changeset 0:aca6a8c9cf83 draft

planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/obitools commit e1031e4c94b25d1ed535bf221764ab801b710ab2
author iuc
date Wed, 12 Apr 2017 17:38:00 -0400
parents
children 0de27b538106
files macros.xml obisort.xml test-data/illuminapairedend.output.fastq test-data/input_ngsfilter_extrafile.txt test-data/output_ngsfilter.fastq test-data/output_ngsfilter_error_3.fastq test-data/output_ngsfilter_unidentified.fastq test-data/output_obiannotate.fasta test-data/output_obiclean_advanced.fasta test-data/output_obiclean_simple.fasta test-data/output_obiconvert.fasta test-data/output_obigrep_lmin.fastq test-data/output_obigrep_predicat.fasta test-data/output_obisort.fasta test-data/output_obisort.fastq test-data/output_obistat.txt test-data/output_obitab.txt test-data/output_obiuniq.fasta test-data/output_obiuniq_family.fasta test-data/wolf_small.F.fastq test-data/wolf_small.R.fastq
diffstat 21 files changed, 7497 insertions(+), 0 deletions(-) [+]
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/macros.xml	Wed Apr 12 17:38:00 2017 -0400
@@ -0,0 +1,136 @@
+<?xml version="1.0"?>
+<macros>
+    <xml name="requirements">
+        <requirements>
+            <requirement type="package" version="1.0.010">obitools</requirement>
+        </requirements>
+    </xml>
+
+    <token name="@WRAPPER_VERSION@">1.0.010</token>
+
+    <xml name="stdio">
+        <stdio>
+            <exit_code range="1:" level="fatal" description="Error in Obitools execution" />
+        </stdio>
+    </xml>
+
+    <token name="@OBITOOLS_LINK@">
+<![CDATA[
+--------
+
+**Project links:**
+
+`OBITools`_
+
+.. _OBITools: http://metabarcoding.org/obitools/
+]]>
+    </token>
+
+    <xml name="attributes">
+        <option value="ali_dir" selected="true">ali_dir</option>
+        <option value="ali_length">ali_length</option>
+        <option value="avg_quality">avg_quality</option>
+        <option value="best_match">best_match</option>
+        <option value="best_identity">best_identity</option>
+        <option value="class">class</option>
+        <option value="cluster">cluster</option>
+        <option value="complemented">complemented</option>
+        <option value="count">count</option>
+        <option value="cut">cut</option>
+        <option value="direction">direction</option>
+        <option value="distance">distance</option>
+        <option value="error">error</option>
+        <option value="experiment">experiment</option>
+        <option value="family">family</option>
+        <option value="family_name">family_name</option>
+        <option value="forward_error">forward_error</option>
+        <option value="forward_match">forward_match</option>
+        <option value="forward_primer">forward_primer</option>
+        <option value="forward_score">forward_score</option>
+        <option value="forward_tag">forward_tag</option>
+        <option value="forward_tm">forward_tm</option>
+        <option value="genus">genus</option>
+        <option value="genus_name">genus_name</option>
+        <option value="head_quality">head_quality</option>
+        <option value="id_status">id_status</option>
+        <option value="merged_star">merged_star</option>
+        <option value="merged">merged</option>
+        <option value="mid_quality">mid_quality</option>
+        <option value="mode">mode</option>
+        <option value="obiclean_cluster">obiclean_cluster</option>
+        <option value="obiclean_count">obiclean_count</option>
+        <option value="obiclean_head">obiclean_head</option>
+        <option value="obiclean_headcount">obiclean_headcount</option>
+        <option value="obiclean_internalcount">obiclean_internalcount</option>
+        <option value="obiclean_samplecount">obiclean_samplecount</option>
+        <option value="obiclean_singletoncount">obiclean_singletoncount</option>
+        <option value="obiclean_status">obiclean_status</option>
+        <option value="occurrence">occurrence</option>
+        <option value="order">order</option>
+        <option value="order_name">order_name</option>
+        <option value="pairend_limit ">pairend_limit </option>
+        <option value="partial ">partial </option>
+        <option value="rank">rank</option>
+        <option value="reverse_error">reverse_error</option>
+        <option value="reverse_match">reverse_match</option>
+        <option value="reverse_primer">reverse_primer</option>
+        <option value="reverse_score">reverse_score</option>
+        <option value="reverse_tag">reverse_tag</option>
+        <option value="reverse_tm">reverse_tm</option>
+        <option value="sample">sample</option>
+        <option value="scientific_name">scientific_name</option>
+        <option value="score">score</option>
+        <option value="score_norm">score_norm</option>
+        <option value="select">select</option>
+        <option value="seq_ab_match">seq_ab_match</option>
+        <option value="seq_a_single">seq_a_single</option>
+        <option value="seq_a_mismatch">seq_a_mismatch</option>
+        <option value="seq_a_deletion">seq_a_deletion</option>
+        <option value="seq_a_insertion">seq_a_insertion</option>
+        <option value="seq_b_single">seq_b_single</option>
+        <option value="seq_b_mismatch">seq_b_mismatch</option>
+        <option value="seq_b_deletion">seq_b_deletion</option>
+        <option value="seq_b_insertion">seq_b_insertion</option>
+        <option value="seq_length">seq_length</option>
+        <option value="seq_length_ori">seq_length_ori</option>
+        <option value="seq_rank">seq_rank</option>
+        <option value="sminL">sminL</option>
+        <option value="sminR">sminR</option>
+        <option value="species">species</option>
+        <option value="species_list">species_list</option>
+        <option value="species_name">species_name</option>
+        <option value="status">status</option>
+        <option value="strand">strand</option>
+        <option value="tail_quality">tail_quality</option>
+        <option value="taxid">taxid</option>
+    </xml>
+
+    <xml name="inputtype">
+        <option value="--genbank">genbank</option>
+        <option value="--embl">embl</option>
+        <option value="--sanger">sanger</option>
+        <option value="--solexa">solexa</option>
+        <option value="--ecopcr">ecopcr</option>
+        <option value="--ecopcrdb">ecopcrdb</option>
+        <option value="--fasta" selected="true">fasta</option>
+    </xml>
+
+    <xml name="sanitizer">
+        <sanitizer invalid_char="test">
+            <valid initial="default">
+                <!--add value="&quot;"/-->
+            </valid>
+            <mapping initial="default">
+                <add source="&gt;" target="\&gt;"/>
+                <add source="&quot;" target="\&quot;"/>
+            </mapping>
+        </sanitizer>
+    </xml>
+
+    <xml name="citation">
+        <citations>
+            <citation type="doi">10.1111/1755-0998.12428</citation>
+        </citations>
+    </xml>
+
+</macros>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/obisort.xml	Wed Apr 12 17:38:00 2017 -0400
@@ -0,0 +1,67 @@
+<tool id="obi_sort" name="obisort" version="@WRAPPER_VERSION@">
+    <description>sorts sequence records according to the value of a given attribute, which can be either numeric or alphanumeric</description>
+    <macros>
+        <import>macros.xml</import>
+    </macros>
+    <expand macro="requirements"/>
+    <expand macro="stdio"/>
+
+    <command>
+
+        <![CDATA[
+            obisort
+            -k '$key'
+            ${reverse}
+            '$input' > '$output'
+        ]]>
+
+    </command>
+
+    <inputs>
+        <param name="input" type="data" format="fastq,fasta,txt,tabular" label="Input sequences file" />
+        <param name="key" type="text" label="key" />
+        <param name="reverse" type="boolean" checked="false" truevalue="-r" falsevalue="" label="sorts in reverse order?" />
+        <param name="out_format" type="select" label="Output data type">
+            <option value="fasta">fasta</option>
+            <option value="fastq">fastq</option>
+        </param>
+
+    </inputs>
+    <outputs>
+        <data format="fastq" name="output" label="output with ${tool.name} on ${on_string}" >
+            <change_format>
+                <when input="out_format" value="fasta" format="fasta" />
+            </change_format>
+        </data>
+    </outputs>
+    <tests>
+        <test>
+            <param name="input" value="output_obiclean_advanced.fasta" />
+            <param name="key" value="count"/>
+            <param name="reverse" value="False"/>
+            <param name="out_format" value="fasta"/>
+            <output name="output" file="output_obisort.fasta" ftype="fasta"/>
+        </test>
+        <test>
+            <param name="input" value="output_obiclean_advanced.fasta" />
+            <param name="key" value="count"/>
+            <param name="reverse" value="True"/>
+            <param name="out_format" value="fastq"/>
+            <output name="output" file="output_obisort.fastq" ftype="fastq"/>
+        </test>
+    </tests>
+    <help><![CDATA[
+
+.. class:: infomark
+
+**What it does**
+
+obisort sorts sequence records according to the value of a given attribute, which can be either numeric or alphanumeric.
+
+@OBITOOLS_LINK@
+
+        ]]>
+
+    </help>
+    <expand macro="citation" />
+</tool>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/illuminapairedend.output.fastq	Wed Apr 12 17:38:00 2017 -0400
@@ -0,0 +1,996 @@
+@HELIUM_000100422_612GNAAXX:7:119:14871:19157#0/2_CONS ali_length=62; direction=left; seq_ab_match=47; sminR=40.0; score=115.761290673; seq_a_mismatch=1; seq_b_deletion=1; seq_b_mismatch=13; seq_a_deletion=0; score_norm=1.86711759151; seq_b_insertion=1; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgcctccttagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttgagctattgccggtagtactctggcgaatgattttgttataataattacttgtgtttagggctaagcatagtggggtatctaaaggaggcgg
++
+dddddddddddbbdaddcddddddcadaddddaadcccWaaddabdx~~|b~~~~cccccccBcBcccBcBcccBccBBcc~}`kXyxu|~Kyr`b~~~~~~b~~~b~d\cdddddddddddddcacddddcdddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:108:5640:3823#0/2_CONS ali_length=62; direction=left; seq_ab_match=60; sminR=40.0; score=231.881364714; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=2; seq_a_deletion=0; score_norm=3.74002201152; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgcctccttagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaacaattttgttatattaattacttgtgtttagggctaagcatagtggggtatctaaaggaggcgg
++
+ddddddddddddddddbdddddbddddddddddddddddddddddd~~~~~~~~~~~~~~~~~~}~~~~~~~~~~~~~~~~~~~~~~~~~~~Z~~~~~~~~~~~~~b~d]dddddddcdddddcddddddddddddddddddddddcddddddd
+@HELIUM_000100422_612GNAAXX:7:97:14311:19299#0/2_CONS ali_length=62; direction=left; seq_ab_match=52; sminR=40.0; score=167.91734192; seq_a_mismatch=5; seq_b_deletion=0; seq_b_mismatch=5; seq_a_deletion=0; score_norm=2.70834422451; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgcctccttagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctcttgccggtagtactctggcgaataattttgttatattaattacttgtgtttagggctaagcatagtggggtatctaaaggaggcgg
++
+ddadddddcd`dcddddddddd^dd]ddddddZad`\`]Lcca``YT|~~^||v|z|~ts~~~|r~sZ^~~`~~~~~~~~~~~~~~~~V~b~]~~~~b~~~~~~~~`~b\aadddd`dcdddddc`dddccddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:22:8540:14708#0/2_CONS ali_length=62; direction=left; seq_ab_match=59; sminR=40.0; score=223.982011431; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=3; seq_a_deletion=0; score_norm=3.61261308759; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgcctcctttagataccccactatgcttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctaaggaggcgg
++
+dddedddddddddedddddddddedddaddbddddddddddddedd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~b~~~~~~~~b~~~~ddddddddddabbb^bdddddddddddcddddddddcddddddddd
+@HELIUM_000100422_612GNAAXX:7:57:18459:16145#0/2_CONS ali_length=63; direction=left; seq_ab_match=60; sminR=40.0; score=227.883189945; seq_a_mismatch=3; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.61719349119; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccgaatatctagaacaggctcctctagagggatgtaaagcaccgccaagtcctttgagtttcaggctgttgctagtagtactctggcgaacattcttgtttattgaatgtttatgtttagggctaagcatagtggggtatctaagatattcgg
++
+ddcdddddddddddddddeddddddddddddddddddddcddddd~b~~~~~~b~~~~~~~~~~~~~~c~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddddddddddddddddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:89:10281:5930#0/2_CONS ali_length=62; direction=left; seq_ab_match=60; sminR=40.0; score=231.893859399; seq_a_mismatch=2; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.7402235387; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgcctccttagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctgttgccgctagtactctggtgaacaattttgtttgtgtaattatttgtgtttagggctaagcatagtggggtatctaaaggaggcgg
++
+ddddddddddddddddddcddddddddddddd\ddeddecddddddb~~~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddddcddddddcdddddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:29:15520:18035#0/2_CONS ali_length=62; direction=left; seq_ab_match=61; sminR=40.0; score=239.965360923; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=1; seq_a_deletion=0; score_norm=3.87040904714; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgcctcctttagataccccactatgcttagccctaaacacaagtaattattataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctaaggaggcgg
++
+cccccccc_cc_cccacacb]Y]_`a^__`_Y_`_a_`cc_ccccc~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~~~~~~~dddddddddddddddddddddddddddadddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:6:9274:14951#0/2_CONS ali_length=62; direction=left; seq_ab_match=59; sminR=40.0; score=223.791171196; seq_a_mismatch=1; seq_b_deletion=0; seq_b_mismatch=2; seq_a_deletion=0; score_norm=3.60953501929; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccaattaacttagataccccactatgcctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctagttaattgg
++
+dcdddddddddddedddddddddcddddddcddddddddddddddd~~~~~~~~~~~~~~~~~~|z~}a|~~~~}}}}~~~~~~~~~~}~}b~b~~~~~~~~~~~~~~ddddddcdcddcd^ddddddddddddddddddddddeddddddddd
+@HELIUM_000100422_612GNAAXX:7:111:2893:6772#0/2_CONS ali_length=62; direction=left; seq_ab_match=61; sminR=40.0; score=239.959941063; seq_a_mismatch=1; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.87032163005; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgcctcctttagataccccactatgcttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctaaggaggcgg
++
+dddddddddddddddddddddddddddddddddddedddddded_d~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~x~dddddddcdddcdcdddadddddddddddedddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:89:10621:20317#0/2_CONS ali_length=62; direction=left; seq_ab_match=59; sminR=40.0; score=223.827654468; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=3; seq_a_deletion=0; score_norm=3.61012345916; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgcctcctttagataccccactatgcttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctaaggaggcgg
++
+ddddddddddddddbdddddadddddddd`ddddadadddddddRc~}~~z~~~~~~~t~sw}~~g}~~~~~~~~~~~~~~~~~~~~~~~~~~~~^~b`~~~~~~~~~ddddddddbdbdd_dddadddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:50:2791:11138#0/2_CONS ali_length=62; direction=left; seq_ab_match=60; sminR=40.0; score=231.976017167; seq_a_mismatch=2; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.74154866398; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgcctcctttagataccccactatgcttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctaaggaggcgg
++
+dddddcdddddcddddcd^dddddddddbdbdddddddc\ddddbd~~~~~~~~~~~~~~~~~~b~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddddbdddddddddcddddddddcddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:108:17701:18887#0/2_CONS ali_length=62; direction=left; seq_ab_match=58; sminR=40.0; score=215.828321765; seq_a_mismatch=4; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.48110196396; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgaagtagtagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaataattttgttatattaattacttgtgtttagggctaagcatagtggggtatctaactacttcgg
++
+dd[dddddddd``ddddddddddddeddddddcdddddd\ddddddb~~~b~~~~~~~~~~~b~~~~~b~~~{~~{z|{|~~~~~~~~~~~ssx~~~~~~~~~~~~~~c^cddddddddddd`cedddddddddddddddddddddddddddcd
+@HELIUM_000100422_612GNAAXX:7:97:10414:9929#0/2_CONS ali_length=62; direction=left; seq_ab_match=61; sminR=40.0; score=239.864541102; seq_a_mismatch=1; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.86878292101; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccaattaactagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaatagttttgtttgcataactatttgtgtttaaggctaggcatagtggggtatctaagttaattgg
++
+ddddddddddddddddddddddddddddddddcddddddcdddddd~~~~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddddeddddddddddddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:97:9091:15775#0/2_CONS ali_length=62; direction=left; seq_ab_match=59; sminR=40.0; score=223.861916171; seq_a_mismatch=3; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.61067606728; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccaattaactagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaatagttttgtttgcataactatttgtgtttaaggctaggcatagtggggtatctaagttaattgg
++
+ddddddddddddddddddddddddddddddddcddddddddddddd~~~~b~~^~~~~~~b~~~~~~~|~~~~~~~~~x~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddddddadcdddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:74:8683:20738#0/2_CONS ali_length=63; direction=left; seq_ab_match=62; sminR=40.0; score=243.961428864; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=1; seq_a_deletion=0; score_norm=3.87240363276; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+tcgaatatcttagataccccactatgcttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccctctagaggagcctgttctagatattcgg
++
+ddddddddddddddddddddddddddddddddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~`~~~~~~~~~~~~~~ddedddddddddddddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:24:16230:12703#0/2_CONS ali_length=62; direction=left; seq_ab_match=59; sminR=40.0; score=223.86908915; seq_a_mismatch=2; seq_b_deletion=0; seq_b_mismatch=1; seq_a_deletion=0; score_norm=3.61079176049; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgaagtagtagaacaggctcctctagaaggggataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaataattttgttatattaattacttgtgtttagggctaagcatagtggggtatctaactacttcgg
++
+ddd`ddddad_ddaddddddddaddddddc`bO``ddd_a`ddd`a}}~sb{~~~~~~~~~~~~~~~~a~~~~~~y~u~~~~~~~~~~~~~~~~~~~~~~~~b~~~~~b^ddcdbcddadddd_ddbdcdcdddd`ddddbddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:4:4214:9434#0/2_CONS ali_length=62; direction=left; seq_ab_match=58; sminR=40.0; score=215.812703412; seq_a_mismatch=3; seq_b_deletion=0; seq_b_mismatch=1; seq_a_deletion=0; score_norm=3.48085005502; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccaattaacttagataccccactatgcctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactacaggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctagttaattgg
++
+ddddddddSddddbbdddddddbddabdddbdddddcddddddddd~^~~~{~{~~~~~}~~{~~ym~L||~~wuy~zyxPzjyyvxku~~~~~~~~~~~~~~~~~xbacdddddaddac_^`_`dcddddacddcddddadaa`[``^c`acc
+@HELIUM_000100422_612GNAAXX:7:12:17693:3451#0/2_CONS ali_length=62; direction=left; seq_ab_match=62; sminR=40.0; score=247.862243; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.9977781129; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccaattaactagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaatagttttgtttgcataactatttgtgtttaaggctaggcatagtggggtatctaagttaattgg
++
+dddddddddddddddddddddddddbddddddaddddddcdddddc~~~~~~~~~~~~~~~~~~~~~~~~~}~{~}{v}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddddeddddddddddcdeddddddcddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:3:14624:12375#0/2_CONS ali_length=63; direction=left; seq_ab_match=61; sminR=40.0; score=235.922125108; seq_a_mismatch=1; seq_b_deletion=0; seq_b_mismatch=1; seq_a_deletion=0; score_norm=3.74479563663; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccgaatatcttagataccccactatgcttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccctctagaggagcctgttctagatattcgg
++
+ddddddddddddddddddcdcddddcddcdcdddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~Y`~~~~~~~~~~~~~~~~~~~~~~~dddddcdddddddcedddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:18:5317:11571#0/2_CONS ali_length=62; direction=left; seq_ab_match=61; sminR=40.0; score=239.862078449; seq_a_mismatch=1; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.86874320079; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccaattaactagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaatagttttgtttgcataactatttgtgtttaaggctaggcatagtggggtatctaagttaattgg
++
+ddddddddddddddddddddddddddddddddadddddddcddddd~~~~b~~~~~~~~~~{~~~~~~~~~~~~~~~~~y~~~~~~~~~~~~~~~~~~~~~~~~~~~~edddeddddddddddddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:109:17335:11429#0/2_CONS ali_length=63; direction=left; seq_ab_match=56; sminR=40.0; score=195.716358124; seq_a_mismatch=1; seq_b_deletion=0; seq_b_mismatch=6; seq_a_deletion=0; score_norm=3.10660885911; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccgaatatctagaacaggctcctctagagggatgtaaagcaccgccaagtcctttgagtttcaggctgttgctagtagtactctggcgaacattcttgtttattgaatgtttatgtttagggctaagcatagtggggtatctaagatattcgg
++
+ddddcdddddcdddddda`ddd^dd`^^`bdd`dR\]``]cdddd~x}~~W}}~~}~~~~~x~s~~z~ccccccccccccccccc~[|~`\~}``~|~~~~~~~~~b~dbdcddddddddadcdddcdcdddcddddaddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:7:10646:8487#0/2_CONS ali_length=62; direction=left; seq_ab_match=60; sminR=40.0; score=231.85443709; seq_a_mismatch=1; seq_b_deletion=0; seq_b_mismatch=1; seq_a_deletion=0; score_norm=3.739587695; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccaattaactagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaatagttttgtttgcataactatttgtgtttaaggctaggcatagtggggtatctaagttaattgg
++
+dddddddddddddddddddddddddddcdddddddddddddddddd~~~~~~~~~~~~~~~~b~~~~~~~hpoppitzv{~~~~~~~~~~~~~~~~~~~~~~~~~~~cedddddddddddddddccdddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:19:4865:20715#0/2_CONS ali_length=62; direction=left; seq_ab_match=60; sminR=40.0; score=231.923942025; seq_a_mismatch=2; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.74070874234; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccaattaactagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaatagttttgtttgcataactatttgtgtttaaggctaggcatagtggggtatctaagttaattgg
++
+ddddddddddddddddddddddddddddcdddaddcddddddddddby~~~~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~bddddddddddddddbcdddddeddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:13:6954:13039#0/2_CONS ali_length=63; direction=left; seq_ab_match=62; sminR=40.0; score=243.872474161; seq_a_mismatch=1; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.87099165336; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccgaatatctagaacaggctcctctagagggatataaagcaccgccaagtcctttgagttttaagctattgctagtagtcctctggcgaacattcttgtttattgaatgtttatgtttagggctaagcatagtggggtatctaagatattcgg
++
+dddddddddddddddddddddddddddddddcddddddddddddd~~~~~b~~~~~~~~~~~~~~~~~~~~~~~r~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddddddddddddddcdddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:120:14963:1929#0/2_CONS ali_length=62; direction=left; seq_ab_match=59; sminR=40.0; score=223.810433242; seq_a_mismatch=2; seq_b_deletion=0; seq_b_mismatch=1; seq_a_deletion=0; score_norm=3.60984569745; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgaagtagtagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaataattttgttatattaattacttgtgtttagggctaagcatagtggggtatctaactacttcgg
++
+ddddddddddddddddddddddddddddddddcddddddddddddd~~~~_~~~~~~~~~~~~~~}~~~}}`z}~~~}~~}~~|~~u~~~~~~~~~~~~~~~~}~~b~dbdddddedddddddadddcddddcddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:115:3921:10649#0/2_CONS ali_length=63; direction=left; seq_ab_match=61; sminR=40.0; score=235.871015095; seq_a_mismatch=1; seq_b_deletion=0; seq_b_mismatch=1; seq_a_deletion=0; score_norm=3.74398436659; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccgaatatctagaacaggctcctctagagggatgtaaagcaccgccaagtcctttgagtttcaggctgttgctagtagtactctggcgaacattcttgtttattgaatgtttatgtttagggctaagcatagtggggtatctaagatattcgg
++
+dddddddddddddddddddddddeddddddddddddddddddddd~b~~~~~~~~~~~~~~~~~~~~~~i~{n~}~}~~~~~~~~~~~~~~~~~b~~~~~~~~~~~~~dddddcdddddddddeddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:109:12848:8882#0/2_CONS ali_length=62; direction=left; seq_ab_match=60; sminR=40.0; score=231.869965661; seq_a_mismatch=2; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.73983815582; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgaagtagtagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaataattttgttatattaattacttgtgtttagggctaagcatagtggggtatctaactacttcgg
++
+ddeddcddddddcdddddddddddddddddddTdddddddddddcdb~~~~~~~~~~~~~~~~~~~~~~}~~~b~x~~{~~~~~~~~~~~~~~~~~~~~~~~~~~~~~d`dcdddddddddddeeddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:84:11257:18886#0/2_CONS ali_length=63; direction=left; seq_ab_match=55; sminR=40.0; score=187.890540948; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=8; seq_a_deletion=0; score_norm=2.98238953885; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccgaatatctagaacaggctcctctagagggatgtaaagcaccgccaagtcctttgagtttcaggctgttgctagtagtactctggcgaacattcttgtttattgaatgtttatgtttagggctaagcatagtggggtatctaagatattcgg
++
+dddddddddddddddddddddddddddcddddddddddddddddd~t~~x~~~~~~~~~~~~~~~~~~~~t~~~~~~y~s}\`~~a|~b{~~~~~~b~~~~b~~a~b~ddddddddddddddcdddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:72:13060:5051#0/2_CONS ali_length=62; direction=left; seq_ab_match=61; sminR=40.0; score=239.985823237; seq_a_mismatch=1; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.87073908447; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgcctcctttagataccccactatgcttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctaaggaggcgg
++
+ddbddddddddcbbdddcdcdddbd`cddddddddddddddddd_b~~~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddddedddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:35:3798:1896#0/2_CONS ali_length=62; direction=left; seq_ab_match=61; sminR=40.0; score=239.863223783; seq_a_mismatch=1; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.86876167392; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgaagtagttagataccccactatgcttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctactacttcgg
++
+dddddddddddddbddddddddddddddddddddcddbddddddad~b~~}~~~~~~~~~~~~~~~~~n~~~~~|~}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddcddaddaddd^dddbcddddddddadddddddddcdddddddd
+@HELIUM_000100422_612GNAAXX:7:117:12470:18434#0/2_CONS ali_length=63; direction=left; seq_ab_match=59; sminR=40.0; score=219.83660627; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=4; seq_a_deletion=0; score_norm=3.4894699408; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccgaatatcttagataccccactatgcttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccctctagaggagcctgttctagatattcgg
++
+ddddddcddddddbdddcdddddbbdddddddddddcddddddcd~~~~~~~~~~~~~~~~~~~~~~~~~~~~O~~~~~~~~~{~~{~~Wx~~~~~~~~~~~b~~~b}ddabdddddddddddddddddddddddddddddddeddddddbdd
+@HELIUM_000100422_612GNAAXX:7:11:8428:13716#0/2_CONS ali_length=62; direction=left; seq_ab_match=61; sminR=40.0; score=239.97387484; seq_a_mismatch=1; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.87054636839; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgaagtagttagataccccactatgcttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctactacttcgg
++
+ddddddddddddddddddddddddddddddddddddddddddddad~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddddddddddddddddddcddddeddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:78:18994:16521#0/2_CONS ali_length=62; direction=left; seq_ab_match=61; sminR=40.0; score=239.927346216; seq_a_mismatch=1; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.86979590672; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgaagtagtagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaataattttgttatattaattacttgtgtttagggctaagcatagtggggtatctaactacttcgg
++
+ddcdddddcdddcdddcdddddddddcbdddd`dedddaeeddaddb~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dadddddddddcddddddcddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:16:5047:7843#0/2_CONS ali_length=63; direction=left; seq_ab_match=63; sminR=40.0; score=251.979285107; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.99967119217; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccgaatatcttagataccccactatgcttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccctctagaggagcctgttctagatattcgg
++
+ddddddddddddddddddddddddddddedddbdddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddddddcdcddddddeeccdddddddcedddddeddddddddddd
+@HELIUM_000100422_612GNAAXX:7:118:13803:15594#0/2_CONS ali_length=63; direction=left; seq_ab_match=60; sminR=40.0; score=227.87720055; seq_a_mismatch=2; seq_b_deletion=0; seq_b_mismatch=1; seq_a_deletion=0; score_norm=3.61709842144; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccgaatatctagaacaggctcctctagagggatgtaaagcaccgccaagtcctttgagtttcaggctgttgctagtagtactctggcgaacattcttgtttattgaatgtttatgtttagggctaagcatagtggggtatctaagatattcgg
++
+ddddddddddddddddddddddddddddddddddddddddddddd~~~~~b~~b~~~~~~~~~~v~~~~~~~~~~y~{~~~~~~~~~~~a~~~~~~~~~~~~~~~~~~dddedddddbdddd^ddeddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:53:14379:5922#0/2_CONS ali_length=62; direction=left; seq_ab_match=62; sminR=40.0; score=247.982071703; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.99971083392; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgcctcctttagataccccactatgcttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctaaggaggcgg
++
+dddcdddddddddddddddddddddddddddddddddddddddd`d~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddddeddddddddddddddddddcddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:52:10700:16508#0/2_CONS ali_length=62; direction=left; seq_ab_match=61; sminR=40.0; score=239.790995416; seq_a_mismatch=1; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.86759670025; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgaagtagtagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaataattttgttatattaattacttgtgtttagggctaagcatagtggggtatctaactacttcgg
++
+dddddddddddddeddddcdddcdddddddddIddbdddbdcddddb~~u~~~}~|||v|~~~~{~~~~~}}}~~~~~~~~~~~~~~~~v~~{{~~~~~~~~~~~~~~ccccccacccccccccc^cccccccccccccccc_cccccc[cca^
+@HELIUM_000100422_612GNAAXX:7:69:7696:12881#0/2_CONS ali_length=63; direction=left; seq_ab_match=63; sminR=40.0; score=251.983052061; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.99973098509; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccgaatatcttagataccccactatgcttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccctctagaggagcctgttctagatattcgg
++
+dddddddddddddddddddddddddddeddddddcdddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddddddddddddddcdddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:44:12484:5320#0/2_CONS ali_length=62; direction=left; seq_ab_match=60; sminR=40.0; score=231.837799589; seq_a_mismatch=2; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.73931934821; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccaattaactagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaatagttttgtttgcataactatttgtgtttaaggctaggcatagtggggtatctaagttaattgg
++
+ddddcbddddddccddddeddddddddddddddddddddaddddcda~~~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~z}}}~~~~~~~~~~~~~~~~~~~cddddddddddddddddeddddddddddddddddddddddeddddd
+@HELIUM_000100422_612GNAAXX:7:21:4713:10229#0/2_CONS ali_length=62; direction=left; seq_ab_match=61; sminR=40.0; score=239.864510201; seq_a_mismatch=1; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.86878242259; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccaattaactagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaatagttttgtttgcataactatttgtgtttaaggctaggcatagtggggtatctaagttaattgg
++
+dddddddddddddddddddddddddddbdddd`ddddddddddddd~~~~~~~~~~~~~~b~~~~~~~~~~~~~~~~~~~|~~~~~~~~~~~~~~~~~~~~~~~~~~~ddddddcddddddddbdcdddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:38:6201:12003#0/2_CONS ali_length=63; direction=left; seq_ab_match=59; sminR=40.0; score=219.686655506; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=4; seq_a_deletion=0; score_norm=3.48708976993; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccgaatatctagaacaggctcctctagcgggatataaagcaccgcccagttctttgagttttaagctattgctagtagtcctctggcgaattattttgttgtaaaattatctatgtttagggctaagcatagtggggtatctaagatattcgg
++
+bbb`^a``b[a[aa^YVY\YW__TXbbHaDDDDDDDDDDDDDDDDcBcccBccccccccccccccccc~x~z}}}}}y~rzwzz||{zyzxa{}~t~~~~~~~b~~~~cddddd[dddcddcddbddbdddddd`dddd^dcddddddddddd
+@HELIUM_000100422_612GNAAXX:7:33:16506:1490#0/2_CONS ali_length=62; direction=left; seq_ab_match=62; sminR=40.0; score=247.963002972; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.99940327375; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccaattaacttagataccccactatgcctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctagttaattgg
++
+ddddeddddddddddddddddddddddddddddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddddeddddddddddddddddddddddddddeedddd
+@HELIUM_000100422_612GNAAXX:7:1:9007:3289#0/2_CONS ali_length=62; direction=left; seq_ab_match=60; sminR=40.0; score=231.83380127; seq_a_mismatch=2; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.7392548592; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccatctctctagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaataattttgttatattaattacttgtgtttagggctaagcatagtggggtatctaagagagatgg
++
+dddddddddddddbddddddddddddddddddddddddddddddddb~~~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}~~~~~~~~~~~~~~~~~~~dbddcddddddddddddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:32:4360:3451#0/2_CONS ali_length=61; direction=left; seq_ab_match=61; sminR=40.0; score=243.999335649; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.999989109; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=47; seq_b_single=47; 
+cccaattaacttagataccccactatgcctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctagttaattgg
++
+dddeddcddddddcdddddddddddddddddddddddddddddddde~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddeddddddddddeeddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:115:17402:4174#0/2_CONS ali_length=62; direction=left; seq_ab_match=59; sminR=40.0; score=223.877240886; seq_a_mismatch=3; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.6109232401; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgcctccttagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgcaggtagtactctggcgaataattttgttatattaattacttgtgtttagggctaagcatagtggggtatctaaaggaggcgg
++
+ddddddddddddddddcddddd`addddddddcdddddddddddddb~~~b~~~~~~~~~~~~~~{~~~~~~Sv~y|~s~~~~~~~~~~~~~~~~~~~~~~~~~~~~~d]ddcdeddddccdddddeddddcdddddddddddddddddddded
+@HELIUM_000100422_612GNAAXX:7:45:6831:6228#0/2_CONS ali_length=62; direction=left; seq_ab_match=62; sminR=40.0; score=247.974637619; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.99959092934; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccaattaacttagataccccactatgcctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctagttaattgg
++
+ddddddddddddddddddddddddddddddcddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddddedddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:117:4291:18111#0/2_CONS ali_length=63; direction=left; seq_ab_match=62; sminR=40.0; score=243.911625561; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=1; seq_a_deletion=0; score_norm=3.87161310415; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccgaatatcttagataccccactatgcttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccctctagaggagcctgttctagatattcgg
++
+dddddddddddddddddddddddddddddddddddaddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~~~~~ddddddddddddddddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:71:14800:3222#0/2_CONS ali_length=62; direction=left; seq_ab_match=60; sminR=40.0; score=231.89389474; seq_a_mismatch=2; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.74022410871; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgcctccttagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaataattttgttatattaattacttgtgtttagggctaagcatagtggggtatctaaaggaggcgg
++
+ddddddddddddddddddeddddddddeddddcdddddccdddddd~~~~b~~~~~~~~~~~~~~~~~\~~~}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dcddddddddeedddddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:11:8547:18238#0/2_CONS ali_length=63; direction=left; seq_ab_match=63; sminR=40.0; score=251.984413754; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.99975259927; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccgaatatcttagataccccactatgcttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccctctagaggagcctgttctagatattcgg
++
+ddddddddddddddddddddddddddddbdcdddddddddcdddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddddddddddddddddddddddeddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:117:2416:10342#0/2_CONS ali_length=63; direction=left; seq_ab_match=61; sminR=40.0; score=235.921215944; seq_a_mismatch=2; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.74478120546; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccgaatatctagaacaggctcctctagagggatgtaaagcaccgccaagtcctttgagtttcaggctgttgctagtagtactctggcgaacattcttgtttattgaatgtttatgtttagggctaagcatagtggggtatctaagatattcgg
++
+dddddddddddddddcdcddddaddcddddddddbddddbddddd~b~~|b~~~~~}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddcdcddddY[ZYUd^dbdbdddddddddddddcdddddddddd
+@HELIUM_000100422_612GNAAXX:7:78:7151:19928#0/2_CONS ali_length=63; direction=left; seq_ab_match=56; sminR=40.0; score=195.576462373; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=7; seq_a_deletion=0; score_norm=3.10438829164; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccgaatatcttagataccccactatgcttagccctaaacataaacattcaataaacgagaatgttcgccagtgtacttctagcaacaggctgaaactcaaaggacttggcggtggtttacatccctctagaggagcctgttctagatattcgg
++
+ZYQOYVVXRYYOYZZ^^^_bZZ]Z[S[WSR]YbbbDDDDDDDDDDcccccccccccBBcccccccccccccBcccccBccccccccccBccccccccccBccccc~`~WNS]Y_KTUVZ[O_SHW]ZQ_^^^ab`Obb\TY\MPPPPQQQQQQ
+@HELIUM_000100422_612GNAAXX:7:71:18821:20471#0/2_CONS ali_length=62; direction=left; seq_ab_match=53; sminR=40.0; score=175.889514148; seq_a_mismatch=7; seq_b_deletion=0; seq_b_mismatch=2; seq_a_deletion=0; score_norm=2.83692764755; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccaattaacttagataccccactatgcctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctagttaattgg
++
+ddddddddddddddddddddddddddddd\ddddddddd^ddd`dd~~~~Xx~~~~~{|q}}x}^Y`J`~Xv{wt~~~~~~~~~~~~~~~~~~~~~~~~~b~~~~~sbddddddddddddd^bdccddbdddddd`ddddddddddddddcddd
+@HELIUM_000100422_612GNAAXX:7:58:15837:8531#0/2_CONS ali_length=63; direction=left; seq_ab_match=63; sminR=40.0; score=251.96128051; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.99938540492; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccgaatatcttagataccccactatgcttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccctctagaggagcctgttctagatattcgg
++
+ddddddddddddddddddddddddddddddbdddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddddddddddddcdddddddddddddcdddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:38:10813:16867#0/2_CONS ali_length=63; direction=left; seq_ab_match=63; sminR=40.0; score=251.97777927; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.99964729; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccgaatatcttagataccccactatgcttagccctaaacataaacattcaataaacaagaatgtttgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccctctagaggagcctgttctagatattcgg
++
+dddddddddddddddddddddddcdddddddddddeddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dbcdddddadadcdddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:68:19115:18847#0/2_CONS ali_length=62; direction=left; seq_ab_match=54; sminR=40.0; score=183.856571062; seq_a_mismatch=6; seq_b_deletion=0; seq_b_mismatch=2; seq_a_deletion=0; score_norm=2.96542856552; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgcctccttagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaataattttgttatattaattacttgtgtttagggctaagcatagtggggtatctaaaggaggcgg
++
+cdbdddddddcdbcddc[Tabcddd_`bddaaabd^bb^P`ccd`db{~~b~~~~~~\\~~x~~~~s~~s~~~_~~{~~~~~~~b{~~}~~~~~~~~~~~b~~~~~`~ddd^dd_ddcdd_ddceddedcdddddcddacdddddddddddcad
+@HELIUM_000100422_612GNAAXX:7:14:3978:11028#0/2_CONS ali_length=62; direction=left; seq_ab_match=60; sminR=40.0; score=231.869517243; seq_a_mismatch=2; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.73983092328; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgaagtagtagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgcaggtagtactctggcgaataattttgttatattaattacttgtgtttagggctaagcatagtggggtatctaactacttcgg
++
+ddcddddddcdddeddddddddcddddddcb`Zbbddddddddddd_~~~~~~~~~~~~~~~~~~~v~~~y~J|~u{|w~~~~~~~~~~~~~~~~~~~~~~~~~~~~~da`dddeddddcdbdaeddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:34:18733:3827#0/2_CONS ali_length=63; direction=left; seq_ab_match=62; sminR=40.0; score=243.983236898; seq_a_mismatch=1; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.87274979204; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccgaatatcttagataccccactatgcttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccctctagaggagcctgttctagatattcgg
++
+ddddddddddddddddddddddddddddddddddddddddddddd~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddddddddddddddddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:65:6787:8456#0/2_CONS ali_length=62; direction=left; seq_ab_match=60; sminR=40.0; score=231.869006954; seq_a_mismatch=2; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.7398226928; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgaagtagtagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaataattttgttatattaattacttgtgtttagggctaagcatagtggggtatctaactacttcgg
++
+ddddddddbddddeddddedddddddddddddddddddddddddddb~~~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~d_ddeddddddcdddddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:111:7441:14688#0/2_CONS ali_length=63; direction=left; seq_ab_match=62; sminR=40.0; score=243.832560428; seq_a_mismatch=1; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.87035810203; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccgaatatctagaacaggctcctctagagggatgtaaagcaccgccaagtcctttgagtttcaggctgttgctagtagtactctggcgaacattcttgtttattgaatgtttatgtttagggctaagcatagtggggtatctaagatattcgg
++
+ddddddddddddddddddddddddddddddddddddddddddddd~~~~~b~~~~~u~~~~~~~~~~~~~~~~~~}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddddedddddddddadddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:86:10092:15563#0/2_CONS ali_length=62; direction=left; seq_ab_match=59; sminR=40.0; score=223.927744132; seq_a_mismatch=2; seq_b_deletion=0; seq_b_mismatch=1; seq_a_deletion=0; score_norm=3.61173780858; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgcctcctttagataccccactatgcttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctaaggaggcgg
++
+dddd`dddddbdddddddddddcddddddbdddddccdddddaddd~b~~~~~~~~~~~~~_~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|bddddddddddcddcddd`^dddddddddddcddddddddddddbdd
+@HELIUM_000100422_612GNAAXX:7:16:4418:5128#0/2_CONS ali_length=62; direction=left; seq_ab_match=59; sminR=40.0; score=223.862543287; seq_a_mismatch=3; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.61068618206; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccaattaactagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaatagttttgtttgcataactatttgtgtttaaggctaggcatagtggggtatctaagttaattgg
++
+dddddddddddddddddddddddddddddddddddddddbddedddb~~~b~~b~~~~~~~~~~~~~~~{~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~bddddddddddddddedddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:13:5742:9859#0/2_CONS ali_length=58; direction=right; seq_ab_match=55; sminR=40.0; score=207.846895043; seq_a_mismatch=3; seq_b_deletion=50; seq_b_mismatch=0; seq_a_deletion=50; score_norm=3.58356715591; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=0; seq_b_single=0; 
+ccgcctcctttagataccccactatgcttttctagaggagcctgttctaaggaggcgg
++
+~~~~~~Z~~~~~~~~~b~~~~~~~~~_~~~~~~~~~~}~~~~~~~~~~~~~~~~~~~~
+@HELIUM_000100422_612GNAAXX:7:85:18986:17662#0/2_CONS ali_length=62; direction=left; seq_ab_match=60; sminR=40.0; score=231.874929984; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=2; seq_a_deletion=0; score_norm=3.73991822554; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgaagtagttagataccccactatgcttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctactacttcgg
++
+ddcdddddddddeccdddddddddcbdddddddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}~~s~~~~~b~~~~~~b~~~~~~~ddcddddddcddddddddddddd`dddddddddddddddddddded
+@HELIUM_000100422_612GNAAXX:7:16:16357:19948#0/2_CONS ali_length=63; direction=left; seq_ab_match=57; sminR=40.0; score=203.860719115; seq_a_mismatch=5; seq_b_deletion=0; seq_b_mismatch=1; seq_a_deletion=0; score_norm=3.23588443039; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccgaatatcttagataccccactatgcttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcacaggacttggcggtgctttacatccctctagaggagcctgttctagatattcgg
++
+baNdQdd`dd`da_ddbadbdddcddddd_dbddbdaddbddddd~`~~b~~~~~~b~~{~~~}x}}~}`twyhw~~~~}w|~|~~~~~X~~~|~~~~~Y~~~~~~~~XVRSQ[Qadd``^P^adYdddddddcc`^_dccddcdccdddddd
+@HELIUM_000100422_612GNAAXX:7:107:3570:18147#0/2_CONS ali_length=62; direction=left; seq_ab_match=60; sminR=40.0; score=231.924768153; seq_a_mismatch=2; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.74072206698; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgcctccttagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttatgctattgccggtagtactctggcgaataattttgttatattaattacttgtgtttagggctaagcatagtggggtatctaaaggaggcgg
++
+ddada`dcddddddddddddddadd_^b_cdd]dddddcdd_dcdd`~s~a~~~~~~~~}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~d\d\dddddcdddddadddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:82:8836:11354#0/2_CONS ali_length=62; direction=left; seq_ab_match=60; sminR=40.0; score=231.781218203; seq_a_mismatch=2; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.73840674522; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccaattaactagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaatagttttgtttgcataactatttgtgtttaaggctaggcatagtggggtatctaagttaattgg
++
+dddddddddddddddddddddddddddaddddcdddddcaddddddb~~~b~~~~~~~~~~~~~~~~~~~~~|~~k{{w~~~~~~~~~~~~~~~~~~~~~~{~~~~~~ddddddddddddddddeddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:41:2354:1449#0/2_CONS ali_length=63; direction=left; seq_ab_match=55; sminR=40.0; score=187.777927438; seq_a_mismatch=5; seq_b_deletion=0; seq_b_mismatch=3; seq_a_deletion=0; score_norm=2.98060202283; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccgaatatcttagataccccactatgcttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccctctagaggagcctgttctagatattcgg
++
+ddbdddccddddddddddddddddddddaaddddddcddbcdddd~b}bb~b~~~b~q~~}~}~x~x~t~s~|k|~w~~z~~{|{~ccBc~~}~~~~~~a~~a~}p~~baceddbbedddda_aa_c[cdadddddddddddddddadddadd
+@HELIUM_000100422_612GNAAXX:7:114:4511:17596#0/2_CONS ali_length=62; direction=left; seq_ab_match=57; sminR=40.0; score=207.883730153; seq_a_mismatch=4; seq_b_deletion=0; seq_b_mismatch=1; seq_a_deletion=0; score_norm=3.35296338956; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgcctccttagaacaggctcctctagaagcgtataaagcaccgccaagtcctttgagttttaagctattgccggtagcactctggcgaataattttgttatattaattacttgtgtttagggctaagcatagtggggtatctaaaggaggcgg
++
+ddeedecddddddbdddcdeeddddPQPPPKKPQPPPPPQdddddd~~~~b~~~~~~~~~~~~~~~~~as~a~~~~~}W~~~~~~~~~~~~~X~~~~~~~~~~~~~~~d^d^dddddddddddddddddddddddbdddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:1:8849:9880#0/2_PairEnd sminR=40.0; pairend_limit=108; ali_dir=left; score=25.9064763088; mode=joined; sminL=40.0; 
+ggacgggagagggggggggggggggaaggggggggttttggggggggggggccgttttaaaaaaaaaaaaaaaacaacgtgacatggcacagccgtcacaactgtcagctgacgaccactggcagtgagtctactctcctattttgttttttttttcaagcagaagacggcatacgatatcggtctcggcattcctgctgaaccgctcttccgatc
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB_`X`b[`T[ZWHZTWU]]b]]TZ^__\^`\OOOOO^`^Z^_ba_bbbbbb
+@HELIUM_000100422_612GNAAXX:7:94:12367:17729#0/2_CONS ali_length=62; direction=left; seq_ab_match=59; sminR=40.0; score=223.888596169; seq_a_mismatch=3; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.61110638983; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgaagtagtagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaataattttgttatattaattacttgtgtttagggctaagcatagtggggtatctaactacttcgg
++
+dddddddddddddddddddddddddddcceddccdadbd`dddddcb~~~b}~~~~~~~~~~~~~~~~~x||t~|r~~~~~~~~b~~~~~~~~~~~~~~~~~~~~~~~daddedddddddddd`dddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:30:5374:18213#0/2_CONS ali_length=63; direction=left; seq_ab_match=63; sminR=40.0; score=251.958026467; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.99933375344; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccgaatatcttagataccccactatgcttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccctctagaggagcctgttctagatattcgg
++
+dddddddddddddeddddddddddddddddddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddddddddddddddddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:49:11740:5547#0/2_CONS ali_length=63; direction=left; seq_ab_match=62; sminR=40.0; score=243.959827817; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=1; seq_a_deletion=0; score_norm=3.87237821931; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccgaatatcttagataccccactatgcttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccctctagaggagcctgttctagatattcgg
++
+ddaddcdddddddedddddddddddddeddddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~cddddddddcdddddddddddddddddddddedddddddddd`dd
+@HELIUM_000100422_612GNAAXX:7:29:3531:8314#0/2_CONS ali_length=63; direction=left; seq_ab_match=61; sminR=40.0; score=235.837856208; seq_a_mismatch=2; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.74345803504; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccgaatatctagaacaggctcctctagagggatgtaaagcaccgccaagtcctttgagtttcaggctgttgctagtagtactctggcgaacattcttgtttattgaatgtttatgtttagggctaagcatagtggggtatctaagatattcgg
++
+dddddddddddddcddddddddddddddddddcddddddddddcd~a~~~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}~~~~~~~~~~~~~~~~~~~~~ddceddddddddddddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:114:10615:11217#0/2_CONS ali_length=62; direction=left; seq_ab_match=60; sminR=40.0; score=231.702876359; seq_a_mismatch=1; seq_b_deletion=0; seq_b_mismatch=1; seq_a_deletion=0; score_norm=3.73714316708; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgcctcctttagataccccactatgcttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctaaggaggcgg
++
+ddcdddcddcd`d__^dddddd`cddddddddaaa``a_adddd^d~b~~z~~~~~~~~~~~~~cBcccccccccccccc~y~~s~~~~~~~|~~~~~|~~~~sz~~~adddddd[dad`VRW]VZdddddddddddddc``_ccddddddddd
+@HELIUM_000100422_612GNAAXX:7:108:2729:8600#0/2_CONS ali_length=62; direction=left; seq_ab_match=59; sminR=40.0; score=223.856778095; seq_a_mismatch=2; seq_b_deletion=0; seq_b_mismatch=1; seq_a_deletion=0; score_norm=3.61059319508; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgaagtagtagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaataattttgttatattaattacttgtgtttagggctaagcatagtggggtatctaactacttcgg
++
+dddddddddddddeddddddddcddddddddddWddddcddddddd~~~~b~~~~~}~~~~~~~~~~~`~~~~~~~~~~~~~~~~~~~~~~~a~~~~~~~~~~~~~~~dacdcdeddddddddddddddedddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:103:8847:6326#0/2_CONS ali_length=63; direction=left; seq_ab_match=63; sminR=40.0; score=251.968264217; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.99949625741; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccgaatatcttagataccccactatgcttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccctctagaggagcctgttctagatattcgg
++
+ddddddddddddddddddddddddddddddddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddddcddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:70:11798:2668#0/2_CONS ali_length=62; direction=left; seq_ab_match=61; sminR=40.0; score=239.988667111; seq_a_mismatch=1; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.8707849534; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgaagtagttagataccccactatgcttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacctttctagaggagcctgttctactacttcgg
++
+dddddddddddddddddddddddddddddddddddddddddddddd~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dcdddddcddddddddbddedddddddcdeddeddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:4:18261:9148#0/2_CONS ali_length=63; direction=left; seq_ab_match=61; sminR=40.0; score=235.937993338; seq_a_mismatch=1; seq_b_deletion=0; seq_b_mismatch=1; seq_a_deletion=0; score_norm=3.7450475133; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccgaatatcttagataccccactatgcttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccctctagaggagcctgttctagatattcgg
++
+ddeddddddddddcdddddddddddddeddddddddddddddddd~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~`~~~~~~~~~~~~~~~~~~~~~~~ddddddddddddddddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:29:18416:16620#0/2_CONS ali_length=62; direction=left; seq_ab_match=60; sminR=40.0; score=231.873033258; seq_a_mismatch=2; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.7398876332; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgcctccttagaacaggctcctctagcagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagaactctggcgaataattttgttataataattacttgtgtttagggctaagcatagtggggtatctaaaggaggcgg
++
+ddddddddddddddddccddddddd`d\dd`bH[`bbb^bdddddd~~~~~~~~~~~~~~~~~~~~~~~~~`~s~u||Fz~~~~~~~~~~~~~~~~~~~~~~~~~~~~d`ddcdbdcddbbbb\dadddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:32:18262:6966#0/2_CONS ali_length=62; direction=left; seq_ab_match=61; sminR=40.0; score=239.975704028; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=1; seq_a_deletion=0; score_norm=3.87057587142; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccaattaacttagataccccactatgcctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctagttaattgg
++
+edddddddddddddddddddddddddddddddddcddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~`~~~~~~~~~~~~ddddddddddbdddddddddddddcdddddddbddcdcddcdddbb
+@HELIUM_000100422_612GNAAXX:7:110:17877:11976#0/2_CONS ali_length=62; direction=left; seq_ab_match=59; sminR=40.0; score=223.833250149; seq_a_mismatch=2; seq_b_deletion=0; seq_b_mismatch=1; seq_a_deletion=0; score_norm=3.61021371209; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgcctccttagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaataattttgttatattaattacttgtgtttagggctaagcatagtggggtatctaaaggaggcgg
++
+ddddddddddddddddddddddddddd_ddddadddddddddddddb~~~b~~~~~~~~~~~~~~~~~~~vqx{w~~~~~~~~~~x~~~~~~~~~~~~~~~~~~~~`~b\d^dddddddddddcdddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:97:9416:9155#0/2_CONS ali_length=62; direction=left; seq_ab_match=60; sminR=40.0; score=231.872797448; seq_a_mismatch=2; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.7398838298; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccaattaactagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaatagttttgtttgcataactatttgtgtttaaggctaggcatagtggggtatctaagttaattgg
++
+ddddddddddddddddddddddddddddddddeddddddddddaddb~~~~~~~~~~~~~~~b~~~~~~{~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~eddddddddddddddedddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:72:8905:10715#0/2_CONS ali_length=63; direction=left; seq_ab_match=63; sminR=40.0; score=251.929473647; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.99888053408; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccgaatatctagaacaggctcctctagagggatgtaaagcaccgccaagtcctttgagtttcaggctgttgctagtagtactctggcgaacattcttgtttattgaatgtttatgtttagggctaagcatagtggggtatctaagatattcgg
++
+dddddddddddddeddddedddddddddddcdddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddddddddddddddcdddddadddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:48:5296:16375#0/2_CONS ali_length=63; direction=left; seq_ab_match=63; sminR=40.0; score=251.994265764; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.99990898038; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccgaatatcttagataccccactatgcttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccctctagaggagcctgttctagatattcgg
++
+dddddddddddddcdddd`ddddddddcddbdddddaddddbddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddd`dbdaaddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:53:6550:1163#0/2_CONS ali_length=63; direction=left; seq_ab_match=61; sminR=40.0; score=235.996766828; seq_a_mismatch=2; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.74598042584; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccgaatatcttagataccccactatgcttagccctaaacataaacattcaataaacaagaatgtttgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccctctagaggagcctgttctagatattcgg
++
+dddddddddddddddddddddddedddddaddddddddddddddd~b~~~~~~~~~~~~~~~~~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddddddddddddddddddddddeddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:120:1900:13295#0/2_CONS ali_length=62; direction=left; seq_ab_match=60; sminR=40.0; score=219.874676069; seq_a_mismatch=1; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=1; score_norm=3.54636574304; seq_b_insertion=0; seq_a_insertion=1; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgaagtagtagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgcgcgtagtactctggcgaataattttgttatattaattacttgtgtttagggctaagcatagtggggtatctaactacttcgg
++
+dddddddddddddcdddddddddddddddddddcdddddcdddddd~~~~b~~~~~~~~~~~~~~~~~~~opfFhtpp~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dcddddcdddcdddddcdddddddddddddddeddddedddddddd
+@HELIUM_000100422_612GNAAXX:7:96:19317:7551#0/2_CONS ali_length=62; direction=left; seq_ab_match=58; sminR=40.0; score=215.85731879; seq_a_mismatch=3; seq_b_deletion=0; seq_b_mismatch=1; seq_a_deletion=0; score_norm=3.48156965791; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgaagtagtagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaataattttgttatattaattacttgtgtttagggctaagcatagtggggtatctaactacttcgg
++
+ccccccbccccccccccccccc^cccccccbcXcbccccccccccc~q~|a~~~~~~|~~~~az~~~|_snppphy~~xq{tzz~~~~~~~~Z~~~~~~~~~~~~~~~d_ddddddddcddd`bbdddddddcddddddddddddddddddddc
+@HELIUM_000100422_612GNAAXX:7:93:18556:10479#0/2_CONS ali_length=62; direction=left; seq_ab_match=59; sminR=40.0; score=223.913795643; seq_a_mismatch=2; seq_b_deletion=0; seq_b_mismatch=1; seq_a_deletion=0; score_norm=3.61151283295; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgcctcctttagataccccactatgcttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctaaggaggcgg
++
+ddddddddcddcddcddddddddddddddddddddddddddddddd~b~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~~~~~~~dddddddddddddbdddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:44:19605:15509#0/2_CONS ali_length=62; direction=left; seq_ab_match=59; sminR=40.0; score=223.916231984; seq_a_mismatch=3; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.61155212878; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgcctccttagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaataattttgttatattaattacttgtgtttagggctaagcatagtggggtatctaaaggaggcgg
++
+dddddddddddddddddddddddddbddddddcddcdcdacddcdd~r~~`~k`~~p~~~_~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~z}y~~~~~~~~~~~~~~a_d_dddddddddddcdadddddddcdddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:40:3610:8896#0/2_CONS ali_length=62; direction=left; seq_ab_match=61; sminR=40.0; score=239.967241748; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=1; seq_a_deletion=0; score_norm=3.87043938304; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgaagtagttagataccccactatgcttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctactacttcgg
++
+dddddddddddddddddddddddddddddddddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~~~~~~~~~dddddddddddddedddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:41:19763:3556#0/2_CONS ali_length=62; direction=left; seq_ab_match=62; sminR=40.0; score=247.825851895; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.99719115959; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgaagtagtagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaataattttgttatattaattacttgtgtttagggctaagcatagtggggtatctaactacttcgg
++
+ddddddddddddddddddddddddddddddddcddddddddddddd{~~~~~~~~~~~~~~~~~~~v~~~~~~~~jz{m{~~~~~~~~~~~~~~~~~~~~~~~~~~~~dacddddddddddddcddddddddddddddededddddddddddWd
+@HELIUM_000100422_612GNAAXX:7:111:7660:7465#0/2_CONS ali_length=63; direction=left; seq_ab_match=58; sminR=40.0; score=211.768626837; seq_a_mismatch=2; seq_b_deletion=0; seq_b_mismatch=3; seq_a_deletion=0; score_norm=3.36140677518; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccgaatatcttagataccccactatgcttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccctctagaggagcctgttctagatattcgg
++
+dbdbddcdddddddddd^dd`dddddcddcdddddd`ddddddcd~~~~~~~~_~~~~~~~~~~~~~Ky~~~~~~c~Y}~~s~~`~x~}~}~{~Z|h~~~~~~~~~~~dYYdddaddaaddad^dddcddddddcdddddddadcdddd``dd
+@HELIUM_000100422_612GNAAXX:7:76:10822:18722#0/2_CONS ali_length=63; direction=left; seq_ab_match=58; sminR=40.0; score=211.83390837; seq_a_mismatch=5; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.36244299; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccgaatatcttagataccccactatgcttagccctaaacataaacattcaataaacacgaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccctctagaggagcctgttctagatattcgg
++
+ddddddbcdbdddddddd_dddddddcacbdcddddTbdcddddd~`~~~z~~~~~~S~~~~~~b~~`~~~t~t~~}~~~~~~~~~~~T~~~|~~~~~~~~~~~~x~~ddddadddd_ddbdcbdddadddcdddddddbdddddddbddddd
+@HELIUM_000100422_612GNAAXX:7:76:8491:8900#0/2_CONS ali_length=62; direction=left; seq_ab_match=57; sminR=40.0; score=207.828655885; seq_a_mismatch=4; seq_b_deletion=0; seq_b_mismatch=1; seq_a_deletion=0; score_norm=3.35207509492; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgaagtagtagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgcaggtagcactctggcgaataattttgttatattaattacttgtgtttagggctaagcatagtggggtatctaactacttcgg
++
+dcddddddddddddadddddddadddcaddddadcdddddddddddb~~~b~~~~~o~~~~~~~~~~~~~z}F}~xq~N}~~y~~~}~~~~wu~~~~~~~~~~~~~^~b[bcc_ccccbcccccccbcbabacccccccbc_ccbbb`bccccc
+@HELIUM_000100422_612GNAAXX:7:47:7619:9866#0/2_CONS ali_length=62; direction=left; seq_ab_match=61; sminR=40.0; score=239.867362445; seq_a_mismatch=1; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.86882842653; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccaattaactagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaatagttttgtttgcataactatttgtgtttaaggctaggcatagtggggtatctaagttaattgg
++
+dddddeddddddedddddddddeddddddddddddddddddddddda~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dedddddddddddddddddddddddddddddddddddddddedddd
+@HELIUM_000100422_612GNAAXX:7:1:8649:5297#0/2_CONS ali_length=104; direction=right; seq_ab_match=104; sminR=40.0; score=415.823014771; seq_a_mismatch=0; seq_b_deletion=4; seq_b_mismatch=0; seq_a_deletion=4; score_norm=3.99829821895; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=0; seq_b_single=0; 
+ccagcgagatcccattgagtctctgcacctatcctttttttcgttttctgaatctttgtttggaaaaaaacaggatttggctcaggattgcccgatctcgctgg
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@HELIUM_000100422_612GNAAXX:7:99:14742:5591#0/2_CONS ali_length=62; direction=left; seq_ab_match=60; sminR=40.0; score=231.982488051; seq_a_mismatch=2; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.74165303308; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgcctcctttagataccccactatgcttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctaaggaggcgg
++
+dddddddddddddddddeddddddddddddddddddddddddddcd~b~~~~~~~~~~~~~a~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddddddddddddddddcddddddddddcdddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:95:3274:5435#0/2_CONS ali_length=63; direction=left; seq_ab_match=61; sminR=40.0; score=235.944669323; seq_a_mismatch=1; seq_b_deletion=0; seq_b_mismatch=1; seq_a_deletion=0; score_norm=3.74515348131; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccgaatatctagaacaggctcctctagagggatgtaaagcaccgccaagtcctttgagtttcaggctgttgctagtagtactctggcgaacattcttgtttattgaatgtttatgtttagggctaagcatagtggggtatctaagatattcgg
++
+dddddddddddcddddddddddccddddddddddcdddddddddd~~~~~b~~~~~~~~~~~~~~~~~~~~~~~~~{~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~ddddcdddddddddcdddddddddddedddddddeddcdcddddd
+@HELIUM_000100422_612GNAAXX:7:74:8396:18135#0/2_CONS ali_length=63; direction=left; seq_ab_match=61; sminR=40.0; score=235.858013544; seq_a_mismatch=2; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.74377799276; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccgaatatctagaacaggctcctctagagggatgtaaagcaccgccaagtcctttgagtttcaggctgttgctagtagtactctggcgaacattcttgtttattgaatgtttatgtttagggctaagcatagtggggtatctaagatattcgg
++
+ddddddddddddddddddddddddddddddddddddddddddddd~W~~~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddcddddddddddddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:9:10358:4089#0/2_CONS ali_length=61; direction=left; seq_ab_match=54; sminR=40.0; score=181.620394786; seq_a_mismatch=1; seq_b_deletion=1; seq_b_mismatch=6; seq_a_deletion=0; score_norm=2.97738352108; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=47; 
+ccaattaactagaacaggctcctctagaagggtataaagcaccgccaagttctttgagttttgagctattgcctgtagtactctggcgaatagttttgtttgcataactatttgtgtttaaggctaggcatagtggggtatctaagttaattgg
++
+ddcddddddddbdddddddddd`ddadddddda`]][\[]cdd`ccacccBcccccccccccBccccccccccBccccBcccccccccccccccc~~~ZzzzwX~yz`^dcddcddddddabdad^dddbbcbdddddddbdbbcddddddddd
+@HELIUM_000100422_612GNAAXX:7:78:10338:12302#0/2_CONS ali_length=62; direction=left; seq_ab_match=60; sminR=40.0; score=231.881878067; seq_a_mismatch=2; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.74003029141; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccaattaacttagataccccactatgcctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctagttaattgg
++
+ddddcddddddddddddddddddddddddddddddddddddddddd~a~~~~~~~~~~~~~~~~~~~~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddeddddddddddddddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:95:17941:6113#0/2_CONS ali_length=63; direction=left; seq_ab_match=57; sminR=40.0; score=203.869927289; seq_a_mismatch=6; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.23603059189; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccgaatatctagaacaggctcctctagagggatgtaaagcaccgccaagtcctttgagtttcaggctgttgctagtagtactctggcgaacattcttgtttattgaatgtttatgtttagggctaagcatagtggggtatctaagatattcgg
++
+ddedddddddddedddddddddddddddddddddddddddddddd~b~~~b~~b~~~bb~~~~~~~~~~~~~~~~~~~~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~acede^cdddc`dd`ddddedadddedddddddddddcdddaacc
+@HELIUM_000100422_612GNAAXX:7:59:11971:12063#0/2_CONS ali_length=62; direction=left; seq_ab_match=62; sminR=40.0; score=247.995051728; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.99992018915; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgcctcctttagataccccactatgcttagccctaaacacaagtaattaatataacaaaattattcgtcagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctaaggaggcgg
++
+ddddddddddddddddddddeddddddacddddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~|~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddddcdddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:47:3878:6141#0/2_CONS ali_length=62; direction=left; seq_ab_match=62; sminR=40.0; score=247.947034203; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.99914571295; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccaattaacttagataccccactatgcctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctagttaattgg
++
+dddddddddddddddddddddddddddddddddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddddddddddddddddddddddddddddddddcddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:21:5487:19582#0/2_CONS ali_length=62; direction=left; seq_ab_match=58; sminR=40.0; score=215.831528178; seq_a_mismatch=3; seq_b_deletion=0; seq_b_mismatch=1; seq_a_deletion=0; score_norm=3.4811536803; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccaattaacttagataccccactatgcctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctagttaattgg
++
+dddaddbddddcdcddddddddddddddbddcdddcddddddddd_~v}~~}{~~~~b~}ZZ}}}t~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~~~~d`dbdddbdcdcdacddddddddddddaddddddddddeddddddd
+@HELIUM_000100422_612GNAAXX:7:38:13721:2004#0/2_CONS ali_length=62; direction=left; seq_ab_match=61; sminR=40.0; score=239.856433937; seq_a_mismatch=1; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.86865216027; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgaagtagtagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaataattttgttatattaattacttgtgtttagggctaagcatagtggggtatctaactacttcgg
++
+ddcccd`dddddddddddddddddddbbddbd^ddabddddddddd~{~~~~~~~~~~~~b~~~~~~~~~~~~~~~}}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~d`ddddddddddddddd]addddbddddddddcddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:111:19168:18517#0/2_CONS ali_length=63; direction=left; seq_ab_match=60; sminR=40.0; score=223.825469474; seq_a_mismatch=1; seq_b_deletion=0; seq_b_mismatch=1; seq_a_deletion=0; score_norm=3.55278522975; seq_b_insertion=0; seq_a_insertion=1; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=46; 
+ccgaagtagttagataccccactatgcttagccctaaacacaagtaattaatataacaaaattatccgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctactacttcgg
++
+ddddddddddcddddddddddddddcdddbddddddbcdddd^dd~~~{~_~~~~~~~~~y{}{~U~{|~~~~~n~~|~~~~}x~~~~~~~~~~~~~~~~~^~~~~~~ccdaddbdddbddb_ddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:89:16162:8889#0/2_CONS ali_length=63; direction=left; seq_ab_match=62; sminR=40.0; score=243.971622168; seq_a_mismatch=1; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.87256543123; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccaattaacttagataccccactatgcctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctagttaattg
++
+dddddedddeddddddddddddddddddddddddddddddddddd~~c~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddedddddddeddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:74:4888:6953#0/2_CONS ali_length=63; direction=left; seq_ab_match=61; sminR=40.0; score=235.986171514; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=2; seq_a_deletion=0; score_norm=3.74581224625; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccgaatatcttagataccccactatgcttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccctctagaggagcctgttctagatattcgg
++
+ddddddddddddddddddddddddddddddddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~~~]~~~~~~~~~~~~~~~~~~~dddddddddeddddddddddddddddddddcdddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:41:16707:19819#0/2_CONS ali_length=62; direction=left; seq_ab_match=60; sminR=40.0; score=231.94731954; seq_a_mismatch=2; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.74108579903; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgcctccttagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaataattttgttatattaattacttgtgtttagggctaagcatagtggggtatctaaaggaggcgg
++
+dedddddddddddbddedadddddccddddddaddbddd^a`daddb~~~~~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~bbdddddddddddddddddddddddddddddddccddddddddddd
+@HELIUM_000100422_612GNAAXX:7:7:7916:16505#0/2_CONS ali_length=58; direction=right; seq_ab_match=58; sminR=40.0; score=231.999536374; seq_a_mismatch=0; seq_b_deletion=50; seq_b_mismatch=0; seq_a_deletion=50; score_norm=3.99999200644; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=0; seq_b_single=0; 
+ccgcctccttagaacaggctcctctagaaaagcatagtggggtatctaaaggaggcgg
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@HELIUM_000100422_612GNAAXX:7:41:9316:2256#0/2_CONS ali_length=62; direction=left; seq_ab_match=61; sminR=40.0; score=239.993848494; seq_a_mismatch=1; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.87086852409; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgcctcctttagataccccactatgcttagccctaaacacaagaaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctaaggaggcgg
++
+dddddddddddeddddcdddddddddddddddddddddddddddNd~~~~~~~~~~~~~~~~~~~~~~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddddddddddcadedddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:67:7582:3642#0/2_CONS ali_length=63; direction=left; seq_ab_match=62; sminR=40.0; score=243.962430842; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=1; seq_a_deletion=0; score_norm=3.87241953718; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccgaatatcttagataccccactatgcttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccctctagaggagcctgttctagatattcgg
++
+ddddddddddddddddddddddddddddddddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~`~~~~~~~~ddddddddddddddddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:42:8435:4155#0/2_CONS ali_length=63; direction=left; seq_ab_match=63; sminR=40.0; score=251.987540492; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.99980223003; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccgaatatcttagataccccactatgcttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccctctagaggagcctgttctagatattcgg
++
+ddddddddeddddddddddddddddddddddddddddd`dddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddddddddddddddddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:1:8702:15835#0/2_CONS ali_length=85; direction=left; seq_ab_match=85; sminR=40.0; score=339.959438284; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.99952280334; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=23; seq_b_single=23; 
+cccatcgctcagatatccgttgccgagagtcgtgtagattatatagaattgcaactcggggtgcggccagcaagccagccacatcccctcgttaggcacagtgttccttgacgccttcggtgagcgatggg
++
+ddddddddddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~{~~~~~~~~ddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:33:9900:9541#0/2_CONS ali_length=62; direction=left; seq_ab_match=62; sminR=40.0; score=247.949713348; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.99918892497; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccaattaacttagataccccactatgcctagccctaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctagttaattgg
++
+dddddddddddddcddddddddddddddddddd\`cccccdddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddedddddddddecddcddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:48:7139:3789#0/2_CONS ali_length=63; direction=left; seq_ab_match=63; sminR=40.0; score=251.902451987; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.99845161885; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccgaatatcttagataccccactatgcttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccctctagaggagcctgttctagatattcgg
++
+ddddddddddddddddddddddddddddddddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddddddddddddddddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:46:13269:4134#0/2_CONS ali_length=63; direction=left; seq_ab_match=63; sminR=40.0; score=251.997344433; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.99995784814; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccgaatatcttagataccccactatgcttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccctctagaggagcctgttctagatattcgg
++
+dddddddddddddeddddddddddddddddddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddddddcdddddddddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:46:9246:19171#0/2_CONS ali_length=62; direction=left; seq_ab_match=52; sminR=40.0; score=167.802718427; seq_a_mismatch=10; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=2.70649545851; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgcctcctttagataccccactatgcttagccctaaacacaagtaattattataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctaaggaggcgg
++
+ddadddddddcaddddddddbdcdddd`dddddddddd^bddadcd~b~~~~~b~~~~~~~_`~~~~~b~~~~~S~~~~~~~~~~b~~n~`~~k~zoY|~~~~jb~~~DDDDDDDDDDDDDDDDDD`M\^ca__T^^Y^c^c_[`[ddddd`cd
+@HELIUM_000100422_612GNAAXX:7:37:12979:6595#0/2_CONS ali_length=58; direction=right; seq_ab_match=58; sminR=40.0; score=231.998796685; seq_a_mismatch=0; seq_b_deletion=50; seq_b_mismatch=0; seq_a_deletion=50; score_norm=3.99997925319; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=0; seq_b_single=0; 
+ccgcctcctttagataccccactatgcttttctagaggagcctgttctaaggaggcgg
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@HELIUM_000100422_612GNAAXX:7:95:1688:9598#0/2_CONS ali_length=63; direction=left; seq_ab_match=54; sminR=40.0; score=179.847313607; seq_a_mismatch=6; seq_b_deletion=0; seq_b_mismatch=3; seq_a_deletion=0; score_norm=2.8547192636; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccgaatatctagaacaggctcctctagagggatgtaaagcaccgccaagtcctttgagtttcaggctgttgctagtatcactctggcgaacattcttgtttattgaatgtttatgtttagggctaagcatagtggggtatctaagatattcgg
++
+aaaddbdbddbd`bdc^`[cddbddd`d_ddddcd^^`[`ddd[d~~~~pW~~`xzxwr~p{vvwxjwItwwrxxm|FPS~~}}}~z|~~__~~~~~~~~~~~~~[~~bbacb`adcdddd`cddddddddbbddddddddddddcdddcddd
+@HELIUM_000100422_612GNAAXX:7:55:16528:11418#0/2_CONS ali_length=62; direction=left; seq_ab_match=58; sminR=40.0; score=215.988419267; seq_a_mismatch=4; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.48368418172; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccaattaacttagataccccactatgcctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcactagcttacaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctagttaattag
++
+ddddbadddddddccddccddddaaadddcdddddddddddcd`da~~~~~~~~~~~~x~~~~~\~~~~~~~~~v~~~~~~~~~~\~~~~~~~[~~~s~~~~~~~~]~cY__]\QPPPP`]`[`c^^[cccccccccccaba_a\``]_WK[T[
+@HELIUM_000100422_612GNAAXX:7:32:18486:7018#0/2_CONS ali_length=63; direction=left; seq_ab_match=63; sminR=40.0; score=251.909476689; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.99856312205; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccgaatatcttagataccccactatgcttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccctctagaggagcctgttctagatattcgg
++
+dddddedddddddddddddddddddddddddddddddddddedcd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddeddddddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:85:2105:21152#0/2_CONS ali_length=63; direction=left; seq_ab_match=57; sminR=40.0; score=203.706262238; seq_a_mismatch=2; seq_b_deletion=0; seq_b_mismatch=4; seq_a_deletion=0; score_norm=3.23343273394; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccgaatatctagaacaggctcctctagagggatgtaaagcaccgccaagtcctttgagtttcaggctgttgctagtagtactctggcgaacattcttgtttattgaatgtttatgtttagggctaagcatagtggggtatctaagatattcgg
++
+ddddddddddddddddddddddddccdddddcddedddeddddbd~b~~{~~~~~}~}\~~~~cccccccccccccccccc~~~x~j~~~~~~~~~b~`s~b~~~~b~d`dddaddddddddddaddaddddcdddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:83:6795:14061#0/2_CONS ali_length=62; direction=left; seq_ab_match=62; sminR=40.0; score=247.992382324; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.99987713426; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgcctcctttagataccccactatgcttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctaaggaggcgg
++
+dddddddddddddcddddddcdcddddddddddddddddddddd_d~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddcddddddddddbdddbdddddddddcddddeddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:73:16525:10764#0/2_CONS ali_length=62; direction=left; seq_ab_match=60; sminR=40.0; score=231.90336822; seq_a_mismatch=2; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.74037690678; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgcctccttagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaataattttgttatattaattacttgtgtttagggctaagcatagtggggtatctaaaggaggcgg
++
+ddcddddddddddedddddddddddddadddd[bddddb_dddddd~~~~~~~~~~~~~~b~b~~~~~|~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b^ddddcddcddddddd_cdddddcddbdddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:19:6313:16567#0/2_CONS ali_length=63; direction=left; seq_ab_match=60; sminR=40.0; score=227.826165596; seq_a_mismatch=3; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.61628834279; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccgaatatctagaacaggctcctctagagggatgtaaagcaccgccaagccctttgagtttcaggctgttgctagtagtactctggcgaacattcttgtttattgaatgtttatgtttagggctaagcatagtggggtatctaagatattcgg
++
+ddbcddddcdddbdcdcdddddadddcddcdYab`__b_bddcdd~~~~O_~~~~~}~~u}~~~~~~~a|~~~z{mrwvx~r~|w}}~~~~~~~~~~~~~~~~~~~~~dddddcaddddddcddddddeeddddddddebddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:114:8865:19510#0/2_CONS ali_length=62; direction=left; seq_ab_match=61; sminR=40.0; score=239.913762365; seq_a_mismatch=1; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.86957681233; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccaattaacttagataccccactatgcctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctagttaattgg
++
+ddddedddddddddddddddddcddddddddddddddddddddddd~a~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddcdddddddddddddddedddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:111:8478:1127#0/2_CONS ali_length=63; direction=left; seq_ab_match=57; sminR=40.0; score=203.794981474; seq_a_mismatch=5; seq_b_deletion=0; seq_b_mismatch=1; seq_a_deletion=0; score_norm=3.23484097578; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccgaatatctagaacaggctcctctagagggatgtaaagcaccgccaagtcctttgcgttccaggctgttgctagtagtactctggcgaacattcttgtttattgaatgtttatgtttagggctaagcatagtggggtatctaagatattcgg
++
+dddd_ddddcdadddddcddddbdddddcd^dabdddcaddddda~]v~~Z~~`puIwxxH~|~}~~~~~~~|~~y}vp~{~~~~|yz~~~~~~~{~~~~~~|~~~b~ddbMddddddddddadddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:81:15726:2345#0/2_CONS ali_length=63; direction=left; seq_ab_match=56; sminR=40.0; score=195.641193686; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=7; seq_a_deletion=0; score_norm=3.10541577279; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccgaatatctagaacaggctcctctagagggatgtaaagcaccgccgagtgctttgagtttcaggctgttgctagtagtactctggcgaacattcttgtttattgaatgtttatgtttagggctaagcatagtggggtatctaagatattcgg
++
+````Z]]cbb`ccbcc[`ca`bU[cQZ___cQbc`DDDDDDDDDDcBcccBccccccccccccccBccccccccccBcBccccccBccBc~~~~qp~wws~~{~~s~~b_cc__ba_accb_cXJWXWaabcac_c`[__[[_]_aa__`___
+@HELIUM_000100422_612GNAAXX:7:13:14386:20412#0/2_CONS ali_length=63; direction=left; seq_ab_match=60; sminR=40.0; score=223.918527801; seq_a_mismatch=1; seq_b_deletion=0; seq_b_mismatch=1; seq_a_deletion=0; score_norm=3.55426234604; seq_b_insertion=1; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=45; 
+ccaattaactagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaatagttttgtttgcataactatttgtgtttaaggctaggcatagtggggtatctaagttaattgg
++
+dddddddddddddddddddddddddddcdddddddddddddddddd~~~~b~~~~~~~~~~~~~~~~~~t~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ax~~~~a~~dddddddddddddddcedddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:83:18882:9967#0/2_CONS ali_length=63; direction=left; seq_ab_match=60; sminR=40.0; score=227.922890965; seq_a_mismatch=2; seq_b_deletion=0; seq_b_mismatch=1; seq_a_deletion=0; score_norm=3.6178236661; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccgaatatcttagataccccactatgcttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccctctagaggagcctgttctagatattcgg
++
+ddddddddddddddddddcdddddddddddddddddddddddddd~b~~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~~~~~~~~~~~~~~dddddddddddddddddadddddddddcddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:13:17353:13234#0/2_CONS ali_length=62; direction=left; seq_ab_match=59; sminR=40.0; score=223.801902424; seq_a_mismatch=1; seq_b_deletion=0; seq_b_mismatch=2; seq_a_deletion=0; score_norm=3.60970810361; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgaagtagtagaacaggctcctctagaaaggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaataattttgttatattaattacttgtgtttagggctaagcatagtggggtatctaactacttcgg
++
+ddddedddddddddddddddddddcdddddbcUcbdddbddbddadb~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|~~~~~~~~~~~~~]pVo~~~~~x~~~~~}~~b`dWddeddddddddddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:53:10153:11845#0/2_CONS ali_length=62; direction=left; seq_ab_match=61; sminR=40.0; score=239.985596162; seq_a_mismatch=1; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.87073542196; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgaagtagttagataccccactatgcttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctactacttcgg
++
+dddddddddddddcddddddddcddddddddddddddddddddddd~~~~~~~~~~~~~~~a~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddddedddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:33:9296:13526#0/2_CONS ali_length=62; direction=left; seq_ab_match=61; sminR=40.0; score=239.852481933; seq_a_mismatch=1; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.86858841828; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgaagtagtagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaataattttgttatattaattacttgtgtttagggctaagcatagtggggtatctaactacttcgg
++
+ddddadddddddddddddddddcdddddcdddZdddddbddddddd^~~~~~~~~~~~~~~~~~~~~~~~v~~~~~|~|~~~~~~~~~~~~~~~~~~~~~~~~~~~~~d^ddddddddeedddddcdddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:113:2918:18736#0/2_CONS ali_length=62; direction=left; seq_ab_match=58; sminR=40.0; score=215.87931956; seq_a_mismatch=4; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.48192450903; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgcctccttagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaataattttgttatattaattacttgtgtttagggctaagcatagtggggtatctaaaggaggcgg
++
+dddddddddddddddddddddddddddddddd_adddddcddddcdb~~~b~~b~~~~~~~~~~~y~~`y~~v~~~v~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~d`_ddddddddddddcdcdddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:63:4725:12502#0/2_CONS ali_length=62; direction=left; seq_ab_match=61; sminR=40.0; score=239.998975242; seq_a_mismatch=1; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.87095121358; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgcctccttagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaataattttgttatattaattacttgtgtttagggctaagcatagtggggtatctaaaggaggcgg
++
+ddadcdddcdddddddddcdddaddadTdd\]R\]ddd``dddddd~~~~~~~~~~~~~~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~d]dWddddddddeddcdcddddddddddddddddcddddddddddd
+@HELIUM_000100422_612GNAAXX:7:7:11110:17924#0/2_CONS ali_length=62; direction=left; seq_ab_match=58; sminR=40.0; score=215.812113201; seq_a_mismatch=3; seq_b_deletion=0; seq_b_mismatch=1; seq_a_deletion=0; score_norm=3.4808405355; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgaagtagttagataccccactatgcttagccctaaacacaagtaattaatataacaaaattattcgccagagtcataccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctactacttcgg
++
+ddddcddd_dddddddddddddddcdddcddddddddcdddddd`d~b~~~~~~~~~~~~~~~~~rm{kripoooEJpoolppp~~~~~~~~~~~~~v~~~~~`v~~~dddcdddddddbddddaddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:102:6364:4627#0/2_CONS ali_length=63; direction=left; seq_ab_match=63; sminR=40.0; score=251.985885517; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.99977596059; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccgaatatcttagataccccactatgcttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccctctagaggagcctgttctagatattcgg
++
+ddddddddddddddddddddddddddddddddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddcddddddddddcdddddddddddddddddcddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:96:8737:4973#0/2_CONS ali_length=58; direction=right; seq_ab_match=57; sminR=40.0; score=223.980140585; seq_a_mismatch=1; seq_b_deletion=50; seq_b_mismatch=0; seq_a_deletion=50; score_norm=3.86172656181; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=0; seq_b_single=0; 
+ccgcctccttagaacaggctcctctagaaaagcatagtggggtatctaaaggaggcgg
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@HELIUM_000100422_612GNAAXX:7:89:9710:20652#0/2_CONS ali_length=63; direction=left; seq_ab_match=62; sminR=40.0; score=243.910293117; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=1; seq_a_deletion=0; score_norm=3.87159195424; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccgaatatcttagataccccactatgcttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttatatccctctagaggagcctgttctagatattcgg
++
+ddddddddddddd`addddddddd`dddad]ccccddcdddcddd~~}~~~~~~~~~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}ddadddddddddddddddddddddddadddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:71:17473:7401#0/2_CONS ali_length=62; direction=left; seq_ab_match=60; sminR=40.0; score=231.883938289; seq_a_mismatch=1; seq_b_deletion=0; seq_b_mismatch=1; seq_a_deletion=0; score_norm=3.74006352079; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgaagtagtagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattaccggtagtactctggcgaataattttgttatattaattacttgtgtttagggctaagcatagtggggtatctaactacttcgg
++
+cccccc^ccccccccccccccccc_cccccabaac^ccccc_cc^c~~~~R~~~~s~~w~~~~~xg~~~~powyw~~~~~~~~~~~~~~~~~~~~~~~~b~~~~~~~~dddbddbdccddddaddddbdddddddacdddcddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:28:9406:18226#0/2_CONS ali_length=62; direction=left; seq_ab_match=60; sminR=40.0; score=231.816671723; seq_a_mismatch=2; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.73897857618; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgaagtagtagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaataattttgttatattaattacttgtgtttagggctaagcatagtggggtatctaactacttcgg
++
+ddddddddddddddddddddddddddddddddcddddddddddedd_~~~b~~~~~~~~~~~~~~x~~~~~~~~~~{~~~~~~~~~~~~~~|~~~~~~~~~~~~~~~~dcedcdcddddddddddddddddddddcddddeddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:15:16118:15111#0/2_CONS ali_length=62; direction=left; seq_ab_match=60; sminR=40.0; score=231.917355899; seq_a_mismatch=2; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.7406025145; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgaagtagttagataccccactatgcttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctactacttcgg
++
+dddddddddddddddddddddddddddddddddddddddddd`d]d~~~c~~~~x~~~~~~a~~~w~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddddddddd`dddedddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:58:18618:20959#0/2_CONS ali_length=62; direction=left; seq_ab_match=59; sminR=40.0; score=223.882241304; seq_a_mismatch=1; seq_b_deletion=0; seq_b_mismatch=2; seq_a_deletion=0; score_norm=3.611003892; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccaattaactagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaatagttttgtttgcataactatttgtgtttaaggctaggcatagtggggtatctaagttaattgg
++
+ddddeddddddddddddddddddddddddddd_ddddddcdddddd~~~}b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|~~~~~z~~x~~~~~~~~~b~~~~~bddddddddddddddddcddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:46:11654:6037#0/2_CONS ali_length=62; direction=left; seq_ab_match=61; sminR=40.0; score=239.828425953; seq_a_mismatch=1; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.8682004186; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgaagtagtagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaataattttgttatattaattacttgtgtttagggctaagcatagtggggtatctaactacttcgg
++
+ddddddddddbd`adddddddddddddddddddbcbbb^bcddcccb~~~~~~~~~~~~~~~~}~~~~~~~{~~~v~~z{}~~~~~~~~~~~~~~~~~~~~~~~~~~~dcdddddddddcdddedddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:2:6320:8068#0/2_CONS ali_length=63; direction=left; seq_ab_match=63; sminR=40.0; score=251.910304163; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.99857625655; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccgaatatcttagataccccactatgcttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccctctagaggagcctgttctagatattcgg
++
+ddedddddddddddddddddddddddddddddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddeddddbdddddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:46:1592:11866#0/2_CONS ali_length=62; direction=left; seq_ab_match=62; sminR=40.0; score=247.993604064; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.99989683974; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccaattaacttagataccccactatgcctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctagttaattgg
++
+ddcdddcddddbdddcdddd_ddaddddd_dddbcd\dddddd]dd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddcddcddd`dddcddcdddddddddddddcdd`dddddcdd`ddd
+@HELIUM_000100422_612GNAAXX:7:119:2660:19129#0/2_CONS ali_length=63; direction=left; seq_ab_match=61; sminR=40.0; score=235.859804076; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=2; seq_a_deletion=0; score_norm=3.74380641391; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccgaatatcttagataccccactatgcttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccctctagaggagcctgttctagatattcgg
++
+ddddcdddedddedddddddddddddddcddcddddddddcdddd~~~~~~~~~~~~~~~~z}~~~~~~~~~~~~~~~~~~~~~~~~~~~~k~~~~~~~~~~b~^~~~dddbddddddddddddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:115:3625:10051#0/2_CONS ali_length=59; direction=right; seq_ab_match=59; sminR=40.0; score=235.999642017; seq_a_mismatch=0; seq_b_deletion=49; seq_b_mismatch=0; seq_a_deletion=49; score_norm=3.99999393249; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=0; seq_b_single=0; 
+ccaattaacttagataccccactatgccaatactagaggagcctgttctagttaattgg
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@HELIUM_000100422_612GNAAXX:7:100:17253:5513#0/2_CONS ali_length=62; direction=left; seq_ab_match=60; sminR=40.0; score=231.761122002; seq_a_mismatch=2; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.73808261294; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccaattaacttagataccccactatgcctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctagttaattgg
++
+dddcddcddccddbddddddddbdcdcdddbdddddcddddddddd~~~~|{|~~~~b~~~~~~~~~~s~~~~~x~~~~~~~rs~zqwxy~z~~|}~z~}|{^v~~~~c``Zc`cXWcc[WYYZccccccc_ccccccccWbcc`cc]cccccc
+@HELIUM_000100422_612GNAAXX:7:82:6036:6921#0/2_CONS ali_length=62; direction=left; seq_ab_match=60; sminR=40.0; score=231.901981419; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=2; seq_a_deletion=0; score_norm=3.74035453901; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgaagtagtagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaataattttgttatattaattacttgtgtttagggctaagcatagtggggtatctaactacttcgg
++
+dddddddddddddddddddddddddcd`dddbaddddcdccddddd~{~|~~~~~~~~~~~~~~~~~~~}~~~~~~~~]~~~~~~~~~~~~~~~~~~~~~~~b~~~~~dcddddddddeddddbcddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:120:4726:20808#0/2_CONS ali_length=62; direction=left; seq_ab_match=62; sminR=40.0; score=247.810697755; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.99694673798; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccaattaacttagataccccactatgcctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctagttaattgg
++
+ddddecdcdddddcedddddddddddddbedddddcdddddddddb~~~~~~~~~~~~~~ty}y~~~~~~~~~~~~{~~~~~~~~~~~~~~~~~~~~~~~~~~~~~r~ddddcdddddcdd`dddddedddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:99:8183:13912#0/2_CONS ali_length=62; direction=left; seq_ab_match=60; sminR=40.0; score=231.903850642; seq_a_mismatch=1; seq_b_deletion=0; seq_b_mismatch=1; seq_a_deletion=0; score_norm=3.74038468777; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccaattaacttagataccccactatgcctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctcctagaggagcctgttctagttaattgg
++
+ddddddddddddceeddddddddddddddddddddddcddddddeb~Z~~~~~~~~~~~~~~~~~}~l~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~~~~dadcdedddcdddddddd`ddddddddddddddddcddddeddddd
+@HELIUM_000100422_612GNAAXX:7:10:4085:7492#0/2_CONS ali_length=63; direction=left; seq_ab_match=62; sminR=40.0; score=243.95581367; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=1; seq_a_deletion=0; score_norm=3.87231450269; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccgaatatcttagataccccactatgcttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccctctagaggagcctgttctagatattcgg
++
+ddddddddddddddddddddddddddddddddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~ddddddddddddddddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:35:12723:18557#0/2_CONS ali_length=63; direction=left; seq_ab_match=63; sminR=40.0; score=251.945522222; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.99913527337; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccgaatatcttagataccccactatgcttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccctctagaggagcctgttctagatattcgg
++
+ddddddddddddddddd`ddddddddaadddcddddddddddddd~~}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~cdddcdddddddbddddddcdddddddddddcddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:97:10495:17046#0/2_CONS ali_length=62; direction=left; seq_ab_match=61; sminR=40.0; score=239.938979134; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=1; seq_a_deletion=0; score_norm=3.86998353443; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccaattaacttagataccccactatgcctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctagttaattgg
++
+ddedecdddddddbbdddddddddcddddddddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~a~~~~~~~~~~~~dddddddddddddddcddddddddddedddddcddddddddcdddd
+@HELIUM_000100422_612GNAAXX:7:73:17068:16620#0/2_CONS ali_length=58; direction=right; seq_ab_match=57; sminR=40.0; score=223.962007947; seq_a_mismatch=0; seq_b_deletion=50; seq_b_mismatch=1; seq_a_deletion=50; score_norm=3.86141393012; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=0; seq_b_single=0; 
+ccgcctccttagaacaggctcctctagaaaagcatagtggggtatctaaaggaggcgg
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~~~~~~~~~~~~~|~
+@HELIUM_000100422_612GNAAXX:7:23:13304:5167#0/2_CONS ali_length=62; direction=left; seq_ab_match=62; sminR=40.0; score=247.997553566; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.99996054139; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccaattaacttagataccccactatgcctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctagttaattgg
++
+dddddddddddddddddddddddddddddddddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddddcdddddddddddddcdddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:54:2542:19180#0/2_CONS ali_length=62; direction=left; seq_ab_match=61; sminR=40.0; score=239.868258533; seq_a_mismatch=1; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.86884287957; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgaagtagtagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaataattttgttatattaattacttgtgtttagggctaagcatagtggggtatctaactacttcgg
++
+ddddddddddddddddddddddddddddddddbddddcdccddddd~~~~b~~~~~~~~~~~~~~~~~|~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dadbdddddddddddddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:1:8613:9165#0/2_CONS ali_length=101; direction=left; seq_ab_match=99; sminR=40.0; score=387.825112777; seq_a_mismatch=2; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.83985260176; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=7; seq_b_single=7; 
+ccagagcgagtgggcaatcctgagccaaatctttatttttagaaaaacaaaagggcttcagaaagcaaaaataaacataaaggataggtgcagagactcaatggactcgctctgg
++
+ddddddd~~~~b~~~~~~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddddddd
+@HELIUM_000100422_612GNAAXX:7:109:17917:15159#0/2_CONS ali_length=63; direction=left; seq_ab_match=61; sminR=40.0; score=235.857230348; seq_a_mismatch=2; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.74376556108; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccgaatatctagaacaggctcctctagagggatgtaaagcaccgccaagtcctttgagtttcaggctgttgctagtagtactctggcgaacattcttgtttattgaatgtttatgtttagggctaagcatagtggggtatctaagatattcgg
++
+dddedddddddddddddddddddddddddddcddddddddddddc~~~~~b~~a~~~~~~~~~~~~~~~~~~~~~}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddddddddddddddcdddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:59:18371:8149#0/2_CONS ali_length=62; direction=left; seq_ab_match=62; sminR=40.0; score=247.998742319; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.99997971482; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccaattaacttagataccccactatgcctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctagttaattgg
++
+ddddddddddddddddddddddddddddcddddddddddddddddc~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddddedddddddddddddddddcdddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:1:8670:8750#0/2_CONS ali_length=90; direction=right; seq_ab_match=90; sminR=40.0; score=359.914979278; seq_a_mismatch=0; seq_b_deletion=18; seq_b_mismatch=0; seq_a_deletion=18; score_norm=3.99905532531; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=0; seq_b_single=0; 
+ccgaggcttactaggattagataccctattatttttgaatgttaatgtttgtttgcttgagtagtattagttatgttcttgaaagcctcg
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@HELIUM_000100422_612GNAAXX:7:86:11013:15234#0/2_CONS ali_length=62; direction=left; seq_ab_match=61; sminR=40.0; score=239.990009212; seq_a_mismatch=1; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.8708066002; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccaattaacttagataccccactatgcctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctagttaattgg
++
+dddddddddddddddddddddddddddddddddddddddddddddd~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddddddddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:77:18518:10758#0/2_CONS ali_length=62; direction=left; seq_ab_match=59; sminR=40.0; score=223.70605163; seq_a_mismatch=2; seq_b_deletion=0; seq_b_mismatch=1; seq_a_deletion=0; score_norm=3.60816212307; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccaattaacttagataccccactatgcctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctagttaattgg
++
+aaa]`_ccca_a`ccccccccc]c_c_caccaccccccccccc_cc~~~~~~~~~~~~wzz{~~a~~~~y~_~~~~~~~~~~m~sygwqv~ccBccccccccccccc~bb^^bc`U\\`\]XPZ\__[\Z`ZX`accccc``c`Rb`Z`bbccc
+@HELIUM_000100422_612GNAAXX:7:63:18851:7688#0/2_CONS ali_length=62; direction=left; seq_ab_match=59; sminR=40.0; score=223.854412144; seq_a_mismatch=3; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.61055503459; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccaattaactagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaatagttttgtttgcataactatttgtgtttaaggctaggcatagtggggtatctaagttaattgg
++
+ddddddddddddddddddedddddddddddddddeddddddddddd~~~~b~~~~~~~~~b~a~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddddddeddddddddddcdddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:22:1798:3790#0/2_CONS ali_length=62; direction=left; seq_ab_match=59; sminR=40.0; score=223.82253574; seq_a_mismatch=3; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.61004089903; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccaattaactagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagcactctggcgaatagttttgtttgcataactatttgtgtttaaggctaggcatagtggggtatctaagttaattgg
++
+ddddddddddddcdddddddddddddddddddadddddddddddddb~~~b~~~~~~~~~~~~~~~~~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddddddddddddbddbdadddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:115:14354:10118#0/2_CONS ali_length=63; direction=left; seq_ab_match=59; sminR=40.0; score=219.850378027; seq_a_mismatch=2; seq_b_deletion=0; seq_b_mismatch=2; seq_a_deletion=0; score_norm=3.4896885401; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccgaatatctagaacaggctcctctagagggatgtaaagcaccgccaagtcctttgagtttcaggctgttgcgagtagtactctggcgaacattcttgtttattgaatgtttatgtttagggctaagcatagtggggtatctaagatattcgg
++
+ddddddddddddddddddddddcdddddddddccddcdddddddd~~~~~b~~~~~~~~~~~~~}~~~~~~}Jt~y|w~~~~~~~~~~~~~~~_~~~~~~~~~~~~b~dcddddeddddddddeddcdddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:99:14794:3606#0/2_CONS ali_length=63; direction=left; seq_ab_match=61; sminR=40.0; score=235.971679218; seq_a_mismatch=1; seq_b_deletion=0; seq_b_mismatch=1; seq_a_deletion=0; score_norm=3.74558220981; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccgaatatcttagataccccactatgcttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccctctagaggagcctgttctagatattcgg
++
+dddcdddddddcdddddddcddd``addddddddddddddddddd~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~dddddddddddddddddddddddddddddddcddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:74:8297:20108#0/2_CONS ali_length=62; direction=left; seq_ab_match=61; sminR=40.0; score=239.962155962; seq_a_mismatch=1; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.87035735423; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgaagtagttagataccccactatgcttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctactacttcgg
++
+dddddddddddddddddddddddddddddcdddddddddddddd`d~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}~dddddddddddddddddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:29:12308:10119#0/2_CONS ali_length=63; direction=left; seq_ab_match=63; sminR=40.0; score=251.866768717; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.99788521773; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccgaatatctagaacaggctcctctagagggatgtaaagcaccgccaagtcctttgagtttcaggctgttgctagtagtactctggcgaacattcttgtttattgaatgtttatgtttagggctaagcatagtggggtatctaagatattcgg
++
+ddddddddddddddddddddddddddddddddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddcdeddddedddddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:25:11691:21134#0/2_CONS ali_length=62; direction=left; seq_ab_match=59; sminR=40.0; score=223.86269299; seq_a_mismatch=2; seq_b_deletion=0; seq_b_mismatch=1; seq_a_deletion=0; score_norm=3.61068859661; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgcctccttagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaataattttgttatattaattacttgtgtttagggctaagcatagtggggtatctaaaggaggcgg
++
+dddddddddddddddddddddd`ddcddddddadcdddaddddddd_~~~b~~}~~~~~~~~~~~~~~~}~}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~d]daddddddcdddddcdddaddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:111:15484:19248#0/2_CONS ali_length=63; direction=left; seq_ab_match=60; sminR=40.0; score=227.828264164; seq_a_mismatch=2; seq_b_deletion=0; seq_b_mismatch=1; seq_a_deletion=0; score_norm=3.6163216534; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccgaatatctagaacaggctcctctagagggatgtaaagcaccgccaagtcctttgagtttcaggctgttgctagtagtactctggcgaacattcttgtttattgaatgtttatgtttagggctaagcatagtggggtatctaagatattcgg
++
+dddddddddddddddddddddddddddddddcdd`dddddddddd~~~~~b~~~~~~~~s~~~~~~~~`{~~}~xy}~{~~~z~{txvzj~~`~~~~~~~~~~~~~~~dddaddddddddddddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:103:3594:15996#0/2_CONS ali_length=62; direction=left; seq_ab_match=60; sminR=40.0; score=231.92194325; seq_a_mismatch=2; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.74067650404; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccaattaacttagataccccactatgcctagccttaaacacaaatagttatgcaaacacaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctagttaattgg
++
+dddddedddddddddddddddddcddddddddddddddddddddddb~~~~~~~~~~~R~}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddddaddddddddddddd\bddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:1:8732:6209#0/2_PairEnd sminR=40.0; pairend_limit=108; ali_dir=right; score=15.9727840143; mode=joined; sminL=40.0; 
+gctctacagaggcgggggggggggagaaggggaaatcatggggggggggggcgacatctaaaaacatacatacaacccacacctcctaccacacagctcccagcgcaaagatagatcatgatggtaagtagaggcaaatgagatcatctatttttttcaaagagaagacggcatacgatatcggtctcggcattcctgctaaccgctcttccgatc
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBa[]aa_aaaa]aa`]a\[aZ`\ZcMWR]Z`````
+@HELIUM_000100422_612GNAAXX:7:1:14576:14181#0/2_CONS ali_length=63; direction=left; seq_ab_match=60; sminR=40.0; score=223.962708229; seq_a_mismatch=2; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.55496362269; seq_b_insertion=0; seq_a_insertion=1; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=46; 
+ccgaagtagttagataccccactatgcttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctactacttcgg
++
+dddddddddddddddddddddddddddddddddddcddddddcda~~~~b~~~~~~~~~~~a~~~~~~`~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddedddddcdddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:99:13467:17714#0/2_CONS ali_length=62; direction=left; seq_ab_match=59; sminR=40.0; score=223.932198733; seq_a_mismatch=1; seq_b_deletion=0; seq_b_mismatch=2; seq_a_deletion=0; score_norm=3.61180965699; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgcctcctttagataccccactatgcttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctaaggaggcgg
++
+ddddcdddddddddcddddddddddddddcddddddddddddddcd~~~~~~~~b~~~}~~~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~bddddddddddeddcdddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:43:7980:7908#0/2_CONS ali_length=62; direction=left; seq_ab_match=61; sminR=40.0; score=239.984831014; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=1; seq_a_deletion=0; score_norm=3.87072308087; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccaattaacttagataccccactatgcctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctagttaattgg
++
+ddddcdddddddddddd`ddddddddbdaddcdddd_cddcdddda~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~`~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~d`ddddddddddccbdddddddddddddcdddeddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:105:14135:6905#0/2_CONS ali_length=62; direction=left; seq_ab_match=61; sminR=40.0; score=239.985379811; seq_a_mismatch=1; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.87073193244; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgcctcctttagataccccactatgcttagccctaaacacaagtaattaatataacaaaattattcaccagagtactagcggcaacagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctaaggaggcgg
++
+ddddddddddcddedddddddddddddddddddddddddddddddd~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddeddddddddddddbdddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:89:16663:15081#0/2_CONS ali_length=62; direction=left; seq_ab_match=62; sminR=40.0; score=247.939062327; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.9990171343; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccaattaacttagataccccactatgcctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctagttaattgg
++
+dddedddddddddddddddddddddddddddddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddddddddddddecddddddddddddcdddddcddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:86:15907:21191#0/2_CONS ali_length=63; direction=left; seq_ab_match=58; sminR=40.0; score=211.91203832; seq_a_mismatch=3; seq_b_deletion=0; seq_b_mismatch=2; seq_a_deletion=0; score_norm=3.36368314793; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccgaatatctagaacaggctcctctagagggatgtaaagcaccgccaagtcctttgagtttcaggctgttgctagtagtactctggcgaacattcttgtttattgaatgtttatgtttagggctaagcatagtggggtatctaagatattcgg
++
+dddcdddddddddeddddddddaddddbdddcdddddadd\dcdd~b~~~a{~`~~~~~~~~~~~~~~~~~~~[~~~X~~~~~~~~~~~~~~~~~~~~~~~~{~~~~~ddddddddddddded`ddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:81:17261:2872#0/2_CONS ali_length=63; direction=left; seq_ab_match=63; sminR=40.0; score=251.967130674; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.99947826467; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccgaatatctagaacaggctcctctagagggatgtaaagcaccgccaagtcctttgagtttcaggctgttgctagtagtactctggcgaacattcttgtttattgaatgtttatgtttagggctaagcatagtggggtatctaagatattcgg
++
+dddcddddddddcddddddddddddddddddddeddedddddadd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddddedddddddddedddddddddddddddddddddddddddded
+@HELIUM_000100422_612GNAAXX:7:14:15397:17819#0/2_CONS ali_length=62; direction=left; seq_ab_match=59; sminR=40.0; score=223.847163266; seq_a_mismatch=2; seq_b_deletion=0; seq_b_mismatch=1; seq_a_deletion=0; score_norm=3.61043811719; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgcctccttagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctgttgccgctagtactctggtgaacaattttgtttgtgtaattatttgtgtttagggctaagcatagtggggtatctaaaggaggcgg
++
+ddcddddddddddddddddddddddbddddddcddddddbcddddd~~~~~~~a~~}~~~~~~~~v~~~s~a~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~`~cddddddddddddddddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:76:18268:14980#0/2_CONS ali_length=62; direction=left; seq_ab_match=61; sminR=40.0; score=239.985254914; seq_a_mismatch=1; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.87072991797; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgcctccttagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaataattttgttatattaattacttgtgtttaggggtaagcatagtggggtatctaaaggaggcgg
++
+ddddddddddddddddddddddbdcddbdbddHddcccb^dbdbda~~~~b~~~~~~~~~~~~~~~~~~~~z~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dceddddddddddcdcc\dddddddddddddedddddddddccded
+@HELIUM_000100422_612GNAAXX:7:16:15509:18069#0/2_CONS ali_length=62; direction=left; seq_ab_match=58; sminR=40.0; score=215.81634366; seq_a_mismatch=4; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.48090876871; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgaagtagtagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaataattttgttatattaattacttgtgtttagggctaagcatagtggggtatctaactacttcgg
++
+dddddddddddddddddcdddd_cdcddbddaLdddddbddddddd_~}}b~~~~~~~~~~~~~}~~~~zz]~~~~~~~~~~~~~~r~a}~~~~~~~~~~~~~~~~~~adddcdbdddbdddddYdcdddcdddddddddddddcddcdddddd
+@HELIUM_000100422_612GNAAXX:7:25:7789:3090#0/2_CONS ali_length=62; direction=left; seq_ab_match=59; sminR=40.0; score=223.705772044; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=3; seq_a_deletion=0; score_norm=3.60815761361; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgcctccttagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgcctgtagtactctggcgaataattttgttatattaattacttgtgtttagggctaagcatagtggggtatctaaaggaggcgg
++
+ddccdcddbdddddddddcdbbddc^T`_`]\L\Zccc^Tb\^abNt|rzu~~~||j|w~~~p~y~}z~~cccBccccccccccccBBc~~~~}~{~~~~~~~~~~~~dbddddddddddddd]daedddddddddddddeddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:53:18419:8404#0/2_CONS ali_length=62; direction=left; seq_ab_match=60; sminR=40.0; score=231.841887233; seq_a_mismatch=1; seq_b_deletion=0; seq_b_mismatch=1; seq_a_deletion=0; score_norm=3.73938527796; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccaattaactagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaatagttttgtttgcataactatttgtgtttaaggctaggcatagtggggtatctaagttaattgg
++
+dddddddddddddedddddddddddddddddd_ddddddedddddd~~~~~~~~~{~~~~~~~~~~~~~~~b~~~~{~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~bddddddddddddddddcedddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:19:11039:3957#0/2_CONS ali_length=62; direction=left; seq_ab_match=62; sminR=40.0; score=247.811165598; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.99695428384; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgaagtagtagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaataattttgttatattaattacttgtgtttagggctaagcatagtggggtatctaactacttcgg
++
+dddddddddaddddddddddddddcccdddddbdddddabdddbdd~~~~~~~~~~~~~~~~~~~~~~~v~~~~~~~~~~}~~~~~~~~~~~~~~~~~~~~~~~~~~~dadddddddddddddcdddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:42:19757:3800#0/2_CONS ali_length=62; direction=left; seq_ab_match=57; sminR=40.0; score=187.78301321; seq_a_mismatch=1; seq_b_deletion=1; seq_b_mismatch=3; seq_a_deletion=1; score_norm=3.02875827758; seq_b_insertion=0; seq_a_insertion=1; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=46; 
+ccgaagtagtagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaataattttgtatattaattacttgtgtttagggctaagcatagtggggtatctaactacttcgg
++
+dddeddddddddddddddddddddddddcdddaddddd`dddddd~~~~~~]~~~~~~~~~~~~~_x~~~~~~~~~~~zv~~~~~~~~~~~`~a~~~|~b~~~~~~~ccdcddddddedddeddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:116:14244:17926#0/2_CONS ali_length=63; direction=left; seq_ab_match=55; sminR=40.0; score=187.882758912; seq_a_mismatch=5; seq_b_deletion=0; seq_b_mismatch=3; seq_a_deletion=0; score_norm=2.98226601448; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccgaatatcttagataccccactatgcttagccctaaacataaacattcaataaacaagaatgttcgcaagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccctctagaggagcctgttctagatattcgg
++
+dddddddddddddddddddddddedddd`dbcccc`dddddeddd~~~~~~_~~~~b~~~~~~^xz{ZRzpooop~~s~~~~~~`~~~~~~~~~~~~~~~~~b~~~b~dddddeddddddddddddddeddddadddddeddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:91:10071:8960#0/2_CONS ali_length=63; direction=left; seq_ab_match=63; sminR=40.0; score=251.979171474; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.99966938848; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccgaatatcttagataccccactatgcttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccctctagaggagcctgttctagatattcgg
++
+dddddddddddddddddddddddddddddddddddddddddeddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddddddddddddddddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:61:17484:5085#0/2_CONS ali_length=62; direction=left; seq_ab_match=62; sminR=40.0; score=247.996979391; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.9999512805; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgcctcctttagataccccactatgcttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctaaggaggcgg
++
+ddcdddddddddddddddeddddddddddddedddddddddddd`d~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddccddcdddddddddddddddddbddddddddedcd
+@HELIUM_000100422_612GNAAXX:7:18:2721:16829#0/2_CONS ali_length=63; direction=left; seq_ab_match=63; sminR=40.0; score=251.960802952; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.99937782464; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccgaatatcttagataccccactatgcttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccctctagaggagcctgttctagatattcgg
++
+ddddecdededdedddddddddddddddddeeddddedddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dbddddddddddddddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:2:7296:17275#0/2_CONS ali_length=62; direction=left; seq_ab_match=59; sminR=40.0; score=223.923525795; seq_a_mismatch=1; seq_b_deletion=0; seq_b_mismatch=2; seq_a_deletion=0; score_norm=3.61166977089; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgcctcctttagataccccactatgcttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctaaggaggcgg
++
+ddcddcdd_dddddddddddddcdddddbcacbcbd`ddddddd_b~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~~vbdddddddddddcc]baddbddddbdddddddddddddcdddddddd
+@HELIUM_000100422_612GNAAXX:7:58:8591:17028#0/2_CONS ali_length=62; direction=left; seq_ab_match=59; sminR=40.0; score=223.788176649; seq_a_mismatch=2; seq_b_deletion=0; seq_b_mismatch=1; seq_a_deletion=0; score_norm=3.60948672015; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgcctccttagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaataattttgttatattaattacttgtgtttagggctaagcatagtggggtatctaaaggaggcgg
++
+cc^cccccacabcaaccccccccc_\_[__ccaccccc`ac]caaa~~~~_~~`~wx~z~~~~~xxuz{~~~~~~ppppkzzrz~~x~~~~nyw~~~~~y~~a~~~~~ccccccaccbcccccccb_cccccccc_ccccc^]ccccccccccc
+@HELIUM_000100422_612GNAAXX:7:13:3469:18630#0/2_CONS ali_length=63; direction=left; seq_ab_match=58; sminR=40.0; score=211.840326012; seq_a_mismatch=3; seq_b_deletion=0; seq_b_mismatch=2; seq_a_deletion=0; score_norm=3.36254485733; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccgaatatctagaacaggctcctctagagggatgtaaagcaccgccaagtcctttgagtttcaggctgttgctagtagtactctggcgaacattcttgtttattgaatgtttatgtttagggctaagcatagtggggtatctaagatattcgg
++
+dddddd`ddadddddddcddddcdddd`ddc_a`^dddd_ddddd~b~~~b~~[~~~~~~~~~~~~~~{yy|{xzsz~~~~~~~~~~~~~~~~~~w{VqLyyx~~~~~ddadcdddadPPQQIdddddddddddddddcddddddd_ddcd`d
+@HELIUM_000100422_612GNAAXX:7:72:12959:5736#0/2_CONS ali_length=63; direction=left; seq_ab_match=56; sminR=40.0; score=195.664863172; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=7; seq_a_deletion=0; score_norm=3.10579147892; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccgaatatctagaacaggctcctctagaggggtgtaaagcaccgccaagtcctttgagtttcaggctgttgctagtagtactctggcgaacattcttgtttattgaatgtttatgtttagggctaagcatagtggggtatctaagatattcgg
++
+__T__WY_b_Sb__X[_\S_bDDDDDDDDDDDDDDDDDDDDDDDDccccccccccccccccccccBcccccccccBBBcc~_~~~~~~bi~~b~~~~~~~~~~~~~~~dddd^dddddbbbbSb\^b^cacdddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:1:8858:2566#0/2_PairEnd sminR=40.0; pairend_limit=108; ali_dir=left; score=15.7312871104; mode=joined; sminL=40.0; 
+ggctcggagagagggggggggggggggaggggggggatccgggggggggggggtcttacaaaaaaacacaaaacacataaccactctcacacccacactcgcacacccggatgtggttgtggtgtgcgcgtggatggtgtggtgtggtttttttttcaagcagaagacggcatacgagatcggtctcggcattcctgctgaaccgctcttccgatc
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBa_a_a]aaaa_`Y`_W]Y[S]]aaaabbbbbcbbbbbbbbbbbbb`bbbbbbbbbbbbbb
+@HELIUM_000100422_612GNAAXX:7:115:6263:17700#0/2_CONS ali_length=63; direction=left; seq_ab_match=61; sminR=40.0; score=235.853550005; seq_a_mismatch=2; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.74370714293; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccgaatatctagaacaggctcctctagagggatgtaaagcaccgccaagtcctttgagtttcaggctgttgctagtagtactctggcgaacattcttgtttattgaatgtttatgtttagggctaagcatagtggggtatctaagatattcgg
++
+ddddddddddddddddddddddddddddddddddddddddedddd~b~~~b~~~~~~~~~~~~~~~~~~~~~{~~xxy{z|y~~~~~~~~~~~~~~~~~~~~~~~~~~dddedddddddddddcdddddddddddddddcddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:7:15538:8325#0/2_CONS ali_length=63; direction=left; seq_ab_match=52; sminR=40.0; score=151.662770749; seq_a_mismatch=0; seq_b_deletion=1; seq_b_mismatch=10; seq_a_deletion=0; score_norm=2.40734556744; seq_b_insertion=1; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccgaatatctagaacaggctcctctagagggatgtaaagcaccgcccagttctttgagtttcatgctgttgctagtagtactctggccgacattcttgtttattgaatgtttatgtttagggctaagcatagtggggtatctaagatattcgg
++
+__\b\][\XVbZX_\_b[abbDDDDDDDDDDDDDDDDDDDDDDDDcBcccBcccccBccccccBccccccBBccccccccccccccBcca~~~^YgzYxq~~~~}y~~_ccccac_accacba\S_][_cc^cccaccbacba`a_c_`a_aa
+@HELIUM_000100422_612GNAAXX:7:120:16005:7955#0/2_CONS ali_length=64; direction=left; seq_ab_match=61; sminR=40.0; score=231.880428082; seq_a_mismatch=1; seq_b_deletion=0; seq_b_mismatch=2; seq_a_deletion=0; score_norm=3.62313168878; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=44; seq_b_single=44; 
+ccgaatatctagaacaggctcctctagagggatgtaaagcaccgccaagtcctttgagtttcggctgttgctagtagtactctggcgaacattcttgtttattgaatgtttatgtttagggctaagcatagtggggtatctaagatattcgg
++
+dddddddddddddddddddddddddddddddddddddddcdddd~~~~~~~~~~~~~~~~~~`~~~~~~~{~~~~~~~~~~z~~~~~~~~~~~b~~~~~~~~~b~~~~dddddddddddddddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:115:3396:14235#0/2_CONS ali_length=63; direction=left; seq_ab_match=61; sminR=40.0; score=235.745732131; seq_a_mismatch=1; seq_b_deletion=0; seq_b_mismatch=1; seq_a_deletion=0; score_norm=3.74199574811; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccgaatatctagaacaggctcctctagagggatgtaaagcaccgccaagtcctttgagtttcaggctgttgctagtagtactctggcgaacattcttgtttattgaatgtttatgtttagggctaagcatagtggggtatctaagatattcgg
++
+ddddddddddddddddddddddddddddddddcdcdddddddddd~~~~~b~~~~~~~~~~~~~~~~~~~s~~~~~~~{~~~~|~ccc~}~}~~~~~~~~~b~~~~~~dddcdddddadddddcdddddddddddddddeddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:32:15197:9940#0/2_CONS ali_length=62; direction=left; seq_ab_match=60; sminR=40.0; score=231.86950825; seq_a_mismatch=2; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.73983077822; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccaattaactagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaatagttttgtttgcataactatttgtgtttaaggctaggcatagtggggtatctaagttaattgg
++
+dddddedddddddddddddddddddeddddddcddddddcdddd`db~~~~~~b~~~~~~~~~~~~~~~{~~~~~}}tw~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddcddddddddddddacddddddddddddcddddddddddddddcd
+@HELIUM_000100422_612GNAAXX:7:7:17828:13825#0/2_CONS ali_length=62; direction=left; seq_ab_match=56; sminR=40.0; score=187.930205125; seq_a_mismatch=2; seq_b_deletion=1; seq_b_mismatch=3; seq_a_deletion=0; score_norm=3.03113234072; seq_b_insertion=1; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgcctcctttagataccccactatgcttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctaaggaggcgg
++
+ddeddcdddddcddddddddddddddddddbddddddddacbaa[b~b~~~~~~~~~~~~~a~~~~~~~~~~~~b~~~~~~~~~~~b~~~~~~~b}~~~~~~~~~~~_ddddddddddddccdddcdddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:53:2128:13141#0/2_CONS ali_length=62; direction=left; seq_ab_match=62; sminR=40.0; score=247.978630411; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.99965532921; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgaagtagttagataccccactatgcttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctactacttcgg
++
+ddcddddddddddddddddddddddddddddddddddddddd^dad~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddcddddddddddcdddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:1:8644:15229#0/2_CONS ali_length=106; direction=left; seq_ab_match=103; sminR=40.0; score=399.617128202; seq_a_mismatch=1; seq_b_deletion=0; seq_b_mismatch=2; seq_a_deletion=0; score_norm=3.76997290756; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=2; seq_b_single=2; 
+cacacgctctccattgagtctctgcacctatcctttttgattttcgctttctgaatctttgtttgttttcggaaaacgtgatttggctcaggattgcccagagcgtgtgg
++
+dd~~~~~~~~~~~~~~~~~~~~~~~~{~~~~b~~~~~~~~~{|~~~~s|~v~~|p~~~~~~~~~~~u~qy~a~~~~~~~x~|~~~~z{~|~o|~{yvwwy~~|~~[~~cb
+@HELIUM_000100422_612GNAAXX:7:72:7057:20448#0/2_CONS ali_length=62; direction=left; seq_ab_match=62; sminR=40.0; score=247.94833093; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.9991666279; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccaattaacttagataccccactatgcctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctagttaattgg
++
+ddddddddddddddddddddddddddddddeddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddddebddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:10:9237:10532#0/2_CONS ali_length=62; direction=left; seq_ab_match=57; sminR=40.0; score=207.90944986; seq_a_mismatch=2; seq_b_deletion=0; seq_b_mismatch=3; seq_a_deletion=0; score_norm=3.35337822355; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgcctccttagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaattattttgttatattaattacttgtgtttagggctaagcatagtggggtatctaaaggaggcgg
++
+ddcdccddddcddcdcdcdddd[a^[]]V]adadddacdddadddd~~~~b~~b~~~~~~o|~|xpppoj~~Y~~~~~~~~~~~~~~~\~~N~~~~~~~~~~~~~~~~`\_addddddddddd`cSccadddddd`dddddbabdcdddddddd
+@HELIUM_000100422_612GNAAXX:7:16:16055:12835#0/2_CONS ali_length=62; direction=left; seq_ab_match=61; sminR=40.0; score=239.868244499; seq_a_mismatch=1; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.86884265322; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccaattaactagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaatagttttgtttgcataactatttgtgtttaaggctaggcatagtggggtatctaagttaattgg
++
+ddddddddddddddddddddddddddddddddcddddddddddddd~~~~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~cdddddddddddcddd`bdddddcdddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:17:16877:9760#0/2_CONS ali_length=62; direction=left; seq_ab_match=59; sminR=40.0; score=223.899159093; seq_a_mismatch=3; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.61127675956; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgcctcctttagataccccactatgcttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctaaggaggcgg
++
+ddddddddddddddddddddeddddcddddddddddddcddddddd~b~~~~~~~~~~~~~a~~~~~~b~~~{~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddddddddddddddddddddddddddddddddeddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:47:8320:8571#0/2_CONS ali_length=63; direction=left; seq_ab_match=61; sminR=40.0; score=235.809300513; seq_a_mismatch=1; seq_b_deletion=0; seq_b_mismatch=1; seq_a_deletion=0; score_norm=3.74300477004; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccgaatatctagaacaggctcctctagagggatgtaaagcaccgccaagtcctttgagtttcaggctgttgctagtagtactctggcgaacattcttgtttattgaatgtttatgtttagggctaagcatagtggggtatctaagatattcgg
++
+dddddddddcdddddddddddd`dd`daddd\ddddddaddddad~b~~~~~~~~~~x~~~~~|~~~~~~~~~~~yuu~~~~~~~~~~~~~~~~~~~~~b~~~~~|~~ddddddddddddddddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:6:6617:2744#0/2_CONS ali_length=63; direction=left; seq_ab_match=61; sminR=40.0; score=235.875132744; seq_a_mismatch=2; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.7440497261; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccgaatatcttagataccccactatgcttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccctctagaggagcctgttctagatattcgg
++
+ddddddddddddcadddddddddddddeddddd`ddddddddcbd~b~~~~b~~~~~~~~~~~~|~~~~~~~~y~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddddddddddddddcbddddeddddddddddeddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:12:9609:14740#0/2_CONS ali_length=62; direction=left; seq_ab_match=60; sminR=40.0; score=231.833538451; seq_a_mismatch=2; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.73925062018; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccaattaactagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaatagttttgtttgcataactatttgtgtttaaggctaggcatagtggggtatctaagttaattgg
++
+dddddddeddddddddddddddddddddddddedddddcdddddddb~~~b~~~~~~~~~~~~~~~~~~}~~~~~}~sz~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddddddcddddddddddcdddddddddddddddddddddddedddd
+@HELIUM_000100422_612GNAAXX:7:21:2093:4412#0/2_CONS ali_length=63; direction=left; seq_ab_match=60; sminR=40.0; score=227.763131817; seq_a_mismatch=3; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.61528780662; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccgaatatcttagataccccactatgcttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccctctagaggagcctgttctagatattcgg
++
+dddddddddddddddddddddddddddeddddddddddddddddd~b~~~~~~~~~~~~~}~~`~~~~~~~~~~~~~Z{~~|{~~~~{~|~|~~~~~}~~~}|~~}}}DDDDDDDD``U`^\[dddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:18:5240:1587#0/2_CONS ali_length=62; direction=left; seq_ab_match=59; sminR=40.0; score=223.905608015; seq_a_mismatch=1; seq_b_deletion=0; seq_b_mismatch=2; seq_a_deletion=0; score_norm=3.61138077443; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccaattaacttagataccccactatgcctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctagttaattgg
++
+dddddddddddddddddddddddddddddddddddddddddddddd~}~~~~~~~~~~~~}~~~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~~~bdddddddedddddcdddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:88:15797:19191#0/2_CONS ali_length=62; direction=left; seq_ab_match=58; sminR=40.0; score=215.88300628; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=4; seq_a_deletion=0; score_norm=3.48198397226; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccaattaacttagataccccactatgcctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctagttaattgg
++
+ddddddddddddddddddddddddddddddddddddddddddcddc~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~~~`~~~~b~~b~~~~ddeddddddddddcdddddcddddddddcddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:1:8613:5665#0/2_CONS ali_length=90; direction=right; seq_ab_match=89; sminR=40.0; score=351.879189487; seq_a_mismatch=0; seq_b_deletion=18; seq_b_mismatch=1; seq_a_deletion=18; score_norm=3.90976877208; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=0; seq_b_single=0; 
+ccttcctggggtagtactctggcgaataattttgttatattaattacttgtgtttagggctaagcatagtggggtatctaaccaggaagg
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~~~~~~~
+@HELIUM_000100422_612GNAAXX:7:47:11864:1343#0/2_CONS ali_length=63; direction=left; seq_ab_match=63; sminR=40.0; score=251.976310174; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.99962397102; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccgaatatcttagataccccactatgcttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccctctagaggagcctgttctagatattcgg
++
+dddddddddddddddddddddddddddddddddddddddddbdcd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddcdddddddddddddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:43:8022:8427#0/2_CONS ali_length=62; direction=left; seq_ab_match=60; sminR=40.0; score=231.869859511; seq_a_mismatch=2; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.73983644372; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccaattaactagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaatagttttgtttgcataactatttgtgtttaaggctaggcatagtggggtatctaagttaattgg
++
+ddddddddddddddddddddddddddddddddcddddddddddddd~~~~b~~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddddddcdedddddcdddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:95:11283:2557#0/2_CONS ali_length=58; direction=right; seq_ab_match=57; sminR=40.0; score=223.999078974; seq_a_mismatch=0; seq_b_deletion=50; seq_b_mismatch=1; seq_a_deletion=50; score_norm=3.86205308576; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=0; seq_b_single=0; 
+ccgcctccttagaacaggctcctctagaaaagcatagtggggtatctaaaggaggcgg
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~a~~~~~~~~~~~~~~~
+@HELIUM_000100422_612GNAAXX:7:67:5288:13403#0/2_CONS ali_length=62; direction=left; seq_ab_match=62; sminR=40.0; score=247.999078967; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.99998514464; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgcctcctttagataccccactatgcttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctaaggaggcgg
++
+ddeddddddddddddddddddddddddddddddddddcdddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddddedddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:7:11998:4462#0/2_CONS ali_length=63; direction=left; seq_ab_match=59; sminR=40.0; score=219.864332815; seq_a_mismatch=4; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.48991004469; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccgaatatcttagataccccactatgcttagccctaaacataaacattcaataaacaagaatgttcgccagagtagtactagcaacagcctgaaactcaaaggacttggcggtgctttacatccctctagaggagcctgttctagatattcgg
++
+dddddddddddddddddddddddddddddddddddddddddcddd~b~~~~~~~~~~~~b~~~~~~~b~~~~~~~G~}}~~}}~~~~~~~~~~~~~~~~~~~~~~~~~ddddddddddddcdccddedddddddcdddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:116:12598:9964#0/2_CONS ali_length=62; direction=left; seq_ab_match=53; sminR=40.0; score=175.843125508; seq_a_mismatch=8; seq_b_deletion=0; seq_b_mismatch=1; seq_a_deletion=0; score_norm=2.83617944368; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccaattaactagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaatagttttgtttgcataactatttgtgtttaaggctaggcatagtggggtatctaagttaattgg
++
+dddddddddddddddddddddddddddddddddddddddeddddddb~~~b~~~~~~~~~~~b~~~~~~{~b~b~~~~~b~~~~b~~~b~~~~~~~~~~~~~~~~~~`adddbdddddddcddddddddccdcedddeddddddddddbcecdd
+@HELIUM_000100422_612GNAAXX:7:111:18277:17779#0/2_CONS ali_length=63; direction=left; seq_ab_match=61; sminR=40.0; score=235.877819976; seq_a_mismatch=2; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.74409238057; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccgaatatctagaacaggctcctctagagggatgtaaagcaccgccaagtcctttgagtttcaggctattgctagtagtcctctggcgaattattttgttgtaaaattatctatgtttagggctaagcatagtggggtatctaagatattcgg
++
+dddddddddddddcdddddddddddddddddddddddeddddddd~~~~~b~~~~~~~~~~~~_~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dcdddbddddddddddddeddeddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:85:13257:14594#0/2_CONS ali_length=62; direction=left; seq_ab_match=60; sminR=40.0; score=231.92296471; seq_a_mismatch=2; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.7406929792; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgcctccttagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctgttgccgctagtactctggtgaacaattttgtttgtgtaattatttgtgtttagggctaagcatagtggggtatctaaaggaggcgg
++
+dddddddddddeddddddddddddddddddddacdddddaddccdda~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~_~~~~~~~~~~~~~~~~~~~~~~~ddddddddddeddddddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:17:11935:17343#0/2_CONS ali_length=63; direction=left; seq_ab_match=62; sminR=40.0; score=243.983570342; seq_a_mismatch=1; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.87275508479; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccgaatatcttagataccccactatgcttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccctctagaggagcctgttctagatattcgg
++
+ddddddddddddddddddddddddddddddddddddddddddddd~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddddddddddddddddddcddddddddddddcddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:38:9654:18700#0/2_CONS ali_length=63; direction=left; seq_ab_match=62; sminR=40.0; score=243.950053136; seq_a_mismatch=1; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.87222306566; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccgaatatctagaacaggctcctctagagggatgtaaagcaccgccaagtcctttgagtttcaggctgttgctagtagtactctggcgaacattcttgtttattgaatgtttatgtttagggctaagcatagtggggtatctaagatattcgg
++
+dddddddddddddddddddddddddddcddddcddddddddddcd~~~~~~~~~~~~~~~~~~~~~~~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddeddddddddddddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:101:11720:19906#0/2_CONS ali_length=62; direction=left; seq_ab_match=57; sminR=40.0; score=207.841888471; seq_a_mismatch=4; seq_b_deletion=0; seq_b_mismatch=1; seq_a_deletion=0; score_norm=3.35228852373; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgcctccttagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaataattttgttatattaattacttgtgtttagggctaagcatagtggggtatctaaaggaggcgg
++
+dddddddddddddddddddddddddddddddd^ddbbcc^dcdddd_~~~c~~b~~~~x~}~~~~}~~b~}sq~~}t{z~~{~~psh~|~~]~~~~~~~~~~~~~~~~d\ddddddcdddddd_cddddddddddddddddddddddddddcdd
+@HELIUM_000100422_612GNAAXX:7:42:12961:8650#0/2_CONS ali_length=63; direction=left; seq_ab_match=62; sminR=40.0; score=243.985409859; seq_a_mismatch=1; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.87278428347; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccgaatatcttagataccccactatgcttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccctctagaggagcctgttctagatattcgg
++
+ddddddddddddddddddddddddddddddddddddddddddddd~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddcddddddddddddddddddddddddddddeddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:36:10388:10324#0/2_CONS ali_length=62; direction=left; seq_ab_match=61; sminR=40.0; score=239.950587748; seq_a_mismatch=1; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.87017077012; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgaagtagttagataccccactatgcttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctactacttcgg
++
+dddddddddddddddddddddddddddddddddddddddddddddd~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddddeddddddddddddddddddcddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:1:8823:6682#0/2_PairEnd sminR=40.0; pairend_limit=108; ali_dir=right; score=15.9839512414; mode=joined; sminL=40.0; 
+gatcgggagagcgtcgtgtaggggaagagggtagatctcggggggggccgtatcattaaaaaaaaaaacaaacatcagcacgaagcacatgacaccgcctagctatcaatcttgagatgagatcagacatctgtttgttttcttttgtttttttttcaagcagaagacggcatacgatatcggtctcggcattcctgctgaaccgctcttccgatc
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB_aa]a`]^S``aabaab^bbbbab_c``abbbbbbbcbbbbbbbbbbbbbbbbbbbbbbbbbbab
+@HELIUM_000100422_612GNAAXX:7:66:11860:20419#0/2_CONS ali_length=62; direction=left; seq_ab_match=61; sminR=40.0; score=239.911387587; seq_a_mismatch=1; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.86953850946; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgcctccttagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaataattttgttatattaattacttgtgtttagggctaagcatagtggggtatctaaaggaggcgg
++
+ddeddddddddddddedd`dddddd`edddddNddddddddddcdd|~~~b~~~~~~~~~~~~~~~}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~daddddddddedddddcddddedddddddddddddddddddddedd
+@HELIUM_000100422_612GNAAXX:7:3:17077:6562#0/2_CONS ali_length=62; direction=left; seq_ab_match=59; sminR=40.0; score=223.876050008; seq_a_mismatch=3; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.61090403239; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgaagtagtagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggcagtactctggcgaataattttgttatattaattacttgtgtttagggctaagcatagtggggtatctaactacttcgg
++
+ccccccccccccccccccccccccbccccccccacccccccccccc~~~ua~~~~~~~~~~~~~~}~~~~~~~a~Fz~zz~~~~~~~~~~~~~~~~~~~~~~~~~~~~badadddddddddddcdddddddcddddddddeddddddbdddbdd
+@HELIUM_000100422_612GNAAXX:7:18:11865:6418#0/2_CONS ali_length=63; direction=left; seq_ab_match=63; sminR=40.0; score=251.959188225; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.99935219405; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccgaatatcttagataccccactatgcttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccctctagaggagcctgttctagatattcgg
++
+ddddddddddddddddddddddddddddddddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddddddcdddedddddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:19:4311:13343#0/2_CONS ali_length=63; direction=left; seq_ab_match=58; sminR=40.0; score=211.837822462; seq_a_mismatch=4; seq_b_deletion=0; seq_b_mismatch=1; seq_a_deletion=0; score_norm=3.36250511845; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccgaatatctagaacaggctcctctagagggatgtaaagcaccgccaagtcctttgagtttcaggctgttgctcgtagtactctggcgaacattcttgtttattgaatgtttatgtttagggctaagcatagtggggtatctaagatattcgg
++
+dddddddddddcd`ddcddddddcd\bcccdddddddddcdddcb~b~~~b~~~~~|~~~}~~~{y~~_~~~{Z{~~~~~~~~~~~~~~~~~~~b~~~~~~~~~~~~~ddddd^ddcddddcddbdddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:30:1800:7833#0/2_CONS ali_length=62; direction=left; seq_ab_match=52; sminR=40.0; score=167.712615339; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=10; seq_a_deletion=0; score_norm=2.70504218289; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgaagtagttagataccccactatgcttagccctaaacacaagacattaatataacgagattaatcgacagagtactaccggctatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctactacttcgg
++
+DDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDccBccccccccBcBccccBBccBcccccccc~u~v}[wJ~~Q|~~~~~~~~~~~~a~~~~t~Z^ccc`c]bbc_[V_[`[````bb_cc[_cc[\[\[bcbbbccccc
+@HELIUM_000100422_612GNAAXX:7:16:19299:8684#0/2_CONS ali_length=62; direction=left; seq_ab_match=60; sminR=40.0; score=231.845804746; seq_a_mismatch=2; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.73944846365; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgaagtagtagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaataattttgttatattaattacttgtgtttagggctaagcatagtggggtatctaactacttcgg
++
+ddddddddddddddddddddddcdddddddddcddddddddddddd~~~~b~~~~~~~`~~~~~~~~~~~~~~~~~~~~~~~~|~~~~~~~~~~~~~~~~~~~~~~~~cadaddddddeddddccdcddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:54:14618:14353#0/2_CONS ali_length=62; direction=left; seq_ab_match=61; sminR=40.0; score=239.8562981; seq_a_mismatch=1; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.86864996935; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccaattaactagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaatagttttgtttgcataactatttgtgtttaaggctaggcatagtggggtatctaagttaattgg
++
+ddddddddddddddddddcdddddddddddddcddddddcdddddd~~~~b~~~~~~~~~~~~~~~~~~y~~~~~z|}z~~~~~~~~~~~~~~~~~~~~~~~~~~~~~eddddddddddddddecddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:108:9222:18258#0/2_CONS ali_length=62; direction=left; seq_ab_match=60; sminR=40.0; score=231.857703869; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=2; seq_a_deletion=0; score_norm=3.73964038498; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccaattaacttagataccccactatgcctagccttaaacacaaatagttatgcagacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctagttaattgg
++
+ddddeeddddddeddddddddddddddddccddddddddddddddd~~~~~~~~~~~~~~~~~~~v~~~~~}~}}~~~~~`~~~~~~~~~~b~~~~~~~~~~~~~~~~dcdddddddddddddddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:74:4783:20479#0/2_CONS ali_length=62; direction=left; seq_ab_match=61; sminR=40.0; score=239.87314657; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=1; seq_a_deletion=0; score_norm=3.86892171887; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgcctccttagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaataattttgttatattaattacttgtgtttagggctaagcatagtggggtatctaaaggaggcgg
++
+dddddddddddddddddd`dddcddcdadcddWdddddadWddbbcqy~~~~~~~~~~r~}~~~qx~~~~~z|~~~~~~~~~~~~~~~}~~~~~~~~~~~~~~~~~b~d`dZddddbddddddaddddddcddddbdddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:38:3005:20881#0/2_CONS ali_length=63; direction=left; seq_ab_match=60; sminR=40.0; score=227.901935995; seq_a_mismatch=3; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.61749104754; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccgaatatctagaacaggctcctctagagggatgtaaagcaccgccaagtcctttgagtttcaggctgttgctagtagtactctggcgaacattcttgtttattgaatgttcatgtttagggctaagcatagtggggtatctaagatattcgg
++
+dddddddddddddddddddddddddddddddddbdddddcdddbd~~}~~b~~b~~~~~~|~~~~~~~a~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddeadddddddddddddddddddcddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:4:10139:2389#0/2_CONS ali_length=63; direction=left; seq_ab_match=63; sminR=40.0; score=251.802206044; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.99686041339; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccgaatatcttagataccccactatgcttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccctctagaggagcctgttctagatattcgg
++
+ddddddcddddddddddddd`dcdddddaddaddddbdddddddc~~~~~~~~~{~~~~~~~~zxy~~|~~~~ru~~~~~~~~~~~~~~~~~~{~~p~~~~~~~~~~~ddddddddddabaP`ddddabddddddddddddddddcdcdaddd
+@HELIUM_000100422_612GNAAXX:7:75:9674:16966#0/2_CONS ali_length=58; direction=right; seq_ab_match=57; sminR=40.0; score=224.000075421; seq_a_mismatch=0; seq_b_deletion=50; seq_b_mismatch=1; seq_a_deletion=50; score_norm=3.86207026589; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=0; seq_b_single=0; 
+ccgcctccttagaacaggctcctctagaaaagcatagtggggtatctaaaggaggcgg
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~~~~~~~~~~~~~~~
+@HELIUM_000100422_612GNAAXX:7:59:15367:8376#0/2_CONS ali_length=62; direction=left; seq_ab_match=62; sminR=40.0; score=247.996374666; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.99994152687; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgaagtagttagataccccactatgcttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctactacttcgg
++
+ddddddddddddddddddddddddddddddddddddddddddddad~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddddedddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:29:1328:13185#0/2_CONS ali_length=63; direction=left; seq_ab_match=59; sminR=40.0; score=223.94591652; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=4; seq_a_deletion=0; score_norm=3.55469708763; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccgaatatcttagataccccactatgcttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccctctagaggagcctgttctagatattcgg
++
+ddddddddddddccdddddddddeddddddddddddddddedadd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~W[~~~~~~~~~~~~~~~~~~~~~~~b~~~b~dddcdddddddcddddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:30:16081:4486#0/2_CONS ali_length=63; direction=left; seq_ab_match=62; sminR=40.0; score=243.950667893; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=1; seq_a_deletion=0; score_norm=3.87223282369; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccgaatatctagaacaggctcctctagagggatgtaaagcaccgccaagtcctttgagtttcaggctgttgctagtagtactctggcgaacattcttgtttattgaatgtttatgtttagggctaagcatagtggggtatctaagatattcgg
++
+ddddddddddddddddddddddddddddddddddddddcdddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~c~~~dddeddddddddddadddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:104:10274:7999#0/2_CONS ali_length=63; direction=left; seq_ab_match=63; sminR=40.0; score=251.962499638; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; score_norm=3.99940475616; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; seq_b_single=45; 
+ccgaatatcttagataccccactatgcttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccctctagaggagcctgttctagatattcgg
++
+dddcdddddddddddedddddddddddccdddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddd^ddddddddddddddddddddddddcddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:14:7706:12338#0/2_CONS ali_length=62; direction=left; seq_ab_match=59; sminR=40.0; score=223.864093999; seq_a_mismatch=2; seq_b_deletion=0; seq_b_mismatch=1; seq_a_deletion=0; score_norm=3.61071119354; seq_b_insertion=0; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; seq_b_single=46; 
+ccgaagtagtagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaataattttgttatattaattacttgtgtttagggctaagcatagtggggtatctaactacttcgg
++
+dddcddcddcdbdbddddddddddddddddddcdddddccaddddd~~~~~~b~~~~~~~~~~~x~~~~wyZq~mv~}}~~~~~~~~~P~~~~~~~~~~~~~~~~~~~d^cddddddddcdddadddddddddddddddddddddddddddddd
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/input_ngsfilter_extrafile.txt	Wed Apr 12 17:38:00 2017 -0400
@@ -0,0 +1,4 @@
+wolf_diet    13a_F730603      aattaac  TTAGATACCCCACTATGC    TAGAACAGGCTCCTCTAG     F       @
+wolf_diet    15a_F730814      gaagtag  TTAGATACCCCACTATGC    TAGAACAGGCTCCTCTAG     F       @
+wolf_diet    26a_F040644      gaatatc  TTAGATACCCCACTATGC    TAGAACAGGCTCCTCTAG     F       @
+wolf_diet    29a_F260619      gcctcct  TTAGATACCCCACTATGC    TAGAACAGGCTCCTCTAG     F       @
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/output_ngsfilter.fastq	Wed Apr 12 17:38:00 2017 -0400
@@ -0,0 +1,952 @@
+@HELIUM_000100422_612GNAAXX:7:119:14871:19157#0/2_CONS_SUB_SUB_CMP sample=29a_F260619; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gcctcct; reverse_tag=gcctcct; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=47; sminR=40.0; seq_b_mismatch=13; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=1; mid_quality=69.1492537313; seq_a_deletion=0; seq_b_single=46; score=115.761290673; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=68.8701298701; sminL=40.0; seq_a_single=46; score_norm=1.86711759151; seq_b_insertion=1; 
+ttagccctaaacacaagtaattattataacaaaatcattcgccagagtactaccggcaatagctcaaaactcaaaggacttggcggtgctttataccctt
++
+cacdddddddddddddc\d~b~~~b~~~~~~b`ryK~|uxyXk`}~ccBBccBcccBcBcccBcBccccccc~~~~b|~~xdbaddaaWcccdaadddda
+@HELIUM_000100422_612GNAAXX:7:108:5640:3823#0/2_CONS_SUB_SUB_CMP sample=29a_F260619; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gcctcct; reverse_tag=gcctcct; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=60; sminR=40.0; seq_b_mismatch=2; seq_a_mismatch=0; tail_quality=66.9; seq_b_deletion=0; mid_quality=78.447761194; seq_a_deletion=0; seq_b_single=46; score=231.881364714; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=76.9545454545; sminL=40.0; seq_a_single=46; score_norm=3.74002201152; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattgttcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dddcdddddcddddddd]d~b~~~~~~~~~~~~~Z~~~~~~~~~~~~~~~~~~~~~~~~~~~}~~~~~~~~~~~~~~~~~~ddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:97:14311:19299#0/2_CONS_SUB_SUB_CMP sample=29a_F260619; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gcctcct; reverse_tag=gcctcct; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=52; sminR=40.0; seq_b_mismatch=5; seq_a_mismatch=5; tail_quality=67.0; seq_b_deletion=0; mid_quality=75.0820895522; seq_a_deletion=0; seq_b_single=46; score=167.91734192; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=66.6; avg_quality=74.0064935065; sminL=40.0; seq_a_single=46; score_norm=2.70834422451; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaagagcttaaaactcaaaggacttggcggtgctttataccctt
++
+d`cdddddcd`ddddaa\b~`~~~~~~~~b~~~~]~b~V~~~~~~~~~~~~~~~~`~~^Zs~r|~~~st~|z|v||^~~|TY``accL]`\`daZddddd
+@HELIUM_000100422_612GNAAXX:7:22:8540:14708#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=29a_F260619; experiment=wolf_diet; forward_tag=gcctcct; reverse_tag=gcctcct; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=59; sminR=40.0; seq_b_mismatch=3; seq_a_mismatch=0; tail_quality=66.9; seq_b_deletion=0; mid_quality=78.2537313433; seq_a_deletion=0; seq_b_single=46; score=223.982011431; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.1; avg_quality=76.7922077922; sminL=40.0; seq_a_single=46; score_norm=3.61261308759; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+addbddddddddddddedd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~b~~~~~~~~b~~~~ddddddddddabbb^bddd
+@HELIUM_000100422_612GNAAXX:7:57:18459:16145#0/2_CONS_SUB_SUB_CMP sample=26a_F040644; experiment=wolf_diet; seq_length=99; forward_score=72.0; forward_tag=gaatatc; reverse_tag=gaatatc; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=63; seq_ab_match=60; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=3; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.6917293233; seq_a_deletion=0; seq_b_single=45; score=227.883189945; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=66.9; avg_quality=77.1568627451; sminL=40.0; seq_a_single=45; score_norm=3.61719349119; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+dddddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~c~~~~~~~~~~~~~~b~~~~~~b~dddddcdddddddddddd
+@HELIUM_000100422_612GNAAXX:7:89:10281:5930#0/2_CONS_SUB_SUB_CMP sample=29a_F260619; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gcctcct; reverse_tag=gcctcct; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=60; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.5373134328; seq_a_deletion=0; seq_b_single=46; score=231.893859399; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=77.038961039; sminL=40.0; seq_a_single=46; score_norm=3.7402235387; seq_b_insertion=0; 
+ttagccctaaacacaaataattacacaaacaaaattgttcaccagagtactagcggcaacagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dddddddcddddddcdddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~~~bddddddceddedd\ddddd
+@HELIUM_000100422_612GNAAXX:7:29:15520:18035#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=29a_F260619; experiment=wolf_diet; forward_tag=gcctcct; reverse_tag=gcctcct; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=61; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=77.828358209; seq_a_deletion=0; seq_b_single=46; score=239.965360923; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=65.6; avg_quality=76.3311688312; sminL=40.0; seq_a_single=46; score_norm=3.87040904714; seq_b_insertion=0; 
+ttagccctaaacacaagtaattattataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+__`_Y_`_a_`cc_ccccc~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~~~~~~~ddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:6:9274:14951#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=13a_F730603; experiment=wolf_diet; forward_tag=aattaac; reverse_tag=aattaac; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=59; sminR=40.0; seq_b_mismatch=2; seq_a_mismatch=1; tail_quality=67.1; seq_b_deletion=0; mid_quality=78.2089552239; seq_a_deletion=0; seq_b_single=46; score=223.791171196; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=66.9; avg_quality=76.7532467532; sminL=40.0; seq_a_single=46; score_norm=3.60953501929; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dddcddddddddddddddd~~~~~~~~~~~~~~~~~~|z~}a|~~~~}}}}~~~~~~~~~~}~}b~b~~~~~~~~~~~~~~ddddddcdcddcd^ddddd
+@HELIUM_000100422_612GNAAXX:7:111:2893:6772#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=29a_F260619; experiment=wolf_diet; forward_tag=gcctcct; reverse_tag=gcctcct; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=61; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.7164179104; seq_a_deletion=0; seq_b_single=46; score=239.959941063; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=77.1948051948; sminL=40.0; seq_a_single=46; score_norm=3.87032163005; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddddddddedddddded_d~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~x~dddddddcdddcdcdddad
+@HELIUM_000100422_612GNAAXX:7:89:10621:20317#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=29a_F260619; experiment=wolf_diet; forward_tag=gcctcct; reverse_tag=gcctcct; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=59; sminR=40.0; seq_b_mismatch=3; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=77.5820895522; seq_a_deletion=0; seq_b_single=46; score=223.827654468; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=76.2077922078; sminL=40.0; seq_a_single=46; score_norm=3.61012345916; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dd`ddddadadddddddRc~}~~z~~~~~~~t~sw}~~g}~~~~~~~~~~~~~~~~~~~~~~~~~~~~^~b`~~~~~~~~~ddddddddbdbdd_dddad
+@HELIUM_000100422_612GNAAXX:7:50:2791:11138#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=29a_F260619; experiment=wolf_diet; forward_tag=gcctcct; reverse_tag=gcctcct; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=60; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.3805970149; seq_a_deletion=0; seq_b_single=46; score=231.976017167; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=66.9; avg_quality=76.8961038961; sminL=40.0; seq_a_single=46; score_norm=3.74154866398; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dbdbdddddddc\ddddbd~~~~~~~~~~~~~~~~~~b~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddddbddddd
+@HELIUM_000100422_612GNAAXX:7:108:17701:18887#0/2_CONS_SUB_SUB_CMP sample=15a_F730814; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gaagtag; reverse_tag=gaagtag; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=58; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=4; tail_quality=66.9; seq_b_deletion=0; mid_quality=77.6492537313; seq_a_deletion=0; seq_b_single=46; score=215.828321765; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=66.1; avg_quality=76.2012987013; sminL=40.0; seq_a_single=46; score_norm=3.48110196396; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddec`dddddddddddc^c~~~~~~~~~~~~~~xss~~~~~~~~~~~|{|z{~~{~~~b~~~~~b~~~~~~~~~~~b~~~bdddddd\ddddddcddddd
+@HELIUM_000100422_612GNAAXX:7:97:10414:9929#0/2_CONS_SUB_SUB_CMP sample=13a_F730603; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=aattaac; reverse_tag=aattaac; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=61; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.8134328358; seq_a_deletion=0; seq_b_single=46; score=239.864541102; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=77.2792207792; sminL=40.0; seq_a_single=46; score_norm=3.86878292101; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddddddddddddddedddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~~~~ddddddcddddddcddddd
+@HELIUM_000100422_612GNAAXX:7:97:9091:15775#0/2_CONS_SUB_SUB_CMP sample=13a_F730603; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=aattaac; reverse_tag=aattaac; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=59; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=3; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.276119403; seq_a_deletion=0; seq_b_single=46; score=223.861916171; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=76.8116883117; sminL=40.0; seq_a_single=46; score_norm=3.61067606728; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dcdaddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~x~~~~~~~~~|~~~~~~~b~~~~~~^~~b~~~~dddddddddddddcddddd
+@HELIUM_000100422_612GNAAXX:7:74:8683:20738#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=62; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.0977443609; seq_a_deletion=0; seq_b_single=45; score=243.961428864; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.5163398693; sminL=40.0; seq_a_single=45; score_norm=3.87240363276; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+dddddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~`~~~~~~~~~~~~~~ddeddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:24:16230:12703#0/2_CONS_SUB_SUB_CMP sample=15a_F730814; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gaagtag; reverse_tag=gaagtag; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=59; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=77.4552238806; seq_a_deletion=0; seq_b_single=46; score=223.86908915; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=66.3; avg_quality=76.0519480519; sminL=40.0; seq_a_single=46; score_norm=3.61079176049; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatcccctt
++
+bdd_ddddaddcbdcdd^b~~~~~b~~~~~~~~~~~~~~~~~~~~~~~~u~y~~~~~~a~~~~~~~~~~~~~~~~{bs~}}a`ddd`a_ddd``Ob`cdd
+@HELIUM_000100422_612GNAAXX:7:4:4214:9434#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=13a_F730603; experiment=wolf_diet; forward_tag=aattaac; reverse_tag=aattaac; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=58; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=3; tail_quality=63.3; seq_b_deletion=0; mid_quality=76.2388059701; seq_a_deletion=0; seq_b_single=46; score=215.812703412; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=65.3; avg_quality=74.6883116883; sminL=40.0; seq_a_single=46; score_norm=3.48085005502; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactacaggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dddbdddddcddddddddd~^~~~{~{~~~~~}~~{~~ym~L||~~wuy~zyxPzjyyvxku~~~~~~~~~~~~~~~~~xbacdddddaddac_^`_`dc
+@HELIUM_000100422_612GNAAXX:7:12:17693:3451#0/2_CONS_SUB_SUB_CMP sample=13a_F730603; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=aattaac; reverse_tag=aattaac; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=62; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.8507462687; seq_a_deletion=0; seq_b_single=46; score=247.862243; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=77.3116883117; sminL=40.0; seq_a_single=46; score_norm=3.9977781129; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dedcddddddddddedddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}v{}~{~}~~~~~~~~~~~~~~~~~~~~~~~~~cdddddcddddddaddddd
+@HELIUM_000100422_612GNAAXX:7:3:14624:12375#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=61; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.7669172932; seq_a_deletion=0; seq_b_single=45; score=235.922125108; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.2287581699; sminL=40.0; seq_a_single=45; score_norm=3.74479563663; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+dcdcdddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~Y`~~~~~~~~~~~~~~~~~~~~~~~dddddcdddddddceddd
+@HELIUM_000100422_612GNAAXX:7:18:5317:11571#0/2_CONS_SUB_SUB_CMP sample=13a_F730603; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=aattaac; reverse_tag=aattaac; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=61; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.7462686567; seq_a_deletion=0; seq_b_single=46; score=239.862078449; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=77.2207792208; sminL=40.0; seq_a_single=46; score_norm=3.86874320079; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddddddddddddddeddde~~~~~~~~~~~~~~~~~~~~~~~~~~~~y~~~~~~~~~~~~~~~~~{~~~~~~~~~~b~~~~dddddcdddddddaddddd
+@HELIUM_000100422_612GNAAXX:7:109:17335:11429#0/2_CONS_SUB_SUB_CMP sample=26a_F040644; experiment=wolf_diet; seq_length=99; forward_score=72.0; forward_tag=gaatatc; reverse_tag=gaatatc; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=63; seq_ab_match=56; sminR=40.0; seq_b_mismatch=6; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=73.1278195489; seq_a_deletion=0; seq_b_single=45; score=195.716358124; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=66.9; avg_quality=72.3202614379; sminL=40.0; seq_a_single=45; score_norm=3.10660885911; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+dddcdaddddddddcdbd~b~~~~~~~~~|~``}~\`~|[~ccccccccccccccccc~z~~s~x~~~~~}~~}}W~~}x~ddddc]``]\Rd`ddb`^
+@HELIUM_000100422_612GNAAXX:7:7:10646:8487#0/2_CONS_SUB_SUB_CMP sample=13a_F730603; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=aattaac; reverse_tag=aattaac; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=60; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=77.671641791; seq_a_deletion=0; seq_b_single=46; score=231.85443709; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=76.2857142857; sminL=40.0; seq_a_single=46; score_norm=3.739587695; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dccdddddddddddddddec~~~~~~~~~~~~~~~~~~~~~~~~~~~{vztippoph~~~~~~~b~~~~~~~~~~~~~~~~ddddddddddddddddddc
+@HELIUM_000100422_612GNAAXX:7:19:4865:20715#0/2_CONS_SUB_SUB_CMP sample=13a_F730603; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=aattaac; reverse_tag=aattaac; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=60; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.5074626866; seq_a_deletion=0; seq_b_single=46; score=231.923942025; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=77.012987013; sminL=40.0; seq_a_single=46; score_norm=3.74070874234; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddcbddddddddddddddb~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~~~~ybddddddddddcddadddcd
+@HELIUM_000100422_612GNAAXX:7:13:6954:13039#0/2_CONS_SUB_SUB_CMP sample=26a_F040644; experiment=wolf_diet; seq_length=99; forward_score=72.0; forward_tag=gaatatc; reverse_tag=gaatatc; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=63; seq_ab_match=62; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.0; seq_a_deletion=0; seq_b_single=45; score=243.872474161; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.431372549; sminL=40.0; seq_a_single=45; score_norm=3.87099165336; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagaggactactagcaatagcttaaaactcaaaggacttggcggtgctttatatccct
++
+dddcdddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~r~~~~~~~~~~~~~~~~~~~~~~~b~~~~~dddddddddddddcdddd
+@HELIUM_000100422_612GNAAXX:7:120:14963:1929#0/2_CONS_SUB_SUB_CMP sample=15a_F730814; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gaagtag; reverse_tag=gaagtag; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=59; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.1492537313; seq_a_deletion=0; seq_b_single=46; score=223.810433242; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=76.7012987013; sminL=40.0; seq_a_single=46; score_norm=3.60984569745; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dddadddddddedddddbd~b~~}~~~~~~~~~~~~~~~~u~~|~~}~~}~~~}z`}}~~~}~~~~~~~~~~~~~~_~~~~dddddddddddddcddddd
+@HELIUM_000100422_612GNAAXX:7:115:3921:10649#0/2_CONS_SUB_SUB_CMP sample=26a_F040644; experiment=wolf_diet; seq_length=99; forward_score=72.0; forward_tag=gaatatc; reverse_tag=gaatatc; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=63; seq_ab_match=61; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.5864661654; seq_a_deletion=0; seq_b_single=45; score=235.871015095; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.0718954248; sminL=40.0; seq_a_single=45; score_norm=3.74398436659; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+ddedddddddddcddddd~~~~~~~~~~~~~b~~~~~~~~~~~~~~~~~}~}~n{~i~~~~~~~~~~~~~~~~~~~~~~b~dddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:109:12848:8882#0/2_CONS_SUB_SUB_CMP sample=15a_F730814; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gaagtag; reverse_tag=gaagtag; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=60; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.3805970149; seq_a_deletion=0; seq_b_single=46; score=231.869965661; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=76.9025974026; sminL=40.0; seq_a_single=46; score_norm=3.73983815582; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddeedddddddddddcd`d~~~~~~~~~~~~~~~~~~~~~~~~~~~~~{~~x~b~~~}~~~~~~~~~~~~~~~~~~~~~~bdcdddddddddddTddddd
+@HELIUM_000100422_612GNAAXX:7:84:11257:18886#0/2_CONS_SUB_SUB_CMP sample=26a_F040644; experiment=wolf_diet; seq_length=99; forward_score=72.0; forward_tag=gaatatc; reverse_tag=gaatatc; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=63; seq_ab_match=55; sminR=40.0; seq_b_mismatch=8; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=77.1804511278; seq_a_deletion=0; seq_b_single=45; score=187.890540948; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=75.8496732026; sminL=40.0; seq_a_single=45; score_norm=2.98238953885; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+dddcdddddddddddddd~b~a~~b~~~~b~~~~~~{b~|a~~`\}s~y~~~~~~t~~~~~~~~~~~~~~~~~~~~x~~t~dddddddddddddddddc
+@HELIUM_000100422_612GNAAXX:7:72:13060:5051#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=29a_F260619; experiment=wolf_diet; forward_tag=gcctcct; reverse_tag=gcctcct; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=61; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.671641791; seq_a_deletion=0; seq_b_single=46; score=239.985823237; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=66.8; avg_quality=77.1428571429; sminL=40.0; seq_a_single=46; score_norm=3.87073908447; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddddddddddddddddd_b~~~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddddeddddd
+@HELIUM_000100422_612GNAAXX:7:35:3798:1896#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=15a_F730814; experiment=wolf_diet; forward_tag=gaagtag; reverse_tag=gaagtag; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=61; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=1; tail_quality=66.9; seq_b_deletion=0; mid_quality=78.4701492537; seq_a_deletion=0; seq_b_single=46; score=239.863223783; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=76.974025974; sminL=40.0; seq_a_single=46; score_norm=3.86876167392; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dddddddcddbddddddad~b~~}~~~~~~~~~~~~~~~~~n~~~~~|~}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddcddaddaddd^dddbc
+@HELIUM_000100422_612GNAAXX:7:117:12470:18434#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=59; sminR=40.0; seq_b_mismatch=4; seq_a_mismatch=0; tail_quality=66.9; seq_b_deletion=0; mid_quality=78.045112782; seq_a_deletion=0; seq_b_single=45; score=219.83660627; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=66.9; avg_quality=76.5882352941; sminL=40.0; seq_a_single=45; score_norm=3.4894699408; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+dddddddddcddddddcd~~~~~~~~~~~~~~~~~~~~~~~~~~~~O~~~~~~~~~{~~{~~Wx~~~~~~~~~~~b~~~b}ddabdddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:11:8428:13716#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=15a_F730814; experiment=wolf_diet; forward_tag=gaagtag; reverse_tag=gaagtag; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=61; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.7985074627; seq_a_deletion=0; seq_b_single=46; score=239.97387484; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=77.2662337662; sminL=40.0; seq_a_single=46; score_norm=3.87054636839; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dddddddddddddddddad~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:78:18994:16521#0/2_CONS_SUB_SUB_CMP sample=15a_F730814; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gaagtag; reverse_tag=gaagtag; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=61; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.6940298507; seq_a_deletion=0; seq_b_single=46; score=239.927346216; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=66.8; avg_quality=77.1623376623; sminL=40.0; seq_a_single=46; score_norm=3.86979590672; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+cddddddcdddddddddad~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~bddaddeeaddded`ddddb
+@HELIUM_000100422_612GNAAXX:7:16:5047:7843#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=63; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.3007518797; seq_a_deletion=0; seq_b_single=45; score=251.979285107; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.6928104575; sminL=40.0; seq_a_single=45; score_norm=3.99967119217; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+dedddbdddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddddddcdcddddddeec
+@HELIUM_000100422_612GNAAXX:7:118:13803:15594#0/2_CONS_SUB_SUB_CMP sample=26a_F040644; experiment=wolf_diet; seq_length=99; forward_score=72.0; forward_tag=gaatatc; reverse_tag=gaatatc; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=63; seq_ab_match=60; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.5112781955; seq_a_deletion=0; seq_b_single=45; score=227.87720055; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.0065359477; sminL=40.0; seq_a_single=45; score_norm=3.61709842144; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+edd^ddddbdddddeddd~~~~~~~~~~~~~~~~~~a~~~~~~~~~~~{~y~~~~~~~~~~v~~~~~~~~~~b~~b~~~~~dddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:53:14379:5922#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=29a_F260619; experiment=wolf_diet; forward_tag=gcctcct; reverse_tag=gcctcct; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=62; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.0; seq_a_deletion=0; seq_b_single=46; score=247.982071703; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=66.9; avg_quality=77.4350649351; sminL=40.0; seq_a_single=46; score_norm=3.99971083392; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddddddddddddddddd`d~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddddeddddd
+@HELIUM_000100422_612GNAAXX:7:52:10700:16508#0/2_CONS_SUB_SUB_CMP sample=15a_F730814; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gaagtag; reverse_tag=gaagtag; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=61; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=1; tail_quality=64.5; seq_b_deletion=0; mid_quality=77.8805970149; seq_a_deletion=0; seq_b_single=46; score=239.790995416; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=76.3051948052; sminL=40.0; seq_a_single=46; score_norm=3.86759670025; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+c^ccccccccccacccccc~~~~~~~~~~~~~~{{~~v~~~~~~~~~~~~~~~~}}}~~~~~{~~~~|v|||~}~~~u~~bddddcdbdddbddIddddd
+@HELIUM_000100422_612GNAAXX:7:69:7696:12881#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=63; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.3082706767; seq_a_deletion=0; seq_b_single=45; score=251.983052061; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.6993464052; sminL=40.0; seq_a_single=45; score_norm=3.99973098509; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+eddddddcdddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddddddddddddddcddd
+@HELIUM_000100422_612GNAAXX:7:44:12484:5320#0/2_CONS_SUB_SUB_CMP sample=13a_F730603; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=aattaac; reverse_tag=aattaac; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=60; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=2; tail_quality=67.1; seq_b_deletion=0; mid_quality=78.5149253731; seq_a_deletion=0; seq_b_single=46; score=231.837799589; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=66.7; avg_quality=77.0064935065; sminL=40.0; seq_a_single=46; score_norm=3.73931934821; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+deddddddddddddddddc~~~~~~~~~~~~~~~~~~~}}}z~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~~~adcddddadddddddddddd
+@HELIUM_000100422_612GNAAXX:7:21:4713:10229#0/2_CONS_SUB_SUB_CMP sample=13a_F730603; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=aattaac; reverse_tag=aattaac; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=61; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.7313432836; seq_a_deletion=0; seq_b_single=46; score=239.864510201; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=77.2077922078; sminL=40.0; seq_a_single=46; score_norm=3.86878242259; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dcdbddddddddcdddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~|~~~~~~~~~~~~~~~~~~~b~~~~~~~~~~~~~~ddddddddddddd`ddddb
+@HELIUM_000100422_612GNAAXX:7:38:6201:12003#0/2_CONS_SUB_SUB_CMP sample=26a_F040644; experiment=wolf_diet; seq_length=99; forward_score=72.0; forward_tag=gaatatc; reverse_tag=gaatatc; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=63; seq_ab_match=59; sminR=40.0; seq_b_mismatch=4; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=67.7443609023; seq_a_deletion=0; seq_b_single=45; score=219.686655506; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=63.2; avg_quality=67.3986928105; sminL=40.0; seq_a_single=45; score_norm=3.48708976993; seq_b_insertion=0; 
+ttagccctaaacatagataattttacaacaaaataattcgccagaggactactagcaatagcttaaaactcaaagaactgggcggtgctttatatcccg
++
+dbddcddcddd[dddddc~~~~b~~~~~~~t~}{axzyz{||zzwzr~y}}}}}z~x~cccccccccccccccccBcccBcDDDDDDDDDDDDDDDDaH
+@HELIUM_000100422_612GNAAXX:7:33:16506:1490#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=13a_F730603; experiment=wolf_diet; forward_tag=aattaac; reverse_tag=aattaac; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=62; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.2; seq_b_deletion=0; mid_quality=79.0373134328; seq_a_deletion=0; seq_b_single=46; score=247.963002972; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.1; avg_quality=77.4935064935; sminL=40.0; seq_a_single=46; score_norm=3.99940327375; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddddddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddddeddddd
+@HELIUM_000100422_612GNAAXX:7:32:4360:3451#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=13a_F730603; experiment=wolf_diet; forward_tag=aattaac; reverse_tag=aattaac; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=61; seq_ab_match=61; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.7703703704; seq_a_deletion=0; seq_b_single=47; score=243.999335649; seq_a_insertion=0; mode=alignment; seq_length_ori=155; head_quality=67.0; avg_quality=77.2516129032; sminL=40.0; seq_a_single=47; score_norm=3.999989109; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dddddddddddddddddde~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddeddddddddddeedddd
+@HELIUM_000100422_612GNAAXX:7:115:17402:4174#0/2_CONS_SUB_SUB_CMP sample=29a_F260619; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gcctcct; reverse_tag=gcctcct; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=59; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=3; tail_quality=67.1; seq_b_deletion=0; mid_quality=77.9402985075; seq_a_deletion=0; seq_b_single=46; score=223.877240886; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=76.525974026; sminL=40.0; seq_a_single=46; score_norm=3.6109232401; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactacctgcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+edddddccddddedcdd]d~~~~~~~~~~~~~~~~~~~~~~~~~~~~~s~|y~vS~~~~~~{~~~~~~~~~~~~~~b~~~bdddddddddddddcddddd
+@HELIUM_000100422_612GNAAXX:7:45:6831:6228#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=13a_F730603; experiment=wolf_diet; forward_tag=aattaac; reverse_tag=aattaac; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=62; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.0298507463; seq_a_deletion=0; seq_b_single=46; score=247.974637619; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=77.4675324675; sminL=40.0; seq_a_single=46; score_norm=3.99959092934; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dddcddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddddeddddd
+@HELIUM_000100422_612GNAAXX:7:117:4291:18111#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=62; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.0827067669; seq_a_deletion=0; seq_b_single=45; score=243.911625561; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.5032679739; sminL=40.0; seq_a_single=45; score_norm=3.87161310415; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+ddddddddaddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~~~~~dddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:71:14800:3222#0/2_CONS_SUB_SUB_CMP sample=29a_F260619; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gcctcct; reverse_tag=gcctcct; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=60; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.5597014925; seq_a_deletion=0; seq_b_single=46; score=231.89389474; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=77.0584415584; sminL=40.0; seq_a_single=46; score_norm=3.74022410871; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dddddddeeddddddddcd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}~~~\~~~~~~~~~~~~~~~~~b~~~~ddddddccdddddcdddde
+@HELIUM_000100422_612GNAAXX:7:11:8547:18238#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=63; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.2932330827; seq_a_deletion=0; seq_b_single=45; score=251.984413754; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.6862745098; sminL=40.0; seq_a_single=45; score_norm=3.99975259927; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+dbdcdddddddddcdddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:117:2416:10342#0/2_CONS_SUB_SUB_CMP sample=26a_F040644; experiment=wolf_diet; seq_length=99; forward_score=72.0; forward_tag=gaatatc; reverse_tag=gaatatc; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=63; seq_ab_match=61; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.2781954887; seq_a_deletion=0; seq_b_single=45; score=235.921215944; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=76.8039215686; sminL=40.0; seq_a_single=45; score_norm=3.74478120546; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+d^dUYZ[Yddddcdcddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}~~~~~b|~~b~dddddbddddbddddddd
+@HELIUM_000100422_612GNAAXX:7:78:7151:19928#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=56; sminR=40.0; seq_b_mismatch=7; seq_a_mismatch=0; tail_quality=47.6; seq_b_deletion=0; mid_quality=58.2105263158; seq_a_deletion=0; seq_b_single=45; score=195.576462373; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=52.9; avg_quality=57.1699346405; sminL=40.0; seq_a_single=45; score_norm=3.10438829164; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacgagaatgttcgccagtgtacttctagcaacaggctgaaactcaaaggacttggcggtggtttacatccct
++
+WSR]YbbbDDDDDDDDDDcccccccccccBBcccccccccccccBcccccBccccccccccBccccccccccBccccc~`~WNS]Y_KTUVZ[O_SHW]
+@HELIUM_000100422_612GNAAXX:7:71:18821:20471#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=13a_F730603; experiment=wolf_diet; forward_tag=aattaac; reverse_tag=aattaac; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=53; sminR=40.0; seq_b_mismatch=2; seq_a_mismatch=7; tail_quality=66.9; seq_b_deletion=0; mid_quality=75.9029850746; seq_a_deletion=0; seq_b_single=46; score=175.889514148; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=74.7402597403; sminL=40.0; seq_a_single=46; score_norm=2.83692764755; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dd\ddddddddd^ddd`dd~~~~Xx~~~~~{|q}}x}^Y`J`~Xv{wt~~~~~~~~~~~~~~~~~~~~~~~~~b~~~~~sbddddddddddddd^bdccd
+@HELIUM_000100422_612GNAAXX:7:58:15837:8531#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=63; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.2857142857; seq_a_deletion=0; seq_b_single=45; score=251.96128051; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.6797385621; sminL=40.0; seq_a_single=45; score_norm=3.99938540492; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+dddbdddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddddddddddddcddddd
+@HELIUM_000100422_612GNAAXX:7:38:10813:16867#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=63; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.2406015038; seq_a_deletion=0; seq_b_single=45; score=251.97777927; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.6405228758; sminL=40.0; seq_a_single=45; score_norm=3.99964729; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgtttgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+ddddddddeddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dbcdddddadadcddddd
+@HELIUM_000100422_612GNAAXX:7:68:19115:18847#0/2_CONS_SUB_SUB_CMP sample=29a_F260619; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gcctcct; reverse_tag=gcctcct; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=54; sminR=40.0; seq_b_mismatch=2; seq_a_mismatch=6; tail_quality=66.6; seq_b_deletion=0; mid_quality=76.0074626866; seq_a_deletion=0; seq_b_single=46; score=183.856571062; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=66.7; avg_quality=74.7922077922; sminL=40.0; seq_a_single=46; score_norm=2.96542856552; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddecdd_ddcdd_dd^ddd~`~~~~~b~~~~~~~~~~~}~~{b~~~~~~~{~~_~~~s~~s~~~~x~~\\~~~~~~b~~{bd`dcc`P^bb^dbaaaddb
+@HELIUM_000100422_612GNAAXX:7:14:3978:11028#0/2_CONS_SUB_SUB_CMP sample=15a_F730814; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gaagtag; reverse_tag=gaagtag; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=60; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=77.9029850746; seq_a_deletion=0; seq_b_single=46; score=231.869517243; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=66.8; avg_quality=76.474025974; sminL=40.0; seq_a_single=46; score_norm=3.73983092328; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactacctgcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddeadbdcddddeddd`ad~~~~~~~~~~~~~~~~~~~~~~~~~~~~~w|{u~|J~y~~~v~~~~~~~~~~~~~~~~~~~_dddddddddddbbZ`bcdd
+@HELIUM_000100422_612GNAAXX:7:34:18733:3827#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=62; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.1052631579; seq_a_deletion=0; seq_b_single=45; score=243.983236898; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.522875817; sminL=40.0; seq_a_single=45; score_norm=3.87274979204; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+dddddddddddddddddd~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:65:6787:8456#0/2_CONS_SUB_SUB_CMP sample=15a_F730814; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gaagtag; reverse_tag=gaagtag; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=60; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.5895522388; seq_a_deletion=0; seq_b_single=46; score=231.869006954; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=66.8; avg_quality=77.0714285714; sminL=40.0; seq_a_single=46; score_norm=3.7398226928; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dddddddcddddddedd_d~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~~~bddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:111:7441:14688#0/2_CONS_SUB_SUB_CMP sample=26a_F040644; experiment=wolf_diet; seq_length=99; forward_score=72.0; forward_tag=gaatatc; reverse_tag=gaatatc; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=63; seq_ab_match=62; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.015037594; seq_a_deletion=0; seq_b_single=45; score=243.832560428; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.4444444444; sminL=40.0; seq_a_single=45; score_norm=3.87035810203; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+dddadddddddddedddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}~~~~~~~~~~~~~~~~~~u~~~~~b~~~~~dddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:86:10092:15563#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=29a_F260619; experiment=wolf_diet; forward_tag=gcctcct; reverse_tag=gcctcct; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=59; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=2; tail_quality=66.8; seq_b_deletion=0; mid_quality=78.1940298507; seq_a_deletion=0; seq_b_single=46; score=223.927744132; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=66.6; avg_quality=76.7012987013; sminL=40.0; seq_a_single=46; score_norm=3.61173780858; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddbdddddccdddddaddd~b~~~~~~~~~~~~~_~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|bddddddddddcddcddd`^
+@HELIUM_000100422_612GNAAXX:7:16:4418:5128#0/2_CONS_SUB_SUB_CMP sample=13a_F730603; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=aattaac; reverse_tag=aattaac; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=59; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=3; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.3656716418; seq_a_deletion=0; seq_b_single=46; score=223.862543287; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=76.8896103896; sminL=40.0; seq_a_single=46; score_norm=3.61068618206; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dddeddddddddddddddb~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~{~~~~~~~~~~~~~~~b~~b~~~bdddeddbdddddddddddd
+@HELIUM_000100422_612GNAAXX:7:13:5742:9859#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=4; sample=29a_F260619; experiment=wolf_diet; forward_tag=gcctcct; reverse_tag=gcctcct; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=58; seq_ab_match=55; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=3; tail_quality=93.0; seq_b_deletion=50; mid_quality=91.4210526316; seq_a_deletion=50; seq_b_single=0; score=207.846895043; seq_a_insertion=0; mode=alignment; seq_length_ori=58; head_quality=89.4; avg_quality=91.3448275862; sminL=40.0; seq_a_single=0; score_norm=3.58356715591; seq_b_insertion=0; 
+tttt
++
+~~~~
+@HELIUM_000100422_612GNAAXX:7:85:18986:17662#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=15a_F730814; experiment=wolf_diet; forward_tag=gaagtag; reverse_tag=gaagtag; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=60; sminR=40.0; seq_b_mismatch=2; seq_a_mismatch=0; tail_quality=67.1; seq_b_deletion=0; mid_quality=78.447761194; seq_a_deletion=0; seq_b_single=46; score=231.874929984; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=66.9; avg_quality=76.961038961; sminL=40.0; seq_a_single=46; score_norm=3.73991822554; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddddddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}~~s~~~~~b~~~~~~b~~~~~~~ddcddddddcddddddddd
+@HELIUM_000100422_612GNAAXX:7:16:16357:19948#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=57; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=5; tail_quality=66.7; seq_b_deletion=0; mid_quality=75.6541353383; seq_a_deletion=0; seq_b_single=45; score=203.860719115; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=62.0; avg_quality=74.1764705882; sminL=40.0; seq_a_single=45; score_norm=3.23588443039; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcacaggacttggcggtgctttacatccct
++
+dd_dbddbdaddbddddd~`~~b~~~~~~b~~{~~~}x}}~}`twyhw~~~~}w|~|~~~~~X~~~|~~~~~Y~~~~~~~~XVRSQ[Qadd``^P^adY
+@HELIUM_000100422_612GNAAXX:7:107:3570:18147#0/2_CONS_SUB_SUB_CMP sample=29a_F260619; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gcctcct; reverse_tag=gcctcct; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=60; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.0820895522; seq_a_deletion=0; seq_b_single=46; score=231.924768153; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=65.9; avg_quality=76.5714285714; sminL=40.0; seq_a_single=46; score_norm=3.74072206698; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcataaaactcaaaggacttggcggtgctttataccctt
++
+dddadddddcddddd\d\d~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}~~~~~~~~a~s~`ddcd_ddcddddd]ddc_b
+@HELIUM_000100422_612GNAAXX:7:82:8836:11354#0/2_CONS_SUB_SUB_CMP sample=13a_F730603; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=aattaac; reverse_tag=aattaac; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=60; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.2835820896; seq_a_deletion=0; seq_b_single=46; score=231.781218203; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=76.8181818182; sminL=40.0; seq_a_single=46; score_norm=3.73840674522; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddedddddddddddddddd~~~~~~{~~~~~~~~~~~~~~~~~~~~~~w{{k~~|~~~~~~~~~~~~~~~~~~~~~b~~~bddddddacdddddcdddda
+@HELIUM_000100422_612GNAAXX:7:41:2354:1449#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=55; sminR=40.0; seq_b_mismatch=3; seq_a_mismatch=5; tail_quality=66.4; seq_b_deletion=0; mid_quality=75.5789473684; seq_a_deletion=0; seq_b_single=45; score=187.777927438; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=66.6; avg_quality=74.3921568627; sminL=40.0; seq_a_single=45; score_norm=2.98060202283; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+daaddddddcddbcdddd~b}bb~b~~~b~q~~}~}~x~x~t~s~|k|~w~~z~~{|{~ccBc~~}~~~~~~a~~a~}p~~baceddbbedddda_aa_
+@HELIUM_000100422_612GNAAXX:7:114:4511:17596#0/2_CONS_SUB_SUB_CMP sample=29a_F260619; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gcctcct; reverse_tag=gcctcct; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=57; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=4; tail_quality=67.0; seq_b_deletion=0; mid_quality=75.3208955224; seq_a_deletion=0; seq_b_single=46; score=207.883730153; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.2; avg_quality=74.2532467532; sminL=40.0; seq_a_single=46; score_norm=3.35296338956; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtgctaccggcaatagcttaaaactcaaaggacttggcggtgctttatacgctt
++
+ddddddddddddddd^d^d~~~~~~~~~~~~~~~X~~~~~~~~~~~~~W}~~~~~a~sa~~~~~~~~~~~~~~~~~b~~~~ddddddQPPPPPQPKKPPP
+@HELIUM_000100422_612GNAAXX:7:94:12367:17729#0/2_CONS_SUB_SUB_CMP sample=15a_F730814; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gaagtag; reverse_tag=gaagtag; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=59; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=3; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.0; seq_a_deletion=0; seq_b_single=46; score=223.888596169; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=76.5714285714; sminL=40.0; seq_a_single=46; score_norm=3.61110638983; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddd`ddddddddddeddad~~~~~~~~~~~~~~~~~~~~~~~b~~~~~~~~r|~t||x~~~~~~~~~~~~~~~~~}b~~~bcddddd`dbdadccddecc
+@HELIUM_000100422_612GNAAXX:7:30:5374:18213#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=63; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.3233082707; seq_a_deletion=0; seq_b_single=45; score=251.958026467; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.7124183007; sminL=40.0; seq_a_single=45; score_norm=3.99933375344; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+dddddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:49:11740:5547#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=62; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=0; tail_quality=66.6; seq_b_deletion=0; mid_quality=79.1127819549; seq_a_deletion=0; seq_b_single=45; score=243.959827817; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=66.6; avg_quality=77.477124183; sminL=40.0; seq_a_single=45; score_norm=3.87237821931; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+eddddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~cddddddddcdddddddd
+@HELIUM_000100422_612GNAAXX:7:29:3531:8314#0/2_CONS_SUB_SUB_CMP sample=26a_F040644; experiment=wolf_diet; seq_length=99; forward_score=72.0; forward_tag=gaatatc; reverse_tag=gaatatc; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=63; seq_ab_match=61; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.8571428571; seq_a_deletion=0; seq_b_single=45; score=235.837856208; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.3071895425; sminL=40.0; seq_a_single=45; score_norm=3.74345803504; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+ddddddddddddddecdd~~~~~~~~~~~~~~~~~~~~~}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~~~a~dcddddddddddcddddd
+@HELIUM_000100422_612GNAAXX:7:114:10615:11217#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=29a_F260619; experiment=wolf_diet; forward_tag=gcctcct; reverse_tag=gcctcct; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=60; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=1; tail_quality=66.9; seq_b_deletion=0; mid_quality=73.7985074627; seq_a_deletion=0; seq_b_single=46; score=231.702876359; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=66.7; avg_quality=72.8896103896; sminL=40.0; seq_a_single=46; score_norm=3.73714316708; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dddddaaa``a_adddd^d~b~~z~~~~~~~~~~~~~cBcccccccccccccc~y~~s~~~~~~~|~~~~~|~~~~sz~~~adddddd[dad`VRW]VZd
+@HELIUM_000100422_612GNAAXX:7:108:2729:8600#0/2_CONS_SUB_SUB_CMP sample=15a_F730814; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gaagtag; reverse_tag=gaagtag; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=59; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.2462686567; seq_a_deletion=0; seq_b_single=46; score=223.856778095; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=76.7857142857; sminL=40.0; seq_a_single=46; score_norm=3.61059319508; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddddddddddddedcdcad~~~~~~~~~~~~~~~a~~~~~~~~~~~~~~~~~~~~~~~`~~~~~~~~~~~}~~~~~b~~~~dddddddcddddWdddddd
+@HELIUM_000100422_612GNAAXX:7:103:8847:6326#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=63; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.3082706767; seq_a_deletion=0; seq_b_single=45; score=251.968264217; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.6993464052; sminL=40.0; seq_a_single=45; score_norm=3.99949625741; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+dddddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddddcdddd
+@HELIUM_000100422_612GNAAXX:7:70:11798:2668#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=15a_F730814; experiment=wolf_diet; forward_tag=gaagtag; reverse_tag=gaagtag; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=61; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.8059701493; seq_a_deletion=0; seq_b_single=46; score=239.988667111; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=77.2727272727; sminL=40.0; seq_a_single=46; score_norm=3.8707849534; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccttt
++
+ddddddddddddddddddd~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dcdddddcddddddddbdd
+@HELIUM_000100422_612GNAAXX:7:4:18261:9148#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=61; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.8796992481; seq_a_deletion=0; seq_b_single=45; score=235.937993338; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.1; avg_quality=77.3333333333; sminL=40.0; seq_a_single=45; score_norm=3.7450475133; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+eddddddddddddddddd~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~`~~~~~~~~~~~~~~~~~~~~~~~dddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:29:18416:16620#0/2_CONS_SUB_SUB_CMP sample=29a_F260619; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gcctcct; reverse_tag=gcctcct; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=60; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=77.4179104478; seq_a_deletion=0; seq_b_single=46; score=231.873033258; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=76.0649350649; sminL=40.0; seq_a_single=46; score_norm=3.7398876332; seq_b_insertion=0; 
+ttagccctaaacacaagtaattattataacaaaattattcgccagagttctaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctg
++
+dad\bbbbddcdbdcdd`d~~~~~~~~~~~~~~~~~~~~~~~~~~~~zF||u~s~`~~~~~~~~~~~~~~~~~~~~~~~~~ddddddb^bbb`[Hb`dd\
+@HELIUM_000100422_612GNAAXX:7:32:18262:6966#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=13a_F730603; experiment=wolf_diet; forward_tag=aattaac; reverse_tag=aattaac; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=61; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=0; tail_quality=66.4; seq_b_deletion=0; mid_quality=78.7537313433; seq_a_deletion=0; seq_b_single=46; score=239.975704028; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.1; avg_quality=77.1948051948; sminL=40.0; seq_a_single=46; score_norm=3.87057587142; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dddddddcddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~`~~~~~~~~~~~~ddddddddddbdddddddd
+@HELIUM_000100422_612GNAAXX:7:110:17877:11976#0/2_CONS_SUB_SUB_CMP sample=29a_F260619; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gcctcct; reverse_tag=gcctcct; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=59; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=77.8805970149; seq_a_deletion=0; seq_b_single=46; score=223.833250149; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=76.4675324675; sminL=40.0; seq_a_single=46; score_norm=3.61021371209; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dddcddddddddddd^d\b~`~~~~~~~~~~~~~~~~~~~~x~~~~~~~~~~w{xqv~~~~~~~~~~~~~~~~~~~b~~~bdddddddddddddadddd_
+@HELIUM_000100422_612GNAAXX:7:97:9416:9155#0/2_CONS_SUB_SUB_CMP sample=13a_F730603; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=aattaac; reverse_tag=aattaac; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=60; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.5895522388; seq_a_deletion=0; seq_b_single=46; score=231.872797448; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=77.0844155844; sminL=40.0; seq_a_single=46; score_norm=3.7398838298; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dddedddddddddddddde~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~{~~~~~~b~~~~~~~~~~~~~~~bddaddddddddddeddddd
+@HELIUM_000100422_612GNAAXX:7:72:8905:10715#0/2_CONS_SUB_SUB_CMP sample=26a_F040644; experiment=wolf_diet; seq_length=99; forward_score=72.0; forward_tag=gaatatc; reverse_tag=gaatatc; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=63; seq_ab_match=63; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.2932330827; seq_a_deletion=0; seq_b_single=45; score=251.929473647; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.6862745098; sminL=40.0; seq_a_single=45; score_norm=3.99888053408; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+dddcdddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddddddddddddddcddd
+@HELIUM_000100422_612GNAAXX:7:48:5296:16375#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=63; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.1278195489; seq_a_deletion=0; seq_b_single=45; score=251.994265764; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.5424836601; sminL=40.0; seq_a_single=45; score_norm=3.99990898038; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+cddbdddddaddddbddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddd`dbdaadddd
+@HELIUM_000100422_612GNAAXX:7:53:6550:1163#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=61; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.8872180451; seq_a_deletion=0; seq_b_single=45; score=235.996766828; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.3333333333; sminL=40.0; seq_a_single=45; score_norm=3.74598042584; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgtttgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+ddaddddddddddddddd~b~~~~~~~~~~~~~~~~~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:120:1900:13295#0/2_CONS_SUB_SUB_CMP sample=15a_F730814; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gaagtag; reverse_tag=gaagtag; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=60; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=1; tail_quality=67.1; seq_b_deletion=0; mid_quality=77.5149253731; seq_a_deletion=1; seq_b_single=46; score=219.874676069; seq_a_insertion=1; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=76.1558441558; sminL=40.0; seq_a_single=46; score_norm=3.54636574304; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactacgcgcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddcdddddcdddcddddcd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ppthFfpo~~~~~~~~~~~~~~~~~~~b~~~~ddddddcdddddcdddddd
+@HELIUM_000100422_612GNAAXX:7:96:19317:7551#0/2_CONS_SUB_SUB_CMP sample=15a_F730814; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gaagtag; reverse_tag=gaagtag; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=58; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=3; tail_quality=66.9; seq_b_deletion=0; mid_quality=76.3955223881; seq_a_deletion=0; seq_b_single=46; score=215.85731879; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=65.9; avg_quality=75.0974025974; sminL=40.0; seq_a_single=46; score_norm=3.48156965791; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddbb`dddcdddddddd_d~~~~~~~~~~~~~~~Z~~~~~~~~zzt{qx~~yhpppns_|~~~za~~~~|~~~~~~a|~q~cccccccccccbcXcbccc
+@HELIUM_000100422_612GNAAXX:7:93:18556:10479#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=29a_F260619; experiment=wolf_diet; forward_tag=gcctcct; reverse_tag=gcctcct; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=59; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.3731343284; seq_a_deletion=0; seq_b_single=46; score=223.913795643; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=66.9; avg_quality=76.8896103896; sminL=40.0; seq_a_single=46; score_norm=3.61151283295; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddddddddddddddddddd~b~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~~~~~~~dddddddddddddbddddd
+@HELIUM_000100422_612GNAAXX:7:44:19605:15509#0/2_CONS_SUB_SUB_CMP sample=29a_F260619; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gcctcct; reverse_tag=gcctcct; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=59; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=3; tail_quality=67.0; seq_b_deletion=0; mid_quality=77.7313432836; seq_a_deletion=0; seq_b_single=46; score=223.916231984; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=76.3376623377; sminL=40.0; seq_a_single=46; score_norm=3.61155212878; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dadcddddddddddd_d_a~~~~~~~~~~~~~~y}z~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~_~~~p~~`k~`~~r~ddcddcadcdcddcddddd
+@HELIUM_000100422_612GNAAXX:7:40:3610:8896#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=15a_F730814; experiment=wolf_diet; forward_tag=gaagtag; reverse_tag=gaagtag; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=61; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.828358209; seq_a_deletion=0; seq_b_single=46; score=239.967241748; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=77.2922077922; sminL=40.0; seq_a_single=46; score_norm=3.87043938304; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddddddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~~~~~~~~~dddddddddddddeddddd
+@HELIUM_000100422_612GNAAXX:7:41:19763:3556#0/2_CONS_SUB_SUB_CMP sample=15a_F730814; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gaagtag; reverse_tag=gaagtag; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=62; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=65.7; seq_b_deletion=0; mid_quality=78.5671641791; seq_a_deletion=0; seq_b_single=46; score=247.825851895; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=76.9805194805; sminL=40.0; seq_a_single=46; score_norm=3.99719115959; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dddcddddddddddddcad~~~~~~~~~~~~~~~~~~~~~~~~~~~~{m{zj~~~~~~~~v~~~~~~~~~~~~~~~~~~~{dddddddddddddcddddd
+@HELIUM_000100422_612GNAAXX:7:111:7660:7465#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=58; sminR=40.0; seq_b_mismatch=3; seq_a_mismatch=2; tail_quality=66.1; seq_b_deletion=0; mid_quality=76.8646616541; seq_a_deletion=0; seq_b_single=45; score=211.768626837; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=66.5; avg_quality=75.4836601307; sminL=40.0; seq_a_single=45; score_norm=3.36140677518; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+ddcdddddd`ddddddcd~~~~~~~~_~~~~~~~~~~~~~Ky~~~~~~c~Y}~~s~~`~x~}~}~{~Z|h~~~~~~~~~~~dYYdddaddaaddad^dd
+@HELIUM_000100422_612GNAAXX:7:76:10822:18722#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=58; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=5; tail_quality=66.8; seq_b_deletion=0; mid_quality=77.3834586466; seq_a_deletion=0; seq_b_single=45; score=211.83390837; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=66.5; avg_quality=75.9803921569; sminL=40.0; seq_a_single=45; score_norm=3.36244299; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacacgaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+acbdcddddTbdcddddd~`~~~z~~~~~~S~~~~~~b~~`~~~t~t~~}~~~~~~~~~~~T~~~|~~~~~~~~~~~~x~~ddddadddd_ddbdcbdd
+@HELIUM_000100422_612GNAAXX:7:76:8491:8900#0/2_CONS_SUB_SUB_CMP sample=15a_F730814; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gaagtag; reverse_tag=gaagtag; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=57; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=4; tail_quality=65.3; seq_b_deletion=0; mid_quality=76.552238806; seq_a_deletion=0; seq_b_single=46; score=207.828655885; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=66.9; avg_quality=75.1948051948; sminL=40.0; seq_a_single=46; score_norm=3.35207509492; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtgctacctgcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+bcccccccbcccc_ccb[b~^~~~~~~~~~~~~~uw~~~~}~~~y~~}N~qx~}F}z~~~~~~~~~~~~~o~~~~~b~~~bdddddddddddcdadddda
+@HELIUM_000100422_612GNAAXX:7:47:7619:9866#0/2_CONS_SUB_SUB_CMP sample=13a_F730603; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=aattaac; reverse_tag=aattaac; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=61; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=1; tail_quality=67.1; seq_b_deletion=0; mid_quality=78.8358208955; seq_a_deletion=0; seq_b_single=46; score=239.867362445; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.1; avg_quality=77.3116883117; sminL=40.0; seq_a_single=46; score_norm=3.86882842653; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddddddddddddddddded~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~addddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:99:14742:5591#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=29a_F260619; experiment=wolf_diet; forward_tag=gcctcct; reverse_tag=gcctcct; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=60; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.5895522388; seq_a_deletion=0; seq_b_single=46; score=231.982488051; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=77.0844155844; sminL=40.0; seq_a_single=46; score_norm=3.74165303308; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dddddddddddddddddcd~b~~~~~~~~~~~~~a~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddddddddddddddddcdd
+@HELIUM_000100422_612GNAAXX:7:95:3274:5435#0/2_CONS_SUB_SUB_CMP sample=26a_F040644; experiment=wolf_diet; seq_length=99; forward_score=72.0; forward_tag=gaatatc; reverse_tag=gaatatc; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=63; seq_ab_match=61; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=1; tail_quality=66.8; seq_b_deletion=0; mid_quality=78.8421052632; seq_a_deletion=0; seq_b_single=45; score=235.944669323; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.2810457516; sminL=40.0; seq_a_single=45; score_norm=3.74515348131; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+dddcdddddddddcdddd~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~{~~~~~~~~~~~~~~~~~~~~~~~~~b~~~~~ddddddddddcddddddd
+@HELIUM_000100422_612GNAAXX:7:74:8396:18135#0/2_CONS_SUB_SUB_CMP sample=26a_F040644; experiment=wolf_diet; seq_length=99; forward_score=72.0; forward_tag=gaatatc; reverse_tag=gaatatc; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=63; seq_ab_match=61; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.8045112782; seq_a_deletion=0; seq_b_single=45; score=235.858013544; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.2614379085; sminL=40.0; seq_a_single=45; score_norm=3.74377799276; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+ddddddddddddddcddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~~~W~dddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:9:10358:4089#0/2_CONS_SUB_SUB_CMP sample=13a_F730603; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=aattaac; reverse_tag=aattaac; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=61; seq_ab_match=54; sminR=40.0; seq_b_mismatch=6; seq_a_mismatch=1; tail_quality=66.9; seq_b_deletion=1; mid_quality=66.3880597015; seq_a_deletion=0; seq_b_single=47; score=181.620394786; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=66.9; avg_quality=66.4545454545; sminL=40.0; seq_a_single=46; score_norm=2.97738352108; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactacaggcaatagctcaaaactcaaagaacttggcggtgctttataccctt
++
+d^dadbaddddddcddcd^`zy~XwzzzZ~~~ccccccccccccccccBccccBccccccccccBcccccccccccBcccacc`ddc][\[]]`addddd
+@HELIUM_000100422_612GNAAXX:7:78:10338:12302#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=13a_F730603; experiment=wolf_diet; forward_tag=aattaac; reverse_tag=aattaac; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=60; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.6119402985; seq_a_deletion=0; seq_b_single=46; score=231.881878067; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=66.9; avg_quality=77.0974025974; sminL=40.0; seq_a_single=46; score_norm=3.74003029141; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddddddddddddddddddd~a~~~~~~~~~~~~~~~~~~~~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddedddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:95:17941:6113#0/2_CONS_SUB_SUB_CMP sample=26a_F040644; experiment=wolf_diet; seq_length=99; forward_score=72.0; forward_tag=gaatatc; reverse_tag=gaatatc; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=63; seq_ab_match=57; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=6; tail_quality=66.1; seq_b_deletion=0; mid_quality=77.9172932331; seq_a_deletion=0; seq_b_single=45; score=203.869927289; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.1; avg_quality=76.4379084967; sminL=40.0; seq_a_single=45; score_norm=3.23603059189; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+ddd`dd`cdddc^edeca~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~~~~~~~~~~~~~~~~~~~~bb~~~b~~b~~~b~dddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:59:11971:12063#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=29a_F260619; experiment=wolf_diet; forward_tag=gcctcct; reverse_tag=gcctcct; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=62; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.9850746269; seq_a_deletion=0; seq_b_single=46; score=247.995051728; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=77.4285714286; sminL=40.0; seq_a_single=46; score_norm=3.99992018915; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgtcagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+acddddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~|~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddddcddddd
+@HELIUM_000100422_612GNAAXX:7:47:3878:6141#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=13a_F730603; experiment=wolf_diet; forward_tag=aattaac; reverse_tag=aattaac; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=62; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.0223880597; seq_a_deletion=0; seq_b_single=46; score=247.947034203; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=77.461038961; sminL=40.0; seq_a_single=46; score_norm=3.99914571295; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddddddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:21:5487:19582#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=13a_F730603; experiment=wolf_diet; forward_tag=aattaac; reverse_tag=aattaac; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=58; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=3; tail_quality=67.1; seq_b_deletion=0; mid_quality=77.6641791045; seq_a_deletion=0; seq_b_single=46; score=215.831528178; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=66.5; avg_quality=76.2532467532; sminL=40.0; seq_a_single=46; score_norm=3.4811536803; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dbddcdddcddddddddd_~v}~~}{~~~~b~}ZZ}}}t~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~~~~d`dbdddbdcdcdacdddd
+@HELIUM_000100422_612GNAAXX:7:38:13721:2004#0/2_CONS_SUB_SUB_CMP sample=15a_F730814; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gaagtag; reverse_tag=gaagtag; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=61; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.5298507463; seq_a_deletion=0; seq_b_single=46; score=239.856433937; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=66.3; avg_quality=76.987012987; sminL=40.0; seq_a_single=46; score_norm=3.86865216027; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+a]ddddddddddddddd`d~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}}~~~~~~~~~~~~~~~b~~~~~~~~~~~~{~dddddddddbadd^dbddb
+@HELIUM_000100422_612GNAAXX:7:111:19168:18517#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=15a_F730814; experiment=wolf_diet; forward_tag=gaagtag; reverse_tag=gaagtag; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=60; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=77.8955223881; seq_a_deletion=0; seq_b_single=46; score=223.825469474; seq_a_insertion=1; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=76.4805194805; sminL=40.0; seq_a_single=45; score_norm=3.55278522975; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattatccgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddbddddddbcdddd^dd~~~{~_~~~~~~~~~y{}{~U~{|~~~~~n~~|~~~~}x~~~~~~~~~~~~~~~~~^~~~~~~ccdaddbdddbddb_dddd
+@HELIUM_000100422_612GNAAXX:7:89:16162:8889#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=13a_F730603; experiment=wolf_diet; forward_tag=aattaac; reverse_tag=aattaac; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=62; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.1278195489; seq_a_deletion=0; seq_b_single=45; score=243.971622168; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.2; avg_quality=77.5555555556; sminL=40.0; seq_a_single=45; score_norm=3.87256543123; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dddddddddddddddddd~~c~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddedddddddeddddd
+@HELIUM_000100422_612GNAAXX:7:74:4888:6953#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=61; sminR=40.0; seq_b_mismatch=2; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.8571428571; seq_a_deletion=0; seq_b_single=45; score=235.986171514; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.3071895425; sminL=40.0; seq_a_single=45; score_norm=3.74581224625; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+dddddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~~~]~~~~~~~~~~~~~~~~~~~dddddddddedddddddd
+@HELIUM_000100422_612GNAAXX:7:41:16707:19819#0/2_CONS_SUB_SUB_CMP sample=29a_F260619; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gcctcct; reverse_tag=gcctcct; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=60; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.3656716418; seq_a_deletion=0; seq_b_single=46; score=231.94731954; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.1; avg_quality=76.8961038961; sminL=40.0; seq_a_single=46; score_norm=3.74108579903; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dddddddddddddddddbb~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~~~~~bddad`a^dddbddaddddd
+@HELIUM_000100422_612GNAAXX:7:7:7916:16505#0/2_CONS_SUB_SUB_CMP sample=29a_F260619; experiment=wolf_diet; seq_length=4; forward_score=72.0; forward_tag=gcctcct; reverse_tag=gcctcct; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=58; seq_ab_match=58; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=93.0; seq_b_deletion=50; mid_quality=93.0; seq_a_deletion=50; seq_b_single=0; score=231.999536374; seq_a_insertion=0; mode=alignment; seq_length_ori=58; head_quality=93.0; avg_quality=93.0; sminL=40.0; seq_a_single=0; score_norm=3.99999200644; seq_b_insertion=0; 
+tttt
++
+~~~~
+@HELIUM_000100422_612GNAAXX:7:41:9316:2256#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=29a_F260619; experiment=wolf_diet; forward_tag=gcctcct; reverse_tag=gcctcct; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=61; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.6343283582; seq_a_deletion=0; seq_b_single=46; score=239.993848494; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=77.1233766234; sminL=40.0; seq_a_single=46; score_norm=3.87086852409; seq_b_insertion=0; 
+ttagccctaaacacaagaaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dddddddddddddddddNd~~~~~~~~~~~~~~~~~~~~~~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddddddddddcadeddddd
+@HELIUM_000100422_612GNAAXX:7:67:7582:3642#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=62; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.0902255639; seq_a_deletion=0; seq_b_single=45; score=243.962430842; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.5098039216; sminL=40.0; seq_a_single=45; score_norm=3.87241953718; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+dddddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~`~~~~~~~~dddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:42:8435:4155#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=63; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.2857142857; seq_a_deletion=0; seq_b_single=45; score=251.987540492; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.1; avg_quality=77.6862745098; sminL=40.0; seq_a_single=45; score_norm=3.99980223003; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+ddddddddddd`dddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:33:9900:9541#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=13a_F730603; experiment=wolf_diet; forward_tag=aattaac; reverse_tag=aattaac; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=62; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.8955223881; seq_a_deletion=0; seq_b_single=46; score=247.949713348; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=77.3506493506; sminL=40.0; seq_a_single=46; score_norm=3.99918892497; seq_b_insertion=0; 
+ctagccctaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dddddd\`cccccdddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddedddddddddecddcdd
+@HELIUM_000100422_612GNAAXX:7:48:7139:3789#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=63; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.3157894737; seq_a_deletion=0; seq_b_single=45; score=251.902451987; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.7058823529; sminL=40.0; seq_a_single=45; score_norm=3.99845161885; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+dddddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:46:13269:4134#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=63; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.3157894737; seq_a_deletion=0; seq_b_single=45; score=251.997344433; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.7058823529; sminL=40.0; seq_a_single=45; score_norm=3.99995784814; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+dddddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddddddcddddddddddd
+@HELIUM_000100422_612GNAAXX:7:46:9246:19171#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=29a_F260619; experiment=wolf_diet; forward_tag=gcctcct; reverse_tag=gcctcct; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=52; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=10; tail_quality=65.2; seq_b_deletion=0; mid_quality=70.7611940299; seq_a_deletion=0; seq_b_single=46; score=167.802718427; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=66.7; avg_quality=70.1363636364; sminL=40.0; seq_a_single=46; score_norm=2.70649545851; seq_b_insertion=0; 
+ttagccctaaacacaagtaattattataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+`dddddddddd^bddadcd~b~~~~~b~~~~~~~_`~~~~~b~~~~~S~~~~~~~~~~b~~n~`~~k~zoY|~~~~jb~~~DDDDDDDDDDDDDDDDDD`
+@HELIUM_000100422_612GNAAXX:7:37:12979:6595#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=4; sample=29a_F260619; experiment=wolf_diet; forward_tag=gcctcct; reverse_tag=gcctcct; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=58; seq_ab_match=58; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=93.0; seq_b_deletion=50; mid_quality=93.0; seq_a_deletion=50; seq_b_single=0; score=231.998796685; seq_a_insertion=0; mode=alignment; seq_length_ori=58; head_quality=93.0; avg_quality=93.0; sminL=40.0; seq_a_single=0; score_norm=3.99997925319; seq_b_insertion=0; 
+tttt
++
+~~~~
+@HELIUM_000100422_612GNAAXX:7:95:1688:9598#0/2_CONS_SUB_SUB_CMP sample=26a_F040644; experiment=wolf_diet; seq_length=99; forward_score=72.0; forward_tag=gaatatc; reverse_tag=gaatatc; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=63; seq_ab_match=54; sminR=40.0; seq_b_mismatch=3; seq_a_mismatch=6; tail_quality=66.8; seq_b_deletion=0; mid_quality=74.2932330827; seq_a_deletion=0; seq_b_single=45; score=179.847313607; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=65.7; avg_quality=73.2418300654; sminL=40.0; seq_a_single=45; score_norm=2.8547192636; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtgatactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+dddc`ddddcda`bcabb~~[~~~~~~~~~~~~~__~~|z~}}}~~SPF|mxxrwwtIwjxwvv{p~rwxzx`~~Wp~~~~d[ddd`[`^^dcdddd_d
+@HELIUM_000100422_612GNAAXX:7:55:16528:11418#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=13a_F730603; experiment=wolf_diet; forward_tag=aattaac; reverse_tag=aattaac; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=58; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=4; tail_quality=57.0; seq_b_deletion=0; mid_quality=76.0746268657; seq_a_deletion=0; seq_b_single=46; score=215.988419267; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=66.5; avg_quality=74.2142857143; sminL=40.0; seq_a_single=46; score_norm=3.48368418172; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcactagcttacaactcaaaggacttggcggtgctttataccctt
++
+ddcdddddddddddcd`da~~~~~~~~~~~~x~~~~~\~~~~~~~~~v~~~~~~~~~~\~~~~~~~[~~~s~~~~~~~~]~cY__]\QPPPP`]`[`c^^
+@HELIUM_000100422_612GNAAXX:7:32:18486:7018#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=63; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.3233082707; seq_a_deletion=0; seq_b_single=45; score=251.909476689; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.1; avg_quality=77.7189542484; sminL=40.0; seq_a_single=45; score_norm=3.99856312205; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+ddddddddddddddedcd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddedddddddd
+@HELIUM_000100422_612GNAAXX:7:85:2105:21152#0/2_CONS_SUB_SUB_CMP sample=26a_F040644; experiment=wolf_diet; seq_length=99; forward_score=72.0; forward_tag=gaatatc; reverse_tag=gaatatc; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=63; seq_ab_match=57; sminR=40.0; seq_b_mismatch=4; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=73.8947368421; seq_a_deletion=0; seq_b_single=45; score=203.706262238; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=72.9934640523; sminL=40.0; seq_a_single=45; score_norm=3.23343273394; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+daddddddddddaddd`d~b~~~~b~s`~b~~~~~~~~~j~x~~~cccccccccccccccccc~~~~\}~}~~~~~{~~b~dbddddedddeddcdddd
+@HELIUM_000100422_612GNAAXX:7:83:6795:14061#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=29a_F260619; experiment=wolf_diet; forward_tag=gcctcct; reverse_tag=gcctcct; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=62; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.9328358209; seq_a_deletion=0; seq_b_single=46; score=247.992382324; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=77.3831168831; sminL=40.0; seq_a_single=46; score_norm=3.99987713426; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddddddddddddddddd_d~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddcddddddddddbdddbd
+@HELIUM_000100422_612GNAAXX:7:73:16525:10764#0/2_CONS_SUB_SUB_CMP sample=29a_F260619; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gcctcct; reverse_tag=gcctcct; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=60; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.3059701493; seq_a_deletion=0; seq_b_single=46; score=231.90336822; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=66.9; avg_quality=76.8311688312; sminL=40.0; seq_a_single=46; score_norm=3.74037690678; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+c_dddddddcddcdddd^b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|~~~~~b~b~~~~~~~~~~~~~~dddddd_bddddb[dddda
+@HELIUM_000100422_612GNAAXX:7:19:6313:16567#0/2_CONS_SUB_SUB_CMP sample=26a_F040644; experiment=wolf_diet; seq_length=99; forward_score=72.0; forward_tag=gaatatc; reverse_tag=gaatatc; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=63; seq_ab_match=60; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=3; tail_quality=67.0; seq_b_deletion=0; mid_quality=77.4135338346; seq_a_deletion=0; seq_b_single=45; score=227.826165596; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=66.6; avg_quality=76.0261437908; sminL=40.0; seq_a_single=45; score_norm=3.61628834279; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaagggcttggcggtgctttacatccct
++
+ddddcddddddacddddd~~~~~~~~~~~~~~~~~~~~~}}w|~r~xvwrm{z~~~|a~~~~~~~}u~~}~~~~~_O~~~~ddcddb_b__`baYdcdd
+@HELIUM_000100422_612GNAAXX:7:114:8865:19510#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=13a_F730603; experiment=wolf_diet; forward_tag=aattaac; reverse_tag=aattaac; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=61; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.8059701493; seq_a_deletion=0; seq_b_single=46; score=239.913762365; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.1; avg_quality=77.2792207792; sminL=40.0; seq_a_single=46; score_norm=3.86957681233; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddddddddddddddddddd~a~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddcddddddd
+@HELIUM_000100422_612GNAAXX:7:111:8478:1127#0/2_CONS_SUB_SUB_CMP sample=26a_F040644; experiment=wolf_diet; seq_length=99; forward_score=72.0; forward_tag=gaatatc; reverse_tag=gaatatc; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=63; seq_ab_match=57; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=5; tail_quality=67.0; seq_b_deletion=0; mid_quality=76.3909774436; seq_a_deletion=0; seq_b_single=45; score=203.794981474; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=66.4; avg_quality=75.1241830065; sminL=40.0; seq_a_single=45; score_norm=3.23484097578; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctggaacgcaaaggacttggcggtgctttacatccct
++
+dddaddddddddddMbdd~b~~~|~~~~~~{~~~~~~~zy|~~~~{~pv}y~~|~~~~~~~}~|~HxxwIup`~~Z~~v]~adddddacdddbad^dcd
+@HELIUM_000100422_612GNAAXX:7:81:15726:2345#0/2_CONS_SUB_SUB_CMP sample=26a_F040644; experiment=wolf_diet; seq_length=99; forward_score=72.0; forward_tag=gaatatc; reverse_tag=gaatatc; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=63; seq_ab_match=56; sminR=40.0; seq_b_mismatch=7; seq_a_mismatch=0; tail_quality=62.3; seq_b_deletion=0; mid_quality=63.1954887218; seq_a_deletion=0; seq_b_single=45; score=195.641193686; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=62.5; avg_quality=63.091503268; sminL=40.0; seq_a_single=45; score_norm=3.10541577279; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaagcactcggcggtgctttacatccct
++
+WJXc_bcca_ab__cc_b~~s~~{~~sww~pq~~~~cBccBccccccBcBccccccccccBccccccccccccccBcccBcDDDDDDDDDD`cbQc___
+@HELIUM_000100422_612GNAAXX:7:13:14386:20412#0/2_CONS_SUB_SUB_CMP sample=13a_F730603; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=aattaac; reverse_tag=aattaac; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=63; seq_ab_match=60; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.4552238806; seq_a_deletion=0; seq_b_single=45; score=223.918527801; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=76.9675324675; sminL=40.0; seq_a_single=46; score_norm=3.55426234604; seq_b_insertion=1; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+decddddddddddddddd~~a~~~~xa~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~t~~~~~~~~~~~~~~~~~~b~~~~ddddddddddddddddddc
+@HELIUM_000100422_612GNAAXX:7:83:18882:9967#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=60; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.6466165414; seq_a_deletion=0; seq_b_single=45; score=227.922890965; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.1241830065; sminL=40.0; seq_a_single=45; score_norm=3.6178236661; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+dddddddddddddddddd~b~~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~~~~~~~~~~~~~~ddddddddddddddddda
+@HELIUM_000100422_612GNAAXX:7:13:17353:13234#0/2_CONS_SUB_SUB_CMP sample=15a_F730814; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gaagtag; reverse_tag=gaagtag; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=59; sminR=40.0; seq_b_mismatch=2; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=77.6417910448; seq_a_deletion=0; seq_b_single=46; score=223.801902424; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.1; avg_quality=76.2662337662; sminL=40.0; seq_a_single=46; score_norm=3.60970810361; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccttt
++
+ddddddddddddeddWd`b~~}~~~~~x~~~~~oVp]~~~~~~~~~~~~~|~~~~~~~~~~~~~~~~~~~~~~~~~~~~~bdaddbddbdddbcUcbddd
+@HELIUM_000100422_612GNAAXX:7:53:10153:11845#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=15a_F730814; experiment=wolf_diet; forward_tag=gaagtag; reverse_tag=gaagtag; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=61; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.8059701493; seq_a_deletion=0; seq_b_single=46; score=239.985596162; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=77.2727272727; sminL=40.0; seq_a_single=46; score_norm=3.87073542196; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddddddddddddddddddd~~~~~~~~~~~~~~~a~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddddeddddd
+@HELIUM_000100422_612GNAAXX:7:33:9296:13526#0/2_CONS_SUB_SUB_CMP sample=15a_F730814; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gaagtag; reverse_tag=gaagtag; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=61; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.5597014925; seq_a_deletion=0; seq_b_single=46; score=239.852481933; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=66.7; avg_quality=77.038961039; sminL=40.0; seq_a_single=46; score_norm=3.86858841828; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dcdddddeedddddddd^d~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|~|~~~~~v~~~~~~~~~~~~~~~~~~~~~~~^dddddddbdddddZdddcd
+@HELIUM_000100422_612GNAAXX:7:113:2918:18736#0/2_CONS_SUB_SUB_CMP sample=29a_F260619; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gcctcct; reverse_tag=gcctcct; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=58; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=4; tail_quality=67.0; seq_b_deletion=0; mid_quality=77.828358209; seq_a_deletion=0; seq_b_single=46; score=215.87931956; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=76.4220779221; sminL=40.0; seq_a_single=46; score_norm=3.48192450903; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dcdcdddddddddddd_`d~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~v~~~v~~y`~~y~~~~~~~~~~~b~~b~~~bdcddddcddddda_ddddd
+@HELIUM_000100422_612GNAAXX:7:63:4725:12502#0/2_CONS_SUB_SUB_CMP sample=29a_F260619; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gcctcct; reverse_tag=gcctcct; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=61; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.0671641791; seq_a_deletion=0; seq_b_single=46; score=239.998975242; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=66.5; avg_quality=76.5974025974; sminL=40.0; seq_a_single=46; score_norm=3.87095121358; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dcdcddeddddddddWd]d~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~~~~~~~~~~~~~~dddddd``ddd]\R]\ddT
+@HELIUM_000100422_612GNAAXX:7:7:11110:17924#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=15a_F730814; experiment=wolf_diet; forward_tag=gaagtag; reverse_tag=gaagtag; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=58; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=3; tail_quality=67.0; seq_b_deletion=0; mid_quality=75.723880597; seq_a_deletion=0; seq_b_single=46; score=215.812113201; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=66.4; avg_quality=74.5519480519; sminL=40.0; seq_a_single=46; score_norm=3.4808405355; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtcataccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dcddddddddcdddddd`d~b~~~~~~~~~~~~~~~~~rm{kripoooEJpoolppp~~~~~~~~~~~~~v~~~~~`v~~~dddcdddddddbddddadd
+@HELIUM_000100422_612GNAAXX:7:102:6364:4627#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=63; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.2932330827; seq_a_deletion=0; seq_b_single=45; score=251.985885517; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.6862745098; sminL=40.0; seq_a_single=45; score_norm=3.99977596059; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+dddddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddcddddddddddcdddd
+@HELIUM_000100422_612GNAAXX:7:96:8737:4973#0/2_CONS_SUB_SUB_CMP sample=29a_F260619; experiment=wolf_diet; seq_length=4; forward_score=72.0; forward_tag=gcctcct; reverse_tag=gcctcct; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=58; seq_ab_match=57; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=1; tail_quality=93.0; seq_b_deletion=50; mid_quality=92.2631578947; seq_a_deletion=50; seq_b_single=0; score=223.980140585; seq_a_insertion=0; mode=alignment; seq_length_ori=58; head_quality=93.0; avg_quality=92.5172413793; sminL=40.0; seq_a_single=0; score_norm=3.86172656181; seq_b_insertion=0; 
+tttt
++
+~b~~
+@HELIUM_000100422_612GNAAXX:7:89:9710:20652#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=62; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.8421052632; seq_a_deletion=0; seq_b_single=45; score=243.910293117; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.2941176471; sminL=40.0; seq_a_single=45; score_norm=3.87159195424; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttatatccct
++
+dad]ccccddcdddcddd~~}~~~~~~~~~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}ddaddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:71:17473:7401#0/2_CONS_SUB_SUB_CMP sample=15a_F730814; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gaagtag; reverse_tag=gaagtag; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=60; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=77.2089552239; seq_a_deletion=0; seq_b_single=46; score=231.883938289; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=65.5; avg_quality=75.7857142857; sminL=40.0; seq_a_single=46; score_norm=3.74006352079; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggtaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddddaddddccdbddbddd~~~~~~~~b~~~~~~~~~~~~~~~~~~~~~~~~wywop~~~~gx~~~~~w~~s~~~~R~~~~c^cc_ccccc^caabaccc
+@HELIUM_000100422_612GNAAXX:7:28:9406:18226#0/2_CONS_SUB_SUB_CMP sample=15a_F730814; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gaagtag; reverse_tag=gaagtag; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=60; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.4925373134; seq_a_deletion=0; seq_b_single=46; score=231.816671723; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=77.0; sminL=40.0; seq_a_single=46; score_norm=3.73897857618; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddddddddddddcdcdecd~~~~~~~~~~~~~~~~|~~~~~~~~~~~~~~{~~~~~~~~~~x~~~~~~~~~~~~~~b~~~_ddeddddddddddcddddd
+@HELIUM_000100422_612GNAAXX:7:15:16118:15111#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=15a_F730814; experiment=wolf_diet; forward_tag=gaagtag; reverse_tag=gaagtag; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=60; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.4104477612; seq_a_deletion=0; seq_b_single=46; score=231.917355899; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=76.9285714286; sminL=40.0; seq_a_single=46; score_norm=3.7406025145; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddddddddddddddd`d]d~~~c~~~~x~~~~~~a~~~w~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddddddddd`dddeddddd
+@HELIUM_000100422_612GNAAXX:7:58:18618:20959#0/2_CONS_SUB_SUB_CMP sample=13a_F730603; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=aattaac; reverse_tag=aattaac; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=59; sminR=40.0; seq_b_mismatch=2; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.2537313433; seq_a_deletion=0; seq_b_single=46; score=223.882241304; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.1; avg_quality=76.7987012987; sminL=40.0; seq_a_single=46; score_norm=3.611003892; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddcddddddddddddddddb~~~~~b~~~~~~~~~x~~z~~~~~|~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b}~~~ddddddcdddddd_ddddd
+@HELIUM_000100422_612GNAAXX:7:46:11654:6037#0/2_CONS_SUB_SUB_CMP sample=15a_F730814; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gaagtag; reverse_tag=gaagtag; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=61; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.4402985075; seq_a_deletion=0; seq_b_single=46; score=239.828425953; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=76.9545454545; sminL=40.0; seq_a_single=46; score_norm=3.8682004186; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dddedddcdddddddddcd~~~~~~~~~~~~~~~~~~~~~~~~~~~}{z~~v~~~{~~~~~~~}~~~~~~~~~~~~~~~~bcccddcb^bbbcbdddddd
+@HELIUM_000100422_612GNAAXX:7:2:6320:8068#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=63; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.3082706767; seq_a_deletion=0; seq_b_single=45; score=251.910304163; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.1; avg_quality=77.7058823529; sminL=40.0; seq_a_single=45; score_norm=3.99857625655; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+dddddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddeddddbddddddd
+@HELIUM_000100422_612GNAAXX:7:46:1592:11866#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=13a_F730603; experiment=wolf_diet; forward_tag=aattaac; reverse_tag=aattaac; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=62; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=66.5; seq_b_deletion=0; mid_quality=78.6791044776; seq_a_deletion=0; seq_b_single=46; score=247.993604064; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=66.8; avg_quality=77.1168831169; sminL=40.0; seq_a_single=46; score_norm=3.99989683974; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dd_dddbcd\dddddd]dd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddcddcddd`dddcddcdd
+@HELIUM_000100422_612GNAAXX:7:119:2660:19129#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=61; sminR=40.0; seq_b_mismatch=2; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.6541353383; seq_a_deletion=0; seq_b_single=45; score=235.859804076; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.1307189542; sminL=40.0; seq_a_single=45; score_norm=3.74380641391; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+dcddcddddddddcdddd~~~~~~~~~~~~~~~~z}~~~~~~~~~~~~~~~~~~~~~~~~~~~~k~~~~~~~~~~b~^~~~dddbdddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:115:3625:10051#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=5; sample=13a_F730603; experiment=wolf_diet; forward_tag=aattaac; reverse_tag=aattaac; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=59; seq_ab_match=59; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=93.0; seq_b_deletion=49; mid_quality=93.0; seq_a_deletion=49; seq_b_single=0; score=235.999642017; seq_a_insertion=0; mode=alignment; seq_length_ori=59; head_quality=93.0; avg_quality=93.0; sminL=40.0; seq_a_single=0; score_norm=3.99999393249; seq_b_insertion=0; 
+caata
++
+~~~~~
+@HELIUM_000100422_612GNAAXX:7:100:17253:5513#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=13a_F730603; experiment=wolf_diet; forward_tag=aattaac; reverse_tag=aattaac; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=60; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=2; tail_quality=65.1; seq_b_deletion=0; mid_quality=76.6417910448; seq_a_deletion=0; seq_b_single=46; score=231.761122002; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=66.7; avg_quality=75.2467532468; sminL=40.0; seq_a_single=46; score_norm=3.73808261294; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dddbdddddcddddddddd~~~~|{|~~~~b~~~~~~~~~~s~~~~~x~~~~~~~rs~zqwxy~z~~|}~z~}|{^v~~~~c``Zc`cXWcc[WYYZccc
+@HELIUM_000100422_612GNAAXX:7:82:6036:6921#0/2_CONS_SUB_SUB_CMP sample=15a_F730814; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gaagtag; reverse_tag=gaagtag; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=60; sminR=40.0; seq_b_mismatch=2; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.4104477612; seq_a_deletion=0; seq_b_single=46; score=231.901981419; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=76.9285714286; sminL=40.0; seq_a_single=46; score_norm=3.74035453901; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddcbddddeddddddddcd~~~~~b~~~~~~~~~~~~~~~~~~~~~~~]~~~~~~~~}~~~~~~~~~~~~~~~~~~~|~{~dddddccdcddddabddd`
+@HELIUM_000100422_612GNAAXX:7:120:4726:20808#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=13a_F730603; experiment=wolf_diet; forward_tag=aattaac; reverse_tag=aattaac; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=62; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.6940298507; seq_a_deletion=0; seq_b_single=46; score=247.810697755; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=66.9; avg_quality=77.1688311688; sminL=40.0; seq_a_single=46; score_norm=3.99694673798; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dbedddddcdddddddddb~~~~~~~~~~~~~~ty}y~~~~~~~~~~~~{~~~~~~~~~~~~~~~~~~~~~~~~~~~~~r~ddddcdddddcdd`ddddd
+@HELIUM_000100422_612GNAAXX:7:99:8183:13912#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=13a_F730603; experiment=wolf_diet; forward_tag=aattaac; reverse_tag=aattaac; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=60; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=1; tail_quality=67.1; seq_b_deletion=0; mid_quality=78.3358208955; seq_a_deletion=0; seq_b_single=46; score=231.903850642; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=76.8701298701; sminL=40.0; seq_a_single=46; score_norm=3.74038468777; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctc
++
+ddddddddddcddddddeb~Z~~~~~~~~~~~~~~~~~}~l~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~~~~dadcdedddcdddddddd`
+@HELIUM_000100422_612GNAAXX:7:10:4085:7492#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=62; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.1052631579; seq_a_deletion=0; seq_b_single=45; score=243.95581367; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.522875817; sminL=40.0; seq_a_single=45; score_norm=3.87231450269; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+dddddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~dddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:35:12723:18557#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=63; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.1804511278; seq_a_deletion=0; seq_b_single=45; score=251.945522222; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.5882352941; sminL=40.0; seq_a_single=45; score_norm=3.99913527337; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+adddcddddddddddddd~~}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~cdddcdddddddbddddd
+@HELIUM_000100422_612GNAAXX:7:97:10495:17046#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=13a_F730603; experiment=wolf_diet; forward_tag=aattaac; reverse_tag=aattaac; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=61; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=0; tail_quality=66.9; seq_b_deletion=0; mid_quality=78.7686567164; seq_a_deletion=0; seq_b_single=46; score=239.938979134; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.1; avg_quality=77.2402597403; sminL=40.0; seq_a_single=46; score_norm=3.86998353443; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddddddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~a~~~~~~~~~~~~dddddddddddddddcddd
+@HELIUM_000100422_612GNAAXX:7:73:17068:16620#0/2_CONS_SUB_SUB_CMP sample=29a_F260619; experiment=wolf_diet; seq_length=4; forward_score=72.0; forward_tag=gcctcct; reverse_tag=gcctcct; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=58; seq_ab_match=57; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=0; tail_quality=92.8; seq_b_deletion=50; mid_quality=92.2631578947; seq_a_deletion=50; seq_b_single=0; score=223.962007947; seq_a_insertion=0; mode=alignment; seq_length_ori=58; head_quality=93.0; avg_quality=92.4827586207; sminL=40.0; seq_a_single=0; score_norm=3.86141393012; seq_b_insertion=0; 
+tttt
++
+~~~~
+@HELIUM_000100422_612GNAAXX:7:23:13304:5167#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=13a_F730603; experiment=wolf_diet; forward_tag=aattaac; reverse_tag=aattaac; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=62; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.0149253731; seq_a_deletion=0; seq_b_single=46; score=247.997553566; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=77.4545454545; sminL=40.0; seq_a_single=46; score_norm=3.99996054139; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddddddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddddcddddd
+@HELIUM_000100422_612GNAAXX:7:54:2542:19180#0/2_CONS_SUB_SUB_CMP sample=15a_F730814; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gaagtag; reverse_tag=gaagtag; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=61; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.7313432836; seq_a_deletion=0; seq_b_single=46; score=239.868258533; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=77.2077922078; sminL=40.0; seq_a_single=46; score_norm=3.86884287957; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dddddddddddddddbdad~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|~~~~~~~~~~~~~~~~~b~~~~dddddccdcddddbddddd
+@HELIUM_000100422_612GNAAXX:7:109:17917:15159#0/2_CONS_SUB_SUB_CMP sample=26a_F040644; experiment=wolf_diet; seq_length=99; forward_score=72.0; forward_tag=gaatatc; reverse_tag=gaatatc; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=63; seq_ab_match=61; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.8571428571; seq_a_deletion=0; seq_b_single=45; score=235.857230348; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.1; avg_quality=77.3137254902; sminL=40.0; seq_a_single=45; score_norm=3.74376556108; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+dddcdddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}~~~~~~~~~~~~~~~~~~~~~a~~b~~~~~cddddddddddddcdddd
+@HELIUM_000100422_612GNAAXX:7:59:18371:8149#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=13a_F730603; experiment=wolf_diet; forward_tag=aattaac; reverse_tag=aattaac; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=62; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.0149253731; seq_a_deletion=0; seq_b_single=46; score=247.998742319; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=77.4545454545; sminL=40.0; seq_a_single=46; score_norm=3.99997971482; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dcddddddddddddddddc~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddddeddddd
+@HELIUM_000100422_612GNAAXX:7:86:11013:15234#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=13a_F730603; experiment=wolf_diet; forward_tag=aattaac; reverse_tag=aattaac; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=61; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.8208955224; seq_a_deletion=0; seq_b_single=46; score=239.990009212; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=77.2857142857; sminL=40.0; seq_a_single=46; score_norm=3.8708066002; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddddddddddddddddddd~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:77:18518:10758#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=13a_F730603; experiment=wolf_diet; forward_tag=aattaac; reverse_tag=aattaac; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=59; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=2; tail_quality=62.5; seq_b_deletion=0; mid_quality=72.2388059701; seq_a_deletion=0; seq_b_single=46; score=223.70605163; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=63.9; avg_quality=71.0649350649; sminL=40.0; seq_a_single=46; score_norm=3.60816212307; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+caccaccccccccccc_cc~~~~~~~~~~~~wzz{~~a~~~~y~_~~~~~~~~~~m~sygwqv~ccBccccccccccccc~bb^^bc`U\\`\]XPZ\__
+@HELIUM_000100422_612GNAAXX:7:63:18851:7688#0/2_CONS_SUB_SUB_CMP sample=13a_F730603; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=aattaac; reverse_tag=aattaac; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=59; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=3; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.4104477612; seq_a_deletion=0; seq_b_single=46; score=223.854412144; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=76.9285714286; sminL=40.0; seq_a_single=46; score_norm=3.61055503459; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dcddddddddddedddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~a~b~~~~~~~~~b~~~~dddddddddddeddddddd
+@HELIUM_000100422_612GNAAXX:7:22:1798:3790#0/2_CONS_SUB_SUB_CMP sample=13a_F730603; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=aattaac; reverse_tag=aattaac; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=59; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=3; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.3208955224; seq_a_deletion=0; seq_b_single=46; score=223.82253574; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=76.8506493506; sminL=40.0; seq_a_single=46; score_norm=3.61004089903; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtgctaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dadbddbdddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~~~~~~~~~~~~~~~~~b~~~bdddddddddddddaddddd
+@HELIUM_000100422_612GNAAXX:7:115:14354:10118#0/2_CONS_SUB_SUB_CMP sample=26a_F040644; experiment=wolf_diet; seq_length=99; forward_score=72.0; forward_tag=gaatatc; reverse_tag=gaatatc; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=63; seq_ab_match=59; sminR=40.0; seq_b_mismatch=2; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.045112782; seq_a_deletion=0; seq_b_single=45; score=219.850378027; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=76.6013071895; sminL=40.0; seq_a_single=45; score_norm=3.4896885401; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactcgcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+ddeddddddddeddddcd~b~~~~~~~~~~~~_~~~~~~~~~~~~~~~w|y~tJ}~~~~~~}~~~~~~~~~~~~~b~~~~~ddddddddcddccddddd
+@HELIUM_000100422_612GNAAXX:7:99:14794:3606#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=61; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.7894736842; seq_a_deletion=0; seq_b_single=45; score=235.971679218; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=66.9; avg_quality=77.2418300654; sminL=40.0; seq_a_single=45; score_norm=3.74558220981; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+dddddddddddddddddd~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~dddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:74:8297:20108#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=15a_F730814; experiment=wolf_diet; forward_tag=gaagtag; reverse_tag=gaagtag; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=61; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.776119403; seq_a_deletion=0; seq_b_single=46; score=239.962155962; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=77.2467532468; sminL=40.0; seq_a_single=46; score_norm=3.87035735423; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddcdddddddddddddd`d~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}~ddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:29:12308:10119#0/2_CONS_SUB_SUB_CMP sample=26a_F040644; experiment=wolf_diet; seq_length=99; forward_score=72.0; forward_tag=gaatatc; reverse_tag=gaatatc; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=63; seq_ab_match=63; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.3233082707; seq_a_deletion=0; seq_b_single=45; score=251.866768717; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.7124183007; sminL=40.0; seq_a_single=45; score_norm=3.99788521773; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+dddddddeddddedcddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:25:11691:21134#0/2_CONS_SUB_SUB_CMP sample=29a_F260619; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gcctcct; reverse_tag=gcctcct; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=59; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.1567164179; seq_a_deletion=0; seq_b_single=46; score=223.86269299; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=76.7077922078; sminL=40.0; seq_a_single=46; score_norm=3.61068859661; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddcdddddcddddddad]d~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}~}~~~~~~~~~~~~~~~}~~b~~~_dddddddadddcdaddddd
+@HELIUM_000100422_612GNAAXX:7:111:15484:19248#0/2_CONS_SUB_SUB_CMP sample=26a_F040644; experiment=wolf_diet; seq_length=99; forward_score=72.0; forward_tag=gaatatc; reverse_tag=gaatatc; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=63; seq_ab_match=60; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=77.954887218; seq_a_deletion=0; seq_b_single=45; score=227.828264164; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=76.522875817; sminL=40.0; seq_a_single=45; score_norm=3.6163216534; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+ddddddddddddddaddd~~~~~~~~~~~~~~~`~~jzvxt{~z~~~{~}yx~}~~{`~~~~~~~~s~~~~~~~~b~~~~~dddddddddd`ddcdddd
+@HELIUM_000100422_612GNAAXX:7:103:3594:15996#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=13a_F730603; experiment=wolf_diet; forward_tag=aattaac; reverse_tag=aattaac; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=60; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.3805970149; seq_a_deletion=0; seq_b_single=46; score=231.92194325; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.1; avg_quality=76.9090909091; sminL=40.0; seq_a_single=46; score_norm=3.74067650404; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacacaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dddddddddddddddddddb~~~~~~~~~~~R~}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddddaddddd
+@HELIUM_000100422_612GNAAXX:7:1:14576:14181#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=15a_F730814; experiment=wolf_diet; forward_tag=gaagtag; reverse_tag=gaagtag; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=60; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.5373134328; seq_a_deletion=0; seq_b_single=46; score=223.962708229; seq_a_insertion=1; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=77.038961039; sminL=40.0; seq_a_single=45; score_norm=3.55496362269; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddddddddcddddddcda~~~~b~~~~~~~~~~~a~~~~~~`~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddedddddcddddd
+@HELIUM_000100422_612GNAAXX:7:99:13467:17714#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=29a_F260619; experiment=wolf_diet; forward_tag=gcctcct; reverse_tag=gcctcct; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=59; sminR=40.0; seq_b_mismatch=2; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.3432835821; seq_a_deletion=0; seq_b_single=46; score=223.932198733; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=66.9; avg_quality=76.8636363636; sminL=40.0; seq_a_single=46; score_norm=3.61180965699; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddcddddddddddddddcd~~~~~~~~b~~~}~~~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~bddddddddddeddcddddd
+@HELIUM_000100422_612GNAAXX:7:43:7980:7908#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=13a_F730603; experiment=wolf_diet; forward_tag=aattaac; reverse_tag=aattaac; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=61; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.5970149254; seq_a_deletion=0; seq_b_single=46; score=239.984831014; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=66.9; avg_quality=77.0844155844; sminL=40.0; seq_a_single=46; score_norm=3.87072308087; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+daddcdddd_cddcdddda~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~`~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~d`ddddddddddccbdddd
+@HELIUM_000100422_612GNAAXX:7:105:14135:6905#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=29a_F260619; experiment=wolf_diet; forward_tag=gcctcct; reverse_tag=gcctcct; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=61; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.8134328358; seq_a_deletion=0; seq_b_single=46; score=239.985379811; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=77.2792207792; sminL=40.0; seq_a_single=46; score_norm=3.87073193244; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcaccagagtactagcggcaacagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddddddddddddddddddd~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddeddddddddddddbddd
+@HELIUM_000100422_612GNAAXX:7:89:16663:15081#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=13a_F730603; experiment=wolf_diet; forward_tag=aattaac; reverse_tag=aattaac; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=62; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.0149253731; seq_a_deletion=0; seq_b_single=46; score=247.939062327; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.1; avg_quality=77.461038961; sminL=40.0; seq_a_single=46; score_norm=3.9990171343; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddddddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddddddddddddecddddd
+@HELIUM_000100422_612GNAAXX:7:86:15907:21191#0/2_CONS_SUB_SUB_CMP sample=26a_F040644; experiment=wolf_diet; seq_length=99; forward_score=72.0; forward_tag=gaatatc; reverse_tag=gaatatc; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=63; seq_ab_match=58; sminR=40.0; seq_b_mismatch=2; seq_a_mismatch=3; tail_quality=67.0; seq_b_deletion=0; mid_quality=77.9172932331; seq_a_deletion=0; seq_b_single=45; score=211.91203832; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=66.9; avg_quality=76.4836601307; sminL=40.0; seq_a_single=45; score_norm=3.36368314793; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+dd`deddddddddddddd~~~~~{~~~~~~~~~~~~~~~~~~~~~~~~X~~~[~~~~~~~~~~~~~~~~~~~`~{a~~~b~ddcd\ddadddddcdddb
+@HELIUM_000100422_612GNAAXX:7:81:17261:2872#0/2_CONS_SUB_SUB_CMP sample=26a_F040644; experiment=wolf_diet; seq_length=99; forward_score=72.0; forward_tag=gaatatc; reverse_tag=gaatatc; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=63; seq_ab_match=63; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.1; seq_b_deletion=0; mid_quality=79.3157894737; seq_a_deletion=0; seq_b_single=45; score=251.967130674; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=66.9; avg_quality=77.7058823529; sminL=40.0; seq_a_single=45; score_norm=3.99947826467; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+dddedddddddddedddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddadddddeddedddddd
+@HELIUM_000100422_612GNAAXX:7:14:15397:17819#0/2_CONS_SUB_SUB_CMP sample=29a_F260619; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gcctcct; reverse_tag=gcctcct; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=59; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.171641791; seq_a_deletion=0; seq_b_single=46; score=223.847163266; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=66.9; avg_quality=76.7142857143; sminL=40.0; seq_a_single=46; score_norm=3.61043811719; seq_b_insertion=0; 
+ttagccctaaacacaaataattacacaaacaaaattgttcaccagagtactagcggcaacagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddddddddddddddddddc~`~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~a~s~~~v~~~~~~~~}~~a~~~~~~~dddddcbddddddcddddd
+@HELIUM_000100422_612GNAAXX:7:76:18268:14980#0/2_CONS_SUB_SUB_CMP sample=29a_F260619; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gcctcct; reverse_tag=gcctcct; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=61; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=1; tail_quality=66.9; seq_b_deletion=0; mid_quality=78.3208955224; seq_a_deletion=0; seq_b_single=46; score=239.985254914; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=76.8441558442; sminL=40.0; seq_a_single=46; score_norm=3.87072991797; seq_b_insertion=0; 
+ttacccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+d\ccdcddddddddddecd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~z~~~~~~~~~~~~~~~~~~~~b~~~~adbdbd^bcccddHddbdb
+@HELIUM_000100422_612GNAAXX:7:16:15509:18069#0/2_CONS_SUB_SUB_CMP sample=15a_F730814; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gaagtag; reverse_tag=gaagtag; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=58; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=4; tail_quality=66.8; seq_b_deletion=0; mid_quality=77.5; seq_a_deletion=0; seq_b_single=46; score=215.81634366; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=76.1233766234; sminL=40.0; seq_a_single=46; score_norm=3.48090876871; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+cdYdddddbdddbdcddda~~~~~~~~~~~~~~~~~~}a~r~~~~~~~~~~~~~~]zz~~~~}~~~~~~~~~~~~~b}}~_dddddddbdddddLaddbd
+@HELIUM_000100422_612GNAAXX:7:25:7789:3090#0/2_CONS_SUB_SUB_CMP sample=29a_F260619; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gcctcct; reverse_tag=gcctcct; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=59; sminR=40.0; seq_b_mismatch=3; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=72.4179104478; seq_a_deletion=0; seq_b_single=46; score=223.705772044; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=66.5; avg_quality=71.6818181818; sminL=40.0; seq_a_single=46; score_norm=3.60815761361; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactacaggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ead]dddddddddddddbd~~~~~~~~~~~~{~}~~~~cBBccccccccccccBccc~~z}~y~p~~~w|j||~~~uzr|tNba^\bT^cccZ\L\]`_`
+@HELIUM_000100422_612GNAAXX:7:53:18419:8404#0/2_CONS_SUB_SUB_CMP sample=13a_F730603; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=aattaac; reverse_tag=aattaac; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=60; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.5447761194; seq_a_deletion=0; seq_b_single=46; score=231.841887233; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=77.0454545455; sminL=40.0; seq_a_single=46; score_norm=3.73938527796; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+decddddddddddddddddb~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~{~~~~b~~~~~~~~~~~~~~~{~~~~~~~~~ddddddedddddd_ddddd
+@HELIUM_000100422_612GNAAXX:7:19:11039:3957#0/2_CONS_SUB_SUB_CMP sample=15a_F730814; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gaagtag; reverse_tag=gaagtag; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=62; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.8432835821; seq_a_deletion=0; seq_b_single=46; score=247.811165598; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=66.7; avg_quality=77.2857142857; sminL=40.0; seq_a_single=46; score_norm=3.99695428384; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dddcdddddddddddddad~~~~~~~~~~~~~~~~~~~~~~~~~~~}~~~~~~~~~~v~~~~~~~~~~~~~~~~~~~~~~~ddbdddbadddddbddddd
+@HELIUM_000100422_612GNAAXX:7:42:19757:3800#0/2_CONS_SUB_SUB_CMP sample=15a_F730814; experiment=wolf_diet; seq_length=99; forward_score=72.0; forward_tag=gaagtag; reverse_tag=gaagtag; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=57; sminR=40.0; seq_b_mismatch=3; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=1; mid_quality=77.7669172932; seq_a_deletion=1; seq_b_single=46; score=187.78301321; seq_a_insertion=1; mode=alignment; seq_length_ori=153; head_quality=67.1; avg_quality=76.3660130719; sminL=40.0; seq_a_single=45; score_norm=3.02875827758; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatatacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddddedddeddddddcdcc~~~~~~~b~|~~~a~`~~~~~~~~~~~vz~~~~~~~~~~~x_~~~~~~~~~~~~~]~~~~~~dddddd`dddddadddcd
+@HELIUM_000100422_612GNAAXX:7:116:14244:17926#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=55; sminR=40.0; seq_b_mismatch=3; seq_a_mismatch=5; tail_quality=67.0; seq_b_deletion=0; mid_quality=76.5338345865; seq_a_deletion=0; seq_b_single=45; score=187.882758912; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=75.2875816993; sminL=40.0; seq_a_single=45; score_norm=2.98226601448; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgcaagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+d`dbcccc`dddddeddd~~~~~~_~~~~b~~~~~~^xz{ZRzpooop~~s~~~~~~`~~~~~~~~~~~~~~~~~b~~~b~dddddedddddddddddd
+@HELIUM_000100422_612GNAAXX:7:91:10071:8960#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=63; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.3233082707; seq_a_deletion=0; seq_b_single=45; score=251.979171474; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.7124183007; sminL=40.0; seq_a_single=45; score_norm=3.99966938848; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+ddddddddddddddeddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:61:17484:5085#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=29a_F260619; experiment=wolf_diet; forward_tag=gcctcct; reverse_tag=gcctcct; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=62; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.9776119403; seq_a_deletion=0; seq_b_single=46; score=247.996979391; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=66.9; avg_quality=77.4155844156; sminL=40.0; seq_a_single=46; score_norm=3.9999512805; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddddedddddddddddd`d~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddccddcddd
+@HELIUM_000100422_612GNAAXX:7:18:2721:16829#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=63; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.3308270677; seq_a_deletion=0; seq_b_single=45; score=251.960802952; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.2; avg_quality=77.7320261438; sminL=40.0; seq_a_single=45; score_norm=3.99937782464; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+dddeeddddedddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dbdddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:2:7296:17275#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=29a_F260619; experiment=wolf_diet; forward_tag=gcctcct; reverse_tag=gcctcct; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=59; sminR=40.0; seq_b_mismatch=2; seq_a_mismatch=1; tail_quality=66.9; seq_b_deletion=0; mid_quality=78.0298507463; seq_a_deletion=0; seq_b_single=46; score=223.923525795; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=66.3; avg_quality=76.5454545455; sminL=40.0; seq_a_single=46; score_norm=3.61166977089; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dbcacbcbd`ddddddd_b~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~~vbdddddddddddcc]baddb
+@HELIUM_000100422_612GNAAXX:7:58:8591:17028#0/2_CONS_SUB_SUB_CMP sample=29a_F260619; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gcctcct; reverse_tag=gcctcct; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=59; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=2; tail_quality=66.0; seq_b_deletion=0; mid_quality=75.8582089552; seq_a_deletion=0; seq_b_single=46; score=223.788176649; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=65.3; avg_quality=74.5324675325; sminL=40.0; seq_a_single=46; score_norm=3.60948672015; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+_bcccccccbccacccccc~~~~~a~~y~~~~~wyn~~~~x~~zrzzkpppp~~~~~~{zuxx~~~~~z~xw~`~~_~~~~aaac]ca`cccccacc__[
+@HELIUM_000100422_612GNAAXX:7:13:3469:18630#0/2_CONS_SUB_SUB_CMP sample=26a_F040644; experiment=wolf_diet; seq_length=99; forward_score=72.0; forward_tag=gaatatc; reverse_tag=gaatatc; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=63; seq_ab_match=58; sminR=40.0; seq_b_mismatch=2; seq_a_mismatch=3; tail_quality=66.0; seq_b_deletion=0; mid_quality=76.2631578947; seq_a_deletion=0; seq_b_single=45; score=211.840326012; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=66.3; avg_quality=74.9411764706; sminL=40.0; seq_a_single=45; score_norm=3.36254485733; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+dddIQQPPdadddcdadd~~~~~xyyLqV{w~~~~~~~~~~~~~~~~~~zszx{|yy{~~~~~~~~~~~~~~[~~b~~~b~ddddd_dddd^`a_cdd`
+@HELIUM_000100422_612GNAAXX:7:72:12959:5736#0/2_CONS_SUB_SUB_CMP sample=26a_F040644; experiment=wolf_diet; seq_length=99; forward_score=72.0; forward_tag=gaatatc; reverse_tag=gaatatc; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=63; seq_ab_match=56; sminR=40.0; seq_b_mismatch=7; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=63.5263157895; seq_a_deletion=0; seq_b_single=45; score=195.664863172; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=59.8; avg_quality=63.5098039216; sminL=40.0; seq_a_single=45; score_norm=3.10579147892; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacacccct
++
+^\bSbbbbddddd^dddd~~~~~~~~~~~~~~~b~~ib~~~~~~_~ccBBBcccccccccBccccccccccccccccccccDDDDDDDDDDDDDDDDDD
+@HELIUM_000100422_612GNAAXX:7:115:6263:17700#0/2_CONS_SUB_SUB_CMP sample=26a_F040644; experiment=wolf_diet; seq_length=99; forward_score=72.0; forward_tag=gaatatc; reverse_tag=gaatatc; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=63; seq_ab_match=61; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.6390977444; seq_a_deletion=0; seq_b_single=45; score=235.853550005; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.1176470588; sminL=40.0; seq_a_single=45; score_norm=3.74370714293; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+ddcdddddddddddeddd~~~~~~~~~~~~~~~~~~~~~~~~~~y|z{yxx~~{~~~~~~~~~~~~~~~~~~~~~b~~~b~ddddeddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:7:15538:8325#0/2_CONS_SUB_SUB_CMP sample=26a_F040644; experiment=wolf_diet; seq_length=99; forward_score=72.0; forward_tag=gaatatc; reverse_tag=gaatatc; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=63; seq_ab_match=52; sminR=40.0; seq_b_mismatch=10; seq_a_mismatch=0; tail_quality=63.4; seq_b_deletion=1; mid_quality=60.1879699248; seq_a_deletion=0; seq_b_single=45; score=151.662770749; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=59.2; avg_quality=60.3333333333; sminL=40.0; seq_a_single=45; score_norm=2.40734556744; seq_b_insertion=1; 
+ttagccctaaacataaacattcaataaacaagaatgtcggccagagtactactagcaacagcatgaaactcaaagaactgggcggtgctttacatccct
++
+_S\abcacca_cacccc_~~y}~~~~qxYzgY^~~~accBccccccccccccccBBccccccBccccccBcccccBcccBcDDDDDDDDDDDDDDDDDD
+@HELIUM_000100422_612GNAAXX:7:120:16005:7955#0/2_CONS_SUB_SUB_CMP sample=26a_F040644; experiment=wolf_diet; seq_length=98; forward_score=72.0; forward_tag=gaatatc; reverse_tag=gaatatc; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=64; seq_ab_match=61; sminR=40.0; seq_b_mismatch=2; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.8939393939; seq_a_deletion=0; seq_b_single=44; score=231.880428082; seq_a_insertion=0; mode=alignment; seq_length_ori=152; head_quality=67.0; avg_quality=77.3289473684; sminL=40.0; seq_a_single=44; score_norm=3.62313168878; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagccgaaactcaaaggacttggcggtgctttacatccct
++
+ddddddddddddddddd~~~~b~~~~~~~~~b~~~~~~~~~~~z~~~~~~~~~~{~~~~~~~`~~~~~~~~~~~~~~~~~~ddddcdddddddddddd
+@HELIUM_000100422_612GNAAXX:7:115:3396:14235#0/2_CONS_SUB_SUB_CMP sample=26a_F040644; experiment=wolf_diet; seq_length=99; forward_score=72.0; forward_tag=gaatatc; reverse_tag=gaatatc; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=63; seq_ab_match=61; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.1052631579; seq_a_deletion=0; seq_b_single=45; score=235.745732131; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=76.6535947712; sminL=40.0; seq_a_single=45; score_norm=3.74199574811; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+ddcdddddadddddcddd~~~~~~b~~~~~~~~~}~}~ccc~|~~~~{~~~~~~~s~~~~~~~~~~~~~~~~~~~b~~~~~ddddddddddcdcddddd
+@HELIUM_000100422_612GNAAXX:7:32:15197:9940#0/2_CONS_SUB_SUB_CMP sample=13a_F730603; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=aattaac; reverse_tag=aattaac; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=60; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=2; tail_quality=66.9; seq_b_deletion=0; mid_quality=78.3656716418; seq_a_deletion=0; seq_b_single=46; score=231.86950825; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.1; avg_quality=76.8896103896; sminL=40.0; seq_a_single=46; score_norm=3.73983077822; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddcaddddddddddddcdd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~wt}}~~~~~{~~~~~~~~~~~~~~~b~~~~~~bd`ddddcddddddcddddd
+@HELIUM_000100422_612GNAAXX:7:7:17828:13825#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=29a_F260619; experiment=wolf_diet; forward_tag=gcctcct; reverse_tag=gcctcct; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=56; sminR=40.0; seq_b_mismatch=3; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=1; mid_quality=77.5223880597; seq_a_deletion=0; seq_b_single=46; score=187.930205125; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=76.1558441558; sminL=40.0; seq_a_single=46; score_norm=3.03113234072; seq_b_insertion=1; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dddbddddddddacbaa[b~b~~~~~~~~~~~~~a~~~~~~~~~~~~b~~~~~~~~~~~b~~~~~~~b}~~~~~~~~~~~_ddddddddddddccdddcd
+@HELIUM_000100422_612GNAAXX:7:53:2128:13141#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=15a_F730814; experiment=wolf_diet; forward_tag=gaagtag; reverse_tag=gaagtag; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=62; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.947761194; seq_a_deletion=0; seq_b_single=46; score=247.978630411; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=66.9; avg_quality=77.3896103896; sminL=40.0; seq_a_single=46; score_norm=3.99965532921; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddddddddddddddd^dad~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddcddddddddddcddddd
+@HELIUM_000100422_612GNAAXX:7:72:7057:20448#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=13a_F730603; experiment=wolf_diet; forward_tag=aattaac; reverse_tag=aattaac; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=62; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.0298507463; seq_a_deletion=0; seq_b_single=46; score=247.94833093; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=77.4675324675; sminL=40.0; seq_a_single=46; score_norm=3.9991666279; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dddeddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddddebdddd
+@HELIUM_000100422_612GNAAXX:7:10:9237:10532#0/2_CONS_SUB_SUB_CMP sample=29a_F260619; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gcctcct; reverse_tag=gcctcct; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=57; sminR=40.0; seq_b_mismatch=3; seq_a_mismatch=2; tail_quality=66.9; seq_b_deletion=0; mid_quality=75.9402985075; seq_a_deletion=0; seq_b_single=46; score=207.90944986; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=66.7; avg_quality=74.7532467532; sminL=40.0; seq_a_single=46; score_norm=3.35337822355; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaataattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+cSc`ddddddddddda_\`~~~~~~~~~~~~~~~~N~~\~~~~~~~~~~~~~~~Y~~jopppx|~|o~~~~~~b~~b~~~~ddddadddcadddada]V]
+@HELIUM_000100422_612GNAAXX:7:16:16055:12835#0/2_CONS_SUB_SUB_CMP sample=13a_F730603; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=aattaac; reverse_tag=aattaac; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=61; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.7462686567; seq_a_deletion=0; seq_b_single=46; score=239.868244499; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=77.2207792208; sminL=40.0; seq_a_single=46; score_norm=3.86884265322; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+db`dddcdddddddddddc~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~~~~dddddddddddddcddddd
+@HELIUM_000100422_612GNAAXX:7:17:16877:9760#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=29a_F260619; experiment=wolf_diet; forward_tag=gcctcct; reverse_tag=gcctcct; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=59; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=3; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.3731343284; seq_a_deletion=0; seq_b_single=46; score=223.899159093; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=76.8961038961; sminL=40.0; seq_a_single=46; score_norm=3.61127675956; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dddddddddddcddddddd~b~~~~~~~~~~~~~a~~~~~~b~~~{~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:47:8320:8571#0/2_CONS_SUB_SUB_CMP sample=26a_F040644; experiment=wolf_diet; seq_length=99; forward_score=72.0; forward_tag=gaatatc; reverse_tag=gaatatc; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=63; seq_ab_match=61; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.4586466165; seq_a_deletion=0; seq_b_single=45; score=235.809300513; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=66.9; avg_quality=76.954248366; sminL=40.0; seq_a_single=45; score_norm=3.74300477004; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+dddddddddddddddddd~~|~~~~~b~~~~~~~~~~~~~~~~~~~~~uuy~~~~~~~~~~~|~~~~~x~~~~~~~~~~b~daddddadddddd\ddda
+@HELIUM_000100422_612GNAAXX:7:6:6617:2744#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=61; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.7593984962; seq_a_deletion=0; seq_b_single=45; score=235.875132744; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.2222222222; sminL=40.0; seq_a_single=45; score_norm=3.7440497261; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+eddddd`ddddddddcbd~b~~~~b~~~~~~~~~~~~|~~~~~~~~y~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddddddddddddddcbdd
+@HELIUM_000100422_612GNAAXX:7:12:9609:14740#0/2_CONS_SUB_SUB_CMP sample=13a_F730603; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=aattaac; reverse_tag=aattaac; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=60; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=2; tail_quality=67.1; seq_b_deletion=0; mid_quality=78.4701492537; seq_a_deletion=0; seq_b_single=46; score=231.833538451; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.1; avg_quality=76.9935064935; sminL=40.0; seq_a_single=46; score_norm=3.73925062018; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dcddddddddddcdddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~zs~}~~~~~}~~~~~~~~~~~~~~~~~~b~~~bdddddddcdddddeddddd
+@HELIUM_000100422_612GNAAXX:7:21:2093:4412#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=60; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=3; tail_quality=67.0; seq_b_deletion=0; mid_quality=76.1428571429; seq_a_deletion=0; seq_b_single=45; score=227.763131817; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=74.9477124183; sminL=40.0; seq_a_single=45; score_norm=3.61528780662; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+eddddddddddddddddd~b~~~~~~~~~~~~~}~~`~~~~~~~~~~~~~Z{~~|{~~~~{~|~|~~~~~}~~~}|~~}}}DDDDDDDD``U`^\[ddd
+@HELIUM_000100422_612GNAAXX:7:18:5240:1587#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=13a_F730603; experiment=wolf_diet; forward_tag=aattaac; reverse_tag=aattaac; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=59; sminR=40.0; seq_b_mismatch=2; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.3880597015; seq_a_deletion=0; seq_b_single=46; score=223.905608015; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=76.9090909091; sminL=40.0; seq_a_single=46; score_norm=3.61138077443; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddddddddddddddddddd~}~~~~~~~~~~~~}~~~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~~~bdddddddedddddcddddd
+@HELIUM_000100422_612GNAAXX:7:88:15797:19191#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=13a_F730603; experiment=wolf_diet; forward_tag=aattaac; reverse_tag=aattaac; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=58; sminR=40.0; seq_b_mismatch=4; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.1492537313; seq_a_deletion=0; seq_b_single=46; score=215.88300628; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=76.7012987013; sminL=40.0; seq_a_single=46; score_norm=3.48198397226; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dddddddddddddddcddc~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~~~`~~~~b~~b~~~~ddeddddddddddcddddd
+@HELIUM_000100422_612GNAAXX:7:47:11864:1343#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=63; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.2857142857; seq_a_deletion=0; seq_b_single=45; score=251.976310174; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.6797385621; sminL=40.0; seq_a_single=45; score_norm=3.99962397102; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+ddddddddddddddbdcd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddcddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:43:8022:8427#0/2_CONS_SUB_SUB_CMP sample=13a_F730603; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=aattaac; reverse_tag=aattaac; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=60; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.5970149254; seq_a_deletion=0; seq_b_single=46; score=231.869859511; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=77.0909090909; sminL=40.0; seq_a_single=46; score_norm=3.73983644372; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dedcddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~~b~~~~dddddddddddddcddddd
+@HELIUM_000100422_612GNAAXX:7:95:11283:2557#0/2_CONS_SUB_SUB_CMP sample=29a_F260619; experiment=wolf_diet; seq_length=4; forward_score=72.0; forward_tag=gcctcct; reverse_tag=gcctcct; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=58; seq_ab_match=57; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=0; tail_quality=93.0; seq_b_deletion=50; mid_quality=92.2368421053; seq_a_deletion=50; seq_b_single=0; score=223.999078974; seq_a_insertion=0; mode=alignment; seq_length_ori=58; head_quality=93.0; avg_quality=92.5; sminL=40.0; seq_a_single=0; score_norm=3.86205308576; seq_b_insertion=0; 
+tttt
++
+~~~~
+@HELIUM_000100422_612GNAAXX:7:67:5288:13403#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=29a_F260619; experiment=wolf_diet; forward_tag=gcctcct; reverse_tag=gcctcct; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=62; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.0298507463; seq_a_deletion=0; seq_b_single=46; score=247.999078967; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.1; avg_quality=77.474025974; sminL=40.0; seq_a_single=46; score_norm=3.99998514464; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddddddddddcdddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddddeddddd
+@HELIUM_000100422_612GNAAXX:7:7:11998:4462#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=59; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=4; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.2105263158; seq_a_deletion=0; seq_b_single=45; score=219.864332815; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=76.7450980392; sminL=40.0; seq_a_single=45; score_norm=3.48991004469; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtagtactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+ddddddddddddddcddd~b~~~~~~~~~~~~b~~~~~~~b~~~~~~~G~}}~~}}~~~~~~~~~~~~~~~~~~~~~~~~~ddddddddddddcdccdd
+@HELIUM_000100422_612GNAAXX:7:116:12598:9964#0/2_CONS_SUB_SUB_CMP sample=13a_F730603; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=aattaac; reverse_tag=aattaac; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=53; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=8; tail_quality=66.7; seq_b_deletion=0; mid_quality=77.0671641791; seq_a_deletion=0; seq_b_single=46; score=175.843125508; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=75.7402597403; sminL=40.0; seq_a_single=46; score_norm=2.83617944368; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddddddcdddddddbddda`~~~~~~~~~~~~~~~~~~b~~~b~~~~b~~~~~b~b~{~~~~~~b~~~~~~~~~~~b~~~bddddddedddddddddddd
+@HELIUM_000100422_612GNAAXX:7:111:18277:17779#0/2_CONS_SUB_SUB_CMP sample=26a_F040644; experiment=wolf_diet; seq_length=99; forward_score=72.0; forward_tag=gaatatc; reverse_tag=gaatatc; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=63; seq_ab_match=61; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.8646616541; seq_a_deletion=0; seq_b_single=45; score=235.877819976; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.3137254902; sminL=40.0; seq_a_single=45; score_norm=3.74409238057; seq_b_insertion=0; 
+ttagccctaaacatagataattttacaacaaaataattcgccagaggactactagcaatagcctgaaactcaaaggacttggcggtgctttacatccct
++
+ddddddddddddbdddcd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~_~~~~~~~~~~~~b~~~~~dddddddedddddddddd
+@HELIUM_000100422_612GNAAXX:7:85:13257:14594#0/2_CONS_SUB_SUB_CMP sample=29a_F260619; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gcctcct; reverse_tag=gcctcct; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=60; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.5298507463; seq_a_deletion=0; seq_b_single=46; score=231.92296471; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=77.0324675325; sminL=40.0; seq_a_single=46; score_norm=3.7406929792; seq_b_insertion=0; 
+ttagccctaaacacaaataattacacaaacaaaattgttcaccagagtactagcggcaacagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddddddddedddddddddd~~~~~~~~~~~~~~~~~~~~~~~_~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~addccddadddddcaddddd
+@HELIUM_000100422_612GNAAXX:7:17:11935:17343#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=62; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.0902255639; seq_a_deletion=0; seq_b_single=45; score=243.983570342; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.5098039216; sminL=40.0; seq_a_single=45; score_norm=3.87275508479; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+dddddddddddddddddd~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:38:9654:18700#0/2_CONS_SUB_SUB_CMP sample=26a_F040644; experiment=wolf_diet; seq_length=99; forward_score=72.0; forward_tag=gaatatc; reverse_tag=gaatatc; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=63; seq_ab_match=62; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.0902255639; seq_a_deletion=0; seq_b_single=45; score=243.950053136; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.5098039216; sminL=40.0; seq_a_single=45; score_norm=3.87222306566; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+ddddddddddddddeddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~~~~~~~~~~~~~~~~~~~~~~~dcddddddddddcddddc
+@HELIUM_000100422_612GNAAXX:7:101:11720:19906#0/2_CONS_SUB_SUB_CMP sample=29a_F260619; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gcctcct; reverse_tag=gcctcct; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=57; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=4; tail_quality=66.9; seq_b_deletion=0; mid_quality=76.9104477612; seq_a_deletion=0; seq_b_single=46; score=207.841888471; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=75.6168831169; sminL=40.0; seq_a_single=46; score_norm=3.35228852373; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddc_ddddddcdddddd\d~~~~~~~~~~~~~~~~]~~|~hsp~~{~~z{t}~~qs}~b~~}~~~~}~x~~~~b~~c~~~_ddddcd^ccbbdd^ddddd
+@HELIUM_000100422_612GNAAXX:7:42:12961:8650#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=62; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.1052631579; seq_a_deletion=0; seq_b_single=45; score=243.985409859; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.522875817; sminL=40.0; seq_a_single=45; score_norm=3.87278428347; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+dddddddddddddddddd~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddcddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:36:10388:10324#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=15a_F730814; experiment=wolf_diet; forward_tag=gaagtag; reverse_tag=gaagtag; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=61; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.8208955224; seq_a_deletion=0; seq_b_single=46; score=239.950587748; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=77.2857142857; sminL=40.0; seq_a_single=46; score_norm=3.87017077012; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddddddddddddddddddd~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddddeddddd
+@HELIUM_000100422_612GNAAXX:7:66:11860:20419#0/2_CONS_SUB_SUB_CMP sample=29a_F260619; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gcctcct; reverse_tag=gcctcct; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=61; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=1; tail_quality=67.1; seq_b_deletion=0; mid_quality=78.5671641791; seq_a_deletion=0; seq_b_single=46; score=239.911387587; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.1; avg_quality=77.0779220779; sminL=40.0; seq_a_single=46; score_norm=3.86953850946; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddcdddddeddddddddad~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}~~~~~~~~~~~~~~~b~~~|ddcddddddddddNddddd
+@HELIUM_000100422_612GNAAXX:7:3:17077:6562#0/2_CONS_SUB_SUB_CMP sample=15a_F730814; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gaagtag; reverse_tag=gaagtag; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=59; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=3; tail_quality=66.6; seq_b_deletion=0; mid_quality=77.6567164179; seq_a_deletion=0; seq_b_single=46; score=223.876050008; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=66.0; avg_quality=76.1818181818; sminL=40.0; seq_a_single=46; score_norm=3.61090403239; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactgccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dddcdddddddddddadab~~~~~~~~~~~~~~~~~~~~~~~~~~~~zz~zF~a~~~~~~~}~~~~~~~~~~~~~~au~~~ccccccccccccacccccc
+@HELIUM_000100422_612GNAAXX:7:18:11865:6418#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=63; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.3157894737; seq_a_deletion=0; seq_b_single=45; score=251.959188225; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.7058823529; sminL=40.0; seq_a_single=45; score_norm=3.99935219405; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+dddddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddddddcdddeddddddd
+@HELIUM_000100422_612GNAAXX:7:19:4311:13343#0/2_CONS_SUB_SUB_CMP sample=26a_F040644; experiment=wolf_diet; seq_length=99; forward_score=72.0; forward_tag=gaatatc; reverse_tag=gaatatc; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=63; seq_ab_match=58; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=4; tail_quality=67.0; seq_b_deletion=0; mid_quality=77.7969924812; seq_a_deletion=0; seq_b_single=45; score=211.837822462; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=76.385620915; sminL=40.0; seq_a_single=45; score_norm=3.36250511845; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactacgagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+dbddcddddcdd^ddddd~~~~~~~~~~~~~b~~~~~~~~~~~~~~~~~~~{Z{~~~_~~y{~~~}~~~|~~~~~b~~~b~bcdddcdddddddddccc
+@HELIUM_000100422_612GNAAXX:7:30:1800:7833#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=15a_F730814; experiment=wolf_diet; forward_tag=gaagtag; reverse_tag=gaagtag; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=52; sminR=40.0; seq_b_mismatch=10; seq_a_mismatch=0; tail_quality=65.6; seq_b_deletion=0; mid_quality=59.9104477612; seq_a_deletion=0; seq_b_single=46; score=167.712615339; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=35.0; avg_quality=58.6623376623; sminL=40.0; seq_a_single=46; score_norm=2.70504218289; seq_b_insertion=0; 
+ttagccctaaacacaagacattaatataacgagattaatcgacagagtactaccggctatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+DDDDDDDDDDDDDDDDDDDccBccccccccBcBccccBBccBcccccccc~u~v}[wJ~~Q|~~~~~~~~~~~~a~~~~t~Z^ccc`c]bbc_[V_[`[`
+@HELIUM_000100422_612GNAAXX:7:16:19299:8684#0/2_CONS_SUB_SUB_CMP sample=15a_F730814; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gaagtag; reverse_tag=gaagtag; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=60; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.5; seq_a_deletion=0; seq_b_single=46; score=231.845804746; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=77.0064935065; sminL=40.0; seq_a_single=46; score_norm=3.73944846365; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+cdccddddeddddddadac~~~~~~~~~~~~~~~~~~~~~~~~|~~~~~~~~~~~~~~~~~~~~~~~~`~~~~~~~b~~~~dddddddddddddcddddd
+@HELIUM_000100422_612GNAAXX:7:54:14618:14353#0/2_CONS_SUB_SUB_CMP sample=13a_F730603; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=aattaac; reverse_tag=aattaac; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=61; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.6865671642; seq_a_deletion=0; seq_b_single=46; score=239.8562981; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=77.1688311688; sminL=40.0; seq_a_single=46; score_norm=3.86864996935; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddcedddddddddddddde~~~~~~~~~~~~~~~~~~~~~~~~~~~~~z}|z~~~~~y~~~~~~~~~~~~~~~~~~b~~~~ddddddcddddddcddddd
+@HELIUM_000100422_612GNAAXX:7:108:9222:18258#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=13a_F730603; experiment=wolf_diet; forward_tag=aattaac; reverse_tag=aattaac; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=60; sminR=40.0; seq_b_mismatch=2; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.5; seq_a_deletion=0; seq_b_single=46; score=231.857703869; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.2; avg_quality=77.0194805195; sminL=40.0; seq_a_single=46; score_norm=3.73964038498; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcagacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddccddddddddddddddd~~~~~~~~~~~~~~~~~~~v~~~~~}~}}~~~~~`~~~~~~~~~~b~~~~~~~~~~~~~~~~dcddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:74:4783:20479#0/2_CONS_SUB_SUB_CMP sample=29a_F260619; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gcctcct; reverse_tag=gcctcct; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=61; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=77.9029850746; seq_a_deletion=0; seq_b_single=46; score=239.87314657; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=76.487012987; sminL=40.0; seq_a_single=46; score_norm=3.86892171887; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dddaddddddbddddZd`d~b~~~~~~~~~~~~~~~~~}~~~~~~~~~~~~~~~|z~~~~~xq~~~}~r~~~~~~~~~~yqcbbddWdadddddWddcda
+@HELIUM_000100422_612GNAAXX:7:38:3005:20881#0/2_CONS_SUB_SUB_CMP sample=26a_F040644; experiment=wolf_diet; seq_length=99; forward_score=72.0; forward_tag=gaatatc; reverse_tag=gaatatc; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=63; seq_ab_match=60; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=3; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.5939849624; seq_a_deletion=0; seq_b_single=45; score=227.901935995; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.0784313725; sminL=40.0; seq_a_single=45; score_norm=3.61749104754; seq_b_insertion=0; 
+ttagccctaaacatgaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+ddddddddddddddaedd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~a~~~~~~~|~~~~~~b~~b~~}~~dbdddcdddddbdddddd
+@HELIUM_000100422_612GNAAXX:7:4:10139:2389#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=63; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=66.5; seq_b_deletion=0; mid_quality=78.4962406015; seq_a_deletion=0; seq_b_single=45; score=251.802206044; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=66.9; avg_quality=76.954248366; sminL=40.0; seq_a_single=45; score_norm=3.99686041339; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+daddaddddbdddddddc~~~~~~~~~{~~~~~~~~zxy~~|~~~~ru~~~~~~~~~~~~~~~~~~{~~p~~~~~~~~~~~ddddddddddabaP`ddd
+@HELIUM_000100422_612GNAAXX:7:75:9674:16966#0/2_CONS_SUB_SUB_CMP sample=29a_F260619; experiment=wolf_diet; seq_length=4; forward_score=72.0; forward_tag=gcctcct; reverse_tag=gcctcct; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=58; seq_ab_match=57; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=0; tail_quality=93.0; seq_b_deletion=50; mid_quality=92.2631578947; seq_a_deletion=50; seq_b_single=0; score=224.000075421; seq_a_insertion=0; mode=alignment; seq_length_ori=58; head_quality=93.0; avg_quality=92.5172413793; sminL=40.0; seq_a_single=0; score_norm=3.86207026589; seq_b_insertion=0; 
+tttt
++
+~~~~
+@HELIUM_000100422_612GNAAXX:7:59:15367:8376#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=15a_F730814; experiment=wolf_diet; forward_tag=gaagtag; reverse_tag=gaagtag; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=62; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.0149253731; seq_a_deletion=0; seq_b_single=46; score=247.996374666; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=77.4545454545; sminL=40.0; seq_a_single=46; score_norm=3.99994152687; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dddddddddddddddddad~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddddeddddd
+@HELIUM_000100422_612GNAAXX:7:29:1328:13185#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=59; sminR=40.0; seq_b_mismatch=4; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.3007518797; seq_a_deletion=0; seq_b_single=45; score=223.94591652; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=76.8235294118; sminL=40.0; seq_a_single=45; score_norm=3.55469708763; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+dddddddddddddedadd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~W[~~~~~~~~~~~~~~~~~~~~~~~b~~~b~dddcdddddddcdddddd
+@HELIUM_000100422_612GNAAXX:7:30:16081:4486#0/2_CONS_SUB_SUB_CMP sample=26a_F040644; experiment=wolf_diet; seq_length=99; forward_score=72.0; forward_tag=gaatatc; reverse_tag=gaatatc; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=63; seq_ab_match=62; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.0902255639; seq_a_deletion=0; seq_b_single=45; score=243.950667893; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.5098039216; sminL=40.0; seq_a_single=45; score_norm=3.87223282369; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+dddaddddddddddeddd~~~c~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddddddcddddddddddd
+@HELIUM_000100422_612GNAAXX:7:104:10274:7999#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=63; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.2556390977; seq_a_deletion=0; seq_b_single=45; score=251.962499638; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=66.9; avg_quality=77.6470588235; sminL=40.0; seq_a_single=45; score_norm=3.99940475616; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+ccdddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddd^ddddddddddd
+@HELIUM_000100422_612GNAAXX:7:14:7706:12338#0/2_CONS_SUB_SUB_CMP sample=15a_F730814; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gaagtag; reverse_tag=gaagtag; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=59; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=77.6194029851; seq_a_deletion=0; seq_b_single=46; score=223.864093999; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=66.7; avg_quality=76.2207792208; sminL=40.0; seq_a_single=46; score_norm=3.61071119354; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dddadddcddddddddc^d~~~~~~~~~~~~~~~~~~~P~~~~~~~~~}}~vm~qZyw~~~~x~~~~~~~~~~~b~~~~~~dddddaccdddddcddddd
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/output_ngsfilter_error_3.fastq	Wed Apr 12 17:38:00 2017 -0400
@@ -0,0 +1,952 @@
+@HELIUM_000100422_612GNAAXX:7:119:14871:19157#0/2_CONS_SUB_SUB_CMP sample=29a_F260619; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gcctcct; reverse_tag=gcctcct; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=47; sminR=40.0; seq_b_mismatch=13; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=1; mid_quality=69.1492537313; seq_a_deletion=0; seq_b_single=46; score=115.761290673; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=68.8701298701; sminL=40.0; seq_a_single=46; score_norm=1.86711759151; seq_b_insertion=1; 
+ttagccctaaacacaagtaattattataacaaaatcattcgccagagtactaccggcaatagctcaaaactcaaaggacttggcggtgctttataccctt
++
+cacdddddddddddddc\d~b~~~b~~~~~~b`ryK~|uxyXk`}~ccBBccBcccBcBcccBcBccccccc~~~~b|~~xdbaddaaWcccdaadddda
+@HELIUM_000100422_612GNAAXX:7:108:5640:3823#0/2_CONS_SUB_SUB_CMP sample=29a_F260619; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gcctcct; reverse_tag=gcctcct; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=60; sminR=40.0; seq_b_mismatch=2; seq_a_mismatch=0; tail_quality=66.9; seq_b_deletion=0; mid_quality=78.447761194; seq_a_deletion=0; seq_b_single=46; score=231.881364714; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=76.9545454545; sminL=40.0; seq_a_single=46; score_norm=3.74002201152; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattgttcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dddcdddddcddddddd]d~b~~~~~~~~~~~~~Z~~~~~~~~~~~~~~~~~~~~~~~~~~~}~~~~~~~~~~~~~~~~~~ddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:97:14311:19299#0/2_CONS_SUB_SUB_CMP sample=29a_F260619; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gcctcct; reverse_tag=gcctcct; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=52; sminR=40.0; seq_b_mismatch=5; seq_a_mismatch=5; tail_quality=67.0; seq_b_deletion=0; mid_quality=75.0820895522; seq_a_deletion=0; seq_b_single=46; score=167.91734192; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=66.6; avg_quality=74.0064935065; sminL=40.0; seq_a_single=46; score_norm=2.70834422451; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaagagcttaaaactcaaaggacttggcggtgctttataccctt
++
+d`cdddddcd`ddddaa\b~`~~~~~~~~b~~~~]~b~V~~~~~~~~~~~~~~~~`~~^Zs~r|~~~st~|z|v||^~~|TY``accL]`\`daZddddd
+@HELIUM_000100422_612GNAAXX:7:22:8540:14708#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=29a_F260619; experiment=wolf_diet; forward_tag=gcctcct; reverse_tag=gcctcct; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=59; sminR=40.0; seq_b_mismatch=3; seq_a_mismatch=0; tail_quality=66.9; seq_b_deletion=0; mid_quality=78.2537313433; seq_a_deletion=0; seq_b_single=46; score=223.982011431; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.1; avg_quality=76.7922077922; sminL=40.0; seq_a_single=46; score_norm=3.61261308759; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+addbddddddddddddedd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~b~~~~~~~~b~~~~ddddddddddabbb^bddd
+@HELIUM_000100422_612GNAAXX:7:57:18459:16145#0/2_CONS_SUB_SUB_CMP sample=26a_F040644; experiment=wolf_diet; seq_length=99; forward_score=72.0; forward_tag=gaatatc; reverse_tag=gaatatc; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=63; seq_ab_match=60; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=3; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.6917293233; seq_a_deletion=0; seq_b_single=45; score=227.883189945; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=66.9; avg_quality=77.1568627451; sminL=40.0; seq_a_single=45; score_norm=3.61719349119; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+dddddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~c~~~~~~~~~~~~~~b~~~~~~b~dddddcdddddddddddd
+@HELIUM_000100422_612GNAAXX:7:89:10281:5930#0/2_CONS_SUB_SUB_CMP sample=29a_F260619; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gcctcct; reverse_tag=gcctcct; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=60; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.5373134328; seq_a_deletion=0; seq_b_single=46; score=231.893859399; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=77.038961039; sminL=40.0; seq_a_single=46; score_norm=3.7402235387; seq_b_insertion=0; 
+ttagccctaaacacaaataattacacaaacaaaattgttcaccagagtactagcggcaacagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dddddddcddddddcdddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~~~bddddddceddedd\ddddd
+@HELIUM_000100422_612GNAAXX:7:29:15520:18035#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=29a_F260619; experiment=wolf_diet; forward_tag=gcctcct; reverse_tag=gcctcct; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=61; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=77.828358209; seq_a_deletion=0; seq_b_single=46; score=239.965360923; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=65.6; avg_quality=76.3311688312; sminL=40.0; seq_a_single=46; score_norm=3.87040904714; seq_b_insertion=0; 
+ttagccctaaacacaagtaattattataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+__`_Y_`_a_`cc_ccccc~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~~~~~~~ddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:6:9274:14951#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=13a_F730603; experiment=wolf_diet; forward_tag=aattaac; reverse_tag=aattaac; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=59; sminR=40.0; seq_b_mismatch=2; seq_a_mismatch=1; tail_quality=67.1; seq_b_deletion=0; mid_quality=78.2089552239; seq_a_deletion=0; seq_b_single=46; score=223.791171196; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=66.9; avg_quality=76.7532467532; sminL=40.0; seq_a_single=46; score_norm=3.60953501929; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dddcddddddddddddddd~~~~~~~~~~~~~~~~~~|z~}a|~~~~}}}}~~~~~~~~~~}~}b~b~~~~~~~~~~~~~~ddddddcdcddcd^ddddd
+@HELIUM_000100422_612GNAAXX:7:111:2893:6772#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=29a_F260619; experiment=wolf_diet; forward_tag=gcctcct; reverse_tag=gcctcct; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=61; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.7164179104; seq_a_deletion=0; seq_b_single=46; score=239.959941063; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=77.1948051948; sminL=40.0; seq_a_single=46; score_norm=3.87032163005; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddddddddedddddded_d~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~x~dddddddcdddcdcdddad
+@HELIUM_000100422_612GNAAXX:7:89:10621:20317#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=29a_F260619; experiment=wolf_diet; forward_tag=gcctcct; reverse_tag=gcctcct; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=59; sminR=40.0; seq_b_mismatch=3; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=77.5820895522; seq_a_deletion=0; seq_b_single=46; score=223.827654468; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=76.2077922078; sminL=40.0; seq_a_single=46; score_norm=3.61012345916; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dd`ddddadadddddddRc~}~~z~~~~~~~t~sw}~~g}~~~~~~~~~~~~~~~~~~~~~~~~~~~~^~b`~~~~~~~~~ddddddddbdbdd_dddad
+@HELIUM_000100422_612GNAAXX:7:50:2791:11138#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=29a_F260619; experiment=wolf_diet; forward_tag=gcctcct; reverse_tag=gcctcct; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=60; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.3805970149; seq_a_deletion=0; seq_b_single=46; score=231.976017167; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=66.9; avg_quality=76.8961038961; sminL=40.0; seq_a_single=46; score_norm=3.74154866398; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dbdbdddddddc\ddddbd~~~~~~~~~~~~~~~~~~b~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddddbddddd
+@HELIUM_000100422_612GNAAXX:7:108:17701:18887#0/2_CONS_SUB_SUB_CMP sample=15a_F730814; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gaagtag; reverse_tag=gaagtag; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=58; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=4; tail_quality=66.9; seq_b_deletion=0; mid_quality=77.6492537313; seq_a_deletion=0; seq_b_single=46; score=215.828321765; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=66.1; avg_quality=76.2012987013; sminL=40.0; seq_a_single=46; score_norm=3.48110196396; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddec`dddddddddddc^c~~~~~~~~~~~~~~xss~~~~~~~~~~~|{|z{~~{~~~b~~~~~b~~~~~~~~~~~b~~~bdddddd\ddddddcddddd
+@HELIUM_000100422_612GNAAXX:7:97:10414:9929#0/2_CONS_SUB_SUB_CMP sample=13a_F730603; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=aattaac; reverse_tag=aattaac; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=61; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.8134328358; seq_a_deletion=0; seq_b_single=46; score=239.864541102; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=77.2792207792; sminL=40.0; seq_a_single=46; score_norm=3.86878292101; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddddddddddddddedddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~~~~ddddddcddddddcddddd
+@HELIUM_000100422_612GNAAXX:7:97:9091:15775#0/2_CONS_SUB_SUB_CMP sample=13a_F730603; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=aattaac; reverse_tag=aattaac; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=59; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=3; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.276119403; seq_a_deletion=0; seq_b_single=46; score=223.861916171; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=76.8116883117; sminL=40.0; seq_a_single=46; score_norm=3.61067606728; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dcdaddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~x~~~~~~~~~|~~~~~~~b~~~~~~^~~b~~~~dddddddddddddcddddd
+@HELIUM_000100422_612GNAAXX:7:74:8683:20738#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=62; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.0977443609; seq_a_deletion=0; seq_b_single=45; score=243.961428864; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.5163398693; sminL=40.0; seq_a_single=45; score_norm=3.87240363276; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+dddddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~`~~~~~~~~~~~~~~ddeddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:24:16230:12703#0/2_CONS_SUB_SUB_CMP sample=15a_F730814; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gaagtag; reverse_tag=gaagtag; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=59; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=77.4552238806; seq_a_deletion=0; seq_b_single=46; score=223.86908915; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=66.3; avg_quality=76.0519480519; sminL=40.0; seq_a_single=46; score_norm=3.61079176049; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatcccctt
++
+bdd_ddddaddcbdcdd^b~~~~~b~~~~~~~~~~~~~~~~~~~~~~~~u~y~~~~~~a~~~~~~~~~~~~~~~~{bs~}}a`ddd`a_ddd``Ob`cdd
+@HELIUM_000100422_612GNAAXX:7:4:4214:9434#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=13a_F730603; experiment=wolf_diet; forward_tag=aattaac; reverse_tag=aattaac; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=58; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=3; tail_quality=63.3; seq_b_deletion=0; mid_quality=76.2388059701; seq_a_deletion=0; seq_b_single=46; score=215.812703412; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=65.3; avg_quality=74.6883116883; sminL=40.0; seq_a_single=46; score_norm=3.48085005502; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactacaggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dddbdddddcddddddddd~^~~~{~{~~~~~}~~{~~ym~L||~~wuy~zyxPzjyyvxku~~~~~~~~~~~~~~~~~xbacdddddaddac_^`_`dc
+@HELIUM_000100422_612GNAAXX:7:12:17693:3451#0/2_CONS_SUB_SUB_CMP sample=13a_F730603; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=aattaac; reverse_tag=aattaac; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=62; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.8507462687; seq_a_deletion=0; seq_b_single=46; score=247.862243; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=77.3116883117; sminL=40.0; seq_a_single=46; score_norm=3.9977781129; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dedcddddddddddedddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}v{}~{~}~~~~~~~~~~~~~~~~~~~~~~~~~cdddddcddddddaddddd
+@HELIUM_000100422_612GNAAXX:7:3:14624:12375#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=61; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.7669172932; seq_a_deletion=0; seq_b_single=45; score=235.922125108; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.2287581699; sminL=40.0; seq_a_single=45; score_norm=3.74479563663; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+dcdcdddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~Y`~~~~~~~~~~~~~~~~~~~~~~~dddddcdddddddceddd
+@HELIUM_000100422_612GNAAXX:7:18:5317:11571#0/2_CONS_SUB_SUB_CMP sample=13a_F730603; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=aattaac; reverse_tag=aattaac; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=61; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.7462686567; seq_a_deletion=0; seq_b_single=46; score=239.862078449; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=77.2207792208; sminL=40.0; seq_a_single=46; score_norm=3.86874320079; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddddddddddddddeddde~~~~~~~~~~~~~~~~~~~~~~~~~~~~y~~~~~~~~~~~~~~~~~{~~~~~~~~~~b~~~~dddddcdddddddaddddd
+@HELIUM_000100422_612GNAAXX:7:109:17335:11429#0/2_CONS_SUB_SUB_CMP sample=26a_F040644; experiment=wolf_diet; seq_length=99; forward_score=72.0; forward_tag=gaatatc; reverse_tag=gaatatc; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=63; seq_ab_match=56; sminR=40.0; seq_b_mismatch=6; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=73.1278195489; seq_a_deletion=0; seq_b_single=45; score=195.716358124; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=66.9; avg_quality=72.3202614379; sminL=40.0; seq_a_single=45; score_norm=3.10660885911; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+dddcdaddddddddcdbd~b~~~~~~~~~|~``}~\`~|[~ccccccccccccccccc~z~~s~x~~~~~}~~}}W~~}x~ddddc]``]\Rd`ddb`^
+@HELIUM_000100422_612GNAAXX:7:7:10646:8487#0/2_CONS_SUB_SUB_CMP sample=13a_F730603; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=aattaac; reverse_tag=aattaac; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=60; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=77.671641791; seq_a_deletion=0; seq_b_single=46; score=231.85443709; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=76.2857142857; sminL=40.0; seq_a_single=46; score_norm=3.739587695; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dccdddddddddddddddec~~~~~~~~~~~~~~~~~~~~~~~~~~~{vztippoph~~~~~~~b~~~~~~~~~~~~~~~~ddddddddddddddddddc
+@HELIUM_000100422_612GNAAXX:7:19:4865:20715#0/2_CONS_SUB_SUB_CMP sample=13a_F730603; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=aattaac; reverse_tag=aattaac; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=60; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.5074626866; seq_a_deletion=0; seq_b_single=46; score=231.923942025; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=77.012987013; sminL=40.0; seq_a_single=46; score_norm=3.74070874234; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddcbddddddddddddddb~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~~~~ybddddddddddcddadddcd
+@HELIUM_000100422_612GNAAXX:7:13:6954:13039#0/2_CONS_SUB_SUB_CMP sample=26a_F040644; experiment=wolf_diet; seq_length=99; forward_score=72.0; forward_tag=gaatatc; reverse_tag=gaatatc; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=63; seq_ab_match=62; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.0; seq_a_deletion=0; seq_b_single=45; score=243.872474161; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.431372549; sminL=40.0; seq_a_single=45; score_norm=3.87099165336; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagaggactactagcaatagcttaaaactcaaaggacttggcggtgctttatatccct
++
+dddcdddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~r~~~~~~~~~~~~~~~~~~~~~~~b~~~~~dddddddddddddcdddd
+@HELIUM_000100422_612GNAAXX:7:120:14963:1929#0/2_CONS_SUB_SUB_CMP sample=15a_F730814; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gaagtag; reverse_tag=gaagtag; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=59; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.1492537313; seq_a_deletion=0; seq_b_single=46; score=223.810433242; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=76.7012987013; sminL=40.0; seq_a_single=46; score_norm=3.60984569745; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dddadddddddedddddbd~b~~}~~~~~~~~~~~~~~~~u~~|~~}~~}~~~}z`}}~~~}~~~~~~~~~~~~~~_~~~~dddddddddddddcddddd
+@HELIUM_000100422_612GNAAXX:7:115:3921:10649#0/2_CONS_SUB_SUB_CMP sample=26a_F040644; experiment=wolf_diet; seq_length=99; forward_score=72.0; forward_tag=gaatatc; reverse_tag=gaatatc; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=63; seq_ab_match=61; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.5864661654; seq_a_deletion=0; seq_b_single=45; score=235.871015095; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.0718954248; sminL=40.0; seq_a_single=45; score_norm=3.74398436659; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+ddedddddddddcddddd~~~~~~~~~~~~~b~~~~~~~~~~~~~~~~~}~}~n{~i~~~~~~~~~~~~~~~~~~~~~~b~dddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:109:12848:8882#0/2_CONS_SUB_SUB_CMP sample=15a_F730814; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gaagtag; reverse_tag=gaagtag; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=60; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.3805970149; seq_a_deletion=0; seq_b_single=46; score=231.869965661; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=76.9025974026; sminL=40.0; seq_a_single=46; score_norm=3.73983815582; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddeedddddddddddcd`d~~~~~~~~~~~~~~~~~~~~~~~~~~~~~{~~x~b~~~}~~~~~~~~~~~~~~~~~~~~~~bdcdddddddddddTddddd
+@HELIUM_000100422_612GNAAXX:7:84:11257:18886#0/2_CONS_SUB_SUB_CMP sample=26a_F040644; experiment=wolf_diet; seq_length=99; forward_score=72.0; forward_tag=gaatatc; reverse_tag=gaatatc; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=63; seq_ab_match=55; sminR=40.0; seq_b_mismatch=8; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=77.1804511278; seq_a_deletion=0; seq_b_single=45; score=187.890540948; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=75.8496732026; sminL=40.0; seq_a_single=45; score_norm=2.98238953885; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+dddcdddddddddddddd~b~a~~b~~~~b~~~~~~{b~|a~~`\}s~y~~~~~~t~~~~~~~~~~~~~~~~~~~~x~~t~dddddddddddddddddc
+@HELIUM_000100422_612GNAAXX:7:72:13060:5051#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=29a_F260619; experiment=wolf_diet; forward_tag=gcctcct; reverse_tag=gcctcct; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=61; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.671641791; seq_a_deletion=0; seq_b_single=46; score=239.985823237; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=66.8; avg_quality=77.1428571429; sminL=40.0; seq_a_single=46; score_norm=3.87073908447; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddddddddddddddddd_b~~~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddddeddddd
+@HELIUM_000100422_612GNAAXX:7:35:3798:1896#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=15a_F730814; experiment=wolf_diet; forward_tag=gaagtag; reverse_tag=gaagtag; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=61; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=1; tail_quality=66.9; seq_b_deletion=0; mid_quality=78.4701492537; seq_a_deletion=0; seq_b_single=46; score=239.863223783; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=76.974025974; sminL=40.0; seq_a_single=46; score_norm=3.86876167392; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dddddddcddbddddddad~b~~}~~~~~~~~~~~~~~~~~n~~~~~|~}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddcddaddaddd^dddbc
+@HELIUM_000100422_612GNAAXX:7:117:12470:18434#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=59; sminR=40.0; seq_b_mismatch=4; seq_a_mismatch=0; tail_quality=66.9; seq_b_deletion=0; mid_quality=78.045112782; seq_a_deletion=0; seq_b_single=45; score=219.83660627; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=66.9; avg_quality=76.5882352941; sminL=40.0; seq_a_single=45; score_norm=3.4894699408; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+dddddddddcddddddcd~~~~~~~~~~~~~~~~~~~~~~~~~~~~O~~~~~~~~~{~~{~~Wx~~~~~~~~~~~b~~~b}ddabdddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:11:8428:13716#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=15a_F730814; experiment=wolf_diet; forward_tag=gaagtag; reverse_tag=gaagtag; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=61; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.7985074627; seq_a_deletion=0; seq_b_single=46; score=239.97387484; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=77.2662337662; sminL=40.0; seq_a_single=46; score_norm=3.87054636839; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dddddddddddddddddad~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:78:18994:16521#0/2_CONS_SUB_SUB_CMP sample=15a_F730814; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gaagtag; reverse_tag=gaagtag; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=61; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.6940298507; seq_a_deletion=0; seq_b_single=46; score=239.927346216; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=66.8; avg_quality=77.1623376623; sminL=40.0; seq_a_single=46; score_norm=3.86979590672; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+cddddddcdddddddddad~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~bddaddeeaddded`ddddb
+@HELIUM_000100422_612GNAAXX:7:16:5047:7843#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=63; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.3007518797; seq_a_deletion=0; seq_b_single=45; score=251.979285107; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.6928104575; sminL=40.0; seq_a_single=45; score_norm=3.99967119217; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+dedddbdddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddddddcdcddddddeec
+@HELIUM_000100422_612GNAAXX:7:118:13803:15594#0/2_CONS_SUB_SUB_CMP sample=26a_F040644; experiment=wolf_diet; seq_length=99; forward_score=72.0; forward_tag=gaatatc; reverse_tag=gaatatc; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=63; seq_ab_match=60; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.5112781955; seq_a_deletion=0; seq_b_single=45; score=227.87720055; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.0065359477; sminL=40.0; seq_a_single=45; score_norm=3.61709842144; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+edd^ddddbdddddeddd~~~~~~~~~~~~~~~~~~a~~~~~~~~~~~{~y~~~~~~~~~~v~~~~~~~~~~b~~b~~~~~dddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:53:14379:5922#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=29a_F260619; experiment=wolf_diet; forward_tag=gcctcct; reverse_tag=gcctcct; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=62; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.0; seq_a_deletion=0; seq_b_single=46; score=247.982071703; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=66.9; avg_quality=77.4350649351; sminL=40.0; seq_a_single=46; score_norm=3.99971083392; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddddddddddddddddd`d~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddddeddddd
+@HELIUM_000100422_612GNAAXX:7:52:10700:16508#0/2_CONS_SUB_SUB_CMP sample=15a_F730814; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gaagtag; reverse_tag=gaagtag; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=61; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=1; tail_quality=64.5; seq_b_deletion=0; mid_quality=77.8805970149; seq_a_deletion=0; seq_b_single=46; score=239.790995416; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=76.3051948052; sminL=40.0; seq_a_single=46; score_norm=3.86759670025; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+c^ccccccccccacccccc~~~~~~~~~~~~~~{{~~v~~~~~~~~~~~~~~~~}}}~~~~~{~~~~|v|||~}~~~u~~bddddcdbdddbddIddddd
+@HELIUM_000100422_612GNAAXX:7:69:7696:12881#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=63; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.3082706767; seq_a_deletion=0; seq_b_single=45; score=251.983052061; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.6993464052; sminL=40.0; seq_a_single=45; score_norm=3.99973098509; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+eddddddcdddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddddddddddddddcddd
+@HELIUM_000100422_612GNAAXX:7:44:12484:5320#0/2_CONS_SUB_SUB_CMP sample=13a_F730603; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=aattaac; reverse_tag=aattaac; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=60; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=2; tail_quality=67.1; seq_b_deletion=0; mid_quality=78.5149253731; seq_a_deletion=0; seq_b_single=46; score=231.837799589; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=66.7; avg_quality=77.0064935065; sminL=40.0; seq_a_single=46; score_norm=3.73931934821; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+deddddddddddddddddc~~~~~~~~~~~~~~~~~~~}}}z~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~~~adcddddadddddddddddd
+@HELIUM_000100422_612GNAAXX:7:21:4713:10229#0/2_CONS_SUB_SUB_CMP sample=13a_F730603; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=aattaac; reverse_tag=aattaac; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=61; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.7313432836; seq_a_deletion=0; seq_b_single=46; score=239.864510201; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=77.2077922078; sminL=40.0; seq_a_single=46; score_norm=3.86878242259; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dcdbddddddddcdddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~|~~~~~~~~~~~~~~~~~~~b~~~~~~~~~~~~~~ddddddddddddd`ddddb
+@HELIUM_000100422_612GNAAXX:7:38:6201:12003#0/2_CONS_SUB_SUB_CMP sample=26a_F040644; experiment=wolf_diet; seq_length=99; forward_score=72.0; forward_tag=gaatatc; reverse_tag=gaatatc; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=63; seq_ab_match=59; sminR=40.0; seq_b_mismatch=4; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=67.7443609023; seq_a_deletion=0; seq_b_single=45; score=219.686655506; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=63.2; avg_quality=67.3986928105; sminL=40.0; seq_a_single=45; score_norm=3.48708976993; seq_b_insertion=0; 
+ttagccctaaacatagataattttacaacaaaataattcgccagaggactactagcaatagcttaaaactcaaagaactgggcggtgctttatatcccg
++
+dbddcddcddd[dddddc~~~~b~~~~~~~t~}{axzyz{||zzwzr~y}}}}}z~x~cccccccccccccccccBcccBcDDDDDDDDDDDDDDDDaH
+@HELIUM_000100422_612GNAAXX:7:33:16506:1490#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=13a_F730603; experiment=wolf_diet; forward_tag=aattaac; reverse_tag=aattaac; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=62; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.2; seq_b_deletion=0; mid_quality=79.0373134328; seq_a_deletion=0; seq_b_single=46; score=247.963002972; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.1; avg_quality=77.4935064935; sminL=40.0; seq_a_single=46; score_norm=3.99940327375; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddddddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddddeddddd
+@HELIUM_000100422_612GNAAXX:7:32:4360:3451#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=13a_F730603; experiment=wolf_diet; forward_tag=aattaac; reverse_tag=aattaac; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=61; seq_ab_match=61; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.7703703704; seq_a_deletion=0; seq_b_single=47; score=243.999335649; seq_a_insertion=0; mode=alignment; seq_length_ori=155; head_quality=67.0; avg_quality=77.2516129032; sminL=40.0; seq_a_single=47; score_norm=3.999989109; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dddddddddddddddddde~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddeddddddddddeedddd
+@HELIUM_000100422_612GNAAXX:7:115:17402:4174#0/2_CONS_SUB_SUB_CMP sample=29a_F260619; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gcctcct; reverse_tag=gcctcct; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=59; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=3; tail_quality=67.1; seq_b_deletion=0; mid_quality=77.9402985075; seq_a_deletion=0; seq_b_single=46; score=223.877240886; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=76.525974026; sminL=40.0; seq_a_single=46; score_norm=3.6109232401; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactacctgcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+edddddccddddedcdd]d~~~~~~~~~~~~~~~~~~~~~~~~~~~~~s~|y~vS~~~~~~{~~~~~~~~~~~~~~b~~~bdddddddddddddcddddd
+@HELIUM_000100422_612GNAAXX:7:45:6831:6228#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=13a_F730603; experiment=wolf_diet; forward_tag=aattaac; reverse_tag=aattaac; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=62; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.0298507463; seq_a_deletion=0; seq_b_single=46; score=247.974637619; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=77.4675324675; sminL=40.0; seq_a_single=46; score_norm=3.99959092934; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dddcddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddddeddddd
+@HELIUM_000100422_612GNAAXX:7:117:4291:18111#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=62; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.0827067669; seq_a_deletion=0; seq_b_single=45; score=243.911625561; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.5032679739; sminL=40.0; seq_a_single=45; score_norm=3.87161310415; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+ddddddddaddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~~~~~dddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:71:14800:3222#0/2_CONS_SUB_SUB_CMP sample=29a_F260619; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gcctcct; reverse_tag=gcctcct; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=60; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.5597014925; seq_a_deletion=0; seq_b_single=46; score=231.89389474; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=77.0584415584; sminL=40.0; seq_a_single=46; score_norm=3.74022410871; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dddddddeeddddddddcd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}~~~\~~~~~~~~~~~~~~~~~b~~~~ddddddccdddddcdddde
+@HELIUM_000100422_612GNAAXX:7:11:8547:18238#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=63; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.2932330827; seq_a_deletion=0; seq_b_single=45; score=251.984413754; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.6862745098; sminL=40.0; seq_a_single=45; score_norm=3.99975259927; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+dbdcdddddddddcdddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:117:2416:10342#0/2_CONS_SUB_SUB_CMP sample=26a_F040644; experiment=wolf_diet; seq_length=99; forward_score=72.0; forward_tag=gaatatc; reverse_tag=gaatatc; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=63; seq_ab_match=61; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.2781954887; seq_a_deletion=0; seq_b_single=45; score=235.921215944; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=76.8039215686; sminL=40.0; seq_a_single=45; score_norm=3.74478120546; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+d^dUYZ[Yddddcdcddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}~~~~~b|~~b~dddddbddddbddddddd
+@HELIUM_000100422_612GNAAXX:7:78:7151:19928#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=56; sminR=40.0; seq_b_mismatch=7; seq_a_mismatch=0; tail_quality=47.6; seq_b_deletion=0; mid_quality=58.2105263158; seq_a_deletion=0; seq_b_single=45; score=195.576462373; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=52.9; avg_quality=57.1699346405; sminL=40.0; seq_a_single=45; score_norm=3.10438829164; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacgagaatgttcgccagtgtacttctagcaacaggctgaaactcaaaggacttggcggtggtttacatccct
++
+WSR]YbbbDDDDDDDDDDcccccccccccBBcccccccccccccBcccccBccccccccccBccccccccccBccccc~`~WNS]Y_KTUVZ[O_SHW]
+@HELIUM_000100422_612GNAAXX:7:71:18821:20471#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=13a_F730603; experiment=wolf_diet; forward_tag=aattaac; reverse_tag=aattaac; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=53; sminR=40.0; seq_b_mismatch=2; seq_a_mismatch=7; tail_quality=66.9; seq_b_deletion=0; mid_quality=75.9029850746; seq_a_deletion=0; seq_b_single=46; score=175.889514148; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=74.7402597403; sminL=40.0; seq_a_single=46; score_norm=2.83692764755; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dd\ddddddddd^ddd`dd~~~~Xx~~~~~{|q}}x}^Y`J`~Xv{wt~~~~~~~~~~~~~~~~~~~~~~~~~b~~~~~sbddddddddddddd^bdccd
+@HELIUM_000100422_612GNAAXX:7:58:15837:8531#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=63; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.2857142857; seq_a_deletion=0; seq_b_single=45; score=251.96128051; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.6797385621; sminL=40.0; seq_a_single=45; score_norm=3.99938540492; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+dddbdddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddddddddddddcddddd
+@HELIUM_000100422_612GNAAXX:7:38:10813:16867#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=63; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.2406015038; seq_a_deletion=0; seq_b_single=45; score=251.97777927; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.6405228758; sminL=40.0; seq_a_single=45; score_norm=3.99964729; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgtttgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+ddddddddeddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dbcdddddadadcddddd
+@HELIUM_000100422_612GNAAXX:7:68:19115:18847#0/2_CONS_SUB_SUB_CMP sample=29a_F260619; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gcctcct; reverse_tag=gcctcct; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=54; sminR=40.0; seq_b_mismatch=2; seq_a_mismatch=6; tail_quality=66.6; seq_b_deletion=0; mid_quality=76.0074626866; seq_a_deletion=0; seq_b_single=46; score=183.856571062; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=66.7; avg_quality=74.7922077922; sminL=40.0; seq_a_single=46; score_norm=2.96542856552; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddecdd_ddcdd_dd^ddd~`~~~~~b~~~~~~~~~~~}~~{b~~~~~~~{~~_~~~s~~s~~~~x~~\\~~~~~~b~~{bd`dcc`P^bb^dbaaaddb
+@HELIUM_000100422_612GNAAXX:7:14:3978:11028#0/2_CONS_SUB_SUB_CMP sample=15a_F730814; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gaagtag; reverse_tag=gaagtag; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=60; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=77.9029850746; seq_a_deletion=0; seq_b_single=46; score=231.869517243; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=66.8; avg_quality=76.474025974; sminL=40.0; seq_a_single=46; score_norm=3.73983092328; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactacctgcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddeadbdcddddeddd`ad~~~~~~~~~~~~~~~~~~~~~~~~~~~~~w|{u~|J~y~~~v~~~~~~~~~~~~~~~~~~~_dddddddddddbbZ`bcdd
+@HELIUM_000100422_612GNAAXX:7:34:18733:3827#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=62; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.1052631579; seq_a_deletion=0; seq_b_single=45; score=243.983236898; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.522875817; sminL=40.0; seq_a_single=45; score_norm=3.87274979204; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+dddddddddddddddddd~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:65:6787:8456#0/2_CONS_SUB_SUB_CMP sample=15a_F730814; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gaagtag; reverse_tag=gaagtag; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=60; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.5895522388; seq_a_deletion=0; seq_b_single=46; score=231.869006954; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=66.8; avg_quality=77.0714285714; sminL=40.0; seq_a_single=46; score_norm=3.7398226928; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dddddddcddddddedd_d~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~~~bddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:111:7441:14688#0/2_CONS_SUB_SUB_CMP sample=26a_F040644; experiment=wolf_diet; seq_length=99; forward_score=72.0; forward_tag=gaatatc; reverse_tag=gaatatc; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=63; seq_ab_match=62; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.015037594; seq_a_deletion=0; seq_b_single=45; score=243.832560428; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.4444444444; sminL=40.0; seq_a_single=45; score_norm=3.87035810203; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+dddadddddddddedddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}~~~~~~~~~~~~~~~~~~u~~~~~b~~~~~dddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:86:10092:15563#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=29a_F260619; experiment=wolf_diet; forward_tag=gcctcct; reverse_tag=gcctcct; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=59; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=2; tail_quality=66.8; seq_b_deletion=0; mid_quality=78.1940298507; seq_a_deletion=0; seq_b_single=46; score=223.927744132; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=66.6; avg_quality=76.7012987013; sminL=40.0; seq_a_single=46; score_norm=3.61173780858; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddbdddddccdddddaddd~b~~~~~~~~~~~~~_~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|bddddddddddcddcddd`^
+@HELIUM_000100422_612GNAAXX:7:16:4418:5128#0/2_CONS_SUB_SUB_CMP sample=13a_F730603; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=aattaac; reverse_tag=aattaac; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=59; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=3; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.3656716418; seq_a_deletion=0; seq_b_single=46; score=223.862543287; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=76.8896103896; sminL=40.0; seq_a_single=46; score_norm=3.61068618206; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dddeddddddddddddddb~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~{~~~~~~~~~~~~~~~b~~b~~~bdddeddbdddddddddddd
+@HELIUM_000100422_612GNAAXX:7:13:5742:9859#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=4; sample=29a_F260619; experiment=wolf_diet; forward_tag=gcctcct; reverse_tag=gcctcct; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=58; seq_ab_match=55; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=3; tail_quality=93.0; seq_b_deletion=50; mid_quality=91.4210526316; seq_a_deletion=50; seq_b_single=0; score=207.846895043; seq_a_insertion=0; mode=alignment; seq_length_ori=58; head_quality=89.4; avg_quality=91.3448275862; sminL=40.0; seq_a_single=0; score_norm=3.58356715591; seq_b_insertion=0; 
+tttt
++
+~~~~
+@HELIUM_000100422_612GNAAXX:7:85:18986:17662#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=15a_F730814; experiment=wolf_diet; forward_tag=gaagtag; reverse_tag=gaagtag; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=60; sminR=40.0; seq_b_mismatch=2; seq_a_mismatch=0; tail_quality=67.1; seq_b_deletion=0; mid_quality=78.447761194; seq_a_deletion=0; seq_b_single=46; score=231.874929984; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=66.9; avg_quality=76.961038961; sminL=40.0; seq_a_single=46; score_norm=3.73991822554; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddddddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}~~s~~~~~b~~~~~~b~~~~~~~ddcddddddcddddddddd
+@HELIUM_000100422_612GNAAXX:7:16:16357:19948#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=57; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=5; tail_quality=66.7; seq_b_deletion=0; mid_quality=75.6541353383; seq_a_deletion=0; seq_b_single=45; score=203.860719115; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=62.0; avg_quality=74.1764705882; sminL=40.0; seq_a_single=45; score_norm=3.23588443039; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcacaggacttggcggtgctttacatccct
++
+dd_dbddbdaddbddddd~`~~b~~~~~~b~~{~~~}x}}~}`twyhw~~~~}w|~|~~~~~X~~~|~~~~~Y~~~~~~~~XVRSQ[Qadd``^P^adY
+@HELIUM_000100422_612GNAAXX:7:107:3570:18147#0/2_CONS_SUB_SUB_CMP sample=29a_F260619; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gcctcct; reverse_tag=gcctcct; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=60; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.0820895522; seq_a_deletion=0; seq_b_single=46; score=231.924768153; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=65.9; avg_quality=76.5714285714; sminL=40.0; seq_a_single=46; score_norm=3.74072206698; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcataaaactcaaaggacttggcggtgctttataccctt
++
+dddadddddcddddd\d\d~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}~~~~~~~~a~s~`ddcd_ddcddddd]ddc_b
+@HELIUM_000100422_612GNAAXX:7:82:8836:11354#0/2_CONS_SUB_SUB_CMP sample=13a_F730603; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=aattaac; reverse_tag=aattaac; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=60; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.2835820896; seq_a_deletion=0; seq_b_single=46; score=231.781218203; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=76.8181818182; sminL=40.0; seq_a_single=46; score_norm=3.73840674522; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddedddddddddddddddd~~~~~~{~~~~~~~~~~~~~~~~~~~~~~w{{k~~|~~~~~~~~~~~~~~~~~~~~~b~~~bddddddacdddddcdddda
+@HELIUM_000100422_612GNAAXX:7:41:2354:1449#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=55; sminR=40.0; seq_b_mismatch=3; seq_a_mismatch=5; tail_quality=66.4; seq_b_deletion=0; mid_quality=75.5789473684; seq_a_deletion=0; seq_b_single=45; score=187.777927438; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=66.6; avg_quality=74.3921568627; sminL=40.0; seq_a_single=45; score_norm=2.98060202283; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+daaddddddcddbcdddd~b}bb~b~~~b~q~~}~}~x~x~t~s~|k|~w~~z~~{|{~ccBc~~}~~~~~~a~~a~}p~~baceddbbedddda_aa_
+@HELIUM_000100422_612GNAAXX:7:114:4511:17596#0/2_CONS_SUB_SUB_CMP sample=29a_F260619; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gcctcct; reverse_tag=gcctcct; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=57; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=4; tail_quality=67.0; seq_b_deletion=0; mid_quality=75.3208955224; seq_a_deletion=0; seq_b_single=46; score=207.883730153; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.2; avg_quality=74.2532467532; sminL=40.0; seq_a_single=46; score_norm=3.35296338956; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtgctaccggcaatagcttaaaactcaaaggacttggcggtgctttatacgctt
++
+ddddddddddddddd^d^d~~~~~~~~~~~~~~~X~~~~~~~~~~~~~W}~~~~~a~sa~~~~~~~~~~~~~~~~~b~~~~ddddddQPPPPPQPKKPPP
+@HELIUM_000100422_612GNAAXX:7:94:12367:17729#0/2_CONS_SUB_SUB_CMP sample=15a_F730814; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gaagtag; reverse_tag=gaagtag; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=59; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=3; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.0; seq_a_deletion=0; seq_b_single=46; score=223.888596169; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=76.5714285714; sminL=40.0; seq_a_single=46; score_norm=3.61110638983; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddd`ddddddddddeddad~~~~~~~~~~~~~~~~~~~~~~~b~~~~~~~~r|~t||x~~~~~~~~~~~~~~~~~}b~~~bcddddd`dbdadccddecc
+@HELIUM_000100422_612GNAAXX:7:30:5374:18213#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=63; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.3233082707; seq_a_deletion=0; seq_b_single=45; score=251.958026467; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.7124183007; sminL=40.0; seq_a_single=45; score_norm=3.99933375344; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+dddddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:49:11740:5547#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=62; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=0; tail_quality=66.6; seq_b_deletion=0; mid_quality=79.1127819549; seq_a_deletion=0; seq_b_single=45; score=243.959827817; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=66.6; avg_quality=77.477124183; sminL=40.0; seq_a_single=45; score_norm=3.87237821931; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+eddddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~cddddddddcdddddddd
+@HELIUM_000100422_612GNAAXX:7:29:3531:8314#0/2_CONS_SUB_SUB_CMP sample=26a_F040644; experiment=wolf_diet; seq_length=99; forward_score=72.0; forward_tag=gaatatc; reverse_tag=gaatatc; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=63; seq_ab_match=61; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.8571428571; seq_a_deletion=0; seq_b_single=45; score=235.837856208; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.3071895425; sminL=40.0; seq_a_single=45; score_norm=3.74345803504; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+ddddddddddddddecdd~~~~~~~~~~~~~~~~~~~~~}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~~~a~dcddddddddddcddddd
+@HELIUM_000100422_612GNAAXX:7:114:10615:11217#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=29a_F260619; experiment=wolf_diet; forward_tag=gcctcct; reverse_tag=gcctcct; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=60; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=1; tail_quality=66.9; seq_b_deletion=0; mid_quality=73.7985074627; seq_a_deletion=0; seq_b_single=46; score=231.702876359; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=66.7; avg_quality=72.8896103896; sminL=40.0; seq_a_single=46; score_norm=3.73714316708; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dddddaaa``a_adddd^d~b~~z~~~~~~~~~~~~~cBcccccccccccccc~y~~s~~~~~~~|~~~~~|~~~~sz~~~adddddd[dad`VRW]VZd
+@HELIUM_000100422_612GNAAXX:7:108:2729:8600#0/2_CONS_SUB_SUB_CMP sample=15a_F730814; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gaagtag; reverse_tag=gaagtag; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=59; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.2462686567; seq_a_deletion=0; seq_b_single=46; score=223.856778095; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=76.7857142857; sminL=40.0; seq_a_single=46; score_norm=3.61059319508; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddddddddddddedcdcad~~~~~~~~~~~~~~~a~~~~~~~~~~~~~~~~~~~~~~~`~~~~~~~~~~~}~~~~~b~~~~dddddddcddddWdddddd
+@HELIUM_000100422_612GNAAXX:7:103:8847:6326#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=63; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.3082706767; seq_a_deletion=0; seq_b_single=45; score=251.968264217; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.6993464052; sminL=40.0; seq_a_single=45; score_norm=3.99949625741; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+dddddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddddcdddd
+@HELIUM_000100422_612GNAAXX:7:70:11798:2668#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=15a_F730814; experiment=wolf_diet; forward_tag=gaagtag; reverse_tag=gaagtag; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=61; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.8059701493; seq_a_deletion=0; seq_b_single=46; score=239.988667111; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=77.2727272727; sminL=40.0; seq_a_single=46; score_norm=3.8707849534; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccttt
++
+ddddddddddddddddddd~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dcdddddcddddddddbdd
+@HELIUM_000100422_612GNAAXX:7:4:18261:9148#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=61; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.8796992481; seq_a_deletion=0; seq_b_single=45; score=235.937993338; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.1; avg_quality=77.3333333333; sminL=40.0; seq_a_single=45; score_norm=3.7450475133; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+eddddddddddddddddd~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~`~~~~~~~~~~~~~~~~~~~~~~~dddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:29:18416:16620#0/2_CONS_SUB_SUB_CMP sample=29a_F260619; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gcctcct; reverse_tag=gcctcct; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=60; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=77.4179104478; seq_a_deletion=0; seq_b_single=46; score=231.873033258; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=76.0649350649; sminL=40.0; seq_a_single=46; score_norm=3.7398876332; seq_b_insertion=0; 
+ttagccctaaacacaagtaattattataacaaaattattcgccagagttctaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctg
++
+dad\bbbbddcdbdcdd`d~~~~~~~~~~~~~~~~~~~~~~~~~~~~zF||u~s~`~~~~~~~~~~~~~~~~~~~~~~~~~ddddddb^bbb`[Hb`dd\
+@HELIUM_000100422_612GNAAXX:7:32:18262:6966#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=13a_F730603; experiment=wolf_diet; forward_tag=aattaac; reverse_tag=aattaac; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=61; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=0; tail_quality=66.4; seq_b_deletion=0; mid_quality=78.7537313433; seq_a_deletion=0; seq_b_single=46; score=239.975704028; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.1; avg_quality=77.1948051948; sminL=40.0; seq_a_single=46; score_norm=3.87057587142; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dddddddcddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~`~~~~~~~~~~~~ddddddddddbdddddddd
+@HELIUM_000100422_612GNAAXX:7:110:17877:11976#0/2_CONS_SUB_SUB_CMP sample=29a_F260619; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gcctcct; reverse_tag=gcctcct; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=59; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=77.8805970149; seq_a_deletion=0; seq_b_single=46; score=223.833250149; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=76.4675324675; sminL=40.0; seq_a_single=46; score_norm=3.61021371209; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dddcddddddddddd^d\b~`~~~~~~~~~~~~~~~~~~~~x~~~~~~~~~~w{xqv~~~~~~~~~~~~~~~~~~~b~~~bdddddddddddddadddd_
+@HELIUM_000100422_612GNAAXX:7:97:9416:9155#0/2_CONS_SUB_SUB_CMP sample=13a_F730603; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=aattaac; reverse_tag=aattaac; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=60; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.5895522388; seq_a_deletion=0; seq_b_single=46; score=231.872797448; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=77.0844155844; sminL=40.0; seq_a_single=46; score_norm=3.7398838298; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dddedddddddddddddde~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~{~~~~~~b~~~~~~~~~~~~~~~bddaddddddddddeddddd
+@HELIUM_000100422_612GNAAXX:7:72:8905:10715#0/2_CONS_SUB_SUB_CMP sample=26a_F040644; experiment=wolf_diet; seq_length=99; forward_score=72.0; forward_tag=gaatatc; reverse_tag=gaatatc; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=63; seq_ab_match=63; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.2932330827; seq_a_deletion=0; seq_b_single=45; score=251.929473647; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.6862745098; sminL=40.0; seq_a_single=45; score_norm=3.99888053408; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+dddcdddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddddddddddddddcddd
+@HELIUM_000100422_612GNAAXX:7:48:5296:16375#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=63; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.1278195489; seq_a_deletion=0; seq_b_single=45; score=251.994265764; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.5424836601; sminL=40.0; seq_a_single=45; score_norm=3.99990898038; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+cddbdddddaddddbddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddd`dbdaadddd
+@HELIUM_000100422_612GNAAXX:7:53:6550:1163#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=61; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.8872180451; seq_a_deletion=0; seq_b_single=45; score=235.996766828; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.3333333333; sminL=40.0; seq_a_single=45; score_norm=3.74598042584; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgtttgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+ddaddddddddddddddd~b~~~~~~~~~~~~~~~~~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:120:1900:13295#0/2_CONS_SUB_SUB_CMP sample=15a_F730814; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gaagtag; reverse_tag=gaagtag; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=60; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=1; tail_quality=67.1; seq_b_deletion=0; mid_quality=77.5149253731; seq_a_deletion=1; seq_b_single=46; score=219.874676069; seq_a_insertion=1; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=76.1558441558; sminL=40.0; seq_a_single=46; score_norm=3.54636574304; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactacgcgcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddcdddddcdddcddddcd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ppthFfpo~~~~~~~~~~~~~~~~~~~b~~~~ddddddcdddddcdddddd
+@HELIUM_000100422_612GNAAXX:7:96:19317:7551#0/2_CONS_SUB_SUB_CMP sample=15a_F730814; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gaagtag; reverse_tag=gaagtag; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=58; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=3; tail_quality=66.9; seq_b_deletion=0; mid_quality=76.3955223881; seq_a_deletion=0; seq_b_single=46; score=215.85731879; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=65.9; avg_quality=75.0974025974; sminL=40.0; seq_a_single=46; score_norm=3.48156965791; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddbb`dddcdddddddd_d~~~~~~~~~~~~~~~Z~~~~~~~~zzt{qx~~yhpppns_|~~~za~~~~|~~~~~~a|~q~cccccccccccbcXcbccc
+@HELIUM_000100422_612GNAAXX:7:93:18556:10479#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=29a_F260619; experiment=wolf_diet; forward_tag=gcctcct; reverse_tag=gcctcct; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=59; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.3731343284; seq_a_deletion=0; seq_b_single=46; score=223.913795643; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=66.9; avg_quality=76.8896103896; sminL=40.0; seq_a_single=46; score_norm=3.61151283295; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddddddddddddddddddd~b~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~~~~~~~dddddddddddddbddddd
+@HELIUM_000100422_612GNAAXX:7:44:19605:15509#0/2_CONS_SUB_SUB_CMP sample=29a_F260619; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gcctcct; reverse_tag=gcctcct; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=59; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=3; tail_quality=67.0; seq_b_deletion=0; mid_quality=77.7313432836; seq_a_deletion=0; seq_b_single=46; score=223.916231984; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=76.3376623377; sminL=40.0; seq_a_single=46; score_norm=3.61155212878; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dadcddddddddddd_d_a~~~~~~~~~~~~~~y}z~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~_~~~p~~`k~`~~r~ddcddcadcdcddcddddd
+@HELIUM_000100422_612GNAAXX:7:40:3610:8896#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=15a_F730814; experiment=wolf_diet; forward_tag=gaagtag; reverse_tag=gaagtag; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=61; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.828358209; seq_a_deletion=0; seq_b_single=46; score=239.967241748; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=77.2922077922; sminL=40.0; seq_a_single=46; score_norm=3.87043938304; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddddddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~~~~~~~~~dddddddddddddeddddd
+@HELIUM_000100422_612GNAAXX:7:41:19763:3556#0/2_CONS_SUB_SUB_CMP sample=15a_F730814; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gaagtag; reverse_tag=gaagtag; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=62; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=65.7; seq_b_deletion=0; mid_quality=78.5671641791; seq_a_deletion=0; seq_b_single=46; score=247.825851895; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=76.9805194805; sminL=40.0; seq_a_single=46; score_norm=3.99719115959; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dddcddddddddddddcad~~~~~~~~~~~~~~~~~~~~~~~~~~~~{m{zj~~~~~~~~v~~~~~~~~~~~~~~~~~~~{dddddddddddddcddddd
+@HELIUM_000100422_612GNAAXX:7:111:7660:7465#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=58; sminR=40.0; seq_b_mismatch=3; seq_a_mismatch=2; tail_quality=66.1; seq_b_deletion=0; mid_quality=76.8646616541; seq_a_deletion=0; seq_b_single=45; score=211.768626837; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=66.5; avg_quality=75.4836601307; sminL=40.0; seq_a_single=45; score_norm=3.36140677518; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+ddcdddddd`ddddddcd~~~~~~~~_~~~~~~~~~~~~~Ky~~~~~~c~Y}~~s~~`~x~}~}~{~Z|h~~~~~~~~~~~dYYdddaddaaddad^dd
+@HELIUM_000100422_612GNAAXX:7:76:10822:18722#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=58; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=5; tail_quality=66.8; seq_b_deletion=0; mid_quality=77.3834586466; seq_a_deletion=0; seq_b_single=45; score=211.83390837; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=66.5; avg_quality=75.9803921569; sminL=40.0; seq_a_single=45; score_norm=3.36244299; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacacgaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+acbdcddddTbdcddddd~`~~~z~~~~~~S~~~~~~b~~`~~~t~t~~}~~~~~~~~~~~T~~~|~~~~~~~~~~~~x~~ddddadddd_ddbdcbdd
+@HELIUM_000100422_612GNAAXX:7:76:8491:8900#0/2_CONS_SUB_SUB_CMP sample=15a_F730814; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gaagtag; reverse_tag=gaagtag; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=57; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=4; tail_quality=65.3; seq_b_deletion=0; mid_quality=76.552238806; seq_a_deletion=0; seq_b_single=46; score=207.828655885; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=66.9; avg_quality=75.1948051948; sminL=40.0; seq_a_single=46; score_norm=3.35207509492; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtgctacctgcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+bcccccccbcccc_ccb[b~^~~~~~~~~~~~~~uw~~~~}~~~y~~}N~qx~}F}z~~~~~~~~~~~~~o~~~~~b~~~bdddddddddddcdadddda
+@HELIUM_000100422_612GNAAXX:7:47:7619:9866#0/2_CONS_SUB_SUB_CMP sample=13a_F730603; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=aattaac; reverse_tag=aattaac; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=61; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=1; tail_quality=67.1; seq_b_deletion=0; mid_quality=78.8358208955; seq_a_deletion=0; seq_b_single=46; score=239.867362445; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.1; avg_quality=77.3116883117; sminL=40.0; seq_a_single=46; score_norm=3.86882842653; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddddddddddddddddded~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~addddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:99:14742:5591#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=29a_F260619; experiment=wolf_diet; forward_tag=gcctcct; reverse_tag=gcctcct; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=60; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.5895522388; seq_a_deletion=0; seq_b_single=46; score=231.982488051; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=77.0844155844; sminL=40.0; seq_a_single=46; score_norm=3.74165303308; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dddddddddddddddddcd~b~~~~~~~~~~~~~a~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddddddddddddddddcdd
+@HELIUM_000100422_612GNAAXX:7:95:3274:5435#0/2_CONS_SUB_SUB_CMP sample=26a_F040644; experiment=wolf_diet; seq_length=99; forward_score=72.0; forward_tag=gaatatc; reverse_tag=gaatatc; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=63; seq_ab_match=61; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=1; tail_quality=66.8; seq_b_deletion=0; mid_quality=78.8421052632; seq_a_deletion=0; seq_b_single=45; score=235.944669323; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.2810457516; sminL=40.0; seq_a_single=45; score_norm=3.74515348131; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+dddcdddddddddcdddd~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~{~~~~~~~~~~~~~~~~~~~~~~~~~b~~~~~ddddddddddcddddddd
+@HELIUM_000100422_612GNAAXX:7:74:8396:18135#0/2_CONS_SUB_SUB_CMP sample=26a_F040644; experiment=wolf_diet; seq_length=99; forward_score=72.0; forward_tag=gaatatc; reverse_tag=gaatatc; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=63; seq_ab_match=61; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.8045112782; seq_a_deletion=0; seq_b_single=45; score=235.858013544; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.2614379085; sminL=40.0; seq_a_single=45; score_norm=3.74377799276; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+ddddddddddddddcddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~~~W~dddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:9:10358:4089#0/2_CONS_SUB_SUB_CMP sample=13a_F730603; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=aattaac; reverse_tag=aattaac; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=61; seq_ab_match=54; sminR=40.0; seq_b_mismatch=6; seq_a_mismatch=1; tail_quality=66.9; seq_b_deletion=1; mid_quality=66.3880597015; seq_a_deletion=0; seq_b_single=47; score=181.620394786; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=66.9; avg_quality=66.4545454545; sminL=40.0; seq_a_single=46; score_norm=2.97738352108; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactacaggcaatagctcaaaactcaaagaacttggcggtgctttataccctt
++
+d^dadbaddddddcddcd^`zy~XwzzzZ~~~ccccccccccccccccBccccBccccccccccBcccccccccccBcccacc`ddc][\[]]`addddd
+@HELIUM_000100422_612GNAAXX:7:78:10338:12302#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=13a_F730603; experiment=wolf_diet; forward_tag=aattaac; reverse_tag=aattaac; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=60; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.6119402985; seq_a_deletion=0; seq_b_single=46; score=231.881878067; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=66.9; avg_quality=77.0974025974; sminL=40.0; seq_a_single=46; score_norm=3.74003029141; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddddddddddddddddddd~a~~~~~~~~~~~~~~~~~~~~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddedddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:95:17941:6113#0/2_CONS_SUB_SUB_CMP sample=26a_F040644; experiment=wolf_diet; seq_length=99; forward_score=72.0; forward_tag=gaatatc; reverse_tag=gaatatc; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=63; seq_ab_match=57; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=6; tail_quality=66.1; seq_b_deletion=0; mid_quality=77.9172932331; seq_a_deletion=0; seq_b_single=45; score=203.869927289; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.1; avg_quality=76.4379084967; sminL=40.0; seq_a_single=45; score_norm=3.23603059189; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+ddd`dd`cdddc^edeca~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~~~~~~~~~~~~~~~~~~~~bb~~~b~~b~~~b~dddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:59:11971:12063#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=29a_F260619; experiment=wolf_diet; forward_tag=gcctcct; reverse_tag=gcctcct; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=62; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.9850746269; seq_a_deletion=0; seq_b_single=46; score=247.995051728; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=77.4285714286; sminL=40.0; seq_a_single=46; score_norm=3.99992018915; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgtcagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+acddddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~|~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddddcddddd
+@HELIUM_000100422_612GNAAXX:7:47:3878:6141#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=13a_F730603; experiment=wolf_diet; forward_tag=aattaac; reverse_tag=aattaac; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=62; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.0223880597; seq_a_deletion=0; seq_b_single=46; score=247.947034203; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=77.461038961; sminL=40.0; seq_a_single=46; score_norm=3.99914571295; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddddddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:21:5487:19582#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=13a_F730603; experiment=wolf_diet; forward_tag=aattaac; reverse_tag=aattaac; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=58; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=3; tail_quality=67.1; seq_b_deletion=0; mid_quality=77.6641791045; seq_a_deletion=0; seq_b_single=46; score=215.831528178; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=66.5; avg_quality=76.2532467532; sminL=40.0; seq_a_single=46; score_norm=3.4811536803; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dbddcdddcddddddddd_~v}~~}{~~~~b~}ZZ}}}t~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~~~~d`dbdddbdcdcdacdddd
+@HELIUM_000100422_612GNAAXX:7:38:13721:2004#0/2_CONS_SUB_SUB_CMP sample=15a_F730814; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gaagtag; reverse_tag=gaagtag; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=61; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.5298507463; seq_a_deletion=0; seq_b_single=46; score=239.856433937; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=66.3; avg_quality=76.987012987; sminL=40.0; seq_a_single=46; score_norm=3.86865216027; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+a]ddddddddddddddd`d~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}}~~~~~~~~~~~~~~~b~~~~~~~~~~~~{~dddddddddbadd^dbddb
+@HELIUM_000100422_612GNAAXX:7:111:19168:18517#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=15a_F730814; experiment=wolf_diet; forward_tag=gaagtag; reverse_tag=gaagtag; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=60; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=77.8955223881; seq_a_deletion=0; seq_b_single=46; score=223.825469474; seq_a_insertion=1; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=76.4805194805; sminL=40.0; seq_a_single=45; score_norm=3.55278522975; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattatccgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddbddddddbcdddd^dd~~~{~_~~~~~~~~~y{}{~U~{|~~~~~n~~|~~~~}x~~~~~~~~~~~~~~~~~^~~~~~~ccdaddbdddbddb_dddd
+@HELIUM_000100422_612GNAAXX:7:89:16162:8889#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=13a_F730603; experiment=wolf_diet; forward_tag=aattaac; reverse_tag=aattaac; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=62; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.1278195489; seq_a_deletion=0; seq_b_single=45; score=243.971622168; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.2; avg_quality=77.5555555556; sminL=40.0; seq_a_single=45; score_norm=3.87256543123; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dddddddddddddddddd~~c~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddedddddddeddddd
+@HELIUM_000100422_612GNAAXX:7:74:4888:6953#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=61; sminR=40.0; seq_b_mismatch=2; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.8571428571; seq_a_deletion=0; seq_b_single=45; score=235.986171514; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.3071895425; sminL=40.0; seq_a_single=45; score_norm=3.74581224625; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+dddddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~~~]~~~~~~~~~~~~~~~~~~~dddddddddedddddddd
+@HELIUM_000100422_612GNAAXX:7:41:16707:19819#0/2_CONS_SUB_SUB_CMP sample=29a_F260619; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gcctcct; reverse_tag=gcctcct; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=60; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.3656716418; seq_a_deletion=0; seq_b_single=46; score=231.94731954; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.1; avg_quality=76.8961038961; sminL=40.0; seq_a_single=46; score_norm=3.74108579903; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dddddddddddddddddbb~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~~~~~bddad`a^dddbddaddddd
+@HELIUM_000100422_612GNAAXX:7:7:7916:16505#0/2_CONS_SUB_SUB_CMP sample=29a_F260619; experiment=wolf_diet; seq_length=4; forward_score=72.0; forward_tag=gcctcct; reverse_tag=gcctcct; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=58; seq_ab_match=58; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=93.0; seq_b_deletion=50; mid_quality=93.0; seq_a_deletion=50; seq_b_single=0; score=231.999536374; seq_a_insertion=0; mode=alignment; seq_length_ori=58; head_quality=93.0; avg_quality=93.0; sminL=40.0; seq_a_single=0; score_norm=3.99999200644; seq_b_insertion=0; 
+tttt
++
+~~~~
+@HELIUM_000100422_612GNAAXX:7:41:9316:2256#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=29a_F260619; experiment=wolf_diet; forward_tag=gcctcct; reverse_tag=gcctcct; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=61; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.6343283582; seq_a_deletion=0; seq_b_single=46; score=239.993848494; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=77.1233766234; sminL=40.0; seq_a_single=46; score_norm=3.87086852409; seq_b_insertion=0; 
+ttagccctaaacacaagaaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dddddddddddddddddNd~~~~~~~~~~~~~~~~~~~~~~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddddddddddcadeddddd
+@HELIUM_000100422_612GNAAXX:7:67:7582:3642#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=62; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.0902255639; seq_a_deletion=0; seq_b_single=45; score=243.962430842; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.5098039216; sminL=40.0; seq_a_single=45; score_norm=3.87241953718; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+dddddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~`~~~~~~~~dddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:42:8435:4155#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=63; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.2857142857; seq_a_deletion=0; seq_b_single=45; score=251.987540492; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.1; avg_quality=77.6862745098; sminL=40.0; seq_a_single=45; score_norm=3.99980223003; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+ddddddddddd`dddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:33:9900:9541#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=13a_F730603; experiment=wolf_diet; forward_tag=aattaac; reverse_tag=aattaac; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=62; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.8955223881; seq_a_deletion=0; seq_b_single=46; score=247.949713348; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=77.3506493506; sminL=40.0; seq_a_single=46; score_norm=3.99918892497; seq_b_insertion=0; 
+ctagccctaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dddddd\`cccccdddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddedddddddddecddcdd
+@HELIUM_000100422_612GNAAXX:7:48:7139:3789#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=63; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.3157894737; seq_a_deletion=0; seq_b_single=45; score=251.902451987; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.7058823529; sminL=40.0; seq_a_single=45; score_norm=3.99845161885; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+dddddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:46:13269:4134#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=63; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.3157894737; seq_a_deletion=0; seq_b_single=45; score=251.997344433; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.7058823529; sminL=40.0; seq_a_single=45; score_norm=3.99995784814; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+dddddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddddddcddddddddddd
+@HELIUM_000100422_612GNAAXX:7:46:9246:19171#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=29a_F260619; experiment=wolf_diet; forward_tag=gcctcct; reverse_tag=gcctcct; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=52; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=10; tail_quality=65.2; seq_b_deletion=0; mid_quality=70.7611940299; seq_a_deletion=0; seq_b_single=46; score=167.802718427; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=66.7; avg_quality=70.1363636364; sminL=40.0; seq_a_single=46; score_norm=2.70649545851; seq_b_insertion=0; 
+ttagccctaaacacaagtaattattataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+`dddddddddd^bddadcd~b~~~~~b~~~~~~~_`~~~~~b~~~~~S~~~~~~~~~~b~~n~`~~k~zoY|~~~~jb~~~DDDDDDDDDDDDDDDDDD`
+@HELIUM_000100422_612GNAAXX:7:37:12979:6595#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=4; sample=29a_F260619; experiment=wolf_diet; forward_tag=gcctcct; reverse_tag=gcctcct; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=58; seq_ab_match=58; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=93.0; seq_b_deletion=50; mid_quality=93.0; seq_a_deletion=50; seq_b_single=0; score=231.998796685; seq_a_insertion=0; mode=alignment; seq_length_ori=58; head_quality=93.0; avg_quality=93.0; sminL=40.0; seq_a_single=0; score_norm=3.99997925319; seq_b_insertion=0; 
+tttt
++
+~~~~
+@HELIUM_000100422_612GNAAXX:7:95:1688:9598#0/2_CONS_SUB_SUB_CMP sample=26a_F040644; experiment=wolf_diet; seq_length=99; forward_score=72.0; forward_tag=gaatatc; reverse_tag=gaatatc; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=63; seq_ab_match=54; sminR=40.0; seq_b_mismatch=3; seq_a_mismatch=6; tail_quality=66.8; seq_b_deletion=0; mid_quality=74.2932330827; seq_a_deletion=0; seq_b_single=45; score=179.847313607; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=65.7; avg_quality=73.2418300654; sminL=40.0; seq_a_single=45; score_norm=2.8547192636; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtgatactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+dddc`ddddcda`bcabb~~[~~~~~~~~~~~~~__~~|z~}}}~~SPF|mxxrwwtIwjxwvv{p~rwxzx`~~Wp~~~~d[ddd`[`^^dcdddd_d
+@HELIUM_000100422_612GNAAXX:7:55:16528:11418#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=13a_F730603; experiment=wolf_diet; forward_tag=aattaac; reverse_tag=aattaac; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=58; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=4; tail_quality=57.0; seq_b_deletion=0; mid_quality=76.0746268657; seq_a_deletion=0; seq_b_single=46; score=215.988419267; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=66.5; avg_quality=74.2142857143; sminL=40.0; seq_a_single=46; score_norm=3.48368418172; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcactagcttacaactcaaaggacttggcggtgctttataccctt
++
+ddcdddddddddddcd`da~~~~~~~~~~~~x~~~~~\~~~~~~~~~v~~~~~~~~~~\~~~~~~~[~~~s~~~~~~~~]~cY__]\QPPPP`]`[`c^^
+@HELIUM_000100422_612GNAAXX:7:32:18486:7018#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=63; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.3233082707; seq_a_deletion=0; seq_b_single=45; score=251.909476689; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.1; avg_quality=77.7189542484; sminL=40.0; seq_a_single=45; score_norm=3.99856312205; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+ddddddddddddddedcd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddedddddddd
+@HELIUM_000100422_612GNAAXX:7:85:2105:21152#0/2_CONS_SUB_SUB_CMP sample=26a_F040644; experiment=wolf_diet; seq_length=99; forward_score=72.0; forward_tag=gaatatc; reverse_tag=gaatatc; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=63; seq_ab_match=57; sminR=40.0; seq_b_mismatch=4; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=73.8947368421; seq_a_deletion=0; seq_b_single=45; score=203.706262238; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=72.9934640523; sminL=40.0; seq_a_single=45; score_norm=3.23343273394; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+daddddddddddaddd`d~b~~~~b~s`~b~~~~~~~~~j~x~~~cccccccccccccccccc~~~~\}~}~~~~~{~~b~dbddddedddeddcdddd
+@HELIUM_000100422_612GNAAXX:7:83:6795:14061#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=29a_F260619; experiment=wolf_diet; forward_tag=gcctcct; reverse_tag=gcctcct; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=62; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.9328358209; seq_a_deletion=0; seq_b_single=46; score=247.992382324; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=77.3831168831; sminL=40.0; seq_a_single=46; score_norm=3.99987713426; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddddddddddddddddd_d~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddcddddddddddbdddbd
+@HELIUM_000100422_612GNAAXX:7:73:16525:10764#0/2_CONS_SUB_SUB_CMP sample=29a_F260619; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gcctcct; reverse_tag=gcctcct; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=60; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.3059701493; seq_a_deletion=0; seq_b_single=46; score=231.90336822; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=66.9; avg_quality=76.8311688312; sminL=40.0; seq_a_single=46; score_norm=3.74037690678; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+c_dddddddcddcdddd^b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|~~~~~b~b~~~~~~~~~~~~~~dddddd_bddddb[dddda
+@HELIUM_000100422_612GNAAXX:7:19:6313:16567#0/2_CONS_SUB_SUB_CMP sample=26a_F040644; experiment=wolf_diet; seq_length=99; forward_score=72.0; forward_tag=gaatatc; reverse_tag=gaatatc; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=63; seq_ab_match=60; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=3; tail_quality=67.0; seq_b_deletion=0; mid_quality=77.4135338346; seq_a_deletion=0; seq_b_single=45; score=227.826165596; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=66.6; avg_quality=76.0261437908; sminL=40.0; seq_a_single=45; score_norm=3.61628834279; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaagggcttggcggtgctttacatccct
++
+ddddcddddddacddddd~~~~~~~~~~~~~~~~~~~~~}}w|~r~xvwrm{z~~~|a~~~~~~~}u~~}~~~~~_O~~~~ddcddb_b__`baYdcdd
+@HELIUM_000100422_612GNAAXX:7:114:8865:19510#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=13a_F730603; experiment=wolf_diet; forward_tag=aattaac; reverse_tag=aattaac; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=61; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.8059701493; seq_a_deletion=0; seq_b_single=46; score=239.913762365; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.1; avg_quality=77.2792207792; sminL=40.0; seq_a_single=46; score_norm=3.86957681233; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddddddddddddddddddd~a~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddcddddddd
+@HELIUM_000100422_612GNAAXX:7:111:8478:1127#0/2_CONS_SUB_SUB_CMP sample=26a_F040644; experiment=wolf_diet; seq_length=99; forward_score=72.0; forward_tag=gaatatc; reverse_tag=gaatatc; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=63; seq_ab_match=57; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=5; tail_quality=67.0; seq_b_deletion=0; mid_quality=76.3909774436; seq_a_deletion=0; seq_b_single=45; score=203.794981474; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=66.4; avg_quality=75.1241830065; sminL=40.0; seq_a_single=45; score_norm=3.23484097578; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctggaacgcaaaggacttggcggtgctttacatccct
++
+dddaddddddddddMbdd~b~~~|~~~~~~{~~~~~~~zy|~~~~{~pv}y~~|~~~~~~~}~|~HxxwIup`~~Z~~v]~adddddacdddbad^dcd
+@HELIUM_000100422_612GNAAXX:7:81:15726:2345#0/2_CONS_SUB_SUB_CMP sample=26a_F040644; experiment=wolf_diet; seq_length=99; forward_score=72.0; forward_tag=gaatatc; reverse_tag=gaatatc; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=63; seq_ab_match=56; sminR=40.0; seq_b_mismatch=7; seq_a_mismatch=0; tail_quality=62.3; seq_b_deletion=0; mid_quality=63.1954887218; seq_a_deletion=0; seq_b_single=45; score=195.641193686; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=62.5; avg_quality=63.091503268; sminL=40.0; seq_a_single=45; score_norm=3.10541577279; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaagcactcggcggtgctttacatccct
++
+WJXc_bcca_ab__cc_b~~s~~{~~sww~pq~~~~cBccBccccccBcBccccccccccBccccccccccccccBcccBcDDDDDDDDDD`cbQc___
+@HELIUM_000100422_612GNAAXX:7:13:14386:20412#0/2_CONS_SUB_SUB_CMP sample=13a_F730603; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=aattaac; reverse_tag=aattaac; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=63; seq_ab_match=60; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.4552238806; seq_a_deletion=0; seq_b_single=45; score=223.918527801; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=76.9675324675; sminL=40.0; seq_a_single=46; score_norm=3.55426234604; seq_b_insertion=1; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+decddddddddddddddd~~a~~~~xa~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~t~~~~~~~~~~~~~~~~~~b~~~~ddddddddddddddddddc
+@HELIUM_000100422_612GNAAXX:7:83:18882:9967#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=60; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.6466165414; seq_a_deletion=0; seq_b_single=45; score=227.922890965; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.1241830065; sminL=40.0; seq_a_single=45; score_norm=3.6178236661; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+dddddddddddddddddd~b~~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~~~~~~~~~~~~~~ddddddddddddddddda
+@HELIUM_000100422_612GNAAXX:7:13:17353:13234#0/2_CONS_SUB_SUB_CMP sample=15a_F730814; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gaagtag; reverse_tag=gaagtag; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=59; sminR=40.0; seq_b_mismatch=2; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=77.6417910448; seq_a_deletion=0; seq_b_single=46; score=223.801902424; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.1; avg_quality=76.2662337662; sminL=40.0; seq_a_single=46; score_norm=3.60970810361; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccttt
++
+ddddddddddddeddWd`b~~}~~~~~x~~~~~oVp]~~~~~~~~~~~~~|~~~~~~~~~~~~~~~~~~~~~~~~~~~~~bdaddbddbdddbcUcbddd
+@HELIUM_000100422_612GNAAXX:7:53:10153:11845#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=15a_F730814; experiment=wolf_diet; forward_tag=gaagtag; reverse_tag=gaagtag; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=61; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.8059701493; seq_a_deletion=0; seq_b_single=46; score=239.985596162; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=77.2727272727; sminL=40.0; seq_a_single=46; score_norm=3.87073542196; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddddddddddddddddddd~~~~~~~~~~~~~~~a~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddddeddddd
+@HELIUM_000100422_612GNAAXX:7:33:9296:13526#0/2_CONS_SUB_SUB_CMP sample=15a_F730814; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gaagtag; reverse_tag=gaagtag; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=61; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.5597014925; seq_a_deletion=0; seq_b_single=46; score=239.852481933; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=66.7; avg_quality=77.038961039; sminL=40.0; seq_a_single=46; score_norm=3.86858841828; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dcdddddeedddddddd^d~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|~|~~~~~v~~~~~~~~~~~~~~~~~~~~~~~^dddddddbdddddZdddcd
+@HELIUM_000100422_612GNAAXX:7:113:2918:18736#0/2_CONS_SUB_SUB_CMP sample=29a_F260619; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gcctcct; reverse_tag=gcctcct; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=58; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=4; tail_quality=67.0; seq_b_deletion=0; mid_quality=77.828358209; seq_a_deletion=0; seq_b_single=46; score=215.87931956; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=76.4220779221; sminL=40.0; seq_a_single=46; score_norm=3.48192450903; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dcdcdddddddddddd_`d~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~v~~~v~~y`~~y~~~~~~~~~~~b~~b~~~bdcddddcddddda_ddddd
+@HELIUM_000100422_612GNAAXX:7:63:4725:12502#0/2_CONS_SUB_SUB_CMP sample=29a_F260619; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gcctcct; reverse_tag=gcctcct; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=61; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.0671641791; seq_a_deletion=0; seq_b_single=46; score=239.998975242; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=66.5; avg_quality=76.5974025974; sminL=40.0; seq_a_single=46; score_norm=3.87095121358; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dcdcddeddddddddWd]d~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~~~~~~~~~~~~~~dddddd``ddd]\R]\ddT
+@HELIUM_000100422_612GNAAXX:7:7:11110:17924#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=15a_F730814; experiment=wolf_diet; forward_tag=gaagtag; reverse_tag=gaagtag; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=58; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=3; tail_quality=67.0; seq_b_deletion=0; mid_quality=75.723880597; seq_a_deletion=0; seq_b_single=46; score=215.812113201; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=66.4; avg_quality=74.5519480519; sminL=40.0; seq_a_single=46; score_norm=3.4808405355; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtcataccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dcddddddddcdddddd`d~b~~~~~~~~~~~~~~~~~rm{kripoooEJpoolppp~~~~~~~~~~~~~v~~~~~`v~~~dddcdddddddbddddadd
+@HELIUM_000100422_612GNAAXX:7:102:6364:4627#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=63; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.2932330827; seq_a_deletion=0; seq_b_single=45; score=251.985885517; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.6862745098; sminL=40.0; seq_a_single=45; score_norm=3.99977596059; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+dddddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddcddddddddddcdddd
+@HELIUM_000100422_612GNAAXX:7:96:8737:4973#0/2_CONS_SUB_SUB_CMP sample=29a_F260619; experiment=wolf_diet; seq_length=4; forward_score=72.0; forward_tag=gcctcct; reverse_tag=gcctcct; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=58; seq_ab_match=57; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=1; tail_quality=93.0; seq_b_deletion=50; mid_quality=92.2631578947; seq_a_deletion=50; seq_b_single=0; score=223.980140585; seq_a_insertion=0; mode=alignment; seq_length_ori=58; head_quality=93.0; avg_quality=92.5172413793; sminL=40.0; seq_a_single=0; score_norm=3.86172656181; seq_b_insertion=0; 
+tttt
++
+~b~~
+@HELIUM_000100422_612GNAAXX:7:89:9710:20652#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=62; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.8421052632; seq_a_deletion=0; seq_b_single=45; score=243.910293117; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.2941176471; sminL=40.0; seq_a_single=45; score_norm=3.87159195424; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttatatccct
++
+dad]ccccddcdddcddd~~}~~~~~~~~~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}ddaddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:71:17473:7401#0/2_CONS_SUB_SUB_CMP sample=15a_F730814; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gaagtag; reverse_tag=gaagtag; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=60; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=77.2089552239; seq_a_deletion=0; seq_b_single=46; score=231.883938289; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=65.5; avg_quality=75.7857142857; sminL=40.0; seq_a_single=46; score_norm=3.74006352079; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggtaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddddaddddccdbddbddd~~~~~~~~b~~~~~~~~~~~~~~~~~~~~~~~~wywop~~~~gx~~~~~w~~s~~~~R~~~~c^cc_ccccc^caabaccc
+@HELIUM_000100422_612GNAAXX:7:28:9406:18226#0/2_CONS_SUB_SUB_CMP sample=15a_F730814; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gaagtag; reverse_tag=gaagtag; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=60; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.4925373134; seq_a_deletion=0; seq_b_single=46; score=231.816671723; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=77.0; sminL=40.0; seq_a_single=46; score_norm=3.73897857618; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddddddddddddcdcdecd~~~~~~~~~~~~~~~~|~~~~~~~~~~~~~~{~~~~~~~~~~x~~~~~~~~~~~~~~b~~~_ddeddddddddddcddddd
+@HELIUM_000100422_612GNAAXX:7:15:16118:15111#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=15a_F730814; experiment=wolf_diet; forward_tag=gaagtag; reverse_tag=gaagtag; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=60; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.4104477612; seq_a_deletion=0; seq_b_single=46; score=231.917355899; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=76.9285714286; sminL=40.0; seq_a_single=46; score_norm=3.7406025145; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddddddddddddddd`d]d~~~c~~~~x~~~~~~a~~~w~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddddddddd`dddeddddd
+@HELIUM_000100422_612GNAAXX:7:58:18618:20959#0/2_CONS_SUB_SUB_CMP sample=13a_F730603; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=aattaac; reverse_tag=aattaac; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=59; sminR=40.0; seq_b_mismatch=2; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.2537313433; seq_a_deletion=0; seq_b_single=46; score=223.882241304; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.1; avg_quality=76.7987012987; sminL=40.0; seq_a_single=46; score_norm=3.611003892; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddcddddddddddddddddb~~~~~b~~~~~~~~~x~~z~~~~~|~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b}~~~ddddddcdddddd_ddddd
+@HELIUM_000100422_612GNAAXX:7:46:11654:6037#0/2_CONS_SUB_SUB_CMP sample=15a_F730814; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gaagtag; reverse_tag=gaagtag; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=61; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.4402985075; seq_a_deletion=0; seq_b_single=46; score=239.828425953; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=76.9545454545; sminL=40.0; seq_a_single=46; score_norm=3.8682004186; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dddedddcdddddddddcd~~~~~~~~~~~~~~~~~~~~~~~~~~~}{z~~v~~~{~~~~~~~}~~~~~~~~~~~~~~~~bcccddcb^bbbcbdddddd
+@HELIUM_000100422_612GNAAXX:7:2:6320:8068#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=63; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.3082706767; seq_a_deletion=0; seq_b_single=45; score=251.910304163; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.1; avg_quality=77.7058823529; sminL=40.0; seq_a_single=45; score_norm=3.99857625655; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+dddddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddeddddbddddddd
+@HELIUM_000100422_612GNAAXX:7:46:1592:11866#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=13a_F730603; experiment=wolf_diet; forward_tag=aattaac; reverse_tag=aattaac; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=62; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=66.5; seq_b_deletion=0; mid_quality=78.6791044776; seq_a_deletion=0; seq_b_single=46; score=247.993604064; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=66.8; avg_quality=77.1168831169; sminL=40.0; seq_a_single=46; score_norm=3.99989683974; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dd_dddbcd\dddddd]dd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddcddcddd`dddcddcdd
+@HELIUM_000100422_612GNAAXX:7:119:2660:19129#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=61; sminR=40.0; seq_b_mismatch=2; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.6541353383; seq_a_deletion=0; seq_b_single=45; score=235.859804076; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.1307189542; sminL=40.0; seq_a_single=45; score_norm=3.74380641391; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+dcddcddddddddcdddd~~~~~~~~~~~~~~~~z}~~~~~~~~~~~~~~~~~~~~~~~~~~~~k~~~~~~~~~~b~^~~~dddbdddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:115:3625:10051#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=5; sample=13a_F730603; experiment=wolf_diet; forward_tag=aattaac; reverse_tag=aattaac; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=59; seq_ab_match=59; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=93.0; seq_b_deletion=49; mid_quality=93.0; seq_a_deletion=49; seq_b_single=0; score=235.999642017; seq_a_insertion=0; mode=alignment; seq_length_ori=59; head_quality=93.0; avg_quality=93.0; sminL=40.0; seq_a_single=0; score_norm=3.99999393249; seq_b_insertion=0; 
+caata
++
+~~~~~
+@HELIUM_000100422_612GNAAXX:7:100:17253:5513#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=13a_F730603; experiment=wolf_diet; forward_tag=aattaac; reverse_tag=aattaac; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=60; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=2; tail_quality=65.1; seq_b_deletion=0; mid_quality=76.6417910448; seq_a_deletion=0; seq_b_single=46; score=231.761122002; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=66.7; avg_quality=75.2467532468; sminL=40.0; seq_a_single=46; score_norm=3.73808261294; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dddbdddddcddddddddd~~~~|{|~~~~b~~~~~~~~~~s~~~~~x~~~~~~~rs~zqwxy~z~~|}~z~}|{^v~~~~c``Zc`cXWcc[WYYZccc
+@HELIUM_000100422_612GNAAXX:7:82:6036:6921#0/2_CONS_SUB_SUB_CMP sample=15a_F730814; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gaagtag; reverse_tag=gaagtag; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=60; sminR=40.0; seq_b_mismatch=2; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.4104477612; seq_a_deletion=0; seq_b_single=46; score=231.901981419; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=76.9285714286; sminL=40.0; seq_a_single=46; score_norm=3.74035453901; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddcbddddeddddddddcd~~~~~b~~~~~~~~~~~~~~~~~~~~~~~]~~~~~~~~}~~~~~~~~~~~~~~~~~~~|~{~dddddccdcddddabddd`
+@HELIUM_000100422_612GNAAXX:7:120:4726:20808#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=13a_F730603; experiment=wolf_diet; forward_tag=aattaac; reverse_tag=aattaac; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=62; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.6940298507; seq_a_deletion=0; seq_b_single=46; score=247.810697755; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=66.9; avg_quality=77.1688311688; sminL=40.0; seq_a_single=46; score_norm=3.99694673798; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dbedddddcdddddddddb~~~~~~~~~~~~~~ty}y~~~~~~~~~~~~{~~~~~~~~~~~~~~~~~~~~~~~~~~~~~r~ddddcdddddcdd`ddddd
+@HELIUM_000100422_612GNAAXX:7:99:8183:13912#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=13a_F730603; experiment=wolf_diet; forward_tag=aattaac; reverse_tag=aattaac; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=60; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=1; tail_quality=67.1; seq_b_deletion=0; mid_quality=78.3358208955; seq_a_deletion=0; seq_b_single=46; score=231.903850642; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=76.8701298701; sminL=40.0; seq_a_single=46; score_norm=3.74038468777; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctc
++
+ddddddddddcddddddeb~Z~~~~~~~~~~~~~~~~~}~l~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~~~~dadcdedddcdddddddd`
+@HELIUM_000100422_612GNAAXX:7:10:4085:7492#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=62; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.1052631579; seq_a_deletion=0; seq_b_single=45; score=243.95581367; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.522875817; sminL=40.0; seq_a_single=45; score_norm=3.87231450269; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+dddddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~dddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:35:12723:18557#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=63; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.1804511278; seq_a_deletion=0; seq_b_single=45; score=251.945522222; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.5882352941; sminL=40.0; seq_a_single=45; score_norm=3.99913527337; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+adddcddddddddddddd~~}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~cdddcdddddddbddddd
+@HELIUM_000100422_612GNAAXX:7:97:10495:17046#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=13a_F730603; experiment=wolf_diet; forward_tag=aattaac; reverse_tag=aattaac; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=61; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=0; tail_quality=66.9; seq_b_deletion=0; mid_quality=78.7686567164; seq_a_deletion=0; seq_b_single=46; score=239.938979134; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.1; avg_quality=77.2402597403; sminL=40.0; seq_a_single=46; score_norm=3.86998353443; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddddddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~a~~~~~~~~~~~~dddddddddddddddcddd
+@HELIUM_000100422_612GNAAXX:7:73:17068:16620#0/2_CONS_SUB_SUB_CMP sample=29a_F260619; experiment=wolf_diet; seq_length=4; forward_score=72.0; forward_tag=gcctcct; reverse_tag=gcctcct; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=58; seq_ab_match=57; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=0; tail_quality=92.8; seq_b_deletion=50; mid_quality=92.2631578947; seq_a_deletion=50; seq_b_single=0; score=223.962007947; seq_a_insertion=0; mode=alignment; seq_length_ori=58; head_quality=93.0; avg_quality=92.4827586207; sminL=40.0; seq_a_single=0; score_norm=3.86141393012; seq_b_insertion=0; 
+tttt
++
+~~~~
+@HELIUM_000100422_612GNAAXX:7:23:13304:5167#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=13a_F730603; experiment=wolf_diet; forward_tag=aattaac; reverse_tag=aattaac; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=62; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.0149253731; seq_a_deletion=0; seq_b_single=46; score=247.997553566; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=77.4545454545; sminL=40.0; seq_a_single=46; score_norm=3.99996054139; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddddddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddddcddddd
+@HELIUM_000100422_612GNAAXX:7:54:2542:19180#0/2_CONS_SUB_SUB_CMP sample=15a_F730814; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gaagtag; reverse_tag=gaagtag; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=61; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.7313432836; seq_a_deletion=0; seq_b_single=46; score=239.868258533; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=77.2077922078; sminL=40.0; seq_a_single=46; score_norm=3.86884287957; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dddddddddddddddbdad~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|~~~~~~~~~~~~~~~~~b~~~~dddddccdcddddbddddd
+@HELIUM_000100422_612GNAAXX:7:109:17917:15159#0/2_CONS_SUB_SUB_CMP sample=26a_F040644; experiment=wolf_diet; seq_length=99; forward_score=72.0; forward_tag=gaatatc; reverse_tag=gaatatc; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=63; seq_ab_match=61; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.8571428571; seq_a_deletion=0; seq_b_single=45; score=235.857230348; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.1; avg_quality=77.3137254902; sminL=40.0; seq_a_single=45; score_norm=3.74376556108; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+dddcdddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}~~~~~~~~~~~~~~~~~~~~~a~~b~~~~~cddddddddddddcdddd
+@HELIUM_000100422_612GNAAXX:7:59:18371:8149#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=13a_F730603; experiment=wolf_diet; forward_tag=aattaac; reverse_tag=aattaac; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=62; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.0149253731; seq_a_deletion=0; seq_b_single=46; score=247.998742319; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=77.4545454545; sminL=40.0; seq_a_single=46; score_norm=3.99997971482; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dcddddddddddddddddc~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddddeddddd
+@HELIUM_000100422_612GNAAXX:7:86:11013:15234#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=13a_F730603; experiment=wolf_diet; forward_tag=aattaac; reverse_tag=aattaac; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=61; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.8208955224; seq_a_deletion=0; seq_b_single=46; score=239.990009212; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=77.2857142857; sminL=40.0; seq_a_single=46; score_norm=3.8708066002; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddddddddddddddddddd~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:77:18518:10758#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=13a_F730603; experiment=wolf_diet; forward_tag=aattaac; reverse_tag=aattaac; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=59; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=2; tail_quality=62.5; seq_b_deletion=0; mid_quality=72.2388059701; seq_a_deletion=0; seq_b_single=46; score=223.70605163; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=63.9; avg_quality=71.0649350649; sminL=40.0; seq_a_single=46; score_norm=3.60816212307; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+caccaccccccccccc_cc~~~~~~~~~~~~wzz{~~a~~~~y~_~~~~~~~~~~m~sygwqv~ccBccccccccccccc~bb^^bc`U\\`\]XPZ\__
+@HELIUM_000100422_612GNAAXX:7:63:18851:7688#0/2_CONS_SUB_SUB_CMP sample=13a_F730603; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=aattaac; reverse_tag=aattaac; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=59; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=3; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.4104477612; seq_a_deletion=0; seq_b_single=46; score=223.854412144; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=76.9285714286; sminL=40.0; seq_a_single=46; score_norm=3.61055503459; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dcddddddddddedddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~a~b~~~~~~~~~b~~~~dddddddddddeddddddd
+@HELIUM_000100422_612GNAAXX:7:22:1798:3790#0/2_CONS_SUB_SUB_CMP sample=13a_F730603; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=aattaac; reverse_tag=aattaac; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=59; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=3; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.3208955224; seq_a_deletion=0; seq_b_single=46; score=223.82253574; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=76.8506493506; sminL=40.0; seq_a_single=46; score_norm=3.61004089903; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtgctaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dadbddbdddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~~~~~~~~~~~~~~~~~b~~~bdddddddddddddaddddd
+@HELIUM_000100422_612GNAAXX:7:115:14354:10118#0/2_CONS_SUB_SUB_CMP sample=26a_F040644; experiment=wolf_diet; seq_length=99; forward_score=72.0; forward_tag=gaatatc; reverse_tag=gaatatc; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=63; seq_ab_match=59; sminR=40.0; seq_b_mismatch=2; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.045112782; seq_a_deletion=0; seq_b_single=45; score=219.850378027; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=76.6013071895; sminL=40.0; seq_a_single=45; score_norm=3.4896885401; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactcgcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+ddeddddddddeddddcd~b~~~~~~~~~~~~_~~~~~~~~~~~~~~~w|y~tJ}~~~~~~}~~~~~~~~~~~~~b~~~~~ddddddddcddccddddd
+@HELIUM_000100422_612GNAAXX:7:99:14794:3606#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=61; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.7894736842; seq_a_deletion=0; seq_b_single=45; score=235.971679218; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=66.9; avg_quality=77.2418300654; sminL=40.0; seq_a_single=45; score_norm=3.74558220981; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+dddddddddddddddddd~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~dddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:74:8297:20108#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=15a_F730814; experiment=wolf_diet; forward_tag=gaagtag; reverse_tag=gaagtag; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=61; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.776119403; seq_a_deletion=0; seq_b_single=46; score=239.962155962; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=77.2467532468; sminL=40.0; seq_a_single=46; score_norm=3.87035735423; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddcdddddddddddddd`d~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}~ddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:29:12308:10119#0/2_CONS_SUB_SUB_CMP sample=26a_F040644; experiment=wolf_diet; seq_length=99; forward_score=72.0; forward_tag=gaatatc; reverse_tag=gaatatc; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=63; seq_ab_match=63; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.3233082707; seq_a_deletion=0; seq_b_single=45; score=251.866768717; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.7124183007; sminL=40.0; seq_a_single=45; score_norm=3.99788521773; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+dddddddeddddedcddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:25:11691:21134#0/2_CONS_SUB_SUB_CMP sample=29a_F260619; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gcctcct; reverse_tag=gcctcct; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=59; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.1567164179; seq_a_deletion=0; seq_b_single=46; score=223.86269299; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=76.7077922078; sminL=40.0; seq_a_single=46; score_norm=3.61068859661; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddcdddddcddddddad]d~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}~}~~~~~~~~~~~~~~~}~~b~~~_dddddddadddcdaddddd
+@HELIUM_000100422_612GNAAXX:7:111:15484:19248#0/2_CONS_SUB_SUB_CMP sample=26a_F040644; experiment=wolf_diet; seq_length=99; forward_score=72.0; forward_tag=gaatatc; reverse_tag=gaatatc; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=63; seq_ab_match=60; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=77.954887218; seq_a_deletion=0; seq_b_single=45; score=227.828264164; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=76.522875817; sminL=40.0; seq_a_single=45; score_norm=3.6163216534; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+ddddddddddddddaddd~~~~~~~~~~~~~~~`~~jzvxt{~z~~~{~}yx~}~~{`~~~~~~~~s~~~~~~~~b~~~~~dddddddddd`ddcdddd
+@HELIUM_000100422_612GNAAXX:7:103:3594:15996#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=13a_F730603; experiment=wolf_diet; forward_tag=aattaac; reverse_tag=aattaac; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=60; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.3805970149; seq_a_deletion=0; seq_b_single=46; score=231.92194325; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.1; avg_quality=76.9090909091; sminL=40.0; seq_a_single=46; score_norm=3.74067650404; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacacaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dddddddddddddddddddb~~~~~~~~~~~R~}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddddaddddd
+@HELIUM_000100422_612GNAAXX:7:1:14576:14181#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=15a_F730814; experiment=wolf_diet; forward_tag=gaagtag; reverse_tag=gaagtag; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=60; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.5373134328; seq_a_deletion=0; seq_b_single=46; score=223.962708229; seq_a_insertion=1; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=77.038961039; sminL=40.0; seq_a_single=45; score_norm=3.55496362269; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddddddddcddddddcda~~~~b~~~~~~~~~~~a~~~~~~`~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddedddddcddddd
+@HELIUM_000100422_612GNAAXX:7:99:13467:17714#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=29a_F260619; experiment=wolf_diet; forward_tag=gcctcct; reverse_tag=gcctcct; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=59; sminR=40.0; seq_b_mismatch=2; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.3432835821; seq_a_deletion=0; seq_b_single=46; score=223.932198733; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=66.9; avg_quality=76.8636363636; sminL=40.0; seq_a_single=46; score_norm=3.61180965699; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddcddddddddddddddcd~~~~~~~~b~~~}~~~~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~bddddddddddeddcddddd
+@HELIUM_000100422_612GNAAXX:7:43:7980:7908#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=13a_F730603; experiment=wolf_diet; forward_tag=aattaac; reverse_tag=aattaac; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=61; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.5970149254; seq_a_deletion=0; seq_b_single=46; score=239.984831014; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=66.9; avg_quality=77.0844155844; sminL=40.0; seq_a_single=46; score_norm=3.87072308087; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+daddcdddd_cddcdddda~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~`~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~d`ddddddddddccbdddd
+@HELIUM_000100422_612GNAAXX:7:105:14135:6905#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=29a_F260619; experiment=wolf_diet; forward_tag=gcctcct; reverse_tag=gcctcct; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=61; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.8134328358; seq_a_deletion=0; seq_b_single=46; score=239.985379811; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=77.2792207792; sminL=40.0; seq_a_single=46; score_norm=3.87073193244; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcaccagagtactagcggcaacagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddddddddddddddddddd~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddeddddddddddddbddd
+@HELIUM_000100422_612GNAAXX:7:89:16663:15081#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=13a_F730603; experiment=wolf_diet; forward_tag=aattaac; reverse_tag=aattaac; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=62; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.0149253731; seq_a_deletion=0; seq_b_single=46; score=247.939062327; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.1; avg_quality=77.461038961; sminL=40.0; seq_a_single=46; score_norm=3.9990171343; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddddddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddddddddddddecddddd
+@HELIUM_000100422_612GNAAXX:7:86:15907:21191#0/2_CONS_SUB_SUB_CMP sample=26a_F040644; experiment=wolf_diet; seq_length=99; forward_score=72.0; forward_tag=gaatatc; reverse_tag=gaatatc; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=63; seq_ab_match=58; sminR=40.0; seq_b_mismatch=2; seq_a_mismatch=3; tail_quality=67.0; seq_b_deletion=0; mid_quality=77.9172932331; seq_a_deletion=0; seq_b_single=45; score=211.91203832; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=66.9; avg_quality=76.4836601307; sminL=40.0; seq_a_single=45; score_norm=3.36368314793; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+dd`deddddddddddddd~~~~~{~~~~~~~~~~~~~~~~~~~~~~~~X~~~[~~~~~~~~~~~~~~~~~~~`~{a~~~b~ddcd\ddadddddcdddb
+@HELIUM_000100422_612GNAAXX:7:81:17261:2872#0/2_CONS_SUB_SUB_CMP sample=26a_F040644; experiment=wolf_diet; seq_length=99; forward_score=72.0; forward_tag=gaatatc; reverse_tag=gaatatc; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=63; seq_ab_match=63; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.1; seq_b_deletion=0; mid_quality=79.3157894737; seq_a_deletion=0; seq_b_single=45; score=251.967130674; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=66.9; avg_quality=77.7058823529; sminL=40.0; seq_a_single=45; score_norm=3.99947826467; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+dddedddddddddedddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddadddddeddedddddd
+@HELIUM_000100422_612GNAAXX:7:14:15397:17819#0/2_CONS_SUB_SUB_CMP sample=29a_F260619; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gcctcct; reverse_tag=gcctcct; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=59; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.171641791; seq_a_deletion=0; seq_b_single=46; score=223.847163266; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=66.9; avg_quality=76.7142857143; sminL=40.0; seq_a_single=46; score_norm=3.61043811719; seq_b_insertion=0; 
+ttagccctaaacacaaataattacacaaacaaaattgttcaccagagtactagcggcaacagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddddddddddddddddddc~`~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~a~s~~~v~~~~~~~~}~~a~~~~~~~dddddcbddddddcddddd
+@HELIUM_000100422_612GNAAXX:7:76:18268:14980#0/2_CONS_SUB_SUB_CMP sample=29a_F260619; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gcctcct; reverse_tag=gcctcct; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=61; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=1; tail_quality=66.9; seq_b_deletion=0; mid_quality=78.3208955224; seq_a_deletion=0; seq_b_single=46; score=239.985254914; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=76.8441558442; sminL=40.0; seq_a_single=46; score_norm=3.87072991797; seq_b_insertion=0; 
+ttacccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+d\ccdcddddddddddecd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~z~~~~~~~~~~~~~~~~~~~~b~~~~adbdbd^bcccddHddbdb
+@HELIUM_000100422_612GNAAXX:7:16:15509:18069#0/2_CONS_SUB_SUB_CMP sample=15a_F730814; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gaagtag; reverse_tag=gaagtag; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=58; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=4; tail_quality=66.8; seq_b_deletion=0; mid_quality=77.5; seq_a_deletion=0; seq_b_single=46; score=215.81634366; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=76.1233766234; sminL=40.0; seq_a_single=46; score_norm=3.48090876871; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+cdYdddddbdddbdcddda~~~~~~~~~~~~~~~~~~}a~r~~~~~~~~~~~~~~]zz~~~~}~~~~~~~~~~~~~b}}~_dddddddbdddddLaddbd
+@HELIUM_000100422_612GNAAXX:7:25:7789:3090#0/2_CONS_SUB_SUB_CMP sample=29a_F260619; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gcctcct; reverse_tag=gcctcct; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=59; sminR=40.0; seq_b_mismatch=3; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=72.4179104478; seq_a_deletion=0; seq_b_single=46; score=223.705772044; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=66.5; avg_quality=71.6818181818; sminL=40.0; seq_a_single=46; score_norm=3.60815761361; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactacaggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ead]dddddddddddddbd~~~~~~~~~~~~{~}~~~~cBBccccccccccccBccc~~z}~y~p~~~w|j||~~~uzr|tNba^\bT^cccZ\L\]`_`
+@HELIUM_000100422_612GNAAXX:7:53:18419:8404#0/2_CONS_SUB_SUB_CMP sample=13a_F730603; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=aattaac; reverse_tag=aattaac; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=60; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.5447761194; seq_a_deletion=0; seq_b_single=46; score=231.841887233; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=77.0454545455; sminL=40.0; seq_a_single=46; score_norm=3.73938527796; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+decddddddddddddddddb~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~{~~~~b~~~~~~~~~~~~~~~{~~~~~~~~~ddddddedddddd_ddddd
+@HELIUM_000100422_612GNAAXX:7:19:11039:3957#0/2_CONS_SUB_SUB_CMP sample=15a_F730814; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gaagtag; reverse_tag=gaagtag; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=62; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.8432835821; seq_a_deletion=0; seq_b_single=46; score=247.811165598; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=66.7; avg_quality=77.2857142857; sminL=40.0; seq_a_single=46; score_norm=3.99695428384; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dddcdddddddddddddad~~~~~~~~~~~~~~~~~~~~~~~~~~~}~~~~~~~~~~v~~~~~~~~~~~~~~~~~~~~~~~ddbdddbadddddbddddd
+@HELIUM_000100422_612GNAAXX:7:42:19757:3800#0/2_CONS_SUB_SUB_CMP sample=15a_F730814; experiment=wolf_diet; seq_length=99; forward_score=72.0; forward_tag=gaagtag; reverse_tag=gaagtag; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=57; sminR=40.0; seq_b_mismatch=3; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=1; mid_quality=77.7669172932; seq_a_deletion=1; seq_b_single=46; score=187.78301321; seq_a_insertion=1; mode=alignment; seq_length_ori=153; head_quality=67.1; avg_quality=76.3660130719; sminL=40.0; seq_a_single=45; score_norm=3.02875827758; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatatacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddddedddeddddddcdcc~~~~~~~b~|~~~a~`~~~~~~~~~~~vz~~~~~~~~~~~x_~~~~~~~~~~~~~]~~~~~~dddddd`dddddadddcd
+@HELIUM_000100422_612GNAAXX:7:116:14244:17926#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=55; sminR=40.0; seq_b_mismatch=3; seq_a_mismatch=5; tail_quality=67.0; seq_b_deletion=0; mid_quality=76.5338345865; seq_a_deletion=0; seq_b_single=45; score=187.882758912; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=75.2875816993; sminL=40.0; seq_a_single=45; score_norm=2.98226601448; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgcaagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+d`dbcccc`dddddeddd~~~~~~_~~~~b~~~~~~^xz{ZRzpooop~~s~~~~~~`~~~~~~~~~~~~~~~~~b~~~b~dddddedddddddddddd
+@HELIUM_000100422_612GNAAXX:7:91:10071:8960#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=63; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.3233082707; seq_a_deletion=0; seq_b_single=45; score=251.979171474; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.7124183007; sminL=40.0; seq_a_single=45; score_norm=3.99966938848; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+ddddddddddddddeddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:61:17484:5085#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=29a_F260619; experiment=wolf_diet; forward_tag=gcctcct; reverse_tag=gcctcct; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=62; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.9776119403; seq_a_deletion=0; seq_b_single=46; score=247.996979391; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=66.9; avg_quality=77.4155844156; sminL=40.0; seq_a_single=46; score_norm=3.9999512805; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddddedddddddddddd`d~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddccddcddd
+@HELIUM_000100422_612GNAAXX:7:18:2721:16829#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=63; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.3308270677; seq_a_deletion=0; seq_b_single=45; score=251.960802952; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.2; avg_quality=77.7320261438; sminL=40.0; seq_a_single=45; score_norm=3.99937782464; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+dddeeddddedddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dbdddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:2:7296:17275#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=29a_F260619; experiment=wolf_diet; forward_tag=gcctcct; reverse_tag=gcctcct; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=59; sminR=40.0; seq_b_mismatch=2; seq_a_mismatch=1; tail_quality=66.9; seq_b_deletion=0; mid_quality=78.0298507463; seq_a_deletion=0; seq_b_single=46; score=223.923525795; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=66.3; avg_quality=76.5454545455; sminL=40.0; seq_a_single=46; score_norm=3.61166977089; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dbcacbcbd`ddddddd_b~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~~vbdddddddddddcc]baddb
+@HELIUM_000100422_612GNAAXX:7:58:8591:17028#0/2_CONS_SUB_SUB_CMP sample=29a_F260619; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gcctcct; reverse_tag=gcctcct; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=59; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=2; tail_quality=66.0; seq_b_deletion=0; mid_quality=75.8582089552; seq_a_deletion=0; seq_b_single=46; score=223.788176649; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=65.3; avg_quality=74.5324675325; sminL=40.0; seq_a_single=46; score_norm=3.60948672015; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+_bcccccccbccacccccc~~~~~a~~y~~~~~wyn~~~~x~~zrzzkpppp~~~~~~{zuxx~~~~~z~xw~`~~_~~~~aaac]ca`cccccacc__[
+@HELIUM_000100422_612GNAAXX:7:13:3469:18630#0/2_CONS_SUB_SUB_CMP sample=26a_F040644; experiment=wolf_diet; seq_length=99; forward_score=72.0; forward_tag=gaatatc; reverse_tag=gaatatc; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=63; seq_ab_match=58; sminR=40.0; seq_b_mismatch=2; seq_a_mismatch=3; tail_quality=66.0; seq_b_deletion=0; mid_quality=76.2631578947; seq_a_deletion=0; seq_b_single=45; score=211.840326012; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=66.3; avg_quality=74.9411764706; sminL=40.0; seq_a_single=45; score_norm=3.36254485733; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+dddIQQPPdadddcdadd~~~~~xyyLqV{w~~~~~~~~~~~~~~~~~~zszx{|yy{~~~~~~~~~~~~~~[~~b~~~b~ddddd_dddd^`a_cdd`
+@HELIUM_000100422_612GNAAXX:7:72:12959:5736#0/2_CONS_SUB_SUB_CMP sample=26a_F040644; experiment=wolf_diet; seq_length=99; forward_score=72.0; forward_tag=gaatatc; reverse_tag=gaatatc; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=63; seq_ab_match=56; sminR=40.0; seq_b_mismatch=7; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=63.5263157895; seq_a_deletion=0; seq_b_single=45; score=195.664863172; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=59.8; avg_quality=63.5098039216; sminL=40.0; seq_a_single=45; score_norm=3.10579147892; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacacccct
++
+^\bSbbbbddddd^dddd~~~~~~~~~~~~~~~b~~ib~~~~~~_~ccBBBcccccccccBccccccccccccccccccccDDDDDDDDDDDDDDDDDD
+@HELIUM_000100422_612GNAAXX:7:115:6263:17700#0/2_CONS_SUB_SUB_CMP sample=26a_F040644; experiment=wolf_diet; seq_length=99; forward_score=72.0; forward_tag=gaatatc; reverse_tag=gaatatc; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=63; seq_ab_match=61; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.6390977444; seq_a_deletion=0; seq_b_single=45; score=235.853550005; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.1176470588; sminL=40.0; seq_a_single=45; score_norm=3.74370714293; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+ddcdddddddddddeddd~~~~~~~~~~~~~~~~~~~~~~~~~~y|z{yxx~~{~~~~~~~~~~~~~~~~~~~~~b~~~b~ddddeddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:7:15538:8325#0/2_CONS_SUB_SUB_CMP sample=26a_F040644; experiment=wolf_diet; seq_length=99; forward_score=72.0; forward_tag=gaatatc; reverse_tag=gaatatc; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=63; seq_ab_match=52; sminR=40.0; seq_b_mismatch=10; seq_a_mismatch=0; tail_quality=63.4; seq_b_deletion=1; mid_quality=60.1879699248; seq_a_deletion=0; seq_b_single=45; score=151.662770749; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=59.2; avg_quality=60.3333333333; sminL=40.0; seq_a_single=45; score_norm=2.40734556744; seq_b_insertion=1; 
+ttagccctaaacataaacattcaataaacaagaatgtcggccagagtactactagcaacagcatgaaactcaaagaactgggcggtgctttacatccct
++
+_S\abcacca_cacccc_~~y}~~~~qxYzgY^~~~accBccccccccccccccBBccccccBccccccBcccccBcccBcDDDDDDDDDDDDDDDDDD
+@HELIUM_000100422_612GNAAXX:7:120:16005:7955#0/2_CONS_SUB_SUB_CMP sample=26a_F040644; experiment=wolf_diet; seq_length=98; forward_score=72.0; forward_tag=gaatatc; reverse_tag=gaatatc; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=64; seq_ab_match=61; sminR=40.0; seq_b_mismatch=2; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.8939393939; seq_a_deletion=0; seq_b_single=44; score=231.880428082; seq_a_insertion=0; mode=alignment; seq_length_ori=152; head_quality=67.0; avg_quality=77.3289473684; sminL=40.0; seq_a_single=44; score_norm=3.62313168878; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagccgaaactcaaaggacttggcggtgctttacatccct
++
+ddddddddddddddddd~~~~b~~~~~~~~~b~~~~~~~~~~~z~~~~~~~~~~{~~~~~~~`~~~~~~~~~~~~~~~~~~ddddcdddddddddddd
+@HELIUM_000100422_612GNAAXX:7:115:3396:14235#0/2_CONS_SUB_SUB_CMP sample=26a_F040644; experiment=wolf_diet; seq_length=99; forward_score=72.0; forward_tag=gaatatc; reverse_tag=gaatatc; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=63; seq_ab_match=61; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.1052631579; seq_a_deletion=0; seq_b_single=45; score=235.745732131; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=76.6535947712; sminL=40.0; seq_a_single=45; score_norm=3.74199574811; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+ddcdddddadddddcddd~~~~~~b~~~~~~~~~}~}~ccc~|~~~~{~~~~~~~s~~~~~~~~~~~~~~~~~~~b~~~~~ddddddddddcdcddddd
+@HELIUM_000100422_612GNAAXX:7:32:15197:9940#0/2_CONS_SUB_SUB_CMP sample=13a_F730603; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=aattaac; reverse_tag=aattaac; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=60; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=2; tail_quality=66.9; seq_b_deletion=0; mid_quality=78.3656716418; seq_a_deletion=0; seq_b_single=46; score=231.86950825; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.1; avg_quality=76.8896103896; sminL=40.0; seq_a_single=46; score_norm=3.73983077822; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddcaddddddddddddcdd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~wt}}~~~~~{~~~~~~~~~~~~~~~b~~~~~~bd`ddddcddddddcddddd
+@HELIUM_000100422_612GNAAXX:7:7:17828:13825#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=29a_F260619; experiment=wolf_diet; forward_tag=gcctcct; reverse_tag=gcctcct; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=56; sminR=40.0; seq_b_mismatch=3; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=1; mid_quality=77.5223880597; seq_a_deletion=0; seq_b_single=46; score=187.930205125; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=76.1558441558; sminL=40.0; seq_a_single=46; score_norm=3.03113234072; seq_b_insertion=1; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dddbddddddddacbaa[b~b~~~~~~~~~~~~~a~~~~~~~~~~~~b~~~~~~~~~~~b~~~~~~~b}~~~~~~~~~~~_ddddddddddddccdddcd
+@HELIUM_000100422_612GNAAXX:7:53:2128:13141#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=15a_F730814; experiment=wolf_diet; forward_tag=gaagtag; reverse_tag=gaagtag; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=62; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.947761194; seq_a_deletion=0; seq_b_single=46; score=247.978630411; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=66.9; avg_quality=77.3896103896; sminL=40.0; seq_a_single=46; score_norm=3.99965532921; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddddddddddddddd^dad~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddcddddddddddcddddd
+@HELIUM_000100422_612GNAAXX:7:72:7057:20448#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=13a_F730603; experiment=wolf_diet; forward_tag=aattaac; reverse_tag=aattaac; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=62; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.0298507463; seq_a_deletion=0; seq_b_single=46; score=247.94833093; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=77.4675324675; sminL=40.0; seq_a_single=46; score_norm=3.9991666279; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dddeddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddddebdddd
+@HELIUM_000100422_612GNAAXX:7:10:9237:10532#0/2_CONS_SUB_SUB_CMP sample=29a_F260619; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gcctcct; reverse_tag=gcctcct; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=57; sminR=40.0; seq_b_mismatch=3; seq_a_mismatch=2; tail_quality=66.9; seq_b_deletion=0; mid_quality=75.9402985075; seq_a_deletion=0; seq_b_single=46; score=207.90944986; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=66.7; avg_quality=74.7532467532; sminL=40.0; seq_a_single=46; score_norm=3.35337822355; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaataattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+cSc`ddddddddddda_\`~~~~~~~~~~~~~~~~N~~\~~~~~~~~~~~~~~~Y~~jopppx|~|o~~~~~~b~~b~~~~ddddadddcadddada]V]
+@HELIUM_000100422_612GNAAXX:7:16:16055:12835#0/2_CONS_SUB_SUB_CMP sample=13a_F730603; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=aattaac; reverse_tag=aattaac; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=61; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.7462686567; seq_a_deletion=0; seq_b_single=46; score=239.868244499; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=77.2207792208; sminL=40.0; seq_a_single=46; score_norm=3.86884265322; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+db`dddcdddddddddddc~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~~~~dddddddddddddcddddd
+@HELIUM_000100422_612GNAAXX:7:17:16877:9760#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=29a_F260619; experiment=wolf_diet; forward_tag=gcctcct; reverse_tag=gcctcct; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=59; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=3; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.3731343284; seq_a_deletion=0; seq_b_single=46; score=223.899159093; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=76.8961038961; sminL=40.0; seq_a_single=46; score_norm=3.61127675956; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dddddddddddcddddddd~b~~~~~~~~~~~~~a~~~~~~b~~~{~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:47:8320:8571#0/2_CONS_SUB_SUB_CMP sample=26a_F040644; experiment=wolf_diet; seq_length=99; forward_score=72.0; forward_tag=gaatatc; reverse_tag=gaatatc; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=63; seq_ab_match=61; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.4586466165; seq_a_deletion=0; seq_b_single=45; score=235.809300513; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=66.9; avg_quality=76.954248366; sminL=40.0; seq_a_single=45; score_norm=3.74300477004; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+dddddddddddddddddd~~|~~~~~b~~~~~~~~~~~~~~~~~~~~~uuy~~~~~~~~~~~|~~~~~x~~~~~~~~~~b~daddddadddddd\ddda
+@HELIUM_000100422_612GNAAXX:7:6:6617:2744#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=61; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.7593984962; seq_a_deletion=0; seq_b_single=45; score=235.875132744; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.2222222222; sminL=40.0; seq_a_single=45; score_norm=3.7440497261; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+eddddd`ddddddddcbd~b~~~~b~~~~~~~~~~~~|~~~~~~~~y~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddddddddddddddcbdd
+@HELIUM_000100422_612GNAAXX:7:12:9609:14740#0/2_CONS_SUB_SUB_CMP sample=13a_F730603; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=aattaac; reverse_tag=aattaac; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=60; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=2; tail_quality=67.1; seq_b_deletion=0; mid_quality=78.4701492537; seq_a_deletion=0; seq_b_single=46; score=231.833538451; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.1; avg_quality=76.9935064935; sminL=40.0; seq_a_single=46; score_norm=3.73925062018; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dcddddddddddcdddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~zs~}~~~~~}~~~~~~~~~~~~~~~~~~b~~~bdddddddcdddddeddddd
+@HELIUM_000100422_612GNAAXX:7:21:2093:4412#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=60; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=3; tail_quality=67.0; seq_b_deletion=0; mid_quality=76.1428571429; seq_a_deletion=0; seq_b_single=45; score=227.763131817; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=74.9477124183; sminL=40.0; seq_a_single=45; score_norm=3.61528780662; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+eddddddddddddddddd~b~~~~~~~~~~~~~}~~`~~~~~~~~~~~~~Z{~~|{~~~~{~|~|~~~~~}~~~}|~~}}}DDDDDDDD``U`^\[ddd
+@HELIUM_000100422_612GNAAXX:7:18:5240:1587#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=13a_F730603; experiment=wolf_diet; forward_tag=aattaac; reverse_tag=aattaac; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=59; sminR=40.0; seq_b_mismatch=2; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.3880597015; seq_a_deletion=0; seq_b_single=46; score=223.905608015; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=76.9090909091; sminL=40.0; seq_a_single=46; score_norm=3.61138077443; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddddddddddddddddddd~}~~~~~~~~~~~~}~~~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~~~bdddddddedddddcddddd
+@HELIUM_000100422_612GNAAXX:7:88:15797:19191#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=13a_F730603; experiment=wolf_diet; forward_tag=aattaac; reverse_tag=aattaac; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=58; sminR=40.0; seq_b_mismatch=4; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.1492537313; seq_a_deletion=0; seq_b_single=46; score=215.88300628; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=76.7012987013; sminL=40.0; seq_a_single=46; score_norm=3.48198397226; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dddddddddddddddcddc~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~~~`~~~~b~~b~~~~ddeddddddddddcddddd
+@HELIUM_000100422_612GNAAXX:7:47:11864:1343#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=63; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.2857142857; seq_a_deletion=0; seq_b_single=45; score=251.976310174; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.6797385621; sminL=40.0; seq_a_single=45; score_norm=3.99962397102; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+ddddddddddddddbdcd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddcddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:43:8022:8427#0/2_CONS_SUB_SUB_CMP sample=13a_F730603; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=aattaac; reverse_tag=aattaac; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=60; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.5970149254; seq_a_deletion=0; seq_b_single=46; score=231.869859511; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=77.0909090909; sminL=40.0; seq_a_single=46; score_norm=3.73983644372; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dedcddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~~b~~~~dddddddddddddcddddd
+@HELIUM_000100422_612GNAAXX:7:95:11283:2557#0/2_CONS_SUB_SUB_CMP sample=29a_F260619; experiment=wolf_diet; seq_length=4; forward_score=72.0; forward_tag=gcctcct; reverse_tag=gcctcct; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=58; seq_ab_match=57; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=0; tail_quality=93.0; seq_b_deletion=50; mid_quality=92.2368421053; seq_a_deletion=50; seq_b_single=0; score=223.999078974; seq_a_insertion=0; mode=alignment; seq_length_ori=58; head_quality=93.0; avg_quality=92.5; sminL=40.0; seq_a_single=0; score_norm=3.86205308576; seq_b_insertion=0; 
+tttt
++
+~~~~
+@HELIUM_000100422_612GNAAXX:7:67:5288:13403#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=29a_F260619; experiment=wolf_diet; forward_tag=gcctcct; reverse_tag=gcctcct; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=62; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.0298507463; seq_a_deletion=0; seq_b_single=46; score=247.999078967; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.1; avg_quality=77.474025974; sminL=40.0; seq_a_single=46; score_norm=3.99998514464; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddddddddddcdddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddddeddddd
+@HELIUM_000100422_612GNAAXX:7:7:11998:4462#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=59; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=4; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.2105263158; seq_a_deletion=0; seq_b_single=45; score=219.864332815; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=76.7450980392; sminL=40.0; seq_a_single=45; score_norm=3.48991004469; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtagtactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+ddddddddddddddcddd~b~~~~~~~~~~~~b~~~~~~~b~~~~~~~G~}}~~}}~~~~~~~~~~~~~~~~~~~~~~~~~ddddddddddddcdccdd
+@HELIUM_000100422_612GNAAXX:7:116:12598:9964#0/2_CONS_SUB_SUB_CMP sample=13a_F730603; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=aattaac; reverse_tag=aattaac; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=53; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=8; tail_quality=66.7; seq_b_deletion=0; mid_quality=77.0671641791; seq_a_deletion=0; seq_b_single=46; score=175.843125508; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=75.7402597403; sminL=40.0; seq_a_single=46; score_norm=2.83617944368; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddddddcdddddddbddda`~~~~~~~~~~~~~~~~~~b~~~b~~~~b~~~~~b~b~{~~~~~~b~~~~~~~~~~~b~~~bddddddedddddddddddd
+@HELIUM_000100422_612GNAAXX:7:111:18277:17779#0/2_CONS_SUB_SUB_CMP sample=26a_F040644; experiment=wolf_diet; seq_length=99; forward_score=72.0; forward_tag=gaatatc; reverse_tag=gaatatc; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=63; seq_ab_match=61; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.8646616541; seq_a_deletion=0; seq_b_single=45; score=235.877819976; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.3137254902; sminL=40.0; seq_a_single=45; score_norm=3.74409238057; seq_b_insertion=0; 
+ttagccctaaacatagataattttacaacaaaataattcgccagaggactactagcaatagcctgaaactcaaaggacttggcggtgctttacatccct
++
+ddddddddddddbdddcd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~_~~~~~~~~~~~~b~~~~~dddddddedddddddddd
+@HELIUM_000100422_612GNAAXX:7:85:13257:14594#0/2_CONS_SUB_SUB_CMP sample=29a_F260619; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gcctcct; reverse_tag=gcctcct; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=60; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.5298507463; seq_a_deletion=0; seq_b_single=46; score=231.92296471; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=77.0324675325; sminL=40.0; seq_a_single=46; score_norm=3.7406929792; seq_b_insertion=0; 
+ttagccctaaacacaaataattacacaaacaaaattgttcaccagagtactagcggcaacagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddddddddedddddddddd~~~~~~~~~~~~~~~~~~~~~~~_~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~addccddadddddcaddddd
+@HELIUM_000100422_612GNAAXX:7:17:11935:17343#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=62; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.0902255639; seq_a_deletion=0; seq_b_single=45; score=243.983570342; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.5098039216; sminL=40.0; seq_a_single=45; score_norm=3.87275508479; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+dddddddddddddddddd~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:38:9654:18700#0/2_CONS_SUB_SUB_CMP sample=26a_F040644; experiment=wolf_diet; seq_length=99; forward_score=72.0; forward_tag=gaatatc; reverse_tag=gaatatc; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=63; seq_ab_match=62; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.0902255639; seq_a_deletion=0; seq_b_single=45; score=243.950053136; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.5098039216; sminL=40.0; seq_a_single=45; score_norm=3.87222306566; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+ddddddddddddddeddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~~~~~~~~~~~~~~~~~~~~~~~dcddddddddddcddddc
+@HELIUM_000100422_612GNAAXX:7:101:11720:19906#0/2_CONS_SUB_SUB_CMP sample=29a_F260619; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gcctcct; reverse_tag=gcctcct; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=57; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=4; tail_quality=66.9; seq_b_deletion=0; mid_quality=76.9104477612; seq_a_deletion=0; seq_b_single=46; score=207.841888471; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=75.6168831169; sminL=40.0; seq_a_single=46; score_norm=3.35228852373; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddc_ddddddcdddddd\d~~~~~~~~~~~~~~~~]~~|~hsp~~{~~z{t}~~qs}~b~~}~~~~}~x~~~~b~~c~~~_ddddcd^ccbbdd^ddddd
+@HELIUM_000100422_612GNAAXX:7:42:12961:8650#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=62; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.1052631579; seq_a_deletion=0; seq_b_single=45; score=243.985409859; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.522875817; sminL=40.0; seq_a_single=45; score_norm=3.87278428347; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+dddddddddddddddddd~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddcddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:36:10388:10324#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=15a_F730814; experiment=wolf_diet; forward_tag=gaagtag; reverse_tag=gaagtag; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=61; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.8208955224; seq_a_deletion=0; seq_b_single=46; score=239.950587748; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=77.2857142857; sminL=40.0; seq_a_single=46; score_norm=3.87017077012; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddddddddddddddddddd~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddddeddddd
+@HELIUM_000100422_612GNAAXX:7:66:11860:20419#0/2_CONS_SUB_SUB_CMP sample=29a_F260619; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gcctcct; reverse_tag=gcctcct; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=61; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=1; tail_quality=67.1; seq_b_deletion=0; mid_quality=78.5671641791; seq_a_deletion=0; seq_b_single=46; score=239.911387587; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.1; avg_quality=77.0779220779; sminL=40.0; seq_a_single=46; score_norm=3.86953850946; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddcdddddeddddddddad~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}~~~~~~~~~~~~~~~b~~~|ddcddddddddddNddddd
+@HELIUM_000100422_612GNAAXX:7:3:17077:6562#0/2_CONS_SUB_SUB_CMP sample=15a_F730814; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gaagtag; reverse_tag=gaagtag; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=59; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=3; tail_quality=66.6; seq_b_deletion=0; mid_quality=77.6567164179; seq_a_deletion=0; seq_b_single=46; score=223.876050008; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=66.0; avg_quality=76.1818181818; sminL=40.0; seq_a_single=46; score_norm=3.61090403239; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactgccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dddcdddddddddddadab~~~~~~~~~~~~~~~~~~~~~~~~~~~~zz~zF~a~~~~~~~}~~~~~~~~~~~~~~au~~~ccccccccccccacccccc
+@HELIUM_000100422_612GNAAXX:7:18:11865:6418#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=63; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.3157894737; seq_a_deletion=0; seq_b_single=45; score=251.959188225; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.7058823529; sminL=40.0; seq_a_single=45; score_norm=3.99935219405; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+dddddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddddddcdddeddddddd
+@HELIUM_000100422_612GNAAXX:7:19:4311:13343#0/2_CONS_SUB_SUB_CMP sample=26a_F040644; experiment=wolf_diet; seq_length=99; forward_score=72.0; forward_tag=gaatatc; reverse_tag=gaatatc; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=63; seq_ab_match=58; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=4; tail_quality=67.0; seq_b_deletion=0; mid_quality=77.7969924812; seq_a_deletion=0; seq_b_single=45; score=211.837822462; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=76.385620915; sminL=40.0; seq_a_single=45; score_norm=3.36250511845; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactacgagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+dbddcddddcdd^ddddd~~~~~~~~~~~~~b~~~~~~~~~~~~~~~~~~~{Z{~~~_~~y{~~~}~~~|~~~~~b~~~b~bcdddcdddddddddccc
+@HELIUM_000100422_612GNAAXX:7:30:1800:7833#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=15a_F730814; experiment=wolf_diet; forward_tag=gaagtag; reverse_tag=gaagtag; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=52; sminR=40.0; seq_b_mismatch=10; seq_a_mismatch=0; tail_quality=65.6; seq_b_deletion=0; mid_quality=59.9104477612; seq_a_deletion=0; seq_b_single=46; score=167.712615339; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=35.0; avg_quality=58.6623376623; sminL=40.0; seq_a_single=46; score_norm=2.70504218289; seq_b_insertion=0; 
+ttagccctaaacacaagacattaatataacgagattaatcgacagagtactaccggctatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+DDDDDDDDDDDDDDDDDDDccBccccccccBcBccccBBccBcccccccc~u~v}[wJ~~Q|~~~~~~~~~~~~a~~~~t~Z^ccc`c]bbc_[V_[`[`
+@HELIUM_000100422_612GNAAXX:7:16:19299:8684#0/2_CONS_SUB_SUB_CMP sample=15a_F730814; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gaagtag; reverse_tag=gaagtag; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=60; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.5; seq_a_deletion=0; seq_b_single=46; score=231.845804746; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=77.0064935065; sminL=40.0; seq_a_single=46; score_norm=3.73944846365; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+cdccddddeddddddadac~~~~~~~~~~~~~~~~~~~~~~~~|~~~~~~~~~~~~~~~~~~~~~~~~`~~~~~~~b~~~~dddddddddddddcddddd
+@HELIUM_000100422_612GNAAXX:7:54:14618:14353#0/2_CONS_SUB_SUB_CMP sample=13a_F730603; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=aattaac; reverse_tag=aattaac; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=61; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=1; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.6865671642; seq_a_deletion=0; seq_b_single=46; score=239.8562981; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=77.1688311688; sminL=40.0; seq_a_single=46; score_norm=3.86864996935; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddcedddddddddddddde~~~~~~~~~~~~~~~~~~~~~~~~~~~~~z}|z~~~~~y~~~~~~~~~~~~~~~~~~b~~~~ddddddcddddddcddddd
+@HELIUM_000100422_612GNAAXX:7:108:9222:18258#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=13a_F730603; experiment=wolf_diet; forward_tag=aattaac; reverse_tag=aattaac; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=60; sminR=40.0; seq_b_mismatch=2; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.5; seq_a_deletion=0; seq_b_single=46; score=231.857703869; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.2; avg_quality=77.0194805195; sminL=40.0; seq_a_single=46; score_norm=3.73964038498; seq_b_insertion=0; 
+ctagccttaaacacaaatagttatgcagacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddccddddddddddddddd~~~~~~~~~~~~~~~~~~~v~~~~~}~}}~~~~~`~~~~~~~~~~b~~~~~~~~~~~~~~~~dcddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:74:4783:20479#0/2_CONS_SUB_SUB_CMP sample=29a_F260619; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gcctcct; reverse_tag=gcctcct; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=61; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=77.9029850746; seq_a_deletion=0; seq_b_single=46; score=239.87314657; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=76.487012987; sminL=40.0; seq_a_single=46; score_norm=3.86892171887; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dddaddddddbddddZd`d~b~~~~~~~~~~~~~~~~~}~~~~~~~~~~~~~~~|z~~~~~xq~~~}~r~~~~~~~~~~yqcbbddWdadddddWddcda
+@HELIUM_000100422_612GNAAXX:7:38:3005:20881#0/2_CONS_SUB_SUB_CMP sample=26a_F040644; experiment=wolf_diet; seq_length=99; forward_score=72.0; forward_tag=gaatatc; reverse_tag=gaatatc; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=63; seq_ab_match=60; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=3; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.5939849624; seq_a_deletion=0; seq_b_single=45; score=227.901935995; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.0784313725; sminL=40.0; seq_a_single=45; score_norm=3.61749104754; seq_b_insertion=0; 
+ttagccctaaacatgaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+ddddddddddddddaedd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~a~~~~~~~|~~~~~~b~~b~~}~~dbdddcdddddbdddddd
+@HELIUM_000100422_612GNAAXX:7:4:10139:2389#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=63; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=66.5; seq_b_deletion=0; mid_quality=78.4962406015; seq_a_deletion=0; seq_b_single=45; score=251.802206044; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=66.9; avg_quality=76.954248366; sminL=40.0; seq_a_single=45; score_norm=3.99686041339; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+daddaddddbdddddddc~~~~~~~~~{~~~~~~~~zxy~~|~~~~ru~~~~~~~~~~~~~~~~~~{~~p~~~~~~~~~~~ddddddddddabaP`ddd
+@HELIUM_000100422_612GNAAXX:7:75:9674:16966#0/2_CONS_SUB_SUB_CMP sample=29a_F260619; experiment=wolf_diet; seq_length=4; forward_score=72.0; forward_tag=gcctcct; reverse_tag=gcctcct; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=58; seq_ab_match=57; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=0; tail_quality=93.0; seq_b_deletion=50; mid_quality=92.2631578947; seq_a_deletion=50; seq_b_single=0; score=224.000075421; seq_a_insertion=0; mode=alignment; seq_length_ori=58; head_quality=93.0; avg_quality=92.5172413793; sminL=40.0; seq_a_single=0; score_norm=3.86207026589; seq_b_insertion=0; 
+tttt
++
+~~~~
+@HELIUM_000100422_612GNAAXX:7:59:15367:8376#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=100; sample=15a_F730814; experiment=wolf_diet; forward_tag=gaagtag; reverse_tag=gaagtag; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=62; seq_ab_match=62; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.0149253731; seq_a_deletion=0; seq_b_single=46; score=247.996374666; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=77.4545454545; sminL=40.0; seq_a_single=46; score_norm=3.99994152687; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dddddddddddddddddad~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddddeddddd
+@HELIUM_000100422_612GNAAXX:7:29:1328:13185#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=59; sminR=40.0; seq_b_mismatch=4; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.3007518797; seq_a_deletion=0; seq_b_single=45; score=223.94591652; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=76.8235294118; sminL=40.0; seq_a_single=45; score_norm=3.55469708763; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+dddddddddddddedadd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~W[~~~~~~~~~~~~~~~~~~~~~~~b~~~b~dddcdddddddcdddddd
+@HELIUM_000100422_612GNAAXX:7:30:16081:4486#0/2_CONS_SUB_SUB_CMP sample=26a_F040644; experiment=wolf_diet; seq_length=99; forward_score=72.0; forward_tag=gaatatc; reverse_tag=gaatatc; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=63; seq_ab_match=62; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.0902255639; seq_a_deletion=0; seq_b_single=45; score=243.950667893; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=67.0; avg_quality=77.5098039216; sminL=40.0; seq_a_single=45; score_norm=3.87223282369; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+dddaddddddddddeddd~~~c~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddddddcddddddddddd
+@HELIUM_000100422_612GNAAXX:7:104:10274:7999#0/2_CONS_SUB_SUB reverse_score=72.0; reverse_match=tagaacaggctcctctag; seq_length=99; sample=26a_F040644; experiment=wolf_diet; forward_tag=gaatatc; reverse_tag=gaatatc; reverse_primer=tagaacaggctcctctag; status=full; forward_score=72.0; direction=forward; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; ali_length=63; seq_ab_match=63; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=79.2556390977; seq_a_deletion=0; seq_b_single=45; score=251.962499638; seq_a_insertion=0; mode=alignment; seq_length_ori=153; head_quality=66.9; avg_quality=77.6470588235; sminL=40.0; seq_a_single=45; score_norm=3.99940475616; seq_b_insertion=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccct
++
+ccdddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddd^ddddddddddd
+@HELIUM_000100422_612GNAAXX:7:14:7706:12338#0/2_CONS_SUB_SUB_CMP sample=15a_F730814; experiment=wolf_diet; seq_length=100; forward_score=72.0; forward_tag=gaagtag; reverse_tag=gaagtag; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=59; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=77.6194029851; seq_a_deletion=0; seq_b_single=46; score=223.864093999; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=66.7; avg_quality=76.2207792208; sminL=40.0; seq_a_single=46; score_norm=3.61071119354; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+dddadddcddddddddc^d~~~~~~~~~~~~~~~~~~~P~~~~~~~~~}}~vm~qZyw~~~~x~~~~~~~~~~~b~~~~~~dddddaccdddddcddddd
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/output_ngsfilter_unidentified.fastq	Wed Apr 12 17:38:00 2017 -0400
@@ -0,0 +1,44 @@
+@HELIUM_000100422_612GNAAXX:7:1:9007:3289#0/2_CONS_SUB_SUB_CMP error=Cannot assign sequence to a sample; forward_score=72.0; forward_tag=atctctc; reverse_tag=atctctc; forward_match=ttagataccccactatgc; forward_primer=ttagataccccactatgc; reverse_score=72.0; status=full; direction=reverse; reverse_match=tagaacaggctcctctag; reverse_primer=tagaacaggctcctctag; ali_length=62; seq_ab_match=60; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=2; tail_quality=67.0; seq_b_deletion=0; mid_quality=78.5671641791; seq_a_deletion=0; seq_b_single=46; score=231.83380127; seq_a_insertion=0; mode=alignment; seq_length_ori=154; head_quality=67.0; avg_quality=77.0649350649; sminL=40.0; seq_a_single=46; score_norm=3.7392548592; seq_b_insertion=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttataccctt
++
+ddddddddddddddcddbd~~~~~~~~~~~~~~~~~~~}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~~~bddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:1:8849:9880#0/2_PairEnd sminR=40.0; pairend_limit=108; tail_quality=64.3; mid_quality=37.8724489796; ali_dir=left; score=25.9064763088; mode=joined; error=No primer match; head_quality=33.0; avg_quality=38.8703703704; sminL=40.0; 
+ggacgggagagggggggggggggggaaggggggggttttggggggggggggccgttttaaaaaaaaaaaaaaaacaacgtgacatggcacagccgtcacaactgtcagctgacgaccactggcagtgagtctactctcctattttgttttttttttcaagcagaagacggcatacgatatcggtctcggcattcctgctgaaccgctcttccgatc
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB_`X`b[`T[ZWHZTWU]]b]]TZ^__\^`\OOOOO^`^Z^_ba_bbbbbb
+@HELIUM_000100422_612GNAAXX:7:1:8649:5297#0/2_CONS ali_length=104; direction=right; seq_ab_match=104; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=93.0; seq_b_deletion=4; mid_quality=93.0; seq_a_deletion=4; seq_b_single=0; score=415.823014771; seq_a_insertion=0; mode=alignment; error=No primer match; head_quality=93.0; avg_quality=93.0; sminL=40.0; seq_a_single=0; score_norm=3.99829821895; seq_b_insertion=0; 
+ccagcgagatcccattgagtctctgcacctatcctttttttcgttttctgaatctttgtttggaaaaaaacaggatttggctcaggattgcccgatctcgctgg
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@HELIUM_000100422_612GNAAXX:7:1:8702:15835#0/2_CONS ali_length=85; direction=left; seq_ab_match=85; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=67.0; seq_b_deletion=0; mid_quality=86.8828828829; seq_a_deletion=0; seq_b_single=23; score=339.959438284; seq_a_insertion=0; mode=alignment; error=No primer match; head_quality=67.0; avg_quality=83.8473282443; sminL=40.0; seq_a_single=23; score_norm=3.99952280334; seq_b_insertion=0; 
+cccatcgctcagatatccgttgccgagagtcgtgtagattatatagaattgcaactcggggtgcggccagcaagccagccacatcccctcgttaggcacagtgttccttgacgccttcggtgagcgatggg
++
+ddddddddddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~{~~~~~~~~ddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:1:8613:9165#0/2_CONS ali_length=101; direction=left; seq_ab_match=99; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=2; tail_quality=74.8; seq_b_deletion=0; mid_quality=92.4105263158; seq_a_deletion=0; seq_b_single=7; score=387.825112777; seq_a_insertion=0; mode=alignment; error=No primer match; head_quality=74.8; avg_quality=89.347826087; sminL=40.0; seq_a_single=7; score_norm=3.83985260176; seq_b_insertion=0; 
+ccagagcgagtgggcaatcctgagccaaatctttatttttagaaaaacaaaagggcttcagaaagcaaaaataaacataaaggataggtgcagagactcaatggactcgctctgg
++
+ddddddd~~~~b~~~~~~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddddddd
+@HELIUM_000100422_612GNAAXX:7:1:8670:8750#0/2_CONS ali_length=90; direction=right; seq_ab_match=90; sminR=40.0; seq_b_mismatch=0; seq_a_mismatch=0; tail_quality=93.0; seq_b_deletion=18; mid_quality=93.0; seq_a_deletion=18; seq_b_single=0; score=359.914979278; seq_a_insertion=0; mode=alignment; error=No primer match; head_quality=93.0; avg_quality=93.0; sminL=40.0; seq_a_single=0; score_norm=3.99905532531; seq_b_insertion=0; 
+ccgaggcttactaggattagataccctattatttttgaatgttaatgtttgtttgcttgagtagtattagttatgttcttgaaagcctcg
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@HELIUM_000100422_612GNAAXX:7:1:8732:6209#0/2_PairEnd sminR=40.0; pairend_limit=108; tail_quality=57.9; mid_quality=36.5408163265; ali_dir=right; score=15.9727840143; mode=joined; error=No primer match; head_quality=33.0; avg_quality=37.3657407407; sminL=40.0; 
+gctctacagaggcgggggggggggagaaggggaaatcatggggggggggggcgacatctaaaaacatacatacaacccacacctcctaccacacagctcccagcgcaaagatagatcatgatggtaagtagaggcaaatgagatcatctatttttttcaaagagaagacggcatacgatatcggtctcggcattcctgctaaccgctcttccgatc
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBa[]aa_aaaa]aa`]a\[aZ`\ZcMWR]Z`````
+@HELIUM_000100422_612GNAAXX:7:1:8858:2566#0/2_PairEnd sminR=40.0; pairend_limit=108; tail_quality=65.0; mid_quality=40.6581632653; ali_dir=left; score=15.7312871104; mode=joined; error=No primer match; head_quality=33.0; avg_quality=41.4305555556; sminL=40.0; 
+ggctcggagagagggggggggggggggaggggggggatccgggggggggggggtcttacaaaaaaacacaaaacacataaccactctcacacccacactcgcacacccggatgtggttgtggtgtgcgcgtggatggtgtggtgtggtttttttttcaagcagaagacggcatacgagatcggtctcggcattcctgctgaaccgctcttccgatc
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBa_a_a]aaaa_`Y`_W]Y[S]]aaaabbbbbcbbbbbbbbbbbbb`bbbbbbbbbbbbbb
+@HELIUM_000100422_612GNAAXX:7:1:8644:15229#0/2_CONS ali_length=106; direction=left; seq_ab_match=103; sminR=40.0; seq_b_mismatch=2; seq_a_mismatch=1; tail_quality=83.8; seq_b_deletion=0; mid_quality=90.8; seq_a_deletion=0; seq_b_single=2; score=399.617128202; seq_a_insertion=0; mode=alignment; error=No primer match; head_quality=87.8; avg_quality=89.8909090909; sminL=40.0; seq_a_single=2; score_norm=3.76997290756; seq_b_insertion=0; 
+cacacgctctccattgagtctctgcacctatcctttttgattttcgctttctgaatctttgtttgttttcggaaaacgtgatttggctcaggattgcccagagcgtgtgg
++
+dd~~~~~~~~~~~~~~~~~~~~~~~~{~~~~b~~~~~~~~~{|~~~~s|~v~~|p~~~~~~~~~~~u~qy~a~~~~~~~x~|~~~~z{~|~o|~{yvwwy~~|~~[~~cb
+@HELIUM_000100422_612GNAAXX:7:1:8613:5665#0/2_CONS ali_length=90; direction=right; seq_ab_match=89; sminR=40.0; seq_b_mismatch=1; seq_a_mismatch=0; tail_quality=90.2; seq_b_deletion=18; mid_quality=93.0; seq_a_deletion=18; seq_b_single=0; score=351.879189487; seq_a_insertion=0; mode=alignment; error=No primer match; head_quality=93.0; avg_quality=92.6888888889; sminL=40.0; seq_a_single=0; score_norm=3.90976877208; seq_b_insertion=0; 
+ccttcctggggtagtactctggcgaataattttgttatattaattacttgtgtttagggctaagcatagtggggtatctaaccaggaagg
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~~~~~~~
+@HELIUM_000100422_612GNAAXX:7:1:8823:6682#0/2_PairEnd sminR=40.0; pairend_limit=108; tail_quality=64.9; mid_quality=41.693877551; ali_dir=right; score=15.9839512414; mode=joined; error=No primer match; head_quality=33.0; avg_quality=42.3657407407; sminL=40.0; 
+gatcgggagagcgtcgtgtaggggaagagggtagatctcggggggggccgtatcattaaaaaaaaaaacaaacatcagcacgaagcacatgacaccgcctagctatcaatcttgagatgagatcagacatctgtttgttttcttttgtttttttttcaagcagaagacggcatacgatatcggtctcggcattcctgctgaaccgctcttccgatc
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB_aa]a`]^S``aabaab^bbbbab_c``abbbbbbbcbbbbbbbbbbbbbbbbbbbbbbbbbbab
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/output_obiannotate.fasta	Wed Apr 12 17:38:00 2017 -0400
@@ -0,0 +1,172 @@
+>HELIUM_000100422_612GNAAXX:7:119:14871:19157#0/2_CONS_SUB_SUB_CMP merged_sample={'29a_F260619': 1}; seq_rank=1; count=1; seq_length=100; 
+ttagccctaaacacaagtaattattataacaaaatcattcgccagagtactaccggcaat
+agctcaaaactcaaaggacttggcggtgctttataccctt
+>HELIUM_000100422_612GNAAXX:7:108:5640:3823#0/2_CONS_SUB_SUB_CMP merged_sample={'29a_F260619': 1}; seq_rank=2; count=1; seq_length=100; 
+ttagccctaaacacaagtaattaatataacaaaattgttcgccagagtactaccggcaat
+agcttaaaactcaaaggacttggcggtgctttataccctt
+>HELIUM_000100422_612GNAAXX:7:97:14311:19299#0/2_CONS_SUB_SUB_CMP merged_sample={'29a_F260619': 1}; seq_rank=3; count=1; seq_length=100; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaag
+agcttaaaactcaaaggacttggcggtgctttataccctt
+>HELIUM_000100422_612GNAAXX:7:22:8540:14708#0/2_CONS_SUB_SUB merged_sample={'29a_F260619': 30, '15a_F730814': 31}; count=61; seq_length=100; seq_rank=4; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaat
+agcttaaaactcaaaggacttggcggtgctttataccctt
+>HELIUM_000100422_612GNAAXX:7:57:18459:16145#0/2_CONS_SUB_SUB_CMP merged_sample={'26a_F040644': 64}; seq_rank=5; count=64; seq_length=99; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaaca
+gcctgaaactcaaaggacttggcggtgctttacatccct
+>HELIUM_000100422_612GNAAXX:7:89:10281:5930#0/2_CONS_SUB_SUB_CMP merged_sample={'29a_F260619': 3}; seq_rank=6; count=3; seq_length=100; 
+ttagccctaaacacaaataattacacaaacaaaattgttcaccagagtactagcggcaac
+agcttaaaactcaaaggacttggcggtgctttataccctt
+>HELIUM_000100422_612GNAAXX:7:29:15520:18035#0/2_CONS_SUB_SUB merged_sample={'29a_F260619': 2}; seq_rank=7; count=2; seq_length=100; 
+ttagccctaaacacaagtaattattataacaaaattattcgccagagtactaccggcaat
+agcttaaaactcaaaggacttggcggtgctttataccctt
+>HELIUM_000100422_612GNAAXX:7:6:9274:14951#0/2_CONS_SUB_SUB merged_sample={'13a_F730603': 46}; count=46; seq_length=100; seq_rank=8; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaat
+agcttaaaactcaaaggacttggcggtgctttataccctt
+>HELIUM_000100422_612GNAAXX:7:24:16230:12703#0/2_CONS_SUB_SUB_CMP merged_sample={'15a_F730814': 1}; seq_rank=9; count=1; seq_length=100; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaat
+agcttaaaactcaaaggacttggcggtgctttatcccctt
+>HELIUM_000100422_612GNAAXX:7:4:4214:9434#0/2_CONS_SUB_SUB merged_sample={'13a_F730603': 1}; seq_rank=10; count=1; seq_length=100; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactacaggcaat
+agcttaaaactcaaaggacttggcggtgctttataccctt
+>HELIUM_000100422_612GNAAXX:7:13:6954:13039#0/2_CONS_SUB_SUB_CMP merged_sample={'26a_F040644': 1}; seq_rank=11; count=1; seq_length=99; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagaggactactagcaata
+gcttaaaactcaaaggacttggcggtgctttatatccct
+>HELIUM_000100422_612GNAAXX:7:38:6201:12003#0/2_CONS_SUB_SUB_CMP merged_sample={'26a_F040644': 1}; seq_rank=12; count=1; seq_length=99; 
+ttagccctaaacatagataattttacaacaaaataattcgccagaggactactagcaata
+gcttaaaactcaaagaactgggcggtgctttatatcccg
+>HELIUM_000100422_612GNAAXX:7:115:17402:4174#0/2_CONS_SUB_SUB_CMP merged_sample={'29a_F260619': 1, '15a_F730814': 1}; seq_rank=13; count=2; seq_length=100; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactacctgcaat
+agcttaaaactcaaaggacttggcggtgctttataccctt
+>HELIUM_000100422_612GNAAXX:7:78:7151:19928#0/2_CONS_SUB_SUB merged_sample={'26a_F040644': 1}; seq_rank=14; count=1; seq_length=99; 
+ttagccctaaacataaacattcaataaacgagaatgttcgccagtgtacttctagcaaca
+ggctgaaactcaaaggacttggcggtggtttacatccct
+>HELIUM_000100422_612GNAAXX:7:38:10813:16867#0/2_CONS_SUB_SUB merged_sample={'26a_F040644': 2}; seq_rank=15; count=2; seq_length=99; 
+ttagccctaaacataaacattcaataaacaagaatgtttgccagagtactactagcaaca
+gcctgaaactcaaaggacttggcggtgctttacatccct
+>HELIUM_000100422_612GNAAXX:7:13:5742:9859#0/2_CONS_SUB_SUB merged_sample={'29a_F260619': 7}; seq_rank=16; count=7; seq_length=4; 
+tttt
+>HELIUM_000100422_612GNAAXX:7:16:16357:19948#0/2_CONS_SUB_SUB merged_sample={'26a_F040644': 1}; seq_rank=17; count=1; seq_length=99; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaaca
+gcctgaaactcacaggacttggcggtgctttacatccct
+>HELIUM_000100422_612GNAAXX:7:107:3570:18147#0/2_CONS_SUB_SUB_CMP merged_sample={'29a_F260619': 1}; seq_rank=18; count=1; seq_length=100; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaat
+agcataaaactcaaaggacttggcggtgctttataccctt
+>HELIUM_000100422_612GNAAXX:7:114:4511:17596#0/2_CONS_SUB_SUB_CMP merged_sample={'29a_F260619': 1}; seq_rank=19; count=1; seq_length=100; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtgctaccggcaat
+agcttaaaactcaaaggacttggcggtgctttatacgctt
+>HELIUM_000100422_612GNAAXX:7:70:11798:2668#0/2_CONS_SUB_SUB merged_sample={'15a_F730814': 2}; seq_rank=20; count=2; seq_length=100; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaat
+agcttaaaactcaaaggacttggcggtgctttataccttt
+>HELIUM_000100422_612GNAAXX:7:29:18416:16620#0/2_CONS_SUB_SUB_CMP merged_sample={'29a_F260619': 1}; seq_rank=21; count=1; seq_length=100; 
+ttagccctaaacacaagtaattattataacaaaattattcgccagagttctaccggcaat
+agcttaaaactcaaaggacttggcggtgctttataccctg
+>HELIUM_000100422_612GNAAXX:7:120:1900:13295#0/2_CONS_SUB_SUB_CMP merged_sample={'15a_F730814': 1}; seq_rank=22; count=1; seq_length=100; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactacgcgcaat
+agcttaaaactcaaaggacttggcggtgctttataccctt
+>HELIUM_000100422_612GNAAXX:7:76:10822:18722#0/2_CONS_SUB_SUB merged_sample={'26a_F040644': 1}; seq_rank=23; count=1; seq_length=99; 
+ttagccctaaacataaacattcaataaacacgaatgttcgccagagtactactagcaaca
+gcctgaaactcaaaggacttggcggtgctttacatccct
+>HELIUM_000100422_612GNAAXX:7:76:8491:8900#0/2_CONS_SUB_SUB_CMP merged_sample={'15a_F730814': 1}; seq_rank=24; count=1; seq_length=100; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtgctacctgcaat
+agcttaaaactcaaaggacttggcggtgctttataccctt
+>HELIUM_000100422_612GNAAXX:7:9:10358:4089#0/2_CONS_SUB_SUB_CMP merged_sample={'13a_F730603': 1}; seq_rank=25; count=1; seq_length=100; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactacaggcaat
+agctcaaaactcaaagaacttggcggtgctttataccctt
+>HELIUM_000100422_612GNAAXX:7:59:11971:12063#0/2_CONS_SUB_SUB merged_sample={'29a_F260619': 1}; seq_rank=26; count=1; seq_length=100; 
+ttagccctaaacacaagtaattaatataacaaaattattcgtcagagtactaccggcaat
+agcttaaaactcaaaggacttggcggtgctttataccctt
+>HELIUM_000100422_612GNAAXX:7:111:19168:18517#0/2_CONS_SUB_SUB merged_sample={'15a_F730814': 1}; seq_rank=27; count=1; seq_length=100; 
+ttagccctaaacacaagtaattaatataacaaaattatccgccagagtactaccggcaat
+agcttaaaactcaaaggacttggcggtgctttataccctt
+>HELIUM_000100422_612GNAAXX:7:41:9316:2256#0/2_CONS_SUB_SUB merged_sample={'29a_F260619': 1}; seq_rank=28; count=1; seq_length=100; 
+ttagccctaaacacaagaaattaatataacaaaattattcgccagagtactaccggcaat
+agcttaaaactcaaaggacttggcggtgctttataccctt
+>HELIUM_000100422_612GNAAXX:7:33:9900:9541#0/2_CONS_SUB_SUB merged_sample={'13a_F730603': 1}; seq_rank=29; count=1; seq_length=100; 
+ctagccctaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaat
+agcttaaaactcaaaggacttggcggtgctttataccctt
+>HELIUM_000100422_612GNAAXX:7:95:1688:9598#0/2_CONS_SUB_SUB_CMP merged_sample={'26a_F040644': 1}; seq_rank=30; count=1; seq_length=99; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtgatactagcaaca
+gcctgaaactcaaaggacttggcggtgctttacatccct
+>HELIUM_000100422_612GNAAXX:7:55:16528:11418#0/2_CONS_SUB_SUB merged_sample={'13a_F730603': 1}; seq_rank=31; count=1; seq_length=100; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcact
+agcttacaactcaaaggacttggcggtgctttataccctt
+>HELIUM_000100422_612GNAAXX:7:19:6313:16567#0/2_CONS_SUB_SUB_CMP merged_sample={'26a_F040644': 1}; seq_rank=32; count=1; seq_length=99; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaaca
+gcctgaaactcaaagggcttggcggtgctttacatccct
+>HELIUM_000100422_612GNAAXX:7:111:8478:1127#0/2_CONS_SUB_SUB_CMP merged_sample={'26a_F040644': 1}; seq_rank=33; count=1; seq_length=99; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaaca
+gcctggaacgcaaaggacttggcggtgctttacatccct
+>HELIUM_000100422_612GNAAXX:7:81:15726:2345#0/2_CONS_SUB_SUB_CMP merged_sample={'26a_F040644': 1}; seq_rank=34; count=1; seq_length=99; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaaca
+gcctgaaactcaaagcactcggcggtgctttacatccct
+>HELIUM_000100422_612GNAAXX:7:7:11110:17924#0/2_CONS_SUB_SUB merged_sample={'15a_F730814': 1}; seq_rank=35; count=1; seq_length=100; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtcataccggcaat
+agcttaaaactcaaaggacttggcggtgctttataccctt
+>HELIUM_000100422_612GNAAXX:7:89:9710:20652#0/2_CONS_SUB_SUB merged_sample={'26a_F040644': 1}; seq_rank=36; count=1; seq_length=99; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaaca
+gcctgaaactcaaaggacttggcggtgctttatatccct
+>HELIUM_000100422_612GNAAXX:7:71:17473:7401#0/2_CONS_SUB_SUB_CMP merged_sample={'15a_F730814': 1}; seq_rank=37; count=1; seq_length=100; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggtaat
+agcttaaaactcaaaggacttggcggtgctttataccctt
+>HELIUM_000100422_612GNAAXX:7:115:3625:10051#0/2_CONS_SUB_SUB merged_sample={'13a_F730603': 1}; seq_rank=38; count=1; seq_length=5; 
+caata
+>HELIUM_000100422_612GNAAXX:7:99:8183:13912#0/2_CONS_SUB_SUB merged_sample={'13a_F730603': 1}; seq_rank=39; count=1; seq_length=100; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaat
+agcttaaaactcaaaggacttggcggtgctttataccctc
+>HELIUM_000100422_612GNAAXX:7:22:1798:3790#0/2_CONS_SUB_SUB_CMP merged_sample={'13a_F730603': 1}; seq_rank=40; count=1; seq_length=100; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtgctaccggcaat
+agcttaaaactcaaaggacttggcggtgctttataccctt
+>HELIUM_000100422_612GNAAXX:7:115:14354:10118#0/2_CONS_SUB_SUB_CMP merged_sample={'26a_F040644': 1}; seq_rank=41; count=1; seq_length=99; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactcgcaaca
+gcctgaaactcaaaggacttggcggtgctttacatccct
+>HELIUM_000100422_612GNAAXX:7:103:3594:15996#0/2_CONS_SUB_SUB merged_sample={'13a_F730603': 1}; seq_rank=42; count=1; seq_length=100; 
+ctagccttaaacacaaatagttatgcaaacacaactattcgccagagtactaccggcaat
+agcttaaaactcaaaggacttggcggtgctttataccctt
+>HELIUM_000100422_612GNAAXX:7:105:14135:6905#0/2_CONS_SUB_SUB merged_sample={'29a_F260619': 1}; seq_rank=43; count=1; seq_length=100; 
+ttagccctaaacacaagtaattaatataacaaaattattcaccagagtactagcggcaac
+agcttaaaactcaaaggacttggcggtgctttataccctt
+>HELIUM_000100422_612GNAAXX:7:76:18268:14980#0/2_CONS_SUB_SUB_CMP merged_sample={'29a_F260619': 1}; seq_rank=44; count=1; seq_length=100; 
+ttacccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaat
+agcttaaaactcaaaggacttggcggtgctttataccctt
+>HELIUM_000100422_612GNAAXX:7:25:7789:3090#0/2_CONS_SUB_SUB_CMP merged_sample={'29a_F260619': 1}; seq_rank=45; count=1; seq_length=100; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactacaggcaat
+agcttaaaactcaaaggacttggcggtgctttataccctt
+>HELIUM_000100422_612GNAAXX:7:42:19757:3800#0/2_CONS_SUB_SUB_CMP merged_sample={'15a_F730814': 1}; seq_rank=46; count=1; seq_length=99; 
+ttagccctaaacacaagtaattaatatacaaaattattcgccagagtactaccggcaata
+gcttaaaactcaaaggacttggcggtgctttataccctt
+>HELIUM_000100422_612GNAAXX:7:116:14244:17926#0/2_CONS_SUB_SUB merged_sample={'26a_F040644': 1}; seq_rank=47; count=1; seq_length=99; 
+ttagccctaaacataaacattcaataaacaagaatgttcgcaagagtactactagcaaca
+gcctgaaactcaaaggacttggcggtgctttacatccct
+>HELIUM_000100422_612GNAAXX:7:72:12959:5736#0/2_CONS_SUB_SUB_CMP merged_sample={'26a_F040644': 1}; seq_rank=48; count=1; seq_length=99; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaaca
+gcctgaaactcaaaggacttggcggtgctttacacccct
+>HELIUM_000100422_612GNAAXX:7:7:15538:8325#0/2_CONS_SUB_SUB_CMP merged_sample={'26a_F040644': 1}; seq_rank=49; count=1; seq_length=99; 
+ttagccctaaacataaacattcaataaacaagaatgtcggccagagtactactagcaaca
+gcatgaaactcaaagaactgggcggtgctttacatccct
+>HELIUM_000100422_612GNAAXX:7:120:16005:7955#0/2_CONS_SUB_SUB_CMP merged_sample={'26a_F040644': 1}; seq_rank=50; count=1; seq_length=98; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaaca
+gccgaaactcaaaggacttggcggtgctttacatccct
+>HELIUM_000100422_612GNAAXX:7:10:9237:10532#0/2_CONS_SUB_SUB_CMP merged_sample={'29a_F260619': 1}; seq_rank=51; count=1; seq_length=100; 
+ttagccctaaacacaagtaattaatataacaaaataattcgccagagtactaccggcaat
+agcttaaaactcaaaggacttggcggtgctttataccctt
+>HELIUM_000100422_612GNAAXX:7:7:11998:4462#0/2_CONS_SUB_SUB merged_sample={'26a_F040644': 1}; seq_rank=52; count=1; seq_length=99; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtagtactagcaaca
+gcctgaaactcaaaggacttggcggtgctttacatccct
+>HELIUM_000100422_612GNAAXX:7:111:18277:17779#0/2_CONS_SUB_SUB_CMP merged_sample={'26a_F040644': 1}; seq_rank=53; count=1; seq_length=99; 
+ttagccctaaacatagataattttacaacaaaataattcgccagaggactactagcaata
+gcctgaaactcaaaggacttggcggtgctttacatccct
+>HELIUM_000100422_612GNAAXX:7:3:17077:6562#0/2_CONS_SUB_SUB_CMP merged_sample={'15a_F730814': 1}; seq_rank=54; count=1; seq_length=100; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactgccggcaat
+agcttaaaactcaaaggacttggcggtgctttataccctt
+>HELIUM_000100422_612GNAAXX:7:19:4311:13343#0/2_CONS_SUB_SUB_CMP merged_sample={'26a_F040644': 1}; seq_rank=55; count=1; seq_length=99; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactacgagcaaca
+gcctgaaactcaaaggacttggcggtgctttacatccct
+>HELIUM_000100422_612GNAAXX:7:30:1800:7833#0/2_CONS_SUB_SUB merged_sample={'15a_F730814': 1}; seq_rank=56; count=1; seq_length=100; 
+ttagccctaaacacaagacattaatataacgagattaatcgacagagtactaccggctat
+agcttaaaactcaaaggacttggcggtgctttataccctt
+>HELIUM_000100422_612GNAAXX:7:108:9222:18258#0/2_CONS_SUB_SUB merged_sample={'13a_F730603': 1}; seq_rank=57; count=1; seq_length=100; 
+ctagccttaaacacaaatagttatgcagacaaaactattcgccagagtactaccggcaat
+agcttaaaactcaaaggacttggcggtgctttataccctt
+>HELIUM_000100422_612GNAAXX:7:38:3005:20881#0/2_CONS_SUB_SUB_CMP merged_sample={'26a_F040644': 1}; seq_rank=58; count=1; seq_length=99; 
+ttagccctaaacatgaacattcaataaacaagaatgttcgccagagtactactagcaaca
+gcctgaaactcaaaggacttggcggtgctttacatccct
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/output_obiclean_advanced.fasta	Wed Apr 12 17:38:00 2017 -0400
@@ -0,0 +1,172 @@
+>HELIUM_000100422_612GNAAXX:7:119:14871:19157#0/2_CONS_SUB_SUB_CMP merged_sample={'29a_F260619': 1}; obiclean_internalcount=0; obiclean_singletoncount=1; count=1; seq_length=100; obiclean_headcount=0; seq_rank=1; obiclean_samplecount=1; obiclean_head=True; 
+ttagccctaaacacaagtaattattataacaaaatcattcgccagagtactaccggcaat
+agctcaaaactcaaaggacttggcggtgctttataccctt
+>HELIUM_000100422_612GNAAXX:7:108:5640:3823#0/2_CONS_SUB_SUB_CMP merged_sample={'29a_F260619': 1}; obiclean_internalcount=1; obiclean_singletoncount=0; count=1; seq_length=100; obiclean_headcount=0; seq_rank=2; obiclean_samplecount=1; obiclean_head=False; 
+ttagccctaaacacaagtaattaatataacaaaattgttcgccagagtactaccggcaat
+agcttaaaactcaaaggacttggcggtgctttataccctt
+>HELIUM_000100422_612GNAAXX:7:97:14311:19299#0/2_CONS_SUB_SUB_CMP merged_sample={'29a_F260619': 1}; obiclean_internalcount=1; obiclean_singletoncount=0; count=1; seq_length=100; obiclean_headcount=0; seq_rank=3; obiclean_samplecount=1; obiclean_head=False; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaag
+agcttaaaactcaaaggacttggcggtgctttataccctt
+>HELIUM_000100422_612GNAAXX:7:22:8540:14708#0/2_CONS_SUB_SUB merged_sample={'29a_F260619': 30, '15a_F730814': 31}; obiclean_internalcount=0; obiclean_singletoncount=0; count=61; seq_length=100; obiclean_headcount=2; seq_rank=4; obiclean_samplecount=2; obiclean_head=True; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaat
+agcttaaaactcaaaggacttggcggtgctttataccctt
+>HELIUM_000100422_612GNAAXX:7:57:18459:16145#0/2_CONS_SUB_SUB_CMP merged_sample={'26a_F040644': 64}; obiclean_internalcount=0; obiclean_singletoncount=0; count=64; seq_length=99; obiclean_headcount=1; seq_rank=5; obiclean_samplecount=1; obiclean_head=True; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaaca
+gcctgaaactcaaaggacttggcggtgctttacatccct
+>HELIUM_000100422_612GNAAXX:7:89:10281:5930#0/2_CONS_SUB_SUB_CMP merged_sample={'29a_F260619': 3}; obiclean_internalcount=0; obiclean_singletoncount=1; count=3; seq_length=100; obiclean_headcount=0; seq_rank=6; obiclean_samplecount=1; obiclean_head=True; 
+ttagccctaaacacaaataattacacaaacaaaattgttcaccagagtactagcggcaac
+agcttaaaactcaaaggacttggcggtgctttataccctt
+>HELIUM_000100422_612GNAAXX:7:29:15520:18035#0/2_CONS_SUB_SUB merged_sample={'29a_F260619': 2}; obiclean_internalcount=0; obiclean_singletoncount=1; count=2; seq_length=100; obiclean_headcount=0; seq_rank=7; obiclean_samplecount=1; obiclean_head=True; 
+ttagccctaaacacaagtaattattataacaaaattattcgccagagtactaccggcaat
+agcttaaaactcaaaggacttggcggtgctttataccctt
+>HELIUM_000100422_612GNAAXX:7:6:9274:14951#0/2_CONS_SUB_SUB merged_sample={'13a_F730603': 46}; obiclean_internalcount=0; obiclean_singletoncount=0; count=46; seq_length=100; obiclean_headcount=1; seq_rank=8; obiclean_samplecount=1; obiclean_head=True; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaat
+agcttaaaactcaaaggacttggcggtgctttataccctt
+>HELIUM_000100422_612GNAAXX:7:24:16230:12703#0/2_CONS_SUB_SUB_CMP merged_sample={'15a_F730814': 1}; obiclean_internalcount=1; obiclean_singletoncount=0; count=1; seq_length=100; obiclean_headcount=0; seq_rank=9; obiclean_samplecount=1; obiclean_head=False; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaat
+agcttaaaactcaaaggacttggcggtgctttatcccctt
+>HELIUM_000100422_612GNAAXX:7:4:4214:9434#0/2_CONS_SUB_SUB merged_sample={'13a_F730603': 1}; obiclean_internalcount=1; obiclean_singletoncount=0; count=1; seq_length=100; obiclean_headcount=0; seq_rank=10; obiclean_samplecount=1; obiclean_head=False; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactacaggcaat
+agcttaaaactcaaaggacttggcggtgctttataccctt
+>HELIUM_000100422_612GNAAXX:7:13:6954:13039#0/2_CONS_SUB_SUB_CMP merged_sample={'26a_F040644': 1}; obiclean_internalcount=0; obiclean_singletoncount=1; count=1; seq_length=99; obiclean_headcount=0; seq_rank=11; obiclean_samplecount=1; obiclean_head=True; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagaggactactagcaata
+gcttaaaactcaaaggacttggcggtgctttatatccct
+>HELIUM_000100422_612GNAAXX:7:38:6201:12003#0/2_CONS_SUB_SUB_CMP merged_sample={'26a_F040644': 1}; obiclean_internalcount=0; obiclean_singletoncount=1; count=1; seq_length=99; obiclean_headcount=0; seq_rank=12; obiclean_samplecount=1; obiclean_head=True; 
+ttagccctaaacatagataattttacaacaaaataattcgccagaggactactagcaata
+gcttaaaactcaaagaactgggcggtgctttatatcccg
+>HELIUM_000100422_612GNAAXX:7:115:17402:4174#0/2_CONS_SUB_SUB_CMP merged_sample={'29a_F260619': 1, '15a_F730814': 1}; obiclean_internalcount=2; obiclean_singletoncount=0; count=2; seq_length=100; obiclean_headcount=0; seq_rank=13; obiclean_samplecount=2; obiclean_head=False; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactacctgcaat
+agcttaaaactcaaaggacttggcggtgctttataccctt
+>HELIUM_000100422_612GNAAXX:7:78:7151:19928#0/2_CONS_SUB_SUB merged_sample={'26a_F040644': 1}; obiclean_internalcount=0; obiclean_singletoncount=1; count=1; seq_length=99; obiclean_headcount=0; seq_rank=14; obiclean_samplecount=1; obiclean_head=True; 
+ttagccctaaacataaacattcaataaacgagaatgttcgccagtgtacttctagcaaca
+ggctgaaactcaaaggacttggcggtggtttacatccct
+>HELIUM_000100422_612GNAAXX:7:38:10813:16867#0/2_CONS_SUB_SUB merged_sample={'26a_F040644': 2}; obiclean_internalcount=1; obiclean_singletoncount=0; count=2; seq_length=99; obiclean_headcount=0; seq_rank=15; obiclean_samplecount=1; obiclean_head=False; 
+ttagccctaaacataaacattcaataaacaagaatgtttgccagagtactactagcaaca
+gcctgaaactcaaaggacttggcggtgctttacatccct
+>HELIUM_000100422_612GNAAXX:7:13:5742:9859#0/2_CONS_SUB_SUB merged_sample={'29a_F260619': 7}; obiclean_internalcount=0; obiclean_singletoncount=1; count=7; seq_length=4; obiclean_headcount=0; seq_rank=16; obiclean_samplecount=1; obiclean_head=True; 
+tttt
+>HELIUM_000100422_612GNAAXX:7:16:16357:19948#0/2_CONS_SUB_SUB merged_sample={'26a_F040644': 1}; obiclean_internalcount=1; obiclean_singletoncount=0; count=1; seq_length=99; obiclean_headcount=0; seq_rank=17; obiclean_samplecount=1; obiclean_head=False; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaaca
+gcctgaaactcacaggacttggcggtgctttacatccct
+>HELIUM_000100422_612GNAAXX:7:107:3570:18147#0/2_CONS_SUB_SUB_CMP merged_sample={'29a_F260619': 1}; obiclean_internalcount=1; obiclean_singletoncount=0; count=1; seq_length=100; obiclean_headcount=0; seq_rank=18; obiclean_samplecount=1; obiclean_head=False; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaat
+agcataaaactcaaaggacttggcggtgctttataccctt
+>HELIUM_000100422_612GNAAXX:7:114:4511:17596#0/2_CONS_SUB_SUB_CMP merged_sample={'29a_F260619': 1}; obiclean_internalcount=0; obiclean_singletoncount=1; count=1; seq_length=100; obiclean_headcount=0; seq_rank=19; obiclean_samplecount=1; obiclean_head=True; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtgctaccggcaat
+agcttaaaactcaaaggacttggcggtgctttatacgctt
+>HELIUM_000100422_612GNAAXX:7:70:11798:2668#0/2_CONS_SUB_SUB merged_sample={'15a_F730814': 2}; obiclean_internalcount=0; obiclean_singletoncount=1; count=2; seq_length=100; obiclean_headcount=0; seq_rank=20; obiclean_samplecount=1; obiclean_head=True; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaat
+agcttaaaactcaaaggacttggcggtgctttataccttt
+>HELIUM_000100422_612GNAAXX:7:29:18416:16620#0/2_CONS_SUB_SUB_CMP merged_sample={'29a_F260619': 1}; obiclean_internalcount=0; obiclean_singletoncount=1; count=1; seq_length=100; obiclean_headcount=0; seq_rank=21; obiclean_samplecount=1; obiclean_head=True; 
+ttagccctaaacacaagtaattattataacaaaattattcgccagagttctaccggcaat
+agcttaaaactcaaaggacttggcggtgctttataccctg
+>HELIUM_000100422_612GNAAXX:7:120:1900:13295#0/2_CONS_SUB_SUB_CMP merged_sample={'15a_F730814': 1}; obiclean_internalcount=0; obiclean_singletoncount=1; count=1; seq_length=100; obiclean_headcount=0; seq_rank=22; obiclean_samplecount=1; obiclean_head=True; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactacgcgcaat
+agcttaaaactcaaaggacttggcggtgctttataccctt
+>HELIUM_000100422_612GNAAXX:7:76:10822:18722#0/2_CONS_SUB_SUB merged_sample={'26a_F040644': 1}; obiclean_internalcount=1; obiclean_singletoncount=0; count=1; seq_length=99; obiclean_headcount=0; seq_rank=23; obiclean_samplecount=1; obiclean_head=False; 
+ttagccctaaacataaacattcaataaacacgaatgttcgccagagtactactagcaaca
+gcctgaaactcaaaggacttggcggtgctttacatccct
+>HELIUM_000100422_612GNAAXX:7:76:8491:8900#0/2_CONS_SUB_SUB_CMP merged_sample={'15a_F730814': 1}; obiclean_internalcount=0; obiclean_singletoncount=1; count=1; seq_length=100; obiclean_headcount=0; seq_rank=24; obiclean_samplecount=1; obiclean_head=True; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtgctacctgcaat
+agcttaaaactcaaaggacttggcggtgctttataccctt
+>HELIUM_000100422_612GNAAXX:7:9:10358:4089#0/2_CONS_SUB_SUB_CMP merged_sample={'13a_F730603': 1}; obiclean_internalcount=0; obiclean_singletoncount=1; count=1; seq_length=100; obiclean_headcount=0; seq_rank=25; obiclean_samplecount=1; obiclean_head=True; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactacaggcaat
+agctcaaaactcaaagaacttggcggtgctttataccctt
+>HELIUM_000100422_612GNAAXX:7:59:11971:12063#0/2_CONS_SUB_SUB merged_sample={'29a_F260619': 1}; obiclean_internalcount=1; obiclean_singletoncount=0; count=1; seq_length=100; obiclean_headcount=0; seq_rank=26; obiclean_samplecount=1; obiclean_head=False; 
+ttagccctaaacacaagtaattaatataacaaaattattcgtcagagtactaccggcaat
+agcttaaaactcaaaggacttggcggtgctttataccctt
+>HELIUM_000100422_612GNAAXX:7:111:19168:18517#0/2_CONS_SUB_SUB merged_sample={'15a_F730814': 1}; obiclean_internalcount=1; obiclean_singletoncount=0; count=1; seq_length=100; obiclean_headcount=0; seq_rank=27; obiclean_samplecount=1; obiclean_head=False; 
+ttagccctaaacacaagtaattaatataacaaaattatccgccagagtactaccggcaat
+agcttaaaactcaaaggacttggcggtgctttataccctt
+>HELIUM_000100422_612GNAAXX:7:41:9316:2256#0/2_CONS_SUB_SUB merged_sample={'29a_F260619': 1}; obiclean_internalcount=1; obiclean_singletoncount=0; count=1; seq_length=100; obiclean_headcount=0; seq_rank=28; obiclean_samplecount=1; obiclean_head=False; 
+ttagccctaaacacaagaaattaatataacaaaattattcgccagagtactaccggcaat
+agcttaaaactcaaaggacttggcggtgctttataccctt
+>HELIUM_000100422_612GNAAXX:7:33:9900:9541#0/2_CONS_SUB_SUB merged_sample={'13a_F730603': 1}; obiclean_internalcount=1; obiclean_singletoncount=0; count=1; seq_length=100; obiclean_headcount=0; seq_rank=29; obiclean_samplecount=1; obiclean_head=False; 
+ctagccctaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaat
+agcttaaaactcaaaggacttggcggtgctttataccctt
+>HELIUM_000100422_612GNAAXX:7:95:1688:9598#0/2_CONS_SUB_SUB_CMP merged_sample={'26a_F040644': 1}; obiclean_internalcount=0; obiclean_singletoncount=1; count=1; seq_length=99; obiclean_headcount=0; seq_rank=30; obiclean_samplecount=1; obiclean_head=True; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtgatactagcaaca
+gcctgaaactcaaaggacttggcggtgctttacatccct
+>HELIUM_000100422_612GNAAXX:7:55:16528:11418#0/2_CONS_SUB_SUB merged_sample={'13a_F730603': 1}; obiclean_internalcount=0; obiclean_singletoncount=1; count=1; seq_length=100; obiclean_headcount=0; seq_rank=31; obiclean_samplecount=1; obiclean_head=True; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcact
+agcttacaactcaaaggacttggcggtgctttataccctt
+>HELIUM_000100422_612GNAAXX:7:19:6313:16567#0/2_CONS_SUB_SUB_CMP merged_sample={'26a_F040644': 1}; obiclean_internalcount=1; obiclean_singletoncount=0; count=1; seq_length=99; obiclean_headcount=0; seq_rank=32; obiclean_samplecount=1; obiclean_head=False; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaaca
+gcctgaaactcaaagggcttggcggtgctttacatccct
+>HELIUM_000100422_612GNAAXX:7:111:8478:1127#0/2_CONS_SUB_SUB_CMP merged_sample={'26a_F040644': 1}; obiclean_internalcount=0; obiclean_singletoncount=1; count=1; seq_length=99; obiclean_headcount=0; seq_rank=33; obiclean_samplecount=1; obiclean_head=True; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaaca
+gcctggaacgcaaaggacttggcggtgctttacatccct
+>HELIUM_000100422_612GNAAXX:7:81:15726:2345#0/2_CONS_SUB_SUB_CMP merged_sample={'26a_F040644': 1}; obiclean_internalcount=0; obiclean_singletoncount=1; count=1; seq_length=99; obiclean_headcount=0; seq_rank=34; obiclean_samplecount=1; obiclean_head=True; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaaca
+gcctgaaactcaaagcactcggcggtgctttacatccct
+>HELIUM_000100422_612GNAAXX:7:7:11110:17924#0/2_CONS_SUB_SUB merged_sample={'15a_F730814': 1}; obiclean_internalcount=0; obiclean_singletoncount=1; count=1; seq_length=100; obiclean_headcount=0; seq_rank=35; obiclean_samplecount=1; obiclean_head=True; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtcataccggcaat
+agcttaaaactcaaaggacttggcggtgctttataccctt
+>HELIUM_000100422_612GNAAXX:7:89:9710:20652#0/2_CONS_SUB_SUB merged_sample={'26a_F040644': 1}; obiclean_internalcount=1; obiclean_singletoncount=0; count=1; seq_length=99; obiclean_headcount=0; seq_rank=36; obiclean_samplecount=1; obiclean_head=False; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaaca
+gcctgaaactcaaaggacttggcggtgctttatatccct
+>HELIUM_000100422_612GNAAXX:7:71:17473:7401#0/2_CONS_SUB_SUB_CMP merged_sample={'15a_F730814': 1}; obiclean_internalcount=1; obiclean_singletoncount=0; count=1; seq_length=100; obiclean_headcount=0; seq_rank=37; obiclean_samplecount=1; obiclean_head=False; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggtaat
+agcttaaaactcaaaggacttggcggtgctttataccctt
+>HELIUM_000100422_612GNAAXX:7:115:3625:10051#0/2_CONS_SUB_SUB merged_sample={'13a_F730603': 1}; obiclean_internalcount=0; obiclean_singletoncount=1; count=1; seq_length=5; obiclean_headcount=0; seq_rank=38; obiclean_samplecount=1; obiclean_head=True; 
+caata
+>HELIUM_000100422_612GNAAXX:7:99:8183:13912#0/2_CONS_SUB_SUB merged_sample={'13a_F730603': 1}; obiclean_internalcount=1; obiclean_singletoncount=0; count=1; seq_length=100; obiclean_headcount=0; seq_rank=39; obiclean_samplecount=1; obiclean_head=False; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaat
+agcttaaaactcaaaggacttggcggtgctttataccctc
+>HELIUM_000100422_612GNAAXX:7:22:1798:3790#0/2_CONS_SUB_SUB_CMP merged_sample={'13a_F730603': 1}; obiclean_internalcount=1; obiclean_singletoncount=0; count=1; seq_length=100; obiclean_headcount=0; seq_rank=40; obiclean_samplecount=1; obiclean_head=False; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtgctaccggcaat
+agcttaaaactcaaaggacttggcggtgctttataccctt
+>HELIUM_000100422_612GNAAXX:7:115:14354:10118#0/2_CONS_SUB_SUB_CMP merged_sample={'26a_F040644': 1}; obiclean_internalcount=1; obiclean_singletoncount=0; count=1; seq_length=99; obiclean_headcount=0; seq_rank=41; obiclean_samplecount=1; obiclean_head=False; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactcgcaaca
+gcctgaaactcaaaggacttggcggtgctttacatccct
+>HELIUM_000100422_612GNAAXX:7:103:3594:15996#0/2_CONS_SUB_SUB merged_sample={'13a_F730603': 1}; obiclean_internalcount=1; obiclean_singletoncount=0; count=1; seq_length=100; obiclean_headcount=0; seq_rank=42; obiclean_samplecount=1; obiclean_head=False; 
+ctagccttaaacacaaatagttatgcaaacacaactattcgccagagtactaccggcaat
+agcttaaaactcaaaggacttggcggtgctttataccctt
+>HELIUM_000100422_612GNAAXX:7:105:14135:6905#0/2_CONS_SUB_SUB merged_sample={'29a_F260619': 1}; obiclean_internalcount=0; obiclean_singletoncount=1; count=1; seq_length=100; obiclean_headcount=0; seq_rank=43; obiclean_samplecount=1; obiclean_head=True; 
+ttagccctaaacacaagtaattaatataacaaaattattcaccagagtactagcggcaac
+agcttaaaactcaaaggacttggcggtgctttataccctt
+>HELIUM_000100422_612GNAAXX:7:76:18268:14980#0/2_CONS_SUB_SUB_CMP merged_sample={'29a_F260619': 1}; obiclean_internalcount=1; obiclean_singletoncount=0; count=1; seq_length=100; obiclean_headcount=0; seq_rank=44; obiclean_samplecount=1; obiclean_head=False; 
+ttacccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaat
+agcttaaaactcaaaggacttggcggtgctttataccctt
+>HELIUM_000100422_612GNAAXX:7:25:7789:3090#0/2_CONS_SUB_SUB_CMP merged_sample={'29a_F260619': 1}; obiclean_internalcount=1; obiclean_singletoncount=0; count=1; seq_length=100; obiclean_headcount=0; seq_rank=45; obiclean_samplecount=1; obiclean_head=False; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactacaggcaat
+agcttaaaactcaaaggacttggcggtgctttataccctt
+>HELIUM_000100422_612GNAAXX:7:42:19757:3800#0/2_CONS_SUB_SUB_CMP merged_sample={'15a_F730814': 1}; obiclean_internalcount=1; obiclean_singletoncount=0; count=1; seq_length=99; obiclean_headcount=0; seq_rank=46; obiclean_samplecount=1; obiclean_head=False; 
+ttagccctaaacacaagtaattaatatacaaaattattcgccagagtactaccggcaata
+gcttaaaactcaaaggacttggcggtgctttataccctt
+>HELIUM_000100422_612GNAAXX:7:116:14244:17926#0/2_CONS_SUB_SUB merged_sample={'26a_F040644': 1}; obiclean_internalcount=1; obiclean_singletoncount=0; count=1; seq_length=99; obiclean_headcount=0; seq_rank=47; obiclean_samplecount=1; obiclean_head=False; 
+ttagccctaaacataaacattcaataaacaagaatgttcgcaagagtactactagcaaca
+gcctgaaactcaaaggacttggcggtgctttacatccct
+>HELIUM_000100422_612GNAAXX:7:72:12959:5736#0/2_CONS_SUB_SUB_CMP merged_sample={'26a_F040644': 1}; obiclean_internalcount=1; obiclean_singletoncount=0; count=1; seq_length=99; obiclean_headcount=0; seq_rank=48; obiclean_samplecount=1; obiclean_head=False; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaaca
+gcctgaaactcaaaggacttggcggtgctttacacccct
+>HELIUM_000100422_612GNAAXX:7:7:15538:8325#0/2_CONS_SUB_SUB_CMP merged_sample={'26a_F040644': 1}; obiclean_internalcount=0; obiclean_singletoncount=1; count=1; seq_length=99; obiclean_headcount=0; seq_rank=49; obiclean_samplecount=1; obiclean_head=True; 
+ttagccctaaacataaacattcaataaacaagaatgtcggccagagtactactagcaaca
+gcatgaaactcaaagaactgggcggtgctttacatccct
+>HELIUM_000100422_612GNAAXX:7:120:16005:7955#0/2_CONS_SUB_SUB_CMP merged_sample={'26a_F040644': 1}; obiclean_internalcount=1; obiclean_singletoncount=0; count=1; seq_length=98; obiclean_headcount=0; seq_rank=50; obiclean_samplecount=1; obiclean_head=False; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaaca
+gccgaaactcaaaggacttggcggtgctttacatccct
+>HELIUM_000100422_612GNAAXX:7:10:9237:10532#0/2_CONS_SUB_SUB_CMP merged_sample={'29a_F260619': 1}; obiclean_internalcount=1; obiclean_singletoncount=0; count=1; seq_length=100; obiclean_headcount=0; seq_rank=51; obiclean_samplecount=1; obiclean_head=False; 
+ttagccctaaacacaagtaattaatataacaaaataattcgccagagtactaccggcaat
+agcttaaaactcaaaggacttggcggtgctttataccctt
+>HELIUM_000100422_612GNAAXX:7:7:11998:4462#0/2_CONS_SUB_SUB merged_sample={'26a_F040644': 1}; obiclean_internalcount=1; obiclean_singletoncount=0; count=1; seq_length=99; obiclean_headcount=0; seq_rank=52; obiclean_samplecount=1; obiclean_head=False; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtagtactagcaaca
+gcctgaaactcaaaggacttggcggtgctttacatccct
+>HELIUM_000100422_612GNAAXX:7:111:18277:17779#0/2_CONS_SUB_SUB_CMP merged_sample={'26a_F040644': 1}; obiclean_internalcount=0; obiclean_singletoncount=1; count=1; seq_length=99; obiclean_headcount=0; seq_rank=53; obiclean_samplecount=1; obiclean_head=True; 
+ttagccctaaacatagataattttacaacaaaataattcgccagaggactactagcaata
+gcctgaaactcaaaggacttggcggtgctttacatccct
+>HELIUM_000100422_612GNAAXX:7:3:17077:6562#0/2_CONS_SUB_SUB_CMP merged_sample={'15a_F730814': 1}; obiclean_internalcount=1; obiclean_singletoncount=0; count=1; seq_length=100; obiclean_headcount=0; seq_rank=54; obiclean_samplecount=1; obiclean_head=False; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactgccggcaat
+agcttaaaactcaaaggacttggcggtgctttataccctt
+>HELIUM_000100422_612GNAAXX:7:19:4311:13343#0/2_CONS_SUB_SUB_CMP merged_sample={'26a_F040644': 1}; obiclean_internalcount=1; obiclean_singletoncount=0; count=1; seq_length=99; obiclean_headcount=0; seq_rank=55; obiclean_samplecount=1; obiclean_head=False; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactacgagcaaca
+gcctgaaactcaaaggacttggcggtgctttacatccct
+>HELIUM_000100422_612GNAAXX:7:30:1800:7833#0/2_CONS_SUB_SUB merged_sample={'15a_F730814': 1}; obiclean_internalcount=0; obiclean_singletoncount=1; count=1; seq_length=100; obiclean_headcount=0; seq_rank=56; obiclean_samplecount=1; obiclean_head=True; 
+ttagccctaaacacaagacattaatataacgagattaatcgacagagtactaccggctat
+agcttaaaactcaaaggacttggcggtgctttataccctt
+>HELIUM_000100422_612GNAAXX:7:108:9222:18258#0/2_CONS_SUB_SUB merged_sample={'13a_F730603': 1}; obiclean_internalcount=1; obiclean_singletoncount=0; count=1; seq_length=100; obiclean_headcount=0; seq_rank=57; obiclean_samplecount=1; obiclean_head=False; 
+ctagccttaaacacaaatagttatgcagacaaaactattcgccagagtactaccggcaat
+agcttaaaactcaaaggacttggcggtgctttataccctt
+>HELIUM_000100422_612GNAAXX:7:38:3005:20881#0/2_CONS_SUB_SUB_CMP merged_sample={'26a_F040644': 1}; obiclean_internalcount=1; obiclean_singletoncount=0; count=1; seq_length=99; obiclean_headcount=0; seq_rank=58; obiclean_samplecount=1; obiclean_head=False; 
+ttagccctaaacatgaacattcaataaacaagaatgttcgccagagtactactagcaaca
+gcctgaaactcaaaggacttggcggtgctttacatccct
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/output_obiclean_simple.fasta	Wed Apr 12 17:38:00 2017 -0400
@@ -0,0 +1,67 @@
+>HELIUM_000100422_612GNAAXX:7:119:14871:19157#0/2_CONS_SUB_SUB_CMP count=1; obiclean_count={'XXX': 1}; obiclean_head=True; obiclean_cluster={'XXX': 'HELIUM_000100422_612GNAAXX:7:119:14871:19157#0/2_CONS_SUB_SUB_CMP'}; seq_length=100; obiclean_internalcount=0; obiclean_status={'XXX': 's'}; seq_rank=1; merged_sample={'29a_F260619': 1}; obiclean_samplecount=1; obiclean_headcount=0; obiclean_singletoncount=1; 
+ttagccctaaacacaagtaattattataacaaaatcattcgccagagtactaccggcaat
+agctcaaaactcaaaggacttggcggtgctttataccctt
+>HELIUM_000100422_612GNAAXX:7:22:8540:14708#0/2_CONS_SUB_SUB count=61; obiclean_count={'XXX': 81}; obiclean_head=True; obiclean_cluster={'XXX': 'HELIUM_000100422_612GNAAXX:7:22:8540:14708#0/2_CONS_SUB_SUB'}; seq_length=100; obiclean_internalcount=0; obiclean_status={'XXX': 'h'}; seq_rank=4; merged_sample={'29a_F260619': 30, '15a_F730814': 31}; obiclean_samplecount=1; obiclean_headcount=1; obiclean_singletoncount=0; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaat
+agcttaaaactcaaaggacttggcggtgctttataccctt
+>HELIUM_000100422_612GNAAXX:7:57:18459:16145#0/2_CONS_SUB_SUB_CMP count=64; obiclean_count={'XXX': 77}; obiclean_head=True; obiclean_cluster={'XXX': 'HELIUM_000100422_612GNAAXX:7:57:18459:16145#0/2_CONS_SUB_SUB_CMP'}; seq_length=99; obiclean_internalcount=0; obiclean_status={'XXX': 'h'}; seq_rank=5; merged_sample={'26a_F040644': 64}; obiclean_samplecount=1; obiclean_headcount=1; obiclean_singletoncount=0; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaaca
+gcctgaaactcaaaggacttggcggtgctttacatccct
+>HELIUM_000100422_612GNAAXX:7:89:10281:5930#0/2_CONS_SUB_SUB_CMP count=3; obiclean_count={'XXX': 3}; obiclean_head=True; obiclean_cluster={'XXX': 'HELIUM_000100422_612GNAAXX:7:89:10281:5930#0/2_CONS_SUB_SUB_CMP'}; seq_length=100; obiclean_internalcount=0; obiclean_status={'XXX': 's'}; seq_rank=6; merged_sample={'29a_F260619': 3}; obiclean_samplecount=1; obiclean_headcount=0; obiclean_singletoncount=1; 
+ttagccctaaacacaaataattacacaaacaaaattgttcaccagagtactagcggcaac
+agcttaaaactcaaaggacttggcggtgctttataccctt
+>HELIUM_000100422_612GNAAXX:7:6:9274:14951#0/2_CONS_SUB_SUB count=46; obiclean_count={'XXX': 52}; obiclean_head=True; obiclean_cluster={'XXX': 'HELIUM_000100422_612GNAAXX:7:6:9274:14951#0/2_CONS_SUB_SUB'}; seq_length=100; obiclean_internalcount=0; obiclean_status={'XXX': 'h'}; seq_rank=8; merged_sample={'13a_F730603': 46}; obiclean_samplecount=1; obiclean_headcount=1; obiclean_singletoncount=0; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaat
+agcttaaaactcaaaggacttggcggtgctttataccctt
+>HELIUM_000100422_612GNAAXX:7:13:6954:13039#0/2_CONS_SUB_SUB_CMP count=1; obiclean_count={'XXX': 1}; obiclean_head=True; obiclean_cluster={'XXX': 'HELIUM_000100422_612GNAAXX:7:13:6954:13039#0/2_CONS_SUB_SUB_CMP'}; seq_length=99; obiclean_internalcount=0; obiclean_status={'XXX': 's'}; seq_rank=11; merged_sample={'26a_F040644': 1}; obiclean_samplecount=1; obiclean_headcount=0; obiclean_singletoncount=1; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagaggactactagcaata
+gcttaaaactcaaaggacttggcggtgctttatatccct
+>HELIUM_000100422_612GNAAXX:7:38:6201:12003#0/2_CONS_SUB_SUB_CMP count=1; obiclean_count={'XXX': 1}; obiclean_head=True; obiclean_cluster={'XXX': 'HELIUM_000100422_612GNAAXX:7:38:6201:12003#0/2_CONS_SUB_SUB_CMP'}; seq_length=99; obiclean_internalcount=0; obiclean_status={'XXX': 's'}; seq_rank=12; merged_sample={'26a_F040644': 1}; obiclean_samplecount=1; obiclean_headcount=0; obiclean_singletoncount=1; 
+ttagccctaaacatagataattttacaacaaaataattcgccagaggactactagcaata
+gcttaaaactcaaagaactgggcggtgctttatatcccg
+>HELIUM_000100422_612GNAAXX:7:78:7151:19928#0/2_CONS_SUB_SUB count=1; obiclean_count={'XXX': 1}; obiclean_head=True; obiclean_cluster={'XXX': 'HELIUM_000100422_612GNAAXX:7:78:7151:19928#0/2_CONS_SUB_SUB'}; seq_length=99; obiclean_internalcount=0; obiclean_status={'XXX': 's'}; seq_rank=14; merged_sample={'26a_F040644': 1}; obiclean_samplecount=1; obiclean_headcount=0; obiclean_singletoncount=1; 
+ttagccctaaacataaacattcaataaacgagaatgttcgccagtgtacttctagcaaca
+ggctgaaactcaaaggacttggcggtggtttacatccct
+>HELIUM_000100422_612GNAAXX:7:13:5742:9859#0/2_CONS_SUB_SUB count=7; obiclean_count={'XXX': 7}; obiclean_head=True; obiclean_cluster={'XXX': 'HELIUM_000100422_612GNAAXX:7:13:5742:9859#0/2_CONS_SUB_SUB'}; seq_length=4; obiclean_internalcount=0; obiclean_status={'XXX': 's'}; seq_rank=16; merged_sample={'29a_F260619': 7}; obiclean_samplecount=1; obiclean_headcount=0; obiclean_singletoncount=1; 
+tttt
+>HELIUM_000100422_612GNAAXX:7:114:4511:17596#0/2_CONS_SUB_SUB_CMP count=1; obiclean_count={'XXX': 1}; obiclean_head=True; obiclean_cluster={'XXX': 'HELIUM_000100422_612GNAAXX:7:114:4511:17596#0/2_CONS_SUB_SUB_CMP'}; seq_length=100; obiclean_internalcount=0; obiclean_status={'XXX': 's'}; seq_rank=19; merged_sample={'29a_F260619': 1}; obiclean_samplecount=1; obiclean_headcount=0; obiclean_singletoncount=1; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtgctaccggcaat
+agcttaaaactcaaaggacttggcggtgctttatacgctt
+>HELIUM_000100422_612GNAAXX:7:29:18416:16620#0/2_CONS_SUB_SUB_CMP count=1; obiclean_count={'XXX': 1}; obiclean_head=True; obiclean_cluster={'XXX': 'HELIUM_000100422_612GNAAXX:7:29:18416:16620#0/2_CONS_SUB_SUB_CMP'}; seq_length=100; obiclean_internalcount=0; obiclean_status={'XXX': 's'}; seq_rank=21; merged_sample={'29a_F260619': 1}; obiclean_samplecount=1; obiclean_headcount=0; obiclean_singletoncount=1; 
+ttagccctaaacacaagtaattattataacaaaattattcgccagagttctaccggcaat
+agcttaaaactcaaaggacttggcggtgctttataccctg
+>HELIUM_000100422_612GNAAXX:7:120:1900:13295#0/2_CONS_SUB_SUB_CMP count=1; obiclean_count={'XXX': 1}; obiclean_head=True; obiclean_cluster={'XXX': 'HELIUM_000100422_612GNAAXX:7:120:1900:13295#0/2_CONS_SUB_SUB_CMP'}; seq_length=100; obiclean_internalcount=0; obiclean_status={'XXX': 's'}; seq_rank=22; merged_sample={'15a_F730814': 1}; obiclean_samplecount=1; obiclean_headcount=0; obiclean_singletoncount=1; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtactacgcgcaat
+agcttaaaactcaaaggacttggcggtgctttataccctt
+>HELIUM_000100422_612GNAAXX:7:9:10358:4089#0/2_CONS_SUB_SUB_CMP count=1; obiclean_count={'XXX': 1}; obiclean_head=True; obiclean_cluster={'XXX': 'HELIUM_000100422_612GNAAXX:7:9:10358:4089#0/2_CONS_SUB_SUB_CMP'}; seq_length=100; obiclean_internalcount=0; obiclean_status={'XXX': 's'}; seq_rank=25; merged_sample={'13a_F730603': 1}; obiclean_samplecount=1; obiclean_headcount=0; obiclean_singletoncount=1; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactacaggcaat
+agctcaaaactcaaagaacttggcggtgctttataccctt
+>HELIUM_000100422_612GNAAXX:7:95:1688:9598#0/2_CONS_SUB_SUB_CMP count=1; obiclean_count={'XXX': 1}; obiclean_head=True; obiclean_cluster={'XXX': 'HELIUM_000100422_612GNAAXX:7:95:1688:9598#0/2_CONS_SUB_SUB_CMP'}; seq_length=99; obiclean_internalcount=0; obiclean_status={'XXX': 's'}; seq_rank=30; merged_sample={'26a_F040644': 1}; obiclean_samplecount=1; obiclean_headcount=0; obiclean_singletoncount=1; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtgatactagcaaca
+gcctgaaactcaaaggacttggcggtgctttacatccct
+>HELIUM_000100422_612GNAAXX:7:55:16528:11418#0/2_CONS_SUB_SUB count=1; obiclean_count={'XXX': 1}; obiclean_head=True; obiclean_cluster={'XXX': 'HELIUM_000100422_612GNAAXX:7:55:16528:11418#0/2_CONS_SUB_SUB'}; seq_length=100; obiclean_internalcount=0; obiclean_status={'XXX': 's'}; seq_rank=31; merged_sample={'13a_F730603': 1}; obiclean_samplecount=1; obiclean_headcount=0; obiclean_singletoncount=1; 
+ctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcact
+agcttacaactcaaaggacttggcggtgctttataccctt
+>HELIUM_000100422_612GNAAXX:7:111:8478:1127#0/2_CONS_SUB_SUB_CMP count=1; obiclean_count={'XXX': 1}; obiclean_head=True; obiclean_cluster={'XXX': 'HELIUM_000100422_612GNAAXX:7:111:8478:1127#0/2_CONS_SUB_SUB_CMP'}; seq_length=99; obiclean_internalcount=0; obiclean_status={'XXX': 's'}; seq_rank=33; merged_sample={'26a_F040644': 1}; obiclean_samplecount=1; obiclean_headcount=0; obiclean_singletoncount=1; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaaca
+gcctggaacgcaaaggacttggcggtgctttacatccct
+>HELIUM_000100422_612GNAAXX:7:81:15726:2345#0/2_CONS_SUB_SUB_CMP count=1; obiclean_count={'XXX': 1}; obiclean_head=True; obiclean_cluster={'XXX': 'HELIUM_000100422_612GNAAXX:7:81:15726:2345#0/2_CONS_SUB_SUB_CMP'}; seq_length=99; obiclean_internalcount=0; obiclean_status={'XXX': 's'}; seq_rank=34; merged_sample={'26a_F040644': 1}; obiclean_samplecount=1; obiclean_headcount=0; obiclean_singletoncount=1; 
+ttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaaca
+gcctgaaactcaaagcactcggcggtgctttacatccct
+>HELIUM_000100422_612GNAAXX:7:7:11110:17924#0/2_CONS_SUB_SUB count=1; obiclean_count={'XXX': 1}; obiclean_head=True; obiclean_cluster={'XXX': 'HELIUM_000100422_612GNAAXX:7:7:11110:17924#0/2_CONS_SUB_SUB'}; seq_length=100; obiclean_internalcount=0; obiclean_status={'XXX': 's'}; seq_rank=35; merged_sample={'15a_F730814': 1}; obiclean_samplecount=1; obiclean_headcount=0; obiclean_singletoncount=1; 
+ttagccctaaacacaagtaattaatataacaaaattattcgccagagtcataccggcaat
+agcttaaaactcaaaggacttggcggtgctttataccctt
+>HELIUM_000100422_612GNAAXX:7:115:3625:10051#0/2_CONS_SUB_SUB count=1; obiclean_count={'XXX': 1}; obiclean_head=True; obiclean_cluster={'XXX': 'HELIUM_000100422_612GNAAXX:7:115:3625:10051#0/2_CONS_SUB_SUB'}; seq_length=5; obiclean_internalcount=0; obiclean_status={'XXX': 's'}; seq_rank=38; merged_sample={'13a_F730603': 1}; obiclean_samplecount=1; obiclean_headcount=0; obiclean_singletoncount=1; 
+caata
+>HELIUM_000100422_612GNAAXX:7:105:14135:6905#0/2_CONS_SUB_SUB count=1; obiclean_count={'XXX': 1}; obiclean_head=True; obiclean_cluster={'XXX': 'HELIUM_000100422_612GNAAXX:7:105:14135:6905#0/2_CONS_SUB_SUB'}; seq_length=100; obiclean_internalcount=0; obiclean_status={'XXX': 's'}; seq_rank=43; merged_sample={'29a_F260619': 1}; obiclean_samplecount=1; obiclean_headcount=0; obiclean_singletoncount=1; 
+ttagccctaaacacaagtaattaatataacaaaattattcaccagagtactagcggcaac
+agcttaaaactcaaaggacttggcggtgctttataccctt
+>HELIUM_000100422_612GNAAXX:7:7:15538:8325#0/2_CONS_SUB_SUB_CMP count=1; obiclean_count={'XXX': 1}; obiclean_head=True; obiclean_cluster={'XXX': 'HELIUM_000100422_612GNAAXX:7:7:15538:8325#0/2_CONS_SUB_SUB_CMP'}; seq_length=99; obiclean_internalcount=0; obiclean_status={'XXX': 's'}; seq_rank=49; merged_sample={'26a_F040644': 1}; obiclean_samplecount=1; obiclean_headcount=0; obiclean_singletoncount=1; 
+ttagccctaaacataaacattcaataaacaagaatgtcggccagagtactactagcaaca
+gcatgaaactcaaagaactgggcggtgctttacatccct
+>HELIUM_000100422_612GNAAXX:7:111:18277:17779#0/2_CONS_SUB_SUB_CMP count=1; obiclean_count={'XXX': 1}; obiclean_head=True; obiclean_cluster={'XXX': 'HELIUM_000100422_612GNAAXX:7:111:18277:17779#0/2_CONS_SUB_SUB_CMP'}; seq_length=99; obiclean_internalcount=0; obiclean_status={'XXX': 's'}; seq_rank=53; merged_sample={'26a_F040644': 1}; obiclean_samplecount=1; obiclean_headcount=0; obiclean_singletoncount=1; 
+ttagccctaaacatagataattttacaacaaaataattcgccagaggactactagcaata
+gcctgaaactcaaaggacttggcggtgctttacatccct
+>HELIUM_000100422_612GNAAXX:7:30:1800:7833#0/2_CONS_SUB_SUB count=1; obiclean_count={'XXX': 1}; obiclean_head=True; obiclean_cluster={'XXX': 'HELIUM_000100422_612GNAAXX:7:30:1800:7833#0/2_CONS_SUB_SUB'}; seq_length=100; obiclean_internalcount=0; obiclean_status={'XXX': 's'}; seq_rank=56; merged_sample={'15a_F730814': 1}; obiclean_samplecount=1; obiclean_headcount=0; obiclean_singletoncount=1; 
+ttagccctaaacacaagacattaatataacgagattaatcgacagagtactaccggctat
+agcttaaaactcaaaggacttggcggtgctttataccctt
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/output_obiconvert.fasta	Wed Apr 12 17:38:00 2017 -0400
@@ -0,0 +1,172 @@
+>HELIUM_000100422_612GNAAXX:7:119:14871:19157#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'29a_F260619': 1}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=100; obiclean_headcount=0; seq_rank=1; obiclean_samplecount=1; obiclean_head=True; 
+TTAGCCCTAAACACAAGTAATTATTATAACAAAATCATTCGCCAGAGTACTACCGGCAAT
+AGCTCAAAACTCAAAGGACTTGGCGGTGCTTTATACCCTT
+>HELIUM_000100422_612GNAAXX:7:108:5640:3823#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'29a_F260619': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=100; obiclean_headcount=0; seq_rank=2; obiclean_samplecount=1; obiclean_head=False; 
+TTAGCCCTAAACACAAGTAATTAATATAACAAAATTGTTCGCCAGAGTACTACCGGCAAT
+AGCTTAAAACTCAAAGGACTTGGCGGTGCTTTATACCCTT
+>HELIUM_000100422_612GNAAXX:7:97:14311:19299#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'29a_F260619': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=100; obiclean_headcount=0; seq_rank=3; obiclean_samplecount=1; obiclean_head=False; 
+TTAGCCCTAAACACAAGTAATTAATATAACAAAATTATTCGCCAGAGTACTACCGGCAAG
+AGCTTAAAACTCAAAGGACTTGGCGGTGCTTTATACCCTT
+>HELIUM_000100422_612GNAAXX:7:24:16230:12703#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'15a_F730814': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=100; obiclean_headcount=0; seq_rank=9; obiclean_samplecount=1; obiclean_head=False; 
+TTAGCCCTAAACACAAGTAATTAATATAACAAAATTATTCGCCAGAGTACTACCGGCAAT
+AGCTTAAAACTCAAAGGACTTGGCGGTGCTTTATCCCCTT
+>HELIUM_000100422_612GNAAXX:7:4:4214:9434#0/2_CONS_SUB_SUB count=1; merged_sample={'13a_F730603': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=100; obiclean_headcount=0; seq_rank=10; obiclean_samplecount=1; obiclean_head=False; 
+CTAGCCTTAAACACAAATAGTTATGCAAACAAAACTATTCGCCAGAGTACTACAGGCAAT
+AGCTTAAAACTCAAAGGACTTGGCGGTGCTTTATACCCTT
+>HELIUM_000100422_612GNAAXX:7:13:6954:13039#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=99; obiclean_headcount=0; seq_rank=11; obiclean_samplecount=1; obiclean_head=True; 
+TTAGCCCTAAACATAAACATTCAATAAACAAGAATGTTCGCCAGAGGACTACTAGCAATA
+GCTTAAAACTCAAAGGACTTGGCGGTGCTTTATATCCCT
+>HELIUM_000100422_612GNAAXX:7:38:6201:12003#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=99; obiclean_headcount=0; seq_rank=12; obiclean_samplecount=1; obiclean_head=True; 
+TTAGCCCTAAACATAGATAATTTTACAACAAAATAATTCGCCAGAGGACTACTAGCAATA
+GCTTAAAACTCAAAGAACTGGGCGGTGCTTTATATCCCG
+>HELIUM_000100422_612GNAAXX:7:78:7151:19928#0/2_CONS_SUB_SUB count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=99; obiclean_headcount=0; seq_rank=14; obiclean_samplecount=1; obiclean_head=True; 
+TTAGCCCTAAACATAAACATTCAATAAACGAGAATGTTCGCCAGTGTACTTCTAGCAACA
+GGCTGAAACTCAAAGGACTTGGCGGTGGTTTACATCCCT
+>HELIUM_000100422_612GNAAXX:7:16:16357:19948#0/2_CONS_SUB_SUB count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=99; obiclean_headcount=0; seq_rank=17; obiclean_samplecount=1; obiclean_head=False; 
+TTAGCCCTAAACATAAACATTCAATAAACAAGAATGTTCGCCAGAGTACTACTAGCAACA
+GCCTGAAACTCACAGGACTTGGCGGTGCTTTACATCCCT
+>HELIUM_000100422_612GNAAXX:7:107:3570:18147#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'29a_F260619': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=100; obiclean_headcount=0; seq_rank=18; obiclean_samplecount=1; obiclean_head=False; 
+TTAGCCCTAAACACAAGTAATTAATATAACAAAATTATTCGCCAGAGTACTACCGGCAAT
+AGCATAAAACTCAAAGGACTTGGCGGTGCTTTATACCCTT
+>HELIUM_000100422_612GNAAXX:7:114:4511:17596#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'29a_F260619': 1}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=100; obiclean_headcount=0; seq_rank=19; obiclean_samplecount=1; obiclean_head=True; 
+TTAGCCCTAAACACAAGTAATTAATATAACAAAATTATTCGCCAGAGTGCTACCGGCAAT
+AGCTTAAAACTCAAAGGACTTGGCGGTGCTTTATACGCTT
+>HELIUM_000100422_612GNAAXX:7:29:18416:16620#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'29a_F260619': 1}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=100; obiclean_headcount=0; seq_rank=21; obiclean_samplecount=1; obiclean_head=True; 
+TTAGCCCTAAACACAAGTAATTATTATAACAAAATTATTCGCCAGAGTTCTACCGGCAAT
+AGCTTAAAACTCAAAGGACTTGGCGGTGCTTTATACCCTG
+>HELIUM_000100422_612GNAAXX:7:120:1900:13295#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'15a_F730814': 1}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=100; obiclean_headcount=0; seq_rank=22; obiclean_samplecount=1; obiclean_head=True; 
+TTAGCCCTAAACACAAGTAATTAATATAACAAAATTATTCGCCAGAGTACTACGCGCAAT
+AGCTTAAAACTCAAAGGACTTGGCGGTGCTTTATACCCTT
+>HELIUM_000100422_612GNAAXX:7:76:10822:18722#0/2_CONS_SUB_SUB count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=99; obiclean_headcount=0; seq_rank=23; obiclean_samplecount=1; obiclean_head=False; 
+TTAGCCCTAAACATAAACATTCAATAAACACGAATGTTCGCCAGAGTACTACTAGCAACA
+GCCTGAAACTCAAAGGACTTGGCGGTGCTTTACATCCCT
+>HELIUM_000100422_612GNAAXX:7:76:8491:8900#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'15a_F730814': 1}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=100; obiclean_headcount=0; seq_rank=24; obiclean_samplecount=1; obiclean_head=True; 
+TTAGCCCTAAACACAAGTAATTAATATAACAAAATTATTCGCCAGAGTGCTACCTGCAAT
+AGCTTAAAACTCAAAGGACTTGGCGGTGCTTTATACCCTT
+>HELIUM_000100422_612GNAAXX:7:9:10358:4089#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'13a_F730603': 1}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=100; obiclean_headcount=0; seq_rank=25; obiclean_samplecount=1; obiclean_head=True; 
+CTAGCCTTAAACACAAATAGTTATGCAAACAAAACTATTCGCCAGAGTACTACAGGCAAT
+AGCTCAAAACTCAAAGAACTTGGCGGTGCTTTATACCCTT
+>HELIUM_000100422_612GNAAXX:7:59:11971:12063#0/2_CONS_SUB_SUB count=1; merged_sample={'29a_F260619': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=100; obiclean_headcount=0; seq_rank=26; obiclean_samplecount=1; obiclean_head=False; 
+TTAGCCCTAAACACAAGTAATTAATATAACAAAATTATTCGTCAGAGTACTACCGGCAAT
+AGCTTAAAACTCAAAGGACTTGGCGGTGCTTTATACCCTT
+>HELIUM_000100422_612GNAAXX:7:111:19168:18517#0/2_CONS_SUB_SUB count=1; merged_sample={'15a_F730814': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=100; obiclean_headcount=0; seq_rank=27; obiclean_samplecount=1; obiclean_head=False; 
+TTAGCCCTAAACACAAGTAATTAATATAACAAAATTATCCGCCAGAGTACTACCGGCAAT
+AGCTTAAAACTCAAAGGACTTGGCGGTGCTTTATACCCTT
+>HELIUM_000100422_612GNAAXX:7:41:9316:2256#0/2_CONS_SUB_SUB count=1; merged_sample={'29a_F260619': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=100; obiclean_headcount=0; seq_rank=28; obiclean_samplecount=1; obiclean_head=False; 
+TTAGCCCTAAACACAAGAAATTAATATAACAAAATTATTCGCCAGAGTACTACCGGCAAT
+AGCTTAAAACTCAAAGGACTTGGCGGTGCTTTATACCCTT
+>HELIUM_000100422_612GNAAXX:7:33:9900:9541#0/2_CONS_SUB_SUB count=1; merged_sample={'13a_F730603': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=100; obiclean_headcount=0; seq_rank=29; obiclean_samplecount=1; obiclean_head=False; 
+CTAGCCCTAAACACAAATAGTTATGCAAACAAAACTATTCGCCAGAGTACTACCGGCAAT
+AGCTTAAAACTCAAAGGACTTGGCGGTGCTTTATACCCTT
+>HELIUM_000100422_612GNAAXX:7:95:1688:9598#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=99; obiclean_headcount=0; seq_rank=30; obiclean_samplecount=1; obiclean_head=True; 
+TTAGCCCTAAACATAAACATTCAATAAACAAGAATGTTCGCCAGAGTGATACTAGCAACA
+GCCTGAAACTCAAAGGACTTGGCGGTGCTTTACATCCCT
+>HELIUM_000100422_612GNAAXX:7:55:16528:11418#0/2_CONS_SUB_SUB count=1; merged_sample={'13a_F730603': 1}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=100; obiclean_headcount=0; seq_rank=31; obiclean_samplecount=1; obiclean_head=True; 
+CTAGCCTTAAACACAAATAGTTATGCAAACAAAACTATTCGCCAGAGTACTACCGGCACT
+AGCTTACAACTCAAAGGACTTGGCGGTGCTTTATACCCTT
+>HELIUM_000100422_612GNAAXX:7:19:6313:16567#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=99; obiclean_headcount=0; seq_rank=32; obiclean_samplecount=1; obiclean_head=False; 
+TTAGCCCTAAACATAAACATTCAATAAACAAGAATGTTCGCCAGAGTACTACTAGCAACA
+GCCTGAAACTCAAAGGGCTTGGCGGTGCTTTACATCCCT
+>HELIUM_000100422_612GNAAXX:7:111:8478:1127#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=99; obiclean_headcount=0; seq_rank=33; obiclean_samplecount=1; obiclean_head=True; 
+TTAGCCCTAAACATAAACATTCAATAAACAAGAATGTTCGCCAGAGTACTACTAGCAACA
+GCCTGGAACGCAAAGGACTTGGCGGTGCTTTACATCCCT
+>HELIUM_000100422_612GNAAXX:7:81:15726:2345#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=99; obiclean_headcount=0; seq_rank=34; obiclean_samplecount=1; obiclean_head=True; 
+TTAGCCCTAAACATAAACATTCAATAAACAAGAATGTTCGCCAGAGTACTACTAGCAACA
+GCCTGAAACTCAAAGCACTCGGCGGTGCTTTACATCCCT
+>HELIUM_000100422_612GNAAXX:7:7:11110:17924#0/2_CONS_SUB_SUB count=1; merged_sample={'15a_F730814': 1}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=100; obiclean_headcount=0; seq_rank=35; obiclean_samplecount=1; obiclean_head=True; 
+TTAGCCCTAAACACAAGTAATTAATATAACAAAATTATTCGCCAGAGTCATACCGGCAAT
+AGCTTAAAACTCAAAGGACTTGGCGGTGCTTTATACCCTT
+>HELIUM_000100422_612GNAAXX:7:89:9710:20652#0/2_CONS_SUB_SUB count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=99; obiclean_headcount=0; seq_rank=36; obiclean_samplecount=1; obiclean_head=False; 
+TTAGCCCTAAACATAAACATTCAATAAACAAGAATGTTCGCCAGAGTACTACTAGCAACA
+GCCTGAAACTCAAAGGACTTGGCGGTGCTTTATATCCCT
+>HELIUM_000100422_612GNAAXX:7:71:17473:7401#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'15a_F730814': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=100; obiclean_headcount=0; seq_rank=37; obiclean_samplecount=1; obiclean_head=False; 
+TTAGCCCTAAACACAAGTAATTAATATAACAAAATTATTCGCCAGAGTACTACCGGTAAT
+AGCTTAAAACTCAAAGGACTTGGCGGTGCTTTATACCCTT
+>HELIUM_000100422_612GNAAXX:7:115:3625:10051#0/2_CONS_SUB_SUB count=1; merged_sample={'13a_F730603': 1}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=5; obiclean_headcount=0; seq_rank=38; obiclean_samplecount=1; obiclean_head=True; 
+CAATA
+>HELIUM_000100422_612GNAAXX:7:99:8183:13912#0/2_CONS_SUB_SUB count=1; merged_sample={'13a_F730603': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=100; obiclean_headcount=0; seq_rank=39; obiclean_samplecount=1; obiclean_head=False; 
+CTAGCCTTAAACACAAATAGTTATGCAAACAAAACTATTCGCCAGAGTACTACCGGCAAT
+AGCTTAAAACTCAAAGGACTTGGCGGTGCTTTATACCCTC
+>HELIUM_000100422_612GNAAXX:7:22:1798:3790#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'13a_F730603': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=100; obiclean_headcount=0; seq_rank=40; obiclean_samplecount=1; obiclean_head=False; 
+CTAGCCTTAAACACAAATAGTTATGCAAACAAAACTATTCGCCAGAGTGCTACCGGCAAT
+AGCTTAAAACTCAAAGGACTTGGCGGTGCTTTATACCCTT
+>HELIUM_000100422_612GNAAXX:7:115:14354:10118#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=99; obiclean_headcount=0; seq_rank=41; obiclean_samplecount=1; obiclean_head=False; 
+TTAGCCCTAAACATAAACATTCAATAAACAAGAATGTTCGCCAGAGTACTACTCGCAACA
+GCCTGAAACTCAAAGGACTTGGCGGTGCTTTACATCCCT
+>HELIUM_000100422_612GNAAXX:7:103:3594:15996#0/2_CONS_SUB_SUB count=1; merged_sample={'13a_F730603': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=100; obiclean_headcount=0; seq_rank=42; obiclean_samplecount=1; obiclean_head=False; 
+CTAGCCTTAAACACAAATAGTTATGCAAACACAACTATTCGCCAGAGTACTACCGGCAAT
+AGCTTAAAACTCAAAGGACTTGGCGGTGCTTTATACCCTT
+>HELIUM_000100422_612GNAAXX:7:105:14135:6905#0/2_CONS_SUB_SUB count=1; merged_sample={'29a_F260619': 1}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=100; obiclean_headcount=0; seq_rank=43; obiclean_samplecount=1; obiclean_head=True; 
+TTAGCCCTAAACACAAGTAATTAATATAACAAAATTATTCACCAGAGTACTAGCGGCAAC
+AGCTTAAAACTCAAAGGACTTGGCGGTGCTTTATACCCTT
+>HELIUM_000100422_612GNAAXX:7:76:18268:14980#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'29a_F260619': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=100; obiclean_headcount=0; seq_rank=44; obiclean_samplecount=1; obiclean_head=False; 
+TTACCCCTAAACACAAGTAATTAATATAACAAAATTATTCGCCAGAGTACTACCGGCAAT
+AGCTTAAAACTCAAAGGACTTGGCGGTGCTTTATACCCTT
+>HELIUM_000100422_612GNAAXX:7:25:7789:3090#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'29a_F260619': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=100; obiclean_headcount=0; seq_rank=45; obiclean_samplecount=1; obiclean_head=False; 
+TTAGCCCTAAACACAAGTAATTAATATAACAAAATTATTCGCCAGAGTACTACAGGCAAT
+AGCTTAAAACTCAAAGGACTTGGCGGTGCTTTATACCCTT
+>HELIUM_000100422_612GNAAXX:7:42:19757:3800#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'15a_F730814': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=99; obiclean_headcount=0; seq_rank=46; obiclean_samplecount=1; obiclean_head=False; 
+TTAGCCCTAAACACAAGTAATTAATATACAAAATTATTCGCCAGAGTACTACCGGCAATA
+GCTTAAAACTCAAAGGACTTGGCGGTGCTTTATACCCTT
+>HELIUM_000100422_612GNAAXX:7:116:14244:17926#0/2_CONS_SUB_SUB count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=99; obiclean_headcount=0; seq_rank=47; obiclean_samplecount=1; obiclean_head=False; 
+TTAGCCCTAAACATAAACATTCAATAAACAAGAATGTTCGCAAGAGTACTACTAGCAACA
+GCCTGAAACTCAAAGGACTTGGCGGTGCTTTACATCCCT
+>HELIUM_000100422_612GNAAXX:7:72:12959:5736#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=99; obiclean_headcount=0; seq_rank=48; obiclean_samplecount=1; obiclean_head=False; 
+TTAGCCCTAAACATAAACATTCAATAAACAAGAATGTTCGCCAGAGTACTACTAGCAACA
+GCCTGAAACTCAAAGGACTTGGCGGTGCTTTACACCCCT
+>HELIUM_000100422_612GNAAXX:7:7:15538:8325#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=99; obiclean_headcount=0; seq_rank=49; obiclean_samplecount=1; obiclean_head=True; 
+TTAGCCCTAAACATAAACATTCAATAAACAAGAATGTCGGCCAGAGTACTACTAGCAACA
+GCATGAAACTCAAAGAACTGGGCGGTGCTTTACATCCCT
+>HELIUM_000100422_612GNAAXX:7:120:16005:7955#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=98; obiclean_headcount=0; seq_rank=50; obiclean_samplecount=1; obiclean_head=False; 
+TTAGCCCTAAACATAAACATTCAATAAACAAGAATGTTCGCCAGAGTACTACTAGCAACA
+GCCGAAACTCAAAGGACTTGGCGGTGCTTTACATCCCT
+>HELIUM_000100422_612GNAAXX:7:10:9237:10532#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'29a_F260619': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=100; obiclean_headcount=0; seq_rank=51; obiclean_samplecount=1; obiclean_head=False; 
+TTAGCCCTAAACACAAGTAATTAATATAACAAAATAATTCGCCAGAGTACTACCGGCAAT
+AGCTTAAAACTCAAAGGACTTGGCGGTGCTTTATACCCTT
+>HELIUM_000100422_612GNAAXX:7:7:11998:4462#0/2_CONS_SUB_SUB count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=99; obiclean_headcount=0; seq_rank=52; obiclean_samplecount=1; obiclean_head=False; 
+TTAGCCCTAAACATAAACATTCAATAAACAAGAATGTTCGCCAGAGTAGTACTAGCAACA
+GCCTGAAACTCAAAGGACTTGGCGGTGCTTTACATCCCT
+>HELIUM_000100422_612GNAAXX:7:111:18277:17779#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=99; obiclean_headcount=0; seq_rank=53; obiclean_samplecount=1; obiclean_head=True; 
+TTAGCCCTAAACATAGATAATTTTACAACAAAATAATTCGCCAGAGGACTACTAGCAATA
+GCCTGAAACTCAAAGGACTTGGCGGTGCTTTACATCCCT
+>HELIUM_000100422_612GNAAXX:7:3:17077:6562#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'15a_F730814': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=100; obiclean_headcount=0; seq_rank=54; obiclean_samplecount=1; obiclean_head=False; 
+TTAGCCCTAAACACAAGTAATTAATATAACAAAATTATTCGCCAGAGTACTGCCGGCAAT
+AGCTTAAAACTCAAAGGACTTGGCGGTGCTTTATACCCTT
+>HELIUM_000100422_612GNAAXX:7:19:4311:13343#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=99; obiclean_headcount=0; seq_rank=55; obiclean_samplecount=1; obiclean_head=False; 
+TTAGCCCTAAACATAAACATTCAATAAACAAGAATGTTCGCCAGAGTACTACGAGCAACA
+GCCTGAAACTCAAAGGACTTGGCGGTGCTTTACATCCCT
+>HELIUM_000100422_612GNAAXX:7:30:1800:7833#0/2_CONS_SUB_SUB count=1; merged_sample={'15a_F730814': 1}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=100; obiclean_headcount=0; seq_rank=56; obiclean_samplecount=1; obiclean_head=True; 
+TTAGCCCTAAACACAAGACATTAATATAACGAGATTAATCGACAGAGTACTACCGGCTAT
+AGCTTAAAACTCAAAGGACTTGGCGGTGCTTTATACCCTT
+>HELIUM_000100422_612GNAAXX:7:108:9222:18258#0/2_CONS_SUB_SUB count=1; merged_sample={'13a_F730603': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=100; obiclean_headcount=0; seq_rank=57; obiclean_samplecount=1; obiclean_head=False; 
+CTAGCCTTAAACACAAATAGTTATGCAGACAAAACTATTCGCCAGAGTACTACCGGCAAT
+AGCTTAAAACTCAAAGGACTTGGCGGTGCTTTATACCCTT
+>HELIUM_000100422_612GNAAXX:7:38:3005:20881#0/2_CONS_SUB_SUB_CMP count=1; merged_sample={'26a_F040644': 1}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=99; obiclean_headcount=0; seq_rank=58; obiclean_samplecount=1; obiclean_head=False; 
+TTAGCCCTAAACATGAACATTCAATAAACAAGAATGTTCGCCAGAGTACTACTAGCAACA
+GCCTGAAACTCAAAGGACTTGGCGGTGCTTTACATCCCT
+>HELIUM_000100422_612GNAAXX:7:29:15520:18035#0/2_CONS_SUB_SUB count=2; merged_sample={'29a_F260619': 2}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=100; obiclean_headcount=0; seq_rank=7; obiclean_samplecount=1; obiclean_head=True; 
+TTAGCCCTAAACACAAGTAATTATTATAACAAAATTATTCGCCAGAGTACTACCGGCAAT
+AGCTTAAAACTCAAAGGACTTGGCGGTGCTTTATACCCTT
+>HELIUM_000100422_612GNAAXX:7:115:17402:4174#0/2_CONS_SUB_SUB_CMP count=2; merged_sample={'29a_F260619': 1, '15a_F730814': 1}; obiclean_singletoncount=0; obiclean_internalcount=2; seq_length=100; obiclean_headcount=0; seq_rank=13; obiclean_samplecount=2; obiclean_head=False; 
+TTAGCCCTAAACACAAGTAATTAATATAACAAAATTATTCGCCAGAGTACTACCTGCAAT
+AGCTTAAAACTCAAAGGACTTGGCGGTGCTTTATACCCTT
+>HELIUM_000100422_612GNAAXX:7:38:10813:16867#0/2_CONS_SUB_SUB count=2; merged_sample={'26a_F040644': 2}; obiclean_singletoncount=0; obiclean_internalcount=1; seq_length=99; obiclean_headcount=0; seq_rank=15; obiclean_samplecount=1; obiclean_head=False; 
+TTAGCCCTAAACATAAACATTCAATAAACAAGAATGTTTGCCAGAGTACTACTAGCAACA
+GCCTGAAACTCAAAGGACTTGGCGGTGCTTTACATCCCT
+>HELIUM_000100422_612GNAAXX:7:70:11798:2668#0/2_CONS_SUB_SUB count=2; merged_sample={'15a_F730814': 2}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=100; obiclean_headcount=0; seq_rank=20; obiclean_samplecount=1; obiclean_head=True; 
+TTAGCCCTAAACACAAGTAATTAATATAACAAAATTATTCGCCAGAGTACTACCGGCAAT
+AGCTTAAAACTCAAAGGACTTGGCGGTGCTTTATACCTTT
+>HELIUM_000100422_612GNAAXX:7:89:10281:5930#0/2_CONS_SUB_SUB_CMP count=3; merged_sample={'29a_F260619': 3}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=100; obiclean_headcount=0; seq_rank=6; obiclean_samplecount=1; obiclean_head=True; 
+TTAGCCCTAAACACAAATAATTACACAAACAAAATTGTTCACCAGAGTACTAGCGGCAAC
+AGCTTAAAACTCAAAGGACTTGGCGGTGCTTTATACCCTT
+>HELIUM_000100422_612GNAAXX:7:13:5742:9859#0/2_CONS_SUB_SUB count=7; merged_sample={'29a_F260619': 7}; obiclean_singletoncount=1; obiclean_internalcount=0; seq_length=4; obiclean_headcount=0; seq_rank=16; obiclean_samplecount=1; obiclean_head=True; 
+TTTT
+>HELIUM_000100422_612GNAAXX:7:6:9274:14951#0/2_CONS_SUB_SUB count=46; merged_sample={'13a_F730603': 46}; obiclean_singletoncount=0; obiclean_internalcount=0; seq_length=100; obiclean_headcount=1; seq_rank=8; obiclean_samplecount=1; obiclean_head=True; 
+CTAGCCTTAAACACAAATAGTTATGCAAACAAAACTATTCGCCAGAGTACTACCGGCAAT
+AGCTTAAAACTCAAAGGACTTGGCGGTGCTTTATACCCTT
+>HELIUM_000100422_612GNAAXX:7:22:8540:14708#0/2_CONS_SUB_SUB count=61; merged_sample={'29a_F260619': 30, '15a_F730814': 31}; obiclean_singletoncount=0; obiclean_internalcount=0; seq_length=100; obiclean_headcount=2; seq_rank=4; obiclean_samplecount=2; obiclean_head=True; 
+TTAGCCCTAAACACAAGTAATTAATATAACAAAATTATTCGCCAGAGTACTACCGGCAAT
+AGCTTAAAACTCAAAGGACTTGGCGGTGCTTTATACCCTT
+>HELIUM_000100422_612GNAAXX:7:57:18459:16145#0/2_CONS_SUB_SUB_CMP count=64; merged_sample={'26a_F040644': 64}; obiclean_singletoncount=0; obiclean_internalcount=0; seq_length=99; obiclean_headcount=1; seq_rank=5; obiclean_samplecount=1; obiclean_head=True; 
+TTAGCCCTAAACATAAACATTCAATAAACAAGAATGTTCGCCAGAGTACTACTAGCAACA
+GCCTGAAACTCAAAGGACTTGGCGGTGCTTTACATCCCT
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/output_obigrep_lmin.fastq	Wed Apr 12 17:38:00 2017 -0400
@@ -0,0 +1,32 @@
+@HELIUM_000100422_612GNAAXX:7:13:5742:9859#0/2_CONS ali_length=58; direction=right; seq_ab_match=55; sminR=40.0; seq_a_mismatch=3; seq_b_deletion=50; seq_b_mismatch=0; seq_a_deletion=50; seq_b_single=0; score=207.846895043; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=0; score_norm=3.58356715591; seq_b_insertion=0; 
+ccgcctcctttagataccccactatgcttttctagaggagcctgttctaaggaggcgg
++
+~~~~~~Z~~~~~~~~~b~~~~~~~~~_~~~~~~~~~~}~~~~~~~~~~~~~~~~~~~~
+@HELIUM_000100422_612GNAAXX:7:7:7916:16505#0/2_CONS ali_length=58; direction=right; seq_ab_match=58; sminR=40.0; seq_a_mismatch=0; seq_b_deletion=50; seq_b_mismatch=0; seq_a_deletion=50; seq_b_single=0; score=231.999536374; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=0; score_norm=3.99999200644; seq_b_insertion=0; 
+ccgcctccttagaacaggctcctctagaaaagcatagtggggtatctaaaggaggcgg
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@HELIUM_000100422_612GNAAXX:7:37:12979:6595#0/2_CONS ali_length=58; direction=right; seq_ab_match=58; sminR=40.0; seq_a_mismatch=0; seq_b_deletion=50; seq_b_mismatch=0; seq_a_deletion=50; seq_b_single=0; score=231.998796685; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=0; score_norm=3.99997925319; seq_b_insertion=0; 
+ccgcctcctttagataccccactatgcttttctagaggagcctgttctaaggaggcgg
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@HELIUM_000100422_612GNAAXX:7:96:8737:4973#0/2_CONS ali_length=58; direction=right; seq_ab_match=57; sminR=40.0; seq_a_mismatch=1; seq_b_deletion=50; seq_b_mismatch=0; seq_a_deletion=50; seq_b_single=0; score=223.980140585; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=0; score_norm=3.86172656181; seq_b_insertion=0; 
+ccgcctccttagaacaggctcctctagaaaagcatagtggggtatctaaaggaggcgg
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@HELIUM_000100422_612GNAAXX:7:115:3625:10051#0/2_CONS ali_length=59; direction=right; seq_ab_match=59; sminR=40.0; seq_a_mismatch=0; seq_b_deletion=49; seq_b_mismatch=0; seq_a_deletion=49; seq_b_single=0; score=235.999642017; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=0; score_norm=3.99999393249; seq_b_insertion=0; 
+ccaattaacttagataccccactatgccaatactagaggagcctgttctagttaattgg
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@HELIUM_000100422_612GNAAXX:7:73:17068:16620#0/2_CONS ali_length=58; direction=right; seq_ab_match=57; sminR=40.0; seq_a_mismatch=0; seq_b_deletion=50; seq_b_mismatch=1; seq_a_deletion=50; seq_b_single=0; score=223.962007947; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=0; score_norm=3.86141393012; seq_b_insertion=0; 
+ccgcctccttagaacaggctcctctagaaaagcatagtggggtatctaaaggaggcgg
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~~~~~~~~~~~~~|~
+@HELIUM_000100422_612GNAAXX:7:95:11283:2557#0/2_CONS ali_length=58; direction=right; seq_ab_match=57; sminR=40.0; seq_a_mismatch=0; seq_b_deletion=50; seq_b_mismatch=1; seq_a_deletion=50; seq_b_single=0; score=223.999078974; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=0; score_norm=3.86205308576; seq_b_insertion=0; 
+ccgcctccttagaacaggctcctctagaaaagcatagtggggtatctaaaggaggcgg
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~a~~~~~~~~~~~~~~~
+@HELIUM_000100422_612GNAAXX:7:75:9674:16966#0/2_CONS ali_length=58; direction=right; seq_ab_match=57; sminR=40.0; seq_a_mismatch=0; seq_b_deletion=50; seq_b_mismatch=1; seq_a_deletion=50; seq_b_single=0; score=224.000075421; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=0; score_norm=3.86207026589; seq_b_insertion=0; 
+ccgcctccttagaacaggctcctctagaaaagcatagtggggtatctaaaggaggcgg
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~~~~~~~~~~~~~~~
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/output_obigrep_predicat.fasta	Wed Apr 12 17:38:00 2017 -0400
@@ -0,0 +1,980 @@
+@HELIUM_000100422_612GNAAXX:7:119:14871:19157#0/2_CONS ali_length=62; direction=left; seq_ab_match=47; sminR=40.0; seq_a_mismatch=1; seq_b_deletion=1; seq_b_mismatch=13; seq_a_deletion=0; seq_b_single=46; score=115.761290673; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; score_norm=1.86711759151; seq_b_insertion=1; 
+ccgcctccttagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttgagctattgccggtagtactctggcgaatgattttgttataataattacttgtgtttagggctaagcatagtggggtatctaaaggaggcgg
++
+dddddddddddbbdaddcddddddcadaddddaadcccWaaddabdx~~|b~~~~cccccccBcBcccBcBcccBccBBcc~}`kXyxu|~Kyr`b~~~~~~b~~~b~d\cdddddddddddddcacddddcdddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:108:5640:3823#0/2_CONS ali_length=62; direction=left; seq_ab_match=60; sminR=40.0; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=2; seq_a_deletion=0; seq_b_single=46; score=231.881364714; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; score_norm=3.74002201152; seq_b_insertion=0; 
+ccgcctccttagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaacaattttgttatattaattacttgtgtttagggctaagcatagtggggtatctaaaggaggcgg
++
+ddddddddddddddddbdddddbddddddddddddddddddddddd~~~~~~~~~~~~~~~~~~}~~~~~~~~~~~~~~~~~~~~~~~~~~~Z~~~~~~~~~~~~~b~d]dddddddcdddddcddddddddddddddddddddddcddddddd
+@HELIUM_000100422_612GNAAXX:7:97:14311:19299#0/2_CONS ali_length=62; direction=left; seq_ab_match=52; sminR=40.0; seq_a_mismatch=5; seq_b_deletion=0; seq_b_mismatch=5; seq_a_deletion=0; seq_b_single=46; score=167.91734192; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; score_norm=2.70834422451; seq_b_insertion=0; 
+ccgcctccttagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctcttgccggtagtactctggcgaataattttgttatattaattacttgtgtttagggctaagcatagtggggtatctaaaggaggcgg
++
+ddadddddcd`dcddddddddd^dd]ddddddZad`\`]Lcca``YT|~~^||v|z|~ts~~~|r~sZ^~~`~~~~~~~~~~~~~~~~V~b~]~~~~b~~~~~~~~`~b\aadddd`dcdddddc`dddccddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:22:8540:14708#0/2_CONS ali_length=62; direction=left; seq_ab_match=59; sminR=40.0; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=3; seq_a_deletion=0; seq_b_single=46; score=223.982011431; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; score_norm=3.61261308759; seq_b_insertion=0; 
+ccgcctcctttagataccccactatgcttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctaaggaggcgg
++
+dddedddddddddedddddddddedddaddbddddddddddddedd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~b~~~~~~~~b~~~~ddddddddddabbb^bdddddddddddcddddddddcddddddddd
+@HELIUM_000100422_612GNAAXX:7:57:18459:16145#0/2_CONS ali_length=63; direction=left; seq_ab_match=60; sminR=40.0; seq_a_mismatch=3; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; seq_b_single=45; score=227.883189945; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; score_norm=3.61719349119; seq_b_insertion=0; 
+ccgaatatctagaacaggctcctctagagggatgtaaagcaccgccaagtcctttgagtttcaggctgttgctagtagtactctggcgaacattcttgtttattgaatgtttatgtttagggctaagcatagtggggtatctaagatattcgg
++
+ddcdddddddddddddddeddddddddddddddddddddcddddd~b~~~~~~b~~~~~~~~~~~~~~c~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddddddddddddddddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:89:10281:5930#0/2_CONS ali_length=62; direction=left; seq_ab_match=60; sminR=40.0; seq_a_mismatch=2; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; seq_b_single=46; score=231.893859399; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; score_norm=3.7402235387; seq_b_insertion=0; 
+ccgcctccttagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctgttgccgctagtactctggtgaacaattttgtttgtgtaattatttgtgtttagggctaagcatagtggggtatctaaaggaggcgg
++
+ddddddddddddddddddcddddddddddddd\ddeddecddddddb~~~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddddcddddddcdddddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:29:15520:18035#0/2_CONS ali_length=62; direction=left; seq_ab_match=61; sminR=40.0; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=1; seq_a_deletion=0; seq_b_single=46; score=239.965360923; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; score_norm=3.87040904714; seq_b_insertion=0; 
+ccgcctcctttagataccccactatgcttagccctaaacacaagtaattattataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctaaggaggcgg
++
+cccccccc_cc_cccacacb]Y]_`a^__`_Y_`_a_`cc_ccccc~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~~~~~~~dddddddddddddddddddddddddddadddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:6:9274:14951#0/2_CONS ali_length=62; direction=left; seq_ab_match=59; sminR=40.0; seq_a_mismatch=1; seq_b_deletion=0; seq_b_mismatch=2; seq_a_deletion=0; seq_b_single=46; score=223.791171196; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; score_norm=3.60953501929; seq_b_insertion=0; 
+ccaattaacttagataccccactatgcctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctagttaattgg
++
+dcdddddddddddedddddddddcddddddcddddddddddddddd~~~~~~~~~~~~~~~~~~|z~}a|~~~~}}}}~~~~~~~~~~}~}b~b~~~~~~~~~~~~~~ddddddcdcddcd^ddddddddddddddddddddddeddddddddd
+@HELIUM_000100422_612GNAAXX:7:111:2893:6772#0/2_CONS ali_length=62; direction=left; seq_ab_match=61; sminR=40.0; seq_a_mismatch=1; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; seq_b_single=46; score=239.959941063; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; score_norm=3.87032163005; seq_b_insertion=0; 
+ccgcctcctttagataccccactatgcttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctaaggaggcgg
++
+dddddddddddddddddddddddddddddddddddedddddded_d~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~x~dddddddcdddcdcdddadddddddddddedddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:89:10621:20317#0/2_CONS ali_length=62; direction=left; seq_ab_match=59; sminR=40.0; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=3; seq_a_deletion=0; seq_b_single=46; score=223.827654468; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; score_norm=3.61012345916; seq_b_insertion=0; 
+ccgcctcctttagataccccactatgcttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctaaggaggcgg
++
+ddddddddddddddbdddddadddddddd`ddddadadddddddRc~}~~z~~~~~~~t~sw}~~g}~~~~~~~~~~~~~~~~~~~~~~~~~~~~^~b`~~~~~~~~~ddddddddbdbdd_dddadddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:50:2791:11138#0/2_CONS ali_length=62; direction=left; seq_ab_match=60; sminR=40.0; seq_a_mismatch=2; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; seq_b_single=46; score=231.976017167; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; score_norm=3.74154866398; seq_b_insertion=0; 
+ccgcctcctttagataccccactatgcttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctaaggaggcgg
++
+dddddcdddddcddddcd^dddddddddbdbdddddddc\ddddbd~~~~~~~~~~~~~~~~~~b~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddddbdddddddddcddddddddcddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:108:17701:18887#0/2_CONS ali_length=62; direction=left; seq_ab_match=58; sminR=40.0; seq_a_mismatch=4; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; seq_b_single=46; score=215.828321765; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; score_norm=3.48110196396; seq_b_insertion=0; 
+ccgaagtagtagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaataattttgttatattaattacttgtgtttagggctaagcatagtggggtatctaactacttcgg
++
+dd[dddddddd``ddddddddddddeddddddcdddddd\ddddddb~~~b~~~~~~~~~~~b~~~~~b~~~{~~{z|{|~~~~~~~~~~~ssx~~~~~~~~~~~~~~c^cddddddddddd`cedddddddddddddddddddddddddddcd
+@HELIUM_000100422_612GNAAXX:7:97:10414:9929#0/2_CONS ali_length=62; direction=left; seq_ab_match=61; sminR=40.0; seq_a_mismatch=1; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; seq_b_single=46; score=239.864541102; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; score_norm=3.86878292101; seq_b_insertion=0; 
+ccaattaactagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaatagttttgtttgcataactatttgtgtttaaggctaggcatagtggggtatctaagttaattgg
++
+ddddddddddddddddddddddddddddddddcddddddcdddddd~~~~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddddeddddddddddddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:97:9091:15775#0/2_CONS ali_length=62; direction=left; seq_ab_match=59; sminR=40.0; seq_a_mismatch=3; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; seq_b_single=46; score=223.861916171; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; score_norm=3.61067606728; seq_b_insertion=0; 
+ccaattaactagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaatagttttgtttgcataactatttgtgtttaaggctaggcatagtggggtatctaagttaattgg
++
+ddddddddddddddddddddddddddddddddcddddddddddddd~~~~b~~^~~~~~~b~~~~~~~|~~~~~~~~~x~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddddddadcdddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:74:8683:20738#0/2_CONS ali_length=63; direction=left; seq_ab_match=62; sminR=40.0; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=1; seq_a_deletion=0; seq_b_single=45; score=243.961428864; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; score_norm=3.87240363276; seq_b_insertion=0; 
+tcgaatatcttagataccccactatgcttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccctctagaggagcctgttctagatattcgg
++
+ddddddddddddddddddddddddddddddddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~`~~~~~~~~~~~~~~ddedddddddddddddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:24:16230:12703#0/2_CONS ali_length=62; direction=left; seq_ab_match=59; sminR=40.0; seq_a_mismatch=2; seq_b_deletion=0; seq_b_mismatch=1; seq_a_deletion=0; seq_b_single=46; score=223.86908915; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; score_norm=3.61079176049; seq_b_insertion=0; 
+ccgaagtagtagaacaggctcctctagaaggggataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaataattttgttatattaattacttgtgtttagggctaagcatagtggggtatctaactacttcgg
++
+ddd`ddddad_ddaddddddddaddddddc`bO``ddd_a`ddd`a}}~sb{~~~~~~~~~~~~~~~~a~~~~~~y~u~~~~~~~~~~~~~~~~~~~~~~~~b~~~~~b^ddcdbcddadddd_ddbdcdcdddd`ddddbddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:4:4214:9434#0/2_CONS ali_length=62; direction=left; seq_ab_match=58; sminR=40.0; seq_a_mismatch=3; seq_b_deletion=0; seq_b_mismatch=1; seq_a_deletion=0; seq_b_single=46; score=215.812703412; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; score_norm=3.48085005502; seq_b_insertion=0; 
+ccaattaacttagataccccactatgcctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactacaggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctagttaattgg
++
+ddddddddSddddbbdddddddbddabdddbdddddcddddddddd~^~~~{~{~~~~~}~~{~~ym~L||~~wuy~zyxPzjyyvxku~~~~~~~~~~~~~~~~~xbacdddddaddac_^`_`dcddddacddcddddadaa`[``^c`acc
+@HELIUM_000100422_612GNAAXX:7:12:17693:3451#0/2_CONS ali_length=62; direction=left; seq_ab_match=62; sminR=40.0; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; seq_b_single=46; score=247.862243; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; score_norm=3.9977781129; seq_b_insertion=0; 
+ccaattaactagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaatagttttgtttgcataactatttgtgtttaaggctaggcatagtggggtatctaagttaattgg
++
+dddddddddddddddddddddddddbddddddaddddddcdddddc~~~~~~~~~~~~~~~~~~~~~~~~~}~{~}{v}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddddeddddddddddcdeddddddcddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:3:14624:12375#0/2_CONS ali_length=63; direction=left; seq_ab_match=61; sminR=40.0; seq_a_mismatch=1; seq_b_deletion=0; seq_b_mismatch=1; seq_a_deletion=0; seq_b_single=45; score=235.922125108; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; score_norm=3.74479563663; seq_b_insertion=0; 
+ccgaatatcttagataccccactatgcttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccctctagaggagcctgttctagatattcgg
++
+ddddddddddddddddddcdcddddcddcdcdddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~Y`~~~~~~~~~~~~~~~~~~~~~~~dddddcdddddddcedddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:18:5317:11571#0/2_CONS ali_length=62; direction=left; seq_ab_match=61; sminR=40.0; seq_a_mismatch=1; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; seq_b_single=46; score=239.862078449; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; score_norm=3.86874320079; seq_b_insertion=0; 
+ccaattaactagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaatagttttgtttgcataactatttgtgtttaaggctaggcatagtggggtatctaagttaattgg
++
+ddddddddddddddddddddddddddddddddadddddddcddddd~~~~b~~~~~~~~~~{~~~~~~~~~~~~~~~~~y~~~~~~~~~~~~~~~~~~~~~~~~~~~~edddeddddddddddddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:109:17335:11429#0/2_CONS ali_length=63; direction=left; seq_ab_match=56; sminR=40.0; seq_a_mismatch=1; seq_b_deletion=0; seq_b_mismatch=6; seq_a_deletion=0; seq_b_single=45; score=195.716358124; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; score_norm=3.10660885911; seq_b_insertion=0; 
+ccgaatatctagaacaggctcctctagagggatgtaaagcaccgccaagtcctttgagtttcaggctgttgctagtagtactctggcgaacattcttgtttattgaatgtttatgtttagggctaagcatagtggggtatctaagatattcgg
++
+ddddcdddddcdddddda`ddd^dd`^^`bdd`dR\]``]cdddd~x}~~W}}~~}~~~~~x~s~~z~ccccccccccccccccc~[|~`\~}``~|~~~~~~~~~b~dbdcddddddddadcdddcdcdddcddddaddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:7:10646:8487#0/2_CONS ali_length=62; direction=left; seq_ab_match=60; sminR=40.0; seq_a_mismatch=1; seq_b_deletion=0; seq_b_mismatch=1; seq_a_deletion=0; seq_b_single=46; score=231.85443709; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; score_norm=3.739587695; seq_b_insertion=0; 
+ccaattaactagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaatagttttgtttgcataactatttgtgtttaaggctaggcatagtggggtatctaagttaattgg
++
+dddddddddddddddddddddddddddcdddddddddddddddddd~~~~~~~~~~~~~~~~b~~~~~~~hpoppitzv{~~~~~~~~~~~~~~~~~~~~~~~~~~~cedddddddddddddddccdddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:19:4865:20715#0/2_CONS ali_length=62; direction=left; seq_ab_match=60; sminR=40.0; seq_a_mismatch=2; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; seq_b_single=46; score=231.923942025; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; score_norm=3.74070874234; seq_b_insertion=0; 
+ccaattaactagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaatagttttgtttgcataactatttgtgtttaaggctaggcatagtggggtatctaagttaattgg
++
+ddddddddddddddddddddddddddddcdddaddcddddddddddby~~~~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~bddddddddddddddbcdddddeddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:13:6954:13039#0/2_CONS ali_length=63; direction=left; seq_ab_match=62; sminR=40.0; seq_a_mismatch=1; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; seq_b_single=45; score=243.872474161; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; score_norm=3.87099165336; seq_b_insertion=0; 
+ccgaatatctagaacaggctcctctagagggatataaagcaccgccaagtcctttgagttttaagctattgctagtagtcctctggcgaacattcttgtttattgaatgtttatgtttagggctaagcatagtggggtatctaagatattcgg
++
+dddddddddddddddddddddddddddddddcddddddddddddd~~~~~b~~~~~~~~~~~~~~~~~~~~~~~r~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddddddddddddddcdddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:120:14963:1929#0/2_CONS ali_length=62; direction=left; seq_ab_match=59; sminR=40.0; seq_a_mismatch=2; seq_b_deletion=0; seq_b_mismatch=1; seq_a_deletion=0; seq_b_single=46; score=223.810433242; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; score_norm=3.60984569745; seq_b_insertion=0; 
+ccgaagtagtagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaataattttgttatattaattacttgtgtttagggctaagcatagtggggtatctaactacttcgg
++
+ddddddddddddddddddddddddddddddddcddddddddddddd~~~~_~~~~~~~~~~~~~~}~~~}}`z}~~~}~~}~~|~~u~~~~~~~~~~~~~~~~}~~b~dbdddddedddddddadddcddddcddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:115:3921:10649#0/2_CONS ali_length=63; direction=left; seq_ab_match=61; sminR=40.0; seq_a_mismatch=1; seq_b_deletion=0; seq_b_mismatch=1; seq_a_deletion=0; seq_b_single=45; score=235.871015095; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; score_norm=3.74398436659; seq_b_insertion=0; 
+ccgaatatctagaacaggctcctctagagggatgtaaagcaccgccaagtcctttgagtttcaggctgttgctagtagtactctggcgaacattcttgtttattgaatgtttatgtttagggctaagcatagtggggtatctaagatattcgg
++
+dddddddddddddddddddddddeddddddddddddddddddddd~b~~~~~~~~~~~~~~~~~~~~~~i~{n~}~}~~~~~~~~~~~~~~~~~b~~~~~~~~~~~~~dddddcdddddddddeddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:109:12848:8882#0/2_CONS ali_length=62; direction=left; seq_ab_match=60; sminR=40.0; seq_a_mismatch=2; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; seq_b_single=46; score=231.869965661; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; score_norm=3.73983815582; seq_b_insertion=0; 
+ccgaagtagtagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaataattttgttatattaattacttgtgtttagggctaagcatagtggggtatctaactacttcgg
++
+ddeddcddddddcdddddddddddddddddddTdddddddddddcdb~~~~~~~~~~~~~~~~~~~~~~}~~~b~x~~{~~~~~~~~~~~~~~~~~~~~~~~~~~~~~d`dcdddddddddddeeddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:84:11257:18886#0/2_CONS ali_length=63; direction=left; seq_ab_match=55; sminR=40.0; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=8; seq_a_deletion=0; seq_b_single=45; score=187.890540948; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; score_norm=2.98238953885; seq_b_insertion=0; 
+ccgaatatctagaacaggctcctctagagggatgtaaagcaccgccaagtcctttgagtttcaggctgttgctagtagtactctggcgaacattcttgtttattgaatgtttatgtttagggctaagcatagtggggtatctaagatattcgg
++
+dddddddddddddddddddddddddddcddddddddddddddddd~t~~x~~~~~~~~~~~~~~~~~~~~t~~~~~~y~s}\`~~a|~b{~~~~~~b~~~~b~~a~b~ddddddddddddddcdddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:72:13060:5051#0/2_CONS ali_length=62; direction=left; seq_ab_match=61; sminR=40.0; seq_a_mismatch=1; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; seq_b_single=46; score=239.985823237; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; score_norm=3.87073908447; seq_b_insertion=0; 
+ccgcctcctttagataccccactatgcttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctaaggaggcgg
++
+ddbddddddddcbbdddcdcdddbd`cddddddddddddddddd_b~~~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddddedddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:35:3798:1896#0/2_CONS ali_length=62; direction=left; seq_ab_match=61; sminR=40.0; seq_a_mismatch=1; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; seq_b_single=46; score=239.863223783; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; score_norm=3.86876167392; seq_b_insertion=0; 
+ccgaagtagttagataccccactatgcttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctactacttcgg
++
+dddddddddddddbddddddddddddddddddddcddbddddddad~b~~}~~~~~~~~~~~~~~~~~n~~~~~|~}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddcddaddaddd^dddbcddddddddadddddddddcdddddddd
+@HELIUM_000100422_612GNAAXX:7:117:12470:18434#0/2_CONS ali_length=63; direction=left; seq_ab_match=59; sminR=40.0; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=4; seq_a_deletion=0; seq_b_single=45; score=219.83660627; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; score_norm=3.4894699408; seq_b_insertion=0; 
+ccgaatatcttagataccccactatgcttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccctctagaggagcctgttctagatattcgg
++
+ddddddcddddddbdddcdddddbbdddddddddddcddddddcd~~~~~~~~~~~~~~~~~~~~~~~~~~~~O~~~~~~~~~{~~{~~Wx~~~~~~~~~~~b~~~b}ddabdddddddddddddddddddddddddddddddeddddddbdd
+@HELIUM_000100422_612GNAAXX:7:11:8428:13716#0/2_CONS ali_length=62; direction=left; seq_ab_match=61; sminR=40.0; seq_a_mismatch=1; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; seq_b_single=46; score=239.97387484; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; score_norm=3.87054636839; seq_b_insertion=0; 
+ccgaagtagttagataccccactatgcttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctactacttcgg
++
+ddddddddddddddddddddddddddddddddddddddddddddad~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddddddddddddddddddcddddeddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:78:18994:16521#0/2_CONS ali_length=62; direction=left; seq_ab_match=61; sminR=40.0; seq_a_mismatch=1; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; seq_b_single=46; score=239.927346216; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; score_norm=3.86979590672; seq_b_insertion=0; 
+ccgaagtagtagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaataattttgttatattaattacttgtgtttagggctaagcatagtggggtatctaactacttcgg
++
+ddcdddddcdddcdddcdddddddddcbdddd`dedddaeeddaddb~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dadddddddddcddddddcddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:16:5047:7843#0/2_CONS ali_length=63; direction=left; seq_ab_match=63; sminR=40.0; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; seq_b_single=45; score=251.979285107; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; score_norm=3.99967119217; seq_b_insertion=0; 
+ccgaatatcttagataccccactatgcttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccctctagaggagcctgttctagatattcgg
++
+ddddddddddddddddddddddddddddedddbdddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddddddcdcddddddeeccdddddddcedddddeddddddddddd
+@HELIUM_000100422_612GNAAXX:7:118:13803:15594#0/2_CONS ali_length=63; direction=left; seq_ab_match=60; sminR=40.0; seq_a_mismatch=2; seq_b_deletion=0; seq_b_mismatch=1; seq_a_deletion=0; seq_b_single=45; score=227.87720055; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; score_norm=3.61709842144; seq_b_insertion=0; 
+ccgaatatctagaacaggctcctctagagggatgtaaagcaccgccaagtcctttgagtttcaggctgttgctagtagtactctggcgaacattcttgtttattgaatgtttatgtttagggctaagcatagtggggtatctaagatattcgg
++
+ddddddddddddddddddddddddddddddddddddddddddddd~~~~~b~~b~~~~~~~~~~v~~~~~~~~~~y~{~~~~~~~~~~~a~~~~~~~~~~~~~~~~~~dddedddddbdddd^ddeddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:53:14379:5922#0/2_CONS ali_length=62; direction=left; seq_ab_match=62; sminR=40.0; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; seq_b_single=46; score=247.982071703; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; score_norm=3.99971083392; seq_b_insertion=0; 
+ccgcctcctttagataccccactatgcttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctaaggaggcgg
++
+dddcdddddddddddddddddddddddddddddddddddddddd`d~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddddeddddddddddddddddddcddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:52:10700:16508#0/2_CONS ali_length=62; direction=left; seq_ab_match=61; sminR=40.0; seq_a_mismatch=1; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; seq_b_single=46; score=239.790995416; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; score_norm=3.86759670025; seq_b_insertion=0; 
+ccgaagtagtagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaataattttgttatattaattacttgtgtttagggctaagcatagtggggtatctaactacttcgg
++
+dddddddddddddeddddcdddcdddddddddIddbdddbdcddddb~~u~~~}~|||v|~~~~{~~~~~}}}~~~~~~~~~~~~~~~~v~~{{~~~~~~~~~~~~~~ccccccacccccccccc^cccccccccccccccc_cccccc[cca^
+@HELIUM_000100422_612GNAAXX:7:69:7696:12881#0/2_CONS ali_length=63; direction=left; seq_ab_match=63; sminR=40.0; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; seq_b_single=45; score=251.983052061; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; score_norm=3.99973098509; seq_b_insertion=0; 
+ccgaatatcttagataccccactatgcttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccctctagaggagcctgttctagatattcgg
++
+dddddddddddddddddddddddddddeddddddcdddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddddddddddddddcdddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:44:12484:5320#0/2_CONS ali_length=62; direction=left; seq_ab_match=60; sminR=40.0; seq_a_mismatch=2; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; seq_b_single=46; score=231.837799589; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; score_norm=3.73931934821; seq_b_insertion=0; 
+ccaattaactagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaatagttttgtttgcataactatttgtgtttaaggctaggcatagtggggtatctaagttaattgg
++
+ddddcbddddddccddddeddddddddddddddddddddaddddcda~~~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~z}}}~~~~~~~~~~~~~~~~~~~cddddddddddddddddeddddddddddddddddddddddeddddd
+@HELIUM_000100422_612GNAAXX:7:21:4713:10229#0/2_CONS ali_length=62; direction=left; seq_ab_match=61; sminR=40.0; seq_a_mismatch=1; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; seq_b_single=46; score=239.864510201; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; score_norm=3.86878242259; seq_b_insertion=0; 
+ccaattaactagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaatagttttgtttgcataactatttgtgtttaaggctaggcatagtggggtatctaagttaattgg
++
+dddddddddddddddddddddddddddbdddd`ddddddddddddd~~~~~~~~~~~~~~b~~~~~~~~~~~~~~~~~~~|~~~~~~~~~~~~~~~~~~~~~~~~~~~ddddddcddddddddbdcdddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:38:6201:12003#0/2_CONS ali_length=63; direction=left; seq_ab_match=59; sminR=40.0; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=4; seq_a_deletion=0; seq_b_single=45; score=219.686655506; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; score_norm=3.48708976993; seq_b_insertion=0; 
+ccgaatatctagaacaggctcctctagcgggatataaagcaccgcccagttctttgagttttaagctattgctagtagtcctctggcgaattattttgttgtaaaattatctatgtttagggctaagcatagtggggtatctaagatattcgg
++
+bbb`^a``b[a[aa^YVY\YW__TXbbHaDDDDDDDDDDDDDDDDcBcccBccccccccccccccccc~x~z}}}}}y~rzwzz||{zyzxa{}~t~~~~~~~b~~~~cddddd[dddcddcddbddbdddddd`dddd^dcddddddddddd
+@HELIUM_000100422_612GNAAXX:7:33:16506:1490#0/2_CONS ali_length=62; direction=left; seq_ab_match=62; sminR=40.0; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; seq_b_single=46; score=247.963002972; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; score_norm=3.99940327375; seq_b_insertion=0; 
+ccaattaacttagataccccactatgcctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctagttaattgg
++
+ddddeddddddddddddddddddddddddddddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddddeddddddddddddddddddddddddddeedddd
+@HELIUM_000100422_612GNAAXX:7:1:9007:3289#0/2_CONS ali_length=62; direction=left; seq_ab_match=60; sminR=40.0; seq_a_mismatch=2; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; seq_b_single=46; score=231.83380127; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; score_norm=3.7392548592; seq_b_insertion=0; 
+ccatctctctagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaataattttgttatattaattacttgtgtttagggctaagcatagtggggtatctaagagagatgg
++
+dddddddddddddbddddddddddddddddddddddddddddddddb~~~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}~~~~~~~~~~~~~~~~~~~dbddcddddddddddddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:32:4360:3451#0/2_CONS ali_length=61; direction=left; seq_ab_match=61; sminR=40.0; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; seq_b_single=47; score=243.999335649; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=47; score_norm=3.999989109; seq_b_insertion=0; 
+cccaattaacttagataccccactatgcctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctagttaattgg
++
+dddeddcddddddcdddddddddddddddddddddddddddddddde~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddeddddddddddeeddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:115:17402:4174#0/2_CONS ali_length=62; direction=left; seq_ab_match=59; sminR=40.0; seq_a_mismatch=3; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; seq_b_single=46; score=223.877240886; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; score_norm=3.6109232401; seq_b_insertion=0; 
+ccgcctccttagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgcaggtagtactctggcgaataattttgttatattaattacttgtgtttagggctaagcatagtggggtatctaaaggaggcgg
++
+ddddddddddddddddcddddd`addddddddcdddddddddddddb~~~b~~~~~~~~~~~~~~{~~~~~~Sv~y|~s~~~~~~~~~~~~~~~~~~~~~~~~~~~~~d]ddcdeddddccdddddeddddcdddddddddddddddddddded
+@HELIUM_000100422_612GNAAXX:7:45:6831:6228#0/2_CONS ali_length=62; direction=left; seq_ab_match=62; sminR=40.0; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; seq_b_single=46; score=247.974637619; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; score_norm=3.99959092934; seq_b_insertion=0; 
+ccaattaacttagataccccactatgcctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctagttaattgg
++
+ddddddddddddddddddddddddddddddcddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddddedddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:117:4291:18111#0/2_CONS ali_length=63; direction=left; seq_ab_match=62; sminR=40.0; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=1; seq_a_deletion=0; seq_b_single=45; score=243.911625561; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; score_norm=3.87161310415; seq_b_insertion=0; 
+ccgaatatcttagataccccactatgcttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccctctagaggagcctgttctagatattcgg
++
+dddddddddddddddddddddddddddddddddddaddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~~~~~ddddddddddddddddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:71:14800:3222#0/2_CONS ali_length=62; direction=left; seq_ab_match=60; sminR=40.0; seq_a_mismatch=2; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; seq_b_single=46; score=231.89389474; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; score_norm=3.74022410871; seq_b_insertion=0; 
+ccgcctccttagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaataattttgttatattaattacttgtgtttagggctaagcatagtggggtatctaaaggaggcgg
++
+ddddddddddddddddddeddddddddeddddcdddddccdddddd~~~~b~~~~~~~~~~~~~~~~~\~~~}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dcddddddddeedddddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:11:8547:18238#0/2_CONS ali_length=63; direction=left; seq_ab_match=63; sminR=40.0; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; seq_b_single=45; score=251.984413754; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; score_norm=3.99975259927; seq_b_insertion=0; 
+ccgaatatcttagataccccactatgcttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccctctagaggagcctgttctagatattcgg
++
+ddddddddddddddddddddddddddddbdcdddddddddcdddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddddddddddddddddddddddeddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:117:2416:10342#0/2_CONS ali_length=63; direction=left; seq_ab_match=61; sminR=40.0; seq_a_mismatch=2; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; seq_b_single=45; score=235.921215944; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; score_norm=3.74478120546; seq_b_insertion=0; 
+ccgaatatctagaacaggctcctctagagggatgtaaagcaccgccaagtcctttgagtttcaggctgttgctagtagtactctggcgaacattcttgtttattgaatgtttatgtttagggctaagcatagtggggtatctaagatattcgg
++
+dddddddddddddddcdcddddaddcddddddddbddddbddddd~b~~|b~~~~~}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddcdcddddY[ZYUd^dbdbdddddddddddddcdddddddddd
+@HELIUM_000100422_612GNAAXX:7:78:7151:19928#0/2_CONS ali_length=63; direction=left; seq_ab_match=56; sminR=40.0; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=7; seq_a_deletion=0; seq_b_single=45; score=195.576462373; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; score_norm=3.10438829164; seq_b_insertion=0; 
+ccgaatatcttagataccccactatgcttagccctaaacataaacattcaataaacgagaatgttcgccagtgtacttctagcaacaggctgaaactcaaaggacttggcggtggtttacatccctctagaggagcctgttctagatattcgg
++
+ZYQOYVVXRYYOYZZ^^^_bZZ]Z[S[WSR]YbbbDDDDDDDDDDcccccccccccBBcccccccccccccBcccccBccccccccccBccccccccccBccccc~`~WNS]Y_KTUVZ[O_SHW]ZQ_^^^ab`Obb\TY\MPPPPQQQQQQ
+@HELIUM_000100422_612GNAAXX:7:71:18821:20471#0/2_CONS ali_length=62; direction=left; seq_ab_match=53; sminR=40.0; seq_a_mismatch=7; seq_b_deletion=0; seq_b_mismatch=2; seq_a_deletion=0; seq_b_single=46; score=175.889514148; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; score_norm=2.83692764755; seq_b_insertion=0; 
+ccaattaacttagataccccactatgcctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctagttaattgg
++
+ddddddddddddddddddddddddddddd\ddddddddd^ddd`dd~~~~Xx~~~~~{|q}}x}^Y`J`~Xv{wt~~~~~~~~~~~~~~~~~~~~~~~~~b~~~~~sbddddddddddddd^bdccddbdddddd`ddddddddddddddcddd
+@HELIUM_000100422_612GNAAXX:7:58:15837:8531#0/2_CONS ali_length=63; direction=left; seq_ab_match=63; sminR=40.0; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; seq_b_single=45; score=251.96128051; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; score_norm=3.99938540492; seq_b_insertion=0; 
+ccgaatatcttagataccccactatgcttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccctctagaggagcctgttctagatattcgg
++
+ddddddddddddddddddddddddddddddbdddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddddddddddddcdddddddddddddcdddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:38:10813:16867#0/2_CONS ali_length=63; direction=left; seq_ab_match=63; sminR=40.0; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; seq_b_single=45; score=251.97777927; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; score_norm=3.99964729; seq_b_insertion=0; 
+ccgaatatcttagataccccactatgcttagccctaaacataaacattcaataaacaagaatgtttgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccctctagaggagcctgttctagatattcgg
++
+dddddddddddddddddddddddcdddddddddddeddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dbcdddddadadcdddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:68:19115:18847#0/2_CONS ali_length=62; direction=left; seq_ab_match=54; sminR=40.0; seq_a_mismatch=6; seq_b_deletion=0; seq_b_mismatch=2; seq_a_deletion=0; seq_b_single=46; score=183.856571062; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; score_norm=2.96542856552; seq_b_insertion=0; 
+ccgcctccttagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaataattttgttatattaattacttgtgtttagggctaagcatagtggggtatctaaaggaggcgg
++
+cdbdddddddcdbcddc[Tabcddd_`bddaaabd^bb^P`ccd`db{~~b~~~~~~\\~~x~~~~s~~s~~~_~~{~~~~~~~b{~~}~~~~~~~~~~~b~~~~~`~ddd^dd_ddcdd_ddceddedcdddddcddacdddddddddddcad
+@HELIUM_000100422_612GNAAXX:7:14:3978:11028#0/2_CONS ali_length=62; direction=left; seq_ab_match=60; sminR=40.0; seq_a_mismatch=2; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; seq_b_single=46; score=231.869517243; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; score_norm=3.73983092328; seq_b_insertion=0; 
+ccgaagtagtagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgcaggtagtactctggcgaataattttgttatattaattacttgtgtttagggctaagcatagtggggtatctaactacttcgg
++
+ddcddddddcdddeddddddddcddddddcb`Zbbddddddddddd_~~~~~~~~~~~~~~~~~~~v~~~y~J|~u{|w~~~~~~~~~~~~~~~~~~~~~~~~~~~~~da`dddeddddcdbdaeddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:34:18733:3827#0/2_CONS ali_length=63; direction=left; seq_ab_match=62; sminR=40.0; seq_a_mismatch=1; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; seq_b_single=45; score=243.983236898; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; score_norm=3.87274979204; seq_b_insertion=0; 
+ccgaatatcttagataccccactatgcttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccctctagaggagcctgttctagatattcgg
++
+ddddddddddddddddddddddddddddddddddddddddddddd~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddddddddddddddddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:65:6787:8456#0/2_CONS ali_length=62; direction=left; seq_ab_match=60; sminR=40.0; seq_a_mismatch=2; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; seq_b_single=46; score=231.869006954; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; score_norm=3.7398226928; seq_b_insertion=0; 
+ccgaagtagtagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaataattttgttatattaattacttgtgtttagggctaagcatagtggggtatctaactacttcgg
++
+ddddddddbddddeddddedddddddddddddddddddddddddddb~~~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~d_ddeddddddcdddddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:111:7441:14688#0/2_CONS ali_length=63; direction=left; seq_ab_match=62; sminR=40.0; seq_a_mismatch=1; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; seq_b_single=45; score=243.832560428; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; score_norm=3.87035810203; seq_b_insertion=0; 
+ccgaatatctagaacaggctcctctagagggatgtaaagcaccgccaagtcctttgagtttcaggctgttgctagtagtactctggcgaacattcttgtttattgaatgtttatgtttagggctaagcatagtggggtatctaagatattcgg
++
+ddddddddddddddddddddddddddddddddddddddddddddd~~~~~b~~~~~u~~~~~~~~~~~~~~~~~~}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddddedddddddddadddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:86:10092:15563#0/2_CONS ali_length=62; direction=left; seq_ab_match=59; sminR=40.0; seq_a_mismatch=2; seq_b_deletion=0; seq_b_mismatch=1; seq_a_deletion=0; seq_b_single=46; score=223.927744132; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; score_norm=3.61173780858; seq_b_insertion=0; 
+ccgcctcctttagataccccactatgcttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctaaggaggcgg
++
+dddd`dddddbdddddddddddcddddddbdddddccdddddaddd~b~~~~~~~~~~~~~_~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~|bddddddddddcddcddd`^dddddddddddcddddddddddddbdd
+@HELIUM_000100422_612GNAAXX:7:16:4418:5128#0/2_CONS ali_length=62; direction=left; seq_ab_match=59; sminR=40.0; seq_a_mismatch=3; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; seq_b_single=46; score=223.862543287; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; score_norm=3.61068618206; seq_b_insertion=0; 
+ccaattaactagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaatagttttgtttgcataactatttgtgtttaaggctaggcatagtggggtatctaagttaattgg
++
+dddddddddddddddddddddddddddddddddddddddbddedddb~~~b~~b~~~~~~~~~~~~~~~{~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~bddddddddddddddedddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:13:5742:9859#0/2_CONS ali_length=58; direction=right; seq_ab_match=55; sminR=40.0; seq_a_mismatch=3; seq_b_deletion=50; seq_b_mismatch=0; seq_a_deletion=50; seq_b_single=0; score=207.846895043; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=0; score_norm=3.58356715591; seq_b_insertion=0; 
+ccgcctcctttagataccccactatgcttttctagaggagcctgttctaaggaggcgg
++
+~~~~~~Z~~~~~~~~~b~~~~~~~~~_~~~~~~~~~~}~~~~~~~~~~~~~~~~~~~~
+@HELIUM_000100422_612GNAAXX:7:85:18986:17662#0/2_CONS ali_length=62; direction=left; seq_ab_match=60; sminR=40.0; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=2; seq_a_deletion=0; seq_b_single=46; score=231.874929984; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; score_norm=3.73991822554; seq_b_insertion=0; 
+ccgaagtagttagataccccactatgcttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctactacttcgg
++
+ddcdddddddddeccdddddddddcbdddddddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}~~s~~~~~b~~~~~~b~~~~~~~ddcddddddcddddddddddddd`dddddddddddddddddddded
+@HELIUM_000100422_612GNAAXX:7:16:16357:19948#0/2_CONS ali_length=63; direction=left; seq_ab_match=57; sminR=40.0; seq_a_mismatch=5; seq_b_deletion=0; seq_b_mismatch=1; seq_a_deletion=0; seq_b_single=45; score=203.860719115; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; score_norm=3.23588443039; seq_b_insertion=0; 
+ccgaatatcttagataccccactatgcttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcacaggacttggcggtgctttacatccctctagaggagcctgttctagatattcgg
++
+baNdQdd`dd`da_ddbadbdddcddddd_dbddbdaddbddddd~`~~b~~~~~~b~~{~~~}x}}~}`twyhw~~~~}w|~|~~~~~X~~~|~~~~~Y~~~~~~~~XVRSQ[Qadd``^P^adYdddddddcc`^_dccddcdccdddddd
+@HELIUM_000100422_612GNAAXX:7:107:3570:18147#0/2_CONS ali_length=62; direction=left; seq_ab_match=60; sminR=40.0; seq_a_mismatch=2; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; seq_b_single=46; score=231.924768153; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; score_norm=3.74072206698; seq_b_insertion=0; 
+ccgcctccttagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttatgctattgccggtagtactctggcgaataattttgttatattaattacttgtgtttagggctaagcatagtggggtatctaaaggaggcgg
++
+ddada`dcddddddddddddddadd_^b_cdd]dddddcdd_dcdd`~s~a~~~~~~~~}~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~d\d\dddddcdddddadddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:82:8836:11354#0/2_CONS ali_length=62; direction=left; seq_ab_match=60; sminR=40.0; seq_a_mismatch=2; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; seq_b_single=46; score=231.781218203; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; score_norm=3.73840674522; seq_b_insertion=0; 
+ccaattaactagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaatagttttgtttgcataactatttgtgtttaaggctaggcatagtggggtatctaagttaattgg
++
+dddddddddddddddddddddddddddaddddcdddddcaddddddb~~~b~~~~~~~~~~~~~~~~~~~~~|~~k{{w~~~~~~~~~~~~~~~~~~~~~~{~~~~~~ddddddddddddddddeddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:41:2354:1449#0/2_CONS ali_length=63; direction=left; seq_ab_match=55; sminR=40.0; seq_a_mismatch=5; seq_b_deletion=0; seq_b_mismatch=3; seq_a_deletion=0; seq_b_single=45; score=187.777927438; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; score_norm=2.98060202283; seq_b_insertion=0; 
+ccgaatatcttagataccccactatgcttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccctctagaggagcctgttctagatattcgg
++
+ddbdddccddddddddddddddddddddaaddddddcddbcdddd~b}bb~b~~~b~q~~}~}~x~x~t~s~|k|~w~~z~~{|{~ccBc~~}~~~~~~a~~a~}p~~baceddbbedddda_aa_c[cdadddddddddddddddadddadd
+@HELIUM_000100422_612GNAAXX:7:114:4511:17596#0/2_CONS ali_length=62; direction=left; seq_ab_match=57; sminR=40.0; seq_a_mismatch=4; seq_b_deletion=0; seq_b_mismatch=1; seq_a_deletion=0; seq_b_single=46; score=207.883730153; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; score_norm=3.35296338956; seq_b_insertion=0; 
+ccgcctccttagaacaggctcctctagaagcgtataaagcaccgccaagtcctttgagttttaagctattgccggtagcactctggcgaataattttgttatattaattacttgtgtttagggctaagcatagtggggtatctaaaggaggcgg
++
+ddeedecddddddbdddcdeeddddPQPPPKKPQPPPPPQdddddd~~~~b~~~~~~~~~~~~~~~~~as~a~~~~~}W~~~~~~~~~~~~~X~~~~~~~~~~~~~~~d^d^dddddddddddddddddddddddbdddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:94:12367:17729#0/2_CONS ali_length=62; direction=left; seq_ab_match=59; sminR=40.0; seq_a_mismatch=3; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; seq_b_single=46; score=223.888596169; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; score_norm=3.61110638983; seq_b_insertion=0; 
+ccgaagtagtagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaataattttgttatattaattacttgtgtttagggctaagcatagtggggtatctaactacttcgg
++
+dddddddddddddddddddddddddddcceddccdadbd`dddddcb~~~b}~~~~~~~~~~~~~~~~~x||t~|r~~~~~~~~b~~~~~~~~~~~~~~~~~~~~~~~daddedddddddddd`dddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:30:5374:18213#0/2_CONS ali_length=63; direction=left; seq_ab_match=63; sminR=40.0; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; seq_b_single=45; score=251.958026467; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; score_norm=3.99933375344; seq_b_insertion=0; 
+ccgaatatcttagataccccactatgcttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccctctagaggagcctgttctagatattcgg
++
+dddddddddddddeddddddddddddddddddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddddddddddddddddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:49:11740:5547#0/2_CONS ali_length=63; direction=left; seq_ab_match=62; sminR=40.0; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=1; seq_a_deletion=0; seq_b_single=45; score=243.959827817; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; score_norm=3.87237821931; seq_b_insertion=0; 
+ccgaatatcttagataccccactatgcttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccctctagaggagcctgttctagatattcgg
++
+ddaddcdddddddedddddddddddddeddddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~cddddddddcdddddddddddddddddddddedddddddddd`dd
+@HELIUM_000100422_612GNAAXX:7:29:3531:8314#0/2_CONS ali_length=63; direction=left; seq_ab_match=61; sminR=40.0; seq_a_mismatch=2; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; seq_b_single=45; score=235.837856208; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; score_norm=3.74345803504; seq_b_insertion=0; 
+ccgaatatctagaacaggctcctctagagggatgtaaagcaccgccaagtcctttgagtttcaggctgttgctagtagtactctggcgaacattcttgtttattgaatgtttatgtttagggctaagcatagtggggtatctaagatattcgg
++
+dddddddddddddcddddddddddddddddddcddddddddddcd~a~~~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~}~~~~~~~~~~~~~~~~~~~~~ddceddddddddddddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:114:10615:11217#0/2_CONS ali_length=62; direction=left; seq_ab_match=60; sminR=40.0; seq_a_mismatch=1; seq_b_deletion=0; seq_b_mismatch=1; seq_a_deletion=0; seq_b_single=46; score=231.702876359; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; score_norm=3.73714316708; seq_b_insertion=0; 
+ccgcctcctttagataccccactatgcttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctaaggaggcgg
++
+ddcdddcddcd`d__^dddddd`cddddddddaaa``a_adddd^d~b~~z~~~~~~~~~~~~~cBcccccccccccccc~y~~s~~~~~~~|~~~~~|~~~~sz~~~adddddd[dad`VRW]VZdddddddddddddc``_ccddddddddd
+@HELIUM_000100422_612GNAAXX:7:108:2729:8600#0/2_CONS ali_length=62; direction=left; seq_ab_match=59; sminR=40.0; seq_a_mismatch=2; seq_b_deletion=0; seq_b_mismatch=1; seq_a_deletion=0; seq_b_single=46; score=223.856778095; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; score_norm=3.61059319508; seq_b_insertion=0; 
+ccgaagtagtagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaataattttgttatattaattacttgtgtttagggctaagcatagtggggtatctaactacttcgg
++
+dddddddddddddeddddddddcddddddddddWddddcddddddd~~~~b~~~~~}~~~~~~~~~~~`~~~~~~~~~~~~~~~~~~~~~~~a~~~~~~~~~~~~~~~dacdcdeddddddddddddddedddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:103:8847:6326#0/2_CONS ali_length=63; direction=left; seq_ab_match=63; sminR=40.0; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; seq_b_single=45; score=251.968264217; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; score_norm=3.99949625741; seq_b_insertion=0; 
+ccgaatatcttagataccccactatgcttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccctctagaggagcctgttctagatattcgg
++
+ddddddddddddddddddddddddddddddddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddddcddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:70:11798:2668#0/2_CONS ali_length=62; direction=left; seq_ab_match=61; sminR=40.0; seq_a_mismatch=1; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; seq_b_single=46; score=239.988667111; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; score_norm=3.8707849534; seq_b_insertion=0; 
+ccgaagtagttagataccccactatgcttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacctttctagaggagcctgttctactacttcgg
++
+dddddddddddddddddddddddddddddddddddddddddddddd~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dcdddddcddddddddbddedddddddcdeddeddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:4:18261:9148#0/2_CONS ali_length=63; direction=left; seq_ab_match=61; sminR=40.0; seq_a_mismatch=1; seq_b_deletion=0; seq_b_mismatch=1; seq_a_deletion=0; seq_b_single=45; score=235.937993338; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; score_norm=3.7450475133; seq_b_insertion=0; 
+ccgaatatcttagataccccactatgcttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccctctagaggagcctgttctagatattcgg
++
+ddeddddddddddcdddddddddddddeddddddddddddddddd~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~`~~~~~~~~~~~~~~~~~~~~~~~ddddddddddddddddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:29:18416:16620#0/2_CONS ali_length=62; direction=left; seq_ab_match=60; sminR=40.0; seq_a_mismatch=2; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; seq_b_single=46; score=231.873033258; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; score_norm=3.7398876332; seq_b_insertion=0; 
+ccgcctccttagaacaggctcctctagcagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagaactctggcgaataattttgttataataattacttgtgtttagggctaagcatagtggggtatctaaaggaggcgg
++
+ddddddddddddddddccddddddd`d\dd`bH[`bbb^bdddddd~~~~~~~~~~~~~~~~~~~~~~~~~`~s~u||Fz~~~~~~~~~~~~~~~~~~~~~~~~~~~~d`ddcdbdcddbbbb\dadddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:32:18262:6966#0/2_CONS ali_length=62; direction=left; seq_ab_match=61; sminR=40.0; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=1; seq_a_deletion=0; seq_b_single=46; score=239.975704028; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; score_norm=3.87057587142; seq_b_insertion=0; 
+ccaattaacttagataccccactatgcctagccttaaacacaaatagttatgcaaacaaaactattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctagttaattgg
++
+edddddddddddddddddddddddddddddddddcddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~`~~~~~~~~~~~~ddddddddddbdddddddddddddcdddddddbddcdcddcdddbb
+@HELIUM_000100422_612GNAAXX:7:110:17877:11976#0/2_CONS ali_length=62; direction=left; seq_ab_match=59; sminR=40.0; seq_a_mismatch=2; seq_b_deletion=0; seq_b_mismatch=1; seq_a_deletion=0; seq_b_single=46; score=223.833250149; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; score_norm=3.61021371209; seq_b_insertion=0; 
+ccgcctccttagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaataattttgttatattaattacttgtgtttagggctaagcatagtggggtatctaaaggaggcgg
++
+ddddddddddddddddddddddddddd_ddddadddddddddddddb~~~b~~~~~~~~~~~~~~~~~~~vqx{w~~~~~~~~~~x~~~~~~~~~~~~~~~~~~~~`~b\d^dddddddddddcdddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:97:9416:9155#0/2_CONS ali_length=62; direction=left; seq_ab_match=60; sminR=40.0; seq_a_mismatch=2; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; seq_b_single=46; score=231.872797448; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; score_norm=3.7398838298; seq_b_insertion=0; 
+ccaattaactagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaatagttttgtttgcataactatttgtgtttaaggctaggcatagtggggtatctaagttaattgg
++
+ddddddddddddddddddddddddddddddddeddddddddddaddb~~~~~~~~~~~~~~~b~~~~~~{~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~eddddddddddddddedddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:72:8905:10715#0/2_CONS ali_length=63; direction=left; seq_ab_match=63; sminR=40.0; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; seq_b_single=45; score=251.929473647; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; score_norm=3.99888053408; seq_b_insertion=0; 
+ccgaatatctagaacaggctcctctagagggatgtaaagcaccgccaagtcctttgagtttcaggctgttgctagtagtactctggcgaacattcttgtttattgaatgtttatgtttagggctaagcatagtggggtatctaagatattcgg
++
+dddddddddddddeddddedddddddddddcdddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddddddddddddddcdddddadddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:48:5296:16375#0/2_CONS ali_length=63; direction=left; seq_ab_match=63; sminR=40.0; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; seq_b_single=45; score=251.994265764; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; score_norm=3.99990898038; seq_b_insertion=0; 
+ccgaatatcttagataccccactatgcttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccctctagaggagcctgttctagatattcgg
++
+dddddddddddddcdddd`ddddddddcddbdddddaddddbddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddd`dbdaaddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:53:6550:1163#0/2_CONS ali_length=63; direction=left; seq_ab_match=61; sminR=40.0; seq_a_mismatch=2; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; seq_b_single=45; score=235.996766828; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; score_norm=3.74598042584; seq_b_insertion=0; 
+ccgaatatcttagataccccactatgcttagccctaaacataaacattcaataaacaagaatgtttgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccctctagaggagcctgttctagatattcgg
++
+dddddddddddddddddddddddedddddaddddddddddddddd~b~~~~~~~~~~~~~~~~~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddddddddddddddddddddddddddddddeddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:120:1900:13295#0/2_CONS ali_length=62; direction=left; seq_ab_match=60; sminR=40.0; seq_a_mismatch=1; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=1; seq_b_single=46; score=219.874676069; seq_a_insertion=1; mode=alignment; sminL=40.0; seq_a_single=46; score_norm=3.54636574304; seq_b_insertion=0; 
+ccgaagtagtagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgcgcgtagtactctggcgaataattttgttatattaattacttgtgtttagggctaagcatagtggggtatctaactacttcgg
++
+dddddddddddddcdddddddddddddddddddcdddddcdddddd~~~~b~~~~~~~~~~~~~~~~~~~opfFhtpp~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dcddddcdddcdddddcdddddddddddddddeddddedddddddd
+@HELIUM_000100422_612GNAAXX:7:96:19317:7551#0/2_CONS ali_length=62; direction=left; seq_ab_match=58; sminR=40.0; seq_a_mismatch=3; seq_b_deletion=0; seq_b_mismatch=1; seq_a_deletion=0; seq_b_single=46; score=215.85731879; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; score_norm=3.48156965791; seq_b_insertion=0; 
+ccgaagtagtagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaataattttgttatattaattacttgtgtttagggctaagcatagtggggtatctaactacttcgg
++
+ccccccbccccccccccccccc^cccccccbcXcbccccccccccc~q~|a~~~~~~|~~~~az~~~|_snppphy~~xq{tzz~~~~~~~~Z~~~~~~~~~~~~~~~d_ddddddddcddd`bbdddddddcddddddddddddddddddddc
+@HELIUM_000100422_612GNAAXX:7:93:18556:10479#0/2_CONS ali_length=62; direction=left; seq_ab_match=59; sminR=40.0; seq_a_mismatch=2; seq_b_deletion=0; seq_b_mismatch=1; seq_a_deletion=0; seq_b_single=46; score=223.913795643; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; score_norm=3.61151283295; seq_b_insertion=0; 
+ccgcctcctttagataccccactatgcttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctaaggaggcgg
++
+ddddddddcddcddcddddddddddddddddddddddddddddddd~b~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~~~~~~~dddddddddddddbdddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:44:19605:15509#0/2_CONS ali_length=62; direction=left; seq_ab_match=59; sminR=40.0; seq_a_mismatch=3; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; seq_b_single=46; score=223.916231984; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; score_norm=3.61155212878; seq_b_insertion=0; 
+ccgcctccttagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaataattttgttatattaattacttgtgtttagggctaagcatagtggggtatctaaaggaggcgg
++
+dddddddddddddddddddddddddbddddddcddcdcdacddcdd~r~~`~k`~~p~~~_~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~z}y~~~~~~~~~~~~~~a_d_dddddddddddcdadddddddcdddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:40:3610:8896#0/2_CONS ali_length=62; direction=left; seq_ab_match=61; sminR=40.0; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=1; seq_a_deletion=0; seq_b_single=46; score=239.967241748; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; score_norm=3.87043938304; seq_b_insertion=0; 
+ccgaagtagttagataccccactatgcttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctactacttcgg
++
+dddddddddddddddddddddddddddddddddddddddddddddd~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~~~~~~~~~dddddddddddddedddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:41:19763:3556#0/2_CONS ali_length=62; direction=left; seq_ab_match=62; sminR=40.0; seq_a_mismatch=0; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; seq_b_single=46; score=247.825851895; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; score_norm=3.99719115959; seq_b_insertion=0; 
+ccgaagtagtagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaataattttgttatattaattacttgtgtttagggctaagcatagtggggtatctaactacttcgg
++
+ddddddddddddddddddddddddddddddddcddddddddddddd{~~~~~~~~~~~~~~~~~~~v~~~~~~~~jz{m{~~~~~~~~~~~~~~~~~~~~~~~~~~~~dacddddddddddddcddddddddddddddededddddddddddWd
+@HELIUM_000100422_612GNAAXX:7:111:7660:7465#0/2_CONS ali_length=63; direction=left; seq_ab_match=58; sminR=40.0; seq_a_mismatch=2; seq_b_deletion=0; seq_b_mismatch=3; seq_a_deletion=0; seq_b_single=45; score=211.768626837; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; score_norm=3.36140677518; seq_b_insertion=0; 
+ccgaatatcttagataccccactatgcttagccctaaacataaacattcaataaacaagaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccctctagaggagcctgttctagatattcgg
++
+dbdbddcdddddddddd^dd`dddddcddcdddddd`ddddddcd~~~~~~~~_~~~~~~~~~~~~~Ky~~~~~~c~Y}~~s~~`~x~}~}~{~Z|h~~~~~~~~~~~dYYdddaddaaddad^dddcddddddcdddddddadcdddd``dd
+@HELIUM_000100422_612GNAAXX:7:76:10822:18722#0/2_CONS ali_length=63; direction=left; seq_ab_match=58; sminR=40.0; seq_a_mismatch=5; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; seq_b_single=45; score=211.83390837; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; score_norm=3.36244299; seq_b_insertion=0; 
+ccgaatatcttagataccccactatgcttagccctaaacataaacattcaataaacacgaatgttcgccagagtactactagcaacagcctgaaactcaaaggacttggcggtgctttacatccctctagaggagcctgttctagatattcgg
++
+ddddddbcdbdddddddd_dddddddcacbdcddddTbdcddddd~`~~~z~~~~~~S~~~~~~b~~`~~~t~t~~}~~~~~~~~~~~T~~~|~~~~~~~~~~~~x~~ddddadddd_ddbdcbdddadddcdddddddbdddddddbddddd
+@HELIUM_000100422_612GNAAXX:7:76:8491:8900#0/2_CONS ali_length=62; direction=left; seq_ab_match=57; sminR=40.0; seq_a_mismatch=4; seq_b_deletion=0; seq_b_mismatch=1; seq_a_deletion=0; seq_b_single=46; score=207.828655885; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; score_norm=3.35207509492; seq_b_insertion=0; 
+ccgaagtagtagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgcaggtagcactctggcgaataattttgttatattaattacttgtgtttagggctaagcatagtggggtatctaactacttcgg
++
+dcddddddddddddadddddddadddcaddddadcdddddddddddb~~~b~~~~~o~~~~~~~~~~~~~z}F}~xq~N}~~y~~~}~~~~wu~~~~~~~~~~~~~^~b[bcc_ccccbcccccccbcbabacccccccbc_ccbbb`bccccc
+@HELIUM_000100422_612GNAAXX:7:47:7619:9866#0/2_CONS ali_length=62; direction=left; seq_ab_match=61; sminR=40.0; seq_a_mismatch=1; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; seq_b_single=46; score=239.867362445; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; score_norm=3.86882842653; seq_b_insertion=0; 
+ccaattaactagaacaggctcctctagaagggtataaagcaccgccaagtcctttgagttttaagctattgccggtagtactctggcgaatagttttgtttgcataactatttgtgtttaaggctaggcatagtggggtatctaagttaattgg
++
+dddddeddddddedddddddddeddddddddddddddddddddddda~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dedddddddddddddddddddddddddddddddddddddddedddd
+@HELIUM_000100422_612GNAAXX:7:1:8649:5297#0/2_CONS ali_length=104; direction=right; seq_ab_match=104; sminR=40.0; seq_a_mismatch=0; seq_b_deletion=4; seq_b_mismatch=0; seq_a_deletion=4; seq_b_single=0; score=415.823014771; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=0; score_norm=3.99829821895; seq_b_insertion=0; 
+ccagcgagatcccattgagtctctgcacctatcctttttttcgttttctgaatctttgtttggaaaaaaacaggatttggctcaggattgcccgatctcgctgg
++
+~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~
+@HELIUM_000100422_612GNAAXX:7:99:14742:5591#0/2_CONS ali_length=62; direction=left; seq_ab_match=60; sminR=40.0; seq_a_mismatch=2; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; seq_b_single=46; score=231.982488051; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; score_norm=3.74165303308; seq_b_insertion=0; 
+ccgcctcctttagataccccactatgcttagccctaaacacaagtaattaatataacaaaattattcgccagagtactaccggcaatagcttaaaactcaaaggacttggcggtgctttatacccttctagaggagcctgttctaaggaggcgg
++
+dddddddddddddddddeddddddddddddddddddddddddddcd~b~~~~~~~~~~~~~a~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ddddddddddddddddcddddddddddcdddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:95:3274:5435#0/2_CONS ali_length=63; direction=left; seq_ab_match=61; sminR=40.0; seq_a_mismatch=1; seq_b_deletion=0; seq_b_mismatch=1; seq_a_deletion=0; seq_b_single=45; score=235.944669323; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; score_norm=3.74515348131; seq_b_insertion=0; 
+ccgaatatctagaacaggctcctctagagggatgtaaagcaccgccaagtcctttgagtttcaggctgttgctagtagtactctggcgaacattcttgtttattgaatgtttatgtttagggctaagcatagtggggtatctaagatattcgg
++
+dddddddddddcddddddddddccddddddddddcdddddddddd~~~~~b~~~~~~~~~~~~~~~~~~~~~~~~~{~~~~~~~~~~~~~~~~~~~~~~~~~~~~~b~ddddcdddddddddcdddddddddddedddddddeddcdcddddd
+@HELIUM_000100422_612GNAAXX:7:74:8396:18135#0/2_CONS ali_length=63; direction=left; seq_ab_match=61; sminR=40.0; seq_a_mismatch=2; seq_b_deletion=0; seq_b_mismatch=0; seq_a_deletion=0; seq_b_single=45; score=235.858013544; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=45; score_norm=3.74377799276; seq_b_insertion=0; 
+ccgaatatctagaacaggctcctctagagggatgtaaagcaccgccaagtcctttgagtttcaggctgttgctagtagtactctggcgaacattcttgtttattgaatgtttatgtttagggctaagcatagtggggtatctaagatattcgg
++
+ddddddddddddddddddddddddddddddddddddddddddddd~W~~~b~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~dddcddddddddddddddddddddddddddddddddddddddddd
+@HELIUM_000100422_612GNAAXX:7:9:10358:4089#0/2_CONS ali_length=61; direction=left; seq_ab_match=54; sminR=40.0; seq_a_mismatch=1; seq_b_deletion=1; seq_b_mismatch=6; seq_a_deletion=0; seq_b_single=47; score=181.620394786; seq_a_insertion=0; mode=alignment; sminL=40.0; seq_a_single=46; score_norm=2.97738352108; seq_b_insertion=0; 
+ccaattaactagaacaggctcctctagaagggtataaagcaccgccaagttctttgagttttgagctattgcctgtagtactctggcgaatagttttgtttgcataactatttgtgtttaag