annotate rgFastQC.xml @ 11:db2dc6bc8f05 draft

planemo upload for repository https://github.com/galaxyproject/tools-iuc/tree/master/tools/fastqc commit 168f7aeb0f9f38de6dec873f3cbf0c30014fdd72

<tool id="fastqc" name="FastQC" version="0.68">
    <description>Read Quality reports</description>
    <requirements>
        <requirement type="package" version="0.11.5">fastqc</requirement>
    </requirements>
    <stdio>
        <exit_code range="1:" />
        <exit_code range=":-1" />
        <regex match="Error:" />
        <regex match="Exception:" />
    </stdio>
    <command><![CDATA[
        python '${__tool_directory__}/rgFastQC.py'
            -i '$input_file'
            -d '${html_file.files_path}'
            -o '$html_file'
            -t '$text_file'
            -f '${input_file.ext}'
            -j '${input_file.name}'
            #if $contaminants.dataset and str($contaminants) > ''
                -c '$contaminants'
            #end if
            #if $limits.dataset and str($limits) > ''
                -l '$limits'
            #end if
    ]]></command>
    <inputs>
        <param format="fastq,fastq.gz,fastq.bz2,bam,sam" name="input_file" type="data" label="Short read data from your current history" />
        <param name="contaminants" type="data" format="tabular" optional="true" label="Contaminant list"
               help="tab delimited file with 2 columns: name and sequence.  For example: Illumina Small RNA RT Primer CAAGCAGAAGACGGCATACGA" />
        <param name="limits" type="data" format="txt" optional="true" label="Submodule and Limit specifing file"
               help="a file that specifies which submodules are to be executed (default=all) and also specifies the thresholds for the each submodules warning parameter" />
    </inputs>
    <outputs>
        <data format="html" name="html_file" label="${tool.name} on ${on_string}: Webpage" />
        <data format="txt" name="text_file"  label="${tool.name} on ${on_string}: RawData" />
    </outputs>
    <tests>
        <test>
            <param name="input_file" value="1000gsample.fastq" />
            <param name="contaminants" value="fastqc_contaminants.txt" ftype="tabular" />
            <output name="html_file" file="fastqc_report.html" ftype="html" lines_diff="100"/>
            <output name="text_file" file="fastqc_data.txt" ftype="txt" lines_diff="100"/>
        </test>
        <test>
            <param name="input_file" value="1000gsample.fastq" />
            <param name="limits" value="fastqc_customlimits.txt" ftype="txt" />
            <output name="html_file" file="fastqc_report2.html" ftype="html" compare="sim_size" delta="4096"/>
            <output name="text_file" file="fastqc_data2.txt" ftype="txt" compare="sim_size"/>
        </test>
        <test>
            <param name="input_file" value="1000gsample.fastq.gz" ftype="fastq.gz" />
            <param name="contaminants" value="fastqc_contaminants.txt" ftype="tabular" />
            <output name="html_file" file="fastqc_report.html" ftype="html" lines_diff="100"/>
            <output name="text_file" file="fastqc_data.txt" ftype="txt" lines_diff="100"/>
        </test>
        <test>
            <param name="input_file" value="1000gsample.fastq.bz2" ftype="fastq.bz2" />
            <param name="contaminants" value="fastqc_contaminants.txt" ftype="tabular" />
            <output name="html_file" file="fastqc_report.html" ftype="html" lines_diff="100"/>
            <output name="text_file" file="fastqc_data.txt" ftype="txt" lines_diff="100"/>
        </test>
    </tests>
    <help>
.. class:: infomark

**Purpose**

FastQC aims to provide a simple way to do some quality control checks on raw
sequence data coming from high throughput sequencing pipelines.
It provides a modular set of analyses which you can use to give a quick
impression of whether your data has any problems of
which you should be aware before doing any further analysis.

The main functions of FastQC are:

- Import of data from BAM, SAM or FastQ/FastQ.gz files (any variant),
- Providing a quick overview to tell you in which areas there may be problems
- Summary graphs and tables to quickly assess your data
- Export of results to an HTML based permanent report
- Offline operation to allow automated generation of reports without running the interactive application

-----

.. class:: infomark

**FastQC**

This is a Galaxy wrapper. It merely exposes the external package FastQC_ which is documented at FastQC_
Kindly acknowledge it as well as this tool if you use it.
FastQC incorporates the Picard-tools_ libraries for sam/bam processing.

The contaminants file parameter was borrowed from the independently developed
fastqcwrapper contributed to the Galaxy Community Tool Shed by J. Johnson.
Adaption to version 0.11.2 by T. McGowan.

-----

.. class:: infomark

**Inputs and outputs**

FastQC_ is the best place to look for documentation - it's very good.
A summary follows below for those in a tearing hurry.

This wrapper will accept a Galaxy fastq, fastq.gz, sam or bam as the input read file to check.
It will also take an optional file containing a list of contaminants information, in the form of
a tab-delimited file with 2 columns, name and sequence. As another option the tool takes a custom
limits.txt file that allows setting the warning thresholds for the different modules and also specifies
which modules to include in the output.

The tool produces a basic text and a HTML output file that contain all of the results, including the following:

- Basic Statistics
- Per base sequence quality
- Per sequence quality scores
- Per base sequence content
- Per base GC content
- Per sequence GC content
- Per base N content
- Sequence Length Distribution
- Sequence Duplication Levels
- Overrepresented sequences
- Kmer Content

All except Basic Statistics and Overrepresented sequences are plots.
 .. _FastQC: http://www.bioinformatics.babraham.ac.uk/projects/fastqc/
 .. _Picard-tools: http://picard.sourceforge.net/index.shtml
    </help>
    <citations>
        <citation type="bibtex">
        @unpublished{andrews_s,
            author = {Andrews, S.},
            keywords = {bioinformatics, ngs, qc},
            priority = {2},
            title = {{FastQC A Quality Control tool for High Throughput Sequence Data}},
            url = {http://www.bioinformatics.babraham.ac.uk/projects/fastqc/}
        }
        </citation>
    </citations>
</tool>