Mercurial > repos > yating-l > multi_fasta_glimmer_hmm
view glimmerhmm.xml @ 1:6618d16f276c draft
planemo upload for repository https://github.com/remimarenco/multi_fasta_glimmerhmm.git commit 5594d470c65c83b5b620681db44b1975bd218581-dirty
author | yating-l |
---|---|
date | Mon, 01 May 2017 17:44:12 -0400 |
parents | b07a805758cc |
children |
line wrap: on
line source
<tool id="multi_fasta_glimmerhmm" name="Multi Fasta GlimmerHMM" version="4.0"> <description>Predict ORFs in eukaryotic genomes for Multi Fasta file</description> <requirements> <requirement type="package" version="3.0.4">glimmerhmm</requirement> </requirements> <command detect_errors="aggressive"><![CDATA[ python $__tool_directory__/multi_glimmer.py --multi_fasta $input --trained_dir $trained_specie.fields.path --output $output ]]></command> <inputs> <param name="input" type="data" format="fasta" label="Genome Sequence"/> <param name="trained_specie" type="select" label="Select a specie"> <options from_data_table="glimmer_hmm_trained_dir"> <filter type="sort_by" column="2"/> <validator type="no_options" message="No indexes are available"/> </options> </param> </inputs> <outputs> <data format="gff3" name="output" /> </outputs> <help> **What it does** GlimmerHMM is a new gene finder based on a Generalized Hidden Markov Model (GHMM). Although the gene finder conforms to the overall mathematical framework of a GHMM, additionally it incorporates splice site models adapted from the GeneSplicer program and a decision tree adapted from GlimmerM. It also utilizes Interpolated Markov Models for the coding and noncoding models . Currently, GlimmerHMM's GHMM structure includes introns of each phase, intergenic regions, and four types of exons (initial, internal, final, and single). A basic user manual can be consulted here. **Example** Suppose you have the following DNA formatted sequences:: >SQ Sequence 8667507 BP; 1203558 A; 3121252 C; 3129638 G; 1213059 T; 0 other; cccgcggagcgggtaccacatcgctgcgcgatgtgcgagcgaacacccgggctgcgcccg ggtgttgcgctcccgctccgcgggagcgctggcgggacgctgcgcgtcccgctcaccaag cccgcttcgcgggcttggtgacgctccgtccgctgcgcttccggagttgcggggcttcgc cccgctaaccctgggcctcgcttcgctccgccttgggcctgcggcgggtccgctgcgctc ccccgcctcaagggcccttccggctgcgcctccaggacccaaccgcttgcgcgggcctgg Running this tool will produce this:: ##gff-version 3 ##sequence-region ConsensusfromCH236920mapping 1 4148552 ConsensusfromCH236920mapping GlimmerHMM mRNA 1 122 . + . ID=ConsensusfromCH236920mapping.path1.gene1;Name=ConsensusfromCH236920mapping.path1.gene1 ConsensusfromCH236920mapping GlimmerHMM CDS 1 122 . + 0 ID=ConsensusfromCH236920mapping.cds1.1; ConsensusfromCH236920mapping GlimmerHMM mRNA 14066 15205 . - . ID=ConsensusfromCH236920mapping.path1.gene2;Name=ConsensusfromCH236920mapping.path1.gene2 ConsensusfromCH236920mapping GlimmerHMM CDS 14066 15034 . - 0 ID=ConsensusfromCH236920mapping.cds2.1; ConsensusfromCH236920mapping GlimmerHMM CDS 15137 15205 . - 0 ID=ConsensusfromCH236920mapping.cds2.2; ConsensusfromCH236920mapping GlimmerHMM mRNA 19910 24210 . - . ID=ConsensusfromCH236920mapping.path1.gene3;Name=ConsensusfromCH236920mapping.path1.gene3 </help> </tool>