCGGGACGGATAGCAAGTACGATAGCGATGCGCTTTCCACCAGACAAA
+TAAAGGTTCTGTAGGAAGCCTGAATATTCATCCAAATGGTTTACCTCACCTATTAGCGGT
+GTTATGGACATGTAATTTTAACCAGCAAATGCTTAACAAAAATAATTTCTTTTTTAAGCG
+CTGAAGGTTTTCTCTATTTATTGATGCAGAGTAATACTGAATATGAAAAATTTTGGAAAT
+CAGGTGATTACAGTAGTTACAAACCAGGTTTTTATATGTTTGCATGTGTATTATAATAAA
+TTTTCAGAGGATGAGACATATGCCGTTTACATTTCATATCGGAAATCATAGTTGCCAGAT
+ATCAGAAAGGTATTTAAGAGATATCATCGATAATAAAAGAGAACATGTTTTTTCAACGTG
+TGAGAAATTTATAGATTTTTTCAGGAATATATTTACCAGGCGAAGTTTAATTTCTGATTA
+TAGAGAAATCTATAATCTACTGTGCCAAAAAAAAGAGCATCCCGATATTAAAGGGCCTTT
+CTCTCCAGGACCATTTTCGAAGCGAGATGAAGACTGTACACGATGGCGCCCCCTTCTTGG
+ATATATTAAACTTATTGATGCCTCCAGACCTGAAACAATAGATAAATACACTGTAGAGGT
+ATTAGCACATCAAGAAAATATGTTACTACTACAGATGTTTTACGATGGAGTATTAGTGAC
+CGAGACGGAGTGTTCTGAACGTTGCGTCGATTTTTTAAAAGAAACGATGTTTAATTATAA
+TAACGGGGAAATTACGCTTGCCGCTTTGGGTAATGATAATCTACCGCCGAGCGAGGCAGG
+TAGTAATGGAATCTATGAGGCTTTTGAGCAACGTTTGATAGGCTTCCTGACCACGCCCGC
+CACGGCGTCTGGTGATGAGAGCGGCGCTATTGATCAGACGGATGCATCACAACCAGCGGC
+AATAGAGGCGTTTATTAACTCGCCGGAGTTTCAGAAAAATATTCGCATGCGTGATATTGA
+AAAAAATAAAATAGGTAGCGGAAGTTATGGGACAGTCTATCGGTTACATGATGACTTTGT
+TGTTAAGATTCCAATTAATGAGCGGGGAATAAAAGTGGATGTTAACTCTCAGGAACATCG
+TAATTGTCATCCTGAGCGTGTCAGTAAGTATTTGAATATGGCCAATGGCGACAAGAATTT
+TTCTCGTTCGGCCATCATGAATATTAATGGTAAAGACGTTACGGTTTTAGTTTCAAAATA
+TATTCAAGGTCAGGAGTTCGATGTTGAAGATGAAGATAACTATCGAATGGCGGAGGCGCT
+TCTTAAATCCCGGGGGGTTTATATGCATGATATAAATATCTTAGGTAATATTCTGGTTAA
+AGAGGGGGTTCTTTTCTTTGTGGATGGCGATCAAATCGTGTTATCACAAGAATCACGGCA
+ACAGCGAAGCGTTTCTCTTGCAACAAGGCAACTGGAAGAGCAAATTAAGGCCCATCACAT
+GATAAAATTAAAGCGGGCCGAGACCGAAGGAAATACTGAAGATGTTGAATATTATAAGTC
+ACTTATTACGGATCTTGATGCGTTAATCGGAGAGGAAGAACAGACACCTGCGCCAGGAAG
+ACGTTTTAAACTAGCCGCGCCGGAGGAAGGGACTCTTGTGGCTAAGGTATTAAAGGATGA
+ATTAAAAAAATAGCATTTAGTTCCGTTCTTTTCTGCGAATCGCCGGGGGCACATTCGCTA
+CAGATTTACCGATCAATTATTGAGAGTTGCTATTCGCTTAAAGGTCGTTCGGGGGATCTG
+GACAGCCTGTAGCGGAGATGCAACTCGCCACTAGGGTTGGCGATGCCGCGCTGCCATAGT
+GGGTGAAATGCCTCGCAATGGTGTAACAACATTAACTCGCCTTGATTTTTCCCCTCTGCC
+TGACAAGAAAAACCTGGCTTTACGGATGGTCTCATGCCGTCGTATTAGCGTTGTTCGGCG
+TAGTATGTAAATTTCCTTATAGCAATAGAGGAACATTCTCAAAACATAAAATTAGCAAGT
+TATCATGAAGTTAACATATATTGTTTTTTTCGATCATTTTTTATATATTGATCGTTTTTA
+TTGATTGATTTGCGTTAAAAGCGCATTATCAGGGAGTTAAGATCAAGTGGAGTGGTCACA
+TGCGCTATTTTTTTATGGCAGAGCCGATAAGGGCAATGGAGGGGGATTTACTGGGTGTCG
+AAATCACTACCCATTTTGCATCGTCGCCCGCTCGTCCGCTACACCCTGAGTTTGTTATCT
+CGTCATGGGACAATTCGCAGAAGCGCCGTTTTCTGCTTGATCTGTTGCGGACAATCGCGG
+CCAAACATGGCTGGTTTCTACGCCACGGCCTATTCTGTATCGTAAATATTGATCGGGGTA
+TGGCGCAGCTTGTCCTTCAGGATAAAGATATTCGCGCATTACTACACGCCATGCTATTTG
+TGGAGCTGCAGGTCGCTGAACATTTTTCATGTCAAGATAACGCCTTAATCGATCCTTTAA
+TACACGCGCTTCATAAGCAACCTAATCCATTATGGCTGGGCGACCTGGGCGTAGGGAATG
+CAACTGCTGTGCCATTAGTTTGCGGGTGTTTTAGCGGCGTAAAACTTGATCGCAGCTTTT
+TTGTCTCACAAATTGAAAAAATGACGTTTCCGCTGCTTGTCAAACATATCCGGCGTTATT
+GTGACAAGATCGTGGTGGGGGGCCAGGAAAACACACGCTATTTGCCGGTGTTAAAAACGG
+CAGGCATTTGGGCAACCCAGGGCACGTTATTTCCTTCCGTTGCGTTAGAAGAGGTTGAAA
+CATTGCTGTTGGGCAGTCGCATGAACACCCTCAGAGAATCGAACTGAGGGTATTTGTTTC
+GCTTAGCGATCCTTTCGCCATGCGTCAGCGGTCAGCGCCTCGCCAAAATGGCCTGCGATT
+AAACGGCGGGTAAGCTCATGTAGCGGAGAGGCGAGCACATCGGCGGTGCTGCCGCGTTCA
+ACCACTTCCCCCTGATGCATCACTAATACCTGATCGCTAATATGCTTCATCATGCCGATA
+TGCTGCGTGACATAGATATAGGAGATGCCTTGCTTTTCCTGCAATTCAAGCATCAGATTG
+ATGAGCTGCGAGCGCATGGACATATCAAGCGAAGCCAGCGCTTCGTCCGCGATAATGACT
+TTAGGGCGTAAAATCAGCGCGCGGGCCAGGCCCAGACGCTGTTTCTGCCCCGGCGCCAGC
+ATATGCGGGTAGTAGCTCACGTGATCGGGCAATAGCCCCACCATACGCATCGTCTCGACA
+ATCTGTTTGCGCCGCTGTTCCGGCTCCAGATCGGTATTAAGGCGCAGGGGGAAGTCAAGG
+ATCTGCGAAATACGTTGACGTGGATTCAGTGACGTTGAGGGGTCCTGAAAAATCATTCGA
+ATACGTTGGCTTCGAAACGAATAGTCGCCGTAATGCAGGGGATGATCGTCAATAAGAAGC
+TCGCCGCTGGTGGGTTCAATCATGCCGGCCAGCATCTTTGCCAGCGTGGATTTGCCGGAA
+CCGTTTTCGCCGATAATGGCCAGGGTCTGACGCTCACGAAGCGTAAAGCTTAATGGTTTC
+ACGGCGTCGACGGTCTGGCGGCGAAACCATCCTGTCCGGTAGCGAAAGGTTTTACTCAGG
+TTGCGCACTTCAAGCAGAGTTTCCACCATATCACTCTCTCTCCATATTCAGCGGAAAATG
+ACAGGCATAGAGATGATTTTTCGCGCCGGTTAAGCGTGGCGTGATAATGCATTCTCGTTG
+CGCGTAAGGGCAGCGCGGCCCCAGACGACAACCTATCGGTAACTGCTCCAGTAGCGGGAT
+CGCGCCCGGCAGCGTATTGAGACGGCTTTTATGCGGCATCGCGCTGCCAAAATCCGGAAT
+CGCACGGATAAGCGCCTGCGTATAAGGATGATGTGGCGTCGTCACCAGATCTTTACTTGG
+CGCGGTTTCTACCGTCTGGCCGCAGTATAAAACGTTGATTTTGTCAGCCCACTGACTCAG
+CATTTGCAGGTCGTGGCTAATCAACAGAATGGTGGTATTACTGTTTTGATTCAGTCGCGT
+CAACAGGCGAAAAATTTGCGCCTGCGTCGTCGGTTCCATTGAGTTGGTGGGTTCATCAGC
+GATCAGGAGTCGCGGTTGATTCGCCAGCGCGATAGCGATCATAACTTTCTGACACTCGCC
+ATCGGTCAGTTCATAGGGAAAACTGCGCATCGCGTCTTTATGATCTTTAATTCCCACCCG
+GTGCAGTAATTCAATTGCACGCCGTTTACGCCAGCCTAAACGCTGCCACCAGCGGCCTTT
+ATAGGTCCAGGCGGGAATATTTTGCATTAACTGGCGGCCGACGCGTTCGGAAGGATCAAG
+GCACGACTGCGGCTCCTGGAAGATCATCGACACATTATGTCCGACCAGCTTACGCCGTTC
+ACGTGAGGAGAGGCGCAGCAGATCGATATCATCAAAACGCATACGGTCGGCAGTGACTCG
+CCAGTTGTCTTTCGCGACGCCGCAAATAGCTTTAGCAATCAAGCTCTTTCCGGAACCCGA
+TTCACCTACCAGGCCGCGAATTTCACCTTCGCTTAATGTCATACTGACGCGATCGACCGC
+TTTTACCCAACCTTCGCTGGTTTTAAATTCAATGGTGAGATTGCGGATATCCAGTAACGG
+CATTATTCCACCCCCGCAATAATCGCACGACGAATCCCATCTCCGAGCAGGTTTACCAGT
+AAAACACTGAGCGTTATCGCCGCGCCGGGTAGCATAACGGTCCACGGCGCGACATAGATT
+AGCTCCAGCGCATCCCCCAACATGGCGCCCCATTCAGGAGAGGGAAGCTGCGCGCCGAGA
+TCTAAAAATCCCAGCGCGGCGATGTCCAGAATCGCCATCGACAGCGCCCGGGTAATTTCG
+GTGACCAGACCGGCGGTAATATTCGGTAAAATGGCGAACCACAGAATATTCAGCGTTGTC
+GCTCCATCCAGACGGGCGGCAATGACGTACTCTTTTTCCAGTTCATCATGCACCATGCTG
+TAGACGGAACGTACCATTCGCGGCAACAGGGCCAGCCAGACGGCAAACATCGCGTGTGAC
+AGATGTGGGCCGGCAAATGCCACGACGATAATCGCCAGCAAGAGCGAAGGGATGGAAAGC
+AGCGTGTCCAGAATATGGTTCAGCACGGCAGAGCGTAAACCGTGCGTCGCGCCTGCCACT
+ACGCCGAGGACTAATCCACATAGCGTAGCCGCCAGCGTTACGATAAACGCGCCGCCGACC
+GTGGGCGCCGCGCCGCTTAACAGGCGGCTCAGCACATCGCGCCCCAGATCGTCAGTCCCC
+AGAAAAAAGGAGACTTCGCCATAGCGTGACCAGGAGGGTGGCAGTAGCTGATAGCCCAGA
+AATTGCTGATCGATACCATAGGGCGCGATCCAGCCGCCAAAAATACACAGCAACGCCAGA
+CCGGCGCATCCATACAGACCCACCATCGCAGGCGCGTCGCTATAAAATTTACGCCAGGCA
+GTGCGCAGGGTGCCTGGCGGGCGCTTTTCGCTGTATACGCTATCGTAAGGCATACCATTC
+CTTATGTTTCAGATGGTTAGCCATAGCACCCAAAATATCGGAAATCACATTGACCACAAT
+AACCAGCGACCCAATGACCATCACGCCAGCGGAAATAGCGGCATAGTCCTGCTGACGAAT
+GGCGTGAATTAACCATCGTCCCAGCCCAGGCCAGCTGAAAACCATTTCGGTAATCATCGC
+CAGCGTTAACATGGTTGAAAACTGCAGACCAAGACGGGGAATGACCGGCGGCAGCGCATT
+ATGCAACACGTGACGGCGTAAAATCGTAAAGCGCGATAAGCCGCGCGTGGCCGCCGCTTT
+AACGTAGTTCTGATCGTAGACCTCAATAGTGCTGATTCGCATCAGGCGGATCACTTCTGT
+GGTCGGCGCGACGGAGAGCGTGAGCACCGGTAAAACCATATGCCGTATGGCGCTCATCAC
+CATTTCATCACGCCATGGCGAATCTGAAATCCAGGCGTCAATGATGGCGAAACCGGTAAC
+CGGTTTAACTTCATAAAGCAGGTCAAATCGCCCGGATACCGGCAGCCACCCCAGCGTGAG
+CGAAAAGAACAGTGTGAGCAGAAGCGCCAGCCAGAAAACCGGAATTGAGAAACCTAATAG
+CGCCAGCGCGCTGATAAAACGATCCGGCCATTTGCTACGCGTCACGCCAGCCAGCATCCC
+GACCGGGATGCCGACCATCAGCGCAAAACCAAAGGCGAGAATGCACAGCTCCATCGTGGC
+GGGAAACACCTCTTTAAGCTGTTCGGAGATCAGCTGGCCGTTAATGCTGGACACGCCAAA
+GTCCCAGTGCAGCAGACCGTTGAACCAGAAAACCCAGGCATTCCATAATGATGCGCCTTG
+TAGCGGCGCGTGCGGCGTAAAATAGCTCAGGCTAAAGCCGATAAAGGTCAGGAAGAATAG
+CGTCACCAGCAACAGCAATAACCGACGCAGGGTGAAGATAATCATGGTTTTTTCACCTCT
+TCGTGTTTTTCGCGGGAGACGCCGGCAAAAGACGCATTGCCGAACGGGCTTAACACCAGC
+CCTTTAATATCGTAGCGGTAAGCCTGCAGGCGTAGTGATGATGCCAGCGGCAGTATCGGC
+AGCTCTTTCTCCAGGATATTCTGCGCTTCCTCATATGCTTCTATGCGCGAAGCCAACTGC
+TGCGACGACAGTGCTTTACGCAGCACGCTGTCAAATTCAGGGTTACACCAGTGGGCGAAA
+TTGGTTTGCGAATTGATGGCCGCACAGCTTAACAGTGGTCTGAAAAAGCTATCCGGATCG
+TTGCTGTCCGTGGCCCAGCCGGATAAGGTCAGATCGTGATTCATATCCATCAGGCGCGCC
+TCCTGAAAACGACCTTCAACCGGCACAATGACCACTTTTACGCCAACCTGCGCCATATCC
+GCCTGAATAAGCTCCGCCGTTTTTAGCGGACTTGGGTTCCAGGCCTGAGAACTGGTCGGC
+ACCCAGAGATGCAGCGTAAGATTCTCAATGCCCAGCGCTTTTAGCTGTTCGCGCGATTTT
+TCCGGATTGTACTCCGTAATTTTGGCATCGTTATCGTAAGCCCATGAGGCTCTCGGTAAA
+ATGGAGGCTGCGGTTTCCGCCGTGCCGTAATAAATCGACTGCATCAGACGCTGGTTGTTG
+ATCGATAAGGCCAGCGCATGGCGCACTGCGGGATTATTCAACGGCGGCTTATCGGTGTTA
+AAGGCCAGATAGGCGATATTCATCCCCGGGCGCAACGTCAGACGTAAACGCGGATCGTCG
+CGTAAAATAGTTAGCTGGCTGGCGGCGGGCCAGGCCAGAACATCGCATTCACCGGTCAGT
+AATTTCGATAAACGCCCGGTACCGCCGGAGCCTAAATCCACTACCACTTGCGGCATCAGC
+GGTTTGCCGCGCCAAAACCCATCGTGGCGCTGGAGACGAATAAACTGTCCGGCACGGTAC
+TCCGAAAGCTGGAAAGGCCCGGTGCCGACCGGTTGGCGGTCTAGCAGTTCCTGACGATCT
+TTTCGGCTAAGCTGCGCGGCGTACTCAGCGGACATGACGGAAGCGTAGTGTGTAGCCAGA
+TGCCATAAAAAGGAGGCGTCTGGCTGCGTCAGGCGAAACTCAACGGTGTTATTGTCCAGC
+TTACGCACGCTTTTTACATTGTCGGCGAACTGTAGGCTATCAAAGTAGGGGAAGCTACTG
+CCGTTGATGTTATGCCACGGATGCCGACGATCAAAAATCCGCTGAAAGGTAAAGACGACA
+TCATCAGCATTGAGTTTTCGGGTCGGCGTAAACCAGGCGGTTTTTTGAAAGGAAACGTCG
+CGGCGCAGGTGAAAACGGTACGTTGCCCCGTTATCCAGCACTTCCCAGCTTTCTGCCAGC
+TCTGGGACTAAACGATAAGTATAGGGATCGACATCCAACAGGCGGTCATATAACTGGGCT
+GCCAGGGTATCGACGATGAGGCCGCTGCTCGCTTTTTGCGGATTAAAGGTGTTGACCTGC
+CCGCTGACACAATACACAAAGCCGCTATCGCGAATATCTGCACTCGCAGTTTGTTCGGGC
+GCAGCCGCAGCCGTAGCCTGACTACTCAGTAGACCCGCTATCACGATCAGAGACGATAAA
+ACCAGGCGCATAATAGTTAAGTTTTTGAAGTTCAATTTGCAAAGTGTATCGCACTTCGGC
+CCGCCACGTAAAAATGTCGGTGGATAACTGGCGTAAATGTCGTCAATTAGCCGGAGAAAT
+AGCTAAAGCTGATGCTTTTTAAGCAAGGCGCGAAACTGGTGGTAGGTGAGTGCCAGCAAA
+TCGGCGGCTCGTTTCTGGTTAAATTTCGCCTGTTGTAAGCTACGTTGCAGCAGCGCTTTT
+TCCTGTTGCAGTTGAAACTCCCGCAACTTGAGCGGCAGGTCAGGCGTGGCGGATGCCGCT
+GGCAGGGCGGGCGTGGGCGGTTCGGCGGAATGGCGTTGAAAAGGATCGATAACAATTTCA
+TCCAAAGGATGTTCACTGCTGCCGTGGCGATACACTGAACGTTCGACTACGTTTTTCAGC
+TCGCGGACATTACCCGGCCAGGCGTAATGCAACAACGTTTCTTTTGCCCGATCGGTAAAA
+CCGGGAAATAAGGGCAGACGTAGCTCACGACACATCTGAATAGCAAAATGCTCGGCTATC
+AGCATAATATCGCTTTGACGTTCGCGCAGCGGCGGCAGTTGTACAACGTCAAAAGCCAGC
+CTGTCGAGCAGATCGGCACGAAATGTTCCTTCCTTTACCATGGCGGGTAAATCGGCATTG
+GTGGCGCATACTAATCGCACATTAACCTGTAACGGCTGGCTGCCGCCGACGCGCTCTAGC
+TCGCCATATTCAATCACCCGCAGTAGCTTTTCCTGTACCAGCATTGGCGCTGTCGCCAGT
+TCATCCAAAAACAGCGTGCCGCCATCGGCGCGTTCAAAGCGACCGGGATGGCGTTTTTGC
+GCCCCGGTAAAAGCACCCGCTTCATGACCAAACAGTTCGGAGTCCAGCAGATTTTCGTTA
+AGCGCTGCGCAGTTAAGCGAGATAAGCGGCCCCTGCCAGCGTGAAGAGAGATAGTGCAGG
+CGATTGGCGATAAGTTCTTTACCCGTACCGCGTTCGCCAATAATCAGCACTGGCTTATCC
+AGCGGCGCGAGCCGGGAGACTTGTTCCAGTACTTCAAGAAAACGGTTTGCCTCGCCGAGC
+AGGTTATCTTTAAATTCAGCCATGATGAAAATCGCCACTTGTTAGTGTTTTTCACCACTT
+TATCCTTTTTTGCTGGCGAGGTAAAACGAAATAATTCCTTTACTATCAGTGGTATAAAAA
+GTTGGCACGCAAATTGTATTAACCATGTAGCAGGGCATCGCCCGTTATCAGAACATTATG
+TGAGGATTGAATTATGGGTATTTTTTCTCGTTTTGCCGACATCGTGAACGCCAATATCAA
+TGCGTTGTTGGAAAAAGCGGAAGATCCGCAGAAGCTGGTGCGCCTGATGATTCAGGAGAT
+GGAAGATACGCTGGTGGAGGTTCGCTCGAACTCCGCGCGTGCTTTAGCGGAAAAGAAACA
+GTTATCCCGTCGCATTGAACAGGCTACGGTTCAGCAGACCGAGTGGCAGGAAAAAGCGGA
+ACTGGCTCTGCGCAAAGATAAAGACGATCTGGCGCGCGCCGCATTGATTGAAAAACAAAA
+GCTGACCGATTTAATTGCTACGCTTGAACAGGAAGTCACGCTGGTGGATGACACGCTGGC
+GCGCATGAAGAAAGAGATTGGCGAGCTGGAAAACAAACTCAGCGAAACACGCGCTCGCCA
+GCAGGCGCTGATGCTGCGTCATCAGGCGGCGAGTTCTTCCCGCGATGTCCGTCGTCAGCT
+TGACAGCGGCAAACTGGATGAAGCCATGGCGCGGTTTGAATCCTTTGAACGTCGTATCGA
+TCAAATGGAAGCGGAAGCGGAAAGCCATCGTTTTGGTAAGCAGCAATCGCTGGACCAACA
+GTTTGCCAACCTGAAAGCCGATGATGAAATCAGCGAGCAGCTGGCGCAGTTGAAAGCCAA
+AATGAAGCAAGATAATCAATAATGACAATGGCGGCGCCGATACGCGCCGTCGCTCATCAG
+CTTTAGGTGTAAGGAGAACGCATGAGCGCGCTATTTTTGGCCATCCCGTTAACCATTTTT
+GTGTTGTTTGTGTTACCGATTTGGCTGTGGCTGCATTACAGCAACCGCGCCGGTCGGGGA
+GAACTGTCGCAAAGCGAGCAGCAACGCTTACTGCAACTCACAGACGATGCGCAACGTATG
+CGCGAGCGCATTCAGGCGCTGGAAGACATTCTTGATGCAGAGCATCCGAACTGGAGAGAG
+CGCTAATGGGTGGAATCAATCTGAATAAAAAACTATGGCGTATGCCGCAAAAGGGCATGG
+TGCGTGGCGTTTGCGCCGGGATCGCCGACTACCTTGATGTACCGGTAAAACTGGTGCGTA
+TTCTGGTCGTGCTGTCGATTTTCTTTGGGCTGGCGTTTTTTACCGTAGTGGCCTATATCG
+TTCTGTCTTTTGTACTGGACCCTATGCCGGATAATCTGGCCGCAGGCAAACCGCAGCCGA
+CCAGCGGCGAACTGCTGGATACCGTAGACAGAGAGCTTGCCGTAGGCGAAAAGCGTTTGC
+GAGAAATGGAACGCTACGTCACGTCAGATACGTTCACACTGCGTAGTCGTTTCCGTCAAC
+TTTAAGTGTTATATCGGGAAGGTGAAGATGAATACTCGCTGGCAACGCGTCGGGCAGAAG
+GTGAAGCCCGGCTTCAAAATAGCAGGTAAGCTGGTTCTGTTGACCGCGTTACGCTACGGG
+CCTGCCGGCGTGGCGGGATGGGCGGTAAAATCCGTCGCCCGTCGTCCGCTAAAAATGTTG
+CTGGCGTTTGCGCTGGAGCCAGTACTTCGTAAGGCGGCGAATAAAATTTCGCAGCGTTAC
+AAATAGCGAGTCTGGTCATAATATTTCGTTAAGCTCTGGCGTATAGTGTGTGCGAAATAC
+ATTACGTGTCAGGACGGAAGTATGTTGAAAAAAGGAATATTTGCGTTAGCGTTATTCGTA
+GCCATGCCGCTTTATGCCGCAGAATACTGGATAGATGTCCGCATTCCGGAACAATATCAG
+CGTGAGCATATTCAGGGCGCGATTAATATCCCATTGAAGGAGATTAAATCTCATATCGAA
+ACGGTAGTTCCAGACAGGAACGATACGGTAAAGTTATATTGCAACTCCGGACGACAGTCG
+GGCATGGCAAAACAAATGTTGCTTGATATGGGGTATACGCACGCGATGAATATGGGCGGC
+ATCAGTCGTCTTGATATGCCGAAAGTAAAAAAATAGATAATCTATTGCTCAATACTCATA
+CTAACCGCGGCGCTTAATGCGCCGTTGTTGATCTCTCCGGGTAGTTGATAATAACGTTTT
+TGCACATATCTATAACGCAGGCTCGTTATTATTTTTTCTTCTCTTCAGGCTCAACAGGAT
+GTCAATGAAGCGACTTAAAACTGAACTCAACGCGCTGGTCAATCGTGGGGTAGACAGGCA
+TTTGCGTCTTGCCGTAACCGGGTTGAGCCGCAGCGGTAAAACAGCGTTTATCACGGCGAT
+GGTTAACCAGTTGCTTAATGTCCACGCGGGCGCGCGCTTACCGTTGCTCAGCGCGGTACG
+CGAAGAACGCCTGCTTGGCGTAAAGCGCGTGCCTCAACGTGATTTTGGTATTCCCCGTTT
+TACCTACGATGAGGGGATACTTCAGCTTTATGGCAATCCTCCCGCATGGCCCACACCGAC
+GCGCGGCGTCAGTGAGATTCGGCTGGCGTTGCGCTATCGCTCCAACGACTCGCTGCTGCG
+CCATTTTAAAGATACCTCGACATTGTATCTGGAGATTGTGGACTATCCAGGGGAATGGTT
+ACTCGATCTGCCCATGCTGGCTCAGGATTATTTAAGCTGGTCCCGTCAGATGAACGGCTT
+GTTACAAGGACAACGCGCTGAGTGGGCCGCAAAATGGCGGCAACTTTGCGACGGGCTCGA
+TCCGCTGGCACCCGTCGATGAAAACCGGCTGGCGGAGATTGCCGCCGCCTGGACGGATTA
+TTTGCATCAGTGTAAATCGCAGGGATTGCATTTTATTCAACCTGGACGGTTTGTTTTGCC
+GGGCGATATGGCGGGTGCGCCAGCGTTGCAGTTTTTCCCGTGGCCGGATGTGGACGCCTT
+CGGCGAGTCAAAACTGGCGCAGGCGGATAAACAGACCAACGCTGGAATGCTGCGCGAACG
+CTTTAACTACTATTGCGAAAAAGTGGTCAAAGGGTTCTATAAAAATCATTTTCTACGCTT
+TGATCGCCAGATTGTACTGGTCGACTGTCTGCAACCGCTTAATAGCGGGCCGCAGGCGTT
+TAATGATATGCGTCTCGCCTTAACGCAGTTGATGCAAAGTTTTCACTATGGCCAGCGGAC
+TCTGTTTCGCCGCTTGTTTTCGCCGGTGATTGATAAATTGCTGTTCGCCGCGACGAAAGC
+CGACCATGTCACCCTCGACCAACATGCCAATATGGTGGCCTTGCTCCAGCAGCTTATTCA
+GGATGCCTGGCAAAATGCCGCGTTTGAAGGCATTAGTATGGATTGCCTAGGGCTGGCGTC
+GGTACAGGCGACCACCAGCGGCGTGATTGAGGTCAACGGTGAAAAAATCCCGGCTTTACG
+TGGAAACCGTTTGAGTGACGGCGCGCCGTTAACCGTGTACCCCGGCGAAGTGCCTTCGCG
+TTTGCCGGGACAAGCGTTTTGGGATAGTCAGGGTTTTCAGTTCGAAGCCTTTCGTCCGCA
+GGTGATGGATGTTGATAAACCGTTACCACATATTCGTCTGGACGCTGCGCTGGAGTTTTT
+AATAGGAGATAAGCTGCGATGAGCGAACCGTTAAAACCGCGTATTGATTTTGCAGAACCG
+CTAAAGGAGGAACCTACGTCGGCCTTCAAAGCGCAGCAAACTTTTAGCGAAGCGGAGTCG
+CGTACATTTGCGCCTGCAGCTATCGATGAGCGCCCGGAAGACGAAGGCGTGGCAGAAGCG
+GCGGTCGATGCCGCGCTGCGCCCCAAACGCAGTCTGTGGCGTAAAATGGTGATGGGAGGG
+CTGGCGCTGTTTGGCGCGAGCGTGGTCGGGCAAGGCGTACAGTGGACAATGAATGCCTGG
+CAAACTCAGGACTGGGTCGCTTTAGGCGGCTGTGCCGCAGGCGCGCTGATCATTGGCGCT
+GGCGTGGGATCGGTGGTCACGGAGTGGCGGCGATTATGGCGCTTGCGCCAGCGGGCGCAT
+GAGCGCGATGAGGCGCGTGAACTGTTACATAGCCATAGCGTCGGGAAAGGTCGCGCATTT
+TGCGAAAAACTGGCGCAGCAGGCGGGGATTGATCAATCACATCCGGCATTACAACGTTGG
+TATGCCGCTATTCACGAAACGCAAAACGACAGGGAAATCGTCGGCTTGTATGCGCATCTG
+GTACAGCCGGTACTTGACGCGCAGGCGCGACGTGAGATTAGCCGTTTCGCCGCGGAATCG
+ACTCTGATGATCGCCGTCAGCTCGTTAGCGTTGGTGGATATGGCGTTTATTGCCTGGCGT
+AATTTACGCCTGATTAACCGCATCGCAACGCTGTATGGCATTGAACTTGGTTATTACAGC
+CGCCTTCGTCTGTTCCGTCTGGTGTTGCTGAATATCGCGTTCGCGGGGGCCAGTGAGCTG
+GTGCGTGAAGTCGGTATGGACTGGATGTCTCAGGATCTGGCCGCACGCCTGTCTACGCGC
+GCGGCGCAGGGGATTGGCGCAGGTCTCCTTACCGCTCGACTGGGAATAAAAGCGATGGAG
+CTATGTCGACCATTGCCGTGGATCGATAACGATAAACCACGTCTCGGTGATTTTCGTCGT
+CAGCTTATCGGTCAGCTAAAAGAGACGCTGCAAAAGAGTAAGTCGTCGCCTGAGAAATGA
+CCTTCCACAGGGCGCTGATTGCCTGGCTTTACGCCGCAGCGCCCGTTTTTCCGTCATGCT
+GTCAATATTTGTTGACAGAATCCTTCCTGCCAGCCGAATAGTGGCTTATCATCTATTTAA
+TGGTTCATTATTCAGGTGAAGGTTCCCATGCGTCTGGAAGTCTTTTGTGAAGACCGACTT
+GGTCTGACCCGCGAATTACTTGATTTACTGGTGTTACGTAGCATTGATTTACGCGGAATC
+GAGATTGATCCCATTGGGCGAATTTATCTTAATTTTGCTGAGCTGGAATTCACCGACTTC
+AGCAGCCTGATGGCAGAAATCCGCCGTATTTCCGGCGTAACGGATGTCCGTACCGTTCCC
+TGGATGCCGTCCGAACGTGAACATCTGGCCCTGAGCGCGCTGCTTGAGGCGTTGCCGGAG
+CCGGTGCTCTCATTGGATATGAAGAGTAAAGTGGAGATGGCGAACCCGGCGAGTTGTCAA
+CTTTTTGCCCAGAGCCAGGAGCGAATGCGGCACCATACCGCCGCACAATTAATCAACGGC
+TTCAATTTTCAGCGCTGGCTGGACGGTAACCCGCAAAGCTCCCATAACGAACATGTCGTG
+ATCAACGGGCAAAACTTCCTGATGGAGATTACGCCGGTACATTTACAAAACGAAAATGAC
+GAATACGTGTTGACCGGGGCGGTCGTGATGTTGCGTTCCACGATTCGTATGGGACAGCAG
+CTACAGAATTTGTCCACGCAGGATCTGAGCGCGTTTAGTCAGATTATTGCCGTGAGCGCA
+AAGATGAAGCACGTCGTTGAGCAGGCGCGCAAACTGGCGATGCTCAGCGCGCCGCTGCTG
+ATTACCGGCGATACGGGAACCGGCAAAGATCTTTTCGCCTATGCCTGTCACCAGGCAAGC
+CCTCGTTCAGCGAAACCGTATCTGGCGCTCAACTGCGCTTCAATCCCGGAAGATGCGGTA
+GAAAGCGAACTATTTGGCCATGCGCCGGAAGGTAAAAAAGGTTTCTTTGAACAGGCGAAT
+GGCGGTTCGGTGCTGCTGGATGAAATTGGCGAAATGTCGCCGCGTATGCAGGCGAAGCTG
+CTGCGTTTTCTCAACGATGGTACGTTCCGTCGCGTCGGCGAAGATCACGAAATTCATGTT
+GATGTCCGCGTTATCTGCGCCACGCAGAAAAATCTGGTGGAGCTGGTGCAAAAAGGACTG
+TTCCGCGAAGATCTCTATTATCGACTTAACGTTCTGACGCTTAATTTGCCGCCGTTGCGC
+GATTGTCCGCAGGATATTATGCCGTTGACCGAACTGTTCGTGGCGCGTTTTGCCGACGAA
+CAGGGCGTTCCGCGACCGAAACTGTCTGCCGATCTGAGTACGGTCCTCACTCGTTACGGC
+TGGCCGGGTAACGTTCGCCAGCTTAAAAATGCGATTTACCGGGCGCTGACGCAACTGGAA
+GGGTATGAGCTGCGTCCGCAGGATATCCTGCTGCCTGACTACGATGCCGCGACGGTGGCA
+GTCGGCGAGGATGCGATGGAAGGCTCGCTGGATGACATTACCAGTCGTTTTGAACGTTCT
+GTCCTGACCCAGCTTTATCGTAGCTATCCGAGTACGCGTAAACTGGCGAAACGGTTGGGG
+GTATCGCATACCGCGATTGCCAATAAGCTGCGTGAATATGGTCTGAGCCAGAAGAAGGGT
+GAAGAGTAGAAAAAAAGAAGGCCTCCGGATAGAGGCCTTCTTGTGACAAAAGAGCACCGC
+CTGTAGTACTGACAAACGTAGCGCCAGCAGGCGCTGGCTTATGCCTTCAGGACATTAAGC
+GCGGCGTCGTAATCCGGCTCGTGGGTGATTTCATCCACCAACTGGCTGAAAATAACGTTG
+TCGTTTTCGTCAAGCACGATGACTGCGCGCGCCGCCAAACCTTTCAGCGGGCCGTCAACG
+ATTTCGACGCCGTAGTTTTTCAGAAACTCGTTATTACGCAGAGTGGAAAGCGTAATAACG
+TTGCTCAGGCCTTCCGCGCCGCAAAAACGCGACTGTGCAAAAGGCAGGTCAGCAGAAACG
+CACAATACGACGGTATTCTCCACTTCTGTGGCCAGTTGATTAAACTTACGAACTGATGCG
+GCGCATACGCCAGTATCAATGCTTGGGAAAATATTCAGCACTTTGCGTTTGCCTGCATAT
+TGGCTGAGGGAAACGTCAGACAAATCTTTTGCGACAAGAGTAAAAGCCTGTGCTTTGCTA
+CCAGCCTGCGGAATAACGTTGGCAACGGTGACCGGGTTACCCTGGAAATGTACAGTCTGT
+GACATAATTATGTTCCTATTTACTTATAGTTAACGTCGAAATCCAGTTTAAGTCATTATT
+CATTAACACGGCAAATACTATTTGTAGCAAGCCGCGTCCGGCGCTATCAGAGGGGAAGAG
+ATGAGATCTGTTAAGGTATATGAGGAAACCTGGCCGTTACATACGCCTTTTGTTATTGCG
+CGTGGTAGCCGAAGCGAAGCGCATGTTGTCGTTGTCGAACTGGAAGAAGAGGACGTAAAA
+GGCATCGGGGAATGTACGCCATATCCACGTTATGGTGAAAGTGATGCCTCGGTCATGGCG
+CAAATCATGAGTATTGTGCCTCAGTTGGAAAACGGGCTGACTCGCGAAGCATTGCAGAAA
+CTGTTGCCGGCAGGCGCGGCGCGCAACGCGGTGGATAGCGCCTTATGGGATTTGCAGGCC
+CGCCAGCGGCAGCAAAGCCTTGCCGGGCTGCTCGGCGTGACGCTGTCCCCGGTTTTTACT
+ACCGCGCAAACGGTAGTGATAGGTACGCCGGAACAGATGGCAGCCAGTGCGGCGGCACTA
+TGGGAAAAAGGGGCGACGTTGCTGAAAATTAAACTCGATGCTCGTCTGATTAGCGAACGT
+ATGGTGGCGATCCGCTCGGCGGTGCCGGAGGCGACGCTCATTGTGGACGCCAATGAATCG
+TGGCGTCCGGAGGGGCTGGCGGCGCGTTGCCAGTTACTGGCGGATCTGAATGTCGCGATG
+CTGGAGCAACCGCTGCCCGCGCAGGATGACGCCGCCCTGGAAAATTTTATTCATCCGTTG
+CCCATCTGTGCAGATGAGAGCTGCCATACTCGCAGTAGTCTGAAAGCCCTGACGGGGCGC
+TACGATATGATCAACATTAAGCTGGATAAAACCGGCGGTCTGACTGAGGCGCTGGCGCTG
+GCAACGGAGGCGCGGGAGCAAGGATTCGGCCTGATGCTGGGCTGTATGCTCTGTACATCA
+AGAGCGATTAGCGCCGCGCTGCCGCTTATGCCGCAGGTGAGCTTCGCCGATCTTGATGGC
+CCAACATGGCTGGCGGTTGATGTTGAGCCCGCGCTACGCTTTACGACGGGTCAACTCCAT
+CTTTAGGATGCCAGCGGAGCAGATTCGACATAGCCAGCAAGTATTTTTCGCTGGCTTCAT
+CGGCAGAAACAGGGGGAAACTCGGCGGTAATGCAGTGCAGGTTGAGGTTGGCGCACCAGC
+TGCCAAACGAACCGGGCGTTTCGTAACCTACGCTGGTCACCAGCGGCAACGCAAACGCAT
+CGGCCAGCCACTCGCCTAGCTCGCTGCGACGTGGATCTTCAATGCAGGCTAGCGGATCGT
+GAAAAGAGACGACCCAGGCGGGTTGGAGTCGATGAATTAACTGGCAAAGCGCCTGGGTTT
+CCGGTTCTGAGCCGGGATGGTCGCCGGTTAGCAGCACGACATCACGCTCTTGCGCGCGGC
+TATTCCAGCGATAAACTGTCTCACCCGCTTTCCAGTTGGCGGCGGGAAAGTTACGGTTTA
+GATCAACGCCATTCGCATTTGCCCTTAACCCCAGTTGACAGCCATCAGGATTAACGGCAA
+GTACGACATGATGACGGCGAAGGGTTGGATTTAAGGTGCGTAACGCACAGGAGAGCGTCA
+CCACGGATGAGGTTTCATCCCCGTGGGTGCCAGCCAGTATCAGACCGCTTTCGCGATTGG
+CTGCAGGTGCCGGAAACCAGATTAGCGGCGCGCCTAGTAGCGAACGTCCATAATGTTCAG
+TGCCTGGCGGAAATGCGCCGCGCTCGGCACGGGGGCGGGTGACAGTCATACGCGTTTCCC
+GAAGCTGAGACCAGTAGGGTAATCATCGTAGTGTTGTGTAAAACCCGCCGATTATCAAAT
+GGTTTCTATTTACCCTCTTGTATGGCGCGATATCAACTTTCTGGCGGAAGATAATTGCAT
+TTCTTTTTGCTGAAACAAATAATTACGTTGTCATTTAACTCATCTTTGAGGAACTTCTAT
+GAGACATTCTGTTTCAGTAACCTGTTGTGCGCTGTTGGTTAGCAGCTTTTCCCTGGCATA
+TGCTGCGGATGTTCCCGGCGGAACGGTACTGGCAGAAAAACAAGAACTGGTGCGTCATAT
+CAAAGATGAGCCCGCTTCGTTAGATCCAGCGAAAGCCGTTGGGCTGCCTGAAATTCAGGT
+GATCCGCGATCTGTTTGAAGGGCTGGTTAACCAGAACGAAAAGGGTGAAATTATCCCTGG
+CGTCGCCAGCCAGTGGAAGAGCAATGATAATCGTATCTGGACGTTTACGTTGCGGGATAA
+TGCGCAATGGGCCGATGGAACGCCGGTGACCGCCCAGGATTTTGTCTATAGCTGGCAACG
+TCTCGTTGATCCCAAAACGCTTTCCCCCTTCGCCTGGTTTGCCGCGCTGGCTGGCATCAC
+TAATGCGCAAGCCATTATCGACGGTAAAGTCACGCCGGATCAGCTTGGCGTCAGTGCCGT
+GGACGCGCACACTTTGCGTGTTCAGCTTGACAAGCCGTTGCCCTGGTTTGCCAGTCTGAC
+CGCCAGTTTTGCCTTTTATCCGGTCCAAAAAGCGAATGTCGAAAGCGGCAAAGACTGGAT
+GAAGCCGGGAAAACTGATTGGCAATGGCGCGTATGTGCTTAAAGAGCGCGTGGTAAATGA
+AAAACTGGTGGTCGTGCCTAATACGCATTACTGGGATAACGCGAAAACGGTACTGCAAAA
+AGTAACATTTTTACCCATTAACCAAGAATCGGCTGCGACGAAACGTTACCTTGCCGGTGA
+TATTGATATCACCGAATCTTTCCCTAAAAATATGTACCAGAAATTATTGAAGGATATTCC
+AGGGCAAGTTTATACGCCGCCGCAATTAGGGACTTATTATTATGCGTTTAATACGCAGAA
+AGGGCCGACGGCGGATTCCCGCGTTCGTCTGGCGCTAAGTATGACCATTGATCGCCGTTT
+GATGGCGGAAAAAGTCTTAGGTACCGGTGAAAAACCGGCCTGGCATTTTACACCGGATGT
+CACGGCAGGATTTAAGCCCGATCCTTCACCGTTTGAACAAATGAGCCAGGAAGAACTTAA
+CGCCCAGGCGAAAACATTGCTGCGTGCAGCAGGCTACGGATCGCAGAAGCCGCTTAAATT
+AACTCTGCTTTACAATACCTCAGAAAACCATCAGAAAATCGCGATTGCGGTGGCGTCAAT
+GTGGAAGAAAAATCTGGGGGTGGATGTGAAATTGCAAAACCAGGAGTGGAAAACGTATAT
+CGACAGCCGGAATACAGGTAATTTTGATGTTATTCGCGCCTCCTGGGTGGGTGATTACAA
+CGAACCGTCGACTTTCTTATCCTTATTAACGTCCACGCATACGGGGAATATTTCACGCTT
+TACTAATCCGACTTATGACAAAATCCTGACGCAAGCGACGATGGAAAATACCGCCGAAGC
+GCGTAACGCGGATTACAATGCAGCGGAGAAAATTTTAACGGAACAAGCGCCTATAGCGCC
+TATTTATCAGTATACCAATGGCCGGTTAATTAAACCGTGGGTAAAGGGATACCCCATTAC
+TAACCCGGAAGATGTGGCCTATAGCCGTACAATGTATATCGTGAAGCACTGATGCGTACT
+GGTTTCTTGTTAACTCAAGGTAGCCAAGCCCGCCGCCTGATGCTGGCAGAAGGCATGGGG
+ATTAAGCGAGCGCCTGATGCCGCCGTTCTCATTGCTGTGTTTTCAGCCAGGCGGCAATAT
+CCTGTGTCGGCAGATGATGTTGTGCATTCCAGGTGTCACTCATCGGCCACCACATACCGT
+CACCACGCGCGAAGGCGACGCGATAGCGCAGCATTGGGTCATGCGGATGTAAACGGAGCT
+GCTCCTGTAAGTCAGGTAGCGTCAATACGCCTCGGGTAAAAGTTTGCTGCGTCACGCGTT
+CGACCGTTTCCGCCAGTTTTGCATAAGAGGTCGTTTCCCCCGCGACAAAGACGACTTCGT
+TAGTGATACGCGGCTGATGCAGATAAATTTCAGTGGTCAGGCGACCAATATCCGTAGGCG
+ACGTGACGGTGACCTGCATTTCCCATCCGCCGAGGGCATTGATGGTTTTTTGGGCTAAGT
+TGACCACACCAAAGGCCGGTTCGAAGAGAAAAGAGGTAAATATACCGGTTGAAACAATCA
+CCCACTCCGTGACGTTTTGCTCGCGCAAAAGCGTCCTGACGTCATACTGTTCGTCCCACA
+CCGGCTGGCCACTACCTTTGCCGACCACATCGTAATTCACGCCAAACTGCCAGGGGAAAT
+AGCGCTTAACGCCCGCCTCCAGTACCGCGCGGGTGATTTTTATCTGGGTACCCGCACCGG
+CGACAAACCCCATACAATTGATGATCGTATCAAAACCGTGGAATTGATCTTTTAACGCTG
+CAACCGAACTGCCTGCGATGTCGACCGGGATAAACCGCGCACCGGCATCCGCCAGTTGTT
+GATGAATGCTGGAACGTCGTTTGCTCTGTTTATTCCTGGATCGCCCTGACACAATAACGC
+AAACGGAACCATTACGCTGTGTGACCGCCGGAACCAACGACGCCAGCACTGACGCCCCCA
+GTTGTCCCGCGCCCAGCACCAATACTTTTTCACCCACCTGATTATTGGATTGTTTCATTT
+GCACCTCTCTGTGTTGATTCACCTGTAGATAGAGATTACGTCAGGGATCTGCGTTCGATA
+AGACGCCGAAGACGGGTTAGACTGTTCTGATAAATGGGATAATTGGCGGGGGGAAAATGG
+ACAAGCTGGAAGCGATGCAGGTCTATGTTTGCGTAGTGGATACCCATAGTTTTATCAGAG
+CCGCCGAAGTGCTTGGCGTGCCGCGCTCAACGGTATCGCGAGTGGTTAAAGAACTGGAAT
+CCTGGCTTAAGATTCAACTTTTGCAACGTACAACCCGCAAACTTAGCGTGACCGCAGAGG
+GGCGGCGTTACTACGAAGAGTGCAAAAGAGTGCTGGCAGATATCGCGGCCATGGAGTCGT
+CATTTCCCGGCCGGGCGGCACAACCCAAAGGGCGTTTTAAAGTGGGGATGCCGCAATCTC
+TCGCCCGGCATTGCATTATTCCTACGCTCCCGGCCTTTTTGTGCCAGTATCCGGAGCTGG
+AGCTGATACTTTGTTCCAGCGATAGCGTGGAGGATATTATCCTTCAAGGGTATGACTGCG
+TGATTCGGGCCGGCAGAATCGATGATTCCACCACGCTGGTTGCCCGTCCACTTGCCAGCT
+TTAACTGGGTGATAGCAGCATCGCCCACTTACATTGAGCGTTACGGTAGCCCTGAAAATT
+TAGATGATCTGCAAAAACACCATGCGGTCGGCTACCTGAACCACCGCACCGGGCGTACCA
+CCGACTGGTTTTTTACGCGTGAGGGGGAGGATTACGCGATGCGGGTGCAGGAGACGCTGG
+TTGTCGATGATACGGACGCTTATATTCAGGCCGGAATACAGGGGCTGGGGTTAATTCGCG
+TCGCCAGCTATCTGGTTGCGCCGTATCTGCACAGCGGGGCGCTGGTGACCTGCATGGACA
+ACCATTTTTATGATTTGCCGCTTGCGCTGGTCTATCCGCAAAACAGGTTTCTGCCGCCTG
+CGGTACGCGCTTTTTATGACTGGTGCAAAACGGCGCTGAACCAGCCGGAGCCTCTTCGCT
+AAAAATATTATTCCGGATATCGCATTGCCTGTTCAGAAAACTTTTTCACAGACGGTCAAA
+ATGACGGTACTGGTTTTTGACGCATAAGTAAAAGGCATTATCAAACAGGTGCTACACGGC
+GAGGATATAGCAAGCACGGAACGTTTGGATGCAATAAAAAATCTGTACAACTGTTATTAA
+TGAACTTTTTGTATAAATATAATCGGATTTAACAATACTCATTGTACCTGTATTTTGCTC
+TTATCATGGCGTCTTTACGACGAAAGGGTGCTTTAGCGTGGAATATTCAATATTAAGTAA
+CAACCTTAAAATGCCTATGGTGGGTTTTGGCGTTTTTAAGGTAACCGACAAAGAAGAATG
+TCAGCAGTCAGTGTTAAGCGCTATTCGCAGCGGTTATCGTCTTATCGATACCGCTGCGGT
+ATACGGCAATGAAGATGCCGTTGGTGACGCTGTTCGTAAAGCTATCGCGACAGGTCTGTG
+TACCCGTGAGGAGTTATTTATTACTTCTAAACTGTGGGTGCAAGATATGGCTAACTACGA
+TCTGGCCAAAGCAGGTATTGAAGCGTCGCTGAAAAAATCCGGGTTAGATTATTTTGATCT
+CTATTTATTGCATCAGGCAATGGGCGATTATTTTAGTGCGTGGCGCGCGCTGGAAGACGC
+TTATGAAGCCGGTAAACTAAAAGCCATTGGCGTGTCCAACTTCTATGCGCATGTGTTAGC
+CAACTTCTGTGAAACCGTCAGAATTACGCCAATGGTAAACCAGGTCGAATTGCATCCATA
+CTTTGCACAACCCGCCGCGCTGGAAACCATGAAGCATTATAACGTTCAGCCTGAAGCGTG
+GGCGCCGTTAGGCGGCGGGAGACATAAACCGTATGAAAATGTCATGCTTCAAAGGATTGC
+CGATGCCCATCAAAAAACCATCGCGCAGGTTGTCCTGCGTTGGAACGTGCAGCGTGGTGT
+CACGGTTATTCCTAAATCCACTCGACAGGAACGCATTGAAGAGAACTTTGCCATCTGGGA
+TTTCTCACTAACGGATAATGAAATGGCTCAAATCAACGCCCTTGATTTAGGCTACGTTGG
+CGAAGCGGTGAAGCATTTTAATCCTGAATTTGTTCGCGGTTGTCTTGGCGTTAAAATCTA
+CGATTGATCCCGGCGCTTGCGGATGTTTTCTCGCATGAACAGCTTCTAACACGGTTGCCG
+GAGCGTAGACGGCAACCGTGTGATATTCGCCTGGCCGTCAGGCGCCGAAGGCACCATCGA
+TGGTGTGCATCGCGCCGGTGACGAAAGAGGCTTCCGGGCCGGCAAGCCATGCCACCATTC
+CAGCCACTTCTTCAGGTCTTCCGTGTCGTTTGATTGCCATGAAACTGTGCATCAGCTCTT
+TCATGGGGCCATCTTCCGGATTGATGTCGGTATCAATGGGGCCTGGCTGCACCACATTTA
+TCGTAATCCCGCGGGGGCCAAAATCACGGGCCAGGCCGCGCGCCAGCCCTTGCAGGGCTG
+ATTTACTGGCGGCGTACGCGGCCATTCCCGGTACGGGCATCCGATCGCCATTCACGGAAC
+CGATAATAATAATGCGTCCACCTTCCGGCATGTTGCGGGCTGCTTCGACTGACGCATGGT
+AAGGCGCATGGATATTAATACGGAACAAACGATCTATCGCATCGCTATCTTGTTCCAGCG
+CATCGCCGAAGAGAGCCACGCCCGCATTGACGACCAGAATATCCAGTGGTCCGTACTCAC
+GCACGAGGCTGATGACGGCATCCCGATCGGCGCTATCCGTCTGGATGGCGGTGCTTCCGG
+TTTCCGCTGCCAGTTTTTCGGCGGCTTCACGCGATCCGGCGTAGCTGAAAACGACCGATG
+CGCCGTCAGCGCTAAAGCGTCGTACAATAGCCGCGCCGATACCACGACTTCCCCCTAAAA
+CCAGTACAGATTTGTTGCGAAATAGCATCATCAGGATGTCCTTTATGATATTGTAGTAGC
+CACTACAATATGCGTAATGAAATCATGCCGTCAAGGAGTTATGTAGTAATGACTACAAAA
+CATAGCCGAACGCCGGGTCGCCCTCGCCAGTTCGATCCGGAGCAAGCCATTGAAACCGCT
+CAACACTTATTTCATTCGCGCGGATACGACGCGGTGAGCGTAGCGGATCTGACAAAAGCG
+TTCGGGATCAATCCTCCCAGTTTCTATGCGGCGTTTGGCAGCAAGCTGGGGCTGTATACT
+CGCGTATTAAAGCGTTACAGGATGACCGACGCGATTCCGCTCGGGGCGCTTCTGCGTCAC
+GATCGCCCGACCGCGAAGTGCCTTATCGATGTGCTGATGGAAGCGGCAAGACGTTACGCT
+GCCGATCCTGATGCCACTGGATGTCTGGTTCTGGAGGGCGCTCATTGTAACGATAAACCG
+GCACGAGAGGCCGCCTGCGAGTTTTACATCGCTGCTGAAAACCTGATTCGCACTTATGTC
+GCCATGCGGTATCCGCAAGAGGCTGACCGGACGACGGACTTTATGGGGACGCTAATGGCG
+GGGCTTTCCGCCAAGGCGCGAGCGGGGTATAGCCTGGAGCGTCTTCAGGAGAGCGTGCTT
+CTGGCTGGGGATGTGCTGGAGCGATTACTGCCGGATTAACGCAGCGCATCAAAAAACCTG
+AGCCAGTCAGATACGGACAAACAGGGAGCAATAGCCCTAATCATCCATCTTGCCGTTGCG
+GTATTCGGTAAAGTACATCAAAAATAGAGGTGTCAGGGAAACAAGAAATGCAAAAGTGTA
+GTCTTATTACGGTACTTAGCTTATCAGTGTTGATGCTAGCCGGATGTACAACGACCTATA
+CCATGACGACCCGGACGGGAGAGATTATTGAAACGCAGGGTAAGCCGGAGGTTGACTCCG
+CAACCGGAATGACGAAATACGCTGATGTTTATGGTTATCATCGCGTTATTAAAACCAGTG
+AAATAGTGCAGACAACAGAAGGCGCATCGAAGCTGGACTGGTAATGCGCTAAAGCAGTTG
+GGAGGCCGTGTCCAGTATGGGTACCGGACGGTTTCTGGGCCTGAATTGAATAGAGCGCCT
+GTATAGCCGAATTCCGGGTATCGGCTTGATTTGTGTTGTCAGTTATTTGGTTGTTCCCTG
+TATAGTGAAGATAAACAGTACTCATGGCTAACGGTCTGTTTTGGATTGCTAACTATCCCG
+GATTCTGCGCGTTTTATTTAGTCACAACCGTGGTTAAGAATATTTTGGGTCAGACTTACA
+CGCCGGGTATTAAGATAATCCGTCGCATAGAGAGCTTGATCGGCATCATTCGGTTCAAGA
+AGAAACGGCGTGACTTTAGGTATGAGATCAGCAAAGAGGTTATATTGATCCACAGAGGCA
+AAATGCTGGGTAGCGCTGGCCCAGGGCATTCGCATCAGCTCTGCGTAAGGAGGGGATAGT
+TGAACAGGCAAATCAAATTCTTTCAGATTAGCAAGCATCTCCTTACTCATATAAAATGTG
+ACCCTGTTTCGCGAAAAGGTGTTAAGCACTGCCTTCAGTCGTTTAACTTTTGCTTCTTTA
+CTCATGCTATTATCAAAAAAACGTGGTGAAAGCATAATAGCAATCGATGCATTTGATGAA
+ATAACATTATGTAGTGGTTTCAGGGCTACAACAATCTGATCGTTTGTGAAGATACGCTGC
+GTACCAGAGGAGGTAGTATAGTTTCCACCCAGCCAGATCACATAATCTGTTGTTTTGAGG
+GGAAGCGTTTTTTCCGGTATATTACCCCTGTCAGGTGCCACTGTTTCAATTGCTAGTGAG
+TCTTGTCCCCAGACATTATTTACTTTAGAACTCAAAAAATTATATTCTGAAATGTTCCTT
+AGTTTTAGTAGAGTTATCTGTGAGCGGGTAAAAAAGAGATTGAATCTCACTTTGTTCTGC
+AATTGCCGAAGTAATCTGAGCGTGTTCTGATCGATCAGATGAGTGTAAAGACCAACAGTT
+TTTCCGGAAAGTATTGCTGAGGCATTGTTCGCAAGAAGCATCTCTTTTATAGCTCCTTGC
+CCAATAATCAGTACGCAACGGTATTTTTCTGGTCTGATTTTATCTATGGGGATATCGGTA
+AGATTGACCAGGTCAGGAGTGCCATGCCGCCAATTATCATGAATGACTGTGGCTCCGGAG
+GCGTCTCCTCCGGCTCCCCTGGTGATAATAAGAGGAGGGTGGGTACTGGCATGTGCGATA
+TACGAAAAACACGCTACCATTGCTAGCGTTGTGTTTCTGATGGTTGTATACATATCGTCT
+GCCCTGATTTCGAAAATATGAATAATGTCTCCTCTTATAATGTACATCAAAAAGAGAGCA
+TTTTAATTAAACGTTATCTCAACGAGATAAAAGGTTAGCACAGTAAAGTATAGAGAGAAT
+GTAATCATACCAACATTATAGATGTGGGAGCATGAAGGCCCCGCAAGCCGCCCGGCCAGC
+ATACTCCCATTAATAGTTAAAGTATGGACTTTGCTTTTACCGTAAACTGTAGCCAATATT
+ACCTGATCACTACACCGTACAGTACTGTCAGAAATCTGTCCCCGGTGTCGCGTGCACGCA
+AGTTATTTTTTTTCAATTCTTTCAAAACGTTAACTATATTAATAGTCACTTATTTTATCA
+GAATCAATACTGAGGGTTTTATTACCGCTCTGAAAAGAGAAGGCTTTTCAGATGAAATGC
+GTGGATGGTACGAAGTCATTACAGTACAGGGATGTAATAATAAAGATCGACAATGGATTC
+ATTACTCTGTTGCTTTTGGACGGATGCCAAATGGAAGTATTCAATATCTTCTCCTTCTCT
+CCTGATAAGATTCAGTTTTGGCAATATACACATATATATTGTATTGGAAAATTGTTGATA
+TTGTTCTTTATGACCAACGAAATGGAATTTTGCATATTTACCACATTTTATTACCCTCGA
+CATGGGTATTTTGCCTCCATCGACGGAATTATGTTCCATACCAAAAAAACTGCTTACGGA
+GATGACCTGGTCTTTGGTATTATCCGGCTTAAAAGACGAGAGACAATACACATTTTCGCC
+CCACGTTCTGAGCGTCTCATGAATGATTTTCCATTTTATAGGCGACGCTTTTTTAGGAAG
+GTCATTTGTTGCGATCTGATGAGACGTTTGAAATCCGAAAATTTCTTTTGACGTAAGCTG
+ACAAATTTCGAACTGATAATGCTCATCACAGTCAAGCCAGTAGGGAGGCCGTAGGTTTCT
+GAGATCCCAGAAATCAGCCTTGCGATAGTTATTGGGATTGACGCCAAATGTTTTTTTGAA
+CTCTCGACTATAGGACTGCACTGAATCAAACCCCATTCTGAACGCGATATCTGTGACCGA
+CTGAGAGGTCAGCTTTAGCAGAGTGGCGCTTCTGCTCAACTTGCGTTGTCTGATATATTT
+TCCGATTGAGACGCCACACTTTTCTTTAAAAAAATCCTGCAAACTCCTTCGCGAATAACC
+TGTTATAACAACCAGCTTTTCAATATCAATCCTCTCTTCAAGATTTTTTTCTATTTGCTC
+TAATACTGAGATTATTATGGCTTTTTTCATCATCATTCCTCTCTATTGAAGCCGAAAATA
+TAAAAATTTAAGGTGTTTGACATACTGTGTTATTAAACTGGTGGGGGGTTGTTAGCTTTT
+CTGGCAAAACAAGAAAGATTTAAATTGCTTGACGTTTCTGAATAAACTTTACACTTGGAG
+ATCGGCTTTTGCCAGTAAAGCTAAGTAATTGGCATGGCGAAGGGCATAATTTCACAGGCG
+GTTAAAATGATTGAATAACCCTGAATTTTTAGCTCGTGAGATTATAAATCTCATAATTAT
+TTCTAATGATTTAATAAAAGGGAATTGTTTTGTACTTCAAAAGATCTTTATTAGCGTTAG
+CAATTTGTGCATCCGTGGTCTCAGTAGAGACGGTGGCGAATACCAGAGCCAATGATATGG
+CTTCTTCTGCTACACCTGCTTCTGTTGGTCACCGTCCTGTGGCAACTACTAATGCAAAAA
+AAATAGAAGTGTCTGGGGAACTGACGACCGGTTCAACCCTCCAGATAGCGGATGTTTTTA
+TTAGGGATGAGGATGGGGATCCCTTATCGCTGGATAAAATGAATAATGCCGACGATATTA
+AATGGTATCTGGTGGATAATGAGGCCGCCGATCCTTCTGGAACCCCGGCGGCAACCGGGA
+CGGCTTTTACCATTCCTGCTGATGCAGGCGGTAAAAAAATTAAAATCGTTTACCGGATTA
+AGACGGCAACGGGGACGCCGGATAGTGCATTCTTGCCTGCCACTGTCTTATTAACTTCTG
+CATCTTCTGGGGTGAGCGGCGACTCCGCCGCAGACGGTACAATTTCTAATAAGCTACGTT
+CTGTCACTATCAATGTGGTGAATGAAAGTGGTAAACCGACTGATGAACTCAACGGTACCA
+ATGACGCCAACACTCCAGTGGTAGGCGGCACCCTTGAAGCGGTACTGGAATGTGCCGCCA
+CAGCGGCGGCTGAGTGTGAGGTCAGTAATTATAACTTTACCTGGCAGATGGCGGATGCCG
+GGACACCAGATAAGTTCACCGATCTGAATAATACCAACGCTGAAAAGCATAAATATATTA
+TTAAGGGAACTGAGCAGAATAAACTGTTCCGTGTCCACGTTACGCCTAAAACGACGAAAG
+CCACGCCGGAGAATAAACGCGCTATCCGTCGCTGATGGTTATCGCCAAATAAACATCTTA
+TTTAAATACTCCCTCTGCCAGGCAGGGGGATATAGCAGGAGACAATAAAGTGGTTTTTTC
+TAAAAAACCCATTACTAAATATATAACCTGGGCCATTGTTACCAGTCAGATTCCACTGCC
+GGTCATTGCTGATAGCGATAATGAAATTCAGTCGTGGATTGCGGGGACGGCATCGTCTAT
+TTCTCCGCATCTGCAGGAGGGGACGCTGGAGGATTATGCCAAAGGAAAAATAAAGGCGTT
+ACCAGGGCAGGCCGCTAATCATCTGGTGAACGAGGGGATAAAGAGCGCTTTTCCGGAGAT
+TATTTTCCGTGGTGGCGTCAATCTTGAAGATGGCGCGAAATATCGCTCATCAGAGTTCGA
+TATGTTTATTCCCGTCCAGGAAACAACATCGTCTTTACTCTTTGGTCAGCTTGGCTTTCG
+CGACCACGACAACAGCAGTTTCGATGGCCGCACCTATGTTAACGTTGGTATGGGTTACCG
+CCAGGAGGTCAATGGATGGCTGCTCGGCGTCAATACGTTTCTGGATGCCGACATCCGTTA
+TTCCCACTTACGTGGCGGCATTGGCGGGGAAGTTTATAAAGACAGTCTGGCCTTTTCCGG
+CAACTATTATTTCCCTCTCACCGGCTGGAAAACGTCAGCAGCGCATGAATTACATGATGA
+GCGTCCGGCATATGGCTTTGATCTGCGAACAAAAGGCACGCTTCCCGATTTTCCCTGGTT
+CAGTGGCGAGCTCACATATGAACAGTATTACGGGGATAAAGTTGATCTATTGGGTAACGG
+TACATTAAGCCGGAATCCCCGCGCCGCAGGTGCGGATCTGGTCTGGAATCCTGTCCCCTT
+GCTTGAGGTCAGAGCAGGATATCGGGACGCCGGTAACGGCGGCTCGCAGGCAGAGGGCGG
+TCTGAGAGTCAACTATTCCTTCGGTACGCCGTTACATGAACAGCTTGATTACCGCAACGT
+TGGTGCGCCGTCAAATACGACTAATCGGCGTGCCTTTGTCGATCGTAATTACGATATCGT
+CATGGCGTATCGGGAGCAGGCCAGTAAAATCCGCATTACGGCAATGCCGGTTTCAGGCCT
+GTCCGGGACGCTGGTGACATTAATGGCGACGGTAGATAGCCGTTACCCGATTGAGAAGGT
+TGAGTGGTCGGGTGATGCGGAACTTCTCGCCGGACTCCAGCTTCAGGGGAGTTTGGGCAG
+CGGCCTTATCCTTCCACAACTTCCGCTGACGGTGACCGACGGTCAGGAGTATAGCCTTTA
+TTTAACGGTGACTGACAGCCGGGGTACTCGCGTGACCTCCGAGCGTATCCCGGTAAGGGT
+GACACAGGATGAGACCAGTTTCCGTTCATGGATAAATGTTATCAATGACGATGTTCAGGT
+TGAGGACGGCAACTTTGTTATCAGTACGCCGCTTCCTGCCGGCGAAGAGGGGAAGGTTAT
+TGAGTGGCACTACGTGCGCGAGCGCTCTGAAGAGGAGTGGGCGTCGCTCAAACCACGTCA
+TATTAAGTATCAATCAGATATGCCGGGTCTGGCATTTAAAGCGCTCGGTGGCACAGAGCG
+TGACGGCCATTGGGTTGAACGGGTTCTGGTGACCCATATCGGCGATGATACCCGCTCGCT
+CAAATTACATATTGAAGCAAGCGGACCAGACGATAAACATCCGGTGAAGGGGACCGTACT
+GCTGCAAGCGCAGCCAGACAGCATTGCGCAGAAGGTCACTTCTGTGGAGGTGCTTTTTAC
+GCCGGGTACTGAAGAAGCCAACGGAAGCGTTACTGCGCCAGTCGTCGGAACAGAAATGCG
+AGCCAGAACGCTTTGTGTAAATAACACGGACTGTACTGATGCGTTTAATTATCAGTGGGA
+AATCTCGGATGAAATGAAATCCTGGCAATCCGTACCGGGGGCGACAAAGGCCACCTGGCT
+TATCCCTTATAGCCTTAATGGGGAATCGCTACAGAATAAATATATCCGCGTCAGAATTAT
+TTCTGATAAAGAAAATGCCAAGAGTTCTACCGCAGCATCTGATGCGAATTAATGTTTTAA
+AAAGGATCAACAGTGTGTATGTCGAAACATAATCTTATTATCTATAGCCTGCTTCTGGCG
+GCTGCGCCGATAAGCGTCTTGGCGGATTCGTCGACAACTTCCGCGGCAACCGTCGGGATG
+TTTTCTCCTCCTACGGCGCCGAGCGTTGGGCACAGGCCTGGAACACCTCGCGATGGCTAC
+GAATTGAAGTTTAATGGACTTGACTTTTCTATTGAAAAGTATACACCTTTTCCGGGAATG
+ACTATTGAGAGGTATGCCAGAAATGTAGGCATCAGAGATCCGGATAATAACTATCAGTCT
+GCGGAAACTTTTACTACAGTATGTACGTATTATCAGATAAATAAAGATAACTCTCAGCAT
+ATACTTAAACGTGAAAATCCATGTGAGCATAAATTTAATATCCAAAAGGAACATCGGGGT
+TCAAAGATTAAACTAGAAATTTATAATGAAACGGATATGGCTTCAGCGTCAGGGTACACG
+CCTGCGCCATCGGTATCTGAATTTCAGTATATTGAAACAGAAACTATATCTAATACGCCA
+AGTCGAGATTTAACAGTTATGAGTATAGATAAGTCTGTATTATCGCCGGGTGAAAGTGCC
+ACCATCACAACTATTGTTAAGGATATCGACGGGAATCCTATAAATGAAGTTTACATTAAT
+AAGTCTGTAGCGTGTGAAATTTTAGAGTGCTTATGGGATTATGGTCCTCTTAAGAAAGAA
+AATGCTCCAGGTAAATATACACAAGTTATAACCTATCGTGGGCATAGTAATGAGCGTATT
+GACATATCTTTTAAATATTCAGCGGCTTTTACGAAAACAATTTCCATCAGAGGAAGACCA
+TAAAACTATATTAATCATTATGGGTAATGTAATTCTTTTTATCACCATCATCTTATTATG
+GATGTTTACCTGGTTTTTTAGCGGATTGCTAAATAATTATTATGGCTAAAAGAATACAAA
+CGTTAAAAGGAGAGGTTTTTATGACACCAGCAACAACACAAGATTATATTTCATTGGGTC
+AGGAACACGCTGTCACCTTTGGCAAAACGCAACTGACCCTCAAACCCGGTATACTGGCTG
+AAGGCGAACCATTACCCTGCACAAAGGGGCTGGTGAGCCATAATTTATTACCGGGTTACT
+GTATCCCGGGGATAAAAAAGCGGATTATTGTCGTCCCGTCACTGGATACGCCGGTTTGTG
+AATGGCAGGTAAAAGACTATAGTAACCGCCTTAAATCAGCGGGTAGCCACTCAAACCGGG
+CGGTATATGTGCTGAGTATGGATACGCCATTTGCTCAGGCCCGTTTTATTCTGGAACATG
+ATATTCATCCCGGCATAACCTTTGTTTCTGACTACGCTTGCCGCCAGTTTTTGGATAATT
+CCGGGCTGAAAATTAATGAGCTCAGTATTTTTGCCAGAGCGTTGATAGAGTGCGATGAAA
+ATAATGTGGTTACGCGTGTTATTGTACCACGAGATATCACTCATCTTCCTGTTTACTAAT
+CACTTATATCAGCACCGTCCCTGCACAGAGAACCGAATAATCGGCAATGCAGGGGCGCAG
+GCATCCTCCTGTAGTGCCCCCACATTTAACACATATACTATTGCATCACGCATAAGGAAC
+TGAAAATGATGCCAGCGGATGGGGCAGGTTAACGTTATGGCACCCCTGAATTTCTGCAAT
+AATCGTCTGGTAACCGGAAAGCCACTTATGACTTTGTGATTTGGCCTGCTGGTGCTGTAA
+ATTATTTATCAATAGCTCCATTGATTCGCGGGTCTGCCAGTAATAATTATTAACCATTCT
+TCCGCTGGCGGCATCGGTATAGCTTTCCATCCCAATATAGCCATCAATAGTCTGTGTATA
+GCGCTCAATCCAGCCATCCAGTTGATAAAACTCTTCGTCGTACTCTTTTTTTTCGAAAAT
+AAAACTTGTCAGAAACAGCGACATGGTATTTCTCCTGTTACGCAATATCAATCAAACACC
+CATCAACGTGGATTCAAAACGTAAACCTGGCATCATTTTTTCAAGGCCGTCAGTCAGCAT
+GTTTCCTGCCGCGTACAATTCATCAACCGGCATTTCCGGCAAGCTTTCAAGGATAAACCA
+CATCGCTTTATCTGAAGCGCTTAGTCGGGTACGTACTCCCTGACGCCAGTTCCAGCGCCG
+ACAGGTGACGCCTCTGTCATCGCGCCAGATAACTTCGCCCGGTTCTGGCGACTCGGTGAC
+GGGTTGTCCTTCTTTCAGGGTATCAAATGTTTCACTTCCGTCTGCGAAAACCAGCCGCGG
+CGATCCACAATAAGCCGCGCTATTTTCGCCGCCTACCGGTACGGCATAGCGCAGGCTCAC
+GGCGTTATAAAGATCAACGACCGGGTCCAGCGCCGCCATTGTTCCATCCTTCAACACGCG
+TTTTCGTAGCGCTTCAGCCGAGCAGGGGGTGCGCTTCGGTTTTGCGCCGAATGCTTTAAA
+CACCGCATTCCAGGCGTCTATATGCGCCTGTGCCCACGTCGGTTGGCCGTTAATTACGGC
+CTGACAGGCCTCTTTTAGCGCGATTTCTCCGACCTGCGCATCGCGAATCGGAGCGGCAAT
+AACATTAATACTTAATGCACGAAAGCCGGGAGCGATACGGGCCAGTTCCGGGCTGATTGA
+CGGTAACATAGAAGACATCGCATAATCCTGTAATGACTATTTTCTTCTATGATATCGACC
+AATGACCAAAAAAGTCAACTTATCGACCACGACGGGCGCCGACGTCAGCACAATAAATGA
+AGCTGTTTCCCAACGTATCAAACAATTTCGTAGCCAAAAAAAGATGTCGCTGGATGAGCT
+TGCGCGGCGTTCCGGCGTCAGTAAAGGAATGCTGGTGGAAATTGAAGGCTGTAAAGCCAA
+TCCAAGCATTGCGCTGTTATGTAAGATCGCGGCGGCAATGGGAGTGTCCGTGGCGGATTT
+TGTCAACGTCGCCAGCGAGCCGATGGTTCATCTTATCGACCGGGATGCTATTCCGGTGTT
+GTGGCGCGGCGAGAAAGGCGGCAGTGCAAAACTAATGGCGGGAACCAGCGGGCCGGATAT
+GCTGGAACTCTGGCAATGGATAATGCATCCTGGTGAACAGTTTGAATCGGCAGGGCATCC
+GGCAGACACCTGTGAATTACTGTTTGTTAATCAGGGAACACTGACATTAACAGTCAATGG
+TAGACGCTTTATTATTCGGGAGGGCTGCTCCGCTGTAGCCAGAACCGACATGCCTCATGC
+CTACGTTAACGACACTAATGAGGTGCTTGAATTTACCATGACGGTGAATGAAAAGAGCCG
+TTGATCACCGTAAGGTGCTAACAACCCGTCATCCGGACAGGGAAGCCTCGGTGCCCGATA
+AGCGTTATCGGGCACCGGCTATCTTTTATTTTGTCGCAGGCGCGGCCTCCGGGTCATCGA
+TATAGAGCGTCTGGCTTGGGAAGGCGAAGTCAGCGCCGTTTTCCTGGACAATCGCAATAA
+TTTTCAGGTAAACATCCTGCTGTACGGCAAGCCATTCCTGCCATACTGTTGTTTTGGTAA
+AGCAATACACCATAATATTCAGCGAAGAGTCGGCGAATTCATTAAAATAGACCAACAGCG
+TCTGTTTCTGATCGATATCTCTGTGCGCCTGCAGCATGTTTCTGATAGCGTCAACAATGA
+GGCCAATTTTGTCGGCATCTTCGTAACGTAATCCAATAACCGTTTTTATTCGACGGTTGG
+TCATCCGTCCCGGATTCTCAACGCTAATGGATGAAAAGACGGAATTAGGCACGTACAACG
+GGCGGTGGTCGAATGTGTTAATTCGCGTAATTCGCCAGCCGATTTCGGCGACCGTACCTT
+CGATATTTCTGTCAGGAGAACGAATCCAGTCTCCGATACTGAAGGGGCGATCGAAATAGA
+GCATAATACCGGAGAAAAAATTGCTCAGGACATCTTTGCCCGCCATACCAACAGCGATAC
+CGCCGATACCGCCAAAGGTCAGCAGACCGGACAGACTCATGCCAAAATGTTCGCCATACA
+GTAAGACAATCGCGACAATAATGGTTATTTTTATGACCCGTGCCAGAATACGGGTACTGG
+TGACATCTCTACCTTTATTGACCTGTGCTTTTTCAAATTGGTTAATAATCAGGAAAAGTT
+TTATCGTCAGAATAAGCGCAATGAGCGAGGTGCAGATAAAATCAATGACCCCGGAAGAGA
+TAAAACGCAAATTATAATCTTCAATAGCATTATTCAGGATGCTCCCGATGGTTCCAATAA
+TAATCGCGTAAATAAAAAACTGTGCCGCATGGAACGTGAATCCTTTCTTCCACTGTACGT
+TACGGCTGAGCCAAAATCTCACGACCAGCAACGCCATACCGCAACTGAAAAGTATCGCCA
+GATTAAATGCGTTTTTGAGAAAAAATTCAGTGAACATTATTGTTTTCCGCTCCTTCCTAC
+GATAACAGCTCAGAATGACCTGATTAACAGGTATTTTACCCAGGATAAACGCGTAGATCA
+TCGATAAGTAAAAAGAAGAAATAGTGCTATCAGCTTTAATCTCAGCGGTTTACTTTTTAT
+GTAAATACAATGTCACGTTTTATGGAGCAGACATCGCGTGATTGTCATGGTATTGTTGCT
+ATCAGGTAACAAAGTCATCTGTAAAGGACAATACTATGATCATGATGAAGCTGAAATCGG
+CGAAGGGGAAAAAATTTCTGTTATGCCTGCTGGCAGTGTTTATCGTTGCGGCATCGGTGG
+TAACGCGCGCGACTATCGGCGGTGTGATTGAGCAGTATCATATTCCACTGTCCGAGTGGA
+CAAGCTCTATGTATGCCATTCAGTCGGCAATGATTTTCGTTTACAGTCTGGTGTTCACTA
+TTCTGCTGGCGATTCCTTTGGGGATCTATTTCCTCGGCGGAGATGAGTAACAGGGATGAG
+GTGTTGGCCGGATGGCAGCGCCATCCGGCAGGACGCAAGAGGGATTAATCGTCCTCGTCG
+TCCAGTTCAACCGGTGTCTGATACTCATCAGGCTTAATGACTAACAGGTCGCAGCGCAGA
+TGGTCAATGACCTGTTCGGCCGTGTTCCCCAAAAACGCGGCCGAGAGTCCGGTACGTCCA
+ACAGTGCCAAGCACAACGATCCCCGCCTGGAGATGTTCAGCAAGATCCGGGATAACTTCT
+TCCGGCAAGCCTTTTTCTACATGCGTAACTTTTTCATCGATGCTGAATTTCTGGCGCAGC
+GCTTTCATCGCCAGTAAATGCTGGCCTCTGATGGCGTCGTTATACACGCTGGGATCAAAT
+TCCGGCAGCTCAATGGCGATATTGATTGGCGTAACGGGGTAGGCGCCGACCAGGTGCACT
+TCGGTATGATTAACCTGCTCCGCCAATTGTAAGGTCTCTTTTACCAGCTTTTCGTTGAGA
+GCATTGTGATAAGGCTCTTCGCTTGCCAGGTTCACGGCGACCAGGGCTTTGCCGCCCTCT
+GGCCACGGCTGATCCTTGACCATCCACACGGGGCTTGGGCATTTACGCAGCAAATGCCAG
+TCGGTAGGGGTAAAAATGACCGCTTCCAGTCGATCGTGCTGATGCGCCATTTTCAACACC
+AGATCGTGACTGCCGGCGATAACCTCCTGGATGATGGCCTCAAAGGGACGATTGTGCCAG
+ACCACTTTAATTTCAATGGGGACACCGGCTTCAAGATAATATTTCGCCTGCTCACGTATC
+CAGGCTGTGCGTTGGCTTATTACGCCCTGACGCATTGCGGTGCGTTCGTCAGGAGAAAGC
+AGGGTGGTCATCTCATACGAGAAATCGTAAATAGGCAGGAAAGCTTTAATTTTGCCGCCA
+ATCCGTTGATGCAAATAAACTGCTCGCCGTAATGCGGGTTGGTCGTCCTGATTGGGATCG
+ATGACCACCAGCATATTTTGATACATAGCCATACAGGGTCTCCTTACAACTGTCATCGCA
+GTTTGTAACTAAAGAGTAACTCAAATATGGTGAATGAAACAGAGGAAGCGCTTCTGCCAG
+ATCAATAAATGAGAAAAATTTAACGATATGGCAGAAGATAACATCAATGGTTTAGCTGAC
+GTTTAAGCGACGTTGCGGGTATGACCGGCGAGGGCCGCCAGCGCATCGCTGTTTTCAATA
+GTAATATACTTACCTTTCACCGCCAGCATGCCGCTTTTCTGGAAACGCCCCAGCAGACGG
+CTAATGGTTTCGACCGTTAAGCCCAGATAGTTGCCGATATCGCCACGGGTCATCGTCAGG
+CGGAATTCACGCGGTGAAAAACCACGCTGCGCAAAGCGGCGGGACAGGTTGTAAATAAAC
+GCAGCCAGACGTTCTTCGGCGTTTTTCTTCGACAATAACAGAATCATATCCTGATCGCCT
+TTAATTTCACCGCTCATCAGACGCATCATTTGCTGACGCAGGTTAGGCATTTTGCCGGAC
+AGGTCATCCAGTGTCTCAAAGGGTATTTCACATACCATTGAGGTTTCCAGCGCCTGTGCA
+AAGCTCGGATGATGACCGCTGCCAATGGCGTCAAAACCCACCAGGTCGCCTGCTAAATGG
+AATCCAGTAATCTGCTCATCGCCTTGCTCGGTAATGGTGTAGCTCTTAATCGTTCCGGAG
+CGGATAGCATAGAGCGATTTCAATTCATCACCTGCTTTAAACAGAGTTTGCCCTTTCTGA
+ATGGGCTTTTTGCGCTCGATGATATTATCAAGCTGATCAAGCTCATGCTCGTTAAGTGTG
+AACGGGATGCAAAGCTGGCTGATACTGCAATCCTGGCAATGGATAGCACAACCGCCAGAC
+TGAATGCGCCGTATAATTCGCTTTTCCGGGATCATAGGTCTGCTCAAGCCGTAATTGATA
+TTTGTCAATTTTAACATCTTTTTGGTGAGCGCGTAAGTCTGAGCTATCCCGGAGAAGGAA
+TAATTCAAGTATAAGTTTGATGAATACTTTTATCTATTTGAAAATACGTAATTTATTTGT
+TGTTGCTTTACATAAAAGTGTGACCGATAAGGCACTTTTTGCCTGTATATTCATAATAAA
+AGATAGCCTTCATGGCGTAATAGCCACTCTTTTCGCTGCACGCCACCGGCGTATCCGGTC
+AGAGTGCCGTTACGCCCAATGACGCGATGGCAGGGAACAACAATACTGATGGGGTTAGCG
+CCATTCGCAGCACCGACTGCGCGTGCGGCGCCCGGTCGTCCCAATTGCGCCGCCAGCTGA
+CCATAGTGCATCACCTGCCCGCAGGGGATAGCGCGCAACGCCTGCCATACTTCCCGTTGA
+AAAGGTGTGCCCCCCGTGGCGGTTTCCAGGGTATCAATTACGGCGAGATTGCCTGCAAAA
+TAATCTGTAAGCTTATCGCTGAGTCCACCGGGGTTAGTTGCAGAAACGCGTTCATAGCCT
+TCGTGACGGTAGTGGATATTTAGCAGTTGTTCCATACGATCGCGGTACTGTTCCCACTCA
+ATGGCCCGCAGTCGAAACTGCTCATCGCAAACCACCCATAACGGACCTAATGGCGTGGCT
+ATCTTCTCTTCAAGTAATCTCAGCATCCGTTCTCTCACATCGTCTTAATCTAACGTAAGA
+GACAAGATATCATGCCAGGAATACCCGCAACCATACTCCTTAAAAGATAGTCAGGGATAA
+CACATTTAGCGCCAGTAATATCGTAGGCGGAGAAAAAGAGAGCCTGGCGAGGCGGTTAAT
+TGCCTGACATTGTCGCTGTTATTGGAAATAACTGTAAACCGTTGTCGGTATAACAGGGCA
+CGGTTATGATAACGGCAGTCGCAAAAACGCTGGAGGATGAACCATGAACCTTGACGATAA
+AGCGCTGTTTCTTGACGCCATGGAGGATGTCCAGCCGCTGAAACGCCATACTGATGTACA
+CTGGCAGCCAACGCGTAATCTTAAAACGCCCCAGCGTATCGACACGCTTCAGCTTGATAA
+TTTCCTGACGACGGGCTTTCTGGATATTCTGCCGCTGAATGAACCGCTGGAATTTCGTCG
+GGAAGGATTGCAGCAGGGTGTCATCGACAAGTTACGCAGTGGGAAATACCCTCAGCAGGC
+CAGCCTCAATTTGTTACGCCAGCCGGTCGAAACGTGCCGAAAAATGCTATTTCGTTTTAT
+CCTGGAGGCGCAGAAAGAGGGGTTGCGTAATGTCCTGATCATTCATGGTAAAGGGCGAGA
+GGCGAAGTCGCATGCCAATATCGTCCGAAGCTATGTGGCCCGCTGGTTGACAGAGTTTGA
+GGATGTACAGGCTTATTGTTCGGCGCTGCCGCATCATGGCGGCGGCGGGGCATGTTATGT
+CGCGTTACGTAAAACGGTGCAGGCTAAACAGGATAACTGGGAGCGCCATGCGAAGCGTAG
+TCGGTAAATCGTTGCCGCTGGCGGACAGGACCGCCAGCGCAAGCTCGCGCGAACCCGATT
+TTATGCCTGATATAACGCCTTATCCAAACGCTCAGGATTCTGCAAGAGAACGGGCGATAA
+CGCTGTCCACAGTAATAACACGGAGAAACAGTCATTCGCTTATTTAAGCGTCTATTAAAA
+TATACTGGCTTTCGACTTAACTATTAAGCAGAAAATGGTGATAAGTACATCACTTGTCAA
+TATGGATGGATGAATATCCTGGCATAGCGAATATAGGTGATTTTATCTGTTGCACTAAGG
+GAAATGGCGATGGTCTGGTATTGAATATGGAGAATGTCAAAGAAACGAATGGCAATAGGT
+ATCTGAAATGCTATAAAAATAAAACCTGTCTCCTATCCTGGTTGTAGGCCGTCAAAAATG
+TTGAGAAATATCAGCGTCAGAACATGCATTATTCTATTCATGGTATGTACGTTTCTTTTG
+GTGGATACTTTACAAATAACCTTTCTGCACGATCTCCCTATTTTAATTACGTGTAATATC
+ATTTATCTGATCTCGACATTACTGCTTTGGTGGTATATGACCTGCTATCTGGTAGTGCCG
+ATTAATACCGTGAAGAAAAGTATTGAAGAGGTCGCAGCAGGAAACTTGTCTATTCATATC
+TCCGAATTTGGCAATAATTGCGCCGGGCGACTCATCCCCGGAATTAATAGCCTGTCGGAG
+AATATTTCCGCGCTGGTACGCGAAATCAGATCCTCTTCGCAAACGGCAATGACCCTTTCC
+GAACAACTGGCGGCGCGCAGTATGTCGCTATCCGTAAAGACGGAACAGCAGTCGGCCTCG
+TTAATTCAAACTGCCGCCAGTATGGATGAAATGGCGGCGAGTACCAAAAACAATGCGGAT
+AATACCCGAATGGCGAGCATACAGGCGGATTGTGCAACCCAATGCGCCCGTAAAGGCGGT
+GAATTAATGGTGCGGGTTACAGAAAATATGCGTTCTATTACCGACTGTGCCTCGCAGATG
+ACGGAGATTATTTCATTGATTGACGGTATCGCATTCCAGACTAATATTCTGGCGCTTAAC
+GCGGCGGTAGAGGCTGCGCGGGCGGGCGATCATGGAAAAGGTTTCTCCGTGGTGGCCGGG
+GAAGTGCGTAACCTGGCGCATCGTAGCGCCGAGGCGGCAAAAAGTATCAAGGCGCTGATC
+GACGTTACGCATGAGAATGTGCGGCAGGGGGCCGCCATAGTGCAGGAGGCTGAAAAAAAT
+ATGCAGGAGATTGTTGGCGGCTCCGGGCAATTAAACGTGCTGATGAGTGAAATTTCCACC
+ACCACGCGGGAGCAGGAAAAAGGCATTAACCAGATAACACTGGCGTTGAGCGATCTGGAA
+AGCGCAACCCATAGCAATGTTTTAATGGTTGAAGCGTTATCTGCTTCTTCGGATGTTTTA
+AAGGCGCAGGTGATCGAGTTACAGACTAAAACCGACAAATTTCGTTTAAGCCAGCCGGGT
+TACAGTGAACATGCGCTGTCGCGCTCTCATGTATCACCTCTTTCGACCATCACCAGGCGC
+GGCCAGGCCTGATAATACATGTTTGGTAAGCGCCTGTTGCTAAGGCGCTTTTTTCGCACG
+TTCCCGTAATTCTTTTTGCGCAATGAGAAAATGAGAGATTGCTTAACCTTTCCCGAAAGC
+TAGACTAACGGCATCAGAGTTGTAACGTGGAGGCGCTGTGGAAGCCATTAAGGGATCGGA
+TGTGAACGTGCCGGATGCCGTTTTCGCATGGCTACTGGATGGTCGTGGTGGAGTAAAACC
+GCTCGAAGATAATGATGTGATCGATAGTCAGCATCCCTGTTGGCTACATCTTAATTATAC
+CCACCCGGACAGCGCCCGCTGGTTGGCTTCAACGCCTTTACTCCCCAATAACGTGCGTGA
+TGCGCTGGCTGGTGAAAGCTCGCGCCCGCGCGTAAGTCGTATGGGGGAAGGGACGCTCAT
+TACGCTGCGCTGTATTAATGGCAGTACTGACGAACGCCCGGATCAATTAGTGGCAATGCG
+TTTATATATGGACGAGCGATTCATTGTGTCTACCCGTCAGCGAAAGGTTCTGGCGCTGGA
+CGATGTGGTCAGTGATTTGCAGGAGGGCACCGGGCCCGTAGATTGCGGCAGCTGGTTAGT
+AGATGTGTGCGATGCGTTAACCGATCACGCCAGTGAATTTATTGAAGAGCTACACGATAA
+AATTATCGATCTGGAAGATAATCTTCTCGACCAGCAAATCCCACCACGCGGTTTCCTCGC
+ATTGCTACGTAAACAGCTAATTGTTATGCGCCGCTATATGGCGCCGCAGCGCGACGTCTA
+TGCCCGGCTTGCGAGTGAACGGCTGCCGTGGATGAGCGACGATCACCGGCGCAGAATGCA
+GGATATCGCCGACAGGCTGGGAAGGGGGTTGGATGAAATTGACGCTTGTATCGCGCGTAC
+TGGCATCATGGCGGATGAAATTGCCCAGGTGATGCAGGAGTCTCTGGCGCGCAGAACTTA
+TACCATGTCGCTTATGGCGATGGTTTTTCTGCCCAGCACCTTCTTAACAGGATTATTTGG
+CGTTAACCTGGGCGGTATTCCTGGCGGCGGATGGCGGTTCGGCTTTTCTCTGTTTTGTAT
+TCTGTTAGTTGTCCTGATCGGTGGTGTTACTTTATGGTTGCATCGCAGTAAATGGTTGTA
+ACAAAAGCGCTTTTCAGACCATTTCGTATGAAAAAACGCCGAGAAATTTGAGCGAAGTCA
+ATAAACCATCTACCTATTCGGGGCAATATCTCTCTCGCAGGTGAATGCAACGTCAAGCGA
+TGGGCGTTGCGCTCCATATTGTCTTACTTCCTTTTTTGAATTACTGCATAGCACAATTGA
+TTCGTACGACGCCGGCTTAGATTAGTCGGCTTTTTTTTGCCTGTAGAATATCAGCGTCTA
+CCCTTTAAGAGTCTGAATGACATTCTGGAGGGTAATATGAGCTGTCTTTTGACCTTATTA
+TATCTACACTCGTCCTTGTCGGACCCGATTCCCACTGACCCTGTTCCCATTCCTGAGCCG
+CTTCCCCGTCCTCAGCCGATGCCCGACCCGCCGCCGGACGAAGAACCGATTAAAATGTCG
+CATCAAACGCCCGGATCTGCGAGGATACGCGCCTGCTGACTATGAGTCGTTACCGCGAGA
+GTAAATTGTGACCGCTTTTTCAACCCTGAATGTTTTGCCCGCCGCCCAGCTCAATAACCT
+TACTGAGCTGGGCTATCTTGAGATGACGCCTGTTCAGGCCGCAGCATTACCCGTCATTCT
+GGCGGGTAATGATGTGCGTGTGCAGGCCAGGACCGGTAGCGGCAAAACGGCGGCGTTTGG
+TCTTGGGCTCTTGCATCGAATTGACGTCACTCTGTTCCAGACACAGGCATTAGTGCTGTG
+CCCGACGCGGGAGCTGGCGGATCAGGTTGCCGGAGAGTTACGTCGCCTGGCCCGTTTTCT
+GCCAAATACCAAAATTCTGACCTTGTGTGGCGGGCAACCCTTTGGCGCACAGCGCGACTC
+GCTTCAGCACGCTCCGCATATCATTGTCGCGACGCCGGGGCGCCTGCTGGATCATTTACA
+AAAAGAAACCGTATCGCTGGATGCGCTGCATATTCTGGTAATGGATGAAGCAGACCGAAT
+GCTGGACATGGGATTCAGTGACGCCATTGATGAGGTGATCCGCTTTGCGCCTGCGACGCG
+CCAGACGTTATTGTTTTCAGCAACCTGGCCTGAGGCCATCGCGGCGATTAGCGGTCGTGT
+ACAGCAGCAGCCAATACGTATTGAAATCGATACGGTAGATGCGCTACCGGCTATCGAACA
+ACAGTTCTTCGAAACGTCTGCGCATGAAAAAATTTCGCTGCTACAAACGTTGCTTAGCCA
+GCATCAGCCAGCGTCCTGCGTGGTATTTTGCAATACCAAAAAAGATTGTCAGGCCGTTTG
+TGATGCGCTTAATGCGGTAGGACAAAGCGCGTTGGCGCTCCACGGCGATCTGGAACAACG
+CGACCGCGACCAGACGTTGGTGCGTTTTGCAAACGGTAGCGCGCGCATTCTGGTTGCCAC
+CGACGTTGCCGCGCGAGGATTAGACATTAAATCGCTCGAACTGGTGGTTAACTATGAACT
+GGCCTGGGACCCGGAGGTGCATGTCCATCGTATTGGCCGTACGGCGCGCGCGGGAAGCAG
+CGGCCTGGCGATCAGTTTCTGCGCGCCGGAAGAGGCGCAGCGGGCGAATATTCTTTCAGA
+AATGCTGCAACTCAAGCTGAACTGGCTGAATGCGCCCGCCCGGCAGCCGTCACTCCCTCT
+GGCCGCAGAGATGGCTACCCTATGCATTGACGGCGGCAAAAAAGCGAAAATGCGTCCGGG
+AGATATTTTGGGCGCGCTGACCGGCGATATTGGATTAGACGGGGCGGATATTGGCAAAAT
+TAACGTGCATCCAATGCACGTTTACGTCGCCGTACGTCAAGCAGTAGCGCAAAAAGCCTG
+GAAGCAGTTGCAAAACGGGAAGATCAAAGGCAAGTCATGCCGGGTACGGCTATTAAAATG
+ATCGATAGCATGGCGTCTCAGCGGAGTGCTGAGACGCCTGCAGATTATTTCACTTCGATA
+ACATCAAGCCGCAACGCCTCTAAGGCGGTGTCATCTTCTTCCGGCTGCCAGCCAGCGGGC
+TGCAAGGGAATCTCTTCACGATCGAACGCTAAATCGCCGCCGTCGACGACCTCGGAACCG
+TGAGTGATTCCTTTGAAATCGAACAGGTTAGTGTCACAAAGGTGAGACGGCACGACATTC
+TGCATGGCGCTAAACATCGTCTCGATCCGTCCAGGATAGCGCTTATCCCAGTCGCGTAGC
+ATGTCGGCAATCACCTGGCGTTGCAGGTTTGGTTGCGAACCGCACAGATTACAAGGAATG
+ATAGGGAAGGCTTTGGCCTCAGCAAAACGGACAATATCTTTCTCGCGGCAGTAAGCCAGC
+GGGCGGATCACGATATGTTTGCCGTCATCGCTCATCAGTTTCGGCGGCATCCCTTTCATT
+TTTCCGCCATAGAACATATTCAGAAACAGGGTTTGCAGAATATCGTCGCGATGGTGGCCC
+AGGGCGATTTTGGTCGCGCCCAGTTCAGTCGCCGTACGATACAGGATACCCCGACGCAAA
+CGCGAGCACAGCGAGCAGGTGGTTTTTCCTTCCGGAATCTTTTCTTTCACAATGCCGTAG
+GTGTTTTCTTCGACGATTTTATATTCTACGCCCAGCTGCTCAAGGTAGGCTGGCAGGATA
+TGTTCCGGAAAACCTGGCTGCTTTTGATCGAGGTTGACGGCGACCAGTGAAAAATTGATC
+GGGGCGCTTTGCTGCAAATTACGTAAAATTTCCAGCATCGTATAGCTATCTTTGCCGCCA
+GAAAGGCAAACCATAATGCGATCGCCTTCTTCAATCATATTAAAATCGGCAATCGCTTCG
+CCAACGTTACGGCGCAGGCGCTTTTGCAACTTGTTGAGGTTGTATTGTTCTTTCTTTGTA
+TTCTTTTGAATTTCTTGCATTATTTCAGTTCTCTGGTACTAAATGGGGCAAATTGGGGGC
+AAACTTTGCAACTACGATAACCGTGCATTCAACATCGCTACTTGTTCGTCGTTCATGTCA
+TCAATCCACATACCGTAAATTTCATACACCATCTGCGCAGTTTCATGCCCCATTTGGCTG
+GCGATAAATGCCGGGTTCGCTCCTGCCGTCAACAGCCAGCAGGCAAAAGTATGTCGCGTA
+TGGTACGGATTACGGCGGCGAATACCAGCACGTTTTACTGCCGCATTCCACCTTGCCCCT
+AAACTGCTTACCGAGTAATAAGGTTTCTGTTTTCCTTTACTCATCCTGGGCATGAACCTG
+TTCAGACTTCCGCAATACCATTAACAGGTTCTGGATATAGCTGTTTTCCTGTTCCATTTC
+GAGAACGGTAATATGCCTGCGTTGAGCGCGGGTGGCGTGATGCAAATATTTTTTGTCTGT
+GGCAGCGTAAGTAAAAATGTGCAACACGCGCTGGGGGAACGGCAGGGTGGCGACGGAAAC
+TTCGCAGTCCTGACATTCGTCGTTGTCACTGGTGTCTGTCCCGCTTTCTTCGGTGCCAGC
+GTCGTCGGCGCATTCCTCCGTTTTTTCGTCGTGGGCGTCAGTAGCGGGCGTGCCGGGGAT
+GAGCATAAATGTTTTGCCATCTTCGCCGCCCAGCTCATATTTCTGACAGAAGGTGGTATC
+AAAACTTCCCTCCGGCGGAAGTTCGTTAACAGCGGGGGAATTAACGCGAACCGGTTTTGC
+AAAATCTGTCGGTTCGAATCCGGCGTCAAGCATTGATACGGCAAGGCGTGCTGTGGCAGC
+GGCTTCGCTGCTTTCAGTTTTCCACCAGAAAGCAAAAGGGAAGCCGAGACGTTTCCGGGC
+GCTTTCATTTTTAACCTTAATATAATATGAGTATTCTGTTTTATTGTCGCTCATTATCAT
+TACCCTTATTACAAATCATACTTAATGAAGACTTTCATTTTTCATTGAGCAGAATGCGTT
+CGTGACGAGCTCTTTACACTCCATCAGTTTCAACAATGAAATAAAATTTTCGGGAGGAGC
+TTCGTTCATTTTTAACAGCATTATTGCGGCTGTTATTGACCTGTCATATGCGCCTGTTTC
+ACTGTCTGTATATGCAACAAGAGTTCTGGAAACACTTTCATCGTCACAGTCCCGGGCATA
+AGAAACAACACAGGGCATATTGTTTTCGATACATAACGTACGAATTTTTCCTGAAAGCTG
+GCGGAGCTCTGCAATTACTGATTCAGGTACATTTTTCATATAGATTCCTTTTTTCAGGTT
+GAGTGAATTCCTGCCATTGCAGGCATATTTAAAAACAGGATGGTTTAAACGATTACTGTT
+CTGTTACCATGATTCAGCTTTGGCAGGCAGACCATTTCTGTTCAGCCAGACTTTTACCAT
+GCAATCGGTAATACATCTTTGCGTTGTTAAATCACGGATATATAAACGGCGTTTTTTAAT
+GTTATTCGCTGAGGCGATATAAGTACGACCATCATGGATAACATAATCTCCCGGCGTAAT
+ACACTGACGCGGTATTTCATCCGTTCCGAAGTGATGAGCAATCATAGCCCCTCCATTTCT
+GGTAAATAAATTTTGTGGTGCGGTGCCTGGTGCCTCCAGGTGACATTAACCAGTTAACAA
+TTAATGCCGACTTAAACCACCCATACTGATTCAGGGAGTTTTAACTGTGCCGCGTGCGCT
+TAGCCGCATTCACCGCATCACAAAATTCACTTTAAAAAGGGCGGACATCAGAAAGGACTA
+AGAAAAACTGATGCCGCCAAGTACTACACACAGCATTATTGTCGCAGTGGCAACTACAAC
+CGGAGGCGCACTTCCACTATTTGGATTTACAGACAAGACCGACTCAGAAAACATCAGAAA
+TGCGCCTTCGTGTTGTGCCCGGCTTTATTTAACCACCTCCGGGCTTCGGTGGTCTCGGCT
+ATACCCCTACAGCGAGAACCTGTGTTAACATTTCAATACCCTTACAGTTGAGAGTTATTG
+ATATGTCAGAAACCGCTCTGGTTATCGTAAAATTCCTAATTGGTAAATCCGTCGGACAAT
+TTATGCTCACAGTGGCTTTATTTTTCTTAATTATCATCTTCATTCCTAGAGATATTACGG
+AGCTTATTGAGGCGCGTAGCGATTTACCATATGCCGTTCAGATTTTTAGTTTTGCTGTGG
+CTTACCTTATAGTGCTGATCCTCAAAGTCACTGGTTATTTTTTCGTGTCGGCGCTGCCGT
+TGTGCCAGCGTAGGGGCAGGGCAAAACGCATGTTAAAAACGCTTAATTCATTGAGTACTG
+AACAGCTGTTTTTACTTGAACCCTTTCTTAAAACTCATTCTCCCACTTTCCGGGCGTCCT
+GGGATAACCCTGATGCAGATGCTCTGGTTAAGGCAGGTATCGTTCGTCCGGCTGGTTCGT
+GTATCGACGGTGTTTCTGTGATGTTCAAAATCGAACCCGAGTATGAGTCGTTAATGCTTT
+CCACCTGGAATCCCTGCACAAAACGGTTCGATATTAGCCGTTAGCTGAAAGCGCCAGCAG
+AAACTCACTGAAACTGAGTGCTTCTTCTCCTTCGTCAAGGCTTTCAAAGTATTCTTCGTA
+AGCCTTTTCCATGATTGTGTCGAAATCCATATCACTCACCTGAGTTTCTTTCTAACCAGC
+GACGTGCGCCTGTTTCAGTTTTAAACGTCCTGCTTCTGGTGTACGTCATGGCGGTGAACG
+TTCCATCCTGGTTGGGGAACACGCCACACACCAGGGATTCGTTATTGCCGAGGTGGATTT
+TTTGCAGCTTGTCCATTATCACCCCGGATAATACTGTTCCTGTAGCTCGCATTGAGCCAA
+AAACATATCCCATCCATTGTCGCGCAATGCTTGGAGAGCTGCGCTAAAGCTGACGTTGCA
+ACTATCCATCAAATACTGAATCACTTCATTCCTTCCCATCTTTCCCTCTCCCCTTAACGC
+CGGGTGGCGGAACTAAAACCTACAGCGCCGTGCTGTTTCTGAGATTATATTAGCGATATT
+CATATAGTTGATCAAGATAAATATGCATATATATCATAAATATGATCTATCCTAATGAAA
+ATAAATGTGTTTTATCTGATGCAAGAGGGGGAGGGAGGAGCTTTAGCCAAAAGAAAACCG
+CCGGGAGAGGCGGTTTGATGTGGTTGGTTCGTCACTGATTTTTTAGGCGCTTTTGTGCAG
+CGAGCATGTTCTGGAAAGCCTCTTTATATAGCTCATTCTGACCTTTAAGCCGGTCAATGA
+GTTTTTCTTTCTCAGATTCAGGGAGTATATCAAAAAGGTTTAGTAAATCAGCCTGTTGTC
+TGCTCACCATTCGCCAGCCACCACCTTCGAAGTTGTCATCGTAAGTACCAGAAGAACGAA
+CGTAGTTCATTAGATCGGCCAAATCCGGTCGTAACTCTTCGGGTTTAACTCTCAATAGAA
+CAGAAAATTTTAAGGCCGCATCAGTGTTGAGAGGTGCCTTACCGTTCAAATAGTGACTGA
+CGGTAGATTGTGTCTCAAAGCCCATAAGATCAGCGGCGATCTCCTGAGTAAGTTTGAGGT
+CTCGCTTTTTGGCGTCCCAGATGGCGCGTAAGCGCTGGGTAGCTTCTGGTGGAGCTATTT
+CTTCACGTTTTTTTCTCATGCGCTCATCTTATGAATGTGACTCATAAACTCAAACTGATA
+TAAGTATTGATCATTTAAATTAGTATGGTTAATATTTAGCGAGAATTACTAAGGTGACCT
+TTATGACGTTAGATGAATATTTGAAAAAAAATCGTGTACGACAGTCTTGTTTGGCCACGC
+TGGCTGGTTGTTCGCAATCGATGATTAGCCTTGTTACTACTGGCCGTAGTCAGTTAAGCC
+CCGAAAAGGTATTGCGTATCGCAGAGGCTACGAATTTCGAGGTTACACCTCATGAACTCC
+GGCCTGATAACACTTACGGAGCTGAGGAGGATGACGGGGTTAACCATTTATTCGACCCGC
+CACTACCTGGACAAGGCAGAACGTTGTGGGGATGTGTACCAGGCGGGCAGAAGAGGGGGG
+ATTTTCCCGTCAGAAGAGGCTTATCGTGCCTGGAAGAAACAGGCGAAAGTGGACGCTGAC
+CTGATTTGGAAGCTGCCTGACGGTGAGGTACGTCGTTACGACAGGCACCACAACGTAATT
+TGTCGTGAGTGTCGTAAAAGCGAGTACATGCAGCGGGTACTGGCGTTTTATCGGGGAAAC
+TTTCAGGAGGTGCTGTTGTGAGCCAAATTAACAATCGGAACTGCGTGAAGTGAAAGAGAA
+AGCATAATCCAAATATGAATAATTAAATTTAGTGATGTAAATAAACTTTAATCCTTAACC
+GGATGGATTCCTGCACGCTCAGAACACCAGGAGACCGCCCGAAAGGGCGGTAGCTCCATT
+GCTTAATTGTCTAAAATCGTGCTAAATCTTTTTATTACCATTAAGAAAGTTATGACAGTG
+ATAAAAAAGGATGTATAGGCTAAAAAGCTAACGATATATGCGGGTGCGCGAAAATACCAT
+TTCATTAAATCCACTGCATTGTCAGGCAGGAAATATATTATTACTGAAAATATAACCAAT
+ACTATTGAAGTTAATATTGCATAAGCGACGTTGTGGCATAACTGCTCATATATGGTTTTG
+TTAGTGTTTAATGATATCAATTTGTCTCTTGATTTGTTTCCTTCAATTATATCTGATATC
+TTAGTAATGGTTTTTTGTTTTTGTTCATAAATCATTATTACTGCACTCATTAATAGTGCT
+GTTGTAATAGCCCCGAAGTTAACGAAGACGGAAGCAATTGCCGGTTTCATTATTCCGTAT
+GTCCAGCACAGAACGAAAGAAAGAGATAGAGGAACTATAAAATGTACGGTAATGTCGCTC
+ATCAACATTGTTCCACGCTGATCTGACATTGTTTTGTAGTGTTTTATTATTACACCCAGC
+ACATTTATTTTATTCATATAATCACCCCTTTATTTCCACAGTGCAGTTCTTCCAATATAT
+CATTGGAAAGGTTTTTTATCGTGTCATGAAGTGCTGTTAGATCAGGTATACCTGTTAATG
+GGTCGATTTTTAGATCATTATCATCTAACTCTGCTGAAATTCCTTTTTTTAGTATGGTAT
+CATAATTGAAAACGACAGTCCGACTGCCGAGCTGTAAGCTTACTTTTATTGCATCACATT
+TATCTTCAATAATCTCAATGATGTTTCCTATATTCTTGTTTCTTAAATCCCTGAAACTTC
+CGAATATGCCATCGTTTGCTTTTATTATTAAGTCTGTCTTGATGTTTGTTTTGTTTTTAC
+CAAAGGAATCAGCAATATCTTCTGGTGCTTTATATCCTTGAGCTTTAATTTGTTTCAATT
+CAGAATTGAGAATGTATTGAGGGATTTTCTTATGATGTAATGGATTGATTCTTGCTTCTA
+GTTGAAATTGTTTTTTTAGATATTCAGTGATAGAATCAGAAAGAACACCTCGAGCAGAAA
+TATTATCGCATGAATGGAATGCAATAATTCCTTCTTCAAGATTATCTGGTAGATATATTA
+AAATATAACGCTCTTTGAGCGTTACATCATAAGCAGTTGTTCTGTAATGGACTTTTTTGA
+GTTTTACATCTTTTATTTCACTGCTTTCTCCATATTTTCCAACTTTTATATAACCATATA
+TGATTTTTTTTGTGTTATCAAAGTGAAGTTTAGTATGTTGTTCCAGAGATATTTTAGTTT
+TTGAAACGCCGAACTCGATGGGGGTGTTTTTATAAAGAGTAAAATAATCAACAAAAAGTT
+CATATGCCGTTTTTTTATTACTTAAACCTAAGTCATTAAGTTTTTTGCTGGCTCGACTGC
+CTTTATGGGTCAATACGCGGAATGAATAGAAATTAACGCTGTGCATGAAAAATCCTTTTG
+AGTATACAGGAATATACTAGAACATAAATGTATGCAATGCATAAAGGAAAAGCTACCGCA
+GGGCGAATTCACCCACCGATAGCTCTTAAATGATTGTTTTCAAGCGATAATACATAAATT
+TTGGTCTGTGTAAAGAGGGATGTATCGTCAGGGCAAGGGAGATGTATTAAGGGGTATTGG
+TAAAATTTGCGTTGGGGATAAAAACGGTTTGCGGGAAAAGGAGAGTTAAGTAGAATTGTT
+GCGGGTGCTTGAGGCTATCTGCCTCAGGCATGAACACCAAAAGGCAGATAGAGAAAAGCC
+CCAGTTAACATTACGCGTCCGGCAAGACGCTTAACATTAATCTGAGGCCAATTTCATGCT
+TTGCACATGTAGGTTAGCCTCTTACGTGCCGAAAGGCAAGGAGAAGCAGGCTATGAAGCA
+GCAAAAGGCGATGTTAATCGCCCTGATCGTCATCTGTTTAACCGTCATAGTGACGGCACT
+GGTAACGAGGAAAGACCTCTGCGAGGTACGAATCCGAACCGGCCAGACGGAGGTCGCTGT
+CTTCACAGCTTACGAACCTGAGGAGTAAGAGACCTGGCGGGGAGAAATCCCCGCCACCTC
+TGACGTGTCAGGCATCCTCAACGCACCCACACTTAACCCGCTTCGGCGGGTTTTTTGTTA
+CCCGTAAAATAAAAATTCATAAAAATGATCAACTTTCAGATTGGTTGCGCAACAAGTGAA
+AAATGTCCTTGCTGGTGAACATAAAATAAGCAAATTTATATAATGAAATAAATAGTCGCA
+GTGTTTATATTTCCCGCCTCAACAGAAATCGCGTTGAAATCGCACCTTTTCATTTTTCCT
+TAGTTGTCTGGAGGTAACGTGAAAAAACTCAAGGATTTATTAGAGTTAGATGAAGACGGG
+CTTTATGCAGTACGTGTAAAAAATGGTGAAATCTCATTCTGTACGCTAATTCCTGACGAC
+CATCTGATTCTGTCTGTTGAAGCGTTTATTGATTATCTGATAAGACTGGGTTTCACTGTC
+AGTTATTAATGTTTTAATATGTTACGGCTGACCTGAACAATCAGCAACCTACAGCGCCAC
+CGGAGAGAACGATGGCGCATCTACAACTTGTTAAACAAACCTCATCAGGGCTTCTGCTCC
+CGGCAACGCCGGAGAGTGAGGACTTCCTGCGCTCAGTAAAAATCGGTGCGTGGATACACG
+CCGATTTTAAGCGAGTACGTAACTACGCGTTCCACAAACGTTTTTTCAAGCTCCTTCAGC
+TTGGTTTCGATTACTGGACTCCGATCGGCGGGGCGATCCTGCCTCAGGAACAGGAGCTGA
+TTACCGGCTTTGTCGATTTCCTGTGTGAGTCAGCAGCGCAGGGCCACAGTCCCGCACTCA
+GTGACGCGGCGGAACAGTACCTGCATAAGGTTGCTGTCAACCGAACGCTCGATGTTGCGC
+TGCTCAAGTCCTTCGACGCTTTCCGCGAGTGGGTAACCATTCAGGCCGGGTTTTATACTG
+AGCATTATTATCCGGATGGCAGCCGTGGGCGCCGGGCGAAATCCATCGCTTTTGCGAATA
+TGGACGAAACCGAGTTTCAGCAGGTTTATAAGGCCGTACTGAACGTCCTGTGGAACTGGA
+TTCTGTTTCGTAAATTCTCCTCTCCGGAAGAGGTCGAAAATGTCGCAGCGCAACTGCTGG
+AGTTTGCGTAATGGCGGATTTACGTAAAGCGGCGCGGGGCCTGATGTGTACGGTAAGAAT
+TCCCGGCCATTGCAACCATAATCCTGAAACGTCCGTACTGGCACATTACCGGCTGGCGGG
+TACGTGCGGAACGGCGACAAAACCAAACGATATGCAGGCAGCAATTGCCTGTAGCTCGTG
+CCACGATATTGTCGATGGGCGGGTAAAAATCGACGACTTCACGAAAACAGAAATTCGCCT
+GATGCACGCAGAGGGCGTTTTCCGCACGCAGGAAATCTGGAGAGAGAAAGGCATTTTATG
+ATTTACCCAACAAACACCGGAAAAAGCGGAGAACACCTTCGTCTCAGCACGCTGGAAAGT
+GTGTGGATTCAGGGGAAATTGCGTATGTGGGGGCGCTGGTCATACATTGGTGGCGGCAAA
+ACAGGGAATATGTTTAACCAGTTGCTGGCGTCCAAAAAACTGACGAAGACGGCCATTAAC
+GATGCTTTGCGCCGTATGAAAAAAGCGGGGCTGGAGAAACCTGAACTGGAAGTGTTCCTG
+AGAGAGATGATCAACGGAAAGCAAAAAAGCTGGCTGGCACACTGTACGGATACGGAAGCG
+CTGATTATCGATCGGGTTGTAGGCGAGGTACTGACGGATCATCCGGGGCTGCTTGGTATC
+CTGAACCAGCGTTACGTGGGGCGGGGGATGAGTAAGAGAAGGATGGCCGAGTTACTAAAC
+GAACAGTACCCAGAGTGGGCGTTGATTACATGCCGACGCCGTGTTGAGCAGTGGTTGAGT
+ATCGCTGAGTTCATTTTGTATTCACCTATGAGAAAAGCGTTCGATTATGCTTAAAAAATC
+ATTTGCAAAATGAGCCACAAACTGCTTCAATTCCAGTACGCTTCGCAAAGCTGTATCGCG
+AGGCTAATGACAGACATGAACGCATTTTGAAACCCGCCATCGTGCGGGTTTTGTCGTTTC
+TGCAATACAGAAAAATATTCGCCAGTGTAATCCGGGTTGTTAAACATGGTGCGTTTTAAA
+TATGTTTTATGTACATTAAATTAATGTGAAATGTTTTGATAAAATAAAAATGTAATAATA
+ACTTTACGTTTATTGACACAATGAATTGTTGAAACGCCTGTTCTGACTCGTATTATTTTC
+ATCGGTCCGAAGGGGATGATGGATAACCTTCTTCTGCCCCCGAGGATCAGAGAGCCGGTT
+TTTTTGTGCATCCTGGAAAATTCACGTGAAGGAACCGGCTCTCAACCAGAGAAGAAGAGG
+CGTTTTTTTCGATACAACTATCGTAATTACTCCGTTGGTGGTGCTGGCACGTAAAGTGTG
+GATAGTGCGTTTATGATGAGTGCATGATGTATATCCTGATACAGCATCCGGTTTGTGGGG
+GCGGAGAAGCCCCGATGGACTCAGTGCCACAATTTTTTATTGCATTCAGATAGCGTACTG
+TGAATCGGATAAATGAGAATGTCAGTGTGTTGGTAATGCGGGGTTCTCAGTGCGCTATCT
+GAATGCAGTGAAATCTGCTCTGAGCAGAGCTAAACAGCATTGTCTGCGTTTGATCAATTT
+GTAGCGGGTCATAGTGGCTGACTAAAGACTCTCCGGGGCATCCCGGCACTGCATTTATTA
+CTAAAAATCTTCATATCACAGAGGCAGAACATACGGAAAATTCTTGTCAATACAACACCT
+GACACAGCAATATTTTTCGGGAGTCCCCGGCGCCTCAGGTTTTTTATCGCCATCAATAAA
+ACTATAATAATAACTCCATGTTATGATTACCACCTCTCTCTCATGAGGTGGTTTTTTTAT
+TCCCGCAAATTGCAGAAATAAGATGGAGTCATCAGAATATGCCCTGATTGTATTTTGTCT
+TTTTTGAATTAATGCAAAACATTTGGAATAAATAAACATCTAATGATAAATTTACATTTC
+TTGACGCGACTGCTTGTTGAAATGAAATTTTTATGATTTATTATTGTCGACAGTTTGGCG
+GAGGTGACTGGCAGATTTCTCCACTCCGTCGAATAAGAGAGTTGATTCTTTATACCTCCT
+GAGTCGTCTGATTAAAGAATCATCACTCGATTTGGCATTAAGGTGAAATTAAGATTCCAT
+TGATATAGGTATCGTTCTTACTCTTTGTGGTGCAGGCATATGGATATGGGGTGGTTACAT
+TAATGTTCCTTTAATTTAACCTCCTGATAGTGAATCAGGCACCGCAATTTTTTTACTGCA
+TTCAGATGGCGTACTGCAAAAAAACGGTCATTGCTTGCGCCACTGTCTGATGCTCTTGTA
+ACACATACGGGATTTGTGGTACGCCATCTGAATGCAGTGAAACCCACATAAAGTGGGGCA
+TAAACAGGATATGAGGTGCGTTTATTTTCGTCTGCGGGTCATGGTGACTGACCAACGGCC
+CTCCGGAGATAATTCCGGCACTGCATTATTTATTGAGGTGTTCCCCAGTGCGGGGGTGAC
+CGGGAAAAATGTTCTGCCGATGGTCACAGACACATACCGGGCTAATATGTGTTTTCGGGA
+GGCACCCGACACCTCTACTGTTTTTCCAGTCGATAACTATAAAACATGCTTCAGATATTG
+AGCACCGCCTCCCGTGAGGCGGTTTTTTTTATTCCGGGAAAAAGTTCTTCCCGCCATATA
+ATAAAGTTAACGTTTTCAGACCAGGGTGCGGGAAGTATCCGGGGCGGGAAATAATGAATT
+AAAAAAGAAGCGCGGCTGTCGGATTTAAGCCGCGGGACAATGTCCGTGATAGATAGTTGA
+AAAATTTCAGGCTATCCCTTTCGGGAGGTCGCCATTATTTTACTCATAACAAAATAAGAC
+CGGAACCCCGGAAACAACCTTATTTTCCGGTAAGGCTTATTTCATTCCCCGCGCCACGCC
+CGGCGCACATTCATAACTAACCACGGAGCCTTTCAGGGGTGAGCTTACGGGATGGTCAGT
+GTGACTTTCTCTGTGGGCTGGTCACCCCCGGGCGCAGGCTCACCCACTAAAAGGAAAAGT
+CACGATGTTAGGTATTTTCAGAAAGAAAACCCGCAAGGCTATTGTTGAAGTGAAGAAGAT
+GGAGAACCGGGATGCGGTGGAGGCGACCGTCTGGGGCGCATATTCCATTGCATACGCCGA
+TGGCACCTGTGACGCGAAAGAAATTGCAGTGCTGGAGAAAACCATCGCGGCACTTCCTGC
+CTTTGCGCCGTTCTCCGGCGAGATTGCCCAGATGAGTGCCAATATCCGCGCCCGCTATGA
+GGCGTCACCGCGTAGCGCGAATGCTCAGGCACTGCGTGAGCTGGCTGACGTGGCAGGAAC
+AGCAGAAGCGGTTGATGTGCTGTGCCTGTACTGGCCTCGTTCCTGTCCCGCCTTGCTGAC
+TACAACGGTAAACCGCTGGATGCGCTGTGTGCAGTGGTGATGTCGGTGCTGTCAGTGAAA
+TTTCTGACCTTCATTCATGACCAGGACATTTCATCGCTGACCGGGGTTTTTTCACGGATG
+CGGGGAGGAGGGAGTGGTCATGGAAAGTAATCTGACCGGCACACTGAATGCGGGCCTGTG
+CCTGGTGACAGTGCTGGCCCTTTTTCTCTACCGCCGGAACGGCGCCAGATACAAACCGGG
+AATAGCCTGGCTGTCGTACCTGCTGATGCTGGGCTATGCGCTGGTTCCGTTCCGTTTTCT
+GGCCGGACATTACCCGTCTTCATCCTGGCCTGTGGTGCTGATGAACGCGCTGTTCTGCGG
+GCTGGTGCTGTGGGCGCGGGGTAATGTGTCGAAAATACTTTCACTGCTGAGGCTGCGATG
+AAACCGAAGGACGAAATTTTTGATGAAATTCTGGGTAAGGAAGGCGGCTACGTCAACCAT
+CCGGACGATAAAGGCGGGCCGACAAAATGGGGTATTACGGAAAAAGTTGCCCGCGCCCAC
+GGATACCGTGGTGATATGCGCAATTTAACCCGTGGACAGGCGCTGGAAATTCTGGAGACC
+GACTACTGGTACGGTCCCCGCTTTGACCGGGTGGCGAAGGCCTCGCCGGATGTTGCTGCC
+GAACTGTGTGACACGGGCGTGAACATGGGGCCGTCGGTGGCAGCGAAAATGTTGCAGCGC
+TGGCTGAACGTGTTCAACCAGGGCGGGAGGCTGTATCCGGATATGGATACGGACGGGCGC
+ATCGGGCCGCGAACCCTTAACGCGTTACGTGTTTATCTGGAAAAGCGCGGTAAGGATGGC
+GAGCGTGTACTGCTGGTGGCGCTGAACTGCACGCAGGGGGAGCGCTATCTGGAGCTGGCG
+GAAAAGCGGGAGGCTGACGAGTCGTTTGTCTATGGCTGGATGAAAGAGCGCGTATTGATA
+TGAACCGAAAACACTGGACACACAGAATGCCGCGAATGGCGGCGAAATGGGCACTGGTAG
+CGATACTGGTGCCTTTTTTACTGGTGGGGTGCGCCAGCCTGGATAAGGCGCGCCAGATAT
+TCGAAGCTGCCGGGCAGAGTCGTAGTGAACGTCTTTTGGGCCTGAAAAGTAAATCCCCAG
+TTGTTGCTGACAACTGGGGATTTTTATAACAGCATATAAATCGTAAAGGAAATTGTCATA
+TGCCATATTCAAGAACGTGCTGAGGTTGAGAAGTTTTGGAATTTTTTCGGTGGCAAAAAT
+GGGGCAAAATGCTGTAAAAGGGGCAAAAATGGGGCAACAAAAGAGTGGATTATCGTAGCT
+TATTGTTGTTGCTGATAATGCTTAACGCATTGAAAAATAAATAAAACTATTATGCATCAG
+ATGGTTGTGATTTTTGCCCTTACTTGTTGAGGTTGTATTGCTCTTTCTTTGTATTCTTTT
+GAATTTCTTGCATTATTTCAGTTCTCTGGTACTAAATGGGGCAAATTGGGGGCAAACTTT
+GCAATTACGATAACCGCGCATTCAACATCGCTACTTGTTCGTCGTTCATGTCATCAATCC
+ACATACCGTAAATTTCATACACCATCTGCGCAGTTTCATGCCCCATTTGGCTGGCGATAA
+ATGCCGGGTTCGCTCCTGCCGTCAACAGCCAGCAGGCAAAAGCATGTCGCGTATGGTACG
+GATTACGGCGACGAATGCCAGCACGTTTTTATGGCAAGATACGCAATGGTTCAAAAGCGT
+CTTTATTCTGTCATCCGTATTACTTAAGATATCATCACGACCCGAAAAATATTGGAACGA
+AGAGATGTATGACTAAAGAAGCTGTAATCTTTCTATTTATCGCCATCGTGGTAGAAGTTA
+TCGCCACGATCTCATTAAAATTATCAGATAGTTTTACGCGTCTGGTACCGAGCCTCGTTA
+CTATCATCGGATATTGTATTGCGTTCTGGTGTCTTACCATCCCAATGCGAACCATCCCTG
+CGGGTATCATTTATGCTATTTGGTCTGGGGTAGGGATTGTTCTTATTGGATTGATAGGAT
+GGTTATTTCTCGGCCAAAAACTGGATATGCCGGCTATTATTGGCATGTTGCTTATCATCT
+GCGGCGTAATCGTAATCAATCTGTTTTCAAAAAGTGTCAGTCACTAGGCGATGATGATTG
+ATTTGAGCCCGCACTCTCTTATGCGGGCTCGGGTATTTAGCGTACCACCAGTACGGAGCA
+TTCCGCATGACGCACAACGGCTGCGGCGTTGGAACCCAACAGATAGGTAGTAATATCCGG
+GCGATGCGAGGCGATAATCACCATATCGGCCGGTAATTTTTTTGCCATTTCCAGAATCTT
+ATCTTTAGGAGAGCCTTCTGCAACGTGAGCCTGCACGCGGTCCGCAGGAAGGTTGAATTT
+CTTGATAATCGCTTCCAGTTGAGATTTGGCTTCGGCTTTCAAATCGTCCATTGCGGGAAG
+CTCTGCTGAATAAGCCAGTCCCAGTGAAGCGTAATAGGGCAAAGACGGGATTACAGTCAA
+AAAGTGCACTTTAGCGTCGTCAATCTTTGCTTCAGCTTCAACATGCGAAATTACGCGTTG
+AGTTAATTCTGAATCTGAAATATCGATGGGTACAAGAATCGTTCTGTTCATAAAACCTCC
+TGTTTAAGTATCCACTGAAATTCTACTCCCTAAAGGCACTTTATGTACAATGACATACGT
+CACATTTTAGGTGCTGCTCCACGATACTCTGCGGGGACTGCCTACAGGGGAGGGCGACGT
+AATATTACGCGTATTCCACGTAAATAATCAGCGAGTTGACGTTAAAACGTTATTTCTGAC
+TTGTCAGGAAAGACCTAAAAAGAGATGTTACCGTTTAATTCAATAATTAATGAAATAATT
+CGCAGTGAAATAGATATAATTTATACGAATGCTTTTGGGGGTATTATACGAAATAAAAAT
+TATACAATATCATTCGGTTACGATATTCTACGCCTGTTATATGCCTTTATTGTCACATAT
+TCATTTTGTCGCTGGGCCATTGCGTTAACCTTTGCTTTCCAGCGTATAAATTGACAAGCC
+CGAACGGATGTTCGGGCTTTTTTTGTTTCCAGGTTAATCCTTAGAATATTTTTTAATCTG
+CGCCGGGTTTTTCCGCTTTTCCTGCCAGCAAGGCAAGAAAGTCATAGCGTTTTTGCAAAT
+CCAATGCGGCATCTCGCCATAATTGTTCAGCTACTTCAGGCTGTTGCGCATTCAGGCGAC
+GGAAACGCTGTTCATTAAGCAACGTTTCCGCCAGGGCATCAGACGGTGGCCGAGAGTCCA
+GAGCCAGCGGCGGCTTGCCTTCATCCGCACGGCGGGGATCAAAGCGGTATAACGGCCAGA
+AACCGGTCGCCGTTAACTGGCGCATCTGGTCATGGCTTAGCGCCAGATCGTAACCATGTT
+CCTCACAGGGGCTATAGGCAATGATCAGCGACGGTCCTGGCCAGGCTTCGGCCTCCTGGA
+TGGCTTTCACCGTCTGGTTTAACTGCGCGCCCAGCGAAATTTGCGCGACATAAACATGAC
+CATACATCATCATGCTGACGCCAAGATCTTTACGGGCTTTACGCTTGCCATGTTCGCCAA
+ACTTAGTGACGGCGCCAAGCGGCGTCGCCTTCGACGCCTGGCCGCCAGTATTGGAATAAC
+ACTGCGTATCCAGAACCAGAATATTGACATTCTCCGTCAGGCTTAACACATGGTCTAAAC
+CGCCAAAGCCGATGTCGTATGCCCAACCATCGCCGCCAATCAGCCAGATTGATTTTTCTA
+CCAGCGCATCAGCATCCTTTAACAGTTCCTCTGCGCCCGCAACCGATTTCAGATGTTGGC
+GTAATGCGGCGACCTGTTCACGCCGAACGTCAGGCGTTGCTTCGGCATGCAGCGCATCGT
+TTAATTCCGCCGGAATGCGATCGGCGAATTGCGCCAGTAAACGCATGACGCGCGCCCGGT
+GCTGATCCACACTCAGACGGAAACCGAGGCCAAATTCCGCGTTATCTTCAAATAGCGAAT
+TCGCCCACGCCGGGCCGCGTCCGTTGGCATCGGTGGTATAAGGCGTAGAGGGTAAGTTAC
+CGCCGTAAATAGAGGAACACCCCGTGGCGTTAGCGATTAACATTCTGTCGCCATATAACT
+GAGTCAGCAGTTTAATATACGGCGTTTCACCGCAGCCGGAACAGGCGCCGGAATATTCAA
+ACAGCGGCGTAATAAGCTGCGATGTGCGGATATCAATTCGTTCCAGTTTGCTGCGATCGA
+TTTCCGGTAAGTCGAGGAAAAAGTCATAATTCACTTTCTCTTCTTCCACATGCTCCAGGC
+GCGACATCATGTTAATAGCCTTGATCTGTGGATTTTGCCGATCTTTAGCCGGGCAGACCT
+CTACGCATAAATTACAGCCAGTACAGTCTTCCGGCGCGACCTGCAGCACATATTTCTGGC
+CGCGCATATCGCGGGACTTCACGTCCAGCGAATGCAGACTGGCTGGCGCGTTCTCCATCG
+CCTGCGGGGAAACGACTTTTGCACGAATCGCCGAGTGAGGGCAGGCGGCGACGCAGTGAT
+TACATTGTGTACACAGTTCCTCTTTCCAGACAGGAATCTCTTCGGCGATATTGCGTTTTT
+CCCAGCGGGTGGTGCCCATTGGCCATGTTCCGTCCGGCGGCAGGGCGGAAACAGGCAGTG
+CGTCGCCGAGGCCCGCCAACATGGCGGCGGTAACGGTTTTCACGAAATCCGGCGCGGCGT
+CGGAGACGACCGGCGGGCGATGCGCGCTATGCGGATTAACCGCCTGCAACGGCACTTCCG
+CCAGCGATTCCTGCGCCAGAGCCAATGCCTGCCAGTTACGCTCAACCAGATCCTGTCCTT
+TGCTGCTATAGCTTTTGGCAATCGCGCCCTGCAGCTCAACCAGGGCGCTATCGCCCGGAA
+GAATATGCGTCAGGTGGAAGAAAGCCATTTGCATGACGGTATTGATGCGGGCGCCAAGTC
+CACATTCGCGGGCGATTTTCGCCGCGTTAACCACGTAAAAACGCGCCTTTTTCTGATTCA
+ACACCGCCTGAACTTCTTGCGGCAGACGCGACCAGACCTCGTCGGCGCTGTACGGCGTAT
+TAAGCAGAAAGATACCGCCGGGCTTCAGACGCTCCGCCATCTGATATTTATCGATAAACT
+GTAATTGATGGCAGCCGACAAAATCCGCCTGAGCAATTAAGTAAGCGGAACGAATGGGTT
+TTTCGCTGACGCGCAGGTGCGATACCGTGAGCCCGCCAGCTTTTTTAGAGTCATAAACGA
+AATAACCTTGCGCATACCACGGCGTAGAATTACCGATAATTTTAATATTATTTTTCGTGG
+CGGATACGCTGCCGTCGCTTCCCAGACCGTAAAATAACGCTTCAAGTTTAGCGCTGCCGG
+GCAGGGTATTTTCCGGTAATGGCAGCGAGAGGTTAGTAACGTCATCATAAATGCCCACCG
+TAAACCGTGGCTTGGGTTTCGCACGGCTGAGTTCATTAAAGACCGCCAGTACGCACGCCG
+GGCCGAACTCTTTGGATGATAGCCCATAACGGCCGCCAATGGTGCGCGGCAACGTTTCGC
+GCTCGCCATTATTAAAGGCCTCCGCCAGTGCGGTCATCACGTCCAGATAAAGCGGCTCGG
+CCTGGGCGCCAGGCTCTTTGGTGCGATCCAGCACGGCGATAGCGCGAACGGTTTCCGGTA
+ATGCCTGTAACAAATGTTTGGCGGAGAAGGGGCGGAACAGACGGACTTTCAGAACGCCGA
+CCTTTTCTCCGCGTATCAGTAGCTCGTCCACGACCTCTTCGCAGGTGCCGAGGGCGGAGC
+CCATCATTATGATGACGCGTTCAGCCTGGGGATGGCCATAATATTCAAATGGCTGGTACT
+GACGGCCCGTAGCGTCGCCAAATGCCTTCATCGCCTCTTCAACATGATCATAAACGGCGT
+TGTACCACGGGTTGGTCGCTTCGCGAGACTGGAAGTAGGTGTCCGGATTCGCTGAAGTTC
+CACGAATCACCGGATGTTCCGGATTCAGCGCGCGGGCGCGGTGAGCGTCGATCTCCGCCT
+GCGGCATCAGGTTCAGAATGGTTTCATTCGTTAGCGGTATAATTTTGTTGATTTCATGCG
+ATGTACGGAAGCCATCAAAAAAATGAATAAACGGAACGCGGCTTTTCAGCGTAGCCCTGT
+GTGCGATCAGCGCAAAATCCTGCGCTTCCTGAACGCTGGCGGCGCATAACATCGCGCAGC
+CTGTCTGGCGGACCGCCATCACATCGGAATGGTCGCCAAAAATAGAAAGCGCGTGTGTGG
+CGACAGTGCGCGCGGCAACGTGCAGTACAAACGGCGTGAGCTGCCCCGCCAGTTTATACA
+GCGTTGGAATCATCAGCAGCAGCCCCTGCGATGATGTAAATGACGTAGAAAGCGAACCGG
+TTTGTAACGCACCGTGAACGGCGGCGATCGCGCCGCCTTCCGACTGCATCTCTACCACAC
+GCGGCGTATCGCCCCAGACATTTTTAAGCCCATTGCCGGCCCAGGCATCCGCTTGTTCAG
+CCATTGTTGAACTGGGCGTAATCGGGTAAATGGCGATAACCTCGCTGGTACGGAACGCCA
+CCGACGCTACTGCGCCATTACCGTCAATTGTTTGCATATGACACCCTTACATTGCGCAAA
+AAAGAGGGACACGCATAATCGTGAGCGCATCCTGTAGTTATCCTTTTATTTTAGCAAAGC
+CCTTCAAGCCCCATTTTCGCTTTTGTGTCCCTGGCGGGAGGAGAATGGCGATTTCTTGCC
+GAAAAGACGTAAAAAATTGCCAATAAATGTTAATGAAGCGCATAAATGCGCGCTTTGCCT
+CTCGACGCGTCAGTTTCTGCTGCCTATTATTTAGGGCGGTGTCGTTTGGATGAATAAACA
+GAGGGGAGAGAAATGCGCGCAGCGTTTTGGGTGGGATGTGCCGCGTTATTATTGTCGGCT
+TGCAGTAGCGAACCTGTTCAGCAGGCAACCGCGGCACATGTTTCGCCAGGGATGAAAGCG
+GCGATGTCCAGCGCCGGCGAAGCGAATTGCGCTATGATTGGCGGTTCGCTTTCAGCGGCC
+CGGCAGCTTGATGGTTCAGTAATTGGTATGTGCGCGCTACCCAACGGCAAACGTTGTAGC
+GAACAGTCGCTTGCCGCCGGAAGCTGCGGGAGTTATTAAGCGCGGCGTTTCGCCTGACGC
+GTATAACTTTTCACTTAATGGCTTAGTGCGCTAAATCCGCCAGTTTATACATTAGCGTTG
+TTTCTGCCGTCGCCAGCGTTAATTGGTTCGCGGTTAAATCGACCTGTGCGCCCTTGCTGA
+AGAGCTCGCTGAGGGTGCCGTCCAGCGCGTTAAGCTGTGGATCGGCGCACATCATTCGGG
+TCATCGCTAAATTTTTCACTTTTAATTCGCCGTCCGACAGTTTTCCTTCGCCGGTGAATT
+GATTGCACATTTTGCCGGATACCGTCATGTCCTCGCCAAAGCTGAGCTCCGGGCCGGTGA
+CCGTTTTACCGTTTACGCTTTCCAGAACAAAGCGGTGGTGCTCCAGTTGCTCGCGTTTGA
+CGGACACTTTTCCACTGCTCACACACCCTGTCATTATGATGCTCAGGGCGACCAGCGTGA
+CGCTTTTCTTCATTGATATTCTCTGTAATCTGATAGTTAACACTGACTATAGTAATGATA
+TGACCGGATAGATCTTCAGGGGTTATCCGAAAATGCTCCCCTGAGCGCAGGGGAGCGACA
+GGATTAGAACAGCGCGTTCGGGCAGGCTTCGCCCTTCTCAAGCTGGCTTAAGTTTTGTAA
+CGTGGTTTCAGAGATGCTGATCAGCGCTTCTGCGGTCAGGAATGCCTGGTGCCCCGTAAA
+CAGTACGTTATGGCAGGCCGACAGACGGCGGAAAACATCATCCTGGATAACATCGTTTGA
+CTTATCTTCAAAGAACAGGTCGCGTTCGTTTTCATACACATCCATCCCCAGCGAGCCGAT
+TTTCTGATTCTTCAGAGCTTCGATAGCCGCCTGGGAATCAATCAGCGCGCCACGACTGGT
+ATTAATGACCATAACGCCATTTTTCATTTGGTCGAATGCCGCATGGTTCAGTAAATGGTA
+GTTTTCCGGCGTGAGCGGGCAGTGCAGGGAAATGACATCCGATTCGGCAAACAACGTTTG
+CAGATCCACATACTCGACGCCGAGATCAAGCGCGGCGGTGCTGGGATAGGGATCAAACGC
+CAGTAAACGCATTCCAAAGCCTTTCAGGATACGCAGCGCGGCGACGCCGATTTTACCGGT
+ACCAATGACGCCAGCGGTTTTTCCGTGCATGGTAAAGCCGGTCAGTCCCTCAAGGGAAAA
+GTTAGCGTCGCGGGTGCGTTGATAAGCGCGGTGAATACGGCGGTTCAATGTCATCATCAT
+GCCAATCGCATGTTCAGCGACGGCTTCCGGAGAATAAGCCGGTACGCGCACCACCTGCAA
+ACCGAGCTCTTTTGCGGCATCCAGGTCGACATTATTAAATCCGGCGCAACGCAGCGCGAT
+GTATTTCACGCCGTGTTTTTTCAGCTCTTCCAGTACCGGTCGGCTCCCGTCGTCATTCAC
+GAAGATACAAACTGCTTCACATCCATTGGCGGTTTTCGCCGTTTTCTCGGTTAGCAGAAA
+ATCAAAAAACTCCAGTTCAAAACCGAACGCTTCGTTCACTTGCTGTAGATATTTCTTGTC
+ATACTGTTTGGTACTATAGACGGCGAGTTTCATATGACCTTCTCCAGTGATGTTTGAATC
+ACACAAATATGCTTAAAATTATCTTACAAAAAATCAAAAATAATTGATAGTCATACATAT
+AATGAATAATTTTAGGTTATCATTCTCCACAACGCCTCAAATAGCCGGAGGGCGCCCCTG
+CAACATGAACTATTAGGCTATGTACGGGCAATCATGCCAAAATAAAGAGATAGCCGACTG
+AATTTTTCGTTAAATCAGGAAATTAATGGCCCATGAAGGGTAAATATAAAGCCGCCCTTG
+CGCTACTGTTACTGCTGATTCTTATCCCTCTGACGCTACTGATGACCCTCGGGCTGTGGG
+TTCCCACTCTGGCGGGAATTTGGCTACCCGTCGGTACCCGTATCGCTCTGGAACAAAGTC
+CACGCCTGACACGTCATGGGTTAGTGATTCCCGATCTTCGCTATCTGGTCAATGATTGTT
+CGTTAGCGCATATTACCCAGGCGGAACTGACGCATCCCAGCCGTTGGTTGCTGAATATTA
+AAAGCCTTAAACTGGATGCCGCATGCCTGGCGAAACTGCCCGCTACGGAAGCTTCTCCCG
+CCGCGCCGCGTACGCTGGCGCAGTGGCAGTCAATGCTGCCCAATACCTGGATTAACATCG
+ATAATGTCATTCTCGCGCCCTGGCCGGAATGGCAGGGCAAGCTGGCGATCTCCATGACGC
+CGGTCATTCAGCAGATACGTTATCAGGGCGAAAAAGTAAAATTTCAAGGGCAGCTACGCG
+GTCAGGCATTGACGGTGAGCCAACTGGAGATCGCCGCGCTGGCCAACCAGCCTCCCGTTA
+GCCTGGCGGGGGAATTTGTGTTGCCGCTGGTACCGGATGGCCTGCCGGTCAGCGGTCATG
+CGGCAGCGACCTTGCGTCTGCCGCAGGAACCGTCGCTGGTGGATGCGGAACTGGAGTGGC
+GTGATAACGCCGGACAGCTCATCGTGATGGCGCGAGGTAATCCTGACCCGATTCTCGATC
+TCCCCTGGGCGGTAACGCGTCAGCGGCTTACCATCAGCGATGGCCGCTGGAACTGGCCAT
+ATCAGGGATTCCCCTTGAGCGGACGTCTGGCTTTTAATATCGATAACTGGCAAGCCGGGC
+TGGATAATGCGCAAGTCAGCGGACGCCTGAATATTCTGACCCAGGGCGATGCCGGTAAAG
+CGAACGCTGTACTGACTATCGGCCCGGGAAAACTCAGCATGGATAGCAGTGAGATGCCTC
+TACAGCTTACCGGCGAGGCTAAACAGAAGGATTTAATCTTTTATGCCGTATTGCCCGCTA
+TGTTCCGCGGCAGTCTGGCCGATCCGCAGCTCACCTTTGCACCTGGCGCATTGCTACGCT
+CGCGCGGGCGGGTGATTGATGCGTTAGATATTGATGAAATTCGTTGGCCGCTGGCGGGCG
+TTAAGGTGACGCCGCGCGGCGTTGATGGCCGATTACAGGCTATTTTACGGGCGCACGAAA
+ATGAGATGGGCGATTTCGTTCTTCATCTTGATGGCCTGGCCAATGATTTTCTCCCTGATG
+CTGGTCGCTGGCGGTGGCGCTATTGGGGGCAAGGAAGCTTTACGCCAATGCGCGCCCACT
+GGGATATTGCCGGACAGGGCGAATGGCATGATAACACCATCAGGTTGACCAGTTTGTCCA
+CCGGTTTTGATCAGTTGCACTATGGCGCAATGACTGTCACATCGCCAAGACTGGCGCTGA
+ATAAACCTATTGTCTGGGTTCGCGACGCCACAACGCCGTCGCTACAGGGCGCGCTGTCTC
+TGGTGGCGGGGAAAACCGTATTTACCAGTGGGAGCGTGCTGCCGCCTTCTACCCTTAATT
+TTAGCGTTGAAGGGCGAGAGCCAACCCTGTTCCAGTTTAAAGGCGACCTTCGGGCGGGGG
+CGATAGGGCCGGTACGGCTGAATGGGCGCTGGGATGGCGAACGCCTTCGTGGACAGGCCT
+GGTGGCCGAAGCAGTCGCTTATCGTTTTCCAGCCGTTGCTTCCACCGGACTGGAAAATGA
+CGCTGCGCGAAGGCTCACTGTATGCGCAGGTGGCTTTTTCCGCCGCACAGGGGCAGGGGT
+TTGAAGCAGGTGGACACGGCGTGTTAAAAGGCGGCAGCGCCTGGATGCCGGATAACAAAA
+TCAACGGCGTCGATTTCATTCTGCCATTTCGCTTCCACAACGGCGCGTGGCAATTGGGGA
+CGCGCGGGCCCATCTCGCTGCGTATCGCCGGGATAGTTAACCAGGTCACGGCGAAAAATA
+TCACCGCTGATTTACAGGGCGGTTATCCCTGGAGCGAGTCGAATCCATTACTGCTAAGCG
+ATGTCAGCGTAGACGTGCTGGGCGGTCAAATCATTATGAAACAGTTGCGAATGCCGCAGC
+ACGACCCGGCGCTTTTGCGGGTGCAAAATATTTCATCCAGCGAATTGATTAGCGCCATAA
+ATCCAAAGCAATTCGCCATGTCTGGTCCGGTCAGCGGCGCGCTGCCGCTGTGGCTGAACA
+ATGAAAAATGGATAATCAAAGATGGCTGGCTTACGAATCCTGGGCCAATGACGTTGCGTA
+TCGATAAAGATACTGCGGATGCGGTGGTGAAGGATAATGTCACGGCAGGCTCGGCGATCA
+ACTGGCTACGTTATATGGAGATTACGCATTCGTGGACGAAAATTAACGTTGATAACCTGG
+GCGTACTAACGATGCAGGCGGCTATTACCGGCAAAAGCCGGGTAGATGGTAAAACCGCGA
+TCGTTAACTTGAACTATACCCATGAAGAAAATGTGTTTACGCTGTGGCGCAGTTTGCGTT
+TTGGCGACAATTTACAGGCATGGCTTGAACAAAATACAGTGTTGCCGCAACCTCCTTGCC
+GGAAAGACAAGGACTGTGAGGATAAATAATGAAAATGAGTATTGCCATGCTGTCAGCGCT
+TGCGTCATTTATCGTGGTGGGCTGCACGCCACGTATTGAAGTCGCCGCGCCGGAACAGCC
+GATTACCATCAACATGAATGTAAAGATCGAGCATGAAATACATATCAAAGTCGATAAAGA
+TGTTGAAGAACTCCTGAAATCACGCAGCGATCTATTCTGAGGCCATAATGAAAAAGTATT
+TAATGCTATGGGTGCTGACGCTGAGCTTGCTCACACCTTCTGTGTGGGCCTTAACCCTGG
+ACGAAGCGCGCACGCAGGGCCGGGTCGGGGAAACGCTGAATGGCTATCTGGTGGCCTTAA
+AGAATGATGCCGAAACCCAGAAACTGGTGCTTGATATTAATCATGCCCGCCGCGCCAGTT
+ATCAGCAGTTAGCGGATAGCAATCATCTTCCCGTGGACGAGGTGGCGAAGATGGCAGGGC
+AAAAACTGGTTGAGCGCGCCAGGCCGGGAGAATATGTCCAGGGAATTAATGGCAAATGGA
+TGCGTAAATAACCGCTTCCCGACAATTTTTTTACCGCAAAATGCATTTTTATATTGGTAA
+TTTTTGAATACGGAGGTCGTATTTACATTAGGCGAACCGGAAGGCTATTTCTATACTGTC
+GACTGGTATCACTATTCGCGAGAGTAACCAGGTATGACGTCTGAAAAATTATCTGCTGCT
+TGCCATTGTGGCAGCGTCGTGTTTACCGTTCAACTTAGCGATGGCTTTCATACCGCCAGG
+CGCTGCAACTGTTCGTTTTGCCGGATGCGCGGAGCGGTGGCAGTGTCTGCGCCGCTATCG
+GGTATTAAAGTGCTAAAAGGGCAGGATAAGCTTACCGAATATCGCTTCAATACGGGCAAG
+GCGGTGCATTTTTTCTGTTCGGTATGCGGGATATATACTTTTCATCAGCGCCGATCCAAT
+CCCGATCAATATGGGGTCAATGTGGCGTGCATCGAAAATGTGTCGCCTTTTGATTTCGCC
+TGCGTTGAAGTCAATGATGGGGTAACGCATCCCAGCGATGGCGGCAGTAGCGGCGTGGTA
+GGATATTTGCGCTACGAACCGGAGACGTTGCCTCCCGTCGAAACGGGAGGCAAAAATATT
+TAAGCGGCCACGACGCTGTCAATCGCGGCTTTAGCATCGGCCTGAGCTTTAGCCGCCACT
+TCCGGCCCGTAGGCGATGCCTTCGGCAAAGACAAAATTCACGTCGGTGATACCGATAAAA
+CCAAGGAACACTTTCAGGTAAGGCGCAATCAAATCCGTCGGGGTGTCTTTATGGATACCG
+CCGCGGCTGGAGAGAACCACCGCGCGTTTACCGGTTACCAGACCTTCCGGGCCTTTTTCG
+GTATAGCGGAAAGTGATACCGGCGCGGGCAATCAGATCAAAGTAGTTTTTCAGCTGCGTC
+GGGATATTGAAATTGTACATCGGCGCCGCAATAACGATGACGTCGTGGGCTTTCAGTTCA
+GCAATGAGTTCATCAGACAGCGCCAGAGCGTCCTGCTGACGTGGCGTTAAAGGCGCATCG
+CCCGGACGCATCGCGCCCACCAGCTCGCCATCCAGCACCGGAACAGGGTTGGCCGCCAGA
+TCGCGGACAGTAATTTCATCTGCGACGTGTTTTTCGCGCCATTGTTCAATAAAATAGTCA
+GTCAACTGACCAGACTGAGAGTACCCTGCCAGAATACTGGATTTAAGAACTAATACCTTG
+CTCATGGGTGTTTCCTTTTATGTGTTTGAAGGGGCGTGCCCCGTTGCTTGTTGACACTTT
+ATTCACAAATATGTCGCAGGGATAGCGCAATATATCGAACCCTTTGTTCGAAATTATTGA
+ACAACACAAAAAAAGCCCCAATGTGGTACTCTATACCTATCATTTAAAACGATTTTAAAC
+AGGCAGAATGCTGCCCAAGAGCTTTATGACTGAACAATCTACGTTGACGCTTCAGGTGTT
+ACAGCAGCGGCTGGATGCACTGATGCTGCGCGACAAACAGCGCTTTGCGCGCCGCCTGCA
+TGGCGTAAAGAAAGTAAAAAATCCTGATGCGCAACAGGCCATTTTCCAGACGATGGCGAA
+AGAAATTGAACAGGCTGTGGCGCAAGTCGCCCTCCGTGAAGCGGCGCGCCCCTCAATCAC
+TTATCCGCAAAATCTGCCTGTTAGCCAGAAGAAACAGGACATTCTGGAAGCGGTCCGCGA
+TCATCAGGTAGTGATCGTAGCAGGGGAAACCGGTTCCGGTAAAACCACCCAGTTGCCGAA
+AATTTGTATGGAACTGGGACGTGGAATTAAAGGACTTATTGGTCATACTCAGCCGCGTCG
+CCTGGCGGCGCGCACCGTCGCTAACCGCATTGCCGAAGAGTTGCAAACGGAGCCAGGCGG
+CTGCATCGGCTATAAAGTTCGTTTCAGCGATCATGTCAGTAGCAACACCATGGTCAAACT
+GATGACGGACGGTATCCTGCTGGCGGAAATCCAGCAGGACAGACTATTGATGCAGTATGA
+CACCATCATTATTGATGAAGCGCATGAACGCAGCCTGAATATTGACTTCTTGCTCGGCTA
+TCTGAAAGAGCTTCTGCCGCGTCGCCCCGATCTGAAAGTGATTATTACCTCTGCGACCAT
+CGACCCGGAACGCTTCTCGCGCCACTTTAATAACGCGCCGATTATCGAAGTCTCTGGCCG
+AACGTATCCCGTAGAAGTTCGTTATCGCCCCATCGTGGAAGAGGCTGACGACACTGAACG
+CGATCAGCTACAGGCAATTTTCGACGCTGTTGATGAACTGGGGCGTGAAAGTCCCGGCGA
+TATCCTGATTTTTATGAGCGGAGAGCGGGAAATCCGCGATACCGCCGATGCCCTGAACAA
+GCTGAACTTACGGCATACCGAAGTGTTGCCGCTGTATGCACGCTTGTCGAACAGCGAACA
+GAACCGCGTTTTCCAGTCGCACAGCGGACGCCGTATCGTGCTGGCGACTAACGTGGCGGA
+AACCTCGCTGACGGTGCCGGGTATCAAGTATGTGATCGATCCTGGCACTGCGCGCATCAG
+CCGCTACAGCTACCGCACTAAAGTGCAGCGCCTGCCGATTGAACCGATCTCACAGGCTTC
+CGCCAATCAGCGTAAAGGGCGTTGCGGACGCGTATCGGAAGGGATTTGCATTCGTCTGTA
+TTCGGAAGATGACTTTTTGTCACGTCCGGAATTTACCGACCCGGAAATTCTACGTACCAA
+CCTGGCGTCGGTTATTTTGCAGATGACCGCACTGGGGCTGGGTGACATCGCCGCCTTCCC
+GTTTGTTGAAGCGCCGGATAAGCGCAATATTCAGGATGGCGTGCGTTTGTTGGAAGAGCT
+GGGGGCGATTACCGCCGACGAACAGCAAACGGCATATAAGCTGACGCCGCTGGGCCGACA
+ATTATCCCAGTTGCCGGTCGACCCGCGCCTGGCGCGTATGGTTCTGGAAGCGCAAAAGCA
+TGGCTGTGTGCGCGAAGCGATGATCATTACTTCCGCACTCTCTATTCAGGATCCGCGCGA
+GCGCCCAGTGGATAAGCAGCAGGCTTCCGATGAGAAACACCGGCGCTTTCATGATAAGGA
+ATCCGATTTTCTGGCGTTTGTTAACCTGTGGAATTACCTCGGCGAGCAACAAAAGGCCCT
+GTCGTCGAATCAATTCCGCCGTCTGTGTCGCACCGACTATCTGAACTATTTACGCGTGCG
+TGAGTGGCAGGATATCTATACCCAACTGCGTCAGGTGGTAAAAGAGCTGGGGATTCCGGT
+AAACAGCGAACCCGCAGAGTACCGGGAAATTCACGTTGCGTTGTTAACGGGGCTGTTGTC
+GCATATCGGGATGAAAGATGCCGATAAACAAGAGTACACCGGCGCGCGTAACGCCCGATT
+CTCTATTTTCCCCGGATCCGGTTTATTCAAAAAACCGCCGAAATGGACAATGGTCGCAGA
+ACTGGTGGAGACCAGCCGTTTGTGGGGGCGCATCGCTGCCCGCATTGAGCCAGAATGGGT
+GGAACCGGTAGCCCAGCACCTGATTAAACGTTCATATAGCGAACCGCACTGGGAGCGGGC
+GCAAGGCGCGGTGATGGCGACGGAAAAGGTTACTGTCTACGGTCTGCCGATTGTCGCCGC
+GCGCAAGGTGAATTACAGCCAGATTGACCCGGCGTTGTGTCGTGAGTTGTTTATCCGCCA
+TGCGCTGGTGGAGGGGGACTGGCAAACCCGTCATGCCTTCTTCCGTGAGAATCTGAAATT
+GCGTGCGGAAGTCGAGGAACTTGAGCACAAATCTCGCCGCCGCGATATCCTGGTGGATGA
+CGATACCCTGTTTGAGTTTTATGACCAGCGTATTAGCCATGACGTTATTTCCGCCCGCCA
+CTTTGATAGTTGGTGGAAAAAAATCAGCCGCGAGACGCCGGATCTGCTCAACTTTGAAAA
+AAGTATGCTGATTAAAGAAGGCGCGGAAAAAATCAGCAAACTGGATTACCCGAATTTCTG
+GCACCAGGGCAATCTCAAGCTGCGTTTGAGCTATCAGTTTGAACCGGGCGCGGATGCTGA
+CGGCGTGACCGTCCATATTCCGTTGCCGCTACTTAACCAGGTTGACGAGAGCGGTTTTGA
+ATGGCAGATCCCGGGGCTGCGCCGTGAATTAGTGATTGCGCTGATTAAATCGTTGCCAAA
+ACCGGTACGTCGCAACTTTGTTCCGGCGCCAAACTATGCTGAAGCGTTTTTGGGTCGCGT
+AACGCCGCTGGAGCTGCCGCTGCTGGACGCTCTGGAGCGTGAACTGCGCCGGATGACCGG
+CGTCACGGTCGACCGGGAAGACTGGCATTGGGATCAGGTGCCCGGGCATCTGAAAATCAC
+GTTTCGCGTGGTGAATGACAAAAACAAGAAACTGCAGGAAGGGCGTTCGCTCGCCGAGCT
+TAAAAATGCGCTGAAAGGCAAAGTGCAGGAGACGCTCTCGGCGGTGGCGGATGACGGCAT
+CGAGCAGAGCGGGCTGCATATCTGGAGTTTCGGCGAGCTGCCGGAAAGCTACGAACAGAA
+ACGCGGTAATTATAAAGTGAAGGCGTGGCCAGCGTTAGTGGATGAGCGTGACAGCGTCGC
+TATCAAATTGTTTGATAATCCGCTGGAACAACAACAGGCGATGTGGTGCGGTTTACGCCG
+TCTGCTGTTGCTCAATATTCCTTCACCGATTAAGTATCTGCATGAGAAATTGCCGAATAA
+AGCCAAGCTGGGGCTGTACTTTAACCCGTACGGCAAAGTACTGGAGTTGATTGATGACTG
+TATCGCCTGCGGGGTAGATAAGCTGATAGATGCCAACGGCGGGCCGGTTTGGAGCGAAGC
+AGGTTTCACCGCGCTGCACGAAAAGGTACGCGCCGAGCTGAATGATACTGTGGTGGATAT
+CGCGAAGCAGGTTGAGCGGATCCTGACGACCGTATTCAATATCAATAAGCGTCTGAAAGG
+GCGGGTGGATATGAGCATGGCGTTGGGGCTTTCCGATATCAAGGCGCAGATGAGCGGTCT
+GGTATACCGTGGTTTTGTGACTGGCAACGGCTTTAAACGTCTCGGCGATACGCTGCGTTA
+TCTGCAGGCAATTGAAAAGCGGCTGGAGAAACTGGCTGTCGATCCGCACCGCGATCGGGC
+GCAAATGCTGAAAGTCGAAAGCGTCCAGCAGGCGTGGCAACAATGGATAAATAAATTGCC
+TCCAGCGCGTCGCGAAGATGATGATGTTAAAGAGATCCGTTGGATGATTGAAGAACTGCG
+TGTCAGTTATTTCGCCCAACAGCTCGGTACGCCTTATCCTATTTCCGATAAGCGTATTTT
+ACAGGCCATGGATCAGATTACGGCCTAAAAAGCCAGGCGACGACGTCTTTCAAAGCGATC
+CGGTACAAGTTCGGAACAAAAAGGAGGAATTATGAATACAACGCCATTTCCGGCGCTCTC
+TGCGGAAACATTGCTGGCGGTGAATACCGTCGGACAGTGGCTGGCGCAAAATGATTTTTC
+CGGCGAACAACCTTATTCGTCGGATTGCGTCGTCCTGGCGGGCAATGCGGTGATCCCCAC
+TATCGACGCGGCCTGTCGCATCGCCAAAGCGCAAGGCGTTCCTTTACTGATTAGCGGCGG
+TATAGGTCATTCGACGCCGTTTTTGTACGCCGTGATTGCCCGGCATCCGCGCTACCACAC
+TATTCGCACAACCGGACGCGCTGAAGCCGCGATCCTCGCGGATATCGCGAACCAGTTCTG
+GCATATTCCGGCTGAGAAAATTTGGCTGGAAGATCGGTCAACTAATTGCGGCGAAAATGC
+CCGTTTCTCTTGCGCACTGATCCGTCAGGCGAAAGAAAACATTAACACGGCTATCGTTGT
+GCAAGACCCCACCATGCAGCGGCGCACTATCGCGGCATTCCGGCGCGTGACAAACGACGA
+CACCGATGCGCCGCGCTGGCTGAGTTTTCCTGGTTTTGTTCCGGTACTGCGCCACCTTAA
+CGGCGGTACACGTTTTGCCAACGTTGAAGAGGGCATCTGGACGGGGGGGCGGTATCTGTC
+TCTGATTGCCGGCGGGCTGCCACGTTTGCGTGACGATGAAACAGGGTATGGACCGCGCGG
+TAAAGATTTTATCATTCACGTTGATATCCCACGCGATATTGAAAACGCATGGCAGGTATT
+GCAGGCAGATACGACGCTGCGCAGTGCGTTAGAACAGAGAGCGTTACGCTAAAAATCGCC
+CGTTTGCGAGGGTGAACGGGCAAGTGCGACCACCATCTCATAAATTTGATGAATTATTTA
+TAAAAGCTGGTTATGTTGTCGCTTTACGGTTTTCATTCAGGACGCGCTATGGGCAATAAG
+TATTCCGGCCTGCAAATTGGTATTCACTGGTTAGTCTTTTTTCTGGTTATTGTGGCTTAC
+GCCGCGATGGAACTGCGCGGTTTTGCGCCGCGTAGTTATCGGCCCTGGTTTAATATGACG
+CATGTTTCATGTGGTATCACTATTTTGCTTTTAATGGTGGCGCGCTTGATTATTCGGCTG
+AAATATCCCACGCCGCCCATTGTTCCTCGTCCAAAACCGATGATGACCGGAATGGCGCAT
+TTAGGACATCTGGTGATTTACCTGTTATTTATCGTGCTGCCTGTTATTGGTCTGGTCATG
+ATGTATAACCGCGGCAATCCCTGGGTCGCATTTGGCATTACTATGCCGCATGCCGCCGAA
+GCTAACTTTGAACGCGTAGATATGCTGAAATCCTGGCACGTCACGCTGGCGAATCTGGGC
+TATTTTGTTATTGGACTTCATGCCATCGCTGCTTTGATGCATCACTATTTCTGGAAAGAC
+AATACGCTGTTACGGATGATGCCGCGTAAGCGTAACTGACCGTCCTGTATGACGTTTGCT
+ACAGGCGGGGGTAACTGCTTCAGGCAAACAAGGCATCTATCAGAGGGGATGGCGTATTCC
+ATACAGAAAACGCCTGCGTCTAACCAGGACCCGTGACGCAGGCGAAGGAGGACGGGTCTA
+CATCGGAAGCGGGTATTATACTTATTTGTATGACAAATAAAATAAACAATTACTATTCCG
+TAATCCAATGTTTAATCAACGGGTTAAACCCACATGATCGCGCTGCCGACCGCCCGGAAG
+TGCCTACACTTACAATGAACGTGGCATAGTGGCGGAAAATAGCGCAACGGCGCCATGTTG
+CTCCAAAGTCACCTTAGCGAAATGTTCGTCCAACACGCTGCGTAACGTATCGGCTGAATC
+ATTGGTATTACTGAATATTCCTTTCTTGTTATAAACAGCCATTAATTTCTTACCAAAAGC
+ATTGTGAGGAACCTCTTTGCCCAGAATCGTGGCGCCAAAAAGTGTGCCGCCGGGTTTAAG
+CGCCATACCGGCATTTTTAATTGCCTTCGCTTTTGTTGTCATCTCACCGGGTAAGCAGTG
+CAGAAGATAGTACATCGAAACGGAATCGAAGCGCCCGTGCCAGTCCGCCGGGAACGTGTC
+GAAAACATCGTGTTGTAGTGTGGCGCGGATTTTCGTATTACCCACTCGGCTGGCGGCTAT
+TTTCAGGCTATCCGGATTTAAATCCATCAGCGAAATGGCATGAGTCGCAGGTGCATGTTT
+CAGGTAATAACCTGTACCTACGCCAATATCCAGGTGAGTCTCGCCCATGTGATGCAGGAA
+GAAAGGAAGTAGTCGCGTATCAGTAGGACACTTCCATGCATATTTGTTTGAGATATTGAG
+TACCCACCAGTCATATAAGCTAAGCGTGAATGGGTTATAGACTTTTGCGCCTGATTGTTG
+TGTATGCTTCATTGTTCTCTCACTAAATAATTTCGCGCTGGAATTAAAACAACGAAGCAA
+TCGTTAGGCAAGCATTAATCAGGTGAGTGAGTAATTTAATGCGATGAATAAAGGAGATAT
+TATGAATTAAGCGGCTATCTTAAAGAATATAGAGGATAATAATAGCTGATAAATGAATTG
+AACAGTCATATTATTATAAGCTGATAATTAATAATCGTTGATGTACGCGTATTAAGCCCT
+TTGATAATAACAATGCAATTAAATGCAGGAAGAACAATATTTATTCAAACACATAAAGCG
+ATTATTACACATTAATTGATATTTTAAATGTTACGCTGAGATAGCCATCTTTATTTAATA
+TCACCTACCTGGAGGCGATATGATTGAGGTTTTTGAAGCGTTTGGCTGGACCTTACTTTT
+AGGCGGTCTGGCAGTGGCAGTACTGTTTATCACTGCACTGGATAAAAAACGGTAATCATT
+GCATTTGACGCGCCTGTTGAGTCGGTATTACAAATAACTGTACCTGAAATCTACCACTTC
+TGAAGTTTGCGATATTTTGCCATTCTGACGGCAAGGGATAATCCTGACTAAAGTTACCGC
+CGCTTACCAACCAGACACGATGGTAACTTTTTGAAAGCGTTGTCAGAGTATCAATATATG
+TCTGATCGGCTTGCGCATAAAACAGTGAACCAAATCCATAGGCATTCGGTCTGCCTGATG
+TTCCATGAGCGTTAGGCGGTGTATAAAGAAACGTACGATAATCTCGCTTATTATAATACA
+CATAACTTAAATAATCGAACATTTTACTGACTACCACGGCATCATTAGGCTGGTGACGGG
+TATTAATATAGTTTACCAGTGGTTTAAACTCGTCTATGTGCTCAGGGTTATTATGATATG
+AACCATAGCCGAATAATAAGGTGAATAAGATAAACCAGAAGCCACAAACCGCTTTTTTTG
+CGCGGGTAAGTAATACCGCGAGCAGGGGAGGAATGCTCAGCGATGAGAAGAAGAAATAAC
+GATCGATAAATAACGGCATCCACCAGGAAATGATGAAGACCAGCATTACAGGGATGACCA
+GATTACAAAATAATATCAGCTGATATCTTTCATATTCTCCGTTGCATAAAGATATTCGCC
+CCACAGTACCGATAAAACCTCCCACAGCCAGCCACAGAATGAACGACGGAAAACCCTGTC
+CGTTGTTTCCGGTAAAAAATGCCAATACATCGCAGGCAGGTCACGCCATGTTACGGGGGG
+AATCCAACCGATATCATTACCGGCTCTCAACTGCGCCAGATGAGTCAGTAAATTAAACAA
+TACGGGCAACCAGGGGAGATAAGCGACAGCAATCGCCAGGTTAGCAAACCACCAGCCAGG
+AAGTTTAAGGTAGCAGGCCGTTTTATGGCTTTGGCAGGATAATATTGTTACTGCGATCCA
+GTGGGCAATAAGTGTAAATAGGGTGAAATAATGGGTGTAAAAGCTGAACGTCATAAGTAA
+AGCATACGCGATAAGATAGCGATTATGGGTGGGTGTTTTTATCCACATCATCAATGCTAA
+CGCGGCAGCGAGCGTTAGCATTCCCATTAACGCGTACATGCGCGTTTCTTGACTGTAATG
+AACTGCCATCGGCATCAGGGCGGCGAACCATCCCGCCAATAAGGCTGTACGTTCATTTGC
+CAGTCATCGCGTAAGCGCGATAACCAGCACAACTGTCAGGATCCCAAAGAGTAGACTGAG
+AGAGCGTACCGCTGCAATGCTATCACCCAATAATATGATCCAGTCATGCAGTAACAGATA
+ATAAAGCGGGGGATGCACGTCAAAAGCGGTATGGAATAGCAGATTATCTACGCTATGTCG
+ACTAATCAGCACGCTGGACGCTTCGTCACACCAAAGGTAGCGGTCAGTTAAAAACAGCAA
+CCGTATAAGGACGGAGAATATGACAATGAGACAAACATGATATTTATACTTTATTTTTCT
+TAACCCATCGCCGGGCTGCCATATTGATAGTTGTGGTAGCGCCATAATATCCTCAATGGA
+GTAAGACTTAGACCAGAATGGACACCTAACGCAATAATGAAGGTTAAAATCTTAACCAAC
+ACTAAATAAAAATAACTTTGATAATGTCAGTGGTGAATTAATCAGAATAGTGCAGTGCAA
+CTCAGTAACCCTGACCGTAATGGCGAAGCAGTCTATGCTCTAAAAACCGGGTCAAACCGA
+CGATAAAGGTAACGCCAATAAGATACACTATGGCGGCAAAAAGGTAAGCATGGAAGAATT
+TAAAGCTGGTTGCAGCAACCTCCTGAATTCGCGCGAAAAACTCAGTATATTGGATAAGAA
+AAACGATGGTGCTGTCTTTAAGGTTATTAATCACCTGATTCGTTAAGGCTGGAATGGAAG
+ACAGCAATACCTGAGGCAGTATAATCCACAAAAAGACCTGCCGTTTGTTCAACCCCTGAA
+CGACTGCTGCCTCCGTTTCATACTTATTCAATGCGTTATAGGCCGTTGTCATGTACGCGG
+CATTATATGCGCCGACATTCAAGGTAAAACCTGTAACCGCCACGGTAAAAGAGGACAGGT
+GAATGCCAGATTGAGGTAAACCATAATAGATAACAAATAGAATAAGAATGAGTGGCGTAC
+CGATAAAGAAATCCATGTACAGTCGAGTTATGGCTTTTACCACGGGGCGATGGCTCAGGC
+TCAGAAAGAAAATAATAATTCCCCACAAAAAACCGGTGATGGAAACAATCAGCGCAAGTT
+TACAGGTTTCTTTAATACCGTCCACAACAAGTGGCAGTTGTTCAGTCAGGTCATTAAAGA
+AGAGAGACCAGCCAGCGATCATCGTTGTGCCTCGCTAAAAAAACAGTGGATATCTGGATC
+CGTTTCTCGTAAGGCAAGATCGGTAAAAGCGCCTTCTGCACGAATCTTGCCATGATTAAG
+AAACGTTACGTTATCGCTTAGTAATCTGGCGAGGCGAATATCATGAGTGACGCATAATAT
+AGTGACGCCATTGTCGTGAAGTTGCTTGATCAACATTCCGACTTCACGAGTCATGAGCGG
+ATCAAGCGCAGACGTCGGCTCATCAAAAATAATGAGTTCTGGGTCGGTGACCATTGTACG
+GGCCAGGGCGACGCGCTGTTGCTGGCCGCCCGATAATTGCGAAGGGTATTTCGCGCTATG
+CGAGGCCATATCAAGTTTTTGTAGCTCATGTAAGGCTTTCTCCCGGGCTAGTTGTCCCGG
+CATGCCAAACACTTTACATAGGGCAAGGGTAATATTATCCATGACGTTAAGATGGCGATA
+CAAAGCGTAATTCTGGAAGACACAACCAACTTTTTTTCTGAACTCAAGAATAGTAAATTC
+TTTGTCGTAAATATTTTTCCCGTGAAAATAAATATTGCCATAATCAGGTTCTTCTAATCG
+AAGCAGACAGCGTAAAAGCGTCGTTTTTCCACAACCTGATGGCCCCATGACTACTTTCAT
+GTCTCCCGATTGAATTTTCAGACTAACCGTATCAAGAACCTTTTTTCCTGAATATTCCTT
+ACTTATCTCTTTTAGTTTCAGTAAAGCCATGAGTATCACCTCTATTTTTATGGTTCAACT
+GATGCGATATTTTTTCTCAAACACTCCGGCCAGAAGAGTAAAAACTTTATAAATAATGAA
+ATATAATACCCCGTCAAGAGTATAGATCTGTAACCCGTTCAGCGTGATGGCTGTCAGTGA
+CATTGCCTGCTTCGTTATTTCAGCGATACCTACAGTATAAGCAAAGGGCGTCGCTTTTAA
+TACAGAAGAAAACTCATTGATAATACCGGGCACAGAAAATCGCAACATCTGTGGCAGTTC
+AATATTTATTATAACCTGTAATTGACGCATTCCTGCTACTTTCGCTACCGTAATTTCGTA
+TGGCTCAACTAATTTAAGCGCCCCTCTGAACACCTCGGCAAGATAGCTCCCACTGATTAA
+GCCGACGCTGAGGTTCATGGCCACCAGAGGTGAAACATATATGCCAATCGATGGCAATCC
+AAAATAAACAAGAAAAACAGCAATAAGTATTGGAATTCCCCGAAGAATAAAGACCAGTAC
+GTCGAGTATCTTCTGTAGTGGAAGGGGGGATAGTCGCCGTAATACGGCGACTGTAAGCCC
+AAACAAAAACGCTGAGAGAAAACAGGTAAATGTTACAAGCAGCGTATTACCAATCCCTTC
+CAATAGGAAATAAAAGATAGCCAGCATATTACCTGATGACATAGCTTACTATTTCATCCA
+GCTATCGACAATGCCAGATATTTTTTGTGGCCCTTGCTCTTTAAGCCATAAGTTGAAATC
+ATCGCGCACGGGAGAGCCTTTCTTAAAGGCAATGCCAAGCTGATCAACATTCTTGAAAAC
+ATAACGGCTTTCTATCGGCATCTTTTTCTTATTTTTGAAGGTAAAATAAACCGGCTCTTC
+TATAAAAGCCAGATCAAGATTGCCATTTTTTAGATCAGCCATCGTCTCATTATAGGTTGG
+ATACAATTTTACTTTACTTAACGAGTAGTATCCTTTGGGCTCCAGATCGTTTTTGATAAG
+GTCGGAGTAAGCCATTCCTCGAGGGTATCCAATAGAATATTGATTTAATTCATTGAGGTT
+ATTGAGCGTTATTTTATGATTGGCCATACTGACCAGATAAAAAGAGTTGATGTAATAAGG
+TTCAGAGAAATCAATAACTTTCTTACGTTTATCTGTGATTGAAATTCCCGAAAATGCTAC
+ATCTGCCTGACCACTCGCCACTGCGCCAAGCATTCCATCCCAGGCATATTCGGTGATGTT
+TAGCTTACAATGCCGTGACTGACAGTAAGACGAAAAAAGCTCCAGATCTATCCCCTGCAA
+TTTGCCATCAGCACTTTTAAATAACATAGGGGGAGAGGCTGGTGATACTGCGACATTGAG
+TGTTCTCCCTTCAACGATGCTATCAGCAAACGCTGAAGACGACATTATTCCCAACACTAT
+CATCGATAAGCCAAATTTTTTGGATAACATGCTATCTATTTCCTGTAGTAAGGTAATGCG
+TATTATAAATTAAGCATTAGGGCGTGAGCCTGACATTTGCAGGCGTAAAGTACTTAACGT
+TATGTATTCCATCGCTGTTAAGTAATTTAATCAGGAGGTTTGACAGGAATCATCAAAGGG
+AATGGATTGAATATACCATAAGATATCAACTGGATATGAGTGCAGCGACACCATGAAAGG
+TGAAAATGTAAAGATACCATAGACATTAGTATACTGGACATAGTTTATGCTCCATTTACG
+CATACATATTTACATGATAAGCAGATAAATGCTTCAGTGACGGTGCCTTTCATGTCTCTA
+ATTATCATCTTACCACTCTATCCAGGGCCAATATAAAGACTTATCTTTTCTTGTCAAATA
+CATTTTTTGAGCTAAGTTGATTTGCGTGCTATCTATATTTACAAGCATATAAATTATTTG
+TCTCATGAACAAACGACAACAAGTCAGGATTTTTGACGATGTTGTTATGTTTATCAAAAC
+GTTAACTTGTTTTAATCGATGATAATCTTAATTCAGAAATATCTGAATATATACGGTTGT
+TGAGATAAAATTCTCAAATTAACATCGTACATCTTATGTAATAAATATAAATACGATTAA
+TAAATCCAAAACTGAGACTGACAACCGGATAACAAACAGCAATAAAGAGGGTTCTTCATT
+AAGTTATCCTGGCAACGATTAAGGTGATAACATTTTCGGTGGCTTTACCCATTTTAATCG
+TGTTCACAGCCGTTAATTACCTTATGATTACCATGGTAATTAAAAATGAATCCTTAATGA
+CTCGTTGGCTGAGTGAAAAAAAATTCTACATCACATAGGCGCATGTATCGCGTATAATGG
+GCTCCGATGCCCCTAATTATTGCTATGACATAATGATATGTATCTTAACCGCTTTTGTTA
+TTTACTCCTGATCTTCGCTGCGGTCGGAAGCATTTTTACATCGCATCCCGTCGCGATGTG
+GTTCCTGCTCGCCAATGTGCTAACGCTGGCGATCTACGGTATAGACAAAACGGCGGCACG
+TAAAACCTGGCGCAGAGTGCCGGAATCCACTTTGTTGGTGTTTGGGGTTGTCGGTGGGTG
+GCCTGGGGCGATTGTTGGTCAACAACTCTTCCGTCATAAAACGCAAAAGCAGCCATTCAA
+AACATACTTTATTGTCAGTGTGATAGTGAGTATTTTAGTTACGGTGGCGATTTATCGACT
+CTATCCATTTTTGTCTTACTGAACATAGACTATGTATCACTTATTGACCAATCGGCAGCA
+AAGATAGCATCATATTTTCATGCCACCGGCACTATGATATTGAGCTGTGTTTTGCTCAAG
+GCGTACCGCAGCCGATGGAACTTTATTCAGTGGAATAATGATGAGCTATAAAACTTTCTA
+ACATTATGGCAAAACAATGATGGACTTCCTGGGTTGGATGGACAAGGTCGTTGAAGACGT
+ATTGCGGACATATATCTAGCTGAGGGTCTTTAGCCCCGGGAACATGTACATAGCCGTGGT
+GAGTATAAGGGTTTTCCGTATCATAACCAATATTACTGGCCGCCTCCATTATCACCTTAA
+ATGCATCGGCAGTCTCGTAATAGCATATTTTATGCTGGGGGTATTTTTCTTTTAATTCTT
+CAACATTAGTTTTTAACAGGGCATTGTGAGCGATGCTTTCATCCTTAAGCTTTCTTTTTT
+CATCAGAATGTTTGCCATAAGGTGTTAAAGACAAATCGGGAATCCCCATGACCAGAACAT
+TATTAACTCCACCGGAAATTATTTTTTCAATATCATCAATTTGTTGCTCAACGACCATTA
+TTACATTATCTTTGTGTAGTGTCATATAGTCATTAGCCCCCAATAAAAATATCGCCAGGT
+CCTGGTGAGAAGGGGTGTAAGATGCGACTTGTCTATCCGTATTTGATACAAAGTCACCGA
+TGCAATTAAAGCAGGAATAGCTTGCCGATGTACTTCCCCCTTCAGCAAAATTAAGCATCT
+CTTTACCTAAGAAGTGTGGAGATGATAAAAACTCAGTCCAGGTAAATCCATTAGTAAACC
+TTCCGCCAAAGTATTGACCATAGGAGGGTAAGATATGATGTGTTTTTTCAAACATACGCC
+CTAAGGAGTCAGACAAGCTGTCGCCAAAAAATACCAGTCTGGTAATATCACCCAAAGAAA
+TATTTTTGGGCTTGGGATGTGATTTATTGATTTCTTTGGCAAGACCAAAAGCTTCCGGAT
+GACATTCAACCTCAATAGATAAAATATTGTCACCATTATCATCTTTAATAATCAACTTAT
+CGGCGTGTTCCTGTGATTCTATAATAAACTGTTCTTTACATCCCTGAGACGCTAAGGCTC
+GAAGTTTGATGTAGGCTCCGCGAACCTGTACCGGTGTTAGATTCAGTTCCTGATGGTGGT
+AAAGATTAAAGATACATTCGAGCGCCTCTGCATGGTGGGTGGTAAAGAAATATGCTTTGA
+TTTTCTCCCATAAACTTAATTCCGGAAGGCGTGCGCTTTCTTTTATCGCATTAAATTTTT
+CAGAACTGATAGATGATGTGAAATAACCCTGTCCAACACTCAATGGCATAGTGTCCTCCT
+TACTTTATTAAACACGCTTTAGCAAATAATTAATTAGCAAATATTAGCAAGAAAAGTAAT
+CAGGTAAATGGTGTATATGGAATTACGCTTCTTTAACAGTTTTTCGTCGCCAATAAAATA
+CATACAATGTTTATTGTTTTTCAACGAAGTAAATATATCATCAACAACGTGAGGTTAATA
+CCTGGTACATATTATCTGACTGCTATCATTATTGAGTGTGCGCCTGGCTAAGGCAAAGAT
+CTAAAAAAGAAGCCACTCCTGATTTTAGTGTGCTGGCGTGAGTATGAGCTGGCTTGATAC
+TCAGGAAAAACAGACAAACTTATCATCCGACTATTATTGCTAAAGTGCTAGTGTTTTATG
+TGACATTTTGATTTCTATTTTCATATTAAATATTTCTTAAGTGAGTTAACTATAATGAAT
+GATGATTCAATTATTAAAAACTCTTCGATGCTTTTGGCCTATTTAGGTGGTTTGGGATGG
+GGAAGCGCCTATTTTTATGGCTGGGGCGTCTCCGCGTACTATGGTTTCCCGTGGTGGTAT
+GTAGGCGTCGGCCCTGACAACATTGCCCGAAGTCTATTCCATGCGATTAGCCTGATGGCT
+ATATTCATAATAGCGTGGGGAGTGGGTATTCTATTATTTTTTCTAGTAAAGCAAAAAGCA
+CGTATCCACGACCTTAGCTTTTTACGTCTTTTTTTGGCAGCGGTTTTGTTCTTTATTCCA
+ATTGTTATCGAGTTTTCTCTCTTAACAGAATCGTTTTTGTGGGAGCTTTTTTTTATCATT
+TTACTGGTGGCTTTATGCTTATCGGTGGGGATGCGTTTTTATAGTAAATTGATGCCGGTG
+ATTTGTTTTACGCAACTCAGTTGGGTGCGAAGGCATTGTTTCACTATAGTTATGCTTGGT
+TTTATTATATATTTTTTTATATTTTCTTTTTTTGTTGGGATCTATAAACCACAATTAAAG
+AAAGAATACGAAATGATATTGTATGATGGAGGCTGGTACTACGTCCTGGCCAGATATCAT
+GATAGTTTTATTTTGTCGAAATCCTTTACTAAAAATAACAATAGATTTATTATTTTTAGA
+CCAGAAGATGGGCACTCTTATGAAATTACTCTGGTAAAAGTCAGGCTTTAATAAAATGCT
+GGTTGGCAAGAGCGTGAAATGACGGCAGAACTTCCCATAGCAACGATTGAGGAAAGAACT
+GAGCGCCCATATCTGTAGGATGTGGAATAGCAATGCCGGGAAGGACATGGCATGACACTT
+TATCTGACATTACCATTTGAGTGACAGGTTAGCAGATGTTTCAGGCCAAACCCAAGTTGA
+ACTGGAGCGCTCAGAAGCCGATTACCTACATAACAAATATTGGCCGCAAGCTTATGCTGT
+GGGCGGAATATACGACCGCTATTATCCAGACTGGCTGTTAACTTATTTATTTTCCCATAG
+TAACCTATAACAGGCCTCCCTGAGGCATTGGCTAGCATCTGTGCATTGGAAAAACAGGCT
+CCATTTGCACTATAGCAACTTATAAATTTTATTTCCTCATGAGAGTTGCTAATATGGCGG
+ATTGATTTTGAAAGTGATGATGACTGACTTGCACCGGAACCGTACCGATTTTCATGTTGA
+ACAACAAAAGGAGCACCATGTTTACAAATCGAAATAGGCATGGATTATTACCTGAGATTG
+ATTTCAAATTAACAATAATGATGACGCTTTTGGGTATTAAAAATCTTTCAAATAACGCTC
+ATTTGATTTTTTGTCCACATTGACTAAGCCTGGAAAGACACAGGGTTAAGATATTTTCGC
+TACCCGTCGGCGGTGTATCGCAGTTGTGATGTTACGTTCTTACAAGACTGACATCTGCAT
+ATCATAACCTTTATTCATTACCACCTGGTGAGTAAATAAAAACTATTAAGCAAATATTTA
+CTTCTGGGTAATGGGACTGGATTTACCGGCATTACCTCTGTGCCCCAGTCGGGCAGAACA
+TTGCAGCTTAGAAAGAAAGCTTTGGTGTTTATTGTCTGTGGCCTGAAAAAGTTCCCATGA
+GCTGAATATGCTGAATGTGAACTGATTCTTGATGGTCTATGCCGGAAATCTATAAGCTAT
+TGATTTTTATATTGTGTGTAATTTTACAATTACATAAACATAAAATTCTGATAGTATACC
+CCCCTATAGTATATGGAGGTCGAATGCCGCATTCACCTGAAGATAAAAAACGTATCCTTA
+CCCGTGTTCGTCGCATACGCGGGCAGGTCGAAGCGCTGGAGCGGGCGCTTGAGTCTGGCG
+AACCTTGTCTGGCGATTCTGCAACAGATTGCCGCCGTGCGCGGCGCGTCTAATGGCCTGA
+TGAGTGAAATGGTTGAAATCCATCTGAAAGATGAGCTGGTCAGCGGGGAGACTACGCCAG
+ATCAGCGCGCGGTTCGGATGGCGGAAATCGGCCATCTTCTTCGCGCTTATCTAAAATAAC
+AATTTCCCTCACCGTAACAGGAAGAGATATATGAAATCACGTGCAGCAGTTGCTTTTGGT
+CCCGGTCAGCCGTTAAAAATTGTCGAGATTGACGTTGCGCCGCCGAAAAAAGGCGAAGTT
+CTGGTCAAAATCACTCATACCGGCGTTTGCCATACCGATGCTTTTACCCTTTCCGGCGAT
+GATCCGGAAGGCGTATTCCCGGCAGTCCTGGGTCACGAAGGCGGCGGCGTGGTAGTCGAG
+GTCGGCGAGGGGGTCACCAGCCTGAAACCCGGCGATCATGTTATTCCACTGTATACGGCG
+GAATGCGGCGAGTGTAAGTTCTGTAAGTCCGGTAAAACTAACCTTTGTCAGGCCGTACGC
+GCCACTCAGGGAAAAGGGCTGATGCCGGATGGCACTACCCGCTTTTCTTATAACGGCGAA
+CCCGTTTATCACTATATGGGAACCAGCACGTTCAGCGAATATACCGTTTGCGCGGAAATT
+TCTCTGGCGAAAGTGAACCCGCAGGCGCCGCTGGATAAAGTGTGTCTGTTGGGCTGCGGC
+GTGACGACTGGTATTGGCGCCGTCCATAACACCGCTAAAGTGAAAGCGGGCGACACCGTT
+GCCGTTTTTGGTTTAGGCGGTATTGGGCTGGCGGTTATTCAGGGCGCGGTTCAGGCTAAA
+GCCGGGCGTATTTTAGCTGTCGACACGAATCCGGAAAAATTTACGCTGGCGGGCGAAATG
+GGGGCCACGGACTTTATTAATCCGAATGATTACGACAAACCGATCCAGGACGTTATTGTT
+GAGCTTACTGATGGCGGCGTAGATTTCAGTTTTGAATGTATCGGCAACGTTAACGTGATG
+CGAGCAGCGCTGGAATGTTGTCATAAAGGCTGGGGCGAAAGCATTATTATTGGCGTAGCG
+GGGGCAGGGCAGGAAATCAAAACCCGTCCCTTCCAGCTAGTGACCGGTCGCGTCTGGCGT
+GGCTCCGCCTTTGGCGGCGTGAAAGGGCGCACGCAGCTGCCAGGGATGGTCGAAGATGCG
+ATGAACGGTAAAATCCGTTTAGATCCTTTTATTACTCACCGCCTGCCGCTGGAGCAGATT
+AACGATGCCTTTGAACTGATGCATCAGGGTAAATCCATCCGTACTGTTATCCACTTTGGC
+GATAACTGATTCATCCGCCAGCGGATTTTCCGCTGGCGCTTTTCTGAATTTTCTGGAATG
+AATGTTGTGAAAATGTGACGAAGGCGATGCTTTTCGCGATAAGCAAACGTCACGAAGTGC
+CGATGACTATCTAACGGGCGTGTTTTACGCATAAAACCTACAAGAGAGTCGACGGTCATG
+GGCAACACATTCTCGATGCAAGCCTCGCATAAACTGGGCTTCCTGCATCATATTCGGCTG
+GTTCCGCTGTTTTCCTCCATTCTCGGTGGCATCCTTCTTCTTTTTGCTTTGAGCGCCGGG
+CTGGCAGGCTATTTTCTGTTACAGGCCGATCGCGATCAGCGTGATGTCACGGACGAGATT
+CAGGTACGGATGGGATTATCCAACAGCGCTAACCACTTACGTACCGCACGTATCAATATG
+ATCCACGCTGGCGCGGCGAGCCGGATTGCTGAAATGGATGAAATGAAAGCCAATATTGCC
+GCTGCGGAAACGCGGATCAAGCAGTCTCAGGACGGCTTTAACGCTTATATGTCCAGAGCG
+GTGAAAACACCCGCTGATGACGCGTTAGATAACGAGTTAAACGCCCGCTACACCGCCTAT
+ATCAACGGCCTGCAACCGATGCTGAAATTTGCCAAAAATGGCATGTTCGAAGCGATCATT
+AATCATGAAAACGAGCAGGCAAAACAACTGGATGCAGCATATAACCATGTCCTGTTGAAA
+GCGATTGAACTGCGCACCGAGCGGGCAAGACTACTTAGCGAGCAGGCTTACCAACGTACC
+CGACTCGGTATGATGTTTATGATTGGCGCATTTACGTTGGCGCTGGTATTGACGTTAATG
+ACCTTCATGGTGCTGCGTCGCACGGTGATACAACCCTTGCAGCAGTCTGCGTCACGTATC
+GAACGCATTGCGGCCGGCGATCTGACCATGGCTGACGAGCCCACAGGACGCAGTGAAATT
+GGTCGCCTGAGTCATCATCTTCAGCAGATGCAGCATGCGTTGCAACAAACGGTAGGGGCG
+GTGCGTCAGGGGGCGGAGGAAATTTATCGAGGCACCAGCGAAATTACCGCTGGTAATACG
+GATTTATCTTCTCGTACTGAACAGCAGGCTGCCGCCATTGAACAAACCGCGGCCAGTATG
+GAACAGTTGACGGCAACCGTTAAGCAGAATGCGGATAATGCGCATCACGCCAGCAAACTG
+GCGGAAGATGCTTCCGGTAAAGCCAGCCGCGGAGGCCAGATGGTTTCCGGGGTCGTACAA
+ACGATGGGGAATATTTCCACCAGCTCGAAAAAAATCTCGGAAATTACCGCCGTCATTAAC
+AGTATCGCTTTCCAGACCAACATCCTGGCGCTGAACGCGGCGGTCGAGGCGGCACGCGCC
+GGGGAACAAGGACGCGGTTTTGCGGTGGTCGCCAGTGAGGTTCGTACCCTCGCCAGTCGC
+AGCGCGCAGGCGGCAAAAGAGATTGAAGGCTTGATCGGCGCATCGGTCAGCCTGATTGAA
+CAAGGATCTGAAGAGGTTATCGCTGCGGGGAGCACCATGAATGAGATTGTGGATGCCGTC
+AAACGCGTCACCGATATTATGCTCGATATCGCGGCAGCCTCTGATGAGCAAAGTCGCGGT
+ATTGTTCAGGTCAGTCAGGCGATTTCTGAGATGGACAAGGTTACGCAACAAAACGCGTCG
+CTGGTCGAAGAGGCGTCCGCGGCGGCGGCTTCGCTTGAAGAACAGGCCGCCCGCTTGACG
+CAAGCCGTTGATGCGTTTCATTTACAGGATACTGGCGCGACGATGCGATCATCCTTCCTT
+TAGTAAGCGTCGCGCCAGCGGGCTATTTTAGCCGCGGGCGCGTTTATTCTCCGACAGCCG
+CTATCACAGCGGCATCGATTTACGGATCGCCGCAATCAGCATTTGCGCCCCGGTTGAGAG
+CGGGATATCAACTCGCGTAAGAATACCTATCGGCTCGCCCGCGCTCTGGGTCGGCACGGG
+TAATGAGACCAGCGTCGCCTGGCGAAGATCTTCTTTAACCGCGCCAGAGGGGACGAACCA
+GACGTAATCGTAATCTACGGTCAGTTGTCGTGATAACGATGCGGATAGCGTTTCGATACA
+TCCGGCAGGCATTTTACACCCCTGGCTTTGCAACAGGGCTTCCGCATTCTGGCGCGGTAC
+CGTGCCTTTTGGCGAGACGACTACCGGCCATTCCATAACCCGGCTGAGCGTGATCGTCTC
+CTGTAACAGGGGATGACCGGGGCGTACCACTAATTTAAGCGATTCTAAAAACAGCAGTTC
+GTAATTTAAACCGCCCATTAATTCCGGGTCTGACATGCGGCCAATACCCAGATCGATCTC
+GCCTGATTTCAGACCCGCAAGCAACATCGTATTGTTCATGGTCGCGACCTGTAACGAGGT
+CGATTTTTGCTGTTGATGGAACCGCCCAATAGCCGCCGGGAGTATACCCAGCGCAGCGGT
+GGGGAGCGCGCCAACACGCACCACATCGGCGCTGGCGTCCTCTTTGCGATTCAGCGCCTG
+CCCGGCGGTATTCAATGCATCTAATACTTTTACCGCATGAGTCAAAAATTGTTCGCCAGG
+AACCGTTAATTGCGCGCCCAGTCGCCCGCGTTCAAACAGACGGGTTCCGGTGAGTTGTTC
+CAGTTCGTTCAGCGTTTTAGAAAGCGCTGGCTGGCTCAGGTTAAGAGTTTCAGCCGCGCG
+CCCCAGAGTTCCCTGTTGCGCAACGGCTACAAATGTATGAAGGTGGCGCAACCGAATGCG
+CTGACTAAACAGACCATTTTTTTCCATAAGCGATGTTAAAAACAGAGCCGTGCGGGTGAC
+AAGTAAAGTTGTTTGTTTTTGATAACCTGATAGCAAAATATTATTAACATTTTACCATTT
+CAAGTTACAACTGTTTTATTTTACTGATGATTCAACTGCCGTTAAGCGTGTTAAGCCGCG
+ATCTGGTCGGGGATATGCCAGCTCATGTCAATCCGTTCTGCATAATGAATTCAGGTCGGA
+TCACACTTTATAAATTCTTCTCCCCGGAATGGATGAGGTTTTCTACACTCCAGGTAACAT
+TCACTGGAGGCATGACATTATGGCGAACACCATCACGGCAGATGAGATTCGGGAACACTT
+TTCGCAGGCAATGTCGGCAATGTACCAGCAGGAAGTTCCGCAGTACGGTACGTTACTGGA
+ACTTGTGGCTGACGTGAATCTGGCGGTGCTGGAAAATAATCCCAAACTGCATGAGCAGTT
+GGCTAATGCCGATGAACTGGCGCGATTGAACGTGGAACGGCATGGCGCCATTCGTGTTGG
+CACCGCAGAAGAACTTTCTACCTTGCGTCGGATATTCGCCATCATGGGGATGTACCCAGT
+AAGTTATTACGATCTCTCTCAGGCGGGCGTGCCTGTGCACTCCACGGCATTTCGTCCCAT
+TGACGAGGCTTCGCTCTCGCGTAATCCCTTTCGCATGTTCACTTCGCTATTACGCCTGGA
+GCTCATTGAAAACGCGGCATTACGCCAGCGGGCGGCGGAAATCTTATCGCAGCGGGATAT
+TTTTACATCGCGCTGCCGACAATTGCTGGATGAGTACGACGAGCAGGGCGGTTTTAGTGC
+TGCTCAGGCCGAAGAATTTGTCCGTGAAACGCTGGAGACTTTTCGCTGGCATCGTCAGGC
+TACCGTTGATGAAGAAACGTACCGCAGCCTGCATCGTGAGCATCGTTTAATTGCCGACGT
+GGTCTGTTTTCCGGGATGTCACATTAACCATCTGACGCCGCGTACTCTGGATATCGACCG
+GGTACAGGCCATGATGCCGGAGTGCGGCATTACGCCTAAAACTCTTATCGAAGGTCCGCC
+TCGCCGCGAAGTGCCTATTCTGTTGCGGCAAACCAGTTTCAAAGCCCTGGAAGAGCAGGT
+GCTCTTCGTTGATGAAAAGCAGGGTACGCACACGGCGCGCTTCGGCGAAATTGAGCAACG
+TGGCGTCGCGCTGACGCCAAAAGGTCGTCGATTATATGACGAGCTGTTGCACAAGGCGGG
+AACGGGTAAGGATAACTTCACGCATCAACTCCATTTGCGGGAGGTCTTTAACGCCTTTCC
+GGATAGCGAATTTCTGCTTCGCCAGCAGGGGCTTGCCTGGTTCCGCTATCGCTTAACGCC
+TTCCGGTGAGGCGCATCGTCAGGCGATCCATCCTGGCGACGATCCGCAGCCGCTTATTGA
+GCGCGGTTGGGTAATCGCGCAGCCGATTACCTATGAAGATTTTCTTCCGGTCAGCGCAGC
+CGGCATTTTTCAGTCGAATTTGGGAAATGAAACGCTGGCCAGAAGCCACGGCAATGCCAG
+CCGCGACGCCTTTGAACAGGCGCTGGGATGTGCTGTACGGGATGAATTTTCGTTATATCA
+GGAAGCGGAAGAACGCAGTAAACGCCGTTGCGGTCTGCTTTAAAAGCGGTAAGCTTCACA
+GGCTGTGAGGATACTGTAAAAGGAAGGCGTTATGTTGAATCCCTCCATCCCGCTGGTGGC
+GACGCGTCACGGTAAAATCGTGGGCGTCGTACAGGAAGAAACCCATATCTGGCGCGGTAT
+ACCTTATGCCGCGCCGCCAACAGGGGAGCTACGCTGGCGTGCGCCGCAGCCTGTTACGCC
+CTGGCAGGATGTGCGCCAGGCGGATTGTTTCTCCTGCGCCAGTTGGCAGGATATTACCTG
+GTGTCGCGAACTCGGCGGCGGCGATCCGGGAAATTTTTCCGAAGACTGTCTCTATCTGAA
+CGTCTGGGCTCCCGCCGTGCGTCATGAACCGTTGCCGGTCATGGTCTGGCTACACGGCGG
+CGGTTACACCATTGGCGCGGGGAGTTTGCCGCCCTATGACGGTCAAGCGCTGGCGAAGCG
+CGGCGCAATCGTGGTGACGGTCAATTATCGGCTTGGCCATCTGGGCTTTTTCGCGCATCC
+GGCGCTGGAAGGCGAAGGGGCGGAGTGTATTCATAATTTCGCTTTACTCGATCAAATCGC
+TGCGCTGCGTTGGGTGCAGGACAATATTGCCGCATTTGGCGGCGATACGCAGAATGTGAC
+GTTATTTGGCGAATCCGCCGGCGCCCGCAGCGTGCTGTCGTTGATGGCTTCGCCGTTGGC
+GAAGGGGCTTTTTCATAAAGCGATTATTCAGAGTGGTTATACGCTGCCGGATACGCCCCG
+CGAGGTGGCGCTAAAAAAAGGCGTTGCGCTGGCGGAACATCTTGGTTTAGCCCATGCCAC
+TGCCGAACAGCTACGCGCTTTACCGGCAGAGACGTTTTGGCCGCTGGACGCGCCTTTTAA
+AATTGCGCCGACGCCGATTTCCGGCGACGTCGTGCTGCCGCATCCGATGCTGGAAACCTT
+CTTTGCGGCGAAACAGCATCCAATACCGGTGATGATCGGCTCGAATAGCGATGAAGCCAG
+CGTATTGGCCGTTTTTGGCGTCGATATTGCCGGTCAAATTCAAAAAATGCGCCGTGAGCG
+GCGTGTTGGCCTGGGGTTAATCCGGCTGCTTTATCCTGGAGTGAAAGGCGACGAAGCGCT
+AGGGCGGCAGGTCTGTCGGGATATGGTATTTACCACGTTGGGTTATGTCGTCATGCAAGC
+GCAGCAGCGGATCGGCGAACCGTGCTGGCGTTACTGGTTTGATTATGTCGCCGAGGCGGA
+GCATAACACCTACGCGAATGGCGCCTGTCATGGCAATGAAATACCGTATGTATTCGATAC
+GTTAACGCGGGCTGAGCCCACATGCCATTATGTGAATGAGAATGACCTGGCCTTTGCCTC
+GCAGGTGGCGGATTACTGGGTGAATTTCGCTCGTCATGCCAGCCGCACGCGCGACGTGCT
+GCACGGCCCGGTTCGCTGGCCCGCCAGCATTCGGGGGCGAGATCGTCTGTTGCGGATTGG
+GCTGAACAAACTTGCCGGTTTTAAAGTGGAAAACCGCTTTATGCGTGCGCGTCTGGCGCT
+GTTTAAACGAGTCATGAAACATCACGTTAGTCTGGAATAAACTTTTCATAACCTGAAGAA
+TGCTGCGTGAGGTTTACATCCGATTCGGTCGGTTCTTATCGACATAAAATATTTACGCTT
+TTGCACAGTTTCCAGGCGACCAACAATTGGATTATTAATGAATTTTGTCTAGAGTGAGCG
+GTCAGAAACGGGCACATTCTTGCTGCTGAAAAAACCAGCGCGGGACCATTCACAAGACCA
+GAAGGACTCATTTTCAGGTATGAATCGTAGACGATTTATTAAAGGTTCAATGGCAATGGC
+CGCCGTGTGCGGTTCCAGCGGTATTGCTTCACTCTTTTCTCAGGCGGCGTTTGCCGCGGA
+ATCCGATATTGCGGATGGTAAAATTGTCCGTTTTGATTTTGCTGGTCTGCAATCAATGGC
+CCAGGCGTTAGCGAAAAAGCCCTGGGGCGGCGCGCCGGGACCCTTGCCGGATACGCTCGC
+CAATCTGACGCCGCAGGCCTATAACAGCATTCAGTATGACGCGGCGCATTCACTCTGGAA
+CGGTGTTGCCAACCGGCAGCTCGATATTCAGTTTTTCCACGTAGGGATGGGCTTTCGTTG
+TCGCGTACGCATGTTTTCCGTTGATACGACGACGCATCTTGCTCGCGAGATTCATTTTCG
+CCCGGAACTGTTTAAATACAACGATGCCGGCGTCGATACGACGCAACTGGAAGGGCAGAG
+CGATCTCGGTTTCGCCGGTTTCCGTGTCTTTAAAGCGCCGGAACTGGCGCGGCGCGATGT
+CGTCTCCTTCCTGGGCGCCAGTTATTTCCGGGCGGTAGATGATACTTATCAGTATGGCCT
+GTCGGCTCGCGGGCTGGCGATAGATACCTATACTGACGGTCAGGAAGAGTTCCCTGACTT
+CACCGCATTCTGGTTTGACACCGCGAAGCCGGGCGATACTACGTTTACCGTTTACGCTCT
+GCTGGACAGCGCTAGCGTGACGGGCGCGTATAAATTTGTGATTCATTGCGAAAAATCGCA
+GGTGATCATGGATGTAGAAAACCATCTCTACGCCCGTAAAGATATAAAGCAACTTGGCAT
+TGCGCCGATGACCAGTATGTTTAGCTGTGGGAATAATGAACGTCGGGTATGCGACACCAT
+TCACCCGCAAATTCACGACTCCGATCGGCTGGCGATGTGGCGGGGTAACGGCGAGTGGAT
+TTGCCGCCCGCTGAATAATCCGCAGAAATTGCAGTTCAATGCATATATGGACGATAACCC
+AAAAGGGTTCGGCCTGCTGCAACTCGATCGCGATTTCTCGCATTATCAGGATGTGATGGG
+CTGGTACAACAAACGTCCGAGCCTGTGGGTGGAGCCGCGTAGTAAGTGGGGGAAAGGCGC
+AGTTAGCCTGATGGAGATCCCAACCACTGGCGAAACTCTGGATAATGTGGTCTGTTTCTG
+GCAGCCGGAAAAAGCGATCAAAGCCGGGGATACGCTGGCGTTTAATTATCGTTTGTACTG
+GAGCGCGCAGCCGCCGGTACAATCTCCGCTTGCGCGGGTCATGGCGACCCGTACAGGGAT
+GGGCGGCTTTCCCGAAGGTTGGGCGCCGGGCGAACATTACCCGGATAAATGGGCGCGCCG
+TTTTGCTATTGATTTTGTCGGCGGCGATCTGAAAGCGGCCGCGCCAAAAGGCATTGAGCC
+GGTGATTACGCTTTCCAGTGGCGAGGCGAAGCAGATTGAGATCCTCTACGTCGAGCCTTT
+CGACGGTTATCGTATCCAGTTTGACTGGTATCCGACCTCGGATTCTACGGCACCGGTGGA
+TATGCGTATGTTCCTGCGCTGCCAGGGGGAAGCTATCAGCGAAACCTGGCTGTATCAGTA
+TTTCCCGCCCGCGCCGGATAAGCGCCGTTATGTCGACGATCGTATCATGCGTTAGTCAGT
+TTGCCTTCTGTACCGCCACAAAGGCGGTACAGGTTCCGGAAATAGCCCTGACATAAACTC
+ATTCGTGAGCCGCTGTTTTTGTGACACGGCCTTTCCATCGTTCTATTTTTGCAACAGTCC
+TTCCTGTTTATCCCTCTCGATCCTGCGGACAGGGAACATTAAGATAGCTTCACCTTATTT
+AAGATATAAAGTGAATATAATGAAAAAGAGCTTTCTTGGTGTTGTCCTGTCTCTGGGTTT
+ATTAAGTGCTGCTCATGCAGATGTATATAAATTTGATAATACGCATACCAATGCGGTATT
+TAATATCGATCATTTCCAGACCTCAACCAATCATGGCGGGTTTTATGCTATTAGCGGCGA
+ACTGAAATATCAGCCGGAAAAGCAAGATGCAGAGATGCGCGTGACGATTCCCGTGAGCGC
+CTTAAATACCGGGGTGGATGCGTTTGATAACCATATTCGCAGTAGCGATATTCTGGATGC
+GGAAAAATATCCAGAAATGGTATTTAAATCAACAAAATGGCATTTTGAAGATAATAAACC
+GGTTTCTATTGACGGTTTGCTAACAATGAAGGGAGTAACGAAGCCCGTCACCTTAACCAC
+CACCAAGTTTGGCTGTTATATGAGCCCGATATTCAAGGCGCAGGTTTGCGGTGGTGATTT
+TGTCACGCAAATAGATCGCACCCAGTGGGGGGTAGATTATCTGGTCGATATGGGGATGAC
+GAAAGTTGTCGATATAAAAATTCAGGCAGAAGCGGTTAAGCAATAAAGGGAATGATGATG
+AAAATTATTGTATGTTAAGGGGGCTTGGCTATTTGAAGCTTCGCTGATTTCAGGCCGCAC
+TGCCACGATTTTAAAGTGGGACTATGTCACTAAATAGTTGATGGCAACTATTTCGGATTC
+AGATATGTTAAATTGCTCTACTACTTGAGCTTGTAACCAACGGTTATTTTGTCCCTGATG
+TCTCTGTAGATTTGATTTTTTCGATCGCAATAATATTGCCTGACATCGCTTCATTGAGCA
+CTTCGACGGCCGTGCTGGCATCGCGATTCTTTATCGACATGTAGACCTTGATATGGGCTT
+CCACACTTTCAAGGGTAATACCCAGCGCACGGTTAAGCTCTTCAAGATAGTAGTAATAGA
+TGTCTTTAATCGAGCTCATCACGTTGTAGAACACGCTGTTGTGCGATGCCCTGACAATCG
+CCAGATGGAACTCGTAGTCCGCTTCCGAGTATTTTTTATAATCACCTTTGTGGATCAGCA
+TGTTGTTCAATGCTTCCTCGAGCTGGCGAATGTCATCATCGGTGGCGTGTGTGACGGCGA
+GCTCCACGCATTTGAACTCCACGGTCTGACGAAAAATCATCATATCGTGAAACTCTTCGC
+GGCTAAGGTGCATGATTGGGCGGGGATCGTTACTCAACATCTGCGGGGTGAAGTTTTCGC
+TCACGTAGCTGCCGCTGCCCTGACGCGTCACCACAATCCCCAGGTCACGAAAACGCTGTA
+CTGCGCTGCGAACGCTGACCCGGCTGACGTTAAATGAGGCGGTCAGTTCCACTTCTGAGG
+GCAAACGGCTACCCGGCGCCCAACTGCCGTCCAGCAGTTTGCTACTTATCTGATCATAAA
+TTTCATTTACAACATTCTGTTTTTGAATGGATTTTATGCTCAAGATGGGTATCCGTTAAG
+ATGTCGCTGAAGTGCTTTATTATATAACAATTCTCTTTTAAGAACAAAGCGCCCGGCCGG
+GCGCTTTTCACCGTTAATCGAAACGAATGAGTACCTTAGCAGAGACATTTTTGTCTGTGG
+CGGTAATCAGCGCGTCTTCAATTTGCTGGGGCGGGAACTCGGCGCTGATAAGCGGGCGAG
+GATCGACGCGCCCATCTTCCAGCCAGCGTACCGCGGTGATGAACTCACCGATAAAACGGA
+ATGAGCCGACCCAGTTGAGTTCTTTAACCAGCATCGTTGACACCGGCCAGCTTACCGGGC
+TGGCGCCCATCCCCACCTGAACGATGGTGCCGGCAGGGCGGGTGAAGTCGACGGTGGATG
+CCACGGCAATCGGCGCGCCGGAGGCCTCAAACACGACATCAAAGTAGCCTTTATGCTGCT
+GATAATGGGCAACCTGTTCTTCATCGCGCGGATCCATCACCGCTGTGGCCCCCATTTGGC
+GTGCCAGTTCCAGACAGCGTGGGCTGAGATCGGATGCTACCAGTTCAGATGCTCCGGCAC
+TGCGCGCCGCCGCGAGGATCAGACAACCAATGGGGCCTGCGCCAATCACCAGTACGCGTT
+TGCCGGTCAACTGGCCTGCCTTTTTTACTGCATGAATGGCGACCGCCAGCGGCTCCGAAA
+AGGCCATCACGTTTGCGGGCACGCGCCTGTCGTAAGGAATGCATTGCTCCGGTTTTACCA
+CCACGTATTCAGAAAAACCGCCATTCACATGCGGATTGAACTGCGCGCTGCCCATAAAGC
+GCATGGAGCCGCACAGATTTTGATGGCCGGAAAGGCACATCTCGCACTGATTGCATGGGC
+TGGACGGGTTCACCGCAACCGTCTGGCCCACTTTCAGGTCGCTGCCTGCTGGCACTTTGC
+TGATCACGCCAACAAACTCATGGCCAATCACCATCGGATGCTTGAGGACAGACATCCCCG
+CGCGGCCATGCTGATAGTAGTGAATATCAGAGCCACAGATGCCGCCGCAGGCGACCTTCA
+CGACGACGTCATGTTCACTGTGCTCGATTTCACGTGATTCAAAGCGTACGTCTTTTTCCG
+CATGGGCCAGACAAGCGTTACAGGTTATTTTTTCCATTTTGATAATGACCTCATTATTTG
+TTGGCAGTTGCCGGGTTAATGGCATTCTTATCCACAGTGTCGGCATTCTTTTTTCCAGGC
+AGGATCACTTCAATTTTGCCCACCAGGAATATGTAGGCTAATAAGCCCAGTCCGGCGACG
+CCTGCGATATACCACATGGCATACTGGAAGTTTTGCGTGCGCTGGAGAATAACCCCAATA
+ACAATTGGGCTAACGATCCCCGAAAGGTTGCCGCAAATATTTAAAAAGCCACCCATAGTC
+CCGAGAAAATTACGGGGAATTACATCGCTCCAGACCACCCAGCCCAGGTTTGAAAAGGCG
+TTGGCAAAGAACGCAACAGACAGAATGACAATCGCAATAACTGGCTGGTTTTCAAAGAAA
+TTGACCAGGCCAATAATCATGGTGACGCACAGGCCAGCCATAACGGGTAATTTTCGTGCC
+AGCGTTCGGGATTTTCCTTTTTTCAGCAGCATGTCGCTTAGCGTACCGCCACAGAGCACC
+CCAAGCATCGCCATAATATAGGGCAGCATGGCGCCTATCCCGGCTTTGGAAATAGAGAGA
+TGCAGTCCTTTTTCCAGGTAAACAATAAACCAGGTCAGGAAAAAATAGAGCGTAGACGAG
+CAGGCAAACTGGGTGATGAACAAACCCCAAATCGTTTTTTTGCTGAGGAAGAATTTAATA
+TTTTGCCAGCTGATTTTTGCACTCACGGAGGATTGGTTCTCCGAGCCATAGCCGCCGCCT
+GCTTTGATATAATCCAGTTCGGCCTGGTTCACAGCAGTGCTGTGCTGTGGATCGCGGTAA
+TACATAAGCCAGTAGATGCCAAACAGAATACCGGCGCCACCGGACAGATAAAACGACATT
+TCCCAACCGTAGTTAGCCACAATAAAGGCGAGGGCAGGCGTCAGCAGCGCGAGACCGATA
+TATTGTGCACTGGAATAAATCGCGGTCGCACGGGCACGTTCATGGTCCGGGAACCAGGTG
+GCGATTATTTTTGTGTTAGACGGGAAGGATGGCGCTTCGGCAACACCAATTAATGCGCGG
+CAGGCCAGAAGCATTGCAAATGAAGCGGTTGCCGTCGCGAATAAATGGTGTGAGGCGAAC
+CCCATCATAAAGGTAAAAATACTCCACAGAATAATCGCACCACCATAAAGAATACGTGAG
+CCAATGCGATCAAGAACATAGCCGACAGGAATTTGACTGGCAGCGTAGGCCCAGGTAAAC
+ATGGAGAAAAGCAAACCCAGTTGTGTTGGCGTCAGACTGAAATCATTCTGGATATTCGAA
+CCAGCGACGGCAAGATTGGCGCGATCCATATAATTAATTGCAGTCACAATAAACAGCAAT
+GTGAGAATAAAGAGTCGTTGTCTTGAAGCCTTCATAATAATACCTGTGTTATATCGGCAT
+GCATCGGGGTAAACACATGCCATCAATTTTAAAGGCGAGTAGGTAGAGTGCGGGCGACTT
+ATAAAACTGCGAGCCAGCCACCATCGACGTAAATAATCTGCCCGTTGATATAATCTGATG
+CTTTGGATGATAAGAAGATGGCGGTGCCGATGAGCTCTTCCGGACGACCCCAACGTTGAG
+AAGGGGTGCTGCTTTTCACCCAGCTATCGAACTGCTTGTCTTCAATAAGCGCGGTGTTCA
+TGTCGGTCAGAATGTAGCCAGGTCCAATGGCGTTAGTCTGGATATTAAACTGCGCCCATT
+CAGCAGCCATCGAGCAGGTGAGCATTTTGATGCCGCCTTTTGCTGCCGTGTACGGGGCAA
+CAGTCGGGCGGGCCGCCTGGCTGGTAAGCGAGCCGATATTAATAATTTTGCCGCCGCTGT
+TGCGGGCGATCATCCGTTTTGCCGCCGAGCGGGAGACTAAAAATGCGCTGGTCAGGTTAG
+TGTCGATCACCTTCTGCCAGTTTTCCAGCTCCAGCTCGACCATTGGTTTGCGGTACTGAA
+TACCGGCGTTATTGATCAGGATATCAACATGGATCCCTTCTGCATCAAGTTTGCTAAAAG
+CTGCCTCAATCGCCAGTTCATCGGTGACGTCAAAAGCCACGCCATGCGCGTCGTAGCCTT
+TTCTGGTCAGCGTATCCACTGATTCGGCCAACAGCGTGGCGCGAATATCATTCAGGATAA
+CCCGTGCACCCGCAGCGGCAAGACCCTCTGCGTAGGCAAAGCCCAGTCCTCGTGCAGAAC
+CCGTTACCAGCGCCGTTTTCCCAGTTAAATCAAATAAAGCGGTCATGTTGTTTCCTCACT
+TGTTTAATTTGTATGACGACTATCCTTTTTTAGGTTGAATTTTCGCCCTGATAAAATCAA
+CAGTTCACCCATGAATTTGCAACAAGGATCACAAACAGCTCCACATGCCGACCGCGTAAT
+TAATATTAATTAATTGAATTATATGTATATATTTGGTTTAAATTTAACGCAGTTTGATCG
+CTGTCACAGAATGGCACTCGCAGCGATCCGCTGTAAAAGAAGCGTGATATAACAGCATAA
+AGTTGTAGGACAACTTACGTATATCTGTTGTATCATCCACAACGGTATGACATGCGGTAA
+ATTCGCTGAGTTAAGGAGTGAAAGTGAGTAACCTGAAAATTACCAACGTGAAAACGATTC
+TGACGGCGCCGGGCGGCATTGATTTGGCAGTCGTTAAGATAGAAACCAACGAGCCAGGGC
+TGTATGGGCTGGGATGTGCGACATTTACCCAGCGTATCTTCGCGGTAAAAAGCGCGATCG
+ATGAGTACATGGCGCCTTTTCTGGTTGGCAAAGATCCGACCCGTATTGAGGACATCTGGC
+AGTCAGGCGTGGTGAGCGGCTACTGGCGCAATGGCCCGATCATGAACAATGCATTGTCCG
+GCGTGGACATGGCACTGTGGGATATCAAAGGTAAGCTAGCGGGGATGCCAGTTTATGATC
+TGCTGGGCGGCAAATGTCGTGATGGGATCCCACTGTACTGCCACACCGATGGTGGTGATG
+AAGTTGAAGTGGAAGATAACATCCGAGCCAGAATGGAAGAGGGTTACCAGTACGTTCGCT
+GCCAGATGGGAATGTATGGCGGTGCGGGGACCGATGACCTTAAACTGATCGCCACGCAGC
+TGGCACGTGCGAAGAACATTCAGCCGAAACGTTCACCGCGCAGCAAAACGCCCGGCATCT
+ACTTTGACCCGGACGCCTACGCCAAAAGCGTTCCGCGTCTGTTCGACCACCTGCGTAACA
+AGCTCGGTTTTGGCATCGAATTTATTCATGATGTACATGAGCGCGTGACCCCGGTGACTG
+CCATTAATCTGGCCAAAACGCTTGAACAGTATCAACTATTTTATCTTGAGGATCCGGTGG
+CACCGGAAAACATCGACTGGCTGAAAATGCTGCGCCAGCAGTCTTCCACTCCGATATCCA
+TGGGTGAGCTGTTTGTGAATGTGAATGAGTGGAAGCCGCTCATCGACAACAGGCTCATCG
+ACTACATTCGCTGCCACGTGAGTACCATCGGCGGCATTACGCCGGCGAGGAAACTTGCTG
+TCTACAGCGAACTGAACGGTGTGCGCACCGCATGGCACGGGCCGGGCGACATTTCTCCAG
+TTGGGGTTTGCGCCAATATGCATTTGGATTTGAGTTCACCGAACTTTGGCATTCAGGAAT
+ACACGCCAATGAACGACGCGCTGCGTGATGTCTTCCCGGGCTGCCCTGAGATTGACCACG
+GTTATGCCTATCTGAACGATAAGCCGGGTCTGGGTATTGACATTGATGAAGCCAAAGCGG
+CGAAATATCCGTGCGAGGGGGGAATCCCATCCTGGACAATGGCGCGCACACCAGACGGTA
+CGGCCTCAAGACCGTAAGCAATGAAGGCCCGGCTTGCATCTGCCGGGTCTTATTCCCGAC
+GTCCTGATGGACTCCGTTTTAGAAACAGGAATTATTGTATATTGAGGCTGCTTTTTAATC
+AGTGACCACTTCTCTATAAGGAGCCTGAATATTTCCCTCAACAACGCTTCCGGTAGAAAA
+TGACGCGCTCTGTTTCCTCAAATCCTAATGCCAGGTGAACTTTCTGGGAAATTGTATTTT
+CCGGCGTGGTATCAGAGGCCATTTCCCGACACCCTTTATTCGTTCCCCATCGTTGCACCG
+CTGCAATCAATTGTTTCGCTACGCCGCGTTGACGGAACGAGGGGAGAACAAAAATACCTT
+CAAGAAAAGCCACGGGCGAACTGTCACAGCCATTGACATAATCGTGGCGGATTGAGGCAT
+CCGCAAAGCCAATCGCCACCCCGTCTGCCATCGCAACAAATGATGCCAAATGATCGGCTT
+GCAGGATTTCTTCGCCGTCTGCCAGATGGGCGTCATCCGGGTGACCGGGCCAGAGCTGTT
+TTCGCAATCCGCGCCAGTGCTCCAGATGGGTTTTGTTCATTTGCCTGATGTCCATTAACG
+CACTCCTGATGAGGGGTCTGGCATGATGAGACGGCACCCCGCCTGCTGATAACGTCGGGC
+GATAGCAGACGGGAGCGCGCTGTCGCTAAGAATGGTAGTAATACAGGACAGCGTCGCCAC
+CGCATGGGGTTCTACAGTATCAAACTTTGAGTGATCGGCCATCAATATGACCTCGCGTGA
+GCGCTGAATAATGCGCGTTTTAACGCCCACTTCAAACATGGTAGCGTTGGTGATGCCCGT
+TTCAATCGACAGCGCATCGCAGGAGATAAAGGCGCGTTCAACGGCAAAGGCGTTAATCAT
+CTCCAGCGCCAGACTCTCGCCCACCGAAAAGTAACCGGGGCGAATCAGTCCGCCGATAAT
+GTAACTCTCTACGTGTGGGAAGCCACCCAGTTCATTAGCGATTTTGATGTCATTGCAAAT
+GACTTTTACTTTGGCGTCGACCAGACATTTTGCCAGTTCCAGACAGGTGGAGCCGGAGTC
+GAGAAAAAAGCAGTCTCCATCCTTGATGAACGTGCGGGCGAGGGCAGCGATTTCGCGTTT
+CGCCTCGCTTTGTAACGTCCGCTTAACGTCGAAAACATATTCTTTATCTTCCGTACTGTC
+GTCGAAGTCAATACAACCATGGCCGCGAACCATACCGGGATAACGGCTGGCAATATAGTG
+AAAATCCCGGCGCACGGTTGCCTCTGCATAGCCAAAAAGCTCAATAGCTTGCTGTGTTGA
+GAGGTGCCTGTGTTGCCAAAGGTAATGCAACATCTGTTTGATACGGTCGGGGCGCTGTTG
+GCTCATCAGCATATGACTCCTTTATAGCGCGGTGAATTGTGACAACGTCACATCATAGTT
+CGCCGTCGTGAATAACGCCCGGCCAATCACCAGATGCTGTGCGCCTGCGGCGGCAAGCAG
+CCGTGCGGCGCGAAGTGTAATACCGCCGTCCGCCCAGCATTCCGCAGCAGGGAAATGCTC
+TCTGCCCTGGCTCACTTTTTCACACATCGCGGCGATAAATTGCTGTCCGCGTCCGTCGGG
+TTCGCTGGTCATGATCATCAGCGCATCCAGTTGCAATGCCAGATAACGATAAGGCAATAG
+CGGCGTTGCCGGGTTAAGCGCCAGTCCTGCTTTCGCCCCGATAGCGCGAATATCCGCCAG
+AATCTCCGGGGGGTTTTGCACGCTTTCGGCATGAATGAAAATCCAGCCGGGGCGGATAGC
+TGCAAGCCAGGGTAGCCAGCGTTGCGGTGATGAGACCATCAGGTGAAATGAGAGCGGATG
+GCGGGTGTGTTGTGCGACTGCCTGAATGGTTTTCATACCGAAGGTAATATTGTTGATGAA
+ACTGGTATCTTCGATATCCAGATGCAACGAGCCGAGGGGCGCATCGTGTAAAGCGGTCAA
+CGCCTCGGCATAGCGCAGCGGATCGGCGGAGGCCAGTGAAGGGTGCAGGATCATCGAAAC
+CTCCATCAGCGCAATGCGGTTAATTGCGCGAAAAGCGCGGCGTCATTTGGCGCATCTTGC
+AGCATCGCGACGCTTTCCGGCGAGTCTAGCCACTGGCTGATGCGTTGAATGGTGCGAATA
+TGTGCTTCGGCATCCGTGGCGCTGGCGCAAAGCAACAGCCAGATGGGATCGCAATCCGCA
+TTGCCGAAAGCGACCGGCGTTGCTAACGTAGTGACGCTGATTTGATTATGGTTGGCGCCT
+TGCTCTGGTCTGGCATGGGGCAACGCAATCCCCGGCGCGATAAGATAATATGGCCCCCAT
+TTAAGGGTGTTCTCAATAATACCGTCCAGGTAGCAGGGGGCCGCCGCGCCGAAGGTAATC
+AGCGGACGAACGGCGATATCCAGCGCGTGTCGCCAGTCGCTGGCATGGCGTTGCGCCTGA
+ACCCACTTAACATCATTAATCATCGATCGTTGACTCCTTGCCGGTTCGGGTTACTCTGAA
+ACCGATCCCCGGCGTGTCTTTTGGCGAAGGCGACGGAGATCGGCAGAAGAGTTATCGCTC
+TCTGCAGGGGATAAGCGTTTTGCTTATCCCCATTTTATTGTCGGATATGGCGTACTTTCT
+CCATAAACTTCGCCACGCGCGCCTGGTCGACAAAGTTGGCGAAGACGCCGTCTTTTTTAA
+ACGTGGTTGCCGTTACGCATCCGTCGGCAATGCAGAGCTGCTCCTCGACGTTTTCCAGAC
+ACACCCCGGTATTCGCCAGCACGACCGTGTCGGGGACGGTCTCTTTTACCCGCTTCAGTA
+TGGCGCTATCCGTGCGAGCGCCCGCCGTCAGCCCCGAGACGCACAGGGCATCGGGGTTAT
+TGTTAAATACGGTCGATTTCGCAATTGAACAGACATCCCGGTTTCCCAGATACACCGCCG
+CTTCCGGCACGATGTTAAACAGCGTTTTCACGTGGCCTGCGCCGATGCGATGCTGATGGC
+GAATGGTTTCGCCGACATTCGTATCCCAGACGCCAAAATCGCTGGCGTAAGCGCCGGTGA
+AAATTTCGCGAATAAATTTTGCGTCGGTCGCCATCGCCAAATCAAACGAGGCCACAGGGT
+CCCACAACACGTTTACCCCAAACGGTACGCGGATTTCACTCATTAACTGACCGATGATTC
+TTGCCATCGCGGCGGTCGTTTCCGGTCTGACTTTCGTTAAATAAGGCAGACTAAATTCGT
+TGGAGAACATCACCGCATCCACGCCGCCATTTTGTAGCGCCATTAAATCGTCATGGGCGC
+GGTCAATTACCCAATTCATGCCTTTCCTGGTATCGAACCCGGGATCGCCCGGCAGCGCCC
+GTAAATGGCACATGGCGATAACGGCTTTTTCCGTTCCTATTACCTCTTTTAGCCAACTCA
+TTCTGGGTTGCTCCTTATTCCGGTAGTTCACGTTTACGTAAGACAAGTATGATGCTGGCG
+ACAATGCCGACCACAATAACCACACCAATCATGCCCAGCGACATCAATTCAGATATTGAC
+CAGCCAAACATATTTCCCACCGACAGCGCGGTAATTTGCGCGTTTTCAGCGGCGAAGCTA
+AAGCCGCCTTTGAGCGCCATATCGGTAAAGTACGGCGCGAACTGGGTGGCGATCAGCAAA
+ACGGTAATCATGACAATGATGCCGCTGAGCAGAGTACGAATCAGATCGCCGCGATGAATA
+ACCGTGGCCATGCAGATAAAAAACGGCGCAACCGGTAAATCAGCCAGCGGCAGGACTTTA
+TTGCCCGGCAGTATGCTCGCCAGAATTAACATGATGGGAATTAACAGCAGTCCAACCGCG
+ATGGTGGTCGGGTGGCCTAACGTCACTGCGGTATCCAGACCGATAAAGACTTCGCGCCCT
+TTAAAGTGTTTCTGGAAGAACTTACGCGCGCCGTCGGAAATGGGCATTAATCCCTCAACG
+ATAAGGCGAATCATGCGCGGAAACAGCACCATAATCGCCGCCACGGTAATCATTAAGGTT
+GCGCACCCTTTAAAGCCTTCGCCTGCGGCAAGTCCGAAGATCAGCCCGAGAACAACGCCA
+ATGATCACCGGGTCGCCAACCATCCCATACCGTTTTTGGATCTCCTGAGCATCAATATTG
+CGTCCTTTCATAAACGGTATTTTTTCGTATATCGCATCCAGCAATACGAACAACGGCACG
+GAACTGGAGCCATACCCTTGCGGAATAGAAATCCCTTCCAGACCCACAATGTTCTGTACT
+CGTTTCGCCGTCCAGTCGGCCATTTTCAACGACAAGGCGGCGTGGCAAATCGCGCCCAGT
+ACGCCATAAATCAGACTGCCGGTCATCAACTGGACGACCGTTCCGGTAATGGCGTAGTGC
+CAGTAGTTATAAATATCAACGTTCATGGTTTTGGTCAGACGAGTCACCAGCATACCGACG
+TTGAGCAGAAAGATAACGGGAATGATCATCGCGCCGATGGCCGTCGCATAGCCGACGCCG
+GATGCGGGCCCGGCGCCGACGTCAAACACATGCAGCGTCAGGCCAAAACGCTCAATCATC
+ACTTTAATCGGCGGACTGAGACTGTCGATCGCCATGACGATCACCAGCCCCATGCCGACA
+AAACCGATGCCGACCGTCCCCCCGGCTTTCACCGCCTGCAGCCAGGGAATACGAAAGATT
+AAGCCGATGATAATCATAATGATGGGCACAAAAACGGTGCCGCCGAGAGACAGGATGTAA
+TCAAACATAATGCCCCCTTTATTGTGTTAACAGCGCCTTGATTTCTTGTTTTAATGCGTC
+GTCGTTGATGCCTGTCAGCAGGGCGGCGCCGTTGAGCGTCGGGATGCCATAGTCACTGTG
+CGTACGCATGGACGTTACGATGAGATCCATACCGTTACAATTCAACGGGATCTCATTCAG
+ACAACATTGCGCCGTGGTTGCCGCAATGCCTTGCTCCGCAAGAAAGTCCTGCAGTTTTTG
+TGCAATCATGGTTGATGTCGACATGCCGGTACCACATGCCACAAGGATCTTTTTCATCAT
+GGTCGTGCCTCTTGTGTAGCGCCTGTTTCAGGCTCAATGGGAAACTGTTCTGGCGACATG
+TTAGCCAGCGCAGTCAGTAAACGGATACAATCAGCCAGGTCGCGCAGGCTGGCGACTTCG
+GCTGGCGAGTGGGTATAGCGGCAGGGAATAGAAAGACTGGCGCAGGGAATACCGTCCAGT
+TCAACCTGAATGTAGCCGGTTTCGGTGATGACGCCTGGCGCGACTTCTCGCTGTACGGGA
+ATATTATTTTCGTGCGCGGTGGTCTCCAGCATCCGCAGCAAACGCGGCGGCGTAATCAGT
+CCCGCCAACGTACCGCGTCCGTGATAGTTCAGACAGGTGATGCCGACGCCGTGGTTGACC
+CGCACATCAGAGTAATCCTGCAGGTCAGGCGTGTCGCAGGAGGGGGTGATATCAATACCA
+ATCGCCAGGTCGGGGCGCACGCGTCGTAAAACGGGAACAATACCGCGAATATTGAACTCT
+TCCTGTACCGACGCGACCAGGAATACCGCGATATCGAGCGGTGTGGAGGCGAGGGCCTCG
+GCGACGCCCAGTAGCGCCGTACACCCCAGCCTGTCATCCAGCGCCTTACTGCACACCAGG
+TCGTTGCCCAGACAGTGCGGCGGGTTGTAAAGGGTTACTGGCGTCCCCACCTGAATACCC
+ATTCGTTCGGCATCCGCTTTATCTTTTGCGCCGATATCAATCCAGAGTTTATCGAGCGCG
+GGAGGCTGGGTGCGCTCGTCACCCTTCGCGAAGTGATATGCTTTAATACCGATACAGCCC
+ATGATATCGCCTGAACGTCCGGCAAGCGTCACGACCGAACCGGGCATAGTAATTTGCGCC
+GGGCCGCCCACGCGTTCAAAACGTAAAAAGCCGGAGGGTTCGATCTTGCGTACCATAAAA
+CCGACTTCATCCATATGCGCAAAAATCATCAGGCGAAGCGCGTCGGATTTGTCGCTGCCA
+TAACGGGCGACGACATTGCCTAAGCGATCCCGCCAGACGTCTTTGGCCTGCTGTTCAAAC
+GCGTGCTGCATAACGTTTGCAATACTGCTTTCATGTCCTGAAATCCCGTTTAGCCGCAGT
+AAAGAAAAAAGCGTTTCCTGCACAGAAAAGGTCATTGGCGTCTCCGTGGTGATAAAACAA
+TCAGTCGTTGAGCGTTTTATAGGCGGAGAATGGTTGGATAAGTGTGAAATGTGTCACGCG
+GAAATACGCTAAATATGGCCAATAAAAAATAATGTGATGGCGATACAATAAAAACGCTCA
+TATCACCTGCGGGTTATCGGTAAACCAGGCTATTTATGTGATCACGACCAACAACGAAGA
+AGGGCAACGCGATGGTGGAAATTATTCCTGTTAGCACGACGCTGGAACTGCGAGCGGCAG
+ATGAAAGTCATGTTCCGGCGCTGCACGAACTGGTACTCAAAAACAAAGCGTGGCTACAAC
+AGTCGCTCGACTGGCCGCAATATGTCACGTCGCAGGAGGAAACGCGTAAGCATGTGCAGG
+GTAATATACTGTTGCACCAGCGTGGTTACGCCAAAATGTACCTGATTTTCTGCCAGAATG
+AGATGGCGGGCGTACTCTCATTTAATGCCATTGAACCGGTAAACAAAGCCGCCTATATCG
+GTTACTGGCTGGATGAGTCCCTCCAGGGACAAGGGATAATGTCGCAATCATTACAGGCGC
+TGATGACACATTATGCCCGGCGCGGCGATATTCGGCGCTTCGTCATTAAATGCCGCGTTG
+ATAATCAGGCCAGTAACGCGGTCGCACGGCGCAACCATTTTACGCTGGAAGGCTGTATGA
+AACAGGCAGAGTATCTTAACGGCGACTATCACGACGTTAATATGTATGCCCGCATTATTG
+ATGCGGATTAAAGGGAACCGACTAAGGGGGTACGCGTAATACGATCCTCGCCATTGATCA
+CTTTTGGGCCGCGCAGGTGAATAGTATTGCCGTCAAAGGCTATCACCGCCGCCCGTCCGC
+TAATCTCGACCTGGTGCTCAATCAGAATTTCGCCCTGTATACAGGCATGGCCTTCAATCA
+GCACGCGGTCGTCCAGTAAAATCGGGCCTCCGCGTACCTCAGCATGTCCGCCTACCAGCA
+CATGATGTTTTAACACACAGTTGCCTTCGATTAACGCATGTTCCGCTACCTGCGAGCTGT
+AGCGAAGGGTAGGGATCGCATCTTCCTCTGTACCGGCGATAACCCGCGCATGGCCATAGA
+CTTTGGCGCAGTCACAGATCCAGACATTATTGTCTTTGTTGCCTTCGATGAGCGCGAAAT
+CAAAGACCTCCGCCCGGTGCTCAATAAAAGCGTGTGTGATAGTGGCGTCGCCATAAAGCT
+GTACCTGATGGACAATCCGCGAATGGTTCACGGTGGCGCGATCGTAAATTTGTAAAATCT
+GCGCATGTTCATGCGTTAGTCCCTGAACGGCGAGAATTTCTGACTGGTTTAACACGCGGG
+CATCGCCATAAATCGCACACTCTCCGCGCACGGAAGAGGACTGAATGGTGACGTTGTCAC
+TTATCCGTGCGCCATCGCTGATATCAGCGCGATCAACCCAGACGTTATCGCCTATTCGCA
+CGTTATTGTAGAGCGTGCACGGCAGCGTGATACGCGCGTTACCCGTAATTTCCGTGCCCG
+CAAAGGCCATCGCGTTTTCATCATAAATCCAGCAATCCCCCTGTTGTGACAGCACATTAT
+CGGCATCAACCCAGCCGCCGGAGGTTCCGGCTTTAACATCGTTAAAATCCGTTACGGCAA
+TAACTTGTCGTAATAAGACGCTTTTCTTCTCACCGTCTACCTGATAAGTAAAAGCACGAG
+GTTCTTCACTCAGTCGATATTTGATCATAGGGAAATTCCGTGTGAACGATTAAGATAACC
+GTAGCAAAGGTACTGGCGGAACAACCAGAAATTCCATAAAATGCATTTCAAATATACTTT
+ATAAATTAAACAAAATGCGTAATCACAAGCAGAGCGATCGCGTGCTCAATCTGCCTGCGG
+GCTATTTTGGCATCGTCCTTGGCACTATCGGTATGGGATTCGCCTGGCGTTATGCCAGCC
+AGATATGGGGAATAAGCCACTGGCCCGGCGACATCATGGTGATCCTGGCGATGATTATTT
+GGGCACTCTTGACCCTGGCGTTCCTTAGCCGTCTGGTGCGCTTTCCCCATAGCGTGATGG
+CTGAAGTGCGACATCCGGTAATGAGCAGTTTTGTCAGCCTGTTTCCCGCCACCACGATGC
+TGGTCGCGATCGGTTTCGTTCCCTGGTATCGCCCGTTGGCCGTTGCGCTATTCAGCGTGG
+GGGTCGTCATACAACTGGCGTATGCCGCCTGGCAGACGGCGGGACTTTGGCGCGGAGCGC
+ATCCGGAAGAAGCGACAACCCCGGGGCTTTATCTGCCCACGGTAGCGAATAATTTTATCA
+GCGCTATGGCCTGTGGAGCGCTCGGTTACAATGATGCCGGACTGGTGTTTTTAGGCGCAG
+GCGTCTTTTCGTGGTTAAGTCTGGAGCCGGTTATTTTGCAGCGACTGCGTAGCTGCGGCG
+AATTACCGGCGGTGCTGCGTACGTCGCTGGGTATCCAACTGGCGCCCGCGCTGGTCGCCT
+GTAGCGCCTGGCTGAGCGTCAATGGCGGGGAGGGCGACACGCTGGCGAAAATGCTATTCG
+GCTACGGTCTGTTACAGCTTTTATTTATGCTGCGATTAATGCCCTGGTATTTATCACAAC
+CGTTTAATGCTTCCTTCTGGAGTTTTTCGTTCGGCGTTTCCGCGCTGGCGACCACGGGGT
+TACATCTTGGTCACGGTAGTGAATCAGGGCTTTTCCATATTCTGGCCGTCCCGCTGTTTA
+TTTTCACTAACGCTATTATCGCTTTATTGCTGGTTCGTACATTTCTATTGCTGGTGCAGG
+GGACGTTGCTTATTCGCACTGAGCGCGCTGCACTGTTGAAAACGGAGGAAAAAAATGACC
+GTTCGTGACGAAAATTACTTTACTGAGAAATACGGTTTAACCCGCACGCATTCGGATGTG
+CTGGCGGCGGCAAAGGTTGTCGCGCCAGGCCGAACGCTGGATTTGGGATGTGGCAATGGC
+CGTAATAGTCTGTATCTGGCCGCGAACGGTTATGACGTTACCGCGTGGGATAAAAATCCG
+GCCAGTATGGCTAATCTTGAGCGTATTAAAGCGGCAGAAGGGCTGGATAATCTGCAAACC
+GACCTTGTCGATCTGAATACATTGACCTTTGACGGTGAGTACGACTTTATTCTCTCGACG
+GTGGTTATGATGTTTCTTGAGGCGCAAACCATTCCCAGTTTAATTGCCAATATGCAACGC
+TGCACAAAACCCGGCGGGTATAATTTGATTGTTGCGGCAATGGATACGCCGGACTTTCCC
+TGTACGGTGGGATTCCCGTTTGCTTTTAAAGAAGGCGAATTACGCCGCTATTACGAAGGA
+TGGGACATGCTGAAATACAACGAAGATGTCGGCGAGCTTCACCGCACGGACGAAAACGGC
+AACCGTATCAAACTGCGCTTTGCTACGATGCTGGCGAGAAAAACGGCCTGAGCGATGCAA
+GTTCTGTAAGTCTCGCTGCGTTCGGCATTTTTTTGTCGGGCGCTGCGTTCAAATTGTGCT
+GTCGTTACCATTTTTAGTGCATCCAGAATGATTTCGTTTTGCTATTATTTCCTTTGCATC
+ATTGCGAAGACTAAAGGGATCGTTTCATGCGTACTCATACTTTATTTAAAGTTGCAGTGC
+TTACTGGCTTGCTGGCGTTATCCGGCTGTGCGTCTAAAGTCACACAGCCGGATAAGTATT
+CTGGATTCTTAAAAAATTATTCGGACCTGCAGGAAACTACCTCCGCCACGGGGAAACCGG
+TGTTGCGCTGGGTAGATCCACATTTCAATGACTCTAACTATGACAGTATTGTTTACAATC
+CGATAACATACTATCCCGTCCCCAAACCAACGACCCAGGTCGGGCAGCAAGTTCTTGATA
+AACTGCTGGCTTATACGAACACTAAAGTAAAATCAGCAATTGAACAGCGCAAACCGCTGG
+TCACGACGCCAGGGCCGCGCAGTTTGATTTTCCGCGGGGCGATTACGGGCGTGGATACCA
+GCAAAGAAGGGCTGCAATTCTATGAGGTGATCCCTGTAGCGCTGATTGTGGCGGGCACGC
+AAATGGCGACGGGCCACCGGACCATGGATACCCACCTCTATTTTGAAGGTGAGCTGATAG
+ATGCCGCGACCAACAAGCCGGTCGTCAAGGTAGTACGCCAGGGTGAAGGTAAAGACCTGA
+GTAACTCCAGTACGCCAATGGCGTTTGAGACGTTGAAACAGGTCGTGGATGATATGGCGA
+CGGATACCTCTATGTTTGACGTTAACAAAAAATAATTCTGCGGCGCCATCGCAAGATGGC
+GCAAACCCCGGCAGATTAGCGGTCACCATCAGCCAGACAACGATGGGCGGCGCGTTCTCG
+TTAATACTGCATAGCCTATCCCGCCAGCGATCAACCCCCAGAATGCCGATCCGATGCCCA
+TCAGCGTTAGCCCGCTGGCGGTGACGAGAAATGCGATAACTGCCGCGTCACGCTCACTTT
+CGTGAGTAAGCGCCTGATACAGGCTACCGCTAATCGTACTTAACAGTGCCAGACCAGCCA
+GCATTTGCACCCAGCTAACCGGCAGGGCGACCATCAGCCCGGTTATCGAACCGCCAAACC
+ACCCGGCAAGTAAATAAAAAACGCCTGCGGCGGCGGCCGCTAACCAGCGACGCGTTGGAT
+CGGGGTGCGCGTCCGGGCTTTGACAAATGGCGGCTGTAATGGCGGCAATGCAGATAGAAT
+AAACGCCAAATGGCGAAAGCAGCAGCGCCAGCAATCCGGTAAAAATCATTAACGGAGAGA
+CAGGAAGCTGATAGCCAGACGCCTTCATTGTGGCGACGCCGGGGGCGTTTTGCGATGCCA
+TCGTCACCAGGAAGAGCGGTACCGCGACGCTCAGGCTTTGAGCGAATGAAAAGTGGGGGG
+GAACGAAGGTGGGCCACACCGGCGCGAAATGAATACCGCTCATCGCCACCTTACCCTGGA
+TGAGCGCCACCGTTATTCCCATCACCATGGCAGCAATAACGGCATAGCGGGGCGCGAATA
+CTTTAAAGAGTAGCCACGCCAATAGCATACCGCCGCACATGACAAACTCTCCGTTGAGCG
+TCCCGAACGCCTGCAGGCCGAAGCGTAGCAGTATTCCCGCCAGCATTGCAGCGGCAAGAG
+AATGGGGGATTATCCGCATCAAACGCGCAAACAATCCCGTGACGCCGCACAGCACAATCA
+GGGCATTGGCGACAATGAATATGCCCACCGCGTCTGGCAACGATAATCCCTGAAGCCCTG
+TTACCAACAGAGCGGCGCCAGGCGTTGACCAGGCGGTTAAAACCGGCGCACGATACCACA
+AGGTTAACGTTAGTGTGCTTATGCCCATGGCTATACCGAGGGCGGTCATCCAGCCGGCGA
+TCTCTGCGGGTGTTGCGCCAGCGGCAAGCGCCGCCTGCCAGATAATGGCGGCGGAACTTG
+CATAGCCGACCAGAACGGCGACCAGACCGGATAATACAGTAGGTAACGGCAGTGATAACA
+GACGCATGATCGCCTCTTGTGCGTTATAACGGTCAGTCAATGTAGCATTGTGCGTTATAG
+CGTACAAGTGATACGCTATGGCCTTACTGGGGGGGGAAAATGGATAACCTGACACACTAT
+CTGGCGACCACGTTAAGAATGTTACGCCATCAGCGAGGCTGGAGTTTATCGCGTCTGGCG
+GAGATCTCCGGCGTCTCAAAAGCCATGTTGGGGCAGATAGAGCGTAATGAATCCAGCCCG
+ACAGTCGCAACGCTGTGGAAAATTGCGACGGGCCTGAACGTTCCATTCTCAGTGTTTATT
+TCGCCGCCGCAGGCCGAATTTCCTCCGACCTTCGATCCCCAGCAGCAAGCGATGGTAATC
+ACACCGTTGTTTCCATGGGATCCTGAACTCTGTTTTGACTATTTTTCCCTATTGCTGGCG
+CCTGGCGCGGTCAGCGAATCAACGCCGCATAAAGCCGGCGTTGTCGAACATGTGGTGGTG
+ATTCAGGGTCGGCTGGACATGTGTACTGGTGGGGTATGGCAAACCATAGACGCCGGTAAA
+GGATTGCGTTTTGCCGGTGATATGGCGCATACCTATCGCAATAGCAGTGACCAGACGGTT
+CATTTTCACTCGCTGATCCATTACCCGCGTGGTTAAGCGGGAAAACTATTTCGTTAGTTT
+GCGCTTCTGACTACAATAGCCGCCATTTCGCTGCTATTGGATAAGAAAGACTGTATGCGC
+CAGCAACCTCACTATCTCGAATTATTAAGTCCGGCCCGTGACGCCGCAATTGCTCGCGAA
+GCGATTTTGCATGGCGCAGATGCCGTCTACATCGGCGGACCCGGTTTTGGCGCACGTCAT
+AACGCCAGTAACAGTCTGCGCGATATCGCCGATCTGGTTCCGTTTGCTCACCGTTATGGC
+GCCAGGATTTTTGTCACGCTGAATACTATCCTGCATGATGATGAGCTGGAGCCCGCGCAG
+CGGTTAATCACCGATTTGTACGACACCGGGGTGGATGCGCTGATTGTGCAGGATATGGGC
+ATTCTGGAACTGGATATCCCGCCGATTGAGCTTCACGCCAGTACACAGTGTGATATTCGC
+AGCGTGGAAAAAGCGAAGTTTCTTGCCGATGTCGGTTTTTCACAGATTGTACTGGCGCGC
+GAGCTTAATTTGAGTCAGATAGCGGCTATTCATCAGGCTACTGACGCCACGATTGAGTTC
+TTCATTCATGGCGCGCTGTGTGTCGCTTATTCTGGGCAGTGTTATATCTCTCATGCGCAA
+ACCGGGCGCAGCGCCAATCGGGGCGACTGTTCGCAAGCCTGTCGCTTACCGTATACGTTA
+AAAGACGATCAGGGGCGGGTGGTCTCTTACGAAAAACATTTGCTATCGATGAAAGATAAC
+GACCAAACGGCTAACCTCGGCGCGTTGATCGATGCAGGCGTACGTTCCTTCAAGATTGAA
+GGGCGCTATAAAGACATGAGCTATGTCAAAAACATCACCGCGCATTATCGTCAGATGCTG
+GACGCGATTATCGAGCAACGTGGCGATCTGGCGCGTGCGTCGGTTGGTCGGACCGAACAC
+TTTTTTGTTCCCTCCACGGAGAAAACTTTCCATCGCGGCAGCACCGACTATTTTGTTAAC
+GCGCGTAAAGGTGATATTGGCGCATTTGATTCACCAAAATTTATTGGCTTGCCGGTAGGT
+GAGGTGCTGAATGTGGCGAAGGATTATCTCGACGTAGAAGCTACGGAGCCGTTGGCGAAT
+GGCGATGGTCTGAACGTGTTGATTAAGCGTGAAGTGGTAGGTTTTCGCGCCAATACGGTG
+GAGAAAACCGGTCATAACCGCTACCGCGTTTGGCCAAATGATATGCCTGCCGACCTGCAT
+AAAGTCCGTCCGCATCATCCGTTGAATCGTAATCTGGATCATAACTGGCAGCAAGCGCTG
+ACAAAAACCTCCAGTGAGCGCCGTGTGGCGGTTGATATCATGCTGGGCGGCTGGCAGGAA
+CAGCTTATTCTGACGCTGACCAGTGAAGACGGTGTCTGCATCACGCATACGCTTGACGGG
+GTATTTGAGGAAGCCAACAACTCTGAAAAAGCGTTGAATAACCTAAAAGCCGGACTGGCG
+AAGCTGGGACAGACGCCTTACTACGCGCGTGATATGCAGGTGACATTACCGGCGGCGTTG
+TTCGTGCCAAATAGCCTGCTCAATCAGTTCCGTCGGGAGGCGATTGATATGCTTGACGCG
+GCGCGGCTGGCCCATTATCAACGAGGTCGTCGTAAACCCGTGGCGCAGCCTGCGCCGGTC
+TATCCGCAAACGCATCTCAGCTTTCTCGCTAATGTCTACAACCACAAAGCACGGGAATTT
+TATCACCGTTACGGCGTACAATTGATTGATGCGGCCTATGAGGCGCATCAGGAGAAGGGC
+GAGGTACCGGTCATGATCACCAAACACTGCCTGCGTTTTGCGTTCAACCTTTGTCCAAAG
+CAGGCGAAAGGAAATATTAAGAGCTGGAAAGCCACGCCGATGCAGTTGGTGCATGGCGAT
+GAGGTACTGACGCTAAAATTCGACTGCCGCCCTTGCGAAATGCATGTCATTGGCAAAATT
+AAAAACCACATCTTAAAAATGCCCCAGCCCGGCAGCGTTGTCGCTTCAGTGAGCCCTGAA
+GCGCTGATGAAAACGCTGCCGAAGCGCAGGGGCGTTTAATTAACGAAAATAGCTTTCTGG
+TTTGCGCGATTTCTGCCAGTTGTGGTGCTCGCGCAAGCCTTCCGCGGATTCTTCCGCTGC
+CGCCCGTAATTCATCGCTGTCGGCTTCGTGTCTAAGCTGGTGCCCTCCCGTCGCAAACCA
+TACGAACGCGTGGTCTTGCTGTTTCGCCAGTAACTGGCCTGAAAACAGCGCACAGGTCAG
+TAAAACTACTGATAACGTTTTTGTAAGCATCATGCCACCTTCCAGTTACGTCGTGAGGCT
+ATGATGCCAATAATTTCTTTGAGTTATTATTCCACACTTCAAATTAGCGAAAACGGTTTG
+TCAATAAGTGCGATAAGTTGTATGAGAAAATATACTTATACTCAGTATATCAATTATAAA
+AATAACGAGCCAATTCGTTCCATAGTAAATCCATTATTCCCTGGGAGTATATATTTAAAG
+TTATTGTATTAGATGGTTTTGGTATTGCCAGGGGATTGTAAATCCATACTATTTATGGTG
+TGATCAACTCTGGTGATGAGCCTCATTTTTTGTTGTTTCAACGAGTGAAGATAAATCTTC
+AGAAAAAAGGCTGTTATGAACTTGTAGCGCTACATATTCAGTAAGCTCGTTTAAACATAG
+CAGGCCATGAAAGGAACTTTCTTCCAGCATATTCATTAGTATCTCATTCTTAAACAAACA
+TGAATAAACAATTTGAGTAACTGAGCTTTGTGCATAATTTGGTTCAAACGCTGCATTCTT
+TAAGTTAGTATTCTCAATAACCTTTGCGGCTATTTTGTTTTTGATAGCGTCGTCAATAGG
+TGGTACATCTGCCTGGGCAATGCCCAGATTAATCCTGGAGGAGATGGCGGCTTTTCTTTC
+CTGTTCCTTCCAGTCACATAAATTACCCTTTTCTGCCATGGCGATAAGCGTCTCTTTTAT
+ATTTTTTAGGTCAACGGGAAATGTTATACCGCCGGATAGCGAGAGTAGTAACCGCTCAGG
+GAACAAGCAACATAGCTCTTCACAAACATAAGTGCTAGCTTTTATAGTAATATCAGAATA
+TCTTTTCAGGTGGGCAGGCTGAGTATCAACACAGAGCACTGTTCTATTCATTATATCATA
+ATAGTAGTGATCCTGACGTATCACAATGCATAACGGAATATCTTCGCCATCTTTAATAAA
+GAGATTTGTATATTGACACTCAGCATCTTTATAGTGCTGAAAATGGAAATTTCCTCTGCA
+TGACGGAGATGATAATTCATATAACGCGCAAAATAAATCAAATAAACGTTGCGCGTCAGG
+CGGAGAGGCAACATCACATAATTCCTTTATATATTGATCGGCAGTGGATCTTTGCGTGTC
+ACAAAAAAAATCTTTAATCCTTTCCCATAGTAACGTAAAGAAGGAGCGTTGAGAGATAGC
+ACTTTGAGAAAACATCTCACTCTTTAAAAATCCTCTCCCGATAGTAATTGGCATAATGTA
+GACCACAAGTGATTATATGATACTTCATTACTGGAATAGGTGGTATTCGAAATATTATCC
+CATGTTGCCCATCGGTTTGCCTATCGGTGAAACACCTGATTTTTGCTTTGTCCTGAACCG
+TCAACATTATTGTTCAATTGTTCAAATCGACCCGTAGCTTTAGTCATGCCCACGCCTCCT
+GGCCATGAAATATGTCAGATAAAACGAATGAAAGTAAAACGGTTTTCTTAATTCTCACAT
+CATCATGTACTATGAGTAATGATTAATTACGCACTATATTATTTTTAGAGAAAGTAAATA
+GTTGCTCAACCGTGTAGAAATTGTCTTATAAGAAGTTAAACTAAAAGTATTATTAGGCTA
+ACAACAATGAGATGTTTAGCGGTAGGGCAGAAGGCCAATACTGATAGTGCTTATGATATA
+AATACCTTACTCTTTAGTTTTTGTCTTAATTATATTTGTTGTAACGATTAGCTGACGGCT
+TTATTTCCAGTTGGGCGATAAAATTATAAAAACCTGCGAGGAGGCTCAAAATGAAGAAAT
+CAGATGGTGAAATTCACGAAAAGACAGCATCCTGGGGCATTTTGCAGTCAGAATGGCTAA
+GAAAATGTGGACGGCTATTATTGCTGTTACTTTACCGTTTCGTTATCGGATGGGCTTTTT
+TTCAATTACTTGCCATGATCGTGGCAGGGATATTTTTGTTAGGCGTCTTATTATTTCATC
+CCATAATATTTGTACAGACTATCGCAATCACTGAGAAGTTAAATCATGCTTCGCTTGATT
+TATGGCATATCCTTAAGTTATGCCTATGGCATTACGGTATCATCGCAGGGTTTATTTTTA
+TGGCGGAGTGTACGTTAAGTAAAAGTATACGGCAGGTTCAGCGCTTGTCCAAAAAATTTG
+GGGCACAGGATTTTTCTTCACGCCCGTGATCCGCCGCTGCAACCTGCGGTCTTACTGAAT
+AATGGCTATGACCAGCAGACCGAATTATCTCGGTTCGAGGGGGATTCTATGTGTTTGCAC
+AACTGCAGTGAATCGTAATTTCAGTGCATTATCGCCGACAATCGACGTGTTCCTCACTAA
+TTGCCTTCCTGACTATATAGTGGTCTTATCTTTGGCGAAACAATGTTATTTAGTTATGGA
+AGGCGACAACAACTGTACTACTGATTATCAAATGACCTTTCTGGTCAGGTAGACTCGCCT
+TTGTGAAAACACATCGTTATCTGTGCTCCTGAGACTCACTCCCTTGCCGCCTTTACGCAA
+CTCGAATTATTTTGGGTATAGAACAGGAGGCGCAGTGGTCGTATAAGCAAAATATAAACT
+CTCCGTTTGTGATAAGGCACAGATTACAGGGGGAATGATGTTTATTTTAACCATCTGTTT
+AAGCGGTGTCCGCTAATCTTTACCTGCTCAAATACATAATCACCCCTGTGACTCTCGCGA
+GGTGTAACATATGGTAAAATGCGTATCTTCTTTCCTCCTGTTCAGCCTGTTGTCCGTTCA
+GGCAATGTCAGCTGAAAACCATATTGATCTCCACCAGCCAAAAGACTTTGTCGATATTAC
+TACGGTCGCCCCCGACGTACAGGTAGACATGCGATACTTCAGTTCCCATAACTTTATTGG
+TCGCCCCATTAAAGGCTATAACGCGCCTGTTTGCCTGTTAACACGACCAGCCGCGAACGC
+AGTGAAGCAGGTCGCCGATCGTTTACGCCCCTTCGGACTTACCTTAAAAATATATGATTG
+CTACCGTCCGCAAAGCGCAGTGAACGACTTTATCGCGTGGGCCAAAGATCCTTCTCAAAA
+CCAAATGAAAAACGAATTTTATCCGCAGGTAGAGAAAAATCGTCTGTTTGAGGAAGGTTA
+TCTTGCCGCCAGATCCGGCCACAGTCGGGGAAGTACGCTTGATCTAACGATTGTTCCACT
+TGACAGTAAAATACCAATATACGATCCCGGACGACCACTGGTGAATTGTACTGCGTCCGC
+GGCGCAACGCTCGCCAGATAATAGTCTGGATTTTGGTACCGGCTTTGACTGTTTTAGTCC
+GTTATCCCATCCCGATAATGTCATGCTTACCGCTCAGCAACGCGCAAATAGGTTGTTATT
+ACAAACATTGATGCGTGATGCGGGTTTTACGCCACTGGATACTGAATGGTGGCACTTCTC
+TCTTACTCATGAACCATACCCGAACACTTGGTTTGACTTTCCCGTTAAGCAGAGACCCTG
+AAACGGCGTTTTGTTGCGAAATCTAATCATTACGCCTGTTGGAAAGCACCATAACAGTTA
+GCAAATCATTGTTAATTTTAACAACTGATATACACTGCGGTTGCCACCTGCAAGCAGCGC
+TCAATGAGATCGAATAATGAAAAAATATCAACGTCTGGCGGAGCAAATTAGAGAACAAAT
+CGCCTCTGGCGTTTGGCAACCCGGCGATCGATTACCCTCGCTGAGGGAGCAGGTCGCCAG
+TAGCGGCATGAGTTTTATGACTGTCGGTCATGCGTACCAGTTGCTGGAAAGTCAGGGACG
+GATTATCGCCCGTCCGCAATCTGGTTATTATGTCGCGCCGCATCCGGTTTGTCGGTCAGT
+CGCGACGGCAGCGCACGTTATTCGGGATGAAGCCGTAGATATCAATACCTATATTTTTGA
+GATGCTGCAGGCGAGCCGTGATACCTCTGTGGTGCCCTTTGCCTCAGCGTTTCCCGATCC
+GCGTCTGTTTCCCTTGCCGCAATTGAACCGCTCTCTGGCGCAGGTCAGTAAAACCGCGAC
+GGCAATGAGCGTCATCGAAAACTTGCCGCCAGGTAATGCAGAATTGCGCTATGCGATAGC
+ACGCCGTTACGCGCAGCAGGGGATTACCGTTTCTCCTGACGAGATTGTCATTACCGCCGG
+CGCGCTGGAAGCGTTGAATCTTAGTTTACAGGCGGTGACGGCGCCGGGAGACTGGGTGGT
+GGTGGAGAACCCCTGTTTCTACGGTGCGCTACAGGCCCTGGAGCGATTGCGCCTGAAAGC
+GTTGTCGATACCTACCGATGTTAAAGAAGGTATCGATCTTATGGCGCTGGAACAGGCGTT
+ACAGGAATATCCGGTGAAAGCGTGCTGGTTAATGACCAACAGCCAGAATCCGTTAGGGTT
+CACGCTGAGTGCTGAGAAAAAAGCGCGGCTGGTTGCGTTACTCACGCACCATAACGTGAC
+GCTAATTGAAGACGATGTTTATAGCGAACTCTACTTTGGCCGCGAGAAACCTCTGCCTGC
+CAAAGCATGGGATCACGACGATACCGTGTTGCATTGTTCGTCTTTTTCCAAATGTCTGGT
+TCCCGGTTTTCGCATTGGCTGGGTTGCGGGAGGAAGCCATGCCAGACAAATTCAGCGTTT
+GCAGTTAATGAGCACATTATCCACCAGTTCCCCCATGCAATTGGCGTTAGTGGATTATCT
+CTCGACACGTCGATATGACGCGCATCTGCGACGATTGCGAAGGCAGCTTGCCGAACGTAA
+ACAGCAAGCCTGGCAAACCCTTTTGCGCCATCTCCCGGCGGAAGTAAAAATTCACCATAA
+CGATAGCGGTTATTTTCTTTGGCTGGAGCTACCTGAGCAGCTTGATGCCGGTGAACTTAG
+CGCCAAAGCGCTTGAACACCTTATCAGTATCGCGCCGGGGAAAATGTTTTCAACGTCCGG
+CGCCTGGACGCGTTTCTTTCGTTTTAACACCGCATGGCATTGGGGAGAACGGGAAGAACA
+GGCCGTAAAACAGCTTGGCAGCCTGATTCGCGAGATGCTGAGCGCTAAAAGCCTTGTGTG
+AGGTGGAATGCGTGTCAGCTCACAACCTGACTAAATTTCCCGAGTGTGCCGGGTGAGCAT
+CTGGCGCGCCGTCTATTTTTAGGAAAGCGGCGGCCCGTTCGCCGGAAATCGATTAATGAC
+GATATGGGAAAATGCTATGCAATATCAATTACTGATTAATGGCGTGCTGGTGGACGGTGA
+GGGAGAAAGGCAGTCTGTTTATAACCCGGCGACAGGCGAGGTCATACTTGAGATTGCGGA
+AGCGTCGCCCGCGCAGGTTGACGCCGCAGTGCTGGCCGCCGATAGCGCGTTTGCCGAATG
+GGGGCAGACCACACCCAAAGCACGGGCGGAATGTCTGTTAAAACTGGCGGACAGCATCGA
+GCAAAACGCCCTTGAGTTCGCCCGGCTTGAATCGCAAAACTGCGGTAAGCCTTTGCACTG
+CGTAATTAATGATGAAATTCCGGCAATCGTGGATGTCTTTCGCTTTTTTGCCGGCGCGGC
+CCGTTGTTTGAGTGGGCTGGCGGCGGGCGAATATCTGGAAGGACATACGTCGATGATCCG
+CCGGGATCCGATTGGCGTGGTTGCCTCTATCGCGCCGTGGAATTATCCGCTCATGATGGC
+GGCCTGGAAGCTGGCTCCAGCGCTGGCGGCAGGTAACTGCGTGGTGATTAAGCCTTCTGA
+AATCACGCCGCTGACGGCGCTTAAACTTGCCGCGCTGGCGAAGGATATCTTTCCGCCGGG
+GGGGCTCAATGTCCTGTTCGGACGAGGGCAGACTGTTGGCGATGTATTGACCGGTCATGA
+AAAAGTACGCATGGTCTCTTTAACCGGTTCTATCGCGACCGGGGAGCATATTCTGCGCCA
+TACTGCGCCAGCGATAAAACGTACGCATATGGAACTCGGTGGTAAAGCCCCGGTGATTGT
+TTTTGATGACGCCGATCTGGATGCGGTGGCGCAGGGCGTCCGGACTTTTGGTTTCTATAA
+TGCCGGACAGGATTGTACTGCGGCGTGCCGTATATACGCGCAGCGCGGTATCTATGATGC
+GCTGGTCGAAAAGCTAGGGAACGCGGTGAGCAGCCTGAAAATGGGCGCGCCGGAGGATGA
+GTCGACAGAGCTGGGGCCGTTAAGTTCGCTGGCGCACCTGAAGCGCGTCACAGCGGCTGT
+AGAGGAGGCGAAGGCCCTCAGCCATATCCGTGTGATTACTGGCGGAAGTCAAACGGAAGG
+TAAAGGTTACTATTTCGCTCCGACGTTGCTGGCAGACGCAAAACAGGAAGATGCCATCGT
+GCAACGCGAGGTCTTCGGCCCGGTGGTCAGTATAACCGTCTTTGATGATGAAGATCAGGT
+TCTGAGGTGGGCCAACGATTCTCGCTATGGTCTGGCATCCTCCGTCTGGACTCAGGACGT
+TGGGCGGGCGCACCGGCTTAGCGCCAGATTGCAGTATGGCTGTACCTGGATTAATACCCA
+TTTCATGTTGGTTAGCGAGATGCCGCATGGAGGGCAAAAACAGTCGGGATACGGCAAAGA
+TATGTCATTGTATGGTCTGGAAGACTACACACTTGTCCGTCACATCATGGTTAAGCATTA
+AGGATCATTTACTGTTCAGAAAAATCGTGAAAAAATAGGCGGGTGTCGGCGGAGAGGGGG
+ACCTCCCCGCCAACATGCGCAGCAAGTACTCAAAGGTTGAACACCTCAAGCAAACCAGCC
+GAATCTCAACGAGATCAGACCCAAAAGTCCTGCAGCAGCAAAGACATTAATCAGCACGAC
+GGTTTTACTGGAAACATTCATTTTCGCCACCTTTCATCATAACCCCTATGGGTATAGTAC
+GGGTTGGCGAGATCCGCAATAATACGTAAACAGGATATTCTGTGAGCGGAGCCGTGCATT
+GAGAACGTTTTGCTGTTAAGGCTGATAAACCTTGATGTGCGTCAAATAAAAAGAGCATAT
+TGCGCGCGTTTTTTCCTCTGGTTGGCGCGGATGCCTGATATGACCCTCTTTCAAAAGATA
+TTAATTTTTTACGCCGTCATGGCGGTGATATCATCCCTGATCACCTGGTTTTTGACTCAT
+GACAAAAAACGAATTCGTTTCCTGAGCGCCTTTTTGGTTGGCGCGACATGGCCAATAAGT
+TTCCCCGTCGCATTGCTGTTTTCGCTTTTCTGACCTCAAGCCCGATACAGGTTACCGGGC
+ATGGTTTTTCCGCCAGGTCAGGCTATCAGGGCAATTAATTGCGCTCTGTCTACGTCGGTA
+ACGTCCTGCGGATGCCGATATCCTGCGTTCTCATTGGCCAGGGTATACAGCGCAACAAGC
+CAGTCATAGACATAGCGGCTGGCGGCGTGAACGGGCTGTTCGTCAAGCTTTGTTAGACGC
+AACATTGTCGAACGCGGTGTTGCGGCGAAAATGGCTGCGCCTTTCTGAACGCGGCTGGCC
+GGGCGTTGGGCCTCCTCGATATTGGCGTAGCCGAGCCAGGCGATGAAGTTACCAATGATG
+GCATGAAGCTGCGCGCCGCTCACCTCCTCGCGCTGCATGGTTTTCTGTAACTGCTGAGGT
+AAACCGAGGCGATAGCTGGCGGTAATTAAAATCTCCGCCACGGCGTTGAGCATCTGCGGT
+TCCAGTCCCAGACGCTGCGCATTATCCCGGCAGTGGGCCCACTGGCGCAGATGATTGATC
+CACATTTTGTGCGCCTGGTAGCCTGTTTCGTGACCTTCTGACGCTGAAGCGCGCGTTGGT
+TCGTCGGCAAAGAGATCGATCGCGTCATTAAATAAACCGCAGACCTGTTCTTCTCGTGAC
+TGTCGGGTGCGCAGCAACGCTTCGAAATTCTGTACTGGCGGTAACAGCCCGGCCAGCAGG
+TCGCCATGTCTGGCGGCCTGGGCCTGAAGACGCCGGATCACGGTTTCAACCGGTAGCCGC
+GCGTCATCAAACATCGGTAACAGATCGCGCACGCGGCCTCGCAGTTGTTCGCGTAACGCC
+TGTAAGCGCGCCTGTCGCTGTGGTGCCGATGTCGCCTGCGATAACCATTCCACCAAACGC
+TGCATACTGTGTTTATCCAGCGCCTGCAACGTTCCCCAATGCACGCCAGGTTTACCCATC
+AACTGCTGGACGGCTTCATCCAGATTTTGCTGGGTGGCAAAACGGGCATCCTGTGGAGTA
+ATAGCCCAGACGACGCCGGGTAACGCTGATTCATGCTGCGGCTGCGTGGCGTTAACCCAC
+TCCAGTAAGTGACGGGCGGCAGTGGACGTTTGCGAGCGAGATGCCAGAGCATTGCAAATC
+ACCAGAACATCGGGCTGTACCTGTTGGCGGTAATGGGCCAGCATCCAGCCTAATTTCGCC
+CGCCATAACGGATGAGGATGACTGTCTGGCGCGACCGGAATATCCAGTAAATCTACGTTA
+TCCAGTACGTTGTTTTCAACGGTTAGCACCAGTTCGCGGGTAAGCAGCGCCAGAGAATCA
+AGCGAAAGGCTGACCGCATTGAGCAGTCGGCCTTCCTTAACCGGATGCACCACCACATCG
+ATTTGCGTATCGTTGGCGGTTAGCGCCATTTGCGTCAGGAAGTTTTCCGCCGGTAAGCCA
+AAATGATCGACCAGCAGGCTGAGCGGCGCCGCCAGTTCCCCGGCATGGCCGGTTTGTTGC
+AACATATGCGCCAGCGCCAGCCATTGCTGGGTGATCTCCGGTTGCTCTCCCCACAGTAAT
+GCCCAGGCGTGCGCCCGTGTCGTGAGATCCAGCGCAGGCAAGAGCGAGGCAAAGTGTTGC
+CATGTCGCATCATCAATATGTTGTCTGGCGGACGGCAGGCAAGAGCGCCAGAAACTCGCG
+ATGGTCGCTACCTCTTCAGCGGTAACGCCGGGGACGGGCTGCGGTTGGCGAAGCGATTGC
+CATTTCTCCAGGCGTGATGTGATAATGGATTTTTCGACCTGGCGACAAATGGGGGACGCG
+CTGGTCCAGGCAATAAAGATCTGCACCAGTTCGGCTTCACTGATCAAGCGCAGGCGCAAC
+GGCCAGCCGCTCTCGTTTGAAAAAATGTCGCGCGTAAAGCGAATAGCCATATTCGCTGGC
+GCATGACCCGGATTGATGTGGCTGAAATAATCATAGTCACGGTCCGGCGTGATAATTTCC
+AGCTTGCCATTCTCGTTACCGCATAGCGTCGTTAACAGATGCGCTTTTGCGGATTGCGCA
+TACCCGTACAGACCAACGCAGCCATGTGACGCGCAGGCGGCGTTGAGCGCTGACTCATCC
+GCCGCGGCAAGCGTAAGTTGCGCCAGCAGAGCGTCGGCTTCGTCATCCAGTCGCGTTGCG
+TAACGGCGCGTGTTGTTAACCCACTCGATAACAGCCTGGGTGGCGTTTAACGGTTTTGTC
+ATTTCAGGTATACACTCCCGCTATCTATCCAGTAGTGGCTGCCGCTGTGGCGGCGGTCAG
+CCAGCGTATTCAATTTTAATGTCAGCGCATCGGCGGCGACCGGCGTCCCGTCCTGGAGCC
+AGGCATCACTTAATATGAACGATTCCGGGGCGCTATCTTTGCTACTGCCGCGTAATTTCA
+GTCGCACATTCAGTACGCCGTCGCCAGCGATGGTTTTCGCCAGTTCGGCGGAATTAATGC
+TCAGGCAATAAAGTGGTGTTGCCGGCCAGCGACTGTTCGCCAGTTGACGAAAGCCCAACG
+TCACGTTACCGCGTAGCGGAAAATGCAAGCGAGCGTCCAGCGTTGCGCCGGGTTTATCCA
+AATCGATTTCGTGATACCAGATGTTTTCATCGCGAAGGGTATTAACGGTATTATCCAGTA
+CGCCGAGATAACGTACAGTCGAATACGCGCCGATATCAGCCGCTTTAAAATTGAAACGCG
+GCAGACGTAAGTCCAGCGCCAGGCTGCATAACATCGCGCCCACCGCGGCAGTGGATTTTG
+GGTTACCGATACGCCCTTGCTGACTGAAGGGATACCATTCATGTACCTGATACTTATCCA
+TCCACACAATGCGATTAACCGGCACCGGTTGTAAGTGCCGGATGAGCGCCTGTACGCCGG
+GTAAGCAGGTCGGTCTCCCCGTCACCAGCAAGATATCGCAGTGATAGTGGGAGATCGCTT
+CGCAGACCGCATGAAGCGGCGTTGTTAGCGTAAACTGACCGGCCAGCAGAGCCTCCTGAA
+GCTGGCTAAACTGGATTTGCAACGGCACATTGAATATATCAAATGTCGGCGAACCAGACG
+GTAAGGCATGATCGATCGCCTGCTGGATATAGTTCATCACGTTGCTCGTTGGGCGGCGGA
+TCAGCAGATCGCCAAATGTCGCGTGTAAACCGGCAAACGGATCGTTAATGTCGCTTTGCT
+CCCAGGCGGAAAGTACCGCATGGCCCAGCGGCATAAATAATTGCAGCGCCGTTTGCTGAC
+GCAAAATGGCCTGAGTATCAATTCGTCCCGAATCGCCAAATAAGGTCGCCAGCAGGGCGG
+CGGCATCCGTAACGCCTGCCCGTTGCAACGCCGTTTGCAGGGAAGGGAGTACACAGCGCT
+GAATGATATCCAATAGCAGATCGTCCCCGGCGACTTTAAAACCTTCGCGAAACAGGAGAT
+GAGGCGTAATTTTTACATTGGCCCCCACGCCGTCATCTAACTGATAGTGAACGATCGCCA
+TATCCGTCGTGCCGCCGCCGATATCAATCGATGCCACGCGCAACGCGCGTCCGGGGACGA
+CGCCGGGTTCAGGCTGGCGATCCGGTCTGGCGAGCGCATTAAAAAAGGATTCGGTACGCC
+CGGCGTAATGCGAAATGGCTTCGTTATAAAGCCATACCAGTTGGCCGCAACTTGCTTCGT
+CCCATTCCATCTGTATTTCTGGTACCGGCACCACGCTTTTTTCACGCTGCTTAGGCGTGG
+TGAAATCCTCATCCTGCGGATGCCAGCCCATGGCTTTCCAGACCAGCGCCAGCGCTTCAA
+ACATTCGCTGGCGGAAAATTTCTCGCTCCTGTTTCGGCATGGCGGAAGGCAGCGTTAAAA
+TCAGGGTGCGTAGCTGGCGCGGCGAGGCGGGAAAGCCGAGCCGCAGCCGGGTGGCGACGC
+TGTTAATTTGCCCCAGCGCCTGAGCCAGAATTTCGCACAACATATGCGTCATCAAGGTGC
+TACGGCTGTATTGCGGCGAAAAAACCGGTAGCCTTTCTTCATGCGGCAGGCGGAATAACG
+GCTGTCCGTCATCGTTCATCAGATTCATCAGCGGAAACGCGGTGGCAAGCGCTTCGCGCT
+GCGTTTTACCGTGGATCTGGCTAAAACGCCAGTCCTGCAAGGCGGGGGTTTCATCCCACA
+GGTAGCGACGCGGGCTGGAGATGCCGCTGCTGCCTTCGGTGCCCACACGCTGCATAGCAA
+GGGCGCGAGCCTCGTCGCCCACACGCACAATGGAAGGCCAGACAAAGGCGTCGTCTCGTC
+CGCTTTCGACAGAAAAGTGTTGCTTGCCAAAGCGTGCTTCCGAGAATTCCACCCGGCTGG
+TAAATAAAGGATCGTTCAGATACTGCGGCTCGCTTAAAGAACGCACCTGAAGCTCTGCCG
+TCTGGCGTAACCCGTCATTCGCATCGCCATGATCCTCGATCAAGACGCCGCAGGTATGCG
+TATTGCCGACATCCAGAATCAGATCGACCGGGATTGCGGGCGTGCTTAACGTATGTGTCA
+TAAACTTTACTTCCGGCACCGTAAGCTGTTCGCCTAACAGCGTCAGTAAATTCAACCAGT
+GCGCCTGATACTCAAAGCTACGCAGCGCTTGTTGTATGGCCTGTTCCGAACGGTTTTCCA
+CCTGTGAGGCATACTGAAGAAACGACTCGCGCAGCCAGCCGTCAATCCATGTCTGGTCAA
+GAAAATCGGCAACTTCTTCATCCTGCCAGGCGAGCGCAAAACGTGTGCCATTGAGCAGAT
+CGTTTTCGCAAGGCGCCAACGCCGCAGGCATATTTTTTGCCAGTTGACTGTCGAAGGCGA
+GGGTGATCCGGTGTGTGTTTCCGGCGCTATCTGGCTCGCTGAGTTTACGTACCTGAATGC
+GCGCCCAGTTATCCGGCCCGTCAATAAAGGTACGCGGCGGATTAAAACGCAGGAACGGCA
+GGGGAAGCCAGATTCCGTCGAGTACATCCAGAGAATAGTGCAGCGTCTGAGTGCTTTCCG
+GTTTCACGACTTCGGGTTGGCCGCCAGCACGTCCAGGCAACGTGTAGCGCCCGCTGGTCA
+GATCAAAATCGAGGCGCAGTAGCGGGCCGTTTGCCGTTTTGCGCACAAAACGTCCGTAGT
+GGGCCGACTCTTGCGGCGTTAAGCCAAAATCAAGAAACTGGACGCCACTGTTTGCAATGA
+GCGTGACGCTCTGTTTGTAATCACACAGATTGACCAACATAAAATCAGGCACCTATCTTT
+TTAAACGTCAACGGAATTGCCGCGTGGTCGCCATAACGGGCGGTACAGGTTGCGACGTCA
+TTGACGCCTGCTTTACAGGTAATTTCCGGCATCGGATAACGTGAACCGTCGGTGCAGCGC
+GCATTGCCGCGACTTTTAATCATCAGCTCGCCCGTTTGATGCAGACCAGAGAAAATTTCC
+GCCCGACAAACCACGTTATCGCCATGTACTACGCGCGCGATACCTTTGTTATTTTGGATC
+TGATAACGCAGAGAGGGCGGCTTGCCGGTAATCGGATCTTTGACATCCACGCTGACCCGC
+CAGCTACCGTTTAAAAAGCGCGTGGTTCCAAGCTTCATCTGCGTACTGTCCATCACCAGC
+GCGTCTTTGGGAATAGCGGCAATGATAACAGGCGCTTCCGGCAGCGGCGCCGCTTTGGGG
+GCGGGCGTCACCTCAGCGCGATGCAGCGGCAAATGCGCGGTGAGTTCAGGCAATGGGGTA
+ACGTCAGTTTTCGCGGTAGCGACAGGCGCGGCGCGAACAGGAGAGGACCCGTCAACGGAT
+GAAGATGGCCAGAAAAAAGGCGTGGCGACGGCGGCGATAACCACGGCAGCGACAGGTAAG
+CTCCACAGCGGTAGACGGCGAGCTCTTTTCGCCTCAGCAACCGGGATGGGTGTGGCCGGC
+TTCGGCTCGCTAACGATAACGGGCGGCGCAACAGGTTCCTCCGGCATTTTCGGCGGCTCA
+ATGACAGACGTTAACAAAGGTTCATCCGCCTGACTAAATGCCGCCTCTACCAGCGGCTTT
+TCTTCGGGCTCCGGCTCCGGCTCGACCAGAGGGATGTCGGGGATTGCCTCGGTTACCCGC
+AGGCAGTCCAGCACATCATCGCGTGTATTTTCGTTGAGATTAACGAATCCCCAGAAGGTG
+ATAACCGGTTTGCCGTTAACCAGGAAAACATGATTTTCGCCGGGAAATTGCGTCGCTTTC
+TCAAGTAGCGACCCAAATAGCTGGAGCGCTGTTTTACCGGATTGCAGACTTTTGCGACTG
+AGTGCAGCCGCGCTTTCAAAAGTGCTGGCTAAATAACGTAAAGCCCGAGAACGTGTCTCT
+TCGTCAGCCGCTTTCCACGCTATCGCCTGACCTTCAATCGGCGAATACCAGTCAACCCGA
+TCGCCATTATCGTTAAGTTGCGGAATCGCCAGACAGTCAACCATCGCCTGCTGTTTACGC
+AGACGAAGCGTTTCGCGAATTTGCAATGCTGATTCAAATACGGCCTGACCGCCGCCGCCC
+ACGGCCTGATAATCATCCAGATTGCCGCTGCGCAAGAGAGATTTTGCCACGTTGTTATCC
+CTTAGACTTCTTCACGCGTCTACTTTACGGGGTCTATACGCAAGCAAACGGCGGAAGAAA
+GGCAAAAAGGCGCGAATTCTCGGTCTATTAAGCCCCGTGTTTTCACTTGACGTAAGTTAA
+ATCAGGAGGGCAGCGGCGAATTACCGCATCGGGCGACAATAACGCGTATAATAGGCGAAT
+CATGCTGTTACAGAATAAAGAGTAGGAGAGCTTATGTCGCACCTGGAGGAAGTGAGCGCC
+CGCGTGGATGCCGCCATCGCGGAGAGCGTAATTGCCCATATGAATGAATTGCTGATTGCC
+TTGAGCGATGACGCTGAATTACGTCGCGAAGATCGTTATGTGCAGCAGCAGCGTTTACGC
+ACGGCTATCGCGCATCACGGCAGGCAATATCAAGAAGATCGGGACGCGCGCCGCGAGCAG
+CTCACCAAAGGCGGCACGATCCTGTAACCCATTAAAACTGGCGCTTCGCAATCAGCCATG
+CGCCAATGACCAGCAACAGCGCGCCAAACGCCGGCCCGACCATTGCGCGTAACGTGACGC
+CGTGGCTACGCGCGATATCCAGCGCCAGTCCGCCGATTAACTGGCTGGCGACCAGTACCG
+CGATAGTCGTCGCGGCGCCAACGTTCTGATACCCGCTAATGCTGGCAAATACAAAAAATG
+ACCCCAGCAGACCGGGGATCAATGTCCACCAGCGAACGCTGGCGACCAGCTCGCCGAAAC
+CCGCAGCGCCTTGCTTAAACCACAATATCGTCACAAATAAAACGATCCCTACCAGCGAGT
+TCAACAGCATAGCGATCAGAATCGTCGATGATGTCTGCGTAATACGCACCATAATACTGT
+TTTGTACCACCAGCCCGACGCCGGCGAAAAAGATAAGCGTCAAAGACTGGTTCATCAGCA
+GGCGTCCGGCGCGGCGTGTTCATCAAGCTGGAGCTGCATAAACGTAAGATCTAACCAACG
+GCCAAATTTTACGCCGACCTGCGGCATTTGCGCGGTAACGGTAAATCCCAGCGAATGATG
+CAGGCGTATCGAGGCGGCATTCTGTGACTCAATACCGGCCACCATCACATGCTTGCCGCA
+GCGTCGGGCTTCGTCGATCAGTCTGCTGAGCAGCTTTCGCCCCAGTCCTTTCCCCTGGTG
+CGCCGGATGAACATAAACCGAGTGCTCGACGGTATAGCGAAAACCGTCGAAACTGCGCCA
+ATCGCCAAATGATGCATAGCCAGTCACCACGCCATTTTCTTCGCTTACCAGCACCGGATA
+GCCCAGTAATTGACGGGCCTCATACCAGGCAAGGCGATTATCCGTATCGACCGTCCGATC
+GTTCCAGATGGCCGCAGTATGTAATACCGCATGGTTATAGATTTCGGTAATCGCGGCGCA
+GTCTGCTTTATCGGCAAAGCGAATCGTCATAGGGAACCCCAGGGAATGTTTACGATAGTG
+TTAGAAATACTATTGAAGGCGGCATAAATCAACGAATTAGCGCAAGAATTCATATTTAGC
+GAGAGGGGAAAGAAAGTCGTTCATAAAAGCGCACAGCCTGATATCTGAGAGTGTTTAACT
+CCCTCAGAAAGCTAATGTTCGACTATTATTGATGGATTATGCCAGGCATGAGGAGAATAG
+AATGAAGCAACAGACCAACCGAAATCGTCGTTGGGTTTTGGCCTCGCGTCCCCACGGCGC
+GCCGCAGATGGATAACTTCCGCCTCGAAGAAGATGACGTCGCGACGCCCGGTGAAGGGCA
+GGTGCTATTGCGTACCGTTTTTTTATCACTCGACCCTTATATGCGTGGCCGCATGAGCGA
+TGAACCCTCATATGCGCCGCCTGTTGAACCTGGCTGCGTTATGGTTGGCGGTACGGTCAG
+TCGCGTTGTCGCGTCAAACCATCCTGATTACCGACCAGACGAATGGGTGTTGAGTTACAA
+TGGCTGGCAGGATTATGACATTTCAGATGGCGAAGGGTTAGTAAAGCTGGGTGATAATCC
+GCAACATCCTTCCTGGTCATTGGGTATTTTAGGAATGCCGGGGTTTACCGCCTATATGGG
+GTTACTGGATATCGGCCAGCCGAAAGAGGGCGAAACGCTGGTTGTCGCCGCCGCCACCGG
+CCCCGTAGGCGCAACGGTTGGGCAAATTGGTAAGCTGAAGGGCTGCCGGGTCGTGGGTAT
+TGCTGGCGGCGCGGAAAAATGCCGTCATGCGACAGACGTTTTGGGATTTGATCTGTGCCT
+TGATCATCACGCTGATAATTTCCCACAACAGCTTGCGCAGGCCTGCCCGCAGGGTATCGA
+TATCTATTATGAGAATGTCGGTGGTAAAGTCTTTGACGCCGTCTTACCGCTACTGAATAC
+GTCGGCGCGGATTCCGCTCTGCGGTCTGGTCAGCGGCTACAATGCGACAGCGTTGCCGGA
+CGGTCCAGACAGACTGCCTCTGCTGATGGCGACATTACTTAAAAAGCGTATTCGTCTGCA
+AGGTTTTATCATCAACCAGGACTATGGTCACCGGATACATGAGTTTCAGCAAGAAATGGG
+GCGTTGGATCAAAGAAGGGAAAATACATTACCGGGAGCAGATTACTGATGGGCTGGAAAA
+TGCGCCAGAAGCGTTTATGGGGCTGCTGGCGGGGAAGAACTTTGGCAAAGTCGTGATACG
+TTTAGCGGACGATGCGTAAAGAAAAAATGGCGGCATTATGTCGCCATAAAAATGTGCAAA
+TTTTAAAATTCCGGCTTTACTTATATTCATCATTCAGATCGCGGTGGGGCAGCTTATCTC
+GCTCAGCGGCCTGAACCGGTCAAAAATCTCGATACATGAAGGAATGACGGAGATAAAACG
+GTTGCCATAAAGAAACCTGTATTGTTGTAAAAGATGAGAATATCACGCAAGTAAATTATC
+ACTTTTATTTATTTGGCCGTTCAGGCCTGGATTATCTTTTTTACAATTAAGTTCCGAAAC
+TTCTTCGGGACTCGATTGCGATGTTGTTCTGCCAAGAGGTGAAGGAAGGAAAATGCCGGG
+TACGGAAAAAACACAACATATAAGCCTGACCACACAGGTTGAAAATCGGTTAAAGCATCA
+ATTGTCTATTGGCGCATTAAAACCAGGCGCAAGGCTTATCACTAAAAATATCGCTCAAGA
+GTTAGGCGTCAGTATTACGCCAGTGCGTGAGGCCCTGTTAAGGCTGGTCTCTTCCAGTGC
+TTTGGCGGTGGCGCCAGCACAGGCGTTTATGGTGCCGGAGATCTCGCTGGAAAGTTTGCT
+GGAAATTAATACGATTCGTACTGCCCTGGAGGAGATGGCGGTGGTCGCCGCTGCGGGTAA
+GATTACCCCGGATCGCGAGCAGACGCTGAATGCGCTATTAGATGAATTTCAACAGGCGCT
+GGAAAGTGGCGTTATGGAGAAAATTCTTTTGGCCAACCGCGCATTCCGCTTTGAGATCTA
+CCACTACGCGGATATGCCAACGCTGTATGCCATGATCGAGCAATTATGGGTACGCCTGGG
+GCCAAGTCTGCATTTTTTATATGATAATTTTAAACTTGATGATTATCAAAACGGCGTTAA
+TCTGTACAGAAAATTGCTTAATGCGTTAGTGACTGGTGATAAAGAAGCCAGTCGCCACTG
+CCTACAGAACGTTTTGCAACAAAACGTAGCGACGATTAAAAATCAGTACTTCATGTAACT
+TTCATGAAACTATGACTAATCAATAGCGGGGATGCCCCGCTATTGCCGGATATTTATTCA
+AATTGCCATGCCAGATTAATCCCCACGCCATAGTTACGCCCTGGCGCTGGCTCATAATAT
+CGGCCATTAGATTCATTAACGATCACCGAACCGATATATTCTTTATCAAATAGATTATCT
+ACCCGCCCAAAAATATCGACGGTAAGCTGACTGTAATTAAATTTATACCCTGTATTTAGT
+CCAACAACGGTATACGAAGGCGCTTTGGCGGTATTTTCATCATTGGCCATGATATCGCCC
+ATATACCGAACGTCTGTTCCGGCGTACCACCCCTCATCCGGGATAAAACCTAATGAGGCG
+AATCCCATATTACGGGCGATGCCGGGCATCCGGTTTCCATCACAGTTTTGCCCCTGACAA
+ACGTTACTGCGATAGGTCGCATCCAGCCAGGTCCATGATGCTTTCACCCGCCAGTCGCCG
+GCGAAGCGCTGGTCCAACGCGAGCTCTGCGCCCTGGCGGCGCGTTTTGCCCGCGTTTTTG
+TAGGTAGTGCGTCCTCCCATACTACTGGCGACGACAATTTCATCATCGGTATCGGTTTGA
+AATAACGCGGCGGTCAACAAGCCATTGCCAATCCGCGTTTTACTGCCGACTTCCACCGTA
+TCATTGGTCGACGGTTTGAGGTCAAAGTTGAACCCGCTTTGGCCGTCAGCGCGATAAGAA
+AGTTCATTGATAGTGGGAGTTTCAAATCCGCGACCGGCAGCAAGATAGAGATTCCAGGCG
+TCAGTTAACGCATATTTTAGCGATCCGGCGGGTAGCCAGTGGTGATAGCTGGCGTCGCCG
+CTGTCATCGCCATTGCCGGGCGCGATATAGTGATCGTTAGAATCGAACCACACGGAACTG
+TAGCGCACGCCAGCATCCAGCGAGAGTTTTTGCGTAAGCTGCCACTGGGTTTGCAGATAA
+GGATCGACATTCCACATCAGGTTACGCTCATCCCGCCGTAAATCGCCTTTATGCCCGAAC
+TCAGGGGGGCCGTTGTTGAGACGGAAGTTATTGTAACCCTTGCGGTTTTCGCTCATGTTT
+TCATAGTTTAACCCGCCAGTGAAGGTGACCGGCACACCTAATTCTCCCCGGTGAGTCCAG
+CGGGAATCAATTCCCTGATAGTGGCGTTGCAGTGTAATTACGCCGCCAGCCTGGGCTGGT
+TTTAGCTGTGCCACCAGGGGAATAGACTGGTATTGCGTGGTTTCCCGCTCTCCGGCGTAG
+GCCATCACGCTGATATCATCCTGCGCGCTGAGCTGACGTTCATAACGCAATCCTGCCTGA
+GTTTGTTTGATGGTTTTACGCGTATTGTACTGTTCAGCGCGCGGCGCCTGTTGCGGATCG
+GCTTTCCATTCAGATTCGGTAAGTCCGCCGGGATCGTCCGCCTTAATGTCCACACTATTA
+AAAATCAGCGAAAGTTTACTGACATCGTCAAGGCGCACGCCCAGTTTGGCATTAGCCAGA
+TTTTTTCGCGCGCCGCTGTGATCGCGGTAGCCGTGGGTGGTGAAACGGGTAGTTGATACC
+GTGTAATCCACGTCGCCAGGCTGTGTGCCGTCACCCATCGCGCCCGTGGCTTTTAGCCCA
+TAGCGCCAGCTTCCATAACTGCCGTAGTAGCTGCTGGCCTCAAGGGTGGGCGGCTGTCTC
+CCGGTTTCGGTGGTGACATTTATTACGCCGCCGGAAGCATTGCCGTATAGCGCTGAGAAG
+GGGCCGCGTAACACTTCAACGTCTTGTATGCTGTTAATATCAATATTCGAAATCTGGCCT
+TGTCCATCCGGCATGGTGGCGGGAATGCCATCAACATACAGACGAATGCCGCGCACGCCA
+AAGGCGGAACGCGAGCCAAATCCACGGATAGAGATTTGCAGATCCTGCGCGTAGTTCTGC
+CGGTTCTGCACCTGCAATCCCGGGACGCTGGTTAAAGTCTCAGATAAATTAACGCGCGGC
+GTCGCCAGACGCATGTCTTCTCCCTCAATGACGCTAACGGCGGCAGGTGTATCCAGTTCG
+GATACGGTTTGCGGCGTTGCGGTGACTATCATGGTTTGTTCATTGGACGCGCTGGCGGCC
+TGAAGGACCGGGGAGAAGGTCAGAGGCAATAAGAGGGCGGGATAAAGTCGCTGTCTAACG
+GAAATAATTTTCATGAAAATGCCGGATAAATGTAAGCGTATCAACGGAAAACGTGACATT
+AAGGGTAGTCAATATGTAAAGTTTTGAAATTTTAATCGCACATTAAGTTAAGAAAATGTG
+CGGTATTTAAGAGCCATGACATTCGCAGGCGAGGAAAAGCTCCACTTTCTGATAAATAAT
+GATTATTATTCTCAACTTATAATAAGTGCGGAACGAAGATCCCGCGCAGCGAAGTAGTGT
+GAAGCAGCTATACACGTTTTTATCAAAGGGAGTCGTCATGCACTTACGTCATCTTTTTTC
+GCCGCGCCTGCGTGGTTCTTTATTGTTAGGTTCGCTCCTCGTGGCATCCTCATTTAGCAC
+GCTGGCGGCGGAAGACATGCTGCGTAAAGCAGTAGGCAAAGGCGCTTATGAGATGGCCTG
+GAGTCAGCAAGAAAACGCGCTCTGGCTGGCTACATCGCAAAGCCGTAAACTGGATAAAGG
+CGGCGTAGTTTATCGTCTCGACCCGGTGACGCTGGAAATCACGCAAGCGATTCATAACGA
+TCTCAAGCCGTTCGGCGCCACCATCAATGCCGCGACCCAAACGCTGTGGTTTGGCAATAC
+CATTAACAGCGCTGTTACCGCGATTGATGCCAAAACGGGTGATGTAAAAGGTCGTCTGGT
+ACTTGATGCGCGCAAACGTACTGAAGAGGTTCGTCCGTTACAGCCCCGTGAGCTGGTTGC
+CGATGCGGCGACCAACACGATCTACATTAGCGGTGTTGGTAAAGAGAGTGCTATTTGGGT
+AGTGGATGGCGAAACCATCAAACTGAAAACGACGATCGAAAATACCGGCAAAATGAGTAC
+GGGTCTGGCGCTCGACAGTAAAGCGCAACGCCTGTACACCACCAATGCGGATGGCGAATT
+TATCACCATCGATACCGCCAGCAATAAAATTCTCAGTCGTAAGAAGTTGCTGGATGACGG
+TAAAGAACACTTCTTTATTAACCTGAGTCTCGATACCGCAGGTCATCGCGCGTTTATCAC
+CGACTCGAAGGCGACTGAGGTTCTGGTTGTCGATACCCGTAATGGCAATATTCTTGCCAA
+AATCGCGGCGCCTGCTTCTTTGGCCGTCCTGTTTAACCCGACACGTAACGAGGCGTATGT
+GACACATCGTCAGGCAGGTCAGGTCAGCGTGATCGATGCGAAGACCTATAACGTTGTTAA
+AACGTTCGATACGCCGACGTACCCGAATAGCCTGGCGCTATCGGCAGACGGTAAAACGCT
+CTACGTCAGCGTGAAGCAGAAATCGACACGTGAACAGGAAGCGACGCAGCCGGATGATGT
+TATTCGCATTGCTCTGTAAATAGGGTATGGAGGGGGAAACCCCTCCAGTCATCTCTTTAA
+ACGCACCGATACGCCTCGTTACACCCCGCCGATAGCCTGATGATTCTGTGAGAATTACAC
+TGCCTTTTTGCTGTAGTTAACTCATTATATTCACGAGGAAAATATGAAAAAGTTATTTAT
+ATGCTCAGGTTTGGGCATGATGTTTTTTATGCTTGCGGGTTGTACAACCAACTATGTGAT
+GACGACGAAGAATGGGCAAACGATCGTAACTCAGGGTAAGCCGCAGTTAGATAAAGAGAC
+GGGGATGACCAGTTATACCGATCAGGAAGGCAACCAGCGGGAAATTAACAGCAATGATGT
+GGCGCAGTTGATTAAGGCTGACTAAGCATTGGGCGCGATGCGGTGTTGGCGGCAACGCGC
+ATTAAACCCGGCAGGCCTGGGGCTGCCGGGGAAGGGGAATGTTATGTCGCTGCTTCTTCT
+TTCAATACGACACTCTCTGTCGAATCCGCCGTCACTGGCGCAGTGCGATGGATCTCCGCC
+ACGCGACGTCGCACGCCAAACCAGCCGGCGACCAGCAGAATGGCGATCAGCGGCAACGAG
+GCGATAGTGTAAGTTCCATTCGGGTAGTCAAACGCCATGAGTACCAGCACGCTTAGTAAA
+AACAGCAGCGTTAGCCAGGAGGTAAAAGGCGCGCCGGGCAGTTTAAAACTGACGTCTGCG
+GCTTTGCCTTCTTTTATCGCCTGGCGTAAACGCATCTGGCACACCATGATAAACGCCCAC
+GACGCGATAATGCCGAGCGAGGCAAAATTAAGAACGATCTCAAACACGCGGGAGGGGACC
+AGGTAATTCAGGAATACGCCGACCACGTAAACCACCAGAGTCGCCAGTATACCCGCATAG
+GGCACATGCTGACGGCTCATTTTCGCCATGAATTTCGGCGCGGAACCCCCCATCGACATT
+GAACGTAAAATTCTCCCCGTACAGTAAAGCCCGGAGTTCAGGCTGGAAAGCGCGGCGGTT
+AACACCACGATATTCATAATACTGCCGATATAAGGCACGCCAAGTTTAGAAAAGAAGGTG
+ACAAACGGACTTTGCCCCGCCTGGTAGGCGTTCCACGGCAGCAGCAAAACCAGCAATACG
+ACCGATCCTACATAGAAAAGACCAATACGCCAGATCACGCTATTGATGGCTTTTGGCACC
+ATCGTCTGTGGATCTTTGCACTCCCCAGCGGCGGTACCGACCAGTTCAATCGACGCAAAA
+GCGAACACTACGCCCTGAATCAGTACCAGCGCGGGCAACAGGCCGTGCGGGAAAAAGCCG
+CCATTATCTGTAATCAGGTGAAAACCGGTGGCATTACCCTCAAGCGGTTGACCGGTACCG
+AGAAAAATCGTGCCTACCACCAGGAAGATAACAATGGCGAGTACTTTTATCAGCGCGAAC
+CAGAACTCCATTTCGGCAAACCATTTTACGCCGATCATGTTCATGGTACCGACAATGGTT
+AACGCGCCGAGCGCGAACACCCATTGCGGAACGTCGCCAAATGCGCCCCAGTAGTGCATG
+TATAACGCCACTGCGGTGATATCGACGATCCCGGTCATCGCCCAGTTAATAAAGTACATC
+CAGCCTGCGACGTAGGCCGCTTTTTCACCCAAAAATTCACGGGCGTAGGAGACGAAGCTC
+CCGCTGGAAGGGCGATGCAATACCAGTTCGCCCAGCGCGCGTAAAATGAAAAAAGAAAAA
+ATGCCGCATATCAGATAGACCAGCGCCAGTGCCGGTCCGGCCATTTGCAATCGGGCGCCT
+GCACCTAAAAATAAACCGGTGCCAATCGCGCCGCCGATAGCAATCATCTGAACCTGACGA
+TTCCCCATCGCTTTGTGATACCCCTCTTCATGGGCGTTCAGCCAGCGTCGTTTCGCCGCA
+TGTTGTTCTGCGGCGTGCGTAGTCTGTGTTTTCATTACGTTACCTGTTATAGCCTGTCCT
+GACAGAAAAATTCCTTATGCCGCGACGGGCGCTCACCAATCGATTGCCTGCAATGGCGAA
+TGCCGCTTTTCCCTGATTCTGTGACAGGGATAAAACCGCCGGCGGAGCATCCTACCTGCA
+ATTGTTAAATGACGCAAAACATACGGAAAGAAGAAAATGAGGATGTCGTGTTTATTTGTG
+CGGTCAGATGTGGTGCGGTGTGGTCACGATTCAGCCAGATAAGCTTTCAGCACAAATCCG
+CAGTGATTGCGTTGCGCAATAATTAATCAGGGTTAATCCCTGCAGGGATTTATGGTCATA
+GATATGACCTCGAACGATAAACCACCTGACGATATTGAAGCAGCATAAGATCAGGCCGTT
+GCGCCTGTTATTCTCATTTCCTCCTGAAAATGTATGCCTTTGAGCAATTTTGTTGATTGA
+CATATCGTCATAATGAGAGAGGAGTAGGACATATAAAGCTATTGAGCAAAATTTGAAGGA
+GCAGGATATGCCATATACATCAGTTTCTACCTATGCCAGAGCTTTATCAGGAAATAAGCT
+ACCTCATGTTGCTGCAGGAGATTATGAAAATAAATTATCAACAAAAATCATGAAAGGCAT
+CTTGTATGTGCTTACCGCAGGACTGGCCTACGGATTTACGCGAGTAATTGAACATTATTG
+CAATGTTACGCCTAAAGTTGATGAGTTCTGTGCCAATGCAGGGAATATCCATAATCACCT
+TGCTGATGCTGTGTGTGATGGGCTGTATACTATAGATGTCGACCTTTCTGATGGTCGGAG
+GTTAACATTCGAACAACTCTCGCTGATGGCTGGACGTGAGCCAATCGTCAGGATATCGGA
+TGGCGAACATACCGTTGAGGTTAAGGGGTCCTTTGAAGAGATTTGTATGAGACTGGAAGA
+GGGCTTTTTTGAAGCGCCAGCGTACTATGATTATGATATTGATGAAAAATATAAAACCGT
+CAGAGAGCGAATGGCAGCATATAATGCCTTACCTCAGGCATTAGGCGCCATTCCGTGTTT
+AGAATATTATATCGCTCGGGCCAGCAACATGCAGGAGGCGAAAGCGCAATGGGCGGCCGA
+CATAAAAGCTCGCTACCATAACTATTTGGACAATTATTAAAAAGCGTTTATGTTTAGCCA
+GTTTTGTTAGAAATCAGACTCGCTGAGCCGGCGTTAAAAATTTTAACACGCCGCTATTTT
+GGCGGCGTGTCGCAAAGAGATTCTCAGAACCCGATTTCCGTTTGTACGCCAAAATTCCAC
+GTACCTCCGGCGCGACAGCCGGCCTGTCTTATTTTTTCAAAAGTATCCAACGCTATTCCA
+CGGATAGGGTATCCTGTTGCGCAGCGATATCCGCCTCAGCCTGTGTGCCGAACGCAAGCA
+TTAATGTTAATGGAAGCCTCAGATGACCTCTTTTTTACATGCTTATTTTACGCGATTACA
+TTGTCAGCCGTTGGGGGTTCCTACGGTTGAAGCGCTCAGAACGCTTCACTTAGCGCACAA
+CTGCGCGATTCCTTTTGAAAATCTGGATGTGCTACTGCCTCGTGAAATACAGCTCGATGA
+GACGGCATTAGAGGAGAAACTGCTTTATGCCCGACGCGGTGGATACTGTTTTGAACTGAA
+TGGTCTGTTTGAACGTGCGTTACGCGACATCGGTTTTAACGTCCGAAGCTTATTGGGGCG
+GGTCATTCTGTCTCATCCCGCCAGTTTACCGCCGCGCACGCACCGTTTGCTGCTGGTTGA
+TGTTGAGGATGAACAGTGGATCGCTGACGTGGGGTTTGGCGGCCAAACGCTAACCGCGCC
+GCTTCGTCTGCAGGCTGAAATTGCCCAGCAAACGCCGCATGGCGAATACCGCCTGATGCA
+GGAGGGAAGCACATGGATTTTACAATTCCGCCACCATGAGCACTGGCAGTCGATGTACTG
+TTTTGATCTGGGGGTGCAGCAGCAGAGCGATCATGTGATGGGCAATTTCTGGTCGGCTCA
+CTGGCCGCAATCCCATTTTCGTCATCATTTGTTGATGTGCCGCCATTTGCCTGATGGCGG
+CAAGCTGACATTAACGAATTTCCACTTCACGCGTTACCACCAGGGACATGCCGTTGAACA
+GGTCAATGTACCGGATGTACCGTCGTTGTATCAGTTACTTCAGCAGCAGTTTGGTCTCGG
+CGTAAATGATGTAAAGCACGGTTTTACCGAGGCGGAGCTGGCCGCGGTAATGGCTGCATT
+TGATACCCATCCGGAGGCGGGAAAATAATTTTTTGCCGCGAGGATTTGCGGGCCTGACAA
+AGATTAAAAAGTAATGGCCCATTCGGCATGAAACAGAATGACCGCCTGGCCGGAGATGGT
+GACGTTTTCCGGCTGGTTATCGCGAATGGTGACGGTAACATCAACAGTACCCTCTTTGCC
+TAAAGCGCGCCCCTGATGGCCTTGAATCTGCAGCGTTTTACCGTCATGCGCCATCAGGCC
+ATGATGGACGAGCCATGCCCCCATCGGGCCATTGGCGTTTCCCGTTACCGGATCTTCCAC
+AATTCCTATCGCCGGGGAAAACATTCGCCCATCGGTTTCGTTTTTTCCCGGACGAATCTG
+GAAAGGAAAAAAGCCGTTACAGCCAATTTGCTGGCTGATTGCCGTCAGGGCTGCCAGATT
+CGGAGAAAGGGCATCAATATCAACGTCTGGTTTGAGCAGGATCATCACTTTTGCATGTCC
+TGTTGAAGCCACCTGAATTGGCGCTCCCGGCACGATATCATCTTCAGTCAGGTTCAGTGC
+GGTGATAATGGCAGCCCGAATCTCTCCGACTAACGGTGGTTCAAAAGAGGGCTGACCTTG
+TTCCAGCGTGATGCGATAGTCGTTGTGTTCGGCATGAATTTCAACGCGATGACGGCCCGC
+TAACGAGGTTTGCCAGACGGTGGTGTTTCCCAACCCCAGTACCGTTGCCCGAACATAATG
+CGCGGCCACGGTGGCATGACCACAGATGGGGACTTCTACTGTCGGTGTAAAGTAGCGTAT
+GCGCACATCACTCTCTTCGCTTTTTAGCAAAAAGGCGGTTTCCGAGTGACGAAGTTCACG
+GGCAATCAGCTGCATCTGCGCGTCGCTTAGCGTATCCGCATGTAAGACAACGCCAGCAGA
+GTTGCCGCGAAAGGGTTCGCTGGTGAAGGCGTCAACATGGTAAATCTGCGGTTTCATTGA
+TGTTCTCCTTTGACTGAAGAATCATCATAGCCTGTGCGTTGCCGAATGACGACGCCCAGA
+CGTTTTTCTTTGCCCGGTAAGCGTCCCCCCGGGCAAAGAGAATTAGCGGCGGGTACGAAC
+AATCTGGTAGCGACGGGTGAAATACTCAAACGGCGCGCTCCAGACATGAACCAGACGGGT
+GAACGGGAAGAGCAGGAAAATAGTCATTCCCAGCACCAGATGAACGCGGAAAACAAACGC
+CACACCGCTCAGCATTTCCGAAGACCCGCCGCGGAAGGTGACAATACTTTGCGCCCAGCC
+CACCAACTTCATCATTTCGCTGCCATCCGGATATTGCGCCGAAAACGGAATAGTGCTCAG
+GCCAAGCAGGCACTGAATCAGCAAAATGCTCATGATGATAATATCTGGTGTAGTGGATGT
+CGCCCGCACACGCTGATTGGTCAGACGACGCCACAGTAATCCCGCGCCGCCGATCAACGT
+TAATACGCCGCACACGCCGCCGAGGATCATCGCCATCTGCTGTTTTACCGCAATCGGCAG
+GAACCAGGCATACATCCAGTGTGGCGTCAGCATTCCAAACAGATGGCCAAAAAAGATCCC
+CAGAATGCCAATATGGAACAGATTCGACCATATCACCATCCCACGCTTATCCAGCATCTG
+GCTGGACGACGCGCGCCAGGTATATTGTCCGTAGTCATAGCGCAGCCAACTGCCGAGGAA
+GAAGACCGTGGCGCAAATATAGGGGTAGATATCGTAAAAAAAGACGTTCAGGTACTGTAT
+CATTTCGGGCCTCCCGCGCTGACGTCGACGTACTGCGGCGCCGCGTCCTGGCTAAAGCGT
+CGTTGATAATGGTGTAACGGTGAACTGTCACAGGTCGTGGCGTTATCTTCGATAAACTTC
+ACCTGTTCTTCTTCCCAGACGGCATCCAGTGCCTGACGGGTATCATCCCGCGATTCCTGA
+ACAATCTGTTTGGTGACACTGTCACTTGTAAGCGTACTGCCCGCCAGCGTCAGCAGGGCG
+TCAAACAGTTGATACCACGGCGCTCCTCGCTGTTTCAGACGACCGCCCAGTAGCGCCAGA
+ATAGGGGCAATATTCTGTAATCCCTCGCGCGCTTCCGCTTCCGGCAACACGCTTAAGTAT
+TCCAGATAGAGCGGCAGGTGATCCGGCAGTTCGCGGCAGTTGAGCTGCAGGCCCACGGTT
+TCATACTGGCTTAACAAATCGACCATCGCCTGGCCGCGATCGCGGGACTCCGCATGAACA
+TGCTCGAATAACAGCAATGAAGTGGCGCGCCCGCGGTCAAACACTTCACACCATTCTGCT
+TGTTTATCCAGTAACGGCGCATAAAGCAGCTCGCGAGTGAAGTCGGCCAGCATTGGCGCA
+TCGTGTTGGATAAGGGCAAGCGCTTCATCCCGACATTCCCACAACTCGTCGTCCGGATAC
+TCCATCAACAGGCCAATCGCTTTGAGGATTTGCATTATTCCCCCTCCGCTTTATCACGTA
+CTTCGGTGATATTGATGGCATCAATACGGCTACTGTTGAACAGGTTGAATTTGGTATCCG
+ACCCGTGGCAACCGTCGCCAAAAGTAAAGCCGCAGCCGTTGCGCTCCGGAAAGGCATCGC
+GCGCCATTTCCCGGTGGCTGGTGGGAATGACAAAACGATCTTCATAATTGGCAATCGCCA
+GGTAGCGATACATCTCTTCAACCTGTTGTACGCTCAGACCGACTTCGTCAATCGCGCGGG
+TATCCGTCACGCCTTCAACCGTCTGCGAGCGCATGTAGTGGCGCATCGCCATCATCCGCT
+TTAGAGCCCGAATGACCGGACCGGTATCGCCCGCGCTGAGCATATTGGCCAGGTACTGGA
+CCGGAATACGCAGCGTCTCCACCGCCGGCAGAATATTGCCATTGTGCGGTAACCCGCCCG
+CGTCGGCGTATGACTGGATGGGCGACAGCGGCGGTACGTACCAGACCATCGGCAGGGTAC
+GGTATTCCGGGTGCAGCGGAAGCGCCAGCTTCCAGTCCATCGCCATTTTGTACACCGGCG
+ACCGTTGGGCAGCGTCGATGACGTTTTGCGGGATGCCCTGTTTAAGCGCCTCTTCGATGA
+CCGCCGGATCGTGCGGATTGAGAAACACATCACACTGACGTTCATACAAATCCGTCTCGT
+GTTCGGTACTGGCCGCTTCTTCAATCCTGTCGGCGTCGTAGAGCAGAACGCCAAGATAAC
+GGATGCGCCCGACGCAGGTTTCCGAGCAAACGGTCGGCTGGCCGGATTCAATACGCGGAT
+AGCAAAATATGCATTTCTCAGACTTGCCGCTCTTCCAGTTAAAGTAGATTTTTTTGTACG
+GGCAGCCGCTGATACACAAACGCCAGCCCCGGCATTTATCCTGGTCGATTAGCACGATGC
+CGTCTTCTTCACGCTTATAAATAGCGCCACTTGGGCAGGTGGCGACACAACTGGGGTTGA
+GGCAGTGTTCGCACAGGCGCGGCAGGTACATCATGAAGGTGTTTTCGAACTGACCGTACA
+TCTCCTTTTGTATGTTGTCGAAGTTGCGGTCGCGGGCGCGTTTTTCAAACTCGCCGCCGA
+GCAGCTCTTCCCAGTTTGGCCCCCAGATCACCTTGTCCATCCGTTTTCCGTCGATCAGTG
+AACGAGGACGGGCAGTGGGCTGATGCTTACTCTCCGGCGCATTATGTAAATGCTGATAAT
+CGAAGGTAAAGGGTTCATAGTAATCATCGATTTGCGGAATCACCGGGTTGGCGAAAATTT
+TGCTAATTACCCCCATTTTGCCGCCCAGACGGGGCCTTATCTTGCCATTAACATCACGAA
+CCCAACCGCCTTGCCACTCCTGCTGGTCTTCCCAGTTTTTGGGATAGCCGATACCCGGTT
+TAGTTTCGACGTTATTGAACCATGCGTATTCCATCCCTTCACGTCCGGTCCAGACGTTTT
+TACAGGTGACGGAGCAGGTGTGACAGCCAATACATTTATCAAGATTCAGTACCATCCCAA
+CCTGTGAGCGTATTTTCATTTTTTCGCCTCCTGTACCTGATCCCGGCCCTCATCATCCAG
+CCAGTTAATGTTTTTCATCTTCCTGATCATGATGAATTCATCGCGATTCGAACCCACGGT
+TCCGTAATAGTTGAAGCCGTAAGCCAGTTGCGCATAGCCGCCGATCATATGCGTCGGTTT
+TGGACAGACCCGGGTCACGGAGTTATGGATCCCGCCGCGCATCCCGGTCACTTCCGAACC
+CGGAATGTTCATAATCCGCTCCTGGGCGTGGTACATCATGGTCATACCCGGCGGGACGCG
+CTGGCTGACCACCGCACGAGCGGTAAGGGCGCCATTAGCGTTGAAGGCTTCAATCCAGTC
+GTTATCTTCAATACCCAATTCACGGGCATCGGCTTCGCTGATCCAGACAATCGGCCCGCC
+GCGCGACAAGGTCAGCATCAGCAGGTTTTCGCTGTAGGTGGAGTGAATTCCCCATTTCTG
+GTGCGGCGTCAGGAAGTTAAGCGCTTTTTCCGGGAAACCGTTGGGCGGAATTTCTCGCAT
+TTCGCTGACGCTGCGGGTATCAATCGGCGGACGATATGCCACCAGGCTTTCGCCAAAAGC
+GCGCATCCACGCATGATCCTGATAGAGTTGTTGACGCCCCGACAACGTGCGCCACGGGAT
+CAGTTCATGTACGTTGGTATAGCCGGCGTTATAAGAGACATGCTCGCTTTCCAGCCCTGA
+CCAGGTCGGGCTGGAGATAATTTTGCGCGGTTGCGCCTGGATATCACGAAAGCGAATTTT
+CTCATCTTCTTTATTGATGGCCAGATGGGTGTGCTCGCGCCCGGTCATCTCGCCCAACGC
+CTGCCAGGCTTTCACCGCCACCTGGCCGTTAGTTTCCGGCGCTAAGGCAAGAATCACTTC
+CGAAGCATCCAGCGCGGTGTCGATCCGCGGACGTCCTTTCGCCGGGCCATCGTGTTTGGT
+GTAATTGAGCTTCCCGAGGAAATCGACTTCATCTTGCGTATTCCAGGCAATACCCTTACC
+GCCGTTGCCTAATTTATCCAGCAGGGGACCCAGCGAGGTAAAACGTTCATAGGTGGCCGG
+ATAATCGCGTTCAACCACGACGATATTGGGGGCGGTTTTGCCCGGAATAAGTTCGCACTC
+GCCTTTACGCCAGTCGAGAATATCAAATGGCTGCGCCAGTTCCGCCGGGGAATCATGCTG
+GAGCGGGTGTAACACCACATCGGTTTCCTGTCCGAGATGTCCGACACACACTTCAGAAAA
+GACGCTGGCGATACCTTTGTAGATCTCCCAGTCGCTTTTGGATTCCCAGGCAGGATCGAC
+CGCGGCGGAAAGGGGGTGGATAAACGGATGCATATCCGAGGTATTCATATCGTCTTTTTC
+ATACCAGGTGGCGGTCGGCAAAACGATATCGGAAAACAGACAGGTACTGGACATACGGAA
+ATCAAGCGTGACCAACAGATCGAGCTTGCCCTCAATCGCGGCGGACTGCCATTCCACCTC
+TTCAGGCTTAATTCCTTCGCTGGAACCCAGCGCTTCGCCCTGAATACCGCTGTCGGTGCC
+CAGCAGATATTTGAGCATGTACTCATGACCTTTCCCGGAGGAGCCGAGCAGGTTAGAGCG
+CCAGACAAATAAATTTCGCGGGTGATTATGACCACTGTCAGGCTGTTCGCAGGCAAAACG
+GATAGCGCCTGATTTCAACGCCTGCACGGTATAATCCGCCGCAGACAGCCCGGCTTTATC
+GGCGCTCGCTTTCACGCTGAGCGGGTTAAGATTAAGCTGCGGCGCCGAGGGTAGCCAGCC
+CATACGTTCCGCGCGCACGTTGAAATCGATCAGGTGTCCGGAAAATTTAGCCGGATCGGC
+CAGCGGCGACAGCAACTCTTGCGCAGTCAGTTTTTCATAGCGCCACTGGCTGGCATGGTT
+GTAGAAAAACGAGGTACTGTTCATCTGACGTGGCGGGCGATTCCAGTCCAGCGCGAAGGC
+CAGCGGCAGCCAGCCGGTTTGCGGCCGCAGCTTCTCCTGGCCGACATAGTGCGCCCAGCC
+GCCGCCGGTTTGTCCAACACAGCCGCAGAACACCAGCATGTTAATCATCCCACGGTAATT
+CATATCCATGTGATACCAGTGATTCACTCCCGCGCCGAGGATGATCATCGAACGACCGTG
+AGTTTTATGGGCGGTCTCGGCAAATTCACGTGCAATAGTTTCGATATGTCGACGCGGCAC
+GCCGGTAATCTGTTCGCCCCAGGCCGGCGTGTAGGCTTTTACGTCGTTATAATTATTGGC
+GCTATGGCCGTCATCCAGACCACGATCCAGCCCATAATTAGCCAGCACCAGATCGTAAAC
+GCTGACGACCATCCGCTCGCTACCGTCCGCCAGAGCCAGGCGTTTCACCGGTAACTGACG
+TACCAGCACCGGTTCCTGCCGCACGCTGCGAAAATGCGGGTTTTCGTTACCGCCAAAATA
+GGGGAAGGCGACACCCGCCACGTCATCATGCTGACCGAGTAAAGAGAGCGACAGTTCAGT
+TTCGACGCCCGCCGCCACCGGTTCCAGGTTCCATTTTCCCTTTTCGCCCCAGCGAAAACC
+GATAGAACCATTGGGCGCGACCAGTTCGCCCGTACTGTTGAGCGCGACGGTTTTCCATTC
+CGGATTATTGGCTTCTCCCAGTCCATCCACCAGATCCGACGCGCGCATCATACGCCCCGG
+CACATAACTGCCGTCTGCGCGCTCATCCAACAGAACCAGCATTGGCATGTCGGTATAACG
+GCGGCAATAGTTAAGAAAATAGTCGCTGGGATTATCGAGATGAAACTCTTTTAAAATAAC
+GTGACCCATGGCCATCGCCAGCGCGCTGTCGGTACCTTGCTTTGGCGCCAGCCACTGATC
+GCACAGTTTAGCGACTTCGGAATAGTCCGGGGTGATGGCGATCGTCTTGGTGCCTTTGTA
+GCGCACTTCGGTAAAGAAGTGGGCGTCCGGGGTACGCGTCTGCGGCACGTTAGAGCCCCA
+GGCAATAATGTAGGCTGAGTTATACCAGTCGGCGGACTCCGGCACGTCAGTCTGCTCGCC
+CCAGGTCATTGGCGACGCGGGTGGAAGATCGCAATACCAGTCATAGAAGCTCAGACAAGT
+ACCGCCAAGCAATGACAGATAACGTGTTCCGGCGGCGTAAGAAACCATCGACATTGCCGG
+AATAGGTGAAAACCCCGCCACACGATCCGGACCATAGGTTTTGATTGTCCAGACGTTAGC
+AGCGGCAATGAGCTGATTCAGCTCTTTCCAGTTCGAACGAATAAAGCCGCCATGTCCGCG
+CACCTGTTTGTAACTTTGGCATTTTTGCGGGTCGTTCATTATAGATTCCCATGCCAGTAC
+CGGATCGCTGTGCCGGGAAAGGGCCTCGCGCCACAGTTCTATCAGCCGCTTACGCACCAG
+AGGGTATTTCAAACGATTGGCGCTATAGAGATACCATGAGTAGCTGGCGCCGCGCGGGCA
+GCCGCGCGGTTCATGGTTCGGTAAATCGGGACGCGTGCGCGGGTAGTCGGTTTGCTGGGT
+TTCCCACGTCACCAGACCATTTTTGACATAAATTTTCCAACTACAGGAGCCCGTGCAGTT
+GACGCCGTGGGTTGAGCGCACGATCTTATCAAACTGCCAGCGCTGGCGATAACTGTCTTC
+CCAGTCGCGGTTGGTATGCATCACCTGACCATGGCCGTCGGCAAAGGTATCGCCTTTTTG
+TTTAAAGTAACGAAAGCGATCCAACAGTTTACTCATGACATTTCTCCTGCTTCGATAAAT
+TTTCCGCCATCCTGTCGATTTGGCGTTAAACCATTACCGGATGGCCGTCCTACAGGTGCG
+TATGTTGTTATTGTTGTTTAGGCTTACGACGCCCGTAGACCAGCCAGGTCAGCAGGACGC
+AAGCGATGTAAAACAGCAAAAAGATTTTCATGGCGCCCACCGGCGAGCCGGTCAAGGCCA
+AAGAGGTGCCAAACGCTTTTGGAATAAAGAAGCCGCCCACAGCGCCAATAGCGGAGATAA
+AACCGAGCGCGGCGGCGGTATCCGTCACCGCTTCGCGCTGCGCCTGCTCATCGCTCCCGC
+CGCGCAGTTTGACGTTGTAGAGCGTGATCTGACGGAAGATCACCGCAATCATCTGGAAGG
+TAGAACCGCTGCCGAGACCCGCTGTCAAAAACAGGCCCATAAAAACAAGATAGAACGCGC
+TAAAGCTGCCTGCGCCGGAGCCTGGCAGTGTGAGGAATAGCAAGGCGGTAAACAGCGCCA
+TAAAGATAAAATTAATGAGCGTGACGCGAACGCCGCCGAATTTATCGGAGATCACGCCGC
+CTGCCGATCGCGCCAGCGCGCCGATAAAGGGGCCAAAGAACGCCAGTTGCAGAATGTTTA
+CGTCGGGAAATTGCGTTTTGGCGAGCATGGCGAAACCTGCGGAAAAGCCGATGAATGACC
+CGAATGTCGCCAGGTACAACAGGCTAAGCAGCCACAGGTGCAGACGTTTTAGCACCGGCA
+ATTGCGAGGCGACAGACGCTTTTGAACTGCCGATATCGTTCATACCAAACCAGGCGGCAA
+GCGTCGCGACAGCCAGTAACGGCACCCAGATCCAGGCTGCGTTAGTGAGGGCGAGCAGGG
+AGCCATCAGGTTGCGGCACGCCCCGGACGCCTAAAAAAGTAAATATCGGCAGAAAAATAA
+CCAGCGGCGCAATCAACTGCATCACACTGACGCCAAGATTTCCCAGTCCGCCGTTAATAC
+CCAACGCGCTACCTTGTCTGGCTTTTGGAAAGAAAAAACTGATGTTGCCCATACTGGACG
+CGAAGTTTGCCCCCGCAAAACCGCACAACAGAGCGATGAGCATAAATACCCCGAAAGGGG
+TGGCAGGATTTTGCACGGCGAATCCCAGCCAGGTGCAGGGAATAATCAATATTACGGTAC
+TTAATACGGTCCATTTACGGCCACCAAACAGTGGTACCATAAAGGAGTAGGGAACGCGTA
+ATATTGCGCCGGAAAGAGAAGGTAGTGCGGTTAATAAAAAGAGTTGGTCGGTGGTAAAAT
+TAAATCCAATTTTATTGAGGTTGACGGCAACAGCGCTAAACAACATCCAGACGCAAAATG
+CAAGGAGCAAACAACTTACTGAAATCAATAAGTTTCTTCTGGCGATGCCTTTCCCTTTAT
+TCTCCCAGAAGGCTGGATTTTCGGGTCGCCAGTCACTCAAGAGATAACGGTTATAATTCT
+CGTTTTGTCGTGTCATTTTACCCCTCACATGCGCATATCATTTGAAGAAAAACACAAAAA
+AGAGACAGAGCGTCACGCGCTCTTTTGAGAACTTATTGAAGTTTTTTTAGAATATTGAGT
+GAAAGAATAGATAAAAAACCAGGCCAGCGCGGCGCGATGAGGAGATATGATGTTTCTTAA
+TTGTTACTATTTGTAAATTAAAAGCGATTTTTATTAAATTATTTGTAACTTTACGCAAAG
+AGTTCAAGCGTAATCATACGATCCAGATGGAATTTAAACGCGGGATCGGCCATTTCCGGA
+ATCCCCAGTACATACATACCGTCCAGCCCGCACACCAGTGCGATAAGCCGCCAGGCGATA
+TCCGTGGCGTTAGCAGTAAACGTAAATTCTCCTGCCTGTTTGCCCTGCTCGATAATTGTG
+ACCGTTTCCTCATGCCACATCTGCATCGTGAGGAGATAAGCATCTCTGATGTGCGGATCC
+CGGTCGGCCAGAATTTGCGCCTCTCGCCACAATTTTATGTAAGGCTCAAAGCCGCCGTCT
+TCGCTACCCAACATAGCGTGAAGCCGTGCACGCCAGGTGGCGGGCGGCGGAACTTGCCCG
+GCATCAAGCAGGGTGCGGATCAAATGGACAAAGGCCAGCGCTTTGAGCTCGCCCGCCGAG
+CTGAAGTGGTGATGCACCTGGCCGGCGGCGACATCGGCTTCTGATGCAATTCGTCGCACC
+GTCATGGCGGCAAACCCGTCTGCCAGCGCCACGCGCATCGCCGCTTGCAGGATCACTTCG
+CGGCGTTCATCCCGGTTAAGGTAACTCATATTTTCCCCACATTAGCCAATGCGCGCAGTG
+TAACAAAAAGCTGGACATTCGTTCAACTTACCGTAGGATCCTGAAGCTGGACAATCGTCC
+AAATTTGAGTTTTTGAAGGGAGAGTTATGTTTCGTCAGTGGTTAACGTTAGTCATTATTG
+TGCTGGTCTATATTCCTGTCGCCATTGATGCCACGGTCTTGCATGTCGCCGCCCCGACAC
+TGAGTATGACACTGGGGGCCAGCGGCAACGAGCTGCTGTGGATCATTGATATTTATTCTT
+TGGTCATGGCTGGCATGGTGTTGCCGATGGGCGCGCTTGGCGATCGTATCGGTTTTAAAC
+GCCTGCTGATGCTGGGCGGGACGCTCTTTGGCCTGGCGTCATTGGCGGCAGCGTTTTCGC
+ATACCGCCAGTTGGCTTATCGCCACCAGGGTATTACTGGCTATTGGCGCGGCGATGATTG
+TACCGGCGACGCTGGCCGGAATACGCGCTACCTTTTGTGAAGAGAAGCATCGCAACATGG
+CGCTGGGCGTCTGGGCAGCGGTAGGTTCGGGCGGAGCGGCGTTTGGGCCGCTCATCGGCG
+GCATATTATTAGAGCATTTTTACTGGGGATCGGTTTTCCTGATCAACGTGCCGATTGTGC
+TGGTCGTCATGGGCTTAACCGCCCGCTATGTTCCTCGCCAGGCGGGCCGTCGCGATCAAC
+CGCTCAATCTTGGCCATGCGGTGATGCTGATTATTGCCATTTTGCTGTTGGTCTATAGCG
+CTAAAACCGCGCTGAAAGGGAATTTGTCGCTGTGGGCCATCTCGCTTACCCTGCTTACCG
+GCACGCTGCTCCTGGGACTCTTTCTCCGCACACAGCTTGCGACATCGCGTCCGATGATTG
+ATATGCGACTATTTACCCATCGCATTATCCTGAGCGGCGTCGTGATGGCGATGACCGCGA
+TGATCACTCTGGTGGGTTTTGAGCTGCTGATGGCGCAAGAGCTACAGTTTGTTCACGGGC
+TATCGCCTTATGAGGCCGGGGTATTTATGCTGCCGGTGATGGTCGCCAGTGGATTCAGCG
+GGCCGATTGCGGGCGCGCTGGTCTCGCGTCTGGGGTTACGGCTGGTCGCGACGGGCGGCA
+TGGCGTTAAGCGCGCTGAGTTTTTATGGCCTGGCGATGACGGATTTCAGCACCCAACAAT
+GGCAGGCCTGGGGGCTGATGGCGCTGCTGGGATTTAGCGCCGCCAGCGCATTGCTGGCTT
+CCACGTCGGCAATTATGGCCGCTGCGCCGGCAGAAAAAGCGGCGGCGGCCGGCGCGATAG
+AAACGATGGCTTATGAACTGGGCGCGGGACTGGGCATTGCCATTTTCGGTCTGTTGTTAA
+GCCGTAGCTTCTCCGCGTCTATCCGTCTGCCTGCCGGGCTTGAGGCGCAAGAGATTGCCA
+GAGCGTCATCTTCAATGGGAGAAGCCGTGCAGTTGGCGAATAGCCTACCGCCCACGCAGG
+GGCAGGCAATACTGGACGCCGCCAGACATGCCTTTATCTGGTCGCATAGCGTGGCGTTAA
+GCAGCGCCGGGAGTATGCTTCTTTTGCTGGCGGTAGGGATGTGGTTCAGCCTGGCAAAAG
+CCCAACGCCGATAACATAACGCCTGGTGAGATAAGCGCTTAATGCGCTAGCTGGCAGGGG
+GAGTCCATTTCCTCAACCTCTTTACCGCTGAGGCGTGCGTATTGCCCCGTCAGTCGCCAG
+AAGGCAGGCTGGGTTTCGGTATAAATTTCCGCAGCCAGAATCAGCCGACGGCGATCAACT
+TCGTTCAGTTCCAGTAAGGTCCAGGGAATAAAATAGCGATCGGTATCGGTAAGCCGAAAC
+CACAGCGGACACCCGCAGCCGGAACAGAAGTAGCGTTCGCCGCGCGAAGAGGATGAAAAG
+TATGGCGGTTCCGGGGAAAGGGGGGCTAGCTGTGGTTGCCCGCAGGCTTCCAGATACATG
+GCTATTCCACCCGACCATTTTTGACACAGCGTACAATGGCAGGCATAGACATCCAGCATT
+TCGACGTCAACGGTAAAATGGCTCTGTCCGCAAAGACAACGACCAGTGAACGTCTGCACG
+GCATACTCCTTATGACCGAGTCTACATCAAGAGAAAAAGCCAGCCCTGAAAGGACTGGCT
+TTGTATTCAGACTACAACAAAATTAGAACTGGTAGTTCAGACCAACAGCAACGATGTTGT
+CGGTAGACACTTTAGCCGCTTTGGTGAAGTCGCTGTCGTCCAGCAGGTTGATTTTGTAAT
+CAACGAAGGTGGACATGTTTTTGTTGAAGTAGTAGGTAGCACCGACATCGATGTACTCAA
+CCAGATCCTGGTCGCCGTAAGTACCCAGGTTTTTACCTTTGGATTTCAGGTAAGCGATGG
+ACGGACGCAGACCGAAGTCGAACTGATACTGAGCAACTGCTTCAAAGTTCTGGGTTTTAT
+TCGCGATAAACGCATCACCCGCTGAATCTTCACCAAAGGTGGTCATGTTCAGCGTTTCGG