annotate paired_fastq_filtering.xml @ 34:91996b991991 draft default tip

Uploaded

<tool id="paired_fastq_filtering" name="Preprocessing of FASTQ paired-end reads" version="1.0.0.3">
    <stdio>
        <exit_code range="1:" level="fatal" description="Error"/>
    </stdio>
    <description>
        Preprocessing of paired-end reads in FASTQ format
        including trimming, quality filtering, cutadapt filtering and interlacing. Broken
        pairs are discarded.
    </description>
    <requirements>
        <requirement type="package">blast</requirement>
        <requirement type="package" version="4.4">cutadapt</requirement>
        <requirement type="package">bioconductor-shortread</requirement>
        <requirement type="package">r-optparse</requirement>
    </requirements>
    <required_files>
        <include type="literal" path="paired_fastq_filtering_wrapper.sh"/>
        <include type="literal" path="paired_fastq_filtering.R"/>
        <include type="literal" path="fasta_interlacer.py"/>
    </required_files>
    <command>
        cutadapt --version;
        bash '$__tool_directory__'/paired_fastq_filtering_wrapper.sh -a ${A} -b ${B} -o
        ${paired} -c ${cut_off} -p ${percent_above} -N ${max_n} $rename -G ${png_output}

        #if $sampling.sequence_sampling :
        -n $sampling.sample_size
        #end if

        #if $trimming.sequence_trimming :
        -e $trimming.trim_end -s $trimming.trim_start
        #end if

        #if $cutadapt.use_custom :
        -C "${cutadapt.custom_options}"
        #end if

        #if $similarity_filtering.include :
        -F "${similarity_filtering.filter_database}"
        #end if

    </command>

    <inputs>
        <param format="fastq,fastq.gz" type="data" name="A" label="Left-hand reads"/>

        <param format="fastq,fastq.gz" type="data" name="B" label="Right-hand reads"/>

        <conditional name="sampling">
            <param name="sequence_sampling" type="boolean" truevalue="true"
                   falsevalue="false" checked="False" label="Read sampling"/>
            <when value="false">
                <!-- do nothing here -->
            </when>
            <when value="true">
                <param name="sample_size" type="integer"
                       label="Sample size (number of pairs)"
                       help="How many read pairs should be sampled" value="500000"
                       min="0"/>
            </when>
        </conditional>

        <param type="integer" name="cut_off" label="Quality cutoff" value="10" min="0"
               help="See below how to correctly set the quality cutoff"/>
        <param type="integer" name="percent_above" label="Percent above cutoff" value="95"
               min="0"
               help="Percentage of bases in the read that must have quality equal to or higher than the cutoff value"/>

        <conditional name="trimming">
            <param name="sequence_trimming" type="boolean" truevalue="true"
                   falsevalue="false" checked="False" label="Trim reads"/>
            <when value="false">
                <!-- do nothing here -->
            </when>
            <when value="true">
                <param type="integer" name="trim_start" label="Start position" value="1"
                       min="1"
                       help="Reads are trimmed at the specified start"/>
                <param type="integer" name="trim_end" label="End position" value="100"
                       min="1"
                       help="Reads are trimmed to the specified end position, shorted sequences are discarded"/>
            </when>

        </conditional>
        <param name="max_n" type="integer" label="Maximum Ns"
               help="Maximal number of Ns allowed in reads" value="0" min="0" max="10"/>

        <conditional name="cutadapt">
            <param name="use_custom" type="boolean" truevalue="true" falsevalue="false"
                   checked="False" label="Custom cutadapt options"/>
            <when value="false">
                <!-- do nothing here -->
            </when>
            <when value="true">
                <param name="custom_options" type="text" area="True" size="8x30"
                       label="Custom options" help="Consult cutadapt for usage" value="">
                    <sanitizer sanitize="False"/>
                </param>
                >
            </when>
        </conditional>

        <conditional name="similarity_filtering">
            <param name="include" type="boolean" truevalue="true" falsevalue="false"
                   checked="False" label="Use similarity search filtering"/>
            <when value="false">
                <!-- do nothing here -->
            </when>
            <when value="true">

                <param name="filter_database" format="fasta" type="data"
                       label="Sequence filter database"
                       help="Provide DNA sequences in FASTA format. Reads that have at least 90% similarity over 90% of their length to sequence in the filter database will be removed. This option is suitable for removing organellar or other contaminating sequences."/>
            </when>
        </conditional>

        <param name="rename" type="boolean" truevalue="-R" falsevalue="" checked="True"
               label="Rename reads"
               help="By default, original read names are used. In case your reads do not follow proper naming scheme to label paired-end mates, use this option. All read pairs must be complete!"/>
    </inputs>


    <outputs>
        <data format="fasta" name="paired"
              label="Interlaced paired reads from datasets ${A.hid} and ${B.hid} "/>
        <data format="png" name="png_output"
              label="Nucleotide composition after filtering of ${A.hid} and ${B.hid} "/>"
    </outputs>


    <tests>
        <test>
            <param name="A" value="ERR215189_1_part.fastq.gz"/>
            <param name="B" value="ERR215189_2_part.fastq.gz"/>
            <param name="max_n" value="0"/>
            <param name="cut_off" value="10"/>
            <param name="percent_above" value="95"/>
            <output name="output" value="paired_output.fasta"/>
            <output name="png_output" value="paired_output.png"/>
        </test>
    </tests>

    <help>
        **What it does**

        This tool is designed to make memory efficient preprocessing of two
        fastq files. Output of this file can be used as input of RepeatExplorer
        clustering.
        Input files can be in GNU zipped archive (.gz extension).
        Reads are filtered based on the quality, presence of N bases and
        adapters. Two input fastq files are procesed in parallel. Only complete pair
        are kept. As the input files are process in chunks, it is required that
        pair reads are complete and in the same order in both input files. All
        reads which pass the quality filter fill be writen into output files.
        If sampling is specified, only sample of sequences will be
        returned. Cutadapt us run with this options::

        --anywhere='AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT'
        --anywhere='AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT'
        --anywhere='GATCGGAAGAGCACACGTCTGAACTCCAGTCAC'
        --anywhere='ATCTCGTATGCCGTCTTCTGCTTG'
        --anywhere='CAAGCAGAAGACGGCATACGAGAT'
        --anywhere='GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC'
        --error-rate=0.05
        --times=1 --overlap=15 --discard


        **Order of fastq files processing**

        1. Trimming (optional)
        #. Filter by quality
        #. Discard single reads, keep complete pairs
        #. Cutadapt filtering
        #. Discard single reads, keep complete pairs
        #. Sampling (optional)
        #. Interlacing two fasta files

        **Quality setting cutoff**

        To correctly set quality cutoff, you need to know how the quality is encoded in
        your fastq file, default
        filtering which is suitable for Sanger and Illumina 1.8 encoding is shown below::


        Default filtering cutoff
        |
        |
        V
        SSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS.....................................................
        ..........................XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX......................
        ...............................IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII......................
        .................................JJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJ......................
        LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLL....................................................
        !"#$%&amp;'()*+,-./0123456789:;&lt;=&gt;?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~
        | | | | | |
        33 59 64 73 104 126
        0........................26...31.......40
        -5....0........9.............................40
        0........9.............................40
        3.....9.............................40
        0.2......................26...31........41

        S - Sanger Phred+33, raw reads typically (0, 40)
        X - Solexa Solexa+64, raw reads typically (-5, 40)
        I - Illumina 1.3+ Phred+64, raw reads typically (0, 40)
        J - Illumina 1.5+ Phred+64, raw reads typically (3, 40)
        with 0=unused, 1=unused, 2=Read Segment Quality Control Indicator (bold)
        (Note: See discussion above).
        L - Illumina 1.8+ Phred+33, raw reads typically (0, 41)

    </help>
</tool>