annotate read2mut.py @ 83:8cec772c0bf1 draft

planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
author mheinzl
date Fri, 05 Aug 2022 08:23:34 +0000
parents c2e8932b4d8d
children e46d5e377760
Ignore whitespace changes - Everywhere: Within whitespace: At end of lines:
rev   line source
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1 #!/usr/bin/env python
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
2
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
3 """read2mut.py
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
4
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
5 Author -- Gundula Povysil
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
6 Contact -- povysil@bioinf.jku.at
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
7
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
8 Looks for reads with mutation at known
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
9 positions and calculates frequencies and stats.
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
10
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
11 ======= ========== ================= ================================
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
12 Version Date Author Description
63
f0fc93b7945c planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 62
diff changeset
13 0.2.2 2019-10-27 Gundula Povysil -
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
14 ======= ========== ================= ================================
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
15
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
16
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
17 USAGE: python read2mut.py --mutFile DCS_Mutations.tabular --bamFile Interesting_Reads.trim.bam
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
18 --inputJson tag_count_dict.json --sscsJson SSCS_counts.json
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
19 --outputFile mutant_reads_summary_short_trim.xlsx --thresh 10 --phred 20 --trim 10 --chimera_correction
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
20
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
21 """
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
22
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
23 from __future__ import division
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
24
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
25 import argparse
55
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
26 import csv
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
27 import itertools
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
28 import json
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
29 import operator
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
30 import os
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
31 import re
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
32 import sys
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
33
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
34 import numpy as np
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
35 import pysam
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
36 import xlsxwriter
6
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
37 from cyvcf2 import VCF
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
38
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
39
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
40 def make_argparser():
6
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
41 parser = argparse.ArgumentParser(description='Takes a VCF file with mutations, a BAM file and JSON files as input and prints stats about variants to a user specified output file.')
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
42 parser.add_argument('--mutFile',
6
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
43 help='VCF file with DCS mutations.')
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
44 parser.add_argument('--bamFile',
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
45 help='BAM file with aligned raw reads of selected tags (FASTQ created by mut2read.py - trimming with Trimmomatic - alignment with bwa).')
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
46 parser.add_argument('--inputJson',
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
47 help='JSON file with data collected by mut2read.py.')
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
48 parser.add_argument('--sscsJson',
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
49 help='JSON file with SSCS counts collected by mut2sscs.py.')
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
50 parser.add_argument('--outputFile',
12
7a418148319d planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 11
diff changeset
51 help='Output xlsx file with summary of mutations.')
55
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
52 parser.add_argument('--outputFile_csv',
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
53 help='Output csv file with summary of mutations.')
12
7a418148319d planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 11
diff changeset
54 parser.add_argument('--outputFile2',
7a418148319d planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 11
diff changeset
55 help='Output xlsx file with allele frequencies of mutations.')
7a418148319d planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 11
diff changeset
56 parser.add_argument('--outputFile3',
7a418148319d planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 11
diff changeset
57 help='Output xlsx file with examples of the tier classification.')
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
58 parser.add_argument('--thresh', type=int, default=0,
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
59 help='Integer threshold for displaying mutations. Only mutations occuring less than thresh times are displayed. Default of 0 displays all.')
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
60 parser.add_argument('--phred', type=int, default=20,
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
61 help='Integer threshold for Phred score. Only reads higher than this threshold are considered. Default 20.')
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
62 parser.add_argument('--trim', type=int, default=10,
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
63 help='Integer threshold for assigning mutations at start and end of reads to lower tier. Default 10.')
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
64 parser.add_argument('--chimera_correction', action="store_true",
6
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
65 help='Count chimeric variants and correct the variant frequencies')
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
66 parser.add_argument('--softclipping_dist', type=int, default=15,
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
67 help='Count mutation as an artifact if mutation lies within this parameter away from the softclipping part of the read.')
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
68 parser.add_argument('--reads_threshold', type=float, default=1.0,
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
69 help='Float number which specifies the minimum percentage of softclipped reads in a family to be considered in the softclipping tiers. Default: 1.0, means all reads of a family have to be softclipped.')
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
70 return parser
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
71
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
72
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
73 def safe_div(x, y):
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
74 if y == 0:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
75 return None
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
76 return x / y
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
77
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
78
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
79 def read2mut(argv):
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
80 parser = make_argparser()
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
81 args = parser.parse_args(argv[1:])
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
82 file1 = args.mutFile
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
83 file2 = args.bamFile
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
84 json_file = args.inputJson
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
85 sscs_json = args.sscsJson
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
86 outfile = args.outputFile
12
7a418148319d planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 11
diff changeset
87 outfile2 = args.outputFile2
7a418148319d planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 11
diff changeset
88 outfile3 = args.outputFile3
55
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
89 outputFile_csv = args.outputFile_csv
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
90
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
91 thresh = args.thresh
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
92 phred_score = args.phred
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
93 trim = args.trim
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
94 chimera_correction = args.chimera_correction
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
95 thr = args.softclipping_dist
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
96 threshold_reads = args.reads_threshold
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
97
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
98 if os.path.isfile(file1) is False:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
99 sys.exit("Error: Could not find '{}'".format(file1))
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
100 if os.path.isfile(file2) is False:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
101 sys.exit("Error: Could not find '{}'".format(file2))
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
102 if os.path.isfile(json_file) is False:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
103 sys.exit("Error: Could not find '{}'".format(json_file))
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
104 if thresh < 0:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
105 sys.exit("Error: thresh is '{}', but only non-negative integers allowed".format(thresh))
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
106 if phred_score < 0:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
107 sys.exit("Error: phred is '{}', but only non-negative integers allowed".format(phred_score))
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
108 if trim < 0:
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
109 sys.exit("Error: trim is '{}', but only non-negative integers allowed".format(thresh))
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
110 if thr <= 0:
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
111 sys.exit("Error: trim is '{}', but only non-negative integers allowed".format(thr))
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
112
2
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
113 # load dicts
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
114 with open(json_file, "r") as f:
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
115 (tag_dict, cvrg_dict, tag_dict_ref) = json.load(f)
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
116
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
117 with open(sscs_json, "r") as f:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
118 (mut_pos_dict, ref_pos_dict) = json.load(f)
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
119
2
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
120 # read bam file
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
121 # pysam.index(file2)
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
122 bam = pysam.AlignmentFile(file2, "rb")
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
123
6
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
124 # create mut_dict
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
125 mut_dict = {}
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
126 mut_read_pos_dict = {}
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
127 mut_read_dict = {}
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
128 reads_dict = {}
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
129 mut_read_cigar_dict = {}
61
3722268ffac5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 60
diff changeset
130 real_start_end = {}
6
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
131 i = 0
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
132 mut_array = []
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
133
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
134 for count, variant in enumerate(VCF(file1)):
6
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
135 chrom = variant.CHROM
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
136 stop_pos = variant.start
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
137 ref = variant.REF
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
138 if len(variant.ALT) == 0:
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
139 continue
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
140 else:
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
141 alt = variant.ALT[0]
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
142
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
143 alt = alt.upper()
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
144 ref = ref.upper()
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
145 if "N" in alt: # skip indels with N in alt allele --> it is not an indel but just a mismatch at the position where the N is (checked this in IGV)
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
146 continue
7
ded0dc6a20d3 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 6
diff changeset
147
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
148 chrom_stop_pos = str(chrom) + "#" + str(stop_pos) + "#" + ref + "#" + alt
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
149 mut_array.append([chrom, stop_pos, ref, alt])
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
150 i += 1
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
151 mut_dict[chrom_stop_pos] = {}
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
152 mut_read_pos_dict[chrom_stop_pos] = {}
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
153 reads_dict[chrom_stop_pos] = {}
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
154 mut_read_cigar_dict[chrom_stop_pos] = {}
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
155 real_start_end[chrom_stop_pos] = {}
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
156 for pileupcolumn in bam.pileup(chrom, stop_pos - 1, stop_pos + 1, max_depth=1000000000):
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
157 if pileupcolumn.reference_pos == stop_pos:
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
158 count_alt = 0
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
159 count_ref = 0
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
160 count_indel = 0
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
161 count_n = 0
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
162 count_other = 0
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
163 count_lowq = 0
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
164 n = 0
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
165 for pileupread in pileupcolumn.pileups:
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
166 n += 1
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
167 if not pileupread.is_refskip:
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
168 if pileupread.is_del:
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
169 p = pileupread.query_position_or_next
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
170 e = p + len(alt) - 1
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
171 else:
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
172 p = pileupread.query_position
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
173 e = p + len(alt)
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
174 s = p
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
175 tag = pileupread.alignment.query_name
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
176 split_cigar = re.split('(\d+)', pileupread.alignment.cigarstring)
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
177
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
178 if len(ref) < len(alt):
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
179 if "I" in split_cigar:
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
180 all_insertions = [inser_i for inser_i, ins in enumerate(split_cigar) if ins == "I"]
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
181 for ai in all_insertions: # if multiple insertions in DCS
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
182 ins_index = [int(ci) for ci in split_cigar[:ai - 1] if ci.isdigit()]
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
183 ins_count = split_cigar[ai - 1] # nr of insertions should match with alt allele
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
184 if "I" in split_cigar and sum(ins_index) == p + 1 and int(ins_count) >= len(alt) - 1: # if pe read matches exatcly to insertion
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
185 nuc = pileupread.alignment.query_sequence[s:e]
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
186 phred = ord(pileupread.alignment.qual[s]) - 33
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
187 break
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
188 elif "I" in split_cigar and sum(ins_index) == p + 1 and int(ins_count) < len(alt) - 1: # if pe read has shorter insertion -- not alt
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
189 nuc = pileupread.alignment.query_sequence[s:s+int(ins_count)+1]
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
190 phred = ord(pileupread.alignment.qual[s]) - 33
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
191 break
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
192 else: # insertion in pe reads but not at the desired position
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
193 nuc = pileupread.alignment.query_sequence[s]
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
194 phred = ord(pileupread.alignment.qual[s]) - 33
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
195 elif "D" in split_cigar: # if deletion in pe read, don't count
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
196 all_deletions = [del_i for del_i, dele in enumerate(split_cigar) if dele == "D"]
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
197 for di, ai in enumerate(all_deletions): # if multiple insertions in DCS
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
198 if di > 0: # more than 1 deletion, don't count previous deletion to position
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
199 all_deletions_mod = split_cigar[:ai - 1]
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
200 prev_del_idx = [all_deletions_mod.index("D") - 1, all_deletions_mod.index("D")]
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
201 split_cigar_no_prev = [ad for i, ad in enumerate(all_deletions_mod) if i not in prev_del_idx]
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
202 del_index = [int(ci) for ci in split_cigar_no_prev[:ai - 1] if ci.isdigit()]
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
203 else: # first deletion in read, sum all previous (mis)matches and insertions to position
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
204 del_index = [int(ci) for ci in split_cigar[:ai - 1] if ci.isdigit()]
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
205 if "D" in split_cigar and sum(del_index) == p + 1: # if deletion at that position
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
206 nuc = "D"
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
207 phred = ord(pileupread.alignment.qual[s]) - 33
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
208 break
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
209 else:
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
210 nuc = pileupread.alignment.query_sequence[s]
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
211 phred = ord(pileupread.alignment.qual[s]) - 33
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
212 else: # insertion in pe reads but not at the desired position
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
213 nuc = pileupread.alignment.query_sequence[s]
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
214 phred = ord(pileupread.alignment.qual[s]) - 33
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
215
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
216 elif len(ref) > len(alt):
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
217 ref_positions = pileupread.alignment.get_reference_positions(full_length=True)[s:p + len(ref)]
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
218 if "D" in split_cigar:
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
219 all_deletions = [del_i for del_i, dele in enumerate(split_cigar) if dele == "D"]
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
220 for di, ai in enumerate(all_deletions): # if multiple insertions in DCS
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
221 if di > 0: # more than 1 deletion, don't count previous deletion to position
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
222 all_deletions_mod = split_cigar[:ai - 1]
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
223 prev_del_idx = [all_deletions_mod.index("D") - 1, all_deletions_mod.index("D")]
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
224 split_cigar_no_prev = [ad for i, ad in enumerate(all_deletions_mod) if i not in prev_del_idx]
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
225 del_index = [int(ci) for ci in split_cigar_no_prev[:ai - 1] if ci.isdigit()]
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
226 else: # first deletion in read, sum all previous (mis)matches and insertions to position
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
227 del_index = [int(ci) for ci in split_cigar[:ai - 1] if ci.isdigit()]
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
228 del_count = split_cigar[ai - 1] # deletion on that position but does not necesserily match in the length
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
229 if "D" in split_cigar and sum(del_index) == p + 1 and int(del_count) >= len(ref) - 1: # if pe read matches exatcly to deletion
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
230 nuc = pileupread.alignment.query_sequence[s:e]
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
231 phred = ord(pileupread.alignment.qual[s]) - 33
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
232 if nuc == "":
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
233 nuc = str(alt)
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
234 break
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
235 elif "D" in split_cigar and sum(del_index) == p + 1 and int(del_count) < len(ref) - 1: # if pe read has shorter deletion --> not alt
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
236 nuc = str(ref)[:int(del_count)+1]
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
237 phred = ord(pileupread.alignment.qual[s]) - 33
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
238 break
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
239 else: # deletion in pe reads but not at the desired position
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
240 nuc = pileupread.alignment.query_sequence[s:s + len(ref)]
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
241 phred = ord(pileupread.alignment.qual[s]) - 33
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
242 elif "I" in split_cigar: # if pe read has insertion --> not count
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
243 all_insertions = [inser_i for inser_i, ins in enumerate(split_cigar) if ins == "I"]
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
244 for ai in all_insertions: # if multiple insertions in DCS
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
245 ins_index = [int(ci) for ci in split_cigar[:ai - 1] if ci.isdigit()]
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
246 ins_count = split_cigar[ai - 1] # nr of insertions should match with alt allele
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
247 if "I" in split_cigar and sum(ins_index) == p + 1:
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
248 nuc = "I"
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
249 phred = ord(pileupread.alignment.qual[s]) - 33
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
250 break
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
251 else:
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
252 nuc = pileupread.alignment.query_sequence[s]
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
253 phred = ord(pileupread.alignment.qual[s]) - 33
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
254 elif len(ref_positions) < len(ref): # DCS has reference but the position is at the very end of the DCS and therefore not the full reference positions are there
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
255 nuc = pileupread.alignment.get_reference_sequence()[s:s + len(ref)]
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
256 phred = ord(pileupread.alignment.qual[s]) - 33
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
257 if nuc.upper() == ref[:len(nuc)]:
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
258 nuc = str(ref)
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
259 else: # deletion in pe reads but not at the desired position
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
260 nuc = pileupread.alignment.query_sequence[s:s + len(ref)]
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
261 phred = ord(pileupread.alignment.qual[s]) - 33
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
262 else: # SNV: query position is None if is_del or is_refskip is set.
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
263 nuc = pileupread.alignment.query_sequence[s]
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
264 phred = ord(pileupread.alignment.qual[s]) - 33
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
265
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
266 nuc = nuc.upper()
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
267
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
268 # if read is softclipped, store real position in reference
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
269 if "S" in pileupread.alignment.cigarstring:
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
270 # spftclipped at start
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
271 if re.search(r"^[0-9]+S", pileupread.alignment.cigarstring):
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
272 start = pileupread.alignment.reference_start - int(pileupread.alignment.cigarstring.split("S")[0])
61
3722268ffac5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 60
diff changeset
273 end = pileupread.alignment.reference_end
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
274 # softclipped at end
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
275 elif re.search(r"S$", pileupread.alignment.cigarstring):
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
276 end = pileupread.alignment.reference_end + int(re.split("[A-Z]", str(pileupread.alignment.cigarstring))[-2])
61
3722268ffac5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 60
diff changeset
277 start = pileupread.alignment.reference_start
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
278 else:
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
279 end = pileupread.alignment.reference_end
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
280 start = pileupread.alignment.reference_start
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
281 if phred < phred_score:
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
282 nuc = "lowQ"
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
283 if tag not in mut_dict[chrom_stop_pos]:
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
284 mut_dict[chrom_stop_pos][tag] = {}
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
285 if nuc in mut_dict[chrom_stop_pos][tag]:
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
286 mut_dict[chrom_stop_pos][tag][nuc] += 1
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
287 else:
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
288 mut_dict[chrom_stop_pos][tag][nuc] = 1
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
289 if tag not in mut_read_pos_dict[chrom_stop_pos]:
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
290 mut_read_pos_dict[chrom_stop_pos][tag] = [s + 1]
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
291 reads_dict[chrom_stop_pos][tag] = [len(pileupread.alignment.query_sequence)]
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
292 mut_read_cigar_dict[chrom_stop_pos][tag] = [pileupread.alignment.cigarstring]
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
293 real_start_end[chrom_stop_pos][tag] = [(start, end)]
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
294 else:
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
295 mut_read_pos_dict[chrom_stop_pos][tag].append(s + 1)
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
296 reads_dict[chrom_stop_pos][tag].append(len(pileupread.alignment.query_sequence))
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
297 mut_read_cigar_dict[chrom_stop_pos][tag].append(pileupread.alignment.cigarstring)
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
298 real_start_end[chrom_stop_pos][tag].append((start, end))
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
299 if nuc == alt:
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
300 count_alt += 1
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
301 if tag not in mut_read_dict:
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
302 mut_read_dict[tag] = {}
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
303 mut_read_dict[tag][chrom_stop_pos] = (alt, ref)
6
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
304 else:
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
305 mut_read_dict[tag][chrom_stop_pos] = (alt, ref)
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
306 elif nuc == ref:
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
307 count_ref += 1
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
308 elif nuc == "N":
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
309 count_n += 1
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
310 elif nuc == "lowQ":
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
311 count_lowq += 1
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
312 else:
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
313 count_other += 1
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
314 else:
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
315 count_indel += 1
79
d7aea14291e8 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 78
diff changeset
316 print("coverage at pos %s = %s, ref = %s, alt = %s, other bases = %s, N = %s, low quality = %s\n" %
d7aea14291e8 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 78
diff changeset
317 (pileupcolumn.pos, count_ref + count_alt, count_ref, count_alt, count_other, count_n, count_lowq))
6
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
318
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
319 mut_array = np.array(mut_array)
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
320 for read in bam.fetch(until_eof=True):
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
321 if read.is_unmapped:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
322 pure_tag = read.query_name[:-5]
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
323 nuc = "na"
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
324 if pure_tag in tag_dict.keys(): # stored all ref and alt reads --> get only alt reads
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
325 for key in tag_dict[pure_tag].keys():
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
326 if key not in mut_dict:
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
327 mut_dict[key] = {}
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
328 if read.query_name not in mut_dict[key]:
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
329 mut_dict[key][read.query_name] = {}
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
330 if nuc in mut_dict[key][read.query_name]:
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
331 mut_dict[key][read.query_name][nuc] += 1
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
332 else:
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
333 mut_dict[key][read.query_name][nuc] = 1
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
334 bam.close()
6
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
335 # create pure_tags_dict
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
336 pure_tags_dict = {}
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
337 pure_tags_dict_ref = {}
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
338 for key1, value1 in sorted(mut_dict.items()):
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
339 i = np.where(np.array(['#'.join(str(i) for i in z)
7
ded0dc6a20d3 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 6
diff changeset
340 for z in zip(mut_array[:, 0], mut_array[:, 1], mut_array[:, 2], mut_array[:, 3])]) == key1)[0][0]
6
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
341 ref = mut_array[i, 2]
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
342 alt = mut_array[i, 3]
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
343 pure_tags_dict[key1] = {}
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
344 pure_tags_dict_ref[key1] = {}
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
345 for key2, value2 in sorted(value1.items()):
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
346 for key3, value3 in value2.items():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
347 pure_tag = key2[:-5]
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
348 if key3 == alt:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
349 if pure_tag in pure_tags_dict[key1]:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
350 pure_tags_dict[key1][pure_tag] += 1
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
351 else:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
352 pure_tags_dict[key1][pure_tag] = 1
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
353
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
354 if key3 == ref:
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
355 if pure_tag in pure_tags_dict_ref[key1]:
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
356 pure_tags_dict_ref[key1][pure_tag] += 1
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
357 else:
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
358 pure_tags_dict_ref[key1][pure_tag] = 1
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
359
6
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
360 # create pure_tags_dict_short with thresh
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
361 if thresh > 0:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
362 pure_tags_dict_short = {}
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
363 for key, value in sorted(pure_tags_dict.items()):
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
364 if len(value) < thresh:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
365 pure_tags_dict_short[key] = value
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
366 else:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
367 pure_tags_dict_short = pure_tags_dict
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
368
76
56f271641828 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 75
diff changeset
369 csv_data = open(outputFile_csv, "w")
55
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
370 csv_writer = csv.writer(csv_data, delimiter=",")
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
371
6
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
372 # output summary with threshold
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
373 workbook = xlsxwriter.Workbook(outfile)
29
b14b69697cf6 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 28
diff changeset
374 workbook2 = xlsxwriter.Workbook(outfile2)
b14b69697cf6 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 28
diff changeset
375 workbook3 = xlsxwriter.Workbook(outfile3)
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
376 ws1 = workbook.add_worksheet("Results")
6
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
377 ws2 = workbook2.add_worksheet("Allele frequencies")
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
378 ws3 = workbook3.add_worksheet("Tiers")
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
379
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
380 format1 = workbook.add_format({'bg_color': '#BCF5A9'}) # green
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
381 format2 = workbook.add_format({'bg_color': '#FFC7CE'}) # red
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
382 format3 = workbook.add_format({'bg_color': '#FACC2E'}) # yellow
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
383
6
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
384 format12 = workbook2.add_format({'bg_color': '#BCF5A9'}) # green
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
385 format22 = workbook2.add_format({'bg_color': '#FFC7CE'}) # red
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
386 format32 = workbook2.add_format({'bg_color': '#FACC2E'}) # yellow
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
387
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
388 format13 = workbook3.add_format({'bg_color': '#BCF5A9'}) # green
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
389 format23 = workbook3.add_format({'bg_color': '#FFC7CE'}) # red
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
390 format33 = workbook3.add_format({'bg_color': '#FACC2E'}) # yellow
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
391
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
392 header_line = ('variant ID', 'tier', 'allele', 'tag', 'mate', 'read pos.ab', 'read pos.ba', 'read median length.ab',
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
393 'read median length.ba', 'DCS median length',
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
394 'FS.ab', 'FS.ba', 'FSqc.ab', 'FSqc.ba', 'ref.ab', 'ref.ba', 'alt.ab', 'alt.ba',
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
395 'rel. ref.ab', 'rel. ref.ba', 'rel. alt.ab', 'rel. alt.ba',
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
396 'na.ab', 'na.ba', 'lowq.ab', 'lowq.ba', 'trim.ab', 'trim.ba',
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
397 'SSCS alt.ab', 'SSCS alt.ba', 'SSCS ref.ab', 'SSCS ref.ba',
4
386438cd4c3b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 3
diff changeset
398 'in phase', 'chimeric tag')
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
399 ws1.write_row(0, 0, header_line)
55
8fbe6aba07e5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 54
diff changeset
400 csv_writer.writerow(header_line)
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
401
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
402 counter_tier11 = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
403 counter_tier12 = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
404 counter_tier21 = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
405 counter_tier22 = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
406 counter_tier23 = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
407 counter_tier24 = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
408 counter_tier31 = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
409 counter_tier32 = 0
46
f733c425b804 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 45
diff changeset
410 counter_tier25 = 0
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
411 counter_tier4 = 0
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
412 counter_tier51 = 0
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
413 counter_tier52 = 0
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
414 counter_tier53 = 0
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
415 counter_tier54 = 0
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
416 counter_tier55 = 0
28
afda74e874ac planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 27
diff changeset
417 counter_tier6 = 0
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
418 counter_tier7 = 0
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
419
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
420 row = 1
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
421 tier_dict = {}
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
422 tier_dict_ref = {}
2
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
423 chimera_dict = {}
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
424 for key1, value1 in sorted(mut_dict.items()):
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
425 counts_mut = 0
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
426 chimeric_tag_list = []
2
9d74f30275c6 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 0
diff changeset
427 chimeric_tag = {}
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
428 if (key1 in pure_tags_dict_short.keys()) or (key1 in pure_tags_dict_ref.keys()): # ref or alt
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
429
81
612c110305db planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 80
diff changeset
430 # if key1 not in np.array(['#'.join(str(i) for i in z)
612c110305db planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 80
diff changeset
431 # for z in zip(mut_array[:, 0], mut_array[:, 1], mut_array[:, 2], mut_array[:, 3])]):
612c110305db planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 80
diff changeset
432 # continue
79
d7aea14291e8 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 78
diff changeset
433
57
706bf8b59eae planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 56
diff changeset
434 change_tier_after_print = []
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
435 i = np.where(np.array(['#'.join(str(i) for i in z)
7
ded0dc6a20d3 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 6
diff changeset
436 for z in zip(mut_array[:, 0], mut_array[:, 1], mut_array[:, 2], mut_array[:, 3])]) == key1)[0][0]
6
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
437 ref = mut_array[i, 2]
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
438 alt = mut_array[i, 3]
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
439 dcs_median = cvrg_dict[key1][2]
77
1797e461d674 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 76
diff changeset
440 whole_array = list(pure_tags_dict_short[key1].keys())
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
441
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
442 tier_dict[key1] = {}
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
443 tier_dict_ref[key1] = {}
75
6ccff403db8a planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 70
diff changeset
444 values_tier_dict = [("tier 1.1", 0), ("tier 1.2", 0), ("tier 2.1", 0), ("tier 2.2", 0), ("tier 2.3", 0), ("tier 2.4", 0), ("tier 2.5", 0),
51
26e53b5b8bcb planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 50
diff changeset
445 ("tier 3.1", 0), ("tier 3.2", 0), ("tier 4", 0), ("tier 5.1", 0), ("tier 5.2", 0), ("tier 5.3", 0), ("tier 5.4", 0), ("tier 5.5", 0),
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
446 ("tier 6", 0), ("tier 7", 0)]
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
447 for k, v in values_tier_dict:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
448 tier_dict[key1][k] = v
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
449 tier_dict_ref[key1][k] = v
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
450
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
451 used_keys = []
79
d7aea14291e8 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 78
diff changeset
452 # used_keys_ref = []
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
453 if 'ab' in mut_pos_dict[key1].keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
454 sscs_mut_ab = mut_pos_dict[key1]['ab']
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
455 else:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
456 sscs_mut_ab = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
457 if 'ba' in mut_pos_dict[key1].keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
458 sscs_mut_ba = mut_pos_dict[key1]['ba']
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
459 else:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
460 sscs_mut_ba = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
461 if 'ab' in ref_pos_dict[key1].keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
462 sscs_ref_ab = ref_pos_dict[key1]['ab']
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
463 else:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
464 sscs_ref_ab = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
465 if 'ba' in ref_pos_dict[key1].keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
466 sscs_ref_ba = ref_pos_dict[key1]['ba']
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
467 else:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
468 sscs_ref_ba = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
469 for key2, value2 in sorted(value1.items()):
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
470 add_mut14 = ""
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
471 add_mut23 = ""
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
472 if key2[:-5] not in tag_dict.keys() and key2[:-5] not in tag_dict_ref.keys(): # skip reads that have not alt or ref
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
473 continue
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
474
79
d7aea14291e8 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 78
diff changeset
475 if (((key2[:-5] in tag_dict.keys()) and (key2[:-5] in pure_tags_dict_short[key1].keys()) and (key1 in tag_dict[key2[:-5]].keys()) and (key2[:-5] not in used_keys)) or ((key2[:-5] in tag_dict_ref.keys()) and (key2[:-5] in pure_tags_dict_ref[key1].keys()) and (key1 in tag_dict_ref[key2[:-5]].keys()) and (key2[:-5] not in used_keys))):
d7aea14291e8 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 78
diff changeset
476 if key2[:-5] in tag_dict.keys():
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
477 variant_type = "alt"
79
d7aea14291e8 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 78
diff changeset
478 elif key2[:-5] in tag_dict_ref.keys():
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
479 variant_type = "ref"
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
480
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
481 if key2[:-5] + '.ab.1' in mut_dict[key1].keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
482 total1 = sum(mut_dict[key1][key2[:-5] + '.ab.1'].values())
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
483 if 'na' in mut_dict[key1][key2[:-5] + '.ab.1'].keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
484 na1 = mut_dict[key1][key2[:-5] + '.ab.1']['na']
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
485 # na1f = na1/total1
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
486 else:
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
487 # na1 = na1f = 0
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
488 na1 = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
489 if 'lowQ' in mut_dict[key1][key2[:-5] + '.ab.1'].keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
490 lowq1 = mut_dict[key1][key2[:-5] + '.ab.1']['lowQ']
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
491 # lowq1f = lowq1 / total1
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
492 else:
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
493 # lowq1 = lowq1f = 0
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
494 lowq1 = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
495 if ref in mut_dict[key1][key2[:-5] + '.ab.1'].keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
496 ref1 = mut_dict[key1][key2[:-5] + '.ab.1'][ref]
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
497 ref1f = ref1 / (total1 - na1 - lowq1)
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
498 else:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
499 ref1 = ref1f = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
500 if alt in mut_dict[key1][key2[:-5] + '.ab.1'].keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
501 alt1 = mut_dict[key1][key2[:-5] + '.ab.1'][alt]
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
502 alt1f = alt1 / (total1 - na1 - lowq1)
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
503 else:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
504 alt1 = alt1f = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
505 total1new = total1 - na1 - lowq1
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
506 if (key2[:-5] + '.ab.1') in mut_read_dict.keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
507 k1 = mut_read_dict[(key2[:-5] + '.ab.1')].keys()
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
508 add_mut1 = len(k1)
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
509 if add_mut1 > 1:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
510 for k, v in mut_read_dict[(key2[:-5] + '.ab.1')].items():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
511 if k != key1:
4
386438cd4c3b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 3
diff changeset
512 new_mut = str(k).split("#")[0] + "-" + str(int(str(k).split("#")[1]) + 1) + "-" + v[1] + "-" + v[0]
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
513 if len(add_mut14) == 0:
4
386438cd4c3b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 3
diff changeset
514 add_mut14 = new_mut
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
515 else:
4
386438cd4c3b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 3
diff changeset
516 add_mut14 = add_mut14 + ", " + new_mut
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
517 else:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
518 k1 = []
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
519 else:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
520 total1 = total1new = na1 = lowq1 = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
521 ref1 = alt1 = ref1f = alt1f = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
522 k1 = []
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
523
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
524 if key2[:-5] + '.ab.2' in mut_dict[key1].keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
525 total2 = sum(mut_dict[key1][key2[:-5] + '.ab.2'].values())
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
526 if 'na' in mut_dict[key1][key2[:-5] + '.ab.2'].keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
527 na2 = mut_dict[key1][key2[:-5] + '.ab.2']['na']
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
528 # na2f = na2 / total2
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
529 else:
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
530 # na2 = na2f = 0
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
531 na2 = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
532 if 'lowQ' in mut_dict[key1][key2[:-5] + '.ab.2'].keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
533 lowq2 = mut_dict[key1][key2[:-5] + '.ab.2']['lowQ']
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
534 # lowq2f = lowq2 / total2
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
535 else:
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
536 # lowq2 = lowq2f = 0
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
537 lowq2 = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
538 if ref in mut_dict[key1][key2[:-5] + '.ab.2'].keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
539 ref2 = mut_dict[key1][key2[:-5] + '.ab.2'][ref]
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
540 ref2f = ref2 / (total2 - na2 - lowq2)
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
541 else:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
542 ref2 = ref2f = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
543 if alt in mut_dict[key1][key2[:-5] + '.ab.2'].keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
544 alt2 = mut_dict[key1][key2[:-5] + '.ab.2'][alt]
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
545 alt2f = alt2 / (total2 - na2 - lowq2)
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
546 else:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
547 alt2 = alt2f = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
548 total2new = total2 - na2 - lowq2
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
549 if (key2[:-5] + '.ab.2') in mut_read_dict.keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
550 k2 = mut_read_dict[(key2[:-5] + '.ab.2')].keys()
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
551 add_mut2 = len(k2)
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
552 if add_mut2 > 1:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
553 for k, v in mut_read_dict[(key2[:-5] + '.ab.2')].items():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
554 if k != key1:
4
386438cd4c3b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 3
diff changeset
555 new_mut = str(k).split("#")[0] + "-" + str(int(str(k).split("#")[1]) + 1) + "-" + v[1] + "-" + v[0]
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
556 if len(add_mut23) == 0:
4
386438cd4c3b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 3
diff changeset
557 add_mut23 = new_mut
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
558 else:
4
386438cd4c3b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 3
diff changeset
559 add_mut23 = add_mut23 + ", " + new_mut
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
560 else:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
561 k2 = []
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
562 else:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
563 total2 = total2new = na2 = lowq2 = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
564 ref2 = alt2 = ref2f = alt2f = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
565 k2 = []
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
566
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
567 if key2[:-5] + '.ba.1' in mut_dict[key1].keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
568 total3 = sum(mut_dict[key1][key2[:-5] + '.ba.1'].values())
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
569 if 'na' in mut_dict[key1][key2[:-5] + '.ba.1'].keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
570 na3 = mut_dict[key1][key2[:-5] + '.ba.1']['na']
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
571 # na3f = na3 / total3
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
572 else:
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
573 # na3 = na3f = 0
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
574 na3 = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
575 if 'lowQ' in mut_dict[key1][key2[:-5] + '.ba.1'].keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
576 lowq3 = mut_dict[key1][key2[:-5] + '.ba.1']['lowQ']
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
577 # lowq3f = lowq3 / total3
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
578 else:
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
579 # lowq3 = lowq3f = 0
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
580 lowq3 = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
581 if ref in mut_dict[key1][key2[:-5] + '.ba.1'].keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
582 ref3 = mut_dict[key1][key2[:-5] + '.ba.1'][ref]
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
583 ref3f = ref3 / (total3 - na3 - lowq3)
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
584 else:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
585 ref3 = ref3f = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
586 if alt in mut_dict[key1][key2[:-5] + '.ba.1'].keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
587 alt3 = mut_dict[key1][key2[:-5] + '.ba.1'][alt]
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
588 alt3f = alt3 / (total3 - na3 - lowq3)
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
589 else:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
590 alt3 = alt3f = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
591 total3new = total3 - na3 - lowq3
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
592 if (key2[:-5] + '.ba.1') in mut_read_dict.keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
593 add_mut3 = len(mut_read_dict[(key2[:-5] + '.ba.1')].keys())
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
594 if add_mut3 > 1:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
595 for k, v in mut_read_dict[(key2[:-5] + '.ba.1')].items():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
596 if k != key1 and k not in k2:
4
386438cd4c3b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 3
diff changeset
597 new_mut = str(k).split("#")[0] + "-" + str(int(str(k).split("#")[1]) + 1) + "-" + v[1] + "-" + v[0]
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
598 if len(add_mut23) == 0:
4
386438cd4c3b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 3
diff changeset
599 add_mut23 = new_mut
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
600 else:
4
386438cd4c3b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 3
diff changeset
601 add_mut23 = add_mut23 + ", " + new_mut
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
602 else:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
603 total3 = total3new = na3 = lowq3 = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
604 ref3 = alt3 = ref3f = alt3f = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
605
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
606 if key2[:-5] + '.ba.2' in mut_dict[key1].keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
607 total4 = sum(mut_dict[key1][key2[:-5] + '.ba.2'].values())
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
608 if 'na' in mut_dict[key1][key2[:-5] + '.ba.2'].keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
609 na4 = mut_dict[key1][key2[:-5] + '.ba.2']['na']
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
610 # na4f = na4 / total4
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
611 else:
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
612 # na4 = na4f = 0
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
613 na4 = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
614 if 'lowQ' in mut_dict[key1][key2[:-5] + '.ba.2'].keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
615 lowq4 = mut_dict[key1][key2[:-5] + '.ba.2']['lowQ']
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
616 # lowq4f = lowq4 / total4
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
617 else:
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
618 # lowq4 = lowq4f = 0
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
619 lowq4 = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
620 if ref in mut_dict[key1][key2[:-5] + '.ba.2'].keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
621 ref4 = mut_dict[key1][key2[:-5] + '.ba.2'][ref]
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
622 ref4f = ref4 / (total4 - na4 - lowq4)
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
623 else:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
624 ref4 = ref4f = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
625 if alt in mut_dict[key1][key2[:-5] + '.ba.2'].keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
626 alt4 = mut_dict[key1][key2[:-5] + '.ba.2'][alt]
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
627 alt4f = alt4 / (total4 - na4 - lowq4)
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
628 else:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
629 alt4 = alt4f = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
630 total4new = total4 - na4 - lowq4
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
631 if (key2[:-5] + '.ba.2') in mut_read_dict.keys():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
632 add_mut4 = len(mut_read_dict[(key2[:-5] + '.ba.2')].keys())
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
633 if add_mut4 > 1:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
634 for k, v in mut_read_dict[(key2[:-5] + '.ba.2')].items():
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
635 if k != key1 and k not in k1:
4
386438cd4c3b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 3
diff changeset
636 new_mut = str(k).split("#")[0] + "-" + str(int(str(k).split("#")[1]) + 1) + "-" + v[1] + "-" + v[0]
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
637 if len(add_mut14) == 0:
4
386438cd4c3b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 3
diff changeset
638 add_mut14 = new_mut
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
639 else:
4
386438cd4c3b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 3
diff changeset
640 add_mut14 = add_mut14 + ", " + new_mut
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
641 else:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
642 total4 = total4new = na4 = lowq4 = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
643 ref4 = alt4 = ref4f = alt4f = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
644
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
645 read_pos1 = read_pos2 = read_pos3 = read_pos4 = -1
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
646 read_len_median1 = read_len_median2 = read_len_median3 = read_len_median4 = 0
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
647 cigars_dcs1 = cigars_dcs2 = cigars_dcs3 = cigars_dcs4 = []
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
648 pos_read1 = pos_read2 = pos_read3 = pos_read4 = []
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
649 end_read1 = end_read2 = end_read3 = end_read4 = []
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
650 if key2[:-5] + '.ab.1' in mut_read_pos_dict[key1].keys():
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
651 read_pos1 = np.median(np.array(mut_read_pos_dict[key1][key2[:-5] + '.ab.1']))
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
652 read_len_median1 = np.median(np.array(reads_dict[key1][key2[:-5] + '.ab.1']))
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
653 cigars_dcs1 = mut_read_cigar_dict[key1][key2[:-5] + '.ab.1']
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
654 pos_read1 = mut_read_pos_dict[key1][key2[:-5] + '.ab.1']
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
655 end_read1 = reads_dict[key1][key2[:-5] + '.ab.1']
61
3722268ffac5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 60
diff changeset
656 ref_positions1 = real_start_end[key1][key2[:-5] + '.ab.1']
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
657 if key2[:-5] + '.ab.2' in mut_read_pos_dict[key1].keys():
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
658 read_pos2 = np.median(np.array(mut_read_pos_dict[key1][key2[:-5] + '.ab.2']))
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
659 read_len_median2 = np.median(np.array(reads_dict[key1][key2[:-5] + '.ab.2']))
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
660 cigars_dcs2 = mut_read_cigar_dict[key1][key2[:-5] + '.ab.2']
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
661 pos_read2 = mut_read_pos_dict[key1][key2[:-5] + '.ab.2']
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
662 end_read2 = reads_dict[key1][key2[:-5] + '.ab.2']
61
3722268ffac5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 60
diff changeset
663 ref_positions2 = real_start_end[key1][key2[:-5] + '.ab.2']
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
664 if key2[:-5] + '.ba.1' in mut_read_pos_dict[key1].keys():
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
665 read_pos3 = np.median(np.array(mut_read_pos_dict[key1][key2[:-5] + '.ba.1']))
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
666 read_len_median3 = np.median(np.array(reads_dict[key1][key2[:-5] + '.ba.1']))
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
667 cigars_dcs3 = mut_read_cigar_dict[key1][key2[:-5] + '.ba.1']
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
668 pos_read3 = mut_read_pos_dict[key1][key2[:-5] + '.ba.1']
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
669 end_read3 = reads_dict[key1][key2[:-5] + '.ba.1']
61
3722268ffac5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 60
diff changeset
670 ref_positions3 = real_start_end[key1][key2[:-5] + '.ba.1']
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
671 if key2[:-5] + '.ba.2' in mut_read_pos_dict[key1].keys():
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
672 read_pos4 = np.median(np.array(mut_read_pos_dict[key1][key2[:-5] + '.ba.2']))
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
673 read_len_median4 = np.median(np.array(reads_dict[key1][key2[:-5] + '.ba.2']))
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
674 cigars_dcs4 = mut_read_cigar_dict[key1][key2[:-5] + '.ba.2']
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
675 pos_read4 = mut_read_pos_dict[key1][key2[:-5] + '.ba.2']
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
676 end_read4 = reads_dict[key1][key2[:-5] + '.ba.2']
61
3722268ffac5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 60
diff changeset
677 ref_positions4 = real_start_end[key1][key2[:-5] + '.ba.2']
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
678
79
d7aea14291e8 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 78
diff changeset
679 # if variant_type == "alt":
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
680 used_keys.append(key2[:-5])
79
d7aea14291e8 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 78
diff changeset
681 # elif variant_type == "ref":
d7aea14291e8 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 78
diff changeset
682 # used_keys_ref.append(key2[:-5])
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
683 counts_mut += 1
82
c2e8932b4d8d planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 81
diff changeset
684
c2e8932b4d8d planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 81
diff changeset
685 if key2[:-5] == "CTTGAACACGTCAGCATGCATGGAGA":
c2e8932b4d8d planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 81
diff changeset
686 print(key1, variant_type, (alt1f + alt2f + alt3f + alt4f) > 0.5, (ref1f + ref2f + ref3f + ref4f) > 0.5)
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
687 if (variant_type == "alt" and ((alt1f + alt2f + alt3f + alt4f) > 0.5)) or (variant_type == "ref" and ((ref1f + ref2f + ref3f + ref4f) > 0.5)):
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
688 if variant_type == "alt":
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
689 tier1ff, tier2ff, tier3ff, tier4ff = alt1f, alt2f, alt3f, alt4f
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
690 tier1ff_trim, tier2ff_trim, tier3ff_trim, tier4ff_trim = alt1f, alt2f, alt3f, alt4f
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
691 elif variant_type == "ref":
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
692 tier1ff, tier2ff, tier3ff, tier4ff = ref1f, ref2f, ref3f, ref4f
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
693 tier1ff_trim, tier2ff_trim, tier3ff_trim, tier4ff_trim = ref1f, ref2f, ref3f, ref4f
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
694
76
56f271641828 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 75
diff changeset
695 total1new_trim, total2new_trim, total3new_trim, total4new_trim = total1new, total2new, total3new, total4new
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
696 if total1new == 0:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
697 ref1f = alt1f = None
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
698 alt1ff = -1
61
3722268ffac5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 60
diff changeset
699 alt1ff_trim = -1
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
700 tier1ff = -1
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
701 tier1ff_trim = -1
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
702 else:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
703 alt1ff = alt1f
61
3722268ffac5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 60
diff changeset
704 alt1ff_trim = alt1f
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
705 tier1ff = tier1ff
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
706 tier1ff_trim = tier1ff_trim
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
707 if total2new == 0:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
708 ref2f = alt2f = None
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
709 alt2ff = -1
61
3722268ffac5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 60
diff changeset
710 alt2ff_trim = -1
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
711 tier2ff = -1
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
712 tier2ff_trim = -1
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
713 else:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
714 alt2ff = alt2f
61
3722268ffac5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 60
diff changeset
715 alt2ff_trim = alt2f
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
716 tier2ff = tier2ff
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
717 tier2ff_trim = tier2ff_trim
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
718 if total3new == 0:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
719 ref3f = alt3f = None
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
720 alt3ff = -1
61
3722268ffac5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 60
diff changeset
721 alt3ff_trim = -1
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
722 tier3ff = -1
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
723 tier3ff_trim = -1
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
724 else:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
725 alt3ff = alt3f
61
3722268ffac5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 60
diff changeset
726 alt3ff_trim = alt3f
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
727 tier3ff = tier3ff
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
728 tier3ff_trim = tier3ff_trim
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
729 if total4new == 0:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
730 ref4f = alt4f = None
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
731 alt4ff = -1
69
c44475567466 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 68
diff changeset
732 alt4ff_trim = -1
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
733 tier4ff = -1
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
734 tier4ff_trim = -1
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
735 else:
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
736 alt4ff = alt4f
61
3722268ffac5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 60
diff changeset
737 alt4ff_trim = alt4f
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
738 tier4ff = tier4ff
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
739 tier4ff_trim = tier4ff_trim
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
740
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
741 beg1 = beg4 = beg2 = beg3 = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
742
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
743 details1 = (total1, total4, total1new, total4new, ref1, ref4, alt1, alt4, ref1f, ref4f, alt1f, alt4f, na1, na4, lowq1, lowq4, beg1, beg4)
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
744 details2 = (total2, total3, total2new, total3new, ref2, ref3, alt2, alt3, ref2f, ref3f, alt2f, alt3f, na2, na3, lowq2, lowq3, beg2, beg3)
6
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
745
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
746 trimmed = False
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
747 contradictory = False
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
748 softclipped_mutation_allMates = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
749 softclipped_mutation_oneOfTwoMates = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
750 softclipped_mutation_oneOfTwoSSCS = False
59
0b3df6ea1434 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 58
diff changeset
751 softclipped_mutation_oneOfTwoSSCS_diffMates = False
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
752 softclipped_mutation_oneMate = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
753 softclipped_mutation_oneMateOneSSCS = False
61
3722268ffac5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 60
diff changeset
754
3722268ffac5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 60
diff changeset
755 trimmed_actual_high_tier = False
3722268ffac5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 60
diff changeset
756
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
757 dist_start_read1 = dist_start_read2 = dist_start_read3 = dist_start_read4 = []
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
758 dist_end_read1 = dist_end_read2 = dist_end_read3 = dist_end_read4 = []
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
759 ratio_dist_start1 = ratio_dist_start2 = ratio_dist_start3 = ratio_dist_start4 = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
760 ratio_dist_end1 = ratio_dist_end2 = ratio_dist_end3 = ratio_dist_end4 = False
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
761
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
762 # mate 1 - SSCS ab
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
763 softclipped_idx1 = [True if re.search(r"^[0-9]+S", string) or re.search(r"S$", string) else False for string in cigars_dcs1]
77
1797e461d674 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 76
diff changeset
764 safe_div_result = safe_div(sum(softclipped_idx1), float(len(softclipped_idx1)))
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
765 if (safe_div_result is None):
77
1797e461d674 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 76
diff changeset
766 ratio1 = False
1797e461d674 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 76
diff changeset
767 else:
1797e461d674 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 76
diff changeset
768 ratio1 = safe_div_result >= threshold_reads
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
769 if any(ij is True for ij in softclipped_idx1):
75
6ccff403db8a planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 70
diff changeset
770 softclipped_both_ends_idx1 = [True if (re.search(r"^[0-9]+S", string) and re.search(r"S$", string)) else False for string in cigars_dcs1]
6ccff403db8a planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 70
diff changeset
771 softclipped_start1 = [int(string.split("S")[0]) if re.search(r"^[0-9]+S", string) else -1 for string in cigars_dcs1]
6ccff403db8a planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 70
diff changeset
772 softclipped_end1 = [int(re.split("[A-Z]", str(string))[-2]) if re.search(r"S$", string) else -1 for string in cigars_dcs1]
6ccff403db8a planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 70
diff changeset
773 dist_start_read1 = [(pos - soft) if soft != -1 else thr + 1000 for soft, pos in zip(softclipped_start1, pos_read1)]
6ccff403db8a planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 70
diff changeset
774 dist_end_read1 = [(length_read - pos - soft) if soft != -1 else thr + 1000 for soft, pos, length_read in zip(softclipped_end1, pos_read1, end_read1)]
6ccff403db8a planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 70
diff changeset
775 # if read at both ends softclipped --> select end with smallest distance between mut position and softclipping
6ccff403db8a planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 70
diff changeset
776 if any(ij is True for ij in softclipped_both_ends_idx1):
6ccff403db8a planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 70
diff changeset
777 for nr, indx in enumerate(softclipped_both_ends_idx1):
6ccff403db8a planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 70
diff changeset
778 if indx:
6ccff403db8a planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 70
diff changeset
779 if dist_start_read1[nr] <= dist_end_read1[nr]:
6ccff403db8a planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 70
diff changeset
780 dist_end_read1[nr] = thr + 1000 # use dist of start and set start to very large number
6ccff403db8a planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 70
diff changeset
781 else:
6ccff403db8a planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 70
diff changeset
782 dist_start_read1[nr] = thr + 1000 # use dist of end and set start to very large number
6ccff403db8a planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 70
diff changeset
783 ratio_dist_start1 = safe_div(sum([True if x <= thr else False for x in dist_start_read1]), float(sum(softclipped_idx1))) >= threshold_reads
6ccff403db8a planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 70
diff changeset
784 ratio_dist_end1 = safe_div(sum([True if x <= thr else False for x in dist_end_read1]), float(sum(softclipped_idx1))) >= threshold_reads
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
785
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
786 # mate 1 - SSCS ba
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
787 softclipped_idx4 = [True if re.search(r"^[0-9]+S", string) or re.search(r"S$", string) else False for string in cigars_dcs4]
77
1797e461d674 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 76
diff changeset
788 safe_div_result = safe_div(sum(softclipped_idx4), float(len(softclipped_idx4)))
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
789 if (safe_div_result is None):
77
1797e461d674 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 76
diff changeset
790 ratio4 = False
1797e461d674 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 76
diff changeset
791 else:
1797e461d674 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 76
diff changeset
792 ratio4 = safe_div_result >= threshold_reads
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
793 if any(ij is True for ij in softclipped_idx4):
75
6ccff403db8a planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 70
diff changeset
794 softclipped_both_ends_idx4 = [True if (re.search(r"^[0-9]+S", string) and re.search(r"S$", string)) else False for string in cigars_dcs4]
6ccff403db8a planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 70
diff changeset
795 softclipped_start4 = [int(string.split("S")[0]) if re.search(r"^[0-9]+S", string) else -1 for string in cigars_dcs4]
6ccff403db8a planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 70
diff changeset
796 softclipped_end4 = [int(re.split("[A-Z]", str(string))[-2]) if re.search(r"S$", string) else -1 for string in cigars_dcs4]
6ccff403db8a planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 70
diff changeset
797 dist_start_read4 = [(pos - soft) if soft != -1 else thr + 1000 for soft, pos in zip(softclipped_start4, pos_read4)]
6ccff403db8a planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 70
diff changeset
798 dist_end_read4 = [(length_read - pos - soft) if soft != -1 else thr + 1000 for soft, pos, length_read in zip(softclipped_end4, pos_read4, end_read4)]
6ccff403db8a planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 70
diff changeset
799 # if read at both ends softclipped --> select end with smallest distance between mut position and softclipping
6ccff403db8a planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 70
diff changeset
800 if any(ij is True for ij in softclipped_both_ends_idx4):
6ccff403db8a planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 70
diff changeset
801 for nr, indx in enumerate(softclipped_both_ends_idx4):
6ccff403db8a planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 70
diff changeset
802 if indx:
6ccff403db8a planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 70
diff changeset
803 if dist_start_read4[nr] <= dist_end_read4[nr]:
6ccff403db8a planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 70
diff changeset
804 dist_end_read4[nr] = thr + 1000 # use dist of start and set start to very large number
6ccff403db8a planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 70
diff changeset
805 else:
6ccff403db8a planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 70
diff changeset
806 dist_start_read4[nr] = thr + 1000 # use dist of end and set start to very large number
6ccff403db8a planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 70
diff changeset
807 ratio_dist_start4 = safe_div(sum([True if x <= thr else False for x in dist_start_read4]), float(sum(softclipped_idx4))) >= threshold_reads
6ccff403db8a planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 70
diff changeset
808 ratio_dist_end4 = safe_div(sum([True if x <= thr else False for x in dist_end_read4]), float(sum(softclipped_idx4))) >= threshold_reads
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
809
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
810 # mate 2 - SSCS ab
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
811 softclipped_idx2 = [True if re.search(r"^[0-9]+S", string) or re.search(r"S$", string) else False for string in cigars_dcs2]
77
1797e461d674 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 76
diff changeset
812 safe_div_result = safe_div(sum(softclipped_idx2), float(len(softclipped_idx2)))
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
813 if (safe_div_result is None):
77
1797e461d674 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 76
diff changeset
814 ratio2 = False
1797e461d674 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 76
diff changeset
815 else:
1797e461d674 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 76
diff changeset
816 ratio2 = safe_div_result >= threshold_reads
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
817 if any(ij is True for ij in softclipped_idx2):
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
818 softclipped_both_ends_idx2 = [True if (re.search(r"^[0-9]+S", string) and re.search(r"S$", string)) else False for string in cigars_dcs2]
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
819 softclipped_start2 = [int(string.split("S")[0]) if re.search(r"^[0-9]+S", string) else -1 for string in cigars_dcs2]
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
820 softclipped_end2 = [int(re.split("[A-Z]", str(string))[-2]) if re.search(r"S$", string) else -1 for string in cigars_dcs2]
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
821 dist_start_read2 = [(pos - soft) if soft != -1 else thr + 1000 for soft, pos in zip(softclipped_start2, pos_read2)]
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
822 dist_end_read2 = [(length_read - pos - soft) if soft != -1 else thr + 1000 for soft, pos, length_read in zip(softclipped_end2, pos_read2, end_read2)]
75
6ccff403db8a planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 70
diff changeset
823 # if read at both ends softclipped --> select end with smallest distance between mut position and softclipping
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
824 if any(ij is True for ij in softclipped_both_ends_idx2):
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
825 for nr, indx in enumerate(softclipped_both_ends_idx2):
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
826 if indx:
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
827 if dist_start_read2[nr] <= dist_end_read2[nr]:
75
6ccff403db8a planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 70
diff changeset
828 dist_end_read2[nr] = thr + 1000 # use dist of start and set start to very large number
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
829 else:
75
6ccff403db8a planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 70
diff changeset
830 dist_start_read2[nr] = thr + 1000 # use dist of end and set start to very large number
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
831 ratio_dist_start2 = safe_div(sum([True if x <= thr else False for x in dist_start_read2]), float(sum(softclipped_idx2))) >= threshold_reads
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
832 ratio_dist_end2 = safe_div(sum([True if x <= thr else False for x in dist_end_read2]), float(sum(softclipped_idx2))) >= threshold_reads
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
833
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
834 # mate 2 - SSCS ba
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
835 softclipped_idx3 = [True if re.search(r"^[0-9]+S", string) or re.search(r"S$", string) else False for string in cigars_dcs3]
77
1797e461d674 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 76
diff changeset
836 safe_div_result = safe_div(sum(softclipped_idx3), float(len(softclipped_idx3)))
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
837 if (safe_div_result is None):
77
1797e461d674 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 76
diff changeset
838 ratio3 = False
1797e461d674 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 76
diff changeset
839 else:
1797e461d674 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 76
diff changeset
840 ratio3 = safe_div_result >= threshold_reads
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
841 if any(ij is True for ij in softclipped_idx3):
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
842 softclipped_both_ends_idx3 = [True if (re.search(r"^[0-9]+S", string) and re.search(r"S$", string)) else False for string in cigars_dcs3]
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
843 softclipped_start3 = [int(string.split("S")[0]) if re.search(r"^[0-9]+S", string) else -1 for string in cigars_dcs3]
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
844 softclipped_end3 = [int(re.split("[A-Z]", str(string))[-2]) if re.search(r"S$", string) else -1 for string in cigars_dcs3]
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
845 dist_start_read3 = [(pos - soft) if soft != -1 else thr + 1000 for soft, pos in zip(softclipped_start3, pos_read3)]
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
846 dist_end_read3 = [(length_read - pos - soft) if soft != -1 else thr + 1000 for soft, pos, length_read in zip(softclipped_end3, pos_read3, end_read3)]
75
6ccff403db8a planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 70
diff changeset
847 # if read at both ends softclipped --> select end with smallest distance between mut position and softclipping
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
848 if any(ij is True for ij in softclipped_both_ends_idx3):
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
849 for nr, indx in enumerate(softclipped_both_ends_idx3):
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
850 if indx:
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
851 if dist_start_read3[nr] <= dist_end_read3[nr]:
75
6ccff403db8a planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 70
diff changeset
852 dist_end_read3[nr] = thr + 1000 # use dist of start and set start to a larger number than thresh
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
853 else:
75
6ccff403db8a planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 70
diff changeset
854 dist_start_read3[nr] = thr + 1000 # use dist of end and set start to very large number
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
855 ratio_dist_start3 = safe_div(sum([True if x <= thr else False for x in dist_start_read3]), float(sum(softclipped_idx3))) >= threshold_reads
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
856 ratio_dist_end3 = safe_div(sum([True if x <= thr else False for x in dist_end_read3]), float(sum(softclipped_idx3))) >= threshold_reads
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
857
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
858 if ((all(float(ij) >= 0.5 for ij in [tier1ff, tier4ff]) & # contradictory variant
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
859 all(float(ij) == 0. for ij in [tier2ff, tier3ff])) |
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
860 (all(float(ij) >= 0.5 for ij in [tier2ff, tier3ff]) &
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
861 all(float(ij) == 0. for ij in [tier1ff, tier4ff]))):
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
862 tier1ff = 0
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
863 tier4ff = 0
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
864 tier2ff = 0
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
865 tier3ff = 0
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
866 trimmed = False
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
867 contradictory = True
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
868 # softclipping tiers
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
869 # information of both mates available --> all reads for both mates and SSCS are softclipped
75
6ccff403db8a planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 70
diff changeset
870 elif (ratio1 & ratio4 & ratio2 & ratio3 &
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
871 (ratio_dist_start1 | ratio_dist_end1) & (ratio_dist_start4 | ratio_dist_end4) & (ratio_dist_start2 | ratio_dist_end2) & (ratio_dist_start3 | ratio_dist_end3) &
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
872 all(float(ij) > 0. for ij in [tier1ff, tier2ff, tier3ff, tier4ff])): # all mates available
75
6ccff403db8a planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 70
diff changeset
873 # if distance between softclipping and mutation is at start or end of the read smaller than threshold
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
874 softclipped_mutation_allMates = True
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
875 softclipped_mutation_oneOfTwoMates = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
876 softclipped_mutation_oneOfTwoSSCS = False
59
0b3df6ea1434 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 58
diff changeset
877 softclipped_mutation_oneOfTwoSSCS_diffMates = False
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
878 softclipped_mutation_oneMate = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
879 softclipped_mutation_oneMateOneSSCS = False
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
880 tier1ff = 0
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
881 tier4ff = 0
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
882 tier2ff = 0
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
883 tier3ff = 0
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
884 trimmed = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
885 contradictory = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
886 # information of both mates available --> only one mate softclipped
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
887 elif (((ratio1 & ratio4 & (ratio_dist_start1 | ratio_dist_end1) & (ratio_dist_start4 | ratio_dist_end4)) |
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
888 (ratio2 & ratio3 & (ratio_dist_start2 | ratio_dist_end2) & (ratio_dist_start3 | ratio_dist_end3))) &
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
889 all(float(ij) > 0. for ij in [tier1ff, tier2ff, tier3ff, tier4ff])): # all mates available
75
6ccff403db8a planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 70
diff changeset
890 # if distance between softclipping and mutation is at start or end of the read smaller than threshold
6ccff403db8a planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 70
diff changeset
891 min_start1 = min(min([ij[0] for ij in ref_positions1]), min([ij[0] for ij in ref_positions4])) # red
6ccff403db8a planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 70
diff changeset
892 min_start2 = min(min([ij[0] for ij in ref_positions2]), min([ij[0] for ij in ref_positions3])) # blue
6ccff403db8a planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 70
diff changeset
893 max_end1 = max(max([ij[1] for ij in ref_positions1]), max([ij[1] for ij in ref_positions4])) # red
6ccff403db8a planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 70
diff changeset
894 max_end2 = max(max([ij[1] for ij in ref_positions2]), max([ij[1] for ij in ref_positions3])) # blue
6ccff403db8a planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 70
diff changeset
895 if (min_start1 > min_start2) or (max_end1 > max_end2): # if mate1 is red and mate2 is blue
61
3722268ffac5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 60
diff changeset
896 softclipped_mutation_oneOfTwoMates = False
3722268ffac5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 60
diff changeset
897 # blue mate at beginning softclipped
3722268ffac5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 60
diff changeset
898 if min_start1 > min_start2:
3722268ffac5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 60
diff changeset
899 n_spacer_barcode = min_start1 - min_start2
3722268ffac5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 60
diff changeset
900 read_pos2 = read_pos2 - n_spacer_barcode
3722268ffac5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 60
diff changeset
901 read_pos3 = read_pos3 - n_spacer_barcode
3722268ffac5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 60
diff changeset
902 read_len_median2 = read_len_median2 - n_spacer_barcode
3722268ffac5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 60
diff changeset
903 read_len_median3 = read_len_median3 - n_spacer_barcode
3722268ffac5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 60
diff changeset
904 # red mate at end softclipped
75
6ccff403db8a planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 70
diff changeset
905 if max_end1 > max_end2:
61
3722268ffac5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 60
diff changeset
906 n_spacer_barcode = max_end1 - max_end2
3722268ffac5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 60
diff changeset
907 read_len_median1 = read_len_median1 - n_spacer_barcode
3722268ffac5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 60
diff changeset
908 read_len_median4 = read_len_median4 - n_spacer_barcode
75
6ccff403db8a planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 70
diff changeset
909 elif (min_start1 < min_start2) or (max_end1 < max_end2): # if mate1 is blue and mate2 is red
61
3722268ffac5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 60
diff changeset
910 softclipped_mutation_oneOfTwoMates = False
75
6ccff403db8a planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 70
diff changeset
911 if min_start1 < min_start2:
61
3722268ffac5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 60
diff changeset
912 n_spacer_barcode = min_start2 - min_start1
3722268ffac5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 60
diff changeset
913 read_pos1 = read_pos1 - n_spacer_barcode
3722268ffac5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 60
diff changeset
914 read_pos4 = read_pos4 - n_spacer_barcode
3722268ffac5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 60
diff changeset
915 read_len_median1 = read_len_median1 - n_spacer_barcode
3722268ffac5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 60
diff changeset
916 read_len_median4 = read_len_median4 - n_spacer_barcode
75
6ccff403db8a planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 70
diff changeset
917 if max_end1 < max_end2: # if mate1 ends after mate 2 starts
61
3722268ffac5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 60
diff changeset
918 n_spacer_barcode = max_end2 - max_end1
3722268ffac5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 60
diff changeset
919 read_len_median2 = read_len_median2 - n_spacer_barcode
3722268ffac5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 60
diff changeset
920 read_len_median3 = read_len_median3 - n_spacer_barcode
3722268ffac5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 60
diff changeset
921 else:
3722268ffac5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 60
diff changeset
922 softclipped_mutation_oneOfTwoMates = True
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
923 tier1ff = 0
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
924 tier4ff = 0
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
925 tier2ff = 0
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
926 tier3ff = 0
61
3722268ffac5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 60
diff changeset
927 trimmed = False
3722268ffac5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 60
diff changeset
928 contradictory = False
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
929 softclipped_mutation_allMates = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
930 softclipped_mutation_oneOfTwoSSCS = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
931 softclipped_mutation_oneMate = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
932 softclipped_mutation_oneMateOneSSCS = False
75
6ccff403db8a planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 70
diff changeset
933
6ccff403db8a planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 70
diff changeset
934 if softclipped_mutation_oneOfTwoMates is False: # check trimming tier
61
3722268ffac5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 60
diff changeset
935 if ((read_pos1 >= 0) and ((read_pos1 <= trim) | (abs(read_len_median1 - read_pos1) <= trim))):
3722268ffac5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 60
diff changeset
936 beg1 = total1new
3722268ffac5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 60
diff changeset
937 total1new = 0
3722268ffac5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 60
diff changeset
938 alt1ff = 0
3722268ffac5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 60
diff changeset
939 alt1f = 0
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
940 tier1ff = 0
61
3722268ffac5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 60
diff changeset
941 trimmed = True
3722268ffac5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 60
diff changeset
942
3722268ffac5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 60
diff changeset
943 if ((read_pos4 >= 0) and ((read_pos4 <= trim) | (abs(read_len_median4 - read_pos4) <= trim))):
3722268ffac5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 60
diff changeset
944 beg4 = total4new
3722268ffac5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 60
diff changeset
945 total4new = 0
3722268ffac5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 60
diff changeset
946 alt4ff = 0
3722268ffac5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 60
diff changeset
947 alt4f = 0
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
948 tier4ff = 0
61
3722268ffac5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 60
diff changeset
949 trimmed = True
3722268ffac5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 60
diff changeset
950
3722268ffac5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 60
diff changeset
951 if ((read_pos2 >= 0) and ((read_pos2 <= trim) | (abs(read_len_median2 - read_pos2) <= trim))):
3722268ffac5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 60
diff changeset
952 beg2 = total2new
3722268ffac5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 60
diff changeset
953 total2new = 0
3722268ffac5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 60
diff changeset
954 alt2ff = 0
3722268ffac5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 60
diff changeset
955 alt2f = 0
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
956 tier2ff = 0
61
3722268ffac5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 60
diff changeset
957 trimmed = True
3722268ffac5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 60
diff changeset
958
3722268ffac5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 60
diff changeset
959 if ((read_pos3 >= 0) and ((read_pos3 <= trim) | (abs(read_len_median3 - read_pos3) <= trim))):
3722268ffac5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 60
diff changeset
960 beg3 = total3new
3722268ffac5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 60
diff changeset
961 total3new = 0
3722268ffac5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 60
diff changeset
962 alt3ff = 0
3722268ffac5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 60
diff changeset
963 alt3f = 0
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
964 tier3ff = 0
61
3722268ffac5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 60
diff changeset
965 trimmed = True
3722268ffac5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 60
diff changeset
966 details1 = (total1, total4, total1new, total4new, ref1, ref4, alt1, alt4, ref1f, ref4f, alt1f, alt4f, na1, na4, lowq1, lowq4, beg1, beg4)
3722268ffac5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 60
diff changeset
967 details2 = (total2, total3, total2new, total3new, ref2, ref3, alt2, alt3, ref2f, ref3f, alt2f, alt3f, na2, na3, lowq2, lowq3, beg2, beg3)
3722268ffac5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 60
diff changeset
968
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
969 # information of both mates available --> only one mate softclipped
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
970 elif (((ratio1 & (ratio_dist_start1 | ratio_dist_end1)) | (ratio4 & (ratio_dist_start4 | ratio_dist_end4))) &
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
971 ((ratio2 & (ratio_dist_start2 | ratio_dist_end2)) | (ratio3 & (ratio_dist_start3 | ratio_dist_end3))) &
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
972 all(float(ij) > 0. for ij in [tier1ff, tier2ff, tier3ff, tier4ff])): # all mates available
75
6ccff403db8a planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 70
diff changeset
973 # if distance between softclipping and mutation is at start or end of the read smaller than threshold
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
974 softclipped_mutation_allMates = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
975 softclipped_mutation_oneOfTwoMates = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
976 softclipped_mutation_oneOfTwoSSCS = True
59
0b3df6ea1434 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 58
diff changeset
977 softclipped_mutation_oneOfTwoSSCS_diffMates = False
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
978 softclipped_mutation_oneMate = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
979 softclipped_mutation_oneMateOneSSCS = False
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
980 tier1ff = 0
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
981 tier4ff = 0
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
982 tier2ff = 0
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
983 tier3ff = 0
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
984 trimmed = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
985 contradictory = False
59
0b3df6ea1434 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 58
diff changeset
986
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
987 # information of one mate available --> all reads of one mate are softclipped
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
988 elif ((ratio1 & ratio4 & (ratio_dist_start1 | ratio_dist_end1) & (ratio_dist_start4 | ratio_dist_end4) &
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
989 all(float(ij) < 0. for ij in [tier2ff, tier3ff]) & all(float(ij) > 0. for ij in [tier1ff, tier4ff])) |
75
6ccff403db8a planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 70
diff changeset
990 (ratio2 & ratio3 & (ratio_dist_start2 | ratio_dist_end2) & (ratio_dist_start3 | ratio_dist_end3) &
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
991 all(float(ij) < 0. for ij in [tier1ff, tier4ff]) & all(float(ij) > 0. for ij in [tier2ff, tier3ff]))): # all mates available
75
6ccff403db8a planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 70
diff changeset
992 # if distance between softclipping and mutation is at start or end of the read smaller than threshold
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
993 softclipped_mutation_allMates = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
994 softclipped_mutation_oneOfTwoMates = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
995 softclipped_mutation_oneOfTwoSSCS = False
59
0b3df6ea1434 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 58
diff changeset
996 softclipped_mutation_oneOfTwoSSCS_diffMates = False
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
997 softclipped_mutation_oneMate = True
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
998 softclipped_mutation_oneMateOneSSCS = False
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
999 tier1ff = 0
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1000 tier4ff = 0
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1001 tier2ff = 0
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1002 tier3ff = 0
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1003 trimmed = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1004 contradictory = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1005 # information of one mate available --> only one SSCS is softclipped
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1006 elif ((((ratio1 & (ratio_dist_start1 | ratio_dist_end1)) | (ratio4 & (ratio_dist_start4 | ratio_dist_end4))) &
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1007 (all(float(ij) < 0. for ij in [tier2ff, tier3ff]) & all(float(ij) > 0. for ij in [tier1ff, tier4ff]))) |
75
6ccff403db8a planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 70
diff changeset
1008 (((ratio2 & (ratio_dist_start2 | ratio_dist_end2)) | (ratio3 & (ratio_dist_start3 | ratio_dist_end3))) &
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1009 (all(float(ij) < 0. for ij in [tier1ff, tier4ff]) & all(float(ij) < 0. for ij in [tier2ff, tier3ff])))): # all mates available
75
6ccff403db8a planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 70
diff changeset
1010 # if distance between softclipping and mutation is at start or end of the read smaller than threshold
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1011 softclipped_mutation_allMates = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1012 softclipped_mutation_oneOfTwoMates = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1013 softclipped_mutation_oneOfTwoSSCS = False
59
0b3df6ea1434 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 58
diff changeset
1014 softclipped_mutation_oneOfTwoSSCS_diffMates = False
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1015 softclipped_mutation_oneMate = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1016 softclipped_mutation_oneMateOneSSCS = True
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1017 tier1ff = 0
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1018 tier4ff = 0
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1019 tier2ff = 0
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1020 tier3ff = 0
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1021 trimmed = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1022 contradictory = False
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1023
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1024 else:
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1025 if ((read_pos1 >= 0) and ((read_pos1 <= trim) | (abs(read_len_median1 - read_pos1) <= trim))):
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1026 beg1 = total1new
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1027 total1new = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1028 alt1ff = 0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1029 alt1f = 0
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1030 tier1ff = 0
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1031 trimmed = True
28
afda74e874ac planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 27
diff changeset
1032
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1033 if ((read_pos4 >= 0) and ((read_pos4 <= trim) | (abs(read_len_median4 - read_pos4) <= trim))):
28
afda74e874ac planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 27
diff changeset
1034 beg4 = total4new
afda74e874ac planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 27
diff changeset
1035 total4new = 0
afda74e874ac planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 27
diff changeset
1036 alt4ff = 0
afda74e874ac planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 27
diff changeset
1037 alt4f = 0
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1038 tier4ff = 0
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1039 trimmed = True
28
afda74e874ac planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 27
diff changeset
1040
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1041 if ((read_pos2 >= 0) and ((read_pos2 <= trim) | (abs(read_len_median2 - read_pos2) <= trim))):
28
afda74e874ac planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 27
diff changeset
1042 beg2 = total2new
afda74e874ac planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 27
diff changeset
1043 total2new = 0
afda74e874ac planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 27
diff changeset
1044 alt2ff = 0
afda74e874ac planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 27
diff changeset
1045 alt2f = 0
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1046 tier2ff = 0
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1047 trimmed = True
6
11a2a34f8a2b planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 5
diff changeset
1048
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1049 if ((read_pos3 >= 0) and ((read_pos3 <= trim) | (abs(read_len_median3 - read_pos3) <= trim))):
28
afda74e874ac planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 27
diff changeset
1050 beg3 = total3new
afda74e874ac planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 27
diff changeset
1051 total3new = 0
afda74e874ac planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 27
diff changeset
1052 alt3ff = 0
afda74e874ac planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 27
diff changeset
1053 alt3f = 0
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1054 tier3ff = 0
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1055 trimmed = True
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1056 details1 = (total1, total4, total1new, total4new, ref1, ref4, alt1, alt4, ref1f, ref4f, alt1f, alt4f, na1, na4, lowq1, lowq4, beg1, beg4)
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1057 details2 = (total2, total3, total2new, total3new, ref2, ref3, alt2, alt3, ref2f, ref3f, alt2f, alt3f, na2, na3, lowq2, lowq3, beg2, beg3)
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1058
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1059 # assign tiers
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1060 if ((all(int(ij) >= 3 for ij in [total1new, total4new]) &
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1061 all(float(ij) >= 0.75 for ij in [tier1ff, tier4ff])) |
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1062 (all(int(ij) >= 3 for ij in [total2new, total3new]) &
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1063 all(float(ij) >= 0.75 for ij in [tier2ff, tier3ff]))):
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1064 tier = "1.1"
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1065 counter_tier11 += 1
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1066 if variant_type == "alt":
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1067 tier_dict[key1]["tier 1.1"] += 1
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1068 elif variant_type == "ref":
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1069 tier_dict_ref[key1]["tier 1.1"] += 1
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1070
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1071 elif (all(int(ij) >= 1 for ij in [total1new, total2new, total3new, total4new]) &
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1072 any(int(ij) >= 3 for ij in [total1new, total4new]) &
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1073 any(int(ij) >= 3 for ij in [total2new, total3new]) &
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1074 all(float(ij) >= 0.75 for ij in [tier1ff, tier2ff, tier3ff, tier4ff])):
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1075 tier = "1.2"
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1076 counter_tier12 += 1
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1077 if variant_type == "alt":
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1078 tier_dict[key1]["tier 1.2"] += 1
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1079 elif variant_type == "ref":
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1080 tier_dict_ref[key1]["tier 1.2"] += 1
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1081
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1082 elif ((all(int(ij) >= 1 for ij in [total1new, total4new]) &
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1083 any(int(ij) >= 3 for ij in [total1new, total4new]) &
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1084 all(float(ij) >= 0.75 for ij in [tier1ff, tier4ff])) |
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1085 (all(int(ij) >= 1 for ij in [total2new, total3new]) &
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1086 any(int(ij) >= 3 for ij in [total2new, total3new]) &
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1087 all(float(ij) >= 0.75 for ij in [tier2ff, tier3ff]))):
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1088 tier = "2.1"
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1089 counter_tier21 += 1
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1090 if variant_type == "alt":
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1091 tier_dict[key1]["tier 2.1"] += 1
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1092 elif variant_type == "ref":
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1093 tier_dict_ref[key1]["tier 2.1"] += 1
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1094
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1095 elif (all(int(ij) >= 1 for ij in [total1new, total2new, total3new, total4new]) &
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1096 all(float(ij) >= 0.75 for ij in [tier1ff, tier2ff, tier3ff, tier4ff])):
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1097 tier = "2.2"
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1098 counter_tier22 += 1
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1099 if variant_type == "alt":
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1100 tier_dict[key1]["tier 2.2"] += 1
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1101 elif variant_type == "ref":
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1102 tier_dict_ref[key1]["tier 2.2"] += 1
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1103
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1104 elif ((all(int(ij) >= 1 for ij in [total1new, total4new]) &
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1105 any(int(ij) >= 3 for ij in [total2new, total3new]) &
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1106 all(float(ij) >= 0.75 for ij in [tier1ff, tier4ff]) &
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1107 any(float(ij) >= 0.75 for ij in [tier2ff, tier3ff])) |
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1108 (all(int(ij) >= 1 for ij in [total2new, total3new]) &
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1109 any(int(ij) >= 3 for ij in [total1new, total4new]) &
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1110 all(float(ij) >= 0.75 for ij in [tier2ff, tier3ff]) &
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1111 any(float(ij) >= 0.75 for ij in [tier1ff, tier4ff]))):
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1112 tier = "2.3"
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1113 counter_tier23 += 1
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1114 if variant_type == "alt":
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1115 tier_dict[key1]["tier 2.3"] += 1
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1116 elif variant_type == "ref":
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1117 tier_dict_ref[key1]["tier 2.3"] += 1
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1118
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1119 elif ((all(int(ij) >= 1 for ij in [total1new, total4new]) &
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1120 all(float(ij) >= 0.75 for ij in [tier1ff, tier4ff])) |
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1121 (all(int(ij) >= 1 for ij in [total2new, total3new]) &
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1122 all(float(ij) >= 0.75 for ij in [tier2ff, tier3ff]))):
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1123 tier = "2.4"
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1124 counter_tier24 += 1
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1125 if variant_type == "alt":
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1126 tier_dict[key1]["tier 2.4"] += 1
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1127 elif variant_type == "ref":
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1128 tier_dict_ref[key1]["tier 2.4"] += 1
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1129
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1130 elif ((len(pure_tags_dict_short[key1]) > 1) &
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1131 (all(float(ij) >= 0.5 for ij in [tier1ff, tier4ff]) |
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1132 all(float(ij) >= 0.5 for ij in [tier2ff, tier3ff]))):
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1133 tier = "3.1"
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1134 counter_tier31 += 1
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1135 if variant_type == "alt":
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1136 tier_dict[key1]["tier 3.1"] += 1
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1137 elif variant_type == "ref":
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1138 tier_dict_ref[key1]["tier 3.1"] += 1
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1139
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1140 elif ((all(int(ij) >= 1 for ij in [total1new, total4new]) &
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1141 all(float(ij) >= 0.5 for ij in [tier1ff, tier4ff])) |
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1142 (all(int(ij) >= 1 for ij in [total2new, total3new]) &
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1143 all(float(ij) >= 0.5 for ij in [tier2ff, tier3ff]))):
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1144 tier = "3.2"
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1145 counter_tier32 += 1
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1146 if variant_type == "alt":
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1147 tier_dict[key1]["tier 3.2"] += 1
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1148 elif variant_type == "ref":
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1149 tier_dict_ref[key1]["tier 3.2"] += 1
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1150
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1151 elif (trimmed):
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1152 tier = "4"
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1153 counter_tier4 += 1
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1154 if variant_type == "alt":
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1155 tier_dict[key1]["tier 4"] += 1
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1156 elif variant_type == "ref":
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1157 tier_dict_ref[key1]["tier 4"] += 1
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1158
75
6ccff403db8a planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 70
diff changeset
1159 # assign tiers
64
fd342f5a97d9 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 63
diff changeset
1160 if ((all(int(ij) >= 3 for ij in [total1new_trim, total4new_trim]) &
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1161 all(float(ij) >= 0.75 for ij in [tier1ff_trim, tier4ff_trim])) |
64
fd342f5a97d9 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 63
diff changeset
1162 (all(int(ij) >= 3 for ij in [total2new_trim, total3new_trim]) &
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1163 all(float(ij) >= 0.75 for ij in [tier2ff_trim, tier3ff_trim]))):
64
fd342f5a97d9 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 63
diff changeset
1164 trimmed_actual_high_tier = True
fd342f5a97d9 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 63
diff changeset
1165 elif (all(int(ij) >= 1 for ij in [total1new_trim, total2new_trim, total3new_trim, total4new_trim]) &
fd342f5a97d9 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 63
diff changeset
1166 any(int(ij) >= 3 for ij in [total1new_trim, total4new_trim]) &
fd342f5a97d9 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 63
diff changeset
1167 any(int(ij) >= 3 for ij in [total2new_trim, total3new_trim]) &
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1168 all(float(ij) >= 0.75 for ij in [tier1ff_trim, tier2ff_trim, tier3ff_trim, tier4ff_trim])):
65
712a37137b1f planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 64
diff changeset
1169 trimmed_actual_high_tier = True
712a37137b1f planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 64
diff changeset
1170 elif ((all(int(ij) >= 1 for ij in [total1new_trim, total4new_trim]) &
712a37137b1f planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 64
diff changeset
1171 any(int(ij) >= 3 for ij in [total1new_trim, total4new_trim]) &
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1172 all(float(ij) >= 0.75 for ij in [tier1ff_trim, tier4ff_trim])) |
64
fd342f5a97d9 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 63
diff changeset
1173 (all(int(ij) >= 1 for ij in [total2new_trim, total3new_trim]) &
fd342f5a97d9 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 63
diff changeset
1174 any(int(ij) >= 3 for ij in [total2new_trim, total3new_trim]) &
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1175 all(float(ij) >= 0.75 for ij in [tier2ff_trim, tier3ff_trim]))):
64
fd342f5a97d9 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 63
diff changeset
1176 trimmed_actual_high_tier = True
fd342f5a97d9 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 63
diff changeset
1177 elif (all(int(ij) >= 1 for ij in [total1new_trim, total2new_trim, total3new_trim, total4new_trim]) &
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1178 all(float(ij) >= 0.75 for ij in [tier1ff_trim, tier2ff_trim, tier3ff_trim, tier4ff_trim])):
64
fd342f5a97d9 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 63
diff changeset
1179 trimmed_actual_high_tier = True
fd342f5a97d9 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 63
diff changeset
1180 elif ((all(int(ij) >= 1 for ij in [total1new_trim, total4new_trim]) &
fd342f5a97d9 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 63
diff changeset
1181 any(int(ij) >= 3 for ij in [total2new_trim, total3new_trim]) &
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1182 all(float(ij) >= 0.75 for ij in [tier1ff_trim, tier4ff_trim]) &
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1183 any(float(ij) >= 0.75 for ij in [tier2ff_trim, tier3ff_trim])) |
64
fd342f5a97d9 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 63
diff changeset
1184 (all(int(ij) >= 1 for ij in [total2new_trim, total3new_trim]) &
fd342f5a97d9 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 63
diff changeset
1185 any(int(ij) >= 3 for ij in [total1new_trim, total4new_trim]) &
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1186 all(float(ij) >= 0.75 for ij in [tier2ff_trim, tier3ff_trim]) &
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1187 any(float(ij) >= 0.75 for ij in [tier1ff_trim, tier4ff_trim]))):
64
fd342f5a97d9 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 63
diff changeset
1188 trimmed_actual_high_tier = True
fd342f5a97d9 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 63
diff changeset
1189 elif ((all(int(ij) >= 1 for ij in [total1new_trim, total4new_trim]) &
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1190 all(float(ij) >= 0.75 for ij in [tier1ff_trim, tier4ff_trim])) |
64
fd342f5a97d9 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 63
diff changeset
1191 (all(int(ij) >= 1 for ij in [total2new_trim, total3new_trim]) &
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1192 all(float(ij) >= 0.75 for ij in [tier2ff_trim, tier3ff_trim]))):
64
fd342f5a97d9 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 63
diff changeset
1193 trimmed_actual_high_tier = True
fd342f5a97d9 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 63
diff changeset
1194 else:
fd342f5a97d9 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 63
diff changeset
1195 trimmed_actual_high_tier = False
61
3722268ffac5 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 60
diff changeset
1196
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1197 elif softclipped_mutation_allMates:
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1198 tier = "5.1"
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1199 counter_tier51 += 1
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1200 if variant_type == "alt":
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1201 tier_dict[key1]["tier 5.1"] += 1
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1202 elif variant_type == "ref":
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1203 tier_dict_ref[key1]["tier 5.1"] += 1
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1204
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1205 elif softclipped_mutation_oneOfTwoMates:
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1206 tier = "5.2"
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1207 counter_tier52 += 1
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1208 if variant_type == "alt":
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1209 tier_dict[key1]["tier 5.2"] += 1
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1210 elif variant_type == "ref":
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1211 tier_dict_ref[key1]["tier 5.2"] += 1
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1212
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1213 elif softclipped_mutation_oneOfTwoSSCS:
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1214 tier = "5.3"
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1215 counter_tier53 += 1
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1216 if variant_type == "alt":
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1217 tier_dict[key1]["tier 5.3"] += 1
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1218 elif variant_type == "ref":
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1219 tier_dict_ref[key1]["tier 5.3"] += 1
0
e5953c54cfb5 planemo upload for repository https://github.com/gpovysil/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents:
diff changeset
1220
43
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1221 elif softclipped_mutation_oneMate:
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1222 tier = "5.4"
d21960b45a6b planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8
mheinzl
parents: 42
diff changeset
1223 counter_tier54 += 1
78
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77
diff changeset
1224 if variant_type == "alt":
fdfe9a919ff7 planemo upload for repository https://github.com/Single-Molecule-Genetics/VariantAnalyzerGalaxy/tree/master/tools/variant_analyzer commit ee4a8e6cf290e6c8a4d55f9cd2839d60ab3b11c8-dirty
mheinzl
parents: 77