Mercurial > repos > bgruening > agat
changeset 0:f7c0a0030254 draft
planemo upload for repository https://github.com/bgruening/galaxytools/tree/master/tools/agat commit 0851e9e6d46223a8233c56f3b0bcf14e19d63916
line wrap: on
line diff
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/agat.xml Tue May 23 13:43:07 2023 +0000 @@ -0,0 +1,374 @@ +<tool id="agat" name="AGAT" version="@TOOL_VERSION@+galaxy@VERSION_SUFFIX@"> + <description>GTF/GFF analysis toolkit</description> + <macros> + <import>macros.xml</import> + </macros> + <expand macro="biotools"/> + <expand macro="requirements" /> + <version_command>agat_sq_stat_basic.pl --version</version_command> + <command detect_errors="exit_code"><![CDATA[ + #if $tool.selector == 'fix' + @input_annotation_single@ + agat_convert_sp_gxf2gxf.pl -gff $input_annotation --output 'output.gff' && + cat 'output.gff' > '${annotation_gff}' + #else if $tool.selector == 'convert_GFF2GTF' + @input_annotation_single@ + agat_convert_sp_gff2gtf.pl --gff $input_annotation --gtf_version $tool.gtf_version --output 'output.gtf' && + cat 'output.gtf' > '${annotation_gtf}' + #else if $tool.selector == 'convert_GTF2GFF' + @input_annotation_single@ + agat_convert_sp_gxf2gxf.pl --gff $input_annotation --output 'output.gff' && + cat 'output.gff' > '${annotation_gff}' + #else if $tool.selector == 'compare' + @input_annotation_double@ + agat_sp_compare_two_annotations.pl --gff1 $input1 --gff2 $input2 --output 'temp_output' && + cat 'temp_output' > '${stats_output}' + #else if $tool.selector == 'extract' + @input_annotation_single@ + @input_reference@ + agat_sp_extract_sequences.pl + --gff $input_annotation + -f $ref_genome + $tool.mrna + $tool.cdna + $tool.clean_final_stop + $tool.clean_internal_stop + #if $tool.downstream + --downstream $tool.downstream + #end if + $tool.full + $tool.keep_attributes + $tool.keep_parent_attributes + $tool.merge + $tool.plus_strand_only + $tool.protein + $tool.remove_orf_offset + $tool.revcomp + $tool.split + #if $tool.type + --type $tool.type + #end if + #if $tool.upstream + --upstream $tool.upstream + #end if + --output '${sequence_output}' + #else if $tool.selector == 'functional_analysis' + @input_annotation_single@ + @input_reference@ + mkdir -p './statistics' && + agat_sp_statistics.pl + --gff $input_annotation + --gs $ref_genome + --output 'temp_output' && + cat 'temp_output' > '$stats_output' + #else if $tool.selector == 'merge_annotations' + @input_annotation_double@ + agat_sp_merge_annotations.pl -gff $input1 --gff $input2 --output 'temp_output' && + cat 'temp_output' > '${annotation_gff}' + #else if $tool.selector == 'annotation_statistics' + @input_annotation_single@ + @input_reference@ + agat_sp_statistics.pl --gff $input_annotation --gs $ref_genome -d --output 'temp_output' && + cat 'temp_output' > '$stats_output' + #else if $tool.selector == 'filter_feature_fasta' + @input_annotation_single@ + @input_reference@ + agat_sq_filter_feature_from_fasta.pl --gff $input_annotation --fasta $ref_genome --output 'temp_output' && + cat 'temp_output' > '${features_filtered}' + #else if $tool.selector == 'complement' + @input_annotation_double@ + agat_sp_complement_annotations.pl --ref $input1 --add $input2 --size_min $tool.size_min --output 'temp_output' && + cat 'temp_output' > '${annotation_gff}' + #end if + ]]> + </command> + <inputs> + <conditional name="tool"> + <param name="selector" type="select" label="AGAT tool selector" help="As AGAT is a toolkit, it contains a lot of tools. If any of them is missing, please contact the server admin."> + <option value="annotation_statistics">Annotation statistics (agat_sp_statistics.pl)</option> + <option value="compare">Compare annotation files (agat_sp_compare_two_annotations.pl)</option> + <option value="complement">Complement annotation file (agat_sp_complement_annotations.pl)</option> + <option value="extract">Extract sequences (agat_sp_extract_sequences.pl)</option> + <option value="convert_GFF2GTF">GFF to GTF format conversion (agat_convert_sp_gff2gtf.pl)</option> + <option value="convert_GTF2GFF">GTF to GFF3 format conversion (agat_convert_sp_gxf2gxf.pl)</option> + <option value="filter_feature_fasta">Filter annotation by sequence name (agat_sq_filter_feature_from_fasta.pl)</option> + <option value="fix">Fix and/or standarize GFF3 annotation file (agat_convert_sp_gxf2gxf.pl)</option> + <option value="functional_analysis">Functional analysis (agat_sp_functional_statistics.pl)</option> + <option value="merge_annotations">Merge annotations (agat_sp_merge_annotations.pl)</option> + </param> + <when value="annotation_statistics"> + <expand macro="ANNOTATION_INPUT"/> + <expand macro="REFERENCE_FASTA"/> + </when> + <when value="compare"> + <param argument="--gff1" name="input_annotation1" type="data" format="gff,gtf,gff3,gff3.gz" label="Annotation file 1" help="Input GTF/GFF file" /> + <param argument="--gff2" name="input_annotation2" type="data" format="gff,gtf,gff3,gff3.gz" label="Annotation file 2" help="Input GTF/GFF file" /> + </when> + <when value="extract"> + <expand macro="ANNOTATION_INPUT"/> + <expand macro="REFERENCE_FASTA"/> + <param name="type" type="select" label="Type of feature to extract" optional="true" help="Define the feature you want to extract the sequence from."> + <option value="gene">Gene</option> + <option value="transcript">Transcript</option> + <option value="exon">Exon</option> + <option value="cds">CDS</option> + <option value="trna">tRNA</option> + <option value="three_prime_utr">3' UTR</option> + <option value="five_prime_utr">5' UTR</option> + </param> + <param argument="--mrna" type="boolean" truevalue="--mrna" falsevalue="" checked="false" label="Extract mRNA sequences" help=" This extract the mrna + sequence (i.e transcribed sequence (devoid of introns, but containing untranslated exons))." /> + <param argument="--cdna" type="boolean" truevalue="--cdna" falsevalue="" checked="false" label="Extract the cDNA sequence" + help=" This extract the cdna sequence (i.e reverse complement of the mRNA: transcribed sequence (devoid of introns, but + containing untranslated exons, then reverse complemented)." /> + <param argument="--clean_final_stop" type="boolean" truevalue="--clean_final_stop" falsevalue="" checked="false" label="Clean final stop codons" + help=" This option allows removing the translation of the final stop codons that is represented by the '*' character. This character can be + disturbing for many programs (e.g interproscan)" /> + <param argument="--clean_internal_stop" type="boolean" truevalue="--clean_internal_stop" falsevalue="" checked="false" label="Clean internal + stop codons" help="The Clean Internal Stop option allows replacing the translation of the stop codons present among the sequence that is + represented by the '*' character by . This character can be disturbing for many programs (e.g interproscan)" /> + <param argument="--upstream" type="integer" min="0" value="" optional="true" label="Upstream nucleotides" help="It will take that number of nucleotide in more at the 5' extremity." /> + <param argument="--downstream" type="integer" min="0" value="" optional="true" label="Downstream nucleotides" help="It will take that number of downstream nucleotides." /> + <param argument="--full" type="boolean" truevalue="--full" falsevalue="" checked="false" label="Full" help="This option allows dealing + with feature that may span over several locations like CDS or exon, in order to extract the full sequence from the start extremity + of the first chunck to the end extremity of the last chunk. The use of that option with '--type exon' will extract the pre-mRNA + sequence (i.e with introns). Use of that option on CDS will give the pre-mRNA without the untraslated regions (UTRs). " /> + <param argument="--keep_attributes" type="boolean" truevalue="--keep_attributes" falsevalue="" checked="false" label="Keep attributes" + help="The value of the attribute tags will be extracted from the feature type specified by the option --type and stored in the FASTA header." /> + <param argument="--keep_parent_attributes" type="boolean" truevalue="--keep_parent_attributes" falsevalue="" checked="false" label="Keep parental attributes" + help="Keep parental attributes" /> + <param argument="--merge" type="boolean" truevalue="--merge" falsevalue="" checked="false" label="Merge" help="By default, only features that span + several locations (e.g. CDS and utr can span over several exons) are merged together. In order to merge other type of features (e.g. exon) you + must activate this parameter." /> + <param argument="--plus_strand_only" type="boolean" truevalue="--plus_strand_only" falsevalue="" checked="false" label="Plus strand only" help="By default + the extrated feature sequences from a minus strand is reverse complemented. Activating this option you will always get sequence from plus strand (not reverse complemented). " /> + <param argument="--protein" type="boolean" truevalue="--protein" falsevalue="" checked="false" label="Protein" help="It will extract the sequence in amino acids." /> + <param argument="--remove_orf_offset" type="boolean" truevalue="--remove_orf_offset" falsevalue="" checked="false" label="Remove ORF offset" help=" CDS can start with a phase different + from 0 when a gene model is fragmented. When asking for protein translation this (start) offset is trimmed out automatically. But when you extract CDS dna sequences, this (start) + offset is not removed by default. To remove it activate this option. If --upstream or --downstream option are used too, the (start) offset is trimmed first, then is added the piece + of sequence asked for." /> + <param argument="--revcomp" type="boolean" truevalue="--revcomp" falsevalue="" checked="false" label="Reverse complement the extracted sequence" help="By default the extrated feature + sequences from a minus strand is reverse complemented. Consequently, for minus strand features that option will extract the sequences from plus strand from left to right." /> + <param argument="--split" type="boolean" truevalue="--split" falsevalue="" checked="false" label="Split" help="By default, all features that span several locations (e.g. CDs and UTR can + span over several exons) are merge together to shape the biological feature (e.g. several CDS chuncks are merged to create the CDS in its whole). If you wish to extract all the chuncks + independently activate this option." /> + </when> + <when value="convert_GFF2GTF"> + <expand macro="ANNOTATION_INPUT" format="gff,gff3,gff3.gz"/> + <param argument="--gtf_version" type="select" label="GTF version"> + <option value="3">GTF v3 - 9 feature types accepted: gene, transcript, exon, CDS, Selenocysteine, start_codon, stop_codon, three_prime_utr and five_prime_utr</option> + <option value="2.5">GTF v2.5 - 8 feature types accepted: gene, transcript, exon, CDS, UTR, start_codon, stop_codon and Selenocysteine</option> + <option value="2.2">GTF v2.2 - 9 feature types accepted: CDS, start_codon, stop_codon, 5UTR, 3UTR, inter, inter_CNS, intron_CNS and exon</option> + <option value="2.1">GTF v2.1 - 6 feature types accepted: CDS, start_codon, stop_codon, exon, 5UTR and 3UTR</option> + <option value="2">GTF v2 - 4 feature types accepted: CDS, start_codon, stop_codon and exon</option> + <option value="1">GTF v1 - 5 feature types accepted: CDS, start_codon, stop_codon, exon and intron</option> + <option value="relax">Relax: all feature types are accepted.</option> + </param> + </when> + <when value="convert_GTF2GFF"> + <expand macro="ANNOTATION_INPUT" format="gtf"/> + </when> + <when value="filter_feature_fasta"> + <expand macro="ANNOTATION_INPUT" /> + <expand macro="REFERENCE_FASTA"/> + </when> + <when value="fix"> + <expand macro="ANNOTATION_INPUT" format="gff,gff3,gff3.gz"/> + </when> + <when value="functional_analysis"> + <expand macro="ANNOTATION_INPUT" format="gff,gtf,gff3,gff3.gz"/> + <expand macro="REFERENCE_FASTA"/> + </when> + <when value="merge_annotations"> + <param argument="--gff1" name="input_annotation1" type="data" format="gff,gtf,gff3,gff3.gz" label="Annotation file 1" help="Input GTF/GFF file" /> + <param argument="--gff2" name="input_annotation2" type="data" format="gff,gtf,gff3,gff3.gz" label="Annotation file 2" help="Input GTF/GFF file" /> + </when> + <when value="complement"> + <param argument="--ref" name="input_annotation1" type="data" format="gff,gtf,gff3,gff3.gz" label="Reference annotaiton" help="Reference GTF/GFF file" /> + <param argument="--add" name="input_annotation2" type="data" format="gff,gtf,gff3,gff3.gz" label="Annotation to complement" help="Annotation file you would like to use to complement the reference annotation." /> + <param argument="--size_min" type="integer" min="0" value="0" label="Minimun CDS size" help="Option to keep the non-overlping gene only if the CDS size (in nucleotide) is over the minimum + size defined. Default = 0 that means all of them are kept." /> + </when> + </conditional> + </inputs> + <outputs> + <data name="annotation_gff" format="gff" label="${tool.name} on ${on_string}: annotation file (GFF)"> + <filter>tool['selector'] not in ['annotation_statistics','extract','functional_analysis','compare','convert_GFF2GTF','filter_feature_fasta']</filter> + </data> + <data name="annotation_gtf" format="gtf" label="${tool.name} on ${on_string}: annotation file (GTF)"> + <filter>tool['selector'] == 'convert_GFF2GTF'</filter> + </data> + <data name="features_filtered" format="tabular" label="${tool.name} on ${on_string}: filtered results"> + <filter>tool['selector'] == 'filter_feature_fasta'</filter> + </data> + <data name="sequence_output" format="fasta" label="${tool.name} on ${on_string}: FASTA file"> + <filter>tool['selector'] =='extract'</filter> + </data> + <data name="stats_output" format="txt" label="${tool.name} on ${on_string}: stats file"> + <filter>tool['selector'] in ['annotation_statistics','compare','functional_analysis']</filter> + </data> + <collection name="distribution_plots_wiso" type="list" label="${tool.name} on ${on_string}: distribution plots (with isoforms)"> + <discover_datasets pattern="__designation_and_ext__" directory="temp_output_distribution_plots/with_isoforms" format="pdf"/> + <filter>tool['selector'] == 'annotation_statistics'</filter> + </collection> + <collection name="distribution_plots_woiso" type="list" label="${tool.name} on ${on_string}: distribution plots (without isoforms)"> + <discover_datasets pattern="__designation_and_ext__" directory="temp_output_distribution_plots/without_isoforms" format="pdf"/> + <filter>tool['selector'] == 'annotation_statistics'</filter> + </collection> + </outputs> +<tests> + <!-- Test 01: annotation statistics--> + <test expect_num_outputs="3"> + <conditional name="tool"> + <param name="selector" value="annotation_statistics"/> + <param name="gff" value="annotation.gtf" ftype="gtf"/> + <conditional name="reference_genome"> + <param name="source" value="history"/> + <param name="history_item" value="genome.fasta.gz"/> + </conditional> + </conditional> + <output name="stats_output" file="test01_stats.txt" ftype="txt"/> + <output_collection name="distribution_plots_woiso" type="list" count="4"> + <element name="transcriptClass_cds" file="test01_plot2.pdf" ftype="pdf" compare="sim_size" delta="100"/> + </output_collection> + <output_collection name="distribution_plots_wiso" type="list" count="4"> + <element name="transcriptClass_cds" file="test01_plot1.pdf" ftype="pdf" compare="sim_size" delta="100"/> + </output_collection> + </test> + <!-- Test 02: extract sequences --> + <test expect_num_outputs="1"> + <conditional name="tool"> + <param name="selector" value="extract"/> + <param name="gff" value="annotation_small.gtf"/> + <conditional name="reference_genome"> + <param name="source" value="history"/> + <param name="history_item" value="genome.fasta.gz"/> + </conditional> + <param name="type" value="gene"/> + <param name="upstream" value="10"/> + <param name="downstream" value="20"/> + </conditional> + <output name="sequence_output" file="test02.fasta" ftype="fasta"/> + </test> + <!-- Test 03: compare annotations --> + <test expect_num_outputs="1"> + <conditional name="tool"> + <param name="selector" value="compare"/> + <param name="input_annotation1" value="annotation.gtf"/> + <param name="input_annotation2" value="annotation_small.gtf"/> + </conditional> + <output name="stats_output" file="test03.txt" ftype="txt" lines_diff="2"/> + </test> + <!-- Test 04: comlement annotation --> + <test expect_num_outputs="1"> + <conditional name="tool"> + <param name="selector" value="complement"/> + <param name="input_annotation1" value="annotation_small.gtf" ftype="gtf"/> + <param name="input_annotation2" value="annotation_unique.gtf" ftype="gtf"/> + <param name="size_min" value="10"/> + </conditional> + <output name="annotation_gff" file="test04.gff" ftype="gff"/> + </test> + <!-- Test 05: Convert GFF2GTF --> + <test expect_num_outputs="1"> + <conditional name="tool"> + <param name="selector" value="convert_GFF2GTF"/> + <param name="gff" value="test04.gff" ftype="gff"/> + <param name="gtf_version" value="2"/> + </conditional> + <output name="annotation_gtf" file="test05.gtf" ftype="gtf"/> + </test> + <!-- Test 06: Convert GTF2GFF --> + <test expect_num_outputs="1"> + <conditional name="tool"> + <param name="selector" value="convert_GTF2GFF"/> + <param name="gff" value="annotation_small.gtf" ftype="gtf"/> + </conditional> + <output name="annotation_gff" file="test06.gff" ftype="gff"/> + </test> + <!-- Test 07: Filter feature FASTA --> + <test expect_num_outputs="1"> + <conditional name="tool"> + <param name="selector" value="filter_feature_fasta"/> + <param name="gff" value="annotation_small.gtf" ftype="gtf"/> + <conditional name="reference_genome"> + <param name="source" value="history"/> + <param name="history_item" value="genome.fasta.gz"/> + </conditional> + </conditional> + <output name="features_filtered" file="test07.tabular" ftype="tabular"/> + </test> + <!-- Test 08: Fix annotation file --> + <test expect_num_outputs="1"> + <conditional name="tool"> + <param name="selector" value="fix"/> + <param name="gff" value="annotation_broken.gff" ftype="gff"/> + </conditional> + <output name="annotation_gff" file="annotation_fixed.gff" ftype="gff"/> + <assert_stdout> + <has_text text="2 exons created that were missing" /> + </assert_stdout> + </test> + <!-- Test 09: Functional analysis --> + <test expect_num_outputs="1"> + <conditional name="tool"> + <param name="selector" value="functional_analysis"/> + <param name="gff" value="annotation_small.gtf"/> + <conditional name="reference_genome"> + <param name="source" value="history"/> + <param name="history_item" value="genome.fasta.gz"/> + </conditional> + </conditional> + <output name="stats_output" file="test09.txt" ftype="txt"/> + </test> + <!-- Test 10: Merge annotations --> + <test expect_num_outputs="1"> + <conditional name="tool"> + <param name="selector" value="merge_annotations"/> + <param name="input_annotation1" value="annotation_small.gtf"/> + <param name="input_annotation2" value="annotation_unique.gtf"/> + </conditional> + <output name="annotation_gff" file="test10.gff" ftype="gff"/> + </test> + <!-- Test 11: Test compressed files --> + <test expect_num_outputs="1"> + <conditional name="tool"> + <param name="selector" value="fix"/> + <param name="gff" value="annotation_broken.gff.gz" ftype="gff"/> + </conditional> + <output name="annotation_gff" file="annotation_fixed.gff" ftype="gff"/> + <assert_stdout> + <has_text text="2 exons created that were missing" /> + </assert_stdout> + </test> + <!-- Test 12:test indexed references --> + <test expect_num_outputs="1"> + <conditional name="tool"> + <param name="selector" value="extract"/> + <param name="gff" value="phix174.gff"/> + <conditional name="reference_genome"> + <param name="source" value="indexed"/> + <param name="index" value="phix174"/> + </conditional> + <param name="type" value="gene"/> + </conditional> + <assert_stdout> + <has_text text="Job done" /> + </assert_stdout> + </test> + </tests> + <help><![CDATA[ + +.. class:: infomark + +**Purpose** + +AGAT a GFF/GTF toolkit allowing you to perform almost everything you might want to achieve ^^ + +AGAT has the power to check, fix, pad missing information (features/attributes) of any kind of GTF and GFF to create complete, sorted and standardised gff3 format. +Over the years it has been enriched by many many tools to perform just about any tasks that is possible related to GTF/GFF format files (sanitizing, conversions, +merging, modifying, filtering, FASTA sequence extraction, adding information, etc). Comparing to other methods AGAT is robust to even the most despicable GTF/GFF files. + +]]></help> + <expand macro="citations"/> +</tool>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/macros.xml Tue May 23 13:43:07 2023 +0000 @@ -0,0 +1,63 @@ +<macros> + <token name="@TOOL_VERSION@">1.1.0</token> + <token name="@VERSION_SUFFIX@">0</token> + <xml name="requirements"> + <requirements> + <requirement type="package" version="@TOOL_VERSION@">agat</requirement> + <requirement type="package" version="0.34">perl-statistics-r</requirement> + </requirements> + </xml> + <xml name="biotools"> + <xrefs> + <xref type="bio.tools">agat</xref> + </xrefs> + </xml> + <xml name="citations"> + <citations> + <citation type="doi">10.5281/zenodo.3552717</citation> + </citations> + </xml> + <xml name="ANNOTATION_INPUT" token_format="gff,gtf,gff3,gff3.gz"> + <param argument="--gff" type="data" format="@FORMAT@" label="Annotation file" help="Input GTF/GFF file" /> + </xml> + + <xml name="REFERENCE_FASTA"> + <conditional name="reference_genome"> + <param name="source" type="select" label="Source for the reference genome" help="Built-in references were created using default options."> + <option value="indexed" selected="true">Use a built-in genome</option> + <option value="history" selected="true">Use a genome from history</option> + </param> + <when value="indexed"> + <param name="index" type="select" label="Select a reference genome" help="If your genome of interest is not listed, contact the Galaxy team."> + <options from_data_table="fasta_indexes"> + <filter type="sort_by" column="2" /> + <validator type="no_options" message="No genomes are available for the selected input dataset" /> + </options> + </param> + </when> + <when value="history"> + <param name="history_item" type="data" format="fasta" label="Reference genome" help="A reference genome in FASTA format" /> + </when> + </conditional> + </xml> + <token name="@input_annotation_single@"><![CDATA[ + #set $input_annotation = 'annotation.' + str($tool.gff.ext) + ln -s '${tool.gff}' $input_annotation && + ]]></token> + <token name="@input_reference@"><![CDATA[ + #if $tool.reference_genome.source == 'history': + #set $ref_genome = 'reference.fasta' + ln -s -f '${tool.reference_genome.history_item}' $ref_genome && + #else: + #set $ref_genome = $tool.reference_genome.index.fields.path + #end if + ]]></token> + <token name="@input_annotation_double@"><![CDATA[ + #set $input1 = 'annotation1.' + str($tool.input_annotation1.ext) + #set $input2 = 'annotation2.' + str($tool.input_annotation2.ext) + ln -s '${tool.input_annotation1}' $input1 && + ln -s '${tool.input_annotation2}' $input2 && + ]]></token> + + +</macros>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/annotation.gtf Tue May 23 13:43:07 2023 +0000 @@ -0,0 +1,1522 @@ +##gtf-version 3 +#!gff-spec-version 1.21 +#!processor NCBI annotwriter +#!genome-build ASM301845v1 +#!genome-build-accession NCBI_Assembly:GCF_003018455.1 +#!annotation-date 05/25/2022 04:54:31 +#!annotation-source NCBI RefSeq +##sequence-region NZ_CP027599.1 1 5942969 +##species https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=562 +NZ_CP027601.1 RefSeq gene 1 542 . - . gene_id "nbis-pseudogene-254"; ID "nbis-pseudogene-254"; Name "C7A06_RS33350"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33350"; original_biotype "pseudogene"; partial "true"; pseudo "true"; start_range "." "1"; +NZ_CP027601.1 RefSeq transcript 1 542 . - . gene_id "nbis-pseudogene-254"; transcript_id "gene-C7A06_RS33350"; ID "gene-C7A06_RS33350"; Name "C7A06_RS33350"; Parent "nbis-pseudogene-254"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33350"; original_biotype "mrna"; partial "true"; pseudo "true"; start_range "." "1"; +NZ_CP027601.1 Protein Homology exon 1 542 . - . gene_id "nbis-pseudogene-254"; transcript_id "gene-C7A06_RS33350"; ID "nbis-exon-5902"; Note "frameshifted; incomplete; missing C-terminus"; Parent "gene-C7A06_RS33350"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001066419.1"; locus_tag "C7A06_RS33350"; partial "true"; product "IS66 family transposase zinc-finger binding domain-containing protein"; pseudo "true"; start_range "." "1"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 1 542 . - 0 gene_id "nbis-pseudogene-254"; transcript_id "gene-C7A06_RS33350"; ID "cds-C7A06_RS33350"; Note "frameshifted; incomplete; missing C-terminus"; Parent "gene-C7A06_RS33350"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001066419.1"; locus_tag "C7A06_RS33350"; partial "true"; product "IS66 family transposase zinc-finger binding domain-containing protein"; pseudo "true"; start_range "." "1"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 562 909 . - . gene_id "nbis-gene-5648"; ID "nbis-gene-5648"; Name "tnpB"; gbkey "Gene"; gene "tnpB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33355"; +NZ_CP027601.1 RefSeq transcript 562 909 . - . gene_id "nbis-gene-5648"; transcript_id "gene-C7A06_RS33355"; ID "gene-C7A06_RS33355"; Name "tnpB"; Parent "nbis-gene-5648"; gbkey "Gene"; gene "tnpB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33355"; original_biotype "mrna"; +NZ_CP027601.1 Protein Homology exon 562 909 . - . gene_id "nbis-gene-5648"; transcript_id "gene-C7A06_RS33355"; Dbxref "Genbank:WP_000631725.1"; ID "nbis-exon-5903"; Name "WP_000631725.1"; Note "TnpB, as the term is used for proteins encoded by IS66 family insertion elements, is considered an accessory protein, since TnpC, encoded by a neighboring gene, is a DDE family transposase."; Parent "gene-C7A06_RS33355"; gbkey "CDS"; gene "tnpB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_858152.1"; locus_tag "C7A06_RS33355"; product "IS66 family insertion sequence element accessory protein TnpB"; protein_id "WP_000631725.1"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 562 909 . - 0 gene_id "nbis-gene-5648"; transcript_id "gene-C7A06_RS33355"; Dbxref "Genbank:WP_000631725.1"; ID "cds-WP_000631725.1"; Name "WP_000631725.1"; Note "TnpB, as the term is used for proteins encoded by IS66 family insertion elements, is considered an accessory protein, since TnpC, encoded by a neighboring gene, is a DDE family transposase."; Parent "gene-C7A06_RS33355"; gbkey "CDS"; gene "tnpB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_858152.1"; locus_tag "C7A06_RS33355"; product "IS66 family insertion sequence element accessory protein TnpB"; protein_id "WP_000631725.1"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 906 1580 . - . gene_id "nbis-gene-5649"; ID "nbis-gene-5649"; Name "tnpA"; gbkey "Gene"; gene "tnpA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33360"; +NZ_CP027601.1 RefSeq transcript 906 1580 . - . gene_id "nbis-gene-5649"; transcript_id "gene-C7A06_RS33360"; ID "gene-C7A06_RS33360"; Name "tnpA"; Parent "nbis-gene-5649"; gbkey "Gene"; gene "tnpA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33360"; original_biotype "mrna"; +NZ_CP027601.1 Protein Homology exon 906 1580 . - . gene_id "nbis-gene-5649"; transcript_id "gene-C7A06_RS33360"; Dbxref "Genbank:WP_001341423.1"; ID "nbis-exon-5904"; Name "WP_001341423.1"; Ontology_term "GO:0006313" "GO:0003677" "GO:0004803"; Parent "gene-C7A06_RS33360"; gbkey "CDS"; gene "tnpA"; go_function "DNA binding|0003677||IEA" "transposase activity|0004803||IEA"; go_process "transposition, DNA-mediated|0006313||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_311873.1"; locus_tag "C7A06_RS33360"; product "IS66-like element accessory protein TnpA"; protein_id "WP_001341423.1"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 906 1580 . - 0 gene_id "nbis-gene-5649"; transcript_id "gene-C7A06_RS33360"; Dbxref "Genbank:WP_001341423.1"; ID "cds-WP_001341423.1"; Name "WP_001341423.1"; Ontology_term "GO:0006313" "GO:0003677" "GO:0004803"; Parent "gene-C7A06_RS33360"; gbkey "CDS"; gene "tnpA"; go_function "DNA binding|0003677||IEA" "transposase activity|0004803||IEA"; go_process "transposition, DNA-mediated|0006313||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_311873.1"; locus_tag "C7A06_RS33360"; product "IS66-like element accessory protein TnpA"; protein_id "WP_001341423.1"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 1664 1930 . + . gene_id "nbis-pseudogene-366"; ID "nbis-pseudogene-366"; Name "C7A06_RS35230"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS35230"; original_biotype "pseudogene"; partial "true"; pseudo "true"; start_range "." "1664"; +NZ_CP027601.1 RefSeq transcript 1664 1930 . + . gene_id "nbis-pseudogene-366"; transcript_id "gene-C7A06_RS35230"; ID "gene-C7A06_RS35230"; Name "C7A06_RS35230"; Parent "nbis-pseudogene-366"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS35230"; original_biotype "mrna"; partial "true"; pseudo "true"; start_range "." "1664"; +NZ_CP027601.1 Protein Homology exon 1664 1930 . + . gene_id "nbis-pseudogene-366"; transcript_id "gene-C7A06_RS35230"; ID "nbis-exon-6226"; Note "incomplete; partial in the middle of a contig; missing N-terminus"; Parent "gene-C7A06_RS35230"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_016245103.1"; locus_tag "C7A06_RS35230"; partial "true"; product "YqiJ family protein"; pseudo "true"; start_range "." "1664"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 1664 1930 . + 0 gene_id "nbis-pseudogene-366"; transcript_id "gene-C7A06_RS35230"; ID "cds-C7A06_RS35230"; Note "incomplete; partial in the middle of a contig; missing N-terminus"; Parent "gene-C7A06_RS35230"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_016245103.1"; locus_tag "C7A06_RS35230"; partial "true"; product "YqiJ family protein"; pseudo "true"; start_range "." "1664"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 1978 2190 . - . gene_id "nbis-pseudogene-255"; ID "nbis-pseudogene-255"; Name "C7A06_RS33375"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33375"; original_biotype "pseudogene"; partial "true"; pseudo "true"; start_range "." "1978"; +NZ_CP027601.1 RefSeq transcript 1978 2190 . - . gene_id "nbis-pseudogene-255"; transcript_id "gene-C7A06_RS33375"; ID "gene-C7A06_RS33375"; Name "C7A06_RS33375"; Parent "nbis-pseudogene-255"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33375"; original_biotype "mrna"; partial "true"; pseudo "true"; start_range "." "1978"; +NZ_CP027601.1 Protein Homology exon 1978 2190 . - . gene_id "nbis-pseudogene-255"; transcript_id "gene-C7A06_RS33375"; ID "nbis-exon-5905"; Note "incomplete; partial in the middle of a contig; missing C-terminus"; Parent "gene-C7A06_RS33375"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_076611998.1"; locus_tag "C7A06_RS33375"; partial "true"; product "transposase"; pseudo "true"; start_range "." "1978"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 1978 2190 . - 0 gene_id "nbis-pseudogene-255"; transcript_id "gene-C7A06_RS33375"; ID "cds-C7A06_RS33375"; Note "incomplete; partial in the middle of a contig; missing C-terminus"; Parent "gene-C7A06_RS33375"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_076611998.1"; locus_tag "C7A06_RS33375"; partial "true"; product "transposase"; pseudo "true"; start_range "." "1978"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 2252 2425 . + . gene_id "nbis-pseudogene-256"; ID "nbis-pseudogene-256"; Name "C7A06_RS33380"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33380"; original_biotype "pseudogene"; partial "true"; pseudo "true"; start_range "." "2252"; +NZ_CP027601.1 RefSeq transcript 2252 2425 . + . gene_id "nbis-pseudogene-256"; transcript_id "gene-C7A06_RS33380"; ID "gene-C7A06_RS33380"; Name "C7A06_RS33380"; Parent "nbis-pseudogene-256"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33380"; original_biotype "mrna"; partial "true"; pseudo "true"; start_range "." "2252"; +NZ_CP027601.1 Protein Homology exon 2252 2425 . + . gene_id "nbis-pseudogene-256"; transcript_id "gene-C7A06_RS33380"; ID "nbis-exon-5906"; Note "incomplete; partial in the middle of a contig; missing N-terminus"; Parent "gene-C7A06_RS33380"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000998048.1"; locus_tag "C7A06_RS33380"; partial "true"; product "IS66 family transposase"; pseudo "true"; start_range "." "2252"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 2252 2425 . + 0 gene_id "nbis-pseudogene-256"; transcript_id "gene-C7A06_RS33380"; ID "cds-C7A06_RS33380"; Note "incomplete; partial in the middle of a contig; missing N-terminus"; Parent "gene-C7A06_RS33380"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000998048.1"; locus_tag "C7A06_RS33380"; partial "true"; product "IS66 family transposase"; pseudo "true"; start_range "." "2252"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 2868 6770 . + . gene_id "nbis-gene-5650"; ID "nbis-gene-5650"; Name "espP"; gbkey "Gene"; gene "espP"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33385"; +NZ_CP027601.1 RefSeq transcript 2868 6770 . + . gene_id "nbis-gene-5650"; transcript_id "gene-C7A06_RS33385"; ID "gene-C7A06_RS33385"; Name "espP"; Parent "nbis-gene-5650"; gbkey "Gene"; gene "espP"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33385"; original_biotype "mrna"; +NZ_CP027601.1 Protein Homology exon 2868 6770 . + . gene_id "nbis-gene-5650"; transcript_id "gene-C7A06_RS33385"; Dbxref "Genbank:WP_001034100.1"; ID "nbis-exon-5907"; Name "WP_001034100.1"; Parent "gene-C7A06_RS33385"; gbkey "CDS"; gene "espP"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_052685.1"; locus_tag "C7A06_RS33385"; product "serine protease autotransporter EspP"; protein_id "WP_001034100.1"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 2868 6770 . + 0 gene_id "nbis-gene-5650"; transcript_id "gene-C7A06_RS33385"; Dbxref "Genbank:WP_001034100.1"; ID "cds-WP_001034100.1"; Name "WP_001034100.1"; Parent "gene-C7A06_RS33385"; gbkey "CDS"; gene "espP"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_052685.1"; locus_tag "C7A06_RS33385"; product "serine protease autotransporter EspP"; protein_id "WP_001034100.1"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 7018 7275 . - . gene_id "nbis-gene-5772"; ID "nbis-gene-5772"; Name "C7A06_RS34375"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS34375"; +NZ_CP027601.1 RefSeq transcript 7018 7275 . - . gene_id "nbis-gene-5772"; transcript_id "gene-C7A06_RS34375"; ID "gene-C7A06_RS34375"; Name "C7A06_RS34375"; Parent "nbis-gene-5772"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS34375"; original_biotype "mrna"; +NZ_CP027601.1 GeneMarkS-2+ exon 7018 7275 . - . gene_id "nbis-gene-5772"; transcript_id "gene-C7A06_RS34375"; Dbxref "Genbank:WP_000112000.1"; ID "nbis-exon-6062"; Name "WP_000112000.1"; Parent "gene-C7A06_RS34375"; gbkey "CDS"; inference "COORDINATES: ab initio prediction:GeneMarkS-2+"; locus_tag "C7A06_RS34375"; product "hypothetical protein"; protein_id "WP_000112000.1"; transl_table "11"; +NZ_CP027601.1 GeneMarkS-2+ CDS 7018 7275 . - 0 gene_id "nbis-gene-5772"; transcript_id "gene-C7A06_RS34375"; Dbxref "Genbank:WP_000112000.1"; ID "cds-WP_000112000.1"; Name "WP_000112000.1"; Parent "gene-C7A06_RS34375"; gbkey "CDS"; inference "COORDINATES: ab initio prediction:GeneMarkS-2+"; locus_tag "C7A06_RS34375"; product "hypothetical protein"; protein_id "WP_000112000.1"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 7314 7526 . + . gene_id "nbis-pseudogene-257"; ID "nbis-pseudogene-257"; Name "C7A06_RS33395"; end_range "7526" "."; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33395"; original_biotype "pseudogene"; partial "true"; pseudo "true"; +NZ_CP027601.1 RefSeq transcript 7314 7526 . + . gene_id "nbis-pseudogene-257"; transcript_id "gene-C7A06_RS33395"; ID "gene-C7A06_RS33395"; Name "C7A06_RS33395"; Parent "nbis-pseudogene-257"; end_range "7526" "."; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33395"; original_biotype "mrna"; partial "true"; pseudo "true"; +NZ_CP027601.1 Protein Homology exon 7314 7526 . + . gene_id "nbis-pseudogene-257"; transcript_id "gene-C7A06_RS33395"; ID "nbis-exon-5908"; Note "incomplete; partial in the middle of a contig; missing C-terminus"; Parent "gene-C7A06_RS33395"; end_range "7526" "."; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_076611998.1"; locus_tag "C7A06_RS33395"; partial "true"; product "transposase"; pseudo "true"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 7314 7526 . + 0 gene_id "nbis-pseudogene-257"; transcript_id "gene-C7A06_RS33395"; ID "cds-C7A06_RS33395"; Note "incomplete; partial in the middle of a contig; missing C-terminus"; Parent "gene-C7A06_RS33395"; end_range "7526" "."; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_076611998.1"; locus_tag "C7A06_RS33395"; partial "true"; product "transposase"; pseudo "true"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 7574 7840 . - . gene_id "nbis-pseudogene-367"; ID "nbis-pseudogene-367"; Name "C7A06_RS35235"; end_range "7840" "."; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS35235"; original_biotype "pseudogene"; partial "true"; pseudo "true"; +NZ_CP027601.1 RefSeq transcript 7574 7840 . - . gene_id "nbis-pseudogene-367"; transcript_id "gene-C7A06_RS35235"; ID "gene-C7A06_RS35235"; Name "C7A06_RS35235"; Parent "nbis-pseudogene-367"; end_range "7840" "."; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS35235"; original_biotype "mrna"; partial "true"; pseudo "true"; +NZ_CP027601.1 Protein Homology exon 7574 7840 . - . gene_id "nbis-pseudogene-367"; transcript_id "gene-C7A06_RS35235"; ID "nbis-exon-6227"; Note "incomplete; partial in the middle of a contig; missing N-terminus"; Parent "gene-C7A06_RS35235"; end_range "7840" "."; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_016245103.1"; locus_tag "C7A06_RS35235"; partial "true"; product "YqiJ family protein"; pseudo "true"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 7574 7840 . - 0 gene_id "nbis-pseudogene-367"; transcript_id "gene-C7A06_RS35235"; ID "cds-C7A06_RS35235"; Note "incomplete; partial in the middle of a contig; missing N-terminus"; Parent "gene-C7A06_RS35235"; end_range "7840" "."; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_016245103.1"; locus_tag "C7A06_RS35235"; partial "true"; product "YqiJ family protein"; pseudo "true"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 7986 9199 . + . gene_id "nbis-gene-5651"; ID "nbis-gene-5651"; Name "C7A06_RS33410"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33410"; +NZ_CP027601.1 RefSeq transcript 7986 9199 . + . gene_id "nbis-gene-5651"; transcript_id "gene-C7A06_RS33410"; ID "gene-C7A06_RS33410"; Name "C7A06_RS33410"; Parent "nbis-gene-5651"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33410"; original_biotype "mrna"; +NZ_CP027601.1 Protein Homology exon 7986 9199 . + . gene_id "nbis-gene-5651"; transcript_id "gene-C7A06_RS33410"; Dbxref "Genbank:WP_162908518.1"; ID "nbis-exon-5909"; Name "WP_162908518.1"; Note "programmed frameshift"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS33410"; exception "ribosomal slippage"; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_086558238.1"; locus_tag "C7A06_RS33410"; product "IS3 family transposase"; protein_id "WP_162908518.1"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 7986 9199 . + 0 gene_id "nbis-gene-5651"; transcript_id "gene-C7A06_RS33410"; Dbxref "Genbank:WP_162908518.1"; ID "cds-WP_162908518.1"; Name "WP_162908518.1"; Note "programmed frameshift"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS33410"; exception "ribosomal slippage"; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_086558238.1"; locus_tag "C7A06_RS33410"; product "IS3 family transposase"; protein_id "WP_162908518.1"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 9240 9620 . - . gene_id "nbis-pseudogene-258"; ID "nbis-pseudogene-258"; Name "C7A06_RS33415"; end_range "9620" "."; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33415"; original_biotype "pseudogene"; partial "true"; pseudo "true"; start_range "." "9240"; +NZ_CP027601.1 RefSeq transcript 9240 9620 . - . gene_id "nbis-pseudogene-258"; transcript_id "gene-C7A06_RS33415"; ID "gene-C7A06_RS33415"; Name "C7A06_RS33415"; Parent "nbis-pseudogene-258"; end_range "9620" "."; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33415"; original_biotype "mrna"; partial "true"; pseudo "true"; start_range "." "9240"; +NZ_CP027601.1 Protein Homology exon 9240 9620 . - . gene_id "nbis-pseudogene-258"; transcript_id "gene-C7A06_RS33415"; ID "nbis-exon-5910"; Note "incomplete; partial in the middle of a contig; missing N-terminus and C-terminus"; Parent "gene-C7A06_RS33415"; end_range "9620" "."; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_076611997.1"; locus_tag "C7A06_RS33415"; partial "true"; product "IS3 family transposase"; pseudo "true"; start_range "." "9240"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 9240 9620 . - 0 gene_id "nbis-pseudogene-258"; transcript_id "gene-C7A06_RS33415"; ID "cds-C7A06_RS33415"; Note "incomplete; partial in the middle of a contig; missing N-terminus and C-terminus"; Parent "gene-C7A06_RS33415"; end_range "9620" "."; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_076611997.1"; locus_tag "C7A06_RS33415"; partial "true"; product "IS3 family transposase"; pseudo "true"; start_range "." "9240"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 9651 11222 . - . gene_id "nbis-gene-5652"; ID "nbis-gene-5652"; Name "C7A06_RS33420"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33420"; +NZ_CP027601.1 RefSeq transcript 9651 11222 . - . gene_id "nbis-gene-5652"; transcript_id "gene-C7A06_RS33420"; ID "gene-C7A06_RS33420"; Name "C7A06_RS33420"; Parent "nbis-gene-5652"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33420"; original_biotype "mrna"; +NZ_CP027601.1 Protein Homology exon 9651 11222 . - . gene_id "nbis-gene-5652"; transcript_id "gene-C7A06_RS33420"; Dbxref "Genbank:WP_000381395.1"; ID "nbis-exon-5911"; Name "WP_000381395.1"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS33420"; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_012904571.1"; locus_tag "C7A06_RS33420"; product "IS66 family transposase"; protein_id "WP_000381395.1"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 9651 11222 . - 0 gene_id "nbis-gene-5652"; transcript_id "gene-C7A06_RS33420"; Dbxref "Genbank:WP_000381395.1"; ID "cds-WP_000381395.1-10"; Name "WP_000381395.1"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS33420"; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_012904571.1"; locus_tag "C7A06_RS33420"; product "IS66 family transposase"; protein_id "WP_000381395.1"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 11242 11589 . - . gene_id "nbis-gene-5653"; ID "nbis-gene-5653"; Name "tnpB"; gbkey "Gene"; gene "tnpB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33425"; +NZ_CP027601.1 RefSeq transcript 11242 11589 . - . gene_id "nbis-gene-5653"; transcript_id "gene-C7A06_RS33425"; ID "gene-C7A06_RS33425"; Name "tnpB"; Parent "nbis-gene-5653"; gbkey "Gene"; gene "tnpB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33425"; original_biotype "mrna"; +NZ_CP027601.1 Protein Homology exon 11242 11589 . - . gene_id "nbis-gene-5653"; transcript_id "gene-C7A06_RS33425"; Dbxref "Genbank:WP_000624622.1"; ID "nbis-exon-5912"; Name "WP_000624622.1"; Note "TnpB, as the term is used for proteins encoded by IS66 family insertion elements, is considered an accessory protein, since TnpC, encoded by a neighboring gene, is a DDE family transposase."; Parent "gene-C7A06_RS33425"; gbkey "CDS"; gene "tnpB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_858152.1"; locus_tag "C7A06_RS33425"; product "IS66 family insertion sequence element accessory protein TnpB"; protein_id "WP_000624622.1"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 11242 11589 . - 0 gene_id "nbis-gene-5653"; transcript_id "gene-C7A06_RS33425"; Dbxref "Genbank:WP_000624622.1"; ID "cds-WP_000624622.1-10"; Name "WP_000624622.1"; Note "TnpB, as the term is used for proteins encoded by IS66 family insertion elements, is considered an accessory protein, since TnpC, encoded by a neighboring gene, is a DDE family transposase."; Parent "gene-C7A06_RS33425"; gbkey "CDS"; gene "tnpB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_858152.1"; locus_tag "C7A06_RS33425"; product "IS66 family insertion sequence element accessory protein TnpB"; protein_id "WP_000624622.1"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 11589 12266 . - . gene_id "nbis-gene-5654"; ID "nbis-gene-5654"; Name "tnpA"; gbkey "Gene"; gene "tnpA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33430"; +NZ_CP027601.1 RefSeq transcript 11589 12266 . - . gene_id "nbis-gene-5654"; transcript_id "gene-C7A06_RS33430"; ID "gene-C7A06_RS33430"; Name "tnpA"; Parent "nbis-gene-5654"; gbkey "Gene"; gene "tnpA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33430"; original_biotype "mrna"; +NZ_CP027601.1 Protein Homology exon 11589 12266 . - . gene_id "nbis-gene-5654"; transcript_id "gene-C7A06_RS33430"; Dbxref "Genbank:WP_001339397.1"; ID "nbis-exon-5913"; Name "WP_001339397.1"; Ontology_term "GO:0006313" "GO:0003677" "GO:0004803"; Parent "gene-C7A06_RS33430"; gbkey "CDS"; gene "tnpA"; go_function "DNA binding|0003677||IEA" "transposase activity|0004803||IEA"; go_process "transposition, DNA-mediated|0006313||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001743492.1"; locus_tag "C7A06_RS33430"; product "IS66-like element accessory protein TnpA"; protein_id "WP_001339397.1"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 11589 12266 . - 0 gene_id "nbis-gene-5654"; transcript_id "gene-C7A06_RS33430"; Dbxref "Genbank:WP_001339397.1"; ID "cds-WP_001339397.1-10"; Name "WP_001339397.1"; Ontology_term "GO:0006313" "GO:0003677" "GO:0004803"; Parent "gene-C7A06_RS33430"; gbkey "CDS"; gene "tnpA"; go_function "DNA binding|0003677||IEA" "transposase activity|0004803||IEA"; go_process "transposition, DNA-mediated|0006313||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001743492.1"; locus_tag "C7A06_RS33430"; product "IS66-like element accessory protein TnpA"; protein_id "WP_001339397.1"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 12319 12635 . - . gene_id "nbis-pseudogene-259"; ID "nbis-pseudogene-259"; Name "C7A06_RS33440"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33440"; original_biotype "pseudogene"; partial "true"; pseudo "true"; start_range "." "12319"; +NZ_CP027601.1 RefSeq transcript 12319 12635 . - . gene_id "nbis-pseudogene-259"; transcript_id "gene-C7A06_RS33440"; ID "gene-C7A06_RS33440"; Name "C7A06_RS33440"; Parent "nbis-pseudogene-259"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33440"; original_biotype "mrna"; partial "true"; pseudo "true"; start_range "." "12319"; +NZ_CP027601.1 Protein Homology exon 12319 12635 . - . gene_id "nbis-pseudogene-259"; transcript_id "gene-C7A06_RS33440"; ID "nbis-exon-5914"; Note "frameshifted; incomplete; partial in the middle of a contig; missing C-terminus"; Ontology_term "GO:0006313" "GO:0003677" "GO:0004803"; Parent "gene-C7A06_RS33440"; gbkey "CDS"; go_function "DNA binding|0003677||IEA" "transposase activity|0004803||IEA"; go_process "transposition, DNA-mediated|0006313||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_076611998.1"; locus_tag "C7A06_RS33440"; partial "true"; product "transposase"; pseudo "true"; start_range "." "12319"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 12319 12635 . - 0 gene_id "nbis-pseudogene-259"; transcript_id "gene-C7A06_RS33440"; ID "cds-C7A06_RS33440"; Note "frameshifted; incomplete; partial in the middle of a contig; missing C-terminus"; Ontology_term "GO:0006313" "GO:0003677" "GO:0004803"; Parent "gene-C7A06_RS33440"; gbkey "CDS"; go_function "DNA binding|0003677||IEA" "transposase activity|0004803||IEA"; go_process "transposition, DNA-mediated|0006313||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_076611998.1"; locus_tag "C7A06_RS33440"; partial "true"; product "transposase"; pseudo "true"; start_range "." "12319"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 12701 12994 . + . gene_id "nbis-pseudogene-368"; ID "nbis-pseudogene-368"; Name "C7A06_RS35240"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS35240"; original_biotype "pseudogene"; partial "true"; pseudo "true"; start_range "." "12701"; +NZ_CP027601.1 RefSeq transcript 12701 12994 . + . gene_id "nbis-pseudogene-368"; transcript_id "gene-C7A06_RS35240"; ID "gene-C7A06_RS35240"; Name "C7A06_RS35240"; Parent "nbis-pseudogene-368"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS35240"; original_biotype "mrna"; partial "true"; pseudo "true"; start_range "." "12701"; +NZ_CP027601.1 Protein Homology exon 12701 12994 . + . gene_id "nbis-pseudogene-368"; transcript_id "gene-C7A06_RS35240"; ID "nbis-exon-6228"; Note "incomplete; partial in the middle of a contig; missing N-terminus"; Parent "gene-C7A06_RS35240"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000077650.1"; locus_tag "C7A06_RS35240"; partial "true"; product "conjugal transfer protein TrbC"; pseudo "true"; start_range "." "12701"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 12701 12994 . + 0 gene_id "nbis-pseudogene-368"; transcript_id "gene-C7A06_RS35240"; ID "cds-C7A06_RS35240"; Note "incomplete; partial in the middle of a contig; missing N-terminus"; Parent "gene-C7A06_RS35240"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000077650.1"; locus_tag "C7A06_RS35240"; partial "true"; product "conjugal transfer protein TrbC"; pseudo "true"; start_range "." "12701"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 13215 15935 . - . gene_id "nbis-gene-5655"; ID "nbis-gene-5655"; Name "C7A06_RS33450"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33450"; +NZ_CP027601.1 RefSeq transcript 13215 15935 . - . gene_id "nbis-gene-5655"; transcript_id "gene-C7A06_RS33450"; ID "gene-C7A06_RS33450"; Name "C7A06_RS33450"; Parent "nbis-gene-5655"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33450"; original_biotype "mrna"; +NZ_CP027601.1 Protein Homology exon 13215 15935 . - . gene_id "nbis-gene-5655"; transcript_id "gene-C7A06_RS33450"; Dbxref "Genbank:WP_000991402.1"; ID "nbis-exon-5915"; Name "WP_000991402.1"; Parent "gene-C7A06_RS33450"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000991381.1"; locus_tag "C7A06_RS33450"; product "relaxase/mobilization nuclease domain-containing protein"; protein_id "WP_000991402.1"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 13215 15935 . - 0 gene_id "nbis-gene-5655"; transcript_id "gene-C7A06_RS33450"; Dbxref "Genbank:WP_000991402.1"; ID "cds-WP_000991402.1"; Name "WP_000991402.1"; Parent "gene-C7A06_RS33450"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000991381.1"; locus_tag "C7A06_RS33450"; product "relaxase/mobilization nuclease domain-containing protein"; protein_id "WP_000991402.1"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 15947 16279 . - . gene_id "nbis-gene-5656"; ID "nbis-gene-5656"; Name "C7A06_RS33455"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33455"; +NZ_CP027601.1 RefSeq transcript 15947 16279 . - . gene_id "nbis-gene-5656"; transcript_id "gene-C7A06_RS33455"; ID "gene-C7A06_RS33455"; Name "C7A06_RS33455"; Parent "nbis-gene-5656"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33455"; original_biotype "mrna"; +NZ_CP027601.1 Protein Homology exon 15947 16279 . - . gene_id "nbis-gene-5656"; transcript_id "gene-C7A06_RS33455"; Dbxref "Genbank:WP_001291056.1"; ID "nbis-exon-5916"; Name "WP_001291056.1"; Parent "gene-C7A06_RS33455"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001291057.1"; locus_tag "C7A06_RS33455"; product "DUF6290 family protein"; protein_id "WP_001291056.1"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 15947 16279 . - 0 gene_id "nbis-gene-5656"; transcript_id "gene-C7A06_RS33455"; Dbxref "Genbank:WP_001291056.1"; ID "cds-WP_001291056.1"; Name "WP_001291056.1"; Parent "gene-C7A06_RS33455"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001291057.1"; locus_tag "C7A06_RS33455"; product "DUF6290 family protein"; protein_id "WP_001291056.1"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 16511 16846 . + . gene_id "nbis-gene-5657"; ID "nbis-gene-5657"; Name "C7A06_RS33460"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33460"; +NZ_CP027601.1 RefSeq transcript 16511 16846 . + . gene_id "nbis-gene-5657"; transcript_id "gene-C7A06_RS33460"; ID "gene-C7A06_RS33460"; Name "C7A06_RS33460"; Parent "nbis-gene-5657"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33460"; original_biotype "mrna"; +NZ_CP027601.1 Protein Homology exon 16511 16846 . + . gene_id "nbis-gene-5657"; transcript_id "gene-C7A06_RS33460"; Dbxref "Genbank:WP_000157095.1"; ID "nbis-exon-5917"; Name "WP_000157095.1"; Parent "gene-C7A06_RS33460"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000157082.1"; locus_tag "C7A06_RS33460"; product "molybdopterin-guanine dinucleotide biosynthesis protein MobC"; protein_id "WP_000157095.1"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 16511 16846 . + 0 gene_id "nbis-gene-5657"; transcript_id "gene-C7A06_RS33460"; Dbxref "Genbank:WP_000157095.1"; ID "cds-WP_000157095.1"; Name "WP_000157095.1"; Parent "gene-C7A06_RS33460"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000157082.1"; locus_tag "C7A06_RS33460"; product "molybdopterin-guanine dinucleotide biosynthesis protein MobC"; protein_id "WP_000157095.1"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 16932 17780 . - . gene_id "nbis-gene-5658"; ID "nbis-gene-5658"; Name "C7A06_RS33465"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33465"; +NZ_CP027601.1 RefSeq transcript 16932 17780 . - . gene_id "nbis-gene-5658"; transcript_id "gene-C7A06_RS33465"; ID "gene-C7A06_RS33465"; Name "C7A06_RS33465"; Parent "nbis-gene-5658"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33465"; original_biotype "mrna"; +NZ_CP027601.1 Protein Homology exon 16932 17780 . - . gene_id "nbis-gene-5658"; transcript_id "gene-C7A06_RS33465"; Dbxref "Genbank:WP_001341408.1"; ID "nbis-exon-5918"; Name "WP_001341408.1"; Parent "gene-C7A06_RS33465"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001401764.1"; locus_tag "C7A06_RS33465"; product "DUF4942 domain-containing protein"; protein_id "WP_001341408.1"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 16932 17780 . - 0 gene_id "nbis-gene-5658"; transcript_id "gene-C7A06_RS33465"; Dbxref "Genbank:WP_001341408.1"; ID "cds-WP_001341408.1"; Name "WP_001341408.1"; Parent "gene-C7A06_RS33465"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001401764.1"; locus_tag "C7A06_RS33465"; product "DUF4942 domain-containing protein"; protein_id "WP_001341408.1"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 17973 18299 . + . gene_id "nbis-gene-5659"; ID "nbis-gene-5659"; Name "C7A06_RS33470"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33470"; +NZ_CP027601.1 RefSeq transcript 17973 18299 . + . gene_id "nbis-gene-5659"; transcript_id "gene-C7A06_RS33470"; ID "gene-C7A06_RS33470"; Name "C7A06_RS33470"; Parent "nbis-gene-5659"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33470"; original_biotype "mrna"; +NZ_CP027601.1 Protein Homology exon 17973 18299 . + . gene_id "nbis-gene-5659"; transcript_id "gene-C7A06_RS33470"; Dbxref "Genbank:WP_199852433.1"; ID "nbis-exon-5919"; Name "WP_199852433.1"; Parent "gene-C7A06_RS33470"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001431784.1"; locus_tag "C7A06_RS33470"; product "hypothetical protein"; protein_id "WP_199852433.1"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 17973 18299 . + 0 gene_id "nbis-gene-5659"; transcript_id "gene-C7A06_RS33470"; Dbxref "Genbank:WP_199852433.1"; ID "cds-WP_199852433.1"; Name "WP_199852433.1"; Parent "gene-C7A06_RS33470"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001431784.1"; locus_tag "C7A06_RS33470"; product "hypothetical protein"; protein_id "WP_199852433.1"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 18358 18609 . + . gene_id "nbis-gene-5660"; ID "nbis-gene-5660"; Name "C7A06_RS33475"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33475"; +NZ_CP027601.1 RefSeq transcript 18358 18609 . + . gene_id "nbis-gene-5660"; transcript_id "gene-C7A06_RS33475"; ID "gene-C7A06_RS33475"; Name "C7A06_RS33475"; Parent "nbis-gene-5660"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33475"; original_biotype "mrna"; +NZ_CP027601.1 Protein Homology exon 18358 18609 . + . gene_id "nbis-gene-5660"; transcript_id "gene-C7A06_RS33475"; Dbxref "Genbank:WP_000148286.1"; ID "nbis-exon-5920"; Name "WP_000148286.1"; Parent "gene-C7A06_RS33475"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_003980153.1"; locus_tag "C7A06_RS33475"; product "helix-turn-helix domain-containing protein"; protein_id "WP_000148286.1"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 18358 18609 . + 0 gene_id "nbis-gene-5660"; transcript_id "gene-C7A06_RS33475"; Dbxref "Genbank:WP_000148286.1"; ID "cds-WP_000148286.1"; Name "WP_000148286.1"; Parent "gene-C7A06_RS33475"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_003980153.1"; locus_tag "C7A06_RS33475"; product "helix-turn-helix domain-containing protein"; protein_id "WP_000148286.1"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 18640 19539 . - . gene_id "nbis-gene-5661"; ID "nbis-gene-5661"; Name "C7A06_RS33480"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33480"; +NZ_CP027601.1 RefSeq transcript 18640 19539 . - . gene_id "nbis-gene-5661"; transcript_id "gene-C7A06_RS33480"; ID "gene-C7A06_RS33480"; Name "C7A06_RS33480"; Parent "nbis-gene-5661"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33480"; original_biotype "mrna"; +NZ_CP027601.1 Protein Homology exon 18640 19539 . - . gene_id "nbis-gene-5661"; transcript_id "gene-C7A06_RS33480"; Dbxref "Genbank:WP_032348834.1"; ID "nbis-exon-5921"; Name "WP_032348834.1"; Parent "gene-C7A06_RS33480"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000038335.1"; locus_tag "C7A06_RS33480"; product "Rpn family recombination-promoting nuclease/putative transposase"; protein_id "WP_032348834.1"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 18640 19539 . - 0 gene_id "nbis-gene-5661"; transcript_id "gene-C7A06_RS33480"; Dbxref "Genbank:WP_032348834.1"; ID "cds-WP_032348834.1"; Name "WP_032348834.1"; Parent "gene-C7A06_RS33480"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000038335.1"; locus_tag "C7A06_RS33480"; product "Rpn family recombination-promoting nuclease/putative transposase"; protein_id "WP_032348834.1"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 19604 19870 . - . gene_id "nbis-gene-5662"; ID "nbis-gene-5662"; Name "C7A06_RS33485"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33485"; +NZ_CP027601.1 RefSeq transcript 19604 19870 . - . gene_id "nbis-gene-5662"; transcript_id "gene-C7A06_RS33485"; ID "gene-C7A06_RS33485"; Name "C7A06_RS33485"; Parent "nbis-gene-5662"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33485"; original_biotype "mrna"; +NZ_CP027601.1 Protein Homology exon 19604 19870 . - . gene_id "nbis-gene-5662"; transcript_id "gene-C7A06_RS33485"; Dbxref "Genbank:WP_001247865.1"; ID "nbis-exon-5922"; Name "WP_001247865.1"; Parent "gene-C7A06_RS33485"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001247860.1"; locus_tag "C7A06_RS33485"; product "hypothetical protein"; protein_id "WP_001247865.1"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 19604 19870 . - 0 gene_id "nbis-gene-5662"; transcript_id "gene-C7A06_RS33485"; Dbxref "Genbank:WP_001247865.1"; ID "cds-WP_001247865.1"; Name "WP_001247865.1"; Parent "gene-C7A06_RS33485"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001247860.1"; locus_tag "C7A06_RS33485"; product "hypothetical protein"; protein_id "WP_001247865.1"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 19963 20397 . - . gene_id "nbis-gene-5663"; ID "nbis-gene-5663"; Name "C7A06_RS33490"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33490"; +NZ_CP027601.1 RefSeq transcript 19963 20397 . - . gene_id "nbis-gene-5663"; transcript_id "gene-C7A06_RS33490"; ID "gene-C7A06_RS33490"; Name "C7A06_RS33490"; Parent "nbis-gene-5663"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33490"; original_biotype "mrna"; +NZ_CP027601.1 Protein Homology exon 19963 20397 . - . gene_id "nbis-gene-5663"; transcript_id "gene-C7A06_RS33490"; Dbxref "Genbank:WP_000218854.1"; ID "nbis-exon-5923"; Name "WP_000218854.1"; Parent "gene-C7A06_RS33490"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000218847.1"; locus_tag "C7A06_RS33490"; product "hypothetical protein"; protein_id "WP_000218854.1"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 19963 20397 . - 0 gene_id "nbis-gene-5663"; transcript_id "gene-C7A06_RS33490"; Dbxref "Genbank:WP_000218854.1"; ID "cds-WP_000218854.1"; Name "WP_000218854.1"; Parent "gene-C7A06_RS33490"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000218847.1"; locus_tag "C7A06_RS33490"; product "hypothetical protein"; protein_id "WP_000218854.1"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 20503 21123 . + . gene_id "nbis-gene-5805"; ID "nbis-gene-5805"; Name "C7A06_RS34645"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS34645"; +NZ_CP027601.1 RefSeq transcript 20503 21123 . + . gene_id "nbis-gene-5805"; transcript_id "gene-C7A06_RS34645"; ID "gene-C7A06_RS34645"; Name "C7A06_RS34645"; Parent "nbis-gene-5805"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS34645"; original_biotype "mrna"; +NZ_CP027601.1 GeneMarkS-2+ exon 20503 21123 . + . gene_id "nbis-gene-5805"; transcript_id "gene-C7A06_RS34645"; Dbxref "Genbank:WP_162137195.1"; ID "nbis-exon-6111"; Name "WP_162137195.1"; Parent "gene-C7A06_RS34645"; gbkey "CDS"; inference "COORDINATES: ab initio prediction:GeneMarkS-2+"; locus_tag "C7A06_RS34645"; product "hypothetical protein"; protein_id "WP_162137195.1"; transl_table "11"; +NZ_CP027601.1 GeneMarkS-2+ CDS 20503 21123 . + 0 gene_id "nbis-gene-5805"; transcript_id "gene-C7A06_RS34645"; Dbxref "Genbank:WP_162137195.1"; ID "cds-WP_162137195.1"; Name "WP_162137195.1"; Parent "gene-C7A06_RS34645"; gbkey "CDS"; inference "COORDINATES: ab initio prediction:GeneMarkS-2+"; locus_tag "C7A06_RS34645"; product "hypothetical protein"; protein_id "WP_162137195.1"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 21125 21625 . - . gene_id "nbis-gene-5664"; ID "nbis-gene-5664"; Name "C7A06_RS33505"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33505"; +NZ_CP027601.1 RefSeq transcript 21125 21625 . - . gene_id "nbis-gene-5664"; transcript_id "gene-C7A06_RS33505"; ID "gene-C7A06_RS33505"; Name "C7A06_RS33505"; Parent "nbis-gene-5664"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33505"; original_biotype "mrna"; +NZ_CP027601.1 Protein Homology exon 21125 21625 . - . gene_id "nbis-gene-5664"; transcript_id "gene-C7A06_RS33505"; Dbxref "Genbank:WP_000117628.1"; ID "nbis-exon-5924"; Name "WP_000117628.1"; Parent "gene-C7A06_RS33505"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000117633.1"; locus_tag "C7A06_RS33505"; product "antirestriction protein ArdA"; protein_id "WP_000117628.1"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 21125 21625 . - 0 gene_id "nbis-gene-5664"; transcript_id "gene-C7A06_RS33505"; Dbxref "Genbank:WP_000117628.1"; ID "cds-WP_000117628.1"; Name "WP_000117628.1"; Parent "gene-C7A06_RS33505"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000117633.1"; locus_tag "C7A06_RS33505"; product "antirestriction protein ArdA"; protein_id "WP_000117628.1"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 22087 22684 . - . gene_id "nbis-pseudogene-306"; ID "nbis-pseudogene-306"; Name "C7A06_RS34650"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS34650"; original_biotype "pseudogene"; pseudo "true"; +NZ_CP027601.1 RefSeq transcript 22087 22684 . - . gene_id "nbis-pseudogene-306"; transcript_id "gene-C7A06_RS34650"; ID "gene-C7A06_RS34650"; Name "C7A06_RS34650"; Parent "nbis-pseudogene-306"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS34650"; original_biotype "mrna"; pseudo "true"; +NZ_CP027601.1 Protein Homology exon 22087 22684 . - . gene_id "nbis-pseudogene-306"; transcript_id "gene-C7A06_RS34650"; ID "nbis-exon-6112"; Note "frameshifted"; Parent "gene-C7A06_RS34650"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000978013.1"; locus_tag "C7A06_RS34650"; product "hypothetical protein"; pseudo "true"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 22087 22684 . - 0 gene_id "nbis-pseudogene-306"; transcript_id "gene-C7A06_RS34650"; ID "cds-C7A06_RS34650"; Note "frameshifted"; Parent "gene-C7A06_RS34650"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000978013.1"; locus_tag "C7A06_RS34650"; product "hypothetical protein"; pseudo "true"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 22681 23400 . - . gene_id "nbis-gene-5665"; ID "nbis-gene-5665"; Name "C7A06_RS33520"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33520"; +NZ_CP027601.1 RefSeq transcript 22681 23400 . - . gene_id "nbis-gene-5665"; transcript_id "gene-C7A06_RS33520"; ID "gene-C7A06_RS33520"; Name "C7A06_RS33520"; Parent "nbis-gene-5665"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33520"; original_biotype "mrna"; +NZ_CP027601.1 Protein Homology exon 22681 23400 . - . gene_id "nbis-gene-5665"; transcript_id "gene-C7A06_RS33520"; Dbxref "Genbank:WP_001276261.1"; ID "nbis-exon-5925"; Name "WP_001276261.1"; Parent "gene-C7A06_RS33520"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001723065.1"; locus_tag "C7A06_RS33520"; product "plasmid SOS inhibition protein A"; protein_id "WP_001276261.1"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 22681 23400 . - 0 gene_id "nbis-gene-5665"; transcript_id "gene-C7A06_RS33520"; Dbxref "Genbank:WP_001276261.1"; ID "cds-WP_001276261.1"; Name "WP_001276261.1"; Parent "gene-C7A06_RS33520"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001723065.1"; locus_tag "C7A06_RS33520"; product "plasmid SOS inhibition protein A"; protein_id "WP_001276261.1"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 23397 23645 . - . gene_id "nbis-pseudogene-307"; ID "nbis-pseudogene-307"; Name "psiB"; end_range "23645" "."; gbkey "Gene"; gene "psiB"; gene_biotype "pseudogene"; locus_tag "C7A06_RS34655"; original_biotype "pseudogene"; partial "true"; pseudo "true"; +NZ_CP027601.1 RefSeq transcript 23397 23645 . - . gene_id "nbis-pseudogene-307"; transcript_id "gene-C7A06_RS34655"; ID "gene-C7A06_RS34655"; Name "psiB"; Parent "nbis-pseudogene-307"; end_range "23645" "."; gbkey "Gene"; gene "psiB"; gene_biotype "pseudogene"; locus_tag "C7A06_RS34655"; original_biotype "mrna"; partial "true"; pseudo "true"; +NZ_CP027601.1 Protein Homology exon 23397 23645 . - . gene_id "nbis-pseudogene-307"; transcript_id "gene-C7A06_RS34655"; ID "nbis-exon-6113"; Note "incomplete; partial in the middle of a contig; missing N-terminus"; Parent "gene-C7A06_RS34655"; end_range "23645" "."; gbkey "CDS"; gene "psiB"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000845953.1"; locus_tag "C7A06_RS34655"; partial "true"; product "conjugation system SOS inhibitor PsiB"; pseudo "true"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 23397 23645 . - 0 gene_id "nbis-pseudogene-307"; transcript_id "gene-C7A06_RS34655"; ID "cds-C7A06_RS34655"; Note "incomplete; partial in the middle of a contig; missing N-terminus"; Parent "gene-C7A06_RS34655"; end_range "23645" "."; gbkey "CDS"; gene "psiB"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000845953.1"; locus_tag "C7A06_RS34655"; partial "true"; product "conjugation system SOS inhibitor PsiB"; pseudo "true"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 23640 23879 . - . gene_id "nbis-pseudogene-308"; ID "nbis-pseudogene-308"; Name "C7A06_RS34660"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS34660"; original_biotype "pseudogene"; partial "true"; pseudo "true"; start_range "." "23640"; +NZ_CP027601.1 RefSeq transcript 23640 23879 . - . gene_id "nbis-pseudogene-308"; transcript_id "gene-C7A06_RS34660"; ID "gene-C7A06_RS34660"; Name "C7A06_RS34660"; Parent "nbis-pseudogene-308"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS34660"; original_biotype "mrna"; partial "true"; pseudo "true"; start_range "." "23640"; +NZ_CP027601.1 Protein Homology exon 23640 23879 . - . gene_id "nbis-pseudogene-308"; transcript_id "gene-C7A06_RS34660"; ID "nbis-exon-6114"; Note "incomplete; partial in the middle of a contig; missing C-terminus"; Parent "gene-C7A06_RS34660"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_858335.1"; locus_tag "C7A06_RS34660"; partial "true"; product "hypothetical protein"; pseudo "true"; start_range "." "23640"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 23640 23879 . - 0 gene_id "nbis-pseudogene-308"; transcript_id "gene-C7A06_RS34660"; ID "cds-C7A06_RS34660"; Note "incomplete; partial in the middle of a contig; missing C-terminus"; Parent "gene-C7A06_RS34660"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_858335.1"; locus_tag "C7A06_RS34660"; partial "true"; product "hypothetical protein"; pseudo "true"; start_range "." "23640"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 23924 24410 . - . gene_id "nbis-pseudogene-260"; ID "nbis-pseudogene-260"; Name "C7A06_RS33530"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33530"; original_biotype "pseudogene"; pseudo "true"; +NZ_CP027601.1 RefSeq transcript 23924 24410 . - . gene_id "nbis-pseudogene-260"; transcript_id "gene-C7A06_RS33530"; ID "gene-C7A06_RS33530"; Name "C7A06_RS33530"; Parent "nbis-pseudogene-260"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33530"; original_biotype "mrna"; pseudo "true"; +NZ_CP027601.1 Protein Homology exon 23924 24410 . - . gene_id "nbis-pseudogene-260"; transcript_id "gene-C7A06_RS33530"; ID "nbis-exon-5926"; Note "frameshifted"; Parent "gene-C7A06_RS33530"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_052646.1"; locus_tag "C7A06_RS33530"; product "DUF1380 domain-containing protein"; pseudo "true"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 23924 24410 . - 0 gene_id "nbis-pseudogene-260"; transcript_id "gene-C7A06_RS33530"; ID "cds-C7A06_RS33530"; Note "frameshifted"; Parent "gene-C7A06_RS33530"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_052646.1"; locus_tag "C7A06_RS33530"; product "DUF1380 domain-containing protein"; pseudo "true"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 24370 24588 . - . gene_id "nbis-gene-5666"; ID "nbis-gene-5666"; Name "C7A06_RS33535"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33535"; +NZ_CP027601.1 RefSeq transcript 24370 24588 . - . gene_id "nbis-gene-5666"; transcript_id "gene-C7A06_RS33535"; ID "gene-C7A06_RS33535"; Name "C7A06_RS33535"; Parent "nbis-gene-5666"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33535"; original_biotype "mrna"; +NZ_CP027601.1 Protein Homology exon 24370 24588 . - . gene_id "nbis-gene-5666"; transcript_id "gene-C7A06_RS33535"; Dbxref "Genbank:WP_001443814.1"; ID "nbis-exon-5927"; Name "WP_001443814.1"; Parent "gene-C7A06_RS33535"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_858332.1"; locus_tag "C7A06_RS33535"; product "hypothetical protein"; protein_id "WP_001443814.1"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 24370 24588 . - 0 gene_id "nbis-gene-5666"; transcript_id "gene-C7A06_RS33535"; Dbxref "Genbank:WP_001443814.1"; ID "cds-WP_001443814.1"; Name "WP_001443814.1"; Parent "gene-C7A06_RS33535"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_858332.1"; locus_tag "C7A06_RS33535"; product "hypothetical protein"; protein_id "WP_001443814.1"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 24588 25271 . - . gene_id "nbis-gene-5667"; ID "nbis-gene-5667"; Name "C7A06_RS33540"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33540"; +NZ_CP027601.1 RefSeq transcript 24588 25271 . - . gene_id "nbis-gene-5667"; transcript_id "gene-C7A06_RS33540"; ID "gene-C7A06_RS33540"; Name "C7A06_RS33540"; Parent "nbis-gene-5667"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33540"; original_biotype "mrna"; +NZ_CP027601.1 Protein Homology exon 24588 25271 . - . gene_id "nbis-gene-5667"; transcript_id "gene-C7A06_RS33540"; Dbxref "Genbank:WP_000086167.1"; ID "nbis-exon-5928"; Name "WP_000086167.1"; Parent "gene-C7A06_RS33540"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_858331.2"; locus_tag "C7A06_RS33540"; product "DNA methylase"; protein_id "WP_000086167.1"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 24588 25271 . - 0 gene_id "nbis-gene-5667"; transcript_id "gene-C7A06_RS33540"; Dbxref "Genbank:WP_000086167.1"; ID "cds-WP_000086167.1"; Name "WP_000086167.1"; Parent "gene-C7A06_RS33540"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_858331.2"; locus_tag "C7A06_RS33540"; product "DNA methylase"; protein_id "WP_000086167.1"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 25347 25658 . - . gene_id "nbis-gene-5668"; ID "nbis-gene-5668"; Name "C7A06_RS33545"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33545"; +NZ_CP027601.1 RefSeq transcript 25347 25658 . - . gene_id "nbis-gene-5668"; transcript_id "gene-C7A06_RS33545"; ID "gene-C7A06_RS33545"; Name "C7A06_RS33545"; Parent "nbis-gene-5668"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33545"; original_biotype "mrna"; +NZ_CP027601.1 Protein Homology exon 25347 25658 . - . gene_id "nbis-gene-5668"; transcript_id "gene-C7A06_RS33545"; Dbxref "Genbank:WP_012680995.1"; ID "nbis-exon-5929"; Name "WP_012680995.1"; Parent "gene-C7A06_RS33545"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_858330.2"; locus_tag "C7A06_RS33545"; product "hypothetical protein"; protein_id "WP_012680995.1"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 25347 25658 . - 0 gene_id "nbis-gene-5668"; transcript_id "gene-C7A06_RS33545"; Dbxref "Genbank:WP_012680995.1"; ID "cds-WP_012680995.1-2"; Name "WP_012680995.1"; Parent "gene-C7A06_RS33545"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_858330.2"; locus_tag "C7A06_RS33545"; product "hypothetical protein"; protein_id "WP_012680995.1"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 25655 26557 . - . gene_id "nbis-gene-5669"; ID "nbis-gene-5669"; Name "C7A06_RS33550"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33550"; +NZ_CP027601.1 RefSeq transcript 25655 26557 . - . gene_id "nbis-gene-5669"; transcript_id "gene-C7A06_RS33550"; ID "gene-C7A06_RS33550"; Name "C7A06_RS33550"; Parent "nbis-gene-5669"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33550"; original_biotype "mrna"; +NZ_CP027601.1 Protein Homology exon 25655 26557 . - . gene_id "nbis-gene-5669"; transcript_id "gene-C7A06_RS33550"; Dbxref "Genbank:WP_077249722.1"; ID "nbis-exon-5930"; Name "WP_077249722.1"; Parent "gene-C7A06_RS33550"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_052643.1"; locus_tag "C7A06_RS33550"; product "DUF1281 domain-containing protein"; protein_id "WP_077249722.1"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 25655 26557 . - 0 gene_id "nbis-gene-5669"; transcript_id "gene-C7A06_RS33550"; Dbxref "Genbank:WP_077249722.1"; ID "cds-WP_077249722.1"; Name "WP_077249722.1"; Parent "gene-C7A06_RS33550"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_052643.1"; locus_tag "C7A06_RS33550"; product "DUF1281 domain-containing protein"; protein_id "WP_077249722.1"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 26830 27789 . + . gene_id "nbis-gene-5670"; ID "nbis-gene-5670"; Name "C7A06_RS33555"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33555"; +NZ_CP027601.1 RefSeq transcript 26830 27789 . + . gene_id "nbis-gene-5670"; transcript_id "gene-C7A06_RS33555"; ID "gene-C7A06_RS33555"; Name "C7A06_RS33555"; Parent "nbis-gene-5670"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33555"; original_biotype "mrna"; +NZ_CP027601.1 Protein Homology exon 26830 27789 . + . gene_id "nbis-gene-5670"; transcript_id "gene-C7A06_RS33555"; Dbxref "Genbank:WP_000921957.1"; ID "nbis-exon-5931"; Name "WP_000921957.1"; Parent "gene-C7A06_RS33555"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_858328.1"; locus_tag "C7A06_RS33555"; product "plasmid segregation protein ParM"; protein_id "WP_000921957.1"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 26830 27789 . + 0 gene_id "nbis-gene-5670"; transcript_id "gene-C7A06_RS33555"; Dbxref "Genbank:WP_000921957.1"; ID "cds-WP_000921957.1"; Name "WP_000921957.1"; Parent "gene-C7A06_RS33555"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_858328.1"; locus_tag "C7A06_RS33555"; product "plasmid segregation protein ParM"; protein_id "WP_000921957.1"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 27789 28184 . + . gene_id "nbis-gene-5671"; ID "nbis-gene-5671"; Name "C7A06_RS33560"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33560"; +NZ_CP027601.1 RefSeq transcript 27789 28184 . + . gene_id "nbis-gene-5671"; transcript_id "gene-C7A06_RS33560"; ID "gene-C7A06_RS33560"; Name "C7A06_RS33560"; Parent "nbis-gene-5671"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33560"; original_biotype "mrna"; +NZ_CP027601.1 Protein Homology exon 27789 28184 . + . gene_id "nbis-gene-5671"; transcript_id "gene-C7A06_RS33560"; Dbxref "Genbank:WP_000445934.1"; ID "nbis-exon-5932"; Name "WP_000445934.1"; Parent "gene-C7A06_RS33560"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_858327.1"; locus_tag "C7A06_RS33560"; product "plasmid partitioning/stability family protein"; protein_id "WP_000445934.1"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 27789 28184 . + 0 gene_id "nbis-gene-5671"; transcript_id "gene-C7A06_RS33560"; Dbxref "Genbank:WP_000445934.1"; ID "cds-WP_000445934.1"; Name "WP_000445934.1"; Parent "gene-C7A06_RS33560"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_858327.1"; locus_tag "C7A06_RS33560"; product "plasmid partitioning/stability family protein"; protein_id "WP_000445934.1"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 28264 29031 . - . gene_id "nbis-pseudogene-261"; ID "nbis-pseudogene-261"; Name "C7A06_RS33565"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33565"; original_biotype "pseudogene"; partial "true"; pseudo "true"; start_range "." "28264"; +NZ_CP027601.1 RefSeq transcript 28264 29031 . - . gene_id "nbis-pseudogene-261"; transcript_id "gene-C7A06_RS33565"; ID "gene-C7A06_RS33565"; Name "C7A06_RS33565"; Parent "nbis-pseudogene-261"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33565"; original_biotype "mrna"; partial "true"; pseudo "true"; start_range "." "28264"; +NZ_CP027601.1 Protein Homology exon 28264 29031 . - . gene_id "nbis-pseudogene-261"; transcript_id "gene-C7A06_RS33565"; ID "nbis-exon-5933"; Note "frameshifted; internal stop; incomplete; partial in the middle of a contig; missing C-terminus"; Parent "gene-C7A06_RS33565"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_076612086.1"; locus_tag "C7A06_RS33565"; partial "true"; product "IS3 family transposase"; pseudo "true"; start_range "." "28264"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 28264 29031 . - 0 gene_id "nbis-pseudogene-261"; transcript_id "gene-C7A06_RS33565"; ID "cds-C7A06_RS33565"; Note "frameshifted; internal stop; incomplete; partial in the middle of a contig; missing C-terminus"; Parent "gene-C7A06_RS33565"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_076612086.1"; locus_tag "C7A06_RS33565"; partial "true"; product "IS3 family transposase"; pseudo "true"; start_range "." "28264"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 29145 29534 . - . gene_id "nbis-gene-5672"; ID "nbis-gene-5672"; Name "C7A06_RS33570"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33570"; +NZ_CP027601.1 RefSeq transcript 29145 29534 . - . gene_id "nbis-gene-5672"; transcript_id "gene-C7A06_RS33570"; ID "gene-C7A06_RS33570"; Name "C7A06_RS33570"; Parent "nbis-gene-5672"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33570"; original_biotype "mrna"; +NZ_CP027601.1 Protein Homology exon 29145 29534 . - . gene_id "nbis-gene-5672"; transcript_id "gene-C7A06_RS33570"; Dbxref "Genbank:WP_001172748.1"; ID "nbis-exon-5934"; Name "WP_001172748.1"; Ontology_term "GO:0022900" "GO:0005506" "GO:0009055" "GO:0020037" "GO:0042597"; Parent "gene-C7A06_RS33570"; gbkey "CDS"; go_component "periplasmic space|0042597||IEA"; go_function "iron ion binding|0005506||IEA" "electron transfer activity|0009055||IEA" "heme binding|0020037||IEA"; go_process "electron transport chain|0022900||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_016242783.1"; locus_tag "C7A06_RS33570"; product "cytochrome b562"; protein_id "WP_001172748.1"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 29145 29534 . - 0 gene_id "nbis-gene-5672"; transcript_id "gene-C7A06_RS33570"; Dbxref "Genbank:WP_001172748.1"; ID "cds-WP_001172748.1"; Name "WP_001172748.1"; Ontology_term "GO:0022900" "GO:0005506" "GO:0009055" "GO:0020037" "GO:0042597"; Parent "gene-C7A06_RS33570"; gbkey "CDS"; go_component "periplasmic space|0042597||IEA"; go_function "iron ion binding|0005506||IEA" "electron transfer activity|0009055||IEA" "heme binding|0020037||IEA"; go_process "electron transport chain|0022900||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_016242783.1"; locus_tag "C7A06_RS33570"; product "cytochrome b562"; protein_id "WP_001172748.1"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 29578 31788 . - . gene_id "nbis-gene-5673"; ID "nbis-gene-5673"; Name "katP"; gbkey "Gene"; gene "katP"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33575"; +NZ_CP027601.1 RefSeq transcript 29578 31788 . - . gene_id "nbis-gene-5673"; transcript_id "gene-C7A06_RS33575"; ID "gene-C7A06_RS33575"; Name "katP"; Parent "nbis-gene-5673"; gbkey "Gene"; gene "katP"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33575"; original_biotype "mrna"; +NZ_CP027601.1 Protein Homology exon 29578 31788 . - . gene_id "nbis-gene-5673"; transcript_id "gene-C7A06_RS33575"; Dbxref "Genbank:WP_000592771.1"; ID "nbis-exon-5935"; Name "WP_000592771.1"; Parent "gene-C7A06_RS33575"; gbkey "CDS"; gene "katP"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000592771.1"; locus_tag "C7A06_RS33575"; product "catalase/peroxidase KatP"; protein_id "WP_000592771.1"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 29578 31788 . - 0 gene_id "nbis-gene-5673"; transcript_id "gene-C7A06_RS33575"; Dbxref "Genbank:WP_000592771.1"; ID "cds-WP_000592771.1"; Name "WP_000592771.1"; Parent "gene-C7A06_RS33575"; gbkey "CDS"; gene "katP"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000592771.1"; locus_tag "C7A06_RS33575"; product "catalase/peroxidase KatP"; protein_id "WP_000592771.1"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 31961 33174 . - . gene_id "nbis-gene-5674"; ID "nbis-gene-5674"; Name "C7A06_RS33585"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33585"; +NZ_CP027601.1 RefSeq transcript 31961 33174 . - . gene_id "nbis-gene-5674"; transcript_id "gene-C7A06_RS33585"; ID "gene-C7A06_RS33585"; Name "C7A06_RS33585"; Parent "nbis-gene-5674"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33585"; original_biotype "mrna"; +NZ_CP027601.1 Protein Homology exon 31961 33174 . - . gene_id "nbis-gene-5674"; transcript_id "gene-C7A06_RS33585"; Dbxref "Genbank:WP_162908515.1"; ID "nbis-exon-5936"; Name "WP_162908515.1"; Note "programmed frameshift"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS33585"; exception "ribosomal slippage"; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_086558238.1"; locus_tag "C7A06_RS33585"; product "IS3 family transposase"; protein_id "WP_162908515.1"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 31961 33174 . - 2 gene_id "nbis-gene-5674"; transcript_id "gene-C7A06_RS33585"; Dbxref "Genbank:WP_162908515.1"; ID "cds-WP_162908515.1"; Name "WP_162908515.1"; Note "programmed frameshift"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS33585"; exception "ribosomal slippage"; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_086558238.1"; locus_tag "C7A06_RS33585"; product "IS3 family transposase"; protein_id "WP_162908515.1"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 33980 34957 . + . gene_id "nbis-gene-5675"; ID "nbis-gene-5675"; Name "C7A06_RS33590"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33590"; +NZ_CP027601.1 RefSeq transcript 33980 34957 . + . gene_id "nbis-gene-5675"; transcript_id "gene-C7A06_RS33590"; ID "gene-C7A06_RS33590"; Name "C7A06_RS33590"; Parent "nbis-gene-5675"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33590"; original_biotype "mrna"; +NZ_CP027601.1 Protein Homology exon 33980 34957 . + . gene_id "nbis-gene-5675"; transcript_id "gene-C7A06_RS33590"; Dbxref "Genbank:WP_000361610.1"; ID "nbis-exon-5937"; Name "WP_000361610.1"; Ontology_term "GO:0006270" "GO:0003887"; Parent "gene-C7A06_RS33590"; gbkey "CDS"; go_function "DNA-directed DNA polymerase activity|0003887||IEA"; go_process "DNA replication initiation|0006270||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_052630.2"; locus_tag "C7A06_RS33590"; product "RepB family plasmid replication initiator protein"; protein_id "WP_000361610.1"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 33980 34957 . + 0 gene_id "nbis-gene-5675"; transcript_id "gene-C7A06_RS33590"; Dbxref "Genbank:WP_000361610.1"; ID "cds-WP_000361610.1"; Name "WP_000361610.1"; Ontology_term "GO:0006270" "GO:0003887"; Parent "gene-C7A06_RS33590"; gbkey "CDS"; go_function "DNA-directed DNA polymerase activity|0003887||IEA"; go_process "DNA replication initiation|0006270||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_052630.2"; locus_tag "C7A06_RS33590"; product "RepB family plasmid replication initiator protein"; protein_id "WP_000361610.1"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 35141 35347 . + . gene_id "nbis-gene-5676"; ID "nbis-gene-5676"; Name "C7A06_RS33595"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33595"; +NZ_CP027601.1 RefSeq transcript 35141 35347 . + . gene_id "nbis-gene-5676"; transcript_id "gene-C7A06_RS33595"; ID "gene-C7A06_RS33595"; Name "C7A06_RS33595"; Parent "nbis-gene-5676"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33595"; original_biotype "mrna"; +NZ_CP027601.1 Protein Homology exon 35141 35347 . + . gene_id "nbis-gene-5676"; transcript_id "gene-C7A06_RS33595"; Dbxref "Genbank:WP_012917682.1"; ID "nbis-exon-5938"; Name "WP_012917682.1"; Parent "gene-C7A06_RS33595"; gbkey "CDS"; inference "COORDINATES: protein motif:HMM:NF013677.2"; locus_tag "C7A06_RS33595"; product "transposase"; protein_id "WP_012917682.1"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 35141 35347 . + 0 gene_id "nbis-gene-5676"; transcript_id "gene-C7A06_RS33595"; Dbxref "Genbank:WP_012917682.1"; ID "cds-WP_012917682.1"; Name "WP_012917682.1"; Parent "gene-C7A06_RS33595"; gbkey "CDS"; inference "COORDINATES: protein motif:HMM:NF013677.2"; locus_tag "C7A06_RS33595"; product "transposase"; protein_id "WP_012917682.1"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 35401 36075 . + . gene_id "nbis-gene-5677"; ID "nbis-gene-5677"; Name "tnpA"; gbkey "Gene"; gene "tnpA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33600"; +NZ_CP027601.1 RefSeq transcript 35401 36075 . + . gene_id "nbis-gene-5677"; transcript_id "gene-C7A06_RS33600"; ID "gene-C7A06_RS33600"; Name "tnpA"; Parent "nbis-gene-5677"; gbkey "Gene"; gene "tnpA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33600"; original_biotype "mrna"; +NZ_CP027601.1 Protein Homology exon 35401 36075 . + . gene_id "nbis-gene-5677"; transcript_id "gene-C7A06_RS33600"; Dbxref "Genbank:WP_001341423.1"; ID "nbis-exon-5939"; Name "WP_001341423.1"; Ontology_term "GO:0006313" "GO:0003677" "GO:0004803"; Parent "gene-C7A06_RS33600"; gbkey "CDS"; gene "tnpA"; go_function "DNA binding|0003677||IEA" "transposase activity|0004803||IEA"; go_process "transposition, DNA-mediated|0006313||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_311873.1"; locus_tag "C7A06_RS33600"; product "IS66-like element accessory protein TnpA"; protein_id "WP_001341423.1"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 35401 36075 . + 0 gene_id "nbis-gene-5677"; transcript_id "gene-C7A06_RS33600"; Dbxref "Genbank:WP_001341423.1"; ID "cds-WP_001341423.1-2"; Name "WP_001341423.1"; Ontology_term "GO:0006313" "GO:0003677" "GO:0004803"; Parent "gene-C7A06_RS33600"; gbkey "CDS"; gene "tnpA"; go_function "DNA binding|0003677||IEA" "transposase activity|0004803||IEA"; go_process "transposition, DNA-mediated|0006313||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_311873.1"; locus_tag "C7A06_RS33600"; product "IS66-like element accessory protein TnpA"; protein_id "WP_001341423.1"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 36072 36419 . + . gene_id "nbis-gene-5678"; ID "nbis-gene-5678"; Name "tnpB"; gbkey "Gene"; gene "tnpB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33605"; +NZ_CP027601.1 RefSeq transcript 36072 36419 . + . gene_id "nbis-gene-5678"; transcript_id "gene-C7A06_RS33605"; ID "gene-C7A06_RS33605"; Name "tnpB"; Parent "nbis-gene-5678"; gbkey "Gene"; gene "tnpB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33605"; original_biotype "mrna"; +NZ_CP027601.1 Protein Homology exon 36072 36419 . + . gene_id "nbis-gene-5678"; transcript_id "gene-C7A06_RS33605"; Dbxref "Genbank:WP_000631725.1"; ID "nbis-exon-5940"; Name "WP_000631725.1"; Note "TnpB, as the term is used for proteins encoded by IS66 family insertion elements, is considered an accessory protein, since TnpC, encoded by a neighboring gene, is a DDE family transposase."; Parent "gene-C7A06_RS33605"; gbkey "CDS"; gene "tnpB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_858152.1"; locus_tag "C7A06_RS33605"; product "IS66 family insertion sequence element accessory protein TnpB"; protein_id "WP_000631725.1"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 36072 36419 . + 0 gene_id "nbis-gene-5678"; transcript_id "gene-C7A06_RS33605"; Dbxref "Genbank:WP_000631725.1"; ID "cds-WP_000631725.1-2"; Name "WP_000631725.1"; Note "TnpB, as the term is used for proteins encoded by IS66 family insertion elements, is considered an accessory protein, since TnpC, encoded by a neighboring gene, is a DDE family transposase."; Parent "gene-C7A06_RS33605"; gbkey "CDS"; gene "tnpB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_858152.1"; locus_tag "C7A06_RS33605"; product "IS66 family insertion sequence element accessory protein TnpB"; protein_id "WP_000631725.1"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 36439 37991 . + . gene_id "nbis-pseudogene-262"; ID "nbis-pseudogene-262"; Name "C7A06_RS33610"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33610"; original_biotype "pseudogene"; pseudo "true"; +NZ_CP027601.1 RefSeq transcript 36439 37991 . + . gene_id "nbis-pseudogene-262"; transcript_id "gene-C7A06_RS33610"; ID "gene-C7A06_RS33610"; Name "C7A06_RS33610"; Parent "nbis-pseudogene-262"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33610"; original_biotype "mrna"; pseudo "true"; +NZ_CP027601.1 Protein Homology exon 36439 37991 . + . gene_id "nbis-pseudogene-262"; transcript_id "gene-C7A06_RS33610"; ID "nbis-exon-5941"; Note "frameshifted"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS33610"; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001066419.1"; locus_tag "C7A06_RS33610"; product "IS66 family transposase"; pseudo "true"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 36439 37991 . + 0 gene_id "nbis-pseudogene-262"; transcript_id "gene-C7A06_RS33610"; ID "cds-C7A06_RS33610"; Note "frameshifted"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS33610"; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001066419.1"; locus_tag "C7A06_RS33610"; product "IS66 family transposase"; pseudo "true"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 38025 38414 . + . gene_id "nbis-pseudogene-263"; ID "nbis-pseudogene-263"; Name "C7A06_RS33615"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33615"; original_biotype "pseudogene"; partial "true"; pseudo "true"; start_range "." "38025"; +NZ_CP027601.1 RefSeq transcript 38025 38414 . + . gene_id "nbis-pseudogene-263"; transcript_id "gene-C7A06_RS33615"; ID "gene-C7A06_RS33615"; Name "C7A06_RS33615"; Parent "nbis-pseudogene-263"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33615"; original_biotype "mrna"; partial "true"; pseudo "true"; start_range "." "38025"; +NZ_CP027601.1 Protein Homology exon 38025 38414 . + . gene_id "nbis-pseudogene-263"; transcript_id "gene-C7A06_RS33615"; ID "nbis-exon-5942"; Note "incomplete; partial in the middle of a contig; missing N-terminus"; Parent "gene-C7A06_RS33615"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_052628.1"; locus_tag "C7A06_RS33615"; partial "true"; product "site-specific integrase"; pseudo "true"; start_range "." "38025"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 38025 38414 . + 0 gene_id "nbis-pseudogene-263"; transcript_id "gene-C7A06_RS33615"; ID "cds-C7A06_RS33615"; Note "incomplete; partial in the middle of a contig; missing N-terminus"; Parent "gene-C7A06_RS33615"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_052628.1"; locus_tag "C7A06_RS33615"; partial "true"; product "site-specific integrase"; pseudo "true"; start_range "." "38025"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 38815 39180 . + . gene_id "nbis-gene-5679"; ID "nbis-gene-5679"; Name "C7A06_RS33625"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33625"; +NZ_CP027601.1 RefSeq transcript 38815 39180 . + . gene_id "nbis-gene-5679"; transcript_id "gene-C7A06_RS33625"; ID "gene-C7A06_RS33625"; Name "C7A06_RS33625"; Parent "nbis-gene-5679"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33625"; original_biotype "mrna"; +NZ_CP027601.1 GeneMarkS-2+ exon 38815 39180 . + . gene_id "nbis-gene-5679"; transcript_id "gene-C7A06_RS33625"; Dbxref "Genbank:WP_000091308.1"; ID "nbis-exon-5943"; Name "WP_000091308.1"; Parent "gene-C7A06_RS33625"; gbkey "CDS"; inference "COORDINATES: ab initio prediction:GeneMarkS-2+"; locus_tag "C7A06_RS33625"; product "hypothetical protein"; protein_id "WP_000091308.1"; transl_table "11"; +NZ_CP027601.1 GeneMarkS-2+ CDS 38815 39180 . + 0 gene_id "nbis-gene-5679"; transcript_id "gene-C7A06_RS33625"; Dbxref "Genbank:WP_000091308.1"; ID "cds-WP_000091308.1"; Name "WP_000091308.1"; Parent "gene-C7A06_RS33625"; gbkey "CDS"; inference "COORDINATES: ab initio prediction:GeneMarkS-2+"; locus_tag "C7A06_RS33625"; product "hypothetical protein"; protein_id "WP_000091308.1"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 39180 40367 . + . gene_id "nbis-gene-5680"; ID "nbis-gene-5680"; Name "C7A06_RS33630"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33630"; +NZ_CP027601.1 RefSeq transcript 39180 40367 . + . gene_id "nbis-gene-5680"; transcript_id "gene-C7A06_RS33630"; ID "gene-C7A06_RS33630"; Name "C7A06_RS33630"; Parent "nbis-gene-5680"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33630"; original_biotype "mrna"; +NZ_CP027601.1 Protein Homology exon 39180 40367 . + . gene_id "nbis-gene-5680"; transcript_id "gene-C7A06_RS33630"; Dbxref "Genbank:WP_000937603.1"; ID "nbis-exon-5944"; Name "WP_000937603.1"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS33630"; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_013747467.1"; locus_tag "C7A06_RS33630"; product "IS91 family transposase"; protein_id "WP_000937603.1"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 39180 40367 . + 0 gene_id "nbis-gene-5680"; transcript_id "gene-C7A06_RS33630"; Dbxref "Genbank:WP_000937603.1"; ID "cds-WP_000937603.1"; Name "WP_000937603.1"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS33630"; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_013747467.1"; locus_tag "C7A06_RS33630"; product "IS91 family transposase"; protein_id "WP_000937603.1"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 40646 42198 . - . gene_id "nbis-pseudogene-264"; ID "nbis-pseudogene-264"; Name "C7A06_RS33635"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33635"; original_biotype "pseudogene"; pseudo "true"; +NZ_CP027601.1 RefSeq transcript 40646 42198 . - . gene_id "nbis-pseudogene-264"; transcript_id "gene-C7A06_RS33635"; ID "gene-C7A06_RS33635"; Name "C7A06_RS33635"; Parent "nbis-pseudogene-264"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33635"; original_biotype "mrna"; pseudo "true"; +NZ_CP027601.1 Protein Homology exon 40646 42198 . - . gene_id "nbis-pseudogene-264"; transcript_id "gene-C7A06_RS33635"; ID "nbis-exon-5945"; Note "frameshifted"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS33635"; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001066419.1"; locus_tag "C7A06_RS33635"; product "IS66 family transposase"; pseudo "true"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 40646 42198 . - 0 gene_id "nbis-pseudogene-264"; transcript_id "gene-C7A06_RS33635"; ID "cds-C7A06_RS33635"; Note "frameshifted"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS33635"; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001066419.1"; locus_tag "C7A06_RS33635"; product "IS66 family transposase"; pseudo "true"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 42218 42565 . - . gene_id "nbis-gene-5681"; ID "nbis-gene-5681"; Name "tnpB"; gbkey "Gene"; gene "tnpB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33640"; +NZ_CP027601.1 RefSeq transcript 42218 42565 . - . gene_id "nbis-gene-5681"; transcript_id "gene-C7A06_RS33640"; ID "gene-C7A06_RS33640"; Name "tnpB"; Parent "nbis-gene-5681"; gbkey "Gene"; gene "tnpB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33640"; original_biotype "mrna"; +NZ_CP027601.1 Protein Homology exon 42218 42565 . - . gene_id "nbis-gene-5681"; transcript_id "gene-C7A06_RS33640"; Dbxref "Genbank:WP_000631725.1"; ID "nbis-exon-5946"; Name "WP_000631725.1"; Note "TnpB, as the term is used for proteins encoded by IS66 family insertion elements, is considered an accessory protein, since TnpC, encoded by a neighboring gene, is a DDE family transposase."; Parent "gene-C7A06_RS33640"; gbkey "CDS"; gene "tnpB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_858152.1"; locus_tag "C7A06_RS33640"; product "IS66 family insertion sequence element accessory protein TnpB"; protein_id "WP_000631725.1"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 42218 42565 . - 0 gene_id "nbis-gene-5681"; transcript_id "gene-C7A06_RS33640"; Dbxref "Genbank:WP_000631725.1"; ID "cds-WP_000631725.1-3"; Name "WP_000631725.1"; Note "TnpB, as the term is used for proteins encoded by IS66 family insertion elements, is considered an accessory protein, since TnpC, encoded by a neighboring gene, is a DDE family transposase."; Parent "gene-C7A06_RS33640"; gbkey "CDS"; gene "tnpB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_858152.1"; locus_tag "C7A06_RS33640"; product "IS66 family insertion sequence element accessory protein TnpB"; protein_id "WP_000631725.1"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 42562 43236 . - . gene_id "nbis-gene-5682"; ID "nbis-gene-5682"; Name "tnpA"; gbkey "Gene"; gene "tnpA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33645"; +NZ_CP027601.1 RefSeq transcript 42562 43236 . - . gene_id "nbis-gene-5682"; transcript_id "gene-C7A06_RS33645"; ID "gene-C7A06_RS33645"; Name "tnpA"; Parent "nbis-gene-5682"; gbkey "Gene"; gene "tnpA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33645"; original_biotype "mrna"; +NZ_CP027601.1 Protein Homology exon 42562 43236 . - . gene_id "nbis-gene-5682"; transcript_id "gene-C7A06_RS33645"; Dbxref "Genbank:WP_001341423.1"; ID "nbis-exon-5947"; Name "WP_001341423.1"; Ontology_term "GO:0006313" "GO:0003677" "GO:0004803"; Parent "gene-C7A06_RS33645"; gbkey "CDS"; gene "tnpA"; go_function "DNA binding|0003677||IEA" "transposase activity|0004803||IEA"; go_process "transposition, DNA-mediated|0006313||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_311873.1"; locus_tag "C7A06_RS33645"; product "IS66-like element accessory protein TnpA"; protein_id "WP_001341423.1"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 42562 43236 . - 0 gene_id "nbis-gene-5682"; transcript_id "gene-C7A06_RS33645"; Dbxref "Genbank:WP_001341423.1"; ID "cds-WP_001341423.1-3"; Name "WP_001341423.1"; Ontology_term "GO:0006313" "GO:0003677" "GO:0004803"; Parent "gene-C7A06_RS33645"; gbkey "CDS"; gene "tnpA"; go_function "DNA binding|0003677||IEA" "transposase activity|0004803||IEA"; go_process "transposition, DNA-mediated|0006313||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_311873.1"; locus_tag "C7A06_RS33645"; product "IS66-like element accessory protein TnpA"; protein_id "WP_001341423.1"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 43320 43676 . - . gene_id "nbis-pseudogene-265"; ID "nbis-pseudogene-265"; Name "C7A06_RS33650"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33650"; original_biotype "pseudogene"; partial "true"; pseudo "true"; start_range "." "43320"; +NZ_CP027601.1 RefSeq transcript 43320 43676 . - . gene_id "nbis-pseudogene-265"; transcript_id "gene-C7A06_RS33650"; ID "gene-C7A06_RS33650"; Name "C7A06_RS33650"; Parent "nbis-pseudogene-265"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33650"; original_biotype "mrna"; partial "true"; pseudo "true"; start_range "." "43320"; +NZ_CP027601.1 Protein Homology exon 43320 43676 . - . gene_id "nbis-pseudogene-265"; transcript_id "gene-C7A06_RS33650"; ID "nbis-exon-5948"; Note "incomplete; partial in the middle of a contig; missing C-terminus"; Ontology_term "GO:0006310" "GO:0015074" "GO:0003677"; Parent "gene-C7A06_RS33650"; gbkey "CDS"; go_function "DNA binding|0003677||IEA"; go_process "DNA recombination|0006310||IEA" "DNA integration|0015074||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_052628.1"; locus_tag "C7A06_RS33650"; partial "true"; product "tyrosine-type recombinase/integrase"; pseudo "true"; start_range "." "43320"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 43320 43676 . - 0 gene_id "nbis-pseudogene-265"; transcript_id "gene-C7A06_RS33650"; ID "cds-C7A06_RS33650"; Note "incomplete; partial in the middle of a contig; missing C-terminus"; Ontology_term "GO:0006310" "GO:0015074" "GO:0003677"; Parent "gene-C7A06_RS33650"; gbkey "CDS"; go_function "DNA binding|0003677||IEA"; go_process "DNA recombination|0006310||IEA" "DNA integration|0015074||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_052628.1"; locus_tag "C7A06_RS33650"; partial "true"; product "tyrosine-type recombinase/integrase"; pseudo "true"; start_range "." "43320"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 43804 44664 . + . gene_id "nbis-gene-5683"; ID "nbis-gene-5683"; Name "C7A06_RS33655"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33655"; +NZ_CP027601.1 RefSeq transcript 43804 44664 . + . gene_id "nbis-gene-5683"; transcript_id "gene-C7A06_RS33655"; ID "gene-C7A06_RS33655"; Name "C7A06_RS33655"; Parent "nbis-gene-5683"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33655"; original_biotype "mrna"; +NZ_CP027601.1 Protein Homology exon 43804 44664 . + . gene_id "nbis-gene-5683"; transcript_id "gene-C7A06_RS33655"; Dbxref "Genbank:WP_000704534.1"; ID "nbis-exon-5949"; Name "WP_000704534.1"; Parent "gene-C7A06_RS33655"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_052670.1"; locus_tag "C7A06_RS33655"; product "alpha/beta hydrolase"; protein_id "WP_000704534.1"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 43804 44664 . + 0 gene_id "nbis-gene-5683"; transcript_id "gene-C7A06_RS33655"; Dbxref "Genbank:WP_000704534.1"; ID "cds-WP_000704534.1"; Name "WP_000704534.1"; Parent "gene-C7A06_RS33655"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_052670.1"; locus_tag "C7A06_RS33655"; product "alpha/beta hydrolase"; protein_id "WP_000704534.1"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 45279 45428 . + . gene_id "nbis-gene-5806"; ID "nbis-gene-5806"; Name "C7A06_RS34665"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS34665"; +NZ_CP027601.1 RefSeq transcript 45279 45428 . + . gene_id "nbis-gene-5806"; transcript_id "gene-C7A06_RS34665"; ID "gene-C7A06_RS34665"; Name "C7A06_RS34665"; Parent "nbis-gene-5806"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS34665"; original_biotype "mrna"; +NZ_CP027601.1 GeneMarkS-2+ exon 45279 45428 . + . gene_id "nbis-gene-5806"; transcript_id "gene-C7A06_RS34665"; Dbxref "Genbank:WP_000955366.1"; ID "nbis-exon-6115"; Name "WP_000955366.1"; Parent "gene-C7A06_RS34665"; gbkey "CDS"; inference "COORDINATES: ab initio prediction:GeneMarkS-2+"; locus_tag "C7A06_RS34665"; product "hypothetical protein"; protein_id "WP_000955366.1"; transl_table "11"; +NZ_CP027601.1 GeneMarkS-2+ CDS 45279 45428 . + 0 gene_id "nbis-gene-5806"; transcript_id "gene-C7A06_RS34665"; Dbxref "Genbank:WP_000955366.1"; ID "cds-WP_000955366.1"; Name "WP_000955366.1"; Parent "gene-C7A06_RS34665"; gbkey "CDS"; inference "COORDINATES: ab initio prediction:GeneMarkS-2+"; locus_tag "C7A06_RS34665"; product "hypothetical protein"; protein_id "WP_000955366.1"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 45469 46625 . - . gene_id "nbis-gene-5684"; ID "nbis-gene-5684"; Name "C7A06_RS33660"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33660"; +NZ_CP027601.1 RefSeq transcript 45469 46625 . - . gene_id "nbis-gene-5684"; transcript_id "gene-C7A06_RS33660"; ID "gene-C7A06_RS33660"; Name "C7A06_RS33660"; Parent "nbis-gene-5684"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33660"; original_biotype "mrna"; +NZ_CP027601.1 Protein Homology exon 45469 46625 . - . gene_id "nbis-gene-5684"; transcript_id "gene-C7A06_RS33660"; Dbxref "Genbank:WP_085948186.1"; ID "nbis-exon-5950"; Name "WP_085948186.1"; Note "programmed frameshift"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS33660"; exception "ribosomal slippage"; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_076611998.1"; locus_tag "C7A06_RS33660"; product "IS3 family transposase"; protein_id "WP_085948186.1"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 45469 46625 . - 2 gene_id "nbis-gene-5684"; transcript_id "gene-C7A06_RS33660"; Dbxref "Genbank:WP_085948186.1"; ID "cds-WP_085948186.1-12"; Name "WP_085948186.1"; Note "programmed frameshift"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS33660"; exception "ribosomal slippage"; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_076611998.1"; locus_tag "C7A06_RS33660"; product "IS3 family transposase"; protein_id "WP_085948186.1"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 46693 47238 . + . gene_id "nbis-gene-5685"; ID "nbis-gene-5685"; Name "C7A06_RS33665"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33665"; +NZ_CP027601.1 RefSeq transcript 46693 47238 . + . gene_id "nbis-gene-5685"; transcript_id "gene-C7A06_RS33665"; ID "gene-C7A06_RS33665"; Name "C7A06_RS33665"; Parent "nbis-gene-5685"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33665"; original_biotype "mrna"; +NZ_CP027601.1 Protein Homology exon 46693 47238 . + . gene_id "nbis-gene-5685"; transcript_id "gene-C7A06_RS33665"; Dbxref "Genbank:WP_001165114.1"; ID "nbis-exon-5951"; Name "WP_001165114.1"; Parent "gene-C7A06_RS33665"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001165114.1"; locus_tag "C7A06_RS33665"; product "hypothetical protein"; protein_id "WP_001165114.1"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 46693 47238 . + 0 gene_id "nbis-gene-5685"; transcript_id "gene-C7A06_RS33665"; Dbxref "Genbank:WP_001165114.1"; ID "cds-WP_001165114.1"; Name "WP_001165114.1"; Parent "gene-C7A06_RS33665"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001165114.1"; locus_tag "C7A06_RS33665"; product "hypothetical protein"; protein_id "WP_001165114.1"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 47400 47816 . - . gene_id "nbis-gene-5686"; ID "nbis-gene-5686"; Name "C7A06_RS33670"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33670"; +NZ_CP027601.1 RefSeq transcript 47400 47816 . - . gene_id "nbis-gene-5686"; transcript_id "gene-C7A06_RS33670"; ID "gene-C7A06_RS33670"; Name "C7A06_RS33670"; Parent "nbis-gene-5686"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33670"; original_biotype "mrna"; +NZ_CP027601.1 Protein Homology exon 47400 47816 . - . gene_id "nbis-gene-5686"; transcript_id "gene-C7A06_RS33670"; Dbxref "Genbank:WP_001044768.1"; ID "nbis-exon-5952"; Name "WP_001044768.1"; Parent "gene-C7A06_RS33670"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_005229630.1"; locus_tag "C7A06_RS33670"; product "type II toxin-antitoxin system VapC family toxin"; protein_id "WP_001044768.1"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 47400 47816 . - 0 gene_id "nbis-gene-5686"; transcript_id "gene-C7A06_RS33670"; Dbxref "Genbank:WP_001044768.1"; ID "cds-WP_001044768.1"; Name "WP_001044768.1"; Parent "gene-C7A06_RS33670"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_005229630.1"; locus_tag "C7A06_RS33670"; product "type II toxin-antitoxin system VapC family toxin"; protein_id "WP_001044768.1"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 47813 48043 . - . gene_id "nbis-gene-5687"; ID "nbis-gene-5687"; Name "vapB"; gbkey "Gene"; gene "vapB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33675"; +NZ_CP027601.1 RefSeq transcript 47813 48043 . - . gene_id "nbis-gene-5687"; transcript_id "gene-C7A06_RS33675"; ID "gene-C7A06_RS33675"; Name "vapB"; Parent "nbis-gene-5687"; gbkey "Gene"; gene "vapB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33675"; original_biotype "mrna"; +NZ_CP027601.1 Protein Homology exon 47813 48043 . - . gene_id "nbis-gene-5687"; transcript_id "gene-C7A06_RS33675"; Dbxref "Genbank:WP_001261287.1"; ID "nbis-exon-5953"; Name "WP_001261287.1"; Parent "gene-C7A06_RS33675"; gbkey "CDS"; gene "vapB"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_005229629.1"; locus_tag "C7A06_RS33675"; product "type II toxin-antitoxin system VapB family antitoxin"; protein_id "WP_001261287.1"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 47813 48043 . - 0 gene_id "nbis-gene-5687"; transcript_id "gene-C7A06_RS33675"; Dbxref "Genbank:WP_001261287.1"; ID "cds-WP_001261287.1"; Name "WP_001261287.1"; Parent "gene-C7A06_RS33675"; gbkey "CDS"; gene "vapB"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_005229629.1"; locus_tag "C7A06_RS33675"; product "type II toxin-antitoxin system VapB family antitoxin"; protein_id "WP_001261287.1"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 48603 49016 . + . gene_id "nbis-gene-5688"; ID "nbis-gene-5688"; Name "C7A06_RS33695"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33695"; +NZ_CP027601.1 RefSeq transcript 48603 49016 . + . gene_id "nbis-gene-5688"; transcript_id "gene-C7A06_RS33695"; ID "gene-C7A06_RS33695"; Name "C7A06_RS33695"; Parent "nbis-gene-5688"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33695"; original_biotype "mrna"; +NZ_CP027601.1 Protein Homology exon 48603 49016 . + . gene_id "nbis-gene-5688"; transcript_id "gene-C7A06_RS33695"; Dbxref "Genbank:WP_000465041.1"; ID "nbis-exon-5954"; Name "WP_000465041.1"; Parent "gene-C7A06_RS33695"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001536595.1"; locus_tag "C7A06_RS33695"; product "hypothetical protein"; protein_id "WP_000465041.1"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 48603 49016 . + 0 gene_id "nbis-gene-5688"; transcript_id "gene-C7A06_RS33695"; Dbxref "Genbank:WP_000465041.1"; ID "cds-WP_000465041.1"; Name "WP_000465041.1"; Parent "gene-C7A06_RS33695"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001536595.1"; locus_tag "C7A06_RS33695"; product "hypothetical protein"; protein_id "WP_000465041.1"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 49018 49800 . + . gene_id "nbis-gene-5689"; ID "nbis-gene-5689"; Name "C7A06_RS33700"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33700"; +NZ_CP027601.1 RefSeq transcript 49018 49800 . + . gene_id "nbis-gene-5689"; transcript_id "gene-C7A06_RS33700"; ID "gene-C7A06_RS33700"; Name "C7A06_RS33700"; Parent "nbis-gene-5689"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33700"; original_biotype "mrna"; +NZ_CP027601.1 Protein Homology exon 49018 49800 . + . gene_id "nbis-gene-5689"; transcript_id "gene-C7A06_RS33700"; Dbxref "Genbank:WP_001164205.1"; ID "nbis-exon-5955"; Name "WP_001164205.1"; Parent "gene-C7A06_RS33700"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001164193.1"; locus_tag "C7A06_RS33700"; product "site-specific integrase"; protein_id "WP_001164205.1"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 49018 49800 . + 0 gene_id "nbis-gene-5689"; transcript_id "gene-C7A06_RS33700"; Dbxref "Genbank:WP_001164205.1"; ID "cds-WP_001164205.1"; Name "WP_001164205.1"; Parent "gene-C7A06_RS33700"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001164193.1"; locus_tag "C7A06_RS33700"; product "site-specific integrase"; protein_id "WP_001164205.1"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 49972 50325 . + . gene_id "nbis-gene-5690"; ID "nbis-gene-5690"; Name "cmi"; gbkey "Gene"; gene "cmi"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33705"; +NZ_CP027601.1 RefSeq transcript 49972 50325 . + . gene_id "nbis-gene-5690"; transcript_id "gene-C7A06_RS33705"; ID "gene-C7A06_RS33705"; Name "cmi"; Parent "nbis-gene-5690"; gbkey "Gene"; gene "cmi"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33705"; original_biotype "mrna"; +NZ_CP027601.1 Protein Homology exon 49972 50325 . + . gene_id "nbis-gene-5690"; transcript_id "gene-C7A06_RS33705"; Dbxref "Genbank:WP_000864810.1"; ID "nbis-exon-5956"; Name "WP_000864810.1"; Parent "gene-C7A06_RS33705"; gbkey "CDS"; gene "cmi"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_104216667.1"; locus_tag "C7A06_RS33705"; product "colicin M immunity protein"; protein_id "WP_000864810.1"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 49972 50325 . + 0 gene_id "nbis-gene-5690"; transcript_id "gene-C7A06_RS33705"; Dbxref "Genbank:WP_000864810.1"; ID "cds-WP_000864810.1"; Name "WP_000864810.1"; Parent "gene-C7A06_RS33705"; gbkey "CDS"; gene "cmi"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_104216667.1"; locus_tag "C7A06_RS33705"; product "colicin M immunity protein"; protein_id "WP_000864810.1"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 50333 50524 . - . gene_id "nbis-pseudogene-266"; ID "nbis-pseudogene-266"; Name "C7A06_RS33710"; end_range "50524" "."; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33710"; original_biotype "pseudogene"; partial "true"; pseudo "true"; +NZ_CP027601.1 RefSeq transcript 50333 50524 . - . gene_id "nbis-pseudogene-266"; transcript_id "gene-C7A06_RS33710"; ID "gene-C7A06_RS33710"; Name "C7A06_RS33710"; Parent "nbis-pseudogene-266"; end_range "50524" "."; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33710"; original_biotype "mrna"; partial "true"; pseudo "true"; +NZ_CP027601.1 Protein Homology exon 50333 50524 . - . gene_id "nbis-pseudogene-266"; transcript_id "gene-C7A06_RS33710"; ID "nbis-exon-5957"; Note "incomplete; partial in the middle of a contig; missing N-terminus"; Ontology_term "GO:0042742"; Parent "gene-C7A06_RS33710"; end_range "50524" "."; gbkey "CDS"; go_process "defense response to bacterium|0042742||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000449473.1"; locus_tag "C7A06_RS33710"; partial "true"; product "lipid II-degrading bacteriocin"; pseudo "true"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 50333 50524 . - 0 gene_id "nbis-pseudogene-266"; transcript_id "gene-C7A06_RS33710"; ID "cds-C7A06_RS33710"; Note "incomplete; partial in the middle of a contig; missing N-terminus"; Ontology_term "GO:0042742"; Parent "gene-C7A06_RS33710"; end_range "50524" "."; gbkey "CDS"; go_process "defense response to bacterium|0042742||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000449473.1"; locus_tag "C7A06_RS33710"; partial "true"; product "lipid II-degrading bacteriocin"; pseudo "true"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 50528 50671 . - . gene_id "nbis-pseudogene-267"; ID "nbis-pseudogene-267"; Name "C7A06_RS33715"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33715"; original_biotype "pseudogene"; partial "true"; pseudo "true"; start_range "." "50528"; +NZ_CP027601.1 RefSeq transcript 50528 50671 . - . gene_id "nbis-pseudogene-267"; transcript_id "gene-C7A06_RS33715"; ID "gene-C7A06_RS33715"; Name "C7A06_RS33715"; Parent "nbis-pseudogene-267"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33715"; original_biotype "mrna"; partial "true"; pseudo "true"; start_range "." "50528"; +NZ_CP027601.1 Protein Homology exon 50528 50671 . - . gene_id "nbis-pseudogene-267"; transcript_id "gene-C7A06_RS33715"; ID "nbis-exon-5958"; Note "incomplete; partial in the middle of a contig; missing C-terminus"; Parent "gene-C7A06_RS33715"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_958720.1"; locus_tag "C7A06_RS33715"; partial "true"; product "transcriptional regulator"; pseudo "true"; start_range "." "50528"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 50528 50671 . - 0 gene_id "nbis-pseudogene-267"; transcript_id "gene-C7A06_RS33715"; ID "cds-C7A06_RS33715"; Note "incomplete; partial in the middle of a contig; missing C-terminus"; Parent "gene-C7A06_RS33715"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_958720.1"; locus_tag "C7A06_RS33715"; partial "true"; product "transcriptional regulator"; pseudo "true"; start_range "." "50528"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 50738 52176 . - . gene_id "nbis-pseudogene-268"; ID "nbis-pseudogene-268"; Name "ehxD"; gbkey "Gene"; gene "ehxD"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33720"; original_biotype "pseudogene"; pseudo "true"; +NZ_CP027601.1 RefSeq transcript 50738 52176 . - . gene_id "nbis-pseudogene-268"; transcript_id "gene-C7A06_RS33720"; ID "gene-C7A06_RS33720"; Name "ehxD"; Parent "nbis-pseudogene-268"; gbkey "Gene"; gene "ehxD"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33720"; original_biotype "mrna"; pseudo "true"; +NZ_CP027601.1 Protein Homology exon 50738 52176 . - . gene_id "nbis-pseudogene-268"; transcript_id "gene-C7A06_RS33720"; ID "nbis-exon-5959"; Note "frameshifted"; Parent "gene-C7A06_RS33720"; gbkey "CDS"; gene "ehxD"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_052626.1"; locus_tag "C7A06_RS33720"; product "enterohemolysin T1SS ABC transporter subunit EhxD"; pseudo "true"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 50738 52176 . - 0 gene_id "nbis-pseudogene-268"; transcript_id "gene-C7A06_RS33720"; ID "cds-C7A06_RS33720"; Note "frameshifted"; Parent "gene-C7A06_RS33720"; gbkey "CDS"; gene "ehxD"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_052626.1"; locus_tag "C7A06_RS33720"; product "enterohemolysin T1SS ABC transporter subunit EhxD"; pseudo "true"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 52180 54300 . - . gene_id "nbis-gene-5691"; ID "nbis-gene-5691"; Name "ehxB"; gbkey "Gene"; gene "ehxB"; gene_biotype "protein_coding"; gene_synonym "hlyB"; locus_tag "C7A06_RS33725"; +NZ_CP027601.1 RefSeq transcript 52180 54300 . - . gene_id "nbis-gene-5691"; transcript_id "gene-C7A06_RS33725"; ID "gene-C7A06_RS33725"; Name "ehxB"; Parent "nbis-gene-5691"; gbkey "Gene"; gene "ehxB"; gene_biotype "protein_coding"; gene_synonym "hlyB"; locus_tag "C7A06_RS33725"; original_biotype "mrna"; +NZ_CP027601.1 Protein Homology exon 52180 54300 . - . gene_id "nbis-gene-5691"; transcript_id "gene-C7A06_RS33725"; Dbxref "Genbank:WP_000987096.1"; ID "nbis-exon-5960"; Name "WP_000987096.1"; Parent "gene-C7A06_RS33725"; gbkey "CDS"; gene "ehxB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_052625.1"; locus_tag "C7A06_RS33725"; product "enterohemolysin T1SS ABC transporter permease/ATPase EhxB"; protein_id "WP_000987096.1"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 52180 54300 . - 0 gene_id "nbis-gene-5691"; transcript_id "gene-C7A06_RS33725"; Dbxref "Genbank:WP_000987096.1"; ID "cds-WP_000987096.1"; Name "WP_000987096.1"; Parent "gene-C7A06_RS33725"; gbkey "CDS"; gene "ehxB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_052625.1"; locus_tag "C7A06_RS33725"; product "enterohemolysin T1SS ABC transporter permease/ATPase EhxB"; protein_id "WP_000987096.1"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 54350 57346 . - . gene_id "nbis-gene-5692"; ID "nbis-gene-5692"; Name "ehxA"; gbkey "Gene"; gene "ehxA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33730"; +NZ_CP027601.1 RefSeq transcript 54350 57346 . - . gene_id "nbis-gene-5692"; transcript_id "gene-C7A06_RS33730"; ID "gene-C7A06_RS33730"; Name "ehxA"; Parent "nbis-gene-5692"; gbkey "Gene"; gene "ehxA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33730"; original_biotype "mrna"; +NZ_CP027601.1 Protein Homology exon 54350 57346 . - . gene_id "nbis-gene-5692"; transcript_id "gene-C7A06_RS33730"; Dbxref "Genbank:WP_000217745.1"; ID "nbis-exon-5961"; Name "WP_000217745.1"; Parent "gene-C7A06_RS33730"; gbkey "CDS"; gene "ehxA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_052624.1"; locus_tag "C7A06_RS33730"; product "enterohemolysin EhxA"; protein_id "WP_000217745.1"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 54350 57346 . - 0 gene_id "nbis-gene-5692"; transcript_id "gene-C7A06_RS33730"; Dbxref "Genbank:WP_000217745.1"; ID "cds-WP_000217745.1"; Name "WP_000217745.1"; Parent "gene-C7A06_RS33730"; gbkey "CDS"; gene "ehxA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_052624.1"; locus_tag "C7A06_RS33730"; product "enterohemolysin EhxA"; protein_id "WP_000217745.1"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 57348 57862 . - . gene_id "nbis-pseudogene-269"; ID "nbis-pseudogene-269"; Name "ehxC"; gbkey "Gene"; gene "ehxC"; gene_biotype "pseudogene"; gene_synonym "hlyC"; locus_tag "C7A06_RS33735"; original_biotype "pseudogene"; pseudo "true"; +NZ_CP027601.1 RefSeq transcript 57348 57862 . - . gene_id "nbis-pseudogene-269"; transcript_id "gene-C7A06_RS33735"; ID "gene-C7A06_RS33735"; Name "ehxC"; Parent "nbis-pseudogene-269"; gbkey "Gene"; gene "ehxC"; gene_biotype "pseudogene"; gene_synonym "hlyC"; locus_tag "C7A06_RS33735"; original_biotype "mrna"; pseudo "true"; +NZ_CP027601.1 Protein Homology exon 57348 57862 . - . gene_id "nbis-pseudogene-269"; transcript_id "gene-C7A06_RS33735"; ID "nbis-exon-5962"; Note "frameshifted"; Parent "gene-C7A06_RS33735"; gbkey "CDS"; gene "ehxC"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000839950.1"; locus_tag "C7A06_RS33735"; product "enterohemolysin-activating lysine-acyltransferase EhxC"; pseudo "true"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 57348 57862 . - 0 gene_id "nbis-pseudogene-269"; transcript_id "gene-C7A06_RS33735"; ID "cds-C7A06_RS33735"; Note "frameshifted"; Parent "gene-C7A06_RS33735"; gbkey "CDS"; gene "ehxC"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000839950.1"; locus_tag "C7A06_RS33735"; product "enterohemolysin-activating lysine-acyltransferase EhxC"; pseudo "true"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 58385 59037 . - . gene_id "nbis-pseudogene-270"; ID "nbis-pseudogene-270"; Name "C7A06_RS33745"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33745"; original_biotype "pseudogene"; partial "true"; pseudo "true"; start_range "." "58385"; +NZ_CP027601.1 RefSeq transcript 58385 59037 . - . gene_id "nbis-pseudogene-270"; transcript_id "gene-C7A06_RS33745"; ID "gene-C7A06_RS33745"; Name "C7A06_RS33745"; Parent "nbis-pseudogene-270"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33745"; original_biotype "mrna"; partial "true"; pseudo "true"; start_range "." "58385"; +NZ_CP027601.1 Protein Homology exon 58385 59037 . - . gene_id "nbis-pseudogene-270"; transcript_id "gene-C7A06_RS33745"; ID "nbis-exon-5963"; Note "frameshifted; incomplete; partial in the middle of a contig; missing C-terminus"; Parent "gene-C7A06_RS33745"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_076612086.1"; locus_tag "C7A06_RS33745"; partial "true"; product "IS3 family transposase"; pseudo "true"; start_range "." "58385"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 58385 59037 . - 0 gene_id "nbis-pseudogene-270"; transcript_id "gene-C7A06_RS33745"; ID "cds-C7A06_RS33745"; Note "frameshifted; incomplete; partial in the middle of a contig; missing C-terminus"; Parent "gene-C7A06_RS33745"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_076612086.1"; locus_tag "C7A06_RS33745"; partial "true"; product "IS3 family transposase"; pseudo "true"; start_range "." "58385"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 60511 61332 . + . gene_id "nbis-gene-5693"; ID "nbis-gene-5693"; Name "C7A06_RS33755"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33755"; +NZ_CP027601.1 RefSeq transcript 60511 61332 . + . gene_id "nbis-gene-5693"; transcript_id "gene-C7A06_RS33755"; ID "gene-C7A06_RS33755"; Name "C7A06_RS33755"; Parent "nbis-gene-5693"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33755"; original_biotype "mrna"; +NZ_CP027601.1 Protein Homology exon 60511 61332 . + . gene_id "nbis-gene-5693"; transcript_id "gene-C7A06_RS33755"; Dbxref "Genbank:WP_001302199.1"; ID "nbis-exon-5964"; Name "WP_001302199.1"; Parent "gene-C7A06_RS33755"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001302199.1"; locus_tag "C7A06_RS33755"; product "polysaccharide deacetylase family protein"; protein_id "WP_001302199.1"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 60511 61332 . + 0 gene_id "nbis-gene-5693"; transcript_id "gene-C7A06_RS33755"; Dbxref "Genbank:WP_001302199.1"; ID "cds-WP_001302199.1"; Name "WP_001302199.1"; Parent "gene-C7A06_RS33755"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001302199.1"; locus_tag "C7A06_RS33755"; product "polysaccharide deacetylase family protein"; protein_id "WP_001302199.1"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 61332 62438 . + . gene_id "nbis-gene-5694"; ID "nbis-gene-5694"; Name "C7A06_RS33760"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33760"; +NZ_CP027601.1 RefSeq transcript 61332 62438 . + . gene_id "nbis-gene-5694"; transcript_id "gene-C7A06_RS33760"; ID "gene-C7A06_RS33760"; Name "C7A06_RS33760"; Parent "nbis-gene-5694"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33760"; original_biotype "mrna"; +NZ_CP027601.1 Protein Homology exon 61332 62438 . + . gene_id "nbis-gene-5694"; transcript_id "gene-C7A06_RS33760"; Dbxref "Genbank:WP_000975743.1"; ID "nbis-exon-5965"; Name "WP_000975743.1"; Parent "gene-C7A06_RS33760"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_052687.1"; locus_tag "C7A06_RS33760"; product "glycosyltransferase family 4 protein"; protein_id "WP_000975743.1"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 61332 62438 . + 0 gene_id "nbis-gene-5694"; transcript_id "gene-C7A06_RS33760"; Dbxref "Genbank:WP_000975743.1"; ID "cds-WP_000975743.1"; Name "WP_000975743.1"; Parent "gene-C7A06_RS33760"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_052687.1"; locus_tag "C7A06_RS33760"; product "glycosyltransferase family 4 protein"; protein_id "WP_000975743.1"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 62532 64253 . + . gene_id "nbis-gene-5695"; ID "nbis-gene-5695"; Name "cptA"; gbkey "Gene"; gene "cptA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33765"; +NZ_CP027601.1 RefSeq transcript 62532 64253 . + . gene_id "nbis-gene-5695"; transcript_id "gene-C7A06_RS33765"; ID "gene-C7A06_RS33765"; Name "cptA"; Parent "nbis-gene-5695"; gbkey "Gene"; gene "cptA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33765"; original_biotype "mrna"; +NZ_CP027601.1 Protein Homology exon 62532 64253 . + . gene_id "nbis-gene-5695"; transcript_id "gene-C7A06_RS33765"; Dbxref "Genbank:WP_000550559.1"; ID "nbis-exon-5966"; Name "WP_000550559.1"; Parent "gene-C7A06_RS33765"; gbkey "CDS"; gene "cptA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_052688.1"; locus_tag "C7A06_RS33765"; product "phosphoethanolamine transferase CptA"; protein_id "WP_000550559.1"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 62532 64253 . + 0 gene_id "nbis-gene-5695"; transcript_id "gene-C7A06_RS33765"; Dbxref "Genbank:WP_000550559.1"; ID "cds-WP_000550559.1"; Name "WP_000550559.1"; Parent "gene-C7A06_RS33765"; gbkey "CDS"; gene "cptA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_052688.1"; locus_tag "C7A06_RS33765"; product "phosphoethanolamine transferase CptA"; protein_id "WP_000550559.1"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 64327 65325 . + . gene_id "nbis-gene-5696"; ID "nbis-gene-5696"; Name "lpxM"; gbkey "Gene"; gene "lpxM"; gene_biotype "protein_coding"; gene_synonym "msbB"; locus_tag "C7A06_RS33770"; +NZ_CP027601.1 RefSeq transcript 64327 65325 . + . gene_id "nbis-gene-5696"; transcript_id "gene-C7A06_RS33770"; ID "gene-C7A06_RS33770"; Name "lpxM"; Parent "nbis-gene-5696"; gbkey "Gene"; gene "lpxM"; gene_biotype "protein_coding"; gene_synonym "msbB"; locus_tag "C7A06_RS33770"; original_biotype "mrna"; +NZ_CP027601.1 Protein Homology exon 64327 65325 . + . gene_id "nbis-gene-5696"; transcript_id "gene-C7A06_RS33770"; Dbxref "Genbank:WP_012680945.1"; ID "nbis-exon-5967"; Name "WP_012680945.1"; Note "LpxM is lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase, an enzyme characterized in Escherichia coli and involved in biosynthesis of the form of lipid A found in that species and some closely related species."; Ontology_term "GO:0009245" "GO:0016746"; Parent "gene-C7A06_RS33770"; gbkey "CDS"; gene "lpxM"; go_function "acyltransferase activity|0016746||IEA"; go_process "lipid A biosynthetic process|0009245||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_052689.1"; locus_tag "C7A06_RS33770"; product "lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase"; protein_id "WP_012680945.1"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 64327 65325 . + 0 gene_id "nbis-gene-5696"; transcript_id "gene-C7A06_RS33770"; Dbxref "Genbank:WP_012680945.1"; ID "cds-WP_012680945.1"; Name "WP_012680945.1"; Note "LpxM is lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase, an enzyme characterized in Escherichia coli and involved in biosynthesis of the form of lipid A found in that species and some closely related species."; Ontology_term "GO:0009245" "GO:0016746"; Parent "gene-C7A06_RS33770"; gbkey "CDS"; gene "lpxM"; go_function "acyltransferase activity|0016746||IEA"; go_process "lipid A biosynthetic process|0009245||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_052689.1"; locus_tag "C7A06_RS33770"; product "lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase"; protein_id "WP_012680945.1"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 65378 65566 . + . gene_id "nbis-pseudogene-271"; ID "nbis-pseudogene-271"; Name "C7A06_RS33775"; end_range "65566" "."; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33775"; original_biotype "pseudogene"; partial "true"; pseudo "true"; +NZ_CP027601.1 RefSeq transcript 65378 65566 . + . gene_id "nbis-pseudogene-271"; transcript_id "gene-C7A06_RS33775"; ID "gene-C7A06_RS33775"; Name "C7A06_RS33775"; Parent "nbis-pseudogene-271"; end_range "65566" "."; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33775"; original_biotype "mrna"; partial "true"; pseudo "true"; +NZ_CP027601.1 Protein Homology exon 65378 65566 . + . gene_id "nbis-pseudogene-271"; transcript_id "gene-C7A06_RS33775"; ID "nbis-exon-5968"; Note "internal stop; incomplete; partial in the middle of a contig; missing C-terminus"; Parent "gene-C7A06_RS33775"; end_range "65566" "."; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_012767718.1"; locus_tag "C7A06_RS33775"; partial "true"; product "hypothetical protein"; pseudo "true"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 65378 65566 . + 0 gene_id "nbis-pseudogene-271"; transcript_id "gene-C7A06_RS33775"; ID "cds-C7A06_RS33775"; Note "internal stop; incomplete; partial in the middle of a contig; missing C-terminus"; Parent "gene-C7A06_RS33775"; end_range "65566" "."; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_012767718.1"; locus_tag "C7A06_RS33775"; partial "true"; product "hypothetical protein"; pseudo "true"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 65629 67167 . - . gene_id "nbis-gene-5697"; ID "nbis-gene-5697"; Name "C7A06_RS33780"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33780"; +NZ_CP027601.1 RefSeq transcript 65629 67167 . - . gene_id "nbis-gene-5697"; transcript_id "gene-C7A06_RS33780"; ID "gene-C7A06_RS33780"; Name "C7A06_RS33780"; Parent "nbis-gene-5697"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33780"; original_biotype "mrna"; +NZ_CP027601.1 Protein Homology exon 65629 67167 . - . gene_id "nbis-gene-5697"; transcript_id "gene-C7A06_RS33780"; Dbxref "Genbank:WP_012917688.1"; ID "nbis-exon-5969"; Name "WP_012917688.1"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS33780"; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000998048.1"; locus_tag "C7A06_RS33780"; product "IS66 family transposase"; protein_id "WP_012917688.1"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 65629 67167 . - 0 gene_id "nbis-gene-5697"; transcript_id "gene-C7A06_RS33780"; Dbxref "Genbank:WP_012917688.1"; ID "cds-WP_012917688.1"; Name "WP_012917688.1"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS33780"; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000998048.1"; locus_tag "C7A06_RS33780"; product "IS66 family transposase"; protein_id "WP_012917688.1"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 67217 67564 . - . gene_id "nbis-gene-5698"; ID "nbis-gene-5698"; Name "tnpB"; gbkey "Gene"; gene "tnpB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33785"; +NZ_CP027601.1 RefSeq transcript 67217 67564 . - . gene_id "nbis-gene-5698"; transcript_id "gene-C7A06_RS33785"; ID "gene-C7A06_RS33785"; Name "tnpB"; Parent "nbis-gene-5698"; gbkey "Gene"; gene "tnpB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33785"; original_biotype "mrna"; +NZ_CP027601.1 Protein Homology exon 67217 67564 . - . gene_id "nbis-gene-5698"; transcript_id "gene-C7A06_RS33785"; Dbxref "Genbank:WP_000612591.1"; ID "nbis-exon-5970"; Name "WP_000612591.1"; Note "TnpB, as the term is used for proteins encoded by IS66 family insertion elements, is considered an accessory protein, since TnpC, encoded by a neighboring gene, is a DDE family transposase."; Parent "gene-C7A06_RS33785"; gbkey "CDS"; gene "tnpB"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_019104956.1"; locus_tag "C7A06_RS33785"; product "IS66 family insertion sequence element accessory protein TnpB"; protein_id "WP_000612591.1"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 67217 67564 . - 0 gene_id "nbis-gene-5698"; transcript_id "gene-C7A06_RS33785"; Dbxref "Genbank:WP_000612591.1"; ID "cds-WP_000612591.1-5"; Name "WP_000612591.1"; Note "TnpB, as the term is used for proteins encoded by IS66 family insertion elements, is considered an accessory protein, since TnpC, encoded by a neighboring gene, is a DDE family transposase."; Parent "gene-C7A06_RS33785"; gbkey "CDS"; gene "tnpB"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_019104956.1"; locus_tag "C7A06_RS33785"; product "IS66 family insertion sequence element accessory protein TnpB"; protein_id "WP_000612591.1"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 67801 68166 . + . gene_id "nbis-gene-5699"; ID "nbis-gene-5699"; Name "C7A06_RS33795"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33795"; +NZ_CP027601.1 RefSeq transcript 67801 68166 . + . gene_id "nbis-gene-5699"; transcript_id "gene-C7A06_RS33795"; ID "gene-C7A06_RS33795"; Name "C7A06_RS33795"; Parent "nbis-gene-5699"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33795"; original_biotype "mrna"; +NZ_CP027601.1 GeneMarkS-2+ exon 67801 68166 . + . gene_id "nbis-gene-5699"; transcript_id "gene-C7A06_RS33795"; Dbxref "Genbank:WP_000091308.1"; ID "nbis-exon-5971"; Name "WP_000091308.1"; Parent "gene-C7A06_RS33795"; gbkey "CDS"; inference "COORDINATES: ab initio prediction:GeneMarkS-2+"; locus_tag "C7A06_RS33795"; product "hypothetical protein"; protein_id "WP_000091308.1"; transl_table "11"; +NZ_CP027601.1 GeneMarkS-2+ CDS 67801 68166 . + 0 gene_id "nbis-gene-5699"; transcript_id "gene-C7A06_RS33795"; Dbxref "Genbank:WP_000091308.1"; ID "cds-WP_000091308.1-2"; Name "WP_000091308.1"; Parent "gene-C7A06_RS33795"; gbkey "CDS"; inference "COORDINATES: ab initio prediction:GeneMarkS-2+"; locus_tag "C7A06_RS33795"; product "hypothetical protein"; protein_id "WP_000091308.1"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 68166 69353 . + . gene_id "nbis-gene-5700"; ID "nbis-gene-5700"; Name "C7A06_RS33800"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33800"; +NZ_CP027601.1 RefSeq transcript 68166 69353 . + . gene_id "nbis-gene-5700"; transcript_id "gene-C7A06_RS33800"; ID "gene-C7A06_RS33800"; Name "C7A06_RS33800"; Parent "nbis-gene-5700"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33800"; original_biotype "mrna"; +NZ_CP027601.1 Protein Homology exon 68166 69353 . + . gene_id "nbis-gene-5700"; transcript_id "gene-C7A06_RS33800"; Dbxref "Genbank:WP_000937603.1"; ID "nbis-exon-5972"; Name "WP_000937603.1"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS33800"; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_013747467.1"; locus_tag "C7A06_RS33800"; product "IS91 family transposase"; protein_id "WP_000937603.1"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 68166 69353 . + 0 gene_id "nbis-gene-5700"; transcript_id "gene-C7A06_RS33800"; Dbxref "Genbank:WP_000937603.1"; ID "cds-WP_000937603.1-2"; Name "WP_000937603.1"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS33800"; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_013747467.1"; locus_tag "C7A06_RS33800"; product "IS91 family transposase"; protein_id "WP_000937603.1"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 69944 70951 . + . gene_id "nbis-pseudogene-272"; ID "nbis-pseudogene-272"; Name "C7A06_RS33810"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33810"; original_biotype "pseudogene"; partial "true"; pseudo "true"; start_range "." "69944"; +NZ_CP027601.1 RefSeq transcript 69944 70951 . + . gene_id "nbis-pseudogene-272"; transcript_id "gene-C7A06_RS33810"; ID "gene-C7A06_RS33810"; Name "C7A06_RS33810"; Parent "nbis-pseudogene-272"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33810"; original_biotype "mrna"; partial "true"; pseudo "true"; start_range "." "69944"; +NZ_CP027601.1 Protein Homology exon 69944 70951 . + . gene_id "nbis-pseudogene-272"; transcript_id "gene-C7A06_RS33810"; ID "nbis-exon-5973"; Note "frameshifted; internal stop; incomplete; partial in the middle of a contig; missing N-terminus"; Ontology_term "GO:0006313" "GO:0003677" "GO:0004803"; Parent "gene-C7A06_RS33810"; gbkey "CDS"; go_function "DNA binding|0003677||IEA" "transposase activity|0004803||IEA"; go_process "transposition, DNA-mediated|0006313||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_013747467.1"; locus_tag "C7A06_RS33810"; partial "true"; product "transposase"; pseudo "true"; start_range "." "69944"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 69944 70951 . + 0 gene_id "nbis-pseudogene-272"; transcript_id "gene-C7A06_RS33810"; ID "cds-C7A06_RS33810"; Note "frameshifted; internal stop; incomplete; partial in the middle of a contig; missing N-terminus"; Ontology_term "GO:0006313" "GO:0003677" "GO:0004803"; Parent "gene-C7A06_RS33810"; gbkey "CDS"; go_function "DNA binding|0003677||IEA" "transposase activity|0004803||IEA"; go_process "transposition, DNA-mediated|0006313||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_013747467.1"; locus_tag "C7A06_RS33810"; partial "true"; product "transposase"; pseudo "true"; start_range "." "69944"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 71571 73080 . + . gene_id "nbis-pseudogene-273"; ID "nbis-pseudogene-273"; Name "C7A06_RS33815"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33815"; original_biotype "pseudogene"; pseudo "true"; +NZ_CP027601.1 RefSeq transcript 71571 73080 . + . gene_id "nbis-pseudogene-273"; transcript_id "gene-C7A06_RS33815"; ID "gene-C7A06_RS33815"; Name "C7A06_RS33815"; Parent "nbis-pseudogene-273"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33815"; original_biotype "mrna"; pseudo "true"; +NZ_CP027601.1 Protein Homology exon 71571 73080 . + . gene_id "nbis-pseudogene-273"; transcript_id "gene-C7A06_RS33815"; ID "nbis-exon-5974"; Note "frameshifted"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS33815"; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001368704.1"; locus_tag "C7A06_RS33815"; product "ISL3 family transposase"; pseudo "true"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 71571 73080 . + 0 gene_id "nbis-pseudogene-273"; transcript_id "gene-C7A06_RS33815"; ID "cds-C7A06_RS33815"; Note "frameshifted"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS33815"; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001368704.1"; locus_tag "C7A06_RS33815"; product "ISL3 family transposase"; pseudo "true"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 73131 73245 . - . gene_id "nbis-pseudogene-274"; ID "nbis-pseudogene-274"; Name "C7A06_RS33820"; end_range "73245" "."; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33820"; original_biotype "pseudogene"; partial "true"; pseudo "true"; start_range "." "73131"; +NZ_CP027601.1 RefSeq transcript 73131 73245 . - . gene_id "nbis-pseudogene-274"; transcript_id "gene-C7A06_RS33820"; ID "gene-C7A06_RS33820"; Name "C7A06_RS33820"; Parent "nbis-pseudogene-274"; end_range "73245" "."; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33820"; original_biotype "mrna"; partial "true"; pseudo "true"; start_range "." "73131"; +NZ_CP027601.1 Protein Homology exon 73131 73245 . - . gene_id "nbis-pseudogene-274"; transcript_id "gene-C7A06_RS33820"; ID "nbis-exon-5975"; Note "frameshifted; incomplete; partial in the middle of a contig; missing N-terminus and C-terminus"; Parent "gene-C7A06_RS33820"; end_range "73245" "."; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_012477168.1"; locus_tag "C7A06_RS33820"; partial "true"; product "IS3 family transposase"; pseudo "true"; start_range "." "73131"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 73131 73245 . - 0 gene_id "nbis-pseudogene-274"; transcript_id "gene-C7A06_RS33820"; ID "cds-C7A06_RS33820"; Note "frameshifted; incomplete; partial in the middle of a contig; missing N-terminus and C-terminus"; Parent "gene-C7A06_RS33820"; end_range "73245" "."; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_012477168.1"; locus_tag "C7A06_RS33820"; partial "true"; product "IS3 family transposase"; pseudo "true"; start_range "." "73131"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 73332 73808 . + . gene_id "nbis-gene-5701"; ID "nbis-gene-5701"; Name "C7A06_RS33825"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33825"; +NZ_CP027601.1 RefSeq transcript 73332 73808 . + . gene_id "nbis-gene-5701"; transcript_id "gene-C7A06_RS33825"; ID "gene-C7A06_RS33825"; Name "C7A06_RS33825"; Parent "nbis-gene-5701"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33825"; original_biotype "mrna"; +NZ_CP027601.1 Protein Homology exon 73332 73808 . + . gene_id "nbis-gene-5701"; transcript_id "gene-C7A06_RS33825"; Dbxref "Genbank:WP_000422675.1"; ID "nbis-exon-5976"; Name "WP_000422675.1"; Parent "gene-C7A06_RS33825"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000422669.1"; locus_tag "C7A06_RS33825"; product "transposase"; protein_id "WP_000422675.1"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 73332 73808 . + 0 gene_id "nbis-gene-5701"; transcript_id "gene-C7A06_RS33825"; Dbxref "Genbank:WP_000422675.1"; ID "cds-WP_000422675.1"; Name "WP_000422675.1"; Parent "gene-C7A06_RS33825"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000422669.1"; locus_tag "C7A06_RS33825"; product "transposase"; protein_id "WP_000422675.1"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 73789 74941 . + . gene_id "nbis-pseudogene-275"; ID "nbis-pseudogene-275"; Name "C7A06_RS33830"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33830"; original_biotype "pseudogene"; pseudo "true"; +NZ_CP027601.1 RefSeq transcript 73789 74941 . + . gene_id "nbis-pseudogene-275"; transcript_id "gene-C7A06_RS33830"; ID "gene-C7A06_RS33830"; Name "C7A06_RS33830"; Parent "nbis-pseudogene-275"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33830"; original_biotype "mrna"; pseudo "true"; +NZ_CP027601.1 Protein Homology exon 73789 74941 . + . gene_id "nbis-pseudogene-275"; transcript_id "gene-C7A06_RS33830"; ID "nbis-exon-5977"; Note "frameshifted"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS33830"; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_076611553.1"; locus_tag "C7A06_RS33830"; product "IS3 family transposase"; pseudo "true"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 73789 74941 . + 0 gene_id "nbis-pseudogene-275"; transcript_id "gene-C7A06_RS33830"; ID "cds-C7A06_RS33830"; Note "frameshifted"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS33830"; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_076611553.1"; locus_tag "C7A06_RS33830"; product "IS3 family transposase"; pseudo "true"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 75004 76453 . + . gene_id "nbis-pseudogene-276"; ID "nbis-pseudogene-276"; Name "C7A06_RS33835"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33835"; original_biotype "pseudogene"; pseudo "true"; +NZ_CP027601.1 RefSeq transcript 75004 76453 . + . gene_id "nbis-pseudogene-276"; transcript_id "gene-C7A06_RS33835"; ID "gene-C7A06_RS33835"; Name "C7A06_RS33835"; Parent "nbis-pseudogene-276"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33835"; original_biotype "mrna"; pseudo "true"; +NZ_CP027601.1 Protein Homology exon 75004 76453 . + . gene_id "nbis-pseudogene-276"; transcript_id "gene-C7A06_RS33835"; ID "nbis-exon-5978"; Note "frameshifted; internal stop"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS33835"; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000080164.1"; locus_tag "C7A06_RS33835"; product "IS66 family transposase"; pseudo "true"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 75004 76453 . + 0 gene_id "nbis-pseudogene-276"; transcript_id "gene-C7A06_RS33835"; ID "cds-C7A06_RS33835"; Note "frameshifted; internal stop"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS33835"; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000080164.1"; locus_tag "C7A06_RS33835"; product "IS66 family transposase"; pseudo "true"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 76520 77012 . - . gene_id "nbis-pseudogene-277"; ID "nbis-pseudogene-277"; Name "C7A06_RS33840"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33840"; original_biotype "pseudogene"; partial "true"; pseudo "true"; start_range "." "76520"; +NZ_CP027601.1 RefSeq transcript 76520 77012 . - . gene_id "nbis-pseudogene-277"; transcript_id "gene-C7A06_RS33840"; ID "gene-C7A06_RS33840"; Name "C7A06_RS33840"; Parent "nbis-pseudogene-277"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33840"; original_biotype "mrna"; partial "true"; pseudo "true"; start_range "." "76520"; +NZ_CP027601.1 Protein Homology exon 76520 77012 . - . gene_id "nbis-pseudogene-277"; transcript_id "gene-C7A06_RS33840"; ID "nbis-exon-5979"; Note "frameshifted; incomplete; partial in the middle of a contig; missing C-terminus"; Parent "gene-C7A06_RS33840"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_086558155.1"; locus_tag "C7A06_RS33840"; partial "true"; product "IS3 family transposase"; pseudo "true"; start_range "." "76520"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 76520 77012 . - 0 gene_id "nbis-pseudogene-277"; transcript_id "gene-C7A06_RS33840"; ID "cds-C7A06_RS33840"; Note "frameshifted; incomplete; partial in the middle of a contig; missing C-terminus"; Parent "gene-C7A06_RS33840"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_086558155.1"; locus_tag "C7A06_RS33840"; partial "true"; product "IS3 family transposase"; pseudo "true"; start_range "." "76520"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 76935 77165 . + . gene_id "nbis-gene-5702"; ID "nbis-gene-5702"; Name "C7A06_RS33845"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33845"; +NZ_CP027601.1 RefSeq transcript 76935 77165 . + . gene_id "nbis-gene-5702"; transcript_id "gene-C7A06_RS33845"; ID "gene-C7A06_RS33845"; Name "C7A06_RS33845"; Parent "nbis-gene-5702"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33845"; original_biotype "mrna"; +NZ_CP027601.1 Protein Homology exon 76935 77165 . + . gene_id "nbis-gene-5702"; transcript_id "gene-C7A06_RS33845"; Dbxref "Genbank:WP_001443774.1"; ID "nbis-exon-5980"; Name "WP_001443774.1"; Parent "gene-C7A06_RS33845"; gbkey "CDS"; inference "COORDINATES: protein motif:HMM:NF015365.2"; locus_tag "C7A06_RS33845"; product "IS1 family transposase"; protein_id "WP_001443774.1"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 76935 77165 . + 0 gene_id "nbis-gene-5702"; transcript_id "gene-C7A06_RS33845"; Dbxref "Genbank:WP_001443774.1"; ID "cds-WP_001443774.1"; Name "WP_001443774.1"; Parent "gene-C7A06_RS33845"; gbkey "CDS"; inference "COORDINATES: protein motif:HMM:NF015365.2"; locus_tag "C7A06_RS33845"; product "IS1 family transposase"; protein_id "WP_001443774.1"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 77280 86778 . + . gene_id "nbis-pseudogene-278"; ID "nbis-pseudogene-278"; Name "toxB"; gbkey "Gene"; gene "toxB"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33850"; original_biotype "pseudogene"; pseudo "true"; +NZ_CP027601.1 RefSeq transcript 77280 86778 . + . gene_id "nbis-pseudogene-278"; transcript_id "gene-C7A06_RS33850"; ID "gene-C7A06_RS33850"; Name "toxB"; Parent "nbis-pseudogene-278"; gbkey "Gene"; gene "toxB"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33850"; original_biotype "mrna"; pseudo "true"; +NZ_CP027601.1 Protein Homology exon 77280 86778 . + . gene_id "nbis-pseudogene-278"; transcript_id "gene-C7A06_RS33850"; ID "nbis-exon-5981"; Note "frameshifted"; Parent "gene-C7A06_RS33850"; gbkey "CDS"; gene "toxB"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000581688.1"; locus_tag "C7A06_RS33850"; product "toxin B"; pseudo "true"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 77280 86778 . + 0 gene_id "nbis-pseudogene-278"; transcript_id "gene-C7A06_RS33850"; ID "cds-C7A06_RS33850"; Note "frameshifted"; Parent "gene-C7A06_RS33850"; gbkey "CDS"; gene "toxB"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000581688.1"; locus_tag "C7A06_RS33850"; product "toxin B"; pseudo "true"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 87738 88769 . - . gene_id "nbis-gene-5703"; ID "nbis-gene-5703"; Name "C7A06_RS33865"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33865"; +NZ_CP027601.1 RefSeq transcript 87738 88769 . - . gene_id "nbis-gene-5703"; transcript_id "gene-C7A06_RS33865"; ID "gene-C7A06_RS33865"; Name "C7A06_RS33865"; Parent "nbis-gene-5703"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33865"; original_biotype "mrna"; +NZ_CP027601.1 Protein Homology exon 87738 88769 . - . gene_id "nbis-gene-5703"; transcript_id "gene-C7A06_RS33865"; Dbxref "Genbank:WP_000907857.1"; ID "nbis-exon-5982"; Name "WP_000907857.1"; Parent "gene-C7A06_RS33865"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000907860.1"; locus_tag "C7A06_RS33865"; product "replication initiation protein"; protein_id "WP_000907857.1"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 87738 88769 . - 0 gene_id "nbis-gene-5703"; transcript_id "gene-C7A06_RS33865"; Dbxref "Genbank:WP_000907857.1"; ID "cds-WP_000907857.1"; Name "WP_000907857.1"; Parent "gene-C7A06_RS33865"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000907860.1"; locus_tag "C7A06_RS33865"; product "replication initiation protein"; protein_id "WP_000907857.1"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 89478 90119 . + . gene_id "nbis-gene-5704"; ID "nbis-gene-5704"; Name "C7A06_RS33880"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33880"; +NZ_CP027601.1 RefSeq transcript 89478 90119 . + . gene_id "nbis-gene-5704"; transcript_id "gene-C7A06_RS33880"; ID "gene-C7A06_RS33880"; Name "C7A06_RS33880"; Parent "nbis-gene-5704"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33880"; original_biotype "mrna"; +NZ_CP027601.1 Protein Homology exon 89478 90119 . + . gene_id "nbis-gene-5704"; transcript_id "gene-C7A06_RS33880"; Dbxref "Genbank:WP_000335839.1"; ID "nbis-exon-5983"; Name "WP_000335839.1"; Parent "gene-C7A06_RS33880"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000335849.1"; locus_tag "C7A06_RS33880"; product "transcription termination factor NusG"; protein_id "WP_000335839.1"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 89478 90119 . + 0 gene_id "nbis-gene-5704"; transcript_id "gene-C7A06_RS33880"; Dbxref "Genbank:WP_000335839.1"; ID "cds-WP_000335839.1"; Name "WP_000335839.1"; Parent "gene-C7A06_RS33880"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000335849.1"; locus_tag "C7A06_RS33880"; product "transcription termination factor NusG"; protein_id "WP_000335839.1"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 90260 90925 . + . gene_id "nbis-gene-5705"; ID "nbis-gene-5705"; Name "C7A06_RS33885"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33885"; +NZ_CP027601.1 RefSeq transcript 90260 90925 . + . gene_id "nbis-gene-5705"; transcript_id "gene-C7A06_RS33885"; ID "gene-C7A06_RS33885"; Name "C7A06_RS33885"; Parent "nbis-gene-5705"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33885"; original_biotype "mrna"; +NZ_CP027601.1 Protein Homology exon 90260 90925 . + . gene_id "nbis-gene-5705"; transcript_id "gene-C7A06_RS33885"; Dbxref "Genbank:WP_000154135.1"; ID "nbis-exon-5984"; Name "WP_000154135.1"; Parent "gene-C7A06_RS33885"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000154135.1"; locus_tag "C7A06_RS33885"; product "hypothetical protein"; protein_id "WP_000154135.1"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 90260 90925 . + 0 gene_id "nbis-gene-5705"; transcript_id "gene-C7A06_RS33885"; Dbxref "Genbank:WP_000154135.1"; ID "cds-WP_000154135.1"; Name "WP_000154135.1"; Parent "gene-C7A06_RS33885"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000154135.1"; locus_tag "C7A06_RS33885"; product "hypothetical protein"; protein_id "WP_000154135.1"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 91191 91579 . + . gene_id "nbis-pseudogene-279"; ID "nbis-pseudogene-279"; Name "C7A06_RS33895"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33895"; original_biotype "pseudogene"; pseudo "true"; +NZ_CP027601.1 RefSeq transcript 91191 91579 . + . gene_id "nbis-pseudogene-279"; transcript_id "gene-C7A06_RS33895"; ID "gene-C7A06_RS33895"; Name "C7A06_RS33895"; Parent "nbis-pseudogene-279"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33895"; original_biotype "mrna"; pseudo "true"; +NZ_CP027601.1 Protein Homology exon 91191 91579 . + . gene_id "nbis-pseudogene-279"; transcript_id "gene-C7A06_RS33895"; ID "nbis-exon-5985"; Note "frameshifted"; Parent "gene-C7A06_RS33895"; gbkey "CDS"; inference "COORDINATES: protein motif:HMM:NF018941.2"; locus_tag "C7A06_RS33895"; product "YqiJ family protein"; pseudo "true"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 91191 91579 . + 0 gene_id "nbis-pseudogene-279"; transcript_id "gene-C7A06_RS33895"; ID "cds-C7A06_RS33895"; Note "frameshifted"; Parent "gene-C7A06_RS33895"; gbkey "CDS"; inference "COORDINATES: protein motif:HMM:NF018941.2"; locus_tag "C7A06_RS33895"; product "YqiJ family protein"; pseudo "true"; transl_table "11"; +NZ_CP027601.1 RefSeq gene 91582 92590 . - . gene_id "nbis-pseudogene-280"; ID "nbis-pseudogene-280"; Name "C7A06_RS33900"; end_range "92590" "."; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33900"; original_biotype "pseudogene"; partial "true"; pseudo "true"; +NZ_CP027601.1 RefSeq transcript 91582 92590 . - . gene_id "nbis-pseudogene-280"; transcript_id "gene-C7A06_RS33900"; ID "gene-C7A06_RS33900"; Name "C7A06_RS33900"; Parent "nbis-pseudogene-280"; end_range "92590" "."; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33900"; original_biotype "mrna"; partial "true"; pseudo "true"; +NZ_CP027601.1 Protein Homology exon 91582 92590 . - . gene_id "nbis-pseudogene-280"; transcript_id "gene-C7A06_RS33900"; ID "nbis-exon-5986"; Note "frameshifted; incomplete; missing N-terminus"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS33900"; end_range "92590" "."; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001066419.1"; locus_tag "C7A06_RS33900"; partial "true"; product "IS66 family transposase"; pseudo "true"; transl_table "11"; +NZ_CP027601.1 Protein Homology CDS 91582 92590 . - 2 gene_id "nbis-pseudogene-280"; transcript_id "gene-C7A06_RS33900"; ID "cds-C7A06_RS33900"; Note "frameshifted; incomplete; missing N-terminus"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS33900"; end_range "92590" "."; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001066419.1"; locus_tag "C7A06_RS33900"; partial "true"; product "IS66 family transposase"; pseudo "true"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 1052 2152 . + . gene_id "nbis-gene-2"; ID "nbis-gene-2"; Name "dnaN"; gbkey "Gene"; gene "dnaN"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00010"; +NZ_CP027599.1 RefSeq transcript 1052 2152 . + . gene_id "nbis-gene-2"; transcript_id "gene-C7A06_RS00010"; ID "gene-C7A06_RS00010"; Name "dnaN"; Parent "nbis-gene-2"; gbkey "Gene"; gene "dnaN"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00010"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 1052 2152 . + . gene_id "nbis-gene-2"; transcript_id "gene-C7A06_RS00010"; Dbxref "Genbank:WP_000673464.1"; ID "nbis-exon-2"; Name "WP_000673464.1"; Ontology_term "GO:0006260" "GO:0003887" "GO:0009360"; Parent "gene-C7A06_RS00010"; gbkey "CDS"; gene "dnaN"; go_component "DNA polymerase III complex|0009360||IEA"; go_function "DNA-directed DNA polymerase activity|0003887||IEA"; go_process "DNA replication|0006260||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_006177590.1"; locus_tag "C7A06_RS00010"; product "DNA polymerase III subunit beta"; protein_id "WP_000673464.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 1052 2152 . + 0 gene_id "nbis-gene-2"; transcript_id "gene-C7A06_RS00010"; Dbxref "Genbank:WP_000673464.1"; ID "cds-WP_000673464.1"; Name "WP_000673464.1"; Ontology_term "GO:0006260" "GO:0003887" "GO:0009360"; Parent "gene-C7A06_RS00010"; gbkey "CDS"; gene "dnaN"; go_component "DNA polymerase III complex|0009360||IEA"; go_function "DNA-directed DNA polymerase activity|0003887||IEA"; go_process "DNA replication|0006260||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_006177590.1"; locus_tag "C7A06_RS00010"; product "DNA polymerase III subunit beta"; protein_id "WP_000673464.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 2152 3225 . + . gene_id "nbis-gene-3"; ID "nbis-gene-3"; Name "recF"; gbkey "Gene"; gene "recF"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00015"; +NZ_CP027599.1 RefSeq transcript 2152 3225 . + . gene_id "nbis-gene-3"; transcript_id "gene-C7A06_RS00015"; ID "gene-C7A06_RS00015"; Name "recF"; Parent "nbis-gene-3"; gbkey "Gene"; gene "recF"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00015"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 2152 3225 . + . gene_id "nbis-gene-3"; transcript_id "gene-C7A06_RS00015"; Dbxref "Genbank:WP_000060112.1"; ID "nbis-exon-3"; Name "WP_000060112.1"; Ontology_term "GO:0006281" "GO:0003697" "GO:0005524"; Parent "gene-C7A06_RS00015"; gbkey "CDS"; gene "recF"; go_function "single-stranded DNA binding|0003697||IEA" "ATP binding|0005524||IEA"; go_process "DNA repair|0006281||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_005121479.1"; locus_tag "C7A06_RS00015"; product "DNA replication/repair protein RecF"; protein_id "WP_000060112.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 2152 3225 . + 0 gene_id "nbis-gene-3"; transcript_id "gene-C7A06_RS00015"; Dbxref "Genbank:WP_000060112.1"; ID "cds-WP_000060112.1"; Name "WP_000060112.1"; Ontology_term "GO:0006281" "GO:0003697" "GO:0005524"; Parent "gene-C7A06_RS00015"; gbkey "CDS"; gene "recF"; go_function "single-stranded DNA binding|0003697||IEA" "ATP binding|0005524||IEA"; go_process "DNA repair|0006281||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_005121479.1"; locus_tag "C7A06_RS00015"; product "DNA replication/repair protein RecF"; protein_id "WP_000060112.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 3254 5668 . + . gene_id "nbis-gene-4"; ID "nbis-gene-4"; Name "gyrB"; gbkey "Gene"; gene "gyrB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00020"; +NZ_CP027599.1 RefSeq transcript 3254 5668 . + . gene_id "nbis-gene-4"; transcript_id "gene-C7A06_RS00020"; ID "gene-C7A06_RS00020"; Name "gyrB"; Parent "nbis-gene-4"; gbkey "Gene"; gene "gyrB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00020"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 3254 5668 . + . gene_id "nbis-gene-4"; transcript_id "gene-C7A06_RS00020"; Dbxref "Genbank:WP_000072067.1"; ID "nbis-exon-4"; Name "WP_000072067.1"; Ontology_term "GO:0006265" "GO:0003918" "GO:0009330"; Parent "gene-C7A06_RS00020"; gbkey "CDS"; gene "gyrB"; go_component "DNA topoisomerase type II (double strand cut, ATP-hydrolyzing) complex|0009330||IEA"; go_function "DNA topoisomerase type II (double strand cut, ATP-hydrolyzing) activity|0003918||IEA"; go_process "DNA topological change|0006265||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_005121480.1"; locus_tag "C7A06_RS00020"; product "DNA topoisomerase (ATP-hydrolyzing) subunit B"; protein_id "WP_000072067.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 3254 5668 . + 0 gene_id "nbis-gene-4"; transcript_id "gene-C7A06_RS00020"; Dbxref "Genbank:WP_000072067.1"; ID "cds-WP_000072067.1"; Name "WP_000072067.1"; Ontology_term "GO:0006265" "GO:0003918" "GO:0009330"; Parent "gene-C7A06_RS00020"; gbkey "CDS"; gene "gyrB"; go_component "DNA topoisomerase type II (double strand cut, ATP-hydrolyzing) complex|0009330||IEA"; go_function "DNA topoisomerase type II (double strand cut, ATP-hydrolyzing) activity|0003918||IEA"; go_process "DNA topological change|0006265||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_005121480.1"; locus_tag "C7A06_RS00020"; product "DNA topoisomerase (ATP-hydrolyzing) subunit B"; protein_id "WP_000072067.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 5908 6306 . + . gene_id "nbis-gene-5"; ID "nbis-gene-5"; Name "yidB"; gbkey "Gene"; gene "yidB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00025"; +NZ_CP027599.1 RefSeq transcript 5908 6306 . + . gene_id "nbis-gene-5"; transcript_id "gene-C7A06_RS00025"; ID "gene-C7A06_RS00025"; Name "yidB"; Parent "nbis-gene-5"; gbkey "Gene"; gene "yidB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00025"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 5908 6306 . + . gene_id "nbis-gene-5"; transcript_id "gene-C7A06_RS00025"; Dbxref "Genbank:WP_000522208.1"; ID "nbis-exon-5"; Name "WP_000522208.1"; Parent "gene-C7A06_RS00025"; gbkey "CDS"; gene "yidB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418153.4"; locus_tag "C7A06_RS00025"; product "YidB family protein"; protein_id "WP_000522208.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 5908 6306 . + 0 gene_id "nbis-gene-5"; transcript_id "gene-C7A06_RS00025"; Dbxref "Genbank:WP_000522208.1"; ID "cds-WP_000522208.1"; Name "WP_000522208.1"; Parent "gene-C7A06_RS00025"; gbkey "CDS"; gene "yidB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418153.4"; locus_tag "C7A06_RS00025"; product "YidB family protein"; protein_id "WP_000522208.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 6421 7233 . + . gene_id "nbis-gene-6"; ID "nbis-gene-6"; Name "yidA"; gbkey "Gene"; gene "yidA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00030"; +NZ_CP027599.1 RefSeq transcript 6421 7233 . + . gene_id "nbis-gene-6"; transcript_id "gene-C7A06_RS00030"; ID "gene-C7A06_RS00030"; Name "yidA"; Parent "nbis-gene-6"; gbkey "Gene"; gene "yidA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00030"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 6421 7233 . + . gene_id "nbis-gene-6"; transcript_id "gene-C7A06_RS00030"; Dbxref "Genbank:WP_000985541.1"; ID "nbis-exon-6"; Name "WP_000985541.1"; Ontology_term "GO:0016787"; Parent "gene-C7A06_RS00030"; gbkey "CDS"; gene "yidA"; go_function "hydrolase activity|0016787||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418152.1"; locus_tag "C7A06_RS00030"; product "sugar-phosphatase"; protein_id "WP_000985541.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 6421 7233 . + 0 gene_id "nbis-gene-6"; transcript_id "gene-C7A06_RS00030"; Dbxref "Genbank:WP_000985541.1"; ID "cds-WP_000985541.1"; Name "WP_000985541.1"; Ontology_term "GO:0016787"; Parent "gene-C7A06_RS00030"; gbkey "CDS"; gene "yidA"; go_function "hydrolase activity|0016787||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418152.1"; locus_tag "C7A06_RS00030"; product "sugar-phosphatase"; protein_id "WP_000985541.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 7279 7935 . - . gene_id "nbis-gene-7"; ID "nbis-gene-7"; Name "C7A06_RS00035"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00035"; +NZ_CP027599.1 RefSeq transcript 7279 7935 . - . gene_id "nbis-gene-7"; transcript_id "gene-C7A06_RS00035"; ID "gene-C7A06_RS00035"; Name "C7A06_RS00035"; Parent "nbis-gene-7"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00035"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 7279 7935 . - . gene_id "nbis-gene-7"; transcript_id "gene-C7A06_RS00035"; Dbxref "Genbank:WP_000772931.1"; ID "nbis-exon-7"; Name "WP_000772931.1"; Parent "gene-C7A06_RS00035"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709504.1"; locus_tag "C7A06_RS00035"; product "hypothetical protein"; protein_id "WP_000772931.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 7279 7935 . - 0 gene_id "nbis-gene-7"; transcript_id "gene-C7A06_RS00035"; Dbxref "Genbank:WP_000772931.1"; ID "cds-WP_000772931.1"; Name "WP_000772931.1"; Parent "gene-C7A06_RS00035"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709504.1"; locus_tag "C7A06_RS00035"; product "hypothetical protein"; protein_id "WP_000772931.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 8213 8902 . + . gene_id "nbis-gene-8"; ID "nbis-gene-8"; Name "dgoR"; gbkey "Gene"; gene "dgoR"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00040"; +NZ_CP027599.1 RefSeq transcript 8213 8902 . + . gene_id "nbis-gene-8"; transcript_id "gene-C7A06_RS00040"; ID "gene-C7A06_RS00040"; Name "dgoR"; Parent "nbis-gene-8"; gbkey "Gene"; gene "dgoR"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00040"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 8213 8902 . + . gene_id "nbis-gene-8"; transcript_id "gene-C7A06_RS00040"; Dbxref "Genbank:WP_000174305.1"; ID "nbis-exon-8"; Name "WP_000174305.1"; Parent "gene-C7A06_RS00040"; gbkey "CDS"; gene "dgoR"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709505.1"; locus_tag "C7A06_RS00040"; product "D-galactonate utilization transcriptional regulator DgoR"; protein_id "WP_000174305.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 8213 8902 . + 0 gene_id "nbis-gene-8"; transcript_id "gene-C7A06_RS00040"; Dbxref "Genbank:WP_000174305.1"; ID "cds-WP_000174305.1"; Name "WP_000174305.1"; Parent "gene-C7A06_RS00040"; gbkey "CDS"; gene "dgoR"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709505.1"; locus_tag "C7A06_RS00040"; product "D-galactonate utilization transcriptional regulator DgoR"; protein_id "WP_000174305.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 8899 9777 . + . gene_id "nbis-gene-9"; ID "nbis-gene-9"; Name "dgoK"; gbkey "Gene"; gene "dgoK"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00045"; +NZ_CP027599.1 RefSeq transcript 8899 9777 . + . gene_id "nbis-gene-9"; transcript_id "gene-C7A06_RS00045"; ID "gene-C7A06_RS00045"; Name "dgoK"; Parent "nbis-gene-9"; gbkey "Gene"; gene "dgoK"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00045"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 8899 9777 . + . gene_id "nbis-gene-9"; transcript_id "gene-C7A06_RS00045"; Dbxref "Genbank:WP_000127112.1"; ID "nbis-exon-9"; Name "WP_000127112.1"; Parent "gene-C7A06_RS00045"; gbkey "CDS"; gene "dgoK"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709506.1"; locus_tag "C7A06_RS00045"; product "2-dehydro-3-deoxygalactonokinase"; protein_id "WP_000127112.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 8899 9777 . + 0 gene_id "nbis-gene-9"; transcript_id "gene-C7A06_RS00045"; Dbxref "Genbank:WP_000127112.1"; ID "cds-WP_000127112.1"; Name "WP_000127112.1"; Parent "gene-C7A06_RS00045"; gbkey "CDS"; gene "dgoK"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709506.1"; locus_tag "C7A06_RS00045"; product "2-dehydro-3-deoxygalactonokinase"; protein_id "WP_000127112.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 9761 10378 . + . gene_id "nbis-gene-10"; ID "nbis-gene-10"; Name "dgoA"; gbkey "Gene"; gene "dgoA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00050"; +NZ_CP027599.1 RefSeq transcript 9761 10378 . + . gene_id "nbis-gene-10"; transcript_id "gene-C7A06_RS00050"; ID "gene-C7A06_RS00050"; Name "dgoA"; Parent "nbis-gene-10"; gbkey "Gene"; gene "dgoA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00050"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 9761 10378 . + . gene_id "nbis-gene-10"; transcript_id "gene-C7A06_RS00050"; Dbxref "Genbank:WP_001198699.1"; ID "nbis-exon-10"; Name "WP_001198699.1"; Parent "gene-C7A06_RS00050"; gbkey "CDS"; gene "dgoA"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_026238.1"; locus_tag "C7A06_RS00050"; product "2-dehydro-3-deoxy-6-phosphogalactonate aldolase"; protein_id "WP_001198699.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 9761 10378 . + 0 gene_id "nbis-gene-10"; transcript_id "gene-C7A06_RS00050"; Dbxref "Genbank:WP_001198699.1"; ID "cds-WP_001198699.1"; Name "WP_001198699.1"; Parent "gene-C7A06_RS00050"; gbkey "CDS"; gene "dgoA"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_026238.1"; locus_tag "C7A06_RS00050"; product "2-dehydro-3-deoxy-6-phosphogalactonate aldolase"; protein_id "WP_001198699.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 10375 11523 . + . gene_id "nbis-gene-11"; ID "nbis-gene-11"; Name "dgoD"; gbkey "Gene"; gene "dgoD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00055"; +NZ_CP027599.1 RefSeq transcript 10375 11523 . + . gene_id "nbis-gene-11"; transcript_id "gene-C7A06_RS00055"; ID "gene-C7A06_RS00055"; Name "dgoD"; Parent "nbis-gene-11"; gbkey "Gene"; gene "dgoD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00055"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 10375 11523 . + . gene_id "nbis-gene-11"; transcript_id "gene-C7A06_RS00055"; Dbxref "Genbank:WP_000705001.1"; ID "nbis-exon-11"; Name "WP_000705001.1"; Ontology_term "GO:0009063" "GO:0008869"; Parent "gene-C7A06_RS00055"; gbkey "CDS"; gene "dgoD"; go_function "galactonate dehydratase activity|0008869||IEA"; go_process "cellular amino acid catabolic process|0009063||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_020077623.1"; locus_tag "C7A06_RS00055"; product "galactonate dehydratase"; protein_id "WP_000705001.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 10375 11523 . + 0 gene_id "nbis-gene-11"; transcript_id "gene-C7A06_RS00055"; Dbxref "Genbank:WP_000705001.1"; ID "cds-WP_000705001.1"; Name "WP_000705001.1"; Ontology_term "GO:0009063" "GO:0008869"; Parent "gene-C7A06_RS00055"; gbkey "CDS"; gene "dgoD"; go_function "galactonate dehydratase activity|0008869||IEA"; go_process "cellular amino acid catabolic process|0009063||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_020077623.1"; locus_tag "C7A06_RS00055"; product "galactonate dehydratase"; protein_id "WP_000705001.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 11598 12935 . + . gene_id "nbis-gene-12"; ID "nbis-gene-12"; Name "dgoT"; gbkey "Gene"; gene "dgoT"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00060"; +NZ_CP027599.1 RefSeq transcript 11598 12935 . + . gene_id "nbis-gene-12"; transcript_id "gene-C7A06_RS00060"; ID "gene-C7A06_RS00060"; Name "dgoT"; Parent "nbis-gene-12"; gbkey "Gene"; gene "dgoT"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00060"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 11598 12935 . + . gene_id "nbis-gene-12"; transcript_id "gene-C7A06_RS00060"; Dbxref "Genbank:WP_000253455.1"; ID "nbis-exon-12"; Name "WP_000253455.1"; Parent "gene-C7A06_RS00060"; gbkey "CDS"; gene "dgoT"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709507.1"; locus_tag "C7A06_RS00060"; product "MFS transporter"; protein_id "WP_000253455.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 11598 12935 . + 0 gene_id "nbis-gene-12"; transcript_id "gene-C7A06_RS00060"; Dbxref "Genbank:WP_000253455.1"; ID "cds-WP_000253455.1"; Name "WP_000253455.1"; Parent "gene-C7A06_RS00060"; gbkey "CDS"; gene "dgoT"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709507.1"; locus_tag "C7A06_RS00060"; product "MFS transporter"; protein_id "WP_000253455.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 12932 13996 . - . gene_id "nbis-gene-13"; ID "nbis-gene-13"; Name "cbrA"; gbkey "Gene"; gene "cbrA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00065"; +NZ_CP027599.1 RefSeq transcript 12932 13996 . - . gene_id "nbis-gene-13"; transcript_id "gene-C7A06_RS00065"; ID "gene-C7A06_RS00065"; Name "cbrA"; Parent "nbis-gene-13"; gbkey "Gene"; gene "cbrA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00065"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 12932 13996 . - . gene_id "nbis-gene-13"; transcript_id "gene-C7A06_RS00065"; Dbxref "Genbank:WP_001341773.1"; ID "nbis-exon-13"; Name "WP_001341773.1"; Parent "gene-C7A06_RS00065"; gbkey "CDS"; gene "cbrA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418145.2"; locus_tag "C7A06_RS00065"; product "colicin M resistance lipid reductase CbrA"; protein_id "WP_001341773.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 12932 13996 . - 0 gene_id "nbis-gene-13"; transcript_id "gene-C7A06_RS00065"; Dbxref "Genbank:WP_001341773.1"; ID "cds-WP_001341773.1"; Name "WP_001341773.1"; Parent "gene-C7A06_RS00065"; gbkey "CDS"; gene "cbrA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418145.2"; locus_tag "C7A06_RS00065"; product "colicin M resistance lipid reductase CbrA"; protein_id "WP_001341773.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 14097 15311 . + . gene_id "nbis-gene-14"; ID "nbis-gene-14"; Name "yidR"; gbkey "Gene"; gene "yidR"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00070"; +NZ_CP027599.1 RefSeq transcript 14097 15311 . + . gene_id "nbis-gene-14"; transcript_id "gene-C7A06_RS00070"; ID "gene-C7A06_RS00070"; Name "yidR"; Parent "nbis-gene-14"; gbkey "Gene"; gene "yidR"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00070"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 14097 15311 . + . gene_id "nbis-gene-14"; transcript_id "gene-C7A06_RS00070"; Dbxref "Genbank:WP_001448315.1"; ID "nbis-exon-14"; Name "WP_001448315.1"; Parent "gene-C7A06_RS00070"; gbkey "CDS"; gene "yidR"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312656.3"; locus_tag "C7A06_RS00070"; product "DUF3748 domain-containing protein"; protein_id "WP_001448315.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 14097 15311 . + 0 gene_id "nbis-gene-14"; transcript_id "gene-C7A06_RS00070"; Dbxref "Genbank:WP_001448315.1"; ID "cds-WP_001448315.1"; Name "WP_001448315.1"; Parent "gene-C7A06_RS00070"; gbkey "CDS"; gene "yidR"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312656.3"; locus_tag "C7A06_RS00070"; product "DUF3748 domain-containing protein"; protein_id "WP_001448315.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 15313 15645 . - . gene_id "nbis-gene-15"; ID "nbis-gene-15"; Name "yidQ"; gbkey "Gene"; gene "yidQ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00075"; +NZ_CP027599.1 RefSeq transcript 15313 15645 . - . gene_id "nbis-gene-15"; transcript_id "gene-C7A06_RS00075"; ID "gene-C7A06_RS00075"; Name "yidQ"; Parent "nbis-gene-15"; gbkey "Gene"; gene "yidQ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00075"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 15313 15645 . - . gene_id "nbis-gene-15"; transcript_id "gene-C7A06_RS00075"; Dbxref "Genbank:WP_000620888.1"; ID "nbis-exon-15"; Name "WP_000620888.1"; Parent "gene-C7A06_RS00075"; gbkey "CDS"; gene "yidQ"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418143.2"; locus_tag "C7A06_RS00075"; product "YceK/YidQ family lipoprotein"; protein_id "WP_000620888.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 15313 15645 . - 0 gene_id "nbis-gene-15"; transcript_id "gene-C7A06_RS00075"; Dbxref "Genbank:WP_000620888.1"; ID "cds-WP_000620888.1"; Name "WP_000620888.1"; Parent "gene-C7A06_RS00075"; gbkey "CDS"; gene "yidQ"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418143.2"; locus_tag "C7A06_RS00075"; product "YceK/YidQ family lipoprotein"; protein_id "WP_000620888.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 15951 16364 . + . gene_id "nbis-gene-16"; ID "nbis-gene-16"; Name "ibpA"; gbkey "Gene"; gene "ibpA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00080"; +NZ_CP027599.1 RefSeq transcript 15951 16364 . + . gene_id "nbis-gene-16"; transcript_id "gene-C7A06_RS00080"; ID "gene-C7A06_RS00080"; Name "ibpA"; Parent "nbis-gene-16"; gbkey "Gene"; gene "ibpA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00080"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 15951 16364 . + . gene_id "nbis-gene-16"; transcript_id "gene-C7A06_RS00080"; Dbxref "Genbank:WP_001243437.1"; ID "nbis-exon-16"; Name "WP_001243437.1"; Parent "gene-C7A06_RS00080"; gbkey "CDS"; gene "ibpA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_006687722.1"; locus_tag "C7A06_RS00080"; product "heat shock chaperone IbpA"; protein_id "WP_001243437.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 15951 16364 . + 0 gene_id "nbis-gene-16"; transcript_id "gene-C7A06_RS00080"; Dbxref "Genbank:WP_001243437.1"; ID "cds-WP_001243437.1"; Name "WP_001243437.1"; Parent "gene-C7A06_RS00080"; gbkey "CDS"; gene "ibpA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_006687722.1"; locus_tag "C7A06_RS00080"; product "heat shock chaperone IbpA"; protein_id "WP_001243437.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 16476 16904 . + . gene_id "nbis-gene-17"; ID "nbis-gene-17"; Name "ibpB"; gbkey "Gene"; gene "ibpB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00085"; +NZ_CP027599.1 RefSeq transcript 16476 16904 . + . gene_id "nbis-gene-17"; transcript_id "gene-C7A06_RS00085"; ID "gene-C7A06_RS00085"; Name "ibpB"; Parent "nbis-gene-17"; gbkey "Gene"; gene "ibpB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00085"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 16476 16904 . + . gene_id "nbis-gene-17"; transcript_id "gene-C7A06_RS00085"; Dbxref "Genbank:WP_001243431.1"; ID "nbis-exon-17"; Name "WP_001243431.1"; Parent "gene-C7A06_RS00085"; gbkey "CDS"; gene "ibpB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709512.2"; locus_tag "C7A06_RS00085"; product "heat shock chaperone IbpB"; protein_id "WP_001243431.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 16476 16904 . + 0 gene_id "nbis-gene-17"; transcript_id "gene-C7A06_RS00085"; Dbxref "Genbank:WP_001243431.1"; ID "cds-WP_001243431.1"; Name "WP_001243431.1"; Parent "gene-C7A06_RS00085"; gbkey "CDS"; gene "ibpB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709512.2"; locus_tag "C7A06_RS00085"; product "heat shock chaperone IbpB"; protein_id "WP_001243431.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 17101 18762 . + . gene_id "nbis-gene-18"; ID "nbis-gene-18"; Name "yidE"; gbkey "Gene"; gene "yidE"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00090"; +NZ_CP027599.1 RefSeq transcript 17101 18762 . + . gene_id "nbis-gene-18"; transcript_id "gene-C7A06_RS00090"; ID "gene-C7A06_RS00090"; Name "yidE"; Parent "nbis-gene-18"; gbkey "Gene"; gene "yidE"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00090"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 17101 18762 . + . gene_id "nbis-gene-18"; transcript_id "gene-C7A06_RS00090"; Dbxref "Genbank:WP_001279752.1"; ID "nbis-exon-18"; Name "WP_001279752.1"; Ontology_term "GO:0006813" "GO:0008324"; Parent "gene-C7A06_RS00090"; gbkey "CDS"; gene "yidE"; go_function "cation transmembrane transporter activity|0008324||IEA"; go_process "potassium ion transport|0006813||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312652.2"; locus_tag "C7A06_RS00090"; product "putative transporter"; protein_id "WP_001279752.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 17101 18762 . + 0 gene_id "nbis-gene-18"; transcript_id "gene-C7A06_RS00090"; Dbxref "Genbank:WP_001279752.1"; ID "cds-WP_001279752.1"; Name "WP_001279752.1"; Ontology_term "GO:0006813" "GO:0008324"; Parent "gene-C7A06_RS00090"; gbkey "CDS"; gene "yidE"; go_function "cation transmembrane transporter activity|0008324||IEA"; go_process "potassium ion transport|0006813||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312652.2"; locus_tag "C7A06_RS00090"; product "putative transporter"; protein_id "WP_001279752.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 18759 19475 . - . gene_id "nbis-gene-19"; ID "nbis-gene-19"; Name "yidP"; gbkey "Gene"; gene "yidP"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00095"; +NZ_CP027599.1 RefSeq transcript 18759 19475 . - . gene_id "nbis-gene-19"; transcript_id "gene-C7A06_RS00095"; ID "gene-C7A06_RS00095"; Name "yidP"; Parent "nbis-gene-19"; gbkey "Gene"; gene "yidP"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00095"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 18759 19475 . - . gene_id "nbis-gene-19"; transcript_id "gene-C7A06_RS00095"; Dbxref "Genbank:WP_001300779.1"; ID "nbis-exon-19"; Name "WP_001300779.1"; Parent "gene-C7A06_RS00095"; gbkey "CDS"; gene "yidP"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418139.1"; locus_tag "C7A06_RS00095"; product "GntR family transcriptional regulator"; protein_id "WP_001300779.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 18759 19475 . - 0 gene_id "nbis-gene-19"; transcript_id "gene-C7A06_RS00095"; Dbxref "Genbank:WP_001300779.1"; ID "cds-WP_001300779.1"; Name "WP_001300779.1"; Parent "gene-C7A06_RS00095"; gbkey "CDS"; gene "yidP"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418139.1"; locus_tag "C7A06_RS00095"; product "GntR family transcriptional regulator"; protein_id "WP_001300779.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 19771 21387 . + . gene_id "nbis-gene-20"; ID "nbis-gene-20"; Name "C7A06_RS00100"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00100"; +NZ_CP027599.1 RefSeq transcript 19771 21387 . + . gene_id "nbis-gene-20"; transcript_id "gene-C7A06_RS00100"; ID "gene-C7A06_RS00100"; Name "C7A06_RS00100"; Parent "nbis-gene-20"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00100"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 19771 21387 . + . gene_id "nbis-gene-20"; transcript_id "gene-C7A06_RS00100"; Dbxref "Genbank:WP_000952127.1"; ID "nbis-exon-20"; Name "WP_000952127.1"; Parent "gene-C7A06_RS00100"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312650.2"; locus_tag "C7A06_RS00100"; product "PTS sugar transporter subunit IIB"; protein_id "WP_000952127.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 19771 21387 . + 0 gene_id "nbis-gene-20"; transcript_id "gene-C7A06_RS00100"; Dbxref "Genbank:WP_000952127.1"; ID "cds-WP_000952127.1"; Name "WP_000952127.1"; Parent "gene-C7A06_RS00100"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312650.2"; locus_tag "C7A06_RS00100"; product "PTS sugar transporter subunit IIB"; protein_id "WP_000952127.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 21387 22201 . + . gene_id "nbis-pseudogene-1"; ID "nbis-pseudogene-1"; Name "C7A06_RS00105"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS00105"; original_biotype "pseudogene"; pseudo "true"; +NZ_CP027599.1 RefSeq transcript 21387 22201 . + . gene_id "nbis-pseudogene-1"; transcript_id "gene-C7A06_RS00105"; ID "gene-C7A06_RS00105"; Name "C7A06_RS00105"; Parent "nbis-pseudogene-1"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS00105"; original_biotype "mrna"; pseudo "true"; +NZ_CP027599.1 Protein Homology exon 21387 22201 . + . gene_id "nbis-pseudogene-1"; transcript_id "gene-C7A06_RS00105"; ID "nbis-exon-21"; Note "frameshifted"; Parent "gene-C7A06_RS00105"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312649.2"; locus_tag "C7A06_RS00105"; product "hypothetical protein"; pseudo "true"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 21387 22201 . + 0 gene_id "nbis-pseudogene-1"; transcript_id "gene-C7A06_RS00105"; ID "cds-C7A06_RS00105"; Note "frameshifted"; Parent "gene-C7A06_RS00105"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312649.2"; locus_tag "C7A06_RS00105"; product "hypothetical protein"; pseudo "true"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 22198 23091 . - . gene_id "nbis-gene-21"; ID "nbis-gene-21"; Name "yidL"; gbkey "Gene"; gene "yidL"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00110"; +NZ_CP027599.1 RefSeq transcript 22198 23091 . - . gene_id "nbis-gene-21"; transcript_id "gene-C7A06_RS00110"; ID "gene-C7A06_RS00110"; Name "yidL"; Parent "nbis-gene-21"; gbkey "Gene"; gene "yidL"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00110"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 22198 23091 . - . gene_id "nbis-gene-21"; transcript_id "gene-C7A06_RS00110"; Dbxref "Genbank:WP_001013540.1"; ID "nbis-exon-22"; Name "WP_001013540.1"; Parent "gene-C7A06_RS00110"; gbkey "CDS"; gene "yidL"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418136.2"; locus_tag "C7A06_RS00110"; product "AraC family transcriptional regulator"; protein_id "WP_001013540.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 22198 23091 . - 0 gene_id "nbis-gene-21"; transcript_id "gene-C7A06_RS00110"; Dbxref "Genbank:WP_001013540.1"; ID "cds-WP_001013540.1"; Name "WP_001013540.1"; Parent "gene-C7A06_RS00110"; gbkey "CDS"; gene "yidL"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418136.2"; locus_tag "C7A06_RS00110"; product "AraC family transcriptional regulator"; protein_id "WP_001013540.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 23258 24973 . + . gene_id "nbis-gene-22"; ID "nbis-gene-22"; Name "yidK"; gbkey "Gene"; gene "yidK"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00115"; +NZ_CP027599.1 RefSeq transcript 23258 24973 . + . gene_id "nbis-gene-22"; transcript_id "gene-C7A06_RS00115"; ID "gene-C7A06_RS00115"; Name "yidK"; Parent "nbis-gene-22"; gbkey "Gene"; gene "yidK"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00115"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 23258 24973 . + . gene_id "nbis-gene-22"; transcript_id "gene-C7A06_RS00115"; Dbxref "Genbank:WP_001087147.1"; ID "nbis-exon-23"; Name "WP_001087147.1"; Ontology_term "GO:0055085" "GO:0022857" "GO:0016020"; Parent "gene-C7A06_RS00115"; gbkey "CDS"; gene "yidK"; go_component "membrane|0016020||IEA"; go_function "transmembrane transporter activity|0022857||IEA"; go_process "transmembrane transport|0055085||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418135.1"; locus_tag "C7A06_RS00115"; product "solute:sodium symporter family transporter"; protein_id "WP_001087147.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 23258 24973 . + 0 gene_id "nbis-gene-22"; transcript_id "gene-C7A06_RS00115"; Dbxref "Genbank:WP_001087147.1"; ID "cds-WP_001087147.1"; Name "WP_001087147.1"; Ontology_term "GO:0055085" "GO:0022857" "GO:0016020"; Parent "gene-C7A06_RS00115"; gbkey "CDS"; gene "yidK"; go_component "membrane|0016020||IEA"; go_function "transmembrane transporter activity|0022857||IEA"; go_process "transmembrane transport|0055085||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418135.1"; locus_tag "C7A06_RS00115"; product "solute:sodium symporter family transporter"; protein_id "WP_001087147.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 24970 26463 . + . gene_id "nbis-gene-23"; ID "nbis-gene-23"; Name "yidJ"; gbkey "Gene"; gene "yidJ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00120"; +NZ_CP027599.1 RefSeq transcript 24970 26463 . + . gene_id "nbis-gene-23"; transcript_id "gene-C7A06_RS00120"; ID "gene-C7A06_RS00120"; Name "yidJ"; Parent "nbis-gene-23"; gbkey "Gene"; gene "yidJ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00120"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 24970 26463 . + . gene_id "nbis-gene-23"; transcript_id "gene-C7A06_RS00120"; Dbxref "Genbank:WP_000828487.1"; ID "nbis-exon-24"; Name "WP_000828487.1"; Ontology_term "GO:0008484"; Parent "gene-C7A06_RS00120"; gbkey "CDS"; gene "yidJ"; go_function "sulfuric ester hydrolase activity|0008484||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418134.1"; locus_tag "C7A06_RS00120"; product "sulfatase-like hydrolase/transferase"; protein_id "WP_000828487.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 24970 26463 . + 0 gene_id "nbis-gene-23"; transcript_id "gene-C7A06_RS00120"; Dbxref "Genbank:WP_000828487.1"; ID "cds-WP_000828487.1"; Name "WP_000828487.1"; Ontology_term "GO:0008484"; Parent "gene-C7A06_RS00120"; gbkey "CDS"; gene "yidJ"; go_function "sulfuric ester hydrolase activity|0008484||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418134.1"; locus_tag "C7A06_RS00120"; product "sulfatase-like hydrolase/transferase"; protein_id "WP_000828487.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 26510 26959 . - . gene_id "nbis-gene-24"; ID "nbis-gene-24"; Name "C7A06_RS00125"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00125"; +NZ_CP027599.1 RefSeq transcript 26510 26959 . - . gene_id "nbis-gene-24"; transcript_id "gene-C7A06_RS00125"; ID "gene-C7A06_RS00125"; Name "C7A06_RS00125"; Parent "nbis-gene-24"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00125"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 26510 26959 . - . gene_id "nbis-gene-24"; transcript_id "gene-C7A06_RS00125"; Dbxref "Genbank:WP_000511287.1"; ID "nbis-exon-25"; Name "WP_000511287.1"; Parent "gene-C7A06_RS00125"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418133.1"; locus_tag "C7A06_RS00125"; product "membrane protein"; protein_id "WP_000511287.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 26510 26959 . - 0 gene_id "nbis-gene-24"; transcript_id "gene-C7A06_RS00125"; Dbxref "Genbank:WP_000511287.1"; ID "cds-WP_000511287.1"; Name "WP_000511287.1"; Parent "gene-C7A06_RS00125"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418133.1"; locus_tag "C7A06_RS00125"; product "membrane protein"; protein_id "WP_000511287.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 27069 27416 . + . gene_id "nbis-gene-25"; ID "nbis-gene-25"; Name "yidH"; gbkey "Gene"; gene "yidH"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00130"; +NZ_CP027599.1 RefSeq transcript 27069 27416 . + . gene_id "nbis-gene-25"; transcript_id "gene-C7A06_RS00130"; ID "gene-C7A06_RS00130"; Name "yidH"; Parent "nbis-gene-25"; gbkey "Gene"; gene "yidH"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00130"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 27069 27416 . + . gene_id "nbis-gene-25"; transcript_id "gene-C7A06_RS00130"; Dbxref "Genbank:WP_000703959.1"; ID "nbis-exon-26"; Name "WP_000703959.1"; Parent "gene-C7A06_RS00130"; gbkey "CDS"; gene "yidH"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312644.1"; locus_tag "C7A06_RS00130"; product "YidH family protein"; protein_id "WP_000703959.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 27069 27416 . + 0 gene_id "nbis-gene-25"; transcript_id "gene-C7A06_RS00130"; Dbxref "Genbank:WP_000703959.1"; ID "cds-WP_000703959.1"; Name "WP_000703959.1"; Parent "gene-C7A06_RS00130"; gbkey "CDS"; gene "yidH"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312644.1"; locus_tag "C7A06_RS00130"; product "YidH family protein"; protein_id "WP_000703959.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 27406 27768 . + . gene_id "nbis-gene-26"; ID "nbis-gene-26"; Name "yidG"; gbkey "Gene"; gene "yidG"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00135"; +NZ_CP027599.1 RefSeq transcript 27406 27768 . + . gene_id "nbis-gene-26"; transcript_id "gene-C7A06_RS00135"; ID "gene-C7A06_RS00135"; Name "yidG"; Parent "nbis-gene-26"; gbkey "Gene"; gene "yidG"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00135"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 27406 27768 . + . gene_id "nbis-gene-26"; transcript_id "gene-C7A06_RS00135"; Dbxref "Genbank:WP_001113432.1"; ID "nbis-exon-27"; Name "WP_001113432.1"; Parent "gene-C7A06_RS00135"; gbkey "CDS"; gene "yidG"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312643.1"; locus_tag "C7A06_RS00135"; product "DUF202 domain-containing protein"; protein_id "WP_001113432.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 27406 27768 . + 0 gene_id "nbis-gene-26"; transcript_id "gene-C7A06_RS00135"; Dbxref "Genbank:WP_001113432.1"; ID "cds-WP_001113432.1"; Name "WP_001113432.1"; Parent "gene-C7A06_RS00135"; gbkey "CDS"; gene "yidG"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312643.1"; locus_tag "C7A06_RS00135"; product "DUF202 domain-containing protein"; protein_id "WP_001113432.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 27765 28262 . + . gene_id "nbis-gene-27"; ID "nbis-gene-27"; Name "yidF"; gbkey "Gene"; gene "yidF"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00140"; +NZ_CP027599.1 RefSeq transcript 27765 28262 . + . gene_id "nbis-gene-27"; transcript_id "gene-C7A06_RS00140"; ID "gene-C7A06_RS00140"; Name "yidF"; Parent "nbis-gene-27"; gbkey "Gene"; gene "yidF"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00140"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 27765 28262 . + . gene_id "nbis-gene-27"; transcript_id "gene-C7A06_RS00140"; Dbxref "Genbank:WP_000148063.1"; ID "nbis-exon-28"; Name "WP_000148063.1"; Parent "gene-C7A06_RS00140"; gbkey "CDS"; gene "yidF"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709521.1"; locus_tag "C7A06_RS00140"; product "radical SAM protein"; protein_id "WP_000148063.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 27765 28262 . + 0 gene_id "nbis-gene-27"; transcript_id "gene-C7A06_RS00140"; Dbxref "Genbank:WP_000148063.1"; ID "cds-WP_000148063.1"; Name "WP_000148063.1"; Parent "gene-C7A06_RS00140"; gbkey "CDS"; gene "yidF"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709521.1"; locus_tag "C7A06_RS00140"; product "radical SAM protein"; protein_id "WP_000148063.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 28270 29454 . - . gene_id "nbis-gene-28"; ID "nbis-gene-28"; Name "emrD"; gbkey "Gene"; gene "emrD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00145"; +NZ_CP027599.1 RefSeq transcript 28270 29454 . - . gene_id "nbis-gene-28"; transcript_id "gene-C7A06_RS00145"; ID "gene-C7A06_RS00145"; Name "emrD"; Parent "nbis-gene-28"; gbkey "Gene"; gene "emrD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00145"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 28270 29454 . - . gene_id "nbis-gene-28"; transcript_id "gene-C7A06_RS00145"; Dbxref "Genbank:WP_000828746.1"; ID "nbis-exon-29"; Name "WP_000828746.1"; Parent "gene-C7A06_RS00145"; gbkey "CDS"; gene "emrD"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418129.2"; locus_tag "C7A06_RS00145"; product "multidrug efflux MFS transporter EmrD"; protein_id "WP_000828746.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 28270 29454 . - 0 gene_id "nbis-gene-28"; transcript_id "gene-C7A06_RS00145"; Dbxref "Genbank:WP_000828746.1"; ID "cds-WP_000828746.1"; Name "WP_000828746.1"; Parent "gene-C7A06_RS00145"; gbkey "CDS"; gene "emrD"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418129.2"; locus_tag "C7A06_RS00145"; product "multidrug efflux MFS transporter EmrD"; protein_id "WP_000828746.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 29536 29610 . + . gene_id "nbis-gene-5807"; ID "nbis-gene-5807"; Name "ysdE"; gbkey "Gene"; gene "ysdE"; gene_biotype "protein_coding"; locus_tag "C7A06_RS34670"; +NZ_CP027599.1 RefSeq transcript 29536 29610 . + . gene_id "nbis-gene-5807"; transcript_id "gene-C7A06_RS34670"; ID "gene-C7A06_RS34670"; Name "ysdE"; Parent "nbis-gene-5807"; gbkey "Gene"; gene "ysdE"; gene_biotype "protein_coding"; locus_tag "C7A06_RS34670"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 29536 29610 . + . gene_id "nbis-gene-5807"; transcript_id "gene-C7A06_RS34670"; Dbxref "Genbank:WP_211180519.1"; ID "nbis-exon-6116"; Name "WP_211180519.1"; Parent "gene-C7A06_RS34670"; gbkey "CDS"; gene "ysdE"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_010051212.1"; locus_tag "C7A06_RS34670"; product "protein YsdE"; protein_id "WP_211180519.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 29536 29610 . + 0 gene_id "nbis-gene-5807"; transcript_id "gene-C7A06_RS34670"; Dbxref "Genbank:WP_211180519.1"; ID "cds-WP_211180519.1"; Name "WP_211180519.1"; Parent "gene-C7A06_RS34670"; gbkey "CDS"; gene "ysdE"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_010051212.1"; locus_tag "C7A06_RS34670"; product "protein YsdE"; protein_id "WP_211180519.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 29873 29962 . - . gene_id "nbis-gene-29"; ID "nbis-gene-29"; Name "tisB"; gbkey "Gene"; gene "tisB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00155"; +NZ_CP027599.1 RefSeq transcript 29873 29962 . - . gene_id "nbis-gene-29"; transcript_id "gene-C7A06_RS00155"; ID "gene-C7A06_RS00155"; Name "tisB"; Parent "nbis-gene-29"; gbkey "Gene"; gene "tisB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00155"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 29873 29962 . - . gene_id "nbis-gene-29"; transcript_id "gene-C7A06_RS00155"; Dbxref "Genbank:WP_000060506.1"; ID "nbis-exon-30"; Name "WP_000060506.1"; Parent "gene-C7A06_RS00155"; gbkey "CDS"; gene "tisB"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_009502662.1"; locus_tag "C7A06_RS00155"; product "type I toxin-antitoxin system toxin TisB"; protein_id "WP_000060506.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 29873 29962 . - 0 gene_id "nbis-gene-29"; transcript_id "gene-C7A06_RS00155"; Dbxref "Genbank:WP_000060506.1"; ID "cds-WP_000060506.1"; Name "WP_000060506.1"; Parent "gene-C7A06_RS00155"; gbkey "CDS"; gene "tisB"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_009502662.1"; locus_tag "C7A06_RS00155"; product "type I toxin-antitoxin system toxin TisB"; protein_id "WP_000060506.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 30527 30625 . + . gene_id "nbis-gene-30"; ID "nbis-gene-30"; Name "ivbL"; gbkey "Gene"; gene "ivbL"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00175"; +NZ_CP027599.1 RefSeq transcript 30527 30625 . + . gene_id "nbis-gene-30"; transcript_id "gene-C7A06_RS00175"; ID "gene-C7A06_RS00175"; Name "ivbL"; Parent "nbis-gene-30"; gbkey "Gene"; gene "ivbL"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00175"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 30527 30625 . + . gene_id "nbis-gene-30"; transcript_id "gene-C7A06_RS00175"; Dbxref "Genbank:WP_001315912.1"; ID "nbis-exon-31"; Name "WP_001315912.1"; Parent "gene-C7A06_RS00175"; gbkey "CDS"; gene "ivbL"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418128.1"; locus_tag "C7A06_RS00175"; product "ilvB operon leader peptide IvbL"; protein_id "WP_001315912.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 30527 30625 . + 0 gene_id "nbis-gene-30"; transcript_id "gene-C7A06_RS00175"; Dbxref "Genbank:WP_001315912.1"; ID "cds-WP_001315912.1"; Name "WP_001315912.1"; Parent "gene-C7A06_RS00175"; gbkey "CDS"; gene "ivbL"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418128.1"; locus_tag "C7A06_RS00175"; product "ilvB operon leader peptide IvbL"; protein_id "WP_001315912.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 30731 32419 . + . gene_id "nbis-gene-31"; ID "nbis-gene-31"; Name "ilvB"; gbkey "Gene"; gene "ilvB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00180"; +NZ_CP027599.1 RefSeq transcript 30731 32419 . + . gene_id "nbis-gene-31"; transcript_id "gene-C7A06_RS00180"; ID "gene-C7A06_RS00180"; Name "ilvB"; Parent "nbis-gene-31"; gbkey "Gene"; gene "ilvB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00180"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 30731 32419 . + . gene_id "nbis-gene-31"; transcript_id "gene-C7A06_RS00180"; Dbxref "Genbank:WP_000168497.1"; ID "nbis-exon-32"; Name "WP_000168497.1"; Ontology_term "GO:0009082" "GO:0000287" "GO:0003984" "GO:0030976" "GO:0050660"; Parent "gene-C7A06_RS00180"; gbkey "CDS"; gene "ilvB"; go_function "magnesium ion binding|0000287||IEA" "acetolactate synthase activity|0003984||IEA" "thiamine pyrophosphate binding|0030976||IEA" "flavin adenine dinucleotide binding|0050660||IEA"; go_process "branched-chain amino acid biosynthetic process|0009082||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418127.1"; locus_tag "C7A06_RS00180"; product "acetolactate synthase large subunit"; protein_id "WP_000168497.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 30731 32419 . + 0 gene_id "nbis-gene-31"; transcript_id "gene-C7A06_RS00180"; Dbxref "Genbank:WP_000168497.1"; ID "cds-WP_000168497.1"; Name "WP_000168497.1"; Ontology_term "GO:0009082" "GO:0000287" "GO:0003984" "GO:0030976" "GO:0050660"; Parent "gene-C7A06_RS00180"; gbkey "CDS"; gene "ilvB"; go_function "magnesium ion binding|0000287||IEA" "acetolactate synthase activity|0003984||IEA" "thiamine pyrophosphate binding|0030976||IEA" "flavin adenine dinucleotide binding|0050660||IEA"; go_process "branched-chain amino acid biosynthetic process|0009082||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418127.1"; locus_tag "C7A06_RS00180"; product "acetolactate synthase large subunit"; protein_id "WP_000168497.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 32423 32713 . + . gene_id "nbis-gene-32"; ID "nbis-gene-32"; Name "ilvN"; gbkey "Gene"; gene "ilvN"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00185"; +NZ_CP027599.1 RefSeq transcript 32423 32713 . + . gene_id "nbis-gene-32"; transcript_id "gene-C7A06_RS00185"; ID "gene-C7A06_RS00185"; Name "ilvN"; Parent "nbis-gene-32"; gbkey "Gene"; gene "ilvN"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00185"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 32423 32713 . + . gene_id "nbis-gene-32"; transcript_id "gene-C7A06_RS00185"; Dbxref "Genbank:WP_001181706.1"; ID "nbis-exon-33"; Name "WP_001181706.1"; Parent "gene-C7A06_RS00185"; gbkey "CDS"; gene "ilvN"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312638.1"; locus_tag "C7A06_RS00185"; product "acetolactate synthase small subunit"; protein_id "WP_001181706.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 32423 32713 . + 0 gene_id "nbis-gene-32"; transcript_id "gene-C7A06_RS00185"; Dbxref "Genbank:WP_001181706.1"; ID "cds-WP_001181706.1"; Name "WP_001181706.1"; Parent "gene-C7A06_RS00185"; gbkey "CDS"; gene "ilvN"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312638.1"; locus_tag "C7A06_RS00185"; product "acetolactate synthase small subunit"; protein_id "WP_001181706.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 32788 33378 . + . gene_id "nbis-gene-33"; ID "nbis-gene-33"; Name "uhpA"; gbkey "Gene"; gene "uhpA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00190"; +NZ_CP027599.1 RefSeq transcript 32788 33378 . + . gene_id "nbis-gene-33"; transcript_id "gene-C7A06_RS00190"; ID "gene-C7A06_RS00190"; Name "uhpA"; Parent "nbis-gene-33"; gbkey "Gene"; gene "uhpA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00190"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 32788 33378 . + . gene_id "nbis-gene-33"; transcript_id "gene-C7A06_RS00190"; Dbxref "Genbank:WP_000633668.1"; ID "nbis-exon-34"; Name "WP_000633668.1"; Ontology_term "GO:0006355" "GO:0003677"; Parent "gene-C7A06_RS00190"; gbkey "CDS"; gene "uhpA"; go_function "DNA binding|0003677||IEA"; go_process "regulation of transcription, DNA-templated|0006355||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312633.1"; locus_tag "C7A06_RS00190"; product "transcriptional regulator UhpA"; protein_id "WP_000633668.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 32788 33378 . + 0 gene_id "nbis-gene-33"; transcript_id "gene-C7A06_RS00190"; Dbxref "Genbank:WP_000633668.1"; ID "cds-WP_000633668.1"; Name "WP_000633668.1"; Ontology_term "GO:0006355" "GO:0003677"; Parent "gene-C7A06_RS00190"; gbkey "CDS"; gene "uhpA"; go_function "DNA binding|0003677||IEA"; go_process "regulation of transcription, DNA-templated|0006355||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312633.1"; locus_tag "C7A06_RS00190"; product "transcriptional regulator UhpA"; protein_id "WP_000633668.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 33378 34880 . + . gene_id "nbis-gene-34"; ID "nbis-gene-34"; Name "uhpB"; gbkey "Gene"; gene "uhpB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00195"; +NZ_CP027599.1 RefSeq transcript 33378 34880 . + . gene_id "nbis-gene-34"; transcript_id "gene-C7A06_RS00195"; ID "gene-C7A06_RS00195"; Name "uhpB"; Parent "nbis-gene-34"; gbkey "Gene"; gene "uhpB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00195"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 33378 34880 . + . gene_id "nbis-gene-34"; transcript_id "gene-C7A06_RS00195"; Dbxref "Genbank:WP_001295243.1"; ID "nbis-exon-35"; Name "WP_001295243.1"; Ontology_term "GO:0000160" "GO:0000155"; Parent "gene-C7A06_RS00195"; gbkey "CDS"; gene "uhpB"; go_function "phosphorelay sensor kinase activity|0000155||IEA"; go_process "phosphorelay signal transduction system|0000160||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418124.4"; locus_tag "C7A06_RS00195"; product "signal transduction histidine-protein kinase/phosphatase UhpB"; protein_id "WP_001295243.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 33378 34880 . + 0 gene_id "nbis-gene-34"; transcript_id "gene-C7A06_RS00195"; Dbxref "Genbank:WP_001295243.1"; ID "cds-WP_001295243.1"; Name "WP_001295243.1"; Ontology_term "GO:0000160" "GO:0000155"; Parent "gene-C7A06_RS00195"; gbkey "CDS"; gene "uhpB"; go_function "phosphorelay sensor kinase activity|0000155||IEA"; go_process "phosphorelay signal transduction system|0000160||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418124.4"; locus_tag "C7A06_RS00195"; product "signal transduction histidine-protein kinase/phosphatase UhpB"; protein_id "WP_001295243.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 34890 36209 . + . gene_id "nbis-gene-35"; ID "nbis-gene-35"; Name "uhpC"; gbkey "Gene"; gene "uhpC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00200"; +NZ_CP027599.1 RefSeq transcript 34890 36209 . + . gene_id "nbis-gene-35"; transcript_id "gene-C7A06_RS00200"; ID "gene-C7A06_RS00200"; Name "uhpC"; Parent "nbis-gene-35"; gbkey "Gene"; gene "uhpC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00200"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 34890 36209 . + . gene_id "nbis-gene-35"; transcript_id "gene-C7A06_RS00200"; Dbxref "Genbank:WP_001341770.1"; ID "nbis-exon-36"; Name "WP_001341770.1"; Parent "gene-C7A06_RS00200"; gbkey "CDS"; gene "uhpC"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709527.2"; locus_tag "C7A06_RS00200"; product "MFS transporter family glucose-6-phosphate receptor UhpC"; protein_id "WP_001341770.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 34890 36209 . + 0 gene_id "nbis-gene-35"; transcript_id "gene-C7A06_RS00200"; Dbxref "Genbank:WP_001341770.1"; ID "cds-WP_001341770.1"; Name "WP_001341770.1"; Parent "gene-C7A06_RS00200"; gbkey "CDS"; gene "uhpC"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709527.2"; locus_tag "C7A06_RS00200"; product "MFS transporter family glucose-6-phosphate receptor UhpC"; protein_id "WP_001341770.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 36465 37856 . + . gene_id "nbis-gene-36"; ID "nbis-gene-36"; Name "uhpT"; gbkey "Gene"; gene "uhpT"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00205"; +NZ_CP027599.1 RefSeq transcript 36465 37856 . + . gene_id "nbis-gene-36"; transcript_id "gene-C7A06_RS00205"; ID "gene-C7A06_RS00205"; Name "uhpT"; Parent "nbis-gene-36"; gbkey "Gene"; gene "uhpT"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00205"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 36465 37856 . + . gene_id "nbis-gene-36"; transcript_id "gene-C7A06_RS00205"; Dbxref "Genbank:WP_000879194.1"; ID "nbis-exon-37"; Name "WP_000879194.1"; Ontology_term "GO:0055085" "GO:0022857"; Parent "gene-C7A06_RS00205"; gbkey "CDS"; gene "uhpT"; go_function "transmembrane transporter activity|0022857||IEA"; go_process "transmembrane transport|0055085||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312630.1"; locus_tag "C7A06_RS00205"; product "hexose-6-phosphate:phosphate antiporter"; protein_id "WP_000879194.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 36465 37856 . + 0 gene_id "nbis-gene-36"; transcript_id "gene-C7A06_RS00205"; Dbxref "Genbank:WP_000879194.1"; ID "cds-WP_000879194.1"; Name "WP_000879194.1"; Ontology_term "GO:0055085" "GO:0022857"; Parent "gene-C7A06_RS00205"; gbkey "CDS"; gene "uhpT"; go_function "transmembrane transporter activity|0022857||IEA"; go_process "transmembrane transport|0055085||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312630.1"; locus_tag "C7A06_RS00205"; product "hexose-6-phosphate:phosphate antiporter"; protein_id "WP_000879194.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 37901 39667 . - . gene_id "nbis-gene-37"; ID "nbis-gene-37"; Name "adeD"; gbkey "Gene"; gene "adeD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00210"; +NZ_CP027599.1 RefSeq transcript 37901 39667 . - . gene_id "nbis-gene-37"; transcript_id "gene-C7A06_RS00210"; ID "gene-C7A06_RS00210"; Name "adeD"; Parent "nbis-gene-37"; gbkey "Gene"; gene "adeD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00210"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 37901 39667 . - . gene_id "nbis-gene-37"; transcript_id "gene-C7A06_RS00210"; Dbxref "Genbank:WP_001065695.1"; ID "nbis-exon-38"; Name "WP_001065695.1"; Parent "gene-C7A06_RS00210"; gbkey "CDS"; gene "adeD"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418121.1"; locus_tag "C7A06_RS00210"; product "adenine deaminase"; protein_id "WP_001065695.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 37901 39667 . - 0 gene_id "nbis-gene-37"; transcript_id "gene-C7A06_RS00210"; Dbxref "Genbank:WP_001065695.1"; ID "cds-WP_001065695.1"; Name "WP_001065695.1"; Parent "gene-C7A06_RS00210"; gbkey "CDS"; gene "adeD"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418121.1"; locus_tag "C7A06_RS00210"; product "adenine deaminase"; protein_id "WP_001065695.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 39842 41176 . + . gene_id "nbis-gene-38"; ID "nbis-gene-38"; Name "adeQ"; gbkey "Gene"; gene "adeQ"; gene_biotype "protein_coding"; gene_synonym "yicO"; locus_tag "C7A06_RS00215"; +NZ_CP027599.1 RefSeq transcript 39842 41176 . + . gene_id "nbis-gene-38"; transcript_id "gene-C7A06_RS00215"; ID "gene-C7A06_RS00215"; Name "adeQ"; Parent "nbis-gene-38"; gbkey "Gene"; gene "adeQ"; gene_biotype "protein_coding"; gene_synonym "yicO"; locus_tag "C7A06_RS00215"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 39842 41176 . + . gene_id "nbis-gene-38"; transcript_id "gene-C7A06_RS00215"; Dbxref "Genbank:WP_001349999.1"; ID "nbis-exon-39"; Name "WP_001349999.1"; Parent "gene-C7A06_RS00215"; gbkey "CDS"; gene "adeQ"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418120.2"; locus_tag "C7A06_RS00215"; product "adenine permease AdeQ"; protein_id "WP_001349999.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 39842 41176 . + 0 gene_id "nbis-gene-38"; transcript_id "gene-C7A06_RS00215"; Dbxref "Genbank:WP_001349999.1"; ID "cds-WP_001349999.1"; Name "WP_001349999.1"; Parent "gene-C7A06_RS00215"; gbkey "CDS"; gene "adeQ"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418120.2"; locus_tag "C7A06_RS00215"; product "adenine permease AdeQ"; protein_id "WP_001349999.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 41229 41681 . + . gene_id "nbis-gene-39"; ID "nbis-gene-39"; Name "yicN"; gbkey "Gene"; gene "yicN"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00220"; +NZ_CP027599.1 RefSeq transcript 41229 41681 . + . gene_id "nbis-gene-39"; transcript_id "gene-C7A06_RS00220"; ID "gene-C7A06_RS00220"; Name "yicN"; Parent "nbis-gene-39"; gbkey "Gene"; gene "yicN"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00220"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 41229 41681 . + . gene_id "nbis-gene-39"; transcript_id "gene-C7A06_RS00220"; Dbxref "Genbank:WP_001295241.1"; ID "nbis-exon-40"; Name "WP_001295241.1"; Parent "gene-C7A06_RS00220"; gbkey "CDS"; gene "yicN"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418119.2"; locus_tag "C7A06_RS00220"; product "DUF1198 domain-containing protein"; protein_id "WP_001295241.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 41229 41681 . + 0 gene_id "nbis-gene-39"; transcript_id "gene-C7A06_RS00220"; Dbxref "Genbank:WP_001295241.1"; ID "cds-WP_001295241.1"; Name "WP_001295241.1"; Parent "gene-C7A06_RS00220"; gbkey "CDS"; gene "yicN"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418119.2"; locus_tag "C7A06_RS00220"; product "DUF1198 domain-containing protein"; protein_id "WP_001295241.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 41892 43082 . + . gene_id "nbis-gene-40"; ID "nbis-gene-40"; Name "nepI"; gbkey "Gene"; gene "nepI"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00230"; +NZ_CP027599.1 RefSeq transcript 41892 43082 . + . gene_id "nbis-gene-40"; transcript_id "gene-C7A06_RS00230"; ID "gene-C7A06_RS00230"; Name "nepI"; Parent "nbis-gene-40"; gbkey "Gene"; gene "nepI"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00230"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 41892 43082 . + . gene_id "nbis-gene-40"; transcript_id "gene-C7A06_RS00230"; Dbxref "Genbank:WP_001288553.1"; ID "nbis-exon-41"; Name "WP_001288553.1"; Ontology_term "GO:0015860" "GO:0015211" "GO:0016021"; Parent "gene-C7A06_RS00230"; gbkey "CDS"; gene "nepI"; go_component "integral component of membrane|0016021||IEA"; go_function "purine nucleoside transmembrane transporter activity|0015211||IEA"; go_process "purine nucleoside transmembrane transport|0015860||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418118.2"; locus_tag "C7A06_RS00230"; product "purine ribonucleoside efflux pump NepI"; protein_id "WP_001288553.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 41892 43082 . + 0 gene_id "nbis-gene-40"; transcript_id "gene-C7A06_RS00230"; Dbxref "Genbank:WP_001288553.1"; ID "cds-WP_001288553.1"; Name "WP_001288553.1"; Ontology_term "GO:0015860" "GO:0015211" "GO:0016021"; Parent "gene-C7A06_RS00230"; gbkey "CDS"; gene "nepI"; go_component "integral component of membrane|0016021||IEA"; go_function "purine nucleoside transmembrane transporter activity|0015211||IEA"; go_process "purine nucleoside transmembrane transport|0015860||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418118.2"; locus_tag "C7A06_RS00230"; product "purine ribonucleoside efflux pump NepI"; protein_id "WP_001288553.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 43123 43416 . - . gene_id "nbis-gene-41"; ID "nbis-gene-41"; Name "C7A06_RS00235"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00235"; +NZ_CP027599.1 RefSeq transcript 43123 43416 . - . gene_id "nbis-gene-41"; transcript_id "gene-C7A06_RS00235"; ID "gene-C7A06_RS00235"; Name "C7A06_RS00235"; Parent "nbis-gene-41"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00235"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 43123 43416 . - . gene_id "nbis-gene-41"; transcript_id "gene-C7A06_RS00235"; Dbxref "Genbank:WP_000805507.1"; ID "nbis-exon-42"; Name "WP_000805507.1"; Parent "gene-C7A06_RS00235"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_588471.1"; locus_tag "C7A06_RS00235"; product "hypothetical protein"; protein_id "WP_000805507.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 43123 43416 . - 0 gene_id "nbis-gene-41"; transcript_id "gene-C7A06_RS00235"; Dbxref "Genbank:WP_000805507.1"; ID "cds-WP_000805507.1"; Name "WP_000805507.1"; Parent "gene-C7A06_RS00235"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_588471.1"; locus_tag "C7A06_RS00235"; product "hypothetical protein"; protein_id "WP_000805507.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 43638 44456 . + . gene_id "nbis-gene-42"; ID "nbis-gene-42"; Name "nlpA"; gbkey "Gene"; gene "nlpA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00245"; +NZ_CP027599.1 RefSeq transcript 43638 44456 . + . gene_id "nbis-gene-42"; transcript_id "gene-C7A06_RS00245"; ID "gene-C7A06_RS00245"; Name "nlpA"; Parent "nbis-gene-42"; gbkey "Gene"; gene "nlpA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00245"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 43638 44456 . + . gene_id "nbis-gene-42"; transcript_id "gene-C7A06_RS00245"; Dbxref "Genbank:WP_000779426.1"; ID "nbis-exon-43"; Name "WP_000779426.1"; Parent "gene-C7A06_RS00245"; gbkey "CDS"; gene "nlpA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418117.1"; locus_tag "C7A06_RS00245"; product "lipoprotein NlpA"; protein_id "WP_000779426.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 43638 44456 . + 0 gene_id "nbis-gene-42"; transcript_id "gene-C7A06_RS00245"; Dbxref "Genbank:WP_000779426.1"; ID "cds-WP_000779426.1"; Name "WP_000779426.1"; Parent "gene-C7A06_RS00245"; gbkey "CDS"; gene "nlpA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418117.1"; locus_tag "C7A06_RS00245"; product "lipoprotein NlpA"; protein_id "WP_000779426.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 44460 45383 . - . gene_id "nbis-gene-43"; ID "nbis-gene-43"; Name "yicL"; gbkey "Gene"; gene "yicL"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00250"; +NZ_CP027599.1 RefSeq transcript 44460 45383 . - . gene_id "nbis-gene-43"; transcript_id "gene-C7A06_RS00250"; ID "gene-C7A06_RS00250"; Name "yicL"; Parent "nbis-gene-43"; gbkey "Gene"; gene "yicL"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00250"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 44460 45383 . - . gene_id "nbis-gene-43"; transcript_id "gene-C7A06_RS00250"; Dbxref "Genbank:WP_000535958.1"; ID "nbis-exon-44"; Name "WP_000535958.1"; Ontology_term "GO:0016021"; Parent "gene-C7A06_RS00250"; gbkey "CDS"; gene "yicL"; go_component "integral component of membrane|0016021||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418116.1"; locus_tag "C7A06_RS00250"; product "carboxylate/amino acid/amine transporter"; protein_id "WP_000535958.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 44460 45383 . - 0 gene_id "nbis-gene-43"; transcript_id "gene-C7A06_RS00250"; Dbxref "Genbank:WP_000535958.1"; ID "cds-WP_000535958.1"; Name "WP_000535958.1"; Ontology_term "GO:0016021"; Parent "gene-C7A06_RS00250"; gbkey "CDS"; gene "yicL"; go_component "integral component of membrane|0016021||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418116.1"; locus_tag "C7A06_RS00250"; product "carboxylate/amino acid/amine transporter"; protein_id "WP_000535958.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 45494 46678 . - . gene_id "nbis-gene-44"; ID "nbis-gene-44"; Name "setC"; gbkey "Gene"; gene "setC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00255"; +NZ_CP027599.1 RefSeq transcript 45494 46678 . - . gene_id "nbis-gene-44"; transcript_id "gene-C7A06_RS00255"; ID "gene-C7A06_RS00255"; Name "setC"; Parent "nbis-gene-44"; gbkey "Gene"; gene "setC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00255"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 45494 46678 . - . gene_id "nbis-gene-44"; transcript_id "gene-C7A06_RS00255"; Dbxref "Genbank:WP_001172895.1"; ID "nbis-exon-45"; Name "WP_001172895.1"; Ontology_term "GO:0008643" "GO:0005351"; Parent "gene-C7A06_RS00255"; gbkey "CDS"; gene "setC"; go_function "carbohydrate:proton symporter activity|0005351||IEA"; go_process "carbohydrate transport|0008643||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418115.1"; locus_tag "C7A06_RS00255"; product "sugar efflux transporter"; protein_id "WP_001172895.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 45494 46678 . - 0 gene_id "nbis-gene-44"; transcript_id "gene-C7A06_RS00255"; Dbxref "Genbank:WP_001172895.1"; ID "cds-WP_001172895.1"; Name "WP_001172895.1"; Ontology_term "GO:0008643" "GO:0005351"; Parent "gene-C7A06_RS00255"; gbkey "CDS"; gene "setC"; go_function "carbohydrate:proton symporter activity|0005351||IEA"; go_process "carbohydrate transport|0008643||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418115.1"; locus_tag "C7A06_RS00255"; product "sugar efflux transporter"; protein_id "WP_001172895.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 47107 47235 . - . gene_id "nbis-pseudogene-2"; ID "nbis-pseudogene-2"; Name "C7A06_RS00260"; end_range "47235" "."; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS00260"; original_biotype "pseudogene"; partial "true"; pseudo "true"; start_range "." "47107"; +NZ_CP027599.1 RefSeq transcript 47107 47235 . - . gene_id "nbis-pseudogene-2"; transcript_id "gene-C7A06_RS00260"; ID "gene-C7A06_RS00260"; Name "C7A06_RS00260"; Parent "nbis-pseudogene-2"; end_range "47235" "."; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS00260"; original_biotype "mrna"; partial "true"; pseudo "true"; start_range "." "47107"; +NZ_CP027599.1 Protein Homology exon 47107 47235 . - . gene_id "nbis-pseudogene-2"; transcript_id "gene-C7A06_RS00260"; ID "nbis-exon-46"; Note "internal stop; incomplete; partial in the middle of a contig; missing N-terminus and C-terminus"; Parent "gene-C7A06_RS00260"; end_range "47235" "."; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_462654.1"; locus_tag "C7A06_RS00260"; partial "true"; product "virulence RhuM family protein"; pseudo "true"; start_range "." "47107"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 47107 47235 . - 0 gene_id "nbis-pseudogene-2"; transcript_id "gene-C7A06_RS00260"; ID "cds-C7A06_RS00260"; Note "internal stop; incomplete; partial in the middle of a contig; missing N-terminus and C-terminus"; Parent "gene-C7A06_RS00260"; end_range "47235" "."; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_462654.1"; locus_tag "C7A06_RS00260"; partial "true"; product "virulence RhuM family protein"; pseudo "true"; start_range "." "47107"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 47473 48315 . - . gene_id "nbis-gene-45"; ID "nbis-gene-45"; Name "C7A06_RS00270"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00270"; +NZ_CP027599.1 RefSeq transcript 47473 48315 . - . gene_id "nbis-gene-45"; transcript_id "gene-C7A06_RS00270"; ID "gene-C7A06_RS00270"; Name "C7A06_RS00270"; Parent "nbis-gene-45"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00270"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 47473 48315 . - . gene_id "nbis-gene-45"; transcript_id "gene-C7A06_RS00270"; Dbxref "Genbank:WP_032348719.1"; ID "nbis-exon-47"; Name "WP_032348719.1"; Parent "gene-C7A06_RS00270"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001696593.1"; locus_tag "C7A06_RS00270"; product "DUF4942 domain-containing protein"; protein_id "WP_032348719.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 47473 48315 . - 0 gene_id "nbis-gene-45"; transcript_id "gene-C7A06_RS00270"; Dbxref "Genbank:WP_032348719.1"; ID "cds-WP_032348719.1"; Name "WP_032348719.1"; Parent "gene-C7A06_RS00270"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001696593.1"; locus_tag "C7A06_RS00270"; product "DUF4942 domain-containing protein"; protein_id "WP_032348719.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 48400 48597 . - . gene_id "nbis-gene-46"; ID "nbis-gene-46"; Name "C7A06_RS00275"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00275"; +NZ_CP027599.1 RefSeq transcript 48400 48597 . - . gene_id "nbis-gene-46"; transcript_id "gene-C7A06_RS00275"; ID "gene-C7A06_RS00275"; Name "C7A06_RS00275"; Parent "nbis-gene-46"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00275"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 48400 48597 . - . gene_id "nbis-gene-46"; transcript_id "gene-C7A06_RS00275"; Dbxref "Genbank:WP_086795284.1"; ID "nbis-exon-48"; Name "WP_086795284.1"; Parent "gene-C7A06_RS00275"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_708775.1"; locus_tag "C7A06_RS00275"; product "DUF957 domain-containing protein"; protein_id "WP_086795284.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 48400 48597 . - 0 gene_id "nbis-gene-46"; transcript_id "gene-C7A06_RS00275"; Dbxref "Genbank:WP_086795284.1"; ID "cds-WP_086795284.1"; Name "WP_086795284.1"; Parent "gene-C7A06_RS00275"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_708775.1"; locus_tag "C7A06_RS00275"; product "DUF957 domain-containing protein"; protein_id "WP_086795284.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 48673 48822 . - . gene_id "nbis-pseudogene-3"; ID "nbis-pseudogene-3"; Name "C7A06_RS00280"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS00280"; original_biotype "pseudogene"; partial "true"; pseudo "true"; start_range "." "48673"; +NZ_CP027599.1 RefSeq transcript 48673 48822 . - . gene_id "nbis-pseudogene-3"; transcript_id "gene-C7A06_RS00280"; ID "gene-C7A06_RS00280"; Name "C7A06_RS00280"; Parent "nbis-pseudogene-3"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS00280"; original_biotype "mrna"; partial "true"; pseudo "true"; start_range "." "48673"; +NZ_CP027599.1 Protein Homology exon 48673 48822 . - . gene_id "nbis-pseudogene-3"; transcript_id "gene-C7A06_RS00280"; ID "nbis-exon-49"; Note "incomplete; partial in the middle of a contig; missing C-terminus"; Parent "gene-C7A06_RS00280"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_708774.1"; locus_tag "C7A06_RS00280"; partial "true"; product "DUF5983 family protein"; pseudo "true"; start_range "." "48673"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 48673 48822 . - 0 gene_id "nbis-pseudogene-3"; transcript_id "gene-C7A06_RS00280"; ID "cds-C7A06_RS00280"; Note "incomplete; partial in the middle of a contig; missing C-terminus"; Parent "gene-C7A06_RS00280"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_708774.1"; locus_tag "C7A06_RS00280"; partial "true"; product "DUF5983 family protein"; pseudo "true"; start_range "." "48673"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 48819 49196 . - . gene_id "nbis-gene-47"; ID "nbis-gene-47"; Name "cbtA"; gbkey "Gene"; gene "cbtA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00285"; +NZ_CP027599.1 RefSeq transcript 48819 49196 . - . gene_id "nbis-gene-47"; transcript_id "gene-C7A06_RS00285"; ID "gene-C7A06_RS00285"; Name "cbtA"; Parent "nbis-gene-47"; gbkey "Gene"; gene "cbtA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00285"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 48819 49196 . - . gene_id "nbis-gene-47"; transcript_id "gene-C7A06_RS00285"; Dbxref "Genbank:WP_000854821.1"; ID "nbis-exon-50"; Name "WP_000854821.1"; Parent "gene-C7A06_RS00285"; gbkey "CDS"; gene "cbtA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000854828.1"; locus_tag "C7A06_RS00285"; product "type IV toxin-antitoxin system toxin CbtA"; protein_id "WP_000854821.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 48819 49196 . - 0 gene_id "nbis-gene-47"; transcript_id "gene-C7A06_RS00285"; Dbxref "Genbank:WP_000854821.1"; ID "cds-WP_000854821.1"; Name "WP_000854821.1"; Parent "gene-C7A06_RS00285"; gbkey "CDS"; gene "cbtA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000854828.1"; locus_tag "C7A06_RS00285"; product "type IV toxin-antitoxin system toxin CbtA"; protein_id "WP_000854821.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 49286 49654 . - . gene_id "nbis-gene-48"; ID "nbis-gene-48"; Name "C7A06_RS00290"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00290"; +NZ_CP027599.1 RefSeq transcript 49286 49654 . - . gene_id "nbis-gene-48"; transcript_id "gene-C7A06_RS00290"; ID "gene-C7A06_RS00290"; Name "C7A06_RS00290"; Parent "nbis-gene-48"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00290"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 49286 49654 . - . gene_id "nbis-gene-48"; transcript_id "gene-C7A06_RS00290"; Dbxref "Genbank:WP_001285609.1"; ID "nbis-exon-51"; Name "WP_001285609.1"; Parent "gene-C7A06_RS00290"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001443430.1"; locus_tag "C7A06_RS00290"; product "type IV toxin-antitoxin system YeeU family antitoxin"; protein_id "WP_001285609.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 49286 49654 . - 0 gene_id "nbis-gene-48"; transcript_id "gene-C7A06_RS00290"; Dbxref "Genbank:WP_001285609.1"; ID "cds-WP_001285609.1"; Name "WP_001285609.1"; Parent "gene-C7A06_RS00290"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001443430.1"; locus_tag "C7A06_RS00290"; product "type IV toxin-antitoxin system YeeU family antitoxin"; protein_id "WP_001285609.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 49734 49955 . - . gene_id "nbis-pseudogene-4"; ID "nbis-pseudogene-4"; Name "C7A06_RS00295"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS00295"; original_biotype "pseudogene"; pseudo "true"; +NZ_CP027599.1 RefSeq transcript 49734 49955 . - . gene_id "nbis-pseudogene-4"; transcript_id "gene-C7A06_RS00295"; ID "gene-C7A06_RS00295"; Name "C7A06_RS00295"; Parent "nbis-pseudogene-4"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS00295"; original_biotype "mrna"; pseudo "true"; +NZ_CP027599.1 Protein Homology exon 49734 49955 . - . gene_id "nbis-pseudogene-4"; transcript_id "gene-C7A06_RS00295"; ID "nbis-exon-52"; Note "internal stop"; Parent "gene-C7A06_RS00295"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_708771.1"; locus_tag "C7A06_RS00295"; product "DUF987 domain-containing protein"; pseudo "true"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 49734 49955 . - 0 gene_id "nbis-pseudogene-4"; transcript_id "gene-C7A06_RS00295"; ID "cds-C7A06_RS00295"; Note "internal stop"; Parent "gene-C7A06_RS00295"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_708771.1"; locus_tag "C7A06_RS00295"; product "DUF987 domain-containing protein"; pseudo "true"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 50042 50518 . - . gene_id "nbis-gene-49"; ID "nbis-gene-49"; Name "C7A06_RS00300"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00300"; +NZ_CP027599.1 RefSeq transcript 50042 50518 . - . gene_id "nbis-gene-49"; transcript_id "gene-C7A06_RS00300"; ID "gene-C7A06_RS00300"; Name "C7A06_RS00300"; Parent "nbis-gene-49"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00300"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 50042 50518 . - . gene_id "nbis-gene-49"; transcript_id "gene-C7A06_RS00300"; Dbxref "Genbank:WP_001186768.1"; ID "nbis-exon-53"; Name "WP_001186768.1"; Parent "gene-C7A06_RS00300"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_310830.1"; locus_tag "C7A06_RS00300"; product "RadC family protein"; protein_id "WP_001186768.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 50042 50518 . - 0 gene_id "nbis-gene-49"; transcript_id "gene-C7A06_RS00300"; Dbxref "Genbank:WP_001186768.1"; ID "cds-WP_001186768.1"; Name "WP_001186768.1"; Parent "gene-C7A06_RS00300"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_310830.1"; locus_tag "C7A06_RS00300"; product "RadC family protein"; protein_id "WP_001186768.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 50533 51012 . - . gene_id "nbis-gene-50"; ID "nbis-gene-50"; Name "C7A06_RS00305"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00305"; +NZ_CP027599.1 RefSeq transcript 50533 51012 . - . gene_id "nbis-gene-50"; transcript_id "gene-C7A06_RS00305"; ID "gene-C7A06_RS00305"; Name "C7A06_RS00305"; Parent "nbis-gene-50"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00305"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 50533 51012 . - . gene_id "nbis-gene-50"; transcript_id "gene-C7A06_RS00305"; Dbxref "Genbank:WP_000706979.1"; ID "nbis-exon-54"; Name "WP_000706979.1"; Parent "gene-C7A06_RS00305"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_708769.2"; locus_tag "C7A06_RS00305"; product "antirestriction protein"; protein_id "WP_000706979.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 50533 51012 . - 0 gene_id "nbis-gene-50"; transcript_id "gene-C7A06_RS00305"; Dbxref "Genbank:WP_000706979.1"; ID "cds-WP_000706979.1"; Name "WP_000706979.1"; Parent "gene-C7A06_RS00305"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_708769.2"; locus_tag "C7A06_RS00305"; product "antirestriction protein"; protein_id "WP_000706979.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 51112 51252 . + . gene_id "nbis-gene-5706"; ID "nbis-gene-5706"; Name "C7A06_RS33905"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33905"; +NZ_CP027599.1 RefSeq transcript 51112 51252 . + . gene_id "nbis-gene-5706"; transcript_id "gene-C7A06_RS33905"; ID "gene-C7A06_RS33905"; Name "C7A06_RS33905"; Parent "nbis-gene-5706"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33905"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 51112 51252 . + . gene_id "nbis-gene-5706"; transcript_id "gene-C7A06_RS33905"; Dbxref "Genbank:WP_000997937.1"; ID "nbis-exon-5987"; Name "WP_000997937.1"; Parent "gene-C7A06_RS33905"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000997937.1"; locus_tag "C7A06_RS33905"; product "hypothetical protein"; protein_id "WP_000997937.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 51112 51252 . + 0 gene_id "nbis-gene-5706"; transcript_id "gene-C7A06_RS33905"; Dbxref "Genbank:WP_000997937.1"; ID "cds-WP_000997937.1"; Name "WP_000997937.1"; Parent "gene-C7A06_RS33905"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000997937.1"; locus_tag "C7A06_RS33905"; product "hypothetical protein"; protein_id "WP_000997937.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 51290 52096 . - . gene_id "nbis-gene-51"; ID "nbis-gene-51"; Name "C7A06_RS00310"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00310"; +NZ_CP027599.1 RefSeq transcript 51290 52096 . - . gene_id "nbis-gene-51"; transcript_id "gene-C7A06_RS00310"; ID "gene-C7A06_RS00310"; Name "C7A06_RS00310"; Parent "nbis-gene-51"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00310"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 51290 52096 . - . gene_id "nbis-gene-51"; transcript_id "gene-C7A06_RS00310"; Dbxref "Genbank:WP_001175154.1"; ID "nbis-exon-55"; Name "WP_001175154.1"; Parent "gene-C7A06_RS00310"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_309428.1"; locus_tag "C7A06_RS00310"; product "DUF945 domain-containing protein"; protein_id "WP_001175154.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 51290 52096 . - 0 gene_id "nbis-gene-51"; transcript_id "gene-C7A06_RS00310"; Dbxref "Genbank:WP_001175154.1"; ID "cds-WP_001175154.1"; Name "WP_001175154.1"; Parent "gene-C7A06_RS00310"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_309428.1"; locus_tag "C7A06_RS00310"; product "DUF945 domain-containing protein"; protein_id "WP_001175154.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 52186 52419 . - . gene_id "nbis-gene-52"; ID "nbis-gene-52"; Name "C7A06_RS00315"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00315"; +NZ_CP027599.1 RefSeq transcript 52186 52419 . - . gene_id "nbis-gene-52"; transcript_id "gene-C7A06_RS00315"; ID "gene-C7A06_RS00315"; Name "C7A06_RS00315"; Parent "nbis-gene-52"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00315"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 52186 52419 . - . gene_id "nbis-gene-52"; transcript_id "gene-C7A06_RS00315"; Dbxref "Genbank:WP_001278287.1"; ID "nbis-exon-56"; Name "WP_001278287.1"; Parent "gene-C7A06_RS00315"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001278287.1"; locus_tag "C7A06_RS00315"; product "DUF905 family protein"; protein_id "WP_001278287.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 52186 52419 . - 0 gene_id "nbis-gene-52"; transcript_id "gene-C7A06_RS00315"; Dbxref "Genbank:WP_001278287.1"; ID "cds-WP_001278287.1"; Name "WP_001278287.1"; Parent "gene-C7A06_RS00315"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001278287.1"; locus_tag "C7A06_RS00315"; product "DUF905 family protein"; protein_id "WP_001278287.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 52425 53102 . - . gene_id "nbis-gene-53"; ID "nbis-gene-53"; Name "C7A06_RS00320"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00320"; +NZ_CP027599.1 RefSeq transcript 52425 53102 . - . gene_id "nbis-gene-53"; transcript_id "gene-C7A06_RS00320"; ID "gene-C7A06_RS00320"; Name "C7A06_RS00320"; Parent "nbis-gene-53"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00320"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 52425 53102 . - . gene_id "nbis-gene-53"; transcript_id "gene-C7A06_RS00320"; Dbxref "Genbank:WP_001097301.1"; ID "nbis-exon-57"; Name "WP_001097301.1"; Parent "gene-C7A06_RS00320"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001097314.1"; locus_tag "C7A06_RS00320"; product "hypothetical protein"; protein_id "WP_001097301.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 52425 53102 . - 0 gene_id "nbis-gene-53"; transcript_id "gene-C7A06_RS00320"; Dbxref "Genbank:WP_001097301.1"; ID "cds-WP_001097301.1"; Name "WP_001097301.1"; Parent "gene-C7A06_RS00320"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001097314.1"; locus_tag "C7A06_RS00320"; product "hypothetical protein"; protein_id "WP_001097301.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 53250 53930 . - . gene_id "nbis-gene-54"; ID "nbis-gene-54"; Name "C7A06_RS00325"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00325"; +NZ_CP027599.1 RefSeq transcript 53250 53930 . - . gene_id "nbis-gene-54"; transcript_id "gene-C7A06_RS00325"; ID "gene-C7A06_RS00325"; Name "C7A06_RS00325"; Parent "nbis-gene-54"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00325"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 53250 53930 . - . gene_id "nbis-gene-54"; transcript_id "gene-C7A06_RS00325"; Dbxref "Genbank:WP_001282919.1"; ID "nbis-exon-58"; Name "WP_001282919.1"; Parent "gene-C7A06_RS00325"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001278649.1"; locus_tag "C7A06_RS00325"; product "WYL domain-containing protein"; protein_id "WP_001282919.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 53250 53930 . - 0 gene_id "nbis-gene-54"; transcript_id "gene-C7A06_RS00325"; Dbxref "Genbank:WP_001282919.1"; ID "cds-WP_001282919.1"; Name "WP_001282919.1"; Parent "gene-C7A06_RS00325"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001278649.1"; locus_tag "C7A06_RS00325"; product "WYL domain-containing protein"; protein_id "WP_001282919.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 54133 55017 . - . gene_id "nbis-gene-55"; ID "nbis-gene-55"; Name "C7A06_RS00330"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00330"; +NZ_CP027599.1 RefSeq transcript 54133 55017 . - . gene_id "nbis-gene-55"; transcript_id "gene-C7A06_RS00330"; ID "gene-C7A06_RS00330"; Name "C7A06_RS00330"; Parent "nbis-gene-55"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00330"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 54133 55017 . - . gene_id "nbis-gene-55"; transcript_id "gene-C7A06_RS00330"; Dbxref "Genbank:WP_000010408.1"; ID "nbis-exon-59"; Name "WP_000010408.1"; Ontology_term "GO:0005525"; Parent "gene-C7A06_RS00330"; gbkey "CDS"; go_function "GTP binding|0005525||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001557377.1"; locus_tag "C7A06_RS00330"; product "50S ribosome-binding GTPase"; protein_id "WP_000010408.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 54133 55017 . - 0 gene_id "nbis-gene-55"; transcript_id "gene-C7A06_RS00330"; Dbxref "Genbank:WP_000010408.1"; ID "cds-WP_000010408.1"; Name "WP_000010408.1"; Ontology_term "GO:0005525"; Parent "gene-C7A06_RS00330"; gbkey "CDS"; go_function "GTP binding|0005525||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001557377.1"; locus_tag "C7A06_RS00330"; product "50S ribosome-binding GTPase"; protein_id "WP_000010408.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 55202 56332 . + . gene_id "nbis-gene-56"; ID "nbis-gene-56"; Name "C7A06_RS00335"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00335"; +NZ_CP027599.1 RefSeq transcript 55202 56332 . + . gene_id "nbis-gene-56"; transcript_id "gene-C7A06_RS00335"; ID "gene-C7A06_RS00335"; Name "C7A06_RS00335"; Parent "nbis-gene-56"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00335"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 55202 56332 . + . gene_id "nbis-gene-56"; transcript_id "gene-C7A06_RS00335"; Dbxref "Genbank:WP_000147741.1"; ID "nbis-exon-60"; Name "WP_000147741.1"; Parent "gene-C7A06_RS00335"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000147750.1"; locus_tag "C7A06_RS00335"; product "hypothetical protein"; protein_id "WP_000147741.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 55202 56332 . + 0 gene_id "nbis-gene-56"; transcript_id "gene-C7A06_RS00335"; Dbxref "Genbank:WP_000147741.1"; ID "cds-WP_000147741.1"; Name "WP_000147741.1"; Parent "gene-C7A06_RS00335"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000147750.1"; locus_tag "C7A06_RS00335"; product "hypothetical protein"; protein_id "WP_000147741.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 57825 58556 . + . gene_id "nbis-gene-57"; ID "nbis-gene-57"; Name "C7A06_RS00340"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00340"; +NZ_CP027599.1 RefSeq transcript 57825 58556 . + . gene_id "nbis-gene-57"; transcript_id "gene-C7A06_RS00340"; ID "gene-C7A06_RS00340"; Name "C7A06_RS00340"; Parent "nbis-gene-57"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00340"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 57825 58556 . + . gene_id "nbis-gene-57"; transcript_id "gene-C7A06_RS00340"; Dbxref "Genbank:WP_001075456.1"; ID "nbis-exon-61"; Name "WP_001075456.1"; Parent "gene-C7A06_RS00340"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001075464.1"; locus_tag "C7A06_RS00340"; product "inovirus Gp2 family protein"; protein_id "WP_001075456.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 57825 58556 . + 0 gene_id "nbis-gene-57"; transcript_id "gene-C7A06_RS00340"; Dbxref "Genbank:WP_001075456.1"; ID "cds-WP_001075456.1"; Name "WP_001075456.1"; Parent "gene-C7A06_RS00340"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001075464.1"; locus_tag "C7A06_RS00340"; product "inovirus Gp2 family protein"; protein_id "WP_001075456.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 58884 59762 . + . gene_id "nbis-gene-58"; ID "nbis-gene-58"; Name "C7A06_RS00345"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00345"; +NZ_CP027599.1 RefSeq transcript 58884 59762 . + . gene_id "nbis-gene-58"; transcript_id "gene-C7A06_RS00345"; ID "gene-C7A06_RS00345"; Name "C7A06_RS00345"; Parent "nbis-gene-58"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00345"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 58884 59762 . + . gene_id "nbis-gene-58"; transcript_id "gene-C7A06_RS00345"; Dbxref "Genbank:WP_000769115.1"; ID "nbis-exon-62"; Name "WP_000769115.1"; Parent "gene-C7A06_RS00345"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_008786839.1"; locus_tag "C7A06_RS00345"; product "restriction endonuclease"; protein_id "WP_000769115.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 58884 59762 . + 0 gene_id "nbis-gene-58"; transcript_id "gene-C7A06_RS00345"; Dbxref "Genbank:WP_000769115.1"; ID "cds-WP_000769115.1"; Name "WP_000769115.1"; Parent "gene-C7A06_RS00345"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_008786839.1"; locus_tag "C7A06_RS00345"; product "restriction endonuclease"; protein_id "WP_000769115.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 59816 60369 . + . gene_id "nbis-pseudogene-5"; ID "nbis-pseudogene-5"; Name "C7A06_RS00350"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS00350"; original_biotype "pseudogene"; partial "true"; pseudo "true"; start_range "." "59816"; +NZ_CP027599.1 RefSeq transcript 59816 60369 . + . gene_id "nbis-pseudogene-5"; transcript_id "gene-C7A06_RS00350"; ID "gene-C7A06_RS00350"; Name "C7A06_RS00350"; Parent "nbis-pseudogene-5"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS00350"; original_biotype "mrna"; partial "true"; pseudo "true"; start_range "." "59816"; +NZ_CP027599.1 Protein Homology exon 59816 60369 . + . gene_id "nbis-pseudogene-5"; transcript_id "gene-C7A06_RS00350"; ID "nbis-exon-63"; Note "frameshifted; internal stop; incomplete; partial in the middle of a contig; missing N-terminus"; Ontology_term "GO:0006313" "GO:0003677" "GO:0004803"; Parent "gene-C7A06_RS00350"; gbkey "CDS"; go_function "DNA binding|0003677||IEA" "transposase activity|0004803||IEA"; go_process "transposition, DNA-mediated|0006313||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000343613.1"; locus_tag "C7A06_RS00350"; partial "true"; product "transposase"; pseudo "true"; start_range "." "59816"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 59816 60369 . + 0 gene_id "nbis-pseudogene-5"; transcript_id "gene-C7A06_RS00350"; ID "cds-C7A06_RS00350"; Note "frameshifted; internal stop; incomplete; partial in the middle of a contig; missing N-terminus"; Ontology_term "GO:0006313" "GO:0003677" "GO:0004803"; Parent "gene-C7A06_RS00350"; gbkey "CDS"; go_function "DNA binding|0003677||IEA" "transposase activity|0004803||IEA"; go_process "transposition, DNA-mediated|0006313||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000343613.1"; locus_tag "C7A06_RS00350"; partial "true"; product "transposase"; pseudo "true"; start_range "." "59816"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 61437 62003 . + . gene_id "nbis-gene-59"; ID "nbis-gene-59"; Name "C7A06_RS00355"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00355"; +NZ_CP027599.1 RefSeq transcript 61437 62003 . + . gene_id "nbis-gene-59"; transcript_id "gene-C7A06_RS00355"; ID "gene-C7A06_RS00355"; Name "C7A06_RS00355"; Parent "nbis-gene-59"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00355"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 61437 62003 . + . gene_id "nbis-gene-59"; transcript_id "gene-C7A06_RS00355"; Dbxref "Genbank:WP_001126817.1"; ID "nbis-exon-64"; Name "WP_001126817.1"; Parent "gene-C7A06_RS00355"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001126805.1"; locus_tag "C7A06_RS00355"; product "inovirus-type Gp2 protein"; protein_id "WP_001126817.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 61437 62003 . + 0 gene_id "nbis-gene-59"; transcript_id "gene-C7A06_RS00355"; Dbxref "Genbank:WP_001126817.1"; ID "cds-WP_001126817.1"; Name "WP_001126817.1"; Parent "gene-C7A06_RS00355"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001126805.1"; locus_tag "C7A06_RS00355"; product "inovirus-type Gp2 protein"; protein_id "WP_001126817.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 62250 62822 . + . gene_id "nbis-gene-60"; ID "nbis-gene-60"; Name "C7A06_RS00360"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00360"; +NZ_CP027599.1 RefSeq transcript 62250 62822 . + . gene_id "nbis-gene-60"; transcript_id "gene-C7A06_RS00360"; ID "gene-C7A06_RS00360"; Name "C7A06_RS00360"; Parent "nbis-gene-60"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00360"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 62250 62822 . + . gene_id "nbis-gene-60"; transcript_id "gene-C7A06_RS00360"; Dbxref "Genbank:WP_000991590.1"; ID "nbis-exon-65"; Name "WP_000991590.1"; Parent "gene-C7A06_RS00360"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_012602601.1"; locus_tag "C7A06_RS00360"; product "hypothetical protein"; protein_id "WP_000991590.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 62250 62822 . + 0 gene_id "nbis-gene-60"; transcript_id "gene-C7A06_RS00360"; Dbxref "Genbank:WP_000991590.1"; ID "cds-WP_000991590.1"; Name "WP_000991590.1"; Parent "gene-C7A06_RS00360"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_012602601.1"; locus_tag "C7A06_RS00360"; product "hypothetical protein"; protein_id "WP_000991590.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 62891 63127 . + . gene_id "nbis-gene-61"; ID "nbis-gene-61"; Name "C7A06_RS00365"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00365"; +NZ_CP027599.1 RefSeq transcript 62891 63127 . + . gene_id "nbis-gene-61"; transcript_id "gene-C7A06_RS00365"; ID "gene-C7A06_RS00365"; Name "C7A06_RS00365"; Parent "nbis-gene-61"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00365"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 62891 63127 . + . gene_id "nbis-gene-61"; transcript_id "gene-C7A06_RS00365"; Dbxref "Genbank:WP_000958094.1"; ID "nbis-exon-66"; Name "WP_000958094.1"; Parent "gene-C7A06_RS00365"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000958092.1"; locus_tag "C7A06_RS00365"; product "AlpA family transcriptional regulator"; protein_id "WP_000958094.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 62891 63127 . + 0 gene_id "nbis-gene-61"; transcript_id "gene-C7A06_RS00365"; Dbxref "Genbank:WP_000958094.1"; ID "cds-WP_000958094.1"; Name "WP_000958094.1"; Parent "gene-C7A06_RS00365"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000958092.1"; locus_tag "C7A06_RS00365"; product "AlpA family transcriptional regulator"; protein_id "WP_000958094.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 63762 64880 . + . gene_id "nbis-gene-62"; ID "nbis-gene-62"; Name "C7A06_RS00375"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00375"; +NZ_CP027599.1 RefSeq transcript 63762 64880 . + . gene_id "nbis-gene-62"; transcript_id "gene-C7A06_RS00375"; ID "gene-C7A06_RS00375"; Name "C7A06_RS00375"; Parent "nbis-gene-62"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00375"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 63762 64880 . + . gene_id "nbis-gene-62"; transcript_id "gene-C7A06_RS00375"; Dbxref "Genbank:WP_001231527.1"; ID "nbis-exon-67"; Name "WP_001231527.1"; Parent "gene-C7A06_RS00375"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001231518.1"; locus_tag "C7A06_RS00375"; product "glycosyltransferase"; protein_id "WP_001231527.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 63762 64880 . + 0 gene_id "nbis-gene-62"; transcript_id "gene-C7A06_RS00375"; Dbxref "Genbank:WP_001231527.1"; ID "cds-WP_001231527.1"; Name "WP_001231527.1"; Parent "gene-C7A06_RS00375"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001231518.1"; locus_tag "C7A06_RS00375"; product "glycosyltransferase"; protein_id "WP_001231527.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 65029 66294 . - . gene_id "nbis-gene-63"; ID "nbis-gene-63"; Name "C7A06_RS00380"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00380"; +NZ_CP027599.1 RefSeq transcript 65029 66294 . - . gene_id "nbis-gene-63"; transcript_id "gene-C7A06_RS00380"; ID "gene-C7A06_RS00380"; Name "C7A06_RS00380"; Parent "nbis-gene-63"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00380"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 65029 66294 . - . gene_id "nbis-gene-63"; transcript_id "gene-C7A06_RS00380"; Dbxref "Genbank:WP_000800845.1"; ID "nbis-exon-68"; Name "WP_000800845.1"; Parent "gene-C7A06_RS00380"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000800843.1"; locus_tag "C7A06_RS00380"; product "alpha/beta hydrolase-fold protein"; protein_id "WP_000800845.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 65029 66294 . - 0 gene_id "nbis-gene-63"; transcript_id "gene-C7A06_RS00380"; Dbxref "Genbank:WP_000800845.1"; ID "cds-WP_000800845.1"; Name "WP_000800845.1"; Parent "gene-C7A06_RS00380"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000800843.1"; locus_tag "C7A06_RS00380"; product "alpha/beta hydrolase-fold protein"; protein_id "WP_000800845.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 66842 67276 . - . gene_id "nbis-gene-64"; ID "nbis-gene-64"; Name "C7A06_RS00390"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00390"; +NZ_CP027599.1 RefSeq transcript 66842 67276 . - . gene_id "nbis-gene-64"; transcript_id "gene-C7A06_RS00390"; ID "gene-C7A06_RS00390"; Name "C7A06_RS00390"; Parent "nbis-gene-64"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00390"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 66842 67276 . - . gene_id "nbis-gene-64"; transcript_id "gene-C7A06_RS00390"; Dbxref "Genbank:WP_000281561.1"; ID "nbis-exon-69"; Name "WP_000281561.1"; Parent "gene-C7A06_RS00390"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001554632.1"; locus_tag "C7A06_RS00390"; product "hypothetical protein"; protein_id "WP_000281561.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 66842 67276 . - 0 gene_id "nbis-gene-64"; transcript_id "gene-C7A06_RS00390"; Dbxref "Genbank:WP_000281561.1"; ID "cds-WP_000281561.1"; Name "WP_000281561.1"; Parent "gene-C7A06_RS00390"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001554632.1"; locus_tag "C7A06_RS00390"; product "hypothetical protein"; protein_id "WP_000281561.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 68088 68297 . + . gene_id "nbis-gene-65"; ID "nbis-gene-65"; Name "mchI"; gbkey "Gene"; gene "mchI"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00395"; +NZ_CP027599.1 RefSeq transcript 68088 68297 . + . gene_id "nbis-gene-65"; transcript_id "gene-C7A06_RS00395"; ID "gene-C7A06_RS00395"; Name "mchI"; Parent "nbis-gene-65"; gbkey "Gene"; gene "mchI"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00395"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 68088 68297 . + . gene_id "nbis-gene-65"; transcript_id "gene-C7A06_RS00395"; Dbxref "Genbank:WP_000120664.1"; ID "nbis-exon-70"; Name "WP_000120664.1"; Parent "gene-C7A06_RS00395"; gbkey "CDS"; gene "mchI"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000120664.1"; locus_tag "C7A06_RS00395"; product "microcin H47 immunity protein MchI"; protein_id "WP_000120664.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 68088 68297 . + 0 gene_id "nbis-gene-65"; transcript_id "gene-C7A06_RS00395"; Dbxref "Genbank:WP_000120664.1"; ID "cds-WP_000120664.1"; Name "WP_000120664.1"; Parent "gene-C7A06_RS00395"; gbkey "CDS"; gene "mchI"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000120664.1"; locus_tag "C7A06_RS00395"; product "microcin H47 immunity protein MchI"; protein_id "WP_000120664.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 68314 68541 . + . gene_id "nbis-gene-66"; ID "nbis-gene-66"; Name "mchB"; gbkey "Gene"; gene "mchB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00400"; +NZ_CP027599.1 RefSeq transcript 68314 68541 . + . gene_id "nbis-gene-66"; transcript_id "gene-C7A06_RS00400"; ID "gene-C7A06_RS00400"; Name "mchB"; Parent "nbis-gene-66"; gbkey "Gene"; gene "mchB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00400"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 68314 68541 . + . gene_id "nbis-gene-66"; transcript_id "gene-C7A06_RS00400"; Dbxref "Genbank:WP_001375214.1"; ID "nbis-exon-71"; Name "WP_001375214.1"; Parent "gene-C7A06_RS00400"; gbkey "CDS"; gene "mchB"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001375214.1"; locus_tag "C7A06_RS00400"; product "microcin H47"; protein_id "WP_001375214.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 68314 68541 . + 0 gene_id "nbis-gene-66"; transcript_id "gene-C7A06_RS00400"; Dbxref "Genbank:WP_001375214.1"; ID "cds-WP_001375214.1"; Name "WP_001375214.1"; Parent "gene-C7A06_RS00400"; gbkey "CDS"; gene "mchB"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001375214.1"; locus_tag "C7A06_RS00400"; product "microcin H47"; protein_id "WP_001375214.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 68812 70362 . + . gene_id "nbis-gene-67"; ID "nbis-gene-67"; Name "C7A06_RS00405"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00405"; +NZ_CP027599.1 RefSeq transcript 68812 70362 . + . gene_id "nbis-gene-67"; transcript_id "gene-C7A06_RS00405"; ID "gene-C7A06_RS00405"; Name "C7A06_RS00405"; Parent "nbis-gene-67"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00405"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 68812 70362 . + . gene_id "nbis-gene-67"; transcript_id "gene-C7A06_RS00405"; Dbxref "Genbank:WP_000019329.1"; ID "nbis-exon-72"; Name "WP_000019329.1"; Parent "gene-C7A06_RS00405"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000019324.1"; locus_tag "C7A06_RS00405"; product "hypothetical protein"; protein_id "WP_000019329.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 68812 70362 . + 0 gene_id "nbis-gene-67"; transcript_id "gene-C7A06_RS00405"; Dbxref "Genbank:WP_000019329.1"; ID "cds-WP_000019329.1"; Name "WP_000019329.1"; Parent "gene-C7A06_RS00405"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000019324.1"; locus_tag "C7A06_RS00405"; product "hypothetical protein"; protein_id "WP_000019329.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 70466 70840 . + . gene_id "nbis-gene-68"; ID "nbis-gene-68"; Name "C7A06_RS00410"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00410"; +NZ_CP027599.1 RefSeq transcript 70466 70840 . + . gene_id "nbis-gene-68"; transcript_id "gene-C7A06_RS00410"; ID "gene-C7A06_RS00410"; Name "C7A06_RS00410"; Parent "nbis-gene-68"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00410"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 70466 70840 . + . gene_id "nbis-gene-68"; transcript_id "gene-C7A06_RS00410"; Dbxref "Genbank:WP_001391575.1"; ID "nbis-exon-73"; Name "WP_001391575.1"; Ontology_term "GO:0009404" "GO:0016746" "GO:0005737"; Parent "gene-C7A06_RS00410"; gbkey "CDS"; go_component "cytoplasm|0005737||IEA"; go_function "acyltransferase activity|0016746||IEA"; go_process "toxin metabolic process|0009404||IEA"; inference "COORDINATES: protein motif:HMM:NF014813.2"; locus_tag "C7A06_RS00410"; product "toxin-activating lysine-acyltransferase"; protein_id "WP_001391575.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 70466 70840 . + 0 gene_id "nbis-gene-68"; transcript_id "gene-C7A06_RS00410"; Dbxref "Genbank:WP_001391575.1"; ID "cds-WP_001391575.1"; Name "WP_001391575.1"; Ontology_term "GO:0009404" "GO:0016746" "GO:0005737"; Parent "gene-C7A06_RS00410"; gbkey "CDS"; go_component "cytoplasm|0005737||IEA"; go_function "acyltransferase activity|0016746||IEA"; go_process "toxin metabolic process|0009404||IEA"; inference "COORDINATES: protein motif:HMM:NF014813.2"; locus_tag "C7A06_RS00410"; product "toxin-activating lysine-acyltransferase"; protein_id "WP_001391575.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 70993 72267 . + . gene_id "nbis-gene-69"; ID "nbis-gene-69"; Name "C7A06_RS00415"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00415"; +NZ_CP027599.1 RefSeq transcript 70993 72267 . + . gene_id "nbis-gene-69"; transcript_id "gene-C7A06_RS00415"; ID "gene-C7A06_RS00415"; Name "C7A06_RS00415"; Parent "nbis-gene-69"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00415"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 70993 72267 . + . gene_id "nbis-gene-69"; transcript_id "gene-C7A06_RS00415"; Dbxref "Genbank:WP_000489612.1"; ID "nbis-exon-74"; Name "WP_000489612.1"; Parent "gene-C7A06_RS00415"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000489618.1"; locus_tag "C7A06_RS00415"; product "HlyD family secretion protein"; protein_id "WP_000489612.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 70993 72267 . + 0 gene_id "nbis-gene-69"; transcript_id "gene-C7A06_RS00415"; Dbxref "Genbank:WP_000489612.1"; ID "cds-WP_000489612.1"; Name "WP_000489612.1"; Parent "gene-C7A06_RS00415"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000489618.1"; locus_tag "C7A06_RS00415"; product "HlyD family secretion protein"; protein_id "WP_000489612.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 72260 74356 . + . gene_id "nbis-gene-70"; ID "nbis-gene-70"; Name "mchF"; gbkey "Gene"; gene "mchF"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00420"; +NZ_CP027599.1 RefSeq transcript 72260 74356 . + . gene_id "nbis-gene-70"; transcript_id "gene-C7A06_RS00420"; ID "gene-C7A06_RS00420"; Name "mchF"; Parent "nbis-gene-70"; gbkey "Gene"; gene "mchF"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00420"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 72260 74356 . + . gene_id "nbis-gene-70"; transcript_id "gene-C7A06_RS00420"; Dbxref "Genbank:WP_000181294.1"; ID "nbis-exon-75"; Name "WP_000181294.1"; Parent "gene-C7A06_RS00420"; gbkey "CDS"; gene "mchF"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001529577.1"; locus_tag "C7A06_RS00420"; product "microcin export transporter peptidase/ATP-binding subunit MchF"; protein_id "WP_000181294.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 72260 74356 . + 0 gene_id "nbis-gene-70"; transcript_id "gene-C7A06_RS00420"; Dbxref "Genbank:WP_000181294.1"; ID "cds-WP_000181294.1"; Name "WP_000181294.1"; Parent "gene-C7A06_RS00420"; gbkey "CDS"; gene "mchF"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001529577.1"; locus_tag "C7A06_RS00420"; product "microcin export transporter peptidase/ATP-binding subunit MchF"; protein_id "WP_000181294.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 74610 74888 . + . gene_id "nbis-gene-71"; ID "nbis-gene-71"; Name "mcmA"; gbkey "Gene"; gene "mcmA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00430"; +NZ_CP027599.1 RefSeq transcript 74610 74888 . + . gene_id "nbis-gene-71"; transcript_id "gene-C7A06_RS00430"; ID "gene-C7A06_RS00430"; Name "mcmA"; Parent "nbis-gene-71"; gbkey "Gene"; gene "mcmA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00430"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 74610 74888 . + . gene_id "nbis-gene-71"; transcript_id "gene-C7A06_RS00430"; Dbxref "Genbank:WP_071531329.1"; ID "nbis-exon-76"; Name "WP_071531329.1"; Parent "gene-C7A06_RS00430"; gbkey "CDS"; gene "mcmA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001466656.1"; locus_tag "C7A06_RS00430"; product "microcin McmA"; protein_id "WP_071531329.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 74610 74888 . + 0 gene_id "nbis-gene-71"; transcript_id "gene-C7A06_RS00430"; Dbxref "Genbank:WP_071531329.1"; ID "cds-WP_071531329.1"; Name "WP_071531329.1"; Parent "gene-C7A06_RS00430"; gbkey "CDS"; gene "mcmA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001466656.1"; locus_tag "C7A06_RS00430"; product "microcin McmA"; protein_id "WP_071531329.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 75027 75203 . - . gene_id "nbis-gene-5829"; ID "nbis-gene-5829"; Name "C7A06_RS34795"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS34795"; +NZ_CP027599.1 RefSeq transcript 75027 75203 . - . gene_id "nbis-gene-5829"; transcript_id "gene-C7A06_RS34795"; ID "gene-C7A06_RS34795"; Name "C7A06_RS34795"; Parent "nbis-gene-5829"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS34795"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 75027 75203 . - . gene_id "nbis-gene-5829"; transcript_id "gene-C7A06_RS34795"; Dbxref "Genbank:WP_231360822.1"; ID "nbis-exon-6139"; Name "WP_231360822.1"; Parent "gene-C7A06_RS34795"; gbkey "CDS"; inference "COORDINATES: protein motif:HMM:NF014566.2"; locus_tag "C7A06_RS34795"; product "hypothetical protein"; protein_id "WP_231360822.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 75027 75203 . - 0 gene_id "nbis-gene-5829"; transcript_id "gene-C7A06_RS34795"; Dbxref "Genbank:WP_231360822.1"; ID "cds-WP_231360822.1"; Name "WP_231360822.1"; Parent "gene-C7A06_RS34795"; gbkey "CDS"; inference "COORDINATES: protein motif:HMM:NF014566.2"; locus_tag "C7A06_RS34795"; product "hypothetical protein"; protein_id "WP_231360822.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 75790 76101 . - . gene_id "nbis-pseudogene-310"; ID "nbis-pseudogene-310"; Name "C7A06_RS34800"; end_range "76101" "."; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS34800"; original_biotype "pseudogene"; partial "true"; pseudo "true"; +NZ_CP027599.1 RefSeq transcript 75790 76101 . - . gene_id "nbis-pseudogene-310"; transcript_id "gene-C7A06_RS34800"; ID "gene-C7A06_RS34800"; Name "C7A06_RS34800"; Parent "nbis-pseudogene-310"; end_range "76101" "."; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS34800"; original_biotype "mrna"; partial "true"; pseudo "true"; +NZ_CP027599.1 Protein Homology exon 75790 76101 . - . gene_id "nbis-pseudogene-310"; transcript_id "gene-C7A06_RS34800"; ID "nbis-exon-6140"; Note "incomplete; partial in the middle of a contig; missing N-terminus"; Parent "gene-C7A06_RS34800"; end_range "76101" "."; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_309401.1"; locus_tag "C7A06_RS34800"; partial "true"; product "hypothetical protein"; pseudo "true"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 75790 76101 . - 0 gene_id "nbis-pseudogene-310"; transcript_id "gene-C7A06_RS34800"; ID "cds-C7A06_RS34800"; Note "incomplete; partial in the middle of a contig; missing N-terminus"; Parent "gene-C7A06_RS34800"; end_range "76101" "."; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_309401.1"; locus_tag "C7A06_RS34800"; partial "true"; product "hypothetical protein"; pseudo "true"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 76178 76726 . + . gene_id "nbis-gene-72"; ID "nbis-gene-72"; Name "C7A06_RS00450"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00450"; +NZ_CP027599.1 RefSeq transcript 76178 76726 . + . gene_id "nbis-gene-72"; transcript_id "gene-C7A06_RS00450"; ID "gene-C7A06_RS00450"; Name "C7A06_RS00450"; Parent "nbis-gene-72"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00450"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 76178 76726 . + . gene_id "nbis-gene-72"; transcript_id "gene-C7A06_RS00450"; Dbxref "Genbank:WP_001167431.1"; ID "nbis-exon-77"; Name "WP_001167431.1"; Parent "gene-C7A06_RS00450"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001167424.1"; locus_tag "C7A06_RS00450"; product "hypothetical protein"; protein_id "WP_001167431.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 76178 76726 . + 0 gene_id "nbis-gene-72"; transcript_id "gene-C7A06_RS00450"; Dbxref "Genbank:WP_001167431.1"; ID "cds-WP_001167431.1"; Name "WP_001167431.1"; Parent "gene-C7A06_RS00450"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001167424.1"; locus_tag "C7A06_RS00450"; product "hypothetical protein"; protein_id "WP_001167431.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 76745 77089 . - . gene_id "nbis-gene-73"; ID "nbis-gene-73"; Name "C7A06_RS00455"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00455"; +NZ_CP027599.1 RefSeq transcript 76745 77089 . - . gene_id "nbis-gene-73"; transcript_id "gene-C7A06_RS00455"; ID "gene-C7A06_RS00455"; Name "C7A06_RS00455"; Parent "nbis-gene-73"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00455"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 76745 77089 . - . gene_id "nbis-gene-73"; transcript_id "gene-C7A06_RS00455"; Dbxref "Genbank:WP_000166948.1"; ID "nbis-exon-78"; Name "WP_000166948.1"; Parent "gene-C7A06_RS00455"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000166950.1"; locus_tag "C7A06_RS00455"; product "ProQ/FinO family protein"; protein_id "WP_000166948.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 76745 77089 . - 0 gene_id "nbis-gene-73"; transcript_id "gene-C7A06_RS00455"; Dbxref "Genbank:WP_000166948.1"; ID "cds-WP_000166948.1"; Name "WP_000166948.1"; Parent "gene-C7A06_RS00455"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000166950.1"; locus_tag "C7A06_RS00455"; product "ProQ/FinO family protein"; protein_id "WP_000166948.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 77086 77259 . - . gene_id "nbis-gene-74"; ID "nbis-gene-74"; Name "C7A06_RS00460"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00460"; +NZ_CP027599.1 RefSeq transcript 77086 77259 . - . gene_id "nbis-gene-74"; transcript_id "gene-C7A06_RS00460"; ID "gene-C7A06_RS00460"; Name "C7A06_RS00460"; Parent "nbis-gene-74"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00460"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 77086 77259 . - . gene_id "nbis-gene-74"; transcript_id "gene-C7A06_RS00460"; Dbxref "Genbank:WP_000258194.1"; ID "nbis-exon-79"; Name "WP_000258194.1"; Parent "gene-C7A06_RS00460"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000258194.1"; locus_tag "C7A06_RS00460"; product "hypothetical protein"; protein_id "WP_000258194.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 77086 77259 . - 0 gene_id "nbis-gene-74"; transcript_id "gene-C7A06_RS00460"; Dbxref "Genbank:WP_000258194.1"; ID "cds-WP_000258194.1"; Name "WP_000258194.1"; Parent "gene-C7A06_RS00460"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000258194.1"; locus_tag "C7A06_RS00460"; product "hypothetical protein"; protein_id "WP_000258194.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 77395 77568 . + . gene_id "nbis-gene-75"; ID "nbis-gene-75"; Name "C7A06_RS00465"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00465"; +NZ_CP027599.1 RefSeq transcript 77395 77568 . + . gene_id "nbis-gene-75"; transcript_id "gene-C7A06_RS00465"; ID "gene-C7A06_RS00465"; Name "C7A06_RS00465"; Parent "nbis-gene-75"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00465"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 77395 77568 . + . gene_id "nbis-gene-75"; transcript_id "gene-C7A06_RS00465"; Dbxref "Genbank:WP_153274857.1"; ID "nbis-exon-80"; Name "WP_153274857.1"; Parent "gene-C7A06_RS00465"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000130014.1"; locus_tag "C7A06_RS00465"; product "hypothetical protein"; protein_id "WP_153274857.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 77395 77568 . + 0 gene_id "nbis-gene-75"; transcript_id "gene-C7A06_RS00465"; Dbxref "Genbank:WP_153274857.1"; ID "cds-WP_153274857.1"; Name "WP_153274857.1"; Parent "gene-C7A06_RS00465"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000130014.1"; locus_tag "C7A06_RS00465"; product "hypothetical protein"; protein_id "WP_153274857.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 77982 78416 . + . gene_id "nbis-gene-76"; ID "nbis-gene-76"; Name "C7A06_RS00475"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00475"; +NZ_CP027599.1 RefSeq transcript 77982 78416 . + . gene_id "nbis-gene-76"; transcript_id "gene-C7A06_RS00475"; ID "gene-C7A06_RS00475"; Name "C7A06_RS00475"; Parent "nbis-gene-76"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00475"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 77982 78416 . + . gene_id "nbis-gene-76"; transcript_id "gene-C7A06_RS00475"; Dbxref "Genbank:WP_000038249.1"; ID "nbis-exon-81"; Name "WP_000038249.1"; Ontology_term "GO:0006355" "GO:0003677"; Parent "gene-C7A06_RS00475"; gbkey "CDS"; go_function "DNA binding|0003677||IEA"; go_process "regulation of transcription, DNA-templated|0006355||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000038245.1"; locus_tag "C7A06_RS00475"; product "H-NS histone family protein"; protein_id "WP_000038249.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 77982 78416 . + 0 gene_id "nbis-gene-76"; transcript_id "gene-C7A06_RS00475"; Dbxref "Genbank:WP_000038249.1"; ID "cds-WP_000038249.1"; Name "WP_000038249.1"; Ontology_term "GO:0006355" "GO:0003677"; Parent "gene-C7A06_RS00475"; gbkey "CDS"; go_function "DNA binding|0003677||IEA"; go_process "regulation of transcription, DNA-templated|0006355||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000038245.1"; locus_tag "C7A06_RS00475"; product "H-NS histone family protein"; protein_id "WP_000038249.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 78833 79402 . - . gene_id "nbis-gene-77"; ID "nbis-gene-77"; Name "C7A06_RS00480"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00480"; +NZ_CP027599.1 RefSeq transcript 78833 79402 . - . gene_id "nbis-gene-77"; transcript_id "gene-C7A06_RS00480"; ID "gene-C7A06_RS00480"; Name "C7A06_RS00480"; Parent "nbis-gene-77"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00480"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 78833 79402 . - . gene_id "nbis-gene-77"; transcript_id "gene-C7A06_RS00480"; Dbxref "Genbank:WP_000517678.1"; ID "nbis-exon-82"; Name "WP_000517678.1"; Parent "gene-C7A06_RS00480"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000517641.1"; locus_tag "C7A06_RS00480"; product "hypothetical protein"; protein_id "WP_000517678.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 78833 79402 . - 0 gene_id "nbis-gene-77"; transcript_id "gene-C7A06_RS00480"; Dbxref "Genbank:WP_000517678.1"; ID "cds-WP_000517678.1"; Name "WP_000517678.1"; Parent "gene-C7A06_RS00480"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000517641.1"; locus_tag "C7A06_RS00480"; product "hypothetical protein"; protein_id "WP_000517678.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 79502 80734 . - . gene_id "nbis-gene-78"; ID "nbis-gene-78"; Name "dgt"; gbkey "Gene"; gene "dgt"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00485"; +NZ_CP027599.1 RefSeq transcript 79502 80734 . - . gene_id "nbis-gene-78"; transcript_id "gene-C7A06_RS00485"; ID "gene-C7A06_RS00485"; Name "dgt"; Parent "nbis-gene-78"; gbkey "Gene"; gene "dgt"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00485"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 79502 80734 . - . gene_id "nbis-gene-78"; transcript_id "gene-C7A06_RS00485"; Dbxref "Genbank:WP_000271619.1"; ID "nbis-exon-83"; Name "WP_000271619.1"; Ontology_term "GO:0015949" "GO:0008832"; Parent "gene-C7A06_RS00485"; gbkey "CDS"; gene "dgt"; go_function "dGTPase activity|0008832||IEA"; go_process "nucleobase-containing small molecule interconversion|0015949||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001566974.1"; locus_tag "C7A06_RS00485"; product "dNTP triphosphohydrolase"; protein_id "WP_000271619.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 79502 80734 . - 0 gene_id "nbis-gene-78"; transcript_id "gene-C7A06_RS00485"; Dbxref "Genbank:WP_000271619.1"; ID "cds-WP_000271619.1"; Name "WP_000271619.1"; Ontology_term "GO:0015949" "GO:0008832"; Parent "gene-C7A06_RS00485"; gbkey "CDS"; gene "dgt"; go_function "dGTPase activity|0008832||IEA"; go_process "nucleobase-containing small molecule interconversion|0015949||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001566974.1"; locus_tag "C7A06_RS00485"; product "dNTP triphosphohydrolase"; protein_id "WP_000271619.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 80885 82047 . - . gene_id "nbis-gene-79"; ID "nbis-gene-79"; Name "C7A06_RS00490"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00490"; +NZ_CP027599.1 RefSeq transcript 80885 82047 . - . gene_id "nbis-gene-79"; transcript_id "gene-C7A06_RS00490"; ID "gene-C7A06_RS00490"; Name "C7A06_RS00490"; Parent "nbis-gene-79"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00490"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 80885 82047 . - . gene_id "nbis-gene-79"; transcript_id "gene-C7A06_RS00490"; Dbxref "Genbank:WP_106904140.1"; ID "nbis-exon-84"; Name "WP_106904140.1"; Note "programmed frameshift"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS00490"; exception "ribosomal slippage"; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_012477168.1"; locus_tag "C7A06_RS00490"; product "IS3 family transposase"; protein_id "WP_106904140.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 80885 82047 . - 2 gene_id "nbis-gene-79"; transcript_id "gene-C7A06_RS00490"; Dbxref "Genbank:WP_106904140.1"; ID "cds-WP_106904140.1"; Name "WP_106904140.1"; Note "programmed frameshift"; Ontology_term "GO:0004803"; Parent "gene-C7A06_RS00490"; exception "ribosomal slippage"; gbkey "CDS"; go_function "transposase activity|0004803||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_012477168.1"; locus_tag "C7A06_RS00490"; product "IS3 family transposase"; protein_id "WP_106904140.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 82610 83124 . - . gene_id "nbis-pseudogene-6"; ID "nbis-pseudogene-6"; Name "C7A06_RS00500"; end_range "83124" "."; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS00500"; original_biotype "pseudogene"; partial "true"; pseudo "true"; +NZ_CP027599.1 RefSeq transcript 82610 83124 . - . gene_id "nbis-pseudogene-6"; transcript_id "gene-C7A06_RS00500"; ID "gene-C7A06_RS00500"; Name "C7A06_RS00500"; Parent "nbis-pseudogene-6"; end_range "83124" "."; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS00500"; original_biotype "mrna"; partial "true"; pseudo "true"; +NZ_CP027599.1 Protein Homology exon 82610 83124 . - . gene_id "nbis-pseudogene-6"; transcript_id "gene-C7A06_RS00500"; ID "nbis-exon-85"; Note "frameshifted; incomplete; partial in the middle of a contig; missing N-terminus"; Parent "gene-C7A06_RS00500"; end_range "83124" "."; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001368704.1"; locus_tag "C7A06_RS00500"; partial "true"; product "transposase"; pseudo "true"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 82610 83124 . - 0 gene_id "nbis-pseudogene-6"; transcript_id "gene-C7A06_RS00500"; ID "cds-C7A06_RS00500"; Note "frameshifted; incomplete; partial in the middle of a contig; missing N-terminus"; Parent "gene-C7A06_RS00500"; end_range "83124" "."; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001368704.1"; locus_tag "C7A06_RS00500"; partial "true"; product "transposase"; pseudo "true"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 83732 87145 . + . gene_id "nbis-gene-80"; ID "nbis-gene-80"; Name "C7A06_RS00510"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00510"; +NZ_CP027599.1 RefSeq transcript 83732 87145 . + . gene_id "nbis-gene-80"; transcript_id "gene-C7A06_RS00510"; ID "gene-C7A06_RS00510"; Name "C7A06_RS00510"; Parent "nbis-gene-80"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00510"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 83732 87145 . + . gene_id "nbis-gene-80"; transcript_id "gene-C7A06_RS00510"; Dbxref "Genbank:WP_000438167.1"; ID "nbis-exon-86"; Name "WP_000438167.1"; Ontology_term "GO:0003677" "GO:0005524" "GO:0016787"; Parent "gene-C7A06_RS00510"; gbkey "CDS"; go_function "DNA binding|0003677||IEA" "ATP binding|0005524||IEA" "hydrolase activity|0016787||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000438152.1"; locus_tag "C7A06_RS00510"; product "DEAD/DEAH box helicase family protein"; protein_id "WP_000438167.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 83732 87145 . + 0 gene_id "nbis-gene-80"; transcript_id "gene-C7A06_RS00510"; Dbxref "Genbank:WP_000438167.1"; ID "cds-WP_000438167.1"; Name "WP_000438167.1"; Ontology_term "GO:0003677" "GO:0005524" "GO:0016787"; Parent "gene-C7A06_RS00510"; gbkey "CDS"; go_function "DNA binding|0003677||IEA" "ATP binding|0005524||IEA" "hydrolase activity|0016787||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000438152.1"; locus_tag "C7A06_RS00510"; product "DEAD/DEAH box helicase family protein"; protein_id "WP_000438167.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 87209 88843 . + . gene_id "nbis-gene-81"; ID "nbis-gene-81"; Name "C7A06_RS00515"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00515"; +NZ_CP027599.1 RefSeq transcript 87209 88843 . + . gene_id "nbis-gene-81"; transcript_id "gene-C7A06_RS00515"; ID "gene-C7A06_RS00515"; Name "C7A06_RS00515"; Parent "nbis-gene-81"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00515"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 87209 88843 . + . gene_id "nbis-gene-81"; transcript_id "gene-C7A06_RS00515"; Dbxref "Genbank:WP_000627719.1"; ID "nbis-exon-87"; Name "WP_000627719.1"; Parent "gene-C7A06_RS00515"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000627727.1"; locus_tag "C7A06_RS00515"; product "type I restriction-modification system subunit M"; protein_id "WP_000627719.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 87209 88843 . + 0 gene_id "nbis-gene-81"; transcript_id "gene-C7A06_RS00515"; Dbxref "Genbank:WP_000627719.1"; ID "cds-WP_000627719.1"; Name "WP_000627719.1"; Parent "gene-C7A06_RS00515"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000627727.1"; locus_tag "C7A06_RS00515"; product "type I restriction-modification system subunit M"; protein_id "WP_000627719.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 88840 89982 . + . gene_id "nbis-gene-82"; ID "nbis-gene-82"; Name "C7A06_RS00520"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00520"; +NZ_CP027599.1 RefSeq transcript 88840 89982 . + . gene_id "nbis-gene-82"; transcript_id "gene-C7A06_RS00520"; ID "gene-C7A06_RS00520"; Name "C7A06_RS00520"; Parent "nbis-gene-82"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00520"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 88840 89982 . + . gene_id "nbis-gene-82"; transcript_id "gene-C7A06_RS00520"; Dbxref "Genbank:WP_001680721.1"; ID "nbis-exon-88"; Name "WP_001680721.1"; Ontology_term "GO:0006304" "GO:0003677"; Parent "gene-C7A06_RS00520"; gbkey "CDS"; go_function "DNA binding|0003677||IEA"; go_process "DNA modification|0006304||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001680721.1"; locus_tag "C7A06_RS00520"; product "restriction endonuclease subunit S"; protein_id "WP_001680721.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 88840 89982 . + 0 gene_id "nbis-gene-82"; transcript_id "gene-C7A06_RS00520"; Dbxref "Genbank:WP_001680721.1"; ID "cds-WP_001680721.1"; Name "WP_001680721.1"; Ontology_term "GO:0006304" "GO:0003677"; Parent "gene-C7A06_RS00520"; gbkey "CDS"; go_function "DNA binding|0003677||IEA"; go_process "DNA modification|0006304||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001680721.1"; locus_tag "C7A06_RS00520"; product "restriction endonuclease subunit S"; protein_id "WP_001680721.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 89991 91613 . + . gene_id "nbis-gene-83"; ID "nbis-gene-83"; Name "C7A06_RS00525"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00525"; +NZ_CP027599.1 RefSeq transcript 89991 91613 . + . gene_id "nbis-gene-83"; transcript_id "gene-C7A06_RS00525"; ID "gene-C7A06_RS00525"; Name "C7A06_RS00525"; Parent "nbis-gene-83"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00525"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 89991 91613 . + . gene_id "nbis-gene-83"; transcript_id "gene-C7A06_RS00525"; Dbxref "Genbank:WP_000778953.1"; ID "nbis-exon-89"; Name "WP_000778953.1"; Parent "gene-C7A06_RS00525"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000778955.1"; locus_tag "C7A06_RS00525"; product "AAA family ATPase"; protein_id "WP_000778953.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 89991 91613 . + 0 gene_id "nbis-gene-83"; transcript_id "gene-C7A06_RS00525"; Dbxref "Genbank:WP_000778953.1"; ID "cds-WP_000778953.1"; Name "WP_000778953.1"; Parent "gene-C7A06_RS00525"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000778955.1"; locus_tag "C7A06_RS00525"; product "AAA family ATPase"; protein_id "WP_000778953.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 91613 92509 . + . gene_id "nbis-gene-84"; ID "nbis-gene-84"; Name "C7A06_RS00530"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00530"; +NZ_CP027599.1 RefSeq transcript 91613 92509 . + . gene_id "nbis-gene-84"; transcript_id "gene-C7A06_RS00530"; ID "gene-C7A06_RS00530"; Name "C7A06_RS00530"; Parent "nbis-gene-84"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00530"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 91613 92509 . + . gene_id "nbis-gene-84"; transcript_id "gene-C7A06_RS00530"; Dbxref "Genbank:WP_001680722.1"; ID "nbis-exon-90"; Name "WP_001680722.1"; Parent "gene-C7A06_RS00530"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001680722.1"; locus_tag "C7A06_RS00530"; product "hypothetical protein"; protein_id "WP_001680722.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 91613 92509 . + 0 gene_id "nbis-gene-84"; transcript_id "gene-C7A06_RS00530"; Dbxref "Genbank:WP_001680722.1"; ID "cds-WP_001680722.1"; Name "WP_001680722.1"; Parent "gene-C7A06_RS00530"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001680722.1"; locus_tag "C7A06_RS00530"; product "hypothetical protein"; protein_id "WP_001680722.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 92732 92910 . - . gene_id "nbis-pseudogene-7"; ID "nbis-pseudogene-7"; Name "C7A06_RS00535"; end_range "92910" "."; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS00535"; original_biotype "pseudogene"; partial "true"; pseudo "true"; +NZ_CP027599.1 RefSeq transcript 92732 92910 . - . gene_id "nbis-pseudogene-7"; transcript_id "gene-C7A06_RS00535"; ID "gene-C7A06_RS00535"; Name "C7A06_RS00535"; Parent "nbis-pseudogene-7"; end_range "92910" "."; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS00535"; original_biotype "mrna"; partial "true"; pseudo "true"; +NZ_CP027599.1 Protein Homology exon 92732 92910 . - . gene_id "nbis-pseudogene-7"; transcript_id "gene-C7A06_RS00535"; ID "nbis-exon-91"; Note "frameshifted; incomplete; partial in the middle of a contig; missing N-terminus"; Parent "gene-C7A06_RS00535"; end_range "92910" "."; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_012421665.1"; locus_tag "C7A06_RS00535"; partial "true"; product "integrase"; pseudo "true"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 92732 92910 . - 0 gene_id "nbis-pseudogene-7"; transcript_id "gene-C7A06_RS00535"; ID "cds-C7A06_RS00535"; Note "frameshifted; incomplete; partial in the middle of a contig; missing N-terminus"; Parent "gene-C7A06_RS00535"; end_range "92910" "."; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_012421665.1"; locus_tag "C7A06_RS00535"; partial "true"; product "integrase"; pseudo "true"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 93193 93561 . + . gene_id "nbis-gene-85"; ID "nbis-gene-85"; Name "C7A06_RS00540"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00540"; +NZ_CP027599.1 RefSeq transcript 93193 93561 . + . gene_id "nbis-gene-85"; transcript_id "gene-C7A06_RS00540"; ID "gene-C7A06_RS00540"; Name "C7A06_RS00540"; Parent "nbis-gene-85"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00540"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 93193 93561 . + . gene_id "nbis-gene-85"; transcript_id "gene-C7A06_RS00540"; Dbxref "Genbank:WP_001275820.1"; ID "nbis-exon-92"; Name "WP_001275820.1"; Parent "gene-C7A06_RS00540"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001275822.1"; locus_tag "C7A06_RS00540"; product "hypothetical protein"; protein_id "WP_001275820.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 93193 93561 . + 0 gene_id "nbis-gene-85"; transcript_id "gene-C7A06_RS00540"; Dbxref "Genbank:WP_001275820.1"; ID "cds-WP_001275820.1"; Name "WP_001275820.1"; Parent "gene-C7A06_RS00540"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001275822.1"; locus_tag "C7A06_RS00540"; product "hypothetical protein"; protein_id "WP_001275820.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 93779 94525 . + . gene_id "nbis-gene-86"; ID "nbis-gene-86"; Name "C7A06_RS00545"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00545"; +NZ_CP027599.1 RefSeq transcript 93779 94525 . + . gene_id "nbis-gene-86"; transcript_id "gene-C7A06_RS00545"; ID "gene-C7A06_RS00545"; Name "C7A06_RS00545"; Parent "nbis-gene-86"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00545"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 93779 94525 . + . gene_id "nbis-gene-86"; transcript_id "gene-C7A06_RS00545"; Dbxref "Genbank:WP_000755107.1"; ID "nbis-exon-93"; Name "WP_000755107.1"; Parent "gene-C7A06_RS00545"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001536427.1"; locus_tag "C7A06_RS00545"; product "porin family protein"; protein_id "WP_000755107.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 93779 94525 . + 0 gene_id "nbis-gene-86"; transcript_id "gene-C7A06_RS00545"; Dbxref "Genbank:WP_000755107.1"; ID "cds-WP_000755107.1"; Name "WP_000755107.1"; Parent "gene-C7A06_RS00545"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001536427.1"; locus_tag "C7A06_RS00545"; product "porin family protein"; protein_id "WP_000755107.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 94710 96211 . + . gene_id "nbis-pseudogene-8"; ID "nbis-pseudogene-8"; Name "C7A06_RS00550"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS00550"; original_biotype "pseudogene"; pseudo "true"; +NZ_CP027599.1 RefSeq transcript 94710 96211 . + . gene_id "nbis-pseudogene-8"; transcript_id "gene-C7A06_RS00550"; ID "gene-C7A06_RS00550"; Name "C7A06_RS00550"; Parent "nbis-pseudogene-8"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS00550"; original_biotype "mrna"; pseudo "true"; +NZ_CP027599.1 Protein Homology exon 94710 96211 . + . gene_id "nbis-pseudogene-8"; transcript_id "gene-C7A06_RS00550"; ID "nbis-exon-94"; Note "frameshifted"; Parent "gene-C7A06_RS00550"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001608786.1"; locus_tag "C7A06_RS00550"; product "phosphoethanolamine transferase"; pseudo "true"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 94710 96211 . + 0 gene_id "nbis-pseudogene-8"; transcript_id "gene-C7A06_RS00550"; ID "cds-C7A06_RS00550"; Note "frameshifted"; Parent "gene-C7A06_RS00550"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001608786.1"; locus_tag "C7A06_RS00550"; product "phosphoethanolamine transferase"; pseudo "true"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 96571 97614 . - . gene_id "nbis-gene-87"; ID "nbis-gene-87"; Name "C7A06_RS00560"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00560"; +NZ_CP027599.1 RefSeq transcript 96571 97614 . - . gene_id "nbis-gene-87"; transcript_id "gene-C7A06_RS00560"; ID "gene-C7A06_RS00560"; Name "C7A06_RS00560"; Parent "nbis-gene-87"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00560"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 96571 97614 . - . gene_id "nbis-gene-87"; transcript_id "gene-C7A06_RS00560"; Dbxref "Genbank:WP_000999846.1"; ID "nbis-exon-95"; Name "WP_000999846.1"; Parent "gene-C7A06_RS00560"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709438.1"; locus_tag "C7A06_RS00560"; product "hypothetical protein"; protein_id "WP_000999846.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 96571 97614 . - 0 gene_id "nbis-gene-87"; transcript_id "gene-C7A06_RS00560"; Dbxref "Genbank:WP_000999846.1"; ID "cds-WP_000999846.1"; Name "WP_000999846.1"; Parent "gene-C7A06_RS00560"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709438.1"; locus_tag "C7A06_RS00560"; product "hypothetical protein"; protein_id "WP_000999846.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 98026 99210 . - . gene_id "nbis-gene-88"; ID "nbis-gene-88"; Name "C7A06_RS00565"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00565"; +NZ_CP027599.1 RefSeq transcript 98026 99210 . - . gene_id "nbis-gene-88"; transcript_id "gene-C7A06_RS00565"; ID "gene-C7A06_RS00565"; Name "C7A06_RS00565"; Parent "nbis-gene-88"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00565"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 98026 99210 . - . gene_id "nbis-gene-88"; transcript_id "gene-C7A06_RS00565"; Dbxref "Genbank:WP_001218900.1"; ID "nbis-exon-96"; Name "WP_001218900.1"; Ontology_term "GO:0006310" "GO:0015074" "GO:0003677"; Parent "gene-C7A06_RS00565"; gbkey "CDS"; go_function "DNA binding|0003677||IEA"; go_process "DNA recombination|0006310||IEA" "DNA integration|0015074||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001218899.1"; locus_tag "C7A06_RS00565"; product "tyrosine-type recombinase/integrase"; protein_id "WP_001218900.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 98026 99210 . - 0 gene_id "nbis-gene-88"; transcript_id "gene-C7A06_RS00565"; Dbxref "Genbank:WP_001218900.1"; ID "cds-WP_001218900.1"; Name "WP_001218900.1"; Ontology_term "GO:0006310" "GO:0015074" "GO:0003677"; Parent "gene-C7A06_RS00565"; gbkey "CDS"; go_function "DNA binding|0003677||IEA"; go_process "DNA recombination|0006310||IEA" "DNA integration|0015074||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001218899.1"; locus_tag "C7A06_RS00565"; product "tyrosine-type recombinase/integrase"; protein_id "WP_001218900.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 99510 99604 . - . gene_id "gene-C7A06_RS00570"; ID "gene-C7A06_RS00570"; Name "C7A06_RS00570"; gbkey "Gene"; gene_biotype "tRNA"; locus_tag "C7A06_RS00570"; +NZ_CP027599.1 tRNAscan-SE transcript 99510 99604 . - . gene_id "gene-C7A06_RS00570"; transcript_id "rna-C7A06_RS00570"; ID "rna-C7A06_RS00570"; Parent "gene-C7A06_RS00570"; anticodon "(pos:complement(99568..99570))"; gbkey "tRNA"; inference "COORDINATES: profile:tRNAscan-SE:2.0.7"; locus_tag "C7A06_RS00570"; original_biotype "trna"; product "tRNA-Sec"; +NZ_CP027599.1 tRNAscan-SE exon 99510 99604 . - . gene_id "gene-C7A06_RS00570"; transcript_id "rna-C7A06_RS00570"; ID "exon-C7A06_RS00570-1"; Parent "rna-C7A06_RS00570"; anticodon "(pos:complement(99568..99570))"; gbkey "tRNA"; inference "COORDINATES: profile:tRNAscan-SE:2.0.7"; locus_tag "C7A06_RS00570"; product "tRNA-Sec"; +NZ_CP027599.1 RefSeq gene 99897 101279 . + . gene_id "nbis-gene-89"; ID "nbis-gene-89"; Name "yicJ"; gbkey "Gene"; gene "yicJ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00575"; +NZ_CP027599.1 RefSeq transcript 99897 101279 . + . gene_id "nbis-gene-89"; transcript_id "gene-C7A06_RS00575"; ID "gene-C7A06_RS00575"; Name "yicJ"; Parent "nbis-gene-89"; gbkey "Gene"; gene "yicJ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00575"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 99897 101279 . + . gene_id "nbis-gene-89"; transcript_id "gene-C7A06_RS00575"; Dbxref "Genbank:WP_000834439.1"; ID "nbis-exon-97"; Name "WP_000834439.1"; Ontology_term "GO:0006814" "GO:0008643" "GO:0015293" "GO:0016021"; Parent "gene-C7A06_RS00575"; gbkey "CDS"; gene "yicJ"; go_component "integral component of membrane|0016021||IEA"; go_function "symporter activity|0015293||IEA"; go_process "sodium ion transport|0006814||IEA" "carbohydrate transport|0008643||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418114.4"; locus_tag "C7A06_RS00575"; product "glycoside-pentoside-hexuronide family transporter"; protein_id "WP_000834439.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 99897 101279 . + 0 gene_id "nbis-gene-89"; transcript_id "gene-C7A06_RS00575"; Dbxref "Genbank:WP_000834439.1"; ID "cds-WP_000834439.1"; Name "WP_000834439.1"; Ontology_term "GO:0006814" "GO:0008643" "GO:0015293" "GO:0016021"; Parent "gene-C7A06_RS00575"; gbkey "CDS"; gene "yicJ"; go_component "integral component of membrane|0016021||IEA"; go_function "symporter activity|0015293||IEA"; go_process "sodium ion transport|0006814||IEA" "carbohydrate transport|0008643||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418114.4"; locus_tag "C7A06_RS00575"; product "glycoside-pentoside-hexuronide family transporter"; protein_id "WP_000834439.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 101289 103607 . + . gene_id "nbis-gene-90"; ID "nbis-gene-90"; Name "yicI"; gbkey "Gene"; gene "yicI"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00580"; +NZ_CP027599.1 RefSeq transcript 101289 103607 . + . gene_id "nbis-gene-90"; transcript_id "gene-C7A06_RS00580"; ID "gene-C7A06_RS00580"; Name "yicI"; Parent "nbis-gene-90"; gbkey "Gene"; gene "yicI"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00580"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 101289 103607 . + . gene_id "nbis-gene-90"; transcript_id "gene-C7A06_RS00580"; Dbxref "Genbank:WP_000702953.1"; ID "nbis-exon-98"; Name "WP_000702953.1"; Ontology_term "GO:0005975" "GO:0004553"; Parent "gene-C7A06_RS00580"; gbkey "CDS"; gene "yicI"; go_function "hydrolase activity, hydrolyzing O-glycosyl compounds|0004553||IEA"; go_process "carbohydrate metabolic process|0005975||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418113.1"; locus_tag "C7A06_RS00580"; product "alpha-xylosidase"; protein_id "WP_000702953.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 101289 103607 . + 0 gene_id "nbis-gene-90"; transcript_id "gene-C7A06_RS00580"; Dbxref "Genbank:WP_000702953.1"; ID "cds-WP_000702953.1"; Name "WP_000702953.1"; Ontology_term "GO:0005975" "GO:0004553"; Parent "gene-C7A06_RS00580"; gbkey "CDS"; gene "yicI"; go_function "hydrolase activity, hydrolyzing O-glycosyl compounds|0004553||IEA"; go_process "carbohydrate metabolic process|0005975||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418113.1"; locus_tag "C7A06_RS00580"; product "alpha-xylosidase"; protein_id "WP_000702953.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 103660 105369 . - . gene_id "nbis-gene-91"; ID "nbis-gene-91"; Name "yicH"; gbkey "Gene"; gene "yicH"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00585"; +NZ_CP027599.1 RefSeq transcript 103660 105369 . - . gene_id "nbis-gene-91"; transcript_id "gene-C7A06_RS00585"; ID "gene-C7A06_RS00585"; Name "yicH"; Parent "nbis-gene-91"; gbkey "Gene"; gene "yicH"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00585"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 103660 105369 . - . gene_id "nbis-gene-91"; transcript_id "gene-C7A06_RS00585"; Dbxref "Genbank:WP_001341763.1"; ID "nbis-exon-99"; Name "WP_001341763.1"; Parent "gene-C7A06_RS00585"; gbkey "CDS"; gene "yicH"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418112.1"; locus_tag "C7A06_RS00585"; product "AsmA family protein"; protein_id "WP_001341763.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 103660 105369 . - 0 gene_id "nbis-gene-91"; transcript_id "gene-C7A06_RS00585"; Dbxref "Genbank:WP_001341763.1"; ID "cds-WP_001341763.1"; Name "WP_001341763.1"; Parent "gene-C7A06_RS00585"; gbkey "CDS"; gene "yicH"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418112.1"; locus_tag "C7A06_RS00585"; product "AsmA family protein"; protein_id "WP_001341763.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 105490 106881 . - . gene_id "nbis-gene-92"; ID "nbis-gene-92"; Name "xanP"; gbkey "Gene"; gene "xanP"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00590"; +NZ_CP027599.1 RefSeq transcript 105490 106881 . - . gene_id "nbis-gene-92"; transcript_id "gene-C7A06_RS00590"; ID "gene-C7A06_RS00590"; Name "xanP"; Parent "nbis-gene-92"; gbkey "Gene"; gene "xanP"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00590"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 105490 106881 . - . gene_id "nbis-gene-92"; transcript_id "gene-C7A06_RS00590"; Dbxref "Genbank:WP_001295238.1"; ID "nbis-exon-100"; Name "WP_001295238.1"; Parent "gene-C7A06_RS00590"; gbkey "CDS"; gene "xanP"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312557.1"; locus_tag "C7A06_RS00590"; product "xanthine/proton symporter XanP"; protein_id "WP_001295238.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 105490 106881 . - 0 gene_id "nbis-gene-92"; transcript_id "gene-C7A06_RS00590"; Dbxref "Genbank:WP_001295238.1"; ID "cds-WP_001295238.1"; Name "WP_001295238.1"; Parent "gene-C7A06_RS00590"; gbkey "CDS"; gene "xanP"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312557.1"; locus_tag "C7A06_RS00590"; product "xanthine/proton symporter XanP"; protein_id "WP_001295238.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 107161 108366 . + . gene_id "nbis-gene-93"; ID "nbis-gene-93"; Name "gltS"; gbkey "Gene"; gene "gltS"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00595"; +NZ_CP027599.1 RefSeq transcript 107161 108366 . + . gene_id "nbis-gene-93"; transcript_id "gene-C7A06_RS00595"; ID "gene-C7A06_RS00595"; Name "gltS"; Parent "nbis-gene-93"; gbkey "Gene"; gene "gltS"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00595"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 107161 108366 . + . gene_id "nbis-gene-93"; transcript_id "gene-C7A06_RS00595"; Dbxref "Genbank:WP_000468836.1"; ID "nbis-exon-101"; Name "WP_000468836.1"; Ontology_term "GO:0015813" "GO:0015501"; Parent "gene-C7A06_RS00595"; gbkey "CDS"; gene "gltS"; go_function "glutamate:sodium symporter activity|0015501||IEA"; go_process "L-glutamate transmembrane transport|0015813||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312556.1"; locus_tag "C7A06_RS00595"; product "sodium/glutamate symporter"; protein_id "WP_000468836.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 107161 108366 . + 0 gene_id "nbis-gene-93"; transcript_id "gene-C7A06_RS00595"; Dbxref "Genbank:WP_000468836.1"; ID "cds-WP_000468836.1"; Name "WP_000468836.1"; Ontology_term "GO:0015813" "GO:0015501"; Parent "gene-C7A06_RS00595"; gbkey "CDS"; gene "gltS"; go_function "glutamate:sodium symporter activity|0015501||IEA"; go_process "L-glutamate transmembrane transport|0015813||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312556.1"; locus_tag "C7A06_RS00595"; product "sodium/glutamate symporter"; protein_id "WP_000468836.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 108369 109235 . + . gene_id "nbis-gene-94"; ID "nbis-gene-94"; Name "C7A06_RS00600"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00600"; +NZ_CP027599.1 RefSeq transcript 108369 109235 . + . gene_id "nbis-gene-94"; transcript_id "gene-C7A06_RS00600"; ID "gene-C7A06_RS00600"; Name "C7A06_RS00600"; Parent "nbis-gene-94"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00600"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 108369 109235 . + . gene_id "nbis-gene-94"; transcript_id "gene-C7A06_RS00600"; Dbxref "Genbank:WP_000747329.1"; ID "nbis-exon-102"; Name "WP_000747329.1"; Parent "gene-C7A06_RS00600"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312555.2"; locus_tag "C7A06_RS00600"; product "hypothetical protein"; protein_id "WP_000747329.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 108369 109235 . + 0 gene_id "nbis-gene-94"; transcript_id "gene-C7A06_RS00600"; Dbxref "Genbank:WP_000747329.1"; ID "cds-WP_000747329.1"; Name "WP_000747329.1"; Parent "gene-C7A06_RS00600"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312555.2"; locus_tag "C7A06_RS00600"; product "hypothetical protein"; protein_id "WP_000747329.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 109220 111301 . - . gene_id "nbis-gene-95"; ID "nbis-gene-95"; Name "recG"; gbkey "Gene"; gene "recG"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00605"; +NZ_CP027599.1 RefSeq transcript 109220 111301 . - . gene_id "nbis-gene-95"; transcript_id "gene-C7A06_RS00605"; ID "gene-C7A06_RS00605"; Name "recG"; Parent "nbis-gene-95"; gbkey "Gene"; gene "recG"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00605"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 109220 111301 . - . gene_id "nbis-gene-95"; transcript_id "gene-C7A06_RS00605"; Dbxref "Genbank:WP_000678419.1"; ID "nbis-exon-103"; Name "WP_000678419.1"; Ontology_term "GO:0006281" "GO:0006310" "GO:0003676" "GO:0003678" "GO:0005524"; Parent "gene-C7A06_RS00605"; gbkey "CDS"; gene "recG"; go_function "nucleic acid binding|0003676||IEA" "DNA helicase activity|0003678||IEA" "ATP binding|0005524||IEA"; go_process "DNA repair|0006281||IEA" "DNA recombination|0006310||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418109.1"; locus_tag "C7A06_RS00605"; product "ATP-dependent DNA helicase RecG"; protein_id "WP_000678419.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 109220 111301 . - 0 gene_id "nbis-gene-95"; transcript_id "gene-C7A06_RS00605"; Dbxref "Genbank:WP_000678419.1"; ID "cds-WP_000678419.1"; Name "WP_000678419.1"; Ontology_term "GO:0006281" "GO:0006310" "GO:0003676" "GO:0003678" "GO:0005524"; Parent "gene-C7A06_RS00605"; gbkey "CDS"; gene "recG"; go_function "nucleic acid binding|0003676||IEA" "DNA helicase activity|0003678||IEA" "ATP binding|0005524||IEA"; go_process "DNA repair|0006281||IEA" "DNA recombination|0006310||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418109.1"; locus_tag "C7A06_RS00605"; product "ATP-dependent DNA helicase RecG"; protein_id "WP_000678419.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 111307 111996 . - . gene_id "nbis-gene-96"; ID "nbis-gene-96"; Name "trmH"; gbkey "Gene"; gene "trmH"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00610"; +NZ_CP027599.1 RefSeq transcript 111307 111996 . - . gene_id "nbis-gene-96"; transcript_id "gene-C7A06_RS00610"; ID "gene-C7A06_RS00610"; Name "trmH"; Parent "nbis-gene-96"; gbkey "Gene"; gene "trmH"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00610"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 111307 111996 . - . gene_id "nbis-gene-96"; transcript_id "gene-C7A06_RS00610"; Dbxref "Genbank:WP_001070177.1"; ID "nbis-exon-104"; Name "WP_001070177.1"; Ontology_term "GO:0030488" "GO:0008173" "GO:0009020"; Parent "gene-C7A06_RS00610"; gbkey "CDS"; gene "trmH"; go_function "RNA methyltransferase activity|0008173||IEA" "tRNA (guanosine-2'-O-)-methyltransferase activity|0009020||IEA"; go_process "tRNA methylation|0030488||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418108.1"; locus_tag "C7A06_RS00610"; product "tRNA (guanosine(18)-2'-O)-methyltransferase TrmH"; protein_id "WP_001070177.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 111307 111996 . - 0 gene_id "nbis-gene-96"; transcript_id "gene-C7A06_RS00610"; Dbxref "Genbank:WP_001070177.1"; ID "cds-WP_001070177.1"; Name "WP_001070177.1"; Ontology_term "GO:0030488" "GO:0008173" "GO:0009020"; Parent "gene-C7A06_RS00610"; gbkey "CDS"; gene "trmH"; go_function "RNA methyltransferase activity|0008173||IEA" "tRNA (guanosine-2'-O-)-methyltransferase activity|0009020||IEA"; go_process "tRNA methylation|0030488||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418108.1"; locus_tag "C7A06_RS00610"; product "tRNA (guanosine(18)-2'-O)-methyltransferase TrmH"; protein_id "WP_001070177.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 112003 114111 . - . gene_id "nbis-gene-97"; ID "nbis-gene-97"; Name "spoT"; gbkey "Gene"; gene "spoT"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00615"; +NZ_CP027599.1 RefSeq transcript 112003 114111 . - . gene_id "nbis-gene-97"; transcript_id "gene-C7A06_RS00615"; ID "gene-C7A06_RS00615"; Name "spoT"; Parent "nbis-gene-97"; gbkey "Gene"; gene "spoT"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00615"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 112003 114111 . - . gene_id "nbis-gene-97"; transcript_id "gene-C7A06_RS00615"; Dbxref "Genbank:WP_000280488.1"; ID "nbis-exon-105"; Name "WP_000280488.1"; Ontology_term "GO:0015969" "GO:0008728" "GO:0008893"; Parent "gene-C7A06_RS00615"; gbkey "CDS"; gene "spoT"; go_function "GTP diphosphokinase activity|0008728||IEA" "guanosine-3',5'-bis(diphosphate) 3'-diphosphatase activity|0008893||IEA"; go_process "guanosine tetraphosphate metabolic process|0015969||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312552.1"; locus_tag "C7A06_RS00615"; product "bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase"; protein_id "WP_000280488.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 112003 114111 . - 0 gene_id "nbis-gene-97"; transcript_id "gene-C7A06_RS00615"; Dbxref "Genbank:WP_000280488.1"; ID "cds-WP_000280488.1"; Name "WP_000280488.1"; Ontology_term "GO:0015969" "GO:0008728" "GO:0008893"; Parent "gene-C7A06_RS00615"; gbkey "CDS"; gene "spoT"; go_function "GTP diphosphokinase activity|0008728||IEA" "guanosine-3',5'-bis(diphosphate) 3'-diphosphatase activity|0008893||IEA"; go_process "guanosine tetraphosphate metabolic process|0015969||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312552.1"; locus_tag "C7A06_RS00615"; product "bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase"; protein_id "WP_000280488.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 114130 114405 . - . gene_id "nbis-gene-98"; ID "nbis-gene-98"; Name "rpoZ"; gbkey "Gene"; gene "rpoZ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00620"; +NZ_CP027599.1 RefSeq transcript 114130 114405 . - . gene_id "nbis-gene-98"; transcript_id "gene-C7A06_RS00620"; ID "gene-C7A06_RS00620"; Name "rpoZ"; Parent "nbis-gene-98"; gbkey "Gene"; gene "rpoZ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00620"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 114130 114405 . - . gene_id "nbis-gene-98"; transcript_id "gene-C7A06_RS00620"; Dbxref "Genbank:WP_000135058.1"; ID "nbis-exon-106"; Name "WP_000135058.1"; Ontology_term "GO:0006351" "GO:0003899" "GO:0000345"; Parent "gene-C7A06_RS00620"; gbkey "CDS"; gene "rpoZ"; go_component "cytosolic DNA-directed RNA polymerase complex|0000345||IEA"; go_function "DNA-directed 5'-3' RNA polymerase activity|0003899||IEA"; go_process "transcription, DNA-templated|0006351||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_013511051.1"; locus_tag "C7A06_RS00620"; product "DNA-directed RNA polymerase subunit omega"; protein_id "WP_000135058.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 114130 114405 . - 0 gene_id "nbis-gene-98"; transcript_id "gene-C7A06_RS00620"; Dbxref "Genbank:WP_000135058.1"; ID "cds-WP_000135058.1"; Name "WP_000135058.1"; Ontology_term "GO:0006351" "GO:0003899" "GO:0000345"; Parent "gene-C7A06_RS00620"; gbkey "CDS"; gene "rpoZ"; go_component "cytosolic DNA-directed RNA polymerase complex|0000345||IEA"; go_function "DNA-directed 5'-3' RNA polymerase activity|0003899||IEA"; go_process "transcription, DNA-templated|0006351||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_013511051.1"; locus_tag "C7A06_RS00620"; product "DNA-directed RNA polymerase subunit omega"; protein_id "WP_000135058.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 114460 115083 . - . gene_id "nbis-gene-99"; ID "nbis-gene-99"; Name "gmk"; gbkey "Gene"; gene "gmk"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00625"; +NZ_CP027599.1 RefSeq transcript 114460 115083 . - . gene_id "nbis-gene-99"; transcript_id "gene-C7A06_RS00625"; ID "gene-C7A06_RS00625"; Name "gmk"; Parent "nbis-gene-99"; gbkey "Gene"; gene "gmk"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00625"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 114460 115083 . - . gene_id "nbis-gene-99"; transcript_id "gene-C7A06_RS00625"; Dbxref "Genbank:WP_001295237.1"; ID "nbis-exon-107"; Name "WP_001295237.1"; Ontology_term "GO:0015949" "GO:0004385"; Parent "gene-C7A06_RS00625"; gbkey "CDS"; gene "gmk"; go_function "guanylate kinase activity|0004385||IEA"; go_process "nucleobase-containing small molecule interconversion|0015949||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000046969.1"; locus_tag "C7A06_RS00625"; product "guanylate kinase"; protein_id "WP_001295237.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 114460 115083 . - 0 gene_id "nbis-gene-99"; transcript_id "gene-C7A06_RS00625"; Dbxref "Genbank:WP_001295237.1"; ID "cds-WP_001295237.1"; Name "WP_001295237.1"; Ontology_term "GO:0015949" "GO:0004385"; Parent "gene-C7A06_RS00625"; gbkey "CDS"; gene "gmk"; go_function "guanylate kinase activity|0004385||IEA"; go_process "nucleobase-containing small molecule interconversion|0015949||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000046969.1"; locus_tag "C7A06_RS00625"; product "guanylate kinase"; protein_id "WP_001295237.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 115341 117023 . + . gene_id "nbis-gene-100"; ID "nbis-gene-100"; Name "ligB"; gbkey "Gene"; gene "ligB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00630"; +NZ_CP027599.1 RefSeq transcript 115341 117023 . + . gene_id "nbis-gene-100"; transcript_id "gene-C7A06_RS00630"; ID "gene-C7A06_RS00630"; Name "ligB"; Parent "nbis-gene-100"; gbkey "Gene"; gene "ligB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00630"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 115341 117023 . + . gene_id "nbis-gene-100"; transcript_id "gene-C7A06_RS00630"; Dbxref "Genbank:WP_001426185.1"; ID "nbis-exon-108"; Name "WP_001426185.1"; Ontology_term "GO:0006260" "GO:0006281" "GO:0003911"; Parent "gene-C7A06_RS00630"; gbkey "CDS"; gene "ligB"; go_function "DNA ligase (NAD+) activity|0003911||IEA"; go_process "DNA replication|0006260||IEA" "DNA repair|0006281||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312549.2"; locus_tag "C7A06_RS00630"; product "NAD-dependent DNA ligase LigB"; protein_id "WP_001426185.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 115341 117023 . + 0 gene_id "nbis-gene-100"; transcript_id "gene-C7A06_RS00630"; Dbxref "Genbank:WP_001426185.1"; ID "cds-WP_001426185.1"; Name "WP_001426185.1"; Ontology_term "GO:0006260" "GO:0006281" "GO:0003911"; Parent "gene-C7A06_RS00630"; gbkey "CDS"; gene "ligB"; go_function "DNA ligase (NAD+) activity|0003911||IEA"; go_process "DNA replication|0006260||IEA" "DNA repair|0006281||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312549.2"; locus_tag "C7A06_RS00630"; product "NAD-dependent DNA ligase LigB"; protein_id "WP_001426185.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 117020 117637 . - . gene_id "nbis-gene-101"; ID "nbis-gene-101"; Name "yicG"; gbkey "Gene"; gene "yicG"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00635"; +NZ_CP027599.1 RefSeq transcript 117020 117637 . - . gene_id "nbis-gene-101"; transcript_id "gene-C7A06_RS00635"; ID "gene-C7A06_RS00635"; Name "yicG"; Parent "nbis-gene-101"; gbkey "Gene"; gene "yicG"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00635"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 117020 117637 . - . gene_id "nbis-gene-101"; transcript_id "gene-C7A06_RS00635"; Dbxref "Genbank:WP_000924289.1"; ID "nbis-exon-109"; Name "WP_000924289.1"; Parent "gene-C7A06_RS00635"; gbkey "CDS"; gene "yicG"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312548.2"; locus_tag "C7A06_RS00635"; product "trimeric intracellular cation channel family protein"; protein_id "WP_000924289.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 117020 117637 . - 0 gene_id "nbis-gene-101"; transcript_id "gene-C7A06_RS00635"; Dbxref "Genbank:WP_000924289.1"; ID "cds-WP_000924289.1"; Name "WP_000924289.1"; Parent "gene-C7A06_RS00635"; gbkey "CDS"; gene "yicG"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312548.2"; locus_tag "C7A06_RS00635"; product "trimeric intracellular cation channel family protein"; protein_id "WP_000924289.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 117929 118753 . - . gene_id "nbis-gene-102"; ID "nbis-gene-102"; Name "dinD"; gbkey "Gene"; gene "dinD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00640"; +NZ_CP027599.1 RefSeq transcript 117929 118753 . - . gene_id "nbis-gene-102"; transcript_id "gene-C7A06_RS00640"; ID "gene-C7A06_RS00640"; Name "dinD"; Parent "nbis-gene-102"; gbkey "Gene"; gene "dinD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00640"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 117929 118753 . - . gene_id "nbis-gene-102"; transcript_id "gene-C7A06_RS00640"; Dbxref "Genbank:WP_001297374.1"; ID "nbis-exon-110"; Name "WP_001297374.1"; Parent "gene-C7A06_RS00640"; gbkey "CDS"; gene "dinD"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312547.2"; locus_tag "C7A06_RS00640"; product "DNA damage-inducible protein D"; protein_id "WP_001297374.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 117929 118753 . - 0 gene_id "nbis-gene-102"; transcript_id "gene-C7A06_RS00640"; Dbxref "Genbank:WP_001297374.1"; ID "cds-WP_001297374.1"; Name "WP_001297374.1"; Parent "gene-C7A06_RS00640"; gbkey "CDS"; gene "dinD"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312547.2"; locus_tag "C7A06_RS00640"; product "DNA damage-inducible protein D"; protein_id "WP_001297374.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 118974 119837 . - . gene_id "nbis-gene-103"; ID "nbis-gene-103"; Name "yicC"; gbkey "Gene"; gene "yicC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00645"; +NZ_CP027599.1 RefSeq transcript 118974 119837 . - . gene_id "nbis-gene-103"; transcript_id "gene-C7A06_RS00645"; ID "gene-C7A06_RS00645"; Name "yicC"; Parent "nbis-gene-103"; gbkey "Gene"; gene "yicC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00645"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 118974 119837 . - . gene_id "nbis-gene-103"; transcript_id "gene-C7A06_RS00645"; Dbxref "Genbank:WP_000621336.1"; ID "nbis-exon-111"; Name "WP_000621336.1"; Parent "gene-C7A06_RS00645"; gbkey "CDS"; gene "yicC"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_005122606.1"; locus_tag "C7A06_RS00645"; product "YicC family protein"; protein_id "WP_000621336.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 118974 119837 . - 0 gene_id "nbis-gene-103"; transcript_id "gene-C7A06_RS00645"; Dbxref "Genbank:WP_000621336.1"; ID "cds-WP_000621336.1"; Name "WP_000621336.1"; Parent "gene-C7A06_RS00645"; gbkey "CDS"; gene "yicC"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_005122606.1"; locus_tag "C7A06_RS00645"; product "YicC family protein"; protein_id "WP_000621336.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 119964 120680 . + . gene_id "nbis-gene-104"; ID "nbis-gene-104"; Name "rph"; gbkey "Gene"; gene "rph"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00655"; +NZ_CP027599.1 RefSeq transcript 119964 120680 . + . gene_id "nbis-gene-104"; transcript_id "gene-C7A06_RS00655"; ID "gene-C7A06_RS00655"; Name "rph"; Parent "nbis-gene-104"; gbkey "Gene"; gene "rph"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00655"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 119964 120680 . + . gene_id "nbis-gene-104"; transcript_id "gene-C7A06_RS00655"; Dbxref "Genbank:WP_001247089.1"; ID "nbis-exon-112"; Name "WP_001247089.1"; Ontology_term "GO:0008033" "GO:0004549"; Parent "gene-C7A06_RS00655"; gbkey "CDS"; gene "rph"; go_function "tRNA-specific ribonuclease activity|0004549||IEA"; go_process "tRNA processing|0008033||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_006803115.1"; locus_tag "C7A06_RS00655"; product "ribonuclease PH"; protein_id "WP_001247089.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 119964 120680 . + 0 gene_id "nbis-gene-104"; transcript_id "gene-C7A06_RS00655"; Dbxref "Genbank:WP_001247089.1"; ID "cds-WP_001247089.1"; Name "WP_001247089.1"; Ontology_term "GO:0008033" "GO:0004549"; Parent "gene-C7A06_RS00655"; gbkey "CDS"; gene "rph"; go_function "tRNA-specific ribonuclease activity|0004549||IEA"; go_process "tRNA processing|0008033||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_006803115.1"; locus_tag "C7A06_RS00655"; product "ribonuclease PH"; protein_id "WP_001247089.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 120746 121387 . + . gene_id "nbis-gene-105"; ID "nbis-gene-105"; Name "pyrE"; gbkey "Gene"; gene "pyrE"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00660"; +NZ_CP027599.1 RefSeq transcript 120746 121387 . + . gene_id "nbis-gene-105"; transcript_id "gene-C7A06_RS00660"; ID "gene-C7A06_RS00660"; Name "pyrE"; Parent "nbis-gene-105"; gbkey "Gene"; gene "pyrE"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00660"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 120746 121387 . + . gene_id "nbis-gene-105"; transcript_id "gene-C7A06_RS00660"; Dbxref "Genbank:WP_000806161.1"; ID "nbis-exon-113"; Name "WP_000806161.1"; Ontology_term "GO:0009220" "GO:0004588"; Parent "gene-C7A06_RS00660"; gbkey "CDS"; gene "pyrE"; go_function "orotate phosphoribosyltransferase activity|0004588||IEA"; go_process "pyrimidine ribonucleotide biosynthetic process|0009220||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312544.1"; locus_tag "C7A06_RS00660"; product "orotate phosphoribosyltransferase"; protein_id "WP_000806161.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 120746 121387 . + 0 gene_id "nbis-gene-105"; transcript_id "gene-C7A06_RS00660"; Dbxref "Genbank:WP_000806161.1"; ID "cds-WP_000806161.1"; Name "WP_000806161.1"; Ontology_term "GO:0009220" "GO:0004588"; Parent "gene-C7A06_RS00660"; gbkey "CDS"; gene "pyrE"; go_function "orotate phosphoribosyltransferase activity|0004588||IEA"; go_process "pyrimidine ribonucleotide biosynthetic process|0009220||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312544.1"; locus_tag "C7A06_RS00660"; product "orotate phosphoribosyltransferase"; protein_id "WP_000806161.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 121424 122020 . - . gene_id "nbis-gene-106"; ID "nbis-gene-106"; Name "slmA"; gbkey "Gene"; gene "slmA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00665"; +NZ_CP027599.1 RefSeq transcript 121424 122020 . - . gene_id "nbis-gene-106"; transcript_id "gene-C7A06_RS00665"; ID "gene-C7A06_RS00665"; Name "slmA"; Parent "nbis-gene-106"; gbkey "Gene"; gene "slmA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00665"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 121424 122020 . - . gene_id "nbis-gene-106"; transcript_id "gene-C7A06_RS00665"; Dbxref "Genbank:WP_000818601.1"; ID "nbis-exon-114"; Name "WP_000818601.1"; Ontology_term "GO:0010974" "GO:0003677"; Parent "gene-C7A06_RS00665"; gbkey "CDS"; gene "slmA"; go_function "DNA binding|0003677||IEA"; go_process "negative regulation of division septum assembly|0010974||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000818604.1"; locus_tag "C7A06_RS00665"; product "nucleoid occlusion factor SlmA"; protein_id "WP_000818601.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 121424 122020 . - 0 gene_id "nbis-gene-106"; transcript_id "gene-C7A06_RS00665"; Dbxref "Genbank:WP_000818601.1"; ID "cds-WP_000818601.1"; Name "WP_000818601.1"; Ontology_term "GO:0010974" "GO:0003677"; Parent "gene-C7A06_RS00665"; gbkey "CDS"; gene "slmA"; go_function "DNA binding|0003677||IEA"; go_process "negative regulation of division septum assembly|0010974||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000818604.1"; locus_tag "C7A06_RS00665"; product "nucleoid occlusion factor SlmA"; protein_id "WP_000818601.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 122127 122585 . - . gene_id "nbis-gene-107"; ID "nbis-gene-107"; Name "dut"; gbkey "Gene"; gene "dut"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00670"; +NZ_CP027599.1 RefSeq transcript 122127 122585 . - . gene_id "nbis-gene-107"; transcript_id "gene-C7A06_RS00670"; ID "gene-C7A06_RS00670"; Name "dut"; Parent "nbis-gene-107"; gbkey "Gene"; gene "dut"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00670"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 122127 122585 . - . gene_id "nbis-gene-107"; transcript_id "gene-C7A06_RS00670"; Dbxref "Genbank:WP_000976070.1"; ID "nbis-exon-115"; Name "WP_000976070.1"; Ontology_term "GO:0006226" "GO:0046081" "GO:0000287" "GO:0004170"; Parent "gene-C7A06_RS00670"; gbkey "CDS"; gene "dut"; go_function "magnesium ion binding|0000287||IEA" "dUTP diphosphatase activity|0004170||IEA"; go_process "dUMP biosynthetic process|0006226||IEA" "dUTP catabolic process|0046081||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000976070.1"; locus_tag "C7A06_RS00670"; product "dUTP diphosphatase"; protein_id "WP_000976070.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 122127 122585 . - 0 gene_id "nbis-gene-107"; transcript_id "gene-C7A06_RS00670"; Dbxref "Genbank:WP_000976070.1"; ID "cds-WP_000976070.1"; Name "WP_000976070.1"; Ontology_term "GO:0006226" "GO:0046081" "GO:0000287" "GO:0004170"; Parent "gene-C7A06_RS00670"; gbkey "CDS"; gene "dut"; go_function "magnesium ion binding|0000287||IEA" "dUTP diphosphatase activity|0004170||IEA"; go_process "dUMP biosynthetic process|0006226||IEA" "dUTP catabolic process|0046081||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000976070.1"; locus_tag "C7A06_RS00670"; product "dUTP diphosphatase"; protein_id "WP_000976070.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 122563 123783 . - . gene_id "nbis-gene-108"; ID "nbis-gene-108"; Name "coaBC"; gbkey "Gene"; gene "coaBC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00675"; +NZ_CP027599.1 RefSeq transcript 122563 123783 . - . gene_id "nbis-gene-108"; transcript_id "gene-C7A06_RS00675"; ID "gene-C7A06_RS00675"; Name "coaBC"; Parent "nbis-gene-108"; gbkey "Gene"; gene "coaBC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00675"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 122563 123783 . - . gene_id "nbis-gene-108"; transcript_id "gene-C7A06_RS00675"; Dbxref "Genbank:WP_000050139.1"; ID "nbis-exon-116"; Name "WP_000050139.1"; Ontology_term "GO:0015937" "GO:0015939" "GO:0004632" "GO:0004633"; Parent "gene-C7A06_RS00675"; gbkey "CDS"; gene "coaBC"; go_function "phosphopantothenate--cysteine ligase activity|0004632||IEA" "phosphopantothenoylcysteine decarboxylase activity|0004633||IEA"; go_process "coenzyme A biosynthetic process|0015937||IEA" "pantothenate metabolic process|0015939||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418096.4"; locus_tag "C7A06_RS00675"; product "bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC"; protein_id "WP_000050139.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 122563 123783 . - 0 gene_id "nbis-gene-108"; transcript_id "gene-C7A06_RS00675"; Dbxref "Genbank:WP_000050139.1"; ID "cds-WP_000050139.1"; Name "WP_000050139.1"; Ontology_term "GO:0015937" "GO:0015939" "GO:0004632" "GO:0004633"; Parent "gene-C7A06_RS00675"; gbkey "CDS"; gene "coaBC"; go_function "phosphopantothenate--cysteine ligase activity|0004632||IEA" "phosphopantothenoylcysteine decarboxylase activity|0004633||IEA"; go_process "coenzyme A biosynthetic process|0015937||IEA" "pantothenate metabolic process|0015939||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418096.4"; locus_tag "C7A06_RS00675"; product "bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC"; protein_id "WP_000050139.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 123955 124623 . + . gene_id "nbis-gene-109"; ID "nbis-gene-109"; Name "radC"; gbkey "Gene"; gene "radC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00680"; +NZ_CP027599.1 RefSeq transcript 123955 124623 . + . gene_id "nbis-gene-109"; transcript_id "gene-C7A06_RS00680"; ID "gene-C7A06_RS00680"; Name "radC"; Parent "nbis-gene-109"; gbkey "Gene"; gene "radC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00680"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 123955 124623 . + . gene_id "nbis-gene-109"; transcript_id "gene-C7A06_RS00680"; Dbxref "Genbank:WP_001297375.1"; ID "nbis-exon-117"; Name "WP_001297375.1"; Ontology_term "GO:0006281" "GO:0003677"; Parent "gene-C7A06_RS00680"; gbkey "CDS"; gene "radC"; go_function "DNA binding|0003677||IEA"; go_process "DNA repair|0006281||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709417.4"; locus_tag "C7A06_RS00680"; product "DNA repair protein RadC"; protein_id "WP_001297375.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 123955 124623 . + 0 gene_id "nbis-gene-109"; transcript_id "gene-C7A06_RS00680"; Dbxref "Genbank:WP_001297375.1"; ID "cds-WP_001297375.1"; Name "WP_001297375.1"; Ontology_term "GO:0006281" "GO:0003677"; Parent "gene-C7A06_RS00680"; gbkey "CDS"; gene "radC"; go_function "DNA binding|0003677||IEA"; go_process "DNA repair|0006281||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709417.4"; locus_tag "C7A06_RS00680"; product "DNA repair protein RadC"; protein_id "WP_001297375.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 124840 125076 . + . gene_id "nbis-gene-110"; ID "nbis-gene-110"; Name "rpmB"; gbkey "Gene"; gene "rpmB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00685"; +NZ_CP027599.1 RefSeq transcript 124840 125076 . + . gene_id "nbis-gene-110"; transcript_id "gene-C7A06_RS00685"; ID "gene-C7A06_RS00685"; Name "rpmB"; Parent "nbis-gene-110"; gbkey "Gene"; gene "rpmB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00685"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 124840 125076 . + . gene_id "nbis-gene-110"; transcript_id "gene-C7A06_RS00685"; Dbxref "Genbank:WP_000091955.1"; ID "nbis-exon-118"; Name "WP_000091955.1"; Ontology_term "GO:0006412" "GO:0003735" "GO:0000311" "GO:0022625"; Parent "gene-C7A06_RS00685"; gbkey "CDS"; gene "rpmB"; go_component "plastid large ribosomal subunit|0000311||IEA" "cytosolic large ribosomal subunit|0022625||IEA"; go_function "structural constituent of ribosome|0003735||IEA"; go_process "translation|0006412||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_008457442.1"; locus_tag "C7A06_RS00685"; product "50S ribosomal protein L28"; protein_id "WP_000091955.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 124840 125076 . + 0 gene_id "nbis-gene-110"; transcript_id "gene-C7A06_RS00685"; Dbxref "Genbank:WP_000091955.1"; ID "cds-WP_000091955.1"; Name "WP_000091955.1"; Ontology_term "GO:0006412" "GO:0003735" "GO:0000311" "GO:0022625"; Parent "gene-C7A06_RS00685"; gbkey "CDS"; gene "rpmB"; go_component "plastid large ribosomal subunit|0000311||IEA" "cytosolic large ribosomal subunit|0022625||IEA"; go_function "structural constituent of ribosome|0003735||IEA"; go_process "translation|0006412||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_008457442.1"; locus_tag "C7A06_RS00685"; product "50S ribosomal protein L28"; protein_id "WP_000091955.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 125097 125264 . + . gene_id "nbis-gene-111"; ID "nbis-gene-111"; Name "rpmG"; gbkey "Gene"; gene "rpmG"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00690"; +NZ_CP027599.1 RefSeq transcript 125097 125264 . + . gene_id "nbis-gene-111"; transcript_id "gene-C7A06_RS00690"; ID "gene-C7A06_RS00690"; Name "rpmG"; Parent "nbis-gene-111"; gbkey "Gene"; gene "rpmG"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00690"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 125097 125264 . + . gene_id "nbis-gene-111"; transcript_id "gene-C7A06_RS00690"; Dbxref "Genbank:WP_001051798.1"; ID "nbis-exon-119"; Name "WP_001051798.1"; Ontology_term "GO:0006412" "GO:0003735" "GO:0000315" "GO:0022625"; Parent "gene-C7A06_RS00690"; gbkey "CDS"; gene "rpmG"; go_component "organellar large ribosomal subunit|0000315||IEA" "cytosolic large ribosomal subunit|0022625||IEA"; go_function "structural constituent of ribosome|0003735||IEA"; go_process "translation|0006412||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_010847629.1"; locus_tag "C7A06_RS00690"; product "50S ribosomal protein L33"; protein_id "WP_001051798.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 125097 125264 . + 0 gene_id "nbis-gene-111"; transcript_id "gene-C7A06_RS00690"; Dbxref "Genbank:WP_001051798.1"; ID "cds-WP_001051798.1"; Name "WP_001051798.1"; Ontology_term "GO:0006412" "GO:0003735" "GO:0000315" "GO:0022625"; Parent "gene-C7A06_RS00690"; gbkey "CDS"; gene "rpmG"; go_component "organellar large ribosomal subunit|0000315||IEA" "cytosolic large ribosomal subunit|0022625||IEA"; go_function "structural constituent of ribosome|0003735||IEA"; go_process "translation|0006412||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_010847629.1"; locus_tag "C7A06_RS00690"; product "50S ribosomal protein L33"; protein_id "WP_001051798.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 125362 126171 . + . gene_id "nbis-gene-112"; ID "nbis-gene-112"; Name "mutM"; gbkey "Gene"; gene "mutM"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00695"; +NZ_CP027599.1 RefSeq transcript 125362 126171 . + . gene_id "nbis-gene-112"; transcript_id "gene-C7A06_RS00695"; ID "gene-C7A06_RS00695"; Name "mutM"; Parent "nbis-gene-112"; gbkey "Gene"; gene "mutM"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00695"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 125362 126171 . + . gene_id "nbis-gene-112"; transcript_id "gene-C7A06_RS00695"; Dbxref "Genbank:WP_001114533.1"; ID "nbis-exon-120"; Name "WP_001114533.1"; Ontology_term "GO:0006281" "GO:0006284" "GO:0003676" "GO:0003684" "GO:0003906" "GO:0008534" "GO:0016799" "GO:0019104"; Parent "gene-C7A06_RS00695"; gbkey "CDS"; gene "mutM"; go_function "nucleic acid binding|0003676||IEA" "damaged DNA binding|0003684||IEA" "DNA-(apurinic or apyrimidinic site) endonuclease activity|0003906||IEA" "oxidized purine nucleobase lesion DNA N-glycosylase activity|0008534||IEA" "hydrolase activity, hydrolyzing N-glycosyl compounds|0016799||IEA" "DNA N-glycosylase activity|0019104||IEA"; go_process "DNA repair|0006281||IEA" "base-excision repair|0006284||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312537.1"; locus_tag "C7A06_RS00695"; product "bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase"; protein_id "WP_001114533.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 125362 126171 . + 0 gene_id "nbis-gene-112"; transcript_id "gene-C7A06_RS00695"; Dbxref "Genbank:WP_001114533.1"; ID "cds-WP_001114533.1"; Name "WP_001114533.1"; Ontology_term "GO:0006281" "GO:0006284" "GO:0003676" "GO:0003684" "GO:0003906" "GO:0008534" "GO:0016799" "GO:0019104"; Parent "gene-C7A06_RS00695"; gbkey "CDS"; gene "mutM"; go_function "nucleic acid binding|0003676||IEA" "damaged DNA binding|0003684||IEA" "DNA-(apurinic or apyrimidinic site) endonuclease activity|0003906||IEA" "oxidized purine nucleobase lesion DNA N-glycosylase activity|0008534||IEA" "hydrolase activity, hydrolyzing N-glycosyl compounds|0016799||IEA" "DNA N-glycosylase activity|0019104||IEA"; go_process "DNA repair|0006281||IEA" "base-excision repair|0006284||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312537.1"; locus_tag "C7A06_RS00695"; product "bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase"; protein_id "WP_001114533.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 126210 126689 . - . gene_id "nbis-gene-113"; ID "nbis-gene-113"; Name "coaD"; gbkey "Gene"; gene "coaD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00700"; +NZ_CP027599.1 RefSeq transcript 126210 126689 . - . gene_id "nbis-gene-113"; transcript_id "gene-C7A06_RS00700"; ID "gene-C7A06_RS00700"; Name "coaD"; Parent "nbis-gene-113"; gbkey "Gene"; gene "coaD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00700"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 126210 126689 . - . gene_id "nbis-gene-113"; transcript_id "gene-C7A06_RS00700"; Dbxref "Genbank:WP_001171866.1"; ID "nbis-exon-121"; Name "WP_001171866.1"; Ontology_term "GO:0015937" "GO:0004595"; Parent "gene-C7A06_RS00700"; gbkey "CDS"; gene "coaD"; go_function "pantetheine-phosphate adenylyltransferase activity|0004595||IEA"; go_process "coenzyme A biosynthetic process|0015937||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312536.1"; locus_tag "C7A06_RS00700"; product "pantetheine-phosphate adenylyltransferase"; protein_id "WP_001171866.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 126210 126689 . - 0 gene_id "nbis-gene-113"; transcript_id "gene-C7A06_RS00700"; Dbxref "Genbank:WP_001171866.1"; ID "cds-WP_001171866.1"; Name "WP_001171866.1"; Ontology_term "GO:0015937" "GO:0004595"; Parent "gene-C7A06_RS00700"; gbkey "CDS"; gene "coaD"; go_function "pantetheine-phosphate adenylyltransferase activity|0004595||IEA"; go_process "coenzyme A biosynthetic process|0015937||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312536.1"; locus_tag "C7A06_RS00700"; product "pantetheine-phosphate adenylyltransferase"; protein_id "WP_001171866.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 126697 127974 . - . gene_id "nbis-gene-114"; ID "nbis-gene-114"; Name "waaA"; gbkey "Gene"; gene "waaA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00705"; +NZ_CP027599.1 RefSeq transcript 126697 127974 . - . gene_id "nbis-gene-114"; transcript_id "gene-C7A06_RS00705"; ID "gene-C7A06_RS00705"; Name "waaA"; Parent "nbis-gene-114"; gbkey "Gene"; gene "waaA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00705"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 126697 127974 . - . gene_id "nbis-gene-114"; transcript_id "gene-C7A06_RS00705"; Dbxref "Genbank:WP_000891564.1"; ID "nbis-exon-122"; Name "WP_000891564.1"; Ontology_term "GO:0016740"; Parent "gene-C7A06_RS00705"; gbkey "CDS"; gene "waaA"; go_function "transferase activity|0016740||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312535.1"; locus_tag "C7A06_RS00705"; product "lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase"; protein_id "WP_000891564.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 126697 127974 . - 0 gene_id "nbis-gene-114"; transcript_id "gene-C7A06_RS00705"; Dbxref "Genbank:WP_000891564.1"; ID "cds-WP_000891564.1"; Name "WP_000891564.1"; Ontology_term "GO:0016740"; Parent "gene-C7A06_RS00705"; gbkey "CDS"; gene "waaA"; go_function "transferase activity|0016740||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312535.1"; locus_tag "C7A06_RS00705"; product "lipid IV(A) 3-deoxy-D-manno-octulosonic acid transferase"; protein_id "WP_000891564.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 128387 129445 . + . gene_id "nbis-gene-115"; ID "nbis-gene-115"; Name "rfaQ"; gbkey "Gene"; gene "rfaQ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00710"; +NZ_CP027599.1 RefSeq transcript 128387 129445 . + . gene_id "nbis-gene-115"; transcript_id "gene-C7A06_RS00710"; ID "gene-C7A06_RS00710"; Name "rfaQ"; Parent "nbis-gene-115"; gbkey "Gene"; gene "rfaQ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00710"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 128387 129445 . + . gene_id "nbis-gene-115"; transcript_id "gene-C7A06_RS00710"; Dbxref "Genbank:WP_000360406.1"; ID "nbis-exon-123"; Name "WP_000360406.1"; Ontology_term "GO:0016757"; Parent "gene-C7A06_RS00710"; gbkey "CDS"; gene "rfaQ"; go_function "glycosyltransferase activity|0016757||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709409.1"; locus_tag "C7A06_RS00710"; product "lipopolysaccharide core heptosyltransferase RfaQ"; protein_id "WP_000360406.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 128387 129445 . + 0 gene_id "nbis-gene-115"; transcript_id "gene-C7A06_RS00710"; Dbxref "Genbank:WP_000360406.1"; ID "cds-WP_000360406.1"; Name "WP_000360406.1"; Ontology_term "GO:0016757"; Parent "gene-C7A06_RS00710"; gbkey "CDS"; gene "rfaQ"; go_function "glycosyltransferase activity|0016757||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709409.1"; locus_tag "C7A06_RS00710"; product "lipopolysaccharide core heptosyltransferase RfaQ"; protein_id "WP_000360406.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 129442 130566 . + . gene_id "nbis-gene-116"; ID "nbis-gene-116"; Name "waaG"; gbkey "Gene"; gene "waaG"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00715"; +NZ_CP027599.1 RefSeq transcript 129442 130566 . + . gene_id "nbis-gene-116"; transcript_id "gene-C7A06_RS00715"; ID "gene-C7A06_RS00715"; Name "waaG"; Parent "nbis-gene-116"; gbkey "Gene"; gene "waaG"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00715"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 129442 130566 . + . gene_id "nbis-gene-116"; transcript_id "gene-C7A06_RS00715"; Dbxref "Genbank:WP_000634240.1"; ID "nbis-exon-124"; Name "WP_000634240.1"; Parent "gene-C7A06_RS00715"; gbkey "CDS"; gene "waaG"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312533.1"; locus_tag "C7A06_RS00715"; product "glycosyltransferase family 4 protein"; protein_id "WP_000634240.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 129442 130566 . + 0 gene_id "nbis-gene-116"; transcript_id "gene-C7A06_RS00715"; Dbxref "Genbank:WP_000634240.1"; ID "cds-WP_000634240.1"; Name "WP_000634240.1"; Parent "gene-C7A06_RS00715"; gbkey "CDS"; gene "waaG"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312533.1"; locus_tag "C7A06_RS00715"; product "glycosyltransferase family 4 protein"; protein_id "WP_000634240.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 130559 131356 . + . gene_id "nbis-gene-117"; ID "nbis-gene-117"; Name "rfaP"; gbkey "Gene"; gene "rfaP"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00720"; +NZ_CP027599.1 RefSeq transcript 130559 131356 . + . gene_id "nbis-gene-117"; transcript_id "gene-C7A06_RS00720"; ID "gene-C7A06_RS00720"; Name "rfaP"; Parent "nbis-gene-117"; gbkey "Gene"; gene "rfaP"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00720"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 130559 131356 . + . gene_id "nbis-gene-117"; transcript_id "gene-C7A06_RS00720"; Dbxref "Genbank:WP_001341761.1"; ID "nbis-exon-125"; Name "WP_001341761.1"; Ontology_term "GO:0009103" "GO:0016301"; Parent "gene-C7A06_RS00720"; gbkey "CDS"; gene "rfaP"; go_function "kinase activity|0016301||IEA"; go_process "lipopolysaccharide biosynthetic process|0009103||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312532.2"; locus_tag "C7A06_RS00720"; product "lipopolysaccharide core heptose(I) kinase RfaP"; protein_id "WP_001341761.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 130559 131356 . + 0 gene_id "nbis-gene-117"; transcript_id "gene-C7A06_RS00720"; Dbxref "Genbank:WP_001341761.1"; ID "cds-WP_001341761.1"; Name "WP_001341761.1"; Ontology_term "GO:0009103" "GO:0016301"; Parent "gene-C7A06_RS00720"; gbkey "CDS"; gene "rfaP"; go_function "kinase activity|0016301||IEA"; go_process "lipopolysaccharide biosynthetic process|0009103||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312532.2"; locus_tag "C7A06_RS00720"; product "lipopolysaccharide core heptose(I) kinase RfaP"; protein_id "WP_001341761.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 131399 132406 . + . gene_id "nbis-gene-118"; ID "nbis-gene-118"; Name "waaO"; gbkey "Gene"; gene "waaO"; gene_biotype "protein_coding"; gene_synonym "rfaI"; locus_tag "C7A06_RS00725"; +NZ_CP027599.1 RefSeq transcript 131399 132406 . + . gene_id "nbis-gene-118"; transcript_id "gene-C7A06_RS00725"; ID "gene-C7A06_RS00725"; Name "waaO"; Parent "nbis-gene-118"; gbkey "Gene"; gene "waaO"; gene_biotype "protein_coding"; gene_synonym "rfaI"; locus_tag "C7A06_RS00725"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 131399 132406 . + . gene_id "nbis-gene-118"; transcript_id "gene-C7A06_RS00725"; Dbxref "Genbank:WP_000080643.1"; ID "nbis-exon-126"; Name "WP_000080643.1"; Ontology_term "GO:0009103" "GO:0008918"; Parent "gene-C7A06_RS00725"; gbkey "CDS"; gene "waaO"; go_function "lipopolysaccharide 3-alpha-galactosyltransferase activity|0008918||IEA"; go_process "lipopolysaccharide biosynthetic process|0009103||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001521942.1"; locus_tag "C7A06_RS00725"; product "lipopolysaccharide 3-alpha-galactosyltransferase"; protein_id "WP_000080643.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 131399 132406 . + 0 gene_id "nbis-gene-118"; transcript_id "gene-C7A06_RS00725"; Dbxref "Genbank:WP_000080643.1"; ID "cds-WP_000080643.1"; Name "WP_000080643.1"; Ontology_term "GO:0009103" "GO:0008918"; Parent "gene-C7A06_RS00725"; gbkey "CDS"; gene "waaO"; go_function "lipopolysaccharide 3-alpha-galactosyltransferase activity|0008918||IEA"; go_process "lipopolysaccharide biosynthetic process|0009103||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001521942.1"; locus_tag "C7A06_RS00725"; product "lipopolysaccharide 3-alpha-galactosyltransferase"; protein_id "WP_000080643.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 132432 133139 . + . gene_id "nbis-gene-119"; ID "nbis-gene-119"; Name "rfaY"; gbkey "Gene"; gene "rfaY"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00730"; +NZ_CP027599.1 RefSeq transcript 132432 133139 . + . gene_id "nbis-gene-119"; transcript_id "gene-C7A06_RS00730"; ID "gene-C7A06_RS00730"; Name "rfaY"; Parent "nbis-gene-119"; gbkey "Gene"; gene "rfaY"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00730"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 132432 133139 . + . gene_id "nbis-gene-119"; transcript_id "gene-C7A06_RS00730"; Dbxref "Genbank:WP_000639946.1"; ID "nbis-exon-127"; Name "WP_000639946.1"; Parent "gene-C7A06_RS00730"; gbkey "CDS"; gene "rfaY"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709405.1"; locus_tag "C7A06_RS00730"; product "lipopolysaccharide core heptose(II) kinase RfaY"; protein_id "WP_000639946.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 132432 133139 . + 0 gene_id "nbis-gene-119"; transcript_id "gene-C7A06_RS00730"; Dbxref "Genbank:WP_000639946.1"; ID "cds-WP_000639946.1"; Name "WP_000639946.1"; Parent "gene-C7A06_RS00730"; gbkey "CDS"; gene "rfaY"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709405.1"; locus_tag "C7A06_RS00730"; product "lipopolysaccharide core heptose(II) kinase RfaY"; protein_id "WP_000639946.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 133164 134177 . + . gene_id "nbis-gene-120"; ID "nbis-gene-120"; Name "C7A06_RS00735"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00735"; +NZ_CP027599.1 RefSeq transcript 133164 134177 . + . gene_id "nbis-gene-120"; transcript_id "gene-C7A06_RS00735"; ID "gene-C7A06_RS00735"; Name "C7A06_RS00735"; Parent "nbis-gene-120"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00735"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 133164 134177 . + . gene_id "nbis-gene-120"; transcript_id "gene-C7A06_RS00735"; Dbxref "Genbank:WP_000346017.1"; ID "nbis-exon-128"; Name "WP_000346017.1"; Parent "gene-C7A06_RS00735"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312529.1"; locus_tag "C7A06_RS00735"; product "UDP-glucose--(galactosyl) LPS alpha1,2-glucosyltransferase"; protein_id "WP_000346017.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 133164 134177 . + 0 gene_id "nbis-gene-120"; transcript_id "gene-C7A06_RS00735"; Dbxref "Genbank:WP_000346017.1"; ID "cds-WP_000346017.1"; Name "WP_000346017.1"; Parent "gene-C7A06_RS00735"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312529.1"; locus_tag "C7A06_RS00735"; product "UDP-glucose--(galactosyl) LPS alpha1,2-glucosyltransferase"; protein_id "WP_000346017.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 134186 135328 . + . gene_id "nbis-gene-121"; ID "nbis-gene-121"; Name "C7A06_RS00740"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00740"; +NZ_CP027599.1 RefSeq transcript 134186 135328 . + . gene_id "nbis-gene-121"; transcript_id "gene-C7A06_RS00740"; ID "gene-C7A06_RS00740"; Name "C7A06_RS00740"; Parent "nbis-gene-121"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00740"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 134186 135328 . + . gene_id "nbis-gene-121"; transcript_id "gene-C7A06_RS00740"; Dbxref "Genbank:WP_000227812.1"; ID "nbis-exon-129"; Name "WP_000227812.1"; Parent "gene-C7A06_RS00740"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312528.1"; locus_tag "C7A06_RS00740"; product "lipopolysaccharide N-acetylglucosaminyltransferase"; protein_id "WP_000227812.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 134186 135328 . + 0 gene_id "nbis-gene-121"; transcript_id "gene-C7A06_RS00740"; Dbxref "Genbank:WP_000227812.1"; ID "cds-WP_000227812.1"; Name "WP_000227812.1"; Parent "gene-C7A06_RS00740"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312528.1"; locus_tag "C7A06_RS00740"; product "lipopolysaccharide N-acetylglucosaminyltransferase"; protein_id "WP_000227812.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 135364 136572 . - . gene_id "nbis-gene-122"; ID "nbis-gene-122"; Name "rfaL"; gbkey "Gene"; gene "rfaL"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00745"; +NZ_CP027599.1 RefSeq transcript 135364 136572 . - . gene_id "nbis-gene-122"; transcript_id "gene-C7A06_RS00745"; ID "gene-C7A06_RS00745"; Name "rfaL"; Parent "nbis-gene-122"; gbkey "Gene"; gene "rfaL"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00745"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 135364 136572 . - . gene_id "nbis-gene-122"; transcript_id "gene-C7A06_RS00745"; Dbxref "Genbank:WP_000204742.1"; ID "nbis-exon-130"; Name "WP_000204742.1"; Parent "gene-C7A06_RS00745"; gbkey "CDS"; gene "rfaL"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312527.1"; locus_tag "C7A06_RS00745"; product "O-antigen ligase RfaL"; protein_id "WP_000204742.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 135364 136572 . - 0 gene_id "nbis-gene-122"; transcript_id "gene-C7A06_RS00745"; Dbxref "Genbank:WP_000204742.1"; ID "cds-WP_000204742.1"; Name "WP_000204742.1"; Parent "gene-C7A06_RS00745"; gbkey "CDS"; gene "rfaL"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312527.1"; locus_tag "C7A06_RS00745"; product "O-antigen ligase RfaL"; protein_id "WP_000204742.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 136569 137561 . - . gene_id "nbis-gene-123"; ID "nbis-gene-123"; Name "rfaC"; gbkey "Gene"; gene "rfaC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00750"; +NZ_CP027599.1 RefSeq transcript 136569 137561 . - . gene_id "nbis-gene-123"; transcript_id "gene-C7A06_RS00750"; ID "gene-C7A06_RS00750"; Name "rfaC"; Parent "nbis-gene-123"; gbkey "Gene"; gene "rfaC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00750"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 136569 137561 . - . gene_id "nbis-gene-123"; transcript_id "gene-C7A06_RS00750"; Dbxref "Genbank:WP_001264565.1"; ID "nbis-exon-131"; Name "WP_001264565.1"; Ontology_term "GO:0009244" "GO:0008920"; Parent "gene-C7A06_RS00750"; gbkey "CDS"; gene "rfaC"; go_function "lipopolysaccharide heptosyltransferase activity|0008920||IEA"; go_process "lipopolysaccharide core region biosynthetic process|0009244||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312526.1"; locus_tag "C7A06_RS00750"; product "lipopolysaccharide heptosyltransferase RfaC"; protein_id "WP_001264565.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 136569 137561 . - 0 gene_id "nbis-gene-123"; transcript_id "gene-C7A06_RS00750"; Dbxref "Genbank:WP_001264565.1"; ID "cds-WP_001264565.1"; Name "WP_001264565.1"; Ontology_term "GO:0009244" "GO:0008920"; Parent "gene-C7A06_RS00750"; gbkey "CDS"; gene "rfaC"; go_function "lipopolysaccharide heptosyltransferase activity|0008920||IEA"; go_process "lipopolysaccharide core region biosynthetic process|0009244||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312526.1"; locus_tag "C7A06_RS00750"; product "lipopolysaccharide heptosyltransferase RfaC"; protein_id "WP_001264565.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 137565 138611 . - . gene_id "nbis-gene-124"; ID "nbis-gene-124"; Name "rfaF"; gbkey "Gene"; gene "rfaF"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00755"; +NZ_CP027599.1 RefSeq transcript 137565 138611 . - . gene_id "nbis-gene-124"; transcript_id "gene-C7A06_RS00755"; ID "gene-C7A06_RS00755"; Name "rfaF"; Parent "nbis-gene-124"; gbkey "Gene"; gene "rfaF"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00755"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 137565 138611 . - . gene_id "nbis-gene-124"; transcript_id "gene-C7A06_RS00755"; Dbxref "Genbank:WP_000699219.1"; ID "nbis-exon-132"; Name "WP_000699219.1"; Ontology_term "GO:0009103" "GO:0016757"; Parent "gene-C7A06_RS00755"; gbkey "CDS"; gene "rfaF"; go_function "glycosyltransferase activity|0016757||IEA"; go_process "lipopolysaccharide biosynthetic process|0009103||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418077.1"; locus_tag "C7A06_RS00755"; product "ADP-heptose--LPS heptosyltransferase RfaF"; protein_id "WP_000699219.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 137565 138611 . - 0 gene_id "nbis-gene-124"; transcript_id "gene-C7A06_RS00755"; Dbxref "Genbank:WP_000699219.1"; ID "cds-WP_000699219.1"; Name "WP_000699219.1"; Ontology_term "GO:0009103" "GO:0016757"; Parent "gene-C7A06_RS00755"; gbkey "CDS"; gene "rfaF"; go_function "glycosyltransferase activity|0016757||IEA"; go_process "lipopolysaccharide biosynthetic process|0009103||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418077.1"; locus_tag "C7A06_RS00755"; product "ADP-heptose--LPS heptosyltransferase RfaF"; protein_id "WP_000699219.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 138621 139553 . - . gene_id "nbis-gene-125"; ID "nbis-gene-125"; Name "rfaD"; gbkey "Gene"; gene "rfaD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00760"; +NZ_CP027599.1 RefSeq transcript 138621 139553 . - . gene_id "nbis-gene-125"; transcript_id "gene-C7A06_RS00760"; ID "gene-C7A06_RS00760"; Name "rfaD"; Parent "nbis-gene-125"; gbkey "Gene"; gene "rfaD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00760"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 138621 139553 . - . gene_id "nbis-gene-125"; transcript_id "gene-C7A06_RS00760"; Dbxref "Genbank:WP_000587764.1"; ID "nbis-exon-133"; Name "WP_000587764.1"; Ontology_term "GO:0005975" "GO:0008712"; Parent "gene-C7A06_RS00760"; gbkey "CDS"; gene "rfaD"; go_function "ADP-glyceromanno-heptose 6-epimerase activity|0008712||IEA"; go_process "carbohydrate metabolic process|0005975||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_020233050.1"; locus_tag "C7A06_RS00760"; product "ADP-glyceromanno-heptose 6-epimerase"; protein_id "WP_000587764.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 138621 139553 . - 0 gene_id "nbis-gene-125"; transcript_id "gene-C7A06_RS00760"; Dbxref "Genbank:WP_000587764.1"; ID "cds-WP_000587764.1"; Name "WP_000587764.1"; Ontology_term "GO:0005975" "GO:0008712"; Parent "gene-C7A06_RS00760"; gbkey "CDS"; gene "rfaD"; go_function "ADP-glyceromanno-heptose 6-epimerase activity|0008712||IEA"; go_process "carbohydrate metabolic process|0005975||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_020233050.1"; locus_tag "C7A06_RS00760"; product "ADP-glyceromanno-heptose 6-epimerase"; protein_id "WP_000587764.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 139857 140714 . + . gene_id "nbis-gene-126"; ID "nbis-gene-126"; Name "yibB"; gbkey "Gene"; gene "yibB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00765"; +NZ_CP027599.1 RefSeq transcript 139857 140714 . + . gene_id "nbis-gene-126"; transcript_id "gene-C7A06_RS00765"; ID "gene-C7A06_RS00765"; Name "yibB"; Parent "nbis-gene-126"; gbkey "Gene"; gene "yibB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00765"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 139857 140714 . + . gene_id "nbis-gene-126"; transcript_id "gene-C7A06_RS00765"; Dbxref "Genbank:WP_000842823.1"; ID "nbis-exon-134"; Name "WP_000842823.1"; Parent "gene-C7A06_RS00765"; gbkey "CDS"; gene "yibB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418075.2"; locus_tag "C7A06_RS00765"; product "protein YibB"; protein_id "WP_000842823.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 139857 140714 . + 0 gene_id "nbis-gene-126"; transcript_id "gene-C7A06_RS00765"; Dbxref "Genbank:WP_000842823.1"; ID "cds-WP_000842823.1"; Name "WP_000842823.1"; Parent "gene-C7A06_RS00765"; gbkey "CDS"; gene "yibB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418075.2"; locus_tag "C7A06_RS00765"; product "protein YibB"; protein_id "WP_000842823.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 140989 142185 . + . gene_id "nbis-gene-127"; ID "nbis-gene-127"; Name "kbl"; gbkey "Gene"; gene "kbl"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00770"; +NZ_CP027599.1 RefSeq transcript 140989 142185 . + . gene_id "nbis-gene-127"; transcript_id "gene-C7A06_RS00770"; ID "gene-C7A06_RS00770"; Name "kbl"; Parent "nbis-gene-127"; gbkey "Gene"; gene "kbl"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00770"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 140989 142185 . + . gene_id "nbis-gene-127"; transcript_id "gene-C7A06_RS00770"; Dbxref "Genbank:WP_001213834.1"; ID "nbis-exon-135"; Name "WP_001213834.1"; Ontology_term "GO:0006567" "GO:0008890"; Parent "gene-C7A06_RS00770"; gbkey "CDS"; gene "kbl"; go_function "glycine C-acetyltransferase activity|0008890||IEA"; go_process "threonine catabolic process|0006567||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_020239151.1"; locus_tag "C7A06_RS00770"; product "glycine C-acetyltransferase"; protein_id "WP_001213834.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 140989 142185 . + 0 gene_id "nbis-gene-127"; transcript_id "gene-C7A06_RS00770"; Dbxref "Genbank:WP_001213834.1"; ID "cds-WP_001213834.1"; Name "WP_001213834.1"; Ontology_term "GO:0006567" "GO:0008890"; Parent "gene-C7A06_RS00770"; gbkey "CDS"; gene "kbl"; go_function "glycine C-acetyltransferase activity|0008890||IEA"; go_process "threonine catabolic process|0006567||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_020239151.1"; locus_tag "C7A06_RS00770"; product "glycine C-acetyltransferase"; protein_id "WP_001213834.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 142195 143220 . + . gene_id "nbis-gene-128"; ID "nbis-gene-128"; Name "tdh"; gbkey "Gene"; gene "tdh"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00775"; +NZ_CP027599.1 RefSeq transcript 142195 143220 . + . gene_id "nbis-gene-128"; transcript_id "gene-C7A06_RS00775"; ID "gene-C7A06_RS00775"; Name "tdh"; Parent "nbis-gene-128"; gbkey "Gene"; gene "tdh"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00775"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 142195 143220 . + . gene_id "nbis-gene-128"; transcript_id "gene-C7A06_RS00775"; Dbxref "Genbank:WP_000646014.1"; ID "nbis-exon-136"; Name "WP_000646014.1"; Ontology_term "GO:0006567" "GO:0008743"; Parent "gene-C7A06_RS00775"; gbkey "CDS"; gene "tdh"; go_function "L-threonine 3-dehydrogenase activity|0008743||IEA"; go_process "threonine catabolic process|0006567||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_005120462.1"; locus_tag "C7A06_RS00775"; product "L-threonine 3-dehydrogenase"; protein_id "WP_000646014.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 142195 143220 . + 0 gene_id "nbis-gene-128"; transcript_id "gene-C7A06_RS00775"; Dbxref "Genbank:WP_000646014.1"; ID "cds-WP_000646014.1"; Name "WP_000646014.1"; Ontology_term "GO:0006567" "GO:0008743"; Parent "gene-C7A06_RS00775"; gbkey "CDS"; gene "tdh"; go_function "L-threonine 3-dehydrogenase activity|0008743||IEA"; go_process "threonine catabolic process|0006567||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_005120462.1"; locus_tag "C7A06_RS00775"; product "L-threonine 3-dehydrogenase"; protein_id "WP_000646014.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 143472 144506 . + . gene_id "nbis-gene-129"; ID "nbis-gene-129"; Name "waaH"; gbkey "Gene"; gene "waaH"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00780"; +NZ_CP027599.1 RefSeq transcript 143472 144506 . + . gene_id "nbis-gene-129"; transcript_id "gene-C7A06_RS00780"; ID "gene-C7A06_RS00780"; Name "waaH"; Parent "nbis-gene-129"; gbkey "Gene"; gene "waaH"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00780"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 143472 144506 . + . gene_id "nbis-gene-129"; transcript_id "gene-C7A06_RS00780"; Dbxref "Genbank:WP_000982091.1"; ID "nbis-exon-137"; Name "WP_000982091.1"; Parent "gene-C7A06_RS00780"; gbkey "CDS"; gene "waaH"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418072.1"; locus_tag "C7A06_RS00780"; product "UDP-glucuronate:LPS(HepIII) glycosyltransferase"; protein_id "WP_000982091.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 143472 144506 . + 0 gene_id "nbis-gene-129"; transcript_id "gene-C7A06_RS00780"; Dbxref "Genbank:WP_000982091.1"; ID "cds-WP_000982091.1"; Name "WP_000982091.1"; Parent "gene-C7A06_RS00780"; gbkey "CDS"; gene "waaH"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418072.1"; locus_tag "C7A06_RS00780"; product "UDP-glucuronate:LPS(HepIII) glycosyltransferase"; protein_id "WP_000982091.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 144493 145452 . - . gene_id "nbis-gene-130"; ID "nbis-gene-130"; Name "yibQ"; gbkey "Gene"; gene "yibQ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00785"; +NZ_CP027599.1 RefSeq transcript 144493 145452 . - . gene_id "nbis-gene-130"; transcript_id "gene-C7A06_RS00785"; ID "gene-C7A06_RS00785"; Name "yibQ"; Parent "nbis-gene-130"; gbkey "Gene"; gene "yibQ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00785"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 144493 145452 . - . gene_id "nbis-gene-130"; transcript_id "gene-C7A06_RS00785"; Dbxref "Genbank:WP_000483865.1"; ID "nbis-exon-138"; Name "WP_000483865.1"; Parent "gene-C7A06_RS00785"; gbkey "CDS"; gene "yibQ"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312519.2"; locus_tag "C7A06_RS00785"; product "divergent polysaccharide deacetylase family protein"; protein_id "WP_000483865.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 144493 145452 . - 0 gene_id "nbis-gene-130"; transcript_id "gene-C7A06_RS00785"; Dbxref "Genbank:WP_000483865.1"; ID "cds-WP_000483865.1"; Name "WP_000483865.1"; Parent "gene-C7A06_RS00785"; gbkey "CDS"; gene "yibQ"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312519.2"; locus_tag "C7A06_RS00785"; product "divergent polysaccharide deacetylase family protein"; protein_id "WP_000483865.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 145456 146715 . - . gene_id "nbis-gene-131"; ID "nbis-gene-131"; Name "envC"; gbkey "Gene"; gene "envC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00790"; +NZ_CP027599.1 RefSeq transcript 145456 146715 . - . gene_id "nbis-gene-131"; transcript_id "gene-C7A06_RS00790"; ID "gene-C7A06_RS00790"; Name "envC"; Parent "nbis-gene-131"; gbkey "Gene"; gene "envC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00790"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 145456 146715 . - . gene_id "nbis-gene-131"; transcript_id "gene-C7A06_RS00790"; Dbxref "Genbank:WP_000196256.1"; ID "nbis-exon-139"; Name "WP_000196256.1"; Parent "gene-C7A06_RS00790"; gbkey "CDS"; gene "envC"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418070.6"; locus_tag "C7A06_RS00790"; product "murein hydrolase activator EnvC"; protein_id "WP_000196256.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 145456 146715 . - 0 gene_id "nbis-gene-131"; transcript_id "gene-C7A06_RS00790"; Dbxref "Genbank:WP_000196256.1"; ID "cds-WP_000196256.1"; Name "WP_000196256.1"; Parent "gene-C7A06_RS00790"; gbkey "CDS"; gene "envC"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418070.6"; locus_tag "C7A06_RS00790"; product "murein hydrolase activator EnvC"; protein_id "WP_000196256.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 146749 148293 . - . gene_id "nbis-gene-132"; ID "nbis-gene-132"; Name "gpmM"; gbkey "Gene"; gene "gpmM"; gene_biotype "protein_coding"; gene_synonym "pgmI"; locus_tag "C7A06_RS00795"; +NZ_CP027599.1 RefSeq transcript 146749 148293 . - . gene_id "nbis-gene-132"; transcript_id "gene-C7A06_RS00795"; ID "gene-C7A06_RS00795"; Name "gpmM"; Parent "nbis-gene-132"; gbkey "Gene"; gene "gpmM"; gene_biotype "protein_coding"; gene_synonym "pgmI"; locus_tag "C7A06_RS00795"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 146749 148293 . - . gene_id "nbis-gene-132"; transcript_id "gene-C7A06_RS00795"; Dbxref "Genbank:WP_000116566.1"; ID "nbis-exon-140"; Name "WP_000116566.1"; Ontology_term "GO:0006007" "GO:0004619"; Parent "gene-C7A06_RS00795"; gbkey "CDS"; gene "gpmM"; go_function "phosphoglycerate mutase activity|0004619||IEA"; go_process "glucose catabolic process|0006007||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312517.1"; locus_tag "C7A06_RS00795"; product "2,3-bisphosphoglycerate-independent phosphoglycerate mutase"; protein_id "WP_000116566.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 146749 148293 . - 0 gene_id "nbis-gene-132"; transcript_id "gene-C7A06_RS00795"; Dbxref "Genbank:WP_000116566.1"; ID "cds-WP_000116566.1"; Name "WP_000116566.1"; Ontology_term "GO:0006007" "GO:0004619"; Parent "gene-C7A06_RS00795"; gbkey "CDS"; gene "gpmM"; go_function "phosphoglycerate mutase activity|0004619||IEA"; go_process "glucose catabolic process|0006007||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312517.1"; locus_tag "C7A06_RS00795"; product "2,3-bisphosphoglycerate-independent phosphoglycerate mutase"; protein_id "WP_000116566.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 148538 148969 . + . gene_id "nbis-gene-133"; ID "nbis-gene-133"; Name "yibN"; gbkey "Gene"; gene "yibN"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00805"; +NZ_CP027599.1 RefSeq transcript 148538 148969 . + . gene_id "nbis-gene-133"; transcript_id "gene-C7A06_RS00805"; ID "gene-C7A06_RS00805"; Name "yibN"; Parent "nbis-gene-133"; gbkey "Gene"; gene "yibN"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00805"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 148538 148969 . + . gene_id "nbis-gene-133"; transcript_id "gene-C7A06_RS00805"; Dbxref "Genbank:WP_001156181.1"; ID "nbis-exon-141"; Name "WP_001156181.1"; Parent "gene-C7A06_RS00805"; gbkey "CDS"; gene "yibN"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312516.1"; locus_tag "C7A06_RS00805"; product "rhodanese-like domain-containing protein"; protein_id "WP_001156181.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 148538 148969 . + 0 gene_id "nbis-gene-133"; transcript_id "gene-C7A06_RS00805"; Dbxref "Genbank:WP_001156181.1"; ID "cds-WP_001156181.1"; Name "WP_001156181.1"; Parent "gene-C7A06_RS00805"; gbkey "CDS"; gene "yibN"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312516.1"; locus_tag "C7A06_RS00805"; product "rhodanese-like domain-containing protein"; protein_id "WP_001156181.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 149111 149362 . + . gene_id "nbis-gene-134"; ID "nbis-gene-134"; Name "grxC"; gbkey "Gene"; gene "grxC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00810"; +NZ_CP027599.1 RefSeq transcript 149111 149362 . + . gene_id "nbis-gene-134"; transcript_id "gene-C7A06_RS00810"; ID "gene-C7A06_RS00810"; Name "grxC"; Parent "nbis-gene-134"; gbkey "Gene"; gene "grxC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00810"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 149111 149362 . + . gene_id "nbis-gene-134"; transcript_id "gene-C7A06_RS00810"; Dbxref "Genbank:WP_000024392.1"; ID "nbis-exon-142"; Name "WP_000024392.1"; Parent "gene-C7A06_RS00810"; gbkey "CDS"; gene "grxC"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312515.1"; locus_tag "C7A06_RS00810"; product "glutaredoxin 3"; protein_id "WP_000024392.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 149111 149362 . + 0 gene_id "nbis-gene-134"; transcript_id "gene-C7A06_RS00810"; Dbxref "Genbank:WP_000024392.1"; ID "cds-WP_000024392.1"; Name "WP_000024392.1"; Parent "gene-C7A06_RS00810"; gbkey "CDS"; gene "grxC"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312515.1"; locus_tag "C7A06_RS00810"; product "glutaredoxin 3"; protein_id "WP_000024392.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 149425 149892 . + . gene_id "nbis-gene-135"; ID "nbis-gene-135"; Name "secB"; gbkey "Gene"; gene "secB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00815"; +NZ_CP027599.1 RefSeq transcript 149425 149892 . + . gene_id "nbis-gene-135"; transcript_id "gene-C7A06_RS00815"; ID "gene-C7A06_RS00815"; Name "secB"; Parent "nbis-gene-135"; gbkey "Gene"; gene "secB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00815"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 149425 149892 . + . gene_id "nbis-gene-135"; transcript_id "gene-C7A06_RS00815"; Dbxref "Genbank:WP_000003377.1"; ID "nbis-exon-143"; Name "WP_000003377.1"; Parent "gene-C7A06_RS00815"; gbkey "CDS"; gene "secB"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_015369180.1"; locus_tag "C7A06_RS00815"; product "protein-export chaperone SecB"; protein_id "WP_000003377.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 149425 149892 . + 0 gene_id "nbis-gene-135"; transcript_id "gene-C7A06_RS00815"; Dbxref "Genbank:WP_000003377.1"; ID "cds-WP_000003377.1"; Name "WP_000003377.1"; Parent "gene-C7A06_RS00815"; gbkey "CDS"; gene "secB"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_015369180.1"; locus_tag "C7A06_RS00815"; product "protein-export chaperone SecB"; protein_id "WP_000003377.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 149892 150911 . + . gene_id "nbis-gene-136"; ID "nbis-gene-136"; Name "gpsA"; gbkey "Gene"; gene "gpsA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00820"; +NZ_CP027599.1 RefSeq transcript 149892 150911 . + . gene_id "nbis-gene-136"; transcript_id "gene-C7A06_RS00820"; ID "gene-C7A06_RS00820"; Name "gpsA"; Parent "nbis-gene-136"; gbkey "Gene"; gene "gpsA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00820"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 149892 150911 . + . gene_id "nbis-gene-136"; transcript_id "gene-C7A06_RS00820"; Dbxref "Genbank:WP_001076194.1"; ID "nbis-exon-144"; Name "WP_001076194.1"; Ontology_term "GO:0006072" "GO:0004367"; Parent "gene-C7A06_RS00820"; gbkey "CDS"; gene "gpsA"; go_function "glycerol-3-phosphate dehydrogenase [NAD+] activity|0004367||IEA"; go_process "glycerol-3-phosphate metabolic process|0006072||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312513.1"; locus_tag "C7A06_RS00820"; product "NAD(P)H-dependent glycerol-3-phosphate dehydrogenase"; protein_id "WP_001076194.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 149892 150911 . + 0 gene_id "nbis-gene-136"; transcript_id "gene-C7A06_RS00820"; Dbxref "Genbank:WP_001076194.1"; ID "cds-WP_001076194.1"; Name "WP_001076194.1"; Ontology_term "GO:0006072" "GO:0004367"; Parent "gene-C7A06_RS00820"; gbkey "CDS"; gene "gpsA"; go_function "glycerol-3-phosphate dehydrogenase [NAD+] activity|0004367||IEA"; go_process "glycerol-3-phosphate metabolic process|0006072||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312513.1"; locus_tag "C7A06_RS00820"; product "NAD(P)H-dependent glycerol-3-phosphate dehydrogenase"; protein_id "WP_001076194.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 150991 151812 . + . gene_id "nbis-gene-137"; ID "nbis-gene-137"; Name "cysE"; gbkey "Gene"; gene "cysE"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00825"; +NZ_CP027599.1 RefSeq transcript 150991 151812 . + . gene_id "nbis-gene-137"; transcript_id "gene-C7A06_RS00825"; ID "gene-C7A06_RS00825"; Name "cysE"; Parent "nbis-gene-137"; gbkey "Gene"; gene "cysE"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00825"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 150991 151812 . + . gene_id "nbis-gene-137"; transcript_id "gene-C7A06_RS00825"; Dbxref "Genbank:WP_001277561.1"; ID "nbis-exon-145"; Name "WP_001277561.1"; Ontology_term "GO:0006535" "GO:0009001"; Parent "gene-C7A06_RS00825"; gbkey "CDS"; gene "cysE"; go_function "serine O-acetyltransferase activity|0009001||IEA"; go_process "cysteine biosynthetic process from serine|0006535||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001112113.1"; locus_tag "C7A06_RS00825"; product "serine O-acetyltransferase"; protein_id "WP_001277561.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 150991 151812 . + 0 gene_id "nbis-gene-137"; transcript_id "gene-C7A06_RS00825"; Dbxref "Genbank:WP_001277561.1"; ID "cds-WP_001277561.1"; Name "WP_001277561.1"; Ontology_term "GO:0006535" "GO:0009001"; Parent "gene-C7A06_RS00825"; gbkey "CDS"; gene "cysE"; go_function "serine O-acetyltransferase activity|0009001||IEA"; go_process "cysteine biosynthetic process from serine|0006535||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001112113.1"; locus_tag "C7A06_RS00825"; product "serine O-acetyltransferase"; protein_id "WP_001277561.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 151865 152338 . - . gene_id "nbis-gene-138"; ID "nbis-gene-138"; Name "trmL"; gbkey "Gene"; gene "trmL"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00830"; +NZ_CP027599.1 RefSeq transcript 151865 152338 . - . gene_id "nbis-gene-138"; transcript_id "gene-C7A06_RS00830"; ID "gene-C7A06_RS00830"; Name "trmL"; Parent "nbis-gene-138"; gbkey "Gene"; gene "trmL"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00830"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 151865 152338 . - . gene_id "nbis-gene-138"; transcript_id "gene-C7A06_RS00830"; Dbxref "Genbank:WP_000932342.1"; ID "nbis-exon-146"; Name "WP_000932342.1"; Ontology_term "GO:0001510" "GO:0008173"; Parent "gene-C7A06_RS00830"; gbkey "CDS"; gene "trmL"; go_function "RNA methyltransferase activity|0008173||IEA"; go_process "RNA methylation|0001510||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312511.1"; locus_tag "C7A06_RS00830"; product "tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL"; protein_id "WP_000932342.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 151865 152338 . - 0 gene_id "nbis-gene-138"; transcript_id "gene-C7A06_RS00830"; Dbxref "Genbank:WP_000932342.1"; ID "cds-WP_000932342.1"; Name "WP_000932342.1"; Ontology_term "GO:0001510" "GO:0008173"; Parent "gene-C7A06_RS00830"; gbkey "CDS"; gene "trmL"; go_function "RNA methyltransferase activity|0008173||IEA"; go_process "RNA methylation|0001510||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312511.1"; locus_tag "C7A06_RS00830"; product "tRNA (uridine(34)/cytosine(34)/5-carboxymethylaminomethyluridine(34)-2'-O)-methyltransferase TrmL"; protein_id "WP_000932342.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 152524 153714 . - . gene_id "nbis-gene-139"; ID "nbis-gene-139"; Name "lldD"; gbkey "Gene"; gene "lldD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00835"; +NZ_CP027599.1 RefSeq transcript 152524 153714 . - . gene_id "nbis-gene-139"; transcript_id "gene-C7A06_RS00835"; ID "gene-C7A06_RS00835"; Name "lldD"; Parent "nbis-gene-139"; gbkey "Gene"; gene "lldD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00835"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 152524 153714 . - . gene_id "nbis-gene-139"; transcript_id "gene-C7A06_RS00835"; Dbxref "Genbank:WP_000586964.1"; ID "nbis-exon-147"; Name "WP_000586964.1"; Parent "gene-C7A06_RS00835"; gbkey "CDS"; gene "lldD"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312510.1"; locus_tag "C7A06_RS00835"; product "quinone-dependent L-lactate dehydrogenase"; protein_id "WP_000586964.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 152524 153714 . - 0 gene_id "nbis-gene-139"; transcript_id "gene-C7A06_RS00835"; Dbxref "Genbank:WP_000586964.1"; ID "cds-WP_000586964.1"; Name "WP_000586964.1"; Parent "gene-C7A06_RS00835"; gbkey "CDS"; gene "lldD"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312510.1"; locus_tag "C7A06_RS00835"; product "quinone-dependent L-lactate dehydrogenase"; protein_id "WP_000586964.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 153711 154487 . - . gene_id "nbis-gene-140"; ID "nbis-gene-140"; Name "lldR"; gbkey "Gene"; gene "lldR"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00840"; +NZ_CP027599.1 RefSeq transcript 153711 154487 . - . gene_id "nbis-gene-140"; transcript_id "gene-C7A06_RS00840"; ID "gene-C7A06_RS00840"; Name "lldR"; Parent "nbis-gene-140"; gbkey "Gene"; gene "lldR"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00840"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 153711 154487 . - . gene_id "nbis-gene-140"; transcript_id "gene-C7A06_RS00840"; Dbxref "Genbank:WP_000636500.1"; ID "nbis-exon-148"; Name "WP_000636500.1"; Ontology_term "GO:0006355" "GO:0003700"; Parent "gene-C7A06_RS00840"; gbkey "CDS"; gene "lldR"; go_function "DNA-binding transcription factor activity|0003700||IEA"; go_process "regulation of transcription, DNA-templated|0006355||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418061.1"; locus_tag "C7A06_RS00840"; product "transcriptional regulator LldR"; protein_id "WP_000636500.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 153711 154487 . - 0 gene_id "nbis-gene-140"; transcript_id "gene-C7A06_RS00840"; Dbxref "Genbank:WP_000636500.1"; ID "cds-WP_000636500.1"; Name "WP_000636500.1"; Ontology_term "GO:0006355" "GO:0003700"; Parent "gene-C7A06_RS00840"; gbkey "CDS"; gene "lldR"; go_function "DNA-binding transcription factor activity|0003700||IEA"; go_process "regulation of transcription, DNA-templated|0006355||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418061.1"; locus_tag "C7A06_RS00840"; product "transcriptional regulator LldR"; protein_id "WP_000636500.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 154487 156142 . - . gene_id "nbis-gene-141"; ID "nbis-gene-141"; Name "lldP"; gbkey "Gene"; gene "lldP"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00845"; +NZ_CP027599.1 RefSeq transcript 154487 156142 . - . gene_id "nbis-gene-141"; transcript_id "gene-C7A06_RS00845"; ID "gene-C7A06_RS00845"; Name "lldP"; Parent "nbis-gene-141"; gbkey "Gene"; gene "lldP"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00845"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 154487 156142 . - . gene_id "nbis-gene-141"; transcript_id "gene-C7A06_RS00845"; Dbxref "Genbank:WP_001297977.1"; ID "nbis-exon-149"; Name "WP_001297977.1"; Ontology_term "GO:0015727" "GO:0015129" "GO:0005887"; Parent "gene-C7A06_RS00845"; gbkey "CDS"; gene "lldP"; go_component "integral component of plasma membrane|0005887||IEA"; go_function "lactate transmembrane transporter activity|0015129||IEA"; go_process "lactate transport|0015727||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312508.1"; locus_tag "C7A06_RS00845"; product "L-lactate permease"; protein_id "WP_001297977.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 154487 156142 . - 0 gene_id "nbis-gene-141"; transcript_id "gene-C7A06_RS00845"; Dbxref "Genbank:WP_001297977.1"; ID "cds-WP_001297977.1"; Name "WP_001297977.1"; Ontology_term "GO:0015727" "GO:0015129" "GO:0005887"; Parent "gene-C7A06_RS00845"; gbkey "CDS"; gene "lldP"; go_component "integral component of plasma membrane|0005887||IEA"; go_function "lactate transmembrane transporter activity|0015129||IEA"; go_process "lactate transport|0015727||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312508.1"; locus_tag "C7A06_RS00845"; product "L-lactate permease"; protein_id "WP_001297977.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 156511 161361 . - . gene_id "nbis-gene-142"; ID "nbis-gene-142"; Name "ehaG"; gbkey "Gene"; gene "ehaG"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00855"; +NZ_CP027599.1 RefSeq transcript 156511 161361 . - . gene_id "nbis-gene-142"; transcript_id "gene-C7A06_RS00855"; ID "gene-C7A06_RS00855"; Name "ehaG"; Parent "nbis-gene-142"; gbkey "Gene"; gene "ehaG"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00855"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 156511 161361 . - . gene_id "nbis-gene-142"; transcript_id "gene-C7A06_RS00855"; Dbxref "Genbank:WP_001033225.1"; ID "nbis-exon-150"; Name "WP_001033225.1"; Parent "gene-C7A06_RS00855"; gbkey "CDS"; gene "ehaG"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312507.1"; locus_tag "C7A06_RS00855"; product "trimeric autotransporter adhesin EhaG"; protein_id "WP_001033225.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 156511 161361 . - 0 gene_id "nbis-gene-142"; transcript_id "gene-C7A06_RS00855"; Dbxref "Genbank:WP_001033225.1"; ID "cds-WP_001033225.1"; Name "WP_001033225.1"; Parent "gene-C7A06_RS00855"; gbkey "CDS"; gene "ehaG"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312507.1"; locus_tag "C7A06_RS00855"; product "trimeric autotransporter adhesin EhaG"; protein_id "WP_001033225.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 161361 162089 . - . gene_id "nbis-gene-143"; ID "nbis-gene-143"; Name "C7A06_RS00860"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00860"; +NZ_CP027599.1 RefSeq transcript 161361 162089 . - . gene_id "nbis-gene-143"; transcript_id "gene-C7A06_RS00860"; ID "gene-C7A06_RS00860"; Name "C7A06_RS00860"; Parent "nbis-gene-143"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00860"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 161361 162089 . - . gene_id "nbis-gene-143"; transcript_id "gene-C7A06_RS00860"; Dbxref "Genbank:WP_001049540.1"; ID "nbis-exon-151"; Name "WP_001049540.1"; Parent "gene-C7A06_RS00860"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001049551.1"; locus_tag "C7A06_RS00860"; product "DUF3251 domain-containing protein"; protein_id "WP_001049540.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 161361 162089 . - 0 gene_id "nbis-gene-143"; transcript_id "gene-C7A06_RS00860"; Dbxref "Genbank:WP_001049540.1"; ID "cds-WP_001049540.1"; Name "WP_001049540.1"; Parent "gene-C7A06_RS00860"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001049551.1"; locus_tag "C7A06_RS00860"; product "DUF3251 domain-containing protein"; protein_id "WP_001049540.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 162632 162994 . - . gene_id "nbis-gene-144"; ID "nbis-gene-144"; Name "yibL"; gbkey "Gene"; gene "yibL"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00870"; +NZ_CP027599.1 RefSeq transcript 162632 162994 . - . gene_id "nbis-gene-144"; transcript_id "gene-C7A06_RS00870"; ID "gene-C7A06_RS00870"; Name "yibL"; Parent "nbis-gene-144"; gbkey "Gene"; gene "yibL"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00870"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 162632 162994 . - . gene_id "nbis-gene-144"; transcript_id "gene-C7A06_RS00870"; Dbxref "Genbank:WP_000665680.1"; ID "nbis-exon-152"; Name "WP_000665680.1"; Parent "gene-C7A06_RS00870"; gbkey "CDS"; gene "yibL"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312505.1"; locus_tag "C7A06_RS00870"; product "YibL family ribosome-associated protein"; protein_id "WP_000665680.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 162632 162994 . - 0 gene_id "nbis-gene-144"; transcript_id "gene-C7A06_RS00870"; Dbxref "Genbank:WP_000665680.1"; ID "cds-WP_000665680.1"; Name "WP_000665680.1"; Parent "gene-C7A06_RS00870"; gbkey "CDS"; gene "yibL"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312505.1"; locus_tag "C7A06_RS00870"; product "YibL family ribosome-associated protein"; protein_id "WP_000665680.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 163279 163488 . + . gene_id "nbis-gene-145"; ID "nbis-gene-145"; Name "C7A06_RS00875"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00875"; +NZ_CP027599.1 RefSeq transcript 163279 163488 . + . gene_id "nbis-gene-145"; transcript_id "gene-C7A06_RS00875"; ID "gene-C7A06_RS00875"; Name "C7A06_RS00875"; Parent "nbis-gene-145"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00875"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 163279 163488 . + . gene_id "nbis-gene-145"; transcript_id "gene-C7A06_RS00875"; Dbxref "Genbank:WP_000517100.1"; ID "nbis-exon-153"; Name "WP_000517100.1"; Parent "gene-C7A06_RS00875"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_588470.1"; locus_tag "C7A06_RS00875"; product "hypothetical protein"; protein_id "WP_000517100.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 163279 163488 . + 0 gene_id "nbis-gene-145"; transcript_id "gene-C7A06_RS00875"; Dbxref "Genbank:WP_000517100.1"; ID "cds-WP_000517100.1"; Name "WP_000517100.1"; Parent "gene-C7A06_RS00875"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_588470.1"; locus_tag "C7A06_RS00875"; product "hypothetical protein"; protein_id "WP_000517100.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 163500 164087 . - . gene_id "nbis-gene-146"; ID "nbis-gene-146"; Name "mtlR"; gbkey "Gene"; gene "mtlR"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00880"; +NZ_CP027599.1 RefSeq transcript 163500 164087 . - . gene_id "nbis-gene-146"; transcript_id "gene-C7A06_RS00880"; ID "gene-C7A06_RS00880"; Name "mtlR"; Parent "nbis-gene-146"; gbkey "Gene"; gene "mtlR"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00880"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 163500 164087 . - . gene_id "nbis-gene-146"; transcript_id "gene-C7A06_RS00880"; Dbxref "Genbank:WP_000228271.1"; ID "nbis-exon-154"; Name "WP_000228271.1"; Parent "gene-C7A06_RS00880"; gbkey "CDS"; gene "mtlR"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312504.1"; locus_tag "C7A06_RS00880"; product "mannitol operon repressor MtlR"; protein_id "WP_000228271.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 163500 164087 . - 0 gene_id "nbis-gene-146"; transcript_id "gene-C7A06_RS00880"; Dbxref "Genbank:WP_000228271.1"; ID "cds-WP_000228271.1"; Name "WP_000228271.1"; Parent "gene-C7A06_RS00880"; gbkey "CDS"; gene "mtlR"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312504.1"; locus_tag "C7A06_RS00880"; product "mannitol operon repressor MtlR"; protein_id "WP_000228271.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 164087 165235 . - . gene_id "nbis-gene-147"; ID "nbis-gene-147"; Name "mtlD"; gbkey "Gene"; gene "mtlD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00885"; +NZ_CP027599.1 RefSeq transcript 164087 165235 . - . gene_id "nbis-gene-147"; transcript_id "gene-C7A06_RS00885"; ID "gene-C7A06_RS00885"; Name "mtlD"; Parent "nbis-gene-147"; gbkey "Gene"; gene "mtlD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00885"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 164087 165235 . - . gene_id "nbis-gene-147"; transcript_id "gene-C7A06_RS00885"; Dbxref "Genbank:WP_000645424.1"; ID "nbis-exon-155"; Name "WP_000645424.1"; Ontology_term "GO:0019594" "GO:0008926"; Parent "gene-C7A06_RS00885"; gbkey "CDS"; gene "mtlD"; go_function "mannitol-1-phosphate 5-dehydrogenase activity|0008926||IEA"; go_process "mannitol metabolic process|0019594||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709374.2"; locus_tag "C7A06_RS00885"; product "mannitol-1-phosphate 5-dehydrogenase"; protein_id "WP_000645424.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 164087 165235 . - 0 gene_id "nbis-gene-147"; transcript_id "gene-C7A06_RS00885"; Dbxref "Genbank:WP_000645424.1"; ID "cds-WP_000645424.1"; Name "WP_000645424.1"; Ontology_term "GO:0019594" "GO:0008926"; Parent "gene-C7A06_RS00885"; gbkey "CDS"; gene "mtlD"; go_function "mannitol-1-phosphate 5-dehydrogenase activity|0008926||IEA"; go_process "mannitol metabolic process|0019594||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709374.2"; locus_tag "C7A06_RS00885"; product "mannitol-1-phosphate 5-dehydrogenase"; protein_id "WP_000645424.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 165465 167378 . - . gene_id "nbis-gene-148"; ID "nbis-gene-148"; Name "mtlA"; gbkey "Gene"; gene "mtlA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00890"; +NZ_CP027599.1 RefSeq transcript 165465 167378 . - . gene_id "nbis-gene-148"; transcript_id "gene-C7A06_RS00890"; ID "gene-C7A06_RS00890"; Name "mtlA"; Parent "nbis-gene-148"; gbkey "Gene"; gene "mtlA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00890"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 165465 167378 . - . gene_id "nbis-gene-148"; transcript_id "gene-C7A06_RS00890"; Dbxref "Genbank:WP_000093261.1"; ID "nbis-exon-156"; Name "WP_000093261.1"; Parent "gene-C7A06_RS00890"; gbkey "CDS"; gene "mtlA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709373.1"; locus_tag "C7A06_RS00890"; product "PTS mannitol transporter subunit IICBA"; protein_id "WP_000093261.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 165465 167378 . - 0 gene_id "nbis-gene-148"; transcript_id "gene-C7A06_RS00890"; Dbxref "Genbank:WP_000093261.1"; ID "cds-WP_000093261.1"; Name "WP_000093261.1"; Parent "gene-C7A06_RS00890"; gbkey "CDS"; gene "mtlA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709373.1"; locus_tag "C7A06_RS00890"; product "PTS mannitol transporter subunit IICBA"; protein_id "WP_000093261.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 167915 168277 . + . gene_id "nbis-gene-149"; ID "nbis-gene-149"; Name "yibI"; gbkey "Gene"; gene "yibI"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00895"; +NZ_CP027599.1 RefSeq transcript 167915 168277 . + . gene_id "nbis-gene-149"; transcript_id "gene-C7A06_RS00895"; ID "gene-C7A06_RS00895"; Name "yibI"; Parent "nbis-gene-149"; gbkey "Gene"; gene "yibI"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00895"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 167915 168277 . + . gene_id "nbis-gene-149"; transcript_id "gene-C7A06_RS00895"; Dbxref "Genbank:WP_000479624.1"; ID "nbis-exon-157"; Name "WP_000479624.1"; Parent "gene-C7A06_RS00895"; gbkey "CDS"; gene "yibI"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418055.1"; locus_tag "C7A06_RS00895"; product "DUF3302 domain-containing protein"; protein_id "WP_000479624.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 167915 168277 . + 0 gene_id "nbis-gene-149"; transcript_id "gene-C7A06_RS00895"; Dbxref "Genbank:WP_000479624.1"; ID "cds-WP_000479624.1"; Name "WP_000479624.1"; Parent "gene-C7A06_RS00895"; gbkey "CDS"; gene "yibI"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418055.1"; locus_tag "C7A06_RS00895"; product "DUF3302 domain-containing protein"; protein_id "WP_000479624.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 168280 169346 . + . gene_id "nbis-pseudogene-9"; ID "nbis-pseudogene-9"; Name "yibH"; gbkey "Gene"; gene "yibH"; gene_biotype "pseudogene"; locus_tag "C7A06_RS00900"; original_biotype "pseudogene"; pseudo "true"; +NZ_CP027599.1 RefSeq transcript 168280 169346 . + . gene_id "nbis-pseudogene-9"; transcript_id "gene-C7A06_RS00900"; ID "gene-C7A06_RS00900"; Name "yibH"; Parent "nbis-pseudogene-9"; gbkey "Gene"; gene "yibH"; gene_biotype "pseudogene"; locus_tag "C7A06_RS00900"; original_biotype "mrna"; pseudo "true"; +NZ_CP027599.1 Protein Homology exon 168280 169346 . + . gene_id "nbis-pseudogene-9"; transcript_id "gene-C7A06_RS00900"; ID "nbis-exon-158"; Note "frameshifted"; Parent "gene-C7A06_RS00900"; gbkey "CDS"; gene "yibH"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312500.1"; locus_tag "C7A06_RS00900"; product "HlyD family secretion protein"; pseudo "true"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 168280 169346 . + 0 gene_id "nbis-pseudogene-9"; transcript_id "gene-C7A06_RS00900"; ID "cds-C7A06_RS00900"; Note "frameshifted"; Parent "gene-C7A06_RS00900"; gbkey "CDS"; gene "yibH"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312500.1"; locus_tag "C7A06_RS00900"; product "HlyD family secretion protein"; pseudo "true"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 169806 170315 . - . gene_id "nbis-gene-150"; ID "nbis-gene-150"; Name "C7A06_RS00905"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00905"; +NZ_CP027599.1 RefSeq transcript 169806 170315 . - . gene_id "nbis-gene-150"; transcript_id "gene-C7A06_RS00905"; ID "gene-C7A06_RS00905"; Name "C7A06_RS00905"; Parent "nbis-gene-150"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00905"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 169806 170315 . - . gene_id "nbis-gene-150"; transcript_id "gene-C7A06_RS00905"; Dbxref "Genbank:WP_236917825.1"; ID "nbis-exon-159"; Name "WP_236917825.1"; Parent "gene-C7A06_RS00905"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_016158939.1"; locus_tag "C7A06_RS00905"; product "Imm57 family immunity protein"; protein_id "WP_236917825.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 169806 170315 . - 0 gene_id "nbis-gene-150"; transcript_id "gene-C7A06_RS00905"; Dbxref "Genbank:WP_236917825.1"; ID "cds-WP_236917825.1"; Name "WP_236917825.1"; Parent "gene-C7A06_RS00905"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_016158939.1"; locus_tag "C7A06_RS00905"; product "Imm57 family immunity protein"; protein_id "WP_236917825.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 170950 171411 . - . gene_id "nbis-gene-151"; ID "nbis-gene-151"; Name "yibG"; gbkey "Gene"; gene "yibG"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00920"; +NZ_CP027599.1 RefSeq transcript 170950 171411 . - . gene_id "nbis-gene-151"; transcript_id "gene-C7A06_RS00920"; ID "gene-C7A06_RS00920"; Name "yibG"; Parent "nbis-gene-151"; gbkey "Gene"; gene "yibG"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00920"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 170950 171411 . - . gene_id "nbis-gene-151"; transcript_id "gene-C7A06_RS00920"; Dbxref "Genbank:WP_000642489.1"; ID "nbis-exon-160"; Name "WP_000642489.1"; Parent "gene-C7A06_RS00920"; gbkey "CDS"; gene "yibG"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418053.1"; locus_tag "C7A06_RS00920"; product "sel1 repeat family protein"; protein_id "WP_000642489.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 170950 171411 . - 0 gene_id "nbis-gene-151"; transcript_id "gene-C7A06_RS00920"; Dbxref "Genbank:WP_000642489.1"; ID "cds-WP_000642489.1"; Name "WP_000642489.1"; Parent "gene-C7A06_RS00920"; gbkey "CDS"; gene "yibG"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418053.1"; locus_tag "C7A06_RS00920"; product "sel1 repeat family protein"; protein_id "WP_000642489.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 171423 172381 . - . gene_id "nbis-pseudogene-281"; ID "nbis-pseudogene-281"; Name "C7A06_RS33910"; end_range "172381" "."; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33910"; original_biotype "pseudogene"; partial "true"; pseudo "true"; +NZ_CP027599.1 RefSeq transcript 171423 172381 . - . gene_id "nbis-pseudogene-281"; transcript_id "gene-C7A06_RS33910"; ID "gene-C7A06_RS33910"; Name "C7A06_RS33910"; Parent "nbis-pseudogene-281"; end_range "172381" "."; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS33910"; original_biotype "mrna"; partial "true"; pseudo "true"; +NZ_CP027599.1 Protein Homology exon 171423 172381 . - . gene_id "nbis-pseudogene-281"; transcript_id "gene-C7A06_RS33910"; ID "nbis-exon-5988"; Note "frameshifted; incomplete; partial in the middle of a contig; missing N-terminus"; Parent "gene-C7A06_RS33910"; end_range "172381" "."; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312497.1"; locus_tag "C7A06_RS33910"; partial "true"; product "RHS domain-containing protein"; pseudo "true"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 171423 172381 . - 0 gene_id "nbis-pseudogene-281"; transcript_id "gene-C7A06_RS33910"; ID "cds-C7A06_RS33910"; Note "frameshifted; incomplete; partial in the middle of a contig; missing N-terminus"; Parent "gene-C7A06_RS33910"; end_range "172381" "."; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312497.1"; locus_tag "C7A06_RS33910"; partial "true"; product "RHS domain-containing protein"; pseudo "true"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 172409 173251 . - . gene_id "nbis-gene-152"; ID "nbis-gene-152"; Name "yibA"; gbkey "Gene"; gene "yibA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00930"; +NZ_CP027599.1 RefSeq transcript 172409 173251 . - . gene_id "nbis-gene-152"; transcript_id "gene-C7A06_RS00930"; ID "gene-C7A06_RS00930"; Name "yibA"; Parent "nbis-gene-152"; gbkey "Gene"; gene "yibA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00930"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 172409 173251 . - . gene_id "nbis-gene-152"; transcript_id "gene-C7A06_RS00930"; Dbxref "Genbank:WP_000072850.1"; ID "nbis-exon-161"; Name "WP_000072850.1"; Parent "gene-C7A06_RS00930"; gbkey "CDS"; gene "yibA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418051.1"; locus_tag "C7A06_RS00930"; product "HEAT repeat domain-containing protein"; protein_id "WP_000072850.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 172409 173251 . - 0 gene_id "nbis-gene-152"; transcript_id "gene-C7A06_RS00930"; Dbxref "Genbank:WP_000072850.1"; ID "cds-WP_000072850.1"; Name "WP_000072850.1"; Parent "gene-C7A06_RS00930"; gbkey "CDS"; gene "yibA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418051.1"; locus_tag "C7A06_RS00930"; product "HEAT repeat domain-containing protein"; protein_id "WP_000072850.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 173272 177393 . - . gene_id "nbis-gene-153"; ID "nbis-gene-153"; Name "C7A06_RS00935"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00935"; +NZ_CP027599.1 RefSeq transcript 173272 177393 . - . gene_id "nbis-gene-153"; transcript_id "gene-C7A06_RS00935"; ID "gene-C7A06_RS00935"; Name "C7A06_RS00935"; Parent "nbis-gene-153"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00935"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 173272 177393 . - . gene_id "nbis-gene-153"; transcript_id "gene-C7A06_RS00935"; Dbxref "Genbank:WP_000015217.1"; ID "nbis-exon-162"; Name "WP_000015217.1"; Parent "gene-C7A06_RS00935"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418050.1"; locus_tag "C7A06_RS00935"; product "polymorphic toxin type 34 domain-containing protein"; protein_id "WP_000015217.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 173272 177393 . - 0 gene_id "nbis-gene-153"; transcript_id "gene-C7A06_RS00935"; Dbxref "Genbank:WP_000015217.1"; ID "cds-WP_000015217.1"; Name "WP_000015217.1"; Parent "gene-C7A06_RS00935"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418050.1"; locus_tag "C7A06_RS00935"; product "polymorphic toxin type 34 domain-containing protein"; protein_id "WP_000015217.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 177622 178230 . + . gene_id "nbis-gene-154"; ID "nbis-gene-154"; Name "yibF"; gbkey "Gene"; gene "yibF"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00940"; +NZ_CP027599.1 RefSeq transcript 177622 178230 . + . gene_id "nbis-gene-154"; transcript_id "gene-C7A06_RS00940"; ID "gene-C7A06_RS00940"; Name "yibF"; Parent "nbis-gene-154"; gbkey "Gene"; gene "yibF"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00940"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 177622 178230 . + . gene_id "nbis-gene-154"; transcript_id "gene-C7A06_RS00940"; Dbxref "Genbank:WP_000779792.1"; ID "nbis-exon-163"; Name "WP_000779792.1"; Ontology_term "GO:0006749" "GO:0005515"; Parent "gene-C7A06_RS00940"; gbkey "CDS"; gene "yibF"; go_function "protein binding|0005515||IEA"; go_process "glutathione metabolic process|0006749||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418049.1"; locus_tag "C7A06_RS00940"; product "glutathione S-transferase"; protein_id "WP_000779792.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 177622 178230 . + 0 gene_id "nbis-gene-154"; transcript_id "gene-C7A06_RS00940"; Dbxref "Genbank:WP_000779792.1"; ID "cds-WP_000779792.1"; Name "WP_000779792.1"; Ontology_term "GO:0006749" "GO:0005515"; Parent "gene-C7A06_RS00940"; gbkey "CDS"; gene "yibF"; go_function "protein binding|0005515||IEA"; go_process "glutathione metabolic process|0006749||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418049.1"; locus_tag "C7A06_RS00940"; product "glutathione S-transferase"; protein_id "WP_000779792.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 178328 179719 . + . gene_id "nbis-gene-155"; ID "nbis-gene-155"; Name "selA"; gbkey "Gene"; gene "selA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00945"; +NZ_CP027599.1 RefSeq transcript 178328 179719 . + . gene_id "nbis-gene-155"; transcript_id "gene-C7A06_RS00945"; ID "gene-C7A06_RS00945"; Name "selA"; Parent "nbis-gene-155"; gbkey "Gene"; gene "selA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00945"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 178328 179719 . + . gene_id "nbis-gene-155"; transcript_id "gene-C7A06_RS00945"; Dbxref "Genbank:WP_000206271.1"; ID "nbis-exon-164"; Name "WP_000206271.1"; Ontology_term "GO:0016260" "GO:0004125"; Parent "gene-C7A06_RS00945"; gbkey "CDS"; gene "selA"; go_function "L-seryl-tRNASec selenium transferase activity|0004125||IEA"; go_process "selenocysteine biosynthetic process|0016260||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312495.1"; locus_tag "C7A06_RS00945"; product "L-seryl-tRNA(Sec) selenium transferase"; protein_id "WP_000206271.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 178328 179719 . + 0 gene_id "nbis-gene-155"; transcript_id "gene-C7A06_RS00945"; Dbxref "Genbank:WP_000206271.1"; ID "cds-WP_000206271.1"; Name "WP_000206271.1"; Ontology_term "GO:0016260" "GO:0004125"; Parent "gene-C7A06_RS00945"; gbkey "CDS"; gene "selA"; go_function "L-seryl-tRNASec selenium transferase activity|0004125||IEA"; go_process "selenocysteine biosynthetic process|0016260||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312495.1"; locus_tag "C7A06_RS00945"; product "L-seryl-tRNA(Sec) selenium transferase"; protein_id "WP_000206271.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 179716 181560 . + . gene_id "nbis-gene-156"; ID "nbis-gene-156"; Name "selB"; gbkey "Gene"; gene "selB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00950"; +NZ_CP027599.1 RefSeq transcript 179716 181560 . + . gene_id "nbis-gene-156"; transcript_id "gene-C7A06_RS00950"; ID "gene-C7A06_RS00950"; Name "selB"; Parent "nbis-gene-156"; gbkey "Gene"; gene "selB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00950"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 179716 181560 . + . gene_id "nbis-gene-156"; transcript_id "gene-C7A06_RS00950"; Dbxref "Genbank:WP_000582492.1"; ID "nbis-exon-165"; Name "WP_000582492.1"; Ontology_term "GO:0001514" "GO:0003723" "GO:0003746" "GO:0003924" "GO:0005525"; Parent "gene-C7A06_RS00950"; gbkey "CDS"; gene "selB"; go_function "RNA binding|0003723||IEA" "translation elongation factor activity|0003746||IEA" "GTPase activity|0003924||IEA" "GTP binding|0005525||IEA"; go_process "selenocysteine incorporation|0001514||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418047.1"; locus_tag "C7A06_RS00950"; product "selenocysteine-specific translation elongation factor"; protein_id "WP_000582492.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 179716 181560 . + 0 gene_id "nbis-gene-156"; transcript_id "gene-C7A06_RS00950"; Dbxref "Genbank:WP_000582492.1"; ID "cds-WP_000582492.1"; Name "WP_000582492.1"; Ontology_term "GO:0001514" "GO:0003723" "GO:0003746" "GO:0003924" "GO:0005525"; Parent "gene-C7A06_RS00950"; gbkey "CDS"; gene "selB"; go_function "RNA binding|0003723||IEA" "translation elongation factor activity|0003746||IEA" "GTPase activity|0003924||IEA" "GTP binding|0005525||IEA"; go_process "selenocysteine incorporation|0001514||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418047.1"; locus_tag "C7A06_RS00950"; product "selenocysteine-specific translation elongation factor"; protein_id "WP_000582492.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 181750 182901 . + . gene_id "nbis-gene-157"; ID "nbis-gene-157"; Name "yiaY"; gbkey "Gene"; gene "yiaY"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00955"; +NZ_CP027599.1 RefSeq transcript 181750 182901 . + . gene_id "nbis-gene-157"; transcript_id "gene-C7A06_RS00955"; ID "gene-C7A06_RS00955"; Name "yiaY"; Parent "nbis-gene-157"; gbkey "Gene"; gene "yiaY"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00955"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 181750 182901 . + . gene_id "nbis-gene-157"; transcript_id "gene-C7A06_RS00955"; Dbxref "Genbank:WP_000168712.1"; ID "nbis-exon-166"; Name "WP_000168712.1"; Ontology_term "GO:0016491"; Parent "gene-C7A06_RS00955"; gbkey "CDS"; gene "yiaY"; go_function "oxidoreductase activity|0016491||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312493.1"; locus_tag "C7A06_RS00955"; product "L-threonine dehydrogenase"; protein_id "WP_000168712.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 181750 182901 . + 0 gene_id "nbis-gene-157"; transcript_id "gene-C7A06_RS00955"; Dbxref "Genbank:WP_000168712.1"; ID "cds-WP_000168712.1"; Name "WP_000168712.1"; Ontology_term "GO:0016491"; Parent "gene-C7A06_RS00955"; gbkey "CDS"; gene "yiaY"; go_function "oxidoreductase activity|0016491||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312493.1"; locus_tag "C7A06_RS00955"; product "L-threonine dehydrogenase"; protein_id "WP_000168712.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 183066 184604 . + . gene_id "nbis-gene-158"; ID "nbis-gene-158"; Name "aldB"; gbkey "Gene"; gene "aldB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00960"; +NZ_CP027599.1 RefSeq transcript 183066 184604 . + . gene_id "nbis-gene-158"; transcript_id "gene-C7A06_RS00960"; ID "gene-C7A06_RS00960"; Name "aldB"; Parent "nbis-gene-158"; gbkey "Gene"; gene "aldB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00960"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 183066 184604 . + . gene_id "nbis-gene-158"; transcript_id "gene-C7A06_RS00960"; Dbxref "Genbank:WP_000183978.1"; ID "nbis-exon-167"; Name "WP_000183978.1"; Parent "gene-C7A06_RS00960"; gbkey "CDS"; gene "aldB"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001551836.1"; locus_tag "C7A06_RS00960"; product "aldehyde dehydrogenase AldB"; protein_id "WP_000183978.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 183066 184604 . + 0 gene_id "nbis-gene-158"; transcript_id "gene-C7A06_RS00960"; Dbxref "Genbank:WP_000183978.1"; ID "cds-WP_000183978.1"; Name "WP_000183978.1"; Parent "gene-C7A06_RS00960"; gbkey "CDS"; gene "aldB"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001551836.1"; locus_tag "C7A06_RS00960"; product "aldehyde dehydrogenase AldB"; protein_id "WP_000183978.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 184823 184987 . - . gene_id "nbis-gene-159"; ID "nbis-gene-159"; Name "C7A06_RS00965"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00965"; +NZ_CP027599.1 RefSeq transcript 184823 184987 . - . gene_id "nbis-gene-159"; transcript_id "gene-C7A06_RS00965"; ID "gene-C7A06_RS00965"; Name "C7A06_RS00965"; Parent "nbis-gene-159"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00965"; original_biotype "mrna"; +NZ_CP027599.1 GeneMarkS-2+ exon 184823 184987 . - . gene_id "nbis-gene-159"; transcript_id "gene-C7A06_RS00965"; Dbxref "Genbank:WP_001375509.1"; ID "nbis-exon-168"; Name "WP_001375509.1"; Parent "gene-C7A06_RS00965"; gbkey "CDS"; inference "COORDINATES: ab initio prediction:GeneMarkS-2+"; locus_tag "C7A06_RS00965"; product "hypothetical protein"; protein_id "WP_001375509.1"; transl_table "11"; +NZ_CP027599.1 GeneMarkS-2+ CDS 184823 184987 . - 0 gene_id "nbis-gene-159"; transcript_id "gene-C7A06_RS00965"; Dbxref "Genbank:WP_001375509.1"; ID "cds-WP_001375509.1"; Name "WP_001375509.1"; Parent "gene-C7A06_RS00965"; gbkey "CDS"; inference "COORDINATES: ab initio prediction:GeneMarkS-2+"; locus_tag "C7A06_RS00965"; product "hypothetical protein"; protein_id "WP_001375509.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 185169 185471 . + . gene_id "nbis-gene-160"; ID "nbis-gene-160"; Name "yiaW"; gbkey "Gene"; gene "yiaW"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00975"; +NZ_CP027599.1 RefSeq transcript 185169 185471 . + . gene_id "nbis-gene-160"; transcript_id "gene-C7A06_RS00975"; ID "gene-C7A06_RS00975"; Name "yiaW"; Parent "nbis-gene-160"; gbkey "Gene"; gene "yiaW"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00975"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 185169 185471 . + . gene_id "nbis-gene-160"; transcript_id "gene-C7A06_RS00975"; Dbxref "Genbank:WP_032348558.1"; ID "nbis-exon-169"; Name "WP_032348558.1"; Parent "gene-C7A06_RS00975"; gbkey "CDS"; gene "yiaW"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312490.1"; locus_tag "C7A06_RS00975"; product "DUF3302 domain-containing protein"; protein_id "WP_032348558.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 185169 185471 . + 0 gene_id "nbis-gene-160"; transcript_id "gene-C7A06_RS00975"; Dbxref "Genbank:WP_032348558.1"; ID "cds-WP_032348558.1"; Name "WP_032348558.1"; Parent "gene-C7A06_RS00975"; gbkey "CDS"; gene "yiaW"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312490.1"; locus_tag "C7A06_RS00975"; product "DUF3302 domain-containing protein"; protein_id "WP_032348558.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 185477 186613 . + . gene_id "nbis-gene-161"; ID "nbis-gene-161"; Name "yiaV"; gbkey "Gene"; gene "yiaV"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00980"; +NZ_CP027599.1 RefSeq transcript 185477 186613 . + . gene_id "nbis-gene-161"; transcript_id "gene-C7A06_RS00980"; ID "gene-C7A06_RS00980"; Name "yiaV"; Parent "nbis-gene-161"; gbkey "Gene"; gene "yiaV"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00980"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 185477 186613 . + . gene_id "nbis-gene-161"; transcript_id "gene-C7A06_RS00980"; Dbxref "Genbank:WP_000364874.1"; ID "nbis-exon-170"; Name "WP_000364874.1"; Parent "gene-C7A06_RS00980"; gbkey "CDS"; gene "yiaV"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418043.1"; locus_tag "C7A06_RS00980"; product "HlyD family secretion protein"; protein_id "WP_000364874.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 185477 186613 . + 0 gene_id "nbis-gene-161"; transcript_id "gene-C7A06_RS00980"; Dbxref "Genbank:WP_000364874.1"; ID "cds-WP_000364874.1"; Name "WP_000364874.1"; Parent "gene-C7A06_RS00980"; gbkey "CDS"; gene "yiaV"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418043.1"; locus_tag "C7A06_RS00980"; product "HlyD family secretion protein"; protein_id "WP_000364874.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 186610 187584 . - . gene_id "nbis-gene-162"; ID "nbis-gene-162"; Name "yiaU"; gbkey "Gene"; gene "yiaU"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00985"; +NZ_CP027599.1 RefSeq transcript 186610 187584 . - . gene_id "nbis-gene-162"; transcript_id "gene-C7A06_RS00985"; ID "gene-C7A06_RS00985"; Name "yiaU"; Parent "nbis-gene-162"; gbkey "Gene"; gene "yiaU"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00985"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 186610 187584 . - . gene_id "nbis-gene-162"; transcript_id "gene-C7A06_RS00985"; Dbxref "Genbank:WP_000164036.1"; ID "nbis-exon-171"; Name "WP_000164036.1"; Parent "gene-C7A06_RS00985"; gbkey "CDS"; gene "yiaU"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418042.1"; locus_tag "C7A06_RS00985"; product "LysR family transcriptional regulator"; protein_id "WP_000164036.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 186610 187584 . - 0 gene_id "nbis-gene-162"; transcript_id "gene-C7A06_RS00985"; Dbxref "Genbank:WP_000164036.1"; ID "cds-WP_000164036.1"; Name "WP_000164036.1"; Parent "gene-C7A06_RS00985"; gbkey "CDS"; gene "yiaU"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418042.1"; locus_tag "C7A06_RS00985"; product "LysR family transcriptional regulator"; protein_id "WP_000164036.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 187708 188448 . + . gene_id "nbis-gene-163"; ID "nbis-gene-163"; Name "yiaT"; gbkey "Gene"; gene "yiaT"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00990"; +NZ_CP027599.1 RefSeq transcript 187708 188448 . + . gene_id "nbis-gene-163"; transcript_id "gene-C7A06_RS00990"; ID "gene-C7A06_RS00990"; Name "yiaT"; Parent "nbis-gene-163"; gbkey "Gene"; gene "yiaT"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00990"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 187708 188448 . + . gene_id "nbis-gene-163"; transcript_id "gene-C7A06_RS00990"; Dbxref "Genbank:WP_000906808.1"; ID "nbis-exon-172"; Name "WP_000906808.1"; Parent "gene-C7A06_RS00990"; gbkey "CDS"; gene "yiaT"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312487.1"; locus_tag "C7A06_RS00990"; product "MipA/OmpV family protein"; protein_id "WP_000906808.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 187708 188448 . + 0 gene_id "nbis-gene-163"; transcript_id "gene-C7A06_RS00990"; Dbxref "Genbank:WP_000906808.1"; ID "cds-WP_000906808.1"; Name "WP_000906808.1"; Parent "gene-C7A06_RS00990"; gbkey "CDS"; gene "yiaT"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312487.1"; locus_tag "C7A06_RS00990"; product "MipA/OmpV family protein"; protein_id "WP_000906808.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 188395 188658 . - . gene_id "nbis-pseudogene-311"; ID "nbis-pseudogene-311"; Name "C7A06_RS34805"; end_range "188658" "."; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS34805"; original_biotype "pseudogene"; partial "true"; pseudo "true"; start_range "." "188395"; +NZ_CP027599.1 RefSeq transcript 188395 188658 . - . gene_id "nbis-pseudogene-311"; transcript_id "gene-C7A06_RS34805"; ID "gene-C7A06_RS34805"; Name "C7A06_RS34805"; Parent "nbis-pseudogene-311"; end_range "188658" "."; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS34805"; original_biotype "mrna"; partial "true"; pseudo "true"; start_range "." "188395"; +NZ_CP027599.1 Protein Homology exon 188395 188658 . - . gene_id "nbis-pseudogene-311"; transcript_id "gene-C7A06_RS34805"; ID "nbis-exon-6141"; Note "incomplete; partial in the middle of a contig; missing N-terminus and C-terminus"; Parent "gene-C7A06_RS34805"; end_range "188658" "."; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_020239594.1"; locus_tag "C7A06_RS34805"; partial "true"; product "hypothetical protein"; pseudo "true"; start_range "." "188395"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 188395 188658 . - 0 gene_id "nbis-pseudogene-311"; transcript_id "gene-C7A06_RS34805"; ID "cds-C7A06_RS34805"; Note "incomplete; partial in the middle of a contig; missing N-terminus and C-terminus"; Parent "gene-C7A06_RS34805"; end_range "188658" "."; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_020239594.1"; locus_tag "C7A06_RS34805"; partial "true"; product "hypothetical protein"; pseudo "true"; start_range "." "188395"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 188662 188763 . + . gene_id "nbis-pseudogene-290"; ID "nbis-pseudogene-290"; Name "C7A06_RS34380"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS34380"; original_biotype "pseudogene"; partial "true"; pseudo "true"; start_range "." "188662"; +NZ_CP027599.1 RefSeq transcript 188662 188763 . + . gene_id "nbis-pseudogene-290"; transcript_id "gene-C7A06_RS34380"; ID "gene-C7A06_RS34380"; Name "C7A06_RS34380"; Parent "nbis-pseudogene-290"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS34380"; original_biotype "mrna"; partial "true"; pseudo "true"; start_range "." "188662"; +NZ_CP027599.1 Protein Homology exon 188662 188763 . + . gene_id "nbis-pseudogene-290"; transcript_id "gene-C7A06_RS34380"; ID "nbis-exon-6063"; Note "incomplete; partial in the middle of a contig; missing N-terminus"; Parent "gene-C7A06_RS34380"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312484.1"; locus_tag "C7A06_RS34380"; partial "true"; product "AraC family transcriptional regulator"; pseudo "true"; start_range "." "188662"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 188662 188763 . + 0 gene_id "nbis-pseudogene-290"; transcript_id "gene-C7A06_RS34380"; ID "cds-C7A06_RS34380"; Note "incomplete; partial in the middle of a contig; missing N-terminus"; Parent "gene-C7A06_RS34380"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312484.1"; locus_tag "C7A06_RS34380"; partial "true"; product "AraC family transcriptional regulator"; pseudo "true"; start_range "." "188662"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 188795 189490 . - . gene_id "nbis-gene-164"; ID "nbis-gene-164"; Name "araD"; gbkey "Gene"; gene "araD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01000"; +NZ_CP027599.1 RefSeq transcript 188795 189490 . - . gene_id "nbis-gene-164"; transcript_id "gene-C7A06_RS01000"; ID "gene-C7A06_RS01000"; Name "araD"; Parent "nbis-gene-164"; gbkey "Gene"; gene "araD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01000"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 188795 189490 . - . gene_id "nbis-gene-164"; transcript_id "gene-C7A06_RS01000"; Dbxref "Genbank:WP_000893142.1"; ID "nbis-exon-173"; Name "WP_000893142.1"; Ontology_term "GO:0019568" "GO:0008742"; Parent "gene-C7A06_RS01000"; gbkey "CDS"; gene "araD"; go_function "L-ribulose-phosphate 4-epimerase activity|0008742||IEA"; go_process "arabinose catabolic process|0019568||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418040.1"; locus_tag "C7A06_RS01000"; product "L-ribulose-5-phosphate 4-epimerase"; protein_id "WP_000893142.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 188795 189490 . - 0 gene_id "nbis-gene-164"; transcript_id "gene-C7A06_RS01000"; Dbxref "Genbank:WP_000893142.1"; ID "cds-WP_000893142.1"; Name "WP_000893142.1"; Ontology_term "GO:0019568" "GO:0008742"; Parent "gene-C7A06_RS01000"; gbkey "CDS"; gene "araD"; go_function "L-ribulose-phosphate 4-epimerase activity|0008742||IEA"; go_process "arabinose catabolic process|0019568||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418040.1"; locus_tag "C7A06_RS01000"; product "L-ribulose-5-phosphate 4-epimerase"; protein_id "WP_000893142.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 189484 190344 . - . gene_id "nbis-gene-165"; ID "nbis-gene-165"; Name "sgbU"; gbkey "Gene"; gene "sgbU"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01005"; +NZ_CP027599.1 RefSeq transcript 189484 190344 . - . gene_id "nbis-gene-165"; transcript_id "gene-C7A06_RS01005"; ID "gene-C7A06_RS01005"; Name "sgbU"; Parent "nbis-gene-165"; gbkey "Gene"; gene "sgbU"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01005"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 189484 190344 . - . gene_id "nbis-gene-165"; transcript_id "gene-C7A06_RS01005"; Dbxref "Genbank:WP_001296811.1"; ID "nbis-exon-174"; Name "WP_001296811.1"; Parent "gene-C7A06_RS01005"; gbkey "CDS"; gene "sgbU"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418039.2"; locus_tag "C7A06_RS01005"; product "L-ribulose-5-phosphate 3-epimerase"; protein_id "WP_001296811.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 189484 190344 . - 0 gene_id "nbis-gene-165"; transcript_id "gene-C7A06_RS01005"; Dbxref "Genbank:WP_001296811.1"; ID "cds-WP_001296811.1"; Name "WP_001296811.1"; Parent "gene-C7A06_RS01005"; gbkey "CDS"; gene "sgbU"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418039.2"; locus_tag "C7A06_RS01005"; product "L-ribulose-5-phosphate 3-epimerase"; protein_id "WP_001296811.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 190337 190999 . - . gene_id "nbis-gene-166"; ID "nbis-gene-166"; Name "ulaD"; gbkey "Gene"; gene "ulaD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01010"; +NZ_CP027599.1 RefSeq transcript 190337 190999 . - . gene_id "nbis-gene-166"; transcript_id "gene-C7A06_RS01010"; ID "gene-C7A06_RS01010"; Name "ulaD"; Parent "nbis-gene-166"; gbkey "Gene"; gene "ulaD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01010"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 190337 190999 . - . gene_id "nbis-gene-166"; transcript_id "gene-C7A06_RS01010"; Dbxref "Genbank:WP_000089497.1"; ID "nbis-exon-175"; Name "WP_000089497.1"; Parent "gene-C7A06_RS01010"; gbkey "CDS"; gene "ulaD"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418038.1"; locus_tag "C7A06_RS01010"; product "3-keto-L-gulonate-6-phosphate decarboxylase UlaD"; protein_id "WP_000089497.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 190337 190999 . - 0 gene_id "nbis-gene-166"; transcript_id "gene-C7A06_RS01010"; Dbxref "Genbank:WP_000089497.1"; ID "cds-WP_000089497.1"; Name "WP_000089497.1"; Parent "gene-C7A06_RS01010"; gbkey "CDS"; gene "ulaD"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418038.1"; locus_tag "C7A06_RS01010"; product "3-keto-L-gulonate-6-phosphate decarboxylase UlaD"; protein_id "WP_000089497.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 190996 192492 . - . gene_id "nbis-gene-167"; ID "nbis-gene-167"; Name "lyxK"; gbkey "Gene"; gene "lyxK"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01015"; +NZ_CP027599.1 RefSeq transcript 190996 192492 . - . gene_id "nbis-gene-167"; transcript_id "gene-C7A06_RS01015"; ID "gene-C7A06_RS01015"; Name "lyxK"; Parent "nbis-gene-167"; gbkey "Gene"; gene "lyxK"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01015"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 190996 192492 . - . gene_id "nbis-gene-167"; transcript_id "gene-C7A06_RS01015"; Dbxref "Genbank:WP_000196086.1"; ID "nbis-exon-176"; Name "WP_000196086.1"; Parent "gene-C7A06_RS01015"; gbkey "CDS"; gene "lyxK"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418037.1"; locus_tag "C7A06_RS01015"; product "L-xylulokinase"; protein_id "WP_000196086.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 190996 192492 . - 0 gene_id "nbis-gene-167"; transcript_id "gene-C7A06_RS01015"; Dbxref "Genbank:WP_000196086.1"; ID "cds-WP_000196086.1"; Name "WP_000196086.1"; Parent "gene-C7A06_RS01015"; gbkey "CDS"; gene "lyxK"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418037.1"; locus_tag "C7A06_RS01015"; product "L-xylulokinase"; protein_id "WP_000196086.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 192496 193482 . - . gene_id "nbis-gene-168"; ID "nbis-gene-168"; Name "yiaO"; gbkey "Gene"; gene "yiaO"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01020"; +NZ_CP027599.1 RefSeq transcript 192496 193482 . - . gene_id "nbis-gene-168"; transcript_id "gene-C7A06_RS01020"; ID "gene-C7A06_RS01020"; Name "yiaO"; Parent "nbis-gene-168"; gbkey "Gene"; gene "yiaO"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01020"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 192496 193482 . - . gene_id "nbis-gene-168"; transcript_id "gene-C7A06_RS01020"; Dbxref "Genbank:WP_000776892.1"; ID "nbis-exon-177"; Name "WP_000776892.1"; Parent "gene-C7A06_RS01020"; gbkey "CDS"; gene "yiaO"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418036.1"; locus_tag "C7A06_RS01020"; product "2,3-diketo-L-gulonate transporter substrate-binding protein YiaO"; protein_id "WP_000776892.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 192496 193482 . - 0 gene_id "nbis-gene-168"; transcript_id "gene-C7A06_RS01020"; Dbxref "Genbank:WP_000776892.1"; ID "cds-WP_000776892.1"; Name "WP_000776892.1"; Parent "gene-C7A06_RS01020"; gbkey "CDS"; gene "yiaO"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418036.1"; locus_tag "C7A06_RS01020"; product "2,3-diketo-L-gulonate transporter substrate-binding protein YiaO"; protein_id "WP_000776892.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 193495 194772 . - . gene_id "nbis-gene-169"; ID "nbis-gene-169"; Name "yiaN"; gbkey "Gene"; gene "yiaN"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01025"; +NZ_CP027599.1 RefSeq transcript 193495 194772 . - . gene_id "nbis-gene-169"; transcript_id "gene-C7A06_RS01025"; ID "gene-C7A06_RS01025"; Name "yiaN"; Parent "nbis-gene-169"; gbkey "Gene"; gene "yiaN"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01025"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 193495 194772 . - . gene_id "nbis-gene-169"; transcript_id "gene-C7A06_RS01025"; Dbxref "Genbank:WP_000279599.1"; ID "nbis-exon-178"; Name "WP_000279599.1"; Parent "gene-C7A06_RS01025"; gbkey "CDS"; gene "yiaN"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_026232.1"; locus_tag "C7A06_RS01025"; product "2,3-diketo-L-gulonate transporter large permease YiaN"; protein_id "WP_000279599.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 193495 194772 . - 0 gene_id "nbis-gene-169"; transcript_id "gene-C7A06_RS01025"; Dbxref "Genbank:WP_000279599.1"; ID "cds-WP_000279599.1"; Name "WP_000279599.1"; Parent "gene-C7A06_RS01025"; gbkey "CDS"; gene "yiaN"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_026232.1"; locus_tag "C7A06_RS01025"; product "2,3-diketo-L-gulonate transporter large permease YiaN"; protein_id "WP_000279599.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 194775 195248 . - . gene_id "nbis-gene-170"; ID "nbis-gene-170"; Name "yiaM"; gbkey "Gene"; gene "yiaM"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01030"; +NZ_CP027599.1 RefSeq transcript 194775 195248 . - . gene_id "nbis-gene-170"; transcript_id "gene-C7A06_RS01030"; ID "gene-C7A06_RS01030"; Name "yiaM"; Parent "nbis-gene-170"; gbkey "Gene"; gene "yiaM"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01030"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 194775 195248 . - . gene_id "nbis-gene-170"; transcript_id "gene-C7A06_RS01030"; Dbxref "Genbank:WP_000721664.1"; ID "nbis-exon-179"; Name "WP_000721664.1"; Parent "gene-C7A06_RS01030"; gbkey "CDS"; gene "yiaM"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418034.1"; locus_tag "C7A06_RS01030"; product "2,3-diketo-L-gulonate TRAP transporter small permease YiaM"; protein_id "WP_000721664.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 194775 195248 . - 0 gene_id "nbis-gene-170"; transcript_id "gene-C7A06_RS01030"; Dbxref "Genbank:WP_000721664.1"; ID "cds-WP_000721664.1"; Name "WP_000721664.1"; Parent "gene-C7A06_RS01030"; gbkey "CDS"; gene "yiaM"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418034.1"; locus_tag "C7A06_RS01030"; product "2,3-diketo-L-gulonate TRAP transporter small permease YiaM"; protein_id "WP_000721664.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 195366 195833 . - . gene_id "nbis-gene-171"; ID "nbis-gene-171"; Name "yiaL"; gbkey "Gene"; gene "yiaL"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01035"; +NZ_CP027599.1 RefSeq transcript 195366 195833 . - . gene_id "nbis-gene-171"; transcript_id "gene-C7A06_RS01035"; ID "gene-C7A06_RS01035"; Name "yiaL"; Parent "nbis-gene-171"; gbkey "Gene"; gene "yiaL"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01035"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 195366 195833 . - . gene_id "nbis-gene-171"; transcript_id "gene-C7A06_RS01035"; Dbxref "Genbank:WP_000576071.1"; ID "nbis-exon-180"; Name "WP_000576071.1"; Parent "gene-C7A06_RS01035"; gbkey "CDS"; gene "yiaL"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418033.1"; locus_tag "C7A06_RS01035"; product "YhcH/YjgK/YiaL family protein"; protein_id "WP_000576071.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 195366 195833 . - 0 gene_id "nbis-gene-171"; transcript_id "gene-C7A06_RS01035"; Dbxref "Genbank:WP_000576071.1"; ID "cds-WP_000576071.1"; Name "WP_000576071.1"; Parent "gene-C7A06_RS01035"; gbkey "CDS"; gene "yiaL"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418033.1"; locus_tag "C7A06_RS01035"; product "YhcH/YjgK/YiaL family protein"; protein_id "WP_000576071.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 195845 196843 . - . gene_id "nbis-gene-172"; ID "nbis-gene-172"; Name "yiaK"; gbkey "Gene"; gene "yiaK"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01040"; +NZ_CP027599.1 RefSeq transcript 195845 196843 . - . gene_id "nbis-gene-172"; transcript_id "gene-C7A06_RS01040"; ID "gene-C7A06_RS01040"; Name "yiaK"; Parent "nbis-gene-172"; gbkey "Gene"; gene "yiaK"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01040"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 195845 196843 . - . gene_id "nbis-gene-172"; transcript_id "gene-C7A06_RS01040"; Dbxref "Genbank:WP_000869039.1"; ID "nbis-exon-181"; Name "WP_000869039.1"; Ontology_term "GO:0047559" "GO:0070403"; Parent "gene-C7A06_RS01040"; gbkey "CDS"; gene "yiaK"; go_function "3-dehydro-L-gulonate 2-dehydrogenase activity|0047559||IEA" "NAD+ binding|0070403||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709360.1"; locus_tag "C7A06_RS01040"; product "3-dehydro-L-gulonate 2-dehydrogenase"; protein_id "WP_000869039.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 195845 196843 . - 0 gene_id "nbis-gene-172"; transcript_id "gene-C7A06_RS01040"; Dbxref "Genbank:WP_000869039.1"; ID "cds-WP_000869039.1"; Name "WP_000869039.1"; Ontology_term "GO:0047559" "GO:0070403"; Parent "gene-C7A06_RS01040"; gbkey "CDS"; gene "yiaK"; go_function "3-dehydro-L-gulonate 2-dehydrogenase activity|0047559||IEA" "NAD+ binding|0070403||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709360.1"; locus_tag "C7A06_RS01040"; product "3-dehydro-L-gulonate 2-dehydrogenase"; protein_id "WP_000869039.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 197044 197892 . + . gene_id "nbis-gene-173"; ID "nbis-gene-173"; Name "yiaJ"; gbkey "Gene"; gene "yiaJ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01045"; +NZ_CP027599.1 RefSeq transcript 197044 197892 . + . gene_id "nbis-gene-173"; transcript_id "gene-C7A06_RS01045"; ID "gene-C7A06_RS01045"; Name "yiaJ"; Parent "nbis-gene-173"; gbkey "Gene"; gene "yiaJ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01045"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 197044 197892 . + . gene_id "nbis-gene-173"; transcript_id "gene-C7A06_RS01045"; Dbxref "Genbank:WP_000514230.1"; ID "nbis-exon-182"; Name "WP_000514230.1"; Parent "gene-C7A06_RS01045"; gbkey "CDS"; gene "yiaJ"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418031.1"; locus_tag "C7A06_RS01045"; product "IclR family transcriptional regulator YiaJ"; protein_id "WP_000514230.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 197044 197892 . + 0 gene_id "nbis-gene-173"; transcript_id "gene-C7A06_RS01045"; Dbxref "Genbank:WP_000514230.1"; ID "cds-WP_000514230.1"; Name "WP_000514230.1"; Parent "gene-C7A06_RS01045"; gbkey "CDS"; gene "yiaJ"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418031.1"; locus_tag "C7A06_RS01045"; product "IclR family transcriptional regulator YiaJ"; protein_id "WP_000514230.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 197994 198467 . + . gene_id "nbis-gene-174"; ID "nbis-gene-174"; Name "ysaA"; gbkey "Gene"; gene "ysaA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01050"; +NZ_CP027599.1 RefSeq transcript 197994 198467 . + . gene_id "nbis-gene-174"; transcript_id "gene-C7A06_RS01050"; ID "gene-C7A06_RS01050"; Name "ysaA"; Parent "nbis-gene-174"; gbkey "Gene"; gene "ysaA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01050"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 197994 198467 . + . gene_id "nbis-gene-174"; transcript_id "gene-C7A06_RS01050"; Dbxref "Genbank:WP_001296790.1"; ID "nbis-exon-183"; Name "WP_001296790.1"; Parent "gene-C7A06_RS01050"; gbkey "CDS"; gene "ysaA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312483.1"; locus_tag "C7A06_RS01050"; product "4Fe-4S binding protein"; protein_id "WP_001296790.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 197994 198467 . + 0 gene_id "nbis-gene-174"; transcript_id "gene-C7A06_RS01050"; Dbxref "Genbank:WP_001296790.1"; ID "cds-WP_001296790.1"; Name "WP_001296790.1"; Parent "gene-C7A06_RS01050"; gbkey "CDS"; gene "ysaA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312483.1"; locus_tag "C7A06_RS01050"; product "4Fe-4S binding protein"; protein_id "WP_001296790.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 198619 199872 . - . gene_id "nbis-gene-175"; ID "nbis-gene-175"; Name "avtA"; gbkey "Gene"; gene "avtA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01055"; +NZ_CP027599.1 RefSeq transcript 198619 199872 . - . gene_id "nbis-gene-175"; transcript_id "gene-C7A06_RS01055"; ID "gene-C7A06_RS01055"; Name "avtA"; Parent "nbis-gene-175"; gbkey "Gene"; gene "avtA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01055"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 198619 199872 . - . gene_id "nbis-gene-175"; transcript_id "gene-C7A06_RS01055"; Dbxref "Genbank:WP_000144361.1"; ID "nbis-exon-184"; Name "WP_000144361.1"; Parent "gene-C7A06_RS01055"; gbkey "CDS"; gene "avtA"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_026231.1"; locus_tag "C7A06_RS01055"; product "valine--pyruvate transaminase"; protein_id "WP_000144361.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 198619 199872 . - 0 gene_id "nbis-gene-175"; transcript_id "gene-C7A06_RS01055"; Dbxref "Genbank:WP_000144361.1"; ID "cds-WP_000144361.1"; Name "WP_000144361.1"; Parent "gene-C7A06_RS01055"; gbkey "CDS"; gene "avtA"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_026231.1"; locus_tag "C7A06_RS01055"; product "valine--pyruvate transaminase"; protein_id "WP_000144361.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 200050 202080 . - . gene_id "nbis-gene-176"; ID "nbis-gene-176"; Name "malS"; gbkey "Gene"; gene "malS"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01060"; +NZ_CP027599.1 RefSeq transcript 200050 202080 . - . gene_id "nbis-gene-176"; transcript_id "gene-C7A06_RS01060"; ID "gene-C7A06_RS01060"; Name "malS"; Parent "nbis-gene-176"; gbkey "Gene"; gene "malS"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01060"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 200050 202080 . - . gene_id "nbis-gene-176"; transcript_id "gene-C7A06_RS01060"; Dbxref "Genbank:WP_000761204.1"; ID "nbis-exon-185"; Name "WP_000761204.1"; Ontology_term "GO:0004556"; Parent "gene-C7A06_RS01060"; gbkey "CDS"; gene "malS"; go_function "alpha-amylase activity|0004556||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312481.1"; locus_tag "C7A06_RS01060"; product "alpha-amylase"; protein_id "WP_000761204.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 200050 202080 . - 0 gene_id "nbis-gene-176"; transcript_id "gene-C7A06_RS01060"; Dbxref "Genbank:WP_000761204.1"; ID "cds-WP_000761204.1"; Name "WP_000761204.1"; Ontology_term "GO:0004556"; Parent "gene-C7A06_RS01060"; gbkey "CDS"; gene "malS"; go_function "alpha-amylase activity|0004556||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312481.1"; locus_tag "C7A06_RS01060"; product "alpha-amylase"; protein_id "WP_000761204.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 202400 203224 . + . gene_id "nbis-gene-177"; ID "nbis-gene-177"; Name "bax"; gbkey "Gene"; gene "bax"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01065"; +NZ_CP027599.1 RefSeq transcript 202400 203224 . + . gene_id "nbis-gene-177"; transcript_id "gene-C7A06_RS01065"; ID "gene-C7A06_RS01065"; Name "bax"; Parent "nbis-gene-177"; gbkey "Gene"; gene "bax"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01065"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 202400 203224 . + . gene_id "nbis-gene-177"; transcript_id "gene-C7A06_RS01065"; Dbxref "Genbank:WP_001296804.1"; ID "nbis-exon-186"; Name "WP_001296804.1"; Parent "gene-C7A06_RS01065"; gbkey "CDS"; gene "bax"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_026230.1"; locus_tag "C7A06_RS01065"; product "protein bax"; protein_id "WP_001296804.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 202400 203224 . + 0 gene_id "nbis-gene-177"; transcript_id "gene-C7A06_RS01065"; Dbxref "Genbank:WP_001296804.1"; ID "cds-WP_001296804.1"; Name "WP_001296804.1"; Parent "gene-C7A06_RS01065"; gbkey "CDS"; gene "bax"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_026230.1"; locus_tag "C7A06_RS01065"; product "protein bax"; protein_id "WP_001296804.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 203332 204510 . - . gene_id "nbis-gene-178"; ID "nbis-gene-178"; Name "xylR"; gbkey "Gene"; gene "xylR"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01070"; +NZ_CP027599.1 RefSeq transcript 203332 204510 . - . gene_id "nbis-gene-178"; transcript_id "gene-C7A06_RS01070"; ID "gene-C7A06_RS01070"; Name "xylR"; Parent "nbis-gene-178"; gbkey "Gene"; gene "xylR"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01070"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 203332 204510 . - . gene_id "nbis-gene-178"; transcript_id "gene-C7A06_RS01070"; Dbxref "Genbank:WP_000494484.1"; ID "nbis-exon-187"; Name "WP_000494484.1"; Parent "gene-C7A06_RS01070"; gbkey "CDS"; gene "xylR"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312479.1"; locus_tag "C7A06_RS01070"; product "DNA-binding transcriptional regulator XylR"; protein_id "WP_000494484.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 203332 204510 . - 0 gene_id "nbis-gene-178"; transcript_id "gene-C7A06_RS01070"; Dbxref "Genbank:WP_000494484.1"; ID "cds-WP_000494484.1"; Name "WP_000494484.1"; Parent "gene-C7A06_RS01070"; gbkey "CDS"; gene "xylR"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312479.1"; locus_tag "C7A06_RS01070"; product "DNA-binding transcriptional regulator XylR"; protein_id "WP_000494484.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 204588 205769 . - . gene_id "nbis-gene-179"; ID "nbis-gene-179"; Name "xylH"; gbkey "Gene"; gene "xylH"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01075"; +NZ_CP027599.1 RefSeq transcript 204588 205769 . - . gene_id "nbis-gene-179"; transcript_id "gene-C7A06_RS01075"; ID "gene-C7A06_RS01075"; Name "xylH"; Parent "nbis-gene-179"; gbkey "Gene"; gene "xylH"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01075"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 204588 205769 . - . gene_id "nbis-gene-179"; transcript_id "gene-C7A06_RS01075"; Dbxref "Genbank:WP_000045978.1"; ID "nbis-exon-188"; Name "WP_000045978.1"; Parent "gene-C7A06_RS01075"; gbkey "CDS"; gene "xylH"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312478.1"; locus_tag "C7A06_RS01075"; product "xylose ABC transporter permease XylH"; protein_id "WP_000045978.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 204588 205769 . - 0 gene_id "nbis-gene-179"; transcript_id "gene-C7A06_RS01075"; Dbxref "Genbank:WP_000045978.1"; ID "cds-WP_000045978.1"; Name "WP_000045978.1"; Parent "gene-C7A06_RS01075"; gbkey "CDS"; gene "xylH"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312478.1"; locus_tag "C7A06_RS01075"; product "xylose ABC transporter permease XylH"; protein_id "WP_000045978.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 205747 207288 . - . gene_id "nbis-gene-180"; ID "nbis-gene-180"; Name "xylG"; gbkey "Gene"; gene "xylG"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01080"; +NZ_CP027599.1 RefSeq transcript 205747 207288 . - . gene_id "nbis-gene-180"; transcript_id "gene-C7A06_RS01080"; ID "gene-C7A06_RS01080"; Name "xylG"; Parent "nbis-gene-180"; gbkey "Gene"; gene "xylG"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01080"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 205747 207288 . - . gene_id "nbis-gene-180"; transcript_id "gene-C7A06_RS01080"; Dbxref "Genbank:WP_001146482.1"; ID "nbis-exon-189"; Name "WP_001146482.1"; Ontology_term "GO:0015753" "GO:0005524" "GO:0015614" "GO:0009898" "GO:0055052"; Parent "gene-C7A06_RS01080"; gbkey "CDS"; gene "xylG"; go_component "cytoplasmic side of plasma membrane|0009898||IEA" "ATP-binding cassette (ABC) transporter complex, substrate-binding subunit-containing|0055052||IEA"; go_function "ATP binding|0005524||IEA" "ABC-type D-xylose transporter activity|0015614||IEA"; go_process "D-xylose transmembrane transport|0015753||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312477.1"; locus_tag "C7A06_RS01080"; product "D-xylose ABC transporter ATP-binding protein"; protein_id "WP_001146482.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 205747 207288 . - 0 gene_id "nbis-gene-180"; transcript_id "gene-C7A06_RS01080"; Dbxref "Genbank:WP_001146482.1"; ID "cds-WP_001146482.1"; Name "WP_001146482.1"; Ontology_term "GO:0015753" "GO:0005524" "GO:0015614" "GO:0009898" "GO:0055052"; Parent "gene-C7A06_RS01080"; gbkey "CDS"; gene "xylG"; go_component "cytoplasmic side of plasma membrane|0009898||IEA" "ATP-binding cassette (ABC) transporter complex, substrate-binding subunit-containing|0055052||IEA"; go_function "ATP binding|0005524||IEA" "ABC-type D-xylose transporter activity|0015614||IEA"; go_process "D-xylose transmembrane transport|0015753||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312477.1"; locus_tag "C7A06_RS01080"; product "D-xylose ABC transporter ATP-binding protein"; protein_id "WP_001146482.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 207366 208358 . - . gene_id "nbis-gene-181"; ID "nbis-gene-181"; Name "xylF"; gbkey "Gene"; gene "xylF"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01085"; +NZ_CP027599.1 RefSeq transcript 207366 208358 . - . gene_id "nbis-gene-181"; transcript_id "gene-C7A06_RS01085"; ID "gene-C7A06_RS01085"; Name "xylF"; Parent "nbis-gene-181"; gbkey "Gene"; gene "xylF"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01085"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 207366 208358 . - . gene_id "nbis-gene-181"; transcript_id "gene-C7A06_RS01085"; Dbxref "Genbank:WP_001296518.1"; ID "nbis-exon-190"; Name "WP_001296518.1"; Ontology_term "GO:0015753"; Parent "gene-C7A06_RS01085"; gbkey "CDS"; gene "xylF"; go_process "D-xylose transmembrane transport|0015753||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418023.1"; locus_tag "C7A06_RS01085"; product "D-xylose ABC transporter substrate-binding protein"; protein_id "WP_001296518.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 207366 208358 . - 0 gene_id "nbis-gene-181"; transcript_id "gene-C7A06_RS01085"; Dbxref "Genbank:WP_001296518.1"; ID "cds-WP_001296518.1"; Name "WP_001296518.1"; Ontology_term "GO:0015753"; Parent "gene-C7A06_RS01085"; gbkey "CDS"; gene "xylF"; go_process "D-xylose transmembrane transport|0015753||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418023.1"; locus_tag "C7A06_RS01085"; product "D-xylose ABC transporter substrate-binding protein"; protein_id "WP_001296518.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 208724 210046 . + . gene_id "nbis-gene-182"; ID "nbis-gene-182"; Name "xylA"; gbkey "Gene"; gene "xylA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01090"; +NZ_CP027599.1 RefSeq transcript 208724 210046 . + . gene_id "nbis-gene-182"; transcript_id "gene-C7A06_RS01090"; ID "gene-C7A06_RS01090"; Name "xylA"; Parent "nbis-gene-182"; gbkey "Gene"; gene "xylA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01090"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 208724 210046 . + . gene_id "nbis-gene-182"; transcript_id "gene-C7A06_RS01090"; Dbxref "Genbank:WP_001149582.1"; ID "nbis-exon-191"; Name "WP_001149582.1"; Ontology_term "GO:0006098" "GO:0042732" "GO:0000287" "GO:0009045"; Parent "gene-C7A06_RS01090"; gbkey "CDS"; gene "xylA"; go_function "magnesium ion binding|0000287||IEA" "xylose isomerase activity|0009045||IEA"; go_process "pentose-phosphate shunt|0006098||IEA" "D-xylose metabolic process|0042732||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312475.1"; locus_tag "C7A06_RS01090"; product "xylose isomerase"; protein_id "WP_001149582.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 208724 210046 . + 0 gene_id "nbis-gene-182"; transcript_id "gene-C7A06_RS01090"; Dbxref "Genbank:WP_001149582.1"; ID "cds-WP_001149582.1"; Name "WP_001149582.1"; Ontology_term "GO:0006098" "GO:0042732" "GO:0000287" "GO:0009045"; Parent "gene-C7A06_RS01090"; gbkey "CDS"; gene "xylA"; go_function "magnesium ion binding|0000287||IEA" "xylose isomerase activity|0009045||IEA"; go_process "pentose-phosphate shunt|0006098||IEA" "D-xylose metabolic process|0042732||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312475.1"; locus_tag "C7A06_RS01090"; product "xylose isomerase"; protein_id "WP_001149582.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 210118 211572 . + . gene_id "nbis-gene-183"; ID "nbis-gene-183"; Name "xylB"; gbkey "Gene"; gene "xylB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01095"; +NZ_CP027599.1 RefSeq transcript 210118 211572 . + . gene_id "nbis-gene-183"; transcript_id "gene-C7A06_RS01095"; ID "gene-C7A06_RS01095"; Name "xylB"; Parent "nbis-gene-183"; gbkey "Gene"; gene "xylB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01095"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 210118 211572 . + . gene_id "nbis-gene-183"; transcript_id "gene-C7A06_RS01095"; Dbxref "Genbank:WP_000275386.1"; ID "nbis-exon-192"; Name "WP_000275386.1"; Ontology_term "GO:0005997" "GO:0004856"; Parent "gene-C7A06_RS01095"; gbkey "CDS"; gene "xylB"; go_function "xylulokinase activity|0004856||IEA"; go_process "xylulose metabolic process|0005997||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709351.1"; locus_tag "C7A06_RS01095"; product "xylulokinase"; protein_id "WP_000275386.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 210118 211572 . + 0 gene_id "nbis-gene-183"; transcript_id "gene-C7A06_RS01095"; Dbxref "Genbank:WP_000275386.1"; ID "cds-WP_000275386.1"; Name "WP_000275386.1"; Ontology_term "GO:0005997" "GO:0004856"; Parent "gene-C7A06_RS01095"; gbkey "CDS"; gene "xylB"; go_function "xylulokinase activity|0004856||IEA"; go_process "xylulose metabolic process|0005997||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709351.1"; locus_tag "C7A06_RS01095"; product "xylulokinase"; protein_id "WP_000275386.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 211741 212082 . + . gene_id "nbis-gene-184"; ID "nbis-gene-184"; Name "C7A06_RS01100"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01100"; +NZ_CP027599.1 RefSeq transcript 211741 212082 . + . gene_id "nbis-gene-184"; transcript_id "gene-C7A06_RS01100"; ID "gene-C7A06_RS01100"; Name "C7A06_RS01100"; Parent "nbis-gene-184"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01100"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 211741 212082 . + . gene_id "nbis-gene-184"; transcript_id "gene-C7A06_RS01100"; Dbxref "Genbank:WP_000858193.1"; ID "nbis-exon-193"; Name "WP_000858193.1"; Parent "gene-C7A06_RS01100"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709350.2"; locus_tag "C7A06_RS01100"; product "hypothetical protein"; protein_id "WP_000858193.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 211741 212082 . + 0 gene_id "nbis-gene-184"; transcript_id "gene-C7A06_RS01100"; Dbxref "Genbank:WP_000858193.1"; ID "cds-WP_000858193.1"; Name "WP_000858193.1"; Parent "gene-C7A06_RS01100"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709350.2"; locus_tag "C7A06_RS01100"; product "hypothetical protein"; protein_id "WP_000858193.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 212128 212565 . + . gene_id "nbis-gene-185"; ID "nbis-gene-185"; Name "yiaA"; gbkey "Gene"; gene "yiaA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01105"; +NZ_CP027599.1 RefSeq transcript 212128 212565 . + . gene_id "nbis-gene-185"; transcript_id "gene-C7A06_RS01105"; ID "gene-C7A06_RS01105"; Name "yiaA"; Parent "nbis-gene-185"; gbkey "Gene"; gene "yiaA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01105"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 212128 212565 . + . gene_id "nbis-gene-185"; transcript_id "gene-C7A06_RS01105"; Dbxref "Genbank:WP_001298726.1"; ID "nbis-exon-194"; Name "WP_001298726.1"; Parent "gene-C7A06_RS01105"; gbkey "CDS"; gene "yiaA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312472.2"; locus_tag "C7A06_RS01105"; product "YiaB family inner membrane protein"; protein_id "WP_001298726.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 212128 212565 . + 0 gene_id "nbis-gene-185"; transcript_id "gene-C7A06_RS01105"; Dbxref "Genbank:WP_001298726.1"; ID "cds-WP_001298726.1"; Name "WP_001298726.1"; Parent "gene-C7A06_RS01105"; gbkey "CDS"; gene "yiaA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312472.2"; locus_tag "C7A06_RS01105"; product "YiaB family inner membrane protein"; protein_id "WP_001298726.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 212607 213602 . - . gene_id "nbis-gene-186"; ID "nbis-gene-186"; Name "wecH"; gbkey "Gene"; gene "wecH"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01110"; +NZ_CP027599.1 RefSeq transcript 212607 213602 . - . gene_id "nbis-gene-186"; transcript_id "gene-C7A06_RS01110"; ID "gene-C7A06_RS01110"; Name "wecH"; Parent "nbis-gene-186"; gbkey "Gene"; gene "wecH"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01110"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 212607 213602 . - . gene_id "nbis-gene-186"; transcript_id "gene-C7A06_RS01110"; Dbxref "Genbank:WP_001182671.1"; ID "nbis-exon-195"; Name "WP_001182671.1"; Parent "gene-C7A06_RS01110"; gbkey "CDS"; gene "wecH"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709348.1"; locus_tag "C7A06_RS01110"; product "O-acetyltransferase WecH"; protein_id "WP_001182671.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 212607 213602 . - 0 gene_id "nbis-gene-186"; transcript_id "gene-C7A06_RS01110"; Dbxref "Genbank:WP_001182671.1"; ID "cds-WP_001182671.1"; Name "WP_001182671.1"; Parent "gene-C7A06_RS01110"; gbkey "CDS"; gene "wecH"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709348.1"; locus_tag "C7A06_RS01110"; product "O-acetyltransferase WecH"; protein_id "WP_001182671.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 213777 214076 . + . gene_id "nbis-gene-187"; ID "nbis-gene-187"; Name "ysaB"; gbkey "Gene"; gene "ysaB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01115"; +NZ_CP027599.1 RefSeq transcript 213777 214076 . + . gene_id "nbis-gene-187"; transcript_id "gene-C7A06_RS01115"; ID "gene-C7A06_RS01115"; Name "ysaB"; Parent "nbis-gene-187"; gbkey "Gene"; gene "ysaB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01115"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 213777 214076 . + . gene_id "nbis-gene-187"; transcript_id "gene-C7A06_RS01115"; Dbxref "Genbank:WP_000980114.1"; ID "nbis-exon-196"; Name "WP_000980114.1"; Parent "gene-C7A06_RS01115"; gbkey "CDS"; gene "ysaB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709347.1"; locus_tag "C7A06_RS01115"; product "YsaB family lipoprotein"; protein_id "WP_000980114.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 213777 214076 . + 0 gene_id "nbis-gene-187"; transcript_id "gene-C7A06_RS01115"; Dbxref "Genbank:WP_000980114.1"; ID "cds-WP_000980114.1"; Name "WP_000980114.1"; Parent "gene-C7A06_RS01115"; gbkey "CDS"; gene "ysaB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709347.1"; locus_tag "C7A06_RS01115"; product "YsaB family lipoprotein"; protein_id "WP_000980114.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 214171 215082 . + . gene_id "nbis-gene-188"; ID "nbis-gene-188"; Name "glyQ"; gbkey "Gene"; gene "glyQ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01120"; +NZ_CP027599.1 RefSeq transcript 214171 215082 . + . gene_id "nbis-gene-188"; transcript_id "gene-C7A06_RS01120"; ID "gene-C7A06_RS01120"; Name "glyQ"; Parent "nbis-gene-188"; gbkey "Gene"; gene "glyQ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01120"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 214171 215082 . + . gene_id "nbis-gene-188"; transcript_id "gene-C7A06_RS01120"; Dbxref "Genbank:WP_001168544.1"; ID "nbis-exon-197"; Name "WP_001168544.1"; Ontology_term "GO:0006426" "GO:0004820" "GO:0009345"; Parent "gene-C7A06_RS01120"; gbkey "CDS"; gene "glyQ"; go_component "glycine-tRNA ligase complex|0009345||IEA"; go_function "glycine-tRNA ligase activity|0004820||IEA"; go_process "glycyl-tRNA aminoacylation|0006426||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312470.1"; locus_tag "C7A06_RS01120"; product "glycine--tRNA ligase subunit alpha"; protein_id "WP_001168544.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 214171 215082 . + 0 gene_id "nbis-gene-188"; transcript_id "gene-C7A06_RS01120"; Dbxref "Genbank:WP_001168544.1"; ID "cds-WP_001168544.1"; Name "WP_001168544.1"; Ontology_term "GO:0006426" "GO:0004820" "GO:0009345"; Parent "gene-C7A06_RS01120"; gbkey "CDS"; gene "glyQ"; go_component "glycine-tRNA ligase complex|0009345||IEA"; go_function "glycine-tRNA ligase activity|0004820||IEA"; go_process "glycyl-tRNA aminoacylation|0006426||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312470.1"; locus_tag "C7A06_RS01120"; product "glycine--tRNA ligase subunit alpha"; protein_id "WP_001168544.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 215092 217161 . + . gene_id "nbis-gene-189"; ID "nbis-gene-189"; Name "glyS"; gbkey "Gene"; gene "glyS"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01125"; +NZ_CP027599.1 RefSeq transcript 215092 217161 . + . gene_id "nbis-gene-189"; transcript_id "gene-C7A06_RS01125"; ID "gene-C7A06_RS01125"; Name "glyS"; Parent "nbis-gene-189"; gbkey "Gene"; gene "glyS"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01125"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 215092 217161 . + . gene_id "nbis-gene-189"; transcript_id "gene-C7A06_RS01125"; Dbxref "Genbank:WP_001291774.1"; ID "nbis-exon-198"; Name "WP_001291774.1"; Ontology_term "GO:0006426" "GO:0004820" "GO:0009345"; Parent "gene-C7A06_RS01125"; gbkey "CDS"; gene "glyS"; go_component "glycine-tRNA ligase complex|0009345||IEA"; go_function "glycine-tRNA ligase activity|0004820||IEA"; go_process "glycyl-tRNA aminoacylation|0006426||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001291772.1"; locus_tag "C7A06_RS01125"; product "glycine--tRNA ligase subunit beta"; protein_id "WP_001291774.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 215092 217161 . + 0 gene_id "nbis-gene-189"; transcript_id "gene-C7A06_RS01125"; Dbxref "Genbank:WP_001291774.1"; ID "cds-WP_001291774.1"; Name "WP_001291774.1"; Ontology_term "GO:0006426" "GO:0004820" "GO:0009345"; Parent "gene-C7A06_RS01125"; gbkey "CDS"; gene "glyS"; go_component "glycine-tRNA ligase complex|0009345||IEA"; go_function "glycine-tRNA ligase activity|0004820||IEA"; go_process "glycyl-tRNA aminoacylation|0006426||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001291772.1"; locus_tag "C7A06_RS01125"; product "glycine--tRNA ligase subunit beta"; protein_id "WP_001291774.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 217486 217638 . + . gene_id "nbis-gene-190"; ID "nbis-gene-190"; Name "hokA"; gbkey "Gene"; gene "hokA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01130"; +NZ_CP027599.1 RefSeq transcript 217486 217638 . + . gene_id "nbis-gene-190"; transcript_id "gene-C7A06_RS01130"; ID "gene-C7A06_RS01130"; Name "hokA"; Parent "nbis-gene-190"; gbkey "Gene"; gene "hokA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01130"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 217486 217638 . + . gene_id "nbis-gene-190"; transcript_id "gene-C7A06_RS01130"; Dbxref "Genbank:WP_001135738.1"; ID "nbis-exon-199"; Name "WP_001135738.1"; Parent "gene-C7A06_RS01130"; gbkey "CDS"; gene "hokA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_012540334.1"; locus_tag "C7A06_RS01130"; product "type I toxin-antitoxin system toxin HokA"; protein_id "WP_001135738.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 217486 217638 . + 0 gene_id "nbis-gene-190"; transcript_id "gene-C7A06_RS01130"; Dbxref "Genbank:WP_001135738.1"; ID "cds-WP_001135738.1"; Name "WP_001135738.1"; Parent "gene-C7A06_RS01130"; gbkey "CDS"; gene "hokA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_012540334.1"; locus_tag "C7A06_RS01130"; product "type I toxin-antitoxin system toxin HokA"; protein_id "WP_001135738.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 217627 217686 . - . gene_id "nbis-gene-5808"; ID "nbis-gene-5808"; Name "C7A06_RS34675"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS34675"; +NZ_CP027599.1 RefSeq transcript 217627 217686 . - . gene_id "nbis-gene-5808"; transcript_id "gene-C7A06_RS34675"; ID "gene-C7A06_RS34675"; Name "C7A06_RS34675"; Parent "nbis-gene-5808"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS34675"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 217627 217686 . - . gene_id "nbis-gene-5808"; transcript_id "gene-C7A06_RS34675"; Dbxref "Genbank:WP_212591412.1"; ID "nbis-exon-6117"; Name "WP_212591412.1"; Parent "gene-C7A06_RS34675"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_010051206.1"; locus_tag "C7A06_RS34675"; product "hypothetical protein"; protein_id "WP_212591412.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 217627 217686 . - 0 gene_id "nbis-gene-5808"; transcript_id "gene-C7A06_RS34675"; Dbxref "Genbank:WP_212591412.1"; ID "cds-WP_212591412.1"; Name "WP_212591412.1"; Parent "gene-C7A06_RS34675"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_010051206.1"; locus_tag "C7A06_RS34675"; product "hypothetical protein"; protein_id "WP_212591412.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 217826 218038 . - . gene_id "nbis-gene-191"; ID "nbis-gene-191"; Name "cspA"; gbkey "Gene"; gene "cspA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01135"; +NZ_CP027599.1 RefSeq transcript 217826 218038 . - . gene_id "nbis-gene-191"; transcript_id "gene-C7A06_RS01135"; ID "gene-C7A06_RS01135"; Name "cspA"; Parent "nbis-gene-191"; gbkey "Gene"; gene "cspA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01135"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 217826 218038 . - . gene_id "nbis-gene-191"; transcript_id "gene-C7A06_RS01135"; Dbxref "Genbank:WP_000014594.1"; ID "nbis-exon-200"; Name "WP_000014594.1"; Parent "gene-C7A06_RS01135"; gbkey "CDS"; gene "cspA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312468.1"; locus_tag "C7A06_RS01135"; product "RNA chaperone/antiterminator CspA"; protein_id "WP_000014594.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 217826 218038 . - 0 gene_id "nbis-gene-191"; transcript_id "gene-C7A06_RS01135"; Dbxref "Genbank:WP_000014594.1"; ID "cds-WP_000014594.1"; Name "WP_000014594.1"; Parent "gene-C7A06_RS01135"; gbkey "CDS"; gene "cspA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312468.1"; locus_tag "C7A06_RS01135"; product "RNA chaperone/antiterminator CspA"; protein_id "WP_000014594.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 218319 218609 . - . gene_id "nbis-gene-192"; ID "nbis-gene-192"; Name "yiaG"; gbkey "Gene"; gene "yiaG"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01140"; +NZ_CP027599.1 RefSeq transcript 218319 218609 . - . gene_id "nbis-gene-192"; transcript_id "gene-C7A06_RS01140"; ID "gene-C7A06_RS01140"; Name "yiaG"; Parent "nbis-gene-192"; gbkey "Gene"; gene "yiaG"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01140"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 218319 218609 . - . gene_id "nbis-gene-192"; transcript_id "gene-C7A06_RS01140"; Dbxref "Genbank:WP_000455798.1"; ID "nbis-exon-201"; Name "WP_000455798.1"; Parent "gene-C7A06_RS01140"; gbkey "CDS"; gene "yiaG"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312467.1"; locus_tag "C7A06_RS01140"; product "HTH-type transcriptional regulator"; protein_id "WP_000455798.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 218319 218609 . - 0 gene_id "nbis-gene-192"; transcript_id "gene-C7A06_RS01140"; Dbxref "Genbank:WP_000455798.1"; ID "cds-WP_000455798.1"; Name "WP_000455798.1"; Parent "gene-C7A06_RS01140"; gbkey "CDS"; gene "yiaG"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312467.1"; locus_tag "C7A06_RS01140"; product "HTH-type transcriptional regulator"; protein_id "WP_000455798.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 219043 219753 . + . gene_id "nbis-gene-193"; ID "nbis-gene-193"; Name "yiaF"; gbkey "Gene"; gene "yiaF"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01145"; +NZ_CP027599.1 RefSeq transcript 219043 219753 . + . gene_id "nbis-gene-193"; transcript_id "gene-C7A06_RS01145"; ID "gene-C7A06_RS01145"; Name "yiaF"; Parent "nbis-gene-193"; gbkey "Gene"; gene "yiaF"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01145"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 219043 219753 . + . gene_id "nbis-gene-193"; transcript_id "gene-C7A06_RS01145"; Dbxref "Genbank:WP_000190517.1"; ID "nbis-exon-202"; Name "WP_000190517.1"; Parent "gene-C7A06_RS01145"; gbkey "CDS"; gene "yiaF"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418010.2"; locus_tag "C7A06_RS01145"; product "DUF3053 domain-containing protein"; protein_id "WP_000190517.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 219043 219753 . + 0 gene_id "nbis-gene-193"; transcript_id "gene-C7A06_RS01145"; Dbxref "Genbank:WP_000190517.1"; ID "cds-WP_000190517.1"; Name "WP_000190517.1"; Parent "gene-C7A06_RS01145"; gbkey "CDS"; gene "yiaF"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418010.2"; locus_tag "C7A06_RS01145"; product "DUF3053 domain-containing protein"; protein_id "WP_000190517.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 219803 220777 . - . gene_id "nbis-gene-194"; ID "nbis-gene-194"; Name "ghrB"; gbkey "Gene"; gene "ghrB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01150"; +NZ_CP027599.1 RefSeq transcript 219803 220777 . - . gene_id "nbis-gene-194"; transcript_id "gene-C7A06_RS01150"; ID "gene-C7A06_RS01150"; Name "ghrB"; Parent "nbis-gene-194"; gbkey "Gene"; gene "ghrB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01150"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 219803 220777 . - . gene_id "nbis-gene-194"; transcript_id "gene-C7A06_RS01150"; Dbxref "Genbank:WP_000805027.1"; ID "nbis-exon-203"; Name "WP_000805027.1"; Ontology_term "GO:0016616" "GO:0051287"; Parent "gene-C7A06_RS01150"; gbkey "CDS"; gene "ghrB"; go_function "oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor|0016616||IEA" "NAD binding|0051287||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312465.2"; locus_tag "C7A06_RS01150"; product "glyoxylate/hydroxypyruvate reductase GhrB"; protein_id "WP_000805027.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 219803 220777 . - 0 gene_id "nbis-gene-194"; transcript_id "gene-C7A06_RS01150"; Dbxref "Genbank:WP_000805027.1"; ID "cds-WP_000805027.1"; Name "WP_000805027.1"; Ontology_term "GO:0016616" "GO:0051287"; Parent "gene-C7A06_RS01150"; gbkey "CDS"; gene "ghrB"; go_function "oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor|0016616||IEA" "NAD binding|0051287||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312465.2"; locus_tag "C7A06_RS01150"; product "glyoxylate/hydroxypyruvate reductase GhrB"; protein_id "WP_000805027.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 220881 221540 . - . gene_id "nbis-gene-195"; ID "nbis-gene-195"; Name "yiaD"; gbkey "Gene"; gene "yiaD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01155"; +NZ_CP027599.1 RefSeq transcript 220881 221540 . - . gene_id "nbis-gene-195"; transcript_id "gene-C7A06_RS01155"; ID "gene-C7A06_RS01155"; Name "yiaD"; Parent "nbis-gene-195"; gbkey "Gene"; gene "yiaD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01155"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 220881 221540 . - . gene_id "nbis-gene-195"; transcript_id "gene-C7A06_RS01155"; Dbxref "Genbank:WP_000747625.1"; ID "nbis-exon-204"; Name "WP_000747625.1"; Ontology_term "GO:0009279"; Parent "gene-C7A06_RS01155"; gbkey "CDS"; gene "yiaD"; go_component "cell outer membrane|0009279||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312464.1"; locus_tag "C7A06_RS01155"; product "OmpA family lipoprotein"; protein_id "WP_000747625.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 220881 221540 . - 0 gene_id "nbis-gene-195"; transcript_id "gene-C7A06_RS01155"; Dbxref "Genbank:WP_000747625.1"; ID "cds-WP_000747625.1"; Name "WP_000747625.1"; Ontology_term "GO:0009279"; Parent "gene-C7A06_RS01155"; gbkey "CDS"; gene "yiaD"; go_component "cell outer membrane|0009279||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312464.1"; locus_tag "C7A06_RS01155"; product "OmpA family lipoprotein"; protein_id "WP_000747625.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 221693 224026 . + . gene_id "nbis-gene-196"; ID "nbis-gene-196"; Name "bisC"; gbkey "Gene"; gene "bisC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01160"; +NZ_CP027599.1 RefSeq transcript 221693 224026 . + . gene_id "nbis-gene-196"; transcript_id "gene-C7A06_RS01160"; ID "gene-C7A06_RS01160"; Name "bisC"; Parent "nbis-gene-196"; gbkey "Gene"; gene "bisC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01160"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 221693 224026 . + . gene_id "nbis-gene-196"; transcript_id "gene-C7A06_RS01160"; Dbxref "Genbank:WP_000013916.1"; ID "nbis-exon-205"; Name "WP_000013916.1"; Parent "gene-C7A06_RS01160"; gbkey "CDS"; gene "bisC"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418007.3"; locus_tag "C7A06_RS01160"; product "biotin sulfoxide reductase"; protein_id "WP_000013916.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 221693 224026 . + 0 gene_id "nbis-gene-196"; transcript_id "gene-C7A06_RS01160"; Dbxref "Genbank:WP_000013916.1"; ID "cds-WP_000013916.1"; Name "WP_000013916.1"; Parent "gene-C7A06_RS01160"; gbkey "CDS"; gene "bisC"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418007.3"; locus_tag "C7A06_RS01160"; product "biotin sulfoxide reductase"; protein_id "WP_000013916.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 223995 224435 . - . gene_id "nbis-gene-197"; ID "nbis-gene-197"; Name "yiaC"; gbkey "Gene"; gene "yiaC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01165"; +NZ_CP027599.1 RefSeq transcript 223995 224435 . - . gene_id "nbis-gene-197"; transcript_id "gene-C7A06_RS01165"; ID "gene-C7A06_RS01165"; Name "yiaC"; Parent "nbis-gene-197"; gbkey "Gene"; gene "yiaC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01165"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 223995 224435 . - . gene_id "nbis-gene-197"; transcript_id "gene-C7A06_RS01165"; Dbxref "Genbank:WP_000617478.1"; ID "nbis-exon-206"; Name "WP_000617478.1"; Ontology_term "GO:0008080"; Parent "gene-C7A06_RS01165"; gbkey "CDS"; gene "yiaC"; go_function "N-acetyltransferase activity|0008080||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709328.1"; locus_tag "C7A06_RS01165"; product "N-acetyltransferase"; protein_id "WP_000617478.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 223995 224435 . - 0 gene_id "nbis-gene-197"; transcript_id "gene-C7A06_RS01165"; Dbxref "Genbank:WP_000617478.1"; ID "cds-WP_000617478.1"; Name "WP_000617478.1"; Ontology_term "GO:0008080"; Parent "gene-C7A06_RS01165"; gbkey "CDS"; gene "yiaC"; go_function "N-acetyltransferase activity|0008080||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709328.1"; locus_tag "C7A06_RS01165"; product "N-acetyltransferase"; protein_id "WP_000617478.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 224432 224995 . - . gene_id "nbis-gene-198"; ID "nbis-gene-198"; Name "tag"; gbkey "Gene"; gene "tag"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01170"; +NZ_CP027599.1 RefSeq transcript 224432 224995 . - . gene_id "nbis-gene-198"; transcript_id "gene-C7A06_RS01170"; ID "gene-C7A06_RS01170"; Name "tag"; Parent "nbis-gene-198"; gbkey "Gene"; gene "tag"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01170"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 224432 224995 . - . gene_id "nbis-gene-198"; transcript_id "gene-C7A06_RS01170"; Dbxref "Genbank:WP_000438953.1"; ID "nbis-exon-207"; Name "WP_000438953.1"; Parent "gene-C7A06_RS01170"; gbkey "CDS"; gene "tag"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418005.1"; locus_tag "C7A06_RS01170"; product "DNA-3-methyladenine glycosylase I"; protein_id "WP_000438953.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 224432 224995 . - 0 gene_id "nbis-gene-198"; transcript_id "gene-C7A06_RS01170"; Dbxref "Genbank:WP_000438953.1"; ID "cds-WP_000438953.1"; Name "WP_000438953.1"; Parent "gene-C7A06_RS01170"; gbkey "CDS"; gene "tag"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418005.1"; locus_tag "C7A06_RS01170"; product "DNA-3-methyladenine glycosylase I"; protein_id "WP_000438953.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 225153 225851 . + . gene_id "nbis-gene-199"; ID "nbis-gene-199"; Name "yhjY"; gbkey "Gene"; gene "yhjY"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01175"; +NZ_CP027599.1 RefSeq transcript 225153 225851 . + . gene_id "nbis-gene-199"; transcript_id "gene-C7A06_RS01175"; ID "gene-C7A06_RS01175"; Name "yhjY"; Parent "nbis-gene-199"; gbkey "Gene"; gene "yhjY"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01175"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 225153 225851 . + . gene_id "nbis-gene-199"; transcript_id "gene-C7A06_RS01175"; Dbxref "Genbank:WP_001296791.1"; ID "nbis-exon-208"; Name "WP_001296791.1"; Parent "gene-C7A06_RS01175"; gbkey "CDS"; gene "yhjY"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709326.2"; locus_tag "C7A06_RS01175"; product "autotransporter outer membrane beta-barrel domain-containing protein"; protein_id "WP_001296791.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 225153 225851 . + 0 gene_id "nbis-gene-199"; transcript_id "gene-C7A06_RS01175"; Dbxref "Genbank:WP_001296791.1"; ID "cds-WP_001296791.1"; Name "WP_001296791.1"; Parent "gene-C7A06_RS01175"; gbkey "CDS"; gene "yhjY"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709326.2"; locus_tag "C7A06_RS01175"; product "autotransporter outer membrane beta-barrel domain-containing protein"; protein_id "WP_001296791.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 226080 227282 . + . gene_id "nbis-gene-200"; ID "nbis-gene-200"; Name "yhjX"; gbkey "Gene"; gene "yhjX"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01185"; +NZ_CP027599.1 RefSeq transcript 226080 227282 . + . gene_id "nbis-gene-200"; transcript_id "gene-C7A06_RS01185"; ID "gene-C7A06_RS01185"; Name "yhjX"; Parent "nbis-gene-200"; gbkey "Gene"; gene "yhjX"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01185"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 226080 227282 . + . gene_id "nbis-gene-200"; transcript_id "gene-C7A06_RS01185"; Dbxref "Genbank:WP_000189036.1"; ID "nbis-exon-209"; Name "WP_000189036.1"; Parent "gene-C7A06_RS01185"; gbkey "CDS"; gene "yhjX"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312459.1"; locus_tag "C7A06_RS01185"; product "MFS transporter"; protein_id "WP_000189036.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 226080 227282 . + 0 gene_id "nbis-gene-200"; transcript_id "gene-C7A06_RS01185"; Dbxref "Genbank:WP_000189036.1"; ID "cds-WP_000189036.1"; Name "WP_000189036.1"; Parent "gene-C7A06_RS01185"; gbkey "CDS"; gene "yhjX"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312459.1"; locus_tag "C7A06_RS01185"; product "MFS transporter"; protein_id "WP_000189036.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 227606 228130 . + . gene_id "nbis-gene-201"; ID "nbis-gene-201"; Name "C7A06_RS01190"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01190"; +NZ_CP027599.1 RefSeq transcript 227606 228130 . + . gene_id "nbis-gene-201"; transcript_id "gene-C7A06_RS01190"; ID "gene-C7A06_RS01190"; Name "C7A06_RS01190"; Parent "nbis-gene-201"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01190"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 227606 228130 . + . gene_id "nbis-gene-201"; transcript_id "gene-C7A06_RS01190"; Dbxref "Genbank:WP_000756356.1"; ID "nbis-exon-210"; Name "WP_000756356.1"; Parent "gene-C7A06_RS01190"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000756357.1"; locus_tag "C7A06_RS01190"; product "long polar fimbria major subunit LpfA"; protein_id "WP_000756356.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 227606 228130 . + 0 gene_id "nbis-gene-201"; transcript_id "gene-C7A06_RS01190"; Dbxref "Genbank:WP_000756356.1"; ID "cds-WP_000756356.1"; Name "WP_000756356.1"; Parent "gene-C7A06_RS01190"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000756357.1"; locus_tag "C7A06_RS01190"; product "long polar fimbria major subunit LpfA"; protein_id "WP_000756356.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 228214 228900 . + . gene_id "nbis-gene-202"; ID "nbis-gene-202"; Name "lpfB"; gbkey "Gene"; gene "lpfB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01195"; +NZ_CP027599.1 RefSeq transcript 228214 228900 . + . gene_id "nbis-gene-202"; transcript_id "gene-C7A06_RS01195"; ID "gene-C7A06_RS01195"; Name "lpfB"; Parent "nbis-gene-202"; gbkey "Gene"; gene "lpfB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01195"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 228214 228900 . + . gene_id "nbis-gene-202"; transcript_id "gene-C7A06_RS01195"; Dbxref "Genbank:WP_000822476.1"; ID "nbis-exon-211"; Name "WP_000822476.1"; Parent "gene-C7A06_RS01195"; gbkey "CDS"; gene "lpfB"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000822474.1"; locus_tag "C7A06_RS01195"; product "long polar fimbrial biogenesis chaperone LpfB"; protein_id "WP_000822476.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 228214 228900 . + 0 gene_id "nbis-gene-202"; transcript_id "gene-C7A06_RS01195"; Dbxref "Genbank:WP_000822476.1"; ID "cds-WP_000822476.1"; Name "WP_000822476.1"; Parent "gene-C7A06_RS01195"; gbkey "CDS"; gene "lpfB"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000822474.1"; locus_tag "C7A06_RS01195"; product "long polar fimbrial biogenesis chaperone LpfB"; protein_id "WP_000822476.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 228924 231455 . + . gene_id "nbis-gene-203"; ID "nbis-gene-203"; Name "lpfC"; gbkey "Gene"; gene "lpfC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01200"; +NZ_CP027599.1 RefSeq transcript 228924 231455 . + . gene_id "nbis-gene-203"; transcript_id "gene-C7A06_RS01200"; ID "gene-C7A06_RS01200"; Name "lpfC"; Parent "nbis-gene-203"; gbkey "Gene"; gene "lpfC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01200"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 228924 231455 . + . gene_id "nbis-gene-203"; transcript_id "gene-C7A06_RS01200"; Dbxref "Genbank:WP_000558677.1"; ID "nbis-exon-212"; Name "WP_000558677.1"; Parent "gene-C7A06_RS01200"; gbkey "CDS"; gene "lpfC"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001759518.1"; locus_tag "C7A06_RS01200"; product "outer membrane usher protein LpfC"; protein_id "WP_000558677.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 228924 231455 . + 0 gene_id "nbis-gene-203"; transcript_id "gene-C7A06_RS01200"; Dbxref "Genbank:WP_000558677.1"; ID "cds-WP_000558677.1"; Name "WP_000558677.1"; Parent "gene-C7A06_RS01200"; gbkey "CDS"; gene "lpfC"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001759518.1"; locus_tag "C7A06_RS01200"; product "outer membrane usher protein LpfC"; protein_id "WP_000558677.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 231466 232521 . + . gene_id "nbis-gene-204"; ID "nbis-gene-204"; Name "lpfD"; gbkey "Gene"; gene "lpfD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01205"; +NZ_CP027599.1 RefSeq transcript 231466 232521 . + . gene_id "nbis-gene-204"; transcript_id "gene-C7A06_RS01205"; ID "gene-C7A06_RS01205"; Name "lpfD"; Parent "nbis-gene-204"; gbkey "Gene"; gene "lpfD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01205"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 231466 232521 . + . gene_id "nbis-gene-204"; transcript_id "gene-C7A06_RS01205"; Dbxref "Genbank:WP_000694926.1"; ID "nbis-exon-213"; Name "WP_000694926.1"; Parent "gene-C7A06_RS01205"; gbkey "CDS"; gene "lpfD"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000694923.1"; locus_tag "C7A06_RS01205"; product "long polar fimbrial protein LpfD"; protein_id "WP_000694926.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 231466 232521 . + 0 gene_id "nbis-gene-204"; transcript_id "gene-C7A06_RS01205"; Dbxref "Genbank:WP_000694926.1"; ID "cds-WP_000694926.1"; Name "WP_000694926.1"; Parent "gene-C7A06_RS01205"; gbkey "CDS"; gene "lpfD"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000694923.1"; locus_tag "C7A06_RS01205"; product "long polar fimbrial protein LpfD"; protein_id "WP_000694926.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 232527 233051 . + . gene_id "nbis-gene-205"; ID "nbis-gene-205"; Name "lpfE"; gbkey "Gene"; gene "lpfE"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01210"; +NZ_CP027599.1 RefSeq transcript 232527 233051 . + . gene_id "nbis-gene-205"; transcript_id "gene-C7A06_RS01210"; ID "gene-C7A06_RS01210"; Name "lpfE"; Parent "nbis-gene-205"; gbkey "Gene"; gene "lpfE"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01210"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 232527 233051 . + . gene_id "nbis-gene-205"; transcript_id "gene-C7A06_RS01210"; Dbxref "Genbank:WP_000831422.1"; ID "nbis-exon-214"; Name "WP_000831422.1"; Parent "gene-C7A06_RS01210"; gbkey "CDS"; gene "lpfE"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000792957.1"; locus_tag "C7A06_RS01210"; product "long polar fimbrial protein LpfE"; protein_id "WP_000831422.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 232527 233051 . + 0 gene_id "nbis-gene-205"; transcript_id "gene-C7A06_RS01210"; Dbxref "Genbank:WP_000831422.1"; ID "cds-WP_000831422.1"; Name "WP_000831422.1"; Parent "gene-C7A06_RS01210"; gbkey "CDS"; gene "lpfE"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000792957.1"; locus_tag "C7A06_RS01210"; product "long polar fimbrial protein LpfE"; protein_id "WP_000831422.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 233304 234995 . + . gene_id "nbis-gene-206"; ID "nbis-gene-206"; Name "eptB"; gbkey "Gene"; gene "eptB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01215"; +NZ_CP027599.1 RefSeq transcript 233304 234995 . + . gene_id "nbis-gene-206"; transcript_id "gene-C7A06_RS01215"; ID "gene-C7A06_RS01215"; Name "eptB"; Parent "nbis-gene-206"; gbkey "Gene"; gene "eptB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01215"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 233304 234995 . + . gene_id "nbis-gene-206"; transcript_id "gene-C7A06_RS01215"; Dbxref "Genbank:WP_001269224.1"; ID "nbis-exon-215"; Name "WP_001269224.1"; Ontology_term "GO:0008484"; Parent "gene-C7A06_RS01215"; gbkey "CDS"; gene "eptB"; go_function "sulfuric ester hydrolase activity|0008484||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418002.2"; locus_tag "C7A06_RS01215"; product "kdo(2)-lipid A phosphoethanolamine 7''-transferase"; protein_id "WP_001269224.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 233304 234995 . + 0 gene_id "nbis-gene-206"; transcript_id "gene-C7A06_RS01215"; Dbxref "Genbank:WP_001269224.1"; ID "cds-WP_001269224.1"; Name "WP_001269224.1"; Ontology_term "GO:0008484"; Parent "gene-C7A06_RS01215"; gbkey "CDS"; gene "eptB"; go_function "sulfuric ester hydrolase activity|0008484||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418002.2"; locus_tag "C7A06_RS01215"; product "kdo(2)-lipid A phosphoethanolamine 7''-transferase"; protein_id "WP_001269224.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 235087 235163 . + . gene_id "gene-C7A06_RS01220"; ID "gene-C7A06_RS01220"; Name "C7A06_RS01220"; gbkey "Gene"; gene_biotype "tRNA"; locus_tag "C7A06_RS01220"; +NZ_CP027599.1 tRNAscan-SE transcript 235087 235163 . + . gene_id "gene-C7A06_RS01220"; transcript_id "rna-C7A06_RS01220"; ID "rna-C7A06_RS01220"; Parent "gene-C7A06_RS01220"; anticodon "(pos:235121..235123)"; gbkey "tRNA"; inference "COORDINATES: profile:tRNAscan-SE:2.0.7"; locus_tag "C7A06_RS01220"; original_biotype "trna"; product "tRNA-Pro"; +NZ_CP027599.1 tRNAscan-SE exon 235087 235163 . + . gene_id "gene-C7A06_RS01220"; transcript_id "rna-C7A06_RS01220"; ID "exon-C7A06_RS01220-1"; Parent "rna-C7A06_RS01220"; anticodon "(pos:235121..235123)"; gbkey "tRNA"; inference "COORDINATES: profile:tRNAscan-SE:2.0.7"; locus_tag "C7A06_RS01220"; product "tRNA-Pro"; +NZ_CP027599.1 RefSeq gene 235198 235331 . + . gene_id "gene-C7A06_RS01225"; ID "gene-C7A06_RS01225"; Name "C7A06_RS01225"; gbkey "Gene"; gene_biotype "ncRNA"; locus_tag "C7A06_RS01225"; +NZ_CP027599.1 cmsearch transcript 235198 235331 . + . gene_id "gene-C7A06_RS01225"; transcript_id "rna-C7A06_RS01225"; Dbxref "RFAM:RF00391"; ID "rna-C7A06_RS01225"; Note "rtT sRNA, processed from tyrT transcript"; Parent "gene-C7A06_RS01225"; gbkey "ncRNA"; inference "COORDINATES: profile:INFERNAL:1.1.1"; locus_tag "C7A06_RS01225"; original_biotype "ncrna"; product "RtT sRNA"; +NZ_CP027599.1 cmsearch exon 235198 235331 . + . gene_id "gene-C7A06_RS01225"; transcript_id "rna-C7A06_RS01225"; Dbxref "RFAM:RF00391"; ID "exon-C7A06_RS01225-1"; Note "rtT sRNA, processed from tyrT transcript"; Parent "rna-C7A06_RS01225"; gbkey "ncRNA"; inference "COORDINATES: profile:INFERNAL:1.1.1"; locus_tag "C7A06_RS01225"; product "RtT sRNA"; +NZ_CP027599.1 RefSeq gene 235531 236511 . - . gene_id "nbis-gene-207"; ID "nbis-gene-207"; Name "C7A06_RS01235"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01235"; +NZ_CP027599.1 RefSeq transcript 235531 236511 . - . gene_id "nbis-gene-207"; transcript_id "gene-C7A06_RS01235"; ID "gene-C7A06_RS01235"; Name "C7A06_RS01235"; Parent "nbis-gene-207"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01235"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 235531 236511 . - . gene_id "nbis-gene-207"; transcript_id "gene-C7A06_RS01235"; Dbxref "Genbank:WP_000399648.1"; ID "nbis-exon-216"; Name "WP_000399648.1"; Parent "gene-C7A06_RS01235"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_012904434.1"; locus_tag "C7A06_RS01235"; product "IS110-like element IS621 family transposase"; protein_id "WP_000399648.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 235531 236511 . - 0 gene_id "nbis-gene-207"; transcript_id "gene-C7A06_RS01235"; Dbxref "Genbank:WP_000399648.1"; ID "cds-WP_000399648.1"; Name "WP_000399648.1"; Parent "gene-C7A06_RS01235"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_012904434.1"; locus_tag "C7A06_RS01235"; product "IS110-like element IS621 family transposase"; protein_id "WP_000399648.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 236503 237003 . + . gene_id "nbis-gene-5830"; ID "nbis-gene-5830"; Name "C7A06_RS34810"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS34810"; +NZ_CP027599.1 RefSeq transcript 236503 237003 . + . gene_id "nbis-gene-5830"; transcript_id "gene-C7A06_RS34810"; ID "gene-C7A06_RS34810"; Name "C7A06_RS34810"; Parent "nbis-gene-5830"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS34810"; original_biotype "mrna"; +NZ_CP027599.1 GeneMarkS-2+ exon 236503 237003 . + . gene_id "nbis-gene-5830"; transcript_id "gene-C7A06_RS34810"; Dbxref "Genbank:WP_000469071.1"; ID "nbis-exon-6142"; Name "WP_000469071.1"; Parent "gene-C7A06_RS34810"; gbkey "CDS"; inference "COORDINATES: ab initio prediction:GeneMarkS-2+"; locus_tag "C7A06_RS34810"; product "hypothetical protein"; protein_id "WP_000469071.1"; transl_table "11"; +NZ_CP027599.1 GeneMarkS-2+ CDS 236503 237003 . + 0 gene_id "nbis-gene-5830"; transcript_id "gene-C7A06_RS34810"; Dbxref "Genbank:WP_000469071.1"; ID "cds-WP_000469071.1"; Name "WP_000469071.1"; Parent "gene-C7A06_RS34810"; gbkey "CDS"; inference "COORDINATES: ab initio prediction:GeneMarkS-2+"; locus_tag "C7A06_RS34810"; product "hypothetical protein"; protein_id "WP_000469071.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 237355 238962 . + . gene_id "nbis-gene-208"; ID "nbis-gene-208"; Name "dppA"; gbkey "Gene"; gene "dppA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01245"; +NZ_CP027599.1 RefSeq transcript 237355 238962 . + . gene_id "nbis-gene-208"; transcript_id "gene-C7A06_RS01245"; ID "gene-C7A06_RS01245"; Name "dppA"; Parent "nbis-gene-208"; gbkey "Gene"; gene "dppA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01245"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 237355 238962 . + . gene_id "nbis-gene-208"; transcript_id "gene-C7A06_RS01245"; Dbxref "Genbank:WP_001222883.1"; ID "nbis-exon-217"; Name "WP_001222883.1"; Parent "gene-C7A06_RS01245"; gbkey "CDS"; gene "dppA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418001.1"; locus_tag "C7A06_RS01245"; product "dipeptide ABC transporter substrate-binding protein DppA"; protein_id "WP_001222883.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 237355 238962 . + 0 gene_id "nbis-gene-208"; transcript_id "gene-C7A06_RS01245"; Dbxref "Genbank:WP_001222883.1"; ID "cds-WP_001222883.1"; Name "WP_001222883.1"; Parent "gene-C7A06_RS01245"; gbkey "CDS"; gene "dppA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418001.1"; locus_tag "C7A06_RS01245"; product "dipeptide ABC transporter substrate-binding protein DppA"; protein_id "WP_001222883.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 239113 240132 . + . gene_id "nbis-gene-209"; ID "nbis-gene-209"; Name "dppB"; gbkey "Gene"; gene "dppB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01255"; +NZ_CP027599.1 RefSeq transcript 239113 240132 . + . gene_id "nbis-gene-209"; transcript_id "gene-C7A06_RS01255"; ID "gene-C7A06_RS01255"; Name "dppB"; Parent "nbis-gene-209"; gbkey "Gene"; gene "dppB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01255"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 239113 240132 . + . gene_id "nbis-gene-209"; transcript_id "gene-C7A06_RS01255"; Dbxref "Genbank:WP_000938864.1"; ID "nbis-exon-218"; Name "WP_000938864.1"; Parent "gene-C7A06_RS01255"; gbkey "CDS"; gene "dppB"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_005133865.1"; locus_tag "C7A06_RS01255"; product "dipeptide ABC transporter permease DppB"; protein_id "WP_000938864.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 239113 240132 . + 0 gene_id "nbis-gene-209"; transcript_id "gene-C7A06_RS01255"; Dbxref "Genbank:WP_000938864.1"; ID "cds-WP_000938864.1"; Name "WP_000938864.1"; Parent "gene-C7A06_RS01255"; gbkey "CDS"; gene "dppB"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_005133865.1"; locus_tag "C7A06_RS01255"; product "dipeptide ABC transporter permease DppB"; protein_id "WP_000938864.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 240142 241044 . + . gene_id "nbis-gene-210"; ID "nbis-gene-210"; Name "dppC"; gbkey "Gene"; gene "dppC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01260"; +NZ_CP027599.1 RefSeq transcript 240142 241044 . + . gene_id "nbis-gene-210"; transcript_id "gene-C7A06_RS01260"; ID "gene-C7A06_RS01260"; Name "dppC"; Parent "nbis-gene-210"; gbkey "Gene"; gene "dppC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01260"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 240142 241044 . + . gene_id "nbis-gene-210"; transcript_id "gene-C7A06_RS01260"; Dbxref "Genbank:WP_000084677.1"; ID "nbis-exon-219"; Name "WP_000084677.1"; Ontology_term "GO:0055085"; Parent "gene-C7A06_RS01260"; gbkey "CDS"; gene "dppC"; go_process "transmembrane transport|0055085||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_010426221.1"; locus_tag "C7A06_RS01260"; product "dipeptide ABC transporter permease DppC"; protein_id "WP_000084677.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 240142 241044 . + 0 gene_id "nbis-gene-210"; transcript_id "gene-C7A06_RS01260"; Dbxref "Genbank:WP_000084677.1"; ID "cds-WP_000084677.1"; Name "WP_000084677.1"; Ontology_term "GO:0055085"; Parent "gene-C7A06_RS01260"; gbkey "CDS"; gene "dppC"; go_process "transmembrane transport|0055085||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_010426221.1"; locus_tag "C7A06_RS01260"; product "dipeptide ABC transporter permease DppC"; protein_id "WP_000084677.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 241055 242038 . + . gene_id "nbis-gene-211"; ID "nbis-gene-211"; Name "dppD"; gbkey "Gene"; gene "dppD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01265"; +NZ_CP027599.1 RefSeq transcript 241055 242038 . + . gene_id "nbis-gene-211"; transcript_id "gene-C7A06_RS01265"; ID "gene-C7A06_RS01265"; Name "dppD"; Parent "nbis-gene-211"; gbkey "Gene"; gene "dppD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01265"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 241055 242038 . + . gene_id "nbis-gene-211"; transcript_id "gene-C7A06_RS01265"; Dbxref "Genbank:WP_001196495.1"; ID "nbis-exon-220"; Name "WP_001196495.1"; Ontology_term "GO:0015833" "GO:0000166" "GO:0005524"; Parent "gene-C7A06_RS01265"; gbkey "CDS"; gene "dppD"; go_function "nucleotide binding|0000166||IEA" "ATP binding|0005524||IEA"; go_process "peptide transport|0015833||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312448.1"; locus_tag "C7A06_RS01265"; product "dipeptide ABC transporter ATP-binding protein"; protein_id "WP_001196495.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 241055 242038 . + 0 gene_id "nbis-gene-211"; transcript_id "gene-C7A06_RS01265"; Dbxref "Genbank:WP_001196495.1"; ID "cds-WP_001196495.1"; Name "WP_001196495.1"; Ontology_term "GO:0015833" "GO:0000166" "GO:0005524"; Parent "gene-C7A06_RS01265"; gbkey "CDS"; gene "dppD"; go_function "nucleotide binding|0000166||IEA" "ATP binding|0005524||IEA"; go_process "peptide transport|0015833||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312448.1"; locus_tag "C7A06_RS01265"; product "dipeptide ABC transporter ATP-binding protein"; protein_id "WP_001196495.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 242035 243039 . + . gene_id "nbis-gene-212"; ID "nbis-gene-212"; Name "dppF"; gbkey "Gene"; gene "dppF"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01270"; +NZ_CP027599.1 RefSeq transcript 242035 243039 . + . gene_id "nbis-gene-212"; transcript_id "gene-C7A06_RS01270"; ID "gene-C7A06_RS01270"; Name "dppF"; Parent "nbis-gene-212"; gbkey "Gene"; gene "dppF"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01270"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 242035 243039 . + . gene_id "nbis-gene-212"; transcript_id "gene-C7A06_RS01270"; Dbxref "Genbank:WP_000107031.1"; ID "nbis-exon-221"; Name "WP_000107031.1"; Parent "gene-C7A06_RS01270"; gbkey "CDS"; gene "dppF"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312447.1"; locus_tag "C7A06_RS01270"; product "dipeptide ABC transporter ATP-binding subunit DppF"; protein_id "WP_000107031.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 242035 243039 . + 0 gene_id "nbis-gene-212"; transcript_id "gene-C7A06_RS01270"; Dbxref "Genbank:WP_000107031.1"; ID "cds-WP_000107031.1"; Name "WP_000107031.1"; Parent "gene-C7A06_RS01270"; gbkey "CDS"; gene "dppF"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312447.1"; locus_tag "C7A06_RS01270"; product "dipeptide ABC transporter ATP-binding subunit DppF"; protein_id "WP_000107031.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 243069 244340 . - . gene_id "nbis-gene-213"; ID "nbis-gene-213"; Name "yhjV"; gbkey "Gene"; gene "yhjV"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01275"; +NZ_CP027599.1 RefSeq transcript 243069 244340 . - . gene_id "nbis-gene-213"; transcript_id "gene-C7A06_RS01275"; ID "gene-C7A06_RS01275"; Name "yhjV"; Parent "nbis-gene-213"; gbkey "Gene"; gene "yhjV"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01275"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 243069 244340 . - . gene_id "nbis-gene-213"; transcript_id "gene-C7A06_RS01275"; Dbxref "Genbank:WP_001296805.1"; ID "nbis-exon-222"; Name "WP_001296805.1"; Parent "gene-C7A06_RS01275"; gbkey "CDS"; gene "yhjV"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417996.1"; locus_tag "C7A06_RS01275"; product "amino acid permease"; protein_id "WP_001296805.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 243069 244340 . - 0 gene_id "nbis-gene-213"; transcript_id "gene-C7A06_RS01275"; Dbxref "Genbank:WP_001296805.1"; ID "cds-WP_001296805.1"; Name "WP_001296805.1"; Parent "gene-C7A06_RS01275"; gbkey "CDS"; gene "yhjV"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417996.1"; locus_tag "C7A06_RS01275"; product "amino acid permease"; protein_id "WP_001296805.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 244816 244923 . + . gene_id "nbis-gene-214"; ID "nbis-gene-214"; Name "C7A06_RS01285"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01285"; +NZ_CP027599.1 RefSeq transcript 244816 244923 . + . gene_id "nbis-gene-214"; transcript_id "gene-C7A06_RS01285"; ID "gene-C7A06_RS01285"; Name "C7A06_RS01285"; Parent "nbis-gene-214"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01285"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 244816 244923 . + . gene_id "nbis-gene-214"; transcript_id "gene-C7A06_RS01285"; Dbxref "Genbank:WP_001295224.1"; ID "nbis-exon-223"; Name "WP_001295224.1"; Parent "gene-C7A06_RS01285"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_009502657.1"; locus_tag "C7A06_RS01285"; product "type I toxin-antitoxin system toxin Ldr family protein"; protein_id "WP_001295224.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 244816 244923 . + 0 gene_id "nbis-gene-214"; transcript_id "gene-C7A06_RS01285"; Dbxref "Genbank:WP_001295224.1"; ID "cds-WP_001295224.1"; Name "WP_001295224.1"; Parent "gene-C7A06_RS01285"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_009502657.1"; locus_tag "C7A06_RS01285"; product "type I toxin-antitoxin system toxin Ldr family protein"; protein_id "WP_001295224.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 245299 245406 . + . gene_id "nbis-gene-5707"; ID "nbis-gene-5707"; Name "C7A06_RS33915"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33915"; +NZ_CP027599.1 RefSeq transcript 245299 245406 . + . gene_id "nbis-gene-5707"; transcript_id "gene-C7A06_RS33915"; ID "gene-C7A06_RS33915"; Name "C7A06_RS33915"; Parent "nbis-gene-5707"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33915"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 245299 245406 . + . gene_id "nbis-gene-5707"; transcript_id "gene-C7A06_RS33915"; Dbxref "Genbank:WP_001295224.1"; ID "nbis-exon-5989"; Name "WP_001295224.1"; Parent "gene-C7A06_RS33915"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_009502657.1"; locus_tag "C7A06_RS33915"; product "type I toxin-antitoxin system toxin Ldr family protein"; protein_id "WP_001295224.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 245299 245406 . + 0 gene_id "nbis-gene-5707"; transcript_id "gene-C7A06_RS33915"; Dbxref "Genbank:WP_001295224.1"; ID "cds-WP_001295224.1-2"; Name "WP_001295224.1"; Parent "gene-C7A06_RS33915"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_009502657.1"; locus_tag "C7A06_RS33915"; product "type I toxin-antitoxin system toxin Ldr family protein"; protein_id "WP_001295224.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 245782 245889 . + . gene_id "nbis-gene-5708"; ID "nbis-gene-5708"; Name "C7A06_RS33920"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33920"; +NZ_CP027599.1 RefSeq transcript 245782 245889 . + . gene_id "nbis-gene-5708"; transcript_id "gene-C7A06_RS33920"; ID "gene-C7A06_RS33920"; Name "C7A06_RS33920"; Parent "nbis-gene-5708"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS33920"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 245782 245889 . + . gene_id "nbis-gene-5708"; transcript_id "gene-C7A06_RS33920"; Dbxref "Genbank:WP_001295224.1"; ID "nbis-exon-5990"; Name "WP_001295224.1"; Parent "gene-C7A06_RS33920"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_009502657.1"; locus_tag "C7A06_RS33920"; product "type I toxin-antitoxin system toxin Ldr family protein"; protein_id "WP_001295224.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 245782 245889 . + 0 gene_id "nbis-gene-5708"; transcript_id "gene-C7A06_RS33920"; Dbxref "Genbank:WP_001295224.1"; ID "cds-WP_001295224.1-3"; Name "WP_001295224.1"; Parent "gene-C7A06_RS33920"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_009502657.1"; locus_tag "C7A06_RS33920"; product "type I toxin-antitoxin system toxin Ldr family protein"; protein_id "WP_001295224.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 246265 246372 . + . gene_id "nbis-gene-215"; ID "nbis-gene-215"; Name "C7A06_RS01315"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01315"; +NZ_CP027599.1 RefSeq transcript 246265 246372 . + . gene_id "nbis-gene-215"; transcript_id "gene-C7A06_RS01315"; ID "gene-C7A06_RS01315"; Name "C7A06_RS01315"; Parent "nbis-gene-215"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01315"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 246265 246372 . + . gene_id "nbis-gene-215"; transcript_id "gene-C7A06_RS01315"; Dbxref "Genbank:WP_001295224.1"; ID "nbis-exon-224"; Name "WP_001295224.1"; Parent "gene-C7A06_RS01315"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_009502657.1"; locus_tag "C7A06_RS01315"; product "type I toxin-antitoxin system toxin Ldr family protein"; protein_id "WP_001295224.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 246265 246372 . + 0 gene_id "nbis-gene-215"; transcript_id "gene-C7A06_RS01315"; Dbxref "Genbank:WP_001295224.1"; ID "cds-WP_001295224.1-4"; Name "WP_001295224.1"; Parent "gene-C7A06_RS01315"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_009502657.1"; locus_tag "C7A06_RS01315"; product "type I toxin-antitoxin system toxin Ldr family protein"; protein_id "WP_001295224.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 246459 248138 . - . gene_id "nbis-gene-216"; ID "nbis-gene-216"; Name "bcsG"; gbkey "Gene"; gene "bcsG"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01320"; +NZ_CP027599.1 RefSeq transcript 246459 248138 . - . gene_id "nbis-gene-216"; transcript_id "gene-C7A06_RS01320"; ID "gene-C7A06_RS01320"; Name "bcsG"; Parent "nbis-gene-216"; gbkey "Gene"; gene "bcsG"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01320"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 246459 248138 . - . gene_id "nbis-gene-216"; transcript_id "gene-C7A06_RS01320"; Dbxref "Genbank:WP_000191606.1"; ID "nbis-exon-225"; Name "WP_000191606.1"; Ontology_term "GO:0030244" "GO:0003674" "GO:0005575"; Parent "gene-C7A06_RS01320"; gbkey "CDS"; gene "bcsG"; go_component "cellular_component|0005575||IEA"; go_function "molecular_function|0003674||IEA"; go_process "cellulose biosynthetic process|0030244||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312445.1"; locus_tag "C7A06_RS01320"; product "cellulose biosynthesis protein BcsG"; protein_id "WP_000191606.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 246459 248138 . - 0 gene_id "nbis-gene-216"; transcript_id "gene-C7A06_RS01320"; Dbxref "Genbank:WP_000191606.1"; ID "cds-WP_000191606.1"; Name "WP_000191606.1"; Ontology_term "GO:0030244" "GO:0003674" "GO:0005575"; Parent "gene-C7A06_RS01320"; gbkey "CDS"; gene "bcsG"; go_component "cellular_component|0005575||IEA"; go_function "molecular_function|0003674||IEA"; go_process "cellulose biosynthetic process|0030244||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312445.1"; locus_tag "C7A06_RS01320"; product "cellulose biosynthesis protein BcsG"; protein_id "WP_000191606.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 248135 248326 . - . gene_id "nbis-gene-217"; ID "nbis-gene-217"; Name "bcsF"; gbkey "Gene"; gene "bcsF"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01325"; +NZ_CP027599.1 RefSeq transcript 248135 248326 . - . gene_id "nbis-gene-217"; transcript_id "gene-C7A06_RS01325"; ID "gene-C7A06_RS01325"; Name "bcsF"; Parent "nbis-gene-217"; gbkey "Gene"; gene "bcsF"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01325"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 248135 248326 . - . gene_id "nbis-gene-217"; transcript_id "gene-C7A06_RS01325"; Dbxref "Genbank:WP_000988308.1"; ID "nbis-exon-226"; Name "WP_000988308.1"; Ontology_term "GO:0052324" "GO:0003674" "GO:0005575"; Parent "gene-C7A06_RS01325"; gbkey "CDS"; gene "bcsF"; go_component "cellular_component|0005575||IEA"; go_function "molecular_function|0003674||IEA"; go_process "plant-type cell wall cellulose biosynthetic process|0052324||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417994.2"; locus_tag "C7A06_RS01325"; product "cellulose biosynthesis protein BcsF"; protein_id "WP_000988308.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 248135 248326 . - 0 gene_id "nbis-gene-217"; transcript_id "gene-C7A06_RS01325"; Dbxref "Genbank:WP_000988308.1"; ID "cds-WP_000988308.1"; Name "WP_000988308.1"; Ontology_term "GO:0052324" "GO:0003674" "GO:0005575"; Parent "gene-C7A06_RS01325"; gbkey "CDS"; gene "bcsF"; go_component "cellular_component|0005575||IEA"; go_function "molecular_function|0003674||IEA"; go_process "plant-type cell wall cellulose biosynthetic process|0052324||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417994.2"; locus_tag "C7A06_RS01325"; product "cellulose biosynthesis protein BcsF"; protein_id "WP_000988308.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 248323 249894 . - . gene_id "nbis-gene-218"; ID "nbis-gene-218"; Name "bcsE"; gbkey "Gene"; gene "bcsE"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01330"; +NZ_CP027599.1 RefSeq transcript 248323 249894 . - . gene_id "nbis-gene-218"; transcript_id "gene-C7A06_RS01330"; ID "gene-C7A06_RS01330"; Name "bcsE"; Parent "nbis-gene-218"; gbkey "Gene"; gene "bcsE"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01330"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 248323 249894 . - . gene_id "nbis-gene-218"; transcript_id "gene-C7A06_RS01330"; Dbxref "Genbank:WP_001204931.1"; ID "nbis-exon-227"; Name "WP_001204931.1"; Ontology_term "GO:0035438"; Parent "gene-C7A06_RS01330"; gbkey "CDS"; gene "bcsE"; go_function "cyclic-di-GMP binding|0035438||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417993.1"; locus_tag "C7A06_RS01330"; product "cellulose biosynthesis protein BcsE"; protein_id "WP_001204931.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 248323 249894 . - 0 gene_id "nbis-gene-218"; transcript_id "gene-C7A06_RS01330"; Dbxref "Genbank:WP_001204931.1"; ID "cds-WP_001204931.1"; Name "WP_001204931.1"; Ontology_term "GO:0035438"; Parent "gene-C7A06_RS01330"; gbkey "CDS"; gene "bcsE"; go_function "cyclic-di-GMP binding|0035438||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417993.1"; locus_tag "C7A06_RS01330"; product "cellulose biosynthesis protein BcsE"; protein_id "WP_001204931.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 250167 250355 . + . gene_id "nbis-gene-219"; ID "nbis-gene-219"; Name "bcsR"; gbkey "Gene"; gene "bcsR"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01335"; +NZ_CP027599.1 RefSeq transcript 250167 250355 . + . gene_id "nbis-gene-219"; transcript_id "gene-C7A06_RS01335"; ID "gene-C7A06_RS01335"; Name "bcsR"; Parent "nbis-gene-219"; gbkey "Gene"; gene "bcsR"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01335"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 250167 250355 . + . gene_id "nbis-gene-219"; transcript_id "gene-C7A06_RS01335"; Dbxref "Genbank:WP_001063318.1"; ID "nbis-exon-228"; Name "WP_001063318.1"; Parent "gene-C7A06_RS01335"; gbkey "CDS"; gene "bcsR"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417992.1"; locus_tag "C7A06_RS01335"; product "cellulose biosynthesis protein BcsR"; protein_id "WP_001063318.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 250167 250355 . + 0 gene_id "nbis-gene-219"; transcript_id "gene-C7A06_RS01335"; Dbxref "Genbank:WP_001063318.1"; ID "cds-WP_001063318.1"; Name "WP_001063318.1"; Parent "gene-C7A06_RS01335"; gbkey "CDS"; gene "bcsR"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417992.1"; locus_tag "C7A06_RS01335"; product "cellulose biosynthesis protein BcsR"; protein_id "WP_001063318.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 250367 251119 . + . gene_id "nbis-gene-220"; ID "nbis-gene-220"; Name "bcsQ"; gbkey "Gene"; gene "bcsQ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01340"; +NZ_CP027599.1 RefSeq transcript 250367 251119 . + . gene_id "nbis-gene-220"; transcript_id "gene-C7A06_RS01340"; ID "gene-C7A06_RS01340"; Name "bcsQ"; Parent "nbis-gene-220"; gbkey "Gene"; gene "bcsQ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01340"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 250367 251119 . + . gene_id "nbis-gene-220"; transcript_id "gene-C7A06_RS01340"; Dbxref "Genbank:WP_000279530.1"; ID "nbis-exon-229"; Name "WP_000279530.1"; Parent "gene-C7A06_RS01340"; gbkey "CDS"; gene "bcsQ"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709309.1"; locus_tag "C7A06_RS01340"; product "cellulose biosynthesis protein BcsQ"; protein_id "WP_000279530.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 250367 251119 . + 0 gene_id "nbis-gene-220"; transcript_id "gene-C7A06_RS01340"; Dbxref "Genbank:WP_000279530.1"; ID "cds-WP_000279530.1"; Name "WP_000279530.1"; Parent "gene-C7A06_RS01340"; gbkey "CDS"; gene "bcsQ"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709309.1"; locus_tag "C7A06_RS01340"; product "cellulose biosynthesis protein BcsQ"; protein_id "WP_000279530.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 251116 253734 . + . gene_id "nbis-gene-221"; ID "nbis-gene-221"; Name "bcsA"; gbkey "Gene"; gene "bcsA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01345"; +NZ_CP027599.1 RefSeq transcript 251116 253734 . + . gene_id "nbis-gene-221"; transcript_id "gene-C7A06_RS01345"; ID "gene-C7A06_RS01345"; Name "bcsA"; Parent "nbis-gene-221"; gbkey "Gene"; gene "bcsA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01345"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 251116 253734 . + . gene_id "nbis-gene-221"; transcript_id "gene-C7A06_RS01345"; Dbxref "Genbank:WP_000025892.1"; ID "nbis-exon-230"; Name "WP_000025892.1"; Ontology_term "GO:0006011" "GO:0030244" "GO:0016760" "GO:0035438" "GO:0016020"; Parent "gene-C7A06_RS01345"; gbkey "CDS"; gene "bcsA"; go_component "membrane|0016020||IEA"; go_function "cellulose synthase (UDP-forming) activity|0016760||IEA" "cyclic-di-GMP binding|0035438||IEA"; go_process "UDP-glucose metabolic process|0006011||IEA" "cellulose biosynthetic process|0030244||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417990.4"; locus_tag "C7A06_RS01345"; product "UDP-forming cellulose synthase catalytic subunit"; protein_id "WP_000025892.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 251116 253734 . + 0 gene_id "nbis-gene-221"; transcript_id "gene-C7A06_RS01345"; Dbxref "Genbank:WP_000025892.1"; ID "cds-WP_000025892.1"; Name "WP_000025892.1"; Ontology_term "GO:0006011" "GO:0030244" "GO:0016760" "GO:0035438" "GO:0016020"; Parent "gene-C7A06_RS01345"; gbkey "CDS"; gene "bcsA"; go_component "membrane|0016020||IEA"; go_function "cellulose synthase (UDP-forming) activity|0016760||IEA" "cyclic-di-GMP binding|0035438||IEA"; go_process "UDP-glucose metabolic process|0006011||IEA" "cellulose biosynthetic process|0030244||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417990.4"; locus_tag "C7A06_RS01345"; product "UDP-forming cellulose synthase catalytic subunit"; protein_id "WP_000025892.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 253745 256084 . + . gene_id "nbis-gene-222"; ID "nbis-gene-222"; Name "bcsB"; gbkey "Gene"; gene "bcsB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01350"; +NZ_CP027599.1 RefSeq transcript 253745 256084 . + . gene_id "nbis-gene-222"; transcript_id "gene-C7A06_RS01350"; ID "gene-C7A06_RS01350"; Name "bcsB"; Parent "nbis-gene-222"; gbkey "Gene"; gene "bcsB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01350"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 253745 256084 . + . gene_id "nbis-gene-222"; transcript_id "gene-C7A06_RS01350"; Dbxref "Genbank:WP_000823624.1"; ID "nbis-exon-231"; Name "WP_000823624.1"; Parent "gene-C7A06_RS01350"; gbkey "CDS"; gene "bcsB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417989.1"; locus_tag "C7A06_RS01350"; product "cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB"; protein_id "WP_000823624.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 253745 256084 . + 0 gene_id "nbis-gene-222"; transcript_id "gene-C7A06_RS01350"; Dbxref "Genbank:WP_000823624.1"; ID "cds-WP_000823624.1"; Name "WP_000823624.1"; Parent "gene-C7A06_RS01350"; gbkey "CDS"; gene "bcsB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417989.1"; locus_tag "C7A06_RS01350"; product "cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB"; protein_id "WP_000823624.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 256091 257197 . + . gene_id "nbis-gene-223"; ID "nbis-gene-223"; Name "bcsZ"; gbkey "Gene"; gene "bcsZ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01355"; +NZ_CP027599.1 RefSeq transcript 256091 257197 . + . gene_id "nbis-gene-223"; transcript_id "gene-C7A06_RS01355"; ID "gene-C7A06_RS01355"; Name "bcsZ"; Parent "nbis-gene-223"; gbkey "Gene"; gene "bcsZ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01355"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 256091 257197 . + . gene_id "nbis-gene-223"; transcript_id "gene-C7A06_RS01355"; Dbxref "Genbank:WP_001341948.1"; ID "nbis-exon-232"; Name "WP_001341948.1"; Ontology_term "GO:0005975" "GO:0004553"; Parent "gene-C7A06_RS01355"; gbkey "CDS"; gene "bcsZ"; go_function "hydrolase activity, hydrolyzing O-glycosyl compounds|0004553||IEA"; go_process "carbohydrate metabolic process|0005975||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312438.1"; locus_tag "C7A06_RS01355"; product "cellulose synthase complex periplasmic endoglucanase BcsZ"; protein_id "WP_001341948.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 256091 257197 . + 0 gene_id "nbis-gene-223"; transcript_id "gene-C7A06_RS01355"; Dbxref "Genbank:WP_001341948.1"; ID "cds-WP_001341948.1"; Name "WP_001341948.1"; Ontology_term "GO:0005975" "GO:0004553"; Parent "gene-C7A06_RS01355"; gbkey "CDS"; gene "bcsZ"; go_function "hydrolase activity, hydrolyzing O-glycosyl compounds|0004553||IEA"; go_process "carbohydrate metabolic process|0005975||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312438.1"; locus_tag "C7A06_RS01355"; product "cellulose synthase complex periplasmic endoglucanase BcsZ"; protein_id "WP_001341948.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 257179 260652 . + . gene_id "nbis-gene-224"; ID "nbis-gene-224"; Name "bcsC"; gbkey "Gene"; gene "bcsC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01360"; +NZ_CP027599.1 RefSeq transcript 257179 260652 . + . gene_id "nbis-gene-224"; transcript_id "gene-C7A06_RS01360"; ID "gene-C7A06_RS01360"; Name "bcsC"; Parent "nbis-gene-224"; gbkey "Gene"; gene "bcsC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01360"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 257179 260652 . + . gene_id "nbis-gene-224"; transcript_id "gene-C7A06_RS01360"; Dbxref "Genbank:WP_001225108.1"; ID "nbis-exon-233"; Name "WP_001225108.1"; Ontology_term "GO:0030244" "GO:0005515" "GO:0019867"; Parent "gene-C7A06_RS01360"; gbkey "CDS"; gene "bcsC"; go_component "outer membrane|0019867||IEA"; go_function "protein binding|0005515||IEA"; go_process "cellulose biosynthetic process|0030244||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_026226.4"; locus_tag "C7A06_RS01360"; product "cellulose synthase complex outer membrane protein BcsC"; protein_id "WP_001225108.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 257179 260652 . + 0 gene_id "nbis-gene-224"; transcript_id "gene-C7A06_RS01360"; Dbxref "Genbank:WP_001225108.1"; ID "cds-WP_001225108.1"; Name "WP_001225108.1"; Ontology_term "GO:0030244" "GO:0005515" "GO:0019867"; Parent "gene-C7A06_RS01360"; gbkey "CDS"; gene "bcsC"; go_component "outer membrane|0019867||IEA"; go_function "protein binding|0005515||IEA"; go_process "cellulose biosynthetic process|0030244||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_026226.4"; locus_tag "C7A06_RS01360"; product "cellulose synthase complex outer membrane protein BcsC"; protein_id "WP_001225108.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 260734 262722 . + . gene_id "nbis-gene-225"; ID "nbis-gene-225"; Name "hmsP"; gbkey "Gene"; gene "hmsP"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01365"; +NZ_CP027599.1 RefSeq transcript 260734 262722 . + . gene_id "nbis-gene-225"; transcript_id "gene-C7A06_RS01365"; ID "gene-C7A06_RS01365"; Name "hmsP"; Parent "nbis-gene-225"; gbkey "Gene"; gene "hmsP"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01365"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 260734 262722 . + . gene_id "nbis-gene-225"; transcript_id "gene-C7A06_RS01365"; Dbxref "Genbank:WP_001266286.1"; ID "nbis-exon-234"; Name "WP_001266286.1"; Ontology_term "GO:0007165"; Parent "gene-C7A06_RS01365"; gbkey "CDS"; gene "hmsP"; go_process "signal transduction|0007165||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417986.4"; locus_tag "C7A06_RS01365"; product "biofilm formation regulator HmsP"; protein_id "WP_001266286.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 260734 262722 . + 0 gene_id "nbis-gene-225"; transcript_id "gene-C7A06_RS01365"; Dbxref "Genbank:WP_001266286.1"; ID "cds-WP_001266286.1"; Name "WP_001266286.1"; Ontology_term "GO:0007165"; Parent "gene-C7A06_RS01365"; gbkey "CDS"; gene "hmsP"; go_process "signal transduction|0007165||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417986.4"; locus_tag "C7A06_RS01365"; product "biofilm formation regulator HmsP"; protein_id "WP_001266286.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 262905 264191 . + . gene_id "nbis-gene-226"; ID "nbis-gene-226"; Name "dctA"; gbkey "Gene"; gene "dctA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01375"; +NZ_CP027599.1 RefSeq transcript 262905 264191 . + . gene_id "nbis-gene-226"; transcript_id "gene-C7A06_RS01375"; ID "gene-C7A06_RS01375"; Name "dctA"; Parent "nbis-gene-226"; gbkey "Gene"; gene "dctA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01375"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 262905 264191 . + . gene_id "nbis-gene-226"; transcript_id "gene-C7A06_RS01375"; Dbxref "Genbank:WP_044164517.1"; ID "nbis-exon-235"; Name "WP_044164517.1"; Parent "gene-C7A06_RS01375"; gbkey "CDS"; gene "dctA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417985.1"; locus_tag "C7A06_RS01375"; product "C4-dicarboxylate transporter DctC"; protein_id "WP_044164517.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 262905 264191 . + 0 gene_id "nbis-gene-226"; transcript_id "gene-C7A06_RS01375"; Dbxref "Genbank:WP_044164517.1"; ID "cds-WP_044164517.1"; Name "WP_044164517.1"; Parent "gene-C7A06_RS01375"; gbkey "CDS"; gene "dctA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417985.1"; locus_tag "C7A06_RS01375"; product "C4-dicarboxylate transporter DctC"; protein_id "WP_044164517.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 264411 265907 . + . gene_id "nbis-gene-227"; ID "nbis-gene-227"; Name "yhjJ"; gbkey "Gene"; gene "yhjJ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01385"; +NZ_CP027599.1 RefSeq transcript 264411 265907 . + . gene_id "nbis-gene-227"; transcript_id "gene-C7A06_RS01385"; ID "gene-C7A06_RS01385"; Name "yhjJ"; Parent "nbis-gene-227"; gbkey "Gene"; gene "yhjJ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01385"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 264411 265907 . + . gene_id "nbis-gene-227"; transcript_id "gene-C7A06_RS01385"; Dbxref "Genbank:WP_001163135.1"; ID "nbis-exon-236"; Name "WP_001163135.1"; Parent "gene-C7A06_RS01385"; gbkey "CDS"; gene "yhjJ"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312434.1"; locus_tag "C7A06_RS01385"; product "insulinase family protein"; protein_id "WP_001163135.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 264411 265907 . + 0 gene_id "nbis-gene-227"; transcript_id "gene-C7A06_RS01385"; Dbxref "Genbank:WP_001163135.1"; ID "cds-WP_001163135.1"; Name "WP_001163135.1"; Parent "gene-C7A06_RS01385"; gbkey "CDS"; gene "yhjJ"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312434.1"; locus_tag "C7A06_RS01385"; product "insulinase family protein"; protein_id "WP_001163135.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 266003 266932 . - . gene_id "nbis-gene-228"; ID "nbis-gene-228"; Name "kdgK"; gbkey "Gene"; gene "kdgK"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01390"; +NZ_CP027599.1 RefSeq transcript 266003 266932 . - . gene_id "nbis-gene-228"; transcript_id "gene-C7A06_RS01390"; ID "gene-C7A06_RS01390"; Name "kdgK"; Parent "nbis-gene-228"; gbkey "Gene"; gene "kdgK"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01390"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 266003 266932 . - . gene_id "nbis-gene-228"; transcript_id "gene-C7A06_RS01390"; Dbxref "Genbank:WP_001296796.1"; ID "nbis-exon-237"; Name "WP_001296796.1"; Parent "gene-C7A06_RS01390"; gbkey "CDS"; gene "kdgK"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417983.2"; locus_tag "C7A06_RS01390"; product "2-dehydro-3-deoxygluconokinase"; protein_id "WP_001296796.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 266003 266932 . - 0 gene_id "nbis-gene-228"; transcript_id "gene-C7A06_RS01390"; Dbxref "Genbank:WP_001296796.1"; ID "cds-WP_001296796.1"; Name "WP_001296796.1"; Parent "gene-C7A06_RS01390"; gbkey "CDS"; gene "kdgK"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417983.2"; locus_tag "C7A06_RS01390"; product "2-dehydro-3-deoxygluconokinase"; protein_id "WP_001296796.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 267164 267931 . + . gene_id "nbis-gene-229"; ID "nbis-gene-229"; Name "pdeH"; gbkey "Gene"; gene "pdeH"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01400"; +NZ_CP027599.1 RefSeq transcript 267164 267931 . + . gene_id "nbis-gene-229"; transcript_id "gene-C7A06_RS01400"; ID "gene-C7A06_RS01400"; Name "pdeH"; Parent "nbis-gene-229"; gbkey "Gene"; gene "pdeH"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01400"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 267164 267931 . + . gene_id "nbis-gene-229"; transcript_id "gene-C7A06_RS01400"; Dbxref "Genbank:WP_001295219.1"; ID "nbis-exon-238"; Name "WP_001295219.1"; Parent "gene-C7A06_RS01400"; gbkey "CDS"; gene "pdeH"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417982.2"; locus_tag "C7A06_RS01400"; product "cyclic-guanylate-specific phosphodiesterase"; protein_id "WP_001295219.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 267164 267931 . + 0 gene_id "nbis-gene-229"; transcript_id "gene-C7A06_RS01400"; Dbxref "Genbank:WP_001295219.1"; ID "cds-WP_001295219.1"; Name "WP_001295219.1"; Parent "gene-C7A06_RS01400"; gbkey "CDS"; gene "pdeH"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417982.2"; locus_tag "C7A06_RS01400"; product "cyclic-guanylate-specific phosphodiesterase"; protein_id "WP_001295219.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 268001 270061 . + . gene_id "nbis-gene-230"; ID "nbis-gene-230"; Name "yhjG"; gbkey "Gene"; gene "yhjG"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01405"; +NZ_CP027599.1 RefSeq transcript 268001 270061 . + . gene_id "nbis-gene-230"; transcript_id "gene-C7A06_RS01405"; ID "gene-C7A06_RS01405"; Name "yhjG"; Parent "nbis-gene-230"; gbkey "Gene"; gene "yhjG"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01405"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 268001 270061 . + . gene_id "nbis-gene-230"; transcript_id "gene-C7A06_RS01405"; Dbxref "Genbank:WP_001344892.1"; ID "nbis-exon-239"; Name "WP_001344892.1"; Parent "gene-C7A06_RS01405"; gbkey "CDS"; gene "yhjG"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417981.2"; locus_tag "C7A06_RS01405"; product "AsmA family protein"; protein_id "WP_001344892.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 268001 270061 . + 0 gene_id "nbis-gene-230"; transcript_id "gene-C7A06_RS01405"; Dbxref "Genbank:WP_001344892.1"; ID "cds-WP_001344892.1"; Name "WP_001344892.1"; Parent "gene-C7A06_RS01405"; gbkey "CDS"; gene "yhjG"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417981.2"; locus_tag "C7A06_RS01405"; product "AsmA family protein"; protein_id "WP_001344892.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 270295 271617 . - . gene_id "nbis-gene-231"; ID "nbis-gene-231"; Name "yhjE"; gbkey "Gene"; gene "yhjE"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01410"; +NZ_CP027599.1 RefSeq transcript 270295 271617 . - . gene_id "nbis-gene-231"; transcript_id "gene-C7A06_RS01410"; ID "gene-C7A06_RS01410"; Name "yhjE"; Parent "nbis-gene-231"; gbkey "Gene"; gene "yhjE"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01410"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 270295 271617 . - . gene_id "nbis-gene-231"; transcript_id "gene-C7A06_RS01410"; Dbxref "Genbank:WP_001149002.1"; ID "nbis-exon-240"; Name "WP_001149002.1"; Parent "gene-C7A06_RS01410"; gbkey "CDS"; gene "yhjE"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417980.1"; locus_tag "C7A06_RS01410"; product "MHS family MFS transporter"; protein_id "WP_001149002.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 270295 271617 . - 0 gene_id "nbis-gene-231"; transcript_id "gene-C7A06_RS01410"; Dbxref "Genbank:WP_001149002.1"; ID "cds-WP_001149002.1"; Name "WP_001149002.1"; Parent "gene-C7A06_RS01410"; gbkey "CDS"; gene "yhjE"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417980.1"; locus_tag "C7A06_RS01410"; product "MHS family MFS transporter"; protein_id "WP_001149002.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 272028 273041 . - . gene_id "nbis-gene-232"; ID "nbis-gene-232"; Name "yhjD"; gbkey "Gene"; gene "yhjD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01415"; +NZ_CP027599.1 RefSeq transcript 272028 273041 . - . gene_id "nbis-gene-232"; transcript_id "gene-C7A06_RS01415"; ID "gene-C7A06_RS01415"; Name "yhjD"; Parent "nbis-gene-232"; gbkey "Gene"; gene "yhjD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01415"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 272028 273041 . - . gene_id "nbis-gene-232"; transcript_id "gene-C7A06_RS01415"; Dbxref "Genbank:WP_000191257.1"; ID "nbis-exon-241"; Name "WP_000191257.1"; Parent "gene-C7A06_RS01415"; gbkey "CDS"; gene "yhjD"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312429.1"; locus_tag "C7A06_RS01415"; product "inner membrane protein YhjD"; protein_id "WP_000191257.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 272028 273041 . - 0 gene_id "nbis-gene-232"; transcript_id "gene-C7A06_RS01415"; Dbxref "Genbank:WP_000191257.1"; ID "cds-WP_000191257.1"; Name "WP_000191257.1"; Parent "gene-C7A06_RS01415"; gbkey "CDS"; gene "yhjD"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312429.1"; locus_tag "C7A06_RS01415"; product "inner membrane protein YhjD"; protein_id "WP_000191257.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 273090 273989 . - . gene_id "nbis-gene-233"; ID "nbis-gene-233"; Name "rcdB"; gbkey "Gene"; gene "rcdB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01420"; +NZ_CP027599.1 RefSeq transcript 273090 273989 . - . gene_id "nbis-gene-233"; transcript_id "gene-C7A06_RS01420"; ID "gene-C7A06_RS01420"; Name "rcdB"; Parent "nbis-gene-233"; gbkey "Gene"; gene "rcdB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01420"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 273090 273989 . - . gene_id "nbis-gene-233"; transcript_id "gene-C7A06_RS01420"; Dbxref "Genbank:WP_001307449.1"; ID "nbis-exon-242"; Name "WP_001307449.1"; Parent "gene-C7A06_RS01420"; gbkey "CDS"; gene "rcdB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417978.2"; locus_tag "C7A06_RS01420"; product "LysR family transcriptional regulator"; protein_id "WP_001307449.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 273090 273989 . - 0 gene_id "nbis-gene-233"; transcript_id "gene-C7A06_RS01420"; Dbxref "Genbank:WP_001307449.1"; ID "cds-WP_001307449.1"; Name "WP_001307449.1"; Parent "gene-C7A06_RS01420"; gbkey "CDS"; gene "rcdB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417978.2"; locus_tag "C7A06_RS01420"; product "LysR family transcriptional regulator"; protein_id "WP_001307449.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 274509 275111 . + . gene_id "nbis-gene-234"; ID "nbis-gene-234"; Name "yhjB"; gbkey "Gene"; gene "yhjB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01425"; +NZ_CP027599.1 RefSeq transcript 274509 275111 . + . gene_id "nbis-gene-234"; transcript_id "gene-C7A06_RS01425"; ID "gene-C7A06_RS01425"; Name "yhjB"; Parent "nbis-gene-234"; gbkey "Gene"; gene "yhjB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01425"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 274509 275111 . + . gene_id "nbis-gene-234"; transcript_id "gene-C7A06_RS01425"; Dbxref "Genbank:WP_001167676.1"; ID "nbis-exon-243"; Name "WP_001167676.1"; Parent "gene-C7A06_RS01425"; gbkey "CDS"; gene "yhjB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417977.1"; locus_tag "C7A06_RS01425"; product "response regulator transcription factor"; protein_id "WP_001167676.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 274509 275111 . + 0 gene_id "nbis-gene-234"; transcript_id "gene-C7A06_RS01425"; Dbxref "Genbank:WP_001167676.1"; ID "cds-WP_001167676.1"; Name "WP_001167676.1"; Parent "gene-C7A06_RS01425"; gbkey "CDS"; gene "yhjB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417977.1"; locus_tag "C7A06_RS01425"; product "response regulator transcription factor"; protein_id "WP_001167676.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 275162 276811 . - . gene_id "nbis-gene-235"; ID "nbis-gene-235"; Name "treF"; gbkey "Gene"; gene "treF"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01430"; +NZ_CP027599.1 RefSeq transcript 275162 276811 . - . gene_id "nbis-gene-235"; transcript_id "gene-C7A06_RS01430"; ID "gene-C7A06_RS01430"; Name "treF"; Parent "nbis-gene-235"; gbkey "Gene"; gene "treF"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01430"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 275162 276811 . - . gene_id "nbis-gene-235"; transcript_id "gene-C7A06_RS01430"; Dbxref "Genbank:WP_000934218.1"; ID "nbis-exon-244"; Name "WP_000934218.1"; Parent "gene-C7A06_RS01430"; gbkey "CDS"; gene "treF"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709297.1"; locus_tag "C7A06_RS01430"; product "alpha,alpha-trehalase"; protein_id "WP_000934218.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 275162 276811 . - 0 gene_id "nbis-gene-235"; transcript_id "gene-C7A06_RS01430"; Dbxref "Genbank:WP_000934218.1"; ID "cds-WP_000934218.1"; Name "WP_000934218.1"; Parent "gene-C7A06_RS01430"; gbkey "CDS"; gene "treF"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709297.1"; locus_tag "C7A06_RS01430"; product "alpha,alpha-trehalase"; protein_id "WP_000934218.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 277216 278613 . + . gene_id "nbis-gene-236"; ID "nbis-gene-236"; Name "ccp"; gbkey "Gene"; gene "ccp"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01435"; +NZ_CP027599.1 RefSeq transcript 277216 278613 . + . gene_id "nbis-gene-236"; transcript_id "gene-C7A06_RS01435"; ID "gene-C7A06_RS01435"; Name "ccp"; Parent "nbis-gene-236"; gbkey "Gene"; gene "ccp"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01435"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 277216 278613 . + . gene_id "nbis-gene-236"; transcript_id "gene-C7A06_RS01435"; Dbxref "Genbank:WP_000784821.1"; ID "nbis-exon-245"; Name "WP_000784821.1"; Parent "gene-C7A06_RS01435"; gbkey "CDS"; gene "ccp"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312425.1"; locus_tag "C7A06_RS01435"; product "cytochrome c peroxidase"; protein_id "WP_000784821.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 277216 278613 . + 0 gene_id "nbis-gene-236"; transcript_id "gene-C7A06_RS01435"; Dbxref "Genbank:WP_000784821.1"; ID "cds-WP_000784821.1"; Name "WP_000784821.1"; Parent "gene-C7A06_RS01435"; gbkey "CDS"; gene "ccp"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312425.1"; locus_tag "C7A06_RS01435"; product "cytochrome c peroxidase"; protein_id "WP_000784821.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 278824 280224 . + . gene_id "nbis-gene-237"; ID "nbis-gene-237"; Name "gadA"; gbkey "Gene"; gene "gadA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01440"; +NZ_CP027599.1 RefSeq transcript 278824 280224 . + . gene_id "nbis-gene-237"; transcript_id "gene-C7A06_RS01440"; ID "gene-C7A06_RS01440"; Name "gadA"; Parent "nbis-gene-237"; gbkey "Gene"; gene "gadA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01440"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 278824 280224 . + . gene_id "nbis-gene-237"; transcript_id "gene-C7A06_RS01440"; Dbxref "Genbank:WP_000372240.1"; ID "nbis-exon-246"; Name "WP_000372240.1"; Ontology_term "GO:0006540" "GO:0004351"; Parent "gene-C7A06_RS01440"; gbkey "CDS"; gene "gadA"; go_function "glutamate decarboxylase activity|0004351||IEA"; go_process "glutamate decarboxylation to succinate|0006540||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417974.1"; locus_tag "C7A06_RS01440"; product "glutamate decarboxylase"; protein_id "WP_000372240.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 278824 280224 . + 0 gene_id "nbis-gene-237"; transcript_id "gene-C7A06_RS01440"; Dbxref "Genbank:WP_000372240.1"; ID "cds-WP_000372240.1"; Name "WP_000372240.1"; Ontology_term "GO:0006540" "GO:0004351"; Parent "gene-C7A06_RS01440"; gbkey "CDS"; gene "gadA"; go_function "glutamate decarboxylase activity|0004351||IEA"; go_process "glutamate decarboxylation to succinate|0006540||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417974.1"; locus_tag "C7A06_RS01440"; product "glutamate decarboxylase"; protein_id "WP_000372240.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 280594 281418 . + . gene_id "nbis-gene-238"; ID "nbis-gene-238"; Name "gadX"; gbkey "Gene"; gene "gadX"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01445"; +NZ_CP027599.1 RefSeq transcript 280594 281418 . + . gene_id "nbis-gene-238"; transcript_id "gene-C7A06_RS01445"; ID "gene-C7A06_RS01445"; Name "gadX"; Parent "nbis-gene-238"; gbkey "Gene"; gene "gadX"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01445"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 280594 281418 . + . gene_id "nbis-gene-238"; transcript_id "gene-C7A06_RS01445"; Dbxref "Genbank:WP_001191068.1"; ID "nbis-exon-247"; Name "WP_001191068.1"; Parent "gene-C7A06_RS01445"; gbkey "CDS"; gene "gadX"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709339.1"; locus_tag "C7A06_RS01445"; product "acid resistance transcriptional activator GadX"; protein_id "WP_001191068.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 280594 281418 . + 0 gene_id "nbis-gene-238"; transcript_id "gene-C7A06_RS01445"; Dbxref "Genbank:WP_001191068.1"; ID "cds-WP_001191068.1"; Name "WP_001191068.1"; Parent "gene-C7A06_RS01445"; gbkey "CDS"; gene "gadX"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709339.1"; locus_tag "C7A06_RS01445"; product "acid resistance transcriptional activator GadX"; protein_id "WP_001191068.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 281786 282514 . + . gene_id "nbis-gene-239"; ID "nbis-gene-239"; Name "gadW"; gbkey "Gene"; gene "gadW"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01450"; +NZ_CP027599.1 RefSeq transcript 281786 282514 . + . gene_id "nbis-gene-239"; transcript_id "gene-C7A06_RS01450"; ID "gene-C7A06_RS01450"; Name "gadW"; Parent "nbis-gene-239"; gbkey "Gene"; gene "gadW"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01450"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 281786 282514 . + . gene_id "nbis-gene-239"; transcript_id "gene-C7A06_RS01450"; Dbxref "Genbank:WP_000149991.1"; ID "nbis-exon-248"; Name "WP_000149991.1"; Parent "gene-C7A06_RS01450"; gbkey "CDS"; gene "gadW"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312422.1"; locus_tag "C7A06_RS01450"; product "acid resistance transcriptional activator GadW"; protein_id "WP_000149991.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 281786 282514 . + 0 gene_id "nbis-gene-239"; transcript_id "gene-C7A06_RS01450"; Dbxref "Genbank:WP_000149991.1"; ID "cds-WP_000149991.1"; Name "WP_000149991.1"; Parent "gene-C7A06_RS01450"; gbkey "CDS"; gene "gadW"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312422.1"; locus_tag "C7A06_RS01450"; product "acid resistance transcriptional activator GadW"; protein_id "WP_000149991.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 282877 285990 . - . gene_id "nbis-gene-240"; ID "nbis-gene-240"; Name "mdtF"; gbkey "Gene"; gene "mdtF"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01460"; +NZ_CP027599.1 RefSeq transcript 282877 285990 . - . gene_id "nbis-gene-240"; transcript_id "gene-C7A06_RS01460"; ID "gene-C7A06_RS01460"; Name "mdtF"; Parent "nbis-gene-240"; gbkey "Gene"; gene "mdtF"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01460"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 282877 285990 . - . gene_id "nbis-gene-240"; transcript_id "gene-C7A06_RS01460"; Dbxref "Genbank:WP_000024892.1"; ID "nbis-exon-249"; Name "WP_000024892.1"; Parent "gene-C7A06_RS01460"; gbkey "CDS"; gene "mdtF"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312421.1"; locus_tag "C7A06_RS01460"; product "multidrug efflux pump RND permease MdtF"; protein_id "WP_000024892.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 282877 285990 . - 0 gene_id "nbis-gene-240"; transcript_id "gene-C7A06_RS01460"; Dbxref "Genbank:WP_000024892.1"; ID "cds-WP_000024892.1"; Name "WP_000024892.1"; Parent "gene-C7A06_RS01460"; gbkey "CDS"; gene "mdtF"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312421.1"; locus_tag "C7A06_RS01460"; product "multidrug efflux pump RND permease MdtF"; protein_id "WP_000024892.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 286015 287172 . - . gene_id "nbis-gene-241"; ID "nbis-gene-241"; Name "mdtE"; gbkey "Gene"; gene "mdtE"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01465"; +NZ_CP027599.1 RefSeq transcript 286015 287172 . - . gene_id "nbis-gene-241"; transcript_id "gene-C7A06_RS01465"; ID "gene-C7A06_RS01465"; Name "mdtE"; Parent "nbis-gene-241"; gbkey "Gene"; gene "mdtE"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01465"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 286015 287172 . - . gene_id "nbis-gene-241"; transcript_id "gene-C7A06_RS01465"; Dbxref "Genbank:WP_001081984.1"; ID "nbis-exon-250"; Name "WP_001081984.1"; Parent "gene-C7A06_RS01465"; gbkey "CDS"; gene "mdtE"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417970.1"; locus_tag "C7A06_RS01465"; product "multidrug transporter subunit MdtE"; protein_id "WP_001081984.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 286015 287172 . - 0 gene_id "nbis-gene-241"; transcript_id "gene-C7A06_RS01465"; Dbxref "Genbank:WP_001081984.1"; ID "cds-WP_001081984.1"; Name "WP_001081984.1"; Parent "gene-C7A06_RS01465"; gbkey "CDS"; gene "mdtE"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417970.1"; locus_tag "C7A06_RS01465"; product "multidrug transporter subunit MdtE"; protein_id "WP_001081984.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 287232 287510 . + . gene_id "nbis-gene-242"; ID "nbis-gene-242"; Name "C7A06_RS01470"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01470"; +NZ_CP027599.1 RefSeq transcript 287232 287510 . + . gene_id "nbis-gene-242"; transcript_id "gene-C7A06_RS01470"; ID "gene-C7A06_RS01470"; Name "C7A06_RS01470"; Parent "nbis-gene-242"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01470"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 287232 287510 . + . gene_id "nbis-gene-242"; transcript_id "gene-C7A06_RS01470"; Dbxref "Genbank:WP_001205329.1"; ID "nbis-exon-251"; Name "WP_001205329.1"; Parent "gene-C7A06_RS01470"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_009502656.1"; locus_tag "C7A06_RS01470"; product "hypothetical protein"; protein_id "WP_001205329.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 287232 287510 . + 0 gene_id "nbis-gene-242"; transcript_id "gene-C7A06_RS01470"; Dbxref "Genbank:WP_001205329.1"; ID "cds-WP_001205329.1"; Name "WP_001205329.1"; Parent "gene-C7A06_RS01470"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_009502656.1"; locus_tag "C7A06_RS01470"; product "hypothetical protein"; protein_id "WP_001205329.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 287511 288038 . - . gene_id "nbis-gene-243"; ID "nbis-gene-243"; Name "gadE"; gbkey "Gene"; gene "gadE"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01475"; +NZ_CP027599.1 RefSeq transcript 287511 288038 . - . gene_id "nbis-gene-243"; transcript_id "gene-C7A06_RS01475"; ID "gene-C7A06_RS01475"; Name "gadE"; Parent "nbis-gene-243"; gbkey "Gene"; gene "gadE"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01475"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 287511 288038 . - . gene_id "nbis-gene-243"; transcript_id "gene-C7A06_RS01475"; Dbxref "Genbank:WP_000576690.1"; ID "nbis-exon-252"; Name "WP_000576690.1"; Parent "gene-C7A06_RS01475"; gbkey "CDS"; gene "gadE"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312419.1"; locus_tag "C7A06_RS01475"; product "acid resistance transcriptional activator GadE"; protein_id "WP_000576690.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 287511 288038 . - 0 gene_id "nbis-gene-243"; transcript_id "gene-C7A06_RS01475"; Dbxref "Genbank:WP_000576690.1"; ID "cds-WP_000576690.1"; Name "WP_000576690.1"; Parent "gene-C7A06_RS01475"; gbkey "CDS"; gene "gadE"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312419.1"; locus_tag "C7A06_RS01475"; product "acid resistance transcriptional activator GadE"; protein_id "WP_000576690.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 288837 289409 . - . gene_id "nbis-gene-244"; ID "nbis-gene-244"; Name "hdeD"; gbkey "Gene"; gene "hdeD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01480"; +NZ_CP027599.1 RefSeq transcript 288837 289409 . - . gene_id "nbis-gene-244"; transcript_id "gene-C7A06_RS01480"; ID "gene-C7A06_RS01480"; Name "hdeD"; Parent "nbis-gene-244"; gbkey "Gene"; gene "hdeD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01480"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 288837 289409 . - . gene_id "nbis-gene-244"; transcript_id "gene-C7A06_RS01480"; Dbxref "Genbank:WP_000965672.1"; ID "nbis-exon-253"; Name "WP_000965672.1"; Parent "gene-C7A06_RS01480"; gbkey "CDS"; gene "hdeD"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312418.1"; locus_tag "C7A06_RS01480"; product "acid-resistance protein HdeD"; protein_id "WP_000965672.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 288837 289409 . - 0 gene_id "nbis-gene-244"; transcript_id "gene-C7A06_RS01480"; Dbxref "Genbank:WP_000965672.1"; ID "cds-WP_000965672.1"; Name "WP_000965672.1"; Parent "gene-C7A06_RS01480"; gbkey "CDS"; gene "hdeD"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312418.1"; locus_tag "C7A06_RS01480"; product "acid-resistance protein HdeD"; protein_id "WP_000965672.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 289664 289996 . + . gene_id "nbis-gene-245"; ID "nbis-gene-245"; Name "hdeA"; gbkey "Gene"; gene "hdeA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01485"; +NZ_CP027599.1 RefSeq transcript 289664 289996 . + . gene_id "nbis-gene-245"; transcript_id "gene-C7A06_RS01485"; ID "gene-C7A06_RS01485"; Name "hdeA"; Parent "nbis-gene-245"; gbkey "Gene"; gene "hdeA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01485"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 289664 289996 . + . gene_id "nbis-gene-245"; transcript_id "gene-C7A06_RS01485"; Dbxref "Genbank:WP_000756550.1"; ID "nbis-exon-254"; Name "WP_000756550.1"; Parent "gene-C7A06_RS01485"; gbkey "CDS"; gene "hdeA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312417.1"; locus_tag "C7A06_RS01485"; product "acid-activated periplasmic chaperone HdeA"; protein_id "WP_000756550.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 289664 289996 . + 0 gene_id "nbis-gene-245"; transcript_id "gene-C7A06_RS01485"; Dbxref "Genbank:WP_000756550.1"; ID "cds-WP_000756550.1"; Name "WP_000756550.1"; Parent "gene-C7A06_RS01485"; gbkey "CDS"; gene "hdeA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312417.1"; locus_tag "C7A06_RS01485"; product "acid-activated periplasmic chaperone HdeA"; protein_id "WP_000756550.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 290112 290438 . + . gene_id "nbis-gene-246"; ID "nbis-gene-246"; Name "hdeB"; gbkey "Gene"; gene "hdeB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01490"; +NZ_CP027599.1 RefSeq transcript 290112 290438 . + . gene_id "nbis-gene-246"; transcript_id "gene-C7A06_RS01490"; ID "gene-C7A06_RS01490"; Name "hdeB"; Parent "nbis-gene-246"; gbkey "Gene"; gene "hdeB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01490"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 290112 290438 . + . gene_id "nbis-gene-246"; transcript_id "gene-C7A06_RS01490"; Dbxref "Genbank:WP_001298717.1"; ID "nbis-exon-255"; Name "WP_001298717.1"; Parent "gene-C7A06_RS01490"; gbkey "CDS"; gene "hdeB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417966.4"; locus_tag "C7A06_RS01490"; product "acid-activated periplasmic chaperone HdeB"; protein_id "WP_001298717.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 290112 290438 . + 0 gene_id "nbis-gene-246"; transcript_id "gene-C7A06_RS01490"; Dbxref "Genbank:WP_001298717.1"; ID "cds-WP_001298717.1"; Name "WP_001298717.1"; Parent "gene-C7A06_RS01490"; gbkey "CDS"; gene "hdeB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417966.4"; locus_tag "C7A06_RS01490"; product "acid-activated periplasmic chaperone HdeB"; protein_id "WP_001298717.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 290502 291149 . + . gene_id "nbis-gene-247"; ID "nbis-gene-247"; Name "yhiD"; gbkey "Gene"; gene "yhiD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01495"; +NZ_CP027599.1 RefSeq transcript 290502 291149 . + . gene_id "nbis-gene-247"; transcript_id "gene-C7A06_RS01495"; ID "gene-C7A06_RS01495"; Name "yhiD"; Parent "nbis-gene-247"; gbkey "Gene"; gene "yhiD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01495"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 290502 291149 . + . gene_id "nbis-gene-247"; transcript_id "gene-C7A06_RS01495"; Dbxref "Genbank:WP_001341943.1"; ID "nbis-exon-256"; Name "WP_001341943.1"; Parent "gene-C7A06_RS01495"; gbkey "CDS"; gene "yhiD"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417965.1"; locus_tag "C7A06_RS01495"; product "MgtC/SapB family protein"; protein_id "WP_001341943.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 290502 291149 . + 0 gene_id "nbis-gene-247"; transcript_id "gene-C7A06_RS01495"; Dbxref "Genbank:WP_001341943.1"; ID "cds-WP_001341943.1"; Name "WP_001341943.1"; Parent "gene-C7A06_RS01495"; gbkey "CDS"; gene "yhiD"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417965.1"; locus_tag "C7A06_RS01495"; product "MgtC/SapB family protein"; protein_id "WP_001341943.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 291191 291721 . - . gene_id "nbis-gene-248"; ID "nbis-gene-248"; Name "dctR"; gbkey "Gene"; gene "dctR"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01500"; +NZ_CP027599.1 RefSeq transcript 291191 291721 . - . gene_id "nbis-gene-248"; transcript_id "gene-C7A06_RS01500"; ID "gene-C7A06_RS01500"; Name "dctR"; Parent "nbis-gene-248"; gbkey "Gene"; gene "dctR"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01500"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 291191 291721 . - . gene_id "nbis-gene-248"; transcript_id "gene-C7A06_RS01500"; Dbxref "Genbank:WP_000478623.1"; ID "nbis-exon-257"; Name "WP_000478623.1"; Ontology_term "GO:0006355"; Parent "gene-C7A06_RS01500"; gbkey "CDS"; gene "dctR"; go_process "regulation of transcription, DNA-templated|0006355||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709290.2"; locus_tag "C7A06_RS01500"; product "LuxR C-terminal-related transcriptional regulator"; protein_id "WP_000478623.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 291191 291721 . - 0 gene_id "nbis-gene-248"; transcript_id "gene-C7A06_RS01500"; Dbxref "Genbank:WP_000478623.1"; ID "cds-WP_000478623.1"; Name "WP_000478623.1"; Ontology_term "GO:0006355"; Parent "gene-C7A06_RS01500"; gbkey "CDS"; gene "dctR"; go_process "regulation of transcription, DNA-templated|0006355||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709290.2"; locus_tag "C7A06_RS01500"; product "LuxR C-terminal-related transcriptional regulator"; protein_id "WP_000478623.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 291877 292443 . - . gene_id "nbis-gene-249"; ID "nbis-gene-249"; Name "slp"; gbkey "Gene"; gene "slp"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01510"; +NZ_CP027599.1 RefSeq transcript 291877 292443 . - . gene_id "nbis-gene-249"; transcript_id "gene-C7A06_RS01510"; ID "gene-C7A06_RS01510"; Name "slp"; Parent "nbis-gene-249"; gbkey "Gene"; gene "slp"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01510"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 291877 292443 . - . gene_id "nbis-gene-249"; transcript_id "gene-C7A06_RS01510"; Dbxref "Genbank:WP_001057453.1"; ID "nbis-exon-258"; Name "WP_001057453.1"; Parent "gene-C7A06_RS01510"; gbkey "CDS"; gene "slp"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312404.2"; locus_tag "C7A06_RS01510"; product "outer membrane lipoprotein Slp"; protein_id "WP_001057453.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 291877 292443 . - 0 gene_id "nbis-gene-249"; transcript_id "gene-C7A06_RS01510"; Dbxref "Genbank:WP_001057453.1"; ID "cds-WP_001057453.1"; Name "WP_001057453.1"; Parent "gene-C7A06_RS01510"; gbkey "CDS"; gene "slp"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312404.2"; locus_tag "C7A06_RS01510"; product "outer membrane lipoprotein Slp"; protein_id "WP_001057453.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 292798 293913 . - . gene_id "nbis-pseudogene-291"; ID "nbis-pseudogene-291"; Name "C7A06_RS34385"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS34385"; original_biotype "pseudogene"; pseudo "true"; +NZ_CP027599.1 RefSeq transcript 292798 293913 . - . gene_id "nbis-pseudogene-291"; transcript_id "gene-C7A06_RS34385"; ID "gene-C7A06_RS34385"; Name "C7A06_RS34385"; Parent "nbis-pseudogene-291"; gbkey "Gene"; gene_biotype "pseudogene"; locus_tag "C7A06_RS34385"; original_biotype "mrna"; pseudo "true"; +NZ_CP027599.1 Protein Homology exon 292798 293913 . - . gene_id "nbis-pseudogene-291"; transcript_id "gene-C7A06_RS34385"; ID "nbis-exon-6064"; Note "frameshifted; internal stop"; Parent "gene-C7A06_RS34385"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312403.1"; locus_tag "C7A06_RS34385"; product "hypothetical protein"; pseudo "true"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 292798 293913 . - 0 gene_id "nbis-pseudogene-291"; transcript_id "gene-C7A06_RS34385"; ID "cds-C7A06_RS34385"; Note "frameshifted; internal stop"; Parent "gene-C7A06_RS34385"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312403.1"; locus_tag "C7A06_RS34385"; product "hypothetical protein"; pseudo "true"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 294493 295494 . - . gene_id "nbis-gene-250"; ID "nbis-gene-250"; Name "C7A06_RS01520"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01520"; +NZ_CP027599.1 RefSeq transcript 294493 295494 . - . gene_id "nbis-gene-250"; transcript_id "gene-C7A06_RS01520"; ID "gene-C7A06_RS01520"; Name "C7A06_RS01520"; Parent "nbis-gene-250"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01520"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 294493 295494 . - . gene_id "nbis-gene-250"; transcript_id "gene-C7A06_RS01520"; Dbxref "Genbank:WP_000100276.1"; ID "nbis-exon-259"; Name "WP_000100276.1"; Parent "gene-C7A06_RS01520"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000100290.1"; locus_tag "C7A06_RS01520"; product "permease"; protein_id "WP_000100276.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 294493 295494 . - 0 gene_id "nbis-gene-250"; transcript_id "gene-C7A06_RS01520"; Dbxref "Genbank:WP_000100276.1"; ID "cds-WP_000100276.1"; Name "WP_000100276.1"; Parent "gene-C7A06_RS01520"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_000100290.1"; locus_tag "C7A06_RS01520"; product "permease"; protein_id "WP_000100276.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 295601 295897 . + . gene_id "nbis-gene-251"; ID "nbis-gene-251"; Name "C7A06_RS01525"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01525"; +NZ_CP027599.1 RefSeq transcript 295601 295897 . + . gene_id "nbis-gene-251"; transcript_id "gene-C7A06_RS01525"; ID "gene-C7A06_RS01525"; Name "C7A06_RS01525"; Parent "nbis-gene-251"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01525"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 295601 295897 . + . gene_id "nbis-gene-251"; transcript_id "gene-C7A06_RS01525"; Dbxref "Genbank:WP_001175589.1"; ID "nbis-exon-260"; Name "WP_001175589.1"; Parent "gene-C7A06_RS01525"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001465662.1"; locus_tag "C7A06_RS01525"; product "helix-turn-helix domain-containing protein"; protein_id "WP_001175589.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 295601 295897 . + 0 gene_id "nbis-gene-251"; transcript_id "gene-C7A06_RS01525"; Dbxref "Genbank:WP_001175589.1"; ID "cds-WP_001175589.1"; Name "WP_001175589.1"; Parent "gene-C7A06_RS01525"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_001465662.1"; locus_tag "C7A06_RS01525"; product "helix-turn-helix domain-containing protein"; protein_id "WP_001175589.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 296031 296456 . - . gene_id "nbis-gene-252"; ID "nbis-gene-252"; Name "arsC"; gbkey "Gene"; gene "arsC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01530"; +NZ_CP027599.1 RefSeq transcript 296031 296456 . - . gene_id "nbis-gene-252"; transcript_id "gene-C7A06_RS01530"; ID "gene-C7A06_RS01530"; Name "arsC"; Parent "nbis-gene-252"; gbkey "Gene"; gene "arsC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01530"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 296031 296456 . - . gene_id "nbis-gene-252"; transcript_id "gene-C7A06_RS01530"; Dbxref "Genbank:WP_000065769.1"; ID "nbis-exon-261"; Name "WP_000065769.1"; Ontology_term "GO:0008794"; Parent "gene-C7A06_RS01530"; gbkey "CDS"; gene "arsC"; go_function "arsenate reductase (glutaredoxin) activity|0008794||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417960.1"; locus_tag "C7A06_RS01530"; product "glutaredoxin-dependent arsenate reductase"; protein_id "WP_000065769.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 296031 296456 . - 0 gene_id "nbis-gene-252"; transcript_id "gene-C7A06_RS01530"; Dbxref "Genbank:WP_000065769.1"; ID "cds-WP_000065769.1"; Name "WP_000065769.1"; Ontology_term "GO:0008794"; Parent "gene-C7A06_RS01530"; gbkey "CDS"; gene "arsC"; go_function "arsenate reductase (glutaredoxin) activity|0008794||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417960.1"; locus_tag "C7A06_RS01530"; product "glutaredoxin-dependent arsenate reductase"; protein_id "WP_000065769.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 296469 297758 . - . gene_id "nbis-gene-253"; ID "nbis-gene-253"; Name "arsB"; gbkey "Gene"; gene "arsB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01535"; +NZ_CP027599.1 RefSeq transcript 296469 297758 . - . gene_id "nbis-gene-253"; transcript_id "gene-C7A06_RS01535"; ID "gene-C7A06_RS01535"; Name "arsB"; Parent "nbis-gene-253"; gbkey "Gene"; gene "arsB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01535"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 296469 297758 . - . gene_id "nbis-gene-253"; transcript_id "gene-C7A06_RS01535"; Dbxref "Genbank:WP_000922639.1"; ID "nbis-exon-262"; Name "WP_000922639.1"; Parent "gene-C7A06_RS01535"; gbkey "CDS"; gene "arsB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312401.1"; locus_tag "C7A06_RS01535"; product "arsenite/antimonite:H(+) antiporter ArsB"; protein_id "WP_000922639.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 296469 297758 . - 0 gene_id "nbis-gene-253"; transcript_id "gene-C7A06_RS01535"; Dbxref "Genbank:WP_000922639.1"; ID "cds-WP_000922639.1"; Name "WP_000922639.1"; Parent "gene-C7A06_RS01535"; gbkey "CDS"; gene "arsB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312401.1"; locus_tag "C7A06_RS01535"; product "arsenite/antimonite:H(+) antiporter ArsB"; protein_id "WP_000922639.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 297812 298165 . - . gene_id "nbis-gene-254"; ID "nbis-gene-254"; Name "arsR"; gbkey "Gene"; gene "arsR"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01540"; +NZ_CP027599.1 RefSeq transcript 297812 298165 . - . gene_id "nbis-gene-254"; transcript_id "gene-C7A06_RS01540"; ID "gene-C7A06_RS01540"; Name "arsR"; Parent "nbis-gene-254"; gbkey "Gene"; gene "arsR"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01540"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 297812 298165 . - . gene_id "nbis-gene-254"; transcript_id "gene-C7A06_RS01540"; Dbxref "Genbank:WP_000008957.1"; ID "nbis-exon-263"; Name "WP_000008957.1"; Parent "gene-C7A06_RS01540"; gbkey "CDS"; gene "arsR"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417958.1"; locus_tag "C7A06_RS01540"; product "As(III)-sensing metalloregulatory transcriptional repressor ArsR"; protein_id "WP_000008957.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 297812 298165 . - 0 gene_id "nbis-gene-254"; transcript_id "gene-C7A06_RS01540"; Dbxref "Genbank:WP_000008957.1"; ID "cds-WP_000008957.1"; Name "WP_000008957.1"; Parent "gene-C7A06_RS01540"; gbkey "CDS"; gene "arsR"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417958.1"; locus_tag "C7A06_RS01540"; product "As(III)-sensing metalloregulatory transcriptional repressor ArsR"; protein_id "WP_000008957.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 298905 298988 . + . gene_id "nbis-gene-255"; ID "nbis-gene-255"; Name "dinQ"; gbkey "Gene"; gene "dinQ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01550"; +NZ_CP027599.1 RefSeq transcript 298905 298988 . + . gene_id "nbis-gene-255"; transcript_id "gene-C7A06_RS01550"; ID "gene-C7A06_RS01550"; Name "dinQ"; Parent "nbis-gene-255"; gbkey "Gene"; gene "dinQ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01550"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 298905 298988 . + . gene_id "nbis-gene-255"; transcript_id "gene-C7A06_RS01550"; Dbxref "Genbank:WP_001295215.1"; ID "nbis-exon-264"; Name "WP_001295215.1"; Parent "gene-C7A06_RS01550"; gbkey "CDS"; gene "dinQ"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_001165328.2"; locus_tag "C7A06_RS01550"; product "hypothetical protein"; protein_id "WP_001295215.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 298905 298988 . + 0 gene_id "nbis-gene-255"; transcript_id "gene-C7A06_RS01550"; Dbxref "Genbank:WP_001295215.1"; ID "cds-WP_001295215.1"; Name "WP_001295215.1"; Parent "gene-C7A06_RS01550"; gbkey "CDS"; gene "dinQ"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_001165328.2"; locus_tag "C7A06_RS01550"; product "hypothetical protein"; protein_id "WP_001295215.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 299042 300394 . - . gene_id "nbis-gene-256"; ID "nbis-gene-256"; Name "gorA"; gbkey "Gene"; gene "gorA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01555"; +NZ_CP027599.1 RefSeq transcript 299042 300394 . - . gene_id "nbis-gene-256"; transcript_id "gene-C7A06_RS01555"; ID "gene-C7A06_RS01555"; Name "gorA"; Parent "nbis-gene-256"; gbkey "Gene"; gene "gorA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01555"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 299042 300394 . - . gene_id "nbis-gene-256"; transcript_id "gene-C7A06_RS01555"; Dbxref "Genbank:WP_000160808.1"; ID "nbis-exon-265"; Name "WP_000160808.1"; Ontology_term "GO:0006749" "GO:0045454" "GO:0004362" "GO:0050660" "GO:0050661"; Parent "gene-C7A06_RS01555"; gbkey "CDS"; gene "gorA"; go_function "glutathione-disulfide reductase (NADPH) activity|0004362||IEA" "flavin adenine dinucleotide binding|0050660||IEA" "NADP binding|0050661||IEA"; go_process "glutathione metabolic process|0006749||IEA" "cell redox homeostasis|0045454||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_003861215.1"; locus_tag "C7A06_RS01555"; product "glutathione-disulfide reductase"; protein_id "WP_000160808.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 299042 300394 . - 0 gene_id "nbis-gene-256"; transcript_id "gene-C7A06_RS01555"; Dbxref "Genbank:WP_000160808.1"; ID "cds-WP_000160808.1"; Name "WP_000160808.1"; Ontology_term "GO:0006749" "GO:0045454" "GO:0004362" "GO:0050660" "GO:0050661"; Parent "gene-C7A06_RS01555"; gbkey "CDS"; gene "gorA"; go_function "glutathione-disulfide reductase (NADPH) activity|0004362||IEA" "flavin adenine dinucleotide binding|0050660||IEA" "NADP binding|0050661||IEA"; go_process "glutathione metabolic process|0006749||IEA" "cell redox homeostasis|0045454||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_003861215.1"; locus_tag "C7A06_RS01555"; product "glutathione-disulfide reductase"; protein_id "WP_000160808.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 300466 301308 . - . gene_id "nbis-gene-257"; ID "nbis-gene-257"; Name "rlmJ"; gbkey "Gene"; gene "rlmJ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01560"; +NZ_CP027599.1 RefSeq transcript 300466 301308 . - . gene_id "nbis-gene-257"; transcript_id "gene-C7A06_RS01560"; ID "gene-C7A06_RS01560"; Name "rlmJ"; Parent "nbis-gene-257"; gbkey "Gene"; gene "rlmJ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01560"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 300466 301308 . - . gene_id "nbis-gene-257"; transcript_id "gene-C7A06_RS01560"; Dbxref "Genbank:WP_000954225.1"; ID "nbis-exon-266"; Name "WP_000954225.1"; Parent "gene-C7A06_RS01560"; gbkey "CDS"; gene "rlmJ"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312398.1"; locus_tag "C7A06_RS01560"; product "23S rRNA (adenine(2030)-N(6))-methyltransferase"; protein_id "WP_000954225.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 300466 301308 . - 0 gene_id "nbis-gene-257"; transcript_id "gene-C7A06_RS01560"; Dbxref "Genbank:WP_000954225.1"; ID "cds-WP_000954225.1"; Name "WP_000954225.1"; Parent "gene-C7A06_RS01560"; gbkey "CDS"; gene "rlmJ"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312398.1"; locus_tag "C7A06_RS01560"; product "23S rRNA (adenine(2030)-N(6))-methyltransferase"; protein_id "WP_000954225.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 301511 303553 . + . gene_id "nbis-gene-258"; ID "nbis-gene-258"; Name "prlC"; gbkey "Gene"; gene "prlC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01565"; +NZ_CP027599.1 RefSeq transcript 301511 303553 . + . gene_id "nbis-gene-258"; transcript_id "gene-C7A06_RS01565"; ID "gene-C7A06_RS01565"; Name "prlC"; Parent "nbis-gene-258"; gbkey "Gene"; gene "prlC"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01565"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 301511 303553 . + . gene_id "nbis-gene-258"; transcript_id "gene-C7A06_RS01565"; Dbxref "Genbank:WP_001341942.1"; ID "nbis-exon-267"; Name "WP_001341942.1"; Ontology_term "GO:0006508" "GO:0004222"; Parent "gene-C7A06_RS01565"; gbkey "CDS"; gene "prlC"; go_function "metalloendopeptidase activity|0004222||IEA"; go_process "proteolysis|0006508||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_020317218.1"; locus_tag "C7A06_RS01565"; product "oligopeptidase A"; protein_id "WP_001341942.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 301511 303553 . + 0 gene_id "nbis-gene-258"; transcript_id "gene-C7A06_RS01565"; Dbxref "Genbank:WP_001341942.1"; ID "cds-WP_001341942.1"; Name "WP_001341942.1"; Ontology_term "GO:0006508" "GO:0004222"; Parent "gene-C7A06_RS01565"; gbkey "CDS"; gene "prlC"; go_function "metalloendopeptidase activity|0004222||IEA"; go_process "proteolysis|0006508||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_020317218.1"; locus_tag "C7A06_RS01565"; product "oligopeptidase A"; protein_id "WP_001341942.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 303561 304313 . + . gene_id "nbis-gene-259"; ID "nbis-gene-259"; Name "rsmJ"; gbkey "Gene"; gene "rsmJ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01570"; +NZ_CP027599.1 RefSeq transcript 303561 304313 . + . gene_id "nbis-gene-259"; transcript_id "gene-C7A06_RS01570"; ID "gene-C7A06_RS01570"; Name "rsmJ"; Parent "nbis-gene-259"; gbkey "Gene"; gene "rsmJ"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01570"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 303561 304313 . + . gene_id "nbis-gene-259"; transcript_id "gene-C7A06_RS01570"; Dbxref "Genbank:WP_000686608.1"; ID "nbis-exon-268"; Name "WP_000686608.1"; Ontology_term "GO:0031167" "GO:0008990"; Parent "gene-C7A06_RS01570"; gbkey "CDS"; gene "rsmJ"; go_function "rRNA (guanine-N2-)-methyltransferase activity|0008990||IEA"; go_process "rRNA methylation|0031167||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709277.2"; locus_tag "C7A06_RS01570"; product "16S rRNA (guanine(1516)-N(2))-methyltransferase RsmJ"; protein_id "WP_000686608.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 303561 304313 . + 0 gene_id "nbis-gene-259"; transcript_id "gene-C7A06_RS01570"; Dbxref "Genbank:WP_000686608.1"; ID "cds-WP_000686608.1"; Name "WP_000686608.1"; Ontology_term "GO:0031167" "GO:0008990"; Parent "gene-C7A06_RS01570"; gbkey "CDS"; gene "rsmJ"; go_function "rRNA (guanine-N2-)-methyltransferase activity|0008990||IEA"; go_process "rRNA methylation|0031167||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709277.2"; locus_tag "C7A06_RS01570"; product "16S rRNA (guanine(1516)-N(2))-methyltransferase RsmJ"; protein_id "WP_000686608.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 304362 305831 . - . gene_id "nbis-gene-260"; ID "nbis-gene-260"; Name "dtpB"; gbkey "Gene"; gene "dtpB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01575"; +NZ_CP027599.1 RefSeq transcript 304362 305831 . - . gene_id "nbis-gene-260"; transcript_id "gene-C7A06_RS01575"; ID "gene-C7A06_RS01575"; Name "dtpB"; Parent "nbis-gene-260"; gbkey "Gene"; gene "dtpB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01575"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 304362 305831 . - . gene_id "nbis-gene-260"; transcript_id "gene-C7A06_RS01575"; Dbxref "Genbank:WP_001098647.1"; ID "nbis-exon-269"; Name "WP_001098647.1"; Parent "gene-C7A06_RS01575"; gbkey "CDS"; gene "dtpB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417953.1"; locus_tag "C7A06_RS01575"; product "dipeptide/tripeptide permease DtpB"; protein_id "WP_001098647.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 304362 305831 . - 0 gene_id "nbis-gene-260"; transcript_id "gene-C7A06_RS01575"; Dbxref "Genbank:WP_001098647.1"; ID "cds-WP_001098647.1"; Name "WP_001098647.1"; Parent "gene-C7A06_RS01575"; gbkey "CDS"; gene "dtpB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_417953.1"; locus_tag "C7A06_RS01575"; product "dipeptide/tripeptide permease DtpB"; protein_id "WP_001098647.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 305997 306050 . + . gene_id "nbis-gene-5809"; ID "nbis-gene-5809"; Name "C7A06_RS34680"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS34680"; +NZ_CP027599.1 RefSeq transcript 305997 306050 . + . gene_id "nbis-gene-5809"; transcript_id "gene-C7A06_RS34680"; ID "gene-C7A06_RS34680"; Name "C7A06_RS34680"; Parent "nbis-gene-5809"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS34680"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 305997 306050 . + . gene_id "nbis-gene-5809"; transcript_id "gene-C7A06_RS34680"; Dbxref "Genbank:WP_212591402.1"; ID "nbis-exon-6118"; Name "WP_212591402.1"; Parent "gene-C7A06_RS34680"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_010051205.1"; locus_tag "C7A06_RS34680"; product "hypothetical protein"; protein_id "WP_212591402.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 305997 306050 . + 0 gene_id "nbis-gene-5809"; transcript_id "gene-C7A06_RS34680"; Dbxref "Genbank:WP_212591402.1"; ID "cds-WP_212591402.1"; Name "WP_212591402.1"; Parent "gene-C7A06_RS34680"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_010051205.1"; locus_tag "C7A06_RS34680"; product "hypothetical protein"; protein_id "WP_212591402.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 306149 306583 . - . gene_id "nbis-gene-261"; ID "nbis-gene-261"; Name "uspA"; gbkey "Gene"; gene "uspA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01585"; +NZ_CP027599.1 RefSeq transcript 306149 306583 . - . gene_id "nbis-gene-261"; transcript_id "gene-C7A06_RS01585"; ID "gene-C7A06_RS01585"; Name "uspA"; Parent "nbis-gene-261"; gbkey "Gene"; gene "uspA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS01585"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 306149 306583 . - . gene_id "nbis-gene-261"; transcript_id "gene-C7A06_RS01585"; Dbxref "Genbank:WP_000323571.1"; ID "nbis-exon-270"; Name "WP_000323571.1"; Parent "gene-C7A06_RS01585"; gbkey "CDS"; gene "uspA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312394.1"; locus_tag "C7A06_RS01585"; product "universal stress protein UspA"; protein_id "WP_000323571.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 306149 306583 . - 0 gene_id "nbis-gene-261"; transcript_id "gene-C7A06_RS01585"; Dbxref "Genbank:WP_000323571.1"; ID "cds-WP_000323571.1"; Name "WP_000323571.1"; Parent "gene-C7A06_RS01585"; gbkey "CDS"; gene "uspA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_312394.1"; locus_tag "C7A06_RS01585"; product "universal stress protein UspA"; protein_id "WP_000323571.1"; transl_table "11"; \ No newline at end of file
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/annotation_broken.gff Tue May 23 13:43:07 2023 +0000 @@ -0,0 +1,44 @@ +##gff-version 3 +##gtf-version 3 +#!gff-spec-version 1.21 +#!processor NCBI annotwriter +#!genome-build ASM301845v1 +#!genome-build-accession NCBI_Assembly:GCF_003018455.1 +#!annotation-date 05/25/2022 04:54:31 +#!annotation-source NCBI RefSeq +##sequence-region NZ_CP027599.1 1 5942969 +##species https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=562 +NZ_CP027599.1 RefSeq gene 1052 2152 . + . ID=nbis-gene-2;Name=dnaN;gbkey=Gene;gene=dnaN;gene_biotype=protein_coding;gene_id=nbis-gene-2;locus_tag=C7A06_RS00010 +NZ_CP027599.1 RefSeq transcript 1052 2152 . + . ID=gene-C7A06_RS00010;Parent=nbis-gene-2;Name=dnaN;gbkey=Gene;gene=dnaN;gene_biotype=protein_coding;gene_id=nbis-gene-2;locus_tag=C7A06_RS00010;original_biotype=mrna;transcript_id=gene-C7A06_RS00010 +NZ_CP027599.1 Protein Homology exon 1052 2152 . + . ID=nbis-exon-2;Parent=gene-C7A06_RS00010;Dbxref=Genbank:WP_000673464.1;Name=WP_000673464.1;Ontology_term=GO:0006260,GO:0003887,GO:0009360;gbkey=CDS;gene=dnaN;gene_id=nbis-gene-2;go_component=DNA polymerase III complex|0009360||IEA;go_function=DNA-directed DNA polymerase activity|0003887||IEA;go_process=DNA replication|0006260||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_006177590.1;locus_tag=C7A06_RS00010;product=DNA polymerase III subunit beta;protein_id=WP_000673464.1;transcript_id=gene-C7A06_RS00010;transl_table=11 +NZ_CP027599.1 Protein Homology CDS 1052 2152 . + 0 ID=cds-WP_000673464.1;Parent=gene-C7A06_RS00010;Dbxref=Genbank:WP_000673464.1;Name=WP_000673464.1;Ontology_term=GO:0006260,GO:0003887,GO:0009360;gbkey=CDS;gene=dnaN;gene_id=nbis-gene-2;go_component=DNA polymerase III complex|0009360||IEA;go_function=DNA-directed DNA polymerase activity|0003887||IEA;go_process=DNA replication|0006260||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_006177590.1;locus_tag=C7A06_RS00010;product=DNA polymerase III subunit beta;protein_id=WP_000673464.1;transcript_id=gene-C7A06_RS00010;transl_table=11 +NZ_CP027599.1 RefSeq gene 2152 3225 . + . ID=nbis-gene-3;Name=recF;gbkey=Gene;gene=recF;gene_biotype=protein_coding;gene_id=nbis-gene-3;locus_tag=C7A06_RS00015 +NZ_CP027599.1 RefSeq transcript 2152 3225 . + . ID=gene-C7A06_RS00015;Parent=nbis-gene-3;Name=recF;gbkey=Gene;gene=recF;gene_biotype=protein_coding;gene_id=nbis-gene-3;locus_tag=C7A06_RS00015;original_biotype=mrna;transcript_id=gene-C7A06_RS00015 +NZ_CP027599.1 Protein Homology CDS 2152 3225 . + 0 ID=cds-WP_000060112.1;Parent=gene-C7A06_RS00015;Dbxref=Genbank:WP_000060112.1;Name=WP_000060112.1;Ontology_term=GO:0006281,GO:0003697,GO:0005524;gbkey=CDS;gene=recF;gene_id=nbis-gene-3;go_function=single-stranded DNA binding|0003697||IEA,ATP binding|0005524||IEA;go_process=DNA repair|0006281||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_005121479.1;locus_tag=C7A06_RS00015;product=DNA replication/repair protein RecF;protein_id=WP_000060112.1;transcript_id=gene-C7A06_RS00015;transl_table=11 +NZ_CP027599.1 RefSeq gene 3254 5668 . + . ID=nbis-gene-4;Name=gyrB;gbkey=Gene;gene=gyrB;gene_biotype=protein_coding;gene_id=nbis-gene-4;locus_tag=C7A06_RS00020 +NZ_CP027599.1 Protein Homology CDS 3254 5668 . + 0 ID=cds-WP_000072067.1;Parent=gene-C7A06_RS00020;Dbxref=Genbank:WP_000072067.1;Name=WP_000072067.1;Ontology_term=GO:0006265,GO:0003918,GO:0009330;gbkey=CDS;gene=gyrB;gene_id=nbis-gene-4;go_component=DNA topoisomerase type II (double strand cut%2C ATP-hydrolyzing) complex|0009330||IEA;go_function=DNA topoisomerase type II (double strand cut%2C ATP-hydrolyzing) activity|0003918||IEA;go_process=DNA topological change|0006265||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_005121480.1;locus_tag=C7A06_RS00020;product=DNA topoisomerase (ATP-hydrolyzing) subunit B;protein_id=WP_000072067.1;transcript_id=gene-C7A06_RS00020;transl_table=11 +NZ_CP027599.1 RefSeq gene 5908 6306 . + . ID=nbis-gene-5;Name=yidB;gbkey=Gene;gene=yidB;gene_biotype=protein_coding;gene_id=nbis-gene-5;locus_tag=C7A06_RS00025 +NZ_CP027599.1 RefSeq transcript 5908 6306 . + . ID=gene-C7A06_RS00025;Parent=nbis-gene-5;Name=yidB;gbkey=Gene;gene=yidB;gene_biotype=protein_coding;gene_id=nbis-gene-5;locus_tag=C7A06_RS00025;original_biotype=mrna;transcript_id=gene-C7A06_RS00025 +NZ_CP027599.1 Protein Homology exon 5908 6306 . + . ID=nbis-exon-5;Parent=gene-C7A06_RS00025;Dbxref=Genbank:WP_000522208.1;Name=WP_000522208.1;gbkey=CDS;gene=yidB;gene_id=nbis-gene-5;inference=COORDINATES: similar to AA sequence:RefSeq:NP_418153.4;locus_tag=C7A06_RS00025;product=YidB family protein;protein_id=WP_000522208.1;transcript_id=gene-C7A06_RS00025;transl_table=11 +NZ_CP027599.1 Protein Homology CDS 5908 6306 . + 0 ID=cds-WP_000522208.1;Parent=gene-C7A06_RS00025;Dbxref=Genbank:WP_000522208.1;Name=WP_000522208.1;gbkey=CDS;gene=yidB;gene_id=nbis-gene-5;inference=COORDINATES: similar to AA sequence:RefSeq:NP_418153.4;locus_tag=C7A06_RS00025;product=YidB family protein;protein_id=WP_000522208.1;transcript_id=gene-C7A06_RS00025;transl_table=11 +NZ_CP027599.1 RefSeq gene 6421 7233 . + . ID=nbis-gene-6;Name=yidA;gbkey=Gene;gene=yidA;gene_biotype=protein_coding;gene_id=nbis-gene-6;locus_tag=C7A06_RS00030 +NZ_CP027599.1 RefSeq transcript 6421 7233 . + . ID=gene-C7A06_RS00030;Parent=nbis-gene-6;Name=yidA;gbkey=Gene;gene=yidA;gene_biotype=protein_coding;gene_id=nbis-gene-6;locus_tag=C7A06_RS00030;original_biotype=mrna;transcript_id=gene-C7A06_RS00030 +NZ_CP027599.1 Protein Homology exon 6421 7233 . + . ID=nbis-exon-6;Parent=gene-C7A06_RS00030;Dbxref=Genbank:WP_000985541.1;Name=WP_000985541.1;Ontology_term=GO:0016787;gbkey=CDS;gene=yidA;gene_id=nbis-gene-6;go_function=hydrolase activity|0016787||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:NP_418152.1;locus_tag=C7A06_RS00030;product=sugar-phosphatase;protein_id=WP_000985541.1;transcript_id=gene-C7A06_RS00030;transl_table=11 +NZ_CP027599.1 RefSeq transcript 7279 7935 . - . ID=gene-C7A06_RS00035;Parent=nbis-gene-7;Name=C7A06_RS00035;gbkey=Gene;gene_biotype=protein_coding;gene_id=nbis-gene-7;locus_tag=C7A06_RS00035;original_biotype=mrna;transcript_id=gene-C7A06_RS00035 +NZ_CP027599.1 Protein Homology exon 7279 7935 . - . ID=nbis-exon-7;Parent=gene-C7A06_RS00035;Dbxref=Genbank:WP_000772931.1;Name=WP_000772931.1;gbkey=CDS;gene_id=nbis-gene-7;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709504.1;locus_tag=C7A06_RS00035;product=hypothetical protein;protein_id=WP_000772931.1;transcript_id=gene-C7A06_RS00035;transl_table=11 +NZ_CP027599.1 Protein Homology CDS 7279 7935 . - 0 ID=cds-WP_000772931.1;Parent=gene-C7A06_RS00035;Dbxref=Genbank:WP_000772931.1;Name=WP_000772931.1;gbkey=CDS;gene_id=nbis-gene-7;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709504.1;locus_tag=C7A06_RS00035;product=hypothetical protein;protein_id=WP_000772931.1;transcript_id=gene-C7A06_RS00035;transl_table=11 +NZ_CP027599.1 RefSeq gene 8213 8902 . + . ID=nbis-gene-8;Name=dgoR;gbkey=Gene;gene=dgoR;gene_biotype=protein_coding;gene_id=nbis-gene-8;locus_tag=C7A06_RS00040 +NZ_CP027599.1 RefSeq transcript 8213 8902 . + . ID=gene-C7A06_RS00040;Parent=nbis-gene-8;Name=dgoR;gbkey=Gene;gene=dgoR;gene_biotype=protein_coding;gene_id=nbis-gene-8;locus_tag=C7A06_RS00040;original_biotype=mrna;transcript_id=gene-C7A06_RS00040 +NZ_CP027599.1 Protein Homology exon 8213 8902 . + . ID=nbis-exon-8;Parent=gene-C7A06_RS00040;Dbxref=Genbank:WP_000174305.1;Name=WP_000174305.1;gbkey=CDS;gene=dgoR;gene_id=nbis-gene-8;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709505.1;locus_tag=C7A06_RS00040;product=D-galactonate utilization transcriptional regulator DgoR;protein_id=WP_000174305.1;transcript_id=gene-C7A06_RS00040;transl_table=11 +NZ_CP027599.1 Protein Homology CDS 8213 8902 . + 0 ID=cds-WP_000174305.1;Parent=gene-C7A06_RS00040;Dbxref=Genbank:WP_000174305.1;Name=WP_000174305.1;gbkey=CDS;gene=dgoR;gene_id=nbis-gene-8;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709505.1;locus_tag=C7A06_RS00040;product=D-galactonate utilization transcriptional regulator DgoR;protein_id=WP_000174305.1;transcript_id=gene-C7A06_RS00040;transl_table=11 +NZ_CP027599.1 RefSeq gene 8899 9777 . + . ID=nbis-gene-9;Name=dgoK;gbkey=Gene;gene=dgoK;gene_biotype=protein_coding;gene_id=nbis-gene-9;locus_tag=C7A06_RS00045 +NZ_CP027599.1 Protein Homology exon 8899 9777 . + . ID=nbis-exon-9;Parent=gene-C7A06_RS00045;Dbxref=Genbank:WP_000127112.1;Name=WP_000127112.1;gbkey=CDS;gene=dgoK;gene_id=nbis-gene-9;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709506.1;locus_tag=C7A06_RS00045;product=2-dehydro-3-deoxygalactonokinase;protein_id=WP_000127112.1;transcript_id=gene-C7A06_RS00045;transl_table=11 +NZ_CP027599.1 Protein Homology CDS 8899 9777 . + 0 ID=cds-WP_000127112.1;Parent=gene-C7A06_RS00045;Dbxref=Genbank:WP_000127112.1;Name=WP_000127112.1;gbkey=CDS;gene=dgoK;gene_id=nbis-gene-9;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709506.1;locus_tag=C7A06_RS00045;product=2-dehydro-3-deoxygalactonokinase;protein_id=WP_000127112.1;transcript_id=gene-C7A06_RS00045;transl_table=11 +NZ_CP027599.1 RefSeq gene 9761 10378 . + . ID=nbis-gene-10;Name=dgoA;gbkey=Gene;gene=dgoA;gene_biotype=protein_coding;gene_id=nbis-gene-10;locus_tag=C7A06_RS00050 +NZ_CP027599.1 RefSeq transcript 9761 10378 . + . ID=gene-C7A06_RS00050;Parent=nbis-gene-10;Name=dgoA;gbkey=Gene;gene=dgoA;gene_biotype=protein_coding;gene_id=nbis-gene-10;locus_tag=C7A06_RS00050;original_biotype=mrna;transcript_id=gene-C7A06_RS00050 +NZ_CP027599.1 Protein Homology exon 9761 10378 . + . ID=nbis-exon-10;Parent=gene-C7A06_RS00050;Dbxref=Genbank:WP_001198699.1;Name=WP_001198699.1;gbkey=CDS;gene=dgoA;gene_id=nbis-gene-10;inference=COORDINATES: similar to AA sequence:RefSeq:YP_026238.1;locus_tag=C7A06_RS00050;product=2-dehydro-3-deoxy-6-phosphogalactonate aldolase;protein_id=WP_001198699.1;transcript_id=gene-C7A06_RS00050;transl_table=11 +NZ_CP027599.1 Protein Homology CDS 9761 10378 . + 0 ID=cds-WP_001198699.1;Parent=gene-C7A06_RS00050;Dbxref=Genbank:WP_001198699.1;Name=WP_001198699.1;gbkey=CDS;gene=dgoA;gene_id=nbis-gene-10;inference=COORDINATES: similar to AA sequence:RefSeq:YP_026238.1;locus_tag=C7A06_RS00050;product=2-dehydro-3-deoxy-6-phosphogalactonate aldolase;protein_id=WP_001198699.1;transcript_id=gene-C7A06_RS00050;transl_table=11 +NZ_CP027599.1 RefSeq gene 10375 11523 . + . ID=nbis-gene-11;Name=dgoD;gbkey=Gene;gene=dgoD;gene_biotype=protein_coding;gene_id=nbis-gene-11;locus_tag=C7A06_RS00055 +NZ_CP027599.1 RefSeq transcript 10375 11523 . + . ID=gene-C7A06_RS00055;Parent=nbis-gene-11;Name=dgoD;gbkey=Gene;gene=dgoD;gene_biotype=protein_coding;gene_id=nbis-gene-11;locus_tag=C7A06_RS00055;original_biotype=mrna;transcript_id=gene-C7A06_RS00055 +NZ_CP027599.1 Protein Homology exon 10375 11523 . + . ID=nbis-exon-11;Parent=gene-C7A06_RS00055;Dbxref=Genbank:WP_000705001.1;Name=WP_000705001.1;Ontology_term=GO:0009063,GO:0008869;gbkey=CDS;gene=dgoD;gene_id=nbis-gene-11;go_function=galactonate dehydratase activity|0008869||IEA;go_process=cellular amino acid catabolic process|0009063||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_020077623.1;locus_tag=C7A06_RS00055;product=galactonate dehydratase;protein_id=WP_000705001.1;transcript_id=gene-C7A06_RS00055;transl_table=11 +NZ_CP027599.1 Protein Homology CDS 10375 11523 . + 0 ID=cds-WP_000705001.1;Parent=gene-C7A06_RS00055;Dbxref=Genbank:WP_000705001.1;Name=WP_000705001.1;Ontology_term=GO:0009063,GO:0008869;gbkey=CDS;gene=dgoD;gene_id=nbis-gene-11;go_function=galactonate dehydratase activity|0008869||IEA;go_process=cellular amino acid catabolic process|0009063||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_020077623.1;locus_tag=C7A06_RS00055;product=galactonate dehydratase;protein_id=WP_000705001.1;transcript_id=gene-C7A06_RS00055;transl_table=11
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/annotation_fixed.gff Tue May 23 13:43:07 2023 +0000 @@ -0,0 +1,49 @@ +##gff-version 3 +##gtf-version 3 +#!gff-spec-version 1.21 +#!processor NCBI annotwriter +#!genome-build ASM301845v1 +#!genome-build-accession NCBI_Assembly:GCF_003018455.1 +#!annotation-date 05/25/2022 04:54:31 +#!annotation-source NCBI RefSeq +##sequence-region NZ_CP027599.1 1 5942969 +##species https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=562 +NZ_CP027599.1 RefSeq gene 1052 2152 . + . ID=nbis-gene-2;Name=dnaN;gbkey=Gene;gene=dnaN;gene_biotype=protein_coding;gene_id=nbis-gene-2;locus_tag=C7A06_RS00010 +NZ_CP027599.1 RefSeq transcript 1052 2152 . + . ID=gene-C7A06_RS00010;Parent=nbis-gene-2;Name=dnaN;gbkey=Gene;gene=dnaN;gene_biotype=protein_coding;gene_id=nbis-gene-2;locus_tag=C7A06_RS00010;original_biotype=mrna;transcript_id=gene-C7A06_RS00010 +NZ_CP027599.1 Protein Homology exon 1052 2152 . + . ID=nbis-exon-2;Parent=gene-C7A06_RS00010;Dbxref=Genbank:WP_000673464.1;Name=WP_000673464.1;Ontology_term=GO:0006260,GO:0003887,GO:0009360;gbkey=CDS;gene=dnaN;gene_id=nbis-gene-2;go_component=DNA polymerase III complex|0009360||IEA;go_function=DNA-directed DNA polymerase activity|0003887||IEA;go_process=DNA replication|0006260||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_006177590.1;locus_tag=C7A06_RS00010;product=DNA polymerase III subunit beta;protein_id=WP_000673464.1;transcript_id=gene-C7A06_RS00010;transl_table=11 +NZ_CP027599.1 Protein Homology CDS 1052 2152 . + 0 ID=cds-WP_000673464.1;Parent=gene-C7A06_RS00010;Dbxref=Genbank:WP_000673464.1;Name=WP_000673464.1;Ontology_term=GO:0006260,GO:0003887,GO:0009360;gbkey=CDS;gene=dnaN;gene_id=nbis-gene-2;go_component=DNA polymerase III complex|0009360||IEA;go_function=DNA-directed DNA polymerase activity|0003887||IEA;go_process=DNA replication|0006260||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_006177590.1;locus_tag=C7A06_RS00010;product=DNA polymerase III subunit beta;protein_id=WP_000673464.1;transcript_id=gene-C7A06_RS00010;transl_table=11 +NZ_CP027599.1 RefSeq gene 2152 3225 . + . ID=nbis-gene-3;Name=recF;gbkey=Gene;gene=recF;gene_biotype=protein_coding;gene_id=nbis-gene-3;locus_tag=C7A06_RS00015 +NZ_CP027599.1 RefSeq transcript 2152 3225 . + . ID=gene-C7A06_RS00015;Parent=nbis-gene-3;Name=recF;gbkey=Gene;gene=recF;gene_biotype=protein_coding;gene_id=nbis-gene-3;locus_tag=C7A06_RS00015;original_biotype=mrna;transcript_id=gene-C7A06_RS00015 +NZ_CP027599.1 Protein Homology exon 2152 3225 . + . ID=nbis-exon-1;Parent=gene-C7A06_RS00015;Dbxref=Genbank:WP_000060112.1;Name=WP_000060112.1;Ontology_term=GO:0006281,GO:0003697,GO:0005524;gbkey=CDS;gene=recF;gene_id=nbis-gene-3;go_function=single-stranded DNA binding|0003697||IEA,ATP binding|0005524||IEA;go_process=DNA repair|0006281||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_005121479.1;locus_tag=C7A06_RS00015;product=DNA replication/repair protein RecF;protein_id=WP_000060112.1;transcript_id=gene-C7A06_RS00015;transl_table=11 +NZ_CP027599.1 Protein Homology CDS 2152 3225 . + 0 ID=cds-WP_000060112.1;Parent=gene-C7A06_RS00015;Dbxref=Genbank:WP_000060112.1;Name=WP_000060112.1;Ontology_term=GO:0006281,GO:0003697,GO:0005524;gbkey=CDS;gene=recF;gene_id=nbis-gene-3;go_function=single-stranded DNA binding|0003697||IEA,ATP binding|0005524||IEA;go_process=DNA repair|0006281||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_005121479.1;locus_tag=C7A06_RS00015;product=DNA replication/repair protein RecF;protein_id=WP_000060112.1;transcript_id=gene-C7A06_RS00015;transl_table=11 +NZ_CP027599.1 RefSeq gene 3254 5668 . + . ID=nbis-gene-4;Name=gyrB;gbkey=Gene;gene=gyrB;gene_biotype=protein_coding;gene_id=nbis-gene-4;locus_tag=C7A06_RS00020 +NZ_CP027599.1 RefSeq mRNA 3254 5668 . + . ID=gene-C7A06_RS00020;Parent=nbis-gene-4;Name=gyrB;gbkey=Gene;gene=gyrB;gene_biotype=protein_coding;gene_id=nbis-gene-4;locus_tag=C7A06_RS00020 +NZ_CP027599.1 Protein Homology exon 3254 5668 . + . ID=nbis-exon-3;Parent=gene-C7A06_RS00020;Dbxref=Genbank:WP_000072067.1;Name=WP_000072067.1;Ontology_term=GO:0006265,GO:0003918,GO:0009330;gbkey=CDS;gene=gyrB;gene_id=nbis-gene-4;go_component=DNA topoisomerase type II (double strand cut%2C ATP-hydrolyzing) complex|0009330||IEA;go_function=DNA topoisomerase type II (double strand cut%2C ATP-hydrolyzing) activity|0003918||IEA;go_process=DNA topological change|0006265||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_005121480.1;locus_tag=C7A06_RS00020;product=DNA topoisomerase (ATP-hydrolyzing) subunit B;protein_id=WP_000072067.1;transcript_id=gene-C7A06_RS00020;transl_table=11 +NZ_CP027599.1 Protein Homology CDS 3254 5668 . + 0 ID=cds-WP_000072067.1;Parent=gene-C7A06_RS00020;Dbxref=Genbank:WP_000072067.1;Name=WP_000072067.1;Ontology_term=GO:0006265,GO:0003918,GO:0009330;gbkey=CDS;gene=gyrB;gene_id=nbis-gene-4;go_component=DNA topoisomerase type II (double strand cut%2C ATP-hydrolyzing) complex|0009330||IEA;go_function=DNA topoisomerase type II (double strand cut%2C ATP-hydrolyzing) activity|0003918||IEA;go_process=DNA topological change|0006265||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_005121480.1;locus_tag=C7A06_RS00020;product=DNA topoisomerase (ATP-hydrolyzing) subunit B;protein_id=WP_000072067.1;transcript_id=gene-C7A06_RS00020;transl_table=11 +NZ_CP027599.1 RefSeq gene 5908 6306 . + . ID=nbis-gene-5;Name=yidB;gbkey=Gene;gene=yidB;gene_biotype=protein_coding;gene_id=nbis-gene-5;locus_tag=C7A06_RS00025 +NZ_CP027599.1 RefSeq transcript 5908 6306 . + . ID=gene-C7A06_RS00025;Parent=nbis-gene-5;Name=yidB;gbkey=Gene;gene=yidB;gene_biotype=protein_coding;gene_id=nbis-gene-5;locus_tag=C7A06_RS00025;original_biotype=mrna;transcript_id=gene-C7A06_RS00025 +NZ_CP027599.1 Protein Homology exon 5908 6306 . + . ID=nbis-exon-5;Parent=gene-C7A06_RS00025;Dbxref=Genbank:WP_000522208.1;Name=WP_000522208.1;gbkey=CDS;gene=yidB;gene_id=nbis-gene-5;inference=COORDINATES: similar to AA sequence:RefSeq:NP_418153.4;locus_tag=C7A06_RS00025;product=YidB family protein;protein_id=WP_000522208.1;transcript_id=gene-C7A06_RS00025;transl_table=11 +NZ_CP027599.1 Protein Homology CDS 5908 6306 . + 0 ID=cds-WP_000522208.1;Parent=gene-C7A06_RS00025;Dbxref=Genbank:WP_000522208.1;Name=WP_000522208.1;gbkey=CDS;gene=yidB;gene_id=nbis-gene-5;inference=COORDINATES: similar to AA sequence:RefSeq:NP_418153.4;locus_tag=C7A06_RS00025;product=YidB family protein;protein_id=WP_000522208.1;transcript_id=gene-C7A06_RS00025;transl_table=11 +NZ_CP027599.1 RefSeq gene 6421 7233 . + . ID=nbis-gene-6;Name=yidA;gbkey=Gene;gene=yidA;gene_biotype=protein_coding;gene_id=nbis-gene-6;locus_tag=C7A06_RS00030 +NZ_CP027599.1 RefSeq transcript 6421 7233 . + . ID=gene-C7A06_RS00030;Parent=nbis-gene-6;Name=yidA;gbkey=Gene;gene=yidA;gene_biotype=protein_coding;gene_id=nbis-gene-6;locus_tag=C7A06_RS00030;original_biotype=mrna;transcript_id=gene-C7A06_RS00030 +NZ_CP027599.1 Protein Homology exon 6421 7233 . + . ID=nbis-exon-6;Parent=gene-C7A06_RS00030;Dbxref=Genbank:WP_000985541.1;Name=WP_000985541.1;Ontology_term=GO:0016787;gbkey=CDS;gene=yidA;gene_id=nbis-gene-6;go_function=hydrolase activity|0016787||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:NP_418152.1;locus_tag=C7A06_RS00030;product=sugar-phosphatase;protein_id=WP_000985541.1;transcript_id=gene-C7A06_RS00030;transl_table=11 +NZ_CP027599.1 RefSeq gene 7279 7935 . - . ID=nbis-gene-7;Name=C7A06_RS00035;gbkey=Gene;gene_biotype=protein_coding;gene_id=nbis-gene-7;locus_tag=C7A06_RS00035;original_biotype=mrna;transcript_id=gene-C7A06_RS00035 +NZ_CP027599.1 RefSeq transcript 7279 7935 . - . ID=gene-C7A06_RS00035;Parent=nbis-gene-7;Name=C7A06_RS00035;gbkey=Gene;gene_biotype=protein_coding;gene_id=nbis-gene-7;locus_tag=C7A06_RS00035;original_biotype=mrna;transcript_id=gene-C7A06_RS00035 +NZ_CP027599.1 Protein Homology exon 7279 7935 . - . ID=nbis-exon-7;Parent=gene-C7A06_RS00035;Dbxref=Genbank:WP_000772931.1;Name=WP_000772931.1;gbkey=CDS;gene_id=nbis-gene-7;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709504.1;locus_tag=C7A06_RS00035;product=hypothetical protein;protein_id=WP_000772931.1;transcript_id=gene-C7A06_RS00035;transl_table=11 +NZ_CP027599.1 Protein Homology CDS 7279 7935 . - 0 ID=cds-WP_000772931.1;Parent=gene-C7A06_RS00035;Dbxref=Genbank:WP_000772931.1;Name=WP_000772931.1;gbkey=CDS;gene_id=nbis-gene-7;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709504.1;locus_tag=C7A06_RS00035;product=hypothetical protein;protein_id=WP_000772931.1;transcript_id=gene-C7A06_RS00035;transl_table=11 +NZ_CP027599.1 RefSeq gene 8213 8902 . + . ID=nbis-gene-8;Name=dgoR;gbkey=Gene;gene=dgoR;gene_biotype=protein_coding;gene_id=nbis-gene-8;locus_tag=C7A06_RS00040 +NZ_CP027599.1 RefSeq transcript 8213 8902 . + . ID=gene-C7A06_RS00040;Parent=nbis-gene-8;Name=dgoR;gbkey=Gene;gene=dgoR;gene_biotype=protein_coding;gene_id=nbis-gene-8;locus_tag=C7A06_RS00040;original_biotype=mrna;transcript_id=gene-C7A06_RS00040 +NZ_CP027599.1 Protein Homology exon 8213 8902 . + . ID=nbis-exon-8;Parent=gene-C7A06_RS00040;Dbxref=Genbank:WP_000174305.1;Name=WP_000174305.1;gbkey=CDS;gene=dgoR;gene_id=nbis-gene-8;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709505.1;locus_tag=C7A06_RS00040;product=D-galactonate utilization transcriptional regulator DgoR;protein_id=WP_000174305.1;transcript_id=gene-C7A06_RS00040;transl_table=11 +NZ_CP027599.1 Protein Homology CDS 8213 8902 . + 0 ID=cds-WP_000174305.1;Parent=gene-C7A06_RS00040;Dbxref=Genbank:WP_000174305.1;Name=WP_000174305.1;gbkey=CDS;gene=dgoR;gene_id=nbis-gene-8;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709505.1;locus_tag=C7A06_RS00040;product=D-galactonate utilization transcriptional regulator DgoR;protein_id=WP_000174305.1;transcript_id=gene-C7A06_RS00040;transl_table=11 +NZ_CP027599.1 RefSeq gene 8899 9777 . + . ID=nbis-gene-9;Name=dgoK;gbkey=Gene;gene=dgoK;gene_biotype=protein_coding;gene_id=nbis-gene-9;locus_tag=C7A06_RS00045 +NZ_CP027599.1 RefSeq mRNA 8899 9777 . + . ID=gene-C7A06_RS00045;Parent=nbis-gene-9;Name=dgoK;gbkey=Gene;gene=dgoK;gene_biotype=protein_coding;gene_id=nbis-gene-9;locus_tag=C7A06_RS00045 +NZ_CP027599.1 Protein Homology exon 8899 9777 . + . ID=nbis-exon-9;Parent=gene-C7A06_RS00045;Dbxref=Genbank:WP_000127112.1;Name=WP_000127112.1;gbkey=CDS;gene=dgoK;gene_id=nbis-gene-9;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709506.1;locus_tag=C7A06_RS00045;product=2-dehydro-3-deoxygalactonokinase;protein_id=WP_000127112.1;transcript_id=gene-C7A06_RS00045;transl_table=11 +NZ_CP027599.1 Protein Homology CDS 8899 9777 . + 0 ID=cds-WP_000127112.1;Parent=gene-C7A06_RS00045;Dbxref=Genbank:WP_000127112.1;Name=WP_000127112.1;gbkey=CDS;gene=dgoK;gene_id=nbis-gene-9;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709506.1;locus_tag=C7A06_RS00045;product=2-dehydro-3-deoxygalactonokinase;protein_id=WP_000127112.1;transcript_id=gene-C7A06_RS00045;transl_table=11 +NZ_CP027599.1 RefSeq gene 9761 10378 . + . ID=nbis-gene-10;Name=dgoA;gbkey=Gene;gene=dgoA;gene_biotype=protein_coding;gene_id=nbis-gene-10;locus_tag=C7A06_RS00050 +NZ_CP027599.1 RefSeq transcript 9761 10378 . + . ID=gene-C7A06_RS00050;Parent=nbis-gene-10;Name=dgoA;gbkey=Gene;gene=dgoA;gene_biotype=protein_coding;gene_id=nbis-gene-10;locus_tag=C7A06_RS00050;original_biotype=mrna;transcript_id=gene-C7A06_RS00050 +NZ_CP027599.1 Protein Homology exon 9761 10378 . + . ID=nbis-exon-10;Parent=gene-C7A06_RS00050;Dbxref=Genbank:WP_001198699.1;Name=WP_001198699.1;gbkey=CDS;gene=dgoA;gene_id=nbis-gene-10;inference=COORDINATES: similar to AA sequence:RefSeq:YP_026238.1;locus_tag=C7A06_RS00050;product=2-dehydro-3-deoxy-6-phosphogalactonate aldolase;protein_id=WP_001198699.1;transcript_id=gene-C7A06_RS00050;transl_table=11 +NZ_CP027599.1 Protein Homology CDS 9761 10378 . + 0 ID=cds-WP_001198699.1;Parent=gene-C7A06_RS00050;Dbxref=Genbank:WP_001198699.1;Name=WP_001198699.1;gbkey=CDS;gene=dgoA;gene_id=nbis-gene-10;inference=COORDINATES: similar to AA sequence:RefSeq:YP_026238.1;locus_tag=C7A06_RS00050;product=2-dehydro-3-deoxy-6-phosphogalactonate aldolase;protein_id=WP_001198699.1;transcript_id=gene-C7A06_RS00050;transl_table=11 +NZ_CP027599.1 RefSeq gene 10375 11523 . + . ID=nbis-gene-11;Name=dgoD;gbkey=Gene;gene=dgoD;gene_biotype=protein_coding;gene_id=nbis-gene-11;locus_tag=C7A06_RS00055 +NZ_CP027599.1 RefSeq transcript 10375 11523 . + . ID=gene-C7A06_RS00055;Parent=nbis-gene-11;Name=dgoD;gbkey=Gene;gene=dgoD;gene_biotype=protein_coding;gene_id=nbis-gene-11;locus_tag=C7A06_RS00055;original_biotype=mrna;transcript_id=gene-C7A06_RS00055 +NZ_CP027599.1 Protein Homology exon 10375 11523 . + . ID=nbis-exon-11;Parent=gene-C7A06_RS00055;Dbxref=Genbank:WP_000705001.1;Name=WP_000705001.1;Ontology_term=GO:0009063,GO:0008869;gbkey=CDS;gene=dgoD;gene_id=nbis-gene-11;go_function=galactonate dehydratase activity|0008869||IEA;go_process=cellular amino acid catabolic process|0009063||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_020077623.1;locus_tag=C7A06_RS00055;product=galactonate dehydratase;protein_id=WP_000705001.1;transcript_id=gene-C7A06_RS00055;transl_table=11 +NZ_CP027599.1 Protein Homology CDS 10375 11523 . + 0 ID=cds-WP_000705001.1;Parent=gene-C7A06_RS00055;Dbxref=Genbank:WP_000705001.1;Name=WP_000705001.1;Ontology_term=GO:0009063,GO:0008869;gbkey=CDS;gene=dgoD;gene_id=nbis-gene-11;go_function=galactonate dehydratase activity|0008869||IEA;go_process=cellular amino acid catabolic process|0009063||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_020077623.1;locus_tag=C7A06_RS00055;product=galactonate dehydratase;protein_id=WP_000705001.1;transcript_id=gene-C7A06_RS00055;transl_table=11
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/annotation_small.gtf Tue May 23 13:43:07 2023 +0000 @@ -0,0 +1,49 @@ +##gtf-version 3 +#!gff-spec-version 1.21 +#!processor NCBI annotwriter +#!genome-build ASM301845v1 +#!genome-build-accession NCBI_Assembly:GCF_003018455.1 +#!annotation-date 05/25/2022 04:54:31 +#!annotation-source NCBI RefSeq +##sequence-region NZ_CP027599.1 1 5942969 +##species https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=562 +NZ_CP027599.1 RefSeq gene 1052 2152 . + . gene_id "nbis-gene-2"; ID "nbis-gene-2"; Name "dnaN"; gbkey "Gene"; gene "dnaN"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00010"; +NZ_CP027599.1 RefSeq transcript 1052 2152 . + . gene_id "nbis-gene-2"; transcript_id "gene-C7A06_RS00010"; ID "gene-C7A06_RS00010"; Name "dnaN"; Parent "nbis-gene-2"; gbkey "Gene"; gene "dnaN"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00010"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 1052 2152 . + . gene_id "nbis-gene-2"; transcript_id "gene-C7A06_RS00010"; Dbxref "Genbank:WP_000673464.1"; ID "nbis-exon-2"; Name "WP_000673464.1"; Ontology_term "GO:0006260" "GO:0003887" "GO:0009360"; Parent "gene-C7A06_RS00010"; gbkey "CDS"; gene "dnaN"; go_component "DNA polymerase III complex|0009360||IEA"; go_function "DNA-directed DNA polymerase activity|0003887||IEA"; go_process "DNA replication|0006260||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_006177590.1"; locus_tag "C7A06_RS00010"; product "DNA polymerase III subunit beta"; protein_id "WP_000673464.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 1052 2152 . + 0 gene_id "nbis-gene-2"; transcript_id "gene-C7A06_RS00010"; Dbxref "Genbank:WP_000673464.1"; ID "cds-WP_000673464.1"; Name "WP_000673464.1"; Ontology_term "GO:0006260" "GO:0003887" "GO:0009360"; Parent "gene-C7A06_RS00010"; gbkey "CDS"; gene "dnaN"; go_component "DNA polymerase III complex|0009360||IEA"; go_function "DNA-directed DNA polymerase activity|0003887||IEA"; go_process "DNA replication|0006260||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_006177590.1"; locus_tag "C7A06_RS00010"; product "DNA polymerase III subunit beta"; protein_id "WP_000673464.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 2152 3225 . + . gene_id "nbis-gene-3"; ID "nbis-gene-3"; Name "recF"; gbkey "Gene"; gene "recF"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00015"; +NZ_CP027599.1 RefSeq transcript 2152 3225 . + . gene_id "nbis-gene-3"; transcript_id "gene-C7A06_RS00015"; ID "gene-C7A06_RS00015"; Name "recF"; Parent "nbis-gene-3"; gbkey "Gene"; gene "recF"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00015"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 2152 3225 . + . gene_id "nbis-gene-3"; transcript_id "gene-C7A06_RS00015"; Dbxref "Genbank:WP_000060112.1"; ID "nbis-exon-3"; Name "WP_000060112.1"; Ontology_term "GO:0006281" "GO:0003697" "GO:0005524"; Parent "gene-C7A06_RS00015"; gbkey "CDS"; gene "recF"; go_function "single-stranded DNA binding|0003697||IEA" "ATP binding|0005524||IEA"; go_process "DNA repair|0006281||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_005121479.1"; locus_tag "C7A06_RS00015"; product "DNA replication/repair protein RecF"; protein_id "WP_000060112.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 2152 3225 . + 0 gene_id "nbis-gene-3"; transcript_id "gene-C7A06_RS00015"; Dbxref "Genbank:WP_000060112.1"; ID "cds-WP_000060112.1"; Name "WP_000060112.1"; Ontology_term "GO:0006281" "GO:0003697" "GO:0005524"; Parent "gene-C7A06_RS00015"; gbkey "CDS"; gene "recF"; go_function "single-stranded DNA binding|0003697||IEA" "ATP binding|0005524||IEA"; go_process "DNA repair|0006281||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_005121479.1"; locus_tag "C7A06_RS00015"; product "DNA replication/repair protein RecF"; protein_id "WP_000060112.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 3254 5668 . + . gene_id "nbis-gene-4"; ID "nbis-gene-4"; Name "gyrB"; gbkey "Gene"; gene "gyrB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00020"; +NZ_CP027599.1 RefSeq transcript 3254 5668 . + . gene_id "nbis-gene-4"; transcript_id "gene-C7A06_RS00020"; ID "gene-C7A06_RS00020"; Name "gyrB"; Parent "nbis-gene-4"; gbkey "Gene"; gene "gyrB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00020"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 3254 5668 . + . gene_id "nbis-gene-4"; transcript_id "gene-C7A06_RS00020"; Dbxref "Genbank:WP_000072067.1"; ID "nbis-exon-4"; Name "WP_000072067.1"; Ontology_term "GO:0006265" "GO:0003918" "GO:0009330"; Parent "gene-C7A06_RS00020"; gbkey "CDS"; gene "gyrB"; go_component "DNA topoisomerase type II (double strand cut, ATP-hydrolyzing) complex|0009330||IEA"; go_function "DNA topoisomerase type II (double strand cut, ATP-hydrolyzing) activity|0003918||IEA"; go_process "DNA topological change|0006265||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_005121480.1"; locus_tag "C7A06_RS00020"; product "DNA topoisomerase (ATP-hydrolyzing) subunit B"; protein_id "WP_000072067.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 3254 5668 . + 0 gene_id "nbis-gene-4"; transcript_id "gene-C7A06_RS00020"; Dbxref "Genbank:WP_000072067.1"; ID "cds-WP_000072067.1"; Name "WP_000072067.1"; Ontology_term "GO:0006265" "GO:0003918" "GO:0009330"; Parent "gene-C7A06_RS00020"; gbkey "CDS"; gene "gyrB"; go_component "DNA topoisomerase type II (double strand cut, ATP-hydrolyzing) complex|0009330||IEA"; go_function "DNA topoisomerase type II (double strand cut, ATP-hydrolyzing) activity|0003918||IEA"; go_process "DNA topological change|0006265||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_005121480.1"; locus_tag "C7A06_RS00020"; product "DNA topoisomerase (ATP-hydrolyzing) subunit B"; protein_id "WP_000072067.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 5908 6306 . + . gene_id "nbis-gene-5"; ID "nbis-gene-5"; Name "yidB"; gbkey "Gene"; gene "yidB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00025"; +NZ_CP027599.1 RefSeq transcript 5908 6306 . + . gene_id "nbis-gene-5"; transcript_id "gene-C7A06_RS00025"; ID "gene-C7A06_RS00025"; Name "yidB"; Parent "nbis-gene-5"; gbkey "Gene"; gene "yidB"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00025"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 5908 6306 . + . gene_id "nbis-gene-5"; transcript_id "gene-C7A06_RS00025"; Dbxref "Genbank:WP_000522208.1"; ID "nbis-exon-5"; Name "WP_000522208.1"; Parent "gene-C7A06_RS00025"; gbkey "CDS"; gene "yidB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418153.4"; locus_tag "C7A06_RS00025"; product "YidB family protein"; protein_id "WP_000522208.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 5908 6306 . + 0 gene_id "nbis-gene-5"; transcript_id "gene-C7A06_RS00025"; Dbxref "Genbank:WP_000522208.1"; ID "cds-WP_000522208.1"; Name "WP_000522208.1"; Parent "gene-C7A06_RS00025"; gbkey "CDS"; gene "yidB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418153.4"; locus_tag "C7A06_RS00025"; product "YidB family protein"; protein_id "WP_000522208.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 6421 7233 . + . gene_id "nbis-gene-6"; ID "nbis-gene-6"; Name "yidA"; gbkey "Gene"; gene "yidA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00030"; +NZ_CP027599.1 RefSeq transcript 6421 7233 . + . gene_id "nbis-gene-6"; transcript_id "gene-C7A06_RS00030"; ID "gene-C7A06_RS00030"; Name "yidA"; Parent "nbis-gene-6"; gbkey "Gene"; gene "yidA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00030"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 6421 7233 . + . gene_id "nbis-gene-6"; transcript_id "gene-C7A06_RS00030"; Dbxref "Genbank:WP_000985541.1"; ID "nbis-exon-6"; Name "WP_000985541.1"; Ontology_term "GO:0016787"; Parent "gene-C7A06_RS00030"; gbkey "CDS"; gene "yidA"; go_function "hydrolase activity|0016787||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418152.1"; locus_tag "C7A06_RS00030"; product "sugar-phosphatase"; protein_id "WP_000985541.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 6421 7233 . + 0 gene_id "nbis-gene-6"; transcript_id "gene-C7A06_RS00030"; Dbxref "Genbank:WP_000985541.1"; ID "cds-WP_000985541.1"; Name "WP_000985541.1"; Ontology_term "GO:0016787"; Parent "gene-C7A06_RS00030"; gbkey "CDS"; gene "yidA"; go_function "hydrolase activity|0016787||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418152.1"; locus_tag "C7A06_RS00030"; product "sugar-phosphatase"; protein_id "WP_000985541.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 7279 7935 . - . gene_id "nbis-gene-7"; ID "nbis-gene-7"; Name "C7A06_RS00035"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00035"; +NZ_CP027599.1 RefSeq transcript 7279 7935 . - . gene_id "nbis-gene-7"; transcript_id "gene-C7A06_RS00035"; ID "gene-C7A06_RS00035"; Name "C7A06_RS00035"; Parent "nbis-gene-7"; gbkey "Gene"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00035"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 7279 7935 . - . gene_id "nbis-gene-7"; transcript_id "gene-C7A06_RS00035"; Dbxref "Genbank:WP_000772931.1"; ID "nbis-exon-7"; Name "WP_000772931.1"; Parent "gene-C7A06_RS00035"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709504.1"; locus_tag "C7A06_RS00035"; product "hypothetical protein"; protein_id "WP_000772931.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 7279 7935 . - 0 gene_id "nbis-gene-7"; transcript_id "gene-C7A06_RS00035"; Dbxref "Genbank:WP_000772931.1"; ID "cds-WP_000772931.1"; Name "WP_000772931.1"; Parent "gene-C7A06_RS00035"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709504.1"; locus_tag "C7A06_RS00035"; product "hypothetical protein"; protein_id "WP_000772931.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 8213 8902 . + . gene_id "nbis-gene-8"; ID "nbis-gene-8"; Name "dgoR"; gbkey "Gene"; gene "dgoR"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00040"; +NZ_CP027599.1 RefSeq transcript 8213 8902 . + . gene_id "nbis-gene-8"; transcript_id "gene-C7A06_RS00040"; ID "gene-C7A06_RS00040"; Name "dgoR"; Parent "nbis-gene-8"; gbkey "Gene"; gene "dgoR"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00040"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 8213 8902 . + . gene_id "nbis-gene-8"; transcript_id "gene-C7A06_RS00040"; Dbxref "Genbank:WP_000174305.1"; ID "nbis-exon-8"; Name "WP_000174305.1"; Parent "gene-C7A06_RS00040"; gbkey "CDS"; gene "dgoR"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709505.1"; locus_tag "C7A06_RS00040"; product "D-galactonate utilization transcriptional regulator DgoR"; protein_id "WP_000174305.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 8213 8902 . + 0 gene_id "nbis-gene-8"; transcript_id "gene-C7A06_RS00040"; Dbxref "Genbank:WP_000174305.1"; ID "cds-WP_000174305.1"; Name "WP_000174305.1"; Parent "gene-C7A06_RS00040"; gbkey "CDS"; gene "dgoR"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709505.1"; locus_tag "C7A06_RS00040"; product "D-galactonate utilization transcriptional regulator DgoR"; protein_id "WP_000174305.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 8899 9777 . + . gene_id "nbis-gene-9"; ID "nbis-gene-9"; Name "dgoK"; gbkey "Gene"; gene "dgoK"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00045"; +NZ_CP027599.1 RefSeq transcript 8899 9777 . + . gene_id "nbis-gene-9"; transcript_id "gene-C7A06_RS00045"; ID "gene-C7A06_RS00045"; Name "dgoK"; Parent "nbis-gene-9"; gbkey "Gene"; gene "dgoK"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00045"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 8899 9777 . + . gene_id "nbis-gene-9"; transcript_id "gene-C7A06_RS00045"; Dbxref "Genbank:WP_000127112.1"; ID "nbis-exon-9"; Name "WP_000127112.1"; Parent "gene-C7A06_RS00045"; gbkey "CDS"; gene "dgoK"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709506.1"; locus_tag "C7A06_RS00045"; product "2-dehydro-3-deoxygalactonokinase"; protein_id "WP_000127112.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 8899 9777 . + 0 gene_id "nbis-gene-9"; transcript_id "gene-C7A06_RS00045"; Dbxref "Genbank:WP_000127112.1"; ID "cds-WP_000127112.1"; Name "WP_000127112.1"; Parent "gene-C7A06_RS00045"; gbkey "CDS"; gene "dgoK"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709506.1"; locus_tag "C7A06_RS00045"; product "2-dehydro-3-deoxygalactonokinase"; protein_id "WP_000127112.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 9761 10378 . + . gene_id "nbis-gene-10"; ID "nbis-gene-10"; Name "dgoA"; gbkey "Gene"; gene "dgoA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00050"; +NZ_CP027599.1 RefSeq transcript 9761 10378 . + . gene_id "nbis-gene-10"; transcript_id "gene-C7A06_RS00050"; ID "gene-C7A06_RS00050"; Name "dgoA"; Parent "nbis-gene-10"; gbkey "Gene"; gene "dgoA"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00050"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 9761 10378 . + . gene_id "nbis-gene-10"; transcript_id "gene-C7A06_RS00050"; Dbxref "Genbank:WP_001198699.1"; ID "nbis-exon-10"; Name "WP_001198699.1"; Parent "gene-C7A06_RS00050"; gbkey "CDS"; gene "dgoA"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_026238.1"; locus_tag "C7A06_RS00050"; product "2-dehydro-3-deoxy-6-phosphogalactonate aldolase"; protein_id "WP_001198699.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 9761 10378 . + 0 gene_id "nbis-gene-10"; transcript_id "gene-C7A06_RS00050"; Dbxref "Genbank:WP_001198699.1"; ID "cds-WP_001198699.1"; Name "WP_001198699.1"; Parent "gene-C7A06_RS00050"; gbkey "CDS"; gene "dgoA"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_026238.1"; locus_tag "C7A06_RS00050"; product "2-dehydro-3-deoxy-6-phosphogalactonate aldolase"; protein_id "WP_001198699.1"; transl_table "11"; +NZ_CP027599.1 RefSeq gene 10375 11523 . + . gene_id "nbis-gene-11"; ID "nbis-gene-11"; Name "dgoD"; gbkey "Gene"; gene "dgoD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00055"; +NZ_CP027599.1 RefSeq transcript 10375 11523 . + . gene_id "nbis-gene-11"; transcript_id "gene-C7A06_RS00055"; ID "gene-C7A06_RS00055"; Name "dgoD"; Parent "nbis-gene-11"; gbkey "Gene"; gene "dgoD"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00055"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 10375 11523 . + . gene_id "nbis-gene-11"; transcript_id "gene-C7A06_RS00055"; Dbxref "Genbank:WP_000705001.1"; ID "nbis-exon-11"; Name "WP_000705001.1"; Ontology_term "GO:0009063" "GO:0008869"; Parent "gene-C7A06_RS00055"; gbkey "CDS"; gene "dgoD"; go_function "galactonate dehydratase activity|0008869||IEA"; go_process "cellular amino acid catabolic process|0009063||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_020077623.1"; locus_tag "C7A06_RS00055"; product "galactonate dehydratase"; protein_id "WP_000705001.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 10375 11523 . + 0 gene_id "nbis-gene-11"; transcript_id "gene-C7A06_RS00055"; Dbxref "Genbank:WP_000705001.1"; ID "cds-WP_000705001.1"; Name "WP_000705001.1"; Ontology_term "GO:0009063" "GO:0008869"; Parent "gene-C7A06_RS00055"; gbkey "CDS"; gene "dgoD"; go_function "galactonate dehydratase activity|0008869||IEA"; go_process "cellular amino acid catabolic process|0009063||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_020077623.1"; locus_tag "C7A06_RS00055"; product "galactonate dehydratase"; protein_id "WP_000705001.1"; transl_table "11"; \ No newline at end of file
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/annotation_unique.gtf Tue May 23 13:43:07 2023 +0000 @@ -0,0 +1,13 @@ +##gtf-version 3 +#!gff-spec-version 1.21 +#!processor NCBI annotwriter +#!genome-build ASM301845v1 +#!genome-build-accession NCBI_Assembly:GCF_003018455.1 +#!annotation-date 05/25/2022 04:54:31 +#!annotation-source NCBI RefSeq +##sequence-region NZ_CP027599.1 1 5942969 +##species https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=562 +NZ_CP027599.1 RefSeq gene 11598 12935 . + . gene_id "nbis-gene-12"; ID "nbis-gene-12"; Name "dgoT"; gbkey "Gene"; gene "dgoT"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00060"; +NZ_CP027599.1 RefSeq transcript 11598 12935 . + . gene_id "nbis-gene-12"; transcript_id "gene-C7A06_RS00060"; ID "gene-C7A06_RS00060"; Name "dgoT"; Parent "nbis-gene-12"; gbkey "Gene"; gene "dgoT"; gene_biotype "protein_coding"; locus_tag "C7A06_RS00060"; original_biotype "mrna"; +NZ_CP027599.1 Protein Homology exon 11598 12935 . + . gene_id "nbis-gene-12"; transcript_id "gene-C7A06_RS00060"; Dbxref "Genbank:WP_000253455.1"; ID "nbis-exon-12"; Name "WP_000253455.1"; Parent "gene-C7A06_RS00060"; gbkey "CDS"; gene "dgoT"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709507.1"; locus_tag "C7A06_RS00060"; product "MFS transporter"; protein_id "WP_000253455.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 11598 12935 . + 0 gene_id "nbis-gene-12"; transcript_id "gene-C7A06_RS00060"; Dbxref "Genbank:WP_000253455.1"; ID "cds-WP_000253455.1"; Name "WP_000253455.1"; Parent "gene-C7A06_RS00060"; gbkey "CDS"; gene "dgoT"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709507.1"; locus_tag "C7A06_RS00060"; product "MFS transporter"; protein_id "WP_000253455.1"; transl_table "11";
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/fasta_indexes.loc Tue May 23 13:43:07 2023 +0000 @@ -0,0 +1,1 @@ +phix174 phiX174 PhiX174 bacteriophage ${__HERE__}/test-cache/reference.fasta
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/phix174.fasta Tue May 23 13:43:07 2023 +0000 @@ -0,0 +1,2 @@ +>K03455 +TGGAAGGGCTAATTCACTCCCAACGAAGACAAGATATCCTTGATCTGTGGATCTACCACACACAAGGCTACTTCCCTGATTAGCAGAACTACACACCAGGGCCAGGGATCAGATATCCACTGACCTTTGGATGGTGCTACAAGCTAGTACCAGTTGAGCCAGAGAAGTTAGAAGAAGCCAACAAAGGAGAGAACACCAGCTTGTTACACCCTGTGAGCCTGCATGGAATGGATGACCCGGAGAGAGAAGTGTTAGAGTGGAGGTTTGACAGCCGCCTAGCATTTCATCACATGGCCCGAGAGCTGCATCCGGAGTACTTCAAGAACTGCTGACATCGAGCTTGCTACAAGGGACTTTCCGCTGGGGACTTTCCAGGGAGGCGTGGCCTGGGCGGGACTGGGGAGTGGCGAGCCCTCAGATCCTGCATATAAGCAGCTGCTTTTTGCCTGTACTGGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCAGTGGCGCCCGAACAGGGACCTGAAAGCGAAAGGGAAACCAGAGGAGCTCTCTCGACGCAGGACTCGGCTTGCTGAAGCGCGCACGGCAAGAGGCGAGGGGCGGCGACTGGTGAGTACGCCAAAAATTTTGACTAGCGGAGGCTAGAAGGAGAGAGATGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAGAATTAGATCGATGGGAAAAAATTCGGTTAAGGCCAGGGGGAAAGAAAAAATATAAATTAAAACATATAGTATGGGCAAGCAGGGAGCTAGAACGATTCGCAGTTAATCCTGGCCTGTTAGAAACATCAGAAGGCTGTAGACAAATACTGGGACAGCTACAACCATCCCTTCAGACAGGATCAGAAGAACTTAGATCATTATATAATACAGTAGCAACCCTCTATTGTGTGCATCAAAGGATAGAGATAAAAGACACCAAGGAAGCTTTAGACAAGATAGAGGAAGAGCAAAACAAAAGTAAGAAAAAAGCACAGCAAGCAGCAGCTGACACAGGACACAGCAATCAGGTCAGCCAAAATTACCCTATAGTGCAGAACATCCAGGGGCAAATGGTACATCAGGCCATATCACCTAGAACTTTAAATGCATGGGTAAAAGTAGTAGAAGAGAAGGCTTTCAGCCCAGAAGTGATACCCATGTTTTCAGCATTATCAGAAGGAGCCACCCCACAAGATTTAAACACCATGCTAAACACAGTGGGGGGACATCAAGCAGCCATGCAAATGTTAAAAGAGACCATCAATGAGGAAGCTGCAGAATGGGATAGAGTGCATCCAGTGCATGCAGGGCCTATTGCACCAGGCCAGATGAGAGAACCAAGGGGAAGTGACATAGCAGGAACTACTAGTACCCTTCAGGAACAAATAGGATGGATGACAAATAATCCACCTATCCCAGTAGGAGAAATTTATAAAAGATGGATAATCCTGGGATTAAATAAAATAGTAAGAATGTATAGCCCTACCAGCATTCTGGACATAAGACAAGGACCAAAGGAACCCTTTAGAGACTATGTAGACCGGTTCTATAAAACTCTAAGAGCCGAGCAAGCTTCACAGGAGGTAAAAAATTGGATGACAGAAACCTTGTTGGTCCAAAATGCGAACCCAGATTGTAAGACTATTTTAAAAGCATTGGGACCAGCGGCTACACTAGAAGAAATGATGACAGCATGTCAGGGAGTAGGAGGACCCGGCCATAAGGCAAGAGTTTTGGCTGAAGCAATGAGCCAAGTAACAAATTCAGCTACCATAATGATGCAGAGAGGCAATTTTAGGAACCAAAGAAAGATTGTTAAGTGTTTCAATTGTGGCAAAGAAGGGCACACAGCCAGAAATTGCAGGGCCCCTAGGAAAAAGGGCTGTTGGAAATGTGGAAAGGAAGGACACCAAATGAAAGATTGTACTGAGAGACAGGCTAATTTTTTAGGGAAGATCTGGCCTTCCTACAAGGGAAGGCCAGGGAATTTTCTTCAGAGCAGACCAGAGCCAACAGCCCCACCAGAAGAGAGCTTCAGGTCTGGGGTAGAGACAACAACTCCCCCTCAGAAGCAGGAGCCGATAGACAAGGAACTGTATCCTTTAACTTCCCTCAGGTCACTCTTTGGCAACGACCCCTCGTCACAATAAAGATAGGGGGGCAACTAAAGGAAGCTCTATTAGATACAGGAGCAGATGATACAGTATTAGAAGAAATGAGTTTGCCAGGAAGATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAGTATGATCAGATACTCATAGAAATCTGTGGACATAAAGCTATAGGTACAGTATTAGTAGGACCTACACCTGTCAACATAATTGGAAGAAATCTGTTGACTCAGATTGGTTGCACTTTAAATTTTCCCATTAGCCCTATTGAGACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAAGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAGTAGAAATTTGTACAGAGATGGAAAAGGAAGGGAAAATTTCAAAAATTGGGCCTGAAAATCCATACAATACTCCAGTATTTGCCATAAAGAAAAAAGACAGTACTAAATGGAGAAAATTAGTAGATTTCAGAGAACTTAATAAGAGAACTCAAGACTTCTGGGAAGTTCAATTAGGAATACCACATCCCGCAGGGTTAAAAAAGAAAAAATCAGTAACAGTACTGGATGTGGGTGATGCATATTTTTCAGTTCCCTTAGATGAAGACTTCAGGAAGTATACTGCATTTACCATACCTAGTATAAACAATGAGACACCAGGGATTAGATATCAGTACAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAATATTCCAAAGTAGCATGACAAAAATCTTAGAGCCTTTTAGAAAACAAAATCCAGACATAGTTATCTATCAATACATGGATGATTTGTATGTAGGATCTGACTTAGAAATAGGGCAGCATAGAACAAAAATAGAGGAGCTGAGACAACATCTGTTGAGGTGGGGACTTACCACACCAGACAAAAAACATCAGAAAGAACCTCCATTCCTTTGGATGGGTTATGAACTCCATCCTGATAAATGGACAGTACAGCCTATAGTGCTGCCAGAAAAAGACAGCTGGACTGTCAATGACATACAGAAGTTAGTGGGGAAATTGAATTGGGCAAGTCAGATTTACCCAGGGATTAAAGTAAGGCAATTATGTAAACTCCTTAGAGGAACCAAAGCACTAACAGAAGTAATACCACTAACAGAAGAAGCAGAGCTAGAACTGGCAGAAAACAGAGAGATTCTAAAAGAACCAGTACATGGAGTGTATTATGACCCATCAAAAGACTTAATAGCAGAAATACAGAAGCAGGGGCAAGGCCAATGGACATATCAAATTTATCAAGAGCCATTTAAAAATCTGAAAACAGGAAAATATGCAAGAATGAGGGGTGCCCACACTAATGATGTAAAACAATTAACAGAGGCAGTGCAAAAAATAACCACAGAAAGCATAGTAATATGGGGAAAGACTCCTAAATTTAAACTGCCCATACAAAAGGAAACATGGGAAACATGGTGGACAGAGTATTGGCAAGCCACCTGGATTCCTGAGTGGGAGTTTGTTAATACCCCTCCCTTAGTGAAATTATGGTACCAGTTAGAGAAAGAACCCATAGTAGGAGCAGAAACCTTCTATGTAGATGGGGCAGCTAACAGGGAGACTAAATTAGGAAAAGCAGGATATGTTACTAATAGAGGAAGACAAAAAGTTGTCACCCTAACTGACACAACAAATCAGAAGACTGAGTTACAAGCAATTTATCTAGCTTTGCAGGATTCGGGATTAGAAGTAAACATAGTAACAGACTCACAATATGCATTAGGAATCATTCAAGCACAACCAGATCAAAGTGAATCAGAGTTAGTCAATCAAATAATAGAGCAGTTAATAAAAAAGGAAAAGGTCTATCTGGCATGGGTACCAGCACACAAAGGAATTGGAGGAAATGAACAAGTAGATAAATTAGTCAGTGCTGGAATCAGGAAAGTACTATTTTTAGATGGAATAGATAAGGCCCAAGATGAACATGAGAAATATCACAGTAATTGGAGAGCAATGGCTAGTGATTTTAACCTGCCACCTGTAGTAGCAAAAGAAATAGTAGCCAGCTGTGATAAATGTCAGCTAAAAGGAGAAGCCATGCATGGACAAGTAGACTGTAGTCCAGGAATATGGCAACTAGATTGTACACATTTAGAAGGAAAAGTTATCCTGGTAGCAGTTCATGTAGCCAGTGGATATATAGAAGCAGAAGTTATTCCAGCAGAAACAGGGCAGGAAACAGCATATTTTCTTTTAAAATTAGCAGGAAGATGGCCAGTAAAAACAATACATACTGACAATGGCAGCAATTTCACCGGTGCTACGGTTAGGGCCGCCTGTTGGTGGGCGGGAATCAAGCAGGAATTTGGAATTCCCTACAATCCCCAAAGTCAAGGAGTAGTAGAATCTATGAATAAAGAATTAAAGAAAATTATAGGACAGGTAAGAGATCAGGCTGAACATCTTAAGACAGCAGTACAAATGGCAGTATTCATCCACAATTTTAAAAGAAAAGGGGGGATTGGGGGGTACAGTGCAGGGGAAAGAATAGTAGACATAATAGCAACAGACATACAAACTAAAGAATTACAAAAACAAATTACAAAAATTCAAAATTTTCGGGTTTATTACAGGGACAGCAGAAATCCACTTTGGAAAGGACCAGCAAAGCTCCTCTGGAAAGGTGAAGGGGCAGTAGTAATACAAGATAATAGTGACATAAAAGTAGTGCCAAGAAGAAAAGCAAAGATCATTAGGGATTATGGAAAACAGATGGCAGGTGATGATTGTGTGGCAAGTAGACAGGATGAGGATTAGAACATGGAAAAGTTTAGTAAAACACCATATGTATGTTTCAGGGAAAGCTAGGGGATGGTTTTATAGACATCACTATGAAAGCCCTCATCCAAGAATAAGTTCAGAAGTACACATCCCACTAGGGGATGCTAGATTGGTAATAACAACATATTGGGGTCTGCATACAGGAGAAAGAGACTGGCATTTGGGTCAGGGAGTCTCCATAGAATGGAGGAAAAAGAGATATAGCACACAAGTAGACCCTGAACTAGCAGACCAACTAATTCATCTGTATTACTTTGACTGTTTTTCAGACTCTGCTATAAGAAAGGCCTTATTAGGACACATAGTTAGCCCTAGGTGTGAATATCAAGCAGGACATAACAAGGTAGGATCTCTACAATACTTGGCACTAGCAGCATTAATAACACCAAAAAAGATAAAGCCACCTTTGCCTAGTGTTACGAAACTGACAGAGGATAGATGGAACAAGCCCCAGAAGACCAAGGGCCACAGAGGGAGCCACACAATGAATGGACACTAGAGCTTTTAGAGGAGCTTAAGAATGAAGCTGTTAGACATTTTCCTAGGATTTGGCTCCATGGCTTAGGGCAACATATCTATGAAACTTATGGGGATACTTGGGCAGGAGTGGAAGCCATAATAAGAATTCTGCAACAACTGCTGTTTATCCATTTTCAGAATTGGGTGTCGACATAGCAGAATAGGCGTTACTCGACAGAGGAGAGCAAGAAATGGAGCCAGTAGATCCTAGACTAGAGCCCTGGAAGCATCCAGGAAGTCAGCCTAAAACTGCTTGTACCAATTGCTATTGTAAAAAGTGTTGCTTTCATTGCCAAGTTTGTTTCATAACAAAAGCCTTAGGCATCTCCTATGGCAGGAAGAAGCGGAGACAGCGACGAAGAGCTCATCAGAACAGTCAGACTCATCAAGCTTCTCTATCAAAGCAGTAAGTAGTACATGTAACGCAACCTATACCAATAGTAGCAATAGTAGCATTAGTAGTAGCAATAATAATAGCAATAGTTGTGTGGTCCATAGTAATCATAGAATATAGGAAAATATTAAGACAAAGAAAAATAGACAGGTTAATTGATAGACTAATAGAAAGAGCAGAAGACAGTGGCAATGAGAGTGAAGGAGAAATATCAGCACTTGTGGAGATGGGGGTGGAGATGGGGCACCATGCTCCTTGGGATGTTGATGATCTGTAGTGCTACAGAAAAATTGTGGGTCACAGTCTATTATGGGGTACCTGTGTGGAAGGAAGCAACCACCACTCTATTTTGTGCATCAGATGCTAAAGCATATGATACAGAGGTACATAATGTTTGGGCCACACATGCCTGTGTACCCACAGACCCCAACCCACAAGAAGTAGTATTGGTAAATGTGACAGAAAATTTTAACATGTGGAAAAATGACATGGTAGAACAGATGCATGAGGATATAATCAGTTTATGGGATCAAAGCCTAAAGCCATGTGTAAAATTAACCCCACTCTGTGTTAGTTTAAAGTGCACTGATTTGAAGAATGATACTAATACCAATAGTAGTAGCGGGAGAATGATAATGGAGAAAGGAGAGATAAAAAACTGCTCTTTCAATATCAGCACAAGCATAAGAGGTAAGGTGCAGAAAGAATATGCATTTTTTTATAAACTTGATATAATACCAATAGATAATGATACTACCAGCTATAAGTTGACAAGTTGTAACACCTCAGTCATTACACAGGCCTGTCCAAAGGTATCCTTTGAGCCAATTCCCATACATTATTGTGCCCCGGCTGGTTTTGCGATTCTAAAATGTAATAATAAGACGTTCAATGGAACAGGACCATGTACAAATGTCAGCACAGTACAATGTACACATGGAATTAGGCCAGTAGTATCAACTCAACTGCTGTTAAATGGCAGTCTAGCAGAAGAAGAGGTAGTAATTAGATCTGTCAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTGAACACATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGAATCCGTATCCAGAGAGGACCAGGGAGAGCATTTGTTACAATAGGAAAAATAGGAAATATGAGACAAGCACATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGCTAGCAAATTAAGAGAACAATTTGGAAATAATAAAACAATAATCTTTAAGCAATCCTCAGGAGGGGACCCAGAAATTGTAACGCACAGTTTTAATTGTGGAGGGGAATTTTTCTACTGTAATTCAACACAACTGTTTAATAGTACTTGGTTTAATAGTACTTGGAGTACTGAAGGGTCAAATAACACTGAAGGAAGTGACACAATCACCCTCCCATGCAGAATAAAACAAATTATAAACATGTGGCAGAAAGTAGGAAAAGCAATGTATGCCCCTCCCATCAGTGGACAAATTAGATGTTCATCAAATATTACAGGGCTGCTATTAACAAGAGATGGTGGTAATAGCAACAATGAGTCCGAGATCTTCAGACCTGGAGGAGGAGATATGAGGGACAATTGGAGAAGTGAATTATATAAATATAAAGTAGTAAAAATTGAACCATTAGGAGTAGCACCCACCAAGGCAAAGAGAAGAGTGGTGCAGAGAGAAAAAAGAGCAGTGGGAATAGGAGCTTTGTTCCTTGGGTTCTTGGGAGCAGCAGGAAGCACTATGGGCGCAGCCTCAATGACGCTGACGGTACAGGCCAGACAATTATTGTCTGGTATAGTGCAGCAGCAGAACAATTTGCTGAGGGCTATTGAGGCGCAACAGCATCTGTTGCAACTCACAGTCTGGGGCATCAAGCAGCTCCAGGCAAGAATCCTGGCTGTGGAAAGATACCTAAAGGATCAACAGCTCCTGGGGATTTGGGGTTGCTCTGGAAAACTCATTTGCACCACTGCTGTGCCTTGGAATGCTAGTTGGAGTAATAAATCTCTGGAACAGATTTGGAATCACACGACCTGGATGGAGTGGGACAGAGAAATTAACAATTACACAAGCTTAATACACTCCTTAATTGAAGAATCGCAAAACCAGCAAGAAAAGAATGAACAAGAATTATTGGAATTAGATAAATGGGCAAGTTTGTGGAATTGGTTTAACATAACAAATTGGCTGTGGTATATAAAATTATTCATAATGATAGTAGGAGGCTTGGTAGGTTTAAGAATAGTTTTTGCTGTACTTTCTATAGTGAATAGAGTTAGGCAGGGATATTCACCATTATCGTTTCAGACCCACCTCCCAACCCCGAGGGGACCCGACAGGCCCGAAGGAATAGAAGAAGAAGGTGGAGAGAGAGACAGAGACAGATCCATTCGATTAGTGAACGGATCCTTGGCACTTATCTGGGACGATCTGCGGAGCCTGTGCCTCTTCAGCTACCACCGCTTGAGAGACTTACTCTTGATTGTAACGAGGATTGTGGAACTTCTGGGACGCAGGGGGTGGGAAGCCCTCAAATATTGGTGGAATCTCCTACAGTATTGGAGTCAGGAACTAAAGAATAGTGCTGTTAGCTTGCTCAATGCCACAGCCATAGCAGTAGCTGAGGGGACAGATAGGGTTATAGAAGTAGTACAAGGAGCTTGTAGAGCTATTCGCCACATACCTAGAAGAATAAGACAGGGCTTGGAAAGGATTTTGCTATAAGATGGGTGGCAAGTGGTCAAAAAGTAGTGTGATTGGATGGCCTACTGTAAGGGAAAGAATGAGACGAGCTGAGCCAGCAGCAGATAGGGTGGGAGCAGCATCTCGAGACCTGGAAAAACATGGAGCAATCACAAGTAGCAATACAGCAGCTACCAATGCTGCTTGTGCCTGGCTAGAAGCACAAGAGGAGGAGGAGGTGGGTTTTCCAGTCACACCTCAGGTACCTTTAAGACCAATGACTTACAAGGCAGCTGTAGATCTTAGCCACTTTTTAAAAGAAAAGGGGGGACTGGAAGGGCTAATTCACTCCCAAAGAAGACAAGATATCCTTGATCTGTGGATCTACCACACACAAGGCTACTTCCCTGATTAGCAGAACTACACACCAGGGCCAGGGGTCAGATATCCACTGACCTTTGGATGGTGCTACAAGCTAGTACCAGTTGAGCCAGATAAGATAGAAGAGGCCAATAAAGGAGAGAACACCAGCTTGTTACACCCTGTGAGCCTGCATGGGATGGATGACCCGGAGAGAGAAGTGTTAGAGTGGAGGTTTGACAGCCGCCTAGCATTTCATCACGTGGCCCGAGAGCTGCATCCGGAGTACTTCAAGAACTGCTGACATCGAGCTTGCTACAAGGGACTTTCCGCTGGGGACTTTCCAGGGAGGCGTGGCCTGGGCGGGACTGGGGAGTGGCGAGCCCTCAGATCCTGCATATAAGCAGCTGCTTTTTGCCTGTACTGGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCA
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/phix174.gff Tue May 23 13:43:07 2023 +0000 @@ -0,0 +1,2 @@ +##gff-version 3 +K03455 data gene 2 2669 . . . ID=1
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test-cache/reference.fasta Tue May 23 13:43:07 2023 +0000 @@ -0,0 +1,2 @@ +>K03455 +TGGAAGGGCTAATTCACTCCCAACGAAGACAAGATATCCTTGATCTGTGGATCTACCACACACAAGGCTACTTCCCTGATTAGCAGAACTACACACCAGGGCCAGGGATCAGATATCCACTGACCTTTGGATGGTGCTACAAGCTAGTACCAGTTGAGCCAGAGAAGTTAGAAGAAGCCAACAAAGGAGAGAACACCAGCTTGTTACACCCTGTGAGCCTGCATGGAATGGATGACCCGGAGAGAGAAGTGTTAGAGTGGAGGTTTGACAGCCGCCTAGCATTTCATCACATGGCCCGAGAGCTGCATCCGGAGTACTTCAAGAACTGCTGACATCGAGCTTGCTACAAGGGACTTTCCGCTGGGGACTTTCCAGGGAGGCGTGGCCTGGGCGGGACTGGGGAGTGGCGAGCCCTCAGATCCTGCATATAAGCAGCTGCTTTTTGCCTGTACTGGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCAGTGGCGCCCGAACAGGGACCTGAAAGCGAAAGGGAAACCAGAGGAGCTCTCTCGACGCAGGACTCGGCTTGCTGAAGCGCGCACGGCAAGAGGCGAGGGGCGGCGACTGGTGAGTACGCCAAAAATTTTGACTAGCGGAGGCTAGAAGGAGAGAGATGGGTGCGAGAGCGTCAGTATTAAGCGGGGGAGAATTAGATCGATGGGAAAAAATTCGGTTAAGGCCAGGGGGAAAGAAAAAATATAAATTAAAACATATAGTATGGGCAAGCAGGGAGCTAGAACGATTCGCAGTTAATCCTGGCCTGTTAGAAACATCAGAAGGCTGTAGACAAATACTGGGACAGCTACAACCATCCCTTCAGACAGGATCAGAAGAACTTAGATCATTATATAATACAGTAGCAACCCTCTATTGTGTGCATCAAAGGATAGAGATAAAAGACACCAAGGAAGCTTTAGACAAGATAGAGGAAGAGCAAAACAAAAGTAAGAAAAAAGCACAGCAAGCAGCAGCTGACACAGGACACAGCAATCAGGTCAGCCAAAATTACCCTATAGTGCAGAACATCCAGGGGCAAATGGTACATCAGGCCATATCACCTAGAACTTTAAATGCATGGGTAAAAGTAGTAGAAGAGAAGGCTTTCAGCCCAGAAGTGATACCCATGTTTTCAGCATTATCAGAAGGAGCCACCCCACAAGATTTAAACACCATGCTAAACACAGTGGGGGGACATCAAGCAGCCATGCAAATGTTAAAAGAGACCATCAATGAGGAAGCTGCAGAATGGGATAGAGTGCATCCAGTGCATGCAGGGCCTATTGCACCAGGCCAGATGAGAGAACCAAGGGGAAGTGACATAGCAGGAACTACTAGTACCCTTCAGGAACAAATAGGATGGATGACAAATAATCCACCTATCCCAGTAGGAGAAATTTATAAAAGATGGATAATCCTGGGATTAAATAAAATAGTAAGAATGTATAGCCCTACCAGCATTCTGGACATAAGACAAGGACCAAAGGAACCCTTTAGAGACTATGTAGACCGGTTCTATAAAACTCTAAGAGCCGAGCAAGCTTCACAGGAGGTAAAAAATTGGATGACAGAAACCTTGTTGGTCCAAAATGCGAACCCAGATTGTAAGACTATTTTAAAAGCATTGGGACCAGCGGCTACACTAGAAGAAATGATGACAGCATGTCAGGGAGTAGGAGGACCCGGCCATAAGGCAAGAGTTTTGGCTGAAGCAATGAGCCAAGTAACAAATTCAGCTACCATAATGATGCAGAGAGGCAATTTTAGGAACCAAAGAAAGATTGTTAAGTGTTTCAATTGTGGCAAAGAAGGGCACACAGCCAGAAATTGCAGGGCCCCTAGGAAAAAGGGCTGTTGGAAATGTGGAAAGGAAGGACACCAAATGAAAGATTGTACTGAGAGACAGGCTAATTTTTTAGGGAAGATCTGGCCTTCCTACAAGGGAAGGCCAGGGAATTTTCTTCAGAGCAGACCAGAGCCAACAGCCCCACCAGAAGAGAGCTTCAGGTCTGGGGTAGAGACAACAACTCCCCCTCAGAAGCAGGAGCCGATAGACAAGGAACTGTATCCTTTAACTTCCCTCAGGTCACTCTTTGGCAACGACCCCTCGTCACAATAAAGATAGGGGGGCAACTAAAGGAAGCTCTATTAGATACAGGAGCAGATGATACAGTATTAGAAGAAATGAGTTTGCCAGGAAGATGGAAACCAAAAATGATAGGGGGAATTGGAGGTTTTATCAAAGTAAGACAGTATGATCAGATACTCATAGAAATCTGTGGACATAAAGCTATAGGTACAGTATTAGTAGGACCTACACCTGTCAACATAATTGGAAGAAATCTGTTGACTCAGATTGGTTGCACTTTAAATTTTCCCATTAGCCCTATTGAGACTGTACCAGTAAAATTAAAGCCAGGAATGGATGGCCCAAAAGTTAAACAATGGCCATTGACAGAAGAAAAAATAAAAGCATTAGTAGAAATTTGTACAGAGATGGAAAAGGAAGGGAAAATTTCAAAAATTGGGCCTGAAAATCCATACAATACTCCAGTATTTGCCATAAAGAAAAAAGACAGTACTAAATGGAGAAAATTAGTAGATTTCAGAGAACTTAATAAGAGAACTCAAGACTTCTGGGAAGTTCAATTAGGAATACCACATCCCGCAGGGTTAAAAAAGAAAAAATCAGTAACAGTACTGGATGTGGGTGATGCATATTTTTCAGTTCCCTTAGATGAAGACTTCAGGAAGTATACTGCATTTACCATACCTAGTATAAACAATGAGACACCAGGGATTAGATATCAGTACAATGTGCTTCCACAGGGATGGAAAGGATCACCAGCAATATTCCAAAGTAGCATGACAAAAATCTTAGAGCCTTTTAGAAAACAAAATCCAGACATAGTTATCTATCAATACATGGATGATTTGTATGTAGGATCTGACTTAGAAATAGGGCAGCATAGAACAAAAATAGAGGAGCTGAGACAACATCTGTTGAGGTGGGGACTTACCACACCAGACAAAAAACATCAGAAAGAACCTCCATTCCTTTGGATGGGTTATGAACTCCATCCTGATAAATGGACAGTACAGCCTATAGTGCTGCCAGAAAAAGACAGCTGGACTGTCAATGACATACAGAAGTTAGTGGGGAAATTGAATTGGGCAAGTCAGATTTACCCAGGGATTAAAGTAAGGCAATTATGTAAACTCCTTAGAGGAACCAAAGCACTAACAGAAGTAATACCACTAACAGAAGAAGCAGAGCTAGAACTGGCAGAAAACAGAGAGATTCTAAAAGAACCAGTACATGGAGTGTATTATGACCCATCAAAAGACTTAATAGCAGAAATACAGAAGCAGGGGCAAGGCCAATGGACATATCAAATTTATCAAGAGCCATTTAAAAATCTGAAAACAGGAAAATATGCAAGAATGAGGGGTGCCCACACTAATGATGTAAAACAATTAACAGAGGCAGTGCAAAAAATAACCACAGAAAGCATAGTAATATGGGGAAAGACTCCTAAATTTAAACTGCCCATACAAAAGGAAACATGGGAAACATGGTGGACAGAGTATTGGCAAGCCACCTGGATTCCTGAGTGGGAGTTTGTTAATACCCCTCCCTTAGTGAAATTATGGTACCAGTTAGAGAAAGAACCCATAGTAGGAGCAGAAACCTTCTATGTAGATGGGGCAGCTAACAGGGAGACTAAATTAGGAAAAGCAGGATATGTTACTAATAGAGGAAGACAAAAAGTTGTCACCCTAACTGACACAACAAATCAGAAGACTGAGTTACAAGCAATTTATCTAGCTTTGCAGGATTCGGGATTAGAAGTAAACATAGTAACAGACTCACAATATGCATTAGGAATCATTCAAGCACAACCAGATCAAAGTGAATCAGAGTTAGTCAATCAAATAATAGAGCAGTTAATAAAAAAGGAAAAGGTCTATCTGGCATGGGTACCAGCACACAAAGGAATTGGAGGAAATGAACAAGTAGATAAATTAGTCAGTGCTGGAATCAGGAAAGTACTATTTTTAGATGGAATAGATAAGGCCCAAGATGAACATGAGAAATATCACAGTAATTGGAGAGCAATGGCTAGTGATTTTAACCTGCCACCTGTAGTAGCAAAAGAAATAGTAGCCAGCTGTGATAAATGTCAGCTAAAAGGAGAAGCCATGCATGGACAAGTAGACTGTAGTCCAGGAATATGGCAACTAGATTGTACACATTTAGAAGGAAAAGTTATCCTGGTAGCAGTTCATGTAGCCAGTGGATATATAGAAGCAGAAGTTATTCCAGCAGAAACAGGGCAGGAAACAGCATATTTTCTTTTAAAATTAGCAGGAAGATGGCCAGTAAAAACAATACATACTGACAATGGCAGCAATTTCACCGGTGCTACGGTTAGGGCCGCCTGTTGGTGGGCGGGAATCAAGCAGGAATTTGGAATTCCCTACAATCCCCAAAGTCAAGGAGTAGTAGAATCTATGAATAAAGAATTAAAGAAAATTATAGGACAGGTAAGAGATCAGGCTGAACATCTTAAGACAGCAGTACAAATGGCAGTATTCATCCACAATTTTAAAAGAAAAGGGGGGATTGGGGGGTACAGTGCAGGGGAAAGAATAGTAGACATAATAGCAACAGACATACAAACTAAAGAATTACAAAAACAAATTACAAAAATTCAAAATTTTCGGGTTTATTACAGGGACAGCAGAAATCCACTTTGGAAAGGACCAGCAAAGCTCCTCTGGAAAGGTGAAGGGGCAGTAGTAATACAAGATAATAGTGACATAAAAGTAGTGCCAAGAAGAAAAGCAAAGATCATTAGGGATTATGGAAAACAGATGGCAGGTGATGATTGTGTGGCAAGTAGACAGGATGAGGATTAGAACATGGAAAAGTTTAGTAAAACACCATATGTATGTTTCAGGGAAAGCTAGGGGATGGTTTTATAGACATCACTATGAAAGCCCTCATCCAAGAATAAGTTCAGAAGTACACATCCCACTAGGGGATGCTAGATTGGTAATAACAACATATTGGGGTCTGCATACAGGAGAAAGAGACTGGCATTTGGGTCAGGGAGTCTCCATAGAATGGAGGAAAAAGAGATATAGCACACAAGTAGACCCTGAACTAGCAGACCAACTAATTCATCTGTATTACTTTGACTGTTTTTCAGACTCTGCTATAAGAAAGGCCTTATTAGGACACATAGTTAGCCCTAGGTGTGAATATCAAGCAGGACATAACAAGGTAGGATCTCTACAATACTTGGCACTAGCAGCATTAATAACACCAAAAAAGATAAAGCCACCTTTGCCTAGTGTTACGAAACTGACAGAGGATAGATGGAACAAGCCCCAGAAGACCAAGGGCCACAGAGGGAGCCACACAATGAATGGACACTAGAGCTTTTAGAGGAGCTTAAGAATGAAGCTGTTAGACATTTTCCTAGGATTTGGCTCCATGGCTTAGGGCAACATATCTATGAAACTTATGGGGATACTTGGGCAGGAGTGGAAGCCATAATAAGAATTCTGCAACAACTGCTGTTTATCCATTTTCAGAATTGGGTGTCGACATAGCAGAATAGGCGTTACTCGACAGAGGAGAGCAAGAAATGGAGCCAGTAGATCCTAGACTAGAGCCCTGGAAGCATCCAGGAAGTCAGCCTAAAACTGCTTGTACCAATTGCTATTGTAAAAAGTGTTGCTTTCATTGCCAAGTTTGTTTCATAACAAAAGCCTTAGGCATCTCCTATGGCAGGAAGAAGCGGAGACAGCGACGAAGAGCTCATCAGAACAGTCAGACTCATCAAGCTTCTCTATCAAAGCAGTAAGTAGTACATGTAACGCAACCTATACCAATAGTAGCAATAGTAGCATTAGTAGTAGCAATAATAATAGCAATAGTTGTGTGGTCCATAGTAATCATAGAATATAGGAAAATATTAAGACAAAGAAAAATAGACAGGTTAATTGATAGACTAATAGAAAGAGCAGAAGACAGTGGCAATGAGAGTGAAGGAGAAATATCAGCACTTGTGGAGATGGGGGTGGAGATGGGGCACCATGCTCCTTGGGATGTTGATGATCTGTAGTGCTACAGAAAAATTGTGGGTCACAGTCTATTATGGGGTACCTGTGTGGAAGGAAGCAACCACCACTCTATTTTGTGCATCAGATGCTAAAGCATATGATACAGAGGTACATAATGTTTGGGCCACACATGCCTGTGTACCCACAGACCCCAACCCACAAGAAGTAGTATTGGTAAATGTGACAGAAAATTTTAACATGTGGAAAAATGACATGGTAGAACAGATGCATGAGGATATAATCAGTTTATGGGATCAAAGCCTAAAGCCATGTGTAAAATTAACCCCACTCTGTGTTAGTTTAAAGTGCACTGATTTGAAGAATGATACTAATACCAATAGTAGTAGCGGGAGAATGATAATGGAGAAAGGAGAGATAAAAAACTGCTCTTTCAATATCAGCACAAGCATAAGAGGTAAGGTGCAGAAAGAATATGCATTTTTTTATAAACTTGATATAATACCAATAGATAATGATACTACCAGCTATAAGTTGACAAGTTGTAACACCTCAGTCATTACACAGGCCTGTCCAAAGGTATCCTTTGAGCCAATTCCCATACATTATTGTGCCCCGGCTGGTTTTGCGATTCTAAAATGTAATAATAAGACGTTCAATGGAACAGGACCATGTACAAATGTCAGCACAGTACAATGTACACATGGAATTAGGCCAGTAGTATCAACTCAACTGCTGTTAAATGGCAGTCTAGCAGAAGAAGAGGTAGTAATTAGATCTGTCAATTTCACGGACAATGCTAAAACCATAATAGTACAGCTGAACACATCTGTAGAAATTAATTGTACAAGACCCAACAACAATACAAGAAAAAGAATCCGTATCCAGAGAGGACCAGGGAGAGCATTTGTTACAATAGGAAAAATAGGAAATATGAGACAAGCACATTGTAACATTAGTAGAGCAAAATGGAATAACACTTTAAAACAGATAGCTAGCAAATTAAGAGAACAATTTGGAAATAATAAAACAATAATCTTTAAGCAATCCTCAGGAGGGGACCCAGAAATTGTAACGCACAGTTTTAATTGTGGAGGGGAATTTTTCTACTGTAATTCAACACAACTGTTTAATAGTACTTGGTTTAATAGTACTTGGAGTACTGAAGGGTCAAATAACACTGAAGGAAGTGACACAATCACCCTCCCATGCAGAATAAAACAAATTATAAACATGTGGCAGAAAGTAGGAAAAGCAATGTATGCCCCTCCCATCAGTGGACAAATTAGATGTTCATCAAATATTACAGGGCTGCTATTAACAAGAGATGGTGGTAATAGCAACAATGAGTCCGAGATCTTCAGACCTGGAGGAGGAGATATGAGGGACAATTGGAGAAGTGAATTATATAAATATAAAGTAGTAAAAATTGAACCATTAGGAGTAGCACCCACCAAGGCAAAGAGAAGAGTGGTGCAGAGAGAAAAAAGAGCAGTGGGAATAGGAGCTTTGTTCCTTGGGTTCTTGGGAGCAGCAGGAAGCACTATGGGCGCAGCCTCAATGACGCTGACGGTACAGGCCAGACAATTATTGTCTGGTATAGTGCAGCAGCAGAACAATTTGCTGAGGGCTATTGAGGCGCAACAGCATCTGTTGCAACTCACAGTCTGGGGCATCAAGCAGCTCCAGGCAAGAATCCTGGCTGTGGAAAGATACCTAAAGGATCAACAGCTCCTGGGGATTTGGGGTTGCTCTGGAAAACTCATTTGCACCACTGCTGTGCCTTGGAATGCTAGTTGGAGTAATAAATCTCTGGAACAGATTTGGAATCACACGACCTGGATGGAGTGGGACAGAGAAATTAACAATTACACAAGCTTAATACACTCCTTAATTGAAGAATCGCAAAACCAGCAAGAAAAGAATGAACAAGAATTATTGGAATTAGATAAATGGGCAAGTTTGTGGAATTGGTTTAACATAACAAATTGGCTGTGGTATATAAAATTATTCATAATGATAGTAGGAGGCTTGGTAGGTTTAAGAATAGTTTTTGCTGTACTTTCTATAGTGAATAGAGTTAGGCAGGGATATTCACCATTATCGTTTCAGACCCACCTCCCAACCCCGAGGGGACCCGACAGGCCCGAAGGAATAGAAGAAGAAGGTGGAGAGAGAGACAGAGACAGATCCATTCGATTAGTGAACGGATCCTTGGCACTTATCTGGGACGATCTGCGGAGCCTGTGCCTCTTCAGCTACCACCGCTTGAGAGACTTACTCTTGATTGTAACGAGGATTGTGGAACTTCTGGGACGCAGGGGGTGGGAAGCCCTCAAATATTGGTGGAATCTCCTACAGTATTGGAGTCAGGAACTAAAGAATAGTGCTGTTAGCTTGCTCAATGCCACAGCCATAGCAGTAGCTGAGGGGACAGATAGGGTTATAGAAGTAGTACAAGGAGCTTGTAGAGCTATTCGCCACATACCTAGAAGAATAAGACAGGGCTTGGAAAGGATTTTGCTATAAGATGGGTGGCAAGTGGTCAAAAAGTAGTGTGATTGGATGGCCTACTGTAAGGGAAAGAATGAGACGAGCTGAGCCAGCAGCAGATAGGGTGGGAGCAGCATCTCGAGACCTGGAAAAACATGGAGCAATCACAAGTAGCAATACAGCAGCTACCAATGCTGCTTGTGCCTGGCTAGAAGCACAAGAGGAGGAGGAGGTGGGTTTTCCAGTCACACCTCAGGTACCTTTAAGACCAATGACTTACAAGGCAGCTGTAGATCTTAGCCACTTTTTAAAAGAAAAGGGGGGACTGGAAGGGCTAATTCACTCCCAAAGAAGACAAGATATCCTTGATCTGTGGATCTACCACACACAAGGCTACTTCCCTGATTAGCAGAACTACACACCAGGGCCAGGGGTCAGATATCCACTGACCTTTGGATGGTGCTACAAGCTAGTACCAGTTGAGCCAGATAAGATAGAAGAGGCCAATAAAGGAGAGAACACCAGCTTGTTACACCCTGTGAGCCTGCATGGGATGGATGACCCGGAGAGAGAAGTGTTAGAGTGGAGGTTTGACAGCCGCCTAGCATTTCATCACGTGGCCCGAGAGCTGCATCCGGAGTACTTCAAGAACTGCTGACATCGAGCTTGCTACAAGGGACTTTCCGCTGGGGACTTTCCAGGGAGGCGTGGCCTGGGCGGGACTGGGGAGTGGCGAGCCCTCAGATCCTGCATATAAGCAGCTGCTTTTTGCCTGTACTGGGTCTCTCTGGTTAGACCAGATCTGAGCCTGGGAGCTCTCTGGCTAACTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTCAGACCCTTTTAGTCAGTGTGGAAAATCTCTAGCA
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test-cache/reference.fasta.fai Tue May 23 13:43:07 2023 +0000 @@ -0,0 +1,1 @@ +K03455 9719 8 9719 9720
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test01_stats.txt Tue May 23 13:43:07 2023 +0000 @@ -0,0 +1,80 @@ +-------------------------------------------------------------------------------- + +Compute transcript with isoforms if any + +Number of gene 379 +Number of transcript 379 +Number of cds 376 +Number of exon 379 +Number of exon in cds 376 +Number gene overlapping 62 +Number of single exon gene 379 +Number of single exon transcript 379 +mean transcripts per gene 1.0 +mean cdss per transcript 1.0 +mean exons per transcript 1.0 +mean exons per cds 1.0 +Total gene length 342644 +Total transcript length 342644 +Total cds length 342338 +Total exon length 342644 +mean gene length 904 +mean transcript length 904 +mean cds length 910 +mean exon length 904 +mean cds piece length 910 +% of genome covered by gene 33.1 +% of genome covered by transcript 33.1 +% of genome covered by cds 33.1 +% of genome covered by exon 33.1 +Longest gene 9499 +Longest transcript 9499 +Longest cds 9499 +Longest exon 9499 +Longest cds piece 9499 +Shortest gene 54 +Shortest transcript 54 +Shortest cds 54 +Shortest exon 54 +Shortest cds piece 54 + +Re-compute transcript without isoforms asked. We remove shortest isoforms if any + +Number of gene 379 +Number of transcript 379 +Number of cds 376 +Number of exon 379 +Number of exon in cds 376 +Number gene overlapping 62 +Number of single exon gene 379 +Number of single exon transcript 379 +mean transcripts per gene 1.0 +mean cdss per transcript 1.0 +mean exons per transcript 1.0 +mean exons per cds 1.0 +Total gene length 342644 +Total transcript length 342644 +Total cds length 342338 +Total exon length 342644 +mean gene length 904 +mean transcript length 904 +mean cds length 910 +mean exon length 904 +mean cds piece length 910 +% of genome covered by gene 33.1 +% of genome covered by transcript 33.1 +% of genome covered by cds 33.1 +% of genome covered by exon 33.1 +Longest gene 9499 +Longest transcript 9499 +Longest cds 9499 +Longest exon 9499 +Longest cds piece 9499 +Shortest gene 54 +Shortest transcript 54 +Shortest cds 54 +Shortest exon 54 +Shortest cds piece 54 + +-------------------------------------------------------------------------------- +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test02.fasta Tue May 23 13:43:07 2023 +0000 @@ -0,0 +1,183 @@ +>nbis-gene-2 seq_id=NZ_CP027599.1 type=gene 5'extra=10nt 3'extra=20nt +TCGTAAACCTATGAAATTTACCGTAGAACGTGAGCATTTATTAAAACCGCTACAACAGGT +GAGCGGTCCGTTAGGTGGTCGTCCTACGCTACCGATTCTCGGTAATCTGCTGTTACAGGT +TGCTGACGGTACGTTGTCGCTGACCGGTACTGATCTCGAGATGGAAATGGTGGCACGTGT +TGCGCTGGTTCAGCCACACGAGCCAGGAGCGACGACCGTTCCGGCGCGCAAATTCTTTGA +TATCTGCCGTGGTCTGCCTGAAGGCGCGGAAATTGCCGTGCAGCTGGAAGGTGAACGGAT +GCTGGTACGCTCCGGGCGTAGCCGTTTTTCGCTGTCTACCCTGCCAGCGGCGGATTTCCC +GAACCTCGATGACTGGCAGAGTGAAGTCGAATTTACCCTGCCGCAGGCAACGATGAAGCG +TCTGATTGAAGCGACCCAGTTTTCGATGGCGCATCAGGACGTTCGCTATTACTTAAATGG +TATGCTGTTTGAAACCGAAGGTGAAGAACTGCGCACCGTGGCAACCGACGGCCACCGTCT +GGCGGTCTGTTCAATGCCAATTGGTCAATCTTTGCCAAGCCATTCGGTGATCGTACCGCG +TAAAGGCGTGATTGAACTGATGCGTATGCTCGACGGCGGCGACAATCCGCTGCGCGTGCA +GATTGGCAGCAACAATATTCGCGCCCACGTTGGCGACTTTATCTTCACCTCCAAACTGGT +GGATGGTCGCTTCCCGGATTACCGCCGCGTTCTGCCGAAGAATCCGGACAAACATCTGGA +AGCTGGCTGCGATCTGCTCAAGCAGGCGTTTGCCCGTGCGGCAATTCTCTCTAACGAGAA +ATTCCGCGGCGTGCGCCTGTATGTCAGCGAAAACCAGCTGAAAATCACCGCCAACAACCC +GGAACAGGAAGAAGCGGAAGAGATCCTCGACGTTACCTATAGCGGTGCGGAGATGGAAAT +CGGCTTCAACGTCAGCTATGTGCTGGATGTTCTGAACGCGCTGAAATGCGAAAACGTCCG +CATGATGCTGACCGATTCGGTTTCCAGCGTGCAGATTGAAGATGCCGCATCACAGTCGGC +TGCCTATGTTGTCATGCCAATGAGACTGTAATGTCCCTCACCCGCTTGTTG +>nbis-gene-3 seq_id=NZ_CP027599.1 type=gene 5'extra=10nt 3'extra=20nt +TGAGACTGTAATGTCCCTCACCCGCTTGTTGATCCGCGATTTCCGCAACATTGAAACCGC +GGATCTCGCTTTATCTCCCGGCTTTAACTTTCTGGTAGGTGCCAACGGCAGTGGCAAAAC +CAGCGTGCTGGAAGCCATCTATACGCTCGGCCATGGTCGGGCGTTTCGCAGTTTGCAGAT +TGGTCGCGTCATTCGCCATGAGCAGGAGGCATTTGTTCTCCATGGGCGATTACAGGGCGA +AGAGCGCGAGACGGCGATTGGCTTAACCAAGGACAAACAGGGCGACAGCAAAGTCCGCAT +CGACGGTACTGACGGGCATAAAGTCGCGGAACTGGCGCACCTGATGCCAATGCAGCTGAT +AACGCCAGAAGGGTTTACTTTACTCAACGGCGGCCCCAAATACAGAAGAGCATTCCTCGA +CTGGGGATGCTTTCACAACGAACCCGGATTTTTCACCGCCTGGAGCAATCTCAAGCGATT +GCTCAAGCAGCGCAATGCGGCGCTGCGCCAGGTGACACGTTACGAACAGCTACGCCCGTG +GGATAAAGAACTGATCCCGCTGGCGGAGCAAATCAGCACCTGGCGCGCGGAGTATAGCGC +CGGTATCGCGGCCGATATGGCCGATACCTGTAAGCAATTTCTCCCTGAGTTTTCTCTGAC +TTTCTCTTTCCAGCGCGGCTGGGAGAAAGAGACAGAATATGCTGAGGTGCTGGAACGTAA +TTTTGAACGCGATCGCCAGCTAACCTACACCGCGCATGGCCCGCATAAAGCGGACTTACG +CATTCGCGCCGACGGTGCGCCGGTGGAAGATACCTTATCGCGTGGGCAGCTTAAGCTGTT +GATGTGCGCCTTACGTCTGGCGCAAGGAGAGTTCCTCACCCGTGAAAGCGGGCGGCGGTG +TCTCTACCTGATAGATGATTTTGCCTCTGAGCTTGATGATGAGCGTCGTGGGTTGCTTGC +CAGCCGCTTAAAAGCGACGCAATCACAGGTCTTTGTCAGCGCGATCAGTGCTGAACACGT +TATAGACATGTCGGACGAAAATTCGAAGATGTTTACCGTGGAAAAGGGTAAAATAACGGA +TTAACCCAAGTATAAATGAGCGAG +>nbis-gene-4 seq_id=NZ_CP027599.1 type=gene 5'extra=10nt 3'extra=20nt +AGAAACGTTGATGTCGAATTCTTATGACTCCTCCAGTATCAAAGTCCTGAAAGGGCTGGA +TGCGGTGCGTAAGCGCCCGGGTATGTATATCGGCGACACGGATGACGGCACCGGTCTGCA +CCACATGGTATTCGAGGTGGTAGATAACGCTATCGACGAAGCGCTCGCGGGTCACTGTAA +AGAAATTATCGTCACCATTCACGCCGACAACTCTGTCTCTGTACAGGATGACGGGCGCGG +CATTCCGACCGGTATTCACCCGGAAGAGGGCGTATCGGCGGCGGAAGTGATCATGACCGT +TCTGCACGCAGGCGGTAAATTCGACGATAACTCCTATAAAGTGTCCGGCGGTCTGCACGG +CGTTGGTGTTTCGGTAGTAAACGCCCTGTCGCAAAAACTGGAGCTGGTTATCCAGCGCGA +GGGTAAAATTCACCGTCAGATCTACGAACACGGTGTACCGCAGGCCCCGCTGGCGGTTAC +CGGCGAGACTGAAAAAACCGGCACCATGGTGCGTTTCTGGCCTAGCCTCGAAACTTTCAC +CAATGTGACCGAGTTCGAATATGAAATTCTGGCGAAACGTCTGCGTGAGTTGTCGTTCCT +CAACTCCGGCGTTTCCATTCGTCTGCGCGACAAGCGCGACGGCAAAGAAGACCACTTCCA +CTATGAAGGCGGCATCAAGGCGTTCGTTGAATATCTGAACAAGAACAAAACGCCGATCCA +CCCGAATATCTTCTACTTCTCCACTGAAAAAGACGGTATTGGCGTCGAAGTGGCGTTGCA +GTGGAACGATGGCTTCCAGGAAAACATCTACTGCTTTACCAACAACATTCCGCAGCGTGA +CGGCGGTACTCACCTGGCAGGCTTCCGTGCGGCGATGACCCGTACCCTGAACGCCTACAT +GGACAAAGAAGGCTACAGCAAAAAAGCCAAAGTTAGCGCCACCGGTGACGATGCGCGTGA +AGGCCTGATTGCGGTCGTTTCCGTGAAAGTGCCGGACCCGAAATTCTCCTCCCAGACCAA +AGACAAACTGGTTTCTTCTGAGGTGAAATCAGCGGTTGAACAGCAGATGAACGAACTGCT +GGCAGAATACCTGCTGGAAAACCCAACCGACGCGAAAATCGTGGTTGGCAAAATTATCGA +TGCTGCCCGTGCCCGTGAAGCGGCGCGTCGCGCGCGTGAAATGACCCGCCGTAAAGGTGC +GCTCGACTTAGCGGGCCTGCCGGGCAAACTGGCAGACTGCCAGGAACGCGATCCGGCGCT +TTCCGAACTGTACTTGGTGGAAGGGGACTCCGCGGGCGGCTCTGCGAAGCAGGGGCGTAA +CCGCAAGAACCAGGCGATTCTGCCGCTGAAGGGTAAAATCCTCAACGTCGAGAAAGCGCG +CTTCGATAAGATGCTCTCTTCTCAGGAAGTGGCGACGCTTATCACCGCGCTTGGCTGTGG +TATCGGTCGTGACGAGTACAACCCGGACAAACTGCGTTATCACAGCATCATCATCATGAC +CGATGCGGACGTCGACGGCTCGCACATTCGTACGCTGCTGTTGACCTTCTTCTATCGTCA +GATGCCGGAAATCGTTGAACGCGGTCACGTCTACATCGCTCAGCCGCCGCTGTACAAAGT +GAAGAAAGGCAAGCAGGAACAGTACATTAAAGACGACGAAGCGATGGATCAGTACCAGAT +CTCTATCGCGCTGGATGGCGCAACGCTGCACACCAACGCCAGCGCACCGGCATTGGCTGG +CGAAGCGTTAGAGAAATTGGTGTCTGAGTACAACGCGACGCAGAAAATGATCAACCGCAT +GGAGCGTCGTTATCCGAAAGCAATGCTGAAAGAGCTTATCTATCAGCCGACGCTGACGGA +AGCCGACCTCTCTGATGAGCAGACCGTTACCCGCTGGGTGAACGCGCTGGTCAGCGAACT +GAACGACAAAGAACAGCACGGCAGCCAGTGGAAGTTTGATGTCCACACCAATGCCGAACA +AAACCTGTTCGAGCCGATTGTTCGCGTGCGTACCCACGGTGTGGATACTGACTATCCGCT +GGATCACGAGTTTATCACCGGTGGCGAATATCGTCGTATCTGCACGCTGGGTGAGAAACT +GCGTGGCTTGCTGGAAGAAGATGCGTTTATCGAACGTGGCGAGCGTCGTCAGCCGGTAGC +CAGCTTCGAGCAGGCGCTGGACTGGCTGGTGAAAGAGTCCCGTCGCGGCCTCTCCATCCA +GCGTTATAAAGGTCTGGGCGAGATGAACCCGGAACAGCTGTGGGAAACCACCATGGACCC +GGAAAGCCGTCGTATGCTGCGCGTTACCGTTAAGGATGCGATTGCCGCTGACCAGTTGTT +CACCACGCTGATGGGCGACGCCGTTGAACCGCGCCGTGCGTTTATTGAAGAGAACGCCCT +GAAAGCGGCGAATATCGATATTTAATGGCGCTAACCATGCGAGCG +>nbis-gene-5 seq_id=NZ_CP027599.1 type=gene 5'extra=10nt 3'extra=20nt +GGTGATTATCATGGGGCTTTTTGATGAAGTTGTCGGTGCCTTTCTGAAAGGCGATGCGGG +GAAATATCAGGCTATTTTAAGTTGGGTTGAGGAGCAGGGCGGCATTCAGGTGCTGCTGGA +AAAACTGCAAAGTGGCGGCTTAGGGGCCATTCTCTCAACCTGGCTGAGTAATCAACAGGG +CAATCAATCGGTTAGTGGCGAGCAACTGGAATCGGCGCTCGGCACAAATGCGGTGTCCGA +TCTTGGACAAAAACTTGGCGTGGATACCAGTACAGCTTCCAGTTTACTGGCAGAACAATT +GCCGAAGATTATTGATGCGCTCTCACCGCAAGGTGAAGTGTCTCCACAAGCCAATAACGA +TCTGCTTTCCGCAGGCATGGAACTGCTGAAAGGGAAACTCTTCCGCTAAGCAAATGGGGA +GCATGCAAC +>nbis-gene-6 seq_id=NZ_CP027599.1 type=gene 5'extra=10nt 3'extra=20nt +TGGGGAACTCATGGCTATCAAACTCATTGCTATCGATATGGATGGCACCCTTCTGCTACC +CGATCACACCATTTCACCCGCCGTTAAAAATGCGATTGCCGCAGCTCGCGCCCGTGGCGT +GAATGTCGTGCTAACGACGGGTCGCCCTTATGCAGGTGTTCACAATTACCTGAAAGAGCT +GCATATGGAACTGCCGGGCGACTACTGCATTACTTATAACGGCGCGCTGGTACAGAAGGC +CGCTGATGGTAGCACCGTGGCGCAAACCGCTCTCAGCTATGACGACTACCGTTTCCTGGA +AAAACTCTCTCGCGAAGTCGGTTCTCATTTCCACGCCCTGGACCGCACCACGCTGTACAC +CGCCAACCGTGATATCAGCTACTACACGGTGCATGAATCCTTCGTTGCCACAATTCCGCT +GGTGTTCTGCGAAGCGGAGAAAATGGACCCCAATACCCAGTTCCTGAAAGTGATGATGAT +TGATGAACCCGCCATCCTCGACCAGGCTATCGCGCGTATTCCGCAGGAAGTGAAAGAGAA +ATATACCGTGCTGAAAAGTGCGCCGTACTTCCTCGAAATCCTCGATAAACGCGTTAACAA +AGGTACGGGGGTGAAATCACTGGCCGACGTGTTAGGTATTAAACCGGAAGAAATCATGGC +GATTGGCGATCAGGAAAACGACATCGCAATGATTGAATATGCAGGCGTCGGTGTGGCGAT +GGATAACGCTATTCCTTCGGTGAAAGAAGTGGCGAACTTTGTCACCAAATCCAACCTTGA +AGATGGCGTGGCGTTTGCTATTGAGAAGTATGTGCTGAATTAATCAGTGGACGGGCAAAC +AGC +>nbis-gene-7 seq_id=NZ_CP027599.1 type=gene 3'extra=20nt 5'extra=10nt +AGGATTAATCATGAAGTTGAATTTTAAGGGATTTTTTAAGGCTGCCGGTTTATTCCCACT +GGCGCTGATGCTTTCAGGCTGTATCTCGTATGCTCTGGTTTCCCATACCGCAAAGGGTAG +TTCAGGAAAGTATCAATCGCAGTCAGACACCATCACTGGGCTATCGCAGGCAAAAGATAG +TAATGGAACAAAAGGCTATGTTTTTGTAGGGGAATCGCTGGATTACCTTATCACTGATGG +TGCCGATGACATCGTTAAGATGCTCAATGATCCAGCACTTAACCGGCACAATATTCAGGT +TGCCGATGACGCAAGATTTGTTTTAAATGCGGGGAAAAAGAAATTTACCGGCACAATATC +GCTTTACTACCACTGGAATAACGAAGAAGAAAAGGCACTGGCAACGCATTATGGTTTTGC +CTGTGGTGTTCAACACTGTACCAGGTCACTGGAAAACCTAAAAGGCACAATCCATGAGAA +AAATAAAAACATGGATTACTCAAAGGTGATGGCGTTCTATCATCCGTTTAAAGTGCGATT +TTATGAATACTATTCACCCAGAGGCATTCCGGATGGTGTTTCCGCAGCATTACTGCCAGT +GACTGTTACGCTGGACATCATTACTGCACCGCTGCAATTTCTGGTTGTATATGCAGTAAA +CCAATAATCAGTAAGCGGGCAAACGCG +>nbis-gene-8 seq_id=NZ_CP027599.1 type=gene 5'extra=10nt 3'extra=20nt +AGGACTCTCCATGACTCTCAATAAAACCGATCGCATTGTCATTACGCTGGGTAAACAGAT +TGTTCACGGCAAATACGTACCTGGCTCGCCACTTCCGGCTGAGGCGGAGCTCTGTGAAGA +GTTTGCAACCTCGCGCAACATCATCCGTGAGGTGTTCCGTTCGTTGATGGCGAAACGGCT +GATTGAAATGAAACGTTATCGCGGCGCGTTTGTGGCACCGCGTAACCAGTGGAATTACCT +CGACACTGACGTACTGCAATGGGTGCTGGAAAACGACTACGACCCACGGCTTATCAGTGC +CATGAGCGAAGTGCGAAATCTGGTGGAACCGGCGATTGCCCGTTGGGCAGCAGAGCGCGC +GACTTCCAGCGATCTGGCGCAGATTGAATCGGCGCTGAACGAGATGATTGCCAACAATCA +GGACCGCGAAGCGTTTAACGAAGCGGATATTCGCTACCACGAGGCGGTGCTGCAGTCGGT +ACATAACCCGGTGTTACAGCAACTTAGCATTGCGATCAGTTCGTTGCAGCGGGCGGTTTT +TGAACGAACCTGGATGGGCGATGAGGCCAACATGCCGCAAACGCTCCAGGAACATAAGGC +GCTGTTCGATGCAATACGGCATCAGGACGGCGATGCGGCAGAGCAGGCGGCGCTTACCAT +GATCGCCAGCTCGACACGAAGGTTAAAGGAAATCACATGACAGCTCGCTACATCGCAATT +>nbis-gene-9 seq_id=NZ_CP027599.1 type=gene 5'extra=10nt 3'extra=20nt +AGGAAATCACATGACAGCTCGCTACATCGCAATTGACTGGGGATCGACCAATCTTCGCGC +CTGGCTTTATCAGGGCGACCACTGCCTGGAGAGCAGGCAATCAGAAGCAGGCGTCACGCG +CCTGAACGGAAAATCTCCGGCTGCGGTGTTAGCAGAAGTCACGACCGACTGGCGTGAAGA +GAATACGCCAGTGGTAATGGCAGGAATGGTCGGCAGCAATGTCGGCTGGAAAGTTGCTCC +GTATTTATCTGTTCCTGCCCGTTTTTCGTCTATTGGCGAACAATTAACGTCTGTTGGCGA +CAATATCTGGATTATTCCCGGATTATGCGTCTCTCATGACGATAACCACAATGTGATGCG +CGGCGAAGAAACACAATTGATCGGCGCGCGAACTCTGGCTCCTTCCTCTCTTTATGTTAT +GCCCGGTACGCATTGCAAATGGGTGCAGGCCGATAGCCAGCAAATCAACGATTTTCGCAC +CGTGATGACCGGTGAATTACATCATTTACTGTTAAATCACTCATTGATTGGCGCAGGTTT +GCCGCCGCAGGAAAACTCTGCCGATGCCTTCGCGGCTGGCCTTGAGCGCGGCCTTAATGC +GCCCGCCATATTGCCGCAGCTTTTTGAAGTTCGCGCCTCGCATGTGCTGGGAACACTTCC +CCGCGAACAGGTCAGCGAATTTCTCTCTGGTTTGTTGATTGGCGCAGAGGTTGCCAGTAT +GCGCGACTATGTGACCCATCAACACGCCATCACCCTTGTCGCCGGAACATCGCTGACCGC +GCGCTACCAGCAAGCCTTTCAGGCGATGGGTTGCGACGTGACGGCGGTGGCGGGCGACAC +GGCATTTCAGGCTGGTATAAGGAGCATCGCTCATGCAGTGGCAAACTAAACTTCCGCTGA +TCGCCATTT +>nbis-gene-10 seq_id=NZ_CP027599.1 type=gene 5'extra=10nt 3'extra=20nt +AGCATCGCTCATGCAGTGGCAAACTAAACTTCCGCTGATCGCCATTTTGCGCGGCATTAA +GCCCGACGAGGCGCTGGCGCATGTTGGCGCGGTGATTGACGCCGGGTTCGACGCGGTTGA +AATCCCGCTGAATTCCCCACAATGGGAGCAAAGCATTCCCGCCATCGTTGATGCGTATGG +CGACAAGGCGTTGATTGGCGCAGGTACGGTACTGAAACCTGAACAGGTCGATGCGCTCGC +CAGGATGGGTTGTCAGCTCATCGTTACGCCCAATATCCATAGTGAAGTGATCCGCCGTGC +GGTGGGCTACGGCATGACCGTCTGCCCCGGCTGCGCGACGGCGACCGAAGCCTTTACCGC +GCTCGAAGCGGGCGCGCAGGCGCTGAAAATATTTCCGTCATCGGCTTTTGGTCCGCAATA +CATCAAAGCGTTAAAAGCGGTATTGCCATCGGACATCGCAGTCTTTGCCGTTGGCGGCGT +GACGCCAGAAAACCTGGCGCAGTGGATAGACGCAGGTTGTGCTGGGGCGGGCTTAGGCAG +CGATCTCTATCGCGCCGGGCAGTCCGTAGAACGCACCGCGCAGCAGGCAGCAGCATTTGT +TAAGGCGTATCGAGAGGCAGTGCAATGAAAATCACCAAAATTACCACG +>nbis-gene-11 seq_id=NZ_CP027599.1 type=gene 5'extra=10nt 3'extra=20nt +AGGCAGTGCAATGAAAATCACCAAAATTACCACGTATCGTTTACCTCCCCGCTGGATGTT +CCTGAAAATTGAAACCGATGAAGGCGTGGTCGGTTGGGGCGAGCCCGTGATTGAAGGCCG +CGCCCGTACGGTGGAAGCGGCAGTTCACGAGCTGGGTGACTATTTGATTGGTCAGGATCC +TTCGCGCATCAATGACTTATGGCAAGTGATGTATCGCGCCGGATTTTATCGTGGCGGTCC +AATCCTGATGAGCGCCATTGCCGGGATCGACCAGGCGTTATGGGATATCAAAGGCAAAGT +GCTGAATGCGCCGGTCTGGCAACTGATGGGCGGCCTGGTTCGCGACAAAATTAAAGCCTA +CAGTTGGGTCGGCGGCGATCGTCCGGCGGATGTTATCGACGGCATTAAAACCCTGCGCGA +AATCGGCTTCGATACCTTCAAACTGAACGGTTGTGAAGAACTGGGGCTAATTGATAACTC +CCGCGCGGTAGATGCGGCAGTCAACACCGTGGCACAAATTCGTGAAGCTTTTGGCAATCA +GATTGAGTTTGGTCTTGATTTCCACGGTCGCGTCAGCGCGCCAATGGCGAAAGTGCTGAT +TAAAGAACTGGAGCCGTATCGCCCGCTGTTTATTGAAGAGCCGGTGCTGGCGGAACAAGC +CGAATACTACCCGAAATTGGCGGCACAAACGCATATTCCACTGGCGGCAGGTGAGCGCAT +GTTCTCACGTTTCGATTTTAAACGCGTGCTGGAGGCAGGCGGTATTTCGATTCTGCAACC +GGATCTCTCCCATGCAGGCGGTATTACCGAATGCTACAAAATTGCTGGAATGGCAGAAGC +CTATGATGTGACCCTTGCGCCGCACTGTCCGCTCGGACCGATTGCACTGGCAGCTTGCCT +GCATATCGACTTTGTTTCCTATAACGCGGTACTTCAGGAACAAAGTATGGGCATTCATTA +CAACAAAGGCGCGGAGTTACTCGACTTTGTGAAAAACAAAGAAGACTTCAGTATGGTTGG +CGGCTTCTTTAAACCGTTAACGAAACCGGGCTTAGGTGTGGAAATCGACGAAGCTAAAGT +TATTGAGTTCAGTAAAAATGCCCCGGACTGGCGTAATCCGCTCTGGCGTCATGAAGATAA +CAGCGTAGCAGAGTGGTAATTCCTGCCACGTAAGCCCCT
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test03.txt Tue May 23 13:43:07 2023 +0000 @@ -0,0 +1,28 @@ +usage: /home/laptop/miniconda3/envs/mulled-v1-d5d9956f5cc87a70e05e5aa3970eaf3637ef7e96fa1e50da0f6646fabcdc59e1/bin/agat_sp_compare_two_annotations.pl --gff1 annotation1.gtf --gff2 annotation2.gtf --output temp_output +Results of number of genes from file1 that overlap genes from file2: + +---------------------------------------------------------------------------------------------- +| gene@transcript@cds | +---------------------------------------------------------------------------------------------- +| annotation1.gtf | annotation2.gtf | Number of cases | +---------------------------------------------------------------------------------------------- +| 1 | 0 | 366 | +| 1 | 1 | 4 | +| 2 | 2 | 3 | +---------------------------------------------------------------------------------------------- +Number gene in annotation1: 376 +Number gene in annotation2: 10 + + +---------------------------------------------------------------------------------------------- +| gene@transcript@exon | +---------------------------------------------------------------------------------------------- +| annotation1.gtf | annotation2.gtf | Number of cases | +---------------------------------------------------------------------------------------------- +| 1 | 0 | 3 | +---------------------------------------------------------------------------------------------- +Number gene in annotation1: 3 +Number gene in annotation2: 0 + + +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test04.gff Tue May 23 13:43:07 2023 +0000 @@ -0,0 +1,54 @@ +##gff-version 3 +##gtf-version 3 +#!gff-spec-version 1.21 +#!processor NCBI annotwriter +#!genome-build ASM301845v1 +#!genome-build-accession NCBI_Assembly:GCF_003018455.1 +#!annotation-date 05/25/2022 04:54:31 +#!annotation-source NCBI RefSeq +##sequence-region NZ_CP027599.1 1 5942969 +##species https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=562 +NZ_CP027599.1 RefSeq gene 1052 2152 . + . ID=nbis-gene-2;Name=dnaN;gbkey=Gene;gene=dnaN;gene_biotype=protein_coding;gene_id=nbis-gene-2;locus_tag=C7A06_RS00010 +NZ_CP027599.1 RefSeq transcript 1052 2152 . + . ID=gene-C7A06_RS00010;Parent=nbis-gene-2;Name=dnaN;gbkey=Gene;gene=dnaN;gene_biotype=protein_coding;gene_id=nbis-gene-2;locus_tag=C7A06_RS00010;original_biotype=mrna;transcript_id=gene-C7A06_RS00010 +NZ_CP027599.1 Protein Homology exon 1052 2152 . + . ID=nbis-exon-2;Parent=gene-C7A06_RS00010;Dbxref=Genbank:WP_000673464.1;Name=WP_000673464.1;Ontology_term=GO:0006260,GO:0003887,GO:0009360;gbkey=CDS;gene=dnaN;gene_id=nbis-gene-2;go_component=DNA polymerase III complex|0009360||IEA;go_function=DNA-directed DNA polymerase activity|0003887||IEA;go_process=DNA replication|0006260||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_006177590.1;locus_tag=C7A06_RS00010;product=DNA polymerase III subunit beta;protein_id=WP_000673464.1;transcript_id=gene-C7A06_RS00010;transl_table=11 +NZ_CP027599.1 Protein Homology CDS 1052 2152 . + 0 ID=cds-WP_000673464.1;Parent=gene-C7A06_RS00010;Dbxref=Genbank:WP_000673464.1;Name=WP_000673464.1;Ontology_term=GO:0006260,GO:0003887,GO:0009360;gbkey=CDS;gene=dnaN;gene_id=nbis-gene-2;go_component=DNA polymerase III complex|0009360||IEA;go_function=DNA-directed DNA polymerase activity|0003887||IEA;go_process=DNA replication|0006260||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_006177590.1;locus_tag=C7A06_RS00010;product=DNA polymerase III subunit beta;protein_id=WP_000673464.1;transcript_id=gene-C7A06_RS00010;transl_table=11 +NZ_CP027599.1 RefSeq gene 2152 3225 . + . ID=nbis-gene-3;Name=recF;gbkey=Gene;gene=recF;gene_biotype=protein_coding;gene_id=nbis-gene-3;locus_tag=C7A06_RS00015 +NZ_CP027599.1 RefSeq transcript 2152 3225 . + . ID=gene-C7A06_RS00015;Parent=nbis-gene-3;Name=recF;gbkey=Gene;gene=recF;gene_biotype=protein_coding;gene_id=nbis-gene-3;locus_tag=C7A06_RS00015;original_biotype=mrna;transcript_id=gene-C7A06_RS00015 +NZ_CP027599.1 Protein Homology exon 2152 3225 . + . ID=nbis-exon-3;Parent=gene-C7A06_RS00015;Dbxref=Genbank:WP_000060112.1;Name=WP_000060112.1;Ontology_term=GO:0006281,GO:0003697,GO:0005524;gbkey=CDS;gene=recF;gene_id=nbis-gene-3;go_function=single-stranded DNA binding|0003697||IEA,ATP binding|0005524||IEA;go_process=DNA repair|0006281||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_005121479.1;locus_tag=C7A06_RS00015;product=DNA replication/repair protein RecF;protein_id=WP_000060112.1;transcript_id=gene-C7A06_RS00015;transl_table=11 +NZ_CP027599.1 Protein Homology CDS 2152 3225 . + 0 ID=cds-WP_000060112.1;Parent=gene-C7A06_RS00015;Dbxref=Genbank:WP_000060112.1;Name=WP_000060112.1;Ontology_term=GO:0006281,GO:0003697,GO:0005524;gbkey=CDS;gene=recF;gene_id=nbis-gene-3;go_function=single-stranded DNA binding|0003697||IEA,ATP binding|0005524||IEA;go_process=DNA repair|0006281||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_005121479.1;locus_tag=C7A06_RS00015;product=DNA replication/repair protein RecF;protein_id=WP_000060112.1;transcript_id=gene-C7A06_RS00015;transl_table=11 +NZ_CP027599.1 RefSeq gene 3254 5668 . + . ID=nbis-gene-4;Name=gyrB;gbkey=Gene;gene=gyrB;gene_biotype=protein_coding;gene_id=nbis-gene-4;locus_tag=C7A06_RS00020 +NZ_CP027599.1 RefSeq transcript 3254 5668 . + . ID=gene-C7A06_RS00020;Parent=nbis-gene-4;Name=gyrB;gbkey=Gene;gene=gyrB;gene_biotype=protein_coding;gene_id=nbis-gene-4;locus_tag=C7A06_RS00020;original_biotype=mrna;transcript_id=gene-C7A06_RS00020 +NZ_CP027599.1 Protein Homology exon 3254 5668 . + . ID=nbis-exon-4;Parent=gene-C7A06_RS00020;Dbxref=Genbank:WP_000072067.1;Name=WP_000072067.1;Ontology_term=GO:0006265,GO:0003918,GO:0009330;gbkey=CDS;gene=gyrB;gene_id=nbis-gene-4;go_component=DNA topoisomerase type II (double strand cut%2C ATP-hydrolyzing) complex|0009330||IEA;go_function=DNA topoisomerase type II (double strand cut%2C ATP-hydrolyzing) activity|0003918||IEA;go_process=DNA topological change|0006265||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_005121480.1;locus_tag=C7A06_RS00020;product=DNA topoisomerase (ATP-hydrolyzing) subunit B;protein_id=WP_000072067.1;transcript_id=gene-C7A06_RS00020;transl_table=11 +NZ_CP027599.1 Protein Homology CDS 3254 5668 . + 0 ID=cds-WP_000072067.1;Parent=gene-C7A06_RS00020;Dbxref=Genbank:WP_000072067.1;Name=WP_000072067.1;Ontology_term=GO:0006265,GO:0003918,GO:0009330;gbkey=CDS;gene=gyrB;gene_id=nbis-gene-4;go_component=DNA topoisomerase type II (double strand cut%2C ATP-hydrolyzing) complex|0009330||IEA;go_function=DNA topoisomerase type II (double strand cut%2C ATP-hydrolyzing) activity|0003918||IEA;go_process=DNA topological change|0006265||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_005121480.1;locus_tag=C7A06_RS00020;product=DNA topoisomerase (ATP-hydrolyzing) subunit B;protein_id=WP_000072067.1;transcript_id=gene-C7A06_RS00020;transl_table=11 +NZ_CP027599.1 RefSeq gene 5908 6306 . + . ID=nbis-gene-5;Name=yidB;gbkey=Gene;gene=yidB;gene_biotype=protein_coding;gene_id=nbis-gene-5;locus_tag=C7A06_RS00025 +NZ_CP027599.1 RefSeq transcript 5908 6306 . + . ID=gene-C7A06_RS00025;Parent=nbis-gene-5;Name=yidB;gbkey=Gene;gene=yidB;gene_biotype=protein_coding;gene_id=nbis-gene-5;locus_tag=C7A06_RS00025;original_biotype=mrna;transcript_id=gene-C7A06_RS00025 +NZ_CP027599.1 Protein Homology exon 5908 6306 . + . ID=nbis-exon-5;Parent=gene-C7A06_RS00025;Dbxref=Genbank:WP_000522208.1;Name=WP_000522208.1;gbkey=CDS;gene=yidB;gene_id=nbis-gene-5;inference=COORDINATES: similar to AA sequence:RefSeq:NP_418153.4;locus_tag=C7A06_RS00025;product=YidB family protein;protein_id=WP_000522208.1;transcript_id=gene-C7A06_RS00025;transl_table=11 +NZ_CP027599.1 Protein Homology CDS 5908 6306 . + 0 ID=cds-WP_000522208.1;Parent=gene-C7A06_RS00025;Dbxref=Genbank:WP_000522208.1;Name=WP_000522208.1;gbkey=CDS;gene=yidB;gene_id=nbis-gene-5;inference=COORDINATES: similar to AA sequence:RefSeq:NP_418153.4;locus_tag=C7A06_RS00025;product=YidB family protein;protein_id=WP_000522208.1;transcript_id=gene-C7A06_RS00025;transl_table=11 +NZ_CP027599.1 RefSeq gene 6421 7233 . + . ID=nbis-gene-6;Name=yidA;gbkey=Gene;gene=yidA;gene_biotype=protein_coding;gene_id=nbis-gene-6;locus_tag=C7A06_RS00030 +NZ_CP027599.1 RefSeq transcript 6421 7233 . + . ID=gene-C7A06_RS00030;Parent=nbis-gene-6;Name=yidA;gbkey=Gene;gene=yidA;gene_biotype=protein_coding;gene_id=nbis-gene-6;locus_tag=C7A06_RS00030;original_biotype=mrna;transcript_id=gene-C7A06_RS00030 +NZ_CP027599.1 Protein Homology exon 6421 7233 . + . ID=nbis-exon-6;Parent=gene-C7A06_RS00030;Dbxref=Genbank:WP_000985541.1;Name=WP_000985541.1;Ontology_term=GO:0016787;gbkey=CDS;gene=yidA;gene_id=nbis-gene-6;go_function=hydrolase activity|0016787||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:NP_418152.1;locus_tag=C7A06_RS00030;product=sugar-phosphatase;protein_id=WP_000985541.1;transcript_id=gene-C7A06_RS00030;transl_table=11 +NZ_CP027599.1 Protein Homology CDS 6421 7233 . + 0 ID=cds-WP_000985541.1;Parent=gene-C7A06_RS00030;Dbxref=Genbank:WP_000985541.1;Name=WP_000985541.1;Ontology_term=GO:0016787;gbkey=CDS;gene=yidA;gene_id=nbis-gene-6;go_function=hydrolase activity|0016787||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:NP_418152.1;locus_tag=C7A06_RS00030;product=sugar-phosphatase;protein_id=WP_000985541.1;transcript_id=gene-C7A06_RS00030;transl_table=11 +NZ_CP027599.1 RefSeq gene 7279 7935 . - . ID=nbis-gene-7;Name=C7A06_RS00035;gbkey=Gene;gene_biotype=protein_coding;gene_id=nbis-gene-7;locus_tag=C7A06_RS00035 +NZ_CP027599.1 RefSeq transcript 7279 7935 . - . ID=gene-C7A06_RS00035;Parent=nbis-gene-7;Name=C7A06_RS00035;gbkey=Gene;gene_biotype=protein_coding;gene_id=nbis-gene-7;locus_tag=C7A06_RS00035;original_biotype=mrna;transcript_id=gene-C7A06_RS00035 +NZ_CP027599.1 Protein Homology exon 7279 7935 . - . ID=nbis-exon-7;Parent=gene-C7A06_RS00035;Dbxref=Genbank:WP_000772931.1;Name=WP_000772931.1;gbkey=CDS;gene_id=nbis-gene-7;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709504.1;locus_tag=C7A06_RS00035;product=hypothetical protein;protein_id=WP_000772931.1;transcript_id=gene-C7A06_RS00035;transl_table=11 +NZ_CP027599.1 Protein Homology CDS 7279 7935 . - 0 ID=cds-WP_000772931.1;Parent=gene-C7A06_RS00035;Dbxref=Genbank:WP_000772931.1;Name=WP_000772931.1;gbkey=CDS;gene_id=nbis-gene-7;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709504.1;locus_tag=C7A06_RS00035;product=hypothetical protein;protein_id=WP_000772931.1;transcript_id=gene-C7A06_RS00035;transl_table=11 +NZ_CP027599.1 RefSeq gene 8213 8902 . + . ID=nbis-gene-8;Name=dgoR;gbkey=Gene;gene=dgoR;gene_biotype=protein_coding;gene_id=nbis-gene-8;locus_tag=C7A06_RS00040 +NZ_CP027599.1 RefSeq transcript 8213 8902 . + . ID=gene-C7A06_RS00040;Parent=nbis-gene-8;Name=dgoR;gbkey=Gene;gene=dgoR;gene_biotype=protein_coding;gene_id=nbis-gene-8;locus_tag=C7A06_RS00040;original_biotype=mrna;transcript_id=gene-C7A06_RS00040 +NZ_CP027599.1 Protein Homology exon 8213 8902 . + . ID=nbis-exon-8;Parent=gene-C7A06_RS00040;Dbxref=Genbank:WP_000174305.1;Name=WP_000174305.1;gbkey=CDS;gene=dgoR;gene_id=nbis-gene-8;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709505.1;locus_tag=C7A06_RS00040;product=D-galactonate utilization transcriptional regulator DgoR;protein_id=WP_000174305.1;transcript_id=gene-C7A06_RS00040;transl_table=11 +NZ_CP027599.1 Protein Homology CDS 8213 8902 . + 0 ID=cds-WP_000174305.1;Parent=gene-C7A06_RS00040;Dbxref=Genbank:WP_000174305.1;Name=WP_000174305.1;gbkey=CDS;gene=dgoR;gene_id=nbis-gene-8;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709505.1;locus_tag=C7A06_RS00040;product=D-galactonate utilization transcriptional regulator DgoR;protein_id=WP_000174305.1;transcript_id=gene-C7A06_RS00040;transl_table=11 +NZ_CP027599.1 RefSeq gene 8899 9777 . + . ID=nbis-gene-9;Name=dgoK;gbkey=Gene;gene=dgoK;gene_biotype=protein_coding;gene_id=nbis-gene-9;locus_tag=C7A06_RS00045 +NZ_CP027599.1 RefSeq transcript 8899 9777 . + . ID=gene-C7A06_RS00045;Parent=nbis-gene-9;Name=dgoK;gbkey=Gene;gene=dgoK;gene_biotype=protein_coding;gene_id=nbis-gene-9;locus_tag=C7A06_RS00045;original_biotype=mrna;transcript_id=gene-C7A06_RS00045 +NZ_CP027599.1 Protein Homology exon 8899 9777 . + . ID=nbis-exon-9;Parent=gene-C7A06_RS00045;Dbxref=Genbank:WP_000127112.1;Name=WP_000127112.1;gbkey=CDS;gene=dgoK;gene_id=nbis-gene-9;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709506.1;locus_tag=C7A06_RS00045;product=2-dehydro-3-deoxygalactonokinase;protein_id=WP_000127112.1;transcript_id=gene-C7A06_RS00045;transl_table=11 +NZ_CP027599.1 Protein Homology CDS 8899 9777 . + 0 ID=cds-WP_000127112.1;Parent=gene-C7A06_RS00045;Dbxref=Genbank:WP_000127112.1;Name=WP_000127112.1;gbkey=CDS;gene=dgoK;gene_id=nbis-gene-9;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709506.1;locus_tag=C7A06_RS00045;product=2-dehydro-3-deoxygalactonokinase;protein_id=WP_000127112.1;transcript_id=gene-C7A06_RS00045;transl_table=11 +NZ_CP027599.1 RefSeq gene 9761 10378 . + . ID=nbis-gene-10;Name=dgoA;gbkey=Gene;gene=dgoA;gene_biotype=protein_coding;gene_id=nbis-gene-10;locus_tag=C7A06_RS00050 +NZ_CP027599.1 RefSeq transcript 9761 10378 . + . ID=gene-C7A06_RS00050;Parent=nbis-gene-10;Name=dgoA;gbkey=Gene;gene=dgoA;gene_biotype=protein_coding;gene_id=nbis-gene-10;locus_tag=C7A06_RS00050;original_biotype=mrna;transcript_id=gene-C7A06_RS00050 +NZ_CP027599.1 Protein Homology exon 9761 10378 . + . ID=nbis-exon-10;Parent=gene-C7A06_RS00050;Dbxref=Genbank:WP_001198699.1;Name=WP_001198699.1;gbkey=CDS;gene=dgoA;gene_id=nbis-gene-10;inference=COORDINATES: similar to AA sequence:RefSeq:YP_026238.1;locus_tag=C7A06_RS00050;product=2-dehydro-3-deoxy-6-phosphogalactonate aldolase;protein_id=WP_001198699.1;transcript_id=gene-C7A06_RS00050;transl_table=11 +NZ_CP027599.1 Protein Homology CDS 9761 10378 . + 0 ID=cds-WP_001198699.1;Parent=gene-C7A06_RS00050;Dbxref=Genbank:WP_001198699.1;Name=WP_001198699.1;gbkey=CDS;gene=dgoA;gene_id=nbis-gene-10;inference=COORDINATES: similar to AA sequence:RefSeq:YP_026238.1;locus_tag=C7A06_RS00050;product=2-dehydro-3-deoxy-6-phosphogalactonate aldolase;protein_id=WP_001198699.1;transcript_id=gene-C7A06_RS00050;transl_table=11 +NZ_CP027599.1 RefSeq gene 10375 11523 . + . ID=nbis-gene-11;Name=dgoD;gbkey=Gene;gene=dgoD;gene_biotype=protein_coding;gene_id=nbis-gene-11;locus_tag=C7A06_RS00055 +NZ_CP027599.1 RefSeq transcript 10375 11523 . + . ID=gene-C7A06_RS00055;Parent=nbis-gene-11;Name=dgoD;gbkey=Gene;gene=dgoD;gene_biotype=protein_coding;gene_id=nbis-gene-11;locus_tag=C7A06_RS00055;original_biotype=mrna;transcript_id=gene-C7A06_RS00055 +NZ_CP027599.1 Protein Homology exon 10375 11523 . + . ID=nbis-exon-11;Parent=gene-C7A06_RS00055;Dbxref=Genbank:WP_000705001.1;Name=WP_000705001.1;Ontology_term=GO:0009063,GO:0008869;gbkey=CDS;gene=dgoD;gene_id=nbis-gene-11;go_function=galactonate dehydratase activity|0008869||IEA;go_process=cellular amino acid catabolic process|0009063||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_020077623.1;locus_tag=C7A06_RS00055;product=galactonate dehydratase;protein_id=WP_000705001.1;transcript_id=gene-C7A06_RS00055;transl_table=11 +NZ_CP027599.1 Protein Homology CDS 10375 11523 . + 0 ID=cds-WP_000705001.1;Parent=gene-C7A06_RS00055;Dbxref=Genbank:WP_000705001.1;Name=WP_000705001.1;Ontology_term=GO:0009063,GO:0008869;gbkey=CDS;gene=dgoD;gene_id=nbis-gene-11;go_function=galactonate dehydratase activity|0008869||IEA;go_process=cellular amino acid catabolic process|0009063||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_020077623.1;locus_tag=C7A06_RS00055;product=galactonate dehydratase;protein_id=WP_000705001.1;transcript_id=gene-C7A06_RS00055;transl_table=11 +NZ_CP027599.1 RefSeq gene 11598 12935 . + . ID=nbis-gene-12;Name=dgoT;gbkey=Gene;gene=dgoT;gene_biotype=protein_coding;gene_id=nbis-gene-12;locus_tag=C7A06_RS00060 +NZ_CP027599.1 RefSeq transcript 11598 12935 . + . ID=gene-C7A06_RS00060;Parent=nbis-gene-12;Name=dgoT;gbkey=Gene;gene=dgoT;gene_biotype=protein_coding;gene_id=nbis-gene-12;locus_tag=C7A06_RS00060;original_biotype=mrna;transcript_id=gene-C7A06_RS00060 +NZ_CP027599.1 Protein Homology exon 11598 12935 . + . ID=nbis-exon-12;Parent=gene-C7A06_RS00060;Dbxref=Genbank:WP_000253455.1;Name=WP_000253455.1;gbkey=CDS;gene=dgoT;gene_id=nbis-gene-12;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709507.1;locus_tag=C7A06_RS00060;product=MFS transporter;protein_id=WP_000253455.1;transcript_id=gene-C7A06_RS00060;transl_table=11 +NZ_CP027599.1 Protein Homology CDS 11598 12935 . + 0 ID=cds-WP_000253455.1;Parent=gene-C7A06_RS00060;Dbxref=Genbank:WP_000253455.1;Name=WP_000253455.1;gbkey=CDS;gene=dgoT;gene_id=nbis-gene-12;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709507.1;locus_tag=C7A06_RS00060;product=MFS transporter;protein_id=WP_000253455.1;transcript_id=gene-C7A06_RS00060;transl_table=11
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test05.gtf Tue May 23 13:43:07 2023 +0000 @@ -0,0 +1,32 @@ +##gtf-version 2 +##gtf-version 3 +#!gff-spec-version 1.21 +#!processor NCBI annotwriter +#!genome-build ASM301845v1 +#!genome-build-accession NCBI_Assembly:GCF_003018455.1 +#!annotation-date 05/25/2022 04:54:31 +#!annotation-source NCBI RefSeq +##sequence-region NZ_CP027599.1 1 5942969 +##species https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=562 +NZ_CP027599.1 Protein Homology exon 1052 2152 . + . gene_id "nbis-gene-2"; transcript_id "gene-C7A06_RS00010"; Dbxref "Genbank:WP_000673464.1"; ID "nbis-exon-2"; Name "WP_000673464.1"; Ontology_term "GO:0006260" "GO:0003887" "GO:0009360"; Parent "gene-C7A06_RS00010"; gbkey "CDS"; gene "dnaN"; go_component "DNA polymerase III complex|0009360||IEA"; go_function "DNA-directed DNA polymerase activity|0003887||IEA"; go_process "DNA replication|0006260||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_006177590.1"; locus_tag "C7A06_RS00010"; product "DNA polymerase III subunit beta"; protein_id "WP_000673464.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 1052 2152 . + 0 gene_id "nbis-gene-2"; transcript_id "gene-C7A06_RS00010"; Dbxref "Genbank:WP_000673464.1"; ID "cds-WP_000673464.1"; Name "WP_000673464.1"; Ontology_term "GO:0006260" "GO:0003887" "GO:0009360"; Parent "gene-C7A06_RS00010"; gbkey "CDS"; gene "dnaN"; go_component "DNA polymerase III complex|0009360||IEA"; go_function "DNA-directed DNA polymerase activity|0003887||IEA"; go_process "DNA replication|0006260||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_006177590.1"; locus_tag "C7A06_RS00010"; product "DNA polymerase III subunit beta"; protein_id "WP_000673464.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology exon 2152 3225 . + . gene_id "nbis-gene-3"; transcript_id "gene-C7A06_RS00015"; Dbxref "Genbank:WP_000060112.1"; ID "nbis-exon-3"; Name "WP_000060112.1"; Ontology_term "GO:0006281" "GO:0003697" "GO:0005524"; Parent "gene-C7A06_RS00015"; gbkey "CDS"; gene "recF"; go_function "single-stranded DNA binding|0003697||IEA" "ATP binding|0005524||IEA"; go_process "DNA repair|0006281||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_005121479.1"; locus_tag "C7A06_RS00015"; product "DNA replication/repair protein RecF"; protein_id "WP_000060112.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 2152 3225 . + 0 gene_id "nbis-gene-3"; transcript_id "gene-C7A06_RS00015"; Dbxref "Genbank:WP_000060112.1"; ID "cds-WP_000060112.1"; Name "WP_000060112.1"; Ontology_term "GO:0006281" "GO:0003697" "GO:0005524"; Parent "gene-C7A06_RS00015"; gbkey "CDS"; gene "recF"; go_function "single-stranded DNA binding|0003697||IEA" "ATP binding|0005524||IEA"; go_process "DNA repair|0006281||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_005121479.1"; locus_tag "C7A06_RS00015"; product "DNA replication/repair protein RecF"; protein_id "WP_000060112.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology exon 3254 5668 . + . gene_id "nbis-gene-4"; transcript_id "gene-C7A06_RS00020"; Dbxref "Genbank:WP_000072067.1"; ID "nbis-exon-4"; Name "WP_000072067.1"; Ontology_term "GO:0006265" "GO:0003918" "GO:0009330"; Parent "gene-C7A06_RS00020"; gbkey "CDS"; gene "gyrB"; go_component "DNA topoisomerase type II (double strand cut, ATP-hydrolyzing) complex|0009330||IEA"; go_function "DNA topoisomerase type II (double strand cut, ATP-hydrolyzing) activity|0003918||IEA"; go_process "DNA topological change|0006265||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_005121480.1"; locus_tag "C7A06_RS00020"; product "DNA topoisomerase (ATP-hydrolyzing) subunit B"; protein_id "WP_000072067.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 3254 5668 . + 0 gene_id "nbis-gene-4"; transcript_id "gene-C7A06_RS00020"; Dbxref "Genbank:WP_000072067.1"; ID "cds-WP_000072067.1"; Name "WP_000072067.1"; Ontology_term "GO:0006265" "GO:0003918" "GO:0009330"; Parent "gene-C7A06_RS00020"; gbkey "CDS"; gene "gyrB"; go_component "DNA topoisomerase type II (double strand cut, ATP-hydrolyzing) complex|0009330||IEA"; go_function "DNA topoisomerase type II (double strand cut, ATP-hydrolyzing) activity|0003918||IEA"; go_process "DNA topological change|0006265||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_005121480.1"; locus_tag "C7A06_RS00020"; product "DNA topoisomerase (ATP-hydrolyzing) subunit B"; protein_id "WP_000072067.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology exon 5908 6306 . + . gene_id "nbis-gene-5"; transcript_id "gene-C7A06_RS00025"; Dbxref "Genbank:WP_000522208.1"; ID "nbis-exon-5"; Name "WP_000522208.1"; Parent "gene-C7A06_RS00025"; gbkey "CDS"; gene "yidB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418153.4"; locus_tag "C7A06_RS00025"; product "YidB family protein"; protein_id "WP_000522208.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 5908 6306 . + 0 gene_id "nbis-gene-5"; transcript_id "gene-C7A06_RS00025"; Dbxref "Genbank:WP_000522208.1"; ID "cds-WP_000522208.1"; Name "WP_000522208.1"; Parent "gene-C7A06_RS00025"; gbkey "CDS"; gene "yidB"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418153.4"; locus_tag "C7A06_RS00025"; product "YidB family protein"; protein_id "WP_000522208.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology exon 6421 7233 . + . gene_id "nbis-gene-6"; transcript_id "gene-C7A06_RS00030"; Dbxref "Genbank:WP_000985541.1"; ID "nbis-exon-6"; Name "WP_000985541.1"; Ontology_term "GO:0016787"; Parent "gene-C7A06_RS00030"; gbkey "CDS"; gene "yidA"; go_function "hydrolase activity|0016787||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418152.1"; locus_tag "C7A06_RS00030"; product "sugar-phosphatase"; protein_id "WP_000985541.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 6421 7233 . + 0 gene_id "nbis-gene-6"; transcript_id "gene-C7A06_RS00030"; Dbxref "Genbank:WP_000985541.1"; ID "cds-WP_000985541.1"; Name "WP_000985541.1"; Ontology_term "GO:0016787"; Parent "gene-C7A06_RS00030"; gbkey "CDS"; gene "yidA"; go_function "hydrolase activity|0016787||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_418152.1"; locus_tag "C7A06_RS00030"; product "sugar-phosphatase"; protein_id "WP_000985541.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology exon 7279 7935 . - . gene_id "nbis-gene-7"; transcript_id "gene-C7A06_RS00035"; Dbxref "Genbank:WP_000772931.1"; ID "nbis-exon-7"; Name "WP_000772931.1"; Parent "gene-C7A06_RS00035"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709504.1"; locus_tag "C7A06_RS00035"; product "hypothetical protein"; protein_id "WP_000772931.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 7279 7935 . - 0 gene_id "nbis-gene-7"; transcript_id "gene-C7A06_RS00035"; Dbxref "Genbank:WP_000772931.1"; ID "cds-WP_000772931.1"; Name "WP_000772931.1"; Parent "gene-C7A06_RS00035"; gbkey "CDS"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709504.1"; locus_tag "C7A06_RS00035"; product "hypothetical protein"; protein_id "WP_000772931.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology exon 8213 8902 . + . gene_id "nbis-gene-8"; transcript_id "gene-C7A06_RS00040"; Dbxref "Genbank:WP_000174305.1"; ID "nbis-exon-8"; Name "WP_000174305.1"; Parent "gene-C7A06_RS00040"; gbkey "CDS"; gene "dgoR"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709505.1"; locus_tag "C7A06_RS00040"; product "D-galactonate utilization transcriptional regulator DgoR"; protein_id "WP_000174305.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 8213 8902 . + 0 gene_id "nbis-gene-8"; transcript_id "gene-C7A06_RS00040"; Dbxref "Genbank:WP_000174305.1"; ID "cds-WP_000174305.1"; Name "WP_000174305.1"; Parent "gene-C7A06_RS00040"; gbkey "CDS"; gene "dgoR"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709505.1"; locus_tag "C7A06_RS00040"; product "D-galactonate utilization transcriptional regulator DgoR"; protein_id "WP_000174305.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology exon 8899 9777 . + . gene_id "nbis-gene-9"; transcript_id "gene-C7A06_RS00045"; Dbxref "Genbank:WP_000127112.1"; ID "nbis-exon-9"; Name "WP_000127112.1"; Parent "gene-C7A06_RS00045"; gbkey "CDS"; gene "dgoK"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709506.1"; locus_tag "C7A06_RS00045"; product "2-dehydro-3-deoxygalactonokinase"; protein_id "WP_000127112.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 8899 9777 . + 0 gene_id "nbis-gene-9"; transcript_id "gene-C7A06_RS00045"; Dbxref "Genbank:WP_000127112.1"; ID "cds-WP_000127112.1"; Name "WP_000127112.1"; Parent "gene-C7A06_RS00045"; gbkey "CDS"; gene "dgoK"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709506.1"; locus_tag "C7A06_RS00045"; product "2-dehydro-3-deoxygalactonokinase"; protein_id "WP_000127112.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology exon 9761 10378 . + . gene_id "nbis-gene-10"; transcript_id "gene-C7A06_RS00050"; Dbxref "Genbank:WP_001198699.1"; ID "nbis-exon-10"; Name "WP_001198699.1"; Parent "gene-C7A06_RS00050"; gbkey "CDS"; gene "dgoA"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_026238.1"; locus_tag "C7A06_RS00050"; product "2-dehydro-3-deoxy-6-phosphogalactonate aldolase"; protein_id "WP_001198699.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 9761 10378 . + 0 gene_id "nbis-gene-10"; transcript_id "gene-C7A06_RS00050"; Dbxref "Genbank:WP_001198699.1"; ID "cds-WP_001198699.1"; Name "WP_001198699.1"; Parent "gene-C7A06_RS00050"; gbkey "CDS"; gene "dgoA"; inference "COORDINATES: similar to AA sequence:RefSeq:YP_026238.1"; locus_tag "C7A06_RS00050"; product "2-dehydro-3-deoxy-6-phosphogalactonate aldolase"; protein_id "WP_001198699.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology exon 10375 11523 . + . gene_id "nbis-gene-11"; transcript_id "gene-C7A06_RS00055"; Dbxref "Genbank:WP_000705001.1"; ID "nbis-exon-11"; Name "WP_000705001.1"; Ontology_term "GO:0009063" "GO:0008869"; Parent "gene-C7A06_RS00055"; gbkey "CDS"; gene "dgoD"; go_function "galactonate dehydratase activity|0008869||IEA"; go_process "cellular amino acid catabolic process|0009063||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_020077623.1"; locus_tag "C7A06_RS00055"; product "galactonate dehydratase"; protein_id "WP_000705001.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 10375 11523 . + 0 gene_id "nbis-gene-11"; transcript_id "gene-C7A06_RS00055"; Dbxref "Genbank:WP_000705001.1"; ID "cds-WP_000705001.1"; Name "WP_000705001.1"; Ontology_term "GO:0009063" "GO:0008869"; Parent "gene-C7A06_RS00055"; gbkey "CDS"; gene "dgoD"; go_function "galactonate dehydratase activity|0008869||IEA"; go_process "cellular amino acid catabolic process|0009063||IEA"; inference "COORDINATES: similar to AA sequence:RefSeq:WP_020077623.1"; locus_tag "C7A06_RS00055"; product "galactonate dehydratase"; protein_id "WP_000705001.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology exon 11598 12935 . + . gene_id "nbis-gene-12"; transcript_id "gene-C7A06_RS00060"; Dbxref "Genbank:WP_000253455.1"; ID "nbis-exon-12"; Name "WP_000253455.1"; Parent "gene-C7A06_RS00060"; gbkey "CDS"; gene "dgoT"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709507.1"; locus_tag "C7A06_RS00060"; product "MFS transporter"; protein_id "WP_000253455.1"; transl_table "11"; +NZ_CP027599.1 Protein Homology CDS 11598 12935 . + 0 gene_id "nbis-gene-12"; transcript_id "gene-C7A06_RS00060"; Dbxref "Genbank:WP_000253455.1"; ID "cds-WP_000253455.1"; Name "WP_000253455.1"; Parent "gene-C7A06_RS00060"; gbkey "CDS"; gene "dgoT"; inference "COORDINATES: similar to AA sequence:RefSeq:NP_709507.1"; locus_tag "C7A06_RS00060"; product "MFS transporter"; protein_id "WP_000253455.1"; transl_table "11";
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test06.gff Tue May 23 13:43:07 2023 +0000 @@ -0,0 +1,50 @@ +##gff-version 3 +##gtf-version 3 +#!gff-spec-version 1.21 +#!processor NCBI annotwriter +#!genome-build ASM301845v1 +#!genome-build-accession NCBI_Assembly:GCF_003018455.1 +#!annotation-date 05/25/2022 04:54:31 +#!annotation-source NCBI RefSeq +##sequence-region NZ_CP027599.1 1 5942969 +##species https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=562 +NZ_CP027599.1 RefSeq gene 1052 2152 . + . ID=nbis-gene-2;Name=dnaN;gbkey=Gene;gene=dnaN;gene_biotype=protein_coding;gene_id=nbis-gene-2;locus_tag=C7A06_RS00010 +NZ_CP027599.1 RefSeq transcript 1052 2152 . + . ID=gene-C7A06_RS00010;Parent=nbis-gene-2;Name=dnaN;gbkey=Gene;gene=dnaN;gene_biotype=protein_coding;gene_id=nbis-gene-2;locus_tag=C7A06_RS00010;original_biotype=mrna;transcript_id=gene-C7A06_RS00010 +NZ_CP027599.1 Protein Homology exon 1052 2152 . + . ID=nbis-exon-2;Parent=gene-C7A06_RS00010;Dbxref=Genbank:WP_000673464.1;Name=WP_000673464.1;Ontology_term=GO:0006260,GO:0003887,GO:0009360;gbkey=CDS;gene=dnaN;gene_id=nbis-gene-2;go_component=DNA polymerase III complex|0009360||IEA;go_function=DNA-directed DNA polymerase activity|0003887||IEA;go_process=DNA replication|0006260||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_006177590.1;locus_tag=C7A06_RS00010;product=DNA polymerase III subunit beta;protein_id=WP_000673464.1;transcript_id=gene-C7A06_RS00010;transl_table=11 +NZ_CP027599.1 Protein Homology CDS 1052 2152 . + 0 ID=cds-WP_000673464.1;Parent=gene-C7A06_RS00010;Dbxref=Genbank:WP_000673464.1;Name=WP_000673464.1;Ontology_term=GO:0006260,GO:0003887,GO:0009360;gbkey=CDS;gene=dnaN;gene_id=nbis-gene-2;go_component=DNA polymerase III complex|0009360||IEA;go_function=DNA-directed DNA polymerase activity|0003887||IEA;go_process=DNA replication|0006260||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_006177590.1;locus_tag=C7A06_RS00010;product=DNA polymerase III subunit beta;protein_id=WP_000673464.1;transcript_id=gene-C7A06_RS00010;transl_table=11 +NZ_CP027599.1 RefSeq gene 2152 3225 . + . ID=nbis-gene-3;Name=recF;gbkey=Gene;gene=recF;gene_biotype=protein_coding;gene_id=nbis-gene-3;locus_tag=C7A06_RS00015 +NZ_CP027599.1 RefSeq transcript 2152 3225 . + . ID=gene-C7A06_RS00015;Parent=nbis-gene-3;Name=recF;gbkey=Gene;gene=recF;gene_biotype=protein_coding;gene_id=nbis-gene-3;locus_tag=C7A06_RS00015;original_biotype=mrna;transcript_id=gene-C7A06_RS00015 +NZ_CP027599.1 Protein Homology exon 2152 3225 . + . ID=nbis-exon-3;Parent=gene-C7A06_RS00015;Dbxref=Genbank:WP_000060112.1;Name=WP_000060112.1;Ontology_term=GO:0006281,GO:0003697,GO:0005524;gbkey=CDS;gene=recF;gene_id=nbis-gene-3;go_function=single-stranded DNA binding|0003697||IEA,ATP binding|0005524||IEA;go_process=DNA repair|0006281||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_005121479.1;locus_tag=C7A06_RS00015;product=DNA replication/repair protein RecF;protein_id=WP_000060112.1;transcript_id=gene-C7A06_RS00015;transl_table=11 +NZ_CP027599.1 Protein Homology CDS 2152 3225 . + 0 ID=cds-WP_000060112.1;Parent=gene-C7A06_RS00015;Dbxref=Genbank:WP_000060112.1;Name=WP_000060112.1;Ontology_term=GO:0006281,GO:0003697,GO:0005524;gbkey=CDS;gene=recF;gene_id=nbis-gene-3;go_function=single-stranded DNA binding|0003697||IEA,ATP binding|0005524||IEA;go_process=DNA repair|0006281||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_005121479.1;locus_tag=C7A06_RS00015;product=DNA replication/repair protein RecF;protein_id=WP_000060112.1;transcript_id=gene-C7A06_RS00015;transl_table=11 +NZ_CP027599.1 RefSeq gene 3254 5668 . + . ID=nbis-gene-4;Name=gyrB;gbkey=Gene;gene=gyrB;gene_biotype=protein_coding;gene_id=nbis-gene-4;locus_tag=C7A06_RS00020 +NZ_CP027599.1 RefSeq transcript 3254 5668 . + . ID=gene-C7A06_RS00020;Parent=nbis-gene-4;Name=gyrB;gbkey=Gene;gene=gyrB;gene_biotype=protein_coding;gene_id=nbis-gene-4;locus_tag=C7A06_RS00020;original_biotype=mrna;transcript_id=gene-C7A06_RS00020 +NZ_CP027599.1 Protein Homology exon 3254 5668 . + . ID=nbis-exon-4;Parent=gene-C7A06_RS00020;Dbxref=Genbank:WP_000072067.1;Name=WP_000072067.1;Ontology_term=GO:0006265,GO:0003918,GO:0009330;gbkey=CDS;gene=gyrB;gene_id=nbis-gene-4;go_component=DNA topoisomerase type II (double strand cut%2C ATP-hydrolyzing) complex|0009330||IEA;go_function=DNA topoisomerase type II (double strand cut%2C ATP-hydrolyzing) activity|0003918||IEA;go_process=DNA topological change|0006265||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_005121480.1;locus_tag=C7A06_RS00020;product=DNA topoisomerase (ATP-hydrolyzing) subunit B;protein_id=WP_000072067.1;transcript_id=gene-C7A06_RS00020;transl_table=11 +NZ_CP027599.1 Protein Homology CDS 3254 5668 . + 0 ID=cds-WP_000072067.1;Parent=gene-C7A06_RS00020;Dbxref=Genbank:WP_000072067.1;Name=WP_000072067.1;Ontology_term=GO:0006265,GO:0003918,GO:0009330;gbkey=CDS;gene=gyrB;gene_id=nbis-gene-4;go_component=DNA topoisomerase type II (double strand cut%2C ATP-hydrolyzing) complex|0009330||IEA;go_function=DNA topoisomerase type II (double strand cut%2C ATP-hydrolyzing) activity|0003918||IEA;go_process=DNA topological change|0006265||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_005121480.1;locus_tag=C7A06_RS00020;product=DNA topoisomerase (ATP-hydrolyzing) subunit B;protein_id=WP_000072067.1;transcript_id=gene-C7A06_RS00020;transl_table=11 +NZ_CP027599.1 RefSeq gene 5908 6306 . + . ID=nbis-gene-5;Name=yidB;gbkey=Gene;gene=yidB;gene_biotype=protein_coding;gene_id=nbis-gene-5;locus_tag=C7A06_RS00025 +NZ_CP027599.1 RefSeq transcript 5908 6306 . + . ID=gene-C7A06_RS00025;Parent=nbis-gene-5;Name=yidB;gbkey=Gene;gene=yidB;gene_biotype=protein_coding;gene_id=nbis-gene-5;locus_tag=C7A06_RS00025;original_biotype=mrna;transcript_id=gene-C7A06_RS00025 +NZ_CP027599.1 Protein Homology exon 5908 6306 . + . ID=nbis-exon-5;Parent=gene-C7A06_RS00025;Dbxref=Genbank:WP_000522208.1;Name=WP_000522208.1;gbkey=CDS;gene=yidB;gene_id=nbis-gene-5;inference=COORDINATES: similar to AA sequence:RefSeq:NP_418153.4;locus_tag=C7A06_RS00025;product=YidB family protein;protein_id=WP_000522208.1;transcript_id=gene-C7A06_RS00025;transl_table=11 +NZ_CP027599.1 Protein Homology CDS 5908 6306 . + 0 ID=cds-WP_000522208.1;Parent=gene-C7A06_RS00025;Dbxref=Genbank:WP_000522208.1;Name=WP_000522208.1;gbkey=CDS;gene=yidB;gene_id=nbis-gene-5;inference=COORDINATES: similar to AA sequence:RefSeq:NP_418153.4;locus_tag=C7A06_RS00025;product=YidB family protein;protein_id=WP_000522208.1;transcript_id=gene-C7A06_RS00025;transl_table=11 +NZ_CP027599.1 RefSeq gene 6421 7233 . + . ID=nbis-gene-6;Name=yidA;gbkey=Gene;gene=yidA;gene_biotype=protein_coding;gene_id=nbis-gene-6;locus_tag=C7A06_RS00030 +NZ_CP027599.1 RefSeq transcript 6421 7233 . + . ID=gene-C7A06_RS00030;Parent=nbis-gene-6;Name=yidA;gbkey=Gene;gene=yidA;gene_biotype=protein_coding;gene_id=nbis-gene-6;locus_tag=C7A06_RS00030;original_biotype=mrna;transcript_id=gene-C7A06_RS00030 +NZ_CP027599.1 Protein Homology exon 6421 7233 . + . ID=nbis-exon-6;Parent=gene-C7A06_RS00030;Dbxref=Genbank:WP_000985541.1;Name=WP_000985541.1;Ontology_term=GO:0016787;gbkey=CDS;gene=yidA;gene_id=nbis-gene-6;go_function=hydrolase activity|0016787||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:NP_418152.1;locus_tag=C7A06_RS00030;product=sugar-phosphatase;protein_id=WP_000985541.1;transcript_id=gene-C7A06_RS00030;transl_table=11 +NZ_CP027599.1 Protein Homology CDS 6421 7233 . + 0 ID=cds-WP_000985541.1;Parent=gene-C7A06_RS00030;Dbxref=Genbank:WP_000985541.1;Name=WP_000985541.1;Ontology_term=GO:0016787;gbkey=CDS;gene=yidA;gene_id=nbis-gene-6;go_function=hydrolase activity|0016787||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:NP_418152.1;locus_tag=C7A06_RS00030;product=sugar-phosphatase;protein_id=WP_000985541.1;transcript_id=gene-C7A06_RS00030;transl_table=11 +NZ_CP027599.1 RefSeq gene 7279 7935 . - . ID=nbis-gene-7;Name=C7A06_RS00035;gbkey=Gene;gene_biotype=protein_coding;gene_id=nbis-gene-7;locus_tag=C7A06_RS00035 +NZ_CP027599.1 RefSeq transcript 7279 7935 . - . ID=gene-C7A06_RS00035;Parent=nbis-gene-7;Name=C7A06_RS00035;gbkey=Gene;gene_biotype=protein_coding;gene_id=nbis-gene-7;locus_tag=C7A06_RS00035;original_biotype=mrna;transcript_id=gene-C7A06_RS00035 +NZ_CP027599.1 Protein Homology exon 7279 7935 . - . ID=nbis-exon-7;Parent=gene-C7A06_RS00035;Dbxref=Genbank:WP_000772931.1;Name=WP_000772931.1;gbkey=CDS;gene_id=nbis-gene-7;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709504.1;locus_tag=C7A06_RS00035;product=hypothetical protein;protein_id=WP_000772931.1;transcript_id=gene-C7A06_RS00035;transl_table=11 +NZ_CP027599.1 Protein Homology CDS 7279 7935 . - 0 ID=cds-WP_000772931.1;Parent=gene-C7A06_RS00035;Dbxref=Genbank:WP_000772931.1;Name=WP_000772931.1;gbkey=CDS;gene_id=nbis-gene-7;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709504.1;locus_tag=C7A06_RS00035;product=hypothetical protein;protein_id=WP_000772931.1;transcript_id=gene-C7A06_RS00035;transl_table=11 +NZ_CP027599.1 RefSeq gene 8213 8902 . + . ID=nbis-gene-8;Name=dgoR;gbkey=Gene;gene=dgoR;gene_biotype=protein_coding;gene_id=nbis-gene-8;locus_tag=C7A06_RS00040 +NZ_CP027599.1 RefSeq transcript 8213 8902 . + . ID=gene-C7A06_RS00040;Parent=nbis-gene-8;Name=dgoR;gbkey=Gene;gene=dgoR;gene_biotype=protein_coding;gene_id=nbis-gene-8;locus_tag=C7A06_RS00040;original_biotype=mrna;transcript_id=gene-C7A06_RS00040 +NZ_CP027599.1 Protein Homology exon 8213 8902 . + . ID=nbis-exon-8;Parent=gene-C7A06_RS00040;Dbxref=Genbank:WP_000174305.1;Name=WP_000174305.1;gbkey=CDS;gene=dgoR;gene_id=nbis-gene-8;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709505.1;locus_tag=C7A06_RS00040;product=D-galactonate utilization transcriptional regulator DgoR;protein_id=WP_000174305.1;transcript_id=gene-C7A06_RS00040;transl_table=11 +NZ_CP027599.1 Protein Homology CDS 8213 8902 . + 0 ID=cds-WP_000174305.1;Parent=gene-C7A06_RS00040;Dbxref=Genbank:WP_000174305.1;Name=WP_000174305.1;gbkey=CDS;gene=dgoR;gene_id=nbis-gene-8;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709505.1;locus_tag=C7A06_RS00040;product=D-galactonate utilization transcriptional regulator DgoR;protein_id=WP_000174305.1;transcript_id=gene-C7A06_RS00040;transl_table=11 +NZ_CP027599.1 RefSeq gene 8899 9777 . + . ID=nbis-gene-9;Name=dgoK;gbkey=Gene;gene=dgoK;gene_biotype=protein_coding;gene_id=nbis-gene-9;locus_tag=C7A06_RS00045 +NZ_CP027599.1 RefSeq transcript 8899 9777 . + . ID=gene-C7A06_RS00045;Parent=nbis-gene-9;Name=dgoK;gbkey=Gene;gene=dgoK;gene_biotype=protein_coding;gene_id=nbis-gene-9;locus_tag=C7A06_RS00045;original_biotype=mrna;transcript_id=gene-C7A06_RS00045 +NZ_CP027599.1 Protein Homology exon 8899 9777 . + . ID=nbis-exon-9;Parent=gene-C7A06_RS00045;Dbxref=Genbank:WP_000127112.1;Name=WP_000127112.1;gbkey=CDS;gene=dgoK;gene_id=nbis-gene-9;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709506.1;locus_tag=C7A06_RS00045;product=2-dehydro-3-deoxygalactonokinase;protein_id=WP_000127112.1;transcript_id=gene-C7A06_RS00045;transl_table=11 +NZ_CP027599.1 Protein Homology CDS 8899 9777 . + 0 ID=cds-WP_000127112.1;Parent=gene-C7A06_RS00045;Dbxref=Genbank:WP_000127112.1;Name=WP_000127112.1;gbkey=CDS;gene=dgoK;gene_id=nbis-gene-9;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709506.1;locus_tag=C7A06_RS00045;product=2-dehydro-3-deoxygalactonokinase;protein_id=WP_000127112.1;transcript_id=gene-C7A06_RS00045;transl_table=11 +NZ_CP027599.1 RefSeq gene 9761 10378 . + . ID=nbis-gene-10;Name=dgoA;gbkey=Gene;gene=dgoA;gene_biotype=protein_coding;gene_id=nbis-gene-10;locus_tag=C7A06_RS00050 +NZ_CP027599.1 RefSeq transcript 9761 10378 . + . ID=gene-C7A06_RS00050;Parent=nbis-gene-10;Name=dgoA;gbkey=Gene;gene=dgoA;gene_biotype=protein_coding;gene_id=nbis-gene-10;locus_tag=C7A06_RS00050;original_biotype=mrna;transcript_id=gene-C7A06_RS00050 +NZ_CP027599.1 Protein Homology exon 9761 10378 . + . ID=nbis-exon-10;Parent=gene-C7A06_RS00050;Dbxref=Genbank:WP_001198699.1;Name=WP_001198699.1;gbkey=CDS;gene=dgoA;gene_id=nbis-gene-10;inference=COORDINATES: similar to AA sequence:RefSeq:YP_026238.1;locus_tag=C7A06_RS00050;product=2-dehydro-3-deoxy-6-phosphogalactonate aldolase;protein_id=WP_001198699.1;transcript_id=gene-C7A06_RS00050;transl_table=11 +NZ_CP027599.1 Protein Homology CDS 9761 10378 . + 0 ID=cds-WP_001198699.1;Parent=gene-C7A06_RS00050;Dbxref=Genbank:WP_001198699.1;Name=WP_001198699.1;gbkey=CDS;gene=dgoA;gene_id=nbis-gene-10;inference=COORDINATES: similar to AA sequence:RefSeq:YP_026238.1;locus_tag=C7A06_RS00050;product=2-dehydro-3-deoxy-6-phosphogalactonate aldolase;protein_id=WP_001198699.1;transcript_id=gene-C7A06_RS00050;transl_table=11 +NZ_CP027599.1 RefSeq gene 10375 11523 . + . ID=nbis-gene-11;Name=dgoD;gbkey=Gene;gene=dgoD;gene_biotype=protein_coding;gene_id=nbis-gene-11;locus_tag=C7A06_RS00055 +NZ_CP027599.1 RefSeq transcript 10375 11523 . + . ID=gene-C7A06_RS00055;Parent=nbis-gene-11;Name=dgoD;gbkey=Gene;gene=dgoD;gene_biotype=protein_coding;gene_id=nbis-gene-11;locus_tag=C7A06_RS00055;original_biotype=mrna;transcript_id=gene-C7A06_RS00055 +NZ_CP027599.1 Protein Homology exon 10375 11523 . + . ID=nbis-exon-11;Parent=gene-C7A06_RS00055;Dbxref=Genbank:WP_000705001.1;Name=WP_000705001.1;Ontology_term=GO:0009063,GO:0008869;gbkey=CDS;gene=dgoD;gene_id=nbis-gene-11;go_function=galactonate dehydratase activity|0008869||IEA;go_process=cellular amino acid catabolic process|0009063||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_020077623.1;locus_tag=C7A06_RS00055;product=galactonate dehydratase;protein_id=WP_000705001.1;transcript_id=gene-C7A06_RS00055;transl_table=11 +NZ_CP027599.1 Protein Homology CDS 10375 11523 . + 0 ID=cds-WP_000705001.1;Parent=gene-C7A06_RS00055;Dbxref=Genbank:WP_000705001.1;Name=WP_000705001.1;Ontology_term=GO:0009063,GO:0008869;gbkey=CDS;gene=dgoD;gene_id=nbis-gene-11;go_function=galactonate dehydratase activity|0008869||IEA;go_process=cellular amino acid catabolic process|0009063||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_020077623.1;locus_tag=C7A06_RS00055;product=galactonate dehydratase;protein_id=WP_000705001.1;transcript_id=gene-C7A06_RS00055;transl_table=11
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test07.tabular Tue May 23 13:43:07 2023 +0000 @@ -0,0 +1,41 @@ +##gff-version 3 +NZ_CP027599.1 RefSeq gene 1052 2152 . + . +NZ_CP027599.1 RefSeq transcript 1052 2152 . + . +NZ_CP027599.1 Protein Homology exon 1052 2152 . + . +NZ_CP027599.1 Protein Homology CDS 1052 2152 . + 0 +NZ_CP027599.1 RefSeq gene 2152 3225 . + . +NZ_CP027599.1 RefSeq transcript 2152 3225 . + . +NZ_CP027599.1 Protein Homology exon 2152 3225 . + . +NZ_CP027599.1 Protein Homology CDS 2152 3225 . + 0 +NZ_CP027599.1 RefSeq gene 3254 5668 . + . +NZ_CP027599.1 RefSeq transcript 3254 5668 . + . +NZ_CP027599.1 Protein Homology exon 3254 5668 . + . +NZ_CP027599.1 Protein Homology CDS 3254 5668 . + 0 +NZ_CP027599.1 RefSeq gene 5908 6306 . + . +NZ_CP027599.1 RefSeq transcript 5908 6306 . + . +NZ_CP027599.1 Protein Homology exon 5908 6306 . + . +NZ_CP027599.1 Protein Homology CDS 5908 6306 . + 0 +NZ_CP027599.1 RefSeq gene 6421 7233 . + . +NZ_CP027599.1 RefSeq transcript 6421 7233 . + . +NZ_CP027599.1 Protein Homology exon 6421 7233 . + . +NZ_CP027599.1 Protein Homology CDS 6421 7233 . + 0 +NZ_CP027599.1 RefSeq gene 7279 7935 . - . +NZ_CP027599.1 RefSeq transcript 7279 7935 . - . +NZ_CP027599.1 Protein Homology exon 7279 7935 . - . +NZ_CP027599.1 Protein Homology CDS 7279 7935 . - 0 +NZ_CP027599.1 RefSeq gene 8213 8902 . + . +NZ_CP027599.1 RefSeq transcript 8213 8902 . + . +NZ_CP027599.1 Protein Homology exon 8213 8902 . + . +NZ_CP027599.1 Protein Homology CDS 8213 8902 . + 0 +NZ_CP027599.1 RefSeq gene 8899 9777 . + . +NZ_CP027599.1 RefSeq transcript 8899 9777 . + . +NZ_CP027599.1 Protein Homology exon 8899 9777 . + . +NZ_CP027599.1 Protein Homology CDS 8899 9777 . + 0 +NZ_CP027599.1 RefSeq gene 9761 10378 . + . +NZ_CP027599.1 RefSeq transcript 9761 10378 . + . +NZ_CP027599.1 Protein Homology exon 9761 10378 . + . +NZ_CP027599.1 Protein Homology CDS 9761 10378 . + 0 +NZ_CP027599.1 RefSeq gene 10375 11523 . + . +NZ_CP027599.1 RefSeq transcript 10375 11523 . + . +NZ_CP027599.1 Protein Homology exon 10375 11523 . + . +NZ_CP027599.1 Protein Homology CDS 10375 11523 . + 0
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test09.txt Tue May 23 13:43:07 2023 +0000 @@ -0,0 +1,80 @@ +-------------------------------------------------------------------------------- + +Compute transcript with isoforms if any + +Number of gene 10 +Number of transcript 10 +Number of cds 10 +Number of exon 10 +Number of exon in cds 10 +Number gene overlapping 4 +Number of single exon gene 10 +Number of single exon transcript 10 +mean transcripts per gene 1.0 +mean cdss per transcript 1.0 +mean exons per transcript 1.0 +mean exons per cds 1.0 +Total gene length 9795 +Total transcript length 9795 +Total cds length 9795 +Total exon length 9795 +mean gene length 979 +mean transcript length 979 +mean cds length 979 +mean exon length 979 +mean cds piece length 979 +% of genome covered by gene 0.9 +% of genome covered by transcript 0.9 +% of genome covered by cds 0.9 +% of genome covered by exon 0.9 +Longest gene 2415 +Longest transcript 2415 +Longest cds 2415 +Longest exon 2415 +Longest cds piece 2415 +Shortest gene 399 +Shortest transcript 399 +Shortest cds 399 +Shortest exon 399 +Shortest cds piece 399 + +Re-compute transcript without isoforms asked. We remove shortest isoforms if any + +Number of gene 10 +Number of transcript 10 +Number of cds 10 +Number of exon 10 +Number of exon in cds 10 +Number gene overlapping 4 +Number of single exon gene 10 +Number of single exon transcript 10 +mean transcripts per gene 1.0 +mean cdss per transcript 1.0 +mean exons per transcript 1.0 +mean exons per cds 1.0 +Total gene length 9795 +Total transcript length 9795 +Total cds length 9795 +Total exon length 9795 +mean gene length 979 +mean transcript length 979 +mean cds length 979 +mean exon length 979 +mean cds piece length 979 +% of genome covered by gene 0.9 +% of genome covered by transcript 0.9 +% of genome covered by cds 0.9 +% of genome covered by exon 0.9 +Longest gene 2415 +Longest transcript 2415 +Longest cds 2415 +Longest exon 2415 +Longest cds piece 2415 +Shortest gene 399 +Shortest transcript 399 +Shortest cds 399 +Shortest exon 399 +Shortest cds piece 399 + +-------------------------------------------------------------------------------- +
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/test-data/test10.gff Tue May 23 13:43:07 2023 +0000 @@ -0,0 +1,51 @@ +##gff-version 3 +##gtf-version 3 +#!gff-spec-version 1.21 +#!processor NCBI annotwriter +#!genome-build ASM301845v1 +#!genome-build-accession NCBI_Assembly:GCF_003018455.1 +#!annotation-date 05/25/2022 04:54:31 +#!annotation-source NCBI RefSeq +##sequence-region NZ_CP027599.1 1 5942969 +##species https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=562 +NZ_CP027599.1 RefSeq gene 1052 3225 . + . ID=nbis-gene-2;Name=dnaN,recF;gbkey=Gene;gene=dnaN,recF;gene_biotype=protein_coding;gene_id=nbis-gene-2,nbis-gene-3;locus_tag=C7A06_RS00010,C7A06_RS00015 +NZ_CP027599.1 RefSeq transcript 1052 2152 . + . ID=gene-C7A06_RS00010;Parent=nbis-gene-2;Name=dnaN;gbkey=Gene;gene=dnaN;gene_biotype=protein_coding;gene_id=nbis-gene-2;locus_tag=C7A06_RS00010;original_biotype=mrna;transcript_id=gene-C7A06_RS00010 +NZ_CP027599.1 Protein Homology exon 1052 2152 . + . ID=nbis-exon-2;Parent=gene-C7A06_RS00010;Dbxref=Genbank:WP_000673464.1;Name=WP_000673464.1;Ontology_term=GO:0006260,GO:0003887,GO:0009360;gbkey=CDS;gene=dnaN;gene_id=nbis-gene-2;go_component=DNA polymerase III complex|0009360||IEA;go_function=DNA-directed DNA polymerase activity|0003887||IEA;go_process=DNA replication|0006260||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_006177590.1;locus_tag=C7A06_RS00010;product=DNA polymerase III subunit beta;protein_id=WP_000673464.1;transcript_id=gene-C7A06_RS00010;transl_table=11 +NZ_CP027599.1 Protein Homology CDS 1052 2152 . + 0 ID=cds-WP_000673464.1;Parent=gene-C7A06_RS00010;Dbxref=Genbank:WP_000673464.1;Name=WP_000673464.1;Ontology_term=GO:0006260,GO:0003887,GO:0009360;gbkey=CDS;gene=dnaN;gene_id=nbis-gene-2;go_component=DNA polymerase III complex|0009360||IEA;go_function=DNA-directed DNA polymerase activity|0003887||IEA;go_process=DNA replication|0006260||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_006177590.1;locus_tag=C7A06_RS00010;product=DNA polymerase III subunit beta;protein_id=WP_000673464.1;transcript_id=gene-C7A06_RS00010;transl_table=11 +NZ_CP027599.1 RefSeq transcript 2152 3225 . + . ID=gene-C7A06_RS00015;Parent=nbis-gene-2;Name=recF;gbkey=Gene;gene=recF;gene_biotype=protein_coding;gene_id=nbis-gene-3;locus_tag=C7A06_RS00015;original_biotype=mrna;transcript_id=gene-C7A06_RS00015 +NZ_CP027599.1 Protein Homology exon 2152 3225 . + . ID=nbis-exon-3;Parent=gene-C7A06_RS00015;Dbxref=Genbank:WP_000060112.1;Name=WP_000060112.1;Ontology_term=GO:0006281,GO:0003697,GO:0005524;gbkey=CDS;gene=recF;gene_id=nbis-gene-3;go_function=single-stranded DNA binding|0003697||IEA,ATP binding|0005524||IEA;go_process=DNA repair|0006281||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_005121479.1;locus_tag=C7A06_RS00015;product=DNA replication/repair protein RecF;protein_id=WP_000060112.1;transcript_id=gene-C7A06_RS00015;transl_table=11 +NZ_CP027599.1 Protein Homology CDS 2152 3225 . + 0 ID=cds-WP_000060112.1;Parent=gene-C7A06_RS00015;Dbxref=Genbank:WP_000060112.1;Name=WP_000060112.1;Ontology_term=GO:0006281,GO:0003697,GO:0005524;gbkey=CDS;gene=recF;gene_id=nbis-gene-3;go_function=single-stranded DNA binding|0003697||IEA,ATP binding|0005524||IEA;go_process=DNA repair|0006281||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_005121479.1;locus_tag=C7A06_RS00015;product=DNA replication/repair protein RecF;protein_id=WP_000060112.1;transcript_id=gene-C7A06_RS00015;transl_table=11 +NZ_CP027599.1 RefSeq gene 3254 5668 . + . ID=nbis-gene-4;Name=gyrB;gbkey=Gene;gene=gyrB;gene_biotype=protein_coding;gene_id=nbis-gene-4;locus_tag=C7A06_RS00020 +NZ_CP027599.1 RefSeq transcript 3254 5668 . + . ID=gene-C7A06_RS00020;Parent=nbis-gene-4;Name=gyrB;gbkey=Gene;gene=gyrB;gene_biotype=protein_coding;gene_id=nbis-gene-4;locus_tag=C7A06_RS00020;original_biotype=mrna;transcript_id=gene-C7A06_RS00020 +NZ_CP027599.1 Protein Homology exon 3254 5668 . + . ID=nbis-exon-4;Parent=gene-C7A06_RS00020;Dbxref=Genbank:WP_000072067.1;Name=WP_000072067.1;Ontology_term=GO:0006265,GO:0003918,GO:0009330;gbkey=CDS;gene=gyrB;gene_id=nbis-gene-4;go_component=DNA topoisomerase type II (double strand cut%2C ATP-hydrolyzing) complex|0009330||IEA;go_function=DNA topoisomerase type II (double strand cut%2C ATP-hydrolyzing) activity|0003918||IEA;go_process=DNA topological change|0006265||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_005121480.1;locus_tag=C7A06_RS00020;product=DNA topoisomerase (ATP-hydrolyzing) subunit B;protein_id=WP_000072067.1;transcript_id=gene-C7A06_RS00020;transl_table=11 +NZ_CP027599.1 Protein Homology CDS 3254 5668 . + 0 ID=cds-WP_000072067.1;Parent=gene-C7A06_RS00020;Dbxref=Genbank:WP_000072067.1;Name=WP_000072067.1;Ontology_term=GO:0006265,GO:0003918,GO:0009330;gbkey=CDS;gene=gyrB;gene_id=nbis-gene-4;go_component=DNA topoisomerase type II (double strand cut%2C ATP-hydrolyzing) complex|0009330||IEA;go_function=DNA topoisomerase type II (double strand cut%2C ATP-hydrolyzing) activity|0003918||IEA;go_process=DNA topological change|0006265||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_005121480.1;locus_tag=C7A06_RS00020;product=DNA topoisomerase (ATP-hydrolyzing) subunit B;protein_id=WP_000072067.1;transcript_id=gene-C7A06_RS00020;transl_table=11 +NZ_CP027599.1 RefSeq gene 5908 6306 . + . ID=nbis-gene-5;Name=yidB;gbkey=Gene;gene=yidB;gene_biotype=protein_coding;gene_id=nbis-gene-5;locus_tag=C7A06_RS00025 +NZ_CP027599.1 RefSeq transcript 5908 6306 . + . ID=gene-C7A06_RS00025;Parent=nbis-gene-5;Name=yidB;gbkey=Gene;gene=yidB;gene_biotype=protein_coding;gene_id=nbis-gene-5;locus_tag=C7A06_RS00025;original_biotype=mrna;transcript_id=gene-C7A06_RS00025 +NZ_CP027599.1 Protein Homology exon 5908 6306 . + . ID=nbis-exon-5;Parent=gene-C7A06_RS00025;Dbxref=Genbank:WP_000522208.1;Name=WP_000522208.1;gbkey=CDS;gene=yidB;gene_id=nbis-gene-5;inference=COORDINATES: similar to AA sequence:RefSeq:NP_418153.4;locus_tag=C7A06_RS00025;product=YidB family protein;protein_id=WP_000522208.1;transcript_id=gene-C7A06_RS00025;transl_table=11 +NZ_CP027599.1 Protein Homology CDS 5908 6306 . + 0 ID=cds-WP_000522208.1;Parent=gene-C7A06_RS00025;Dbxref=Genbank:WP_000522208.1;Name=WP_000522208.1;gbkey=CDS;gene=yidB;gene_id=nbis-gene-5;inference=COORDINATES: similar to AA sequence:RefSeq:NP_418153.4;locus_tag=C7A06_RS00025;product=YidB family protein;protein_id=WP_000522208.1;transcript_id=gene-C7A06_RS00025;transl_table=11 +NZ_CP027599.1 RefSeq gene 6421 7233 . + . ID=nbis-gene-6;Name=yidA;gbkey=Gene;gene=yidA;gene_biotype=protein_coding;gene_id=nbis-gene-6;locus_tag=C7A06_RS00030 +NZ_CP027599.1 RefSeq transcript 6421 7233 . + . ID=gene-C7A06_RS00030;Parent=nbis-gene-6;Name=yidA;gbkey=Gene;gene=yidA;gene_biotype=protein_coding;gene_id=nbis-gene-6;locus_tag=C7A06_RS00030;original_biotype=mrna;transcript_id=gene-C7A06_RS00030 +NZ_CP027599.1 Protein Homology exon 6421 7233 . + . ID=nbis-exon-6;Parent=gene-C7A06_RS00030;Dbxref=Genbank:WP_000985541.1;Name=WP_000985541.1;Ontology_term=GO:0016787;gbkey=CDS;gene=yidA;gene_id=nbis-gene-6;go_function=hydrolase activity|0016787||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:NP_418152.1;locus_tag=C7A06_RS00030;product=sugar-phosphatase;protein_id=WP_000985541.1;transcript_id=gene-C7A06_RS00030;transl_table=11 +NZ_CP027599.1 Protein Homology CDS 6421 7233 . + 0 ID=cds-WP_000985541.1;Parent=gene-C7A06_RS00030;Dbxref=Genbank:WP_000985541.1;Name=WP_000985541.1;Ontology_term=GO:0016787;gbkey=CDS;gene=yidA;gene_id=nbis-gene-6;go_function=hydrolase activity|0016787||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:NP_418152.1;locus_tag=C7A06_RS00030;product=sugar-phosphatase;protein_id=WP_000985541.1;transcript_id=gene-C7A06_RS00030;transl_table=11 +NZ_CP027599.1 RefSeq gene 7279 7935 . - . ID=nbis-gene-7;Name=C7A06_RS00035;gbkey=Gene;gene_biotype=protein_coding;gene_id=nbis-gene-7;locus_tag=C7A06_RS00035 +NZ_CP027599.1 RefSeq transcript 7279 7935 . - . ID=gene-C7A06_RS00035;Parent=nbis-gene-7;Name=C7A06_RS00035;gbkey=Gene;gene_biotype=protein_coding;gene_id=nbis-gene-7;locus_tag=C7A06_RS00035;original_biotype=mrna;transcript_id=gene-C7A06_RS00035 +NZ_CP027599.1 Protein Homology exon 7279 7935 . - . ID=nbis-exon-7;Parent=gene-C7A06_RS00035;Dbxref=Genbank:WP_000772931.1;Name=WP_000772931.1;gbkey=CDS;gene_id=nbis-gene-7;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709504.1;locus_tag=C7A06_RS00035;product=hypothetical protein;protein_id=WP_000772931.1;transcript_id=gene-C7A06_RS00035;transl_table=11 +NZ_CP027599.1 Protein Homology CDS 7279 7935 . - 0 ID=cds-WP_000772931.1;Parent=gene-C7A06_RS00035;Dbxref=Genbank:WP_000772931.1;Name=WP_000772931.1;gbkey=CDS;gene_id=nbis-gene-7;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709504.1;locus_tag=C7A06_RS00035;product=hypothetical protein;protein_id=WP_000772931.1;transcript_id=gene-C7A06_RS00035;transl_table=11 +NZ_CP027599.1 RefSeq gene 8213 9777 . + . ID=nbis-gene-8;Name=dgoR,dgoK;gbkey=Gene;gene=dgoR,dgoK;gene_biotype=protein_coding;gene_id=nbis-gene-8,nbis-gene-9;locus_tag=C7A06_RS00040,C7A06_RS00045 +NZ_CP027599.1 RefSeq transcript 8213 8902 . + . ID=gene-C7A06_RS00040;Parent=nbis-gene-8;Name=dgoR;gbkey=Gene;gene=dgoR;gene_biotype=protein_coding;gene_id=nbis-gene-8;locus_tag=C7A06_RS00040;original_biotype=mrna;transcript_id=gene-C7A06_RS00040 +NZ_CP027599.1 Protein Homology exon 8213 8902 . + . ID=nbis-exon-8;Parent=gene-C7A06_RS00040;Dbxref=Genbank:WP_000174305.1;Name=WP_000174305.1;gbkey=CDS;gene=dgoR;gene_id=nbis-gene-8;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709505.1;locus_tag=C7A06_RS00040;product=D-galactonate utilization transcriptional regulator DgoR;protein_id=WP_000174305.1;transcript_id=gene-C7A06_RS00040;transl_table=11 +NZ_CP027599.1 Protein Homology CDS 8213 8902 . + 0 ID=cds-WP_000174305.1;Parent=gene-C7A06_RS00040;Dbxref=Genbank:WP_000174305.1;Name=WP_000174305.1;gbkey=CDS;gene=dgoR;gene_id=nbis-gene-8;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709505.1;locus_tag=C7A06_RS00040;product=D-galactonate utilization transcriptional regulator DgoR;protein_id=WP_000174305.1;transcript_id=gene-C7A06_RS00040;transl_table=11 +NZ_CP027599.1 RefSeq transcript 8899 9777 . + . ID=gene-C7A06_RS00045;Parent=nbis-gene-8;Name=dgoK;gbkey=Gene;gene=dgoK;gene_biotype=protein_coding;gene_id=nbis-gene-9;locus_tag=C7A06_RS00045;original_biotype=mrna;transcript_id=gene-C7A06_RS00045 +NZ_CP027599.1 Protein Homology exon 8899 9777 . + . ID=nbis-exon-9;Parent=gene-C7A06_RS00045;Dbxref=Genbank:WP_000127112.1;Name=WP_000127112.1;gbkey=CDS;gene=dgoK;gene_id=nbis-gene-9;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709506.1;locus_tag=C7A06_RS00045;product=2-dehydro-3-deoxygalactonokinase;protein_id=WP_000127112.1;transcript_id=gene-C7A06_RS00045;transl_table=11 +NZ_CP027599.1 Protein Homology CDS 8899 9777 . + 0 ID=cds-WP_000127112.1;Parent=gene-C7A06_RS00045;Dbxref=Genbank:WP_000127112.1;Name=WP_000127112.1;gbkey=CDS;gene=dgoK;gene_id=nbis-gene-9;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709506.1;locus_tag=C7A06_RS00045;product=2-dehydro-3-deoxygalactonokinase;protein_id=WP_000127112.1;transcript_id=gene-C7A06_RS00045;transl_table=11 +NZ_CP027599.1 RefSeq gene 9761 11523 . + . ID=nbis-gene-10;Name=dgoA,dgoD;gbkey=Gene;gene=dgoA,dgoD;gene_biotype=protein_coding;gene_id=nbis-gene-10,nbis-gene-11;locus_tag=C7A06_RS00050,C7A06_RS00055 +NZ_CP027599.1 RefSeq transcript 9761 10378 . + . ID=gene-C7A06_RS00050;Parent=nbis-gene-10;Name=dgoA;gbkey=Gene;gene=dgoA;gene_biotype=protein_coding;gene_id=nbis-gene-10;locus_tag=C7A06_RS00050;original_biotype=mrna;transcript_id=gene-C7A06_RS00050 +NZ_CP027599.1 Protein Homology exon 9761 10378 . + . ID=nbis-exon-10;Parent=gene-C7A06_RS00050;Dbxref=Genbank:WP_001198699.1;Name=WP_001198699.1;gbkey=CDS;gene=dgoA;gene_id=nbis-gene-10;inference=COORDINATES: similar to AA sequence:RefSeq:YP_026238.1;locus_tag=C7A06_RS00050;product=2-dehydro-3-deoxy-6-phosphogalactonate aldolase;protein_id=WP_001198699.1;transcript_id=gene-C7A06_RS00050;transl_table=11 +NZ_CP027599.1 Protein Homology CDS 9761 10378 . + 0 ID=cds-WP_001198699.1;Parent=gene-C7A06_RS00050;Dbxref=Genbank:WP_001198699.1;Name=WP_001198699.1;gbkey=CDS;gene=dgoA;gene_id=nbis-gene-10;inference=COORDINATES: similar to AA sequence:RefSeq:YP_026238.1;locus_tag=C7A06_RS00050;product=2-dehydro-3-deoxy-6-phosphogalactonate aldolase;protein_id=WP_001198699.1;transcript_id=gene-C7A06_RS00050;transl_table=11 +NZ_CP027599.1 RefSeq transcript 10375 11523 . + . ID=gene-C7A06_RS00055;Parent=nbis-gene-10;Name=dgoD;gbkey=Gene;gene=dgoD;gene_biotype=protein_coding;gene_id=nbis-gene-11;locus_tag=C7A06_RS00055;original_biotype=mrna;transcript_id=gene-C7A06_RS00055 +NZ_CP027599.1 Protein Homology exon 10375 11523 . + . ID=nbis-exon-11;Parent=gene-C7A06_RS00055;Dbxref=Genbank:WP_000705001.1;Name=WP_000705001.1;Ontology_term=GO:0009063,GO:0008869;gbkey=CDS;gene=dgoD;gene_id=nbis-gene-11;go_function=galactonate dehydratase activity|0008869||IEA;go_process=cellular amino acid catabolic process|0009063||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_020077623.1;locus_tag=C7A06_RS00055;product=galactonate dehydratase;protein_id=WP_000705001.1;transcript_id=gene-C7A06_RS00055;transl_table=11 +NZ_CP027599.1 Protein Homology CDS 10375 11523 . + 0 ID=cds-WP_000705001.1;Parent=gene-C7A06_RS00055;Dbxref=Genbank:WP_000705001.1;Name=WP_000705001.1;Ontology_term=GO:0009063,GO:0008869;gbkey=CDS;gene=dgoD;gene_id=nbis-gene-11;go_function=galactonate dehydratase activity|0008869||IEA;go_process=cellular amino acid catabolic process|0009063||IEA;inference=COORDINATES: similar to AA sequence:RefSeq:WP_020077623.1;locus_tag=C7A06_RS00055;product=galactonate dehydratase;protein_id=WP_000705001.1;transcript_id=gene-C7A06_RS00055;transl_table=11 +NZ_CP027599.1 RefSeq gene 11598 12935 . + . ID=nbis-gene-12;Name=dgoT;gbkey=Gene;gene=dgoT;gene_biotype=protein_coding;gene_id=nbis-gene-12;locus_tag=C7A06_RS00060 +NZ_CP027599.1 RefSeq transcript 11598 12935 . + . ID=gene-C7A06_RS00060;Parent=nbis-gene-12;Name=dgoT;gbkey=Gene;gene=dgoT;gene_biotype=protein_coding;gene_id=nbis-gene-12;locus_tag=C7A06_RS00060;original_biotype=mrna;transcript_id=gene-C7A06_RS00060 +NZ_CP027599.1 Protein Homology exon 11598 12935 . + . ID=nbis-exon-12;Parent=gene-C7A06_RS00060;Dbxref=Genbank:WP_000253455.1;Name=WP_000253455.1;gbkey=CDS;gene=dgoT;gene_id=nbis-gene-12;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709507.1;locus_tag=C7A06_RS00060;product=MFS transporter;protein_id=WP_000253455.1;transcript_id=gene-C7A06_RS00060;transl_table=11 +NZ_CP027599.1 Protein Homology CDS 11598 12935 . + 0 ID=cds-WP_000253455.1;Parent=gene-C7A06_RS00060;Dbxref=Genbank:WP_000253455.1;Name=WP_000253455.1;gbkey=CDS;gene=dgoT;gene_id=nbis-gene-12;inference=COORDINATES: similar to AA sequence:RefSeq:NP_709507.1;locus_tag=C7A06_RS00060;product=MFS transporter;protein_id=WP_000253455.1;transcript_id=gene-C7A06_RS00060;transl_table=11
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool-data/fasta_indexes.loc.sample Tue May 23 13:43:07 2023 +0000 @@ -0,0 +1,29 @@ +#This is a sample file distributed with Galaxy that enables tools +#to use a directory of Samtools indexed sequences data files. You will need +#to create these data files and then create a fasta_indexes.loc file +#similar to this one (store it in this directory) that points to +#the directories in which those files are stored. The fasta_indexes.loc +#file has this format (white space characters are TAB characters): +# +# <unique_build_id> <dbkey> <display_name> <file_base_path> +# +#So, for example, if you had hg19 Canonical indexed stored in +# +# /depot/data2/galaxy/hg19/sam/, +# +#then the fasta_indexes.loc entry would look like this: +# +#hg19canon hg19 Human (Homo sapiens): hg19 Canonical /depot/data2/galaxy/hg19/sam/hg19canon.fa +# +#and your /depot/data2/galaxy/hg19/sam/ directory +#would contain hg19canon.fa and hg19canon.fa.fai files. +# +#Your fasta_indexes.loc file should include an entry per line for +#each index set you have stored. The file in the path does actually +#exist, but it should never be directly used. Instead, the name serves +#as a prefix for the index file. For example: +# +#hg18canon hg18 Human (Homo sapiens): hg18 Canonical /depot/data2/galaxy/hg18/sam/hg18canon.fa +#hg18full hg18 Human (Homo sapiens): hg18 Full /depot/data2/galaxy/hg18/sam/hg18full.fa +#hg19canon hg19 Human (Homo sapiens): hg19 Canonical /depot/data2/galaxy/hg19/sam/hg19canon.fa +#hg19full hg19 Human (Homo sapiens): hg19 Full /depot/data2/galaxy/hg19/sam/hg19full.fa
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool_data_table_conf.xml.sample Tue May 23 13:43:07 2023 +0000 @@ -0,0 +1,7 @@ +<tables> + <!-- Location of SAMTools indexes for FASTA files --> + <table name="fasta_indexes" comment_char="#"> + <columns>value, dbkey, name, path</columns> + <file path="tool-data/fasta_indexes.loc" /> + </table> +</tables>
--- /dev/null Thu Jan 01 00:00:00 1970 +0000 +++ b/tool_data_table_conf.xml.test Tue May 23 13:43:07 2023 +0000 @@ -0,0 +1,7 @@ +<tables> + <!-- Locations of FASTA index ffiles for testing --> + <table name="fasta_indexes" comment_char="#"> + <columns>value, dbkey, name, path</columns> + <file path="${__HERE__}/test-data/fasta_indexes.loc" /> + </table> +</tables>