annotate read2mut.py @ 46:f733c425b804 draft

planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
author mheinzl
date Tue, 09 Mar 2021 12:43:22 +0000
parents abb937211f2e
children edf8596463a8
Ignore whitespace changes - Everywhere: Within whitespace: At end of lines:
rev   line source
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1 #!/usr/bin/env python
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
2
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
3 """read2mut.py
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
4
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
5 Author -- Gundula Povysil
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
6 Contact -- povysil@bioinf.jku.at
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
7
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
8 Looks for reads with mutation at known
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
9 positions and calculates frequencies and stats.
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
10
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
11 ======= ========== ================= ================================
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
12 Version Date Author Description
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
13 0.2.1 2019-10-27 Gundula Povysil -
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
14 ======= ========== ================= ================================
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
15
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
16
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
17 USAGE: python read2mut.py --mutFile DCS_Mutations.tabular --bamFile Interesting_Reads.trim.bam
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
18 --inputJson tag_count_dict.json --sscsJson SSCS_counts.json
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
19 --outputFile mutant_reads_summary_short_trim.xlsx --thresh 10 --phred 20 --trim 10 --chimera_correction
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
20
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
21 """
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
22
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
23 from __future__ import division
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
24
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
25 import argparse
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
26 import itertools
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
27 import json
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
28 import operator
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
29 import os
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
30 import re
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
31 import sys
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
32
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
33 import numpy as np
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
34 import pysam
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
35 import xlsxwriter
6
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
36 from cyvcf2 import VCF
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
37
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
38
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
39 def make_argparser():
6
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
40 parser = argparse.ArgumentParser(description='Takes a VCF file with mutations, a BAM file and JSON files as input and prints stats about variants to a user specified output file.')
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
41 parser.add_argument('--mutFile',
6
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
42 help='VCF file with DCS mutations.')
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
43 parser.add_argument('--bamFile',
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
44 help='BAM file with aligned raw reads of selected tags (FASTQ created by mut2read.py - trimming with Trimmomatic - alignment with bwa).')
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
45 parser.add_argument('--inputJson',
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
46 help='JSON file with data collected by mut2read.py.')
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
47 parser.add_argument('--sscsJson',
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
48 help='JSON file with SSCS counts collected by mut2sscs.py.')
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
49 parser.add_argument('--outputFile',
12
7a418148319d planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 11
diff changeset
50 help='Output xlsx file with summary of mutations.')
7a418148319d planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 11
diff changeset
51 parser.add_argument('--outputFile2',
7a418148319d planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 11
diff changeset
52 help='Output xlsx file with allele frequencies of mutations.')
7a418148319d planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 11
diff changeset
53 parser.add_argument('--outputFile3',
7a418148319d planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 11
diff changeset
54 help='Output xlsx file with examples of the tier classification.')
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
55 parser.add_argument('--thresh', type=int, default=0,
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
56 help='Integer threshold for displaying mutations. Only mutations occuring less than thresh times are displayed. Default of 0 displays all.')
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
57 parser.add_argument('--phred', type=int, default=20,
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
58 help='Integer threshold for Phred score. Only reads higher than this threshold are considered. Default 20.')
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
59 parser.add_argument('--trim', type=int, default=10,
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
60 help='Integer threshold for assigning mutations at start and end of reads to lower tier. Default 10.')
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
61 parser.add_argument('--chimera_correction', action="store_true",
6
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
62 help='Count chimeric variants and correct the variant frequencies')
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
63 parser.add_argument('--softclipping_dist', type=int, default=15,
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
64 help='Count mutation as an artifact if mutation lies within this parameter away from the softclipping part of the read.')
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
65 parser.add_argument('--reads_threshold', type=float, default=1.0,
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
66 help='Float number which specifies the minimum percentage of softclipped reads in a family to be considered in the softclipping tiers. Default: 1.0, means all reads of a family have to be softclipped.')
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
67 return parser
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
68
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
69
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
70 def safe_div(x, y):
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
71 if y == 0:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
72 return None
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
73 return x / y
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
74
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
75
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
76 def read2mut(argv):
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
77 parser = make_argparser()
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
78 args = parser.parse_args(argv[1:])
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
79 file1 = args.mutFile
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
80 file2 = args.bamFile
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
81 json_file = args.inputJson
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
82 sscs_json = args.sscsJson
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
83 outfile = args.outputFile
12
7a418148319d planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 11
diff changeset
84 outfile2 = args.outputFile2
7a418148319d planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 11
diff changeset
85 outfile3 = args.outputFile3
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
86 thresh = args.thresh
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
87 phred_score = args.phred
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
88 trim = args.trim
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
89 chimera_correction = args.chimera_correction
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
90 thr = args.softclipping_dist
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
91 threshold_reads = args.reads_threshold
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
92
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
93 if os.path.isfile(file1) is False:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
94 sys.exit("Error: Could not find '{}'".format(file1))
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
95 if os.path.isfile(file2) is False:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
96 sys.exit("Error: Could not find '{}'".format(file2))
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
97 if os.path.isfile(json_file) is False:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
98 sys.exit("Error: Could not find '{}'".format(json_file))
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
99 if thresh < 0:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
100 sys.exit("Error: thresh is '{}', but only non-negative integers allowed".format(thresh))
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
101 if phred_score < 0:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
102 sys.exit("Error: phred is '{}', but only non-negative integers allowed".format(phred_score))
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
103 if trim < 0:
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
104 sys.exit("Error: trim is '{}', but only non-negative integers allowed".format(thresh))
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
105 if thr <= 0:
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
106 sys.exit("Error: trim is '{}', but only non-negative integers allowed".format(thr))
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
107
2
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
108 # load dicts
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
109 with open(json_file, "r") as f:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
110 (tag_dict, cvrg_dict) = json.load(f)
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
111
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
112 with open(sscs_json, "r") as f:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
113 (mut_pos_dict, ref_pos_dict) = json.load(f)
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
114
2
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
115 # read bam file
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
116 # pysam.index(file2)
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
117 bam = pysam.AlignmentFile(file2, "rb")
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
118
6
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
119 # create mut_dict
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
120 mut_dict = {}
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
121 mut_read_pos_dict = {}
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
122 mut_read_dict = {}
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
123 reads_dict = {}
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
124 mut_read_cigar_dict = {}
6
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
125 i = 0
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
126 mut_array = []
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
127
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
128 for count, variant in enumerate(VCF(file1)):
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
129 #if count == 2000:
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
130 # break
6
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
131 chrom = variant.CHROM
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
132 stop_pos = variant.start
7
ded0dc6a20d3 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 6
diff changeset
133 #chrom_stop_pos = str(chrom) + "#" + str(stop_pos)
6
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
134 ref = variant.REF
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
135 if len(variant.ALT) == 0:
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
136 continue
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
137 else:
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
138 alt = variant.ALT[0]
7
ded0dc6a20d3 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 6
diff changeset
139 chrom_stop_pos = str(chrom) + "#" + str(stop_pos) + "#" + ref + "#" + alt
ded0dc6a20d3 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 6
diff changeset
140
6
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
141 if len(ref) == len(alt):
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
142 mut_array.append([chrom, stop_pos, ref, alt])
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
143 i += 1
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
144 mut_dict[chrom_stop_pos] = {}
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
145 mut_read_pos_dict[chrom_stop_pos] = {}
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
146 reads_dict[chrom_stop_pos] = {}
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
147 mut_read_cigar_dict[chrom_stop_pos] = {}
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
148
6
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
149 for pileupcolumn in bam.pileup(chrom, stop_pos - 1, stop_pos + 1, max_depth=100000000):
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
150 if pileupcolumn.reference_pos == stop_pos:
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
151 count_alt = 0
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
152 count_ref = 0
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
153 count_indel = 0
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
154 count_n = 0
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
155 count_other = 0
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
156 count_lowq = 0
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
157 n = 0
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
158 #print("unfiltered reads=", pileupcolumn.n, "filtered reads=", len(pileupcolumn.pileups),
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
159 # "difference= ", len(pileupcolumn.pileups) - pileupcolumn.n)
6
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
160 for pileupread in pileupcolumn.pileups:
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
161 n += 1
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
162 if not pileupread.is_del and not pileupread.is_refskip:
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
163 tag = pileupread.alignment.query_name
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
164 nuc = pileupread.alignment.query_sequence[pileupread.query_position]
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
165 phred = ord(pileupread.alignment.qual[pileupread.query_position]) - 33
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
166 if phred < phred_score:
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
167 nuc = "lowQ"
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
168 if tag not in mut_dict[chrom_stop_pos]:
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
169 mut_dict[chrom_stop_pos][tag] = {}
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
170 if nuc in mut_dict[chrom_stop_pos][tag]:
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
171 mut_dict[chrom_stop_pos][tag][nuc] += 1
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
172 else:
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
173 mut_dict[chrom_stop_pos][tag][nuc] = 1
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
174 if tag not in mut_read_pos_dict[chrom_stop_pos]:
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
175 mut_read_pos_dict[chrom_stop_pos][tag] = [pileupread.query_position + 1]
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
176 reads_dict[chrom_stop_pos][tag] = [len(pileupread.alignment.query_sequence)]
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
177 mut_read_cigar_dict[chrom_stop_pos][tag] = [pileupread.alignment.cigarstring]
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
178
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
179 #alignedRefPositions = pileupread.get_reference_positions()[0]
6
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
180 else:
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
181 mut_read_pos_dict[chrom_stop_pos][tag].append(pileupread.query_position + 1)
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
182 reads_dict[chrom_stop_pos][tag].append(len(pileupread.alignment.query_sequence))
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
183 mut_read_cigar_dict[chrom_stop_pos][tag].append(pileupread.alignment.cigarstring)
6
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
184 if nuc == alt:
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
185 count_alt += 1
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
186 if tag not in mut_read_dict:
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
187 mut_read_dict[tag] = {}
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
188 mut_read_dict[tag][chrom_stop_pos] = (alt, ref)
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
189 else:
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
190 mut_read_dict[tag][chrom_stop_pos] = (alt, ref)
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
191 elif nuc == ref:
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
192 count_ref += 1
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
193 elif nuc == "N":
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
194 count_n += 1
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
195 elif nuc == "lowQ":
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
196 count_lowq += 1
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
197 else:
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
198 count_other += 1
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
199 else:
6
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
200 count_indel += 1
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
201
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
202 #print("coverage at pos %s = %s, ref = %s, alt = %s, other bases = %s, N = %s, indel = %s, low quality = %s\n" % (pileupcolumn.pos, count_ref + count_alt, count_ref, count_alt, count_other, count_n, count_indel, count_lowq))
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
203 #else:
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
204 # print("indels are currently not evaluated")
6
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
205 mut_array = np.array(mut_array)
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
206 for read in bam.fetch(until_eof=True):
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
207 if read.is_unmapped:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
208 pure_tag = read.query_name[:-5]
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
209 nuc = "na"
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
210 for key in tag_dict[pure_tag].keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
211 if key not in mut_dict:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
212 mut_dict[key] = {}
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
213 if read.query_name not in mut_dict[key]:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
214 mut_dict[key][read.query_name] = {}
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
215 if nuc in mut_dict[key][read.query_name]:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
216 mut_dict[key][read.query_name][nuc] += 1
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
217 else:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
218 mut_dict[key][read.query_name][nuc] = 1
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
219 bam.close()
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
220
6
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
221 # create pure_tags_dict
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
222 pure_tags_dict = {}
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
223 for key1, value1 in sorted(mut_dict.items()):
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
224 #if len(np.where(np.array(['#'.join(str(i) for i in z)
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
225 # for z in zip(mut_array[:, 0], mut_array[:, 1])]) == key1)[0]) == 0:
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
226 # continue
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
227
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
228 i = np.where(np.array(['#'.join(str(i) for i in z)
7
ded0dc6a20d3 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 6
diff changeset
229 for z in zip(mut_array[:, 0], mut_array[:, 1], mut_array[:, 2], mut_array[:, 3])]) == key1)[0][0]
6
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
230 ref = mut_array[i, 2]
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
231 alt = mut_array[i, 3]
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
232 pure_tags_dict[key1] = {}
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
233 for key2, value2 in sorted(value1.items()):
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
234 for key3, value3 in value2.items():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
235 pure_tag = key2[:-5]
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
236 if key3 == alt:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
237 if pure_tag in pure_tags_dict[key1]:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
238 pure_tags_dict[key1][pure_tag] += 1
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
239 else:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
240 pure_tags_dict[key1][pure_tag] = 1
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
241
6
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
242 # create pure_tags_dict_short with thresh
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
243 if thresh > 0:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
244 pure_tags_dict_short = {}
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
245 for key, value in sorted(pure_tags_dict.items()):
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
246 if len(value) < thresh:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
247 pure_tags_dict_short[key] = value
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
248 else:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
249 pure_tags_dict_short = pure_tags_dict
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
250
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
251 # whole_array = []
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
252 # for k in pure_tags_dict.values():
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
253 # if len(k) != 0:
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
254 # keys = k.keys()
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
255 # if len(keys) > 1:
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
256 # for k1 in keys:
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
257 # whole_array.append(k1)
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
258 # else:
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
259 # whole_array.append(keys[0])
28
afda74e874ac planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 27
diff changeset
260
6
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
261 # output summary with threshold
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
262 workbook = xlsxwriter.Workbook(outfile)
29
b14b69697cf6 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 28
diff changeset
263 workbook2 = xlsxwriter.Workbook(outfile2)
b14b69697cf6 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 28
diff changeset
264 workbook3 = xlsxwriter.Workbook(outfile3)
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
265 ws1 = workbook.add_worksheet("Results")
6
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
266 ws2 = workbook2.add_worksheet("Allele frequencies")
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
267 ws3 = workbook3.add_worksheet("Tiers")
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
268
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
269 format1 = workbook.add_format({'bg_color': '#BCF5A9'}) # green
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
270 format2 = workbook.add_format({'bg_color': '#FFC7CE'}) # red
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
271 format3 = workbook.add_format({'bg_color': '#FACC2E'}) # yellow
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
272
6
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
273 format12 = workbook2.add_format({'bg_color': '#BCF5A9'}) # green
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
274 format22 = workbook2.add_format({'bg_color': '#FFC7CE'}) # red
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
275 format32 = workbook2.add_format({'bg_color': '#FACC2E'}) # yellow
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
276
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
277 format13 = workbook3.add_format({'bg_color': '#BCF5A9'}) # green
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
278 format23 = workbook3.add_format({'bg_color': '#FFC7CE'}) # red
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
279 format33 = workbook3.add_format({'bg_color': '#FACC2E'}) # yellow
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
280
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
281 header_line = ('variant ID', 'tier', 'tag', 'mate', 'read pos.ab', 'read pos.ba', 'read median length.ab',
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
282 'read median length.ba', 'DCS median length',
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
283 'FS.ab', 'FS.ba', 'FSqc.ab', 'FSqc.ba', 'ref.ab', 'ref.ba', 'alt.ab', 'alt.ba',
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
284 'rel. ref.ab', 'rel. ref.ba', 'rel. alt.ab', 'rel. alt.ba',
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
285 'na.ab', 'na.ba', 'lowq.ab', 'lowq.ba', 'trim.ab', 'trim.ba',
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
286 'SSCS alt.ab', 'SSCS alt.ba', 'SSCS ref.ab', 'SSCS ref.ba',
4
386438cd4c3b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 3
diff changeset
287 'in phase', 'chimeric tag')
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
288 ws1.write_row(0, 0, header_line)
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
289
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
290 counter_tier11 = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
291 counter_tier12 = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
292 counter_tier21 = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
293 counter_tier22 = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
294 counter_tier23 = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
295 counter_tier24 = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
296 counter_tier31 = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
297 counter_tier32 = 0
46
f733c425b804 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 45
diff changeset
298 counter_tier25 = 0
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
299 counter_tier4 = 0
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
300 # if chimera_correction:
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
301 # counter_tier43 = 0
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
302 counter_tier51 = 0
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
303 counter_tier52 = 0
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
304 counter_tier53 = 0
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
305 counter_tier54 = 0
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
306 counter_tier55 = 0
28
afda74e874ac planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 27
diff changeset
307 counter_tier6 = 0
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
308 counter_tier7 = 0
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
309
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
310 row = 1
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
311 tier_dict = {}
2
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
312 chimera_dict = {}
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
313 for key1, value1 in sorted(mut_dict.items()):
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
314 counts_mut = 0
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
315 chimeric_tag_list = []
2
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
316 chimeric_tag = {}
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
317 if key1 in pure_tags_dict_short.keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
318 i = np.where(np.array(['#'.join(str(i) for i in z)
7
ded0dc6a20d3 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 6
diff changeset
319 for z in zip(mut_array[:, 0], mut_array[:, 1], mut_array[:, 2], mut_array[:, 3])]) == key1)[0][0]
6
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
320 ref = mut_array[i, 2]
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
321 alt = mut_array[i, 3]
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
322 dcs_median = cvrg_dict[key1][2]
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
323 whole_array = pure_tags_dict_short[key1].keys()
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
324
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
325 tier_dict[key1] = {}
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
326 values_tier_dict = [("tier 1.1", 0), ("tier 1.2", 0), ("tier 2.1", 0), ("tier 2.2", 0), ("tier 2.3", 0), ("tier 2.4", 0), ("tier 3.1", 0),
46
f733c425b804 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 45
diff changeset
327 ("tier 3.2", 0), ("tier 2.5", 0), ("tier 4", 0), ("tier 5.1", 0), ("tier 5.2", 0), ("tier 5.3", 0), ("tier 5.4", 0), ("tier 5.5", 0),
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
328 ("tier 6", 0), ("tier 7", 0)]
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
329 for k, v in values_tier_dict:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
330 tier_dict[key1][k] = v
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
331
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
332 used_keys = []
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
333 if 'ab' in mut_pos_dict[key1].keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
334 sscs_mut_ab = mut_pos_dict[key1]['ab']
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
335 else:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
336 sscs_mut_ab = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
337 if 'ba' in mut_pos_dict[key1].keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
338 sscs_mut_ba = mut_pos_dict[key1]['ba']
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
339 else:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
340 sscs_mut_ba = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
341 if 'ab' in ref_pos_dict[key1].keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
342 sscs_ref_ab = ref_pos_dict[key1]['ab']
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
343 else:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
344 sscs_ref_ab = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
345 if 'ba' in ref_pos_dict[key1].keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
346 sscs_ref_ba = ref_pos_dict[key1]['ba']
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
347 else:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
348 sscs_ref_ba = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
349 for key2, value2 in sorted(value1.items()):
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
350 add_mut14 = ""
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
351 add_mut23 = ""
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
352 if (key2[:-5] in pure_tags_dict_short[key1].keys()) and (key2[:-5] not in used_keys) and (key1 in tag_dict[key2[:-5]].keys()):
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
353 if key2[:-5] + '.ab.1' in mut_dict[key1].keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
354 total1 = sum(mut_dict[key1][key2[:-5] + '.ab.1'].values())
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
355 if 'na' in mut_dict[key1][key2[:-5] + '.ab.1'].keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
356 na1 = mut_dict[key1][key2[:-5] + '.ab.1']['na']
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
357 # na1f = na1/total1
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
358 else:
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
359 # na1 = na1f = 0
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
360 na1 = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
361 if 'lowQ' in mut_dict[key1][key2[:-5] + '.ab.1'].keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
362 lowq1 = mut_dict[key1][key2[:-5] + '.ab.1']['lowQ']
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
363 # lowq1f = lowq1 / total1
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
364 else:
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
365 # lowq1 = lowq1f = 0
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
366 lowq1 = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
367 if ref in mut_dict[key1][key2[:-5] + '.ab.1'].keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
368 ref1 = mut_dict[key1][key2[:-5] + '.ab.1'][ref]
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
369 ref1f = ref1 / (total1 - na1 - lowq1)
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
370 else:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
371 ref1 = ref1f = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
372 if alt in mut_dict[key1][key2[:-5] + '.ab.1'].keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
373 alt1 = mut_dict[key1][key2[:-5] + '.ab.1'][alt]
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
374 alt1f = alt1 / (total1 - na1 - lowq1)
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
375 else:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
376 alt1 = alt1f = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
377 total1new = total1 - na1 - lowq1
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
378 if (key2[:-5] + '.ab.1') in mut_read_dict.keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
379 k1 = mut_read_dict[(key2[:-5] + '.ab.1')].keys()
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
380 add_mut1 = len(k1)
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
381 if add_mut1 > 1:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
382 for k, v in mut_read_dict[(key2[:-5] + '.ab.1')].items():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
383 if k != key1:
4
386438cd4c3b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 3
diff changeset
384 new_mut = str(k).split("#")[0] + "-" + str(int(str(k).split("#")[1]) + 1) + "-" + v[1] + "-" + v[0]
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
385 if len(add_mut14) == 0:
4
386438cd4c3b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 3
diff changeset
386 add_mut14 = new_mut
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
387 else:
4
386438cd4c3b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 3
diff changeset
388 add_mut14 = add_mut14 + ", " + new_mut
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
389 else:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
390 k1 = []
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
391 else:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
392 total1 = total1new = na1 = lowq1 = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
393 ref1 = alt1 = ref1f = alt1f = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
394 k1 = []
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
395
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
396 if key2[:-5] + '.ab.2' in mut_dict[key1].keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
397 total2 = sum(mut_dict[key1][key2[:-5] + '.ab.2'].values())
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
398 if 'na' in mut_dict[key1][key2[:-5] + '.ab.2'].keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
399 na2 = mut_dict[key1][key2[:-5] + '.ab.2']['na']
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
400 # na2f = na2 / total2
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
401 else:
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
402 # na2 = na2f = 0
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
403 na2 = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
404 if 'lowQ' in mut_dict[key1][key2[:-5] + '.ab.2'].keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
405 lowq2 = mut_dict[key1][key2[:-5] + '.ab.2']['lowQ']
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
406 # lowq2f = lowq2 / total2
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
407 else:
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
408 # lowq2 = lowq2f = 0
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
409 lowq2 = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
410 if ref in mut_dict[key1][key2[:-5] + '.ab.2'].keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
411 ref2 = mut_dict[key1][key2[:-5] + '.ab.2'][ref]
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
412 ref2f = ref2 / (total2 - na2 - lowq2)
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
413 else:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
414 ref2 = ref2f = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
415 if alt in mut_dict[key1][key2[:-5] + '.ab.2'].keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
416 alt2 = mut_dict[key1][key2[:-5] + '.ab.2'][alt]
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
417 alt2f = alt2 / (total2 - na2 - lowq2)
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
418 else:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
419 alt2 = alt2f = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
420 total2new = total2 - na2 - lowq2
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
421 if (key2[:-5] + '.ab.2') in mut_read_dict.keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
422 k2 = mut_read_dict[(key2[:-5] + '.ab.2')].keys()
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
423 add_mut2 = len(k2)
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
424 if add_mut2 > 1:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
425 for k, v in mut_read_dict[(key2[:-5] + '.ab.2')].items():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
426 if k != key1:
4
386438cd4c3b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 3
diff changeset
427 new_mut = str(k).split("#")[0] + "-" + str(int(str(k).split("#")[1]) + 1) + "-" + v[1] + "-" + v[0]
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
428 if len(add_mut23) == 0:
4
386438cd4c3b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 3
diff changeset
429 add_mut23 = new_mut
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
430 else:
4
386438cd4c3b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 3
diff changeset
431 add_mut23 = add_mut23 + ", " + new_mut
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
432 else:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
433 k2 = []
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
434 else:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
435 total2 = total2new = na2 = lowq2 = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
436 ref2 = alt2 = ref2f = alt2f = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
437 k2 = []
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
438
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
439 if key2[:-5] + '.ba.1' in mut_dict[key1].keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
440 total3 = sum(mut_dict[key1][key2[:-5] + '.ba.1'].values())
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
441 if 'na' in mut_dict[key1][key2[:-5] + '.ba.1'].keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
442 na3 = mut_dict[key1][key2[:-5] + '.ba.1']['na']
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
443 # na3f = na3 / total3
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
444 else:
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
445 # na3 = na3f = 0
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
446 na3 = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
447 if 'lowQ' in mut_dict[key1][key2[:-5] + '.ba.1'].keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
448 lowq3 = mut_dict[key1][key2[:-5] + '.ba.1']['lowQ']
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
449 # lowq3f = lowq3 / total3
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
450 else:
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
451 # lowq3 = lowq3f = 0
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
452 lowq3 = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
453 if ref in mut_dict[key1][key2[:-5] + '.ba.1'].keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
454 ref3 = mut_dict[key1][key2[:-5] + '.ba.1'][ref]
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
455 ref3f = ref3 / (total3 - na3 - lowq3)
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
456 else:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
457 ref3 = ref3f = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
458 if alt in mut_dict[key1][key2[:-5] + '.ba.1'].keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
459 alt3 = mut_dict[key1][key2[:-5] + '.ba.1'][alt]
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
460 alt3f = alt3 / (total3 - na3 - lowq3)
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
461 else:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
462 alt3 = alt3f = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
463 total3new = total3 - na3 - lowq3
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
464 if (key2[:-5] + '.ba.1') in mut_read_dict.keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
465 add_mut3 = len(mut_read_dict[(key2[:-5] + '.ba.1')].keys())
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
466 if add_mut3 > 1:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
467 for k, v in mut_read_dict[(key2[:-5] + '.ba.1')].items():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
468 if k != key1 and k not in k2:
4
386438cd4c3b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 3
diff changeset
469 new_mut = str(k).split("#")[0] + "-" + str(int(str(k).split("#")[1]) + 1) + "-" + v[1] + "-" + v[0]
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
470 if len(add_mut23) == 0:
4
386438cd4c3b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 3
diff changeset
471 add_mut23 = new_mut
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
472 else:
4
386438cd4c3b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 3
diff changeset
473 add_mut23 = add_mut23 + ", " + new_mut
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
474 else:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
475 total3 = total3new = na3 = lowq3 = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
476 ref3 = alt3 = ref3f = alt3f = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
477
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
478 if key2[:-5] + '.ba.2' in mut_dict[key1].keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
479 total4 = sum(mut_dict[key1][key2[:-5] + '.ba.2'].values())
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
480 if 'na' in mut_dict[key1][key2[:-5] + '.ba.2'].keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
481 na4 = mut_dict[key1][key2[:-5] + '.ba.2']['na']
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
482 # na4f = na4 / total4
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
483 else:
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
484 # na4 = na4f = 0
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
485 na4 = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
486 if 'lowQ' in mut_dict[key1][key2[:-5] + '.ba.2'].keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
487 lowq4 = mut_dict[key1][key2[:-5] + '.ba.2']['lowQ']
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
488 # lowq4f = lowq4 / total4
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
489 else:
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
490 # lowq4 = lowq4f = 0
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
491 lowq4 = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
492 if ref in mut_dict[key1][key2[:-5] + '.ba.2'].keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
493 ref4 = mut_dict[key1][key2[:-5] + '.ba.2'][ref]
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
494 ref4f = ref4 / (total4 - na4 - lowq4)
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
495 else:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
496 ref4 = ref4f = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
497 if alt in mut_dict[key1][key2[:-5] + '.ba.2'].keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
498 alt4 = mut_dict[key1][key2[:-5] + '.ba.2'][alt]
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
499 alt4f = alt4 / (total4 - na4 - lowq4)
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
500 else:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
501 alt4 = alt4f = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
502 total4new = total4 - na4 - lowq4
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
503 if (key2[:-5] + '.ba.2') in mut_read_dict.keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
504 add_mut4 = len(mut_read_dict[(key2[:-5] + '.ba.2')].keys())
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
505 if add_mut4 > 1:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
506 for k, v in mut_read_dict[(key2[:-5] + '.ba.2')].items():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
507 if k != key1 and k not in k1:
4
386438cd4c3b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 3
diff changeset
508 new_mut = str(k).split("#")[0] + "-" + str(int(str(k).split("#")[1]) + 1) + "-" + v[1] + "-" + v[0]
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
509 if len(add_mut14) == 0:
4
386438cd4c3b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 3
diff changeset
510 add_mut14 = new_mut
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
511 else:
4
386438cd4c3b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 3
diff changeset
512 add_mut14 = add_mut14 + ", " + new_mut
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
513 else:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
514 total4 = total4new = na4 = lowq4 = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
515 ref4 = alt4 = ref4f = alt4f = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
516
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
517 read_pos1 = read_pos2 = read_pos3 = read_pos4 = -1
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
518 read_len_median1 = read_len_median2 = read_len_median3 = read_len_median4 = 0
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
519 cigars_dcs1 = cigars_dcs2 = cigars_dcs3 = cigars_dcs4 = []
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
520 pos_read1 = pos_read2 = pos_read3 = pos_read4 = []
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
521 end_read1 = end_read2 = end_read3 = end_read4 = []
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
522 if key2[:-5] + '.ab.1' in mut_read_pos_dict[key1].keys():
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
523 read_pos1 = np.median(np.array(mut_read_pos_dict[key1][key2[:-5] + '.ab.1']))
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
524 read_len_median1 = np.median(np.array(reads_dict[key1][key2[:-5] + '.ab.1']))
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
525 cigars_dcs1 = mut_read_cigar_dict[key1][key2[:-5] + '.ab.1']
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
526 #print(mut_read_cigar_dict[key1][key2[:-5] + '.ab.1'])
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
527 pos_read1 = mut_read_pos_dict[key1][key2[:-5] + '.ab.1']
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
528 #print(cigars_dcs1)
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
529 end_read1 = reads_dict[key1][key2[:-5] + '.ab.1']
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
530 if key2[:-5] + '.ab.2' in mut_read_pos_dict[key1].keys():
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
531 read_pos2 = np.median(np.array(mut_read_pos_dict[key1][key2[:-5] + '.ab.2']))
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
532 read_len_median2 = np.median(np.array(reads_dict[key1][key2[:-5] + '.ab.2']))
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
533 cigars_dcs2 = mut_read_cigar_dict[key1][key2[:-5] + '.ab.2']
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
534 pos_read2 = mut_read_pos_dict[key1][key2[:-5] + '.ab.2']
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
535 end_read2 = reads_dict[key1][key2[:-5] + '.ab.2']
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
536 if key2[:-5] + '.ba.1' in mut_read_pos_dict[key1].keys():
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
537 read_pos3 = np.median(np.array(mut_read_pos_dict[key1][key2[:-5] + '.ba.1']))
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
538 read_len_median3 = np.median(np.array(reads_dict[key1][key2[:-5] + '.ba.1']))
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
539 cigars_dcs3 = mut_read_cigar_dict[key1][key2[:-5] + '.ba.1']
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
540 pos_read3 = mut_read_pos_dict[key1][key2[:-5] + '.ba.1']
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
541 end_read3 = reads_dict[key1][key2[:-5] + '.ba.1']
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
542 if key2[:-5] + '.ba.2' in mut_read_pos_dict[key1].keys():
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
543 read_pos4 = np.median(np.array(mut_read_pos_dict[key1][key2[:-5] + '.ba.2']))
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
544 read_len_median4 = np.median(np.array(reads_dict[key1][key2[:-5] + '.ba.2']))
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
545 #print(mut_read_cigar_dict[key1][key2[:-5] + '.ba.2'])
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
546 cigars_dcs4 = mut_read_cigar_dict[key1][key2[:-5] + '.ba.2']
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
547
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
548 pos_read4 = mut_read_pos_dict[key1][key2[:-5] + '.ba.2']
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
549 #print(cigars_dcs4)
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
550 end_read4 = reads_dict[key1][key2[:-5] + '.ba.2']
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
551
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
552 used_keys.append(key2[:-5])
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
553 counts_mut += 1
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
554 if (alt1f + alt2f + alt3f + alt4f) > 0.5:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
555 if total1new == 0:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
556 ref1f = alt1f = None
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
557 alt1ff = -1
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
558 else:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
559 alt1ff = alt1f
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
560 if total2new == 0:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
561 ref2f = alt2f = None
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
562 alt2ff = -1
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
563 else:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
564 alt2ff = alt2f
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
565 if total3new == 0:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
566 ref3f = alt3f = None
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
567 alt3ff = -1
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
568 else:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
569 alt3ff = alt3f
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
570 if total4new == 0:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
571 ref4f = alt4f = None
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
572 alt4ff = -1
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
573 else:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
574 alt4ff = alt4f
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
575
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
576 beg1 = beg4 = beg2 = beg3 = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
577
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
578 details1 = (total1, total4, total1new, total4new, ref1, ref4, alt1, alt4, ref1f, ref4f, alt1f, alt4f, na1, na4, lowq1, lowq4, beg1, beg4)
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
579 details2 = (total2, total3, total2new, total3new, ref2, ref3, alt2, alt3, ref2f, ref3f, alt2f, alt3f, na2, na3, lowq2, lowq3, beg2, beg3)
6
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
580
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
581 trimmed = False
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
582 contradictory = False
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
583 softclipped_mutation_allMates = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
584 softclipped_mutation_oneOfTwoMates = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
585 softclipped_mutation_oneOfTwoSSCS = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
586 softclipped_mutation_oneMate = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
587 softclipped_mutation_oneMateOneSSCS = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
588 print()
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
589 print(key1, cigars_dcs1, cigars_dcs4, cigars_dcs2, cigars_dcs3)
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
590 dist_start_read1 = dist_start_read2 = dist_start_read3 = dist_start_read4 = []
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
591 dist_end_read1 = dist_end_read2 = dist_end_read3 = dist_end_read4 = []
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
592 ratio_dist_start1 = ratio_dist_start2 = ratio_dist_start3 = ratio_dist_start4 = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
593 ratio_dist_end1 = ratio_dist_end2 = ratio_dist_end3 = ratio_dist_end4 = False
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
594
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
595 # mate 1 - SSCS ab
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
596 softclipped_idx1 = [True if re.search(r"^[0-9]+S", string) or re.search(r"S$", string) else False for string in cigars_dcs1]
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
597 ratio1 = safe_div(sum(softclipped_idx1), float(len(softclipped_idx1))) >= threshold_reads
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
598
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
599 if any(ij is True for ij in softclipped_idx1):
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
600 softclipped_both_ends_idx1 = [True if (re.search(r"^[0-9]+S", string) and re.search(r"S$", string)) else False for string in cigars_dcs1]
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
601 softclipped_start1 = [int(string.split("S")[0]) if re.search(r"^[0-9]+S", string) else -1 for string in cigars_dcs1]
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
602 softclipped_end1 = [int(re.split("[A-Z]", str(string))[-2]) if re.search(r"S$", string) else -1 for string in cigars_dcs1]
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
603 dist_start_read1 = [(pos - soft) if soft != -1 else thr + 1000 for soft, pos in zip(softclipped_start1, pos_read1)]
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
604 dist_end_read1 = [(length_read - pos - soft) if soft != -1 else thr + 1000 for soft, pos, length_read in zip(softclipped_end1, pos_read1, end_read1)]
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
605
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
606 # if read at both ends softclipped --> select end with smallest distance between mut position and softclipping
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
607 if any(ij is True for ij in softclipped_both_ends_idx1):
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
608 print(softclipped_both_ends_idx1)
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
609 for nr, indx in enumerate(softclipped_both_ends_idx1):
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
610 if indx:
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
611 if dist_start_read1[nr] <= dist_end_read1[nr]:
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
612 dist_end_read1[nr] = thr + 1000 # use dist of start and set start to very large number
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
613 else:
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
614 dist_start_read1[nr] = thr + 1000 # use dist of end and set start to very large number
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
615 ratio_dist_start1 = safe_div(sum([True if x <= thr else False for x in dist_start_read1]), float(sum(softclipped_idx1))) >= threshold_reads
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
616 ratio_dist_end1 = safe_div(sum([True if x <= thr else False for x in dist_end_read1]), float(sum(softclipped_idx1))) >= threshold_reads
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
617 print(key1, "mate1 ab", dist_start_read1, dist_end_read1, cigars_dcs1, ratio1, ratio_dist_start1, ratio_dist_end1)
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
618
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
619 # mate 1 - SSCS ba
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
620 softclipped_idx4 = [True if re.search(r"^[0-9]+S", string) or re.search(r"S$", string) else False for string in cigars_dcs4]
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
621 ratio4 = safe_div(sum(softclipped_idx4), float(len(softclipped_idx4))) >= threshold_reads
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
622 if any(ij is True for ij in softclipped_idx4):
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
623 softclipped_both_ends_idx4 = [True if (re.search(r"^[0-9]+S", string) and re.search(r"S$", string)) else False for string in cigars_dcs4]
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
624 softclipped_start4 = [int(string.split("S")[0]) if re.search(r"^[0-9]+S", string) else -1 for string in cigars_dcs4]
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
625 softclipped_end4 = [int(re.split("[A-Z]", str(string))[-2]) if re.search(r"S$", string) else -1 for string in cigars_dcs4]
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
626 dist_start_read4 = [(pos - soft) if soft != -1 else thr + 1000 for soft, pos in zip(softclipped_start4, pos_read4)]
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
627 dist_end_read4 = [(length_read - pos - soft) if soft != -1 else thr + 1000 for soft, pos, length_read in zip(softclipped_end4, pos_read4, end_read4)]
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
628
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
629 # if read at both ends softclipped --> select end with smallest distance between mut position and softclipping
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
630 if any(ij is True for ij in softclipped_both_ends_idx4):
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
631 print(softclipped_both_ends_idx4)
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
632 for nr, indx in enumerate(softclipped_both_ends_idx4):
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
633 if indx:
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
634 if dist_start_read4[nr] <= dist_end_read4[nr]:
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
635 dist_end_read4[nr] = thr + 1000 # use dist of start and set start to very large number
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
636 else:
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
637 dist_start_read4[nr] = thr + 1000 # use dist of end and set start to very large number
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
638 ratio_dist_start4 = safe_div(sum([True if x <= thr else False for x in dist_start_read4]), float(sum(softclipped_idx4))) >= threshold_reads
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
639 ratio_dist_end4 = safe_div(sum([True if x <= thr else False for x in dist_end_read4]), float(sum(softclipped_idx4))) >= threshold_reads
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
640 print(key1, "mate1 ba", dist_start_read4, dist_end_read4,cigars_dcs4, ratio4, ratio_dist_start4, ratio_dist_end4)
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
641
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
642 # mate 2 - SSCS ab
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
643 softclipped_idx2 = [True if re.search(r"^[0-9]+S", string) or re.search(r"S$", string) else False for string in cigars_dcs2]
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
644 #print(sum(softclipped_idx2))
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
645 ratio2 = safe_div(sum(softclipped_idx2), float(len(softclipped_idx2))) >= threshold_reads
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
646 if any(ij is True for ij in softclipped_idx2):
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
647 softclipped_both_ends_idx2 = [True if (re.search(r"^[0-9]+S", string) and re.search(r"S$", string)) else False for string in cigars_dcs2]
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
648 softclipped_start2 = [int(string.split("S")[0]) if re.search(r"^[0-9]+S", string) else -1 for string in cigars_dcs2]
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
649 softclipped_end2 = [int(re.split("[A-Z]", str(string))[-2]) if re.search(r"S$", string) else -1 for string in cigars_dcs2]
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
650 dist_start_read2 = [(pos - soft) if soft != -1 else thr + 1000 for soft, pos in zip(softclipped_start2, pos_read2)]
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
651 dist_end_read2 = [(length_read - pos - soft) if soft != -1 else thr + 1000 for soft, pos, length_read in zip(softclipped_end2, pos_read2, end_read2)]
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
652
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
653 # if read at both ends softclipped --> select end with smallest distance between mut position and softclipping
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
654 if any(ij is True for ij in softclipped_both_ends_idx2):
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
655 print(softclipped_both_ends_idx2)
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
656 for nr, indx in enumerate(softclipped_both_ends_idx2):
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
657 if indx:
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
658 if dist_start_read2[nr] <= dist_end_read2[nr]:
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
659 dist_end_read2[nr] = thr + 1000 # use dist of start and set start to very large number
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
660 else:
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
661 dist_start_read2[nr] = thr + 1000 # use dist of end and set start to very large number
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
662 ratio_dist_start2 = safe_div(sum([True if x <= thr else False for x in dist_start_read2]), float(sum(softclipped_idx2))) >= threshold_reads
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
663 #print(ratio_dist_end2)
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
664 #print([True if x <= thr else False for x in ratio_dist_end2])
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
665 ratio_dist_end2 = safe_div(sum([True if x <= thr else False for x in dist_end_read2]), float(sum(softclipped_idx2))) >= threshold_reads
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
666 print(key1, "mate2 ab", dist_start_read2, dist_end_read2,cigars_dcs2, ratio2, ratio_dist_start2, ratio_dist_end2)
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
667
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
668 # mate 2 - SSCS ba
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
669 softclipped_idx3 = [True if re.search(r"^[0-9]+S", string) or re.search(r"S$", string) else False for string in cigars_dcs3]
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
670 ratio3 = safe_div(sum(softclipped_idx3), float(len(softclipped_idx3))) >= threshold_reads
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
671 if any(ij is True for ij in softclipped_idx3):
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
672 softclipped_both_ends_idx3 = [True if (re.search(r"^[0-9]+S", string) and re.search(r"S$", string)) else False for string in cigars_dcs3]
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
673 softclipped_start3 = [int(string.split("S")[0]) if re.search(r"^[0-9]+S", string) else -1 for string in cigars_dcs3]
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
674 softclipped_end3 = [int(re.split("[A-Z]", str(string))[-2]) if re.search(r"S$", string) else -1 for string in cigars_dcs3]
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
675 dist_start_read3 = [(pos - soft) if soft != -1 else thr + 1000 for soft, pos in zip(softclipped_start3, pos_read3)]
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
676 dist_end_read3 = [(length_read - pos - soft) if soft != -1 else thr + 1000 for soft, pos, length_read in zip(softclipped_end3, pos_read3, end_read3)]
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
677
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
678 # if read at both ends softclipped --> select end with smallest distance between mut position and softclipping
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
679 if any(ij is True for ij in softclipped_both_ends_idx3):
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
680 print(softclipped_both_ends_idx3)
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
681 for nr, indx in enumerate(softclipped_both_ends_idx3):
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
682 if indx:
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
683 if dist_start_read3[nr] <= dist_end_read3[nr]:
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
684 dist_end_read3[nr] = thr + 1000 # use dist of start and set start to a larger number than thresh
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
685 else:
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
686 dist_start_read3[nr] = thr + 1000 # use dist of end and set start to very large number
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
687 #print([True if x <= thr else False for x in dist_start_read3])
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
688 ratio_dist_start3 = safe_div(sum([True if x <= thr else False for x in dist_start_read3]), float(sum(softclipped_idx3))) >= threshold_reads
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
689 ratio_dist_end3 = safe_div(sum([True if x <= thr else False for x in dist_end_read3]), float(sum(softclipped_idx3))) >= threshold_reads
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
690 print(key1, "mate2 ba", dist_start_read3, dist_end_read3,cigars_dcs3, ratio3, ratio_dist_start3, ratio_dist_end3)
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
691
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
692 if ((all(float(ij) >= 0.5 for ij in [alt1ff, alt4ff]) & # contradictory variant
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
693 all(float(ij) == 0. for ij in [alt2ff, alt3ff])) |
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
694 (all(float(ij) >= 0.5 for ij in [alt2ff, alt3ff]) &
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
695 all(float(ij) == 0. for ij in [alt1ff, alt4ff]))):
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
696 alt1ff = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
697 alt4ff = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
698 alt2ff = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
699 alt3ff = 0
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
700 trimmed = False
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
701 contradictory = True
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
702 # softclipping tiers
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
703 # information of both mates available --> all reads for both mates and SSCS are softclipped
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
704 elif (ratio1 & ratio4 & ratio2 & ratio3 &
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
705 (ratio_dist_start1 | ratio_dist_end1) & (ratio_dist_start4 | ratio_dist_end4) & (ratio_dist_start2 | ratio_dist_end2) & (ratio_dist_start3 | ratio_dist_end3) &
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
706 all(float(ij) > 0. for ij in [alt1ff, alt2ff, alt3ff, alt4ff])): # all mates available
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
707 # if distance between softclipping and mutation is at start or end of the read smaller than threshold
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
708 softclipped_mutation_allMates = True
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
709 softclipped_mutation_oneOfTwoMates = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
710 softclipped_mutation_oneOfTwoSSCS = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
711 softclipped_mutation_oneMate = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
712 softclipped_mutation_oneMateOneSSCS = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
713 alt1ff = 0
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
714 alt4ff = 0
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
715 alt2ff = 0
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
716 alt3ff = 0
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
717 trimmed = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
718 contradictory = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
719 print(key1, "softclipped_mutation_allMates", softclipped_mutation_allMates)
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
720 # information of both mates available --> only one mate softclipped
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
721 elif (((ratio1 & ratio4 & (ratio_dist_start1 | ratio_dist_end1) & (ratio_dist_start4 | ratio_dist_end4)) |
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
722 (ratio2 & ratio3 & (ratio_dist_start2 | ratio_dist_end2) & (ratio_dist_start3 | ratio_dist_end3))) &
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
723 all(float(ij) > 0. for ij in [alt1ff, alt2ff, alt3ff, alt4ff])): # all mates available
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
724 # if distance between softclipping and mutation is at start or end of the read smaller than threshold
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
725 softclipped_mutation_allMates = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
726 softclipped_mutation_oneOfTwoMates = True
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
727 softclipped_mutation_oneOfTwoSSCS = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
728 softclipped_mutation_oneMate = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
729 softclipped_mutation_oneMateOneSSCS = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
730 alt1ff = 0
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
731 alt4ff = 0
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
732 alt2ff = 0
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
733 alt3ff = 0
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
734 trimmed = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
735 contradictory = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
736 print(key1, "softclipped_mutation_oneOfTwoMates", softclipped_mutation_oneOfTwoMates)
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
737 # information of both mates available --> only one mate softclipped
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
738 elif (((ratio1 & (ratio_dist_start1 | ratio_dist_end1)) | (ratio4 & (ratio_dist_start4 | ratio_dist_end4))) &
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
739 ((ratio2 & (ratio_dist_start2 | ratio_dist_end2)) | (ratio3 & (ratio_dist_start3 | ratio_dist_end3))) &
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
740 all(float(ij) > 0. for ij in [alt1ff, alt2ff, alt3ff, alt4ff])): # all mates available
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
741 # if distance between softclipping and mutation is at start or end of the read smaller than threshold
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
742 softclipped_mutation_allMates = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
743 softclipped_mutation_oneOfTwoMates = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
744 softclipped_mutation_oneOfTwoSSCS = True
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
745 softclipped_mutation_oneMate = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
746 softclipped_mutation_oneMateOneSSCS = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
747 alt1ff = 0
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
748 alt4ff = 0
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
749 alt2ff = 0
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
750 alt3ff = 0
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
751 trimmed = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
752 contradictory = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
753 print(key1, "softclipped_mutation_oneOfTwoSSCS", softclipped_mutation_oneOfTwoSSCS, [alt1ff, alt2ff, alt3ff, alt4ff])
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
754 # information of one mate available --> all reads of one mate are softclipped
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
755 elif ((ratio1 & ratio4 & (ratio_dist_start1 | ratio_dist_end1) & (ratio_dist_start4 | ratio_dist_end4) &
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
756 all(float(ij) < 0. for ij in [alt2ff, alt3ff]) & all(float(ij) > 0. for ij in [alt1ff, alt4ff])) |
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
757 (ratio2 & ratio3 & (ratio_dist_start2 | ratio_dist_end2) & (ratio_dist_start3 | ratio_dist_end3) &
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
758 all(float(ij) < 0. for ij in [alt1ff, alt4ff]) & all(float(ij) > 0. for ij in [alt2ff, alt3ff]))): # all mates available
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
759 # if distance between softclipping and mutation is at start or end of the read smaller than threshold
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
760 #if ((((len(dist_start_read1) > 0 | len(dist_end_read1) > 0 ) & all(ij <= thr or nm <= thr for ij, nm in zip(dist_start_read1, dist_end_read1))) &
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
761 # ((len(dist_start_read4) > 0 | len(dist_end_read4) > 0 ) & all(ij <= thr or nm <= thr for ij, nm in zip(dist_start_read4, dist_end_read4)))) |
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
762 # (((len(dist_start_read2) > 0 | len(dist_end_read2) > 0 ) & all(ij <= thr or nm <= thr for ij, nm in zip(dist_start_read2, dist_end_read2))) &
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
763 # ((len(dist_start_read3) > 0 | len(dist_end_read3) > 0 ) & all(ij <= thr or nm <= thr for ij, nm in zip(dist_start_read3, dist_end_read3))))):
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
764 softclipped_mutation_allMates = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
765 softclipped_mutation_oneOfTwoMates = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
766 softclipped_mutation_oneOfTwoSSCS = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
767 softclipped_mutation_oneMate = True
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
768 softclipped_mutation_oneMateOneSSCS = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
769 alt1ff = 0
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
770 alt4ff = 0
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
771 alt2ff = 0
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
772 alt3ff = 0
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
773 trimmed = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
774 contradictory = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
775 print(key1, "softclipped_mutation_oneMate", softclipped_mutation_oneMate)
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
776 # information of one mate available --> only one SSCS is softclipped
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
777 elif ((((ratio1 & (ratio_dist_start1 | ratio_dist_end1)) | (ratio4 & (ratio_dist_start4 | ratio_dist_end4))) &
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
778 (all(float(ij) < 0. for ij in [alt2ff, alt3ff]) & all(float(ij) > 0. for ij in [alt1ff, alt4ff]))) |
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
779 (((ratio2 & (ratio_dist_start2 | ratio_dist_end2)) | (ratio3 & (ratio_dist_start3 | ratio_dist_end3))) &
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
780 (all(float(ij) < 0. for ij in [alt1ff, alt4ff]) & all(float(ij) < 0. for ij in [alt2ff, alt3ff])))): # all mates available
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
781 # if distance between softclipping and mutation is at start or end of the read smaller than threshold
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
782 #if ((all(ij <= thr or nm <= thr for ij, nm in zip(dist_start_read1, dist_end_read1)) |
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
783 # all(ij <= thr or nm <= thr for ij, nm in zip(dist_start_read4, dist_end_read4))) |
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
784 # (all(ij <= thr or nm <= thr for ij, nm in zip(dist_start_read2, dist_end_read2)) |
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
785 # all(ij <= thr or nm <= thr for ij, nm in zip(dist_start_read3, dist_end_read3)))):
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
786 softclipped_mutation_allMates = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
787 softclipped_mutation_oneOfTwoMates = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
788 softclipped_mutation_oneOfTwoSSCS = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
789 softclipped_mutation_oneMate = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
790 softclipped_mutation_oneMateOneSSCS = True
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
791 alt1ff = 0
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
792 alt4ff = 0
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
793 alt2ff = 0
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
794 alt3ff = 0
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
795 trimmed = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
796 contradictory = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
797 print(key1, "softclipped_mutation_oneMateOneSSCS", softclipped_mutation_oneMateOneSSCS)
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
798
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
799 else:
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
800 if ((read_pos1 >= 0) and ((read_pos1 <= trim) | (abs(read_len_median1 - read_pos1) <= trim))):
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
801 beg1 = total1new
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
802 total1new = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
803 alt1ff = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
804 alt1f = 0
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
805 trimmed = True
28
afda74e874ac planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 27
diff changeset
806
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
807 if ((read_pos4 >= 0) and ((read_pos4 <= trim) | (abs(read_len_median4 - read_pos4) <= trim))):
28
afda74e874ac planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 27
diff changeset
808 beg4 = total4new
afda74e874ac planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 27
diff changeset
809 total4new = 0
afda74e874ac planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 27
diff changeset
810 alt4ff = 0
afda74e874ac planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 27
diff changeset
811 alt4f = 0
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
812 trimmed = True
28
afda74e874ac planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 27
diff changeset
813
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
814 if ((read_pos2 >= 0) and ((read_pos2 <= trim) | (abs(read_len_median2 - read_pos2) <= trim))):
28
afda74e874ac planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 27
diff changeset
815 beg2 = total2new
afda74e874ac planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 27
diff changeset
816 total2new = 0
afda74e874ac planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 27
diff changeset
817 alt2ff = 0
afda74e874ac planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 27
diff changeset
818 alt2f = 0
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
819 trimmed = True
6
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
820
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
821 if ((read_pos3 >= 0) and ((read_pos3 <= trim) | (abs(read_len_median3 - read_pos3) <= trim))):
28
afda74e874ac planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 27
diff changeset
822 beg3 = total3new
afda74e874ac planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 27
diff changeset
823 total3new = 0
afda74e874ac planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 27
diff changeset
824 alt3ff = 0
afda74e874ac planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 27
diff changeset
825 alt3f = 0
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
826 trimmed = True
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
827 details1 = (total1, total4, total1new, total4new, ref1, ref4, alt1, alt4, ref1f, ref4f, alt1f, alt4f, na1, na4, lowq1, lowq4, beg1, beg4)
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
828 details2 = (total2, total3, total2new, total3new, ref2, ref3, alt2, alt3, ref2f, ref3f, alt2f, alt3f, na2, na3, lowq2, lowq3, beg2, beg3)
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
829
46
f733c425b804 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 45
diff changeset
830
f733c425b804 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 45
diff changeset
831 sum_highTiers = sum([tier_dict[key1][ij] for ij in tier_dict[key1].keys()[:6]])
f733c425b804 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 45
diff changeset
832
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
833 # assign tiers
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
834 if ((all(int(ij) >= 3 for ij in [total1new, total4new]) &
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
835 all(float(ij) >= 0.75 for ij in [alt1ff, alt4ff])) |
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
836 (all(int(ij) >= 3 for ij in [total2new, total3new]) &
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
837 all(float(ij) >= 0.75 for ij in [alt2ff, alt3ff]))):
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
838 tier = "1.1"
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
839 counter_tier11 += 1
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
840 tier_dict[key1]["tier 1.1"] += 1
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
841
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
842 elif (all(int(ij) >= 1 for ij in [total1new, total2new, total3new, total4new]) &
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
843 any(int(ij) >= 3 for ij in [total1new, total4new]) &
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
844 any(int(ij) >= 3 for ij in [total2new, total3new]) &
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
845 all(float(ij) >= 0.75 for ij in [alt1ff, alt2ff, alt3ff, alt4ff])):
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
846 tier = "1.2"
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
847 counter_tier12 += 1
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
848 tier_dict[key1]["tier 1.2"] += 1
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
849
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
850 elif ((all(int(ij) >= 1 for ij in [total1new, total4new]) &
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
851 any(int(ij) >= 3 for ij in [total1new, total4new]) &
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
852 all(float(ij) >= 0.75 for ij in [alt1ff, alt4ff])) |
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
853 (all(int(ij) >= 1 for ij in [total2new, total3new]) &
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
854 any(int(ij) >= 3 for ij in [total2new, total3new]) &
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
855 all(float(ij) >= 0.75 for ij in [alt2ff, alt3ff]))):
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
856 tier = "2.1"
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
857 counter_tier21 += 1
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
858 tier_dict[key1]["tier 2.1"] += 1
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
859
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
860 elif (all(int(ij) >= 1 for ij in [total1new, total2new, total3new, total4new]) &
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
861 all(float(ij) >= 0.75 for ij in [alt1ff, alt2ff, alt3ff, alt4ff])):
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
862 tier = "2.2"
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
863 counter_tier22 += 1
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
864 tier_dict[key1]["tier 2.2"] += 1
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
865
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
866 elif ((all(int(ij) >= 1 for ij in [total1new, total4new]) &
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
867 any(int(ij) >= 3 for ij in [total2new, total3new]) &
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
868 all(float(ij) >= 0.75 for ij in [alt1ff, alt4ff]) &
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
869 any(float(ij) >= 0.75 for ij in [alt2ff, alt3ff])) |
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
870 (all(int(ij) >= 1 for ij in [total2new, total3new]) &
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
871 any(int(ij) >= 3 for ij in [total1new, total4new]) &
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
872 all(float(ij) >= 0.75 for ij in [alt2ff, alt3ff]) &
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
873 any(float(ij) >= 0.75 for ij in [alt1ff, alt4ff]))):
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
874 tier = "2.3"
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
875 counter_tier23 += 1
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
876 tier_dict[key1]["tier 2.3"] += 1
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
877
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
878 elif ((all(int(ij) >= 1 for ij in [total1new, total4new]) &
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
879 all(float(ij) >= 0.75 for ij in [alt1ff, alt4ff])) |
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
880 (all(int(ij) >= 1 for ij in [total2new, total3new]) &
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
881 all(float(ij) >= 0.75 for ij in [alt2ff, alt3ff]))):
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
882 tier = "2.4"
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
883 counter_tier24 += 1
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
884 tier_dict[key1]["tier 2.4"] += 1
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
885
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
886 elif ((len(pure_tags_dict_short[key1]) > 1) &
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
887 (all(float(ij) >= 0.5 for ij in [alt1ff, alt4ff]) |
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
888 all(float(ij) >= 0.5 for ij in [alt2ff, alt3ff]))):
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
889 tier = "3.1"
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
890 counter_tier31 += 1
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
891 tier_dict[key1]["tier 3.1"] += 1
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
892
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
893 elif ((all(int(ij) >= 1 for ij in [total1new, total4new]) &
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
894 all(float(ij) >= 0.5 for ij in [alt1ff, alt4ff])) |
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
895 (all(int(ij) >= 1 for ij in [total2new, total3new]) &
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
896 all(float(ij) >= 0.5 for ij in [alt2ff, alt3ff]))):
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
897 tier = "3.2"
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
898 counter_tier32 += 1
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
899 tier_dict[key1]["tier 3.2"] += 1
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
900
46
f733c425b804 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 45
diff changeset
901 elif (trimmed) and (sum_highTiers > 1):
f733c425b804 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 45
diff changeset
902 tier = "2.5"
f733c425b804 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 45
diff changeset
903 counter_tier25 += 1
f733c425b804 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 45
diff changeset
904 tier_dict[key1]["tier 2.5"] += 1
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
905
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
906 elif (trimmed):
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
907 tier = "4"
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
908 counter_tier4 += 1
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
909 tier_dict[key1]["tier 4"] += 1
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
910
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
911 elif softclipped_mutation_allMates:
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
912 tier = "5.1"
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
913 counter_tier51 += 1
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
914 tier_dict[key1]["tier 5.1"] += 1
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
915
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
916 elif softclipped_mutation_oneOfTwoMates:
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
917 tier = "5.2"
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
918 counter_tier52 += 1
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
919 tier_dict[key1]["tier 5.2"] += 1
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
920
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
921 elif softclipped_mutation_oneOfTwoSSCS:
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
922 tier = "5.3"
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
923 counter_tier53 += 1
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
924 tier_dict[key1]["tier 5.3"] += 1
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
925
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
926 elif softclipped_mutation_oneMate:
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
927 tier = "5.4"
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
928 counter_tier54 += 1
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
929 tier_dict[key1]["tier 5.4"] += 1
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
930
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
931 elif softclipped_mutation_oneMateOneSSCS:
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
932 tier = "5.5"
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
933 counter_tier55 += 1
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
934 tier_dict[key1]["tier 5.5"] += 1
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
935
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
936 elif (contradictory):
28
afda74e874ac planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 27
diff changeset
937 tier = "6"
afda74e874ac planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 27
diff changeset
938 counter_tier6 += 1
afda74e874ac planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 27
diff changeset
939 tier_dict[key1]["tier 6"] += 1
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
940
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
941 else:
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
942 tier = "7"
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
943 counter_tier7 += 1
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
944 tier_dict[key1]["tier 7"] += 1
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
945
7
ded0dc6a20d3 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 6
diff changeset
946 chrom, pos, ref_a, alt_a = re.split(r'\#', key1)
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
947 var_id = '-'.join([chrom, str(int(pos)+1), ref, alt])
2
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
948 sample_tag = key2[:-5]
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
949 array2 = np.unique(whole_array) # remove duplicate sequences to decrease running time
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
950 # exclude identical tag from array2, to prevent comparison to itself
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
951 same_tag = np.where(array2 == sample_tag)
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
952 index_array2 = np.arange(0, len(array2), 1)
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
953 index_withoutSame = np.delete(index_array2, same_tag) # delete identical tag from the data
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
954 array2 = array2[index_withoutSame]
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
955 if len(array2) != 0: # only perform chimera analysis if there is more than 1 variant
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
956 array1_half = sample_tag[0:int(len(sample_tag) / 2)] # mate1 part1
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
957 array1_half2 = sample_tag[int(len(sample_tag) / 2):int(len(sample_tag))] # mate1 part 2
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
958 array2_half = np.array([ii[0:int(len(ii) / 2)] for ii in array2]) # mate2 part1
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
959 array2_half2 = np.array([ii[int(len(ii) / 2):int(len(ii))] for ii in array2]) # mate2 part2
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
960
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
961 min_tags_list_zeros = []
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
962 chimera_tags = []
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
963 for mate_b in [False, True]:
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
964 i = 0 # counter, only used to see how many HDs of tags were already calculated
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
965 if mate_b is False: # HD calculation for all a's
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
966 half1_mate1 = array1_half
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
967 half2_mate1 = array1_half2
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
968 half1_mate2 = array2_half
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
969 half2_mate2 = array2_half2
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
970 elif mate_b is True: # HD calculation for all b's
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
971 half1_mate1 = array1_half2
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
972 half2_mate1 = array1_half
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
973 half1_mate2 = array2_half2
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
974 half2_mate2 = array2_half
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
975 # calculate HD of "a" in the tag to all "a's" or "b" in the tag to all "b's"
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
976 dist = np.array([sum(itertools.imap(operator.ne, half1_mate1, c)) for c in half1_mate2])
2
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
977 min_index = np.where(dist == dist.min()) # get index of min HD
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
978 # get all "b's" of the tag or all "a's" of the tag with minimum HD
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
979 min_tag_half2 = half2_mate2[min_index]
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
980 min_tag_array2 = array2[min_index] # get whole tag with min HD
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
981 min_value = dist.min()
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
982 # calculate HD of "b" to all "b's" or "a" to all "a's"
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
983 dist_second_half = np.array([sum(itertools.imap(operator.ne, half2_mate1, e))
2
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
984 for e in min_tag_half2])
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
985
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
986 dist2 = dist_second_half.max()
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
987 max_index = np.where(dist_second_half == dist_second_half.max())[0] # get index of max HD
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
988 max_tag = min_tag_array2[max_index]
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
989
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
990 # tags which have identical parts:
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
991 if min_value == 0 or dist2 == 0:
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
992 min_tags_list_zeros.append(tag)
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
993 chimera_tags.append(max_tag)
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
994 # chimeric = True
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
995 # else:
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
996 # chimeric = False
2
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
997
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
998 # if mate_b is False:
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
999 # text = "pos {}: sample tag: {}; HD a = {}; HD b' = {}; similar tag(s): {}; chimeric = {}".format(pos, sample_tag, min_value, dist2, list(max_tag), chimeric)
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1000 # else:
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1001 # text = "pos {}: sample tag: {}; HD a' = {}; HD b = {}; similar tag(s): {}; chimeric = {}".format(pos, sample_tag, dist2, min_value, list(max_tag), chimeric)
2
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1002 i += 1
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1003 chimera_tags = [x for x in chimera_tags if x != []]
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1004 chimera_tags_new = []
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1005 for i in chimera_tags:
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1006 if len(i) > 1:
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1007 for t in i:
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1008 chimera_tags_new.append(t)
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1009 else:
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1010 chimera_tags_new.extend(i)
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1011 chimera = ", ".join(chimera_tags_new)
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1012 else:
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1013 chimera_tags_new = []
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1014 chimera = ""
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1015
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1016 if len(chimera_tags_new) > 0:
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1017 chimera_tags_new.append(sample_tag)
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1018 key_chimera = ",".join(sorted(chimera_tags_new))
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1019 if key_chimera in chimeric_tag.keys():
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1020 chimeric_tag[key_chimera].append(float(tier))
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1021 else:
6
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
1022 chimeric_tag[key_chimera] = [float(tier)]
2
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1023
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1024 if (read_pos1 == -1):
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1025 read_pos1 = read_len_median1 = None
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1026 if (read_pos4 == -1):
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1027 read_pos4 = read_len_median4 = None
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1028 if (read_pos2 == -1):
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1029 read_pos2 = read_len_median2 = None
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1030 if (read_pos3 == -1):
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1031 read_pos3 = read_len_median3 = None
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1032 line = (var_id, tier, key2[:-5], 'ab1.ba2', read_pos1, read_pos4, read_len_median1, read_len_median4, dcs_median) + details1 + (sscs_mut_ab, sscs_mut_ba, sscs_ref_ab, sscs_ref_ba, add_mut14, chimera)
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1033 ws1.write_row(row, 0, line)
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1034 line = ("", "", key2[:-5], 'ab2.ba1', read_pos2, read_pos3, read_len_median2, read_len_median3, dcs_median) + details2 + (sscs_mut_ab, sscs_mut_ba, sscs_ref_ab, sscs_ref_ba, add_mut23, chimera)
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1035 ws1.write_row(row + 1, 0, line)
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1036
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1037 ws1.conditional_format('L{}:M{}'.format(row + 1, row + 2),
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1038 {'type': 'formula',
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1039 'criteria': '=OR($B${}="1.1", $B${}="1.2")'.format(row + 1, row + 1),
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1040 'format': format1,
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1041 'multi_range': 'L{}:M{} T{}:U{} B{}'.format(row + 1, row + 2, row + 1, row + 2, row + 1, row + 2)})
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1042 ws1.conditional_format('L{}:M{}'.format(row + 1, row + 2),
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1043 {'type': 'formula',
46
f733c425b804 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 45
diff changeset
1044 'criteria': '=OR($B${}="2.1", $B${}="2.2", $B${}="2.3", $B${}="2.4", $B${}="2.5")'.format(row + 1, row + 1, row + 1, row + 1, row + 1),
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1045 'format': format3,
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1046 'multi_range': 'L{}:M{} T{}:U{} B{}'.format(row + 1, row + 2, row + 1, row + 2, row + 1, row + 2)})
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1047 ws1.conditional_format('L{}:M{}'.format(row + 1, row + 2),
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1048 {'type': 'formula',
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1049 'criteria': '=$B${}>="3"'.format(row + 1),
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1050 'format': format2,
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1051 'multi_range': 'L{}:M{} T{}:U{} B{}'.format(row + 1, row + 2, row + 1, row + 2, row + 1, row + 2)})
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1052
11
84a1a3f70407 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 10
diff changeset
1053 row += 3
2
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1054 if chimera_correction:
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1055 chimeric_dcs_high_tiers = 0
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1056 chimeric_dcs = 0
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1057 for keys_chimera in chimeric_tag.keys():
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1058 tiers = chimeric_tag[keys_chimera]
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1059 chimeric_dcs += len(tiers) - 1
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1060 high_tiers = sum(1 for t in tiers if t < 3.)
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1061 if high_tiers == len(tiers):
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1062 chimeric_dcs_high_tiers += high_tiers - 1
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1063 else:
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1064 chimeric_dcs_high_tiers += high_tiers
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1065 chimera_dict[key1] = (chimeric_dcs, chimeric_dcs_high_tiers)
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1066 # sheet 2
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1067 if chimera_correction:
3
4fc62ab6e9e8 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 2
diff changeset
1068 header_line2 = ('variant ID', 'cvrg', 'AC alt (all tiers)', 'AF (all tiers)', 'chimeras in AC alt (all tiers)', 'chimera-corrected cvrg', 'chimera-corrected AF (all tiers)', 'cvrg (tiers 1.1-2.4)', 'AC alt (tiers 1.1-2.4)', 'AF (tiers 1.1-2.4)', 'chimeras in AC alt (tiers 1.1-2.4)', 'chimera-corrected cvrg (tiers 1.1-2.4)', 'chimera-corrected AF (tiers 1.1-2.4)', 'AC alt (orginal DCS)', 'AF (original DCS)',
46
f733c425b804 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 45
diff changeset
1069 'tier 1.1', 'tier 1.2', 'tier 2.1', 'tier 2.2', 'tier 2.3', 'tier 2.4', 'tier 2.5',
f733c425b804 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 45
diff changeset
1070 'tier 3.1', 'tier 3.2', 'tier 4', 'tier 5.1', 'tier 5.2', 'tier 5.3', 'tier 5.4', 'tier 5.5', 'tier 6', 'tier 7', 'AF 1.1-1.2', 'AF 1.1-2.1', 'AF 1.1-2.2',
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1071 'AF 1.1-2.3', 'AF 1.1-2.4', 'AF 1.1-3.1', 'AF 1.1-3.2', 'AF 1.1-4.1', 'AF 1.1-4.2', 'AF 1.1-5.1', 'AF 1.1-5.2', 'AF 1.1-5.3', 'AF 1.1-5.4', 'AF 1.1-5.5', 'AF 1.1-6')
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1072 else:
2
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1073 header_line2 = ('variant ID', 'cvrg', 'AC alt (all tiers)', 'AF (all tiers)', 'cvrg (tiers 1.1-2.4)', 'AC alt (tiers 1.1-2.4)', 'AF (tiers 1.1-2.4)', 'AC alt (orginal DCS)', 'AF (original DCS)',
46
f733c425b804 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 45
diff changeset
1074 'tier 1.1', 'tier 1.2', 'tier 2.1', 'tier 2.2', 'tier 2.3', 'tier 2.4', 'tier 2.5',
f733c425b804 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 45
diff changeset
1075 'tier 3.1', 'tier 3.2', 'tier 4', 'tier 5.1', 'tier 5.2', 'tier 5.3', 'tier 5.4', 'tier 5.5', 'tier 6', 'tier 7', 'AF 1.1-1.2', 'AF 1.1-2.1', 'AF 1.1-2.2',
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1076 'AF 1.1-2.3', 'AF 1.1-2.4', 'AF 1.1-3.1', 'AF 1.1-3.2', 'AF 1.1-4.1', 'AF 1.1-4.2', 'AF 1.1-5.1', 'AF 1.1-5.2', 'AF 1.1-5.3', 'AF 1.1-5.4', 'AF 1.1-5.5', 'AF 1.1-6')
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1077
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1078 ws2.write_row(0, 0, header_line2)
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1079 row = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1080
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1081 for key1, value1 in sorted(tier_dict.items()):
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1082 if key1 in pure_tags_dict_short.keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1083 i = np.where(np.array(['#'.join(str(i) for i in z)
7
ded0dc6a20d3 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 6
diff changeset
1084 for z in zip(mut_array[:, 0], mut_array[:, 1], mut_array[:, 2], mut_array[:, 3])]) == key1)[0][0]
6
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
1085 ref = mut_array[i, 2]
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
1086 alt = mut_array[i, 3]
7
ded0dc6a20d3 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 6
diff changeset
1087 chrom, pos, ref_a, alt_a = re.split(r'\#', key1)
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1088 ref_count = cvrg_dict[key1][0]
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1089 alt_count = cvrg_dict[key1][1]
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1090 cvrg = ref_count + alt_count
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1091
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1092 var_id = '-'.join([chrom, str(int(pos)+1), ref, alt])
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1093 lst = [var_id, cvrg]
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1094 used_tiers = []
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1095 cum_af = []
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1096 for key2, value2 in sorted(value1.items()):
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1097 # calculate cummulative AF
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1098 used_tiers.append(value2)
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1099 if len(used_tiers) > 1:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1100 cum = safe_div(sum(used_tiers), cvrg)
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1101 cum_af.append(cum)
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1102 if sum(used_tiers) == 0: # skip mutations that are filtered by the VA in the first place
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1103 continue
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1104 lst.extend([sum(used_tiers), safe_div(sum(used_tiers), cvrg)])
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1105 if chimera_correction:
2
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1106 chimeras_all = chimera_dict[key1][0]
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1107 new_alt = sum(used_tiers) - chimeras_all
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1108 fraction_chimeras = safe_div(chimeras_all, float(sum(used_tiers)))
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1109 if fraction_chimeras is None:
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1110 fraction_chimeras = 0.
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1111 new_cvrg = cvrg * (1. - fraction_chimeras)
3
4fc62ab6e9e8 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 2
diff changeset
1112 lst.extend([chimeras_all, new_cvrg, safe_div(new_alt, new_cvrg)])
46
f733c425b804 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 45
diff changeset
1113 lst.extend([(cvrg - sum(used_tiers[-10:])), sum(used_tiers[0:7]), safe_div(sum(used_tiers[0:7]), (cvrg - sum(used_tiers[-10:])))])
2
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1114 if chimera_correction:
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1115 chimeras_all = chimera_dict[key1][1]
46
f733c425b804 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 45
diff changeset
1116 new_alt = sum(used_tiers[0:7]) - chimeras_all
f733c425b804 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 45
diff changeset
1117 fraction_chimeras = safe_div(chimeras_all, float(sum(used_tiers[0:7])))
2
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1118 if fraction_chimeras is None:
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1119 fraction_chimeras = 0.
46
f733c425b804 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 45
diff changeset
1120 new_cvrg = (cvrg - sum(used_tiers[-10:])) * (1. - fraction_chimeras)
3
4fc62ab6e9e8 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 2
diff changeset
1121 lst.extend([chimeras_all, new_cvrg, safe_div(new_alt, new_cvrg)])
2
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1122 lst.extend([alt_count, safe_div(alt_count, cvrg)])
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1123 lst.extend(used_tiers)
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1124 lst.extend(cum_af)
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1125 lst = tuple(lst)
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1126 ws2.write_row(row + 1, 0, lst)
41
db3ed9202516 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 40
diff changeset
1127 if chimera_correction:
db3ed9202516 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 40
diff changeset
1128 ws2.conditional_format('P{}:Q{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$P$1="tier 1.1"', 'format': format12, 'multi_range': 'P{}:Q{} P1:Q1'.format(row + 2, row + 2)})
46
f733c425b804 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 45
diff changeset
1129 ws2.conditional_format('R{}:V{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$R$1="tier 2.1"', 'format': format32, 'multi_range': 'R{}:V{} R1:V1'.format(row + 2, row + 2)})
f733c425b804 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 45
diff changeset
1130 ws2.conditional_format('W{}:AF{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$W$1="tier 3.1"', 'format': format22, 'multi_range': 'W{}:AF{} W1:AF1'.format(row + 2, row + 2)})
41
db3ed9202516 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 40
diff changeset
1131 else:
db3ed9202516 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 40
diff changeset
1132 ws2.conditional_format('J{}:K{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$J$1="tier 1.1"', 'format': format12, 'multi_range': 'J{}:K{} J1:K1'.format(row + 2, row + 2)})
46
f733c425b804 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 45
diff changeset
1133 ws2.conditional_format('L{}:P{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$L$1="tier 2.1"', 'format': format32, 'multi_range': 'L{}:P{} L1:P1'.format(row + 2, row + 2)})
f733c425b804 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 45
diff changeset
1134 ws2.conditional_format('Q{}:Z{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$P$1="tier 3.1"', 'format': format22, 'multi_range': 'Q{}:Z{} Q1:Z1'.format(row + 2, row + 2)})
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1135 row += 1
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1136
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1137 # sheet 3
2
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1138 sheet3 = [("tier 1.1", counter_tier11), ("tier 1.2", counter_tier12), ("tier 2.1", counter_tier21),
46
f733c425b804 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 45
diff changeset
1139 ("tier 2.2", counter_tier22), ("tier 2.3", counter_tier23), ("tier 2.4", counter_tier24), ("tier 2.5", counter_tier25),
f733c425b804 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 45
diff changeset
1140 ("tier 3.1", counter_tier31), ("tier 3.2", counter_tier32), ("tier 4", counter_tier4),
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1141 ("tier 5.1", counter_tier51), ("tier 5.2", counter_tier52),
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1142 ("tier 5.3", counter_tier53), ("tier 5.4", counter_tier54), ("tier 5.5", counter_tier55), ("tier 6", counter_tier6), ("tier 7", counter_tier7)]
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1143
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1144 header = ("tier", "count")
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1145 ws3.write_row(0, 0, header)
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1146
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1147 for i in range(len(sheet3)):
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1148 ws3.write_row(i + 1, 0, sheet3[i])
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1149 ws3.conditional_format('A{}:B{}'.format(i + 2, i + 2),
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1150 {'type': 'formula',
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1151 'criteria': '=OR($A${}="tier 1.1", $A${}="tier 1.2")'.format(i + 2, i + 2),
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1152 'format': format1})
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1153 ws3.conditional_format('A{}:B{}'.format(i + 2, i + 2),
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1154 {'type': 'formula',
46
f733c425b804 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 45
diff changeset
1155 'criteria': '=OR($A${}="tier 2.1", $A${}="tier 2.2", $A${}="tier 2.3", $A${}="tier 2.4", $A${}="tier 2.5")'.format(i + 2, i + 2, i + 2, i + 2, i + 2),
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1156 'format': format3})
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1157 ws3.conditional_format('A{}:B{}'.format(i + 2, i + 2),
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1158 {'type': 'formula',
30
e7da54e10e2d planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 29
diff changeset
1159 'criteria': '=$A${}>="3"'.format(i + 2),
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1160 'format': format2})
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1161
28
afda74e874ac planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 27
diff changeset
1162 description_tiers = [("Tier 1.1", "both ab and ba SSCS present (>75% of the sites with alternative base) and minimal FS>=3 for both SSCS in at least one mate"), ("", ""),
afda74e874ac planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 27
diff changeset
1163 ("Tier 1.2", "both ab and ba SSCS present (>75% of the sites with alt. base) and mate pair validation (min. FS=1) and minimal FS>=3 for at least one of the SSCS"),
afda74e874ac planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 27
diff changeset
1164 ("Tier 2.1", "both ab and ba SSCS present (>75% of the sites with alt. base) and minimal FS>=3 for at least one of the SSCS in at least one mate"),
afda74e874ac planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 27
diff changeset
1165 ("Tier 2.2", "both ab and ba SSCS present (>75% of the sites with alt. base) and mate pair validation (min. FS=1)"),
afda74e874ac planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 27
diff changeset
1166 ("Tier 2.3", "both ab and ba SSCS present (>75% of the sites with alt. base) and minimal FS=1 for both SSCS in one mate and minimal FS>=3 for at least one of the SSCS in the other mate"),
afda74e874ac planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 27
diff changeset
1167 ("Tier 2.4", "both ab and ba SSCS present (>75% of the sites with alt. base) and minimal FS=1 for both SSCS in at least one mate"),
afda74e874ac planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 27
diff changeset
1168 ("Tier 3.1", "both ab and ba SSCS present (>50% of the sites with alt. base) and recurring mutation on this position"),
afda74e874ac planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 27
diff changeset
1169 ("Tier 3.2", "both ab and ba SSCS present (>50% of the sites with alt. base) and minimal FS>=1 for both SSCS in at least one mate"),
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1170 ("Tier 4.1", "variants at the start or end of the reads"), ("Tier 4.2", "mates with contradictory information"),
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1171 ("Tier 5.1", "variant is close to softclipping in both mates"),
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1172 ("Tier 5.2", "variant is close to softclipping in one of the mates"),
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1173 ("Tier 5.3", "variant is close to softclipping in one of the SSCS of both mates"),
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1174 ("Tier 5.4", "variant is close to softclipping in one mate (no information of second mate"),
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1175 ("Tier 5.5", "variant is close to softclipping in one of the SSCS (no information of the second mate"),
28
afda74e874ac planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 27
diff changeset
1176 ("Tier 6", "remaining variants")]
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1177 examples_tiers = [[("Chr5:5-20000-11068-C-G", "1.1", "AAAAAGATGCCGACTACCTT", "ab1.ba2", "254", "228", "287", "288", "289",
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1178 "3", "6", "3", "6", "0", "0", "3", "6", "0", "0", "1", "1", "0", "0", "0", "0", "0", "0",
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1179 "4081", "4098", "5", "10", "", ""),
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1180 ("", "", "AAAAAGATGCCGACTACCTT", "ab2.ba1", None, None, None, None,
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1181 "289", "0", "0", "0", "0", "0", "0", "0", "0", None, None, None, None,
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1182 "0", "0", "0", "0", "0", "0", "4081", "4098", "5", "10", "", "")],
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1183 [("Chr5:5-20000-11068-C-G", "1.1", "AAAAATGCGTAGAAATATGC", "ab1.ba2", "254", "228", "287", "288", "289",
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1184 "33", "43", "33", "43", "0", "0", "33", "43", "0", "0", "1", "1", "0", "0", "0", "0", "0",
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1185 "0", "4081", "4098", "5", "10", "", ""),
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1186 ("", "", "AAAAATGCGTAGAAATATGC", "ab2.ba1", "268", "268", "270", "288", "289",
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1187 "11", "34", "10", "27", "0", "0", "10", "27", "0", "0", "1", "1", "0", "0", "1",
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1188 "7", "0", "0", "4081", "4098", "5", "10", "", "")],
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1189 [("Chr5:5-20000-10776-G-T", "1.2", "CTATGACCCGTGAGCCCATG", "ab1.ba2", "132", "132", "287", "288", "290",
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1190 "4", "1", "4", "1", "0", "0", "4", "1", "0", "0", "1", "1", "0", "0", "0", "0",
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1191 "0", "0", "1", "6", "47170", "41149", "", ""),
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1192 ("", "", "CTATGACCCGTGAGCCCATG", "ab2.ba1", "77", "132", "233", "200", "290",
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1193 "4", "1", "4", "1", "0", "0", "4", "1", "0", "0", "1", "1", "0", "0", "0", "0",
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1194 "0", "0", "1", "6", "47170", "41149", "", "")],
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1195 [("Chr5:5-20000-11068-C-G", "2.1", "AAAAAAACATCATACACCCA", "ab1.ba2", "246", "244", "287", "288", "289",
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1196 "2", "8", "2", "8", "0", "0", "2", "8", "0", "0", "1", "1", "0", "0", "0", "0", "0", "0",
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1197 "4081", "4098", "5", "10", "", ""),
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1198 ("", "", "AAAAAAACATCATACACCCA", "ab2.ba1", None, None, None, None,
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1199 "289", "0", "0", "0", "0", "0", "0", "0", "0", None, None, None, None, "0", "0",
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1200 "0", "0", "0", "0", "4081", "4098", "5", "10", "", "")],
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1201 [("Chr5:5-20000-11068-C-G", "2.2", "ATCAGCCATGGCTATTATTG", "ab1.ba2", "72", "72", "217", "288", "289",
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1202 "1", "1", "1", "1", "0", "0", "1", "1", "0", "0", "1", "1", "0", "0", "0", "0", "0", "0",
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1203 "4081", "4098", "5", "10", "", ""),
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1204 ("", "", "ATCAGCCATGGCTATTATTG", "ab2.ba1", "153", "164", "217", "260", "289",
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1205 "1", "1", "1", "1", "0", "0", "1", "1", "0", "0", "1", "1", "0", "0", "0", "0", "0", "0",
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1206 "4081", "4098", "5", "10", "", "")],
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1207 [("Chr5:5-20000-11068-C-G", "2.3", "ATCAATATGGCCTCGCCACG", "ab1.ba2", None, None, None, None,
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1208 "289", "0", "5", "0", "5", "0", "0", "0", "5", None, None, None, "1", "0",
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1209 "0", "0", "0", "0", "0", "4081", "4098", "5", "10", "", ""),
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1210 ("", "", "ATCAATATGGCCTCGCCACG", "ab2.ba1", "202", "255", "277", "290", "289",
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1211 "1", "3", "1", "3", "0", "0", "1", "3", "0", "0", "1", "1", "0", "0", "0", "0",
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1212 "0", "0", "4081", "4098", "5", "10", "", "")],
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1213 [("Chr5:5-20000-11068-C-G", "2.4", "ATCAGCCATGGCTATTTTTT", "ab1.ba2", "72", "72", "217", "288", "289",
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1214 "1", "1", "1", "1", "0", "0", "1", "1", "0", "0", "1", "1", "0", "0", "0", "0", "0", "0", "4081",
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1215 "4098", "5", "10", "", ""),
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1216 ("", "", "ATCAGCCATGGCTATTTTTT", "ab2.ba1", "153", "164", "217", "260", "289",
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1217 "1", "1", "0", "0", "0", "0", "0", "0", "0", "0", "0", "0", "1", "1", "0", "0", "0", "0", "4081",
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1218 "4098", "5", "10", "", "")],
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1219 [("Chr5:5-20000-10776-G-T", "3.1", "ATGCCTACCTCATTTGTCGT", "ab1.ba2", "46", "15", "287", "288", "290",
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1220 "3", "3", "3", "2", "3", "1", "0", "1", "1", "0.5", "0", "0.5", "0", "0", "0", "1",
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1221 "0", "0", "3", "3", "47170", "41149", "", ""),
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1222 ("", "", "ATGCCTACCTCATTTGTCGT", "ab2.ba1", None, "274", None,
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1223 "288", "290", "0", "3", "0", "2", "0", "1", "0", "1", None, "0.5", None, "0.5",
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1224 "0", "0", "0", "1", "0", "0", "3", "3", "47170", "41149", "", "")],
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1225 [("Chr5:5-20000-11315-C-T", "3.2", "ACAACATCACGTATTCAGGT", "ab1.ba2", "197", "197", "240", "255", "271",
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1226 "2", "3", "2", "3", "0", "1", "2", "2", "0", "0.333333333333333", "1",
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1227 "0.666666666666667", "0", "0", "0", "0", "0", "0", "1", "1", "6584", "6482", "", ""),
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1228 ("", "", "ACAACATCACGTATTCAGGT", "ab2.ba1", "35", "35", "240", "258", "271",
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1229 "2", "3", "2", "3", "0", "1", "2", "2", "0", "0.333333333333333", "1",
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1230 "0.666666666666667", "0", "0", "0", "0", "0", "0", "1", "1", "6584", "6482", "", "")],
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1231 [("Chr5:5-20000-13983-G-C", "4.1", "AAAAAAAGAATAACCCACAC", "ab1.ba2", "0", "100", "255", "276", "269",
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1232 "5", "6", "0", "6", "0", "0", "5", "6", "0", "0", "0", "1", "0", "0", "0", "0", "5", "0", "1", "1", "5348", "5350", "", ""),
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1233 ("", "", "AAAAAAAGAATAACCCACAC", "ab2.ba1", None, None, None, None,
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1234 "269", "0", "0", "0", "0", "0", "0", "0", "0", None, None, None, None, "0",
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1235 "0", "0", "0", "0", "0", "1", "1", "5348", "5350", "", "")],
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1236 [("Chr5:5-20000-13963-T-C", "4.2", "TTTTTAAGAATAACCCACAC", "ab1.ba2", "38", "38", "240", "283", "263",
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1237 "110", "54", "110", "54", "0", "0", "110", "54", "0", "0", "1", "1", "0", "0", "0",
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1238 "0", "0", "0", "1", "1", "5348", "5350", "", ""),
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1239 ("", "", "TTTTTAAGAATAACCCACAC", "ab2.ba1", "100", "112", "140", "145", "263",
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1240 "7", "12", "7", "12", "7", "12", "0", "0", "1", "1", "0",
2
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1241 "0", "0", "0", "0", "0", "0", "0", "1", "1", "5348", "5350", "", "")],
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1242 [("" * 34), ("" * 34)], [("" * 34), ("" * 34)], [("" * 34), ("" * 34)], [("" * 34), ("" * 34)], [("" * 34), ("" * 34)],
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1243 [("Chr5:5-20000-13983-G-C", "6", "ATGTTGTGAATAACCCACAC", "ab1.ba2", None, "186", None, "276", "269",
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1244 "0", "6", "0", "6", "0", "0", "0", "6", "0", "0", "0", "1", "0", "0", "0", "0", "0",
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1245 "0", "1", "1", "5348", "5350", "", ""),
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1246 ("", "", "ATGTTGTGAATAACCCACAC", "ab2.ba1", None, None, None, None,
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1247 "269", "0", "0", "0", "0", "0", "0", "0", "0", None, None, None, None, "0",
2
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1248 "0", "0", "0", "0", "0", "1", "1", "5348", "5350", "", "")]]
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1249
43
d21960b45a6b planemo upload for repository https://github.co