annotate bio_hansel.xml @ 3:29faaa849e41 draft

planemo upload for repository https://github.com/phac-nml/bio_hansel commit 4f09991d49a1701c54d5b97601a622e111c7290c

<tool id="bio_hansel" name="Bio Hansel" version="1.0.0">
    <description>SNV Subtyping with genome assemblies or reads</description>
    <requirements>
        <requirement type="package" version="1.1.0">bio_hansel</requirement>
        <requirement type="package" version="17.2.0">attrs</requirement>
    </requirements>
    <command detect_errors="exit_code"><![CDATA[
        ## Preparing file input.
        #if $data_type.type == "paired":

            ln -s '$data_type.fastq_input1' '$data_type.fastq_input1.name' &&
            ln -s '$data_type.fastq_input2' '$data_type.fastq_input2.name' &&

        #elif $data_type.type == "collection":

            ln -s '$data_type.fastq_input1.forward' '$data_type.fastq_input1.name'_1 &&
            ln -s '$data_type.fastq_input1.reverse' '$data_type.fastq_input1.name'_2 &&

        #elif $data_type.type == "single":

            #if $data_type.fastq_input1.is_of_type('fastqsanger') or $data_type.fastq_input1.is_of_type('fastq'):
                ln -s '$data_type.fastq_input1' '$data_type.fastq_input1.name' &&
            #end if

            #if $data_type.fastq_input1.is_of_type('fasta'):
                ln -s '$data_type.fastq_input1' '$data_type.fastq_input1.name' &&
            #end if

        #end if


        ## Checking for custom scheme.
        #if $type_of_scheme.scheme_type == "custom":
            #if $type_of_scheme.scheme_input.is_of_type('fasta'):
                ln -s '$type_of_scheme.scheme_input' '$type_of_scheme.scheme_input.name' &&
            #end if
        #end if

        ## Start the actual command here
        hansel 


        ## Select the scheme
        -s

        #if $type_of_scheme.scheme_type == "heidelberg":
            heidelberg
        #elif $type_of_scheme.scheme_type == "enteritidis":
            enteritidis
        #elif $type_of_scheme.scheme_type == "custom":
            '$type_of_scheme.scheme_input.name'
        #end if


        #if $kmer_vals.kmer_min
            --min-kmer-freq $kmer_vals.kmer_min
        #end if

        #if $kmer_vals.kmer_max
            --max-kmer-freq $kmer_vals.kmer_max
        #end if

        #if $qc_vals.low_cov_depth_freq
            --low-cov-depth-freq $qc_vals.low_cov_depth_freq
        #end if

        #if $qc_vals.max_missing_tiles
            --max-missing-tiles $qc_vals.max_missing_tiles
        #end if

        #if $qc_vals.min_ambiguous_tiles
            --min-ambiguous-tiles $qc_vals.min_ambiguous_tiles
        #end if

        #if $qc_vals.max_intermediate_tiles
            --max-intermediate-tiles $qc_vals.max_intermediate_tiles
        #end if

        ## Adding more parameters to the command.
        -vvv -t "\${GALAXY_SLOTS:-1}" -o results.tab -O match_results.tab -S tech_results.tab


        ## Entering the file inputs

        #if $data_type.type == "single":
            '$data_type.fastq_input1.name'

        #elif $data_type.type =="collection":
            -p '$data_type.fastq_input1.name'_1  '$data_type.fastq_input1.name'_2
        
        #elif $data_type.type =="paired":
            -p '$data_type.fastq_input1.name'  '$data_type.fastq_input2.name'

        #end if


    ]]></command>
    <inputs>
        <conditional name="data_type">
            <param name="type" type="select" label="Specify the read type.">
                <option value="single">Single-end Data</option>
                <option value="paired">Paired-end Data</option>
                <option value="collection">Collection Paired-end Data</option>
            </param>
            <when value="single">
                <param name="fastq_input1" type="data" format="fastqsanger, fastq, fasta" label="Single end read file(s)"/>
            </when>
            <when value="paired">
                <param name="fastq_input1" type="data" format="fastqsanger, fastq" label="Forward paired-end read file"/>
                <param name="fastq_input2" type="data" format="fastqsanger, fastq" label="Reverse paired-end read file"/>
            </when>
            <when value="collection">
                <param name="fastq_input1" type="data_collection" label="Paired-end reads collection" optional="false" format="fastqsanger, fastq" collection_type="paired" />
            </when>
        </conditional>
        <conditional name="type_of_scheme">
            <param name="scheme_type" type="select" label="Specify scheme to use. (Heidelberg is default)">
                <option value="heidelberg">Heidelberg scheme</option>
                <option value="enteritidis">Enteritidis scheme</option>
                <option value="custom">Specify your own custom scheme</option>
            </param>
            <when value="heidelberg"/>
            <when value="enteritidis"/>
            <when value="custom">
                <param name="scheme_input" type="data" format="fasta" label="Scheme Input"/>
            </when>
        </conditional>
        <!-- K-mer frequencies. -->
        <section name="kmer_vals" title="K-mer Frequency Thresholds" expanded="False">
            <param name="kmer_min" argument="--min-kmer-freq" optional="True" type="integer" min="0" label="Min k-mer freq/coverage" value="8" help="default = 8"/>
            <param name="kmer_max" argument="--max-kmer-freq" optional="True" type="integer" min="1" label="Max k-mer freq/coverage" value="1000" help="default = 1000"/>
        </section>
        <!-- Quality Checking Parameters -->
        <section name="qc_vals" title="Quality Checking Thresholds" expanded="False">
            <param name="low_cov_depth_freq" argument="--low-cov-depth-freq" optional="True" type="integer" min="0" label="QC: Frequency below this coverage are considered low coverage" value="20" help="default = 20"/>
            <param name="min_ambiguous_tiles" argument="--min-ambiguous-tiles" optional="True" type="integer" min="0" label="QC: Min number of tiles missing for Ambiguous Result" value="3" help="default = 3"/>
            <param name="max_missing_tiles" argument="--max-missing-tiles" optional="True" type="float" min="0" max="1" label="QC: Decimal Proportion of max allowed missing tiles" value="0.05" help="default = 0.05, valid values {0.0 - 1.0}"/>
            <param name="max_intermediate_tiles" argument="--max-intermediate-tiles" optional="True" type="float" min="0" max="1" label="QC: Decimal Proportion of max allowed missing tiles for an intermediate subtype" value="0.05" help="default = 0.05, valid values {0.0 - 1.0}"/> 
        </section>
    </inputs>
    <outputs>
        <data format="tabular" name="results.tab" from_work_dir="results.tab" label="results.tab"/>
        <data format="tabular" name="match_results.tab" from_work_dir="match_results.tab" label="match_results.tab"/>
        <data format="tabular" name="tech_results.tab" from_work_dir="tech_results.tab" label="tech_results.tab"/>
    </outputs>
    <tests>
        <test>
            <param name="type" value="single"/>
            <param name="type_of_scheme" value="heidelberg"/>
            <param name="fastq_input1" value="SRR1002850_SMALL.fasta"/>
            <output name="results.tab">
                <assert_contents>
                    <has_text_matching expression="sample\s+scheme\s+scheme_version\s+subtype\s+all_subtypes\s+tiles_matching_subtype\s+are_subtypes_consistent\s+inconsistent_subtypes\s+n_tiles_matching_all\s+n_tiles_matching_all_expected\s+n_tiles_matching_positive\s+n_tiles_matching_positive_expected\s+n_tiles_matching_subtype\s+n_tiles_matching_subtype_expected\s+file_path\s+qc_status\s+qc_message"/>
                </assert_contents>
            </output>
            <output name="match_results.tab">
                <assert_contents>
                    <has_text_matching expression="tilename\s+seq\s+is_revcomp\s+contig_id\s+match_index\s+refposition\s+subtype\s+is_pos_tile\s+sample\s+file_path\s+scheme\s+scheme_version\s+qc_status\s+qc_message"/>
                </assert_contents>
            </output>
            <output name="tech_results.tab">
                <assert_contents>
                    <has_text_matching expression="sample\s+subtype\s+qc_status\s+qc_message"/>
                </assert_contents>
            </output>
        </test>
        <test>
            <param name="type" value="paired"/>
            <param name="type_of_scheme" value="heidelberg"/>
            <param name="fastq_input1" value="SRR5646583_SMALL_1.fastq"/>
            <param name="fastq_input2" value="SRR5646583_SMALL_2.fastq"/>
            <output name="results.tab">
                <assert_contents>
                    <has_text_matching expression="sample\s+scheme\s+scheme_version\s+subtype\s+all_subtypes\s+tiles_matching_subtype\s+are_subtypes_consistent\s+inconsistent_subtypes\s+n_tiles_matching_all\s+n_tiles_matching_all_expected\s+n_tiles_matching_positive\s+n_tiles_matching_positive_expected\s+n_tiles_matching_subtype\s+n_tiles_matching_subtype_expected\s+file_path\s+qc_status\s+qc_message"/>
                </assert_contents>
            </output>
            <output name="match_results.tab">
                <assert_contents>
                    <has_text_matching expression="tilename\s+seq\s+freq\s+refposition\s+subtype\s+is_pos_tile\s+is_kmer_freq_okay\s+sample\s+scheme\s+scheme_version\s+qc_status\s+qc_message"/>
                </assert_contents>
            </output>
            <output name="tech_results.tab">
                <assert_contents>
                    <has_text_matching expression="sample\s+subtype\s+qc_status\s+qc_message"/>
                </assert_contents>
            </output>
        </test>
    </tests>
    <help><![CDATA[
***********************************************************
  bio_hansel - Heidelberg And eNteritidis Snp ELucidation
***********************************************************

Subtype *Salmonella enterica* subsp. enterica serovar Heidelberg and Enteritidis genomes using *in-silico* 33 bp k-mer SNP subtyping schemes developed by Genevieve Labbe et al.
Subtype *Salmonella* genome assemblies (FASTA files) and/or whole-genome sequencing reads (FASTQ files)!
 
Usage
=====
1) Enter your FASTA/FASTQ file(s)
2) Select which scheme you would like to use (e.g. heidelberg, enteritidis, or specify your own)
3) Click Execute

For more information visit `https://github.com/phac-nml/bio_hansel`


Example Usage
=============

Analysis of a single FASTA file
-------------------------------


Contents of ``results.tab``:

    +------------+------------+-------------+------------------------------------------------+---------------------------------------------------------------+-------------------------+-----------------------+----------------------+----------------------------+---------------------------+---------------------------------+--------------------------+--------------------------------+------------+
    | sample     | scheme     | subtype     | all_subtypes                                   | tiles_matching_subtype                                        | are_subtypes_consistent | inconsistent_subtypes | n_tiles_matching_all | n_tiles_matching_all_total | n_tiles_matching_positive | n_tiles_matching_positive_total | n_tiles_matching_subtype | n_tiles_matching_subtype_total | file_path  |
    +------------+------------+-------------+------------------------------------------------+---------------------------------------------------------------+-------------------------+-----------------------+----------------------+----------------------------+---------------------------+---------------------------------+--------------------------+--------------------------------+------------+
    | file.fasta | heidelberg | 2.2.2.2.1.4 | 2; 2.2; 2.2.2; 2.2.2.2; 2.2.2.2.1; 2.2.2.2.1.4 | 1037658-2.2.2.2.1.4; 2154958-2.2.2.2.1.4; 3785187-2.2.2.2.1.4 | True                    |                       | 202                  | 202                        | 17                        | 17                              | 3                        | 3                              | file.fasta |
    +------------+------------+-------------+------------------------------------------------+---------------------------------------------------------------+-------------------------+-----------------------+----------------------+----------------------------+---------------------------+---------------------------------+--------------------------+--------------------------------+------------+



Contents of ``match_results.tab``:

    +-----------------------------+---------------------------------------+--------+--------+----------+---------+--------+------+--------+--------+--------+----------+------+--------+-----------------------------------+----------+----------+-----------------+-------------+-------------+--------+------------+------------+
    | tilename                    | stitle                                | pident | length | mismatch | gapopen | qstart | qend | sstart | send   | evalue | bitscore | qlen | slen   | seq                               | coverage | is_trunc | refposition     | subtype     | is_pos_tile | sample | file_path  | scheme     |
    +-----------------------------+---------------------------------------+--------+--------+----------+---------+--------+------+--------+--------+--------+----------+------+--------+-----------------------------------+----------+----------+-----------------+-------------+-------------+--------+------------+------------+
    | 775920-2.2.2.2              | NODE_2_length_512016_cov_46.4737_ID_3 | 100    | 33     | 0        | 0       | 1      | 33   | 474875 | 474907 | 2E-11  | 62.1     | 33   | 512016 | GTTCAGGTGCTACCGAGGATCGTTTTTGGTGCG | 1        | False    | 775920          | 2.2.2.2     | True        | out    | file.fasta | heidelberg |
    +-----------------------------+---------------------------------------+--------+--------+----------+---------+--------+------+--------+--------+--------+----------+------+--------+-----------------------------------+----------+----------+-----------------+-------------+-------------+--------+------------+------------+
    | negative3305400-2.1.1.1     | NODE_3_length_427905_cov_48.1477_ID_5 | 100    | 33     | 0        | 0       | 1      | 33   | 276235 | 276267 | 2E-11  | 62.1     | 33   | 427905 | CATCGTGAAGCAGAACAGACGCGCATTCTTGCT | 1        | False    | negative3305400 | 2.1.1.1     | False       | out    | file.fasta | heidelberg |
    +-----------------------------+---------------------------------------+--------+--------+----------+---------+--------+------+--------+--------+--------+----------+------+--------+-----------------------------------+----------+----------+-----------------+-------------+-------------+--------+------------+------------+
    | negative3200083-2.1         | NODE_3_length_427905_cov_48.1477_ID_5 | 100    | 33     | 0        | 0       | 1      | 33   | 170918 | 170950 | 2E-11  | 62.1     | 33   | 427905 | ACCCGGTCTACCGCAAAATGGAAAGCGATATGC | 1        | False    | negative3200083 | 2.1         | False       | out    | file.fasta | heidelberg |
    +-----------------------------+---------------------------------------+--------+--------+----------+---------+--------+------+--------+--------+--------+----------+------+--------+-----------------------------------+----------+----------+-----------------+-------------+-------------+--------+------------+------------+
    | negative3204925-2.2.3.1.5   | NODE_3_length_427905_cov_48.1477_ID_5 | 100    | 33     | 0        | 0       | 1      | 33   | 175760 | 175792 | 2E-11  | 62.1     | 33   | 427905 | CTCGCTGGCAAGCAGTGCGGGTACTATCGGCGG | 1        | False    | negative3204925 | 2.2.3.1.5   | False       | out    | file.fasta | heidelberg |
    +-----------------------------+---------------------------------------+--------+--------+----------+---------+--------+------+--------+--------+--------+----------+------+--------+-----------------------------------+----------+----------+-----------------+-------------+-------------+--------+------------+------------+
    | negative3230678-2.2.2.1.1.1 | NODE_3_length_427905_cov_48.1477_ID_5 | 100    | 33     | 0        | 0       | 1      | 33   | 201513 | 201545 | 2E-11  | 62.1     | 33   | 427905 | AGCGGTGCGCCAAACCACCCGGAATGATGAGTG | 1        | False    | negative3230678 | 2.2.2.1.1.1 | False       | out    | file.fasta | heidelberg |
    +-----------------------------+---------------------------------------+--------+--------+----------+---------+--------+------+--------+--------+--------+----------+------+--------+-----------------------------------+----------+----------+-----------------+-------------+-------------+--------+------------+------------+
    | negative3233869-2.1.1.1.1   | NODE_3_length_427905_cov_48.1477_ID_5 | 100    | 33     | 0        | 0       | 1      | 33   | 204704 | 204736 | 2E-11  | 62.1     | 33   | 427905 | CAGCGCTGGTATGTGGCTGCACCATCGTCATTA | 1        | False    | negative3233869 | 2.1.1.1.1   | False       | out    | file.fasta | heidelberg |
    +-----------------------------+---------------------------------------+--------+--------+----------+---------+--------+------+--------+--------+--------+----------+------+--------+-----------------------------------+----------+----------+-----------------+-------------+-------------+--------+------------+------------+
    | negative3254229-2.2.3.1.3   | NODE_3_length_427905_cov_48.1477_ID_5 | 100    | 33     | 0        | 0       | 1      | 33   | 225064 | 225096 | 2E-11  | 62.1     | 33   | 427905 | CGCCACCACGCGGTTAGCGTCACGCTGACATTC | 1        | False    | negative3254229 | 2.2.3.1.3   | False       | out    | file.fasta | heidelberg |
    +-----------------------------+---------------------------------------+--------+--------+----------+---------+--------+------+--------+--------+--------+----------+------+--------+-----------------------------------+----------+----------+-----------------+-------------+-------------+--------+------------+------------+
    | negative3257074-2.2.1       | NODE_3_length_427905_cov_48.1477_ID_5 | 100    | 33     | 0        | 0       | 1      | 33   | 227909 | 227941 | 2E-11  | 62.1     | 33   | 427905 | CGGCAACCAGACCGACTACGCCGCCAAGCAGAC | 1        | False    | negative3257074 | 2.2.1       | False       | out    | file.fasta | heidelberg |
    +-----------------------------+---------------------------------------+--------+--------+----------+---------+--------+------+--------+--------+--------+----------+------+--------+-----------------------------------+----------+----------+-----------------+-------------+-------------+--------+------------+------------+
    | negative3264474-2.2.2.1.1.1 | NODE_3_length_427905_cov_48.1477_ID_5 | 100    | 33     | 0        | 0       | 1      | 33   | 235309 | 235341 | 2E-11  | 62.1     | 33   | 427905 | AATGGCGCCGATCGTCGCCAGATAACCGTTGCC | 1        | False    | negative3264474 | 2.2.2.1.1.1 | False       | out    | file.fasta | heidelberg |
    +-----------------------------+---------------------------------------+--------+--------+----------+---------+--------+------+--------+--------+--------+----------+------+--------+-----------------------------------+----------+----------+-----------------+-------------+-------------+--------+------------+------------+
    | negative3267927-2.2.2.2.2.1 | NODE_3_length_427905_cov_48.1477_ID_5 | 100    | 33     | 0        | 0       | 1      | 33   | 238762 | 238794 | 2E-11  | 62.1     | 33   | 427905 | AAAGAGAAATATGATGCCAGGCTGATACATGAC | 1        | False    | negative3267927 | 2.2.2.2.2.1 | False       | out    | file.fasta | heidelberg |
    +-----------------------------+---------------------------------------+--------+--------+----------+---------+--------+------+--------+--------+--------+----------+------+--------+-----------------------------------+----------+----------+-----------------+-------------+-------------+--------+------------+------------+
    | negative3278067-1.1         | NODE_3_length_427905_cov_48.1477_ID_5 | 100    | 33     | 0        | 0       | 1      | 33   | 248902 | 248934 | 2E-11  | 62.1     | 33   | 427905 | TGTGAGTAAGTTGCGCGATATTCTGCTGGATTC | 1        | False    | negative3278067 | 1.1         | False       | out    | file.fasta | heidelberg |
    +-----------------------------+---------------------------------------+--------+--------+----------+---------+--------+------+--------+--------+--------+----------+------+--------+-----------------------------------+----------+----------+-----------------+-------------+-------------+--------+------------+------------+
    | negative3299717-2.2.3.1.4   | NODE_3_length_427905_cov_48.1477_ID_5 | 100    | 33     | 0        | 0       | 1      | 33   | 270552 | 270584 | 2E-11  | 62.1     | 33   | 427905 | ATGCCGGACAGCAGGCGAAACTCGAACCGGATA | 1        | False    | negative3299717 | 2.2.3.1.4   | False       | out    | file.fasta | heidelberg |
    +-----------------------------+---------------------------------------+--------+--------+----------+---------+--------+------+--------+--------+--------+----------+------+--------+-----------------------------------+----------+----------+-----------------+-------------+-------------+--------+------------+------------+
    | negative3373069-2.2.2.2.1.1 | NODE_3_length_427905_cov_48.1477_ID_5 | 100    | 33     | 0        | 0       | 1      | 33   | 344011 | 344043 | 2E-11  | 62.1     | 33   | 427905 | CTCTCCAGAAGATGAAGCCCGTGATGCGGCGCA | 1        | False    | negative3373069 | 2.2.2.2.1.1 | False       | out    | file.fasta | heidelberg |
    +-----------------------------+---------------------------------------+--------+--------+----------+---------+--------+------+--------+--------+--------+----------+------+--------+-----------------------------------+----------+----------+-----------------+-------------+-------------+--------+------------+------------+

    Next 196 lines omitted.



Analysis of a single FASTQ readset
----------------------------------

Contents of ``results.tab``:

    +--------+------------+-------------+------------------------------------------------+------------------------------------------+-------------------------+-----------------------+----------------------+----------------------------+---------------------------+---------------------------------+--------------------------+--------------------------------+------------------------------------------+
    | sample | scheme     | subtype     | all_subtypes                                   | tiles_matching_subtype                   | are_subtypes_consistent | inconsistent_subtypes | n_tiles_matching_all | n_tiles_matching_all_total | n_tiles_matching_positive | n_tiles_matching_positive_total | n_tiles_matching_subtype | n_tiles_matching_subtype_total | file_path                                |
    +--------+------------+-------------+------------------------------------------------+------------------------------------------+-------------------------+-----------------------+----------------------+----------------------------+---------------------------+---------------------------------+--------------------------+--------------------------------+------------------------------------------+
    | 564    | heidelberg | 2.2.1.1.1.1 | 2; 2.2; 2.2.1; 2.2.1.1; 2.2.1.1.1; 2.2.1.1.1.1 | 1983064-2.2.1.1.1.1; 4211912-2.2.1.1.1.1 | True                    |                       | 202                  | 202                        | 20                        | 20                              | 2                        | 2                              | forward.fastqsanger; reverse.fastqsanger |
    +--------+------------+-------------+------------------------------------------------+------------------------------------------+-------------------------+-----------------------+----------------------+----------------------------+---------------------------+---------------------------------+--------------------------+--------------------------------+------------------------------------------+


Contents of ``match_results.tab``:

    +-----------------------------------+------+--------+------------------------------------------+------------------+-------------+-----------+-------------+-------------------+------------+
    | seq                               | freq | sample | file_path                                | tilename         | is_pos_tile | subtype   | refposition | is_kmer_freq_okay | scheme     |
    +-----------------------------------+------+--------+------------------------------------------+------------------+-------------+-----------+-------------+-------------------+------------+
    | ACGGTAAAAGAGGACTTGACTGGCGCGATTTGC | 68   | 564    | forward.fastqsanger; reverse.fastqsanger | 21097-2.2.1.1.1  | True        | 2.2.1.1.1 | 21097       | True              | heidelberg |
    +-----------------------------------+------+--------+------------------------------------------+------------------+-------------+-----------+-------------+-------------------+------------+
    | AACCGGCGGTATTGGCTGCGGTAAAAGTACCGT | 77   | 564    | forward.fastqsanger; reverse.fastqsanger | 157792-2.2.1.1.1 | True        | 2.2.1.1.1 | 157792      | True              | heidelberg |
    +-----------------------------------+------+--------+------------------------------------------+------------------+-------------+-----------+-------------+-------------------+------------+
    | CCGCTGCTTTCTGAAATCGCGCGTCGTTTCAAC | 67   | 564    | forward.fastqsanger; reverse.fastqsanger | 293728-2.2.1.1   | True        | 2.2.1.1   | 293728      | True              | heidelberg |
    +-----------------------------------+------+--------+------------------------------------------+------------------+-------------+-----------+-------------+-------------------+------------+
    | GAATAACAGCAAAGTGATCATGATGCCGCTGGA | 91   | 564    | forward.fastqsanger; reverse.fastqsanger | 607438-2.2.1     | True        | 2.2.1     | 607438      | True              | heidelberg |
    +-----------------------------------+------+--------+------------------------------------------+------------------+-------------+-----------+-------------+-------------------+------------+
    | CAGTTTTACATCCTGCGAAATGCGCAGCGTCAA | 87   | 564    | forward.fastqsanger; reverse.fastqsanger | 691203-2.2.1.1   | True        | 2.2.1.1   | 691203      | True              | heidelberg |
    +-----------------------------------+------+--------+------------------------------------------+------------------+-------------+-----------+-------------+-------------------+------------+
    | CAGGAGAAAGGATGCCAGGGTCAACACGTAAAC | 33   | 564    | forward.fastqsanger; reverse.fastqsanger | 944885-2.2.1.1.1 | True        | 2.2.1.1.1 | 944885      | True              | heidelberg |
    +-----------------------------------+------+--------+------------------------------------------+------------------+-------------+-----------+-------------+-------------------+------------+

    Next 200 lines omitted.

Galaxy wrapper written by Matthew Gopez at the Public Health Agency of Canada, National Microbiology Laboratory.

    ]]></help>
    <citations>
        <citation type="bibtex">@ARTICLE{a1,
            title = {A robust genotyping scheme for *Salmonella enterica* serovar Heidelberg clones circulating in North America.},
            author = {Geneviève Labbé, James Robertson, Peter Kruczkiewicz, Chad R. Laing, Kim Ziebell, Aleisha R. Reimer, Lorelee Tschetter, Gary Van Domselaar, Sadjia Bekal, Kimberley A. MacDonald, Linda Hoang, Linda Chui, Danielle Daignault, Durda Slavic, Frank Pollari, E. Jane Parmley, Philip Mabon, Elissa Giang, Lok Kan Lee, Jonathan Moffat, Marisa Rankin, Joanne MacKinnon, Roger Johnson, John H.E. Nash.},
            url = {https://github.com/phac-nml/bio_hansel}
            }
        }</citation>
    </citations>
</tool>