changeset 0:1b6d07160736 draft

planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/stacks2 commit b395fa36fa826e26085820ba3a9faacaeddcb460
author iuc
date Mon, 01 Jul 2019 10:57:08 -0400
parents
children b75174403a65
files macros.xml macros_process.xml stacks_clonefilter.xml test-data/clonefilter/R1_0001.1.fq.gz test-data/clonefilter/R2_0001.2.fq.gz test-data/clonefilter/Removed1_0001.1.1.fq.gz test-data/clonefilter/Removed1_0001.1.1.fq.single.gz test-data/clonefilter/Removed2_0001.2.2.fq.gz test-data/clonefilter/clonefilter.log test-data/cstacks/catalog.alleles.tsv test-data/cstacks/catalog.snps.tsv test-data/cstacks/catalog.tags.tsv test-data/cstacks/cstacks.log test-data/demultiplexed/PopA_01.1.fa test-data/demultiplexed/PopA_01.1.fa.gz test-data/demultiplexed/PopA_01.1.fq test-data/demultiplexed/PopA_01.2.fa test-data/demultiplexed/PopA_01.2.fa.gz test-data/demultiplexed/PopA_01.2.fq test-data/demultiplexed/PopA_01.fq test-data/demultiplexed/PopA_01.rem.1.fa test-data/demultiplexed/PopA_01.rem.1.fa.gz test-data/demultiplexed/PopA_01.rem.2.fa test-data/demultiplexed/PopA_01.rem.2.fa.gz test-data/demultiplexed/PopA_02.1.fq test-data/demultiplexed/PopA_02.2.fq test-data/denovo_map/denovo_map.log test-data/denovo_map/popmap_cstacks.tsv test-data/gentest.sh test-data/gstacks/PopA_01.alns.bam test-data/gstacks/PopA_02.alns.bam test-data/gstacks/alignments.bam test-data/gstacks/catalog.calls.vcf test-data/gstacks/catalog.fa.gz test-data/gstacks/gstacks.log test-data/gstacks/gstacks.log.distribs test-data/kmerfilter/kfreq.tsv test-data/kmerfilter/kfreqdist.tsv test-data/kmerfilter/kmerfilter.log test-data/populations/blacklist.tsv test-data/populations/populations.fixed.phylip test-data/populations/populations.fixed.phylip.log test-data/populations/populations.fst_summary.tsv test-data/populations/populations.haplotypes.tsv test-data/populations/populations.haps.genepop test-data/populations/populations.haps.radpainter test-data/populations/populations.haps.vcf test-data/populations/populations.hapstats.tsv test-data/populations/populations.hzar.csv test-data/populations/populations.loci.fa test-data/populations/populations.log test-data/populations/populations.log.distribs test-data/populations/populations.markers.tsv test-data/populations/populations.phistats.tsv test-data/populations/populations.phistats_summary.tsv test-data/populations/populations.plink.map test-data/populations/populations.plink.ped test-data/populations/populations.samples-raw.fa test-data/populations/populations.samples.fa test-data/populations/populations.snps.genepop test-data/populations/populations.snps.vcf test-data/populations/populations.structure test-data/populations/populations.sumstats.tsv test-data/populations/populations.sumstats_summary.tsv test-data/populations/populations.treemix test-data/populations/populations.var.phylip test-data/populations/populations.var.phylip.log test-data/procrad/R1.fa.discards test-data/procrad/R1.fq test-data/procrad/R1.fq.discards test-data/procrad/R1.fq.gzip test-data/procrad/R2.fa.discards test-data/procrad/R2.fq test-data/procrad/R2.fq.discards test-data/procrad/R2.fq.gzip test-data/procrad/barcodes test-data/procrad/process_radtags.out test-data/procrad/process_radtags_paired.out test-data/refmap/PopA_01.bam test-data/refmap/PopA_02.bam test-data/refmap/catalog.calls.vcf test-data/refmap/catalog.fa.gz test-data/refmap/populations.haplotypes.tsv test-data/refmap/populations.hapstats.tsv test-data/refmap/populations.log.distribs test-data/refmap/populations.markers.tsv test-data/refmap/populations.sumstats.tsv test-data/refmap/populations.sumstats_summary.tsv test-data/shortreads/PopA_01.forward.fq.gz test-data/shortreads/PopA_01.fq test-data/shortreads/PopA_01.rem.forward.fq.gz test-data/shortreads/PopA_01.rem.reverse.fq.gz test-data/shortreads/PopA_01.reverse.fq.gz test-data/shortreads/process_shortreads.out test-data/shortreads/reads.forward.fq test-data/shortreads/reads.reverse.fq test-data/sstacks/PopA_01.matches.tsv test-data/sstacks/PopA_02.matches.tsv test-data/sstacks/sstacks.log test-data/stacks_outputs/catalog.calls test-data/stacks_outputs/tsv2bam.log test-data/tsv2bam/PopA_01.bam test-data/tsv2bam/PopA_01.matches.bam test-data/tsv2bam/PopA_02.bam test-data/tsv2bam/PopA_02.matches.bam test-data/tsv2bam/tsv2bam.log test-data/ustacks/PopA_01.alleles.tsv test-data/ustacks/PopA_01.snps.tsv test-data/ustacks/PopA_01.tags.tsv test-data/ustacks/PopA_02.alleles.tsv test-data/ustacks/PopA_02.snps.tsv test-data/ustacks/PopA_02.tags.tsv test-data/ustacks/ustacks.log
diffstat 106 files changed, 119955 insertions(+), 0 deletions(-) [+]
line wrap: on
line diff
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/macros.xml	Mon Jul 01 10:57:08 2019 -0400
@@ -0,0 +1,596 @@
+<?xml version="1.0"?>
+<macros>
+    <xml name="requirements">
+        <requirements>
+            <requirement type="package" version="@STACKS_VERSION@">stacks</requirement>
+            <yield/>
+        </requirements>
+    </xml>
+
+    <token name="@STACKS_VERSION@">2.4</token>
+    <token name="@WRAPPER_VERSION@">0</token>
+    <!-- fix to 18.01 since https://github.com/galaxyproject/galaxy/pull/7032 -->
+    <token name="@PROFILE@">18.01</token>
+
+    <xml name="citation">
+        <citations>
+            <citation type="doi">10.1111/mec.12354</citation>
+            <citation type="doi">10.1111/mec.12330</citation>
+            <citation type="doi">10.1534/g3.111.000240</citation>
+            <citation type="doi">10.1534/genetics.111.127324</citation>
+            <citation type="doi">10.1111/j.1755-0998.2010.02967.x</citation>
+            <citation type="doi">10.1073/pnas.1006538107</citation>
+        </citations>
+    </xml>
+
+    <xml name="version_cmd">
+        <version_command><![CDATA[
+        process_radtags -h |& grep process_radtags  | head -n 1 | cut -d" " -f 2
+        ]]>
+        </version_command>
+    </xml>
+
+    <token name="@STACKS_INFOS@">
+<![CDATA[
+--------
+
+**Created by:**
+
+Stacks was developed by Julian Catchen with contributions from Angel Amores, Paul Hohenlohe, and Bill Cresko
+
+**Project links:**
+
+`Stacks website <http://catchenlab.life.illinois.edu/stacks/>`_
+
+`Stacks manual <http://catchenlab.life.illinois.edu/stacks/manual/>`_
+
+`Stacks google group <http://groups.google.com/group/stacks-users>`_
+]]></token>
+
+    <!-- enzyme list for procrad and denovo -->
+    <xml name="enzymes">
+        <option value="">Unspecified</option>
+        <option value="aciI">aciI</option>
+        <option value="ageI">ageI</option>
+        <option value="aluI">aluI</option>
+        <option value="apaLI">apaLI</option>
+        <option value="apeKI">apeKI</option>
+        <option value="apoI">apoI</option>
+        <option value="aseI">aseI</option>
+        <option value="bamHI">bamHI</option>
+        <option value="bbvCI">bbvCI</option>
+        <option value="bfaI">bfaI</option>
+        <option value="bfuCI">bfuCI</option>
+        <option value="bgIII">bgIII</option>
+        <option value="bsaHI">bsaHI</option>
+        <option value="bspDI">bspDI</option>
+        <option value="bstYI">bstYI</option>
+        <option value="cac8I">cac8I</option>
+        <option value="claI">claI</option>
+        <option value="csp6I">csp6I</option>
+        <option value="ddeI">ddeI</option>
+        <option value="dpnII">dpnII</option>
+        <option value="eaeI">eaeI</option>
+        <option value="ecoRI">ecoRI</option>
+        <option value="ecoRV">ecoRV</option>
+        <option value="ecoT22I">ecoT22I</option>
+        <option value="haeIII">haeIII</option>
+        <option value="hindIII">hindIII</option>
+        <option value="hinP1I">hinP1I</option>
+        <option value="hpaII">hpaII</option>
+        <option value="kpnI">kpnI</option>
+        <option value="mluCI">mluCI</option>
+        <option value="mseI">mseI</option>
+        <option value="mslI">mslI</option>
+        <option value="mspI">mspI</option>
+        <option value="ncoI">ncoI</option>
+        <option value="ndeI">ndeI</option>
+        <option value="nheI">nheI</option>
+        <option value="nlaIII">nlaIII</option>
+        <option value="notI">notI</option>
+        <option value="nsiI">nsiI</option>
+        <option value="nspI">nspI</option>
+        <option value="pstI">pstI</option>
+        <option value="rsaI">rsaI</option>
+        <option value="sacI">sacI</option>
+        <option value="sau3AI">sau3AI</option>
+        <option value="sbfI">sbfI</option>
+        <option value="sexAI">sexAI</option>
+        <option value="sgrAI">sgrAI</option>
+        <option value="speI">speI</option>
+        <option value="sphI">sphI</option>
+        <option value="taqI">taqI</option>
+        <option value="xbaI">xbaI</option>
+        <option value="xhoI">xhoI</option>
+    </xml>
+
+    <!-- log file handling -->
+    <token name="@TEE_APPEND_LOG@"><![CDATA[
+        #if $output_log
+            2>> '$output_log' &&
+        #end if
+    ]]></token>
+    <token name="@CAT_LOG_TO_STDERR@"><![CDATA[
+        #if $output_log
+            cat '$output_log' 2>&1
+        #end if
+    ]]></token>
+    <xml name="in_log">
+        <param name="add_log" type="boolean" checked="true" truevalue="yes" falsevalue="no" label="Add log output as dataset" />
+    </xml>
+    <xml name="out_log">
+        <data format="txt" name="output_log" label="${tool.name} on ${on_string} log file">
+            <filter>add_log</filter>
+        </data>
+    </xml>
+
+    <!-- inputs from previous pipeline steps -->
+    <xml name="input_stacks_macro">
+        <param name="input_stacks" format="tabular,txt" type="data_collection" collection_type="list" label="Loci and polymorphism" help="output from previous Stacks pipeline steps e.g. denovo_map, refmap or ustacks" />
+    </xml>
+    <xml name="input_cat_macro">
+        <param name="input_cat" format="tabular,txt" type="data_collection" collection_type="list" label="Catalog of loci" help="output from a previous Stacks pipeline steps e.g. denovo_map, refmap or cstacks" />
+    </xml>
+    <xml name="input_matches_macro">
+        <param name="input_matches" format="tabular,txt" type="data_collection" collection_type="list" label="Matches to the catalog" help="output from previous Stacks pipeline steps e.g. denovo_map, refmap or sstacks" />
+    </xml>
+    <xml name="bam_input_macro">
+        <param name="input_bam" format="bam" type="data" multiple="true" optional="false" label="Aligned data" help="either the matches to the catalog (bam), i.e. tsv2bam, or reads aligned to a reference" />
+    </xml>
+    <xml name="input_aln_macro">
+        <param name="input_aln" format="vcf,fasta.gz" type="data_collection" collection_type="list" label="Assembled contigs and variant sites" help="output from previous Stacks pipeline steps (e.g. gstacks, denovo_map, or refmap)" argument="-P" />
+    </xml>
+
+    <!-- code for creating links to the data sets from previous pipeline steps
+         - stacks (i.e ustacks outputs POP.tags.tsv, POP.alleles.tsv, POP.snps.tsv)
+             also stores sample names in list (samples)
+         - cat (cstacks catalog.tags.tsv, catalog.alleles.tsv, catalog.snps.tsv)
+         - matches (sstacks POP.matches.tsv) -->
+    <token name="@LINK_STACKS_INPUT@"><![CDATA[
+    #set $samples = []
+    #for $input_file in $input_stacks
+        #set $filename = str($input_file.element_identifier)
+        #if not filename.endswith('.tsv')
+            #set $filename = $filename + ".tsv"
+        #end if
+        #if re.search('^(?!catalog).+\.(tags|alleles|snps)\.tsv$', $filename)
+            ln -s '${input_file}' 'stacks_inputs/$filename' &&
+            #if $filename.endswith('.tags.tsv')
+                $samples.append($filename[:-9])
+            #end if
+        #end if
+    #end for
+    ]]>
+    </token>
+    <token name="@LINK_CAT_INPUT@"><![CDATA[
+    #for $input_file in $input_cat
+        #set $filename = str($input_file.element_identifier)
+        #if not filename.endswith('.tsv')
+            #set $filename = $filename + ".tsv"
+        #end if
+        #if re.search('^catalog\.(tags|alleles|snps)\.tsv$', $filename)
+            ln -s '${input_file}' 'stacks_inputs/$filename' &&
+        #end if
+    #end for
+    ]]></token>
+    <token name="@LINK_MATCHES_INPUT@"><![CDATA[
+    #for $input_file in $input_matches
+        #set $filename = str($input_file.element_identifier)
+        #if not filename.endswith('.tsv')
+            #set $filename = $filename + ".tsv"
+        #end if
+        #if re.search('matches.tsv$', $filename)
+            ln -s '${input_file}' 'stacks_inputs/$filename' &&
+        #end if
+    #end for
+    ]]></token>
+
+    <!-- fastq input for process_radtags/shortreads (non-batch) and clone/kmerfilter (batch)
+         for batch processing chose multiple=false and paired
+         otherwise multiple=true and listtype=list:paired -->
+    <xml name="fastq_input_bc" token_multiple="false" token_listtype="paired">
+        <conditional name="input_type">
+            <param name="input_type_select" type="select" label="Single-end or paired-end reads">
+                <option value="single" selected="True">Single-end files</option>
+                <option value="paired">Paired-end files</option>
+            </param>
+            <when value="single">
+                <param name="fqinputs" argument="-f" type="data" format="fastqsanger,fastqsanger.gz" multiple="@MULTIPLE@" label="Singles-end reads" />
+                <param name="barcode_encoding" type="select" label="Barcode location">
+                    <expand macro="barcode_encoding_single" type="Barcode" />
+                </param>
+            </when>
+            <when value="paired">
+                <param name="fqinputs" type="data_collection" collection_type="@LISTTYPE@" label="Paired-end reads" format="fastqsanger,fastqsanger.gz"/>
+                <param name="barcode_encoding" type="select" label="Barcode location">
+                    <expand macro="barcode_encoding_pair" type="Barcode" />
+                </param>
+            </when>
+        </conditional>
+        <yield/>
+    </xml>
+
+    <xml name="fastq_input_bc_file" token_multiple="false" token_listtype="paired">
+        <expand macro="fastq_input_bc" multiple="@MULTIPLE@" listtype="@LISTTYPE@">
+            <param name="barcode" argument="-b" type="data" format="tabular,txt" label="Barcode file" />
+        </expand>
+    </xml>
+
+    <!-- fastq input (used in denovomap, tsv2bam, ustacks) 
+         - fastq_optional: makes fastq input optional (true/false) 
+         - se_option: wording for "single end" option (for tsv2bam this is the
+              reverse reads for the others its the forward reads)
+         - help: help text -->
+    <xml name="fastq_input" token_fastq_optional="false" token_se_option="single end or forward reads" token_help="">
+        <conditional name="input_type">
+            <param name="input_type_select" type="select" label="Short read data from individuals" help="@HELP@">
+                <option value="single" selected="true">@SE_OPTION@</option>
+                <option value="paired">(paired) dataset list</option>
+            </param>
+            <when value="single">
+                <param name="fqinputs" argument="-f" format="fastqsanger,fastqsanger.gz,fasta,fasta.gz" type="data" label="Reads" multiple="true" optional="@FASTQ_OPTIONAL@"/>
+            </when>
+            <when value="paired">
+                <param name="fqinputs" argument="-f" type="data_collection" collection_type="list:paired" format="fastqsanger,fastqsanger.gz,fasta,fasta.gz" label="List for forward reads or read pairs" optional="@FASTQ_OPTIONAL@"/>
+            </when>
+        </conditional>
+    </xml>
+
+    <!-- helper functions for linking fastq data sets -->
+    <token name="@FASTQ_INPUT_FUNCTIONS@"><![CDATA[
+    #from os.path import splitext
+    #import re
+
+    #def clean_ext($identifier)
+        #while $identifier.endswith(('.1', '.2', '.fa', '.fq', '.fasta', '.fastq', '.gz', '.gzip', '.sam', '.bam'))
+            #set $identifier = splitext($identifier)[0]
+        #end while
+$identifier#slurp
+    #end def
+
+    #def fastq_input_foo( $sample, $read_direction="", $infix="" )
+        #set $name = $clean_ext($sample.element_identifier)
+        #if $sample.is_collection:
+            #set $cur_sample=$sample[$read_direction]
+        #else:
+            #set $cur_sample=$sample
+        #end if
+
+        #if $cur_sample.is_of_type('fastqsanger')
+            #set $ext =  "fastq"
+            #set $inputype = "fastq"
+        #else if $cur_sample.is_of_type('fastqsanger.gz')
+            #set $ext = "fastq.gz"
+            #set $inputype = "gzfastq"
+        #else if $cur_sample.is_of_type('fasta')
+            #set $ext = "fasta"
+            #set $inputype = "fasta"
+        #else if $cur_sample.is_of_type('fasta.gz')
+            #set $ext = "fasta.gz"
+            #set $inputype = "gzfasta"
+        #else
+            #set $inputype = "UNKNOWN"
+        #end if
+        #set $data_path = "stacks_inputs/"+$name+$infix+"."+$ext
+        #set $link_cmd = "ln -s '%s' '%s' &&" % ($cur_sample, $data_path)
+        #return ($link_cmd, $data_path, $name, $inputype)
+    #end def
+
+    ## fastq_input_batch determine link command, access path(s), and input type
+    ## for batch tools
+    ##
+    ## inputs
+    ## - sample data set / pair
+    ## - type "single" / "paired"
+    ## return (link_command, fwd_path, rev_path, inputype)
+    ## - link_command bash command(s) to link the data sets
+    ## - fwd_path file name of the link to the forward data set
+    ## - rev_path file name of the link to the forward data set (if type=paired)
+    ## - inputype input type as used in stacks ([gz]fast(a|q))
+    #def fastq_input_batch($sample, $type)
+        #if $type == "single"
+            #set ($link_cmd, $path, $name, $inputype) = $fastq_input_foo($sample, "", "")
+            #return ($link_cmd, $path, "", $inputype)
+        #else:
+            #set ($fwd_link_cmd, $fwd_path, $name, $inputype) = $fastq_input_foo($sample, "forward", ".1")
+            #set ($rev_link_cmd, $rev_path, $name, $inputype) = $fastq_input_foo($sample, "reverse", ".2")
+            #return ( $fwd_link_cmd+$rev_link_cmd, $fwd_path, $rev_path, $inputype)
+        #end if
+    #end def
+
+    ## fastq_input_nonbatch determine link command, access path(s), and input type
+    ## for non-batch tools (procrad, shortreads, denovomap the former need R[12]_
+    ## and the latter needs .[12])
+    ##
+    ## inputs
+    ## - samples list of data set / pair
+    ## - type "single" / "paired"
+    ## - infix_pattern pattern for the infix of the files (needs to contain %d which is replaced by 1/2)
+    ## return (link_command, inputype)
+    ## - link_command bash command(s) to link the data sets
+    ## - inputype input type as used in stacks ([gz]fast(a|q))
+    #def fastq_input_nonbatch( $samples, $type, $infix_pattern )
+        #set $link_command = ""
+        #for $sample in $samples
+            #if $type == "single"
+                #set ($lc, $path, $name, $inputype) = $fastq_input_foo($sample, "", "")
+                #set link_command += lc
+            #else:
+                #set ($lc, $path, $name, $inputype) = $fastq_input_foo($sample, "forward", $infix_pattern % (1))
+                #set link_command += lc
+                #set ($lc, $path, $name, $inputype) = $fastq_input_foo($sample, "reverse", $infix_pattern % (2))
+                #set link_command += lc
+            #end if
+        #end for
+        #return ($link_command, $inputype)
+    #end def
+    ]]></token>
+
+    <!-- macro and token for BAM input, for each bam file w identifier NAME
+       - creates a link NAME.bam <- bam_inputs/NAME.INFIX.bam
+       - appends -B bam_inputs/NAME.INFIX.bam to variable bamlist
+
+         INFIX is set to"" per default, can be set with optional variable $infix
+         only needed for gstacks in denovo mode which needs .matches.bam -->
+    <token name="@BAM_INPUT@"><![CDATA[
+    #set $bamlist = ""
+    #for $bam in $input_bam:
+        #if $bam.is_of_type('bam')
+            #set $filename = $clean_ext($bam.element_identifier)+".bam"
+            ln -s '$bam' bam_inputs/$filename &&
+            #set bamlist += " -B 'bam_inputs/"+$filename+"'"
+        #end if
+    #end for
+    ]]></token>
+
+    <token name="@EXTRACT_VCF@"><![CDATA[
+    ## the catalog.calls output is a gzip-ed vcf extract it
+    ## to make it usable in Galaxy (with the downside that we
+    ## need to gzip it again for downstream calls like populations)
+    && gunzip -c stacks_outputs/catalog.calls > stacks_outputs/catalog.calls.vcf
+    ]]></token>
+
+
+
+    <!-- tokens and macros for gapped alignment options
+         the _onoff macro gives an empty conditional (which is not so nice
+         but allows to be used also in the full macro) -->
+    <token name="@GAP_OPTIONS@"><![CDATA[
+    #if $gapped.use_gapped == "yes"
+        --max_gaps $gapped.max_gaps
+        --min_aln_len $gapped.min_aln_len
+    #else
+        --disable-gapped
+    #end if
+    ]]></token>
+    <token name="@GAP_OPTIONS_ONOFF@"><![CDATA[
+    #if $gapped.use_gapped != "yes"
+        --disable-gapped
+    #end if
+    ]]></token>
+    <xml name="gap_options">
+        <expand macro="gap_options_onoff">
+            <param argument="--max_gaps" type="float" value="2.0" label="Number of gaps allowed between stacks before merging"/>
+            <param argument="--min_aln_len" type="float" value="0.8" min="0.0" max="1.0" label="Minimum length of aligned sequence in a gapped alignment"/>
+        </expand>
+    </xml>
+    <xml name="gap_options_onoff">
+        <conditional name="gapped">
+            <param name="use_gapped" argument="--disable-gapped" type="select" label="Perform gapped alignments between stacks">
+                <option value="no">No</option>
+                <option value="yes" selected="true">Yes</option>
+            </param>
+            <when value="no"/>
+            <when value="yes">
+                <yield/>
+            </when>
+        </conditional>
+    </xml>
+
+
+    <!-- ustacks outputs collection containing SAMPLE.tags.tsv, SAMPLE.snps.tsv, SAMPLE.alleles.tsv (SAMPLE!=catalog) -->
+    <!-- TODO tags, snps, and alleles could go to sub collections; same for other tools -->
+    <xml name="ustacks_outputs_macro" token_tooladd="">
+        <collection name="tabs" type="list" label="${tool.name} @TOOLADD@ on ${on_string} Loci and polymorphism">
+            <discover_datasets pattern="(?P&lt;name&gt;(?!catalog).+\.tags)\.tsv$" ext="tabular" directory="stacks_outputs" />
+            <discover_datasets pattern="(?P&lt;name&gt;(?!catalog).+\.snps)\.tsv$" ext="tabular" directory="stacks_outputs" />
+            <discover_datasets pattern="(?P&lt;name&gt;(?!catalog).+\.alleles)\.tsv$" ext="tabular" directory="stacks_outputs" />
+        </collection>
+    </xml>
+    <!-- cstacks outputs collection containing catalog.tags.tsv, catalog.snps.tsv, catalog.alleles.tsv -->
+    <xml name="cstacks_outputs_macro" token_tooladd="">
+        <collection name="catalog" type="list" label="${tool.name} @TOOLADD@ on ${on_string} Catalog of loci">
+            <discover_datasets pattern="(?P&lt;name&gt;catalog\.(tags|snps|alleles))\.tsv$" ext="tabular" directory="stacks_outputs" />
+        </collection>
+    </xml>
+    <!-- sstacks outputs collection containing SAMPLE.matches.tsv -->
+    <xml name="sstacks_outputs_macro" token_tooladd="">
+        <collection name="matches" type="list" label="${tool.name} @TOOLADD@ on ${on_string} Matches to the catalog">
+            <discover_datasets pattern="(?P&lt;name&gt;.+\.matches)\.tsv$" ext="tabular" directory="stacks_outputs" />
+        </collection>
+    </xml>
+    <!-- tsv2bam outputs collection containing SAMPLE.matches.bam -->
+    <xml name="tsv2bam_outputs_macro" token_tooladd="">
+        <collection name="bams" type="list" label="${tool.name} @TOOLADD@ on ${on_string} Matches to the catalog (bam)">
+            <discover_datasets pattern="(?P&lt;name&gt;.+\.matches)\.bam$" ext="bam" directory="stacks_outputs" />
+        </collection>
+    </xml>
+    <!-- gstacks outputs collection containing catalog.calls.vcf and catalog.fa.gz
+         + optional output alignments.bam (if no popmap is given) and POP.alns.bam otherwise-->
+    <xml name="gstacks_outputs_full_macro" token_tooladd="">
+        <expand macro="gstacks_outputs_macro"/>
+        <data format="txt" name="distribs" label="${tool.name} on ${on_string} log.distribs" from_work_dir="stacks_outputs/gstacks.log.distribs">
+            <filter>add_log_distribs</filter>
+        </data>
+        <collection name="gstacks_alns_out" type="list" label="${tool.name} @TOOLADD@ on ${on_string} Read alignments">
+            <discover_datasets pattern="(?P&lt;name&gt;.*).alns.bam$" ext="bam" directory="stacks_outputs" />
+            <filter>mode_cond['mode_select'] == 'denovo' and mode_cond['advanced_cond']['advanced_select'] == "yes" and mode_cond['advanced_cond']['write_alignments'] != "" and popmap!=None</filter>
+        </collection>
+        <data name="gstacks_aln_out" format="bam" label="${tool.name} @TOOLADD@ on ${on_string} Read alignment" from_work_dir="stacks_outputs/alignments.bam">
+            <filter>mode_cond['mode_select'] == 'denovo' and mode_cond['advanced_cond']['advanced_select'] == "yes" and mode_cond['advanced_cond']['write_alignments'] != "" and popmap==None</filter>
+        </data>
+    </xml>
+    <xml name="gstacks_outputs_macro" token_tooladd="">
+        <collection name="gstacks_out" type="list" label="${tool.name} @TOOLADD@ on ${on_string} Assembled contigs and variant sites">
+            <discover_datasets pattern="(?P&lt;name&gt;catalog\.calls\.vcf)$" ext="vcf" directory="stacks_outputs" />
+            <discover_datasets pattern="(?P&lt;name&gt;catalog\.fa\.gz)$" ext="fasta.gz" directory="stacks_outputs" />
+        </collection>
+    </xml>
+
+    <!-- default output of populations -->
+    <xml name="populations_output_light" token_tooladd="">
+        <data format="tabular" name="out_haplotypes" label="${tool.name} @TOOLADD@ on ${on_string} Raw Genotypes/Haplotypes" from_work_dir="stacks_outputs/populations.haplotypes.tsv" />
+        <data format="tabular" name="out_hapstats" label="${tool.name} @TOOLADD@ on ${on_string} Population-level haplotype summary statistics" from_work_dir="stacks_outputs/populations.hapstats.tsv" />
+        <data format="txt" name="out_populations_log_distribs" label="${tool.name} @TOOLADD@ on ${on_string} Populations log distributions" from_work_dir="stacks_outputs/populations.log.distribs" />
+        <data format="tabular" name="out_sumstats_sum" label="${tool.name} @TOOLADD@ on ${on_string} Summary of Population-level summary statistics" from_work_dir="stacks_outputs/populations.sumstats_summary.tsv" />
+        <data format="tabular" name="out_sumstats" label="${tool.name} @TOOLADD@ on ${on_string} Population-level summary statistics" from_work_dir="stacks_outputs/populations.sumstats.tsv" />
+        <data format="tabular" name="out_sql" label="${tool.name} @TOOLADD@ on ${on_string} Genotyping markers" from_work_dir="stacks_outputs/populations.markers.tsv" />
+    </xml>
+
+    <xml name="populations_output_full">
+        <expand macro="populations_output_light"/>
+
+        <!-- log_fst_comp populations.fst_summary.tsv populations.phistats_summary.tsv populations.phistats.tsv-->
+        <data format="tabular" name="out_phistats" label="${tool.name} on ${on_string} Phi_st statistics" from_work_dir="stacks_outputs/populations.phistats.tsv">
+            <filter>advanced_options['log_fst_comp'] and fstats_conditional['fstats']=='yes'</filter>
+        </data>
+        <data format="tabular" name="out_phistats_sum" label="${tool.name} on ${on_string} Summary of Phi_st statistics" from_work_dir="stacks_outputs/populations.phistats_summary.tsv">
+            <filter>advanced_options['log_fst_comp'] and fstats_conditional['fstats']=='yes'</filter>
+        </data>
+        <data format="tabular" name="out_fststats_sum" label="${tool.name} on ${on_string} Summary of Fst statistics" from_work_dir="stacks_outputs/populations.fst_summary.tsv">
+            <filter>advanced_options['log_fst_comp'] and fstats_conditional['fstats']=='yes'</filter>
+        </data>
+
+        <!-- fasta_loci populations.loci.fa
+             fasta_samples populations.samples.fa
+             fasta_samples_raw populations.samples-raw.fa-->
+        <data format="tabular" name="out_fasta_strict" label="${tool.name} on ${on_string} per-locus consensus sequences" from_work_dir="stacks_outputs/populations.loci.fa">
+            <filter>populations_output['fasta_loci']</filter>
+        </data>
+        <data format="tabular" name="out_fasta" label="${tool.name} on ${on_string} per-locus, per-haplotpye sequences" from_work_dir="stacks_outputs/populations.samples.fa">
+            <filter>populations_output['fasta_samples']</filter>
+        </data>
+        <data format="tabular" name="out_fasta_raw" label="${tool.name} on ${on_string} per-locus, per-haplotpye sequences (regardless of biological plausibility)" from_work_dir="stacks_outputs/populations.samples-raw.fa">
+            <filter>populations_output['fasta_samples_raw']</filter>
+        </data>
+
+        <!-- phylip populations.fixed.phylip populations.fixed.phylip.log
+             phylip_var populations.var.phylip populations.var.phylip.log-->
+        <data format="tabular" name="out_phylip_all_pop_fix" label="${tool.name} on ${on_string} Phylip nucleotides that are fixed-within, and variant among populations" from_work_dir="stacks_outputs/populations.fixed.phylip">
+            <filter>populations_output['phylip']</filter>
+        </data>
+        <data format="tabular" name="out_phylip_all_loci_fix" label="${tool.name} on ${on_string} Phylip (loci) nucleotides that are fixed-within, and variant among populations" from_work_dir="stacks_outputs/populations.fixed.phylip.log">
+            <filter>populations_output['phylip']</filter>
+        </data>
+        <data format="tabular" name="out_phylip_all_pop_var" label="${tool.name} on ${on_string} Phylip all sequence as well as variable sites" from_work_dir="stacks_outputs/populations.var.phylip">
+            <filter>populations_output['phylip_var']</filter>
+        </data>
+        <data format="tabular" name="out_phylip_all_loci_var" label="${tool.name} on ${on_string} Phylip (loci) all sequence as well as variable sites" from_work_dir="stacks_outputs/populations.var.phylip.log">
+            <filter>populations_output['phylip_var']</filter>
+        </data>
+
+        <!-- genepop populations.haps.genepop populations.snps.genepop -->
+        <data format="tabular" name="out_genepop_snps" label="${tool.name} on ${on_string} SNPs in GenePop format" from_work_dir="stacks_outputs/populations.snps.genepop">
+            <filter>populations_output['genepop']</filter>
+        </data>
+        <data format="tabular" name="out_genepop_haps" label="${tool.name} on ${on_string} Haplotypes in GenePop format" from_work_dir="stacks_outputs/populations.haps.genepop">
+            <filter>populations_output['genepop']</filter>
+        </data>
+
+        <!-- vcf populations.haps.vcf populations.snps.vcf -->
+        <data format="vcf" name="out_vcf_haplotypes_snps" label="${tool.name} on ${on_string} SNPs in VCF format" from_work_dir="stacks_outputs/populations.snps.vcf">
+            <filter>populations_output['vcf']</filter>
+        </data>
+        <data format="vcf" name="out_vcf_haplotypes_haps" label="${tool.name} on ${on_string} Haplotypes in VCF format" from_work_dir="stacks_outputs/populations.haps.vcf">
+            <filter>populations_output['vcf']</filter>
+        </data>
+
+        <!--plink populations.plink.map populations.plink.ped-->
+        <data format="tabular" name="out_plink_markers" label="${tool.name} on ${on_string} PLINK (makers)" from_work_dir="stacks_outputs/populations.plink.map">
+            <filter>populations_output['plink']</filter>
+        </data>
+        <data format="tabular" name="out_plink_genotypes" label="${tool.name} on ${on_string} PLINK format (genotypes)" from_work_dir="stacks_outputs/populations.plink.ped">
+            <filter>populations_output['plink']</filter>
+        </data>
+
+		<!--structure populations.hzar-->
+        <data format="tabular" name="out_hzar" label="${tool.name} on ${on_string} hzar format" from_work_dir="stacks_outputs/populations.hzar.csv">
+            <filter>populations_output['hzar']</filter>
+        </data>
+        <!--structure populations.structure-->
+        <data format="tabular" name="out_structure" label="${tool.name} on ${on_string} Structure format" from_work_dir="stacks_outputs/populations.structure">
+            <filter>populations_output['structure']</filter>
+        </data>
+
+        <!-- radpainter populations.haps.radpainter -->
+        <data format="tabular" name="out_radpainter" label="${tool.name} on ${on_string} Radpainter format" from_work_dir="stacks_outputs/populations.haps.radpainter">
+            <filter>populations_output['radpainter']</filter>
+        </data>
+
+        <!-- treemix populations.treemix -->
+        <data format="tabular" name="out_treemix" label="${tool.name} on ${on_string} Treemix format" from_work_dir="stacks_outputs/populations.treemix">
+            <filter>populations_output['treemix']</filter>
+        </data>
+    </xml>
+
+    <xml name="snp_options_alpha">
+        <param argument="--alpha" type="select" label="Chi square significance level required to call a heterozygote or homozygote" >
+            <option value="0.1">0.1</option>
+            <option value="0.05" selected="True">0.05</option>
+            <option value="0.01">0.01</option>
+            <option value="0.001">0.001</option>
+        </param>
+    </xml>
+
+    <xml name="snp_options">
+        <conditional name="select_model">
+            <param argument="--model_type" type="select" label="Choose the model">
+                <option value="snp" selected="true">SNP</option>
+                <option value="bounded">Bounded SNP</option>
+                <option value="fixed">Fixed</option>
+            </param>
+            <when value="snp">
+                <expand macro="snp_options_alpha"/>
+            </when>
+            <when value="bounded">
+                <param argument="--bound_low" type="float" value="0.0" min="0.0" max="1.0" label="Lower bound for epsilon, the error rate" help="between 0 and 1.0"/>
+                <param argument="--bound_high" type="float" value="1.0" min="0.0" max="1.0" label="Upper bound for epsilon, the error rate" help="between 0 and 1.0" />
+                <expand macro="snp_options_alpha"/>
+            </when>
+            <when value="fixed">
+                <yield/>
+            </when>
+        </conditional>
+    </xml>
+    <xml name="snp_options_full">
+        <expand macro="snp_options">
+            <param argument="--bc_err_freq" type="float" value="0.1" min="0.0" max="1.0" label="Barcode error frequency" help="between 0 and 1.0"/>
+        </expand>
+    </xml>
+
+	<!-- variant calling option for use in gstacks and denovomap 
+         default for var_alpha is 0.01 if model == marukilow (which is the case in denovomap and refmap)
+         otherwise no default is is available and gstacks will output and error
+         "Error: No value was provided for \-\-var-alpha and there is no default for this model)" 
+	-->
+    <xml name="variant_calling_options_vg" token_varalpha_default="">
+        <param argument="--var-alpha" name="var_alpha" type="float" value="@VARALPHA_DEFAULT@" min="0" label="Alpha threshold for discovering SNPs" help="Default is 0.01 if the marukilow model is used (which is the case in refmap and denovomap), otherwise no default value is available." />
+        <param argument="--gt-alpha" name="gt_alpha" type="float" value="0.05" min="0" label="Alpha threshold for calling genotypes" />
+    </xml>
+
+    <xml name="barcode_encoding_single" token_type="">
+        <option value="--inline_null" selected="True">@TYPE@ is inline with sequence, occurs only on single-end read (--inline_null)</option>
+        <option value="--index_null">@TYPE@ is provded in FASTQ header (Illumina i5 or i7 read) (--index_null)</option>
+        <yield/>
+    </xml>
+
+    <xml name="barcode_encoding_pair" token_type="">
+        <expand macro="barcode_encoding_single" type="@TYPE@">
+            <option value="--null_index">@TYPE@ is provded in FASTQ header (Illumina i7 read if both i5 and i7 read are provided) (--null_index)</option>
+            <option value="--inline_inline">@TYPE@ is inline with sequence, occurs on single and paired-end read (--inline_inline)</option>
+            <option value="--index_index">@TYPE@ is provded in FASTQ header (Illumina i5 and i7 reads) (--index_index)</option>
+            <option value="--inline_index">@TYPE@ is inline with sequence on single-end read and occurs in FASTQ header (from either i5 or i7 read) (--inline_index)</option>
+            <option value="--index_inline">@TYPE@ occurs in FASTQ header (Illumina i5 or i7 read) and is inline with sequence on single-end read (if single read data) or paired-end read (if paired data) (--index_inline)</option>
+        </expand>
+    </xml>
+</macros>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/macros_process.xml	Mon Jul 01 10:57:08 2019 -0400
@@ -0,0 +1,183 @@
+<?xml version="1.0"?>
+
+<!-- macros and tokens for process_radtags and process_short_reads -->
+
+<macros>
+
+    <token name="@PROCESS_IOOPTIONS@"><![CDATA[
+    -p stacks_inputs/
+    #if $input_type.input_type_select == "paired"
+        --paired
+    #end if
+    -i $inputype
+    -b '$barcode'
+    $input_type.barcode_encoding
+    #if str( $outype ) != "auto"
+        -y $outype
+    #end if
+    -o stacks_outputs
+    ]]></token>
+    <xml name="process_output_types">
+        <param name="outype" argument="-y" type="select" label="Output format" >
+            <option value="auto" selected="True">Same as input</option>
+            <option value="fastq">fastq</option>
+            <option value="fasta">fasta</option>
+            <option value="gzfastq">gzipped fastq</option>
+            <option value="gzfasta">gzipped fasta</option>
+        </param>
+    </xml>
+
+    <xml name="discover_faqgz_output_macro" token_pattern="" token_dir="">
+        <expand macro="discover_faq_output_macro" pattern="@PATTERN@" dir="@DIR@"/>
+        <discover_datasets pattern="@PATTERN@\.fq\.gz$" ext="fastqsanger.gz" directory="@DIR@/" />
+        <discover_datasets pattern="@PATTERN@\.fa\.gz$" ext="fasta.gz" directory="@DIR@/" />
+    </xml>
+    <xml name="discover_faq_output_macro" token_pattern="" token_dir="">
+        <discover_datasets pattern="@PATTERN@\.fq$" ext="fastqsanger" directory="@DIR@/" />
+        <discover_datasets pattern="@PATTERN@\.fa$" ext="fasta" directory="@DIR@/" />
+    </xml>
+
+    <xml name="process_outputs">
+        <collection name="demultiplexed" type="list" label="${tool.name} on ${on_string} Demultiplexed reads">
+            <filter>input_type['input_type_select'] == "single"</filter>
+            <expand macro="discover_faqgz_output_macro" pattern="(?P&lt;name&gt;.+)" dir="stacks_outputs"/>
+        </collection>
+        <collection name="demultiplexed_paired" type="list:paired" label="${tool.name} on ${on_string} Demultiplexed reads">
+            <filter>input_type['input_type_select'] == "paired"</filter>
+            <expand macro="discover_faqgz_output_macro" pattern="(?P&lt;identifier_0&gt;.+)\.(?P&lt;identifier_1&gt;[^.]+)" dir="stacks_outputs"/>
+        </collection>
+
+        <collection name="remaining" type="list:paired" label="${tool.name} on ${on_string} Remaining orphan reads">
+            <filter>input_type['input_type_select'] == "paired"</filter>
+            <expand macro="discover_faqgz_output_macro" pattern="(?P&lt;identifier_0&gt;.+)\.rem\.(?P&lt;identifier_1&gt;[^.]+)" dir="stacks_outputs/remaining"/>
+        </collection>
+
+        <!-- note irrespective of -y output is always named fastq and are never zipped -->
+        <collection name="discarded" type="list" label="${tool.name} on ${on_string} Discarded reads">
+            <filter>capture is True and input_type['input_type_select'] == "single"</filter>
+            <expand macro="discover_faq_output_macro" pattern="(?P&lt;name&gt;.*)" dir="stacks_outputs/discarded"/>
+        </collection>
+        <collection name="discarded_paired" type="list:paired" label="${tool.name} on ${on_string} Discarded reads">
+            <filter>capture is True and input_type['input_type_select'] == "paired"</filter>
+            <expand macro="discover_faq_output_macro" pattern="(?P&lt;identifier_0&gt;.+)\.(?P&lt;identifier_1&gt;[^.]+)" dir="stacks_outputs/discarded"/>
+        </collection>
+    </xml>
+
+    <!-- FASTQ filtering options -->
+    <xml name="process_filter">
+        <conditional name="filter_cond" >
+            <param name="filter_select" type="select" label="Do quality filtering">
+                <option value="yes">Yes</option>
+                <option value="no" selected="true">No</option>
+            </param>
+            <when value="yes">
+                <param name="sliding" type="float" value="0.15" min="0" max="1" argument="-w" label="Set the size of the sliding window as a fraction of the read length, between 0 and 1" />
+                <param name="score" type="integer" value="10" min="0" max="40" argument="-s" label="Set the score limit. If the average score within the sliding window drops below this value, the read is discarded" />
+                <param name="remove" type="boolean" checked="false" truevalue="-c" falsevalue="" argument="-c" label="Clean data, remove any read with an uncalled base" />
+                <param name="discard" type="boolean" checked="false" truevalue="-q" falsevalue="" argument="-q" label="Discard reads with low quality scores"/>
+                <param argument="--filter_illumina" type="boolean" checked="false" truevalue="--filter_illumina" falsevalue="" label="Discard reads that have been marked by Illumina's chastity/purity filter as failing" />
+            </when>
+            <when value="no">
+                <param argument="--len_limit" type="integer" value="" optional="true" label="Minimum sequence length" help="useful if your data has already been trimmed"/>
+            </when>
+        </conditional>
+        <param name="capture" type="boolean" checked="false" truevalue="-D" falsevalue="" argument="-D" label="Capture discarded reads to a file" />
+    </xml>
+    <token name="@PROCESS_FILTER@"><![CDATA[
+    #if $filter_cond.filter_select == 'yes':
+        -w $filter_cond.sliding
+        -s $filter_cond.score
+        $filter_cond.remove
+        $filter_cond.discard
+        $filter_cond.filter_illumina
+    #else
+        #if str($filter_cond.len_limit) != "":
+            --len_limit $filter_cond.len_limit
+        #end if
+    #end if
+    $capture
+    ]]></token>
+    <token name="@PROCESS_FASTQ_POSTPROC@"><![CDATA[
+    #if $capture:
+        && mkdir stacks_outputs/discarded/
+        && mv stacks_outputs/*discards stacks_outputs/discarded/
+
+        ## fix the _R[12]_0 that was added for preparing the input
+        #if $input_type.input_type_select == 'paired':
+            && find stacks_outputs/discarded/ -type f | while read file; do mv "\$file" "\$(echo \$file | sed 's/_R1_0/.1/; s/_R2_0/.2/;')"; done
+        #end if
+        ## also remove the gz which is added by procrad (but its uncompressed)
+        && find stacks_outputs/discarded/ -type f -iname "*.gz.discards" | while read file; do mv "\$file" "\$(echo \$file | sed 's/.gz.discards$/.discards/;')"; done
+
+        ## the discard files are named fastq even if the output is fasta
+        #if str($outype).endswith("fasta"):
+            && find stacks_outputs/discarded/ -type f | while read file; do mv "\$file" "\$(echo \$file | sed 's/\.fastq.discards/.fa/;')"; done
+        #else
+            && find stacks_outputs/discarded/ -type f | while read file; do mv "\$file" "\$(echo \$file | sed 's/\.fastq.discards/.fq/;')"; done
+        #end if
+    #end if
+    ## prepare paired read output for processing in galaxy
+    #if $input_type.input_type_select == 'paired':
+        && mkdir stacks_outputs/remaining
+        && find stacks_outputs -iregex ".*\.rem\.[12]\.f[aq]\(\.gz\)?" | while read file; do mv "\$file" stacks_outputs/remaining/; done
+        && find stacks_outputs/ -iregex ".*.f[aq]\(\.gz\)?" | while read file; do mv "\$file" "\$(echo \$file | sed 's/\.1\./.forward./; s/\.2\./.reverse./')"; done
+    #end if
+    ]]></token>
+
+    <!-- adapter trimming options -->
+    <xml name="process_adapter">
+            <param argument="--adapter_1" type="text" value="" optional="true" label="Adaptor sequence that may occur on the first read" />
+            <param argument="--adapter_2" type="text" value="" optional="true" label="Adaptor sequence that may occur on the paired-read" />
+            <param argument="--adapter_mm" type="integer" value="" optional="true" label="Number of mismatches allowed in the adapter sequence"/>
+    </xml>
+    <token name="@PROCESS_ADAPTER@"><![CDATA[
+    ## Adapter options
+    #if str($options_advanced.adapter_1) != "":
+        --adapter_1 $options_advanced.adapter_1
+    #end if
+    #if str($options_advanced.adapter_2) != "":
+        --adapter_2 $options_advanced.adapter_2
+    #end if
+    #if str($options_advanced.adapter_mm) != "":
+        --adapter_mm $options_advanced.adapter_mm
+    #end if
+    ]]></token>
+
+    <!-- barcode rescue options -->
+    <xml name="rescue_barcode">
+        <conditional name="rescue_cond">
+            <param name="rescue" type="select" argument="-r" label="Rescue mutated barcodes and RAD-Tags?">
+                <option value="-r">yes</option>
+                <option value="" selected="true">no</option>
+            </param>
+            <when value="-r">
+                <param argument="--barcode_dist_1" type="integer" value="" optional="true" label="Number of allowed mismatches when rescuing first read barcodes" help="(default 1)"/>
+                <param argument="--barcode_dist_2" type="integer" value="" optional="true" label="Number of allowed mismatches when rescuing paired read barcodes" help="(default value for single end barcodes)"/>
+            </when>
+            <when value=""/>
+        </conditional>
+    </xml>
+    <token name="@RESCUE_BARCODE@"><![CDATA[
+    #if str($options_advanced.rescue_cond.rescue) != ""
+        $options_advanced.rescue_cond.rescue
+        #if str($options_advanced.rescue_cond.barcode_dist_1) != "":
+            --barcode_dist_1 $options_advanced.rescue_cond.barcode_dist_1
+        #end if
+        #if str($options_advanced.rescue_cond.barcode_dist_2) != "":
+            --barcode_dist_2 $options_advanced.rescue_cond.barcode_dist_2
+        #end if
+    #end if
+    ]]></token>
+
+    <!-- advanced options that are shared -->
+    <xml name="common_advanced">
+        <param name="truncate" type="integer" value="" optional="True" argument="-t" label="Truncate final read length to this value" />
+        <param argument="--retain_header" type="boolean" checked="false" truevalue="--retain_header" falsevalue="" label="Retain unmodified FASTQ headers in the output" />
+    </xml>
+    <token name="@COMMON_ADVANCED@"><![CDATA[
+    #if str($options_advanced.truncate)
+        -t $options_advanced.truncate
+    #end if
+    $options_advanced.retain_header
+    ]]></token>
+</macros>
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/stacks_clonefilter.xml	Mon Jul 01 10:57:08 2019 -0400
@@ -0,0 +1,162 @@
+<tool id="stacks2_clonefilter" name="Stacks2: clone filter" profile="@PROFILE@" version="@STACKS_VERSION@+galaxy@WRAPPER_VERSION@">
+<description>Identify PCR clones</description>
+    <macros>
+        <import>macros.xml</import>
+    </macros>
+    <expand macro="requirements"/>
+    <expand macro="version_cmd"/>
+    <command detect_errors="aggressive"><![CDATA[
+@FASTQ_INPUT_FUNCTIONS@
+
+mkdir stacks_inputs stacks_outputs &&
+
+#set ($link_command, $fwd_path, $rev_path, $inputype) = $fastq_input_batch($input_type.fqinputs, $input_type.input_type_select)
+$link_command
+
+clone_filter
+#if $input_type.input_type_select == 'single':
+    -f '$fwd_path'
+#else
+    -1 '$fwd_path'
+    -2 '$rev_path'
+#end if
+
+-i $inputype
+
+-o stacks_outputs
+$capture
+$input_type.barcode_encoding
+#if $oligo_len_1
+    --oligo_len_1 $oligo_len_1
+#end if
+#if $oligo_len_2
+    --oligo_len_2 $oligo_len_2
+#end if
+$retain_oligo
+## only supports fastq.gz output since the
+## the program outputs empty files for fasta/fastq
+-y gzfastq
+@TEE_APPEND_LOG@
+@CAT_LOG_TO_STDERR@
+
+## move outputs such that Galaxy can find them
+#if $capture:
+    #if $input_type.input_type_select == "single"
+        && mv stacks_outputs/*.discards.fq.gz '$discarded'
+    #else
+        && mv stacks_outputs/*.discards.1.fq.gz '$discarded_pair.forward'
+        && mv stacks_outputs/*.discards.2.fq.gz '$discarded_pair.reverse'
+    #end if
+#end if
+#if $input_type.input_type_select == "single"
+    && mv stacks_outputs/*.fq.gz '$clean'
+#else
+    && mv stacks_outputs/*.1.fq.gz '$clean_pair.forward'
+    && mv stacks_outputs/*.2.fq.gz '$clean_pair.reverse'
+#end if
+]]></command>
+    <inputs>
+        <expand macro="fastq_input_bc"/>
+        <param name="capture" type="boolean" checked="false" truevalue="-D" falsevalue="" argument="-D" label="Capture discarded reads to a file" />
+        <param name="oligo_len_1" type="integer" value="0" label="Length of the single-end oligo sequence in dataset"/>
+        <param name="oligo_len_2" optional="true" type="integer" label="Length of the paired-end oligo sequence in dataset"/>
+        <param argument="--retain_oligo" type="boolean" checked="false" truevalue="--retain_oligo" falsevalue="" label="Do not trim off the random oligo sequence (if oligo is inline)" />
+        <expand macro="in_log"/>
+    </inputs>
+    <outputs>
+        <expand macro="out_log"/>
+        <data format="fastqsanger.gz" name="clean" from_work_dir="outputs/R1.fq.gz" label="${tool.name} on ${on_string}">
+            <filter>input_type['input_type_select'] == 'single'</filter>
+        </data>
+        <collection name="clean_pair" type="paired" label="${tool.name} on ${on_string}">
+            <filter>input_type['input_type_select'] == 'paired'</filter>
+        </collection>
+        <data name="discarded" format="fastqsanger" label="${tool.name} on ${on_string}: discarded reads">
+            <filter>capture and input_type['input_type_select'] == 'single' and not options_kmer_char['k_dist']</filter>
+        </data>
+        <collection name="discarded_pair" type="paired" label="${tool.name} on ${on_string}: discarded reads">
+            <filter>capture and input_type['input_type_select'] == 'paired' and not options_kmer_char['k_dist']</filter>
+        </collection>
+    </outputs>
+    <tests>
+        <!-- single end, defaults-->
+        <test>
+            <conditional name="input_type">
+                <param name="input_type_select" value="single" />
+                <param name="fqinputs" ftype="fastqsanger.gz" value="clonefilter/R1_0001.1.fq.gz" />
+            </conditional>
+            <param name="oligo_len_1" value="6" />
+            <param name="add_log" value="yes" />
+			<output name="output_log" ftype="txt" file="clonefilter/clonefilter.log" lines_diff="8"/>
+            <output name="clean" compare="sim_size" file="clonefilter/Removed1_0001.1.1.fq.single.gz"/>
+        </test>
+        <!-- single end, alt BCencoding, capture-->
+        <test>
+            <conditional name="input_type">
+                <param name="input_type_select" value="single" />
+                <param name="fqinputs" ftype="fastqsanger.gz" value="clonefilter/R1_0001.1.fq.gz" />
+                <param name="barcode_encoding" value="--index_null" />
+            </conditional>
+            <param name="capture" value="-D" />
+            <param name="oligo_len_1" value="6" />
+            <assert_command>
+                <has_text text="-D" />
+            </assert_command>
+            <output name="clean" compare="sim_size" file="clonefilter/Removed1_0001.1.1.fq.gz"/>
+            <output name="discarded" compare="sim_size" file="clonefilter/Removed1_0001.1.1.fq.gz"/>
+        </test>
+        <!-- paired end, defaults-->
+        <test>
+            <conditional name="input_type">
+                <param name="input_type_select" value="paired" />
+                <param name="fqinputs">
+                    <collection type="paired">
+                        <element name="forward" value="clonefilter/R1_0001.1.fq.gz" />
+                        <element name="reverse" value="clonefilter/R2_0001.2.fq.gz" />
+                    </collection>
+                </param>
+            </conditional>
+            <param name="oligo_len_1" value="6" />
+            <output_collection name="clean_pair" type="paired">
+                <element name="forward" compare="sim_size" file="clonefilter/Removed1_0001.1.1.fq.gz" />
+                <element name="reverse" compare="sim_size" file="clonefilter/Removed2_0001.2.2.fq.gz" />
+            </output_collection>
+        </test>
+        <!-- paired end, non defaults -->
+        <test>
+            <conditional name="input_type">
+                <param name="input_type_select" value="paired" />
+                <param name="fqinputs">
+                    <collection type="paired">
+                        <element name="forward" value="clonefilter/R1_0001.1.fq.gz" />
+                        <element name="reverse" value="clonefilter/R2_0001.2.fq.gz" />
+                    </collection>
+                </param>
+            </conditional>
+            <param name="oligo_len_1" value="6" />
+            <param name="capture" value="-D" />
+            <param name="retain_oligo" value="--retain_oligo" />
+            <assert_command>
+                <has_text text="--retain_oligo" />
+            </assert_command>
+            <output_collection name="clean_pair" type="paired">
+                <element name="forward" compare="sim_size" file="clonefilter/Removed1_0001.1.1.fq.gz" />
+                <element name="reverse" compare="sim_size" file="clonefilter/Removed2_0001.2.2.fq.gz" />
+            </output_collection>
+            <output_collection name="discarded_pair" type="paired">
+                <element name="forward" compare="sim_size" file="clonefilter/Removed1_0001.1.1.fq.gz" />
+                <element name="reverse" compare="sim_size" file="clonefilter/Removed2_0001.2.2.fq.gz" />
+            </output_collection>
+        </test>
+    </tests>
+    <help>
+<![CDATA[
+.. class:: infomark
+
+The clone_filter program is designed to identify PCR clones.
+
+@STACKS_INFOS@
+]]>
+    </help>
+    <expand macro="citation" />
+</tool>
Binary file test-data/clonefilter/R1_0001.1.fq.gz has changed
Binary file test-data/clonefilter/R2_0001.2.fq.gz has changed
Binary file test-data/clonefilter/Removed1_0001.1.1.fq.gz has changed
Binary file test-data/clonefilter/Removed1_0001.1.1.fq.single.gz has changed
Binary file test-data/clonefilter/Removed2_0001.2.2.fq.gz has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/clonefilter/clonefilter.log	Mon Jul 01 10:57:08 2019 -0400
@@ -0,0 +1,8 @@
+Processing single-end data.
+Searching for inline oligo on single-end read.
+Found 1 input file(s).
+Processing file 1 of 1 [R1_0001.fastq.gz]
+  Reading data from:
+  stacks_inputs/R1_0001.fastq.gz
+Calculating the distribution of cloned read pairs...
+5 pairs of reads input. 4 pairs of reads output, discarded 0 pairs of reads, 20.00% clone reads.
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/cstacks/catalog.alleles.tsv	Mon Jul 01 10:57:08 2019 -0400
@@ -0,0 +1,3 @@
+# cstacks version 2.4; catalog generated on 2019-06-18 10:34:45
+0	1	AC	0	0
+0	1	CA	0	0
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/cstacks/catalog.snps.tsv	Mon Jul 01 10:57:08 2019 -0400
@@ -0,0 +1,3 @@
+# cstacks version 2.4; catalog generated on 2019-06-18 10:34:45
+0	1	33	E	0	A	C	-	-
+0	1	88	E	0	A	C	-	-
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/cstacks/catalog.tags.tsv	Mon Jul 01 10:57:08 2019 -0400
@@ -0,0 +1,4 @@
+# cstacks version 2.4; catalog generated on 2019-06-18 10:34:45
+0	1	consensus	0	1_1,2_1	AATTCGTTTGCTGCTTCAGGAATCTCTCGTATAATCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGAGAGAC	0	0	0
+0	2	consensus	0	1_2,2_2	AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT	0	0	0
+0	3	consensus	0	1_3,2_3	AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTGACTGCCACGCCAGCTACCTCTAGA	0	0	0
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/cstacks/cstacks.log	Mon Jul 01 10:57:08 2019 -0400
@@ -0,0 +1,29 @@
+cstacks parameters selected:
+  Loci matched based on sequence identity.
+  Number of mismatches allowed between stacks: 1
+  Gapped alignments: enabled
+Constructing catalog from 2 samples.
+
+Initializing new catalog...
+  Parsing stacks_inputs/PopA_01.tags.tsv
+  Parsing stacks_inputs/PopA_01.snps.tsv
+  Parsing stacks_inputs/PopA_01.alleles.tsv
+  3 loci were newly added to the catalog.
+
+Processing sample stacks_inputs/PopA_02 [2 of 2]
+  Parsing stacks_inputs/PopA_02.tags.tsv
+  Parsing stacks_inputs/PopA_02.snps.tsv
+  Parsing stacks_inputs/PopA_02.alleles.tsv
+Searching for sequence matches...
+  3 loci in the catalog, 184 kmers in the catalog hash.
+Searching for gapped alignments...
+Merging matches into catalog...
+  3 loci were matched to a catalog locus.
+  0 loci were matched to a catalog locus using gapped alignments.
+  0 loci were newly added to the catalog.
+  0 loci matched more than one catalog locus, linking them.
+    0 linked catalog loci were merged into 0 loci.
+
+Writing catalog in directory 'stacks_inputs/'.
+Final catalog contains 3 loci.
+cstacks is done.
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/demultiplexed/PopA_01.1.fa	Mon Jul 01 10:57:08 2019 -0400
@@ -0,0 +1,320 @@
+>lane1_fakedata0_0 1:N:0:
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAA
+>lane1_fakedata0_1 1:N:0:
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAA
+>lane1_fakedata0_2 1:N:0:
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAA
+>lane1_fakedata0_3 1:N:0:
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAA
+>lane1_fakedata0_4 1:N:0:
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAA
+>lane1_fakedata0_5 1:N:0:
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAA
+>lane1_fakedata0_6 1:N:0:
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAA
+>lane1_fakedata0_7 1:N:0:
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAA
+>lane1_fakedata0_8 1:N:0:
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAA
+>lane1_fakedata0_9 1:N:0:
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAA
+>lane1_fakedata0_10 1:N:0:
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAA
+>lane1_fakedata0_11 1:N:0:
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAA
+>lane1_fakedata0_12 1:N:0:
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAA
+>lane1_fakedata0_13 1:N:0:
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAA
+>lane1_fakedata0_14 1:N:0:
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAA
+>lane1_fakedata0_15 1:N:0:
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAGTCTGGGAA
+>lane1_fakedata0_16 1:N:0:
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAA
+>lane1_fakedata0_17 1:N:0:
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAA
+>lane1_fakedata0_18 1:N:0:
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAA
+>lane1_fakedata0_19 1:N:0:
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAA
+>lane1_fakedata0_20 1:N:0:
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAA
+>lane1_fakedata0_21 1:N:0:
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAA
+>lane1_fakedata0_22 1:N:0:
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAA
+>lane1_fakedata0_23 1:N:0:
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAA
+>lane1_fakedata0_24 1:N:0:
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAA
+>lane1_fakedata0_25 1:N:0:
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAA
+>lane1_fakedata0_26 1:N:0:
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAA
+>lane1_fakedata0_27 1:N:0:
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAA
+>lane1_fakedata2_0 1:N:0:
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTG
+>lane1_fakedata2_1 1:N:0:
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTG
+>lane1_fakedata2_2 1:N:0:
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTG
+>lane1_fakedata2_3 1:N:0:
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTG
+>lane1_fakedata2_4 1:N:0:
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTG
+>lane1_fakedata2_5 1:N:0:
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTAAAACACTCTG
+>lane1_fakedata2_6 1:N:0:
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTG
+>lane1_fakedata2_7 1:N:0:
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTG
+>lane1_fakedata2_8 1:N:0:
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTG
+>lane1_fakedata2_9 1:N:0:
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTG
+>lane1_fakedata2_10 1:N:0:
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTG
+>lane1_fakedata2_11 1:N:0:
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTG
+>lane1_fakedata2_12 1:N:0:
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTG
+>lane1_fakedata2_13 1:N:0:
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTG
+>lane1_fakedata2_14 1:N:0:
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTG
+>lane1_fakedata2_15 1:N:0:
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTG
+>lane1_fakedata2_16 1:N:0:
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTG
+>lane1_fakedata2_17 1:N:0:
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTG
+>lane1_fakedata2_18 1:N:0:
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTG
+>lane1_fakedata2_19 1:N:0:
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTG
+>lane1_fakedata3_0 1:N:0:
+AATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTA
+>lane1_fakedata3_1 1:N:0:
+AATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTA
+>lane1_fakedata3_2 1:N:0:
+AATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTA
+>lane1_fakedata3_3 1:N:0:
+AATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAA
+>lane1_fakedata3_4 1:N:0:
+AATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAA
+>lane1_fakedata3_5 1:N:0:
+AATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAA
+>lane1_fakedata4_0 1:N:0:
+AATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCGACTGAAGTAGCTTGGACGGAT
+>lane1_fakedata4_1 1:N:0:
+AATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGAT
+>lane1_fakedata4_2 1:N:0:
+AATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGAT
+>lane1_fakedata4_3 1:N:0:
+AATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGAT
+>lane1_fakedata4_4 1:N:0:
+AATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGAT
+>lane1_fakedata4_5 1:N:0:
+AATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGAT
+>lane1_fakedata4_6 1:N:0:
+AATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGAT
+>lane1_fakedata4_7 1:N:0:
+AATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGAT
+>lane1_fakedata4_8 1:N:0:
+AATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGAT
+>lane1_fakedata4_9 1:N:0:
+AATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGAT
+>lane1_fakedata4_10 1:N:0:
+AATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGAT
+>lane1_fakedata4_11 1:N:0:
+AATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGAT
+>lane1_fakedata4_12 1:N:0:
+AATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGAT
+>lane1_fakedata4_13 1:N:0:
+AATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGAT
+>lane1_fakedata4_14 1:N:0:
+AATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGAT
+>lane1_fakedata4_15 1:N:0:
+AATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGAT
+>lane1_fakedata4_16 1:N:0:
+AATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGAT
+>lane1_fakedata4_17 1:N:0:
+AATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGAT
+>lane1_fakedata4_18 1:N:0:
+AATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGAT
+>lane1_fakedata4_19 1:N:0:
+AATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGAT
+>lane1_fakedata4_20 1:N:0:
+AATTATCGTCTTGCACAAATCGTCGACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGAT
+>lane1_fakedata4_21 1:N:0:
+AATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGAT
+>lane1_fakedata4_22 1:N:0:
+AATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGAT
+>lane1_fakedata4_23 1:N:0:
+AATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGAT
+>lane1_fakedata4_24 1:N:0:
+AATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGAT
+>lane1_fakedata4_25 1:N:0:
+AATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGAT
+>lane1_fakedata4_26 1:N:0:
+AATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGAT
+>lane1_fakedata4_27 1:N:0:
+AATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGAT
+>lane1_fakedata4_28 1:N:0:
+AATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGAT
+>lane1_fakedata4_29 1:N:0:
+AATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGAT
+>lane1_fakedata4_30 1:N:0:
+AATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTCCCTAGCTACTGAAGTAGCTTGGACGGAT
+>lane1_fakedata4_31 1:N:0:
+AATTATTGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGAT
+>lane1_fakedata4_32 1:N:0:
+AATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGAT
+>lane1_fakedata4_33 1:N:0:
+AATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGAT
+>lane1_fakedata6_0 1:N:0:
+AATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAA
+>lane1_fakedata6_1 1:N:0:
+AATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAA
+>lane1_fakedata6_2 1:N:0:
+AATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAA
+>lane1_fakedata6_3 1:N:0:
+AATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAA
+>lane1_fakedata6_4 1:N:0:
+AATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAA
+>lane1_fakedata6_5 1:N:0:
+AATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAA
+>lane1_fakedata6_6 1:N:0:
+AATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAA
+>lane1_fakedata6_7 1:N:0:
+AATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAA
+>lane1_fakedata6_8 1:N:0:
+AATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAA
+>lane1_fakedata6_9 1:N:0:
+AATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAA
+>lane1_fakedata6_10 1:N:0:
+AATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAA
+>lane1_fakedata6_11 1:N:0:
+AATTGACCGCAGCAACCGCTCGTGGCGTTACTTCTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAA
+>lane1_fakedata6_12 1:N:0:
+AATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAA
+>lane1_fakedata6_13 1:N:0:
+AATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTTGTCCTTAGGTAAAGCTTATATGACTGAGAAA
+>lane1_fakedata6_14 1:N:0:
+AATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAA
+>lane1_fakedata6_15 1:N:0:
+AATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAA
+>lane1_fakedata6_16 1:N:0:
+AATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAA
+>lane1_fakedata6_17 1:N:0:
+AATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAA
+>lane1_fakedata6_18 1:N:0:
+AATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAA
+>lane1_fakedata6_19 1:N:0:
+AATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAA
+>lane1_fakedata6_20 1:N:0:
+AATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAA
+>lane1_fakedata6_21 1:N:0:
+AATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAA
+>lane1_fakedata6_22 1:N:0:
+AATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAA
+>lane1_fakedata6_23 1:N:0:
+AATTGACCCCAGCAACCGCTCGTGGCGTTACTTGTCTTGGTCCTTAGGTAAAGCTTATATGACTGAGAAA
+>lane1_fakedata7_0 1:N:0:
+AATTCGTTTGCTGCTTCAGGAATCTCTCGTATACTCTGAGTATGTGCGTACGTACGCTATTTAGATGGAT
+>lane1_fakedata7_1 1:N:0:
+AATTCGTTTGCTGCTTCAGGAATCTCTCGTATACTCTGAGTATGTGCGTACGTACGCTATTTAGATGGAT
+>lane1_fakedata7_2 1:N:0:
+AATTCGTTTGCTGCTTCAGGAATCTCTCGTATACTCTGAGTATGTGCGTACGTACGCTATTTAGATGGAT
+>lane1_fakedata7_3 1:N:0:
+AATTCGTTTGCTGCTTCAGGAATCTCTCGTATACTCTGAGTATGTGCGTACGTACGCTATTTAGATGGAT
+>lane1_fakedata7_4 1:N:0:
+AATTCGTTTGCTGCTTCAGGAATCTCTCGTATACTCTGAGTATGTGCGTACGTACGCTATTTAGATGGAT
+>lane1_fakedata7_5 1:N:0:
+AATTCGTTTGCTGCTTCAGGAATCTCTCGTATACTCTGAGTATGTGCGTACGTACGCTATTTAGATGGAT
+>lane1_fakedata7_6 1:N:0:
+AATTCGTTTGCTGCTTCAGGAATCTCTCGTATACTCTGAGTATGTGCGTACGTACGCTATTTAGATGGAT
+>lane1_fakedata7_7 1:N:0:
+AATTCGTTTGCTGCTTCAGGAATCTCTCGTATACTCTGAGTATGTGCGTACGTACGCTATTTAGATGGAT
+>lane1_fakedata7_8 1:N:0:
+AATTCGTTTGCTGCTTCAGGAATCTCTCGTATACTCTGAGTATGTGCGTACGTACGCTATTTAGATGGAT
+>lane1_fakedata7_9 1:N:0:
+AATTCGTTTGCTGCTTCAGGAATCTCTCGTATAATCTGAGTATGTGCGTACGTACGCTATTTAGATGGAT
+>lane1_fakedata7_10 1:N:0:
+AATTCGTTTGCTGCTTCAGGAATCTCTCGTATAATCTGAGTATGTGCGTACGTACGCTATTTAGATGGAT
+>lane1_fakedata7_11 1:N:0:
+AATTCGTTTGCTGCTTCAGGAATCTCTCGTATAATCTGAGTATGTGCGTACGTACGCTATTTAGATGGAT
+>lane1_fakedata7_12 1:N:0:
+AATTCGTTTGCTGCTTCAGGAATCTCTCGTATAATCTGAGTATGTGCGTACGTACGCTATTTAGATGGAT
+>lane1_fakedata7_13 1:N:0:
+AATTCGTTTGCTGCTTCAGGAATCTCTCGTATAATCTGAGTATGTGCGTACGTACGCTATTTAGATGGAT
+>lane1_fakedata7_14 1:N:0:
+AATTCGTTTGCTGCTTCAGGAATCTCTCGTATAATCTGAGTATGTGCGTACGTACGCTATTTAGATGGAT
+>lane1_fakedata7_15 1:N:0:
+AATTCGTTTGCTGCTTCAGGAATCTCTCGTATAATCTGAGTATGTGCGTACGTACGCTATTTAGATGGAT
+>lane1_fakedata7_16 1:N:0:
+AATTCGTTTGCTGCTTCAGGAATCTCTCGTATAATCTGAGTATGTGCGTACGTACGCTATTTAGATGGAT
+>lane1_fakedata7_17 1:N:0:
+AATTCGTTTGCTGCTTCAGGAATCTCTCGTATAATCTGAGTATGTGCGTACGTACGCTATTTAGATGGAT
+>lane1_fakedata8_0 1:N:0:
+AATTGTGACACGCAGCCTGGGTGACGTCTCTTCTGATAGGCATTGGCAGATTGACTACGCATAGGCGCTC
+>lane1_fakedata8_1 1:N:0:
+AATTGTGACACGCAGCCTGGGTGACGTCTCTTCTGATAGGCATTGGCAGATTGACTACGCATAGGCGCTC
+>lane1_fakedata8_2 1:N:0:
+AATTGTGACACGCAGCCTGGGTGACGTCTCTTCTGATAGGCATTGGCAGATTGACTACGCATAGGCGCTC
+>lane1_fakedata8_3 1:N:0:
+AATTGTGACACGCAGCCTGGGTGACGTCTCTTCTGATAGGCATTGGCAGATCGACTACGCATAGGCGCTC
+>lane1_fakedata8_4 1:N:0:
+AATTGTGACACGCAGCCTGGGTGACGTCTCTTCTGATAGGCATTGGCAGATTGACTACGCATAGGCGCTC
+>lane1_fakedata8_5 1:N:0:
+AATTGTGACACGCAGCCTGGGTGACGTCACTTCTGATAGGCATTGGCAGATTGACTACGCATAGGCGCTC
+>lane1_fakedata8_6 1:N:0:
+AATTGTGACACGCAGCCTGGGTGACGTCTCTTCTGATAGGCATTGGCAGATTGACTACGCATAGGCGCTC
+>lane1_fakedata8_7 1:N:0:
+AATTGTGACACGCAGCCTGGGTGACGTCTCTTCTGTTAGGCATTGGCAGATTGACTACGCATAGGCGCTC
+>lane1_fakedata8_8 1:N:0:
+AATTGTGACACGCAGCCTGGGTGACGTCTCTTCTGATAGGCATTGGCAGATTGACTACGCATAGGCGCTC
+>lane1_fakedata8_9 1:N:0:
+AATTGTGACACGCAGCCTGGGTGACGTCTCTTCTGATAGGCATTGGCAGATTGACTACGCATAGGCGCTC
+>lane1_fakedata9_0 1:N:0:
+AATTATAACAAAGGTCGACCTGACTCAGCCATTGTTGATAGACGCGAAAATAACGAAGCAGGATGACCGC
+>lane1_fakedata9_1 1:N:0:
+AATTATAACAAAGGTCGACCTGACTCAGCCATTGTTGATAGACGCGAAAATAACGAAGCAGGATGACCGC
+>lane1_fakedata9_2 1:N:0:
+AATTATAACAAAGGTCGACCTGACTCAGCCATTGTTGATAGACGCGAAAATAACGAAGCAGGATGACCGC
+>lane1_fakedata9_3 1:N:0:
+AATTATAACAAAGGTCGACCTGACTCAGCCATTGTTGATAGACGCGAAAATAACGAAGCAGGATGACCGC
+>lane1_fakedata9_4 1:N:0:
+AATTATAACAAAGGTCGACCTGACTCAGCCATTGTTGATAGACGCGAAAATAACGAAGCAGGATGACCGC
+>lane1_fakedata9_5 1:N:0:
+AATTATAACAAAGGTCGACCTGACTCAGCCATTGTTGATAGACGCGAAAATAACGAAGCAGGATGACCGC
+>lane1_fakedata9_6 1:N:0:
+AATTATAACAAAGGTCGACCTGACTCAGCCATTGTTGATAGACGCGAAAATAACGAAGCAGGATGACCGC
+>lane1_fakedata9_7 1:N:0:
+AATTATAACAAAGGTCGACCTGACTCAGCCATTGTTGATAGACGCGAAAATAACGAAGCAGGATGACCGC
+>lane1_fakedata9_8 1:N:0:
+AATTATAACAAAGGTCGACCTGACTCAGCCATTGTTGATAGACGCGAAAATAACGAAGCAGGATGACCGC
+>lane1_fakedata9_9 1:N:0:
+AATTATAACAAAGGTCGACCTGACTCAGCCATTGTTGATAGACGCGAAAATAACGAAGCAGGATGACCGC
+>lane1_fakedata9_10 1:N:0:
+AATTATAACAAAGGTCGACCTGACTCAGCCATTGTTGATAGACGCGAAAATAACGAAGCAGGATGACCGC
+>lane1_fakedata9_11 1:N:0:
+AATTATAACAAAGGTCGACCTGACTCAGCCATTGTTGATAGACGCGAAAATAACGAAGCAGGATGACCGC
+>lane1_fakedata9_12 1:N:0:
+AATTATAACAAAGGTCGACCTGACTCAGCCATTGTTGATAGACGCGAAAATAACGAAGCAGGATGACCGC
+>lane1_fakedata9_13 1:N:0:
+AATTATAACAAAGGTCGACCTGACTCAGCCATTGTTGATAGACGCGAAAATAACGAAGCAGGATGACCGC
+>lane1_fakedata9_14 1:N:0:
+AATTATAACAAAGGTCGACCTGACTCAGCCATTGTTGATAGACGCGAAAATAACGAAGCAGGATGACCGC
+>lane1_fakedata9_15 1:N:0:
+AATTATAACAAAGGTCGACCTGACTCAGCCATTGTTGATAGACGCGAAAATAACGAAGCAGGATGACCGC
+>lane1_fakedata9_16 1:N:0:
+AATTATAACAAAGGTCGACCTGACTCAGCCATTGTTGATAGACGCGAAAATAACGAAGCAGGATGACCGC
+>lane1_fakedata9_17 1:N:0:
+AATTATAACAAAGGTCGACCTGACTCAGCCATTGTTGATAGACGCGAAAATAACGAAGCAGGATGACCGC
+>lane1_fakedata9_18 1:N:0:
+AATTATAACAAAGGTCGACCTGACTCAGCCATTGTTGATAGACGCGAAAATAACGAAGCAGGATGACCGC
+>lane1_fakedata9_19 1:N:0:
+AATTATAACAAAGGTCGACCTGACTCAGCCATTGTTGATAGACGCGAAAATAACGAAGCAGGATGACCGC
Binary file test-data/demultiplexed/PopA_01.1.fa.gz has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/demultiplexed/PopA_01.1.fq	Mon Jul 01 10:57:08 2019 -0400
@@ -0,0 +1,264 @@
+@lane1_fakedata0_0 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_1 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_2 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_3 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_4 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_5 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_6 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_7 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_8 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_9 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_10 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_11 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_12 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_13 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_14 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_15 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAGTCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_16 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_17 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_18 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_19 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_20 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_21 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_22 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_23 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_24 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_25 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_26 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_27 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_0 1:N:0:/1
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTGACTGCCACGCCAGCTACCTCTAGA
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_1 1:N:0:/1
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTGACTGCCACGCCAGCTACCTCTAGA
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_2 1:N:0:/1
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTGACTGCCACGCCAGCTACCTCTAGA
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_3 1:N:0:/1
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTGACTGCCACGCCAGCTACCTCTAGA
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_4 1:N:0:/1
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTGACTGCCACGCCAGCTACCTCTAGA
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_5 1:N:0:/1
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTAAAACACTCTGACTGCCACGCCAGCTACCTCTAGA
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_6 1:N:0:/1
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTGACTGCCACGCCAGCTACCTCTAGA
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_7 1:N:0:/1
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTGACTGCCACGCCAGCTACCTCTAGA
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_8 1:N:0:/1
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTGACTGCCACGCCAGCTACCTCTAGA
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_9 1:N:0:/1
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTGACTGCCACGCCAGCTACCTCTAGA
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_10 1:N:0:/1
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTGACTGCCACGCCAGCTACCTCTAGA
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_11 1:N:0:/1
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTGACTGCCACGCCAGCTACCTCTAGA
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_12 1:N:0:/1
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTGACTGCCACGCCAGCTACCTCTAGA
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_13 1:N:0:/1
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTGACTGCCACGCCAGCTACCTCTAGA
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_14 1:N:0:/1
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTGACTGCCACGCCAGCTACCTCTAGA
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_15 1:N:0:/1
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTGACTGCCACGCCAGCTACCTCTAGA
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_16 1:N:0:/1
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTGACTGCCACGCCAGCTACCTCTAGA
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_17 1:N:0:/1
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTGACTGCCACGCCAGCTACCTCCAGA
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_18 1:N:0:/1
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTGACTGCCACGCCAGCTACCTCTAGA
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_19 1:N:0:/1
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTGACTGCCACGCCAGCTACCTCTAGA
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata7_0 1:N:0:/1
+AATTCGTTTGCTGCTTCAGGAATCTCTCGTATACTCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGAGAGAC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata7_1 1:N:0:/1
+AATTCGTTTGCTGCTTCAGGAATCTCTCGTATACTCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGAGAGAC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata7_2 1:N:0:/1
+AATTCGTTTGCTGCTTCAGGAATCTCTCGTATACTCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGAGAGAC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata7_3 1:N:0:/1
+AATTCGTTTGCTGCTTCAGGAATCTCTCGTATACTCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGAGAGAC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata7_4 1:N:0:/1
+AATTCGTTTGCTGCTTCAGGAATCTCTCGTATACTCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGAGAGAC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata7_5 1:N:0:/1
+AATTCGTTTGCTGCTTCAGGAATCTCTCGTATACTCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGAGAGAC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata7_6 1:N:0:/1
+AATTCGTTTGCTGCTTCAGGAATCTCTCGTATACTCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGAGAGAC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata7_7 1:N:0:/1
+AATTCGTTTGCTGCTTCAGGAATCTCTCGTATACTCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGAGAGAC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata7_8 1:N:0:/1
+AATTCGTTTGCTGCTTCAGGAATCTCTCGTATACTCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGAGAGAC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata7_9 1:N:0:/1
+AATTCGTTTGCTGCTTCAGGAATCTCTCGTATAATCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGCGAGAC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata7_10 1:N:0:/1
+AATTCGTTTGCTGCTTCAGGAATCTCTCGTATAATCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGCGAGAC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata7_11 1:N:0:/1
+AATTCGTTTGCTGCTTCAGGAATCTCTCGTATAATCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGCGAGAC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata7_12 1:N:0:/1
+AATTCGTTTGCTGCTTCAGGAATCTCTCGTATAATCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGCGAGAC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata7_13 1:N:0:/1
+AATTCGTTTGCTGCTTCAGGAATCTCTCGTATAATCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGCGAGAC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata7_14 1:N:0:/1
+AATTCGTTTGCTGCTTCAGGAATCTCTCGTATAATCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGCGAGAC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata7_15 1:N:0:/1
+AATTCGTTTGCTGCTTCAGGAATCTCTCGTATAATCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGCGAGAC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata7_16 1:N:0:/1
+AATTCGTTTGCTGCTTCAGGAATCTCTCGTATAATCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGCGAGAC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata7_17 1:N:0:/1
+AATTCGTTTGCTGCTTCAGGAATCTCTCGTATAATCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGCGAGAC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/demultiplexed/PopA_01.2.fa	Mon Jul 01 10:57:08 2019 -0400
@@ -0,0 +1,320 @@
+>lane1_fakedata0_0 1:N:0:
+CCGTGTATTCTCCCATGCGACAGCAGGACCTCCCATCCCCCTCTGATGTTATCAATCATAAGACGCTTCG
+>lane1_fakedata0_1 1:N:0:
+CCGTGTATTCTCCCATGCGACAGCAGGACCTCCCATCCCCCTCTGATGTTATCAATCATAAGACGCTTCG
+>lane1_fakedata0_2 1:N:0:
+CCGTGTATTCTCCCATGCGACAGCAGGACCTCCCATCCCCCTCTGATGTTATCAATCATAAGACGCTTCG
+>lane1_fakedata0_3 1:N:0:
+CCGTGTATTCTCCCATGCGACAGCAGGACCTCCCATCCCCCTCTGATGTTATCAATCATAAGACGCTTCG
+>lane1_fakedata0_4 1:N:0:
+CCGTGTATTCTCCCATGCGACAGCAGGACCTCCCATCCCCCTCTGATGTTATCAATCATAAGACGCTTCG
+>lane1_fakedata0_5 1:N:0:
+CCGTGTATTCTCCCATGCGACAGCAGGACCTCCCATCCCCCTCTGATGTTATCAATCATAAGACGCTTCG
+>lane1_fakedata0_6 1:N:0:
+CCGTGTATTCTCCCATGCGACAGCAGGACCTCCCATCCCCCTCTGATGTTATCAATCATAAGACGCTTCG
+>lane1_fakedata0_7 1:N:0:
+CCGTGTATTCTCCCATGCGACAGCAGGACCTCCCATCCCCCTCTGATGTTATCAATCATAAGACGCTTCG
+>lane1_fakedata0_8 1:N:0:
+CCGTGTATTCTCCCATGCGACAGCAGGACCTCCCATCCCCCTCTGATGTTATCAATCATAAGACGCTTCG
+>lane1_fakedata0_9 1:N:0:
+CCGTGTATTCTCCCATGCGACAGCAGGACCTCCCATCCCCCTCTGATGTTATCAATCATAAGACGCTTCG
+>lane1_fakedata0_10 1:N:0:
+CCGTGTATTCTCCCATGCGACAGCAGGACCTCCCATCCCCCTCTGATGTTATCAATCATAAGACGCTTCG
+>lane1_fakedata0_11 1:N:0:
+CCGTGTATTCTCCCATGCGACAGCAGGACCTCCCATCCCCCTCTGATGTTATCAATCATAAGACGCTTCG
+>lane1_fakedata0_12 1:N:0:
+CCGTGTATTCTCCCATGCGACAGCAGGACCTCCCATCCCCCTCTGATGTTATCAATCATAAGACGCTTCG
+>lane1_fakedata0_13 1:N:0:
+CCGTGTATTCTCCCATGCGACAGCAGGACCTCCCATCCCCCTCTGATGTTATCAATCATAAGACGCTTCG
+>lane1_fakedata0_14 1:N:0:
+CCGTGTATTCTCCCATGCGACAGCAGGACCTCCCATCCCCCTCTGATGTTATCAATCATAAGACGCTTCG
+>lane1_fakedata0_15 1:N:0:
+CCGTGTATTCTCCCATGCGACAGCAGGACATCCCATCCCCCTCTGATGTTATCAATCATAAGACGCTTCG
+>lane1_fakedata0_16 1:N:0:
+CCGTGTATTCTCCCATGCGACAGCAGGACCTCCCATCCCCCTCTGATGTTATCAATCATAAGACGCTTCG
+>lane1_fakedata0_17 1:N:0:
+CCGTGTATTCTCCCATGCGACAGCAGGACCTCCCATCCCCCTCTGATGTTATCAATCATAAGACGCTTCG
+>lane1_fakedata0_18 1:N:0:
+CCGTGTATTCTCCCATGCGACAGCAGGACCTCCCATCCCCCTCTGATGTTATCAATTATAAGACGCTTCG
+>lane1_fakedata0_19 1:N:0:
+CCGTGTATTCTCCCATGCGACAGCAGGACCTCCCATCCCCCTCTGATGTTATCAATCATAAGACGCTTCG
+>lane1_fakedata0_20 1:N:0:
+CCGTGTATTCTCCCATGCGACAGCAGGACCTCCCATCCCCCTCTGATGTTATCAATCATAAGACGCTTCG
+>lane1_fakedata0_21 1:N:0:
+CCGTGTATTCTCCCATGCGACAGCAGGACCTCCCATCCCCCTCTGATGTTATCAATCATAAGACGCTTCG
+>lane1_fakedata0_22 1:N:0:
+CCGTGTATTCTCCCATGCGACAGCAGGACCTCCCATCCCCCTCTGATGTTATCAATCATAAGACGCTTCG
+>lane1_fakedata0_23 1:N:0:
+CCGTGTATTCTCCCATGCGACAGCAGGACCTCCCATCCCCCTCTGATGTTATCAATCATAAGACGCTTCG
+>lane1_fakedata0_24 1:N:0:
+CCGTGTATTCTCCCATGCGACAGCAGGACCTCCCATCCCCCTCTGATGTTATCAATCATAAGACGCTTCG
+>lane1_fakedata0_25 1:N:0:
+CCGTGTATTCTCCCATGCGACAGCAGGACCTCCCATCCCCCTCTGATGTTATCAATCATAAGACGCTTCG
+>lane1_fakedata0_26 1:N:0:
+CCGTGTATTCTCCCATGCGACAGCAGGACCTCCCATCCCCCTCTGATGTTATCAATCATAAGACGCTTCG
+>lane1_fakedata0_27 1:N:0:
+CCGTGTATTCTCCCATGCGACAGCAGGACCTCCCATCCCCCTCTGATGTTATCAATCATAAGACGCTTCG
+>lane1_fakedata2_0 1:N:0:
+CCGGTTCACTAAACTCACTCAACGGTTGGCGATATTGGCCGTGAACTCAGGAATGCTATGTAATCCAGTC
+>lane1_fakedata2_1 1:N:0:
+CCGGTTCACTAAACTCACTCAACGGTTGGCGATATTGGCCGTGAACTCAGGAATGCTATGTAATCCAGTC
+>lane1_fakedata2_2 1:N:0:
+CCGGTTCACTAAACTCACTCAACGGTTGGCGATATTGGCCGTGAACTCAGGAATGCTATGTAATCCAGTC
+>lane1_fakedata2_3 1:N:0:
+CCGGTTCACTAAACTCACTCAACGGTTGGCGATATTGGCCGTGAACTCAGGAATGCTATGTAATCCAGTC
+>lane1_fakedata2_4 1:N:0:
+CCGGTTCACTAAACTCACTCAACGGTTGGCGATATTGGCCGTGAACTCAGGAATGCTATGTAATCCAGTC
+>lane1_fakedata2_5 1:N:0:
+CCGGTTCACTAAACTCACTCAACGGTTGGCGATATTGGCCGTGAACTCAGGAATGCTATGTAATCCAGTC
+>lane1_fakedata2_6 1:N:0:
+CCGGTTCACTAAACTCACTCAACGGTTGGCGATATTGGCCGTGAACTCAGGAATGCTATGTAATCCAGTC
+>lane1_fakedata2_7 1:N:0:
+CCGGTTCACTAAACTCACTCAACGGTTGGCGATATTGGCCGTGAACTCAGGAATGCTATGTAATCCAGTC
+>lane1_fakedata2_8 1:N:0:
+CCGGTTCACTAAACTCACTCAACGGTTGGCGATATTGGCCGTGAACTCAGGAATGCTATGTAATCCAGTC
+>lane1_fakedata2_9 1:N:0:
+CCGGTTCACTAAACTCACTCAACGGTTGGCGATATTGGCCGTGAACTCAGGAATGCTATGTAATCCAGTC
+>lane1_fakedata2_10 1:N:0:
+CCGGTTCACTAAACTCACTCAACGGTTGGCGATATTGGCCGTGAACTAAGGAATGCTATATAATCCAGTC
+>lane1_fakedata2_11 1:N:0:
+CCGGTTCACTAAACTCACTCAACGGTTGGCGATATTGGCCGTGAACTAAGGAATGCTATATAATCCAGTC
+>lane1_fakedata2_12 1:N:0:
+CCGGTTCACTAAACTCACTCAACGGTTGGCGATATTGGCCGTGAACTAAGGAATGCTATATAATCCAGTC
+>lane1_fakedata2_13 1:N:0:
+CCGGTTCACTAAACTCACTCAACGGTTGGCGATATTGGCCGTGAACTAAGGAATGCTATATAATCCAGTC
+>lane1_fakedata2_14 1:N:0:
+CCGGTTCACTAAACTCACTCAACGGTTGGCGATATTGGCCGTGAACTAAGGAATGCTATATAATCCAGTC
+>lane1_fakedata2_15 1:N:0:
+CCGGTTCACTAAACTCACTCAACGGTTGGCGATATTGGCCGTGAACTAAGGAATGCTATATAATCCAGTC
+>lane1_fakedata2_16 1:N:0:
+CCGGTTCACTAAACTCACTCAACGGTTGGCGATATTGGCCGTGAACTAAGGAATGCTATATAATCCAGTC
+>lane1_fakedata2_17 1:N:0:
+CCGGTTCACTAAACTCACTCAACGGTTGGCGATATTGGCCGTGAACTAAGGAATGCTATATAATCCAGTC
+>lane1_fakedata2_18 1:N:0:
+CCGGTTCACTAAACTCACTCAACGGTTGGCGATATTGGCCGTGAACTAAGGAATGCTATATAATCCAGTC
+>lane1_fakedata2_19 1:N:0:
+CCGGTTCACTAAACTCACTCAACGGTTGGCGATATTGGCCGTGAACTAAGGAATGCTATATAATCCAGTC
+>lane1_fakedata3_0 1:N:0:
+CCGCGTGGGGGGCTCCACGCCCTTGCACGGTAGCCATCACTTCCTTCCAAACCATGCAGTAGCACATCTT
+>lane1_fakedata3_1 1:N:0:
+CCGCGTGGGGGGCTCCACGCCCTTGCACGGTAGCCATCACTTCCTTCCAAACCATGCAGTAGCACATCTT
+>lane1_fakedata3_2 1:N:0:
+CCGCGTGGGGGGCTCCACGCCCTTGCACGGTAGCCATCACTTCCTTCCAAACCATGCAGTAGCACATCTT
+>lane1_fakedata3_3 1:N:0:
+CCGCGTGGGGGGCTCCACGCCCTGCACGGTAGACTATCGCTTCCCGTTCCGAAACCATGCAGTAGCCGCA
+>lane1_fakedata3_4 1:N:0:
+CCGCGTGGGGGGCTCCACGCCCTGCACGGTAGACTATCGCTTCCCGTTCCGAAACTATGCAGTAGCCGCA
+>lane1_fakedata3_5 1:N:0:
+CCGCGTGGGGGGCTCCACGCCCTGCACGGTAGACTATCGCTTCCCGTTCCGAAACCATGCAGTAGCCGCA
+>lane1_fakedata4_0 1:N:0:
+CCGACATTCCTTGTGAAGTTAGAATAACTTGCTAAAGCGTCTTGGCCTCTACTTTGAACTCGTAGGCACC
+>lane1_fakedata4_1 1:N:0:
+CCGACATTCCTTGTGAAGTTAGAATAACTTGCTAAAGCGTCTTGGCCTCTACTTTGAACTCGTAGGCACC
+>lane1_fakedata4_2 1:N:0:
+CCGACATTCCTTGTGAAGTTAGAATAACTTGCTAAAGCGTCTTGGCCTCTACTTTGAACTCGTAGGCACC
+>lane1_fakedata4_3 1:N:0:
+CCGACATTCCTTGTGAAGTTAGAATAACTTGCTAAAGCGTCTTGGCCTCTACTTTGAACTCGTAGGCACC
+>lane1_fakedata4_4 1:N:0:
+CCGACATTCCTTGTGAAGTTAGAATAACTTGCTAAAGCGTCTTGGCCTCTACTTTGAACTCGTAGGCACC
+>lane1_fakedata4_5 1:N:0:
+CCGACATTCCTTGTGAAGTTAGAATAACTTGCTAAAGCGTCTTGGCCTCTACTTTGAACTCGTAGGCACC
+>lane1_fakedata4_6 1:N:0:
+CCGACATTCCTTGTGAAGTTAGAATAACTTGCTAAAGCGTCTTGGCCTCTACTTTGAACTCGTAGGCACC
+>lane1_fakedata4_7 1:N:0:
+CCGACATTCCTTGTGAAGTTAGAATAACTTGCTAAAGCGTCTTGGCCTCTACTTTGAACTCGTAGGCACC
+>lane1_fakedata4_8 1:N:0:
+CCGACATTCCTTGTGAAGTTAGAATAACTTGCTAAAGCGTCTTGGCCTCTACTTTGAACTCGTAGGCACC
+>lane1_fakedata4_9 1:N:0:
+CCGACATTCCTTGTGAAGTTAGAATAACTTGCTAAAGCGTCTTGGCCTCTACTTTGAACTCGTAGGCACC
+>lane1_fakedata4_10 1:N:0:
+CCGACATTCCTTGTGAAGTTAGAATAACTTGCTAAAGCGTCTTGGCCTCTACTTTGAACTCGTAGGCACC
+>lane1_fakedata4_11 1:N:0:
+CCGACATTCCTTGTGAAGTTAGAATAACTTGCTAAAGCGTCTTGGCCTCTACTTTGAACTCGTAGGCACC
+>lane1_fakedata4_12 1:N:0:
+CCGACATTCCTTGTGAAGTTAGAATAACTTGCTAAAGCGTCTTGGCCTCTACTTTGAACTCGTAGGCACC
+>lane1_fakedata4_13 1:N:0:
+CCGACATTCCTTGTGAAGTTAGAATAACTTGCTAAAGCGTCTTGGCCTCTACTTTGAACTCGTAGGCACC
+>lane1_fakedata4_14 1:N:0:
+CCGACATTCCTTGTGAAGTTAGAATAACTTGCTAAAGCGTCTTGGCCTCTACTTTGAACTCGTAGGCACC
+>lane1_fakedata4_15 1:N:0:
+CCGACATTCCTTGTGAAGTTAGAATAACTTGCTAAAGCGTCTTGGCCTCTACTTTGAACTCGTAGGCACC
+>lane1_fakedata4_16 1:N:0:
+CCGACATTCCTTGTGAAGTTAGAATAACTTGCTAAAGCGTCTTGGCCTCTACTTTGAACTCGTAGGCACC
+>lane1_fakedata4_17 1:N:0:
+CCGACATTCCTTGTGAAGTTAAAATGACTTGCTAAAGCGTCTTGGCCTCTACTTTGAACTCGTAGGCACC
+>lane1_fakedata4_18 1:N:0:
+CCGACATTCCTTGTGAAGTTAAAATGACTTGCTAAAGCGTCTTGGCCTCTACTTTGAACTCGTAGGCACC
+>lane1_fakedata4_19 1:N:0:
+CCGACATTCCTTGTGAAGTTAAAATGACTTGCTAAAGCGTCTTGGCCTCTACTTGGAACTCGTAGGCACC
+>lane1_fakedata4_20 1:N:0:
+CCGACATTCCTTGTGAAGTTAAAATGACTTGCTAAAGCGTCTTGGCCTCTACTTTGAACTCGTAGGCACC
+>lane1_fakedata4_21 1:N:0:
+CCGACATTCCTTGTGAAGTTAAAATGACTTGCTAAAGCGTCTTGGCCTCTACTTTGAACTCGTAGGCACC
+>lane1_fakedata4_22 1:N:0:
+CCGACATTCCTTGTGAAGTTAAAATGACTTGCTAAAGCGTCTTGGCCTCTACTTTGAACTCGTAGGCACC
+>lane1_fakedata4_23 1:N:0:
+CCGACATTCCTTGTGAAGTTAAAATGACTTGCTAAAGCGTCTTGGCCTCTACTTTGAACTCGTAGGCACC
+>lane1_fakedata4_24 1:N:0:
+CCGACATTCCTTGTGAAGTTAAAATGACTTGCTAAAGCGTCTTGGCCTCTACTTTGAACTCGTAGGCACC
+>lane1_fakedata4_25 1:N:0:
+CCGACATTCCTTGTGAAGTTAAAATGACTTGCTAAAGCGTCTTGGCCTCTACTTTGACCTCGTAGGCACC
+>lane1_fakedata4_26 1:N:0:
+CCGACATTCCTTGTGAATTTAAAATGACTTGCTAAAGCGTCTTGGCCTCTACTTTGAACTCGTAGGCACC
+>lane1_fakedata4_27 1:N:0:
+CCGACATTCCTTGTGAAGTTAAAATGACTTGCTAAAGCGTCTTGGCCTCTACTTTGAACTCGTAGGCACC
+>lane1_fakedata4_28 1:N:0:
+CCGACATTCCTTGTGAAGTTAAAATGACTTGCTAAAGCGTCTTGGCCTCTACTTTGAACTCGTAGGCACC
+>lane1_fakedata4_29 1:N:0:
+CCGACATTCCTTGTGAAGTTAAAATGACTTGCTAAAGCGTCTTGGCCTCTACTTTGAACTCGTAGGCACC
+>lane1_fakedata4_30 1:N:0:
+CCGACATTCCTTGTGAAGTTAAAATGACTTGCTAAAGCGTCTTGGCCTCTACTTTGAACTCGTAGGCACC
+>lane1_fakedata4_31 1:N:0:
+CCGACATTCCTTGTGAAGTTAAAATGACTTGCTAAAGCGTCTTGGCCTCTACTTTGAACTCGTAGGCACC
+>lane1_fakedata4_32 1:N:0:
+CCGACATTCCTTGTGAAGTTAAAATGACTTGCTAAAGCGTCTTGGCCTCTACTTTGAACTCGTAGGCACC
+>lane1_fakedata4_33 1:N:0:
+CCGACATTCCTTGTGAAGTTAAAATGACTTGCTAAAGCGTCTTGGCCTCTACTTTGAACTCGTAGGCACC
+>lane1_fakedata6_0 1:N:0:
+CCGCGCGCGACGACATCGGGATAGTTTAGATGGGGTCTGGTCATATTTTTGTCATCCACGTTGAAAGTGT
+>lane1_fakedata6_1 1:N:0:
+CCGCGCGCGACGACATCGGGATAGTTTAGATGGGGTCTGGTCATATTTTTGTCATCCACGTTGAAAGTGT
+>lane1_fakedata6_2 1:N:0:
+CCGCGCGCGACGACATCGGGATAGTTTAGATGGGGTCTGGTCATATTTTTGTCATCCACGTTGAAAGTGT
+>lane1_fakedata6_3 1:N:0:
+CCGCGCGCGACGACATCGGGATAGTTTAGATGGGGTCTGGTCATATTTTTGTCATCCACGTTGAAAGTGT
+>lane1_fakedata6_4 1:N:0:
+CCGCGCGCGACGACATCGGGATAGTTTAGATGGGGTCTGGTCATATTTTTGTCATCCACGTTGAAAGTGT
+>lane1_fakedata6_5 1:N:0:
+CCGCGCGCGACGACATCGGGATAGTTTAGATGGGGTCTGGTCATATTTTTGTCATCCACGTTGAAAGTGT
+>lane1_fakedata6_6 1:N:0:
+CCGCGCGCGACGACATCGGGATAGTTTAGATGGGGTCTGGTCATATTTTTGTCATCCACGTTGAAAGTGT
+>lane1_fakedata6_7 1:N:0:
+CCGCGCGCGACGACATCGGGATAGTTTAGATGGGGTCTGGTCATATTTTTGTCATCCACGTTGAAAGTGT
+>lane1_fakedata6_8 1:N:0:
+CCGCGCGCGACGACATCGGGATAGTTTAGATGGGGTCTGGTCATATTTTTGTCATCCACGTTGAAAGTGT
+>lane1_fakedata6_9 1:N:0:
+CCGCGCGCGACGACATCGGGATAGTTTAGATGGGGTCTGGTCATATTTTTGTCATCCACGTTGAAAGTGT
+>lane1_fakedata6_10 1:N:0:
+CCGCGCGCGACGACATCGGGATAGTTTAGATGGGGTCTGGTCATATTTTTGTCATCCACGTTGAAAGTGT
+>lane1_fakedata6_11 1:N:0:
+CCGCGCGCGACGACATCGGGATAGTTTAGATGGGGTCTGGTCATATTTTTGTCATCCACGTTGAAAGTGT
+>lane1_fakedata6_12 1:N:0:
+CCGCGCGCGACGACATCGGGATAGTTTAGATGGGGTCTGGTCATATTTTTGTCATCCACGTTGAAAGTGT
+>lane1_fakedata6_13 1:N:0:
+CCGCGCGCGACGACATCGGGATAGTTTAGATGGGGTCTGGTCATATTTTTGTCATCCACGTTGAAAGTGT
+>lane1_fakedata6_14 1:N:0:
+CCGCGCGCGACGACATCGGGATAGTTTAGATGGGGTCTGGTCATATTTTTGTCATCCACGTTGAAAGTGT
+>lane1_fakedata6_15 1:N:0:
+CCGCGCGCGACGACATCGGGATAGTTTAGATGGGGTCTGGTCATATTTTTGTCATCCACGTTGAAAGTGT
+>lane1_fakedata6_16 1:N:0:
+CCGCGCGCGACGACATCGGGATAGTTTAGATGGGGTCTGGTCATATTTTTGTCATCCACGTTGAAAGTGT
+>lane1_fakedata6_17 1:N:0:
+CCGCGCGCGACGACATCGGGATAGTTTAGATGGGGTCTGGTCATATTTTTGTCATCCACGTTGAAAGTGT
+>lane1_fakedata6_18 1:N:0:
+CCGCGCGCGACGACATCGGGATAGTTTAGATGGGGTCTGGTCATATTTTTGTCATCCACGTTGAAAGTGT
+>lane1_fakedata6_19 1:N:0:
+CCGCGCGCGACGACATCGGGATAGTTTAGATGGGGTCTGGTCATATTTTTGTCATCCACGTTGAAAGTGT
+>lane1_fakedata6_20 1:N:0:
+CCGCGCGCGACGACATCGGGATAGTTTAGATGGGGTCTGGTCATATTTTTGTCATCCACGTTGAAAGTGT
+>lane1_fakedata6_21 1:N:0:
+CCGCGCGCGACGACATCGGGATAGTTTAGATGGGGTCTGGTCATATTTTTGTCATCCACGTTGAAAGTGT
+>lane1_fakedata6_22 1:N:0:
+CCGCGCGCGACGACATCGGGATAGTTTAGATGGGGTCTGGTCATATTTTTGTCATCCACGTTGAAAGTGT
+>lane1_fakedata6_23 1:N:0:
+CCGCGCGCGACGACATCGGGATAGTTTAGATGGGGTCTGGTCATATTTTTGTCATCCACGTTGAAAGTGT
+>lane1_fakedata7_0 1:N:0:
+CCGATCAGCATCAGTAGTTTTCAACGAGCTGGCCCAATGGTGTATAACTATGTGGTAGAGAGAAACTGCT
+>lane1_fakedata7_1 1:N:0:
+CCGATCAGCATCAGTAGTTTTCAACGAGCTGGCCCAATGGTGTATAACTATGTGGTAGAGAGAAACTGCT
+>lane1_fakedata7_2 1:N:0:
+CCGATCAGCATCAGTAGTTTTCAACGAGCTGGCCCAATGGTGTATAACTATGTGGTAGAGAGAAACTGCT
+>lane1_fakedata7_3 1:N:0:
+CCGATCAGCATCAGTAGTTTTCAACGAGCTGGCCCAATGGTGTATAACTATGTGGTAGAGAGAAACTGCT
+>lane1_fakedata7_4 1:N:0:
+CCGATCAGCATCAGTAGTTTTCAACGAGCTGGCCCAATGGTGTATAACTATGTGGTAGAGAGAAACTGCT
+>lane1_fakedata7_5 1:N:0:
+CCGATCAGCATCAGTAGTTTTCAACGAGCTGGCCCAATGGTGTATAACTATGTGGTAGAGAGAAACTGCT
+>lane1_fakedata7_6 1:N:0:
+CCGATCAGCATCAGTAGTTTTCAACGAGCTGGCCCAATGGTGTATAACTATGTGGTAGAGAGAAACTGCT
+>lane1_fakedata7_7 1:N:0:
+CCGATCAGCATCAGTAGTTTTCAACGAGCTGGCCCAATGGTGTATAACTATGTGGTAGAGAGAAACTGCT
+>lane1_fakedata7_8 1:N:0:
+CCGATCAGCATCAGTAGTTTTCAACGAGCTGGCCCAATGGTGTATAACTATGTGGTAGAGAGAAACTGCT
+>lane1_fakedata7_9 1:N:0:
+CCGATCAGCATCAGTAGTTTTCAACGAGCTGGCCCAATGGTGTATAACTATGTGGTAGAGAGAAACTGCT
+>lane1_fakedata7_10 1:N:0:
+CCGATCAGCATCAGTAGTTTTCAACGAGCTGGCCCAATGGTGTATAACTATGTGGTAGAGAGAAACTGCT
+>lane1_fakedata7_11 1:N:0:
+CCGATCAGCATCAGTAGTTTTCAACGAGCTGGCCCAATGGTGTATAACTATGTGGTAGAGAGAAACTGCT
+>lane1_fakedata7_12 1:N:0:
+CCGATCAGCATCAATAGTTTTCAACGAGCTGGCCCAATGGTGTATAACTATGTGGTAGAGAGAAACTGCT
+>lane1_fakedata7_13 1:N:0:
+CCGATCAGCATCAGTAGTTTTCAACGAGCTGGCCCAATGGTGTATAACTATGTGGTAGAGAGAAACTGCT
+>lane1_fakedata7_14 1:N:0:
+CCGATCAGCATCAGTAGTTTTCAACGAGCTGGCCCAATGGTGTATAACTATGTGGTAGAGAGAAACTGCT
+>lane1_fakedata7_15 1:N:0:
+CCGATCAGCATCAGTAGTTTTCAACGAGCTGGCCCAATGGTGTATAACTATGTGGTAGAGAGAAACTGCT
+>lane1_fakedata7_16 1:N:0:
+CCGATCAGCATCAGTAGTTTTCAACGAGCTGGCCCAATGGTGTATAACTATGTGGTAGAGAGAAACTGCT
+>lane1_fakedata7_17 1:N:0:
+CCGATCAGCATCAGTAGTTTTCAACGAGCTGGCCCAATGGTGTATAACTATGTGGTAGAGAGAAACTGCT
+>lane1_fakedata8_0 1:N:0:
+CCGGTGGTATCGGATATGTATATGAATTAACCAAGCGCACCCGGGTTTCTGGCATACCAGTTCCATATAC
+>lane1_fakedata8_1 1:N:0:
+CCGGTGGTATCGGATATGTATATGAATTAACCAAGCGCACCCGGGTTTCTGGCATACCAGTTCCATATAC
+>lane1_fakedata8_2 1:N:0:
+CCGGTGGTATCGGATATGTATATGAATTAACCAAGCGCACCCGGGTTTCTGGCATACCAGTTCCATATAC
+>lane1_fakedata8_3 1:N:0:
+CCGGTGGTATCGGATATGTATATGAATTAACCAAGCGCACCCGGGTTTCTGGCATACCAGTTCCATATAC
+>lane1_fakedata8_4 1:N:0:
+CCGGTGGTATCGGATATGTATATGAATTAACCAAGCGCACCCGGGTTTCTGGCATACCAGTTCCATATAC
+>lane1_fakedata8_5 1:N:0:
+CCGGTGGTATCGGATATGTATAAGAATTAACCAAGCGCACCCGGGTTTCTAGCATACCAGTTCCATATAC
+>lane1_fakedata8_6 1:N:0:
+CCGGTGGTATCGGATATGTATAAGAATTAACCAAGCGCACCCGGGTTTCTAGCATACCAGTTCCATATAC
+>lane1_fakedata8_7 1:N:0:
+CCGGTGGTATCGGATATGTATAAGAATTAACCAAGCGCACCCGGGTTTCTAGCATACCAGTTCCATATAC
+>lane1_fakedata8_8 1:N:0:
+CCGGTGGTATCGGATATGTATAAGAATTAACCAAGCGCACCCGGGTTTCTAGCATACCAGTTCCATATAC
+>lane1_fakedata8_9 1:N:0:
+CCGGTGGTATCGGATATGTATAAGAATTAACCAAGCGCACCCGGGTTTCTAGCATACCAGTTCCATATAC
+>lane1_fakedata9_0 1:N:0:
+CCGCGGTTAAAATTGCTCAGTTCCGTCCAAGCAGGTTCTTTCCTCAACCGATGCGATTGGGTTCGCAACA
+>lane1_fakedata9_1 1:N:0:
+CCGCGGTTAAAATTGCTCAGTTCCGTCCAAGCAGGTTCTTTCCTCAACCGATGCGATTGGGTTCGCAACA
+>lane1_fakedata9_2 1:N:0:
+CCGCGGTTAAAATTGCTCAGTTCCGTCCAAGCAGGTTCTTTCCTCAACCGATGCGATTGGGTTCGCAACA
+>lane1_fakedata9_3 1:N:0:
+CCGCGGTTAAAATTGCTCAGTTCCGTCCAAGCAGGTTCTTTCCTCAACCGATGCGATTGGGTTCGCAACA
+>lane1_fakedata9_4 1:N:0:
+CCGCGGTTAAAATTGCTCAGTTCCGTCCAAGCAGGTTCTTTCCTCAACCGATGCGATTGGGTTCGCAACA
+>lane1_fakedata9_5 1:N:0:
+CCGCGGTTAAAATTGCTCAGTTCCGTCCAAGCAGGTTCTTTCCTCAACCGATGCGATTGGGTTCGCAACA
+>lane1_fakedata9_6 1:N:0:
+CCGCGGTTAAAATTGCTCAGTTCCGTCCAAGCAGGTTCTTTCCTCAACCGATGCGATTGGGTTCGCAACA
+>lane1_fakedata9_7 1:N:0:
+CCGCGGTTAAAATTGCTCAGTTCCGTCCAAGCAGGTTCTTTCCTCAACCGATGCGATTGGGTTCGCAACA
+>lane1_fakedata9_8 1:N:0:
+CCGCGGTTAAAATTGCTCAGTTCCGTCCAAGCAGGTTCTTTCCTCAACCGATGCGATTGGGTTCGCAACA
+>lane1_fakedata9_9 1:N:0:
+CCGCGGTTAAAATTGCTCAGTTCCGTCCAAGCAGGTTCTTTCCTCAACCGATGCGATTGGGTTCGCAACA
+>lane1_fakedata9_10 1:N:0:
+CCGCGGTTAAAATTGCTCAGTTCCGTCCAAGCAGGTTCTTTCCTCAACCGATGCGATTGGGTTCGCAACA
+>lane1_fakedata9_11 1:N:0:
+CCGCGGTTAAAATTGCTCAGTTCCGTCCAAGCAGGTTCTTTCCTCAACCGATGCGATTGGGTTCGCAACA
+>lane1_fakedata9_12 1:N:0:
+CCGCGGTTAAAATTGCTCAGTTCCGTCCAAGCAGGTTCTTTCCTCAACCGATGCGATTGGGTTCGCAACA
+>lane1_fakedata9_13 1:N:0:
+CCGCGGTTAAAATTGCTCAGTTCCGTCCAAGCAGGTTCTTTCCTCAACCGATGCGATTGGGTTCGCAACA
+>lane1_fakedata9_14 1:N:0:
+CCGCGGTTAAAATTGCTCAGTTCCGTCCAAGCAGGTTCTTTCCTCAACCGATGCGATTGGGTTCGCAACA
+>lane1_fakedata9_15 1:N:0:
+CCGCGGTTAAAATTGCTCAGTTCCGTCCAAGCAGGTTCTTTCCTCAACCGATGCGATTGGGTTCGCAACA
+>lane1_fakedata9_16 1:N:0:
+CCGCGGTTAAAATTGCTCAGTTCCGTCCAAGCAGGTTCTTTCCTCAACCGATGCGATTGGGTTCGCAACA
+>lane1_fakedata9_17 1:N:0:
+CCGCGGTTAAAATTGCTCAGTTCCGTCCAAGCAGGTTCTTTCCTCAACCGATGCGATTGGGTTCGCAACA
+>lane1_fakedata9_18 1:N:0:
+CCGCGGTTAAAATTGCTCAGTTCCGTCCAAGCAGGTTCTTTCCTCAACCGATGCGATTGGGTTCGCAACA
+>lane1_fakedata9_19 1:N:0:
+CCGCGGTTAAAATTGCTCAGTTCCGTGCAAGCAGGTTCTTTCCTCAACCGATGCGATTGGGTTCGCAACA
Binary file test-data/demultiplexed/PopA_01.2.fa.gz has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/demultiplexed/PopA_01.2.fq	Mon Jul 01 10:57:08 2019 -0400
@@ -0,0 +1,264 @@
+@lane1_fakedata0_0 1:N:0:/2
+CCGTGTATTCTCCCATGCGACAGCAGGACCTCCCATCCCCCTCTGATGTTATCAATCATAAGACGCTTCGATGGGCCTAGGTCTGTGGATTGCTCGTCGT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_1 1:N:0:/2
+CCGTGTATTCTCCCATGCGACAGCAGGACCTCCCATCCCCCTCTGATGTTATCAATCATAAGACGCTTCGATGGGCCTAGGTCTGTGGATTGCTCGTCGT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_2 1:N:0:/2
+CCGTGTATTCTCCCATGCGACAGCAGGACCTCCCATCCCCCTCTGATGTTATCAATCATAAGACGCTTCGATGGGCCTAGGTCTGTGGATTGCTCGTCGT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_3 1:N:0:/2
+CCGTGTATTCTCCCATGCGACAGCAGGACCTCCCATCCCCCTCTGATGTTATCAATCATAAGACGCTTCGATGGGCCTAGGTCTGTGGATTGCTCGTCGT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_4 1:N:0:/2
+CCGTGTATTCTCCCATGCGACAGCAGGACCTCCCATCCCCCTCTGATGTTATCAATCATAAGACGCTTCGATGGGCCTAGGTCTGTGGATTGCTCGTCGT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_5 1:N:0:/2
+CCGTGTATTCTCCCATGCGACAGCAGGACCTCCCATCCCCCTCTGATGTTATCAATCATAAGACGCTTCGATGGGCCTAGGTCTGTGGATTGCTCGTCGT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_6 1:N:0:/2
+CCGTGTATTCTCCCATGCGACAGCAGGACCTCCCATCCCCCTCTGATGTTATCAATCATAAGACGCTTCGATGGGCCTAGGTCTGTGGATTGCTCGTCGT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_7 1:N:0:/2
+CCGTGTATTCTCCCATGCGACAGCAGGACCTCCCATCCCCCTCTGATGTTATCAATCATAAGACGCTTCGATGGGCCTAGGTCTGTGGATTGCTCGTCGT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_8 1:N:0:/2
+CCGTGTATTCTCCCATGCGACAGCAGGACCTCCCATCCCCCTCTGATGTTATCAATCATAAGACGCTTCGATGGGCCTAGGTCTGTGGATTGCTCGTCGT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_9 1:N:0:/2
+CCGTGTATTCTCCCATGCGACAGCAGGACCTCCCATCCCCCTCTGATGTTATCAATCATAAGACGCTTCGATGGGCCTAGGTCTGTGGATTGCTCGTCGT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_10 1:N:0:/2
+CCGTGTATTCTCCCATGCGACAGCAGGACCTCCCATCCCCCTCTGATGTTATCAATCATAAGACGCTTCGATGGGCCTAGGTCTGTGGATTGCTCGTCGT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_11 1:N:0:/2
+CCGTGTATTCTCCCATGCGACAGCAGGACCTCCCATCCCCCTCTGATGTTATCAATCATAAGACGCTTCGATGGGCCTAGGTCTGTGGATTGCTCGTCGT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_12 1:N:0:/2
+CCGTGTATTCTCCCATGCGACAGCAGGACCTCCCATCCCCCTCTGATGTTATCAATCATAAGACGCTTCGATGGGCCTAGGTCTGTGGATTGCTCGTCGT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_13 1:N:0:/2
+CCGTGTATTCTCCCATGCGACAGCAGGACCTCCCATCCCCCTCTGATGTTATCAATCATAAGACGCTTCGATGGGCCTAGGTCTGTGGATTGCTCGTCGT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_14 1:N:0:/2
+CCGTGTATTCTCCCATGCGACAGCAGGACCTCCCATCCCCCTCTGATGTTATCAATCATAAGACGCTTCGATGGGCCTAGGTCTGTGGATTGCTCGTCGT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_15 1:N:0:/2
+CCGTGTATTCTCCCATGCGACAGCAGGACATCCCATCCCCCTCTGATGTTATCAATCATAAGACGCTTCGATGGGCCTAGGTCTGTGGATTGCTCGTCGT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_16 1:N:0:/2
+CCGTGTATTCTCCCATGCGACAGCAGGACCTCCCATCCCCCTCTGATGTTATCAATCATAAGACGCTTCGATGGGCCTAGGTCTGTGGATTGCTCGTCGT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_17 1:N:0:/2
+CCGTGTATTCTCCCATGCGACAGCAGGACCTCCCATCCCCCTCTGATGTTATCAATCATAAGACGCTTCGATGGGCCTAGGTCTGTGGATTGCTCGTCGT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_18 1:N:0:/2
+CCGTGTATTCTCCCATGCGACAGCAGGACCTCCCATCCCCCTCTGATGTTATCAATTATAAGACGCTTCGATGGGCCTAGGTCTGTGGATTGCTCGTCGT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_19 1:N:0:/2
+CCGTGTATTCTCCCATGCGACAGCAGGACCTCCCATCCCCCTCTGATGTTATCAATCATAAGACGCTTCGATGGGCCTAGGTCTGTGGATTGCTCGTCGT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_20 1:N:0:/2
+CCGTGTATTCTCCCATGCGACAGCAGGACCTCCCATCCCCCTCTGATGTTATCAATCATAAGACGCTTCGATGGGCCTAGGTCTGTGGATTGCTCGTCGT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_21 1:N:0:/2
+CCGTGTATTCTCCCATGCGACAGCAGGACCTCCCATCCCCCTCTGATGTTATCAATCATAAGACGCTTCGATGGGCCTAGGTCTGTGGATTGCTCGTCGT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_22 1:N:0:/2
+CCGTGTATTCTCCCATGCGACAGCAGGACCTCCCATCCCCCTCTGATGTTATCAATCATAAGACGCTTCGATGGGCCTAGGTCTGTGGATTGCTCGTCGT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_23 1:N:0:/2
+CCGTGTATTCTCCCATGCGACAGCAGGACCTCCCATCCCCCTCTGATGTTATCAATCATAAGACGCTTCGATGGGCCTAGGTCTGTGGATTGCTCGTCGT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_24 1:N:0:/2
+CCGTGTATTCTCCCATGCGACAGCAGGACCTCCCATCCCCCTCTGATGTTATCAATCATAAGACGCTTCGATGGGCCTAGGTCTGTGGATTGCTCGTCGT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_25 1:N:0:/2
+CCGTGTATTCTCCCATGCGACAGCAGGACCTCCCATCCCCCTCTGATGTTATCAATCATAAGACGCTTCGATGGGCCTAGGTCTGTGGATTGCTCGTCGT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_26 1:N:0:/2
+CCGTGTATTCTCCCATGCGACAGCAGGACCTCCCATCCCCCTCTGATGTTATCAATCATAAGACGCTTCGATGGGCCTAGGTCTGTGGATTGCTCGTCGT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_27 1:N:0:/2
+CCGTGTATTCTCCCATGCGACAGCAGGACCTCCCATCCCCCTCTGATGTTATCAATCATAAGACGCTTCGATGGGCCTAGGTCTGTGGATTGCTCGTCGT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_0 1:N:0:/2
+CCGGTTCACTAAACTCACTCAACGGTTGGCGATATTGGCCGTGAACTCAGGAATGCTATGTAATCCAGTCAAGGTACCGAGCGAAGGACGTCCAGCAGCC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_1 1:N:0:/2
+CCGGTTCACTAAACTCACTCAACGGTTGGCGATATTGGCCGTGAACTCAGGAATGCTATGTAATCCAGTCAACGTACCGAGCGAAGGACGTCCAGCAGCC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_2 1:N:0:/2
+CCGGTTCACTAAACTCACTCAACGGTTGGCGATATTGGCCGTGAACTCAGGAATGCTATGTAATCCAGTCAAGGTACCGAGCGAAGGACGTCCAGCAGCC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_3 1:N:0:/2
+CCGGTTCACTAAACTCACTCAACGGTTGGCGATATTGGCCGTGAACTCAGGAATGCTATGTAATCCAGTCAAGGTACCGAGCGAAGGACGTCCAGCAGCC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_4 1:N:0:/2
+CCGGTTCACTAAACTCACTCAACGGTTGGCGATATTGGCCGTGAACTCAGGAATGCTATGTAATCCAGTCAAGGTACCGAGCGAAGGACGTCCAGCAGCC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_5 1:N:0:/2
+CCGGTTCACTAAACTCACTCAACGGTTGGCGATATTGGCCGTGAACTCAGGAATGCTATGTAATCCAGTCAAGGTACCGAGCGAAGGACGTCCAGCAGCC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_6 1:N:0:/2
+CCGGTTCACTAAACTCACTCAACGGTTGGCGATATTGGCCGTGAACTCAGGAATGCTATGTAATCCAGTCAAGGTACCGAGCGAAGGACGTCCAGCAGCC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_7 1:N:0:/2
+CCGGTTCACTAAACTCACTCAACGGTTGGCGATATTGGCCGTGAACTCAGGAATGCTATGTAATCCAGTCAAGGTACCGAGCGAAGGACGTCCAGCAGCC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_8 1:N:0:/2
+CCGGTTCACTAAACTCACTCAACGGTTGGCGATATTGGCCGTGAACTCAGGAATGCTATGTAATCCAGTCAAGGTACCGAGCGAAGGACGTCCAGCAGCC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_9 1:N:0:/2
+CCGGTTCACTAAACTCACTCAACGGTTGGCGATATTGGCCGTGAACTCAGGAATGCTATGTAATCCAGTCAAGGTACCGAGCGAAGGACGTCCAGCAGCC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_10 1:N:0:/2
+CCGGTTCACTAAACTCACTCAACGGTTGGCGATATTGGCCGTGAACTAAGGAATGCTATATAATCCAGTCAAGGTACCGAGCGAAGGACGTCCAGCAGCC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_11 1:N:0:/2
+CCGGTTCACTAAACTCACTCAACGGTTGGCGATATTGGCCGTGAACTAAGGAATGCTATATAATCCAGTCAAGGTACCGAGCGAAGGACGTCCAGCAGCC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_12 1:N:0:/2
+CCGGTTCACTAAACTCACTCAACGGTTGGCGATATTGGCCGTGAACTAAGGAATGCTATATAATCCAGTCAAGGTACCGAGCGAAGGACGTCCAGCAGCC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_13 1:N:0:/2
+CCGGTTCACTAAACTCACTCAACGGTTGGCGATATTGGCCGTGAACTAAGGAATGCTATATAATCCAGTCAAGGTACCGAGCGAAGGACGTCCAGCAGCC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_14 1:N:0:/2
+CCGGTTCACTAAACTCACTCAACGGTTGGCGATATTGGCCGTGAACTAAGGAATGCTATATAATCCAGTCAAGGTACCGAGCGAAGGACGTCCAGCAGCC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_15 1:N:0:/2
+CCGGTTCACTAAACTCACTCAACGGTTGGCGATATTGGCCGTGAACTAAGGAATGCTATATAATCCAGTCAAGGTACCGAGCGAAGGACGTCCAGCAGCC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_16 1:N:0:/2
+CCGGTTCACTAAACTCACTCAACGGTTGGCGATATTGGCCGTGAACTAAGGAATGCTATATAATCCAGTCAAGGTACCGAGCGAAGGACGTCCAGCAGCC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_17 1:N:0:/2
+CCGGTTCACTAAACTCACTCAACGGTTGGCGATATTGGCCGTGAACTAAGGAATGCTATATAATCCAGTCAAGGTACCGAGCGAAGGACGTCCAGCAGCC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_18 1:N:0:/2
+CCGGTTCACTAAACTCACTCAACGGTTGGCGATATTGGCCGTGAACTAAGGAATGCTATATAATCCAGTCAAGGTACCGAGCGAAGGACGTCCAGCAGCC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_19 1:N:0:/2
+CCGGTTCACTAAACTCACTCAACGGTTGGCGATATTGGCCGTGAACTAAGGAATGCTATATAATCCAGTCAAGGTACCGAGCGAAGGACGTCCAGCAGCC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata7_0 1:N:0:/2
+CCGATCAGCATCAGTAGTTTTCAACGAGCTGGCCCAATGGTGTATAACTATGTGGTAGAGAGAAACTGCTGCTATCACTCACGATATAAGCCCTCTGACG
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata7_1 1:N:0:/2
+CCGATCAGCATCAGTAGTTTTCAACGAGCTGGCCCAATGGTGTATAACTATGTGGTAGAGAGAAACTGCTGCTATCACTCACGATATAAGCCCTCTGACG
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata7_2 1:N:0:/2
+CCGATCAGCATCAGTAGTTTTCAACGAGCTGGCCCAATGGTGTATAACTATGTGGTAGAGAGAAACTGCTGCTATCACTCACGATATAAGCCCTCTGACG
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata7_3 1:N:0:/2
+CCGATCAGCATCAGTAGTTTTCAACGAGCTGGCCCAATGGTGTATAACTATGTGGTAGAGAGAAACTGCTGCTATCACTCACGATATAAGCCCTCTGACG
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata7_4 1:N:0:/2
+CCGATCAGCATCAGTAGTTTTCAACGAGCTGGCCCAATGGTGTATAACTATGTGGTAGAGAGAAACTGCTGCTATCACTCACGATATAAGCCCTCTGACG
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata7_5 1:N:0:/2
+CCGATCAGCATCAGTAGTTTTCAACGAGCTGGCCCAATGGTGTATAACTATGTGGTAGAGAGAAACTGCTGCTATCACTCACGATATAAGCCCTCTGACG
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata7_6 1:N:0:/2
+CCGATCAGCATCAGTAGTTTTCAACGAGCTGGCCCAATGGTGTATAACTATGTGGTAGAGAGAAACTGCTGCTATCACTCACGATATAAGCCCTCTGACG
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata7_7 1:N:0:/2
+CCGATCAGCATCAGTAGTTTTCAACGAGCTGGCCCAATGGTGTATAACTATGTGGTAGAGAGAAACTGCTGCTATCACTCACGATATAAGCCCTCTGACG
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata7_8 1:N:0:/2
+CCGATCAGCATCAGTAGTTTTCAACGAGCTGGCCCAATGGTGTATAACTATGTGGTAGAGAGAAACTGCTGCTATCACTCACGATATAAGCCCTCTGACG
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata7_9 1:N:0:/2
+CCGATCAGCATCAGTAGTTTTCAACGAGCTGGCCCAATGGTGTATAACTATGTGGTAGAGAGAAACTGCTGCTATCACTCACGATATAAGCCCTCTGACG
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata7_10 1:N:0:/2
+CCGATCAGCATCAGTAGTTTTCAACGAGCTGGCCCAATGGTGTATAACTATGTGGTAGAGAGAAACTGCTGCTATCACTCACGATATAAGCCCTCTGACG
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata7_11 1:N:0:/2
+CCGATCAGCATCAGTAGTTTTCAACGAGCTGGCCCAATGGTGTATAACTATGTGGTAGAGAGAAACTGCTGCTATCACTCACGATATAAGCCCTCTGACG
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata7_12 1:N:0:/2
+CCGATCAGCATCAATAGTTTTCAACGAGCTGGCCCAATGGTGTATAACTATGTGGTAGAGAGAAACTGCTGCTATCACTCACGATATAAGCCCTCTGACG
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata7_13 1:N:0:/2
+CCGATCAGCATCAGTAGTTTTCAACGAGCTGGCCCAATGGTGTATAACTATGTGGTAGAGAGAAACTGCTGCTATCACTCACGATATAAGCCCTCTGACG
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata7_14 1:N:0:/2
+CCGATCAGCATCAGTAGTTTTCAACGAGCTGGCCCAATGGTGTATAACTATGTGGTAGAGAGAAACTGCTGCTATCACTCACGATATAAGCCCTCTGACG
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata7_15 1:N:0:/2
+CCGATCAGCATCAGTAGTTTTCAACGAGCTGGCCCAATGGTGTATAACTATGTGGTAGAGAGAAACTGCTGCTATCACTCACGATATAAGCCCTCTGACG
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata7_16 1:N:0:/2
+CCGATCAGCATCAGTAGTTTTCAACGAGCTGGCCCAATGGTGTATAACTATGTGGTAGAGAGAAACTGCTGCTATCACTCACGATATAAGCCCTCTGACG
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata7_17 1:N:0:/2
+CCGATCAGCATCAGTAGTTTTCAACGAGCTGGCCCAATGGTGTATAACTATGTGGTAGAGAGAAACTGCTGCTATCACTCACGATATAAGCCCTCTGACG
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/demultiplexed/PopA_01.fq	Mon Jul 01 10:57:08 2019 -0400
@@ -0,0 +1,264 @@
+@lane1_fakedata0_0 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_1 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_2 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_3 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_4 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_5 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_6 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_7 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_8 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_9 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_10 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_11 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_12 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_13 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_14 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_15 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAGTCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_16 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_17 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_18 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_19 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_20 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_21 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_22 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_23 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_24 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_25 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_26 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_27 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_0 1:N:0:/1
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTGACTGCCACGCCAGCTACCTCTAGA
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_1 1:N:0:/1
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTGACTGCCACGCCAGCTACCTCTAGA
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_2 1:N:0:/1
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTGACTGCCACGCCAGCTACCTCTAGA
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_3 1:N:0:/1
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTGACTGCCACGCCAGCTACCTCTAGA
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_4 1:N:0:/1
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTGACTGCCACGCCAGCTACCTCTAGA
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_5 1:N:0:/1
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTAAAACACTCTGACTGCCACGCCAGCTACCTCTAGA
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_6 1:N:0:/1
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTGACTGCCACGCCAGCTACCTCTAGA
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_7 1:N:0:/1
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTGACTGCCACGCCAGCTACCTCTAGA
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_8 1:N:0:/1
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTGACTGCCACGCCAGCTACCTCTAGA
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_9 1:N:0:/1
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTGACTGCCACGCCAGCTACCTCTAGA
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_10 1:N:0:/1
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTGACTGCCACGCCAGCTACCTCTAGA
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_11 1:N:0:/1
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTGACTGCCACGCCAGCTACCTCTAGA
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_12 1:N:0:/1
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTGACTGCCACGCCAGCTACCTCTAGA
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_13 1:N:0:/1
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTGACTGCCACGCCAGCTACCTCTAGA
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_14 1:N:0:/1
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTGACTGCCACGCCAGCTACCTCTAGA
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_15 1:N:0:/1
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTGACTGCCACGCCAGCTACCTCTAGA
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_16 1:N:0:/1
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTGACTGCCACGCCAGCTACCTCTAGA
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_17 1:N:0:/1
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTGACTGCCACGCCAGCTACCTCCAGA
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_18 1:N:0:/1
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTGACTGCCACGCCAGCTACCTCTAGA
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_19 1:N:0:/1
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTGACTGCCACGCCAGCTACCTCTAGA
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata7_0 1:N:0:/1
+AATTCGTTTGCTGCTTCAGGAATCTCTCGTATACTCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGAGAGAC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata7_1 1:N:0:/1
+AATTCGTTTGCTGCTTCAGGAATCTCTCGTATACTCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGAGAGAC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata7_2 1:N:0:/1
+AATTCGTTTGCTGCTTCAGGAATCTCTCGTATACTCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGAGAGAC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata7_3 1:N:0:/1
+AATTCGTTTGCTGCTTCAGGAATCTCTCGTATACTCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGAGAGAC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata7_4 1:N:0:/1
+AATTCGTTTGCTGCTTCAGGAATCTCTCGTATACTCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGAGAGAC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata7_5 1:N:0:/1
+AATTCGTTTGCTGCTTCAGGAATCTCTCGTATACTCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGAGAGAC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata7_6 1:N:0:/1
+AATTCGTTTGCTGCTTCAGGAATCTCTCGTATACTCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGAGAGAC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata7_7 1:N:0:/1
+AATTCGTTTGCTGCTTCAGGAATCTCTCGTATACTCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGAGAGAC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata7_8 1:N:0:/1
+AATTCGTTTGCTGCTTCAGGAATCTCTCGTATACTCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGAGAGAC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata7_9 1:N:0:/1
+AATTCGTTTGCTGCTTCAGGAATCTCTCGTATAATCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGCGAGAC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata7_10 1:N:0:/1
+AATTCGTTTGCTGCTTCAGGAATCTCTCGTATAATCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGCGAGAC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata7_11 1:N:0:/1
+AATTCGTTTGCTGCTTCAGGAATCTCTCGTATAATCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGCGAGAC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata7_12 1:N:0:/1
+AATTCGTTTGCTGCTTCAGGAATCTCTCGTATAATCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGCGAGAC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata7_13 1:N:0:/1
+AATTCGTTTGCTGCTTCAGGAATCTCTCGTATAATCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGCGAGAC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata7_14 1:N:0:/1
+AATTCGTTTGCTGCTTCAGGAATCTCTCGTATAATCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGCGAGAC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata7_15 1:N:0:/1
+AATTCGTTTGCTGCTTCAGGAATCTCTCGTATAATCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGCGAGAC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata7_16 1:N:0:/1
+AATTCGTTTGCTGCTTCAGGAATCTCTCGTATAATCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGCGAGAC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata7_17 1:N:0:/1
+AATTCGTTTGCTGCTTCAGGAATCTCTCGTATAATCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGCGAGAC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
Binary file test-data/demultiplexed/PopA_01.rem.1.fa.gz has changed
Binary file test-data/demultiplexed/PopA_01.rem.2.fa.gz has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/demultiplexed/PopA_02.1.fq	Mon Jul 01 10:57:08 2019 -0400
@@ -0,0 +1,240 @@
+@lane1_fakedata0_0 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_1 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_2 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_3 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_4 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_5 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_6 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_7 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_8 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_9 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_10 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_11 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_12 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_13 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_14 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_15 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_16 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_17 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_18 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_19 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_20 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_21 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_22 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCCCGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_23 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_24 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_25 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_26 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTATCTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_27 1:N:0:/1
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_0 1:N:0:/1
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTGACTGCCACGCCAGCTACCTCTAGA
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_1 1:N:0:/1
+AATTCTCTACACCACTGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTGACTGCCACGCCAGCTACCTCTAGA
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_2 1:N:0:/1
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTGACTGCCACGCCAGCTACCTCTAGA
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_3 1:N:0:/1
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTGACTGCCACGCCAGCTACCTCTAGA
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_4 1:N:0:/1
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTGACTGCCACGCCAGCTACCTCTAGA
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_5 1:N:0:/1
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTGACTGCCACGCCAGCTACCTCTAGA
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_6 1:N:0:/1
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTGACTGCCACGCCAGCTACCTCTAGA
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_7 1:N:0:/1
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTGACTGCCACGCCAGCTACCTCTAGA
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_8 1:N:0:/1
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTGACTGCCACGCCAGCTACCTCTAGA
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_9 1:N:0:/1
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTGACTGCCACGCCAGCTACCTCTAGA
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_10 1:N:0:/1
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTGACTGCCACGCCAGCTACCTCTAGA
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_11 1:N:0:/1
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTGACTGCCACGCCAGCTACCTCTAGA
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_12 1:N:0:/1
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTGACTGCCACGCCAGCTACCTCTAGA
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_13 1:N:0:/1
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTGACTGCCACGCCAGCTACCTCTAGA
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_14 1:N:0:/1
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTGACTGCCACGCCAGCTACCTCTAGA
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_15 1:N:0:/1
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTGACTGCCACGCCAGCTACCTCTAGA
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_16 1:N:0:/1
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTGACTGCCACGCCAGCTACCTCTAGA
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_17 1:N:0:/1
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTGACTGCCACGCCAGCTACCTCTAGA
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_18 1:N:0:/1
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTGACTGCCACGCCAGCTACCTCTAGA
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_19 1:N:0:/1
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTGACTGCCACGCCAGCTACCTCTAGA
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata7_0 1:N:0:/1
+AATTCGTTTGCTGCTTCAGGAATCTCTCGTATAATCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGCGAGAC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata7_1 1:N:0:/1
+AATTCGTTTGCTGCTTCAGGAATCTCTCGTATAATCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGCGAGAC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata7_2 1:N:0:/1
+AATTCGTTTGCTGCTTCAGGAATCTCTCGTATAATCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGCGAGAC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata7_3 1:N:0:/1
+AATTCGTTTGCTGCTTCAGGAATCTCTCGTATAATCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGCGAGAC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata7_4 1:N:0:/1
+AATTCGTTTGCTGCTTCAGGAATCTCTCGTATAATCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGCGAGAC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata7_5 1:N:0:/1
+AATTCGTTTGCTGCTTCAGGAATCTCTCGTATAATCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGCGAGAC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata7_6 1:N:0:/1
+AATTCGTTTGCTGCTTCAGGAACCTCTCGTATACTCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGAGAGAC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata7_7 1:N:0:/1
+AATTCGTTTGCTGCTTCAGGAATCTCTCGTATACTCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGAGAGAC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata7_8 1:N:0:/1
+AATTCGTTTGCTGCTTCAGGAATCTCTCGTATACTCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGAGAGAC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata7_9 1:N:0:/1
+AATTCGTTTGCTGCTTCAGGAATCTCTCGTATACTCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGAGAGAC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata7_10 1:N:0:/1
+AATTCGTTTGCTGCTTCAGGAATCTTTCGTATACTCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGAGAGAC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata7_11 1:N:0:/1
+AATTCGTTTGCTGCTTCAGGAATCTCTCGTATACTCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGAGAGAC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/demultiplexed/PopA_02.2.fq	Mon Jul 01 10:57:08 2019 -0400
@@ -0,0 +1,240 @@
+@lane1_fakedata0_0 1:N:0:/2
+CCGTATTCTCCCATGCGACAGTAGGACCTCCGCATCCCCCTTTGATGTTATCAATCATAAGACGCTTCGATGGGCCTAGGTCTGTGGATTGCTCGTCGTA
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_1 1:N:0:/2
+CCGTATTCTCCCATGCGACAGTAGGACCTCCGCATCCCCCTTTGATGTTATCAATCATAAGACGCTTCGATGGGCCTAAGTCTGTGGATTGCTCGTCGTA
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_2 1:N:0:/2
+CCGTATTCTCCCATGCGACAGTAGGACCTCCGCATCCCCCTTTGATGTTATCAATCATAAGACGCTTCGATGGGCCTAGGTCTGTGGATTGCTCGTCGTA
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_3 1:N:0:/2
+CCGTATTCTCCCATGCGACAGTAGGACCTCCGCATCCCCCTTTGATGTTATCAATCATAAGACGCTTCGATGGGCCTAGGTCTGTGGATTGCTCGTCGTA
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_4 1:N:0:/2
+CCGTACTCTCCCATGCGACAGTAGGACCTCCGCATCCCCCTTTGATGTTATCAATCATAAGACGCTTCGATGGGCCTAGGTCTGTGGATTGCTCGTCGTA
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_5 1:N:0:/2
+CCGTATTCTCCCATGCGACAGTAGGACCTCCGCATCCCCCTTTGATGTTATCAATCATAAGACGCTTCGATGGGCCTAGGTCTGTGGATTGCTCGTCGTA
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_6 1:N:0:/2
+CCGTATTCTCCCATGCGACAGTAGGACCTCCGCATCCCCCTTTGATGTTATCAATCATAAGACGCTTCGATGGGCCTAGGTCTGTGGATTGCTCGTCGTA
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_7 1:N:0:/2
+CCGTATTCTCCCATGCGACAGTAGGACCTCCGCATCCCCCTTTGATGTTATCAATCATAAGACGCTTCGATGGGCCTAGGTCTGTGGATTGCTCGTCGTA
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_8 1:N:0:/2
+CCGTATTCTCCCATGCGACAGTAGGACCTCCGCATCCCCCTTTGATGTTATCAATCATAAGACGCTTCGATGGGCCTAGGTCTGTGGATTGCTCGTCGTA
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_9 1:N:0:/2
+CCGTATTCTCCCATGCGACAGTAGGACCTCCGCATCCCCCTTTGATGTTATCAATCATAAGACGCTTCGATGGGCCTAGGTCTGTGGATTGCTCGTCGTA
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_10 1:N:0:/2
+CCGTATTCTCCCATGCGACAGTAGGACCTCCGCATCCCCCTTTGATGTTATCAATCATAAGACGCTTCGATGGGCCTAGGTCTGTGGATTGCTCGTCGTA
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_11 1:N:0:/2
+CCGTATTCTCCCATGCGACAGTAGGACCTCCGCATCCCCCTTTGATGTTATCAATCATAAGACGCTTCGATGGGCCTAGGTCTGTGGATTGCTCGTCGTA
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_12 1:N:0:/2
+CCGTATTCTCCCATGCGACAGTAGGACCTCCGCATCCCCCTTTGATGTTATCAATCATAAGACGCTTCGATGGGCCTAGGTCTGTGGATTGCTCGTCGTA
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_13 1:N:0:/2
+CCGTATTCTGCCATGCGACAGTAGGACCTCCGCATCCCCCTTTGATGTTATCAATCATAAGACGCTTCGATGGGCCTAGGTCTGTGGATTGCTCGTCGTA
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_14 1:N:0:/2
+CCGTGTATTCTCCCATGCGACAGCAGGACCTCCCATCCCCCTCTGATGTTATCAATCATAAGACGCTTCGATGGGCCTAGGTCTGTGGATTGCTCGTCGT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_15 1:N:0:/2
+CCGTGTATTCTCCCATGCGACAGCAGGACCTCCCATCCCCCTCTGATGTTATCAATCATAAGACGCTTCGATGGGCCTAGGTCTGTGGATTGCTCGTCGT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_16 1:N:0:/2
+CCGTGTATTCTCCCATGCGCCAGCAGGACCTCCCATCCCCCTCTGATGTTATCAATCATAAGACGCTTCGATGGGCCTAGGTCTGTGGATTGCTCGTCGT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_17 1:N:0:/2
+CCGTGTATTCTCCCATGCGACAGCAGGACCTCCCATCCCCCTCTGATGTTATCAATCATAAGACGCTTCGATGGGCCTAGGTCTGTGGATTGCTCGTCGT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_18 1:N:0:/2
+CCGTGTATTCTCCCATGCGACAGCAGGACCTCCCATCCCCCTCTGATGTTATCAATCATAAGACGCTTCGATGGGCCTAGGTCTGTGGATTGCTCGTCGT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_19 1:N:0:/2
+CCGTGTATTCTCCCATGCGACAGCAGGACCTCCCATCCCCCTCTGATGTTATCAATCATAAGACGCTTCGATGGGCCTAGGTCTGTGGATTGCTCGTCGT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_20 1:N:0:/2
+CCGTGTATTCTCCCATGCGACAGCAGGACCTCCCATCCCCCTCTGATGTTATCAATCATAAGACGCTTCGATGGGCCTAGGTCTGTGGATTGCTCGTCGT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_21 1:N:0:/2
+CCGTGTATTCTCCCATGCGACAGCAGGACCTCCCATCCCCCTCTGATGTTATCAATCATAAGACGCTTCGATGGGCCTAGGTCTGTGGATTGCTCGTCGT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_22 1:N:0:/2
+CCGTGTATTCTCCCATGCGACAGCAGGACCTCCCATCCCCCTCTGATGTTATCAATCATAAGACGCTTCGATGGGCCTAGGTCTGTGGATTGCTCGTCGT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_23 1:N:0:/2
+CCGTGTATTCTCCCATGCGACAGCAGGACCTCCCATCCCCCTCTGATGTTATCAATCATAAGACGCTTCGATGGGCCTAGGTCTGTGGATTGCTCGTCGT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_24 1:N:0:/2
+CCGTGTATTCTCCCATGCGACAGCAGGACCTCCCATCCCCCTCTGATGTTATCAATCATAAGACGCTTCGATGGGCCTAGGTCTGTGGATTGCTCGTCGT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_25 1:N:0:/2
+CCGTGTATTCTCCCATGCGACAGCAGGACCTCCCATCCCCCTCTGATGTTATCAATCATAAGACGCTTCGATGGGCCTAGGTCTGTGGATTGCTCGTCGT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_26 1:N:0:/2
+CCGTGTATTCTCCCATGCGACAGCAGGACCTCCCATCCCCCTCTGATGTTATCAATCATAAGACGCTTCGATGGGCCTAGGTCTGTGGATTGCTCGTCGT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata0_27 1:N:0:/2
+CCGTGTATTCTCCCATGCGACAGCAGGACCTCCCATCCCCCTCTGATGTTATCAATCATAAGACGCTTCGATGGGCCTAGGTCTGTGGATTGCTCGTCGT
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_0 1:N:0:/2
+CCGGTTCACTAAACTCACTCAACGGTTGGCGATATTGGCCGTGAACTAAGGAATGCTATATAATCCAGTCAAGGTACCGAGCGAAGGACGTCCAGCAGCC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_1 1:N:0:/2
+CCGGTTCACTAAACTCACTCAACGGTTGGCGATATTGGCCGTGAACTAAGGAATGCTATATAATCCAGTCAAGGTACCGAGCGAAGGACGTCCAGCAGCC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_2 1:N:0:/2
+CCGGTTCACTAAACTCACTCAACGGTTGGCGATATTGGCCGTGAACTAAGGAATGCTATATAATCCAGTCAAGGTACCGAGCGAAGGACGTCCAGCAGCC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_3 1:N:0:/2
+CCGGTTCACTAAACTCACTCAACGGTTGGCGATATTGGCCGTGAACTAAGGAATGCTATATAATCCAGTCAAGGTACCGAGCGAAGGACGTCCAGCAGCC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_4 1:N:0:/2
+CCGGTTCACTAAACTCACTCAACGGTTGGCGATATTGGCCGTGAACTAAGGAATGCTATATAATCCAGTCAAGGTACCGAGCGAAGGACGTCCAGCAGCC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_5 1:N:0:/2
+CCGGTTCACTAAACTCACTCAACGGTTGGCGATATTGGCCGTGAACTAAGGAATGCTATTTAATCCAGTCAAGGTACCGAGCGAAGGACGTCCAGCAGCC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_6 1:N:0:/2
+CCGGTTCACTAAACTCACTCAACGGTTGGCGATATTGGCCGTGAACTAAGGAATGCTATATAATCCAGTCAAGGTACCGAGCGAAGGACGTCCAGCAGCC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_7 1:N:0:/2
+CCGGTTCACTAAACTCACTCAACGGTTGGCGATATTGGCCGTGAACTAGGGAATGCTATATAATCCAGTCAAGGTACCGAGCGAAGGACGTCCAGCAGCC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_8 1:N:0:/2
+CCGGTTCACTAAACTCACTCAACGGTTGGCGATATTGGCCGTGAACTAAGGAATGCTATATAATCCAGTCAAGGTACCGAGCGAAGGACGTCCAGCAGCC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_9 1:N:0:/2
+CCGGTTCACTAAACTCACTCAACGGTTGGCGATATTGGCCGTGAACTAAGGAATGCTATATAATCCAGTCAAGGTACCGAGCGAAGGACGTCCAGCAGCC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_10 1:N:0:/2
+CCGGTTCACTAAACTCACTCAACGGTTGGCGATATTGGCCGTGAACTCAGGAATGCTATGTAATCCAGTCAAGGTACCGAGCGAAGGACGTCCAGCAGCC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_11 1:N:0:/2
+CCGGTTCACTAAACTCACTCAACGGTTGGCGATATTGGCCGTGAACTCAGGAATGCTATGTAATCCAGTCAAGGTACCGAGCGAAGGACGTCCAGCAGCC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_12 1:N:0:/2
+CCGGTTCACTAAACTCACTCAACGGTTGGCGATATTGGCCGTGAACTCAGGAATGCTATGTAATCCAGTCAAGGTACCGAGCGAAGGACGTCCAGCAGCC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_13 1:N:0:/2
+CCGGTTCACTAAACTCACTCAACGGTTGGCGATATTGGCCGTGAACTCAGGAATGCTATGTAATCCAGTCAAGGTACCGAGCGAAGGACGTCCAGCAGCC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_14 1:N:0:/2
+CCGGTTCACTAAACTCACTCAACGGTTGGCGATATTGGCCGTGAACTCAGGAATGCTATGTAATCCAGTCAAGGTACCGAGCGAAGGACGTCCAGCAGCC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_15 1:N:0:/2
+CCGGTTCACTAAACTCACTCAACGGTTGGCGATATTGGCCGTGAACTCAGGAATGCTATGTAATCCAGTCAAGGTACCGAGCGAAGGACGTCCAGCAGCC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_16 1:N:0:/2
+CCGGTTCACTAAACTCACTCAACGGTTGGCGATATTGGCCGTGAACTCAGGAATGCTATGTAATCCAGTCAAGGTACCGAGCGAAGGACGTCCAGCAGCC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_17 1:N:0:/2
+CCGGTTCACTAAACTCACTCAACGGTTGGCGATATTGGCCGTGAACTCAGGAATGCTATGTAATCCAGTCAAGGTACCGAGCGAAGGACGTCCAGCAGCC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_18 1:N:0:/2
+CCGGTTCACTAAACTCACTCAACGGTTGGCGATATTGGCCGTGAACTCAGGAATGCTATGTAATCCAGTCAAGGTACCGAGCGAAGGACGTCCAGCAGCC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata2_19 1:N:0:/2
+CCGGTTCACTAAACTCACTCAACGGTTGGCGATATTGGCCGTGAACTCAGGAATGCTATGTAATCCAGTCAAGGTACCGAGCGAAGGACGTCCAGCAGCC
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata7_0 1:N:0:/2
+CCGCATCAGCATCAGTAGTTTTCAACGAGCTGGCCGAAGGTGTATAACTATGTGGTAGAGAGAAACTGCTGCTATCACTCACGATATAAGCCCTCTGACG
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata7_1 1:N:0:/2
+CCGCATCAGCATCAGTAGTTTTCAACGAGCTGGCCGAAGGTGTATAACTATGTGGTAGAGAGAAACTGCTGCTATCACTCACGATATAAGCCCTCTGACG
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata7_2 1:N:0:/2
+CCGCATCAGCATCAGTAGTTTTCAACGAGCTGGCCGAAGGTGTATAACTATGTGGTAGAGAGAAACTGCTGCTATCACTCACGATATAAGCCCTCTGACG
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata7_3 1:N:0:/2
+CCGCATCAGCATCAGTAGTTTTCAACGAGCTGGCCGAAGGTGTATAACTATGTGGTAGAGAGAAACTGCTGCTATCACTCACGATATAAGCCCTCTGACG
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata7_4 1:N:0:/2
+CCGCATCAGCATCAGTAGTTTTCAACGAGCTGGCCGAAGGTGTATAACTATGTGGTAGAGAGAAACTGCTGCTATCACTCACGATATAAGCCCTCTGACG
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata7_5 1:N:0:/2
+CCGCATCAGCATCAGTAGTTTTCAACGAGCTGGCCGAAGGTGTATAACTATGTGGTAGAGAGAAACTGCTGCTATCACTCACGATATAAGCCCTCTGACG
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata7_6 1:N:0:/2
+CCGATCAGCATCAGTAGTTTTCAACGAGCTGGCCCAATGGTGTATAACTATGTGGTAGAGAGAAACTGCTGCTATCACTCACGATATAAGCCCTCTGACG
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata7_7 1:N:0:/2
+CCGATCAGCATCAGTAGTTTTCAACGAGCTGGCCCAATGGTGTATAACGATGTGGTAGAGAGAAACTGCTGCTATCACTCACGATATAAGCCCTCTGACG
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata7_8 1:N:0:/2
+CCGATCAGCATCAGTAGTTTTCAACGAGCTGGCCCAATGGTGTATAACTATGTGGTAGAGAGAAACTGCTGCTATCACTCACGATATAAGCCCTCTGACG
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata7_9 1:N:0:/2
+CCGATCAGCATCAGTAGTTTTCAACGAGCTGGCCCAATGGTGTATAACTATGTGGTAGAGAGAAACTGCTGCTATCACTCACGATATAAGCCCTCTGACG
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata7_10 1:N:0:/2
+CCGATCAGCATCAGTAGTTTTCAACGAGCTGGCCCAATGGTGTATAACTATGTGGTAGAGAGAAACTGCTGCTATCACTCACGATATAAGCCCTCTGACG
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
+@lane1_fakedata7_11 1:N:0:/2
+CCGATCAGCATCAGTAGTTTTCAACGAGCTGGCCCTATGGTGTATAACTATGTGGTAGAGAGAAACTGCTGCTATCACTCACGATATAAGCCCTCTGACG
++
+BBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBBB
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/denovo_map/denovo_map.log	Mon Jul 01 10:57:08 2019 -0400
@@ -0,0 +1,309 @@
+denovo_map.pl version 2.4 started at 2019-06-18 10:34:45
+/home/berntm/miniconda3/envs/mulled-v1-2b57e7596f85ebb3b321e6c9681e8fd9250523a80d97945c46ac7743359454e7/bin/denovo_map.pl --samples demultiplexed --popmap denovo_map/popmap_cstacks.tsv -o stacks_outputs --paired
+
+ustacks
+==========
+
+Sample 1 of 2 'PopA_01'
+----------
+ustacks -t fastq -f demultiplexed/PopA_01.1.fq -o stacks_outputs -i 1 --name PopA_01
+ustacks parameters selected:
+  Input file: 'demultiplexed/PopA_01.1.fq'
+  Sample ID: 1
+  Min depth of coverage to create a stack (m): 3
+  Repeat removal algorithm: enabled
+  Max distance allowed between stacks (M): 2
+  Max distance allowed to align secondary reads: 4
+  Max number of stacks allowed per de novo locus: 3
+  Deleveraging algorithm: disabled
+  Gapped assembly: enabled
+  Minimum alignment length: 0.8
+  Model type: SNP
+  Alpha significance level for model: 0.05
+
+Loading RAD-Tags...
+
+Loaded 66 reads; formed:
+  4 stacks representing 63 primary reads (95.5%)
+  3 secondary stacks representing 3 secondary reads (4.5%)
+
+Stack coverage: mean=15.75; stdev=7.46; max=27; n_reads=63(95.5%)
+Removing repetitive stacks: cov > 39 (mean+3*stdev)...
+  Blacklisted 0 stacks.
+Coverage after repeat removal: mean=15.75; stdev=7.46; max=27; n_reads=63(95.5%)
+
+Assembling stacks (max. dist. M=2)...
+  Assembled 4 stacks into 3; blacklisted 0 stacks.
+Coverage after assembling stacks: mean=21.00; stdev=4.24; max=27; n_reads=63(95.5%)
+
+Merging secondary stacks (max. dist. N=4 from consensus)...
+  Merged 3 out of 3 secondary reads (100.0%), 1 merged with gapped alignments.
+Coverage after merging secondary stacks: mean=22.00; stdev=4.32; max=28; n_reads=66(100.0%)
+
+Assembling stacks, allowing for gaps (min. match length 80.0%)...
+  Assembled 3 stacks into 3 stacks.
+Coverage after gapped assembly: mean=22.00; stdev=4.32; max=28; n_reads=66(100.0%)
+
+Merging secondary stacks, allowing for gaps (min. match length 80.0%)...
+  Merged 0 out of 0 secondary reads (-nan%).
+Coverage after merging gapped secondary stacks: mean=22.00; stdev=4.32; max=28; n_reads=66(100.0%)
+
+Final coverage: mean=22.00; stdev=4.32; max=28; n_reads=66(100.0%)
+Calling consensus sequences and haplotypes for catalog assembly...
+Writing tags, SNPs, and alleles files...
+Refetching read IDs...done.
+ustacks is done.
+
+Sample 2 of 2 'PopA_02'
+----------
+ustacks -t fastq -f demultiplexed/PopA_02.1.fq -o stacks_outputs -i 2 --name PopA_02
+ustacks parameters selected:
+  Input file: 'demultiplexed/PopA_02.1.fq'
+  Sample ID: 2
+  Min depth of coverage to create a stack (m): 3
+  Repeat removal algorithm: enabled
+  Max distance allowed between stacks (M): 2
+  Max distance allowed to align secondary reads: 4
+  Max number of stacks allowed per de novo locus: 3
+  Deleveraging algorithm: disabled
+  Gapped assembly: enabled
+  Minimum alignment length: 0.8
+  Model type: SNP
+  Alpha significance level for model: 0.05
+
+Loading RAD-Tags...
+
+Loaded 60 reads; formed:
+  4 stacks representing 55 primary reads (91.7%)
+  5 secondary stacks representing 5 secondary reads (8.3%)
+
+Stack coverage: mean=13.75; stdev=9.12; max=26; n_reads=55(91.7%)
+Removing repetitive stacks: cov > 42 (mean+3*stdev)...
+  Blacklisted 0 stacks.
+Coverage after repeat removal: mean=13.75; stdev=9.12; max=26; n_reads=55(91.7%)
+
+Assembling stacks (max. dist. M=2)...
+  Assembled 4 stacks into 3; blacklisted 0 stacks.
+Coverage after assembling stacks: mean=18.33; stdev=6.55; max=26; n_reads=55(91.7%)
+
+Merging secondary stacks (max. dist. N=4 from consensus)...
+  Merged 5 out of 5 secondary reads (100.0%), 0 merged with gapped alignments.
+Coverage after merging secondary stacks: mean=20.00; stdev=6.53; max=28; n_reads=60(100.0%)
+
+Assembling stacks, allowing for gaps (min. match length 80.0%)...
+  Assembled 3 stacks into 3 stacks.
+Coverage after gapped assembly: mean=20.00; stdev=6.53; max=28; n_reads=60(100.0%)
+
+Merging secondary stacks, allowing for gaps (min. match length 80.0%)...
+  Merged 0 out of 0 secondary reads (-nan%).
+Coverage after merging gapped secondary stacks: mean=20.00; stdev=6.53; max=28; n_reads=60(100.0%)
+
+Final coverage: mean=20.00; stdev=6.53; max=28; n_reads=60(100.0%)
+Calling consensus sequences and haplotypes for catalog assembly...
+Writing tags, SNPs, and alleles files...
+Refetching read IDs...done.
+ustacks is done.
+
+Depths of Coverage for Processed Samples:
+PopA_01: 22.00x
+PopA_02: 20.00x
+
+cstacks
+==========
+cstacks -P stacks_outputs -M denovo_map/popmap_cstacks.tsv
+
+cstacks parameters selected:
+  Loci matched based on sequence identity.
+  Number of mismatches allowed between stacks: 1
+  Gapped alignments: enabled
+Constructing catalog from 2 samples.
+
+Initializing new catalog...
+  Parsing stacks_outputs/PopA_01.tags.tsv
+  Parsing stacks_outputs/PopA_01.snps.tsv
+  Parsing stacks_outputs/PopA_01.alleles.tsv
+  3 loci were newly added to the catalog.
+
+Processing sample stacks_outputs/PopA_02 [2 of 2]
+  Parsing stacks_outputs/PopA_02.tags.tsv
+  Parsing stacks_outputs/PopA_02.snps.tsv
+  Parsing stacks_outputs/PopA_02.alleles.tsv
+Searching for sequence matches...
+  3 loci in the catalog, 184 kmers in the catalog hash.
+Searching for gapped alignments...
+Merging matches into catalog...
+  3 loci were matched to a catalog locus.
+  0 loci were matched to a catalog locus using gapped alignments.
+  0 loci were newly added to the catalog.
+  0 loci matched more than one catalog locus, linking them.
+    0 linked catalog loci were merged into 0 loci.
+
+Writing catalog in directory 'stacks_outputs/'.
+Final catalog contains 3 loci.
+cstacks is done.
+
+sstacks
+==========
+sstacks -P stacks_outputs -M denovo_map/popmap_cstacks.tsv
+
+Searching for matches by sequence identity...
+  Parsing stacks_outputs/catalog.tags.tsv
+  Parsing stacks_outputs/catalog.snps.tsv
+  Parsing stacks_outputs/catalog.alleles.tsv
+Populating kmer dictionary for exact matches...done.
+Populating kmer dictionary for gapped alignments...done.
+
+Processing sample 'stacks_outputs/PopA_01' [1 of 2]
+  Parsing stacks_outputs/PopA_01.tags.tsv
+  Parsing stacks_outputs/PopA_01.snps.tsv
+  Parsing stacks_outputs/PopA_01.alleles.tsv
+Searching for sequence matches...
+3 sample loci compared against the catalog containing 3 loci.
+  3 matching loci, 0 contained no verified haplotypes.
+  0 loci matched more than one catalog locus and were excluded.
+  0 loci contained SNPs unaccounted for in the catalog and were excluded.
+  4 total haplotypes examined from matching loci, 4 verified.
+Searching for gapped alignments...
+Out of 3 query loci, 0 gapped alignments attempted.
+  0 loci matched one catalog locus; 0 total haplotypes examined, 0 verified.
+  0 loci matched no catalog locus;
+    0 loci matched more than one catalog locus and were excluded.
+    0 loci contained SNPs unaccounted for in the catalog and were excluded.
+    0 loci had no verified haplotypes.
+    0 loci had inconsistent alignments to a catalog locus and were excluded.
+Outputing to file stacks_outputs/PopA_01.matches.tsv
+
+Processing sample 'stacks_outputs/PopA_02' [2 of 2]
+  Parsing stacks_outputs/PopA_02.tags.tsv
+  Parsing stacks_outputs/PopA_02.snps.tsv
+  Parsing stacks_outputs/PopA_02.alleles.tsv
+Searching for sequence matches...
+3 sample loci compared against the catalog containing 3 loci.
+  3 matching loci, 0 contained no verified haplotypes.
+  0 loci matched more than one catalog locus and were excluded.
+  0 loci contained SNPs unaccounted for in the catalog and were excluded.
+  4 total haplotypes examined from matching loci, 4 verified.
+Searching for gapped alignments...
+Out of 3 query loci, 0 gapped alignments attempted.
+  0 loci matched one catalog locus; 0 total haplotypes examined, 0 verified.
+  0 loci matched no catalog locus;
+    0 loci matched more than one catalog locus and were excluded.
+    0 loci contained SNPs unaccounted for in the catalog and were excluded.
+    0 loci had no verified haplotypes.
+    0 loci had inconsistent alignments to a catalog locus and were excluded.
+Outputing to file stacks_outputs/PopA_02.matches.tsv
+
+sstacks is done.
+
+tsv2bam
+==========
+tsv2bam -P stacks_outputs  -M denovo_map/popmap_cstacks.tsv -R demultiplexed/
+
+Logging to 'stacks_outputs/tsv2bam.log'.
+Configuration for this run:
+  Stacks directory: 'stacks_outputs/'
+  Population map: 'denovo_map/popmap_cstacks.tsv'
+  Num. samples: 2
+  Paired-end reads directory: 'demultiplexed/'
+
+Paired-end reads files found, e.g. 'demultiplexed/PopA_01.2.fq'.
+Loading the catalog...
+Processing sample 'PopA_01'...
+Processing sample 'PopA_02'...
+
+Sample 'PopA_01': matched 3 sample loci to 3 catalog loci; found a paired-end read for 66 (100.0%) of the assembled forward reads; wrote 132 records.
+Sample 'PopA_02': matched 3 sample loci to 3 catalog loci; found a paired-end read for 60 (100.0%) of the assembled forward reads; wrote 120 records.
+
+tsv2bam is done.
+
+gstacks
+==========
+gstacks -P stacks_outputs -M denovo_map/popmap_cstacks.tsv
+
+Logging to 'stacks_outputs/gstacks.log'.
+Locus/sample distributions will be written to 'stacks_outputs/gstacks.log.distribs'.
+
+Configuration for this run:
+  Input mode: denovo
+  Population map: 'denovo_map/popmap_cstacks.tsv'
+  Input files: 2, e.g. 'stacks_outputs/PopA_01.matches.bam'
+  Output to: 'stacks_outputs/'
+  Model: marukilow (var_alpha: 0.01, gt_alpha: 0.05)
+
+Reading BAM headers...
+Processing all loci...
+20%...
+50%...
+100%
+
+Attempted to assemble and align paired-end reads for 3 loci:
+  0 loci had no or almost no paired-end reads (0.0%);
+  0 loci had paired-end reads that couldn't be assembled into a contig (0.0%);
+  For the remaining 3 loci (100.0%), a paired-end contig was assembled;
+    Average contig size was 204.3 bp;
+  0 paired-end contigs overlapped the forward region (0.0%)
+    Mean overlap: -nanbp; mean size of overlapped loci after merging: -nan;
+  Out of 252 paired-end reads in these loci (mean 84.0 reads per locus),
+    252 were successfuly aligned (100.0%);
+  Mean insert length was -nan, stdev: nan (based on aligned reads in overlapped loci).
+
+Genotyped 3 loci:
+  effective per-sample coverage: mean=31.0x, stdev=1.0x, min=30.0x, max=32.0x
+  mean number of sites per locus: 194.3
+  a consistent phasing was found for 5 of out 5 (100.0%) diploid loci needing phasing
+
+gstacks is done.
+
+populations
+==========
+populations -P stacks_outputs -M denovo_map/popmap_cstacks.tsv
+
+Logging to 'stacks_outputs/populations.log'.
+Locus/sample distributions will be written to 'stacks_outputs/populations.log.distribs'.
+populations parameters selected:
+  Percent samples limit per population: 0
+  Locus Population limit: 1
+  Percent samples overall: 0
+  Minor allele frequency cutoff: 0
+  Maximum observed heterozygosity cutoff: 1
+  Applying Fst correction: none.
+  Pi/Fis kernel smoothing: off
+  Fstats kernel smoothing: off
+  Bootstrap resampling: off
+
+Parsing population map...
+The population map contained 2 samples, 1 population(s), 1 group(s).
+Working on 2 samples.
+Working on 1 population(s):
+    1: PopA_01, PopA_02
+Working on 1 group(s) of populations:
+    defaultgrp: 1
+
+Genotyping markers will be written to 'stacks_outputs/populations.markers.tsv'
+Raw Genotypes/Haplotypes will be written to 'stacks_outputs/populations.haplotypes.tsv'
+Population-level summary statistics will be written to 'stacks_outputs/populations.sumstats.tsv'
+Population-level haplotype summary statistics will be written to 'stacks_outputs/populations.hapstats.tsv'
+
+Processing data in batches:
+  * load a batch of catalog loci and apply filters
+  * compute SNP- and haplotype-wise per-population statistics
+  * write the above statistics in the output files
+  * export the genotypes/haplotypes in specified format(s)
+More details in 'stacks_outputs/populations.log.distribs'.
+Now processing...
+Batch 1 
+
+Removed 0 loci that did not pass sample/population constraints from 3 loci.
+Kept 3 loci, composed of 613 sites; 0 of those sites were filtered, 6 variant sites remained.
+Number of loci with PE contig: 3.00 (100.0%);
+  Mean length of loci: 194.33bp (stderr 0.33);
+Number of loci with SE/PE overlap: 0.00 (0.0%);
+  Mean length of overlapping loci: -nanbp (stderr -0.00); mean overlap: -nanbp (stderr -0.00);
+Mean genotyped sites per locus: 194.33bp (stderr 0.33).
+
+Population summary statistics (more detail in populations.sumstats_summary.tsv):
+  1: 2 samples per locus; pi: 0.61111; all/variant/polymorphic sites: 583/6/6; private alleles: 0
+Populations is done.
+denovo_map.pl is done.
+
+denovo_map.pl completed at 2019-06-18 10:34:45
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/denovo_map/popmap_cstacks.tsv	Mon Jul 01 10:57:08 2019 -0400
@@ -0,0 +1,2 @@
+PopA_01	1
+PopA_02	1
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/gentest.sh	Mon Jul 01 10:57:08 2019 -0400
@@ -0,0 +1,19 @@
+#!/usr/bin/env bash
+
+mkdir stacks_outputs
+
+denovo_map.pl --samples demultiplexed --popmap denovo_map/popmap_cstacks.tsv -o stacks_outputs --paired  && 
+gunzip -c stacks_outputs/catalog.calls > stacks_outputs/catalog.calls.vcf
+rm stacks_outputs/catalog.calls
+
+mv stacks_outputs/PopA_0{1,2}.{tags,snps,alleles}.tsv ustacks/
+mv stacks_outputs/catalog.{tags,snps,alleles}.tsv cstacks/
+mv stacks_outputs/PopA_0{1,2}.matches.tsv sstacks/
+mv stacks_outputs/PopA_0{1,2}.matches.bam tsv2bam/
+mv stacks_outputs/tsv2bam.log tsv2bam/
+mv stacks_outputs/catalog.{calls.vcf,fa.gz} gstacks/
+mv stacks_outputs/gstacks.log* gstacks/
+mv stacks_outputs/populations.* populations/
+mv stacks_outputs/denovo_map.log denovo_map/
+
+rmdir stacks_outputs
Binary file test-data/gstacks/PopA_01.alns.bam has changed
Binary file test-data/gstacks/PopA_02.alns.bam has changed
Binary file test-data/gstacks/alignments.bam has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/gstacks/catalog.calls.vcf	Mon Jul 01 10:57:08 2019 -0400
@@ -0,0 +1,597 @@
+##fileformat=VCFv4.2
+##fileDate=20190618
+##source="Stacks v2.4"
+##INFO=<ID=AD,Number=R,Type=Integer,Description="Total Depth for Each Allele">
+##INFO=<ID=AF,Number=A,Type=Float,Description="Allele Frequency">
+##INFO=<ID=DP,Number=1,Type=Integer,Description="Total Depth">
+##INFO=<ID=NS,Number=1,Type=Integer,Description="Number of Samples With Data">
+##FORMAT=<ID=AD,Number=R,Type=Integer,Description="Allele Depth">
+##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Read Depth">
+##FORMAT=<ID=HQ,Number=2,Type=Integer,Description="Haplotype Quality">
+##FORMAT=<ID=GL,Number=G,Type=Float,Description="Genotype Likelihood">
+##FORMAT=<ID=GQ,Number=1,Type=Integer,Description="Genotype Quality">
+##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
+#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	PopA_01	PopA_02
+1	1	.	A	.	.	.	DP=30;AD=30	DP	18	12
+1	2	.	A	.	.	.	DP=30;AD=30	DP	18	12
+1	3	.	T	.	.	.	DP=30;AD=30	DP	18	12
+1	4	.	T	.	.	.	DP=30;AD=30	DP	18	12
+1	5	.	C	.	.	.	DP=30;AD=30	DP	18	12
+1	6	.	G	.	.	.	DP=30;AD=30	DP	18	12
+1	7	.	T	.	.	.	DP=30;AD=30	DP	18	12
+1	8	.	T	.	.	.	DP=30;AD=30	DP	18	12
+1	9	.	T	.	.	.	DP=30;AD=30	DP	18	12
+1	10	.	G	.	.	.	DP=30;AD=30	DP	18	12
+1	11	.	C	.	.	.	DP=30;AD=30	DP	18	12
+1	12	.	T	.	.	.	DP=30;AD=30	DP	18	12
+1	13	.	G	.	.	.	DP=30;AD=30	DP	18	12
+1	14	.	C	.	.	.	DP=30;AD=30	DP	18	12
+1	15	.	T	.	.	.	DP=30;AD=30	DP	18	12
+1	16	.	T	.	.	.	DP=30;AD=30	DP	18	12
+1	17	.	C	.	.	.	DP=30;AD=30	DP	18	12
+1	18	.	A	.	.	.	DP=30;AD=30	DP	18	12
+1	19	.	G	.	.	.	DP=30;AD=30	DP	18	12
+1	20	.	G	.	.	.	DP=30;AD=30	DP	18	12
+1	21	.	A	.	.	.	DP=30;AD=30	DP	18	12
+1	22	.	A	.	.	.	DP=30;AD=30	DP	18	12
+1	23	.	T	.	.	.	DP=30;AD=29	DP	18	12
+1	24	.	C	.	.	.	DP=30;AD=30	DP	18	12
+1	25	.	T	.	.	.	DP=30;AD=30	DP	18	12
+1	26	.	C	.	.	.	DP=30;AD=29	DP	18	12
+1	27	.	T	.	.	.	DP=30;AD=30	DP	18	12
+1	28	.	C	.	.	.	DP=30;AD=30	DP	18	12
+1	29	.	G	.	.	.	DP=30;AD=30	DP	18	12
+1	30	.	T	.	.	.	DP=30;AD=30	DP	18	12
+1	31	.	A	.	.	.	DP=30;AD=30	DP	18	12
+1	32	.	T	.	.	.	DP=30;AD=30	DP	18	12
+1	33	.	A	.	.	.	DP=30;AD=30	DP	18	12
+1	34	.	A	C	40	.	DP=30;AD=15,15;AF=0.5	GT:PS:FT:GQ:DP:AD:GL	0|1:34:.:40:18:9,9:-20.07,0.00,-20.07	0|1:34:.:40:12:6,6:-13.54,-0.00,-13.54
+1	35	.	T	.	.	.	DP=30;AD=30	DP	18	12
+1	36	.	C	.	.	.	DP=30;AD=30	DP	18	12
+1	37	.	T	.	.	.	DP=30;AD=30	DP	18	12
+1	38	.	G	.	.	.	DP=30;AD=30	DP	18	12
+1	39	.	A	.	.	.	DP=30;AD=30	DP	18	12
+1	40	.	G	.	.	.	DP=30;AD=30	DP	18	12
+1	41	.	T	.	.	.	DP=30;AD=30	DP	18	12
+1	42	.	A	.	.	.	DP=30;AD=30	DP	18	12
+1	43	.	T	.	.	.	DP=30;AD=30	DP	18	12
+1	44	.	G	.	.	.	DP=30;AD=30	DP	18	12
+1	45	.	T	.	.	.	DP=30;AD=30	DP	18	12
+1	46	.	G	.	.	.	DP=30;AD=30	DP	18	12
+1	47	.	C	.	.	.	DP=30;AD=30	DP	18	12
+1	48	.	G	.	.	.	DP=30;AD=30	DP	18	12
+1	49	.	T	.	.	.	DP=30;AD=30	DP	18	12
+1	50	.	A	.	.	.	DP=30;AD=30	DP	18	12
+1	51	.	C	.	.	.	DP=30;AD=30	DP	18	12
+1	52	.	G	.	.	.	DP=30;AD=30	DP	18	12
+1	53	.	T	.	.	.	DP=30;AD=30	DP	18	12
+1	54	.	A	.	.	.	DP=30;AD=30	DP	18	12
+1	55	.	C	.	.	.	DP=30;AD=30	DP	18	12
+1	56	.	G	.	.	.	DP=30;AD=30	DP	18	12
+1	57	.	C	.	.	.	DP=30;AD=30	DP	18	12
+1	58	.	T	.	.	.	DP=30;AD=30	DP	18	12
+1	59	.	A	.	.	.	DP=30;AD=30	DP	18	12
+1	60	.	T	.	.	.	DP=30;AD=30	DP	18	12
+1	61	.	T	.	.	.	DP=30;AD=30	DP	18	12
+1	62	.	T	.	.	.	DP=30;AD=30	DP	18	12
+1	63	.	A	.	.	.	DP=30;AD=30	DP	18	12
+1	64	.	G	.	.	.	DP=30;AD=30	DP	18	12
+1	65	.	A	.	.	.	DP=30;AD=30	DP	18	12
+1	66	.	T	.	.	.	DP=30;AD=30	DP	18	12
+1	67	.	G	.	.	.	DP=30;AD=30	DP	18	12
+1	68	.	G	.	.	.	DP=30;AD=30	DP	18	12
+1	69	.	A	.	.	.	DP=30;AD=30	DP	18	12
+1	70	.	T	.	.	.	DP=30;AD=30	DP	18	12
+1	71	.	A	.	.	.	DP=30;AD=30	DP	18	12
+1	72	.	A	.	.	.	DP=30;AD=30	DP	18	12
+1	73	.	C	.	.	.	DP=30;AD=30	DP	18	12
+1	74	.	C	.	.	.	DP=30;AD=30	DP	18	12
+1	75	.	G	.	.	.	DP=30;AD=30	DP	18	12
+1	76	.	A	.	.	.	DP=30;AD=30	DP	18	12
+1	77	.	C	.	.	.	DP=30;AD=30	DP	18	12
+1	78	.	G	.	.	.	DP=30;AD=30	DP	18	12
+1	79	.	C	.	.	.	DP=30;AD=30	DP	18	12
+1	80	.	T	.	.	.	DP=30;AD=30	DP	18	12
+1	81	.	G	.	.	.	DP=30;AD=30	DP	18	12
+1	82	.	C	.	.	.	DP=30;AD=30	DP	18	12
+1	83	.	C	.	.	.	DP=30;AD=30	DP	18	12
+1	84	.	A	.	.	.	DP=30;AD=30	DP	18	12
+1	85	.	G	.	.	.	DP=30;AD=30	DP	18	12
+1	86	.	A	.	.	.	DP=30;AD=30	DP	18	12
+1	87	.	C	.	.	.	DP=30;AD=30	DP	18	12
+1	88	.	G	.	.	.	DP=30;AD=30	DP	18	12
+1	89	.	A	C	40	.	DP=30;AD=15,15;AF=0.5	GT:PS:FT:GQ:DP:AD:GL	1|0:34:.:40:18:9,9:-20.07,0.00,-20.07	1|0:34:.:40:12:6,6:-13.54,-0.00,-13.54
+1	90	.	G	.	.	.	DP=30;AD=30	DP	18	12
+1	91	.	A	.	.	.	DP=30;AD=30	DP	18	12
+1	92	.	G	.	.	.	DP=30;AD=30	DP	18	12
+1	93	.	A	.	.	.	DP=30;AD=30	DP	18	12
+1	94	.	C	.	.	.	DP=30;AD=30	DP	18	12
+1	105	.	C	.	.	.	DP=19;AD=19	DP	11	8
+1	106	.	G	.	.	.	DP=19;AD=19	DP	11	8
+1	107	.	T	.	.	.	DP=19;AD=19	DP	11	8
+1	108	.	C	.	.	.	DP=19;AD=19	DP	11	8
+1	109	.	A	.	.	.	DP=19;AD=19	DP	11	8
+1	110	.	G	.	.	.	DP=19;AD=19	DP	11	8
+1	111	.	A	.	.	.	DP=19;AD=19	DP	11	8
+1	112	.	G	.	.	.	DP=19;AD=19	DP	11	8
+1	113	.	G	.	.	.	DP=19;AD=19	DP	11	8
+1	114	.	G	.	.	.	DP=19;AD=19	DP	11	8
+1	115	.	C	.	.	.	DP=19;AD=19	DP	11	8
+1	116	.	T	.	.	.	DP=19;AD=19	DP	11	8
+1	117	.	T	.	.	.	DP=19;AD=19	DP	11	8
+1	118	.	A	.	.	.	DP=19;AD=19	DP	11	8
+1	119	.	T	.	.	.	DP=19;AD=19	DP	11	8
+1	120	.	A	.	.	.	DP=19;AD=19	DP	11	8
+1	121	.	T	.	.	.	DP=19;AD=19	DP	11	8
+1	122	.	C	.	.	.	DP=19;AD=19	DP	11	8
+1	123	.	G	.	.	.	DP=19;AD=19	DP	11	8
+1	124	.	T	.	.	.	DP=19;AD=19	DP	11	8
+1	125	.	G	.	.	.	DP=19;AD=19	DP	11	8
+1	126	.	A	.	.	.	DP=19;AD=19	DP	11	8
+1	127	.	G	.	.	.	DP=19;AD=19	DP	11	8
+1	128	.	T	.	.	.	DP=19;AD=19	DP	11	8
+1	129	.	G	.	.	.	DP=19;AD=19	DP	11	8
+1	130	.	A	.	.	.	DP=19;AD=19	DP	11	8
+1	131	.	T	.	.	.	DP=19;AD=19	DP	11	8
+1	132	.	A	.	.	.	DP=19;AD=19	DP	11	8
+1	133	.	G	.	.	.	DP=19;AD=19	DP	11	8
+1	134	.	C	.	.	.	DP=19;AD=19	DP	11	8
+1	135	.	A	.	.	.	DP=19;AD=19	DP	11	8
+1	136	.	G	.	.	.	DP=19;AD=19	DP	11	8
+1	137	.	C	.	.	.	DP=19;AD=19	DP	11	8
+1	138	.	A	.	.	.	DP=19;AD=19	DP	11	8
+1	139	.	G	.	.	.	DP=19;AD=19	DP	11	8
+1	140	.	T	.	.	.	DP=19;AD=19	DP	11	8
+1	141	.	T	.	.	.	DP=19;AD=19	DP	11	8
+1	142	.	T	.	.	.	DP=19;AD=19	DP	11	8
+1	143	.	C	.	.	.	DP=19;AD=19	DP	11	8
+1	144	.	T	.	.	.	DP=19;AD=19	DP	11	8
+1	145	.	C	.	.	.	DP=19;AD=19	DP	11	8
+1	146	.	T	.	.	.	DP=19;AD=19	DP	11	8
+1	147	.	C	.	.	.	DP=19;AD=19	DP	11	8
+1	148	.	T	.	.	.	DP=19;AD=19	DP	11	8
+1	149	.	A	.	.	.	DP=19;AD=19	DP	11	8
+1	150	.	C	.	.	.	DP=19;AD=19	DP	11	8
+1	151	.	C	.	.	.	DP=19;AD=19	DP	11	8
+1	152	.	A	.	.	.	DP=19;AD=19	DP	11	8
+1	153	.	C	.	.	.	DP=19;AD=19	DP	11	8
+1	154	.	A	.	.	.	DP=19;AD=19	DP	11	8
+1	155	.	T	.	.	.	DP=19;AD=19	DP	11	8
+1	156	.	A	.	.	.	DP=19;AD=18	DP	11	8
+1	157	.	G	.	.	.	DP=19;AD=19	DP	11	8
+1	158	.	T	.	.	.	DP=19;AD=19	DP	11	8
+1	159	.	T	.	.	.	DP=19;AD=19	DP	11	8
+1	160	.	A	.	.	.	DP=19;AD=19	DP	11	8
+1	161	.	T	.	.	.	DP=19;AD=19	DP	11	8
+1	162	.	A	.	.	.	DP=19;AD=19	DP	11	8
+1	163	.	C	.	.	.	DP=19;AD=19	DP	11	8
+1	164	.	A	.	.	.	DP=19;AD=19	DP	11	8
+1	165	.	C	.	.	.	DP=19;AD=19	DP	11	8
+1	166	.	C	.	.	.	DP=19;AD=19	DP	11	8
+1	167	.	A	.	.	.	DP=16;AD=16	DP	11	5
+1	168	.	T	.	.	.	DP=19;AD=19	DP	11	8
+1	169	.	T	.	.	.	DP=19;AD=18	DP	11	8
+1	170	.	G	.	.	.	DP=19;AD=16	DP	11	8
+1	171	.	G	.	.	.	DP=19;AD=19	DP	11	8
+1	172	.	G	.	.	.	DP=19;AD=19	DP	11	8
+1	173	.	C	.	.	.	DP=19;AD=19	DP	11	8
+1	174	.	C	.	.	.	DP=19;AD=19	DP	11	8
+1	175	.	A	.	.	.	DP=19;AD=19	DP	11	8
+1	176	.	G	.	.	.	DP=19;AD=19	DP	11	8
+1	177	.	C	.	.	.	DP=19;AD=19	DP	11	8
+1	178	.	T	.	.	.	DP=19;AD=19	DP	11	8
+1	179	.	C	.	.	.	DP=19;AD=19	DP	11	8
+1	180	.	G	.	.	.	DP=19;AD=19	DP	11	8
+1	181	.	T	.	.	.	DP=19;AD=19	DP	11	8
+1	182	.	T	.	.	.	DP=19;AD=19	DP	11	8
+1	183	.	G	.	.	.	DP=19;AD=19	DP	11	8
+1	184	.	A	.	.	.	DP=19;AD=19	DP	11	8
+1	185	.	A	.	.	.	DP=19;AD=19	DP	11	8
+1	186	.	A	.	.	.	DP=19;AD=19	DP	11	8
+1	187	.	A	.	.	.	DP=19;AD=19	DP	11	8
+1	188	.	C	.	.	.	DP=19;AD=19	DP	11	8
+1	189	.	T	.	.	.	DP=19;AD=19	DP	11	8
+1	190	.	A	.	.	.	DP=19;AD=19	DP	11	8
+1	191	.	C	.	.	.	DP=19;AD=18	DP	11	8
+1	192	.	T	.	.	.	DP=19;AD=19	DP	11	8
+1	193	.	G	.	.	.	DP=19;AD=19	DP	11	8
+1	194	.	A	.	.	.	DP=19;AD=19	DP	11	8
+1	195	.	T	.	.	.	DP=19;AD=19	DP	11	8
+1	196	.	G	.	.	.	DP=19;AD=19	DP	11	8
+1	197	.	C	.	.	.	DP=19;AD=19	DP	11	8
+1	198	.	T	.	.	.	DP=19;AD=19	DP	11	8
+1	199	.	G	.	.	.	DP=19;AD=19	DP	11	8
+1	200	.	A	.	.	.	DP=19;AD=19	DP	11	8
+1	201	.	T	.	.	.	DP=19;AD=19	DP	11	8
+1	202	.	C	.	.	.	DP=19;AD=19	DP	11	8
+1	203	.	G	.	.	.	DP=19;AD=19	DP	11	8
+1	204	.	G	.	.	.	DP=19;AD=19	DP	11	8
+2	1	.	A	.	.	.	DP=56;AD=56	DP	28	28
+2	2	.	A	.	.	.	DP=56;AD=56	DP	28	28
+2	3	.	T	.	.	.	DP=56;AD=56	DP	28	28
+2	4	.	T	.	.	.	DP=56;AD=56	DP	28	28
+2	5	.	C	.	.	.	DP=56;AD=56	DP	28	28
+2	6	.	G	.	.	.	DP=56;AD=56	DP	28	28
+2	7	.	G	.	.	.	DP=56;AD=56	DP	28	28
+2	8	.	C	.	.	.	DP=56;AD=56	DP	28	28
+2	9	.	T	.	.	.	DP=56;AD=56	DP	28	28
+2	10	.	T	.	.	.	DP=56;AD=56	DP	28	28
+2	11	.	G	.	.	.	DP=56;AD=56	DP	28	28
+2	12	.	C	.	.	.	DP=56;AD=56	DP	28	28
+2	13	.	A	.	.	.	DP=56;AD=56	DP	28	28
+2	14	.	A	.	.	.	DP=56;AD=56	DP	28	28
+2	15	.	C	.	.	.	DP=56;AD=56	DP	28	28
+2	16	.	G	.	.	.	DP=56;AD=56	DP	28	28
+2	17	.	C	.	.	.	DP=56;AD=56	DP	28	28
+2	18	.	A	.	.	.	DP=56;AD=56	DP	28	28
+2	19	.	A	.	.	.	DP=56;AD=56	DP	28	28
+2	20	.	G	.	.	.	DP=56;AD=56	DP	28	28
+2	21	.	T	.	.	.	DP=56;AD=56	DP	28	28
+2	22	.	G	.	.	.	DP=56;AD=56	DP	28	28
+2	23	.	A	.	.	.	DP=56;AD=56	DP	28	28
+2	24	.	C	.	.	.	DP=56;AD=56	DP	28	28
+2	25	.	G	.	.	.	DP=56;AD=56	DP	28	28
+2	26	.	A	.	.	.	DP=56;AD=56	DP	28	28
+2	27	.	T	.	.	.	DP=56;AD=56	DP	28	28
+2	28	.	T	.	.	.	DP=56;AD=56	DP	28	28
+2	29	.	C	.	.	.	DP=56;AD=56	DP	28	28
+2	30	.	C	.	.	.	DP=56;AD=56	DP	28	28
+2	31	.	C	.	.	.	DP=56;AD=56	DP	28	28
+2	32	.	A	.	.	.	DP=56;AD=55	DP	28	28
+2	33	.	C	.	.	.	DP=56;AD=56	DP	28	28
+2	34	.	G	.	.	.	DP=56;AD=56	DP	28	28
+2	35	.	G	.	.	.	DP=56;AD=56	DP	28	28
+2	36	.	A	.	.	.	DP=56;AD=56	DP	28	28
+2	37	.	C	.	.	.	DP=56;AD=56	DP	28	28
+2	38	.	A	.	.	.	DP=56;AD=56	DP	28	28
+2	39	.	T	.	.	.	DP=56;AD=56	DP	28	28
+2	40	.	A	.	.	.	DP=56;AD=56	DP	28	28
+2	41	.	A	.	.	.	DP=56;AD=56	DP	28	28
+2	42	.	C	.	.	.	DP=56;AD=56	DP	28	28
+2	43	.	T	.	.	.	DP=56;AD=56	DP	28	28
+2	44	.	G	.	.	.	DP=56;AD=56	DP	28	28
+2	45	.	A	.	.	.	DP=56;AD=56	DP	28	28
+2	46	.	T	.	.	.	DP=56;AD=56	DP	28	28
+2	47	.	C	.	.	.	DP=56;AD=56	DP	28	28
+2	48	.	T	.	.	.	DP=56;AD=56	DP	28	28
+2	49	.	A	.	.	.	DP=56;AD=56	DP	28	28
+2	50	.	A	.	.	.	DP=56;AD=56	DP	28	28
+2	51	.	G	.	.	.	DP=56;AD=56	DP	28	28
+2	52	.	T	.	.	.	DP=56;AD=56	DP	28	28
+2	53	.	A	.	.	.	DP=56;AD=56	DP	28	28
+2	54	.	A	.	.	.	DP=56;AD=55	DP	28	28
+2	55	.	C	.	.	.	DP=56;AD=56	DP	28	28
+2	56	.	T	.	.	.	DP=56;AD=56	DP	28	28
+2	57	.	T	.	.	.	DP=56;AD=56	DP	28	28
+2	58	.	C	.	.	.	DP=56;AD=56	DP	28	28
+2	59	.	C	.	.	.	DP=56;AD=56	DP	28	28
+2	60	.	A	.	.	.	DP=56;AD=56	DP	28	28
+2	61	.	A	.	.	.	DP=56;AD=56	DP	28	28
+2	62	.	A	.	.	.	DP=56;AD=55	DP	28	28
+2	63	.	T	.	.	.	DP=56;AD=56	DP	28	28
+2	64	.	C	.	.	.	DP=56;AD=56	DP	28	28
+2	65	.	T	.	.	.	DP=56;AD=56	DP	28	28
+2	66	.	G	.	.	.	DP=56;AD=56	DP	28	28
+2	67	.	G	.	.	.	DP=56;AD=56	DP	28	28
+2	68	.	G	.	.	.	DP=56;AD=56	DP	28	28
+2	69	.	A	.	.	.	DP=56;AD=56	DP	28	28
+2	70	.	A	.	.	.	DP=56;AD=56	DP	28	28
+2	71	.	T	.	.	.	DP=56;AD=56	DP	28	28
+2	72	.	G	.	.	.	DP=56;AD=56	DP	28	28
+2	73	.	G	.	.	.	DP=56;AD=56	DP	28	28
+2	74	.	G	.	.	.	DP=56;AD=56	DP	28	28
+2	75	.	A	.	.	.	DP=56;AD=56	DP	28	28
+2	76	.	T	.	.	.	DP=56;AD=56	DP	28	28
+2	77	.	T	.	.	.	DP=56;AD=56	DP	28	28
+2	78	.	T	.	.	.	DP=56;AD=56	DP	28	28
+2	79	.	C	.	.	.	DP=56;AD=56	DP	28	28
+2	80	.	A	.	.	.	DP=56;AD=56	DP	28	28
+2	81	.	T	.	.	.	DP=56;AD=56	DP	28	28
+2	82	.	A	.	.	.	DP=56;AD=56	DP	28	28
+2	83	.	A	.	.	.	DP=56;AD=56	DP	28	28
+2	84	.	T	.	.	.	DP=56;AD=56	DP	28	28
+2	85	.	T	.	.	.	DP=56;AD=56	DP	28	28
+2	86	.	A	.	.	.	DP=56;AD=56	DP	28	28
+2	87	.	A	.	.	.	DP=56;AD=56	DP	28	28
+2	88	.	G	.	.	.	DP=56;AD=56	DP	28	28
+2	89	.	G	.	.	.	DP=56;AD=56	DP	28	28
+2	90	.	A	.	.	.	DP=56;AD=56	DP	28	28
+2	91	.	C	.	.	.	DP=56;AD=56	DP	28	28
+2	92	.	T	.	.	.	DP=56;AD=56	DP	28	28
+2	93	.	A	.	.	.	DP=56;AD=56	DP	28	28
+2	94	.	T	.	.	.	DP=56;AD=56	DP	28	28
+2	105	.	T	.	.	.	DP=12;AD=12	DP	.	12
+2	106	.	A	.	.	.	DP=46;AD=46	DP	23	23
+2	107	.	C	.	.	.	DP=46;AD=46	DP	23	23
+2	108	.	G	.	.	.	DP=46;AD=46	DP	23	23
+2	109	.	A	.	.	.	DP=46;AD=46	DP	23	23
+2	110	.	C	.	.	.	DP=46;AD=46	DP	23	23
+2	111	.	G	.	.	.	DP=46;AD=46	DP	23	23
+2	112	.	A	.	.	.	DP=46;AD=46	DP	23	23
+2	113	.	G	.	.	.	DP=46;AD=46	DP	23	23
+2	114	.	C	.	.	.	DP=46;AD=46	DP	23	23
+2	115	.	A	.	.	.	DP=46;AD=46	DP	23	23
+2	116	.	A	.	.	.	DP=46;AD=46	DP	23	23
+2	117	.	T	.	.	.	DP=46;AD=46	DP	23	23
+2	118	.	C	.	.	.	DP=46;AD=46	DP	23	23
+2	119	.	C	.	.	.	DP=46;AD=46	DP	23	23
+2	120	.	A	.	.	.	DP=46;AD=46	DP	23	23
+2	121	.	C	.	.	.	DP=46;AD=46	DP	23	23
+2	122	.	A	.	.	.	DP=46;AD=46	DP	23	23
+2	123	.	G	.	.	.	DP=46;AD=46	DP	23	23
+2	124	.	A	.	.	.	DP=46;AD=46	DP	23	23
+2	125	.	C	.	.	.	DP=46;AD=46	DP	23	23
+2	126	.	C	.	.	.	DP=46;AD=45	DP	23	23
+2	127	.	T	.	.	.	DP=46;AD=46	DP	23	23
+2	128	.	A	.	.	.	DP=46;AD=46	DP	23	23
+2	129	.	G	.	.	.	DP=46;AD=46	DP	23	23
+2	130	.	G	.	.	.	DP=46;AD=46	DP	23	23
+2	131	.	C	.	.	.	DP=46;AD=46	DP	23	23
+2	132	.	C	.	.	.	DP=46;AD=46	DP	23	23
+2	133	.	C	.	.	.	DP=46;AD=46	DP	23	23
+2	134	.	A	.	.	.	DP=46;AD=46	DP	23	23
+2	135	.	T	.	.	.	DP=46;AD=46	DP	23	23
+2	136	.	C	.	.	.	DP=46;AD=46	DP	23	23
+2	137	.	G	.	.	.	DP=46;AD=46	DP	23	23
+2	138	.	A	.	.	.	DP=46;AD=46	DP	23	23
+2	139	.	A	.	.	.	DP=46;AD=46	DP	23	23
+2	140	.	G	.	.	.	DP=46;AD=46	DP	23	23
+2	141	.	C	.	.	.	DP=46;AD=46	DP	23	23
+2	142	.	G	.	.	.	DP=46;AD=46	DP	23	23
+2	143	.	T	.	.	.	DP=46;AD=46	DP	23	23
+2	144	.	C	.	.	.	DP=46;AD=46	DP	23	23
+2	145	.	T	.	.	.	DP=46;AD=46	DP	23	23
+2	146	.	T	.	.	.	DP=46;AD=46	DP	23	23
+2	147	.	A	.	.	.	DP=46;AD=46	DP	23	23
+2	148	.	T	.	.	.	DP=46;AD=46	DP	23	23
+2	149	.	G	.	.	.	DP=46;AD=46	DP	23	23
+2	150	.	A	.	.	.	DP=46;AD=46	DP	23	23
+2	151	.	T	.	.	.	DP=46;AD=46	DP	23	23
+2	152	.	T	.	.	.	DP=46;AD=46	DP	23	23
+2	153	.	G	.	.	.	DP=46;AD=46	DP	23	23
+2	154	.	A	.	.	.	DP=46;AD=46	DP	23	23
+2	155	.	T	.	.	.	DP=46;AD=46	DP	23	23
+2	156	.	A	.	.	.	DP=46;AD=46	DP	23	23
+2	157	.	A	.	.	.	DP=46;AD=46	DP	23	23
+2	158	.	C	.	.	.	DP=46;AD=46	DP	23	23
+2	159	.	A	.	.	.	DP=46;AD=46	DP	23	23
+2	160	.	T	.	.	.	DP=46;AD=46	DP	23	23
+2	161	.	C	.	.	.	DP=46;AD=46	DP	23	23
+2	162	.	A	.	.	.	DP=46;AD=46	DP	23	23
+2	163	.	G	A	40	.	DP=46;AD=34,12;AF=0.261	GT:PS:FT:GQ:DP:AD:GL	0/0:.:.:40:23:23,0:-0.00,-6.89,-68.45	1|0:163:.:40:23:11,12:-28.67,0.00,-25.99
+2	164	.	A	.	.	.	DP=46;AD=46	DP	23	23
+2	165	.	G	.	.	.	DP=46;AD=46	DP	23	23
+2	166	.	G	.	.	.	DP=46;AD=46	DP	23	23
+2	167	.	G	.	.	.	DP=46;AD=46	DP	23	23
+2	168	.	G	.	.	.	DP=46;AD=46	DP	23	23
+2	169	.	G	.	.	.	DP=46;AD=46	DP	23	23
+2	170	.	A	.	.	.	DP=46;AD=46	DP	23	23
+2	171	.	T	.	.	.	DP=46;AD=46	DP	23	23
+2	172	.	G	.	.	.	DP=46;AD=46	DP	23	23
+2	173	.	G	.	.	.	DP=46;AD=46	DP	23	23
+2	174	.	G	.	.	.	DP=46;AD=46	DP	23	23
+2	175	.	A	.	.	.	DP=46;AD=46	DP	23	23
+2	176	.	G	.	.	.	DP=46;AD=45	DP	23	23
+2	177	.	G	.	.	.	DP=46;AD=46	DP	23	23
+2	178	.	T	.	.	.	DP=46;AD=46	DP	23	23
+2	179	.	C	.	.	.	DP=46;AD=46	DP	23	23
+2	180	.	C	.	.	.	DP=46;AD=46	DP	23	23
+2	181	.	T	.	.	.	DP=46;AD=46	DP	23	23
+2	182	.	G	A	40	.	DP=46;AD=34,12;AF=0.261	GT:PS:FT:GQ:DP:AD:GL	0/0:.:.:40:23:23,0:-0.00,-6.89,-68.45	1|0:163:.:40:23:11,12:-28.67,0.00,-25.99
+2	183	.	C	.	.	.	DP=46;AD=46	DP	23	23
+2	184	.	T	.	.	.	DP=46;AD=46	DP	23	23
+2	185	.	G	.	.	.	DP=46;AD=46	DP	23	23
+2	186	.	T	.	.	.	DP=46;AD=45	DP	23	23
+2	187	.	C	.	.	.	DP=46;AD=46	DP	23	23
+2	188	.	G	.	.	.	DP=46;AD=46	DP	23	23
+2	189	.	C	.	.	.	DP=46;AD=46	DP	23	23
+2	190	.	A	.	.	.	DP=46;AD=46	DP	23	23
+2	191	.	T	.	.	.	DP=46;AD=46	DP	23	23
+2	192	.	G	.	.	.	DP=46;AD=46	DP	23	23
+2	193	.	G	.	.	.	DP=46;AD=46	DP	23	23
+2	194	.	G	.	.	.	DP=46;AD=45	DP	23	23
+2	195	.	A	.	.	.	DP=46;AD=46	DP	23	23
+2	196	.	G	.	.	.	DP=46;AD=46	DP	23	23
+2	197	.	A	.	.	.	DP=46;AD=46	DP	23	23
+2	198	.	A	.	.	.	DP=46;AD=46	DP	23	23
+2	199	.	T	.	.	.	DP=46;AD=46	DP	23	23
+2	200	.	A	.	.	.	DP=46;AD=46	DP	23	23
+2	201	.	C	.	.	.	DP=46;AD=46	DP	23	23
+2	202	.	A	.	.	.	DP=34;AD=34	DP	23	11
+2	203	.	C	.	.	.	DP=34;AD=34	DP	23	11
+2	204	.	G	.	.	.	DP=34;AD=34	DP	23	11
+2	205	.	G	.	.	.	DP=34;AD=34	DP	23	11
+3	1	.	A	.	.	.	DP=40;AD=40	DP	20	20
+3	2	.	A	.	.	.	DP=40;AD=40	DP	20	20
+3	3	.	T	.	.	.	DP=40;AD=40	DP	20	20
+3	4	.	T	.	.	.	DP=40;AD=40	DP	20	20
+3	5	.	C	.	.	.	DP=40;AD=40	DP	20	20
+3	6	.	T	.	.	.	DP=40;AD=40	DP	20	20
+3	7	.	C	.	.	.	DP=40;AD=40	DP	20	20
+3	8	.	T	.	.	.	DP=40;AD=40	DP	20	20
+3	9	.	A	.	.	.	DP=40;AD=40	DP	20	20
+3	10	.	C	.	.	.	DP=40;AD=40	DP	20	20
+3	11	.	A	.	.	.	DP=40;AD=40	DP	20	20
+3	12	.	C	.	.	.	DP=40;AD=40	DP	20	20
+3	13	.	C	.	.	.	DP=40;AD=40	DP	20	20
+3	14	.	A	.	.	.	DP=40;AD=40	DP	20	20
+3	15	.	C	.	.	.	DP=40;AD=40	DP	20	20
+3	16	.	A	.	.	.	DP=40;AD=39	DP	20	20
+3	17	.	G	.	.	.	DP=40;AD=40	DP	20	20
+3	18	.	C	.	.	.	DP=40;AD=40	DP	20	20
+3	19	.	A	.	.	.	DP=40;AD=40	DP	20	20
+3	20	.	T	.	.	.	DP=40;AD=40	DP	20	20
+3	21	.	C	.	.	.	DP=40;AD=40	DP	20	20
+3	22	.	A	.	.	.	DP=40;AD=40	DP	20	20
+3	23	.	A	.	.	.	DP=40;AD=40	DP	20	20
+3	24	.	T	.	.	.	DP=40;AD=40	DP	20	20
+3	25	.	T	.	.	.	DP=40;AD=40	DP	20	20
+3	26	.	C	.	.	.	DP=40;AD=40	DP	20	20
+3	27	.	T	.	.	.	DP=40;AD=40	DP	20	20
+3	28	.	A	.	.	.	DP=40;AD=40	DP	20	20
+3	29	.	A	.	.	.	DP=40;AD=40	DP	20	20
+3	30	.	A	.	.	.	DP=40;AD=40	DP	20	20
+3	31	.	A	.	.	.	DP=40;AD=40	DP	20	20
+3	32	.	A	.	.	.	DP=40;AD=40	DP	20	20
+3	33	.	T	.	.	.	DP=40;AD=40	DP	20	20
+3	34	.	G	.	.	.	DP=40;AD=40	DP	20	20
+3	35	.	A	.	.	.	DP=40;AD=40	DP	20	20
+3	36	.	C	.	.	.	DP=40;AD=40	DP	20	20
+3	37	.	T	.	.	.	DP=40;AD=40	DP	20	20
+3	38	.	A	.	.	.	DP=40;AD=40	DP	20	20
+3	39	.	C	.	.	.	DP=40;AD=40	DP	20	20
+3	40	.	C	.	.	.	DP=40;AD=40	DP	20	20
+3	41	.	A	.	.	.	DP=40;AD=40	DP	20	20
+3	42	.	G	.	.	.	DP=40;AD=40	DP	20	20
+3	43	.	A	.	.	.	DP=40;AD=40	DP	20	20
+3	44	.	G	.	.	.	DP=40;AD=40	DP	20	20
+3	45	.	A	.	.	.	DP=40;AD=40	DP	20	20
+3	46	.	G	.	.	.	DP=40;AD=40	DP	20	20
+3	47	.	A	.	.	.	DP=40;AD=40	DP	20	20
+3	48	.	C	.	.	.	DP=40;AD=40	DP	20	20
+3	49	.	A	.	.	.	DP=40;AD=40	DP	20	20
+3	50	.	A	.	.	.	DP=40;AD=40	DP	20	20
+3	51	.	C	.	.	.	DP=40;AD=40	DP	20	20
+3	52	.	T	.	.	.	DP=40;AD=40	DP	20	20
+3	53	.	C	.	.	.	DP=40;AD=40	DP	20	20
+3	54	.	C	.	.	.	DP=40;AD=40	DP	20	20
+3	55	.	G	.	.	.	DP=40;AD=40	DP	20	20
+3	56	.	C	.	.	.	DP=40;AD=40	DP	20	20
+3	57	.	A	.	.	.	DP=40;AD=40	DP	20	20
+3	58	.	G	.	.	.	DP=40;AD=40	DP	20	20
+3	59	.	T	.	.	.	DP=40;AD=40	DP	20	20
+3	60	.	T	.	.	.	DP=40;AD=39	DP	20	20
+3	61	.	A	.	.	.	DP=40;AD=40	DP	20	20
+3	62	.	A	.	.	.	DP=40;AD=40	DP	20	20
+3	63	.	A	.	.	.	DP=40;AD=40	DP	20	20
+3	64	.	C	.	.	.	DP=40;AD=40	DP	20	20
+3	65	.	A	.	.	.	DP=40;AD=40	DP	20	20
+3	66	.	C	.	.	.	DP=40;AD=40	DP	20	20
+3	67	.	T	.	.	.	DP=40;AD=40	DP	20	20
+3	68	.	C	.	.	.	DP=40;AD=40	DP	20	20
+3	69	.	T	.	.	.	DP=40;AD=40	DP	20	20
+3	70	.	G	.	.	.	DP=40;AD=40	DP	20	20
+3	71	.	A	.	.	.	DP=40;AD=40	DP	20	20
+3	72	.	C	.	.	.	DP=40;AD=40	DP	20	20
+3	73	.	T	.	.	.	DP=40;AD=40	DP	20	20
+3	74	.	G	.	.	.	DP=40;AD=40	DP	20	20
+3	75	.	C	.	.	.	DP=40;AD=40	DP	20	20
+3	76	.	C	.	.	.	DP=40;AD=40	DP	20	20
+3	77	.	A	.	.	.	DP=40;AD=40	DP	20	20
+3	78	.	C	.	.	.	DP=40;AD=40	DP	20	20
+3	79	.	G	.	.	.	DP=40;AD=40	DP	20	20
+3	80	.	C	.	.	.	DP=40;AD=40	DP	20	20
+3	81	.	C	.	.	.	DP=40;AD=40	DP	20	20
+3	82	.	A	.	.	.	DP=40;AD=40	DP	20	20
+3	83	.	G	.	.	.	DP=40;AD=40	DP	20	20
+3	84	.	C	.	.	.	DP=40;AD=40	DP	20	20
+3	85	.	T	.	.	.	DP=40;AD=40	DP	20	20
+3	86	.	A	.	.	.	DP=40;AD=40	DP	20	20
+3	87	.	C	.	.	.	DP=40;AD=40	DP	20	20
+3	88	.	C	.	.	.	DP=40;AD=40	DP	20	20
+3	89	.	T	.	.	.	DP=40;AD=40	DP	20	20
+3	90	.	C	.	.	.	DP=40;AD=40	DP	20	20
+3	91	.	T	.	.	.	DP=40;AD=39	DP	20	20
+3	92	.	A	.	.	.	DP=40;AD=40	DP	20	20
+3	93	.	G	.	.	.	DP=40;AD=40	DP	20	20
+3	94	.	A	.	.	.	DP=40;AD=40	DP	20	20
+3	105	.	G	.	.	.	DP=30;AD=30	DP	17	13
+3	106	.	G	.	.	.	DP=30;AD=30	DP	17	13
+3	107	.	C	.	.	.	DP=30;AD=30	DP	17	13
+3	108	.	T	.	.	.	DP=30;AD=30	DP	17	13
+3	109	.	G	.	.	.	DP=30;AD=30	DP	17	13
+3	110	.	C	.	.	.	DP=30;AD=30	DP	17	13
+3	111	.	T	.	.	.	DP=30;AD=30	DP	17	13
+3	112	.	G	.	.	.	DP=30;AD=30	DP	17	13
+3	113	.	G	.	.	.	DP=30;AD=30	DP	17	13
+3	114	.	A	.	.	.	DP=30;AD=30	DP	17	13
+3	115	.	C	.	.	.	DP=30;AD=30	DP	17	13
+3	116	.	G	.	.	.	DP=30;AD=30	DP	17	13
+3	117	.	T	.	.	.	DP=30;AD=30	DP	17	13
+3	118	.	C	.	.	.	DP=30;AD=30	DP	17	13
+3	119	.	C	.	.	.	DP=30;AD=30	DP	17	13
+3	120	.	T	.	.	.	DP=30;AD=30	DP	17	13
+3	121	.	T	.	.	.	DP=30;AD=30	DP	17	13
+3	122	.	C	.	.	.	DP=30;AD=30	DP	17	13
+3	123	.	G	.	.	.	DP=30;AD=30	DP	17	13
+3	124	.	C	.	.	.	DP=30;AD=30	DP	17	13
+3	125	.	T	.	.	.	DP=30;AD=30	DP	17	13
+3	126	.	C	.	.	.	DP=30;AD=30	DP	17	13
+3	127	.	G	.	.	.	DP=30;AD=30	DP	17	13
+3	128	.	G	.	.	.	DP=30;AD=30	DP	17	13
+3	129	.	T	.	.	.	DP=30;AD=30	DP	17	13
+3	130	.	A	.	.	.	DP=30;AD=30	DP	17	13
+3	131	.	C	.	.	.	DP=30;AD=30	DP	17	13
+3	132	.	C	.	.	.	DP=30;AD=29	DP	17	13
+3	133	.	T	.	.	.	DP=30;AD=30	DP	17	13
+3	134	.	T	.	.	.	DP=30;AD=30	DP	17	13
+3	135	.	G	.	.	.	DP=30;AD=30	DP	17	13
+3	136	.	A	.	.	.	DP=30;AD=30	DP	17	13
+3	137	.	C	.	.	.	DP=30;AD=30	DP	17	13
+3	138	.	T	.	.	.	DP=30;AD=30	DP	17	13
+3	139	.	G	.	.	.	DP=30;AD=30	DP	17	13
+3	140	.	G	.	.	.	DP=30;AD=30	DP	17	13
+3	141	.	A	.	.	.	DP=30;AD=30	DP	17	13
+3	142	.	T	.	.	.	DP=30;AD=30	DP	17	13
+3	143	.	T	.	.	.	DP=30;AD=30	DP	17	13
+3	144	.	A	.	.	.	DP=30;AD=30	DP	17	13
+3	145	.	T	C	40	.	DP=30;AD=16,14;AF=0.467	GT:PS:FT:GQ:DP:AD:GL	1|0:145:.:40:17:8,9:-20.29,0.00,-17.57	1|0:145:.:40:13:8,5:-10.39,-0.00,-18.77
+3	146	.	A	.	.	.	DP=30;AD=30	DP	17	13
+3	147	.	T	.	.	.	DP=30;AD=30	DP	17	13
+3	148	.	A	.	.	.	DP=30;AD=30	DP	17	13
+3	149	.	G	.	.	.	DP=30;AD=30	DP	17	13
+3	150	.	C	.	.	.	DP=30;AD=30	DP	17	13
+3	151	.	A	.	.	.	DP=30;AD=30	DP	17	13
+3	152	.	T	.	.	.	DP=30;AD=30	DP	17	13
+3	153	.	T	.	.	.	DP=30;AD=30	DP	17	13
+3	154	.	C	.	.	.	DP=30;AD=30	DP	17	13
+3	155	.	C	.	.	.	DP=30;AD=30	DP	17	13
+3	156	.	T	.	.	.	DP=30;AD=29	DP	17	13
+3	157	.	T	G	40	.	DP=30;AD=16,14;AF=0.467	GT:PS:FT:GQ:DP:AD:GL	1|0:145:.:40:17:8,9:-20.29,0.00,-17.57	1|0:145:.:40:13:8,5:-10.39,-0.00,-18.77
+3	158	.	A	.	.	.	DP=30;AD=30	DP	17	13
+3	159	.	G	.	.	.	DP=30;AD=30	DP	17	13
+3	160	.	T	.	.	.	DP=30;AD=30	DP	17	13
+3	161	.	T	.	.	.	DP=30;AD=30	DP	17	13
+3	162	.	C	.	.	.	DP=30;AD=30	DP	17	13
+3	163	.	A	.	.	.	DP=30;AD=30	DP	17	13
+3	164	.	C	.	.	.	DP=30;AD=30	DP	17	13
+3	165	.	G	.	.	.	DP=30;AD=30	DP	17	13
+3	166	.	G	.	.	.	DP=30;AD=30	DP	17	13
+3	167	.	C	.	.	.	DP=30;AD=30	DP	17	13
+3	168	.	C	.	.	.	DP=30;AD=30	DP	17	13
+3	169	.	A	.	.	.	DP=30;AD=30	DP	17	13
+3	170	.	A	.	.	.	DP=30;AD=30	DP	17	13
+3	171	.	T	.	.	.	DP=30;AD=30	DP	17	13
+3	172	.	A	.	.	.	DP=30;AD=30	DP	17	13
+3	173	.	T	.	.	.	DP=30;AD=30	DP	17	13
+3	174	.	C	.	.	.	DP=30;AD=30	DP	17	13
+3	175	.	G	.	.	.	DP=30;AD=30	DP	17	13
+3	176	.	C	.	.	.	DP=30;AD=30	DP	17	13
+3	177	.	C	.	.	.	DP=30;AD=30	DP	17	13
+3	178	.	A	.	.	.	DP=30;AD=30	DP	17	13
+3	179	.	A	.	.	.	DP=30;AD=30	DP	17	13
+3	180	.	C	.	.	.	DP=30;AD=30	DP	17	13
+3	181	.	C	.	.	.	DP=30;AD=30	DP	17	13
+3	182	.	G	.	.	.	DP=30;AD=30	DP	17	13
+3	183	.	T	.	.	.	DP=30;AD=30	DP	17	13
+3	184	.	T	.	.	.	DP=30;AD=30	DP	17	13
+3	185	.	G	.	.	.	DP=30;AD=30	DP	17	13
+3	186	.	A	.	.	.	DP=30;AD=30	DP	17	13
+3	187	.	G	.	.	.	DP=30;AD=30	DP	17	13
+3	188	.	T	.	.	.	DP=30;AD=30	DP	17	13
+3	189	.	G	.	.	.	DP=30;AD=30	DP	17	13
+3	190	.	A	.	.	.	DP=30;AD=30	DP	17	13
+3	191	.	G	.	.	.	DP=30;AD=30	DP	17	13
+3	192	.	T	.	.	.	DP=30;AD=30	DP	17	13
+3	193	.	T	.	.	.	DP=30;AD=30	DP	17	13
+3	194	.	T	.	.	.	DP=30;AD=30	DP	17	13
+3	195	.	A	.	.	.	DP=30;AD=30	DP	17	13
+3	196	.	G	.	.	.	DP=30;AD=30	DP	17	13
+3	197	.	T	.	.	.	DP=30;AD=30	DP	17	13
+3	198	.	G	.	.	.	DP=30;AD=30	DP	17	13
+3	199	.	A	.	.	.	DP=30;AD=30	DP	17	13
+3	200	.	A	.	.	.	DP=30;AD=30	DP	17	13
+3	201	.	C	.	.	.	DP=30;AD=30	DP	17	13
+3	202	.	C	.	.	.	DP=30;AD=30	DP	17	13
+3	203	.	G	.	.	.	DP=30;AD=30	DP	17	13
+3	204	.	G	.	.	.	DP=30;AD=30	DP	17	13
Binary file test-data/gstacks/catalog.fa.gz has changed
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/gstacks/gstacks.log	Mon Jul 01 10:57:08 2019 -0400
@@ -0,0 +1,34 @@
+gstacks v2.4, executed 2019-06-18 10:34:45 (zlib-1.2.11)
+gstacks -P stacks_outputs -M denovo_map/popmap_cstacks.tsv
+Locus/sample distributions will be written to 'stacks_outputs/gstacks.log.distribs'.
+
+Configuration for this run:
+  Input mode: denovo
+  Population map: 'denovo_map/popmap_cstacks.tsv'
+  Input files: 2, e.g. 'stacks_outputs/PopA_01.matches.bam'
+  Output to: 'stacks_outputs/'
+  Model: marukilow (var_alpha: 0.01, gt_alpha: 0.05)
+
+Reading BAM headers...
+Processing all loci...
+20%...
+50%...
+100%
+
+Attempted to assemble and align paired-end reads for 3 loci:
+  0 loci had no or almost no paired-end reads (0.0%);
+  0 loci had paired-end reads that couldn't be assembled into a contig (0.0%);
+  For the remaining 3 loci (100.0%), a paired-end contig was assembled;
+    Average contig size was 204.3 bp;
+  0 paired-end contigs overlapped the forward region (0.0%)
+    Mean overlap: -nanbp; mean size of overlapped loci after merging: -nan;
+  Out of 252 paired-end reads in these loci (mean 84.0 reads per locus),
+    252 were successfuly aligned (100.0%);
+  Mean insert length was -nan, stdev: nan (based on aligned reads in overlapped loci).
+
+Genotyped 3 loci:
+  effective per-sample coverage: mean=31.0x, stdev=1.0x, min=30.0x, max=32.0x
+  mean number of sites per locus: 194.3
+  a consistent phasing was found for 5 of out 5 (100.0%) diploid loci needing phasing
+
+gstacks is done.
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/gstacks/gstacks.log.distribs	Mon Jul 01 10:57:08 2019 -0400
@@ -0,0 +1,43 @@
+# Note: Individual distributions can be extracted using the `stacks-dist-extract` utility.
+#       e.g. `stacks-dist-extract gstacks.log.distribs dist_name`
+
+BEGIN effective_coverages_per_sample
+# For mean_cov_ns, the coverage at each locus is weighted by the number of
+# samples present at that locus (i.e. coverage at shared loci counts more).
+sample	n_loci	n_used_fw_reads	mean_cov	mean_cov_ns
+PopA_01	3	96	32.000	32.000
+PopA_02	3	90	30.000	30.000
+END effective_coverages_per_sample
+
+BEGIN phasing_rates_per_sample
+sample	n_gts	n_multisnp_hets	n_phased	misphasing_rate
+PopA_01	3	2	2	0.000
+PopA_02	3	3	3	0.000
+END phasing_rates_per_sample
+
+BEGIN clockings
+Num. threads: 1
+Parallel time: 0.0
+Average thread time spent:
+     0.0  reading (3.1%)
+     0.0  processing (95.2%)
+             0.0 pre-alignments block (72.2%)
+             0.0  reformatting fw-reads (0.1%)
+             0.0  assembling (22.2%)
+             0.0  initializing alignments (5.4%)
+             0.0  aligning (42.9%)
+             0.0  merging read pairs (1.5%)
+             0.0 post-alignments block (21.2%)
+             0.0  filtering reads (0.0%)
+             0.0  counting nucleotides (3.5%)
+             0.0  genotyping (1.9%)
+             0.0  haplotyping (1.0%)
+             0.0  computing consensus (0.1%)
+             0.0  building_fa (0.1%)
+             0.0  building_vcf (14.6%)
+     0.0  writing_fa (0.1%)
+     0.0  writing_vcf (1.3%)
+     0.0  clocking (0.2%)
+Total time spent writing vcf: 0.0 (1.3%)
+VCFwrite block size: mean=1.0(n=3); max=1
+END clockings
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/kmerfilter/kfreqdist.tsv	Mon Jul 01 10:57:08 2019 -0400
@@ -0,0 +1,3 @@
+# KmerFrequency	Count
+1	408
+2	136
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/kmerfilter/kmerfilter.log	Mon Jul 01 10:57:08 2019 -0400
@@ -0,0 +1,22 @@
+Using a kmer size of 16
+Filtering out reads by identifying rare kmers: On.
+  A kmer is considered rare when its coverage is at 15% or below the median kmer coverage for the read.
+  A read is dropped when it contains 13 or more rare kmers in a row.
+Filtering out reads by identifying abundant kmers: On.
+  Kmer is considered abundant when it occurs 20000 or more times.
+  A read is dropped when it contains 80% or more abundant kmers.
+Normalizing read depth: Off.
+Found 1 input file(s).
+Found 0 paired input file(s).
+Generating kmer distribution...
+Generating kmers from file 1 of 1 [R1_0001.fastq]
+540 unique k-mers recorded.
+Filtering reads by kmer frequency...
+Processing file 1 of 1 [R1_0001.fastq]
+  5 total reads; -0 rare k-mer reads; -0 abundant k-mer reads; 5 retained reads.
+Outputing details to log: 'stacks_outputs/kmer_filter.log'
+
+5 total sequences;
+  0 rare k-mer reads;
+  0 abundant k-mer reads;
+5 retained reads.
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/populations/blacklist.tsv	Mon Jul 01 10:57:08 2019 -0400
@@ -0,0 +1,1 @@
+666
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/populations/populations.fixed.phylip	Mon Jul 01 10:57:08 2019 -0400
@@ -0,0 +1,3 @@
+1	0
+1
+# Stacks v2.4;  Phylip sequential; June 17, 2019
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/populations/populations.fixed.phylip.log	Mon Jul 01 10:57:08 2019 -0400
@@ -0,0 +1,2 @@
+# Stacks v2.4;  Phylip sequential; June 17, 2019
+# Seq Pos	Locus ID	Column	Population
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/populations/populations.fst_summary.tsv	Mon Jul 01 10:57:08 2019 -0400
@@ -0,0 +1,1 @@
+	1
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/populations/populations.haplotypes.tsv	Mon Jul 01 10:57:08 2019 -0400
@@ -0,0 +1,4 @@
+# Catalog Locus ID	Cnt	PopA_01	PopA_02
+1	2	AC/CA	AC/CA
+2	2	GG/GG	AA/GG
+3	2	CG/TT	CG/TT
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/populations/populations.haps.genepop	Mon Jul 01 10:57:08 2019 -0400
@@ -0,0 +1,5 @@
+Stacks v2.4; GenePop v4.1.3; June 17, 2019
+1,2,3
+pop
+PopA_01,	0102	0102	0101
+PopA_02,	0102	0102	0102
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/populations/populations.haps.radpainter	Mon Jul 01 10:57:08 2019 -0400
@@ -0,0 +1,4 @@
+PopA_01	PopA_02
+AC/CA	AC/CA
+CG/TT	CG/TT
+GG	AA/GG
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/populations/populations.haps.vcf	Mon Jul 01 10:57:08 2019 -0400
@@ -0,0 +1,18 @@
+##fileformat=VCFv4.2
+##fileDate=20190617
+##source="Stacks v2.4"
+##INFO=<ID=AD,Number=R,Type=Integer,Description="Total Depth for Each Allele">
+##INFO=<ID=AF,Number=A,Type=Float,Description="Allele Frequency">
+##INFO=<ID=DP,Number=1,Type=Integer,Description="Total Depth">
+##INFO=<ID=NS,Number=1,Type=Integer,Description="Number of Samples With Data">
+##FORMAT=<ID=AD,Number=R,Type=Integer,Description="Allele Depth">
+##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Read Depth">
+##FORMAT=<ID=HQ,Number=2,Type=Integer,Description="Haplotype Quality">
+##FORMAT=<ID=GL,Number=G,Type=Float,Description="Genotype Likelihood">
+##FORMAT=<ID=GQ,Number=1,Type=Integer,Description="Genotype Quality">
+##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
+##INFO=<ID=loc_strand,Number=1,Type=Character,Description="Genomic strand the corresponding Stacks locus aligns on">
+#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	PopA_01	PopA_02
+1	1	.	AC	CA	.	PASS	snp_columns=34,89	GT	0/1	0/1
+2	1	.	CG	TT	.	PASS	snp_columns=145,157	GT	0/1	0/1
+3	1	.	GG	AA	.	PASS	snp_columns=163,182	GT	0/0	0/1
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/populations/populations.hapstats.tsv	Mon Jul 01 10:57:08 2019 -0400
@@ -0,0 +1,5 @@
+# 1	PopA_01,PopA_02
+# Locus ID	Chr	BP	Pop ID	N	Haplotype Cnt	Gene Diversity	Smoothed Gene Diversity	Smoothed Gene Diversity P-value	Haplotype Diversity	Smoothed Haplotype Diversity	Smoothed Haplotype Diversity P-value	HWE P-value	HWE P-value SE	Haplotypes
+1	un	1	1	4	2	0.66667	0.00000	0.00000	1.33333	0.00000	0.00000	0.00000	0.00000	AC:2;CA:2
+2	un	205	1	4	2	0.50000	0.00000	0.00000	1.00000	0.00000	0.00000	0.00000	0.00000	AA:1;GG:3
+3	un	410	1	4	2	0.66667	0.00000	0.00000	1.33333	0.00000	0.00000	0.00000	0.00000	CG:2;TT:2
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/populations/populations.hzar.csv	Mon Jul 01 10:57:08 2019 -0400
@@ -0,0 +1,3 @@
+# Stacks v2.4;  HZAR v0.2-5; June 18, 2019
+Population,Distance,1_33.A,1_33.B,1_33.N,1_88.A,1_88.B,1_88.N,2_162.A,2_162.B,2_162.N,2_181.A,2_181.B,2_181.N,3_144.A,3_144.B,3_144.N,3_156.A,3_156.B,3_156.N
+1,0,0.5,0.5,4,0.5,0.5,4,0.75,0.25,4,0.75,0.25,4,0.5,0.5,4,0.5,0.5,4
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/populations/populations.loci.fa	Mon Jul 01 10:57:08 2019 -0400
@@ -0,0 +1,7 @@
+# Stacks version 2.4; June 17, 2019
+>CLocus_1
+AATTCGTTTGCTGCTTCAGGAATCTCTCGTATAATCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGAGAGACNNNNNNNNNNCGTCAGAGGGCTTATATCGTGAGTGATAGCAGCAGTTTCTCTCTACCACATAGTTATACACCATTGGGCCAGCTCGTTGAAAACTACTGATGCTGATCGG
+>CLocus_2
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTGACTGCCACGCCAGCTACCTCTAGANNNNNNNNNNGGCTGCTGGACGTCCTTCGCTCGGTACCTTGACTGGATTATATAGCATTCCTTAGTTCACGGCCAATATCGCCAACCGTTGAGTGAGTTTAGTGAACCGG
+>CLocus_3
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTATNNNNNNNNNNTACGACGAGCAATCCACAGACCTAGGCCCATCGAAGCGTCTTATGATTGATAACATCAGAGGGGGATGGGAGGTCCTGCTGTCGCATGGGAGAATACACGG
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/populations/populations.log	Mon Jul 01 10:57:08 2019 -0400
@@ -0,0 +1,47 @@
+populations v2.4, executed 2019-06-18 10:34:45 (zlib-1.2.11)
+populations -P stacks_outputs -M denovo_map/popmap_cstacks.tsv
+Locus/sample distributions will be written to 'stacks_outputs/populations.log.distribs'.
+populations parameters selected:
+  Percent samples limit per population: 0
+  Locus Population limit: 1
+  Percent samples overall: 0
+  Minor allele frequency cutoff: 0
+  Maximum observed heterozygosity cutoff: 1
+  Applying Fst correction: none.
+  Pi/Fis kernel smoothing: off
+  Fstats kernel smoothing: off
+  Bootstrap resampling: off
+
+Parsing population map...
+The population map contained 2 samples, 1 population(s), 1 group(s).
+Working on 2 samples.
+Working on 1 population(s):
+    1: PopA_01, PopA_02
+Working on 1 group(s) of populations:
+    defaultgrp: 1
+
+Genotyping markers will be written to 'stacks_outputs/populations.markers.tsv'
+Raw Genotypes/Haplotypes will be written to 'stacks_outputs/populations.haplotypes.tsv'
+Population-level summary statistics will be written to 'stacks_outputs/populations.sumstats.tsv'
+Population-level haplotype summary statistics will be written to 'stacks_outputs/populations.hapstats.tsv'
+
+Processing data in batches:
+  * load a batch of catalog loci and apply filters
+  * compute SNP- and haplotype-wise per-population statistics
+  * write the above statistics in the output files
+  * export the genotypes/haplotypes in specified format(s)
+More details in 'stacks_outputs/populations.log.distribs'.
+Now processing...
+Batch 1 
+
+Removed 0 loci that did not pass sample/population constraints from 3 loci.
+Kept 3 loci, composed of 613 sites; 0 of those sites were filtered, 6 variant sites remained.
+Number of loci with PE contig: 3.00 (100.0%);
+  Mean length of loci: 194.33bp (stderr 0.33);
+Number of loci with SE/PE overlap: 0.00 (0.0%);
+  Mean length of overlapping loci: -nanbp (stderr -0.00); mean overlap: -nanbp (stderr -0.00);
+Mean genotyped sites per locus: 194.33bp (stderr 0.33).
+
+Population summary statistics (more detail in populations.sumstats_summary.tsv):
+  1: 2 samples per locus; pi: 0.61111; all/variant/polymorphic sites: 583/6/6; private alleles: 0
+Populations is done.
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/populations/populations.log.distribs	Mon Jul 01 10:57:08 2019 -0400
@@ -0,0 +1,42 @@
+# Note: Individual distributions can be extracted using the `stacks-dist-extract` utility.
+#       e.g. `stacks-dist-extract populations.log.distribs dist_name`
+
+BEGIN batch_progress
+Batch 1: analyzed 3 loci; filtered 0 loci; 3 loci seen.
+END batch_progress
+
+BEGIN samples_per_loc_prefilters
+# Distribution of valid samples matched to a catalog locus prior to filtering.
+n_samples	n_loci
+2	3
+END samples_per_loc_prefilters
+
+BEGIN missing_samples_per_loc_prefilters
+# Distribution of missing samples for each catalog locus prior to filtering.
+# Absent samples at locus	Count
+0	3
+END missing_samples_per_loc_prefilters
+
+BEGIN snps_per_loc_prefilters
+# Distribution of the number of SNPs per catalog locus prior to filtering.
+n_snps	n_loci
+2	3
+END snps_per_loc_prefilters
+
+BEGIN samples_per_loc_postfilters
+# Distribution of valid samples matched to a catalog locus after filtering.
+n_samples	n_loci
+2	3
+END samples_per_loc_postfilters
+
+BEGIN missing_samples_per_loc_postfilters
+# Distribution of missing samples for each catalog locus after filtering.
+# Absent samples at locus	Count
+0	3
+END missing_samples_per_loc_postfilters
+
+BEGIN snps_per_loc_postfilters
+# Distribution of the number of SNPs per catalog locus (after filtering).
+n_snps	n_loci
+2	3
+END snps_per_loc_postfilters
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/populations/populations.markers.tsv	Mon Jul 01 10:57:08 2019 -0400
@@ -0,0 +1,4 @@
+# Catalog Locus ID		Total Genotypes	Max	Genotype Freqs	F	Mean Log Likelihood	Genotype Map	
+1		2	100.00000	ab:2(100.0%);	0.00000	1.00000	AC:a;CA:b;	
+2		2	50.00000	aa:1(50.0%);ab:1(50.0%);	0.00000	1.00000	AA:b;GG:a;	
+3		2	100.00000	ab:2(100.0%);	0.00000	1.00000	CG:a;TT:b;	
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/populations/populations.phistats_summary.tsv	Mon Jul 01 10:57:08 2019 -0400
@@ -0,0 +1,5 @@
+# Phi_st Means
+	1
+
+# Fst' Means
+	1
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/populations/populations.plink.map	Mon Jul 01 10:57:08 2019 -0400
@@ -0,0 +1,7 @@
+# Stacks v2.4;  PLINK v1.07; June 17, 2019
+un	1_33	0	34
+un	1_88	0	89
+un	2_144	0	349
+un	2_156	0	361
+un	3_162	0	571
+un	3_181	0	590
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/populations/populations.plink.ped	Mon Jul 01 10:57:08 2019 -0400
@@ -0,0 +1,3 @@
+# Stacks v2.4;  PLINK v1.07; June 17, 2019
+1	PopA_01	0	0	0	0	A	C	A	C	C	T	G	T	G	G	G	G
+1	PopA_02	0	0	0	0	A	C	A	C	C	T	G	T	A	G	A	G
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/populations/populations.samples-raw.fa	Mon Jul 01 10:57:08 2019 -0400
@@ -0,0 +1,25 @@
+# Stacks version 2.4; June 17, 2019
+>CLocus_1_Sample_1_Locus_1_Allele_0 [PopA_01]
+AATTCGTTTGCTGCTTCAGGAATCTCTCGTATAATCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGCGAGACNNNNNNNNNNCGTCAGAGGGCTTATATCGTGAGTGATAGCAGCAGTTTCTCTCTACCACATAGTTATACACCATTGGGCCAGCTCGTTGAAAACTACTGATGCTGATCGG
+>CLocus_1_Sample_1_Locus_1_Allele_1 [PopA_01]
+AATTCGTTTGCTGCTTCAGGAATCTCTCGTATACTCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGAGAGACNNNNNNNNNNCGTCAGAGGGCTTATATCGTGAGTGATAGCAGCAGTTTCTCTCTACCACATAGTTATACACCATTGGGCCAGCTCGTTGAAAACTACTGATGCTGATCGG
+>CLocus_1_Sample_2_Locus_1_Allele_0 [PopA_02]
+AATTCGTTTGCTGCTTCAGGAATCTCTCGTATAATCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGCGAGACNNNNNNNNNNCGTCAGAGGGCTTATATCGTGAGTGATAGCAGCAGTTTCTCTCTACCACATAGTTATACACCATTGGGCCAGCTCGTTGAAAACTACTGATGCTGATCGG
+>CLocus_1_Sample_2_Locus_1_Allele_1 [PopA_02]
+AATTCGTTTGCTGCTTCAGGAATCTCTCGTATACTCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGAGAGACNNNNNNNNNNCGTCAGAGGGCTTATATCGTGAGTGATAGCAGCAGTTTCTCTCTACCACATAGTTATACACCATTGGGCCAGCTCGTTGAAAACTACTGATGCTGATCGG
+>CLocus_2_Sample_1_Locus_2_Allele_0 [PopA_01]
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTGACTGCCACGCCAGCTACCTCTAGANNNNNNNNNNGGCTGCTGGACGTCCTTCGCTCGGTACCTTGACTGGATTACATAGCATTCCTGAGTTCACGGCCAATATCGCCAACCGTTGAGTGAGTTTAGTGAACCGG
+>CLocus_2_Sample_1_Locus_2_Allele_1 [PopA_01]
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTGACTGCCACGCCAGCTACCTCTAGANNNNNNNNNNGGCTGCTGGACGTCCTTCGCTCGGTACCTTGACTGGATTATATAGCATTCCTTAGTTCACGGCCAATATCGCCAACCGTTGAGTGAGTTTAGTGAACCGG
+>CLocus_2_Sample_2_Locus_2_Allele_0 [PopA_02]
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTGACTGCCACGCCAGCTACCTCTAGANNNNNNNNNNGGCTGCTGGACGTCCTTCGCTCGGTACCTTGACTGGATTACATAGCATTCCTGAGTTCACGGCCAATATCGCCAACCGTTGAGTGAGTTTAGTGAACCGG
+>CLocus_2_Sample_2_Locus_2_Allele_1 [PopA_02]
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTGACTGCCACGCCAGCTACCTCTAGANNNNNNNNNNGGCTGCTGGACGTCCTTCGCTCGGTACCTTGACTGGATTATATAGCATTCCTTAGTTCACGGCCAATATCGCCAACCGTTGAGTGAGTTTAGTGAACCGG
+>CLocus_3_Sample_1_Locus_3_Allele_0 [PopA_01]
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTATNNNNNNNNNNTACGACGAGCAATCCACAGACCTAGGCCCATCGAAGCGTCTTATGATTGATAACATCAGAGGGGGATGGGAGGTCCTGCTGTCGCATGGGAGAATACACGG
+>CLocus_3_Sample_1_Locus_3_Allele_1 [PopA_01]
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTATNNNNNNNNNNTACGACGAGCAATCCACAGACCTAGGCCCATCGAAGCGTCTTATGATTGATAACATCAGAGGGGGATGGGAGGTCCTGCTGTCGCATGGGAGAATACACGG
+>CLocus_3_Sample_2_Locus_3_Allele_0 [PopA_02]
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTATNNNNNNNNNNTACGACGAGCAATCCACAGACCTAGGCCCATCGAAGCGTCTTATGATTGATAACATCAAAGGGGGATGGGAGGTCCTACTGTCGCATGGGAGAATACACGG
+>CLocus_3_Sample_2_Locus_3_Allele_1 [PopA_02]
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTATNNNNNNNNNNTACGACGAGCAATCCACAGACCTAGGCCCATCGAAGCGTCTTATGATTGATAACATCAGAGGGGGATGGGAGGTCCTGCTGTCGCATGGGAGAATACACGG
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/populations/populations.samples.fa	Mon Jul 01 10:57:08 2019 -0400
@@ -0,0 +1,25 @@
+# Stacks version 2.4; June 17, 2019
+>CLocus_1_Sample_1_Locus_1_Allele_0 [PopA_01]
+AATTCGTTTGCTGCTTCAGGAATCTCTCGTATAATCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGCGAGACNNNNNNNNNNCGTCAGAGGGCTTATATCGTGAGTGATAGCAGCAGTTTCTCTCTACCACATAGTTATACACCATTGGGCCAGCTCGTTGAAAACTACTGATGCTGATCGG
+>CLocus_1_Sample_1_Locus_1_Allele_1 [PopA_01]
+AATTCGTTTGCTGCTTCAGGAATCTCTCGTATACTCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGAGAGACNNNNNNNNNNCGTCAGAGGGCTTATATCGTGAGTGATAGCAGCAGTTTCTCTCTACCACATAGTTATACACCATTGGGCCAGCTCGTTGAAAACTACTGATGCTGATCGG
+>CLocus_1_Sample_2_Locus_1_Allele_0 [PopA_02]
+AATTCGTTTGCTGCTTCAGGAATCTCTCGTATAATCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGCGAGACNNNNNNNNNNCGTCAGAGGGCTTATATCGTGAGTGATAGCAGCAGTTTCTCTCTACCACATAGTTATACACCATTGGGCCAGCTCGTTGAAAACTACTGATGCTGATCGG
+>CLocus_1_Sample_2_Locus_1_Allele_1 [PopA_02]
+AATTCGTTTGCTGCTTCAGGAATCTCTCGTATACTCTGAGTATGTGCGTACGTACGCTATTTAGATGGATAACCGACGCTGCCAGACGAGAGACNNNNNNNNNNCGTCAGAGGGCTTATATCGTGAGTGATAGCAGCAGTTTCTCTCTACCACATAGTTATACACCATTGGGCCAGCTCGTTGAAAACTACTGATGCTGATCGG
+>CLocus_2_Sample_1_Locus_2_Allele_0 [PopA_01]
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTGACTGCCACGCCAGCTACCTCTAGANNNNNNNNNNGGCTGCTGGACGTCCTTCGCTCGGTACCTTGACTGGATTACATAGCATTCCTGAGTTCACGGCCAATATCGCCAACCGTTGAGTGAGTTTAGTGAACCGG
+>CLocus_2_Sample_1_Locus_2_Allele_1 [PopA_01]
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTGACTGCCACGCCAGCTACCTCTAGANNNNNNNNNNGGCTGCTGGACGTCCTTCGCTCGGTACCTTGACTGGATTATATAGCATTCCTTAGTTCACGGCCAATATCGCCAACCGTTGAGTGAGTTTAGTGAACCGG
+>CLocus_2_Sample_2_Locus_2_Allele_0 [PopA_02]
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTGACTGCCACGCCAGCTACCTCTAGANNNNNNNNNNGGCTGCTGGACGTCCTTCGCTCGGTACCTTGACTGGATTACATAGCATTCCTGAGTTCACGGCCAATATCGCCAACCGTTGAGTGAGTTTAGTGAACCGG
+>CLocus_2_Sample_2_Locus_2_Allele_1 [PopA_02]
+AATTCTCTACACCACAGCATCAATTCTAAAAATGACTACCAGAGAGACAACTCCGCAGTTAAACACTCTGACTGCCACGCCAGCTACCTCTAGANNNNNNNNNNGGCTGCTGGACGTCCTTCGCTCGGTACCTTGACTGGATTATATAGCATTCCTTAGTTCACGGCCAATATCGCCAACCGTTGAGTGAGTTTAGTGAACCGG
+>CLocus_3_Sample_1_Locus_3_Allele_0 [PopA_01]
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTATNNNNNNNNNNTACGACGAGCAATCCACAGACCTAGGCCCATCGAAGCGTCTTATGATTGATAACATCAGAGGGGGATGGGAGGTCCTGCTGTCGCATGGGAGAATACACGG
+>CLocus_3_Sample_1_Locus_3_Allele_1 [PopA_01]
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTATNNNNNNNNNNTACGACGAGCAATCCACAGACCTAGGCCCATCGAAGCGTCTTATGATTGATAACATCAGAGGGGGATGGGAGGTCCTGCTGTCGCATGGGAGAATACACGG
+>CLocus_3_Sample_2_Locus_3_Allele_0 [PopA_02]
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTATNNNNNNNNNNTACGACGAGCAATCCACAGACCTAGGCCCATCGAAGCGTCTTATGATTGATAACATCAAAGGGGGATGGGAGGTCCTACTGTCGCATGGGAGAATACACGG
+>CLocus_3_Sample_2_Locus_3_Allele_1 [PopA_02]
+AATTCGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTATNNNNNNNNNNTACGACGAGCAATCCACAGACCTAGGCCCATCGAAGCGTCTTATGATTGATAACATCAGAGGGGGATGGGAGGTCCTGCTGTCGCATGGGAGAATACACGG
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/populations/populations.snps.genepop	Mon Jul 01 10:57:08 2019 -0400
@@ -0,0 +1,5 @@
+# Stacks v2.4; GenePop v4.1.3; June 17, 2019
+1_33,1_88,2_144,2_156,3_162,3_181
+pop
+PopA_01,	0102	0102	0204	0304	0303	0303
+PopA_02,	0102	0102	0204	0304	0103	0103
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/populations/populations.snps.vcf	Mon Jul 01 10:57:08 2019 -0400
@@ -0,0 +1,21 @@
+##fileformat=VCFv4.2
+##fileDate=20190617
+##source="Stacks v2.4"
+##INFO=<ID=AD,Number=R,Type=Integer,Description="Total Depth for Each Allele">
+##INFO=<ID=AF,Number=A,Type=Float,Description="Allele Frequency">
+##INFO=<ID=DP,Number=1,Type=Integer,Description="Total Depth">
+##INFO=<ID=NS,Number=1,Type=Integer,Description="Number of Samples With Data">
+##FORMAT=<ID=AD,Number=R,Type=Integer,Description="Allele Depth">
+##FORMAT=<ID=DP,Number=1,Type=Integer,Description="Read Depth">
+##FORMAT=<ID=HQ,Number=2,Type=Integer,Description="Haplotype Quality">
+##FORMAT=<ID=GL,Number=G,Type=Float,Description="Genotype Likelihood">
+##FORMAT=<ID=GQ,Number=1,Type=Integer,Description="Genotype Quality">
+##FORMAT=<ID=GT,Number=1,Type=String,Description="Genotype">
+##INFO=<ID=loc_strand,Number=1,Type=Character,Description="Genomic strand the corresponding Stacks locus aligns on">
+#CHROM	POS	ID	REF	ALT	QUAL	FILTER	INFO	FORMAT	PopA_01	PopA_02
+1	34	.	A	C	.	PASS	NS=2;AF=0.500	GT:DP:AD:GQ:GL	0/1:18:9,9:40:-20.07,0.00,-20.07	0/1:12:6,6:40:-13.54,-0.00,-13.54
+1	89	.	A	C	.	PASS	NS=2;AF=0.500	GT:DP:AD:GQ:GL	0/1:18:9,9:40:-20.07,0.00,-20.07	0/1:12:6,6:40:-13.54,-0.00,-13.54
+2	145	.	C	T	.	PASS	NS=2;AF=0.500	GT:DP:AD:GQ:GL	0/1:17:9,8:40:-17.57,0.00,-20.29	0/1:13:5,8:40:-18.77,-0.00,-10.39
+2	157	.	G	T	.	PASS	NS=2;AF=0.500	GT:DP:AD:GQ:GL	0/1:17:9,8:40:-17.57,0.00,-20.29	0/1:13:5,8:40:-18.77,-0.00,-10.39
+3	163	.	G	A	.	PASS	NS=2;AF=0.250	GT:DP:AD:GQ:GL	0/0:23:23,0:40:-0.00,-6.89,-68.45	0/1:23:11,12:40:-28.67,0.00,-25.99
+3	182	.	G	A	.	PASS	NS=2;AF=0.250	GT:DP:AD:GQ:GL	0/0:23:23,0:40:-0.00,-6.89,-68.45	0/1:23:11,12:40:-28.67,0.00,-25.99
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/populations/populations.structure	Mon Jul 01 10:57:08 2019 -0400
@@ -0,0 +1,6 @@
+# Stacks v2.4;  Structure v2.3; June 17, 2019
+		1_33	1_88	2_144	2_156	3_162	3_181
+PopA_01	1	1	1	2	3	3	3
+PopA_01	1	2	2	4	4	3	3
+PopA_02	1	1	1	2	3	1	1
+PopA_02	1	2	2	4	4	3	3
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/populations/populations.sumstats.tsv	Mon Jul 01 10:57:08 2019 -0400
@@ -0,0 +1,8 @@
+# 1	PopA_01,PopA_02
+# Locus ID	Chr	BP	Col	Pop ID	P Nuc	Q Nuc	N	P	Obs Het	Obs Hom	Exp Het	Exp Hom	Pi	Smoothed Pi	Smoothed Pi P-value	Fis	Smoothed Fis	Smoothed Fis P-value	HWE P-value	Private
+1	un	34	33	1	A	C	2	0.50000000	1.00000	0.00000	0.50000	0.50000	0.66667	0.00000	0.00000	-0.50000	0.00000	0.00000	0.00000	0
+1	un	89	88	1	A	C	2	0.50000000	1.00000	0.00000	0.50000	0.50000	0.66667	0.00000	0.00000	-0.50000	0.00000	0.00000	0.00000	0
+2	un	367	162	1	G	A	2	0.75000000	0.50000	0.50000	0.37500	0.62500	0.50000	0.00000	0.00000	0.00000	0.00000	0.00000	0.00000	0
+2	un	386	181	1	G	A	2	0.75000000	0.50000	0.50000	0.37500	0.62500	0.50000	0.00000	0.00000	0.00000	0.00000	0.00000	0.00000	0
+3	un	554	144	1	C	T	2	0.50000000	1.00000	0.00000	0.50000	0.50000	0.66667	0.00000	0.00000	-0.50000	0.00000	0.00000	0.00000	0
+3	un	566	156	1	G	T	2	0.50000000	1.00000	0.00000	0.50000	0.50000	0.66667	0.00000	0.00000	-0.50000	0.00000	0.00000	0.00000	0
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/populations/populations.sumstats_summary.tsv	Mon Jul 01 10:57:08 2019 -0400
@@ -0,0 +1,6 @@
+# Variant positions
+# Pop ID	Private	Num_Indv	Var	StdErr	P	Var	StdErr	Obs_Het	Var	StdErr	Obs_Hom	Var	StdErr	Exp_Het	Var	StdErr	Exp_Hom	Var	StdErr	Pi	Var	StdErr	Fis	Var	StdErr
+1	0	2.00000	0.00000	0.00000	0.58333	0.01667	0.05270	0.83333	0.06667	0.10541	0.16667	0.06667	0.10541	0.45833	0.00417	0.02635	0.54167	0.00417	0.02635	0.61111	0.00741	0.03514	-0.33333	0.06667	0.00000
+# All positions (variant and fixed)
+# Pop ID	Private	Sites	Variant_Sites	Polymorphic_Sites	%Polymorphic_Loci	Num_Indv	Var	StdErr	P	Var	StdErr	Obs_Het	Var	StdErr	Obs_Hom	Var	StdErr	Exp_Het	Var	StdErr	Exp_Hom	Var	StdErr	Pi	Var	StdErr	Fis	Var	StdErr
+1	0	583	6	6	1.02916	2.00000	0.00000	0.00000	0.99571	0.00191	0.00181	0.00858	0.00766	0.00362	0.99142	0.00766	0.00362	0.00472	0.00218	0.00193	0.99528	0.00218	0.00193	0.00629	0.00387	0.00258	-0.00343	0.00171	0.00000
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/populations/populations.treemix	Mon Jul 01 10:57:08 2019 -0400
@@ -0,0 +1,8 @@
+# Stacks v2.4;  TreeMix v1.1; June 17, 2019
+1
+2,2
+2,2
+2,2
+2,2
+3,1
+3,1
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/populations/populations.var.phylip	Mon Jul 01 10:57:08 2019 -0400
@@ -0,0 +1,3 @@
+1	6
+1	MMYKRR
+# Stacks v2.4;  Phylip sequential; June 17, 2019
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/populations/populations.var.phylip.log	Mon Jul 01 10:57:08 2019 -0400
@@ -0,0 +1,8 @@
+# Stacks v2.4;  Phylip sequential; June 17, 2019
+# Seq Pos	Locus ID	Column	Population
+0	1	33	1:M,
+1	1	88	1:M,
+2	2	144	1:Y,
+3	2	156	1:K,
+4	3	162	1:R,
+5	3	181	1:R,
--- /dev/null	Thu Jan 01 00:00:00 1970 +0000
+++ b/test-data/procrad/R1.fa.discards	Mon Jul 01 10:57:08 2019 -0400
@@ -0,0 +1,9556 @@
+>lane1_fakedata0_11 1:N:0:
+GGTTGTAATTTGGCTTGCAACGCAAGTGACGATTCCCACGGACATAACTGATCTAAGTAACTTCCAAATCTGGGAATGGGATTTCATAATTAAGGACTAT
+>lane1_fakedata1_0 1:N:0:
+GGTGTGAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGCTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_1 1:N:0:
+GGTGTGAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_2 1:N:0:
+GGTGTGAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_3 1:N:0:
+GGTGTGAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_4 1:N:0:
+GGTGTGAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_5 1:N:0:
+GGTGTGAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_6 1:N:0:
+GGTGTGAATTACGTCCGCGGTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_7 1:N:0:
+GGTGTGAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_8 1:N:0:
+GGTGTGAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_9 1:N:0:
+GGTGTGAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_0 1:N:0:
+TTTAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
+>lane1_fakedata1_1 1:N:0:
+TTTAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
+>lane1_fakedata1_2 1:N:0:
+TTTAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
+>lane1_fakedata1_3 1:N:0:
+TTTAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
+>lane1_fakedata1_4 1:N:0:
+TTTAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
+>lane1_fakedata1_5 1:N:0:
+TTTAAGAATTACGTCCGCGTTTAGATTTGGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
+>lane1_fakedata1_6 1:N:0:
+TTTAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
+>lane1_fakedata1_7 1:N:0:
+TTTAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
+>lane1_fakedata1_8 1:N:0:
+TTTAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
+>lane1_fakedata1_9 1:N:0:
+TTTAAGAATTACGTCCGCGTTGAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
+>lane1_fakedata1_10 1:N:0:
+TTTAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
+>lane1_fakedata1_11 1:N:0:
+TTTAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
+>lane1_fakedata1_12 1:N:0:
+TTTAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_13 1:N:0:
+TTTAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_14 1:N:0:
+TTTAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_15 1:N:0:
+TTTAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
+>lane1_fakedata1_16 1:N:0:
+TTTAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_17 1:N:0:
+TTTAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_18 1:N:0:
+TTTAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_19 1:N:0:
+TTTAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_20 1:N:0:
+TTTAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_21 1:N:0:
+TTTAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_22 1:N:0:
+TTTAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_23 1:N:0:
+TTTAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_0 1:N:0:
+GGTTGTAATTACGTCCGCGTTTAAATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_1 1:N:0:
+GGTTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_2 1:N:0:
+GGTTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_3 1:N:0:
+GGTTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_4 1:N:0:
+GGTTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_5 1:N:0:
+GGTTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_6 1:N:0:
+GGTTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_7 1:N:0:
+GGTTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_8 1:N:0:
+GGTTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_9 1:N:0:
+GGTTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_10 1:N:0:
+GGTTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_11 1:N:0:
+GGTTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_12 1:N:0:
+GGTTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAGAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_13 1:N:0:
+GGTTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_14 1:N:0:
+GGTTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_15 1:N:0:
+GGTTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_16 1:N:0:
+GGTTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_17 1:N:0:
+GGTTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_18 1:N:0:
+GGTTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_19 1:N:0:
+GGTTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_20 1:N:0:
+GGTTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTCGCT
+>lane1_fakedata1_21 1:N:0:
+GGTTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_22 1:N:0:
+GGTTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAATTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_23 1:N:0:
+GGTTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_24 1:N:0:
+GGTTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_25 1:N:0:
+GGTTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_26 1:N:0:
+GGTTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCACGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_27 1:N:0:
+GGTTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_28 1:N:0:
+GGTTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_29 1:N:0:
+GGTTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_0 1:N:0:
+TGATGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_1 1:N:0:
+TGATGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_2 1:N:0:
+TGATGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_3 1:N:0:
+TGATGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_4 1:N:0:
+TGATGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_5 1:N:0:
+TGATGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCATTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_6 1:N:0:
+TGATGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_7 1:N:0:
+TGATGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_8 1:N:0:
+TGATGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_9 1:N:0:
+TGATGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_10 1:N:0:
+TGATGTAATTACGTCCGCGATTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_11 1:N:0:
+TGATGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_12 1:N:0:
+TGATGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_13 1:N:0:
+TGATGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTTAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_14 1:N:0:
+TGATGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_15 1:N:0:
+TGATGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_16 1:N:0:
+TGATGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
+>lane1_fakedata1_17 1:N:0:
+TGATGTAATTACGTCCGCGTTTAGATTTTGGAATCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTTTTTTTTAGGGTAGCT
+>lane1_fakedata1_18 1:N:0:
+TGATGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
+>lane1_fakedata1_19 1:N:0:
+TGATGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
+>lane1_fakedata1_20 1:N:0:
+TGATGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
+>lane1_fakedata1_21 1:N:0:
+TGATGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
+>lane1_fakedata1_22 1:N:0:
+TGATGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
+>lane1_fakedata1_23 1:N:0:
+TGATGTAATTACGTCCGCGTTTAGAGTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
+>lane1_fakedata1_24 1:N:0:
+TGATGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
+>lane1_fakedata1_25 1:N:0:
+TGATGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
+>lane1_fakedata1_26 1:N:0:
+TGATGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
+>lane1_fakedata1_27 1:N:0:
+TGATGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
+>lane1_fakedata1_28 1:N:0:
+TGATGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
+>lane1_fakedata1_29 1:N:0:
+TGATGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
+>lane1_fakedata1_30 1:N:0:
+TGATGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
+>lane1_fakedata1_31 1:N:0:
+TGATGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
+>lane1_fakedata1_0 1:N:0:
+CATCATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_1 1:N:0:
+CATCATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_2 1:N:0:
+CATCATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_3 1:N:0:
+CATCATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_4 1:N:0:
+CATCATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_5 1:N:0:
+CATCATAATTACGTCCGCGTTTCGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_6 1:N:0:
+CATCATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_7 1:N:0:
+CATCATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_8 1:N:0:
+CATCATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_9 1:N:0:
+CATCATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_10 1:N:0:
+CATCATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_11 1:N:0:
+CATCATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_12 1:N:0:
+CATCATAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_13 1:N:0:
+CATCATAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_14 1:N:0:
+CATCATAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_15 1:N:0:
+CATCATAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_16 1:N:0:
+CATCATAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_17 1:N:0:
+CATCATAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_18 1:N:0:
+CATCATAATTACGTCGGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_19 1:N:0:
+CATCATAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_20 1:N:0:
+CATCATAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_21 1:N:0:
+CATCATAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_22 1:N:0:
+CATCATAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_23 1:N:0:
+CATCATAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_0 1:N:0:
+AGGAAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_1 1:N:0:
+AGGAAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGCAAGCTGAAAGTATTCCTTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_2 1:N:0:
+AGGAAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_3 1:N:0:
+AGGAAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_4 1:N:0:
+AGGAAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_5 1:N:0:
+AGGAAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_6 1:N:0:
+AGGAAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_7 1:N:0:
+AGGAAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_8 1:N:0:
+AGGAAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_9 1:N:0:
+AGGAAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_10 1:N:0:
+AGGAAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_11 1:N:0:
+AGGAAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_12 1:N:0:
+AGGAAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_13 1:N:0:
+AGGAAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_14 1:N:0:
+AGGAAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_15 1:N:0:
+AGGAAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_16 1:N:0:
+AGGAAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_17 1:N:0:
+AGGAAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_18 1:N:0:
+AGGAAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_19 1:N:0:
+AGGAAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_20 1:N:0:
+AGGAAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_21 1:N:0:
+AGGAAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGAGTAGCT
+>lane1_fakedata1_0 1:N:0:
+GGGTAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_1 1:N:0:
+GGGTAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_2 1:N:0:
+GGGTAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_3 1:N:0:
+GGGTAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_4 1:N:0:
+GGGTAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_5 1:N:0:
+GGGTAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_6 1:N:0:
+GGGTAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_7 1:N:0:
+GGGTAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_8 1:N:0:
+GGGTAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_9 1:N:0:
+GGGTAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_10 1:N:0:
+GGGTAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_11 1:N:0:
+GGGTAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_12 1:N:0:
+GGGTAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_13 1:N:0:
+GGGTAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_0 1:N:0:
+AAGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTTCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_1 1:N:0:
+AAGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_2 1:N:0:
+AAGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_3 1:N:0:
+AAGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_4 1:N:0:
+AAGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_5 1:N:0:
+AAGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_6 1:N:0:
+AAGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_7 1:N:0:
+AAGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_8 1:N:0:
+AAGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_9 1:N:0:
+AAGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_10 1:N:0:
+AAGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_11 1:N:0:
+AAGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_12 1:N:0:
+AAGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_13 1:N:0:
+AAGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_14 1:N:0:
+AAGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_15 1:N:0:
+AAGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_16 1:N:0:
+AAGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_17 1:N:0:
+AAGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_18 1:N:0:
+AAGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_19 1:N:0:
+AAGATAAATTACGTCCGCGTATAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGATAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_20 1:N:0:
+AAGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_21 1:N:0:
+AAGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_22 1:N:0:
+AAGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_23 1:N:0:
+AAGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_24 1:N:0:
+AAGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_25 1:N:0:
+AAGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_0 1:N:0:
+ATAAGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
+>lane1_fakedata1_1 1:N:0:
+ATAAGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
+>lane1_fakedata1_2 1:N:0:
+ATAAGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
+>lane1_fakedata1_3 1:N:0:
+ATAAGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
+>lane1_fakedata1_4 1:N:0:
+ATAAGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
+>lane1_fakedata1_5 1:N:0:
+ATAAGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
+>lane1_fakedata1_6 1:N:0:
+ATAAGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_7 1:N:0:
+ATAAGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_8 1:N:0:
+ATAAGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_9 1:N:0:
+ATAAGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_10 1:N:0:
+ATAAGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_11 1:N:0:
+ATAAGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_0 1:N:0:
+ATGTAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_1 1:N:0:
+ATGTAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_2 1:N:0:
+ATGTAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_3 1:N:0:
+ATGTAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_4 1:N:0:
+ATGTAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTTCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_5 1:N:0:
+ATGTAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_6 1:N:0:
+ATGTAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_7 1:N:0:
+ATGTAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_8 1:N:0:
+ATGTAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_9 1:N:0:
+ATGTAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_10 1:N:0:
+ATGTAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_11 1:N:0:
+ATGTAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_12 1:N:0:
+ATGTAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_13 1:N:0:
+ATGTAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCTGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_14 1:N:0:
+ATGTAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_15 1:N:0:
+ATGTAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_0 1:N:0:
+AAGGATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_1 1:N:0:
+AAGGATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_2 1:N:0:
+AAGGATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_3 1:N:0:
+AAGGATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_4 1:N:0:
+AAGGATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_5 1:N:0:
+AAGGATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_6 1:N:0:
+AAGGATAATTACGTCCGCGTTTAGTTTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_7 1:N:0:
+AAGGATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_8 1:N:0:
+AAGGATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_9 1:N:0:
+AAGGATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_10 1:N:0:
+AAGGATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_11 1:N:0:
+AAGGATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_12 1:N:0:
+AAGGATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_13 1:N:0:
+AAGGATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_14 1:N:0:
+AAGGATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_15 1:N:0:
+AAGGATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_16 1:N:0:
+AAGGATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_17 1:N:0:
+AAGGATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTATTAGGGTAGCT
+>lane1_fakedata1_18 1:N:0:
+AAGGATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_19 1:N:0:
+AAGGATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_20 1:N:0:
+AAGGATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_21 1:N:0:
+AAGGATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_22 1:N:0:
+AAGGATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_23 1:N:0:
+AAGGATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_0 1:N:0:
+GGAGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_1 1:N:0:
+GGAGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_2 1:N:0:
+GGAGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_3 1:N:0:
+GGAGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_4 1:N:0:
+GGAGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_5 1:N:0:
+GGAGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_6 1:N:0:
+GGAGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_7 1:N:0:
+GGAGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_0 1:N:0:
+GTTTTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
+>lane1_fakedata1_1 1:N:0:
+GTTTTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_0 1:N:0:
+TGATAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_1 1:N:0:
+TGATAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_2 1:N:0:
+TGATAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_3 1:N:0:
+TGATAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_4 1:N:0:
+TGATAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_5 1:N:0:
+TGATAAAATTACGTCCGCGCTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_6 1:N:0:
+TGATAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_7 1:N:0:
+TGATAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_8 1:N:0:
+TGATAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_9 1:N:0:
+TGATAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_10 1:N:0:
+TGATAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_11 1:N:0:
+TGATAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_12 1:N:0:
+TGATAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_13 1:N:0:
+TGATAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_14 1:N:0:
+TGATAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_15 1:N:0:
+TGATAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_16 1:N:0:
+TGATAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_17 1:N:0:
+TGATAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_18 1:N:0:
+TGATAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_19 1:N:0:
+TGATAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_20 1:N:0:
+TGATAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_21 1:N:0:
+TGATAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCGTTTTTAGGGTAGCT
+>lane1_fakedata1_22 1:N:0:
+TGATAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_23 1:N:0:
+TGATAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_24 1:N:0:
+TGATAAAATTACGTCCGCTTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_25 1:N:0:
+TGATAAAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_0 1:N:0:
+GTTGATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_1 1:N:0:
+GTTGATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_2 1:N:0:
+GTTGATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_3 1:N:0:
+GTTGATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_4 1:N:0:
+GTTGATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_5 1:N:0:
+GTTGATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_6 1:N:0:
+GTTGATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_7 1:N:0:
+GTTGATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_8 1:N:0:
+GTTGATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_9 1:N:0:
+GTTGATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_10 1:N:0:
+GTTGATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_11 1:N:0:
+GTTGATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_12 1:N:0:
+GTTGATAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_13 1:N:0:
+GTTGATAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_14 1:N:0:
+GTTGATAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_15 1:N:0:
+GTTGATAATTACGTCCGCGTTTGGATTTAGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_16 1:N:0:
+GTTGATAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGTTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_17 1:N:0:
+GTTGATAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_18 1:N:0:
+GTTGATAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_19 1:N:0:
+GTTGATAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_20 1:N:0:
+GTTGATAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_21 1:N:0:
+GTTGATAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_22 1:N:0:
+GTTGATAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_23 1:N:0:
+GTTGATAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_0 1:N:0:
+AGATTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTATAGGGTAGCT
+>lane1_fakedata1_1 1:N:0:
+AGATTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_2 1:N:0:
+AGATTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_3 1:N:0:
+AGATTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_4 1:N:0:
+AGATTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_5 1:N:0:
+AGATTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_6 1:N:0:
+AGATTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_7 1:N:0:
+AGATTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_8 1:N:0:
+AGATTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_9 1:N:0:
+AGATTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_10 1:N:0:
+AGATTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_11 1:N:0:
+AGATTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_12 1:N:0:
+AGATTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_13 1:N:0:
+AGATTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_14 1:N:0:
+AGATTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_15 1:N:0:
+AGATTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_16 1:N:0:
+AGATTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_17 1:N:0:
+AGATTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_18 1:N:0:
+AGATTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_19 1:N:0:
+AGATTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_20 1:N:0:
+AGATTAAATTACGTCCGCGTTTAGATTTTGGACTCTGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_21 1:N:0:
+AGATTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_22 1:N:0:
+AGATTAAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_23 1:N:0:
+AGATTAAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_24 1:N:0:
+AGATTAAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_25 1:N:0:
+AGATTAAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_26 1:N:0:
+AGATTAAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_27 1:N:0:
+AGATTAAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_28 1:N:0:
+AGATTAAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_29 1:N:0:
+AGATTAAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTGTTTAGGGTAGCT
+>lane1_fakedata1_30 1:N:0:
+AGATTAAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_31 1:N:0:
+AGATTAAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGTCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_32 1:N:0:
+AGATTAAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_33 1:N:0:
+AGATTAAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_34 1:N:0:
+AGATTAAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_35 1:N:0:
+AGATTAAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_36 1:N:0:
+AGATTAAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_37 1:N:0:
+AGATTAAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_38 1:N:0:
+AGATTAAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_39 1:N:0:
+AGATTAAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_40 1:N:0:
+AGATTAAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_41 1:N:0:
+AGATTAAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_42 1:N:0:
+AGATTAAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_43 1:N:0:
+AGATTAAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGTACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_0 1:N:0:
+GTATAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_1 1:N:0:
+GTATAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_2 1:N:0:
+GTATAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_3 1:N:0:
+GTATAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_4 1:N:0:
+GTATAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_5 1:N:0:
+GTATAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_6 1:N:0:
+GTATAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_7 1:N:0:
+GTATAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_8 1:N:0:
+GTATAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_9 1:N:0:
+GTATAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_10 1:N:0:
+GTATAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_11 1:N:0:
+GTATAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGAT
+>lane1_fakedata1_0 1:N:0:
+TTGGGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_1 1:N:0:
+TTGGGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_2 1:N:0:
+TTGGGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_3 1:N:0:
+TTGGGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_4 1:N:0:
+TTGGGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_5 1:N:0:
+TTGGGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_6 1:N:0:
+TTGGGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_7 1:N:0:
+TTGGGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_8 1:N:0:
+TTGGGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_9 1:N:0:
+TTGGGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_10 1:N:0:
+TTGGGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_11 1:N:0:
+TTGGGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_12 1:N:0:
+TTGGGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_13 1:N:0:
+TTGGGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_14 1:N:0:
+TTGGGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_15 1:N:0:
+TTGGGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_16 1:N:0:
+TTGGGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_17 1:N:0:
+TTGGGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_18 1:N:0:
+TTGGGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_19 1:N:0:
+TTGGGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_20 1:N:0:
+TTGGGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_21 1:N:0:
+TTGGGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_22 1:N:0:
+TTGGGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_23 1:N:0:
+TTGGGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_24 1:N:0:
+TTGGGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_25 1:N:0:
+TTGGGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_0 1:N:0:
+ATATATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_1 1:N:0:
+ATATATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_2 1:N:0:
+ATATATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_3 1:N:0:
+ATATATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_4 1:N:0:
+ATATATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_5 1:N:0:
+ATATATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_6 1:N:0:
+ATATATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_7 1:N:0:
+ATATATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_8 1:N:0:
+ATATATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_9 1:N:0:
+ATATATAATTACGTCCGCGTTTAGATTTGGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_10 1:N:0:
+ATATATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_11 1:N:0:
+ATATATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_12 1:N:0:
+ATATATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_13 1:N:0:
+ATATATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_14 1:N:0:
+ATATATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_15 1:N:0:
+ATATATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_16 1:N:0:
+ATATATAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_17 1:N:0:
+ATATATAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_18 1:N:0:
+ATATATAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_19 1:N:0:
+ATATATAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_20 1:N:0:
+ATATATAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_21 1:N:0:
+ATATATAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_22 1:N:0:
+ATATATAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_23 1:N:0:
+ATATATAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_24 1:N:0:
+ATATATAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_25 1:N:0:
+ATATATAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_26 1:N:0:
+ATATATAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_27 1:N:0:
+ATATATAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_28 1:N:0:
+ATATATAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_29 1:N:0:
+ATATATAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_30 1:N:0:
+ATATATAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_31 1:N:0:
+ATATATAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGAAAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_0 1:N:0:
+GATGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_1 1:N:0:
+GATGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_2 1:N:0:
+GATGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAACT
+>lane1_fakedata1_3 1:N:0:
+GATGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_4 1:N:0:
+GATGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_5 1:N:0:
+GATGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_6 1:N:0:
+GATGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_7 1:N:0:
+GATGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_8 1:N:0:
+GATGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_9 1:N:0:
+GATGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_10 1:N:0:
+GATGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGCTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_11 1:N:0:
+GATGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTCTTAGGGTAGCT
+>lane1_fakedata1_12 1:N:0:
+GATGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_13 1:N:0:
+GATGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_14 1:N:0:
+GATGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_15 1:N:0:
+GATGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_16 1:N:0:
+GATGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_17 1:N:0:
+GATGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_18 1:N:0:
+GATGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_19 1:N:0:
+GATGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_20 1:N:0:
+GATGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_21 1:N:0:
+GATGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_22 1:N:0:
+GATGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_23 1:N:0:
+GATGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_24 1:N:0:
+GATGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_25 1:N:0:
+GATGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_26 1:N:0:
+GATGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_27 1:N:0:
+GATGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_28 1:N:0:
+GATGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGAACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_29 1:N:0:
+GATGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_0 1:N:0:
+GGGAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_1 1:N:0:
+GGGAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_2 1:N:0:
+GGGAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_3 1:N:0:
+GGGAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_4 1:N:0:
+GGGAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCATCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_5 1:N:0:
+GGGAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_6 1:N:0:
+GGGAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTGCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_7 1:N:0:
+GGGAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_8 1:N:0:
+GGGAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_9 1:N:0:
+GGGAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_10 1:N:0:
+GGGAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_11 1:N:0:
+GGGAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_12 1:N:0:
+GGGAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_13 1:N:0:
+GGGAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_14 1:N:0:
+GGGAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_15 1:N:0:
+GGGAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_16 1:N:0:
+GGGAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_17 1:N:0:
+GGGAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_18 1:N:0:
+GGGAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_19 1:N:0:
+GGGAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_20 1:N:0:
+GGGAATAATTACGTCCCCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_21 1:N:0:
+GGGAATAATTACGTCCGCGTTTAGATCTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_22 1:N:0:
+GGGAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_23 1:N:0:
+GGGAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_24 1:N:0:
+GGGAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_25 1:N:0:
+GGGAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_26 1:N:0:
+GGGAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_27 1:N:0:
+GGGAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCTAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_28 1:N:0:
+GGGAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_29 1:N:0:
+GGGAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_30 1:N:0:
+GGGAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_31 1:N:0:
+GGGAATAATTACGTCCACGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_32 1:N:0:
+GGGAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_33 1:N:0:
+GGGAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_34 1:N:0:
+GGGAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_35 1:N:0:
+GGGAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCATGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_36 1:N:0:
+GGGAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_37 1:N:0:
+GGGAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_38 1:N:0:
+GGGAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_39 1:N:0:
+GGGAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_40 1:N:0:
+GGGAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_41 1:N:0:
+GGGAATAATTACGTCCGCGTTTAGATTTTGTACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_0 1:N:0:
+AGGGTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_1 1:N:0:
+AGGGTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_2 1:N:0:
+AGGGTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_3 1:N:0:
+AGGGTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_4 1:N:0:
+AGGGTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_5 1:N:0:
+AGGGTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_6 1:N:0:
+AGGGTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_7 1:N:0:
+AGGGTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_8 1:N:0:
+AGGGTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_9 1:N:0:
+AGGGTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_10 1:N:0:
+AGGGTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_11 1:N:0:
+AGGGTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_12 1:N:0:
+AGGGTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_13 1:N:0:
+AGGGTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_0 1:N:0:
+GAGTTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_1 1:N:0:
+GAGTTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_2 1:N:0:
+GAGTTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_3 1:N:0:
+GAGTTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_4 1:N:0:
+GAGTTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_5 1:N:0:
+GAGTTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_6 1:N:0:
+GAGTTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_7 1:N:0:
+GAGTTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_8 1:N:0:
+GAGTTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_9 1:N:0:
+GAGTTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAACT
+>lane1_fakedata1_10 1:N:0:
+GAGTTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_11 1:N:0:
+GAGTTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_12 1:N:0:
+GAGTTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_13 1:N:0:
+GAGTTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_14 1:N:0:
+GAGTTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_15 1:N:0:
+GAGTTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_16 1:N:0:
+GAGTTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_17 1:N:0:
+GAGTTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_18 1:N:0:
+GAGTTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_19 1:N:0:
+GAGTTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTGGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_20 1:N:0:
+GAGTTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_21 1:N:0:
+GAGTTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_22 1:N:0:
+GAGTTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_23 1:N:0:
+GAGTTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_24 1:N:0:
+GAGTTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_25 1:N:0:
+GAGTTAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_0 1:N:0:
+ATAGTTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_1 1:N:0:
+ATAGTTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_2 1:N:0:
+ATAGTTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_3 1:N:0:
+ATAGTTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_4 1:N:0:
+ATAGTTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_5 1:N:0:
+ATAGTTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_6 1:N:0:
+ATAGTTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_7 1:N:0:
+ATAGTTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_8 1:N:0:
+ATAGTTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_9 1:N:0:
+ATAGTTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_10 1:N:0:
+ATAGTTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGGATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_11 1:N:0:
+ATAGTTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_0 1:N:0:
+TGTGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_1 1:N:0:
+TGTGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_2 1:N:0:
+TGTGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGCTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_3 1:N:0:
+TGTGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_4 1:N:0:
+TGTGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_5 1:N:0:
+TGTGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_6 1:N:0:
+TGTGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_7 1:N:0:
+TGTGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_8 1:N:0:
+TGTGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_9 1:N:0:
+TGTGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_10 1:N:0:
+TGTGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGAAAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_11 1:N:0:
+TGTGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_12 1:N:0:
+TGTGAGAATTACGTCCGCGTTTAGATTTTGGCCTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_13 1:N:0:
+TGTGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_14 1:N:0:
+TGTGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_15 1:N:0:
+TGTGAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_0 1:N:0:
+TTTGTGAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_1 1:N:0:
+TTTGTGAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_2 1:N:0:
+TTTGTGAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_3 1:N:0:
+TTTGTGAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_4 1:N:0:
+TTTGTGAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_5 1:N:0:
+TTTGTGAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_6 1:N:0:
+TTTGTGAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_7 1:N:0:
+TTTGTGAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_8 1:N:0:
+TTTGTGAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_9 1:N:0:
+TTTGTGAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_10 1:N:0:
+TTTGTGAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_11 1:N:0:
+TTTGTGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_12 1:N:0:
+TTTGTGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_13 1:N:0:
+TTTGTGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_14 1:N:0:
+TTTGTGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_15 1:N:0:
+TTTGTGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_16 1:N:0:
+TTTGTGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_17 1:N:0:
+TTTGTGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_18 1:N:0:
+TTTGTGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_19 1:N:0:
+TTTGTGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_20 1:N:0:
+TTTGTGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_21 1:N:0:
+TTTGTGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_0 1:N:0:
+GGAAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_1 1:N:0:
+GGAAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_2 1:N:0:
+GGAAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_3 1:N:0:
+GGAAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_4 1:N:0:
+GGAAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_5 1:N:0:
+GGAAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_6 1:N:0:
+GGAAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_7 1:N:0:
+GGAAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_8 1:N:0:
+GGAAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_9 1:N:0:
+GGAAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_10 1:N:0:
+GGAAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_11 1:N:0:
+GGAAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_12 1:N:0:
+GGAAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_13 1:N:0:
+GGAAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_14 1:N:0:
+GGAAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_15 1:N:0:
+GGAAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_16 1:N:0:
+GGAAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_17 1:N:0:
+GGAAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGGCAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_18 1:N:0:
+GGAAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_19 1:N:0:
+GGAAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_20 1:N:0:
+GGAAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_21 1:N:0:
+GGAAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_22 1:N:0:
+GGAAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_23 1:N:0:
+GGAAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_0 1:N:0:
+AATAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_1 1:N:0:
+AATAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_2 1:N:0:
+AATAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_3 1:N:0:
+AATAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_4 1:N:0:
+AATAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_5 1:N:0:
+AATAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_6 1:N:0:
+AATAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_7 1:N:0:
+AATAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_8 1:N:0:
+AATAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_9 1:N:0:
+AATAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_10 1:N:0:
+AATAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_11 1:N:0:
+AATAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_12 1:N:0:
+AATAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_13 1:N:0:
+AATAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_0 1:N:0:
+TTAAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
+>lane1_fakedata1_1 1:N:0:
+TTAAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
+>lane1_fakedata1_2 1:N:0:
+TTAAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
+>lane1_fakedata1_3 1:N:0:
+TTAAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
+>lane1_fakedata1_4 1:N:0:
+TTAAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
+>lane1_fakedata1_5 1:N:0:
+TTAAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
+>lane1_fakedata1_6 1:N:0:
+TTAAATAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_7 1:N:0:
+TTAAATAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTCTTAGGGTAGCT
+>lane1_fakedata1_8 1:N:0:
+TTAAATAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_9 1:N:0:
+TTAAATAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_10 1:N:0:
+TTAAATAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_11 1:N:0:
+TTAAATAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTATGTCCGTTGCCAGGAAAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_0 1:N:0:
+TAGTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
+>lane1_fakedata1_1 1:N:0:
+TAGTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
+>lane1_fakedata1_2 1:N:0:
+TAGTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
+>lane1_fakedata1_3 1:N:0:
+TAGTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
+>lane1_fakedata1_4 1:N:0:
+TAGTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
+>lane1_fakedata1_5 1:N:0:
+TAGTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
+>lane1_fakedata1_6 1:N:0:
+TAGTGTAATTACGTCCGCGTTTAGATTTTGGACTCAGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
+>lane1_fakedata1_7 1:N:0:
+TAGTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
+>lane1_fakedata1_8 1:N:0:
+TAGTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
+>lane1_fakedata1_9 1:N:0:
+TAGTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
+>lane1_fakedata1_10 1:N:0:
+TAGTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_11 1:N:0:
+TAGTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_12 1:N:0:
+TAGTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_13 1:N:0:
+TAGTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_14 1:N:0:
+TAGTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_15 1:N:0:
+TAGTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_16 1:N:0:
+TAGTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_17 1:N:0:
+TAGTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_18 1:N:0:
+TAGTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_19 1:N:0:
+TAGTGTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_0 1:N:0:
+AAGAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_1 1:N:0:
+AAGAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_2 1:N:0:
+AAGAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_3 1:N:0:
+AAGAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGTT
+>lane1_fakedata1_4 1:N:0:
+AAGAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_5 1:N:0:
+AAGAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_6 1:N:0:
+AAGAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_7 1:N:0:
+AAGAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAATAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_8 1:N:0:
+AAGAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_9 1:N:0:
+AAGAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAACTAAGCTGAAAGTATTCCCTTCTCCTTTATAGGGTAGCT
+>lane1_fakedata1_10 1:N:0:
+AAGAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_11 1:N:0:
+AAGAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCATGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_12 1:N:0:
+AAGAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_13 1:N:0:
+AAGAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_14 1:N:0:
+AAGAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_15 1:N:0:
+AAGAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_16 1:N:0:
+AAGAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_17 1:N:0:
+AAGAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_18 1:N:0:
+AAGAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_19 1:N:0:
+AAGAGGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_0 1:N:0:
+GGGTTGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_1 1:N:0:
+GGGTTGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_2 1:N:0:
+GGGTTGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_3 1:N:0:
+GGGTTGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_0 1:N:0:
+TGGAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_1 1:N:0:
+TGGAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_2 1:N:0:
+TGGAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_3 1:N:0:
+TGGAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGCCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_4 1:N:0:
+TGGAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_5 1:N:0:
+TGGAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_6 1:N:0:
+TGGAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_7 1:N:0:
+TGGAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_8 1:N:0:
+TGGAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_9 1:N:0:
+TGGAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGGAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_10 1:N:0:
+TGGAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_11 1:N:0:
+TGGAAGAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_12 1:N:0:
+TGGAAGAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_13 1:N:0:
+TGGAAGAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_14 1:N:0:
+TGGAAGAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_15 1:N:0:
+TGGAAGAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_16 1:N:0:
+TGGAAGAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_17 1:N:0:
+TGGAAGAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_18 1:N:0:
+TGGAAGAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_19 1:N:0:
+TGGAAGAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_20 1:N:0:
+TGGAAGAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_21 1:N:0:
+TGGAAGAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGTTAGCT
+>lane1_fakedata1_0 1:N:0:
+GAGAAGAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_1 1:N:0:
+GAGAAGAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_2 1:N:0:
+GAGAAGAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_3 1:N:0:
+GAGAAGAATTACGTCCGCGTTTGGAGTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_4 1:N:0:
+GAGAAGAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_5 1:N:0:
+GAGAAGAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_6 1:N:0:
+GAGAAGAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_7 1:N:0:
+GAGAAGAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_8 1:N:0:
+GAGAAGAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_9 1:N:0:
+GAGAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_10 1:N:0:
+GAGAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCAGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_11 1:N:0:
+GAGAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_12 1:N:0:
+GAGAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_13 1:N:0:
+GAGAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCATGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_14 1:N:0:
+GAGAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_15 1:N:0:
+GAGAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTACTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGTT
+>lane1_fakedata1_16 1:N:0:
+GAGAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_17 1:N:0:
+GAGAAGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_0 1:N:0:
+AGTAGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_1 1:N:0:
+AGTAGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_2 1:N:0:
+AGTAGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_3 1:N:0:
+AGTAGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_4 1:N:0:
+AGTAGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_5 1:N:0:
+AGTAGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_6 1:N:0:
+AGTAGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_7 1:N:0:
+AGTAGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_8 1:N:0:
+AGTAGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_9 1:N:0:
+AGTAGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_10 1:N:0:
+AGTAGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_11 1:N:0:
+AGTAGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_12 1:N:0:
+AGTAGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_13 1:N:0:
+AGTAGAAATTACGTCCGCGTGTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_14 1:N:0:
+AGTAGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_15 1:N:0:
+AGTAGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_16 1:N:0:
+AGTAGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_17 1:N:0:
+AGTAGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_18 1:N:0:
+AGTAGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_19 1:N:0:
+AGTAGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTCTTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_20 1:N:0:
+AGTAGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_21 1:N:0:
+AGTAGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGTGTAGCT
+>lane1_fakedata1_22 1:N:0:
+AGTAGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_23 1:N:0:
+AGTAGAAATTACGTCCGCGTTTAGATTTTGGACTCGGGGCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_0 1:N:0:
+AGTAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_1 1:N:0:
+AGTAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_2 1:N:0:
+AGTAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_3 1:N:0:
+AGTAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_4 1:N:0:
+AGTAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACATGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_5 1:N:0:
+AGTAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_6 1:N:0:
+AGTAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_7 1:N:0:
+AGTAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_8 1:N:0:
+AGTAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_9 1:N:0:
+AGTAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_10 1:N:0:
+AGTAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_11 1:N:0:
+AGTAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_12 1:N:0:
+AGTAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_13 1:N:0:
+AGTAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_14 1:N:0:
+AGTAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_15 1:N:0:
+AGTAATAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_0 1:N:0:
+GGGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_1 1:N:0:
+GGGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_2 1:N:0:
+GGGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_3 1:N:0:
+GGGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_4 1:N:0:
+GGGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_5 1:N:0:
+GGGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_6 1:N:0:
+GGGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_7 1:N:0:
+GGGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_8 1:N:0:
+GGGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_9 1:N:0:
+GGGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTAGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_10 1:N:0:
+GGGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_11 1:N:0:
+GGGATAAATTACGTCCGCGTTTAGCTTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_12 1:N:0:
+GGGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_13 1:N:0:
+GGGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_14 1:N:0:
+GGGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_15 1:N:0:
+GGGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_16 1:N:0:
+GGGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_17 1:N:0:
+GGGATAAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_0 1:N:0:
+TGTTTTAATTACGTCCGCGTTTGGATTTTGGTCTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_1 1:N:0:
+TGTTTTAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_2 1:N:0:
+TGTTTTAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_3 1:N:0:
+TGTTTTAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_4 1:N:0:
+TGTTTTAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_5 1:N:0:
+TGTTTTAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_6 1:N:0:
+TGTTTTAATTACGTCCGCGTTTGGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_7 1:N:0:
+TGTTTTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_8 1:N:0:
+TGTTTTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_9 1:N:0:
+TGTTTTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_10 1:N:0:
+TGTTTTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_11 1:N:0:
+TGTTTTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_12 1:N:0:
+TGTTTTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_13 1:N:0:
+TGTTTTAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_0 1:N:0:
+ATGATGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
+>lane1_fakedata1_1 1:N:0:
+ATGATGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
+>lane1_fakedata1_2 1:N:0:
+ATGATGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
+>lane1_fakedata1_3 1:N:0:
+ATGATGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
+>lane1_fakedata1_4 1:N:0:
+ATGATGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
+>lane1_fakedata1_5 1:N:0:
+ATGATGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
+>lane1_fakedata1_6 1:N:0:
+ATGATGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
+>lane1_fakedata1_7 1:N:0:
+ATGATGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
+>lane1_fakedata1_8 1:N:0:
+ATGATGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
+>lane1_fakedata1_9 1:N:0:
+ATGATGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
+>lane1_fakedata1_10 1:N:0:
+ATGATGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
+>lane1_fakedata1_11 1:N:0:
+ATGATGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCTTTTTTAGGGTAGCT
+>lane1_fakedata1_12 1:N:0:
+ATGATGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_13 1:N:0:
+ATGATGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCATGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_14 1:N:0:
+ATGATGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_15 1:N:0:
+ATGATGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_16 1:N:0:
+ATGATGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_17 1:N:0:
+ATGATGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_18 1:N:0:
+ATGATGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_19 1:N:0:
+ATGATGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_20 1:N:0:
+ATGATGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_21 1:N:0:
+ATGATGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_22 1:N:0:
+ATGATGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata1_23 1:N:0:
+ATGATGAATTACGTCCGCGTTTAGATTTTGGACTCGGGTCCTGTGTCCGTTGCCAGGACAAGTAAGCTGAAAGTATTCCCTTCTCCTTTTTAGGGTAGCT
+>lane1_fakedata3_0 1:N:0:
+GGTGTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_1 1:N:0:
+GGTGTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_2 1:N:0:
+GGTGTGAATTATTATTAGGCGAATCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_3 1:N:0:
+GGTGTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_4 1:N:0:
+GGTGTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_5 1:N:0:
+GGTGTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_6 1:N:0:
+GGTGTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_7 1:N:0:
+GGTGTGAATTACTATTAGGCGAAGCTGACCGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_8 1:N:0:
+GGTGTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_9 1:N:0:
+GGTGTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_10 1:N:0:
+GGTGTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_11 1:N:0:
+GGTGTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
+>lane1_fakedata3_12 1:N:0:
+GGTGTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
+>lane1_fakedata3_13 1:N:0:
+GGTGTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAGAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
+>lane1_fakedata3_14 1:N:0:
+GGTGTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
+>lane1_fakedata3_15 1:N:0:
+GGTGTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
+>lane1_fakedata3_16 1:N:0:
+GGTGTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
+>lane1_fakedata3_17 1:N:0:
+GGTGTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
+>lane1_fakedata3_18 1:N:0:
+GGTGTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
+>lane1_fakedata3_19 1:N:0:
+GGTGTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
+>lane1_fakedata3_20 1:N:0:
+GGTGTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
+>lane1_fakedata3_21 1:N:0:
+GGTGTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
+>lane1_fakedata3_0 1:N:0:
+TTTAAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_1 1:N:0:
+TTTAAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_2 1:N:0:
+TTTAAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_3 1:N:0:
+TTTAAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_4 1:N:0:
+TTTAAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_5 1:N:0:
+TTTAAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_6 1:N:0:
+TTTAAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_7 1:N:0:
+TTTAAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_8 1:N:0:
+TTTAAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_9 1:N:0:
+TTTAAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_10 1:N:0:
+TTTAAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_11 1:N:0:
+TTTAAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_12 1:N:0:
+TTTAAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_13 1:N:0:
+TTTAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_14 1:N:0:
+TTTAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_15 1:N:0:
+TTTAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_16 1:N:0:
+TTTAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_17 1:N:0:
+TTTAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_18 1:N:0:
+TTTAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_19 1:N:0:
+TTTAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_20 1:N:0:
+TTTAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_21 1:N:0:
+TTTAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_22 1:N:0:
+TTTAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_23 1:N:0:
+TTTAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_24 1:N:0:
+TTTAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_25 1:N:0:
+TTTAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_0 1:N:0:
+GGTTGTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_1 1:N:0:
+GGTTGTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_2 1:N:0:
+GGTTGTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_3 1:N:0:
+GGTTGTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_4 1:N:0:
+GGTTGTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_5 1:N:0:
+GGTTGTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_6 1:N:0:
+GGTTGTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_7 1:N:0:
+GGTTGTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_8 1:N:0:
+GGTTGTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_9 1:N:0:
+GGTTGTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_10 1:N:0:
+GGTTGTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_11 1:N:0:
+GGTTGTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_12 1:N:0:
+GGTTGTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_13 1:N:0:
+GGTTGTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_14 1:N:0:
+GGTTGTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_15 1:N:0:
+GGTTGTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_16 1:N:0:
+GGTTGTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_17 1:N:0:
+GGTTGTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_18 1:N:0:
+GGTTGTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_19 1:N:0:
+GGTTGTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_20 1:N:0:
+GGTTGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_21 1:N:0:
+GGTTGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_22 1:N:0:
+GGTTGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_23 1:N:0:
+GGTTGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_24 1:N:0:
+GGTTGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTTGTAA
+>lane1_fakedata3_25 1:N:0:
+GGTTGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_26 1:N:0:
+GGTTGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_27 1:N:0:
+GGTTGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_28 1:N:0:
+GGTTGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_29 1:N:0:
+GGTTGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_30 1:N:0:
+GGTTGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_31 1:N:0:
+GGTTGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_32 1:N:0:
+GGTTGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_33 1:N:0:
+GGTTGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_34 1:N:0:
+GGTTGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_35 1:N:0:
+GGTTGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_36 1:N:0:
+GGTTGTAATTACTATTAGGCGAAGCTAACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_37 1:N:0:
+GGTTGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_38 1:N:0:
+GGTTGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_39 1:N:0:
+GGTTGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_0 1:N:0:
+TGATGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_1 1:N:0:
+TGATGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAATCCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_2 1:N:0:
+TGATGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_3 1:N:0:
+TGATGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_4 1:N:0:
+TGATGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_5 1:N:0:
+TGATGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_6 1:N:0:
+TGATGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_7 1:N:0:
+TGATGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_8 1:N:0:
+TGATGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_9 1:N:0:
+TGATGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_10 1:N:0:
+TGATGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_11 1:N:0:
+TGATGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_12 1:N:0:
+TGATGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_13 1:N:0:
+TGATGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_14 1:N:0:
+TGATGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_15 1:N:0:
+TGATGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_0 1:N:0:
+ATGGGGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_1 1:N:0:
+ATGGGGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_2 1:N:0:
+ATGGGGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_3 1:N:0:
+ATGGGGAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
+>lane1_fakedata3_4 1:N:0:
+ATGGGGAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
+>lane1_fakedata3_5 1:N:0:
+ATGGGGAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
+>lane1_fakedata3_0 1:N:0:
+CATCATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
+>lane1_fakedata3_1 1:N:0:
+CATCATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
+>lane1_fakedata3_2 1:N:0:
+CATCATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
+>lane1_fakedata3_3 1:N:0:
+CATCATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTACACCTGAGTGCTCAAATGTCGTAA
+>lane1_fakedata3_4 1:N:0:
+CATCATAATTACTATTAGGCGAAGCTGACAAACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
+>lane1_fakedata3_5 1:N:0:
+CATCATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
+>lane1_fakedata3_6 1:N:0:
+CATCATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
+>lane1_fakedata3_7 1:N:0:
+CATCATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
+>lane1_fakedata3_8 1:N:0:
+CATCATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
+>lane1_fakedata3_9 1:N:0:
+CATCATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
+>lane1_fakedata3_10 1:N:0:
+CATCATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_11 1:N:0:
+CATCATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_12 1:N:0:
+CATCATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCGAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_13 1:N:0:
+CATCATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_14 1:N:0:
+CATCATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_15 1:N:0:
+CATCATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_16 1:N:0:
+CATCATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_17 1:N:0:
+CATCATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_18 1:N:0:
+CATCATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_19 1:N:0:
+CATCATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_0 1:N:0:
+AGGAAAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAATGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_1 1:N:0:
+AGGAAAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAATGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_2 1:N:0:
+AGGAAAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAATGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_3 1:N:0:
+AGGAAAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAATGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_4 1:N:0:
+AGGAAAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAATGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_5 1:N:0:
+AGGAAAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAATGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_6 1:N:0:
+AGGAAAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAATGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_7 1:N:0:
+AGGAAAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAATGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_8 1:N:0:
+AGGAAAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAATGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_9 1:N:0:
+AGGAAAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAATGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_10 1:N:0:
+AGGAAAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_11 1:N:0:
+AGGAAAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_12 1:N:0:
+AGGAAAAATTACTATTAGGCGAAGCTGACAGACTGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_13 1:N:0:
+AGGAAAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_14 1:N:0:
+AGGAAAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_15 1:N:0:
+AGGAAAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_16 1:N:0:
+AGGAAAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_17 1:N:0:
+AGGAAAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_18 1:N:0:
+AGGAAAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_19 1:N:0:
+AGGAAAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_0 1:N:0:
+GGGTAAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_1 1:N:0:
+GGGTAAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_2 1:N:0:
+GGGTAAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_3 1:N:0:
+GGGTAAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_4 1:N:0:
+GGGTAAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_5 1:N:0:
+GGGTAAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_6 1:N:0:
+GGGTAAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_7 1:N:0:
+GGGTAAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_8 1:N:0:
+GGGTAAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_9 1:N:0:
+GGGTAAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_10 1:N:0:
+GGGTAAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_11 1:N:0:
+GGGTAAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_0 1:N:0:
+AAGATAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_1 1:N:0:
+AAGATAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_2 1:N:0:
+AAGATAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_3 1:N:0:
+AAGATAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_4 1:N:0:
+AAGATAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_5 1:N:0:
+AAGATAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_6 1:N:0:
+AAGATAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_7 1:N:0:
+AAGATAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_8 1:N:0:
+AAGATAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_9 1:N:0:
+AAGATAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_10 1:N:0:
+AAGATAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAACACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_11 1:N:0:
+AAGATAAATTACTATTAGGCGAAGCTTACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_12 1:N:0:
+AAGATAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_13 1:N:0:
+AAGATAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATAAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_14 1:N:0:
+AAGATAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_15 1:N:0:
+AAGATAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_0 1:N:0:
+ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_1 1:N:0:
+ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_2 1:N:0:
+ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_3 1:N:0:
+ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_4 1:N:0:
+ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_5 1:N:0:
+ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_6 1:N:0:
+ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_7 1:N:0:
+ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_8 1:N:0:
+ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_9 1:N:0:
+ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_10 1:N:0:
+ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_11 1:N:0:
+ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_12 1:N:0:
+ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_13 1:N:0:
+ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_14 1:N:0:
+ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_15 1:N:0:
+ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_16 1:N:0:
+ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_17 1:N:0:
+ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_18 1:N:0:
+ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_19 1:N:0:
+ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_20 1:N:0:
+ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_21 1:N:0:
+ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_22 1:N:0:
+ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_23 1:N:0:
+ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_24 1:N:0:
+ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_25 1:N:0:
+ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_26 1:N:0:
+ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_27 1:N:0:
+ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_28 1:N:0:
+ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_29 1:N:0:
+ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_30 1:N:0:
+ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_31 1:N:0:
+ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_32 1:N:0:
+ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_33 1:N:0:
+ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_34 1:N:0:
+ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_35 1:N:0:
+ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_36 1:N:0:
+ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_37 1:N:0:
+ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_38 1:N:0:
+ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_39 1:N:0:
+ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_40 1:N:0:
+ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_41 1:N:0:
+ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_42 1:N:0:
+ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_43 1:N:0:
+ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_44 1:N:0:
+ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_45 1:N:0:
+ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_46 1:N:0:
+ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAATAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_47 1:N:0:
+ATAAGTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_0 1:N:0:
+ATGTAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_1 1:N:0:
+ATGTAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_2 1:N:0:
+ATGTAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_3 1:N:0:
+ATGTAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_4 1:N:0:
+ATGTAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_5 1:N:0:
+ATGTAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_6 1:N:0:
+ATGTAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_7 1:N:0:
+ATGTAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_8 1:N:0:
+ATGTAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_9 1:N:0:
+ATGTAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_10 1:N:0:
+ATGTAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_11 1:N:0:
+ATGTAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_12 1:N:0:
+ATGTAGAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
+>lane1_fakedata3_13 1:N:0:
+ATGTAGAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
+>lane1_fakedata3_14 1:N:0:
+ATGTAGAATTACTAGTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAACG
+>lane1_fakedata3_15 1:N:0:
+ATGTAGAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
+>lane1_fakedata3_16 1:N:0:
+ATGTAGAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTATACCTGAGTGCTCAAACGTCGTAATG
+>lane1_fakedata3_17 1:N:0:
+ATGTAGAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
+>lane1_fakedata3_18 1:N:0:
+ATGTAGAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
+>lane1_fakedata3_19 1:N:0:
+ATGTAGAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
+>lane1_fakedata3_20 1:N:0:
+ATGTAGAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
+>lane1_fakedata3_21 1:N:0:
+ATGTAGAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
+>lane1_fakedata3_22 1:N:0:
+ATGTAGAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
+>lane1_fakedata3_23 1:N:0:
+ATGTAGAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
+>lane1_fakedata3_0 1:N:0:
+AAGGATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_1 1:N:0:
+AAGGATAATTACTATTAGGCGAAGCTGACAGACGGTGCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_2 1:N:0:
+AAGGATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_3 1:N:0:
+AAGGATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_4 1:N:0:
+AAGGATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_5 1:N:0:
+AAGGATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_6 1:N:0:
+AAGGATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_7 1:N:0:
+AAGGATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_8 1:N:0:
+AAGGATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_9 1:N:0:
+AAGGATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_10 1:N:0:
+AAGGATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_11 1:N:0:
+AAGGATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_12 1:N:0:
+AAGGATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_13 1:N:0:
+AAGGATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_14 1:N:0:
+AAGGATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_15 1:N:0:
+AAGGATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_16 1:N:0:
+AAGGATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_17 1:N:0:
+AAGGATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_18 1:N:0:
+AAGGATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_19 1:N:0:
+AAGGATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_20 1:N:0:
+AAGGATAATTACTATTAGGCGATGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_21 1:N:0:
+AAGGATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_22 1:N:0:
+AAGGATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_23 1:N:0:
+AAGGATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTCAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_24 1:N:0:
+AAGGATAATTACTATTAGGCGAAGCTGACAGACGGCTCATATGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_25 1:N:0:
+AAGGATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_26 1:N:0:
+AAGGATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_27 1:N:0:
+AAGGATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_28 1:N:0:
+AAGGATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_29 1:N:0:
+AAGGATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_30 1:N:0:
+AAGGATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_31 1:N:0:
+AAGGATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_32 1:N:0:
+AAGGATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_33 1:N:0:
+AAGGATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_0 1:N:0:
+GGAGAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
+>lane1_fakedata3_1 1:N:0:
+GGAGAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
+>lane1_fakedata3_2 1:N:0:
+GGAGAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
+>lane1_fakedata3_3 1:N:0:
+GGAGAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
+>lane1_fakedata3_4 1:N:0:
+GGAGAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
+>lane1_fakedata3_5 1:N:0:
+GGAGAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
+>lane1_fakedata3_6 1:N:0:
+GGAGAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
+>lane1_fakedata3_7 1:N:0:
+GGAGAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
+>lane1_fakedata3_8 1:N:0:
+GGAGAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
+>lane1_fakedata3_9 1:N:0:
+GGAGAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
+>lane1_fakedata3_10 1:N:0:
+GGAGAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
+>lane1_fakedata3_11 1:N:0:
+GGAGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_12 1:N:0:
+GGAGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_13 1:N:0:
+GGAGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_14 1:N:0:
+GGAGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_15 1:N:0:
+GGAGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_16 1:N:0:
+GGAGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCCAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_17 1:N:0:
+GGAGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_18 1:N:0:
+GGAGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_19 1:N:0:
+GGAGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_20 1:N:0:
+GGAGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_21 1:N:0:
+GGAGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_0 1:N:0:
+GTTTTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_1 1:N:0:
+GTTTTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_2 1:N:0:
+GTTTTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_3 1:N:0:
+GTTTTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_4 1:N:0:
+GTTTTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_5 1:N:0:
+GTTTTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_6 1:N:0:
+GTTTTAAATTACTATTGGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_7 1:N:0:
+GTTTTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_8 1:N:0:
+GTTTTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_9 1:N:0:
+GTTTTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_10 1:N:0:
+GTTTTAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_11 1:N:0:
+GTTTTAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_12 1:N:0:
+GTTTTAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCTAACGTCGTAA
+>lane1_fakedata3_13 1:N:0:
+GTTTTAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_14 1:N:0:
+GTTTTAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_15 1:N:0:
+GTTTTAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_16 1:N:0:
+GTTTTAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_17 1:N:0:
+GTTTTAAATTACTATTAGGCGAAGCTGACAGACGGCTCATAGGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_18 1:N:0:
+GTTTTAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_19 1:N:0:
+GTTTTAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_0 1:N:0:
+TGATAAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_1 1:N:0:
+TGATAAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_2 1:N:0:
+TGATAAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_3 1:N:0:
+TGATAAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_4 1:N:0:
+TGATAAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_5 1:N:0:
+TGATAAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_6 1:N:0:
+TGATAAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_7 1:N:0:
+TGATAAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_8 1:N:0:
+TGATAAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_9 1:N:0:
+TGATAAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_10 1:N:0:
+TGATAAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_11 1:N:0:
+TGATAAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_12 1:N:0:
+TGATAAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_13 1:N:0:
+TGATAAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_14 1:N:0:
+TGATAAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_15 1:N:0:
+TGATAAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_16 1:N:0:
+TGATAAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_17 1:N:0:
+TGATAAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_18 1:N:0:
+TGATAAAATTACTATAAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_19 1:N:0:
+TGATAAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATAAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_0 1:N:0:
+GTTGATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCATCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_1 1:N:0:
+GTTGATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_0 1:N:0:
+AGATTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_1 1:N:0:
+AGATTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_2 1:N:0:
+AGATTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_3 1:N:0:
+AGATTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_4 1:N:0:
+AGATTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_5 1:N:0:
+AGATTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_6 1:N:0:
+AGATTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_7 1:N:0:
+AGATTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_8 1:N:0:
+AGATTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_9 1:N:0:
+AGATTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_10 1:N:0:
+AGATTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_11 1:N:0:
+AGATTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_12 1:N:0:
+AGATTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_13 1:N:0:
+AGATTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_14 1:N:0:
+AGATTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_15 1:N:0:
+AGATTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_16 1:N:0:
+AGATTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACATCGTAA
+>lane1_fakedata3_17 1:N:0:
+AGATTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_18 1:N:0:
+AGATTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_19 1:N:0:
+AGATTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_20 1:N:0:
+AGATTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_21 1:N:0:
+AGATTAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_22 1:N:0:
+AGATTAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_23 1:N:0:
+AGATTAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_24 1:N:0:
+AGATTAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACAATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_25 1:N:0:
+AGATTAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_26 1:N:0:
+AGATTAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_27 1:N:0:
+AGATTAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_28 1:N:0:
+AGATTAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_29 1:N:0:
+AGATTAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_30 1:N:0:
+AGATTAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTGCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_31 1:N:0:
+AGATTAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_32 1:N:0:
+AGATTAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_33 1:N:0:
+AGATTAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_34 1:N:0:
+AGATTAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_35 1:N:0:
+AGATTAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_36 1:N:0:
+AGATTAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_37 1:N:0:
+AGATTAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_38 1:N:0:
+AGATTAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_39 1:N:0:
+AGATTAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_40 1:N:0:
+AGATTAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_41 1:N:0:
+AGATTAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_0 1:N:0:
+GTATAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_1 1:N:0:
+GTATAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_2 1:N:0:
+GTATAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_3 1:N:0:
+GTATAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_4 1:N:0:
+GTATAGAATTACTATTAGGGGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_5 1:N:0:
+GTATAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_6 1:N:0:
+GTATAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_7 1:N:0:
+GTATAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_8 1:N:0:
+GTATAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_9 1:N:0:
+GTATAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_10 1:N:0:
+GTATAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_11 1:N:0:
+GTATAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_12 1:N:0:
+GTATAGAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
+>lane1_fakedata3_13 1:N:0:
+GTATAGAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
+>lane1_fakedata3_14 1:N:0:
+GTATAGAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
+>lane1_fakedata3_15 1:N:0:
+GTATAGAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
+>lane1_fakedata3_16 1:N:0:
+GTATAGAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
+>lane1_fakedata3_17 1:N:0:
+GTATAGAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
+>lane1_fakedata3_18 1:N:0:
+GTATAGAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACTTGAGTGCTCAAACGTCGTAATG
+>lane1_fakedata3_19 1:N:0:
+GTATAGAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
+>lane1_fakedata3_20 1:N:0:
+GTATAGAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
+>lane1_fakedata3_21 1:N:0:
+GTATAGAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
+>lane1_fakedata3_22 1:N:0:
+GTATAGAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
+>lane1_fakedata3_23 1:N:0:
+GTATAGAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
+>lane1_fakedata3_0 1:N:0:
+TTGGGAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_1 1:N:0:
+TTGGGAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_2 1:N:0:
+TTGGGAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_3 1:N:0:
+TTGGGAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_4 1:N:0:
+TTGGGAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_5 1:N:0:
+TTGGGAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTATACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_6 1:N:0:
+TTGGGAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_7 1:N:0:
+TTGGGAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_8 1:N:0:
+TTGGGAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_9 1:N:0:
+TTGGGAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_10 1:N:0:
+TTGGGAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_11 1:N:0:
+TTGGGAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_12 1:N:0:
+TTGGGAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCACCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_13 1:N:0:
+TTGGGAAATTACTATTAGGCGAAGCTGACTGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGAAA
+>lane1_fakedata3_14 1:N:0:
+TTGGGAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_15 1:N:0:
+TTGGGAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_16 1:N:0:
+TTGGGAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_17 1:N:0:
+TTGGGAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_18 1:N:0:
+TTGGGAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_19 1:N:0:
+TTGGGAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_20 1:N:0:
+TTGGGAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_21 1:N:0:
+TTGGGAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_22 1:N:0:
+TTGGGAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_23 1:N:0:
+TTGGGAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_0 1:N:0:
+ATATATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_1 1:N:0:
+ATATATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_2 1:N:0:
+ATATATAATTACTATTAGGCGAAGCTGGCAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_3 1:N:0:
+ATATATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_4 1:N:0:
+ATATATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_5 1:N:0:
+ATATATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_6 1:N:0:
+ATATATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_7 1:N:0:
+ATATATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_8 1:N:0:
+ATATATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_9 1:N:0:
+ATATATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_10 1:N:0:
+ATATATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_11 1:N:0:
+ATATATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_12 1:N:0:
+ATATATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_13 1:N:0:
+ATATATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_14 1:N:0:
+ATATATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_15 1:N:0:
+ATATATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_0 1:N:0:
+GATGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAAGGTCGTAA
+>lane1_fakedata3_1 1:N:0:
+GATGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_2 1:N:0:
+GATGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_3 1:N:0:
+GATGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_4 1:N:0:
+GATGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_5 1:N:0:
+GATGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_6 1:N:0:
+GATGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_7 1:N:0:
+GATGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCAAACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_8 1:N:0:
+GATGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_9 1:N:0:
+GATGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_10 1:N:0:
+GATGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_11 1:N:0:
+GATGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_12 1:N:0:
+GATGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_13 1:N:0:
+GATGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_14 1:N:0:
+GATGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_15 1:N:0:
+GATGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_16 1:N:0:
+GATGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_17 1:N:0:
+GATGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_18 1:N:0:
+GATGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_19 1:N:0:
+GATGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_20 1:N:0:
+GATGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_21 1:N:0:
+GATGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_22 1:N:0:
+GATGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_23 1:N:0:
+GATGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_24 1:N:0:
+GATGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_25 1:N:0:
+GATGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_26 1:N:0:
+GATGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_27 1:N:0:
+GATGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_28 1:N:0:
+GATGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_29 1:N:0:
+GATGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCTAACGTCGTAA
+>lane1_fakedata3_30 1:N:0:
+GATGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_31 1:N:0:
+GATGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_32 1:N:0:
+GATGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_33 1:N:0:
+GATGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_0 1:N:0:
+GGGAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_1 1:N:0:
+GGGAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_2 1:N:0:
+GGGAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_3 1:N:0:
+GGGAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_4 1:N:0:
+GGGAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_5 1:N:0:
+GGGAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_6 1:N:0:
+GGGAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_7 1:N:0:
+GGGAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_8 1:N:0:
+GGGAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_9 1:N:0:
+GGGAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_10 1:N:0:
+GGGAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_11 1:N:0:
+GGGAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_12 1:N:0:
+GGGAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_13 1:N:0:
+GGGAATAATTTCTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_14 1:N:0:
+GGGAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_15 1:N:0:
+GGGAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_16 1:N:0:
+GGGAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_17 1:N:0:
+GGGAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_18 1:N:0:
+GGGAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_19 1:N:0:
+GGGAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_20 1:N:0:
+GGGAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_21 1:N:0:
+GGGAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_0 1:N:0:
+AGGGTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_1 1:N:0:
+AGGGTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_2 1:N:0:
+AGGGTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_3 1:N:0:
+AGGGTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_4 1:N:0:
+AGGGTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_5 1:N:0:
+AGGGTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_6 1:N:0:
+AGGGTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_7 1:N:0:
+AGGGTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_8 1:N:0:
+AGGGTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_9 1:N:0:
+AGGGTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_10 1:N:0:
+AGGGTAAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
+>lane1_fakedata3_11 1:N:0:
+AGGGTAAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
+>lane1_fakedata3_12 1:N:0:
+AGGGTAAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
+>lane1_fakedata3_13 1:N:0:
+AGGGTAAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCACCTAAACCTGAGTGCTCAAACGTCGTAATG
+>lane1_fakedata3_14 1:N:0:
+AGGGTAAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
+>lane1_fakedata3_15 1:N:0:
+AGGGTAAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
+>lane1_fakedata3_16 1:N:0:
+AGGGTAAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
+>lane1_fakedata3_17 1:N:0:
+AGGGTAAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
+>lane1_fakedata3_18 1:N:0:
+AGGGTAAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
+>lane1_fakedata3_19 1:N:0:
+AGGGTAAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
+>lane1_fakedata3_0 1:N:0:
+GAGTTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_1 1:N:0:
+GAGTTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_2 1:N:0:
+GAGTTAAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_3 1:N:0:
+GAGTTAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_4 1:N:0:
+GAGTTAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_5 1:N:0:
+GAGTTAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_0 1:N:0:
+ATAGTTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_1 1:N:0:
+ATAGTTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_2 1:N:0:
+ATAGTTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_3 1:N:0:
+ATAGTTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_4 1:N:0:
+ATAGTTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_5 1:N:0:
+ATAGTTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACTTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_6 1:N:0:
+ATAGTTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_7 1:N:0:
+ATAGTTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_8 1:N:0:
+ATAGTTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_9 1:N:0:
+ATAGTTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_10 1:N:0:
+ATAGTTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_11 1:N:0:
+ATAGTTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_12 1:N:0:
+ATAGTTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_13 1:N:0:
+ATAGTTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_14 1:N:0:
+ATAGTTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_15 1:N:0:
+ATAGTTAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_16 1:N:0:
+ATAGTTAATTACTATTAGGCGAAGCTGACAGACGGTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAAT
+>lane1_fakedata3_17 1:N:0:
+ATAGTTAATTACTATTAGGCGAAGCTGACAGACGGTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAAT
+>lane1_fakedata3_18 1:N:0:
+ATAGTTAATTACTATTAGGCGAAGCTGACAGACGGTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAAT
+>lane1_fakedata3_19 1:N:0:
+ATAGTTAATTACTATTAGGCGAAGCTGACAGACGGTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAAT
+>lane1_fakedata3_20 1:N:0:
+ATAGTTAATTACTATTAGGCGAAGCTGACAGACGGTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAAT
+>lane1_fakedata3_21 1:N:0:
+ATAGTTAATTACTATTAGGCGAAGCTGACAGACGGTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAAT
+>lane1_fakedata3_22 1:N:0:
+ATAGTTAATTACTATTAGGCGAAGCTGACAGACGGTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAAT
+>lane1_fakedata3_23 1:N:0:
+ATAGTTAATTACTATTAGGCGAAGCTGACAGACGGTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAAT
+>lane1_fakedata3_24 1:N:0:
+ATAGTTAATTACTATTAGGCGAAGCTGACAGACGGTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAAT
+>lane1_fakedata3_25 1:N:0:
+ATAGTTAATTACTATTAGGCGAAGCTGACAGACGGTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAAT
+>lane1_fakedata3_26 1:N:0:
+ATAGTTAATTACTATTAGGCGAAGCTGACAGACGGTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAAT
+>lane1_fakedata3_27 1:N:0:
+ATAGTTAATTACTATTAGGCGAAGCTGACAGACGGTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAAT
+>lane1_fakedata3_28 1:N:0:
+ATAGTTAATTACTATTAGGCGAAGCGGACAGACGGTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAAT
+>lane1_fakedata3_29 1:N:0:
+ATAGTTAATTACTATTAGGCGAAGCTGACAGACGGTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAAT
+>lane1_fakedata3_30 1:N:0:
+ATAGTTAATTACTATTAGGCGAAGCTGACAGACGGTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAAT
+>lane1_fakedata3_31 1:N:0:
+ATAGTTAATTACTATTAGGCGAAGCTGACAGACGGTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAAT
+>lane1_fakedata3_0 1:N:0:
+TGTGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_1 1:N:0:
+TGTGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_2 1:N:0:
+TGTGAGAATTACTATTAGGCGAAGCTGACAGACAGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_3 1:N:0:
+TGTGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_4 1:N:0:
+TGTGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_5 1:N:0:
+TGTGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_6 1:N:0:
+TGTGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_7 1:N:0:
+TGTGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_8 1:N:0:
+TGTGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_9 1:N:0:
+TGTGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_10 1:N:0:
+TGTGAGAATTACTATTAGGCGAAGCTGACAGACGGCCCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_11 1:N:0:
+TGTGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_12 1:N:0:
+TGTGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_13 1:N:0:
+TGTGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACGTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_14 1:N:0:
+TGTGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_15 1:N:0:
+TGTGAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_0 1:N:0:
+TTTGTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_1 1:N:0:
+TTTGTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_2 1:N:0:
+TTTGTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_3 1:N:0:
+TTTGTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_4 1:N:0:
+TTTGTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_5 1:N:0:
+TTTGTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_6 1:N:0:
+TTTGTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_7 1:N:0:
+TTTGTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_8 1:N:0:
+TTTGTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_9 1:N:0:
+TTTGTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_10 1:N:0:
+TTTGTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_11 1:N:0:
+TTTGTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_12 1:N:0:
+TTTGTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_13 1:N:0:
+TTTGTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_14 1:N:0:
+TTTGTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_15 1:N:0:
+TTTGTGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_16 1:N:0:
+TTTGTGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_17 1:N:0:
+TTTGTGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_18 1:N:0:
+TTTGTGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_19 1:N:0:
+TTTGTGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_20 1:N:0:
+TTTGTGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_21 1:N:0:
+TTTGTGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_22 1:N:0:
+TTTGTGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_23 1:N:0:
+TTTGTGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_24 1:N:0:
+TTTGTGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_25 1:N:0:
+TTTGTGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_26 1:N:0:
+TTTGTGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_27 1:N:0:
+TTTGTGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_28 1:N:0:
+TTTGTGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_29 1:N:0:
+TTTGTGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_0 1:N:0:
+GGAAGGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAATGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_1 1:N:0:
+GGAAGGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAATGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_2 1:N:0:
+GGAAGGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAATGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_3 1:N:0:
+GGAAGGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAATGACTCTTGGCTTCCCTCCTAAACCTGAGTGCGCAAACGTCGTAA
+>lane1_fakedata3_4 1:N:0:
+GGAAGGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAATGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_5 1:N:0:
+GGAAGGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAATGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_6 1:N:0:
+GGAAGGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAATGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_7 1:N:0:
+GGAAGGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAATGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_8 1:N:0:
+GGAAGGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAATGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_9 1:N:0:
+GGAAGGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAATGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_10 1:N:0:
+GGAAGGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAATGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_11 1:N:0:
+GGAAGGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAATGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_12 1:N:0:
+GGAAGGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAATGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_13 1:N:0:
+GGAAGGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAATGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_14 1:N:0:
+GGAAGGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAATGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_15 1:N:0:
+GGAAGGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAATGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_16 1:N:0:
+GGAAGGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_17 1:N:0:
+GGAAGGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_18 1:N:0:
+GGAAGGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_19 1:N:0:
+GGAAGGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_20 1:N:0:
+GGAAGGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_21 1:N:0:
+GGAAGGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_22 1:N:0:
+GGAAGGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_23 1:N:0:
+GGAAGGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_24 1:N:0:
+GGAAGGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_25 1:N:0:
+GGAAGGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_26 1:N:0:
+GGAAGGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_27 1:N:0:
+GGAAGGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_28 1:N:0:
+GGAAGGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_29 1:N:0:
+GGAAGGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_30 1:N:0:
+GGAAGGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_31 1:N:0:
+GGAAGGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_0 1:N:0:
+AATAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_1 1:N:0:
+AATAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_2 1:N:0:
+AATAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_3 1:N:0:
+AATAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_4 1:N:0:
+AATAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAATCTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_5 1:N:0:
+AATAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_6 1:N:0:
+AATAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_7 1:N:0:
+AATAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_8 1:N:0:
+AATAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_9 1:N:0:
+AATAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_10 1:N:0:
+AATAAGAATTACTATTAGTCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_11 1:N:0:
+AATAAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTACTCAAACGTCGTAA
+>lane1_fakedata3_12 1:N:0:
+AATAAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_13 1:N:0:
+AATAAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_14 1:N:0:
+AATAAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_15 1:N:0:
+AATAAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_16 1:N:0:
+AATAAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_17 1:N:0:
+AATAAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_18 1:N:0:
+AATAAGAATTACCATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_19 1:N:0:
+AATAAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_20 1:N:0:
+AATAAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACAATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_21 1:N:0:
+AATAAGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_0 1:N:0:
+TTAAATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_1 1:N:0:
+TTAAATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_2 1:N:0:
+TTAAATAATTACTATTAGGCGAACCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_3 1:N:0:
+TTAAATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_4 1:N:0:
+TTAAATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_5 1:N:0:
+TTAAATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_6 1:N:0:
+TTAAATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_7 1:N:0:
+TTAAATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_8 1:N:0:
+TTAAATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_9 1:N:0:
+TTAAATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_10 1:N:0:
+TTAAATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_11 1:N:0:
+TTAAATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_12 1:N:0:
+TTAAATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_13 1:N:0:
+TTAAATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAATAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_14 1:N:0:
+TTAAATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_15 1:N:0:
+TTAAATAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGCAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_0 1:N:0:
+TAGTGTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
+>lane1_fakedata3_1 1:N:0:
+TAGTGTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
+>lane1_fakedata3_2 1:N:0:
+TAGTGTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
+>lane1_fakedata3_3 1:N:0:
+TAGTGTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
+>lane1_fakedata3_4 1:N:0:
+TAGTGTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
+>lane1_fakedata3_5 1:N:0:
+TAGTGTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
+>lane1_fakedata3_6 1:N:0:
+TAGTGTAATTACTATTAGGCAAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
+>lane1_fakedata3_7 1:N:0:
+TAGTGTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
+>lane1_fakedata3_8 1:N:0:
+TAGTGTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
+>lane1_fakedata3_9 1:N:0:
+TAGTGTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
+>lane1_fakedata3_10 1:N:0:
+TAGTGTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
+>lane1_fakedata3_11 1:N:0:
+TAGTGTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
+>lane1_fakedata3_12 1:N:0:
+TAGTGTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
+>lane1_fakedata3_13 1:N:0:
+TAGTGTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
+>lane1_fakedata3_14 1:N:0:
+TAGTGTAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
+>lane1_fakedata3_15 1:N:0:
+TAGTGTAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAAGTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
+>lane1_fakedata3_16 1:N:0:
+TAGTGTAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
+>lane1_fakedata3_17 1:N:0:
+TAGTGTAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
+>lane1_fakedata3_18 1:N:0:
+TAGTGTAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
+>lane1_fakedata3_19 1:N:0:
+TAGTGTAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
+>lane1_fakedata3_20 1:N:0:
+TAGTGTAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
+>lane1_fakedata3_21 1:N:0:
+TAGTGTAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
+>lane1_fakedata3_22 1:N:0:
+TAGTGTAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
+>lane1_fakedata3_23 1:N:0:
+TAGTGTAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
+>lane1_fakedata3_24 1:N:0:
+TAGTGTAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
+>lane1_fakedata3_25 1:N:0:
+TAGTGTAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
+>lane1_fakedata3_26 1:N:0:
+TAGTGTAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
+>lane1_fakedata3_27 1:N:0:
+TAGTGTAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
+>lane1_fakedata3_0 1:N:0:
+AAGAGGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_1 1:N:0:
+AAGAGGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_2 1:N:0:
+AAGAGGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_3 1:N:0:
+AAGAGGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_4 1:N:0:
+AAGAGGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_5 1:N:0:
+AAGAGGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_6 1:N:0:
+AAGAGGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTTCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_7 1:N:0:
+AAGAGGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAACCTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_8 1:N:0:
+AAGAGGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_9 1:N:0:
+AAGAGGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_10 1:N:0:
+AAGAGGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_11 1:N:0:
+AAGAGGAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_0 1:N:0:
+GGGTTGAATTACTATTAGGCGAAGCTGACAGACGGTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAAT
+>lane1_fakedata3_1 1:N:0:
+GGGTTGAATTACTATTAGGCGAAGCTGACAGACGGTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAAT
+>lane1_fakedata3_2 1:N:0:
+GGGTTGAATTACTATTAGGCGAAGCTGACAGACGGTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAAT
+>lane1_fakedata3_3 1:N:0:
+GGGTTGAATTACTATTAGGCGAAGCTGACAGACGGTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAAT
+>lane1_fakedata3_4 1:N:0:
+GGGTTGAATTACTATTAGGCGAAGCTGACAGACGGTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAAT
+>lane1_fakedata3_5 1:N:0:
+GGGTTGAATTACTATTAGGCGAAGCTGACAGACGGTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAAT
+>lane1_fakedata3_6 1:N:0:
+GGGTTGAATTACTATTAGGCGAAGCTGACAGACGGTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAAT
+>lane1_fakedata3_7 1:N:0:
+GGGTTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_8 1:N:0:
+GGGTTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_9 1:N:0:
+GGGTTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_10 1:N:0:
+GGGTTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_11 1:N:0:
+GGGTTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTAAAACGTCGTAA
+>lane1_fakedata3_12 1:N:0:
+GGGTTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_13 1:N:0:
+GGGTTGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_0 1:N:0:
+TGGAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACCCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
+>lane1_fakedata3_1 1:N:0:
+TGGAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
+>lane1_fakedata3_2 1:N:0:
+TGGAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
+>lane1_fakedata3_3 1:N:0:
+TGGAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
+>lane1_fakedata3_4 1:N:0:
+TGGAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAAATATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
+>lane1_fakedata3_5 1:N:0:
+TGGAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
+>lane1_fakedata3_6 1:N:0:
+TGGAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
+>lane1_fakedata3_7 1:N:0:
+TGGAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
+>lane1_fakedata3_8 1:N:0:
+TGGAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
+>lane1_fakedata3_9 1:N:0:
+TGGAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
+>lane1_fakedata3_10 1:N:0:
+TGGAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
+>lane1_fakedata3_11 1:N:0:
+TGGAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAATGTCGTAA
+>lane1_fakedata3_0 1:N:0:
+GAGAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_1 1:N:0:
+GAGAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_2 1:N:0:
+GAGAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACCGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_3 1:N:0:
+GAGAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_4 1:N:0:
+GAGAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_5 1:N:0:
+GAGAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_6 1:N:0:
+GAGAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_7 1:N:0:
+GAGAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_8 1:N:0:
+GAGAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_9 1:N:0:
+GAGAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_10 1:N:0:
+GAGAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_11 1:N:0:
+GAGAAGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_0 1:N:0:
+AGTAGAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_1 1:N:0:
+AGTAGAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_2 1:N:0:
+AGTAGAAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_3 1:N:0:
+AGTAGAAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
+>lane1_fakedata3_4 1:N:0:
+AGTAGAAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
+>lane1_fakedata3_5 1:N:0:
+AGTAGAAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
+>lane1_fakedata3_0 1:N:0:
+AGTAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_1 1:N:0:
+AGTAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_2 1:N:0:
+AGTAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_3 1:N:0:
+AGTAATAATTACTATTAGGCTAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_4 1:N:0:
+AGTAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_5 1:N:0:
+AGTAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_6 1:N:0:
+AGTAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_7 1:N:0:
+AGTAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_8 1:N:0:
+AGTAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_9 1:N:0:
+AGTAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_10 1:N:0:
+AGTAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCACACGTCGTAA
+>lane1_fakedata3_11 1:N:0:
+AGTAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_12 1:N:0:
+AGTAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_13 1:N:0:
+AGTAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACAGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_14 1:N:0:
+AGTAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_15 1:N:0:
+AGTAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_16 1:N:0:
+AGTAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_17 1:N:0:
+AGTAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_18 1:N:0:
+AGTAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_19 1:N:0:
+AGTAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_20 1:N:0:
+AGTAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_21 1:N:0:
+AGTAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_22 1:N:0:
+AGTAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_23 1:N:0:
+AGTAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_24 1:N:0:
+AGTAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_25 1:N:0:
+AGTAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_26 1:N:0:
+AGTAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_27 1:N:0:
+AGTAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_28 1:N:0:
+AGTAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_29 1:N:0:
+AGTAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_30 1:N:0:
+AGTAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_31 1:N:0:
+AGTAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_32 1:N:0:
+AGTAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_33 1:N:0:
+AGTAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_34 1:N:0:
+AGTAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_35 1:N:0:
+AGTAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_36 1:N:0:
+AGTAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_37 1:N:0:
+AGTAATAATTACTATTAGGCGAAGCTGACAGACGGCTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_0 1:N:0:
+TGTTTTAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
+>lane1_fakedata3_1 1:N:0:
+TGTTTTAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
+>lane1_fakedata3_2 1:N:0:
+TGTTTTAATTACTATTAGGCGAAGATGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
+>lane1_fakedata3_3 1:N:0:
+TGTTTTAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
+>lane1_fakedata3_4 1:N:0:
+TGTTTTAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
+>lane1_fakedata3_5 1:N:0:
+TGTTTTAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
+>lane1_fakedata3_6 1:N:0:
+TGTTTTAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
+>lane1_fakedata3_7 1:N:0:
+TGTTTTAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
+>lane1_fakedata3_8 1:N:0:
+TGTTTTAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTATACCTGAGTGCTCAAACGTCGTAATG
+>lane1_fakedata3_9 1:N:0:
+TGTTTTAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTCCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
+>lane1_fakedata3_10 1:N:0:
+TGTTTTAATTACTATTAGGCGAAGCTGACGACGGCTCATACGGTAAACTTCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAATG
+>lane1_fakedata3_11 1:N:0:
+TGTTTTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_12 1:N:0:
+TGTTTTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_13 1:N:0:
+TGTTTTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_14 1:N:0:
+TGTTTTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_15 1:N:0:
+TGTTTTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_16 1:N:0:
+TGTTTTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_17 1:N:0:
+TGTTTTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_18 1:N:0:
+TGTTTTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_19 1:N:0:
+TGTTTTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_20 1:N:0:
+TGTTTTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTACTTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_21 1:N:0:
+TGTTTTAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_0 1:N:0:
+ATGATGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_1 1:N:0:
+ATGATGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_2 1:N:0:
+ATGATGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_3 1:N:0:
+ATGATGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_4 1:N:0:
+ATGATGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_5 1:N:0:
+ATGATGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAAACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_6 1:N:0:
+ATGATGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_7 1:N:0:
+ATGATGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_8 1:N:0:
+ATGATGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_9 1:N:0:
+ATGATGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_10 1:N:0:
+ATGATGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata3_11 1:N:0:
+ATGATGAATTACTATTAGGCGAAGCTGACAGACGGTTCATACGGTAAACTATCAAAGACTCTTGGCTTCCCTCCTAAACCTGAGTGCTCAAACGTCGTAA
+>lane1_fakedata4_0 1:N:0:
+GGTGTGAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
+>lane1_fakedata4_1 1:N:0:
+GGTGTGAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
+>lane1_fakedata4_2 1:N:0:
+GGTGTGAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
+>lane1_fakedata4_3 1:N:0:
+GGTGTGAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTTGACAGGATTCTTTAGTGTCAATCCAACTCG
+>lane1_fakedata4_4 1:N:0:
+GGTGTGAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
+>lane1_fakedata4_5 1:N:0:
+GGTGTGAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAATTCG
+>lane1_fakedata4_6 1:N:0:
+GGTGTGAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
+>lane1_fakedata4_7 1:N:0:
+GGTGTGAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
+>lane1_fakedata4_8 1:N:0:
+GGTGTGAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
+>lane1_fakedata4_9 1:N:0:
+GGTGTGAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
+>lane1_fakedata4_10 1:N:0:
+GGTGTGAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
+>lane1_fakedata4_11 1:N:0:
+GGTGTGAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
+>lane1_fakedata4_12 1:N:0:
+GGTGTGAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
+>lane1_fakedata4_13 1:N:0:
+GGTGTGAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
+>lane1_fakedata4_14 1:N:0:
+GGTGTGAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
+>lane1_fakedata4_15 1:N:0:
+GGTGTGAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
+>lane1_fakedata4_16 1:N:0:
+GGTGTGAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
+>lane1_fakedata4_17 1:N:0:
+GGTGTGAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
+>lane1_fakedata4_18 1:N:0:
+GGTGTGAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
+>lane1_fakedata4_19 1:N:0:
+GGTGTGAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGACAGTAGCTTGGACAGGATTCTTTAGTGTCAATCCAACTCG
+>lane1_fakedata4_20 1:N:0:
+GGTGTGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_21 1:N:0:
+GGTGTGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_22 1:N:0:
+GGTGTGAATTATCGTCTTGCACAAATCGTCTACGCAGATTCGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_23 1:N:0:
+GGTGTGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_24 1:N:0:
+GGTGTGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_25 1:N:0:
+GGTGTGAATTATCGTCTTGCACAAATCGTCTACACAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_26 1:N:0:
+GGTGTGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_27 1:N:0:
+GGTGTGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_28 1:N:0:
+GGTGTGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_29 1:N:0:
+GGTGTGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_30 1:N:0:
+GGTGTGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_31 1:N:0:
+GGTGTGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_32 1:N:0:
+GGTGTGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_33 1:N:0:
+GGTGTGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_34 1:N:0:
+GGTGTGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_35 1:N:0:
+GGTGTGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_36 1:N:0:
+GGTGTGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_37 1:N:0:
+GGTGTGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_38 1:N:0:
+GGTGTGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_39 1:N:0:
+GGTGTGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_0 1:N:0:
+TTTAAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_1 1:N:0:
+TTTAAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_2 1:N:0:
+TTTAAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_3 1:N:0:
+TTTAAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_4 1:N:0:
+TTTAAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_5 1:N:0:
+TTTAAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_6 1:N:0:
+TTTAAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_7 1:N:0:
+TTTAAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_8 1:N:0:
+TTTAAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_9 1:N:0:
+TTTAAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_10 1:N:0:
+TTTAAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_11 1:N:0:
+TTTAAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_12 1:N:0:
+TTTAAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_13 1:N:0:
+TTTAAGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_0 1:N:0:
+GGTTGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_1 1:N:0:
+GGTTGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_2 1:N:0:
+GGTTGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_3 1:N:0:
+GGTTGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_4 1:N:0:
+GGTTGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_5 1:N:0:
+GGTTGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_6 1:N:0:
+GGTTGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_7 1:N:0:
+GGTTGTAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_8 1:N:0:
+GGTTGTAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_9 1:N:0:
+GGTTGTAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_10 1:N:0:
+GGTTGTAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_11 1:N:0:
+GGTTGTAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_12 1:N:0:
+GGTTGTAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_13 1:N:0:
+GGTTGTAATTATCGTCTTGCACAAATCGTGTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_0 1:N:0:
+TGATGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_1 1:N:0:
+TGATGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_2 1:N:0:
+TGATGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_3 1:N:0:
+TGATGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_4 1:N:0:
+TGATGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_5 1:N:0:
+TGATGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_6 1:N:0:
+TGATGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_7 1:N:0:
+TGATGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_8 1:N:0:
+TGATGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_9 1:N:0:
+TGATGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_10 1:N:0:
+TGATGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_11 1:N:0:
+TGATGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_12 1:N:0:
+TGATGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_13 1:N:0:
+TGATGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_14 1:N:0:
+TGATGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACCCGTGT
+>lane1_fakedata4_15 1:N:0:
+TGATGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_16 1:N:0:
+TGATGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTCAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_17 1:N:0:
+TGATGTAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_0 1:N:0:
+ATGGGGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCGACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_1 1:N:0:
+ATGGGGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_2 1:N:0:
+ATGGGGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_3 1:N:0:
+ATGGGGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_4 1:N:0:
+ATGGGGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_5 1:N:0:
+ATGGGGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_6 1:N:0:
+ATGGGGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_7 1:N:0:
+ATGGGGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_8 1:N:0:
+ATGGGGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_9 1:N:0:
+ATGGGGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_10 1:N:0:
+ATGGGGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_11 1:N:0:
+ATGGGGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_12 1:N:0:
+ATGGGGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_13 1:N:0:
+ATGGGGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_14 1:N:0:
+ATGGGGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_15 1:N:0:
+ATGGGGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_16 1:N:0:
+ATGGGGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_17 1:N:0:
+ATGGGGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_18 1:N:0:
+ATGGGGAATTATCGTCTTGCACAAATCGTCTACGCAGATTGGAGTCTTCCTAGCTACTGAAGTAGCTTGGACGGATTCTTTAGTGTCAATCAACTCGTGT
+>lane1_fakedata4_19 1:N:0: