annotate read2mut.py @ 56:371c09d4050b draft

planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
author mheinzl
date Fri, 12 Mar 2021 14:22:03 +0000
parents 8fbe6aba07e5
children 706bf8b59eae
Ignore whitespace changes - Everywhere: Within whitespace: At end of lines:
rev   line source
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1 #!/usr/bin/env python
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
2
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
3 """read2mut.py
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
4
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
5 Author -- Gundula Povysil
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
6 Contact -- povysil@bioinf.jku.at
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
7
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
8 Looks for reads with mutation at known
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
9 positions and calculates frequencies and stats.
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
10
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
11 ======= ========== ================= ================================
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
12 Version Date Author Description
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
13 0.2.1 2019-10-27 Gundula Povysil -
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
14 ======= ========== ================= ================================
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
15
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
16
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
17 USAGE: python read2mut.py --mutFile DCS_Mutations.tabular --bamFile Interesting_Reads.trim.bam
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
18 --inputJson tag_count_dict.json --sscsJson SSCS_counts.json
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
19 --outputFile mutant_reads_summary_short_trim.xlsx --thresh 10 --phred 20 --trim 10 --chimera_correction
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
20
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
21 """
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
22
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
23 from __future__ import division
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
24
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
25 import argparse
55
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
26 import csv
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
27 import itertools
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
28 import json
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
29 import operator
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
30 import os
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
31 import re
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
32 import sys
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
33
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
34 import numpy as np
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
35 import pysam
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
36 import xlsxwriter
6
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
37 from cyvcf2 import VCF
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
38
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
39
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
40 def make_argparser():
6
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
41 parser = argparse.ArgumentParser(description='Takes a VCF file with mutations, a BAM file and JSON files as input and prints stats about variants to a user specified output file.')
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
42 parser.add_argument('--mutFile',
6
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
43 help='VCF file with DCS mutations.')
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
44 parser.add_argument('--bamFile',
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
45 help='BAM file with aligned raw reads of selected tags (FASTQ created by mut2read.py - trimming with Trimmomatic - alignment with bwa).')
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
46 parser.add_argument('--inputJson',
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
47 help='JSON file with data collected by mut2read.py.')
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
48 parser.add_argument('--sscsJson',
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
49 help='JSON file with SSCS counts collected by mut2sscs.py.')
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
50 parser.add_argument('--outputFile',
12
7a418148319d planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 11
diff changeset
51 help='Output xlsx file with summary of mutations.')
55
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
52 parser.add_argument('--outputFile_csv',
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
53 help='Output csv file with summary of mutations.')
12
7a418148319d planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 11
diff changeset
54 parser.add_argument('--outputFile2',
7a418148319d planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 11
diff changeset
55 help='Output xlsx file with allele frequencies of mutations.')
7a418148319d planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 11
diff changeset
56 parser.add_argument('--outputFile3',
7a418148319d planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 11
diff changeset
57 help='Output xlsx file with examples of the tier classification.')
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
58 parser.add_argument('--thresh', type=int, default=0,
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
59 help='Integer threshold for displaying mutations. Only mutations occuring less than thresh times are displayed. Default of 0 displays all.')
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
60 parser.add_argument('--phred', type=int, default=20,
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
61 help='Integer threshold for Phred score. Only reads higher than this threshold are considered. Default 20.')
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
62 parser.add_argument('--trim', type=int, default=10,
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
63 help='Integer threshold for assigning mutations at start and end of reads to lower tier. Default 10.')
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
64 parser.add_argument('--chimera_correction', action="store_true",
6
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
65 help='Count chimeric variants and correct the variant frequencies')
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
66 parser.add_argument('--softclipping_dist', type=int, default=15,
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
67 help='Count mutation as an artifact if mutation lies within this parameter away from the softclipping part of the read.')
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
68 parser.add_argument('--reads_threshold', type=float, default=1.0,
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
69 help='Float number which specifies the minimum percentage of softclipped reads in a family to be considered in the softclipping tiers. Default: 1.0, means all reads of a family have to be softclipped.')
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
70 return parser
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
71
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
72
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
73 def safe_div(x, y):
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
74 if y == 0:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
75 return None
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
76 return x / y
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
77
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
78
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
79 def read2mut(argv):
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
80 parser = make_argparser()
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
81 args = parser.parse_args(argv[1:])
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
82 file1 = args.mutFile
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
83 file2 = args.bamFile
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
84 json_file = args.inputJson
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
85 sscs_json = args.sscsJson
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
86 outfile = args.outputFile
12
7a418148319d planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 11
diff changeset
87 outfile2 = args.outputFile2
7a418148319d planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 11
diff changeset
88 outfile3 = args.outputFile3
55
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
89 outputFile_csv = args.outputFile_csv
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
90 thresh = args.thresh
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
91 phred_score = args.phred
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
92 trim = args.trim
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
93 chimera_correction = args.chimera_correction
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
94 thr = args.softclipping_dist
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
95 threshold_reads = args.reads_threshold
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
96
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
97 if os.path.isfile(file1) is False:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
98 sys.exit("Error: Could not find '{}'".format(file1))
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
99 if os.path.isfile(file2) is False:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
100 sys.exit("Error: Could not find '{}'".format(file2))
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
101 if os.path.isfile(json_file) is False:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
102 sys.exit("Error: Could not find '{}'".format(json_file))
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
103 if thresh < 0:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
104 sys.exit("Error: thresh is '{}', but only non-negative integers allowed".format(thresh))
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
105 if phred_score < 0:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
106 sys.exit("Error: phred is '{}', but only non-negative integers allowed".format(phred_score))
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
107 if trim < 0:
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
108 sys.exit("Error: trim is '{}', but only non-negative integers allowed".format(thresh))
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
109 if thr <= 0:
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
110 sys.exit("Error: trim is '{}', but only non-negative integers allowed".format(thr))
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
111
2
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
112 # load dicts
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
113 with open(json_file, "r") as f:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
114 (tag_dict, cvrg_dict) = json.load(f)
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
115
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
116 with open(sscs_json, "r") as f:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
117 (mut_pos_dict, ref_pos_dict) = json.load(f)
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
118
2
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
119 # read bam file
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
120 # pysam.index(file2)
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
121 bam = pysam.AlignmentFile(file2, "rb")
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
122
6
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
123 # create mut_dict
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
124 mut_dict = {}
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
125 mut_read_pos_dict = {}
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
126 mut_read_dict = {}
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
127 reads_dict = {}
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
128 mut_read_cigar_dict = {}
6
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
129 i = 0
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
130 mut_array = []
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
131
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
132 for count, variant in enumerate(VCF(file1)):
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
133 #if count == 2000:
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
134 # break
6
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
135 chrom = variant.CHROM
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
136 stop_pos = variant.start
7
ded0dc6a20d3 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 6
diff changeset
137 #chrom_stop_pos = str(chrom) + "#" + str(stop_pos)
6
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
138 ref = variant.REF
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
139 if len(variant.ALT) == 0:
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
140 continue
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
141 else:
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
142 alt = variant.ALT[0]
7
ded0dc6a20d3 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 6
diff changeset
143 chrom_stop_pos = str(chrom) + "#" + str(stop_pos) + "#" + ref + "#" + alt
ded0dc6a20d3 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 6
diff changeset
144
6
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
145 if len(ref) == len(alt):
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
146 mut_array.append([chrom, stop_pos, ref, alt])
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
147 i += 1
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
148 mut_dict[chrom_stop_pos] = {}
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
149 mut_read_pos_dict[chrom_stop_pos] = {}
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
150 reads_dict[chrom_stop_pos] = {}
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
151 mut_read_cigar_dict[chrom_stop_pos] = {}
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
152
6
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
153 for pileupcolumn in bam.pileup(chrom, stop_pos - 1, stop_pos + 1, max_depth=100000000):
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
154 if pileupcolumn.reference_pos == stop_pos:
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
155 count_alt = 0
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
156 count_ref = 0
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
157 count_indel = 0
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
158 count_n = 0
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
159 count_other = 0
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
160 count_lowq = 0
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
161 n = 0
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
162 #print("unfiltered reads=", pileupcolumn.n, "filtered reads=", len(pileupcolumn.pileups),
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
163 # "difference= ", len(pileupcolumn.pileups) - pileupcolumn.n)
6
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
164 for pileupread in pileupcolumn.pileups:
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
165 n += 1
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
166 if not pileupread.is_del and not pileupread.is_refskip:
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
167 tag = pileupread.alignment.query_name
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
168 nuc = pileupread.alignment.query_sequence[pileupread.query_position]
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
169 phred = ord(pileupread.alignment.qual[pileupread.query_position]) - 33
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
170 if phred < phred_score:
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
171 nuc = "lowQ"
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
172 if tag not in mut_dict[chrom_stop_pos]:
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
173 mut_dict[chrom_stop_pos][tag] = {}
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
174 if nuc in mut_dict[chrom_stop_pos][tag]:
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
175 mut_dict[chrom_stop_pos][tag][nuc] += 1
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
176 else:
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
177 mut_dict[chrom_stop_pos][tag][nuc] = 1
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
178 if tag not in mut_read_pos_dict[chrom_stop_pos]:
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
179 mut_read_pos_dict[chrom_stop_pos][tag] = [pileupread.query_position + 1]
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
180 reads_dict[chrom_stop_pos][tag] = [len(pileupread.alignment.query_sequence)]
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
181 mut_read_cigar_dict[chrom_stop_pos][tag] = [pileupread.alignment.cigarstring]
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
182
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
183 #alignedRefPositions = pileupread.get_reference_positions()[0]
6
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
184 else:
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
185 mut_read_pos_dict[chrom_stop_pos][tag].append(pileupread.query_position + 1)
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
186 reads_dict[chrom_stop_pos][tag].append(len(pileupread.alignment.query_sequence))
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
187 mut_read_cigar_dict[chrom_stop_pos][tag].append(pileupread.alignment.cigarstring)
6
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
188 if nuc == alt:
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
189 count_alt += 1
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
190 if tag not in mut_read_dict:
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
191 mut_read_dict[tag] = {}
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
192 mut_read_dict[tag][chrom_stop_pos] = (alt, ref)
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
193 else:
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
194 mut_read_dict[tag][chrom_stop_pos] = (alt, ref)
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
195 elif nuc == ref:
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
196 count_ref += 1
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
197 elif nuc == "N":
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
198 count_n += 1
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
199 elif nuc == "lowQ":
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
200 count_lowq += 1
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
201 else:
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
202 count_other += 1
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
203 else:
6
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
204 count_indel += 1
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
205
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
206 #print("coverage at pos %s = %s, ref = %s, alt = %s, other bases = %s, N = %s, indel = %s, low quality = %s\n" % (pileupcolumn.pos, count_ref + count_alt, count_ref, count_alt, count_other, count_n, count_indel, count_lowq))
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
207 #else:
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
208 # print("indels are currently not evaluated")
6
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
209 mut_array = np.array(mut_array)
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
210 for read in bam.fetch(until_eof=True):
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
211 if read.is_unmapped:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
212 pure_tag = read.query_name[:-5]
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
213 nuc = "na"
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
214 for key in tag_dict[pure_tag].keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
215 if key not in mut_dict:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
216 mut_dict[key] = {}
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
217 if read.query_name not in mut_dict[key]:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
218 mut_dict[key][read.query_name] = {}
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
219 if nuc in mut_dict[key][read.query_name]:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
220 mut_dict[key][read.query_name][nuc] += 1
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
221 else:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
222 mut_dict[key][read.query_name][nuc] = 1
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
223 bam.close()
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
224
6
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
225 # create pure_tags_dict
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
226 pure_tags_dict = {}
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
227 for key1, value1 in sorted(mut_dict.items()):
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
228 #if len(np.where(np.array(['#'.join(str(i) for i in z)
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
229 # for z in zip(mut_array[:, 0], mut_array[:, 1])]) == key1)[0]) == 0:
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
230 # continue
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
231
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
232 i = np.where(np.array(['#'.join(str(i) for i in z)
7
ded0dc6a20d3 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 6
diff changeset
233 for z in zip(mut_array[:, 0], mut_array[:, 1], mut_array[:, 2], mut_array[:, 3])]) == key1)[0][0]
6
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
234 ref = mut_array[i, 2]
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
235 alt = mut_array[i, 3]
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
236 pure_tags_dict[key1] = {}
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
237 for key2, value2 in sorted(value1.items()):
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
238 for key3, value3 in value2.items():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
239 pure_tag = key2[:-5]
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
240 if key3 == alt:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
241 if pure_tag in pure_tags_dict[key1]:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
242 pure_tags_dict[key1][pure_tag] += 1
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
243 else:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
244 pure_tags_dict[key1][pure_tag] = 1
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
245
6
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
246 # create pure_tags_dict_short with thresh
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
247 if thresh > 0:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
248 pure_tags_dict_short = {}
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
249 for key, value in sorted(pure_tags_dict.items()):
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
250 if len(value) < thresh:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
251 pure_tags_dict_short[key] = value
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
252 else:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
253 pure_tags_dict_short = pure_tags_dict
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
254
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
255 # whole_array = []
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
256 # for k in pure_tags_dict.values():
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
257 # if len(k) != 0:
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
258 # keys = k.keys()
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
259 # if len(keys) > 1:
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
260 # for k1 in keys:
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
261 # whole_array.append(k1)
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
262 # else:
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
263 # whole_array.append(keys[0])
28
afda74e874ac planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 27
diff changeset
264
55
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
265 csv_data = open(outputFile_csv, "wb")
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
266 csv_writer = csv.writer(csv_data, delimiter=",")
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
267
6
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
268 # output summary with threshold
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
269 workbook = xlsxwriter.Workbook(outfile)
29
b14b69697cf6 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 28
diff changeset
270 workbook2 = xlsxwriter.Workbook(outfile2)
b14b69697cf6 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 28
diff changeset
271 workbook3 = xlsxwriter.Workbook(outfile3)
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
272 ws1 = workbook.add_worksheet("Results")
6
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
273 ws2 = workbook2.add_worksheet("Allele frequencies")
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
274 ws3 = workbook3.add_worksheet("Tiers")
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
275
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
276 format1 = workbook.add_format({'bg_color': '#BCF5A9'}) # green
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
277 format2 = workbook.add_format({'bg_color': '#FFC7CE'}) # red
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
278 format3 = workbook.add_format({'bg_color': '#FACC2E'}) # yellow
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
279
6
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
280 format12 = workbook2.add_format({'bg_color': '#BCF5A9'}) # green
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
281 format22 = workbook2.add_format({'bg_color': '#FFC7CE'}) # red
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
282 format32 = workbook2.add_format({'bg_color': '#FACC2E'}) # yellow
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
283
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
284 format13 = workbook3.add_format({'bg_color': '#BCF5A9'}) # green
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
285 format23 = workbook3.add_format({'bg_color': '#FFC7CE'}) # red
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
286 format33 = workbook3.add_format({'bg_color': '#FACC2E'}) # yellow
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
287
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
288 header_line = ('variant ID', 'tier', 'tag', 'mate', 'read pos.ab', 'read pos.ba', 'read median length.ab',
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
289 'read median length.ba', 'DCS median length',
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
290 'FS.ab', 'FS.ba', 'FSqc.ab', 'FSqc.ba', 'ref.ab', 'ref.ba', 'alt.ab', 'alt.ba',
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
291 'rel. ref.ab', 'rel. ref.ba', 'rel. alt.ab', 'rel. alt.ba',
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
292 'na.ab', 'na.ba', 'lowq.ab', 'lowq.ba', 'trim.ab', 'trim.ba',
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
293 'SSCS alt.ab', 'SSCS alt.ba', 'SSCS ref.ab', 'SSCS ref.ba',
4
386438cd4c3b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 3
diff changeset
294 'in phase', 'chimeric tag')
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
295 ws1.write_row(0, 0, header_line)
55
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
296 csv_writer.writerow(header_line)
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
297 counter_tier11 = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
298 counter_tier12 = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
299 counter_tier21 = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
300 counter_tier22 = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
301 counter_tier23 = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
302 counter_tier24 = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
303 counter_tier31 = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
304 counter_tier32 = 0
46
f733c425b804 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 45
diff changeset
305 counter_tier25 = 0
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
306 counter_tier4 = 0
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
307 # if chimera_correction:
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
308 # counter_tier43 = 0
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
309 counter_tier51 = 0
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
310 counter_tier52 = 0
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
311 counter_tier53 = 0
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
312 counter_tier54 = 0
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
313 counter_tier55 = 0
28
afda74e874ac planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 27
diff changeset
314 counter_tier6 = 0
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
315 counter_tier7 = 0
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
316
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
317 row = 1
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
318 tier_dict = {}
2
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
319 chimera_dict = {}
48
e2a655533077 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 47
diff changeset
320 change_tier_after_print = {}
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
321 for key1, value1 in sorted(mut_dict.items()):
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
322 counts_mut = 0
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
323 chimeric_tag_list = []
2
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
324 chimeric_tag = {}
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
325 if key1 in pure_tags_dict_short.keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
326 i = np.where(np.array(['#'.join(str(i) for i in z)
7
ded0dc6a20d3 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 6
diff changeset
327 for z in zip(mut_array[:, 0], mut_array[:, 1], mut_array[:, 2], mut_array[:, 3])]) == key1)[0][0]
6
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
328 ref = mut_array[i, 2]
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
329 alt = mut_array[i, 3]
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
330 dcs_median = cvrg_dict[key1][2]
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
331 whole_array = pure_tags_dict_short[key1].keys()
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
332
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
333 tier_dict[key1] = {}
51
26e53b5b8bcb planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 50
diff changeset
334 values_tier_dict = [("tier 1.1", 0), ("tier 1.2", 0), ("tier 2.1", 0), ("tier 2.2", 0), ("tier 2.3", 0), ("tier 2.4", 0),("tier 2.5", 0),
26e53b5b8bcb planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 50
diff changeset
335 ("tier 3.1", 0), ("tier 3.2", 0), ("tier 4", 0), ("tier 5.1", 0), ("tier 5.2", 0), ("tier 5.3", 0), ("tier 5.4", 0), ("tier 5.5", 0),
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
336 ("tier 6", 0), ("tier 7", 0)]
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
337 for k, v in values_tier_dict:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
338 tier_dict[key1][k] = v
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
339
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
340 used_keys = []
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
341 if 'ab' in mut_pos_dict[key1].keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
342 sscs_mut_ab = mut_pos_dict[key1]['ab']
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
343 else:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
344 sscs_mut_ab = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
345 if 'ba' in mut_pos_dict[key1].keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
346 sscs_mut_ba = mut_pos_dict[key1]['ba']
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
347 else:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
348 sscs_mut_ba = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
349 if 'ab' in ref_pos_dict[key1].keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
350 sscs_ref_ab = ref_pos_dict[key1]['ab']
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
351 else:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
352 sscs_ref_ab = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
353 if 'ba' in ref_pos_dict[key1].keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
354 sscs_ref_ba = ref_pos_dict[key1]['ba']
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
355 else:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
356 sscs_ref_ba = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
357 for key2, value2 in sorted(value1.items()):
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
358 add_mut14 = ""
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
359 add_mut23 = ""
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
360 if (key2[:-5] in pure_tags_dict_short[key1].keys()) and (key2[:-5] not in used_keys) and (key1 in tag_dict[key2[:-5]].keys()):
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
361 if key2[:-5] + '.ab.1' in mut_dict[key1].keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
362 total1 = sum(mut_dict[key1][key2[:-5] + '.ab.1'].values())
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
363 if 'na' in mut_dict[key1][key2[:-5] + '.ab.1'].keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
364 na1 = mut_dict[key1][key2[:-5] + '.ab.1']['na']
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
365 # na1f = na1/total1
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
366 else:
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
367 # na1 = na1f = 0
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
368 na1 = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
369 if 'lowQ' in mut_dict[key1][key2[:-5] + '.ab.1'].keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
370 lowq1 = mut_dict[key1][key2[:-5] + '.ab.1']['lowQ']
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
371 # lowq1f = lowq1 / total1
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
372 else:
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
373 # lowq1 = lowq1f = 0
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
374 lowq1 = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
375 if ref in mut_dict[key1][key2[:-5] + '.ab.1'].keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
376 ref1 = mut_dict[key1][key2[:-5] + '.ab.1'][ref]
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
377 ref1f = ref1 / (total1 - na1 - lowq1)
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
378 else:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
379 ref1 = ref1f = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
380 if alt in mut_dict[key1][key2[:-5] + '.ab.1'].keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
381 alt1 = mut_dict[key1][key2[:-5] + '.ab.1'][alt]
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
382 alt1f = alt1 / (total1 - na1 - lowq1)
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
383 else:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
384 alt1 = alt1f = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
385 total1new = total1 - na1 - lowq1
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
386 if (key2[:-5] + '.ab.1') in mut_read_dict.keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
387 k1 = mut_read_dict[(key2[:-5] + '.ab.1')].keys()
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
388 add_mut1 = len(k1)
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
389 if add_mut1 > 1:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
390 for k, v in mut_read_dict[(key2[:-5] + '.ab.1')].items():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
391 if k != key1:
4
386438cd4c3b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 3
diff changeset
392 new_mut = str(k).split("#")[0] + "-" + str(int(str(k).split("#")[1]) + 1) + "-" + v[1] + "-" + v[0]
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
393 if len(add_mut14) == 0:
4
386438cd4c3b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 3
diff changeset
394 add_mut14 = new_mut
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
395 else:
4
386438cd4c3b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 3
diff changeset
396 add_mut14 = add_mut14 + ", " + new_mut
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
397 else:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
398 k1 = []
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
399 else:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
400 total1 = total1new = na1 = lowq1 = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
401 ref1 = alt1 = ref1f = alt1f = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
402 k1 = []
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
403
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
404 if key2[:-5] + '.ab.2' in mut_dict[key1].keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
405 total2 = sum(mut_dict[key1][key2[:-5] + '.ab.2'].values())
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
406 if 'na' in mut_dict[key1][key2[:-5] + '.ab.2'].keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
407 na2 = mut_dict[key1][key2[:-5] + '.ab.2']['na']
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
408 # na2f = na2 / total2
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
409 else:
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
410 # na2 = na2f = 0
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
411 na2 = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
412 if 'lowQ' in mut_dict[key1][key2[:-5] + '.ab.2'].keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
413 lowq2 = mut_dict[key1][key2[:-5] + '.ab.2']['lowQ']
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
414 # lowq2f = lowq2 / total2
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
415 else:
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
416 # lowq2 = lowq2f = 0
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
417 lowq2 = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
418 if ref in mut_dict[key1][key2[:-5] + '.ab.2'].keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
419 ref2 = mut_dict[key1][key2[:-5] + '.ab.2'][ref]
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
420 ref2f = ref2 / (total2 - na2 - lowq2)
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
421 else:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
422 ref2 = ref2f = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
423 if alt in mut_dict[key1][key2[:-5] + '.ab.2'].keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
424 alt2 = mut_dict[key1][key2[:-5] + '.ab.2'][alt]
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
425 alt2f = alt2 / (total2 - na2 - lowq2)
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
426 else:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
427 alt2 = alt2f = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
428 total2new = total2 - na2 - lowq2
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
429 if (key2[:-5] + '.ab.2') in mut_read_dict.keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
430 k2 = mut_read_dict[(key2[:-5] + '.ab.2')].keys()
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
431 add_mut2 = len(k2)
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
432 if add_mut2 > 1:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
433 for k, v in mut_read_dict[(key2[:-5] + '.ab.2')].items():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
434 if k != key1:
4
386438cd4c3b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 3
diff changeset
435 new_mut = str(k).split("#")[0] + "-" + str(int(str(k).split("#")[1]) + 1) + "-" + v[1] + "-" + v[0]
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
436 if len(add_mut23) == 0:
4
386438cd4c3b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 3
diff changeset
437 add_mut23 = new_mut
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
438 else:
4
386438cd4c3b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 3
diff changeset
439 add_mut23 = add_mut23 + ", " + new_mut
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
440 else:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
441 k2 = []
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
442 else:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
443 total2 = total2new = na2 = lowq2 = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
444 ref2 = alt2 = ref2f = alt2f = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
445 k2 = []
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
446
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
447 if key2[:-5] + '.ba.1' in mut_dict[key1].keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
448 total3 = sum(mut_dict[key1][key2[:-5] + '.ba.1'].values())
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
449 if 'na' in mut_dict[key1][key2[:-5] + '.ba.1'].keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
450 na3 = mut_dict[key1][key2[:-5] + '.ba.1']['na']
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
451 # na3f = na3 / total3
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
452 else:
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
453 # na3 = na3f = 0
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
454 na3 = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
455 if 'lowQ' in mut_dict[key1][key2[:-5] + '.ba.1'].keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
456 lowq3 = mut_dict[key1][key2[:-5] + '.ba.1']['lowQ']
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
457 # lowq3f = lowq3 / total3
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
458 else:
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
459 # lowq3 = lowq3f = 0
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
460 lowq3 = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
461 if ref in mut_dict[key1][key2[:-5] + '.ba.1'].keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
462 ref3 = mut_dict[key1][key2[:-5] + '.ba.1'][ref]
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
463 ref3f = ref3 / (total3 - na3 - lowq3)
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
464 else:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
465 ref3 = ref3f = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
466 if alt in mut_dict[key1][key2[:-5] + '.ba.1'].keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
467 alt3 = mut_dict[key1][key2[:-5] + '.ba.1'][alt]
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
468 alt3f = alt3 / (total3 - na3 - lowq3)
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
469 else:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
470 alt3 = alt3f = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
471 total3new = total3 - na3 - lowq3
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
472 if (key2[:-5] + '.ba.1') in mut_read_dict.keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
473 add_mut3 = len(mut_read_dict[(key2[:-5] + '.ba.1')].keys())
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
474 if add_mut3 > 1:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
475 for k, v in mut_read_dict[(key2[:-5] + '.ba.1')].items():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
476 if k != key1 and k not in k2:
4
386438cd4c3b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 3
diff changeset
477 new_mut = str(k).split("#")[0] + "-" + str(int(str(k).split("#")[1]) + 1) + "-" + v[1] + "-" + v[0]
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
478 if len(add_mut23) == 0:
4
386438cd4c3b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 3
diff changeset
479 add_mut23 = new_mut
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
480 else:
4
386438cd4c3b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 3
diff changeset
481 add_mut23 = add_mut23 + ", " + new_mut
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
482 else:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
483 total3 = total3new = na3 = lowq3 = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
484 ref3 = alt3 = ref3f = alt3f = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
485
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
486 if key2[:-5] + '.ba.2' in mut_dict[key1].keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
487 total4 = sum(mut_dict[key1][key2[:-5] + '.ba.2'].values())
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
488 if 'na' in mut_dict[key1][key2[:-5] + '.ba.2'].keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
489 na4 = mut_dict[key1][key2[:-5] + '.ba.2']['na']
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
490 # na4f = na4 / total4
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
491 else:
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
492 # na4 = na4f = 0
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
493 na4 = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
494 if 'lowQ' in mut_dict[key1][key2[:-5] + '.ba.2'].keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
495 lowq4 = mut_dict[key1][key2[:-5] + '.ba.2']['lowQ']
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
496 # lowq4f = lowq4 / total4
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
497 else:
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
498 # lowq4 = lowq4f = 0
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
499 lowq4 = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
500 if ref in mut_dict[key1][key2[:-5] + '.ba.2'].keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
501 ref4 = mut_dict[key1][key2[:-5] + '.ba.2'][ref]
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
502 ref4f = ref4 / (total4 - na4 - lowq4)
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
503 else:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
504 ref4 = ref4f = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
505 if alt in mut_dict[key1][key2[:-5] + '.ba.2'].keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
506 alt4 = mut_dict[key1][key2[:-5] + '.ba.2'][alt]
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
507 alt4f = alt4 / (total4 - na4 - lowq4)
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
508 else:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
509 alt4 = alt4f = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
510 total4new = total4 - na4 - lowq4
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
511 if (key2[:-5] + '.ba.2') in mut_read_dict.keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
512 add_mut4 = len(mut_read_dict[(key2[:-5] + '.ba.2')].keys())
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
513 if add_mut4 > 1:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
514 for k, v in mut_read_dict[(key2[:-5] + '.ba.2')].items():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
515 if k != key1 and k not in k1:
4
386438cd4c3b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 3
diff changeset
516 new_mut = str(k).split("#")[0] + "-" + str(int(str(k).split("#")[1]) + 1) + "-" + v[1] + "-" + v[0]
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
517 if len(add_mut14) == 0:
4
386438cd4c3b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 3
diff changeset
518 add_mut14 = new_mut
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
519 else:
4
386438cd4c3b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 3
diff changeset
520 add_mut14 = add_mut14 + ", " + new_mut
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
521 else:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
522 total4 = total4new = na4 = lowq4 = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
523 ref4 = alt4 = ref4f = alt4f = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
524
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
525 read_pos1 = read_pos2 = read_pos3 = read_pos4 = -1
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
526 read_len_median1 = read_len_median2 = read_len_median3 = read_len_median4 = 0
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
527 cigars_dcs1 = cigars_dcs2 = cigars_dcs3 = cigars_dcs4 = []
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
528 pos_read1 = pos_read2 = pos_read3 = pos_read4 = []
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
529 end_read1 = end_read2 = end_read3 = end_read4 = []
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
530 if key2[:-5] + '.ab.1' in mut_read_pos_dict[key1].keys():
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
531 read_pos1 = np.median(np.array(mut_read_pos_dict[key1][key2[:-5] + '.ab.1']))
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
532 read_len_median1 = np.median(np.array(reads_dict[key1][key2[:-5] + '.ab.1']))
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
533 cigars_dcs1 = mut_read_cigar_dict[key1][key2[:-5] + '.ab.1']
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
534 #print(mut_read_cigar_dict[key1][key2[:-5] + '.ab.1'])
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
535 pos_read1 = mut_read_pos_dict[key1][key2[:-5] + '.ab.1']
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
536 #print(cigars_dcs1)
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
537 end_read1 = reads_dict[key1][key2[:-5] + '.ab.1']
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
538 if key2[:-5] + '.ab.2' in mut_read_pos_dict[key1].keys():
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
539 read_pos2 = np.median(np.array(mut_read_pos_dict[key1][key2[:-5] + '.ab.2']))
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
540 read_len_median2 = np.median(np.array(reads_dict[key1][key2[:-5] + '.ab.2']))
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
541 cigars_dcs2 = mut_read_cigar_dict[key1][key2[:-5] + '.ab.2']
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
542 pos_read2 = mut_read_pos_dict[key1][key2[:-5] + '.ab.2']
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
543 end_read2 = reads_dict[key1][key2[:-5] + '.ab.2']
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
544 if key2[:-5] + '.ba.1' in mut_read_pos_dict[key1].keys():
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
545 read_pos3 = np.median(np.array(mut_read_pos_dict[key1][key2[:-5] + '.ba.1']))
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
546 read_len_median3 = np.median(np.array(reads_dict[key1][key2[:-5] + '.ba.1']))
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
547 cigars_dcs3 = mut_read_cigar_dict[key1][key2[:-5] + '.ba.1']
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
548 pos_read3 = mut_read_pos_dict[key1][key2[:-5] + '.ba.1']
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
549 end_read3 = reads_dict[key1][key2[:-5] + '.ba.1']
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
550 if key2[:-5] + '.ba.2' in mut_read_pos_dict[key1].keys():
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
551 read_pos4 = np.median(np.array(mut_read_pos_dict[key1][key2[:-5] + '.ba.2']))
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
552 read_len_median4 = np.median(np.array(reads_dict[key1][key2[:-5] + '.ba.2']))
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
553 #print(mut_read_cigar_dict[key1][key2[:-5] + '.ba.2'])
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
554 cigars_dcs4 = mut_read_cigar_dict[key1][key2[:-5] + '.ba.2']
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
555
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
556 pos_read4 = mut_read_pos_dict[key1][key2[:-5] + '.ba.2']
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
557 #print(cigars_dcs4)
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
558 end_read4 = reads_dict[key1][key2[:-5] + '.ba.2']
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
559
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
560 used_keys.append(key2[:-5])
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
561 counts_mut += 1
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
562 if (alt1f + alt2f + alt3f + alt4f) > 0.5:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
563 if total1new == 0:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
564 ref1f = alt1f = None
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
565 alt1ff = -1
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
566 else:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
567 alt1ff = alt1f
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
568 if total2new == 0:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
569 ref2f = alt2f = None
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
570 alt2ff = -1
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
571 else:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
572 alt2ff = alt2f
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
573 if total3new == 0:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
574 ref3f = alt3f = None
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
575 alt3ff = -1
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
576 else:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
577 alt3ff = alt3f
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
578 if total4new == 0:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
579 ref4f = alt4f = None
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
580 alt4ff = -1
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
581 else:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
582 alt4ff = alt4f
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
583
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
584 beg1 = beg4 = beg2 = beg3 = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
585
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
586 details1 = (total1, total4, total1new, total4new, ref1, ref4, alt1, alt4, ref1f, ref4f, alt1f, alt4f, na1, na4, lowq1, lowq4, beg1, beg4)
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
587 details2 = (total2, total3, total2new, total3new, ref2, ref3, alt2, alt3, ref2f, ref3f, alt2f, alt3f, na2, na3, lowq2, lowq3, beg2, beg3)
6
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
588
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
589 trimmed = False
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
590 contradictory = False
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
591 softclipped_mutation_allMates = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
592 softclipped_mutation_oneOfTwoMates = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
593 softclipped_mutation_oneOfTwoSSCS = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
594 softclipped_mutation_oneMate = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
595 softclipped_mutation_oneMateOneSSCS = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
596 print()
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
597 print(key1, cigars_dcs1, cigars_dcs4, cigars_dcs2, cigars_dcs3)
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
598 dist_start_read1 = dist_start_read2 = dist_start_read3 = dist_start_read4 = []
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
599 dist_end_read1 = dist_end_read2 = dist_end_read3 = dist_end_read4 = []
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
600 ratio_dist_start1 = ratio_dist_start2 = ratio_dist_start3 = ratio_dist_start4 = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
601 ratio_dist_end1 = ratio_dist_end2 = ratio_dist_end3 = ratio_dist_end4 = False
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
602
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
603 # mate 1 - SSCS ab
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
604 softclipped_idx1 = [True if re.search(r"^[0-9]+S", string) or re.search(r"S$", string) else False for string in cigars_dcs1]
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
605 ratio1 = safe_div(sum(softclipped_idx1), float(len(softclipped_idx1))) >= threshold_reads
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
606
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
607 if any(ij is True for ij in softclipped_idx1):
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
608 softclipped_both_ends_idx1 = [True if (re.search(r"^[0-9]+S", string) and re.search(r"S$", string)) else False for string in cigars_dcs1]
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
609 softclipped_start1 = [int(string.split("S")[0]) if re.search(r"^[0-9]+S", string) else -1 for string in cigars_dcs1]
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
610 softclipped_end1 = [int(re.split("[A-Z]", str(string))[-2]) if re.search(r"S$", string) else -1 for string in cigars_dcs1]
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
611 dist_start_read1 = [(pos - soft) if soft != -1 else thr + 1000 for soft, pos in zip(softclipped_start1, pos_read1)]
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
612 dist_end_read1 = [(length_read - pos - soft) if soft != -1 else thr + 1000 for soft, pos, length_read in zip(softclipped_end1, pos_read1, end_read1)]
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
613
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
614 # if read at both ends softclipped --> select end with smallest distance between mut position and softclipping
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
615 if any(ij is True for ij in softclipped_both_ends_idx1):
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
616 print(softclipped_both_ends_idx1)
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
617 for nr, indx in enumerate(softclipped_both_ends_idx1):
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
618 if indx:
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
619 if dist_start_read1[nr] <= dist_end_read1[nr]:
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
620 dist_end_read1[nr] = thr + 1000 # use dist of start and set start to very large number
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
621 else:
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
622 dist_start_read1[nr] = thr + 1000 # use dist of end and set start to very large number
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
623 ratio_dist_start1 = safe_div(sum([True if x <= thr else False for x in dist_start_read1]), float(sum(softclipped_idx1))) >= threshold_reads
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
624 ratio_dist_end1 = safe_div(sum([True if x <= thr else False for x in dist_end_read1]), float(sum(softclipped_idx1))) >= threshold_reads
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
625 print(key1, "mate1 ab", dist_start_read1, dist_end_read1, cigars_dcs1, ratio1, ratio_dist_start1, ratio_dist_end1)
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
626
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
627 # mate 1 - SSCS ba
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
628 softclipped_idx4 = [True if re.search(r"^[0-9]+S", string) or re.search(r"S$", string) else False for string in cigars_dcs4]
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
629 ratio4 = safe_div(sum(softclipped_idx4), float(len(softclipped_idx4))) >= threshold_reads
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
630 if any(ij is True for ij in softclipped_idx4):
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
631 softclipped_both_ends_idx4 = [True if (re.search(r"^[0-9]+S", string) and re.search(r"S$", string)) else False for string in cigars_dcs4]
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
632 softclipped_start4 = [int(string.split("S")[0]) if re.search(r"^[0-9]+S", string) else -1 for string in cigars_dcs4]
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
633 softclipped_end4 = [int(re.split("[A-Z]", str(string))[-2]) if re.search(r"S$", string) else -1 for string in cigars_dcs4]
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
634 dist_start_read4 = [(pos - soft) if soft != -1 else thr + 1000 for soft, pos in zip(softclipped_start4, pos_read4)]
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
635 dist_end_read4 = [(length_read - pos - soft) if soft != -1 else thr + 1000 for soft, pos, length_read in zip(softclipped_end4, pos_read4, end_read4)]
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
636
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
637 # if read at both ends softclipped --> select end with smallest distance between mut position and softclipping
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
638 if any(ij is True for ij in softclipped_both_ends_idx4):
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
639 print(softclipped_both_ends_idx4)
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
640 for nr, indx in enumerate(softclipped_both_ends_idx4):
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
641 if indx:
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
642 if dist_start_read4[nr] <= dist_end_read4[nr]:
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
643 dist_end_read4[nr] = thr + 1000 # use dist of start and set start to very large number
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
644 else:
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
645 dist_start_read4[nr] = thr + 1000 # use dist of end and set start to very large number
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
646 ratio_dist_start4 = safe_div(sum([True if x <= thr else False for x in dist_start_read4]), float(sum(softclipped_idx4))) >= threshold_reads
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
647 ratio_dist_end4 = safe_div(sum([True if x <= thr else False for x in dist_end_read4]), float(sum(softclipped_idx4))) >= threshold_reads
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
648 print(key1, "mate1 ba", dist_start_read4, dist_end_read4,cigars_dcs4, ratio4, ratio_dist_start4, ratio_dist_end4)
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
649
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
650 # mate 2 - SSCS ab
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
651 softclipped_idx2 = [True if re.search(r"^[0-9]+S", string) or re.search(r"S$", string) else False for string in cigars_dcs2]
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
652 #print(sum(softclipped_idx2))
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
653 ratio2 = safe_div(sum(softclipped_idx2), float(len(softclipped_idx2))) >= threshold_reads
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
654 if any(ij is True for ij in softclipped_idx2):
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
655 softclipped_both_ends_idx2 = [True if (re.search(r"^[0-9]+S", string) and re.search(r"S$", string)) else False for string in cigars_dcs2]
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
656 softclipped_start2 = [int(string.split("S")[0]) if re.search(r"^[0-9]+S", string) else -1 for string in cigars_dcs2]
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
657 softclipped_end2 = [int(re.split("[A-Z]", str(string))[-2]) if re.search(r"S$", string) else -1 for string in cigars_dcs2]
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
658 dist_start_read2 = [(pos - soft) if soft != -1 else thr + 1000 for soft, pos in zip(softclipped_start2, pos_read2)]
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
659 dist_end_read2 = [(length_read - pos - soft) if soft != -1 else thr + 1000 for soft, pos, length_read in zip(softclipped_end2, pos_read2, end_read2)]
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
660
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
661 # if read at both ends softclipped --> select end with smallest distance between mut position and softclipping
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
662 if any(ij is True for ij in softclipped_both_ends_idx2):
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
663 print(softclipped_both_ends_idx2)
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
664 for nr, indx in enumerate(softclipped_both_ends_idx2):
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
665 if indx:
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
666 if dist_start_read2[nr] <= dist_end_read2[nr]:
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
667 dist_end_read2[nr] = thr + 1000 # use dist of start and set start to very large number
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
668 else:
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
669 dist_start_read2[nr] = thr + 1000 # use dist of end and set start to very large number
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
670 ratio_dist_start2 = safe_div(sum([True if x <= thr else False for x in dist_start_read2]), float(sum(softclipped_idx2))) >= threshold_reads
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
671 #print(ratio_dist_end2)
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
672 #print([True if x <= thr else False for x in ratio_dist_end2])
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
673 ratio_dist_end2 = safe_div(sum([True if x <= thr else False for x in dist_end_read2]), float(sum(softclipped_idx2))) >= threshold_reads
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
674 print(key1, "mate2 ab", dist_start_read2, dist_end_read2,cigars_dcs2, ratio2, ratio_dist_start2, ratio_dist_end2)
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
675
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
676 # mate 2 - SSCS ba
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
677 softclipped_idx3 = [True if re.search(r"^[0-9]+S", string) or re.search(r"S$", string) else False for string in cigars_dcs3]
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
678 ratio3 = safe_div(sum(softclipped_idx3), float(len(softclipped_idx3))) >= threshold_reads
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
679 if any(ij is True for ij in softclipped_idx3):
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
680 softclipped_both_ends_idx3 = [True if (re.search(r"^[0-9]+S", string) and re.search(r"S$", string)) else False for string in cigars_dcs3]
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
681 softclipped_start3 = [int(string.split("S")[0]) if re.search(r"^[0-9]+S", string) else -1 for string in cigars_dcs3]
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
682 softclipped_end3 = [int(re.split("[A-Z]", str(string))[-2]) if re.search(r"S$", string) else -1 for string in cigars_dcs3]
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
683 dist_start_read3 = [(pos - soft) if soft != -1 else thr + 1000 for soft, pos in zip(softclipped_start3, pos_read3)]
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
684 dist_end_read3 = [(length_read - pos - soft) if soft != -1 else thr + 1000 for soft, pos, length_read in zip(softclipped_end3, pos_read3, end_read3)]
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
685
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
686 # if read at both ends softclipped --> select end with smallest distance between mut position and softclipping
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
687 if any(ij is True for ij in softclipped_both_ends_idx3):
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
688 print(softclipped_both_ends_idx3)
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
689 for nr, indx in enumerate(softclipped_both_ends_idx3):
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
690 if indx:
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
691 if dist_start_read3[nr] <= dist_end_read3[nr]:
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
692 dist_end_read3[nr] = thr + 1000 # use dist of start and set start to a larger number than thresh
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
693 else:
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
694 dist_start_read3[nr] = thr + 1000 # use dist of end and set start to very large number
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
695 #print([True if x <= thr else False for x in dist_start_read3])
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
696 ratio_dist_start3 = safe_div(sum([True if x <= thr else False for x in dist_start_read3]), float(sum(softclipped_idx3))) >= threshold_reads
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
697 ratio_dist_end3 = safe_div(sum([True if x <= thr else False for x in dist_end_read3]), float(sum(softclipped_idx3))) >= threshold_reads
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
698 print(key1, "mate2 ba", dist_start_read3, dist_end_read3,cigars_dcs3, ratio3, ratio_dist_start3, ratio_dist_end3)
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
699
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
700 if ((all(float(ij) >= 0.5 for ij in [alt1ff, alt4ff]) & # contradictory variant
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
701 all(float(ij) == 0. for ij in [alt2ff, alt3ff])) |
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
702 (all(float(ij) >= 0.5 for ij in [alt2ff, alt3ff]) &
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
703 all(float(ij) == 0. for ij in [alt1ff, alt4ff]))):
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
704 alt1ff = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
705 alt4ff = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
706 alt2ff = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
707 alt3ff = 0
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
708 trimmed = False
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
709 contradictory = True
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
710 # softclipping tiers
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
711 # information of both mates available --> all reads for both mates and SSCS are softclipped
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
712 elif (ratio1 & ratio4 & ratio2 & ratio3 &
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
713 (ratio_dist_start1 | ratio_dist_end1) & (ratio_dist_start4 | ratio_dist_end4) & (ratio_dist_start2 | ratio_dist_end2) & (ratio_dist_start3 | ratio_dist_end3) &
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
714 all(float(ij) > 0. for ij in [alt1ff, alt2ff, alt3ff, alt4ff])): # all mates available
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
715 # if distance between softclipping and mutation is at start or end of the read smaller than threshold
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
716 softclipped_mutation_allMates = True
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
717 softclipped_mutation_oneOfTwoMates = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
718 softclipped_mutation_oneOfTwoSSCS = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
719 softclipped_mutation_oneMate = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
720 softclipped_mutation_oneMateOneSSCS = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
721 alt1ff = 0
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
722 alt4ff = 0
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
723 alt2ff = 0
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
724 alt3ff = 0
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
725 trimmed = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
726 contradictory = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
727 print(key1, "softclipped_mutation_allMates", softclipped_mutation_allMates)
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
728 # information of both mates available --> only one mate softclipped
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
729 elif (((ratio1 & ratio4 & (ratio_dist_start1 | ratio_dist_end1) & (ratio_dist_start4 | ratio_dist_end4)) |
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
730 (ratio2 & ratio3 & (ratio_dist_start2 | ratio_dist_end2) & (ratio_dist_start3 | ratio_dist_end3))) &
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
731 all(float(ij) > 0. for ij in [alt1ff, alt2ff, alt3ff, alt4ff])): # all mates available
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
732 # if distance between softclipping and mutation is at start or end of the read smaller than threshold
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
733 softclipped_mutation_allMates = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
734 softclipped_mutation_oneOfTwoMates = True
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
735 softclipped_mutation_oneOfTwoSSCS = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
736 softclipped_mutation_oneMate = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
737 softclipped_mutation_oneMateOneSSCS = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
738 alt1ff = 0
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
739 alt4ff = 0
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
740 alt2ff = 0
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
741 alt3ff = 0
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
742 trimmed = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
743 contradictory = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
744 print(key1, "softclipped_mutation_oneOfTwoMates", softclipped_mutation_oneOfTwoMates)
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
745 # information of both mates available --> only one mate softclipped
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
746 elif (((ratio1 & (ratio_dist_start1 | ratio_dist_end1)) | (ratio4 & (ratio_dist_start4 | ratio_dist_end4))) &
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
747 ((ratio2 & (ratio_dist_start2 | ratio_dist_end2)) | (ratio3 & (ratio_dist_start3 | ratio_dist_end3))) &
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
748 all(float(ij) > 0. for ij in [alt1ff, alt2ff, alt3ff, alt4ff])): # all mates available
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
749 # if distance between softclipping and mutation is at start or end of the read smaller than threshold
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
750 softclipped_mutation_allMates = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
751 softclipped_mutation_oneOfTwoMates = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
752 softclipped_mutation_oneOfTwoSSCS = True
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
753 softclipped_mutation_oneMate = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
754 softclipped_mutation_oneMateOneSSCS = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
755 alt1ff = 0
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
756 alt4ff = 0
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
757 alt2ff = 0
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
758 alt3ff = 0
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
759 trimmed = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
760 contradictory = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
761 print(key1, "softclipped_mutation_oneOfTwoSSCS", softclipped_mutation_oneOfTwoSSCS, [alt1ff, alt2ff, alt3ff, alt4ff])
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
762 # information of one mate available --> all reads of one mate are softclipped
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
763 elif ((ratio1 & ratio4 & (ratio_dist_start1 | ratio_dist_end1) & (ratio_dist_start4 | ratio_dist_end4) &
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
764 all(float(ij) < 0. for ij in [alt2ff, alt3ff]) & all(float(ij) > 0. for ij in [alt1ff, alt4ff])) |
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
765 (ratio2 & ratio3 & (ratio_dist_start2 | ratio_dist_end2) & (ratio_dist_start3 | ratio_dist_end3) &
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
766 all(float(ij) < 0. for ij in [alt1ff, alt4ff]) & all(float(ij) > 0. for ij in [alt2ff, alt3ff]))): # all mates available
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
767 # if distance between softclipping and mutation is at start or end of the read smaller than threshold
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
768 #if ((((len(dist_start_read1) > 0 | len(dist_end_read1) > 0 ) & all(ij <= thr or nm <= thr for ij, nm in zip(dist_start_read1, dist_end_read1))) &
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
769 # ((len(dist_start_read4) > 0 | len(dist_end_read4) > 0 ) & all(ij <= thr or nm <= thr for ij, nm in zip(dist_start_read4, dist_end_read4)))) |
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
770 # (((len(dist_start_read2) > 0 | len(dist_end_read2) > 0 ) & all(ij <= thr or nm <= thr for ij, nm in zip(dist_start_read2, dist_end_read2))) &
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
771 # ((len(dist_start_read3) > 0 | len(dist_end_read3) > 0 ) & all(ij <= thr or nm <= thr for ij, nm in zip(dist_start_read3, dist_end_read3))))):
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
772 softclipped_mutation_allMates = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
773 softclipped_mutation_oneOfTwoMates = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
774 softclipped_mutation_oneOfTwoSSCS = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
775 softclipped_mutation_oneMate = True
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
776 softclipped_mutation_oneMateOneSSCS = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
777 alt1ff = 0
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
778 alt4ff = 0
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
779 alt2ff = 0
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
780 alt3ff = 0
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
781 trimmed = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
782 contradictory = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
783 print(key1, "softclipped_mutation_oneMate", softclipped_mutation_oneMate)
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
784 # information of one mate available --> only one SSCS is softclipped
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
785 elif ((((ratio1 & (ratio_dist_start1 | ratio_dist_end1)) | (ratio4 & (ratio_dist_start4 | ratio_dist_end4))) &
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
786 (all(float(ij) < 0. for ij in [alt2ff, alt3ff]) & all(float(ij) > 0. for ij in [alt1ff, alt4ff]))) |
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
787 (((ratio2 & (ratio_dist_start2 | ratio_dist_end2)) | (ratio3 & (ratio_dist_start3 | ratio_dist_end3))) &
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
788 (all(float(ij) < 0. for ij in [alt1ff, alt4ff]) & all(float(ij) < 0. for ij in [alt2ff, alt3ff])))): # all mates available
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
789 # if distance between softclipping and mutation is at start or end of the read smaller than threshold
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
790 #if ((all(ij <= thr or nm <= thr for ij, nm in zip(dist_start_read1, dist_end_read1)) |
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
791 # all(ij <= thr or nm <= thr for ij, nm in zip(dist_start_read4, dist_end_read4))) |
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
792 # (all(ij <= thr or nm <= thr for ij, nm in zip(dist_start_read2, dist_end_read2)) |
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
793 # all(ij <= thr or nm <= thr for ij, nm in zip(dist_start_read3, dist_end_read3)))):
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
794 softclipped_mutation_allMates = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
795 softclipped_mutation_oneOfTwoMates = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
796 softclipped_mutation_oneOfTwoSSCS = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
797 softclipped_mutation_oneMate = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
798 softclipped_mutation_oneMateOneSSCS = True
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
799 alt1ff = 0
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
800 alt4ff = 0
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
801 alt2ff = 0
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
802 alt3ff = 0
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
803 trimmed = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
804 contradictory = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
805 print(key1, "softclipped_mutation_oneMateOneSSCS", softclipped_mutation_oneMateOneSSCS)
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
806
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
807 else:
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
808 if ((read_pos1 >= 0) and ((read_pos1 <= trim) | (abs(read_len_median1 - read_pos1) <= trim))):
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
809 beg1 = total1new
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
810 total1new = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
811 alt1ff = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
812 alt1f = 0
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
813 trimmed = True
28
afda74e874ac planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 27
diff changeset
814
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
815 if ((read_pos4 >= 0) and ((read_pos4 <= trim) | (abs(read_len_median4 - read_pos4) <= trim))):
28
afda74e874ac planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 27
diff changeset
816 beg4 = total4new
afda74e874ac planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 27
diff changeset
817 total4new = 0
afda74e874ac planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 27
diff changeset
818 alt4ff = 0
afda74e874ac planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 27
diff changeset
819 alt4f = 0
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
820 trimmed = True
28
afda74e874ac planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 27
diff changeset
821
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
822 if ((read_pos2 >= 0) and ((read_pos2 <= trim) | (abs(read_len_median2 - read_pos2) <= trim))):
28
afda74e874ac planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 27
diff changeset
823 beg2 = total2new
afda74e874ac planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 27
diff changeset
824 total2new = 0
afda74e874ac planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 27
diff changeset
825 alt2ff = 0
afda74e874ac planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 27
diff changeset
826 alt2f = 0
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
827 trimmed = True
6
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
828
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
829 if ((read_pos3 >= 0) and ((read_pos3 <= trim) | (abs(read_len_median3 - read_pos3) <= trim))):
28
afda74e874ac planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 27
diff changeset
830 beg3 = total3new
afda74e874ac planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 27
diff changeset
831 total3new = 0
afda74e874ac planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 27
diff changeset
832 alt3ff = 0
afda74e874ac planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 27
diff changeset
833 alt3f = 0
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
834 trimmed = True
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
835 details1 = (total1, total4, total1new, total4new, ref1, ref4, alt1, alt4, ref1f, ref4f, alt1f, alt4f, na1, na4, lowq1, lowq4, beg1, beg4)
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
836 details2 = (total2, total3, total2new, total3new, ref2, ref3, alt2, alt3, ref2f, ref3f, alt2f, alt3f, na2, na3, lowq2, lowq3, beg2, beg3)
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
837
46
f733c425b804 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 45
diff changeset
838
48
e2a655533077 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 47
diff changeset
839 #sum_highTiers = sum([tier_dict[key1][ij] for ij in tier_dict[key1].keys()[:6]])
46
f733c425b804 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 45
diff changeset
840
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
841 # assign tiers
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
842 if ((all(int(ij) >= 3 for ij in [total1new, total4new]) &
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
843 all(float(ij) >= 0.75 for ij in [alt1ff, alt4ff])) |
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
844 (all(int(ij) >= 3 for ij in [total2new, total3new]) &
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
845 all(float(ij) >= 0.75 for ij in [alt2ff, alt3ff]))):
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
846 tier = "1.1"
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
847 counter_tier11 += 1
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
848 tier_dict[key1]["tier 1.1"] += 1
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
849
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
850 elif (all(int(ij) >= 1 for ij in [total1new, total2new, total3new, total4new]) &
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
851 any(int(ij) >= 3 for ij in [total1new, total4new]) &
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
852 any(int(ij) >= 3 for ij in [total2new, total3new]) &
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
853 all(float(ij) >= 0.75 for ij in [alt1ff, alt2ff, alt3ff, alt4ff])):
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
854 tier = "1.2"
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
855 counter_tier12 += 1
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
856 tier_dict[key1]["tier 1.2"] += 1
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
857
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
858 elif ((all(int(ij) >= 1 for ij in [total1new, total4new]) &
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
859 any(int(ij) >= 3 for ij in [total1new, total4new]) &
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
860 all(float(ij) >= 0.75 for ij in [alt1ff, alt4ff])) |
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
861 (all(int(ij) >= 1 for ij in [total2new, total3new]) &
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
862 any(int(ij) >= 3 for ij in [total2new, total3new]) &
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
863 all(float(ij) >= 0.75 for ij in [alt2ff, alt3ff]))):
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
864 tier = "2.1"
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
865 counter_tier21 += 1
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
866 tier_dict[key1]["tier 2.1"] += 1
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
867
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
868 elif (all(int(ij) >= 1 for ij in [total1new, total2new, total3new, total4new]) &
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
869 all(float(ij) >= 0.75 for ij in [alt1ff, alt2ff, alt3ff, alt4ff])):
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
870 tier = "2.2"
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
871 counter_tier22 += 1
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
872 tier_dict[key1]["tier 2.2"] += 1
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
873
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
874 elif ((all(int(ij) >= 1 for ij in [total1new, total4new]) &
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
875 any(int(ij) >= 3 for ij in [total2new, total3new]) &
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
876 all(float(ij) >= 0.75 for ij in [alt1ff, alt4ff]) &
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
877 any(float(ij) >= 0.75 for ij in [alt2ff, alt3ff])) |
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
878 (all(int(ij) >= 1 for ij in [total2new, total3new]) &
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
879 any(int(ij) >= 3 for ij in [total1new, total4new]) &
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
880 all(float(ij) >= 0.75 for ij in [alt2ff, alt3ff]) &
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
881 any(float(ij) >= 0.75 for ij in [alt1ff, alt4ff]))):
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
882 tier = "2.3"
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
883 counter_tier23 += 1
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
884 tier_dict[key1]["tier 2.3"] += 1
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
885
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
886 elif ((all(int(ij) >= 1 for ij in [total1new, total4new]) &
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
887 all(float(ij) >= 0.75 for ij in [alt1ff, alt4ff])) |
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
888 (all(int(ij) >= 1 for ij in [total2new, total3new]) &
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
889 all(float(ij) >= 0.75 for ij in [alt2ff, alt3ff]))):
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
890 tier = "2.4"
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
891 counter_tier24 += 1
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
892 tier_dict[key1]["tier 2.4"] += 1
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
893
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
894 elif ((len(pure_tags_dict_short[key1]) > 1) &
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
895 (all(float(ij) >= 0.5 for ij in [alt1ff, alt4ff]) |
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
896 all(float(ij) >= 0.5 for ij in [alt2ff, alt3ff]))):
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
897 tier = "3.1"
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
898 counter_tier31 += 1
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
899 tier_dict[key1]["tier 3.1"] += 1
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
900
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
901 elif ((all(int(ij) >= 1 for ij in [total1new, total4new]) &
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
902 all(float(ij) >= 0.5 for ij in [alt1ff, alt4ff])) |
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
903 (all(int(ij) >= 1 for ij in [total2new, total3new]) &
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
904 all(float(ij) >= 0.5 for ij in [alt2ff, alt3ff]))):
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
905 tier = "3.2"
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
906 counter_tier32 += 1
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
907 tier_dict[key1]["tier 3.2"] += 1
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
908
48
e2a655533077 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 47
diff changeset
909 #elif (trimmed) and (sum_highTiers > 1):
e2a655533077 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 47
diff changeset
910 # tier = "2.5"
e2a655533077 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 47
diff changeset
911 # counter_tier25 += 1
e2a655533077 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 47
diff changeset
912 # tier_dict[key1]["tier 2.5"] += 1
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
913
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
914 elif (trimmed):
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
915 tier = "4"
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
916 counter_tier4 += 1
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
917 tier_dict[key1]["tier 4"] += 1
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
918
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
919 elif softclipped_mutation_allMates:
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
920 tier = "5.1"
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
921 counter_tier51 += 1
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
922 tier_dict[key1]["tier 5.1"] += 1
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
923
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
924 elif softclipped_mutation_oneOfTwoMates:
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
925 tier = "5.2"
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
926 counter_tier52 += 1
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
927 tier_dict[key1]["tier 5.2"] += 1
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
928
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
929 elif softclipped_mutation_oneOfTwoSSCS:
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
930 tier = "5.3"
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
931 counter_tier53 += 1
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
932 tier_dict[key1]["tier 5.3"] += 1
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
933
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
934 elif softclipped_mutation_oneMate:
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
935 tier = "5.4"
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
936 counter_tier54 += 1
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
937 tier_dict[key1]["tier 5.4"] += 1
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
938
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
939 elif softclipped_mutation_oneMateOneSSCS:
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
940 tier = "5.5"
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
941 counter_tier55 += 1
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
942 tier_dict[key1]["tier 5.5"] += 1
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
943
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
944 elif (contradictory):
28
afda74e874ac planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 27
diff changeset
945 tier = "6"
afda74e874ac planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 27
diff changeset
946 counter_tier6 += 1
afda74e874ac planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 27
diff changeset
947 tier_dict[key1]["tier 6"] += 1
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
948
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
949 else:
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
950 tier = "7"
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
951 counter_tier7 += 1
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
952 tier_dict[key1]["tier 7"] += 1
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
953
7
ded0dc6a20d3 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 6
diff changeset
954 chrom, pos, ref_a, alt_a = re.split(r'\#', key1)
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
955 var_id = '-'.join([chrom, str(int(pos)+1), ref, alt])
2
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
956 sample_tag = key2[:-5]
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
957 array2 = np.unique(whole_array) # remove duplicate sequences to decrease running time
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
958 # exclude identical tag from array2, to prevent comparison to itself
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
959 same_tag = np.where(array2 == sample_tag)
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
960 index_array2 = np.arange(0, len(array2), 1)
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
961 index_withoutSame = np.delete(index_array2, same_tag) # delete identical tag from the data
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
962 array2 = array2[index_withoutSame]
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
963 if len(array2) != 0: # only perform chimera analysis if there is more than 1 variant
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
964 array1_half = sample_tag[0:int(len(sample_tag) / 2)] # mate1 part1
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
965 array1_half2 = sample_tag[int(len(sample_tag) / 2):int(len(sample_tag))] # mate1 part 2
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
966 array2_half = np.array([ii[0:int(len(ii) / 2)] for ii in array2]) # mate2 part1
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
967 array2_half2 = np.array([ii[int(len(ii) / 2):int(len(ii))] for ii in array2]) # mate2 part2
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
968
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
969 min_tags_list_zeros = []
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
970 chimera_tags = []
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
971 for mate_b in [False, True]:
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
972 i = 0 # counter, only used to see how many HDs of tags were already calculated
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
973 if mate_b is False: # HD calculation for all a's
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
974 half1_mate1 = array1_half
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
975 half2_mate1 = array1_half2
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
976 half1_mate2 = array2_half
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
977 half2_mate2 = array2_half2
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
978 elif mate_b is True: # HD calculation for all b's
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
979 half1_mate1 = array1_half2
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
980 half2_mate1 = array1_half
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
981 half1_mate2 = array2_half2
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
982 half2_mate2 = array2_half
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
983 # calculate HD of "a" in the tag to all "a's" or "b" in the tag to all "b's"
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
984 dist = np.array([sum(itertools.imap(operator.ne, half1_mate1, c)) for c in half1_mate2])
2
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
985 min_index = np.where(dist == dist.min()) # get index of min HD
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
986 # get all "b's" of the tag or all "a's" of the tag with minimum HD
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
987 min_tag_half2 = half2_mate2[min_index]
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
988 min_tag_array2 = array2[min_index] # get whole tag with min HD
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
989 min_value = dist.min()
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
990 # calculate HD of "b" to all "b's" or "a" to all "a's"
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
991 dist_second_half = np.array([sum(itertools.imap(operator.ne, half2_mate1, e))
2
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
992 for e in min_tag_half2])
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
993
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
994 dist2 = dist_second_half.max()
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
995 max_index = np.where(dist_second_half == dist_second_half.max())[0] # get index of max HD
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
996 max_tag = min_tag_array2[max_index]
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
997
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
998 # tags which have identical parts:
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
999 if min_value == 0 or dist2 == 0:
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1000 min_tags_list_zeros.append(tag)
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1001 chimera_tags.append(max_tag)
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1002 # chimeric = True
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1003 # else:
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1004 # chimeric = False
2
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1005
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1006 # if mate_b is False:
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1007 # text = "pos {}: sample tag: {}; HD a = {}; HD b' = {}; similar tag(s): {}; chimeric = {}".format(pos, sample_tag, min_value, dist2, list(max_tag), chimeric)
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1008 # else:
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1009 # text = "pos {}: sample tag: {}; HD a' = {}; HD b = {}; similar tag(s): {}; chimeric = {}".format(pos, sample_tag, dist2, min_value, list(max_tag), chimeric)
2
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1010 i += 1
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1011 chimera_tags = [x for x in chimera_tags if x != []]
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1012 chimera_tags_new = []
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1013 for i in chimera_tags:
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1014 if len(i) > 1:
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1015 for t in i:
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1016 chimera_tags_new.append(t)
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1017 else:
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1018 chimera_tags_new.extend(i)
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1019 chimera = ", ".join(chimera_tags_new)
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1020 else:
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1021 chimera_tags_new = []
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1022 chimera = ""
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1023
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1024 if len(chimera_tags_new) > 0:
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1025 chimera_tags_new.append(sample_tag)
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1026 key_chimera = ",".join(sorted(chimera_tags_new))
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1027 if key_chimera in chimeric_tag.keys():
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1028 chimeric_tag[key_chimera].append(float(tier))
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1029 else:
6
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
1030 chimeric_tag[key_chimera] = [float(tier)]
2
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1031
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1032 if (read_pos1 == -1):
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1033 read_pos1 = read_len_median1 = None
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1034 if (read_pos4 == -1):
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1035 read_pos4 = read_len_median4 = None
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1036 if (read_pos2 == -1):
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1037 read_pos2 = read_len_median2 = None
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1038 if (read_pos3 == -1):
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1039 read_pos3 = read_len_median3 = None
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1040 line = (var_id, tier, key2[:-5], 'ab1.ba2', read_pos1, read_pos4, read_len_median1, read_len_median4, dcs_median) + details1 + (sscs_mut_ab, sscs_mut_ba, sscs_ref_ab, sscs_ref_ba, add_mut14, chimera)
55
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
1041 #ws1.write_row(row, 0, line)
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
1042 #csv_writer.writerow(line)
48
e2a655533077 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 47
diff changeset
1043 line2 = ("", "", key2[:-5], 'ab2.ba1', read_pos2, read_pos3, read_len_median2, read_len_median3, dcs_median) + details2 + (sscs_mut_ab, sscs_mut_ba, sscs_ref_ab, sscs_ref_ba, add_mut23, chimera)
55
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
1044 #ws1.write_row(row + 1, 0, line2)
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
1045 #csv_writer.writerow(line2)
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1046
55
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
1047 #ws1.conditional_format('L{}:M{}'.format(row + 1, row + 2),
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
1048 # {'type': 'formula',
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
1049 # 'criteria': '=OR($B${}="1.1", $B${}="1.2")'.format(row + 1, row + 1),
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
1050 # 'format': format1,
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
1051 # 'multi_range': 'L{}:M{} T{}:U{} B{}'.format(row + 1, row + 2, row + 1, row + 2, row + 1, row + 2)})
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
1052 #ws1.conditional_format('L{}:M{}'.format(row + 1, row + 2),
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
1053 # {'type': 'formula',
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
1054 # 'criteria': '=OR($B${}="2.1", $B${}="2.2", $B${}="2.3", $B${}="2.4", $B${}="2.5")'.format(row + 1, row + 1, row + 1, row + 1, row + 1),
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
1055 # 'format': format3,
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
1056 # 'multi_range': 'L{}:M{} T{}:U{} B{}'.format(row + 1, row + 2, row + 1, row + 2, row + 1, row + 2)})
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
1057 #ws1.conditional_format('L{}:M{}'.format(row + 1, row + 2),
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
1058 # {'type': 'formula',
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
1059 # 'criteria': '=$B${}>="3"'.format(row + 1),
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
1060 # 'format': format2,
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
1061 # 'multi_range': 'L{}:M{} T{}:U{} B{}'.format(row + 1, row + 2, row + 1, row + 2, row + 1, row + 2)})
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
1062 #if trimmed:
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
1063 if key1 not in list(change_tier_after_print.keys()):
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
1064 change_tier_after_print[key1] = [((row, line, line2))]
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
1065 else:
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
1066 change_tier_after_print[key1].append(((row, line, line2)))
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1067
11
84a1a3f70407 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 10
diff changeset
1068 row += 3
55
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
1069
2
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1070 if chimera_correction:
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1071 chimeric_dcs_high_tiers = 0
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1072 chimeric_dcs = 0
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1073 for keys_chimera in chimeric_tag.keys():
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1074 tiers = chimeric_tag[keys_chimera]
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1075 chimeric_dcs += len(tiers) - 1
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1076 high_tiers = sum(1 for t in tiers if t < 3.)
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1077 if high_tiers == len(tiers):
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1078 chimeric_dcs_high_tiers += high_tiers - 1
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1079 else:
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1080 chimeric_dcs_high_tiers += high_tiers
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1081 chimera_dict[key1] = (chimeric_dcs, chimeric_dcs_high_tiers)
48
e2a655533077 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 47
diff changeset
1082
55
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
1083 # write to file
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
1084
48
e2a655533077 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 47
diff changeset
1085 # move tier 4 counts to tier 2.5 if there other mutations with tier <= 2.4
53
27b00e38e13d planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 52
diff changeset
1086 sum_highTiers = sum([tier_dict[key1][ij] for ij in list(sorted(tier_dict[key1].keys()))[:6]])
55
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
1087
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
1088 correct_tier = False
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
1089
48
e2a655533077 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 47
diff changeset
1090 if tier_dict[key1]["tier 4"] > 0 and sum_highTiers > 0:
e2a655533077 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 47
diff changeset
1091 tier_dict[key1]["tier 2.5"] = tier_dict[key1]["tier 4"]
e2a655533077 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 47
diff changeset
1092 tier_dict[key1]["tier 4"] = 0
55
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
1093 correct_tier = True
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
1094
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
1095 lines = change_tier_after_print[key1]
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
1096 for sample in lines:
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
1097 row = sample[0]
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
1098 line1 = sample[1]
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
1099 line2 = sample[2]
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
1100
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
1101 if correct_tier:
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
1102 line1 = list(line1)
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
1103 line1[1] = "2.5"
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
1104 line1 = tuple(line1)
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
1105 ws1.write_row(row, 0, line1)
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
1106 csv_writer.writerow(line1)
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
1107 ws1.write_row(row + 1, 0, line2)
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
1108 csv_writer.writerow(line2)
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
1109
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
1110 ws1.conditional_format('L{}:M{}'.format(row + 1, row + 2),
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
1111 {'type': 'formula',
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
1112 'criteria': '=OR($B${}="1.1", $B${}="1.2")'.format(row + 1, row + 1),
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
1113 'format': format1,
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
1114 'multi_range': 'L{}:M{} T{}:U{} B{}'.format(row + 1, row + 2, row + 1, row + 2, row + 1, row + 2)})
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
1115 ws1.conditional_format('L{}:M{}'.format(row + 1, row + 2),
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
1116 {'type': 'formula',
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
1117 'criteria': '=OR($B${}="2.1", $B${}="2.2", $B${}="2.3", $B${}="2.4", $B${}="2.5")'.format(row + 1, row + 1, row + 1, row + 1, row + 1),
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
1118 'format': format3,
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
1119 'multi_range': 'L{}:M{} T{}:U{} B{}'.format(row + 1, row + 2, row + 1, row + 2, row + 1, row + 2)})
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
1120 ws1.conditional_format('L{}:M{}'.format(row + 1, row + 2),
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
1121 {'type': 'formula',
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
1122 'criteria': '=$B${}>="3"'.format(row + 1),
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
1123 'format': format2,
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
1124 'multi_range': 'L{}:M{} T{}:U{} B{}'.format(row + 1, row + 2, row + 1, row + 2, row + 1, row + 2)})
50
b32c973fe8ab planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 49
diff changeset
1125
2
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1126 # sheet 2
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1127 if chimera_correction:
55
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
1128 header_line2 = ('variant ID', 'cvrg', 'AC alt (all tiers)', 'AF (all tiers)', 'chimeras in AC alt (all tiers)', 'chimera-corrected cvrg', 'chimera-corrected AF (all tiers)', 'cvrg (tiers 1.1-2.5)', 'AC alt (tiers 1.1-2.5)', 'AF (tiers 1.1-2.5)', 'chimeras in AC alt (tiers 1.1-2.5)', 'chimera-corrected cvrg (tiers 1.1-2.5)', 'chimera-corrected AF (tiers 1.1-2.5)', 'AC alt (orginal DCS)', 'AF (original DCS)',
46
f733c425b804 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 45
diff changeset
1129 'tier 1.1', 'tier 1.2', 'tier 2.1', 'tier 2.2', 'tier 2.3', 'tier 2.4', 'tier 2.5',
f733c425b804 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 45
diff changeset
1130 'tier 3.1', 'tier 3.2', 'tier 4', 'tier 5.1', 'tier 5.2', 'tier 5.3', 'tier 5.4', 'tier 5.5', 'tier 6', 'tier 7', 'AF 1.1-1.2', 'AF 1.1-2.1', 'AF 1.1-2.2',
55
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
1131 'AF 1.1-2.3', 'AF 1.1-2.4', 'AF 1.1-2.5', 'AF 1.1-3.1', 'AF 1.1-3.2', 'AF 1.1-4', 'AF 1.1-5.1', 'AF 1.1-5.2', 'AF 1.1-5.3', 'AF 1.1-5.4', 'AF 1.1-5.5', 'AF 1.1-6', 'AF 1.1-7')
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1132 else:
55
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
1133 header_line2 = ('variant ID', 'cvrg', 'AC alt (all tiers)', 'AF (all tiers)', 'cvrg (tiers 1.1-2.5)', 'AC alt (tiers 1.1-2.5)', 'AF (tiers 1.1-2.5)', 'AC alt (orginal DCS)', 'AF (original DCS)',
46
f733c425b804 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 45
diff changeset
1134 'tier 1.1', 'tier 1.2', 'tier 2.1', 'tier 2.2', 'tier 2.3', 'tier 2.4', 'tier 2.5',
f733c425b804 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 45
diff changeset
1135 'tier 3.1', 'tier 3.2', 'tier 4', 'tier 5.1', 'tier 5.2', 'tier 5.3', 'tier 5.4', 'tier 5.5', 'tier 6', 'tier 7', 'AF 1.1-1.2', 'AF 1.1-2.1', 'AF 1.1-2.2',
55
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
1136 'AF 1.1-2.3', 'AF 1.1-2.4', 'AF 1.1-2.5', 'AF 1.1-3.1', 'AF 1.1-3.2', 'AF 1.1-4', 'AF 1.1-5.1', 'AF 1.1-5.2', 'AF 1.1-5.3', 'AF 1.1-5.4', 'AF 1.1-5.5', 'AF 1.1-6', 'AF 1.1-7')
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1137
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1138 ws2.write_row(0, 0, header_line2)
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1139 row = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1140
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1141 for key1, value1 in sorted(tier_dict.items()):
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1142 if key1 in pure_tags_dict_short.keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1143 i = np.where(np.array(['#'.join(str(i) for i in z)
7
ded0dc6a20d3 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 6
diff changeset
1144 for z in zip(mut_array[:, 0], mut_array[:, 1], mut_array[:, 2], mut_array[:, 3])]) == key1)[0][0]
6
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
1145 ref = mut_array[i, 2]
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
1146 alt = mut_array[i, 3]
7
ded0dc6a20d3 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 6
diff changeset
1147 chrom, pos, ref_a, alt_a = re.split(r'\#', key1)
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1148 ref_count = cvrg_dict[key1][0]
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1149 alt_count = cvrg_dict[key1][1]
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1150 cvrg = ref_count + alt_count
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1151
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1152 var_id = '-'.join([chrom, str(int(pos)+1), ref, alt])
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1153 lst = [var_id, cvrg]
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1154 used_tiers = []
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1155 cum_af = []
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1156 for key2, value2 in sorted(value1.items()):
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1157 # calculate cummulative AF
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1158 used_tiers.append(value2)
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1159 if len(used_tiers) > 1:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1160 cum = safe_div(sum(used_tiers), cvrg)
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1161 cum_af.append(cum)
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1162 if sum(used_tiers) == 0: # skip mutations that are filtered by the VA in the first place
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1163 continue
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1164 lst.extend([sum(used_tiers), safe_div(sum(used_tiers), cvrg)])
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1165 if chimera_correction:
2
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1166 chimeras_all = chimera_dict[key1][0]
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1167 new_alt = sum(used_tiers) - chimeras_all
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1168 fraction_chimeras = safe_div(chimeras_all, float(sum(used_tiers)))
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1169 if fraction_chimeras is None:
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1170 fraction_chimeras = 0.
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1171 new_cvrg = cvrg * (1. - fraction_chimeras)
3
4fc62ab6e9e8 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 2
diff changeset
1172 lst.extend([chimeras_all, new_cvrg, safe_div(new_alt, new_cvrg)])
46
f733c425b804 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 45
diff changeset
1173 lst.extend([(cvrg - sum(used_tiers[-10:])), sum(used_tiers[0:7]), safe_div(sum(used_tiers[0:7]), (cvrg - sum(used_tiers[-10:])))])
2
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1174 if chimera_correction:
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1175 chimeras_all = chimera_dict[key1][1]
46
f733c425b804 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 45
diff changeset
1176 new_alt = sum(used_tiers[0:7]) - chimeras_all
f733c425b804 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 45
diff changeset
1177 fraction_chimeras = safe_div(chimeras_all, float(sum(used_tiers[0:7])))
2
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1178 if fraction_chimeras is None:
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1179 fraction_chimeras = 0.
46
f733c425b804 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 45
diff changeset
1180 new_cvrg = (cvrg - sum(used_tiers[-10:])) * (1. - fraction_chimeras)
3
4fc62ab6e9e8 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 2
diff changeset
1181 lst.extend([chimeras_all, new_cvrg, safe_div(new_alt, new_cvrg)])
2
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1182 lst.extend([alt_count, safe_div(alt_count, cvrg)])
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1183 lst.extend(used_tiers)
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1184 lst.extend(cum_af)
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1185 lst = tuple(lst)
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1186 ws2.write_row(row + 1, 0, lst)
41
db3ed9202516 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 40
diff changeset
1187 if chimera_correction:
db3ed9202516 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 40
diff changeset
1188 ws2.conditional_format('P{}:Q{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$P$1="tier 1.1"', 'format': format12, 'multi_range': 'P{}:Q{} P1:Q1'.format(row + 2, row + 2)})
46
f733c425b804 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 45
diff changeset
1189 ws2.conditional_format('R{}:V{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$R$1="tier 2.1"', 'format': format32, 'multi_range': 'R{}:V{} R1:V1'.format(row + 2, row + 2)})
f733c425b804 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 45
diff changeset
1190 ws2.conditional_format('W{}:AF{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$W$1="tier 3.1"', 'format': format22, 'multi_range': 'W{}:AF{} W1:AF1'.format(row + 2, row + 2)})
41
db3ed9202516 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 40
diff changeset
1191 else:
db3ed9202516 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 40
diff changeset
1192 ws2.conditional_format('J{}:K{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$J$1="tier 1.1"', 'format': format12, 'multi_range': 'J{}:K{} J1:K1'.format(row + 2, row + 2)})
46
f733c425b804 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 45
diff changeset
1193 ws2.conditional_format('L{}:P{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$L$1="tier 2.1"', 'format': format32, 'multi_range': 'L{}:P{} L1:P1'.format(row + 2, row + 2)})
47
edf8596463a8 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 46
diff changeset
1194 ws2.conditional_format('Q{}:Z{}'.format(row + 2, row + 2), {'type': 'formula', 'criteria': '=$Q$1="tier 3.1"', 'format': format22, 'multi_range': 'Q{}:Z{} Q1:Z1'.format(row + 2, row + 2)})
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1195 row += 1
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1196
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1197 # sheet 3
2
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
1198 sheet3 = [("tier 1.1", counter_tier11), ("tier 1.2", counter_tier12), ("tier 2.1", counter_tier21),
46
f733c425b804 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 45
diff changeset
1199 ("tier 2.2", counter_tier22), ("tier 2.3", counter_tier23), ("tier 2.4", counter_tier24), ("tier 2.5", counter_tier25),
f733c425b804 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 45
diff changeset
1200 ("tier 3.1", counter_tier31), ("tier 3.2", counter_tier32), ("tier 4", counter_tier4),
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1201 ("tier 5.1", counter_tier51), ("tier 5.2", counter_tier52),
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1202 ("tier 5.3", counter_tier53), ("tier 5.4", counter_tier54), ("tier 5.5", counter_tier55), ("tier 6", counter_tier6), ("tier 7", counter_tier7)]
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1203
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1204 header = ("tier", "count")
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1205 ws3.write_row(0, 0, header)
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1206
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1207 for i in range(len(sheet3)):
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1208 ws3.write_row(i + 1, 0, sheet3[i])
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1209 ws3.conditional_format('A{}:B{}'.format(i + 2, i + 2),
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1210 {'type': 'formula',
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1211 'criteria': '=OR($A${}="tier 1.1", $A${}="tier 1.2")'.format(i + 2, i + 2),
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1212 'format': format1})
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1213 ws3.conditional_format('A{}:B{}'.format(i + 2, i + 2),
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1214 {'type': 'formula',
46
f733c425b804 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 45
diff changeset
1215 'criteria': '=OR($A${}="tier 2.1", $A${}="tier 2.2", $A${}="tier 2.3", $A${}="tier 2.4", $A${}="tier 2.5")'.format(i + 2, i + 2, i + 2, i + 2, i + 2),
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1216 'format': format3})
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1217 ws3.conditional_format('A{}:B{}'.format(i + 2, i + 2),
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1218 {'type': 'formula',
30
e7da54e10e2d planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 29
diff changeset
1219 'criteria': '=$A${}>="3"'.format(i + 2),
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1220 'format': format2})
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1221
28
afda74e874ac planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 27
diff changeset
1222 description_tiers = [("Tier 1.1", "both ab and ba SSCS present (>75% of the sites with alternative base) and minimal FS>=3 for both SSCS in at least one mate"), ("", ""),
afda74e874ac planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 27
diff changeset
1223 ("Tier 1.2", "both ab and ba SSCS present (>75% of the sites with alt. base) and mate pair validation (min. FS=1) and minimal FS>=3 for at least one of the SSCS"),
afda74e874ac planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 27
diff changeset
1224 ("Tier 2.1", "both ab and ba SSCS present (>75% of the sites with alt. base) and minimal FS>=3 for at least one of the SSCS in at least one mate"),
afda74e874ac planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 27
diff changeset
1225 ("Tier 2.2", "both ab and ba SSCS present (>75% of the sites with alt. base) and mate pair validation (min. FS=1)"),
afda74e874ac planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 27
diff changeset
1226 ("Tier 2.3", "both ab and ba SSCS present (>75% of the sites with alt. base) and minimal FS=1 for both SSCS in one mate and minimal FS>=3 for at least one of the SSCS in the other mate"),
afda74e874ac planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 27
diff changeset
1227 ("Tier 2.4", "both ab and ba SSCS present (>75% of the sites with alt. base) and minimal FS=1 for both SSCS in at least one mate"),
56
371c09d4050b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 55
diff changeset
1228 ("Tier 2.5", "variants at the start or end of the read and recurring mutation on this position in tier 1.1-2.4"),
28
afda74e874ac planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 27
diff changeset
1229 ("Tier 3.1", "both ab and ba SSCS present (>50% of the sites with alt. base) and recurring mutation on this position"),
afda74e874ac planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 27
diff changeset
1230 ("Tier 3.2", "both ab and ba SSCS present (>50% of the sites with alt. base) and minimal FS>=1 for both SSCS in at least one mate"),
55
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
1231 ("Tier 4", "variants at the start or end of the reads"),
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1232 ("Tier 5.1", "variant is close to softclipping in both mates"),
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1233 ("Tier 5.2", "variant is close to softclipping in one of the mates"),
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1234 ("Tier 5.3", "variant is close to softclipping in one of the SSCS of both mates"),
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1235 ("Tier 5.4", "variant is close to softclipping in one mate (no information of second mate"),
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1236 ("Tier 5.5", "variant is close to softclipping in one of the SSCS (no information of the second mate"),
55
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
1237 ("Tier 6", "mates with contradictory information"),
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
1238 ("Tier 7", "remaining variants")]
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
1239 examples_tiers = [[("chr5-11068-C-G", "1.1", "AAAAAGATGCCGACTACCTT", "ab1.ba2", "254", "228", "287", "288", "289",
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1240 "3", "6", "3", "6", "0", "0", "3", "6", "0", "0", "1", "1", "0", "0", "0", "0", "0", "0",
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1241 "4081", "4098", "5", "10", "", ""),
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1242 ("", "", "AAAAAGATGCCGACTACCTT", "ab2.ba1", None, None, None, None,
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1243 "289", "0", "0", "0", "0", "0", "0", "0", "0", None, None, None, None,
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1244 "0", "0", "0", "0", "0", "0", "4081", "4098", "5", "10", "", "")],
55
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
1245 [("chr5-11068-C-G", "1.1", "AAAAATGCGTAGAAATATGC", "ab1.ba2", "254", "228", "287", "288", "289",
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1246 "33", "43", "33", "43", "0", "0", "33", "43", "0", "0", "1", "1", "0", "0", "0", "0", "0",
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1247 "0", "4081", "4098", "5", "10", "", ""),
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1248 ("", "", "AAAAATGCGTAGAAATATGC", "ab2.ba1", "268", "268", "270", "288", "289",
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1249 "11", "34", "10", "27", "0", "0", "10", "27", "0", "0", "1", "1", "0", "0", "1",
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1250 "7", "0", "0", "4081", "4098", "5", "10", "", "")],
55
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
1251 [("chr5-10776-G-T", "1.2", "CTATGACCCGTGAGCCCATG", "ab1.ba2", "132", "132", "287", "288", "290",
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1252 "4", "1", "4", "1", "0", "0", "4", "1", "0", "0", "1", "1", "0", "0", "0", "0",
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset